Você está na página 1de 109

ISSN 1980-3540

Volume 8 No 1 2013

Conceitos de Gentica Na sala de aula


Gentica e Sociedade Materiais Didticos
Investigaes em Resenhas
Ensino de Gentica Um gene
ndice
Editorial
Na sala de aula
Conversa com Cientistas: uma atividade para transformar a viso de Cincia de professores de Cincias ............................. 4

Materiais Didticos
Identificando o sistema de acasalamento em aves ......................................................................................................................... 10
Disperso do plen entre pequizeiros: uma atividade para a gentica no ensino superior ....................................................... 18
Identificao de espcie e do seu local de origem para a resoluo de crimes contra a fauna brasileira:
uma atividade para o ensino de gentica forense ........................................................................................................................... 28
Por que alguns bezerros do seu Oswaldo morreram? ................................................................................................................... 44
O Julgamento da Mutao ............................................................................................................................................................... 42

Investigaes em Ensino de Gentica


As concepes alternativas de estudantes sobre as implicaes socioambientais do uso dos transgnicos ............................. 58

Conceitos de Gentica
Carga gentica ................................................................................................................................................................................... 68

Gentica e Sociedade
Alfred Russel Wallace - Coproponente da seleo natural, tributo ao centenrio de seu falecimento .................................... 74

Resenhas
Experimento de hibridao de plantas - o artigo de Gregor Mendel .......................................................................................... 86
Experimentos de Hibridao em Plantas Realizados por Gregor Mendel (1865) .......................................................... 88

Um Gene
Gene tnaA: bactrias resistentes altrustas socorrem vizinhas menos resistentes..................................................................104

2 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

Editorial
com prazer que apresentamos este nmero ntica e Sociedade, Um gene e Material
de Gentica na Escola, o segundo a ser pro- Didtico, o que refora que a comunidade de
duzido aps a reformulao da linha edito- cientistas est se mobilizando para apoiar os
rial. Aps um longo percurso de propostas esforos da escola. Entre essas contribuies,
e discusses, chegamos a um novo projeto destacamos a tima traduo do artigo semi-
grfico, novas sees e um novo corpo de nal de Mendel, to comentado nas escolas,
colaboradores no Conselho Editorial. A mas pouco lido na ntegra. A inteno am-
inteno tem sido buscar ampliar o univer- pliar o acesso ao texto original, redigido por
so de leitores da revista, aproximando-a da Mendel em alemo.
realidade dos que ensinam Gentica, em to-
Por ltimo, gostaramos de destacar a pu-
dos os nveis. A comunidade de geneticistas
blicao de um artigo cuja primeira autora
e professores tem contribudo, e muito, para
uma professora do Ensino Mdio, que uti-
caminharmos nessa direo; podemos dizer,
lizou sua experincia para pesquisar as con-
com este nmero, que essa nova proposta
cepes de estudantes sobre as implicaes
editorial est se consolidando.
dos transgnicos. Esperamos que esse seja o
Esta edio de Gentica na Escola traz trs primeiro de uma enxurrada de trabalhos en-
artigos que so propostas desenvolvidas em viados por professores da escola bsica!
cursos de graduao. muito significativo
Assim, esta edio resume o que almeja a
constatar que a comunidade de geneticistas
nova linha editorial de Gentica na Escola:
est ativa na produo de atividades didti-
trazer textos de qualidade, produzidos tanto
cas e que prestigia Gentica na Escola como
por professores como por cientistas profis-
meio de divulgao de suas propostas.
sionais, e que sejam teis para o ensino da
Alm disso, este nmero contm tambm Gentica em todos os nveis.
contribuies de pesquisadores em Genti-
Esperamos que continuem colaborando com
ca, nas sees Conceitos de Gentica, Ge-
Gentica na Escola!
Os editores

Sociedade Brasileira de Gentica 3


NA SALA DE AULA

Conversa com Cientistas:


uma atividade para transformar a viso
de Cincia de professores de Cincias
Felipe Bandoni de Oliveira

Colgio Santa Cruz,


Comisso de Ensino da Sociedade Brasileira de Gentica

Autor para correspondncia: fbofelipe@gmail.com

4 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

O s currculos modernos de Cincias e


suas subreas (Biologia, Qumica, Fsi-
ca) enfatizam cada vez mais a necessidade de
cia, sendo parte integrante de um curso mais
longo que teve esse mesmo objetivo. A ideia
foi promover uma conversa com cientistas
que os alunos compreendam como produ- para aproximar os professores do universo
zido o conhecimento cientfico e aprendam a de produo do conhecimento cientfico.
distingui-lo de outros tipos de conhecimen-
to. Essa tendncia, presente nos Parmetros UMA ATIVIDADE DENTRO
Curriculares Nacionais e em propostas curri- DE UM CURSO; UM CURSO
culares estaduais e municipais, no exclusiva
do Brasil. Todos os pases que se propem a DENTRO DE UM CONGRESSO
modernizar o currculo de Cincias tm che- O Congresso Brasileiro de Gentica, reali-
gado a propostas que valorizam mais o apren- zado anualmente em cidades diferentes, foi
dizado de procedimentos e atitudes tpicos da a oportunidade ideal para realizar um en-
atividade cientfica do que os fatos cientficos contro entre professores do ensino bsico e
em si. Nesse contexto, por exemplo, vale mais cientistas profissionais. Em 2011, em guas
um aluno compreender o raciocnio que um de Lindoia, 95 professores de escolas esta-
cientista segue para classificar um animal do duais paulistas participaram do curso de
que memorizar as estruturas que esse animal aperfeioamento para professores; em 2012,
possui ou seu nome cientfico. Provavelmen- outros 90, de escolas estaduais paranaenses.
te essa uma reao exploso do acesso A maioria desses cursistas era de professores
informao, inclusive cientficas, no mundo de Biologia no Ensino Mdio, mas cerca 60%
atual, principalmente na internet. deles atuavam tambm como professores de
Cincias no Ensino Fundamental. Em 2011,
No entanto, durante dcadas, o ensino de
dois professores de Fsica tambm partici-
Cincias foi baseado na transmisso de fatos.
param. A idade, tempo de magistrio, con-
Currculos estanques, que eram meramente
dies de trabalho e experincia profissional
listas de assuntos (como se fossem um ndice
desses cursistas eram muito variados; pode-
de livro didtico), progressivamente passam a
-se consider-los como representativos de
ser baseados em expectativas de aprendizagem
uma grande rede pblica de ensino, como
que os alunos precisam atingir. Para trabalhar
o caso nos estados de So Paulo e Paran. A
nessa realidade, os professores precisam estar
atividade Conversa com Cientistas foi uma
plenamente familiarizados com o processo de
parte integrante do curso de aperfeioamen-
produo de conhecimento cientfico.
to dos docentes.
As licenciaturas em Cincias, mesmo as atu-
O objetivo central do curso era discutir as-
ais, de uma forma geral no parecem garantir
pectos do pensamento e do modo de agir
que os professores tenham uma viso ade-
cientficos, para que os professores refle-
quada da Cincia. Muitos professores rela-
tissem sobre a viso que possuem sobre a
tam que ao longo de seus cursos no tiveram
natureza da Cincia (no sentido do termo
nenhuma experincia em laboratrios ou em
em ingls: Nature of Science, ou NOS). A
atividades investigativas que revelassem como
motivao para organizar esse curso veio da
acontece o fazer cientfico. Definitivamente,
constatao, apontada por vrios estudos,
no papel das licenciaturas formar cientis-
de que prticas docentes mais inovadoras e
tas profissionais; no entanto, necessrio que
que produzem aprendizados mais efetivos
um professor de Cincias conhea de modo
dependem de uma viso de Cincia mais
cristalino como o conhecimento cientfico
clara por parte dos docentes. interessante,
produzido. Vrios estudos mostram que viso
por exemplo, que os professores reconheam
adequada sobre a Cincia possibilita ativida-
que existem influncias socioculturais sobre
des mais interessantes e os estudantes aca-
a atividade cientfica, que podem existir in-
bam tendo, tambm, uma viso mais clara do
teresses econmicos por trs de alguns tipos
modo cientfico de produzir conhecimento.
de pesquisa, que questes ticas e jurdicas
A atividade descrita tem a inteno de aper- podem interferir, discutir a existncia de um
feioar a viso dos professores sobre a Cin- mtodo cientfico rgido etc.

Sociedade Brasileira de Gentica 5


NA SALA DE AULA

PREPARAO PARA Para a entrevista foram convidados geneti-


cistas atuantes nas mais variadas especialida-
A ATIVIDADE des, com idades e experincias profissionais
Antes da conversa com os cientistas, os cur- diversificadas e, na medida do possvel, re-
sistas j haviam cumprido outras atividades presentativos de todas as regies do Brasil. A
previstas no curso, a fim de que pudessem ideia foi convidar cientistas com experincias
observ-las para depois refletir sobre elas. muito diferentes para que o grupo de cursis-
Em primeiro lugar, receberam as boas-vindas tas pudesse ter contato com a diversidade
e foram apresentados aos objetivos formais. de profissionais da rea da Gentica, mas
Durante essa apresentao, enfatizou-se que tambm pudesse detectar atitudes e proce-
o ponto central seria analisar a viso que dimentos comuns na atividade cientfica.
eles prprios tinham da natureza da Cincia
e como todo o curso se articulava ao redor Existiram perguntas direcionadoras, mas os
desse objetivo principal. Depois disso, assis- professores foram instrudos explicitamente
tiram abertura solene, palestra inaugural a formularem suas prprias perguntas, a fim
do Congresso e a um dos simpsios (segundo de descobrir o que lhes interessava a respeito
sua livre escolha). Em seguida, os cursistas da atividade do cientista, bem como esclare-
reuniram-se para trocar impresses sobre os cer suas dvidas sobre a natureza da Cincia.
primeiros eventos que assistiram e, novamen- As questes, grosso modo, versavam sobre os
te, os objetivos do curso foram mencionados. seguintes aspectos da atividade cientfica: o
Essa insistncia garantiu que o olhar dos tpico de pesquisa do entrevistado, existncia
professores estivesse atento no apenas para de um mtodo cientfico, influncias sociocul-
tpicos especficos da Gentica com os quais turais sobre a Cincia, influncia da formao
estavam tendo contato, mas, sobretudo, para e das crenas do cientista sobre suas pesqui-
questes relacionadas natureza da atividade sas, o papel da subjetividade e da objetividade
cientfica e da sua prpria viso de Cincia. na Cincia, a natureza das observaes e evi-
dncias cientficas, o papel da imaginao e o
Como a atividade envolveria entrevistar processo de validao do conhecimento cien-
um cientista convidado, conversamos por tfico. Para orientar os cursistas a conduzir a
meia hora sobre como conduzir as pergun- entrevista, receberam sugestes de questes
tas e registrar as respostas. Os professores sobre esses aspectos, com a ressalva de que
levantaram a necessidade de cada grupo outras questes seriam bem-vindas. Essas su-
organizar-se para abordar todos os aspectos gestes esto no quadro 1.
importantes da atividade cientfica no tempo
proposto para a entrevista (uma hora). Dis-
cutimos tambm sobre possveis dificuldades A ENTREVISTA
que poderiam aparecer, tais como o convida- Muitos dos professores cursistas (e tambm
do ser muito lacnico ou demasiado prolixo, os entrevistados) mostraram-se ansiosos
e como contorn-las respeitosamente. durante a entrevista, apesar da informalida-
de proposta para a situao. As entrevistas
A ATIVIDADE EM SI duraram uma hora, sendo que os dez convi-
Na tarde do segundo dia de curso aconteceu dados foram entrevistados simultaneamen-
a atividade Conversa com Cientistas. Consi- te pelos diferentes grupos. Como eram cerca
derando que o Congresso de Gentica rene de dez entrevistadores para cada entrevista-
cientistas atuantes nas mais diversas reas da do, foi necessrio que os grupos se organi-
Gentica, convidamos dez deles para serem zassem para conduzir as perguntas e anotar
entrevistados pelos professores cursistas. as respostas, o que aconteceu naturalmente,
A ideia que os professores tivessem liber- sem necessidade de interveno. Embora
dade para questionar os cientistas a respei- tenham partido das mesmas sugestes de
to de como funciona a Cincia. Com isso a questes, cada grupo encaminhou a entre-
inteno era de que, ao ouvir os relatos dos vista em uma direo e aprofundou-se em
cientistas, os cursistas reconsiderassem suas um aspecto da atividade cientfica. Dada a
prprias concepes sobre o fazer Cincia. abertura dos cientistas para colaborar e dis-

