Você está na página 1de 191

Adam Rutherford

Criao
A origem da vida e O futuro da vida

Traduo:
Maria Luiza X. de A. Borges

Reviso tcnica:
Denise Sasaki
Para David Rutherford, de cujas clulas eu vim.
Para Beatrice e Jake, que vieram de minhas clulas.
Prefcio

A ORIGEM DA VIDA
Introduo
1. Gerado, no criado
2. Rumo ao uno
3. Inferno sobre a Terra
4. O que vida?
5. A origem do cdigo
6. Gnese

Notas
Referncias bibliogrficas e sugestes de leitura
ndice remissivo

O FUTURO DA VIDA
Introduo
1. Criado, no gerado
2. Lgica na vida
3. Remixagem e revoluo
4. Em defesa do progresso

Posfcio
Notas
Referncias bibliogrficas e sugestes de leitura
ndice remissivo
Agradecimentos
Prefcio

OS MELHORES LIVROS sobre evoluo provavelmente j foram escritos. Isso prova da ideia
grandiosa, brilhante e correta que lhe subjacente. Em novembro de 1859, Charles Darwin
publicou A origem das espcies, em que esboava seus ponderados argumentos sobre evoluo
pelo mecanismo da seleo natural. Embora o progresso da cincia determine que teorias e
modelos estejam em constante evoluo, nos 150 anos transcorridos desde essa publicao, todos
os aspectos da pesquisa biolgica serviram efetivamente para reforar a ideia central exposta em
A origem das espcies, a de que as espcies mudam ao longo do tempo com ganho ou perda de
caractersticas segundo sua utilidade ideia muitas vezes designada pelo aforismo do prprio
Darwin: descendncia com modificao. Um sculo e meio de pesquisas mostrou de maneira
indubitvel quanto a ideia de seleo natural robusta.
Este livro fala do que aconteceu antes da origem das espcies e do que acontecer de agora
em diante, medida que arquitetamos formas de vida que escapam s restries da seleo
natural. Ele diz respeito, em suma, ao que antecedeu vida e ao que a suceder. As duas partes
do livro se referem tambm descendncia modificada. Na primeira parte retraaremos a
busca da origem da vida a ascenso da qumica inerte biologia no tumulto das rochas
elementares, dos mares e do redemoinho borbulhante da Terra em seus primrdios. A segunda
parte examina a modificao da vida por ao humana o projeto, a engenharia e a construo
deliberada de novas formas de vida. Para explorar esses esforos, precisamos compreender 4
bilhes de anos de evoluo e os dois ou trs sculos de biologia que conduziram a esse ponto
crtico na histria humana. Esses dois campos so estreitamente interdependentes, um
emaranhado matagal de ideias cujas conexes so evidncia do mtodo cientfico e de nossa
insacivel curiosidade por descobrir coisas. medida que alcanamos uma compreenso cada
vez maior dos processos no princpio da evoluo, mais aprendemos como manipular
profundamente a biologia no presente, e vice-versa: medida que desmontamos clulas e as
remontamos sinteticamente, aprendemos mais sobre as condies em que as primeiras clulas
surgiram.
Por essa razo, este um livro formado de metades, e cada qual pode ser lida de maneira
independente, embora ambas as histrias estejam inextricavelmente relacionadas.
A origem da vida
Introduo

IMAGINE QUE VOC tivesse a m sorte de se cortar com papel ao abrir este livro. Esse um
ferimento chato mas trivial, doloroso mas facilmente sanado. No entanto, a reao que essa
inciso desencadeia complexa, organizada e profunda. Ela comparvel reao humana
diante de uma catstrofe de grande escala, como uma inundao ou um terremoto. Como
naqueles desastres, a primeira fase uma reao de emergncia.
Tudo que ocorre dentro de seu corte e em volta dele acontece como uma bela orquestrao
de clulas vivas individuais. No momento exato em que a borda afiada do papel penetra atravs
da superfcie externa da sua pele, clulas incrustadas por toda a sua carne, chamadas
nociceptores, entram em ao. Atravs de fibras nervosas longas e filamentosas que brotam de
suas superfcies, um sinal eltrico dispara da ponta de seu dedo para clulas no seu crtex
cerebral numa frao de segundo. Ali, voc percebe dor, e, velocidade do pensamento, seu
crebro envia uma mensagem de volta para grupos de clulas musculares em seu brao,
dizendo-lhes para se contrarem de maneira coordenada. O msculo contrai-se. Seu brao recua.
Tudo isso acontece no tempo de um batimento cardaco.
O corte ter separado as clulas umas das outras nas paredes de um vaso sanguneo, com
violncia, fato decisivo para dar incio ao processo de cura. Em consequncia da abertura de um
capilar, o sangue inunda o ferimento. A cor escarlate do sangue hemoglobina, a molcula de
protena que transporta oxignio atravs de todo o seu corpo, e ela est empacotada nos discos
cncavos das clulas vermelhas do sangue, que tm a forma de pastilhas de menta parcialmente
chupadas dos dois lados. As clulas vermelhas correspondem a pouco menos da metade dos
cinco litros de sangue que uma pessoa mdia possui. A maior parte do resto compe-se de
plasma, que sobretudo gua. Mas nesse plasma, compreendendo menos que 1% do sangue,
esto clulas absolutamente decisivas para o reparo de seu ferimento. Trata-se das clulas
brancas do sangue, cuja funo encontrar, combater e conter qualquer invasor oportunista
como as bactrias, que logo comeam a tentar se introduzir no corpo de modo a florescer mas,
ao faz-lo, lhe causam infeco.
Nesse meio-tempo, a extremidade da clula nervosa que desencadeou essa dor envia um
sinal no sangue que atrai plaquetas. Estas so a unidade de resposta rpida do corpo, e se
agrupam para formar um cogulo e impedir maior perda de sangue. Elas atuam tambm como
faris de emergncia, enviando sinais que convocam dezenas de outros trabalhadores clulas
e protenas que protegem o ferimento e do incio ao processo de reconstruo. Clulas
musculares nas paredes das artrias contraem-se em espasmos sincronizados. Seu dedo lateja.
Essa contrao restringe o fluxo e a perda de sangue e ajuda a manter clulas imunes no local. A
formao de um cogulo evita perda de sangue e hemorragia e marca a primeira fase da cura
do ferimento. Agora que a barreira entre o interior de seu corpo e o resto do mundo est
restabelecida, a limpeza e a restaurao podem prosseguir.
Depois de uma hora, a maioria das clulas que participam do corte com papel so os
chamados neutrfilos. Eles transportam em suas membranas detectores que captam os sinais de
emergncia qumica que pulsam a partir do marco zero e se movem na direo dos mais fortes
deles. Ao chegar, os neutrfilos agem como faxineiros especializados, envolvendo bactrias e
aspirando destroos e detritos antes de se matarem, quando a tarefa est completa.
Durante as 24 horas seguintes, outro regimento de clulas marcha para o local e cada uma
delas amadurece no Pac-Man gigante do sistema imunolgico, o macrfago (literalmente,
grande comedor em grego). Estes mastigam as carcaas dos neutrfilos e quaisquer outros
vestgios potencialmente danosos que encontrem.
importante ressaltar que o prprio corte no simplesmente colado de volta; se isso
ocorresse, perderamos a sensibilidade que havia ali antes do ferimento. O que ocorre no
tampouco um mero arrolhamento da fenda com novas clulas cutneas, pois nesse caso
ficaramos encaroados e malformados. Nosso corpo se esfora para tornar os reparos to
invisveis quanto possvel e para devolver ao corpo seu estado pr-ferimento. Ele precisar ser
remendado com carne nova, a qual uma complexa colaborao de clulas. E isso significa
nascimento de tecido.
Como em qualquer reconstruo, os alicerces devem ser lanados primeiro. No corte, clulas
bsicas chamadas fibroblastos inundam o local durante os dois dias seguintes, reproduzindo-se e
migrando pela superfcie do ferimento a partir de todas as direes, estendendo antenas
semelhantes a tentculos chamadas pseudpodes falsos ps medida que avanam. A
marcha cessa quando eles se encontram no meio, formando uma camada de fundao para a
reconstruo completa, e comeam a se transformar em partes dos novos vasos sanguneos e do
novo tecido cutneo. Bloqueados na posio correta, eles produzem e exsudam colgeno a fim de
construir uma espcie de matriz ou andaime para o resto do projeto de reconstruo.
A pele feita de clulas, claro, mas no de apenas um tipo. Ela desenvolve-se, camada por
camada, a partir de dentro, com as clulas mortas soltando-se do lado de fora, num processo de
contnua renovao. Dentro dessa matriz h tambm um grande nmero de outras clulas,
inclusive folculos capilares, glndulas sudorparas e sebceas e os vasos sanguneos que
fornecem oxignio e nutrientes carne. Todos esses tipos de clula devem ser reconstrudos no
tecido de reparo.
Cerca de um ms depois de voc ter aberto este livro, o corte estar efetivamente curado.
Meses depois, porm, talvez um ano, quando voc j esqueceu tudo sobre o assunto, as clulas de
seu corpo continuam a trabalhar na ferida, remodelando o local para restaur-lo to bem quanto
possvel e minimizar a cicatriz. A vermelhido desaparece medida que os vasos sanguneos
temporrios, que se estenderam para alimentar o processo de reparo, se retiram e a matriz
temporria de colgeno que atuou como andaime para a reconstruo substituda por uma
verso mais permanente. Um novo pedao de tecido vivo, um novo pedao de voc, foi formado
num ato de reparo bem pequeno, mas necessrio.
Esse projeto de reconstruo foi efetuado em sua totalidade por milhares de clulas
trabalhando juntas e produzindo milhares de novas clulas altamente especializadas que
compem o tecido: epiderme, glndulas, veias e artrias. O fato de ns, e toda forma de vida,
podermos criar novo tecido vivo a partir de clulas a ideia grandiosa que une no somente todas
as coisas vivas, mas todas as coisas vivas que j existiram.
H mais clulas vivas na Terra que estrelas no Universo conhecido. Tome como exemplo as
bactrias: segundo minha estimativa grosseira, h algo em torno de 5 milhes de trilhes de
trilhes (5.000.000.000.000.000.000.000.000.000.000) de clulas na Terra. Provavelmente voc
feito de cerca de 50 trilhes de clulas humanas, algumas dezenas de trilhes a mais ou a menos,
dependendo de seu tamanho. Como se isso no bastasse, todos ns somos placas de Petri
ambulantes. Seres humanos saudveis nascem estreis, uma lousa limpa feita apenas de suas
prprias clulas. Num adulto tpico, porm, o nmero total de clulas humanas excedido em
dez por um pelas clulas no humanas que carregamos, nos intestinos, na pele e em todas as
superfcies externas e internas, o mais das vezes na forma de bactrias. Mas h tambm as
primas das bactrias, as arqueias, alm de caronas maiores e mais complexos como clulas de
levedura, protistas e os ocasionais vermes parasitas. Nesse instante, voc deve carregar mais de
mil espcies aliengenas em seu corpo; a maioria voc nem nota, mas sem muitas delas voc no
poderia viver. Como esses passageiros tm em sua maior parte uma frao do tamanho das
clulas humanas, em termos de massa, ainda somos na maior parte humanos. Contudo em
nmero, num nvel celular, somos feitos na maior parte de outras coisas.
Esses nmeros so to grandes que nos confundem. Mas eles refletem o fato de que nosso
planeta est inundado de vida e que a vida s transportada por clulas. Embora o projeto de
reconstruo de seu corte por papel em processo de cura seja assombrosamente complexo, ele
inteiramente banal: um corte, uma careta e, dentro de alguns dias, pele nova para remend-lo.
Processos semelhantes ocorrem bilhes de vezes a cada minuto em todo o nosso planeta. No s
cortes com papel e cura de ferimentos, mas os processos fundamentais de toda a vida acontecem
por meio das clulas.
Como iremos ver, cada uma dessas clulas, entre as quais as novas clulas cutneas em seu
dedo, nasceu quando uma clula existente dividiu-se em duas. E, em razo desse simples fato, as
clulas em seu corte tm uma linhagem que remonta a 4 bilhes de anos, havendo uma nica
exceo regra: a primeira de todas as clulas. Quando novas clulas nascem para remendar
aquele corte, elas so as ltimas numa cadeia que se estende, sem absolutamente nenhuma
quebra, at o incio da prpria vida na Terra.
Mas como sabemos disso? O que uma clula? Como elas so capazes de executar esse
processo, ou qualquer processo que seja? A maneira como um corte curado pode parecer
trivial, um ato biolgico, ainda que de orquestrao sofisticada, levado a cabo sem pensamento.
Mas, ao perguntar como um processo to refinado surgiu, chegaremos em ltima anlise s
mesmas questes e respostas que dizem respeito natureza e origem da vida. Este livro
sobre essas questes e suas possveis respostas: as origens de nossas vidas, a origem de toda vida e
as origens de nova vida. No cerne de todas elas est nossa compreenso moderna da clula.
De onde vem a vida uma entre um pequeno punhado das questes mais fundamentais que
podemos formular. uma pergunta que preocupou a humanidade ao longo de toda a sua
existncia. Todas as culturas e todas as religies tm um mito da criao, desde os egpcios
antigos, que possuam um deus que espirrava, cuspia e se masturbava para criar o mundo, at a
histria comparativamente comedida do Gnesis cristo, em que a vida criada ex nihilo a
partir do nada e os seres humanos, a partir do barro.
A verdadeira histria comeou a se revelar num perodo de menos de cem anos, entre
meados do sculo XIX e do sculo XX, com a emergncia das trs grandes ideias da biologia.
Como veremos, a teoria celular, a teoria darwiniana da evoluo por seleo natural e mais tarde
a descoberta da estrutura do DNA combinam-se elegantemente para descrever como a vida
funciona. Mas elas tambm nos deixam a dois passos de desvendar a grande questo
propriamente dita: como a vida comeou?
Elementos essenciais dessa narrativa so imprecisos, e os cientistas contemporneos
trabalham arduamente para preencher as lacunas. Com mais fervor do que nunca, est
emergindo um modelo de gnese que usa o peso da biologia moderna para reconstruir o passado
remoto. S h muito pouco tempo, com nossa slida compreenso dos genes, das protenas e da
mecnica desses processos qumicos vivos, passamos a poder indagar seriamente como eles,
afinal, passaram a existir. A biologia moderna revelou complexidade em vez de simplicidade, e
mostrou que redes intricadas de reaes qumicas impelem a reproduo, a herana, a sensao,
o movimento, o pensamento e todas as coisas que a vida faz. Nada disso ocorre de graa: energia
requerida para alimentar essas aes. No fim das contas, sem energia, voc est morto. Para
descobrir como a vida comeou, teremos de desfazer todas essas redes. aqui, no mundo
microscpico e at atmico da clula, que encontraremos as pistas para compreender esses
processos: aqueles que mantm voc, suas clulas e todas as clulas de seres vivos, tal como vm
fazendo h bilhes de anos.
Como na astronomia e na fsica contemporneas, as grandes teorias da biologia agora so
testadas com experimentao inovadora. Nossa pesquisa do Universo levou teoria do big bang
na origem de tudo, e no Grande Colisor de Hdrons do Cern (sigla em francs da Organizao
Europeia para a Pesquisa Nuclear), na fronteira entre a Sua e a Frana, realiza-se o maior
experimento j empreendido para recriar o Universo em sua forma mais embrionria,
bilionsimos de segundo aps a concepo. Ao realizar esse ato, fsicos descobriram o bson de
Higgs, partcula extremamente elementar que teve importante papel no incio do tempo e
continua a ter desde ento. Assim, tambm, a melhor maneira para os cientistas compreenderem
a trajetria da vida na Terra tentando recri-la. Nos prximos anos, apenas pela segunda vez
em 4 bilhes de anos, uma coisa viva, provavelmente algo parecido com uma clula, nascer no
laboratrio sem provir de uma clula j existente. Esta a idade de ouro na biologia, e um
trabalho frentico est em curso no mundo todo para resolver algumas questes fundamentais.
Nossa jornada rumo a esse ponto revolucionrio na histria da Terra a histria da prpria
biologia. E essa histria tambm comea com as clulas.
1. Gerado, no criado

A VIDA FEITA DE CLULAS. Por essa razo, a vasta gama dessas viscosas bolsas
microscpicas indescritvel. Em uma nica espcie, a nossa, por exemplo, no h um nmero
absoluto, porm, entre os cerca de 50 trilhes de clulas que um adulto pode ter, h centenas de
tipos, de astrcitos no crebro s clulas zimognicas do estmago. Junto com essa variedade
vem um sortimento de dimenses. As clulas mais longas so neurnios na espinha, que se
estendem at nosso dedo do p. Se tamanho for documento, devemos nos voltar para o sexo.
Entre as maiores clulas dos seres humanos esto os vulos, grandes quase o bastante para serem
visveis a olho nu. As menores so seus homlogos, os espermatozoides. Mas o que lhes falta em
tamanho, os homens compensam em nmero: o homem adulto mdio pode produzir 10 bilhes
de espermatozoides por ms, ao passo que as mulheres carregam um nmero finito de vulos,
liberados um a um, a cada ms, dos ovrios, da puberdade menopausa. As mulheres nascem j
munidas de todos os seus vulos, o que significa que nossa primeira clula comeou a existir
dentro de nossa av. Afora os vulos, quase todas as clulas so invisveis a olho nu, e mesmo
com microscpio a maioria no parece notvel: minsculas bolhas incolores encerradas numa
membrana ligeiramente menos incolor, em geral acomodadas num caldo desbotado e pouco
interessante. No laboratrio, congelamos tecido e o fatiamos em lascas com menos de um
centsimo de milmetro de espessura sobre lminas de vidro, e as clulas aparecem
comprimidas umas contra as outras em densos padres abstratos. Ou as cultivamos num caldo,
onde podem ser vistas flutuando como estrelas indistintas num cu de um branco-acinzentado.
Coramos clulas em tons de rosa e roxo, e nos ltimos anos em verdes e vermelhos
fluorescentes, para melhor visualizar seu funcionamento interno. Num corpo vivo, porm, a
maioria delas opaca como uma gua-viva.
Cada tipo de clula membro altamente especializado de uma comunidade, trabalhando em
unssono com outras para construir um organismo plenamente funcional. Cada processo de
nossas vidas resulta do fato de essas clulas executarem suas tarefas. Quando voc l esta frase,
as clulas musculares em volta dos seus globos oculares se contraem e relaxam para controlar o
movimento de seus olhos da esquerda para a direita. Agora, se voc levantar os olhos acima
desta pgina e olhar para alguma coisa distncia, um anel de clulas musculares muda o foco
esticando as clulas claras nas suas lentes. Voc move os olhos sem esforo, mas essa ao
requer intricada coordenao inconsciente. Ftons de luz passam atravs de suas lentes e atingem
as clulas fotorreceptoras, cones e bastonetes, no fundo de seu olho, em sua retina. Ali eles so
colhidos e convertidos em impulsos eltricos que se movem velozmente atravs de neurnios,
passando pelo nervo tico at o crebro, para processamento, percepo e, com sorte,
compreenso. Cada movimento, cada batimento cardaco, pensamento e emoo que voc j
teve, cada sentimento de amor ou dio, tdio, entusiasmo, dor, frustrao ou alegria, cada vez
que voc ficou bbado e depois com ressaca, cada machucado, espirro, coceira ou coriza, cada
coisa que voc j ouviu, viu, cheirou ou provou so suas clulas comunicando-se umas com as
outras e com o resto do Universo.
Douglas Adams sugeriu certa vez que Terra no era o nome mais apropriado para nosso
planeta, uma vez que a maior parte da superfcie no solo slido e rocha, mas gua. No entanto,
se quisssemos de fato nomear o mundo que habitamos com base num trao que
verdadeiramente o diferencia dos outros cerca de mil planetas que descobrimos, ns o
chamaramos de Clulas. A Terra, de uma maneira nica, at onde sabemos, est explodindo de
vida, e todos os seres vivos em nosso planeta so feitos de clulas. Tendo em mente que nove
entre dez seres que algum dia existiram na Terra j esto extintos, o nmero total das clulas que
havia em algum momento absolutamente inconcebvel.
Essa uma compreenso muito moderna. A biologia uma cincia jovem, no mximo com
350 anos de idade segundo qualquer clculo sensato, e apenas 150, em termos de uma viso mais
plena e madura, com regras abrangentes e universais. A fsica tem uma linhagem mais antiga.
Em meados do sculo XVII, cientistas haviam mapeado reas do cosmo com uma preciso
insupervel no futuro. Isaac Newton escrevia um conjunto de regras que explicavam por que as
coisas se movem como se movem e por que podemos nos manter sobre a Terra sem sair
flutuando. Mas aquelas que hoje chamamos de cincias da vida estavam muito atrs. A razo
disso que o ponto de partida para a maior parte dos avanos cientficos olhar para as coisas e
descobrir por que elas so como so. Diferentemente das estrelas e dos planetas, ningum jamais
tinha visto ou pelo menos identificado uma clula antes de 1673.
Nessa poca, a prpria cincia estava se formando. Cientistas de alta posio social como
Newton e Robert Hooke haviam fundado o primeiro organismo cientfico do mundo, a Roy al
Society. Mas o homem que primeiro perscrutou o minsculo mundo da clula no nascimento da
biologia celular no foi um dos prestigiosos cavalheiros de peruca da cincia. O improvvel incio
da histria da biologia deve ser atribudo a um negociante de roupa branca chamado Antonie van
Leuwenhoek.
O negcio de fazer e vender panos estava inextricavelmente associado ao desenvolvimento
de lentes ticas melhores, pois os negociantes verificavam a densidade das fibras e a qualidade
de seu tecido usando lentes de aumento semelhantes a uma lupa de relojoeiro. Van Leuwenhoek
era um hbil e meticuloso polidor de lentes que trabalhava em Delft, a capital holandesa dos
tecidos. Ele se especializou numa tcnica que envolvia quebrar um basto de vidro quente e
esmagar as pontas de maneira a formar uma bola, mas mantinha segredo sobre esse processo,
que fizera dele o mais destacado microscopista de seu tempo. As lentes de Van Leuwenhoek
pareciam na verdade minsculas gotas de gordura, no muito maiores que um gro de pimenta,
e ele as fixava em dispositivos portteis que em nada se pareciam com os microscpios que
conhecemos hoje. Os dele eram lminas de cobre retangulares, com cerca de 2,5 5cm, com
um buraco numa extremidade para segurar a rotunda lente semelhante a uma conta de vidro. De
um lado havia um pino de prata para segurar o espcime diante da lente, segurado por um
parafuso que podia ser girado para mudar o foco. Era a forma globular que dava s lentes de Van
Leuwenhoek sua qualidade superior.
Pelo menos, essa era a vantagem tecnolgica do holands. Seu outro atributo decisivo era
uma insacivel curiosidade. Simplesmente, ele gostava de contemplar coisas pequenas atravs
das lentes. Embora eu espere que o corte com papel descrito na Introduo seja inteiramente
imaginrio, Van Leuwenhoek evocou exatamente o mesmo processo de reparo, movido por
desenfreada curiosidade. Numa carta publicada em abril de 1673 em Philosophical Transactions,
a revista oficial da Roy al Society, Van Leuwenhoek escreveu: Diversas vezes esforcei-me para
ver e saber em que partes o sangue consiste; por fim observei, extraindo um pouco de sangue de
minha prpria mo, que ele consiste em pequenos glbulos redondos. Pensamos que ele estava
vendo clulas vermelhas do sangue, e esta parece ter sido a primeira observao registrada de
clulas individuais.1
medida que suas habilidades na microscopia aumentaram, Van Leuwenhoek comeou a
observar toda sorte de amostras materiais e de fluidos. Depois raspou a substncia entre seus
dentes e observou as bactrias que causam a placa dentria. Nos ltimos anos do sculo XVII,
ele se tornava uma espcie de celebridade, por sua explorao de um reino microscpico
escondido vista de todos. O rei Guilherme III da Inglaterra e outros dignitrios o visitaram para
observar o que ele tinha visto. Uma investigao, no entanto, foi mantida em sigilo: seu prprio
smen, embora ele tenha declarado em suas anotaes que a amostra foi adquirida no
profanando pecaminosamente a mim mesmo, mas como um subproduto natural de coito
conjugal. Nesse ato, no qual talvez seja melhor no nos determos, ele viu os espermatozoides
pelo que so: clulas individuais. Descobriu tambm clulas na gota dgua de um lago local e viu
o que hoje chamamos frouxamente de protistas: criaturas unicelulares que incluem nadadores
autnomos e algas.
Van Leuwenhoek foi a primeira pessoa a ver de maneira indubitvel clulas vermelhas do
sangue, espermatozoides, bactrias e organismos unicelulares no parasitrios. A este ltimo
grupo ele deu um nome engraado, animlculos, e nos anos 1670 enviou desenhos de sua
descoberta Roy al Society em Londres. Os membros da sociedade expressaram ceticismo, em
especial porque, quando pediram a Robert Hooke, seu especialista residente em microscopia,
para verificar se conseguia ver as mesmas criaturas em gua tirada do Tmisa, ele a princpio
nada viu.
A expertise de Hooke na observao de coisas minsculas era sem paralelo, tendo ele
publicado, uma dcada antes, um volume sensacional e muito apreciado: Micrography: or Some
Physiological Descriptions of Minute Bodies made by Magnifying Glasses. Raramente um livro
ganhou subttulo to preciso. Ele contm, como seria de esperar, desenhos anotados de coisas
muito pequenas. O microscpio de Hooke era um simples tubo de quinze centmetros com duas
lentes e uma esfera de cristal do tamanho de uma bola de crquete para ampliar a chama que o
iluminava. Muitas das imagens geradas por esse kit so agora muito conhecidas, entre as quais
uma gigantesca pgina desdobrvel com uma pulga e um aterrador close-up dos olhos de uma
mosca-das-flores, incrivelmente parecido com fotos contemporneas feitas com um
descendente quase irreconhecvel dos instrumentos de Hooke, o microscpio eletrnico. Samuel
Pepy s adquiriu um exemplar de Micrographia e anotou em seu dirio ser aquele o mais
engenhoso livro que j li em minha vida.
Ele tinha toda a razo. Mas h uma significativa ironia contida nesse magnfico volume. Uma
das detalhadas ilustraes de Hooke de uma seo transversal longitudinal de um pedao da
casca de um sobreiro. Ali, no meticuloso desenho, esto unidades conjugadas que compem a
estrutura total. No texto, Hooke usa o termo clula para descrever essas unidades. Na
realidade, elas so as paredes mortas que outrora abrigavam clulas de sobreiro. Ele escolheu a
palavra porque ela provinha do latim cella, que significa cubculo, mas observou que estavam
cheias de ar, o que ajudava a explicar a capacidade de flutuao da rolha. Hooke tinha visto os
remanescentes de clulas e os chamou de clulas, mas nem por um instante imaginou que o
objeto de suas observaes eram unidades vivas universais nem o legado permanente desse
nome.
As clulas foram descobertas assim. Mas de onde elas vinham e como se formavam? Com
curiosidade e tecnologia, Van Leuwenhoek havia descerrado as cortinas para revelar um reino
ainda no descoberto. Contudo, o progresso era fundamentalmente estorvado por uma ideologia
no esclarecida.

A origem das clulas

A origem das clulas que Van Leuwenhoek vislumbrava permanecia obscura. As pessoas sabiam,
claro, que o intercurso sexual entre um homem e uma mulher resultava numa nova vida, mas,
talvez porque o sexo em geral no fosse pesquisado, uma viso inteiramente fantasiosa da origem
das clulas ainda persistia.
Por milhares de anos, gerao espontnea foi o mito mais popular sobre a origem da vida.
A primeira explicao importante da gerao espontnea vem de Aristteles, o no reconhecido
pai da biologia. Em seu livro Animalia (A histria dos animais), escrito em meados do sculo III
a.C., ele descreve a gnese de certas espcies:

Assim como com os animais, alguns surgem de animais parentais, de acordo com sua
espcie, ao passo que outros crescem espontaneamente, e no a partir de ascendncia
aparentada; desses casos de gerao espontnea, alguns vm de terra ou matria vegetal em
putrefao, como ocorre com vrios insetos, enquanto outros so espontaneamente gerados
dentro de animais a partir das secrees de seus vrios rgos.

Animalia um livro fascinante, provavelmente o primeiro compndio notvel de biologia. Ele


est repleto de observaes e concluses sobre uma enorme variedade de espcies, algumas das
quais so astuciosas.2
Com a gerao espontnea, Aristteles descrevia uma ideia que persistiu at o sculo XIX,
tempo durante o qual dzias de exemplos se materializaram. O escritor romano Vitrvio referiu-
se casualmente gerao espontnea ao aconselhar arquitetos no sculo I a.C.:

As bibliotecas deveriam estar voltadas para o leste, pois seus objetivos exigem a luz da
manh: nas bibliotecas os livros so, nesse aspecto, preservados da deteriorao; as que se
voltam para o sul e o oeste so prejudicadas pelo verme e pela umidade, que os ventos
midos geram e alimentam e que, espalhando a umidade, deixam os livros mofados.

No sculo XVI, Ziegler de Estrasburgo explicou a origem dos lemingues dizendo que eles
descendiam, em suas hordas, de nuvens de tempestade.3
Na verdade, aps as descobertas de Van Leuwenhoek, as mais variadas especulaes sobre a
origem das clulas e da vida foram propostas, todas envolvendo gerao espontnea. Na
Bruxelas do sculo XVII, Jean Baptiste van Helmont que se destacou na histria como um
cientista respeitado, o pai da qumica dos gases descreveu um experimento em que ps uma
camisa suada num recipiente com um pouco de trigo e deixou isso fermentar no mido poro de
seu castelo durante 21 dias. Sabe o que aconteceu? A preparao deu origem a camundongos.4
muito fcil zombar da ignorncia do passado, e deveramos ser cautelosos em relao a
isso. Embora gerao espontnea fosse uma ideia persistente, ela no um conceito cientfico
slido. Todos os exemplos inapropriados, em especial quando descreviam a gnese de animais
maiores, eram fruto de observao incompleta ou malfeita. Poucas questes so mais essenciais
que a da origem da vida, seja em termos da origem de nova vida a partir de vida j existente,
seja em termos da origem absoluta mais fundamental da vida, ex nihilo.
Passaram-se quase duzentos anos depois que Van Leuwenhoek viu clulas pela primeira vez
antes que essa ideia fosse derrotada. A rejeio final da gerao espontnea traz a marca
distintiva da boa cincia: observao rigorosa e uma hiptese preditiva, testvel. Mas ela vem
tambm com o selo do puro drama: um elenco internacional e uma generosa poro de dinheiro,
fama e traio.

O nascimento da teoria celular

A qualidade dos microscpios aumentou constantemente ao longo dos sculos XVIII e XIX, e a
popularidade do estudo de coisas pequenas cresceu no mesmo ritmo. Os maiores avanos no
vinham da explorao do reino animal microscpico, mas da observao de plantas e algas. O
fato de que as diferentes partes das plantas eram compostas de clulas ficou patente nas
primeiras dcadas do sculo XIX, embora no se percebesse sua onipresena em todas as coisas
vivas. Grande parte desse trabalho foi levada a cabo na Alemanha, e os compndios recebiam
nomes que descreviam uma srie de estruturas observadas: Krnchen, Kgelchen e Klmpchen
(grnulos, vesculas e bolhas). Embora a descrio de tecidos estivesse progredindo, a raiz de sua
gnese no estava. S em 1832 o nascimento de clulas foi descrito pela primeira vez. Um baro
belga chamado Barthlemy Dumortier observou clulas em algas se alongarem cada vez mais
at que surgiu uma parede divisria, e uma clula transformou-se em duas. Outros logo
reproduziram o trabalho e observaram o fenmeno em diferentes algas e plantas.
Mesmo sem um modelo de reproduo consistente, o interior das clulas comeou a ser
explorado. A qualidade dos microscpios aumentava, e em 1831 Robert Brown estudava clulas
de orqudeas.5 Nelas ele observou uma nica arola circular, em geral um pouco mais opaca
que a membrana da clula. Chamou-a de ncleo, nome que ela tem at hoje, e agora ns a
conhecemos como o escritrio central para o cdigo gentico em todos os organismos
complexos.6
Assim como Dumortier no caso da observao da diviso celular, Brown sups que o ncleo
no era universal. Muitos pensavam que a diviso era uma forma excepcional de nascimento da
clula, e nenhuma observao semelhante de fisso fora feita em tecido animal. Como as clulas
vegetais so com frequncia bem maiores que as animais, o estudo da carne ficou em segundo
plano em relao anlise das folhas. O ncleo havia sido observado em alguns tecidos animais,
particularmente clulas cerebrais; mais uma vez, porm, no se sups que existisse em todas as
clulas. Para complicar a questo, as clulas vermelhas, o tipo isolado de clula mais comum em
seres humanos, no contm ncleo: ele expelido durante seu desenvolvimento.
Os nomes mais estreitamente associados teoria celular em quase todos os compndios so
Schwann e Schleiden. Segundo a histria contada por Theodor Schwann, o nascimento da teoria
celular foi marcado por um heureca. Schwann e Matthias Schleiden encontraram-se por acaso
num jantar em 1837. Schwann era anatomista, baixote e muito aplicado, que por vezes no
arredava p de suas investigaes por dias a fio quando examinava tecido corporal. Schleiden,
botnico problemtico e por vezes propenso ao suicdio, fora influenciado pela identificao do
ncleo levada a cabo por Robert Brown. A botnica e a biologia animal eram campos separados,
muito distantes da unificao que a evoluo e a gentica iriam finalmente permitir. Durante o
jantar, os dois discutiram seu trabalho, em tecidos animais e vegetais, respectivamente. A
conversa deve ter se tornado cada vez mais palpitante para os outros convidados medida que a
discusso avanava rumo ao ncleo, aquele corpo menor no meio das clulas. Schwann e
Schleiden deram-se conta de que o ncleo era igual em clulas vegetais e animais. Correram
sem demora ao laboratrio de Schwann para comparar anotaes. Desse momento em diante, a
ideia de que todos os tecidos vivos eram feitos de clulas ganhou razes.
Por mais convincente que seja a lenda, Schwann e Schleiden contriburam apenas
parcialmente para o desenvolvimento de um modelo da vida baseado em clulas, e, sob um
aspecto importante, de maneira significativamente errada. Grande parte do trabalho
demonstrando a existncia do ncleo fora feita antes deles, e a universalidade das clulas fora
sugerida por outros antes de 1837. Schwann provavelmente foi o primeiro a usar a expresso
teoria celular, mas, no tocante origem de novas clulas, ele e Schleiden se equivocaram de
maneira significativa. Ambos descreveram a formao de novas clulas comeando com o
aparecimento espontneo de um ncleo nu nos espaos entre as clulas existentes. Segundo eles,
esse ncleo atuava como uma semente a partir da qual a nova clula emergiria, como um cristal
em crescimento. Embora no to implausvel quanto lemingues celestes, isso ainda se
assemelhava essencialmente gerao espontnea.
Nossa compreenso da origem de novas clulas pode ser atribuda, em grande parte, a Robert
Remak um heri esquecido da biologia e uma vtima da poltica e da raa. Remak era um judeu
polons que passou sua vida adulta em Berlim. Para obter o cargo universitrio que desejava e
merecia, teria sido obrigado a trair suas razes judaicas ortodoxas e a batizar-se, coisa que nunca
fez. Por meio de sua cincia inegavelmente boa, ele acabou ganhando um cargo de
conferencista e mais tarde de professor-assistente na Universidade de Berlim, mas seu posto no
lhe valia nem salrio nem laboratrio. Compare essa situao com a do bilogo celular Rudolf
Virchow, seu contemporneo. Nascido numa abastada famlia prussiana, Virchow era
extravagante e bombstico. Acabaria por ser descrito como o papa da medicina e o nico
caso de consumado mdico-cientista-estadista de nosso tempo. Ele era seis anos mais moo que
Remak, mas ambos foram nomeados para a Universidade de Berlim ao mesmo tempo.
Aps cuidadosa observao, Remak rejeitou a gerao espontnea sob todas as formas,
inclusive aquela descrita por Schwann e Schleiden. Durante uma dcada, ele havia estudado todo
tipo de tecidos animais, inclusive msculo, clulas vermelhas do sangue e embries de r e
frango, e viu apenas clulas dividindo-se, sofrendo um estreitamento no meio, como um balo
apertado por um cinto, at se transformar em duas. Virchow acompanhou o trabalho de Remak, e
a cada ano mais se aproximava de sua maneira de pensar a de que as clulas se formavam
unicamente por diviso celular.
Depois, em 1854, Virchow declarou que no havia vida exceto por meio de sucesso direta,
e um ano mais tarde traduziu isso num moto latino: omnis cellula e cellula todas as clulas
provm de clulas. Apreciado e proeminente, ele exps essa ideia onde pde, inclusive em seu
compndio de sucesso internacional: Die Cellularpathologie. Mas no houve meno a Remak
em nenhum desses textos. Virchow havia feito uma parte pequena do trabalho, mas adotara os
grandes esforos do colega sem lhe atribuir mrito. Encolerizado, Remak escreveu a Virchow
sobre o sumrio em latim:

[Ele] aparece como seu sem nenhuma meno a meu nome. Que o senhor se torne ridculo
aos olhos dos instrudos, uma vez que no possui nenhum conhecimento embriolgico
especializado evidente, algo que nem eu nem ningum podemos impedir. Entretanto, caso
deseje evitar uma discusso pblica da questo, eu lhe pediria para reconhecer
imediatamente minha contribuio.

Por vezes esquecemos que a cincia feita por pessoas, com todas as suas personalidades a
reboque. O mtodo cientfico destina-se a contrabalanar todas essas idiossincrasias, e em ltima
anlise tende a faz-lo. Mas o devido reconhecimento um problema perptuo.7
Contudo, Remak e Virchow, a despeito de seus pecados havia acertado na mosca. A vida
feita de clulas, e as clulas so geradas unicamente a partir de outras clulas. Mas, como um
zumbi, a gerao espontnea continuou arrastando-se por a, tendo sofrido mais um solavanco na
Frana, em 1860. O homem que finalmente a matou foi Louis Pasteur. Ainda no famoso pela
tcnica de esterilizao que leva seu nome, Pasteur, jovem e ambicioso, por duas vezes tivera
negado seu ingresso na Academia Francesa de Cincias.
Um experimento realizado por um destacado proponente da gerao espontnea havia
injetado novo vigor crena em sua existncia. Felix Pouchet quis mostrar que mofo brotaria do
feno, mesmo que o feno, o ar e a gua usados fossem estreis. O cientista havia fervido os
ingredientes, resfriando-os depois com mercrio lquido. Como que por mgica, apareceu mofo
no feno. Desejando esclarecer a questo de uma vez por todas, a Academia ofereceu um prmio
de 2.500 francos primeira pessoa que decidisse a questo da gerao espontnea.
Pasteur percebeu a falha, que era o fato de haver uma camada de poeira na superfcie do
mercrio, que estava produzindo o mofo. Diante disso, ele projetou o mais simples experimento
imaginvel. Sua verso do arranjo de Pouchet teria dois frascos contendo um caldo estril, mas
substancioso, que logo ficaria turvo se exposto vida microbiana. Um frasco foi deixado aberto,
ao passo que o outro tinha um gargalo em forma de S projetando-se para um lado. Pasteur
imaginou que micrbios alcanariam o caldo no primeiro frasco, transportados pelas partculas
de poeira no ar, mas o pescoo de cisne no permitiria que esses contaminantes chegassem ao
caldo no segundo frasco. Dias depois, o contedo do frasco aberto estava turvo, mas o do frasco
com pescoo de cisne continuava perfeitamente lmpido, e assim continuou indefinidamente.
Como controle, Pasteur quebrou o pescoo de cisne e observou o caldo turvar-se durante os dias
seguintes. Ele reivindicou o dinheiro e foi devidamente eleito membro da elite cientfica da
Frana.8
A melhor descrio do destino final dessa ideia obstinada foi feita pelo prprio Pasteur:
Nunca mais a doutrina da gerao espontnea se recobrar do golpe mortal desferido por esse
experimento simples, e os que pensam de outra maneira foram iludidos por seus experimentos
mal-realizados, cheios de erros que eles no sabiam como perceber nem evitar.
Essas so palavras speras, mas verdadeiras. Milhares de anos de superstio biolgica foram
varridos por esse trao essencial da cincia: o experimento. E, com aquele frasco com gargalo
em forma de pescoo de cisne, a teoria celular ficou completa. Como todas as grandes teorias,
ela uma fuso de ideias baseadas em observao e confirmadas por experimentao.
tambm um dos grandes pontos de interseo da biologia. O trabalho de dezenas de homens e
centenas de anos de investigao sobre a matria de que a vida feita resume-se em duas frases:

1) Toda vida feita de clulas.


2) Clulas s surgem por meio da diviso de outras clulas.

Essa teoria tem profundas implicaes, como todas as grandes teorias. Ela abarca toda a vida,
uma descrio simples, mas abrangente, dos inmeros habitantes da Terra viva. Mas, como j
sabemos, h trilhes de tipos diferentes de clula. No caso das clulas vermelhas do sangue, por
exemplo, aquelas encontradas nos seres humanos so diferentes o bastante at daquelas de nossos
primos primatas mais prximos para que no possam ser trocadas sem graves consequncias.
Quando comeamos a considerar uma espcie to distante da nossa como as galinhas,
descobrimos, como fez Remak, que as clulas vermelhas de seu sangue de fato contm um
ncleo, diferentemente das nossas. A primeira grande ideia mostrou que a diversidade da vida na
Terra estava engastada na magnfica variedade das clulas. A segunda mostrou como essa
diversidade surgiu.

Mudana ao longo do tempo

Por volta da mesma poca em que Schwann, Schleiden, Remak e outros observavam como as
clulas se comportam, do outro lado do canal da Mancha um pai de famlia bastante jovem
refletia sobre seu longussimo ano sabtico. De maneira lenta e meticulosa, Charles Darwin
reunia uma argumentao esmagadoramente convincente descrevendo como as criaturas
evoluem. A evoluo, a ideia de que as espcies no so imutveis, j era aventada no sculo
XIX. Mas o processo pelo qual as espcies mudam era desconhecido. Darwin passara cinco anos
viajando milhares de milhas a bordo do HMS Beagle, recolhendo espcimes do outro lado do
mundo. Ao voltar, casara-se com a prima Emma Wedgwood. Os dois eram netos do magnata da
cermica Josiah Wedgwood. O casal estabeleceu-se em Down House, Kent, e, livre de presses
financeiras, Darwin comeou a cinzelar uma esplndida ideia. Em 1859, aps anos de intensos
esforos cientficos e pessoais, ele publicou A origem das espcies.9 Nessa obra, propunha a
segunda teoria da grande unificao da biologia, uma teoria que descreve o processo pelo qual
ocorre a evoluo.10
Em contraste com os microscopistas na Europa, Darwin estava interessado sobretudo em
animais inteiros, o mundo macroscpico. Ele observou que, quando comparamos indivduos em
qualquer populao, h uma diversidade natural no tocante a qualquer caracterstica fsica. Essa
variao o meio pelo qual esses indivduos podem ter uma vantagem competitiva sobre outros.
Numa populao imaginria de tamandus, um animal dotado de lngua ligeiramente mais
comprida que a de seus contemporneos pode ser capaz de devorar mais cupins suculentos,
ficando em consequncia bem-alimentado e saudvel. Isso poderia ter o efeito de faz-lo viver
mais, ou talvez ser um parceiro mais atraente para as fmeas da espcie. Por isso esse tamandu
pode ter mais filhotes, todos potencialmente dotados de lngua mais comprida. Aps algumas
geraes, como a lngua algo til, os tamandus de lngua longa passariam a dominar a
populao, tornando-se a norma. Ao longo de sucessivas geraes, a espcie mudar. Em
contraste com teorias anteriores, Darwin observou que no eram caractersticas adquiridas
durante a vida que se transmitiam prole. Anos de medidas obsessivas o levaram a estabelecer o
princpio de que, para cada caracterstica a lngua de um tamandu, a cor de seu pelo, qualquer
aspecto que voc queira citar , era sua variao em toda a populao que conferia vantagem
para um indivduo. Esses traos se tornariam mais comuns numa populao porque a vantagem
que proporcionavam se manifestaria como maior sucesso reprodutivo.
H outras foras seletivas importantes, como as complexidades do sexo, pelas quais machos
se engrandecem para conquistar uma fmea, ou fmeas exercem uma escolha tambm
caprichosa de machos. Mas a seleo natural a fora abrangente que moldou o mundo vivo em
que estamos. um sistema de erro, tentativa e reviso. A evoluo cega e no tem rumo. As
espcies no so mais ou menos evoludas, nem superiores ou inferiores, como eram descritas
antigamente, e por vezes ainda so. Por meio de iterao, elas so simplesmente mais bem-
adaptadas para sobreviver em seus ambientes. Num experimento que no deveria ser realizado,
um orangotango no sobreviveria dois minutos nas guas submarinas ferventes de uma fonte
hidrotermal, apesar de ser sofisticado o bastante para usar ferramentas nas selvas de Bornu.
Imersas no mar quente de uma dessas fontes, porm, centenas de espcies, entre as quais o
verme cilndrico gigante, de dois metros de comprimento, e dezenas de espcies de bactrias
subsistem com muita satisfao. A mudana a norma, a adaptao o sucesso.
Nos 150 anos desde a publicao de A origem das espcies, milhes de cientistas cutucaram e
esticaram a teoria da evoluo, desmontaram-na, ajustaram-na e puxaram-na de todas as
maneiras concebveis. Eles observaram inmeras espcies, de tamandus a zebras, para estudar
seu comportamento. Criaram simulaes de mirades de populaes, primeiro com modelos
matemticos, mais tarde em computadores, expandiram e pressurizaram seus ambientes
artificiais para ver como eles se adaptam ao longo de sucessivas geraes. Criaram e cruzaram
um sem-nmero de espcies para observar como a herana funciona, para ver onde reside a
vantagem na gerao seguinte. Deixaram tanques de bactrias reproduzirem-se durante dcadas
e testemunharam a descendncia com as modificaes em ao. Nos nossos dias, deciframos
seus cdigos genticos e vimos exatamente as diferenas no DNA que refletem a transformao
de uma espcie em duas, cada qual encontrando um nicho em que est mais bem-ajustada.
Vimos populaes de bactrias adaptarem-se ao hostil de antibiticos e, deploravelmente,
emergirem resistentes. Embora o modelo inicial traado por Darwin tenha sido modificado e
elaborado, a grande argumentao nica, como ele a descreveu, sobreviveu intacta aos
necessrios ataques que uma ideia dessa magnitude requer. por isso que ela chamada teoria
da evoluo por seleo natural. O sentido coloquial da palavra teoria, como um palpite,
suposio, ou simples tiro no escuro, miseravelmente tacanho perto de seu significado
cientfico. Quando cientistas falam sobre uma teoria, eles tm em vista o ponto mais alto da pilha
das ideias: um conjunto de conceitos testveis, todos os quais indicam e predizem uma descrio
da realidade to robusta que indistinguvel de um fato.
Darwin escreveu sua obra-prima quando o estudo das clulas comeava a emergir da poa
estagnada da gerao espontnea. Mas sua descrio da evoluo no diz respeito ao incio de
uma nova vida; ela trata, como est implcito no ttulo, da origem de novas espcies. Estas
surgem quando organismos adquiriram tantos traos mutados que no so mais capazes de se
reproduzir como o que eram antes seus parentes. Quando aprendemos sobre a seleo natural,
temos nossa ateno despertada para traos visveis proeminentes galhadas, cor do pelo e, de
vez em quando, lnguas de tamandus. Mas hoje sabemos como a biologia trabalha no plano
celular e podemos transpor a evoluo por seleo natural para o mundo microscpico de que
Darwin tinha pouco conhecimento. A lngua ficcional do tamandu mais comprida porque,
graas ao acaso da variao dentro de sua populao, esse indivduo tem mais (ou possivelmente
maiores) clulas nessa lngua, e os genes que geram essa disparidade de tecido sero transmitidos
atravs de espermatozoide ou vulo para a gerao seguinte. De maneira semelhante, quando
voc se corta com o papel, suas plaquetas formam uma rolha e uma cunha para ajudar a deter a
perda de sangue porque, efetivamente, criaturas que tinham em seu sangue clulas que no
desempenhavam essa funo coagulante com igual eficcia foram eliminadas pela natureza
milhares de geraes (e espcies) atrs (provavelmente permitindo que tal criatura se curasse de
maneira menos eficaz, ou talvez sangrasse at morrer). No que decisivo, hoje sabemos que o
que est sendo selecionado no o indivduo nem a clula, mas o portador da informao que
confere a vantagem. Como ocorre em toda a biologia, a informao que permite a coagulao
armazenada dentro de clulas, no DNA, a molcula que desempenhar papel central ao longo de
toda essa histria.
Teoria celular e seleo natural so reflexos da mesma verdade: a vida derivada. Ela se
modifica gradativamente e, ao fim e ao cabo, de maneira espetacular, mas, em essncia, a vida
a continuao adaptada do que veio antes.11
A aceitao pblica da evoluo por seleo natural teve perodos alternados de aumento e
declnio, ao longo dos anos, e foi contestada por cientistas nos primeiros cinquenta anos,
aproximadamente. Hoje, porm, pelo menos entre cientistas e aqueles que a compreendem de
maneira geral, a seleo natural figura como a principal explicao vlida para a variedade da
vida na Terra. Embora a cincia por definio espere ser corrigida no decorrer do tempo, agora
parece muitssimo improvvel que a ideia de Darwin vir a ser completamente substituda.
Quando ns a associamos teoria celular, ambas as ideias saem extraordinariamente
fortalecidas.
Embora o conceito de evoluo simplesmente que os organismos mudam ao longo do
tempo seja anterior a Darwin, em 1859, essas eram ideias novas e verdadeiramente
revolucionrias. Ambas refutavam a concepo reinante ao longo da maior parte da histria
humana: que cada uma das criaturas havia sido criada em separado. Sem o rduo trabalho de
Darwin e o meticuloso trabalho de observao dos microscopistas dos sculos XVIII e XIX, a
ideia de mltiplas rotas para a vida, origens separadas no apenas para plantas, animais e fungos,
mas para cada diferente tipo de organismo, podia parecer plausvel. Mesmo levando em conta a
inumervel variedade de distintos tipos de clula, cada um com funes altamente
especializadas, origens separadas ou plurais podiam parecer razoveis.
Em vez disso, graas a Darwin e teoria celular, podemos ligar cada organismo linhagem
maior. Como Darwin escreveu no pargrafo final de sua obra-prima: H uma grandiosidade
nesta concepo da vida, com seus vrios poderes, como originalmente soprada em algumas
formas ou em uma forma. Estas so algumas das mais belas palavras j escritas, e muito
citadas. Algumas coisas merecem ser repetidas. Mas ele inseriu uma dvida naquelas ltimas
palavras: em algumas formas ou em uma forma. Qual ter sido o caso? O que se situa na base
da rvore da vida? Uma nica forma, uma clula, ou muitas? A resposta para essa questo
histrica profundamente enraizada no se situa no passado, mas nas entranhas moleculares de
cada clula viva. Examinando o mecanismo pelo qual as clulas transmitem suas caractersticas
e pelo qual essas caractersticas sofrem mutao, chegaremos a uma resposta para a questo da
origem singular ou mltipla da vida e comearemos a ver que aparncia ela poderia ter tido
quando emergiu.
2. Rumo ao uno

OLHE PELA JANELA mais prxima e tente contar quantas espcies voc v. Sentado aqui
minha mesa, olhando para o jardim, posso contar quarenta espcies de plantas (das quais sei o
nome de pelo menos seis), uma aranha, um esquilo e um suspeitamente bem-alimentado pombo-
torcaz. Sei que h milhes de outros seres aninhados no solo, alimentando-se das folhas, no
concreto entre os tijolos. Sei que h minsculos insetos parasitas pegando carona nos pelos do
esquilo e nas penas da ave, e esses insetos serviro eles prprios de rico hbitat para milhares de
bactrias. Sei que na Terra as bactrias excedem em nmero e massa todas as outras coisas
vivas, e h bilhes delas em cada p cheia de barro. Quando estvamos no curso de graduao,
fizemos culturas de bactrias colhidas esfregando nossa pele adolescente e espalhando-as em
placas com gar. Voc pode olhar para a ponta de seu nariz e ter certeza de que h mais vida
nesse panorama que no resto do Universo extraterrestre conhecido. Classificamos cerca de 2
milhes de espcies vivas e sabemos que esse nmero uma grande subestimao, pois a cada
dia novas espcies so descobertas e nomeadas. A vida perturbadoramente diversa. O que mais
atordoa, porm, sua conformidade.
No necessrio um grande salto de f para ver que somos estreitamente relacionados a
chimpanzs ou gorilas. S um projetista com a inteno de enganar, ou desprovido de
imaginao ou empenho, iria criar coisas to parecidas sem simular que no eram primas.
bvio que os ces em todas as suas formas fabricadas pelo homem so estreitamente
relacionados aos lobos, e a cincia o confirma. preciso um pouco mais de anlise para mostrar
que os golfinhos esto muito mais estreitamente relacionados aos hipoptamos que ao atum, com
os quais se assemelham superficialmente. Investigue com mais ateno, e torna-se bvio que os
trs tm uma ancestralidade comum visvel nas espinhas, nos olhos e na estrutura ssea (entre
muitas outras coisas) de nadadeiras, patas e barbatanas, respectivamente. Mas sem sombra de
dvida mais difcil ver o que h de comum entre a folha de um sicmoro e a barbatana de
peixes como os cicldeos. Ou entre uma equidna ocidental de focinho comprido e o recm-
descoberto cogumelo malaio Spongiforma squarepantsii. Ou entre Turdus philomelos e Candida
albicans: um uma bela ave canora, o tordo, o outro, um fungo amarelado, mas em ingls a
palavra thrush designa ambos.
Esse zoolgico feito de clulas de muitos tamanhos e formas diferentes. Contudo, todas elas
so basicamente a mesma coisa, assim como todos os carros movidos a gasolina so a mesma
coisa. Os carros tm um chassi, um motor, algumas rodas (quase sempre quatro), um volante, e
assim por diante. Os detalhes do motor, o design, os pneus etc. fazem a diferena entre um
Porsche 911 e um Trabant. Fundamentalmente, porm, ambos so carros, derivados por meio de
muitas iteraes de um ancestral comum, o qual possua uma verso primitiva do motor de
combusto interna feito de metal e movido por combustvel fssil. Com as clulas passa-se o
mesmo. Sob o cap, h mecanismos e peas que diversificam o desempenho de uma clula,
segundo ela funcione como parte de um organismo ou permanea isolada. Em termos de
estrutura global, elas so iguais, mas extremamente especializadas para construir as
complexidades e adaptaes de toda a vida.
O ponto de partida desses fundamentos da biologia foi resultado dos avanos efetuados pelos
cientistas celulares em meados do sculo XIX. Essa foi uma poca febril, pois Darwin estava
tambm deduzindo a evoluo, e, milhares de quilmetros a leste, um religioso austraco plantava
um jardim que iria robustecer a biologia para sempre. Joseph Gregor Mendel sempre descrito
como um monge, o que, embora sem dvida verdadeiro, oculta o fato de que foi como gnio
cientfico e experimentalista que transformou o mundo que ele nos deixou um legado.1 Mais ou
menos na poca em que Darwin escrevia sua obra-prima, Mendel estudava ervilhas e cruzava-as
s dezenas de milhares. Como qualquer cientista lhe dir, grandes nmeros fazem boas
estatsticas. O que Mendel descobriu em nmeros impressionantemente grandes foi que, ao
cruzar variantes de ervilhas entre si, os resultados na descendncia eram previsveis. Ele mostrou,
alm disso, que os traos eram herdados de maneira discreta isto , independente das demais
caractersticas da planta. Em vez de plantas com flores de cor mesclada, a prognie de uma
ervilha de flores prpura cruzada com uma de flores brancas no eram plantas com flores
rosadas, mas nmeros previsveis de ervilhas de flores brancas e de flores prpura. Ele cruzou
planta altas com plantas baixas, e viu que as crias eram sempre altas, em vez de apresentar uma
mdia das duas alturas. Quando ele cruzou essas crias entre si, de suas crias eram altos e era
baixo. Nessas propores, ele havia descoberto no apenas que caractersticas so transmitidas
individualmente, mas tambm que algumas caractersticas eram dominantes sobre outras.
A histria de Mendel e suas ervilhas biologia de curso secundrio. O que ele descobriu
(embora o nome tenha vindo muito mais tarde) foi a existncia de genes unidades discretas de
herana.2
Quase totalmente ignorado quando foi publicado, o artigo de Mendel foi redescoberto no
incio do sculo XX. O que se seguiu foi observao alm do visvel a olho nu. As novas
tecnologias do sculo significavam que a escala da biologia reduzia-se do organismo para a
clula, para o nvel molecular e atmico, e com essa aproximao do foco veio o nascimento da
gentica moderna.

No escapou nossa ateno

Entre a morte de Mendel, em 1884, e os anos 1950 houve avanos importantes e sucessivos no
estudo dos genes. Mendel havia provado que a herana ocorria em unidades discretas. Bilogos
marinhos italianos examinaram as clulas de ourios-do-mar e observaram cromossomos
ntidas estruturas dentro do ncleo de todas as clulas, que se tornavam visveis, parecendo
pequenas salsichas, quando as clulas se dividiam. Os cromossomos estavam presentes em
nmeros especficos, dependendo do hospedeiro, e os bilogos descobriram que a alterao desse
nmero resultava em abominaes na descendncia ou impedia por completo a reproduo. Na
dcada de 1920, Thomas Hunt Morgan promoveu endocruzamentos entre drosfilas para mostrar
que as unidades de herana de Mendel estavam posicionadas de maneira muito precisa nesses
cromossomos. No meio-tempo, pesquisadores alemes haviam mostrado que os cromossomos
eram feitos de uma molcula chamada DNA, cuja composio qumica era claramente
diferente das protenas que compunham grande parte dos ingredientes da clula, pois continha
fosfato.
Na dcada de 1940, Oswald Avery, Colin MacLeod e Macly n McCarty demonstraram que
era esse DNA que conferia caractersticas e as transmitia, executando em Nova York uma
interessante proeza de ressurreio, de natureza perversamente fatal. Eles estavam
acompanhando o trabalho de Fred Griffith, um mdico militar britnico que mais de uma dcada
antes percebera que, no curso da pneumonia, estavam presentes bactrias virulentas e benignas,
mas estas ltimas podiam adquirir as caractersticas malignas das primeiras, mesmo que as
virulentas estivessem mortas. Ele demonstrou isso fervendo as bactrias letais de modo a mat-
las, e em seguida acrescentando o caldo resultante aos micrbios benignos, que adquiriam a
capacidade de matar. Avery e sua equipe repetiram o experimento de Griffith, mas, para
compreender como ele funcionava, eliminaram sistematicamente cada um dos componentes das
bactrias candidatos a transmitir suas caractersticas. A transformao s deixou de ocorrer
quando destruram o DNA da bactria mortal. Ficou patente que o DNA, e no as protenas ou
qualquer outra coisa no ambiente da clula, era o material gentico essencial, a substncia que
conferia caractersticas e as transmitia.
O DNA era claramente um possivelmente o componente essencial da herana. No se
sabia, porm, como isso funcionava. A resposta residia em sua construo. Em 1952, um grupo
de pesquisadores no Kings College, incluindo Maurice Wilkins, Rosalind Franklin e Ray mond
Gosling, investigava o DNA usando sua expertise na produo de representaes fotogrficas de
estruturas moleculares tridimensionais. A difrao de raios X, tcnica comum para o
estabelecimento da forma de molculas complexas, foi levada por Wilkins, do Projeto
Manhattan, que produziu as primeiras bombas atmicas, para Londres. O princpio do processo
semelhante ao usado naqueles retratos em silhueta to em moda nos sculos XVIII e XIX:
projeta-se um raio de luz sobre um objeto e captam-se a luz e a escurido projetadas para alm
dele. Nos retratos em silhueta, o sujeito humano um slido para a luz visvel que essa tcnica
usa, mas, na verso molecular, os raios X penetram a molcula sob exame e criam sombras
caractersticas atrs dela, espirais regulares, mas enigmticas, projetadas na placa fotogrfica.
preciso lanar mo de deduo matemtica para compreender o arranjo de tomos que poderia
produzir tal padro, mas o efeito o mesmo: um retrato nico de uma molcula que de outro
modo seria pequena demais para ser vista. Rosalind Franklin era particularmente habilidosa no
uso dessa tcnica, e uma das muitas fotografias que ela revelou com Gosling ao executar esse
rduo mtodo, a Foto 51, seria a chave para uma das grandes faanhas na histria humana.
Os cientistas Francis Crick e James Watson, de Cambridge, adquiriram essa fotografia. A
cincia sempre se baseia no trabalho dos outros, mas foi com sua prpria perspiccia e seu gnio
que eles deduziram da foto de Franklin e Gosling que o DNA assumia a forma de uma escada
retorcida, a icnica dupla-hlice. Num breve artigo publicado na revista cientfica Nature em 25
de abril de 1953, eles mostraram que os degraus dessa escada retorcida continham pares de
letras qumicas A para adenina, T para timina, C para citosina e G para guanina. Cada letra est
ligada a um montante vertical da escada e se emparelha com uma letra correspondente no outro
montante vertical, formando um degrau. esse emparelhamento que torna dupla a hlice, e ele
muito preciso: A sempre se emparelha com T, e C sempre se emparelha com G. Crick e
Watson concluram o artigo com uma das notveis ltotes encontradas na cincia: No escapou
nossa ateno que o emparelhamento especfico que postulamos sugere de imediato um
mecanismo de cpia para o material gentico.
Essa a primeira coisa maravilhosa sobre o DNA. Se voc divide a dupla-hlice nos dois
filamentos que a compem, tem de imediato a informao para repor o filamento que falta:
onde h um A, o outro filamento deve ter um T, e onde h um C, o outro filamento precisa de um
G. Portanto, o DNA possui uma habilidade, inerente sua estrutura, de fornecer as instrues
para sua prpria reproduo. Com o resultado de Crick, Watson e Franklin, foi-nos dada uma
molcula que podia ser copiada e transmitida de gerao em gerao.3
As molculas representadas pelas letras, conhecidas como bases, ligam-se umas s outras,
mantendo juntos os dois montantes da escada. H milhes desses pares em cada filamento de
DNA, que se estende por alguns metros em toda clula humana dotada de ncleo, embora esteja
enrolado e depois enrolado em si mesmo de novo, em torno de pequenos agrupamentos de
protenas, como contas num colar. E isso se enrola em si mesmo novamente para formar um
cromossomo, como uma grossa corda de cabo de guerra.
O nmero de cromossomos e o comprimento deles variam enormemente entre todas as
espcies, e essa variao no parece se relacionar com o tamanho nem com a complexidade do
hospedeiro. Ns temos 23 pares de cromossomos, e as bactrias tendem a ter apenas um, num
ntido anel. Mas algumas carpas tm mais de cem, e isso nem se aproxima do nmero de
cromossomos de algumas clulas vegetais, que pode chegar casa dos milhares. A coleo
completa do DNA de um organismo, empacotada em cromossomos, chamada genoma. Em
seres humanos, aqueles 23 cromossomos, nosso genoma, contm cerca de 3 bilhes dessas
letrinhas, A, T, C e G, o suficiente para encher um catlogo telefnico de 200 mil pginas, caso
esse tipo de comparao o atraia. Mas cada vez que uma clula se divide em duas, desde a
primeira diviso do seu vulo fertilizado at a das clulas cutneas recm-nascidas num corte
com papel, todo o DNA dessas clulas se copia. A nova clula contm todo o DNA de sua me.4
A capacidade de se reproduzir de gerao em gerao uma proeza interessante. Por si s,
porm, isso iria apenas encher o mundo com uma bonita molcula. O poder secreto do DNA
que essa cadeia de letras qumicas, as bases, um cdigo que encerra informao. Essa
informao um manual de instrues para todo o processo da vida, inclusive as instrues
requeridas para o prprio processo de reproduo. A compreenso de como o cdigo do DNA
funciona revelar no s como a mutao e a variao ocorrem, aproximando-nos de uma
resposta para a questo proposta por Darwin, em algumas formas ou em uma forma, mas
tambm nos dar indcios essenciais para a questo de como a vida se formou, em primeiro
lugar.

Como o DNA funciona

Toda a vida feita por ou de protenas. Estas formam as estruturas e os catalisadores da biologia,
assim como as fbricas de osso, cabelo e todos os pedacinhos de um corpo que no so eles
mesmos feitos de protena. Claro que isso no se limita a ns, nem mesmo aos mamferos. Cada
folha, cada lasca de casca de rvore, escama de rptil, chifre, fungo, pena ou flor constitudo
de ou por protenas. Esses paus para toda obra da vida so feitos eles prprios de cadeias de
unidades menores chamadas aminocidos nome genrico para um nmero potencialmente
infinito de partes moleculares que se qualificam para receber essa designao.
Sabemos agora que cada gene aquelas unidades discretas de herana num genoma um
pedao de cdigo composto dos pares de bases de DNA que codificam a construo de uma
protena. No entanto, apenas algumas partes nos genomas de muitas espcies so genes. O resto
de fato, nos seres humanos, a maioria esmagadora do DNA compreende anotaes, instrues,
andaimes e at inseres de vrus intrometidos. Algumas partes so vestgios de genes de nossos
ancestrais, cuja funo foi perdida em ns, mas cujos fantasmas permanecem em nosso
genoma, livres da presso da seleo natural para enferrujar lentamente.5 Depois do grande
salto adiante que foi o estabelecimento, por Crick e Watson, em 1953, de que o DNA era uma
escada em forma de espiral, e que ele tinha o poder duplo de replicao e codificao de
informao, o maior desafio na biologia passou a ser decodificar DNA, e isso representava, antes
de mais nada, identificar quais fragmentos dele eram genes e quais no eram.
Imagine que cada frase deste livro um nico gene: o genoma humano seria um livro
quarenta vezes mais longo que este, cheio de texto incoerente, mas com minhas frases nele
distribudas aleatoriamente. Como voc identificaria quais as frases relevantes? A linguagem
salpicada de pontuao para complementar as letras e acrescentar significado compsito acima
das prprias palavras. Defatomuitodifcilparansextrairsenti-
dodeumafraseemquenohajanemespaosnempontuao. Por sorte, para a cincia, e
necessariamente para a clula, com o DNA no diferente. Antes que os cientistas pudessem
decifrar o que as palavras e frases de DNA significam, o primeiro desafio foi descobrir onde
estavam os espaos onde um gene comea e acaba , e isso significou descobrir sua pontuao.
Na altura dos anos 1960, os cientistas sabiam que a vida era construda de ou por protenas,
que as protenas eram feitas de aminocidos e que o DNA era a matria hereditria que
codificava as protenas. A grande lacuna estava na passagem de um para o outro, do cdigo de
DNA para as protenas. Ao inserir experimentalmente uma molcula entre duas letras de DNA
funcional, Crick e outro futuro Prmio Nobel chamado Sy dney Brenner interromperam
intencionalmente o cdigo e impediram que uma protena fosse produzida. Essas interrupes so
conhecidas como mutaes de deslocamento de quadro de leitura, como um projetor de
filmes cuja velocidade de obturador est errada, de modo que vemos metade de um quadro e
metade de outro. Quando se interrompia o DNA com inseres equivalentes a uma, duas ou
quatro bases, o mesmo efeito era observado uma protena interrompida. Mas, com uma
insero de trs, ainda era vivel a produo de uma protena. Eles deduziram disso que o cdigo
de DNA opera em sequncias de trs bases. Esse padro conhecido como quadro de leitura:
ele se posiciona numa poro do DNA, expondo tripletos de letras que tm significado.
A partir desse ponto, um cientista americano e um alemo decifraram a primeira mensagem
codificada em DNA, em 1961, usando o processo de eliminao. Em vez de tentar descobrir
como uma sequncia de DNA de ocorrncia natural se traduzia em protena, Marshall Nirenberg
e Heinrich Matthaei conectaram uma extenso de cdigo gentico que consistia unicamente na
base timina (a letra T). Eles inseriram isso na mecnica de uma clula ativa e lhe forneceram
um suprimento de aminocidos adequado construo de uma protena. Sabendo que h
somente vinte aminocidos com os quais toda vida construda, em cada um de vinte diferentes
tubos de ensaio contendo todos os vinte, um nico aminocido diferente dentro da mistura foi
marcado com um rtulo radioativo. Isso significava que, se uma protena resultante de seu DNA
alterado zumbisse com radiao, eles seriam capazes de identificar qual aminocido fora
codificado por um tripleto de bases de timina. Quando extraram as protenas de seus vrios tubos
de ensaio, o resultado foram dezenove fiascos e um que fez os contadores Geiger zumbir. Eles
descobriram que um cdigo gentico que consistia exclusivamente na letra T resultava numa
protena que consistia exclusivamente no aminocido fenilanina.
Assim, a natureza do incontrolvel cdigo foi conhecida. Durante os anos seguintes, variando
o modelo, descobriu-se cada tripleto que codificava os outros dezenove aminocidos, at que, no
fim dos anos 1960, tnhamos um esquema completo de como DNA codifica as protenas.
Assim, aqui est uma pequena seo de DNA, parte de um gene:

cctgggaccaacttcgcgaagcgggaagcccggcgg

Aqui est a mesma sequncia quebrada no quadro de leitura de tripletos, tal como a clula a
l:

cct ggg acc aac ttc gcg aag cgg gaa gcc cgg cgg

E aqui est ela novamente, com cada aminocido (escritos aqui em sua forma abreviada) ao
lado de cada cdon:

cct ggg acc aac ttc gcg aag cgg gaa gcc cgg cgg
Pro Gly Thr Asn Phe Ala Ly s Pro Glu Ala Arg Arg

Essa cadeia de aminocidos faz parte de uma protena.


