Você está na página 1de 407

Arnaldo Zaha

Henrique Bunselmeyer Ferreira


Luciane M. P. Passaglia
organizadores

Biologia
Molecular
Bsica
B615 Biologia molecular bsica [recurso eletrnico] / Organizado-
res, Arnaldo Zaha, Henrique Bunselmeyer Ferreira,
Luciane M. P. Passaglia. 5. ed. Dados eletrnicos.
Porto Alegre : Artmed, 2014.

Editado tambm como livro impresso em 2014.


ISBN 978-85-8271-058-6

1. Biologia molecular. I. Zaha, Arnaldo. II. Ferreira,


Henrique Bunselmeyer. III. Passaglia, Luciane M. P.

CDU 577.2

Catalogao na publicao: Ana Paula M. Magnus CRB 10/2052

Zaha_5ed_Iniciais_eletronica.indd ii 22/01/14 08:33


Arnaldo Zaha
Henrique Bunselmeyer Ferreira
Luciane M. P. Passaglia
organizadores

Biologia
Molecular
Bsica
5 edio

Verso impressa
desta obra: 2014

2014

Zaha_5ed_Iniciais_eletronica.indd iii 22/01/14 08:33


Artmed Editora Ltda., 2014

Gerente editorial: Letcia Bispo de Lima

Colaboraram nesta edio:

Preparao de originais: Caroline Vieira, Carine Garcia Prates

Capa: Paola Manica

Imagem da capa:
iStockphoto.com/Theasis, 2010: Model of an Enhanceosome Protein Complex Binding to DNA
Modelo de um complexo proteico ligado ao reforador (enhancer)

Editorao eletrnica: Techbooks

Nota
Assim como a medicina, a biologia molecular uma cincia em constante evoluo. medida que novas pesqui-
sas e a prpria experincia clnica ampliam o nosso conhecimento, so necessrias modificaes na teraputica,
onde tambm se insere o uso de medicamentos. Os autores desta obra consultaram as fontes consideradas confi-
veis, num esforo para oferecer informaes completas e, geralmente, de acordo com os padres aceitos poca
da publicao. Entretanto, tendo em vista a possibilidade de falha humana ou de alteraes nas cincias mdicas,
os leitores devem confirmar estas informaes com outras fontes. Por exemplo, e em particular, os leitores so
aconselhados a conferir a bula completa de qualquer medicamento que pretendam administrar, para se certificar
de que a informao contida neste livro est correta e de que no houve alterao na dose recomendada nem nas
precaues e contraindicaes para o seu uso. Essa recomendao particularmente importante em relao a
medicamentos introduzidos recentemente no mercado farmacutico ou raramente utilizados.

Reservados todos os direitos de publicao


ARTMED EDITORA LTDA., uma empresa do GRUPO A EDUCAO S.A.
Av. Jernimo de Ornelas, 670 Santana
90040-340 Porto Alegre RS
Fone: (51) 3027-7000 Fax: (51) 3027-7070

proibida a duplicao ou reproduo deste volume, no todo ou em parte, sob quaisquer


formas ou por quaisquer meios (eletrnico, mecnico, gravao, fotocpia, distribuio na Web
e outros), sem permisso expressa da Editora.

Unidade So Paulo
Av. Embaixador Macedo Soares, 10.735 Pavilho 5 Cond. Espace Center
Vila Anastcio 05095-035 So Paulo SP
Fone: (11) 3665-1100 Fax: (11) 3667-1333

SAC 0800 703-3444 www.grupoa.com.br

IMPRESSO NO BRASIL
PRINTED IN BRAZIL

Zaha_5ed_Iniciais.indd iv 12/12/13 17:34


Autores

Arnaldo Zaha
Professor titular do Departamento de Biologia Molecular e Biotecnologia, Instituto de Biocincias e pesquisador
do Centro de Biotecnologia, da Universidade Federal do Rio Grande do Sul (UFRGS). Doutorado pelo Programa de
Ps-Graduao em Cincias Biolgicas (Bioqumica) do Instituto de Qumica da Universidade de So Paulo (USP).

Henrique Bunselmeyer Ferreira


Professor associado do Departamento de Biologia Molecular e Biotecnologia, Instituto de Biocincias e pesquisador do
Centro de Biotecnologia, da UFRGS. Doutorado pelo Programa de Ps-Graduao em Gentica e Biologia Molecular da
UFRGS. Ps-doutorado na Yeshiva University, Nova Iorque, Estados Unidos.

Luciane M. P. Passaglia
Professora associada do Departamento de Gentica, Instituto de Biocincias, da UFRGS. Doutorado pelo Programa
de Ps-Graduao em Gentica e Biologia Molecular da UFRGS. Ps-doutorado na University of California, Berkeley,
Estados Unidos.

Ana Tereza Ribeiro de Vasconcelos Augusto Schrank


Coordenadora do Laboratrio de Bioinformtica do La- Professor associado do Departamento de Biologia Mole-
boratrio Nacional de Computao Cientfica (LNCC/ cular e Biotecnologia, Instituto de Biocincias, e pesqui-
MCT), Petrpolis, RJ. Professora visitante da Universit sador do Centro de Biotecnologia da UFRGS. Doutorado
Claude Bernarde Lyon I, Lyon, Frana. Doutorado pelo pela University of Manchester Institute of Science and
Programa de Ps-Graduao em Cincias Biolgicas Technology (UMIST), Manchester, Inglaterra.
(Gentica) da Universidade Federal do Rio de Janeiro
(UFRJ). Ps-doutorado na University of Texas MD An-
derson Cancer Center, Houston, Estados Unidos.

Zaha_5ed_Iniciais.indd v 12/12/13 17:34


Autores vi

Charley Christian Staats Maria Lucia R. Rossetti


Professor do Departamento de Biologia Molecular e Bio- Professora adjunta da Universidade Luterana do Brasil.
tecnologia, Instituto de Biocincias e pesquisador do Pesquisadora do Centro de Desenvolvimento Cientfico e
Centro de Biotecnologia, UFRGS. Doutorado pelo Pro- Tecnolgico (CDCT), da Fundao Estadual de Produo
grama de Ps-Graduao em Biologia Celular e Molecular e Pesquisa em Sade (FEPPS). Doutorado pelo Programa
da UFRGS. de Ps-graduao em Cincias Biolgicas (Bioqumica)
da UFRGS. Ps-doutorado na Azienda Ospedaliera Uni-
versitaria Careggi, Firenze, Itlia.
Darcy Fontoura de Almeida
Professor titular emrito da UFRJ. Professor colabo-
rador voluntrio do Laboratrio de Bioinformtica do
Marilene Henning Vainstein
LNCC/MCT. Professor colaborador voluntrio da Casa de Professora associada do Departamento de Biologia Mole-
Oswaldo Cruz/Departamento de Arquivo e Documenta- cular e Biotecnologia, Instituto de Biocincias, e pesqui-
o da FIOCRUZ. sadora do Centro de Biotecnologia da UFRGS. Doutorado
pela University of Nottingham, Nottingham, Inglaterra.
Elgion Loreto
Professor associado do Departamento de Biologia da
Srgio Ceroni da Silva
Universidade Federal de Santa Maria (UFSM), RS. Dou- Professor adjunto do Departamento de Patologia Clnica
torado pelo Programa de Ps-Graduao em Gentica e Veterinria, Faculdade de Veterinria da UFRGS. Douto-
Biologia Molecular da UFRGS. rado pela Universidade de Glasgow, Glasgow, Esccia.

Irene Silveira Schrank Vera Lcia S. Valente Gaiesky


Professora associada do Departamento de Biologia Mole- Professora titular do Departamento de Gentica, Institu-
cular e Biotecnologia, Instituto de Biocincias, e pesqui- to de Biocincias, da UFRGS. Doutorado pelo Programa
sadora do Centro de Biotecnologia da UFRGS. Doutorado de Ps-Graduao em Gentica e Biologia Molecular da
pela UMIST, Manchester, Inglaterra. UFRGS.

Luiza Amaral de Castro


Ps-doutoranda PNPD/CAPES do Programa de Ps-Gra-
duao em Cincias Veterinrias da UFRGS. Doutorado
pelo Programa de Ps-Graduao em Gentica e Biologia
Molecular da UFRGS.

Zaha_5ed_Iniciais.indd vi 12/12/13 17:34


Apresentao

Esta obra deve ser saudada por sua importncia temtica, e mecanismos envolvidos na organizao molecular
qualidade e abrangncia. Trata-se de um livro de biolo- dos seres vivos. Os dois captulos finais do livro so
gia molecular escrito em uma linguagem clara e acessvel, bastante interessantes, fornecendo a base para a com-
que ser de grande utilidade no apenas para estudantes preenso das tcnicas bsicas de biologia molecular e
de graduao e aqueles que se preparam para ingresso na das ferramentas de bioinformtica para os modernos
ps-graduao, mas tambm para profissionais que alme- estudos de genmica. A preocupao com a didti-
jam reciclar-se nos conceitos da biologia molecular. Mesmo ca permeia toda a obra, motivo pelo qual h resumos
profissionais sem uma formao estrita em cincias biol- concluindo os temas abordados, permitindo ao leitor
gicas iro se beneficiar dos conhecimentos aqui apresen- atentar para os conceitos mais importantes a serem de-
tados, considerando o papel central da biologia molecular preendidos da leitura.
como instrumento para as atividades em todas as reas das
O fato de termos um livro de Biologia molecular b-
cincias biolgicas e grande parte das cincias mdicas.
sica escrito por autores brasileiros, pesquisadores de des-
Ao longo da obra, os conceitos so formulados de taque em suas reas de atuao e experientes professores
modo que o leitor poder avanar de acordo com o n- de biologia molecular proporciona um grande diferencial
vel de complexidade do contedo abordado. So apre- a esta obra, que o fato de os autores terem a vivncia
sentados de maneira bastante simples os conceitos mais para identificar as maiores dificuldades dos estudantes,
importantes da biologia moderna, e os conhecimentos os grandes beneficirios da leitura deste livro. Destina-
adquiridos permitem entender os mecanismos molecula- do queles que tm um primeiro contato com a biologia
res envolvendo clulas simples e organismos mais com- molecular, ela tambm ser til aos que desejam adquirir
plexos. Os principais termos tcnicos so definidos, com conhecimentos fundamentais em biologia molecular.
a nomenclatura em ingls apresentada entre parnteses,
estimulando o leitor a avanar para leituras mais apro-
fundadas em artigos de peridicos cientficos ou em li- Samuel Goldenberg
vros tcnicos mais avanados. Pesquisador titular do Instituto
Carlos Chagas/Fiocruz-Paran.
O livro est organizado em 17 captulos, nos quais Doutor em Cincias pela
so apresentados os fundamentos da clula, das ma- Universidade de Paris VII.
cromolculas que compem as clulas e dos processos

Zaha_5ed_Iniciais.indd vii 12/12/13 17:34


Prefcio

A primeira verso do livro Biologia molecular bsica, pu- resumo ao final de cada captulo, um glossrio e o Ma-
blicada em 1996, tinha como objetivo fundamental reunir terial Complementar online. O resumo e o glossrio, as-
o contedo elementar dessa rea do conhecimento em sim como o destaque de termos-chave ao longo do texto,
uma obra em lngua portuguesa objetivo esse que tem facilitam ao leitor o reconhecimento do contedo essen-
sido mantido desde ento. cial de cada tema abordado no livro. O contedo online
possibilita ao leitor o aprofundamento de vrios tpicos
Na biologia molecular, os ltimos 12 anos foram mar-
abordados no livro, inclusive com listas adicionais de lei-
cados por novidades tecnolgicas espetaculares, que au-
turas recomendadas.
mentaram muito os conhecimentos sobre como os genes
funcionam e como suas atividades esto integradas em Mesmo com a incluso dos temas mais atuais, esta
uma rede que permite o desenvolvimento e o funciona- nova edio continua a apresentar, em todos os seus
mento correto de um organismo completo, seja ele uma captulos, os fundamentos de cada um dos temas abor-
bactria, um vegetal ou um animal. Graas ao desenvol- dados. No houve a pretenso de incluir contedo de
vimento e aplicao de novas tecnologias, milhares de complexidade alm daquela passvel de ser aproveitada
organismos, incluindo o homem, tiveram o genoma com- por leitores que tero, no livro, o seu primeiro contato
pletamente sequenciado, e hoje termos como genmica, com uma obra especificamente dedicada biologia mo-
transcritmica e protemica fazem parte do dia a dia dos lecular. Ele , portanto, indicado para estudantes e pro-
pesquisadores, professores, estudantes e interessados na fissionais que procuram contedos bsicos e que esto
rea de biologia molecular. iniciando o contato com a literatura cientfica original
Para acompanhar todos esses avanos, esta 5 edio de biologia molecular, do ensino pesquisa bsica ou
do livro Biologia molecular bsica foi elaborada por uma aplicada.
equipe de 14 autores, em parceria com a Artmed Editora. Esperamos que esta 5 edio contribua para o en-
Ela inclui, alm de todas as reformulaes da 4 edio, tendimento dos conceitos fundamentais da biologia mo-
que tornaram o livro mais didtico, um captulo que foi lecular e estimule o leitor a interessar-se mais por esta
totalmente reescrito (Captulo 11), agora intitulado Me- rea to dinmica e fascinante da biologia.
canismos de processamento e maturao de RNA. Esta
nova edio conta com um projeto grfico atraente e in-
clui aspectos que auxiliam na aprendizagem, como um Os organizadores

Zaha_5ed_Iniciais.indd ix 12/12/13 17:34


Sumrio

1 A Clula e seus Constituintes Moleculares . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1


Maria Lucia R. Rossetti

2 Estrutura dos cidos Nucleicos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17


Augusto Schrank

3 Cromatina. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .37
Henrique Bunselmeyer Ferreira

4 Genes e Genomas Procariticos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57


Henrique Bunselmeyer Ferreira

5 Genes e Genomas Eucariticos. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .85


Henrique Bunselmeyer Ferreira

6 Replicao do DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111


Irene Silveira Schrank

7 Mutao e Reparao do DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 133


Luciane M. P. Passaglia

8 Recombinao Gentica . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 163


Luciane M. P. Passaglia

9 Elementos Genticos Mveis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 185


Elgion Loreto | Henrique Bunselmeyer Ferreira

Zaha_5ed_Iniciais.indd xi 12/12/13 17:34


Sumrio xii

10 Transcrio. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 205
Augusto Schrank

11 Mecanismos de Processamento e Maturao de RNA. . . . . . . . . . . . . . . . . . . . . . . . .233


Charley Christian Staats

12 Cdigo Gentico e Sntese de Protenas . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .255


Irene Silveira Schrank | Marilene Henning Vainstein

13 Controle da Expresso Gnica em Procariotos. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .277


Srgio Ceroni da Silva | Irene Silveira Schrank | Luiza Amaral de Castro

14 Controle da Expresso Gnica em Eucariotos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .301


Arnaldo Zaha

15 Biologia Molecular do Desenvolvimento . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 319


Vera Lcia S. Valente Gaiesky

16 Tcnicas de Biologia Molecular . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 331


Luciane M. P. Passaglia | Arnaldo Zaha

17 Bioinformtica na Anlise de Genes e Genomas . . . . . . . . . . . . . . . . . . . . . . . . . . . . 363


Ana Tereza Ribeiro de Vasconcelos | Darcy Fontoura de Almeida

Glossrio . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 383
ndice . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .395

Zaha_5ed_Iniciais.indd xii 12/12/13 17:34


Captulo 1

Maria Lucia R. Rossetti

A Clula e seus
Constituintes
Moleculares

1. Estruturas celulares 2 2.2 Carboidratos 9


1.1 Clulas de procariotos e eucariotos 3 2.3 Lipdeos 10
1.2 Organelas 4 2.3.1 cidos graxos 10
2.3.2 Fosfoacilgliceris 12
2. Constituintes moleculares 4 2.3.3 Esteroides 12
2.1 Aminocidos e protenas 4 2.4 cidos nucleicos 13
2.1.1 Estrutura tridimensional da 2.4.1 cido desoxirribonucleico 14
protena 8 2.4.2 cido ribonucleico 14

Zaha_5ed_01.indd 1 27/11/13 10:27


Biologia Molecular Bsica 2

Todos os organismos vivos so constitudos de peque- zadas todas as funes necessrias manuteno e pre-
nas estruturas denominadas clulas. Essas estruturas, servao da vida, foram feitas por Robert Hooke, em 1665.
que representam a menor unidade de vida, so bastante Todas as clulas, independentemente da complexidade do
complexas e diversas, sendo que nelas esto contidas as organismo, possuem uma mesma estrutura formada pela
caractersticas morfolgicas e fisiolgicas dos organismos membrana plasmtica, que circunda o contedo celu-
vivos. As propriedades de um determinado organismo lar e o separa do meio extracelular pelo citosol e pelo n-
dependem de suas clulas individuais, cuja continuidade cleo (ou nucleoide). A Figura 1.1 representa uma clula
ocorre por meio de seu material gentico. A forma mais eucaritica e suas principais estruturas. O citosol todo o
simples de vida ocorre em clulas isoladas, que se propa- volume interno celular, composto por uma soluo aquo-
gam por diviso celular. J os organismos superiores, sa complexa com vrias partculas e molculas dispersas.
como o prprio homem, so constitudos de agregados O tamanho e a forma da clula variam muito e no tm
celulares que desempenham funes especializadas. nenhuma relao com o tamanho do organismo. Algumas
clulas vivem isoladas, como os organismos unicelu-
As clulas de diferentes organismos so muito simi- lares, porm as dos organismos pluricelulares, em
lares quanto estrutura e a constituintes moleculares, geral, se relacionam umas com as outras.
apesar das diferenas organizacionais fundamentais
existentes. Ao analisar os constituintes moleculares, A membrana celular plasmtica, que circunda todas
importante considerar no apenas as propriedades indi- as clulas, formada basicamente por uma dupla camada
viduais das molculas, como tambm as interaes exis- de lipdeos da classe dos fosfolipdeos e, em quantida-
tentes entre elas e a sua localizao dentro da clula. Essa des variveis, se associada com molculas proteicas (ver
anlise ainda mais necessria quando se considera um Figura 1.1). O limite entre o meio intracelular e extracelu-
organismo multicelular e os eventos que ocorrem em seu lar definido pela membrana plasmtica. Para entrar ou
interior, a fim de produzir a diferenciao e o desenvolvi- sair de uma clula, uma substncia deve transpor a mem-
mento desse organismo. Assim, este captulo busca for- brana celular; portanto, isso depender da permeabili-
necer, uma breve reviso sobre a estrutura celular, seus dade da membrana. Essa bicamada lipdica permevel
constituintes moleculares e as interaes realizadas por a certos gases, como O2 e CO2, e impermevel a muitas
esses compostos. substncias, como acar, aminocidos e ons inorgni-
cos (K+ e Cl-). A gua pode difundir-se livremente atra-
vs da clula. Muitas protenas esto ligadas membrana
plasmtica (permeases ou transportadoras), formando
canais na bicamada lipdica e facilitando a passagem de
1. Estruturas celulares certas substncias. Dessa forma, todas as clulas, de to-
As primeiras observaes e a prpria denominao de dos os organismos, possuem caractersticas estruturais
clulas para as unidades estruturais, nas quais so reali- comuns, como a arquitetura de suas membranas e muitos

Citosol Ncleo
Figura 1.1
Representao esquemtica de Membrana
uma clula animal (clula de eu- plasmtica
carioto) com suas principais es- Cromossomos
truturas e organelas celulares. Complexo
de Golgi
As caractersticas principais so a
presena de um ncleo bem definido, Lisossomo
Centrolos
que contm o genoma, e das organe-
las celulares, que compartimentali- Nuclolo
zam determinadas funes. Em des- Retculo
taque, diferentes tipos celulares. endoplasmtico
Mitocndria
Ribossomos
Membrana
celular

Exemplos de diferentes clulas


Clula Clula Clula Clula de tecido
epitelial muscular nervosa conectivo

Zaha_5ed_01.indd 2 27/11/13 10:27


3 A Clula e seus Constituintes Moleculares
processos metablicos, at a replicao de DNA, a sntese
proteica e a produo de energia qumica. Material gentico
Ribossomo (nucleoide)

1.1 Clulas de procariotos e eucariotos


Apesar da similaridade existente entre as clulas que
constituem os seres vivos, os organismos mantm dife-
renas fundamentais em nvel celular, podendo ser clas-
sificados em dois grandes grupos: os procariotos e os Parede celular Membrana citoplasmtica
eucariotos. Os organismos procariotos so unicelula-
res e mais simples em sua organizao, embora possam Figura 1.2
ocorrer associados a grupos, formando colnias com al-
guma diferenciao de funes. Os procariotos incluem Representao esquemtica da orga-
nizao de uma clula de procarioto.
as bactrias e as arqueas (bactrias que sobrevivem
O nucleoide composto pelo genoma no est
em ambientes no usuais, como lagos salinos, piscinas delimitado por uma membrana. Presena de
trmicas e pntanos). Os organismos eucariotos so mais uma parede celular.
complexos e incluem no somente plantas pluricelulares,
animais e fungos, mas tambm protozorios e alguns or-
ganismos unicelulares, como leveduras e algas verdes.
tideoglicano). A parede celular dos vegetais contm
A Tabela 1.1 compara as principais caractersticas celulose e outros polmeros. Clulas de fungos tambm
celulares dos organismos procariotos e eucariotos, possi- esto circundadas por uma parede celular de composio
bilitando, ento, evidenciar as semelhanas e as diferen- diferente das de vegetais e bactrias. As bactrias gram-
as existentes. -negativas possuem, ainda, uma membrana externa, que
A principal diferena entre procariotos e eucariotos circunda a parede celular. Essa parede celular perme-
que, nos eucariotos, encontram-se organelas, princi- vel a muitas substncias qumicas com peso molecular
palmente o ncleo, que contm o genoma. As organelas superior a 1 kDa. Dentro da membrana plasmtica, est
so regies delimitadas por membranas internas, que o citoplasma, constitudo pelo citosol componente
formam compartimentos, nos quais se realizam funes aquoso. O citoplasma de clulas eucariticas difere do
especializadas. Nos procariotos, a ausncia de envoltrio citoplasma de clulas procariticas pela presena das
nuclear deixa o genoma em contato direto com o restante organelas e de protenas filamentosas, que constituem
do citoplasma, em um espao dentro da clula denomina- o chamado citoesqueleto. Entre essas protenas esto
do nucleoide, ficando junto de ribossomos, outras par- os filamentos de actina e os microtbulos, envolvidos na
tculas e uma grande variedade de molculas dissolvidas gerao de movimentos celulares, na determinao da
(Figura 1.2). forma celular e na capacidade de arranjar as organelas.

As clulas de procariotos possuem, normalmente, Outra diferena fundamental observada entre proca-
alm da membrana plasmtica, uma parede celular, cuja riotos e eucariotos em relao ao material gentico. A
funo proporcionar maior rigidez e proteo mecnica. informao gentica de organismos procariticos apre-
Essa membrana tambm est presente em clulas eucari- senta-se, geralmente, em uma ou mais molculas circu-
ticas vegetais. A composio qumica da parede celular lares de DNA. As bactrias so conhecidas por possurem
de procariotos bastante complexa, contendo molculas um nico cromossomo. O arranjo de genes, dentro des-
de polissacardeos, lipdeos e protenas (camada de pep- se cromossomo, difere muito do arranjo em um cromos-

Tabela 1.1 Principais caractersticas celulares de procariotos e de eucariotos


Procariotos Eucariotos

Organizao Principalmente unicelular Principalmente pluricelular


Membrana citoplasmtica Bicamada fosfolipdica; rara presena de Bicamada fosfolipdica; presena de esterois e
esterois carboidratos
Ncle0 Ausente Definido pela membrana nuclear
Citoplasma Sem citoesqueleto Citoesqueleto constitudo
Motilidade Flagelos simples Flagelos complexos; pseudpodes; outros rgos de
locomoo mais complexos
Organelas Poucas ou nenhuma Presentes: lisossomos, complexo de Golgi, retculo
endoplasmtico (RE), mitocndria e cloroplastos
Parede celular Contm glicopeptdeos, lipdeos, Quando presente, contm quitina ou celulose
protenas

Zaha_5ed_01.indd 3 27/11/13 10:27


Biologia Molecular Bsica 4

somo de clulas eucariticas. Nas clulas eucariticas, o crotbulos constitudos de protenas filamentosas, de-
DNA nuclear dividido em dois ou mais um desses cro- nominado citoesqueleto. Essa estrutura responsvel
mossomos. Cada um desses cromossomos formado por por manter a forma da clula e auxiliar nos movimentos
uma molcula de DNA linear que, exceto durante a divi- celulares.
so celular, est confinada dentro do ncleo. Essas mol-
culas de DNA esto associadas a protenas, chamadas de
histonas, formando os nucleossomos, componentes
da cromatina. O nmero e o tamanho dos cromossomos 2. Constituintes moleculares
individuais variam muito entre os diferentes organismos
eucariticos. Os fungos, por exemplo, possuem de 12 a Os constituintes moleculares so responsveis pelas in-
18 cromossomos; clulas humanas contm dois conjun- teraes bioqumicas entre milhares de molculas que
tos de 23 cromossomos, cada um tem aproximadamente permitem a vida celular. Essas reaes qumicas acon-
trinta vezes a quantidade de DNA presente em uma clula tecem em meio aquoso, por isso, a gua, com poucas
da bactria Escherichia coli. Uma descrio mais detalha- excees (clula ssea), o componente encontrado em
da sobre o tema ser feita nos Captulos 4 e 5. maior quantidade na clula, sendo indispensvel para a
atividade metablica. A gua, devido a sua natureza po-
O DNA no encontrado apenas no ncleo, mas lar, serve como solvente natural para ons, minerais e ou-
tambm na mitocndria das clulas de animais, plantas tras substncias e, tambm, como meio de disperso para
e fungos e no cloroplasto das plantas. Essa uma das evi- a estrutura coloidal do citoplasma. A presena de ons,
dncias que sugere a evoluo dessas organelas a partir como Cl-, Na+ e K+, importante para manter a presso
de bactrias que sofreram endocitose por clulas an- osmtica e o equilbrio acidobsico da clula. Alguns ons
cestrais. O DNA dessas organelas contm genes que co- inorgnicos, como o magnsio, so necessrios na fun-
dificam protenas especficas para o funcionamento da o de cofatores enzimticos. Outros, como o fosfato
prpria organela. inorgnico, formam adenosina trifosfato (ATP), principal
fonte de energia qumica dos processos vitais e os ons
1.2 Organelas clcio desempenham um papel regulador.

Existem organelas comuns a todas as clulas eucariticas Alm da gua e dos elementos qumicos citados, a
(ver Figura 1.1), sendo talvez o ncleo a mais importante clula constituda por pequenas molculas e macromo-
dessas organelas. O ncleo envolto por uma membrana lculas. As pequenas molculas, como aminocidos, nu-
nuclear dupla, que possui como caracterstica, alm da cleotdeos, lipdeos e acares constituem os substratos e
cromatina, uma regio rica em RNA, denominada nu- os produtos de vias metablicas, fornecendo energia para
clolo. No nuclolo, os RNAs so sintetizados a partir de a clula e podendo, tambm, ser as unidades formadoras
um molde de DNA e, posteriormente, exportados para o das macromolculas. Nessa estrutura de polmero biol-
citoplasma atravs da membrana nuclear. A mitocn- gico, essas molculas so chamadas de monmeros ou
dria, outra importante organela, possui enzimas espe- resduos.
cializadas em processos oxidativos que produzem energia As clulas so constitudas, basicamente, por trs ti-
para a clula. Alm disso, o DNA e os ribossomos tambm pos de polmeros: cidos nucleicos formados pelos
so encontrados no interior da mitocndria. nucleotdeos (monmero); protenas constitudas
O retculo endoplasmtico uma estrutura for- pelos aminocidos; e carboidratos ou polissacardeos
mada por membranas distribudas por todo o citoplasma cujos monmeros so os acares ou monossacardeos.
e ligadas tanto membrana celular como membrana As clulas possuem uma grande quantidade de lipdeos
nuclear. O RE granuloso possui ribossomos ligados s que, diferentes dos demais, no so polmeros, sendo, de
suas membranas, que constituem a maquinaria molecu- preferncia, molculas pequenas. O lipdeo mais simples
lar para a sntese proteica. e abundante o cido graxo, que participa da compo-
sio de outras molculas de lipdeos mais complexas,
J o complexo de Golgi uma estrutura formada como os triacilgliceris. As estruturas maiores, como a
por membranas e vesculas, envolvido na modificao e bicamada das membranas biolgicas e as fibras do citoes-
na secreo de protenas das clulas. queleto, so formadas pela associao dessas macromo-
Existem organelas especficas para clulas vegetais lculas.
e animais. As clulas animais, por exemplo, contm li-
sossomos com a funo de digesto, e as clulas vegetais
2.1 Aminocidos e protenas
possuem cloroplastos, local onde se realiza a fotossn-
tese. Outra caracterstica, comum maioria das clulas As protenas resultam da expresso da informao conti-
vegetais e a alguns microrganismos, a presena de va- da no gene. Por isso, o gene que determinar a sequn-
colo, cuja funo a estocagem de nutrientes e metab- cia de aminocidos de uma protena especfica. Assim,
litos. Cada organela possui uma coleo prpria de enzi- toda protena possui uma ordem definida de resduos de
mas catalizadoras de reaes especficas, desenvolvendo aminocidos, que, por sua vez, estabelece sua estrutura
um papel nico no crescimento e no metabolismo celular. tridimensional ativa, denominada conformao nati-
As organelas celulares esto ligadas a uma rede de mi- va (Figura 1.3). A estrutura tridimensional da molcula,

Zaha_5ed_01.indd 4 27/11/13 10:27


5 A Clula e seus Constituintes Moleculares
no caso do retrovrus, cujo genoma de RNA serve de
molde para uma molcula de DNA. Alguns retrovrus
possuem genes causadores de cncer (oncogenes), ca-
Vrus: Parasitas celulares
pazes de transformar a clula infectada em uma clula
Tanto as clulas eucariticas como as procariticas tumoral. As alteraes celulares causadas pela presen-
podem ser infectadas por partculas virais muito a de um vrus variam bastante, desde simples para-
pequenas, que esto distribudas na natureza. Essas sitas sem nenhum efeito, at altamente patognicos,
partculas no celulares variam quanto forma e como, por exemplo, os que causam Aids, hepatites e
complexidade estrutural e, geralmente, so formadas cncer em seres humanos. Os vrus tambm possuem
por uma partcula central (core) de nucleoprote- importncia no controle biolgico e como ferramenta
nas, envolta por um capsdeo composto de uma ou de pesquisa.
mais protenas (Figura Q.1). Alguns vrus tambm
possuem uma membrana lipoproteica envolvendo o
capsdeo (envelope viral). O genoma viral pode ser de Protena

DNA ou RNA, mas no de ambos. A replicao viral


ocorre somente em clulas vivas, devido incapacida-
Material
de gentica de replicao de forma autnoma. A maio- gentico
ria dos vrus de DNA de plantas e animais necessita
de enzimas nucleares das clulas hospedeiras para Capsdeo
realizar a transcrio de mRNA e, assim, a sntese de
protenas virais. Em geral, os vrus de DNA replicam e Envelope
agrupam-se no ncleo e os de RNA agrupam-se no ci-
Protena Partcula central
toplasma. Os vrus mais simples contm RNA ou DNA (core)
suficiente para codificar quatro protenas; os mais
complexos podem codificar de 100 a 200 protenas. Figura Q.1
A maioria dos vrus infecta um nmero limitado Desenho esquemtico representati-
de clulas, determinado pelo tipo de protena presente vo da organizao de uma partcula
na superfcie viral, que se ligar especificamente a viral. O material gentico do vrus est
protenas receptoras da clula hospedeira. Os vrus envolto por uma camada proteica (cap-
sdeo) e por um envelope formado por
que infectam bactrias so conhecidos como bacte-
uma dupla camada de fosfoacilgliceris
rifagos ou fagos. O genoma de alguns vrus pode e protenas, que reconhecem receptores
ser integrado ao genoma da clula hospedeira, como celulares.

estabelecida conforme a prpria sequncia de aminoci- da e compactada, com formato globular; abundantes e
dos, pode ser observada em experimentos de desnatura- essenciais, elas podem ser encontradas em quaisquer
o de uma determinada protena. As alteraes em sua organismos. Um exemplo so as enzimas, eficientes ca-
forma natural (nativa), por mudanas nas condies do talisadores biolgicos que aceleram as reaes qumicas.
meio (alteraes de pH, temperatura, adio de solven- Com exceo de alguns RNAs (ribozimas), que possuem
tes) onde se encontra a protena, com consequente perda atividade cataltica, todas as enzimas so protenas. Toda
de sua funo biolgica, podem, algumas vezes, serem protena globular tem uma estrutura nica, enovelada de
recuperadas. O restabelecimento da conformao nati- forma especfica e de acordo com a funo particular a ser
va a renaturao proteica pode ocorrer quando executada.
as condies do meio em que a molcula se encontra so
J que a estrutura de uma protena determina a sua
restabelecidas, possibilitando que os aminocidos voltem
funo, importante conhecer as caractersticas estrutu-
a interagir. O enrolamento de uma protena globular
rais dessa molcula. As protenas so cadeias longas de
um processo energeticamente favorvel, sob condies fi-
aminocidos e constituem mais da metade do peso seco
siolgicas, que permite as interaes entre os grupamen-
de uma clula. Elas tambm so polmeros que desempe-
tos qumicos.
nham inmeras funes biolgicas, alm de determina-
As protenas so classificadas em duas classes princi- rem a forma e a estrutura da clula. As protenas so, ain-
pais: fibrosas e globulares. As protenas fibrosas, em da, conhecidas como molculas que realizam o trabalho
sua maioria, desenvolvem um papel estrutural nas clulas celular. Elas catalisam um extraordinrio nmero de rea-
e nos tecidos animais. Nessa classe esto o colgeno, com- es qumicas, controlam a permeabilidade das membra-
ponente dos ossos e do tecido conectivo, e a -queratina, nas, regulam a concentrao de metablitos, reconhecem
presente em unhas e cabelo. As protenas globulares so e ligam no covalentemente outras biomolculas, propor-
assim chamadas por possurem uma estrutura enovela- cionam movimento e controlam a funo gnica. Todo

Zaha_5ed_01.indd 5 27/11/13 10:27


Biologia Molecular Bsica 6

DNA
Figura 1.3 5' 3'
Esquema de sntese de uma protena globular a 3' 5'
partir da informao contida no DNA e transcrita
Transcrio do DNA
no RNA. A estrutura tridimensional funcional (protena
(sntese de RNA)
nativa) ser determinada pela sequncia de aminocidos.
RNA
5' 3'

Cdons Sntese de protena


Protena
H2N COOH
Aminocidos

Conformao nativa

Protena globular

esse diverso nmero de funes realizado por protenas aminocidos (molculas anfteras). O carter acidob-
constitudas por apenas 20 aminocidos, entre todos os sico, bem como a carga eltrica do aminocido, deter-
aminocidos possveis, unidos por ligaes peptdicas. minado pelo pH do meio onde ele se encontra.
Como a conformao nativa, que permite protena As cadeias laterais dos aminocidos variam em tama-
realizar as suas funes, uma consequncia das proprie- nho, forma, carga eltrica, hidrofobicidade e reatividade.
dades individuais caractersticas dos aminocidos pre- Os aminocidos com cadeias laterais polares so hidro-
sentes na molcula proteica, importante revisar essas flicos e tendem a se localizar na superfcie da protena,
propriedades. Os aminocidos so assim chamados por devido a suas interaes com a gua. Alm disso, quanto
serem cidos orgnicos, que possuem um tomo de car- mais aminocidos polares estiverem presentes na pro-
bono (C) ligado a quatro grupamentos qumicos dife- tena, mais solvel em solues aquosas ela ser, porm
rentes. Um grupamento amnico (-NH2), um grupamen- os aminocidos com grupamentos R apolares, por serem
to carboxlico (-COOH), um tomo de hidrognio (-H) e hidrofbicos, tendem a estar presentes no interior das
um grupamento varivel, so denominados cadeia lateral protenas e provocarem sua insolubilidade em gua. Na
ou radical (-R). A Figura 1.4 apresenta a estrutura de Figura 1.4, est representada a estrutura dos vinte ami-
todos os vinte aminocidos conhecidos. Observando essa nocidos em pH fisiolgico (prximo de 7), que foram
estrutura, possvel verificar que o grupamento R de- classificados conforme a solubilidade em gua. A solubili-
termina as diferenas estruturais entre os aminocidos. dade varia com a polaridade de seus grupamentos R.
Com exceo da glicina, que possui um tomo de hidro- No grupo dos polares, arginina e lisina (polares bsi-
gnio tambm no radical, todos os demais aminocidos cos) so carregadas positivamente, e glutamato e asparta-
possuem quatro grupamentos diferentes ligados ao C, to (polares cidos) so carregados negativamente, esses
dando origem a um carbono assimtrico. A presena des- quatro aminocidos so os principais responsveis pelas
se carbono assimtrico gera duas molculas de imagem cargas das protenas. A histidina, que tambm tem carga
especular no superpostas (estereoismeros), deno- positiva, auxilia na manuteno do pH (tampo fisiol-
minadas, por conveno, ismero D (dextro) e L (levo). gico), pela sua capacidade de captar ou liberar prtons
Com raras excees, apenas os aminocidos de forma por meio do grupamento imidazol presente no radical.
L so encontrados nas protenas. Em pH fisiolgico, os Pertencendo classe dos aminocidos polares neutros, a
grupamentos amnico e carboxlico dos aminocidos so cistena pode reagir com outros resduos de cistena por
ionizados (NH3+ e COO-), fazendo com que o aminoci- meio do grupamento tiol (SH), presente no radical para
do tenha cargas positiva e negativa na mesma molcula formar pontes dissulfeto (SS) em uma reao de oxi-
(molcula dipolar). A presena simultnea desses gru- dao. Esta ligao tem uma participao importante na
pamentos determina o comportamento acidobsico dos conformao das protenas.

Zaha_5ed_01.indd 6 27/11/13 10:27


Zaha_5ed_01.indd 7
Apolares (Hidrofbicos)


COO COO COO COO COO COO COO COO COO
+ + + + + + + + +
H3N C H H3N C H H3N C H H3N C H H3N C H H3N C H H2N C H H3N C H H3N C H
H CH3 CH CH2 CH CH2 H2C CH2 CH2
H3C CH3 H2C CH3 CH2
Glicina Alanina CH CH2 H2C C
(Gly) (Ala) Valina H3C CH3 CH3
HC
S Prolina
(Val) Leucina Isoleucina (Pro) HN
CH3
(Leu) (Ile)
Metionina Fenilalanina Triptofano
(Met) (Phe) (Trp)

Polares (Hidroflicos)

Polares com carga Polares com


Polares sem carga negativa (cidos) carga positiva (Bsicos)


COO COO COO COO COO COO COO COO
+ + + + + + + +
H3N C H H3N C H H3N C H H3N C H H3N C H H3N C H H3N C H H3N C H
CH2OH H C OH CH2 CH2 CH2 CH2 CH2 CH2

Senna CH3 SH COO CH2 CH2 CH2 C
NH
(Ser) HC
Treonina Cistena Asparagina COO CH2 CH2
+ CH
(Thr) (Cys) (Asn) HN
Glutamina CH2 NH
(Gln) + Histidina
COO COO COO NH3 C
+ (His)
+ + + H2N NH2
H3N C H H3N C H H3N C H
Lisina Arginina
CH2 CH2 CH2
(Lys) (Arg)
C CH2
H2N O
C
Aspartato H2N O
(Asp)
Glutamato
OH
(Glu)
Tirosina
(Tyr)

Figura 1.4
Representao da estrutura qumica dos 20 aminocidos que compem as protenas. A parte da estrutura apresentada em igual para todos.
A parte representada pelo radical (R) a que diferencia os aminocidos. Nesta figura, eles esto separados conforme as suas caractersticas de polaridade.

7 A Clula e seus Constituintes Moleculares

27/11/13 10:27
Biologia Molecular Bsica 8

Os aminocidos com cadeias laterais hidrofbicas mas delas, quando envolvidas em reaes de oxirreduo,
so quase insolveis em gua, consequncia da presena s possuem atividade quando ligadas covalentemente a
de hidrocarbonetos nestes grupamentos. A fenilalanina, o uma coenzima (grupo prosttico), como a nicotinamida
+
triptofano e a tirosina possuem grupamentos aromticos, adenina dinucleotdeo (NAD ), cuja estrutura formada
responsveis pela caracterstica de absoro de luz ultra- por um anel de nicotinamida, um anel de adenina e dois
violeta das protenas no comprimento de onda de 280 grupos de acares fosfatados unidos.
nm. Prolina um aminocido especial, uma vez que a sua
cadeia lateral est ligada covalentemente ao nitrognio 2.1.1 Estrutura tridimensional da protena
do grupamento amnico, formando um anel rgido. A pre-
A formao de uma cadeia polipeptdica, consideran-
sena da prolina em uma cadeia proteica pode restringir
do a polimerizao correta dos aminocidos, realizada
a forma como a molcula ir se enovelar.
no processo de traduo e determinada pela informao
Durante a sntese da molcula proteica, os amino- contida no RNA mensageiro (mRNA). A cadeia proteica
cidos vo se unindo por uma ligao covalente (ligao sintetizada assume uma organizao espacial precisa e
peptdica) entre o grupamento carboxlico de um amino- necessria, para que a protena desempenhe a sua funo
cido com o grupamento amnico de outro aminocido, (conformao nativa). A estrutura tridimensional de
ligados por uma reao de desidratao, com a perda de uma protena a combinao de vrios fatores, princi-
uma molcula de gua. A molcula formada gera um pep- palmente de interaes entre os grupamentos qumicos
tdeo e mantm o seu carter anftero, j que sempre fi- presentes nessa protena e de limitaes estereoqumi-
car um grupamento carboxlico livre em uma extremida- cas impostas pela prpria ligao peptdica, devido ao
de (C-terminal) e um grupamento amnico livre na outra carter de ressonncia hdrica. Essa ressonncia impede
extremidade (N-terminal) (ver Figura 1.5). A combina- a rotao do carbono ligado ao nitrognio, deixando to-
o de apenas dois aminocidos forma um dipeptdeo; a dos os tomos envolvidos na ligao peptdica no mesmo
unio de poucos aminocidos d origem a oligopeptdeos. plano (ver Figura 1.5). As protenas so analisadas con-
Um polipeptdeo formado por muitos aminocidos siderando os quatro nveis de organizao estrutural. A
(s vezes, um nmero superior a 1.000). Figura 1.6 esquematiza esses nveis, do menor ao maior
grau de complexidade, exemplificados pela estrutura pri-
A sequncia de uma cadeia proteica , por conven-
mria e quaternria, respectivamente.
o, escrita com a extremidade N-terminal esquerda e
a C-terminal direta. O tamanho de uma protena , em A estrutura primria a primeira etapa na especi-
geral, expresso pela sua massa em daltons (Da). Existem ficao da anlise estrutural de uma protena e refere-se
tambm protenas conjugadas, essencialmente impor- sequncia de aminocidos, ou seja, a ordem na qual os
tantes que, para realizarem sua atividade celular, ne- aminocidos esto ligados para formar uma cadeia pep-
cessitam estar ligadas a outras molculas no proteicas, tdica (Figura 1.6A). Nesta estrutura tambm esto loca-
os denominados grupos prostticos. A essa categoria lizadas as ligaes peptdicas e as pontes SS formadas
pertencem as nucleoprotenas, as lipoprotenas e as cro- entre os resduos de cistena. So as ligaes peptdicas
moprotenas. As enzimas formam uma importante classe que estabilizam este tipo de estrutura. Cada protena pos-
de protenas que catalisa todas as reaes qumicas. Algu- sui a sua estrutura primria especfica, que, por sua vez,

Ligao peptdica

N-terminal C-terminal

H CH3 H O CH3
H H H O
O O
N C C N C C H2O
N C C N C C
OH
H OH H OH H
H H H H H
H2O
Ligao peptdica

Glicina Alanina Dipeptdeo

Figura 1.5
Desenho esquemtico da formao de um peptdeo por meio da ligao entre o grupamento carboxli-
co de um aminocido e o grupamento amnico de outro (ligao peptdica).

Zaha_5ed_01.indd 8 27/11/13 10:27


9 A Clula e seus Constituintes Moleculares
A B C D
Figura 1.6
C
P
VK ES T V O L RR AMO A S L R M L I

Desenho da estrutura tridimensional


V IO GI E O RTIKIOMGDPH TMAD
NLA FLDV T GRIA OTL LNL AKO

N de uma protena com os diferentes

C
CS R ETVGRILKMLE DON

nveis organizacionais. As estruturas


Folha -pregueada esto dispostas do nvel menos complexo
de organizao para o mais complexo. (A)
estrutura primria; (B) estruturas secund-
rias; (C) estrutura terciria; (D) estrutura
-hlice
G

quaternria.

determina a estrutura tridimensional. A importncia bio- mantida por pontes de hidrognio entre grupos pept-
lgica da sequncia de aminocidos bem exemplificada dicos no envolvidos na estrutura secundria, por pontes
na enfermidade hereditria humana, chamada de doena de hidrognio entre grupos R, por interaes hidrofbi-
das clulas falciformes. Nessa doena, ocorrem mudan- cas, por ligaes inicas entre grupos carregados positiva
as biolgicas profundas, provocadas pela substituio de e negativamente e por ligaes covalentes do tipo dissul-
um nico aminocido na molcula de hemoglobina (ver feto (SS) (Figura 1.6C). Nas protenas globulares, as ca-
Captulo 7). deias laterais dos aminocidos mais hidrofbicos tendem
a se agregar no interior da molcula, e os grupamentos
A estrutura secundria se refere aos diversos
hidroflicos se sobressaem da superfcie da protena. A es-
arranjos espaciais de aminocidos prximos na cadeia
trutura tridimensional final pode ser composta pela com-
peptdica central, que provocam dobramentos. Tais do-
binao especfica de estruturas secundrias, -hlices,
bramentos so denominados estruturas secundrias.
Esses arranjos podem apresentar uma organizao que folhas entre outras, que se enovelam, formando unida-
se repete em intervalos regulares. As organizaes de es- des globulares dobradas de forma compacta, chamadas
truturas secundrias mais comuns so a -hlice, a folha de domnios. A estrutura terciria de protenas maiores
-pregueada e as curvaturas (Figura 1.6B). As -hlices, subdividida em domnios, esses domnios possuem em
em que a cadeia peptdica se enrola em torno de um eixo torno de 100 a 150 aminocidos e esto unidos pela ca-
imaginrio, so estabilizadas por pontes de hidrognio deia peptdica.
formadas entre o grupamento amnicos da ligao pep- Protenas com mais de um polipeptdeo, formando
tdica de um aminocido e o grupamento carboxlico da subunidades (protenas multimricas), apresentam mais
ligao peptdica do aminocido situado quatro res- um nvel estrutural, a estrutura quaternria (Figura
duos adiante na mesma cadeia polipeptdica. As folhas 1.6D). Essa estrutura refere-se disposio das subuni-
-pregueadas ocorrem quando os aminocidos assumem dades proteicas que formam a molcula. O nmero de su-
a conformao de uma folha pregueada. A folha es- bunidades pode variar e a unio entre elas ocorre de for-
tabilizada pela formao de pontes de hidrognio entre ma no covalente, por meio de interaes eletrostticas,
os grupamentos amnicos e carboxlico de cadeias poli- pontes de hidrognio e hidrofbicas. Algumas protenas,
peptdicas vizinhas, em vez de ocorrer dentro da pr- chamadas de alostricas, exibem um efeito cooperativo
pria cadeia, como o caso das -hlices. As curvaturas entre as subunidades, de forma que uma alterao em
geralmente ocorrem na superfcie da protena, formando uma dessas subunidades pode resultar em uma modifi-
dobras definidas que redirecionam a cadeia. Essas cur- cao em outra subunidade. Um bom exemplo a mol-
vaturas so compostas por trs a quatro resduos, e um cula de hemoglobina, molcula tetramrica, composta de
deles prolina. Essas dobraduras permitem a compacta- quatro cadeias polipeptdicas formando as subunidades.
o de protenas volumosas. Existem tambm, segmen- Cada subunidade se liga a uma molcula de oxignio de
tos na protena que no fazem ligaes transversais no forma cooperativa, ou seja, depois que uma molcula de
covalentes, formando configuraes menos organizadas. oxignio ligada a uma subunidade, a ligao das demais
Um polipeptdeo pode ser composto por um nico tipo de molculas facilitada.
estrutura secundria, como no caso da -queratina, que
composta apenas por -hlices, ou, ainda, a protena
pode possuir vrios tipos de estruturas secundrias na 2.2 Carboidratos
mesma cadeia, como o caso do citocromo C.
Os carboidratos, ou monossacardeos, so acares sim-
A estrutura terciria refere-se forma como a ples e representam uma das grandes classes de molcu-
cadeia polipeptdica est enovelada, incluindo o arranjo las biolgicas com uma variedade de funes celulares.
tridimensional de todos os tomos da molcula, inclusi- Os polissacardeos so polmeros com longas cadeias de
ve os da cadeia lateral e do grupo prosttico. Este nvel unidades de monossacardeos e constituem a principal
estrutural estabelecido quando diferentes estruturas se- fonte de energia celular. Eles so, tambm, constituintes
cundrias se dispem entre si. A estabilidade da estrutura estruturais importantes da parede celular, atuando como

Zaha_5ed_01.indd 9 27/11/13 10:27


Biologia Molecular Bsica 10

sinais de reconhecimento especfico e desempenhando Os oligossacardeos so molculas formadas, na


um papel informacional. Alm disso, so tambm subs- sua maioria, pela ligao de poucas unidades mono-
tncias intercelulares com funo estrutural. mricas. Um exemplo a sacarose, um dissacardeo
formado pela unio de uma molcula de glicose e uma
Os carboidratos so formados por ligaes covalen-
de frutose que, aps processado, produz o acar co-
tes de carbono, em uma relao 1:1, e gua (CH2O)n, em
mum utilizado na alimentao (Figura 1.8). Os polis-
que n pode ser de 3 a 7. Eles so classificados de acordo
sacardeos mais importantes nos organismos vivos so
com o nmero de tomos de carbono presentes na mo-
o amido e o glicognio, pois representam substncias
lcula: trioses (3), pentoses (5) ou hexoses (6). Todos os
de reserva, ou seja, a forma de estocagem de energia
monossacardeos podem conter vrios grupamentos hi-
nas clulas vegetais e animais. O glicognio um po-
droxlicos e um grupamento aldedico ou cetnico. Esses
lissacardeo formado pela ligao de vrias molculas
dois grupamentos podem reagir com um grupamento hi-
de glicose (ver Figura 1.9). A celulose tambm um
droxlico na mesma molcula, por meio de uma reao
importante polissacardeo e o principal elemento es-
hemiacetal ou hemicetal, convertendo a estrutura linear
trutural da parede celular da clula vegetal.
para uma com formato de anel. O tipo de anel gerado
ser decorrente da ligao e de qual hidroxila se ligar Os dissacardeos, assim como os polissacardeos, so
com a carbonila. Um exemplo a D-glicose, fonte prim- formados por monossacardeos, unidos covalentemente
ria de energia para a maioria das clulas. A estrutura da por ligaes glicosdicas. Essas ligaes so formadas
D-glicose pode se apresentar como uma cadeia linear ou quando um grupamento hidroxlico do carbono ano-
como um anel hemiacetal, com duas estruturas diferentes mrico de um carboidrato reage com o grupamento
(Figura 1.7). Quando o grupamento aldedico do carbo- hidroxlico de outro carboidrato (ver Figura 1.8). Esses
no 1 reage com o grupamento hidroxlico do carbono 5, o grupamentos hidroxlicos livres podem, ainda, ligar-se
anel resultante possui 6 elementos, gerando uma D-glico- com outros grupamentos amnico, sulfato e fosfato de di-
piranose. Se a ligao hemiacetal ocorrer com o carbono ferentes molculas, formando molculas mais complexas,
4, a estrutura uma D-glicofuranose, cuja presena na como os glicosaminoglicanos, principais componentes da
natureza muito mais rara. Todos os monossacardeos, matriz extracelular.
exceto a dihidroxiacetona, contm um ou mais carbonos
assimtricos gerando estereoismeros oticamente ativos
(D e L). A ciclizao da estrutura linear gera novos is-
2.3 Lipdeos
meros, denominados anmeros , por estarem ligados ao Os lipdeos formam um grupo de compostos caracters-
carbono anomrico. tico, que possuem mltiplas funes celulares e ocorrem
com frequncia na natureza. Geralmente, so molculas
pequenas que apresentam uma forte tendncia a se as-
sociarem por meio de foras no covalentes, formando
agregados lipdicos. Os lipdeos so, em geral, caracte-
Glicose
rizados por um tipo de estrutura prpria, conforme
mostrado na Figura 1.10A para os cidos graxos. Uma
H
OH molcula de cido graxo possui duas regies distintas:
1 C
6
CH2OH uma regio polar, hidroflica, conectada a uma regio
apolar, hidrofbica, constituda de uma cadeia de hidro-
H C OH 5
O carboneto. Esse tipo de estrutura caracteriza os lipdeos
2
1
como um grupo de compostos pouco solveis em gua
4
OH e solveis em solventes orgnicos. Essa caracterstica
HO C H
3 3 2
molecular promove as associaes do tipo anfipticas
OH OH
H C OH reunies das molculas lipdicas com interaes no
4
OH covalentes em meio aquoso. Essas interaes possuem
H C OH consequncias considerveis em nvel celular, a mais
5

Forma cclica importante delas a tendncia de os lipdeos formarem


H C OH micelas e bicamadas, que constituem as membranas bio-
6
lgicas (ver Figura 1.10B e C). A estrutura exata, formada
H quando o lipdeo est em contato com a gua, depende
da estrutura molecular especfica das regies hidroflicas
Forma linear e hidrofbicas da molcula. A seguir, alguns dos princi-
pais lipdeos celulares.
Figura 1.7
Estrutura linear e cclica da gli- 2.3.1 cidos graxos
cose. A forma cclica resultante da
ligao entre a carbonila do carbono Os lipdeos mais simples so os cidos graxos, tambm
1 e a hidroxila do carbono 6, gerando constituintes dos lipdeos mais complexos. Sua estrutura
uma glicopiranose. bsica exemplifica a maioria das molculas de lipdeos

Zaha_5ed_01.indd 10 27/11/13 10:27


11 A Clula e seus Constituintes Moleculares
-Glicose Frutose
Figura 1.8
CH2OH
CH2OH Estrutura qumica do dissacardeo sacarose. A
H O H O H sacarose formada pela ligao glicosdica entre uma
H molcula de glicose e uma molcula de frutose.
+
OH H H HO
HO OH OH CH2OH
OH H
H OH

Sacarose
CH2OH
CH2OH
H O H O H
H
OH H H HO
HO O CH2OH
OH H
H OH
+

H2O Ligao glicosdica

Ligao 1,6

Ligao 1,4

Glicognio

6 6 6
HOCH2 HOCH2 HOCH2
H O H H O H H O H
4
H 1 4 H 1 4 H 1
OH H O OH H OH H O
HO O

H OH H OH H OH 6
CH2
6 6 6 6
HOCH2 HOCH2 HOCH2 HOCH2
H O H H O H H O H H O H H O H
H H H H H
4 1 4 1 4 1 4 1 4 1
OH H OH H OH H OH H OH H
O O O O O R

H OH H OH H OH H OH H OH

Figura 1.9
Desenho da estrutura polimrica do glicognio. O glicognio um polmero ramificado de
monmeros de glicose unidos por ligaes glicosdicas, que ocorrem entre os carbonos 1 e 4, exceto
onde a molcula se ramifica (1 e 6). A zona correspondente ao crculo mostrada ampliada.