6 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

Quadro 1.
Sugestes de roteiro de
entrevista para a atividade 1. Qual exatamente o tpico que voc pesquisa?
Conversa com Cientistas.
2. Qual o principal desafio, neste momento, da sua rea de interesse?
3. Pensando na sua experincia, voc diria que segue um mtodo cientfico
universal (significando: propor hiptese, coletar dados, testar hiptese
nessa ordem)? Conhece um caso de algum que trabalhou de outra maneira?
4. Qual o papel da imaginao no seu trabalho? Voc usa a imaginao ou ela
incompatvel com o trabalho de um cientista? Voc consegue pensar em um
exemplo de situao em que usou a imaginao?
5. Voc diria que o cientista tem uma atividade absolutamente objetiva, sem
interferncia de fatores subjetivos?
6. Voc diria que um cientista seria capaz de negar uma hiptese que ele mesmo
props? Conhece algum exemplo na sua rea ou fora dela que mostre isso?
7. Voc diria que um cientista seria capaz de defender uma hiptese mesmo
que tivesse evidncias de que ela estivesse incorreta? Conhece algum exemplo
disso na sua rea?
8. Voc acha que fatores externos comunidade cientfica influenciam o que voc
faz (financiamento, problemas ticos, questes sociais, questes econmicas,
intervenes de religiosos, avanos tecnolgicos)? Que fatores seriam esses?
Poderia citar algum exemplo?
9. Voc acha que a maneira como voc foi formada(o) interfere na maneira como
voc pesquisa? Acha que se fosse formada(o) em outra rea veria a sua atual
pesquisa de maneira diferente?
10. Voc classificaria o resultado do trabalho de um cientista mais como uma
descoberta ou mais como uma inveno? Por qu?
11. Durante um projeto de pesquisa, os cientistas seguem risca o que planejaram
inicialmente? Conhece algum exemplo na sua atuao como cientista?
12. Analise a frase a seguir: uma teoria ou hiptese jamais poder ser rejeitada se
for baseada em pesquisas feitas com qualidade e critrio. Em sua opinio, isso
verdadeiro?
13. Voc teve a chance de observar, na sua atuao como cientista, alguma ideia
ser desprezada? Como foi isso?
14. Na sua rea de atuao voc j observou a proposio de uma ideia inovadora?
Como foi isso? Essa ideia apareceu por causa de novos dados ou por um novo
olhar para os mesmos dados?
15. Uma teoria cientfica (como a teoria da seleo natural, teoria celular ou teoria
atmica) uma descoberta ou uma inveno?
16. Voc diria que possvel que dois cientistas vejam dois resultados diferentes
em um mesmo experimento?
17. As crenas pessoais de um cientista interferem na pesquisa que ele faz?

Sociedade Brasileira de Gentica 7


NA SALA DE AULA

cutir com os professores, a situao tornou- tores histricos, econmicos e at mesmo


-se menos formal e a entrevista converteu-se jurdicos. Mencionou-se, por exemplo, o
em uma conversa descontrada, mas que no caso das pesquisas com clulas-tronco,
deixou de abordar os temas importantes. que sofrem algumas restries, ou o pa-
pel de comisses de tica em estudos
Isso j era esperado, de maneira que, aps
com humanos e animais. A influncia das
as entrevistas, tivemos um tempo para que
agncias de fomento, um assunto que
os grupos compartilhassem relatos sobre os
corriqueiro entre os cientistas, foi novi-
pontos mais significativos de cada entrevista
dade para muitos professores, que desco-
e para que pudssemos discutir sobre even-
nhecem o sistema de financiamento das
tuais semelhanas ou discordncias entre as
pesquisas. A ideia de que o cientista um
falas de cada entrevistado.
indivduo isolado de seu tempo e lugar
foi repetidamente posta em dvida pelos
OS ACHADOS DOS cursistas; questes de influncia poltica
ENTREVISTADORES dentro da comunidade cientfica tambm
Durante a socializao dos relatos, os seguin- vieram tona, surpreendendo os profes-
tes pontos foram levantados como destaques sores que ignoravam esse tipo de influn-
importantes das entrevistas. cia.
1. A figura dos cientistas. Professores 4. O peso das publicaes na atividade
destacaram a humildade dos cientistas cientfica. Os entrevistados notaram,
em falar como pessoas comuns e de um no discurso dos cientistas, a importn-
modo compreensvel. Vrios afirmaram cia que atribuem s publicaes. Para a
estar surpresos em conhecer cientistas imensa maioria foi novidade descobrir
jovens e que tm uma vida normal. O que vrios cientistas dedicam muito mais
fato de esse ponto chamar a ateno na tempo a atividades de escrita e leitura de
entrevista revela que esses professores, de publicaes do que ao laboratrio ou ao
uma maneira geral, tm uma viso este- trabalho de campo. Tambm foi desta-
reotipada da figura do cientista. Esse es- que o rigor necessrio na pesquisa para
teretipo (geralmente homem, de meia- chegar a uma publicao de peso, a anli-
-idade, com hbitos excntricos e falas se annima por pares e todo o sistema de
incompreensveis) muito comum entre validao do conhecimento cientfico.
alunos e o fato de aparecer tambm entre Esses mesmos pontos foram mencio-
professores pode significar que essa pers- nados tanto pelo grupo de cursistas de
pectiva est sendo perpetuada em muitas 2011 como o de 2012, embora com n-
salas de aula. fases diferentes.
2. Inexistncia de um mtodo cientfico
rgido. Os entrevistados relataram vrias AVALIAO
maneiras de conduzir uma investigao Os professores participantes foram quase
cientfica que fogem do padro observa- unnimes em considerarem essa a ativida-
o-hiptese-teste, tida como o nico de mais proveitosa do curso de aperfeioa-
mtodo cientfico por vrios dos profes- mento. O contato prximo com cientistas e
sores cursistas. Houve relatos de erros a possibilidade de discutir abertamente so-
experimentais que levaram a descobertas bre dvidas e curiosidades sobre a atividade
importantes, observaes que por si s cientfica foram apontados como pontos
renderam publicaes cientficas e outros muito positivos da conversa.
exemplos que chamaram a ateno dos
cursistas quanto aos procedimentos que Muitos dos cursistas afirmaram que essa
os cientistas seguem em seu cotidiano. foi a atividade do curso que mais contri-
buiu para que modificassem sua viso de
3. As influncias socioculturais. Alguns Cincia. Embora no haja dados objetivos
grupos trouxeram exemplos desse tipo que confirmem essa impresso, em comen-
de influncia nas pesquisas, tais como fa- trios escritos e no prprio comportamento

8 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

dos professores, percebe-se que a atividade No entanto, se a turma for menor, a ativida-
constituiu-se em um estmulo muito posi- de pode ser conduzida em outros contextos,
tivo para que busquem perspectivas mais como por exemplo dentro de universidades
modernas sobre a Cincia. Perceberam que ou mesmo nos cursos de licenciatura. Um
a pergunta como funciona a Cincia?, apa- exemplo seria uma universidade que abriga
rentemente to simples, no trivial; vrias um curso de licenciatura, mas abriga do-
das concepes que trouxeram para o curso centes que tambm se dedicam pesquisa
no se confirmaram na fala dos cientistas cientfica e que poderiam ser entrevistados
profissionais. Esse conflito foi altamente po- pelos professores em formao. No ne-
sitivo no s do ponto de vista da reflexo, cessariamente o entrevistado precisa ser da
mas tambm da autoestima, pois os profes- mesma rea que o entrevistador (por exem-
sores valorizaram muito o contato com os plo, um professor de Biologia entrevistar
cientistas. Muito embora os pesquisadores um geneticista); como o foco da entrevista
j tenham se acostumado sua atividade a viso que se tem da Cincia, ela pode ser
cotidiana, vrios professores veem a Cincia proveitosa mesmo se envolver pessoas de
como uma atividade elitizada e distante, e reas diferentes. Essa foi a constatao dos
nunca antes tiveram a oportunidade de con- dois professores de Fsica que participaram
versar de maneira franca com um cientista. da atividade narrada aqui.
Outro comentrio muito frequente en-
tre os cursistas, ao final da atividade, foi a VISO DE CINCIA: MAIS
de que ela contribuiu para a sua formao CLAREZA NECESSRIA
como professor de Cincias. Tampouco Muitos estudiosos do Ensino de Cincias
h dados objetivos que confirmem que, de afirmam que a maioria dos professores de
fato, tornaram-se melhores professores, at Cincias Naturais desconhece a maneira
porque no houve nenhuma anlise de sua de trabalhar dos cientistas, seja por nunca
atividade aps o curso. Contudo, no resta a terem vivenciado durante seu aprendiza-
dvida de que ampliaram seus horizontes e do, seja por terem estudado em perodos em
aproximaram-se de uma ideia mais realista que no se valorizava esse aspecto. Essa ob-
do que seja a atividade cientfica, o que deve servao tambm vale para grande parte dos
contribuir para que adquiram uma viso professores que participaram da atividade.
mais clara da natureza da Cincia. De ma- Mesmo que nunca venha a produzir cincia
neira mais ampla, a atividade estimulou-os a em seu sentido mais estrito, fundamental
refletir sobre a necessidade de aperfeioar-se que o professor de Cincias compreenda
sobre os assuntos que ensinam. claramente que a cincia um processo de
construo coletiva, sujeito a falhas, a in-
POSSIBILIDADES DE terpretaes, a contingncias histricas e
REPRODUO DA ATIVIDADE sociais; do contrrio, teremos um professor
que considera o conhecimento cientfico
A atividade pode ser facilmente reproduzi-
como um conjunto de leis imutveis, e que,
da, pois no requer nenhum material espe-
sem dvida, valorizar esse aspecto enquan-
cfico ou grande infraestrutura; precisa-se
to ensina, transmitindo aos alunos uma vi-
apenas de um cientista. No entanto, eles
so distorcida do que realmente a Cincia.
no so to fceis de encontrar em certas
O resultado um professor que sobrevalo-
realidades.
riza nomenclaturas em detrimento de fe-
Reunies cientficas so as situaes ideais nmenos, colees de fatos em detrimento
para organizar um curso de mais abran- de ideias, frmulas dogmticas em vez de
gncia, como foi o caso relatado aqui, com conhecimento em construo. Professores
quase uma centena de participantes. Os com uma viso de Cincia mais adequada,
organizadores do evento cientfico podem ao contrrio, so capazes de propor situ-
facilmente preparar um momento para que aes de aprendizagem que promovam o
alguns cientistas participantes sejam entre- desenvolvimento dessa viso tambm nos
vistados por professores de Cincias. alunos.

Sociedade Brasileira de Gentica 9


MATERIAIS DIDTICOS

Identificando
o sistema de
acasalamento
em aves*
Carolina da Silva Carvalho1,2; Maria Augusta Carvalho1,2;
Rosane Garcia Collevatti1,2
1
Laboratrio de Gentica & Biodiversidade, ICB,
Universidade Federal de Gois, Goinia.
2
Programa de Ps-Graduao em Ecologia e Evoluo, ICB,
Universidade Federal de Gois, Goinia.

Autor para correspondncia: rosanegc68@hotmail.com.

*Material didtico desenvolvido na disciplina Ecologia Molecular, coordenado pela Professora Rosane
Garcia Collevatti, do curso de graduao em Ecologia e Anlise Ambiental do Departamento de Eco-
logia, Instituto de Cincias Biolgicas, Universidade Federal de Gois, como uma atividade do Estgio
Docncia (bolsistas CAPES) das discentes do Programa de Ps-graduao em Ecologia e Evoluo.