Como ento os cientistas podem distinguir onde um gene comea e onde termina? H
tambm pontuao na lngua do DNA. Na srie contnua de As, Ts, Gs e Cs, a clula sabe onde
um gene comea porque todos eles, sem exceo, comeam com as letras ATG, o chamado
cdon de iniciao, equivalente a uma letra maiscula no incio de uma frase. De maneira
semelhante, todos os genes terminam com um ponto-final, um de trs cdons de parada: TGA,
TAG e TAA. Um quadro de leitura para um gene inteiro sempre comea com ATG e termina
com um desses trs cdons de parada.
As protenas so, portanto, longas cadeias de aminocidos tal como decretadas pelo DNA que
as codifica. Elas executam suas funes dobrando-se em formas tridimensionais, e os sulcos,
buracos, grampos e bolsos em suas formas dobradas lhes do toda sorte de habilidades.6
Protenas tambm se agrupam para ganhar novas finalidades. Por exemplo, a hemoglobina que
transporta oxignio por todo o nosso corpo nos glbulos vermelhos do sangue composta de
quatro protenas, que carregam juntas um nico tomo de ferro. As assombrosas propriedades
dos fios de seda produzidos pela aranha so resultado do sofisticado complexo de diferentes
protenas de que eles so feitos, algumas das quais cuidadosamente dobradas, outras se
sobrepondo para criar uma elevada fora tensora comparvel do ao. Algumas protenas so
enzimas, que catalisam reaes biolgicas, o metabolismo nas clulas que nos mantm vivos.
Outras so sensoriais, como aquelas encontradas nos bastonetes e cones de nossa retina, to
especializadas que podem detectar um nico fton de luz e desencadear o processo da viso.
Todas essas propriedades resultam do fato de as protenas dobrarem-se, conectarem-se e
interagirem umas com as outras de maneiras extremamente precisas. Por mais diversas que as
aes das protenas possam ser, o cdigo subjacente a todas elas o mesmo.
Esse o alicerce da biologia: a traduo de cdigo em ao. Mas qual o processo pelo qual
essa traduo ocorre? Se o genoma uma espcie de escritrio central que contm os projetos
para a fbrica, os projetos nunca saem realmente do escritrio, por isso as pginas relevantes
devem ser copiadas. Em outras palavras, h um intermedirio entre o DNA e o local da
fabricao da protena, e esse enviado toma a forma do primo do DNA, o RNA.
O DNA uma hlice torcida a partir de dois montantes de uma escada, os degraus ligando
uma outra. Mas o RNA um filamento nico, com os degraus expostos de um lado. Quando
uma protena particular requerida, a hlice dupla do DNA divide-se em duas para expor o gene
pertinente. Um nico filamento de RNA colocado por cima do gene exposto e cada letra desse
gene copiada no RNA de forma especular. Esse enviado, apropriadamente chamado RNA
mensageiro, leva a mensagem do genoma ao local de construo da protena.
Mais tarde veremos que o RNA desempenha um papel muito mais central na origem da vida
do que sugere seu mero status de mensageiro. No entanto, chegamos agora primeira e maior
pista para a questo proposta pelas palavras em algumas formas ou em uma forma. O sistema
descrito acima universal. No h nenhuma forma de vida que no o empregue e no dependa
inteiramente dele: DNA feito de quatro letras traduz-se em protenas feitas de vinte
aminocidos. Isso conhecido como o dogma central: DNA faz RNA faz protena. O fato de
toda a vida conhecida ser completamente dependente desse sistema faz parecer quase
inconcebvel que ela no esteja relacionada por meio de uma origem singular, comum.
Descobrir como tal sistema pode ter se estabelecido ser essencial se quisermos saber como a
vida tal como a conhecemos ganhou existncia.7

A mo direita da vida

Se o cdigo e as ferramentas compartilhadas da vida no forem suficientes para apontar uma


origem nica de maneira inequvoca, aqui est a estranheza da biologia que decide a questo
enfaticamente. Mantenha as mos com as palmas viradas para voc. Elas so reflexos uma da
outra. Se voc deslizar uma sobre a outra, com as palmas ainda voltadas para voc, uma no
pode esconder a outra, pois os polegares sobressaem. Essa a base da indstria de luvas: a luva
esquerda no servir na mo direita. O mesmo ocorre com as molculas da vida. Assim como
h formas especulares de mos, h formas especulares de certas molculas.
Um tomo feito de um ncleo central, positivamente carregado, cercado por eltrons
negativamente carregados. Esses eltrons formam os elos que mantm tomos individuais unidos
em molculas e, como os polos de um m, eles se repelem uns aos outros. Assim, eles tentam
maximizar o espao entre si. Quando tomos se ligam a outros tomos para formar uma
molcula, eles espaam essas ligaes para distncias to uniformes quanto possvel, tendendo a
adotar formas simtricas. Um tomo com trs ligaes disponveis, como nitrognio, tender a
formar uma molcula triangular, com uma ligao em cada um dos cantos. Dixido de carbono,
por outro lado, uma molcula reta: o tomo de carbono tem quatro ligaes disponveis, o
oxignio tem duas, e assim, o tomo de carbono flanqueado por dois tomos de oxignio, cada
um ocupando uma ligao dupla. Mas se o tomo procura naturalmente fazer quatro ligaes,
como ocorre com o carbono, o maior espaamento das ligaes no se d em duas dimenses,
mas em trs: uma pirmide com base triangular. O tomo de carbono situa-se no centro dessa
forma, com as quatro pontas a espaos iguais uma da outra. Tudo vai muito bem quando os
tomos nos cantos so os mesmos, ou ainda quando dois ou trs deles so diferentes uns dos
outros. Mas, to logo cada um dos quatro cantos ocupado por um tomo diferente, a
lateralidade torna-se uma possibilidade. Em outras palavras, exatamente os mesmos tomos na
mesma conformao podem ser arranjados em formas especulares. Em qumica, isso se chama
quiralidade, da palavra em grego clssico para mo.
Por vezes dizemos que a vida na Terra se baseia no carbono, querendo dizer que todo DNA e
protenas so construdos a partir de estruturas que contm tomos de carbono. E o carbono,
como vimos, pode formar molculas quirais, imagens especulares uma da outra, de tal modo que
seria razovel supor que encontraramos uma mistura de molculas baseadas em carbono destras
e canhotas. O extraordinrio que, no que diz respeito vida, os aminocidos que compem
protenas so canhotos.8
Foi o exterminador daquela ideia permanentemente infrutfera da gerao espontnea quem
primeiro identificou a quiralidade qumica. Uma das maneiras que nos permitem reconhecer a
natureza quiral de uma molcula consiste em simplesmente lanar luz atravs dela.
Imagine que voc prende uma mola slinky numa parede e depois a ondula em todas as
direes. As ondas iriam para cima e para baixo, bem como de um lado para outro. Se em
seguida voc inserisse a mola numa fenda vertical e fizesse o mesmo, ela s seria atravessada
por ondas verticais. Certas molculas tm exatamente esse efeito filtrador sobre a luz. Elas
podem polarizar a luz num nico plano, apesar de sua tendncia natural a ondular em todas as
direes. Louis Pasteur observou que o lanamento de um feixe atravs da soluo de uma
molcula simples chamada cido tartrico purificada a partir de clarificantes para vinho fazia a
luz ser polarizada.9
Mas ele notou tambm que cido tartrico fabricado no laboratrio no tinha essa
propriedade, apesar de quimicamente idntico. Eis a razo: as molculas no cido tartrico so
baseadas em carbono, e, quando sintetizadas em laboratrio, as verses destras e canhotas so
feitas em igual medida, com a mesma probabilidade aleatria do lanamento de uma moeda.
Isso significa que qualquer efeito polarizador de uma verso cancelado pela ao oposta da
molcula espelho. J o cido tartrico encontrado em clarificantes era naturalmente sintetizado
em clulas de levedura como parte do processo de fabricao do vinho. Em consequncia, elas
so todas canhotas. Essas molculas partidrias s deixam passar um plano de luz.
Essa pequena digresso pelos domnios do vinho, das ligaes qumicas e do pensamento
espacial essencial porque, por motivos que no compreendemos bem, as protenas s usam
aminocidos canhotos. A razo por que todos os vinte aminocidos de que todas as protenas so
feitas so canhotos um mistrio. Cerca de 45 dos seres humanos so destros, de modo que o
equivalente no caso das pessoas seria como se os canhotos no existissem.
A revelao de Pasteur de que a produo no biolgica de molculas quirais resultava em
verses canhotas e destras em igual medida foi o pressgio de uma das tragdias mdicas mais
pavorosas da histria. A droga talidomida um tranquilizante e analgsico suave, mas eficiente.
Sua eficcia numa srie de condies, de insnia a dores de cabea, valeu-lhe o status de droga
milagrosa. Sendo tambm um tratamento eficaz para evitar o vmito, foi oferecida a mulheres
grvidas acometidas de enjoo matinal. Entre 1957, quando foi introduzida, e 1962, quando deixou
de ser indicada no mundo todo, mais de 10 mil bebs nasceram com graves defeitos congnitos,
entre os quais membros atrofiados e outras anomalias, em consequncia da exposio
talidomida no tero. A talidomida uma molcula quiral, e foi determinado que, das duas verses
espelhadas, apenas uma tinha o efeito de provocar mutaes. Como no caso do cido tartrico de
Pasteur, sua produo em laboratrios farmacuticos no levou em conta a questo das verses
especulares, e a droga foi vendida com ambas as mos, em igual medida. Sabemos hoje que,
uma vez no organismo, as duas verses de talidomida possuem a desconcertante capacidade de
se transformar em seu reflexo, por isso, mesmo na verso mais inofensiva, ela seria
potencialmente prejudicial ao embrio em desenvolvimento. A droga ainda prescrita em certos
pases como tratamento eficaz para a lepra e outras doenas. Mas seu uso por mulheres grvidas
est proibido.
A quiralidade um fenmeno biolgico, com as protenas situando-se quase exclusivamente
esquerda. No se conhece a origem desse preconceito. Talvez se trate de algo to simples quanto
um evento casual, mas que pegou. A uniformidade aponta para o desenvolvimento de um
sistema com um nico ponto de origem. Se a vida tivesse se desenvolvido duas vezes, provvel
que vssemos protenas canhotas e destras.
O DNA tem uma tendncia inaltervel, mas oposta: ele sempre destro. Aponte o dedo
indicador da mo direita e trace no ar um crculo imaginrio no sentido horrio. Ao mesmo
tempo, afaste sua mo de seu corpo. Esse o giro da dupla-hlice em sua forma mais comum,
como um parafuso tpico.10 Ainda que a existncia da dupla-hlice em imagem especular seja
perfeitamente possvel, ela no ocorre. A vida, revelando mais uma vez sua origem nica, usa
apenas DNA destro.
O fato de um mundo espelhado ser possvel, embora no exista, mostra de maneira
convincente que a vida tem uma origem singular. Se alguma vez houve escolha entre esquerda e
direita, apenas uma delas foi escolhida e a outra descartada para nunca mais aparecer no curso
natural das coisas. No incio dessa mecnica biolgica, ela pode ter sido to simples quanto o
lanamento de uma moeda, um evento casual que passou a ser seguido, com absoluta fidelidade,
para sempre.

A singularidade

Tanto a origem das clulas a partir de clulas-me quanto a origem das espcies por meio de
genes que mudam lentamente nessas clulas trazem as marcas distintivas de uma origem nica.
Esses trs aspectos da biologia clulas apenas a partir de clulas existentes, DNA mudando por
meio de cpias imperfeitas e descendncia de uma espcie modificada, em consequncia
revelam logicamente uma nica linha de ancestralidade que remonta, de forma inevitvel, a um
nico ponto em nosso passado muito, muito remoto.
Em outras palavras, qualquer uma das novas clulas extradas de suas celulas-me no
processo de resposta orquestrada ao desastre representado por um corte com papel transporta
uma linhagem direta e nobre. A histria da vida est repleta de extino, mas uma nova clula
em sua mo uma das magnficas sobreviventes da mais longa linhagem na histria. Em uma
gerao, sua ancestralidade remonta ao vulo fertilizado a partir do qual cada clula de seu corpo
nasceu. O vulo e o espermatozoide que se fundiram para formar sua combinao nica de
genes e DNA podem traar um caminho semelhante at sua origem num vulo fertilizado, e
assim por diante, passando por seus pais, avs e cada ancestral em sua rvore genealgica e, de
fato, na histria de nossa espcie.
Claro que isso nem de longe termina a. Essas clulas, por sua vez, traam sua ancestralidade
atravs do tempo de vida de nossos ancestrais simiescos. Ainda no sabemos exatamente quem
eram, mas eles existiram no corpo dos primeiros indivduos que entalharam ossos para fazer
ferramentas, que acenderam fogueiras com slex e assumiram uma postura ereta que ns, entre
os smios, somos os nicos a ter.11
E certamente no termina a. Antes de estar nos rgos reprodutivos daquele smio ereto, sua
linhagem celular foi transportada atravs de primatas h muito desaparecidos, talvez algo como
Proconsul, que se assemelhava a alguma coisa entre um chimpanz e um macaco do gnero
Macaca. Antes deles, esteve entre outros macacos, e mesmo antes, atravs de seus ancestrais
peludos, de focinho molhado, mais parecidos com os lmures modernos. E, medida que
recuamos, clulas que foram outrora as predecessoras de seus macrfagos Pac-Man ou
neurnios faiscantes existiram numa criatura parecida com um musaranho, dotado de pelo e
mamilos. Esse bicho, seu ancestral, estava presente quando um enorme meteoro explodiu sobre o
Trpico de Cncer e ps fim ao reinado dos dinossauros, 65 milhes de anos atrs. Sua linhagem
celular testemunhou toda a queda e ascenso desses animais, aninhada dentro de muitos
mamferos primitivos, como Cynodontia, que parecia um roedor de tamanho incomum e
rosnador. Antes desses primeiros mamferos, mais de 220 milhes de anos atrs, o ancestral de
suas clulas foi um ovo com casca de um rptil sem pelos e de sangue frio, como Diadectes,
enorme animal de dois metros de comprimento que parecia um crocodilo atarracado, avesso a
dietas.
Para conseguir estar nesse ovo, ele sobreviveu a iteraes de animais que haviam, entre
muitas outras coisas, desenvolvido clulas que produziam uma estrutura de colgeno mais
espessa em seus rgos respiratrios; com essa novidade, os pulmes primitivos podiam se
sustentar sem necessidade de gua. possvel que sua linhagem celular tenha passado atravs de
uma criatura como o peixe pulmonado, de 375 milhes de anos, o Rhinodipterus, que,
diferentemente de outros peixes daquele tempo, tinha um pescoo musculoso, e com isso a
capacidade de levantar a cabea acima da linha da gua. Essas inovaes lhe permitiam respirar
ar, em vez de sugar oxignio da gua do mar. Num passado ainda mais remoto, sua linhagem
celular esteve contida em uma criatura com muito mais jeito de peixe, com barbatanas e
guelras. Antes disso, ela esteve em um dos primeiros vertebrados, ser nadante um pouco
parecido com uma enguia ou uma lampreia. E antes disso esteve numa coisa muito mais clida,
similar ao anfioxo moderno, de cinco centmetros: em uma dessas clulas, um grande erro de
cpia em seu genoma, uma quadruplicao de todo o seu DNA, no resultou numa fatalidade,
mas em toda uma nova plataforma gentica em que os vertebrados comearam a evoluir. Antes
disso ela era uma coisa esponjosa. E antes, ainda, apenas um amontoado de clulas flutuando ou
alojado numa rocha. E assim ela recua mais, mais e mais, incessantemente, no passado. A
linhagem de suas clulas sobreviveu a cada desastre, catstrofe, meteorito, a cada extino, era
do gelo e predador voraz, a cada evento neste sistema solar durante quase 4 bilhes de anos.
A vasta maioria das suas clulas, inclusive todas as clulas novas no corte de sua mo, so
ramos terminais nessa linhagem absoluta, pois sua histria terminar com sua vida. As nicas que
sobrevivem para dar origem a clulas na prxima gerao so o espermatozoide ou o vulo. E,
dos trilhes de clulas que trabalharam para voc durante sua vida, s um punhado prosseguir,
as poucas afortunadas que encontraro um espermatozoide ou um vulo e faro um filho. Mas a
informao contida em todas elas ser levada adiante. Atravs dessa linhagem foi transmitido o
DNA que integra todas essas clulas para forjar a maneira mais eficiente de assegurar a
perptua existncia de seus genes: um organismo. A vida um sistema espantosamente
conservador. O DNA a mesma coisa em todas as espcies; as letras do cdigo so todas as
mesmas; a criptografia no cdigo a mesma; at a orientao das molculas a mesma. O que
verdade numa bactria verdade numa baleia-azul. Somente um sistema com uma nica raiz
poderia exibir tal conservao.
Esse caminho, retraando nossos passos medida que eles se tornam mais e mais apagados
ao longo do tempo geolgico, pode ser aplicado a qualquer criatura viva hoje, ou em qualquer
momento. As lacunas tornam-se maiores, e o caminho quase sempre apenas hipottico.
Embora tenhamos uma boa compreenso global da origem das espcies, afirmar que uma
espcie foi o ancestral direto de outra uma extrapolao exagerada do que sabemos. Mas o
curso geral da evoluo est bem-compreendido, e qualquer passo atrs pelo passado a partir de
qualquer criatura nos conduz a um nico alvo conceitual. A rvore ramificada da vida torna-se,
por fim, cada vez mais estreita medida que recuamos no tempo at alcanarmos um s tronco.
Poderamos traar uma rota equivalente para trs, rumo a uma clula retirada da lama fervente
de uma fonte hidrotermal na Islndia, da flor de uma ervilha-de-cheiro, ou de um champignon
do supermercado, e terminaramos todas as vezes no mesmo lugar. Em cada clula h uma
perfeita cadeia ininterrupta que se estende at a origem da vida. Essa linhagem conduz
irresistivelmente a uma entidade singular, que chamamos o ltimo Ancestral Comum
Universal (Luca, na sigla de Last Universal Common Ancestor). Em algum lugar nos
primrdios da Terra, Luca dividiu-se em dois. Desde ento, a coisa que nos esforamos para
definir como vida passou, sem interrupo, dele at voc, por meio de uma srie colossal de
iteraes. A existncia assombrosamente tenaz.
Entidades que talvez descrevssemos como vivas podem ter emergido vrias vezes, mas a
vida s sobreviveu de maneira duradoura uma vez, e depois continuou. Temos certeza disso
porque essas outras formas simplesmente no existem. Pelo menos no foram descobertas. H
um ramo de especulao que prope algo batizado com um nome um tanto futurstico: biosfera
das sombras. Trata-se da ideia de que h na Terra uma segunda rvore da vida (ou mais) no
detectada, com caractersticas diferentes da nica que conhecemos. Mas o fato que todas as
formas de vida examinadas at agora so baseadas em clulas, DNA e Darwin. A descoberta de
uma segunda rvore da vida aqui na Terra daria uma credibilidade muito necessria procura de
vida em outros planetas, pois duplicaria o nmero de origens bem-sucedidas de eventos da vida
que conhecemos. Mostraria que no somos um extraordinrio golpe de sorte. No entanto, uma
vez que a cincia baseada em evidncias observveis, a biosfera das sombras, por mais
sensacional que parea, definitivamente fico cientfica.

A poda da rvore da vida

As prximas questes parecem de ofuscante obviedade. O que foi Luca e de onde veio?
Podemos supor que ele tinha DNA como seu cdigo gentico, a exemplo de todas as criaturas
que o sucederam, pois seria pouco provvel que elas tivessem desenvolvido esse mecanismo de
maneira independente.
Essas ideias baseiam-se em grande parte no que compartilhamos com outras vidas, quer seja
a orientao das molculas ou grandes caractersticas fsicas como membros com cinco dgitos,
ou mesmo coisas mais simples, como ter a cabea numa extremidade e a cauda na outra. Desde
o incio da era do DNA, e mais ainda depois que a tecnologia para a leitura de genomas tornou-se
muito mais acessvel, nos anos 1990, o estudo da evoluo foi fortalecido pela busca de
similaridades e diferenas entre as letras precisas de DNA. Em razo de termos uma
ancestralidade compartilhada, milhares de nossos genes so muito semelhantes em espcies
relacionadas nossa, de maneira estreita ou mesmo remota.12
O DNA adquire erros de cpia numa taxa bastante constante, o que significa que podemos
comparar os DNAs de quaisquer espcies vivas e estimar quando eles se separaram. Podemos
comparar genes e sequncias de protenas de quaisquer dois organismos e calcular h quanto
tempo eles vm divergindo. Dessa maneira, podemos reconstruir a histria, tal como fazem os
paleontlogos com ossos fsseis, considerando semelhanas e diferenas e reunindo todas essas
comparaes para mostrar no apenas a existncia de relao entre duas espcies, mas quando o
cisma ocorreu. Esse estudo, chamado filogentica, confirmou inteiramente as ideias de
Darwin sobre a rvore ramificada da vida. No entanto, a biologia est repleta de excees de
diferentes tamanhos, e, no caso da rvore da vida, h uma enorme exceo. Usando a
filogentica, muitos cientistas sustentam hoje, de maneira convincente, que durante o primeiro
bilho de anos, aproximadamente, a vida assemelhou-se menos a uma rvore ramificada que a
um arbusto emaranhado.
As primeiras formas de vida, durante os dois primeiros bilhes de anos que se seguiram sua
ciso a partir de Luca, foram clulas individuais. Elas se desenvolviam, mas no se
transformavam de maneira radical. De fato, embora o tempo geracional fosse ordens de
magnitude mais rpido que o da maioria dos animais, durante os dois primeiros bilhes de anos a
vida no passou do estgio dos micrbios. Esses dois domnios da vida so arqueias e bactrias
superficialmente, coisas similares, ambas entidades unicelulares e mais ou menos do mesmo
tamanho. Por um longo tempo, as arqueias foram similares o suficiente para no ser
reconhecidas. No entanto, elas so diferentes o bastante para serem classificadas agora como
muito distintas das bactrias, e, de fato, de todas as outras coisas (e descobriremos que essas
diferenas so cruciais na teoria da vida). Como um domnio, elas so uma categoria parte no
nvel mais elevado da classificao dos seres vivos. O grande salto adiante ocorreu com a
chegada de vida complexa. Esse ramo da rvore, o terceiro domnio, o dos chamados
eucariotos, e inclui tudo que no est nos dois primeiros, inclusive voc e eu, levedura e cobras,
algas e fungos, flores, rvores e nabos. Em algum ponto, talvez cerca de 2 bilhes de anos atrs, a
vida complexa emergiu quando uma juno extremamente improvvel ocorreu: uma arqueia
engoliu uma bactria. Em vez da morte de uma ou outra, o resultado foi benefcio mtuo. O
consumido deixou de ser uma entidade viva livre e ficou permanentemente anexado s entranhas
do que cresceria para se tornar o terceiro domnio da vida, aquele em que voc est.
Essa ideia foi proposta pela primeira vez pela biloga americana Ly nn Margulis, em 1966.
Ela provocou uma empolgante controvrsia, que foi em grande parte rejeitada, e Ly nn foi
considerada hertica. Com tempo, experimentos e evidncias, suas concepes se justificaram, e
hoje so a ortodoxia. As evidncias apresentam-se sob vrias formas, a mais simples delas sendo
que as clulas complexas, das quais ns e todos os animais somos feitos, contm pequenas
unidades de energia internas chamadas mitocndrias. Os processos que tm lugar dentro dessas
estaes de energia so de importncia fundamental para a origem da vida, mas chegaremos a
isso no devido tempo. As mitocndrias funcionam como motores qumicos que fornecem energia
para a clula e, por extenso, ao organismo. Em termos simples, elas se parecem com as
bactrias. Tm aproximadamente o mesmo tamanho delas e tambm possuem cadeias
circulares de DNA como seu prprio genoma, as quais so independentes de grande parte da
informao gentica de uma clula, guardada em segurana no ncleo.
Quando a arqueia engoliu a bactria, isso no foi uma refeio, mas uma tomada hostil de
poder. O engolido nunca mais voltaria a ser livre, mas permitiu um desenvolvimento
anteriormente impossvel em seu novo hospedeiro. Ele chegou com seu prprio genoma, com
milhares de genes. Com o tempo, a maior parte foi perdida para a seleo natural ou migrou
para o centro de controle do ncleo do hospedeiro. Mas as mitocndrias conservam at hoje um
conjunto independente de genes, a maioria dos quais se dedica a manter a gerao de energia
para clulas. Quando isso aconteceu, carregados com novo vigor energtico, genomas puderam
se desenvolver e formar padres maiores para a evoluo, alm de clulas individuais. Clulas
puderam desenvolver estruturas internas e compartimentos que aumentaram sua especializao.
A partir da, a aquisio de comunicao coordenada entre clulas significou que um organismo
no estava restrito a uma nica clula. Seguiu-se a multicelularidade, permitindo, por fim, a
evoluo de planos corporais para plantas e animais, redes complexas de clulas comunicantes
que interagem umas com as outras e com o ambiente em harmonia.
Quando queremos retroceder atravs da rvore da vida no intuito de desbravar nosso
caminho at Luca, esses eventos geram um problema. A complicao em estimar momentos e
fazer uma descrio na base da vida decorre do fato de que tanto bactrias quanto arqueias
fazem algo mais que os cientistas no esperavam. Entre ns, os eucariotos, os genes s se
transmitem de clula para clula-filha. J as bactrias e arqueias podem trocar genes, e portanto
caractersticas, umas com as outras. Por vezes elas no precisam nem ser da mesma espcie.
Isso se chama transferncia horizontal de genes (em contraposio a descendncia vertical),
e decisivo para confundir nossas tentativas de compreender a origem da vida. A razo disso
que no sempre por meio do processo tpico de descendncia por diviso celular que essas
clulas ganham funes evoludas.13
A evoluo da lngua uma metfora que vem a calhar aqui. As palavras bigamia, bicicleta e
biscoito tm uma raiz comum. Bis, em latim, significa duas vezes. Assim, voc se casa duas
vezes, anda sobre duas rodas e come gostosas bolachinhas cozidas duas vezes. Mas h algumas
palavras ou expresses que so mais bem expressas em outras lnguas, ou at esto ausentes na
lngua receptora, e ento so simplesmente furtadas. Cul de sac tem um sentido ligeiramente
diferente e mais especfico em ingls que dead end (beco sem sada), por isso a adotamos. A
palavra alem Schadenfreude no tem equivalente em ingls, mas agora uma tima palavra
para designar o prazer ignbil que o infortnio do nosso inimigo nos proporciona. Em sueco, a
palavra skadegldje, derivada e adaptada diretamente de Schadenfreude, mas passando ao
largo de qualquer raiz comum. Ela passou horizontalmente, e em seguida desenvolveu-se de
forma independente.
O que essa troca horizontal de genes significa que nossas tcnicas para retroceder atravs
da histria da vida usando DNA como nosso guia s pode funcionar de maneira convincente a
partir do ponto em que a descendncia se tornou vertical. A rvore da vida s comea a parecer
algo ramificado, digno do nome rvore, depois da emergncia de vida complexa. Dessa
espcie em diante, depois que uma arqueia engoliu uma bactria, a maioria esmagadora da
herana se deu de me para cria: descendncia com modificao. Nick Lane, bioqumico do
University College London, chama isso de horizonte de evento gentico: a comparao de
genes nos permite recuar por todo o caminho enquanto ele continua se assemelhando a uma bela
rvore ramificada, mas antes desse ponto nossa viso fica embaada. Torna-se simplesmente
complicado demais deslindar o passado mais profundo.
Assim, embora faa sentido usarmos DNA para inferir que seres humanos e chimpanzs
tiveram um ancestral comum 6 ou 7 milhes de anos atrs, e que seres humanos e o esguio
verme marinho chamado anfioxo tiveram um ancestral comum por volta de 500 milhes de anos
atrs, no podemos us-lo confiavelmente para datar Luca. Os ramos da rvore tornam-se
emaranhados e misturados antes da emergncia da vida complexa, e impossvel pesquisar os
padres cambiantes de DNA medida que uma espcie evolui. Somos deixados, portanto, com
muito poucas evidncias genticas do que Luca realmente era.

A criao de Luca

Apesar disso, podemos inferir algumas coisas sobre Luca. Clculos e lgica predizem que o
ltimo ancestral comum universal tinha caractersticas que so compartilhadas por arqueias e
bactrias, e isso significa que seus genes, protenas e mecnica celular eram muito similares ao
que vemos hoje. Graas a isso, podemos usar comparaes entre essas molculas para
compreender algumas coisas sobre Luca, mesmo que no possamos aplicar uma data precisa.
Um estudo feito por Douglas Theobald na Brandeis University, Massachusetts, em 2010, aplicou
anlise estatstica rigorosa aos domnios de bactrias, arqueias e vida complexa. Ele examinou
cuidadosamente a construo de 23 protenas que esto presentes em todos esses trs domnios
com provenincia aparentemente comum, como palavras que tm sons parecidos e significam
coisas similares em lnguas diferentes. Baseado nas similaridades da sequncia dos aminocidos
que compem essas protenas, Theobald calculou que a probabilidade de que tivessem surgido de
maneira independente era uma em 10^2.860 (isto , 1 seguido por 2.860 zeros).14
Outra pista para a origem singular de Luca diz respeito mais fundamental mquina celular
o ribossomo. Ele existe numa clula como uma usina de processamento organizada em
minsculos blocos de molculas. Seu papel universal, e como tal refora mais uma vez a ideia
da origem nica. O ribossomo l o cdigo gentico e o traduz em protena. As complexidades
dessa primorosa mquina sero exploradas adiante (em particular no Posfcio outra parte,
p.101), mas, em essncia, sua funo ler o cdigo gentico (j transcrito numa verso RNA) e
traduzir cada seo de trs letras em um aminocido. O ribossomo encadeia os aminocidos de
acordo com o RNA mensageiro, e uma protena expelida como uma fita de teletipo.
Consideramos o ribossomo um til indicador de parentesco porque ele fundamental sem
sua fbrica no temos nenhuma protena, e nada da vida que conhecemos pode existir. possvel
determinar que as mitocndrias em clulas complexas so derivadas de bactrias anexas porque
as mitocndrias tm seus prprios ribossomos, separados dos da clula hospedeira, e esses
ribossomos se parecem muito mais com os bacterianos do que com os animais. Podemos
comparar as sequncias de genes que codificam partes do ribossomo em todas as espcies e
rastrear a origem das mudanas ocorridas ao longo do tempo para prever que aparncia tinha o
ribossomo de Luca.
Esse um esforo frutfero, mas os resultados so contestados. Por exemplo, examinando a
sequncia especfica de partes do ribossomo de muitas espcies, possvel inferir razoavelmente
a temperatura em que esse organismo hospedeiro prospera. Vrias partes do ribossomo so
construdas com molculas de RNA ordenadamente dobradas, feitas elas prprias de letras de
cdigo gentico A, C, G e U. Como na dupla-hlice do DNA, C emparelha-se com G e A com U.
Mas C e G formam uma ligao mais estvel em temperaturas elevadas. Assim, podemos inferir
da quantidade relativa de ligaes CG em ribossomos uma preferncia por condies mais
quentes. Isso se confirma atravs de muitas espcies, e os ribossomos em que vemos o maior
contedo de CG so de extremfilos de temperaturas elevadas em outras palavras, organismos
que prosperam no calor. Onde encontramos tais criaturas? Em muitos lugares, mas seu hbitat
mais impressionante em torno de fontes hidrotermais submarinas. Ali, aquecidos por uma
fenda na superfcie da Terra, ascendem fumarolas de substncias qumicas nocivas que podem
ferver a gua do mar. Mas a vida ainda abunda. Dezenas de espcies prosperam nesse ambiente:
bactrias, arqueias e at criaturas grandes e complexas como o verme-de-pompeia, capaz de
suportar temperaturas de at 80 (em especial porque usa um casaco isolante de bactrias
resistentes).
Alguns modelos dos ribossomos de Luca sugerem que a quantidade de Cs e Gs era
desproporcionalmente elevada em suas partes componentes. Isso pode sugerir um lar quente
para a base da vida. Decerto a descoberta de arqueias e bactrias amantes de calor extremo, ou
hipertermoflicas, em ambientes como as fontes quentes em Yellowstone Park, ou em fontes
termais submarinas, refora essa ideia, pois a maior parte desses organismos ocupa espaos na
base de rvores evolucionrias, tanto quanto podemos reconstru-las.
Mas a simples verdade que no sabemos, e talvez no possamos saber. Reconstruir o
passado usando filogentica uma arte complicada, com muitos fatores desconcertantes. Usando
a sequncia sempre cambiante de DNA, no podemos ver o que ocorreu at Luca, por causa da
capacidade das bactrias e arqueias de deslocar genes para os lados, e no apenas de clula-me
para filha. Isso no quer dizer que Luca no tenha caractersticas especficas que podemos
investigar e comparar com as das coisas vivas. Ocorre apenas que a ideia de uma nica clula,
um equivalente biolgico do Ado do Gnesis bblico, talvez seja ingnua. Se Luca foi uma
clula, mesmo em sua forma mais bsica, ainda teria dentro de si sistemas semelhantes aos de
suas homlogas modernas: DNA, RNA, protenas, ribossomos para fazer protenas, uma
membrana celular e, decididamente, uma maneira muito desenvolvida de captar energia um
metabolismo; caso contrrio, esperaramos ver mecanismos diferentes e divergentes em
bactrias e arqueias. No queremos com isso denegrir essa til espcie. A utilidade real de Luca
para a cincia como a de um procurador: se Luca est na raiz da vida celular, ele representa
uma coagulao dominante do que veio antes. Segundo Bill Martin, brilhante e pugnaz
bioqumico da origem da vida que iremos conhecer adiante, o problema de Luca que, como o
amor, ele significa diferentes coisas para diferentes pessoas.
Faz quase trs sculos e meio que as clulas foram sangradas, ejaculadas e pescadas de seu
ambiente natural e vistas sob um microscpio primitivo. Desde ento, ns as desmembramos a
tal ponto que adquirimos um domnio quase completo sobre suas propriedades, adquiridas ao
longo de 4 bilhes de anos. Vemos seus atributos comuns to claramente, uma bela nitidez, em
que tudo que descobrimos em biologia serve para refinar e reforar a verdade da evoluo. Esse
um estado de coisas maravilhoso e reflete a maturao de uma cincia. As qualidades
essenciais da vida so conhecidas e se condensam numa viso grandiosa: a vida compartilha suas
ferramentas, seus processos e sua linguagem. A segurana de uma robusta teoria unificadora da
vida tal como a conhecemos nos permite formular um enigma muito mais difcil: de onde veio
Luca? De fato, a melhor maneira de comear a compreender a emergncia da vida na Terra
examinar com ateno onde e quando isso aconteceu. Devemos iniciar, portanto, bem no
princpio. Ele um timo lugar para se comear.
3. Inferno sobre a Terra

Longo e rduo o caminho que do inferno leva at a luz.


JOHN MILTON, Paraso perdido

SE VOC QUISER traar um quadro da Terra em que a vida emergiu pela primeira vez, pense
nos nomes que lhe demos. Quatro ons geolgicos abarcam a existncia de 4.540 milhes de
anos da Terra. Os trs nomes mais recentes, referindo-se a estgios da vida, refletem a
propenso do nosso planeta para coisas vivas. O segundo chamado Arqueano, o que se traduz
um tanto confusamente por origens. O terceiro o Proterozoico, que se traduz
aproximadamente, do grego, como vida anterior; e o atual, o Fanerozoico, iniciado cerca de
542 milhes de anos atrs, significando vida visvel.
Mas o primeiro, o perodo que se estendeu da formao da Terra at 3,8 bilhes de anos atrs,
chamado Hadeano, palavra derivada de Hades, a antiga verso grega do inferno.
A vida no habita este planeta apenas, ela o moldou e parte dele. No s na era atual de
mudana climtica produzida pelo homem, mas ao longo de toda a histria da Terra, ela afetou
as rochas sob nossos ps e o cu acima de ns. Em primeiro lugar, a origem da vida
absolutamente inseparvel da fria da formao da Terra. Uma imagem da Terra hadeana
fundamental para se compreender o turbulento laboratrio natural em que a vida consegue
nascer. Assim como a formao do mundo que habitamos um evento no espao, veremos
como a emergncia de vida aqui essencialmente um evento csmico.
Todo o estudo da geologia primitiva uma cincia extremamente difcil, e as evidncias so
muitas vezes escassas. preciso fazer um trabalho de detetive geolgico, com pistas salpicadas
por todo o planeta e fora dele tambm. A geologia nos d indicaes sobre como a Terra se
formou a partir dos fragmentos de matria que flutuavam no espao em volta do Sol. Mas ela
tambm comea a descrever o mundo que evolver no hospedeiro dos nicos seres vivos de que
temos conhecimento. Embora nossas vidas se baseiem na estabilidade da Terra, temos tambm
aguda conscincia de que, vez por outra, nosso planeta d mostras de violenta atividade. A
superfcie slida (inclusive o leito do mar) composta de sete ou oito imensas placas continentais
e uma coleo de outras menores. Todas elas flutuam sobre a rocha do manto, que flui
lentamente, mas slida, a qual por sua vez encerra o ncleo fundido. As placas que formam a
crosta esto em fluxo constante, sacudindo-se juntas, sem pressa. Algumas, como as placas do
Pacfico e a norte-americana, raspam-se umas contra as outras, empurrando terra nova para
cima, centmetro por centmetro. O subcontinente que hoje a ndia foi outrora uma ilha que se
esmagou contra a sia continental num processo que comeou cerca de 70 milhes de anos
atrs, empurrando a terra, aos centmetros, e enrugando-a na forma das montanhas do Himalaia.
Essas montanhas continuaro a crescer taxa de alguns milmetros por ano medida que a placa
indo-australiana continuar pressionando a sia continental. Outras placas esto esgarando a
Terra em suas fendas. A expanso colonial dos Estados Unidos prossegue rumo ao oeste dia a dia,
pois a costa do Hava ganha terra nova taxa de alguns metros por ano medida que rocha
fundida gorgoleja acima do nvel do mar e se solidifica. Terremotos sacodem a terra e o leito do
mar, deslocando imensos blocos de gua que se tornam tsunamis como aqueles que destroaram
a costa leste do Japo em 2011. Hoje esses eventos so anomalias, embora eles nos faam
lembrar que nosso planeta vive no apenas com vida celular, mas tambm com rochas que
fluem lentamente. Em sua maior parte, porm, nossa Terra tranquilizadoramente estvel.
Mas no foi assim no passado. O nascimento de nosso planeta um processo de criao de
ordem a partir do caos do sistema solar primitivo. O resultado violncia. O Sol, a estrela no
centro de nosso sistema planetrio, formou-se h cerca de 4,6 bilhes de anos como uma colossal
nuvem de molculas flutuantes que desabou sob a fora de sua prpria gravidade e se condensou
no enorme reator de fuso nuclear que continua a aquecer a Terra at hoje. Como consequncia
imediata, o Sol ficou no centro de uma nbula solar, um disco chato de detritos que haviam
sobrado desde sua formao, mas eram mantidos ali pela gravidade. No correr dos primeiros
milhes de anos seguintes, essa matria, em sua maior parte poeira e gs, comeou a se agregar.
A princpio eles tinham o tamanho de auditrios de dimenses medianas, mas ao longo de
centenas de sculos os pedaos colidiram e se uniram num processo chamado acreo. Mais
perto do Sol, a temperatura mais elevada, o que dificulta a condensao e a acreo de gases.
Por essa razo, os quatro planetas interiores do sistema solar Mercrio, Vnus, Terra e Marte
so terrestres, feitos de rocha, ao passo que os quatro exteriores Jpiter, Saturno, Urano e
Netuno so gasosos (ou congelados).1
impossvel descrever todo um planeta em termos simples, pois sabemos muito bem como
este que habitamos no uma massa unificada de terra. Boa parte da superfcie da Terra
moderna slida, porm a maior parcela oceano. Nas partes de terra, h extremos de
temperatura e geografia, neve, desertos, pntano, florestas, plancies, montanhas etc. A rocha sob
seus ps provavelmente muito diferente daquela sob os ps de um leitor do outro lado do
planeta. De maneira semelhante, quase impossvel descrever em termos simples que aspecto
tinha a Terra no Hadeano. As evidncias so de tal modo evanescentes e esparsas que esse
perodo chamado, de uma maneira que pouco nos ajuda, de Era Crptica. Mas podemos extrair
da modelos significativos em termos amplos. Sabemos que imediatamente aps a acreo, o
planeta devia estar derretido em grande parte. Mas, ao contrrio do que se pensava, agora
achamos que esse perodo de Terra derretida foi breve. Como no h rochas sobreviventes desse
tempo, havamos suposto no passado que nele no havia rochas. Mas ausncia de evidncias no
a mesma coisa que evidncia de ausncia.
Assim como examinamos rochas em busca de vestgios de vida recente as formas
fossilizadas de dinossauros, ou mesmo clulas, por exemplo , a histria de nosso planeta antes da
vida est engastada na geologia. A matria com datao mais antiga na Terra no provm de
rochas, mas apresenta-se na forma de cristais de zircnio, mineral abundante encontrado no
mundo todo, provavelmente mais conhecido como substituto barato dos diamantes na joalheria.
Os zircnios tm duas caractersticas convenientes. A primeira a capacidade de suportar
metamorfose o brutal estremecimento de rochas durante longos perodos de tempo. A segunda
que seus tomos esto naturalmente arranjados numa ntida estrutura cbica. Essa caixa
molecular pode prender tomos de urnio dentro de si, em nmeros to pequenos quanto dez
partes por milho. Uma pequena proporo do urnio, como muitos elementos, radioativa, e ao
longo do tempo se decompor em chumbo. Graas natureza precisa da estrutura de seu cristal,
quando zircnios se formam eles podem incluir urnio, mas excluir tomos de chumbo. Depois
de aprisionado nessa gaiola radioativa, o urnio sofre mutao para chumbo, no curso de milhes
de anos, e como essa decomposio ocorre numa taxa fixa (o que chamamos de uma meia-
vida), no momento em que um cristal de zircnio se forma, ele ajusta a hora de um relgio no
zero. O chumbo encontrado dentro de zircnios deve ter comeado sua vida como urnio
aprisionado; e assim, por meio de sua quantificao, podemos datar a origem desse cristal com
99% de preciso. Em Jack Hills, no oeste da Austrlia, foram encontrados cristais de zircnio que
haviam aprisionado seu urnio 4,44 bilhes de anos atrs.
A datao no a nica coisa que distinguimos a partir desses constituintes de joalheria
barata. Tambm possvel inferir, a partir desses mesmos cristais, que sua formao foi parte de
um processo de solidificao, o desenvolvimento de uma crosta. Isso significa que, embora no
haja rochas oriundas do Hadeano, podemos saber que havia terra naquele perodo. Podemos
tambm determinar quais eram os outros ingredientes presentes. Os zircnios de Jack Hill
tambm abrigam um tipo particular de oxignio radioativo cuja presena parece aquela
encontrada em cristais modernos, formados quando a crosta da Terra era sugada para baixo, sob
o leito do oceano. A presena desse oxignio sugere que, a partir de apenas 100 milhes de anos
aps a moldagem inicial da Terra, a gua estava presente. Na Terra, no h vida sem gua,
embora provavelmente essa gua fosse muito cida.2
Assim, nos primeiros dias crpticos na Terra, pode no ter havido o completo inferno diablico
de mares interminveis de lava derretida. Passados meros 100 milhes de anos, a Terra tinha
uma superfcie slida e oceanos. Isso soa bastante agradvel, mas no pintemos um retrato to
pitoresco. As teorias anteriores de uma Terra hadeana derretida baseavam-se numa robusta
observao: no podemos encontrar nenhuma rocha dessa era. Se havia uma superfcie slida,
que diabo aconteceu com ela? Ocorre que estvamos procurando no lugar errado. De fato,
olhvamos o corpo celeste completamente errado. Para considerar a questo do que aconteceu
nos primrdios da Terra, enviamos doze homens Lua. A prpria Lua nasceu do mais destrutivo
impacto j sofrido pela Terra. Em algum momento, entre 50 e 100 milhes de anos aps a
formao do sistema solar, a Terra teve seu pior dia. Ela foi atingida por Teia um belo nome
terrivelmente inapropriado para tal prenncio de destruio. Teorias atuais sugerem que Teia era
uma rocha do tamanho de Marte. Ela arremessou no espao matria suficiente da Terra
embrionria para que os destroos voltassem a se aglutinar na forma do nosso vizinho celeste
mais prximo, a Lua. O impacto foi devastador, o suficiente para desprender do planeta sua
primeira atmosfera. O golpe de vis desferido por Teia pode ter sido o que deslocou o eixo da
Terra da vertical para sua posio inclinada de 23,5. Essa inclinao ocasiona as estaes, pois a
distncia que separa a Terra do Sol varia segundo a inclinao axial do planeta.
Mas nos interessa o que ocorreu aps a formao da Lua. Foi o caracterstico aspecto
pustulento da Lua que nos deu indcios do estado da Terra hadeana. Entre 1969 e 1972, o
programa Apollo da Nasa desembarcou seis misses e doze exploradores na Lua, a comear
com o famoso primeiro pequeno passo de Neil Armstrong. Durante essas misses, astronautas
colheram cerca de meia tonelada de rochas e as trouxeram de volta para serem analisadas.
Consta que o ltimo homem a andar na Lua, o comandante Gene Cernan, na Apollo 17, teria dito:
Fomos explorar a Lua, e o que de fato descobrimos foi a Terra. H uma grande verdade nessas
palavras, pois foi na anlise subsequente de rochas da Lua que descobrimos a natureza dos anos
formativos da Terra. Ao contrrio da Terra, a Lua no tem nenhuma atmosfera ou ventos, e
nenhuma geologia cambiante, por isso as crateras formadas por impactos de meteoritos ficam
inalteradas, juntamente com as pegadas dos pioneiros da Apollo. Isso significa que temos um
registro da atividade de meteoritos no sistema solar local, pegadas deixadas inclumes pelos
ventos, mares e atritos tectnicos da Terra.
Gelogos lunares dataram rochas que apresentavam as marcas caractersticas de choques de
meteoros. Elas so chamadas rochas derretidas por impacto, e eles descobriram que elas
ocorreram todas numa janela de tempo precisa, entre 4,1 e 3,8 bilhes de anos atrs. Podemos
deduzir que esse foi um perodo de intensa atividade meterica local e, por inferncia, que a
Terra tambm sofreu essa diablica pancadaria vinda do alto. O jovem sistema solar estava
repleto de escombros e restos de seu nascimento, e durante um perodo de 300 milhes de anos,
at o fim do Hadeano, recebemos o pleno impacto disso. Esse perodo chamado de
bombardeio pesado tardio; tardio porque foi, felizmente, a ltima vez que a Terra sofreu
semelhante espancamento.
Quo pesado pesado? Meteoros caem do cu o tempo todo. Quase todos, graas a Deus, so
pequeninos e queimam-se, para desaparecer em seguida na atmosfera como estrelas cadentes.
Ocasionalmente, um grande nos atinge e depois se transforma em meteoritos, como um que caiu
na cidadezinha australiana de Murchison, em setembro de 1969, apenas algumas semanas depois
que a Apollo 11 trouxe Armstrong, Buzz Aldrin e o piloto do mdulo de comando Michael Collins
de volta para a Terra. Esse meteorito pesava mais de cem quilos e, como veremos, carregava
uma carga til de interesse para essa histria.
Se voc propenso a formular um desejo quando v uma estrela cadente, talvez possa
desejar que no tenhamos de presenciar nada que se aproxime em tamanho do meteorito mais
conhecido. H 65 milhes de anos, uma rocha de 8 a 9,5 quilmetros de largura chocou-se contra
uma rea do que hoje chamamos Chicxulub, no Mxico. Atualmente, a maior parte da cratera
est escondida sob o mar, mas sua sombra de quase 180 quilmetros de largura subsiste, e foi
reconhecida por prospectores de petrleo nos anos 1970. No solo e no leito do mar, h um crculo
ectpico quebrado, mas detectvel, de minsculas contas de vidro forjadas a partir de rocha
derretida sob o calor do impacto. E do espao podemos ver o mesmo crculo em minsculas
distores gravitacionais s mensurveis a partir de equipamentos de preciso em rbita de
satlite. Desde ento, no houve em lugar algum um impacto com magnitude prxima a essa, e
fique grato por isso. O meteorito de Chicxulub foi a causa imediata da extino do reinado dos
dinossauros e abriu caminho para que pequenos mamferos evolussem e chegassem a ns. Um
impacto dessa ordem significa que muito provvel que o meteorito tenha extirpado, num
instante, muitos milhes de criaturas, com uma circunferncia em expanso de megatsunamis
com mais de 1,5 quilmetro de altura avanando velozmente a partir do local do impacto,
nivelando a terra como uma onda que quebra numa praia. Com isso, teria havido tambm uma
bola de fogo quente o bastante para derreter areia e rocha naquelas reveladoras contas de vidro.
Mas o pleno impacto do meteorito teria perdurado por milhares de anos, uma nuvem de poeira
arremessada para cima que obliterou o Sol. O impacto do Chicxulub mudou irreversivelmente o
sistema terrestre, eliminando formas de vida antes dominantes. No entanto, comparado ao que
havia acontecido no planeta recm-nascido, o lugar onde a vida comeou, Chicxulub foi uma
gota no oceano.
Cientistas estimaram que, durante o bombardeio pesado tardio, cerca de quinze rochas
astronmicas com mais de 160 quilmetros de largura, vinte vezes o tamanho de Chicxulub,
machucaram nosso mundo. Dessas, meia dzia talvez tivesse algo em torno de 320 quilmetros
de largura. Durante 300 milhes de anos, rochas gigantes choveram do cu, algumas to grandes
quanto ilhas de bom tamanho. O p levantado por qualquer um das dezenas de milhares de
impactos sofridos pela Terra durante esse perodo teria feito a mais destrutiva bomba nuclear
parecer um estalinho. Uma destruio ambiental global deve ter ocorrido pelo menos a intervalos
de alguns sculos. Qualquer superfcie que fosse um hbitat potencial para organismos vivos deve
ter sido destruda muitas e muitas vezes. O implacvel espancamento que o planeta sofreu
durante o bombardeio pesado tardio foi suficiente para ferver os oceanos e vaporizar a terra.
Depois, tudo se acalmou de maneira significativa. A blitz meteortica do Hadeano terminou h
cerca de 3,8 bilhes de anos, deixando uma Terra exausta, ainda tempestuosa e encapelada, mas
pelo menos no bombardeada a partir do cu. O Sol estava mais plido que hoje, provavelmente
com menos de de sua fora atual. Com isso, a Terra esfriou rapidamente, e a gua de vulces
e cometas condensou-se nos oceanos que cobriram a superfcie.
O ponto preciso em que a vida comeou desconhecido, e quase certamente sempre o ser.
possvel que ela tenha comeado mltiplas vezes, talvez durante o Hadeano, tendo sido
repetidamente destruda, exceto uma vez, pela rajada esterilizante do bombardeio pesado tardio.
Um modelo de computador construdo em 2009 no Colorado sugere que, mesmo que o on
Hadeano tenha esterilizado a superfcie da Terra, a vida poderia perdurar no fundo do oceano.
O consenso geral (embora no inconteste) que as primeiras evidncias de matria viva
datam de cerca de 3,8 bilhes de anos atrs, coincidindo com o fim do bombardeio pesado tardio.
Esses indcios apresentam-se na forma daquele tomo vitalmente importante, o carbono. No
possvel ver clulas nos registros fsseis dessa idade, pois rochas com mais de 3,5 bilhes de anos
devem ter sofrido a severa metamorfose geolgica que chacoalha irrecuperavelmente qualquer
sombra de estruturas vivas. Temos de procurar, portanto, as marcas qumicas caractersticas da
vida aprisionadas em rochas. Numa formao na costa oeste da Groenlndia foram encontradas
rochas que contm o mais tnue trao de uma forma de carbono radioativo que no tem
nenhuma razo concebvel para estar ali, a menos que tenha sido processada por um organismo
vivo.
No sabemos que forma de vida foi essa. A presena desse carbono s nos permite inferir
que um organismo dotado de mecanismos fundamentais similares aos da vida moderna existiu h
todo esse tempo. D um salto de 400 milhes de anos para a frente, e os vestgios de vida tornam-
se abundantes e muito menos controversos.3 Os melhores deles apresentam-se na forma de
estromatlitos: cogumelos de pedra de trinta centmetros de largura que brotam dos mares rasos
na Austrlia e em outros lugares do mundo. Eles se formam quando esteiras flutuantes de
bactrias energizadas pelo Sol aprisionam minsculas partculas de areia em seu muco viscoso;
depois, ao longo de milnios, essa espuma flutuante acomoda-se em torres superpostos de
pedra.

Ingredientes

Mas isso ocorreu centenas de milhes de anos de evoluo aps o fim do bombardeio pesado
tardio. O que vemos a partir de ento so peas escassas corroborando a existncia de coisas
vivas num colossal quebra-cabea. Temos uma imagem da Terra, mais acomodada do que havia
sido por centenas de milhes de anos, mas ainda violenta, sujeita a tempestades eltricas, com
massas de terra agitando-se, vulces expelindo gases na atmosfera e mares turbulentos. Essa
uma compreenso contempornea da Terra primitiva, e ela nos ajudou a formular experimentos
e hipteses para as condies em que a vida emergiu. No entanto, as primeiras especulaes
sobre a emergncia da vida foram formuladas um sculo antes disso.
Em 1871, Darwin escreveu uma carta a seu amigo Joseph Hooker falando da mudana da
qumica inanimada para a vida. Na segunda pgina desse documento quase ilegvel4 ele
considera no a origem das espcies, mas a origem da vida:

Costuma-se dizer que todas as condies para a primeira produo de um organismo vivo que
algum dia estiveram presentes ainda esto aqui agora. Mas se (e, , que grande se)
pudssemos conceber numa lagoazinha morna com toda sorte de sais de amonaco e
fosfricos, luz, calor, eletricidade etc. presentes, que um composto proteico estivesse
quimicamente formado, pronto para sofrer mudanas mais complexas, hoje tal matria seria
instantaneamente devorada, ou absorvida, o que no teria sido o caso antes que criaturas vivas
se formassem.

Com essa famosa lagoazinha morna Darwin est prefigurando o conceito de sopa
primordial (primeva, significando original ou do tempo mais antigo, e pr-bitico,
significando antes da vida, so tambm usados, em grande parte de maneira intercambivel).
Ali, ele arrola os ingredientes da sopa, exatamente como numa receita. Embora ignorando nosso
quadro moderno da Terra arqueana, Darwin havia chegado por acaso ao que se tornaria a ideia
dominante da origem da vida. Ele no foi o nico a dar esses passos especulativos de beb. Um
de seus grandes defensores foi o zologo e polmata alemo Ernst Haeckel, um dos primeiros a
propor a ideia de que biologia e qumica eram continuidades num mesmo espectro. Em 1892 ele
props um processo em que ocorria a origem de um indivduo orgnico da mxima
simplicidade num fluido formativo inorgnico, isto , num fluido que contm as substncias
fundamentais para a composio do organismo dissolvidas em combinaes simples e frouxas.
Qumicos j se dedicavam alquimia biolgica, no procurando obter ouro a partir de vil
metal, mas fazendo molculas da biologia aparecer a partir da qumica. Em 1828, um cientista
alemo, Friedrich Woehlerr, sintetizou ureia, uma molcula biolgica essencial e um componente
da urina, observando em seus mtodos que o fizera sem o uso de rins, seja de homem ou co.
Isso contradizia o conceito ento muito difundido de vitalismo, segundo o qual a vida era de
algum modo fundamentalmente diferente da no vida. Woehlerr havia mostrado que molculas
da vida podiam ser feitas sinteticamente.
Essa ideia de que o nascedouro da primeira vida foi uma rica lagoa de ingredientes
formalizou-se nos anos 1920, quando um russo, Aleksander Oparin, e um britnico, J.B.S.
Haldane, escreveram, de modo independente, sobre a emergncia de molculas biolgicas
complexas e da vida em condies alimentadas por uma atmosfera esvaziada de oxignio, na
Terra primitiva. Haldane cientista verdadeiramente grande, que se tornaria depois figura
central na emergncia da biologia evolucionista no sculo XX e talentoso divulgador da cincia
um personagem importante nessa jornada cientfica, pois foi o primeiro a usar a expresso
sopa pr-bitica, e a ideia de sopa como o caldo da vida passou a fervilhar desde ento.
A sopa teve seu momento alto em 1953, ano em que se produziu cincia da melhor qualidade.
Crick e Watson revelaram a estrutura do DNA em abril, sem dvida a maior faanha cientfica
do sculo XX. Exatamente ao mesmo tempo, porm, um jovem estudante baseava-se nas ideias
de Haldane e Oparin para montar outro experimento, igualmente icnico. Stanley Miller,
estudante de qumica, de 22 anos, na Universidade de Chicago, implorou a seu orientador, o
ganhador do Prmio Nobel Harold Urey, que, como parte de seu doutorado, o deixasse montar
um experimento meio extravagante. Ele construiu um conjunto de tubos de vidro interconectados
sobre uma grade de metal eletrificada de dois metros quadrados. Esse kit encontra-se agora
numa sala tenuemente iluminada, nos laboratrios de um dos alunos de Miller, Jeffrey Bada,
hoje professor emrito no Scripps Institution of Oceanography em San Diego. Ele lembra, de
maneira no inapropriada, um experimento de fico cientfica dos anos 1950, com fascas,
gases borbulhantes e lquidos coloridos. Miller encheu os bqueres de vidro com gua, metano,
hidrognio e amonaco, numa tentativa de emular o que, segundo se acreditava na poca, eram
os ingredientes essenciais da Terra primitiva. Desenvolvendo as ideias tanto de Oparin quanto de
Haldane, ele raciocinou que a ausncia de oxignio na atmosfera era decisiva para o turbilho
qumico necessrio para provocar a emergncia de molculas biolgicas essenciais. Miller ps
milhares de volts equivalentes a uma fasca nessa montagem de tubos, simulando as tempestades
eltricas e os raios que desabavam do turbulento cu arqueano.
Harold Urey deixou o aluno levar esse experimento adiante, de bom grado, sob a condio de
que ele o encerrasse e passasse a se dedicar a alguma pesquisa menos implausvel se aquela no
produzisse resultados dentro de alguns meses. No foi preciso esperar todo esse tempo. Dentro de
dias, a mistura havia se tornado primeiro cor-de-rosa, depois cor de caf. Miller extraiu a rica
fermentao e, ao analis-la, encontrou o aminocido glicina e um punhado de outros
aminocidos biolgicos essenciais para a formao de protenas. Ele publicou seus resultados na
revista Science, observando nos mtodos que as condies haviam sido planejadas para emular a
Terra primitiva, no para otimizar a produo de aminocidos. Apenas para consolidar esse
extraordinrio resultado, aqui est um doce desfecho para o experimento. Em 2008, um ano
depois da morte de Miller, Jeffrey Bada redescobriu algumas das amostras originais que ele
havia usado enfiadas numa gaveta empoeirada. Submeteu-as em seguida a anlises do sculo
XXI. Mesmo nessas amostras de cinquenta anos de idade, uma inspeo precisa revelou no
apenas os poucos aminocidos que Miller vira, mas todos os vinte aminocidos biolgicos, e de
fato mais outros cinco. Parece que, sob aquelas condies, a produo espontnea de
ingredientes biolgicos essenciais era uma eventualidade fcil. Aquelas unidades simples, poder-
se-ia pensar, se combinariam em protenas de que toda vida depende, e, com sua funo, os
processos da vida comeariam. Miller havia mostrado que, no tumulto da Terra arqueana, as
molculas que formam os operrios universais dos sistemas vivos protenas ganhavam vida
graas ao simples equivalente de um raio.
O experimento era to interessante que Miller se tornou uma celebridade internacional. A
imprensa ficou boquiaberta e alvoroada, e exagerou os resultados em seus relatos a tal ponto
que alguns noticiaram que Miller havia criado vida. Claro que os aminocidos no so vida,
embora sejam essenciais para ela, e sua criao era uma grande novidade. Esse experimento foi
visto como um selo de aprovao para a ideia da sopa primordial, cimentando seu lugar como
parte de nossa cultura, e a ideia mais tenaz sobre a origem da vida. Em algum lugar da Terra,
uma superfcie molhada, ou poa, ou pedra-pomes flutuante, foi exposta aos gases da atmosfera
arqueana e a um raio. Isso d a impresso de um drama, uma centelha de vida injetada num
cadver, animado por um influxo vindo do cu, o momento da criao.
Mas poderia ter sido assim? Como vimos em captulos anteriores, a mecnica da vida
fascinantemente complexa. Uma clula uma colmeia de atividade densamente comprimida,
recebendo input de seu ambiente (quer este seja parte de um organismo ou uma nica clula de
vida independente). Dentro da clula, h um cdigo que criptografa protenas, e essas protenas
desempenham as funes da vida: alimentao, comunicao com outras clulas e reproduo
do organismo para perpetuar os genes que ele carrega. Ver a emergncia espontnea num tubo
de ensaio das molculas (ou componentes dessas molculas) que desempenham esses atos vitais
empresta credibilidade ideia de que a origem da vida no nem mstica nem sobrenatural. No
incio do Arqueano, ingredientes qumicos simples de fato fizeram a transio da qumica para a
biologia, e o experimento icnico de Miller segue na linhagem cientfica direta da lagoazinha
morna de Darwin. Naquela encantadora especulao, a receita inclua sais de amonaco e
fosfricos, luz, calor, eletricidade etc., todos componentes plausveis, pois se relacionam a
alguns dos processos de uma clula tpica. O experimento de Miller ps essa ideia prova,
baseando os ingredientes numa melhor compreenso das condies da Terra em seus primrdios
amonaco, metano, hidrognio, gua e raios. Nos sessenta anos transcorridos desde ento,
muitos experimentos refinaram a receita, ou mostraram construo espontnea similar e mais
sofisticada de molculas biolgicas a partir de uma sopa de ingredientes. uma ideia atraente, e
que emplacou. Mas sob esses experimentos h algumas questes pendentes fundamentais. Pode a
vida emergir do cozimento de uma sopa qumica? Uma centelha o elemento necessrio para
conduzir de uma reao qumica a uma biolgica? Para responder a essas questes, e chegar ao
fundo da origem da vida, devemos formular uma questo muito simples, que tem uma resposta
profundamente obscura.
4. O que vida?

No farei hoje mais nenhuma tentativa de definir os tipos de material que


me parecem estar abrangidos nessa taquigrfica descrio, e possvel que
nunca consiga faz-lo de maneira inteligvel. Mas eu a conheo quando a
vejo.
JUIZ POTTER STEWART, 1964

O QUE VIDA? Uma definio de vida poderia parecer o mais fundamental alicerce sobre o
qual um campo to extensivo quanto a biologia se ergue. Mas e talvez voc fique alarmado ao
descobrir no h nenhuma definio padronizada. Na escola, ensinaram-nos variaes numa
lista de verificao para identificar as caractersticas das coisas vivas:
Movimento.
Respirao.
Sensibilidade.
Crescimento.
Reproduo.
Excreo.
Nutrio.
Escolas do Reino Unido por vezes resumem isso como o acrnimo formado pelas iniciais
dessas palavras em ingls: MRS GREN. Como uma lista de verificao, ela funciona
perfeitamente bem para todas as coisas vivas que vemos nossa volta. provvel que voc
esteja checando pelo menos cinco dessas coisas agora mesmo.1
Os critrios acima abarcam todas as facetas da vida e so, por natureza, bioqumicos a
biologia tal como encenada pela qumica. O movimento, por exemplo, pode assumir muitas
formas nas coisas vivas. Voc passa os olhos por estas palavras quando uma rede de protenas
especializadas se contrai dentro das fibras musculares ligadas a seus globos oculares, mudando e
empurrando o foco atravs da frase. Esse um movimento de tipo muito diferente da curvatura
diria de um girassol quando ele pende em direo sua fonte de energia luminosa. Isso
controlado por uma espcie de articulao inflvel na base da inflorescncia, cujas clulas
incham com gua no lado oposto ao da luz mais intensa e curvam o talo em direo ao Sol
medida que ele cruza o cu. Esse movimento, por sua vez, diferente daquele exibido por certas
bactrias capazes de autopropulso, que vm equipadas com um rotor lindamente evolvido, o
flagelo, que gira at 1.000rpm e pode deslocar uma clula a 110 de milmetro por segundo.
Sabemos muito bem que a vida feita de clulas, e no h nenhuma forma de vida que no
se constitua delas. Mas no isso que a define, da mesma maneira que uma casa no definida
pelos tijolos. Sabemos que toda vida opera por meio da reproduo de um cdigo universal que
podemos traduzir e ler, mas no seramos capazes de compreender uma partida de crquete
lendo o manual de regras. O ponto em que a Terra mudou seu status de vitalmente inanimada
para abriga coisas vivas no aconteceu quando um item foi ticado numa lista de verificao.
Certamente no h nada de errado naquele inventrio vital. Todos aqueles exemplos na lista so
por definio bioqumicos: a maneira como as protenas so formadas em filamentos e dobradas
em emaranhados tridimensionais para conferir s clulas habilidades especficas; a maneira
como o DNA pode codificar e reproduzir informao; a forma como as clulas animais podem
inalar oxignio, extrair energia e exalar dixido de carbono; o modo como clulas vegetais
podem absorver dixido de carbono, extrair energia e exalar oxignio. E assim por diante. Todos
esses processos so qumica em ao, determinada pelo comportamento dos tomos que
compem as molculas. Qual ento a natureza da qumica que, na realidade, biologia?

Em busca de uma definio

Temos uma lista de verificao das aes da vida, mas nenhuma definio singular clara.
Sozinha, ou mesmo em multides, uma protena no est viva, no DNA nem um caminho
metablico. As protenas, pela total falta de um termo menos canhestro, so inanimadas. No
tm em si o sopro da vida, embora sejam claramente essenciais para ela. No entanto, no temos
dvida alguma de que a concatenao de todos esses eventos qumicos num organismo como
voc o que lhe permite viver, e de que o trmino desses processos qumicos resulta em morte.
Quando falamos sobre a origem da vida, tudo gira em torno da jornada da matria inanimada
para a matria viva.2
A transferncia de informao de clula para clula e de organismo para organismo por
meio de DNA bsica para a vida tal como a conhecemos. Ser ento possvel obter uma
definio de vida sustentada na capacidade de transferir informao? O interesse da Nasa pela
vida estende-se desde sua busca no espao at sua construo sinttica, aqui na Terra, como
podemos ver em O futuro da vida. A astrobiologia forma um ramo-satlite da pesquisa sobre a
origem da vida, a procura de vestgios de vida em lugares distantes. Esse novo campo uma
aglutinao de vrios ramos da cincia geoqumica, bioqumica, astrofsica para contemplar
as chances de vida no Universo. A Nasa tem trs grandes prioridades nessa rea: como a vida
comeou e evoluiu; a existncia de vida em algum outro lugar no Universo; qual o futuro da vida
na Terra e alm dela? A primeira questo a origem da vida de importncia central para o
astrobilogo, pois determinar como procuraremos vida e como a reconheceremos quando a
encontrarmos.3 Os objetivos da Nasa nessas exploraes extraterrestres levaram-na a adotar
uma definio de vida que ajudasse a especificar os parmetros das misses: em poucas
palavras, se for darwiniano, vivo. Isso se assemelha posio adotada por Jerry Joy ce,
qumico que trabalha no Scripps Research Institute, em San Diego, cujos experimentos tm
precisamente o objetivo de permitir a ocorrncia de evoluo darwiniana no primo do DNA, o
RNA. Disse-me ele:
Se h um sine qua non da vida, este a capacidade de sofrer evoluo darwiniana e ter
histria em molculas. A qumica no tem histria. Para mim, a aurora da vida a aurora da
histria biolgica escrita nas molculas genticas entalhadas atravs de processos
darwinianos.

