Grass and
Forage Science The Journal of the British Grassland Society The Official Journal of the European Grassland Federation
In vitro direct plant regeneration and Agrobacterium-
mediated transformation of lucerne (Medicago sativa L.)
S. Kumar*, R. Tiwari*, A. Chandra*1, A. Sharma and R. K. Bhatnagar
*Division of Crop Improvement, Indian Grassland and Fodder Research Institute, Jhansi, India, Insect
Resistance Group, International Centre for Genetic Engineering and Biotechnology, New Delhi, India
Abstract
In vitro direct plant regeneration of lucerne was
achieved by simultaneous application of thidiazuron
(TDZ) and 6-benzyladenine (BA) in Murashige and
Skoog (MS) medium. Seedlings were germinated and
grown for 6 d on growth regulatorcontaining MS
medium. The shoot tip, consisting of the apical meri-
stem along with parts of the cotyledonary leaves and
hypocotyl, was then cultured on a medium containing
the growth regulator(s). Adventitious budding of the
shoot tip was promoted synergistically by treatment
with TDZ and BA, and a maximum of thirty-five
shoots per explant was obtained on a medium supple-
mented with 2 mg L 1 TDZ and 1 mg L 1 BA. Plant
regeneration frequency varied from 67 to 93%, and
five Indian lucerne cultivars responded well to the
regeneration protocol. The Agrobacterium-mediated
transformation frequency from co-cultivated explants
was 13% following multiple shoot induction. South-
ern analysis of the T0 plants and T1 progenies
confirmed stable inheritance of the hpt marker gene.
Agrobacterium infection of the explant caused a signifi-
cant reduction in the plant regeneration frequency
(23%) and the number of shoots induced (11) when
compared with uninfected explants. A single shoot tip
provided sufficient material to regenerate and establish
twenty-seven lucerne plants, whereas only nine plants
could be regenerated from an Agrobacterium co-culti-
vated explant. This transformation protocol could rep-
resent a valuable improvement over existing ones for
lucerne.
Correspondence to: S. Kumar, Division of Crop Improve-
ment, Indian Grassland and Fodder Research Institute,
Gwalior Road, Jhansi 284 003, India.
E-mail: sureshkumar3_in@yahoo.co.uk
1
Present address:Indian Institute of Sugarcane Research,
Lucknow, 226002, India
Received 18 December 2011; Revised 11 August 2012
doi: 10.1111/gfs.12009
Keywords: Agrobacterium, direct regeneration, genetic
transformation, lucerne, multiple shoot induction,
thidiazuron
Introduction
Lucerne or alfalfa (Medicago sativa L.) is an important
source of food, feed and other compounds for indus-
trial and commercial uses (Somers et al., 2003). It is a
perennial crop that is widely cultivated throughout
the world in diverse environmental conditions. In
India, lucerne is the third most important forage crop,
after sorghum and berseem (Trifolium alexandrinum). It
contains protein (1522%) and a well-balanced amino
acid profile, vitamins and minerals, as well as trace
elements (see Heuze et al., 2012). Whether used for
hay or silage making, grazing or green chop, it pro-
duces exceptionally good-quality forage. In addition to
these traditional uses, lucerne is currently a candidate
for biofuel production, bioremediation of soils and is
used as a biological factory for the production of
industrial enzymes such as lignin peroxidase, a-amy-
lase, cellulase and phytase (Samac and Temple, 2004;
Kolliker et al., 2010). A review on lucerne transforma-
tion has been presented elsewhere (Kumar, 2011).
Lucerne has long been considered recalcitrant to
tissue culture endeavours (Somers et al., 2003). Plant
regeneration via a callus phase (Tabe et al., 1995;
Moursy et al., 1999; Deavours and Dixon, 2005) and
somatic embryogenesis (Iantcheva et al., 1999; Samac
et al., 2004; Gupta et al., 2006) were common
approaches in early reports. However, the genotypic
effects on tissue cultures were so pronounced that the
transformation efforts were limited to specific regener-
able genotypes (Thomas et al., 1992). Cotyledonary
nodes and shoot tips have also been used for direct
organogenesis and genotype-independent regenera-
tion. For example, Ding et al. (2003) reported the use
of cotyledonary explant for direct plant regeneration
of Medicago and Trifolium species. Kumar et al. (2008)
used lucerne shoot-tip explants and reported a maxi-
mum regeneration of fourteen shoots per explant on
Murashige and Skoog (MS) medium supplemented
2012 John Wiley & Sons Ltd. Grass and Forage Science, 68, 459468 459
460 S. Kumar et al.

