Pathogens and Disease ISSN 2049-632X

RESEARCH ARTICLE

Temporal expression of agrB, cidA, and alsS in the early

development of Staphylococcus aureus UAMS-1 biofilm formation
and the structural role of extracellular DNA and carbohydrates
Rossella Grande1,2, Laura Nistico1, Karthik Sambanthamoorthy3, Mark Longwell1, Antonio Iannitelli2,
Luigina Cellini2, Antonio Di Stefano2, Luanne Hall Stoodley1,4,5 & Paul Stoodley1,5,6,7
1 Center for Genomic Sciences, Allegheny-Singer Research Institute, Pittsburgh, PA, USA
2 Department of Pharmacy, University G. dAnnunzio, Chieti-Pescara, Chieti, Italy
3 Wound Infections, Division of Bacterial and Rickettsial Diseases, Walter Reed Army institute of Research, Maryland, USA
4 Wellcome Trust Clinical Research Facility (WTCRF), Southampton General Hospital, Southampton, UK
5 National Centre for Advanced Tribology at Southampton (nCATS), School of Engineering, University of Southampton, Southampton, UK
6 Department of Microbial Infection and Immunity, Center for Microbial Interface Biology, Ohio State University, Columbus, OH, USA
7 Department of Orthopedics, Ohio State University, Columbus, OH, USA

The goal of Grande and colleagues was to investigate temporal expression of genes involved in early biofilm formation and
to investigate the production of extracellular DNA (eDNA) by Staphylococcus aureus. The data reported here indicate that
eDNA is important for early biofilm development, but that treatment with DNase I alone is not sufficient to cause complete
disruption of the biofilm. It is clear that other components (e.g., polysaccharides) play an important role in the structural
stability of biofilms, and combining DNase I and polysaccharide-degrading enzymes may hold broader promise as a
therapeutic approach.

Keywords Abstract
biofilm; Staphylococcus aureus; agrB; alsS;
cidA; eDNA; carbohydrate. Extracellular DNA (eDNA) is an important component of the extracellular polymeric
substance matrix and is important in the establishment and persistence of
Correspondence Staphylococcus aureus UAMS-1 biofilms. The aim of the study was to determine
Paul Stoodley, Center for Microbial Interface the temporal expression of genes involved in early biofilm formation and eDNA
Biology, Ohio State University, 716 Biomed- production. We used qPCR to investigate expression of agrB, which is associated
ical Research Tower, 460 W. 12th Ave., with secreted virulence factors and biofilm dispersal, cidA, which is associated with
Columbus, OH 43210, USA. biofilm adherence and genomic DNA release, and alsS, which is associated with cell
Tel.: 614 292 7826 lysis, eDNA release and acid tolerance. The contribution of eDNA to the stability of
fax: 614 292 9616 the biofilm matrix was assessed by digesting with DNase I (Pulmozyme) and
e-mail: pstoodley@gmail.com quantifying structure by confocal microscopy and COMSTAT image analysis. AgrB
expression initially increased at 24 h but then dramatically decreased at 72 h in an
Received 30 October 2013; revised 5 inverse relationship to biomass, supporting its role in regulating biofilm dispersal.
February 2014; accepted 6 February 2014. cidA and alsS expression steadily increased over 72 h, suggesting that eDNA was
Final version published online 11 March an important component of early biofilm development. DNase I had no effect on
2014. biomass, but did cause the biofilms to become more heterogeneous. Carbohydrates
in the matrix appeared to play an important role in structural stability.
doi:10.1111/2049-632X.12158

Editor: Tom Coenye

biofilms are embedded in extracellular polymeric substances

Introduction
Staphylococcus aureus is a leading cause of nosocomial
infections including those associated with orthopedic
implants (Otto, 2008; Papa et al., 2013). Biofilm formation
confers antibiotic tolerance and protection from the host
immune system making microbial biofilms difficult to remove
(Fux et al., 2005; Hall-Stoodley et al., 2012). Bacterial cells in
(EPS), a mixture of macromolecules such as exopolysaccha-
rides, proteins and extracellular DNA (eDNA). These com-
ponents vary with bacterial strain, culture conditions and
biofilm age (Whitchurch et al., 2002; Steinberger & Holden,
2005; Allesen-Holm et al., 2006). Biofilm development is a
multistep regulated process in which cellular adherence, EPS
secretion and detachment of bacteria from the maturing