Essa definio est inteiramente centrada em informao. DNA e RNA so cdigos,


armazenando um manual digital de instrues que pode ser indefinidamente copiado. medida
que h infidelidade nessas cpias, elas passam a ter erros, que por sua vez se tornam nova
informao, a ser transmitida, e selecionada, se for til. Isso evoluo.4 A reproduo crucial
para a vida, mas ser suficiente para ser considerada uma definio? Um cristal pode crescer e
replicar sua estrutura. Esse crescimento pode sofrer imperfeies, mas, segundo essa definio,
no vivo, porque essas imperfeies no so transmitidas. Ele no darwiniano, porque no
pode adquirir novas caractersticas por meio de seleo. O comportamento darwiniano sem
dvida um trao essencial de toda vida que vemos, mas apenas parte de um conjunto de
comportamentos universais na vida.
Jack Szostak ganhou um Prmio Nobel em 2009 por uma carreira dedicada gentica
humana. Ele ajudou a desenvolver novas tcnicas para explorarmos nosso prprio genoma e
contribuiu para a descoberta de componentes essenciais do envelhecimento. Depois, passou do
ramo humano, numa das pontas da rvore da vida, para o campo quase desvinculado da biologia
na base da rvore da vida. Em Harvard, Szostak fundou a Origin of Life Initiative. Ali, um de seus
muitos interesses a formao espontnea da membrana celular, de que, como com a vida,
trataremos no devido tempo. Szostak um homem calmo e despreocupado, de fala mansa,
paciente e reflexivo. Mas, quando o entrevistei, ficou claro que a busca de uma definio da vida
o exaspera; mais que isso, parece-lhe estorvar a pesquisa que se faz dela. De maneira nada
caracterstica, ele quase foi rude comigo quando sugeri que a ausncia de uma definio
abrangente da vida problemtica. Atalhou-me no meio da pergunta:

No me parece que isso seja um problema, em absoluto. Creio que isso completamente
irrelevante. O que queremos compreender o caminho, como passamos de substncias
qumicas realmente simples para substncias qumicas mais complicadas; de clulas
realmente simples para clulas mais complicadas, at a biologia moderna. Queremos
simplesmente compreender o processo e todos os passos. No precisamos dizer: Aqui est a
linha divisria: deste lado h qumica e deste h biologia. O importante o caminho.

J.B.S. Haldane, que antes, no sculo XX, havia ajudado a construir a ideia de sopa pr-bitica,
adotou linha semelhante em 1949, com seu livro intitulado simplesmente What Is Life?. O
Captulo 14 tem o mesmo ttulo que o prprio livro, mas comea com essa ousada ressalva,
atrevida o suficiente para que ele usasse maisculas:

NO VOU RESPONDER A ESTA QUESTO. NA VERDADE, DUVIDO que possamos lhe


dar algum dia uma resposta completa, porque sabemos como estar vivo, tal como sabemos
o que vermelhido, o que dor ou esforo. Assim, no podemos descrev-los nos termos de
nenhuma outra coisa.

Em outras palavras, eu a conheo quando a vejo.


No entanto, muitas pessoas concentram-se de fato em estabelecer uma definio. Os seres
humanos sem dvida gostam de categorizar coisas, e a cincia em particular, porque com grande
frequncia isso ajuda a compreenso. Recentemente, Edward Trifonov, bilogo da Universidade
de Haifa, em Israel, abordou o problema com ttica incomum, que consistiu em examinar as
palavras usadas nas inmeras tentativas feitas pelos cientistas para definir a vida. Jogando-as num
cadinho, ele chegou por fim a uma frase depurada: Autorreplicao com variaes. Isso se
assemelha definio da Nasa, e concentra-se na transferncia de informao de uma gerao
para outra. No duvido que a abordagem tenha sido bem-intencionada, mas difcil ver o valor
de se estabelecer uma definio de consenso com base na linguagem usada. A publicao fez a
gentileza de incluir muitas respostas de um grande nmero de cientistas que discordam entre si e
que, no caso de Szostak, resistem por completo ao desejo de limitar a vida a uma definio.
De fato, todas essas tentativas correm o risco de sofrer da sndrome do elefante do cego. O
budismo (mas tambm o isl, o jainismo, o hindusmo e outras culturas) conta a histria de vrios
cegos a quem o rei pede que lhe digam como um elefante. Cada um apalpou uma parte
diferente do animal e concluiu que um paquiderme era apenas o pedao que podiam sentir. O
sujeito que examinou a presa sugeriu que o animal parecia uma relha de arado; o que examinou
a pata o comparou a uma pilastra; o homem da cauda, a um pincel; e assim por diante. Eles
brigavam; o rei ria. Um elefante todas essas coisas, no possvel capturar sua majestade
isolando uma de suas caractersticas.
Quando o juiz Potter Stewart, da Suprema Corte dos Estados Unidos, disse eu a conheo
quando a vejo (palavras citadas na abertura deste captulo), o a a que se referia era
pornografia. O estado de Ohio havia proibido o filme Os amantes, de 1958, por obscenidade, mas
Stewart invalidou a proibio. Isso acabou se transformando numa expresso para descrever a
subjetividade mal definida, ou coisas sem parmetros claros. A vida exatamente assim. Em um
momento havia qumica na Terra e em um momento posterior havia coisas vivas. A rota do
primeiro ponto para o segundo longa, tortuosa e desordenada. O momento em que temos
indiscutivelmente coisas vivas , sem dvida, aquele em que elas se tornaram darwinianas, mas
no s (como logo veremos, h at certas molculas que exibem a propriedade darwiniana de
autorreplicao com seleo). O que importa, portanto, que a fronteira entre qumica e biologia
arbitrria.
A vida uma combinao de muitos sistemas qumicos que so mais que a soma de suas
partes. Separamos a cincia em categorias em debates como esse, e, de fato, quando a
aprendemos: biologia, qumica, geologia, fsica, e assim por diante. Essas distines tambm so
um tanto arbitrrias, pois cincia apenas uma maneira de conhecer a natureza, e ficam
particularmente borradas quando consideramos o prprio comeo de uma delas, a biologia.

A mosca energtica na sopa


Todas as aes das clulas so mediadas, em ltima anlise, pelo fluxo controlado de tomos
eletricamente carregados de um lado de uma membrana para outro. Enquanto voc l, tomos
portadores de carga fluem para milhes de clulas cerebrais nicas at que elas atinjam um
limiar. Quando isso ocorre, a clula cerebral excita-se e, em associao com milhes de outras,
forma um processo de pensamento, ou desencadeia uma lembrana ou compreenso, ou induz o
desejo de fazer uma xcara de caf. De maneira semelhante, o fluxo controlado de prtons
tomos de hidrognio carregados, ao serem privados de seu nico eltron atravs de
membranas que impele a gerao de energia de que a clula e o organismo dependem
inteiramente. Em toda vida complexa (inclusive ns) isso acontece nas centrais eltricas da
clula, as mitocndrias; em bactrias e arqueias, atravs de uma membrana dentro da clula,
logo em seguida ao invlucro mais externo. Esse tipo de caminho qumico parte do que
chamamos metabolismo, e ele de importncia central para toda vida, pois gera energia. Essa
energia alimenta todas as aes biolgicas, inclusive aquelas que facilitam a reproduo de
informao atravs de geraes, e todas as outras coisas na lista MRS GREN.
Por essa razo, ao considerar os fundamentos da qumica em sua relao com a biologia,
temos de recorrer a uma cincia mais fundamental: a fsica. A maneira como as substncias
qumicas se comportam determinada pelas leis que pertencem tradicionalmente a esse campo.
Segundo Ernest Rutherford,5 o descobridor das partculas que compem o tomo, em palavras
que ficaram famosas: A fsica a nica cincia de verdade. O resto no passa de coleo de
selos. Embora seja claramente uma zombaria provocativa, h algum valor nessa viso
reducionista, tpica de fsicos. O comportamento biolgico determinado pelo comportamento
qumico, que determinado por foras atmicas, e estas esto no domnio dos fsicos.
Haldane escreveu What Is Life? em 1949, mas ele no foi o primeiro a usar esse ttulo
enganosamente simples. Em 1944, Erwin Schrdinger produziu, com o mesmo nome, um tratado
de biologia centrado na fsica, texto clssico que reunia uma srie de palestras pblicas.6 Talvez
seja apropriado que essa anlise tenha sido produzida por um fsico, vindo atenuar ainda mais as
fronteiras artificiais entre as modernas disciplinas da cincia. A fsica, por natureza, tende para o
fundamental, e as concluses de Schrdinger derivam de uma de suas regras absolutas e mais
inegociveis: a segunda lei da termodinmica. Esse o princpio que dita com total autoridade
que, durante um perodo de tempo, a energia sempre fluir de um estado mais elevado para um
mais baixo, e nunca na outra direo. Vemos a aplicao da segunda lei por toda parte nossa
volta. Depois que a chama desligada, uma panela de sopa borbulhante s pode esfriar. Esse
princpio estende-se a todos os aspectos de nossas vidas: o calor de um radiador dissipa-se ao
aquecer nossos cmodos porque est tentando equilibrar os dois estados de energia
desequilibrados: um est mais quente que o outro. Isso nunca acontecer no sentido inverso. A
medida da segunda lei o que chamamos de entropia. Numa temperatura constante, um balo
cheio ir apenas esvaziar, a menos que seu n o vede perfeitamente, caso em que permanecer
constantemente inflado. Mas, se seu meio permanecer inalterado, ele nunca se expandir. Dentro
de sua vedao perfeita, o balo alcanou o equilbrio, e sua entropia constante. Relativamente
ao resto do mundo, porm, ele tem um estado de energia mais elevado, e por isso deseja (se
que podemos falar de desejo num balo) difundir sua energia de maneira mais justa. Essa
tendncia justa distribuio de energia representada por um aumento na entropia.
Schrdinger afirmou que sistemas vivos so a contnua manuteno de desequilbrio de
energia. Em essncia, a vida a manuteno de desequilbrio, e a energia, tal como a vida a
utiliza, provm dessa desigualdade. Isso por vezes descrito como um processo longe do
equilbrio. A entropia do Universo est fadada a sempre crescer, criando com isso uma
existncia mais equilibrada, porm menos ordenada. A temperatura em todo o Universo ser por
fim a mesma, em decorrncia da distribuio uniforme de sua energia total, como determina a
segunda lei da termodinmica.7 Schrdinger reconheceu que todos os organismos vivos escapam
ao declnio rumo ao equilbrio energtico durante sua existncia, e continuam a faz-lo em seus
descendentes. Isso vem ocorrendo na Terra h quase 4 bilhes de anos. Consumimos alimento, e
a energia extrada dele, dentro das clulas. Ao fazer isso, construmos uma ordem dentro de
nossos corpos, sem a qual ocorreria a decadncia.
primeira vista, essa ordem mantida em clulas vivas parece violar diretamente a segunda
lei da termodinmica, que dita que a entropia sempre crescer e, portanto, a organizao
decrescer. O caos a direo final de todas as coisas, e as coisas vivas no so caticas (pelo
menos nos termos estabelecidos pela fsica). Mas esse aparente paradoxo no um problema. A
lei declara que o aumento indiscutvel de entropia ocorre dentro de um sistema fechado. O
Universo em sua totalidade um sistema fechado, uma vez que no h, por definio, nada alm
do Universo. Numa escala mais local, as coisas vivas no so um sistema fechado. Produzimos
resduos em decorrncia de nosso metabolismo, que sustenta a vida, e os expelimos no resto do
Universo. Embora a ordem seja aumentada e mantida ao longo de qualquer existncia dentro da
prpria coisa viva, essa aparente contradio da segunda lei mais que compensada por um
aumento da entropia alm dos limites do organismo, isto , nossos resduos. A entropia da
quantidade de resduos que geramos em nossa vida esmagadoramente maior que a reduzida
entropia que nossos corpos mantm ordenados. Assim, as leis do Universo permanecem
perfeitamente intactas.
A vida o processo que impede nossas molculas de decair em formas mais estveis. O
processo da vida a qumica que repele perpetuamente a desintegrao. E por isso que o
conceito da sopa primordial falho. A noo de que os ingredientes certos no ambiente certo
poderiam gerar uma forma de vida autossustentvel ignora o princpio subjacente de que a vida
um processo longe do equilbrio. A atividade qumica numa sopa pode apenas obedecer
segunda lei da termodinmica: a menos que tenha uma fonte externa para manter um
desequilbrio energtico, ela ir apenas se decompor. No experimento de Stanley Miller, a
centelha dos raios pode ter desencadeado a formao de aminocidos, mas no alimentou um
sistema de desequilbrio. Depois de ter reagido, aquelas substncias qumicas no voltariam a
faz-lo.
Bill Martin um dos principais crticos da cincia da origem da vida baseada na sopa, e em
breve falaremos de seu trabalho. Ele prope um experimento fcil para contestar o conceito de
sopa primordial: amasse qualquer forma de vida de sua escolha at destruir qualquer semelhana
celular, mas deixando todos os ingredientes intactos. Na verdade, esse experimento ocorre cada
vez que uma clula morre, mas a ressurreio espontnea a partir dessa sopa, em que todos os
ingredientes certos esto presentes, continua a ser um mito. Qualquer modelo da prpria origem
da vida que no leve em conta a necessidade de fluxo e manipulao contnuos de energia est
partindo de algo que j est morto. O experimento icnico de Stanley Miller continua a ser
importante, embora aquilo que tenha a dizer sobre a origem da vida seja limitado.8 Ele mostra,
com elegncia e de maneira incontestvel, como biomolculas surgiro de qumica bsica nas
condies certas. No entanto, ele refora a ideia de que a vida nada mais que uma reunio de
substncias qumicas ajeitadas numa coisa capaz de se reproduzir. Uma sopa primordial no
uma mistura vital e energtica, pois no tem nenhum meio de manter o desequilbrio de energia,
quer esteja numa lagoazinha morna, numa balsa de pedra-pomes, num vulco lamacento ou em
qualquer dos outros lugares j propostos para a origem da vida. Uma sopa primordial est
condenada como um acmulo de dejetos, um monte de lixo.
Em certo sentido, ns, as coisas vivas, estamos em descompasso com o resto do Universo.
Em A origem das espcies, Darwin descreveu a luta pela existncia referindo-se luta para
obter comida, ou um parceiro, ou a resistncia contra os elementos. Mas ela se aplica a um plano
mais bsico. Estar vivo lutar contra a entropia. A vida no viola a segunda lei da
termodinmica, em absoluto. No podemos derrot-la, pois essa a fora invencvel das leis
cientficas. Na morte, todos ns nos submetemos vontade da fsica, e nossos tomos aceitam
seu destino universal: decompor-se e ser reciclados, finalmente, em estados menos energticos.
A entropia esfora-se para tornar o Universo ao mesmo tempo mais catico e mais equilibrado.
Ao faz-lo, ela sempre aumenta; como nos cassinos, a casa sempre ganha.
Estando vivos, porm, temos a oportunidade de tirar alguma coisa da casa, ou de retardar sua
inevitvel vitria, ao menos por algum tempo. A vida evoluiu para extrair energia de nosso
ambiente e us-la a fim de manter nossa informao vital contra o deslizamento universal rumo
ao equilbrio, trocando e bombeando prtons de um lado para outro de uma membrana dentro
das entranhas de uma clula. Nossas vidas, todas as vidas, conspiram para manipular as foras
fundamentais da natureza, e esforam-se por faz-lo continuamente e para sempre. provvel
que Jack Szostak esteja certo, e arrancar nossos cabelos na tentativa de sintetizar a essncia de
uma vida apenas uma distrao da busca de reconstituir o caminho que sabemos que ela
tomou. Mas essa incurso na fsica crucial para a compreenso da origem da vida. Sabemos
que no podemos voltar no tempo e observar. A maneira como ela se deu outrora est perdida
para a cincia e a histria, portanto, fazemos o que nos possvel para emul-la em condies
que deram origem ao duradouro desequilbrio da vida. Em algum ponto, esse desequilbrio
adquiriu ou criou um sistema que permitiu que a captao de energia se sustentasse de maneira
independente. Nessa incubadora, os comeos da descendncia darwiniana codificada puderam
ocorrer. Mas formas de vida so, antes de mais nada, uma sofisticada coleo de
comportamentos qumicos assegurados pela necessidade de energia, e isso informa a maneira
como levamos a cabo a sondagem experimental da origem da vida. Em outras palavras,
precisamos perseguir as marcas caractersticas do metabolismo.
Est claro que Luca era uma coisa viva da qual toda vida subsequente surgiu, mas ele j
carregava consigo muitos componentes essenciais da vida que se seguiu, inclusive metabolismo e
gentica. Em nossas clulas, o metabolismo envolve dois processos: o primeiro a digesto de
molculas para liberar energia, o segundo o uso desse combustvel para fazer molculas que
sustentam a vida, inclusive DNA e protenas. Isso prope uma espcie de charada. De Luca em
diante, as clulas fazem as coisas arroladas na lista de MRS GREN, e chegaremos montagem
de um sistema to sofisticado no captulo final. Mas cada um deles depende de um problema do
ovo e da galinha. O DNA codifica as protenas que desempenham funes celulares, inclusive
metabolismo, e essas funes levam a cabo a decodificao do prprio cdigo. Vimos como o
cdigo funciona e como foi descoberto. Vimos como ele a espinha dorsal da evoluo e o
molde para a riqueza de toda a vida. Como ento o DNA veio a existir?
5. A origem do cdigo

Pois todas as inferncias a partir da experincia supem, como seu


fundamento, que o futuro se assemelhar ao passado.
DAVID HUME, Investigao acerca
do entendimento humano (1748)

O HEBRAICO TEM 22 LETRAS. O ingls tem 26, e o snscrito, 56. A lngua chinesa usa
pictogramas, e estes somam milhares, dependendo da maneira como os contamos. A vida tem
apenas quatro letras em seu alfabeto: A, T, C e G. Adicione alguns glifos, e a flexibilidade desse
alfabeto se eleva um pouco. Os linguistas chamam esses pequenos sinais de diacrticos: a
cedilha () ou o til (~). Os diacrticos do DNA apresentam-se na forma de um pequeno apndice
molecular, metil, que consiste simplesmente em trs tomos de hidrognio ligados a um tomo
de carbono e preso como um rtulo a A ou C. Assim como nas linguagens, essas anotaes so
um trao essencial da gentica, modificando o significado ao rotular sees do genoma para
caractersticas particulares. De maneira mais significativa, essa marca do cdigo delimita reas
do DNA a serem silenciadas, como se deixasse o texto onde ele se encontra, mas tachasse blocos
inteiros para dizer: No leia esta frase.
Mesmo com esse tipo de marcao, o nmero mais generoso de letras no cdigo da vida fica
muito aqum do encontrado at mesmo no hebraico. A evoluo nos deu uma descrio
abrangente de como o extraordinrio espectro das espcies floresceu a partir desse cdigo
simples, mas muito pouco sobre como isso se deu. Ao refletir sobre a origem da vida, como quer
que tentemos defini-la, em algum ponto bem inicial, a origem de nosso alfabeto uma questo
decisiva.
No s o alfabeto desconcertantemente conservador. Ele se combina num vocabulrio
tambm limitado. Como foi explicado no Captulo 2, nos genes, aquelas quatro bases so
arranjadas em tripletos, cada um dos quais representa um aminocido. Quando encadeados,
estes formam protenas. Mas h somente vinte aminocidos codificados nos genes para todas as
formas de vida. Alm disso, a maneira como os aminocidos so criptografados no DNA
crivada de redundncias. H 64 maneiras de arranjar quatro letras em grupos de trs. Na
gentica, 61 combinaes so usadas para representar apenas os vinte aminocidos (e trs
indicando um sinal de ponto-final, para marcar o fim de uma protena). Isso significa que
muitos tripletos codificam o mesmo aminocido. Por exemplo, TTA representa um aminocido
chamado leucina, mas TTG, CTC e trs outras variaes fazem o mesmo. Essa redundncia
permite que sejam adquiridas em nossos genes mudanas que no ocasionam alteraes
potencialmente prejudiciais nas protenas que elas codificam. Se, durante o processo de diviso
de uma clula em duas, um erro aleatrio de DNA trocasse TTA para TTG, isso ainda
representaria leucina, e a protena contendo esse aminocido no seria inalterada por esse erro
espontneo. Se ele trocasse o A final por um T, a leucina seria substituda por fenilalanina, um
aminocido com propriedades semelhantes. Assim, isso mudaria potencialmente a natureza da
protena, mas no de forma to drstica. Vemos uma redundncia semelhante na lngua. Na
Inglaterra, grafamos a palavra cor como colour. Mas 10 mil quilmetros a oeste, a mesma
palavra tem a grafia alternativa color. Atravs de mutao aleatria, quase certamente um erro
de cpia, em algum momento esquecido na histria, o ingls dos Estados Unidos extirpou uma
letra que os britnicos acreditam ser essencial. Evidentemente no , pois a pronncia a
mesma, e no difcil imaginar um mundo em que meu u extra britnico se degrade lentamente
e saia de uso por completo.
Isso no quer dizer que todas as mutaes sejam igualmente benignas. Se voc deixar cair o r
de friend, ter um companheiro de carter bastante diferente (fiend significa monstro,
demnio, peste). Pode-se ter uma impresso diferente quando algum tem o infortnio de
sofrer uma doena gentica, categoria que inclui todas as formas de cncer, mas, diante da
quantidade de replicaes de DNA que ocorrem, as mutaes perniciosas so relativamente
raras. Quando elas de fato acontecem, porm, uma nica mudana de letra pode ter
consequncias catastrficas. A mudana de uma nica base no DNA que resulte na troca de um
aminocido por outro muito diferente sem dvida pode causar problemas. Troque o A por um T
num ponto especfico no gene -globina, e o aminocido muda de cido glutmico para valina,
que tem propriedades qumicas muito diferentes. O resultado uma protena globina deformada,
a qual, por sua vez, altera a forma de glbulos vermelhos, tornando-os curvos e alongados, em
vez das pastilhas arredondadas que deveriam ser. O hospedeiro desse simples erro de cpia de
uma letra sofrer de anemia falciforme, doena do sangue que com frequncia causa a morte
prematura. Essa a natureza severa, mas felizmente improvvel, da doena gentica.
Em sua maior parte, porm, esses erros tm pouca importncia. Eles so normais e
acontecem toda vez que uma clula se divide. Quando um genoma inteiro copiado durante a
replicao, ocorre uma reviso de prova. As protenas que fazem a cpia, chamadas DNA
polimerases, verificam se o novo filamento que esto fazendo corresponde ao modelo,
assegurando que sempre que haja um A seja colocado um T e no alguma outra coisa. Mas isso
no perfeito, e por vezes, durante a diviso celular, novas mudanas subsistem reviso. Se isso
ocorre na produo de um espermatozoide ou vulo, pode ser o primeiro passo do telefone sem
fio gentico que leva a uma mudana evolutiva. Voc diferente de seus pais no apenas porque
genes inteiros so permutados durante a produo do espermatozoide ou do vulo, mas porque
essas clulas apresentam novas mudanas isoladas no DNA deles, que sero aleatrias, e por isso
unicamente suas. Por vezes, o emparelhamento dos As e Ts e dos Cs e Gs feito de maneira
incorreta, e um dos dois filamentos de DNA fica saliente, como um zper que no se encaixa. Se
no for corrigida pelas protenas que reveem as provas, essa nica mudana pode ser transmitida
e alterar ligeiramente o comportamento das protenas que ela codifica.1
Como viemos a nos decidir por quatro letras arranjadas em tripletos? Com um sistema to
ordenado e independente, desfaz-lo difcil, e nos atrapalhamos ao tentar descobrir onde
interromp-lo. Uma abordagem, porm, calcular a quantidade mnima de DNA necessria
para codificar os vinte aminocidos que a vida usa para fabricar todas as suas protenas. Se o
cdigo gentico fosse constitudo de apenas trs letras, haveria 27 combinaes possveis de
tripletos, ainda mais que o suficiente para codificar os vinte aminocidos de que precisamos.
Mas, ao reduzir a redundncia em mais da metade, reduz-se tambm o escudo contra doenas
potencialmente perniciosas. As trs letras nos tripletos no so todas iguais. Vemos padres na
ordenao das bases em tripletos e nos aminocidos que elas codificam. A primeira base est
relacionada ao processo da fonte do aminocido. Os aminocidos flutuam na clula, esperando
para ser reunidos em suas protenas codificadas.2 Alguns so produtos dos ciclos metablicos da
clula, mas nove deles ns no podemos fabricar, e temos de ingeri-los. Comparando tripletos
com as mesmas primeiras letras, podemos deduzir sua origem, isto , se foram autoproduzidos ou
comidos. A segunda letra corresponde a um tipo, as opes incluindo hidrfilos (dissolvem-se em
gua facilmente) e hidrfobos (no se dissolvem facilmente). As duas primeiras letras tm um
objetivo claro na determinao do produto. A terceira, com toda a sua flexibilidade de coringa,
amarra o acordo, definindo-o apenas como um dos vinte. Podemos, portanto, especular que a
primeira forma de cdigo de DNA teria sido no um tripleto, mas uma parelha, fixando a
decifrao em conjuntos essenciais de processos de manufatura. A adio de uma terceira letra
permite mais combinaes e mais variao na sequncia, criando um cdigo conservador, que
no apenas protege contra o impacto de mudanas catastrficas, mas estimula suavemente a
modificao sutil. Em suma, nosso DNA estimula a evoluo.
Mas o cdigo subjacente est congelado, inalterado provavelmente por 4 bilhes de anos. Os
alfabetos esto gelados, mas no congelados. Eles mudam, mas a mudana lentssima. O DNA,
porm, est realmente travado, pelo menos na natureza, embora isso esteja mudando no novo
mundo da biologia inventada, como voc pode ver em O futuro da vida. Francis Crick certa vez
pensou que o alfabeto do DNA foi fixado em consequncia de um acidente congelado: um
sistema que funcionou bastante bem, quer tenha suplantado outras verses, quer estas nunca
tenham existido. Mas agora est claro que a desigualdade das letras em cada tripleto no
nenhum acidente, e ficou congelada com um delicado equilbrio entre fidelidade e mutao,
como um pai amoroso que estimula os filhos a explorar, mas ao mesmo tempo os protege de
danos.

Mundo-fantasma

Podemos comear a ver como o DNA pode ter se originado numa forma simplificada e se
estabelecido em sua atual existncia estvel. Mas o paradoxo aqui muito mais complicado que
o velho problema do ovo e da galinha.3 A cpia de DNA depende de protenas, e protenas so
codificadas em DNA. O DNA o cdigo e a protena o produto ativo. Mas h razes muito
slidas para pensar que o comeo da vida, a origem da gentica, no se deu com o DNA, mas
com seu primo mais simples, o RNA.
Mais uma vez, examinando como as formas de vida moderna funcionam, podemos inferir
papis anteriores e enigmticos para a mecnica nas clulas. O RNA a parte do meio do que
Francis Crick chamou inapropriadamente de dogma central: o DNA faz o RNA fazer protena.
Para compreender como essa sequncia pode ter surgido, til pens-la em etapas. No
conhecemos nenhuma maneira de fazer protena diretamente a partir de DNA sem a
intermediao do RNA, por isso poderamos supor que a primeira parte DNA faz deve ter
sido acrescentada depois do passo conclusivo RNA faz protena, sendo o RNA a transcrio
codificada a partir da qual as protenas so produzidas. O RNA, um filamento simples, menos
quimicamente estvel que o DNA, com suas hlices emparelhadas, mais propenso a desintegrar-
se. O DNA conserva o cdigo para protenas com um filamento refletindo o outro, fornecendo
um servio de backup espelhado: onde h um A o outro filamento tem um T, onde um tem um G,
o outro apresenta um C. Portanto no absurdo imaginar que o DNA emergiu depois, como
forma mais segura de armazenamento de dados.
Mais recentemente, chegou-se a sugerir um caminho para essa transio considerando que
DNA e RNA esto propensos ao erro quando se copiam um no outro. Uma equipe de Harvard
liderada por Irene Chen comparou o grau de fidelidade da cpia quando o RNA feito a partir de
RNA, o RNA feito a partir de DNA, e o DNA feito a partir de RNA. Isso mais ou menos
como testar as proezas de uma ferramenta de traduo na internet escrevendo-se uma frase,
traduzindo-a e retraduzindo-a para o idioma original, e depois vendo quo desfigurada ela ficou.
Inequivocamente, o DNA revelou-se o melhor modelo. Quando se copiou RNA a partir de um
modelo de DNA, a transcrio foi a mais fiel. Isso sugere que uma mudana de um mundo de
RNA para o que temos hoje pode ter ocorrido sem esttica a mensagem seria preservada. Mas
o DNA copiado de RNA estava crivado de erros.4 Com esse conceito em mente, parece razovel
pensar que, como dispositivo de armazenamento, o DNA mais robusto, seguro e fiel que o
RNA. A transio de um mundo em que o RNA era o portador da informao para a era
biolgica que conhecemos chamada genetic takeover, e parece que, depois que essa anexao
ocorreu, nunca foi possvel voltar atrs.
Aquela charada do ovo e da galinha DNA codifica, protena age pelo menos
parcialmente resolvida com RNA tambm, pois por vezes ele pode fazer ambas as coisas. Uma
segunda pista para pensarmos que houve um mundo que exibia os sinais de vida e era povoado
por RNA, e no por DNA, provm da fbrica de protena da clula, o ribossomo. Quando hora
de um gene fabricar uma protena, o processo se efetua assim: o gene, localizado no DNA no
genoma do hospedeiro, recebe uma instruo para ser localizado. Uma protena desenrosca a
dupla-hlice, como se estivesse desembaraando um arame, e separa os dois filamentos. Outra
protena prende-se ao filamento codificador (o outro um espelho, e desempenha funes
mnimas), nas trs letras ATG. Esse cdon para o aminocido metionina, mas tambm marca o
comeo de um gene, o cdon de iniciao. Da em diante ele avana mecanicamente,
copiando o DNA numa molcula de RNA espelhada: onde vir ATG, o RNA ler UAC.5 Quando a
transcrio do DNA est completa, a fina molcula de RNA sai flutuando, levando a mensagem
do gene, e utilmente chamada RNA mensageiro. Em seguida o ribossomo apanha essa
transcrio e a ingere, uma letra de cada vez. Ele l o cdigo, trs letras de cada vez, cada cdon
especificando um aminocido, o qual entregue ao ribossomo a partir do ambiente da clula.
medida que cada cdon lido sucessivamente, o ribossomo apanha os aminocidos e os amarra
uns aos outros para fazer uma protena, a qual expelida na clula, despachada para cumprir seu
objetivo.
O prprio ribossomo feito de vrias partes, tal como muitos dos componentes ativos das
formas de vida.6 Essas partes menores montam-se a si mesmas muito mais facilmente que
mveis que vm desmontados em embalagens compactas, assumindo suas posies com
algumas sacudidelas. Mas o interessante para nossos objetivos que mais da metade dessas
partes no feita de protena, mas de RNA. Esses filamentos compridos e muito dobrados de
RNA ligam-se a protenas para fazer os ribossomos funcionais, e agem exatamente como
protenas na medida em que executam um processo. Assim, com esses tipos de molculas de
RNA, temos tanto informao quanto funo. Se admitirmos que o RNA foi o antepassado do
DNA na Terra primitiva, o paradoxo do DNA e da protena o primeiro codificando a segunda, a
segunda fabricando o primeiro desaparece. Essa ideia denominada hiptese do mundo de
RNA. Podemos contornar o problema do ovo e da galinha no precisando nem de um nem de
outro. Em algum momento remoto na estrada da mera qumica para a biologia, o dogma central
do DNA faz RNA faz protena era simplesmente RNA faz.

As primeiras fotocopiadoras

NNNNNNUGCUCGAUUGGUAACAGUUUGAA
UGGGUUGAAGUAU GAGACCGNNNNNN

Isso parece familiar para voc? Isto R3C, e o filho de Jerry Joy ce e Tracey Lincoln, do
Instituto Scripps na Califrnia. Se a gentica evolutiva o processo de rastrear as mais ligeiras
mudanas em nossos genes atravs do tempo para reconstruir os replicadores darwinianos do
passado, talvez R3C seja o fim da linha.
Como o RNA um candidato decente ao primeiro mundo de informao e replicao, este
um simples pedao de RNA que faz ambas as coisas. As letras so RNA normal (N um coringa,
representando qualquer das quatro bases A, C, G e U), e ele feito de duas partes (que aparecem
separadas por um trao). Num tubo de ensaio, R3C se contorce numa forma semelhante de um
grampo de cabelo. Sua funo fazer uma verso especular de si mesmo ligando as duas partes.
Essa proximidade com seu reflexo, por sua vez, faz uma nova cpia do original, e assim por
diante. Isso prossegue ad infinitum, enquanto o sistema for alimentado com os ingredientes que
permitam as reaes qumicas contnuas que impelem a replicao. Centenas de milhes de
molculas copiadoras podem ser feitas em poucas horas.
Esse um tipo de protogene, feito de RNA, e no de DNA. Ao contrrio de nossos prprios
genes, que tm funes e instrues para protenas que constroem tecido e osso, ou emitem
comandos para que outros genes o faam, a instruo que R3C transmite simplesmente Copie-
me. O DNA depende de outra mecnica para se copiar, mas R3C no precisa de nenhuma
ajuda: uma fotocopiadora que s faz outras fotocopiadoras. O fato de sua nica instruo ser
Copie-me no o torna muito til para um organismo moderno. Mas a gentica tinha de
comear em algum lugar, e, hipoteticamente, talvez os primeiros genes se parecessem com isso
uma mquina copiadora. O RNA que tem uma funo chamado ribozima.7 nessas
simples molculas de dupla ao que muitos cientistas veem um preceito fundamental da vida:
reproduo e informao. Joy ce acredita que a que a qumica comea a se transformar em
biologia. Esse o primeiro caso, fora da biologia, de informao molecular imortalizada.
Em termos biolgicos, essa a menor unidade de informao; em termos de computao,
um nico bit. Mas, como as ribozimas promovem sua prpria replicao, no tubo de ensaio elas
desempenham uma forma de seleo darwiniana. O experimento de Joy ce foi marcado a
princpio pela fidelidade: as ribozimas reproduziam-se de maneira impecvel. Mas a evoluo
requer cpias falhas, e, como Joy ce me disse, a perfeio enfadonha. Assim, os
pesquisadores introduziram imperfeies na mistura, infidelidade de sequncia isto , erros de
ortografia , para que cada cpia fosse um pouquinho diferente. Portanto, Joy ce introduziu o
fundamento da seleo darwiniana, a variao. A partir de uma quantidade dessas curtas
molculas de RNA, emergem algumas que se reproduzem com maior sucesso para se tornar a
forma dominante. Sem nenhuma orientao, salvo as condies certas e a matria-prima
fornecidas por Joy ce, essas molculas passaram por uma forma no viva de seleo natural.
Essa uma abordagem engenhosa da origem do cdigo gentico. Essas ribozimas
experimentais no so naturais, mas apenas parcialmente projetadas. Nos anos 1990, David
Bartel e Jack Szostak criaram uma tcnica que deu grande estmulo ideia de um antigo mundo
de RNA antes do DNA e das protenas. Sua tcnica permite que ribozimas funcionais criem a si
mesmas, pelo menos parcialmente. Isso se assemelha ideia lendria dos macacos providos de
mquinas de escrever, segundo a qual, com um nmero suficientemente grande de smios
batucando em teclados, um deles vai acabar datilografando um soneto de Shakespeare. Bartel e
Szostak reuniram um conjunto de trilhes de cadeias de RNA idnticas num curto trecho, numa
ponta, e depois cadeias aleatrias nas duzentas letras seguintes. Nos trilhes de combinaes
possveis, eles procuravam encontrar uma que, por puro acaso, tivesse a capacidade de
acrescentar outra molcula similar de RNA a si mesma. Em seguida pescaram nesse conjunto
com um pedao marcado de RNA, uma isca para fisgar qualquer molcula aleatria, em meio
queles trilhes delas, que fosse capaz de prender outra molcula de RNA. Na metfora do
macaco datilgrafo, isso seria como fazer uma busca entre trilhes de arquivos de textos
simiescos com a expresso queridos rebentos de maio. Se isso parece fcil, lembre-se de que
essas so sequncias inteiramente aleatrias, e eles esto esperando que o significado, ou, nesse
caso, a funo, surja do nada. Bartel e Szostak encontraram exatamente essa capacidade a partir
de seu conjunto de molculas de RNA numa taxa de cerca de uma em 20 trilhes.
O exemplo dos macacos e das mquinas de escrever puramente aleatrio e deixa claro
que, quando se trabalha com nmeros muito grandes, alguns padres (ou prosa) emergiro.8 A
evoluo em grande medida no aleatria. A variao no cdigo gentico pode ter surgido
inteiramente por acaso, mas a seleo (seja ela natural ou produzida pela mo de um criador)
exatamente o oposto. Bartel e Szostak emularam completamente a evoluo biolgica com seu
mtodo, permitindo que a variao ocorresse, mas selecionando as variantes que funcionavam.
Em seguida, tal como na natureza, eles repetiram, mas dessa vez usando s ribozimas que j
haviam demonstrado capacidade de se ligar ao RNA (como se, esperando no levar minha
analogia longe demais, dessem aos macacos o primeiro verso de um soneto como ponto de
partida para sua frentica datilografia). Depois de dez rodadas de procura daquelas que poderiam
ligar RNA, as ribozimas que haviam sobrevivido a essas severssimas competies de talentos
eram vrios milhes de vezes melhores para juntar RNA. H uma gota de tnico a se tomar com
isso: o fato de que enzimas de ocorrncia natural trabalham cerca de 10 mil vezes mais depressa
que as melhores ribozimas de Bartel e Szostak, que tinham pouca probabilidade de apresentar
grandes melhoras. Mas lembre-se de que estamos lidando com a introduo de funo num
mundo em que no havia nenhuma, e esse mundo de RNA foi transitrio, destinado a ser
substitudo por DNA e protenas, mais eficientes e eficazes.
Em essncia, esses experimentos esto tentando criar alguma coisa mais fundamental que a
vida. No podemos realmente ter certeza de que as ribozimas foram os primeiros genes, no
precisando nem de protena nem de DNA, embora essa ideia no seja atualmente controversa.
Ribozimas existem de fato na natureza, mas se RNAs autorreplicadores foram os primeiros
genes, eles j esto extintos h mais de 3 bilhes de anos, e experimentamos ressuscitar uma
lngua morta no registrada, s conhecida por seus descendentes.
Em Cambridge, no Reino Unido, o Laboratory of Molecular Biology foi chamado de
Fbrica de Prmios Nobel, pois dezenove dessas to cobiadas condecoraes foram
conquistadas por trabalhos realizados naquele prdio sem graa, de vidro cinzento. Ali, Philipp
Holliger dirige um laboratrio onde o mundo perdido do RNA est sendo explorado. A equipe dele
usou uma evoluo semelhante em tubo de ensaio para escolher outro candidato a gene
aborgene. Eles comearam com uma escolha aleatria em meio a um conjunto menor, de
meros 10 milhes de variantes, e, mediante o uso de certos truques tcnicos envolvendo leo e
contas magnticas, selecionaram uma ribozima que produz mais RNA. Este no se autorreplica,
mas os pesquisadores conseguiram induzi-lo a produzir uma ribozima inteiramente diferente,
muito conhecida, chamada, de maneira um tanto surpreendente, de cabea de martelo.9 At
agora, a ribozima de Holliger s pode fazer novos RNAs de cerca de cem bases de comprimento,
nmero um pouco pequeno para uma ribozima, e fica muito aqum do gene moderno mdio,
mas eles esto trabalhando para ampli-los.
Temos aqui a emergncia de modelos plausveis para a origem de informao na qumica e,
de maneira ainda mais importante, a origem da cpia de informao. Esta a marca
caracterstica da vida. A capacidade assombrosa das ribozimas de Joy ce e Holliger sua funo
espontnea. A de Joy ce copia a si mesma; a de Holliger copia muitas outras coisas. A grande
meta modelar a emergncia de uma que faa ambas as coisas.

Criao por supresso

Mas podemos voltar ainda mais atrs. As ribozimas, como todo cdigo gentico, tm suas quatro
letras com que encerram informao, A, U (em vez do T no DNA), C e G. Se supusermos que
Luca dispunha desse alfabeto, e s at a que nossos registros histricos nos permitem chegar,
no temos nenhum registro de como esse cdigo completo surgiu. Isso diferente da evoluo da
lngua, em que temos registros histricos de formas anteriores, com diferentes letras e
significados. Saber como se deu a aquisio da linguagem do DNA e do RNA decisivo para a
compreenso da origem da vida. A ideia de que todas as quatro letras de cdigo foram adquiridas
simultaneamente parece mais improvvel que a de que foram adquiridas sequencialmente, uma
de cada vez. Podemos p-la prova suprimindo as letras tambm em sequncia.
Como no jogo de tabuleiro Palavras Cruzadas, algumas letras tm mais valor que outras. C,
citosina, ligada a um G mais estvel que um pedacinho de cdigo contendo A e T, que ser o
primeiro a se desintegrar no frio ou no calor. Alm disso, no RNA, as letras podem se emparelhar
de uma maneira ligeiramente diferente dos degraus ntidos e arrumados da escada do DNA. Isso
chamado, muito acuradamente, de pareamento oscilante, e ajuda o RNA a se dobrar nas
alas e pregas que do s ribozimas capacidade de se autocopiar. Na ausncia de C, tanto o
pareamento normal quanto o oscilante ainda podem ocorrer.
Comeando mais uma vez de um colossal conjunto de ribozimas com variaes aleatrias
em sua sequncia, Jerry Joy ce e seu colega Jeff Rogers conduziram a evoluo procurando
repetidamente aquelas que no continham nenhuma citidina,10 usando uma isca com pouca
afinidade com essa letra, mas ainda capaz de juntar duas molculas de RNA. Efetivamente, eles
estavam eliminando por seleo um trao particular de seu estoque, mas, em vez de se tratar de
uma caracterstica indesejvel num animal ou planta, o estoque uma ribozima de 140 letras, e o
trao a letra C. Mesmo na ausncia de das letras disponveis, eles criaram uma ribozima que
podia conservar habilmente sua funo unificadora.
Assim, depois que descartamos uma das letras e mostramos que molculas biolgicas ainda
podem funcionar, qual o experimento seguinte? A abordagem de Joy ce, bvia, mas no menos
brilhante, foi desenvolver uma ribozima com apenas duas letras de cdigo. Isso significou
desenvolver ribozimas com letras similares, mas diferentes, que chamaremos de D e U, e a
atividade da molcula que eles criaram foi muito reduzida em relao de uma verso com o
alfabeto completo. Mesmo assim, ela ainda funciona como uma ferramenta biolgica ativa. Essa
molcula de alfabeto limitado poderia at ter sido vantajosa em guas arqueanas quentes, pois as
ligaes dobradas que contm C poderiam ter se autodestrudo em altas temperaturas.
Embora no exibam o que realmente aconteceu na origem da gentica, esses engenhosos
experimentos mostram o que poderia ter acontecido. Eles demonstram que a evoluo pode
prosseguir com um alfabeto mais restrito que aquele usado hoje pela vida. Inserem-se num
quadro que estabelece de maneira convincente uma origem para a replicao codificada, isto ,
a gentica. Se uma das caractersticas definidoras das formas de vida a capacidade de
armazenar e reproduzir informao, ento uma das questes mais fundamentais relacionadas
origem da vida como um sistema to complexo pode ter se iniciado. At que ponto isso
corresponde ao que pode ter acontecido 4 bilhes de anos atrs, isso difcil dizer. Ns temos a
vantagem de dispor de ingredientes e projeto, pelo menos projeto experimental, em vez da
qumica desordenada e imprecisa da Terra primitiva. Mas aqueles primeiros tempos duraram
milhes de anos, ao passo que os cientistas fizeram esses novos replicadores em uma dcada. A
tarefa no replicar o que aconteceu outrora. Isso seria impossvel. Mas em todos os estudos da
origem da vida importante lembrar que ns conhecemos a resposta: a vida a resposta. A
questo encontrar uma rota plausvel para chegar l, e isso est comeando a emergir nesses
experimentos.

A origem do alfabeto
Podemos recuar ainda mais no passado. Quando Jerry Joy ce pede a uma de suas fermentaes
para copiar e produzir mutao em ribozimas, ele precisa fornecer os ingredientes. A Terra
arqueana no possua um laboratrio limpo, com recipientes de vidro e substncias qumicas
manufaturadas e purificadas, compradas de empresas industriais. Suas ribozimas fornecem um
mecanismo plausvel para os primeiros genes e a base para uma linguagem que sobreviveu por
bilhes de anos. As letras dessa lngua so as bases do RNA, portanto, a questo seguinte : de
onde elas vieram? Elas no so molculas triviais, por transportarem o cdigo da vida, sem
dvida, mas tambm por serem complexas. Pelo menos ns as descrevemos como molculas
complexas por um par de razes. Uma que as letras do cdigo gentico so fabricadas num
caminho biolgico difcil de descobrir, envolvendo muitas protenas diferentes. Nossas clulas
fazem isso sem pensar, claro, pois desenvolveram processos extremamente avanados de
metabolismo que sustentam sua prpria existncia fabricando suas prprias partes. Consideramos
esses processos e os deciframos cuidadosamente e com assombro, por vezes com terror, quando
os revisamos na vspera dos exames escolares. Os caminhos metablicos que criam bases em
nossas clulas desenvolveram-se ao longo de inmeras iteraes o mais rigoroso e implacvel
processo de criao conhecido. Mas, evidentemente, se essas substncias qumicas complexas
so anteriores semente da rvore da vida, no havia nenhum metabolismo sofisticado com que
pudessem ter sido construdas.
Com isso em mente, o fato que a estrutura qumica das letras do cdigo gentico
complexa, antes de mais nada, porque o afirmamos. Se isso parece um raciocnio circular, a
segunda razo pela qual a consideramos complexas que tambm no fcil para ns sintetiz-
la quimicamente. Como o processo de sntese da clula intricado, ns o vemos como complexo,
e nossas tentativas de replicar essa sntese tambm so complicadas. Aquelas bases devem se
alinhar exatamente da maneira certa para formar uma ribozima funcional, e durante dcadas
isso se mostrou obscuro, no laboratrio de qumica. Alm disso, h um grande problema de
fornecimento. Para fazer uma das ribozimas autorreplicadoras de Jerry Joy ce so necessrias
mais de setenta bases de RNA, mas isso se soubermos exatamente o que estamos fazendo. Para
que uma delas emerja de um conjunto aleatrio de milhes, precisaremos de bilhes de bases. E,
quando a ribozima comea a se autocopiar, o nmero de letras cresce exponencialmente. Para
dez rodadas de replicao de uma ribozima de cem bases seria necessrio um pool de mais de 10
mil bases, mas cem rodadas de cpia iriam requerer mais de 10^30. Acrescente a isso o fato de
que cada rodada de replicao reduz a concentrao do pool de letras, o que torna a replicao
mais difcil. Seria como grafar palavras com letrinhas de macarro. Aps usar algumas letras,
torna-se mais difcil grafar outras palavras. Assim, para continuar grafando novas palavras,
precisamos de um fornecimento constante de letras, talvez uma fbrica inteira de macarro.
Portanto, antes de chegarmos s ribozimas autocatalisadoras e autocopiadoras, um problema
anterior, mais bsico, saber de onde vm esses ingredientes no mundo natural inanimado,
embrionrio. O problema este: sem a ajuda da bioqumica, como essas letras se formaram
espontaneamente, quando isso nos parece to difcil no laboratrio? Essa uma questo que
persistiu durante toda a existncia da hiptese do mundo de RNA, que j conta quase quarenta
anos.
Se o DNA uma escada retorcida, seus dois componentes essenciais so os degraus e os
montantes. O RNA, que apenas um nico filamento, como uma escada cortada verticalmente
pelo meio. Para poder se ligar numa molcula funcional, as letras individuais de cdigo precisam
ligar-se aos montantes da escada. Esse terceiro componente um conector feito de fosfato
uma combinao de tomos de fsforo e oxignio. Os montantes, por sua vez, so feitos de tipos
de molculas de acar: o R em RNA representa o acar ribose, e o D em DNA representa
desoxirribose, que a mesma coisa, exceto por ter menos um tomo de oxignio. Cada molcula
desses acares est ligada a uma letra, A, C, G ou T (ou U no RNA), e quando empilhadas,
essas molculas de acar formam a espinha dorsal, os montantes da escada. No DNA, duas
espinhas se emparelham; no RNA, cada uma permanece como um fio nico. a forma dessas
molculas que determina seu comportamento. Por exemplo, a uracila um pequeno anel
hexagonal de tomos, e ela se liga com seu acar, ribose, que uma molcula pentagonal como
dois pedaos de uma bola de futebol. Juntas, a uracila e a ribose compem um nico degrau de
RNA, e vo ser ligadas por fosfatos com as outras bases para compor um pedao de cdigo
gentico.
Essa breve digresso por estruturas qumicas possivelmente penosas ajuda a demonstrar por
que recriar a vida de novo uma questo complicada. S essas formas precisas vo agir como
parte de clulas vivas, mas essas molculas poderiam ser rearranjadas de muitas outras
maneiras. Um tomo na posio errada, um apndice molecular no lugar diferente, e no
teremos DNA ou RNA, no teremos vida.
O problema que a qumica biolgica em clulas simplesmente acontece, ao passo que ns
temos de fazer um grande esforo para imit-la. Embora possamos observar e desconstruir o
mecanismo que as clulas usam para fabricar essas molculas, para o propsito de estudar a
origem da vida precisamos compreender sua sntese antes que essas fbricas existissem. Fora de
nossas clulas, fazer com que os anis de acar e uracila se liguem provou-se uma dificuldade.
A qumica uma cincia antiga e tem caminhos de sntese j muito trilhados. Molculas
complexas muitas vezes so fabricadas assentando-se uma pedra de cada vez, acumulando-se
at o produto final. Alguns passos so mais difceis que outros, e preciso induzir tomos a
formar ligaes onde queremos que elas estejam, e no em algum lugar mais fcil. Uma
induo suave pode persuadir dois tomos relutantes a se ligar no caminho. Mas, quando estamos
fazendo uracila para uso em RNA, essa sntese qumica gradativa provou-se infrutfera, pois ela
reluta em associar seus dois anis componentes.
John Sutherland e sua equipe esto tambm no Laboratory of Molecular Biology, em
Cambridge. Sua abordagem ao problema um passo ousado, pelo menos em termos dos dogmas
da qumica. Num estudo capital feito em 2009, eles contornaram com sucesso o obstculo
tomando uma rota inteiramente diferente.11 A abordagem tradicional consiste em manter a
produo dos dois componentes os anis de ribose e o anel de uracila separada, pois ambos os
processos resultam num lquido viscoso de subprodutos. A mistura deles, supunha-se, resultaria
numa lama qumica contendo muitos acares e grande quantidade de outras coisas, mas no
muita uracila. Para contornar isso, Sutherland ignorou essa ideia preconcebida de procedimentos
segregados lamacentos e decidiu comear misturando os ingredientes. Nessa tcnica, chamada
qumica de sistemas, em vez de reunir as partes de uma molcula complexa uma aps outra, e
de purificar depois de cada passo, todos os ingredientes so misturados ao mesmo tempo. Isso,
sob certos aspectos, lembra os experimentos realizados por Stanley Miller nos anos 1950, que
produziam aminocidos em abundncia a partir de um estoque de ingredientes supostamente
presentes nos primrdios da Terra. No entanto, trata-se de algo muitssimo diferente, porque no
se est apenas misturando ingredientes para ver o que emergir. A produo de uracila dessa
maneira destinada a fazer exatamente isso, num ambiente que poderia ter estado presente. No
comum que os cientistas usem uma palavra como plausvel no ttulo de um artigo, mas, no
caso de Sutherland, ela adequada a seu modelo: Condies pr-bioticamente plausveis.
Desdenhei a ideia da sopa primordial no captulo anterior, sob a alegao de que no
energeticamente plausvel que um sistema vivo autossustentvel pudesse surgir de um caldo
qumico. Isso de que falamos agora diferente, porque se trata de um mecanismo para construir
os elementos das coisas vivas, neste caso, a linguagem da gentica.
A abordagem de Sutherland funciona uracila se forma e resumida em seu comentrio:
A complexidade est nos olhos de quem v. Seu raciocnio que isso deve ter acontecido no
passado sem a assistncia de um laboratrio de qumica ou das maquinaes da biologia. Esse
novo caminho ele prprio de grande importncia, mas um tanto reservado para os bitolados
da qumica. Ocorre que o condimento essencial que faltava era fosfato, o qual tinha o efeito de
obstruir a produo de acar, mas promovendo a ligao dos dois anis para formar uracila.
Mas a abordagem diz algo de significativo sobre a conduta na cincia. O pensamento de
Sutherland bastante radical. Pela primeira vez, em lugar de pensar sobre as condies qumicas
da Terra primitiva e tentar imit-las para fazer uracila, sua equipe imaginou uma maneira de
sintetizar uracila, e depois postulou que essas condies provavelmente tinham sido o caldo
qumico a partir do qual o cdigo se formara. Afinal, j sabemos o resultado na Terra primitiva:
ele aconteceu, por mais difcil que nos parea ser repeti-lo. A uracila e todos os elementos do
cdigo gentico foram criados de alguma maneira e em algum lugar, e, se formos capazes de
recriar isso, poderemos potencialmente saber mais do que sabamos sobre como era a Terra
primitiva.12
Nossas ideias preconcebidas sobre a dificuldade envolvida na criao no biolgica de
molculas complexas foram contestadas tambm em 2008, quando uma equipe liderada por Zita
Martins, no Imperial College London, isolou uracila no meteorito Murchison. Essa rocha de cem
quilos caiu em territrio australiano, em 1969, e foi sujeita a exame desde ento, em especial por
ser grande, o que significava que havia muito material com que trabalhar. Por ser tambm cheia
de carbono, ela tinha interesse para os astrobilogos, muitos dos quais sugerem que rochas
extraterrestres podem ter trazido alguns, se no muitos, dos componentes qumicos para a Terra.
Sem dvida outras bases e aminocidos foram encontrados em meteoritos, e, dado o fluxo dessas
grandes pedras vindas do espao durante o bombardeio pesado tardio, esse pode ter sido um
fornecimento. Seja como for, a presena de uracila fora da Terra mostra mais uma vez que sua
sntese perfeitamente possvel, por mais que nos parea complicado promov-la.
difcil superar os preconceitos das pessoas, mas no h lugar para dogma em cincia. Ao
explicar seu novo caminho, Sutherland enfrentou crticas veementes por parte de qumicos
inflexveis, que censuravam a formao simultnea dos ingredientes e insistiam na ideia
tradicional de que a sntese deve ter sido gradativa e passo a passo, e no derivada de uma
fermentao qumica. Hoje ele brinca dizendo que essa crtica o modelo Dem Dry Bones,a
em que cada elemento criado pronto para ser integrado a um todo: O osso do p conectado ao
osso da perna,b ento, como a evoluo produz um membro inferior? Conectando um p pr-
formado a uma perna, claro Agora, oua a palavra do Senhor!
Esses experimentos no resolvem a questo da emergncia da linguagem universal da vida,
mas revelam um caminho bastante plausvel. A linguagem da vida um assombroso exemplo de
projeto natural. Ela no s tem a capacidade de codificar as maravilhas do mundo vivo, como
incorpora uma zona de proteo natural, que estimula a evoluo, mas no de maneira
demasiado radical. Hoje temos uma compreenso de como esse cdigo surgiu. H razes crveis,
a partir de substncias qumicas bsicas, para as letras da lngua; h molculas simples de RNA
que se comportam como genes e promovem sua prpria replicao; e h razes para pensar que
o DNA devia ser um dispositivo de armazenamento de dados melhor, e assim teria acabado por
substituir o mundo de RNA, onde o cdigo gentico poderia plausivelmente ter se originado. A
charada que est na origem do dogma central DNA faz RNA faz protena parcialmente
solucionada pela capacidade heroica do RNA de fazer os servios dos outros nessa equao,
cdigo e funo. Com ribozimas, a mecnica da duplicao dos genes levada a cabo pelo
prprio RNA e no requer as protenas que executam essa funo vital (e todas as outras). Mas o
problema mais vasto do ovo e da galinha permanece. A replicao em clulas, de Luca em
diante, requer energia. Assim, de forma subjacente ao mundo de RNA, transio para DNA e
ao estabelecimento de clulas e da vida tal como a conhecemos, deve ter havido uma fonte de
energia que poderia ser captada e manipulada para formar a base de todos os processos de
suco de energia de que as clulas precisam. E aqui nos encontramos em guas quentes,
profundas.

a Ttulo de conhecida cano espiritual que fala da visita do profeta Ezequiel ao Vale dos Ossos
Secos e da profecia de que os ossos voltaro a se encaixar, um a um, como est em Ezequiel 37.
(N.T.)
b Trechos da letra dessa msica: The footbone connected to the leg bone e Now, hear the
word of the Lord. (N.T.)
6. Gnese

Pensando bem, que coisa esquisita a Vida! To diferente de tudo o mais,


no ? Se que voc me entende.
P.G. WODEHOUSE, Rallying Round Old George

UMA CARGA PESADA, mas voc a transporta naturalmente. Voc l estas palavras com o
peso acumulado das realizaes da humanidade atrs de si. Apesar de toda a maravilha da
gentica e dos circuitos celulares que lhe permitem funcionar, acumulados ao longo de bilhes de
iteraes na linhagem ininterrupta das clulas, somos tambm uma espcie que o produto de
nossa cultura. Inventamos, compomos, negociamos, compartilhamos, aprendemos e criamos.
Mas, o que ainda mais importante, carregamos essas coisas conosco por meio de famlias, por
meio de grupos e atravs de nossa espcie. A evoluo cultural no est restrita descendncia
de genes atravs de linhagens. Podemos aprender de qualquer outra pessoa e adquirir suas
habilidades sem uma ligao gentica. uma prtica intelectual proveitosa afirmar que uma das
coisas que os seres humanos fazem o que nos define como espcie. No foi a inveno de
ferramentas que nos transformou de simples ancestral em seres humanos modernos, embora isso
tenha sido parte do processo. Espcies humanas anteriores construam ferramentas simples,
cortadores de slex ou toscas cabeas de machado. Muitos animais usam ferramentas tambm,
desde as lontras, que utilizam pedras para quebrar mexilhes, at corvos, que manejam gravetos
para remover uma gorda larva de inseto de um tronco. O importante no fazermos coisas
unicamente humanas, o fato de continuarmos a faz-las. Acima de tudo, os seres humanos
acumulam cultura.
Voc a soma de suas partes e de sua espcie; genes foram transmitidos de pai para filho por
geraes; cultura e ideias foram transmitidas de ser humano para ser humano em todos os
sentidos. Isso deveria ser bvio, assim como evidente que no houve um momento que fez de
voc quem voc . Gostamos de fingir que h momentos decisivos, nos quais alguma coisa
mudou de repente, em que um carter ou um evento se forjou Rosa Parks escolhe continuar
sentada num nibus, um estudante chins annimo desafia um tanque. Esses so momentos
icnicos, mas eles no descrevem o fluxo da histria. A vida sua vida, qualquer vida no se
reduz a uma srie de incidentes. Ela o acmulo de tudo que voc experimenta.
O comeo da vida tambm foi exatamente assim. A transio da qumica para a biologia foi
o acmulo das coisas que a vida faz alimentar, copiar, reproduzir, e assim por diante. Em
algum ponto na histria da Terra havia apenas substncias qumicas, num momento posterior
havia vida. A mais fascinante questo em cincia como essa transio ocorreu.1
A reconstruo da vida de baixo para cima envolve muitos componentes, e a procura de uma
resposta simples para um problema de imensa complexidade deve ser uma futilidade. A maneira
como isso aconteceu da primeira vez e a maneira como acontecer da segunda, e em vezes
subsequentes, sero diferentes. Mas o desafio das iniciativas referentes origem da vida imitar
a criao em situaes plausveis e crveis. Isso significa pensar no apenas sobre quais foram os
processos que transformaram a qumica em biologia, mas tambm onde eles ocorreram.

De terras estranhas

Por que deveramos ter um sistema to conservador de biologia: um cdigo, um mecanismo, um


dogma central? Sabemos que provavelmente o RNA agiu como precursor para o sistema mais
robusto hoje em vigor. Francis Crick especulou que a universalidade do DNA foi um acidente
congelado, um sistema que funcionou e ficou fixado no lugar, ao que parece para sempre,
excluindo qualquer alternativa. Uma vez instalado, qualquer mudana seria letal para os
portadores de um novo sistema vital, ou seria logo derrotada pela vida existente. Por que o cdigo
se fixou? A verdade que no sabemos. Estudos suscitaram ideias de que isso no se deu por
acidente, e que o cdigo de quatro letras e o lxico de vinte aminocidos esto otimamente
equilibrados num ponto em que mutaes positivas e deletrias permitem que a evoluo ocorra
com sucesso. Aparentemente, h uma explicao mais simples, pela qual Crick se deixou seduzir
por um breve tempo. esta: o cdigo no evoluiu de maneira alguma. Ele foi entregue aqui, j
funcional, mas congelado, vindo de algum outro lugar. Nesse caso, outro lugar significa o
espao.
Essa uma das verses vagamente mais cientficas de uma ideia sobre a origem da vida
chamada panspermia, segundo a qual a Terra foi semeada de coisas vivas em algum ponto
remoto do passado, seguindo-se a evoluo das espcies. Esquea as imagens comuns de
extraterrestres, beligerantes bpedes cinzentos de corpos compridos, finos, e cabeas bulbosas. Os
extraterrestres descritos pelos defensores da panspermia seriam clulas simples, do tipo
bacteriano, ou ainda mais simples, a mecnica da vida celular a ser utilizada pelo que quer que
estivesse disponvel no planeta arqueano. Transportadas em cometas ou meteoros, elas agiriam
como as sementes da evoluo, uma infeco a partir das estrelas. Uma vez entregues com
sucesso, estavam livres para passar a evoluir por seleo natural.
Em 1973, Francis Crick publicou um artigo em coautoria com Leslie Orgel em que no
apenas delineava a possibilidade de entrega extraterrestre de sementes da vida, como tambm
afirmava que elas foram enviadas para c deliberadamente, por seres inteligentes. Eles se
sentiram atrados por essa ideia a panspermia dirigida em grande parte por causa das
inadequaes das ideias existentes sobre a origem do cdigo gentico. Esse um estudo
estranhamente irnico, que contempla as limitaes do voo espacial e especula com sbia
prescincia sobre a descoberta de planetas alm do sistema solar. Na poca, nada se sabia; no
momento em que escrevo isto, j chegamos a quase mil planetas.2
No difcil ver o atrativo da panspermia, embora cientificamente ela no seja plausvel
nem crvel. Mesmo hoje, nesta era de calma galctica local, cerca de 30 mil escombros
rochosos aportam em nosso planeta a cada ano, a maior parte sob a forma de poeira,
desintegrada na atmosfera. Chuvas de meteoros podem ser vistas consumindo-se no momento
certo do ano, como fazem as Perseidas, todo vero, no hemisfrio norte. Temos conhecimento
at de relocao interplanetria, pelo menos em minsculas quantidades.3
Muito raramente um grande meteorito atinge a Terra, como ocorreu em Murchison, na
Austrlia, em 1969. De maneira ainda mais rara, felizmente, um meteorito de propores
colossais chega aqui, como em Chicxulub, 65 milhes de anos atrs. Essas rochas vm do espao,
formadas quando rochas espaciais maiores batem uma na outra e lanam seus escombros numa
trajetria de coliso com a Terra. Hoje eventos desse tipo so incomuns, em especial a queda de
meteoros ricos em carbono, como aquele que caiu em Murchison, carregado de molculas que
sabemos serem essenciais para a vida na Terra. Mas o que conduziu s nossas melhores
estimativas do momento em que Luca teria aportado na Terra foi a intensa e implacvel
atividade do bombardeio pesado tardio. Milhes de toneladas de rochas espaciais estavam sendo
depositadas aqui durante um perodo de milhes de anos, numa extenso tal que uma pequena
proporo do manto da Terra feito de rochas interestelares. Potencialmente, teria sido
necessria apenas a sobrevivncia de uma nica clula para semear tudo o que se seguiu.
Infelizmente, o poder de atrao de uma ideia nada significa na cincia. So os dados que
contam, e por isso fcil lidar com a panspermia como explicao para a origem da vida na
Terra. Simplesmente no h nenhuma evidncia disso. Embora a hiptese seja atraente para a
fico cientfica, no temos nenhuma prova de que a vida tenha algum dia sobrevivido alm da
rbita da Lua, e isso apenas quando l estivemos como turistas.
Isso no quer dizer que no exista vida alm desse ponto azul-claro que chamamos de nosso
planeta,4 mas nunca a vimos. Nem nas afirmaes de abduzidos por extraterrestres, nem nas
bolinhas microscpicas presentes em rochas vindas de Marte,5 nem na caada digna de crdito
empreendida pelo projeto Seti, o Search for Extra-Terrestrial Intelligence. A taxa em que
descobrimos planetas semelhantes Terra est crescendo vertiginosamente medida que
conseguimos v-los melhor. Por enquanto, porm, estamos ss.
Sem dvida vemos muitos dos ingredientes da vida no espao. importante lembrar que
estamos no espao, fomos formados no espao e somos parte do sistema solar. Ignorar isso
negar o fato de que nossa existncia determinada pelo espao em que a Terra existe. Muitas
vezes, a imprensa relata uma nova descoberta relacionada origem extraterrestre de partes
constituintes do planeta. Em geral, esses estudos so jubilosamente apresentados como
extraordinrios. O que surpreende que se desconhea a origem dessa parte constituinte at
ento, pois a chegada Terra por meio de cometas ou meteoros nada tem de surpreendente em
si mesma. Sabemos hoje que muitos ingredientes da vida, as partes componentes, esto presentes
no espao, inclusive aminocidos e at, como foi debatido no captulo anterior, elementos do
cdigo gentico. Estas so descobertas cientficas importantes, em especial para o estudo da
origem da vida. Elas mostram que a qumica que produz molculas biolgicas ocorre fora da
biologia. Isso significa que a sntese desses componentes no est limitada Terra. E descreve
um mecanismo de entrega pelo qual cometas ou meteoritos podem carregar esses componentes
qumicos e traz-los potencialmente para nossa superfcie.
De maneira contnua e no surpreendente (embora inconstante), a Terra foi o receptor de
coisas que enchem nosso espao local. Se traarmos uma linha ntida entre Terra e no
Terra, os ingredientes que compem nosso planeta vivo tero sido fabricados em um desses dois
lugares. uma surpresa que gua, metano e outras substncias qumicas que figuram como
elementos bsicos em bioqumica tenham se originado fora da Terra?
A panspermia sedutora porque parece uma explicao mais simples, que no requer a linha
do tempo interrompida, incompleta, de que hoje dispomos. Na verdade, porm, ela no passa de
um artifcio. Se houvesse evidncia da transferncia de vida de outro lugar do Universo para a
Terra, e no houvesse nenhuma outra explicao plausvel, a panspermia poderia se justificar.
Contudo, ela no resolve a questo de como a vida comeou na Terra nem fornece nenhum
apoio, na forma de evidncias, para seu comeo em qualquer outro lugar. A parcimnia impe a
noo de que essa poderia ser uma explicao mais simples que nossas bem incompletas
alternativas. No entanto, ela est longe de ser a mais simples, porque no somente requer que a
vida abunde, ou pelo menos exista, no Universo, como tambm que ela se baseie no DNA. No
possumos nenhuma evidncia que corrobore isso. De fato, h outras avenidas, melhores, que
merecem ser exploradas; elas encerram seus prprios problemas, mas pelo menos so rotas
cientficas, passveis de ser testadas uma e outra vez. Apelar para a vida extraterrestre como o
entregador de um ovo csmico no necessrio nem suficiente para explicar a origem da vida.
Por enquanto, e ao longo do futuro previsvel, a vida vinda de fora de nosso ponto azul-claro deve
continuar no domnio da fico.