10 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

A atividade, apropriada para estudantes de ensino superior,


tem por objetivo estudar um caso de ecologia molecular,
simulando a anlise de dados moleculares referentes sexagem
de aves e anlise de paternidade de filhotes provenientes
de ninhos de diferentes casais. A metodologia possibilita
a inferncia do comportamento da espcie em questo. A
atividade auxilia a compreenso de conceitos bsicos de
Gentica, Ecologia e Comportamento Animal.

Sociedade Brasileira de Gentica 11


MATERIAIS DIDTICOS

FUNO PEDAGGICA culdade em observar comportamentos crp-


ticos. Alm disso, muitas espcies no apre-
A principal funo da atividade proposta
trabalhar conceitos bsicos de Genti-
ca para a soluo de um problema hipottico
sentam dimorfismo sexual, o que dificulta
ainda mais este tipo de estudo. Neste senti-
do, a Ecologia Molecular pode auxiliar a en-
de comportamento sexual de uma espcie de tender o comportamento sexual em diversas
ave. A atividade simula a determinao mole- espcies quando so usados, por exemplo,
cular do sexo dos indivduos e a paternidade marcadores moleculares codominantes e os
de filhotes oriundos de ninhos de diferentes princpios de segregao mendeliana.
casais possibilitando que os estudantes de
ensino superior relacionem e apliquem con- Um pesquisador estudou o sistema de aca-
ceitos bsicos de gentica como gentipo, salamento de uma determinada espcie de
segregao de alelos, caracterizao de esp- ave do Cerrado brasileiro. A partir de ob-
cies, manipulao e caracterizao de cidos servaes em campo, ele identificou a forma-
nucleicos. o de casais durante a estao reprodutiva
e concluiu que a espcie possui sistema de
OBJETIVO acasalamento monogmico. No entanto, ele
observou a presena de outros indivduos
O objetivo da atividade entender que, de-
prximos aos ninhos destes casais, principal-
vido segregao de alelos na formao dos
mente durante o perodo em que o macho
gametas pelos parentais, para lcus que se-
do par monogmico voava para se alimentar.
gregam independentemente, a prole dever
Desta forma, a simples observao no pos-
apresentar um alelo de cada genitor, ou seja,
sibilitou determinar se a espcie estudada
um alelo proveniente do gameta materno e
era monogmica ou monogmica social com
um alelo do gameta paterno. Dessa forma,
ocorrncia de acasalamento extrapar, ou seja,
conhecendo o gentipo da me, e dos filho-
acasalamento com parceiro(s) diferente(s)
tes, o estudante poder determinar se o pai
do parceiro social. Para poder decidir entre
o parceiro social da fmea presente no ninho
as duas possibilidades acima referidas, o pes-
ou no, identificando deste modo se h aca-
quisador decidiu usar uma estratgia de an-
salamento extrapar.
lise molecular de paternidade entre os casais
e os filhotes. O procedimento est abaixo
PROBLEMA PROPOSTO descrito:
Os sistemas de acasalamento em aves podem
1. Trs diferentes ninhos recm-construdos
ser resumidos em trs principais tipos, de
e que eram cuidados por trs casais dife-
acordo com (ALCOCK, 2005):
rentes foram marcados.
a. monogmico: nas relaes monogmicas,
2. Penas dos pais e dos filhotes dos ninhos
casais de sexos opostos so formados por
selecionados foram coletadas para extra-
toda a estao reprodutiva, em alguns ca-
o de DNA e caracterizao gentica por
sos, por toda a vida.
meio de marcadores moleculares.
b. poligmico: no sistema reprodutivo poli- Marcador molecular
3. No laboratrio, amostras de DNA foram um fragmento de DNA,
gmico, o acasalamento pode ocorrer en- oriundo de um segmento
extradas das penas coletadas. Como a es-
tre um macho e vrias fmeas denomi- especfico do genoma,
pcie no tem dimorfismo sexual, foi ne-
nado poliginia; ou uma fmea ter acesso a expresso ou no, utilizado para
cessrio fazer a identificao sexual com o identificar uma regio particular
vrios machos, - denominado poliandria.
uso de marcadores moleculares de genes do genoma (FERREIRA,
c. promscuo: no sistema de acasalamento ligados aos cromossomos sexuais. Nas GRATTAPAGLIA, 1996).
promscuo, fmeas e machos podem aca- aves, isto possvel porque o sistema de
salar com vrios indivduos durante uma determinao sexual do tipo ZW, sen-
mesma estao reprodutiva. do a fmea heterogamtica, com cromos-
No entanto, a identificao em campo do somos Z e W, e o macho homogamtico,
tipo de sistema de acasalamento requer um com dois cromossomos Z. Dois genes,
esforo muito grande por parte de bilogos CHD-W e CHD-Z, localizados nos cro-
e eclogos devido, em grande parte, difi- mossomos sexuais das aves, foram utiliza-

12 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

A reao da polimerase em dos. CHD-W localiza-se no cromossomo genoma (Painel 3). Como o marca-
cadeia (Polymerase Chain W, presente portanto apenas em fmeas; dor molecular microssatlites co-
Reaction) denominada PCR e CHD-Zno cromossomo Z, presente dominante, indivduos que possuem
uma reao enzimtica na
qual uma regio especfica de em ambos os sexos (GRIFFITHS et al, somente uma banda no gel de polia-
DNA, um lcus, amplificada 1998). Segmentos dos referidos genes crilamida so homozigotos, ou seja,
muitas vezes, permitindo assim foram amplificados pelo pesquisador por possuem o mesmo alelo em ambos
a identificao de diferenas no meio da tcnica da PCR. Em seguida, os os cromossomos; indivduos que
DNA dos indivduos.
fragmentos obtidos aps amplificao fo- possuem duas bandas so heterozi-
Eletroforese
ram fracionados por eletroforese. O gel gotos, ou seja, possuem diferentes
uma tcnica de separao de de agarose utilizado na eletroforese foi alelos nos cromossomos.
molculas com base na migrao corado para possibilitar a visualizao dos
das molculas ou de fragmentos fragmentos gerados pela PCR. INSTRUES PARA O
ionizados em um campo eltrico.
No caso da separao de O perfil de bandas obtidas aps separao PROFESSOR
fragmentos de DNA, a mistura eletrofortica em gel de agarose, para cada 1. Esta atividade poder ser realizada indivi-
aplicada em uma matriz ou conjunto de adultos dos trs ninhos, est
gel (geralmente agarose ou dualmente ou em grupos de alunos de, no
acrilamida, dependendo do esquematizado no Painel 1. mximo, trs pessoas.
tamanho dos fragmentos a 4. Em seguida, para determinar o sistema
serem separados) na presena de
2. Cada grupo dever receber o problema
uma soluo inica tamponada.
de acasalamento o pesquisador utilizou proposto, uma cpia do procedimento
o mtodo de paternidade por excluso, para realizar a atividade, uma cpia dos
que consiste na comparao do gentipo painis onde esto esquematizados os gis
Gentipo
a constituio gentica (alelos) da prole com o da me e dos candidatos de agarose. Aps a anlise dos painis, o
de um indivduo para um ou a pais. Como em um filhote, metade dos professor dever entregar para cada grupo
mais lcus. cromossomos foi herdado da me e, a ou- uma srie de questes para ser discutida.
Alelos
tra metade, do pai, o candidato a pai que
no tiver metade dos seus cromossomos 3. recomendvel que o professor aplique
so formas alternativas de um
mesmo gene ou de um marcador igual metade dos cromossomos da prole esta atividade em turmas que j tiveram
molecular. excludo de ser o pai. Para determinar contato prvio com os conceitos de es-
os gentipos de todos os envolvidos, o trutura e organizao do material genti-
Microssatlites
pesquisador escolheu marcadores mole- co, marcadores moleculares e segregao
so unidades de repetio
de pares de bases do DNA, culares do tipo microssatlites. Como mendeliana.
dispersas no genoma. Por os marcadores microssatlites so codo-
exemplo, (CA)10 uma
minantes e tm uma taxa de mutao PROCEDIMENTO PARA OS
sequncia dos nucleotdeos
contendo as bases nitrogenadas relativamente alta, possvel utiliz-los ESTUDANTES
citosina (C) e adenina (A), para identificao individual, sendo assim, 1. Ler com ateno o problema proposto.
repetida 10 vezes em tandem. apropriados para resolver problemas de
As regies de microssatlites
paternidade. O pesquisador determinou o 2. Analisar o painel 1: representao esque-
tm taxa de mutao muito alta mtica do gel de agarose com os gentipos
e so altamente polimrficas, gentipo, de todos os adultos e filhotes co-
por isso os microssatlites so letados, para dois lcus de microssatlites, dos adultos dos ninhos 1, 2 e 3 para os
considerados bons marcadores como descrito a seguir: lcus dos genes CHD-W e CHD-Z.
moleculares para discriminar
indivduos (FREELAND, 2005). 4.1. Amostras de DNA dos diferentes in- 3. A partir da leitura dos gentipos, trans-
divduos foram submetidas tcnica crever o sexo dos indivduos dos trs ni-
Marcadores moleculares nhos para o Painel 2.
de PCR, com o objetivo de amplificar
codominantes
so marcadores que permitem segmentos de dois lcus de micros- Questo 1. Quantos e quais indivduos
identificar os alelos presentes satlites. Os fragmentos gerados pela so machos e quantos e quais indivduos
nos lcus estudados, ou seja, PCR so separados por eletroforese so fmeas? Como foi possvel chegar a
permitem distinguir indivduos em gel de poliacrilamida e, as ban-
homozigotos e heterozigotos
esta concluso?
(FREELAND, 2005). das, evidenciadas por colorao com
Questo 2. Como possvel fazer a iden-
nitrato de prata. Para cada conjunto
Lcus tificao sexual utilizando padres de
dos trs ninhos amostrados (Adulto
uma regio especfica do bandas em gel de agarose?
cromossomo, onde se localiza
A, Adulto B, Prole 1 a 5), foi obtido
um gene ou um marcador o perfil eletrofortico para dois l- 4. Analisar os Painis 3.1, 3.2 e 3.3; repre-
molecular. cus, os de regies microssatlites do sentao esquemtica dos gis de poliacri-

Sociedade Brasileira de Gentica 13


MATERIAIS DIDTICOS

lamida, corados com nitrato de prata, para Questo 3. Qual foi o sistema de acasa-
dois lcus microssatlites. lamento da espcie estudada? Como voc
chegou a esta concluso?
5. Interpretar os resultados genotpicos e
transcrev-los para os Painis 4.1, 4.2 e Questo 4. Justifique a utilizao de mar-
4.3. cadores microssatlites para realizar a
anlise de paternidade.
RESPOSTAS
Questo 1.

Ninho Ind A Ind B Ninho Ind A Ind B Ninho Ind A Ind B


1 Fmea Macho 2 Macho Fmea 3 Macho Fmea
Questo 2. possvel fazer a identificao sexual utilizando padres de banda em gel de aga-
rose, pois os cromossomos sexuais so distintos entre machos e fmeas. Em aves, por exemplo,
o sistema de determinao sexual do tipo ZW, com fmeas heterogamticas (ZW) e machos
homogamticos (ZZ). Assim, utilizando marcadores moleculares de genes localizados nos cro-
mossomos sexuais possvel identificar o sexo dos indivduos. No caso das aves, as fmeas
apresentaro duas bandas no gel de agarose, pois os dois genes (CHD-W e CHD-Z) sero am-
plificados. Os machos apresentaro apenas uma banda, pois s o gene CHD-Z amplificado.
Questo 3.
Ninho 1 Ind A Ind B Prole 1 Prole 2 Prole 3 Prole 4 Prole 5
Lcus 1 BB CC BC BB BC BD BC
Lcus 2 EG GG EG EE GG GG EG

Ninho 2 Ind A Ind B Prole 1 Prole 2 Prole 3 Prole 4 Prole 5


Lcus 1 CD AA AC AC AD AB AC
Lcus 2 EH FG FH FG EG GH GH

Ninho 3 Ind A Ind B Prole 1 Prole 2 Prole 3 Prole 4 Prole 5


Lcus 1 CC AB AC AC AC BC BC
Lcus 2 FH GG GH FG EG FG GH
O sistema de acasalamento encontrado foi o monogmico social, mas com ocorrncia de aca-
salamento extrapar. Nos trs ninhos estudados foram encontrados indivduos da prole que
tinham alelos oriundos apenas da me e, portanto, no poderiam ser filhos do parceiro social.
No possuem os alelos do pai: no ninho 1, os indivduos da prole 2 e 4; no ninho 2, os indiv-
duos da prole 2 e 4; no ninho 3, o indivduo da prole 3.
Questo 4. O pesquisador optou por utilizar o marcador microssatlite para anlise de pa-
ternidade pois este marcador multiallico, ou seja, possui muitos alelos, o que permite a
discriminao dos indivduos e identificao dos parentais.

