Kumpulan Abstrak Publikasi

1Entomological Science (2005) 8, 235-243
Vertical and seasonal variation in the abundance and the species richness of
Attelabidae and Cantharidae (Coleoptera) in a suburban mixed forest
Amin Setyo Leksono, Nobukazu Nakagoshi, Kenta Takada and Koji Nakamura
Abstract
A continuous sampling of canopy beetles was carried out to determine variation in the
abundance and the species richness of the Attelabidae and Cantharidae in a suburban
mixed forest. Changes in the abundance and the species richness were monitored in three
vertical strata of the forest from May to November in 1999, using yellow and blue water
pan traps. The results showed significant variation in the abundance and the species
richness of Attelabidae and Cantharidae between the layers, trap colors and seasons. Rare
species were found in the bottom and middle layers, hut were absent in the upper layer. In
contrast, common species were more abundant in the upper layer than iii the lower layers.
The yellow traps had better trapping efficiency than the blue traps for both families, with
the exception of an attelabid species, Cycnotrachelus reolofsi, which was more abundant
in the blue traps. The abundance and the species richness were generally greater in spring
than in summer. In spring, the abundance was consistently highest in the yellow traps in
the upper layer. Season and layer were determinant factors in the species composition of
the Attelabidae, while only season explained variation in species composition of the
Canthuridae.
Key words: color preference, forest canopy, leaf-rolling weevil, soldier beetle, water pan
trap.
Email: leksono72@yahoo.com
2Insect Science (2005) 12, 199-206

Vertical and seasonal distribution of flying beetles in a suburban
temperate deciduous forest collected by water pan trap
Amin Setyo Leksono, Kenta Takada, Shinsaku Koji, Nobukazu Nakagoshi,

Tjandraanggraeni and Koji Nakamura
Abstract
Vertical and seasonal distributions of flying beetles were investigated in a suburban
temperate deciduous forest in Kanazawa, Japan using water pan traps to determine the
abundance and composition among vertical strata, change in the abundance and
composition through seasons and determinant factors in generating the distributions,
Traps were placed at three levels (0.5 n, 10 in, and 20 in above gro. id) on a tower.
Samplings were carried out seasonally from May to November in 1999 and 2000.
Variations in the abundance of flying beetles were observed from different layers. The
results showed that the abundance and composition of flying beetles varied among strata
and seasons. In both 1999 and 2000, Elateridae was consistently most abundant in the
bottom layer, while Attelabidae and Cantharidae were most abundant in the upper. layer.
In 1999, Eucnemidae and overall scavengers were most abundance in the bottom layer,
but results were not consistent with those in 2000. In general. the abundance of
herbivores reaches a peak in the early season (May/June) and decreases in the following
months. Peaks of abundance in predators vary vertically. In the bottom layer a peak was
observed in the earl\ season (May/June), while in the upper layer this was observed in
July. Scavengers had two peaks, in May/June and September. These patterns indicated
that vertical distributions in the abundance of different feeding guilds varied through
seasons.
Key words Coleoptera, feeding guilds, forest canopy, seasonal abundance, vertical
distribution, water pan trap
e-mail: leksono72@yahoo.com
-----------------------------------------------------------------------------------------------------------
-
3J For Res (2006) 11:61-64
Species composition of Modellidae and Cerambycidae (Coleoptera) in a
coppice woodland
Amin Setyo Leksono , Kenta Takada, Nobukazu Nakagoshi ,Koji Nakamura
Abstract
A continuous sampling of canopy beetles was carried out to determine variations in the
abundance, species diversity, richness, and composition of the Mordellidae and
Cerambycidae in a coppice woodland. Changes in the abundance and the species richness
were monitored at three heights in the forest throughout the season in I 949, using yellow
and blue water pan traps. The results showed significant variations in the abundance of
Mordellidae among the canopy layers, while little variation was found hi Cerambycidae.
The abundance, species diversity and richness were generally greater in summer. The
results showed distinct species compositions in both families among layers.
Key words Canopy beetles ? Forest strata ? Vertical distribution ? Satoyama ? Trap color
The-12th Indonesian Scientific Meeting, Osaka University, September 6-7, 2003.
4Threat of National Park Due to Traditional Ecological Knowledge

Change of Tengger Tribal People in Ranupani Village Lumajang
Amin Setyo Leksono
Abstract.
Tengger tribal people live in enclave area of Bromo Tengger Semeru National Park, East
Java. Their life and social activity threat National Park biological resource particularly
when Traditional Ecological Knowledge (TEK) is abandoned. This study investigated the
character and change of TEK of Tengger tribal people. In part, this is due to the difficulty
of accessing TEK, which is rarely written down and most case documented as a project,
the observation conducted using social study method to gather biological data. In
February, July and August 2002, semi directive interview, facilitated workshop and
collaborative field project were carried out to indigenous Tengger tribal people in
Ranupani village. This study showed that TEK has been abandoned and people activity
threat National Park area.
Keywords: Tengger, Bromo Tengger Semeru National Park, Traditional Ecological
Knowledge
5TROPICS Vol. 14 (4), July 2005
The effects of forest disturbances on flying insect assemblages in Trawas,

East Java
Amin Setyo leksono, Nobukazu nakagoshi and Yuji isagi
Abstract
To evaluate the effects of forest disturbances on flying insects, samples were taken at
three selected disturbed sites in a mountainous area in Trawas, East Java. Changes in the
abundance, family richness and composition of flying insects were monitored during the
2003 wet season and 2004 dry season using window traps. A total of 4947 individuals of
insects, representing 82 families, were collected. The overall abundance and family
richness of flying insects declined with increasing site disturbance. Community
composition was also remarkably different among the sites. Herbivorous insects, such as
Chrysomelidae and Orthoptera, and scavenging beetles, such as Scolytidae and
Nitidulidae, were the most sensitive to disturbance. In contrast, some agricultural insects
were found in highly- disturbed site. These results indicate that forest disturbances
change flying insect composition.
Key words: Anthropogenic disturbance, East Java, flying insect, tropical region,
window
Trap
E-mail: leksono72@yahoo.com
6Buku Panduan Seminar Nasional Basic Science 3

Identifikasi polimorfisme gen growth hormone sapi bali
dengan metode PCR-RFLP
Sri Rahayu, S.B. Sumitro, T. Susilawati Soemarno
Abstract
This study was conducted to identify polymorphism of Growth Hormone gene of Bali
cattle. A PCR-RFLP (polymerase chain reaction-restriction fragment length
polymorphism) procedure was developed for determining polymorphism of Growth
Hormone gene. The DNA was isolated from blood samples by salting out method. Total
DNA were amplified with forward primer , 5?- TAGGGGAGGGTGGAAAATGGA-3?
and reverse primer , 5?- GACACCTACTCAGACAATGCG-3?. The digestion of PCR
product was done by HaeIII restriction enzyme. Result of the amplification was a specific
single band with fragment size 450 bp. Restriction with Haelll restriction enzyme
resulted four kind haplotype, they were haplotype I which was not cut by Haelll
restriction enzyme resulted in fragment size 450 bp, haplotype II that were cut into two
fragments by HaeIII restriction enzyme resulted in fragment size 225 bp and 150 bp,
haplotype Ill that were cut into three fragments by Haelll restriction enzyme resulted in
fragment size 400 bp, 225 bp and 150 bp, and haplotype IV that were cut into five
fragments by Haelll restriction enzyme resulted in fragment size 450 bp, 400 bp, 275 bp,
225 bp and 150 bp
Keywords : Cattle Bali, gen Growth Hormone, PCR, RFLP
Email : srahayu@brawijaya.ac.id
Buku Panduan Seminar Nasional Basic Science 3
7Kemampuan Megabalanus sp. dari pantai balekambang dalam

mengakumulasi logam Pb
Sri Budi Utami, Setijono Samino, Catur Retnaningdyah, Jurusan Biologi,
Abstrak
Tujuan penelitian ini adalah untuk mengetahui tingkat toksisitas logam Pb dan
kemampuan Megabalanus sp. dalam mengakumulasi logam Pb melalui uji toksisitas sub
akut. Penentuan LC50 dilakukan melalui uji toksisitas akut dengan periode jangka pendek
(24, 48, 72 dan 96 jam). Konsentrasi Pb(N03)2 yang digunakan untuk uji toksisitas akut
adalah 0; 100; 200; 300; 400 dan 500 mg/L. Sedangkan uji toksisitas sub akut dilakukan
dengan pendedahan Megabalanus sp. dalam 5-10% dan nilai LC50 48 jam yaitu 0; 2,5; 5;
10; 20 dan 40 mg/L selama 20 hari. Selanjutnya untuk mengetahui kemampuan
Megabalanus sp. dalam mengakumulasi logam Pb dilakukan analisis kadar logam Pb
pada tubuh Megabalanus sp. dengan metode AAS. Selama uji toksisitas akut dan sub
akut juga dilakukan pengukuran kualitas air yang meliputi pH, suhu, konduktivitas dan
salinitas. Hasil analisis Probit melalui paket program SPSS for Windows release 11
diketahui nilai LC50 logam Pb selama 24, 48, 72 dan 96 jam secara berturut-turut adalah
506,95; 462,68; 431,44 dan 414,26 mg/L. Hasil uji toksisitas akut menunjukkan bahwa
semakin lama pendedahan toksisitas logam semakin meningkat. Hasil analisis kandungan
logam Pb dalam tubuh Megabalanus sp. adalah berkisar antara 6,46-44,15 mg/Kg. Hasil
penelitian menunjukkan bahwa semakin tinggi konsentrasi logam dalam media dapat
mengakibatkan semakin tinggi pula yang terkandung dalam tubuh Megabalanus sp.
Kata Kunci : Akumulasi Pb, Megabalanus sp, Uji Toksisitas Akut dan Sub akut
Email :
Struktur komunitas dan kerusakan terumbu karang akibat aktivitas wisata di

kawasan pantai balekambang
Mukhzayadah, Catur Retnanngdyah, Luchman Hakim,
Abstrak
Penelitian ini bertujuan mengetahui struktur komunitas dan kerusakan terumbu karang di
Kawasan Pantai Balekambang. Pengambilan data dilakukan saat surut terjauh di bulan
Juli-Agustus 2005. Pemetaan dilakukan sebagai dasar transek sabuk (belt transect) tegak
lurus garis pantai. Transek terdiri dan 15 petak kuadrat (1x2 rn) selisih jarak 10 m.
Pengamatan jenis dan kerusakan terumbu karang dilakukan dengan cara pengukuran
kerimbunan/penutupan (coverage) terumbu karang. Pengukuran taktor abiotik perairan
dilakukan sebanyak tiga kali ulangan. Hasil pengamatan terumbu karang di Kawasan
Pantai Balekambang ditemukan 11 famili. Berdasarkan nilai Indeks Kesamaan Morisita
terdapat perbedaan struktur komunitas terumbu karang pada daerah dekat pantai (zona 1
dan 2) dan jauh pantai (zona 3,4 dan 5). Pada zona 1 dan 2 di barat pulau Hanoman
didominasi oleh Acropora sp. (37% dan 21%), zona 3 terjadi kodominansi antara
Montipora efflorescens (14%) dan Platygyra Iamellina (13%), zona 4 kodominansi
antara Platygyra lamellina (15%) dan Pocillopora verrucosa (13%). Timur pulau
Hanoman zona 1 didominasi oleh Goniastrea retiformis (11%), zona 2 didominasi
Acropora sp. (19%). Zona 3 terjadi kodominansi antara Montipora efflorescens (14%)
dan Platygyra lamellina (13%), zona 4 terdapat kodominansi antara Astreopora
moretenensis (20%) dan Goniastrea australensis (17%). Platygyra lamellina (15%) dan
Astreopora moretenensis (15%) mendominasi zona 5. Timur pulau lsmoyo, zona 1
terdapat kodominansi antara Goniastrea retiformis (4%) dan Platygyra lamellina (4%),
zona 2 didominasi oleh Acropora sp. (26%). Nilai Indeks Keanekaragaman Shannon-
Wiener (H?) terumbu karang di zona dekat pantal untuk semua lokasi selalu rendah
(1,32-3,13) dibandingkan dengan zona jauh pantai yang berkisar antara 3,27-3,96.
Kerusakan terumbu karang pada zona dekat pantai di seluruh lokasi selalu lebih besar (8-
74%) dibandingkan dengan daerah jauh pantai (0-5%). Nilai taktor abiotik perairan
(suhu, salinitas, konduktivitas dan pH) masih normal dan mampu mendukung kehidupan
terumbu karang tersebut.
Kata kunci : Balekambang, belt transect, terumbu karang

Email
Struktur komunitas makroalga dan echinoidea di kawasan wisata pantai

balekambang
Nur Susanti, Catur Retnaningdyah, dan Lukman Hakim
Abstrak
Penelitian ini bertujuan untuk mengetahui struktur komunitas makroalga dan Echinoidea
serta kualitas faktor abiotik air di kawasan Pantai Balekambang. Pantai Balekambang
dibagi menjadi tiga lokasi yaitu lokasi 1 (barat Pulau Hanoman), lokasi 2 (antara Pulau
Ismoyo dan Pulau Hanoman), lokasi 3 (timur Pulau Ismoyo) dan tiap lokasi dibuat 15
transek yang tegak lurus dengan garis pantai. Pada setiap transek dibuat petak kuadrat
dengan ukuran 1x2 meter dan jarak antar petak kuadrat 10 meter. Hasil pengamatan
makroalga dan Echinoidea di kawasan Pantai Batekambang ditemukan sebanyak 25 taksa
makroalga dan tiga taksa Echinoidea. Perhitungan NP makroalga di lokasi 1
menunjukkan kodominansi antara taksa Sargassum polycystum, Corralina sp.dan
Codium edule silva (zona 1), taksa Corralina sp.dan Scinaia latifroms (zona 2), zona 3
didominansi oleh taksa Halimeda opuntia. Lokasi 2 zona 1 didominansi oleh Corralina
sp., zona 2 terdapat kodominansi antara taksa Dictyota bartayresiana, Laurenca sp., dan
Corralina sp. Zona 3 terdapat kodominansi taksa Dictyota bartayresiana dan Halimeda
opuntia. Pada lokasi 3 didominansi oleh taksa Corralina sp.. Perhitungan NP Echinoidea
menunjukkan Echinometra spp. mendominasi zona 2 lokasi 1, zona 1 lokasi 2 dan zona 3
lokasi 3 sedangkan Stomopneustes sp. mendominasi zona 2 lokasi 2. Di zona dan lokasi
yang lain terdapat kodominansi baik antara Stomopneustes sp - Tripneustes sp. maupun
Echinometra spp.- Stomopneustes sp. Nilai lndeks Keanekaragaman Shannon-Wiener
(H?) makroalga antar lokasi berkisar antara 0,48- 1,57 sedangkan Echinoidea berkisar
antara 0,00-1,22 yang menunjukkan tingkat keragaman yang relatif rendah antar lokasi.
Faktor abiotik di perairan Pantai Balekambang menunjukkan kisaran nilai yang mampu
untuk mendukung kehidupan makroalga dan Echinoidea.
Kata kunci : Echinoidea, Makroalga, Pantal Balekambang, Petak kuadrat.

