The Laryngoscope

C 2016 The American Laryngological,

V
Rhinological and Otological Society, Inc.

Current Molecular Profile of Juvenile Nasopharyngeal Angiofibroma:

First Comprehensive Study From India

Praveen Pandey, PhD; Anupam Mishra, MBBS, MS, DNB, DCP (NIH); Ashoak Mani Tripathi, MBBS;
Veerendra Verma, MBBS, MS; Ritu Trivedi, PhD; Hitendra Prakash Singh, MBBS, MS;
Sunil Kumar, MBBS, MS; Brijesh Patel, MBBS; Vinay Singh, MBBS; Shivani Pandey, PhD;
Amita Pandey, MBBS, MS, DM; Subhash Chandra Mishra, MBBS, MS, DLO

Objective: An attempt is made to analyze the molecular behavior of juvenile nasopharyngeal angiofibroma (JNA).
Study Design: Case Series
Methods: Quantification of mRNAs expression was undertaken through real-time polymerase chain reaction in JNA
(924) samples for VEGF-A, basic fibroblast growth factor (b-FGF), platelet-derived growth factor PDGF-A, KIT proto-oncogene
receptor tyrosine kinase (c-Kit), Avian myelomatosis viral oncogene homolog (c-Myc), Harvey rat sarcoma viral oncogene
homolog (H-Ras), tumor suppressor gene TP53, and androgen receptor and interleukin 6 (IL-6). The b-catenin expression
was evaluated by western blot in 16 samples. Nasal polyp was taken as control.
Results: A significantly increased (P < 0.01) expression of c-myc, VEGFA, bFGF, PDGFA, c-kit, and TP53 was seen, along
with enhanced expression of b-catenin. A massive enhancement of H-Ras expression was seen for the first time. Androgen
receptor expression was no different, whereas IL-6 despite showing upregulation trend was not significant.
Conclusion: The enhanced expressions of various markers suggest their potential role in JNA. Although the biological
significance of c-kit, c-myc, and one of the novel markers H-Ras has yet to be defined, their significant expression may have a
therapeutic importance.
Key Words: Juvenile nasopharyngeal angiofibroma, beta catenin, c-Kit, c-Myc, VEGF, FGF, PDGF, Ras, AR, IL-6, p53.
Level of Evidence: NA.
Laryngoscope, 00:000000, 2016

INTRODUCTION shown wide variations. A better knowledge of molecular

Juvenile nasopharyngeal angiofibroma (JNA) consti-
tutes about 0.5% of all head and neck tumors. Our center
has been one of the largest contributors of JNA across the
globe1 and has witnessed four-fold increase in incidence in
current decade.2 The literature suggests a wide variation
in clinical parameters and etiopathogenesis. Although
putative histopathogenesis of JNA has been reported,3
molecular data from India is grossly lacking as only a sin-
gle study of glutathione S-transferase (GST)M1 has been
published.4 Despite the fact that many small molecular
studies have been reported across the world, a consensus
has not been achieved. Moreover, molecular behaviour has
Additional supporting information may be found in the online
version of this article.
From the Department of Otorhinolaryngology (AM, AMT, VV, BP, VS,
HPS, SK)., the Department of Biochemistry (SP).; the Department of Clini-
cal Genetics (AP)., King George Medical University; and the Biochemistry
and Endocrinology Divisions (PP, RT)., Central Drug Research Institute,
Lucknow, India Department of Otolaryngology, Nepalgunj Medical Col-
lege Nepal (SCM).
Editors Note: This Manuscript was accepted for publication July
25, 2016.
The authors have no funding, financial relationships, or conflicts
of interest to disclose.
Send correspondence to Dr. Anupam Mishra, Professor, Depart-
ment of Otorhinolaryngology K.G.M.U., A-1/19, sector H, Aliganj, Luck-
now (UP) India. E-mail: amishra_ent@yahoo.com
DOI: 10.1002/lary.26250
variations across the globe and their correlation may help
in 1) predicting clinical parameters, 2) explaining the
changing incidence, 3) providing greater insight of subcel-
lular mechanisms, and thereby 4) redefining molecular
targets in different contexts.
The current literature reflects the majority of stud-
ies on one to three markers at a timeand on a sample
of less than 10. Hence, it may be possible for these stud-
ies to have missed out on the expressions of other poten-
tial markers being instrumental. With an aim to further
strengthen the evidence in the context of evaluating the
integrative interaction of multiple molecular factors
operating at a time in a single cohort of patients, we pre-
sent a report of 10 molecular markers operating simulta-
neously in one particular population, North India.
MATERIALS AND METHODS
This study is based on analysis of tissue (JNA) samples
obtained from the Department of Otorhinolaryngology, King
George Medical University (KGMU), in Lucknow, India, as a
part of three consecutive Masters thesis projects that were ethi-
cally approved by the institutional review board (IRB) of
KGMU. After surgery, a tissue sample from a central core of
specimen was obtained for molecular processing. These samples
were 1) snap-frozen and transported in aluminium foil (for esti-
mation of beta catenin), or they were 2) stored at minus 80-
degree centigrade in RNA litter (for estimation of KIT proto-
oncogene receptor tyrosine kinase (c-Kit), Avian myelomatosis