REFERNCIAS FREELAND, J. Molecular Ecology. Chichester,


John Wiley & Sons, 388 p. 2005.
ALCOCK, J. Animal Behavior: An Evolutionary
Approach.Sunderland, Massachussets 8th GRIFFITHS, R.; DOUBLE, M.C.; ORR, K.;
ed. Sinauer Associates Inc. 564 p. 2005. DAWSON, R.J.G. A DNA test to sex most
birds. Molecular Ecology, v. 7, p. 1071-1075,
FERREIRA, M. E.; GRATTAPAGLIA, D. In-
1998.
troduo ao uso de marcadores moleculares
em anlise gentica. Embrapa CENAR- WEIR, B.S. Genetic Data Analysis II. Sunder-
GEN, Braslia, 220 p. 1996. land, Massachussets, Sinauer Associates
Inc., 445 p.1996.

14 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

Painel 1.
Esquema dos gis de agarose
para os genes CHD-W e CHD-Z
utilizados na sexagem dos
parentais de cada ninho.

CHD Ind A Ind B Ind A Ind B Ind A Ind B


Z
Ninho 1 Ninho 2 Ninho 3

W

Painel 2.
Tabela dos gentipos para os
genes CHD-W e CHD-Z, para
determinao do sexo.

Ind A Ind B Ind A Ind B Ind A Ind B


Ninho 1 Ninho 2 Ninho 3

Sociedade Brasileira de Gentica 15


MATERIAIS DIDTICOS

Painis 3.
Esquemas de gis de poliacrilamida para dois lcus
microssatlites, Lcus 1 e Lcus 2, para os adultos,
A e B, e sua prole, (Prole 1 a Prole 5), para os trs Painel 3.1.
ninhos amostrados. Esquema de gis dos
indivduos adultos e filhotes
do Ninho 1 para os lcus 1
e 2.

Ninho 1 Ind A Ind B Prole 1 Prole 2 Prole 3 Prole 4 Prole 5


Alelo A
Alelo B
Lcus 1
Alelo C
Alelo D
Alelo E
Alelo F
Lcus 2
Alelo G
Alelo H

Painel 3.2.
Esquema de gis dos
indivduos adultos e filhotes
do Ninho 2 para os lcus 1
e 2.

Ninho 2 Ind A Ind B Prole 1 Prole 2 Prole 3 Prole 4 Prole 5


Alelo A
Alelo B
Lcus 1
Alelo C
Alelo D
Alelo E
Alelo F
Lcus 2
Alelo G
Alelo H

Painel 3.3.
Esquema de gis dos
indivduos adultos e filhotes
do Ninho 3 para os lcus 1
e 2.

Ninho 3 Ind A Ind B Prole 1 Prole 2 Prole 3 Prole 4 Prole 5


Alelo A
Alelo B
Lcus 1
Alelo C
Alelo D
Alelo E
Alelo F
Lcus 2
Alelo G
Alelo H

16 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

Painis 4.
Tabelas dos gentipos para os dois lcus
microssatlites, Lcus 1 e Lcus 2, para os adultos,
Ind A e Ind B, e sua proles (Prole 1 a Prole 5), para
os trs ninhos amostrados.

Painel 4.1.
Gentipos dos indivduos
adultos e filhotes do Ninho
1 para os Lcus 1 e 2.

Ninho 1 Ind A Ind B Prole 1 Prole 2 Prole 3 Prole 4 Prole 5


Lcus 1
Lcus 2

Painel 4.2.
Gentipos dos indivduos
adultos e filhotes do Ninho
2 para os Lcus 1 e 2.

Ninho 2 Ind A Ind B Prole 1 Prole 2 Prole 3 Prole 4 Prole 5


Lcus 1
Lcus 2

Painel 4.3.
Gentipos dos indivduos
adultos e filhotes do Ninho 3
para os Lcus 1 e 2.

Ninho 3 Ind A Ind B Prole 1 Prole 2 Prole 3 Prole 4 Prole 5


Lcus 1
Lcus 2

Sociedade Brasileira de Gentica 17


MATERIAIS DIDTICOS

Disperso do plen entre pequizeiros:


uma atividade para a gentica
no ensino superior*

Rosane Garcia Collevatti; Mariana Pires de Campos Telles; Thannya Nascimento Soares
Laboratrio de Gentica & Biodiversidade, Instituto de Cincias Biolgicas, Universidade Federal de Gois, Goinia.

Autor para correspondncia: Rosane Garcia Collevatti, rosanegc68@hotmail.com

*Material didtico desenvolvido no contexto do projeto Ncleo de Excelncia em Gentica e Conservao de Espcies do Cerrado (GECER), que recebe apoio financeiro
do PRONEX/FAPEG/CNPq (07/2009)

18 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

N esta atividade apresentada uma abordagem para determinar a distncia de


disperso de plen em uma populao de plantas, utilizando os princpios
bsicos da Gentica. A determinao da distncia de disperso de plen realizada
a partir da anlise de paternidade de sementes com base no polimorfismo de
marcadores moleculares do tipo microssatlites. A aplicao desta atividade
proporciona a discusso e consolidao de alguns conceitos em gentica, tais como
os princpios de segregao e variabilidade gentica em populaes.

FUNO PEDAGGICA parao, imersa em soluo tampo, sob cor-


rente eltrica (veja explicaes bastante di-
O principal objetivo da atividade pro-
posta mostrar como a distncia de
disperso de plen pode ser determinada
dticas em MARTINEZ E PAIVA, 2008 e
SANTOS-FILHO, 2011). Uma vantagem
desses marcadores para a anlise de paterni-
utilizando os princpios bsicos de Gentica.
dade que ele apresenta padro de herana
Para tanto, torna-se necessrio a determina-
codominante, ou seja, permitem a identifica-
o da paternidade das sementes oriundas de
o precisa de homozigotos e heterozigotos,
diferentes rvores-me (matrizes) e tambm
o que por sua vez maximiza a probabilidade
de algumas provedoras de plen em poten-
de identificao da origem parental dos ale-
cial. A determinao de paternidade pode ser
los. Para saber mais sobre a anlise de pater-
realizada de uma maneira simples, utilizan-
nidade, com base em marcadores molecula-
do o princpio da excluso de paternidade,
res, veja CAMPOS et al, (2010).
com base no polimorfismo de marcadores
moleculares (WEIR 1996). Caryocar brasiliense, o pequi, uma impor-
tante planta do Cerrado, cujo fruto muito
PROBLEMA PROPOSTO consumido pela comunidade local do Cen-
O fluxo gnico em populaes de plantas tro-Oeste, sendo uma fonte de renda com-
ocorre durante as geraes gametoftica e plementar para agricultores familiares que
esporoftica, portanto, atravs da disperso o comercializam nas feiras livres. A espcie
do plen e da semente. Uma das questes hermafrodita e polinizada por morcegos.
importantes da gentica de populaes a Suas sementes so dispersas por mamferos,
determinao da distncia de disperso de tais como a anta e o veado campeiro, alm da
plen dentro de uma populao, uma vez ema. Sendo assim, a espcie apresenta gran-
que esse padro tem implicaes diferentes de importncia econmica e ecolgica por
para o manejo e a conservao das espcies servir como fonte de alimento para muitas
nativas. O estudo de disperso de plen espcies da fauna do Cerrado (VIEIRA et
pode ser realizado por uma abordagem ge- al, 2006).
ntica que utiliza os marcadores moleculares, Nesta atividade foi proposta a determinao
principalmente do tipo microssatlites, para da distncia de plen em uma populao de
identificar as provveis origens do plen para pequi, oriunda de um fragmento remanes-
a prognie. Os marcadores microssatlites cente de Cerrado. Neste fragmento foram en-
Foto: Rosane Garcia Collevatti se baseiam no polimorfismo de sequncias contradas trs rvores com frutos (matrizes)
repetitivas em tandem no genoma, conten- e outras oito que produziram flores, mas no
do motivos compostos de um a seis nucle- produziram frutos, sendo consideradas ape-
otdeos. Os marcadores microssatlites so nas provedoras de plen em potencial (Painel
facilmente detectados utilizando-se a tcnica 1). De cada matriz foram coletadas quatro se-
de eletroforese, que se baseia na migrao de mentes para a determinao da paternidade,
fragmentos de DNA em uma matriz de se- a partir da qual ser calculada a distncia de

Sociedade Brasileira de Gentica 19


MATERIAIS DIDTICOS

disperso de plen. Para tanto, os gentipos 4. Painel 4 tabela para os resultados da


das matrizes, sementes e provveis fontes determinao das rvores que forneceram
de plen foram obtidos pela anlise de dois o plen e as distncias de disperso de p-
lcus de microssatlites. Para cada conjunto len na populao avaliada, para os dados
(matriz, sementes e fontes de plen poten- das matrizes M1, M2 e M3.
cial) amostrado foi obtido um perfil eletrofo-
A turma dever ser dividida em 3 grupos.
rtico para estes dois lcus (Painel 2).
Os painis sero distribudos separando os
Foi excluda a possibilidade de autopoliniza- dados de uma matriz para cada grupo da se-
o, ou seja, que a rvore matriz seja a pr- guinte forma:
pria fonte de plen. A autopolinizao pode
Grupo 1: Painis 1, 2.1, 3.1 e 4
acontecer porque a planta hermafrodita, ou
seja, possui flores com os dois sexos. Alm Grupo 2: Painis 1, 2.2, 3.2 e 4
disso, as rvores matrizes tambm foram ex- Grupo 3: Painis 1, 2.3, 3.3 e 4
cludas como potenciais fontes de plen para
outras plantas-me.
PROCEDIMENTO
DISTRIBUIO DO MATERIAL PARA OS GRUPOS
1. A partir dos gis do Painel 2, anotar os
AOS GRUPOS gentipos de cada indivduo (matriz, se-
Para determinar a paternidade e a distncia mentes e doadoras de plen) no Painel 3.
de disperso de plen deve-se: Escrever na tabela os nmeros dos alelos
1. Obter os gentipos de todas as rvores presentes em cada indivduo, para cada
adultas e das sementes. lcus. Como o marcador microssatlite
codominante, sero observados no gel
2. A partir dos gentipos, determinar qual
para cada indivduo, no mximo dois
a rvore de onde provem o plen mais
alelos por lcus. Aqueles indivduos que
provvel para cada semente.
apresentarem uma banda (alelo) no gel
3. Determinar a distncia (em metros) de so considerados homozigotos para tal l-
disperso de plen para cada semente, a cus. Aqueles que apresentarem duas ban-
mdia para cada matriz e a mdia e a vari- das (alelos diferentes) so heterozigotos.
ncia para a populao estudada. Exemplo: Matriz M1, Lcus A, gentipo
1/1, lcus B, gentipo 3/4.
Os recursos didticos que devero ser utiliza-
dos consistem em quatro painis, conforme 2. Utilizar os gentipos do Painel 3 para de-
descrito a seguir e todos os grupos devero terminar, para cada semente, qual a pro-
receber uma cpia de cada painel (material cedncia do plen e anotar no Painel 4.
do Apndice): Para determinar a procedncia do plen,
os grupos devero utilizar o princpio da
1. Painel 1 croqui dos indivduos da po-
excluso de paternidade: a semente deve,
pulao em escala 1:100 cm;
necessariamente, ter um alelo herdado da
2. Painel 2 representao esquemtica da rvore-me (matriz) e outro herdado da
eletroforese de dois gis, contendo as in- provvel provedora do plen. Assim, os
formaes dos lcus l A e B para os dados grupos devero, primeiro, verificar qual
das matrizes M1, M2, M3. Em cada gel, alelo foi herdado da rvore-me e, depois,
as amostras foram aplicadas na seguinte identificar, dentre as potenciais provedo-
ordem: Matriz (M1, M2 e M3), semen- ras de plen, aquela que possui um alelo
tes (S1 a S4) e potenciais fontes de plen igual ao outro alelo observado na semen-
(PD1 a PD8); te. A rvore provedora de plen que no
3. Painel 3 tabela para os gentipos de possuir o alelo igual ao da semente auto-
todos os indivduos analisados na popu- maticamente excluda da paternidade. Os
lao, separados em matrizes M1, M2 e grupos devero fazer este procedimento
M3; para os dois lcus.