Email
10BIOSCIENTIAE (2006) 3: 1-14

Komunitas kapang tanah di lahan kritis berkapur DAS brantas pada musim
kemarau
Dian Siswanto dan Suharjono
Abstract
The lime upland of Brantas River Watershed in East Java Province involve Malang,
Blitar, Tulungagung and Trenggalek Regency are dry upland with limestone, low soil
organic matter and unproductive. Soil productivity was influenced by microorganism
activity that transform soil organic matter and other soil nutrition materials. Soil mold in
lime upland of Brantas River Watershed can be used as bioindicator of productivity and
soil sustainability. The research aims were to find out soil mold community at dry season
in lime upland of The Brantas River Watershed and to know their relation with
environmental factors. Chemical and physical parameters observed were soil
temperature, sunlight intensity, soil acidity, soil moisture, soil organic matter and water
retention capacity, while biological parameters was soil mold abundance. The result
showed that soil mold abundances between groups were significantly different. The range
of soil mold abundances in Trenggalek were 7x103-2,4x104 propaguls/gram.
Tulungagung were 1,8x103-1,0x104 propaguls/gram. Blitar were 7,8x102-4,6x103
propaguls/gram and Malang were 2.8x102-9,0x103 propaguls/gram. Soil mold abundances
were not significantly different between village in Malang Regency contain Pagak
Village were 2.27xl04 propaguls/gram, in Ngernbul Village were 7.91x103
propaguls/gram and Banyuurip Village were 3.32x103 propaguls/gram. Soil mold
abundances between regency and between village both were not significantly influenced
for chemical physic factors. Predominant soil mold in Trenggalek and Blitar were
Penicillium while Mucor were dominant in Tulungagung. Penicillium and Phytophtora
were codominant in Malang.
Key words : community, soil mold, lime upland, Brantas River Watershed, dry season.
Email : dian_siswanto@yahoo.com
11The Ad4BP/SF1 Function of Testes BACAd4BPtTAZ Transgenic-
Knockout Mice normally regulated during Development.
Fatchiyah, Mohamad Zubair and Ken-Ichirou Morohashi
Abstract
Gene disruption studies were performed to investigate the functions of
Ad4BP/SF-1 during the tissue development. The gene knockout mice displayed agenesis
of the adrenal gland and gonads at birth, reflecting increased apoptic cell death in the
particular cell population comprising the tissue primordia. To address the function of
Ad4BP/SF1 in developing gonad on Ad4BP/SF1 knockout mouse, we have modified the
BACAd4BP endogenous by homologous recombinant with modification cassette-
containing Tet-Off system and LacZ reporter genes to allow the expression of
Ad4BP/SF1 in developing tissues and organ differentiation, regulate of Ad4BP/SF1
mechanism, and reveal the defect due to Ad4BP/SF1 deficiency. The BACAd4BPtTAZ
recombinant has a potential to express a lacZ reporter gene and Ad4BP/SF-1 in the
tissues where the endogenous Ad4BP/SF-1 gene is expressed. Expectedly, the lacZ
expressions in the BAC transgenic mice mostly recapitulated the endogenous gene
expressions. However, protein level of upregulated Ad4BP/SF-1 varied among the
transgenic mice. Showing a good correlation with the expression levels, the transgene
differentially affected the target tissues. We further applied the BAC-transgenic mice to
rescue Ad4BP/SF-1 gene disrupted mouse. Interestingly, although the Ad4BP/SF1
protein expression levels are slightly high in testes of BACd4BPtTAZ-Tg mice, the BAC
recombinants successfully rescued and normally developed the gonad of the KO mouse.
Keywords: Ad4BP, SF1, BAC transgenic, Steroidogenesis, Testis.
Email : fatchiya@brawijaya.ac.id
12Biochemical and Biophysical Research Communications 341 (2006) 1036-1045
Differential gene dosage effects of Ad4BP/SF-1 on target tissue

development
Fatchiyah, Mohamad Zubair, Yuichi Shima, Sanae Oka, Satoru Ishihara ,
Yuko Fukui-Katoh , Ken-ichirou Morohashi
Abstract
Ad4BP/SF-1 (NR5A1) was identified as a key regulator of the hypothalamus?pituitary?
gonadal and ?adrenal axes. Loss-of-function studies revealed that Ad4BP/SF-1 is
essential for the development of these tissues and spleen. Here, we generated transgenic
mouse with BAC recombinants carrying a dual promoter and Tet-off system. These
recombinants have a potential to express lacZ and Ad4BP/SF-1 in the tissues where
endogenous Ad4BP/SF-1 is expressed. However, protein level of Ad4BP/SF-1 varied
among the tissues of the transgenic mice and probably thereby the target tissues are
affected differentially. The BAC-transgenic mice were applied to rescue Ad4BP/SF-1
KO mouse. Interestingly, the mice successfully rescued the gonad and spleen but failed to
rescue the adrenal gland. This variation might be dependent on in part the protein
expression levels among the tissues and in part on differential sensitivities to the gene
dosage.
Ke words : BAC transgenic; Ad4BP; SF-1; Steroidogenesis; Testis; Adrenal; Gonad;
Spleen; Gene dosage
13Revealing Spleen Ad4BP/SF1 KO by BAC-Ad4BP-tTAZ transgene

Fatchiyah.
Abstract
The purpose of this study is addressed the function of Ad4BP/SF1 in developing spleen
of Ad4BP/SF-1 KO mouse. I have modified the BAC-Ad4BP endogenous by
homologous recombinant with modification cassette-containing tetracycline
transactivator system and LacZ reporter genes to allow the expression of Ad4BP/SF1 in
developing tissues and organ differentiation, regulate of Ad4BP/SF1 mechanism, and
reveal the defect due to Ad4BP/SF1 deficiency. Recently studies, by
immunihistochemistry of adult tissues showed that revealed coincident expressing
between Ad4BP/SF-1 and lacZ, indicating the tTA system seemed to reproduces the
endogenous expression of Ad4BP/SF-1, and thus likely to lacZ, Ad4BP/SF-1 in the BAC
transgene was expected to be expressed in the corresponding tissues under the control of
the bidirectional promoter. Interstingly, the BAC-Ad4BP-tTA transgenic mice were
succeeded to upregulate the expression of Ad4BP/SF-1 at the protein level than wild
type. And the fetal spleen of Tg(+);Ad4(+/+) was larger than that of the wild type, and
expectedly the size of the spleen of Tg(+);Ad4(-/-) apparently recovered.
Keywords: Ad4BP/SF-1 knockout, Spleen, BAC transgenic, homologous recombinant.
International Conference On Molecular Biology of Life Sciences Brawijaya University,

On November 19 - 21, 2007
14Differential Gene Dosage Effects of Ad4BP/SF-1 on Target Tissue

Development
Fatchiyah, Mohamad Zubair, Ken Ichirou Morohashi .
Abstract
Ad4BP/SF-1 (adrenal-4-binding protein/steroidogenic factor-1; NR5A1) was identified
as a key regulator of the hypothalamus-pituitary-gonadal (HPG) and -adrenal (HPA)
axes. Loss-of-function studies of the gene revealed the function of Ad4BP/SF-1 essential
for the development of the tissues comprising the axes and the spleen. In the present
study, we constructed mouse BAC recombinant clones carrying a dual promoter and Tet-
off system. These recombinant constructs have a potential to express a lacZ reporter gene
and Ad4BP/SF-1 in the tissues where the endogenous Ad4BP/SF-1 gene is expressed.
Expectedly, the lacZ expressions in the BAC transgenic mice mostly recapitulated the
endogenous gene expressions. However, protein level of upregulated Ad4BP/SF-1 varied
among the transgenic mice. Showing a good correlation with the expression levels, the
transgene differentially affected the target tissues. The spleen was the only tissue
reflected gene dosage of Ad4BP/SF-1 on the tissue size determination, while the other
target tissues were unlikely affected. We further applied the BAC-transgenic mice to
rescue Ad4BP/SF-1 gene disrupted mouse. Interestingly, the BAC recombinants
successfully rescued the gonad but failed to rescue the adrenal gland of the KO mouse.
This variation might be dependent on in part the protein expression levels driven by the
BAC transgene and in part on differential sensitivity to the gene dosage of the two
tissues.
Keywords : Ad4BP/SF-1, BAC-transgenic mice, lacZ expressions, adrenal gland
15Tet-off system drive the inactivity gene target of bacad4bpttaz

transgenic mice
Fatchiyah, Mohamad Zubair , Ken Ichirou Morohashi .
Abstract
The orphan nuclear receptor, Ad4BP (adrenal-4-binding protein) or SF1 (steroidogenic
factor-1) or FtzF1 (Fusitarazu-F1), has emerged as a key regulator of endocrine function
within the hypothalamus-pituitary-gonadal axis and adrenal cortex, and also as an
essential factor in sexual differentiation. Ad4BP/SF1 was first identified as a conserved
regulatory motif in the proximal promoter region of genes encoding the cytochrome P-
450 streroid hydroxylases. Numerous cellular studies have implicated Ad4BP/SF1 as a
mediator of cell specific gene expression in adult endocrine organs. Ad4BP/SF1
orchestrates steroidogenesis by regulating many of the adrenal-specific enzymes that
together coordinate the synthesis of glucocorticoids and mineralcorticoids. The role of
Ad4BP/SF1 target genes in the adrenal and gonad implies that Ad4BP/SF1 is a key
molecular determinant in production of sex and adrenal steroid.
An understanding of the functions of individual Ad4BP/SF1 gene requires detailed
information on its pattern of expression, on the localization and biochemical activities of
its product and the partners it interact with, on the phenotypic consequences of altering its
function, and its transcription profile. Here I will focus to use bacterial artificial
chromosome (BAC) transgenic mice for this purpose. The development of methods of
engineering of BAC and for efficient production of BAC transgenic mice has allowed the
design of in vivo approaches to the analysis of steroidogenic genes expression and
function in hypothalamus-pituitary-gonadal axis (HPG) or hypothalamus-pituitary-
adrenal axis (HPA), which could not accomplished using traditional methods. I will
discuss the molecular methods that used to manipulate these large DNA constructs, the
usefulness of reporter genes, and targeted-expression studies to address fundamental
problem in molecular genetics studies of mammalian endocrine function of steroidogenic
genes. In this study, I use the tet-off system to drive selectively the inactivity of
Ad4BP/SF1 expression and use the bacterial artificial chromosome transgenic strategy to
provide the role of Ad4BP/SF1 expression related with endocrine function.
In this study, I use the tet-off system to drive temporally the inactivity of Ad4BP/SF1
expression and use bacterial chromosome transgenic strategy to provide the role of
Ad4BP/SF1 expression related with endocrine function. My experiment results indicate
that the tTA-sensitive bi-directional transgenes yield tTA responsive with high efficiency.
The expression levels of transcriptionally of reporters were tTA-dependent and could be
regulated by Doxycycline (Dox), a tetracycline analog. The level of lacZ expression
reduced after two week treated by using doxycycline in the drinking water. And
abolished the expression after 3 weeks treatment In this analyzed, the doxycycline was
effective in repressing expression of target transgenic of BAC Ad4BPtTAZ mice.
Key word: Ad4BP/SF1, Steroidogenic tissue, Steroid hormone, orphan nuclear receptor,
Tet-off system
16Analisis Mitokondria DNA Banteng Liar (Bos javanicus) dari Taman

Nasional Alas Purwo sebagai Langkah Awal Pemetaan Plasma Nutfah
Fatchiyah, Sri Rahayu, DW. Indriati, DW. Indriani, A. Yunita
Abstrak
Mitochondrial DNA (mtDNA) adalah salah satu penanda keturunan yang bisa dirunut
dari garis maternal. Tujuan penelitian ini adalah menganalisis kemurnian mtDNA untuk
gen cytochrome b pada banteng liar dibandingkan dengan sapi bali dan sapi lokal.
Sampel DNA analisis akan diambil dari tulang banteng dan tulang/darah sapi bali dan
sapi lokal. Analisis mtDNA untuk gen cytochrome b dengan metoda Polymerase Chain
Reaction- Restriction Fragment Lenght Polymorphism (PCR-RFLP). Hasil penelitian ini
menunjukkan bahwa pola genetik dari Banteng tidak berbeda dengan sapi Bali tetapi
berbeda dengan sapi lokal. Keragaman genetik dari Banteng belum bisa ditentukan
apakah ada introduksi dari perkawinan silang dengan sapi lokal atau bukan, ataukah ada
mutasi di urutan basa nukleotida dari gen cytochrome-b ini. Penelitian ini masih perlu
dilanjutkan.
Key words: Banteng (Bos javanicus), endangered species, mtDNA, PCR-RFLP
17International Conference On Molecular Biology of Life Sciences Brawijaya

University, On November 19 ? 21, 2007
Genetic and physiological analysis of brancing on kenaf (Hibiscus

cannabinus)
Estri Laras Arumingtyas, Retno Mastuti, Serafinah Indriyani
Abstract
The objective of this research was to determine the genotypic and physiology
properties of two branching types of kenaf mutant line aroused from Ethyl Methane
Sulfonate (EMS) mutation. The genotypic property was observed based on the existence
of branching gene and the physiological character observed was the auxin concentration.
For molecular analysis, DNA of kenaf seed and leaves were isolated using Doyle dan
Doyle (1987) method. The sequence of branching gene was identified using PCR and
sequencing techniques. PCR was conducted using 5 pair of primers including 4 specific
primers which was designed base on the sequence of branching genes AUX1, AXR1 of
Arabidopsis thaliana, RMS1 of Pisum sativum, and Ls of Lycopersicum esculentum, and
one pair of degenerate primer designed from amino acid conserve sequence of LAS, Ls
and Moc genes. The PCR program used was 93 oC, 1 minute denaturation, 30 second
annealing at 56 oC, 1 minute ekstention 72 oC, for 35 cycles. Pre-heating for 1 minute at
93 oC, and the last extention phase was done for 10 minutes at 72 oC. Sequencing was
performed using the procedure of Big Dye Terminator mix, at ABI 377A sequencer.
Confirmation on the physiological properties of branching lines was determined using
spectrophotometry methods.
Identification of branching gene using PCR and sequencing techniques showed that the
branching gene of kenaf was succesfully amplified by AUX1 and AXR1 primers but were
not amplified by Ls, RMS1, and Llm primers. This indicates that branching gene of kenaf
was homologous to branching gene of Arabidopsis thaliana. Molecular analysis indicate
that the gene act as auxin signaling, but different type of branching was controlled by
different allele of the same locus. The gene was the member of gene family that control
branching and active at the last phase of branching development by controlling auxin
signaling to determine whether the branching candidate continue to develop or not.
Determination of auxin content in the roots, apical shoot, and axilary branches showed
that the branching plants has higher auxin content in the apical shoot compared to the
content in the branches. This indicate that AUX1 control the formation of branches by
either controlling the content of auxin in the apical shoot and branches or the ratio of
auxin content in the shoot and branches
Key word : branching gene, auxin, kenaf,mutation.

Email : laras@brawijaya.ac.id
18Analisis mutasi kandidat gen percabangan pada kenaf (Hibiscus

cannabinus L.)
Estri Laras Arumingtyas, Nur Basuki, Sudjindro dan Sutiman B. Sumitro
Abstrak
Analisis mutasi pada kandidat gen percabangan kenaf (Hibiscus cannabinus L.) hasil
induksi mutasi dengan mutagen kimia Ethyl Methane Sulfonate (EMS), telah dilakukan.
Induksi mutasi dengan berbagai konsentrasi EMS telah berhasil menghasilkan tanaman
mutan bercabang. Polymerase Chain Reaction (PCR) terhadap mutan tersebut dengan
menggunakan primer spesifik RMS1 menghasilkan pita sebesar 400 bp baik pada mutan
maupun kontrol. Sekuensing terhadap fragmen tersebut, dan dilanjutkan dengan analisis
BLAST menunjukkan adanya homologi yang tinggi antara fragmen tersebut dengan
transpososn ogre dan Pisum sativum. Analisis alignment antara fragmen homolog ogre
pada kontrol dan mutan mendapatkan adanya mutation site yang menunjukkan adanya
tipe mutasi yang khas untuk EMS yaitu transisi dan delesi. Beberapa transisi yang terjadi
menghasilkan mutasi missense, sedangkan delesi akan menyebabkan terjadiriya mutasi
frameshift.
Keywords : Ethyl Methane Sulfonate, gen percabangan kenaf , primer spesifik RMS1
Seminar Nasional Basic Science III ?Bacic Science For Better Environment? dan
Pameran Nepenthes FMIPA dalam rangka Dies Natalis UNIBRAW pada tanggal 24-25
Februari 2006
19Karakter Stomata Nilam (Pogostemon cablin Benth.) Hasil Regenerasi In

vitro terhadap Perlakuan Kolkhisin
Yuli Arisa, Retno Mastuti dan Estri Laras Arumingtyas
Abstrak
Karakter stomata telah banyak digunakan sebagai indikator perbedaan tingkat ploidi.
Penelitian ini bertujuan untuk melihat beberapa karakter stomata (kerapatan, panjang dan
indeks stomata) tanaman nilam hasil regenerasi in vitro dan eksplan pucuk dan batang 1
nodus terhadap perlakuan kolkhisin. Masing-masing eksplan direndam dalam larutan
kolkhisin (0, 0.5, 0.75 dan 1.0%) selama 2.5 dan 5 jam. Selanjutnya eksplan ditumbuhkan
pada medium induksi tunas (MS + 0.1 mg/l BAP + 0.4 mg/l NAA) dan akar (MS + 0.1
mg/l NAA). Planlet-planlet hasil regenerasi ditumbuhkan pada kondisi ex vitro, yaitu
pada media pasir selama 2 minggu, selanjutnya dipindahkan ke green house dan
ditumbuhkan pada media campuran tanah : kompos (2:1) selama 3 minggu. Pada
sebagian besar perlakuan koikhisin, kerapatan stomata lebih rendah dibanding kontrol
sedangkan panjang dan indeks stomata iebih tinggi dibanding kontrol.
Kata kunci : in vitro, kolkisin, Pogostemon cablin

Email : mastuti7@brawijaya.ac.id
Jurnal Hayati ( 2003) Vol.10,No.1,ISSN 0854-8587
20In Vitro Methods for Inducing Somatic Embryos of Soybean and

Plantlet Regeneration
Wahyu Widoretno, Estri Laras Arumningtyas, Sudarsono
Abstract
The objectives of this experiment were to obtain suitable medium for inducing primary
and secondary somatic embryos of soybean, to evaluate embryogenetic response of 14
soybean genotypes (Dieng, Kerinci, Kipas Putih, Pangrango, Tambora, Tidar, B3628,
B3639, B3731, MLG2805, MLG2999, MLG3072, MSC8606, and MSC90I9) and to
determine the frequency of somatic embryos convertion into soybean plantlets. Primary
SE was induced from cotyledon of immature embryos while secondary SE was induced
from primary SE, respectively, on modified MS medium containing 2,4-D and NAA.
Maturation of SE was done on MS medium containing 1 g/l activated charcoal and
germination of SE was conducted on MS medium containing GA3 and BAP. The results
showed primary SE induction from at least 13 soybean genotypes can be done by
culturing soybean cotyledon on medium containing a combination of 10 ppm 2,4-D and
10 ppm NAA. On the other hand, primary SE induction from cotyledons of soybean cv.
Pangrango can be done effectively on medium with 10 ppm NAA. For continuous SE
induction, however, primary SE were initiated from cotyledons of soybean on medium
containing 40 ppm 2,4- D followed by culturing primary SE on induction medium
containing a combination of 10 ppm 2,4-D and 10 ppm NAA. Soybean plantlets were
regenerated by culturing SE on maturation medium containing 1 g/l activated charcoal for
one month followed by germinating matured SE on germination medium containing a
combination of 2 ppm GA3 and 2 ppm BAP for one week. Using those procedures
induction of primary and secondary SE and regeneration of plantlet derived from three
soybean genotypes (B3731, MSC8606, and Tidar) were obtained.
Keywords : embryogenetic response, somatic embryos (SE), cotyledons of soybean

Email : widoretno@brawijaya.ac.id
JURNAL ILMU-ILMU HAYATI (Life Sciences) (2005)Vol.17-No.1

21The effect of ethyl methane sulfonate (EMS) to morpho-anatomical
variability of kenaf (hibiscus cannabinus l.) variety kr4
E.L. Arumingtyas, A. Munawarti dan S. Indriyani
Abstract
Induction of mutation to construct new branching kenaf variety was carried out. The
material used was unbranching kenaf KR 4 seed which has been soaked in aquadest for
10 hours. Mutagen used was Ethyl Methane Sulfonate (EMS). The EMS concentration
applied 0.03%, 0.05% and 0.10%. KR4 variety which has a few branches was used as
unbranching control and SM004H used as branching control plant. From 225 induce
plant, 6 branching mutant was arise. This mutant come from induction of 0.03% EMS (2
mutant), and 0.10% EMS (4 mutant). Base on the morphological data, the average value
of all parameter measured on the mutant plant was higher than the control plant
(105.62%), especially the number of capsule and the sum of mutant branch length was
higher than the control plant (143.59% and 167.79 respectively). The highest value for
some parameter was belong to mutant plant EMS 0.10% number 7 and 10. However the
mean number of branches is only 89.58% of the control unbranching plant, the diameter
was 81.88%, the height was 84.48%, the stem volume 57.33%, the thickness of cortex
was 82.29%, the weight of 1000 seeds was 91.51% of the control plant. The
morphological changing observed was not followed by anatomical changing.
Key words : induction, mutation, EMS, kenaf.

