Você está na página 1de 8

Os genes e o controle do metabolismo

01. (FUVEST) A seguir est representada a sequncia dos 13 primeiros pares de nucleotdeos da
regio codificadora de um gene.
ATGAGTTGGCCTG
TACTCAACCGGAC
A primeira trinca de pares de bases nitrogenadas esquerda corresponde ao aminocido
metionina. A tabela a seguir mostra alguns cdons do RNA mensageiro e os aminocidos
codificados por cada um deles.

CDON DO RNAm AMINOCIDOS

ACC Treonina

AGU Serina

AUG Metionina

CCU Prolina

CUG Leucina

GAC cido asprtico

GGC Glicina

UCA Serina

UGG Triptofano

CCG Prolina
Com base no exposto e em seus conhecimentos sobre o assunto, assinale a(s) alternativa(s)
correta(s).

I II

0 0 A sequncia de bases nitrogenadas do RNA mensageiro, transcrito a partir desse segmento


de DNA ser AUG AGU UGG CCU G -.
1 1 Utilizando a tabela do cdigo gentico fornecida, a sequncia dos trs primeiros
aminocidos seguintes metionina, no polipeptdio codificado por esse gene ser Serina
triptofano Prolina .
2 2 A sequncia dos trs primeiros aminocidos de um polipeptdio codificado por um alelo
mutante desse gene, originado pela perda do sexto par de nucleotdeos (deleo do par de bases
A = T) ser Metionina Serina Glicina .
3 3 A sequncia de bases nitrogenadas do RNA mensageiro, transcrito a partir do segmento do
DNA mutante mencionado na alternativa anterior, ser UAC UCA CCG GAC .
4 4 A sequncia dos trs ltimos aminocidos de um polipeptdio codificado por um alelo
mutante desse gene, originado pela perda do dcimo segundo par de nucleotdeos (deleo do par
de bases A = T), ser Serina Triptofano Glicina .
02. (UFAL)Observe o quadro abaixo, que mostra alguns aminocidos codificados pelos cdons de
RNAm (RNA mensageiro) humano. Sobre este assunto, em correto afirmar:

Metionina AUG

Serina UCU, UCC, UCA, UCG, AGU, AGC

Triptofano UGG

Tirosina UAU, UAC

Isoleucina AUU, AUC, AUA


a) o cdigo gentico chamado de universal, pois vrios cdons podem codificar o mesmo
aminocido.
b) a iniciao da sntese proteica sempre ocorre com a incorporao de metionina ou tirosina na
cadeia polipeptdica.

c) o cdigo gentico dito redundante, porque tem o mesmo significado em praticamente todos
os organismos.

d) a substituio da segunda base nitrogenada por citosina, no cdon do triptofano, pode provocar
a incorporao de outro aminocido num polipeptdeo em formao.

e) uma mutao substitutiva de guanina por citosina no cdon da metionina, no produziria


interferncia na sntese proteica.

03. (PUC-PR) Os cdons AGA, CUG e ACU do RNA mensageiro codificam, respectivamente, os
aminocidos arginina, leucina e treonina. A sequncia desses aminocidos na protena
correspondente ao segmento do DNA que apresenta a sequncia de nucleotdeos GAC TGA
TCT ser, respectivamente:
a) arginina, leucina, treonina.

b) leucina, arginina, treonina.

c) leucina, treonina, arginina.

d) treonina, leucina, arginina.

e) treonina, arginina, leucina.