with 6-benzylaminopurine and kinetin (Kn). Weeks Table 1 Effect of cytokinins on multiple shoot induction via
et al. (2008) experimented with in planta transforma- adventitious budding from shoot tip explant in lucerne (cv.
tion of M. sativa, using young seedlings excised at the Chetak) cultured on Murashige and Skoog medium.
shoot apical node. Recently, Li et al. (2009) reported
direct organogenesis from cotyledonary nodes of M. sa- Cytokinin (mg L 1) Shoots
tiva using thidiazuron (TDZ) and AgNO3. Plant regen- per explant
eration via direct organogenesis has become a 6-Benzyladenine Kinetin Thidiazuron (Mean SE)
preferred path because it maintains genetic fidelity, as 0 0 0 0
2 0
11a
there is no intermediate callus phase involved. 1 0 0 1
5 0
32b
Genetic transformation is a promising tool in 2 0 0 2
4 0
62b
molecular-breeding endeavours, which require robust, 3 0 0 4
3 1
32bc
efficient and genotype-independent protocols for 4 0 0 3
3 0
93b
transformation and plant regeneration (Ding et al., 0 1 0 1
1 0
33b
2003). We have observed a considerable reduction in 0 2 0 1
6 0
33b
plant regeneration frequency after Agrobacterium infec- 0 3 0 3
6 1
32b
tion of lucerne explants. Therefore, improvements in 0 4 0 3
3 1
32b
transformation efficiency will require increases in 0 0 1 2
6 1
31b
plant regeneration frequency from explants. The aim 0 0 2 4
3 1
60bc
of this study was to establish a rapid, efficient and 0 0 3 7
3 1
66c
genotype-independent regeneration protocol that 0 0 4 8
6 1
33c
would improve Agrobacterium-mediated genetic trans- 0 0 5 7
3 1
90c
formation efficiency in lucerne. 1 0 1 19
6 1
40e
1 0 2 35
0 1
33h
1 0 3 22
0 1
62f
Materials and methods 0 1 1 11
4 1
90cd
0 1 2 18
6 1
42e
Plant materials 0 1 3 15
4 1
62d
2 0 1 12
3 1
94d
Mature and healthy seeds of the five most popular
2 0 2 17
6 1
33e
Indian cultivars (viz. Chetak, Co-1, LLC-3, RL-88 and
2 0 3 14
3 1
66d
T-9) of lucerne, received from the IGFRI Research
0 2 1 10
7 1
03c
Farm, Jhansi, India, were used in this study. The
0 2 2 18
3 1
66e
shoot tips from in vitro-grown seedlings were excised
0 2 3 16
3 1
96de
and used as explants for multiple shoot induction.
3 0 1 9
6 1
06c
3 0 2 14
6 1
46d
3 0 3 12
6 1
46d
Multiple shoot induction and plant
0 3 1 10
5 0
94c
regeneration
0 3 2 16
6 0
99de
Seeds were surface sterilized and cultured aseptically 0 3 3 13
6 1
32d
to raise seedlings, as described elsewhere (Kumar 1 1 1 19
1 1
31e
et al., 2008). One minor modification consisted of ger- 1 1 2 28
3 1
94g
minating the seeds on MS medium containing growth 1 1 3 18
3 1
91e
regulators (Table 1) instead of half-strength MS basal 1 2 1 18
1 1
04e
medium. Phytagel (2
5 g L 1) was used as a solidifying 1 2 2 25
1 0
66f
agent for the medium. Apical meristems (along with 1 2 3 21
3 0
99ef
5 mm of cotyledonary leaves and 3 mm of hypocotyl; 2 1 1 13
1 1
30d
Figure 1b) were used as explants for multiple shoot 2 1 2 18
6 1
63e
induction via adventitious budding. Five explants were 2 1 3 15
1 1
63d
placed horizontally in 90-mm Petri dishes containing 2 2 1 14
6 1
03d
MS medium with the respective growth regulator(s). 2 2 2 17
6 1
03e
The plates were cultured at 25 2C under a 16-h 2 2 3 14
3 1
93d
photoperiod (light intensity of 110130 mM m 2 s 1
Means followed by different lowercase letters are
PAR using Philips F40/CW fluorescent tubes) for
significantly different (P = 0
05) using Duncans multiple
4 weeks. The shoots induced after 4 weeks of culture
range test.
(Figure 1c) were transferred to freshly prepared med-

2012 John Wiley & Sons Ltd. Grass and Forage Science, 68, 459468
 Regeneration and Agrobacterium-mediated transformation of lucerne 461

(a) (b) (c)

(d) (e) (f)

(g) (h) (i)

(j) (k) (l) (m)

Figure 1 In vitro plant regeneration via adventitious budding in lucerne (cv. Chetak). (a) Six-day-old seedlings used for dissecting
out the explants. (b) Shoot tip explants consisting of the apical meristem along with parts of the cotyledonary leaves and hypo-
cotyl. (c) Adventitious budding from the explant. (d) Multiple shoots induced from the explant on Murashige and Skoog (MS)
medium with thidiazuron (2 mg L 1) and 6-benzyladenine (BA) (1 mg L 1) after 7 weeks of culture. (e) Shoot elongation on
GA3-containing medium. (f) Shoot elongation on GA3-containing medium (A), compared with that on growth regulatorfree MS
medium (B). (g) Rooted shoot. (h) Lucerne plants regenerated from a single explant. (i) Tissue cultured plants in vegetative
growth. (j) Flowering on the tissue cultured plant. (k) Pod formation and seed setting on the tissue cultured plant. (l) Seeds har-
vested from the tissue cultured plant. (m) GUS gene expression in the Agrobacterium co-cultivated explant.