22PARTHENOGENESIS OOSIT KAMBING DENGAN

MENGGUNAKAN
Calcium ionophore DAN 6-Dimethylamino Purine
Hari Soepriandono, Gatot Ciptad, M. Sasmito Djati dan Arief Boediono
Abstrak
Penelitian ini bertujuan untuk mengetahui efektifitas prosedur aktivas untuk
parthenogenesis oosit kambing dengan menggunakan bahan aktivasi tunggal Calcium
ionophore (Cal), dibandingkan kombinasi Calcium ionophore (CaI) yang diikuti dengan
6-Dimethylamino Purine (6-DMAP, suatu inhibitor phosphorilasi) dengan mengamati
persentase oosit yang mencapai fase pembelahan (cleavage) maupun fase morula. Oosit
kambing yang telah dimaturasi selama 30 jam dalam TCM 119 yang disuplemantasi
dengan FBS, FSH dan LH kemudian diaktivasi dengan perlakuan aktivasi tunggal CaI 20
IM selama 7 menit dan kombinasi Cal 20 IM selama 7 menit yang diikuti dengan 6-
DMAP 2mM selama 3,5 jam. Setelah diaktivasi, oosit dikultur selama 48 jam. Hash
penelitian menunjukkan bahwa aktivasi kombinasi secara sangat nyata lebih banyak
menghasilkan oosit yang membelah (cleavage) dibanding aktivasi tunggal (P< 0,01) yaitu
secara berturut-turut untuk aktivasi CaI rata-rata pembelahannya 48,13 %, Cal yang
diikuti dengan 6-DMAP 68,07 % Sedangkan rata-rata persentase embrio yang mencapai
lebih 4 set diantara yang membelah yaitu 27,14 % (CaI) dan 40,46% (CaI yang diikuti
dengan 6-DMAP). Selain itu, aktivasi kombinasi CaI dengan 6-DMAP secara nyata
menghasilkan jumlah embrio parthenot tahap morula pada jam ke-48 lebih banyak
dibanding aktivasi tunggal, yaitu CaI 1,67 % sedangkan CaI yang diikuti dengan 6-
DMAP 19,07 %. Penelitian mi menyimpulkan bahwa parthenogenesis oosit kambing
dengan Calcium ionophore yang diikuti dengan 6-DMAP lebih efektif dibanding aktivasi
tunggal dengan Calcium ionophore.
Kata Kunci: parthenogenesis, aktivasi, Calcium ionophore, 6-DMAP, oosit kambing.

Email : msdjati@brawijaya.ac.id
23Perkembangan embrio parthenot kambing hasil aktivasi dengan

menggunakan etanol dan cycloheximide
Kholifah Holil, Moch. Sasmito Djati, Gatot Ciptadi, Arief Boediono
Abstrak
Pemilihan agen kimia yang tepat dalam metode aktivasi untuk menunjang keberhasilan
nuclear transfer (NT) sangat penting untuk dilakukan. Dengan tujuan untuk mengetahui:
1) pengaruh aktivasi dengan menggunakan etanol dan cycloheximide terhadap
perkembangan awal embrio parthenot kambing secara in vitro; 2) perbedaan efektifitas
aktivasi dengan menggunakan etanol saja dan aktivasi dengan menggunakan etanol yang
dikombinasikan dengan cycloheximide terhadap perkembangan awal embrio kambing
secara in vitro maka penelitian ini dilakukan. Sampel yang digunakan dalam penelitian
mi adalah oosit yang diaspirasi dan folikel ovarium kambing yang diambil dan RPH
Sukun Malang. Oosit di IVM selama 24 jam dan pada jam ke 30 setelah IVM dilakukan
aktivasi dengan menggunakan etanol 7% selama 7 menit dan kemudian dilanjutkan
dengan diinkubasi dalam 10?g/ml cycloheximide selama 3,5 jam. Masing-masing
perlakuan kemudian diulang sebanyak 8x. Berdasarkan hasil penelitian menunjukkan
bahwa aktivasi dengan menggunakan etanol saja mampu menghasilkan cleavage rate
sebesar 70,4%. Sedangkan pada aktivasi dengan menggunakan etanol yang
dikombinasikan dengan cycloheximide mampu menghasilkan cleavage rate sebesar
81,3%. Dengan demikian maka disimpulkan bahwa: 1) ada pengaruh aktivasi dengan
menggunakan etanol dan cycloheximide terhadap perkembangan awal embrio parthenot
kambing secara in vitro; 2) Aktivasi dengan menggunakan etanol 7% selama 7 menit
yang dikombinasikan dengan 10?g/ml cycloheximide selama 3,5 jam lebih efektif
terhadap perkembangan awal embrio parthenot kambing secara in vitro dibandingkan
dengan aktivasi menggunakan etanol saja.
Kata kunci: Nuclear transfer(NT), aktivasi, oosit kambing, etanol, cycloheximide
Email : msdjati@brawijaya.ac.id
24Embriogenesis somatik eksplan daun makadamia (macadamia integrifolia

maiden & betche)
Retno Mastuti
Abstrak
Makadamia (Macadamia integrifolia Maiden & Betche) merupakan tanaman berkayu
dan Proteaceae yang menghasilkan biji bernilai ekonomi tinggi. Penelitian ini bertujuan
untuk mengetahui respon embriogenesis somatik pada eksplan daun Makadamia terhadap
bebcrapa kombinasi hormon dan sukrosa. Eksplan berupa daun ketiga dan pucuk apikal.
Medium dasar yang digunakan adalah Murashige dan Skoog. Pada fase induksi hormon
yang diujikan adalah 2,4-D (5 dan 10 ?M), Kinetin (0 dan 2?M) dan konsentrasi sukrosa
yang diujikan adalah 9 dan 12 %. Pada fase pendewasaan diujikan dua jenis medium
yaitu MS + NA 0.5?M + sukrosa 9% dan MS + NA O?M + Kinetin 3?M+ sukrosa 9%.
Tanpa penambahan kinetin induksi embriogenesis terjadi secara langsung pada dua
minggu setelah kultur sehanyak 48,5-68%. Subkultur ke medium pendewasaan dilakukan
pada umur 9 minggu setelah kultur pada medium induksi. Medium pendewasaan masih
perlu dioptimalkan karena sampai 6 minggu setelah kultur hanya terjadi proliferasi dan
perubahan warna dan belum tampak adanya organ maupun planlet.
Kata kunci : Makadamia, embriogenesis somatic, Murashige dan Skoog
Berk. Penel. Hayati: 9 (1-6). 2003
25Isolation and culture of celosia cristata l. cell suspension protoplasts
Retno Mastuti ,Hiroshi Miyake, Takeshi Taniguch, Yoji Takeoka
Abstract
Developmental competence of Celosia cristata L. cell suspension-derived protoplasts
was investigated. The protoplasts were isolated from 3- to 9-d old cultures in enzyme
solution containing 2% (w/v) Cellulase YC and 0.5% (w/v) Macerozyme R- 10 which
was dissolved in washing solution (0.4 M mannitol and 10mM CaCl2) at pH 5.6 for 3
hours. The highest number of viable protoplasts was released from 5-d old culture of a
homogenous cell suspension. Subsequently, three kinds o[protoplast culture media were
simultaneously examined with four kinds of concentration of gelling agent. Culturing the
protoplasts on KM8p medium solidified with 1.2% agarose significantly enhanced
plating efficiency as well as microcolony formation. Afterwards, the microcalli actively
proliferated into friable watery callus when they were subcultured on MS medium
supplemented with 0.3 mg/l 2,4-D and 1.0 mg/l kinetin. Although the plant regeneration
from the protoplasts-derived calli has not yet been obtained, the reproducible
developmental step from protoplasts to callus in this study may facilitate the
establishment of somatic hybridization using C. cristata as one parent.
Key words: cell suspension, Celosia cristata, agarose, protoplast culture, protoplast
isolation
-------------------------------------------------------------------------------------------------------------------------------------------
26Isolation and Culture of Leaf Bud Protoplasts of Curcuma heyneana Val.

& Van Zijp
Retno Mastuti
Abstract
The first work of isolation and culture of leaf bud protoplasts of Curcuma heyneana Val.
& Van Zijp was undertaken. Protoplasts were isolated from the second full expanded leaf
bud of C. heyneana grown in vitro. Some factors affecting the quantity and quality of
isolated protoplasts such as physiological condition of donor tissues, epidermis scrap out
treatment, membrane stabilizer, and osmoticum were studied. Enzyme solutions
containing Cellulase YC 2 %, Cellulase Onozuka R-l0 0.5%, Pectolyase Y-23 0.05 %,
Macerozyme Onozuka R-l0 0.5% , and varied in CaCI2.2H20 as well as sorbitol were
tested. The enzyme solution containing 5 mM CaCI2.2H20 and 0.4 M sorbitol provided
the highest yield of protoplast (7.3 x l06 protoplasts / g fw). However, in all enzyme
solutions tested the protoplast viability was low which range from 0.3 to 2.6%. Cell wall
regeneration was not observed on protoplast cultured in modified KM8p liquid medium.
Key words : Curcuma heyneana, protoplasts, KM8p liquid medium

Jurnal Ilmu-ilmu Teknik (Engineering) ? Vol.13-NO.2 ? Oktober 2001
27Blo active compounds found in mistletoes

C. Kirana , R. Mastuti , M.A. Widodo S.B. Sumitro , S. Indriyani ,NP. Eka W., N. Sigitianawati,
and B. Alfi
Abstract
Extract of mistletoes has been traditionally used since a long time ago, however little is
known about the species of mistletoes used, the bio-active compounds as well as the
chemical relationship between mistletoes and their host plants as a pharmalogical point of
view. Research, which had been done overseas, has shown that extract of mistletoe
having pharmalogical activity therefore extract of Indonesian mistletoes should be
examined concerning of finding new valuable materials of Indonesian native plants as
phamilogical products. The aim of this experiment was to isolate and identify flavonoids,
alkaloids and proteins found in mistletoes. Isolation and identification of flavonoids,
alkaloids and proteins conducted using various chromatographic methods including thin
layer chromatography, high performance liquid chromatography, UV/Vis analysis shown
that mistletoes have their own pattern of flavonoids and not qualitatively influenced by
the host plants while alkaloids found in the mistletoes were resembles to those in the host
plants. The isolation and identification of bio active protein in the mistletoes which are
assumed to have pharmalogical activity, had not been elucidated yet.
Keywords: Isolation, Identification, Compounds, Mistletoes, Bio-activeEmail :

mastuti7@brawijaya.ac.id
28Physiological responses of soybean somatic embryos towater stress
Wahyu Widoretno, Ludi Pawardani, Retno Mastuti

Abstract
The objectives of this experiment were to investigate the effect of water stress that
be simulated by using polyethylene glycol (PEG) on somatic embryo formation of
soybean and accumulation of proline, soluble total sugar and chlorophyll contents in
somatic embryo, to determine the relationship between proline, soluble total sugar and
chlorophyll accumulation of somatic embryo and genotypic differences in drought
tolerance. Somatic embryos of three soybean genotypes with different level of stress
tolerance were cultured on medium containing PEG at various concentrations. Evaluation
of physiological response of somatic embryo to water stress was undertaken by analyze
proline, soluble total sugar and chlorophyll content of somatic embryo cultured on non-
stress and water stress conditions. The results of this experiment showed that water stress
caused addition of PEG on medium inhibited formation of soybean somatic embryo and
inhibition response depended on the tested soybean genotypes. PEG-simulated water
stress significantly increased proline, soluble total sugar and chlorophyll content in
somatic embryo. Increase in the proline, soluble total sugar and chlorophyll content in
response to water stress differed among soybean genotypes. There were correlation
between the increasing of proline and chlorophyll accumulation on somatic embryo under
water stress due to PEG with the tolerance level to drought stress of soybean. Under
water stress, genotypes more tolerant to drought stress tended to accumulate more proline
but less chlorophyll. Soluble total sugar accumulation of soybean somatic embryo under
PEG stress condition showed no specific pattern associated with the response of
genotypes against drought stress.
Keywords: Somatic embryo; Drought tolerance; Proline; Soluble total sugar; Chlorophyll
29The effect of amino acid on growth and development of

soybean (glycine max (l.) merr) somatic embryo
Henik Agustina, Retno Mastuti, Wahyu Widoretno
Abstract
In vitro plant regeneration of soybean via somatic embryogenesis often produce abnormal
somatic embrio (SE) that has low regeneration ability. Some of the experiments showed
that the amino acid has important role to increase the SE growth and development. The
objectives of this experiment were to evaluate the effect of amino acid on growth and
development of SE from 3 soybean genotypes. Somatic embryo were induced from 3
genotypes: L. Bewok, B 3731 and Petek by culturing of soybeans SE on liquid modified
MS medium consist of macronutrient + micronutrient MS + B5 Vitamin + 15 g sucrose +
10 ppm NAA + 10 ppm 2,4-D. The effect of amino acid on SE growth and development
was evaluated by culturing SE on SE induction medium containing various amino acid
(asparagine, glutamine, proline and D-alanine) at 10 mM, 30 mM, 50 mM concentrations.
The experiment were carried out in a factorial randomized complete block design
(RCBD) with LSD continous test (α0,05). The amino acid addition on medium, decreased
the SE growth but increased the cotyledonary stage and maturation of SE. Effect of
amino acid on SE growth and development, depended on kind and concentration of
amino acid and also tested the soybean genotypes. Application of asparagine, glutamine
and proline on medium had no any effect on percentage of explant of 3 genotypes
forming SE, but decreased the number both of total SE and SE per explant from L Bewok
genotype. Medium containing D-alanin could not induce SE of three genotype soybean to
form SE. Meanwhile asparagine significantly enhanced the development of cotyledonary
stage and maturation of SE from L. Bewok 7% and 9% and 6% and 8% on B 3731
genotypes. The cotyledonary stage and maturation of SE from petek genotype was
enhanced 5% dan 8% by proline addition. On the contrary, the addition of glutamine on
medium decresed cotyledonary stage and maturation of SE from 3 soybean genotypes.
Key word: amino acid, cotyledonary stage SE, maturation, SE soybean.