04. (CEFET-S. Paulo)

QUADRO DE CDONS DO RNAm

CDONS AMINOCIDOS

UUU, UUC Fenilalanina

GUU, GUC, GUA, GUG Valina

GCU, GCC, GCA, GCG Alanina

GAU, GAC cido asprtico

UAU, UAC Tirosina

ACU, ACC, ACA, ACG Treonina

CUU, CUC, CUA, CUG Leucina


O quadro acima mostra que:

a) Caso ocorra a substituio da primeira base nitrogenada G do aminocido valina pela base
nitrogenada C, ser codificado o aminocido leucina.
b) Uma trinca codifica mais de um aminocido.

c) Um mesmo aminocido s pode ser codificado por uma nica trinca.

d) Qualquer mutao que ocorrer na ltima base nitrogenada do cdon que codifica o
aminocido valina, ele no ser sintetizado.
e) A sequncia de trincas do DNA que origina o aminocido cido asprtico CUAou CUG.
05. (PUC-RIO)Quanto ao cdigo gentico, correto afirmar que:
a) as protenas so transcritas a partir do RNA, que traduzido a partir do DNA.

b) tanto o DNA quanto o RNA das clulas eucariotas so molculas de fita dupla.
c) o RNA transcrito a partir do DNA e responsvel pela traduo proteica.

d) as protenas so traduzidas diretamente pelo DNA, que transcrito pelo RNA.

e) o DNA traduzido em protenas diretamente nos ribossomos.

06. (UNICAMP) Uma molcula de DNA sintetizada artificialmente, com a


sequnciaTATCCGCCCTACCCG, foi utilizada para sintetizar a seguinte sequncia de cinco
aminocidos (AA) representados por smbolos:

A mesma molcula de DNA foi submetida a tratamento com substncia mutagnica, provocando
alterao na 12a base da sequncia, que passou a ser uma timina. Com base no exposto, assinale
a(s) alternativa(s) correta(s).
I II

0 0 O aminocido AA4 ser substitudo por um aminocido AA2.


1 1 O aminocido AA4ser substitudo por um aminocido AA3.
2 2 O aminocido AA4 ser substitudo por um aminocido AA1.
3 3 Em face da existncia de cdons sem sentido, haver uma terminao prematura da
cadeia proteica.
4 4 Em face de o cdigo gentico ser degenerado, no haver alterao na cadeia proteica.

07. (CEFET-MG) Apesar da maioria dos aminocidos ter pelo menos dois cdons no RNAm, a
metionina e o triptofano possuem apenas um cdon AUG e UGG, respectivamente. Referindo-se a
esses dados, correto afirmar que
a) o anticdon para o triptofano ACC.
b) o cdon para o triptofano apresenta adenina.

c) a trinca no DNA para a metionina pode ser UAC.


d) o anticdon para a metionina apresenta duas bases pricas.

08. (UEL) Com relao ao cdigo gentico, incorreto afirmar que:


a) Cada aminocido, na protena sintetizada, codificado por uma trinca de bases de uma cadeia
de DNA.

b) Cada RNA transportador possui, em determinada regio de sua molcula, uma trinca de bases
denominada cdon.

c) O suporte para a sntese de protenas dado pelos ribossomos, que so constitudos por RNA
ribossmico e protenas.

d) O DNA no participa diretamente da sntese de protenas, sendo o RNA mensageiro a molcula


que contm as informaes.

e) O RNA transportador, unido a um aminocido especfico, acopla-se aos ribossomos de acordo


com as trincas do RNA mensageiro.

09. (UFOP) O quadro abaixo mostra o cdigo gentico e os aminocidos por ele codificados.
Fen = Fenilalanina. Leu = Leucina. Ile = Isoleucina. Met = Metionina.
Val = Valina. Ser = Serina. Pro = Prolina. Tre =
Treonina.
Ala = Alanina. Tir = Tirosina. His = Histidina. Gln = Glutamina.
Asn = Asparagina. Lis = Lisina. Asp = cido asprtico. Glu = cido
glutmico.
Cis = Cistena. Trp = Triptofano. Arg = Arginina. Gli = Glicina.
Com base no quadro e em seus conhecimentos sobre sntese de protenas, considere um
segmento de DNA que possui a seguinte sequncia de bases:

ACGCGTAAGTTTGTG
correto afirmar:

a) A sequncia de aminocidos codificada por esse segmento ser: treonina-arginina-lisina-


fenilalanina-valina.

b) A sequncia de aminocidos codificada por esse segmento ser: cisteina-alanina-fenilalanina-


lisina-histidina.

c) Se um nucleotdeo for substitudo por outro em um segmento que codifica determinada


protena, a situao poder ser mais drstica, caso um nucleotdeo seja suprimido.

d) A sequncia de bases do RNA-mensageiro ser UGCGCATTCAAACAC.