2012 John Wiley & Sons Ltd. Grass and Forage Science, 68, 459468
462 S. Kumar et al.
ium. The number of shoots induced from an individ-
ual explant was counted after 7 weeks of incubation.
After 7 weeks, the regenerated clump of shoots (Fig-
ure 1d) was subcultured in a Magenta box containing
MS medium with GA3 (06 mg L 1) to promote shoot
elongation, and the shoots were grown in the light for 3
4 weeks. When the shoots achieved a height of 7
8 cm, they were separated into smaller clumps, subcul-
tured onto rooting medium (MS + Naphthalene acetic
acid (NAA) 2 mg L 1 + activated charcoal 2 g L 1 +
Phytagel 2 g L 1) and grown in the light for 34 weeks.
Plants with well-developed shoots and roots (Figure 1g)
were carefully taken out of the medium, adhering med-
ium was washed off under running tap water and the
plants were transplanted into pots filled with a sterilized
mixture of soil and vermiculite (3:1). Individual pots
were covered with polythene bags with small holes for
1 week and then uncovered and cultured in the light at
25 2C for another 2 weeks. The hardened plants
were then transferred to field conditions and grown
until maturity. All tissue culture treatments were tested
on five Indian cultivars. Tissue culture experiments
were aimed at improving the plant regeneration
frequency from shoot tip explant by multiple shoot
induction.
Agrobacterium strain and transformation
vector
Agrobacterium tumefaciens strain LBA-4404 harbouring
pCAMBIA-1305.1 was used in this study. The plasmid
contains GUSPlusTM (CAMBIA, Canberra, Australia) as
a reporter gene (originally isolated from Staphylococcus
sp.) that performs better than Escherichia coli b-glucu-
ronidase (GUS) due to its faster colour development
and it is suitable for a non-destructive assay. The gene
contains a catalase intron, which ensures that GUS
activity is derived from the gene expression in eukary-
otic cells and not from the gene expression in contam-
inating Agrobacterium cells. The plasmid also carries a
kanamycin resistance nptII gene for bacterial selection
and a hygromycin resistance hpt gene (as plant selec-
tion marker) under the control of a dual enhancer
CaMV35S promoter and a CaMV35S polyA terminator
(Figure 2). Starter Agrobacterium culture was grown by
inoculating 5 mL Luria Bertani (LB) medium, contain-
ing 100 mg L 1 kanamycin and 25 mg L 1 rifampicin,
with a single colony of A. tumefaciens. This was cul-
tured for 24 h at 25C on a rotary shaker set at
180 rotations per minute. The resulting starter culture
(1%) was used to inoculate 25 mL Agrobacterium
(AB) medium (Chilton et al., 1974) containing the
antibiotics and grown as mentioned previously for
36 h. The culture was then treated with acetosy-
ringone (100 lM) and grown for another 6 h before
proceeding with the Agrobacterium-mediated transfor-
mation.
Agrobacterium-mediated transformation
The explants were viewed with a dissection micro-
scope and wounded around the meristematic tissues
using a fine sterilized needle. The explants were then
immersed in the Agrobacterium culture (OD600 = 0
35)
for 30 min at room temperature, blotted on sterile tis-
sue paper and co-cultivated on MS medium for 3 d.
About 600 shoot tips of cv. Chetak were co-cultivated
with Agrobacterium in an experiment with three repli-
cations. After co-cultivation, the explants were rinsed
with cefotaxime solution (250 mg L 1) followed by
sterile distilled water and blotted dry on sterile filter
paper. Five explants were cultured on MS medium
containing 2 mg L 1 TDZ, 1 mg L 1 6-benzyladenine
(BA), 50 mg L 1 hygromycin and 250 mg L 1 cefotax-
ime at 25 2C under a 16-h photoperiod. Co-culti-
vated explants were randomly picked from every
fourth plate and assayed histochemically for GUS
activity, as described by Jefferson et al. (1987).
After 7 weeks, the regenerated shoots were elongated
on MS medium containing GA3 (3 mg L 1) for 3
4 weeks. Clumps of shoots were then transferred to the
rooting medium and grown in the light for 34 weeks.
Rooted shoots were then transplanted into pots and hard-
ened as described previously. Subsequently, the putative
transgenic plants were grown in a contained environ-
ment. The transformation experiment was conducted on
one of the Indian cultivars viz. Chetak. The regenerated
transgenic plants were intercrossed at random.
Molecular analysis of transformants
The polymerase chain reaction (PCR) was used to
screen the putative transgenic plants by detecting the
hpt marker gene. For PCR, genomic DNA was isolated
from young leaf tissues using a DNeasy Plant Mini Kit
(Qiagen GmbH, Germany). PCR was carried out in 25-
lL reaction volume consisting of 10 mM TrisHCl,
50 mM KCl, 2 mM MgCl2, 10 mM of dNTP mix,
10 picomole of the gene-specific forward (5
TTTGTGTACGCCCGACAGTCC 3) and reverse (5
GCCGATCTTAGCCAGACGAGC 3) primers, 1
0 unit
of Taq DNA polymerase (BangaloreGenei, Bangalore,
India) and 100 ng of genomic DNA. DNA samples
from non-transgenic lucerne plants raised from tissue
culture (as a negative control) and plasmid DNA (as a
positive control) were also included. PCR conditions
were as follows: 94C for 4 min, followed by forty
cycles of amplification (94C for 1 min, 54C for
1 min and 72C for 1 min) and a final extension at
72C for 10 min.
2012 John Wiley & Sons Ltd. Grass and Forage Science, 68, 459468
 Regeneration and Agrobacterium-mediated transformation of lucerne 463