20 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

Dessa forma, podero acontecer trs si- nidade desta semente pode ser utilizado para
tuaes, excluindo os alelos herdados da descobrir de qual rvore procede o plen para a
rvore-me: formao de cada semente e avaliar a contribui-
o da disperso do plen para o fluxo gnico.
uma rvore potencial provedora de p-
Sabendo-se qual a rvore, de onde provem o
len possui os mesmos alelos que a se-
plen, pode-se inferir a distncia de polinizao
mente, para os dois lcus - portanto, a
pela distncia entre a rvore-me da semente e
mais provvel provedora do plen;
a provedora de plen. A distncia da disperso
uma rvore potencial provedora de p- de plen indica o alcance do polinizador dentro
len possui um alelo igual ao da semente da populao e, deste alcance, possvel se fa-
para um lcus e um alelo diferente para zer inferncias sobre a dinmica do fluxo gnico
o outro lcus, portanto, excluda como via plen na espcie em questo. Esta dinmica
provvel fonte do plen; est, por sua vez, ligada ao potencial evolutivo e
uma rvore potencial provedora de p- ao de persistncia da populao.
len possui os alelos diferentes dos da 2. Por que foi escolhido o marcador micros-
semente para os dois lcus, portanto, satlite para a anlise de paternidade das
tambm excluda como provvel prove- sementes?
dora do plen.
O marcador microssatlite foi escolhido por ser
3. Aps preencher o Painel 4 com as de- altamente polimrfico, ou seja, apresentar mui-
terminaes das provveis procedncias tos alelos dentro de uma populao, e por ser
de plen, os grupos devero preencher a um marcador molecular que apresenta padro
quarta coluna do Painel 4 com a distn- de herana codominante. Desta forma, pos-
cia entre a rvore-me e a fonte do plen. svel distinguir os alelos herdados da me dos
Para isso, devero medir a distncia entre herdados do pai. Esta identificao dos alelos
as rvores do Painel 1, utilizando uma dos parentais na prole torna possvel a determi-
rgua. A distncia dever ser convertida nao da paternidade com alta probabilidade
para metros, utilizando a escala no mapa de excluso e baixa probabilidade de identidade
e anotada no Painel 4. Esta distncia re- gentica.
presenta a distncia de disperso de plen
3. Todas as sementes tiveram sua paternida-
para cada semente de cada rvore-me.
de definida? Qual a provvel causa de no
4. A partir das distncias entre as rvores- determinao da paternidade?
-me e as provedoras de plen, os grupos
No. A semente 2 da matriz 3 no teve sua
devero calcular a distncia mdia de dis-
paternidade definida. Uma provvel causa dis-
perso de plen para cada matriz na po-
to est relacionada com a amostragem, ou seja,
pulao avaliada, anotando na quinta co-
com a origem do plen desta semente que pode
luna do Painel 4.
no ter sido amostrada durante a coleta, uma
5. Os grupos devero ento se reunir e cal- vez que nestes estudos normalmente no poss-
cular juntos a distncia mdia e varincia vel fazer um censo da populao, mas sim uma
de disperso de plen para a populao amostragem de parte dos indivduos. Outro
avaliada. motivo pode ser a imigrao de plen de outra
populao adjacente, ou seja, o plen desta se-
ENTENDENDO A ATIVIDADE mente pode ser oriundo de uma rvore provedo-
1. Como a anlise de paternidade pode ser ra de plen de outra populao fora dos limites
utilizada para avaliar a distncia de dis- do fragmento onde a populao de estudo se
perso de plen em populaes de plan- encontra. Este resultado esperado neste tipo
tas? E o que significa a distncia de disper- de estudo, principalmente considerando que o
so de plen? polinizador do pequizeiro o morcego que tem
capacidade de voo a longas distncias.
O fluxo gnico em plantas pode ser avalia-
do pela movimentao do plen e ou semente 4. Todas as potenciais provedoras de plen
dentro da populao. Uma vez que as sementes apresentaram pelo menos uma semente
Foto: Rosane Garcia Collevatti
so colhidas nas rvores-mes, o teste de pater- como filha? Qual a provvel causa de uma

Sociedade Brasileira de Gentica 21


MATERIAIS DIDTICOS

planta no participar dos eventos de re- de polinizao utilizado para se inferir uma
produo na populao? rea onde esperado encontrar um parentesco
maior entre as plantas que esto dentro desta
No. A rvore DP7 no contribuiu para a for-
rea. Quanto maior a distncia mdia, maior
mao de nenhuma das sementes amostradas.
ser o tamanho de vizinhana gentica da po-
Uma possvel explicao para este fato a baixa
pulao e menor o parentesco entre as plantas
produo de flores por esta rvore, o que fez com
dentro da rea.
que sua participao na oferta de plen para a
fecundao ter ficado prejudicada. Outra ex- A varincia, por outro lado, uma medida de
plicao o nmero de sementes amostradas. disperso dos valores individuais em relao
Como o nmero foi pequeno, h uma alta pro- sua mdia. Nesta atividade, a varincia ir
babilidade de no amostrar sementes produzi- mostrar a variao do alcance mdio de poli-
das por esta rvore. nizao. Embora a mdia de distncia de dis-
perso entre as matrizes seja de 13,9 m existe
5. O que os valores estimados de mdia e
uma varincia de 38,33 m2, o que indica uma
varincia da distncia de disperso signi-
grande variao nas distncias de disperso do
ficam?
plen. Como a varincia uma medida qua-
A mdia indica uma tendncia central dentro drtica, costuma-se usar em seu lugar uma me- Painis 3.
dos valores obtidos. Assim, as mdias de dis- dida linearizada, escalarmente comparvel Tabelas de gentipos para as
tncias de disperso por matriz indicam esta mdia: trata-se do desvio padro, que obtido matrizes (M1, M2 e M3), sua
tendncia dentro da rvore, ou seja, o alcance tirando-se a raiz quadrada do valor da vari- prognie (S1 a S4), e as oito
mdio de polinizao para cada rvore-me, potenciais procedncias do
ncia. Para a medida acima, o desvio padro plen (DP1 a DP8), para os dois
enquanto que a mdia populacional indica toma o valor de 6,19 m, que considerado alto lcus microssatlites A e B.
a tendncia central do alcance de polinizao por ser da ordem de aproximadamente 50% do
na populao como todo. Este alcance mdio Painel 3.1.
valor da mdia. Gentipos da Matriz 1
(M1) e sua prognie (S1 a
S4) com as oito potenciais
RESPOSTAS DA ATIVIDADE procedncias do plen (DP1
a DP8), para os lcus A e B.

Gentipos M1 S1 S2 S3 S4 DP1 DP2 DP3 DP4 DP5 DP6 DP7 DP8


Lcus A 1/1 1/4 1/2 1/3 1/4 3/3 2/3 1/1 3/4 2/2 1/4 2/3 4/4
Lcus B 3/4 3/5 2/3 3/4 2/4 2/4 2/5 1/5 5/5 3/3 2/4 5/5 1/1

Painel 3.2.
Gentipos da Matriz 2
(M2) e sua prognie (S1 a
S4) com as oito potenciais
procedncias do plen (DP1
a DP8), para os lcus A e B.

Gentipos M2 S1 S2 S3 S4 DP1 DP2 DP3 DP4 DP5 DP6 DP7 DP8


Lcus A 2/4 1/2 1/4 2/4 1/2 3/3 2/3 1/1 3/4 2/2 1/4 2/3 4/4
Lcus B 2/5 1/2 1/5 2/3 1/2 2/4 2/5 1/5 5/5 3/3 2/4 5/5 1/1

Painel 3.3.
Gentipos da Matriz 3
(M3) e sua prognie (S1 a
S4) com as oito potenciais
procedncias do plen (DP1
a DP8), para os lcus A e B.

Gentipos M3 S1 S2 S3 S4 DP1 DP2 DP3 DP4 DP5 DP6 DP7 DP8


Lcus A 1/3 1/2 3/3 3/4 3/3 3/3 2/3 1/1 3/4 2/2 1/4 2/3 4/4
Lcus B 3/4 3/3 1/3 1/4 3/4 2/4 2/5 1/5 5/5 3/3 2/4 5/5 1/1

22 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

Painel 4. Provedor Distncia de disperso Mdia da distncia de


Resultado final de determinao Matriz Semente
da procedncia do plen e de plen de plen (m) disperso de plen (m)
distncia de disperso de plen M1 S1 DP4 13,3
para cada semente (S1 a S4)
de cada rvore matriz (M1, M2 M1 S2 DP2 12,5
9,575
e M3). M1 S3 DP1 6,5
M1 S4 DP6 6,0
M2 S1 DP3 21,3
M2 S2 DP3 21,3
19,150
M2 S3 DP3 21,3
M2 S4 DP5 12,7
M3 S1 DP5 17,2
M3 S2 - -
12,667
M3 S3 DP8 4,8
M3 S4 DP1 16,0
Distncia mdia e varincia de disperso de plen para a populao avaliada:
Distncia mdia: 13,9 m
Varincia: 38,33 m

REFERNCIAS slia: Embrapa Recursos Genticos e Biotec-


nologia, 2006. 320 p.
CAMPOS, C. K. P.; SIQUEIRA, M. N.; BOR-
GES, J. P.; RODRIGUES, L. A.; OLIVEI- MARTINEZ, E. R. M.; PAIVA, L. R. S. Eletro-
RA, J. S.; ROSA, M. A.; NEVES, A. F. forese de cidos nucleicos: uma prtica para
Exames de paternidade pelo DNA: uma me- o ensino de gentica. Gentica na Escola, v. 3,
todologia para ensino da gentica molecular. n. 1, p. 43-48, 2011.
Gentica na Escola, v. 5, n. 2, p. 7-13, 2010. SANTOS-FILHO, F. S. Eletroforese: uma im-
VIEIRA, R. F.; COSTA, T. S. A.; SILVA, D. B.; portante ferramenta da gentica. Gentica
FERREIRA, F. R.; SANO, S. M. (editores) na Escola, v. 6, n. 2, p. 43-45, 2011.
Frutas nativas da regio Centro-Oeste. Bra-

Sociedade Brasileira de Gentica 23


MATERIAIS DIDTICOS

PAINIS
Painel 1.
Mapa das matrizes (M1, M2 e
M3) e potenciais procedncias
do plen (DP1 a DP8) em escala
de 1:100 cm.

Painis 2.
Esquemas de gis de eletroforese para dois lcus
microssatlites, A e B, para as trs rvores matrizes,
M1, M2 e M3, sua prognie, S1 a S4, e as potenciais
procedncias do plen, DP1 a DP8. Painel 2.1.
Esquema de gel de
eletroforese para a matriz 1
(M1) e sua prognie (S1 a
S4) com as oito potenciais
procedncias do plen (DP1
a DP8).