10. (UFScar) Diz-se que o cdigo gentico degenerado porque:
a) existe mais de um aminocido para cada cdon.

b) se desorganiza na velhice.

c) mais de um cdon pode codificar um mesmo aminocido.

d) existem cdons que no codificam qualquer aminocido.

e) o cdigo diferente no DNA e no RNA.


11. (PUC-RIO) Diversas doenas esto relacionadas a mutaes no material gentico. Porm,
mutaes pontuais, com a alterao de apenas uma base nitrogenada, muitas vezes no resultam
em substituio efetiva do aminocido correspondente ao cdon mutado na protena produzida.
Isto se d devido ao fato de:
a) o cdigo gentico ser universal.

b) o cdigo gentico ser repetitivo ou degenerado.

c) o erro ser corrigido pela clula durante a traduo.

d) o cdigo gentico no poder sofrer alteraes.

e) os genes mutados no serem transcritos ou traduzidos.

12. (FUVEST) O cdigo gentico o conjunto de todas as trincas possveis de bases nitrogenadas
(cdons). A sequncia de cdons do RNA mensageiro determina a sequncia de aminocidos da
protena. correto afirmar que o cdigo gentico
a) varia entre os tecidos do corpo de um indivduo.

b) o mesmo em todas as clulas de um indivduo, mas varia de indivduo para indivduo.

c) o mesmo nos indivduos de uma mesma espcie, mas varia de espcie para espcie.

d) permite distinguir procariotos de eucariotos.

e) praticamente o mesmo em todas as formas de vida.

13. (UERJ) A mutao em um gene, por consequncia da substituio de uma nica base na
estrutura do DNA, pode acarretar modificaes importantes na atividade biolgica da protena
codificada por esse gene. Considere que a estrutura normal de um RNA mensageiro de um
peptdeo e sua estrutura alterada em virtude da troca de uma nica base no gene correspondente
so:

5 AUGUGGUUUGCACACAAAUGAUAA 3
(normal)
5 AUGUGGUUUGAACACAAAUGAUAA 3
(alterada)
A tabela a seguir identifica alguns cdons.

AMINOCIDO CDON

Alanina GCC, GCG, GCU, GCA

cido asprtico GAC, GAU

Cistena UGC, UGU

Glicina GGA, GGC, GGG, GGU

cido glutmico GAA, GAG

Fenilalanina UUC, UUU

Metionina AUG

Triptofano UGG

Treonina ACA, ACC, ACG, ACU


Lisina AAA, AAG
Observe que:
o cdon da metionina tambm o do incio da traduo.
os cdons de trmino da traduo so UAA, UAG e UGA.
O aminocido encontrado no peptdeo normal e aquele que o substituiu no peptdeo mutante so,
respectivamente:

a) lisina e cistena.

b) treonina e triptofano.

c) alanina e cido glutmico.

d) fenilalanina e cido asprtico.

14. (FCMSC) Um botnico, aps uso de radiao, obteve uma variedade de planta que diferia da
selvagem por apresentar flores pretas. Um bioqumico constatou que tal pigmento fora produto de
uma reao qumica catalisada por uma enzima nova, com 3 cidos aminados terminais a menos
que o relacionado com a sntese do pigmento selvagem. Um geneticista molecular, consultado a
respeito, concluiu que a radiao tinha eliminado, nessa variedade, pelos menos:
a) 3 genes.

b) 3 pares de genes.

c) 3 pares de nucleotdeos do DNA.

d) 3 pares de nucleotdeos do RNA mensageiro.

e) 9 pares de nucleotdeos do DNA.