Laryngoscope 00: Month 2016 Pandey et al.: Current Molecular Status of JNA
1
 TABLE I.
Primers Used for Markers.
Serial No Gene Primer Sequence 8C Amplicon Size

1 VEGFA Forward primer: 50 GGGGCAAAAACGAAAGCGCA 30 588C 75 bp

2 bFGF
3 PDGFA
4 H-RAS
5 P53
6 C-KIT
7 C-MYC
8 b-Actin
9 IL-6
10 AR
Reverse primer: 50 ATTAGACAGCAGCGGGCACC 30
Forward primer: 50 GCTGGTGATGGGAGTTGTATTT 30 528C 118 bp
Reverse Primer: 50 CTGCCGCCTAAAGCCATATT 30
Forward primer: 50 GCAAGACCAGGACGGTCATTT 30 558C 135 bp
Reverse primer: 50 GGCACTTGACACTGCTCGT 300
Forward primer: 50 GGAAGCAGGTGGTCATTGAT 30 528C 134 bp
Reverse primer: 50 GTTGATGGCAAACACACACAG 30
Forward primer: 50 CCTCACCATCATCACACTGG 30 528C 287 bp
Reverse primer: 50 CCTCATTCAGCTCTCGGAAC 30
Forward primer: 50 TGACTTACGACAGGCTCGTG 30 568C 327 bp
Reverse primer: 50 AAGGAGTGAACAGGGTGTGG 30
Forward primer: 50 GATCCAGACTCTGACCTTTTGC 30 588C 102 bp
Reverse primer: 50 CACCAGCAGCGACTCTGA 30
Forward primer: 50 GGCATCCTCACCCTGAAGTA 30 NA 114 bp
Reverse primer: 50 AGGGCATACCCCTCGTAGAT 30
Forward primer: 50 TACCCCCAGGAGAAGATTCC 30 558C 199 bp
Reverse primer: 50 TGGATGGGCAACTGATGTGA 30
Forward primer: 50 CCTGGCTTCCGCAACTTACAC 30 558C 168 bp
Reverse primer: 50 GGACTTGTGCATGCGGTACTCA 30