Figure 2 Schematic presentation of T-DNA carrying the marker genes. Arrows indicate the primers used for PCR amplification
of the hpt gene and the probe prepared for Southern hybridization.

For Southern blot analysis, genomic DNA was iso- Results

lated from young, healthy leaves of PCR-positive
plants using the cetyltrimethylammonium bromide
(CTAB) method as described by Dellaporta et al.
(1983) with minor modifications. About 2 g of leaf tis-
sue was collected from individual plants and homoge-
nized into a fine powder using liquid nitrogen. The
DNA pellet was finally dissolved in 500 lL TE buffer
and quantified on agarose gel electrophoresis by com-
parison with a standard DNA marker (k DNA/HindIII
digest). About 15 lg of genomic DNA was digested
with ZraI, which cuts the hpt gene once at the 5 end
of the coding region. The pCAMBIA-1305.1 DNA, with
two restriction sites for ZraI, was used as a positive
control. A detailed procedure for the Southern blot
analysis was described elsewhere (Kumar et al., 2010).
Transgene inheritance analysis
Seeds collected from PCR- and Southern-positive
transgenic (T0) plants were germinated and grown on
MS medium containing hygromycin (50 mg L 1) for
2 weeks. The surviving seedlings were then trans-
ferred to soil in pots and grown in a contained envi-
ronment. The T1 progenies were screened using PCR
amplification of the hpt gene, and selected transfor-
mants were confirmed for stable inheritance of the
marker gene by Southern analysis.
The transformation experiment was repeated three
times, each with three replications. Statistical analysis
was performed using analysis of variance (ANOVA).
Duncans multiple range test (DMRT) at P = 0
05 was
used to compare the means of the treatments.
Tissue culture response of the explant
The age of the seedling had a significant effect on the
tissue culture response of the explant (Table 2). Shoot
tips from 6-d-old seedlings produced more shoots per
explant with the highest shoot induction frequency
(No. of explants showing adventitious budding/No. of
explants cultured 9 100). The seedlings grown on the
growth regulatorcontaining medium showed stunted
growth when compared with seedlings grown on a
growth regulatorfree medium (data not shown).
Seedlings appeared suitable for excision of apical mer-
istems up to 2 weeks after sowing on the growth reg-
ulatorcontaining medium. The seedlings germinated
on growth regulatorfree medium were overgrown
after 8 d of culture. The explants cultured on the
growth regulatorcontaining MS media (Table 1) were
swollen up within 1 week of culture, whereas no
swelling was observed in explants cultured on the
growth regulatorfree MS medium.
Effects of growth regulators on shoot
induction
Multiple shoot induction from the explants cultured
on the growth regulatorcontaining media was
observed within 4 weeks (Figure 1c). A higher num-
ber of shoots was observed from explants derived
from seedlings grown on growth regulatorcontaining
media than from seedlings grown on growth regula-
torfree medium (Figure 3). A maximum of thirty-

Table 2 Effect of the age of seedling on shoot induction frequency from the explant.*

Age of the No. of explants Explants showing No. of shoots Shoot induction
seedling (d) cultured adventitious budding per explant frequency (%)

6 30 28 35
0 1
33c 93
3

10 30 23 21
0 2
33b 76
6
14 30 11 13
0 2
66a 36
6

Means followed by different lowercase letters are significantly different (P = 0
05) using Duncans multiple range test. *Shoot tips
from the seedlings (cv. Chetak) grown on Murashige and Skoog medium containing thidiazuron (2 mg L 1) and 6-benzylade-
nine (1 mg L 1) were excised and used as explants and cultured on freshly prepared medium with three replications. Shoot
induction frequency = No. of explants showing adventitious budding/No. of explants cultured 9 100.