Email: mastuti7@brawijaya.ac.id
The 1st International Conference of Crop Security, Brawijaya University, Malang,
Indonesia.September 20th - 22nd , 2005
30The production of virus free patchouli seedlings and the development of

serological virus detection tool
Sedyo Hartono, Aminatun Munawarti, Retno Mastuti, Serafinah Indriani, and Siti
Subandiyah
.
Abstract
The supply of disease free seedlings of Pogostemon spp or patchouli is very important to
improve the production of the aromatic compound. Patchouli Mottle Virus (PatMoV) is
the most severe disease on patchouli. Serological detection tool for the disease was
developed in this research. Explants for in vitro propagation of Pogostemon cablin was
obtained from healthy plant originated from non endemic area. Disinfection technique
was applied by immersing the explants in 0.5% NaOC1 for 20 minutes and rinsed in
sterile distilled water. The most optimum medium for inducing shoots was MS medium
supplemented with 1 mg/L of NA\ and 0.1 mg/L of BAP produced more than 50
shoots/explant. The best medium for inducing callus was containing 0.1 mg/mi of 2,4-D.
Shoot was appeared in the culture 19 days after planting, whereas callus was emerged 12
days after planting. Virus isolation was conducted on Chenopodium amaraticolor
resulted on the homogenous local lesions 6 days after inoculation. Virus purification was
obtained from 200 g inoculated leaves resulted on 2 ml virus solution with the
concentration of 1 mg/ml. Polyclonal antibodies were produced on rabbits. Harvested
antiserum was used for further research of virus detection by I-ELISA. The antibodies
were positively reacted with purified viruses at the concentration of 10 ?g, infected field
collection of patchouli, and inoculated C. amaranticolor. On the other hand symptom-
less field samples of patchouli and healthy and plantlets gave negative reaction with the
antibodies. This is the first report of cheap practical antibody production for PatMoV
detection in Indonesia
Key words: in vitro propagation, Pogostemon cablin, polyclonal antibodies, Patchouli

Mottle Virus
Email : ssubandiyah@yahoo.com or
Journal of International Development and Cooperation (2003) 10: 1-10
31Annual growth and phenology of Kyllinga brevifolia (rottb.) hassk.

in temperate and tropical regions
Azrianingsih Rodiyati and Nobukazu Nakagoshi

Abstract
Biomass and inflorescence number of Kyllinga brevifolia were surveyed in Hiroshima
Prefecture, Japan (34?18? to 25?N, 132?26? to 45?E) and in Malang, Indonesia (7?44? to
8?26?S, 112?12? to 57?E) to gain understanding of its survivorship in temperate and
tropical regions. Monthly observations were conducted by using 1m2 plots of six study
sites in Hiroshima from April 2000 to April 2001 while observations in Malang were
carried out in ten study sites four times a year from March 2000 to March 2001.
Considering to developmental stages in the temperate zone, the growing period of K.
brevifolia started in the early of April as the beginning of bud sprouting and vegetative
development. The generative organ started to appear in the end of May and the first
matured in the last week of June. The growing period of K. brevifolia underwent until
December 2000 with a peak in August. The inflorescences appeared from May to
December where its maximum number was in October. Average daily temperature was
significant correlated with the biomass pattern (r2=0.792). On the other hand, in the
tropical region this plant grew and flowered throughout the year with peaks of biomass
and inflorescence number were in the end of the rainy season (March 2000/2001). The
inflorescence number was minimum in the dry season (July 2000) while the lowest
biomass occurred in the early rainy season (November 2000). Furthermore, the pattern of
average daily precipitation appeared to be most similar with the flowering pattern. These
diverse patterns of productivity and flowering of K. brevifolia may explain a great
adaptation of this weed to different climate across the regions.
Key words: climatic zone, Cyperus brevifolius, invader species, life history, seasonality,
weed.
Email : rodiyati@brawijaya.ac.id
----------------------------------------------------------------------------------------------------------
32Eksplorasi tanaman obat berkhasiat antihipertensi di kota

dan kabupaten Malang
Dessy Natalian Wulansari, Rodliyati Azrianingsih,.Jati Batoro
Abstrak
Penelitian mi bertujuan untuk mengetahui jenis-jenis, karakter mortologi dan ekologi
tanaman obat berkhasiat antihipertensi yang tumbuh di Kota dan Kabupaten Malang,
serta mengetahui persebaran tanaman tersebut berdasarkan pengalaman dan penduduk.
Eksplorasi tanaman obat dilakukan Kabupaten dan Kota Malang yang meliputi 33
kecamatan di Kabupaten dan 5 kecamatan di Kota Malang. Penelitian ini bersifat
eksploratif-deskriptif melalui pengumpulan data dan lima responden di tiap kecamatan,
yang digolongkan terdidik Toga dan tidak terdidik Toga. Selanjutnya tanaman obat yang
diperoleh diidentifikasi dan dibuat herbarium. Data responden, tanaman obat dan
penggunaannya dianalisis dengan statistic sederhana dan visual-aids, menggunakan
program komputer (Microsoft Excel dan Microsoft Access). Dan hasil eksplorasi
tanaman obat di Kota dan Kabupaten Malang ditemukan 55 jenis tanaman obat berkhasiat
antihipentensi, yang termasuk dalam 35 tamili. Selain itu didapatkan 6 macam ramuan.
Tanaman yang paling banyak direkomendasikan oleh masyarakat Malang sebagai
antihipertensi adalah mengkudu (Morinda citnifolia L.) 13 %, alpukat (Persea gratissima
Gaertn.) 11 %, ciplukan (Physalis minima L.) dan mentimun (Cucumis sativus L.) 7 %,
binahong (Anredera cordifolia (Tenore) Steenis.) 6 %, seledri (Apium graveolens L.) 5 %
dan blimbing wuluh (Averrhoa bilimbi L.) 4 %. Sedangkan responden terbanyak yang
merekomendasikan fanaman obat antihipertensi adalah responden dengan usia antara 41-
50 tahun (35 %). Dan 82 orang responden, 26 responden terdidik TOGA (32 %) dan 56
responden (68 %) tidak terdidik TOGA. Pada responden terdidik TOGA untuk kisaran
usia 41-50 tahun menunjukkan persentase jumlah responden paling tinggi (15 %),
sedangkan jumlah responden tidak terdidik TOGA tertinggi yaitu pada kisaran usia 31-
40 tahun (26 %). Dan eksplorasi mi ditemukan dua jenis tanaman antihipertensi yang
belum pernah dipublikasikan pada literatur-literatur sebelumnya, yaitu delapan dewa atau
manik-manik dan valerian hutan.
Kata kunci : antihipertensi, eksplorasi, malang, tanaman obat, toga (tanaman obat
keluarga)
HIKOBIA (2001) 13:355-362.
33Morphological variability of Kyllinga found in malang, indonesia:

a perception for its taxonomy
Rodliyati Azrianingsih, Nobukazu Nakagoshi and Yuji Isagi
Abstract
Morphological variability of Kyllinga found in Malang, Indonesia was observed based on
ten identified characters selected from previous dichotomous keys (Delahaussaye &
Thieret 1967; Kern 1974; Bryson et al. 1997). The samples were taken from ten study
sites where the first 5 groups of variants were based on color and head number of
inflorescence. Their position was recognized using a table key formed from the ranked
appropriate characters and referred to the established species from Malesiana (Kern
1974) and Java (Backer 1968) region. Cluster analysis was done to support their position.
This study revealed that the tree variants, having white inflorescence, were in similar
position with Cyperus kyllingia. The two variants, having green inflorescence, were in
similar with C. brevifolius. The five variants found in this study showed wide
morphological variability than the referred species described previously. However, based
on the cluster analysis, the five variants were close position in a cluster and they showed
not much differentiated variability.
Keywords : Kyllinga, dichotomous keys, Cluster analysis
ENVIRONMENTAL AND EXPERIMENTAL BOTANY

53 (2005) 259-269
34Responses of cyperus brevifolius (rottb.) hassk. and cyperus kyllingia
endl. to varying soil water availability
Azrianingsih Rodliyati, Endang Arisoesilaningsih, Yuji Isagi, Nobukazu Nakagoshi
Abstract
Different responses of Different responses of Cyperus brevifolius and Cyperus kyllingia
to varying soil water regimes were examined to explain their successful existence in a
diverse range of habitats throughout the year in Indonesia. Thirty 43-day sprouts of each
species were grown in three soil conditions, namely drought, field capacity, and flooding
under greenhouse conditions. Plant height, leaf length, tiller number, and flower number
were measured twice a week, from 45 to 98 days after sowing (DAS), while the other 12
traits were recorded at the end of the observation time. Ten out of the twelve traits were
substantially influenced by the soil water content. Both species exhibited their best
growth, production, and reproduction under field capacity conditions, and these traits
were greatly subdued under drought conditions. Under drought conditions, both species
manifested reduced growth and leaf expansion; however, stomatal aperture and frequency
did not exhibit strong response to the soil water content. C. brevifolius showed a
significantly greater biomass production and reproductive traits in field capacity and
flooded conditions, but under drought conditions, growth was greatly hampered and only
vegetative propagation occurred. On the other hand, C. kyllingia showed a higher
tolerance to drought conditions, indicated by both a higher biomass and a higher number
of flowers. The results obtained suggest that survival ability when faced with drought
conditions was more apparent in C. kyllingia than in C. brevifolius, but where there was
sufficient soil water, C. brevifolius was more prolific. This could be the explanation for
the dominance of C.brevifolius in flooded areas and during the rainy season, and the
occurrence of C. kyllingia in wider range of habitats throughout the year.
Keywords: Drought; Flooding; Indonesia; Invasive species; Water stress; Weed

E-mail: rodiyati@brawijaya.ac.id
BIOTA VOL. 12 (2007) 1: 47-54, ISSN 0853-8670
35In vitro antagonism test of trichoderma sp. and gliocladium sp. on

fusarium causing wilt disease on various banana plants at purwodadi
botanical garden
Suharjono, Tri Handayani Kurniati, Soejono dan Susanti Dewi
Abstract
Purwodadi Botanical Garden has more than one hundred collection of cultivated bananas.
The major problem in keeping their existency is the occurring of Fusarium wilt disease
which has commonly controlled by pesticide or eradication to terminate the infectious
cycles. Trichoderma and Gliocladium were frequently used as antagonist fungus in
controlling the Fusarium wilt disease in kenaf, tomato or the other plants. So, this study
aims was to know the potency of Trichoderma and Gliocladium on Fusarium growth
inhibition. The experimental design was done by Randomized Complete Design Factorial
using three factors i.e. antagonist fungus, Fusarium and growth distance. The level of
retardation was measured by the growth distance of Fusarium that interacted to
antagonist fungus and data analysis were conducted by Analysis of Variance (ANOVA).
The results showed that Trichoderma has higher inhibition than Gliocladium and the
highest inhibition occurred at 1 cm distance of inoculum which was performed on
Fusarium 4 (77.78%). There was not any significant differencies between Fusarium 1
with Trichoderma (73.55%) and Fusarium 2 with Gliocladium (73.33%). At 2 cm
distance, the highest inhibition occurred in Fusarium 3 by Trichoderma (72.71%), which
was not significantly different with Fusarium 1, 2 and 4. While at 3 cm distance, the
highest inhibition on Fusarium 4 by Trichoderma was 51.11% and not significantly
different from Fusarium 1, 2 and 3.
Key word: Fusarium wilt disease, Trichoderma, Gliocladium, antagonist fungus

Email : calistus@brawijaya.ac.id
BIOTA VOL. IX (2): 119-124, JUNI 2004

ISSN 0853-8670
36Numerical Systematics of Linear Alkylbenzene Sulphonate-Degrading

Pseudomonas Strains Based on Phenotype Character and Protein
Fingerprinting
Suharjono, Langkah Sembiring, Jusup Subagja, Tri Ardyati, Lisa Lisdiana
Abstract
Bacteria strains consisting of Pseudomonas sp. Strain J and R isolated from river
ecosystem polluted and Pseudomonas sp. Strain A and B isolated from river ecosystem
unpolluted by detergent were capable to degrade of LAS. The objective of this research
was to determine similarity value by numerically of LAS-degrading Pseudomonas strains
based on phenotype character and protein fingerprinting using three reference strains
consist of Pseudomonas putida FNCC071, P. fluorescens FNCC070, and P. aeruginosa
FNCC063. Phenotype characteristics examined are cellular and colony morphology,
biochemical nature, capability to degrade polysaccharide, tolerance to various
environmental factors and antibiotics, and ability to ferment sugar. Cellular protein
fingerprinting was analyzed using SDS-PAGE discontinuous. Strains classification was
determined based on Simple Matching Method similarity index by UPGMA (Unweight
Pair Group Method with Average) algorithm. Based on phenotype nature, all strains have
similarity value 0.61; however, based on cellular protein fingerprinting, those strains have
similarity value 0.52. All strains of LAS-degraded were included in the genus of
Pseudomonas.
Key words: Pseudomonas strains, phenotype character, numerical systematic, protein

fingerprinting, similarity
37PROSEDING RESEARCH AND STUDIES III
TPSDP 2006
Seleksi strain bakteri anggota genus Pseudomonas pengurai LAS (Linear
Alkylbenzene Sulphonate) berdasarkan uji potensi dan analisis dna plasmid
Suharjono, Tri Ardyati, dan Umi Marwati
Abstract
LAS is one of the main pollutant in river water ecosystem. Fifteen strains of
Pseudomonas isolated from detergent pollutant river ecosystem were able to degrade
LAS. Based on growth ability of some strains, four strains (A, B, J and R) were chosen
and Pseudomonas putida FNCC-071 was used as standard strain. Strain J and R were
acclimated in simple mineral media using LAS as carbon source. The potency of bacteria
to degrade LAS was carried out in simple mineral media using LAS as carbon source.
Similarity among strains and standard Pseudomonas aeruginosa FN CC063, P.
fluorescens FNCC070 and P. putida FNCC071 were tested by UPGMA (Unweighted
Pair Group Method with Averages) algorithm based on phenotype and plasmid profile.
Test strains include in member of Pseudomonas genus because has similarity index more
than 62% compare to standard strains. Pseudomonas sp strain J and R have ability and
potency to degrade LAS better than P. putida FNCC-071 and Pseudomonas strain A and
B. The optimal growth of Pseudomonas strain J and R at LAS concentration of 150
mg/L, however, P. putida FNCC-071, Pseudomonas strain A and B at LAS concentration
of 75 mg/L. Each of Pseudomonas strain J and R able to degrade LAS at 52,67% and
48,9%, respectively, however, P. putida FNCC-071 able to degrade LAS at 34,97% for
four days. Pseudomonas strain A and B able to degrade LAS at 40,94% and 46,39%
respectively for nine days. The plasmid of test strain could not be analyzed yet because of
contamination with protein and carbohydrate. It is conclude that growth ability and
potency of Pseudomonas strain J and R adapted detergent pollution (LAS) are higher
than P. putida FNCC-071 and Pseudomonas strain A and B
Key words: Pseudomonas, LAS, river ecosystem, biodegradation

Seminar Nasional Biologi, Program Studi Biologi FMIPA-ITS, 25 September 2004
38Kekerabatan kultivar pisang (Musa paradisiaca L)koleksi kebun raya

Purwodadi, Pasuruan
Serafinah Indriyani, Soejono dan Febrinayani
Abstrak
Tujuan penelitian adalah menganalisis diversitas morfologi dan pola pita protein
dikaitkan dengan kekerabatan di antara 11 kultivar pisang koleksi Kebun Raya
Purwodadi Pasuruan. Metode penelitian deskriptif digunakan untuk mengamati karakter
morfologi batang semu, daun, perbungaan dan buah; sedangkan karakter molekuler yang
diamati adalah pola pita protein. Daun pisang yang masih menggulung diekstraksi dengan
menggunakan metode Fernandez dan dianalisis proteinnya dengan elektroforesis SDS-
PAGE. Pita-pita protein yang terseparasi pada gel poliakrilamid 12% ditentukan nifai
mobilitas relatif (Rf) dan berat molekul (BM) nya. Selanjutnya dianalisis kekerabatannya
dengan menggunakan program Clad97. Hasil penelitian menunjukkan bahwa diversitas
morfologi terbesar didapatkan pada karakter warna bagian dalam dan luar dan batang
semu serta warna bercak batarg semu bagian dalam. Diversitas pola pita protein
didapatkan 20 macam pita protein yang memiliki BM 13,97 ? 121,20 kD. Berdasarkan
analisis kekerabatan 11 kultivar pisang dihubungkan pada jarak fenetik sebesar 64%.
Jarak fenetik terbesar didapatkan sebesar 84% yang menghubungkan pisang Photo
dengan Ronggolawe.
Kata kunci: kekerabatan, kultivar pisang, morfologi, pita protein

Email :
39Root anatomical structure of seedling in soybean [Glycine max (L.)