Zaha_5ed_01.indd 11 27/11/13 10:27


Biologia Molecular Bsica 12

A Cabea B Figura 1.10


Hidroflica
polar Desenho esquemtico de uma estru-
tura de lipdeos (A) e formas de as-
C
A Micela sociaes anfipticas (B). A associa-
U o em bicamadas (C) a base molecular
D das membranas.
A Hidrofbica
A
P
O
L
A
R
C
Estrutura geral de lipdeo

Bicamada

encontrada em grande quantidade nas clulas humanas. 2.3.2 Fosfoacilgliceris


A estrutura do cido graxo formada por uma longa ca-
deia hidrocarbonada, hidrofbica e pouco reativa qui- Os fosfoacilgliceris, ou fosfolipdeos, so pequenas
molculas lipdicas, compostas por longas cadeias de cido
micamente. Em geral, os cidos graxos encontrados nos
graxo e glicerol, ligadas a um grupo altamente polar (Figura
organismos vivos contm um nmero par de tomos de
1.11B). Eles diferem dos triacilgliceris por possurem ape-
carbono, e sua cadeia de hidrocarboneto no ramifica-
nas duas molculas de cidos graxos unidas a uma molcula
da. Os cidos graxos so classificados em saturados, in-
de glicerol, cuja terceira hidroxila est esterificada a um ci-
saturados ou poli-insaturados, dependendo das ligaes
do fosfrico (cido fosfatdico). Esse fosfato pode estar uni-
entre os tomos de carbono. Nos cidos graxos satura-
do a uma molcula hidroflica (colina, etanolamina, inositol
dos, a cadeia contm apenas ligaes simples, se existi-
ou serina), conforme o tipo de fosfoacil. A natureza anfipti-
rem ligaes duplas, os cidos graxos so insaturados. Os ca dos fosfoacigliceris responsvel pelas associaes mo-
cidos graxos com mais do que uma ligao dupla so leculares, que formam a membrana celular e conferem mui-
chamados de poli-insaturados. Dois cidos graxos poli- tas das suas propriedades. As membranas so basicamente
-insaturados, classificados como essenciais, so o cido duas camadas de fosfoacilgliceris dispostas de forma que
linoleico, com 18 carbonos e duas ligaes duplas, e o as regies hidrofbicas ficam voltadas para o interior e as
linolnico, tambm com 18 carbonos, porm com trs regies hidroflicas situadas nas interfaces aquosas. Esse ar-
ligaes duplas. ranjo em bicamada a unidade estrutural de quase todas as
A molcula de cido graxo formada por um grupa- membranas biolgicas. O ncleo hidrofbico da estrutura
mento carboxlico extremamente hidroflico, ionizvel atua como uma barreira de impermeabilidade.
em soluo (COO-). Eles formam molculas de triacilgli-
cerois (triglicerdeos), que so tristeres de cido graxo e 2.3.3 Esteroides
glicerol (ver Figura 1.11A), conhecidos como gorduras. Os esteroides so um grande grupo de molculas, que
Os triacilgliceris so a forma de estocagem de lipdeos agregam vrias funes, e incluem um considervel n-
no citoplasma de muitas clulas, pois, devido presen- mero de hormnios, entre eles os hormnios sexuais de
a da cadeia carbonada, servem como excelente fonte animais superiores. O colesterol o esteroide de maior
de energia. Dessa forma, os triacilgliceris so mais efi- importncia, fazendo parte de membranas de clulas,
cientes como estoque de energia que os carboidratos e, principalmente de animais (Figura 1.11C). Os esteroides
por essa razo, muito utilizados por vrios organismos, derivam de uma estrutura geral que contm 3 anis de
incluindo os animais superiores. 6 carbonos (anis A, B e C) e um anel com 5 tomos. A

Zaha_5ed_01.indd 12 27/11/13 10:27


13 A Clula e seus Constituintes Moleculares
A C
CH3

H O
CH-CH2-CH2-CH2-CH-CH3
H C O C
H3C
O CH3

H C O C

O
H3C
H C O C

Triacilglicerol
HO
CH3
B CH3 CH3
N Colesterol
CH2

CH2
O
O
P O
O
CH2 CH CH2
O O
C O C O
CH2 CH2
CH2 CH2

CH
CH
CH2 CH2
CH2 CH2
CH3 CH3
Fosfoacilglicerol

Figura 1.11
Desenho da arquitetura molecular de lipdeos. (A) Triacilglicerol; (B) Fosfoacilglicerol; (C) Colesterol.

molcula de colesterol pouco anfiptica, pois existe um Existem dois tipos de cidos nucleicos: cido de-
grupamento hidroxlico localizado no final da molcula soxirribonucleico (DNA) e cido ribonucleico (RNA).
(ver Figura 1.11C). O restante da molcula de colesterol Ambos so polmeros lineares de nucleotdeos, unidos
solvel no interior hidrofbico das membranas. Os anis por ligaes fosfodister. O nmero de monmeros em
cicloexanos fusionados dessa molcula formam uma es- uma molcula de cido nucleico , na maioria dos ca-
trutura bastante rgida e sua presena na membrana ten- sos, muito maior que o nmero de aminocidos em uma
de a romper a regularidade da estrutura, conferindo-lhe protena. Os RNAs variam em tamanho, podendo ter de
maior rigidez. Essa estrutura compacta tambm res- dez a milhares de nucleotdeos. Tanto o DNA como o
ponsvel pelos efeitos danosos sade, como a ateroscle- RNA consistem em apenas quatro diferentes tipos de
rose doena cardiovascular provocada pelo armazena- nucleotdeos.
mento de colesterol nos vasos sanguneos. Cada nucleotdeo composto por um grupamento
fosfato, um acar (pentose) e uma base nitrogenada (p-
2.4 cidos nucleicos rica ou pirimdica) unidos por ligaes covalentes (ver Fi-
gura 2.1 do Captulo 2). As diferenas entre os dois cidos
Os cidos nucleicos so macromolculas de grande im- nucleicos residem no tipo de acar e na composio de
portncia biolgica em todos os organismos vivos. A partir bases da molcula. No RNA, a pentose sempre a ribo-
dos cidos nucleicos as clulas recebem as informaes so- se e, no DNA, a desoxirribose. As bases que formam os
bre quais protenas sintetizar, qual a sequncia de amino- cidos so cinco: adenina (A), guanina (G) e citosina (C),
cidos de sua estrutura e qual a funo dessas molculas. encontradas tanto no DNA como no RNA; a base timina
Eles so, portanto, as molculas que estocam e transmitem (T) presente apenas no DNA, e a base uracila (U), apenas
a informao gentica na clula. Toda essa informao fica no RNA (ver Figura 2.2 do Captulo 2). Essas letras (A,
em unidades gnicas, localizadas nos cromossomos das c- C, G, T e U) so utilizadas para indicar uma sequncia
lulas. Tal informao decifrada por meio do cdigo gen- de nucleotdeos em um cido nucleico. Alm dessas cinco
tico, cuja traduo resulta na sntese proteica. bases, existem bases no usuais com estrutura um pouco

Zaha_5ed_01.indd 13 27/11/13 10:27


Biologia Molecular Bsica 14

diferenciada, que ocorrem principalmente no RNA, como composio de bases, principalmente sua duplicao na
a hipoxantina e a inosina. clula. O modelo da estrutura da molcula do DNA est
ilustrado na Figura 2.4, no Captulo 2. O DNA com-
O acar faz a ligao entre a base e o grupamento
posto de duas cadeias polinucleotdicas associadas, que
fosfato. Conforme mostrado na Figura 2.3 do Captulo
se enrolam para formar uma hlice dupla em torno de
2, a ligao entre o C 1 do acar e o N 9 da purina
um eixo central com giro para a direita, na maioria das
ou N 1 da pirimidina. O grupamento hidroxlico do C
vezes. As bases esto no interior da hlice, em um pla-
5 do acar substitudo por um grupamento fosfato.
no perpendicular ao eixo helicoidal, interagindo atravs
A combinao de uma base e um acar, sem o grupa-
de pontes de hidrognio que unem as duas cadeias. As
mento fosfato, constitui um nucleosdeo. Quando nu-
pontes de hidrognio, entre as bases de cadeias opostas,
cleotdeos polimerizam-se para formar um cido nu-
e as interaes hidrofbicas, entre as bases adjacentes
cleico, o grupamento hidroxlico ligado ao C 3 do acar na mesma cadeia, estabilizam essa estrutura. Uma vez
de um nucleotdeo forma uma ligao ster com o fos- que, entre os dois acares das cadeias opostas existe
fato de outro (ligao fosfodister), eliminando, assim, uma distncia fixa, apenas alguns pares de bases po-
uma molcula de gua e formando um esqueleto de uni- dem acomodar-se dentro da estrutura. Assim, os nicos
dades repetidas de fostatopentose com as bases ligadas pares possveis so A/T e C/G. importante notar que
ao grupamento lateral. entre A e T h formao de duas pontes de hidrognio e
Uma sequncia de nucleotdeos possui uma orienta- entre C e G, trs pontes; em consequncia disso, o par
o qumica de muita importncia. Em uma fita de DNA C/G mais estvel que o par A/T. Alm dessas pontes de
ou RNA, em uma das extremidades, h um grupamento hidrognio, ainda existem interaes hidrofbicas que
fosfato ligado ao C 5 (carbono 5') do acar (extremidade estabilizam a hlice dupla. A orientao das duas fitas
5') e na outra extremidade h um agrupamento hidrox- de DNA antiparalela, ou seja, o sentido 5' 3' de cada
lico ligado ao C 3 (carbono 3') do acar (extremidade 3') uma oposto ao da outra.
(ver Figura 2.3 do Captulo 2). Convencionou-se escrever
e ler a sequncia nucleotdica da esquerda para a direita, 2.4.2 cido ribonucleico
no sentido 5' 3'. A cadeia polinucleotdica possui indi- O cido ribonucleico (RNA) uma molcula de cido
vidualidade, determinada pela sequncia de suas bases, nucleico formada, em geral, por uma nica cadeia com
conhecida como estrutura primria e nessa estrutura grande diversidade de conformaes. A sequncia de ba-
primria que a informao gentica est contida. O gene ses (estrutura primria) similar do DNA, exceto pela
corresponde a uma sequncia particular de DNA, codifi- substituio da desoxirribose por ribose e de timina por
cadora de uma informao (protena ou RNA). uracila. Existem trs classes principais de cido ribonu-
cleico: RNA mensageiro (mRNA), que contm a infor-
2.4.1 cido desoxirribonucleico mao gentica para a sequncia de aminocidos; RNA
O cido desoxirribonucleico (DNA) encontra-se nos or- transportador (tRNA), que identifica e transporta as mo-
ganismos vivos como molculas, de alto peso molecular, lculas de aminocidos at o ribossomo; e RNA riboss-
por exemplo, E. coli que tem uma s molcula de DNA mico (rRNA), que representa 50% da massa dos ribosso-
circular de 4,2 x 106 pb (pares de bases) e um comprimen- mos. O ribossomo proporciona as condies moleculares
to total de 1,4 mm. A quantidade de DNA nos organismos para a sntese dos polipeptdeos. Todos os tipos de RNAs
superiores pode ser centenas de vezes maior (700 vezes intervm na sntese proteica. A estrutura e a funo dos
no caso do homem); o DNA de uma s clula diploide RNAs sero detalhadas nos Captulos 2 e 12.
humana, completamente estendido, pode ter um compri- Ainda que a molcula de RNA seja constituda por
mento de 1,7 m. apenas uma cadeia polinucleotdica, sua estrutura no
Toda a informao gentica de um organismo est simples. As molculas de RNA possuem regies onde
acumulada na sequncia linear das quatro bases. A es- as bases so complementares, nas quais se estabelecem
trutura primria de todas as protenas (quantidade e se- pontes de hidrognio entre pares A/U e G/C de diferen-
quncia dos 20 aminocidos) deve estar codificada por tes regies da mesma molcula. Como consequncia
um alfabeto de quatro letras (A, T, G e C). Entre 1949 dessas interaes, a molcula se volta sobre si mesma,
e 1953, Chargaff, estudando a composio de bases do formando estruturas caractersticas, chamadas de gram-
DNA, demonstrou que embora a composio variasse de pos e alas. Nas regies pareadas, a molcula se adapta
em uma estrutura helicoidal, semelhante a do DNA. A
uma espcie para outra, em todos os casos a quantidade
estrutura compacta das molculas de RNA tem impor-
de adenina era igual de timina (AT), e a de citosina era
tantes consequncias biolgicas. As diferenas de tama-
igual de guanina (CG). Assim, o nmero total de purinas
nho e conformaes dos vrios tipos de RNA permitem
era igual ao de pirimidinas (A+G C+T). Por outro lado, a
que eles desempenhem funes especficas. Os tRNAs
relao AT/GC variava, de forma considervel, entre as
possuem uma estrutura conformacional que permite o
espcies.
pareamento dos nucleotdeos do anticdon presentes na
Em 1953, com base em dados de difrao por raios molcula com os nucleotdeos do cdon do mRNA (ver
X, Watson e Crick propuseram um modelo para a estru- Captulo 12). Alguns RNAs, denominados ribozimas, tm
tura do DNA. Esse modelo explicava as regularidades da atividade cataltica.

Zaha_5ed_01.indd 14 27/11/13 10:27


15 A Clula e seus Constituintes Moleculares
Resumo
Apesar da grande diversidade existente entre os orga- gados atravs da ligao peptdica; e os carboidratos
nismos, todos so constitudos por pequenas unidades ou polissacardeos cujos monmeros so os acares
morfolgicas, denominadas clulas, separadas do ligados por ligao glicosdica. As clulas ainda pos-
meio externo por uma membrana citoplasmtica. Os suem uma grande quantidade de lipdeos que so, pre-
organismos podem ser classificados em dois grandes ferencialmente, molculas pequenas, como os cidos
grupos, conforme a sua organizao celular. Os orga- graxos, apresentando como caracterstica principal
nismos eucariticos possuem um ncleo delimitado serem praticamente insolveis em gua. A estrutura
por uma membrana que envolve o material gentico e geral de um lipdeo de uma molcula anfiptica com
a compartimentalizao de vrias de suas funes em uma cauda apolar e uma cabea polar. Esse tipo de es-
organelas. Os organismos procariticos so estrutu- trutura responsvel pelas interaes no covalentes
ralmente mais simples, em geral, unicelulares e o seu realizadas pelos fosfolipdeos para formarem a dupla
cromossomo est condensado no nucleoide, porm, camada que origina as membranas celulares. As pro-
sem estar envolvido por uma membrana. A vida celu- tenas so sintetizadas no organismo conforme a in-
lar depende de milhares de interaes qumicas reali- formao contida nos genes que constituem o genoma.
zadas por molculas que so comuns a todo tipo celu- O gene corresponde a um segmento de cido desoxir-
lar. A gua o componente encontrado em maior ribonucleico (DNA), que transcrito em diferentes ti-
quantidade na clula e serve como solvente natural pos de cidos ribonucleicos (RNAs) para a traduo da
para que as reaes qumicas celulares aconteam. molcula de protena. A estrutura tridimensional da
Alm da gua, a clula constituda de pequenas mo- protena determinada pela sequncia de aminoci-
lculas e de biopolmeros formados por muitas cpias dos presente na molcula. Aminocidos com cadeias
de uma pequena molcula, ligada em cadeias por liga- laterais hidrofbicas tendem a agregar-se no interior
es covalentes. Os trs tipos de biopolmeros presen- da protena, evitando o ambiente aquoso. A preserva-
tes nas clulas so: os cidos nucleicos formados o da conformao nativa de uma protena depen-
pelos nucleotdeos unidos por uma ligao fosfodis- dente das condies do meio, como pH e temperatura,
ter; as protenas constitudas pelos aminocidos li- em que a protena se encontra.

Leituras recomendadas
Alberts B, Johnson A, Walter P, Lewis J, Raff M, Roberts K. Lodish H, Baltimore D, Berk A, Zipursky L, Matsudaira PT.
Molecular biology of the cell. 5th ed. New York: Garland Biologia celular e molecular. 5. ed. Porto Alegre: Artmed;
Science; 2008. 2005.
Campbell MK, Farrell SO, Tasks A. Bioqumica. 5. ed. So Persing DH, editor. Molecular microbiology: diagnostic
Paulo: Thomson; 2007. principles and practice. Washington: ASM Press; 2004.
Devlin TM. Manual de bioqumica com correlaes clnicas. Voet D, Voet JG. Bioqumica. 3. ed. Porto Alegre: Artmed;
So Paulo: Edgard Blucher; 2007. 2006.
Lewin B. Genes IX. 9. ed. Porto Alegre: Artmed; 2009.

Zaha_5ed_01.indd 15 27/11/13 10:27


Captulo 2

Augusto Schrank

Estrutura dos
cidos Nucleicos

1. DNA 18 1.6 Outras estruturas do DNA 31


1.1 Composio qumica 18 1.6.1 Curvatura 31
1.2 Hlice dupla 19 1.6.2 Estruturas cruciformes 31
1.2.1 Estrutura 19 1.6.3 Junes de Holliday 31
1.2.2 Propriedades qumicas 23
1.3 Supertoro 25 2. RNA 31
1.4 Topoisomerases 27 2.1 Composio qumica 32
1.5 Tipos de DNA 29 2.2 Estrutura secundria 32
2.3 Classes de RNA 32

Zaha_5ed_02.indd 17 27/11/13 09:20


Biologia Molecular Bsica 18

A estrutura dos cidos nucleicos est relacionada sua um nico cromossomo humano 280 vezes mais longo
funo. Essas molculas so polmeros formados por ca- que o dimetro da clula que o contm.
deias de nucleotdeos, cuja composio (tipo e sequncia)
Os desoxirribonucleotdeos so compostos por: um
determina suas caractersticas qumicas. Essas caracte-
acar, uma base nitrogenada e grupamentos fosfato
rsticas definem a sua interao com outras macromol-
(PO4). O acar a pentose desoxirribose (2'-desoxi-D-
culas na clula, em particular, com as protenas e a sua
-ribose); que est ligada pelo carbono 1' a uma base nitro-
conformao espacial (forma da molcula). A conforma-
genada heterocclica e pelo carbono 5' a grupamentos fos-
o espacial est diretamente relacionada funo e
fato (Figura 2.1). As bases nitrogenadas podem ser de
atividade das macromolculas na clula. Na natureza, so
dois tipos: as bases pricas (derivadas das purinas), que
encontradas todas as formas de DNA e RNA: DNA de ca-
so a adenina (A) e a guanina (G), e as bases pirimdicas
deia dupla, DNA de cadeia simples, RNA de cadeia dupla
(derivadas das pirimidinas), que so a citosina (C) e a timi-
e RNA de cadeia simples.
na (T) (Figura 2.2). A ligao entre a base nitrogenada e
A importncia dos cidos nucleicos na clula levou a pentose denominada ligao glicosdica. A molcula
algum tempo para ser compreendida. A funo do DNA, composta pela base nitrogenada ligada ao acar, sem gru-
de armazenar a informao gentica na sequncia de suas pamentos fosfato, denominada nucleosdeo. Quando
quatro bases nitrogenadas componentes (A, C, G e T), um grupamento fosfato est ligado ao carbono 5' da pento-
foi, durante muito tempo, atribuda s protenas. Devido se, a molcula denominada nucleotdeo, que pode ser
variedade de combinaes possveis entre os 20 ami- mono, di ou tri-fosfatado, dependendo do nmero de fos-
nocidos diferentes com as protenas (podendo, assim, fatos a ele ligados. O primeiro grupamento fosfato ligado
conferir maior variabilidade e potencial para armazenar ao nucleotdeo denominado (alfa), o segundo (beta)
informaes genticas), e dificuldade de obter prepara- e o terceiro (gama). A molcula de DNA conter sempre
es de DNA totalmente livres de protenas, a comprova- nucleotdeos mono-fosfatados e os precursores para a sua
o de qual molcula armazenava a informao gentica sntese sero sempre trifosfatados. Os desoxirribonucleo-
foi demorada. O DNA foi descoberto por Friedrich Mies- tdeos so denominados de acordo com a base nitrogenada
cher, em 1869, entretanto, as suas funes primordiais componente e com o nmero de grupamentos fosfato liga-
foram sugeridas pela primeira vez apenas 75 anos depois, dos pentose (Tabela 2.1).
em 1944, por Avery, MacLeod e McCarty. Esta proposio Na molcula de DNA, os desoxirribonucleotdeos
foi definitivamente comprovada em 1952, por Hershey e formam cadeias, sendo unidos entre si por ligaes co-
Chase e, no ano seguinte, Watson e Crick propuseram a valentes, formando pontes fosfodister estabelecidas
estrutura de hlice dupla do DNA. Estes ltimos autores entre o grupamento fosfato (5'-PO4, ou, simplificadamen-
tambm apresentaram estudos sobre como esta molcula te 5'-P) e o grupamento hidroxlico (3'-OH) do carbono
seria duplicada e lanaram as bases para a transferncia 3' do nucleotdeo adjacente (Figura 2.3). Isso confere
da informao gentica para as protenas, utilizando os s cadeias polinucleotdicas uma propriedade importan-
RNAs como molculas intermedirias neste processo. Em te, que a direcionalidade. O primeiro nucleotdeo
relao aos estudos dos RNAs, recentemente os genomas da cadeia ter uma extremidade 5' com um grupamento
possibilitaram a descoberta de muitas novas classes de fosfato, e o ltimo nucleotdeo na extremidade 3' ter
RNAs, revelando que essas novas classes tm participa- um grupamento hidroxlico. O prximo nucleotdeo a ser
o fundamental na fisiologia da clula. adicionado cadeia, obrigatoriamente, ser adicionado
As descobertas mencionadas promoveram uma srie na extremidade 3'-OH da cadeia polinucleotdica (ver
de avanos na biologia. Atualmente, sabe-se que a mol- Captulo 5). As cadeias polinucleotdicas so, por conven-
cula de DNA no um mero depositrio da informao o, representadas na orientao 5'3', e apenas as letras
gentica, e que os RNAs representam muito mais do que indicativas das bases nitrogenadas so representadas,
apenas intermedirios na transferncia das informaes como no exemplo:
s protenas. Neste captulo, sero abordados aspectos da 5'-AACGTTGCTATCGT-3', ou, mais comumente,
estrutura do DNA e dos RNAs e de sua inter-relao com AACGTTGCTATCGT
as protenas.
Estudos detalhados sobre a estrutura cristalogrfica
do DNA demonstraram que os ngulos das ligaes cova-
lentes e as interaes entre as nuvens eletrnicas confe-
rem certa rigidez conformao espacial das cadeias do
1. DNA DNA, mesmo quando somente uma das cadeias (fitas)
formada. O maior grau de rotao ocorre nas ligaes
1.1 Composio qumica
entre o oxignio e o fsforo (ligao fosfodister) e en-
O cido desoxirribonucleico (DNA) um polmero tre a pentose e a base nitrogenada (ligao glicosdica).
composto por unidades de desoxirribonucleotde- Entretanto, mesmo nessas posies, existem localizaes
os. Ele uma macromolcula muito longa, para termo preferenciais, demonstrando que as molculas de DNA
de comparao, enquanto uma clula eucaritica comum assumem conformaes espaciais no aleatrias. Estas
tem cerca de 50 m, o menor cromossomo humano, se caractersticas qumicas das cadeias de DNA contribuem
estendido, possui aproximadamente 14.000 m, ou seja, para a formao da hlice dupla.

Zaha_5ed_02.indd 18 27/11/13 09:20


19 Estrutura dos cidos Nucleicos
A Figura 2.1
Base Nitrogenada
NH2 Estrutura dos nucleot-
C deos. (A) Estrutura geral.
N
C N (B) Os acares componen-
Fosfatos HC tes; em detalhe, o grupa-
C CH mento OH na posio C2 da
O O O N N
ribose e o H na desoxirribose.
O P O P O P O CH2 (C) Representao das estru-
O
O O O turas cristalogrficas do ATP
C C e do dATP. Observe a grande
H H H Acar diferena no posicionamento
H
C C espacial dos tomos pela sim-
ples presena, ou ausncia
OH H
do oxignio no carbono 2' da
NUCLEOSDEO pentose.

NUCLEOTDEO

5
B HO C H2 O H O C H2
5
O
1 1
4
C C 4
C C

H H H H
H H H H

3 C C 2
3 C C 2

OH OH OH H
Ribose 2'-Desoxirribose
-D-Ribofuranose -D-2-Desoxirribofuranose

C
Fosfatos

Base
nitrogenada

5'



4' 5'
Acar 1'
4'
2'
ribose 3'
1'
3'
2'

ATP dATP
Adenosina trifosfato Desoxi-adenosina trifosfato

1.2 Hlice dupla Crick propuseram um modelo de estrutura tridimensio-


nal do DNA com base nos estudos de difrao por raios
1.2.1 Estrutura X, conduzidos por Rosalind Franklin e Maurice Wilkins,
A elucidao da estrutura secundria da molcula de e em outros estudos qumicos da molcula.
DNA foi fundamental na sua definio como molcula ar- O modelo proposto por Watson e Crick mostrou
mazenadora da informao gentica. A principal proprie- que o DNA uma hlice dupla e que as suas duas fitas
dade para esta funo a capacidade de autorreplicao se enrolam em torno do eixo da hlice. As desoxirribo-
(Captulo 6). Alm de muitos estudos sobre a qumica do ses, ligadas umas s outras pelos grupamentos fosfato,
DNA, a utilizao de mtodos de difrao por raios X ficam externas em relao s bases nitrogenadas, como
foi necessria para a descoberta da estrutura do DNA. A se fossem o corrimo de uma escada circular, expostas ao
difrao permite que seja atribuda a localizao espacial meio aquoso. As ligaes fosfodister nas duas fitas es-
(tridimensional, nos eixos x, y e z) dos tomos em uma to em direes opostas uma fita na direo 5' 3' e
molcula cristalizada e, assim, definir a conformao es- a outra na direo 3' 5' , sendo, portanto, ditas anti-
pacial da molcula. Em 1953, James Watson e Francis -paralelas. O pareamento das bases fundamental para

Zaha_5ed_02.indd 19 27/11/13 09:20


Biologia Molecular Bsica 20

Figura 2.2 A 6
H
7 6
C 5 N 7
5
1N C
Estrutura das bases nitrogenadas pricas (A) e 1
C H
pirimdicas (B). Esto representadas a forma planar e a H C C
8 8
representao em varetas. 2
N 4 N9 2 4 9
3 H 3
Purina
NH2 O
C N C N
N C HN C
C H CH
H C C H2N C C
N N
N N
H H

Adenina (A) Guanina (G)

H
4
C 4
B 3N CH 5 3
5
2HC H6 6
N 2
1 1
Pirimidina
O
O NH2
C C C
H N C CH3 N C H H N C H

O C C H O C C H O C C H
N N N
H H H

Timina (T) Citosina (C) Uracila (U)

Tabela 2.1 Nomenclatura dos cidos nucleicos


Bases Nucleosdeo Nucleotdeo cido nucleico

Purinas

Adenina Adenosina Adenilato RNA


Desoxiadenosina Desoxiadenilato DNA
Guanina Guanosina Guanilato RNA
Desoxiguanosina Desoxiguanilato DNA
Pirimidinas

Citosina Citidina Citidilato RNA


Desoxicitidina Desoxicitidilato DNA
Timina Timidina Timidilato DNA
Uracila Uridina Uridilato RNA

Zaha_5ed_02.indd 20 27/11/13 09:20


21 Estrutura dos cidos Nucleicos
A B Figura 2.3
O
O P O- Ligaes qumicas na
Extremidade cadeia de DNA. (A) Re-
O Adenina
5'-fosfato presentao planar do DNA
O Extremidade
5' CH2 Ligao (fita simples), (B) repre-
glicosdica 5'-fosfato
C 4' 1' C sentao tridimensional das
H H ligaes no DNA (fita sim-
H
3'
H
2' ples). Observe as extremida-
C C 5' des 5'-fosfato e 3'-OH, que
H conferem direcionalidade
O
Ligao O P O
- 4' cadeia; as ligaes fosfodi-
fosfodister
O ster entre os nucleotdeos e
Citosina
3' 1' as ligaes glicosdicas entre
CH2 O os acares e as bases nitro-
2'
C C Ligao genadas. A representao
fosfodister
H H Ligao em (B) a forma tridimen-
H H glicosdica sional obtida com a cris-
C C
talografia por raios X, que
O
H
a forma espacial real da
O P O
- molcula. As bases nitroge-
O Guanina
nadas ficam perpendiculares
e voltadas para o interior da
CH 2 O
cadeia fosfodister.
C C
H H
H H
C C
H
O
-
O P O
O 5'
Timina
5' CH 2 O 1'
4'
C 4' 1' C 2'
H H 3'
H H
2' Extremidade
3' C C
Extremidade H 3'-hidroxila
3'-hidroxila OH

a manuteno da hlice dupla. Os anis aromticos das por meio de uma ponte de hidrognio. C e G, que con-
bases nitrogenadas so hidrofbicos e ficam orientados tm um grupamento ceto e um grupamento amnico,
para o interior da hlice dupla, quase perpendiculares podem formar duas pontes de hidrognio. Alm disso,
ao seu eixo, como se fossem os degraus de uma escada. uma ponte de hidrognio adicional pode ser formada
Cada base nitrogenada de uma das cadeias est pare- entre os nitrognios dos anis aromticos em todos
ada com a base complementar na outra cadeia de DNA os pares. Assim, entre T ou U e A so formadas duas
(Figura 2.4). Este pareamento ocorre pela formao de pontes de hidrognio, e entre C e G so formadas trs
pontes de hidrognio entre as duas fitas, mantendo a pontes de hidrognio (Figura 2.5). Isto confere mo-
estrutura da molcula. lcula de DNA a complementaridade, ou seja, sempre
que existir uma A em uma fita haver uma T pareada, e
Um tomo de hidrognio, em geral, forma uma li-
quando houver uma C na outra fita haver uma G. Esta
gao covalente com apenas outro tomo. Entretanto,
uma propriedade fundamental do DNA e a base para a
se esta ligao ocorre com um tomo que um doador
replicao (Captulo 6), para a transcrio (Captulo 10)
eletronegativo, o hidrognio pode formar associaes
e para outros processos celulares.
fracas adicionais, como as pontes de hidrognio, com
outro tomo aceptor. A presena de grupamentos ceto As bases nitrogenadas possuem dois tamanhos,
(CO) e amnico (C-NH2) (Figura 2.5) permite a for- sendo as pirimdicas menores do que as pricas (ver
mao de pontes de hidrognio entre as bases. Dessa Figura 2.2). O pareamento sempre ocorre entre uma
forma, T e U, que contm um grupamento ceto, podem base prica e uma pirimdica e, portanto, os pares AT
parear com A, que contm um grupamento amnico, e CG tm aproximadamente o mesmo tamanho e di-

Zaha_5ed_02.indd 21 27/11/13 09:20


Biologia Molecular Bsica 22

caractersticas de pareamento explicam o fato de que,


2,37 nm em qualquer sequncia de DNA fita dupla, a relao
molar entre A/T igual a 1,0, ocorrendo o mesmo com
3'OH
5'P a relao C/G, embora as concentraes molares entre
AT e CG variem com a sequncia de DNA analisada. As
pontes de hidrognio (Figura 2.5) CG so mais fortes
(necessitam de mais energia para serem rompidas) que
Cavidade as ligaes AT.
menor
Alm dos pareamentos AT e CG, outros parea-
mentos raros podem ser encontrados. O pareamento de
Hoogsteen, que ocorre em fitas triplas de RNA e DNA e
os pareamentos GA, CA e TG so exemplos desses raros
eventos.

1 volta da hlice 3,4 nm


As ligaes glicosdicas no DNA, entre as desoxir-
riboses e as bases nitrogenadas, no esto diretamente
opostas na hlice dupla, gerando duas cavidades desi-
guais em seu contorno (ver Figura 2.4). As duas cavi-
dades so denominadas cavidade maior e cavidade
Cavidade menor. Nessas cavidades, principalmente na maior, as
maior bases, esto expostas ao meio solvente e so quimica-
mente distinguveis. Assim, molculas (em geral pro-
tenas), que interagem com sequncias especficas de
bases, podem identificar essas sequncias sem romper a
estrutura da hlice dupla.

0,34 nm Em princpio, as fortes cargas negativas dos grupa-


mentos fosfato das cadeias fosfodister das duas fitas de
DNA tendem repulso. Entretanto, um conjunto de
5'P foras age para estabilizar a estrutura da hlice dupla
3'OH
do DNA. fundamental que essas foras sejam fortes
o suficiente para manter a integridade da hlice dupla,
Figura 2.4
mas devem permitir a flexibilidade conformacional, que
Modelo da hlice dupla do DNA essencial para a sua atividade. Como veremos, durante
proposta por Watson e Crick (DNA a replicao e a transcrio do DNA (Captulos 6 e 10), a
tipo B). As ligaes fosfodister da hlice hlice dupla deve ser separada para que estes processos
foram salientadas com o trao de cor roxa
vitais ocorram.
para reforar a viso de enrolamento da
hlice. Em rosa-claro esto representadas Alm das ligaes covalentes, que unem os tomos nas
as desoxirriboses. As bases nitrogenadas, molculas, outras foras mais fracas atuam, estabilizando
voltadas para o interior da hlice, esto a estrutura de hlice dupla do DNA. Estas foras so:
representadas na forma de varetas, e as
pontes de hidrognio esto representadas 1. Os efeitos hidrofbicos, que estabilizam o parea-
por linhas vermelhas tracejadas. Observe mento entre as bases. Os anis das purinas e das piri-
que as bases nitrogenadas so perpendi- midinas, que esto voltados para o interior da hlice
culares ao eixo da hlice (veja na Figura dupla, so mantidos por coeso interna de molculas
2.7 que, se a molcula for vista de seu eixo
de gua, e os stios hidroflicos das bases ficam ex-
longitudinal da hlice, as bases todas vol-
tadas para dentro da hlice e empilhadas
postos ao solvente nas cavidades.
mantm-se por foras de Van der Waals). 2. O empilhamento das bases no interior da hlice
As setas pretas indicam distncias em dupla (observe em uma viso do eixo da hlice, Figu-
nanmetros. So mostradas as duas cavi-
ra 2.4) permite o estabelecimento de foras de Van
dades formadas na hlice.
der Walls entre os anis aromticos de bases adja-
centes. Estas foras so fracas, mas aditivas na ma-
nuteno da estrutura final.
menses semelhantes (Figura 2.5). Desse modo, os 3. As cadeias de acar-fosfato, que so carrega-
dois pares ocupam o mesmo espao tridimensional, das negativamente, interagem com ctions (princi-
conferindo uma uniformidade ao longo da molcula de palmente Mg+2) em soluo, neutralizando a repul-
DNA. Por isso, no existe nenhuma restrio quanto so entre as duas cadeias e estabilizando a hlice
sequncia de nucleotdeos na molcula de DNA. Essas dupla.

Zaha_5ed_02.indd 22 27/11/13 09:20


23 Estrutura dos cidos Nucleicos
A B
3'-OH
OH
5'-P H

O C C Pontes de
H H
H H Hidrognio
O P O-
C C H
O 8
7
H
O CH2
C N CH3
O ADENINA TIMINA
CH2 O 5 N H O
C C 6 C H
C C 5

H O- P O N9 4 C C6
H
H H
H O C4
C C H N
C C
Deoxirribose N1 3
N1
O H
H H
H 3 N 2 C
O P O-
H C
2 Deoxirribose
C C H O
O CH2
O CITOSINA GUANINA O A T
CH2 O
C C
O- P O H
H H
H H H O H
C C C C
5
N H O 7
H C N
O H H H 8
H H 6C C4 C6
5
CH
C
O P O- C C
CH2 1
N N3 H N N9
O O 1 C4
TIMINA ADENINA C
CH2 O O 2
C2
Deoxirribose N3
Deoxirribose
C C
O- P O
O H N
H H
H H H O H
C C C C
O H H
H H
H
C G
O P O- C C
O O CH2

CH2 O GUANINA CITOSINA O

C C O- P O
H H O
H H
C C
H
5'-P
OH

3'-OH

Figura 2.5
Cadeia dupla e pontes de hidrognio na molcula de DNA. (A) Representa a forma planar das duas
cadeias (fitas) de DNA, mostrando a formao das pontes de hidrognio, () representa duas pontes de
hidrognio, () representa trs pontes de hidrognio, 5'-P (extremidades 5' fosfato), 3'-OH (extremidades
3' hidroxila). (B) Representa a forma planar dos pareamentos entre adenina e timina e entre citosina e gua-
nina. As pontes de hidrognio esto representadas em vermelho.

Na clula, a molcula de DNA quase sempre est liga- so a complementaridade entre as bases nitrogenadas
da a protenas estruturais, como as histonas, ou a prote- das duas cadeias, o antiparalelismo, que confere dire-
nas com diferentes funes. Essas interaes com as pro- cionalidade s cadeias, e a capacidade de desnaturao
tenas tambm contribuem, de forma majoritria, para e renaturao da hlice dupla. Na seo anterior, foram
manuteno e alteraes na estrutura do DNA. A forma- analisadas as duas primeiras propriedades e, agora, ser
o da cromatina o principal tipo de estruturao das descrita a propriedade de desnaturao/renaturao.
molculas de DNA na clula, e sua estrutura est apresen-
A desnaturao (ou fuso) ocorre quando as pontes
tada no Captulo 3. Embora o DNA seja visto, na maioria
de hidrognio entre as cadeias complementares do DNA,
das vezes, como uma cadeia dupla, o DNA de cadeia nica
que formam a hlice dupla, so rompidas e as fitas se se-
ou de fita simples encontrado na natureza representan-
param. O processo inverso, o restabelecimento das pon-
do genomas de vrus e em alguns plasmdeos bacterianos.
tes de hidrognio entre as bases complementares (forma-
o da hlice dupla) a renaturao (ou hibridizao ou
1.2.2 Propriedades qumicas anelamento). Sempre que a molcula de DNA replicada,
As propriedades qumicas do DNA mais importantes para transcrita, ou realiza recombinao (Captulos 6, 10 e 8,
as funes de armazenamento da informao gentica respectivamente) as cadeias de DNA so desnaturadas e

Zaha_5ed_02.indd 23 27/11/13 09:20


Biologia Molecular Bsica 24

renaturadas. Aps a renaturao, todas as propriedades (hlice dupla). Isso pode ser demonstrado se uma soluo
originais da hlice dupla so restabelecidas. de DNA for submetida a um aumento de temperatura, e
a absorbncia da soluo for medida a 260 nm. O grfi-
possvel desnaturar o DNA in vitro, em soluo,
co da Figura 2.6 mostra o resultado obtido em tal expe-
por aumento da temperatura, por titulao com cidos ou
rimento. A absorbncia aumenta com a temperatura at
lcalis e por agentes desnaturantes, como a formamida, a
o momento em que as fitas se separam completamente,
ureia e o dimetilsulfxido (DMSO), por exemplo. Os ci- quando se registra a absorbncia mxima (essa alterao
dos protonizam os anis nitrogenados de A, G e C, e os brusca chama-se efeito hipercrmico) e permanece cons-
lcalis deprotonizam os anis nitrogenados de G e T. Es- tante mesmo que a temperatura continue aumentando,
ses tratamentos geram grupamentos carregados no inte- pois as bases j se encontram expostas e tm absoro
rior da hlice dupla, o que leva, tambm, ao rompimento mxima da luz UV. A temperatura na qual 50% do DNA
das pontes de hidrognio entre as bases complementares. est desnaturado denominada temperatura mdia
Como as ligaes glicosdicas nas purinas so sensveis de fuso (Tm, Figura 2.6). O efeito inverso a renatu-
em pH cido, a desnaturao por cidos tem pouca apli- rao tambm pode ser acompanhado desta forma. As-
cao prtica, pois provoca a depurinao das bases, o sim, se esta soluo de DNA totalmente desnaturado for
que altera a molcula de DNA de forma definitiva. resfriada de forma gradativa, as cadeias complementares
A desnaturao/renaturao do DNA pode ser acom- de DNA voltaro a formar a hlice dupla e a absorbncia
panhada pela medida, em espectrofotmetro, da absor- da luz UV diminuir, pois as bases nitrogenadas ficaro
bncia da luz ultravioleta (UV, Figura 2.6). As bases menos expostas ao meio e, portanto, absorvero menos
nitrogenadas absorvem luz UV, atingindo o mximo em luz UV. A reduo da absorbncia cessa quando a hlice
comprimento de onda de 260 nm (A260). Na molcula de dupla estiver completamente renaturada.
DNA, as bases nitrogenadas so responsveis pela maior Mesmo quando as duas cadeias do DNA esto com-
absoro da luz UV, que mxima quando as fitas de pletamente separadas, o processo pode ser revertido,
uma hlice dupla de DNA esto completamente separa- pois as fitas complementares se reassociam. Esse anela-
das, pois as bases esto, em sua totalidade, expostas ao mento ou hibridizao ocorre, em geral, a uma tem-
meio. Quando as fitas de uma molcula de DNA esto to- peratura 25oC abaixo da Tm. No incio, essa renaturao
talmente separadas, a absoro da luz UV 37% maior ocorre devagar, mas, medida que algumas bases com-
do que aquela obtida com o DNA em sua forma nativa plementares se associam, a velocidade do processo au-

A 1,5
Figura 2.6
1,4
Curvas de absorbncia a 260 nm de so-
Absorbncia (A260)

lues de DNA submetidas elevao da Efeito


1,3
temperatura. (A) Temperatura mdia de fuso hipercrmico
(Tm) e efeito hipercrmico. (B) A Tm varia de 1,2
acordo com a composio GC% ou AT% do DNA
(Tm3>Tm2>Tm1). AT uma sequncia de DNA 1,1
apenas com adeninas e timinas (portanto, ape-
nas com duas pontes de hidrognio entre as fitas 1
complementares). CG uma sequncia de DNA 60 70 80 Tm 90 100
apenas com citosinas e guanosinas (portanto, com
trs pontes de hidrognio entre as fitas comple- Temperatura (C)
mentares).

Poli d(AT) DNA Poli d(CG)


B 1,5

1,4
Absorbncia (A260)

1,3

1,2

1,1

1
35 45 55 Tm1 Tm2 Tm3 85 95

Temperatura (C)

Zaha_5ed_02.indd 24 27/11/13 09:20


25 Estrutura dos cidos Nucleicos
menta de forma drstica, tornando este processo muito Co a concentrao de fita simples em um tempo
rpido. Lembre-se de que o pareamento entre as bases zero
nitrogenadas das cadeias do DNA ocorre por comple-
K2 uma constante t tempo
mentaridade das sequncias e, portanto, dependente
da sequncia de bases das fitas, o que torna este processo Quando a frao de reassociao C/Co igual a 50%,
preciso. Em outras palavras, apenas duas fitas que apre- ento Cot 1/k2. Esse valor, denominado (Cot)1/2, pro-
sentarem sequncias complementares e forem antipara- porcional a N, que a medida direta do tamanho do DNA
lelas (uma fita na orientao 5'3' e a outra complemen- analisado.
tar na orientao 3'5') iro reassociar-se. Se ocorrer
Assim, o tamanho de um determinado genoma pode
um resfriamento abrupto, as fitas do DNA colapsam e a
ser definido comparando seu Cot1/2 com o de um DNA pa-
renaturao pode no ocorrer.
dro com tamanho conhecido. Por exemplo: o cromosso-
Os pareamentos por pontes de hidrognio entre as mo da bactria E. coli corresponde a 4,2 x 106 pb. Ento, a
bases no DNA no apresentam a mesma estabilidade em seguinte frmula pode ser utilizada:
relao aos agentes desnaturantes, devido presena
de duas pontes de hidrognio entre os pares AT e trs
pontes entre os pares CG. Portanto, para o rompimento
de um par CG so necessrias temperaturas mais ele-
vadas, pH mais alcalino, ou maiores concentraes de
agentes desnaturantes do que para a separao de um
par AT. Assim, a Tm de um DNA depende da propor- A cintica de renaturao muito importante para a
o de AT em relao a GC (lembre-se que as molculas caracterizao do tamanho e da complexidade dos geno-
de DNA podem ter diferentes propores de AT e GC, mas, principalmente de organismos eucariticos.
dependendo do organismo ou da regio do DNA anali- O reanelamento (renaturao) do DNA tambm
sada). Quanto maior for a porcentagem de GC (ndice de pode ser empregado na identificao de sequncias de
GC ou GC%), maior ser a temperatura necessria para interesse. Esse processo, denominado hibridizao, uti-
desnaturar a molcula de DNA e, portanto, maior ser liza a propriedade dos cidos nucleicos de fita simples
o valor de Tm (Figura 2.6). Na natureza, isso pode ser de parearem (formarem pontes de hidrognio) com fitas
observado no genoma de alguns organismos. Por exem- complementares, mesmo na presena de grandes quanti-
plo, bactrias que habitam ambientes com temperaturas dades de DNA no complementar. Esse tipo de metodo-
elevadas tendem a ter um genoma com maior ndice GC logia tem uma vasta aplicao prtica e ser discutida no
que, potencialmente, teria maior estabilidade em tem- Captulo 16.
peratura mais elevada. Outro exemplo so regies do
genoma onde a hlice dupla separada para o incio da
replicao ou da transcrio que tendem a ter ndice AT 1.3 Supertoro
maior (GC menor), facilitando a abertura (separao das Alm da estrutura secundria da hlice dupla, o DNA as-
cadeias da hlice dupla). sume uma estrutura terciria, denominada supertorcida,
possvel calcular o contedo de GC ou AT de um superenrolada ou super-helicoidal (Figura 2.7). Essa
dado DNA a partir do valor da sua Tm, determinado, de outra estrutura basicamente o enrolamento da hlice
forma experimental, utilizando as equaes: dupla sobre si mesma. Lembre-se que a molcula de DNA
muito longa. A estrutura supertorcida a conformao
Tm (oC) 69,3 + 0,41 (GC%) e AT% 1 (GC%) predominante do DNA na clula e fundamental para
o empacotamento do DNA nos genomas e na estrutura
Alm da medida da absorbncia de luz UV, outras dos nucleosomos (Captulo 3). Alm disso, o superenro-
tcnicas podem ser utilizadas para acompanhar a desna- lamento est envolvido na replicao, na transcrio e na
turao/renaturao do DNA, como, por exemplo: a sedi- recombinao, controlando a expresso de alguns genes.
mentao por centrifugao; o tratamento com enzimas
especficas para fita simples (nuclease S1, por exemplo); e Os mtodos comuns de isolamento de DNA, em ge-
a microscopia eletrnica. ral, alteram a estrutura tridimensional da molcula e,
quando o superenrolamento foi descrito pela primeira
possvel determinar o tamanho de um genoma uti- vez, acreditava-se que ele ocorria somente em molculas
lizando medidas da renaturao do DNA. A velocidade de circulares pequenas, como genomas virais, plasmdeos,
renaturao do genoma de um determinado organismo DNA mitocondrial e de cloroplastos. Atualmente, sabe-
depende do tamanho desse genoma. A seguinte frmula -se que esta uma caracterstica de quase todos os DNAs
define essa relao: circulares e lineares e que de extrema importncia para
a sua funcionalidade.
As estruturas de DNA superenrolado so estudadas
em um ramo da matemtica denominado topologia.
onde:
Para essas consideraes, a molcula de DNA de hlice
C a concentrao de fita simples em um tempo t dupla pode ser representada como duas fitas elsticas

Zaha_5ed_02.indd 25 27/11/13 09:20


Biologia Molecular Bsica 26

Topoisomerase Topoisomerase

Plectonmica Toroidal
Estrutura Relaxado Tenso Plana
terciria Forma Plana Superenrolado Fitas abertas

Tamanho do DNA 360 360 360


Voltas da hlice (L) 36 32 32
Nmero de vezes que as
tas se sobrepe (T) 36 36 32
Superenrolamento (W) 0 4 0

B C
DNA Girase Topoisomerase I
DNA 1 2 3
totalmente
relaxado

DNA
totalmente
supertorcido

DNA DNA
totalmente totalmente
relaxado supertorcido

Figura 2.7
Superenrolamento do DNA. (A) Topologia do superenrolamento e definio dos parmetros. O superenrola-
mento pode ser representado da forma plectonmica ou, como ocorre nos nucleosomos, na forma toroidal. Medidas
do superenrolamento: (B) Molculas individuais de DNA observadas por microscopia eletrnica, aps tratamento
por diferentes tempos, com topoisomerase. (C) Molculas de DNA fracionadas por eletroforese em gel de agarose,
coradas com intercalante fluorescente, que foram tratadas com topoisomerase I em diferentes tempos: (1) tempo
zero; (2) 5 min e (3) 30 min. As bandas de DNA intermedirias entre as formas de DNA totalmente relaxado e supe-
renrolado representam diferentes graus de superenrolamento.

que se enrolam, formando a hlice estrutura secund- das extremidades no estar mais relaxada. Esta nova si-
ria. Quando as extremidades das fitas so unidas, uma tuao poder ser acomodada de trs maneiras (acompa-
estrutura circular plana formada (ver Figura 2.7). Como nhe observando as Figuras citadas):
a orientao das fitas na hlice dupla antiparalela, elas
devem ser corretamente ligadas, ou seja, a extremidade 1. A tenso gerada poder ser distribuda ao longo da
5'-P ligada extremidade 3'-OH. Quando essa estrutu- hlice dupla, diminuindo o nmero de vezes que uma
ra fica perfeitamente assentada em uma superfcie plana, fita se enrola na outra. Dessa forma, aumenta o n-
sem alterar a geometria da hlice dupla, ela denomina- mero de bases pareadas por volta da hlice, ou h
da relaxada (ver Figura 2.7). Se, entretanto, antes de unir concentrao de tenso em um ponto especfico da
as extremidades, uma das fitas for girada sobre si mesma molcula circular, que ficar no pareada, (fita sim-
o
uma ou mais vezes, em voltas de 360 na direo do de- ples), mantendo o mesmo nmero de pares de bases
senrolamento da hlice dupla, ao passo que a outra fita por volta da hlice (Figura 2.7). Nos dois casos, a es-
permanece fixa, a molcula circular formada aps a unio trutura continuar plana.

Zaha_5ed_02.indd 26 27/11/13 09:20


27 Estrutura dos cidos Nucleicos
2. A tenso produzida poder ser anulada, se a hlice valores de Tw e Wr sero alterados para acomodar a nova
enrolar-se sobre si mesma (superenrolamento, Fi- situao (Figura 2.7).
gura 2.7). Dessa forma, o nmero de pares de ba-
O grau de superenrolamento e a sua gerao e remo-
ses por volta da hlice permanecer praticamente o
o em molculas de DNA podem ser medidos por diver-
mesmo, mas a estrutura no ser mais plana, mas
sos mtodos. A eletroforese em gel de agarose, que
superenrolada de forma tridimensional. Quando
permite separar as molculas de DNA em razo da sua
esse superenrolamento gerado pelo desenrola-
massa molecular (tamanho), forma e compactao (as
mento da hlice dupla, ele chamado de superen-
duas ltimas so funes diretas do superenrolamento,
rolamento negativo. Esse superenrolamento
pois uma molcula superenrolada mais compacta, Fi-
negativo encontrado em todos os organismos. As
arqueas so excees a esta regra e tm seu DNA, gura 2.7), uma dessas tcnicas (ver Captulo 16). A ve-
com um superenrolamento positivo. O superenrola- locidade de sedimentao outro exemplo, pois as
mento pode assumir dois tipos: o plectonmico e molculas de DNA com diferentes graus de enrolamen-
o toroidal ( o tipo de espiral dos fios de telefone, to sedimentam com velocidades diferentes e, portanto,
por exemplo). O primeiro o encontrado no DNA podem ser separadas por centrifugao em gradientes.
em soluo, e o outro, no DNA enrolado em prote- Finalmente, o superenrolamento tambm pode ser visua-
nas como as histonas, que formam os nucleossomos lizado por microscopia eletrnica ou de fora at-
(Captulo 3). mica, pela observao direta de molculas com diferen-
tes graus de superenrolamento.
3. O desenrolamento das hlices pode induzir forma-
o de estruturas alternativas, como estruturas cru- O grau de superenrolamento do DNA na clula
ciformes, de triplex ou de DNA do tipo Z. Essas alte- fundamental para a sua funcionalidade. O DNA man-
raes tambm podem absorver um pouco da tenso tido em uma condio de superenrolamento negativo
criada, gerando um nmero menor de superenrola- (lembre-se que apenas em arqueas o superenrolamento
mentos. positivo), que fornece energia para a desnaturao da
hlice dupla permitindo o acesso de enzimas, que promo-
O superenrolamento pode ser descrito matematica- vem a replicao, a transcrio, a reparao e a recom-
mente como: binao do DNA. O conhecimento atual mostra que esse
Lk Tw + Wr, onde: superenrolamento mantido pela clula em um sistema
homeosttico e que, alm da estrutura primria do DNA
Lk o nmero de ligao, ou seja, o nmero to- (sequncia de bases), o superenrolamento tambm arma-
tal das vezes em que uma das fitas do DNA passa sobre a zena informao. Essa informao importante para a
outra; sua funcionalidade. Alm disso, o superenrolamento per-
Tw o nmero de voltas de uma fita em torno da mite que regies dos genomas que esto muito afastadas
outra, ou seja, o nmero de voltas da hlice; umas das outras estejam espacialmente prximas.

Wr o nmero de superenrolamentos.
1.4 Topoisomerases
Lk uma propriedade topolgica da molcula dupla
circular e permanece inalterado, independentemente do Para a manuteno da homeostasia do superenrolamento
que ocorre com o DNA, desde que as cadeias acar-fos- e da conformao do DNA na clula, existe um sistema
fato no sejam rompidas. Esse valor ser alterado apenas complexo de enzimas, as topoisomerases, atuando de
se as cadeias do DNA forem rompidas e novamente se- forma coordenada. As topoisomerases so enzimas que
ladas. Existem enzimas que realizam esse processo, de- catalisam a interconverso de topoismeros de DNA e,
nominadas topoisomerases. Tw e Wr so parmetros portanto, permitem alteraes no grau de superenrola-
geomtricos e podem variar. Molculas com o mesmo Lk mento. Essas enzimas promovem a quebra transitria de
podem ter diferentes Tw e Wr e, portanto, diferentes con- ligaes fosfodister da fita de DNA, gerando uma forma
formaes tridimensionais (topologia). Molculas com intermediria, em que a protena permanece ligada cova-
sequncias e tamanhos idnticos, que diferem apenas na lentemente ao DNA e permite que as fitas do DNA passem
sua topologia, so denominadas topoismeros. umas sobre as outras ou sofram toro, alterando, assim,
o superenrolamento da molcula. Desse modo, essas en-
Em uma molcula de DNA do tipo B relaxada, o ni- zimas introduzem ou removem superenrolamentos no
co enrolamento presente o das voltas da hlice dupla
DNA e resolvem estruturas, como os ns e os concatme-
e, portanto, o nmero de vezes que uma fita passa sobre
ros, geradas nos processos celulares (Figura 2.8). Todas
a outra (Lk) igual ao nmero de voltas da hlice (Tw),
as clulas procariticas e eucariticas estudadas possuem
que, por sua vez, igual ao nmero de pares de bases da
topoisomerases, que so fundamentais nos processos de
molcula dividido pelo nmero de pares de bases em cada
replicao do DNA (Captulo 6), na transcrio (Captulo
volta da hlice (10,5 para B-DNA, ver Figura 2.4). Por-
10), na recombinao (Captulo 8) e no remodelamento
tanto, LkTw e Wr0 para a molcula relaxada. Quando
da cromatina (Captulos 3 e 14).
uma ou as duas fitas do DNA so rompidas e uma rotao
aplicada a uma delas, sendo as fitas novamente seladas, A evoluo desenvolveu duas estratgias gerais para
o valor de Lk alterado. Em consequncia, tambm os a alterao da topologia do DNA pelas topoisomerases.

Zaha_5ed_02.indd 27 27/11/13 09:20


Biologia Molecular Bsica 28

Superenrolado Relaxado Com n Sem n Concatenado Resolvido

Topo I Clivagem Religao Topologia


da da alterada
ta ta

C Concatmero
Estrutura
Liberao
resolvida
do
complexo
Topo II

Religao
Formao das fitas
do
complexo

Clivagem Passagem
das duas da hlice
fitas

Figura 2.8
Topologia do DNA e topoisomerases. (A) As estruturas topolgicas do DNA mais co-
muns encontradas na clula. (B) Representao do mecanismo de ao das topoisomerases
da famlia Tipo I. A forma em cinza representa um complexo de topoisomerase. Apenas uma
das fitas do DNA clivada, sofre rotao, alterando o superenrolamento, e ocorre a religao
da cadeia fosfodister. (C) Representao do mecanismo de ao das topoisomerases da
famlia Tipo II. O substrato inicial um concatmero, onde duas molculas de DNA esto
entrelaadas. Para efeito de visualizao, apenas uma parte da molcula apresentada como
hlice dupla. O complexo Topo II se liga a uma das molculas de DNA, depois, interage com
a outra molcula de DNA. Com as molculas ligadas ao complexo, uma das hlices clivada
nas duas fitas. A outra molcula de DNA passada por dentro das fitas clivadas, alterando
o superenrolamento. O DNA no clivado liberado do complexo. A outra hlice religada e
liberada. O produto da reao o concatmero resolvido. As molculas, antes entrelaadas,
agora esto livres.

Zaha_5ed_02.indd 28 27/11/13 09:20


29 Estrutura dos cidos Nucleicos
Uma delas o mecanismo de rotao, em que a topoi- 1.5 Tipos de DNA
somerase cliva a ligao fosfodister de uma das cadeias
do DNA e permite que uma das extremidades da cadeia Os tipos de DNA encontrados em condies fisiolgicas
aberta gire em torno da hlice. Em seguida, a cadeia cli- so: DNA tipo B, DNA tipo A e DNA tipo Z (Figura 2.9).
vada religada e a molcula de DNA resultante fica com Esses tipos foram identificados por anlises da es-
um superenrolamento diferente do inicial (topoisomera- trutura cristalogrfica e so gerados pela composio de
ses da famlia tipo I). A outra estratgia envolve a cliva- bases, pelo meio em que se encontram ou devido a sua
gem de uma ou das duas cadeias de DNA da hlice dupla, ligao com determinadas protenas. Nestes trs tipos de
causando o rompimento de algumas pontes de hidrog- DNA, as cadeias formam a hlice dupla como visto at
nio entre bases adjacentes, seguida da passagem de uma aqui. As regras de pareamento se aplicam e as alteraes
segunda hlice dupla pela regio clivada (topoisomerases na conformao no alteram a informao contida na se-
da famlia tipo II). Para facilitar a visualizao desta se- quncia de bases. Entretanto, alteraes na conformao
gunda estratgia, acompanhe a Figura 2.8 e lembre-se de podem facilitar ou dificultar a interao do DNA com as
que o superenrolamento uma caracterstica espacial. protenas.
O entendimento da importncia da manuteno do O que diferencia estes trs tipos de DNA a sua es-
superenrolamento do DNA para a funcionalidade das pessura, o nmero de pares de base por volta da hlice
clulas levou a estudos detalhados das topoisomerases e a exposio das bases nitrogenadas ao meio externo.
desde a sua descoberta, em 1970. Esses estudos foram O DNA tipo B o fisiolgico e o majoritariamente en-
tambm impulsionados pela descoberta de que estas en- contrado na clula. O DNA tipo A ocorre em condies
zimas so alvos importantes para a ao de muitas subs- de umidade muito baixa e quando fitas mistas de DNA-
tncias com aplicao em medicina. Assim, atualmente, -RNA e fitas duplas de RNA so formadas. Hbridos
so conhecidas e caracterizadas muitas toposisomerases DNA-RNA so formados na transcrio (Captulo 10) e
em diversos organismos. fitas duplas de RNA so encontradas em genomas de
De forma geral, existem muitas subfamlias de cada alguns vrus e, na clula, nos RNAs transportadores e
uma das duas famlias de topoisomerases, classificadas ribossmicos. O DNA tipo Z ocorre em regies curtas do
a partir da sequncia de aminocidos e do mecanismo DNA, onde existem sequncias de citosinas e guaninas
envolvido na reao de formao dos topoismeros. As seguidas.
topoisomerases da famlia tipo I esto divididas em trs
O DNA tipo B apresenta a forma de hlice dupla cls-
subfamlias: IA, IB e IC. As da famlia tipo II esto divi-
sica, descrita por Watson e Crick (ver Figura 2.4). Esse
didas em duas subfamlias: IIA e IIB. Em todos os orga-
o tipo de DNA que ocorre na presena de umidade relati-
nismos estudados encontrada pelo menos uma topoi-
va elevada (92%) e em solues de baixa fora inica. Ele
somerase de cada famlia. As topoisomerases de cada
apresenta as seguintes caractersticas:
organismo receberam nomes como: topoisomerase I, gi-
rase, topoisomerase IV, etc., o que pode criar alguma con- 1. A hlice dupla gira para a direita e a rotao entre os
o
fuso. A Tabela 2.2 mostra uma classificao resumida dois pares de bases adjacentes de 34,6 . Dessa for-
das topoisomerases, em que organismos so encontradas ma, a hlice dupla perfaz uma volta completa a cada
cada uma das subfamlias e algumas de suas atividades. 10,4 pb.