414 Pathogens and Disease (2014), 70, 414422, 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
R. Grande et al.
biofilm are controlled by the regulation of numerous genes.
For example, the agr global regulator, a two-component
quorum-sensing system, controls cell detachment and the
transition between planktonic and sessile lifestyles,
contributing to S. aureus survival via cell dispersal and
colonization of new niches (Yarwood et al., 2004; Boles &
Horswill, 2008). The cidA gene, involved in cell lysis and
eDNA release (Ranjit et al., 2011), is part of the cidR regulon
that also includes alsSD and in turn encodes a-acetolactate
synthase and a-acetolactate decarboxylase, which are
responsible for the production of acetoin, an important
physiological metabolite secreted by many microorganisms
(Renna et al., 1993; Cho et al., 2013) for survival in acidic
environments (Yang et al., 2006).
The presence of extracellular deoxyribonucleic acid
(eDNA) in the slime layers of various halophilic bacteria
was first described by Smithies and Gibbons (1955). Since
then, the role of eDNA as an important structural component
of the biofilm extracellular matrix in both Gram-negative
(Allesen-Holm et al., 2006; Harmsen et al., 2010) and
Gram-positive bacteria (Moscosco et al., 2006, Izano et al.,
2008; Hall-Stoodley et al., 2008; Rice et al., 2007) has been
documented in multiple studies. These studies showed a
significant reduction in biofilm biomass upon the addition of
DNase I to the culture medium, supporting the hypothesis
that eDNA plays an important role in biofilm establishment
and structural stability. The source of eDNA has been
hypothesized to result from several mechanisms of DNA
release, such as the excretion of small vesicles from the outer
membranes (Renelli et al., 2004; Manning & Kuehn, 2013),
prophage-mediated cell death in Pseudomonas aeruginosa
biofilms (Webb et al., 2004) and controlled cellular lysis
during biofilm formation in S. aureus (Rice et al., 2007).
In this study, we evaluated the temporal expression of
biofilm-specific genes: agrB, cidA, and alsS during
S. aureus UAMS-1 biofilm development. We used saline
and glucose concentrations to approximate those that might
be encountered in an orthopedic implant patient suffering
from diabetes, an established risk factor for implant related
infection (Lovati et al., 2013). Both glucose and salinity have
been shown to play an important role in influencing the
effect of transcriptional regulators agr and rbf on the degree
of staphylococcal biofilm formation (Lim et al., 2004; Boles
& Horswill, 2008). In addition, biofilms were treated with
DNase I (Pulmozyme, which is used to treat cystic
fibrosis-related lung infection) to test how effective eDNA
digestion was in preventing biofilm formation and destabi-
lizing the biofilm matrix. We also used a lectin cocktail to
assess the distribution of carbohydrates in the matrix to
assess the relative contribution that they might play in
biofilm structure and stability.
Materials and methods
Bacterial strain and biofilm growth conditions
Staphylococcus aureus UAMS-1, an oxacillin-susceptible
clinical strain obtained from the bone of a patient suffering
from osteomyelitis (Gillaspy et al., 1995), was grown in
Pathogens and Disease (2014), 70, 414422, 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
eDNA and carbohydrates in S. aureus biofilm
Tryptic Soy Broth (TSB; Oxoid) supplemented with 0.6%
NaCl (w/v) and 0.8% (w/v) glucose and incubated overnight
with shaking at 37 C. The overnight broth culture was
diluted to an optical density of 0.1 at 650 nm (Spectronic
20D+, Thermo Fisher Scientific Inc. Waltham, MA). Two mL
of the diluted broth culture was inoculated into polystyrene
Petri plates (Falcon) treated with either 200 lg mL
1 of
synthetic DNase I (Pulmozyme/Dornase alfa) [1 mg mL
1]
(Genentech Inc., San Francisco, CA) or 200 lL of Pulmo-
zyme buffer alone (8.7 mg mL
1 NaCl, 0.15 mg mL
1
CaCl2 (untreated controls) for confocal laser scanning
microscopy (CLSM) analysis. For RNA isolation, 25 mL of
diluted broth culture was inoculated into Petri plates, and
samples were incubated at 37 C, without shaking for
30 min to promote cell adhesion, followed by shaking for
2, 24, or 72 h. These time points were chosen based on
those described by Mann et al. (2009). Medium containing
DNase I or buffer alone was changed daily, and each
experiment was performed in triplicate.
Isolation of RNA
For isolating total cellular RNA, S. aureus biofilms were
removed using a cell scraper, and RNA was extracted as
previously described by Sambanthamoorthy et al. (2006).
Briefly, cells were harvested by centrifugation (5000 g for
5 min at 4 C) and resuspended in TES buffer containing
100 lg lysostaphin mL
1 (AMBI). The samples were incu-
bated at room temperature for 10 min and were then applied
to a QiagenRNeasy Maxi column to isolate total bacterial
RNA according to the manufacturers directions. The
optional on-column RNase-free DNase I (Qiagen) was used
to remove contaminating DNA. After isolation of RNA, traces
of contaminating DNA were further eliminated by treating
RNA samples with RNase-free DNase I (DNA-free kit,
Ambion) and incubating at 37 C for 20 min. Samples were
used immediately or stored at
80 C. The quality, integrity,
and concentration of the RNA were checked using an
Agilent 2100 Bioanalyzer (Agilent Technologies, Santa
Clara, CA) according to the manufacturers instructions,
and RNA preparations were tested for contaminating DNA
by no-reverse-transcriptase PCR reactions.
Real-time quantitative PCR (qPCR)
Oligonucleotide primers and TaqMan probes (Fam-labeled
TaqMan TAMRA probes) were designed with PRIMER EXPRESS
2.0 software (ABI PRISM; PE Biosystems, Framingham, MA),
to amplify gene fragments having an optimal size of
70180 bp (Table 1). The constitutively expressed gyrase
gene (gyr) was used as an endogenous control, as previ-
ously described (Goerke et al., 2000). Measurements of
relative levels of gene expression were performed by qPCR
as previously described (Sambanthamoorthy et al., 2006;
Hall-Stoodley et al., 2008). All qPCR reactions were per-
formed in triplicate from each of two independent experi-
ments, and the mean CT was used for analysis. Two-fold or
higher changes in gene expression were considered
significant.
415
eDNA and carbohydrates in S. aureus biofilm R. Grande et al.