Merr.] varietas on drought stres
Serafinah Indriyani, Wahvu Widoretno. Rita Fajar Khoirul Aulia
Abstract
The objective of the experiment was to evaluate the effects of drought stress that
simulated by polyethylene glycol (PEG) on changes of seedling root anatomy structure in
soybean varieties. This experiment was carried out in a complete randomized factorials
design and the data were analyzed by analysis of variance test using SPSS 11.5 for
windows software and using LSD α 5%. Germination test was conducted by growing
soybean seeds on sand media containing PEG 0%. 5%. 10%. 15% and 20% during 5
days. Observation of root anatomy structure was conducted by doing semi permanent
slides from transversal section of base of seedling root. Drought stress decreased
epidermis and cortex width, stele diameter, metaxylem number and diameter. The
inhibition of the changes of root anatomy increased with decreasing of water potential.
Each soybean variety showed different root anatomy changes on several water potentials.
There were correlation between the level of drought stress tolerance on soybean and
anatomical structure of base of seedling root under drought stress condition. Soybean
varieties that have higher drought tolerance levels tend to have lower reduction of stele
diameter. metaxylem number and diameter.
Keywords: PEG, drought stress. metaxylem, stele
Email :
----------------------------------------------------------------------------------------------------------
Seminar Nasional Konservasi dan Pendayagunaan Keanekaragaman Tumbuhan Lahan Kering
40Anatomical study of the drought resistant variety of soybean (Glycine

max (L.) Merr.)
Serafinah Indriyani, Estri Laras Arumingiyas, Endang Arisoesilaningsih
Abstract
As a food crop, soybean is important to be cultivated on fertile and drought field. The
objectives are to know and analyze the anatomical structure of the stem and leaf of the
drought resistant and non resistant variety of Soybean. The experiment was conducted
used a Completely Randomized Design factorial 2x3 and repealed four times, the data
were analyzed by Anova and if there is different it will be tested by LSD α 5%. the
descriptive analysis, as were. The results show that anatomically the stem consists of
epidermis layer, cortex layers, vascular layers and pith layers, then the leaf consists of
upper epidermis layer, mesophyll layers that can be divided into two parts. They are
palisade and sponge layers also lower epidermis layer. There is no differences among
varieties of Soybean in normal and drought condition for anatomically parameters of the
stem and leaf, except cortex layers in Wilis variety.
Keywords : anatomy, stem, leaf
Email : s.indriyani@brawijaya.ac.id
JURNAL NATURAL Vol.6 (No.2)
41Developmental study of reproduction structure in cacao (Theobroma

cacao L.)
Serafinah Indriyani
Abstract
The research of developmental study of reproduction structure in cacao was done to
analyze sporogenesis and gametogenesis. Morphological observation was done by
measuring the length of flower bud with calyper from 1 mm length until anthesis.
Anatomical observation was done by micotomy section of some lowers bud stadium. The
results showed that microsporogenesis occured on 13 to 11 days before anthesis of lower
bud with 1,25 to 2,00 mm length. Microgametogenesis occured when pollen had
pollinated pistil. Megasporogenesis occured on 9 to 5 days before anthesis of flower bud
with 2,50 to 4,00 mm length, and megasporogenesis occured on 4 to 1 days before
anthesis of flower bud with 5,00 to 6,20 mm length. In anthesis lower, ovum located in
ovulum is ready to be fertilized.
Key words : Development. sporogenesis, gametogenesis. cacao.
Email : s.indriyani@brawijaya.ac.id
-----------------------------------------------------------------------------------------------------------
-
Berkala Penelitian Hayati (2006) 12 :1-5
42Analisis isoenzym untuk mempelajari variasi genetic sapi Bali di provinsi

Bali
Sri Rahayu, SB Sumitro, T Susilawati, dan Soemarno
Abstract
The aim of this research was to know Bali cattle genetic variation according to the band
pattern of isoenzyme. Esterase and Malate dehydrogenase Isoenzymes of Bali cattle were
studied. Using the native-PAGE method, the analysis has been made of the genetic
structure and variation of the bali cattle population. Isoenzyme isolated from leucocytes
cell using homogenation method by adding Phosphat Buffer Saline (PBS). A hundred
sample of Bali cattles were taken in Mambang, Slemadeg and Kuwumkeladi. The result
of this research indicate that from the 2 different enzyme, 3 loci were detected, and 1 of
them was polymorphic (MDH-2). There was null allele phenomenom in MDH-2 locus.
The loci polymorphic proportion of three population were 0,333. Chi-Square analysis of
three population were 1.251-1.560. The heterozygosity value of three population
(Mambang, Slemadeg, and Kuwumkeladi) were 0.098, 0.111 and 0.118, respectively.
Key words : esterase, malate dehydrogenase, isoenzyme, bali cattle, genetic variation
Jurnal Ilmu-Ilmu Hayati (Life Sciences) (2003) 15
43Bovine DNA amplification using bTSPY spesific male primer by

employing a polymerase chain reaction (PCR)
S, Rahayu, S.B. Sumitro, Fatchiyah,G. Ciptadi, dan M.S. Djati
Abstract
Determining the sex of bovine embrios before transfer are of considerably commercial
value, however, until the present time an efficient and practical test has yet to be found,
especially for local breeds. Currently, the method for determining embrio sex is a
molecular approach, one of which is the PCR system. By using the Y specific DNA
primer, bTSPY, this research attempted to discover whether the specificy DNA primer,
bTSPY, could amplify bovine DNA.
The DNA was isolated from blood samples by use of ?a salting out? method. DNA
amplification was carried out by PCR by employing the Y specific, bTSPY. The DNA
sample was then amplified by the Perkin Elmer Gene Amp PCR System for 35 cycles.
Each cycle consisted of DNA template denaturalization at 95 ?C for 1? minutes. After
this, primer annealing was implemented at 57 ?C for 1? minutes, and extended for a
further 2 minutes at 72 ?C. The cycles commenced with a hot start of 95 ?C for 5
minutes, and ended with incubation at 72 ?C for 7 minutes.
The results showed that the specific Y DNA primer bTSPY 5?-
AGTGCACTGCTTATACGGTCAGACT-3?, could amplify bovine DNA by forming a
DNA band of 2.494bp.
Keywords : Embryo, bTSPY, PCR
Berkala Penelitian Hayati: 12 (7-11), 2006

44polymorphism Identification of gene GH on Bali cattle using PCR-RFLP
method
Sri Rahayu, SB Sumitro, T Susilawati, dan Soemarno
Abstract
This study was conducted to identify polymorphism of growth hormone gene of Bali
cattle. A PCR-RFLP (polymerase chain reaction ? restriction fragment length
polymorphism) procedure was develop for determining polymorphism of growth
hormone gene. The DNA was isolated from blood samples by salting out method. Total
DNA were amplified with forward primer. 5?-TAGGGGAGGGTGGAAAATGGA-3?
and reverse primer, 5?-GACACCTACTCAGACAATGCG-3?. The PCR product was
digested by HaeIII restriction enzyme. Result of the amplification was a specific single
band with fragment 450 bp. Restriction with HaeIII restriction enzyme resulted four
kinds of haplotype. Haplotype I was not cut by HaeIII restriction enzyme. Haplotype II
were cut into two, 225 bp and 150 bp. Haplotype III were cut into three size, 400 bp, 225
bp, and 150 bp. Haplotype IV were cut into five fragments 450 bp, 400 bp, 275 bp, 225
bp and 150 bp.
Key words : Bali cattle, growth hormone gene, PCR, RFLP, HaeIII restriction enzyme
45Study polymorphism of growth hormone gene on Madura cattle in

Sumenep district using PCR-RFLP technique
Suyadi, N. lsnaini dan S. Rahayu
Abstract
Polymorphism of growth hormone gene was studied in Madura Cattle from Sumenep
using a technique of PCR-RFLP. GHE-primer consisting forward: 5?-
TAGGGGAGGGTGGAAAATGGA-3?; reverse: 5?-
GACACCTACTCAGACAATGCG 3? was used for amplification of DNA genome
isolated before. DNA-PCR product was analyzed for polymorphism using HaeIII
restriction enzyme. Amplificated DNA showed a single band of 450 bp. Digestion by
Hae III restriction enzyme resulted 6 haplotypes with different DNA fragments, i.e. not
restricted fragment, restricted at 125 bp, 200 bp, 275 bp, 325 bp, and 375 bp,
respectively.
Key words :Madura cattle, growth hormone gene, PCR, RFLP, HaeIII restriction enzyme
Jurnal Ilmu-Ilmu Hayati (Life Sciences) (2000) 12
46The detection of stress proteins in diary cattle to determine more suitable

stable areas vis- is comfort
G. CiptadiS. Rahayudan T. Susilawati
Abstract
The objective of this study was to research and detect the appearance of stress protein in
Friesian dairy cattle (FH) serum with the possibility of employing the findings as an
alternative and better method of determining the physiology and comfort of these cattle.
There is a hypothesis that extreme microclimatic conditions coupled with feed can induce
environmental stress that can be detected molecularly.
The study was conducted in the field on 40 dairy FH and PFH cows. Physiological
parameters observed were body temperatures, pulse and respiration rates, monitoring was
emplemented to record any incidence of stress proteins in blood serum by using SDS-
Page method (Laemli 1970). The data analysis on physiological status was done using T-
Tests and by a descriptive analysis for any appearance of stress proteins.
Study results show that the physiological status of FH cows depends a great deal on
management, which in turn strongly influences (P<0.01) pulse rates (61.4 vs 71.6 in areas
900 m above seal level) and respiratory speed (24.0 vs 39.0 at 900 m above sea level, and
25.6 vs 38.2 at 600 m above sea level). In PFH cows there was no significant effect on
variables. The physiological status of these cows were within normal limits. However,
differing serum protein patterns were observed between animals, with cows in poorer
condition having more variation in protein patterns. More detailed immunological studies
are required to provide firm confirmation of the above by using the western blotting
method.
Key words : Animal physiology, stress protein, dairy cow.
BIOLOGY IN ASIA INTERNATIONAL CONFERENCE

SINGAPURA, 2004
47Diversity of edible mushroom species in three conservation area

Seloliman forest, Cangar forest and Purwodadi botanical garden
Tri Ardyati
Abstract
Edible mushroom is one of the high mutritious sources of protein, efficiently produce in
large amount. As a mega-diversity country, Indonesia has many species of edible
mushroom which are not identified yet. Recently, a small number of them have been
commercially cultivated for example: Pleurotus ostreatus, Volvariella volvacea and
Auricularia sp. The objective of this research was to obtain information about diversity of
edible mushroom species from some conservation area: Trawas Forest, Cangar Forest and
Purwodadi Botanical Garden. After recognized their diversity in some area, in the next
research we try cultivate them commercially. It will be a good prospect to improve the
diversity of edible mushroom species and also to overcome the requirement of protein.
From the three sampling area, we got twelve species of edible mushroom. In
Trawas Forest we found seven species identified as: Canthariellus cibarius (Gajih
mushroom), Auricularia sp. (Kuping mushroom), Pleurotus cystidus (Cepaki mushroom),
Camarophyllus virgineus (Gagang mushroom), Lactarius sp. (Lot A mushroom),
Clitocybe spp.1 (Lot B mushroom), Clytocybe spp.2 (Lot C mushroom). In Cangar Forest
we found Plerotus sp. (Oyster mushroom) and Schizophyllum commune (Gerigit
mushroom). Finally in Botanical Garden we found Auricularia sp. (Kuping mushroom),
Termytomyces albinos (Barat mushroom), Plerotus flabellatus (Cikrek mushroom),
Schizophyllum commune (Jamur Gerigit) and Gymnopus sp. (Jamur Bulan).
Key words: Edible mushroom, diversity, conservation area
Email :triardy@brawijaya.ac.id
PANDUAN DAN KUMPULAN ABSTRAK

PERTEMUAN ILMIAH TAHUNAN
PERHIMPUNAN MIKROBIOLOGI INDONESIA
Semarang, 27-28 Agustus 2004
48Kloning gen xylanase (xynil) dari jamur yang toleran terhadap kondisi
alkali Acremonium sp TM-28
Tri Ardyati
Abstrak
An alkali-tolerant filamentous fungus, Acremonium sp. TM-28 was able to produce
cellulose-free xylanase. This enzyme has potential application on pulp and paper industry
as a bio-bleaching. The xylanase gen (xyn1) encoding an endo-β-1,4-xylanase (XYN1)
from an alkali-tolerant Acremonium sp. TM-28 was cloned and sequenced. The
nucleotide sequence of the xyn1 was determined, reveals an open reading frame of 622
bp, interrupted by a single intron of 55 bp and encodes a 224 amino acid residues with
molecular mass of 24,3 kDa. Comparison of the deduced amino acid sequence to other
fungal xylanases showed that XYN1 sharing a high degree of similarity with
Thermomyces lanuginosus (72%) and Chocliobolus carbonum (69.2%), indicating the
XYN1 belongs to family 11 of glycosyl hydrolases.
Key words: cloning, xylanase gene, Acremonium sp. TM-28
PANDUAN SEMINAR NASIONAL RESEARCH AND STUDIES III

Yogyakarta, 11-13 Februari 2004
49Perbaikan metode pembelajaran mata kuliah mikrobiologi umum melalui

peningkatan kualitas alat bantu dan pengadaan tutorial
Tri Handayani Kurniati, Tri Ardyati, MSgr, Suharjono, Umi Marwati
Ringkasan
Mikrobiologi Umum (MU) merupaka mata kuliah wajib yang ditawarkan pada
mahasiswa semester lima dengan bobot 4 sks, meliputi 2 sks kuliah dan 2 sks praktikum.
Sebagai mata kuliah wajib, dalam tiap semester peserta mata kuliah ini cukup banyak
(50-60 orang). Banyaknya jumlah mahasiswa serta cakupan materi yang luas (melibatkan
banyak ilmu) seperti biokimia, biologi sel, geentika dan kimia analitik menyebabkan
tingkat pemahaman dan hasil belajar mahasiswa terhadap mata kuliah ini masih rendah
dan pada akhirnya tingkat keberhasilan mata kuliah ini juga rendah. Hal ini ditunjukkan
dari hasil kuisioner rutin yang dilaksanakan oleh jurusan biologi terhadap proses belajar
mengajar tahun ajaran 2002/2003 dengan kesimpulan akhir mata kuliah ini perlu
perbaikan (lebih dari 15% responden memberikan nilai kurang).
Salah satu tolok ukur yang dipakai untuk melihat keberhasilan proses belajar mengajar
adalah nilai akhir yang diperoleh mahasiswa. Berdasarkan data semester sebelumnya,
baru 7,9% peserta mata kuliah ini yang mendapat nilai A; 38,8% mendapatkan nilai B
dan B+; sedang sebagian besar (47,1%) masih mendapatkan nilai C dan C+. Metode
perbaikan yang dilakukan pada perkuliahan adalah dengan pengadaan lecture note, serta
peningkatan kualitas alat bantu seperti penggunaan transparansi berwarna dan LCD.
Kualitas pelaksanaan praktikum juga ditingkatkan dengan memperbaiki petunjuk
praktikum yang telah ada dan penggunaan alat bantu yang dapat mempermudah
mahasiswa mengikuti dan memahami aktivitas praktikum. Selain itu untuk meningkatkan
peluang berdiskusi diadakan tutorial. Hasil kegiatan menunjukkan bahwa usaha
perbaikan yang dilakukan memberikan peningkatan pemahaman dan hasil belajar
mahasiswa. Hal ini antara lain ditunjukkan oleh nilai UTS, nilai UAS serta nilai Ujian
Akhir Praktikum (UAP) yang meningkat dibandingkan dengan nilai tahun sebelumnya.
Disamping itu diketahui pula bahwa hasil belajar mahasiswa juga meningkat berdasarkan
hasil kuisioner.
Kata kunci : UTS, UAS, UAP, alat Bantu
PERTEMUAN ILMIAH TAHUNAN

PERHIMPUNAN MIKROBIOLOGI INDONESIA
Solo, 2006
50The potency of lactic acid bacteria isolates TLA-15 and TLA-20 as

probiotics
Tri Ardyati, Esti Widowati, Arie Srihardiastuti, Yoga Dwi Jatmiko
Abstract
Lactic acid bacteria are dominantly living in milk and milk products. As probiotics, these
bacteria have characters tolerance to acidity of gastrointestinal tract and bile salt, able to
sompete with other microorganisms and maintain the balance of microflora in intestine
and improve our immunity system.
The objectives of this research was to observe the potency of lactic acid bacteria isolate
of Tulungagung (TLA-15 and TLA-20) as probiotics. Isolates were obtained from molk
produced by Kabupaten Tulungagung using MRS agar and NRLC agar. Both isolates
were selected based on Gram staining, ability of using lactose as carbon source, and
catalase test. The potency as probiotics was tested by tolerance of isolates to acidity of
gastrointestinal tracts at pH 3 to 6, using MRS broth enriched with 0.1% tryptone with
addition of bile salt concentration of 0.3% and 0.5%. Incubation were carried out at 37?C
in both aerob and anaerob conditions for 1 to 3 hours, then the number of viable cells was
counted using TPC method.
Results showed that both isolates viable at pH of gastrointestinal tract. Increasing of pH
and incubation period showed that viable cell of isolate TLA-15 larger than isolate TLA-
20. Both isolates tolerance to bile salts with concentration of 0.3%. Antagonism test of
isolate TLA-15 to Staphylococcus aureus on Nutrient Agar and NRLC Agar resulted
clear zones about 6.6 mm and 2.2 mm, respectively. From some tests mentioned above,
isolate TLA-15 has character as probiotic candidate.
Keywords : TLA-15 and TLA-20, probiotic, MRS agar and NRLC agar
Jurnal Hayati( 2002) 9. ISSN 0854-8587
51Effectiveness of Polyethylene Glycol for Evaluating Response of Soybean

at Germination Stage Against Drought Stress
Wahyu Widoretno ,Edi Guhardja, Satriyas Ilyas, Sudarsono
Abstract
The objectives of this experiment were to evaluate responses of soybean genotype to
drought stress generated by polyethylene glycol (PEG) supplementation at germination
stage. Evaluations were conducted using four soybean genotypes (MLG2999,
MLG2805, B3731, and MSC8606) and two soybean varieties (Dieng and Kerinci). The
results indicated that supplementation of PEG in the germination medium reduced
germination responses of the soybean seeds. Drought tolerance soybean exhibited
different germination responses than that of drought sensitive one. Soybean genotypes
that were drought tolerance showed higher index of seed emmergence at 20% PEG, root
length at 10% PEG, seedling dry weight and hypocotyl length at 5% PEG, respectively,
than the sensitive one. This result confirmed MLG2805 as drought tolerance, and
MSC8606 as drought sensitive representatives soybean genotypes. Index of seed
emmergence at 20% PEG and index of hypocotyls length at 5% PEG can be used to
select drought resistance soybean at germination stage.
Keywords : drought stress, PEG, drought tolerance, drought sensitive
Jurnal Hayati ( 2004) 11: 11-20 ISSN 0854-8587
52Evaluation on a Number of Soybean Drought Tolerance Somaclones