Conteno

Todos os processos celulares, inclusive o modo de replicao da informao, so sustentados por


um sistema que capta e usa energia falaremos disso adiante. Antes, porm, h uma questo a
ser tratada. As clulas so unidades discretas de vida, seja dentro de um organismo, seja vivendo
independentemente, e assim sua informao e seu metabolismo devem ser mantidos separados
do resto do Universo. H, portanto, o problema da origem da membrana. A conteno das
entranhas de uma clula uma parte absoluta de sua existncia, e fcil pensar que a
membrana da clula apenas um recipiente, um mero balo em que as maquinaes da vida
esto contidas. Certamente, a conteno dos rgos vitais de uma clula essencial, pois tem o
efeito de concentrar reaes qumicas que mantm a vida. Mas as clulas existem como parte de
um ambiente, e no separadas dele. A membrana da clula se assemelha mais a uma alfndega,
uma interface que monitora e controla a importao e exportao de todos os bens e mensagens
de que uma clula precisa. Essa imensa complexidade permite a uma clula individual existir em
seu ambiente, ou com as outras clulas na criatura que seu hospedeiro. Essa troca se d na
forma de uma rede complexssima atravs da qual o trfego flui constantemente, mesmo quando
em repouso, e regulado com cuidado por poros dotados de portes, bombas e canais que
pontilham a superfcie de uma clula como aqunios num morango.
As membranas celulares so feitas de molculas gordurosas chamadas fosfolipdios. Elas se
parecem com aqueles grampos fendidos usados para manter juntos maos de folhas de papel
perfuradas: tm uma cabea que atrai gua e duas pernas que a repelem. Em Harvard, o
trabalho de Jack Szostak est centrado no modo como a membrana celular se forma. Ele faz
experimentos com molculas simples, dotadas apenas de uma cauda, para ver como elas se
comportam e como poderiam nos ajudar a compreender a formao das primeiras clulas por
meio de comportamento auto-organizador. Quando Szostak mistura uma delicada combinao
dessas molculas gordurosas, elas fazem algo ao mesmo tempo notvel e no notvel: auto-
organizam-se numa pequenina bolha, mais ou menos do tamanho de uma clula bacteriana, com
1100 de milmetro de largura. Isso notvel para ns porque elas se parecem um pouco com
clulas que se formam espontaneamente a partir de substncias qumicas simples. E no
notvel porque elas fazem isso porque podem.6
Os cidos lipdicos tm uma cabea bulbosa e cauda em zigue-zague, e isso lhes confere
comportamento esquizofrnico. Os tomos na cabea esto arranjados de tal modo que gostam
de estar em contato com gua. As caudas so exatamente o oposto, repelem gua. Alm disso,
porm, as caudas atraem umas s outras. Assim, na soluo correta, uma soluo aquosa, elas se
acotovelam em duas linhas organizadas, as caudas viradas para dentro, as cabeas na gua. Na
concentrao certa, essa linha se expandir em todas as direes e se conectar para formar
uma esfera. A natureza dos cidos lipdicos tal que eles ficam quimicamente contentes quando
organizados nesse tipo de membrana. Assim que isso acontece, passa a haver um interior e o
resto das outras coisas.
As membranas celulares modernas so pontilhadas de bombas, canais, antenas e receptores
para assegurar um contato saudvel com o mundo extracelular. H caixas de correspondncia
biolgicas embutidas na membrana para receber sinais de input vindos das cercanias do corpo e
do ambiente local, e ncoras robustas conectam clulas vizinhas para manter o tecido unido.
Todas essas ferramentas das membranas mantm uma ordem viva dentro da clula e do
organismo. As membranas simples de Szostak esto a grande distncia dessa interface altamente
desenvolvida. Mas as primeiras clulas no teriam acesso a esse maquinrio complexo. Parte do
desafio de promover a auto-organizao espontnea est em comear com molculas simples e
desenvolver comportamentos mais complexos de baixo para cima. Szostak chama suas criaes
de protoclulas, e muitas das coisas que elas fazem se assemelham ao que as clulas fazem. Se
forem alimentadas, crescem e se dividem. Elas absorvem espontaneamente molculas
genticas, curtos fragmentos de coisas semelhantes a DNA. Quando o fazem, essa absoro
desencadeia crescimento e fisso. Se forem aquecidas e esfriadas, elas no s sobrevivem
intactas, mas o DNA em seu interior sofre um tipo de replicao que pode estimular crescimento
e diviso do todo.
Julga-se que no devia ser difcil encontrar essas molculas de fosfolipdio com cabea de
bolinha na Terra primitiva, no porque tenhamos vestgios delas, mas porque podem ser feitas
facilmente com diferentes receitas. Uma das mais impressionantes consiste em experimentos
que fulminaram fragmentos congelados semelhantes composio de cometas com luz
ultravioleta para imitar uma forja interestelar. Mas elas foram encontradas tambm em
meteoritos, e feitas com reaes muito mais limitadas Terra. No que diz respeito aos
ingredientes, h ampla suficincia, e elas constituem um bom candidato a primeira membrana.
Mas, como a origem da vida est na transio da qumica para a biologia, essas membranas
prototpicas precisam adquirir complexidade a partir de sua origem simples, auto-organizadora.
As membranas das clulas modernas precisam ser sofisticadas para evitar infiltrao. Um
fluxo livre de imigrao para uma clula pode causar toda espcie de perturbao e agitao; de
maneira semelhante, deixar que seus mais valiosos segredos e bens se derramem perigoso.
Assim, os postos de pesagem alfandegrios da membrana moderna presidem a uma cuidadosa
coordenao que expelir algumas molculas (para transportar mensagens ou como dejetos) e
deixar que as molculas certas entrem. No basta dizer que o sistema complexo que vemos
agora melhor que aquele que o precedeu. Para revelar a real transio, preciso mostrar por
que um prefervel ao outro. Na evoluo, as coisas nunca esto congeladas e raramente so
acidentais. Sendo assim, por que um sistema complexo suplantaria outro mais simples? Itay
Budin e Jack Szostak perguntaram isso experimentalmente s suas protoclulas. A resposta parece
vir daquele que o mais darwiniano dos conceitos: a competio.
Para que a seleo natural se manifeste, necessrio haver variao. Se todos fossem iguais,
no s tudo seria muito enfadonho, como tambm no haveria nenhuma base potencial para a
vantagem. O que essa variedade lhe permite levar a melhor sobre seus irmos, se voc tiver a
sorte de exibir uma vantagem competitiva. Poderia ser a luz do Sol, ou alimento, ou um parceiro,
mas sem competio no h mudana. Embora Darwin no tenha estudado a origem da vida,
exceto para especular ociosamente a respeito, vemos, e no pela primeira vez, um processo
darwiniano em ao em experimentos que com toda a certeza so anteriores vida. Portanto, a
variao acrescentada mistura estvel de protoclulas simples no experimento de Budin e
Szostak foi a adio de minsculas quantidades de fosfolipdios complexos mais parecidos com
aqueles presentes em clulas modernas. Eles se aninham na membrana e se acomodam muito
confortavelmente perto de seus colegas de cauda nica. Mas essas protoclulas crescem at ficar
16 maiores que suas irms simples. Assim, uma clula que adquiriu a capacidade de fazer esses
fosfolipdios ficaria imediatamente maior que outra que no a possusse. Alm disso, o tamanho
maior estimula a diviso da protoclula.
Os experimentos de Szostak, como ele prprio admite, esto muito longe de replicar a
formao espontnea de algo to sofisticado como a membrana celular contempornea. H toda
sorte de restries hiptese de que isso a recriao do que aconteceu da primeira vez. Os
fosfolipdios precisam ser feitos de alguma maneira, pois no so abundantes nem na terra nem
no cu da mesma maneira que seus primos de cauda nica. Isso requer ao menos a forma mais
bsica de metabolismo, a qual, numa bioqumica primitiva, poderia, especulativamente, ser
fornecida por mecanismos at agora no descobertos. Alm disso, as clulas vencedoras, com
suas modernas membranas de fosfolipdios, perdem a capacidade de deixar molculas entrarem
e sarem vontade. De modo que isso exige a emergncia dos canais e poros que fazem da
membrana celular moderna uma alfndega, e no um simples porto. As protoclulas so
espectros de clulas e fazem coisas semelhantes s feitas pelas clulas. A simplicidade de sua
formao um grande alvio para aqueles que acham muito problemtica a emergncia
espontnea de todas as facetas da vida celular. A conteno de processos vivos necessria, mas
no suficiente para permitir a vida tal como a conhecemos, embora esses experimentos sugiram
um caminho. Apesar disso, a formao espontnea de protoclulas numa placa um passo
simples, embora significativo, na recriao da gnese.
As protoclulas tambm imitam a diviso celular. Nos seres humanos, o processo de diviso
de uma clula uma manobra extremamente organizada e ativa, que requer energia metablica.
Alm de ter de ser copiado, o DNA deve ser arranjado para a diviso fsica, e a membrana
precisa crescer o suficiente para fazer duas clulas a partir de uma. As clulas modernas tm
uma rede de hastes internas e um andaime que ajudam a pr tudo no lugar certo a fim de que a
diviso ocorra de maneira uniforme. No incio da vida celular, presumivelmente, no havia
nenhuma arquitetura como essa. O trabalho de Szostak tambm demonstra que propriedades
fsicas foram a diviso celular, algo to simples quanto espremer as protoclulas atravs de um
filtro. Assim, mais uma vez, como no caso dos experimentos mostrando como as ribozimas
poderiam ter sido o cdigo original, a formao da membrana celular tornou-se muito menos
misteriosa graas a esses experimentos, que provam que algo sofisticado pode ter emergido
espontaneamente de algo mais simples.

guas quentes, profundas

Em clulas vivas, DNA e membranas a informao e o invlucro que sustentam a grande


descendncia da vida , tudo isso requer energia. A emergncia de membranas e do cdigo pode
ocorrer numa variedade de locais, caso haja as condies e os ingredientes corretos, mas, se
aceitarmos que, por sob essas qumicas, a vida um processo de captao de energia do
ambiente, exige-se um mundo real muito diferente como seu cenrio.
Numa bancada cinzenta no primeiro andar de um prdio em que Charles Darwin viveu
outrora, v-se um frasco de vidro. Ele tem mais ou menos o tamanho necessrio para conter
uma cabea humana. Est empoleirado sobre um trip de pernas muito abertas, e h um tubo de
borracha isolado com uma folha de estanho conectado sua base. Aqui, gua quase fervente
entra rapidamente. Do outro lado do frasco, gua fria entra atravs de dois bicos de vidro. A
pesada tampa de vidro mantida no lugar com pinos e uma grossa vedao de borracha.
Isso um biorreator. A palavra pode soar impressionante, mas ele mesmo muito antiquado,
como algo desenhado por Heath Robinson.a O prprio laboratrio, no apropriadamente chamado
Darwin Building, em Gower Street, no centro de Londres, tem uma legio de bilogos evolutivos
do University College London e uma tpica e ativa colmeia de biologia molecular, com
centrfugas de bancada, misturadores, mquinas e incontveis tubos minsculos de lquidos
incolores. O frasco do biorreator fica sobre seu trip, com fios, tubos e folha de estanho, o que o
faz parecer um tanto deslocado em meio ao elegante ambiente hi-tech.
O toque mgico o que est dentro do frasco. Algo mais ou menos do tamanho de um queijo
azul Stilton inteiro, um bloco que parece pedra cinzenta. Na verdade, trata-se de uma cermica
cuidadosamente projetada para espelhar os crescimentos minerais que se projetam fora de um
tipo recm-descoberto de fonte hidrotermal submarina. Ela parece algo entre uma esponja e
uma pedra-pomes. Na verdade, Nick Lane, do University College London, que projetou esse
equipamento, experimentou ambas, ao tentar gerar o fluxo certo em torno do material. Ao cozer
esse bloco de sofisticada espuma de cermica, as bolhas e os poros foram delicadamente
controlados para criar exatamente as condies certas que imitassem as borbulhantes fontes
submarinas que, segundo Lane acredita, so os melhores candidatos para o local de surgimento
da vida.
O nome vent, dado aos crescimentos minerais que se projetam sobre essas fontes, sugere
as chamins verticais vistas nas arrebatadoras imagens das torres instveis da Cidade Perdida nas
profundezas do macio Atlantis, a meio caminho entre as ilhas Canrias e as Bermudas. Imagens
e descries dessa metrpole submarina foram publicadas pela primeira vez no incio do sculo
XXI, um novo tipo de campo hidrotermal no leito do mar, fervilhando com a energia de reaes
entre as rochas do manto e a gua do mar. E, apesar do calor de at 90 e de guas
extremamente alcalinas, essas torres so cheias de vida, a tal ponto que a eminente cientista
Deborah Kelly, da Universidade de Washington, em Seattle, disse revista Nature, em 2001:
No se consegue nem ver as rochas, tal a quantidade de bactrias.
So esses vents, ou chamins, sempre cambiantes, por fora da contnua efervescncia da
Terra ativa sob elas, que a cermica de Nick Lane est modelando. As chamins emergem do
solo do mar quando as placas da Terra se deslocam e se fendem, revelando nova rocha virgem
quente puxada do manto. Uma vez expostas, elas reagem com a gua do mar, separando-a em
oxignio e hidrognio, e grande nmero de outros gases igualmente repletos de potencial
energtico, vidos por reagir. Ao faz-lo, esses gases infiltram-se atravs das rochas, perfurando
nelas uma estrutura alveolar, medida que elas se resfriam na gua do mar circundante, num
processo chamado serpentinizao. nessas pequeninas incubadoras que Nick Lane, Bill Martin,
Mike Russell (no Jet Propulsion Laboratory da Nasa no California Institute of Technology,
Caltech) e meia dezena de outros cientistas acham que os primeiros processos vitais ocorreram,
antes do RNA, do DNA e das membranas celulares. No laboratrio, o fluxo de gua e gases em
torno da cermica porosa no se d apenas de baixo para cima, mas circulando continuamente
para dentro e para fora de minsculos poros, exatamente como na Cidade Perdida.
A moeda energtica de uma clula moderna apresenta-se sob a forma de uma molcula
chamada ATP, que est constantemente sendo feita e reciclada, pois contm em suas ligaes
qumicas a energia que as clulas podem utilizar, a tal ponto que a cada dia voc far e usar seu
prprio peso corporal em ATP. O processo pelo qual isso acontece um complexo ciclo
metablico que se baseia na existncia de um gradiente de tomos de hidrognio eletricamente
carregados (prtons) atravs de uma membrana, mantendo-se um desequilbrio. Em nossas
clulas, essa gerao de energia ocorre nas mitocndrias as casas de fora da vida complexa
e em bactrias e arqueias, em membranas dentro de suas paredes celulares. Protenas especiais
nessas membranas agem como turbinas, e o fluxo de prtons atravs dessas turbinas resulta na
gerao de energia, a qual armazenada na ATP, que usada para energizar todos os processos
da clula. Esse ciclo to fundamental para tantos processos vitais que parece um bom candidato
a metabolismo mais elementar da vida, e portanto a um sistema subjacente a toda vida. Ele
depende simplesmente de haver mais prtons de um lado da membrana que de outro um
gradiente.
Foi por isso que Mike Russell props a ideia de que as fontes hidrotermais da Cidade Perdida
oferecem um modelo para a incubadora da primeira vida. Em razo das qualidades precisas das
substncias qumicas que borbulham das reaes entre as rochas e o mar, elas formam
gradientes naturais de prtons nos redemoinhos em volta das rochas alveolares. Em nossas
clulas, esse gradiente de prtons mantido por nossa bioqumica, e a manuteno desse
desequilbrio que nos impede de resvalar rumo deteriorao.
O importante no o calor dos vents: no usamos calor para gerar nossa energia, nem um
raio de luz, como no experimento de Stanley Miller. Ento, por que a primeira vida o faria? As
clulas captam energia qumica sob muitas formas, com caminhos metablicos quase
inescrutveis, mas tendo em seu cerne ATP produzida pelo fluxo de um gradiente de prtons.
Esses sistemas esto longe do equilbrio, e, tal como a vida, so uma contnua restrio ao
crescimento de entropia.
Em certo sentido, as fontes borbulhantes so uma mistura dos ingredientes certos, de tal
maneira que a biologia pode emergir da qumica. Mas isso est longe da gerao espontnea
numa sopa primordial. Nas fontes, so os gases em circulao que mantm o desequilbrio
termodinmico. Especificamente, prtons fluem em torno dos bolsos nas rochas para ser
concentrados no interior alcalino, longe do mar cido. Assim, l no fundo do oceano Atlntico, h
um biorreator borbulhante com um desequilbrio termodinmico de prtons em fluxo, impedindo
o equilbrio. As pepitas de metal que pontilham as rochas catalisam todo o processo, e as clulas
vazias da rocha porosa concentram os ingredientes nessa mistura que nunca repousa.
As fontes quentes so bem adequadas para ser o local da origem da vida, e o biorreator de
Nick Lane um dos pouqussimos experimentos a testar essa ideia. Ele est em curso, e no
momento em que escrevo os resultados so desconhecidos. Se for bem-sucedido, Lane espera
ver emergir reaes e substncias qumicas semelhantes ou iguais s que vemos em biologia.
Isso poderia sugerir um lugar para o nascimento de Luca.
Bill Martin leva o modelo ainda mais longe. Para ele, Luca no era de maneira alguma uma
clula de vida independente.7 Mesmo com uma rede densa entre as clulas isoladas que
povoaram a Terra por 2 bilhes de anos, Luca ainda figura como um ancestral comum tanto de
arqueias quanto de bactrias. Na verso de Martin, Luca foi um caldo de atividade, mas no uma
clula independente, como poderamos supor. As origens da vida no ocorreram dentro de uma
clula limitada por uma membrana. Na verdade, o ltimo ancestral comum dos dois mais antigos
domnios da vida estava trancado dentro da casca rochosa das chamins subaquticas alcalinas.
Ali, concentrada e protegida, mas alimentada e com um constante suprimento de tomos
carregados, reside a transio da qumica para a bioqumica, e depois para a vida. A ciso
evolutiva que arranca arqueias das bactrias ocorre depois que o mundo do RNA deu lugar ao
DNA, mas antes que as molculas gordurosas se arranjassem de modo a formar a membrana da
clula. Elas tm o mesmo cdigo gentico e ambas dependem de ribossomos como fbricas de
protenas. Nesses dois aspectos, elas so mais parecidas entre si do que com nossas clulas.
Contudo, nas arqueias, as ferramentas para escrever e copiar RNA uma protena chamada
RNA polimerase so mais parecidas com as nossas do que com as das bactrias. A casca mais
externa das arqueias, a parede da clula, diferente da parede celular bacteriana tpica, e a
membrana radicalmente diversa de qualquer outra coisa. Essas diferenas esto presentes em
espcies contemporneas, mas so fundamentais o bastante para ter razes que vo abaixo da
base do ndulo da rvore da vida. Segundo Martin, a primeira vida no foi abrigada em
membranas, mas em rocha.
O modelo de Martin comea com hidrognio, amonaco e sulfeto de hidrognio borbulhantes,
espumando em volta dos poros numa rocha serpentinizada. Esses bolsos mais parecem as
cmaras de cortia vazias que Robert Hooke viu com seu microscpio bem no incio desta
jornada no clulas tal como as conhecemos, mas clulas como as cavidades alveolares de
uma colmeia. O mar cido e o interior alcalino fornecem um gradiente de prtons natural para o
fluxo de energia que d incio a uma forma bsica de metabolismo, e ele contnuo enquanto a
chamin estiver ativa. Reaes bioqumicas simples que observamos em clulas modernas
passam a ocorrer nessa mistura energtica, e comeamos a ver aminocidos forjados nesse
tumulto. Em seguida vm outras biomolculas fundamentais, como acares, purina e anis de
pirimidina, e outras que vemos em ciclos metablicos. A purina e a pirimidina passam a se
fundir, tornando-se bases letras de cdigo gentico, talvez como nas snteses de John Sutherland.
Quando essas letras se associam, o mundo do RNA pode ter incio, s para afinal ser substitudo
pelo DNA, com seu processo superior de armazenamento de dados. Mas tudo isso ainda est
aprisionado nos labirintos tortuosos da rocha, os poros que concentram a ao bioqumica, e no
na diluio da poa morna de um caldo. Esse reator fechado o ltimo ancestral comum de
todos os seres vivos, restrito rocha, por enquanto, mas logo adquirindo a pele que lhe permitir
se libertar.
aqui que ocorre o primeiro grande cisma da vida. Dois conjuntos de molculas
desenvolvem-se para forrar o interior de cmaras rochosas separadas que contm essa
bioqumica transbordante. Um conduzir s bactrias; o outro, a todos os demais seres vivos. A
bioqumica que se desenvolveu nessas clulas compartilhada, mas de agora em diante,
medida que desenvolvem novos poderes, eles constroem diferentes tipos de membrana onde se
abrigar, e novas maneiras de manter a diferena energtica entre exterior e interior. Ali, colada
ao lado de uma rocha cheia de gs, no fundo do mar antigo, a vida celular tem incio.
Essa uma ideia. a plausvel descrio que Bill Martin prope para o modo como teria
ocorrido a gnese, com base no que sabemos sobre a vida simples, a qumica e a geologia das
chamins em fontes hidrotermais. impossvel impor uma escala de tempo a essa transio.
Grosso modo, temos uma janela de vrias centenas de milhes de anos, algum momento entre o
bombardeio pesado tardio que socou a Terra e as clulas fsseis que podemos ver atualmente,
com cerca de 3,6 bilhes de anos de idade. Chamins modernas alcalinas so bastante estveis,
mas raras. possvel que tenham abundado nos solos marinhos da caprichosa Terra jovem.
Reaes qumicas no tendem a ser muito lentas. Conceder 1 milho de anos para que duas
coisas reajam lhes d ampla oportunidade para no o fazer, para elas serem destrudas. Mas essa
escala de tempo fornece a oportunidade para que o experimento ocorra bilhes de vezes,
repetindo-se muitas e muitas vezes em bilhes de poros, com infinitas variveis testadas
reiteradamente. Essa uma conspirao do acaso possibilitada pelos simples nmeros em oferta.
Isso s precisa ter funcionado uma vez, o grande prmio da loteria qumica.
No podemos repetir a escala de tempo nem podemos experimentar nas prprias chamins.
Mas podemos model-las. por isso que o humilde biorreator de Nick Lane um experimento
to importante. Trata-se, tambm, de um experimento no mais puro sentido da palavra, pois
Lane no sabe mesmo o que vai resultar dele. Os poros foram semeados com sulfeto de ferro,
pirita, um catalisador que est presente nas chamins e pode acelerar a transduo de energia
que o incio do metabolismo. Assim como nas chamins, prtons brotam da base e circulam
atravs dos poros labirnticos. Cada um dos muitos processos biolgicos diferentes est sendo
testado individualmente, e os produtos so examinados. Lane est procurando os traos
caractersticos das molculas biolgicas as bases de RNA e suas partes componentes,
aminocidos que compem protenas e molculas que provm de metabolismo consumidor de
energia. O objetivo disso encontrar indcios de biologia construda sem enzimas. No momento
em que escrevo, essa simulao est apenas no comeo. A chave para o experimento ele estar
todo longe do equilbrio, tal como a vida e tal como as chamins. Ele no produzir clulas, mas
talvez venha a gerar, espontaneamente, traos caractersticos da qumica subjacente a todos os
processos vivos.
Ainda que seja difcil defini-la, certamente sabemos o que vida quando a vemos. Vida
fsica, qumica e biologia. Isso torna as tentativas de recriar suas origens uma cincia do
renascimento. E tambm a torna contenciosa, porque diferentes especialistas se aproximaro do
ngulo que mais faz sentido para eles. A busca de reconstruir a vida consiste em compreender
todas as coisas que ela faz e recri-las individualmente, a princpio, depois alinh-las aos poucos e
fundi-las. Muitas das peas esto sendo forjadas, todas com caractersticas diferentes, mas vitais:
energia, informao, reproduo, metabolismo, evoluo.
A jornada de qumica simples para qumica mais complexa e para bioqumica, da
informao simples para a gentica profunda e incompreensivelmente sofisticada, de simples
bolhas de sabo para alfndegas dinmicas de membranas, pode parecer improvvel. Certa vez,
o astrnomo e escritor Fred Hoy le descreveu assim a improbabilidade de animao na qumica:
A chance de que formas de vida mais elevadas poderiam ter emergido dessa maneira
comparvel probabilidade de que um tornado que varresse um ferro-velho pudesse montar um
Boeing 747 a partir dos materiais ali atirados. Ele continua, em termos tipicamente bombsticos,
dizendo que isso um completo absurdo. Ao escrever seu livro Evolution from Space, ele
calculou a probabilidade do surgimento espontneo das protenas de uma clula viva
extremamente bsica e chegou ao nmero zero seguido por 40 mil zeros.8 Hoy le, que acreditava
na panspermia, usou esse clculo para contestar a ideia de que a origem da vida tenha sido a
transio da qumica para a biologia nos limites da Terra. Esse um argumento falacioso e que
foi refutado muitas vezes. Os erros de Hoy le incluem a suposio de que as protenas modernas
foram as primeiras a existir. Ele d por certo que a tentativa de construir uma clula funcional foi
sequencial, e no simultnea. Talvez ele estivesse contemplando os vinte aminocidos que
emergiram da borra da famosa fermentao de Stanley Miller, todos presentes e corretos,
prontos para se encaixar numa entidade funcional, viva.
Mas, nos trabalhos de Jerry Joy ce, Jack Szostak, John Sutherland, Nick Lane, Mike Russell, Bill
Martin e outros, vemos agora que propriedades emergentes nada tm de improvveis, e so
muito menos misteriosas do que pensamos outrora. As condies da Terra-beb, testadas em
laboratrio, tornam a autocriao inevitvel.
Vemos RNA cuja origem sequncia aleatria desempenhando os papis de enzimas e genes
primordiais. Vemos bolsas semelhantes a clulas sendo geradas por nada mais que foras
atmicas. Realizamos experimentos para observar as marcas caractersticas do metabolismo
emergirem da efervescncia da qumica inanimada. medida que avanamos para um modelo
cada vez mais robusto de gnese, os mistrios da criao, outrora preenchidos por divindades,
inevitavelmente do lugar cincia. Pelo menos no laboratrio, vemos um prenncio do
processo que impeliu a difuso da vida durante 4 bilhes de anos. As ribozimas passam por uma
forma de seleo darwiniana, assim como a transio de membranas simples para complexas.
Isso no quer dizer que Darwin tivesse um miraculoso e presciente conhecimento da qumica de
cem anos aps sua morte. Mas acontece que o processo de seleo natural que descreveu pela
primeira vez mais poderoso do que ele mesmo teria imaginado. E enquanto este planeta vem
girando segundo a lei fixa da gravidade, como ele escreveu, aconteceu uma transio, impelida
pelo poder de um processo que iria um dia conduzir diretamente a voc. Enquanto continuamos a
explorar o mundo da clula, estamos a ponto de ver o incio dessa grande jornada da vida na
Terra, o nico planeta vivo de que temos conhecimento. E como foram humildes esses comeos.
Cada contrao muscular, cada respirao, cada pensamento, emoo e sensao que voc j
teve algum dia, at o sobressalto de dor ao sofrer um corte insignificante, comeou sua jornada
numa cmara microscpica no fundo do mar, 4 milhes de milnios atrs.

a Artista ingls que desenhava mquinas estranhas e complicadas que faziam coisas simples.
(N.T.)
Notas

1. Gerado, no criado

1. Digo pensamos porque ele tambm descreve ter visto glbulos no leite, e estes
provavelmente eram gotas de gordura suspensas.
2. Por exemplo, Aristteles declara que alguns peixes no so nem machos nem fmeas, e estes
so propensos gerao espontnea, diferentemente de seus confrades sexuados. Hoje
sabemos que todos os peixes so animais sexuados, a tal ponto que muitos, como os peixes-
palhaos e os labros, podem trocar de sexo quando seu ambiente o exige.
3. A noo de que os lemingues so suicidas igualmente fantstica, um mito derivado de
imagens de migrao em massa, provavelmente arranjadas de maneira artificial, no filme O
inferno branco, produzido pela Disney em 1958.
4. Como todo bilogo que trabalhou com eles sabe, a gestao do camundongo domstico
comum dura de fato em torno de trs semanas. Mais importante aqui, porm, o simples fato
de os camundongos serem sorrateiros, pequenos e famintos: onde houver cereal, voc os
encontrar.
5. Robert Brown mais famoso pelo movimento browniano, que descreve a trajetria
microscpica aleatria que partculas em gs ou soluo fazem quando bombardeadas por
tomos de molculas.
6. Embora Brown certamente o tenha batizado, o prmio pela primeira observao do ncleo
vai, mais uma vez, para nosso amigo holands Antonie van Leuwenhoek. Numa carta a
Robert Hooke datada de 1862, ele descreve corpos menores dentro das clulas vermelhas do
sangue de um peixe. Trata-se, sem dvida, de uma descrio incompleta, que nada sugere da
importncia subsequente do ncleo, mas um editor annimo moderno na Roy al Society, onde
essas cartas esto guardadas, rabiscou na margem: Descoberta do ncleo celular.
7. Observe-se que Virchow no era um mau sujeito, ainda que esta parea a ao de um rato
traioeiro. Ao longo de sua carreira, ele exerceu intensa atividade poltica, combateu a
injustia social e lutou pela reforma cvica na Alemanha e na Prssia com grande sucesso.
Segundo uma histria, suas ideias liberais irritaram a tal ponto o primeiro-ministro Otto von
Bismarck que ele desafiou Virchow para um duelo. Na condio de desafiado, Virchow teve o
direito de escolher as armas. Ele escolheu salsichas, uma cozida e a outra cheia de lombrigas.
Bismarck, o Chanceler de Ferro, que tinha medo de salsichas, recuou.
8. Para provar de maneira mais taxativa sua ideia de que os contaminantes estavam no ar, ele
repetiu isso em diferentes lugares, algumas vezes em salas empoeiradas, outras na relativa
esterilidade de oitocentos metros de altitude em Mont Blanc. Os resultados foram invariveis:
ar limpo, nenhuma proliferao.
Darwin foi finalmente instigado a publicar por outro bilogo explorador, Alfred Russell
9.
Wallace, que chegou efetivamente mesma ideia, e escreveu um livro descrevendo-a.
Darwin, um verdadeiro cavalheiro, sugeriu que ambos divulgassem sua ideia ao mesmo
tempo.
10. Graas ao fato de que Darwin era um anotador escrupuloso, tendo registrado praticamente
tudo o que viu e fez, sua importante vida foi documentada em meticulosos detalhes. Est em
curso um gigantesco projeto para digitar tudo que ele escreveu, garatujou, anotou e rabiscou,
e public-lo eletronicamente em The Complete Work of Charles Darwin Online. Ali voc
pode ler sobre tudo, de seu experimento, no qual tocava fagote para as minhocas, passando
pelo escorregador de madeira que ele construiu para a escada central em Down House para
divertir seus muitos filhos. Em decorrncia do fato que ele props o que talvez tenha sido uma
das melhores ideias que algum j teve, o corpus da literatura sobre a evoluo
merecidamente imenso e maravilhoso.
11. Ao longo dos anos, a ideia de Darwin realmente perturbou muita gente, apesar de ser, por
todas as razes, e de maneira vigorosa, evidente, demonstrvel e experimentalmente
verdadeira. A oposio a essa argumentao radical, mas completa, foi imediata e franca,
mas assim tambm foi o apoio. Que enorme estupidez no ter pensado nisso, disse Thomas
Huxley, o mais pugnaz dos defensores contemporneos de Darwin. um sentimento
lisonjeiro, mas ele mascara o meticuloso detalhe e o volume de trabalho que Darwin ps em
sua obra. Inversamente, a teoria celular parece no ter perturbado absolutamente ningum.
Ela foi observada, refinada e depois simplesmente permaneceu verdadeira. As leis da
seleo natural, as leis da gentica e o funcionamento do DNA (que sero abordados em
breve) so ensinados, apropriadamente, como pedras angulares absolutas da biologia. Mas os
princpios da teoria celular so apenas admitidos e considerados corretos. um lapso
estranho, mas do qual suponho que no deveramos nos queixar.

2. Rumo ao uno

1. Inversamente, embora Mendel mais tarde tenha se tornado abade, a histria no registra
quanto ele foi bom como monge.
2. Mendel realizou seus experimentos fundamentais num perodo de sete anos, entre 1856 e
1863, e em 1866 publicou-os numa revista paroquial de pouca importncia, Proceedings of
the Natural History Society in Brnn. Estudiosos mendelianos descobriram que 115 cpias do
artigo foram distribudas, e muitos escritores descreveram como uma delas chegou s mos
do prprio Darwin, tendo sido encontrada em sua biblioteca aps sua morte, em 1882. Mas, ,
a grande decepo em meio a tudo isso! As pginas desse manuscrito no haviam sido
cortadas. Darwin nunca sequer o abriu. Imagine a fuso dessas grandes ideias, os dois
grandes gnios biolgicos finalmente unindo seus trabalhos numa nica lei abrangente, o
modo e o mecanismo da herana Lamentavelmente, toda essa histria um mito do tipo
e se?. No havia nenhuma cpia do artigo de Mendel na biblioteca de Darwin, aberta ou
no. De fato, segundo os guardies de sua biblioteca, Darwin no tinha absolutamente
nenhuma obra publicada da autoria de Mendel em sua vasta coleo. No se sabe de onde
veio essa encantadora fico.
3. Embora tendamos a pensar no DNA como a elegante dupla-hlice em ao dentro das
clulas, ele muito dinmico, constantemente mudando de posio, torcendo-se, dividindo-
se, dobrando-se e remodelando-se medida que executa sua mirade de tarefas. Quando
extrado em laboratrios para experimento, o DNA parece um muco plido, fibroso.
4. A biologia est cheia de restries e excees, e nesse caso a exceo bem importante.
Durante o processo de produo de espermatozoides ou vulos, ocorre uma forma
ligeiramente diferente de diviso celular, chamada meiose. Esta resulta em clulas com
metade do material gentico total. H um retorno ao complemento completo quando
espermatozoide e vulo se encontram na concepo.
5. Quando isso foi descoberto, nos anos 1960, a expresso junk DNA, ou DNA lixo, foi
introduzida para indicar sua redundncia. Hoje, porm, est claro que grande parte dele est
longe de ser lixo; trata-se apenas de pedaos de DNA que no so genes, e atualmente
continuam inexplorados.
6. Aquela sequncia, do gene retinal Chx10, dobra-se na forma de um cabo que se fixa em
curtas extenses nicas de DNA e instrui a clula a ativar outro gene, mais ou menos como se
usa uma palavra num ndice para encontrar uma frase em particular.
7. Num mundo que comeou a rejeitar o dogma durante o Iluminismo, talvez seja uma pena
que esse processo crucial para todas as coisas vivas seja chamado assim. Foi Francis Crick
quem denominou isso dogma, e anos mais tarde lamentou que o sentido que quisera
emprestar a essa palavra talvez no fosse o mesmo que todos os demais lhe conferiam. Ao
longo dos anos, como ocorre com todas as regras e leis na cincia, ele foi refinado e
modificado, de modo que, embora permanea absolutamente verdadeiro, no to
dogmtico quanto seu apelido sugere. Seja como for, assim que chamado.
8. As convenes de nomenclatura que determinam se uma molcula quiral esquerda ou
direita so obscuras e no muito teis. Em geral, os aminocidos que ocorrem naturalmente
so chamados L-aminocidos, e eles fazem protenas canhotas.
9. Pasteur era francs e, portanto, imagino, muito interessado em vinho. Na verdade, ele
desenvolveu a tcnica que leva seu nome pasteurizao para esterilizar no apenas leite,
mas vinho tambm.
10. H um website dedicado a denunciar ilustraes de DNA cuja espiral est no sentido errado,
o Left-Handed DNA Hall of Shame, no qual lamento dizer que sou citado, juntamente com
a maioria das principais revistas e websites de cincia, para no mencionar jornais e muitos,
muitos anncios e filmes. H uma organizao cujo logotipo estampa o parafuso esquerdo
aliengena: a Astrobiology Society of Britain. Ela rene os pesquisadores cujo trabalho diz
respeito existncia de vida no resto do Universo. No se sabe se esse foi um erro de desenho
ou um jogo deliberado com o fato de que eles esto fundamentalmente interessados em
biologia sobrenatural. A meu ver, isso bastante engenhoso.
11. No so apenas os ossos fossilizados que nos contam o nosso passado. Os rastros fsseis so
tambm decisivos. As pegadas indicativas de postura ereta impressas em cinzas macias 3,4
milhes de anos atrs em Laetoli, na Tanznia, pelo Australopithecus afarensis, so evidncias
assombrosas de nosso singular modo de andar, mas a verdade que no sabemos, de fato, se
esses povos simiescos foram nossos ancestrais diretos. O registro fssil para a evoluo
humana terrivelmente irregular.
12. Um gene chamado Pax6, com o qual j trabalhei, um belo exemplo. Em seres humanos,
esse gene codifica uma protena que tem o papel de ditar que uma rea do crebro em
desenvolvimento ir amadurecer como olhos. Ele desempenha a mesma tarefa em
camundongos e peixes-zebras, cujas verses de Pax6 diferem por apenas quatro, entre cem
aminocidos, apesar de s terem um ancestral comum por volta de 400 milhes de anos
atrs. A conservao tal que, na amada drosfila dos pesquisadores genticos, Pax6
tambm especifica onde um olho se desenvolver, muito embora se trate de um olho de
mosca, no de mamfero
13. Foi precisamente esse comportamento que permitiu aos chamados supermicrbios tornarem-
se um problema to infeccioso em hospitais. Alguns anos depois da introduo da penicilina,
na dcada de 1940, foi descrita uma cepa no detectada anteriormente da bactria
Staphylococcus aureus que era resistente ao antibitico. Isso significa que, na presena da
droga de outro modo letal, apareceu uma mutao aleatria numa bactria que tornou a
penicilina ineficaz. Como bactrias reproduzem-se com alarmante rapidez, logo esse
micrbio imune penicilina havia se disseminado. Diante disso, inventamos a meticilina,
outro antibitico que ainda se provaria letal para os micrbios resistentes penicilina. Sabe o
que aconteceu? Alguns anos depois foram encontrados Staphylococcus aureus resistentes
metacilina (Sarm). A evoluo proporcionou o mecanismo para a sobrevivncia, e bactrias
o utilizam com tenaz vigor. Depois de desenvolver aleatoriamente resistncia a um antibitico,
uma bactria fica muito contente em compartilh-la no s com suas descendentes, mas com
suas vizinhas. Elas estendem uma tnue ponte, um pilus, que rene duas bactrias, e, atravs
de um minsculo poro, sees de DNA podem ser transferidas de doadora para receptora.
Isso acelera enormemente a difuso de um trao vantajoso. Significa que uma populao no
precisa esperar necessariamente que uma mutao resistente aleatria surja e seja
transmitida de me para cria. possvel que a resistncia j esteja disponvel, no utilizada, e
distribuda por toda a populao assim que ela exposta ao antibitico. Essa uma histria
conhecida: tentamos controlar um organismo, ele evolve para sobreviver. Para seres
humanos, fazer guerra contra bactrias uma empreitada audaciosa. Aqui, como em outros
lugares, ressoam as palavras do grande qumico Leslie Orgel: segundo sua chamada segunda
lei, a evoluo mais esperta do que ns.
14. E no pense que isso decidiu a questo. Uma equipe japonesa publicou uma resposta segundo
a qual essa anlise no suficiente para nos fazer rejeitar a ideia de mltiplas origens. Isso
no quer dizer que eles ou outros crticos estejam defendendo uma hiptese de mltiplas
origens, apenas que, a seu ver, esse estudo particular no prova suas prprias concluses.
Cientistas podem ser muito briges.

3. Inferno sobre a Terra

1. Pluto, outrora o nono, no mais considerado planeta na plena acepo da palavra, pois
um de vrios corpos de tamanho similar naquela rea do sistema solar.
2. A fonte da gua da Terra permanece controversa. A ausncia de uma atmosfera e sua
posio no espao, to perto do Sol, podem ter feito muita gua na Terra evaporar. Mas
possvel que as primeiras rochas que contriburam para formar este planeta contivessem gua
nas fissuras. Outra ideia que alguns cientistas defendem que a maior parte da gua na Terra
foi trazida em um ou vrios cometas congelados cuja carga til derreteu ao ser entregue.
3. Digo menos controversos porque alguns cientistas alegam que estromatlitos poderiam se
formar a partir de um processo no biolgico abiognese. Apesar disso, o consenso inclina-
se pesadamente a ver nessas rochas uma forte evidncia em favor de um mundo arqueano
apinhado de vida microbiana.
4. A letra de Darwin era extraordinariamente desmazelada, para dizer o mnimo, e a carta
original mal legvel.

4. O que vida?

1. Para um repertrio ainda mais reduzido de comportamentos animais, uma lista mais fcil de
lembrar, mas menos especfica, por vezes designada como os Quatro Fs: Feeding,
Fighting, Fleeing e Reproduction. (Comer, Lutar, Fugir e Reproduzir-se, havendo, claro,
um sinnimo muito conhecido, embora chulo, para esta ltima funo iniciado tambm com
a letra F.)
2. A palavra inanimado insatisfatria porque implica inao, quando certamente a qumica
no inativa. O oposto de vivo morto tambm no ajuda, pelas mesmas razes. No
morto parece uma maneira adequada de descrever o que mais corretamente chamado
qumica pr-bitica: efervescncia, reaes ativas que formam o caminho para a vida.
3. Eles j vm fazendo isso h algum tempo. Nos anos 1970, a Nasa enviou a Marte as misses
Viking, dois insetoides que colheram amostras da superfcie marciana em busca de traos
caractersticos da vida, e no encontraram nenhum. Em agosto de 2012, Curiosity, um rover
do tamanho de um Fusca, pousou graciosamente sobre a superfcie, tendo como um dos itens
de sua misso, at hoje em curso, arranhar as rochas vermelhas aqui e ali procura de traos
do que poderia ter sido outrora vida em Marte. o mais esquisito dos espetculos.
4. A pesquisa de Joy ce nessa rea absolutamente decisiva porque ele lida com as prprias
origens desse processo de descendncia com modificao. Trataremos dela no prximo
captulo.
5. Nenhum parentesco comigo.
6. Schrdinger mais conhecido por meter um gato imaginrio numa caixa e depois lev-lo
morte por envenenamento. Ou talvez no. Seu famoso experimento mental foi uma maneira
de explicar o efeito da observao sobre o mundo quntico e como ela poderia afetar o
mundo fsico clssico. O gato, invisvel nossa observao, seria morto pelo gs venenoso
que tem uma chance aleatria de ser liberado. Mas no h nenhum meio de saber se ele
morreu ou no at abrirmos a caixa. Segundo a fsica quntica, at esse momento o gato
ocupa paradoxalmente dois estados simultneos: vivo e morto, o que s poder ser decidido
por observao. Talvez menos abstrusa tenha sido a tentativa de Schrdinger se concentrar no
primeiro desses estados.
7. Nesse ponto, a entropia universal estar em seu mximo, e o Universo ter alcanado a
morte pelo calor. Mas por enquanto voc pode relaxar: isso levar muitos trilhes de anos
para acontecer.
8. Os gases do experimento de Miller provavelmente no eram aqueles presentes nos
primrdios da Terra: pensa-se agora que dixido de carbono inundava o cu, e nitrognio
tambm estava presente. Esta uma questo secundria aqui; nunca saberemos qual era a
composio exata da Terra primitiva.

5. A origem do cdigo

1. A estatstica muitas vezes citada de que geneticamente todos os seres humanos so 99,9%
similares relevante aqui. Isso significa que, se compararmos o DNA de dois indivduos, eles
diferem apenas por uma letra em mil. Mas, se voc levar em conta que h 3 bilhes de letras
de cdigo num genoma humano, isso faz 3 milhes de letras individuais diferentes (e no
inclui todas as formas de variaes diferentes, maiores, dentro de nossos cdigos). Esse um
grande nmero de variveis com que jogar e contribui muito para explicar por que somos
todos nicos, at os gmeos idnticos. A sequncia precisa de seu genoma nunca existiu antes
e nunca existir em outra pessoa. A humanidade est nos 99,9%, mas voc est criptografado
na opulncia do restante.
2. Uma descrio mais detalhada desse processo essencial feita na p.107 em O futuro da
vida, pois os cientistas comeam a subverter e reprojetar esse processo para criar protenas
novas, artificiais.
3. Obviamente, rpteis ovparos surgiram centenas de milhes de anos antes da evoluo de
qualquer ave, para no falar de Gallus domesticus, as humildes galinhas.
4. Por exemplo, a frase Mas DNA copiado de RNA estava crivado de erros traduzida em
islands pelo Google Translate como En DNA afrita fr RNA var riddled meo villa, e de
volta para o ingls como Mas cpia DNA de RNA estava crivada de erros, o que
deselegante mas de sentido muito aproximado. A repetio desse experimento com tcheco
resulta em Ale DNA zkoprovn z RNA byla prospikovan chybami e depois Mas RNA
copiado de DNA estava crivado de erros, o que exatamente o oposto do sentido original.
5. O RNA usa uracila como um substituto para timidina, que difere apenas pela presena de um
pequeno grupo de tomos chamado grupo metil, tambm usado como o diacrtico na
metilao de DNA.
6. Por exemplo, o que transporta oxignio por nossos corpos inteiros, e de fato o que torna o
sangue vermelho, a chamada hemoglobina, e ela composta a partir de quatro unidades de
protena chamadas globina, em torno de um tomo de ferro.
7. Palavra-valise que combina ribo- para RNA e -zima de enzima, protenas que catalisam
reaes biolgicas. Ela incomodamente parecida com a palavra ribossomo, que tem
propriedades semelhantes s das ribozimas, isto , RNA com funo.
Em 2003, pesquisadores na Universidade de Ply mouth testaram essa ideia num experimento
8.
de escala muito pequena. Deixaram mquinas de escrever com seis macacas durante um
ms e elas produziram cinco pginas consistindo principalmente na letra S. Mas, alm disso,
elas destruram as mquinas urinando e enfiando fezes no teclado.
9. A ribozima cabea de martelo encontrada em vrios vrus e organismos unicelulares. Seu
nome derivado do fato de que, quando a sequncia de RNA se dobra numa estrutura 3D, ela
tem uma cabea de forma quase igual de um martelo.
10. Citidina o nome para citosina ligada ao acar ribose, isto , o degrau ligado ao montante.
11. Este trabalho foi realizado quando Sutherland estava na Universidade de Manchester, ela
prpria uma fbrica de Prmios Nobel, ostentando mais de vinte premiados.
12. A sntese de Sutherland teve um desfecho. Eles descobriram que a projeo de luz ultravioleta
sobre a mistura tinha o duplo efeito de melhorar a produo de uracila e de dividir alguns dos
subprodutos. Na Terra, a luz UV provm do Sol, mais forte hoje do que quando o sistema
solar era jovem. Esta, claro, uma adio possvel reao arqueana, pois essas condies
estavam presentes na Terra jovem, mas torna a ideia mais centrada, pelo menos numa
localizao. Se isso realmente aconteceu, foi na superfcie da Terra.

6. Gnese

1. Mesmo a morte de difcil definio, pela mesma razo que a vida. Podemos apontar, para
eventos essenciais para a morte, aqueles que esto em oposio vida perda de respirao,
parada dos batimentos cardacos, cessao da atividade neural, o fim da conscincia.
Nenhum deles, porm, til para a maior parte das formas de vida, que no tem crebros,
coraes ou conscincia. Os mdicos usam uma lista de verificao para declarar a morte,
mas ela prpria um processo, no um sinal de pontuao no fim de uma vida.
2. O artigo de Crick e Orgel escrito em parte na linguagem formal dos artigos cientficos, mas
tambm divaga, especulando se o destino dos bioengenheiros extraterrestres era eles serem
fritos por sua estrela. Este no um termo que aparea com frequncia em revistas
cientficas. incomum ver cientistas to respeitados pontificar em pblico no que parece ser
a formalizao de uma adorvel conversa de bar: A psicologia das sociedades
extraterrestres, observam com sobrancelhas presumivelmente arqueadas, no est mais
bem-compreendida que a psicologia terrestre.
3. Muito ocasionalmente, um pedao de Marte pousa na Terra. A ltima vez foi em 2011,
quando um meteorito de sete quilos chamado Tissint pousou em Marrocos.
4. Como Carl Sagan o descreveu a partir de uma fotografia feita pela Voy ager em 1990, de
uma distncia de 6 bilhes de quilmetros. Hoje muitos pensam que a vida em outro lugar no
Universo estatisticamente inevitvel. De fato, o florescente campo da astrobiologia existe
para formalizar o estudo de se, como e onde a vida poderia existir fora da Terra.
5. Um artigo publicado na Science em 1996 sugeriu que as formas de depsitos minerais
microscpicos no meteorito Alan Hills (ALH 84001 nos anos 1990) eram de origem
biolgica. Supe-se que a rocha em questo tem cerca de 4 bilhes de anos e foi arremessada
da superfcie de Marte num impacto. Alguns pesquisadores sustentam que as bolinhas vistas
na superfcie do meteorito so produto de formas microscpicas de vida, mas o consenso
cientfico que eles so de origem geolgica. A anlise qumica da rocha mostra que os
aminocidos que ela contm so idnticos em natureza queles presentes no gelo antrtico
em que foi encontrada, sugerindo que essa foi a verdadeira fonte terrestre de molculas
biolgicas. A pesquisa prossegue.
6. Auto-organizao espontnea no algo to mgico quanto poderia parecer. Se voc comeu
Cheerios como seu cereal hoje no caf da manh, ter visto foras universais bsicas
conspirando para evocar organizao espontnea na sua tigela. Os anis de trigo querem
flutuar, porque sua densidade menor que a do leite. A gravidade os puxa para baixo, mas a
presso da coluna de lquido leitoso sob eles os empurra para cima. Se aps as primeiras
colheradas houver espao suficiente na superfcie, eles vo gingar automaticamente,
adotando um padro hexagonal, porque essa a formao que permite fora ascendente
distribuir-se de maneira uniforme.
7. Esta uma ideia heterodoxa de um homem que gosta de uma dose saudvel de agitao ou
propaganda (ou agitprop, no jargo marxista). Ele comea suas palestras sobre a origem da
vida derrubando a tigela de sopa. Observa que Haldane e Oparin, os fundadores
independentes do modelo sopista, eram ambos comunistas. Vindo de um texano (que hoje
vive na Alemanha), isso soa instantaneamente como argumento poltico. De fato, como ele se
apressa a ressaltar, significa que ambos eram materialistas dialticos, para os quais tinha de
haver uma explicao racional para tudo, desde o funcionamento da sociedade at as
necessidades do indivduo, passando pela origem da vida. E a teoria de [Haldane e] Oparin
tornou-se a doutrina do Partido.
8. Hoy le foi um brilhante cientista e autor, mas tinha tambm algo de iconoclasta, tendendo a
rejeitar com veemncia ideias convencionais. Ele contestou que a origem do Universo
estivesse no big bang, concepo cientfica esmagadoramente consensual.
Referncias bibliogrficas e sugestes de leitura

Desfrutamos o luxo de viver num tempo em que os mecanismos bsicos da vida so amplamente
compreendidos, e j se escreveram muitos livros excelentes sobre a evoluo e a gentica. Entre
os recentes, meus favoritos incluem Life Ascending, de Nick Lane (Profile Books, 2010), Why
Evolution is True, de Jerry Coy ne (Oxford University Press, 2010), Your Inner Fish, de Neil
Shubin (Penguin, 2009), muitos dos livros de Matt Ridley e quase tudo que Steve Jones escreveu,
em particular The Language of the Genes (HarperCollins, 1993, que, apesar de escrito vinte anos
atrs, e, ressalte-se, dez anos antes que o Projeto Genoma Humano fosse publicado pela primeira
vez, encerra perspiccia e histrias to boas quanto qualquer livro contemporneo sobre a
natureza do DNA) e Almost Like a Whale (Black Swan, 2000), que consegue atualizar A origem
das espcies com biologia evolucionista contempornea. E, claro, ler qualquer coisa escrita por
Charles Darwin far de voc uma pessoa mais inteligente. Suas obras so mais importantes para
nossa cultura que qualquer coisa escrita por qualquer outro escritor.

1. Gerado, no criado

Como ocorre em toda a cincia, os caminhos que levam a grandes descobertas so complexos,
tortuosos e sinuosos, e quase sempre desprovidos de grandes revelaes sbitas. A estrada que
levou de Van Leuwenhoek teoria celular no diferente, com dezenas de homens fazendo
pequenos e gradativos avanos experimentais e conceituais. Resumi a narrativa de apenas alguns
dos principais atores. Para uma histria completa e acadmica dos primeiros microscopistas, o
livro de sir Henry Harris, The Birth of the Cell (Yale University Press, 2000), o guia definitivo,
em que baseei muitas sees da histria da teoria celular.
Animalia, obra escrita por Aristteles em 350 a.C. e traduzida para o ingls por DArcy
Wentworth Thompson em 1910, absolutamente clara e est gratuitamente disponvel on-line
em: http://classics.mit.edu/Aristotle/history _anim.html.

2. Rumo ao uno

Muito se escreveu sobre Gregor Mendel, como condiz com um grande cientista, e aqui est o
artigo original em que ele delineia o que se tornariam as leis da herana: G. Mendel, Versuche
ber Pflanzen-hy briden, Verhandlungen des Naturforschenden Vereines, n.4, Abh. Brnn, 1866,
p.3-47, ou em traduo para o ingls: Experiments in plant hy bridization, Journal of the Royal
Horticultural Society, n.26 1901, p.1-32.
O fato de ter havido 115 cpias desse artigo, nenhuma das quais chegou biblioteca de
Darwin, est documentado aqui: R.C. Olby, Mendels Vorlafer: Klreuter, Wichura, und
Grtner, Folia Mendeliana, n.21, 1986, p.49-67.
Um ponto de interesse mendeliano reside na nova anlise de seus dados por Ronald Fisher, um
dos fundadores da biologia evolucionista moderna (juntamente com J.B.S. Haldane, com quem,
segundo me contaram, ele no suportava ficar na mesma sala, e Sewall Wright). Fisher concluiu
que a significao estatstica dos resultados de Mendel evidenciava que os experimentos deviam
ter sido falsificados de modo a concordar estritamente com as expectativas de Mendel. Ele no
estava alegando que as leis eram incorretas, apenas que os resultados eram precisos o bastante
para sugerir maquiagem. Desde ento, isso foi repetido muitas vezes, mas o seguinte artigo de
autoria dos geneticistas Daniel Hartl e Daniel Fairbanks conclui que essa alegao pode ser
contestada, porque, a uma anlise mais atenta, ela provou no se sustentar em evidncias
convincentes: Daniel L. Hartl e Daniel J. Fairbanks, Mud sticks: on the alleged falsification of
Mendels data, Genetics, v.175, n.3, mar 2007, p.975-9.
A histria da biologia do sculo XX e de fato da cincia orbita em torno do que
provavelmente o avano cientfico mais importante do sculo a publicao sobre a dupla-
hlice, por Crick e Watson. Para mais sobre a histria do DNA, h muitos livros disponveis. O
relato do prprio James Watson, A dupla hlice, uma leitura absorvente (editado no Brasil pela
Zahar, 2014), embora seja claramente um relato pessoal da autoria de um fabuloso contador de
histrias, que exibe, a meu ver, as marcas caractersticas da fabricao do mito. O tratamento
que ele d a Rosalind Franklin nesse livro horrvel. O papel de Rosalind na histria do DNA
frequentemente debatido, muitas vezes com a questo: Deveria ela ter recebido o Prmio Nobel
juntamente com Crick e Watson? H uma resposta simples e absoluta para isso, que no:
segundo as regras dos Prmios Nobel, eles no devem ser conferidos postumamente, e Rosalind
Franklin estava prematuramente morta quando o DNA foi reconhecido pelo comit premiador
em 1962. A biografia escrita por Brenda Maddox, Rosalind Franklin: The Dark Lady of DNA
(HarperCollins, 2003), emocionante, abrangente e honesta, retratando Rosalind sob uma luz
crvel e nem sempre lisonjeira. um livro maravilhoso.
Francis Crick, como convm a um gnio, aparece em vrias diferentes sees deste livro, pois
ele continuou a explorar a natureza da vida depois de Watson e sua grande descoberta de 1953.
No h descrio melhor de sua vida e suas obras que o livro de Matt Ridley, Francis Crick:
Discoverer of the Genetic Code (HarperCollins, 2011).
A dramatizao pela BBC da histria do DNA chamada Life Story (1987), e pode ser assistida
com muito agrado. Ela estrelada pelo ator favorito de Holly wood para encarnar um cientista
visionrio e excntrico, Jeff Goldblum, no papel do cientista visionrio e excntrico Jim Watson.
Goldblum, diga-se de passagem, fez tambm papel de neurocirurgio (As aventuras de Buckaroo
Banzai, 1984), fsico das partculas (A mosca, 1986), matemtico (O parque dos dinossauros,
1993), cientista computacional e ambientalista (Independence Day, 1996), bilogo marinho (A
vida marinha com Steve Zissou, 2004) e imunologista canino (Como ces e gatos, 2001). Algum
outro ator pode exibir semelhante rosrio de cientistas?
Queremos sugerir uma estrutura para o sal de cido desoxirribonucleico [DNA, na sigla em
ingls]. Essa estrutura tem traos originais de considervel interesse biolgico. Assim comea o
provavelmente mais famoso e importante artigo de pesquisa do sculo XX: J.D. Watson e F.H.C.
Crick, A structure for deoxy ribose nucleic acid, Nature, n.171, 25 abr 1953, p.737-8; disponvel
em: www.nature.com/nature/dna50/archive.html, juntamente com vrios outros artigos capitais
da autoria de tits da biologia dessa idade do ouro, entre os quais: O.T. Avery, C.M. MacLeod e M.
McCarty, Studies on the chemical nature of the substance inducing transformation of
pneumococcal ty pes, Journal of Experimental Medicine, n.79, 1944, p.137-59.
A lngua a metfora mais til e mais frequentemente usada para compreender e explicar o
funcionamento do DNA. A lngua tambm compartilha com ele muitas caractersticas evolutivas,
como explicado na reviso escrita pelo bilogo Mark Pagel: Human language as a culturally
transmitted replicator, Nature Reviews Genetics, n.10, 2009, p.405-15 (doi: 10.1038/nrg2560). E,
para um delicioso passeio no cientfico atravs da evoluo das palavras e da lngua, sugiro o
livro de Guy Deutscher, The Unfolding of Language: The Evolution of Mankinds Greatest
Invention (Arrow, 2006).
Para a anlise estatstica da existncia de Luca por Douglas Theobald, ver: Douglas L.
Theobald, A formal test of the theory of universal common ancestry , Nature, n.465, 13 mai
2010, p.219-22 (doi:10.1038/nature09014); e para uma refutao: Takahiro Yonezawa e Masami
Hasegawa, Was the universal common ancestry proved?, Nature, n.468, E9, 16 dez 2010,
p.219-22 (doi:10.1038/nature09482).
Laurence D. Hurst e Alexa R. Merchant, High guanine-cy tosine content is not an adaptation
to high temperature: a comparative analy sis amongst prokary otes, Proceedings of the Royal
Society B n.268, 2001, p.493-7 (doi:10.1098/rspb.2000.1397).
Sobre alguns dos mais antigos fsseis de clulas, David Wacey et al., Microfossils of sulphur-
metabolizing cells in 3.4-billion-y ear-old rocks of Western Australia, Nature Geoscience, n.4,
2011, p.698-702 (doi:10.1038/ngeo1238).
H muitos artigos sobre bactrias e arqueias trocando genes em vez de herd-los de seus pais
celulares. Um dos mais bem-delineados : V. Kunin et al., The net of life: reconstructing the
microbial phy logenetic network, Genome Research, n.15, 2005, p.954-9, que apresenta um
diagrama necessariamente desconcertante da emaranhada ribanceira da base da rvore da vida.
New Scientist, revista que pode se orgulhar de sua histria, decidiu focalizar a ateno exatamente
nesse assunto por ocasio do aniversrio de duzentos anos do nascimento de Darwin, em 2009. A
atrevida chamada de capa foi Darwin estava errado, embora os artigos dentro da revista
fossem mais nuanados em relao ao assunto da transferncia de genes lateral ou horizontal.
Eles explicaram num editorial que os acompanhou:

Quando celebramos o 200 aniversrio de nascimento de Darwin, aguardamos uma terceira


revoluo que vir transformar e fortalecer a biologia. Nada disso dever ser til para
criacionistas, cujo limitado universo j deve estar alvoroado com a notcia de que a New
Scientist anunciou que Darwin estava errado. Espere encontrar excertos tirados do contexto
e apresentados como prova de que os bilogos esto desertando em massa da teoria da
evoluo. Eles no esto.

Em sete ocasies diferentes, essa capa me foi mostrada (ou algum a mencionou) em
reunies como parte de ataques movidos por grupos religiosos especficos que optam por ignorar
as evidncias e afirmar a doutrina criacionista.
3. Inferno sobre a Terra

Veja o livro-texto clssico de Euan Nisbet sobre os dois primeiros bilhes de anos em nosso
planeta: E.G. Nisbet, The Young Earth: An Introduction to Archean Geology (Allen and Unwin,
1987).
Um estudo que sugere que cometas trouxeram gua para a Terra e a Lua : James P.
Greenwood et al., Hy drogen isotope ratios in lunar rocks indicate delivery of cometary water to
the Moon, Nature Geoscience, n.4, 2011, p.79-82 (doi:10.1038/ngeo1050).
Um interessante modelo sugerindo que vida microbiana poderia ter sobrevivido sob as guas
intensa artilharia do bombardeio pesado tardio pode ser encontrado em: Oleg Abramov e Stephen
J. Mojzsis, Microbial habitability of the hadean Earth during the Late Heavy Bombardment,
Nature, n.459, 21 mai 2009, p.419-22 (doi:10.1038/nature08015); Ly nn J. Rothschild, Earth
science: life battered but unbowed, Nature, n.459, 21 mar 2009, p.335-6 (doi:10.1038/459335a).
Simon A. Wilde et al., Evidence from detrital zircons for the existence of continental crust
and oceans on the Earth 4.4 Gy r Ago, Nature, n.409, 11 jan 2001, p.175-8
(doi:10.1038/35051550).
Um dos estudos essenciais que mostraram que a Lua foi violentamente arrancada da Terra
muito jovem pelo impacto de outro grande corpo celeste, Teia, o tit do mito grego antigo que
deu origem deusa da Lua, Selene, : U. Wiechert et al., Oxy gen isotopes and the Moon-
forming giant impact, Science, n.294, 12 out 2001, p.345-8 (doi:10.1126/science.1063037).
Sobre a letra de Darwin: como parte da filmagem de The Cell pela BBC4, tive o grande
privilgio de segurar em minhas mos a carta enviada por Darwin a Joseph Hooker em 1871, na
qual ele pondera sobre sua hoje famosa lagoazinha morna. De p numa sala de leitura da
Biblioteca da Universidade de Cambridge, li um extrato desse inestimvel pedao de histria.
Mas, depois de vrias tomadas arruinadas porque eu no conseguia decifrar suas garatujas,
acabamos introduzindo uma transcrio impressa sobre a carta verdadeira. Evidentemente, de
todo irrelevante que sua letra fosse to horrorosa, mas isso me parece muito divertido.
J.B.S. (Jack) Haldane uma das figuras dominantes da biologia do sculo XX, em muitas de
suas formas, e um sujeito verdadeiramente fascinante. No s ele refletiu sobre a origem e a
natureza da vida e das espcies, como foi tambm uma figura central na fuso da gentica com
a biologia evolutiva e em muitos outros aspectos fundamentais do mundo vivo, e foi
provavelmente a primeira pessoa a sugerir o hidrognio como base para energia renovvel (em
1923). Marxista, ele criticou com veemncia o papel do governo britnico na crise de Suez em
1956. Seu ensaio clssico On being the right size est gratuitamente disponvel online, assim
como um filme muito curioso apresentado por ele (produzido pela Agncia Sovitica de Cinema,
1940), intitulado Experiments in the Revival of Organisms, que exibe as reaes fsicas pstumas
da cabea cortada de um co. Sua biografia definitiva, escrita por Ronald Clark, The Life and
Works of J.B.S. Haldane (1968), infelizmente est fora do prelo hoje.
Esse o experimento icnico feito por Stanley Miller em 1953: A production of amino acids
under possible primitive Earth conditions, Science, n.117, 15 mai 1953, p.528-9
(doi:10.1126/science.117.3046.528).
E a anlise feita por Jeffrey Bada, em 2008, de alguns dos experimentos de Miller: Adam P.
Johnson et al., The Miller volcanic spark discharge experiment, Science, n.322, 17 out 2008,
p.404 (doi:10.1126/science.1161527).

4. O que vida?

Uma boa leitura sobre a acumulao e o armazenamento de informao e herana em


molculas : G.F. Joy ce, Bit by bit: the darwinian basis of life, PLoS Biology, n.10, 2012
(e1001323.doi:10.1371/).
Sobre vrias definies de vida: Pier Luigi Luisi, Origins of Life and Evolution of the Biosphere,
n.28, 1998, p.613-22.
A metadefinio de Edward Trifonov baseada nas palavras usadas por cientistas. Dezenove
rplicas podem ser encontradas na edio de fevereiro de 2012 da mesma revista: Edward N.
Trifonov, Vocabulary of definitions of life suggests a definition, Journal of Biomolecular
Structure and Dynamics, n.29, 2011, p.259-66.
Os folhetos de Erwin Schrdinger e de J.B.S. Haldane, intitulados What is life? (1944 e 1949,
respectivamente), esto disponveis on-line gratuitamente, e ambos constituem leitura essencial.

5. A origem do cdigo

Kevin Leu et al., On the prebiotic evolutionary advantage of transfering genetic information
from RNA to DNA, Nucleic Acids Research, n.39, 2011, p.8135-47 (doi:10.1093/nar/gkr525).
Sobre as molculas curtas de RNA de Jerry Joy ce e Tracey Lincoln que tm o efeito de se
reproduzir interminavelmente: Tracey A. Lincoln e Gerald F. Joy ce, Self-sustained replication
of an RNA enzy me, Science, n.32, 27 fev 2009, p.1229-32 (doi:10.1126/science.1167856).
Sobre o experimento clssico sobre o ribozima de Jack Szostak e David Bartel: D.P. Bartel e
J.W. Szostak, Isolation of new ribozy mes from a large pool of random sequences, Science,
n.261, 10 set 1993, p.1411-8.
David Adam, Give six monkey s a computer, and what do y ou get? Certainly not the bard,
Guardian, 9 mai 2003.
Sobre a ideia de uma ribozima ser o ancestral mais distante, inspirada pelo blog Tales from the
Nobel Factory, escrito por Alex Tay lor: embora eu tenha escolhido uma ribozima diferente como
ancestral aborgene conceitual, estou muito grato a ele por esse e outros auxlios que me prestou,
embora no sua incapacidade de compreender o que um substantivo coletivo:
http://talesfromthenobelfactory.posterous.com/; Aniela Wochner et al., Ribozy me-cataly zed
transcription of an active ribozy me, Science, n.332, 8 abr 2011, p.209-12
(doi:10.1126/science.1200752).
Trs artigos sobre a origem do cdigo gentico com menos que as quatro bases que a vida
moderna apresenta: Jeff Rogers e Gerald F. Joy ce, A ribozy me that lacks cy tidine, Nature,
n.402, 18 nov 1999, p.323-5 (doi:10.1038/46335); John S. Reader e Gerald F. Joy ce, A ribozy me
composed of only two different nucleotides, Nature, n.420, 19 dez 2002, p.841-4
(doi:10.1038/nature01185); Julia Derr et al., Prebiotically plausible mechanisms increase
compositional diversity of nucleic acid sequences, Nucleic Acids Research, 2012
(doi:10.1093/nar/gks065).
A clssica sntese de uracila por John Sutherland: Matthew W. Powner, Batrice Gerland e
John D. Sutherland, Sy nthesis of activated py rimidine ribonucleotides in prebiotically plausible
conditions, Nature, n.459, 14 maio 2009, p.239-42 (doi:10.1038/nature08013).
Sobre uracila vinda do espao: Zita Martins et al. Extraterrestrial nucleobases in the
Murchison meteorite, Earth and Planetary Science Letters, n.270, 2008, p.130-6.