Table 1 Oligonucleotide primers and TaqMan probes used in qPCR analysis of gene expression

Primer TaqMan probe

Gene Sequences 50 ?30 Sequences 50 ?30
agrB F: TGCAAAGTCTTCGATACTTTGTTACA TCTATTATAGGATTGATTTCCGTTGTTATTTATGCACCG
R: GGTATAGGTTGCTTTTTCGTTGCT
alsS F: AATGGTATGCAAACGCTTGGT AGCATTACCGTGGGCAATTTCAGCTG
R: GCGTATTAGGGCGCACAAGT
cidA F: GCATTGGTCCTGTCGTTTCA ACCAAACAGACCTTTCATAAAACCATCTTGCATTA
R: GGCAACGCTAGGATTTACAACAT

thresholding was used to eliminate residual noise in the

Confocal laser scanning microscopic analysis
image stacks. Prior to analysis, each thresholded image
To evaluate S. aureus UAMS-1 biofilm development with stack was visually compared with the original image files to
and without DNase I treatment using CLSM, biofilms were ensure that the settings had eliminated noise but not
removed at 2, 24, or 72 h and rinsed with Hanks balanced relevant data (Heydorn et al., 2000; Hall-Stoodley et al.,
salt solution (HBSS) with Ca+2 and Mg+2 to remove 2008). The biofilm parameters maximum thickness,
planktonic and loosely adherent cells. Samples were stained biomass, and roughness coefficient (which correlates with
either with the BacLight Live/Dead stain (Invitrogen, Carls- biofilm heterogeneity) were determined for each image
bad, CA) or with a fluorescent Alexa 488-labeled lectin stack, and total biomass was found by adding the green
cocktail and Syto59, as described (Hall-Stoodley et al., channel (EPS carbohydrates) and the blue channel
2008), and image stacks of S. aureus UAMS-1 biofilms
were taken randomly from five different fields. The carbo-
hydrate Alexa 488 lectin cocktail was excited with the (a)
488 nm laser, and the emitted signal was detected in
channel 1 (assigned green) with a detection window set to
500550 nm. The nucleic acid-specific stain, Syto59, was
excited with the 630 nm red laser line, and the channel 2
(assigned red) detection window set to c. 640660 nm, and
the gain and background adjusted until individual bacterial
cells were sharply defined with a minimum amount of noise
(random pixel speckles) between individual cells. At the
settings optimized for bacterial cells containing concentrated
nucleic acids, any signal from eDNA was too faint to be
detected. Therefore, the channel 3 (assigned blue) window (b)
was set to c. 660720 nm, which also detected emitted light
from the Syto59, and the bacteria were deliberately
over-exposed by turning up the gain to reveal signal for
the eDNA surrounding and in between bacterial cells. To
minimize flaring artifacts caused by the high gain, we
identified single isolated bacteria cells in multiple fields of
view, which did not appear to have associated eDNA
(identified by lack of signal). Using this iterative process, we
were able to differentiate signal from noise by frame
averaging, while maintaining a gain that resulted in sharply
defined edges to the signal optimized cells. The background (c)
was set to be at this minimum threshold for noise when all
signal was eliminated (i.e., gain turned to zero) where the
blue channel included signal from bacterial cells and eDNA.
Between two and six stacks were taken from between four
and seven independent replicate biofilm plates, providing an
n = 23 and n = 27 stacks per time point for the Pulmozyme
(DNase I)-treated samples and corresponding controls.

COMSTAT image analysis

Confocal image stacks for each sample, at each time point,
were analyzed using the LEICA LCS software, COMSTAT (16) Fig. 1 Temporal relative expression of agrB (a); alsS (b); cidA (c) genes
and IMARIS software (Bitplane; St. Paul, MN). COMSTAT in the biofilm.

416 Pathogens and Disease (2014), 70, 414422, 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
R. Grande et al. eDNA and carbohydrates in S. aureus biofilm

(bacteria + eDNA). The eDNA biomass was found by
subtracting the red channel (bacteria) from the blue channel.
Cell viability assays
Colony-forming unit (CFU) enumeration and in situ Live/
Dead staining were carried out to evaluate bacterial cell
viability in S. aureus biofilms at 72 h and were evaluated as
described (Hall-Stoodley et al., 2008). CFUs were deter-
mined by rinsing the biofilms and removing adherent cells
from an area of 9.6 cm2 with a cell scraper (Corning Life
Sciences, Pittsburgh, PA). Each sample was resuspended
in 2 mL HBSS, vortexed, diluted, plated on TSA, and
incubated at 37 C.
DNase I (Pulmozyme) treatment of preformed S. aureus
biofilms
S. aureus biofilms were grown as previously described for a
period of 72 h and rinsed three times with HBSS. DNase I
(Pulmozyme; 1 mg mL
1) or buffer alone was added to
biofilms on duplicate plates, incubated at 37 C for 90 min,
rinsed with HBSS, stained with BacLight kit and analysis
was performed by CLSM as previously described. Experi-
ments were performed in duplicate.
Statistical analysis
Statistical analysis of the variance was performed using the
ANOVA program (EXCEL 2000; Microsoft). Differences were
reported as statistically significant for P < 0.05.
Results
agrB, alsS, and cidA expression changes during biofilm
development
The expression of agrB, alsS, and cidA genes was evaluated
by qPCR at 2, 24, and 72 h of incubation in untreated
S. aureus biofilms to evaluate the expression of these genes

(a) (b)

(c) (d)

(e) (f)

Fig. 2 CLSM representative images of

biofilm development of DNase I-treated and
non-treated (control) S. aureus UAMS-1
samples stained with lectin cocktail (green)
and Syto 59 (red and blue) after 2, 24, and
72 h of incubation. Images are compressed
z series, where multiple xy planes from top
to bottom of the biofilm are combined.
DNase I-treated samples: (b) (2 h); (d)
(24 h); and (f) (72 h). Controls: (a) (2 h); (c)
(24 h); (e) (72 h). Scale bar = 47 lm.