2012 John Wiley & Sons Ltd. Grass and Forage Science, 68, 459468
464 S. Kumar et al.

five shoots per explant were recorded on the med-
ium supplemented with 2 mg L 1 TDZ and 1 mg L 1
BA (Table 1). Combining TDZ with BA and/or Kn
considerably increased adventitious budding of the
explant. Together, TDZ, BA and Kn showed synergis-
tic effects; TDZ showed better synergy with BA
(thirty-five shoots/explant) than with Kn (18
6 shoots
per explant) (Table 1). However, higher concentra-
tions of TDZ, BA and/or Kn significantly decreased
the number of shoots. Although variation was
observed in the number of shoots regenerated from
explants of different genotypes, the shoot regenera-
tion frequency (shoot regeneration observed per one
hundred explants cultured) was very high, varying
from 67 to 93% in the different lucerne cultivars
(Figure 4).
The addition of TDZ, BA and Kn also caused
stunted growth of the regenerated shoots. When these
stunted shoots were transferred to MS medium con-
taining GA3, elongation of the shoot was observed
within 4 weeks of culture. Significant differences were
observed between the heights of the shoots cultured
on GA3-containing medium and those cultured on MS
basal medium (Figure 1e,f). Optimal elongation in the

Figure 3 Effect of growth regulators in seed germination medium on multiple shoot induction via adventitious budding from
shoot tip. 6-Benzyladenine (BA) and kinetin were used at 3 and 2 mg L 1 respectively; thidiazuron and BA were used at 2 and
1 mg L 1 respectively, in the medium for seed germination. Vertical bars represent SE.

Figure 4 Shoot induction frequency in five different Indian cultivars of lucerne. Seed germination and explant culturing were
carried out on Murashige and Skoog medium supplemented with thidiazuron (2 mg L 1) and 6-benzyladenine (1 mg L 1). Data
recorded after 7 weeks of culture on the medium. Vertical bars represent SE. Treatments with a different lowercase letters
are significantly different (P < 0
05).

2012 John Wiley & Sons Ltd. Grass and Forage Science, 68, 459468
 Regeneration and Agrobacterium-mediated transformation of lucerne 465
Table 3 Effect of gibberellic acid (GA3) on elongation of regenerated shoots of lucerne.
Gibberellic No. of shoots
acid (mg L 1) cultured
0 30
1 30
2 30
3 30
4 30
5 30
6 30
Regenerated shoots of about 2 cm height were cultured on Murashige and Skoog medium containing GA3. Observations were
taken after 4 weeks of culture. *Stunted growth on medium without GA3 was used as control for comparative evaluation. No.
of shoots showing elongation/No. of shoots cultured 9 100.
stunted shoots was observed with GA3 at 34 mg L
(Table 3).
Plant rooting, hardening and establishment
Rooting from the regenerated shoots was observed
within 4 weeks of culture in a medium containing
NAA and activated charcoal (Figure 1g). Addition of
activated charcoal to the rooting medium resulted in
significant improvement in rooting in the regenerated
shoots (data not shown). About 25% of the regener-
ated plants did not survive the hardening process: 4
8% of the shoots were lost due to lack of rooting,
while 1620% of the rooted plants died by the end of
hardening. The hardened plants were transferred suc-
cessfully to field conditions, with survival of more
than 75% of the transferred plants. Therefore, we
were able to regenerate up to thirty-five shoots, and
we successfully established twenty-seven lucerne
plants in soil from a single shoot tip (Figure 1h)
within a short period of about 18 weeks. The plants
showed normal morphology, growth and development
with normal flowering, pod formation and seed set
(Figure 1il). The harvested seeds germinated to give
rise to normal lucerne plants.
Agrobacterium-mediated transformation
Transient GUS expression was observed in the ex-
plants after 3 d of co-cultivation with Agrobacterium
(Figure 1m). The presence of the transgene (hpt) was
detected by PCR in most (79/84) of the regenerated
and putative transgenic lucerne plants. A transgene-
specific band of expected size (553 bp) was observed
in the T0 and T1 plants along with the plasmid
(positive) control, but no amplification was observed
in the case of the non-transgenic plants (Figure 5a,b).
Southern hybridization analysis of the T0 plants and
their T1 progenies confirmed stable integration of the
2012 John Wiley & Sons Ltd. Grass and Forage Science, 68, 459468
No. of Elongation Increase in
elongated shoots* response (%) height (%)
0 0 15
16 53
3 65
26 86
6 190
25 83
3 295
26 86
6 300
24 80
0 305
21 70
3 213
1
hpt gene into the genome (Figure 5c,d). Transgene
integration at one or two loci was observed. The trans-
formation frequency, calculated as the number of
independent transgenic events per one hundred co-
cultivated explants, was 13%. The values for plant
regeneration frequency (23%) and the number of
shoots (11) regenerated from an Agrobacterium co-cul-
tivated explant were considerably lower than the val-
ues from the explant without co-cultivation (data not
shown). PCR and Southern hybridization analyses of
the T1 progenies indicated inheritance of the transgene
to the offspring.
Discussion
Plant regeneration frequency plays a crucial role in
the success of genetic transformation endeavours. An
efficient and genotype-independent regeneration pro-
tocol is preferred for successful plant transformation.
Major limitations of most of the regeneration and
transformation protocols have been the low regenera-
tion frequency and their genotype dependence (Ding
et al., 2003). The present study aimed at the develop-
ment of rapid, high-frequency, genotype-independent
regeneration and transformation of lucerne using
seedlings as explants for Agrobacterium-mediated trans-
formation.
We germinated seeds on media containing cytoki-
nins to increase the endogenous cytokinin concentra-
tion in the explants. Shoot induction frequency and
the number of shoots induced per explant were high
in young (6 d) seedlings (Table 2). Khalafalla and
Hattori (1999) also reported a similar response for
multiple shoot production in Vicia faba; however, they
used cotyledonary nodes as explants. The age of the
explant (seedling) has been reported to affect the
degree of adventitious budding in other species,
including eastern redbud (Distabanjong and Geneve,
1997) and soya bean (Kim et al., 1990). Addition of
466 S. Kumar et al.