viral oncogene homolog (c-Myc), VEGFA, basic fibroblast
growth factor [bFGF], platelet-derived growth factor [PDGFA],
Harvey rat sarcoma viral oncogene homolog (H-Ras), androgen
receptor [AR], interleukin 6 (IL-6) and tumor suppressor gene
p53). After initial processing, the molecular analysis was under-
taken at Central Drug Research Institute (CDRI), Lucknow,
India, in two different laboratories. The expression of beta-
catenin was estimated in 16 samples by western blot method,
while in second laboratory at CDRI, a comparative expression
profiling of m-RNA through real-time polymerase chain reaction
(RT-PCR) was undertaken for other markers. The number of
samples analyzed for other markers (VEGF, b-FGF, PDGF, H-
RAS, p-53, C-Kit, C-Myc, AR and IL-6) ranged from nine to 24
(Appendix). The number of control samples ranging from four to
10 (Appendix) were obtained from young (< 20 years old) male
patients of nasal polyposis managed in our facility.
The selection of specific molecular markers was based on
existing literature on JNA and related tumors showing fibrosis/
high vasculature with an aim to analyze the molecular spec-
trum comprising cytokines, oncogenes, tumor-suppressor genes,
and hormonal markers. Interleukin 6 was specially selected to
investigate the inflammatory status; thus, for this unreported
marker the sample size was enhanced for a better significance.
Similarly, considering the conflicting role of AR, a larger sample
size was undertaken. The primers used are depicted in Table I.
The protocol for estimating beta catenin expression
through western blot is described elsewhere.5 The expression of
the other molecular markers was estimated by RT-PCR analysis
following RNA extraction as under:
RNA extraction. Approximately 100 mg of each tissue sam-
ple, as mentioned above, was homogenized using Kimble Kontes
Disposable Pellet Pestles (Sigma Aldrich, St. Louis, MO). Total
RNA was extracted with Trizol reagent (Invitrogen, Carlsbad,
CA) as per standard protocol. The quality of the isolated RNA
was determined by running an aliquot of the RNA sample on a
denaturing agarose gel (1.5%) stained with ethidium bromide to
see 28S and 18S rRNA bands. Five micrograms of total RNA
was subjected to reverse transcription using Moloney murine
leukemia virus reverse transcriptase (Invitrogen) at 42 8C for 1
hour. The reaction for synthesis of first strand cDNA was
primed with random hexamer primer.
RT-PCR. Real-time PCR was performed on the Roche
LightCycler480 by using FastStart SYBR Green Master (Roche,
Basel, Switzerland) according to the manufacturers specifica-
tion. The primer sequences for the study genes are mentioned
in Table I. In general, the conditions for the PCR reaction con-
sisted of: 1) initial denaturation at 95 8C for 10 seconds; 2)
denaturation at 94 8C for 30 seconds; 3) annealing for 30 sec-
onds at respective temperatures, as mentioned in Table I; fol-
lowed by 4) extension at 72 8C for 1 minute. Steps 2 to 4 were
repeated for 40 cycles before the reaction was stopped with a
final extension step at 72 8C for 10 minutes. The amplification
was performed in duplicate for each reaction, and the results
were normalized to the actin gene expression level.
Analysis of RT-PCR data. Firstly, the reaction condition
for each set of genes was standardized by running the reaction
in gradient PCR. Results were confirmed by selecting condition
yielding single band after running the PCR product at 1.5%
agarose gel. Subsequently, the marker studies through RT-PCR
were considered. A differential Critical threshold (CT) value
was obtained for each marker, and then double-delta CT
(ddCT) value was calculated for every observation. Subsequent-
ly, the power of analysis (2 ddCT) was calculated for each val-
ue of expression, followed by average of power to estimate the
variation in expression. Finally, the fold action (or fold activa-
tion) was calculated for each sample expression and the aver-
age of which (i.e., fold average) was used in the whisker-plot
charts for every marker separately. Sigma Plot software (Systat
software Inc. San Jose CA) was used for all the statistical
analysis, including comparison of mean expression of marker
with control. The fold average values are depicted in the
Appendix.