Pathogens and Disease (2014), 70, 414422, 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved 417
eDNA and carbohydrates in S. aureus biofilm
as a function of time during biofilm development. The
expression of agrB initially increased by over a factor of 10
at 24 h and then significantly (P < 0.05) decreased by a
factor of over 10 000 at 72 h (Fig. 1a). In contrast, the
expression of both alsS and cidA steadily increased over time
to c. 20 and 90 fold, respectively, after 72 h (Fig. 1b and c).
S. aureus biofilm structure differed over time in
DNase-treated samples
Bacterial cells were adherent to the surface and exhibited no
difference in biofilm structure between control and DNase
I-treated samples following 2 h of incubation (Fig. 2a and b).
At 24 h, although there was a reduction in biomass (by
volume), the reduction in biomass was observed in both
untreated and DNase-treated samples (Fig. 2c and d).
However, differences in biofilm architecture between treated
and untreated samples were evident at both 24 and 72 h of
incubation (Fig. 2e and f). DNase I-treated samples con-
sisted of biofilms characterized by towers, heterogeneously
dispersed among voids with a few bacteria juxtaposed on a
background of carbohydrate visualized by bound lectin
(Fig. 2f). eDNA was detected both in untreated and treated
samples inside the biofilm (Fig. 3) with undigested eDNA
inside carbohydrates structures bound by lectins (Fig. 4c, d
and e), which may have protected it from DNase digestion.
The distribution of eDNA in both treated and untreated
biofilms was heterogeneous, as illustrated by comparing
Fig. 3a, which was in an area with relatively little eDNA
compared with the areas shown in Fig. 1.
COMSTAT analysis indicated that after 24 h, the number of
total cells, carbohydrate EPS, and eDNA biomass was not
(a) (b)
(c) (d)
418 Pathogens and Disease (2014), 70, 414422, 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
R. Grande et al.
statistically significant (P > 0.05) in DNase I-treated biofilm
cultures. However, biofilms grown in the presence of DNase
I had a significantly greater (P < 0.05) maximum thickness
and roughness coefficient (P < 0.05) compared with
untreated controls after 72 h (Fig. 5), indicating greater
surface heterogeneity. These data are consistent with the
visual inspection of the confocal images, which showed
greater heterogeneity in patchy tower formation in the
DNase I grown biofilms. Both biofilms showed a reduction
in biomass of c. 50% or greater between 2 and 24 h, with a
subsequent increase after 72 h.
DNase I (Pulmozyme) digestion on preformed biofilm
did not affect the concentration of viable S. aureus
biofilm cells
Assessment of biofilm CFU cm
2 together with in situ
viability assessment with the BacLight Live/Dead assay at
different time points demonstrated no significant differences
between controls (P > 0.05), and DNase I-treated samples
indicating that DNase I treatment alone did not adversely
affect cell viability, which was 7.0  0.9 CFU cm
2 and
6.6  0.6 CFU cm
2 in the control and DNase I-treated
biofilms, respectively, at 72 h.
Discussion
Biofilm formation results from a multistep process that is
regulated over time by several genes. Our data showed that
agrB gene expression originally increased by over tenfold at
24 h but then dramatically decreased from that level by over
10 000 fold at 72 h. The biofilm biomass (cells, EPS, and
Fig. 3 CLSM representative image of S.
aureus UAMS-1 control (DNase I
untreated) 24 h biofilm showing localized
carbohydrate and eDNA in the EPS. (a)
Lectin cocktail (green fluorescence) and (b,
c) Syto 59 (red and blue). Carbohydrates
are colored in green; bacterial cells in red
and eDNA plus cells in blue. (d) Overlay of
the three channels, the blue shadow
around the cells visualized the eDNA
released by the cells. Scale bar = 9 lm.
R. Grande et al.
(a)
(b) (c)
(d) (e)
Fig. 4 CLSM representative image of Staphylococcus aureus UAMS-1
biofilm treated with DNase I at 24 h of incubation. (a) Carbohydrate
structures (green) associated with clustered cells (red) and eDNA (blue).
Scale bar = 16 lm; (b, c, d) images represent the green, red, and blue
channels that detect carbohydrates, cells, and cells plus eDNA,
respectively. (e) Overlay of the three channels. Scale bar = 5 lm.
eDNA) was inversely correlated with agrB expression, as
expected as the agr operon regulates dispersal from biofilms
(Yarwood et al., 2004; Boles & Horswill, 2008). It was not
clear why the newly attached bacteria would initially exhibit
an increase in agr expression, which would suggest an
increase in secreted virulence factors, increased dispersal
and subsequent reduction in biomass at only 24 h,
particularly when increasing cidA and alsS expression
suggested that eDNA release was rising. Rather, the
expected response would be that after initial attachment,
planktonic bacteria would immediately begin the phenotypic
shift to the early-stage biofilm phenotype in which secreted