6. Gnese

Sobre a acumulao de cultura humana: Adam Powell, Stephen Shennan e Mark G. Thomas,
Late pleistocene demography and the appearance of modern human behavior, Science, n.324,
5 jun 2009, p.1298-301 (doi:10.1126/science.1170165).
Sobre a competio na formao da membrana celular: Itay Budin e Jack W. Szostak,
Phy sical effects underly ing the transition from primitive to modern cell membranes, PNAS,
2011 (doi:10.1073/pnas.1100498108).
O modelo da protoclula de Jack Szostak domina os estudos sobre a emergncia da
membrana. Outras ideias e experimentos sugeriram rotas diferentes. Um recente, de Stephen
Mann, Shoga Koga e colegas da Universidade de Bristol, sugere microgotculas cheias de
nucleotdios e cadeias de aminocidos de modo que elas se compartimentalizam sem uma pele
fsica. Esperamos o desenvolvimento dessa ideia. Shogo Koga et al., Peptide-nucleotide
microdroplets as a step towards a membrane-free protocell model, Nature Chemistry, n.3, 2011,
p.720-4 (doi:10.1038/nchem.1110).
Aqui est um interessante estudo de 2011 que mostra replicao de DNA dentro de
protoclulas autorreprodutoras e compartilhamento do DNA entre as clulas-filhas. Embora
claramente no seja o mesmo que nas clulas modernas, o processo imita o resultado de diviso
celular real: K. Kurihara et al., Self-reproduction of supramolecular giant vesicles combined
with the amplification of encapsulated DNA, Nature Chemistry, n.3, 2011, p.775-81
(doi:10.1038/nchem.1127).
Leslie E. Orgel, Prebiotic chemistry and the origin of the RNA world, Critical Reviews in
Biochemistry and Molecular Biology, n.39, 2004, p.99-123 (doi:10.1080/10409230490460765).
Jack W. Szostak, David P. Bartel e P. Luigi Luisi, Sy nthesizing life, Nature, n.409, 18 jan
2001, p.387-90 (doi:10.1038/35053176).
A primeira descrio das fontes hidrotermais da Cidade Perdida: D.S. Kelly et al., An off-
axis hy drothermal-vent field near the mid-Atlantic ridge at 30 N, Nature, n.412, 12 jul 2001,
p.145-9.
H um punhado de artigos e revises escritos por Nick Lane, Mike Russell, Bill Martin e outros
sobre gradientes de prtons e a origem energtica da vida em fontes hidrotermais. Aqui esto
alguns dos melhores: N. Lane e W. Martin, The origin of membrane bioenergetics, Cell, n.151,
2012, p.1406-16; W. Martin, Hy drogen, metals, bifurcating electrons, and proton gradients: the
early evolution of biological energy conservation, FEBS Letters, n.586, 2012, p.485-93; M.J.
Russell (org.), Origins, Abiogenesis and the Search for Life (Cosmology Science Publishers, 2011);
N. Lane, J.F. Allen e W. Martin, How did LUCA make a living? Chemiosmosis in the origin of
life, Bioessays, n.32, 2010, p.271-80; W. Martin, J. Baross, D. Kelley, M.J. Russell,
Hy drothermal vents and the origin of life, Nature Reviews, Microbiology, n.6, 2008, p.806-14;
W. Martin e M.J. Russell, On the origin of biochemistry at an alkaline hy drothermal vent,
Philosophical Transactions, Royal Society of London (Ser. B), n.362, 2007, p.1887-925; e este um
perfil de Mike Russell e sua pesquisa: John Whitfield, Origin of life: nascence man, Nature,
n.459, 2009, p.316-9 (doi:10.1038/459316a).
Se voc conseguir encontrar esse artigo, ele cmico: Crick e Orgel ponderando sobre as
origens da vida na Terra: F.H.C. Crick e L.E. Orgel, Directed panspermia, Icarus, n.19, 1973,
p.341-6.
As ideias interessantes, mas erradas, de sir Fred Hoy le e Chandra Wickramasinghe sobre
panspermia: Evolution from Space: A Theory fo Cosmic Creationism (Touchstone, 1984).
ndice remissivo

cido tartrico, 1-2


Adam, Douglas, 1
gua, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10-11
Alan Hills, meteorito de, 1n.5
aminocidos, 1, 2-3, 4, 5, 6, 7, 8-9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19n.8
canhotos, 1, 2
amonaco, 1, 2, 3, 4
anemia da clula falciforme, 1
Apollo, programa, 1-2
Aristteles, 1
arqueana, Terra, 1, 2, 3, 4, 5, 6n.12
arqueias, 1, 2, 3, 4, 5, 6-7, 8, 9-10
rvore da vida, 1, 2, 3-4, 5, 6
astrobiologia, 1, 2
tomos, 1, 2-3
carbono, 1, 2
prtons, 1, 2, 3-4, 5, 6
ATP, molcula de, 1
auto-organizao espontnea, 1, 2n.6
Avery, Oswald, 1

bactrias, 1, 2, 3-4, 5, 6, 7, 8, 9, 10-11, 12, 13, 14


Bada, Jeffrey, 1, 2
Bartel, David, 1-2
biorreator, University College London, 1-2, 3
Bismarck, Otto von, 1n.7
bombardeio pesado tardio, 1, 2-3, 4, 5
bson de Higgs, partcula, 1
Brenner, Sy dney, 1
Brown, Robert, 1-2
Budin, Itay, 1
caos, 1, 2
carbono, 1, 2, 3, 4, 5
clulas do sangue:
brancas, 1
vermelhas, 1, 2, 3, 4, 5-6, 7, 8
clulas, 1-2, 3-4, 5
bacterianas, 1; ver tambm bactrias
clulas da pele, 1
e a comunalidade da vida, 1-2
conteno, 1-2
curando um corte, 1-2, 3, 4
diviso, 1, 2, 3, 4, 5, 6, 7, 8
e energia, 1, 2-3
e sexo, 1, 2, 3, 4, 5-6
fibroblastos, 1
membranas, 1, 2, 3-4, 5-6, 7, 8
metabolismo da ver metabolismo
mudana ao longo do tempo, 1-2
msculo, 1, 2, 3
nervosa, 1
neutrfilos, 1
ncleo, 1-2, 3
nmeros de, 1
organismos unicelulares, 1-2, 3, 4n.9
origem, 1-2
plaqueta, 1, 2
replicao de ver replicao
sangue ver clulas do sangue
teoria celular, 1-2, 3-4
Cern, Grande Colisor de Hdrons do, 1
Chen, Irene, 1
Chicxulub, meteorito de, 1, 2
Crick, Francis, 1-2, 3, 4, 5, 6-7, 8-9, 10n.7
cromossomos, 1-2, 3

Darwin, Charles, 1-2, 3-4, 5-6, 7, 8, 9n.9


dextralidade da vida, 1-2
difrao de raios X, 1
dixido de carbono, 1, 2, 3n.8
DNA, 1, 2-3, 4, 5-6, 7, 8, 9, 10, 11-12, 13-14, 15, 16, 17-18n.13
dextralidade, 1
e a singularidade da vida, 1-2
e redundncia, 1, 2
origem do cdigo, 1-2
polimerases, 1
replicao, 1-2, 3, 4, 5, 6
dogma central, 1, 2
Dumortier, Barthlemy, 1

energia, 1, 2-3, 4, 5, 6-7


e a natureza da vida, 1-2
e replicao, 1, 2
entropia, 1-2, 3-4, 5
enzimas, 1, 2
espermatozoide, 1, 2, 3
eucariotos, 1
evoluo cultural, 1-2

fibroblastos, 1
filogentica, 1, 2
fsica, 1-2
fontes hidrotermais, 1, 2-3
fosfolipdios, 1-2
Franklin, Rosalind, 1-2

gentica, 1, 2-3, 4
DNA e ver DNA
doena, 1
ribozimas, 1-2, 3, 4
RNA e ver RNA
geologia, 1-2, 3
lunar, 1-2
gerao espontnea, 1-2, 3, 4-5
glicina, 1
Gosling, Ray mond, 1-2
Grande Colisor de Hdrons, 1
Griffith, Frederick, 1
Guilherme III da Inglaterra, 1

hadeana, Terra, 1, 2-3


Haeckel, Ernst, 1
Haldane, J.B.S., 1-2, 3, 4
Helmont, Jean Baptiste van, 1
hidrognio, 1, 2, 3
prtons, 1, 2, 3-4, 5, 6
hidrotermais, fontes, 1, 2-3
Holliger, Philipp, 1
Hooke, Robert, 1, 2, 3
Hooker, Joseph, 1
Hoy le, Fred, 1-2, 3
Huxley, Thomas, 1

Joy ce, Jerry, 1, 2-3, 4, 5, 6, 7, 8

Kelly, Deborah, 1

Lane, Nick, 1, 2, 3, 4-5, 6


lateralidade molecular/qumica, 1-2
Leuwenhoek, Antonie van, 1-2, 3-4
Lincoln, Tracey, 1
Lua, 1-2
Luca ver ltimo Ancestral Comum Universal

MacLeod, Colin, 1
macrfago, 1
Margulis, Ly nn, 1
Martin, Bill, 1, 2, 3, 4-5, 6
Martins, Zita, 1
Matthaei Heinrich, 1
McCarty, Macly n, 1
Mendel, Joseph Gregor, 1-2, 3
metabolismo, 1, 2, 3, 4, 5-6, 7, 8, 9, 10, 11, 12-13, 14
metano, 1, 2, 3
meteoros/meteoritos, 1, 2-3, 4, 5, 6, 7n.5
microscopia, 1-2, 3
Miller, Stanley, 1-2, 3, 4-5
mitocndria, 1-2, 3, 4, 5
Morgan, Thomas Hunt, 1
morte, 1n.1
mundo-fantasma, 1-2
Murchison, meteorite, 1, 2, 3
mutaes, 1, 2, 3, 4-5, 6, 7-8n.13
de deslocamento de quadro de leitura, 1

Nasa, 1
neutrfilos, 1
Newton, Isaac, 1
Nirenberg, Marshall, 1

Oparin, Aleksander, 1-2


Orgel, Leslie, 1, 2-3n.13
Origin of Life Initiative (Harvard), 1
vulo, 1, 2, 3, 4, 5, 6

panspermia, 1-2, 3
Pasteur, Louis, 1-2, 3-4
Pax6, gene, 1n.12
Pepy s, Samuel, 1
placas continentais, 1, 2
planetas, 1-2, 3-4
plaquetas, 1, 2
Pouchet, Felix, 1
protenas, 1, 2-3, 4, 5, 6, 7-8, 9, 10, 11-12, 13, 14, 15; ver tambm aminocidos
protistas, 1, 2
protoclulas, 1-2
prtons, 1, 2, 3-4, 5, 6

qumica de sistemas, 1-2


quiralidade, 1-2, 3

R3C, 1-2
raio, 1, 2, 3, 4
redundncia, 1, 2
Remak, Robert, 1-2, 3
replicao, 1, 2, 3, 4, 5
DNA, 1-2, 3, 4, 5, 6
e energia, 1, 2
RNA/ribozimas, 1, 2-3, 4-5, 6, 7, 8
ribose, 1, 2
ribossomos, 1-2, 3, 4-5, 6
ribozimas, 1-2, 3, 4
RNA, 1, 2, 3, 4-5, 6-7, 8, 9-10, 11, 12, 13
hiptese do mundo de RNA, 1, 2
polimerase, 1
replicao, 1, 2-3, 4-5, 6, 7, 8
ribozimas, 1-2, 3, 4
Rogers, Jeff, 1
Roy al Society, 1, 2, 3
Russell, Mike, 1, 2, 3
Rutherford, Ernest, 1

Sagan, Carl, 1n.4


Sarm, 1-2n.13
Schleiden, Matthias, 1-2
Schrdinger, Erwin, 1-2
Schwann, Theodor, 1-2
segunda lei da termodinmica, 1-2, 3
seleo natural, 1-2, 3, 4, 5, 6, 7
sexo e clulas, 1, 2, 3, 4, 5-6
sndrome do elefante do cego, 1
sistema solar, 1-2, 3
sistemas vivos e a natureza da vida, 1-2, 3-4
busca de uma definio de vida, 1-2
caractersticas bioqumicas, 1-2
fsica, energia e, 1-2
metabolismo e ver metabolismo
sopa primordial, 1-2, 3-4, 5
Stewart, Potter, juiz, 1, 2
supermicrbios, 1-2n.13
Sutherland, John, 1-2, 3, 4, 5
Szostak, Jack, 1, 2, 3, 4-5, 6-7, 8

talidomida, 1
Teia, 1
teoria darwiniana da evoluo, 1-2, 3-4;
ver tambm seleo natural
teoria evolutiva:
e a comunalidade da vida, 1-2
darwiniana, 1-2, 3-4
seleo natural ver seleo natural
termodinmica, segunda lei da, 1-2, 3
Terra primitiva, 1-2
arqueana, 1, 2, 3, 4, 5, 6n.12
bombardeio pesado tardio, 1, 2-3, 4, 5
hadeana, 1, 2-3
Theobald, Douglas, 1
transferncia horizontal de genes, 1-2
Trifonov, Edward, 1

ltimo Ancestral Comum Universal (Luca, na sigla em ingls), 1-2, 3-4, 5-6, 7, 8
uracila, 1-2, 3n.12
urnio, 1
Urey, Harold, 1

Virchow, Rudolf, 1-2


vitalismo, 1
Vitrvio, 1

Wallace, Alfred Russel, 1n.9


Watson, James D., 1-2, 3, 4
Wedgwood, Emma (depois Emma Darwin), 1
Wedgwood, Josiah, 1
Wilkins, Maurice, 1-2
Woehlerr, Friedrich, 1

Ziegler de Estrasburgo, 1
zircnios, 1
O futuro da vida
Introduo

O que no posso criar, eu no compreendo.


RICHARD FEYNMAN, 1988

QUAL A MELHOR MANEIRA de descobrir como uma coisa funciona? H vrias abordagens,
entre as quais observar como ela se comporta ou test-la (talvez at destru-la, ou pelo menos at
que ela falhe). Mas h um limite para o que podemos aprender com essas tcnicas. A fim de
compreender uma coisa complexa, preciso desmont-la. Um mecnico de automveis no
pode compreender as complexidades do motor de combusto interna apenas destruindo-o numa
pista de corrida. Para entender o motor preciso desmont-lo e ver como as partes se encaixam,
o que cada uma delas faz e como se relaciona com as outras.
Desde antes da descoberta da clula,1 a unidade mais bsica da vida, no fim do sculo XVII,
os bilogos passaram grande parte de seu tempo observando e testando como funcionam as
coisas vivas. Contudo, um esforo muito mais instrutivo consistiu em desmont-las. Leonardo da
Vinci foi um consumado anatomista, que desenhou muitos diagramas lindamente intricados das
entranhas de animais e pessoas para determinar estruturas e funes dentro do nosso corpo. No
princpio do sculo XVII, William Harvey deduziu os mecanismos da circulao sangunea
dissecando a delicada construo de veias e artrias e o corao animal e humano.
Cinquenta anos mais tarde, o negociante de tecidos holands Antonie van Leuwenhoek
descobriu as clulas, coisas de que so feitas todas as formas de vida. medida que os
microscpios se aperfeioaram, as entranhas dessas pequeninas bolsas de matria viva foram
paulatinamente reveladas e por fim removidas das membranas protetoras que as encerram. No
sculo XIX, a mera observao dava lugar ao trabalho qumico de detetive, e a composio dos
elementos das clulas protenas e outros ingredientes essenciais da vida comeava a ser
descrita.
Durante esse mesmo sculo, com as tcnicas da qumica, o DNA foi isolado pela primeira
vez, embora quase cem anos tenham se passado antes que sua importncia e a icnica dupla-
hlice fossem descobertas. Em 1869, um jovem mdico chamado Friedrich Miescher trabalhava
em Tbingen, na Alemanha. Em decorrncia da guerra franco-prussiana ento em curso, ele
tinha fcil acesso s bandagens encharcadas de pus dos soldados feridos que apodreciam
lentamente no hospital do lugar. O pus contm grande abundncia de clulas brancas do sangue,
chamadas leuccitos, cujo objetivo combater a firme invaso de intrusos causadores de
doenas no ferimento aberto. Extraindo vrios ingredientes das ftidas bandagens, Miescher
isolou uma substncia qumica que continha quantidades significativas do pequeno grupo
molecular fosfato. Esse grupo particular de cinco tomos em geral no detectado em protenas,
cuja composio qumica j havia sido bem estudada quela altura. Por isso Miescher imaginou
que aquele extrato era algo diferente. Chamou-o nuclena, pois provinha sobretudo do ncleo
dos leuccitos dos soldados, um compartimento separado no centro das clulas de qualquer vida
complexa. Como os nomes das protenas tendem a terminar com as letras ina, como
hemoglobina ou insulina, tentador especular que Miescher ainda pensava aquele extrato em
termos similares. Seu trabalho nunca foi levado adiante; s muitos anos depois, quando se
demonstrou que a nuclena pertencia a uma classe inteiramente diferente de molculas, isso foi
identificado como DNA.
No sculo XX, a biologia amadureceu, transformando-se no estudo de componentes cada vez
menores das clulas. Em 1953, num episdio famoso, o DNA foi caracterizado por Watson e
Crick com base nos dados de Rosalind Franklin e Maurice Wilkins; e Crick, juntamente com
dezenas de outros pesquisadores, passou os anos seguintes decifrando como a informao vital
estava armazenada dentro da dupla-hlice. Esses dados biolgicos so as instrues para se
construir um organismo, e cada espcie tem seu prprio conjunto, conhecido como genoma. O
modo como ele funciona para a nossa espcie tornou-se foco do mais grandioso esforo j
realizado na biologia, o Projeto Genoma Humano. Esse empreendimento terminou na primeira
dcada do sculo XXI com uma completa transcrio dos 3 bilhes de letras de DNA de um ser
humano mdio, embora os mistrios da genmica humana continuem em pesquisa.
Do marco estabelecido por Crick e Watson em diante, a segunda metade do sculo XX foi a
era da biologia molecular, e quando o sculo terminou, a maior parte de toda a pesquisa
cientfica na Terra dizia respeito, de forma geral, s molculas da vida o DNA, seu primo
igualmente importante, o RNA, e as protenas. A compreenso das molculas e da linguagem da
vida e de sua natureza universal transformou profundamente todos os aspectos de nossa
compreenso acerca dos organismos vivos. Como vimos na outra metade deste livro, o DNA e a
biologia molecular foram a argamassa final que cimentou nossa compreenso sobre a natureza
da evoluo, e forneceram um mecanismo unificador pelo qual podemos retraar nosso
caminho de volta ao passado remoto e rumo a uma origem singular da vida, um tronco a partir
do qual toda a vida se desenvolveu.
Mas isso gerou tambm uma nova maneira de examinar as coisas vivas. Como
descobriremos nos captulos que se seguem, nossa robusta compreenso das molculas da vida
conduziu a uma era em que podemos alterar, manipular e efetivamente remixar o cdigo
gentico bsico de qualquer coisa viva. Reunimos esses campos relacionados sob a expresso
abrangente engenharia gentica, que j comeou a transformar aspectos de nossas vidas. Ela
revolucionou a descoberta de como certas doenas ocorrem, pois podemos alterar o DNA de
animais e clulas para imitar essas doenas e usar essas clulas remixadas como um campo de
testes para novos e audaciosos tratamentos mdicos.
Se o sculo XX biolgico estava interessado em desmembrar clulas para compreender
como elas funcionam, essa compreenso recm-adquirida deu-nos tambm a capacidade de
remont-las de novo, agora projetadas por ns, com inteligncia, para atingir fins especficos.
Clulas so minsculas fbricas que evoluram ao longo de bilhes de anos para desempenhar
funes altamente especializadas construir ossos, armazenar lembranas, converter luz em
eletricidade em nossos olhos, ou engolir invasores que podem nos causar dano. Elas esto
reunidas numa comunidade que funciona em harmonia para formar um organismo, ou, como
o caso da maioria das clulas na Terra (as bactrias e suas primas menos conhecidas, as
arqueias), vivem de forma independente, como entidades nicas.
A citao no incio desta Introduo, O que no posso criar, eu no compreendo, atribuda
ao grande fsico, tocador de bong e verstil mestre da cincia e da divulgao cientfica Richard
Fey nman. Esta foi a ltima mensagem que deu para seus alunos, escrita em seu quadro-negro no
California Institute of Technology (Caltech), antes de sua morte em 1988. na remontagem da
linguagem da vida que nos situamos num plano acima da mera compreenso dos sistemas vivos,
um plano em que formas de vida so ferramentas construdas. A manipulao gentica tornou-se
engenharia em grande escala e agora evoluiu num novo campo, cujo objetivo apenas criar
formas de vida que sirvam como ferramentas para a humanidade. Ele conhecido pelo oximoro
biologia sinttica.
Na cincia, as definies muitas vezes so imprecisas e com frequncia pouco teis. Biologia
sinttica uma expresso que significa diferentes coisas para diferentes pessoas, e aspectos
dessas definies so discutidos nas prximas pginas. Cientificamente, ela uma descendente
direta da engenharia gentica, e a superposio entre as duas nem sempre clara. Por essa
razo, examinei as duas no curso da explorao de nossa recm-adquirida habilidade de criar
formas de vida usando partes de genes de clulas tomadas da caixa de ferramentas fornecida
pela evoluo. E por fim, como um ps-escrito, analisarei a criao de molculas inteiramente
novas que se ajustam ao DNA mas no so parte do lxico da evoluo novas linguagens e
novos usos para o cdigo gentico.
Todas as criaes da engenharia gentica e da biologia sinttica so novas para o inventrio
da vida. A maior parte delas consiste em modificaes secundrias, ou pequenas adies que
acrescentam nova funo a um organismo (ou suprimem uma funo existente). Quase todas
ocorrem em bactrias, cujas genticas foram suficientemente bem compreendidas para que elas
se tornassem o equipamento essencial da moderna era da biologia. Mesmo assim, a biologia
sinttica um novo campo, e muitas pessoas talvez no o tenham encontrado antes.
Isso mudou em maio de 2010, quando os noticirios foram brevemente e de maneira
indita tomados de assalto por uma nica clula. Ela ganhou um nome, e fotos de Sy nthia,
como se tornou conhecida, adornaram as primeiras pginas das publicaes e as telas de canais
de televiso pelo mundo todo. Depois de mais de dez anos de labuta e cerca de US$ 40 milhes, o
geneticista J. Craig Venter publicou um artigo que descrevia uma clula bacteriana que sua
equipe havia criado. Seu genoma no fora montado dentro de uma clula-me, como ocorrera
com todas as outras clulas na histria, mas num computador. A imprensa delirou. Uma revista
classificou Venter como a 14a pessoa mais influente na Terra, encaixado entre o atual primeiro-
ministro britnico, David Cameron, e a poltica americana Sarah Palin. Embora tenha sido um
importante marco, Sy nthia no chegou propriamente a fazer parte da revoluo da biologia
sinttica que est comeando agora.
O prprio Craig Venter estava vido por assinalar esse evento em termos grandiosos. Para
ilustrar nosso domnio sobre o DNA, e para distinguir Sy nthia tambm conhecida como
Mycoplasma micoides JCVI-syn1.0 de bactrias que ocorriam naturalmente, Venter e sua
equipe esconderam em seu genoma o que os jogadores de videogame chamam de ovo da
Pscoa. Este tinha a forma de mensagens cifradas secretas no DNA da nova criatura. Uma
delas foi O que no posso construir, eu no posso compreender, numa ligeira alterao da
frase de Fey nman. Um membro annimo da equipe de Craig Venter a obtivera de um site
desconhecido na internet, um tipo de fonte de referncias que volta e meia se revela enganosa.
Mas, erros parte, essa citao ovo da Pscoa serviu ao objetivo de estampar uma marca-
dgua indelvel na bactria, provando sua origem artificial. Ela mostrou tambm que o DNA
pode agir como um dispositivo de armazenamento de dados, um meio de codificar informao
que no seja biologicamente relevante. Trataremos desse campo emergente no Posfcio. Em
seu conjunto, toda essa histria foi uma impressionante demonstrao de quanto avanamos em
nossa capacidade tecnolgica de manipular e construir DNA.2
Sy nthia deve sua existncia ao Projeto Genoma Mnimo. Mycoplasma genitalium um
parasita que causa leve queimadura e coceira em homens e mulheres infectados quando eles
urinam. Mas no isso que o torna intrigante. O interesse de Venter por essa clula decorre do
fato de que ela tem meros 517 genes e um genoma de apenas 582 mil letras de cdigo gentico,
chamadas bases (em contraposio aos 4,6 milhes de bases do mais comum micrbio de
laboratrio, E. coli, ou aos 3 bilhes dos seres humanos). Aps sequenciar o primeiro genoma
completo em 1995, Venter e colegas dedicaram-se a M. genitalium. Essa no foi uma escolha
ditada pela preguia, e sim o primeiro passo decisivo para a grande ideia seguinte de Venter. O
plano era (e ) determinar o menor nmero de genes e a quantidade mnima de cdigo gentico
necessrios para sustentar uma clula viva. A vida originou-se com apenas um punhado de genes
bsicos; eles foram copiados e sofreram mutao para que toda a vida subsequente florescesse.
Mas aquelas primeiras clulas devem ter iniciado com um conjunto de nvel elementar. Comear
com o menor genoma conhecido (na poca) fazia muito sentido. A longo prazo, o plano era
estabelecer a quantidade mnima de DNA necessria para uma clula existir e se reproduzir, de
modo a usar esse genoma como uma base sobre a qual eles pudessem desenvolver novas
funes. Essas funes so tipicamente grandiosas: por exemplo, lidar com o problema do dano
ambiental que nosso uso de combustveis fsseis provocou no planeta, construindo micrbios
capazes de produzir hidrognio utilizvel como combustvel. H algumas razes para se construir
uma clula a partir do zero, em vez de modificar uma j existente. Essas clulas podem ser
controladas de maneira mais precisa em condies definidas, e por isso s crescem em
laboratrios; elas podem ter um objetivo nico embutido em seu programa gentico, de tal modo
que as funes normais das clulas ficam restringidas. Mas a razo fundamental o controle:
podemos potencialmente controlar uma clula sinttica muito melhor do que clulas naturais que
no compreendemos por completo.
Sy nthia representa uma prova do princpio de que possvel construir sinteticamente um
genoma inteiro, ainda que muito pequeno. possvel introduzi-lo numa clula de modo que esta
funcione e, o que decisivo, se reproduza como qualquer outra bactria. De maneira mais
ampla, essa saga mostra a ambio dos cientistas de transformar a biologia numa cincia
aplicada, em engenharia. Ela revela que a fabricao molecular requerida na biologia sinttica
nada tem de fcil, o que no de surpreender, sendo o campo to jovem. Os protagonistas da
forma mais pura de biologia sinttica tm a engenharia como seu princpio orientador
fundamental, e, de maneira ainda mais especfica, a verso mercantilizada da engenharia
eltrica. No se trata apenas, portanto, de investigar e compreender como processos vivos
funcionam, mas de recriar, remixar e construir organismos vivos que solucionem problemas
globais.
Com a publicao da criao de Venter, a mdia exibiu uma curiosa mescla de ranger de
dentes e triunfalismo inadequado. O Daily Mail, jornal do Reino Unido no conhecido por
reportar avanos cientficos de maneira matizada, publicou a notcia com uma manchete que
alardeava: Cientistas acusados de brincar de Deus aps criar vida artificial fazendo micrbio
projetado a partir do zero mas poderia ele erradicar a humanidade? No a resposta muito
simples para essa pergunta, como ocorre inevitavelmente quando manchetes de jornal sobre
cincia terminam com um ponto de interrogao. Eis a razo: Sy nthia foi projetada com
dispositivos prova de falhas embutidos em seu genoma. Em geral, eles podem funcionar de
duas maneiras: primeiro, podemos incluir genes que determinam que nossa bactria modificada
s cresce numa mistura muito especfica de alimentos que apenas o laboratrio sabe como
produzir; segundo, o genoma do qual Sy nthia foi copiado e modificado baseia-se num pequeno
patgeno de cabra que causa infeco no bere. A equipe de Venter inseriu na clula um naco de
DNA que a torna incapaz de causar infeco. Assim, embora possa sobreviver precariamente
fora do laboratrio em que foi criada, ela no seria capaz de florescer em seu hbitat preferido, a
menos que um especialista em biologia molecular modificasse suas limitaes genticas. Poderia
ela erradicar a humanidade? No; porm, se um geneticista habilidoso fosse persistente e
maldoso o suficiente, sem dvida acabaria importunando uma cabra.
O alvoroo no se limitou aos tabloides. Professores eminentes no se envergonharam de
fazer coro com o excesso de arrogncia. Julian Savulescu, professor de tica da Universidade
Oxford, declarou ao jornal Guardian:

Venter est entreabrindo a mais fundamental porta na histria da humanidade, espreitando


potencialmente o seu destino. Ele no est apenas copiando artificialmente a vida, ou
modificando-a de forma radical por engenharia gentica. Est avanando em direo ao
papel de um deus: criando vida artificial que poderia nunca ter existido de maneira natural.

Claro que uma vaca frsia ou uma couve-lombarda so formas de vida cuja existncia
natural teria sido extremamente improvvel. Elas foram cultivadas ao longo de inmeras
geraes com o objetivo expresso de amplificar caractersticas desejveis: beres cheios de leite
ou folhas crocantes. Apesar disso, duvido que algum acusasse um fazendeiro comum de estar
entreabrindo portas fundamentais na histria da humanidade.
Ter Venter criado vida? Num sentido muito particular, sim. Mas, na maioria dos outros, no.
Sem dvida Sy nthia no existia como coisa viva at a equipe de Venter ger-la num tubo de
plstico. Seu genoma foi criado num computador e depois numa mquina alimentada com quatro
garrafas contendo as letras cruas do cdigo gentico. Ela no foi derivada a partir da replicao
biolgica de um genoma existente que se autocopiava usando o mtodo que serviu vida durante
bilhes de anos. Todavia, a prpria sequncia, modificada com interruptores genticos suicidas
prova de falhas e citaes pretensiosas (e erradas), foi replicada a partir de uma espcie
existente. E o chassi em que o genoma sinttico foi colocado era de uma clula existente tomada
de uma espcie existente na natureza, que, de forma distinta, fazia parte da rvore
profundamente enraizada da vida. O que Craig Venter e sua equipe fizeram foi recriar
sinteticamente uma forma de vida. Isso sem dvida, por si s, uma faanha gigantesca. Trata-
se de mais um passo no caminho de adquirir total controle sobre o DNA e nossa capacidade de
manipular a vida.
A segunda coisa que os esforos de Venter revelam o grau em que esse campo nascente
mal compreendido e deturpado. H dezenas de milhares de anos manipulamos coisas vivas,
embora nunca antes com tal preciso molecular. O ritmo do progresso foi vertiginoso. Uma
dcada atrs, terminei meu doutorado em gentica, durante o qual fiz pequenos atos de
manipulao gentica para descobrir como o olho se desenvolve, e por que em certas famlias
isso d errado, levando algumas crianas a nascerem cegas. Os tipos de experimento que eu
fazia ento poderiam hoje ser realizados por estudantes ainda no curso de graduao ou mesmo
por amadores conhecidos como biohackers pessoas, por vezes ainda em idade escolar, que
misturam genes e DNA de organismos em garagens, nos fins de semana. Em certo sentido, esse
um progresso natural, graas ao qual novas tecnologias se generalizam e a exclusividade que
acompanha o conhecimento especializado ou a inveno perdida medida que elas se tornam
ferramentas padronizadas. Mas o ritmo dessa transferncia assustador e mal compreendido
fora do mundo da cincia. Na atmosfera certa (ou pior, na errada), as pessoas temem o que no
compreendem. Como a histria de Craig Venter e Sy nthia mostra, a cincia extraordinria pode
resultar em reaes viscerais.
O que se segue um instantneo desse campo embrionrio da engenharia de coisas vivas. Os
bilogos sintticos tm em mente aplicaes, solues projetadas e construdas para os
problemas que este planeta enfrenta e, de maneira mais inacreditvel, as ferramentas para
explorar para alm de nossos grilhes terrestres. Muitas das aplicaes das criaes descritas
aqui so especulativas, mas isso no impede que sejam construdas com um propsito em mente.
Com o advento dessas criaes, estamos beira de uma nova revoluo na indstria. A madeira,
o ferro e o carvo que impulsionaram a Revoluo Industrial dos sculos XVIII e XIX foram
realmente tirados da natureza cortada, minerado e extrado do mundo natural. Mas, no uso, eles
foram convertidos em algo inanimado e morto. Dessa vez, os agentes de mudana no so
apenas tirados do mundo natural eles esto vivos.
1. Criado, no gerado

Sou contra a natureza. No curto mesmo a natureza.


Acho a natureza muito artificial.
BOB DYLAN

FRECKLES PARECE UM filhote perfeitamente normal. Ela tem olhos brilhantes, uma saudvel
pelagem branca, e cabriola alegremente com Pudding, Sweetie e seus cinco outros irmos,
exatamente como voc esperaria de uma cabrita. At que eu a afaste, gosta muito de mascar
minhas calas. Para o observador casual e para pastores de cabras profissionais, nada a
diferencia de uma cabra de terreiro numa fazenda normal.
Na verdade, porm, Freckles extraordinria. Embora a maior parte de seu genoma seja o
que voc esperaria encontrar numa cabra, h em seu DNA um canto estrangeiro, tomado de
Nephila clavipes, uma espcie comum de aranha. A linguagem do DNA exatamente a mesma
nas cabras e nas aranhas, bem como em todas as coisas vivas. Mas a traduo desse pedao
particular de cdigo muito estranha a uma cabra comum. Ele foi inserido num ponto muito
especfico do genoma de Freckles, junto de uma instruo codificada que estimula a produo de
leite em seus beres. Em consequncia dessa intruso gentica, quando a cabra produz leite, ele
est repleto de seda de aranha.
Freckles a criao de uma equipe de cientistas da Universidade do Estado de Utah liderada
por Randy Lewis. Visitei seu laboratrio, que de fato uma fazenda situada na base de uma
intimidante cadeia de montanhas em Logan, Utah. Embora muito diferente das salas esterilizadas
de um tpico laboratrio de biologia molecular, trata-se de um cenrio bastante adequado, pois
Lewis e seus colegas cientistas so, em certo sentido, os mais avanados fazendeiros na histria
de nossa espcie. Eles esto interessados na seda de aranha, a fibra difana em que as aranhas
costumam se pendurar quando esto caindo. Esse material tem propriedades assombrosas, com
uma combinao e fora e elasticidade no superadas por qualquer coisa que os seres humanos
j tenham conseguido fabricar. O gene de Nephila clavipes existe desde o perodo jurssico, que
comeou cerca de 201 milhes de anos atrs, e durante as pocas precedentes e desde ento a
natureza conspirou para conferir a essas aranhas um produto que est to acima dos maiores
esforos da humanidade, mas que esses animais produzem a granel, sem pensar. Podemos fazer
fibras dotadas de fora, ou com grande elasticidade, mas no reunir as duas coisas. por isso que
existe Freckles, a criao artificial de cientistas.
Durante mais de 10 mil anos, desde a aurora da agricultura, identificamos caractersticas
atraentes no mundo natural e tentamos acentu-las e explor-las. Isso agropecuria. Trata-se
de um processo que , em essncia, o exato oposto da seleo natural, embora utilize os mesmos
meios. Em vez de a sobrevivncia determinar que adaptaes inteligentemente projetadas vo se
desenvolver, escolhemos caractersticas que nos parecem atraentes e reproduzimos espcies
para otimizar esses traos, quer seja em frutas ou cereais, em gado de corte, leiteiro ou para
explorar o couro, em ces e plantas reproduzidos para desenvolver determinado comportamento
ou por esttica. A agropecuria a evoluo projetada.
At a era da engenharia gentica, essa seleo artificial foi limitada de maneira inerente por
restries naturais. Embora seja difcil explicitar sua natureza, uma espcie pode ser definida
como um grupo de organismos que, quando cruzados uns com os outros, produz crias frteis. No
se trata de uma definio infalvel, e o processo pelo qual essa barreira se introduz a especiao
uma das grandes questes na biologia. Contudo, do ponto de vista de um fazendeiro, as
limitaes da barreira das espcies so insuperveis. Em termos rasteiros, no se pode acasalar
um porco com uma vaca.
Traos desejveis so introduzidos no curso do tempo mediante cuidadoso acasalamento
seletivo ao longo de geraes, fato que Charles Darwin conhecia bem. O captulo de abertura de
A origem das espcies dedicado no sua tese central da evoluo por seleo natural, mas
seleo artificial em pombos. Nessa seo sobre pombos, Darwin demonstra que as espcies no
so imutveis, podendo mudar ao longo do tempo geracional. As aves que ele descreve foram
criadas durante milhares de geraes por reprodutores fantasiosos e competitivos, para exibir
penas, pescoos e ps os mais absurdos, que lhes valessem prmios, tanto que tinham nomes
como Trumpeters, Fantails, Tumblers e Pouters.a Por meio da observao meticulosa de seus
esqueletos, e em oposio direta s opinies sustentadas com energia pelos criadores de pombos,
Darwin revelou, corretamente, que essas aves continuavam a ser variedades da mesma espcie,
o pombo comum Columba livia.
Com a descoberta do cdigo gentico DNA e o advento de nossa capacidade de manipul-
lo, somos agora capazes de evitar as limitaes da evoluo e violar radicalmente a barreira das
espcies. Freckles, embora nada extraordinria em termos das tcnicas de modificao gentica
hoje disponveis, um sensacional exemplo dessa transgresso gentica. Porcos e vacas so
ambos mamferos, ambos artiodctilos ungulados e estreitamente relacionados entre si em
termos evolutivos, bem como com camelos, girafas e hipoptamos. Seus ancestrais comuns
existiram algumas dezenas de milhes de anos atrs, um piscar de olhos na evoluo. Mas essa
distncia suficiente para impedir uma prole vivel, caso eles tentassem o acasalamento. Essa
barreira estabelecida por incompatibilidades genticas divergentes, embora o congresso fsico
seja concebvel. Alguns animais estreitamente relacionados produzem de fato filhos viveis,
como zebrasnos, ligres e bardotos, embora esses hbridos tendam a ser infrteis e, por isso, becos
sem sada evolucionrios, pois eles mesmos no podem se reproduzir.1
O ltimo ancestral comum de uma aranha e uma cabra deve ter existido h algo em torno de
700 milhes de anos, poca em que os seres que iriam adquirir cascas duras, como insetos e
crustceos, estavam se diferenciando de criaturas com exteriores carnudos, como os psceos ou
reptilianos que conduziriam finalmente a ns. Como a rvore da vida complexa s cresce por
ramos divergentes, aranhas e cabras no trocaram genes desde ento. Diferentemente de uma
zebra ou de um asno (ou mesmo de um porco e uma vaca, quanto a isso), a unio sexual de uma
aranha com uma cabra obviamente impossvel por motivos fsicos. Mas o cdigo de DNA que
ambas carregam igual em todas as formas de vida conhecidas. Trata-se da mesma linguagem,
formatada da mesma maneira, de modo que as ferramentas e a mecnica para a traduo desse
cdigo so cegas para seu sentido cifrado. Assim, se o gene da seda de aranha introduzido no
genoma de uma cabra de modo suficientemente cuidadoso para no perturbar a biologia
essencial, a maquinaria celular da cabra produzir seda de aranha sem referncia sua origem
aberrante.
exatamente isso que acontece nos beres de Freckles. Em aranhas, a seda feita de curtos
filamentos de protena que se alinham e se autocongregam medida que so empurrados ou
extrados da fiandeira do animal. As protenas so elas mesmas longas cadeias de molculas
chamadas aminocidos, e as prprias combinaes especficas de aminocidos nas fibras de
seda significam que elas se alinham e se superpem, engatando-se em fios contnuos dotados de
flexibilidade. Em razo disso, esses fios tm extenso, fora e elasticidade. As cabras de Randy
Lewis produzem em abundncia as curtas protenas da seda, que flutuam livremente no leite. A
gordura removida do leite, que depois passado em um processador de alta presso. A partir
da, usando apenas um basto de vidro, eu puxo um nico fio de seda de aranha do leite da cabra,
e os bicos e caudas das fibras mais curtas vo se ligando medida que eu as retiro do lquido. O
fio forte o bastante para que eu o enrole num carretel, aos metros. At agora, essa seda
artificial no tem exatamente a mesma fora elstica ou tnsil que a criada pelas prprias
aranhas. A pesquisa continua.
Embora aparentemente bizarro, esse processo a agropecuria da prxima gerao. As
propriedades fsicas da seda de aranha a tornam uma substncia extremamente desejvel para a
humanidade. Ela mais rija que a fibra Kevlar, feita pelo homem e usada em trajes blindados e
pneus prova de bala. Tambm no gera uma resposta considervel do sistema imunolgico e
insolvel em gua, dois aspectos de que os gregos antigos tiravam partido, usando teias de aranha
como emplastro em feridas que sangravam. Essas propriedades significam que seda de aranha
tem grande potencial para o reparo de ligamentos, para o qual a medicina hoje usa fatias de
carne extradas dos msculos do prprio paciente ou tecido proveniente de corpos mortos.
Nenhuma dessas solues permanente, por isso seria muito til um ligamento substitutivo feito
de uma substncia biologicamente neutra, com fora fsica igual ou maior que a de nossos
prprios ligamentos.
Por mais absurdo que parea dizer isso, no possvel criar aranhas em cativeiro. Quando
mantidas em grupo, elas tendem ao canibalismo. Com nossa capacidade de violar os limites entre
as espcies naturais mediante o uso das ferramentas da gentica moderna, somos capazes de
colher um produto inserindo seu cdigo num animal que pode ser criado. Embora Freckles, a
cabra-aranha, seja um impressionante exemplo de nossa grande percia na mistura de genes, ela
est longe de ser um caso isolado. Isso engenharia gentica: a criao de vida artificial usando
a generosa caixa de ferramentas da evoluo.
A linguagem do DNA carregada por todas as coisas vivas porque a vida sobre a Terra
evoluiu, em ltima anlise, a partir de uma origem nica, uma clula que existiu 4 bilhes de
anos atrs.2 A linguagem, o cdigo e a mecnica de todas as clulas vivas so iguais. O DNA
carrega uma linguagem oculta que decodificada por uma molcula mensageira chamada
RNA, que traduzida em protenas. As protenas realizam todas as funes da vida, seja como
enzimas que aceleram reaes bioqumicas essenciais dentro de nossas clulas para nos fornecer
energia vital, seja como missivas, tais como hormnios, que levam instrues de uma parte do
corpo para outra. Alm de formar estruturas que mantm nossas clulas coesas, as protenas
fabricam outras estruturas como ossos, dentes e cabelos. Em suma, toda vida feita de ou por
protenas.
Em razo dessa origem comum e desse processo universal, a mecnica celular de ler e
traduzir o cdigo de DNA ao mesmo tempo cega para seu sentido e indiferente a ele, o que
significa que o cdigo das coisas vivas pode ser usado para transgredir as barreiras naturais da
reproduo. Quimeras como Freckles so chamadas de organismos transgnicos, pois os genes
foram movidos atravs da barreira das espcies.
O progresso cientfico depende do desenvolvimento de novas tecnologias. Os seres humanos
so exmios no uso de ferramentas, e sempre procuramos instrumentos teis na natureza. Vemos
o que est disponvel, nos apropriamos disso e o modificamos para diferentes usos, desde o tempo
em que usvamos ossos como porretes. O mundo natural sempre serviu como nossa caixa de
ferramentas. Lascamos slex na forma de facas toscas, entalhamos galhos de rvore na forma de
pontas de flecha, fundimos metais a partir de pedras e usamos peles de animais costuradas com
agulhas de osso e fios vegetais. A tecnologia que permitiu a violao da barreira das espcies
requerida pela modificao gentica tambm tomada de emprstimo do assombroso banco de
recursos da natureza. Ela vem de nossos primos evolutivos mais distantes, as bactrias.
Em 1968, Hamilton Smith (que trabalhava ento no Departamento de Microbiologia na
Universidade Johns Hopkins em Baltimore) isolou o primeiro de um conjunto de protenas que
deu incio era da engenharia gentica, e por isso compartilhou o Prmio Nobel de Fisiologia ou
Medicina de 1978. Essas protenas, conhecidas como enzimas de restrio, agem muito como
tesouras de DNA. Na natureza, as enzimas de restrio de uma bactria cortam sua prpria
dupla-hlice como meio de proteg-la contra a invaso de vrus. Como um vrus carrega
somente seu cdigo gentico, e nada da maquinaria para replic-lo, seu objetivo assumir o
controle da clula hospedeira para se reproduzir. A clula infectada traduz o cdigo do vrus e
fabrica novos vrus, inadvertidamente, liberando-os em massa, at que a clula explode. Enzimas
de restrio so parte do arsenal para evitar essa invaso, eliminando o DNA intruso.
A habilidade de cortar DNA de extrema serventia para os geneticistas, pois enzimas de
restrio no cortam o cdigo aleatoriamente. Elas s cortam quando reconhecem uma fileira
precisa de letras no cdigo gentico. H uma enorme variedade de enzimas de restrio,
algumas das quais cortam em sequncias comuns, outras em pedaos muito raros de DNA.
Imagine isso em funcionamento neste livro: uma enzima de restrio que faz o corte quando v a
palavra clula iria despedaar o livro em fragmentos, como se ele tivesse sido baleado com
uma espingarda de caa. Uma enzima de restrio que cortasse a palavra jumentous3 cortaria o
texto exatamente em trs pedaos, pois essa palavra incomum aparece apenas duas vezes.
Essa ferramenta de edio de ocorrncia natural permitiu aos cientistas tratar DNA e genes
da maneira como usamos hoje o software de processamento de palavras: para cortar, copiar e
colar de uma seo para outra. Este pargrafo comeou sua vida em outro captulo, mas com
um simples par de cliques eu o transpus para c e o modifiquei para lhe dar sentido. De maneira
semelhante, o gene da seda de aranha comeou sua vida numa aranha e foi transferido para o
genoma de uma cabra nascente, manipulado e posicionado de maneira a fazer sentido biolgico.
Hoje, centenas de enzimas de restrio esto isoladas e caracterizadas, so baratas e facilmente
disponveis. E, no que ainda melhor que mover texto de c para l, como o DNA uma dupla-
hlice, feita de dois filamentos que se espelham um ao outro com cdigo complementar, h outro
truque til que essas ferramentas de edio de genoma podem efetuar. Algumas simplesmente
fendem os dois filamentos do DNA no mesmo ponto. Essas extremidades so chamadas de
abruptas, e qualquer outro DNA de extremidade abrupta pode ser prontamente colado nelas,
duas extremidades coladas uma na outra, como um domin em branco. Depois de ligados, os
DNAs so perfeitamente estveis e valiosos para o engenheiro de genes, pois podem ser colados
em qualquer lugar. Mas outras enzimas de restrio cortam cada um dos filamentos em pontos
separados por algumas letras, criando extremidades coesivas, com um filamento de DNA
projetando-se alm do outro. Isso os torna um domin desigual, em que s podemos juntar
extremidade o pedao correspondente. Um trecho de DNA estrangeiro que tem a extremidade
coesiva complementar pode se unir ao DNA hospedeiro, encaixando-se direitinho no lugar. Isso
significa que inseres podem ser orientadas numa direo particular, e outras inseres teis,
acrescentadas para fazer caminhos genticos mais complexos, numa sucesso de domins
montada segundo um projeto.
No laboratrio, quase todos esses experimentos de biologia molecular envolvem a
transferncia de pequeninas quantidades de lquidos incolores de um tubo minsculo para outro. A
ao de enzimas de restrio sobre o DNA invisvel a olho nu, e verificamos o sucesso com
uma bateria de visualizaes indiretas, como medir a massa dos fragmentos cindidos ou reunidos
de novo. Em geral no ocorre nada de sensacional, e no fcil ver os atos profundamente
antinaturais que esto sendo perpetrados. Em ltima anlise, porm, o teste real ver se e como
esses cdigos reconstrudos funcionam em clulas e organismos. Por vezes os efeitos podem ser
flagrantes e notveis. Com frequncia, porm, o impacto da modificao gentica pode ser sutil
ou oculto, e por isso a capacidade de detectar onde e quando um experimento est funcionando
uma arte delicada.
Em gentica, fazer um transgene, o cdigo em que estamos interferindo, s o primeiro
passo. O cdigo no faz nada por si s, por isso deve ser inserido em uma clula onde a
decodificao acontecer, e onde esperamos que a mensagem subvertida ser levada a cabo.
Em Freckles, o cdigo no apenas o gene da seda de aranha, mas instrues que dizem quando
ele ser ativado, ou expresso na linguagem da gentica. Graas cuidadosa construo, a seda
s ser produzida no leite, ainda que o gene v estar presente em cada uma das clulas da cabra.
Durante os anos 1990, pedaos extras de cdigo gentico acrescentados ao depsito de
ferramentas incluram rtulos coloridos, de tal modo que pudssemos ver exatamente ao
microscpio se o gene havia sido absorvido com sucesso em seu novo portador. Mais
recentemente, foram acrescentados rtulos fluorescentes, permitindo-nos ver onde o gene est
ativo depois que foi integrado a um animal. O exemplo visualmente mais impressionante disso
a denominada Protena Fluorescente Verde (GFP, da sigla em ingls), que, em sua hospedeira
natural, a gua-viva Aequorea, emite um brilho verde na escurido dos oceanos. O gene que
codifica esse sinal luminoso foi extrado da gua-viva, de modo a poder ser acrescentado ao gene
que estamos testando. Como em cabras-aranhas, a maquinaria que traduz o DNA em protenas
funcionais indiferente a seu significado, por isso l o cdigo gentico universal sem preconceito
de espcie e brilha para mostrar que seu gene modificado est funcionando.4
Genes nunca trabalham sozinhos. Eles fazem parte de cascatas de atividade em rede, como
uma srie de instrues condicionais. Todas as clulas contm todos os genes que integram o
genoma desse organismo, seja ele necessrio ou no. Assim, a coreografia da ativao dos genes
de suprema importncia. A ativao de um gene poderia provocar a ativao ou expresso
de outro, ou lhe dizer para parar; por meio desse processo ns nos desenvolvemos de um nico
vulo fertilizado numa coleo de centenas de tipos coordenados de clulas, cada um
desempenhando diferentes funes em consequncia da expresso de conjuntos especficos de
genes, em vez de uma bolha amorfa compreendendo clulas idnticas. Essa dana
elegantemente coreografada, mas tem flexibilidade limitada. Um gene ativado no momento
errado, no lugar errado ou por tempo longo demais pode produzir doena, anormalidade e muitas
vezes morte. Clulas de cncer so clulas em que genes que normalmente diriam a outros genes
para cessar a diviso celular falharam (ou, inversamente, os genes que instruem a clula a se
reproduzir esto permanentemente ativos), de tal modo que a clula apenas se divide. Essa
reproduo descontrolada desenvolve-se num tumor.
O comando para ativar um gene especfico apresenta-se, de modo tpico, na forma de uma
protena que no se prende fisicamente de forma direta ao prprio gene, mas ao DNA prximo.
Essas instrues so chamadas regies regulatrias, como instrues para mveis que vm
desmontados em embalagens compactas. Assim, um gene produzir uma protena que se ligar a
uma sucesso particular de bases de DNA perto de outro gene que lhe diz para se tornar ativo, e
uma rede contnua de atividade zumbe dentro de cada clula e entre clulas para criar vida.
Grande parte dos genomas no consiste em genes, isto , DNA que codifica uma protena. Os
genomas esto repletos dessas regies regulatrias que no contm genes elas mesmas, mas
atuam como instrues de palco muito precisas a fim de que as protenas desempenhem seu
papel.
Por meio das tcnicas de modificao de DNA, a transformao dessas redes de instrues
em ferramentas fez da biologia molecular uma cincia experimental. E, como tantas vezes
ocorre em biologia, s podemos determinar como as coisas funcionam quebrando-as.
Tradicionalmente, isso assumiu a forma do estudo de doenas hereditrias ou da observao de
animais que sofreram mutao. Como camundongos e homens tm muitos genes em comum,
podemos desativar um gene num embrio de camundongo por meio da modificao do seu DNA
para ver qual o resultado. Isso feito com enzimas de restrio, pedacinhos regulatrios de
DNA e insero de transgenes, formando juntos um processo de grande edio reconstrutiva de
DNA.
Por mais extraordinrias que possam parecer, essas tcnicas so o arroz com feijo da
gentica h mais de uma dcada, e a industrializao do processo de emenda e edio de genes
tornou a experimentao gentica mais fcil. Tomamos as ferramentas fornecidas pela evoluo
e as modificamos, redesenhamos e afiamos para que faam servios alm dos papis que
desempenham nos termos da seleo natural. Um experimento tpico para determinar a funo
de um gene humano causador de doena seria isol-lo numa famlia que sofra dessa doena,
usando os mesmos princpios de gentica e linhagens que conhecemos h um sculo. Depois de
purificado, ele copiado milhes de vezes, para que haja mais DNA com que jogar. Isso facilita
que a insero do gene modificado seja precisa, como num envelope de DNA que poder ser
postado numa bactria. Uma pequenina exploso de eletricidade vai perfurar orifcios
temporrios na membrana celular da bactria, e o DNA construdo simplesmente fluir para
dentro. Com um projeto habilidoso e um pouquinho de sorte ele ser incorporado ao genoma do
hospedeiro. Depois, cada vez que a clula se dividir, o gene inserido ser copiado juntamente
com o genoma hospedeiro. A quantidade, aqui, um fator importante, por isso as bactrias so a
ferramenta perfeita, no s porque podemos manipul-las, mas porque elas se multiplicam
loucamente. O passo seguinte destruir a bactria e deixar somente nosso DNA modificado.
Nesse ponto, podemos fazer com ele o que quisermos. possvel fazer verses dele em RNA,
que mostraro onde o gene est ativo em tecido preservado numa lmina, em um rgo ou at
num animal inteiro. Ou podemos inserir esse gene e todos os seus controles extras numa clula-
tronco embrionria de camundongo, e implant-la numa me para ver o que ela faz medida
que o camundongo se desenvolve.5
Nada disso excepcional, trata-se apenas da biologia molecular normal que tem lugar em
milhares de laboratrios no mundo todo. Tornamo-nos to competentes no uso das ferramentas e
da linguagem que esto no ncleo de todas as coisas vivas que manipular sistemas vivos em seu
nvel mais fundamental faclimo. Por meio de experimentao, sabemos como os genes nas
clulas funcionam e, mais importante, como podemos alter-los. Podemos corrigir genes que
causam doenas, no ainda em seres humanos, mas em animais, e isso nos permite estudar
como as doenas progridem, e portanto como trat-las. Desenvolvemos a capacidade de ler e
caracterizar cada gene num ser humano; no momento em que escrevo, podemos faz-lo em
algumas semanas, com o preo de alguns milhares de libras (e esses dois nmeros iro continuar
caindo).
A biologia sinttica a descendente evoluda da engenharia gentica. Ela toma os princpios
da biologia e os reinventa no intuito de arquitetar solues para problemas humanos especficos
doena, questes ambientais e, como veremos, at explorao do espao. Esse movimento da
biologia sinttica um fenmeno novo na cincia, com uma dcada de idade, na estimativa mais
generosa. Ele trouxe consigo o ethos de uma subcultura. Mas, como no de surpreender, a
cincia convencional e as corporaes tambm comearam a perceber seu potencial.
A mudana climtica e o aquecimento global vo definir grande parte da indstria e da
inovao no campo da biologia sinttica nas prximas dcadas. Como no realista esperar que
as pessoas mudem radicalmente seu comportamento, encontrar alternativas para os combustveis
fsseis um importante desafio. Nesse meio-tempo, porm, sintetizar combustveis, em vez de
extra-los do solo, uma soluo parcial.
H dezenas de projetos para fazer biocombustveis, convertendo vegetais em energia daquela
maneira fundamental pela qual tantas formas de vida o fazem naturalmente.6 Esse um
processo de fixao de carbono, que transforma dixido de carbono em produtos orgnicos, ricos
em energia. Na natureza, uma planta utiliza a energia do Sol em vrios processos metablicos
para viver e se desenvolver. Atear fogo a uma plantao liberar essa energia, agora
armazenada nas fortes paredes celulares de celulose da planta. Uma forma mais eficiente de
explorar essa energia fermentar os acares presos nas clulas da planta, tambm produto da
energia do Sol, diretamente num leo combustvel, cheio de energia mais facilmente disponvel.
Uma dezena de empresas est tentando produzir biocombustvel a partir da biologia sinttica
usando exatamente esse processo.
Um desses projetos dirigido por Jay Keasling, professor da Universidade da Califrnia, em
Berkeley, que fundou a Amy ris, empresa de biologia sinttica cujo objetivo criar diesel a partir
de clulas vivas. A ferramenta que eles projetaram foi um circuito gentico composto por cerca
de uma dzia de nacos individuais de DNA, que eles implantam no genoma de uma levedura de
cerveja, uma clula que fermenta naturalmente acar em lcool na cerveja. O sucesso desse
circuito em produzir diesel um grande feito, e a escala de suas ambies de embasbacar.
Estive num grande nmero de laboratrios de gentica, que vo desde o encantadoramente
antiquado at modernas instalaes. A biologia molecular no requer os enormes espaos
brancos, cirrgicos, que os filmes retratam. Suas salas so cozinhas de grande preciso, com
foges, geladeiras e instrumentos para misturar ingredientes. Mas os laboratrios da Amy ris so
assombrosos. S os bolsos muito fundos de um empreendimento comercial de risco podem
proporcionar tamanho luxo, e no apenas no espao, na iluminao, num saudvel bistr ao estilo
So Francisco, mas tambm por desenvolver o tipo de tecnologia necessrio para a
industrializao da biologia sinttica.
Uma das tarefas que consomem mais tempo num laboratrio normal a insero do circuito
gentico nas clulas hospedeiras. A eficincia desse processo varivel. Ela no aleatria, mas
encerra um elemento de casualidade: o circuito entra ou no. Na manipulao gentica de um
laboratrio normal, inclumos marcadores genticos nos circuitos, rtulos que colorem as clulas
para indicar se a integrao do DNA estrangeiro foi bem-sucedida. Para que possamos ver
essas cores, as clulas no devem ser cultivadas num caldo, mas numa placa, de modo que as
colnias de clulas bem-sucedidas possam ser selecionadas com um palito e cultivadas num
pequeno tubo, deixando os fracassos para o incinerador. Esse um processo rduo, mas trivial, e
feito mo. Na Amy ris, eles o mecanizaram, de modo que podem selecionar centenas de
clones bem-sucedidos em minutos, dezenas de milhares por semana, com apenas um mnimo de
input humano. Uma cmera digital tira um instantneo da placa sobre a qual se encontram os
milhares de colnias de levedura e o processa para identificar os clones bem-sucedidos. Dentro
de uma mquina do tamanho de uma fotocopiadora de escritrio, uma grande quantidade de
agulhas paira e zune sobre a placa, colhendo as clulas de levedura bem-sucedidas com uma
preciso submilimtrica, no ritmo da batida de uma discoteca.
As clulas que foram incorporadas no circuito no precisam de muito mais estmulo.
Incubadas, elas simplesmente vertem diesel. Na sede da Amy ris em So Francisco eles tm um
tanque de teste de trezentos litros que produz diesel aos litros. Os laboratrios tm um cheiro
enjoativamente doce, como o de uma cervejaria, porm mais parecido com o de ma, porque
o diesel que eles esto refinando, chamado farneseno, est presente no leo que d s mas
aquela casca impermevel. Como combustvel, ele mais limpo que o diesel baseado em
petrleo, pois no tem nenhuma emisso de enxofre e quantidades muito reduzidas de xidos
nitrosos e monxido de carbono.
A criao de diesel nos proporciona certas vantagens em relao sua extrao do solo. Mas
envolve tambm um problema diferente (alm do fato de que esse diesel limpo e sinttico
continua a ser diesel, um combustvel gerador de dixido de carbono). A questo mais importante
que os tonis de levedura que exsudam diesel precisam ser alimentados. Isso significa
converter material vegetal, biomassa, em alimento. Cultivar essa biomassa um problema de
agricultura tradicional, suscitando as mesmas questes. A Amy ris estabeleceu fortes parcerias
com empresas no Brasil, para estar perto do lugar em que cultivada a melhor opo de
alimento, a cana-de-acar. O Brasil o lugar ideal para esse projeto, pois o pas que mais
planta cana-de-acar, e desde os anos 1970 vem produzindo biocombustveis, sobretudo etanol,
como forma de se libertar da dependncia de petrleo importado. A questo essencial : quanta
terra necessria para se produzir um litro de diesel? Neste momento, a resposta no est clara.
Diferentes matrias-primas so digeridas de diferentes maneiras, e os programas de levedura
sinttica podem ser alterados para lidar com isso. Nas fbricas brasileiras, o diesel sinttico
farneseno j vem sendo fornecido a veculos locais e usado como combustvel alternativo na
aviao. Mas o objetivo da Amy ris era elevar a produo a 200 milhes de litros at 2011, a US$
2 o galo. A ambio clara: Jack Newman, cofundador e diretor cientfico da Amy ris, me
disse: Ficarei entusiasmado quando chegarmos a 1 bilho de litros.
Por enquanto, porm, parece que o bilho de litros de Newman uma bolha estourada.
Durante algum tempo, a Amy ris deu a impresso de estar vencendo a corrida para fazer e
vender biocombustveis sintticos comercialmente viveis. Mas depois a previso de 200 milhes
de litros caiu para 50 milhes em 2012. Em fevereiro de 2012 eles anunciaram que estavam
reduzindo a produo de farneseno at que sua industrializao se tornasse mais plausvel. O
programa gentico funciona muito bem, mas at agora no foi possvel elev-lo a nveis que o
tornem economicamente vivel. Por enquanto, a despeito de todos os formidveis laboratrios,
parece que o futuro do biocombustvel sinttico ainda est muito distante.
Nesse meio-tempo, fomos capazes de modificar produtos agrcolas para que sejam
resistentes a pragas, cresam mais, tolerem geadas e at produzam vitaminas que protegem os
consumidores de doenas. Tomando genes emprestados de uma bactria e um narciso, os
cientistas criaram uma forma de arroz que produz altos nveis de betacaroteno, molcula
envolvida na produo de vitamina A. O Golden Rice, como chamado, tem o potencial de
tratar os 120 milhes de pessoas que sofrem de deficincia de vitamina A no mundo inteiro, das
quais 2 milhes morrem e meio milho fica cego. Mas ele continua indisponvel em
consequncia de uma combinao de obstculos cientficos e ticos, e de posturas polticas.
Essas histrias mostram algo da promessa, do potencial e dos problemas que a biologia
sinttica envolve. Em essncia, trata-se de engenharia com aplicao de pesquisa bsica em seu
ncleo. Mas, se comparadas sua antepassada, a engenharia gentica, essas indstrias so
imaturas. Elas enfrentam problemas cientficos, de comercializao, de melhoria de qualidade,
questes ticas e, como veremos, obstinada resistncia da parte de alguns membros da
sociedade. A biologia desordenada, e redes genticas complexas so subjacentes a essa
desordem. medida que a engenharia gentica, que s tem trs dcadas de idade, d lugar
biologia sinttica, o grande desafio no apenas simplificar essas redes, mas mercantiliz-las.

a Os Trumpeters so assim chamados por sua vocalizao singular; os Fantails tm caudas em


leque; os Tumblers so acrobatas, girando para trs no voo; e os Pouters tm um papo grande e
inflvel. (N.T.)
2. Lgica na vida

Se era assim, podia ser; e se fosse assim, seria; mas como no , no . Isso
lgico.
TWEEDLEDEE em Atravs do espelho, LEWIS CARROLL

APERTE O INTERRUPTOR, a luz se acende. Esse o mais simples circuito eltrico til. As
partes so projetadas e criadas para seguir uma nica instruo: o interruptor uma lacuna
quando aberto; mas, quando fechado, a energia eltrica se propaga pelo circuito. O filamento na
lmpada converte parte da energia eltrica numa forma que podemos detectar com as clulas
que temos nos olhos, e assim a iluminao ocorre. A funo clara, a instruo, pura, a lgica,
impecvel, faz-se a luz.
No outro extremo da escala, voc assiste a um vdeo transmitido pela internet num laptop.
Bilhes de sinais eltricos tero sido criados, modificados e transmitidos para que essas imagens
em movimento sejam apresentadas. Os circuitos foram projetados em intricado detalhe, cada
um obedecendo a um padro lgico determinado pelo hardware e o software em seu mouse, seu
computador, os servidores que hospedam o arquivo, e assim por diante. A lgica tambm
perfeitamente clara, mas a complexidade do caminho o torna quase inescrutvel, e por vezes
imprevisvel. No entanto, usamos o output desse circuito emaranhado todo dia sem nos importar
com os milhes de decises que foram tomadas para pr uma imagem mvel em nossa tela, ou
compreend-las.
Rememore, se puder suportar, alguns dos sistemas de circuitos que voc aprendeu na escola.
Uma lmpada eltrica conectada a uma bateria com um interruptor simples tem um output
binrio: ligado ou desligado. Depois voc pode ter acrescentado outros dispositivos ao circuito
para introduzir nveis superiores de controle, como dodos vlvulas eltricas que transformam
um fio numa rua de mo nica. Adicione, por exemplo, um tiristor, e voc tem um interruptor
dimmer. Talvez a maior inveno, sem dvida a tecnologia mais facilitadora, do sculo XX tenha
sido o transistor, que nos deu a capacidade de controlar e modificar mltiplos sinais eltricos.
Transistores interconectados compem os chamados portes lgicos, que modificam o sinal de
input para produzir um output especfico, mas diferente. Com a introduo dos portes lgicos,
circuitos de complexidade cada vez maior podem ser projetados e construdos. Por exemplo,
uma porta E age como uma conjuno positiva: se dois inputs eltricos so introduzidos numa
porta E, ambos devem estar ligados para que o output tambm seja ligado (em engenharia
eletrnica, letras maisculas indicam clculos lgicos, em vez de apenas berrar para efeito de
nfase). Um forno de micro-ondas usa esta lgica. Ele s cozer se a porta estiver fechada e o
boto de ligar tiver sido pressionado. Se um ou outro desses sinais decisivos for negativo, o output
ser negativo.
Os circuitos eltricos dependem de lgica, as partes componentes devem seguir determinados
caminhos. Desde o interruptor de luz at a mquina em que estou digitando, a rota da informao
assume a forma de questes digitais com respostas digitais: se pressiono o interruptor ligar, a luz
se acende; se pressiono a tecla enter (atravs de um longo caminho de transistores e milhares de
outros componentes), o pargrafo termina.
Essas so as prprias bases da engenharia eltrica, campo que se desenvolveu de lmpadas
eltricas transmisso de mensagens de e para o espao profundo em pouco mais de cem anos.
Cada sinal enviado a seu telefone celular, ou da nave espacial Voy ager I,1 retransmitido
atravs da lgica inerente aos transistores. Num microchip comum, haver bilhes de
transistores, e essa a tecnologia de que praticamente todo mundo depende hoje.
Esse um sistema imensamente atraente, no apenas porque funciona como o projetamos
para operar, mas tambm em razo do fato de que seu funcionamento nos permitiu construir o
mundo moderno. Essa lgica e essa ambio esto no corao da biologia sinttica. Muitos
componentes foram construdos, e alguns foram montados na forma de sistemas de circuitos
bsicos. Embora a expresso biologia sinttica tenha ganhado um amplo uso para significar
tudo desde o trabalho de Craig Venter em Sy nthia at a reinveno do cdigo gentico descrito
depois, o campo foi originado e mantido por cientistas que buscavam aplicar os princpios da
engenharia, especificamente da engenharia eltrica, biologia. Os seres vivos so muitssimo
complexos, com milhares de genes codificando outros milhares de protenas que interagem umas
com as outras e com o ambiente para produzir milhes de clulas. Mas a lgica bsica da
gentica est presente em princpio: se um gene for ativado, a protena que ele codifica ser
ativada e desempenhar uma funo.
No pensamos nas formas de vida como coisas ilgicas, mas tambm no as consideramos
como as frmulas simples da eletrnica. Apesar disso, os princpios das portas lgicas tal como
usados na eletrnica existem de fato na natureza, pois comportamentos e aes complexas
muitas vezes precisam da anlise de mltiplos inputs. A planta carnvora papa-moscas, ou
dioneia, exibe uma forma simples, mas engenhosa, de circuitos lgicos quando desempenha seu
ato epnimo. Dentro de sua boca foliar h pequeninos pelos que agem como disparadores para
cerr-los. Mas esse ato requer energia metablica, por isso a planta desenvolveu um mecanismo
para evitar a captura infrutfera (isto , de algo que no seja uma mosca). Quando um pelo
tocado pela cutucada de uma mosca, um timer acionado. Se um segundo pelo disparado
dentro de vinte segundos, os maxilares se fecham depressa, em menos de 110 de segundo.
Portanto, os sinais de input que resultam na ao de captura devem ser dados em conjuno. O
gatilho duplo uma forma de porta E, pois os dois outputs dos gatilhos dos pelos precisam estar
posicionados no ligado para que o output do circuito completo esteja no ligado. H tambm o
timer incorporado a cada gatilho, de modo que o caminho eltrico total simplificado poderia ser
escrito assim: se gatilho 1 + gatilho 2 < 20, ENTO FECHAR MAXILARES.
Esse processo conduzido e acionado pela mecnica dentro das clulas da papa-moscas,
com protenas especficas que reagem sensao fsica do toque de uma mosca. Mas a ao
biolgica de uma armadilha espera de ser acionada segue uma lgica simples, muito parecida
com a eletrnica: ela no tem nenhum crebro ou controle consciente para a deciso que toma,
apenas segue um programa.2
No entanto, a maior parte das coisas vivas segue uma lgica que uma fechadura muito mais
difcil de desmontar. A ativao dos genes para produzir protenas funcionais est sujeita a
condies de tempo e local. Os genes interagem e reagem ao ambiente em que esto ativos, na
clula, e a partir de sinais de curto e longo alcance de vizinhos prximos e distantes. Os prprios
genes variam de pessoa para pessoa e de ser vivo para ser vivo de formas diminutas e sutis. Isso
pode fazer sua funo, seu output, tambm variar de pessoa para pessoa. Essa variao
essencial, pois a base sobre a qual a seleo natural pode agir para que a evoluo prossiga.
Combine isso confusa interao de genes e ambiente, e temos a absoluta individualidade. Essa
a razo pela qual as impresses digitais so nicas, mesmo nos dedos de gmeos idnticos, cujos
genes so idnticos no incio de suas existncias.
Algumas clulas funcionam de um modo basicamente digital. As clulas cerebrais, os
neurnios, transmitem impulsos nervosos com uma cintilao dinmica e associam-se para
produzir pensamento e sentido. Sua centelha s iniciada quando inputs de outras clulas (na
forma de tomos carregados) fluem para o neurnio, at que um limiar particular seja
alcanado. Esse processo, que tem um nome impressionante potencial de ao , torna esses
neurnios digitais: eles esto desligados at serem ligados. Mas no permita que tal simplicidade o
induza a pensar que seu crebro facilmente compreensvel. H mais de 100 bilhes de clulas
no seu crebro, e cada uma delas forma milhares de conexes com outras. Isso significa,
potencialmente, centenas de trilhes de interruptores ligados e desligados em exploses de
milissegundos a cada instante que voc passa vivo. Talvez haja uma lgica oculta a, mas durante
um futuro previsvel ela permanecer inexplicavelmente complexa.
Em geral, na vida, os interruptores tampouco so propriamente binrios. H centenas de
outros tipos de clula e interruptores muito mais nuanados, estimulados com incitaes muito
pequenas, ou dependentes de mirades de inputs. Tal como um neurnio, um gene pode de fato
estar aceso ou apagado como uma lmpada eltrica. Mas tambm pode estar aceso em
diferentes intensidades, ou pode ter diferentes funes, dependendo do lugar ou do momento em
que est ativo. Isso explica, at certo ponto, por que no podemos compreender nossa prpria
complexidade com base apenas nos 22 mil genes presentes em nossos genomas (nmero muito
menor do que antes se supusera necessrio para descrever como os seres humanos funcionam).
tambm por isso que mutaes em um mesmo gene podem causar doenas independentes no
olho e no rim. O modo como um gene particular controlado e o momento em que isso ocorre
podem determinar funes muito diferentes em tecidos inteiramente diversos.
H tantos fatores que desconcertam e complicam na biologia que a lgica subjacente se
perde na confuso da vida celular real: variao imprevisvel em meio sofisticao insondvel.
Um genoma, com seu conjunto completo de instrues biolgicas, assemelha-se partitura de
uma sinfonia. A plena beleza expressa numa execuo, complementada por interpretao e
nuance que no esto apenas codificadas em trinados, colcheias e mnimas escritos na pgina.
Por vezes no chamamos a complexidade aparentemente inescrutvel de um sistema vivo de
msica, mas de rudo. Trata-se de uma combinao de todas as coisas que no conseguimos
explicar por completo: coisas como variao natural nos comportamentos de genes, protenas ou
interaes moleculares ainda no descritas. A progresso natural da biologia como cincia para a
biologia sinttica significou encarar as nuances dessa confuso e esmiu-la. No corao da
biologia sinttica h o desejo de evitar essa desordem mediante a criao de novas formas de
vida cujos conjuntos de circuitos e programaes sejam claros, simples e, acima de tudo,
construdos no para a sobrevivncia, mas para um propsito.