24 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

Painel 2.2.
Gel de eletroforese para a
matriz 2 (M2) e sua prognie
(S1 a S4) com as oito
potenciais procedncias do
plen (DP1 a DP8).

Painel 2.3.
Esquema de gel de
eletroforese para a matriz 3
(M3) e sua prognie (S1 a
S4) com as oito potenciais
procedncias do plen (DP1
a DP8).

Sociedade Brasileira de Gentica 25


MATERIAIS DIDTICOS

Painis 3.
Tabelas de gentipos para as matrizes (M1, M2 e
M3), sua prognie (S1 a S4), e as oito potenciais
procedncias do plen (DP1 a DP8), para os dois
lcus microssatlites A e B.

Painel 3.1.
Gentipos da matriz 1
(M1) e sua prognie (S1 a
S4) com as oito potenciais
procedncias do plen (DP1
a DP8), para os lcus A e B.

Gentipos M1 S1 S2 S3 S4 DP1 DP2 DP3 DP4 DP5 DP6 DP7 DP8

Lcus A

Lcus B

Painel 3.2.
Gentipos da matriz 2
(M2) e sua prognie (S1 a
S4) com as oito potenciais
procedncias do plen (DP1
a DP8), para os lcus A e B.

Gentipos M2 S1 S2 S3 S4 DP1 DP2 DP3 DP4 DP5 DP6 DP7 DP8

Lcus A

Lcus B

Painel 3.3.
Gentipos da matriz 3
(M3) e sua prognie (S1 a
S4) com as oito potenciais
procedncias do plen (DP1
a DP8), para os lcus A e B.

Gentipos M3 S1 S2 S3 S4 DP1 DP2 DP3 DP4 DP5 DP6 DP7 DP8

Lcus A

Lcus B

26 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

Painel 4.
Resultado final de determinao
da procedncia do plen e da
distncia de disperso de plen
para cada semente (S1 a S4)
de cada rvore matriz (M1, M2
e M3).

Doadora Distncia de disperso Mdia da distncia de disperso


Matriz Semente
de plen de plen (m) de plen (m)

M1 S1

M1 S2

M1 S3

M1 S4

M2 S1

M2 S2

M2 S3

M2 S4

M3 S1

M3 S2

M3 S3

M3 S4

Foto: Rosane Garcia Collevatti

Sociedade Brasileira de Gentica 27


MATERIAIS DIDTICOS

Identificao de espcie
e do seu local de origem
para a resoluo de
crimes contra a fauna
brasileira: uma atividade
para o ensino de
gentica forense*
Carolina da Silva Carvalho1,2; Maria Augusta Guimares Carvalho1,2; Rosane Garcia Collevatti1,2
1
Laboratrio de Gentica & Biodiversidade, ICB, Universidade Federal de Gois, Goinia.
2
Programa de Ps-Graduao em Ecologia e Evoluo, ICB, Universidade Federal de Gois, Goinia.

Autor para correspondncia: Rosane Garcia Collevatti rosanegc68@hotmail.com

*Material didtico desenvolvido na disciplina Ecologia Molecular, coordenado


pela Profa. Rosane Garcia Collevatti, do curso de graduao em Ecologia e
Anlise Ambiental do Departamento de Ecologia, Instituto de Cincias Biolgicas,
Universidade Federal de Gois, como uma atividade do Estgio Docncia (bolsistas
CAPES) das discentes do Programa de Ps-graduao em Ecologia e Evoluo.

28 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

E sta atividade tem como pblico alvo estudantes de ensino superior e apresenta
um exemplo de anlise forense que possibilita a mobilizao de conhecimentos
tericos das reas de gentica mendeliana, molecular e de populaes. Por meio
da anlise de esquemas de gis de eletroforese, os estudantes tero como objetivo
caracterizar amostras de carnes apreendidas e determinar as espcies s quais elas
pertencem e a procedncia das mesmas.

FUNO PEDAGGICA provas conclusivas sobre a espcie objeto da


caa ou trfico, j que, em muitos casos, so
A principal funo da atividade proposta
mostrar como os princpios bsicos de
gentica podem ser aplicados para responder
apreendidos apenas amostras de carne, ovos,
penas, peles ou ossos. Alm disto, as apreen-
ses ocorrem geralmente em locais distantes
a questes em Ecologia Molecular. A ativi-
da regio de origem do animal, ou ainda o
dade apresenta um caso de gentica forense
local de caa declarado pelo suspeito geral-
que requer, para sua resoluo, a determina-
mente no o correto, pois o mesmo procu-
o das espcies qual pertencem amostras
ra omitir sua fonte. Nesses casos, uma das
de carnes apreendidas, bem como a origem
formas para identificar a espcie e excluir ou
das mesmas, ou seja, se vieram de populaes
atribuir o local de origem do animal o uso
silvestres ou de criadouros autorizados.
de marcadores moleculares (MANEL et al,
Indivduos oriundos de uma mesma popu- 2002).
lao devem compartilhar alelos com maior
Um rgo de fiscalizao ambiental recebeu
probabilidade que indivduos oriundos de
uma denncia de que um aougue comercia-
diferentes populaes. Isto se deve ao fato
lizava carne de caa ilegal. Foram apreendi-
de que, ao longo do tempo, a interrupo de
dos trs pedaos de carne que o proprietrio
fluxo gnico entre indivduos de diferentes
do aougue alegava ser de bovino, mas tinha
populaes pode levar ao acmulo de dife-
aspecto diferenciado das demais vendidas no
renas genticas. Quanto maior o tempo
estabelecimento. Para verificar se as pores
com ausncia de fluxo gnico, maior deve ser
de carne realmente eram bovinas, ou perten-
o nmero de diferenas acumuladas.
ciam a outra(s) espcie(s), as carnes foram
Esta atividade poder ser utilizada como apreendidas e amostras (pequenos pedaos)
atividade de aula prtica ou como uma ati- foram enviadas para um laboratrio especia-
vidade complementar aula expositiva para lizado em anlises genticas. Alm disso, caso
alunos de ensino superior, estimulando o as carnes correspondessem a uma ou mais
raciocnio lgico e promovendo uma efetiva espcies silvestres, era necessrio verificar se
aprendizagem de conceitos bsicos. os animais eram oriundos de criadouro(s)
autorizado(s) pelo rgo de fiscalizao ou
PROBLEMA PROPOSTO se eram oriundos de caa ilegal.
A caa e o trfico ilegais de animais silvestres No laboratrio foi extrado DNA dos frag-
ainda so prticas comuns no Brasil. Estas mentos das diferentes amostras encaminhas.
prticas tem srias consequncias na din- Foram utilizados dois tipos de marcadores
Marcador molecular mica e estrutura de populaes em florestas moleculares:
um fragmento de tropicais (STONER et al, 2007), alm de
1. a sequncia de um fragmento do gene
DNA, oriundo de um serem atividades consideradas imorais por
segmento especfico do
citocromo B (cytB), localizado no DNA
destrurem o meio ambiente e causarem a
genoma, expresso ou no, mitocondrial. Este gene codifica uma en-
extino de diversas espcies.
utilizado para identificar zima que participa da cadeia de transporte
uma regio particular Uma das dificuldades na elucidao dos cri- de eltrons na mitocndria e sua sequn-
do genoma (FERREIRA; mes contra a fauna silvestre a existncia de cia apresenta regies variveis teis para
GRATTAPAGLIA, 1996)

GenticaSociedade
na escolaBrasileira de Gentica 29
MATERIAIS DIDTICOS

estudos de filogenia e filogeografia de as questes 3 e 4, que devero ser res- Filogenia


mamferos. A sequncia deste gene permi- pondidas pelos estudantes. o estudo das relaes
evolutivas entre os organismos
te a caracterizao de espcies de mamfe- Discutir com os estudantes as concluses
ros. desta anlise. Aconselha-se que a atividade A filogeografia
estuda os princpios e processos
2. quatro lcus de microssatlites do seja aplicada para estudantes j familiariza- que controlam as distribuies
DNA nuclear. A anlise desses microssa- dos com os conceitos da biologia molecular geogrficas de linhagens
tlites permite determinar o local de ori- pois, desta forma, os estudantes podero genealgicas, especialmente
gem da amostra analisada. mobilizar o conhecimento do contedo te- aquelas dentro e entre espcies
intimamente relacionadas.
rico. (AVISE, 2000)
INSTRUES
PARA O PROFESSOR PROCEDIMENTO Lcus
uma regio especfica do DNA
Esta atividade pode ser feita individualmen- (PARA OS ESTUDANTES) onde se localiza um gene ou um
te ou em grupo de, no mximo, trs pessoas. 1. Comparar as sequncias do gene citocro- marcador molecular.
Uma das maneiras de se aplicar a atividade mo B (cytB) do DNA mitocondrial para Microssatlites
est descrita a seguir. as trs amostras de carnes apreendidas so sequncias curtas de
(A, B e C) e para diferentes espcies de nucleotdeos repetidas em
Distribuir para cada grupo: tanden, que se encontram
mamferos domesticados ou da fauna dispersas no genoma. Por
o problema proposto; silvestre mais utilizados na alimentao exemplo, (CA)10 uma
o procedimento que cada grupo dever humana (boi, porco, paca e capivara) Ve- sequncia dos nucleotdeos
rificar quais delas so iguais ou muito se- citosina (C) e adenina (A),
seguir; cujo par de bases CA
melhantes e quais so diferentes. repetido 10 vezes. As regies
as sequncias do gene cytB das trs
2. Responder s questes A e B. de microssatlites tm taxa
amostras de carne apreendidas (Qua- de mutao muito altas e so
dro1); Questo A: A qual(is) espcie(s) cor- muito polimrficos, por isso so
respondem as amostras de carne? considerados bons marcadores
as sequncias do gene cytB caractersti- moleculares para discriminar
cas de boi, porco, paca e capivara (Qua- Questo B: Por que foi utilizado mar- geneticamente indivduos
dro 2); cador molecular do tipo mitocondrial (FREELAND, 2005).

as sequncias do gene citocromo B (cytB) (sequncia do gene do citocromo B)


do DNA mitocondrial para a mesma para identificar a espcie que deu ori-
espcie das trs amostras de carne apre- gem s amostras de carnes apreendidas?
endida para diferentes localidades dos A sequncia do gene cytB suficiente
biomas brasileiros: Mata Atlntica, Cer- para distinguir a localidade de origem
rado, Amaznia e Pantanal (Quadro 3); das carnes apreendidas?

as questes A e B, que devero ser res- 3. Analisar o esquema do gel de poliacrila-


pondidas pelos estudantes. mida para quatro lcus microssatlites, (1
a 4), para as amostras de diferentes bio-
Discutir com os estudantes as concluses mas brasileiros (Mata Atlntica MA;
obtidas com esta anlise. Em seguida, distri- Cerrado CE; Pantanal PA; e Amazo-
buir para cada grupo: nas - AM), para o criadouro autorizado
o mapa 1, com os biomas brasileiros e (CR) e para as amostras de carnes apre-
localidades com criadouros autorizados; endidas (Carne). Verificar qual a amostra
Eletroforese
possui mesmo perfil de bandas no gel de a migrao de molculas
esquema da anlise das amostras dos gis poliacrilamida, que reflete o compartilha- ou fragmentos ionizados em
de eletroforese das amostras apreendi- mento de alelos da carne apreendida. um campo eltrico atravs
das para quatro regies de microssatlites de uma matriz de separao
(lcus 1 a 4), para as amostras de diferen- 4. Preencher a tabela 1, aps a anlise do es- com microporos, na presena
tes biomas brasileiros e de criadouro auto- quema do gel de eletroforese. de uma soluo tampo. A
matriz de separao pode ser
rizado (CR); 5. Identificar, no mapa 1, o local de proce- constituda por gel de amido,
tabela que dever ser preenchida pelos dncia das amostras apreendidas. De- agarose, acetato de celulose
estudantes aps a anlise das sequncias terminar qual a localidade de origem da ou poliacrilamida dependendo
amostra e verificar se corresponde mes- do tamanho das molculas que
dos painis 3 e 4 e do mapa 1; sero fracionadas.