virulence factors would be suppressed while initiating the
process of matrix building and biofilm formation. However, it
is not uncommon to see a natural reduction in biomass after
Pathogens and Disease (2014), 70, 414422, 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
eDNA and carbohydrates in S. aureus biofilm
initial attachment, followed by a second phase of growth
(Kroukamp et al., 2010) with subsequent oscillations
between detachment and growth (Lewandowski et al.,
2007). It is thought that these oscillations occur due to
detachment caused by fluid shear, nutrient depletion, and
degradation at the base of the biofilm followed by regrowth,
but agrB expression data suggest that in S. aureus UAMS
the early oscillation might be part of a regulated develop-
ment. qPCR data correlated well with fluctuations in the
biofilm biomass, suggesting that it is not just the presence or
absence of agrB, that plays a role in the biofilm develop-
ment, but also the temporal expression of agr genes(Otto,
2001, 2008).
Studies using agr knockouts showed that agr is capable of
differentially affecting glucose-induced biofilm on polysty-
rene surfaces under static conditions (Vuong et al., 2000)
and occurs by two major functions of the agr system: (1)
repression of adhesin production thereby preventing attach-
ment to surface and (2) increased expression of d-hemol-
ysin, which via its detergent-like and protease function
negatively affects biofilm maturation. Significantly, the
presence of glucose represses the expression of agr and
generates a low pH, establishing an acidic environment
(Regassa & Betley, 1992; Regassa et al., 1992; ONeill
et al., 2008). This is in accordance with agrB expression,
which demonstrated a significant decrease coupled with an
increase in alsS expression over time. This gene belongs to
the bicistronic operon alsSD which encodes the enzymes
acetolactate synthase and acetolactate decarboxylase that
function collaboratively to convert pyruvate to 2-acetolactate
and then acetoin, the latter eventually being converted by
acetoin reductase to 2,3-butanediol. The production of
acetoin and 2,3-butanediol has been shown to be important
for acid tolerance in a number of bacterial species (Kovac-
ikova et al., 2005). When S. aureus is grown on glucose,
lactic acid is the end product of fermentation (Gardner &
Lascelles, 1962). Although our system was aerated, micro-
electrode studies have demonstrated that biofilms formed by
aerobic or facultative bacteria consume oxygen at the
periphery of the biofilm, leaving the inside of biofilm towers
microaerophilic or anaerobic with resulting localized build-up
of acid in the interior of biofilm clusters (Von Ohle et al.,
2010). It is possible that a similar mechanism may explain
the increased levels of alsS expression as the biofilm
developed. Our results are consistent with the observations
that alsS was expressed at higher levels when S. aureus
was subjected to mild acid treatment (Weinrick et al., 2004)
highlighting the adaptation pattern of S. aureus to persist
within a biofilm by surviving an acidic biofilm environment
associated with carbohydrate metabolism (Beenken et al.,
2004). Acid tolerance within the biofilm has also be shown to
be important in Streptococcus mutans (Kovacikova et al.,
2005; Welin-Neilands & Svensater, 2007), Vibrio cholerae
and in other biofilm forming pathogens, which either live in
an acid environment or generate low pH from fermentation
acids deeper in the biofilm where oxygen levels are low. The
localized production of acid and anaerobic conditions in
biofilms growing on indwelling devices such as orthopedic
implants, surgical sutures and meshes and intravascular
419
eDNA and carbohydrates in S. aureus biofilm
catheters may therefore have clinical relevance in terms of
antibiotic tolerance and resistance to host clearance. DNase
1 also has an optimal activity in a pH range of 6.57.0
(Yasuda et al., 2004), and pH gradients within the biofilm
might result in more effective eDNA degradation only on the
outer parts of the biofilm.
The increased expression of alsS gene over time is also in
accordance with the expression of cidA. The production of
acetoin, due to the expression of the als operon, is linked to
the control of apoptosis (Yang et al., 2006), and cidA
increases murein hydrolase activity contributing to bacterial
cell lysis, DNA release and biofilm development (Rice et al.,
2007). Despite the steady increased expression of cidA and
alsS, which suggest eDNA release increased during biofilm
formation, DNase I (Pulmozyme) treatment did not show
promise in disrupting S. aureus biofilms, as it did for
pneumococcal biofilms (Hall-Stoodley et al., 2008). Further-
more the results of the present study differ from those of
Rice et al., 2007 who showed that DNase I treatment
significantly decreased S. aureus UAMS-1 biofilms by
sixfold relative to untreated biofilm and may be due to the