Laryngoscope 00: Month 2016 Pandey et al.: Current Molecular Status of JNA
2
Fig. 1. Optimization of PCR condition
with primer sets for indicated genes.
Total RNA was isolated; reverse-
transcribed; and cDNAs were PCR-
amplified using gene-specific primers.
Reactions represented with single band
were considered for subsequent studies
in RTPCR.
PCR 5 polymerase chain reaction; RT-
PCR 5 real-time polymerase chain
reaction.
The literature was searched for the implications of various
molecular markers in JNA and compared with our observations.
Observation
A unique molecular behavior was observed. The western
blot revealed an overall up-regulation of b-catenin in 69% only.
The clinical correlation is described elsewhere,5 but noteworthy
was that all the postadolescent cases revealed absent expression,
whereas those JNAs showing facial disfiguration revealed
enhanced expression of beta-catenin.
Molecular analyses of expression of mRNA through RT-
PCR. Figure 1 depicts optimization of PCR condition with
primer sets for indicated genes. Total RNA was isolated, reverse-
transcribed, and then cDNAs were PCR-amplified using gene-
specific primers. Reactions represented with single bands were
considered for subsequent studies in RT-PCR.
Figure 2A through 2I depicts box-and-whisker plots for
different molecular markers (c-Kit, c-Myc, VEGFA, bFGF,
PDGFA, H-RAS, IL-6, AR, p53) showing their expression (fold
activation) in JNA and control samples. The upper/lower quar-
tiles and mean (fold average) are depicted, along with outliers
for each and every marker. The mean expression of cases and
controls are compared, and the level of significance is depicted
in the respective blocks. This study revealed the most outstand-
ing expression of H-RAS (Fig. 2I) with 105-fold increase (mean
expression of samples 5 0.9254 vs. mean expression of controls
5 0.0000086; P < 0.001). Although yet unreported, it is worth
mentioning that the experiment was repeated thrice. Among
the established markers, the most significant up-regulation was
appreciated for VEGF-A (Fig. 2A) with a 3,339-fold increase
(mean expression of control 5 1; P < 0.001) from baseline con-
trol. The second was bFGF (Fig. 2B), which revealed a 136-fold
increase (mean expression of control 5 1; P < 0.001). Platelet-
derived growth factor-A (PDGFA) was the third (Fig. 2C), with
a 31.23-fold increase (mean expression of control 5 1; P <
0.001). Thereafter, other markers that revealed a significant
increase in expression were c-MYC (10.84-fold increase; mean
expression of control 5 1; P < 0.002), C-KIT (6.63-fold increase;
mean expression of samples 5 0.004812 vs. mean expression of
controls 5 0.0007258; P < 0.033), and p53 (3.19-fold increase;
Laryngoscope 00: Month 2016
mean expression of controls 5 1; P < 0.001) (Figs. 2E, 2F, 2D).
The expression of AR was overall increased in JNA (1.36-fold)
as compared to controls but did not show significance (mean
expression of samples 5 1.5958 vs. mean expression of controls
5 1.17217; P < 0.8) (Fig. 2G). Similarly, although increased
expression of IL-6 (4.71-fold) was noted but did not achieve sig-
nificance (mean expression of samples 5 5.7202 vs. mean
expression of controls 5 1.2133; P < 0.3) (Fig. 2H; the whisker
plot was prepared using median value for this marker).
Whereas fold change cutoff of > 2 in the mean mRNA
expression for related gene from the control suggested a statisti-
cal significance of enhanced expression, there was a very wide
variation in expressions. For example, a two- to 10-fold increase
of the mean level of expression was appreciated for c-MYC, c-
KIT, and p53; a 30-plus fold increase for PDGF-A; and a 130-
plusfold increase for bFGFwhereas there was a still robust
fold change for VEGF-A and H-Ras as compared to control.
Because the control samples were nasal polyps, the associated
allergic inflammation may have raised the baseline of proin-
flammatory marker (IL-6) expression in controls, thereby fur-
ther decreasing the possibility of revealing significant difference
between JNA and controls. The presence of a few (23) outliers
may suggest a relatively consistent range of expression in the
majority of samples.
DISCUSSION
The world literature on current molecular status of
JNA reflects only 58 markers, the majority being
reported through a single study only. Countries such as
India with maximum incidence are poorest contributors
to the literature. This study is first of its kind, and
especially from India, that harbors maximum burden of
JNA across the world.1,2 Apart from the significant up-
regulation of established markers (VEGFA, bFGF,
PDGFA, c-MYC, C-KIT, p53), this study did not express
any significance for AR. Moreover, the two novel
markers studied, including H-Ras, revealed a 105-fold
significant increase in expression and IL-6, which
did not show significance despite a generalized
Pandey et al.: Current Molecular Status of JNA
3
Fig. 2. Box-and-whisker plots (A-I) representing the expression of several genetic markers (assessed by RT-PCR) in the subjects groups of
the study. The results are expressed as relative fold changes of each gene after normalization. Whiskers represent median, minimum, and
maximum values for particular groups. Each box represents extremities, the median value (line within the box), and the lowest and the high-
est values (bottom and top bars of the whisker). The results were statistically analyzed using Mann-Whitneys U test (P < 0.05). Histograms
(H,L) showing fold increase in m-RNA of AR and IL-6.
AR 5 androgen receptor; RT-PCR 5 real-time polymerase chain reaction.

enhancement. It is noteworthy that these (H-Ras and
IL-6) have not yet been reported. In addition, an
enhanced western-blot expression of beta-catenin was
also noted. The strength of the current study is firstly
due to the fact that 10 markers have been studied in a
single large cohort of JNA patients, and secondly
because the conclusions are based on the m-RNA
expression, this reflects their real expression and not
just their relative concentrations, as suggested by
immunohistochemistry.
It can be speculated that the changing molecular
expression/mechanism may account for the changing
incidence/clinical pattern of JNA. For example, the AR
expression has not shown a significant enhancement in
the current era (as compared to the past), and neither is
our population restricted to pure adolescent age group
these days. The enhancement of Ras may contribute to a
changing aggression of JNA these days, whereas specific
clinical phenotypes5 associated with beta-catenin may
also be applicable in global context.
Although no study to date has investigated 10
markers in a single cohort, this is still insufficient to
establish the molecular epidemiology. This study is fur-
ther limited by sample size, which although it exceeds
other studies still could have been more. The main rea-
son for the limitations in the number of markers and
samples are constraints in infrastructure/funding. Fur-
thermore, RT-PCR could not be carried out for beta-
catenin; whereas selection of inflammatory controls pos-
sibly masked the significance of IL-6. With such an evi-
dent (wide) variation in molecular expression, a still
larger sample size needs to be analyzed for a better