15. (UFU) O aminocido leucina pode ser codificado por mais de uma trinca de nucleotdeos do
DNA (AAT, GAA e outras). Assim sendo, podemos dizer que
I. O cdigo gentico degenerado, o que significa que um aminocido pode ser
codificado por mais de uma trinca.
II. Um aminocido pode ser codificado por apenas uma trinca de nucleotdeos de DNA.
III. Assim como a leucina pode ser codificada por diferentes trincas, uma determinada
trinca tambm pode codificar diferentes aminocidos.
Esto corretas afirmativas:

a) apenas III.
b) apenas II.
c) apenas I.
d) I e III.
e) nenhuma delas.

16. (FUVEST) O cdigo gentico est todo decifrado, isto , sabe-se quais trincas de bases no
DNA correspondem a quais aminocidos nas protenas que se formaro.

SEQUNCIA DO DNA AMINOCIDO

AGA serina (SER)

CAA valina (VAL)

AAA fenilalanina (FEN)

CCG glicina (GLI)

AAT leucina (LEU)


GAA leucina (LEU)
Com base na tabela acima, assinale a(s) alternativa(s) correta(s).

I II

0 0 Se um RNAm tem sequncia de trincas UUAUUUCUUGUUUCUGGC, a sequncia dos


aminocidos no polipeptdeo correspondente ser: LEU FEN LEU VAL SER GLI.
1 1 Os anticdons dos RNAt da leucina sero AAU e GAA.
2 2 O anticdon do RNAt da glicina ser GGC.
3 3 O anticdon do RNAt da valina ser CAA.
4 4 O anticdon do RNAt da serina ser UCU.
17. (MACK) Uma molcula de RNA mensageiro com 90 bases nitrogenadas apresenta:
a) 90 cdons e 90 nucleotdeos.

b) 30 cdons e 90 nucleotdeos.

c) 30 cdons e 30 nucleotdeos.

d) 60 cdons e 30 nucleotdeos.

e) 30 cdons e 60 nucleotdeos.

18. (FUVEST) Considerando tabela a seguir, que indica sequncias de bases do RNA mensageiro e
os aminocidos por elas codificados.

Com base na tabela fornecida, e considerando um segmento hipottico de DNA, cuja sequncia de
bases AAGTTTGGT, qual seria a sequncia de aminocidos codificada?
a) Asparagina, leucina, valina.
b) Asparagina, lisina, prolina.
c) Fenilalanina, lisina, prolina.
d) Fenilalanina, valina, lisina.
e) Valina, lisina, prolina.
19. (MACK) A respeito do cdigo gentico, correto afirmar que:
a) considerado degenerado, porque h cdons diferentes para um mesmo aminocido.
b) apresenta cdons diferentes em cada espcie de ser vivo, o que explica a diversidade biologia.

c) dado pela sequncia de aminocidos em uma protena.

d) resulta em duas cpias idnticas, sem a possibilidade de erro no processo, sempre que
copiado.

e) todos os seus tipos de bases nitrogenadas podem ser encontrado tanto no DNA quanto no RNA.

20. (UPE) Uma cadeia de DNA apresenta a seguinte sucesso de nucleotdeos AAA TAC GTA
GTA e a partir dela sintetizado um polipeptdio.

CDONS AMINOCIDOS ABREVIAO DO AMINOCIDO

UUU, UUC Fenilalanina Phe

CAU, CAC Histidina His

AAA, AAG Lisina Lis

AUG Metionina Met

UAA, UUG Leucina Leu

UCC, UCA Serina Ser

GAA, GAG cido Glutmico Glu


Assinale a alternativa que indica a sequncia de aminocidos do polipeptdeo sintetizado,
utilizando o quadro abaixo:

a) Phe His His Glu.


b) Glu Leu Ser Ser.
c) His His Met Phe.
d) Phe Met His His.
e) Met Phe Lis Lis.
GABARITO

01 02 03 04 05 06 07 08 09 10

VVVFF D C A C FFVFF A B B C

11 12 13 14 15 16 17 18 19 20

B E C E C VVFVF B C A D

https://djalmasantos.wordpress.com/2010/11/15/codigo-genetico/