different culture conditions used in this study. A possible
explanation of this discrepancy is the difference in glucose
and salt concentrations. We used a salt concentration of
1.1% to more closely represent physiological conditions
inside the body (isotonic saline is 0.9%) and approximate
the orthopedic environment, whereas Rice et al. (2007)
used 3.5%, which is more consistent with skin concentra-
tions. Salt concentration is important in S. aureus biofilms
and appears to stimulate biofilm growth (Whitchurch et al.,
2002; Steinberger & Holden, 2005; Allesen-Holm et al.,
2006). Moreover, the resistance of biofilm to degradation by
DNase I after an initial growth period (Weinrick et al., 2004)
420 Pathogens and Disease (2014), 70, 414422, 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
R. Grande et al.
Fig. 5 COMSTAT analysis of the temporal
behavior of S. aureus UAMS-1 treated with
DNase I and untreated biofilms in terms of
cell biomass, EPS biomass, eDNA
biomass, cells plus eDNA biomass, and
cells plus eDNA roughness. Each value
plotted is the mean of data from 27 image
stacks acquired randomly in three
independent experiments at 2, 24, and 72 h
of incubation.
suggests that eDNA in the biofilm was stabilized (Steinber-
ger & Holden, 2005) or protected by the other EPS
components such as carbohydrates. These conditions have
been previously demonstrated to inhibit the activity of
DNase I (Ramsey et al., 1993).
Taken with data from other studies, which have shown
that eDNA is important for the mechanical stability of
staphylococcal biofilms (Mann et al., 2009), our data sug-
gest that the relative contribution of eDNA to overall stability
may be growth and strain dependant and is consistent with
other studies demonstrating that although the biofilm matrix
contains significant amounts of eDNA, it is not necessarily
dispersed by DNase (Lappann et al., 2010; Grande et al.,
2011; Shields et al., 2013). However, we did find evidence
that eDNA plays a role in biofilm morphology. These data
agree with those of Tetz et al., 2009 who showed that
biofilm morphology was modified in the presence of DNase I
in seven different Gram-negative and Gram-positive species
including S. aureus, although the numbers of CFU remained
unchanged, and the biofilm biomass was reduced by 33
50% depending on the species. They concluded that the role
of eDNA in structure was not clear, but they did demonstrate
increased antibiotic efficacy with combined treatments,
consistent with other studies (Kaplan et al., 2012; Jakubov-
ics et al., 2013). While DNase I has been used to demon-
strate the role of eDNA in biofilm stability in staphyolococcal
biofilms, there are potential therapeutic applications for
treating infections. However, further studies are required to
assess the efficacy of DNase I to disrupt biofilms grown
from different strains, over longer time periods and under a
range of physiological glucose and salt concentrations.
Incubation times and concentrations also need to be
optimized.
R. Grande et al.
In our studies, we concluded that carbohydrates in the
EPS were also present and may have played an important
structural role. Carbohydrates and surface proteins involved
in adherence are known to be important in the EPS matrix
and biofilm establishment (Toledo-Arana et al., 2001;
Hall-Stoodley et al., 2008; Vergara-Irigaray et al., 2008).
Poly-b (1,6)-N-acetyl-D-glucosamine (PNAG) is a surface
polysaccharide involved in biofilm accumulation and evasion
of the host immune system in S. aureus and S. epidermidis
(Izano et al., 2008; Babra et al., 2013), and it has been
demonstrated that dispersin B, a PNAG-degrading enzyme,
was capable of detaching S. epidermidis biofilm, while
DNase I primarily affected S. aureus biofilms (Izano et al.,
2008). Our data suggest that multiple EPS components
need to be targeted to effectively disrupt biofilms.
In conclusion, our data support the hypothesis that biofilm
development is a multifactorial process associated with the
differential expression of genes over time during biofilm
development. Composition of the S. aureus biofilm matrix
appears to be complex. Subsequently, the addition of a
single degradative enzyme such as DNase I may not cause
sufficient disruption to S. aureus biofilms to have clinical
potential. However, treatment of S. aureus biofilm with a
mixture of DNase I and other enzymes, capable of digesting
biofilm carbohydrate polymers within the matrix, may be
more promising.
Authors contribution
P.S. and L.H.S. contributed equally to this work. L.N. and
K.S. contributed equally to this work.
References
Allesen-Holm M, Barken KB, Yang L, Klausen M, Webb JS,
Kjelleberg S, Molin S, Givskov M & Tolker-Nielsen T (2006) A
characterization of DNA release in Pseudomonas aeruginosa
cultures and biofilms. Mol Microbiol 59: 11141128.
Babra C, Tiwari J, Costantino P, Sunagar R, Isloor S, Hegde N &
Mukkur T (2013) Human methicillin-sensitive Staphylococcus
aureus biofilms: potential associations with antibiotic resistance