Tabela 2.2 Topoisomerases: classificao resumida


Famlia Subfamlia Organismo/enzima Atividade

Tipo I, IA Bactria e arqueas/topo I e III Desfaz ns e concatmeros


Cliva uma Eucariotos/topo III Mimivrus/topo Relaxa superenrolamento (-)
das fitas do IA Girase reversa de bactrias hipertermfilas, induz
DNA superenrolamento (+)
IB Eucariotos/topo I Relaxa superenrolamento (-) e (+)
Vrus e algumas bactrias
IC Somente um gnero de arqueas/topo Relaxa superenrolamento (-) e (+)
V
Tipo II IIA Eucariotos, vrus e bacterifagos/ Relaxa superenrolamento (-) e (+). Desfaz ns e
Cliva as duas topo II concatmeros
fitas do DNA Bactrias/topo IV
Bactrias, arqueas e cloroplasto, DNA Relaxa superenrolamento (+).
girase Induz superenrolamento (-) Desfaz ns e
concatmeros
IIB Arqueas, plantas e algumas algas/ Relaxa superenrolamento (-) e (+)
topo IV Desfaz ns e concatmeros

Zaha_5ed_02.indd 29 27/11/13 09:20


Biologia Molecular Bsica 30

DNA A DNA B DNA Z


Figura 2.9
Tipos mais comuns de DNA (A, B e Z). Repre-
sentao da estrutura tridimensional das molculas,
vista lateral. Foi traada uma fita ligando os grupa-
mentos fosfatos para evidenciar o enrolamento das
cadeias em torno do eixo da hlice. As bases nitro-
genadas esto representadas em forma de varetas e
em vermelho. Observe as alteraes no dimetro das
hlices e a alterao nas cavidades maior e menor.
Abaixo de cada hlice est a representao transversal
das molculas, mostrando a posio das bases nitro-
genadas em relao ao eixo das hlices.

Vista lateral

Vista do eixo

2. Uma volta da hlice percorre uma distncia de 3,40 O DNA tipo Z mais longo e fino que o tipo B. Uma
nm, que o passo da hlice. Cada par de bases adicio- volta completa da hlice ocorre a cada 12 pb, e o passo da
na hlice uma distncia de 0,33 nm. hlice aumenta para 4,56 nm, com um dimetro de 1,84
nm. A cavidade maior desaparece e a menor torna-se mui-
3. O dimetro da hlice dupla de 2,37 nm.
to profunda, formando uma espiral em torno da estrutura.
Se o DNA tipo B em soluo for desidratado, por Algumas regies do DNA in vivo podem estar nessa for-
exemplo, em 75% de etanol, ou se o contedo de sal for ma. Alguns fatores estabilizam a formao do DNA tipo Z,
diminudo, a molcula, que fina e comprida, se encur- como: a metilao ou a bromatao das bases e o estresse
tar e engrossar gerando o DNA tipo A (Figura 2.9). A torcional, como ocorre em regies do DNA superenrolado
cavidade maior se tornar mais estreita e mais profunda, negativamente ou quando determinadas protenas esto
e a cavidade menor mais larga e rasa. O passo da hlice ligadas ao DNA. Dois fatores determinam a possibilidade
reduz-se de 3,40 nm para 2,60 nm por volta, e o nmero da ocorrncia de regies de DNA tipo Z: a sequncia de
de pares de bases por volta aumenta para 11. nucleotdeos e a estrutura global da hlice dupla. Se tais
fatores forem propcios, o DNA pode converter-se do tipo
Tanto no DNA tipo B quanto no tipo A, a desoxirri-
B para o tipo Z em condies naturais. Isto parece ocorrer
bose e a base nitrogenada esto em lados opostos da li-
em regies do genoma que esto sendo ativamente trans-
gao glicosdica, ou seja, na conformao anti. Nessa
critas. O DNA tipo Z pode ter importncia na regulao da
situao, a repulso estrica entre a base e o acar est
expresso gnica e, tambm, estar envolvido em eventos
minimizada. Na presena de altas concentraes de c-
de processamento de DNA e em instabilidade gentica.
tions, alguns nucleotdeos assumem a conformao syn,
Existem protenas que se ligam especificamente a DNA
ficando o acar e a base do mesmo lado da ligao glico-
tipo Z. Entretanto, ainda no so bem conhecidas as fun-
sdica. Nessas condies, uma estrutura diferente, o DNA
es deste tipo de DNA na fisiologia celular.
tipo Z, formada (Figura 2.9). A hlice dupla neste tipo
de DNA est enrolada para a esquerda e alterna as con- Embora a hlice dupla seja a forma predominante
formaes syn e anti, sendo comum em sequncias onde do DNA na natureza, molculas de DNA de fita simples
os nucleotdeos G e C se alternam. As pirimidinas conser- compem os genomas de alguns vrus de animais e vege-
vam a conformao padro anti com o acar na forma tais, bem como os de alguns bacterifagos, que so vrus
C2'-endo e as purinas esto em syn e C3'-endo. A hlice bacterianos. Alguns bacterifagos que infectam a bactria
dupla gira para a esquerda nessas condies. Devido E. coli, por exemplo, os bacterifagos M13 e X174, apre-
aparncia em ziguezague da cadeia, essa forma, descrita sentam DNA de fita simples como genoma. Esse DNA
em oligonucleotdeos sintticos, foi denominada Z. produz uma forma replicativa (DNA de fita dupla), que

Zaha_5ed_02.indd 30 27/11/13 09:20


31 Estrutura dos cidos Nucleicos
o molde para a sntese de DNA dos bacterifagos replica- Essa alterao reduz o nmero de voltas da hlice
dos no hospedeiro. Genomas de procariotos e eucariotos dupla na regio, removendo o grau de superenrolamento
so discutidos no Captulos 4 e 5, respectivamente. negativo, em uma unidade para cada dez bases de parea-
mento. Essas estruturas ocorrem in vivo e so fundamen-
tais para determinados processos.
1.6 Outras estruturas do DNA
1.6.1 Curvatura 1.6.3 Junes de Holliday
Longas cadeias de DNA so muito flexveis, entretanto, As junes de Holliday so estruturas formadas por qua-
sequncias menores que 100 pb so relativamente rgidas tro fitas de DNA, sendo intermedirias importantes na
para serem curvadas. Algumas sequncias especficas e recombinao gentica (Captulo 8). Protenas e enzimas
protenas especiais tornam determinadas regies do DNA especficas reconhecem essas estruturas e determinam
mais suscetveis curvatura. Essas regies mais flexveis como elas sero clivadas, originando os produtos da re-
curvatura so importantes em sequncias envolvidas combinao.
com o controle de processos como a replicao, a trans-
crio e a recombinao.
Sequncias de DNA constitudas por regies de ade-
ninas tm sua curvatura facilitada, principalmente se tais 2. RNA
sequncias so intercaladas e se repetem vrias vezes. A Uma das molculas que gerou uma grande quantidade de
ligao de protenas tambm pode facilitar a curvatura. novos conhecimentos em biologia molecular na ltima
Um exemplo clssico o nucleossomo, no qual um seg- dcada foi o RNA. Descoberto na mesma poca em que o
mento de DNA de 145 pb se enrola quase duas vezes em DNA, os estudos com o RNA tiveram, a princpio, um de-
torno do octmero de histonas (Captulo 3). As cavidades senvolvimento mais lento. O nmero de classes diferen-
em contato com a protena devem ficar mais estreitas, e tes de RNA e o seu envolvimento em inmeros processos
as cavidades opostas mais largas. na clula, antes desconhecidos, foram, os principais res-
Muitas outras protenas, alm das histonas, promo- ponsveis pela demora na sua caracterizao e na desco-
vem curvatura no DNA: fatores de transcrio, enzimas berta das suas funes. Atualmente, o nmero de funes
de recombinao, enzimas que modificam o DNA, entre biolgicas em que os RNAs esto envolvidos ainda est
outras. Essas protenas curvam o DNA com diferentes aumentando.
magnitudes. Existem diferentes funes para a curvatura H pouco mais de dez anos, aos RNAs eram atribu-
do DNA, como: das funes, no sem importncia, primordialmente na
1. condensar e empacotar DNA, como nos nucleossomos; sntese de protenas. O RNA mensageiro (mRNA)
era visto como uma molcula intermediria na transfe-
2. expor a sequncia de bases internalizada na hlice rncia da informao contida no genoma para a sntese
dupla; das protenas. A sua conformao parecia ser aleatria
e sem importncia. A conformao do RNA riboss-
3. aproximar stios de ligao distantes no DNA linear;
mico (rRNA), gerada por suas estruturas secundria e
4. formar estruturas especiais protena-DNA para ali- terciria, parecia ser um mero arcabouo para interaes
nhar determinados stios, como no caso de recombi- com as protenas ribossmicas, com a funo de catali-
nao stio-especfica; sar a sntese das protenas. Os RNAs transportadores
(tRNAs) eram mais estudados em termos de estrutura
5. forar a molcula de DNA para estimular a clivagem
terciria, mas com vistas a sua capacidade de carregar os
ou a desnaturao.
aminocidos e interagir com os ribossomos.
1.6.2 Estruturas cruciformes Atualmente, os RNAs e a sua conformao espacial
so bastante estudados. Vrias novas classes de RNA
Existem sequncias no DNA que apresentam simetria,
foram descobertas e esto envolvidas no controle da ex-
contendo regies repetidas e invertidas. Por exemplo:
presso gnica (Captulo 14). Foram tambm descobertas
ATTCGCGTAGTAGACATAGCTGACATAGTCAG- novas possibilidades de interaes dos RNAs com as pro-
CTATGTCTGCTC tenas, com o DNA e com outros RNAs, a partir de uma
diversidade de conformaes espaciais. Quanto s pos-
Sequncias como essas podem formar estruturas
sveis atividades bioqumicas dos RNAs, a descoberta de
onde o pareamento entre as duas fitas substitudo pelo
que eles podem catalisar reaes levou formulao do,
pareamento entre as bases complementares na mesma
atualmente denominado o mundo do RNA. Uma mo-
fita.
lcula de RNA linear pode, em sua sequncia de bases,
ATTCGCGTAGTAGACATAGCTGACA armazenar informao gentica (semelhante ao DNA);
realizar um pareamento interno, formando uma estrutu-
:::::::::::::T ra secundria, expondo ou escondendo determinadas se-
CTCGTCTGTATCGACTGA quncias e, assim, interagir com outras molculas; pode

Zaha_5ed_02.indd 31 27/11/13 09:20


Biologia Molecular Bsica 32

assumir uma conformao espacial, estrutura terciria, pacial entre o ATP e o dATP, por exemplo. Na formao
contendo superfcies que podem interagir com outras da cadeia de RNA, esta diferena tambm tem seus efei-
molculas ou regies internas que possam criar stios tos. No RNA, ainda, ocorre a formao de hlice dupla,
de ligao com metais; e promover catlise, como as en- em regies onde existe pareamento entre duas sequn-
zimas. Esta maleabilidade de funes no exibida por cias. Neste caso, a sua estrutura assemelha-se ao DNA
nenhuma outra macromolcula na clula, permitindo, tipo A. A estrutura do DNA tipo B no formada no RNA
assim, propor que o RNA tenha sido a molcula pri- pareado devido ao impedimento espacial representado
mordial e que evoluiu para mais funes ainda, como pelo grupamento hidroxlico na posio 2' da ribose. H-
na regulao da expresso gnica, por exemplo. Portanto, bridos RNA-DNA so formados em diferentes processos
o conhecimento da estrutura e da conformao do RNA na clula, por exemplo, na transcrio, e sua estrutura
ainda mais relevante. do tipo A. As estruturas secundrias e tercirias do RNA
so importantes nas suas funes e no reconhecimento
protena-RNA.
2.1 Composio qumica
A Figura 2.10 mostra alguns tipos de estruturas se-
Existem semelhanas entre a estrutura do RNA e a do
cundrias dos RNAs. Os denominados grampos so
DNA. Ambos so polmeros lineares de subunidades
de nucleotdeos ligadas entre si por ligaes fosfodis- estruturas muito frequentes, compostas pelo pareamento
ter 5'3' (Figura 2.10A). Entretanto, na molcula de interno de uma cadeia simples de RNA formando uma
RNA, o acar presente a ribose, e a base nitrogenada ala onde no existe pareamento. A estabilidade destes
timina (T) substituda pela base nitrogenada uracila grampos muito varivel, dependendo da sequncia do
(U). Portanto, o RNA composto por adenina, citosina, pareamento e da sequncia presente na ala.
guanina e uracila. A presena da ribose origina a deno-
minao de cido ribonucleico. O RNA predominante- 2.3 Classes de RNA
mente de cadeia simples, mas forma regies de cadeia
dupla por pareamentos internos. Estas regies variam Em contraste com o DNA, diferentes tipos de RNA esto
muito em sua extenso, dependendo da classe de RNA presentes nas clulas e possuem funes especficas. Os
e da sua funo. RNAs so classificados de acordo com a sua localizao
e a sua funo na clula. Os avanos nos ltimos anos,
O RNA mais reativo que o DNA. A diferena apa- principalmente na rea de caracterizao de genomas
rentemente sutil da presena da hidroxila na posio 2' e os mtodos de alto desempenho para avaliar a trans-
da ribose (Figura 2.10A) tem reflexos importantes na es- crio, levaram descoberta de vrias novas classes de
trutura e na reatividade do RNA. Assim, o DNA estvel RNAs. Algumas dessas classes ainda tm funes no en-
em presena de lcali, pois, apesar das fitas serem des- tendidas em sua totalidade e outras classes provavelmen-
naturadas com o rompimento das pontes de hidrognio, te sero descritas. Portanto, importante aqui apresentar
as ligaes fosfodister nas cadeias permanecem inalte- uma classificao geral dos RNAs descritos at o momen-
radas. O RNA, na presena de lcali, hidrolisado, origi- to (Tabela 2.3).
nando uma mistura de nucleosdeos monofosfatados 2' e
3'. Na presena de ons hidroxila, o grupamento 2'-hidro- Os principais tipos de RNA encontrados nas clulas,
xlico da ribose convertido no nion alcxi. Esse um envolvidos diretamente na sntese de protenas so os
potente agente nucleoflico que reage com o grupamen- seguintes:
to 3'-fosfodister, formando um nucleotdeo cclico, 1. mRNA (RNA mensageiro), que transfere a infor-
2',3'-nucleosdeo monofosfato. Nesse processo, a ligao mao gentica do DNA aos ribossomos, local onde
fosfodister 5'3' rompida. Em seguida, o nucleotdeo
ocorre a sntese das protenas. Representa 1 a 5% do
cclico submetido a uma segunda hidrlise, em que um
RNA total da clula.
on hidroxila rompe o ciclo fosfodister, formando uma
mistura de nucleosdeos monofosfatados 2' e 3'. 2. rRNA (RNA ribossmico), que o componente majo-
ritrio dos ribossomos. Representa cerca de 75% do
RNA total da clula formando fitas duplas por parea-
2.2 Estrutura secundria mentos internos.
Pareamentos entre C e G e entre A e U ocorrem entre re-
3. tRNA (RNA transportador), que transporta os res-
gies complementares da mesma molcula do RNA ou,
duos de aminocidos at os ribossomos para a snte-
com menos frequncia, entre molculas distintas. A pre-
se das protenas. Representa 10 a 15% do RNA total
sena da hidroxila no carbono 2' da ribose, tambm acar-
da clula.
reta uma diferena espacial grande em relao posio
do grupamento fosfato em relao base nitrogenada. A descoberta das outras classes de RNA levou a uma
Observe na Figura 2.1C a diferena da conformao es- subdiviso mais ampla dos RNAs, em codificadores e no

Zaha_5ed_02.indd 32 27/11/13 09:20


33 Estrutura dos cidos Nucleicos
A B mRNA de bactria
O Extremidade UAG
5'-fosfato AUG
UGA
O P O- RBS UAA
p
O
Adenina 5'UTR 3'UTR
O Ligao
5' C H2
glicosdica
C 4' 1' C mRNA de eucarioto
H H
H H UAG
3' 2' AUG
UGA
C C
UAA
OH 5'UTR 3'UTR
m7Gppp A(~200)
O
- Ligao
O P O
fosfodister
O
Citosina C
O
CH2
C C
H H
H H
C C
OH
O
-
O P O
O
Guanina
O
CH2
C
D
C
H H
H H
C C
OH
O
-
O P O
O
Uracila
O
5' CH2

C 4' 1' C
H H
H H
2'
3' C C
OH
OH
Extremidade
3'-hidroxila

Figura 2.10
Estrutura do RNA. (A) Formao da cadeia do RNA. Note a hidroxila na posio 2' da ribose e a substituio
da timina (no DNA) pela uracila no RNA. (B) Organizao de mRNA em bactrias e em eucariotos. Em verme-
lho a regio que codifica a protena com os cdons de incio e trmino da traduo. UTR: regio no traduzida
(de untranslated sequences); m7G: metil-7-guanosina (5' CAP); A(~200): cauda de poli(A). (C) Estrutura secun-
dria do tRNA (RNA de transferncia). As regies pareadas so os grampos e a regies no pareadas so as
alas. (D) Estrutura secundria complexa do rRNA 16S de bactria (RNA ribossmico). Observe que molculas
uma cadeia nica de RNA com regies internas de pareamento.

Zaha_5ed_02.indd 33 27/11/13 09:20


Biologia Molecular Bsica 34

Tabela 2.3 Classes de RNAs, processos celulares que participam, distribuio e funoa
Processo
Tipo celular Classe Procarioto Eucarioto Funo

Codificador Sntese de mRNA P P Contm a sequncia para a sntese das


protenas (mensageiro) protenas
No Sntese de rRNA P P Forma junto com as protenas
codificador protenas (ribossmico) 70S 80S ribossmicas os ribossomos.
(50S+30S) (60S+40S) Local da sntese das protenas
tRNA P P Transporta os aminocidos ao local da
(transportador) sntese das protenas
Processamento snoRNA A P Maturao de ribossomos e RNAs
do rRNA e tRNA (RNA nucleolar Nuclolo transportadores
pequeno)
Processamento snRNA A P Sntese do mRNA eucaritico
do pr-RNA (RNA nuclear Ncleo
pequeno)
Regulao da sRNA (RNA P P Modula a traduo e a estabilidade de
expresso gnica pequeno) Liga-se em mRNAs
protenas e
em RNAm
100 a 300nt
CRISP RNA P A Interfere com a infeco por bacterifagos
(RNA CRISP) Homologia e com a conjugao
com
bacterifagos
e plasmdeos
miRNA (micro A P Silenciamento gnico. Reprime a traduo
RNA) Curto ou cliva mRNAs alvo
siRNA (RNA A P Silenciamento gnico. Cliva mRNAs
de interferncia Curto (vrus de retroelementos ou sequncias
pequeno) repetitivas)
piRNA (RNA A P Silenciamento gnico em clulas
que liga a germinativas
protena PIWI)
lncRNA (RNA A P Muito transcrito. Transcrio
no codificador Ncleo e generalizada. Existem subclasses
longo) citoplasma
a
Classes de RNA descritas e com funo reconhecida at 2009.
A = ausente; P = presente.

codificadores. RNAs codificadores so exclusivamente caractersticas semelhantes aos RNAs procariticos, que
aqueles que contm a informao gentica para a sntese realizam a sntese de protenas a partir dos genomas das
das protenas. So os mRNAs das clulas procariticas e organelas.
eucariticas. No caso das clulas eucariticas, os mRNAs
Nos procariotos, foram descritas mais duas classes
so produzidos, a princpio, como precursores denomi-
de RNAs no codificadores, os sRNAs (de small) e os
nados pr-mRNAs, que passam por vrios processos de
CRISP RNAs (de clustered regulatory interspaced
modificao para produzir o mRNA final ativo.
short palindromic repeats). Os sRNAs so pequenos
Todos os demais RNAs so denominados no co- (entre 100 e 300 nt), podem parear com mRNAs espec-
dificadores e incluem o rRNA e o tRNA. Estas trs ficos, podem ligar-se com protenas e regular a expres-
classes (mRNA, rRNA e tRNA) participam diretamen- so de determinados genes por alterao da estabilida-
te da sntese de protenas e so denominados RNAs de do mRNA ou por modulao da traduo. Os CRISP
de manuteno do metabolismo celular bsico RNAs tm sequncias homlogas com genomas de bac-
(housekeeping). Nas clulas eucariticas, alm destes terifagos (vrus de bactrias) e plasmdeos e interferem
RNAs de manuteno, as organelas, as mitocndrias e com a infeco por bacterifagos e com a conjugao de
os cloroplastos tm seus mRNAs, rRNAs e tRNAs com plasmdeos.

Zaha_5ed_02.indd 34 27/11/13 09:20


35 Estrutura dos cidos Nucleicos
Nos organismos eucariticos, alm dos RNAs no As demais classes de RNA de eucariotos esto envol-
codificadores (rRNA e tRNA) ainda so encontrados vidas na regulao da expresso dos genes. So RNAs no
os RNAs nucleares pequenos, snRNAs (de small nu- codificadores ncRNA (de non-coding) que so divididos
clear), os RNAs citoplasmticos pequenos, scRNAs em dois grupos: curtos e longos. Os ncRNAs curtos so:
(de small cytoplasmic) e os RNAs nucleolares (do nu- os microRNAs, miRNAs (de micro), os RNAs de interfe-
clolo) pequenos, snoRNAs (de small nucleolar). Es- rncia pequenos, siRNA (de small interfering, algumas
tes RNAs tambm esto envolvidos com a manuteno vezes somente iRNA) e os piRNAs. Esses RNAs ligam-
bsica do metabolismo da clula. Os snRNAs so en- -se com duas classes de protenas: as Argonautas (mi e
contrados no ncleo, formando complexos com prote- siRNA) e as protenas PIWI (piRNA). Os miRNAs e os
nas, as ribonucleoprotenas (RNPs), e participam siRNAs so encontrados em todas as clulas eucariticas.
do processo de remoo dos ntrons. Os snRNAs so Os piRNAs so encontrados apenas em clulas germina-
encontrados no nuclolo (regio do ncleo onde ocorre tivas de animais. Os ncRNAs longos, lncRNA (de long
a sntese do rRNA) e participam do processamento dos non-coding), so encontrados tanto no ncleo como no
ribosomos. citoplasma, sendo, em geral, transcritos e tendo funes
regulatrias ainda no totalmente elucidadas.

estando os tomos nas extremidades e nos vrti-


ces representados em diferentes cores.

Representao grfica de
molculas e tomos
Para representar tomos e molculas, existem pelo
menos trs formas:
1. A representao de frmula elementar: os tomos 3. A representao de preenchimento (ou superfcies
so representados por letras, e as ligaes qumi- de Van der Waals): so representadas as superf-
cas, por traos. cies das nuvens eletrnicas, ou seja, uma aproxi-
NH2 mao do espao ocupado pelo tomo ou molcula.
N C
C N
HC
C CH
O O O N N
O P O P O P O CH2
O
O O O
C C
H H H
H
C C
OH H

2. A representao em forma de varetas (stick): as li-


gaes qumicas so representadas como bastes,

Zaha_5ed_02.indd 35 27/11/13 09:20


Biologia Molecular Bsica 36

Resumo
Os cidos nucleicos DNA e RNA so polmeros de vivo e pelas protenas ou enzimas. As cadeias podem
nucleotdeos, desempenham funes vitais na clula e ser renaturadas, voltando a ter exatamente as mesmas
so encontrados em todos os organismos vivos. O DNA propriedades, em um processo denominado hibridiza-
tem como funo principal armazenar, em sua sequn- o. O DNA de hlice dupla, em geral, sofre um supe-
cia de bases, a informao gentica. A capacidade de renrolamento, que forma a sua estrutura terciria. O
autorreplicao do DNA permite que esta informao superenrolamento mantido nas clulas por enzimas
seja transmitida s geraes seguintes. Molculas de denominadas topoisomerases e fundamental para v-
DNA so polmeros muito longos, e os nucleotdeos rios processos. O RNA composto pela ribose e pelas
componentes contm a desoxirribose como acar e as bases nitrogenadas adenina, uracila, citosina e guanina.
bases nitrogenadas adenina, timina, citosina e guanina. O RNA normalmente de cadeia simples, mas forma
O DNA forma uma cadeia dupla que tem seu parea- muitas estruturas secundrias por pareamentos inter-
mento mantido por pontes de hidrognio entre bases nos. Existem vrias classes de RNAs nas clulas direta-
complementares (AT e CG), formando uma hlice, sen- mente envolvidas na sntese de protenas, no processa-
do as cadeias antiparalelas. Os trs principais tipos de mento dos RNAs, que normalmente so produzidos
DNA so: tipo B, que o predominante, tipo A e tipo Z. como precursores no funcionais, e na regulao da
Estas cadeias podem ser separadas por ruptura das expresso gnica. As classes bsicas so o RNA mensa-
pontes de hidrognio, que pode ser provocada pelo au- geiro (mRNA), o ribossmico (rRNA) e o transportador
mento da temperatura, por agentes desnaturantes ou in (tRNA).

Leituras recomendadas
Brosnan CA, Voinnet O. The long and the short of noncoding and a possible function for pervasive transcription. Science.
RNAs. Curr Opin Cell Biol. 2009;21(3):416-25. 2007;316(5830):1484-8.
Carninci P. Molecular biology: the long and short of RNAs. Kapranov P, Willingham AT, Gingeras TR. Genome-wide
Nature. 2009;457:974-75. transcription and the implications for genomic organization.
Nat Rev Genet. 2007;8(6):413-23.
Carthew RW, Sontheimer EJ. Origins and mechanisms of
miRNAs and siRNAs. Cell. 2009;136(4):642-55. Review. Kim VN, Han J, Siomi MC. Biogenesis of small RNAs in
animals. Nat Rev Mol Cell Biol. 2009;10(2):126-39. Review.
Champoux JJ. DNA topoisomerases: structure, function,
and mechanism. Annu Rev Biochem. 2001;70:369-413. Li PT, Vieregg J, Tinoco I Jr. How RNA unfolds and refolds.
Review. Annu Rev Biochem. 2008;77:77-100. Review.
Cooper TA, Wan L, Dreyfuss G. RNA and disease. Cell. Liu Z, Deibler RW, Chan HS, Zechiedrich L. The why and
2009;136(4):777-93. Review. how of DNA unlinking. Nucleic Acids Res. 2009;37(3):661-
71. Review.
Draper DE, Biophys J. RNA folding: thermodynamic
and molecular descriptions of the roles of ions. Malone CD, Hannon GJ. Small RNAs as guardians of the
2008;95(12):5489-95. genome. Cell. 2009;136(4):656-68. Review.
Ellington AD, Chen X, Robertson M, Syrett A. Evolutionary Ponting CP, Oliver PL, Reik W. Evolution and functions of
origins and directed evolution of RNA. Int J Biochem Cell long noncoding RNAs. Cell. 2009;136(4):629-41. Review.
Biol. 2009;41(2):254-65. Review.
Schoeffler AJ, Berger JM. DNA topoisomerases: harnessing
Ghildiyal M, Zamore PD. Small silencing RNAs: an and constraining energy to govern chromosome topology. Q
expanding universe. Nat Rev Genet. 2009;10(2):94-108. Rev Biophys. 2008;41(1):41-101.
Review.
Sharp PA. The centrality of RNA. Cell. 2009;136(4):577-80.
Hendrix DK, Brenner SE, Holbrook SR. RNA structural
Svoboda P, Di Cara A. Hairpin RNA: a secondary structure
motifs: building blocks of a modular biomolecule. Q Rev
of primary importance. Cell Mol Life Sci. 2006;63(7-8):901-
Biophys. 2005;38(3):221-43.
8. Review.
Jacquier A. The complex eukaryotic transcriptome:
Witz G, Stasiak A. DNA supercoiling and its role in
unexpected pervasive transcription and novel small RNAs.
DNA decatenation and unknotting. Nucleic Acids Res.
Nat Rev Genet. 2009;10(12):833-44.
2010;38(7):1-15.
Kapranov P, Cheng J, Dike S, Nix DA, Duttagupta R,
Willingham AT, et al. RNA maps reveal new RNA classes

Zaha_5ed_02.indd 36 27/11/13 09:20


Captulo 3

Henrique Bunselmeyer Ferreira

Cromatina

1. Cromatina procaritica 38 2.3 Nveis de organizao mais complexos da


1.1 Nucleoide e cromatina bacteriana 38 cromatina eucaritica 48
1.2 Nucleoide e cromatina de arqueas 42 2.3.1 Fibra de 10 nm 50
2.3.2 Fibra de 30 nm 52
2. Cromatina eucaritica 46 2.3.3 Alas de cromatina e fibra de 300
nm 53
2.1 Composio molecular da cromatina
eucaritica 46 2.3.4 Estruturas de cromatina de
ordem superior e cromossomos
2.2 Nucleossomos eucariticos 48
metafsicos 54

3. Cromatina de organelas 54
3.1 Nucleoides mitocondriais 55
3.2 Nucleoides de plastdeos 55

Zaha_5ed_03.indd 37 27/11/13 10:51


Biologia Molecular Bsica 38

Um princpio geral evidente na organizao do mate- ser dito que eles so cilndricos. Em E. coli, por exemplo,
rial gentico de qualquer forma de vida, seja ela acelular, as dimenses do nucleoide giram em torno de 1,7 m de
como um vrus, ou celular, como um organismo proca- comprimento e 0,65 m de dimetro, determinando um
3
ritico ou eucaritico. Em qualquer caso, as molculas de volume prximo a 0,5 m . Esse volume contrasta com
3
RNA ou DNA devem ser compactadas para sua acomoda- os 200 m , que seriam ocupados pelo DNA genmico
o no compartimento que ocupam. Isso ocorre porque da bactria, caso estivesse livre. Por isso, cromossomos
a extenso das molculas de cido nucleico, que consti- procariticos, no contexto do nucleoide, precisam ser
tuem os genomas, excede em muito as dimenses do es- compactados algumas centenas de vezes, formando uma
pao a elas destinado, seja ele proporcionado por um cap- estrutura de cromatina organizada e funcional.
sdeo viral, por uma clula procaritica ou pelo ncleo de
Apesar de semelhantes em muitos aspectos de suas
uma clula eucaritica. Por exemplo, o capsdeo do vrus
respectivas organizaes gnica e genmica (ver Captulo
do mosaico do tabaco (TMV, de tobacco mosaic virus),
4), bactrias e arqueas diferem em outros aspectos mo-
com 0,0008 m de dimetro e 0,3 m de comprimento,
leculares bsicos, dentre os quais se inclui a estrutura da
acomoda um genoma de RNA que tem 2 m de exten-
cromatina. Isso ocorre porque diferentes protenas inte-
so. J a bactria Escherichia coli, um procarioto tpico,
ragem com o DNA em nucleoides de bactrias e arqueas,
com uma clula cilndrica de 2 m de comprimento e 1
e os complexos nucleoproteicos formados definem confi-
m de dimetro, abriga um genoma de DNA circular de
guraes de cromatina distintas, entre esses dois clados
1.600 m (1,6 mm) de circunferncia. Entre eucariotos,
procariticos. Nas duas prximas sees, ser descrita a
as discrepncias entre as dimenses do compartimento
estrutura geral do nucleoide e as interaes nucleoprotei-
que abriga o genoma e a extenso de DNA total so ainda cas que caracterizam a cromatina procaritica.
maiores. O ncleo esfrico de 6 m de dimetro de uma
clula humana, por exemplo, abriga uma extenso total
de DNA de 1,8 m. 1.1 Nucleoide e cromatina bacteriana
fundamental que a compactao do material gen- A estrutura geral do nucleoide depende de foras ine-
tico acontea de forma organizada, pois somente assim rentes prpria estrutura do DNA cromossmico e de
pode ser viabilizada a ocorrncia de processos funcionais interaes entre o DNA e outras molculas, podendo ser
(da replicao e segregao de cromossomos at a ex- identificados diferentes nveis de compactao e organi-
presso gnica). Essa compactao funcional alcanada zao estrutural e funcional na cromatina bacteriana. No
pelas interaes organizadas das molculas de cido nu- espao ocupado pelo nucleoide em uma clula, o DNA
cleico com as protenas especficas. A identidade dessas encontra-se em uma concentrao elevada (da ordem de
protenas e a mecnica molecular da compactao gen- 50 a 100 mg/mL), o que tambm acontece com protenas
mica diferem entre os diversos organismos. e ons que tm afinidade pelo DNA.
Em alguns sistemas virais, diferentes estratgias de Algumas poliaminas (ctions polivalentes, como a
montagem de capsdeos em torno de molculas de DNA espermidina e a putrescina) e outros ctions, juntamente
ou RNA so utilizadas. Exemplos de processos de monta- com o DNA, configuram o nucleoide como um ambien-
gem de capsdeo so discutidos no Material Comple- te eletricamente carregado. Nesse ambiente, a estrutura
mentar Online 3.1. Em sistemas celulares, por outro polianinica do DNA e a autorrepulso proporcionada
lado, tanto no caso de procariotos como no de eucariotos, por ela, contrabalanada por interaes com contraons,
o DNA que constitui o genoma compactado por sua as- levam ocorrncia de mudanas de trajetrias aleatrias
sociao com protenas em um arranjo mais complexo, no DNA, a cada 150 pb (equivalentes a uma extenso de
cujo grau de compactao varia de acordo com seu es- 50 nm), que definem o primeiro nvel de compactao do
tado funcional. Esse arranjo nucleoproteico organizado DNA, cromossmico (Figura 3.1A).
e dinmico chamado de cromatina e, ao longo deste Um nvel maior de compactao do cromossomo
captulo, sero analisadas as configuraes tpicas da cro- proporcionado pela formao de alas, que formam do-
matina de procariotos e de eucariotos, descrevendo sua mnios topolgicos independentes (Figura 3.1B). Cada
organizao, unidades constituintes bsicas e discutindo ala que constitui um domnio tem, em mdia, 10 kb de
como elas podem ser arranjadas em estruturas progressi- extenso total, sua base e o seu pice so mantidos por
vamente mais compactas. interaes entre o DNA e as protenas cromatnicas. Ao
longo de cada ala, um nvel adicional de compactao
da cromatina obtido pela introduo do superenro-
lamento negativo no DNA (ver Captulo 2), o que tam-
1. Cromatina procaritica bm depende de interaes com protenas especficas
(detalhe da Figura 3.1B). Alm disso, no contexto da or-
Todos os procariotos (bactrias e arqueas) tm genomas
ganizao em domnios topolgicos, h nveis adicionais
estruturados em um nucleoide, uma massa de croma-
de organizao estrutural do cromossomo, que definem
tina ocupando cerca de 1/4 do volume celular total. Por
os chamados macrodomnios.
no serem delimitados por qualquer tipo de envoltrio e
serem estruturas funcionalmente dinmicas, os nucleoi- Os macrodomnios so superestruturas que abran-
des procariticos no tm uma forma fixa, embora possa gem de dezenas a centenas de domnios topolgicos,

Zaha_5ed_03.indd 38 27/11/13 10:51


39 Cromatina
A B Interaes
com protenas
especficas
no pice das alas

Ala de DNA
10 m

~10 kb

Interaes
b
0p ) com protenas
15 nm especficas
(50 na base das alas

Figura 3.1
Nveis progressivos de compactao do DNA no nucleoide bacteriano. (A) Um cromossomo
bacteriano em soluo, independentemente de interaes com protenas, forma uma massa de DNA
enrolado de forma aleatoria, que ocuparia um espao esfrico com um dimetro em torno de 10 m; isso
ocorre porque foras entrpicas determinam que o DNA mude de trajetria (dobre-se) aproximadamente
a cada 150 pb ou 50 nm (detalhe). (B) Na clula, interaes com protenas definem a formao de alas
que constituem domnios topolgicos independentes, sendo cada uma estabilizada na sua base e no seu
pice; a compactao adicional conseguida pelo superenrolamento localizado do DNA nas alas, o que
depende de interaes com protenas (detalhe).

compartimentalizando o cromossomo em grandes seg- protenas que delimitam as alas (ver Figura 3.1B) atuam
mentos com funes distintas (ver Captulo 4). Do pon- como barreiras que impedem a livre difuso de superen-
to de vista funcional, os macrodomnios podem diferir rolamento ao longo do DNA, permitindo que, em cada
quanto probabilidade de seu envolvimento em eventos domnio, o DNA possa apresentar diferentes graus de su-
de recombinao, ou frequncia de transcrio nos ge- perenrolamento. J na fase estacionria de multiplicao
nes ali presentes. Do ponto de vista estrutural, pouco se caracterizada por desacelerao do processo de diviso
sabe sobre a organizao da cromatina nos macrodom- celular e diminuio acentuada da atividade transcricio-
nios, mas acredita-se que sejam interaes especficas nal, o nucleoide passa a ter um nmero menor de dom-
com protenas que delimitam fisicamente cada um desses nios e, em cada um deles, o DNA apresenta uma estrutura
grandes segmentos cromossmicos, ao mesmo tempo em mais relaxada, isto , com menor grau de superenrola-
que determinam suas diferentes propriedades funcionais. mento (Figura 3.2C).
A estrutura do nucleoide bacteriano dinmica e va- Um grupo heterogneo com mais de uma dezena de
ria conforme o estado fisiolgico da clula. Por exemplo, protenas que se ligam ao DNA, chamadas de protenas
quando uma bactria est na chamada fase exponencial associadas ao nucleoide (NAPs, de nucleoid-associa-
de sua multiplicao, o nucleoide se organiza em um ted proteins) (Tabela 3.1), o principal responsvel pela
grande nmero (de centenas a milhares) de domnios to- estruturao do nucleoide. As NAPs desempenham dife-
polgicos e possui DNA superenrolado negativamente em rentes papis na organizao da cromatina bacteriana e a
cada um deles (Figura 3.2A e B). Os limites e a extenso atividade de cada protena depende do(s) efeito(s) que ela
de cada domnio variam muito, podendo haver a forma- exerce sobre o trecho do DNA ao qual est ligada. Os efei-
o de alas com at 30 kb ou mais de extenso e com o tos mais evidentes das NAPs so: o dobramento ou o enro-
nucleoide podendo passar de uma estrutura mais com- lamento localizado de uma molcula de DNA e a interliga-
pacta (Figura 3.2A), que agrupa certos genes altamente o (bridging) de duas pores de uma mesma molcula
transcritos, como os genes de rRNA, para uma mais es- de DNA ou de duas molculas de DNA diferentes (for-
tendida (Figura 3.2B), que desfaz esses agrupamentos, mando uma ponte DNA-protena-DNA). Na Figura 3.3,
quando h diminuio do nvel geral de transcrio. As esto representadas as NAPs bacterianas mais conhecidas

Zaha_5ed_03.indd 39 27/11/13 10:51


Biologia Molecular Bsica 40

A B C

Figura 3.2
A dinmica de alterao estrutural do nucleoide bacteriano nas fases expo-
nencial ou estacionria de multiplicao. Na fase exponencial de multiplicao,
o nucleoide pode adotar uma conformao mais compacta (A), com maior nmero de
domnios (alas) de DNA superenrolado, ou uma conformao mais estendida (B), com
um nmero menor desses domnios topolgicos. A transio de uma conformao para a
outra reversvel, como indicado pelas setas, e est correlacionada com o nvel de trans-
crio geral na clula. Em situaes de multiplicao mais acelerada (altos nveis transcri-
cionais), adotada a conformao compacta, que aproxima fisicamente genes altamente
transcritos (representados em ), formando o que se convenciona chamar de fbricas
de transcrio (reas indicadas por crculos em ). Em situaes de multiplicao mais
lenta (nveis transcricionais menores), adotada a conformao estendida, que desfaz as
fbricas de transcrio mantendo os genes transcritos mais dispersos. Quando a bactria
chega a uma fase estacionria de multiplicao, o nucleoide passa a ter uma estrutura ain-
da mais estendida (C), em que o nmero de domnios topolgicos menor e a estrutura
do DNA mais relaxada (com menor contedo de superenrolamento).

Tabela 3.1 Protenas associadas ao nucleoide bacteriano e suas propriedades


Massa Estado oligomrico Efeito(s) sobre
a b c
Protena molecular funcional Stios de ligao no DNA o DNA

CbpA 33 kDa Homodmero DNA curvado n.d.


CbpB 33 kDa Monmero DNA curvado n.d.
EbfC 11 kDa Homodmero GTNAC Provavelmente
interligao
Dps/MrgA 17-19 kDa Monmero ou dodecmero n.d. n.d.
Fis 22 kDa Homodmero Segmentos com repeties de AT ou A, Dobramento,
especialmente (A)6 enrolamento,
interligao
Hlp 21 kDa Monmero n.d. n.d.
H-NS 15,5 kDa Homodmero ou TCGATAAATT e sequncias ricas em Interligao
Heterodmero (H-NSStpA) AT
HU 9,5 kDa (HU) Heterodmero (HU-Hu) Preferencialmente sequncias ricas em Dobramento,
9,5 kDa (HU) AT ou DNA curvado enrolamento
IHF 11 kDa (IHF) Heterodmero (IHF-IHF) (A/T)ATCAANNNNTT(A/G) Dobramento
9,5 kDa (IHF)
Lrp/AsnC 15-18 kDa Homodmero, Octmero ou n.d. Enrolamento,
Hexadecmero interligao
Lsr2 12 kDa Homodmero Sequncias ricas em AT Interligao
SMC/MukB 150-200 kDa Homodmero Preferencialmente DNA de fita simples Interligao
MvaT 13,6 kDa Homodmero Sequncias ricas em AT Interligao
StpA 15,3 kDa Homodmero ou Sequncias ricas em AT Interligao
Heterodmero (H-NSStpA)
a
Informaes sobre a nomenclatura das protenas listadas esto disponveis no Material Complementar Online 3.2.
b
Nas sequncias de DNA, N = qualquer nucleotdeo (A, C, G ou T).
c
Apenas efeitos j comprovados por experimentos in vitro ou in vivo esto listados.
n.d. = no determinado.

Zaha_5ed_03.indd 40 27/11/13 10:51


41 Cromatina
A B C
Figura 3.3
Ligao e efeitos no DNA de algumas NAPs. Nos modelos
apresentados, o dplex de DNA est representado em e as prote-
nas, nos respectivos estados oligomricos funcionais, em .
(A) Dobramento e formao de um nodo (interligao de dois
segmentos do DNA) devido ligao de dois dmeros (cada um re-
presentado por uma esfera) da Fis. (B) Dobras no DNA induzidas
por ligao da HU (em baixas concentraes) ou da IHF. (C) Em
concentraes mais elevadas, a HU leva formao de filamentos
D E super-helicoidais de DNA relativamente rgidos; dois modelos de
filamentos HU-DNA so mostrados, com o da esquerda correspon-
dendo a um filamento menos rgido e o da direita a um filamento
mais rgido. (D) Dois modelos possveis para a interligao de DNA
mediada por molculas da H-NS. (E) Entrelaamento de segmentos
de DNA, devido ligao de molculas da SMC/MukB; os dme-
ros da protena podem estar associados individualmente ao DNA
(esquerda) ou na forma de multmeros (direita). (F) Enrolamento
(esquerda) e interligao (direita) do DNA mediados pela Lrp. (G)
F G A Drp forma dodecmeros (representados por esferas) que se asso-
ciam em uma estrutura hexagonal de 3 camadas (em cima, em uma
vista lateral) com poros; nesse complexo proteico, o DNA arranja-
do em uma estrutura de segmentos paralelos, que passam entre as
camadas e atravs dos poros (embaixo, em uma vista laterofrontal).

estrutural e funcionalmente, sendo apresentados alguns estabilizao das bases das alas, estariam envolvidas
dos efeitos exercidos por elas sobre o DNA. NAPs capazes de fazer a interligao de diferentes seg-
mentos do DNA (H-NS, Lrp e SMC/MukB), ao passo que
Todas as NAPs tm a capacidade de compactar o
NAPs capazes de induzir o dobramento do DNA, (Fis,
DNA, mas, na organizao da cromatina, a contribuio
IHF e HU) definiriam o pice de cada ala. Por fim, o grau
individual de cada tipo de NAP relativamente modesta.
de superenrolamento do DNA nos domnios topolgicos
Os graus de compactao e organizao atingidos so o
independentes requer a atuao de NAPs como a SMC/
resultado do somatrio das atividades de vrias NAPs.
MukB, que introduz e estabiliza supererolamentos nega-
Alm disso, h sobreposio parcial de funes entre as
tivos no DNA, e a H-NS, que delimita segmentos de DNA
NAPs, o que evidenciado pela manuteno da estru-
com diferentes graus de superenrolamento.
tura da cromatina mesmo na ausncia de uma dessas
protenas (em caso de mutao deletria no gene corres- O repertrio de NAPs expressas na clula varia em
pondente), demonstrando que as atividades de uma ou funo do estado fisiolgico da bactria, sugerindo uma
mais das outras NAPs podem compensar funcionalmen- relao de causa e efeito com as alteraes estruturais
te essa ausncia. observadas no nucleoide (ver Figura 3.2). A Figura 3.4
apresenta os padres de expresso diferencial de algumas
Apesar do pouco conhecimento sobre as funes es-
NAPs, em funo do andamento do processo de multipli-
pecficas desempenhadas pelas NAPs, algumas dessas
cao de E. coli, demonstrando que diferentes composi-
protenas podem ser associadas compactao global
es de protenas que dobram e interligam o DNA modu-
do nucleoide, formao de determinadas estruturas da
lam a estrutura do nucleoide em cada fase. As diferentes
cromatina bacteriana ou definio do grau de superen-
composies proteicas e o estado de compactao do
rolamento do DNA. Existem evidncias experimentais do
DNA modulam funcionalmente a cromatina bacteriana,
envolvimento de pelo menos seis NAPs (Dps/MrgA, Fis,
que, em fase exponencial de multiplicao, muito mais
IHF, H-NS, HU e SMC/MukB) nos mecanismos gerais de
ativa do ponto de vista da transcrio e da replicao do
compactao da cromatina, que dependeriam apenas de
que no estgio de multiplicao estacionrio.
suas capacidades de ligao ao DNA. A manuteno de
certas estruturas da cromatina, como as bases e os pices A mecnica molecular dos processos de regulao da
das alas de DNA (ver Figura 3.B), por sua vez, parece expresso gnica influenciada pela estrutura da croma-
envolver a atuao mais especfica de algumas NAPs. Na tina, de modo que muitos genes podem ter a sua trans-

Zaha_5ed_03.indd 41 27/11/13 10:51


Biologia Molecular Bsica 42

Figura 3.4

Concentrao relativa da protena


Fis
Nveis de expresso de algumas NAPs em

Log do nmero de clulas


diferentes fases da multiplicao de E. Dps
coli. A curva sigmoide tpica que representa o HU
processo de multiplicao celular, obtida a partir
da plotagem do logaritmo (Log) do nmero de IHF
clulas versus o tempo, est indicada em e as
diferentes fases do processo (lag, exponencial e
estacionria) esto indicadas, respectivamente, H-NS
por reas coloridas em tons progressivamente
mais escuros de . As concentraes relativas
das diferentes NAPs esto indicadas por curvas
coloridas em (Fis), (H-NS), (HU),
(IHF) e (Dps).
Tempo

crio regulada por NAPs. Esse tipo de regulao pode conforme o estado fisiolgico da clula. Entretanto, as fi-
ser de dois tipos: indireto, em razo de alteraes no grau bras de cromatina que compem o nucleoide em arqueas
de supertoro de um domnio cromossmico (ala), que diferem estruturalmente das bacterianas, pois apresen-
afetam positiva ou negativamente a transcrio de genes tam sistemas de compactao distintos, alguns dos quais
naquela regio; e direto, pois algumas NAPs podem se li- lembram mais estruturas da cromatina eucaritica (Seo
gar a regies reguladoras e ativar ou reprimir a transcri- 2). Essa organizao hbrida da cromatina de arqueas
o de alguns genes. reflexo da histria evolutiva do domnio Archaea, que se
Existe outras protenas que podem influenciar a es- separou inicialmente da linhagem bacteriana e, em um
trutura do nucleoide. Dentre essas protenas, destacam- segundo momento, da linhagem eucaritica (ver Captu-
-se a DnaA, a IciA e a SeqA, envolvidas no controle da lo 4). Com isso, as arqueas atuais apresentam um amplo
replicao (ver Captulo 6), CAP e outros reguladores repertrio de NAPs, incluindo tanto protenas exclusivas
transcricionais (ver Captulo 13). Todas essas prote- do domnio Archaea, como protenas ortlogas de NAPs
nas so capazes de remodelar o DNA em certo grau, o bacterianas ou de protenas cromatnicas eucariticas.
que fez com que algumas chegassem a ser classificadas As NAPs de arqueas e algumas de suas principais
como NAPs. Entretanto, a remodelao introduzida por propriedades estruturais e funcionais esto listadas na
qualquer uma delas na cromatina est restrita a regies Tabela 3.2. A maioria das NAPs de arqueas capaz de
reguladoras da replicao (como a origem de replicao polimerizar sobre o DNA e, assim, formar fibras nucle-
(OriC) e stios metilados ou hemimetilados no DNA), ou oproteicas. Essas fibras cromatnicas de arqueas podem
da transcrio (como promotores). Portanto, a contribui- apresentar diferentes configuraes, dependendo da es-
o dessas protenas para o estado de compactao da pcie, em funo do repertrio de NAPs presente e da
cromatina bacteriana apenas moderada, justificando quantidade relativa de cada uma dessas protenas. im-
sua excluso do conjunto de NAPs. portante salientar, contudo, que a distribuio das NAPs
Acredita-se tambm que algumas enzimas, como a no homognea no domnio Archaea, pois vrias delas
DNA-girase (ver Captulo 6) e a RNA-polimerase (ver Ca- tm distribuio restrita a um determinado filo ou a cer-
ptulo 10), desempenhem algum papel na organizao da tas classes ou gneros. Alm disso, o nmero de genes
cromatina bacteriana. A ligao ao DNA e as atividades parlogos que codifica cada tipo de NAP varia bastante
de polimerase e topoisomerase, respectivamente, dessas (podendo chegar at 6), implicando em variao corres-
enzimas, alteram de forma localizada a distribuio de pondente no repertrio de isoformas para pelo menos al-
superenrolamentos no DNA e constituem barreiras to- gumas dessas protenas.
polgicas de natureza transitria na cromatina. Assim,
Uma anlise filogentica sobre a distribuio dos ge-
elas podem ser responsveis, em parte, pela definio dos
nes codificadores de NAPs demonstra que, em diferen-
limites entre domnios ou entre macrodomnios e pelas
tes linhagens evolutivas do domnio Archaea, diversos
transies nos estados de superenrolamento do DNA nas
subconjuntos de NAPs so utilizados para a compacta-
estruturas cromatnicas de ordem superior.
o da cromatina (Figura 3.5). Considerando espcies
com genomas j sequenciados, os dois tipos de NAPs
1.2 Nucleoide e cromatina de arqueas com maior distribuio entre arqueas so Alba e histo-
nas. (ver Captulo 4).
Nas arqueas, o material gentico est, assim como nas
bactrias, organizado em um nucleoide, que consiste em As protenas Alba (em uma ou duas isoformas) esto
uma massa de cromatina cujo grau de compactao varia presentes nos 3 filos de arqueas (Euryarchaeota, Nono-

Zaha_5ed_03.indd 42 27/11/13 10:51


43 Cromatina
Tabela 3.2 Protenas associadas ao nucleoide em arqueas e suas propriedades
Massa Estado oligomrico Efeito(s) sobre
Protenaa molecular funcional Stios de ligao no DNA o DNAb
c
Alba 10 kDa Homodmero ou Heterodmero n.d. Interligao
Cren7 6,6 kDa Monmero Afinidade genrica por DNA de fita dupla Dobramento
(liga-se nas cavidades menores do DNA)
CC1 6 kDa Monmero n.d. n.d.
c d
Histonas 7,5 kDa Homodmero ou Heterodmero (A/T)3NN(G/C)3NN Enrolamento
HU/HTa 10 kDa Homodmero n.d. Dobramento
Lrp 15-22 kDa Homodmero n.d. Enrolamento,
interligao
MC1 10 kDa Homodmero Sequncias ricas em AT Dobramento
Sul7d 7 kDa Monmero n.d. Dobramento
a
Informaes sobre a nomenclatura das protenas listadas esto disponveis no Material Complementar Online 3.3.
b
Apenas efeitos j comprovados por experimentos in vitro ou in vivo esto listados.
c
Protenas Alba e histonas podem estar presentes em mais de uma isoforma, dependendo da espcie.
d
Na sequncia de DNA, N = qualquer nucleotdeo (A, C, G ou T).
n.d. = no determinado.

archaeota e Chrenarchaeota), no tendo sido identifica- nas cromatnicas de arqueas, por sua vez, tm distribui-
das apenas em euriarqueotas das classes Halobacteria e es mais restritas. Por exemplo, a MC1 encontrada
Methanomicrobia. As histonas (de uma a seis isoformas), apenas nas classes Halobacteria e Methanomicrobia e a
so tambm encontradas nos 3 filos de arqueas, mas es- HU/HTa e a Sul7d esto restritas classe Thermoplas-
to ausentes em euriarqueotas da classe Thermoplasmata mata e ordem Sulfolobales de crenarqueotas, respecti-
e em crenarqueotas hipertermoflicas. As outras prote- vamente. importante notar que, em todas as linhagens

Archaea Crenarchaeota
Euryarchaeota Pyrobaculum

Methanosarcina Thermoplasma
Sulfolobus

Halobacterium
Methanothermobacter
Aeropyrum
Archaeoglobus
Methanococcus
Pyrococcus Eukarya
Cenarchaeum
Methanopyrus
Bacteria Nanoarchaeota
Nanoarchaeum

Figura 3.5
rvore filogentica mostrando a distribuio de protenas associadas ao nucleoide em ar-
queas. As protenas representadas so: Alba , histonas , CC1 , Cren 7 , HU/HTa e MC1
e Sul7d . Na representao simplificada da figura, a ordem das ramificaes correta, mas a extenso
dos ramos no corresponde s distncias evolutivas reais.

Zaha_5ed_03.indd 43 27/11/13 10:51


Biologia Molecular Bsica 44

de arqueas, pelo menos dois tipos de NAPs so expressos. As histonas so protenas bsicas, com elevada
Nas espcies que possuem Alba, h tambm a presena afinidade pelo DNA, que em arqueas, so tipificadas
de histonas (Cren7 ou HU/HTa), podendo ocorrer ainda, pelas duas isoformas presentes em Methanothermus
em espcies de crenarqueotas, um terceiro tipo de NAP fervidus, denominadas HMfA e HMfB. As histonas fo-
(CC1 ou Sul7d). Em espcies que no possuem protenas ram inicialmente caracterizadas como componentes da
Alba, h, em contrapartida, histonas e MC1. cromatina eucaritica (ver Seo 2), mas a demonstra-
o da sua presena e ampla distribuio entre arqueas
Estrutural e funcionalmente, as protenas Alba e as
(ver Figura 3.5) evidenciou aspectos comuns na orga-
histonas so mais conhecidas e, por isso, sero aqui uti-
nizao da cromatina tambm nos domnios Archaea e
lizadas para apresentao de algumas caractersticas da
Eukarya. As histonas de arqueas, apesar de menores, so
cromatina de arqueas. As protenas Alba em arque-
estruturalmente muito similares a histonas eucariticas.
as so codificadas por um ou dois genes e, em casos de
Elas consistem de uma cadeia de 65 a 75 aminocidos
presena de dois genes parlogos, as isoformas de Alba
enovelada em 3 -hlices separadas por alas curtas
produzidas (Alba1 e Alba2), podem formar homodmeros
(Figura 3.7A), em uma estrutura homloga quela do
Alba1-Alba1 e heterodmeros (Alba1-Alba2). Dmeros Al-
domnio caracterstico (histone fold) das histonas cen-
ba2-Alba2 no ocorrem, pois a isoforma Alba2 representa
trais eucariticas (ver Figura 3.8). De um a seis genes
apenas 5% do total de protenas Alba na clula. Dmeros
codificadores de histonas so encontrados nos genomas
de Alba associam-se ao DNA (Figura 3.6A), cobrindo-o
de espcies de arqueas, que possuem essas protenas, so
em arranjos nucleoproteicos em tandem. Com isso, so
estruturalmente estabilizadas a partir da formao de
formadas fibras nucleoproteicas helicoidais estendidas
homo ou de heterodmeros (Figura 3.7B). Na presena
(similares s formadas pela HU bacteriana, representa-
do DNA, os dmeros das histonas associam-se para for-
das na Figura 3.3C), cujo grau de compactao aumenta
mar tetrmeros, em torno dos quais o cido nucleico se
proporcionalmente ao nmero de dmeros presente (Fi-
enrola para formar nucleossomos (Figura 3.7C), que
gura 3.6B). Isso ocorre porque, quando Alba est presen-
so muito similares aos seus equivalentes eucariticos
te em concentraes mais elevadas, h a associao de
(ver Seo 2.2). Na cromatina, os nucleossomos apare-
dmeros ocupando posies adjacentes ao longo do DNA.
cem organizados em tandem, proporcionando a forma-
Heterodmeros Alba1-Alba2, em qualquer concentrao,
o de fibras compactas que lembram um colar de contas
e homodmeros de Alba1, quando em altas concentraes,
(Figura 3.7D).
so tambm capazes de mediar a interligao de diferen-
tes segmentos do DNA, o que leva formao de estru- Em espcies de arqueas com duas ou mais isoformas
turas altamente compactas e ramificadas na cromatina de histonas, diversas combinaes de isoformas podem
(Figura 3.6C). ser encontradas nos tetrmeros. Essas diferentes combi-

Figura 3.6
Interaes das protenas Alba com o A
DNA em arqueas. (A) Dmero de Alba1
(com um monmero em e outro em )
associado ao DNA (em ).
(B) Fibras formadas por dmeros de Alba
(representados por formas ovais em )
associados em arranjos em tandem no
DNA (com o dplex representado em );
as fibras nucleoproteicas helicoidais
formadas so compactadas devido a inte-
raes entre dmeros de Alba adjacentes,
que ocorrem quando a razo Alba:DNA
aumenta. Heterodmeros Alba1-Alba2, em
B C
qualquer concentrao, e homodmeros de
Alba1, em concentraes mais elevadas,
interligam diferentes segmentos do DNA,
levando formao de estruturas altamen-
te ramificadas e compactas na cromatina,
como o segmento de DNA associado a pro- Aumento da razo
tenas Alba representado em (C). Alba:DNA e interaes
entre dmeros de Alba
adjacentes no DNA

Zaha_5ed_03.indd 44 27/11/13 10:51


45 Cromatina
A B
Figura 3.7
L1 2 Histonas e nucleossomos de arque-
as. (A) As histonas de arqueas apresen-
1 tam um enovelamento tpico (histone fold)
3
dessa famlia de protenas, compartilhado
L2 com as histonas centrais de eucariotos.
Cada histona consiste, em 3 -hlices (1,
2 e 3), unidas por duas alas curtas (L1
e L2). (B) Dmero de histonas, com um
monmero representado em e outro em
C D
. (C) Na presena de DNA, dmeros de
histonas associam-se para formar tetrme-
ros, em torno dos quais aproximadamente
90 pb se enrolam para formar um nucleos-
somo. (D) Ao longo do DNA, os nucleos-
somos aparecem organizados em tandem,
em fibras de cromatina com forma similar
de um colar de contas. (E) Dois nucleos-
somos adjacentes com orientaes dmero-
-dmero distintas (representadas por in-
clinaes distintas do dmero anterior em
relao ao dmero posterior em cada um
dos nucleossomos representados). A varia-
o do ngulo formado entre os dmeros
altera o sentido do enrolamento do DNA
em cada nucleossomo (indicado por uma
seta), gerando superenrolamento negativo
E em um caso, e positivo em outro.

naes de histonas determinam vrias propriedades de da), os quais tm uma ampla distribuio ao longo de ge-
associao ao DNA para cada tipo de tetrmero, o que nomas de arqueas. Acredita-se, tambm, que tetrmeros
leva a modificaes na estrutura das fibras de cromatina. de arqueas com diferentes composies de histonas pos-
Por exemplo, as combinaes de histonas determinam sam apresentar variaes quanto afinidade por certas
alteraes na orientao de um dmero em relao a ou- sequncias no DNA.
tro, na estrutura do tetrmero, levando a mudanas no
Devido maior simplicidade dos nucleossomos em
sentido de enrolamento do DNA no nucleossomo (Figura
arqueas (menor contedo de histonas), o grau de com-
3.7E) que pode levar, introduo de superenrolamento
pactao atingido na fibra cromatina menor do que
negativo ou positivo na molcula.
o atingido em fibras cromatnicas eucariticas. Isso
De 60 a 90 pb associam-se a histonas para formar determina diferenas fisiolgicas importantes entre a
um nucleossomo em arqueas e essa extenso de DNA no cromatina de arqueas e a de eucariotos, pois, nas ar-
chega a dar uma volta completa no tetrmero (ver Figu- queas, a configurao menos compacta da cromatina
ra 3.7C). O nmero exato de pares de bases de DNA, em proporciona maquinaria transcricional alta acessibili-
cada nucleossomo, depende da composio de isofor- dade ao genoma, o que no ocorre nos eucariotos. Essa
mas das histonas presente no tetrmero. A distribuio acessibilidade proporciona s arqueas a capacidade de
de nucleossomos ao longo do DNA na cromatina das ar- responder, com rapidez, a mudanas ambientais (em
queas, por sua vez, mais uniforme. H uma preferncia termos de expresso gnica), o que uma exigncia co-
para a montagem de nucleossomos sobre segmentos de mum para procariotos, pois, em geral, esto em contato
DNA que estejam de acordo com a sequncia consensual direto com os fatores ambientais (biticos e abiticos)
(A/T)3NN(G/C)3NN (sendo N qualquer base nitrogena- que os condicionam.