Circuitos matadores

Imagine um programa, um pedao de DNA, que entra numa clula e diz: Se for cncer, faa
uma protena que mate a clula cancerosa; seno, retire-se. Esse um tipo de programa que
somos capazes de escrever, implementar e testar em clulas vivas neste momento.
Essas so as palavras de Ron Weiss, um dos fundadores do moderno ramo da engenharia que
a biologia sinttica e hoje professor no Massachusetts Institute of Technology (MIT). Ele est
descrevendo um estudo de importncia capital que sua equipe publicou no outono de 2011.
Usando a lgica e a linguagem dos circuitos de computador combinados com componentes
biolgicos, eles haviam construdo uma ferramenta que agia efetivamente como assassino do
cncer.
O circuito exterminador uma montagem de componentes de DNA construda para cumprir
uma s misso: identificar e matar um tipo de clula cancerosa. Depois de construdo, o circuito
insere-se no cdigo gentico de um vrus, ele prprio modificado para nos assegurar controle
sobre suas tendncias naturais. Quando apresentado a clulas malignas, ele as infecciona e, como
fazem muitos vrus, acrescenta seu genoma sinttico (incluindo o programa assassino) ao DNA
do hospedeiro. Por fora do ardil natural das infeces virais, essa clula hospedeira decodifica
inadvertidamente o circuito matador e executa o programa que provocar sua prpria runa.
O circuito assassino representa um conjunto de cinco questes, cada uma das quais busca a
presena de uma molcula particular que s esse tipo de clula cancerosa possui. Se alguma das
respostas a essa interrogao molecular for negativa, o programa para, fecha-se e deteriora-se, e
a clula continua a viver sua vida normal. Se, no entanto, a resposta a todas as cinco questes de
identificao for Sim, segue-se o assassinato. O cdigo no circuito contm um gene que
desencadeia o programa de suicdio incorporado na prpria clula hospedeira. Ele um assassino
consciencioso e persuasivo, que assegura, com meticulosidade, que sua presa realmente o alvo
e depois lhe pede gentilmente que se mate.
O circuito gentico complexo, mas lgico. Embora possa parecer banal uma analogia to
literal com os circuitos integrados, h de fato, incorporados nesse sistema, clculos lgicos
especficos inteiramente derivados da eletrnica. Ele usa o mesmo processamento lgico
simplificado de componentes eltricos como portas E. Emprega tambm portas no, que mudam
rapidamente o input de ligado para desligado, e vice-versa.
Essa clula maligna particular talvez seja o laboratrio de cncer mais bem estudado do
mundo, a clula HeLa. Trata-se de uma linhagem imortal de clulas que foi extrada do cncer
cervical de uma jovem mulher negra chamada Henrietta Lacks. Uma raspadura obtida do
cncer no colo de seu tero num laboratrio, em 1951, logo foi identificada como imortal.
Clulas normais envelhecem, ficam fatigadas e acabam perdendo a capacidade de se dividir. A
consequncia a morte celular. Mas as clulas HeLa reproduzem-se indefinidamente em
decorrncia de defeitos idiossincrticos em suas prprias placas lgicas genticas. A tenaz
imortalidade das clulas HeLa representa que elas so as clulas malignas mais estudadas e
esmiuadas que existem, tendo sido compartilhadas e espalhadas entre laboratrios no mundo
inteiro. Com uma impresso digital to bem estudada, elas se tornaram um valioso terreno de
provas para um circuito gentico intensamente manipulado. Como a maioria das clulas no
conhecida em tantos detalhes, uma identificao segura ainda no seria possvel. Mas, no caso de
clulas HeLa, as cinco questes moleculares permitem reconhecimento preciso, to completo
que se qualifica como aquilo que em eletrnica conhecido como valor verdadeiro. A preciso
do circuito assassino tal que ele de fato um computador biolgico.
Esse sistema representa o nvel mximo alcanado pelo campo nascente da biologia sinttica.
Como todas as terapias potenciais, ele tem um longo caminho a percorrer antes de se tornar
disponvel para os seres humanos. At hoje, s foi testado em clulas sobre placas. Em seguida
viro os testes com animais, em que os graus de controle sero ainda mais desafiados pelo rudo
mais catico e dinmico de uma criatura funcional.3 Como uma terapia, porm, sua preciso
potencialmente impressionante. O fato de o cncer ser uma multido de doenas e estar
propenso a mutaes medida que se espalha e cresce significa que estamos mirando um alvo
sempre em movimento. A quimioterapia e a radioterapia continuam a ser as formas mais
eficientes de ataque aos tumores, embora ambas sejam danosas tanto para as clulas malignas
quanto para as saudveis. Comparado ao bombardeio arrasador e aos danos colaterais da
radioterapia, esse novo tratamento do cncer o disparo certeiro desferido por um exmio
atirador de tocaia.

Relgios e ondas

As primeiras incurses na criao de componentes biolgicos ocorreram em 2000, com dois


artigos publicados na revista Nature anunciando alegremente a ruptura da barreira entre biologia
e eletrnica. Uma delas foi a criao de um relgio biolgico na bactria E. coli. Emendando trs
sees de DNA que impedem naturalmente outros genes de produzir suas protenas, Michael
Elowitz e Stanislas Leibler, na Universidade Princeton, construram um circuito que dita no
apenas que um gene est ligado ou desligado, mas que ele est ligado e desligado numa onda
oscilante. A onda continua medida que cada gene inverte o output do seguinte: um desliga o
outro, que liga o outro, e assim por diante. As clulas tm um ciclo natural medida que se
reproduzem e se desenvolvem, mas esse novo circuito no estava ligado a ele. O output do
circuito era a expresso do gene para protena verde fluorescente, e, assim, as clulas
manisfestavam uma oscilao verde lenta.
A segunda parte componente foi feita por uma equipe da Universidade de Boston liderada por
Timothy Gardner. Eles construram uma verso gentica de um tipo de componente eltrico
conhecido como biestvel, ou, mais evocativamente, flip-flop. Interruptores desse tipo
alternam rapidamente entre dois estados, mas cada uma dessas posies tem uma funo. Voc
aperta o boto num CD play er para lig-lo e novamente para deslig-lo, porm, na posio
desligado, o aparelho est na verdade em stand-by, no desconectado da rede eltrica. Ele tem
dois estados, LIGADO e LIGADO STAND-BY, e a alternncia entre os dois inteiramente
reversvel.
Alm de adaptar a linguagem da vida para construir engenhocas artificiais, esses dois
projetos de engenharia tambm adotaram a linguagem da eletrnica para transmitir o ethos de
projeto funcional que esses dispositivos estavam introduzindo na biologia. Eles receberam nomes
que pareciam sados diretamente do lxico da eletrnica (ou talvez da fico cientfica): o
circuito da onda fulgurante ganhou um novo apelido de sonoridade eletrnica repressilador; e o
dispositivo flip-flop biestvel tomou seu nome emprestado de um componente eltrico j
existente: um interruptor de basculante.
Essas duas invenes so corretamente vistas como as primeiras peas da biologia sinttica:
ferramentas microscpicas projetadas para executar um programa, mas construdas a partir de
DNA. A oficina da biologia gentica abriu-se com a construo dessas duas primeiras peas, e o
que se seguiu foi uma cascata de outros mecanismos, ferramentas, partes e peas, todos feitos de
DNA, tomados, modificados, fundidos e redesenhados a partir da caixa de ferramentas da
evoluo. Nos ltimos dez anos, passamos das inseres da engenharia gentica que rompiam a
barreira das espcies para uma caixa de ferramentas em constante expanso, abarrotada de
pequenos dispositivos. Temos agora interruptores, geradores de pulso, timers, osciladores,
contadores e calculadoras lgicos. As combinaes desses e de muitos outros componentes
significou que nosso controle de sistemas vivos estende-se a genes, funo de protena,
desenvolvimento e reproduo celular, metabolismo e as maneiras pelas quais as clulas falam
umas com as outras.
Menos obviamente prtico que o programa assassino de cncer, mas no menos complexo,
foi um circuito construdo em 2009 por Jeff Hasty e colegas na Universidade da Califrnia.
Ciclos que registram o tempo so fundamentais para a maioria das coisas vivas. Conhecidos
como ritmos circadianos, eles determinam todos os tipos de padro de comportamento em
relao ao fluxo do tempo atravs de nossas vidas, como a passagem do dia e da noite.
Dependemos de clulas para regular nosso prprio metabolismo, tal como na liberao rtmica
de insulina e na orquestrao dos ciclos de sono, ambas perturbadas em pessoas que trabalham
regularmente em expedientes noturnos. A maneira como esses timers funcionam est
parcialmente compreendida, mas eles usam mecanismos similares aos relgios biolgicos
artificiais incorporados nesses circuitos sintticos. Hasty queria projetar circuitos sintticos que
criassem um pulso regular de atividade, como o tique-taque de um relgio. Esses chamados
osciladores funcionam como marcadores de tempo celulares, determinados pelo cuidadoso
projeto de um circuito completo de atividade gentica dentro de uma bactria, trs genes
seguindo um conjunto circular de instrues. Imagine trs amigos parados nos vrtices de um
tringulo, a vinte metros um do outro, todos olhando para dentro. Cada um tem uma cadeira, mas
eles s se levantam quando o amigo sua direita se senta. Quando o primeiro se levanta, o
segundo se senta e o terceiro se levanta. O primeiro ento se senta, o segundo se levanta, e assim
por diante. Essa resposta contnua chamada circuito de feedback negativo, e o tempo de reao
dos trs cria um relgio de atividade. Ele no funcionar com quatro pessoas, pois o fluxo
terminar quando a quarta pessoa estiver sentada, no fim de uma rodada, e isso no estimular a
primeira a se sentar de novo.
De fato, esse circuito continua enquanto as pessoas conseguirem lev-lo adiante. Mas no h
output. Agora imagine que, alm de se levantar e sentar, o primeiro sujeito, e somente ele, deve
tambm cantar uma nota, mas s quando estiver de p. Enquanto o jogo continuar com base
nessas regras, ele cantar em circuitos completos alternados. Se voc fechar os olhos e s ouvir o
output, escutar um repente regular de canto. Isso um oscilador biolgico bsico.
Num oscilador biolgico sinttico, quando o gene A est ativo, ele fecha o gene B, que ativa o
gene C, que completa o circuito fechando o gene A. O programa construdo a partir dessas trs
partes componentes genes e suas sequncias de ativao e importado para as entranhas de
uma bactria. Na verso que envolve pessoas, a frequncia do repente de canto determinada
pela velocidade com que cada um dos amigos reage ao vizinho. Na clula, a velocidade em
que a protena produzida. O gene A traduzido numa protena funcional, que se liga ao
interruptor liga/desliga para o gene B, e assim por diante, mas cada passo demanda tempo. A
funo do relgio um resultado dessa demora. Como no caso da nota cantada, o output do
circuito em bactrias poderia ser a expresso de uma protena fluorescente, que se ligar e
desligar lentamente com um pulso regular. Como em biologia sinttica, o objetivo extrair
controle desses circuitos de DNA, e a capacidade de fazer ajustes finos desejvel. O acrscimo
de outros circuitos completos e outros mecanismos pode conferir maior controle frequncia e
intensidade do output, aumentando a complexidade da lgica.
Uma limitao desse relgio biolgico bsico que o circuito oscilador simples
independente. Em termos de relgio, isso seria como se todos os relgios de pulso marcassem o
tempo perfeitamente, mas o de cada pessoa estivesse ajustado segundo uma zona de tempo
diferente. A hora s de extrema utilidade se todos ns sincronizamos nossos relgios; do
contrrio, assistir ao Ten Oclock News seria uma loteria. Em bactrias, a manipulao de uma
nica clula para produzir um pulso regular uma coisa, mas transformar esse pulso numa onda
sincronizada em toda uma populao de bactrias muito mais difcil. E. coli se reproduz a
intervalos de cerca de vinte minutos, sendo portanto uma multido alvoroada sobre a qual
exercer controle militar.
No programa de Jeff Hasty, porm, o circuito tambm envia um sinal para todos os vizinhos,
o que sincroniza o incio do circuito. Em vez de trs pessoas num tringulo, passamos a ter algo
como uma ola mexicana num estdio de futebol. Voc ainda se levanta quando seu vizinho se
senta, mas isso envolve um enorme nmero de pessoas ao mesmo tempo. O pulso, o output de
uma torcida vigorosa, berrado no por uma s pessoa, mas por milhares. As bactrias,
aceleradas num vdeo time-lapse, pulsam com um verde brilhante, como uma ondulao
luminosa. Qualquer pessoa que algum dia tenha participado de uma ola mexicana decente sabe
que ela algo bem impressionante. Mas essas populaes de bactrias so muito maiores que a
capacidade de qualquer estdio. O ato de induzir uma sincronia perfeita nessas bactrias
sintticas assemelha-se mais a fazer todos os sinais de trnsito do mundo ficarem verdes
exatamente ao mesmo tempo.
Isso realmente uma proeza admirvel, e mostra o nvel de controle que esses novos
circuitos sintticos nos proporcionam. Mas tambm tem valor potencial como ferramenta para
sincronizar o output de uma populao de clulas sintticas.
A funo da insulina dizer ao corpo como e quando processar carboidratos e gorduras
depois que voc comeu algumas batatas assadas. A glicose o combustvel que fornece energia
s clulas (e, por extenso, aos organismos), mas a concentrao desse acar simples em seu
sangue um equilbrio delicado: o excesso ou a insuficincia so mortalmente perigosos.
Recebemos glicose diretamente, atravs de nossa dieta, e outros alimentos so convertidos em
glicose em nossos msculos e no fgado, onde ela armazenada sob outras formas, como
gordura. Desenvolvemos toda sorte de mecanismos e cheat codesa biolgicos que asseguram que
nossas clulas sejam alimentadas por um fornecimento constante de glicose, quer tenhamos
acabado de desprezar uma barra de chocolate, quer tenhamos passado horas sem comer. A
insulina um hormnio essencial para a manuteno dos nveis de glicose, o que se faz instruindo
clulas em vrios tecidos a absorver glicose da corrente sangunea. Com isso, os nveis de glicose
no sangue so reduzidos e a converso de glicose a partir de gordura armazenada interrompida.
A produo de insulina provocada por nvel elevado de glicose no sangue e interrompida
quando ele atinge um limiar, sendo portanto, em si mesma, parte de um circuito de feedback.
Num detalhe importante e curioso sobre a produo de insulina no corpo, mesmo quando
estamos em repouso, o nvel desse hormnio no fica imvel. Ele oscila suavemente num ritmo
de entre trs e seis minutos, seja qual for o nvel de glicose no sangue, como um carro em
marcha lenta. Quando esse processo no funciona bem, o resultado a diabetes. Um circuito
sinttico hipottico capaz de oscilar sua produo de insulina (ou de qualquer coisa) numa
populao inteira de clulas, em vez de em uma nica clula, seria de enorme benefcio, ao
imitar o pulso natural e constituir, em ltima anlise, uma terapia potencial para diabticos.
Como no caso do programa assassino de cncer de Ron Weiss, esses circuitos biolgicos
artificialmente construdos no esto prontos para uso clnico. Aquele programa desenvolvido
em um vrus modificado, incapaz de se reproduzir e de executar seu software sem a maquinaria
de clulas vivas existentes. O vrus tem de infectar a clula antes de efetuar seu diagnstico e
executar sua sentena. Mas a maioria dos circuitos de biologia sinttica integrada nos genomas
de bactrias. No alcanamos o ponto de testar sistemas de circuitos sintticos em seres
humanos. Muito antes de chegarmos l, teremos de enfrentar o problema no insignificante de
levar o software e sua embalagem at o lugar em que ele necessrio. As prprias bactrias so
apenas recipientes que transportam o software e fornecem a mecnica de produo do output
daquele circuito. Os seres humanos esto cobertos de bactrias e cheios delas. Uma vez que so
muito menores que as clulas humanas, podemos transportar talvez dez vezes mais clulas
bacterianas que as nossas prprias clulas. Quase todas so benignas ou benficas, especialmente
no nosso intestino, onde bilhes de bactrias, ou o microbioma, desempenham funes digestivas
inerentes. No entanto, como nosso corpo bom em detectar e destruir espcies invasivas, uma
bactria geneticamente aperfeioada teria de ser indetectvel pelo sistema imunolgico,
revestida num manto de invisibilidade molecular, para que as legies de clulas de alarme contra
intrusos que patrulham nossos corpos no consigam identificar a clula sinttica. Mas nossos
sistemas imunolgicos tiveram bilhes de anos para desenvolver a capacidade de detectar
invasores estranhos, e bactrias sintticas a vagar seriam severamente policiadas. Assim, uma
alternativa seria empacotar as bactrias e escond-las do sistema imunolgico. Por mais que isso
soe improvvel, a Nasa est trabalhando precisamente nesse problema.

Sob a pele

A base da Nasa em Ames assemelha-se a uma cidadezinha americana qualquer, prxima via
expressa Californiana, com ruas largas, praas gramadas, construes de estuque falso e
quilmetros de cu azul. A diferena que, em meio a essas quadras comuns, h colossais
panegricos ao otimismo aparatoso dos anos 1950, de que a cincia geraria o futuro. O maior
tnel de vento do mundo ocupa vrias quadras, e seu interior grande o suficiente para
acomodar um avio. A entrada de ar uma gigantesca grade preta retangular, to grande que
difcil estimar sua colossal escala, at que espreitei alguns cientistas da Nasa jogando hquei de
rua na base. Depois, quatro blocos rumo ao norte so ocupados por um gargantuesco hangar
erguido nos anos 1930 para abrigar a construo de dirigveis, as efmeras aeronaves rgidas do
passado. Num ambiente estril, ali perto, a prxima espaonave com destino Lua chamada
Ladee paira, enquanto seu motor de propulso baseado em dixido de carbono que levita
testado pelos tcnicos.
A Nasa existe para explorar o espao, claro. No canto de uma vasta encruzilhada ergue-se
um prdio cuja fachada de concreto pontilhada de moldes de impactos de meteoritos. L
dentro, os pesquisadores do programa de biologia sinttica da Nasa esto usando o
microscopicamente pequeno para solucionar alguns dos maiores problemas que se interpem
entre ns e nosso desejo de explorar mundos novos e estranhos.
O Sol inclemente em Ames; ao mesmo tempo que traz energia e vida para a Terra, ele
muito menos caridoso fora dela. De maneira espordica e imprevisvel, nossa estrela arremessa
uma carga explosiva de partculas de energia extremamente elevada, com fora suficiente para
perturbar geradores de energia na Terra. De maneira semelhante, outras estrelas no Universo
ejetam a partir do espao profundo um contnuo bombardeio de partculas de alta energia que
banha a galxia em radiao. Alm do manto protetor de nossa atmosfera, labaredas solares e
raios csmicos galcticos combinam-se para constituir um dos perigos mais restritivos para a
explorao do espao pelo homem. A radiao, inclusive nessas formas interestelares, tem o
efeito de cortar o DNA aleatoriamente. Muitas vezes isso no um problema: a reparao do
DNA uma importante indstria dentro de nossas clulas, com legies de protenas revisoras
labutando para assegurar que erros no cdigo, ou discordncias entre os dois filamentos da dupla-
hlice, sejam identificados e remendados. Ocasionalmente, o dano pode ocorrer em um dos
muitos genes que controlam a diviso celular. Se isso acontecer num gene cujo objetivo instruir
uma clula a parar de se duplicar, h o incio de um cncer proliferao celular descontrolada
e irrestrita. Inversamente, a fragmentao dos muitos genes necessrios para a existncia
continuada da clula pode resultar no comeo de um programa de suicdio celular natural.4
Morte ou proliferao celulares irrestritas so igualmente ms para o bem-estar de um
organismo. Estamos constantemente expostos a radiao nociva, mas em geral em pequenas
doses ou de maneira pouco frequente. por isso que, quando tiramos uma radiografia num
hospital, o tcnico se pe atrs de uma tela protetora. Para ns, esse um evento raro, mas os
tcnicos, caso no estivessem protegidos, seriam expostos dezenas de vezes por dia, com
consequncias potencialmente mortais. No espao, a exposio contnua.
Em 2005, a Federal Aviation Administration dos Estados Unidos iniciou uma viagem de ida e
volta virtual a Marte, incluindo uma estada de catorze meses no planeta vermelho. Eles
calcularam a quantidade de exposio radiao espacial que astronautas receberiam e
deduziram que eles passariam a correr risco de cncer significativamente aumentado ao longo
de toda a vida (bem como grande nmero de outros males, entre os quais catarata e esterilidade),
em consequncia de exposio a raios csmicos e uma tempestade radioativa de uma labareda
solar. O limite seguro era uma viagem de cerca de 80 milhes de quilmetros, isto , pouco
menos que metade da distncia que nos separa do Sol. A blindagem da espaonave evita a
exposio radiao para os seres humanos, mas ela pesada, e peso uma questo crtica
quando se calculam a propulso e o custo para se sair do planeta. A hostilidade do espao
significa que nossa biologia to restritiva quanto nossa engenharia quando se trata de explorar os
cus.
Nossos sistemas imunolgicos tm defesas inerentes que combatem os efeitos do dano
radioativo. Temos esses mecanismos prontos para lidar com a radiao muito mais fraca
ultravioleta que causa queimaduras de Sol e outras formas de dano ao DNA. Quando esses
danos so detectados, o DNA rompido ativa genes que produzem pequenas molculas chamadas
citocinas, que passam rapidamente de clula para clula, desencadeando cascatas de programas
de reparo. Mas elas tm alcance limitado, especialmente em resposta exposio prolongada a
radiao nociva, e por isso que s vezes se usam terapias de citocina para aumentar a resposta
natural do organismo.
David Loftus e sua equipe na Nasa, em Ames, esto projetando um programa sinttico em
que o input um sistema de deteco para radiao ou dano de DNA, e o output a liberao
controlada de citocinas. Esse programa diferente do assassino de cncer porque o output uma
molcula que estimula o sistema imunolgico natural do prprio corpo. Assim, executar o
programa num vrus que infectar uma clula no vai adiantar. A produo precisa ser
independente. Portanto, uma bactria a fbrica celular sinttica mais apropriada. A questo
como introduzir uma bactria em seres humanos de maneira segura, sem provocar uma resposta
imunolgica.
O circuito ainda no foi construdo, pois essa construo enfrentar todos os problemas de
qualquer projeto de biologia sinttica. Mas Loftus e sua equipe fizeram avanos assombrosos na
construo da cpsula para conter as clulas. Como se o sistema de circuitos de biologia sinttica
no fosse suficientemente impressionante, a biocpsula feita de nanofibras de carbono. Um
minsculo molde pousa sobre uma agulha hipodrmica, que est ligada a uma bomba. Isso
mergulhado numa suspenso contendo as nanofibras de carbono, e elas so literalmente sugadas
para o molde, para formar uma cpsula. Essa bolinha tem 0,5 centmetro de comprimento e 0,5
milmetro de largura, no muito maior que esta letra l. A cpsula minscula, mas, como as
bactrias so muito menores, ela tem tamanho suficiente para aprisionar dezenas de milhares
delas.
Ela tambm biologicamente neutra, o que significa que as nanofibras de carbono no
provocaro uma resposta imunolgica e no causaro nenhum mal ao astronauta. Mas, com
graa casual e providencial, elas se agrupam numa malha emaranhada e porosa como um feixe
de vermes congelados, s visveis ao microscpio eletrnico. As lacunas que percorrem essa
malha so pequenas demais para dar passagem a bactrias, mas grandes o bastante para permitir
que pequenas molculas, como as citocinas que combatem o dano causado pela radiao, se
filtrem. A ideia bastante simples. As clulas bacterianas sintticas so colocadas dentro da
cpsula, e a cpsula implantada sob a pele dos astronautas. As clulas contm um programa
que produz e libera citocinas quando elas so expostas radiao solar e csmica. Isso no
requer nenhum diagnstico ou interveno, e, de forma elegante, o tratamento para a doena
induzido por sua causa.
Imagine essa tecnologia aplicada a problemas humanos prticos menos exticos: um circuito
celular sinttico, permanentemente implantado sob a pele, para liberar o tratamento para uma
doena sem que o paciente sequer tenha conhecimento disso. O potencial fabuloso. Os que
sofrem de diabetes sobressaem como bvios beneficirios. As clulas no pncreas que produzem
insulina poderiam ser substitudas por organismos sintticos que servem ao mesmo propsito. Em
vez de injetar insulina, um circuito sinttico carregado por bactrias escondidas numa casca de
biocpsula produziria insulina de acordo com as necessidades flutuantes do organismo. Em
princpio, o paciente jamais se daria conta de que esse processo estava ocorrendo.
Como sempre acontece com invenes muito novas e no testadas, esse mecanismo exato
pode dar em nada. Talvez ele se revele impraticvel ou dispendioso demais para uso geral. Na
melhor das hipteses, o sistema levar uma dcada para estar disponvel: a cpsula ainda est em
desenvolvimento, e os prprios circuitos sintticos ainda levaro anos para ser testados em
animais, e portanto anos para ser testados em seres humanos. Mas isso mostra como a
necessidade de solues prticas para problemas complexos tipifica a natureza renascentista da
biologia sinttica.

Teste de realidade

O que descrevi a promessa e a esperana desse novo projeto de engenharia. Delineei alguns
dos pontos altos em matria de ambio e sucesso nesse esforo emergente. Hoje, no h muitos
mais, embora o volume de publicaes sobre biologia sinttica esteja crescendo depressa. fcil
deixar-se envolver pela propaganda quando o rigor do laboratrio traduzido em termos
destinados a no especialistas designados para informar, empolgar ou gerar crticas. Dito isso, a
comparao com a engenharia eltrica foi feita pelos prprios bilogos sintticos, numa tentativa
de padronizar as partes do DNA em peas componentes, com o objetivo de construir mquinas
vivas.
Mas a realidade que referir-se a coisas vivas como mquinas tratar superficialmente os
fatos da vida. Clulas e organismos so mquinas cuja complexidade muitas ordens de
magnitude maior que a de um motor, de uma linha de produo ou mesmo de um computador. A
engenharia, como a evoluo, um processo iterativo. O tempo inconcebivelmente longo
transcorrido desde a origem da vida na Terra significa que o nmero de testes, fracassos,
reconstrues e mais testes pelos quais os mecanismos da vida passaram incrivelmente grande.
Cada organismo que existiu algum dia foi uma iterao num teste perptuo de funo de
engenharia, no guiado e cruel: ir isso viver, e viver para se reproduzir? Isso se aplica, claro, a
qualquer espcie ou organismo, mas a verdadeira seleo sob escrutnio na evoluo de genes
individuais, as partes componentes naturais funcionais dos seres vivos. Eles trabalham em
associao, em redes, em cascatas e em caminhos dinmicos sinuosos. A complexidade de um
organismo vivo tem bilhes de anos de testes bem-sucedidos atrs de si, e isso significa que
simplificar ou projetar circuitos genticos na forma de ferramentas simples (ou at complicadas)
difcil. Como disse Nature, em 2009, o especialista em biotecnologia Rob Carlson, h muito
poucas operaes moleculares que compreendemos to bem quanto compreendemos uma
chave-inglesa, uma chave de parafuso ou um transistor.
O teste para projetos em engenharia : ele funciona?, e, mais precisamente, funciona
como foi projetado para funcionar?. Nesta nova disciplina, a resposta para muitos dos vrios
milhares de circuitos e partes atualmente disponveis um simples no. A complexidade da
biologia em clulas gera rudo variao imprevisvel que mascara ou subverte o output
pretendido. O chamado repressilador, que marcou o incio da biologia sinttica em 2001, ao fazer
bactrias piscarem verde fluorescente, funcionou impressionantemente bem. Mas a surpresa foi
que nem todas as clulas operaram da mesma maneira. O pulso do brilho ficou longe de ser
estvel: algumas clulas eram mais brilhantes que outras, algumas mais lentas, outras pulavam
uma batida. No impossvel compreender as razes disso, porm, a complexidade gera
inescrutabilidade, e isso torna mais difcil satisfazer o ethos reducionista da engenharia. Mais uma
vez, a analogia com a engenharia eltrica tambm se sustenta aqui. J fazemos placas lgicas
digitais to densas e cheias de software que no compreendemos inteiramente seu
comportamento. por isso que os computadores travam. Esses sistemas so construdos para um
objetivo e testados e retestados a fim de se assegurar que tero xito nas tarefas para as quais os
projetamos. Mas isso no significa que conheamos todos os seus comportamentos possveis. No
projeto de hardware de computadores, a anlise de fracassos decisiva, assim como na gentica
humana, durante um sculo. Sempre descobrimos genes e suas funes apenas aps observ-los
falhar, isto , quando eles causam doena. O hardware bem-projetado construdo para
enfrentar o rudo imprevisto e no previsvel que a inescrutvel complexidade pode abrigar.
Os problemas causados por genes que sofreram mutao resultando em doena tm uma
origem clara, desde que saibamos onde e como procur-los. Nos programas da biologia sinttica,
que desejaramos fossem cada mais simplificados, os erros espontneos que so problemticos.
Decodificar os mecanismos falhos da doena e projetar programas bem-sucedidos decerto so
os objetivos da gentica e da biologia sinttica. Mas compreender o rudo e lev-lo em conta
ainda um obstculo desorientador. Em razo disso, at agora, as partes, os circuitos e os
hospedeiros vivos tornam distante o sonho de um kit padronizado de construo de DNA. Mas
esse um campo jovem, imaturo e cheio de esperana. Tipicamente perspicaz, o decano da
fico cientfica no sculo XX, Isaac Asimov, observou que os melhores momentos na cincia
no so aqueles em que dizemos heureca, mas aqueles em que dizemos Humm, isso
interessante. Aquele rudo, o fato de que esses programas no funcionam exatamente na
maneira projetada, sem sombra de dvida um problema, mas um problema extremamente
interessante.
Apesar disso, os paralelos com a computao impressionam. As lendas em torno das razes
da indstria dos computadores descrevem futuros bilionrios, como Steve Jobs e Bill Gates
mexendo com eletrnica em suas garagens, brincando com componentes e cdigos para fazer
melhores hardwares e softwares. Os resultados foram a Apple e a Microsoft, um computador em
cada mesa de trabalho, a internet, o Google e um smartphone em cada bolso.
Enquanto as revolues polticas tendem a ser definidas por acontecimentos a tomada da
Bastilha, ou a execuo de um chefe de Estado , a revoluo cultural da computao no foi
desencadeada por nenhum ato singular. Da mesma maneira, operrios na Europa do sculo XIX
perceberam que novssimas tecnologias, como os teares mecnicos e as mquinas de fiar
hidrulicas, estavam introduzindo mudanas importantes em suas vidas de trabalho, e essas
alteraes ocorriam em certo ritmo. Mas a agregao dessa mudana e sua significao eram
desconhecidas na poca, e a expresso Revoluo Industrial foi introduzida muito mais tarde.
Os profissionais da biologia sinttica esto criando de uma maneira nova para a biologia e para a
cincia, e tudo no perodo de uma dcada. Essa manipulao de 4 bilhes de anos de evoluo
especificamente para a criao de ferramentas biolgicas artificiais uma revoluo que est
ocorrendo agora, j.
O aforismo de Richard Fey nman crucial: para compreender alguma coisa voc precisa
primeiro ser capaz de constru-la. Os termos, a linguagem usada e as tcnicas so todos tomados
de emprstimo do ethos solucionador de problemas dos engenheiros, uma viso reducionista de
funo atravs de um projeto. A extenso de processos naturais para servir a anseios da
humanidade no nova, mas raras vezes foi empreendida incorporando uma noo to clara de
construo. Embora os fundadores da biologia sinttica tivessem em mente a engenharia eltrica,
a metfora que mais pegou foi um brinquedo. Exatamente como o DNA, o Lego
universalmente adaptvel, com as peas projetadas para se encaixar, quer provenham de um
conjunto que forma uma nave espacial, quer de um castelo. De maneira semelhante, os bilogos
sintticos tentaram tornar intercambiveis os componentes individuais de seus circuitos, de tal
modo que a construo de novos circuitos no seja estorvada pelo rudo natural da biologia. Com
isso em mente, esprito de inveno, engenho e criatividade foram incorporados biologia
sinttica de maneira singular. No entanto, medida que essa revoluo se desdobra, questes de
propriedade, legalidade e tica se impem a ns com urgncia.

a Cheat codes: em videogames, a expresso designa uma linha de texto ou srie de comandos
que podem ser usados para mudar o comportamento de um jogo, alterar a aparncia e as
habilidades de um personagem, saltar nveis ou ter acesso a outras caractersticas ocultas. (N.T.)
3. Remixagem e revoluo

Nada se perde, nada se cria, tudo se transforma.


ANTOINE-LAURENT LAVOISIER, Elementos de qumica

A EVOLUO o empreendimento mais criativo que j existiu. Nada se aproxima da


diversidade, sofisticao e beleza que ganhou existncia nas mos do DNA e da seleo natural.
Em seu cerne esto duas palavras que carregam uma acepo potencialmente depreciativa:
cpia imperfeita. Em outro sentido, a evoluo o exemplar supremo daquela mxima que
Isaac Newton tornou clebre Se vi mais longe, foi por estar de p sobre os ombros de
gigantes , descrevendo habilmente a natureza derivativa da criatividade, ao mesmo tempo que
a exemplificava, pois Newton tomava e adaptava essa ideia do filsofo Bernard de Chartres, do
sculo XII, que por sua vez provavelmente se referia a antigas verses gregas da mesma ideia. A
mxima do qumico francs Antoine-Lavoisier no alto desta pgina foi um comentrio sobre a
natureza da matria, mas aplica-se igualmente bem a energia, biologia e ideias: Nada se perde,
nada se cria, tudo se transforma.
fcil aplicar um princpio similar cultura, em que, embora possa no haver nada
completamente novo sob o sol, a criao de novas ideias ainda fruto de cpia, adaptao e
transformao do que veio antes. Em msica, por exemplo, no muito difcil traar um
caminho evolutivo de influncia, atravs de vrios sculos de criatividade, de Bach a Hay dn, a
Mozart, a Beethoven, a Mendelssohn. Ou, nos tempos modernos, de Chuck Berry aos Beatles, a
David Bowie, ao punk, a Joy Division, aos Smiths, aos Stone Roses etc.
A natureza da cpia na msica mudou nos anos 1960, quando emergiu um novo mtodo de
criao musical que no se parecia em nada com o que havia antes. A tecnologia permitiu aos
msicos no apenas copiar e modificar o que j existia, mas tom-lo emprestado, apropriar-se
dele e roub-lo. O sampleador permitiu aos produtores de msica tomar a bateria de uma faixa
existente, o naipe de sopros de outra e os vocais de uma terceira para criar um novo som.1 Como
tcnica para criar novos sons, o sampling, ou colagem, realmente comeou nas ruas de Nova
York, com o cenrio emergente do hip hop, nos anos 1970. DJs do Bronx entretinham multides,
homenageavam seus antepassados musicais e criavam novos sons radicais, ao mesmo tempo
misturando LPs em pratos de toca-discos gmeos. Eles tomavam o riff ou batida de um e
jogavam ritmo ou letras de msica de outros por cima, muitas vezes usando discos de soul como
seus licks. Em apresentaes ao vivo em clubes, e mais tarde em gravaes, o que faziam no
era tocar msica nova, mas cri-la mediante adaptao e remixagem de sons existentes. No
incio dos anos 1980, mquinas de samplear eram usadas para registrar curtos extratos de uma
gravao, de modo que pudessem ser integrados em nova melodia. Era possvel lente-los,
aceler-los, repeti-los ou estic-los para ajudar a criar um som inteiramente novo, derivado de
sons anteriores e construdo sobre seus ombros.
Biologia sinttica remixagem. O ethos desse cenrio emergente marcado pela
criatividade irrestrita e sem precedentes que caracteriza uma cultura da remixagem. Os DJs no
precisavam tocar instrumentos especficos como virtuoses para criar novos sons. Em biologia
sinttica, os criadores no precisam ser geneticistas, tcnicos em DNA nem bilogos para
construir novos organismos. O princpio apenas criar.
Desde o comeo, muitos pioneiros da biologia sinttica esforaram-se para formar um
movimento de cincia democrtica e aberta, em que haja livre troca de ideias, tcnicas e
materiais. Se o ano zero dessa nova revoluo industrial foi o repressilador e o interruptor
basculante, em 2001, os primeiros grandes movimentos aconteceram cerca de dois anos depois.
Na cincia, a passagem da manipulao em laboratrios para um movimento ocorreu em 2003 e
2004, com a emergncia de dois fenmenos que se tornariam emblemticos do esprito da
biologia sinttica.
O primeiro deles foi a fundao do Registry of Standard Biological Parts. Apesar de tudo que
se diz sobre a maravilha do alfabeto gentico intercambivel, necessrio muito cdigo para
fazer uma forma de vida. Isso significa que h inmeras possibilidades a examinar, e sobretudo
muitas coisas para dar errado quando remixamos nosso cdigo. De forma irnica, para ser
aberta e livre, de modo a ser usada por todos os demais, uma coisa precisa ser codificada e
padronizada. Pense como aborrecido o fato de os plugues eltricos serem diferentes nos
diversos pases, ou de que os carregadores de telefone mudem de modelo a todo instante. A
linguagem da msica universal, mas precisamos de toda uma bateria de adaptadores e plugues
para execut-la em diferentes pases. No entanto, porcas e parafusos so padronizados, de modo
que o tamanho das roscas ou as dimenses das tarraxas no precisam ser reinventados cada vez
que voc quiser montar um mvel.
Transfira isso para a quantidade ilimitada de informao codificada contida nos novos
circuitos de componentes da biologia sinttica. Dezenas, e depois centenas, de laboratrios
comearam a construir suas prprias engenhocas e dispositivos, todos os quais s funcionam em
circuitos incorporados a genomas de seres vivos (ou, em alguns casos, vrus quase vivos). Sem
padronizao, o compartilhamento til fica tolhido. Assim, em 2003, Drew Endy, em Stanford,
Tom Knight (ento no MIT) e Christopher Voigt, na Universidade da Califrnia em So Francisco
(UCSF), conceberam o BioBrick. Trata-se de uma maneira til e simplificada de conectar
pedacinhos e componentes de modo que cada pessoa que se integre no precise redesenhar cada
ideia e cada parte por si mesma. Os BioBricks so para a gentica o que o sampleador para a
msica um sistema para libertar os elementos do rico passado biolgico e da engenhosidade de
projetos de outrem, a fim de fomentar formas radicais de criatividade, mediante a padronizao
da montagem de componentes de DNA, para que cada elo no precise ser redesenhado a cada
vez. aqui que a comparao com o Lego tem algum peso. Os blocos de Lego so lindamente
projetados para se conectar com qualquer outro bloco de Lego. H um encaixe universal para as
peas, e elas podem ser montadas seja qual for seu kit de origem. No momento em que escrevo,
o catlogo dos BioBricks contm mais de 10 mil partes. Cada uma um pedao de DNA, e
entregue pelo correio na forma de um salpico num mata-borro. Jogue o papel numa soluo, e
o DNA se desprende dele, pronto para a montagem. Alguns BioBricks so genes, alguns so
instrues regulatrias e alguns so combinaes das duas coisas, j reunidas para se integrar a
novos circuitos. Todos foram padronizados, de modo a serem unidos uns aos outros para novas
criaes.
A outra transformao ocorrida nessa poca foi o incio da competio promovida pela
International Genetically Engineered Machine Foundation (iGEM), em 2003 e 2004. Cada ano,
equipes de estudantes de graduao inventam um problema e projetam e constroem uma
proposta de soluo usando s os componentes disponveis no Registry of Standard Biological
Parts. Os estudantes competem para participar das equipes de suas faculdades e passam semanas
pesquisando, projetando e executando solues para os problemas que escolheram. Essa uma
competio de talentos para os inteligentes, e o entusiasmo palpvel. Cada equipe recebe do
Registry um kit composto de mil BioBricks.
Aps rodadas de seleo regional, os finalistas se encontram no MIT em novembro para a
festa anual. Ali, as equipes exibem e celebram suas criaes, pioneiros e lderes da biologia
sinttica decidem a quem conferir uma srie de prmios. O Grande Prmio emblemtico da
mentalidade construtiva: um enorme bloco de Lego de alumnio.2
O princpio democrtico inerente ao Registry e tambm competio iGEM. Todos os
recursos so gratuitos, mas a expectativa de que todos os jogadores contribuam. O website do
Registry pede aos usurios para levar um pouco, doar um pouco. Todas as equipes renem
suas anotaes, projetos, sucessos e fracassos em pginas wiki abertas, destinadas a estimular o
compartilhamento e o uso dos ombros dos pares como apoio.
Embora at hoje poucos projetos iGEM tenham se tornado realidade, esse esforo marcado
por uma vibrao diferente do que vi antes em qualquer encontro cientfico. Muitos estudantes de
graduao empreendem projetos de vero nos laboratrios de seus orientadores. Ali, fazem
muitas vezes servios subalternos ou enfadonhos, parte do trabalho pesado da produo de dados
em que a cincia se baseia, e com isso ganham experincia da realidade da vida no laboratrio.
Mas as equipes do iGEM criam novos projetos e solues potencialmente importantes com um
entusiasmo comovente.3 Eles passam o vero inventando solues para problemas globais. Esto
combinando ferramentas inteiramente novas, por vezes no testadas, e com isso construindo
outras, tudo isso usando a mais avanada biotecnologia disponvel. Depois apresentam seu
trabalho para o painel avaliador, composto por uma robusta proporo dos bilogos sintticos
mais importantes em atividade atualmente.

Al, mundo

Em 2004, um trabalho impressionante inscrito no iGEM veio de uma associao entre a


Universidade do Texas, em Austin, e a UCSF. Eles projetaram um circuito e conseguiram
integr-lo numa bactria, que em seguida agiu como uma placa fotogrfica. Um componente
era uma protena sensvel luz, que desempenhava sua funo quando estimulada por um feixe
de luz. Eles ligaram isso a um gene comum produtor de um pigmento chamado LacZ. Quando
cultivaram a bactria sinttica numa placa transparente e plana, e projetaram uma imagem
sobre ela, a bactria processou a luz e o escuro na resoluo de cem megapixels por polegada
quadrada. Depois o trabalho foi publicado na revista Nature, e os componentes foram
desenvolvidos num novo dispositivo de biologia sinttica: um detector de borda. A imagem
projetada foi uma mensagem de texto anunciando muito oportunamente a chegada desse novo
campo, mas tambm uma piada para iniciados, exibindo as razes da biologia sinttica na
computao. A frase o output de teste-padro que os programadores usam para checar se sua
linguagem de programao est funcionando da maneira correta. Ela dizia simplesmente Al,
mundo.
Em 2009, os vencedores do Grande Prmio foram da Universidade de Cambridge: eles
estenderam o uso de protenas de guas-vivas brilhantes (GFPs, da sigla em ingls para Green
Fluorescent Protein) e projetaram um sistema para que bactrias produzissem pigmentos
multicoloridos como ferramenta de deteco regulvel. Ferramentas desse tipo so conhecidas
como biossensores, e elas j existem, por exemplo, para detectar nveis de glicose no sangue.
Mas at agora todo biossensor precisa ser projetado a partir do zero e construdo especificamente
para detectar apenas um alvo. A equipe iGEM de Cambridge pretendeu construir um biossensor
genrico que pudesse ser ajustado a mltiplos usos. Assim, a bactria manipulada poderia ser
regulada e usada para detectar uma substncia qumica txica especfica no ambiente e
produziria um pigmento colorido em resposta concentrao dessa substncia. Eles tambm
evitaram o uso de GFP, pois para ver essa protena necessrio um kit de fluorescncia. O
objetivo era fazer um biossensor que pudesse ser observado a olho nu. O circuito formado por
um sensor, um regulador de sensibilidade e o gerador de pigmento, e continha seis componentes
que eram novos para o Registry of Standard Biological Parts, para o qual foram submetidos para
serem usados por outros pesquisadores.
A Universidade de Washington conquistou o Grande Prmio em 2011, com um circuito que
produz formas de combustveis fsseis. Em segundo lugar ficou a equipe do Imperial College
London, que tentou combater a desertificao a eroso gradual de solo frtil, que o transforma
em terra inaproveitvel agrcola e economicamente. Segundo algumas estimativas, em 2025 esse
processo ter tornado estreis nada menos que 23 da terra arvel da frica. A equipe do
Imperial College construiu circuitos genticos em clulas que alimentaro razes, que, por sua
vez, protegero a camada superficial do solo contra os elementos erosivos. Sementes so
revestidas com a bactria sinttica; depois que germinam, as clulas conseguem introduzir-se nas
novas razes, e o programa que elas carregam produz o hormnio vegetal auxina, que acelera seu
crescimento na camada superficial do solo.
Quando o ano um nmero par, parece que a equipe nacional da Eslovnia ganha o Grande
Prmio iGEM, tendo levado o trofu, em forma de bloco de Lego, em 2006, 2008 e 2010. Neste
ltimo ano, resolveram inovar a biologia sinttica, evitando por completo a linguagem do DNA.
Em vez de manipular o cdigo embutido nas bases A, T, C e G do DNA para criar nova funo
em traduo, eles usaram o simples fato de que podemos pr essas letras numa ordem especfica
para construir uma linha de produo em miniatura. Os seres vivos esto cheios dessas linhas de
produo: um gene produz uma protena, que provoca outra reao, que desencadeia outro gene,
e assim por diante. Mas, ao contrrio da maquinaria ordenada de uma fbrica, o interior de uma
clula um meio bulioso, com todo o cdigo e as protenas flutuando livremente no plasma
viscoso. Fbricas reais seriam desastrosamente improdutivas se fosse permitido a cada parte
derivar aleatoriamente para o passo seguinte da linha de produo. A equipe da Eslovnia
projetou uma sequncia de DNA que organizava essa confuso solta numa linha bem-arrumada,
usando o DNA como uma plataforma para a linha de produo. Em vez de ter protenas
flutuando livremente na clula, eles imaginaram que poderiam amarr-las numa nica
sequncia de DNA. Como muitas protenas ligam-se ao DNA de qualquer maneira, sabe-se
muito sobre como fazer para que uma protena se prenda a uma sequncia especfica de DNA.
Com o trecho certo de DNA, cada protena num caminho pode ser removida da sopa celular e
amarrada sequencialmente, o que resulta numa linha de produo biolgica. O principal objetivo
dessa plataforma aumentar radicalmente a eficincia de caminhos da biologia sinttica. Mas
ela tambm abre a possibilidade de interruptores oscilantes controlados com mais rigor, ou outros
dispositivos padronizados do kit de ferramentas da biologia sinttica.

Acondicionamento cuidadoso

Quase todas as equipes que participam do iGEM vm de universidades. Mas, como foi descrito
no captulo anterior, a Nasa no demorou a identificar a biologia sinttica como disciplina que
viabilizar sua permanente misso: avanar com coragem. Entre as ideias mais extravagantes
que a Nasa est explorando esto seus planos para bactrias sintticas que fabricam tijolos.
Esse desafio foi aceito pelos estudantes na competio iGEM em 2011. A uma hora de
viagem de So Francisco, a Universidade Stanford colaborou com a Nasa, em Ames, a um pulo
de distncia pela via expressa, e a Universidade Brown, para descobrir como a biologia sinttica
poderia nos ajudar a construir colnias em outros planetas. Liderados por Ly nn Rothschild, eles
perguntaram como circuitos sintticos poderiam contribuir para a terraformao.a Como j foi
mencionado, a questo do peso absolutamente decisiva em viagens espaciais. Estima-se que o
ato de lanar alguma coisa alm da atrao gravitacional da Terra custe cerca de US$ 10 mil por
quilo. A massa de Saturno V, carregando todos os mdulos para levar os trs membros da
tripulao da Apollo 11 at a Lua, para dar um passeio durante algumas horas e voltar para a
Terra, era de cerca de 3 mil toneladas. O prprio mdulo que pousou na Lua, o Eagle, pesava
dezessete toneladas. Estimativas de uma viagem de ida e volta a Marte incluem duzentas
toneladas s em itens consumveis e necessrios para sustentar a vida. Assim, como ao fazermos
as malas para as frias, minimizar o que levamos conosco e usar o que encontrarmos em nosso
destino a melhor soluo. Utilizao de recursos in situ a expresso oficial da Nasa, mas
prefiro chamar isso de preparo cuidadoso da bagagem.
Uma vez que nossos sonhos de estabelecer bases permanentes em outros mundos so
profundamente estorvados pela necessidade de transportar materiais de construo a partir da
Terra, o uso daqueles presentes num outro planeta atraente. A questo : Podemos construir
com poeira lunar? 4
Na iGEM, a equipe de Brown-Stanford baseou seu projeto nessa questo. Eles descobriram
por acaso a bactria Sporosarcina pasteurii, que prospera num ambiente alcalino cujo
metabolismo envolve a expulso do mineral calcita como resduo. No tipo certo de areia, a
calcita passa por um processo chamado biocimentao, isto , ela forma cimento. Num concreto
normal, a gua forma uma cola, por meio de uma srie de reaes qumicas, e consumida
enquanto isso. As clulas que secretam calcita podem servir a esse objetivo sem nenhuma gua
alm da que elas requerem para viver. O componente essencial desse processo uma protena
chamada urase, que inicia a decomposio da ureia e, nessas bactrias, termina com a
cimentao fora da clula. A equipe iGEM identificou o circuito gentico para a produo de
urase em Sporosarcina e copiou-o em uma clula de laboratrio padro, E. coli. Ento,
caracterizaram-no e padronizaram-no num BioBrick, onde ele se tornou conhecido como Parte:
BBa_K656013. Quando expressado numa clula e colocado em regolito, o circuito ativado e
tem capacidade de ciment-lo em tijolos. Os pesquisadores testaram esse processo usando areia
de Marte simulada, em moldes que, bem verdade, no tinham mais de um centmetro de lado;
mas dentro de poucas horas eles a solidificaram em minsculos tijolos. No preciso dizer que
h uma distncia astronmica entre isso e o uso desses tijolos como material de construo em
Marte. Mas essa viagem s ocorrer, na melhor das hipteses, dentro de uma dcada, e, no ritmo
em que a biologia sinttica est progredindo, a fabricao de tijolos reais com BioBricks a partir
de regolito marciano torna-se muito mais plausvel. Em conformidade com as razes
brincalhonas da mentalidade que preside os BioBricks, eles foram batizados de RegoBricks. A
economia de peso enorme. Um frasquinho dessas clulas remixadas, pesando s dois gramas,
poderia ser transportado a bordo de uma nave e cultivado para se transformar numa fbrica de
RegoBricks em Marte.
Esses so apenas alguns entre as centenas de projetos inscritos na competio iGEM durante
seus poucos anos de existncia. A BioBricks Foundation tem por objetivo no apenas difundir o
potencial de aplicao de princpios da engenharia biologia, mas faz-lo de uma maneira que
fomente uma cincia aberta e igualitria, a inventividade e a livre troca de criaes, assim como
os msicos da remixagem nos anos 1970 e 1980.
Embora isso possa soar um pouco idlico, h problemas com a iGEM e os BioBricks. Em
termos de resultados, o mais das vezes, as equipes iGEM no produzem realmente aquilo que
projetaram, com frequncia em razo dos limites de tempo da competio (embora muitas
partes e circuitos individuais tenham resultado em artigos cientficos depois). Mas h muitos
outros problemas com os BioBricks. Centenas, se no milhares das partes que constam do
Registry, no esto bem caracterizadas. As partes individuais incluem genes, bem como
instrues para ativar ou desativar genes. No entanto, muitos deles comportam-se de maneira
irregular ou imprevisvel. Em grande parte isso tem a ver com o rudo biolgico de uma clula
viva quando comparada ao diagrama lgico de um projeto. A natureza da competio significa
que muitas vezes os estudantes no tm tempo para caracterizar completamente as partes que
construram. A padronizao est se revelando uma tarefa de Ssifo, e a taxa de inscries
aniquila a tarefa urgente de caracterizar o que j foi inscrito.
Apesar disso, o entusiasmo que envolve a competio empolgante. As equipes renem
estudantes com formao em matemtica e engenharia, assim como em cincias biolgicas, e
trazem um desconhecimento revigorante para a soluo de problemas. Fui ao encontro da equipe
do Reino Unido em setembro de 2012, organizado pelo lder da Universidade de East Anglia,
Richard Kelwick. Ali, os participantes do Reino Unido apresentaram seus projetos uns aos outros
e para um punhado de bilogos sintticos, antes de rumarem para Amsterd, onde seriam
escolhidos os concorrentes disputa mundial. Dos 85 estudantes que concorriam pelo Reino
Unido, 29 no eram bilogos. O ingresso nessa competio que produz alguns dos trabalhos mais
sofisticados, criativos e avanados em engenharia gentica continua to aberto quanto antes. Das
trs equipes que seguiram para a rodada seguinte, a do University College London era a mais
esquisita, literalmente: bactrias que iriam coletar e consumir os bilhes de minsculos
fragmentos de plstico descartados e no biodegradados que flutuam nos oceanos, com a
inteno de usar essa colheita para construir uma ilha de plstico, reciclada e reclamada ao
mar.5
Esse livre acesso deliberado e inerente mentalidade BioBricks: no preciso ter uma
profunda compreenso de como a biologia trabalha quando se vai us-la apenas como
ferramenta. Embora isso possa parecer questionvel, primeira vista, assim que operamos
com toda tecnologia. Estou digitando estas palavras num computador cujo hardware em grande
parte misterioso para mim, usando software escrito numa linguagem que me to estranha
quanto mandarim. At as mais simples ferramentas mecnicas, como uma chave-inglesa, so
feitas por processos que exigem um conhecimento especializado que a maior parte das pessoas
que as utilizam no possui. Com a aplicao de princpios da engenharia a componentes
biolgicos, a questo no como essas partes funcionam, mas se funcionam ou no. Dessa
maneira, a biologia torna-se no exclusiva. Pela padronizao das partes, os requisitos mnimos
para os critrios de ingresso na rea so minimizados a tal ponto que no se requer nem o
conhecimento especializado tradicional sobre o comportamento do DNA. Paul Freemont, que
dirige o maior departamento de biologia sinttica na Europa, no Imperial College London (local
do mais importante encontro bianual de biologia sinttica de 2013, o SB6.0), declarou BBC em
2012 que eles tm grande quantidade de pessoas novas chegando, pesquisadores jovens e
vibrantes. No lhes importa onde est a biologia, eles querem apenas construir coisas e resolver
problemas. Eles no tm nenhuma bagagem.

Q uem dono da sua criao?

Como o objetivo da biologia sinttica criar solues para os problemas da realidade, o potencial
para a comercializao bvio. Assim, a questo da propriedade assoma de forma inevitvel em
relao a qualquer componente, dispositivo ou produto. A histria das patentes envolvendo o
DNA, ainda em curso, tortuosa e em especial confusa, porque as leis relativas ao
patenteamento no foram elaboradas tendo em mira a biotecnologia. A promessa que a biologia
sinttica encerra para as tecnologias futuras significa que a questo das patentes est
intrinsecamente entrelaada com a cincia, e ainda pode ter um efeito sobre a maneira como
essa indstria criativa ir florescer. Vale a pena, portanto, dar uma breve olhada nesses
problemas.
Historicamente, as patentes so destinadas a proteger invenes funcionais teis, enquanto o
direito autoral protege a expresso fsica de uma ideia, esteja ela na forma de manuscrito,
partitura, fotografia ou pgina da web, garantindo a propriedade, em geral para o criador. O mais
fundamental, porm, que tanto a lei do direito autoral quanto as patentes foram introduzidas nos
Estados Unidos a fim de promover a criatividade para o bem maior. Os inventores precisam
proteger suas criaes, pois tempo, dinheiro e investimento intelectual que dedicaram para
projetar e criar um novo produto so consideravelmente maiores que os necessrios para copi-
lo.
Os produtos da natureza, por outro lado, so inelegveis para patentes porque ocorrem sem
nenhuma engenhosidade humana. Mas j se argumentou, de forma convincente, que, depois de
isolada e caracterizada, uma sequncia gentica, como um gene, no mais produto da
natureza, pois foi copiada e submetida interveno de seres humanos. Portanto, ela pode ser
protegida por patente. A ao legal recente mais divulgada que provavelmente estabelecer um
precedente em relao propriedade de DNA foi (e continua sendo) aquela relativa a dois genes
de cncer de mama e ovariano, BRCA1 e BRCA2, ambos de propriedade da empresa My riad
Genetics e da University of Utah Research Foundation. No momento em que escrevo, esse
processo foi devolvido Suprema Corte Federal dos Estados Unidos, sob alegao de que as
tcnicas aplicadas para isolar o DNA so biologia molecular comum, e no singulares. O vaivm
relativo a patentes de DNA continua gerando problemas. Apesar disso, com base sobretudo no
argumento de que o isolamento de sequncias genticas um processo, um em cinco genes
humanos os genes que voc carrega por a em suas clulas de fato propriedade de outra
pessoa.
Quando se trata do patenteamento de coisas vivas, a lei, pelo menos nos Estados Unidos, um
pouquinho mais clara. A primeira patente sobre um organismo foi confirmada em 1980, no caso
de uma bactria geneticamente modificada que ajuda na decomposio de leo cru. Ela foi
assegurada, com base num recurso, em razo do fato de que seus genes so ao menos
parcialmente feitos pelo homem e de que o processo de manufatura era patentevel. As frases
decisivas usadas no veredicto foram que a inveno (e portanto a patente) constitui uma
manufatura ou composio de matria. Em 1988, isso foi estendido a um organismo
multicelular: o OncoMouse um camundongo transgnico cujo DNA foi modificado para
torn-lo particularmente suscetvel a vrios cnceres, e por isso uma valiosa ferramenta de
pesquisa. E em 2010, Craig Venter solicitou uma patente para sua clula artificial Sy nthia.
Como os produtos da biologia sinttica tm poucos precedentes histricos, ainda no est claro
como a lei lidar com eles (ou evoluir para faz-lo). Nesse caso, as complexidades do
patenteamento de DNA so agravadas pelo fato de que grande parte do pensamento e do
comportamento por trs dos componentes da biologia gentica se assemelha, muitas vezes
deliberadamente, aos softwares de computador. Aqui o problema fica ainda mais obscuro, pois o
software um campo tambm assediado por contnuos e srdidos conflitos de propriedade. O
software recai em algum lugar entre patente e direito autoral, pois ao mesmo tempo funcional
(executa um programa) e obra intangvel ( escrito para ser executado). O comportamento de
partes ou peas individuais de cdigo-fonte de software, como frmulas e mquinas de calcular,
pode mudar dependendo do modo como elas so usadas. Em consequncia, patentes
computacionais so por vezes desconcertantemente amplas, abrangendo muitos termos no
especficos.
Voc me perdoar por penetrar nesse escuro mundo da propriedade intelectual, mas isso tem
particular relevncia para a natureza do BioBrick. Em consequncia da legalidade nebulosa da
biotecnologia, amplas patentes tm sido usadas para assegurar direitos de propriedade sobre
mecanismos da maquinaria celular. Elas abrangem princpios gerais, bem como processos
especficos. Isso tem o efeito de restringir a experimentao com essas atividades celulares, em
especial para pesquisadores em incio de carreira, que no tm condies de pagar por processos
patenteados. Se patentes amplas pudessem ser aplicadas aos dispositivos que os bilogos sintticos
criaram, como o oscilador, num sentido genrico, isso poderia limitar a modificao do que se
tornou um instrumento bsico na caixa de ferramentas da biologia sinttica.
Reconhecendo essas ciladas potenciais, a BioBricks Foundation adotou uma posio muito
precisa em relao a isso. Ela declara que sua misso assegurar que a engenharia da biologia
seja conduzida de maneira aberta e tica, para o benefcio de todas as pessoas e do planeta.
Acreditamos que o conhecimento cientfico bsico pertence a todos ns e deve estar
gratuitamente disponvel para a inovao tica, aberta. Eles julgaram que as leis de
patenteamento e direito autoral tal como aplicadas computao esto repletas de inadequaes.
Os termos de utilizao que o usurio de BioBricks deve aceitar salvaguardam uma proteo
irrevogvel contra a afirmao de direitos de propriedade intelectual. A atribuio ao criador e a
adeso a prticas de segurana e, claro, lei so parte do acordo, mas a pea em si mesma est
quintessencialmente livre para ser usada. Ao colocar seus produtos em domnio pblico, os
usurios esto evitando os meandros da imposio de patentes e, por conseguinte, estimulando a
inovao e a criatividade.
Em abril de 2012, reconhecendo o potencial da biologia sinttica para mudar o mundo, o
presidente Barack Obama lanou o National Bioeconomy Blueprint, manual bsico que ensina a
investir em biologia sinttica de maneira a extrair dela o benefcio mximo. Esse plano encerra
um desenvolvimento comercial, mas tambm reconhece o valor das crenas essenciais que
informam os BioBricks em relao ao compartilhamento de dados e recursos. De maneira muito
especfica, esse conjunto de recomendaes destina-se a promover o crescimento, em biologia
sinttica; tratar de questes de segurana; estimular a comercializao sem restringir a
criatividade; e assegurar que o pblico tambm participe dos benefcios.
A proteo da criatividade est inscrita nos ttulos da legislao sobre patentes e direito
autoral, ambas de 1790: o Copy right Act tem o subttulo Uma lei para o estmulo do saber, e o
Patent Act, Para a promoo de artes teis. Em msica, computao, gentica e agora,
potencialmente, na biologia sinttica, esses princpios ficaram atolados na esteira dos rpidos
avanos tecnolgicos que ultrapassam de longe as mudanas na lei. Em consequncia, as
patentes no campo da biotecnologia correm o risco de se tornar a corporificao do impedimento
da criatividade. Quando isso ocorre, o progresso cessa.
Mais uma vez, os paralelos com a msica so impressionantes. A colagem tornou-se quase
onipresente na msica pop gravada. O hip hop, que se baseia inteiramente na colagem,
desenvolveu-se para se tornar o maior e mais hegemnico dos negcios na msica. medida
que as corporaes reconheceram seu imenso potencial comercial, as companhias que detinham
direitos autorais sobre msicas comearam a exercer e impor o controle sobre a colagem em
que o hip hop e outros gneros de msica se baseiam. Requintaram-se e introduziram-se leis de
direito autoral que significam que, a menos que se tenha muito dinheiro, hoje praticamente
impossvel fazer msica com a mesma liberdade criativa que ajudou a criar e definir o gnero.
Para a biologia sinttica, enfrentar esse emaranhado legal parte da rpida maturao de um
campo muito jovem. Em 2011, um de seus padrinhos, Drew Endy, abriu uma nova empresa para
fornecer apoio e uma estrutura legal aberta para o contnuo desenvolvimento de dispositivos,
circuitos e ferramentas biolgicos. Na inaugurao, ele declarou: Agora precisamos ir alm das
metforas com o Lego e os brinquedos genticos, rumo a tecnologias profissionais. A
mensagem que a biologia sinttica precisa amadurecer, tanto cientfica quanto legalmente, e
tornar-se a indstria global que seus fundadores creem que ela pode ser. Mas ela deveria tambm
continuar a ser alimentada por criatividade irrestrita e at por uma disposio bem-humorada,
pois esse o terreno frtil em que brota a maioria das ideias criativas. Nas palavras de Larry
Lessig, professor de direito de Harvard e ativista dos direitos autorais: Uma cultura livre para
tomar emprstimos do passado e construir sobre ele culturalmente mais rica que uma cultura
controlada.
A criatividade inerente aos BioBricks, e a biologia sinttica em geral, fomenta um ethos
distinto do que caracterizou o campo da modificao gentica que o precedeu. Ela tambm tem
um princpio de engenharia em seu cerne. Esses dois aspectos compem as razes para vermos a
biologia sinttica como uma revoluo industrial no nascedouro. Mas a cincia ocorre como
parte da cultura, no como algo distinto dela, e, como vimos com as questes emergentes de
propriedade, essas novas tecnologias enfrentam no apenas problemas cientficos e prticos, mas
os desafios de sua insero na sociedade.

a Terraformao: engenharia planetria destinada a tornar um ambiente planetrio extraterrestre


mais capaz de sustentar vida. (N.T.)
4. Em defesa do progresso

mais fcil fixar-se na ameaa que aproveitar a oportunidade.


ROB CARLSON, 2011

A AMEAA DE VIOLNCIA no se cumpriu. Na verdade, anunciou-se que o evento seria


marcado pelo vandalismo, e a ao direta revelou-se, pelo que se sabe, uma espcie de
agradvel dia em famlia no campo. Em 27 de maio de 2012, aps algumas semanas de
publicidade, negociao e protestos pblicos, o conflito entre ativistas contrrios aos alimentos
geneticamente modificados e cientistas aconteceu num domingo ensolarado nos campos
verdejantes de Rothamsted, em Hertfordshire, e foi marcado por sorvetes, cantos e algumas
tentativas de retrica estimulante. O grupo de ativistas Take the Flour Back declarara em sua
propaganda que no existiam dados cientficos suficientes para apoiar o cultivo de produtos
agrcolas geneticamente modificados (GM), e que as experincias com esse tipo de trigo em
campos de Rothamsted deveriam ser suspensas, e as plantaes, destrudas. Eles haviam
declarado que nesse dia iriam descontaminar os campos de trigo GM, como ocorrera em
vrias ocasies nos ltimos anos no Reino Unido, querendo dizer com isso que iriam arrancar as
plantaes e destruir os campos. Os cientistas frente dos experimentos protestaram
publicamente e debateram com eles, mas o plano de ao direta se manteve.
O trigo cultivado nesses campos sofreu vrias modificaes genticas. Algumas so para fins
de administrao de laboratrios (para que as sementes experimentais funcionais possam ser
selecionadas das demais). Mas a principal engenhoca produzida pelo homem a introduo de
um circuito gentico que produz a substncia qumica E- farneseno, ou EF (que, por pura
coincidncia, muito estreitamente relacionada s substncias qumicas produzidas para servir
como diesel sinttico, mencionadas no Captulo 1). O EF age exatamente como uma buzina para
pulges, sendo um feromnio que eles produzem quando esto sendo atacados por predadores,
como as formigas. Ele avisa os outros pulges para fugirem. Os prprios pulges produzem EF,
porm, num elegante movimento evolutivo, mais de quatrocentas plantas que eles gostam de
infestar tambm o produzem, como uma espcie de aviso cuidado com o cachorro numa casa
sem ces. A substncia no s repele os pulges, ela tambm os estimula a gerar crias aladas,
que podem fugir da ameaa de perigo. O trigo experimental foi criado para produzir EF com o
propsito especfico de reduzir a quantidade de pesticida destinado a matar pulges que os
fazendeiros precisariam usar.
Um estudo anterior havia mostrado que o trigo manipulado para produzir EF tinha pouco ou
nenhum efeito para repelir pulges, mas isso em condies de laboratrio, que podiam ser
qualitativamente diferentes daquelas em que as plantas crescem em campo aberto, e o
experimento de Rothamsted foi planejado como tentativa de tirar a limpo exatamente essa
questo. Um protesto queixoso, numa carta aberta dos cientistas frente da pesquisa, ressaltava
que a ao planejada pelo Take the Flour Back assemelhava-se a retirar livros de uma
biblioteca, porque voc deseja impedir que outras pessoas descubram o que eles contm.
Apesar do desdobramento claramente no dramtico dos acontecimentos em Rothamsted
naquele dia, o grupo Take the Flour Back no se arrependeu e em seguida divulgou esta
declarao:

Quisemos fazer a coisa responsvel e remover a ameaa de contaminao por GM;


lamentavelmente, no nos foi possvel faz-lo de maneira efetiva hoje. No entanto,
permanecemos unidos a fazendeiros e agricultores do mundo inteiro, que esto dispostos a pr
em risco sua liberdade para deter a imposio de produtos agrcolas GM.