Laryngoscope 00: Month 2016 Pandey et al.: Current Molecular Status of JNA
4
conclusion. The detailed clinical-molecular correlation
for every marker is beyond the scope on this article and
will be published subsequently.
However, it is worth summarizing some interesting
observations arising out of the clinical-molecular correla-
tion. A comparison of the two extremes of molecular
expressions (of a particular marker) can likely character-
ize a specific clinical phenotype associated with enhanced
(or under-) expression. For example, clinical phenotypes of
beta-catenin expression have already been mentioned.5
Similarly, the higher FGF expression has been seen in
postadolescents and associated with enhanced intraopera-
tive bleeding, recurrence, and smaller tumor size. Con-
trastingly, the lower FGF expression has shown a
tendency for lateral extension. A higher c-Kit expression
was seen in adolescents with a shorter duration of illness
and revealed a tendency of rapid growth involving the
skull base, with potential to recur. However, no clearly
demarcated clinical phenotypes could be defined with c-
myc expression. Despite this, the higher Ras expression
was appreciated in postadolescents, with a tendency for
involvement of the skull base and a potential for recur-
rence despite smaller tumor size. The higher p53 and
PDGF expressions were seen with adolescents presenting
early with rapid progression. The severity of hemorrhage
did not correlate with the pattern of p53 expression, but
advanced stage was associated with a higher expression.
A large-sized tumor or enhanced hemorrhage alone did
not correlate with an aggressive molecular expression of
PDGF. The higher VEGF expression was seen in postado-
lescents with prolonged duration of symptoms. A tendency
to involve skull base with enhanced intraoperative bleed-
ing, reflecting enhanced angiogenesis and potent bone
invasive propensity, characterized this subgroup. The
reader is encouraged to read the elaborate descriptions of
clinical-molecular correlation for each and every marker
elsewhere in due course.
The remaining discussion summarizes the world lit-
erature and compares our observations in context of
these 10 studied markers.
AR: The predominance in adolescent males had sug-
gested the implication of sex hormone in etiopathogenesis
69
and was further supported by the presence of sex hor-
mone receptors in tumor tissue.915 A general consensus
for its influence on the development of JNA has been rec-
ognized,6,1417 whereas a recent report18 of a recurrence
20 years after excision in a 36-year-old patient on testos-
terone supplement therapy supports the same. However
relatively late despite the concurrence of other hormonal
disorders, a wide variability in expression of AR in the
tissue, and with no significant alterations in serum hor-
mone levels,11,14 the exact nature of hormonal influence
on JNA has become controversial.69,1115,19 The current
study also did not reveal a significant up-regulation of
AR despite the controls obtained predominantly from ado-
lescent males. The extremes of age as seen at our facility
are 8 and 26 years. Hence, with a transition of predomi-
nant AR expression, as of earlier times to insignificant
enhancement in the current era, a changing pattern of
AR in etiopathogenesis seems likely.
Laryngoscope 00: Month 2016
VEGF, bFGF, and PDGF: VEGF is a well-known
proangiogenic growth factor in JNA,20 showing stronger
expression in recurrent cases.21 In the current study,
VEGF seems to be the most potent proangiogenic factor.
The proangiogenic factors in benign tumors lead to vessel
growth with minimal impact on tumor growth22,23;
accordingly, VEGF may result in high-vessel densities
rather than large or aggressive JNA. The association of
increased levels of other potent proangiogenic factors
such as bFGF, transforming growth factor-b1 (TGFb1),
and VEGF receptor-2 with high-vessel densities in JNA
has been demonstrated.24 The bFGF involved in angio-
genesis/tissue development25 has been implicated in
JNA.24,26 Our observations reveal bFGF as the second
potent proangiogenic factor. As postulated,20 the vascular-
ization may be promoted by angiogenic factors under the
stimulation of androgens through an autocrine mecha-
nism. Thus, apart from VEGF, bFGF and TGFb1 may
also be involved.26,27 With insignificant enhancement, the
role of AR may not be significant in our population.
Hence in Indian patients, bFGF may be specifically
involved in synergism with VEGF. Only a single study24