Zaha_5ed_03.indd 45 27/11/13 10:51


Biologia Molecular Bsica 46

Figura 3.8 A B

Estrutura de histonas centrais e de


L1 L1
histonas de ligao eucariticas. Todas 2 2
as histonas centrais (A-D) apresentam o
domnio tpico (histone fold) dessa famlia de 1
protenas, que consiste de 3 -hlices (1, 2 1
3 3
e 3) unidas por duas alas curtas (L1 e L2).
Nas histonas H2A (A), H2B (B), H3 (C) e L2 L2
H4 (D), esse domnio flanqueado por ex-
tenses (caudas) amino e carboxiterminais.
As histonas representadas so as de nucleos-
somos de galinha (Harp et al.), cujas estru-
turas so representativas de cada uma das C D
quatro classes de histonas centrais. (E) Do-
mnio central globular, contendo 3 -hlices, L1 2
caracterstico das histonas de ligao H1 e 2 3
H5. O domnio representado da histona L1
H1 da levedura S. cerevisiae (Ali et al.) e as 1 1
caudas amino e carboxiterminais da protena, L2
no so mostradas, estando indicadas apenas L2 3
por N e C, respectivamente.

2.1 Composio molecular da cromatina


2. Cromatina eucaritica eucaritica
A cromatina eucaritica, assim como a de arqueas que
A cromatina eucaritica um complexo formado por v-
contm histonas (ver Seo 1.2), possui nucleossomos
rias molculas de DNA linear (uma por cromossomo) as-
como sendo seus componentes estruturais bsicos. Nu-
sociadas a protenas. A massa de cromatina eucaritica
cleossomos eucariticos, contudo, possuem uma estru-
chega a conter duas vezes mais protenas do que o DNA e
tura mais complexa que a dos nucleossomos de arqueas,
as suas principais protenas esto listadas na Tabela 3.3.
pois so formados por um nmero maior de histonas.
A massa de RNA desse complexo 10 vezes menor do que
Esse aumento de complexidade dos nucleossomos em
a massa de DNA e constituda, basicamente, por cadeias
eucariotos proporciona maiores variaes estruturais, o
de RNA nascentes, ainda associadas fita-molde de DNA.
que implica em organizao estrutural e dinmica funcio-
nal mais complexas para a sua cromatina. Neste captulo, As histonas so os constituintes proteicos princi-
sero discutidos os principais aspectos estruturais da cro- pais da cromatina em quase todos os eucariotos, com ex-
matina de eucariotos e os diferentes estados de compac- ceo dos dinoflagelados (filo Dinoflagellata, supergrupo
tao passveis de serem atingidos por fibras de cromati- Chromalveolata), cuja cromatina estruturada de manei-
na. Os aspectos funcionais relacionados sero discutidos ra ainda pouco conhecida. Em geral, a massa combinada
nos Captulos 6, 10 e 14. de histonas aproximadamente igual do DNA total pre-
sente na cromatina eucaritica.

Zaha_5ed_03.indd 46 27/11/13 10:51


47 Cromatina
Tabela 3.3 Protenas associadas ao DNA na cromatina eucaritica e suas propriedades
Massa Estado oligomrico Efeito(s) sobre
a b
Protena molecular funcional Stios de ligao no DNA o DNA

Histonas centrais 11-14 kDa Homodmero (parte do Preferencialmente regies contendo Enrolamento
(H2A, H2B, H3 nucleossomo) dinucleotdeos TA repetidos a cada 10 pb e
e H4) intercalados com dinucleotdeos GC (com 5
pb de distncia entre cada TA e cada GC)
Histonas de ~21 kDa Homodmero Sequncias ricas em AT Interligao
ligao (H1 e H5)
Protenas HMG 11-38 kDa Homodmero ou Trechos ricos em AT Dobramento
heterodmero
Protenas SMC ~140 kDa Heterodmero (p. ex. Sequncias ricas em AT capazes de formar Interligao
SMC2-SMC4, parte da estruturas
condensina) secundrias
a
Informaes sobre a nomenclatura das protenas listadas esto disponveis no Material Complementar Online 3.4.
b
Apenas efeitos j comprovados por experimentos in vitro ou in vivo esto listados.

H muitas isoformas de histonas em clulas euca- mum que, principalmente no caso de histonas centrais,
riticas, mas ser analisado, neste captulo, apenas as os membros de cada classe sejam codificados por famlias
chamadas histonas cannicas envolvidas na com- de genes parlogos, que, em muitas espcies, aparecem
pactao geral da cromatina. Essas histonas so divididas organizados em agrupamentos e tm expresso associada
em dois grandes grupos: o das histonas centrais, que ao processo de replicao.
formam o complexo proteico central dos nucleossomos
As histonas centrais so protenas bastante conser-
eucariticos, e o das histonas de ligao, que se asso-
vadas ao longo da escala evolutiva, como H3 e H4, por
ciam externamente aos nucleossomos e participam de in-
exemplo, que possuem sequncias de aminocidos pra-
teraes entre eles. ticamente idnticas mesmo em organismos pouco rela-
As histonas centrais (H2A, H2B, H3 e H4), cionados como mamferos e plantas dicotiledneas. As
so caracterizadas por um domnio constitudo por 3 histonas de ligao, por outro lado, so protenas bem
-hlices separadas por alas curtas, chamado de his- mais variveis, com mais de uma centena de subtipos j
tone fold (enovelamento de histonas) (Figura 3.8A-D). descritos. H variaes considerveis entre as formas de
Entretanto, por serem um pouco maiores (possuem em H1, encontradas em diferentes espcies, e entre isofor-
torno de 100 aa de extenso), as histonas centrais apre- mas expressas em diferentes tipos celulares ou tecidos de
sentam extenses amino e carboxiterminais no encon- uma mesma espcie. As isoformas mais divergentes en-
tradas em histonas de arqueas. contradas em eritrcitos de aves, como a galinha (onde
foram inicialmente descritas), constituem a subclasse H5.
As histonas de ligao (H1 e H5), por sua vez, so
protenas maiores que as histonas centrais (com 190 a Alm de histonas, a cromatina eucaritica contm
250 aminocidos de extenso) e possuem uma estrutura tambm algumas outras protenas, classificadas generi-
tpica de 3 domnios, na qual um domnio globular cen- camente como protenas no histnicas, correspon-
tral (com aproximadamente 80 aminocidos) flanquea- dentes sempre a uma frao menor do que a constituda
do por uma cauda aminoterminal mais curta (com at 40 pelas histonas. Como regra geral, as histonas respondem
aminocidos) e uma cauda carboxiterminal mais longa pelos nveis de organizao bsicos do material gentico,
(prximo a 100 aminocidos). O domnio globular central ao passo que as protenas no histnicas esto associadas
(Figura 3.8E), com 3 -hlices, essencial para a ligao com a estruturao da cromatina em nveis de organiza-
da histona ao nucleossomo, estando tambm a cauda car- o superiores. So tambm classificadas como protenas
boxiterminal envolvida em interaes com o DNA. no histnicas as vrias DNA e RNA-polimerases, assim
como todas as protenas reguladoras dos processos de re-
Tanto as histonas centrais como as histonas de liga- plicao e transcrio.
o possuem um carter bsico acentuado, pois contm
Dentre as protenas no histnicas relevantes para a
uma elevada proporo (de 20 a 30%) de aminocidos
estruturao da cromatina eucaritica podem ser desta-
carregados positivamente (lisina e arginina) na sua cons-
cadas as protenas HMG e SMC. As protenas HMG (de
tituio. A presena desses aminocidos favorece a inte-
high mobility group grupo de alta mobilidade) consti-
rao das histonas com o DNA de fita dupla, carregado
tuem um grupo de protenas cromossmicas no hist-
negativamente.
nicas abundantes, de tamanho pequeno (em geral, entre
As 5 classes de histonas cannicas (H2A, H2B, H3, 11 e 38 kDa), de elevada mobilidade eletrofortica e com
H4 e H1/H5) podem ser reconhecidas em praticamente uma longa cauda carboxiterminal negativamente car-
todos os eucariotos, como ser visto no Captulo 5. co- regada. As protenas HMG so divididas em 3 famlias,

Zaha_5ed_03.indd 47 27/11/13 10:51


Biologia Molecular Bsica 48

HMGA, HMGB e HMGN, com base em diferenas nos ossomo, dependendo da variante de H1 ou H5 presente,
seus motivos de ligao ao DNA e nos substratos a que em cada espcie ou em diferentes tecidos.
se ligam. As protenas da famlia HMGA ligam-se, por
A estrutura molecular da partcula central do nucle-
meio de um motivo chamado AT-hook (gancho de AT),
ossomo est representada na Figura 3.9. Trs agrega-
aos trechos curtos ricos em AT no DNA. As protenas da
dos, considerados estveis, formam o octmero protei-
famlia HMGB possuem domnios de ligao ao DNA com
co central: o tetrmero (H3)2(H4)2 (Figura 3.9A-B) e os
aproximadamente 80 aa (HMG box) e interagem com ele
dois dmeros H2A-H2B (Figura 3.9C-D). O tetrmero
sem especificidade de sequncia. As protenas da famlia
(H3)2(H4)2, formado por dois dmeros H3-H4, tem os
HMGN so as nicas que se ligam especificamente aos
seus componentes arranjados em uma posio central e
nucleossomos, sendo caracterizadas por um domnio de
aproximadamente em um mesmo plano, acima ou abai-
ligao nucleossmico (NBD, de nucleosomal binding
xo do qual esto posicionados cada um dos dois dmeros
domain) com 30 aa.
H2A-H2B (Figura 3.9E-F). Essa organizao forma uma
As protenas SMC (de structural maintenance espcie de super-hlice proteica, sobre a qual o DNA se
of chromosomes manuteno estrutural de cromos- enrola (Figura 3.9G-I). Essa estrutura confere ao nucle-
somos) constituem uma famlia de protenas com pro- ossomo uma forma tpica, de cilindro achatado, pelo qual
priedades de ligao ao DNA, que formam diferentes se projetam, at certo ponto, as caudas das histonas cen-
complexos multiproteicos envolvidos na organizao da trais, representadas por 15-30 resduos aminoterminais
cromatina eucaritica. Esses complexos so formados de cada uma delas. As caudas aminoterminais das his-
por heterodmeros de protenas SMC (SMC1-SMC3 ou tonas tambm interagem com o DNA, auxiliando na sua
SMC2-SMC-4), que se associam a uma subunidade da estabilizao em torno do nucleossomo.
superfamlia das cleisinas (do grego, kleisi-
mo fechamento) para formar uma estrutura em anel. Um importante aspecto estrutural do nucleossomo
Anis de SMC1-SMC3-cleisina constituem as chamadas o chamado posicionamento rotacional do DNA no
coesinas e anis SMC2-SMC4-cleisina constituem as complexo, que diz respeito posio da hlice dupla do
chamadas condensinas. Devido forma dos complexos DNA em relao superfcie do octmero das histonas
de coesinas e condensinas, acredita-se que eles atuem na centrais (Figura 3.10). No nucleossomo, apenas uma
estruturao da cromatina, formando anis em torno de das faces da molcula de DNA associada ao octmero das
uma ou mais fitas duplas do DNA. histonas fica exposta para interagir com outras protenas.
Assim, a interao de uma protena que se liga a uma se-
quncia nucleotdica especfica no DNA, como um fator
2.2 Nucleossomos eucariticos de transcrio (ver Captulo 14), depende do posiciona-
mento do respectivo stio de ligao (sua sequncia-alvo),
A unidade estrutural bsica da cromatina eucaritica
na face exposta da hlice dupla.
uma partcula nucleoproteica, formada por DNA e histo-
nas, chamada de nucleossomo. Como possuem um n- O posicionamento rotacional do DNA no nucleosso-
mero maior de histonas em sua composio, os nucleos- mo influenciado por muitos fatores, incluindo certas
somos eucariticos so maiores e mais complexos que os sequncias nucleotdicas (que especificam estruturas na
de arqueas. Cada nucleossomo eucaritico constitudo molcula de DNA mais ou menos favorveis interao
por um octmero proteico, formado por duas cpias de com as histonas), contatos entre nucleossomos vizinhos e
cada uma das histonas centrais (H2A, H2B, H3 e H4), e ao de complexos de remodelao da cromatina. Sobre
por uma extenso de DNA suficiente para dar duas voltas a influncia de sequncias nucleotdicas, j foi demons-
sobre o octmero. A esse complexo est ainda associada, trado que a ocorrncia de dinucleotdeos purnicos (AG
externamente, uma molcula de histona de ligao (H1 ou GA), regularmente espaados a cada 10 pb em um
ou H5). Embora ainda restem dvidas sobre o local pre- segmento de DNA, um determinante de posicionamen-
ciso e a forma de associao da molcula da histona de to rotacional nucleossmico importante. Esse tipo de
ligao com o nucleossomo, acredita-se que as principais organizao peridica de dinucleotdeos purnicos en-
interaes entre H1 ou H5 com o DNA ocorram prximas contrado, por exemplo, em torno dos stios de incio de
dos pontos de entrada e sada do cido nucleico no transcrio de muitos genes, sendo responsvel pelo posi-
complexo. cionamento rotacional do DNA nos nucleossomos dessas
O termo partcula central utilizado para descre- regies, que incluem os stios de ligao de muitos fatores
ver o octmero de histonas e a extenso de DNA associa- de transcrio.
da a ele. Em ensaios in vitro, o DNA presente na partcula
central tem uma extenso de 145 a 147 pb, j in vivo, a 2.3 Nveis de organizao mais complexos
extenso do DNA na partcula central pode variar dentro
de limites mais amplos, entre 100 e 170 pb. Essa variao
da cromatina eucaritica
dinmica e responde a influncias externas, exercidas A partir da sua subunidade estrutural bsica (nucleosso-
por outras protenas nucleares que interagem com a cro- mo), a cromatina eucaritica estruturada em confor-
matina. importante salientar que a associao de uma maes progressivamente mais complexas, que vo des-
molcula de histona de ligao j determina que de 150 a de estruturas fibrilares menos compactas at estruturas
250 pb de DNA fiquem estavelmente associados ao nucle- mais enoveladas e compactas, cuja organizao em nvel

Zaha_5ed_03.indd 48 27/11/13 10:51


49 Cromatina
C Figura 3.9
A
Estrutura tpica da partcula
central do nucleossomo. O tetr-
B mero formado por duas molculas de
H3 (em ) e duas molculas de H4
(em ) determinam um plano, que,
em (A), est posicionado perpen-
D dicularmente superfcie da pgina
e, em (B), tem uma inclinao de
aproximadamente 30. Dois dmeros
H2A-H2B, mostrados em (C) e (D),
com H2A em e H2B em , se
E posicionam um acima e outro abaixo
F do plano definido por (H3)2(H4)2,
formando o octmero mostrado em
(E) (vista superior), e em (F) (vista
lateral). Em volta do octmero de
histonas enrolam-se 146 pb de DNA,
em aproximadamente duas voltas,
formando a partcula central do nu-
cleossomo (G-I). Em (G), a partcula
central apresentada (em uma vista
superior), equivalente do oct-
mero mostrado em (E). Em (H), a
H
partcula central apresentada em
G uma vista lateral, equivalente do
octmero mostrado em (F); nesta
vista, ficam evidentes os pontos de
entrada e sada do DNA no nucle-
ossomo (indicados por setas em ).
A vista lateral em (I) mostra o lado
oposto da partcula central mostrada
I
em (H), evidenciando as duas voltas
que o DNA d em torno do octmero
de histonas. Em todas as estruturas
mostradas, ficam evidentes as caudas
aminoterminais das histonas, que,
em (E), esto indicadas por setas
em .

Figura 3.10
Posicionamento rotacional do DNA no nucleosso-
mo. A hlice dupla do DNA (em ) fica, no nucleosso-
istonas
as h ce
nt mo, com uma de suas faces (a oculta) associada ao oct-
om
mero das histonas centrais (em ) e a outra (a exposta)
osta do DNA

ra
la associao

is

acessvel para interaes com protenas que se ligam


especificamente a sequncias do DNA (indicadas pela
Acesso de seta em ). Se a sequncia nucleotdica reconhecida por
protenas uma determinada protena estiver na face oculta do DNA,
e exp

pe

ao DNA
a interao apenas ocorrer se o segmento do DNA que a
ta

Fa ul
Fac

ce do DNA oc
contm for para a face exposta, em funo de uma altera-
o no grau de toro da hlice dupla (rotao sobre seu
prprio eixo longitudinal, representada pela seta em ).

Zaha_5ed_03.indd 49 27/11/13 10:51


Biologia Molecular Bsica 50

molecular ainda no foi esclarecida por completo. A orga- adjacentes, em que a extenso de cada trecho do DNA de
nizao da cromatina dinmica, pois se altera conforme ligao pode variar conforme a espcie ou at mesmo o
o estgio do ciclo celular e de acordo com a sua atividade. tecido ou tipo celular. Extenses de 20 a 80 pb ocorrem
em leveduras e em espermatozoides de equinodermos, e
Durante a interfase, dois tipos bsicos de cromatina
extenses mdias de aproximadamente 35 pb so tpicas
podem ser observados em nvel de microscopia ptica:
para vertebrados. A estrutura da fibra de 10 nm afetada
a eucromatina, que representa a cromatina no seu
pelas histonas de ligao (H1 ou H5), que, por mediarem
estado de menor compactao; e a heterocromatina,
interaes entre os nucleossomos, so determinantes do
uma forma de cromatina densamente compactada. Du-
espaamento entre eles.
rante a diviso celular (mitose ou meiose), toda a cro-
matina encontra-se muito mais condensada, formando A fibra de 10 nm da cromatina tem duas proprie-
os cromossomos mitticos ou meiticos, que so dades importantes. A primeira a periodicidade, que
unidades discretas e bastante compactas. Quanto ao seu decorre da distribuio regular dos nucleossomos a cada
estado funcional, a eucromatina considerada a croma- 200 50 pb ao longo de praticamente toda a extenso do
tina ativa (em termos de expresso gnica), ao passo que DNA nuclear. Essa periodicidade pode ser demonstrada
a heterocromatina e os cromossomos constituem suas a partir de experimentos simples, nos quais feita uma
formas inativas. clivagem parcial da cromatina com uma desoxirribonu-
clease (ver Material Complementar Online 3.5).
O nvel de compresso do DNA em cada nvel de or-
Esses experimentos so fundamentados na sensibilidade
ganizao da cromatina pode ser quantificado pela cha-
diferencial do DNA ao da enzima, quando associado
mada razo de compactao (packing ratio). Essa
ou no aos nucleossomos. A outra propriedade estrutural
grandeza definida pela razo entre o comprimento de
importante, identificada na fibra de 10 nm, o posicio-
uma molcula de DNA e o comprimento da unidade que
namento em fase dos nucleossomos. Essa proprieda-
a contm. Por exemplo, o menor dos cromossomos hu-
de determina que, ao longo do genoma de uma espcie,
manos (cromossomo 21) possui em torno de 4,7 x 107 pb
a maior parte dos nucleossomos esteja posicionada da
de DNA e, estendido, teria um comprimento de apro-
mesma maneira, em relao sequncia nucleotdica de
ximadamente 1,4 cm. Assim, como esse cromossomo
todas as clulas. Em S. cerevisiae, por exemplo, estima-se
tem, na mitose, um comprimento de 2 m, a sua razo
que uma frao de 80% do genoma ocupada por nucle-
de compactao chega a 7.000. A razo de compactao,
ossomos posicionados em fase.
contudo, pode variar de cromossomo para cromossomo e
de espcie para espcie e ainda mais difcil de ser esti- O posicionamento em fase de nucleossomos pode
mada para estruturas amorfas, como a da cromatina in- resultar da associao especfica das histonas ou de seus
terfsica. Em geral aceito que cromossomos mitticos complexos (dmero, tetrmero ou octmero ver Seo
tm razes de compactao de 5.000 a 20.000 e que a 2.2) com determinadas sequncias nucleotdicas, caso
cromatina interfsica tem uma estrutura de 5 a 10 vezes em que chamado de intrnseco. Isso ocorre porque,
menos compacta, com razes de compactao oscilando apesar da aparente inespecificidade da interao das
entre 1.000 e 2.000. histonas com o DNA, os nucleossomos se formam prefe-
rencialmente sobre determinadas sequncias de DNA, e
A organizao da cromatina em nveis progressiva-
evitam outras. Por exemplo, os nucleossomos tm maior
mente mais complexos e compactos, desde as suas fibras
probabilidade de se formarem sobre regies com curva-
mais simples at as estruturas cromossmicas, est su-
tura orientada (sempre na mesma direo) no DNA, de-
marizada nas Figuras 3.11 e 3.12.
finidas por segmentos ricos em pares de bases AT consi-
derados longos (mais de 8 pb). Em contrapartida, trechos
2.3.1 Fibra de 10 nm homopolimricos de nucleotdeos de desoxiadenosina em
O DNA livre tem um dimetro de aproximadamente 2 nm uma das fitas da hlice dupla parecem excluir nucleosso-
(ver Captulo 2), mas, no contexto da cromatina, quase mos. Motivos de sequncia como esses, disseminados em
inexistente. Devido a sua associao com histonas, a for- genomas eucariticos, definiriam uma espcie de cdi-
ma menos compacta do DNA na cromatina corresponde a go genmico, parcialmente responsvel pelo posiciona-
um arranjo de nucleossomos em tandem, formando uma mento de nucleossomos em fase.
estrutura similar a um colar de contas (Figura 3.11A).
O posicionamento em fase, tambm pode acontecer
Essa estrutura linear, cujo dimetro corresponde ao do
de maneira extrnseca, quando apenas um nucleossomo
prprio nucleossomo (de aproximadamente 10 nm), re-
de determinada regio posicionado em um stio prefe-
presenta o primeiro nvel de compactao da cromatina e
rencial, por afinidade com alguma sequncia ou estrutura
chamada de fibra de 10 nm.
na molcula de DNA, sendo os demais montados a partir
Nesse primeiro nvel de compactao da cromatina, dele, obedecendo a periodicidade caracterstica de cada
os nucleossomos adjacentes esto conectados entre si um. Isso ocorre, tambm, a partir de regies adjacentes
pela continuidade da molcula de DNA que, entre nucle- aos stios em que a montagem do DNA em um nucleos-
ossomos e livre da associao com histonas, chamado somo evitada, pela ligao (geralmente reversvel) de
de DNA de ligao (linker DNA). A estrutura da fibra de uma protena no histnica a uma sequncia nucleotdica
10 nm depende apenas de interaes entre nucleossomos especfica (como no caso da ligao de fatores de trans-

Zaha_5ed_03.indd 50 27/11/13 10:51


51 Cromatina
A
~10 nm
Octmero de de dimetro
histonas centrais
DNA associado
partcula central
(150-250 pb) Histona de
DNA ligao
de ligao

B C

DNA ~30 nm
de ligao de dimetro
no interior
do solenoide

DNA
de ligao
Extenso de
uma volta = ~10 nm

D E

~30 nm
de dimetro
DNA
de ligao

DNA
de ligao

Figura 3.11
Fibras de 10 nm e 30 nm da cromatina eucaritica. (A) Representao esquemtica de
nucleossomos organizados em uma fibra de 10 nm de dimetro. O octmero de histonas centrais
de cada nucleossomo (representado como um cilindro achatado em ) e o DNA associado a ele
(representado em ) constituem a chamada partcula central. Uma molcula de uma histona de
ligao (H1 ou H5, em ) fica associada ao nucleossomo externamente, na regio de entrada
e sada do DNA da partcula. O DNA de ligao (representado em ), entre nucleossomos
adjacentes, pode ter extenses variveis (de 20 a 80 pb) na fibra de 10 nm. (B-E) Modelos da
fibra de 30 nm (para simplicao, as molculas de histonas de ligao foram omitidas de todas as
representaes). No modelo em solenoide (B-C), proposta uma estrutura super-helicoidal, com
6 nucleossomos por volta. No modelo solenoidal, o DNA de ligao no cruza o eixo longitudinal
central da fibra, como pode ser observado em uma vista transversal (C). No modelo em zigue-za-
gue (D-E), os nucleossomos esto arranjados em duas fileiras alternadamente. O DNA de ligao
tem, nesse modelo, uma trajetria mais ou menos retilnea e cruza vrias vezes o espao entre as
duas fileiras de nucleossomos, como pode ser melhor observado em uma vista transversal (E).

crio a regies promotoras) ou pela ligao do DNA a determinado, expe certas sequncias de DNA e oculta
estruturas nucleares, como a prpria matriz nuclear (ver outras, facilitando, ou dificultando, sua interao com
Seo 2.3.3). Essas regies definiriam limites (posies as protenas reguladoras de processos como a replica-
especficas no genoma), a partir dos quais os nucleosso- o e a transcrio. Na caracterizao da acessibilidade
mos seriam posicionados em fase. de uma sequncia a protenas reguladoras no contex-
to da fibra de 10 nm, pode ser definido, alm do po-
Os mecanismos de posicionamento dos nucleos- sicionamento rotacional inerente estrutura de cada
somos possuem importantes implicaes funcionais nucleossomo (ver Seo 2.2), o chamado posiciona-
na fisiologia da cromatina. Um arranjo em fase, assim mento translacional, que descreve um determinado

Zaha_5ed_03.indd 51 27/11/13 10:51


Biologia Molecular Bsica 52

Fibra de 300 nm

Matriz nuclear

B C

Eixo central rico


em condensinas

Esqueleto ~500-700 nm
metafsico de dimetro

~750-850 nm
Ala de 300 nm de dimetro
Cromossomo metafsico

Figura 3.12
Estruturas de cromatina de ordem superior. (A) Representao esquemtica das alas de cro-
matina formadas a partir da associao da fibra de 30 nm (em ) com protenas da matriz nuclear (em
). A estrutura da fibra de 30 nm mostrada no detalhe, e os seus segmentos, incluindo MARs, esto
representados em . (B) Na condensao da cromatina, as alas da fibra de 300 nm so compactadas
de modo a formar fibras de cromatina de ordem superior. Como representado na figura, as alas de
cromatina formam um arranjo helicoidal em torno do esqueleto metafsico axial, com vrias alas de
300 nm por volta, de modo a formar fibras com dimetros de 500 a 700 nm. (C) A estrutura do cro-
mossomo metafsico formada a partir do enovelamento da fibra de 300 nm e de outras fibras de ordem
superior apresenta em cada brao do cromossomo aproximadamente 700 a 850 nm de dimetro. A
regio axial de cada brao cromossmico rica em condensinas (complexos proticos que incluem pro-
tenas SNC), representadas na figura por pontos em .

segmento do DNA em relao aos limites externos da Protenas reguladoras podem ter diferentes exign-
partcula central. Isto , dependendo do seu posiciona- cias quanto posio do DNA em relao ao nucleosso-
mento translacional, uma sequncia de DNA parte de mo, inclusive na configurao aberta da fibra de 10 nm.
um nucleossomo ou do DNA de ligao. Para esse pro- Algumas protenas so capazes de interagir apenas com
cesso so tambm teis os experimentos de clivagem o DNA livre da associao com histonas (no DNA de liga-
parcial da cromatina, discutidos no Material Com- o, entre dois nucleossomos), sendo, para isso, funda-
plementar Online 3.5. mental o posicionamento translacional. Outras protenas,
como discutido na Seo 2.2, so capazes de interagir
Limitaes diferenciais de acesso, determinadas pela
com sequncias especficas do DNA expostas na super-
cromatina para a ao da enzima, permitem demons-
fcie do nucleossomo, sendo fundamental, neste caso, o
trar que a cromatina pode ter uma configurao aberta
posicionamento rotacional.
ou uma configurao fechada. A configurao aber-
ta, mais acessvel ao de nucleases (mas tambm de
quaisquer protenas que interajam com o DNA) a da
2.3.2 Fibra de 30 nm
fibra de 10 nm, ao passo que a configurao fechada provvel que a fibra de 10 nm s ocorra in vivo e em
encontrada na fibra de 30 nm, ou em estruturas mais regies especficas, nas quais haveria uma remoo lo-
compactas da cromatina. calizada das molculas de histonas de ligao dos nucle-

Zaha_5ed_03.indd 52 27/11/13 10:51


53 Cromatina
ossomos. Em regies nas quais os nucleossomos esto necessrios nveis de compactao adicionais, nos quais
completos, com uma histona de ligao associada ex- as fibras de 10 e 30 nm se organizam em estruturas de
ternamente a cada um deles, a cromatina tende a adotar ordem superior. Ainda se sabe pouco, em nvel molecular,
uma conformao mais complexa, com um dimetro de sobre a condensao da cromatina em nveis de compac-
30 nm em mdia. tao superiores ao da fibra de 30 nm, mas geralmente
aceito que esta fibra forme alas de cromatina (Figura
A estrutura tridimensional dessa fibra, chamada de
3.12A).
fibra de 30 nm, controversa. Alguns modelos, como
o apresentado na Figura 3.11B-C, propem que ela teria As bases de cada ala de cromatina ficam ancoradas
um arranjo solenoidal, no qual cada espira conteria 6 em estruturas proteicas, podendo variar em composio e
nucleossomos organizados radialmente. J outros mode- estrutura conforme o estado fisiolgico da cromatina (eu-
los, como o apresentado na Figura 3.11D-E, propem um cromatina ou heterocromatina), ou o estgio do ciclo ce-
padro em zigue-zague para a organizao dos nucleos- lular (na interfase ou durante a diviso). Durante a inter-
somos na fibra. No modelo em zigue-zague, so forma- fase, as alas de cromatina ficam ancoradas na chamada
das duas fileiras de nucleossomos ao longo da fibra, que matriz nuclear, que a estrutura proteica filamentosa
podem ser torcidas em diferentes arranjos helicoidais. A que preenche o ncleo. Durante a diviso celular, as al-
acessibilidade do DNA para a interao com as protenas as aparecem ancoradas em um arcabouo proteico mais
tambm difere nos dois modelos da fibra de 30 nm. No estruturado (ou, pelo menos, mais evidente citologica-
modelo solenoidal, o DNA de ligao fica pouco exposto mente), chamado de esqueleto metafsico, no caso de
e relativamente inacessvel no interior da fibra, pois no cromossomos metafsicos.
passa atravs do seu eixo longitudinal (ver Figura 3.11B).
A extenso de DNA em cada ala pode variar con-
J no modelo em zigue-zague, o DNA de ligao cruza o
forme o tipo celular, o tecido, ou a espcie considerada,
eixo longitudinal da fibra e, por isso, fica mais exposto
mas, em geral, oscila entre 40 e 90 kb. Isso corresponde
(ver Figura 3.11E).
de 200 a 450 nucleossomos, que, assumindo a organiza-
Tanto o modelo solenoidal como o em zigue-zague se o da fibra de 30 nm, com 6 nucleossomos a cada 10 nm
baseiam em observaes experimentais e so coerentes (extenso de uma volta do solenoide ver Figura 3.11B),
com propriedades j demonstradas para a fibra de 30 nm. equivalem a uma extenso linear aproximada de 300 a
Esses modelos, bem como suas variaes, no so mutua- 700 nm para cada ala. Por isso, costuma-se definir a fi-
mente exclusivos e podem representar diferentes confi- bra formada por essas alas como fibra de 300 nm (de
guraes para a fibra de 30 nm no contexto da cromatina. dimetro). Na fibra de 300 nm, o DNA fica de 15 a 20
Sabe-se que, in vivo, a estrutura da fibra de 30 nm no vezes mais compactado do que na fibra de 30 nm, ou seja,
homognea, pois possui uma organizao mais frouxa ele atinge razes de compactao da ordem de 600 a 700.
e uma aparncia mais irregular do que as propostas em
A estruturao das alas na fibra de 300 nm depende
qualquer outro modelo, com um dimetro varivel ao
de segmentos do DNA que estabelecem interaes com
longo de toda a sua extenso.
a matriz nuclear ou com o esqueleto metafsico (Figura
A estabilidade estrutural da fibra de 30 nm depende 3.12A-B). Esses segmentos so operacionalmente defini-
tanto das histonas centrais como das histonas de ligao dos como sequncias de DNA que se associam a protenas
dos nucleossomos. As histonas centrais contribuem para da matriz nuclear ou do esqueleto metafsico no contex-
a integridade da fibra graas a suas caudas aminotermi- to da cromatina, por isso, so chamados de MARs (de
nais, que promovem interaes adicionais entre os nucle- matrix attachment regions regies de ligao ma-
ossomos. As histonas de ligao, por sua vez, so funda- triz) ou SARs (de scaffold attachment regions regies
mentais para a definio da extenso do DNA de ligao de ligao ao arcabouo) respectivamente. As SARs e as
(um dos fatores que afetam a conformao da fibra) e MARs so regies consideradas extensas, ricas em pares
tambm para o estabelecimento de interaes entre os de bases AT (representando at 70% das suas bases), mas
nucleossomos adjacentes. Na dinmica da fibra de 30 sem qualquer sequncia consensual especfica. Mais pre-
nm, acredita-se que h participao importante das pro- cisamente, elas so compostas por inmeras sequncias
tenas HMG. Membros das 3 famlias das protenas HMG repetidas de poli(A), espaadas (sem regularidade) ao
(HMGA, HMGB e HMGN) competem com as histonas de longo de vrias centenas de pares de bases. Assim, pro-
ligao pela associao aos nucleossomos ou ao DNA de vvel que as protenas organizadoras da cromatina no
ligao e determinam uma dinmica competitiva, respon- reconheam sequncias especficas nas SARs e MARs,
svel pela modulao da estrutura local da fibra de cro- mas sim certas caractersticas estruturais determinadas
matina e da acessibilidade do DNA a ela associado para por elas no DNA, como as regies de curvatura acentuada
interao com outras protenas. ou mais propensas separao das fitas.
A quantidade de MARs ou SARs ao longo de qualquer
2.3.3 Alas de cromatina e fibra de 300 nm genoma eucaritico muito grande, estima-se, por exem-
A organizao da cromatina em fibras de 10 e 30 nm per- plo, um nmero de pelo menos 150.000 para o genoma
mite que sejam atingidas razes de compactao de no do camundongo, considerando estudos realizados em he-
mximo 40, muito aqum do necessrio para acomodar patcitos. Sabe-se, entretanto, que o nmero de MARs ou
um genoma eucaritico no interior do ncleo. Assim, so SARs efetivamente envolvido em interaes com a matriz

Zaha_5ed_03.indd 53 27/11/13 10:51


Biologia Molecular Bsica 54

nuclear varia conforme o estado fisiolgico da cromati- a 750 nm (Figura 3.12C). Estruturas cromossmicas al-
na, o tipo celular ou o tecido. Essas variaes implicam ternativas, como as de cromossomos plumosos, ob-
tambm, em modificaes dinmicas para o nmero e o servados em anfbios, e cromossomos politnicos,
tamanho mdio das alas de cromatina formadas e as ra- encontrados em insetos dpteros, so discutidas no Ma-
zes de compactao alcanadas pelo DNA na estrutura. terial Complementar Online 3.6.
Por isso, foi introduzido recentemente o conceito funcio-
O arcabouo proteico que sustenta as estruturas de
nal de LARs (de loop attachment regions regies de
cromatina de ordem superior, chamado de esqueleto
ligao de alas), para definir, dentre todas as potenciais
metafsico, apresenta uma composio proteica distinta
MARs ou SARs existentes em um genoma, as que pos-
daquela da matriz nuclear, embora ambas as estruturas
suem envolvimento efetivo no ancoramento das alas de
compartilhem algumas protenas em comum, como a
cromatina, em anlise de um determinado tipo celular,
prpria topoisomerase II. Assim como a matriz nuclear,
tecido ou situao fisiolgica.
o esqueleto metafsico bastante complexo e dinmico.
A composio proteica da matriz nuclear a princi- Ele composto por dezenas de protenas diferentes e a
pal responsvel pela definio da estrutura da cromatina sua composio proteica pode variar ao longo do ciclo de
durante a interfase. A caracterizao estrutural da cro- diviso celular. Com isso, so determinadas as diferen-
matina, contudo, dificultada por ela ser essencialmen- tes estruturas e nveis de compactao observados nos
te amorfa e ter na sua composio, pelo menos, algumas processos de formao e de desestruturao de cromos-
centenas de protenas diferentes (mais de 400, segundo somos, que ocorrem entre a prfase e a metfase e aps
estimativas recentes). Dentre os componentes proteicos a telfase.
principais da matriz nuclear, cabe citar os SMFs (de sca- Dentre as protenas que participam da organizao
ffold attachment factors fatores de ligao ao arcabou- de estruturas de cromatina de ordem superior, inclusive
o) e a topoisomerase II. de cromossomos metafsicos, pode-se salientar HMGs da
Os SMFs constituem uma famlia de protenas da famlia HMGA e protenas SMC (ver Seo 2.1). As prote-
matriz nuclear com afinidade por MARs e SARs, proprie- nas HMGA ligam-se a sequncias com caractersticas de
dade que faz com que alguns autores classifiquem esses SARs (ricas em AT e repetidas) e estudos indicam que so
fatores como componentes da cromatina. Os SMFs, alm componentes integrais da cromatina. Em cromossomos
de serem propostos como elementos organizadores da metafsicos, protenas dessa famlia aparecem em posi-
cromatina, participam de vrios outros processos nucle- es definidas e podem estar ativamente envolvidas nas
ares, incluindo a regulao transcricional. A topoisome- alteraes estruturais dinmicas que ocorrem na croma-
rase II (ver Captulo 2), por sua vez, uma enzima cuja tina durante o processo de condensao cromossmica a
presena significativa em estruturas de cromatina de cada ciclo de diviso celular. As protenas SMC, por sua
ordem superior. Isso sugere que mudanas no superenro- vez, formam, juntamente com outras protenas, os com-
lamento do DNA podem ser crticas no processo de com- plexos chamados de condensinas e coesinas, que parti-
pactao da cromatina. cipam dos processos de condensao cromossmica e de
adeso de cromtides-irms. Em cromossomos metafsi-
2.3.4 Estruturas de cromatina de ordem cos (ver Figura 3.12C), complexos de condensina so ob-
servados nos eixos axiais da estrutura, evidenciando sua
superior e cromossomos metafsicos importncia para a manuteno da estrutura cromoss-
A organizao da cromatina em estruturas mais com- mica. Alm disso, j foi demonstrado (em experimentos)
pactas que a da fibra de 300 nm ocorre na transio de que a presena de condensinas e de protenas SMC fun-
conformaes interfsicas para aquelas representadas damental para que os cromossomos sejam condensados
pelos cromossomos individualizados na diviso celular. de maneira correta.
Essa transio envolve mudanas tanto nas sequncias
de DNA como nas protenas envolvidas, pois, tanto o re-
pertrio de LARs como o de protenas s quais elas se an-
coram mudam quantitativa e qualitativamente. Em geral, 3. Cromatina de organelas
assume-se que, no processo de compactao envolvido,
a fibra de 300 nm seja espiralada em estruturas (fibras) Plastdeos e mitocndrias so organelas celulares que
possuem genomas prprios, constitudos por molculas
de ordem superior, que teriam uma estrutura similar
de DNA circulares pequenas, em geral com dezenas ou
representada na Figura 3.12B. Entretanto, sabe-se que
poucas centenas de quilobases e, que esto presentes em
o enrolamento da fibra de 300 nm em estruturas mais
mltiplas cpias em cada organela (Captulo 4). Nas or-
complexas no to simtrico e homogneo, de modo
ganelas, as mltiplas cpias dos genomas esto associa-
que as fibras de ordem superior da cromatina podem ter
das com protenas, constituindo uma forma de cromati-
conformaes variveis.
na, organizadas em nucleoides. Entretanto, importante
Modelos recentes para a estrutura dos cromossomos salientar que, apesar da origem evolutiva procaritica
propem que a fibra de 30 nm se enovelaria, de forma das organelas, seus nucleoides no so meros remanes-
progressiva e at certo ponto desordenada, para formar centes da organizao da cromatina bacteriana ancestral.
estruturas com dimetros de 100 a 150, 200 a 250 e 500 Os nucleoides de plastdeos e mitocndrias so sistemas

Zaha_5ed_03.indd 54 27/11/13 10:51


55 Cromatina
nucleoproteicos complexos e com arquitetura prpria, es- 3.2 Nucleoides de plastdeos
tabelecidos, ao longo de sua evoluo, a partir da extensa
interao entre genomas organelares e o genoma nuclear. O DNA de cloroplastos e outros plastdeos (ptDNA), as-
sim como o mtDNA, associa-se a protenas especficas
para formar nucleoides no interior das organelas. Em
3.1 Nucleoides mitocondriais cada um dos diversos nucleoides que ocorrem por organe-
O DNA mitocondrial (mtDNA), presente em mltiplas la, esto organizadas de 3 a mais de 10 cpias do ptD-NA.
Os nucleoides de plastdeos podem variar em morfologia
cpias por mitocndria, forma nucleoides discretos no in-
e distribuio na organela, conforme o tecido ou o estgio
terior da organela a partir da sua associao com protenas
de desenvolvimento de uma planta. Em clulas meriste-
estruturais especficas. O nmero de nucleoides por mito-
mticas (indiferenciadas), cada proplastdeo (precursor
cndria varia de dezenas a centenas, dependendo da esp-
de um cloroplasto ou outro tipo de plastdeo) tem apenas
cie, do tipo celular, do estgio de diferenciao da clula
um nucleoide, ocupando uma posio central na organela.
ou do estgio de desenvolvimento do organismo. Cada nu-
Durante a diferenciao de proplastdeos em cloroplas-
cleoide, por sua vez, contm de 2 a 10 cpias do mtDNA e
tos, os nucleoides, ento, em grande nmero, aparecem
comporta-se como um elemento gentico de estrutura es-
posicionados na periferia da organela em contato com a
tvel. O grau de compactao do mtDNA em um nucleoide
sua membrana interna. Em cloroplastos maduros, os nu-
mitocondrial equivalente ao de um nucleoide bacteriano.
cleoides ficam livres, como pequenas partculas discretas
Mais de 50 protenas diferentes podem ser associadas no interior da organela. Por fim, em clulas senescentes, o
ao mtDNA em nucleoides mitocondriais, mas, dentre elas, nmero de nucleoides por organela, assim como o nme-
apenas algumas seriam relevantes para a compactao e ro de cpias do ptDNA por nucleoide, tende a decrescer.
estabilizao do mtDNA. possvel que o componente pro-
Pelo menos dois sistemas distintos foram estabeleci-
teico estrutural mais importante para a cromatina mito-
dos para a organizao dos nucleoides plastidiais ao lon-
condrial seja uma protena relacionada ao grupo HMG (ver go das linhagens evolutivas dos 4 supergrupos de euca-
Seo 2.1). Esse grupo est representado em mitocndrias riotos, que hoje apresentam filos com espcies contendo
por protenas como a TFAM, de mamferos, caracterizada plastdeos (Plantae, Chromalveolata, Excavata e Rhizaria
pela presena de domnios de ligao ao DNA do tipo HMG ver Captulo 5). Um desses sistemas ocorre em algumas
box, encontrados em protenas HMG da famlia HMGB. A espcies de protozorios e algas e o outro, em eucariotos
TFAM (de transcription factor A of mitochondria fator fotossintetizantes. A distino entre eles feita com base
de transcrio A de mitocndrias), foi inicialmente carac- nas protenas responsveis pela compactao do ptDNA.
terizada como um fator de transcrio mitocondrial, mas
acredita-se que ela, assim como as protenas ortlogas Apicoplastos (plastdeos especializados) de espcies
Abf2p, de leveduras, e Glom (de agglomeration of mito- do filo Apicomplexa (Chromoalveolata), como os do gnero
chondrial DNA aglomerao de DNA mitocondrial), de Plasmodium, e plastdeos de algas como Cyanidios-chyzon
Dictyostelium discoideum (Mycetozoa; Amoebozoa), tm merolae (Rodophyta, Plantae) e Guillardia theta (Crypto-
como funo primria a formao e a estabilizao da cro- phyta, Chromalveolata), tm como principal elemento es-
matina mitocondrial. Todas essas protenas formam homo- truturante de seus nucleoides uma protena ortloga da HU
dmeros que se ligam ao mtDNA a cada 35 ou 40 pb e so bacteriana (ver Seo 1.1). A HU plastidial pode ser codifi-
essenciais para a compactao do mtDNA. cada tanto pelo ptDNA como pelo genoma nuclear, depen-
dendo da espcie. Por exemplo, em C. merolae e G. theta,
Outra protena, que possivelmente est envolvida na a HU produto de um gene do ptD-NA, ao passo que, em
organizao estrutural do mtDNA a protena de ligao Plasmodium falciparum, a HU produto de um gene nu-
ao DNA de fita simples. Essa mtSSB (de mitochondrial clear, mas que, aps sua sntese, direcionada para o api-
single-stranded DNA-binding protein protena mi- coplasto. Independentemente da localizao do gene que a
tocondrial de ligao a DNA de fita simples) teria uma codifica, qualquer HU plastidial liga-se ao ptDNA sem es-
participao mais localizada que a da protena HMG mi- pecificidade de sequncia e ocasiona o seu dobramento e
tocondrial. Devido a sua especificidade estrutural de li- compactao, sendo essencial para a formao de nucleoi-
gao ao DNA de fita simples, ela seria responsvel, pelo des plastidiais, em organismos que possuem essa protena.
menos em parte, pela estabilizao da estrutura da ala
em D (D-loop) do mtDNA, um elemento de fita simples Plastdeos de eucariotos fotossintetizantes, por sua
importante para a sua replicao. vez, incluindo os de algas verdes (Chlorophyta, Plantae)
e plantas terrestres (Embryophyta, Plantae), desenvolve-
A participao de produtos do genoma nuclear na orga- ram, ao longo de sua evoluo, um sistema de compacta-
nizao e na manuteno do nucleoide mitocondrial evi- o do ptDNA sem a participao da HU. Dentre as vrias
denciada pela presena da protena Dna2 entre aquelas que protenas que se ligam ao ptDNA e que possivelmente es-
so identificadas como ligantes diretas do mtDNA. A Dna2, to envolvidas nesse sistema, podem ser destacadas trs:
codificada por um gene nuclear, uma DNA-helicase im- a enzima sulfito-redutase, a protease CND41 e a protena
portante, tanto para a replicao como para o reparao do PEND. A sulfito-redutase (SiR), alm de atuar no estro-
mtDNA. Assim como a DNA-helicase Twinkle, codificada ma de cloroplastos no processo de assimilao de enxofre,
por um gene mitocondrial, a Dna2 est entre as protenas liga-se ao ptDNA e induz a sua compactao de forma re-
mais representadas em nucleoides de mitocndrias. versvel. Essa enzima a protena de ligao ao DNA mais

Zaha_5ed_03.indd 55 27/11/13 10:51


Biologia Molecular Bsica 56

abundante em nucleoides plastidiais. A protease CND41 de sequncia. A PEND (de plastid envelope DNA-binding
(de 41-kDa chloroplast nucleoid DNA-binding protein ligao do DNA ao envoltrio plastidial), por sua vez,
protena de ligao a nucleoides de cloroplastos de 41 kDa) uma protena que se associa simultaneamente membra-
tambm considerada uma protena bifuncional, como na interna do envoltrio plastidial e ao ptDNA, ancorando
a SiR, pois, alm de atuar com sua atividade proteoltica os nucleoides de plastdeos em desenvolvimento. A PEND
de aspartil-peptidase acdica nos processos de senescn- uma protena de 70 kDa, com um domnio de ligao ao
cia foliar, liga-se ao ptDNA e o compacta, reprimindo a DNA, (cbZIP), na sua extremidade aminoterminal, e um
transcrio gnica plastidial. A CND41 contm motivos de domnio hidrofbico transmembranar, na sua regio car-
ligao ao DNA do tipo hlice-volta-hlice e dedo de zinco boxiterminal. Ela forma homodmeros que se ligam a se-
(ver Captulo 14) e associa-se ao ptDNA sem especificidade quncias TAA-GAAGT no ptDNA.

Resumo
As molculas de DNA que constituem os genomas celu- de protenas cromatnicas eucariticas. Algumas das
lares ocupam, em sua forma estendida, volumes maio- NAPs de arqueas polimerizam sobre o DNA e formam
res do que os dos compartimentos que as contm. Para fibras nucleoproteicas similares da cromatina euca-
que essas molculas sejam acomodadas em clulas pro- ritica. Em clulas eucariticas, a cromatina nuclear
cariticas, no ncleo, ou em organelas de clulas proca- est organizada em nucleossomos, que so partculas
riticas, elas precisam ser compactadas, constituindo o formadas por um octmero de histonas em torno das
que se chama de cromatina. Na cromatina, o DNA quais o DNA d duas voltas. Uma histona de ligao
compactado de maneira organizada e reversvel, de associa-se externamente ao complexo octmero-DNA
modo que, conforme a demanda fisiolgica da clula, ele e envolve-se em interaes entre nucleossomos.
pode ser descompactado para permitir a ocorrncia de
Durante o ciclo celular, h uma transio entre di-
processos como a replicao e a transcrio.
ferentes estados de compactao da cromatina, desde
Diferentes sistemas de compactao do DNA so a sua conformao mais aberta, na interfase, at a for-
utilizados em bactrias, arqueas e no ncleo e organe- mao de cromossomos metafsicos, que representam
las de clulas eucariticas. Em bactrias, o complexo seu estado de condensao mxima. Nessa dinmica
nucleoproteico da cromatina formado pela associa- de compactao, as fibras de cromatina formadas pela
o do cromossomo com as chamadas protenas as- sequncia linear de nucleossomos condensam-se pro-
sociadas ao nucleoide (NAPs). As NAPs organizam o gressivamente e formam fibras de maior dimetro e
nucleoide bacteriano em mltiplas alas, com o DNA alas cromossmicas. Mitocndrias e plastdeos tm
associado a protenas e superenrolado negativo em os seus genomas compactados em nucleoides por pro-
cada uma delas. Em arqueas, o repertrio de NAPs tenas, que so exclusivas de cada organela e diferem
inclui tanto protenas exclusivas do domnio Archa- tanto das NAPs procariticas como das protenas da
ea, como protenas ortlogas de NAPs bacterianas ou cromatina nuclear.

Leituras recomendadas
Dillon SC, Dorman CJ. Bacterial nucleoid-associated Sandman K, Reeve JN. Archaeal chromatin proteins:
proteins, nucleoid structure and gene expression. Nat Rev different structures but common function? Curr Opin
Microbiol. 2010;8(3):185-95. Microbiol. 2005;8(6):656-61.
Luijsterburg MS, Noom MC, Wuite GJ, Dame RT. The Sakai A, Takano H, Kuroiwa T. Organelle nuclei in higher
architectural role of nucleoid-associated proteins in plants: structure, composition, function, and evolution. Int
the organization of bacterial chromatin: a molecular Rev Cytol. 2004;238:59-118.
perspective. J Struct Biol. 2006;156(2):262-72.
Segal E, Widom J. What controls nucleosome positions?
Luijsterburg MS, White MF, van Driel R, Dame RT. The Trends Genet. 2009;25(8):335-43.
major architects of chromatin: architectural proteins in
Spelbrink JN. Functional organization of mammalian
bacteria, archaea and eukaryotes. Crit Rev Biochem Mol
mitochondrial DNA in nucleoids: history, recent developments,
Biol. 2008;43(6):393-418.
and future challenges. IUBMB Life. 2010;62(1):19-32.
Richmond TJ, Davey CA. The structure of DNA in the
Woodcock CL, Ghosh RP. Chromatin higher-order
nucleosome core. Nature. 2003;423:145-50.
structure and dynamics. Cold Spring Harb Perspect Biol.
2010;2(5):a000596.