Essa pequena saga reflete em que p esto as coisas na percepo pblica da biotecnologia
moderna e, sob muitos aspectos, toda a sua histria de quarenta anos. O grupo Take the Flour Back
veemente, barulhento e gera muita publicidade. Mas difcil avaliar em que medida ele reflete
genuinamente a disposio de nimo pblica, ou o nmero dos fazendeiros com que se proclama
solidrio. De muitas maneiras, seus integrantes se inspiram nos luddistas. Embora a palavra tenha
evoludo para significar qualquer pessoa que rejeita a tecnologia, os primeiros luddistas eram
artesos fabricantes de tecidos que se sentiram ameaados com o advento dos novos teares
mecnicos. Durante alguns anos, no incio do sculo XIX, eles se reuniam ao luar, nas charnecas
do norte da Inglaterra, invadiam fbricas e destruam os teares que lhes haviam tirado os
empregos.1
No caso da modificao gentica, esse tipo de ao direta raro, mas no inaudito: o website
do Take the Flour Back afirma: Entre 1999 e 2003, pelo menos 91 experimentos com GM foram
danificados ou destrudos. O sentimento por trs disso, como iremos ver, tem razes to antigas
quanto a prpria tecnologia. No Reino Unido, a introduo potencial de alimentos geneticamente
modificados nos anos 1980 foi recebida com horror por militantes, alguns dos quais
consideravam que brincar com a natureza dessa maneira era moral e intrinsecamente errado. A
imprensa alimentou a repugnncia criando a expresso frankenfoods um peculiar apelido
genrico, uma vez que o dr. Frankenstein foi o criador do monstro sem nome da autoria de Mary
Shelley. No entanto, rtulos desse tipo tm algum poder. Assim como os furtos de 1972 no edifcio
Watergate, em Washington DC, de certo modo acenderam a luz verde para a imprensa passar a
anexar o sufixo gate a qualquer escndalo poltico, nos ltimos anos tivemos manchetes com os
termos frankenmice, frankenfish, frankenbugs e frankencrops para se referir a qualquer coisa
geneticamente modificada.
medida que se desenvolve cientificamente, a biologia sinttica atrai ateno de todas as
partes, e ela herdou os antagonistas da engenharia gentica genrica. Assim, para tratar das
preocupaes e da ira que a biologia sinttica suscita, precisamos considerar o quadro muito mais
amplo da percepo pblica da biotecnologia em geral e sua histria, que, apesar de breve,
transformou o mundo. Estamos comeando a ver grupos que historicamente lideraram o ataque
aos GM, como o Action Group on Erosion, Technology and Concentration (ETC) e Friends of the
Earth, voltarem-se de maneira muito especfica contra a biologia sinttica e publicarem panfletos
segundo os quais seus produtos no passaram por testes, so mal compreendidos e ameaam
todos os tipos de cenrios humanos e ecolgicos. Imediatamente aps o anncio de Sy nthia, de
Craig Venter (na verdade, foi a ETC que deu Mycoplasma micoides JCVI-syn 1.0 esse apelido
mais amistoso), o presidente Obama encomendou um relatrio de especialistas em biologia
sinttica para avaliar qualquer potencial ameaa, os desafios e benefcios de todo o campo. O
relatrio, publicado no final de 2010, tratou muitas das questes por meio de consultas a vrios
tipos de pblico e a cientistas profissionais, e estabeleceu cinco categorias pelas quais o progresso
do campo pode ser observado: benefcio pblico, gesto responsvel, liberdade intelectual e
responsabilidade, deliberao democrtica, justia e equidade.
Mas nem todo mundo viu isso assim. A comisso despertou considervel ira nos militantes.
Em resposta, 56 organizaes lideradas pelos grupos ETC e Friends of the Earth publicaram
imediatamente uma carta aberta comisso presidencial censurando o relatrio por

ignorar o princpio da precauo, carecendo da adequada reviso de riscos ambientais,


depositando f injustificada em genes de suicdio; outras tecnologias que no fornecem
nenhuma garantia contra a evaso de organismos sintticos para o ambiente e dependendo da
autorregulao da indstria, o que equivale a nenhuma superviso independente.

Regras para a modificao gentica so necessrias e existem. Nos Estados Unidos, trs
agncias federais regulam o uso de plantas GM: o United States Department of Agriculture cuida
da possibilidade de plantas cultivadas tornarem-se infestantes; a Food and Drug Administration,
da possibilidade de elas entrarem na cadeia alimentar e subverterem-na; a Environmental
Protection Agency avalia plantas com poderes pesticidas.
Em 2012, o nmero dos opositores dos GM cresceu, reunindo uma coalizo de 111 grupos
ativistas, que elaborou seu prprio relatrio, condenando tambm o campo da biologia sinttica.
Esse nmero pode parecer grande, mas muitas dessas organizaes so pequenos grupos de meia
dzia de indivduos, tornando-se difcil avaliar em que medida seu ponto de vista representativo
da populao geral. Mais uma vez, com linguagem carregada e afirmativas fortes, suas
concluses foram de que era necessrio haver mais superviso e regulamentao, e que se
deveria suspender por completo o lanamento e o uso comercial de clulas sintticas no
mercado.
Talvez seja til voltar os olhos aqui para a origem da biotecnologia, se quisermos
compreender melhor o contexto em que essa oposio est enraizada. O epicentro da biologia
sinttica est em Stanford, na Califrnia, onde a BioBricks Foundation tem seu quartel-general, e
onde, em meados dos anos 1970, a tecnologia original nasceu. A descoberta de enzimas de
restrio, aquelas ferramentas bacterianas de cortar e colar com que toda essa histria comeou,
havia possibilitado um experimento em que Paul Berg cortou partes do genoma de um vrus e as
inseriu em outro. Esse engatinhar rumo ao mundo da engenharia sinttica valeu-lhe um Prmio
Nobel em 1980. Mas ele foi cauteloso em relao s implicaes de sua nova tecnologia e se
absteve de completar o experimento, temendo criar um monstro e pr em risco seus colegas e o
pblico mais amplo. Em vez disso, Berg pediu uma moratria nesse campo recm-nascido. Em
1975, ele e outros, por solicitao da Academia de Cincia dos Estados Unidos, promoveram
uma pequena conferncia internacional em Asilomar, na pennsula californiana de Monterey.
O encontro de Asilomar hoje encarado como um modelo de responsabilidade cientfica no
tratamento de tecnologias novas e passveis de dupla utilizao, isto , novas ferramentas com o
potencial de ser empregadas tanto para aplicaes positivas quanto por inescrupulosos. No
ambiente cultural em que ele ocorreu, destacava-se o terror paranoide de filmes tipo arrasa
quarteiro, como O enigma de Andrmeda (1971), em que um micrbio extraterrestre causava
loucura e morte indiscriminadamente, tirando proveito da ansiedade ps-Watergate. Berg e
outros que comeavam a manipular o cdigo gentico depararam com um sentimento de franca
cautela ao debater o que fazer em seguida. Jornalista, advogados e cientistas tambm
participaram do encontro, e juntos eles alinharam os argumentos durante vrios dias. No final,
traaram normas que sugeriam novas pesquisas, dilogo aberto e aproveitamento do
conhecimento de especialistas em campos fora da biologia molecular, como o de doenas
infecciosas e ecologia microbiana. Concluram que as novas tcnicas, que permitem a
combinao de informao gentica proveniente de organismos muito diferentes, nos situam
numa rea da biologia com muitas incgnitas. Esse um sentimento to pertinente hoje quanto
naquela poca. Na verdade, a natureza da cincia em geral deveria fomentar, por definio,
uma cultura cheia de incgnitas. Mas considerou-se que a percepo de dano potencial era
superada pelos benefcios potenciais, e eles recomendaram progresso sujeito a restries:

Concordou-se que h certos experimentos em que os riscos potenciais so de natureza to


sria que eles no deveriam ser realizados com os dispositivos de conteno atualmente
disponveis. A mais longo prazo, problemas graves podem surgir na aplicao em grande
escala dessa metodologia na indstria, na medicina e na agricultura. Mas reconhece-se
tambm que a pesquisa e a experincia futuras podem demonstrar que muitos dos biorriscos
potenciais so menos srios e/ou menos provveis do que hoje suspeitamos.

Mas a desavena ideolgica entre biotecnlogos e seus opositores foi formalizada pouco
depois. Assim como em 2010, em 1978, no muito tempo depois de Asilomar, a oposio pblica
maneira como a engenharia gentica estava progredindo comeou a emergir. Houve tambm
um conflito entre vrios cientistas e ativistas ambientais, entre os quais os Friends of the Earth, dos
quais antes haviam sido aliados. Os termos eram quase iguais aos de hoje: o grau de regulao
requerido para permitir o progresso seguro nas pesquisas de manipulao do DNA.
Quando a batalha comeou, um cientista annimo expressou o sentimento de que alguns dos
lobbies ambientais esto trabalhando para propagar a paranoia e de que seu comportamento no
passava de banditismo. Temo, disse James Watson revista Science, em 1978, que esses
grupos prosperem com ms notcias; quanto mais o pblico se preocupa com o ambiente, mais
provvel que continuemos a lhes fornecer os recursos de que precisam para manter suas
organizaes em crescimento. Outro cientista sugeriu, dessa vez confidencialmente, que esses
agentes privados do interesse pblico no so eleitos, e tampouco esto necessariamente em
contato com as ideias da maioria dos membros dos grupos em nome dos quais falam. muito
possvel que a mesma situao exista hoje, com o apoio popular granjeado por tticas de choque,
truques publicitrios e afirmaes provocativas, e no por uma tentativa de entrar num dilogo
honesto e pblico, como vimos em Rothamsted e ainda veremos neste captulo.
Paul Ehrlich, eminente cientista e at ento membro do Friends of the Earth, reiterou a ideia
de que os benefcios potenciais da pesquisa sobre o DNA recombinante so to grandes que
seria imprudente restringir essa pesquisa quase totalmente com base em riscos imaginrios.
verdade que nenhum ato bem-sucedido de bioterrorismo ocorreu desde Asilomar, e trataremos
disso em breve; no entanto, medida que a indstria da engenharia gentica floresceu e mutou
em biologia sinttica, os problemas potenciais permaneceram os mesmos, e o acesso
tecnologia consideravelmente mais fcil que em meados dos anos 1970. Em 1975, era possvel
acomodar todos os especialistas em DNA recombinante num bar de tamanho razovel, que dir
num centro de conferncias. Hoje, a mesma tecnologia foi democratizada a ponto de todas as
pessoas que algum dia executaram uma manipulao de DNA serem suficientes para povoar um
pequeno pas. Romantizar o passado provavelmente no ajuda muito, porm, parece que o clima
em que o nascimento da biologia molecular ocorreu foi significativamente diferente do atual.
Um relatrio presidencial divulgado em abril de 2012 estimou a receita da bioeconomia nos
Estados Unidos, em 2010, em US$ 100 bilhes. Ela s tende a crescer.
As aes e motivaes do grupo Take the Flour Back e as propostas do Friends of the Earth e
ETC agora no so significativamente diferentes daquelas expressas quarenta anos atrs no
nascimento da engenharia gentica. Mas o campo explodiu, por isso a questo se os opositores
foram prescientes em sua oposio ou se sua retrica irrelevante, uma vez que permaneceu
inalterada enquanto a cincia progrediu. Examinaremos adiante algumas das principais
alegaes e situaes possveis.

Armas biolgicas

O caso especfico de transformar formas de vida manipuladas em armas um dos argumentos-


chave apresentados pela oposio tanto engenharia gentica quanto biologia sinttica. Nossas
crescentes habilidades em tecnologia do DNA mantiveram muito vivo o medo do bioterrorismo.
Transformar a vida em arma no um fenmeno novo. O uso de coisas vivas (que no seres
humanos) para gerar dano tem uma tradio rica, mas completamente ignbil, que precede em
milnios nossa conquista do DNA. Anbal usou seus elefantes de ataque na Antiguidade romana.
Um chefe mongol que invadiu a ndia no sculo XIV instigou camelos em chamas a investir
contra elefantes que brandiam cimitarras. Mesmo na era moderna, ratos, gatos, pombos e ces
foram usados como dispositivos para detectar bombas ou para transport-las. Na Segunda Guerra
Mundial, os russos tiveram razovel sucesso treinando ces para correr sob os blindados alemes
carregando um explosivo acionado por uma batida na superfcie inferior dos tanques.
Hoje em dia, a ameaa potencial de armas vivas no menos bizarra, mas muito mais
poderosa, e, como ocorre em todos os aspectos da engenharia gentica, a diferena decisiva a
introduo do controle de preciso da linguagem da vida. Assim como a biologia, o bioterror foi
reduzido em tamanho, passando do uso de animais ao microcosmo da gentica.
A universalidade do cdigo gentico algo de que os vrus tiraram partido ao longo de toda a
histria, pois eles inserem seu prprio DNA num genoma inadvertido para usurpar a prpria
mecnica biolgica da clula desse hospedeiro. Vivemos num mundo que sempre foi afligido por
doenas. O nmero de mortes por agentes infecciosos suplanta de longe o nmero de morte nas
mos de outro ser humano, e nosso domnio da manipulao gentica gerou a possibilidade de
terrorismo com essas ferramentas. Em 2006, um reprter do Guardian, jornal do Reino Unido,
tentou demonstrar uma ideia adquirindo partes de um genoma de varola. Essa doena j foi
erradicada da Terra.2 A sequncia de seu genoma est gratuitamente disponvel on-line, assim
como todas as sequncias de genoma publicamente financiadas, e a inteno era questionar o
grau de facilidade com que se poderia construir uma criao malfica. Sugeriu-se que,
encomendando algumas sees do genoma de Variola major, o vrus que causa varola, seria
possvel costurar um genoma inteiro a partir desses pedaos menores. As curtas sees, de 75
bases, foram manufaturadas por uma obscura companhia de sntese gentica e enviadas para um
endereo residencial no norte de Londres, sem que seu potencial blico fosse verificado. Como
jornalistas investigativos responsveis, eles introduziram erros deliberados, e as sequncias
encomendadas codificavam uma parte do vrus que no era ela prpria txica. Apesar disso, a
matria foi publicada com revelaes alarmantes:

As sequncias de alguns patgenos mais mortferos conhecidos pelo homem podem ser
compradas na internet, descobriu o Guardian. Numa investigao que mostra a facilidade
com que organizaes terroristas poderiam obter os ingredientes bsicos de armas biolgicas,
este jornal obteve uma curta sequncia de DNA da varola.

Por mais alarmante que isso pudesse soar a primeira vez, tratava-se, na melhor das hipteses,
de um desajeitado truque publicitrio. Seu nico triunfo real foi mostrar que algumas empresas
dedicadas sntese de DNA no eram particularmente vigilantes ao aceitar encomendas de
qualquer um. Sua afirmao de ter agido de maneira responsvel ao introduzir erros no cdigo
era pouco sincera. Uma vez de posse da sequncia, corrigir os erros seria uma questo trivial
para qualquer estudante competente formado em gentica.
Mas a premissa global era duvidosa. Usar essa tcnica de costurar uns aos outros fragmentos
de 75 letras para compor um genoma de 186 mil letras uma tarefa muito difcil, algo como
recompor um documento rasgado duas vezes maior que este livro. Teoricamente possvel,
afirma o artigo, mas na realidade rduo a ponto de paralisar. Em 2002, uma equipe baseada em
Nova York conseguiu montar um vrus funcional de poliomielite a partir de segmentos sintetizados
de DNA encomendados pelo correio. Mas esse genoma tem apenas 7.500 bases de comprimento,
e ainda assim exigiu dois anos de trabalho de uma equipe de especialistas em biologia molecular.
Esses no so problemas que possam ser diretamente expandidos. Lembre-se de que em 2010 a
clula Sy nthia, de Venter, com seu genoma de 582 mil letras, demandou dez anos de vinte
pessoas a um custo estimado de US$ 40 milhes. A realidade algo enormemente varivel
quando se debate o teoricamente possvel.
Em 2007, ativistas contrrios biologia sinttica do grupo ETC produziram um relatrio sobre
biologia sinttica que se referia ao truque publicitrio do Guardian e conseguia intensificar ainda
mais a possibilidade terica de perigo: Em tese, um equipamento comercial pode produzir um
DNA inteiro para uma verso sinttica de Variola major em menos de duas semanas, pelo preo
aproximado de um carro esportivo de luxo. Isso era possvel em tese, mas somente se o
sentido de possvel fosse estendido muito alm do praticamente vivel. Como diz o especialista
em biologia sinttica Rob Carlson: mais fcil fixar-se na ameaa que abraar a
oportunidade.
importante reconhecer que h uma ameaa potencial, e que a biologia sinttica e a
engenharia gentica so tecnologias passveis de utilizao ambgua. Doenas relegadas histria
podem agora ser reconstrudas em laboratrio, e algumas que ainda no dominamos podem ser
manipuladas para se tornar mais perigosas. Somos capazes de erradicar doenas, como a varola,
graas vacinao. A poliomielite provavelmente ser a prxima, e algum dia doenas que hoje
nos matam tero apenas interesse histrico para nossos filhos. Embora seja inequvoco que a
cincia e a medicina transformaram a sobrevivncia dos homens, no novidade ressaltar que
milhes morrem todos os anos de doenas que no tm cura. Mas em que medida realista a
possibilidade de que a engenharia gentica venha a ser usada por malfeitores como ferramenta
para gerar terror? A matria do Guardian foi publicada seis anos atrs. Como vimos, a tecnologia
em questo est evoluindo numa taxa impressionante. Em 2012, o jogo mudou mais uma vez.

Gripe assassina

A gripe provm sobretudo das aves. O vrus se insere no mecanismo da clula hospedeira para
executar seu prprio programa gentico e fabricar suas prprias protenas. Nos vrus de gripe,
duas dessas protenas se fixam na superfcie da clula quando eles se transmitem de pessoa para
pessoa: a hemaglutinina (H), que se engancha numa clula-alvo para abrir acesso, e a
neuroaminidase (N), que as novas partculas de vrus usam para sair de volta. Variaes nesse
par de protenas de invaso e de evaso do nome s inmeras cepas de gripe, como H5N4. Em
geral, a gripe H5N4 permanece restrita s aves. Isso no quer dizer que ela no cause sintomas
em seres humanos, mas no fabricaro novos vrus, e por isso no podem espalh-los. No
entanto, a gripe est sempre evoluindo e encontrando novas maneiras de se difundir. De vez em
quando, uma cepa d o salto evolutivo para se tornar uma doena humana, produzindo sintomas e
ao mesmo tempo a capacidade de se transmitir de uma pessoa a outra, por vezes com resultados
apocalpticos. Em 1918, a pandemia de gripe causada por uma cepa H1N1 infectou bilhes de
pessoas e causou a morte de 50 milhes.
Em 1997, pacientes em Hong Kong comearam a morrer de uma nova cepa que ainda no
havia sido encontrada em seres humanos: H5N1. Tratava-se de uma verso que abundava nos
mercados de aves da China, em tal grau que era considerada endmica. A preocupao muito
legtima era que, sendo essa uma cepa nova, os seres humanos no teriam adaptado nenhuma
imunidade a ela. A evoluo acelerada da gripe pode acontecer quando duas cepas diferentes
infectam a mesma clula, onde elas podem trocar genes. Assim, se H5N1 trocasse genes com
uma cepa que atingisse seres humanos e se tornasse transmissvel de uma pessoa a outra,
estaramos diante de um desastre.
Sabendo muito bem que cepas quimricas altamente infecciosas so uma possibilidade
terica, equipes de pesquisadores da gripe comearam a pr em prtica a mxima de Fey nman:
O que eu no posso criar, no compreendo. Cientistas dos Pases Baixos e da Amrica do
Norte comearam a se antecipar natureza, tentando montar as novas combinaes exatamente
como elas poderiam evoluir para ostentar as condies causadoras de pandemia. Yoshihiro
Kawaoka, da Universidade de Wisconsin-Madison, e Ron Fouchier, do Erasmus Medical Centre,
em Roterd, projetaram, cada um deles, vrus de gripe que infectariam mamferos, nesse caso
doninhas. O projeto de Kawaoka misturou dois baralhos de genes virais para formar outro
conjunto que no s invadiria clulas nas vias nasais de uma doninha, como tambm se replicaria
e infectaria outras doninhas por meio de gotculas transportadas pelo ar. O projeto de Fouchier foi
semelhante, mas tinha apenas cinco alteraes genticas, todas observadas em outras cepas
naturais, que permitiam ao vrus prender-se a clulas de doninha e infect-las. Elas tambm
eram transmitidas a outras doninhas por meio do espirro. Nenhum dos dois vrus era letal,
embora a criao de Fouchier causasse morte quando ministrada, em alta concentrao, por
meio de um inalador. Dada a importncia desse trabalho, os estudos foram enviados para as duas
revistas cientficas mais importantes do mundo: o de Kawaoka para a Nature, o de Fouchier para
a Science. O que se seguiu foi uma tortuosa histria da difcil procura de um caminho atravs de
um territrio de fronteira.
O National Science Advisory Board for Biosecurity (NSABB) dos Estados Unidos exerce
vigilncia sobre situaes desse tipo, e, embora no tenha nenhum poder decisrio, em dezembro
de 2011 recomendou que os dois artigos fossem publicados, mas censurados, para no incluir
detalhes metodolgicos e outros que permitissem a replicao dos experimentos por aqueles que
buscassem causar danos. O NSABB um agregado de cientistas, advogados e formuladores de
polticas que aconselha sobre pesquisas passveis de dupla utilizao em biologia. Sua avaliao
inicial foi de que os dois artigos poderiam ser publicados, mas com os mtodos e as prprias
sequncias genticas editadas. Isso provocou um srio e necessrio debate entre todas as partes
envolvidas. Em geral, quando h um relato sobre cincia controversa, a discusso tende a se dar
entre pesquisadores e no cientistas. Dessa vez, porm, excepcionalmente, houve violenta
discordncia entre os prprios cientistas a respeito da convenincia de publicar os artigos na
ntegra, editados ou no. Como ocorreu em Asilomar, essa confrontao estimulou um dilogo
aberto com o pblico. Imitando as aes de Paul Berg em 1975, Fouchier e Kawaoka solicitaram
uma moratria voluntria de sessenta dias na pesquisa sobre a gripe para decidir qual a coisa
certa a se fazer. A Organizao Mundial da Sade (OMS) interveio. Aps muito esbravejar, o
NSABB mudou de opinio e recomendou a publicao do artigo de Kawaoka na ntegra e uma
edio esclarecedora do artigo de Fouchier. Nessa altura, a Nature havia chegado a essa deciso
de maneira independente.
Os dois estudos mostram as possibilidades muito reais da emergncia de novos e perigosos
vrus de gripe no mundo real. Eles evidenciam tambm que transformar vrus de gripe em arma
seria uma faanha da engenharia gentica, e no algo que qualquer pessoa pudesse fazer com
certa facilidade. Os estudos demandaram considervel investimento e dezenas de milhares de
homens-hora altamente habilitados. Para um terrorista em potencial, essa no era a nica
desvantagem. Como um vrus de gripe mutante transmissvel entre mamferos no pode ter por
alvo um grupo particular de pessoas, impossvel qualquer tentativa de us-lo para assassinar
uma populao especfica.
Os vrus tampouco respeitam geografia ou nacionalidades. Uma teoria por trs da difuso
global da devastadora gripe de 1918 foi de que ela comeou num avirio no Kansas que fornecia
frangos a uma base militar local, e os soldados a levaram com eles depois, quando foram
mandados para a frente de combate, na Primeira Guerra Mundial. Hoje, com as viagens pelo
mundo todo e um vrus emergindo numa conurbao densa como Hong Kong, o potencial de
atingir seres humanos em toda parte ainda maior. H uma ameaa decorrente da liberao de
vrus transmissveis de um laboratrio, seja por acidente, seja por inteno malvola. No entanto,
se voc estivesse firmemente decidido a criar um vrus assassino sinttico indiscriminado, em vez
dos milhes que isso demandaria, seria muito mais eficiente recorrer ao processo muito bem
comprovado da seleo artificial, e seu ponto de partida seria um avirio com higiene duvidosa.
Pssimas prticas na criao de aves geram um viveiro muito mais provvel de gripes
assassinas.
A utilidade da gripe como arma tambm questionvel. Se seu objetivo for assassinato em
massa, arremessar um avio de passageiros em pleno voo contra um arranha-cu
consideravelmente mais fcil. Mas o objetivo da biologia sinttica reduzir o nvel de acesso
engenharia gentica, e a cultura aberta dos BioBricks significou que a manipulao de genes
impossvel uma dcada atrs agora cincia de escola. Ter isso tornado mais baixo o nvel de
acesso ao bioterror? Atualmente, no h na biblioteca nenhum bloco (brick) que pudesse ser
diretamente associado a uma arma biolgica. Mas possvel construir uma bomba de pregos
com componentes individualmente incuos o bastante para serem comprados numa loja de
ferragens qualquer. De fato, se estiver assim propensa, a pessoa pode fazer todos os tipos de
explosivo recorrendo a simples itens domsticos. O relatrio do grupo ETC sobre biologia
sinttica descreve-a como engenharia gentica com esteroides, e afirma que, em ltima
anlise, ela significaria ferramentas mais baratas e amplamente acessveis para construir armas
biolgicas, patgenos virulentos e organismos artificiais que poderiam representar graves
ameaas para as pessoas e o planeta. Talvez haja uma centelha de verdade nesse sentimento,
uma vez que qualquer progresso em biologia sinttica permitir o desenvolvimento de nova
tecnologia com utilizao potencialmente ambgua. Hoje, porm, e num futuro previsvel, a
realidade de uma arma construda por engenharia gentica depende do uso muitssimo generoso
das palavras teoricamente possvel.
Essa histria dos experimentos com gripe assassina suscita tambm uma questo muito
importante sobre a natureza da cincia. Um dos princpios fundamentais da pesquisa cientfica
a liberdade para investigar qualquer assunto e publicar os resultados. possvel que, com o
advento dessas to poderosas tecnologias passveis de dupla utilizao, essa era esteja chegando
ao fim. Mas censurar informao cientfica referente a agentes potenciais de terror ignorar
dois problemas. O primeiro que, ao estudar o funcionamento dos patgenos, compreendemos
melhor como lidar com eles. Isso pode ser necessrio diante de uma ameaa terrorista, ou
simplesmente para ajudar a tratar pacientes, em especial quando a virulncia encerra potencial
epidmico. Isso precisa ocorrer de maneira aberta e irrestrita, pois a cincia mais rica, mais
produtiva e criativa ocorre quando a informao no se restringe por barreiras e livremente
compartilhada. Fazendo isso, ns nos equipamos para enfrentar exatamente a mesma ameaa,
caso ela venha a ocorrer. O conhecimento de como funcionam novas formas de vida virulentas
ou transformadas em armas nos deixar preparados para ameaas naturais e fabricadas. Quando
se publicou o texto de Kawaoka, um editorial na Nature sentenciou: Um artigo que omite
resultados decisivos ou mtodos impossibilita pesquisas subsequentes e a reviso pelos pares. O
ponto decisivo tambm de carter prtico. Manter a informao sob sigilo e apenas para os
olhos do autor inexequvel. A Nature tinha conhecimento de que havia muitas verses do artigo
em circulao fora dos canais oficiais do processo de publicao, o que cada vez mais comum
na era da internet. Prosseguindo, o editorial declarou que no parecia possvel imaginar
qualquer mecanismo ou critrio pelo qual avaliar sensatamente quem deveria ou no ter
permisso para ver o trabalho.
Em certo sentido, esses dois estudos foram os primeiros e mais bvios experimentos sobre
uma ameaa atravs da gripe. A evoluo tenaz, e as formas de vida lutam pela imortalidade.
Quando se trata de compreender como isso se desdobrar, estamos sempre tentando recuperar o
atraso. No podemos prever todas as ameaas naturais possveis, mas deveramos fazer o
possvel para nos armar contra aquelas que podemos antecipar. Qualquer conhecimento nessa
corrida armamentista melhor que nada. Isso, a meu ver, boa cincia e boa estratgia. usar
o princpio da precauo de maneira agressiva. At que esses dois estudos sobre gripe fossem
feitos, no estava claro se era possvel para essas cepas saltar a barreira das espcies. Eles
fornecem tambm claras bandeiras genticas, em que as sentinelas da sade pblica devem
estar atentas, em cepas emergentes de gripe. Ao descobrir como transformar uma gripe em
outra que seja capaz de causar uma pandemia, armamo-nos at mesmo contra a possibilidade de
que isso venha a ocorrer naturalmente.

Agenda poltica

Outra linha de ataque consiste em afirmar que comer alimentos geneticamente modificados
poderia nos fazer mal. Em biologia, procuramos mecanismos que expliquem observaes, e no
fcil imaginar que mecanismo iria resultar num efeito adverso sobre nossa sade aps
ingerirmos um alimento modificado. Entretanto, se esse fosse um fenmeno observvel, ele
mereceria explicao. Opositores dos GM citam muitas vezes a ideia de que comer alimentos
GM poderia nos fazer mal, embora ela tenha sido refutada em muitos relatrios independentes.
Como muitos alimentos modificados foram aprovados muito tempo atrs, h tambm mais
evidncias do que um cientista poderia desejar para demonstrar que seguro ingeri-los. Segundo
uma estimativa feita em 2011, 2 trilhes de refeies contendo alimento geneticamente
modificado haviam sido consumidas nos dois anos anteriores. O Departamento de Agricultura
dos Estados Unidos avalia que, em 2010, os GM geraram uma receita de US$ 76 bilhes, e os
produtos j fazem parte da cadeia alimentar humana.
Apesar disso, as controvrsias continuam causando problemas. Em setembro de 2012, um
pequeno estudo publicado numa revista de pouca expresso foi parar nas manchetes e reatiou o
debate sobre os GM. Uma equipe de cientistas franceses, liderada por um bilogo molecular
chamado Gilles-Eric Sralini, alimentara ratos com um tipo de milho geneticamente modificado
durante a vida dos animais e observara todos os efeitos sobre sua sade. O alimento modificado
havia sido desenvolvido pela empresa de biotecnologia Monsanto para resistir a um herbicida
amplamente usado. Ele fora aprovado como alimento para seres humanos e animais no mundo
todo, e estudos anteriores no haviam mostrado nenhum efeito adverso sobre a sade desse milho
particular (chamado NK603, antes Roundup). De fato, em 2012, o que era considerado o padro-
ouro nesses tipos de ensaio, uma reviso sistemtica de mltiplos estudos de longo prazo, tambm
concluiu que uma dieta de alimento GM no produzia qualquer efeito adverso para a sade. No
estudo de Sralini e nos comentrios que o envolveram na imprensa, afirmava-se que algumas
dessas pesquisas anteriores eram qualitativamente diferentes do que ele fizera. Seu artigo
mostrava claramente que os ratos usados foram profundamente afetados pela dieta de GM,
sofrendo tumores grotescos e morrendo bem antes dos ratos do grupo de controle.
Logo, porm, o estudo comeou a ser destrinchado. Os autores e o artigo foram rudemente
criticados pela qualidade do trabalho e tambm pela maneira como relataram a pesquisa. Com a
velocidade possibilitada pela internet, cientistas comearam a condenar os dados, dizendo que o
projeto experimental, a anlise estatstica e a maneira como os dados foram apresentados
estavam todos abaixo do padro, e alguns expressaram surpresa ao ver semelhante artigo ser
publicado. Em especial, os crticos observaram que Sralini havia usado ratos j propensos a
desenvolver tumores, bem como nmeros inadequados de ratos no grupo de controle, em
comparao ao dos experimentais.
Logo veio tona que a divulgao dos resultados era parte de uma campanha orquestrada de
relaes pblicas que inclua um livro de Sralini, o qual tinha um histrico de ativismo
antibiotecnolgico, e um documentrio de televiso. O prprio artigo no foi livremente
distribudo imprensa antes da publicao, o que bastante inusitado, o tipo de coisa que deixa os
jornalistas cientficos desconfiadssimos: a maioria procurar ouvir os comentrios de outros
cientistas. Com o artigo de Sralini, exigiu-se um acordo assinado daqueles a quem foi oferecido
acesso ao texto, que veio com mais uma severa advertncia extremamente incomum: Um
reembolso do custo do estudo de vrios milhes de euros seria considerado indenizao se a
divulgao prematura pusesse em xeque a publicao da pesquisa.
Uma organizao chamada Sustainable Food Trust havia dirigido uma campanha para
difundir o trabalho da maneira mais ampla possvel, incluindo uma pgina exclusiva na web,
afirmando que sua motivao era promover o que chamam de boa cincia. Os defensores
eram incentivados a passar adiante mensagens pr-fabricadas de apoio no influente site de mdia
social Twitter. Quase toda a imprensa convencional havia noticiado o artigo, embora,
curiosamente, parte da cobertura, como a da BBC, tivesse includo algumas das crticas imediatas
e penetrantes formuladas por cientistas. Alguns dias depois, a European Food Safety Authority
emitiu uma declarao: O plano, o relato e a anlise do estudo, tal como delineados no artigo,
so inadequados, acrescentando que o texto tem qualidade cientfica insuficiente para ser
considerado vlido para avaliao de risco.
A ofensiva de relaes pblicas, porm, tinha feito seu trabalho. Muitos rgos de notcias
publicaram a matria de forma acrtica. O semanrio francs Le Nouvel Observateur estampou
uma manchete que gritava: Sim, os GM so venenos! O primeiro-ministro francs declarou
que seu pas defenderia a proibio desses produtos agrcolas geneticamente modificados em
toda a Europa (embora tenha tido a decncia de acrescentar especificamente a ressalva da
necessidade de validar os resultados). Sem esquecer a maneira inusitada como o artigo foi
publicado, os resultados no so invlidos at que outros estudos provem isso, o que no quer dizer
que eles so corretos; dadas as fortes crticas feitas prpria metodologia, parece justo dizer que,
no mnimo, o estudo de Sralini requer a mais rigorosa replicao de resultados, distribuio dos
dados originais para anlise independente e correo da metodologia, tornando-a mais segura,
para estabelecer sua validade de maneira indubitvel.3
Minutos aps a publicao, muitos j investigavam meticulosamente no apenas o artigo, mas
a maneira como ele fora publicado. O objetivo desse tipo de exerccio de relaes pblicas
ganhar adeso para uma ideia, e nesse caso eles foram parcialmente bem-sucedidos, diante do
rpido esquadrinhamento feito pelos crticos. Alguns sugeriram que esse estudo de caso marca
uma virada no conflito em relao aos GM, pois a condenao foi to rpida e to severa que
parte da imprensa convencional a aprovou. Mas, tal como ocorre com os boatos, depois que
ideias cientficas como esta so levadas a pblico, muito difcil corrigi-las, mesmo que a
metodologia seja deficiente, que se conheam as intenes ocultas dos perpetradores ou qualquer
outra coisa.
H volumes e volumes de publicaes sobre GM, e nestas pginas estou mencionando apenas
um punhadinho do passado muito recente. No se trata de escolher o que h de melhor entre os
dados para respaldar uma opinio particular, de um plano criminoso que denuncio, mas de
ilustrar como a pesquisa em GM est sujeita a manipulao e obtm grande publicidade porque
provoca reaes apaixonadas e polarizadas. A opinio pblica e a poltica podem ser distorcidas,
e o foram, pela maneira como campanhas desse tipo so conduzidas, e a polarizao deliberada
dos debates pblicos prejudica a anlise abalizada, informada e necessria da aplicao da
biotecnologia.

Malria

Concentrar-se na possibilidade de dano provocado por alimentos GM ou de bioterror fixar-se


numa ameaa, quer ela esteja assomando, quer seja atualmente implausvel. Como indstria que
serve para abrir oportunidades, o campo nascente da biologia sinttica at agora produziu poucas
histrias de genuno sucesso. Neste livro, expressei entusiasmo pelo seu potencial, mas, neste
captulo e em outras partes, analisei algumas das mais duras realidades da aplicao de cincia
revolucionria sociedade, que esto explcitas no julgamento da biologia sinttica. H inmeros
exemplos de sucesso cientfico da engenharia gentica em seu sentido mais amplo, em especial
em termos da compreenso dos elementos bsicos da biologia e das causas subjacentes a
milhares de doenas. O trabalho que realizei no laboratrio no passado ajudou a identificar uma
forma de cegueira infantil, e isso no teria sido possvel sem a modificao gentica de
camundongos.
A biologia sinttica ainda deve produzir algo com essa escala. No entanto, est pronta para
comear, e, como qualquer disciplina que envolve cincia extremamente complexa e em
constante mudana, no est sujeita apenas ao exame minucioso realizado por pessoas e
polticas, mas tambm por foras de mercado e da economia. A histria da empresa de biologia
sinttica Amy ris e sua tentativa protelada de introduzir o biodiesel no mercado so descritas a
partir da pgina 32. Provavelmente, porm, a maior histria de sucesso isolado da biologia
sinttica, juntamente com o atoleiro dos mercados reais, vem exatamente da mesma equipe, dos
mesmos laboratrios e da mesma placa de circuito gentico.
Em toda a extenso da histria humana, a malria foi uma presena letal constante. Segundo
algumas estimativas, o nmero de pessoas que morreram nas mos do Plasmodium, o parasita da
malria transportado por mosquitos, chega s dezenas de bilhes, dependendo do modo como
definimos espcie humana. Hoje, 14 de bilho de pessoas so infectadas cada ano, e as
estimativas mais elevadas so de que mais de 1 milho morrer, em sua maioria crianas
pequenas. Alm do tremendo custo humano, a OMS estima que o custo da malria para o PIB,
nos pases da frica subsaariana, est na ordem de US$ 100 bilhes desde os anos 1960. O desejo
de reduzir o nus da malria enorme.
Desde o sculo XVII, o quinino, extrado da quina, como so chamadas as rvores do gnero
Cinchona, nativas da Amrica do Sul, era o tratamento preferido, embora fosse acompanhado
por um conjunto de sintomas colaterais desagradveis. Aps a Segunda Guerra Mundial, um
primo qumico do quinino chamado cloroquina usurpou seu lugar como o medicamento
antimalrico usual. Mas, como todas as formas de vida, o parasita quer continuar a viver, e o faz
evoluindo. O tratamento em massa com cloroquina significou que, nos anos 1950, cepas de
Plasmodium resistentes mortal cloroquina emergiram e espalharam-se pelo mundo numa
tentativa de assegurar sua prpria sobrevivncia diante da extino provocada pelo homem.
Hoje, a droga preferida na rea da malria uma pequena molcula chamada artemisinina.
Ela extrada da erva artemsia (Artemisia annua), arbusto canforceo asitico cultivado no
mundo inteiro e usado na medicina popular durante sculos. Como tratamento para malria, a
artemisinina rpida e eficaz. A OMS probe especificamente seu uso isolado, por temor de se
cultivarem e selecionarem de maneira no intencional cepas de Plasmodium naturalmente
resistentes. Recomenda, em vez disso, que a artemisinina seja o elemento principal em terapias
combinadas.
Obter artemisinina suficiente oneroso e complicado. Ela deve ser cultivada rapidamente e
de formas muito especficas. De um ponto de vista econmico, o cultivo da artemsia por si s
significa que ela est competindo com produtos agrcolas destinados alimentao ou a servir de
matria-prima.
Medicamentos so criados em laboratrios qumicos. Comeamos com ingredientes qumicos
bsicos, que podem ser comprados de empresas qumicas ou colhidos no mundo vivo. A
produo de medicamentos como uma culinria meticulosamente precisa, pois cada
ingrediente adicionado e misturado para adicionar ou subtrair, de modo sistemtico, bocadinhos
de molculas at que se obtenha a droga desejada. A artemisinina no uma molcula grande,
mas infelizmente no fcil nem barato, o que mais importante sintetiz-la usando qumica
simples. Logo que se comeou a trabalhar com circuitos sintticos para criar diesel
biossintetizado, o pesquisador Jay Keasling, da Universidade Stanford, foi alertado por um
estudante para o fato de que um dos passos na trajetria qumica deles era tambm um elo-
chave na cadeia que poderia produzir artemisinina sinttica. Enquanto ele tentava construir um
circuito gentico que iria criar diesel, sua equipe tambm tentou desenvolver outro que
construiria artemisinina. Eles publicaram o primeiro circuito bem-sucedido para a sntese de
artemisinina em levedura em 2006, tendo abandonado as bactrias em 2003. Esse circuito
composto por doze genes de trs diferentes organismos.
Em ambos os casos, elevar-se at o nvel de produo industrial era inerente aos objetivos de
Keasling, mais uma vez assinalando a inteno no s de criar pesquisa cientfica, como tambm
de aplic-la diretamente a situaes do mundo real. estranho ver isso num artigo cientfico,
porm, desde o incio, a reduo do custo da produo foi claramente estabelecida como misso
do trabalho: Alcanar escala industrial ser necessrio para elevar a produo de cido
artemisnico at o nvel suficientemente alto para reduzir terapias de combinao de artemisinina
a preos bem inferiores aos atuais. Isso exemplifica como a biologia sinttica incorpora a
mentalidade da engenharia, voltada para a soluo de problemas. E denota a aplicao como a
meta: no se trata apenas de produzir um medicamento funcional, mas tambm de faz-lo a
baixo custo.
A justificao de Keasling para esse aparente altrusmo origina-se das foras de mercado que
perturbaram o cultivo de artemisinina nos anos anteriores. No final do sculo XX, houve grande
insuficincia de cultivo de Artemisia annua, e por isso o mercado elevou o preo da artemisinina.
Em seguida, identificando uma brecha no mercado, milhares de agricultores africanos e asiticos
comearam a cultivar a planta, e os preos caram. Mas mesmo com o preo mantido
artificialmente em US$ 1 a dose nas clnicas pblicas, por convenincia, mais da metade dos
pacientes comprava verses mais caras nas barracas de mercados, no reconhecendo a
interveno do governo. Fornecimento instvel, flutuaes nos preos e produes variveis
ocasionaram nova elevao de preos, e esse padro parecia fadado a continuar.
Keasling aparelhou a Amy ris para desenvolver a produo de artemisinina, juntamente com
seu irmo diesel (que fracassou, pelo menos temporariamente). A partir da, a Bill and Melinda
Gates Foundation, a organizao filantrpica fundada pelo bilionrio da Microsoft e sua esposa,
contribuiu com US$ 46 milhes para a entidade filantrpica Institute for One World Health, que
trabalhava com a Amy ris para realizar a produo em escala industrial. A Amy ris conduziu esse
projeto como atividade sem fins lucrativos e associou-se a organizaes como o Global Fund
para reduzir o custo da artemisinina e distribuir a maior quantidade da droga (como parte de uma
terapia de combinao) pelo menor preo possvel. Isso significa forar a reduo do custo a
menos de US$ 0,50 por tratamento. A Amy ris concedeu ao gigante farmacutico Sanofi-Aventis
uma licena livre de roy alties para produzir barris de artemisinina sinttica, que devem chegar s
prateleiras nos prximos dois anos.
A implementao de um coquetel de medicamentos antimalricos a estratgia da OMS
para o combate da doena. Dessa maneira, no se desenvolve a resistncia contra a artemisinina,
a exemplo do que ocorreu com os antecessores, destruindo seu poder teraputico. No entanto, as
empresas negligenciam a estratgia da OMS como os constituintes da terapia combinada
podem ser vendidos individualmente, lucrativo ignorar sua recomendao. Em 2009, a OMS
sentiu-se compelida a emitir um comunicado que instava as empresas a parar de vender
artemisinina como terapia isolada. Andrea Bosman, que participa do Projeto Global para a
Erradicao da Malria, disse Nature: terrvel. Quem disse que no h lucro a ser obtido
com a malria? Se voc visse o nmero de empresas que operam na frica e a diversidade de
produtos, ficaria pasmo.
A realidade da cincia aplicada no mercado fornece a principal restrio a essa histria.
Aconteceu exatamente o que os cientistas da OMS estavam tentando evitar. Os primeiros casos
de resistncia artemisinina foram descobertos em My anmar, em 2004, tal como ocorrera com
a cloroquina no sculo XX. A conteno do parasita evoludo passou a ser prioridade, mas em
2012 pacientes com respostas limitadas ao medicamento foram registrados no Camboja,
indicando que a resistncia se espalhara (ou possivelmente evolura de maneira separada). Com
sorte, os princpios da troca de componentes e manipulao dos circuitos que caracterizam a
biologia sinttica tornaro a estrada para a modificao do tratamento da malria mais fcil e
mais engenhosa nos prximos anos.
No imaturo mercado do cultivo da artemsia, os preos flutuavam violentamente em ciclos de
altas e baixas. Embora essa instabilidade seja indesejvel, parte da argumentao contra o
estabelecimento de uma base de produo sinttica que isso resultaria no deslocamento de
milhares de agricultores que cultivam Artemisia annua, pois seu meio de vida ser arruinado por
uma produo sinttica muito mais barata. Esse um dos ataques lanados por grupos que
militam contra a biologia sinttica, e talvez ele tenha alguma legitimidade. Em 2012, num
comunicado impresso criticando especificamente o projeto de produo de artemisinina
sinttica, o ETC afirmou que seria possvel atender demanda de artemisinina apenas com o
aumento do cultivo de Artemisia annua. A produo sinttica, portanto, era no apenas
desnecessria como iria retirar o controle dos pequenos agricultores e entreg-lo para grandes
corporaes farmacuticas ocidentais.
Parte desse argumento corre o risco de cair na armadilha da chamada falcia luddista, a
ideia de que o desemprego tecnolgico decorrncia dos avanos tecnolgicos, medida que a
mecanizao e depois a automao substituem os trabalhadores. Isso um sofisma, ao menos a
longo prazo, porque, se fosse verdade, como assinala o economista Alex Tabarrok, estaramos
todos desempregados, pois a produtividade vem crescendo h dois sculos. Ao mesmo tempo,
uma empresa sem fins lucrativos para produzir um medicamento acessvel para tratar milhes
de pessoas deveria falar mais alto que essas preocupaes. A colaborao entre a Amy ris, o One
World e o gigante farmacutico Sanofi-Aventis tem a marca da responsabilidade corporativa.
Eles concordaram em trabalhar sem fins lucrativos e em limitar o fornecimento a 50% da
totalidade do mercado para artemisinina, o que deixa algum espao para a agricultura
convencional. Resta ver se essa colaborao ser o paradigma da ajuda humanitria possibilitada
pela biologia sinttica, pois, no momento em que escrevo, a artemisinina sinttica ainda no est
no mercado. Se e quando isso acontecer, este ser o primeiro produto comercial genuno da
biologia sinttica; se bem-sucedido, ser esmiuado, estudado e acompanhado durante anos.

Deveria ou poderia? A defesa do progresso


A cincia fundamentalmente um esforo pblico, em especial por ser financiada em grande
parte por recursos pblicos, mas tambm porque os benefcios da pesquisa cientfica no
comercial so para todos. medida que emergir, a biologia sinttica enfrentar todos os
problemas que os GM encararam durante a breve histria da biotecnologia, e mais, medida que
ela se desenvolver. Uma coisa parece essencial: o debate sobre biologia sinttica e modificao
gentica deve acontecer em pblico e com o pblico.
As reivindicaes de veto feitas pelos opositores da modificao gentica e agora da biologia
sinttica so irrealistas e destrutivas. Elas se destinam a fomentar o medo a partir de uma posio
ideolgica e a encolerizar, em vez de envolver. O satirista do sculo XVIII Jonathan Swift sugeriu
que no era possvel demover uma pessoa com argumentos racionais de uma posio que ela
no havia adotado por fora de argumentos racionais. Se a resistncia a novas formas de
biotecnologia ideolgica, a tentativa de contestar essas ideias com evidncias encerra rduos
desafios. H questes legtimas e srias envolvidas em qualquer das tecnologias descritas nestas
pginas, mas elas exigem debates racionais, abertos e informados.
Produtos agrcolas GM esto na natureza e tambm em nossa comida. Outro desafio
significativo sugerido pelos ativistas verdes que, uma vez nos campos, os produtos GM podem
se cruzar com produtos tradicionalmente manipulados, e os genes artificiais podem suplantar seus
homlogos mais naturais no mercado aberto da natureza. Essa uma preocupao mais legtima,
pois sabemos que isso pode acontecer. Como ocorreu com o trigo EF em Rothamsted, a
engenharia gentica em produtos agrcolas muitas vezes tem o objetivo de reduzir a necessidade
de pesticidas, fazendo as plantas produzirem suas prprias defesas. De maneira semelhante,
manipular um produto agrcola para torn-lo resistente a um herbicida potencialmente til, pois
significa que os agricultores podem pulverizar seus campos com esse produto, sabendo que
apenas as plantas indesejadas vo morrer. At agora, porm, experimentos de campo
produziram resultados ambguos. Alguns produtos agrcolas GM parecem de fato ter como efeito
reduzir a biodiversidade local, com menos plantas silvestres e menos insetos para poliniz-los.
Mas isso no universal. Em um experimento realizado, o milho GM pareceu aumentar a
biodiversidade, ao passo que a beterraba e a colza tiveram efeito contrrio. Esse tipo de resultado
no incomum: a biologia desordenada. Mas isso deveria nos levar a realizar mais
experimentos, no a encerr-los ou mesmo vandaliz-los.
Um nmero cada vez maior de cientistas e polticos est agora aderindo opinio de que,
para fazer face ao crescimento gigantesco da populao, pobreza e s mudanas de clima que
se aproximam, os produtos agrcolas geneticamente modificados sero muito necessrios. John
Beddington, o principal consultor cientfico do governo do Reino Unido, disse BBC em 2011:

Se houver organismos geneticamente modificados que resolvam os problemas que no


conseguimos solucionar de outras maneiras, e se ficar demonstrado que eles so seguros do
ponto de vista da sade humana e ambiental, nesse caso, deveramos us-los.

O princpio da precauo cuidadosamente inserido nessa declarao, sugerindo a


convenincia de GM, e no um desejo extravagante ou comercial de introduzir essas criaes.
Uma necessidade simples est subjacente ao comentrio de Beddington: em ambientes em
mudana, muitos dos quais tornaro a terra pobre, menos arvel, precisamos de novas maneiras
de conferir maior resistncia a produtos agrcolas em solo difcil. Lenta e complicada, a
hibridizao no uma opo realista.
No caso da biologia sinttica, seu potencial de uso a servio da humanidade e do planeta a
situa num campo similar. No conhecemos a totalidade dos efeitos provocados por levar seus
produtos para fora do laboratrio, para a natureza. Uma das principais reivindicaes dos
antagonistas da biologia sinttica que essas clulas e formas de vida artificiais no devem ser
distribudas. Vimos, com produtos agrcolas GM, a difuso de seus genes modificados alm do
hospedeiro original, embora no se saiba se isso teve resultado prejudicial. Poderia qualquer dos
produtos da biologia sinttica causar estragos? O circuito assassino do cncer descrito no Captulo
3 integra-se ao genoma de um vrus e entrega sua mensagem letal aps infectar uma clula
cancerosa. Ele est destinado a visar apenas um tipo especfico de clula maligna, e efetua um
clculo para determinar precisamente sua natureza cancerosa. Se ele fosse capaz de se adaptar e
se incorporar ao ecossistema natural, haveria o risco de que penetrasse em outras clulas e as
destrusse? inimaginvel que pudesse faz-lo, em razo da natureza muito precisa do projeto do
circuito, mas, teoricamente, no impossvel, apenas muitssimo improvvel. Sabemos que os
genes permutam entre microrganismos e vrus, e essa possibilidade no pode ser excluda.
Poderia Sy nthia viver fora do laboratrio? O Mycoplasma micoides um patgeno natural,
embora pouco importante e no letal para as cabras. Ele poderia viver fora do laboratrio,
embora a equipe de Venter tenha inscrito especificamente em seu genoma um naco de cdigo
que o tornou incapaz de infeco, negando-lhe assim seu hbitat favorito. Mas, dada a notvel
tenacidade das bactrias, talvez lhe fosse possvel adquirir funes ao ficarem expostas a outras
bactrias, medida que elas trocassem seus genes.
Poderiam as clulas de levedura produtoras de artemisinina ou o biocombustvel da Amy ris
escapar de seus barris e devastar ecossistemas? improvvel, pois elas tambm so otimizadas
para cumprir seu objetivo especfico, e no para sobreviver. Elas no esto na natureza ou em
campos de teste, embora seus produtos no vivos estejam.
Esses desdobramentos no so todos incontestveis; contudo, aps cuidadosa ponderao, os
riscos parecem quase triviais. Assim como as questes ainda por resolver na agricultura
geneticamente modificada, eles sugerem a necessidade de mais pesquisa, no menos.

Conhecimento isento de valor

Em 2007, um editorial da revista Nature fez este comentrio: Muitas tecnologias foram, em um
momento ou outro, consideradas uma afronta a Deus, porm, talvez nenhuma atraia essa
acusao de maneira to direta quanto a biologia sinttica. Pela primeira vez Deus tem
concorrncia. Isso foi escrito em amplo apoio biologia sinttica, mas envolve um equvoco
teolgico. Desde que Eva deu uma mordida numa ma, Deus, caso se acredite nessas coisas,
teve concorrncia. Ao longo de toda a nossa existncia, ns contestamos, manipulamos e
forjamos a natureza segundo nossos objetivos. Nossa influncia moldou e definiu este mundo
vivo, governado at este momento por regras darwinianas. Com a biologia sinttica, temos a
oportunidade no de suplantar essas regras, mas de criar novas vidas para objetivos especficos.
No se trata de um apelo para derrotar a natureza, nem de espezinh-la mais do que j o
fizemos. Em menos de uma frao de uma batida cardaca da existncia deste planeta, fizemos
mais que o suficiente para pr em risco a continuidade de nossa existncia aqui. O planeta vivo
continuar girando segundo a lei fixa da gravidade, com ou sem ns, seus rebentos mais criativos
e destrutivos. Mas com decises cientficas inteligentes, informadas, temos capacidade de
consertar nossos erros passados.
Em 2005, no trigsimo aniversrio do encontro de Asilomar, Paul Berg comentou: Antes de
mais nada, ganhamos a confiana do pblico, pois foram os prprios cientistas, os mais
envolvidos no trabalho e com todos os incentivos para continuar livres e perseguir seu sonho, que
chamaram ateno para os riscos inerentes aos experimentos que estavam realizando. Um
dcimo do pblico que compareceu ao evento era formado por jornalistas, desimpedidos para
observar as frequentemente amargas altercaes entre os cientistas. Foram os cientistas que
suscitaram as preocupaes; ao debat-las em pblico, eles asseguraram que os resultados
fossem cuidadosos, progressivos e incontroversos.
Talvez as regras atuais no sejam suficientes no futuro, mas, nesse caso, no deveriam ser
reconsideradas de maneira preventiva, impedindo o progresso. Se uma vigilncia prudente for
incorporada estrutura do financiamento da pesquisa, ao envolvimento pblico e maneira
como os estudos so realizados e aplicados, o princpio da precauo estar em primeiro lugar na
maneira como a biologia sinttica avana. Ainda resta ver se isso funciona, mas deter o
progresso negar o benefcio potencial que novas tecnologias podem proporcionar. Alm disso,
maior regulamentao, progresso restrito e monitorao intensa retiram a pesquisa real das mos
de cientistas publicamente financiados, porque todas essas coisas so caras. Esses nveis de
burocracia so manejados confortavelmente por empresas com interesses comerciais, que no
esto obrigadas a manter dilogos abertos com um pblico que poderia financi-las.
A biologia sinttica est se movendo num ritmo tal que muitos cientistas se atordoam com seu
progresso. Ganhar o apoio do pblico e de polticos tarefa difcil, mas essencial, pois a
sociedade quem decide o que devemos e no devemos fazer. Deliberao democrtica foi a
expresso utilizada no relatrio de bioeconomia de 2010, do presidente Obama. Para esse fim, no
Reino Unido, grandes agncias de financiamento pblico encomendaram em 2010 extensas
pesquisas sobre o que o pblico sabe e pensa em relao biologia sinttica. Questes
fundamentais emergiram:
Qual o objetivo?
Por que vocs querem fazer isso?
O que vocs vo ganhar com isso?
O que mais isso vai fazer?
Como vocs sabem que esto certos?
Essas so as questes certas, que todo cientista deveria fazer em relao a qualquer projeto;
portanto, nesse sentido, o dilogo est funcionando.
No entanto, ao refletir sobre o triunfo do encontro de Asilomar, Paul Berg tambm advertiu
que uma tentativa de repetir sucessos passados seria um gesto ftil:

Em contraposio, as questes que nos desafiam hoje so qualitativamente diferentes. Elas


esto muitas vezes envoltas em interesses econmicos, e, cada vez mais, em conflitos ticos e
religiosos quase inconciliveis, e em valores sociais profundamente arraigados. Uma
conferncia do tipo de Asilomar que tentasse enfrentar essas ideias contenciosas est, eu
acredito, fadada acrimnia e estagnao poltica, e nenhuma das duas nos faz avanar na
causa de encontrar uma soluo.

No compartilho esse pessimismo. Acredito que a pesquisa cientfica deveria ocorrer sob o
foco do escrutnio pblico, e que os cientistas deveriam se envolver com pblicos de todos os
nveis de competncia. Dessa maneira, com os dados expostos e conversas pblicas informadas
sobre o benefcio e o dano potencial que as novas tecnologias produzem, promovemos uma
sociedade em que abordagens racionais a problemas globais e locais tornam-se coisas comuns.
H uma revoluo em processo, e ela est em nossas mos. A biologia sinttica promete
benefcios para a residncia de toda a humanidade na Terra e em mundos ainda no explorados,
benefcios grandes demais para ser ignorados, reprimidos ou censurados. H um otimismo
juvenil, uma cultura da remixagem de criatividade ilimitada que acredita que essas novas
tecnologias ajudaro a corrigir os problemas que enfrentamos, e, pelo menos em alguns lugares,
uma disposio sem precedentes a expandir esse programa.
Enfrentaremos desafios novos e imprevistos, alguns dos quais ns mesmos criamos ou pelo
menos alimentamos. Mas deveramos nos esforar para inventar tecnologias que no estejam
em conflito com a natureza, no a subvertam ou explorem, mas trabalhem lado a lado com nosso
sofisticado mundo vivo, com sua histria evolvida ao longo de 4 bilhes de anos. O progresso da
humanidade nasceu de nossas tentativas de explorar e compreender uma paisagem em constante
mudana, e viver dentro dela sem esbanjar os recursos que nos proporciona. Nossa explorao
do funcionamento de seres vivos durante dois ou trs sculos nos deu o poder de fazer coisas que
nunca poderiam ter acontecido antes. Estamos construindo formas de vida para produzir
combustveis, medicamentos e tratamentos, ferramentas com que explorar nosso Universo e
novas criaes vivas ilimitadas, que podem ajudar nosso mundo e nosso domnio sobre ele. Nossa
responsabilidade no restringir esse conhecimento, mas us-lo para aperfeioar a ns mesmos
e ao nosso planeta vivo. Por vezes isso formulado como a questo de ser ou no conveniente
que faamos as coisas de que somos capazes. A resposta transcende as opes: nossa obrigao
faz-lo.
Posfcio

Novas linguagens

A lngua evolui. Samuel Johnson observou em seu famoso dicionrio que todas as lnguas tm
uma tendncia natural degenerao, embora, ao longo de toda a histria, o declnio terminal
tenha sido, de certo modo, miraculosamente evitado. Essa ansiedade em relao ao modo como
as lnguas mudam juntamente com uma sugesto de que outrora, em algum ponto no passado,
elas existiram em forma perfeita e inviolada foi expressada em cada gerao, atravs da
histria, por briges rabugentos, mas na realidade reflete apenas o fato de que as palavras e seus
significados mudam constantemente com o tempo. Palavras bacanas so acrescentadas,
desfiguradas, furtadas e inventadas. Muito ocasionalmente, lnguas adquirem novas letras
tambm.1
Como o cdigo gentico a nica linguagem da vida de que temos conhecimento, no h
possibilidade de importar letras ou palavras de outras formas de vida; no h nenhuma analogia
direta para o tipo de emprstimo e troca que vemos nas lnguas. No entanto, genes e DNA as
palavras em nossa analogia, em contraposio s letras do cdigo gentico podem ser trocados
entre espcies, em particular espcies unicelulares de bactrias e arqueias. Mas eles podem
tambm ser transportados de maneira inofensiva para criaturas mais complexas quando vrus
integram seu genoma num hospedeiro. Estima-se que nada menos de 8% de nosso DNA esteve
outrora no genoma de um vrus.
Assim, como temos dificuldade de apontar com preciso o momento em que surge uma
espcie, no houve nenhum ponto em que possamos dizer que o ingls nasceu, ou qualquer uma
da mirade de lnguas ou dialetos que so e foram falados na histria humana. No entanto, Kelkaj
lingvoj ne evoluas; kelkaj simple elpensigas, como diriam os que falam esperanto: algumas
lnguas no evoluram, elas foram simplesmente inventadas. O esperanto, uma nobre tentativa de
induzir a paz no mundo mediante a criao de uma lngua universal, sobrevive um sculo depois
de sua criao com alguns milhares de falantes. Na verdade, cerca de novecentas lnguas foram
inventadas a partir do zero, inclusive o Klingon, tal como falado pelos zangados guerreiros
fictcios da franquia Star Trek e algumas centenas de devotos seguidores.
Nosso domnio da lngua do DNA e de sua mecnica nos levou a um ponto em que no
precisamos nos contentar mais com o alfabeto, o lxico e a linguagem de 4 bilhes de anos da
vida. Na era da biologia sinttica, iniciamos o processo de inventar novos elementos.
Se voc algum dia teve herpes labial, provavelmente j usou letras de DNA artificiais. As
letras universais, nucleobases, so, claro, meras substncias qumicas. A para adenina uma
coleo de quinze tomos: cinco tomos de carbono, cinco de nitrognio e cinco de hidrognio.
Eles esto arranjados num hexgono preso a um pentgono com algumas bolinhas projetando-se.
No h nada intrinsecamente especial nesse arranjo nem no das outras bases que compem o
cdigo gentico. Isso no significa que seja fcil para ns introduzir alguma coisa nessa
configurao vital, como o trabalho de John Sutherland demonstrou em A origem da vida
(p.99), mas essas limitaes so nossas, no da natureza. Em algum ponto do passado remoto
essas substncias qumicas adquiriram significado e comearam a se arranjar num sistema do
qual era possvel extrair informao armazenvel e transmissvel. O sistema surge da forma das
molculas o modo como elas se ligam umas com as outras e formam uma cadeia. E agora
podemos fazer nossas prprias substncias qumicas, suficientemente semelhantes s que
ocorrem na natureza para se integrarem em DNA. E j as estamos utilizando no combate a
infeces por vrus.
Tipicamente, um vrus tomar uma clula de assalto carregando seu prprio cdigo gentico,
mas nada da mecnica para traduzi-lo. Uma das razes por que os vrus no so classificados
como vivos o fato de s poderem se reproduzir usando o kit de outrem. Assim, os vrus
sequestram uma clula viva, inserem nela seu prprio cdigo e esperam que ela no perceba.
Essa esteganografia do vrus usa a mesma linguagem, de modo que as clulas muitas vezes no
reconhecem o plano induzido e o leem inadvertidamente. O resultado que a clula hospedeira
produz mais vrus, que escapam para infectar mais clulas, muitas vezes destruindo o hospedeiro
no processo. Tratamentos antivirais incluem letras falsas, parecidas o bastante com suas
homlogas naturais para serem incorporadas junto delas, mas evidentes o bastante para perturbar
qualquer mensagem significativa. Se voc identifica um grande erro tipogrfico no meio de uma
fra&se, seu crebro sofisticado o suficiente para salt-lo sem dificuldade de compreenso. A
clula no to magnnima com letras estrangeiras. Elas so projetadas de tal modo que a
mecnica de traduo da clula v as novas bases como artificiais, e no passa direto sobre elas.
assim que funcionam muitos antivirais e as drogas usadas na quimioterapia do cncer. Essas
bases estrangeiras feitas pelo homem so usadas como tratamentos usuais para infeces de
HIV/aids e herpes: quando voc passa um bocadinho de creme nos lbios com o dedo para
aliviar um herpes, provavelmente est aplicando aciclovir. O blsamo contm uma molcula
suficientemente similar base G para entrar no cdigo de replicao do vrus, mas diferente dela
o bastante para impedir que a frase continue. A utilidade dessa sacolinha de letras estrangeiras
vem do prprio fato de serem estrangeiras. Elas no agem como um cdigo legvel. Em vez
disso, sua insensibilidade maquinaria celular lhes d o poder de frustrar rudemente o nico
desejo do vrus copiar-se. A reproduo sustada, o que faz disso uma ferramenta muito til
para combater esses invasores.
As coisas mais interessantes que podemos fazer com DNA inventado dependem, claro, de
criarmos um cdigo que possa ser copiado. Se um cdigo no pode ser copiado, ele no pode ser
transmitido, e se no pode ser traduzido, no ter uma funo (alm da eliminao, descrita
acima). Foram realizadas muitas tentativas de fazer letras que possam se introduzir num DNA e
no s continuar ali, mas ser copiadas. O bilogo sinttico Steve Benner liderou esse esforo e,
em 2011, acrescentou duas bases estranhas ao alfabeto da gentica.
Tendo duas espinhas que se torcem numa espiral, a dupla-hlice do DNA tem dois sulcos no
lado externo um tobog com escorregadores gmeos. Um mais largo que o outro, razo por
que so chamados de sulcos maior e menor. Eltrons zumbem em torno dos tomos no sulco
menor, exatamente como fazem em todas as molculas. Aqui eles formam um padro
eletrnico que age como um identificador qumico e desempenham papel essencial na
replicao do DNA. A protena que copia o cdigo gentico, DNA polimerase, evoluiu para
reconhecer essa marca eletrnica particular, e atrada para comear seu trabalho de cpia. A
fim de enganar a clula, induzindo-a a incorporar bases artificiais ao DNA, a ttica de Steve
Benner consistiu em projetar novas bases, chamadas Z e P, que imitam a marca eletrnica
quando integradas dupla-hlice, e DNA polimerase penetra no sulco. Assim, agora temos um
DNA cujo cdigo composto por um alfabeto que consiste em A, T, C, G, Z e P. DNA
polimerase exerce alegremente sua funo, lendo o cdigo e copiando-o. Como sempre, o
processo de cpia no perfeito, e h uma taxa de erro equivalente ao acmulo das mutaes no
DNA que impelem a evoluo. Benner acrescentou letras novas em folha ao cdigo gentico.
Essas novas letras ainda no significam nada. O projeto e a construo so uma prova de
incio: possvel acrescentar letras extras ao DNA, e elas no perturbaro o comportamento
normal das clulas. As novas tcnicas de engenharia biolgica tendem a se basear na mecnica
existente da clula para traduzir e executar os novos projetos de bilogos sintticos. As letras do
alfabeto tambm no tm, claro, nenhum significado inerente isoladamente. S quando se
enfileiram em palavras e frases consensualmente acordadas elas deixam de ser mero rudo e se
transformam em prosa capaz de expressar amor e tornar o complexo compreensvel. Se
fssemos simplesmente acrescentar novas letras ao alfabeto ingls, digamos e (do cirlico),
no haveria maneira de pronunci-las, e elas no teriam nenhum significado at que se criasse
um consenso. Mas essa no a nica maneira de inventar lnguas.

Cdigo estrangeiro

Esse foco nas letras da escada em espiral do DNA apenas um aspecto das tentativas da biologia
sinttica de reconstruir o alfabeto da vida. O DNA uma molcula complexa, um polmero, e
isso significa que ele montado a partir de unidades repetidas. O cdigo est oculto nos degraus
da escada, mas outro grande avano em gentica alternativa, artificial, veio da troca ou inveno
no de novos degraus, mas de novas hastes verticais, ou montantes, para a escada. Estas so
feitas de um tipo de acar chamado desoxirribose o D em DNA (e em RNA ele
simplesmente ribose), que se repete e se associa para formar as espinhas de cada filamento.
Desde 2000 os bilogos vm criando espinhas alternativas a partir de uma srie de outros
acares para produzir vrias novas molculas genticas: ANA (com arabinose), TNA (com
treose) e quatro outras como FANA e CeNA. Essas espcies estrangeiras so coletivamente
conhecidas como cidos xenonucleicos (ou XNAs). As letras de cdigo continuam as mesmas,
mas as escoras da escada so estranhas. Em abril de 2012, mais uma vez no Laboratory of
Molecular Biology de Cambridge, uma equipe liderada por Philip Holliger e Vitor Pinheiro
construiu um sistema que pela primeira vez permitiu que esses genes de lngua estrangeira no
apenas se replicassem, mas evolussem.
A genialidade desse experimento no est no modo como o cdigo foi montado, mas no fato
de que ele copiado. DNA polimerase, a protena cuja funo copiar um nico filamento de
DNA para duplic-lo, faz isso lendo um filamento e apanhando e enfileirando as peas para fazer
seu espelho, A para T, C para G, e assim por diante. DNA polimerase no se associar a nenhuma
outra coisa seno DNA, compreensivelmente, pois evolveu durante bilhes de anos para fazer
unicamente isso, e no h nada na natureza sobre o que possa agir, exceto DNA. Protenas como
DNA polimerase so longas e complicadas, e sua funo determinada pela forma
tridimensional (determinada pela ordem de seus aminocidos, que por sua vez determinada por
seu cdigo gentico). Por causa dessa intricada conformao em 3D, elas resistem ao projeto
inteligente: imensamente difcil redesenhar algo to complexo. A evoluo cega, mas
inteligente; ela projeta por meio de experimentao aleatria e seleo de mutantes bem-
sucedidos. Pinheiro guiou um processo de seleo natural criando um pool de protenas
polimerase que foram muito ligeiramente mudadas em reas decisivas. Selecionando mutantes
que podiam apanhar peas de XNA em vez de DNA, ele forou o desenvolvimento de uma
polimerase que l DNA, mas constri um filamento especular usando XNA, como se a molcula
estrangeira fosse nativa. Dessa maneira, a molcula gentica nova em folha, inventada pelo
homem, pode transportar a mesma mensagem codificada em DNA natural. A equipe
efetivamente enganou o maquinrio de criptografia celular, induzindo-a a ler sua lngua natural,
mas a copi-la numa outra, artificial. Construiu uma ferramenta que traduzir uma lngua natural
para uma outra inventada, ingls para Klingon.
Mas isso s metade da histria. A equipe de pesquisa pode tambm traduzir de volta de
novo. Pinheiro e seu grupo mutaram e selecionaram uma protena que faria o oposto, traduzir
XNA de volta para DNA. Esse um truque mais complicado, e nenhuma protena natural dar
conta do servio. Aps oito rodadas de mutao aleatria forada, eles haviam criado algo que o
fazia. Isso torna XNA um sistema que exibe duas marcas caractersticas da vida: armazenamento
de informao e hereditariedade. Fidelidade importante quando se copia, sobretudo em
gentica, mas fidelidade perfeita no evoluo, estase. O processo criado pela equipe fiel
com uma porcentagem na marca de 95%, o que significa que a informao armazenada pode
evoluir.
Se nos importarmos com essas convenes relativas a nomes, isso assinala o surgimento de
um novo ramo da biologia a gentica sinttica. No h dvida de que esse primeiro estudo
ainda se baseia no DNA como modelo, mas a equipe j est tentando deix-lo de fora. Eles
copiaram FANA para FANA e CeNa para CeNA, embora isso ainda no funcione to bem quanto
DNA.
As implicaes so importantes. Pinheiro e seus colegas mostraram que a evoluo gentica
no est limitada ao cdigo natural tal como o conhecemos. bem possvel que haja usos para
essa miscelnea de XNA no futuro, pois eles podem se comportar como partes genticas
naturais, ainda que no o sejam, e talvez no sejam tratados como tais por nossos sistemas
imunolgicos, escolados no reconhecimento de gentica natural, baseada em DNA ou RNA
durante vrios bilhes de anos. Os XNAs so mais robustos que DNA e RNA, ambos propensos a
fraturas e cortes por protenas chamadas nucleases, cujo papel fazer exatamente isso. Sendo
imunes a fatiamentos, os XNAs tm extraordinrio potencial teraputico. Jack Szostak, geneticista
e cientista da origem da vida, desenvolveu uma classe de molculas chamadas aptmeros, que
so filamentos de DNA ou RNA projetados para se dobrar de maneira a se prender a um alvo
muito especfico. Como uma terapia potencial, essa ao tem a capacidade de paralisar um gene
ou inativar uma protena mutante. Atualmente, h apenas um aptmero no mercado, como
tratamento para uma doena ocular degenerativa. Mas, como ele vulnervel a ser fatiado por
nucleases que patrulham em busca de pedacinhos trapaceiros de DNA, o medicamento deve ser
tomado repetidamente. Especulativamente, no presente, existiria um equivalente ao aptmero de
XNA invisvel nuclease, uma arma furtiva no armamento da medicina.