has investigated these two factors simultaneously and
has reported their enhanced expression in JNA. The role
of PDGF is suggested by a single study28 that revealed
overexpression of PDGF-B mRNA in 50% of JNA sam-
ples. Our JNA population also seems to depend on PDGF,
but its role in angiogenesis may be little.
C-MYC and C-KIT: The C-Myc oncogene is reported
to show a potent angiogenic activity and induces fibro-
blasts to build up an immature vascular network.29
Whereas one study could not find any differences between
the expression of c-myc in normal and 25 JNA cases,28
the other study using RT-PCR found c-myc mRNA over-
expression in three of seven JNAs and loss of c-myc gene
in seven cases with florescence in-situ hybridization
(FISH) analysis.30 In contrast to the majority of published
studies, our population has revealed a significant increase
(11-fold). Although a close crosstalk between c-myc, AR,
and b-catenin is known in carcinogenesis, our results do
not suggest the same. However, implication of c-kit in
JNA is suggested by only one of the two studies. Whereas
a strong immunohistochemical expression of c-kit in the
stromal cells of JNA samples has been demonstrated,31
another study could not find any expression.32
RAS and TP53: No evidence suggests the role of
H-RAS gene in JNA, with only a single study in 28
JNAs using Polymerase chain reaction-Single-strand
conformation polymorphism (PCR-SSCP) and DNA
sequencing refuting any such association.33 Ras has an
important role in normal signal transduction and cell
growth.34 The most significantly enhanced expression of
H-ras makes our population molecularly different but
needs further validation. However, two studies have
reported the occurrence of genetic alterations of p53 in
JNA. Whereas one observed increased mRNA expression
in 32%,28 the other found losses of p53 gene in five of
seven cases without mutations.35 Although p53 is usual-
ly down-regulated in cancer, its up-regulation in this
study may reflect the effect of oncogenic stress in order
Pandey et al.: Current Molecular Status of JNA
5
to enhance expression of its target genes. Future studies
are thus needed.
b-CATENIN: The genetic evidence of JNA as an
integral FAP (familial adematous polyposis) tumor with
mutation in APC gene has been reported.36 However,
none of our patients was known to have FAP, whereas
one study has also refuted this association.37 Its associa-
tion in Indian population seems restricted to only a sub-
set of JNA, as opposed to the majority of sporadic JNA
in Western literature. The b-catenin is known to func-
tion as AR coactivator protein, and hence may be of rele-
vance in adolescent males.38 Accordingly, the absent
expression in this study points toward the other domi-
nant factors (apart from androgens) being instrumental
in postadolescent age group.
A total of about 60 molecular markers have been stud-
ied in JNA to date, but the majority of them are yet to be
validated. A complete review of all the markers is beyond
the scope of this article; the reader is encouraged to read
another publication entitled Variations in Molecular
Expressions of Juvenile Nasopharyngeal Angiofibroma in
this regard.39 However, a brief mention is presented. Among
those better studied, the TGFb121,24,27,28 and IGF IIR28
have been implicated in JNA. TGFb1 has been implicated in
JNA for vessel growth24 and has been demonstrated in stro-
mal cell nuclei/cytoplasm24; however, no difference between
TGFb1 mRNA expression in JNA and normal tissue was
seen28 despite the fact that its protein localization in endo-
thelial cells and fibroblasts suggested a probable implication
in fibrogenesis. Although IGF-II R has been found to be
enhanced in 53% of JNAs,28 IGF-1R did not reveal any
expression.31 Coutinho-Camillo et al.40 also have suggested
the implication of alterations in the IGFII/H19 imprinted
region in pathogenesis of JNA. Among the less validated
markers, a 100% positivity has been appreciated for
PCNA,21 which has been further confirmed in yet another
study.41 Among the nonvalidated markers of JNA, the nerve
growth factor expression in fibroblast and endothelial cells
suggests a contribution toward vascular proliferation.31
Similarly, c-fos showed enhancement in 14% of JNA sam-
ples.28 The GSTs have revealed absent expression in three
of eight samples,4 whereas multiple combinations of various
genetic polymorphisms of GSTs have been suggested in rele-
vance to high risk of JNA.42