Zaha_5ed_03.indd 56 27/11/13 10:51


Captulo 4

Henrique Bunselmeyer Ferreira

Genes e Genomas
Procariticos

1. Genes procariticos 58 2.5 Contedo de G+C 72


1.1 Estrutura bsica 58 2.6 Distribuio dos genes e de outras sequncias
1.2 Tamanho 60 em genomas procariticos 74
1.3 Homologia entre genes procariticos 60 2.6.1 Orientao e localizao de genes
em relao origem e ao sentido da
replicao 74
2. Genomas procariticos 62
2.6.2 Desvios de GC 75
2.1 Tamanho 62
2.6.3 Sintenia: conservao da ordem
2.2 Forma, nmero e organizao em replicons de dos genes 76
cromossomos procariticos 63
2.6.4 Superperons e ultraperons 77
2.3 Densidade gnica 64
2.4 Unidades organizacionais de genomas
3. Dinmica evolutiva dos genomas
procariticos: caractersticas e
procariticos 79
representatividade 65
3.1 Principais processos evolutivos 79
2.4.1 Motivos 65
3.1.1 Processos inovadores 79
2.4.2 Repeties 66
3.1.2 Processos que determinam perda de
2.4.3 Genes 67
sequncias 81
2.4.4 perons 69
3.2 Principais tendncias evolutivas 82
2.4.5 Domnios e macrodomnios 70
2.4.6 Ilhas genmicas 71

Zaha_5ed_04.indd 57 27/11/13 09:21


Biologia Molecular Bsica 58

Sistemas de classificao relativamente recentes divi- cilmente discernveis luz de anlises comparativas de
dem os seres vivos celulares em trs grandes clados, de- suas sequncias nucleotdicas. A seguir, sero descritas
nominados domnios: Bacteria, Archaea e Eukarya as principais caractersticas estruturais que definem
(ver Material Complementar Online 4.1). Os dois genes e genomas procariticos. Alm disso, ser feita
primeiros domnios compem o superclado Prokarya, uma correlao dos aspectos estruturais descritos com
que inclui organismos unicelulares caracterizados pela a funcionalidade e a dinmica evolutiva de genomas de
ausncia de organelas e chamados genericamente de bactrias e de arqueas.
procariotos. Em clulas procariticas, o material ge-
ntico (DNA) encontra-se compactado em uma regio
denominada nucleoide (ver Captulos 1 e 3), que no
separada do restante do citoplasma por qualquer tipo de 1. Genes procariticos
membrana. O domnio Bacteria formado pelas bactrias
verdadeiras, que s vezes so chamadas de eubactrias. 1.1 Estrutura bsica
As bactrias so separadas das arqueas, constituintes do
Antes de discutir a organizao de genes e genomas de
domnio Archaea, com base em uma srie de diferenas
procariotos, importante conceituar o que um gene e
genticas e bioqumicas importantes. O terceiro domnio
qual a estrutura bsica dos genes de bactrias e arqueas.
Eukarya inclui todos os eucariotos, um grupo hete-
Simplificadamente, um gene, seja ele de um procarioto
rogneo de organismos que inclui desde protozorios e
ou de um eucarioto, pode ser definido, do ponto de vista
algas unicelulares at fungos, vegetais e animais. As clu-
molecular, como um segmento de DNA que inclui todas
las eucariticas, caracterizadas principalmente pela pre-
as sequncias nucleotdicas necessrias e suficientes para
sena de organelas definidas, como o ncleo, tm uma
a sntese de pelo menos um produto correspondente,
estrutura e uma organizao funcional mais complexa do
que pode ser um mRNA a ser traduzido em uma cadeia
que as clulas procariticas (ver Captulo 1).
polipeptdica (protena) ou outros tipos de RNA (como
Apesar da aparente simplicidade e da semelhan- rRNAs ou tRNAs, entre outros). Em sua estrutura bsi-
a superficial entre bactrias e arqueas, os procariotos ca, cada gene constitudo por uma regio codifica-
em geral so organismos to ou mais heterogneos do dora, que a sequncia nucleotdica que codifica o seu
ponto de vista de suas constituies genticas do que produto (de RNA ou polipeptdico), e pelas sequncias
os organismos eucariticos (discutidos no Captulo 5). reguladoras, que a flanqueiam (as distncias so va-
Essa grande diversidade gentica fica evidente a partir riveis de gene para gene) controlando a sua expresso
de anlises genmicas comparativas abrangentes, poss- (Figura 4.1).
veis agora devido ao nmero cada vez maior de espcies
A expresso de um gene procaritico inclui a sua
procariticas que esto tendo seus genomas completa-
transcrio em um RNA (ver Captulo 10) e a traduo
mente sequenciados. O primeiro genoma procaritico a
do transcrito (se for um mRNA) em uma cadeia polipep-
ser inteiramente sequenciado foi o da bactria patog-
tdica (ver Captulo 12). Genes que codificam rRNAs,
nica Haemophilus influenzae, em 1995, e o primeiro se-
tRNAs ou outras classes menores de RNA so transcri-
quenciamento completo de um genoma de uma arquea
tos, mas no so traduzidos. A traduo s ocorre com
foi o de Methanococcus jannaschii (espcie hoje deno-
mRNAs, os quais so transcritos a partir de genes que
minada Methanocaldococcus jannaschii), concludo em
codificam cadeias polipeptdicas. Etapas de maturao
1996. Desde ento, o nmero de genomas procariticos
de produtos de transcrio primrios para a produo
completamente sequenciados vem crescendo de manei-
de transcritos maduros (ver Captulo 11) tambm fa-
ra quase exponencial e, apesar das espcies estudadas
zem parte do processo de expresso gnica, mas, em
ainda representarem uma frao mnima da biodiversi-
procariotos, essas etapas esto restritas maturao de
dade procaritica na Terra (< 0,1%), j existe uma re-
rRNAs e tRNAs.
presentatividade amostral de todos os filos de bactrias
e arqueas. No momento da reviso final deste captulo, O processo de sntese de RNA (transcrio), que pro-
em setembro de 2011, 1.643 genomas de bactrias e 117 gride de 5' para 3', define a orientao do gene. Assim,
genomas de arqueas haviam sido completamente se- cada gene est orientado de 5' para 3', considerando a
quenciados, havendo ainda 5.140 genomas bacterianos e orientao da fita de DNA cuja sequncia estar repre-
90 genomas de arqueas em processo de sequenciamen- sentada no RNA (denominada fita codificadora). A ou-
to. Dados atualizados sobre o progresso do sequencia- tra fita de DNA, complementar fita codificadora e com
mento de genomas procariticos podem ser obtidos na orientao inversa (de 3' para 5'), denominada fita-
internet, em pginas institucionais especializadas, cujos -molde, pois serve de molde para a sntese do RNA. O
endereos eletrnicos podem ser encontrados no final RNA transcrito complementar fita-molde e, por con-
deste captulo. seguinte, tem a mesma orientao e sequncia correspon-
dente a da fita codificadora.
Apesar da grande heterogeneidade gentica, fisio-
lgica e ecolgica das espcies procariticas, os genes Em um gene procaritico tpico, as sequncias re-
e os genomas tanto de bactrias como de arqueas pos- guladoras que controlam a sua transcrio encontram-
suem alguns princpios organizacionais comuns e fa- -se em posies adjacentes regio codificadora (ver

Zaha_5ed_04.indd 58 27/11/13 09:21


59 Genes e Genomas Procariticos
Regio reguladora

Stio de trmino
da transcrio
da transcrio
Stio de incio

a jusante
Regio reguladora
a montante Regio codificadora
5'3'
DNA 3'5'
Stio regulador
distal

Stio regulador
proximal
Promotor
Transcrio

Regio Regio
5'-UTR Regio codificadora 3'-UTR

mRNA 3'
5'
Stio de incio Stio de trmino
da traduo da traduo

Traduo

Cadeia polipeptdica

Figura 4.1
Esquema representativo da estrutura e da expresso de um gene procaritico que co-
difica uma protena. O gene constitudo basicamente por uma regio codificadora (de seu pro-
duto) e por regies reguladoras (da sua expresso). Por conveno, o gene representado de 5' para
3', considerando sua fita codificadora (em ). A fita complementar (em ), de orientao oposta
(de 3' para 5'), utilizada como molde para a sntese de um mRNA de mesma orientao e sequn-
cia de bases (salvo a troca de T por U) que a fita codificadora. A regio codificadora flanqueada
pelas regies reguladoras. A regio reguladora a montante da regio codificadora inclui o promotor,
e pode incluir um ou mais stios de ligao de protenas ativadoras ou repressoras da transcrio. A
jusante da regio codificadora, h uma sequncia reguladora que determina o final do processo de
transcrio do gene. Quando o gene expresso, a RNA-polimerase o transcreve em um mRNA, cuja
sntese inicia alguns pares de bases antes da regio codificadora e termina alguns pares de bases
depois do final dessa regio. As regies no codificadoras do RNA so chamadas de regies 5' ou
3' no traduzidas ou UTR (de untranslated region). Na regio 5'-UTR do mRNA transcrito, h se-
quncias importantes para o incio da sua traduo. Nos ribossomos, a regio codificadora do RNA
interpretada de 5' para 3' e traduzida em uma cadeia polipeptdica, cuja sequncia de aminocidos
sintetizada da sua extremidade aminoterminal para a sua extremidade carboxiterminal. Em genes
que codificam apenas RNAs, como os de rRNA e tRNA, a etapa de traduo no ocorre.

Figura 4.1). As sequncias reguladoras da transcrio presentes outros elementos reguladores, que so stios
mais fundamentais so o promotor, situado na regio de ligao de protenas ativadoras ou repressoras da
flanqueadora 5', a montante da regio codificadora, e transcrio. Esses stios reguladores adicionais podem
o terminador, situado na regio flanqueadora 3', a ju- estar situados em uma posio adjacente ao promotor
sante da regio codificadora. O promotor o stio no e at sobrepostos a ele, mas tambm podem estar em
DNA onde a RNA-polimerase, enzima responsvel pela posies mais distais, de at poucas centenas de pares
transcrio do gene, se liga. O terminador a sequncia de bases a montante do promotor. O Captulo 13 apre-
nucleotdica que determina a dissociao da RNA-po- senta uma discusso detalhada sobre a organizao e
limerase da fita-molde e o final do processo de trans- as funes das sequncias reguladoras de genes proca-
crio. Alm das referidas sequncias, podem estar riticos.

Zaha_5ed_04.indd 59 27/11/13 09:21


Biologia Molecular Bsica 60

Uma caracterstica tpica de genes procariticos codificadoras com tamanhos entre 4.500 e 5.100 pb (co-
a colinearidade existente entre cada gene e o seu pro- dificando protenas com 1.500 a 1.700 aminocidos), 51
duto (seja uma cadeia polipeptdica ou um RNA). Isso com tamanhos entre 3.000 e 4.500 pb (codificando pro-
significa dizer que h uma exata correspondncia en- tenas com 1.000 a 1.500 aminocidos) e 381 com tama-
tre a sequncia nucleotdica da regio codificadora do nho menor que 300 pb (codificando protenas com me-
gene (DNA) e a sequncia de aminocidos da cadeia nos de 100 aminocidos).
polipeptdica ou a sequncia de nucleotdeos de um
rRNA ou tRNA, por exemplo. Assim, considerando que,
em um gene codificador de uma cadeia polipeptdica,
1.3 Homologia entre genes procariticos
cada cdon de trs nucleotdeos codifica um aminoci- Muitos genes (e tambm outros elementos genmicos
do, para codificar uma protena com um nmero n de estruturais e funcionais) de procariotos (e tambm de
aminocidos necessria uma regio codificadora no eucariotos, ver Captulo 5) apresentam similaridades
gene correspondente com 3n pares de bases. Essa re- evidentes em suas sequncias nucleotdicas, as quais
lao, embora parea bvia, representa uma diferena so genericamente referidas como homologias. De
bsica entre a estrutura de praticamente todos os genes grau varivel conforme o caso, essas homologias decor-
de procariotos e a estrutura de um grande nmero de rem dos processos evolutivos que deram origem s se-
genes de eucariotos, que podem apresentar sequncias quncias envolvidas. Os processos evolutivos determi-
intervenientes (os chamados ntrons) interrompendo nantes do surgimento de sequncias homlogas, como
aquelas sequncias de DNA que devem estar represen- a duplicao seguida de divergncia, a transferncia
tadas no produto final de expresso do gene (ver Ca- gnica horizontal e a especiao, sero discutidos, em
ptulo 5). O sequenciamento de centenas de genomas um contexto genmico procaritico, na Seo 3 deste
e milhares de genes revelou que a maioria dos genes captulo. Aqui, ser apresentado a definio de alguns
procariticos no apresenta ntrons e colinear com os conceitos e parmetros para o reconhecimento de pa-
respectivos produtos, apesar de excees a essa regra rentesco evolutivo entre genes e outras sequncias, os
j terem sido identificadas em genes tanto de bactrias quais so aplicveis tanto para os procariotos como
como de arqueas. para os eucariotos.
Assume-se que quaisquer genes ou sequncias nu-
1.2 Tamanho cleotdicas com homologia (isto , com identidade par-
cial ou at total) tenham uma origem evolutiva comum.
O tamanho de um gene est vinculado ao nmero e
O grau de conservao necessrio para que duas sequn-
extenso das sequncias nucleotdicas que compem as
cias nucleotdicas possam ser consideradas homlogas
suas regies reguladoras e extenso da sua regio codi-
quantitativo e arbitrrio. Alguns autores, por exem-
ficadora, que varia de acordo com o tamanho do produto
plo, consideram homlogos genes que tm pelo menos
codificado. Entretanto, os genes procariticos, por no
30% de identidade em suas sequncias ao longo de pelo
apresentarem regies reguladoras muito extensas nem
menos 60% de suas extenses. Genes com menor grau
serem interrompidos por ntrons, variam em tamanho
de identidade so considerados no relacionados (pelo
dentro de uma faixa mais restrita do que aquela dos ge-
menos em termos evolutivos), e genes com um grau de
nes eucariticos.
identidade muito mais elevado, prximo a 100%, mas
As sequncias de funo reguladora de genes pro- no necessariamente idnticos, so considerados cpias,
cariticos so curtas, com menos de 20 pb, estando em pois se assume que codifiquem produtos sem distino
geral posicionadas a distncias relativamente pequenas funcional.
(de poucas dezenas a poucas centenas de pares de ba-
Genes homlogos surgem ao longo da evoluo a
ses), a montante ou a jusante das regies codificadoras.
partir da ocorrncia de diferentes processos evolutivos
Por isso, elas representam uma frao da extenso total
e, em razo disso, so estabelecidas diferentes categorias
do gene que oscila, em mdia, entre 5 e 10%, sendo o
de homologia e de sequncias homlogas (Figura 4.2).
restante correspondente regio codificadora. Para ge-
Quando o evento evolutivo determinante da presena de
nes procariticos que codificam polipeptdeos (os quais
dois genes (ou sequncias) homlogos uma duplicao
ocupam mais de 95% do espao do genoma em qualquer
de uma regio cromossmica, os genes duplicados so
espcie de bactria ou arquea), a extenso das regies
chamados de parlogos. Em um primeiro momento,
codificadoras oscila entre pouco menos de 100 pb at
uma duplicao gera cpias idnticas do segmento cro-
quase 10.000 pb, com a grande maioria tendo em torno
mossmico envolvido. Contudo, com o passar do tempo
de 1.000 pb.
e dependendo das presses seletivas atuantes, diferentes
No genoma da bactria Escherichia coli (linhagem situaes podem ocorrer. As cpias podem, por exemplo,
K-12), por exemplo, o tamanho mdio das regies codi- serem fixadas como tal (Figura 4.2A), em situaes nas
ficadoras dos aproximadamente 4.300 genes identifica- quais os genes duplicados supririam uma demanda eleva-
dos de 951 pb (equivalente a 317 aminocidos). A re- da do mesmo produto gnico. Alternativamente, uma das
gio codificadora mais longa tem 7.149 pb e codifica uma cpias pode ser fixada, suprindo a demanda pelo produto
protena de 2.383 aminocidos. H ainda quatro regies original, e a outra pode divergir em sua sequncia (Figura

Zaha_5ed_04.indd 60 27/11/13 09:21


61 Genes e Genomas Procariticos
A B Gene C Espcie ancestral
ancestral Gene
ancestral
Gene
ancestral

Duplicao
Especiao

Duplicao Cpia 1 Cpia 2 Espcie 1 Espcie 2

Conservao Divergncia Genes ortlogos


Cpia 1 Cpia 2
ao longo da ao longo da
evoluo evoluo
Fixao ao longo Cpia 1 Gene relacionado D Espcie 1
da evoluo Gene
Genes parlogos mobilizado
Cpia 1 Cpia 2
Transferncia
Conservao Divergncia adicional gnica
Duas cpias do gene ancestral ao longo da e perda de funcionalidade horizontal
evoluo ao longo da evoluo
Cpia 1 Gene no funcional Espcie 1 Espcie 2

Pseudogene Genes xenlogos

Figura 4.2
Eventos evolutivos que geram cpias de genes, genes parlogos, pseudogenes, genes ortlogos e genes
xenlogos. (A) Uma simples duplicao de um segmento cromossmico pode gerar duas cpias de um mesmo gene;
se esse aumento do nmero de cpias conferir alguma vantagem adaptativa, ele poder ser fixado ao longo da evoluo.
(B) Aps um evento de duplicao, uma das cpias geradas pode manter a funo ancestral, ao passo que a outra pode
divergir e, eventualmente, assumir outra funo relacionada. Os genes gerados por duplicao e posterior divergncia
so chamados de parlogos; genes duplicados que, ao divergirem, perdem sua funcionalidade, mas no a homologia
com seu(s) parlogo(s), so chamados de pseudogenes. (C) Genes com sequncias nucleotdicas similares e codificando
protenas com funes correspondentes em duas espcies diferentes podem ser derivados de um gene originalmente
presente em um ancestral comum quelas duas espcies; esses genes, relacionados no por duplicao, mas pela ances-
tralidade comum, so chamados de ortlogos. (D) Genes adquiridos independentemente por duas espcies por meio de
eventos de transferncia gnica horizontal envolvendo uma terceira espcie so chamados de xenlogos. Na figura, as
barras em representam as sequncias ancestrais; as barras em representam sequncias que divergiram ao longo
da evoluo.

4.2B), dando origem a um gene parlogo codificador de muito maior do que o nmero identificvel na compa-
um produto relacionado, mas no idntico ao original, rao do genoma de cada uma dessas bactrias com o
podendo inclusive ter funcionalidade distinta. Em alguns genoma de uma arquea ou de um eucarioto. A impli-
casos, a progressiva divergncia associada uma relativa cao bvia destas comparaes que as duas espcies
falta de presso seletiva para manuteno da sequncia bacterianas so mais aparentadas entre si do que com
de uma das cpias de um gene pode determinar que essa espcies dos domnios Archaea e Eukarya, justificando
cpia se torne no funcional, o que far dela um pseu- a separao desses organismos em diferentes clados. A
dogene. identificao de genes ortlogos, mesmo quando com-
parando genomas de organismos muito distantes evo-
Quando o determinante da presena de homologia
lutivamente, como o de uma bactria com o de um ma-
entre dois genes (ou sequncias) so eventos de espe-
mfero, por exemplo, uma evidncia de que, em algum
ciao (surgimento de novas espcies ao longo da evolu-
momento ao longo da evoluo, tais organismos com-
o), os genes em questo so chamados de ortlogos
partilharam um mesmo ancestral.
(Figura 4.2C). Nesse caso, em genomas de espcies dis-
tintas, os genes ortlogos (que tenham um ancestral co- A transferncia gnica horizontal, mediada por ele-
mum em sua histria evolutiva) so identificveis como mentos genticos mveis (Captulo 9), tambm reco-
sequncias similares, que codificam produtos tambm nhecida como um processo marcante na evoluo de or-
similares e com funes correspondentes em cada uma ganismos procariticos e capaz de levar ao surgimento de
das espcies. Quanto maior for o nmero de genes or- genes ortlogos (Figura 4.2D). Neste caso, duas ou mais
tlogos presentes em genomas de espcies diferentes, espcies distintas podem adquirir, de forma independen-
maior o grau de parentesco (ou a proximidade) desses te, um mesmo gene a partir de eventos de transferncia
organismos na escala evolutiva. Por exemplo, o nme- gnica horizontal da espcie de origem do gene. Os genes
ro de genes ortlogos identificveis na comparao de ortlogos, adquiridos dessa forma, so chamados de ge-
genomas de duas espcies quaisquer de bactrias ser nes xenlogos.

Zaha_5ed_04.indd 61 27/11/13 09:21


Biologia Molecular Bsica 62

(microspordios tm genomas da ordem de 2,9 Mb, e


2. Genomas procariticos os menores genomas de leveduras oscilam entre 10 e 12
Mb, ver Captulo 5).
2.1 Tamanho
Entre os extremos menores e maiores, tanto as es-
Os genomas procariticos j sequenciados, que, como pcies de bactrias como as de arqueas apresentam dis-
visto anteriormente, constituem uma amostragem re- tribuies caractersticas no tamanho de seus genomas.
presentativa de todos os filos de bactrias e de arque- Para bactrias, predominam espcies com genomas com
as, variam de tamanho dentro de uma faixa ampla, que cerca de 2 e 5 Mb, o que resulta em uma distribuio bi-
vai de pouco mais de 150.000 pb (150 kb ou 0,15 Mb) modal, apesar de haver muitas espcies com genomas de
at pouco mais de 13.000.000 pb (13.000 kb ou 13 Mb) tamanho intermedirio. J para arqueas, h uma clara
(Figura 4.3). Entre bactrias, so exemplos extremos predominncia de espcies com genomas de aproxima-
o genoma de 159.662 pb de C. rudii (uma endossim- damente 2 Mb, coincidindo com o primeiro pico bacteria-
bionte de insetos hempteros da famlia Psyllidae) e o
no. Genomas de arqueas muito menores ou maiores que
genoma de 13.033.779 pb da mixobactria de solo S.
2 Mb so uma minoria e, dentre eles, h uma clara predo-
cellulosum. Entre as arqueas, o menor genoma conheci-
minncia dos maiores que 2 Mb em relao aos menores
do o de N. equitans, uma endossimbionte obrigatria
que 2 Mb.
de outra arquea (Ignicoccus hospitalis), com 490.885
pb, e o maior o de M. acetivorans, uma metangena Quando feita uma anlise comparativa dos tama-
anaerbia, com 5.751.492 pb. Esses limites extremos de nhos dos genomas entre espcies, linhagens ou isolados
tamanho chegam a proporcionar sobreposies com os de bactrias ou arqueas dentro de uma mesma catego-
maiores genomas virais de um lado (o do bacterifago ria taxonmica, observa-se uma considervel hetero-
KZ tem 280.334 pb e o do mimivrus APMV tem 1,2 geneidade. Por exemplo, E. coli K-12 tem um genoma
Mb, p. ex.) e os menores genomas eucariticos de outro de 4.639.221 pb (pouco mais de 4,6 Mb), mas j foram

Methanosarcina acetivorans
Halobacterium salinarium
Sulfolobus solfataricus
Halobacterium salinarum
Archaeoglobus fulgidus
Halobacterium sp.
Pyrococcus furiosus
Ferroplasma acidarmanus
Methanothermobacter thermautotrophicus
M. jannaschii
Thermoplasma acidophilum
Nanoarchaeum equitans

Sorangium cellulosum
Nostoc punctiforme
Gemmata obscuriglobus
Myxococcus xanthus
Streptomyces coelicolor
Mesorhizobium loti
Burkholderia pseudomallei
Mycobacterium smegmatis
Pseudomonas aeruginosa
Pseudomonas putida
E. coli 0157:H7
Salmonella enterica Typhi
Agrobacterium tumefaciens
E. coli K-12
Mycobacterium tuberculosis
Bacillus subtilis
Caulobacter crescentus
Geobacter sulfurreducens
Vibrio cholerae
Xylella fastidiosa
Deinococcus radiodurans
Lactococcus lactis
Neisseria meningitidis
Chlorobium tepidum
H. influenzae
Aquifex aeolicus
Rickettsia prowazekii
Mycoplasma hyopneumoniae J
Mycoplasma genitalium
Buchnera aphidicola BCc
Sulcia muelleri
Carsonella rudii
0 1 2 3 4 5 6 7 8 9 10 11 12 13

Tamanho do genoma (Mb)

Figura 4.3
Grfico representativo do tamanho dos genomas de algumas espcies de arqueas (barras em ) e bactrias (barras em ).

Zaha_5ed_04.indd 62 27/11/13 09:21


63 Genes e Genomas Procariticos
caracterizados genomas de outras linhagens de E. coli No que diz respeito forma e ao nmero de mol-
com tamanhos entre 4,5 e 5,5 Mb, o que implica em di- culas de DNA constituintes do genoma, a maioria das
ferenas de at 1 Mb entre genomas de indivduos de espcies de bactrias e de arqueas conhecidas tem seus
uma mesma espcie. Situaes similares foram descritas genomas representados por um nico cromossomo,
tambm para ecotipos de Prochlorococcus marinus (filo na forma de uma molcula de DNA de fita dupla circu-
Cyanobacteria), com genomas com tamanhos entre 1,6 lar covalentemente fechada. Em bactrias, essa situao
Mb e 2,4 Mb, e para linhagens de S. coelicolor (filo Ac- pode ser exemplificada por E. coli, cujo nico cromos-
tinobacteria), com genomas de tamanhos entre 8,7 Mb somo constitudo por uma molcula de DNA circular
e 9,7 Mb. que, como visto na Seo 2.1, tem mais de 4,5 Mb. H,
contudo, alguns poucos casos descritos de espcies bac-
Quando comparaes como essas so estendidas
terianas cujo genoma formado por mais de uma mo-
para nveis taxonmicos mais elevados, como o de filo, lcula de DNA, incluindo situaes nas quais uma ou
observa-se que o tamanho dos genomas de espcies de mais dessas molculas so lineares, em vez de circulares
um mesmo filo pode variar em at 10 vezes. Por exem- (Tabela 4.1). Essas diferentes configuraes genmicas
plo, em Bacteria, o filo Cyanobacteria apresenta espcies parecem estar restritas a algumas espcies ou gneros,
com genomas de 1,6 a 9,0 Mb, o filo Actinobacteria apre- havendo evidncias sugerindo que as variaes estrutu-
senta espcies com genomas de 0,9 a 9,7 Mb, e o filo Fir- rais hoje observadas surgiram de modo independente
micutes (bactrias gram-positivas), espcies com geno- ao longo da evoluo em cada grupo taxonmico que as
mas de 0,6 a 6 Mb. Em Archaea, a variao de tamanho apresenta. Em cada gnero ou espcie com genoma mul-
entre genomas de diferentes espcies de um mesmo filo timolecular, as molculas constituintes podem ser trata-
tambm evidente, apesar de restrita a limites mais es- das de acordo com seu tamanho e contedo gnico. Em
treitos. Por exemplo, espcies do filo Crenarchaeota tm geral, as molculas maiores, da ordem de centenas ou
genomas de 1,3 a 3 Mb e espcies do filo Euryarchaeota milhares de quilobases, e contendo predominantemente
tm genomas de 1,6 a 5,8 Mb. Tanto em bactrias como genes essenciais so chamadas de cromossomos. Quan-
em arqueas h uma considervel sobreposio entre as do se trata de molculas de DNA menores, da ordem de
faixas de tamanho dos genomas de espcies de filos dife- dezenas a poucas centenas de quilobases, e contendo
rentes, o que torna o tamanho dos genomas um parme- um nmero mais limitado de genes essenciais, algumas
tro inadequado para o estabelecimento de relaes filo- delas podem ser denominadas plasmdeos ou megaplas-
genticas. Isso ocorre porque o tamanho do genoma de mdeos, apesar de ainda serem consideradas como parte
qualquer espcie procaritica potencialmente muito do genoma.
plstico, podendo variar com relativa facilidade ao longo
da evoluo sob a influncia de processos determinantes Em arqueas, a amostragem de genomas estudados
de aquisio ou perda de sequncias, os quais sero dis- menor, mas as evidncias disponveis apontam para
cutidos na Seo 3. uma situao similar a de bactrias no que diz respei-
to organizao cromossmica. Assim, para arqueas,
Os menores genomas encontrados na natureza para a situao tpica a de genomas constitudos por um
organismos procariticos ou eucariticos, heterotrficos nico cromossomo circular (ver Tabela 4.2), embora
ou autotrficos e de vida livre ou dependentes de uma haja, tambm, como em bactrias, casos de genomas
espcie hospedeira suscitam questes sobre qual seria o multimoleculares, como o de Haloarcula marismortui
contedo mnimo de genes (e, consequentemente, o ta- (com dois cromossomos) e o de M. jannaschii (com um
manho mnimo de genoma) necessrio para cada uma cromossomo e dois elementos extracromossmicos).
dessas situaes. Isso resultou na proposio do conceito Ainda no foram descritos casos de cromossomos linea-
de genoma mnimo, que descreveria o menor genoma res em arqueas.
capaz de abrigar o nmero mnimo necessrio de genes
para a sobrevivncia de uma forma de vida celular (ver Outro aspecto estrutural importante de genomas
Material Complementar Online 4.2). procariticos refere-se organizao dos cromossomos
em unidades de replicao, que pode diferir entre bac-
trias e arqueas, e bastante distinta da encontrada em
2.2 Forma, nmero e organizao eucariotos (Tabela 4.2 e Figura 4.4). As unidades de
em replicons de cromossomos replicao, ou replicons, so os segmentos cromoss-
micos que replicam a partir de uma origem de replicao
procariticos
(ver Captulo 6) e, em bactrias, o conceito de replicon se
Do ponto de vista estrutural molecular bsico, todos os confunde com o de cromossomo, pois cada cromossomo
genomas procariticos, independentemente do tamanho, bacteriano possui apenas uma origem de replicao (Fi-
so constitudos por DNA de fita dupla. Essa universali- gura 4.4A). Em arqueas, por outro lado, h pelo menos
dade, contudo, no se estende a alguns outros aspectos duas situaes distintas (Figura 4.4B), que foram eviden-
estruturais importantes, como a forma e o nmero de ciadas a partir dos genomas at agora estudados quanto
cromossomos e a maneira como os cromossomos esto a este aspecto. Existem espcies de arqueas com cromos-
organizados em unidades de replicao. somos com uma nica origem de replicao e constituin-

Zaha_5ed_04.indd 63 27/11/13 09:21


Biologia Molecular Bsica 64

Tabela 4.1 Algumas espcies bacterianas com genomas formados por mais de uma molcula de DNA
Tipos de molculas
Espcies constituintes do genoma* Tamanho (kb) Forma

S. coelicolor Cromossomo 8.667 Linear


Plasmdeo 356 Linear
Plasmdeo 31 Circular
S. coelicolor Cromossomo 8.667 Linear
Plasmdeo 356 Linear
Plasmdeo 31 Circular
Borrelia burgdorferi Cromossomo 911 Linear
Plasmdeos (11) 9-54 Circular/Linear
Brucella melitensis Cromossomo 2.117 Circular
Cromossomo 1.178 Circular
Clostridium acetobutylicum Cromossomo 3.941 Circular
Megaplasmdeo 192 Circular
D. radiodurans Cromossomo 2.649 Circular
Cromossomo 412 Circular
Megaplasmdeo 177 Circular
Plasmdeo 46 Circular
Ralstonia solanacearum Cromossomo 3.716 Circular
Megaplasmdeo 2.095 Circular
S. enterica Typhi Cromossomo 4.809 Circular
Plasmdeo 218 Circular
Plasmdeo 107 Circular
Sinorhizobium meliloti Cromossomo 3.654 Circular
Megaplasmdeo 1.683 Circular
Megaplasmdeo 1.354 Circular
V. cholerae Cromossomo 2.941 Circular
Cromossomo 1.072 Circular
Yersinia pestis Cromossomo 4.654 Circular
Plasmdeos (3) 10-96 Circular

* A denominao de cada molcula componente do genoma est de acordo com sua descrio original para a espcie. A definio como cromossomo,
megaplasmdeo ou plasmdeo tem como base, para todas as espcies, o tamanho da molcula e a presena de genes essenciais, mas os parmetros
quantitativos foram estabelecidos arbitrariamente para cada espcie e, portanto, podem diferir entre elas.

do, portanto, um s replicon, como em bactrias. H, nmero de genes por quilobase em genomas procari-
contudo, outras arqueas com cromossomos com duas ou ticos evidencia que a maioria das espcies procariticas
at trs origens de replicao, os quais esto, portanto, tem genomas com densidades gnicas de 0,9 a 1,1 gene a
organizados em dois ou trs replicons, respectivamente. cada 1.000 pb ou, em mdia aproximada, 1 gene/kb. Os
Essa situao em genomas de arqueas parece ser inter- genomas de arqueas, contudo, tendem a ser um pouco
mediria entre a de bactrias, de um cromossomo: um mais compactos, pois predominam genomas com den-
replicon, e a de eucariotos, nos quais cada cromossomo sidades gnicas entre 1 e 1,1 gene/kb, ao passo que, para
est organizado em centenas ou milhares de replicons genomas bacterianos, os valores de densidade gnica
(Figura 4.4C). predominantes so da ordem de 0,9 gene/kb.
Outra anlise interessante de ser feita a da exten-
2.3 Densidade gnica so das regies intergnicas, que como um dos com-
Fatores como o tamanho relativamente reduzido dos ponentes que influenciam a densidade gnica, tambm
genomas, a extenso das regies codificadoras e re- evidencia o grau elevado de compactao da informa-
guladoras dos genes e o nmero de genes por genoma, o em genomas procariticos. Tanto em bactrias
determinam que os genomas procariticos apresentem como em arqueas, as regies intergnicas so bastante
uma elevada densidade gnica, principalmente em curtas, sendo, via de regra, muito menores que os ge-
comparao com genomas eucariticos. A anlise do nes ou as suas regies codificadoras. A extenso das re-

Zaha_5ed_04.indd 64 27/11/13 09:21


65 Genes e Genomas Procariticos
Tabela 4.2 Forma e organizao em replicons de cromossomos de Bacteria, Archaea e Eukarya. A
situao de Archaea representada por algumas das espcies que j tiveram seus genomas estudados
quanto ao nmero de origens de replicao. Para Bacteria e Eukarya, foram feitas generalizaes
baseadas em evidncias experimentais concordantes, disponveis para diversas espcies
Nmero de origens de
Forma do(s) Nmero de replicao (ou de replicons)
Domnio Espcie cromossomo(s) cromossomos por cromossomo
a
Bacteria Todas Circular 1b 1
Archaea A. fulgidus Circular 1 1
Halobacterium sp. NRC-1 Circular 1 (e 2 plasmdeos) 2
M. thermautotrophicus Circular 1 1
Methanosarcina mazei Circular 1 1
Pyrococcus abyssi Circular 1 (e 1 plasmdeo) 1
P. furiosus Circular 1 1
M. jannaschii Circular 1 (e 2 elementos 2
extracromossmicos)
Sulfolobus acidocaldarius Circular 1 3
S. solfataricus Circular 1 2
Eukarya Todas Linear Vrios Centenas ou milhares
a
Casos de cromossomos lineares so considerados excees.
b
Casos de genomas multimoleculares so considerados excees.

gies intergnicas em genomas procariticos pode va- genoma bacteriano ou de arqueas. A seguir, sero dis-
riar desde nenhum par de base at pouco mais de 1.000 cutidas as caractersticas fundamentais de cada um dos
pb. Entretanto, tanto em bactrias como em arqueas, principais tipos de unidades organizacionais encontra-
h uma evidente distribuio bimodal das extenses dos em genomas procariticos.
observadas, com predominncia de regies intergni-
cas menores que 2 a 5 pb e em torno de 100 pb. Essa 2.4.1 Motivos
distribuio em dois picos consequncia da organiza-
Motivos so sequncias nucleotdicas curtas, em geral
o de muitos genes procariticos em perons, unidade
de dois at algumas dezenas de pares de bases de exten-
organizacional discutida na Seo 2.4.4. Em perons,
so, que podem ser relativamente comuns em genomas
a justaposio de regies codificadoras sob controle
procariticos. Essas sequncias podem estar dispersas
de uma regio reguladora comum explica a elevada
ou agrupadas no genoma e, em muitos casos, so unida-
frequncia de regies intergnicas menores que 5 pb, des formadoras de repeties (ver Seo 2.4.2). Alguns
ao passo que regies intergnicas da ordem de 100 pb motivos, contudo, podem ser mais do que meras uni-
corresponderiam, predominantemente, a regies entre dades estruturais e constituir elementos de sequncia
perons. importantes do ponto de vista funcional. Por exemplo,
os stios Chi (de crossover hot spot instigator, insti-
2.4 Unidades organizacionais de genomas gador de stios preferenciais de recombinao), com as
sequncias consensuais 5'-GCTGGTGG-3', em E. coli,
procariticos: caractersticas e e 5'-GNTGGTGG-3' e 5'-G(G/C)TGGAGG-3', em H. in-
representatividade fluenzae, so motivos superrepresentados em genomas
Os genes so apenas alguns dos componentes de se- bacterianos (1.008 cpias no genoma de E. coli K-12) e
quncia presentes em um genoma, e, em genomas importantes para a recombinao gentica, assunto que
procariticos, outras unidades organizacionais de se- ser tratado no Captulo 8.
quncia podem ser identificadas. Essas unidades or- Outro exemplo interessante so os motivos
ganizacionais podem ser hierarquizadas do ponto de KOPS (de FtsK orienting polar sequences, sequn-
vista estrutural, pois variam em complexidade, desde cias polares orientadoras de FtsK), orientados a partir
simples motivos de sequncia curtos at segmentos da origem em direo ao stio de trmino da replica-
cromossmicos inteiros (Figura 4.5). Contudo, o mais o do cromossomo. Os motivos KOPS tm a sequn-
importante que cada uma delas pode ter implicaes cia 5'-GGGNAGGG-3' em E. coli e outras bactrias, e
funcionais e/ou evolutivas e que, no conjunto, elas de- o reconhecimento deles pela DNA-translocase FtsK faz
finem a arquitetura estrutural e funcional de qualquer parte do mecanismo de separao (resoluo) em mo-

Zaha_5ed_04.indd 65 27/11/13 09:21


Biologia Molecular Bsica 66

A B

Figura 4.4
Organizao em replicons de cromossomos de bactrias, arqueas e
eucariotos. Cromossomos bacterianos (A), tipicamente circulares, apresentam
uma nica origem de replicao e, portanto, constituem um nico replicon. Cro-
mossomos de arqueas (B) tambm so circulares, mas, dependendo da espcie,
podem ter uma, duas ou trs origens de replicao, constituindo um, dois ou
trs replicons, respectivamente. Cromossomos eucariticos (C), por sua vez, so
lineares e esto organizados em centenas ou milhares de replicons. As origens de
replicao esto representadas em ; a cada ciclo de diviso celular, um processo
de replicao bidirecional (indicado por um par de setas em divergentes) inicia
a partir de cada origem.

nmeros dos dmeros de cromossomos gerados na re- tambm esto presentes em genomas procariticos. Es-
plicao (ver Captulo 6). No genoma de E. coli K-12, os sas sequncias repetidas so compostas por unidades
motivos KOPS esto superrepresentados na fita repli- de repetio em geral curtas, com menos de 10 pb, mas
cada continuamente (fita-lder do cromossomo), com que, no conjunto, podem representar uma frao signifi-
335 ocorrncias (contra apenas 33 na fita tardia), o que cativa de um genoma procaritico, embora sempre mino-
representa uma cpia do motivo a aproximadamente ritria em relao frao correspondente s sequn-
cada 13 kb. cias nicas (no repetidas). Menos de 2% de qualquer
genoma procaritico so compostos de sequncias repe-
2.4.2 Repeties tidas, o que contrasta com a representatividade desse tipo
Sequncias repetidas, apesar de serem muito mais de sequncia em genomas eucariticos, que pode chegar
abundantes em genomas eucariticos (ver Captulo 5), a mais de 50%.

Repeties Domnios Macrodomnios

Motivos Genes Ilhas

perons
1 10 102 103 104 105 106

Extenso (pb)

Figura 4.5
Principais unidades organizacionais de genomas procariticos. As
barras em indicam as extenses aproximadas tpicas para cada tipo de unidade
organizacional, conforme a escala exponencial indicada na barra inferior.

Zaha_5ed_04.indd 66 27/11/13 09:21


67 Genes e Genomas Procariticos
Em genomas procariticos, diferentes famlias de 2.4.3 Genes
sequncias repetidas esto presentes, com nmeros
de cpias que podem variar de menos de 5 at algumas Como discutido anteriormente (Seo 2.3), a maior parte
centenas ou at milhares por genoma, dependendo da do espao disponvel em um genoma procaritico ocu-
famlia. As unidades de repetio de uma determinada pada pelos genes. Aqui, sero tratados os aspectos mais
famlia podem estar distribudas de maneira aparente- amplos, ligados s caractersticas do repertrio de genes
mente aleatria no genoma ou em arranjos em tan- encontrado em genomas procariticos.
dem (agrupadas lado a lado). Unidades de repetio Em um genoma de qualquer espcie, h um reper-
agrupadas tambm podem estar arranjadas em uma trio de genes que deve suprir todos os produtos g-
mesma orientao ou apresentarem orientaes inverti- nicos (RNAs e protenas) necessrios sobrevivncia do
das (convergentes ou divergentes), umas em relao s organismo no(s) hbitat(s) por ele ocupado(s). Entretan-
outras. Em E. coli K-12, por exemplo, pelo menos sete to, para espcies procariticas, alm de os hbitats serem
famlias de sequncias repetidas esto representadas no altamente variveis (em condies como disponibilidade
genoma, sendo o nmero e a distribuio dos elementos de nutrientes, temperatura, salinidade, pH, etc.), o im-
repetidos variveis de acordo com a famlia. As sequn- pacto das condies ambientais mais direto sobre o or-
cias repetidas mais longas tm de 5,7 a 9,6 kb e perten- ganismo, por ele ser unicelular e desprovido de compar-
cem famlia Rhs, que representa 0,8% do genoma. A timentalizao intracelular (ao contrrio de organismos e
famlia mais representada do ponto de vista do nmero clulas eucariticas). Assim, para sobrevivncia em am-
de unidades de repetio a dos elementos REP. Essas bientes variveis e relativamente hostis, foi fundamental
sequncias palindrmicas (idnticas quando lidas da que os organismos procariticos adquirissem, ao longo
esquerda para a direita ou da direita para a esquerda) tm da evoluo, variabilidade tambm em nvel de repertrio
aproximadamente 40 pb e esto presentes em 314 unida- gnico entre diferentes populaes ou linhagens de uma
des organizadas em 12 arranjos em tandem, representan- mesma espcie.
do 0,54% do genoma.
Hoje, a partir de estudos comparativos do repertrio
A presena de muitas das famlias de sequncias gnico entre linhagens de uma mesma espcie bacteria-
repetidas identificadas em genomas procariticos na, observa-se que entre 20 a 35% dos genes podem ser
explicada pela presena e atividade de elementos ge- linhagem-especficos, ou seja, esto no genoma de uma
nticos mveis (ver Captulo 9). Processos envolvendo linhagem, mas no nos genomas de outras linhagens
integrao e exciso de genomas de bacterifagos ou da mesma espcie. Isso dificulta uma distino clara do
elementos transponveis em genomas procariticos ge- ponto de vista gentico entre espcies muito relacionadas
ram sequncias repetidas, que podem se acumular ao ou linhagens muito divergentes de uma mesma espcie,
longo da evoluo. Alm disso, independentemente da o que levou proposio do conceito de pangenoma,
origem, algumas repeties de genomas procariticos que descreve o repertrio gnico total de uma determi-
podem estar associadas a funes importantes. Dentre nada espcie. O pangenoma incluiria um conjunto de ge-
elas, cabe salientar, alm das repeties de stios Chi nes compartilhado por todos os isolados, populaes ou
e de motivos KOPS, discutidas anteriormente (Seo linhagens da espcie (chamado de genoma central) e um
2.4.1), as repeties CRISPR (de clustered regular- conjunto de genes presentes em algumas, mas no todas
ly interspaced short palindromic repeats, repeties as linhagens da espcie (chamado de genoma dispens-
palindrmicas curtas agrupadas e regularmente espa- vel) (Figura 4.6). Em teoria, o genoma central corres-
adas). As CRIS-PRs so componentes de um sistema ponde ao repertrio de genes indispensveis para a so-
de defesa antiviral (contra bacterifagos), e j foram brevivncia da espcie em qualquer ambiente, ao passo
identificadas em cerca de 40% dos genomas bacteria- que o genoma dispensvel corresponde ao repertrio de
nos e 90% dos genomas de arqueas analisados at o genes determinantes de caractersticas fenotpicas linha-
momento. Elas so constitudas por unidades de repeti-
gem-especficas, que podem ser adaptativas e necessrias
o palindrmicas, com extenso e organizao em ar-
sobrevivncia em algumas condies ambientais, mas
ranjos que variam de espcie para espcie. O tamanho
no em outras.
das unidades de repetio das CRISPRs varia de 24 a 47
pb e, nos arranjos, elas esto presentes em um nmero Exemplos de genes que fariam parte da frao dis-
de cpias que pode variar de 2 at 249 (identificado na pensvel do pangenoma de uma espcie bacteriana se-
bactria gram-negativa Verminephrobacter eisenial). riam os que conferem resistncia a agentes antimicrobia-
O tamanho das sequncias espaadoras entre as repe- nos e os que determinam sobrevivncia e multiplicao
ties dentro de um mesmo arranjo de CRISPR varia em uma determinada espcie hospedeira. No primeiro
de 26 a 72 pb, conforme a espcie. Muitos genomas, caso, alguns genes do repertrio dispensvel codificam
principalmente os de bactrias, contm apenas um ou produtos que s seriam necessrios sobrevivncia da
poucos arranjos (ou lcus) CRISPR, mas em genomas espcie em condies de exposio a um agente antimi-
de arqueas, vrios lcus CRISPR podem estar presentes crobiano especfico e que, portanto, seriam dispensveis
(at um nmero mximo de 18, identificados na arquea para linhagens que vivem em condies normais, livres
M. jannaschii), chegando a representar at 1% das se- da exposio a compostos bactericidas ou bacteriostti-
quncias do genoma. cos. No segundo caso, alguns genes do repertrio dis-

Zaha_5ed_04.indd 67 27/11/13 09:21


Biologia Molecular Bsica 68

Pangenoma

Genoma central
(65 a 80% dos genes)

Genoma dispensvel
Genoma
dispensvel Genes exclusivos
(20 a 35% da linhagem 1
dos genes)
Genes comuns
Genes comuns s linhagens 1 e 2
s linhagens 1 e 3

Genes exclusivos Genes exclusivos


da linhagem 3 da linhagem 2

Genes comuns
s linhagens 2 e 3

Figura 4.6
Diagrama representativo do conceito de pangenoma procaritico. No diagrama, consi-
derada a situao hipottica de uma espcie procaritica para a qual foram identificadas trs linha-
gens. Do total de genes identificados nos genomas sequenciados das trs linhagens, a maior frao
(que pode ser de 65 a 80% deles) comum a todas elas e constitui a frao do pangenoma chamada
de genoma central. Os genes restantes (que podem ser de 20 a 35% do total) esto presentes em uma
ou duas linhagens, porm ausentes na(s) linhagem(s) restante(s), constituindo a frao do pangeno-
ma chamada de genoma dispensvel.

pensvel fazem com que uma ou mais linhagens sejam por parte da clula. Um bom exemplo disso so os genes
capazes de colonizar uma determinada espcie hospe- codificadores de rRNAs, cujo nmero pode chegar a 15
deira, causando (se a bactria for parasita/patognica) em bactrias e 4 em arqueas (Figura 4.7). Assume-se
ou no (se a bactria for comensal ou simbitica) um que a existncia de mltiplas cpias, associada a elevados
quadro patolgico no hospedeiro. Linhagens sem os ge- nveis de transcrio, uma estratgia para o suprimento
nes responsveis pela capacidade de colonizao seriam da grande demanda de molculas de rRNA para a monta-
incapazes de colonizar a espcie hospedeira, mas man- gem dos ribossomos.
teriam (com os genes do genoma central e outros genes
do genoma dispensvel) a capacidade de sobreviver inde- No repertrio gnico de genomas procariticos
pendentemente de um hospedeiro (em vida livre) ou em tambm significativo o nmero de genes parlogos e
outra(s) espcie(s) de hospedeiro. Os mecanismos evolu- ortlogos, definidos na Seo 1.3. Em qualquer genoma
tivos determinantes da variabilidade de repertrio gnico bacteriano ou de arqueas pode ser identificado um n-
intraespecfico em procariotos e, portanto, da formao mero considervel de famlias de genes parlogos,
de repertrios gnicos pangenmicos em espcies de bac- que podem chegar a mais de 200 dependendo da espcie,
trias e arqueas sero discutidos na Seo 3. com cada famlia podendo conter desde dois at algu-
mas dezenas de membros. A presena de muitas famlias
Uma caracterstica tpica do repertrio gnico de de genes parlogos em bactrias e arqueas, embora no
genomas procariticos a de que a maioria dos genes constitua redundncia uma vez que os genes parlogos
est presente em apenas uma cpia. Esse baixo grau de codificam produtos relacionados, mas funcionalmente
redundncia gnica ocorre apesar da frequncia re- distintos , considerada uma evidncia de que a dupli-
lativamente elevada de eventos de duplicao gnica em cao gnica seguida de divergncia foi um mecanismo
genomas procariticos, o que sugere que as duplicaes evolutivo importante para o aumento do repertrio gni-
produzidas so, em sua maioria, eliminadas (ver Seo
co em procariotos (ver Seo 3).
3). Os raros casos de redundncia gnica observados em
genomas de bactrias ou arqueas so, com frequncia, Quando a busca de homologia entre sequncias gni-
explicveis pelo fato de que o maior nmero de cpias cas feita pela comparao entre genomas de diferentes
dos genes envolvidos viabiliza o atendimento de uma espcies, tambm marcante, em procariotos, a ocor-
demanda elevada dos produtos gnicos correspondentes rncia de grupos de genes ortlogos. Para a maioria

Zaha_5ed_04.indd 68 27/11/13 09:21


69 Genes e Genomas Procariticos
110
Figura 4.7
100
Nmero de cpias de genes
90 de rRNA de 16S em espcies
de bactrias e de arqueas. Os
80 dados representados no grfico
Nmero de espcies

correspondem a uma anlise de


70 476 espcies de bactrias (em ) e
60 63 espcies de arqueas (em ). A
anlise tem como base apenas ge-
50 nes de rRNA de 16S, mas pode ser
extrapolada para os demais genes
40 de rRNA (23S e 5S), assumindo-se
a sua organizao em um nico
30
peron, comum maioria das es-
20 pcies procariticas.

10

0
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 1 2 3 4

Nmero de genes de rRNA de 16S

dos genes do genoma de qualquer espcie de bactria ou regio codificadora). A cotranscrio de mais de uma re-
arquea, h ortlogos identificveis em outras espcies gio codificadora, a partir de um mesmo conjunto de se-
procariticas, mesmo quando as comparaes so fei- quncias reguladoras, representa uma otimizao da ma-
tas entre espcies pouco aparentadas, como em casos de quinaria reguladora da clula, que assegura a expresso
comparao de uma bactria com uma arquea. O nmero coordenada (ao mesmo tempo e nos mesmos nveis) dos
de genes ortlogos identificveis na comparao de dife- produtos gnicos de cada peron. Alm disso, a organiza-
rentes espcies e o grau de similaridade (homologia) en- o em perons proporciona uma economia de espao no
tre eles so, em geral, diretamente proporcionais ao grau DNA, o que relevante para os genomas relativamente
de parentesco evolutivo das espcies comparadas. Entre- pequenos e compactos de procariotos. O nmero de re-
tanto, desvios no resultado desse tipo de anlise podem gies codificadoras presentes varia de peron para pe-
advir da presena frequente de genes xenlogos, adquiri- ron, assim como tambm varivel o nmero de pares
dos de forma independente, por transferncia horizontal de bases que separa uma regio codificadora da seguinte.
de espcies mais ou menos aparentadas do que as que A extenso das sequncias entre as regies codificadoras
esto sendo comparadas. adjacentes de um peron, chamadas de regies inter-
cistrnicas, varia tipicamente de um a poucas dezenas
2.4.4 perons de pares de bases. Em casos extremos, pode ocorrer a so-
Um peron uma unidade funcional do genoma, na breposio de duas regies codificadoras, sendo a indivi-
qual duas ou mais regies codificadoras de um produto dualizao de seus produtos de expresso definida graas
gnico (de RNA ou proteico) ocupam posies adjacen- ao controle independente para cada uma delas da etapa
tes, esto coorientadas e tm a sua transcrio controla- de traduo (discutida no Captulo 12).
da por um mesmo conjunto de sequncias reguladoras A presena de perons tpica de genomas procari-
(Figura 4.8). Muitas vezes, por simplificao, as dife- ticos, e o nmero de perons em um genoma pode ser es-
rentes regies codificadoras presentes em um peron so timado por anlise in silico (ver Captulo 17), a partir da
referidas como genes estruturais ou apenas genes, e identificao de sequncias codificadoras coorientadas e
comum que os diferentes genes de um peron codi- muito prximas umas das outras. Pode-se assumir que
fiquem produtos funcionalmente relacionados em algum a maioria dos perons preditos in silico (tambm cha-
grau (p. ex., em perons que codificam diferentes tipos de mados de directons) corresponde realmente a regies
rRNA ou em perons que codificam diferentes enzimas
codificadoras organizadas, quanto a sua funcionalidade,
que participam de uma mesma via metablica).
em unidades transcricionais policistrnicas (o que tam-
As diferentes regies codificadoras presentes em bm pode ser confirmado experimentalmente). O n-
um peron so cotranscritas em um nico produto de mero de sequncias codificadoras organizadas em pe-
RNA, que por isso chamado de policistrnico. A no- rons em um genoma varia de espcie para espcie, sem
menclatura de policistrnico derivada de cstron, um qualquer correlao evidente com grupos taxonmicos
conceito gentico clssico equivalente a um gene (ou uma (Figura 4.9). O que se pode afirmar que a organizao

Zaha_5ed_04.indd 69 27/11/13 09:21


Biologia Molecular Bsica 70

Regies
intercistrnicas

A B C peron

Regio reguladora Regies codificadoras Regio reguladora


do incio da transcrio do trmino da transcrio
Transcrio

A B C mRNA
policistrnico
Traduo Traduo Traduo

Protena A Protena B Protena C

Figura 4.8
Representao esquemtica da estrutura tpica de um peron. O peron ilustrado contm trs
sequncias codificadoras de protenas (A, B e C), separadas por regies intercistrnicas curtas, cujas ex-
tenses variam entre 1 e poucas dezenas de pares de bases em perons tpicos. As trs regies codificado-
ras tm sua transcrio controlada por regies reguladoras comuns, as quais determinam a produo de
um mRNA nico, que por isso chamado de policistrnico. As trs protenas codificadas (A, B e C) pelo
mRNA policistrnico so depois sintetizadas de forma independente nos ribossomos.

em perons prevalente tanto em genomas de bactrias As primeiras evidncias da existncia de domnios


como de arqueas e que a frao de sequncias codifica- topolgicos vieram de imagens de microscopia eletr-
doras em perons maior do que a daquelas transcritas nica de cromossomos bacterianos isolados, nas quais
individualmente. Com base nas estimativas disponveis, puderam ser visualizadas alas de DNA superenrolado,
representam os extremos da distribuio os genomas da delimitadas por interaes com protenas cromatni-
arquea A. pernix e da bactria T. maritima, com 54 e cas. Dados experimentais recentes sugerem que, em
90%, respectivamente, de suas sequncias codificadoras cromossomos bacterianos, um domnio teria aproxi-
organizadas em perons. Para E. coli K-12, so preditos madamente 10 kb de extenso, o que determinaria, por
em torno de 700 perons, com um nmero mdio de 3 a exemplo, a existncia de mais de 400 domnios no cro-
4 sequncias codificadoras por peron, o que correspon- mossomo de E. coli. Entretanto, o nmero e os limites
de a mais de 50% do total estimado de genes no genoma de cada domnio poderiam variar, dentro de limites no
dessa bactria. muito amplos, em diferentes momentos e em diferen-
tes clulas. Essa dinmica determinaria a ocorrncia
2.4.5 Domnios e macrodomnios eventual de domnios de at 30 kb ou mais (j expe-
rimentalmente detectados), dependendo de interaes
Os domnios topolgicos, ou simplesmente dom-
transitrias com protenas estruturais que atuariam
nios, de cromossomos procariticos so regies consi-
como barreiras livre difuso de superenrolamento ao
deradas extensas, definidas, do ponto de vista estrutural,
longo do DNA.
por interaes com protenas cromatnicas (ver Captulo
3) e por padres de superenrolamento do DNA (ver Ca- Em uma escala hierarquicamente superior de dom-
ptulo 2). Aqui, o mais importante a salientar que, em nios estruturais e funcionais foram definidos os chama-
cromossomos bacterianos, esses domnios topolgicos dos macrodomnios, que so superestruturas (con-
tm correlao com a distribuio de pelo menos alguns juntos) de domnios topolgicos que podem abranger
grupos de genes, os quais, em funo disso, podem ter boa parte de um cromossomo bacteriano. As barreiras
padres transcricionais at certo ponto coordenados. Em estruturais (na forma de protenas e estruturas de su-
arqueas, pelo menos at agora, correlaes estruturais e perenrolamento de DNA) entre macrodomnios seriam
funcionais como essas no so to evidentes, pois a es- mais fortes do que aquelas que delimitam os domnios.
trutura da cromatina de arqueas mais relacionada a da No cromossomo de E. coli, por exemplo, foram identifi-
cromatina eucaritica (ver Captulo 3). cados quatro macrodomnios, alm de duas regies me-

Zaha_5ed_04.indd 70 27/11/13 09:21


71 Genes e Genomas Procariticos
4.500
Figura 4.9
Nmero de sequncias codificadoras

4.000 Estimativa do nmero de


sequncias codificadoras
3.500
organizadas em perons
3.000 em genomas de algumas
espcies de bactrias e ar-
2.500 queas. Os nomes das espcies
de arqueas esto em e os
2.000 das bacterianas, em . Cada
barra representa o nmero
1.500 total de sequncias codifica-
1.000 doras identificadas no geno-
ma de uma espcie, estando
500 representada em a frao
das sequncias codificadoras
0 organizadas em perons e,
P. hic hii
au . ja lgi ix
t r o as s

em , a frao de sequncias

en cul e
ra ho iae

ur is
lic . i E ns

a gen pyl e

N ube on m

Th Syn R. p ing osis

U Tre ot oc az is

a pa i t i m .
ur ll a
lyt um
um
fu us
bu aeo sus

C am ce B. dor s

hl d a ty lis
yd pn ter um

ap on a ti ii
C my ylob bu bti i

D. rac on ni

la M cte enz li

M ne ita ori
t o nn du

o u r

sm a ar p
rm M fu rn

a u o

. m r ia

re p og ys ek
e u

sm . r a
hl p t s fe
p c

od at

m h w d
t m u

. t um liu

la em m s s
ob fl . c
a
rg lic
A. p e

er ec ro iti
ia eu jej
am ia c lic

ea id
ic
B. . rio

di m

codificadoras individuais. A
m
ru

predio de organizao em
n
A
py

p
H H

perons tem como base anli-


ro

C .a
Ae

e
he

ses in silico.
C

op
.t

a
M

yc
M

nos estruturadas (sem caractersticas de macrodomnios) dos junto regio de trmino da replicao, cuja transcri-
(Figura 4.10). o estimulada pelo relaxamento do superenrolamento
do DNA.
Os macrodomnios foram identificados em E. coli a
partir da deteco, ao longo do cromossomo, de grandes
regies (de at centenas de milhares de pares de bases)
2.4.6 Ilhas genmicas
que so, pelo menos at certo ponto, compartimentali- As ilhas genmicas, ou simplesmente ilhas, so seg-
zadas funcionalmente. Por exemplo, a probabilidade de mentos de genomas procariticos que diferem em algu-
ocorrncia de eventos de recombinao maior entre mas caractersticas do restante do genoma, como em con-
dois stios que esto a uma determinada distncia um do tedo de GC e padres de sintenia e orientao gnicas
outro, mas que esto em um mesmo macrodomnio, do (discutidos nas Sees 2.5 e 2.6). Essas ilhas podem estar
que entre dois stios com distncia similar entre eles, mas presentes ou no em diferentes isolados ou linhagens de
situados em macrodomnios diferentes. Alm disso, h uma mesma espcie ou em diferentes espcies relaciona-
semelhanas evidentes entre as atividades (expresso) de das (de um mesmo gnero, p. ex.). A estrutura e a compo-
genes dentro de um mesmo macrodomnio, cujo padro sio gnica das ilhas podem ser bem variveis, mas em
difere daquele de outros domnios. geral elas esto associadas em algum grau a elementos
genticos mveis, como bacterifagos e elementos conju-
Do ponto de vista da distribuio dos genes em um
gativos ou transponveis (ver Captulo 9), e a eventos de
cromossomo bacteriano, cada domnio ou macrodomnio
transferncia gnica horizontal.
definiria uma regio, na qual um grupo de genes teria a
sua expresso restringida (ou no) por uma determinada Do ponto de vista estrutural, algumas generalizaes
situao topolgica (grau de superenrolamento do DNA, podem ser feitas em relao s ilhas genmicas. Elas so
p. ex.), que seria diferente da encontrada em outros do- relativamente extensas, podendo variar de 10 at mais de
mnios ou macrodomnios em razo da atuao diferen- 200 kb. Regies menores que 10 kb com outras caracters-
cial de diversas topoisomerases (discutidas no Captulo ticas de ilhas genmicas so chamadas de ilhotas por al-
2). Assim, genes distribudos em um determinado do- guns autores. No que diz respeito composio nucleot-
mnio devem ter sua transcrio adequada s condies dica, em geral o contedo de GC e outros parmetros (ver
estruturais do domnio/macrodomnio topolgico onde Sees 2.5 e 2.6.2) das ilhas so diferentes do restante do
esto posicionados. Por exemplo, no cromossomo de E. genoma. O local de insero de uma ilha em um genoma
coli, evidente que a distribuio dos genes em relao pode ser varivel, mas comum a insero em genes de
organizao do cromossomo em domnios e macrodom- tRNA, o que associado a uma origem ligada mobilida-
nios no aleatria. H uma concentrao importante de de de elementos conjugativos integrativos (discutidos no
genes cuja transcrio reprimida pelo relaxamento do Captulo 9). A associao das ilhas a elementos genticos
superenrolamento prximo origem de replicao. Em mveis tambm evidenciada pela frequente presena de
contrapartida, h um grande grupo de genes posiciona- sequncias flanqueadoras repetidas diretas, de 16 a 20 pb,

Zaha_5ed_04.indd 71 27/11/13 09:21


Biologia Molecular Bsica 72

Figura 4.10
migS
Representao esquemtica dos macrodomnios do NEdireita
cromossomo de E. coli. Os macrodomnios Ori, Ter, direito Ori
oriC
e esquerdo esto identificados por barras em diferentes cores
(em , , e , respectivamente). As linhas tracejadas inter-
rompidas indicam as regies no estruturadas em macrodom-
nios esquerda (NEesquerda) e direita (NEdireita). Para referncia, as Direito
posies dos lcus oriC, migS e dif esto indicadas. O macrodo-
mnio Ori contm a origem de replicao (oriC) e est centrado E. coli K-12
no lcus migS, uma sequncia anloga a um centrmero que est (~4,6 Mb)
envolvida no posicionamento bipolar (segregao) da oriC logo NEesquerda
depois dela ter sido replicada. O macrodomnio Ter, que inclui
a regio de encontro das forquilhas de replicao, est centrado
em dif, um lcus de recombinao stio-especfica que permite a
Ter
resoluo em monmeros dos dmeros de cromossomos resultan- dif
tes da replicao. Ver Captulo 6 para mais informaes sobre o
processo de replicao do cromossomo de E. coli. Esquerdo

que geralmente resultam de eventos de integrao stio- na ilha cag o antgeno CagA (produto do gene cagA,
-especfica (nesse caso, da ilha no seu stio-alvo). Tais s- situado prximo da extremidade direita, ou 3', da ilha).
tios podem funcionar como stios-alvo de enzimas capazes CagA uma protena secretada, e sua translocao para
de levar exciso da ilha do genoma e, muitas vezes, as clulas da mucosa gstrica leva a alteraes morfogen-
prprias enzimas envolvidas em processos de exciso ou ticas importantes na clula hospedeira, as quais podem
integrao, como as integrases (Captulo 8), podem ser resultar na transformao maligna. A maioria dos pro-
codificadas por genes presentes nas prprias ilhas. dutos dos outros genes cag est envolvida com o sistema
Quanto composio gnica, as ilhas contm genes de secreo e translocao da CagA para o citoplasma de
considerados no essenciais, mas que, em determinadas clulas do epitlio gstrico. Algumas protenas codifica-
condies, podem conferir alguma vantagem adaptativa das pela ilha, ainda, induzem clulas dos hospedeiros a
clula. Um exemplo comum o das chamadas ilhas produzirem citocinas (protenas de sinalizao com fun-
de patogenicidade, que ocorrem em muitas espcies o imunomoduladora), que alteram a resposta imune do
bacterianas patognicas, como H. pylori, S. enterica ou hospedeiro de modo favorvel ao patgeno.
V. cholerae. Ilhas de patogenicidade contm genes cujos Alm dos genes codificadores de fatores de viruln-
produtos conferem clula capacidade de infectar e cau- cia, a ilha cag tambm apresenta outras caractersticas
sar doena em alguma espcie hospedeira, por exemplo, tpicas de ilhas genmicas. Ela flanqueada por uma re-
genes que codificam toxinas, protenas imunomodulado- petio direta de 31 pb e contm, a jusante do gene cagA,
ras ou protenas que medeiam a adeso a determinados duas sequncias de insero (IS, de insertion sequences)
tipos de clulas. A capacidade codificadora das ilhas no pertencentes a uma famlia de elementos transponveis
fica limitada, contudo, a determinantes de patogenicida- (IS605) comum no genoma de H. pylori. As repeties
de (ou virulncia) e pode ser bastante diversa. Podem ser diretas e as IS esto associadas a eventos de recombina-
citadas, dentre outras, ilhas genmicas com genes asso- o e mobilidade gentica da ilha cag.
ciados ao metabolismo de compostos incomuns, como
compostos aromticos; sntese de siderforos; resis-
tncia a metais pesados; resistncia a agentes antimi- 2.5 Contedo de G+C
crobianos e adaptao a um modo de vida simbitico. O contedo mdio de G+C (ou, simplesmente, o con-
Para exemplificar o conceito de ilha genmica ser tedo de GC) de um genoma a frao (porcentagem)
analisada uma ilha de patogenicidade da bactria gram- de nucleotdeos de guanina e citosina que ele apresenta,
-negativa H. pylori, que coloniza o estmago de seres hu- que complementar frao de nucleotdeos de adenina
manos e pode causar diversas doenas gstricas, desde e timina. O contedo de GC (GC%) pode ento ser calcu-
gastrites crnicas at lceras ppticas e linfomas de te- lado pela frmula:
cido linfoide associado mucosa gstrica. O genoma de
GC(%) (G+C/A+T+G+C) x 100
linhagens virulentas de H. pylori apresenta uma ilha de
patogenicidade chamada de cag, que consiste em uma re- Onde G, A, T e C representam a quantidade de nu-
gio cromossmica de aproximadamente 37 kb contendo cleotdeos de guanina, adenina, timina e citosina, respec-
31 genes (Figura 4.11). A principal protena codificada tivamente, no genoma.