Generated from In Vitro Selection
Wahyu Widoretno, Sudarsono*
Abstract
The objectives of this experiment were to evaluate the response against drought stress of
soybean somaclonal variants derived from in vitro selection of somatic embryos on
medium containing polyethylene glycol (PEG), to identify drought tolerance somaclones,
and to evaluate proline and total sugar content of the plants grown under water stress and
non-stress conditions. For each SC1 soybean genotype, 12 SC2 progenies derived from
its respective SC1 plants were grown in the plastic house under non-stress condition until
flowering period. At the flowering stage, six plants were kept under non-stress conditions
and the others were subjected to stress by watering the plants every four days. The stress
treatment was conducted up to harvesting. Leaf praline and total sugar content were
determined after 14 days of initial stress. During harvest, various vegetatif and generative
characters were measured and used to calculate drought sensitivity index and to
determine the response of evaluated genotypes against drought. Results of the
experiments indicated under the described stress condition, original soybean genotype
B3731 was identified as medium tolerance while MLG2999 and MSC8606 were drought
sensitive. On the other hand, a number of SC2 somaclones developed from somatic
embryos regenerated on selective medium containing 20% PEG were identified as
drought tolerance based on their drought sensitivity index. Drought tolerance somaclones
were identified from B3731 (medium tolerance genotypes), MLG2999 and MSC8606
(drought sensitive genotypes) at the frequency of 55%, 11%, and 33%, respectively.
Drought tolerance somaclones accumulated much higher praline than the original lines or
the drought sensitive somaclones. Total sugar accumulation showed no specific pattern
associated with the response of the original genotypes or somaclones against drought
stress.
Keywords : PEG, drought tolerance somaclones, proline ,total sugar
Jurnal Hayati, Desember (2003)10: 134-139 ISSN 0854-8587

53Responses of Soybean Somatic Embryos to Polyethylene Glycol and Its
Uses for In Vitro Selection of Soybean Against Drought Stress
Wahyu Widoretno, Rita Megia, Sudarsono
Abstract
The objectives of this experiment were to determined the ability of polyethylene glycol
(PEG) to suppress soybean somatic embryos (SE) regeneration, to determine the use PEG
as selective agent in the medium, and the regeneration of plantlet from in vitro selected
SE on medium containing PEG. To determine the effect of PEG on regeneration, SE from
three soybean genotypes B3731, Tidar and MSC8606 were subjected to selective medium
containing 0, 5, 10, 15, and 20% PEG. In vitro selection to identify variant SE, that were
tolerance to stress condition due to PEG, was conducted by exposing SE of soybean
genotypes B3731, MLG2999, and MSC8606 directly to the medium containing 20%
PEG for three months or by subjecting them subsequently to 10%, 15%, or 20% PEG,
each for one month period, respectively. The secondary somatic embryos developed from
explants from the selective medium were germinated and regenerated. The results
showed that selective medium containing PEG inhibited soybean SE development. The
sub-lethal level (lethal dose > 95%) were identified at concentration of 20% PEG. Direct
selection at 20% PEG resulted in less SE survival than that through stepwise increased of
PEG concentration. However, the results of the later approach of in vitro selection gave
more escaped. At the end in vitro selection 98 plantlets were regenerated from SE that
tolerated stress condition due to PEG. The plantlets were grown in the glass house to
produce SC2 and SC3 generation of seeds.
Keywords : PEG, regeneration, somatic embryos (SE), development
Jurnal Hayati, September (2003) 10:110-117 ISSN 0854-8587
54Variation in Qualitative and Quantitative Characters among

Somaclones of Soybean derived from In Vitro Selected Somatic Embryo
Wahyu Widoretno, Said Harran, Sudarsono
Abstract
The objectives of this experiment were to regenerate population of soybean somaclonal
variants from somatic embryos (SE), evaluate the existence of variation on qualitative
characters, and identify the genetics or epigenetics nature of the variant phenotypes
among population of somaclonal variants. Somatic embryos were induced on selective
medium containing 20% polyethylene glycol (PEG). The SE that was tolerance to stress
due to PEG in the media was germinated and population of somaclonal variant lines
derived from three soybean genotypes (B3731, MLG2999, and MSC8606) were
developed. Various qualitative and quantitative characters were compared among
population of the original lines and the SC1 and SC2 generation of somaclonal variants.
The genetics and epigenetics nature controlling variant phenotypes were determined by
comparing observation among SC1 and SC2 population. The results showed that large
variation in qualitative and quantitative characters of SC1 population originated from SE
and SC2 population from selfing of SC1. Among qualitative characters, rosette leaf, male
sterility, leaf base fusion, and pentafoliate leaflets were genetically controlled while
multiple shoots and difoliate leaflets were epigenetics. Most of somaclonal variant lines
showed less value for various quantitative characters compared to original lines.
However, a number of somaclonal variants showed relatively higher seed yield compared
to the original lines.
Keywords : Embryo somatic, somaclonal variants, epigenetics
International Conference On Molecular Biology of Life Sciences Brawijaya University,

On November 19-21, 2007
55Study of Gene Expression Using cDNA Microarray Analysis in

Young and Old Tissue of a Resistant Genotype of Chickpea (Cicer
arientinum) in Response to Inoculation with the fungus Ascochyta rabiei
*)
Nunung Harijati , Tristan E Coram, Philip J Keane and Edwin CK Pang
Abstract
By using microarray technology, chickpea gene expression changes in response to A.
rabiei inoculation in young and old tissues of the A. rabiei resistant FLIP94508C
accession were analyzed over a time course (24, 48 and 72 h post-inoculation (hpi)).
Gene expression changes were significant at 24 and 72 hpi, with more occurring at 72
hpi. The young tissue expressed fewer numbers and functional diversity of genes than the
old tissue, especially for the defence category. The total number genes that showed
differential expression in young or old tissues was 7 and 19 genes, respectively. By using
hierarchical cluster analysis, the young tissue at 72 hpi showed two distinct clusters,
where one cluster only consisted of genes within the defence category and the other
cluster included a mix of genes involved in metabolism, cell rescue and cellular
communication. All genes in these clusters were up-regulated. However, in the old tissue
at 72 hpi , one of two clusters included down-regulated genes while the other cluster
contained up-regulated genes. This cluster was composed three groups; two groups
consisted of defence-related genes and the other group was a mix of genes involved in
metabolism, transportation, cell rescue and cellular communication. In the defence
category, PR protein 4A was exclusively expressed in old tissue, while a disease
resistance response protein DRRG49-C was expressed only in young tissue.
Keywords : resistant genotype,Young and old tissue , clustering analysis, defence gene
Email : harijati@brawijaya.ac.id
The Journal of Immunology, 2008, 180: 0000–0000.

56Essential Role of CD8_CD122_ Regulatory T Cells in the
Recovery from Experimental Autoimmune Encephalomyelitis1
Young-Ho Lee,* Yoshiyuki Ishida,† Muhaimin Rifa’i,*‡§ Zhe Shi,* Ken-ichi Isobe,*
and Haruhiko Suzuki2*
Experimental autoimmune encephalomyelitis (EAE) is one of the best-documented
animal models of autoimmune disease. We examined the role of CD8+CD122+regulatory
T cells, which we previously identified as naturally occurring regulatory T cells that
effectively regulate CD8+ T cells, in EAE. Depletion of CD8+CD122+regulatory T cells
by in vivo administration of anti-CD122 mAb resulted in persistent EAE symptoms.
Transfer of CD8+CD122+regulatory T cells into EAE mice at the peak EAE score
clearly improved symptoms, indicating an important role of CD8+CD122+regulatory T
cells in the recovery phase of EAE. This was further confirmed by an increase and a
decrease in the number of infiltrating T cells in the CNS and T cell cytokine production
in mice that were depleted of or complemented with CD8+CD122+cells. Furthermore,
transfer of preactivated CD8+CD122+ regulatory T cells resulted in diminished EAE
symptoms, especially in the recovery phase of EAE. These results elucidate the
essential role of CD8+CD122+regulatory T cells in the recovery phase of EAE and
suggest the preventive effect of preactivated CD8+CD122+_ regulatory T cells for EAE.
Essential
International Immunology 2008; 1 of 11 ª The Japanese Society for Immunology. 2008. All rights reserved.
doi:10.1093/intimm/dxn052 For permissions, please e-mail: journals.permissions@oxfordjournals.org
57CD8+CD122+ regulatory T cells recognize activatedT cells via conventional MHC

class I–abTCRinteraction and become IL-10-producing active regulatory cells
Muhaimin Rifa’i1,2,*, Zhe Shi ,*, Shu-Yun Zhang3, Young Ho Lee , Hiroshi
1 1
Shiku4,5, Ken-ichi Isobe and Haruhiko Suzuki

1 1
1Department of Immunology, Nagoya University Graduate School of Medicine, Nagoya 466-

8550, Japan
2Department of Biology, Faculty of Science, Brawijaya University, Malang 65145, East-Java,
Indonesia
3Department of Occupational and Environmental Health, Nagoya University Graduate School of
Medicine, Nagoya 466-8550, Japan
4Department of Cancer Vaccine and 5Department of Immuno-Gene Therapy, Mie University
Graduate School of Medicine,
Tsu 514-8507, Japan
Keywords: in vitro assay, mouse, suppression, Treg
Abstract
CD8+CD122+ regulatory T cells (CD8+CD122+ Treg) are naturally occurring Treg that
effectively suppress the proliferation and IFN~γ production of both CD8+ and
CD4+target cells. This study investigated the molecular mechanisms of the recognition of
target cells by CD8+CD122+ Treg using an in vitro culture system that reconstitutes the
regulatory action of these cells. Naive CD8+CD122+ Treg co-cultured with pre-activated
T cells became active Treg that produced IL-10 and suppressed IFN~γ production from
the target T cells. CD8+CD122+ Treg effectively suppressed the IFN~γ production of
the target cells of syngeneic mouse strains but not of allogeneic mouse strains with
incompatible MHC. By using MHC-congeneic mouse strains, MHC-restricted uppression
by CD8+CD122+ Treg was further confirmed. The blockade of cell surface molecules
either on the Treg or on the target cells by specific blocking antibodies indicated that H-
2K, H-2D, α β TCR and CD8 were involved in the regulatory action but I-A and Qa-1
were not. These results indicate that CD8+CD122+ Treg recognize already-activated T
cells via the interaction of conventional MHC class I–α β TCR and become active
regulatory cells that produce IL-10 and suppress the target cells.
58Importance of CD80/CD86–CD28 interactions in

the recognition of target cells by CD8+ CD122+
regulatory T cells
Introduction
CD8+ CD122+ regulatory T cells are naturally occurring CD8+ regulatory T cells that
were previously identified by our group.1 These regulatory T cells are indispensably
important in the maintenance of immune homeostasis. CD122-deficient mice that lack
CD8+ CD122+ regulatory T cells are severely sick because of the uncontrolled
expansion of activated T cells.2 T-cell deficient RAG)/) mice supplemented with CD8+
cells, not including CD8+ CD122+ regulatory cells (CD8+ CD122) cells), also
showed abnormal expansion of activated T cells similar to that observed in CD122-
deficient mice.1 CD8+ CD122+ regulatory T cells recognize not only CD8+ cells but
also CD4+ cells as their target cells to be regulated, and they suppress proliferation and
interferon-c (IFN-c) production of the target cells. CD8+ CD122+ regulatory T cells
directly suppress the target cells without the intervention of special antigen-presenting
cells (APC), making these regulatory T cells different from CD4+ CD25+ regulatory
T cells.1,3–5. The strong immune-suppressing power of CD8+ CD122+ regulatory T
cells and the indispensable importance of these regulatory cells for the maintenance of
immune homeostasis suggest an application of these cells to immunity-based diseases
including autoimmune diseases and post-transplantation immune disorders. Analysis of
the molecular mechanism of these regulatory T cells
Zhe Shi,1 Muhaimin Rifa’i,1 Young Ho Lee,1 Hiroshi Shiku,2 Kenichi Isobe1 and
Haruhiko Suzuki1
1Department of Immunology, Nagoya UniversityGraduate School of Medicine, Nagoya,
Japan, and 2Department of Haematology andOncology, Mie University Graduate School
of Medicine, Tsu, Japan
doi:10.1111/j.1365-2567.2007.02747.x
Received 13 April 2007; revised 23 July 2007, 15 August 2007, 27 August 2007;
accepted 2 October 2007.
Correspondence: Dr H. Suzuki, Department of Immunology, Nagoya University Graduate
School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8550, Japan.
Email: k46200a@nucc.cc.nagoya-u.ac.jp
Senior author: X. Xxxxx,
1 email: xxxxxxx
Summary
CD8 CD122 regulatory T cells are a newly identified, naturally occurring type of
regulatory T cell that produce interleukin-10 (IL-10) and effectively suppress interferon-c
(IFN-c) production from both CD8 and CD4 target cells. Molecular mechanisms
responsible for the recognition of target cells by CD8 CD122 regulatory T cells were
investigated in this study by using an in vitro culture system that reconstitutes the regu-
latory action of these cells. CD8 CD122 regulatory T cells did not produce IL-10 and did
not suppress the IFN-c production of allogeneic target T cells when they were stimulated
by immobilized anti-CD3 anti body alone, but they clearly produced IL-10 and
suppressed the IFN-c production of target cells when stimulated by anti-CD3 plus anti-
CD28- coated beads. IFN-c production by major histocompatibility complex-class
I-deficient T cells was also suppressed by CD8 CD122 regulatory T cells stimulated with
anti-CD3 plus anti-CD28 antibody but was not suppressed by cells stimulated by anti-
CD3 alone. Experiments examining theblockade of cell surface molecules expressed on
either the regulatory cells or the target cells by adding specific neutralizing antibodies in
the culture indicated that CD80, CD86, and CD28 molecules were involved in the
2regulatory action, but cytotoxic T lymphocyte antigen-4, ICOS and PD-1 3molecules
were not. Finally, CD8 CD122 cells isolated from CD28- knockout (CD28 ) mice showed
no regulatory activity. These results indicate that CD8 CD122 regulatory T cells
recognize target T cells via the interaction of CD80/CD86–CD28 molecules to become
active regulatory cells that produce suppressive factors such as IL-10.
Keywords: regulatory T cells (Treg); MHC class I; CD28; CD80/86
Seminar Nasioan Sins dan Tehnologi 2008, Lampung

59 KAJIAN PENGARUH UMUR TANAMAN TERHADAP RESISTENSI
SERANGAN JAMUR Ascochyta rabiei PADA KACANG ARAB
(CHICKPEA)
Nunung Harijati* dan P. J. Keane**
*Jurusan Biologi FMIPA Universitas Brawijaya

Jl. Veteran, Malang, JawaTimur 65146
Email: harijati@brawijaya.ac.id atau harijati2002@yahoo.com
** B Department of Botany, La Trobe University, Bundoora, victoria 3086, Australia
Abstrak
Resistensi tanaman terhadap serangan pathogen sering lebih efektif pada tahap perkembangan
tertentu dari tanaman. Resistensi tanaman utuh atau jaringan cenderung meningkat selaras dengan
umur jaringan, organ atau tanaman. Penelitian terhadap semaian muda (umur 2 minggu) dan
tanaman dewasa (umur 8 minggu) dari 8 varietas di lakukan di rumah kaca dengan
menyemprotkan larutan spora Ascochyta rabiei (1x105 spore.ml-1) hingga menetes. Disease rating
(DR) diukur berdasarkan parameter daun dan batang. Dari dua tipe kacang arab (tipe desi dan tipe
kabuli), diperoleh hasil varietas Bumper (tipe kabuli) dan varietas lasseter (tipe desi)
menunjukkan DR paling tinggi pada tahap kecambah sedangkan pada tahap dewasa ditunjukkan
oleh Kaniva (tipe kabuli) dan Lasseter. Disease rating (DR) paling rendah ditunjukkan oleh F090
dan F508. Hasil ini selaras dengan karakter berbagai varietas kacang arab yang dikeluarkan oleh
VIDA (Victorian Institute Dryland Agriculture ) sehingga formula untuk menentukan disease
rating bisa digunakan untuk membedakan varietes yang resistant dan sensitive terhadap jamur
Ascochyta rabiei. Dengan formula tersebut juga ditunjukkan tanaman muda (tahap semaian) lebih
sensitif dibandingkan tanaman dewasa. Total panjang luka pada batang yang mempunyai piknidia
tertinggi ditunjukkan oleh Bumper dan Lasseter dan yang terendah oleh F090 dan F508. Pada
tingkat jaringan, ditunjukkan pada batang utama bagian atas (sebagai wakil jaringan muda)
mempunyai luka (lesi) lebih tinggi dibandingkan batang bagian bawah (sebagai wakil jaringan
tua) .
Kata kunci : Disease rating, desi, kabuli, tanaman utuh, jaringan, luka berpiknidia
Seminar Nasional Biologi XX dan Konggres Biologi Indonesia XIV 24-25 Juli
2009
60 Morfologi kristal kalsium oksalat pada Amorphophallus
campanulatus
Nunung Harijati, Nurul Chairiyah, Sinta Duwi Kartika)*
*) Jurusan Biologi, Fakultas MIPA, Universitas Brawijaya

Jl Veteran Malang 65145.
email : harijati2002@yahoo.com atau harijati@brawijaya.ac.id
Abstrak
Seperti diketahui bahwa kristal kalsium oksalat merupakan kristal yang dibentuk
untuk regulasi kalsium yang terserap, proteksi tanaman, detoksifikasi, penyokong
jaringan agar kokoh, termasuk juga untuk mengumpulkan dan merefleksikan
cahaya. Morfologi dari kalsium oksalat pada dasarnya dibagi dalam 5 bentuk
yaitu druse, rafida, pasir, stiloid dan prismatik. Tujuan dari penelitian ini adalah
untuk mengetahui apakah semua bentuk kristal kalsium didapatkan pada
Amophophallus campanulatus. Untuk mencapai tujuan tersebut dibuat preparat
whole mount dengan metode penjernihan menggunakan sodium hipoklorit
komersial dan organ yang diamati adalah daun, ’batang’ dan umbi A.
Campanulatus Hasilnya menunjukkan bahwa pada A. Campanulatus hanya
ditemukan dua bentuk kristal yaitu druse dan rafida. Druse mempunyai dua
variasi bentuk yaitu longgar dan kompak, sedangkan rafida dikelompokkan
menjadi dua yaitu tunggal dan dalam bentuk berkas. Dalam bentuk berkas
dikenali lebih 14 variasi bentuk berkas.
Kata kunci : druse, rafida, A. Campanulatus
Seminar Basic Science, 1`6 Februari 2008, Universitas Brawijaya