A few potential markers that apparently appear
important need mention regarding their insignificance
in pathogenesis. A strong expression of BMP-4 and
TGFb3 has been demonstrated in JNA but was not sig-
nificantly (statistically) different from nasal polyps.31
Similarly, although amplifications of the Her-2/neu onco-
gene have been reported for several tumors,43 no such
evidence has been demonstrated in seven JNA samples
through FISH analysis.38 Also, no immunohistochemical
expression of p130Cas could be appreciated in JNAs.31
Finally, GSTM -1, GLUT-1, and podoplanin expressions
in JNA are not yet conclusive.
CONCLUSION
The role of AR seems to disappear in the context of
modern JNA, whereas H-Ras has emerged as a potent
Laryngoscope 00: Month 2016
6
marker in our population. Beta-catenin has revealed an
association with specific JNA subsets. Similarly, the major-
ity of markers seem to predict a particular clinical pheno-
type, which needs to be further established with a larger
sample size. The addition of microarray to define up-
regulation and down-regulation of genes in juvenile naso-
pharyngeal angiofibroma will further increase the validity
and quality of data. The literature reflects many markers
that have been investigated through a single study only,
with no further validation. Many other potential markers
have been highlighted for their negative significance in
pathogenesis, whereas still others have revealed their
inconclusive expression. Overall, the molecular status of
JNA is still in its infancy. Unless the literature expands
with proper validation, the molecular epidemiology of JNA
remains a distant goal.
Acknowledgment
The authors would like to acknowledge foremost Dr. Jay-
ant Sarkar for his guidance and also Ms. Pooja Nayak and
Mr. Shashi Kant Kumar from CDRI for their valuable con-
tributions in the laboratory.
The study is based on the thesis of V.S., A.M.T., and B.P. for
Masters in Otorhinolaryngology thesis projects under the
chief supervision of A.M.. Ethical permission was obtained
from IRB of KGMU in Lucknow, India.
BIBLIOGRAPHY
1. Chew CT. Nasopharynx (the postnasal space). In: Kerr AG, Groves J, eds.
Scott Browns Otolaryngology: Vol IV Rhinology. 5th ed. Oxford, UK:
Butterworth-Heinemann; 1987
2. Mishra A, Mishra SC. Changing trends in the incidence of juvenile naso-
pharyngeal angiofibroma: seven decades of experience at King Georges
Medical University, Lucknow, India. J Laryngol Otol 2016;130:363368.
doi:10.1017/S0022215116000268.
3. Mishra SC. Putative histogenesis of post nasal angtofibroma. Indian J
Otolaryngol Head Neck Surg 2000;52:118121. doi: 10.1007/
BF03000326.
4. Gautham K, Ogale SB, Shraddha RU, Ajay D. Expression of GSTM1 in
angiofibromas. J Laryngol Otol 2002;116:352354.
5. Mishra A, Singh V, Verma V, et al. Current Status & Clinical correlation
of Beta-Catenin in Juvenile nasopharyngeal Angiofibroma. J Laryngol
Otol 2016. In Press
6. Schiff M. Juvenile nasopharyngeal angiofibroma. Laryngoscope 1959;69:
9811016.
7. Martin H, Ehrlich HE, Abels JC. Juvenile nasopharyngeal angiofibroma.
Ann Surg 1948;127:513536.
8. Johnsen S, Kloster JH, Schiff M. The action of hormones on juvenile naso-
pharyngeal angiofibroma. Acta Otolaryngol 1966;61:153160.
9. Johns ME, MacLeod RM, Cantrell RW. Estrogen receptors in nasopharyn-
geal angiofibromas. Laryngoscope 1980;90:628634.
10. Antonelli AR, Cappiello J, Donajo CA, Di Lorenzo D, Nicolai P, Orlandini
A. Diagnosis, staging and treatment of juvenile nasopharyngeal angiofi-
broma (JNA). Laryngoscope 1987;97:13191325.
11. Farag MM, Ghanimah SE, Ragaie A, Saleem TH. Hormonal receptors in
juvenile nasopharyngeal angiofibroma. Laryngoscope 1987;97:208211.
12. Gatalica Z. Immunohistochemical analysis of steroid hormone receptors in
nasopharyngeal angiofibromas. Cancer Lett 1998;127:8993.
13. Hwang HC, Mills SE, Patterson K, Gown AM. Expression of androgen
receptors in nasopharyngeal angiofibroma: an immunohistochemical
study of 24 cases. Mod Pathol 1998;11:11221126.
14. Lee DA, Rao BR, Meyer JS, Prioleau PG, Bauer WC. Hormonal receptor
determination in juvenile nasopharyngeal angiofibromas. Cancer 1980;
46:547551.
15. Brentani MM, Butugan O, Oshima CTF, Torloni H, Paiva LJ. Multiple steroid
receptors in nasopharyngeal angiofibromas. Laryngoscope 1989;99:398401.
16. Kumagami H. Testosterone and estradiol in juvenile nasopharyngeal
angiofibroma tissue. Acta Otolaryngol 1991;111:569573.
17. Kumagami H. Sex hormones in juvenile nasopharyngeal angiofibroma tis-