Zaha_5ed_04.indd 72 27/11/13 09:21


73 Genes e Genomas Procariticos
Sistema de secreo e translocao da CagA

Q
Z Y X W V U T S R PO M N L I H G F E D CB A

IS605

1 kb
Protena CagA

Ilha cag

H. pylori 26695 (~1,67 Mb)

Figura 4.11
Ilha de patogenicidade cag de H. pylori. A configurao da ilha cag no cromossomo da linhagem 26695 de H.
pylori est representada. Os genes codificadores de protenas e suas respectivas orientaes esto representados por
setas em , ou , e a letra (grega ou romana) que designa cada um deles est representada abaixo de cada seta. O
gene cagA (em ) codifica a protena secretada CagA. A maioria dos demais genes (nomes assinalados por retngulos
em ) codifica protenas essenciais para a secreo e a translocao de CagA para clulas do hospedeiro, sendo que
as protenas codificadas pelos genes cag, cag, cagY, cagX, cagV, cagE e cagC so ortlogas de protenas do sistema de
secreo do tipo IV do patgeno de plantas A. tumefaciens. Dezesseis genes da ilha (setas em ) codificam produtos
que levam clulas da mucosa gstrica a produzirem interleucina 8 (IL-8, uma citocina), o que modula a resposta imu-
ne do hospedeiro de modo favorvel bactria. As pontas de seta menores (em , em cada uma das extremidades
da ilha) representam as duas cpias da repetio direta de 31 pb e as pontas de seta maiores (em ) representam as
duas cpias da IS605; as pontas de seta tambm indicam as orientaes de cada um desses elementos de sequncia.

O contedo de GC varia de espcie para espcie e, em vida livre tendem a ter genomas maiores e mais ricos em
procariotos, essa variao ampla, indo de 22,5%, no ge- GC. O contedo de GC mdio para genomas de espcies
noma da Wigglesworthia glossinidia (proteobactria en- dependentes de hospedeiro seria de cerca de 38%, e o
dossimbionte da mosca ts-ts), at 72,1%, no genoma de contedo de GC mdio para genomas de espcies de vida
S. coelicolor A3(2) (uma actinobactria de solo). Embora livre, de 49%.
os exemplos extremos at agora conhecidos sejam de bac-
No h ainda explicaes definitivas para as cor-
trias, os genomas de arqueas tambm variam bastante
relaes existentes entre o contedo de GC, o tamanho
em termos de contedo de GC, com distribuio entre ex-
dos genomas e o estilo de vida das espcies. Dentre as
tremos de pouco mais de 30% at pouco menos de 70%.
explicaes possveis est o fato de nucleotdeos de G e
Os exemplos extremos mencionados ilustram tam- C serem energeticamente mais custosos para a clula e,
bm um outro fato interessante: h certa correlao entre por isso, a presena deles seria mais limitada em esp-
o tamanho do genoma e o contedo de GC, com genomas cies com metabolismo mais deficiente, como parasitas e
menores (como o genoma de W. glossinidia, com 0,69 simbiontes. Outra explicao residiria no fato da maio-
Mb) tendendo a ser menos ricos em GC (ou mais ricos ria das espcies parasitas e simbiontes (e com genomas
em AT) do que genomas maiores (como o de S. coelicolor, reduzidos) ser deficiente em pelo menos alguns genes
com 8,7 Mb). responsveis pela reparao de mutaes (que assunto
do Captulo 7). Assim, como as mutaes pontuais mais
Comparaes do contedo de GC entre genomas
frequentes so as de C para T ou de G para A, haveria
de espcies de diferentes filos bacterianos tambm su-
uma tendncia de acmulo de AT em relao a GC nos
gerem algumas tendncias, como a de genomas de ac-
genomas dessas espcies.
tinobactrias serem mais ricos em GC do que genomas
de firmicutes, por exemplo. Entretanto, as tendncias ou Cabe ainda salientar que o contedo de GC discuti-
correlaes mais marcantes com o contedo de GC pa- do representa uma mdia da composio nucleotdica
recem no estar associadas a grupos taxonmicos espe- de um genoma. Porm, nenhum genoma tem um con-
cficos, mas sim ao estilo de vida das espcies. Espcies tedo de GC homogneo ao longo de toda a sua exten-
parasitas ou simbiticas, que tambm tendem a ter ge- so. Por exemplo, em qualquer genoma procaritico,
nomas menores (ver Seo 2.1), possuem genomas mais sequncias de origens de replicao e promotoras da
ricos em AT (e pobres em GC), ao passo que espcies de transcrio tendem a ser mais ricas em AT e, mesmo

Zaha_5ed_04.indd 73 27/11/13 09:21


Biologia Molecular Bsica 74

em genomas pequenos de espcies parasitas ou sim- rianos, mas tambm observada em genomas de arque-
biontes, a tendncia a um maior contedo de AT as, principalmente naqueles com uma nica origem de
maior em regies inter-gnicas do que nas regies co- replicao.
dificadoras dos genes. Isso ocorre porque, dependendo
A explicao para a coorientao dos genes e da re-
das funes que cada tipo de regio exerce, diferentes
plicao reside no fato desta organizao evitar ou mi-
presses seletivas atuam sobre elas (ver Seo 3), de-
nimizar o efeito negativo de colises entre a maquinaria
terminando tambm diferenas nos respectivos con-
proteica de replicao (DNA-polimerase e protenas a ela
tedos de GC.
associadas) e RNA-polimerases que esto transcrevendo
genes. Colises entre a maquinaria de replicao e a RNA-
2.6 Distribuio dos genes e de outras -polimerase em situaes nas quais elas se movimentam
sequncias em genomas procariticos em direes opostas podem levar interrupo de even-
tos de transcrio, bem como levariam a um significativo
Os genes (e tambm outras sequncias) de procariotos atraso da replicao se fossem muito frequentes. Em con-
so, at certo ponto, independentes do ponto de vista trapartida, quando o sentido de deslocamento das RNA-
funcional, pois cada gene (ou pequeno grupo de genes, no -polimerases em transcrio o mesmo da maquinaria de
caso de perons ver Sees 1.1 e 2.4.4) autnomo na replicao para a maioria dos genes, as eventuais colises
regulao de sua expresso. Apesar disso, quando ana- (em razo da movimentao mais rpida da DNA-poli-
lisado o posicionamento relativo dos genes e de outras merase) no so abortivas para eventos transcricionais, e
sequncias em genomas procariticos, so identificveis a replicao no atrasada.
padres de distribuio no aleatrios. Esses padres de
distribuio, que definem a arquitetura de cada geno- Inicialmente, foi considerado que isso s significa-
ma, foram estabelecidos e so mantidos ou modificados ria uma vantagem importante para genes com elevados
ao longo da evoluo em razo de diversos fatores, desde nveis de transcrio, como genes relacionados aos pro-
a mecnica molecular do processo de replicao do DNA cessos de sntese de cidos nucleicos ou de protenas,
(Captulo 6) at a frequncia de rearranjos cromoss- para os quais a coorientao entre transcrio e repli-
micos ou de transferncia gnica horizontal na histria cao foi evidenciada primeiro (ver Figura 4.12). Entre-
evolutiva de uma espcie (Seo 3). Aqui, sero descritos tanto, foi demonstrado que, pelo menos para espcies
alguns padres tpicos encontrados na arquitetura de ge- bacterianas dos filos Firmicutes e Proteobacteria, a
nomas procariticos e discutido as suas possveis impli- coorientao entre transcrio e replicao ocorre para
caes funcionais. a maioria dos genes e est mais correlacionada com a
essencialidade de cada gene do que com seu nvel de ex-
2.6.1 Orientao e localizao de genes presso. Por exemplo, em B. subtilis, em torno de 95%
dos genes essenciais (ou seja, aqueles indispensveis
em relao origem e ao sentido da
para a sobrevivncia em qualquer condio ambien-
replicao tal) esto coorientados com a replicao, bem como
Como discutido na Seo 2.2, a maioria dos genomas 75% dos demais genes, independentemente do nvel de
procariticos contm uma nica origem de replicao, transcrio de cada um.
a partir da qual o genoma replicado bidirecionalmente
Outro determinante de organizao gnica em ge-
(ver Captulo 6). Essa origem de replicao nica repre-
nomas procariticos associado replicao o nmero
senta o stio a partir do qual h uma troca entre aquela
de eventos de replicao que so iniciados a cada ciclo
que a fita-lder e a que a fita tardia em cada metade do
de diviso celular. E. coli, por exemplo, divide-se aproxi-
cromossomo, definindo a regio cromossmica que ser
madamente a cada 20 minutos em condies ideais, mas
replicada em primeiro lugar. Esses fatores parecem ter
um processo de replicao completo de seu cromossomo
sido, ao longo da evoluo, determinantes de padres de
dura at trs vezes mais. Por isso, mais de um proces-
distribuio e de orientao de genes em cromossomos
so de replicao deve ser iniciado a cada ciclo celular,
procariticos.
para que as clulas-filhas, ao herdarem cromossomos
Quanto orientao dos genes em relao origem parcialmente replicados, possam concluir um ciclo de
(ou ao sentido) de replicao, foi observada uma pre- replicao antes da prxima diviso celular. Logo, um
dominncia de genes na fita-lder (ou seja, genes cuja cromossomo herdado por uma clula-filha j pode estar
sequncia codificadora est na fita replicada continua- parcialmente duplicado uma ou mais vezes, o que de-
mente de cada metade do cromossomo). Esse padro, termina um efeito de dosagem gnica associado
denominado tendncia gnica de fita (de gene strand replicao. Nessas situaes, genes mais prximos
bias), implica dizer que muitos genes esto coorientados da origem de replicao apresentam um nmero de
em relao ao sentido da replicao, estando no sentido cpias mais elevado do que o nmero de cpias de ge-
horrio, quando situados na metade do cromossomo re- nes prximos regio de trmino da replicao, o que
plicado nesse mesmo sentido, e, no sentido anti-horrio, garante nveis de expresso aumentados aos primeiros
quando na outra metade do cromossomo (Figura 4.12). (Figura 4.13A). Apesar de eventual e varivel em in-
Essa tendncia de coorientao dos genes em relao ao tensidade dependendo das condies ambientais, o efei-
sentido da replicao mais evidente em genomas bacte- to de dosagem gnica associado replicao parece ter

Zaha_5ed_04.indd 74 27/11/13 09:21


75 Genes e Genomas Procariticos
rrnB
Figura 4.12
rrnH
rrnE Orientao de alguns genes no cromossomo
rrnA de E. coli, mostrando a tendncia de coorien-
rrnC tao com o sentido da replicao. Cada seta em
corresponde a um gene e indica a direo da sua
oriC transcrio; apenas genes transcritos em nveis ele-
vados esto representados. As setas do lado externo
do crculo correspondem a genes que fazem parte da
maquinaria de sntese proteica, incluindo aqueles or-
ganizados nos sete perons responsveis pela sntese
de rRNA (rrnA, B, C, D, E, G e H); as setas no interior
do crculo correspondem a genes necessrios para a
sntese de DNA (replicao) ou RNA (transcrio).
rrnD
terC As posies da origem (oriC) e da regio de trmino
(terC) da replicao esto assinaladas, e as setas em
indicam o sentido da replicao em cada metade
do cromossomo.

rrnG

sido um fator evolutivo importante para a distribuio de transio, um de valores de GCdesvio positivos para ne-
de alguns genes ao longo do cromossomo, pelo menos gativos e outro de valores de GCdesvio negativos para posi-
em genomas de espcies procariticas que se multipli- tivos. Esses pontos de transio correspondem aos stios
cam com rapidez. Os genes para os quais a localizao de trmino e origem da replicao, pois mostram quando
preferencial em regies prximas origem mais evi- a fita analisada passa de uma composio um pouco mais
dente so os relacionados transcrio (como os que co- rica em nucleotdeos de G (tpica da metade do cromos-
dificam subunidades da RNA-polimerase) ou traduo somo na qual ela foi replicada continuamente) para uma
(como genes de rRNA ou protenas ribossmicas), o que composio um pouco mais rica em nucleotdeos de C (t-
pode ser observado na arquitetura do genoma de E. coli pica da metade do cromossomo na qual ela foi replicada
(Figura 4.13B). descontinuamente).
Os desvios de GC em genomas procariticos pare-
2.6.2 Desvios de GC cem ser consequncia de mltiplos fatores. Eles podem
Na maioria dos genomas procariticos, h uma assimetria ser explicados, pelo menos em parte, pela ao diferen-
marcante entre as fitas-lder e tardia em cada metade do cial de foras mutacionais sobre a fita-lder e sobre a
cromossomo, no que diz respeito composio nucleo- fita tardia, em razo de seus modos distintos de repli-
tdica. Essa assimetria, conhecida como desvio de GC, cao (contnuo para a fita-lder e descontnuo para a
decorre do fato da fita-lder ser mais rica em nucleotdeos fita tardia). O molde (uma fita-lder) da fita tardia, por
de guanina do que de citosina e a fita tardia ser mais rica ficar mais tempo exposto na forma de fita simples du-
em nucleotdeos de citosina do que de guanina. Em uma rante a replicao, seria mais vulnervel s mutaes
determinada fita (ou segmento de fita) de DNA, seja ela mais frequentes. Como as mutaes mais frequentes
replicada contnua (fita-lder) ou descontinuamente (fita (de modo especial em DNA de fita simples) so justa-
tardia), o desvio de GC (GCdesvio) pode ser calculado pela mente as desaminaes de citosinas que originam timi-
frmula: nas (CT), haveria ento uma tendncia de diminuio
da quantidade de nucleotdeos de citosina em relao
GCdesvio (G C)/(G +C) aos de guanina na fita-lder. Alm disso, haveria ainda
uma presso seletiva maior contra mutaes frequentes
Onde G e C representam a quantidade de nucleot-
(como CT) na fita-lder, j que ela contm as fitas co-
deos de guanina e citosina, respectivamente, na fita (ou
dificadoras da maioria dos genes essenciais (ver Seo
em qualquer segmento dela considerado).
2.6.1) e, por isso, haveria uma maior probabilidade de
O clculo do desvio de GC ao longo de toda uma das que eventuais mutaes nessa fita fossem deletrias, ao
fitas de um cromossomo circular procaritico pode ser contrrio da situao na fita tardia. Finalmente, outra
til, por exemplo, para identificar stios de incio e trmi- causa de desvios de GC seria a presena preferencial na
no da replicao (Figura 4.14). Na representao grfi- fita-lder de motivos repetidos e orientados, ricos em
ca dos resultados de uma anlise in silico como essa, fica nucleotdeos de guanina, como o caso dos stios Chi,
evidente um padro bifsico determinado por dois pontos discutidos na Seo 2.4.1.

Zaha_5ed_04.indd 75 27/11/13 09:21


Biologia Molecular Bsica 76

A B

oriC S6,S18,L9
rpoC S20 S2 rrnH
rpoB rrnE
rrnB
rrnA
rrnC
oriC
L28,L23 S1

S12
rpoA
rrnD terC
L,21,L27
S15
S21

L25
S16,L9
rrnG

Figura 4.13
O efeito de dosagem gnica associado replicao. (A) Representao esquemtica de um
cromossomo procaritico tpico no qual trs processos de replicao bidirecionais (indicados por setas
divergentes em ) foram iniciados durante um mesmo ciclo celular. Em situaes como essa, genes po-
sicionados mais prximos origem de replicao (oriC), representados em e , tendem a apresentar
transitoriamente um nmero maior de cpias do que genes localizados mais distantes dela, representa-
dos em outras cores. (B) Representao do cromossomo de E. coli K-12 mostrando a posio dos pe-
rons de genes de rRNA (em ) e de alguns dos genes que codificam protenas ribossmicas (em ) ou
subunidades da RNA-polimerase (em ). Pode-se observar uma maior tendncia de localizao desses
genes em posies mais prximas a oriC do que regio de trmino da replicao (terC). As setas em
indicam o sentido da replicao em cada metade do cromossomo.

2.6.3 Sintenia: conservao da ordem truncadas e de orientaes contrrias. Esse padro em


dos genes X resultante de uma inverso principal, centrada na
origem de replicao, do cromossomo de uma espcie
Em estudos genmicos, sintenia o termo que des- em relao ao cromossomo da outra. Inverses meno-
creve situaes de conservao da ordem de genes e res determinam as descontinuidades observadas nas
outras sequncias ortlogas entre dois ou mais geno- duas diagonais principais. Na comparao de genomas
mas. A anlise da sintenia exige, portanto, compara- de espcies mais divergentes entre si (Figura 4.15D), h
es entre genomas de diferentes espcies, ou entre uma perda quase total de sintenia, e os pontos corres-
diferentes linhagens de uma mesma espcie, e depende pondentes aos pares de sequncias ortlogas ficam es-
da identificao das sequncias ortlogas nos genomas palhados em toda a rea da matriz.
comparados. Uma das maneiras mais simples para de-
A acumulao de inverses ao longo do perodo
monstrar sintenia entre dois genomas o alinhamento evolutivo decorrido desde a separao das linhagens
das sequncias e a plotagem do resultado da compara- ou espcies comparadas de seu ancestral comum mais
o na forma de uma matriz de pontos (dot plot), que recente parece ser o determinante principal da perda
representa graficamente a posio de cada segmento progressiva de sintenia entre procariotos. Dentre as
de sequncia de um genoma versus a posio de seu inverses, aquelas simtricas, centradas na origem de
segmento ortlogo no outro genoma (Figura 4.15). replicao e abrangendo grande parte do cromossomo
Quando espcies ou linhagens prximas so assim (principais responsveis pelo padro em X das matri-
comparadas, a plotagem gera uma linha diagonal cont- zes de pontos), so bastante comuns. A predominncia
nua, o que indica uma situao de colinearidade (mes- dessas inverses, chamadas de recprocas, e de outras
ma ordenao) para a grande maioria das sequncias inverses menores sobre outros tipos de rearranjos cro-
(e, consequentemente, dos genes) nos dois genomas mossmicos, como translocaes, pode ter vrias expli-
(Figura 4.15A). Em alinhamentos de genomas de es- caes plausveis. As inverses poderiam, por exemplo,
pcies um pouco menos relacionadas (moderadamen- ter uma probabilidade natural maior de ocorrncia e/ou
te divergentes) (Figura 4.15B e C), o padro mais ob- ser mais facilmente fixadas no genoma de uma espcie
servado nas matrizes de pontos o de duas diagonais ao longo da evoluo. Um fator importante pode ser o

Zaha_5ed_04.indd 76 27/11/13 09:21


77 Genes e Genomas Procariticos
A oriC

Fita 1

Fita 2

terC

B
G>C

G=C

G<C

Figura 4.14
Anlise de desvios de GC para identificao dos stios de incio (oriC) e trmino (terC)
da replicao em um cromossomo procaritico tpico. (A) Representao esquemtica da
estrutura e da replicao do cromossomo de E. coli; como a anlise de desvios de GC feita para
cada fita de forma individual, apenas uma delas (arbitrariamente denominada Fita 1) ser conside-
rada aqui, sendo a outra fita (denominada Fita 2) mostrada em apenas para referncia. A metade
da Fita 1 representada em corresponde sua poro replicada continuamente (como indicado
pela seta em contnua) e, portanto, a uma regio de fita-lder; a outra metade, representada em
, corresponde poro da Fita 1 replicada descontinuamente (como indicado pelas setas conse-
cutivas em ) e, portanto, a uma regio de fita tardia. (B) Grfico resultante da anlise de desvios
de GC (GCdesvio) da Fita 1, com as regies de fita-lder e de fita tardia representadas por barras em
e , respectivamente. Na anlise in silico dos desvios de GC, segmentos de tamanho definido (em
geral de 1 kb ou 10 kb), sucessivos e parcialmente sobrepostos tm os respectivos valores de GCdesvio
calculados; depois, os valores calculados so plotados em um grfico em funo da posio de cada
segmento ao longo do cromossomo. Na anlise do grfico, observada uma clara transio de valo-
res de GCdesvio negativos (quantidade de G menor que a de C) para valores de GCdesvio positivos (quan-
tidade de G maior que a de C) na posio do genoma correspondente transio da metade da fita
replicada descontinuamente para a metade da fita replicada continuamente, o que indica a posio
da oriC. Uma segunda transio, de valores de GCdesvio positivos para valores de GCdesvio negativos,
observada na transio da metade da fita replicada continuamente para a metade da fita replicada
descontinuamente, o que indica a posio de terC.

fato de as inverses recprocas no alterarem as exten- conservao de sintenia ainda so observados entre ge-
ses de cada metade do cromossomo circular, nem a dis- nomas predominantemente no sintnicos, em geral eles
tncia ou a orientao dos genes em relao origem de correspondem a perons (Seo 2.4.4). Entretanto, mes-
replicao. Assim, essas inverses no causariam qual- mo os perons apresentam uma considervel plasticida-
quer desequilbrio na dinmica da replicao bidirecio- de organizacional ao longo da evoluo, manifestada na
nal, na preferncia gnica de fita, ou na dosagem gnica forma de quebras de perons maiores (com mais genes)
associada replicao. em perons menores (com menos genes) e de fuses de
perons menores para a formao de perons maiores, o
2.6.4 Superperons e ultraperons que determina limitaes adicionais sintenia entre ge-
Como discutido na Seo 2.6.3, a sintenia gnica observa- nomas. Por exemplo, excluindo-se casos de espcies mui-
da na anlise comparativa de genomas tende a diminuir to aparentadas, apenas 5 a 25% dos genes de bactrias
de forma proporcional ao grau de divergncia evolutiva e arqueas esto organizados em perons compartilhados
entre as espcies. Quando alguns casos localizados de por dois ou mais genomas.

Zaha_5ed_04.indd 77 27/11/13 09:21


Biologia Molecular Bsica 78

A B

3,50

4,97
Geobacillus kaustophilus HTA426 (3,54 Mb)

Shewanella oneidensis MR-1 (4,97 Mb)


2,62

3,82
1,75

2,55
0,87

1,27
0
0

0 0,87 1,75 2,62 3,50 0 1,17 2,35 3,52 4,70

Geobacillus thermodenitrificans NG80-2 (3,55 Mb) Shewanella sp. MR-4 (4,70 Mb)

C D

2,00
1,76

Streptococcus pneumoniae R6 (2,03 Mb)


1,50
1,32
P. abyssi GE5 (1,76 Mb)

1,00
0,88

0,50
0,44

0
0

0 0,43 0,87 1,30 1,73 0 0,50 1,00 1,50 2,00

Pyrococcus horikoshii OT3 (1,74 Mb) Streptococcus gordonii Challis CH1 (2,19 Mb)

Figura 4.15
Matrizes de pontos para alinhamento e identificao de sintenia entre
genomas de espcies com diferentes graus de parentesco evolutivo.
Em todas as matrizes, as posies ao longo de cada genoma comparado esto
indicadas (escala em Mb) no eixo das abscissas (primeira espcie) e no eixo das
ordenadas (segunda espcie); cada ponto em uma matriz indica um pareamento
entre sequncias homlogas das duas espcies comparadas. (A) Na comparao
do genoma de duas espcies proximamente relacionadas (no caso, as bactrias
G. thermodenitrificans NG80-2 e G. kaustophilus HTA426), um elevado grau de
coincidncia na ordenao dos genes ortlogos (sintenia) evidenciado por uma
linha diagonal praticamente sem interrupes. (B) Na comparao dos genomas
de duas espcies moderadamente divergentes (no caso, as bactrias Shewanella sp.
MR-4 e S. oneidensis MR-1), o padro em X evidencia a ocorrncia de uma inverso
centrada na origem de replicao e envolvendo mais de dois teros do cromossomo
de uma espcie em relao ao da outra. (C) Situao similar descrita em (B), mas
envolvendo duas espcies de arqueas moderadamente divergentes (P. horikoshii
OT3 e P. abyssi GE5). (D) Na comparao dos genomas de duas espcies com um
maior grau de divergncia entre elas (como as bactrias S. gordonii Challis CH1 e
S. pneumoniae R6), os padres de sintenia so praticamente eliminados, o que
evidenciado pela ausncia de linhas diagonais definidas.

Entretanto, mesmo com a pouca conservao da sin- que codificam protenas ribossmicas, os quais incluem,
tenia global e da estrutura de perons individuais, alguns em seu conjunto, mais de 50 genes, presentes em todos os
padres organizacionais de ordem superior emergem genomas de bactrias e de arqueas at agora sequencia-
quando so feitas anlises comparativas mais abran- dos. Em cada espcie, o conjunto de perons que engloba
gentes entre genomas de espcies procariticas. Esses esses mais de 50 genes configura o que se convencionou
padres so complexos e ficam mais evidentes quando chamar de um superoperon, cuja presena ubqua em
so analisados perons de genes que codificam protenas procariotos explicvel pela presso seletiva favorvel
funcionalmente relacionadas, como o caso dos perons manuteno dos genes e expresso de todas as pro-

Zaha_5ed_04.indd 78 27/11/13 09:21


79 Genes e Genomas Procariticos
tenas por eles codificadas, em quantidades equilibradas e a mevalonato-quinase (associada ao metabolismo de
entre si e com os rRNAs para a montagem adequada dos lipdeos). A presena desses e de outros genes no ultra-
ribossomos. operon no explicvel por associaes funcionais b-
vias, mas pode ser explicada pela necessidade comum
A partir de estudos comparativos da organizao dos
de um elevado nvel de expresso, proporcionado pela
superperons de protenas ribossmicas e de outros gru-
corregulao transcricional com os genes que codificam
pos menores de perons parcialmente conservados em
protenas ribossmicas.
procariotos, emergiu o conceito mais amplo de ultrao-
peron (beroperon), que descreve um grupo de genes Alm do ultraoperon de protenas ribossmicas,
que aparecem nos genomas de diferentes espcies asso- muitos outros exemplos de ultraperons j foram eviden-
ciados uns aos outros em um conjunto de perons, mes- ciados por estudos in silico, tanto em bactrias como em
mo que o nmero e a organizao (em termos de combi- arqueas (ver Material Complementar Online 4.3).
nao e ordem de genes) de perons individuais variem Esses estudos, mesmo que limitados anlise de uma fra-
de espcie para espcie. O ultraoperon uma entidade es- o do nmero total de espcies com genomas completa-
trutural e funcional supragenmica, porque sua existn- mente sequenciados, j demonstram a prevalncia da or-
cia e organizao s podem ser evidenciadas a partir da ganizao de genes em ultraoperons em procariotos. Alm
comparao dos genomas de vrias espcies. Em cada es- disso, os ultraoperons identificados constituem a base a
pcie, a organizao dos perons vinculados a um ultrao- partir da qual sero delineadas abordagens experimentais
peron representa apenas uma das alternativas funcionais para a caracterizao de muitas interaes funcionais en-
possveis para a distribuio dos genes envolvidos. tre os produtos dos genes envolvidos, o que dever levar
elucidao de muitos processos celulares procariticos
No contexto de um ultraoperon, h presses seleti-
hoje ainda parcial ou totalmente desconhecidos.
vas para que os genes permaneam, ao longo da evolu-
o, estrutural e funcionalmente associados uns aos ou-
tros em vizinhanas gnicas conectadas (connected
gene neighbourhoods), expresso s vezes utilizada
como sinnimo de ultraoperon. Uma presso seletiva fa- 3. Dinmica evolutiva dos
vorvel associao estrutural leva incluso e manu- genomas procariticos
teno desses genes em perons parcialmente conserva-
dos, os quais tm sempre alguns genes em comum com Organismos procariticos apresentam diversos meca-
os perons relacionados (ortlogos) de outras espcies. nismos moleculares que proporcionam variabilidade
Uma presso seletiva favorvel associao funcional gentica, so altamente proliferativos e esto em geral
determina que padres de regulao compartilhados ou expostos a condies ambientais bastante variveis. Por
coordenados entre si sejam adquiridos e mantidos por isso, procariotos evoluem de forma rpida e, na dinmica
todos os perons envolvidos. Em conjunto, essas foras evolutiva de espcies de bactrias e de arqueas, a pos-
evolutivas determinam que, em cada espcie, indepen- sibilidade do genoma ter o seu contedo gnico e a sua
dentemente do nmero de perons e do nmero e da estrutura frequentemente alterados de maneira a gerar
ordem dos genes em cada um deles, todos os produtos variantes genotpicas e fenotpicas com potencial adap-
gnicos de um ultraoperon sejam produzidos nas pro- tativo uma caracterstica fundamental. Essa caracters-
pores adequadas s demandas quantitativas e funcio- tica, chamada de plasticidade genmica, resulta da
nais da clula. grande suscetibilidade dos genomas procariticos ao
de diferentes processos evolutivos, alguns dos quais se-
luz do conceito de ultraoperon, o superoperon de ro discutidos a seguir.
protenas ribossmicas, discutido anteriormente, ganha
outra dimenso, pois esse conjunto de perons relacio-
nados inclui, alm dos mais de 50 genes de protenas 3.1 Principais processos evolutivos
ribossmicas, mais outros 20 a 30 genes, dependendo Na dinmica evolutiva de genomas procariticos
da espcie procaritica considerada. Dentre esses genes (Figura 4.16), vrios processos distintos podem ser re-
adicionais, esto alguns tambm relacionados sntese conhecidos. Esses processos podem ser divididos, para
proteica, como os que codificam alguns fatores de tra- fins didticos, em dois grupos principais, um deles in-
duo. A presena de genes de fatores de traduo no cluindo processos que introduzem inovaes nos geno-
contexto do ultraoperon explicvel pela correlao mas, em termos de aquisio de novas sequncias ou de
funcional de seus produtos com as protenas ribossmi- reorganizao estrutural de sequncias preexistentes, e o
cas no contexto da sntese proteica. Entretanto, vrios outro incluindo processos que levam perda de sequn-
outros genes sem correlao mais direta com a sntese cias. Esses dois grupos de processos evolutivos sero tra-
proteica tambm esto presentes, como os que codifi- tados separadamente nas duas prximas sees.
cam protenas associadas transcrio (subunidades
da RNA-polimerase e fatores de terminao ou anti- 3.1.1 Processos inovadores
-terminao transcricional) e os que codificam enzimas
como a lactato-desidrogenase (associada converso de So includos no grupo de processos evolutivos inova-
energia), a enolase (associada ao metabolismo central) dores aqueles que levam ao surgimento de novas se-

Zaha_5ed_04.indd 79 27/11/13 09:21


Biologia Molecular Bsica 80

quncias ou de novas combinaes de sequncias pree- por processos mediados por elementos genticos m-
xistentes, aumentando a complexidade de um genoma. veis, como plasmdeos conjugativos, bacterifagos e
A aquisio de novas sequncias por parte de genomas elementos transponveis (ver Captulo 9). Essa transfe-
procariticos decorre de trs processos: a duplicao rncia chamada de horizontal porque pode ocorrer
seguida de divergncia, a transferncia gnica horizon- entre espcies sem uma relao linear (vertical) de
tal e a fuso de replicons. Na duplicao seguida de descendncia entre elas. Elementos genticos mveis
divergncia, uma segunda cpia de uma regio gen- so encontrados praticamente em todas as espcies de
mica gerada, e os pares de genes duplicados (inicial- bactrias e arqueas, constituindo uma frao significa-
mente cpias um do outro) podem ento divergir pelo tiva e muito dinmica do repertrio gentico procari-
acmulo diferencial de mutaes ao longo do tempo. tico, chamada de mobiloma. O mobiloma tem com-
Isso, alm de aumentar o nmero de genes (e tambm ponentes celulares, tanto cromossmicos (epissomos,
de outras sequncias), determina que mesmo muta- incluindo elementos transponveis, plasmdeos inte-
es funcionalmente desfavorveis possam ocorrer em grativos e bacterifagos lisognicos), como extracro-
uma das cpias de um gene sem maiores prejuzos para mossmicos (plasmdeos e bacterifagos no integra-
a adaptabilidade do organismo, desde que a outra c- tivos), e tambm componentes extracelulares (vrions
pia se mantenha funcional. Como discutido na Seo de bacterifagos). A natureza dinmica do mobiloma e
1.3, a duplicao seguida de divergncia pode levar a alta prevalncia dos eventos de transferncia gnica
gerao de genes parlogos com funes idnticas (em horizontal so hoje reconhecidas como aspectos fun-
casos de divergncia mnima) ou similares (em casos de damentais da evoluo de procariotos e, luz desse
divergncia moderada), gerao de genes relaciona-
reconhecimento, o modelo inicialmente proposto para
dos, mas com funes distintas (em casos de divergn-
a evoluo dos seres vivos em trs domnios (Bacte-
cia mais acentuada), ou at a parlogos no funcionais
ria, Archaea e Eukarya) vem sendo revisto. Conforme
(pseudogenes).
modelos evolutivos mais recentes, eventos de transfe-
Na transferncia gnica horizontal, novas se- rncia gnica horizontal teriam ocorrido com bastante
quncias so incorporadas ao genoma de uma espcie frequncia entre as clulas primitivas que compunham

Duplicaes, transferncias gnicas horizontais,


fuses de replicons

Degradao genmica

Seleo purificadora,
simplificao genmica

0,1 Mb 1 Mb 10 Mb
~100 genes ~1000 genes ~10.000 genes
Tamanho do genoma
e nmero de genes

Faixa de tamanho
predominante
entre genomas
procariticos
Menor genoma Tamanho mnimo Segunda faixa de tamanho Maior genoma
procaritico de genoma predominante entre procaritico
para um procarioto genomas procariticos
de vida livre

Figura 4.16
Esquema representativo das principais foras atuantes na evoluo de genomas pro-
cariticos. A barra de escala representa (em escala logartmica) os tamanhos dos genomas proca-
riticos e o nmero aproximado correspondente de genes. Esto tambm indicados na barra, para
referncia, o tamanho do menor genoma procaritico conhecido (0,16 Mb, de C. rudii), o limite
mnimo de tamanho conhecido para uma espcie procaritica de vida livre (1,3 Mb, de Pelagibacter
ubique SAR11), a faixa de tamanho mais frequente para genomas procariticos (~2 Mb), a segunda
faixa de tamanho mais frequente para genomas procariticos (~5 Mb) e o tamanho do maior geno-
ma procaritico conhecido (13 Mb, de S. cellulosum). As principais foras evolutivas atuantes esto
indicadas por setas que apontam para a esquerda, quando o efeito de diminuio de tamanho dos
genomas, ou para a direita, quando o efeito de aumento de tamanho dos genomas; cada seta est
posicionada sobre a faixa de tamanho de genomas na barra de escala na qual os efeitos das foras
evolutivas por ela representadas so mais pronunciados.

Zaha_5ed_04.indd 80 27/11/13 09:21


81 Genes e Genomas Procariticos
a comunidade ancestral comum aos domnios Bacte- 3.1.2 Processos que determinam perda de
ria, Archaea e Eukarya e tambm ao longo de todo o sequncias
perodo evolutivo subsequente, de modo especial entre
os ramos correspondentes a linhagens bacterianas e de Em sentido oposto ao de processos evolutivos inovado-
arqueas. Os eventos de transferncia gnica horizontal res, atuam processos determinantes da perda de sequn-
ocorridos envolveram tambm genes cromossmicos, cias genmicas. Pode-se dizer que estes ltimos levam a
eventualmente associados a elementos genticos m- uma reduo geral da complexidade dos genomas, que
veis (em processos de conjugao, transduo ou trans- pode se dar pela diminuio de tamanho (contrao
posio, p. ex.) e, com isso, provvel que a transfern- genmica), pela perda de arranjos estruturais e funcio-
cia gnica horizontal tenha contribudo para o aumento nais e/ou pela eliminao de variabilidade gentica. Em
procariotos, trs processos evolutivos se destacam como
do repertrio gnico de muitas espcies procariticas,
determinantes de reduo de complexidade genmica: a
da mesma forma que a duplicao gnica.
seleo purificadora, a simplificao genmica e a degra-
A fuso de replicons a unio covalente e est- dao genmica.
vel a longo prazo (em termos evolutivos) de dois repli-
A seleo purificadora um tipo de seleo na-
cons originalmente independentes, sendo tambm um
tural determinante de reduo da variabilidade gentica,
processo importante para a aquisio de novas sequn-
pois atua eliminando de uma populao variantes gen-
cias por parte de genomas procariticos. proposto,
ticas no adaptativas. Apesar de a maioria das mutaes
por exemplo, que a fuso de replicons primordiais de
ser deletria, o efeito de cada mutao individual em
tipo plasmidial originou os primeiros cromossomos termos de reduo da adaptabilidade de um indivduo
procariticos. Alm disso, nos genomas de grande par- muito pequeno e, por isso, os efeitos da seleo puri-
te das espcies procariticas atuais, fcil identificar ficadora podem ser relativamente sutis. Na evoluo de
sequncias originalmente plasmidiais ou virais que procariotos, a seleo purificadora parece ter sido mais
agora so componentes cromossmicos estveis, em preponderante em casos de diminuio de complexidade
uma situao distinta daquela que ocorre em eventos gentica associados adaptao de espcies de vida livre
de integrao transitrios de elementos genticos m- a ambientes mais estveis. Nesses casos, a seleo puri-
veis. H evidncias tambm de fuses de cromosso- ficadora, atuando juntamente com foras evolutivas de-
mos (em casos de espcies com ancestrais portadores terminantes de contrao genmica, resultou em espcies
de mais de um cromossomo), que seriam eventos bem com genomas menores e com pouca variao entre indi-
mais raros do que fuses entre cromossomos e elemen- vduos de uma mesma populao (o que uma condio
tos do mobiloma. adaptativa para ambientes pouco variveis).
A reorganizao de sequncias um processo A simplificao genmica (genome streamli-
que introduz inovaes na configurao estrutural de ning) um processo de seleo negativo contra sequn-
genomas procariticos, embora, ao contrrio da du- cias suprfluas presentes em um genoma. A simplificao
plicao, da transferncia gnica horizontal e da fuso decorre de uma tendncia natural (mas no muito acen-
de replicons, no leve aquisio de novas sequncias. tuada) perda de sequncias nucleotdicas no funcio-
Rearranjos cromossmicos que levam a reorganizaes nais, pois a replicao dessas sequncias representa uma
estruturais ocorrem com mais frequncia em genomas sobrecarga metablica para a clula sem qualquer con-
relativamente mais ricos em sequncias repetidas, cuja trapartida adaptativa. Desse modo, h, em genomas de
presena aumenta a probabilidade de ocorrerem, por procariotos, uma tendncia natural perda, por exemplo,
exemplo, eventos de recombinao. A reorganizao de de sequncias intergnicas (sem funo codificadora, re-
sequncias no muda o repertrio de genes de um ge- guladora ou estrutural) e sequncias repetidas (incluindo
noma, pois no implica em aquisio de novos genes ou genes duplicados cuja presena em mais de uma cpia
perda de genes preexistentes. Mesmo assim, seu impac- no oferece vantagem para a clula).
to evolutivo marcante, j que ela proporciona a ocor- O processo de degradao genmica, por sua vez,
rncia de novas interaes funcionais entre os genes, engloba vrios componentes que, em conjunto, deter-
que, ao serem deslocados de uma posio para outra no minam contrao genmica. Dentre as foras evolutivas
cromossomo, podem ser integrados a novos sistemas de componentes de processos de degradao genmica de
regulao da expresso. A reorganizao de sequncias procariotos, podem ser destacadas a prpria simplifica-
de particular importncia quando envolve perons, que o genmica, discutida anteriormente, a deriva gentica
podem ser criados ou desfeitos, ou podem ter o nmero (de modo particular em casos de populaes de pequeno
e a ordem dos genes que os integram alterados. pro- tamanho), baixas frequncias de recombinao, altas ta-
vvel que essa reorganizao de perons (operon xas de mutao, capacidade reduzida para a aquisio de
shuffling) tenha sido um dos principais determinantes novas sequncias (por transferncia gnica horizontal, p.
evolutivos para o surgimento e a manuteno de estru- ex.) e uma predominncia de eventos de deleo de se-
turas organizacionais e funcionais mais complexas em quncias em detrimento de eventos de insero. Quantos
genomas procariticos, como no caso dos ultraperons ou quais desses componentes atuam em um processo de
(ver Seo 2.6.4). degradao genmica ao longo de uma linhagem evolu-

Zaha_5ed_04.indd 81 27/11/13 09:21


Biologia Molecular Bsica 82

tiva algo que varia de caso para caso, pois depende da Genomas procariticos tambm podem apresentar
espcie considerada, de seu modo de vida e das condies tendncias de contrao ou expanso, sendo a din-
ambientais vigentes em cada etapa de sua evoluo. mica de variao de tamanho determinada por desequi-
lbrios entre as foras evolutivas atuantes no sentido da
aquisio de sequncias e aquelas que atuam no sentido
3.2 Principais tendncias evolutivas oposto (ver Figura 4.16). A ao contrria e em diferentes
Quando feita uma anlise genmica comparativa abran- propores dessas foras explica os dois maiores picos de
gente, incluindo um grande nmero de espcies proca- distribuio de tamanho de genomas procariticos, um
riticas com diferentes graus de parentesco filogentico correspondente a espcies com genomas de aproximada-
entre elas, algumas tendncias evolutivas gerais podem mente 2 Mb e outro correspondente a espcies com geno-
ser identificadas. A tendncia geral mais evidente a mas de aproximadamente 5 Mb (ver Seo 2.1). A maior
de aumento de entropia (desorganizao), associada a frequncia de genomas com tamanho em torno de 2 Mb,
eventos frequentes de perda, aquisio ou rearranjo de especialmente vista em arqueas, mas tambm observada
sequncias, que levam perda parcial de organizao em bactrias, seria resultado da ao predominante de
estrutural e funcional (Figura 4.17). Ao aumento da foras que determinaram a contrao de genomas ances-
entropia se contrapem, geralmente em menor propor- trais maiores. J o pico secundrio de frequncia, corres-
o, as foras seletivas determinantes de arquiteturas pondente a genomas com tamanho prximo a 5 Mb, seria
genmicas mais estruturadas e funcionais, os eventos de resultado da ao predominante de foras que levaram
transferncia horizontal de grupos de genes organizados genomas ancestrais menores a uma expanso.
(perons) e as restries impostas pelo sistema de repli- No Material Complementar Online 4.4 so
cao e pela estruturao em domnios do cromossomo. discutidos alguns aspectos adicionais da dinmica evo-
O relativo predomnio das foras entrpicas determina lutiva de genomas procariticos. Nele so apresentados
que a configurao presente de qualquer genoma, apesar alguns casos de maior ou menor estabilidade estrutural
de funcional e adaptativa para as condies vigentes, est e de contrao ou expanso em genomas de procariotos,
sempre aqum da ideal, o que abre espao para o cons- considerando os principais fatores evolutivos determi-
tante surgimento de novas configuraes. nantes de cada situao.

Tendncia geral de entropia genmica

Sintenia Fatores entrpicos Ausncia de sintenia


Mais perons Deriva gentica, recombinao, transposio, Menos perons
perons maiores deleo, transferncia gnica horizontal perons menores
Regies intergnicas menores Regies intergnicas maiores
Menos pseudogenes Mais pseudogenes
Menos elementos transponveis Fatores organizadores
Mais elementos transponveis
Seleo purificadora, seleo positiva,
aquisio horizontal de perons,
tendncias e limites gerais impostos pelo sistema de replicao e
pela estruturao em domnios do cromossomo

Figura 4.17
Principais fatores determinantes do grau de organizao de genomas procariticos. A
tendncia geral entropia (desorganizao) observada em genomas procariticos resultante de uma
relativa predominncia dos fatores entrpicos sobre os fatores organizadores. As principais consequn-
cias do aumento ou da diminuio da entropia em um genoma procaritico esto listadas nos quadros
direta e esquerda, respectivamente.

Zaha_5ed_04.indd 82 27/11/13 09:21


83 Genes e Genomas Procariticos
Resumo
Procariotos (bactrias e arqueas) compartilham algu- conservada entre espcies aparentadas (sintenia), e
mas caractersticas celulares importantes, como a au- alguns grupos de genes podem ter coorientao e cor-
sncia de organelas e a estrutura genmica relativa- regulao definidas em perons, ou em arranjos maio-
mente simples (em comparao de eucariotos). Os res estruturados de acordo com a replicao e com os
genes procariticos so compostos por uma regio co- domnios cromossmicos. Em termos evolutivos, os
dificadora (de um produto de RNA ou protena) e pe- genomas procariticos apresentam uma tendncia
las regies reguladoras responsveis por sua expres- instabilidade e desorganizao. So frequentes os
so. A orientao de cada gene definida pelo sentido eventos de perda, aquisio e rearranjo de sequncias,
da sua transcrio. Os genomas procariticos em geral muitos dos quais envolvem elementos genticos m-
se apresentam na forma de um cromossomo circular veis e transferncia gnica horizontal. Em casos de po-
nico, embora haja espcies com mais de um cromos- pulaes pequenas, mesmo modificaes genticas
somo ou com cromossomos lineares. O tamanho dos no adaptativas podem ser fixadas por deriva genti-
genomas pode variar de menos de 0,16 Mb at mais de ca. Padres organizados so estabelecidos e mantidos
13 Mb, mas a maioria dos procariotos tem genomas de por seleo natural, pela aquisio lateral de grupos
2 a 5 Mb. Os genomas procariticos so compactos, ordenados de genes e pelas tendncias impostas pela
com uma densidade de quase 1 gene/kb, regies inter- estrutura e pelo funcionamento de domnios e repli-
gnicas curtas e poucas sequncias repetidas. Cada cons. Dependendo do equilbrio entre as diferentes
genoma possui diferentes unidades organizacionais, foras evolutivas, um cromossomo procaritico pode
que vo desde repeties de sequncia curtas e genes manter-se razoavelmente estvel ou pode tender
at ilhas genmicas e domnios cromossmicos. Alm contrao ou expanso.
disso, os genes podem ter a sua ordem no cromossomo

Leituras recomendadas
Bentley SD, Parkhill J. Comparative genomic structure of Koonin EV. Evolution of genome architecture. Int J Biochem
prokaryotes. Annu Rev Genet. 2004;38:771-92. Cell Biol. 2009;41(2):298-306.
Center for Biological Sequence Analysis. Genome Atlas Moya A, Gil R, Latorre A, Peret J, Pilar Garcilln-Barcia M,
Database [Internet]. [capturado 23 ago. 2011]. Disponvel de la Cruz F. Toward minimal bacterial cells: evolution vs.
em: http://www.cbs.dtu.dk/services/GenomeAtlas/. design. FEMS Microbiol Rev. 2009;33(1):225-35.
Fraser C, Alm EJ, Polz MF, Spratt BG, Hanage WP. The National Center for Biotechnology Information. Entrez
bacterial species challenge: making sense of genetic and Genome Project: complete microbial genomes [Internet].
ecological diversity. Science. 2009;323(5915):741-6. [capturado 23 ago. 2011]. Disponvel em: http://www.ncbi.
nlm.nih.gov/genomes/lproks.cgi.
Koonin EV, Wolf YI. Genomics of bacteria and archaea: the
emerging dynamic view of the prokaryotic world. Nucleic Rocha EP. The organization of the bacterial genome. Annu
Acids Res. 2008;36(21):6688-719. Rev Genet. 2008;42:211-33.
Koonin EV, Wolf YI. The fundamental units, processes and Rocha EP. Order and disorder in bacterial genomes. Curr
patterns of evolution, and the tree of life conundrum. Biol Opin Microbiol. 2004;7(5):519-27.
Direct. 2009;4:33.