persistence and surface polysaccharide antigens. J Basic
Microbiol 2013 May 17. doi: 10.1002/jobm.201200557 [Epub
ahead of print].
Beenken KE, Dunman PM, McAleese F, Macapagal D, Murphy E,
Projan SJBlevins JS & Smeltzer MS (2004) Global gene expres-
sion in Staphylococcus aureus biofilms. J Bacteriol 186: 4665
4684.
Boles BR & Horswill AR (2008) agr-mediated dispersal of Staph-
ylococcus aureus biofilms. PLoS Pathog 4: e1000052.
Cho S, Kim KD, Ahn JH, Lee J, Kim SW & Um Y (2013) Selective
production of 2,3-butanediol and acetoin by a newly isolated
bacterium Klebsiella oxytoca M1. Appl Biochem Biotechnol 170:
19221933.
Fux CA, Costerton JW, Stewart PS & Stoodley P (2005) Survival
strategies of infectious biofilms. Trends Microbiol 13: 3440.
Gardner JF & Lascelles J (1962) The requirement for acetate of a
streptomycin-resistant strain of Staphylococcus aureus. J Gen
Microbiol 29: 157162.
Gillaspy AF, Hickmon SG, Skinner RA, Thomas JR, Nelson CL &
Smeltzer MS (1995) Role of the accessory gene regulator (agr) in
Pathogens and Disease (2014), 70, 414422, 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
eDNA and carbohydrates in S. aureus biofilm
pathogenesis of staphylococcal osteomyelitis. Infect Immun 63:
33733380.
Goerke C, Campana S, Bayer MG, Do ring G, Botzenhart K & Wolz
C (2000) Direct quantitative transcript analysis of the agr regulon
of Staphylococcus aureus during human infection in comparison
to the expression profile in vitro. Infect Immun 68: 13041311.
Grande R, Di Giulio M, Bessa LJ, Di Campli E, Baffoni M, Guarnieri
S & Cellini L (2011) Extracellular DNA in Helicobacter pylori
biofilm: a backstairs rumour. J Appl Microbiol 110: 490498.
Hall-Stoodley L, Nistico L, Sambanthamoorthy K et al. (2008)
Characterization of biofilm matrix, degradation by DNase treat-
ment and evidence of capsule downregulation in Streptococcus
pneumoniae clinical isolates. BMC Microbiol 8: 173.
Hall-Stoodley L, Stoodley P, Kathju S, Hiby N, Moser C, Costerton
JW, Moter A & Bjarnsholt T (2012) Towards diagnostic guidelines
for biofilm-associated infections. FEMS Immunol Med Microbiol
65: 127145.
Harmsen M, Lappann M, Knchel S & Molin S (2010) Role of
extracellular DNA during biofilm formation by Listeria monocyt-
ogenes. Appl Environ Microbiol 76: 22712279.
Heydorn A, Nielsen AT, Hentzer M, Sternberg C, Givskov M, Ersbll
BK & Molin S (2000) Quantification of biofilm structures by the
novel computer program COMSTAT. Microbiology 146: 23952407.
Izano EA, Amarante MA, Kher WB & Kaplan JB (2008) Differential
roles of poly-N-acetylglucosamine surface polysaccharide and
extracellular DNA in Staphylococcus aureus and Staphylococcus
epidermidis biofilms. Appl Environ Microbiol 74: 470476.
Jakubovics NS, Shields RC, Rajarajan N & Burgess JG (2013) Life
after death: the critical role of extracellular DNA in microbial
biofilms. Lett Appl Microbiol 57: 467475.
Kaplan JB, LoVetri K, Cardona ST, Madhyastha S, Sadovskaya I,
Jabbouri S & Izano EA (2012) Recombinant human DNase I
decreases biofilm and increases antimicrobial susceptibility in
staphylococci. J Antibiot 65: 7377.
Kovacikova G, Lin W & Skorupski K (2005) Dual regulation of genes
involved in acetoin biosynthesis and motility/biofilm formation by
the virulence activator AphA and the acetate-responsive LysR-type
regulator AlsR in Vibrio cholera. Mol Microbiol 57: 420433.
Kroukamp O, Dumitrache RG & Wolfaardt GM (2010) Pronounced
effect of the nature of the inoculum on biofilm development in flow
systems. Appl Environ Microbiol 76: 60256031.
Lappann M, Claus H, van Alen T, Harmsen M, Elias J, Molin S &
Vogel U (2010) A dual role of extracellular DNA during biofilm
formation of Neisseria meningitides. Mol Microbiol 75: 1355
1371.
Lewandowski Z, Beyenal H, Myers J & Stookey D (2007) The effect
of detachment on biofilm structure and activity: the oscillating
pattern of biofilm accumulation. Water Sci Technol 55: 429436.
Lim Y, Jana M, Luong TT & Lee CY (2004) Control of glucose- and
NaCl-induced biofilm formation by rbf in Staphylococcus aureus.
J Bacteriol 186: 722729.
Lovati AB, Drago L, Monti L, De Vecchi E, Previdi S, Banfi G &
Romano  CL (2013) Diabetic mouse model of orthopaedic
implant-related Staphylococcus aureus infection. PLoS One 8:
e67628.
Mann EE, Rice KC, Boles BR, Endres JL, Ranjit D, Chandramohan
L, Tsang LH & Smeltzer MS (2009) Horswill AR & Bayles KW
(2009) Modulation of eDNA release and degradation affects
Staphylococcus aureus biofilm maturation. PLoS One 4: e5822.
Manning AJ & Kuehn MJ (2013) Functional advantages conferred
by extracellular prokaryotic membrane vesicles. J Mol Microbiol
Biotechnol 23: 131141.
Moscoso M, Garca E, L opez R (2006) Biofilm formation by
Streptococcus pneumoniae: role of choline, extracellular DNA,
421
eDNA and carbohydrates in S. aureus biofilm
and capsular polysaccharide in microbial accretion. J Bacteriol
188(22): 778595.
Novick RP & Geisinger E (2008) Quorum sensing in staphylococci.