(a)

(b)

(c)

(d)

Figure 5 Molecular analysis of transgenic lucerne plants. (a) Agarose gel (1
5%) showing PCR product (553 bp) with hpt gene-
specific primers from genomic DNA of putative T0 transgenic lucerne plants. (b) PCR amplification of the hpt gene from T1
progenies. (c) Southern analysis of some T0 transgenic lucerne plants. (d) Southern analysis of some T1 progenies. T1 27, T1 3
4 and T1 69 present more bands than their T0 parents (T1 2, T1 3 and T1 6 respectively) because crosses were made among
transgenic plants from different events. M = DNA molecular weight marker; P = plasmid (positive) control; NT = non-transgenic
lucerne plant.

BA or Kn alone induced only four to five shoots per
explant, while TDZ addition induced nine shoots per
explant. Combinations of cytokinins showed synergis-
tic effects on the degree of multiple shoot induction.
Previously, we reported the production of fourteen
shoots per explant using MS medium supplemented
with 6-benzylaminopurine and Kn (Kumar et al.,
2008). When TDZ and BA were used simultaneously,
the number of shoots (35) induced per explant was
four times higher than that observed with TDZ alone.
TDZ showed better synergy with BA and its use
resulted in a twofold increase in the number of shoots
per explant. A similar synergistic effect was reported
by Khalafalla and Hattori (1999), who combined TDZ
and BA for multiple shoot induction in cotyledonary
nodes of V. faba. Ding et al. (2003) used TDZ with
NAA and reported a shoot induction frequency as
high as 85% in M. sativa, but the number of shoots
induced from an explant was not reported. Li et al.
(2009) also used TDZ (along with AgNO3) and
reported a maximum of six shoots per explant in
M. sativa. TDZ has also been used in different plant
species to induce high-frequency shoot regeneration
(Khalafalla and Hattori, 1999; Caramori et al., 2001;
Seedhabadee et al., 2006; Kumar and Chandra, 2009;
Kumar and Bhat, 2012). TDZ has been reported to
induce synthesis/accumulation of endogenous cytoki-
nin or to promote the conversion of stored forms to
biologically active cytokinins (Hutchinson and Saxena,
1996). Shoot induction frequency varied from 67%
(LLC-3) to 93% (Chetak) in the cultivars tested in the
present study (Figure 4). Despite considerable
variation in the number of shoots induced from an
explant (data not shown), all of the genotypes
responded well to the protocol, indicating it to be a
genotype-independent regeneration procedure.