61POTENSI Microbacterium sp., Azotobacter beijerinckii dan Azotobacter vinelandii
DALAM PENGOMPOSAN
Tri Ardyati, Triani Agustin, Dinanti Premita, Kenichi Iwata*

Jurusan Biologi, Fakultas MIPA, Universitas Brawijaya
*Open Research Center for Environmental Biotechnology, Shibaura Institute of
Technology, Saitama, Japan
ABSTRAK
Limbah pertanian memiliki kandungan selulosa yang cukup tinggi sehingga sulit
didegradasi. Salah satu upaya pemanfaatan limbah tsb. adalah pengomposan.
Pemanfaatan bakteri selulolitik dan bakteri pemfiksasi nitrogen dapat mempercepat
pengomposan dan memperkaya kandungan nitrogen pada kompos.
Isolasi bakteri selulolitik diawali dengan pengayaan pada media mineral sederhana
mengandung 10% limbah jerami dan diinkubasi selama 9 hari. Isolat yang didapatkan
diseleksi berdasarkan zona bening yang terbentuk pada medium carboxymethylcellulose
(CMC) agar yang diinkubasi selama tiga hari. Selain itu dilakukan uji aktivitas selulolitik
dengan menumbuhkan isolat dalam medium CMCNFMM cair dengan waktu inkubasi 72
jam. Aktivitas selulase diuji secara kuantitatif dengan reagen DNS (dinitrosalicylic acid).
Didapatkan empat isolat bakteri selulolitik yang berpotensi dalam menghidrolisis
selulosa. Aktivitas selulolitik tertinggi dimiliki oleh isolat SBD1 sebesar 0,158 U/ml.
Berdasarkan hasil analisis 16S rDNA isolat tsb. adalah Microbacterium sp.
Microbacterium sp., Azotobacter beijerinckii dan Azotobacter vinelandii
ditambahkan sebanyak 107 – 108 CFU/ml pada bahan dasar kompos yang telah digiling
dan ditambahkan air. Selanjutnya diinkubasi selama 21 hari dan dilakukan pengukuran
parameter berikut: suhu, pH, rasio C/N dan jumlah total bakteri.
Didapatkan kompos matang setelah inkubasi 21 hari dengan ciri-ciri : suhu turun
mencapai 30◦C, rasio C/N 13-15. Sedangkan jumlah total bakteri pemfiksasi nitrogen
sebesar 2,0x109 CFU/ml dan bakteri selulolitik sebesar 3,0x108 CFU/ml.
Kata Kunci: bakteri selulolitik, bakteri pemfiksasi nitrogen, pengomposan
Seminar Nasional Biologi XX dan Konggres Biologi Indonesia XIV 24-25 Juli
2009
62KARAKTERISASI BAKTERI TERMOFILIK INDIGEN SUMUR MINYAK BUMI
DI JAWA BARAT
Irfan Mustafa*, Monica Haro**, Nuryati Juli**, Septoratno Siregar**

*Universitas Brawijaya, **Institut Teknologi Bandung
Aktivitas bakteri terhadap hidrokarbon dapat mengakibatkan perubahan sifat

minyak bumi. Kemampuan ini bisa dimanfaatkan untuk keperluan penambangan
minyak bumi. Oleh karena itu, perlu dilakukan karakterisasi bakteri untuk
mengetahui kemampuannya dalam mengubah sifat minyak bumi. Penelitian ini
bertujuan untuk melakukan karakterisasi dan identifikasi koleksi bakteri yang
telah diisolasi dari sumur minyak bumi di Jawa Barat. Dilakukan pengamatan
morfologi koloni dan sel kedua belas isolat bakteri dan kemampuan bertahannya
pada suhu tinggi. Uji kemampuan bertahan pada suhu tinggi tersebut sekaligus
menyeleksi hingga diperoleh isolat bakteri termofilik. Selanjutnya, dilakukan uji
kemampuan dalam mengubah sifat minyak bumi yaitu tegangan antarmuka dan
viskositas yang diikuti dengan identifikasi terhadap isolat bakteri termofilik. Dua
belas isolat memiliki morfologi koloni yang berbeda dan memiliki bentuk sel
batang dengan karakter Gram negatif. Uji termofilik menghasilkan lima isolat
yang mampu bertahan pada suhu di atas 55oC dan dua dari lima isolat tersebut
mampu bertahan pada suhu 90oC. Kelima isolat tersebut teridentifikasi sebagai
Pseudomonas aeruginosa, Pseudomonas diminuta, Pseudomonas putida,
Bacillus circulans, dan Geobacillus stearothermophilus. Kultur dari masing-
masing isolat menunjukkan kemampuan menurunkan tegangan antarmuka dan
meningkatkan viskositas minyak bumi. Data yang diperoleh menunjukkan bahwa
isolat bakteri indigen sumur minyak bumi mampu bertahan hidup pada suhu
tinggi dan memiliki kemampuan mengubah sifat minyak bumi.
Kata kunci: bakteri termofilik, tegangan antarmuka, viskositas
Widyarti, S., Rifa’i, M.,Mulyati, Y., Ardini, M., Priambowo, A., Tamyis, M., Riawan, W.
Disampaikan dalam Seminar dan Lokakarya Pendidikan MIPA, Universitas Negeri Surabaya, 13
Desember 2008
63Pengaruh Paparan Formalin Berulang terhadap Gen Parp-1 pada

Ginjal, Hepar dan Paru Mencit Jantan Mus musculus Galur BALB-c
ABSTRAK
1)
Sri Widyarti, 1)Muhaimin Rifa’i, 2)Yayuk Mulyati, 1)Miranti Ardini,
1)
Anang Priambowo, 1)Muhammad Tamyis, 3)Wibi Riawan,
1)
Jurusan Biologi, 2)Mahasiswa PPS Bioreproduksi, Fakultas MIPA, 3)Laboratorium
Biomedik, Fakultas Kedokteran, Universitas Brawijaya
Meskipun dapat menimbulkan berbagai gangguan kesehatan, formalin telah

disalahgunakan sebagai pengawet makanan. Sejauh ini belum ada keluhan dari
masyarakat tentang dampak makanan berformalin. Sebagai bahan genotoksik, formalin
berpotensi menyebabkan kerusakan DNA sehingga berdampak pada peningkatan resiko
kanker. Namun sejauh ini belum diketahui apakah paparan formalin dapat berdampak
langsung pada DNA. Penelitian ini bertujuan untuk menganalisis efek pemberian
formalin pada mencit Mus musculus Galur BALB-c betina terhadap gen Parp-1. Mencit
dibagi menjadi tiga kelompok yaitu kelompok kontrol tanpa paparan formalin (F0),
kelompok paparan formalin 2 mg/kg BB (F2) dan 5 mg/kg BB (F5), masing-masing
kelompok terdiri dari 10 ekor. Pemberian formalin secara per oral dilakukan setiap hari
selama 90 hari (paparan kronis). Setelah perlakuan, mencit dibunuh kemudian dibedah
secara aseptis, dan diambil organ ginjal, hepar dan paru untuk dilakukan isolasi DNA.
Mutasi DNA Parp-1 dideteksi menggunakan primer forward 5’-CTCGG
AGAGGCTTTATCGAG-3’ dan primer reverse 5’-CTGACTGGCACTGTACTCAG-3’
pada exon 1 sampai exon 4. Hasil penelitian menunjukkan bahwa pemberian formalin 2
dan 5 ppm berulang selama 90 hari dapat berdampak langsung pada gen Parp-1.
Kata Kunci: gen Parp-1, formalin

Natural Vol. 12, No. 2, Mei 2008, hal. 71-80
64PERAN ASAM MALAT DALAM RESISTENSI KACANG ARAB
ATAU CHICKPEA (Cicer arietinum) TERHADAP Ascochyta rabiei
N. Harijati 1) dan P.J. Keane 2)
1) Jurusan Biologi, FMIPA Universitas Brawijaya, Malang 65145

2)
Jurusan Botani, Universitas La Trobe, Bundora, Victoria 3086
Masuk 23 Juli 2007; diterima untuk diterbitkan 3 September 2007
Abstrak
Perbedaan kacang arab atau chickpea (Cicer arietinum) dengan legume lainnya adalah
rambut kelenjar (glandular hair) di daun dan di permukaan tubuh chickpea memproduksi
asam malat. Legume umumnya tidak menghasilkan asam malat. Asam malat pada
chickpea mempunyai peran untuk pertahanan terhadap invasi Ascochyta rabiei.
Penambahan asam malat konsentrasi 0, 0.1, 1, 5 mM ke ‘Water Agar’ kosentrasi 3, 5, 7
dan 10 % memberikan hasil yang berbeda dalam perkecambahan spora Ascochyta rabiei
dan pertumbuhan dari spora yang berkecambah. Perkecambahan dan pertumbuhan A.
rabiei tidak bisa diamati pada agar konsentrasi 2 % yang berisi asam malat 0.1 mM,
karena agar-agar tidak bisa membeku namun membentuk suspensi seperti susu. Pada
konsentrasi yang lebih tinggi (3-10 % agar) , kecuali konsentrasi yang tertinggi (10%),
memberikan penurunan perkecambahan selaras dengan konsentrasi agar yang makin
tinggi. Perkecambahan dan pertumbuhan hifa menurun ketika konsentrasi asam malat
meningkat. Inkubasi spora pada larutan 0, 0.6 dan 2 mM asam malat menunjukkan
penurunan perkecambahan selaras dengan peningkatan asam malat. Pengukuran
kandungan asam malat yang disekresikan melalui permukaan daun menunjukkan bahwa
varietas sensitive (Lasseter) memiliki kandungan sekresi asam malat sedikit lebih tinggi
dibandingkan varietas tahan (FLIP508). Kandungan yang terukur pada Lasseter dan
FLIP508, konsentrasinya jauh lebih rendah (6.67-11.00 µM) dibandingkan konsentrasi
percobaan in vitro (0.1-5mM). Mungkin kandungan yang sedikit lebih tinggi pada
Lasseter membantu mendorong perkecambahan spora A. rabiei.
Kata kunci: Chickpea, asam malat, FLIP508, lasseter, tabung perkecambahan.
This paper is presented at the International Seminar, “Management Strategy on Animal

Health and Production Control in the Anticipation of Global Warming for the
Achievement of Millennium Developmental Goals.” This seminar is hold on June, 34 th
2008 at the ELMI Hotel Surabaya, East Java, Indonesia
65.Transgenic and Knockout Mice in Human Disease
Research:
Novel Insights into Pathophysiology and
Perspectives.
Dra. Fatchiyah, M.Kes. Ph.D.
Brawijaya University, Jl. Veteran, Malang 65145
Email: fatchiya@brawijaya.ac.id
ABSTRACT
The ability to engineer the mouse genome has proven useful for a
variety of applications in research, medicine and biotechnology. The
development of transgenic and knockout technologies has driven an
explosion in new animal models of disease. These engineered diseases
are a departure from previous animal models in that pathological
syndromes are created from a priori assumptions about how disease
pathogenesis could develop. Both of mice models have become
powerful reagents for modeling genetic disorders, understanding
embryonic development and evaluating therapeutics. These mice and
the cell lines derived from them have also accelerated basic research
by allowing scientists to assign functions to genes, dissect genetic
pathways, and manipulate the cellular or biochemical properties of
proteins. Such models have been useful in providing new information
on the functions of receptor of the insulin or insulinlike growth factor
family have been implicated in the regulation of pancreatic βcells and
insulin secretion. However, the contrived nature of the systems might
generate false information, unless validated by careful reference to
human disease and spontaneous disease in other animal models.
Keywords: transgenic, knockout mouse model, pathological function
ICBME Singapore, December 3-6 th , 2008

66. Revealing Spleen Ad4BP/SF1 Knockout Mouse by
ACAd4BPtTAZ transgene
Fatchiyah 1 , M. Zubair 2 , KI. Morohashi 3
1 Dept. of Biology, School of Science, Brawijaya University, Malang, INDONESIA
2 Dept. of Internal Medicine Endocrinology, UT South Western Medical Centre, Dallas, Texas,
USA
3 Dept. of Molecular Biology, Graduate School of Medical Sciences, Kyushu University, Fukuoka,
JAPAN
Abstract— The purpose of this study is addressed the function of Ad4BP/SF1 in

developing spleen of Ad4BP/SF-1 KO mouse. I have modified the BAC-Ad4BP
endogenous by homologous recombinant with modification cassettecontaining
tetracycline transactivator system and LacZ reporter genes to allow the expression of
Ad4BP/SF1 in developing tissues and organ differentiation, regulate of Ad4BP/SF1
mechanism, and reveal the defect due to Ad4BP/SF-1 deficiency. Recently studies, by
immunihistochemistry of adult tissues showed that revealed coincident expressing
between Ad4BP/SF-1 and lacZ, indicating the tTA system seemed to reproduces the
endogenous expression of Ad4BP/SF-1, and thus likely to lacZ, Ad4BP/SF-1 in the BAC
transgene was expected to be expressed in the corresponding tissues under the control of
the bidirectional promoter. Interestingly, the BACAd4BPtTA transgenic mice were
succeeded to up regulate the expression of Ad4BP/SF-1 at the protein level than wild
type. And the fetal spleen of Tg(+);Ad4(+/+) was larger than that of the wild type, and
expectedly the size of the spleen of Tg(+);Ad4(-/-) apparently recovered.
Keywords—Ad4BP/SF1, knockout mouse, Spleen, BAC transgenic, homologous

recombinant.
67 Prosiding Seminar Nasional Sains dan Teknologi-II 2008 Universitas Lampung, 17-18 November 2008
ISBN : 978-979-1165-74-7 III-544
IDENTIFIKASI PENANDA RAPD TERKAIT DENGAN

KETAHANAN TERHADAP KEKERINGAN PADA KEDELAI
(Glycine max. L. Merr).
Estri Laras Arumingtyas
Jurusan Biologi, Fakultas MIPA, Universitas Brawijaya
ABSTRAK
Adanya isu pemanasan global, menyebabkan ketahanan kekeringan pada tanaman
mendapatkan banyak perhatian. Pada kedelai saat ini telah dikenali beberapa
galur/varietas kedelai yang tahan terhadap kekeringan termasuk varietas Dieng. Dalam
pemuliaan tanaman, seleksi merupakan salah satu tahapan yang penting. Dengan
demikian dalam penelitian ini dilakukan identifikasi penanda RAPD untuk membantu
seleksi ketahanan terhadap kekeringan pada kedelai. Bahan tanaman yang digunakan
adalah kedelai varietas tahan kering Dieng, galur tidak tahan kering Burangrang, galur
medium tahan kering 2S3, galur tidak tahan kering 8B6, MSC8606 dan MLG 2999.
Tahapan yang dilakukan adalah isolasi DNA genom dari daun muda kedelai dengan
metode CTAB (Doyle &Doyle, 1987) dilanjutkan dengan RAPD menggunakan
seperangkat primer OPK (Operon Technologies, USA). Dari 20 primer OPK yang
digunakan 6 diantaranya polimorfik. Dari hasil amplifikasi primer-primer yang
polimorfik tersebut terlihat adanya pita-pita polimorfik yang membedakan antara
varietas/galur tahan dan tidak tahan kekeringan. Identifikasi lebih lanjut terhadap pita-
pita tersebut akan dilakukan untuk menghasilkan penanda RAPD untuk ketahanan
terhadap kekeringan.
Kata kunci: RAPD, ketahanan kekeringan, kedelai
68
Prosiding Seminar Nasional Sains dan Teknologi-II 2008 Universitas Lampung, 17-18 November 2008
ISBN : 978-979-1165-74-7 VII-148
69.PENGARUH INTENSIFIKASI PERTANIAN DI KEBUN APEL TERHADAP
KOMUNITAS ARTHROPODA TANAH DI BUMIAJI, KOTA BATU,
MALANG, JAWA TIMUR
Zulfaidah Penata Gama, Amin Setyo Leksono
Jurusan Biologi FMIPA Universitas Brawijaya Malang
gama@brawijaya.ac.id
ABSTRACT
The aim of this research to explore the comparison of abundance, diversity and
composition of ground Arthropods and the influence of agricultural system in apple farm
at Bumiaji village, Batu City.The samples were taken every three days for six times in
June until August 2008 by using Pitfall Trap method with two transects in each location.
The compositions of Arthropods were replication of analyzed using Bray-Curtis index
and the diversities were analyzed by using Shannon-Wienner index. The result showed
that ground Arthropods collected in semiorganic agricultural system were 1547
individual while those in intensive system were 1297 individual. Based on Shanon
Wiener Index that diversity of ground Arthropods in semiorganic agricultural system
were H = 2,35-4,08 greater than intensive system (H= 2,55-3,86). The composition of
ground Arthropods was greater in intensif agricultural system (54%) than its composition
in semiorganic system (48%). Brances of in the composition ground Arthropods both
agricultural system occured at 85%.
Keyword : intensification of agriculture, composition of Arthropods, apple farm
70 Varian-varian Porang (Amorphophallus oncophyllus Hook.) yang