Zaha_5ed_04.indd 83 27/11/13 09:21


Captulo 5

Henrique Bunselmeyer Ferreira

Genes e Genomas
Eucariticos

1. Genes eucariticos 86 2.4 Sintenia 103


1.1 Estrutura bsica e ocorrncia de genes 2.5 Agrupamentos organizados de genes 104
interrompidos em eucariotos 86 2.5.1 perons eucariticos 104
1.2 Tamanho 88 2.5.2 Agrupamentos de genes
1.3 Domnios transcricionais complexos 88 funcionalmente relacionados 104
1.4 Famlias multignicas eucariticas 89 2.5.3 Agrupamentos de genes
coexpressos 105
2. Genomas nucleares eucariticos 90
2.1 Tamanho 90 3. Dinmica evolutiva de genes e genomas
nucleares eucariticos 105
2.2 Forma, nmero e organizao em replicons
de cromossomos eucariticos 92 3.1 Evoluo dos genomas eucariticos 105
2.3 Composio de sequncias 92 3.2 Evoluo dos genes interrompidos 106
2.3.1 Sequncias gnicas 92
2.3.1.1 Nmero de genes e 4. Genomas de organelas 107
densidade gnica 94 4.1 Genomas mitocondriais 107
2.3.1.2 Famlias de parlogos, 4.2 Genomas de plastdeos 109
genes nicos e
pseudogenes 95
2.3.2 Sequncias intergnicas 99
2.3.2.1 Sequncias repetidas
simples 99
2.3.2.2 Elementos
transponveis 101

Zaha_5ed_05.indd 85 27/11/13 09:21


Biologia Molecular Bsica 86

O domnio Eukarya abrange uma ampla variedade de genoma pela utilizao de metodologias para a anlise
organismos uni ou pluricelulares, cuja taxonomia passou em massa de produtos de transcrio (principalmente
por grandes reformulaes nos ltimos anos. A diviso mRNA) ou traduo (ver Captulo 16).
clssica dos eucariotos nos reinos Protista, Metazoa (ou
O primeiro genoma eucaritico a ser completamen-
Animalia), Fungi e Plantae deu lugar a uma diviso em
te sequenciado foi o de S. cerevisiae, publicado em 1996.
seis supergrupos, com base em anlises filogenticas
Em 1998, foi publicada a primeira sequncia genmica
multignicas e caractersticas morfolgicas e bioqumicas
completa de um metazorio (C. elegans) e a ela se se-
(ver Material Complementar Online 5.1). Dos seis
guiram as sequncias dos genomas de D. melanogaster,
supergrupos propostos, quatro (Amoebozoa, Chro-
em 2000, e do camundongo, em 2002. Uma primeira
malveolata, Excavata e Rhizaria) so essencialmente
verso (~90% concluda) do genoma humano foi pu-
microbianos, sendo formados por diferentes grupos de
protozorios, alguns grupos de algas uni ou pluricelulares blicada em 2001, mas a verso completa foi publicada
(mas sem tecidos verdadeiros) e micetozorios. Animais apenas em 2006. O primeiro genoma de um vegetal a
(metazorios) e fungos tpicos (Dikarya), juntamente ser completamente sequenciado foi o da crucfera Ara-
com alguns grupos de eucariotos unicelulares, como os bidopsis thaliana, em 2000, e o de um fungo verda-
dos microspordeos e o dos coanoflagelados, formam o deiro o de Neurospora crassa, em 2003. Informaes
supergrupo Opisthokonta. Os vegetais terrestres fazem sobre projetos de sequenciamento de genomas eucari-
parte do supergrupo Plantae, assim como, as algas ver- ticos concludos ou em andamento e acesso aos dados
des, vermelhas e glaucfitas. de sequncia podem ser obtidos por meio de pginas
institucionais especializadas na internet, referenciadas
A classificao dos eucariotos em seis supergrupos na Seo de Leituras Recomendadas ou no Material
ainda no definitiva, pois alguns dos clados e relaes Complementar Online 5.5.
filogenticas propostos carecem de um maior embasa-
mento, uma vez que foram estabelecidos a partir da anli- A seguir, sero analisados os aspectos estruturais t-
se de nmeros ainda relativamente pequenos de espcies picos de genes e genomas eucariticos. A princpio, sero
e/ou sequncias nucleotdicas. Apesar das incertezas filo- discutidos os genes interrompidos e o carter complexo
genticas e taxonmicas ainda existentes, a caracterstica das unidades transcricionais eucariticas. Depois, ser
mais evidente e distintiva de qualquer clula eucaritica estudada a forma como genes e outras sequncias esto
a presena de um ncleo, que o compartimento celular distribudos nos genomas de diferentes organismos euca-
que abriga a maior parte do DNA celular (o genoma nu- riticos e a hiptese sobre como ocorreu a evoluo de ge-
clear). As clulas eucariticas tambm so caracteriza- nes e genomas nucleares. Por ltimo, ser vista a origem
das pela presena de outras organelas alm do ncleo, evolutiva das organelas e de seus genomas, descrevendo
como as mitocndrias, os retculos endoplasmticos liso e brevemente a estrutura de genomas mitocondriais e de
rugoso, o complexo de Golgi, os plastdeos (tpicos de c- cloroplastos.
lulas vegetais) e os lisossomos (tpicos de clulas animais)
(ver Captulo 1). As mitocndrias e os plastdeos possuem
pequenos genomas especializados, que codificam as fun-
es especficas dessas organelas. 1. Genes eucariticos
O nmero disponvel de sequncias completas de O conceito bsico de gene e as descries de seus compo-
genomas eucariticos considerado pequeno, se com- nentes essenciais de sequncia, apresentados no Captu-
parado com o nmero de genomas sequenciados de lo 4 no contexto de genomas procariticos, tambm so
procariotos e com a enorme biodiversidade do domnio vlidos para genomas eucariticos. Genes procariticos
Eukarya. Em setembro de 2011, j haviam sido dispo- e eucariticos compartilham a mesma estrutura bsica,
nibilizadas ao pblico as sequncias completas dos ge- sendo formados por uma regio codificadora e pelas re-
nomas de 37 espcies eucariticas, estando ainda em gies reguladoras associadas a ela. Entretanto, as sequn-
andamento os projetos de sequenciamento dos genomas cias reguladoras ou codificadoras de genes de eucariotos,
de outras 1.178 espcies. Essa amostragem restrita limi- em geral, possuem estruturas mais complexas que as de
ta o alcance da genmica comparativa, como ferramenta genes procariticos, sendo que essa maior complexidade
para o estudo da organizao e da evoluo de genomas determina refinamentos funcionais que explicam, pelo
eucariticos, de modo que muitas das generalizaes menos em parte, o maior grau de sofisticao de clulas e
feitas, ainda, se baseiam na anlise dos genomas de al- organismos eucariticos.
gumas poucas espcies-modelo, como a levedura Sac-
charomyces cerevisiae, a moscas-da-fruta Drosophila
melanogaster, o nematdeo Caenorhabditis elegans e o 1.1 Estrutura bsica e ocorrncia de genes
camundongo Mus musculus. interrompidos em eucariotos
Estudos genmicos abrangentes apresentam dificul- Como pode ser visto na Figura 5.1, as regies codifica-
dades pelo grande tamanho e a elevada complexidade dos doras e reguladoras de genes eucariticos podem apre-
genomas eucariticos. Por isso, o foco das investigaes sentar estruturas bem mais complexas que as de genes
muitas vezes dirigido apenas frao expressa de cada procariticos. Por exemplo, em genes eucariticos tpicos,

Zaha_5ed_05.indd 86 27/11/13 09:21


87 Genes e Genomas Eucariticos
Promotor e
Elementos outros elementos
reguladores distais reguladores proximais xons
DNA

Stio de incio
da transcrio

Stio de trmino
da transcrio
A distncia entre os ntrons
elementos reguladores
proximais e distais pode
ser de centenas a milhares
de pares de bases Transcrio

xons

pr (-m) RNA
Regio Regio
5'-UTR ntrons 3'-UTR

Processamento

Remoo dos ntrons

mRNA
xons unidos

Traduo

Protena

Figura 5.1
Esquema representativo da estrutura e da expresso de um gene eucaritico que codifica
uma protena. A figura representa um gene interrompido (com ntrons); a presena de ntrons em genes
eucariticos, apesar de tpica (principalmente em eucariotos superiores), no obrigatria. Como explicado
na Figura 4.3 (ver Captulo 4), o gene est representado de 5' para 3', considerando a sua fita codificadora, o
mesmo acontecendo com o RNA transcrito a partir dele. A regio reguladora constituda por um promotor
e outros elementos reguladores proximais, situados logo a montante do stio de incio da transcrio, e por
elementos reguladores distais, que podem estar situados a muitos milhares de pares de bases a montante
ou a jusante do promotor e da regio codificadora. A regio codificadora dividida em segmentos (xons),
que so separados por sequncias intervenientes (ntrons); nesse caso, o gene possui trs xons (em ) e
dois ntrons (em ). O gene transcrito em um pr-mRNA, que inclui as sequncias dos ntrons. Durante o
processamento do pr-mRNA, ocorre a remoo dos ntrons e a unio dos xons (no processo de splicing).
O mRNA maduro gerado , ento, exportado do ncleo para o citoplasma da clula, onde pode ser traduzido
em uma protena.

a regio reguladora a montante da regio codificadora, genes procariticos, em geral, situados a algumas cente-
incluindo o promotor (stio de ligao da RNA-polimera- nas de pares de bases a montante da regio codificadora.
se), , em geral, bem mais extensa e contm um nmero Outra caracterstica marcante, embora no exclusiva,
de elementos reguladores (sequncias nucleotdicas re- de genes eucariticos a presena de sequncias interve-
conhecidas por protenas reguladoras especficas) muito nientes. Essas sequncias, denominadas ntrons, inter-
maior do que o observado em genes procariticos. Alm rompem a regio transcrita do gene e a dividem em v-
disso, um gene eucaritico pode conter elementos regu- rios segmentos, denominados xons (ver Figura 5.1). As
ladores distais situados a milhares de pares de bases da sequncias correspondentes aos ntrons esto presentes
sua regio codificadora, tanto a montante como a jusante, no DNA genmico, so transcritas em um RNA precursor
o que contrasta com os elementos reguladores distais de (pr-RNA), porm removidas durante o processamento

Zaha_5ed_05.indd 87 27/11/13 09:21


Biologia Molecular Bsica 88

do RNA, que d origem ao RNA maduro. Em genes codifi- maioria, em torno de 1 kb e dificilmente ultrapassam os
cadores de protenas, os ntrons em geral interrompem a 10 kb de extenso (ver Captulo 4). O S. cerevisiae, um
regio codificadora. Alm disso, tambm podem ocorrer dos eucariotos mais simples (com apenas 5% de genes
ntrons que interrompem regies flanqueadoras (5'-UTR interrompidos por ntrons), possui genes com extenses
e 3'-UTR), que so transcritas, mas no traduzidas (UTR que variam de 120 pb at mais de 14 kb, com um ta-
untranslated region = regio no traduzida). manho mdio de 1,4 kb. Entretanto, importante con-
siderar que os genes interrompidos so predominantes
Os ntrons de genes eucariticos diferem dos de ge-
entre eucariotos, e isso determina que muitos genes
nes procariticos, quanto a estrutura, essas diferenas
eucariticos, sejam bem maiores do que as regies co-
tm reflexos funcionais importantes. Em razo das se-
dificadoras de seus produtos. Assim, em D. melanogas-
quncias nucleotdicas presentes, ntrons eucariticos, ter ou em mamferos, por exemplo, a maioria dos genes
em geral, no adotam estruturas secundrias (por parea- tem de 2 a 100 kb.
mento intracadeia) no contexto de transcritos de RNA.
Os ntrons procariticos, por sua vez, formam estruturas Sendo a maioria dos genes eucariticos interrom-
secundrias relativamente complexas, e isso um deter- pidos, imprescindvel que, em avaliaes gerais de ta-
minante da maneira como eles so removidos durante o manho, sejam considerados o nmero e o tamanho dos
processamento do RNA. Por isso, os ntrons eucariticos ntrons e dos xons componentes desses genes. Em rela-
dependem de um complexo ribonucleoproteico (spliceos- o a ntrons, h, entre genes eucariticos interrompidos,
somo) para a sua remoo, ao passo que os ntrons proca- uma tendncia geral de aumento no nmero de ntrons
riticos so removidos por meio de processos autocatal- por gene e no tamanho dos ntrons individuais, medida
ticos (ver Captulo 11). que se avana na escala evolutiva. Essas tendncias de-
terminam que o tamanho mdio dos genes seja maior em
A ocorrncia de genes interrompidos rara em pro- espcies eucariticas complexas. No homem, por exem-
cariotos (ver Captulo 4), mas, entre eucariotos, ela bas- plo, os genes possuem um tamanho mdio de 27 kb, com
tante comum. H, contudo, uma ampla gama de variao 1,35 kb (5%) correspondendo a xons e 25,65 kb (95%) a
na frequncia de genes interrompidos, quando compa- ntrons. A mdia do nmero de ntrons por gene no ho-
rados aos genomas de diferentes espcies eucariticas. mem (9) um pouco superior dos vertebrados (5 a 8 n-
Por exemplo, em algumas espcies de eucariotos unice- trons por gene em geral). Excedendo as mdias, h alguns
lulares, como as dos gneros Giardia e Trichomonas (Ex- casos, como o do gene humano que codifica a distrofina,
cavata, filo Metamonada), Trypanosoma (Excavata, filo uma protena muscular com mais de 3.500 aminocidos.
Euglenozoa), Cryptosporidia (Chromalveolata, filo Api- Esse gene, o maior at agora conhecido, tem um total de
complexa) e Entamoeba (Amoebozoa), os ntrons esto 2.400 kb (2,4 Mb), dos quais 14 kb correspondem aos
ausentes, ou o percentual de genes interrompidos muito seus 79 xons e o restante corresponde aos seus 78 n-
baixo (<1%). Em outras espcies, tambm unicelulares, trons. Nas regies codificadoras, a mais longa conhecida
como Plasmodium falciparum, Babesia bovis e Theileria a do gene humano da titina (outra protena muscular),
parva (todas Chromalveolata, filo Apicomplexa), a frao com quase 81 kb, que tem tambm o maior nmero de
de genes interrompidos no genoma chega a 53,9, 73,6 e xons (178) e o maior ntron (17,1 kb) at agora conheci-
61,5%, respectivamente. Uma variao ampla no percen- dos entre eucariotos.
tual de genes com ntrons tambm ocorre em leveduras,
indo de 5%, em S. cerevisiae, a 50%, em Schizosaccha-
romyces pombe. Em eucariotos mais complexos, desde 1.3 Domnios transcricionais complexos
fungos multicelulares at vertebrados, a grande maioria Anlises recentes de genomas e transcritomas de muitas
dos genes tm ntrons, e o percentual de genes inter- espcies eucariticas revelaram que a frao transcrita de
rompidos chega a 83%, em D. melanogaster, e a 94% ou cada genoma excede em muito a frao correspondente
mais, em mamferos. a genes codificadores de mRNA/protenas ou das outras
duas classes majoritrias de RNA (rRNA e tRNA). Por
1.2 Tamanho exemplo, o S. cerevisiae, C. elegans, o camundongo e o
homem tm, respectivamente, pelo menos 85, 70, 63 e
Para eucariotos, a delimitao precisa da extenso das re- 93% de seus genomas transcritos. Foi dado o nome de
gies reguladoras dos genes no simples, pois so mui- transcrio disseminada (de, pervasive transcrip-
tos os elementos de sequncia envolvidos na regulao da tion) a esse fenmeno, e o repertrio de RNAs no co-
expresso de genes eucariticos e, com frequncia, esses dificadores (ncRNAs, de, noncoding RNAs) gerado
elementos esto muito distantes do(s) gene(s) por eles inclui classes diferentes de transcritos (ver Captulo 10),
regulado(s) (ver Captulo 14). Por isso, para avaliaes algumas das quais com funo reguladora da expresso
comparativas de tamanho entre genes eucariticos, como gnica (ver Captulo 14) e outras ainda sem atribuies
as descritas a seguir, so consideradas apenas as regies funcionais claras.
transcritas (xons e ntrons) de cada gene.
Independentemente das questes funcionais, os
O tamanho dos genes eucariticos varia dentro de ncRNAs tornaram a definio dos genes eucariticos
limites amplos mas, em grande parte dos casos, eles so ainda mais complexa. Enquanto alguns desses genes so
maiores que o de genes procariticos, que tm, em sua transcritos a partir de regies antes consideradas como

Zaha_5ed_05.indd 88 27/11/13 09:21


89 Genes e Genomas Eucariticos
intergnicas, outros so transcritos a partir de regies inter e intragnicas transcritas em diferentes ncRNAs
que se sobrepem total ou parcialmente aos genes co- (Figura 5.2).
dificadores de protenas, tanto em pores exnicas
como intrnicas, tanto no mesmo sentido (de 5' para 3'
em relao fita codificadora) como no sentido inverso
1.4 Famlias multignicas eucariticas
(antissenso). Assim, existem lcus cromossmicos, aqui Como descrito no Captulo 4 (Seo 1.4), a presena de
referidos como domnios transcricionais comple- genes parlogos em um genoma a evidncia de pro-
xos, a partir dos quais so gerados mltiplos tipos de cessos evolutivos de duplicao gnica. Os eventos de
transcritos independentes. Um domnio transcricional duplicao gnica e a consequente presena de genes
complexo pode incluir um ou mais genes de estrutura parlogos so caractersticas comuns a genomas proca-
tradicional, como a descrita na Seo 1.1, e regies riticos e eucariticos. Contudo, h ainda, em procario-

DNA

1kb

mRNAs

0,5 kb

ASRs

PARLR miRNA

PASRs TASRs

Figura 5.2
A transcrio disseminada e o repertrio de RNAs produzido de um domnio transcricional
complexo. (A) O lcus cromossmico eucaritico representado (DNA) inclui trs genes de estrutura tradicio-
nal, cujos stios de incio (e o sentido, de 5' para 3') de transcrio e os xons esto representados, respectiva-
mente, por setas menores em preto e por retngulos (com as pores codificadoras em e as regies 5'-UTR
e 3'-UTR em ); os diferentes transcritos primrios produzidos a partir desse lcus esto representados por
setas (que indicam o sentido de transcrio) em (pr-mRNAs) ou em (outros RNAs); (B) Ampliao da
regio correspondente ao gene central do lcus representado em (A), mostrando algumas das vrias classes de
RNA produzidas a partir do processamento dos transcritos primrios. Os diferentes transcritos codificadores de
protena (mRNAs maduros), produzidos por splicing alternativo, esto em , com as regies 5'-UTR e 3'-UTR
em preto e as regies removidas durante o processamento (ntrons e xons alternativos) indicadas por linhas
pontilhadas. Os transcritos no codificadores (ncRNAs) esto em , com indicao da respectiva classificao
(ASRs: RNAs antissenso, complementares a diferentes pores dos transcritos codificadores; PALR: RNA longo
associado ao promotor; PASRs: RNAs curtos associados ao promotor; TASRs: RNAs curtos associados ao termi-
nador; miRNA: micro-RNA produzido a partir de ntron e formando estrutura secundria). Cada RNA indicado
na figura encontra-se alinhado horizontalmente com a regio genmica a partir da qual ele foi gerado.

Zaha_5ed_05.indd 89 27/11/13 09:21


Biologia Molecular Bsica 90

tos, foras evolutivas que atuam no sentido oposto e ten-


dem a limitar uma maior expanso de famlias de genes 2. Genomas nucleares
parlogos. J em genomas eucariticos, principalmente eucariticos
naqueles maiores, de espcies mais complexas, essas
restries so menores e, assim, ao longo da evoluo, 2.1 Tamanho
foram constitudas algumas famlias multignicas,
tpicas de eucariotos. Cada uma dessas famlias possui Uma das caractersticas mais evidentes que diferencia ge-
vrios membros, cada um deles codificando uma va- nomas eucariticos de genomas procariticos o tamanho,
riante de um determinado tipo de protena. As protenas j que os de espcies eucariticas em geral so maiores que
codificadas pelos genes de uma famlia multignica so os de espcies procariticas. Para procariotos, como visto
similares, quanto a sua estrutura e funcionalidade, mas no Captulo 4, a amostragem de genomas completamente
as diferenas existentes entre elas determinam certo sequenciados grande o suficiente para estimativas abran-
grau de especializao funcional. Alm disso, comum a gentes sobre as variaes de tamanho existentes entre es-
diversificao dos padres de expresses espaciais e/ ou pcies de bactrias e de arqueas. Para eucariotos, contudo,
temporais em cada gene da famlia, o que pode definir o nmero de espcies com genomas completamente se-
que certas protenas sejam expressas apenas em um de- quenciados considerado pequeno e a amostragem dis-
terminado tipo celular, de estgio do desenvolvimento, ponvel pobre em representatividade para muitos grupos
ou de tecido. taxonmicos. Assim, as anlises comparativas mais am-
plas para eucariotos se baseiam no apenas em genomas
Em cada famlia multignica, o nmero de genes sequenciados, mas tambm em dados obtidos por meio de
que a compe e a distribuio desses genes ao longo dos outras metodologias, como a densitometria ou a citometria
cromossomos pode variar de espcie para espcie. H, de fluxo, que determinam o contedo total de DNA nuclear
uma tendncia de que espcies mais complexas na escala (ver Material Complementar Online 5.4).
evolutiva (como os mamferos) tenham, para uma deter-
minada famlia, um nmero maior de membros do que A Figura 5.3 mostra a ampla variao de tamanho
aquele encontrado em espcies mesmo evoludas (como de genomas que ocorre entre eucariotos, comparando o
os invertebrados). Isso provavelmente acontea, em ra- contedo de DNA haploide, chamado de valor C.
zo da ocorrncia de sucessivos eventos de duplicao g- No outro extremo da distribuio, interessante
nica dos genes daquela famlia ao longo de uma linhagem notar que os maiores genomas eucariticos conhecidos
evolutiva (como a dos metazorios, p. ex.). tambm ocorrem entre espcies unicelulares, pelo menos
A origem das famlias multignicas a partir de even- com base em quantificaes densitomtricas ou citom-
tos de duplicao gnica tambm determina que os tricas do contedo de DNA nuclear. Para algumas ame-
membros da famlia mais recentes se encontrem ainda bas (Amoebozoa), por exemplo, as dos gneros Polychaos
prximos (agrupados) em uma mesma regio cromoss- e Chaos, foram feitas estimativas de contedo genmico
mica. Existe uma tendncia, de que, ao longo do tempo, da ordem de 600.000 Mb a 1.400.000 Mb. Entretanto,
rearranjos cromossmicos (como inverses e transloca- essas estimativas, que estendem muito a faixa de varia-
es) levem disperso desses membros em um mesmo o de tamanho dos genomas entre espcies protistas,
cromossomo ou em cromossomos diferentes. Entretan- devem ser consideradas com cautela. Muitas amebas so
to, em oposio a essa tendncia, foras seletivas podem altamente poliploides, podendo conter 100 ou mais con-
atuar para a manuteno de agrupamentos gnicos, em juntos cromossmicos completos, o que inviabiliza com-
razo da ocorrncia de mecanismos de regulao coor- paraes diretas com estimativas de tamanho genmico
denada (corregulao) da expresso dos genes (ver Se- haploide.
o 2.5.2). Entre animais (metazorios), o menor genoma co-
Existem muitas famlias multignicas tpicas de eu- nhecido o do nematdeo parasita de plantas Pratylen-
cariotos, embora nem todas elas sejam comuns a todas as chus coffeae, com tamanho prximo a 20 Mb, e o maior
espcies eucariticas. Como exemplos de famlias multi- o do peixe pulmonado P. aethiopicus, com 130.000
gnicas ubquas em eucariotos, podem ser citadas as de Mb. So notavelmente grandes, tambm, os genomas
genes codificadores de protenas da cromatina, como as de alguns anfbios, como o de N. lewisi (ordem Cauda-
histonas, e as de citoesqueleto, como as actinas, as tro- ta, famlia Proteidae), com 120.000 Mb. O genoma hu-
pomiosinas e as tubulinas. Outras famlias so tpicas de mano, com pouco mais de 3.000 Mb, ocupa uma posi-
espcies eucariticas mais complexas, como vertebrados o intermediria entre os genomas de mamferos, cujos
ou plantas superiores. Dentre essas, esto as famlias tamanhos oscilam entre 1.700 Mb (para o morcego M.
multignicas que codificam hemoglobinas, imunoglobu- schreibersi) e 8.200 Mb (para o roedor Tympanoctomys
linas, interferons e fatores de transcrio hometicos. No barrerae). Em qualquer filo considerado h uma ampla
Material Complementar Online 5.3, so discutidos variao de tamanho, que, entre cordados (representados
alguns aspectos adicionais sobre famlias multignicas por peixes, anfbios, rpteis, aves e mamferos), chega a
eucariticas, utilizando como exemplos a famlia de genes mais de 300 vezes do menor ao maior genoma e, entre
codificadores de actinas, ubqua em eucariotos, e a fam- artrpodes (representados por insetos e crustceos), che-
lia de genes codificadores de globinas de vertebrados. ga a mais de 600 vezes. Apesar disso, considerando-se os

Zaha_5ed_05.indd 90 27/11/13 09:21


91 Genes e Genomas Eucariticos
Minopterus Homo sapiens
schreibersi Macaca mulatta
MAMFEROS
Gallus
gallus Struthio camelus
AVES
Caiman
crocodilus Testudo graeca
RPTEIS
Cedrus Pinus
labani sylvestris
GIMNOSPERMAS
Triturus
Xenopus laevis cristatus Necturus lewisi
ANFBIOS
Tetraodon Lampreta Protopterus
fluviatillis fluviatillis Danio reno aethiopicus
PEIXES
Strongyiocentrotus purpuratus
EQUINODERMOS
Mytilus edulis
MOLUSCOS
Polypodium australe
PTERIDFITAS
Homaliodendrum decompositum
BRIFITAS
Daphnia pulex Litopenaeus vannamel
CRUSTCEOS
D. melanogaster
INSETOS
Glycine
A. thaliana Oryza sativa max Zea mays
ANGIOSPERMAS

C. elegans
NEMATDEOS
Cyanidium
caldarium Cyanidioschyzon merolae Chara contraria
ALGAS

S. cerevisiae Aspergillus nidulans


FUNGOS
Encephalitozoon
intestinalis Plasmodium falciparum Polychaos dubium*

PROTISTAS
PROCARIOTOS Escherchia coli

105 106 107 108 109 1010 1011 1012


Nmero de pares de bases por genoma haploide

Figura 5.3
Tamanhos de genoma em diferentes grupos taxonmicos. Para cada grupo taxonmico indi-
cado, a amplitude na variao de tamanho do genoma encontrada entre espcies a ele pertencentes est
indicada por uma barra em . O tamanho do genoma de uma ou mais espcies representativas do grupo
est posicionado na escala. Grupos taxonmicos de diferentes hierarquias esto representados e, por
simplificao, espcies unicelulares pertencentes aos supergrupos Opisthokonta, Amoebozoa, Chromal-
veolata, Excavata e Rhizaria foram reunidas como protistas. Como algas, esto classificadas apenas as es-
pcies pertencentes ao supergrupo Plantae. Os dados de procariotos (barra em ) foram includos para
referncia. Todos os dados representados referem-se ao contedo de DNA do genoma haploide (valor C),
com exceo de alguns protistas (*), cujo genoma apresenta alto grau de poliploidizao.

tamanhos mnimos de genoma observados em cada filo, permas, chegam a mais de 100.000 Mb. De algas do su-
parece haver uma tendncia ao aumento de tamanho que pergrupo Plantae at plantas superiores (gimnospermas
acompanha, at certo ponto, a crescente complexidade e angiospermas), passando por brifitas e pteridfitas,
anatmica e funcional observada entre metazorios, des- tambm parece haver uma certa tendncia ao aumento
de nematdeos at cordados. no tamanho mnimo ou mdio de genoma para cada gru-
Entre vegetais, os menores genomas conhecidos so po taxonmico, que acompanha, parcialmente, o aumen-
os de algumas algas unicelulares, como C. caldarium, to da complexidade das espcies. Entretanto, assim como
com menos de 10 Mb, e os maiores, de algumas angios- acontece para os animais, o tamanho do genoma pode

Zaha_5ed_05.indd 91 27/11/13 09:21


Biologia Molecular Bsica 92

oscilar muito entre as espcies de um mesmo grupo taxo- nico conjunto de cromossomos por clula), como as c-
nmico. Isso evidente, por exemplo, em angiospermas, lulas vegetativas haploides de leveduras e os machos ha-
em que a diferena entre o menor genoma (da roscea ploides de insetos himenpteros.
Fragaria viridis, com em torno de 98 Mb) e o maior (da
O nmero e o tamanho dos cromossomos variam
lilicea Fritillaria assyriaca, com perto de 120.000 Mb)
muito, dependendo da espcie considerada. Quanto ao
chega a 2.000 vezes.
nmero, h espcies como o nematdeo Parascaris uni-
Fungos, em comparao com animais e vegetais, pos- valens e a formiga Myrmecia pilosula, que possuem ape-
suem genomas menores e tambm apresentam uma me- nas um cromossomo em seus complementos cromoss-
nor amplitude na variao de tamanho. O menor genoma micos haploides (n 1), e, por outro lado, a pteridfita
de fungos, at agora conhecido, o do patgeno pulmo- Ophioglossum reticulatum, com seus 630 cromossomos
nar de seres humanos Pneumocystis jiroveci (antes de- no complemento haploide (n 630). Entre animais,
nominado Pneumocystis carinii), com 6,5 Mb, e o maior o maior nmero haploide de cromossomos at agora
o de Scutellospora castanea (ordem Diversiporales), encontrado foi de n 127, no caranguejo Eupagurus
com 795 Mb, o que significa uma amplitude de variao ochotensis. O tamanho do DNA dos cromossomos euca-
de apenas pouco mais de 120 vezes. Entre esses extremos, riticos lineares tpicos pode variar desde pouco mais de
cerca de 90% das espcies de fungos tm genomas entre 0,2 ou 0,3 Mb, como no microspordio Encephalitozoon
10 e 60 Mb e, portanto, so menores que os genomas da cuniculi, at dezenas ou centenas de megabases. Em seres
grande maioria dos metazorios e dos vegetais (excluindo humanos, por exemplo, o menor cromossomo (cromos-
as algas). somo 21) tem cerca de 47 Mb e o maior (cromossomo 1)
aproximadamente 245 Mb.
Um aspecto evidente em qualquer anlise mais
abrangente sobre a variao de tamanho entre genomas Em relao replicao, cada cromossomo eucari-
eucariticos o denominado paradoxo do valor C. tico est organizado em mltiplos replicons em tandem
Esse fenmeno pode ser observado em muitos grupos (Figura 5.4A), em uma situao distinta daquela, em
taxonmicos e descreve uma frequente falta de correla- que cromossomos procariticos esto organizados em um
o entre a complexidade biolgica dos organismos e os ou poucos replicons (ver Captulo 4, Seo 2.2). Quanto a
tamanhos dos respectivos genomas. Organismos perten- estrutura, pode-se afirmar que cada replicon eucaritico
centes a uma mesma classe, por exemplo, a dos anfbios, tem entre 5 e 15 kb, sendo essa extenso definida a par-
podem ter variaes de mais de 120 vezes no tamanho tir do espaamento (nem sempre regular) das mltiplas
dos seus genomas, ao passo que grupos com graus de origens de replicao ao longo de cada molcula de DNA
complexidade anatmica, fisiolgica e comportamental que constitui um cromossomo (Figura 5.4B). Porm, a
muito distintas, como nematdeos, insetos e mamferos, cada ciclo celular, nem todas as origens de replicao so
podem ter espcies com genomas de tamanhos similares. ativadas, o que determina, do ponto de vista funcional,
que a extenso de cada replicon seja bem maior, podendo
O paradoxo do valor C resulta, em essncia, da pre- chegar a mais de 1 Mb (Figura 5.4C).
sena, nos genomas de algumas espcies eucariticas, de
uma grande quantidade de sequncias no associadas a Em microrganismos eucariticos, como espcies de
genes, isso faz com que o tamanho do genoma no refli- leveduras (Opisthokonta), amebas (Amoebozoa) e tripa-
ta diretamente o nmero de genes nele presente. Essas nossomatdeos (Euglenozoa; Excavata), tambm ocor-
sequncias intergnicas, com representatividade variada rem plasmdeos nucleares, que so circulares como os
nos genomas de diferentes espcies, so constitudas em plasmdeos procariticos tpicos. Esses plasmdeos tm
grande parte por elementos transponveis e outras classes replicao autnoma e cpias mltiplas, como muitos
de DNA repetitivo. plasmdeos procariticos. Pelo menos em alguns casos,
como em espcies do gnero Entamoeba (Amoebozoa),
esses plasmdeos podem conter genes essenciais, como os
2.2 Forma, nmero e organizao de rRNA.
em replicons de cromossomos
eucariticos 2.3 Composio de sequncias
O DNA nuclear de espcies eucariticas est organizado
em cromossomos, cada um deles composto por uma
2.3.1 Sequncias gnicas
nica molcula de DNA linear, o que contrasta com a Em eucariotos, os genes podem ocupar uma frao vari-
situao dos cromossomos circulares, tpicos de procario- vel do genoma, dependendo da espcie. Em espcies de
tos. A maioria dos organismos eucariticos diploide, genoma reduzido, como o microspordio E. cuniculi, essa
isto , possui dois conjuntos completos de cromossomos frao chega a mais de 80%, e, em S. cerevisiae, os genes
em cada clula somtica. Contudo, espcies que so poli- ocupam cerca de 70% do genoma. O homem exemplifica
ploides (com 3 ou mais cpias de cada cromossomo por o outro extremo, pois a frao gnica de 25%, conside-
clula) ocorrem entre eucariotos unicelulares, fungos, rando xons e ntrons, e cai para 1% se forem conside-
animais e vegetais. H espcies, ainda, que apresentam rados apenas os xons (que constituem a chamada fra-
fases de desenvolvimento ou formas haploides (com um o codificadora do genoma). A frao gnica, contudo,

Zaha_5ed_05.indd 92 27/11/13 09:21


Zaha_5ed_05.indd 93
A

R1 R2 R3 R4 R5 R6 R7

R1 R2 R3

Figura 5.4
Representao esquemtica da organizao estrutural e funcional de replicons em cromossomos eucariticos. (A) Em um cromos-
somo eucaritico tpico, as origens de replicao (em ) esto distribudas a cada 5 a 15 kb. (B) Se todas as origens de replicao fossem simultanea-
mente ativadas a cada ciclo celular, como indicado pelas setas curtas divergentes em , o tamanho dos replicons (R1-R7), determinado pelos encon-
tros dos processos de replicao que avanam de forma bidirecional, a partir de cada origem (indicados pelas setas pontilhadas em ), seria tambm
de 5 a 15 kb. Entretanto, esse tipo de situao no ocorre, pois, como demonstrado em (C), a cada ciclo celular, apenas algumas das potenciais origens
de replicao so ativadas, de modo que a distncia entre origens ativadas e, em consequncia, o tamanho efetivo dos replicons (R1R3) so muito
maiores.

93 Genes e Genomas Eucariticos

27/11/13 09:21
Biologia Molecular Bsica 94

independentemente da sua representatividade, sempre, ser observado, o nmero total de genes tende a aumen-
do ponto de vista qualitativo, muito complexa e, a seguir, tar conforme o grau de complexidade das espcies, pois
sero discutidos alguns aspectos bsicos da organizao inferior a 10.000 para eucariotos unicelulares, fica en-
dos genes em genomas eucariticos. tre 10.000 e 20.000 para invertebrados e maior que
20.000 para o homem (e outros vertebrados) e para
2.3.1.1 Nmero de genes e densidade gnica
plantas superiores. Um nmero menor de genes em D.
Estimar o nmero de genes em um genoma eucari- melanogaster (artrpode) do que em C. elegans (nema-
tico no tarefa fcil, pois, alm dos genomas serem tdeo) parece contraditrio, j que a mosca morfolgi-
muito grandes, os genes podem variar muito em tama- ca e fisiologicamente mais complexa. Da mesma forma,
nho e estrutura e no ter uma distribuio uniforme as diferenas de apenas 4 vezes entre o nmero de genes
ao longo dos cromossomos. Mesmo o sequenciamento no homem e em S. cerevisiae ou de apenas 5.000 genes
completo de um genoma eucaritico pode no ser de- (20%) entre o homem e C. elegans esto bem aqum do
finitivo para a determinao do nmero total de genes esperado, a partir das diferenas de complexidade em
nele presente. todos os nveis entre essas espcies. Entretanto, tais dis-
No caso de espcies mais complexas, a predomi- crepncias podem ser inerentes grande variabilidade
nncia de genes interrompidos, associada ao tamanho de tamanhos de genomas (e possivelmente de nmero de
pequeno dos xons e a ocorrncia de ntrons de grande genes) em muitos grupos taxonmicos (ver Figura 5.3) e/
tamanho, dificulta sobremaneira a delimitao de genes ou decorrentes de diferenas funcionais relacionadas
individuais. Alm disso, com a descoberta da transcrio expresso gnica.
disseminada e de vrias novas classes de ncRNAs, a pr-
Um dos aspectos funcionais relevantes para a an-
pria definio de gene ficou mais complexa, o que tornou
lise quantitativa de genes codificadores de protenas diz
a tarefa de determinar o nmero total de genes em um
respeito possibilidade de um mesmo gene poder gerar
genoma ainda mais difcil. Por isso, as estimativas gerais
mais de uma protena diferente. Isso pode ocorrer por
se restringem quantificao de genes codificadores de
meio da utilizao de cdons de iniciao ou trmino de
protenas, cuja anlise estrutural e funcional pode ser
traduo alternativos (ver Captulo 12) e/ou por splicing
considerada mais simples.
alternativo (ver Captulos 11 e 14). Como exemplo pode-
A Tabela 5.1 apresenta estimativas do nmero -se citar o gene EPB41 humano, que codifica a protena
de genes codificadores de protenas nos genomas do citoesqueleto de eritrcitos 4.1R. Esse gene capaz de
de algumas espcies eucariticas representativas em di- produzir pelo menos 18 isoformas da protena, a partir da
ferentes nveis de complexidade genmica. Como pode utilizao de dois cdons de incio de traduo alternati-

Tabela 5.1 Estimativas de tamanho, densidade gnica e proporo de genes nicos em famlias de parlogos para
genomas de diferentes espcies eucariticas1
Nmero total Frao do genoma
Tamanho do estimado de ocupada pelos Densidade Genes Genes em
a
Espcies genoma (Mb) genes genesb gnicac nicos famlias
d
E. coli 4,6 4.300 90% 1,1 >90% <10%
S. cerevisiae 12 6.000 73% (72%) 2 72% 28%
P. falciparum 23 5.300 62% (53%) 4,3 n.d. n.d.
C. elegans 97 20.000 53% (27%) 5 55% 45%
D. melanogaster 180 13.600 24,5% (13,4%) 13 72% 28%
H. sapiens 3.000e 25.000 25% (1%) 120 20-25% 75-80%
A. thaliana 157f 25.500 >40%(n.d.) 6,1 10% 90%
G. max 1.100 46.000 n.d. 24 27% 73%
Z. mays 2.300 32.000 5% (2,3%) 72 16% 84%
a
Estimativas de nmero total de genes codificadores de protenas. Nas estimativas, apenas genes funcionais so considerados, excluindose pseudogenes.
b
Para genomas eucariticos, considerando xons e ntrons, com a frao ocupada apenas pelos xons entre parnteses; no caso de S. cerevisiae (com
apenas 5% dos genes com ntrons e ntrons de pequeno tamanho), as duas estimativas so praticamente idnticas, pois a frao do genoma representada
pelos ntrons no chega a 1%. Para E. coli (sem ntrons), a estimativa considera apenas a frao codificadora de protenas do genoma.
c
Espaamento mdio entre genes (kb); uma densidade gnica de n kb significa um gene a cada n quilobases.
d
Os dados da bactria E.coli foram includos para comparao com procariotos.
e
Estimativa do tamanho total da poro eucromtica do genoma.
f
Estimativa com base em citometria de fluxo; essa estimativa mais recente e considerada mais confivel que a estimativa de 125 Mb, feita a partir do
sequenciamento do genoma.
n.d. = dados no disponveis.

Zaha_5ed_05.indd 94 27/11/13 09:21


95 Genes e Genomas Eucariticos
ATG2

14 15 16 17A 17B 18 19 20

ATG1 3 4 5

8
1 2 6 7 9 101112 13 17 21 22

Figura 5.5
Gerao de mltiplos mRNAs a partir do gene humano EPB41, que codifica
a protena 4.1R. O gene, com mais de 90 kb de extenso, transcrito em um nico pr-
-mRNA, que gera pelo menos 18 isoformas diferentes da protena. Isso possvel a partir
da utilizao de dois cdons de incio de traduo alternativos (ATG1 e ATG2, indicados
por setas) e do splicing alternativo de 12 dos 23 xons (representados por barras e nume-
rados) do gene. As regies codificadoras dos xons esto representadas em , e as no
codificadoras, em ; as sequncias dos ntrons no esto representadas. As linhas ligam
os xons unidos por splicing; os eventos de splicing alternativo esto representados em
paralelo.

vos e por splicing alternativo de pelo menos 12 dos seus densidade de um gene por quilobase, comparvel de
23 xons (Figura 5.5). Esse tipo de fenmeno pode ex- genomas procariticos. Em S. cerevisiae, com genoma
pandir significativamente a quantidade de protenas pro- quatro vezes maior que E. cuniculi e o triplo de genes, a
duzidas a partir de um genoma e explicar, pelo menos em densidade cai para um gene a cada 2 kb.
parte, porque genomas de espcies mais complexas no
A densidade gnica diminui em propores ainda
tm um nmero de genes maior, em proporcionalidade, maiores quando so analisados organismos com geno-
que os de espcies menos complexas. mas progressivamente maiores, variando, por exemplo,
A frao de genes que sofrem splicing alternativo desde um gene a cada 4 ou 5 kb, para P. falciparum e C.
maior em organismos mais complexos, sendo de apro- elegans, at um gene a cada 120 kb no homem.
ximadamente 10% em C. elegans e subindo para mais importante lembrar que a densidade gnica um
de 40% em D. melanogaster e mais de 70% no homem. parmetro que no contempla eventuais diferenas na
A anlise de sequncias transcritas dos genomas de A. distribuio dos genes ao longo dos cromossomos (fre-
thaliana e do arroz indica que tambm entre plantas su- quentes em genomas maiores). Por exemplo, no genoma
periores o splicing alternativo comum e responsvel, de D. melanogaster, a densidade gnica varia entre 0 e
como entre animais, por boa parte da diversidade protei- 30 genes a cada 50 kb, dependendo da regio considera-
ca entre espcies mais complexas. da e, no homem, ela varia de 23 genes/Mb, no cromos-
somo com maior densidade (cromossomo 19) a apenas
Outro parmetro importante relacionado s estima-
5 genes/ Mb, no cromossomo com menor densidade
tivas de nmero total de genes em genomas eucariticos
(cromossomo 13). Entre os vegetais, a soja tambm
a densidade gnica, definida como a distncia mdia
um exemplo de falta de uniformidade da densidade g-
entre genes individuais ao longo de um genoma (conside-
nica, pois quase 80% dos seus genes encontram-se nas
rando tambm genes codificadores de protenas). A den-
extremidades dos cromossomos, representando menos
sidade gnica depende da proporo de sequncias inter-
de 50% do genoma.
gnicas no genoma, com tendncia a aumentar mais que
o nmero de genes medida que avana na escala evolu- 2.3.1.2 Famlias de parlogos, genes nicos e
tiva. Assim, a densidade gnica pode variar muito entre pseudogenes
diferentes espcies e apresenta propenso geral inversa A ocorrncia de eventos de duplicao gnica ao longo da
do nmero de genes, pois tende a diminuir em eucariotos evoluo determina que muitos genes faam parte de fa-
mais complexos (ver Tabela 5.1). Em microspordios de mlias de parlogos, cujo grau de parentesco, definido
genoma reduzido, como E. cuniculi (genoma de 2,9 Mb), pela similaridade de sequncias, pode variar desde ape-
a distncia entre os genes apenas de 100 a 200 pb e a nas 30 at quase 100% ao longo de todo o gene ou, pelo

Zaha_5ed_05.indd 95 27/11/13 09:21


Biologia Molecular Bsica 96

menos, em um ou mais de seus xons. Em contra-partida, A tendncia ao aumento do nmero de genes em


os genes rfos, que no fazem parte de nenhuma fam- famlias de eucariotos mais complexos acompanhada
lia em um genoma, so os chamados de genes nicos. tambm pelo aumento do nmero de famlias diferentes e
A proporo de genes funcionais nicos e em famlias no do nmero de genes em cada famlia. Por exemplo, em S.
genoma varia de espcie para espcie, como pode ser vis- cerevisiae, o nmero de famlias de aproximadamente
to na Tabela 5.1. 4.000, e as famlias com 4 ou mais membros representam
menos de um tero do total. Em metazorios ou plantas
A partir de comparaes entre procariotos e eucario-
superiores, o nmero de famlias gnicas de 10.000 a
tos e das espcies eucariticas entre si, pode-se identificar
14.000, e 50% ou mais dos genes esto em famlias com 4
uma tendncia ao aumento da frao de genes em fam-
ou mais membros.
lias (com a correspondente diminuio da frao de genes
nicos) nos genomas medida que se avana na escala Na frao de genes organizados em famlias, os ca-
evolutiva. Assim, a frao de genes nicos maior que sos mais extremos so representados por genes idnticos
50% em S. cerevisiae, D. melanogaster ou C. elegans, ao (com 100% de identidade ou muito prximo disso), pre-
passo que metazorios e vegetais mais complexos, como sentes em cpias mltiplas. Dentre as famlias de ge-
mamferos e angiospermas, tm de 70 a 90% de seus ge- nes de cpias mltiplas de eucariotos, sero considerados
nes em famlias e, em consequncia, apenas de 10 a 30% 3 exemplos marcantes, que so os dos genes codificado-
de seus genes so nicos. res de rRNAs, tRNAs e histonas. A presena de mltiplas
cpias para esses genes representa uma estratgia para
A origem de famlias gnicas por duplicao e diver-
suprir a demanda elevada dos produtos gnicos corres-
gncia por mutao leva tambm formao de muitos
pondentes, que h em clulas eucariticas. A maior parte
parlogos no funcionais, chamados de pseudogenes.
do RNA celular consiste em rRNA e em tRNA, sendo o
O nmero de pseudogenes desse tipo (pseudogenes du-
rRNA o produto de transcrio predominante, represen-
plicados ou no processados), estruturalmente distintos
tando de 80 a 90% da massa celular total de RNA.
dos pseudogenes processados (gerados por retrotrans-
posio), tambm varia muito nos genomas de diferen- As histonas, por sua vez, representam aproximada-
tes espcies eucariticas. Estima-se, por exemplo, que a mente 50% da massa da cromatina e 2% da massa total
quantidade total de pseudogenes (excluindo os processa- de protenas de uma clula eucaritica tpica. Repeties
dos) em D. melanogaster, C. elegans e no homem seja de de genes de rRNA e tRNA ocorrem tambm em procario-
aproximadamente 70, 2.000 e 12.000, respectivamente. tos, mas, em eucariotos, esses genes atingem nveis de
A Figura 5.6 apresenta a proporo de genes nicos, de reiterao bem mais pronunciados. Os genes de histonas
genes em famlias e de pseudogenes no genoma humano, constituem uma famlia compartilhada por eucariotos e
o que ilustra uma situao considerada tpica dos geno- arqueas, mas os eucariotos apresentam esses genes em
mas eucariticos de maior tamanho, encontrados em es- mltiplas cpias e organizados em arranjos que lhe so
pcies mais complexas. peculiares. A seguir, sero discutidos os padres de or-

Pseudogenes Genes funcionais


Pseudogenes processados Genes nicos
(18%) (14%)

Pseudogenes
duplicados Genes em familias
(27%) (41%)

Figura 5.6
Proporo de genes nicos, genes em famlias e pseudogenes
no genoma humano. Os genes nicos e os genes em famlias de par-
logos constituem a frao gnica funcional do genoma. Os pseudogenes
so cpias no funcionais, que podem ser geradas por eventos de dupli-
cao seguidos por mutaes (pseudogenes duplicados ou no proces-
sados) ou por eventos de retrotransposio (pseudogenes processados).

Zaha_5ed_05.indd 96 27/11/13 09:21


97 Genes e Genomas Eucariticos
ganizao tpicos de eucariotos para os genes de rRNA, das espcies eucariticas, os agrupamentos em tandem
tRNA e histonas, lembrando que as estimativas de nme- do peron de rRNA esto distribudos entre diferentes
ro de genes nem sempre so precisas, pois mesmo para cromossomos, embora haja algumas espcies, como S.
genomas sequenciados a quantificao de sequncias re- cereviseae, em que todas as cpias esto em um nico l-
petidas est sujeita a erros. cus cromossmico.
Os genes que codificam rRNAs em eucariotos, O gene de rRNA de 5S encontra-se transcricional-
em geral, se dividem em uma unidade de transcrio, que mente dissociado do peron de rRNA de 18S, 5,8S e 28S
inclui as regies codificadoras dos rRNAs de 18S, 5,8S e em genomas de eucariotos, em uma situao distinta da
28S, e no gene de rRNA de 5S, que transcrito indivi- encontrada em muitas espcies de bactrias e arqueas,
dualmente (Figura 5.7). Os genes de rRNA de 18S, 5,8S em cujos genomas o gene de rRNA de 5S parte do pe-
e 28S (Figura 5.7A) so cotranscritos e formam, portan- ron de rRNA. H certas espcies, como S. cerevisiae e
to, um peron (ver Seo 2.5.1), equivalente ao peron Dictyostelyum discoideum (Mycetozoa; Amoebozoa),
dos rRNAs de 16S, 23S e 5S que ocorre em genomas de em que os genes de rRNA de 5S individuais so encontra-
procariotos. O peron de rRNAs de 18S, 5,8S e 28S ge- dos em posies adjacentes ao peron de rRNA, mas, na
ralmente encontrado em repeties mltiplas em tandem maioria dos genomas de espcies eucariticas, os genes
(Figura 5.7B), cujo nmero varia de espcie para espcie. de rRNA de 5S encontram-se fisicamente distantes dos
Sendo assim, ele sempre ser muito maior do que o n- genes dos demais tipos de rRNA. comum que os genes
mero de repeties encontrado para o peron equivalente de rRNA de 5S de genomas eucariticos se organizem em
em procariotos (menor que 10). Por exemplo, em torno um (como em D. melanogaster e na galinha [G. gallus]),
de 150 cpias esto presentes no genoma de S. cerevisiae, ou em poucos agrupamentos (como em Drosophila viri-
aproximadamente 400 ocorrem no genoma humano e o lis ou A. thaliana) (Figura 5.7C). Pode ocorrer tambm
nmero pode chegar a muitos milhares nos genomas de uma situao mista, como no homem, que possui dois
algumas espcies de plantas. Nos genomas da maioria agrupamentos e vrios genes individuais espalhados pelo

A
P 18S 5,8S 28S T

ENT ETE ETI1 ETI2

RI RC

RI RC

Figura 5.7
Organizao tpica dos genes que codificam rRNAs em genomas de eucariotos. (A) Uma unidade de repe-
tio (peron) dos genes de rRNA de 18S, 5,8S e 28S composta pelas regies codificadoras (RC) dos 3 rRNAs (em )
e por uma regio intergnica (RI). Na poro transcrita da unidade de repetio, h, alm das 3 regies codificadoras,
um espaador transcrito externo (ETE) e dois espaadores transcritos internos (ETI1 e ETI2). A regio intergnica con-
siste essencialmente no chamado espaador no transcrito, embora ela inclua tambm as pores no transcritas dos
elementos de regulao de incio e trmino da transcrio; esses elementos reguladores esto representados na figura
(em ), com P indicando o promotor e T indicando o terminador, e o stio de incio da transcrio est representado
por uma seta. (B) Um arranjo em tandem tpico de unidades de repetio de genes de rRNA de 18S, 5,8S e 28S, como
a descrita em (A). Esse arranjo pode ter de dezenas at milhares de unidades de repetio regularmente espaadas e,
dependendo da espcie, dois ou mais desses arranjos podem estar presentes em diferentes cromossomos. (C) Arranjo
em tandem tpico de genes de rRNA de 5S individuais. Em genes de rRNA de 5S, o promotor (em ) interno regio
codificadora (em ). Nesse arranjo, cada gene transcrito individualmente, estando os stios de incio da transcrio
de cada um indicados por setas. Um ou mais desses agrupamentos, cada um contendo de dezenas a milhares de genes
de rRNA de 5S, podem estar presentes no genoma, dependendo da espcie.

Zaha_5ed_05.indd 97 27/11/13 09:21


Biologia Molecular Bsica 98

genoma. Uma distribuio exclusivamente espalhada, Essa famlia inclui 5 genes, cada um deles codificando um
sem agrupamentos, mais rara, mas j foi encontrada, tipo diferente de histona (H1, H2A, H2B, H3 ou H4; ver
por exemplo, no genoma de S. pombe. Captulo 3). A organizao dessa famlia heterognea,
havendo uma variao considervel no s no nmero de
O nmero de genes de rRNA de 5,8S pode variar des-
cpias, como tambm na distribuio dos genes no geno-
de algumas poucas centenas, como em S. cerevisiae (100
ma. O menor nmero de cpias conhecido para a famlia
a 200) e no homem (em torno de 400), at alguns mi-
o de S. cerevisiae, em que o genoma possui apenas 2
lhares, como no roedor Cricetulus griseus (em torno de
unidades de repetio dos genes H2A, H2B, H3 e H4, dis-
3.000) ou na ervilha Pisum sativum (em torno de 5.000).
tantes uma da outra, e um nico gene da histona H1. Nos
O nmero de genes em cada agrupamento tambm bas-
genomas de muitas outras espcies, os genes de histonas
tante varivel, por exemplo, no genoma humano h um
esto organizados em arranjos em tandem, com a uni-
agrupamento com 5 a 10 genes e outro com 100 a 150 ge-
dade de repetio incluindo todos ou alguns dos 5 genes
nes e, no genoma da ervilha, cada um de seus 3 agrupa-
diferentes.
mentos tem mais de 1.000 genes.
Arranjos de agrupamentos que incluem todos os 5
Os genes de tRNA, embora tambm repetidos em
genes organizados em tandem no genoma ocorrem, por
genomas de eucariotos, apresentam uma organizao dis-
exemplo, em diferentes espcies de ourio-do-mar, em
tinta da dos genes de rRNA. O nmero de genes diferen-
que a unidade de repetio reiterada de 300 a 1.000 ve-
tes varia entre as espcies, podendo chegar a 50, havendo
zes, e em D. melanogaster, em que a unidade de repetio
no genoma humano, por exemplo, 38 genes diferentes de
est presente em pouco mais de 100 cpias (Figura 5.8).
tRNA. O nmero de vezes que cada um dos genes se repe-
comum tambm a ocorrncia simultnea de agrupa-
te em um genoma tambm varivel conforme a espcie,
mentos que contm todos os 5 genes e de agrupamentos
assim como tambm varivel o nmero total de cpias
que incluem apenas os genes para as histonas centrais na
de genes de tRNA. A distribuio desses genes ocorre ge-
organizao do nucleossomo (H2A, H2B, H3 e H4). Esses
ralmente em pequenos agrupamentos, que se encontram
dois tipos de agrupamentos, organizados no genoma em
dispersos no genoma, embora possam, em alguns casos,
arranjos em tandem, ocorrem, por exemplo, em D. virilis
estar concentrados prximos a regies centromricas,
e na r Xenopus borealis.
como em S. pombe e C. elegans.
Em outros eucariotos, os genes para histonas esto
As menores quantidades de genes de tRNA so en-
organizados em agrupamentos com um nmero varivel
contradas nos genomas de algumas espcies unicelulares
de genes (podendo chegar a algumas dezenas), que esto
e parasitas, como E. cuniculi, com 46 genes de tRNA, e
dispersos pelo genoma e no formam arranjos em tandem.
de Trypanosoma brucei (Excavata), com 70 a 120 genes
No genoma do camundongo, por exemplo, h dois agru-
de tRNA, distribudos em pequenos agrupamentos de 2 a
pamentos, um no cromossomo 3 (com 10 genes) e um no
10 genes. Esses nmeros chegam a ser inferiores aos de
cromossomo 13 (com 45 genes), sendo que o agrupamento
muitos genomas procariticos, como o de E. coli, que tem
maior est dividido em 3 agrupamentos menores (um com
86 genes de tRNA. Um nmero maior de genes de tRNA
12, um com 15 e outro com 18 genes), separados entre si
encontrado nos genomas da grande maioria das outras
por aproximadamente 500 kb. Situaes similares ocor-
espcies, variando desde 186, em S. pombe, at mais de
rem tambm nos genomas de outros vertebrados, como a
12.000, no peixe D. rerio (zebrafish).
galinha (com 43 genes organizados em dois agrupamentos
Os genes de histonas tambm constituem uma fa- principais), e no de C. elegans, que possui 11 agrupamen-
mlia de genes repetidos tpica de genomas eucariticos. tos distribudos em diferentes cromossomos. No milho,

S. purpuratus
Figura 5.8
Organizao dos agrupamentos de genes
de histonas nos genomas de S. purpura- H1 H4 H2B H3 H2A
tus e D. melanogaster. Cada agrupamento
constitui uma unidade de repetio que inclui
cinco genes (em ), um para cada classe de
D. Melanogaster
histonas; as sequncias intergnicas esto re-
presentadas em . As setas indicam o sentido
da transcrio de cada um dos genes.
H1 H3 H4 H2A H2B

1 kb

Zaha_5ed_05.indd 98 27/11/13 09:21


99 Genes e Genomas Eucariticos
os mltiplos genes de histonas presentes no genoma no diversos tipos de elementos de sequncia importantes
formam agrupamentos e esto dispersos individualmente. para a fisiologia e para a evoluo dos genomas eucari-
ticos e no pode ser tratada como um mero componente
2.3.2 Sequncias intergnicas estrutural. A partir desse reconhecimento, foi proposto,
em 2001, que o antigo paradoxo do valor C vigente des-
As sequncias intergnicas so todas as sequncias
de a dcada de 1970 fosse substitudo pelo enigma do
genmicas que no estejam vinculadas diretamente a um
valor C, que engloba uma srie de questes referentes
gene. A delimitao dessas regies entre genes ou no
organizao e s funes dessas sequncias em genomas
gnicas pode ser principalmente complicada em geno-
eucariticos.
mas eucariticos, pois neles os limites fsicos dos genes
nem sempre so claros. So fatores complicadores as A Figura 5.9 mostra a composio de sequncias
extensas, complexas e heterogneas regies reguladoras gnicas e intergnicas do genoma humano. Essa compo-
dos genes (a maioria ainda no caracterizada), o grande sio pode ser considerada tpica de genomas eucariti-
nmero de ntrons e sua grande extenso (em especial, cos maiores, encontrados em eucariotos mais complexos,
em genomas de eucariotos mais complexos) e o recente e ilustra a heterogeneidade e a representatividade das se-
conhecimento de que muitas das regies antes tratadas quncias intergnicas. A seguir, sero discutidas as duas
como intergnicas podem ser alvo de transcrio. Assim, classes mais representativas de sequncias intergnicas
por simplificao, so em geral tratadas como interg- eucariticas a das sequncias repetidas simples e a dos
nicas todas as sequncias que no sejam parte de xons elementos transponveis.
ou ntrons de genes funcionais de estrutura tpica, como
a descrita na Seo 1.1. Essa simplificao util para as 2.3.2.1 Sequncias repetidas simples
anlises mais amplas do contedo de regies intergni- A frao intergnica de genomas eucariticos, princi-
cas, como a realizada neste captulo. palmente os de espcies mais complexas, apresenta um
grande nmero de sequncias curtas que podem estar
Grande parte do genoma da maioria das espcies repetidas de milhares a milhes de vezes. Elas so cha-
eucariticas formada por sequncias intergnicas. A madas, de forma geral, de sequncias repetidas sim-
quantidade dessas sequncias tende a aumentar propor-
ples e podem constituir uma frao significativa de um
cionalmente mais do que a quantidade de sequncias g-
genoma. Em mamferos, as sequncias repetidas simples
nicas nos genomas de eucariotos mais complexos, expli-
representam menos de 10% do genoma, mas em outras
cando o chamado paradoxo do valor C (ver Seo 2.1).
espcies, a representatividade dessas sequncias pode
Nos primeiros estudos, essa grande quantidade de DNA
chegar a quase 50%, como em D. virilis.
intergnico em genomas eucariticos maiores foi trata-
da como lixo genmico (do ingls, junk DNA), devido O tamanho da unidade de repetio de cada famlia
a sua natureza predominantemente repetitiva e por no de sequncias repetidas simples varia, e diferentes fam-
ter qualquer funo mais evidente. Hoje, contudo, se re- lias so encontradas nos genomas de diferentes espcies.
conhece que essa frao de genomas eucariticos inclui So mais comuns unidades de repetio de 5 a 10 pb, mas

Sequncias intergnicas Sequncias gnicas Figura 5.9


Composio de sequncias gni-
cas e intergnicas do genoma hu-
Outras sequncias ntrons (24%)
intergnicas mano. A frao gnica representada,
(25%) pelas sequncias transcritas (xons
e ntrons) de genes codificadores de
xons (1%) protenas. As regies intergnicas so
compostas pelas sequncias repetidas
simples, pelos elementos transponveis
Sequncias repetidas
simples (1%)
(transposons e retrotransposons) e por
Outros outras sequncias, incluindo pseudo-
retrotransposons Transposons (3%) genes.
(8%)
Retrotransposons
SINEs com LTRs (4%)
(13%) LINEs
(21%)

Retrotransposons sem LTRs

Zaha_5ed_05.indd 99 27/11/13 09:21


Biologia Molecular Bsica 100

muitas famlias com unidades de repetio maiores, com Quanto distribuio, os arranjos em tandem de
at mais de 300 pb tambm j foram identificadas, por uma determinada famlia de sequncias repetidas sim-
exemplo, em genomas de insetos, mamferos e vegetais ples podem estar tanto dispersos pelo genoma como
superiores. As unidades de repetio, em sua maioria, es- associados a regies especficas, tanto de eucromatina
to organizadas em vrios arranjos em tandem, cada um como de heterocromatina (ver Tabela 5.2). comum,
deles podendo chegar a dezenas ou centenas de quiloba- por exemplo, a associao de famlias de sequncias
ses de extenso. A Tabela 5.2 mostra alguns exemplos repetidas simples com regies especficas de cromos-
de DNA de sequncia simples que ocorrem em diferentes somos metafsicos, principalmente centrmeros e tel-
espcies eucariticas. meros. Isso acontece, por exemplo, com as sequncias
alfoides do homem e com o DNA-satlite telomrico de
Os arranjos em tandem de sequncias repetidas
D. virilis.
simples muitas vezes formam fraes do genoma com
contedo de G+C distinto do contedo da mdia do res- Em relao origem, acredita-se que as sequncias
tante do genoma. Por isso, essas sequncias eram isola- repetidas simples podem ter tido suas primeiras cpias
das de DNA genmico fragmentado (por ultrassom, p. originadas, a partir de eventos de transposio, que
ex.) em experimentos de sedimentao diferencial em duplicam os stios-alvo de insero do elemento mvel
gradientes de densidade. O gradiente ento separava (ver Captulo 9). Um nmero inicial dessas cpias, ge-
um componente (banda) principal, correspondente rado em espcies ancestrais, teria depois expandido, ao
frao gnica e a outros elementos de sequncia mais longo da evoluo, por meio de sucessivos eventos de
variados, e um ou mais componentes (famlias) adi- recombinao desigual (ver Captulo 8). Dentro de uma
cionais, de sequncias repetidas simples. Esses com- mesma famlia, as sequncias das unidades de repetio
ponentes adicionais recebiam o nome de satlites e, so muito conservadas. Entretanto, o nmero de unida-
por essa razo histrica, as sequncias repetidas sim- des de repetio presente em cada arranjo em tandem
ples tambm podem ser chamadas de DNA-satlite. bastante varivel, inclusive entre diferentes indivduos
Repeties ainda menores, de 2 ou 3 pb, so chamadas de uma mesma espcie. Essa variao resultado da
de microssatlites, sendo importante salientar que ocorrncia de recombinao desigual envolvendo tais
alguns microssatlites podem ocorrer inclusive dentro sequncias, durante divises meiticas que do origem
de xons e ntrons gnicos. aos gametas.