2012 John Wiley & Sons Ltd. Grass and Forage Science, 68, 459468
 Regeneration and Agrobacterium-mediated transformation of lucerne 467
The growth regulators used for adventitious bud-
ding also caused stunted growth of the regenerating
shoots. This finding is in agreement with the observa-
tions made by earlier investigators (Meyer and Van
Staden, 1988; Khalafalla and Hattori, 1999; Neves
et al., 2001; Tefera and Wannakrairoj, 2006). TDZ has
been reported to result in regenerated plants that have
short and compact shoots because cytokinin generally
stimulates shoot proliferation by inhibiting shoot elon-
gation (Brassard et al., 1996; Kumar and Chandra,
2009; Kumar and Bhat, 2012). We were able to over-
come the problem of stunted growth by transferring
regenerated shoots into a GA3-containing medium.
Significant differences in the heights of the regener-
ated shoots were observed within 34 weeks of cul-
ture (Figure 1f). Khalafalla and Hattori (1999) and
Neves et al. (2001) used repeated subculture of regen-
erated shoots on hormone-free medium to diminish
hangover effects of TDZ exposure. However, these
serial subcultures increase the time period required for
regeneration of the plant.
In this study, we wounded the shoot tip around
the meristematic tissues before Agrobacterium co-culti-
vation to facilitate Agrobacterium infection of the
explant. The apical meristem is very small in size in a
6-d-old seedling, so we needed to use a dissection
microscope to view the wounding area. The leaf pri-
mordia tend to cover the apical meristem as the seed-
ling age increases, thereby reducing accessibility to the
meristematic tissues for wounding. Therefore, explants
from 6-d-old seedling were found to be better in terms
of the shoot regeneration efficiency and accessibility
to Agrobacterium infection.
The PCR screening failed to detect the transgene
in 6% of the putative transgenic plants; these plants
might have escaped hygromycin selection possibly
because of the rapid regeneration of plants from the
meristematic tissues. Hygromycin selection was
applied only during shoot induction and was subse-
quently withdrawn, which might have supported
survival of the escaped plants. As lucerne shows
inbreeding depression, the transgenic plants were in-
tercrossed at random. This might have resulted in
the appearance of an additional band in the T1 27,
T1 34 and T1 69 progenies (Figure 5d).
Although Agrobacterium infection considerably
reduced plant regeneration frequency (23%) and the
number of shoots (11) regenerated from a co-culti-
vated explant, we still achieved very high transforma-
tion frequency, mainly because of the improved plant
regeneration efficiency. The protocols described here
could prove very useful for clonal multiplication and
the development of transgenic lucerne plants contain-
ing gene(s) of agronomic importance.
2012 John Wiley & Sons Ltd. Grass and Forage Science, 68, 459468
Acknowledgments
The research work was supported by the Department
of Biotechnology, Ministry of Science and Technology,
Government of India, New Delhi, under a project (No.
BT/PR6899/AGR/05/312/2005). SK acknowledges IUS-
STF Research Fellowship (Ref # IUSSTF Fellowships/
2009/14-Suresh Kumar) by the Indo-US Science and
Technology Forum, New Delhi. RT and AS acknowl-
edge Research Fellowships by the Department of Bio-
technology, Government of India. Thanks are also due
to CAMBIA, Australia, for the pCAMBIA-1305.1 used
in the present study. There is no conflict of interest
among the authors.
References
B R A S S A R D N., B R I S S E T T E L., L O R D D. and L A L I B E R T E S.
(1996) Elongation, rooting and acclimatization of
micropropagated shoots from mature material of hybrid
larch. Plant Cell Tissue and Organ Culture, 44, 3744.
C A R A M O R I L.P.C., F A V A R O S. and V I E I R A L.G.E. (2001)
Thidiazuron as promoter of multiple shoots in cotton
explants (Gossypium hirsutum L.). Maringa, 23, 1195
1197.
C H I L T O N M.-D., C U R R I E R T.C., F A R R A N D S.K., B E N D I C H
A.J., G O R D O N M.P. and N E S T E R E.W. (1974)
Agrobacterium tumefaciens DNA and PS8 bacteriophage
DNA not detected in crown gall tumors. Proceedings of the
National Academy of Sciences of the USA, 71, 36723676.
D E A V O U R S B.E. and D I X O N R.A. (2005) Metabolic
engineering of isoflavonoid biosynthesis in alfalfa. Plant
Physiology, 138, 22452259.
D E L L A P O R T A S.L., W O O D J. and H I C K S J.B. (1983) A
plant DNA minipreparation: version II. Plant Molecular
Biology Reporter, 1, 1921.
D I N G Y.-L., A L D A O - H U M B L E G., L U D L O W E., D R A Y T O N
M., L I N Y.-H., N A G E L J., D U P A L M., Z H A O G.,
P A L L A G H Y C., K A L L A R., E M M E R L I N G M. and
S P A N G E N B E R G G. (2003) Efficient plant regeneration
and Agrobacterium-mediated transformation in Medicago
and Trifolium species. Plant Science, 165, 14191427.
D I S T A B A N J O N G K. and G E N E V E R. (1997) Multiple shoot
formation from cotyledonary node segments of Eastern
redbud. Plant Cell Tissue and Organ Culture, 47, 24254.
G U P T A S., G U P T A S., B H A T V. and G U P T A M.G. (2006)
Somatic embryogenesis and Agrobacterium mediated
transformation in Indian accessions of lucerne (Medicago