Ditemukan di Jawa Timur
Rodiyati Azrianingsih1), Tri Wahono2) dan Gustini Ekowati1)
ABSTRAK
Porang (Amorphophlallus oncophyllus Hook.) adalah tanaman umbi-umbian yang

tumbuh baik di Jawa Timur. Kandungan glukomanan yang tinggi pada tepung umbinya
membuatnya sebagai komoditi ekspor penting di propinsi ini. Pengadaan Porang saat ini
masih mengandalkan suplai dari alam karena belum ada acuan yang tepat bagi
budidayanya. Dengan semakin meningkatnya pengambilan Porang di alam menimbulkan
kekhawatiran hilangnya keragaman plasma nutfah Porang di habitat aslinya. Penelitian ini
telah mengeksplorasi 12 (dua belas) kategori daerah di Jawa Timur untuk mendapatkan
varian-varian Porang yang ada di wilayah ini. Ditemukan empat varian Porang yang
ditentukan berdasarkan ciri pembeda morfologi yang paling menonjol yaitu warna dan
corak tangkai daunnya. Ke empat varian itu adalah (1) Varian Hijau-Prismatik Besar
adalah porang yang memiliki warna tangkai daun hijau bercorak prismatik putih yang
besar. Varian ini adalah tipe Porang yang paling banyak dibudidayakan dan ditemukan di
hampir seluruh area yang dikunjungi. (2) Varian Hijau tua-Prismatik Kecil adalah porang
yang memiliki warna tangkai daun hijau tua bercorak prismatik putih yang ditemukan di
lahan liar di Gondang, Bojonegoro dan lahan budidaya di Brongkos, Blitar. (3) Varian
Hijau tua-Garis memiliki warna tangkai daun hijau tua bercorak belang putih yang
membujur berseling yang unik ditemukan liar di Kecamatan Lawang, Kabupaten Malang.
Sedangkan (4) Varian Coklat-Prismatik memiliki warna tangkai daun coklat bercorak
prismatik besar yang juga unik ditemukan liar di Kecamatan Kalipare, Kabupaten Malang.
Dari hasil analisis kadar glukomanan dan kalsium oksalat umbinya, sampel tumbuhan
porang yang tumbuh liar cenderung mengandung kalsium oksalat yang lebih rendah dan
glukomanan tinggi dibanding dengan umbi porang yang tumbuh di lahan budidaya.
Mengingat potensinya sebagai varian unggul, keunikan dan kelangkaan Varian Hijau-
Bergaris dan Varian Coklat-Prismatik perlu dilindungi habitatnya demi kelestariannya.
----------------------------------------------------------------------------
1) Jurusan Biologi, FMIPA, Universitas Brawijaya. Jalan Veteran, Malang 65145. Tel./fax.
(0341)575841. Email: rodiyati@brawijaya.ac.id ; 2) Jurusan Teknologi Hasil Pertanian, FTP,
Universitas Brawijaya. Jalan Veteran, Malang 65145. Email: triwhn@brawijaya.ac.id
71PAPER HASIL PENELITIAN DIPRESENTASIKAN ORAL DALAM

INTERNATIONAL CONFERENCE ON MOLECULAR BIOLOGY OF LIFE SCIENCES 2007
(ICMBLS 2007)
Malang, 19-21 November 2007
THE COMPARATIVE STUDY OF CARCINOGENIC EFFECT OF

BENZAPYRENE AND NDEA (NITROSODIETHYLAMINE) ON p53 PROTEIN,
PROLIFERATION AND PARP USING
FEMALE RAT (Rattus norvegicus) LUNG
S. Widyarti, S.B. Sumitro, A.K.N.G. Amalia, B. D. S. Bahrain, S.I. Noviawati, L. Purwowati, I.P.
Raharjo, S.K. Wijaya, A. Soewondo, A.P.W. Mahendra, M.S. Djati
Biologi Dept, FMIPA, Brawijaya University
e-mail: swid@brawijaya.ac.id
ABSTRACT
The objective of this research was to observe the carcinogenic effect of benzapyrene and NDEA
(nitrosodiethylamine) using female rat lung. Seven-day old female rats (Rattus norvegicus) were
divided on two groups. First group was injected (i.p.) benzapyrene low single dose 0,01 mg/g
BW, second group was high dose benzapirene treatment-rats were injected (i.p.) benzapyrene 0,1
mg/g BW once a week for 3 months (long-term exposure). NDEA 0,1 mg/g BW was injected
once a month for four months on female adult rats. Protein p53 was analyzed by
immunohistochemistry. The study showed that chronic benzapyrene dose decrease protein p53
expression, whereas pre-cancer benzapyrene dose and NDEA treatment increase protein p53
expression. The proliferative and apoptotic analysis showed that this difference may cause by the
balance of proliferative and apoptotic cells. The increasing of p53 on pre-cancer benzapyrene
was followed by decreasing of both proliferative and apoptotic cells. Both increasing of p53 on
NDEA treatment and decreasing of p53 expression on chronic benzapyrene dose was followed by
proliferation increasing and apoptotic decreasing. On this cases can be predicted that NDEA
treatment more carcinogenic than benzapyrene.
Key words: p53, NDEA, benzapyrene, proliferation, apoptosis
72PAPER HASIL PENELITIAN DIPRESENTASIKAN ORAL DALAM

(ICMBLS 2007)
GENETIC AND PHYSIOLOGICAL ANALYSIS OF BRANCING ON KENAF

(Hibiscus cannabinus)
Estri Laras Arumingtyas, Retno Mastuti, Serafinah Indriyani

Department of Biology, Faculty of Mathematic and Natural Sciences,
Brawijaya University
(Seminar Pararel)
ABSTRACT
The objective of this research was to determine the genotypic and physiology
properties of two branching types of kenaf mutant line aroused from Ethyl Methane
Sulfonate (EMS) mutation. The genotypic property was observed based on the
existence of branching gene and the physiological character observed was the auxin
concentration. For molecular analysis, DNA of kenaf seed and leaves were isolated
using Doyle dan Doyle (1987) method. The sequence of branching gene was
identified using PCR and sequencing techniques. PCR was conducted using 5 pair of
primers including 4 specific primers which was designed base on the sequence of
branching genes AUX1, AXR1 of Arabidopsis thaliana, RMS1 of Pisum sativum, and
Ls of Lycopersicum esculentum, and one pair of degenerate primer designed from
amino acid conserve sequence of LAS, Ls and Moc genes. The PCR program used
was 93 oC, 1 minute denaturation, 30 second annealing at 56 oC, 1 minute ekstention
72 oC, for 35 cycles. Pre-heating for 1 minute at 93 oC, and the last extention phase
was done for 10 minutes at 72 oC. Sequencing was performed using the procedure
of Big Dye Terminator mix, at ABI 377A sequencer. Confirmation on the
physiological properties of branching lines was determined using
spectrophotometry methods.
Identification of branching gene using PCR and sequencing techniques showed
that the branching gene of kenaf was succesfully amplified by AUX1 and AXR1 primers
but were not amplified by Ls, RMS1, and Llm primers. This indicates that branching gene
of kenaf was homologous to branching gene of Arabidopsis thaliana. Molecular analysis
indicate that the gene act as auxin signaling, but different type of branching was
controlled by different allele of the same locus. The gene was the member of gene family
that control branching and active at the last phase of branching development by
controlling auxin signaling to determine whether the branching candidate continue to
develop or not. Determination of auxin content in the roots, apical shoot, and axilary
branches showed that the branching plants has higher auxin content in the apical shoot
compared to the content in the branches. This indicate that AUX1 control the formation
of branches by either controlling the content of auxin in the apical shoot and branches or
the ratio of auxin content in the shoot and branches
Key word : branching gene, auxin, kenaf,mutation.
73PAPER DIPRESENTASIKAN ORAL DALAM

(ICMBLS 2007)
DISCOURSE OF HUMAN ENHANCEMENT TECHNOLOGY

M.Sasmito Djati
Faculty of Mathematics and Natural Science Brawijaya University,
Malang 65145, Indonesia, E-mail: msdjati@brawijaya.ac.id
(Plenary session V - ICMBLS 2007)
Since the mid of 1970’s, after test tube baby was born, the scientist were facing ethical
problem, bioethics, a relatively new area of ethics, has emerged at the fore front of
modern biological more over on clinical science. Many philosophical arguments against
organ donation stem from this field. Generally, the arguments are rooted in either
theological or ethical considerations.
The most successful common cloning technique in non-human mammals is the process
which produced Dolly sheep. It is also the technique used by Advanced Cell Technology
(ACT), the first company to successfully, clone early human embryos that stopped at the
six cell stage. The process is as follows: an egg cell taken from a donor has its nucleus
removed. Another cell with the genetic material to be cloned is fused with the original
egg cell. In theory, this process, known as somatic cell nuclear transfer, could be applied
to human beings, it was called Human reproductive cloning also might produce benefits
to create a fertility treatment that allows parents who are both infertile to have children
with at least some of their DNA in their offspring.
ACT also reported its attempts to clone stem cell lines by parthenogenesis, where an
unfertilized egg cell is induced to divide and grow as if it were fertilized, but only
incomplete blastocysts resulted. Even if it were practical with mammals, this technique
could work only with females. If it was applied in Human, it was called human
therapeutic cloning; it could provide genetically identical cells for regenerative medicine,
and tissues and cells for transplantation. Such cells, tissues, and organs would neither
trigger an immune response nor require the use of immunosuppressive drugs. Both basic
research and therapeutic development for serious diseases such as cancer, heart disease,
and diabetes, as well as improvements in burn treatment and reconstructive and cosmetic
surgery, are areas that might benefit from such new technology.
Basically from both advance technology above, inspired new technology namely Human
enhancement technology, it is refers to any attempt, whether temporary or permanent, to
overcome the current limitations of the human body, whether through natural or artifial
means. The term is sometimes applied to the use of technological means to select or alter
human aptitudes and other phenotypical characteristics, whether or not the alteration
results in characteristics that lie beyond the existing human range. Here, the test is
whether the technology is used for non-therapeutic purposes. Some bioethicists restrict
the term to the non-therapeutic application of specific technologies — neuro-, cyber,
gene, and nano-technologies – to human biology.
Life extension refers to an increase in maximum or average lifespan, especially in
humans, by slowing down or reversing the processes of aging. Average lifespan is
determined by vulnerability to accidents and age-related afflictions such as cancer or
cardiovascular disease. Extension of average lifespan can be achieved by good diet,
exercise and avoidance of hazards such as smoking and excessive eating of sugar
-containing foods. Maximum lifespan is determined by the rate of aging for a species
inherent in its genes and probably by certain environmental factors. Currently, the only
widely recognized method of extending maximum lifespan is calorie restriction.
Theoretically, extension of maximum lifespan can be achieved by reducing the rate of
aging damage, by periodic replacement of damages tissues, or by molecular repair or
rejuvenation of deteriorated cells and tissues.
Researchers of life extension are known as biogerontologists. They seek to understand
the nature of aging and they develop treatments to reverse aging processes or to at least
slow them down, for the improvement of health and the maintenance of youthful vigour
at every stage of life. (Biomedical gerontologists are distinguished from biogerontologists
in that the latter may take a purely academic interest in the biological mechanisms of
aging, without seeking a "cure".) Those who take advantage of life extension findings and
seek to apply them upon themselves are called "life extensionists" or "longevists". The
primary life extension strategy currently is to apply available anti-aging methods in the
hope of living long enough to benefit from a complete cure to aging once it is developed,
which given the rapidly advancing state of biogenetic and general medical technology,
could conceivably occur within the lifetimes of people living today.
Many biomedical gerontologists and life extensionists believe that future breakthroughs
in tissue rejuvenation with stem cells, organs replacement (with artificial organs or
xenotransplantation) and molecular repair will eliminate all aging and disease as well as
allow for complete rejuvenation to a youthful condition. Whether such breakthroughs can
occur within the next few decades is impossible to predict. Many life extensionists
arrange to be chronically preserved upon legal death so that they can await the time when
future medicine can eliminate disease, rejuvenate, them to a lasting youthful condition
and repair damage caused by the cryonics process.
Whether the maximum human lifespan should be extended is the subject of much ethical
debate amongst politicians and scientists. But the life extension movement, which began
in the early 1980s, continues to grow rapidly in popularity and momentum among
scientists and the general public opinion and interest.

Kumpulan Abstrak Publikasi

Enviado por

Dados do documento

Título original

Direitos autorais

Formatos disponíveis

Compartilhar este documento

Compartilhar ou incorporar documento

Opções de compartilhamento

Você considera este documento útil?

Este conteúdo é inapropriado?

Direitos autorais:

Formatos disponíveis

Kumpulan Abstrak Publikasi

Enviado por

Direitos autorais:

Formatos disponíveis

1Entomological Science (2005) 8, 235-243

2Insect Science (2005) 12, 199-206

Amin Setyo Leksono, Kenta Takada, Shinsaku Koji, Nobukazu Nakagoshi,

The-12th Indonesian Scientific Meeting, Osaka University, September 6-7, 2003.

4Threat of National Park Due to Traditional Ecological Knowledge

Amin Setyo Leksono

5TROPICS Vol. 14 (4), July 2005

The effects of forest disturbances on flying insect assemblages in Trawas,

Amin Setyo leksono, Nobukazu nakagoshi and Yuji isagi

6Buku Panduan Seminar Nasional Basic Science 3

Buku Panduan Seminar Nasional Basic Science 3

7Kemampuan Megabalanus sp. dari pantai balekambang dalam

Sri Budi Utami, Setijono Samino, Catur Retnaningdyah, Jurusan Biologi,

8Buku Panduan Seminar Nasional Basic Science 3

Struktur komunitas dan kerusakan terumbu karang akibat aktivitas wisata di

Mukhzayadah, Catur Retnanngdyah, Luchman Hakim,

Kata kunci : Balekambang, belt transect, terumbu karang

9Buku Panduan Seminar Nasional Basic Science 3

Struktur komunitas makroalga dan echinoidea di kawasan wisata pantai

Nur Susanti, Catur Retnaningdyah, dan Lukman Hakim

Kata kunci : Echinoidea, Makroalga, Pantal Balekambang, Petak kuadrat.

10BIOSCIENTIAE (2006) 3: 1-14

12Biochemical and Biophysical Research Communications 341 (2006) 1036-1045

Differential gene dosage effects of Ad4BP/SF-1 on target tissue

13Revealing Spleen Ad4BP/SF1 KO by BAC-Ad4BP-tTAZ transgene

International Conference On Molecular Biology of Life Sciences Brawijaya University,

14Differential Gene Dosage Effects of Ad4BP/SF-1 on Target Tissue

15Tet-off system drive the inactivity gene target of bacad4bpttaz

Fatchiyah, Mohamad Zubair , Ken Ichirou Morohashi .

16Analisis Mitokondria DNA Banteng Liar (Bos javanicus) dari Taman

17International Conference On Molecular Biology of Life Sciences Brawijaya

Genetic and physiological analysis of brancing on kenaf (Hibiscus

Key word : branching gene, auxin, kenaf,mutation.

18Analisis mutasi kandidat gen percabangan pada kenaf (Hibiscus

19Karakter Stomata Nilam (Pogostemon cablin Benth.) Hasil Regenerasi In

Yuli Arisa, Retno Mastuti dan Estri Laras Arumingtyas

Kata kunci : in vitro, kolkisin, Pogostemon cablin

Jurnal Hayati ( 2003) Vol.10,No.1,ISSN 0854-8587

20In Vitro Methods for Inducing Somatic Embryos of Soybean and

Keywords : embryogenetic response, somatic embryos (SE), cotyledons of soybean

JURNAL ILMU-ILMU HAYATI (Life Sciences) (2005)Vol.17-No.1

E.L. Arumingtyas, A. Munawarti dan S. Indriyani

Key words : induction, mutation, EMS, kenaf.

Buku Panduan Seminar Nasional Basic Science 3

22PARTHENOGENESIS OOSIT KAMBING DENGAN

Kata Kunci: parthenogenesis, aktivasi, Calcium ionophore, 6-DMAP, oosit kambing.

Buku Panduan Seminar Nasional Basic Science 3

23Perkembangan embrio parthenot kambing hasil aktivasi dengan

Kata kunci: Nuclear transfer(NT), aktivasi, oosit kambing, etanol, cycloheximide

24Embriogenesis somatik eksplan daun makadamia (macadamia integrifolia

Berk. Penel. Hayati: 9 (1-6). 2003

25Isolation and culture of celosia cristata l. cell suspension protoplasts

Retno Mastuti ,Hiroshi Miyake, Takeshi Taniguch, Yoji Takeoka

26Isolation and Culture of Leaf Bud Protoplasts of Curcuma heyneana Val.

Key words : Curcuma heyneana, protoplasts, KM8p liquid medium

Jurnal Ilmu-ilmu Teknik (Engineering) ? Vol.13-NO.2 ? Oktober 2001

27Blo active compounds found in mistletoes

Keywords: Isolation, Identification, Compounds, Mistletoes, Bio-activeEmail :

Buku Panduan Seminar Nasional Basic Science 3

28Physiological responses of soybean somatic embryos towater stress

Wahyu Widoretno, Ludi Pawardani, Retno Mastuti

Buku Panduan Seminar Nasional Basic Science 3

29The effect of amino acid on growth and development of

Irfan Mustafa*, Monica Haro, Nuryati Juli, Septoratno Siregar**