Tabela 5.2 Sequncias repetidas simples de DNA em diferentes espcies eucariticasa


Extenso da unidade Sequncia da unidade
Espcie de repetio (pb) de repetiob Localizao cromossmica

C. elegans (verme) 24 CeRep25B Dois agrupamentos em regies


eucromticas do cromossomo III
D. melanogaster (mosca) 359 359-bp repeat Heterocromatina do cromossomo X
D. virilis (mosca) 7 ACAAACT (satlite I) Centrmeros
7 ATAAACT (satlite II) Centrmeros
7 ACAAATT (satlite III) Centrmeros
370 Satlite telomrico Telmeros
Cancer borealis 2 AT n.d.
(crustceo)
Pagurus pollicaris 3 CAG n.d.
(crustceo) 4 CCTA n.d.
Cavia porcellus (roedor) 6 CCCTAA Centrmeros
Dipodomys ordii (roedor) 10 ACACAGCGGG Centrmeros
Cercopithecus aethiops 172 Sequncias Centrmeros
(primata)
H. sapiens (ser humano) 171 Sequncias alfoides Centrmeros
Hordeum vulgare 3 AAC Heterocromatina, Heterocromatina
(angiosperma) 3 AAG Centrmeros
3 ACG Eucromatina (cromossomos 2, 3, 4, 5 e 6)
3 ACT Heterocromatina
AGG Centrmeros
CAC Centrmeros (cromossomos 3 e 4)
CAG Heterocromatina (cromossomos 4 e 5)
CAT
a
Apenas um ou poucos exemplos das vrias famlias de sequncias repetidas simples de cada espcie so apresentadas.
b
Apenas as sequncias de unidades de repetio 10 pb so apresentadas; as sequncias maiores esto identificadas apenas pelo nome genrico da famlia.

Zaha_5ed_05.indd 100 27/11/13 09:21


101 Genes e Genomas Eucariticos
A expanso das sequncias repetidas simples em ge- possuem 4,5 kb e codificam sua prpria transposase (en-
nomas eucariticos ao longo da evoluo sugere presses zima que medeia a transposio, ver Captulo 9), ao passo
seletivas favorveis manuteno dessas repeties. que os elementos Ds so elementos Ac truncados, cuja
Essas presses podem decorrer de alguns papis impor- transposio depende de elementos Ac completos. De 5
tantes dessas sequncias na estruturao e no funciona- a 12 cpias de elementos Ac/Ds so encontradas no ge-
mento de cromossomos. Por exemplo, as sequncias e noma do milho, dependendo da linhagem. Os elementos
alfoides de primatas definem a estrutura dos centrme- P de Drosophila sp., por sua vez, tm um tamanho de 2,9
ros de modo a viabilizar a sua interao com microt- kb para cpias autnomas (para transposio), que, as-
bulos do fuso mittico ou meitico. Em D. virilis, a re- sim como os elementos Ac, codificam sua prpria trans-
combinao mediada por sequncias repetidas simples posase. Ocorrem tambm cpias truncadas, chamadas de
responsvel pelo alongamento e pela manuteno das elementos P no autnomos, dependentes de elementos
sequncias telomricas dos cromossomos. Alm disso, P autnomos para transposio. Em linhagens de moscas
a recombinao desigual proporcionada por sequncias portadoras do elemento P podem ser encontradas at 50
repetidas simples passvel de incluir sequncias adja- cpias do elemento P espalhadas em diferentes cromos-
centes s repeties e pode incrementar tambm de for- somos, com aproximadamente dois teros delas sendo
ma qualitativa a variabilidade gentica de uma espcie, no autnomas.
aumentando a sua adaptabilidade ao longo da evoluo.
Os retrotransposons, por sua vez, constituem a
Variaes em microssatlites so capazes de determinar
maioria dos elementos genticos mveis encontrados em
alteraes no nvel de expresso ou no produto de genes
genomas eucariticos e, consequentemente, representam
adjacentes, com efeitos fenotpicos evidentes. Exemplos
disso so as diversas doenas humanas, causadas por va- tambm a maior parte das sequncias intergnicas. Em
riaes no nmero de repeties em microssatlites as- comparaes intra e interfilticas, a quantidade de retro-
sociadas a certos genes. transposons est, pelo menos em linhas gerais, correla-
cionada com o tamanho do genoma, o que torna os re-
2.3.2.2 Elementos transponveis trotransposons os maiores responsveis pelo incremento
Os elementos transponveis so sequncias de DNA no tamanho dos genomas observado em eucariotos mais
capazes de se integrarem (por transposio) em outros complexos. No homem, por exemplo, eles constituem
lcus genmicos, o que, em geral, implica aumento do seu 56% das sequncias intergnicas e 42% de todo o genoma
nmero de cpias no genoma. Os elementos transponveis (ver Figura 5.9).
se dividem em dois grupos principais: o dos transposons Os retrotransposons so divididos em duas catego-
de DNA, que so mobilizados por meio de intermedirios rias principais, uma de retrotransposons contendo longas
de DNA, e o dos retrotransposons, cuja mobilizao se d repeties terminais (LTRs, de long terminal repeats),
por um mecanismo que envolve a transcrio reversa de que corresponde aos retrotransposons virais (semelhan-
um intermedirio de RNA (ver Captulo 9). tes a retrovrus), e outra de retrotransposons sem LTRs,
Na maioria das espcies eucariticas, os elementos que inclui os retrotransposons no virais.
transponveis constituem a maior parte do DNA inter- Os retrotransposons com LTRs variam em ta-
gnico e, em alguns casos, a maior parte do genoma. manho, de algumas centenas de pares de bases at mais
Entretanto, o contedo de elementos transponveis em
de 10 kb, com as LTRs tendo, em geral, de poucas cen-
genomas eucariticos pode variar desde a ausncia to-
tenas a alguns milhares de pares de bases de extenso.
tal, como no caso do genoma reduzido de E. cuniculi, at
Eles so encontrados dispersos nos genomas de todos
mais de 80%.
os eucariotos e so abundantes, por exemplo, em leve-
Os transposons de DNA representam, em geral, duras e em plantas superiores. Em S. cerevisiae, 377 kb
uma frao menor dos elementos transponveis eucari- ou 3,1% do genoma, composto por retrotransposons, o
ticos, em uma situao oposta observada em genomas que bastante significativo para um genoma compacto.
procariticos, em que os transposons so a classe princi- Na soja e no milho, eles constituem 42 e 70% do genoma,
pal. No homem, os transposons constituem 3% (90 Mb) respectivamente. Em mamferos, eles so menos comuns
do genoma, o que, ainda assim, 3 vezes o total de se- que os retrotransposons sem LTRs, embora tambm es-
quncias gnicas codificadoras (xons) (ver Figura 5.9). tejam presentes em nmero significativo. No homem, por
A maior parte dos transposons de mamferos acumulou exemplo, retrotransposons com LTRs constituem aproxi-
muitas mutaes ao longo da evoluo, de modo que madamente 4% do genoma.
improvvel haver qualquer um ainda ativo (funcional)
Os elementos Ty de S. cerevisiae com 6,3 kb, quando
nessa classe de vertebrados. O mesmo acontece entre
ntegros, formam 5 famlias (Ty1-5), totalizando um n-
plantas superiores, nas quais a frao do genoma ocupa-
mero de cpias (completas ou incompletas) que varia de
da por transposons fica entre 10 e 20%.
poucas dezenas at mais de 300, conforme a linhagem.
Duas das famlias de transposons eucariticas mais Na linhagem que primeiramente teve o genoma sequen-
conhecidas e com cpias ainda ativas so a dos elementos ciado, foram encontradas 331 cpias, sendo 217 de Ty1,
Ac/Ds, do milho, e a dos elementos P, de algumas esp- 34 de Ty2, 41 de Ty3, 32 de Ty4 e 7 de Ty5. Do total dos
cies de moscas do gnero Drosophila. Os elementos Ac elementos Ty presentes no genoma dessa linhagem, 85%

Zaha_5ed_05.indd 101 27/11/13 09:21


Biologia Molecular Bsica 102

correspondem a cpias truncadas. O elemento Grande, Em primatas, os SINEs mais abundantes so as chama-
por sua vez, um retrotransposon com LTR abundante das sequncias Alu, que se caracterizam por um alto grau
no genoma de espcies do gnero Zea, como o milho. de homologia (de at 80%) com o RNA 7SL e pela usual
Esse elemento deve o seu nome longa extenso que pos- presena de um stio de clivagem para a endonuclease de
sui, de 13,8 kb, ele tambm tem distribuio dispersa por restrio AluI. No homem, h em torno de 1,5 milho de
todos os cromossomos. O nmero de cpias de elemen- cpias de sequncias Alu, que representam 13% do ge-
tos Grande varia de 5.700 a 11.600 por genoma haploide, noma.
conforme a espcie ou linhagem e, em mdia, eles repre-
Um aspecto bastante interessante dos retrotranspo-
sentam 3% do genoma.
sons a capacidade que alguns deles possuem de mobili-
Os retrotransposons sem LTRs de genomas eu- zarem no s a si prprios, mas tambm outras sequn-
cariticos so representados por duas classes principais, cias, por retrotransposio (isto , transcrio reversa de
primariamente distinguidas pelos seus tamanhos. A pri- um RNA em DNA e integrao da cpia de DNA no geno-
meira constituda por elementos mais longos, com 6 a 7 ma). Por exemplo, LINEs da famlia L1 podem mobilizar
kb quando ntegros, chamados de LINEs (do ingls, long SINEs da famlia Alu. interessante considerar tambm
interspersed nuclear elements elementos nucleares o fato de que transcritos de mRNA maduros podem sofrer
longos dispersos). A segunda constituda por elementos o mesmo processo, de modo a terem suas sequncias in-
mais curtos, geralmente com 100 a 300 pb, chamados de tegradas ao genoma em diferentes stios (Figura 5.10).
SINEs (do ingls, short interspersed nuclear elements Essas sequncias so destitudas do promotor e de outras
elementos nucleares curtos dispersos). Como o prprio sequncias reguladoras da expresso original e, por isso,
nome de cada tipo de elemento indica, LINEs e SINEs so as cpias integradas no so em geral funcionais, cons-
encontrados como cpias dispersas ao longo de qualquer tituindo pseudogenes. Entretanto, como as sequncias
genoma onde eles ocorram. integradas sofrem splicing, para remoo de ntrons, e
Os LINEs, quando ntegros, codificam pelo menos adio de cauda de poli(A) (ver Captulo 11), elas clara-
uma transcriptase reversa e uma endonuclease (RNase). mente se distinguem dos pseudogenes parlogos, gerados
Na extremidade 3', eles contm uma cauda de poli(A), o a partir de cpias duplicadas (ver Seo 2.3.1.2), sendo
que evidencia a transcrio tpica pela RNA-polimerase II ento chamados de pseudogenes processados.
(ver Captulo 10), e a reintegrao do elemento no geno- Os pseudogenes processados foram at agora ob-
ma. Os LINEs so considerados ubquos em eucariotos, servados apenas em genomas de metazorios e de plan-
pois esto representados em protistas, fungos, inverte- tas angiospermas. Eles so abundantes em mamferos,
brados, vertebrados e vegetais, e provvel que sejam a mas menos comuns em outras espcies. Por exemplo,
classe (do ponto de vista evolutivo) mais antiga de retro- no genoma humano, estima-se que, do total de 20.000
transposons. Eles so abundantes em genomas de mam- pseudogenes, 8.000 sejam pseudogenes processados. O
feros, onde so reconhecidas mais de 10 famlias distin- genoma do camundongo, por sua vez, tem 14.000 pseu-
tas, cada uma constituda por milhares de membros. Por dogenes, dos quais 5.000 so pseudogenes processados.
exemplo, o genoma humano contm de 20.000 a 40.000 Em C. elegans e D. melanogaster, o nmero de pseudo-
LINEs, o correspondente a mais de 21% das suas sequn- -genes processados cai para 208 (2.200 pseudogenes no
cias. A famlia mais representativa de LINEs em mam- total) e 34 (110 pseudogenes no total), respectivamente.
feros chamada de LINE-1 (ou simplesmente L1), seus
membros representam 17% do genoma humano e 20% do A mobilidade dos elementos transponveis e o au-
genoma do camundongo. mento do nmero de cpias por recombinao desigual
explicam mecanisticamente a disseminao dessas se-
Os SINEs so elementos originrios da transcrio quncias em genomas eucariticos. Entretanto, o acmu-
reversa e da integrao entre algumas sequncias inicial- lo desses elementos em genomas eucariticos maiores,
mente transcritas pela RNA-polimerase III (ver Captulo em propores superiores da frao gnica, exige consi-
10), como tRNAs, rRNA de 5S ou RNA 7SL (componente deraes em termos funcionais e evolutivos. Na variao
da partcula de reconhecimento de sinal, um elemento
dos tamanhos dos genomas entre espcies eucariticas,
ribonucleoproteico que auxilia na secreo de polipept-
h uma evidente contribuio dos elementos transpon-
deos recm-sintetizados atravs das vesculas do retculo
veis. Em plantas, por exemplo, a proliferao ou a eli-
endoplasmtico). Os SINEs no codificam transcriptase
minao de elementos transponveis so, juntamente
reversa e dependem de outros retrotransposons, como os
poliploidizao, os principais fatores responsveis por
LINEs, para sua retrotransposio. Esses elementos so
variaes de tamanho de genoma em diferentes espcies.
abundantes em mamferos, mas pouco frequentes em ou-
A abundncia de elementos transponveis em um genoma
tros grupos taxonmicos, como em insetos e em plantas.
tambm um fator de desestabilizao, seja por eventos
Dentro de um mesmo grupo taxonmico, a presena de mobilizao frequentes ou por rearranjos cromoss-
de SINEs no genoma tambm pode ser bastante varivel. micos proporcionados por recombinao entre os ele-
Entre insetos, por exemplo, no h SINEs na poro se- mentos repetidos. Com isso, os elementos transponveis
quenciada (eucromatina) do genoma de D. melanogas- so uma fora importante para a rpida reestruturao de
ter, mas h vrias famlias distintas, algumas com mais genes e cromossomos e, consequentemente, para a evolu-
de 7.000 cpias, no genoma do mosquito Aedes aegypti. o de genomas eucariticos.

Zaha_5ed_05.indd 102 27/11/13 09:21


103 Genes e Genomas Eucariticos
Gene
ancestral Figura 5.10
Cromossomo P A origem de um pseudogene processado. Os pseudo-
genes processados so originados a partir de um transcrito de
pr-mRNA que normalmente processado. Na figura, as sequn-
Transcrio
cias gnicas esto representadas pelos xons (em ), ntrons
pr-mRNA (em ) e regies reguladoras (em ), com P indicando o promo-
tor. Por ao de enzimas codificadas por retrotransposons ou re-
Processamento trovrus, o mRNA processado transcrito reversamente (por uma
transcriptase reversa) em um DNA complementar, que depois
mRNA A(n) integrado no genoma (por uma integrase). Note que o pseudogene
processado no tem ntrons ou promotor, mas tem uma cauda de
Transcrio reversa poli(A), indicada por A(n).

DNA complementar A(n)

Integrao

Cromossomo A(n)

Pseudogene
processado

Os elementos transponveis podem alterar os pa- cleossomos, ao recrutamento de modificaes no DNA


dres de expresso de alguns genes ou at dar origem a (como a metilao), cromatina (como as modificaes
novos genes. Elementos transponveis ativos so agen- de histona) e delimitao de regies de heterocromatina
tes mutagnicos, e a sua insero em promotores ou em ou de eucromatina.
regies prximas pode levar a alteraes no padro de
expresso dos genes controlados por essas regies re-
guladoras. H elementos transponveis potencialmente
2.4 Sintenia
ativos em qualquer espcie, sendo que esses elementos A comparao da ordem dos genes nos genomas entre
so, por exemplo, responsveis por 10% das mutaes em diferentes espcies eucariticas revela nveis de sintenia
roedores. Alm disso, inseres em xons podem resultar significativos e sua preservao, pelo menos em parte,
na incorporao da sequncia do elemento transponvel mesmo ao longo de distncias evolutivas considerveis.
regio codificadora de uma protena, causando modi- As relaes de sintenia genmica so evidentes em pra-
ficaes estruturais e funcionais nos respectivos produtos ticamente todos os grupos taxonmicos eucariticos j
gnicos, e alguns mRNAs retrotranspostos podem ser in- analisados quanto a esse aspecto, mas os nveis de sinte-
seridos prximos a promotores e tornarem-se genes pro- nia variam em cada grupo. Entre insetos, por exemplo, h
cessados funcionais (retrogenes). possvel considerar sintenia de 99% entre genomas de diferentes espcies do
que, no genoma humano, de 50 a 100 genes codificadores gnero Drosophila, porm ela cai para apenas 10% quan-
de protena evoluram a partir de sequncias de transpo- do os genomas dessas moscas (ordem Diptera) so com-
sons ou retrotransposons. Por exemplo, o gene RAG1, que parados com o da abelha comum (Apis mellifera, ordem
medeia a recombinao das sequncias codificadoras de Hymenoptera). Entre vertebrados, parece haver uma
regies variveis de protenas do sistema imune, foi ori- maior conservao de sintenia, sendo evidente mesmo
ginalmente o gene de uma transposase de um elemento em comparaes de espcies mais distantes em termos de
transponvel em um ancestral de vertebrados. parentesco evolutivo. Por exemplo, quando se compara
os genomas do homem e da galinha, separados h 310
Por fim, os elementos transponveis podem ter tam-
milhes de anos, ou do homem e de peixes, como o zebra-
bm papis relevantes na estruturao dos cromossomos
-fish e o fugu (Takifugu niphobles), separados do homem
e na fisiologia da cromatina. Por exemplo, os telmeros
h 450 milhes de anos, podem ser detectados blocos
de cromossomos de moscas do gnero Drosophila so
sintnicos que variam de 1,8 Mb at 70 Mb de extenso.
mantidos por dois retrotransposons sem LTRs (Het-A e
Blocos sintnicos que se estendem ao longo de 90% dos
TART), que se retrotranspem especificamente para as
genomas so observados em comparaes entre o homem
extremidades dos cromossomos. Em um cenrio mais
e o camundongo, duas espcies de mamferos separadas
amplo, os elementos transponveis podem ser determi-
h menos tempo (91 milhes de anos).
nantes de processos epigenticos (que envolvem fatores
no genticos que alteram a expresso gnica). Isso Entre plantas, altos nveis de sintenia genmica j
evidenciado pela associao de sequncias de elementos foram evidenciados, por meio do alinhamento de marca-
transponveis, por exemplo, ao posicionamento de nu- dores genticos, entre espcies de diferentes gneros de

Zaha_5ed_05.indd 103 27/11/13 09:21


Biologia Molecular Bsica 104

uma mesma famlia. Comparaes de sequncias gen- dos de forma direta, sendo convertidos antes em mRNAs
micas completas evidenciam sintenia mesmo entre esp- monocistrnicos por trans-splicing (ver Captulo 11), e a
cies como o arroz (monocotilednia) e A. thaliana (dico- regulao da expresso gnica se d principalmente em
tilednia), separadas h 200 milhes de anos. Essas duas nvel ps-transcricional. A ocorrncia de perons em ge-
espcies mantm muitos blocos genmicos sintnicos, nomas de nematdeos, tambm marcante como no de
incluindo uma regio que abrange 119 genes. C. elegans, que tem aproximadamente 3.000 (15%) de
seus genes organizados em 1.000 unidades de transcrio
O grau de conservao sintnica, mesmo ao longo de
policistrnicas, cada uma delas incluindo de 2 a 8 genes.
distncias evolutivas da ordem de 100 milhes de anos
ou mais, demonstra que a perda de sintenia genmica em Em nematdeos, os transcritos policistrnicos tam-
eucariotos ocorre de forma mais lenta do que em proca- bm so processados por trans-splicing, embora, do pon-
riotos. certo que, em bactrias ou arqueas, quando o to de vista evolutivo, perons de nematdeos e de tripa-
grau de identidade global entre sequncias de aminoci- nossomatdeos no estejam relacionados entre si, assim
dos de duas espcies da ordem de 90%, j no se obser- como no esto relacionados aos perons procariticos.
va mais qualquer vestgio de sintenia, ao passo que em Casos mais pontuais de ocorrncia de perons tambm
eucariotos, a sintenia s se perde por completo quando foram descritos em espcies de celenterados, platelmin-
essa identidade de 50% ou menos. Isso faz com que, tos, insetos, cordados primitivos e plantas.
em eucariotos, blocos de sintenia possam ser observa-
dos mesmo quando so comparadas espcies de classes 2.5.2 Agrupamentos de genes funcionalmente
distintas (mamferos e peixes, p. ex.), ao passo que entre relacionados
procariotos, as sintenias s podem, em geral, ser obser-
O agrupamento eventual de parlogos durante a evolu-
vadas no mximo entre duas espcies diferentes de um
o de um genoma relativamente comum em eucario-
mesmo gnero. Uma provvel explicao para isso a
tos, pois as duplicaes de segmentos cromossmicos
acelerao da perda de sintenia por mecanismos deter-
parecem ser eventos recorrentes na histria evolutiva de
minantes de inverses pericntricas, os quais so muito
muitas linhagens eucariticas (ver Seo 3). Entretanto, a
ativos em procariotos (ver Captulo 4, Seo 2.6.3), mas
longo prazo em termos evolutivos, esses genes parlogos
no ocorrem em eucariotos.
mantm-se agrupados apenas se houver presso seletiva
para tanto. Caso contrrio, os parlogos se dispersam,
2.5 Agrupamentos organizados de genes como ocorre, por exemplo, com as famlias de genes de
actina (ver Material Complementar Online 5.3).
Como visto no Captulo 4 (Seo 2.4), podem ser iden-
tificadas em genomas de procariotos diversas unidades H, contudo, muitos casos de famlias multignicas
organizacionais envolvendo grupos de genes estrutural eucariticas cujos membros so mantidos agrupados em
e/ou funcionalmente relacionados, como perons, do- funo das vantagens funcionais proporcionadas por esse
mnios e ilhas genmicas. Em eucariotos, agrupamentos tipo de organizao. Exemplos marcantes disso so os
organizados de genes dessa ordem so mais escassos ou, agrupamentos de genes de globina de vertebrados e os
pelo menos, de identificao bem mais difcil, devido genes de fatores transcricionais hometicos (genes Hox)
natureza individualizada da regulao da expresso da de metazorios, cujos padres de expresso espacial e
grande maioria dos genes e aos maiores tamanho e com- temporal dependem da organizao de cada agrupamen-
plexidade dos genomas. Mesmo assim, alguns perons e to. Os genes de globina esto organizados em agrupa-
outros agrupamentos organizados podem ser reconheci- mentos e so expressos de maneiras diferentes ao longo
dos em genomas eucariticos e os principais tipos sero do desenvolvimento de vertebrados em eritrcitos (ver
descritos a seguir. Material Complementar Online 5.3). O padro de
expresso espacial (eritrcito-especfico) e temporal (es-
2.5.1 perons eucariticos tgio-especfico) de cada gene depende, pelo menos em
parte, de sua posio no agrupamento e da proximidade
Os genes eucariticos tpicos esto organizados em uni- relativa com elementos reguladores distais (discutidos no
dades de transcrio individuais, com cada gene sendo Captulo 14), como reforadores (do ingls, enhancers)
transcrito em um produto de RNA monocistrnico (ver ou regies controladoras de lcus (LCRs, do ingls locus
Seo 1.1). Portanto, ao contrrio do que ocorre em bac- control regions). Os genes Hox organizados em agrupa-
trias e arqueas (ver Captulo 4), menos comum em mentos, por sua vez, determinam o padro de diferen-
eucariotos a organizao em perons, com dois ou mais ciao anteroposterior em metazorios. A ordem desses
genes (ou regies codificadoras) sendo transcritos em um genes em cada agrupamento (que tm em geral de 4 a 10
nico RNA policistrnico. H, contudo, vrias excees genes, conforme a espcie e o agrupamento) corresponde
conhecidas, sendo o caso mais extremo o de eugleno- ordem temporal da expresso ao longo do desenvolvi-
zorios (Excavata) da ordem Kinetoplastida (incluindo mento do organismo e ordem espacial de expresso de
tripanossomatdeos), que tm a maioria de seus genes cada gene ao longo do eixo anteroposterior. Em outras
organizados em unidades de transcrio policistrnicas. palavras, genes Hox anteriores no agrupamento so ex-
Entretanto, ao contrrio do que acontece em perons pro- pressos primeiro e em posio mais anterior do corpo que
cariticos, os transcritos policistrnicos no so traduzi- os genes subsequentes (ver Captulo 15). Esse padro de

Zaha_5ed_05.indd 104 27/11/13 09:21


105 Genes e Genomas Eucariticos
expresso espao-temporal vinculado posio no agru- embora haja casos de agrupamentos de genes que codifi-
pamento regulado, pelo menos em parte, pelo silencia- cam enzimas de uma mesma rota metablica. A principal
mento seletivo de parte do agrupamento por compacta- justificativa do agrupamento parece ser mesmo o com-
o da cromatina. partilhamento de um mesmo padro de expresso.
H ainda muitos outros agrupamentos de genes fun- Independentemente da funo, genes coexpressos
cionalmente relacionados que viabilizam mecanismos agrupados no genoma de uma determinada espcie no
de gerao de variabilidade. Em genomas de vertebra- esto necessariamente agrupados, mesmo quando tam-
dos, so exemplos disso os agrupamentos dos genes que bm coexpressos, no genoma de outra espcie. Isso um
codificam os vrios componentes do sistema imune e indicativo de evoluo que independe dos padres de
os agrupamentos dos genes de receptores olfatrios. Os agrupamento em cada espcie, embora os mecanismos
agrupamentos dos genes do sistema imune viabilizam o que embasam a coexpresso devam ser comuns s dife-
mecanismo de recombinao que proporciona variabi- rentes espcies. Os mecanismos de regulao transcri-
lidade a anticorpos e imunorreceptores. Os milhares de cional associados ao fenmeno de agrupamento de genes
genes de receptores olfatrios, por sua vez, so organiza- coexpressos podem ser tanto de ordem local, envolvendo
dos em mltiplos agrupamentos, nos quais o nmero de promotores bidirecionais ou reforadores comuns, como
membros diferentes e o nmero de cpias de cada mem- globais, envolvendo alteraes estruturais na cromatina
bro podem variar de indivduo para indivduo. Essa varia- (ver Captulo 14).
bilidade, resultante dos eventos de duplicao e deleo
proporcionados pelo agrupamento dos genes similares,
responsvel pela evoluo dessa famlia e pela adaptao
do repertrio de receptores s necessidades olfatrias de 3. Dinmica evolutiva de
cada espcie.
genes e genomas nucleares
Em genomas de plantas, so exemplos de agrupa-
mentos de genes funcionalmente relacionados aqueles
eucariticos
de diferentes classes de genes que codificam resistncia 3.1 Evoluo dos genomas eucariticos
a patgenos (genes R). Muitos genes R esto organizados
em agrupamentos de vrios membros derivados de uma A linhagem evolutiva eucaritica descende de procario-
mesma famlia (parlogos), ou em agrupamentos nos tos do domnio Archaea e surgiu h cerca de 1,5 bilho
quais esto colocalizados vrios genes R de diferentes fa- de anos. Anlises genmicas comparativas sugerem que
mlias. O nmero de genes R em um agrupamento pode as arqueas primordiais deram origem a eucariotos, que
chegar a algumas dezenas, como no caso do agrupamen- no pertenceriam a qualquer dos dois principais filos de
to Rp1 do milho, que pode chegar a incluir 52 genes. Se- arqueas atuais (Euryarchaeota e Crenarchaeota), poden-
quncias gnicas e intergnicas repetidas em cada um dos do pertencer a um filo menor, inclusive j extinto. Alm
agrupamentos R proporcionam a ocorrncia de eventos disso, h evidncias de que outros procariotos ancestrais,
de recombinao desigual, podendo resultar em variaes ainda no bem definidos, tambm contriburam para o
no nmero de cpias e at na fuso de diferentes genes e repertrio gnico eucaritico por meio de eventos poste-
eventual formao de uma variante funcional. Isso mui- riores de transferncia gnica horizontal (ver Captulo 4).
to interessante do ponto de vista adaptativo e explica o Os eucariotos atuais podem ser divididos, do ponto
porqu desses genes serem mantidos em agrupamentos, de vista evolutivo, em dois grandes grupos: o dos euca-
apesar de poderem ser expressos independentemente. riotos unicelulares e o dos eucariotos multicelulares. A
maioria dos eucariotos unicelulares tem genomas que
2.5.3 Agrupamentos de genes coexpressos no conseguiram ultrapassar o chamado limiar de com-
Alm de perons e de agrupamentos de genes parlo- plexificao que permitiria a evoluo para formas mul-
ticelulares. Assim, eles ainda possuem genomas que, em
gos, ocorrem tambm em genomas de diferentes esp-
certos aspectos, lembram os de procariotos. Esses euca-
cies eucariticas agrupamentos de genes sem correlao
riotos permanecem com um nmero pequeno de genes,
funcional. As evidncias disponveis at agora sugerem
com regies intergnicas curtas, com um pequeno n-
que muitos genes individuais (que no fazem parte de
mero de elementos transponveis e outras sequncias
qualquer peron ou agrupamento de parlogos) podem
repetidas. Os genomas de eucariotos multicelulares, que
no ter uma distribuio aleatria no genoma, pois esto
ultrapassaram o limiar de complexificao, tm como ca-
posicionados, em geral, prximos a outros genes coex-
ractersticas principais a fixao de duplicaes e a proli-
pressos, isto , compartilhando um determinado padro
ferao de elementos transponveis, sendo essa ltima a
de expresso espacial ou temporal. Foi demonstrado, que
possvel responsvel pela maior parte do incremento de
em torno de 25% dos genes de S. cerevisiae, expressos no
tamanho nos genomas de eucariotos mais complexos.
mesmo estgio mittico do ciclo celular, esto agrupados
no genoma, isto , tm pelo menos um vizinho imedia- O papel evolutivo dos elementos transponveis teria
to no cromossomo expresso no mesmo estgio. No h, ido alm da mera contribuio para o aumento de tama-
contudo, uma correlao funcional mais evidente entre os nho na evoluo dos genomas eucariticos. possvel in-
genes nos agrupamentos identificados em cada espcie, clusive que eventos de especiao tenham sido, diversas

Zaha_5ed_05.indd 105 27/11/13 09:21


Biologia Molecular Bsica 106

vezes, desencadeados ao longo da evoluo em perodos nores, as quais tiveram grande impacto no aumento do
nos quais houve relaxamento no controle da mobilizao nmero de genes e no surgimento de famlias de genes
desses elementos em algumas linhagens eucariticas. parlogos. H um aumento da frao de genes em fam-
Isso teria ocorrido porque a transposio disseminada, lias (com a correspondente diminuio da frao de genes
em espaos de tempo evolutivo considerados curtos, leva- nicos) nos genomas medida que se avana na escala
ria ao rpido surgimento e divergncia de novas espcies. evolutiva. A expanso do nmero de famlias e do nme-
ro de genes em cada famlia foi um fator preponderante
Em genomas eucariticos, assim como nos proca-
para a diversificao e o aumento da complexidade de es-
riticos (ver Captulo 4), as expanses de tamanho fo-
truturas e processos em eucariotos ao longo da evoluo.
ram acompanhadas por um aumento do nvel de desor-
Por exemplo, diferentes grupos de famlias tiveram maior
ganizao (entropia). Essa maior entropia evidenciada
expanso nas linhagens evolutivas de leveduras, Droso-
pelo menor nmero de arranjos organizados de genes
phila sp. e mamferos.
que podem ser observados em eucariotos. Em sua maio-
ria, os genes ficam dispersos em meio a outras sequn- Em leveduras, as famlias de maior expanso foram
cias, o que mais exacerbado em genomas eucariticos as de genes de resposta a estresse, metabolismo e flocula-
maiores, onde as prprias caractersticas de repetio o; em espcies do gnero Drosophila, tiveram particu-
e mobilidade de boa parte das regies intergnicas fa- lar expanso as famlias de genes de resposta defensiva,
vorecem rearranjos estruturais e, consequentemente, a protelise e resposta a estmulos qumicos; e, em ma-
disperso gnica. mferos, dentre as famlias de maior expanso, esto as
de genes de resposta imune, desenvolvimento neuronal
A manuteno dos genes, como unidades funcio-
e transporte e comunicao intercelular. Nos roedores,
nais individualizadas, foi acompanhada pelo aumento
em particular, ocorreram dezenas de expanses locais em
da complexidade dos genes e seus produtos proteicos. A
famlias gnicas, envolvendo principalmente genes asso-
associao desses dois fatores viabilizou um aumento da
ciados reproduo, imunidade e ao olfato, o que suge-
complexidade estrutural e funcional de clulas e organis-
re que esses sistemas fisiolgicos foram o foco de maior
mos eucariticos. Genes codificando protenas multifun-
inovao evolutiva na linhagem. Seguindo essa lgica de
cionais, sendo independentemente regulados, podem ser
raciocnio, pode-se, a partir de uma avaliao da dinmi-
expressos em diferentes combinaes, locais e momen-
ca evolutiva de aquisio e expanso (por duplicao) ou
tos, permitindo a evoluo de relaes bioqumicas mais
perda e contrao (por deleo ou pseudogenizao) de
complexas e a diversificao de funes, passo funda-
famlias gnicas em diferentes linhagens evolutivas eu-
mental para o surgimento de organismos multicelulares,
cariticas, identificar aspectos importantes para o surgi-
com especializao de clulas e organizao de tecidos e
mento, a adaptao e a diversificao de cada linhagem.
rgos. Em procariotos, variaes combinatrias da ex-
presso gnica so limitadas, pelo menos at certo ponto,
pela corregulao de boa parte dos genes no contexto de 3.2 Evoluo dos genes interrompidos
perons.
Como mencionado, genes interrompidos tpicos, com
Apesar das vantagens oferecidas pela regulao indi- ntrons removidos por spliceossomo, so exclusivos de
vidual dos genes em organismos mais complexos, h ain- eucariotos, mas tanto bactrias como arqueas possuem,
da, em genomas eucariticos, muitos arranjos multi-g- embora com baixa frequncia, genes interrompidos por
nicos com algum tipo de coordenao funcional, inclusive ntrons capazes de autorremoo (ver Captulo 11). Alm
perons e agrupamentos de genes coexpressos ou com disso, em genomas de eucariotos, o nmero de genes in-
expresso coordenada. Comparaes genmicas, contu- terrompidos e o nmero mdio de ntrons por gene inter-
do, evidenciam que, em geral, esses arranjos no so con- rompido varia muito de espcie para espcie (ver Seo
servados por perodos evolutivos mais longos. Isso indica 1.2 e Material Complementar Online 5.2). A ocor-
que os arranjos genmicos mais complexos seriam, em rncia desses tipos diferentes de ntrons e a sua distribui-
sua maioria, produtos primrios de processos evoluti- o heterognea, observada em procariotos e eucariotos,
vos mais ou menos neutros (independentes de seleo), tornam controversa a questo sobre a origem evolutiva
como a simplificao genmica (discutidos no Captulos dos genes interrompidos. A origem dos ntrons eucariti-
4), estando as presses seletivas envolvidas apenas na cos discutida no Captulo 11.
modulao dos resultados desse processo. Os arranjos
Independentemente da origem, acredita-se que a
genmicos mais complexos seriam, ento, relativamente
estrutura de genes interrompidos e o seu processamento
efmeros, sendo formados de forma contnua, rearranja-
por splicing tenham contribudo muito para a evoluo
dos (podendo expandir ou contrair) e perdidos ao longo
de eucariotos. Isso aconteceu pelo surgimento de novas
de uma linhagem evolutiva. A expanso ou a perda de um
protenas, mais complexas, a partir de combinaes de
arranjo dependeria do equilbrio entre presses seletivas
xons codificadores de diferentes domnios estruturais
favorveis sua manuteno e de eventos desorganizado-
ou funcionais. O mais importante, ainda, teriam sido as
res aleatrios, como mutaes, recombinao e atividade
alternativas adicionais de regulao da expresso g-
de elementos transponveis.
nica. Sabe-se que, pelo menos em C. elegans, genes in-
A histria evolutiva eucaritica tambm no pode ser terrompidos, que devem sofrer splicing, so expressos
dissociada da ocorrncia de duplicaes maiores e me- em nveis mais elevados que verses sem ntrons dos

Zaha_5ed_05.indd 106 27/11/13 09:21


107 Genes e Genomas Eucariticos
mesmos genes e so inmeros os exemplos de regulao tocndrias, de mtDNA e, no dos plastdeos, de ptDNA
ps-transcricional da expresso que envolvem compo- (denominao utilizada para qualquer tipo de plastdeos
nentes do spliceossomo. O prprio splicing alternativo ou, s vezes, especificamente para plastdeos no fotos-
em geral no constitutivo, sendo as diferentes formas sintetizantes), ou cpDNA (denominao utilizada para
de mRNA maduro produzidas de maneira diferencial e plastdeos fotossintetizantes). importante salientar
controlada em diferentes tipos celulares ou tecidos, ou que o genoma o mesmo para todos os tipos diferentes
em diferentes momentos do desenvolvimento de um or- de plastdeos presentes em clulas de uma determina-
ganismo (ver Captulo 11). da espcie vegetal. Alm do fato de serem geralmente
circulares, os genomas das organelas possuem outras
semelhanas com os genomas procariticos: so peque-
nos, contm genes que codificam funes relacionadas,
4. Genomas de organelas organizados em perons e muitas das protenas por eles
codificadas (como as protenas ribossmicas) so mais
Mitocndrias e plastdeos so organelas que apresen- similares s protenas correspondentes de bactrias do
tam genomas prprios, que diferem tanto em estrutura que s codificadas por genomas nucleares eucariticos.
como em composio gnica dos genomas nucleares eu- Essas semelhanas so explicadas pela origem endos-
cariticos. Esses genomas so chamados de genomas simbintica dessas organelas.
extranucleares e contm essencialmente um elenco de
genes relacionado s funes de cada organela, centradas O repertrio gnico de genomas de mitocndrias e
na sntese de ATP como fonte de energia; no caso de mi- plastdeos hoje deficiente, produzindo apenas uma fra-
tocndrias, na fixao de dixido de carbono atmosfrico o menor das protenas necessrias biognese e ao fun-
em compostos orgnicos s expensas de luz solar; no caso cionamento dessas organelas. Isso ocorre porque, duran-
de cloroplastos, que so plastdeos fotossintetizantes e te a evoluo tanto de mitocndrias como de plastdeos,
na sntese e/ou armazenamento de pigmentos, amido, li- muitos genes foram transferidos horizontalmente, para o
pdeos ou protenas; e no caso de plastdeos no fotossin- ncleo da clula hospedeira em eventos de transfern-
tetizantes (cromoplastos, amiloplastos, elaioplas- cia gnica endossimbintica, ou perdidos. Assim,
tos e proteoplastos, respectivamente). na biognese de novas mitocndrias e plastdeos (que
acontece a partir da diviso de organelas pr-existentes),
A presena de genomas prprios resqucio da ori- a grande maioria das protenas necessrias codificada
gem evolutiva dessas organelas. Mitocndrias e plas- pelo genoma nuclear e importada para as organelas de-
tdeos evoluram a partir de bactrias que foram inter- pois da sntese em ribossomos citoslicos.
nalizadas, inicialmente como endossimbiontes, em
Os processos de replicao de genomas de organelas
clulas eucariticas ancestrais. A identidade das bactrias
e de expresso (transcrio e traduo) de seus genes so
envolvidas pode ser inferida a partir de estudos compa-
autnomos, isto , ocorrem nas prprias organelas. En-
rativos entre genomas de organelas e genomas bacteria-
tretanto, apesar das protenas que medeiam esses proces-
nos. As mitocndrias descendem de bactrias da classe
sos genticos serem exclusivas das organelas, a maioria
-proteobactria (filo Proteobacteria), embora o momen-
delas tambm codificada pelo genoma nuclear.
to da evoluo eucaritica no qual isso ocorreu ainda seja
controverso. A partir do reconhecimento recente de que Apesar das semelhanas ditadas pela origem endos-
todos os eucariotos atuais possuem mitocndrias (ou, simbintica das organelas, os genomas de mitocndrias e
pelo menos, algum tipo de organela delas derivada, como plastdeos tm algumas caractersticas distintas, que vo
hidrogenossomos ou mitossomos), acredita-se que alm dos seus repertrios gnicos especializados. Alm
o evento de endossimbiose, que deu origem s mitocn- disso, o nmero de cpias, o tamanho e a composio g-
drias atuais, se deu em uma clula eucaritica ancestral nica dos genomas de cada tipo de organela podem variar
de todos os grupos eucariticos atuais. muito de espcie para espcie, como demonstrado pelo
sequenciamento e por anlises comparativas de genomas
Os plastdeos, por sua vez, originaram-se de uma
organelares. At outubro de 2010, 2.253 genomas mi-
bactria do filo Cyanobacteria, primeiramente de vida
tocondriais e 186 genomas de plastdeos j haviam sido
livre, e sua clula hospedeira inicial foi a de um euca-
completamente sequenciados. Dados atualizados sobre o
rioto no fotossintetizante, com ncleo, citoesqueleto e
sequenciamento de novos genomas organelares podem ser
mitocndria(s). provavel que a clula hospedeira eu-
obtidos a partir de pginas institucionais especializadas na
caritica primordial foi um ancestral comum de algas
internet, algumas das quais so referenciadas na Seo de
verdes, vermelhas e glaucfitas (supergrupo Plantae).
Leituras recomendadas ou no Material Complementar
Eventos de endossimbiose secundrios e tercirios, entre
Online 5.5. A seguir, sero discutidas as principais carac-
eucariotos, explicariam a disseminao atual dos plast-
tersticas dos genomas de mitocndrias e plastdeos.
deos em linhagens de outros trs supergrupos de eucario-
tos (Chromalveolata, Excavata e Rhizaria).
Do ponto de vista estrutural, os genomas de orga-
4.1 Genomas mitocondriais
nelas so constitudos por molculas de DNA de fita Mitocndrias so organelas que, em geral, possuem ge-
dupla, em geral circulares, chamadas, no caso das mi- nomas prprios, havendo at agora, apenas um caso des-

Zaha_5ed_05.indd 107 27/11/13 09:21


Biologia Molecular Bsica 108

crito o de Cryptosporidium parvum (Apicomplexa; Al- um mtDNA de 86 kb. Os mtDNAs de leveduras e outros
veolata) de mitocndria sem genoma. Esse caso, assim micro-organismos, maiores que os de quaisquer meta-
como os de hidrogenossomos e de mitossomos, que so zorios, demonstram no haver correlao direta entre
organelas relacionadas, mas caracteristicamente sem ge- o tamanho do genoma mitocondrial e a complexidade da
nomas, so decorrentes da degenerao dessas organelas espcie. Isso acontece porque as diferenas de tamanho
durante a evoluo. dos genomas mitocondriais entre espcies muitas vezes
se devem presena ou no de ntrons nos genes e/ou
Os genomas das mitocndrias tpicas so formados
por um cromossomo circular nico. H, contudo, exce- s extenses das regies intergnicas. Por exemplo, boa
es, como genomas mitocondriais constitudos por mais parte da diferena de tamanho entre os mtDNAs de S.
de um cromossomo ou por um cromossomo linear. Por cerevisiae e humano se deve presena, no primeiro, de
exemplo, o fungo Spizellomyces punctatus (Chytridio- um nmero considervel de ntrons (de tipo removvel
mycota) tem seu mtDNA na forma de 3 cromossomos por auto-splicing; ver Captulo 11), que esto ausentes
distintos, e o fungo P. jiroveci (carinii) (Dikarya) tem um no segundo. J no caso das plantas, o grande tamanho
mtDNA linear. Normalmente, h vrias cpias do geno- dos mtDNAs em comparao com os de animais, fungos
ma em cada mitocndria, alm de haver muitas mitocn- e microrganismos explicado, principalmente, pelo ac-
drias por clula, podendo chegar a 1.000 ou 2.000 em mulo de sequncias repetidas curtas e, at, de sequn-
alguns casos, como em hepatcitos de mamferos. Isso cias de cpDNA. Nas regies intergnicas de genomas
determina que, apesar dos genes mitocondriais serem de mitocondriais maiores tambm podem ser encontrados
cpia nica no genoma, todo o mtDNA seja parte da fra- pseudogenes.
o de DNA repetitivo da clula. O contedo gnico dos genomas mitocondriais va-
Os tamanhos dos genomas mitocondriais podem rivel, pois o nmero de protenas e RNAs codificados
variar muito de espcie para espcie. Os maiores so en- pode ser diferente em cada espcie e no est diretamente
contrados em plantas angiospermas, com tamanhos que correlacionado com o tamanho do genoma mitocondrial.
oscilam entre 220 kb a 2,9 Mb, dependendo da espcie. Assim, enquanto o mtDNA humano, com seus 16,5 kb,
Entre metazorios, os genomas mitocondriais so me- codifica 13 protenas (ver Figura 5.11), o de S. cerevisiae,
nores, tendo tamanhos entre 11 kb (no rotfero Brachio- com 86 kb, codifica 8. Alm disso, esto presentes, em ge-
nus plicatilis) e 24 kb (no placozorio Trichoplax adha- ral, 2 ou 3 genes de rRNA e um nmero bastante varivel
erens). O genoma mtDNA humano, por exemplo, tem de genes de tRNA, que pode ir de 0 at 2 ou 3 dezenas,
16,6 kb (Figura 5.11). Entre fungos, os extremos de ta- dependendo da espcie. No mtDNA humano, alm de 2
manho at agora conhecidos so os dos mtDNAs dos Di- rRNAs (de 12S e de 16S, o primeiro para a subunidade
karia Hanseniaspora uvarum (18 kb) e Moniliophthora menor e outro para a subunidade maior de ribossomos
perniciosa (109 kb), com a levedura S. cerevisiae tendo mitocondriais) e de 13 protenas componentes do aparato

OH
Figura 5.11 Ala em "D"
Phe
O genoma mitocondrial humano. Cada uma das fitas do Thr
12S
mtDNA humano circular, com 16.569 pb, codifica um conjun- Val
OH Cytb
to diferente de genes. A chamada fita H (de heavy = pesada),
representada pelo crculo externo, codifica 12 protenas, 14 16S Pro Fita H
tRNAs e 2 rRNAs. A outra fita, chamada de fita L (de light = Glu
leve), representada pelo crculo interno, codifica apenas uma Leu ND6
protena e 8 tRNAs. Os genes que codificam protenas esto
representados em e regies de sobreposio entre eles ND1 ND5
esto representadas em . Aproximadamente 60% da capa-
cidade do mtDNA humano utilizada na codificao de sete lle
F-met Gin Leu
subunidades da enzima NADH-Q-redutase (genes ND1, 2, 3, Ser
4, 4L, 5 e 6), o primeiro de trs complexos bombeadores de ND2 Ala His
prtons da membrana mitocondrial interna; so codificadas Asn
Fita L
Cys
tambm uma subunidade da citocromo-redutase (gene Cytb), ND4
Trp Tyr
as trs subunidades da citocromo-oxidase (genes CO1, 2 e 3)
OL ND4L
e as duas subunidades da ATP-sintetase (genes ATPase6 e 8). Ser
As posies dos genes de tRNAs e dos genes que codificam os Fita L
CO1 Arg
rRNAs de 16S e de 12S esto assinaladas por crculos e barras Gly ND3
em , respectivamente. OH e OL designam as origens de re- Asp CO3
plicao das fitas H e L. A regio de formao da ala em D, CO2 Lys ATPase6
estrutura importante para o incio do processo de replicao, ATPase8
est assinalada.

Zaha_5ed_05.indd 108 27/11/13 09:21


109 Genes e Genomas Eucariticos
da cadeia respiratria, so codificados 22 tRNAs, o mni- (transcrio e traduo). O nmero de genes no ptDNA
mo necessrio para a traduo de todos os seus cdons. ou no cpDNA oscila entre 80 e 200, conforme a espcie.
Um nmero em torno de 80 genes codificadores de pro-
Um aspecto interessante da codificao de protenas
tenas comum ser encontrado no cpDNA de plantas su-
em genomas mitocondriais de muitas espcies, desde leve-
periores (angiospermas e gimnospermas), ao passo que
duras at seres humanos, a utilizao de cdigos gen-
cpDNAs com aproximadamente 220 genes codificadores
ticos alternativos, distintos do nuclear (ver Captulo 12).
de protenas so comuns entre algas vermelhas (Rhodo-
Isso demanda tRNAs especficos para a traduo de deter-
phyta; Plantae). O nmero de protenas codificadas, con-
minados cdons nas protenas por eles codificadas. Alm
tudo, pode variar desde apenas 25, no cpDNA de Epifa-
disso, so considerados frequentes em mitocndrias even-
gus virginiana (angiosperma dicotilednea), at 273, no
tos de processamento ps-transcricional de RNAs, como a
cpDNA de Pinus koraiensis (gimnosperma).
editorao de RNA e o trans-splicing (ver Captulo 11).
Um nmero muito superior de genes codificadores
A editorao de RNA, envolvendo mRNAs ou tRNAs,
de protenas (867) encontrado na organela fotossinteti-
j foi descrita em mitocndrias de plantas, mamferos e
zante de Paulinella chromatophora (Cercozoa; Rhizaria),
de alguns outros organismos, como Acanthamoeba cas-
que tem um genoma de pouco mais de 1 Mb. Contudo,
tellani (Amoebozoa), Physarum polycephalum (Myce-
esse tipo de organela, chamado de cromatforo, teve
tozoa; Amoebozoa) e tripanossomatdeos (Euglenozoa;
origem em um evento de endossimbiose primria inde-
Excavata). Os mecanismos de editorao em cada um dos
pendente e mais recente do que o que deu origem aos
casos so distintos, o que tido como evidncia de aqui-
plastdeos tpicos.
sio recente e independente em cada grupo taxonmico.
Genes mitocondriais interrompidos tambm podem ser A quantidade de protenas codificada nos genomas
processados por trans-splicing. O mecanismo de trans- de plastdeos representa apenas uma frao menor do
-splicing envolve xons individuais, flanqueados a mon- nmero total de protenas de cada organela, que, no caso
tante e a jusante por sequncias intrnicas, que so trans- de cloroplastos de plantas de 2.000 a 5.000. Essencial-
critos independentemente e depois unidos. mente, as protenas codificadas podem ser divididas em
duas categorias. A primeira a de protenas relacionadas
s funes especficas da organela, que, no caso de cloro-
4.2 Genomas de plastdeos plastos, inclui diferentes subunidades dos quatro comple-
Todos os plastdeos at hoje estudados contm seu pr- xos envolvidos na fotossntese e do complexo da NADH-
prio genoma. Os genomas de plastdeos tpicos so circu- -desidrogenase. A segunda a de protenas relacionadas
lares e formados por um nico cromossomo, cujo nmero expresso gnica (transcrio e traduo) da organela,
de cpias por organela pode variar de algumas dezenas que inclui uma RNA-polimerase e, em geral, mais de duas
at pelo menos 1.000. Em plantas superiores, o nme- dezenas de protenas ribossmicas. So tipicamente codi-
ro de cpias do ptDNA ou cpDNA por organela maior ficados pelo ptDNA ou pelo cpDNA de 2 a 4 rRNAs e um
em clulas com diviso mais ativa (que tm menos plas- repertrio de 22 a 50 tRNAs.
tdeos) e menor em clulas maduras, que se dividem com
Em genomas de plastdeos comum a presena de
menor frequncia (e que em geral acumulam um maior
genes interrompidos por ntrons. A representatividade
nmero de plastdeos).
dos ntrons em ptDNAs ou cpDNAs, em termos da exten-
Os genomas de plastdeos so maiores e contm mais so que ocupam ou em nmero de genes interrompidos,
genes que os genomas mitocondriais. Quanto ao tama- varia de espcie para espcie. O tipo dos ntrons encon-
nho, os genomas de plastdeos possuem, em sua maioria, trados so de procariotos (removidos por auto-splicing) e
entre 100 e 200 kb, mas podem variar desde pouco me- ocorrem tanto em genes codificadores de protenas como
nos de 35 kb, como no caso de apicoplastos, que so em genes codificadores de tRNAs.
plastdeos especializados de protistas do filo Apicomple-
Ao contrrio do que acontece em muitos genomas
xa (Chromalveolata), at mais de 420 kb, como no caso de
mitocondriais, os mRNAs codificados por genomas de
cloroplastos da alga Volvox carteri (Chrorophyta; Plan-
plastdeos so traduzidos de acordo com o cdigo ge-
tae). O tamanho de genomas de plastdeos, assim como
ntico universal. Na expresso dos genes de plastdeos,
acontece no caso do mtDNA, no tem correspondncia
contudo, ocorrem, assim como em mitocndrias, eventos
direta com a complexidade da espcie, pois boa parte
de editorao de RNAs e de trans-splicing. Esses dois
das sequncias de genomas, principalmente as grandes,
tipos de processamento ps-transcricional so bastante
no so gnicas. No cpDNA de V. carteri, por exemplo,
comuns em plastdeos de praticamente qualquer espcie,
apenas 24% das sequncias correspondem a genes, e 80%
estando o trans-splicing, porm, ausente em apicoplastos
das regies intergnicas (61% de todo o genoma) so for-
de espcies do filo Apicomplexa e em plastdeos de esp-
madas por sequncias repetidas curtas.
cies de Cercozoa (Rhizaria). Os mecanismos moleculares
O repertrio gnico dos genomas de plastdeos de- dos eventos de editorao de RNA e de trans-splicing de
dicado fotossntese, a alguns outros aspectos do meta- plastdeos so os mesmos dos eventos correspondentes
bolismo dessas organelas e tambm expresso gnica que ocorrem em mitocndrias de algas e plantas.

Zaha_5ed_05.indd 109 27/11/13 09:21


Biologia Molecular Bsica 110

Resumo
Os eucariotos so organismos cujas clulas so com- de genes parlogos podem formar agrupamentos com
partimentalizadas em organelas. Os genomas nuclea- expresso coordenada e muitos genes no relaciona-
res eucariticos so constitudos por vrios cromosso- dos quanto a sua funo, mas que so coexpressos,
mos, cada um deles formado por uma nica molcula tambm se encontram agrupados.
de DNA linear. Genomas eucariticos so, em geral,
A frao intergnica de genomas eucariticos ,
muito maiores que os procariticos, mas h desde ge-
em sua maioria, formada por sequncias repetidas,
nomas com menos de 3 Mb (menores que os de diver-
que podem ser sequncias repetidas simples, mais
sos procariotos), at genomas com mais de 100.000
curtas e com maior nvel de repetio, ou ainda, ele-
Mb de extenso, dependendo da espcie. Os genes de
mentos transponveis, que podem ser transposons ou
eucariotos so tipicamente interrompidos por ntrons.
retrotransposons ativos ou inativos. Essas sequncias
Espcies mais simples tm uma frequncia menor de
repetidas podem ter funes importantes para a estru-
genes com ntrons, mas eles so predominantes em ge-
turao e o funcionamento dos cromossomos e desem-
nomas de espcies mais complexas. Boa parte dos ge-
penharam um papel vital como elementos geradores
nes em um genoma eucaritico pertence a famlias de
de variabilidade genmica ao longo da evoluo dos
parlogos, cujo nmero e tamanho tendem a aumen-
eucariotos. Mitocndrias e plastdeos so organelas
tar em espcies mais complexas.
que possuem genomas prprios, com caractersticas
O nmero de genes e o tamanho dos genomas similares s de genomas procariticos, devido ori-
no aumentam, necessariamente, de maneira propor- gem endossimbintica. Os repertrios gnicos dos ge-
cional ao aumento de complexidade das espcies eu- nomas de mitocndrias e plastdeos esto associados
cariticas. Isso acontece porque, em eucariotos mais s funes especficas de cada organela. Muitos dos
complexos, a maior parte dos genes pode dar origem genes necessrios ao funcionamento de mitocndrias
a vrios produtos proteicos por processamento alter- ou plastdeos, contudo, esto no genoma nuclear, pois,
nativo e porque a maior parte de seus genomas cons- em algum momento durante a evoluo, foram trans-
tituda por sequncias intergnicas. Algumas famlias feridos horizontalmente das organelas para o ncleo.

Leituras recomendadas
Archibald JM. The puzzle of plastid evolution. Curr Biol. Koonin EV. Evolution of genome architecture. Int J Biochem
2009;19(2):R81-8. Cell Biol. 2009;41(2): 298-306.
Demuth JP, Hahn MW. The life and death of gene families. Michalak P. Coexpression, coregulation, and cofunctionality
Bioessays. 2009;31(1):29-39. of neighboring genes in eukaryotic genomes. Genomics.
2008;91(3):243-8.
Embley TM, Martin W. Eukaryotic evolution, changes and
challenges. Nature. 2006;440(7084):623-30. National Center for Biotechnology Information. Entrez
Genome Project: eukaryotic genomes sequencing projects
Gingeras TR. Origin of phenotypes: genes and transcripts.
[Internet]. [capturado 23 ago. 2011]. Disponvel em: http://
Genome Res. 2007;17(6):682-90.
www.ncbi.nlm.nih.gov/genomes/leuks.cgi.
Jurka J, Kapitonov VV, Kohany O, Jurka MV. Repetitive
National Center for Biotechnology Information. Organelle
sequences in complex genomes: structure and evolution.
Genome Resources [Internet]. [capturado 23 ago. 2011].
Annu Rev Genomics Hum Genet. 2007;8:241-59.
Disponvel em: http://www.ncbi.nlm.nih. gov/genomes/
Kim E, Magen A, Ast G. Different levels of alternative GenomesHome.cgi?taxid52759&hopt5html.
splicing among eukaryotes. Nucleic Acids Res.
2007;35(1):125-31.

Zaha_5ed_05.indd 110 27/11/13 09:21


Captulo 6

Irene Silveira Schrank

Replicao do DNA

1. Replicao unidirecional e 5. Dinmica da replicao: Escherichia coli


bidirecional 113 como modelo 125

2. Protenas envolvidas na replicao 113 6. Trmino da replicao 126


2.1. DNA-polimerases 113 6.1 Genomas circulares 126
2.2 Outras protenas presentes no 6.2 Genomas lineares 127
replissomo 115 6.2.1 Telmeros e telomerase 128
2.3 Sntese das fitas contnua e descontnua do 6.2.2 Sistemas iniciadores
DNA 115 alternativos 129
2.4 Estrutura das DNA-polimerases 117
7. Sistemas de replicao por crculo
3. Replicao no contexto da cromatina rolante 130
eucaritica 119

4. Origem da replicao 120


4.1 Caractersticas das origens da replicao 120
4.2 Ciclo celular e origem da replicao 124

Zaha_5ed_06.indd 111