sativa L.). Indian Journal of Biotechnology, 5, 269275.
H E U Z E V., T R A N G., B O V A L M., L E B A S F., L E S S I R E M.,
N O B L E T J. and R E N A U D E A U D. (2012) Alfalfa (Medicago
sativa). Feedipedia.org. INRA, CIRAD, AFZ and FAO.
Available at: http://trc.zootechnie.fr/node/275 (accessed
6 March 2012).
H U T C H I N S O N M.J. and S A X E N A P.K. (1996) Role of
purine metabolism in TDZ-induced somatic
embryogenesis of geranium (Pelargonium horturum)
hypocotyls cultures. Physiologia Plantarum, 98, 517522.
468 S. Kumar et al.
I A N T C H E V A A., V L A H O V A M., B A K A L O V A E., K O N D O R O S I
E., E L L I O T T M. and A T A N A S S O V A. (1999)
Regeneration of diploid annual medics via direct
somatic embryogenesis promoted by thidiazuron and
benzylaminopurine. Plant Cell Report, 18, 904910.
J E F F E R S O N R.A., K A V A N A G H T.A. and B E V A N M.W.
(1987) GUS fusions: beta-glucuronidase as a sensitive
and versatile gene fusion marker in higher plants.
EMBO Journal, 6, 39013907.
K H A L A F A L L A M.M. and H A T T O R I K. (1999) A
combination of thidiazuron and benzyladenine
promotes multiple shoot production from cotyledonary
node explants of faba bean (Vicia faba L.). Plant Growth
Regulation, 27, 145148.
K I M J.H., L A M O T T E C.E. and H A C K E. (1990) Plant
regeneration in vitro from primary leaf nodes of
soybean (Glycine max) seedlings. Journal of Plant
Physiology, 36, 664669.
K O L L I K E R R., R O S E L L I N I D. and W A N G Z.-Y. (2010)
Development and application of biotechnological and
molecular genetic tools. In: Boller B., Posselt U. and
Veronesi F. (eds) Fodder crops and amenity grasses, Vol. 5
in the series: handbook of plant breeding, pp. 89113. New
York: Springer Science, ISBN: 978-1-4419-0759-2. Doi:
10.1007/978-1-4419-8_17.
K U M A R S. (2011) Biotechnological advancements in alfalfa
improvement. Journal of Applied Genetics, 52, 111124.
K U M A R S. and B H A T V. (2012) High-frequency direct
plant regeneration via multiple shoot induction in the
apomictic forage grass Cenchrus ciliaris L. In Vitro Cellular
and Developmental Biology. Plant, 48, 241248.
K U M A R S. and C H A N D R A A. (2009) Direct plant
regeneration via multiple shoot induction in Stylosanthes
seabrana. Cytologia, 74, 391399.
K U M A R S., C H A N D R A A. and G U P T A M.G. (2008) Plantlet
regeneration via multiple shoot induction in Indian
cultivars of lucerne (Medicago sativa L). Journal of Plant
Biochemistry and Biotechnology, 17, 181184.
K U M A R S., A R U L L. and T A L W A R D. (2010) Generation
of marker-free Bt transgenic indica rice and evaluation
of its yellow stem borer resistance. Journal of Applied
Genetics, 51, 243257.
L I J.J., W U Y.M., W A N G T. and L I U J.X. (2009) In vitro
direct organogenesis and regeneration of Medicago sativa.
Biologia Plantarum, 53, 325328.
M E Y E R H.J. and V A N S T A D E N J. (1988) In vitro
multiplication of Ixia flexuosa. HortScience, 23, 10701071.
M O U R S Y H.A., H A G G A M M.E.A., G H A M E N S.A. and
R A D Y M.R. (1999) Callus induction and plant
regeneration of alfalfa (Medicago sativa L.). Egyptian
Journal of Agronomy, 29, 179189.
N E V E S L.O., T O M A Z L. and F E V E R E I R O M.P.S. (2001)
Micropropagation of Medicago truncatula Gaertn cv.
Jemalong and Medicago truncatula ssp.
Narbonensis. Plant Cell Tissue and Organ Culture, 67,
8184.
S A M A C D.A. and T E M P L E S.J. (2004) Development and
utilization of transformation in Medicago species. In:
Liang G.H. and Skinner D.Z. (eds) Genetically modified
crops: their development, uses, and risks, pp. 165202.
Binghampton, NY: Haworth Press.
S A M A C D.A., L I T T E R E R L., T E M P L E G., J U N G H.-J.G. and
S O M E R S D.A. (2004) Expression of UDPglucose
dehydrogenase reduces cell-wall polysaccharide
concentration and increases xylose content in alfalfa
stems. Applied Biochemistry and Biotechnology, 116,
11671182.
S E E D H A B A D E E G., S A N J A Y V.C., M O N I C A B., B R I A N
F.D., P I E R R E H., B R A I N R. and C H I B B A R R. (2006) In
vitro regeneration of cereals based on multiple shoot
induction from mature embryos in response to
thidiazuron. Plant Cell Tissue and Organ Culture, 85,
6373.
S O M E R S D.A., S A M A C D.A. and O L H O F T P.M. (2003)
Recent advances in legume transformation. Plant
Physiology, 131, 892899.
T A B E L.M., W A R D L E Y - R I C H A R D S O N T., C E R I O T T I A.,
A R Y A N A., M C N A B B W., M O O R E A. and H I G G I N S
T.J.V. (1995) A biotechnological approach to improving
the nutritive value of alfalfa. Journal of Animal Science,
73, 27522759.
T E F E R A W. and W A N N A K R A I R O J S. (2006) Synergistic
effects of some plant growth regulators on in vitro
shoot proliferation of korarima (Aframomum corrorima
(Braun) Jansen). African Journal of Biotechnology, 5,
18941901.
T H O M A S M.R., R O S E R.J. and N O L A N K.E. (1992)
Genetic transformation of Medicago truncatula using
Agrobacterium with genetically modified Ri and disarmed
Ti plasmids. Plant Cell Report, 11, 113117.
W E E K S J.T., Y E J. and R O M M E N S C.M. (2008)
Development of an in planta method for transformation
of alfalfa (Medicago sativa). Transgenic Research, 17,
587597.
2012 John Wiley & Sons Ltd. Grass and Forage Science, 68, 459468