30 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

ma localidade indicada pelo sequencia- cias do resultado obtido para o dono do


mento do DNA mitocondrial. aougue?
6. Aps determinao do local de origem, Questo D: Foi possvel identificar o
indicar no Mapa de Biomas a espcie e a local onde as amostras de carne foram
regio das quais as carnes apreendidas so retiradas utilizando os dois tipos de
provenientes. marcadores moleculares (microssatlites
e sequncia do gene citocromo B)? Por
7. Responder s questes C e D.
qu?
Questo C: A que local as amostras de
carnes pertenciam? Quais as consequn-

Quadro 1.
Sequncias do gene citocromo
B (cytB) do DNA mitocondrial Amostra A
para as trs amostras de carne ATGACCCACATACGCAAGTCCCACCCGCTAATTAAAATTATAAACCA
apreendidas (A, B e C).
Amostra B
ATGACCCACATACGCAAGTCCCACCCGCTAATTAAAATTATAAACCA

Amostra C
ATGACCCACATACGCAAGTCCCACCCGCTAATTAAAATTATAAACCA

Quadro 2.
Sequncias obtidas do gene
citocromo B (cytB) do DNA Bos taurus
mitocondrial para diferentes ATGACTAACATTCGAAAGTCCCACCCACTAATAAAAATTGTAAACAA
espcies de mamferos
domesticados ou da fauna Sus scrofa
silvestre mais utilizados na
ATGACCAACATCCGAAAATCACACCCACTAATAAAAATTATCAACAA
alimentao humana: boi (Bos
taurus), porco (Sus scrofa), paca
(Cuniculus paca) e capivara Cuniculus paca
(Hydrochoerus hydrochaeris). ATGACCCACATACGCAAGTCCCACCCGCTAATTAAAATTATAAACCA

Hydrochoerus hydrochaeris
ATGACCCACCTACGAAAATCACACCCACTAATCAAAATCATCAACCA

Quadro 3.
Sequncias do gene citocromo
B (cytB) do DNA mitocondrial Mata Atlntica
para a mesma espcie das trs ATGACCCACATACGCAAGTCCCACCCGCTAATTAAAATTATAAACCA
amostras de carne apreendida
para diferentes localidades Cerrado
dos biomas brasileiros: Mata ATGACCCACATACGCAAGTCCCACCCGCTAATTAAAATTATAAACCA
Atlntica, Cerrado, Amaznia e
Pantanal.
Amaznia
ATGACCCACATACGCAAGTCCCACCCGCTAATTAAAATTATAAACCA

Pantanal
ATGACCCACATACGCAAGTCCCACCCGCTAATTAAAATTATAAACCA

Sociedade Brasileira de Gentica 31


MATERIAIS DIDTICOS

Mapa 1.
Biomas brasileiros e localidade
do criadouro autorizado cujas
amostras foram utilizadas para
comparar com as amostras de
carnes apreendidas.

MA CE PA AM CR Carne Painel 1.
Esquema do gel de
Lcus 1 a poliacrilamida para quatro lcus
b microssatlites, (lcus 1 a 4),
para as amostras de diferentes
c biomas brasileiros (Mata
d Atlntica MA; Cerrado CE;
Pantanal PA; e Amazonas
Lcus 2 a - AM), para o criadouro
b autorizado (CR) e para as
amostras de carnes apreendidas
c (Carne).
d
Lcus 3 a
b
c
d
Lcus 4 a
b
c
d

Tabela 1.
Gentipos MA CE PA AM CR Carne Tabela de gentipos para os
Lcus 1 quatro lcus microssatlites,
(1 a 4), para as amostras de
Lcus 2 diferentes biomas brasileiros
(Mata Atlntica MA; Cerrado
Lcus 3
CE; Pantanal PA; e Amazonas -
Lcus 4 AM), para o criadouro autorizado
(CR) e para as amostras de carne
apreendidas (Carne).

32 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

RESPOSTAS DAS QUESTES taxonmica s possvel se existir um banco de


sequncia no qual a sequncia alvo comparada
Questo A: Aps a comparao das sequncias
com sequncias de diferentes grupos taxonmi-
das amostras A, B e C com as sequncias das
cos, como por exemplo o GenBank (veja no stio
amostras de boi, porco domstico, capivara e
www.ncbi.nlm.nih.gov/genbank).
paca, a sequncia de DNA mais similar com as
das amostras de carnes apreendidas foi a da paca Questo B: Quando comparadas, as amostras
(Cuniculus paca), animal da fauna silvestre bra- de carnes apreendidas com as amostras de dife-
Tabela 1. (preenchida com
sileira. No entanto, s a identificao da espcie rentes biomas e com a de um criadouro autori-
os gentipos dos quatro
lcus analisados)
no garante que o animal foi retirado da nature- zado, chegou-se concluso de que as amostras
Tabela de gentipos para os za porque pode ser proveniente de um criadou- apreendidas foram provenientes de uma popu-
quatro lcus microssatlites, ro autorizado. Portanto, necessrio identificar lao do Cerrado, j que o padro de bandas foi
lcus 1 a 4, para as amostras a origem dessa carne apreendida. Foi utilizado o muito similar entre essas duas amostras (veja o
de diferentes biomas brasileiros marcador molecular do tipo mitocondrial por- resultado do Painel 5 abaixo). Neste caso, como
(Mata Atlntica MA;
Cerrado CE; Pantanal PA; que este marcador tem taxas de mutao no foi encontrado que as amostras de carnes apre-
e Amazonas - AM), para o to altas quando comparada ao marcador mi- endidas eram de paca silvestre, o dono do aou-
criadouro autorizado (CR) e crossatlite, por isso possvel fazer a identifica- gue pode ser acusado de crime contra a fauna
para as amostras de carnes o taxonmica. No entanto, essa identificao silvestre.
apreendidas (Carne).

Gentipos MA CE PA AM CR Carne
Lcus 1 dd bb aa cc cc bb
Lcus 2 bb aa cc dd cc aa
Lcus 3 bb aa dd cc bb aa
A constituio gentica (alelos) Lcus 4 bc aa dd dd bc aa
de um indivduo para um ou
mais lcus definida como
Questes C e D: No foi possvel identifi- FUTUYMA, D. Biologia Evolutiva, 3o.ed. So
gentipo.
car o local de onde a amostra de carne foi Paulo, Funpec. 832 p, 2009.
retirada utilizando a sequncia do gene do GALETTI, M.; GIACOMINI, H.; BUENO, R.;
citocromo B. Com os marcadores micros- MARQUES, R. M.; BERNARDO, C. S. S.;
satlites isto foi possvel, pois estes marca- BOVENDORP, R.; GOBBO S.; DONATTI,
dores tm uma taxa de mutao mais alta, C.; STEFFLER, C.E.; MEIRELLES, F.; AN-
o que permite a identificao individual, ZOLIN, R.B.; NOBRE, R.; CHIARELLO,
sendo assim, mais apropriados para resol- A.; PERES, C. A. Priority areas for the conser-
ver problemas intraespecficos. Ao contr- vation of Atlantic forest large mammals. Biolog-
ical Conservation, v 142, p 12291241, 2009.
rio, o marcador baseado na sequncia do
gene mitocondrial cytB, que tem uma taxa MANEL, S.; BERTHIER, P.; LUIKART, G.
de mutao mais baixa, mais apropriado Detecting wildlife poaching: identifying the
para responder a problemas interespecficos origin of individuals with Bayesian assign-
como, por exemplo, a identificao da esp- ment tests and multi locus genotypes, Con-
servation Biology, v 16, p 650659, 2002.
cie qual as amostras de carnes apreendidas
pertencem. ROBINSON, J. G.; REDFORD, K. H.; BEN-
NETT, E. L. Wildlife Harvest in Logged
Tropical Forests. Science, v 284, n 5414, p
REFERNCIAS 595-596, 1999.
AVISE J.C., Phylogeography: The History and
Formation of Species. Cambridge, Harvard STONER, K. E.; VULINEC, K.; WRIGHT, S.
University Press, 447p, 2000. J.; PERES, C. A. Hunting and Plant Com-
munity Dynamics in Tropical Forests: A
FERREIRA, M. E.; GRATTAPAGLIA, D. Synthesis and Future Directions. Biotropica,
Introduo ao uso de marcadores molecu- v 39, n 3, p 385392, 2007.
lares e anlise gentica. Braslia, Embrapa
CENARGEN, 220 p, 1996. TOBE, S. S.; LINACRE, A. Identifying endan-
gered species from degraded mixtures at low
FREELAND, J. Molecular Ecology. Chichester, levels. Forensic Science International: Genetics
John Wiley & Sons, 388 p. 2005. Supplement Series, v 2, n 1, p 304-305, 2009.

Sociedade Brasileira de Gentica 33


MATERIAIS DIDTICOS

Por que alguns bezerros


do seu Oswaldo
morreram?

Cntia Franco Rocha1, Rogrio Fernandes de Souza2

Especializao em Ensino de Cincias Biolgicas, Departamento de Biologia


1

Geral, Centro de Cincias Biolgicas, Universidade Estadual de Londrina.


Departamento de Biologia Geral, Centro de Cincias Biolgicas,
2

Universidade Estadual de Londrina.

Autor para correspondncia: rogfs@uel.br

34 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

A atividade permite trabalhar de modo integrado a gentica


mendeliana e a estrutura e funcionamento molecular
dos genes facilitando a conexo e a compreenso dos conceitos
envolvidos. Ela pode ser aplicada para estudantes de Ensino
Mdio ou Superior, dependendo do nvel de detalhamento
terico escolhido pelo professor.

A integrao dos contedos de gentica


mendeliana e de gentica molecular
pode ser alcanada pela anlise de uma si-
3. Apresentar a situao problema descrita a
seguir, auxiliando os estudantes, ao longo
do processo, na sua resoluo.
tuao problema que tem como desafio des-
4. Solicitar que os estudantes procedam de
cobrir a causa de morte do bezerro do seu
acordo com as instrues do item Procedi-
Oswaldo. Os estudantes analisaro uma s-
mento, que pode ser impresso e distribu-
rie de resultados moleculares que simulam
do para os grupos.
os processos de transcrio e traduo gnica
usando para tanto figuras e moldes de papel.
SITUAO PROBLEMA
Os requisitos materiais para a aplicao da Seu Osvaldo utilizou o smen de um touro,
atividade so muito simples: folhas de papel filho de vacas campes em produo de leite,
A4 branca ou coloridas, folhas de cartolina para inseminar trs de suas primas, tambm
ou papel carto (opcional), cola branca de campes. O bezerro do primeiro cruza-
papel (opcional), uma cartela RNA men- mento nasceu to saudvel quanto os seus
sageiro (em anexo) para cada grupo de es- genitores. Entretanto, a novilha do segundo
tudantes e uma cartela RNA transportador cruzamento apresentou certo retardo no
e seus respectivos aminocidos (em anexo) crescimento; o do terceiro cruzamento mor-
para cada grupo de estudantes. reu pouco depois do nascimento. Preocupa-
do com tal resultado, seu Osvaldo entrou
APLICANDO A ATIVIDADE em contato com o laboratrio que lhe ven-
EM SALA DE AULA deu o smen. Por sua vez, o laboratrio con-
1. Imprimir, com antecedncia, as cartelas vocou um geneticista para tentar descobrir
RNA mensageiro e RNA transporta- a causa desses problemas. Depois de uma
dor (em anexo), de preferncia em folhas srie de anlises, foi possvel determinar que
de coloraes diferentes. Opcionalmente, os animais desses cruzamentos apresenta-
antes de recortar os modelos das cartelas, vam diferentes alelos para um gene aqui
pode-se col-los em cartolina ou outro pa- representado pela letra A envolvido no
pel mais resistente para facilitar o manu- desenvolvimento animal. Dessa forma, foi
seio e aumentar a sua durabilidade. possvel caracterizar os gentipos de todos
os animais estudados, conforme pode ser
2. Distribuir os recortes dos RNA mensa- observado na Figura 1.
geiro e de RNA transportador para os
grupos de estudantes.