Annu Rev Genet 42: 541564.
Otto M (2001) Staphylococcus aureus and Staphylococcus epide-
rmidis peptide pheromones produced by the accessory gene
regulator agr system. Peptides 22: 16031608.
Otto M (2008) Staphylococcal biofilms. Curr Top Microbiol Immunol
322: 207228.
Papa R, Artini M, Cellini A, Tilotta M, Galano E, Pucci P, Amoresano
A & Selan L (2013) A new anti-infective strategy to reduce the
spreading of antibiotic resistance by the action on adhesion-med-
iated virulence factors in Staphylococcus aureus. Microb Pathog
63: 4453.
Ramsey BW, Astley SJ, Aitken ML et al. (1993) Efficacy and safety
of short-term administration of aerosolized recombinant human
deoxyribonuclease in patients with cystic fibrosis. Am Rev Respir
Dis 148: 145151.
Ranjit DK, Endres JL & Bayles KW (2011) Staphylococcus aureus
CidA and LrgA proteins exhibit holin-like properties. J Bacteriol
193: 24682476.
Regassa LB & Betley MJ (1992) Alkaline pH decreases expression
of the accessory gene regulator (agr) in Staphylococcus aureus. J
Bacteriol 174: 50955100.
Regassa LB, Novick RP & Betley MJ (1992) Glucose and nonmain-
tained pH decrease expression of the accessory gene regulator
(agr) in Staphylococcus aureus. Infect Immun 60: 33813388.
Renelli M, Matias V, Lo RY & Beveridge TJ (2004) DNA-containing
membrane vesicles of Pseudomonas aeruginosa PAO1 and their
genetic transformation potential. Microbiology 150: 21612169.
Renna MC, Najimudin N, Winik LR & Zahler SA (1993) Regulation
of the Bacillus subtilis, alsS, alsD, and alsR genes involved in
post-exponential-phase production of acetoin. J Bacteriol 175:
38633875.
Rice KC, Mann EE, Endres JL, Weiss EC, Cassat JE, Smeltzer MS
& Bayles KW (2007) The cidA murein hydrolase regulator
contributes to DNA release and biofilm development in Staphy-
lococcus aureus. P Natl Acad Sci USA 104: 81138118.
Sambanthamoorthy K, Smeltzer MS & Elasri MO (2006) Identifica-
tion and characterization of msa (SA1233), a gene involved in
expression of SarA and several virulence factors in Staphylococ-
cus aureus. Microbiology 152: 25592572.
Shields RC, Mokhtar N, Ford M, Hall MJ, Burgess JG, ElBadawey
MR & Jakubovics NS (2013) Efficacy of a marine bacterial
nuclease against biofilm forming microorganisms isolated from
chronic rhinosinusitis. PLoS One 8: e55339.
Smithies WR & Gibbons NE (1955) The deoxyribose nucleic acid
slime layer of some halophilic bacteria. Can J Microbiol 8: 614
621.
422 Pathogens and Disease (2014), 70, 414422, 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
R. Grande et al.
Steinberger RE & Holden PA (2005) Extracellular DNA in single-
and multiple-species unsaturated biofilms. Appl Environ Microbiol
71: 54045410.
Tetz GV, Artemenko NK & Tetz VV (2009) Effect of DNase and
antibiotics on biofilm characteristics. Antimicrob Agents Chemo-
ther 53: 12041209.
Toledo-Arana A, Valle J, Solano C, Arrizubieta MJ, Cucarella C,
Lamata M, Amorena B, Leiva J, Penade  s JR & Lasa I (2001) The
enterococcal surface protein, Esp, is involved in Enterococcus
faecalis biofilm formation. Appl Environ Microbiol 67: 45384545.
Vergara-Irigaray M, Maira-Litra n T, Merino N, Pier GB, Penade  s JR
& Lasa I (2008) Wall teichoic acids are dispensable for anchoring
the PNAG exopolysaccharide to the Staphylococcus aureus cell
surface. Microbiology 154: 865877.
Von Ohle C, Gieseke A, Nistico L, Decker EM, deBeer D & Stoodley
P (2010) Real-time microsensor measurement of local metabolic
activities in ex vivo dental biofilms exposed to sucrose and treated
with chlorhexidine. Appl Environ Microbiol 76: 23262334.
Vuong C, Saenz HL, Gotz F & Otto M (2000) Impact of the agr
quorum-sensing system on adherence to polystyrene in Staph-
ylococcus aureus. J Infect Dis 182: 16881693.
Webb JS, Lau M & Kjelleberg S (2004) Bacteriophage and
phenotypic variation in Pseudomonas aeruginosa biofilm devel-
opment. J Bacteriol 186: 80668073.
Weinrick B, Dunman PM, McAleese F, Murphy E, Projan SJ, Fang Y
& Novick RP (2004) Effect of mild acid on gene expression in
Staphylococcus aureus. J Bacteriol 186: 84078423.
Welin-Neilands J & Svensater G (2007) Acid tolerance of biofilm
cells of Streptococcus mutans. Appl Environ Microbiol 73: 5633
5638.
Whitchurch CB, Tolker-Nielsen T, Ragas PC & Mattick JS (2002)
Extracellular DNA required for bacterial biofilm formation. Science
295: 1487.
Yang SJ, Dunman PM, Projan SJ & Bayles KW (2006) Character-
ization of the Staphylococcus aureus CidR regulon: elucidation of
a novel role for acetoin metabolism in cell death and lysis. Mol
Microbiol 60: 458468.
Yarwood JM, Bartels DJ, Volper EM & Greenberg EP (2004)
Quorum sensing in Staphylococcus aureus biofilms. J Bacteriol
186: 18381850.
Yasuda T, Takeshita H, Iida R, Ueki M, Nakajima T, Kaneko Y, Mogi
K, Kominato Y & Kishi K (2004) A single amino acid substitution
can shift the optimum pH of DNase I for enzyme activity:
biochemical and molecular analysis of the piscine DNase I family.
Biochim Biophys Acta 1672: 174183.