sue. Auris Nasus Larynx 1993;20:131135.
18. Riggs S, Orlandi RR. Juvenile nasopharyngeal angiofibroma recurrence
associated with exogenous testosterone therapy. Head Neck 2010;32:
812815. doi: 10.1002/hed.21152.
19. Kuttner K, Katekamp D, Stiller D. Hormone therapy of the juvenile angio-
fibroma. Arch Otorhinolaryngol 1977;214:331338.
Pandey et al.: Current Molecular Status of JNA
20. Brieger J, Wierzbicka M, Sokolov M, Roth Y, Szyfter W, Mann WJ. Vessel
density, proliferation and immunolocalization of vascular endothelial
growth factor in juvenile nasopharyngeal angiofibromas. Arch Otolar-
yngol Head Neck Surg 2004;130:727731.
21. Saylam G, Yucel OT, Sungur A, Onerci M. Proliferation, angiogenesis and
hormonal markers in juvenile nasopharyngeal angiofibroma. Int J
Pediatr Otorhinolaryngol 2006;70:227234.
22. Arbiser ZK, Arbiser JL, Cohen C, et al. Neuroendocrine lung tumors:
grade correlates with proliferation but not angiogenesis. Mod Pathol
2001;14:11951199.
23. Juric G, Zarkovic N, Nola M, et al. The value of cell proliferation and
angiogenesis in the prognostic assessment of ovarian granulosa cell
tumors. Tumori 2001;87:4753.
24. Schuon R, Brieger J, Heinrich UR, Roth Y, Szyfter W, Mann WJ. Immuno-
histochemical analysis of growth mechanisms in juvenile angiofibroma.
Eur Arch Otorhinolaryngol 2007;264:389394.
25. Russell PJ, Bennett S, Stricker P. Growth factor involvement in progres-
sion of prostate cancer. Clin Chem 1998;44:705723.
26. Schiff M, Gonzalez A, Ong M, Baird A. Juvenile nasopharyngeal angiofi-
broma contain an angiogenic growth factor: basic FGF. Laryngoscope
1992;102:940945.
27. Dillard DG, Cohen C, Muller S, et al. Immunolocalization of activated
transforming growth factor beta1 in juvenile nasopharyngeal angiofi-
broma. Arch Otolaryngol Head Neck Surg 2000;126:723725.
28. Nagai MA, Butugan O, Logullo A, Brentani MM. Expression of growth fac-
tors, protooncogenes and p53 in nasopharyngeal angiofibromas. Laryn-
goscope 1996;106:190195.
29. Pelengaris S, Khan M, Evan G. c-MYC: more than just a matter of life
and death. Nat Rev Cancer 2002;2:764776.
30. Schick B, Wemmert S, Jung V, Steuder W, Montenarh M, Urbschat S.
Genetic heterogeneity of MYC oncogene in advanced juvenile angiofibro-
mas. Cancer Genet Cytogenet 2006;164:2531.
31. Zhang PJ, Weber R, Liang H, Pasha TL, LiVolsi VA. Growth factors and
receptors in juvenile nasopharyngeal angiofibroma and nasal polyps.
Arch Pathol Lab Med 2003;127:14801484.
Laryngoscope 00: Month 2016
32. Pauli J, Gundelach R, Vanelli-Rees A, et al. Juvenile nasopharyngeal
angiofibroma: an immunohistochemical characterisation of the stromal
cell. Pathology 2008;40:396400. doi: 10.1080/00313020802035857.
33. Coutinho CM, Bassini AS, Gutierrez LG, et al. Genetic alterations in Ki-
ras and Ha-ras genes in juvenile nasopharyngeal angiofibromas and
head and neck cancer. Sao Paulo Med J 1999;117:113120.
34. Bos JL. Ras oncogenes in human cancer: a review. Cancer Res 1989;49:
46824689.
35. Schick B, Veldung B, Wemmert S, et al. p53 and Her-2/neu in juvenile
angiofibromas. Oncol Rep 2005;13:453457.
36. Valanzano R, Curia MC, Aceto G, et al. Genetic evidence that juvenile
nasopharyngeal angiofibroma is an integral FAP tumour. Gut 2005;54:
10461047.
37. Klockars T, Renkonen S, Leivo I, Hagstrom J, Makitie AA. Juvenile
nasopharyngeal angiofibroma: no evidence for inheritance or associa-
tion with familial adenomatous polyposis. Fam Cancer 2010;9:401
403.
38. Schick B, Brunner C, Praetorius M, Plinkert PK, Urbschat S. First evi-
dence of genetic imbalances in angiofibromas. Laryngoscope 2002;112:
397401.
39. Mishra A, Mishra SC, Pandey A. Variations in molecular expressions
of juvenile nasopharyngeal angiofibroma. Am J Otolaryngol 2016.
Submitted.
40. Coutinho-Camillo CM, Brentani MM, Butugan O, Torloni H, Nagai MA.
Relaxation of imprinting of IGFII gene in juvenile nasopharyngeal
angiofibromas. Diagn Mol Pathol 2003;12:5762.
41. Zhang M, Sun X, Yu H, Hu L, Wang D. Biological distinctions between
juvenile nasopharyngeal angiofibroma and vascular malformation: an
immunohistochemical study. Acta Histochem 2011;113:626630.
42. Mohr LC, Rodgers JK, Silvestri GA. Glutathione stransferase M1 poly-
morphism and the risk of lung cancer. Anticancer Res 2003;23:2111
2124.
43. Smith MR, Kantoff PW. Molecular biology of prostate cancer. In: Mendel-
sohn AC, Howley A, Israel SJ, Liotta L, eds. The Molecular Basis of
Cancer, 2nd ed. Philadelphia, PA: WB Saunders; 2001: 723725.
Pandey et al.: Current Molecular Status of JNA
7