Output alterado

Esses dois projetos reinventam o cdigo da gentica. preciso considerar tambm, claro, o
output desse cdigo. A vida feita por ou de protenas, e agora, com o advento de sofisticada
biologia molecular, as protenas tambm esto sujeitas a reviso.
As protenas so construdas a partir da juno, umas atrs das outras, de molculas
chamadas aminocidos. Numa ponta, um aminocido ter um arranjo de tomos chamado
grupo amina (que composto de um tomo de nitrognio e dois de hidrognio); na outra, um
grupo que forma cido carblico (que um carbono, dois oxignios e um hidrognio). O cdigo
gentico no DNA codifica vinte aminocidos, que so reunidos no processo de fabricao de
protenas e montados pela clula.2
Aminocido um nome genrico para um conjunto de molculas, todas muito parecidas.
Elas variam apenas no que est preso seo mediana da molcula, entre a amina e o cido
carblico. O aminocido mais simples a glicina, com um s tomo de hidrognio como sua
nica cadeia lateral. No outro extremo da escala est o triptofano, com um grande duplo anel de
carbonos, hidrognios e um nitrognio brotando do lado. Todos os tipos de variao entre uma
coisa e outra compem o lxico da vida. Essas cadeias laterais determinam o comportamento da
protena em que os aminocidos so montados. importante lembrar que no h limite real para
o nmero de aminocidos que poderiam existir, em teoria, alm dos vinte que a vida realmente
usa.
Para se ter uma ideia de como esse sistema foi rompido por cientistas nos ltimos anos,
primeiro precisamos compreender como a maquinaria da clula funciona. A construo de
protenas incrivelmente parecida com uma linha de produo mecnica. O gene que est sendo
traduzido primeiro transcrito de DNA para uma cpia solta em RNA, talvez com um milhar de
bases de comprimento, no amarrada ao resto do DNA da clula hospedeira. Essa mensagem
em RNA deriva para um dos muitos ribossomos, o centro em que a protena ser construda. No
meio celular em torno do ribossomo flutuam os aminocidos que sero encadeados uns aos
outros segundo a ordem estabelecida no RNA mensageiro, o mRNA, cada um especificado por
um cdon de trs bases o tripleto especfico de letras que codifica um aminocido. Vrios
jogadores moleculares-chave deslocam essas molculas de um lado para outro, maneira de
uma linha de produo, e o processo funciona como se descreve a seguir.
O gene a ser traduzido (na forma de mRNA) introduzido no meio do ribossomo como se
introduz uma fita de papel num teletipo. As bases de RNA so lidas cdon por cdon e os
aminocidos correspondentes so acrescentados, um de cada vez. A protena ejetada como
uma fita de teletipo ao ser expelida do aparelho. Esse output a protena bsica, a ser dobrada e
transportada para seu local de uso. Mas os agentes nesse processo so efetivamente carregadores
industriais. O prprio ribossomo de importncia fundamental: sua forma e construo, em
grande parte a partir do prprio RNA, a forja rumo qual todos os ingredientes rolam nessa
esteira transportadora biolgica. Alm disso, porm, h um complexo de trs molculas que
conduz muito especificamente os aminocidos ao ribossomo. Essa combinao, embora bsica
para toda vida, no fcil de explicar. Uma parte o prprio aminocido, que coletado pela
segunda parte, um pedao dobrado de RNA que especificamente o coleta e o transfere ao
ribossomo. Por essa razo, esses RNAs so genericamente chamados de RNAs
transportadores, ou tRNA, e funcionam transportando o anticdon, isto , bases
complementares para o prprio cdon um T para apanhar um A, um C para apanhar um G, e
assim por diante (embora haja apenas vinte aminocidos, h dezenas, se no centenas, de
tRNAs). O carregador final uma protena com o nome complicado aminoacil tRNA sintetase,
que chamarei doravante de sintetase. Essa protena prende o aminocido a seu tRNA
correspondente; juntas, as partes componentes da protena so entregues para montagem. O input
de cdigo introduzido numa extremidade, os ingredientes so entregues a partir de outra, na
forma de um pacote, e a protena avana, um aminocido de cada vez.
Esse processo ocorre em todas as formas de vida, e sua universalidade uma das principais
evidncias de que a vida teve uma origem nica. Os componentes so claramente antigos por
mais afastadas que duas espcies sejam, elas compartilham o funcionamento bsico dessa
montadora. Mudar isso exigiu um exemplo de fora bruta evolucionria, um projeto inteligente
proposto por Peter Schultz no Scripps, na Califrnia, e por Jason Chin e sua equipe, no LMB em
Cambridge.
H uma grande redundncia embutida no cdigo existente: as quatro bases podem ser
combinadas de 64 maneiras diferentes, e 61 delas so usadas para codificar os vinte aminocidos
da vida.3 Isso deixa trs combinaes possveis restantes, e, nas formas de vida, todas elas
carregam a mensagem pare, isto , a instruo para encerrar a produo de protenas. Essas
pontuaes so essenciais para indicar o fim de um gene. De fato, a significao do cdon de
parada demonstrada num punhado de doenas genticas: a doena de Sandhoff, letal na
infncia, causada por um gene que carrega um gene de parada prematuro, como uma frase
encurtada de maneira incompreensvel por um ponto-final trapaceiro.
Um deles, o tripleto UAG, chamado parada mbar.4 Jason Chin utilizou essa sequncia
como um cdon para construir aminocidos que de outro modo seriam irreconhecveis para
clulas vivas. Como no h nenhum emparelhamento de tRNA sintetase que v se ligar a uma
parada mbar, a ideia de Chin desenvolver um. Sua equipe comea com esse emparelhamento
a partir de uma espcie remotamente relacionada clula experimental. Isso assegura que o par
no vai comear a interagir com o funcionamento normal da clula: a mecnica da produo de
protena universal, mas isso no significa que o kit seja exatamente o mesmo. Mas, para
conseguir que a sintetase estrangeira reconhea singularmente algo que nenhuma das outras
ferramentas da natureza pode reconhecer a parada mbar , eles usam a premissa bsica da
evoluo. Se, por alguma razo, voc desejasse um peixe que s comesse algo artificial, como
jujubas, comearia com uma lagoa densamente povoada e usaria uma jujuba como isca. Caso
houvesse nessa lagoa um peixe sui generis, com um gosto natural por jujubas, voc o apanharia
com essa isca. Em seguida voc poderia povoar uma nova lagoa com reprodues a partir desse
peixe e gerar uma populao pscea apreciadora de jujubas. Repetindo esse processo
iterativamente, acabaria tendo peixes que se alimentariam exclusivamente de jujubas.
O exerccio com os peixes semelhante ao processo de desenvolver um par de tRNA
sintetase capaz de reconhecer aminocidos artificiais. A partir de um pool de verses de sintetase
com partes aleatoriamente mutadas na regio que ela se engata com o aminocido, podemos
selecionar algumas que se ligam com seu novo aminocido artificial e repetir o processo.
Finalmente, tal como no caso dos peixes que comem jujubas, voc ter criado uma tRNA
sintetase que s ler uma parada e um aminocido artificial.
Isso uma parte da coisa. O tRNA cultivado dessa maneira a fim de agir como o anticdon
para a parada mbar. Acrescentar uma UAG sequncia de um gene para que ele seja capaz de
ser apanhado pelo tRNA um processo delicado, mas usa essencialmente ferramentas de DNA
no diferentes daquelas empregadas para qualquer manipulao de genes a criao de
Freckles, a cabra-aranha, por exemplo. Podemos sintetizar toda uma sequncia de genes,
reescrita a partir do zero, complementada com uma parada mbar num ponto crucial. Ou
podemos usar uma tcnica de cpia, chamada PCR mutagnico, que copiar de maneira
imperfeita e induzir o novo tripleto a erro. Como normalmente UAG s existe num gene para
indicar seu fim, todos os elementos devem ser alterados para esse sistema funcionar: o cdigo, a
sntese, o tRNA, todos de modo a reconhecer um aminocido artificial.
Isso constitui uma delicada engenharia biolgica para os processos vivos mais fundamentais
o dogma central, como Francis Crick o descreveu. Mas no se trata de mera experimentao
por amor experimentao. Jason Chin e outros a esto usando para descobrir como protenas
interagem umas com as outras. As clulas vivas so uma rede de interaes de protenas:
algumas se ligam a DNA, outras a molculas de metabolismo, e frequentemente elas se
conectam com outras protenas para desempenhar suas funes vitais. O aminocido artificial
incorporado aos experimentos de Chin transporta uma cadeia lateral que faz duas coisas.
Primeiro, quando instruda a faz-lo, ele se unir protena com que est interagindo, o que
significa que podemos pescar as duas e identificar o parceiro desconhecido, a protena
manipulada que est agindo como isca. Segundo, o aminocido artificial ativado por luz. Para
fazer com que ele se prenda ao alvo, basta projetar luz ultravioleta sobre a clula, e a ligao
soldada.
Chin no a nica pessoa capaz de realizar esse ato, mas sua equipe a primeira a conseguir
isso em mltiplas espcies, inclusive animais. At 2012, essas aes artificiais estavam restritas a
clulas em cultura, em placas onde o ambiente controlado e limpo. Chin incorporou esse
processo a drosfilas, um dos animais comumente usados na biologia experimental, e mostrou
que nenhum aspecto da biologia nos est vedado quando se trata de reengenharia: alfabeto,
cdigo, protenas agora todo o sistema da vida est maduro para ser reescrito.
Esses reescritores revelam que, embora nosso sistema, o nico de que temos conhecimento,
seja poderoso o bastante para formar a base de toda a vida na Terra, ele pode ser diferente. A
evoluo por seleo natural foi descoberta e descrita muito antes que compreendssemos sua
mecnica. O cdigo que executa esse processo de tentativa e erro nico, mas perfeitamente
capaz de ser ajustado, reescrito e at reinventado. difcil conceber um sistema de evoluo
biolgica (que no dependa de alguma forma de um criador sobrenatural) diferente da seleo
natural, mas temos apenas um sistema de informao codificada, reproduzvel, que funcionou.
XNA, as bases Z e P e aminocidos que so artificiais para a clula, tudo isso mostra que pode
haver outros. Esse o primeiro engatinhar rumo criao de novas formas de vida que usam um
cdigo gentico darwiniano no inventado pela natureza, mas inteiramente por ns.

DNA digital

Com esses exemplos, podemos ver como a invaso da natureza pela biologia sinttica nos deu o
poder de alterar radicalmente o cdigo gentico do DNA, inventar novas verses de material
gentico e at expandir o lxico da gentica de tal maneira que ele possa incluir protenas
artificiais.
A linguagem do DNA no est restrita criao da vida. Nossos genomas so dispositivos de
armazenamento de dados, imperfeitos por projeto natural para estimular a adaptao a
ambientes mutveis. Ao mesmo tempo, porm, o DNA extraordinariamente estvel. Ele
transmitiu informao da mesma maneira durante bilhes de anos. E a informao contida no
DNA permanece intacta durante muito tempo depois da morte da clula ou do organismo que o
carrega. Hoje, no novo mundo cientfico, histrias sobre DNA antigo emergem com frequncia
cada vez maior. O genoma do mamute lanoso foi publicado extrado e decodificado a partir de
pelos de 60 mil anos de idade, comprados no eBay pelos geneticistas que o sequenciaram. Nossos
provveis primos evolutivos, os neandertalenses, ingressaram no clube do genoma em 2010,
quando seu DNA completo foi lido a partir de ossos de 44 mil anos de idade. Mas o recorde atual
pertence ao DNA extrado de amostras de sedimentos subterrneos congelados na Groenlndia,
identificados como da famlia das plantas perenes saxifragceas e com uma faixa etria situada
entre colossais 450 mil e 800 mil anos. verdade que estar enterrado sob dois quilmetros de
gelo estar no que a natureza pode proporcionar de mais parecido com um freezer de
laboratrio, mas o fato de podermos encontrar tecido morto h muito tempo e ainda decodificar
a mensagem escrita nele mostra que dispositivo estvel de armazenamento de dados pode ser o
DNA.
Essa uma das razes por que, nos anos 1990, os cientistas comearam a pensar no DNA
como um meio de armazenar no apenas a informao biolgica de que uma clula precisa para
funcionar, mas dados digitais. Embora no tenha sido a primeira a tirar proveito dos talentos do
DNA para armazenar dados, a bactria sinttica de Craig Venter, tambm conhecida como
Sy nthia, o mais famoso dispositivo digital vivo de que dispomos at hoje. Como foi mencionado
na Introduo, dentro do genoma sintetizado por computador e mquina do patgeno de cabra
Mycoplasma mycoides, Venter escondeu no DNA mensagens que seriam enigmticas at para a
maquinaria da clula. Programadores de computador muitas vezes escondem tesouros ou
mensagens secretas ovos da Pscoa em seus programas como um registro de autoria, ou
simplesmente como enigmas divertidos para os usurios decifrarem.
Esses ovos da Pscoa ocultos no DNA tinham quatro partes. A primeira era uma tabela de
cdigo. Como as mensagens cifradas eram todas concebidas em ingls, foi preciso incluir uma
cifra, de modo que as quatro letras do cdigo gentico pudessem exprimir as 26 letras do alfabeto
ingls mais a pontuao. Por vezes os vinte aminocidos so designados por uma nica letra, de A
a W. Assim, uma forma concebvel de ocultar uma mensagem em lngua inglesa no DNA seria
simplesmente usar o cdigo gentico existente nos tripletos que especificam aminocidos, trs
bases para cada letra romana. Em vez disso, porm, Venter construiu uma nova cifra para o
alfabeto ingls, por isso ela precisava ser decodificada. Dias depois da publicao, o cdigo foi
decifrado.
A segunda e a terceira mensagens escondidas compreendiam algumas dezenas de nomes dos
criadores da clula e um endereo da internet. O ltimo ovo da Pscoa era um conjunto de trs
citaes pertinentes. A primeira era viver, errar, cair, triunfar, recriar a vida a partir da vida,
extrada do romance Retrato do artista quando jovem, de James Joy ce.5 A segunda citao vinha
de J. Robert Oppenheimer, o chamado pai da bomba atmica: Veja as coisas no como so,
mas como poderiam ser. E a terceira foi uma citao ligeiramente errada, por acidente,
daquela maravilhosa frase de Richard Fey nman reproduzida na Introduo: O que no posso
construir, eu no compreendo. 6
Esses blocos de sequncia de DNA foram projetados mo e montados num computador.
Eles tiveram de ser flanqueados por etiquetas de DNA que indicavam que no deveriam ser
traduzidos pela clula, porque o cdigo em que esto escritos inteiramente novo e teria sido
absurdo. Essa sequncia no est escrita nos cdons em tripleto do cdigo gentico; no pode
fazer uma protena, e no o far. Em vez disso, Venter havia projetado um dispositivo de
armazenamento que tinha um cdigo criptografado inventado e novo, e apenas usou o alfabeto do
DNA como cdigo, sem referncia sua histria.
Em 2012, George Church, da Universidade Harvard, levou a comoditizao do DNA para
uma nova era com a primeira publicao de um livro inteiro criptografado digitalmente em DNA
(intitulado Regenesis, ele trata, muito a propsito, de biologia sinttica). Com 53 mil palavras,
onze imagens e um script de cdigo de software, ele teria do tamanho do livro que voc est
segurando, ou cerca de cinco megabits de informao. usado um cdigo muito simples,
binrio: um A ou C representa um 1, e um T ou G representa um 0. As palavras so convertidas
numa forma digital e depois a sequncia equivalente de DNA sintetizada num computador em
comprimentos de 96 bases, cada um com etiquetas de informao sobre a localizao dos
segmentos, e assim por diante o que os programadores chamam de metadados. O livro
composto por 55 mil desses fragmentos, aproximadamente um por palavra. Na traduo do livro
todo em DNA, h apenas dez erros em 5 milhes de bits de dados. A coisa toda est armazenada
no que chamado de chip de DNA, o que, como meio de armazenar um livro, no diferente de
uma pgina e tinta, s que muito menor. Esses chips so pequenas lminas de vidro, mais ou
menos do tamanho de uma caixa de fsforos, revestidas com substncias qumicas s quais o
DNA vai aderir. Os fragmentos de dados de DNA so literalmente borrifados por um pequeno
esguicho lanado por uma impressora de jato de tinta. Ao contrrio da informao armazenada
na bactria sinttica de Craig Venter, a produzida pelo mtodo de Church nunca se aproxima de
uma forma de vida. O DNA escrito num computador, sintetizado por uma mquina, impresso
com uma impressora e decodificado por uma mquina e software usando as mesmas tcnicas
correntes empregadas pelos cientistas ao recobrar DNA de tecido morto h milnios.
Como muitas das tcnicas inventadas neste captulo, esta uma prova de princpio. Como
meio de armazenamento de informao, a elasticidade do DNA irrefutvel. George Church e
outros partiram do simples fato de que o DNA pode carregar um cdigo e o reescreveram para
armazenar dados no biolgicos. A estabilidade do DNA e os custos declinantes da tecnologia
empregada do a essa tcnica um potencial para arquivar dados numa densidade assombrosa:
segundo os autores, 5,5 petabits por milmetro cbico (isto , 1 quatrilho de unidades de
informao). Isso faz dela uma forma mais concentrada de armazenamento de dados que um
disco Blu-Ray, um pen drive ou mesmo o disco rgido de seu computador. O que se conseguiu
fazer at agora til apenas para arquivamento, pois a tecnologia para escrever e ter acesso
memria armazenada em DNA demanda muitos dias, em comparao com o sistema de
circuitos eltricos num computador, que guardar uma quantidade equivalente de dados em
segundos. Mas no inconcebvel que um dia os computadores venham a armazenar suas
memrias no em chips de silcio, mas em chips de DNA.
Essa criativa filosofia da engenharia decisiva para a biologia sinttica: como reprojetar e
usar tecnologia biolgica para fins especficos? Todos os esforos descritos so tecnologias muito
novas, ainda em fase experimental. Mas todas elas demonstram que os limites da natureza esto
sendo superados por nossa prpria inveno. Sempre adaptamos a natureza em nosso benefcio.
Na era da biologia molecular, ns o fizemos remixando-a num nvel molecular. Agora, pela
primeira vez, estamos construindo sistemas vivos criados de uma maneira que reescreve a
prpria linguagem fornecida pela evoluo.
Notas

Introduo

1. Alguns cientistas consideram que os vrus, ou pelo menos alguns tipos de vrus, so vivos. Eles
so problemticos, pois tm muitas caractersticas das clulas vivas mais passveis de
definio, porm so desprovidos da maquinaria celular para se reproduzir. Para isso,
precisam parasitar clulas vivas. A questo O que vida? explorada no Captulo 4 da
outra parte de Criao, mas, em benefcio da simplicidade, optei por aderir ao consenso
geral, embora no inconteste, de que os vrus no so vivos.
2. Sy nthia continha trs citaes ocultas, sobre as quais o satirista britnico Charles Brooker
comentou: Os geneticistas emendaram uma citao de James Joy ce na sequncia do DNA.
O inocente genoma agora tem a frase viver, errar, cair, triunfar, recriar a vida a partir da
vida inscrita nele como letras num basto de acar-cande. Em outras palavras, a bactria
mais pretensiosa do mundo. Essa citao foi extrada do romance Retrato do artista quando
jovem, mas Venter e sua equipe no se deram ao trabalho de pedir permisso ao esplio de
James Joy ce, notrio por proteger agressivamente seus direitos autorais. Os executores do
esplio enviaram imediatamente a Venter uma carta intimando-o a cessar e desistir dessa
atividade. Na verdade, os direitos autorais haviam expirado e nenhuma outra ao foi
empreendida.

1. Criado, no gerado

1. Zebrasnos so fruto de cruzamento entre zebra e asno. De maneira similar, ligres resultam do
cruzamento de leo com tigre, e bardotos, do cruzamento de cavalo macho com asno fmea,
em contraposio s mulas, que resultam do cruzamento oposto. A esterilidade nesses hbridos
incomuns est em conformidade com um princpio chamado regra de Haldane (em aluso a
J.B.S. Haldane, que props a expresso sopa primordial), segundo o qual, quando um
cruzamento entre duas espcies bem-sucedido, um sexo estar ausente na prole, e em
mamferos este ser aquele com dois diferentes cromossomos sexuais, isto , XY (machos)
em vez de XX (fmeas). Em aves e borboletas, isso invertido.
2. Essa clula, conhecida como ltimo Ancestral Comum Universal (Luca, na sigla de Last
Universal Common Ancestral), debatida em detalhes na primeira parte, A origem da
vida.
3. A palavra jumentous, que significa fedendo a urina de cavalo, volta a aparecer neste livro
nos Agradecimentos.
4. Exige-se grande habilidade artesanal para se conseguir que o DNA adicional funcione. A
sintaxe e o fraseado do gene inserido tm de fazer sentido para a maquinaria de traduo da
clula. O arranjo das letras de DNA A, T, C e G preciso e crucial para a protena que
um gene codifica. Essas letras, ou mais propriamente bases, so arranjadas de trs em trs,
cada tripleto codificando um aminocido, uma espcie de valsa biolgica. Se nossa insero
entrar na batida errada, a dana no faz sentido. Mas, quando introduzimos o gene de gua-
viva de modo que ele comece na batida certa, em todo lugar em que nosso gene
experimental estiver ativo a clula ter um brilho verde. Esse rtulo pequeno o bastante
para no afetar a funo da protena, exatamente como se algum usasse um chapu de
cores vivas ao valsar.
5. Esse processo se chama clonagem, mas nada tem a ver com o sentido comum dessa
palavra, isto , a reproduo de um organismo idntico, como na fico cientfica ou em
animais como a ovelha Dolly. Minha prpria contribuio atomicamente minscula ao
campo da gentica se deu numa equipe que trabalhou com um camundongo nascido
naturalmente cego, com olhos reduzidos, uma retina deformada e nenhum nervo tico. Por
meio de vrias tcnicas, nossa equipe, liderada por Jane Sowden, no Institute of Child Health
em Londres, extirpou e emendou vrios genes e elementos genticos para caracterizar o que
o gene defeituoso estava fazendo e quando. Usando os fundamentos da clonagem, extramos
o gene do genoma do camundongo e o utilizamos para determinar o momento e o lugar
precisos em que ele deveria ter estado ativo. Ns o rotulamos e procuramos os outros genes
que ele estava controlando ou pelos quais estava sendo controlado. Com isso, ajudamos a
descobrir que o gene equivalente em seres humanos tambm causa uma forma rara de
cegueira em crianas.
6. O prprio petrleo uma espcie de biocombustvel: o leo cru feito das carcaas de
trilhes de organismos que se decompuseram e depois foram esmagados por centenas de
milhes de anos.

2. Lgica na vida

1. A Voy ager I, o objeto feito pelo homem mais distante da Terra, est, no momento em que
escrevo, a 18 bilhes de quilmetros de ns. Ela envia mensagens regulares via Twitter como
@nasavoy ager.
2. A vnus papa-moscas qualitativamente diferente da eletrnica porque a lgica dos genes
subjacente ao processo est l no para efetuar a captura, mas para montar a armadilha, isto
, abrir os maxilares e armar o gatilho. Eles expressam as protenas que agem como os
componentes no caminho lgico. Em eletrnica, a lgica ditada pelo fluxo de eletricidade
atravs do circuito.
3. E, de fato, de clula para clula. Uma das coisas desconcertantes nos cnceres que seus
DNAs mudam rapidamente, respondendo de maneiras extremamente variveis a ataques
teraputicos dessa preciso.
4. Perversamente, a morte celular essencial para o crescimento e uma parte muito importante
do desenvolvimento no tero. Por exemplo, quando fetos, nossas mos comeam como
nadadeiras e os dedos crescem dentro delas. Os dedos se separam quando as clulas na
membrana promovem a prpria morte.

3. Remixagem e revoluo

1. Os Beatles fizeram isso j em 1967, tomando emprestadas gravaes de calope (um tipo de
rgo a vapor) e fazendo loops delas em Being for the benefit of Mr. Kite, em Sergeant
Peppers Lonely Hearts Club Band (e mais ainda em faixas experimentais como Revolution
9, no lbum branco).
2. Para a competio de 2012 isso foi substitudo por um enorme e elegante bloco de Lego de
madeira.
3. Em 1995, no vero de meu segundo ano no curso de graduao, passei trs meses medindo as
estatsticas vitais de 3 mil das chamadas moscas de olhos pedunculados para avaliar se havia
maior assimetria nos pednculos de seus olhos que em suas asas. No havia. O mundo da
biologia permaneceu inabalado por esse estudo, mas a fascinao do laboratrio foi forte o
bastante para me fazer voltar.
4. Nos anos 1980, uma equipe de mecnicos lunares pde brincar com enorme quantidade de
regolito, o material pulverulento que compe a superfcie da Lua. Enorme quantidade, nesse
caso, eram quarenta gramas, o equivalente a quatro colheres de sopa de acar. Essa
preciosa amostra, trazida para a Terra pelos astronautas da Apollo 16, foi cimentada em
minsculos tijolos, cubos de uma polegada de lado (2,54 centmetros) e umas duas outras
formas, e submetida a testes de resistncia. Os pesquisadores concluram que o solo lunar
pode ser usado como excelente agregado para concreto. Um dos ingredientes essenciais do
concreto, no entanto, gua, e embora a Lua no seja inteiramente dessecada, no h muita
gua por l. Em 2009 a sonda LCROSS foi deliberadamente arremessada contra a cratera
Cabeus, buraco envolto em permanente escurido no lado sul da Lua. A Nasa observou
cuidadosamente a nuvem de dois quilmetros levantada aps o impacto e viu que da sua
singular marca ultravioleta gua e gelo foram expelidos. Mas eles esto enterrados e no
disponveis em quantidades que permitissem a construo de uma base lunar.
5. O vencedor do Grande Prmio de 2012 foi a equipe iGEM da Universidade de Groningen,
nos Pases Baixos, que construiu um circuito em bactrias que detecta substncias qumicas
produzidas quando a carne comea a se deteriorar. Em seguida a bactria produz um
pigmento visvel a olho nu, permitindo aos consumidores ver que a carne est estragada.

4. Em defesa do progresso

1. Esse movimento particular breve, mas importante, foi esmagado com fora implacvel. Em
1812 foram introduzidas leis que proibiam especificamente o vandalismo sobre mquinas e
faziam dele um crime capital. Dezessete luddistas foram enforcados um ano depois, e muitos
foram enviados para o que era ento a colnia penal da Austrlia.
2. Duas amostras de varola so mantidas em cmara frigorfica para fins cientficos; h um
debate em curso sobre a convenincia de conserv-las ou destru-las, principalmente por
causa do risco de bioterror que elas representam.
3. Para ser publicado numa revista cientfica, o artigo proposto precisa passar pela reviso dos
pares, mediante a qual outros cientistas especialistas avaliam sua validade e recomendam
sua publicao ou no. Mas isso no uma garantia de verdade cientfica, apenas um
reconhecimento de que o experimento merece ingressar na literatura cientfica. Nesse caso,
questionaram se o artigo de Sralini deveria ter sido sequer publicado. Historicamente, o
feedback crtico vinha por meio do incmodo mtodo de publicao de correspondncia, ou
da replicao de experimentos em revistas acadmicas. Agora, porm, a internet permite
uma nova forma de reviso dos pares ps-publicao, em que artigos so esmiuados em
blogs e discutidos abertamente. Isso no formal e est sujeito selvageria de uma fronteira
sem guardies, mas rpido, e o escrutnio foi preciso e severo.

Posfcio

1. Quase sempre, esses pequenos roubos tm por objetivo lidar com emprstimos feitos de
lnguas estrangeiras. O francs no tem praticamente nenhum uso para a letra w, exceto em
palavras emprestadas, como weekend. O gals adquiriu o j para lidar com palavras e nomes
ingleses e normandos. As lnguas e seus alfabetos contraem-se e expandem-se como seres
vivos.
2. Na verdade, nossos corpos fazem onze desses aminocidos, e precisamos ingerir outros nove.
H dois outros aminocidos que as formas de vida usam de maneira pouco frequente, um dos
quais exclusivo de bactrias e arqueias. Em geral, tendemos a nos referir apenas aos vinte
cannicos.
3. Por exemplo, seis diferentes combinaes codificam leucina: UUA, UUG, CUA, CUG, CUC
e CUT; ver A origem da vida, Captulo 5, para as razes da evoluo dessa redundncia.
4. A parada mbar no assim chamada em aluso luz indicadora de ateno nos sinais de
trnsito, mas sim porque o nome de seu descobridor era Bernstein, que significa mbar em
alemo.
5. Como foi mencionado na nota 2 da Introduo, seu uso foi contestado como violao de
direito autoral pelo esplio de James Joy ce.
6. Que, caso voc esteja curioso, tem a seguinte aparncia no DNA: TTAACTAGC
TAATTTCATTGCTGATCACTGTAGATATAGTGCATTCTATAAGTCGCTC
CCACAGGCTAGTGCTGCGCACGTTTTTCAGTGATATTATCCTAGTGCTA
CATAACATCATAGTGCGTGATAAACCTGATACAATAGGTGATATCATAGC
AACTGAACTGACGTTGCATAGCTCAACTGTGATCAGTGATATAGATTCT
GATACTATAGCAACGTTGCGTGATATTTTCACTACTGGCTTGACTGTAG
TGCATATGATAGTACGTCTAACTAGCATAACTAGTGATAGTTATATTTCTA
TAGCTGTACATATTGTAATGCTGATAACTAGTGATATAATCCAACTAGAT
AGTCCTGAACTGATCCCTATGCTAACTAGTGATAAACTAACTGATACATC
GTTCCTGCTACGTGATAGCTTCACTGAGTTCCATACATCGTCGTGCTTA
AACATCAGTGATAACACTATAGAGTTCATAGATACTGCATTAACTAGTGAT
ATGACTGCAAATAGCTTGACGTTTTGCAGTCTAAAACAACGTGATAATT
CTGTAGTGCTAGATACTATAGATTCCTGCTAAGTGATAAGTCTACTGATT
TACTAATGAATAGCTTGGTTTTGGCATACACTGTGCGCTGCACTGGTGA
TAGCTTTTCGTTGATGAATAATTTCCCTAGCACTGTGCGTGATATGCTA
GATTCTGTAGATAGGCTAAATTCGTCTACGTTTGTAGG TAGTAGTTTTA
GTTTGCTGTAACTAATATTATCCCTGTGCCGTTGCTAAAGCTGTATATCA
TAGTGCTGCTAGATATGATAAGCAAACTAATAGAGTCGAGGGGGAGTCA
TAGTGAATACTGATATTTTTAGTGCTGCCGTTGAATAAGTTCCCTGAAC
ATTGTGATACTGATATTTTAGTGCTGCCGTTGAATATCCTGCATTTAAC
TAGCTTGATAGTGCATTCGAGGAATACCCATACTACTGTTTTCATAGCTA
ATTATAGGCTAACATTGCCAATAGTGCGGCGCGCCTTAACTAGCTTAA
Referncias bibliogrficas e sugestes de leitura

Introduo

Artigo de Craig Venter sobre a construo de uma clula a partir de um genoma inteiramente
manufaturado: Daniel G. Gibson et al., Creation of a bacterial cell controlled by a chemically
sy nthesized genome, Science, n.329, 2 jul 2010, p.52-6 (doi:10.1126/science.1190719).
E a patente para o genoma mnimo de Mycoplasma micoides, ou Sy nthia, como foi
apelidado, disponvel em: http://1.usa.gov/QsssVZ.
Venter encaixado entre David Cameron e Sarah Palin: New Statesman, 21 set 2010.

1. Criado, no gerado

Encontrei-me fisicamente com Freckles, a cabra-aranha (e seu criador, Randy Lewis), pela
primeira vez durante a filmagem de um episdio de Horizon, srie de cincia da BBC. Partes
deste captulo foram tiradas de entrevistas feitas nessa filmagem e de um artigo que escrevi para
o jornal Observer baseado no programa. Sy nthetic Biology and the rise of the spider-goats, 14
jan 2012.
F. Teul et al., A protocol for the production of recombinant spider silk-like proteins for
artificial fiber spinning, Nature Protocols, v.4, n.3, 2009, p.341-55 (doi:10.1038/nprot.2008.250).
Aqui est o artigo escrito por Hamilton Smith em 1970 que caracteriza a enzima de restrio
HinDII; foi essa tecnologia que originou toda a biologia molecular que se seguiu: H. Smith e K.W.
Wilcox, A restriction enzy me from Hemophilus influenzae 1. Purification and general
properties, Journal of Molecular Biology, n.51, 1970, p.379-91 (doi:10.1016/0022-
2836(70)90149-X).

2. Lgica na vida

A mais abrangente anlise da biotecnologia moderna Biology Is Technology: The Promise, Peril
and New Business of Engineering Life, de Robert H. Carlson (Harvard University Press, 2011);
um brilhante manual da cincia, economia e poltica desse campo sempre em mudana.
Circuito assassino do cncer de Ron Weiss: Zhen Xie et al., Multi-input RNAibased logic
circuit for identification of specific cancer cells, Science, n.333, 2 set 2011, p.1307-11
(doi:10.1126/science.1205527).
As clulas de cncer alvejadas e destrudas nesse sistema so chamadas clulas HeLa.
Graas sua ilimitada capacidade de se dividir imortalidade , elas foram experimentadas e
distribudas inmeras vezes, e so de inestimvel importncia para muitos aspectos da biologia
moderna. Elas foram retiradas em 1951 do colo do tero de Henrietta Lacks, americana negra e
pobre que morreu de cncer e est enterrada num tmulo no identificado. Sua histria narrada
com encanto e mestria por Rebecca Skloot no livro The Immortal Life of Henrietta Lacks
(Macmillan, 2010).
Os dois artigos consecutivos que lanaram a natureza constituinte da engenharia gentica no
nascimento da biologia sinttica: Michael B. Elowitz e Stanislas Leibler, A sy nthetic oscillatory
network of transcriptional regulators, Nature, n.403, 20 jan 2000, p.335-8
(doi:10.1038/35002125); Timothy S. Gardner, Charles R. Cantor e James J. Collins, The
construction of a genetic toggle switch in Escherichia coli, Nature, n.403, 20 jan 2000, p.339-42
(doi:10.1038/35002131).
Dez anos mais tarde, os circuitos haviam se tornado significativamente mais sofisticados, por
exemplo: Tal Danino, Octavio Mondragn-Palomino, Lev Tsimring e Jeff Hasty, A sy nchronized
quorum of genetic clocks, Nature, n.463, 21 jan 2010, p.326-30 (doi:10.1038/nature08753).
Na Nature, minha colega Charlotte Stoddart fez um curta-metragem sobre a assombrosa
sincronizao sinttica dessas bactrias e o divulgou no YouTube. Nele, a voz de Charlotte em off
compara a ao fluorescente com uma ola mexicana, pois ela se assemelha muito ao ritmo
metacrnico demonstrado em estdios superlotados por torcedores levantando-se, gritando e
sentando-se em sucesso. Os espectadores do YouTube no so renomados por fazer
comentrios muito sofisticados sobre os prprios vdeos, mas ficamos surpresos ao aprender ali
que a expresso original, de origem britnica, era mexican wave, em consequncia de sua
ocorrncia em jogos de futebol na Copa do Mundo do Mxico, em 1986. Ao que parece, muitos
outros povos do mundo acharam o nome vagamente racista.
Sobre os perigos de uma viagem a Marte: W. Friedberg et al., Health aspects of radiation
exposure on a simulated mission to Mars, Radioactivity in the Environment, n.7, 2005, p.894-901.
Uma boa anlise das pretenses da biologia sinttica e da propaganda exagerada sua volta:
Roberta Kwok, Five hard truths for sy nthetic biology , Nature, n.463, 20 jan 2010, p.288-90
(doi:10.1038/463288a).

3. Remixagem e revoluo

Meus pensamentos sobre cpia, criatividade e msica em relao evoluo e biologia


sinttica foram influenciados, de maneira bastante apropriada, por uma srie de vdeos on-line do
diretor nova-iorquino Kirby Ferguson chamada Everything is a Remix, disponvel, dividida em
quatro partes, em: http://www.every thingisaremix.info/.
Completando o circuito, Ferguson usou a evoluo como uma metfora introdutria para a
gnese de ideias na Parte IV de seu extraordinrio trabalho, formulado com pequenssima ajuda
minha. Agora estendo alegremente esta ideia ao reino da biologia sinttica, tomando suas ideias
emprestadas e transformando-as. Tenho certeza de que ele no vai se importar.
A natureza cambiante da criatividade, especificamente na msica, em decorrncia da lei do
direito autoral, est documentada de maneira excelente por Joanna Demers em Steal This Music
(University of Georgia Press, 2006).
Entre os exemplos mais impressionantes de sampling ou colagem em msica esto as
inmeras reutilizaes de um curto trecho de um solo de bateria do lado B de um single de sete
polegadas de 1969 de The Winstons, uma banda de funk soul bastante esquecida. A seo de
quatro compassos conhecida como o Amen Break, pois a prpria msica chamava-se
Amen Brother, e caracteriza-se por batidas quebradas e sincopadas conhecidas como
breakbeat. Em meados dos anos 1980, ela comeou a aparecer como samples em faixas na cena
do hip hop que se desenvolvia ento em Nova York. No fim dos anos 1980, ela havia sido
amplamente sampleada por muitas bandas de dance music e hip hop, entre as quais em Straight
Outta Copton, do conhecido grupo NWA. Uma dcada mais tarde, o loop de bateria de sete
segundos havia aparecido em centenas de msicas, desde um single de David Bowie at os
crditos do desenho animado Futurama. E os gneros da jungle music e do drum and bass so
inteiramente baseados no Amen Break. Um banco de dados de faixas que o utilizam est
disponvel em: http://amenbreakdb.com/.
O primeiro lbum a ser construdo inteiramente com samples foi Endtroducing (1996), de DJ
Shadow, usando pelo menos 99 samples nas dezoito faixas, tomadas de filmes que incluam
Corrida silenciosa (1972) e Prncipe das sombras (1987), e bandas que incluam Queen,
Metallica, Pink Floy d, Kraftwerk e Nirvana. A bactria de Craig Venter, apelidada de Sy nthia,
provavelmente a coisa que mais se aproxima de uma clula viva inteiramente sampleada,
embora Endtroducing seja culturalmente mais relevante e muito mais empolgante.
Hello World: Anselm Levskay a et al., Sy nthetic Biology : engineering Escherichia coli to
see light, Nature, n.438, 24 nov 2005, p.441-2 (doi:10.1038/nature04405).
Trs meses medindo as asas e os olhos de vrios milhares de moscas de olhos pedunculados
(Cyrtodiopsis dalmanni), aps procri-las e cultiv-las em milho-verde ptrido e liquefeito que
maravilha: P. David, A. Hingle, D. Greig, A. Rutherford, A. Pomiankowski e K. Fowler, Male
sexual ornament size but not asy mmetry reflects condition in stalk-ey ed flies, Proceedings of the
Royal Society B, n.265, 1998, p.2211 (doi:10.1098/rspb.1998.0561).
O comeo do processo de biocimentao que a equipe iGEM de Brown-Stanford usaria para
conceber a criao do RegoBricks para terraformao: Calcite precipitation induced by
poly urethane-immobilized Bacillus pasteurii, Enzyme and Microbial Technology, n.28, 2001,
p.404-9.
Duas teis revises de patentes em gentica e biologia sinttica: Arti Rai e James Boy le,
Sy nthetic Biology : caught between property rights, the public domain, and the commons, PLoS
Biology, n.5, 2007, p.e58 (doi:10.1371/journal.pbio.0050058); Berthold Rutz, Sy nthetic Biology
and patents: a european perspective, EMBO Reports, n.10, 2009, p.S14-S17
(doi:10.1038/embor.2009.131).
A patente europeia para o Oncomouse, disponvel em:
http://register.epoline.org/espacenet/application?number=EP85304490.
Presidente Obama, National Bioeconomy Blueprint, disponvel em:
http://www.whitehouse.gov/sites/default/files/microsites/
ostp/national_bioeconomy _blueprint_april_2012.pdf.
4. Em defesa do progresso

Ver Martin Robbins, HULK SMASH GM: mixing angry greens with bad science, 30 mai
2012, guardian.co.uk.
Ver Sophie Vandermoten, Aphid alarm pheromone: an overview of current knowledge on
biosy nthesis and functions, Insect Biochemistry and Molecular Biology, n.42, 2012, p.155-63.
G. Kunert, G. Reinhold e J. Gershenzon, Constitutive emission of the aphid alarm pheromone,
(E)-beta-farnesene, from plants does not serve as a direct defense against aphids, BMC Ecology,
n.1, 2010, p.23 (doi:10.1186/1472-6785-10-23).
L.G. Firbank et al., Farm-scale evaluation of genetically modified crops, Nature, n.399,
1999, p.727-8.
J.N. Perry et al., Ban on triazine herbicides likely to reduce but not negate relative benefits of
GMHT maize cropping, Nature, n.428, 18 mar 2004, p.313-6 (doi:10.1038/nature02374).
M.S. Heard et al., Weeds in fields with contrasting conventional and genetically modified
herbicide-tolerant crops. 1. Effects on abundance and diversity , Philosophical Transactions of the
Royal Society B, n.358, 2003, p.819-32.
J.N. Perry et al., Design, analy sis and power of the farm-scale evaluations of genetically
modified herbicide-tolerant crops, Journal of Applied Ecology, n.40, 2003, p.17-31.
Chelsea Snella et al., Assessment of the health impact of GM plant diets in longterm and
multigerational animal feeding trials: a literature review, Food and Chemical Toxicology, n.50,
2012, p.1134-48.
Take the Flour Back, disponvel em: http://taketheflourback.org/.
Recomendaes da Comisso Presidencial dos Estado Unidos sobre biologia sinttica, 2010:
New directions: the ethics of sy nthetic biology and emerging technologies, disponvel em:
http://bioethics.gov/cms/sy nthetic-biology -report.
E a resposta dos Friends of the Earth e ETC, disponvel em:
http://www.foe.org/news/blog/2010-12-groups-criticize-presidential-commissions-recommenda.
Administrao Obama, National Bioeconomy Blueprint, disponvel em:
http://www.foe.org/news/blog/2012/04/26/national-bioeconomy -blueprint-released.
E a resposta dos Friends of the Earth e ETC: Principles for the oversight of sy nthetic
biology , disponvel em: http://www.foe.org/projects/food-and-technology /blog/2012-03-global-
coalition-calls-oversight-sy nthetic-biology .
Este artigo clssico foi o primeiro caso real de modificao gentica, por Paul Berg e sua
equipe: D.A. Jackson, R.H. Sy mons e P. Berg, Biochemical method for inserting new genetic
informations into DNA of simian virus 40, Circular SV 40 DNA containing lambda phage genes
and the galactose operon of Escherichia coli, Proceedings of the National Academy of Science
USA, n.69, 1972, p.2904-9.
O cisma ps-Asilomar relatado em: Environmental groups lose friends in effort to control
DNA research, Science, n.202, 1978, p.22.
Anlise da economia biobaseada pelo ETC: The new biomassters: sy nthetic biology and the
next assault on biodiversity and livelihoods, disponvel em: http://www.etcgroup.org/content/new-
biomassters.
A tentativa de montar partes do genoma de varola por encomenda postal usada pelo Guardian
como truque publicitrio: James Randerson, Revealed: the lax laws that could allow assembly of
deadly virus DNA, Guardian, 14 jun 2006.
A construo em 2002 do vrus causador da poliomielite tomando a sequncia de seu genoma
de bancos de dados publicamente disponveis: Jeronimo Cello, Aniko V. Paul e Eckard Wimmer,
Chemical sy nthesis of poliovirus cDNA: generation of infectious virus in the absence of natural
template, Science, n.297, 9 ago 2002, p.1016-8 (doi:10.1126/science.1072266).
E da gripe de 1918: Terrence M. Tumpey et al., Characterization of the reconstructed 1918
spanish influenza pandemic virus, Science, n.310, 2005, p.77-80 (doi:10.1126/science.1119392).
Os dois artigos sobre gripe experimental, um por Kawaoka, na Nature, o outro por Fouchier, na
Science, ambos finalmente publicados na ntegra em junho de 2012, aps muita deliberao e
debate, e um editorial anterior da Nature: Masaki Imai et al., Experimental adaptation of an
influenza H5 HA confers respiratory droplet transmission to a reassortant H5 HA/H1N1 virus in
ferrets, Nature, n.486, 21 jun 2012, p.420-8 (doi:10.1038/nature10831); Sander Herfst et al.,
Airborne transmission of influenza A/H5N1 virus between ferrets, Science, n.336, 22 jun 2012,
p.1534-41 (doi:10.1126/science.1213362); Publishing risky research, Nature, n.485, 3 mai 2012,
p.5 (doi:10.1038/485005a).
Claire M. Fraser e Malcolm R. Dando, Genomics and future biological weapons: the need for
preventive action by the biomedical community , Nature Genetics, n.29, 2001, p.253-6
(doi:10.1038/ng763).
Estudo controverso de Gilles-Eric Sralini sobre os efeitos negativos de produtos agrcolas GM
em dietas de ratos: Gilles-Eric Sralini et al., Long term toxicity of a roundup herbicide and a
roundup-tolerant genetically modified maize, Food and Chemical Toxicology, n.50, 2012,
p.4221-31.
E dois meses depois, uma reviso condenatria pela European Food Safety Authority :
European Food Safety Authority, Final review of the Sralini et al. (2012a) publication of a 2-
y ear rodent feeding study with gly phosate formulations and GM maize NK603 as published
online on 19 September 2012 in food and chemical toxicology , EFSA Journal, n.10, 2012,
p.2986.
Sobre a criao da artemisinina: Dae-Ky un Ro et al., Production of the antimalarial drug
precursor artemisinic acid in engineered y east, Nature, n.440, 13 abr 2006, p.940-3
(doi:10.1038/nature04640); P. J. Westfall et al., Production of amorphadiene in y east, and its
convertion to dihy droartemisinic acid, precursor to the antimalarial agent artemisinin,
Proceedings of the National Academy of Science USA, n.109, E111-8, 12 jan 2012; Declan Butler,
Malaria drug-makers ignore WHO ban, Nature, n.460, 14 jul 2009, p.310-1
(doi:10.1038/460310b); Melissa Lee Phillips, Genome analy sis homes in on malaria-drug
resistance, Nature News, 5 abr 2012 (doi:10.1038/nature.2012.10398).
O principal consultor cientfico do governo do Reino Unido sobre alimentos GM: GM food
needed to avert global crisis, say s government adviser, Telegraph, 24 jan 2011.
An affront to God: Meanings of Life, Nature, n.447, 28 jun 2007, p.1031-2
(doi:10.1038/4471031b).
Paul Berg, David Baltimore, Sy dney Brenner, Richard O. Roblin III e Maxine F. Singer,
Summary statement of the asilomar conference on recombinant DNA molecules, Proceedings
of the National Academy of Science USA, n.72, 1975, p.1981-4.
Importante avaliao pblica de como vrios pblicos veem a biologia sinttica no RU:
BBSRC sy nthetic biology dialogue, disponvel em:
http://www.bbsrc.ac.uk/web/FILES/Reviews/sy nbio_summary -report.pdf.

Posfcio

Babel, Esperanto, Klingon, Babm, Blissy mbolics, Loglan e Lojba: o maravilhoso livro de Arika
Okrent sobre as histrias de como inventamos quase novecentas novas lnguas: Arika Okrent, In
the Land of Invented Languages: Esperanto Rock Stars, Klingon Poets, Loglan Lovers, and the Mad
Dreamers Who Tried to Build a Perfect Language (Spiegel & Grau, 2009).
A adio de Z e P s bases naturais A, T, C e G por Steve Benner: Z. Yang e F. Chen et al.,
Amplification, mutation, and sequencing of a six-letter sy nthetic genetic sy stem, Journal of the
American Chemical Society, 2011 (doi:10.1021/ja204910n).
XNA e o nascimento da gentica sinttica: Vitor B. Pinheiro et al., Sy nthetic genetic
poly mers capable of heredity and evolution, Science, n.336, 20 abr 2012, p.341-4
(doi:10.1126/science.1217622).
Aminocidos artificiais: Lloy d Davis e Jason W. Chin, Designer proteins: applications of
genetic code expansion in cell biology , Nature Reviews Molecular Cell Biology, n.13, fev 2012,
p.168-82 (doi:10.1038/nrm3286); Jason W. Chin et al., Addition of a photocrosslinking amino acid
to the genetic code of Escherichia coli, PNAS, n.99, 2002, p.11020-4
(doi:10.1073/pnas.172226299).
Sobre DNA antigo: uma das entrevistas mais surpreendentes que fiz, para o Nature Podcast,
foi com Stephan C. Schuster, que chefiou a pesquisa sobre o sequenciamento do mamute, 20 nov
2008:

SCHUSTER: Assim que percebemos que poderia haver a possibilidade de que a haste de pelo
contivesse DNA real, samos em campo e tentamos encontrar fontes de DNA que
pudssemos explorar com segurana. E minha maneira de fazer isso foi procurar por elas
no eBay, e quando constatei, imediatamente, que h zilhes de pelos disponveis, entramos
em contato com o vendedor e depois, junto com as autoridades da universidade,
asseguramos que houvesse autorizaes adequadas de importao; tivemos tambm
paleontologistas e curadores de museu na Rssia para verificar as fontes daquilo, pois nos
preocupava muito que parte desses pelos e fsseis pudesse ter sido vendida ilegalmente fora
da Rssia. E depois que verificamos que tudo isso estava sendo atendido e de que h um
registro limpo, comeamos a comprar uma proviso maior de pelo dessa fonte.
AR: Alguns desses detalhes no so mencionados na seo de mtodos do artigo. Posso repetir
isso? Voc comprou aqueles pelos no eBay ? Qual foi a oferta bemsucedida?
SCHUSTER: Por um punhado de pelos, acho que paguei uns US$ 132.

Webb Miller et al., Sequencing the nuclear genome of the extinct woolly mammoth, Nature,
n.456, 20 nov 2008, p.387-90 (doi:10.1038/nature07446).
Uma avaliao do sequenciamento de DNA de espcies desaparecidas h muito: S. Pbo et
al., Genetic analy ses from ancient DNA, Annual Review of Genetics, n.38, 2004, p.645-79
(doi:10.1146/annurev.genet.37.110801.143214).
Sobre DNA humano muito antigo: Richard E. Green et al., A draft sequence of the
Neanderthal genome, Science, n.328, 7 mai 2010, p.710-22 (doi:10.1126/science.1188021).
DNA de planta extremamente velha: Eske Willerslev et al., Ancient biomolecules from deep
ice cores reveal a forested Southern Greenland, Science, n.317, 6 jul 2007, p.111-4
(doi:10.1126/science.1141758).
Uma das primeiras sugestes na literatura acadmica de que DNA poderia ser usado como
um dispositivo de armazenamento digital: Eric B. Baum, Building an associative memory vastly
larger than the brain, Science, n.268, 28 abr 1995, p.583-5 (doi:10.1126/science.7725109).
A mais avanada realizao de DNA como meio de armazenar dados: George M. Church,
Yuan Gao e Sriram Kosuri, Next generation digital information storage in DNA, Science,
n.337, 28 set 2012 (doi:10.1126/science.1226355).
ndice remissivo

cidos xenonucleicos (XNAs), 1-2, 3


Action Group on Erosion, Technology and Concentration (ETC), 1, 2, 3, 4, 5
aminocidos, 1, 2, 3-4, 5-6, 7n.4, 8n.2
aminoacil tRNA sintetase, 1
Amy ris, 1-2, 3, 4, 5, 6
aptmeros, 1
armas biolgicas, 1-2, 3
arqueias, 1, 2
artemisinina, 1-2, 3
Asilomar, conferncia de, 1, 2-3
Asimov, Isaac, 1
astronautas, 1, 2-3, 4
ativao de genes, 1, 2, 3

bactrias, 1-2, 3, 4-5, 6, 7, 8-9, 10, 11, 12


E.coli, 1, 2, 3, 4
sintticas, 1-2, 3-4, 5, 6-7, 8, 9, 10-11
Sporosarcina pasteurii, 1, 2
Beddington, John, 1
Benner, Steve, 1
Berg, Paul, 1-2, 3, 4, 5
Bernard de Chartres, 1
betacaroteno, 1
BioBricks, 1-2, 3-4, 5-6, 7, 8, 9
biocombustveis sintticos, 1-2
biologia molecular, 1, 2-3, 4, 5, 6, 7, 8-9, 10-11
biologia sinttica ver biologia sinttica
engenharia gentica ver engenharia gentica
biologia sinttica, 1-2, 3-4, 5
circuitos e lgica, 1-2
competies iGEM, 1-2
e a reinveno do cdigo gentico, 1-2
e deliberao democrtica, 1-2
e medicamentos antimalricos, 1-2, 3
e ondas, 1, 2, 3
e propriedade, 1-2
e Sy nthia, 1-2, 3, 4, 5, 6, 7, 8n.2
ferramentas, 1, 2-3, 4, 5-6, 7, 8, 9
oposio ao progresso e sua defesa, 1-2
osciladores, 1, 2, 3
programas/circuitos assassinos, 1-2, 3
remixagem, 1, 2-3, 4
biossensores, 1
bioterrorismo, 1-2, 3
Bosman, Andrea, 1

cncer, 1-2
clulas de, 1, 2-3, 4-5
programas/circuitos assassinos, 1-2, 3
Carlson, Rob, 1, 2, 3
clulas, 1-2, 3, 4, 5, 6-7
de cncer, 1, 2-3, 4-5
e ritmos circadianos, 1
engenharia de ver engenharia gentica; biologia sinttica
HeLa, 1
leuccitos, 1
neurnios, 1
sintticas, 1-2, 3-4, 5, 6, 7; ver tambm biologia sinttica
clulas sanguneas, 1
cepa de gripe H1N1, 1
cepa de gripe H5N1, 1-2
Chin, Jason, 1-2, 3
Church, George, 1-2
citocinas, 1-2
clonagem, 1n.5
cloroquina, 1, 2
conferncia de Asilomar, 1, 2-3
Crick, Francis, 1-2, 3
Darwin, Charles, 1
detectores de bordas, 1
diabetes, 1-2, 3
diesel, 1, 2-3, 4, 5, 6, 7
DNA, 1-2, 3-4, 5, 6, 7
BioBricks, 1-2, 3-4, 5-6, 7, 8, 9
chips, 1, 2
como um andaime de linha de ovos da Pscoa, 1, 2-3
digital, 1-2
dupla-hlice, 1, 2, 3, 4, 5
e a reinveno do cdigo gentico, 1-2; ver tambm biologia sinttica
e enzimas de restrio, 1-2, 3, 4
e organismos transgnicos, 1-2
estabilidade, 1-2, 3
e XNAs, 1-2
modificao ver engenharia gentica; biologia molecular; biologia sinttica
polimerase, 1, 2-3
produo, 1
regies regulatrias, 1-2
reparao, 1
dogma central, 1

E.coli, 1, 2, 3, 4
Ehrlich, Paul, 1
Elowitz, Michael, 1
Endy, Drew, 1, 2
engenharia gentica, 1, 2-3, 4, 5, 6-7, 8, 9, 10-11, 12
biologia sinttica ver biologia sinttica
e agenda poltica, 1-2
e armas biolgicas, 1-2, 3
e Freckles, a cabra-aranha, 1-2, 3, 4, 5, 6
produtos agrcolas GM, 1, 2-3, 4-5, 6-7
protenas construdas, 1-2
enzimas de restrio, 1-2, 3, 4
ETC (Action Group on Erosion, Technology and Concentration), 1, 2, 3, 4, 5
European Food Safety Authority, 1
E- farneseno (EF), 1
Fey nman, Richard, 1, 2, 3, 4, 5
Fouchier, Ron, 1, 2
Franklin, Rosalind, 1
Freckles, a cabra-aranha, 1-2, 3, 4, 5, 6
Freemont, Paul, 1
Friends of the Earth, 1, 2, 3

Gardner, Timothy, 1
gentica sinttica, 1
glucose, 1, 2
Golden Rice, 1
gripe assassina, 1-2

Haldane, regra de, 1n.1


Harvey, William, 1
Hasty, Jeff, 1, 2, 3
HeLa, clulas, 1
hbridos, 1
organismos transgnicos, 1-2
Holliger, Philip, 1

insulina, 1, 2, 3-4, 5
International Genetically Engineered Machine (iGEM), competio, 1-2

Johnson, Samuel, 1

Kawaoka, Yoshihiro, 1, 2, 3
Keasling, Jay, 1, 2-3
Kelwick, Richard, 1
Knight, Tom, 1

Lacks, Henrietta, 1
LacZ, gene, 1
Lavoisier, Antoine-Laurent, 1
Leibler, Stanilas, 1
Leonardo da Vinci, 1
Lessig, Larry, 1
leuccitos, 1
Leuwenhoek, Antonie van, 1
Lewis, Randy, 1-2, 3
lnguas, novas, 1-2
Loftus, David, 1
lgica, na vida e na biologia sinttica, 1-2
portes lgicos, 1, 2

malria, medicamentos antimalricos sintticos, 1-2, 3


Miescher, Friedrich, 1
mutaes, 1, 2, 3, 4-5, 6, 7
Mycoplasma genitalium, 1
Mycoplasma micoides JCVI-syn1.0 ver Sy nthia

Nasa, 1, 2, 3, 4-5
National Science Advisory Board for Biosecurity (NSABB), 1-2
Nature, 1, 2, 3, 4, 5, 6, 7, 8
neurnios, 1
Newman, Jack, 1
Newton, Isaac, 1
NSABB (National Science Advisory Board for Biosecurity ), 1-2
nuclena, 1

Obama, Barack, 1, 2, 3
ondas, 1, 2, 3
One World Health, 1, 2
organismos transgnicos, 1-2
Organizao Mundial da Sade (OMS), 1, 2-3, 4
origens da biotecnologia, 1-2
osciladores, 1, 2, 3

papa-moscas (dioneia), 1
parada mbar (tripleto UAG), 1-2
patenteamento, 1-2
Pinheiro, Vitor, 1-2
Plasmodium, 1, 2
potencial de ao, 1
Projeto Genoma Humano, 1
Projeto Genoma Mnimo, 1
Protena Fluorescente Verde (GFP, na sigla em ingls), 1-2, 3, 4
protenas, 1, 2, 3, 4, 5-6, 7, 8, 9, 10-11
construdas, 1-2
enzimas de restrio, 1-2, 3, 4
GFP, 1-2, 3, 4
sensveis luz, 1
ver tambm aminocidos
pulges, 1

radiao, 1-2
redundncia, 1
Registry of Standard Biological Parts, 1, 2, 3
RegoBricks, 1
relgios biolgicos, 1, 2-3
ribossomos, 1-2
ritmos circadianos, 1
RNA, 1, 2, 3, 4-5
tRNA, 1-2
Rothschild, Ly nn, 1
rudo biolgico, 1, 2, 3, 4, 5

Sandhoff, doena de, 1


Sanofi-Aventis, 1, 2
Savulescu, Julian, 1
Schultz, Peter, 1
Science, 1, 2
seda de aranha, 1-2, 3-4, 5, 6
seleo artificial, 1-2, 3
seleo natural, 1, 2, 3, 4-5
Sralini, Gilles-Eric, 1-2
sntese de combustvel, 1-2
sintetase, aminoacil tRNA, 1-2
sistema de circuitos eltricos e engenharia, 1-2
Smith, Hamilton, 1
Sowden, Jane, 1n.5
Sporosarcina pasteurii, 1-2
Swift, Jonathan, 1
Sy nthia (Mycoplasma micoides JCVI-syn1.0), 1-2, 3, 4, 5, 6, 7, 8n.2
Szostak, Jack, 1

Tabarrok, Alex, 1
Take the Flour Back, 1-2, 3
terraformao, 1
transgenes, 1, 2
tRNA (RNA transportador), 1-2

UAG (parada mbar), 1-2


urase, 1

Variola major1, 2
varola, vrus da, 1-2
Venter, J. Craig, 1-2, 3, 4, 5-6
virus, 1, 2, 3, 4, 5, 6-7, 8-9, 10, 11-12, 13n.1
vrus de gripe, 1-2
vitamina A, 1
Voigt, Christopher, 1
Voy ager I, 1, 2n.1

Watson, James D., 1-2, 3


Weiss, Ron, 1, 2
Wilkins, Maurice, 1
Agradecimentos

Tal como a cincia, escrever este livro foi um processo cooperativo. Escrevi as palavras, mas
Criao uma concatenao e remixagem montada a partir das ideias e do trabalho de outros.
Meu pensamento sobre o assunto da origem da vida foi intensamente influenciado por meu
amigo Nick Lane no University College London. Iniciei Criao antes de ler seu extraordinrio
livro Life Ascending. Mas tendo feito isso agora, e por nossos muitos almoos, tenho uma grande
dvida para com ele. Na primeira metade, lancei mo liberalmente de seus pensamentos, que ele
expressa com clareza magistral. Recomendo a todos, com insistncia, que o leiam.
Muitas das entrevistas e grande parte da pesquisa para este livro foram feitas como parte de
meu envolvimento em produes de rdio e televiso da BBC. Em 2009, apresentei um
documentrio em srie na BBC4 intitulado The Cell, que durante trs horas cobriu a histria da
biologia de Van Leuwenhoek biologia sinttica. Ele foi realizado por uma equipe de brilhantes
cineastas, entre os quais Jacqui Smith, Andrew Thompson, Alison Rooper, Nick Jordan e Jill
Fullerton Smith. Em particular, David Briggs fez importante pesquisa sobre os primeiros
microscopistas e os do sculo XIX, e merece vasto reconhecimento por ter cotejado de maneira
acadmica e meticulosa mltiplas fontes originais. Em 2010, demos prosseguimento a isso com
um programa chamado Frontiers na BBC Radio 4 sobre o status atual da biologia da origem da
vida. Roland Pease produziu, e devo-lhe imensa gratido, bem como a Sasha Feachem e
Deborah Cohen na BBC Radio Science Unit. Enquanto escrevia Criao, filmei um episdio de
Horizon o principal programa da BBC sobre cincia, que vem sendo transmitido h muito
tempo sobre biologia sinttica. Matthew Dy as, Kelly Neaves e Aidan Laverty conduziram isso
habilmente para o mundo. Algumas das entrevistas citadas em Criao foram realizadas sob os
auspcios desses programas.
Aqui esto algumas outras pessoas com quem tenho uma dvida de gratido: Jane Sowden,
minha amiga e orientadora no Ph.D., com quem aprendi como ser um bom cientista; Steve
Jones, por me ensinar, inspirar e figurar como colaborador em quase todos os meus programas
de TV e de rdio; Armand Leroi, por me ajudar com Aristteles, mostrando-me captulos de seu
livro Aristotles Lagoon; Matt Ridley, por fornecer informao cientfica e biogrfica sobre
Francis Crick; Rob Carlson, autor do excelente livro Biology is Technology, por sua ajuda em
muitos aspectos de biologia sinttica; Alex Tay lor e Vitor Pinheiro, por uma orientao muito
necessria sobre XNA e cdigo gentico expandido; John Sutherland, pela sntese de RNA; Zita
Martins, por sua competncia em astrobiologia e rochas marcianas; Emma Perry, por me ajudar
com o currculo escolar; Sinjoro Simon Varwell, dankon; aqueles no Twitter que por vezes
responderam aos meus apelos para encontrar a palavra certa, o fungo ou o rptil,
especificamente @mr_muse, @sarcasmaniac, @janiefae1, @writerJames; Kirby Ferguson, por
direito autoral e remixagem; Richard Kelwick, pelo encontro iGEM no RU; Philip Campbell,
Kerri Smith, Charlotte Stoddart, Geoff Marsh e Thea Cunningham, todos meus amigos na Nature.
Fui um nmade enquanto escrevia, embora raramente tenha me aventurado fora de
Hackney. As seguintes pessoas gentis permitiram-me usar seus vrios espaos: Jack e Ly nsey
Mathew e Barney, fazendo-me companhia (Ly nsey tambm, pela palavra jumentous); John
Sanders e Beth Gibbon; Ana-Paula Lloy d e Jonny Hassid; e todos em minha segunda casa,
Mouse e de Lotz sem dvida o melhor bar em Londres.
Vrias pessoas leram e comentaram o manuscrito durante sua longa gestao. No entanto,
quaisquer erros ou mutaes que tenham sobrevivido a essas rodadas de seleo so unicamente
meus. Desejo agradecer a Ed Yong, Jim Al-Khalili, Matt Ridley, Dara O Briain, Douglas Adams
e sua famlia, Matthew Cobb, Brian Cox, Suzi Gage, David Adam, Nathaniel Rutherford, Mark
Ly nas e David Watson por seus conselhos, conversas e correes, e em particular a Kevin Fong,
com quem compartilhei a crnica condio de escrever. Testei muitas ideias deste livro com ele.
Richard Bravery na Penguin produziu o design nico e original da edio inglesa, levando em
considerao minha obsesso por fontes.
Estou imensamente grato a meus agentes, Sophie Laurimore e Will Francis; sem o constante
apoio de Will, Criao poderia nunca ter acontecido; minha mulher, Georgia, e nossos filhos
apoiaram inabalavelmente sua gnese, e meu amor por eles to profundo quanto o tempo
geolgico. Acima de tudo, agradeo humildemente a meu editor de texto na Viking, Will
Hammond, que se engalfinhou comigo e com estas palavras inmeras vezes, surrando-as at p-
las em forma. Duvido que muitos escritores recebam tanta ateno no cinzelamento de sua
prosa.
Cientistas podem ser muito briges. Eles competem por ideias, e por financiamento, e assim
como em qualquer esforo humano, esto sujeitos a dogma e a crenas caprichosas e
empedernidas. Boas teorias emergem desse redemoinho de debate aberto mas por vezes
irascvel e so testadas e refinadas por experimento. A cincia no se acomoda na verdade,
mas tende em direo a ela. Essas reas particulares da cincia so pioneiras e importantes, e,
como tais, esto talvez mais sujeitas a discusses que a maioria. As ideias apresentadas aqui
sero refinadas ou mudadas com o tempo, ou rejeitadas. E francamente, como todo bom
cientista deveria fazer, aguardo ansioso que me corrijam.
Ttulo original:
Creation
(The Origin of Life/The future of Life)

Traduo autorizada da primeira edio inglesa,


publicada em 2013 por Viking, um selo de Penguin Books,
de Londres, Inglaterra

Copy right 2013, Adam Rutherford

Copy right da edio brasileira 2014:


Jorge Zahar Editor Ltda.
rua Marqus de S. Vicente 99 1 | 22451-041 Rio de Janeiro, RJ
tel (21) 2529-4750 | fax (21) 2529-4787
editora@zahar.com.br | www.zahar.com.br

Todos os direitos reservados.


A reproduo no autorizada desta publicao, no todo ou em parte, constitui violao de direitos
autorais. (Lei 9.610/98)

Grafia atualizada respeitando o novo Acordo Ortogrfico da Lngua Portuguesa

Capa: adaptada da arte da capa publicada por Viking, um selo de Penguin Books
Produo do arquivo ePub: Simplssimo Livros

Edio digital: setembro 2014


ISBN: 978-85-378-1349-2