Sociedade Brasileira de Gentica 35


MATERIAIS DIDTICOS

Figura 1.
Heredogramas indicando os
cruzamentos realizados e os
gentipos dos animais. Os
animais normais (quadrados
Prosseguindo as anlises, foi realizado o A. Parte da sequncia desses genes, jus- representam os machos e
sequenciamento desse gene nesses ani- tamente aquela prxima de onde foram os crculos, as fmeas) so
representados por smbolos
mais, o que permitiu descobrir as dife- detectadas as diferenas, mostrada na
claros; os afetados so corados
renas moleculares para os alelos A, A e Figura 2. em cinza.

Figura 2.
Parte inicial da sequncia dos
trs alelos (A, A e A) do
lcus A obtidos dos animais
analisados.
PROCEDIMENTO gir este objetivo, considere as principais
regras do processo de traduo.
1. Determinar as sequncias dos RNAs
mensageiros que sero produzidas a par- 3. Comparar a estrutura dos trs peptde-
tir dos trs alelos existentes nos animais os para determinar por que os trs no-
estudados. Para atingir este objetivo, con- vilhos apresentaram desde um fentipo
sidere as principais regras do processo de normal at uma situao de morte ps-
transcrio do DNA. -natal.
2. Determinar a sequncia peptdica codifi- 4. Apresentar uma hiptese para o surgi-
cada pelas trs molculas de RNA mensa- mento das diferenas nas sequncias de
geiros obtidas no item anterior. Para atin- nucleotdeos dos trs alelos.

36 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

5. Considerando esse exemplo, qual deve ser que se emparelha com o cdon do RNAm),
a relao entre os diferentes alelos de um teremos as seguintes sequncias peptdicas:
gene com as suas respectivas sequncias
Alelo A: Metionina Treonina
nucleotdicas?
Glicina Prolina cido asprtico
6. Apresente uma hiptese para explicar o Triptofano.
surgimento de descendentes afetados a
Alelo A: Metionina Treonina
partir de um touro parental que primo
Glicina Prolina Valina
das vacas inseminadas. Qual deve ser a ati-
Triptofano.
tude dos criadores nesse tipo de situao?
Alelo A: Metionina Treonina.
RESPOSTAS
Questo 1. As regies do DNA que indi- Questo 3. Comparando as trs molculas de
cam o incio da transcrio dos genes so RNAm, podemos perceber que o alelo A dife-
chamadas de stios promotores. no stio re do alelo A pelo fato de que este resulta em
promotor que protenas iro se ligar, permi- uma troca de nucleotdeos uma adenina por
tindo que a dupla fita do DNA seja aberta uma uracila na sua 14 posio. O mesmo
e que uma delas sirva de molde para a sn- acontece com o alelo A, que difere do A em
tese de uma molcula de RNA. O processo seu 7 nucleotdeo. Neste ltimo caso, isto re-
de transcrio do RNA ocorre sempre no sulta na troca de uma guanina por uma uracila
sentido 5 3, assim a molcula de RNA no RNAm. Portanto, esses trs RNAm iro re-
transcrita tem polaridade inversa da fita sultar em peptdeos pouco ou muito alterados.
molde de DNA. Portanto, na Figura 2, para Por exemplo, para os alelos A e A, percebe-se
cada um dos alelos mostrados, a fita de cima apenas a troca de um nico aminocido na po-
(aquela de sentido 3 5) servir de molde sio 5 desta sequncia peptdica. Neste caso,
para a produo de uma molcula de RNA um cido asprtico, um aminocido com pro-
mensageiro (ou RNAm) e que, portanto, lhe priedade cida, substitudo por uma valina,
ser complementar. Considerando todas es- um aminocido um pouco menor e hidrofbi-
sas informaes, para cada um dos alelos as co. Como o filhote do cruzamento 2 (AA)
sequncias de RNAm sero: no fenotipicamente normal, esta troca de
Alelo A RNAm: 5 AUG ACC aminocidos parece afetar o funcionamento
GGA CCA GAC UGG UAA 3 do peptdeo, fazendo com que o crescimento
do bezerro seja retardado.
Alelo A RNAm: 5 AUG ACC
GGA CCA GUC UGG UAA 3 Quando se observa o alelo A, v-se que a
mutao que lhe deu origem resultou em
Alelo A RNAm: 5 AUG ACC
um cdon de trmino (UGA) na posio do
UGA CCA GAC UGG UAA 3
terceiro aminocido. Cdons de trmino no
so reconhecidos por RNAt, mas sim por
Questo 2. A informao para a sntese de protenas especificas, chamadas de fatores
um peptdeo fornecida pela sequncia do de trmino. Normalmente, os cdons de tr-
RNAm, que interpretada, ou seja, traduzi- mino esto localizados no final dos RNAm
da pela maquinaria da traduo (os ribosso- e, neste caso, eles servem para indicar que
mos e os RNAs transportadores). No ribos- a sntese peptdica foi completada. Quando
somo, cada sequncia de trs nucleotdeos so introduzidos, via mutao, no interior
do RNAm, comeando por sua poro 5, dos genes, eles acabam codificando peptde-
reconhecida por um RNA transportador (ou os que no so produzidos integralmente, o
RNAt) especfico, que ir trazer o aminoci- que compromete o seu funcionamento. Isto
do correspondente, conforme exemplificado explica a morte do filhote do terceiro cru-
na Figura 3. Seguindo a regra de empare- zamento, uma vez que este era homozigoto
lhamento do cdon (nome dado trinca do AA, ou seja, ele no tinha como produzir
RNAm que especifica um aminocido) com corretamente esta protena e por isto acabou
o anticdon (nome dado trinca do RNAt falecendo. Por outro lado, o filhote do pri-

Sociedade Brasileira de Gentica 37


MATERIAIS DIDTICOS

meiro cruzamento (AA), embora carregue na funcional, um exemplo clssico de domi-


uma cpia do alelo A, nasceu normal. Isto nncia/recessividade. Esta mesma relao de
ocorre porque o alelo A, herdado de sua dominncia/recessividade deve existir entre
me produz quantidade suficiente da prote- os alelos A e A.

Figura 3.
Esquema demonstrando a
forma de traduo dos RNAm
(em verde) para cada um dos
trs alelos, usando os RNAt
(em rosa) carregados com seus
respectivos aminocidos.

Questo 4. Novos alelos normalmente sur- nocido diferente na cadeia peptdica. Por
gem devido a mutaes no DNA. Uma mu- outro lado, o alelo A representa uma mu-
tao nada mais que a troca permanente de tao sem sentido. Ou seja, ela introduziu
uma ou mais bases nitrogenadas nesta mo- um cdon de trmino tambm conhecido
lcula. Elas podem ser causadas por fatores como cdon sem sentido da transcrio
internos (erros que ocorrem durante o pro- dentro da regio codificadora do peptdeo.
cesso de duplicao ou por falhas no sistema
Questo 5. Os diferentes alelos de um gene
de reparo de danos do DNA) ou externos
apresentam variaes quanto s prprias in-
(por exemplo, radiao ultra violeta, raios X,
formaes genticas, ou seja, variaes nas
agentes mutagnicos etc.) Nesta atividade,
sequncias de bases nitrogenadas. Sendo
considerando que A seria o alelo original, o
assim, cada alelo pode levar formao de
surgimento do A ocorreu a partir de uma
cadeias polipeptdicas que apresentam um
mutao chamada de substituio de sentido
ou mais aminocidos diferentes. Ou ento,
trocado pelo fato dela resultar em um ami-
como no caso do alelo A, de um peptdeo

38 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

incompleto, o que compromete de forma PARA SABER MAIS


mais radical o seu funcionamento. Mudanas GRIFFITHS, A. J. F.; WESSLER, S. R.;
na sequncia de aminocidos de uma prote- LEWONTIN, R. C.; CARROLL, S. B.
na podem modificar o seu funcionamento e Introduo Gentica. Rio de Janeiro: Gua-
justamente este um dos fatores que fazem nabara-Koogan. 744p, 2009.
com que os indivduos apresentem fentipos
PIERCE, B. A. Gentica - Um enfoque concei-
diferentes para uma srie de caractersticas tual. Rio de Janeiro: Guanabara-Koogan.
fenotpicas. 788p., 2004.
Questo 6. Alelos recessivos mortais, como SNUSTAD, P.; SIMMONS, M. J. Fundamen-
o A so normalmente raros nas populaes, tos de Gentica. Rio de Janeiro: Guanabara-
tendo em vista que eles esto sendo constan- -Koogan. 922 p., 2008
temente eliminados pela seleo natural, j
que indivduos AA morrem ao nascimento.
Porm, um ou mais deles podem ser encon-
trados nas famlias. Assim, se um indivduo
normal, como o touro deste exemplo, carrega
um alelo deste tipo, muito provavelmente um
parente prximo tambm poder t-lo. Foi
provavelmente o que aconteceu com as suas
duas primas. Em cruzamentos deste tipo,
chamados de endogmicos, h aumento da
probabilidade de nascimento de filhotes ho-
mozigotos recessivos. Portanto, quando este
tipo de situao aparece, isto obriga os cria-
dores a retirarem os animais dos seus pro-
gramas de acasalamento, para evitar que tais
tipos de alelos se propaguem pelas prximas
geraes, comprometendo a fertilidade e/ou
produtividade dos rebanhos.

AGRADECIMENTOS
prof Dra. Fernanda Simes de Almeida
pelos testes em sala de aula e pelas sugestes
de modificao que tornaram essa prtica
mais eficiente.

Sociedade Brasileira de Gentica 39


MATERIAIS DIDTICOS

ANEXOS

40 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

Observao:
aminocido com propriedade
(A) cida, (B) bsica, (P) polar
ou (H) hidrfoba.

Sociedade Brasileira de Gentica 41


MATERIAIS DIDTICOS

42 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

O Julgamento
da Mutao
Grace Kelly da Silva1; Julliane Tamara Arajo de Melo2; Ana Helena Sales de Oliveira2; Edson Caio Silva2;
Silvia Regina Batistuzzo de Medeiros2; Luciane Fassarella Agnez3; Lucymara Fassarella Agnez-Lima2

Departamento de Microbiologia e Parasitologia - DMP, Centro de Biocincias, Universidade Federal do Rio Grande do Norte, Natal RN
1

Departamento de Biologia Celular e Gentica - DBG, Centro de Biocincias, Universidade Federal do Rio Grande do Norte, Natal RN
2

Programa de Ps-graduao em Comunicao da Faculdade de Comunicao - Universidade de Braslia, Braslia DF


3

Autor para correspondncia: lfagnez@ufrnet.br

A dramatizao teatral O Julgamento da Mutao discute se a Mutao vil,


fonte de patologias ou se a mocinha, indispensvel para a evoluo das esp-
cies, tendo como advogada de defesa a Seleo Natural e o promotor, o gene TP53.
A partir dos depoimentos das testemunhas, vrios conceitos de Gentica so abor-
dados contribuindo para a compreenso do que mutao e principalmente de seu
papel para os seres vivos. Entre as testemunhas esto: Clula-Me, Clula-Filha,
Enzimas de Reparo, Mutantes, tataraneto de Mendel, Evoluo e uma Cientista
renomada da rea. A deciso final caber plateia.

A dramatizao em O Julgamento da
Mutao, pode ser encenada como um
instrumento sensibilizador do tema muta-
conceitos envolvidos na pea, fazendo com
que a aprendizagem ocorra de forma mais
participativa e prazerosa para os alunos.
o, como atividade extracurricular, como
Esta dramatizao vem sendo encenada por
um assunto para uma Semana de Cincia e
alunos de iniciao cientfica e ps-gradua-
Tecnologia, ou como instrumento para tra-
o durante as atividades de capacitao que
balhar os contedos ministrados em aulas
ofertamos a alunos e professores do Ensino
tericas. Durante as atividades de prepara-
Mdio de escolas pblicas do Rio Grande
o da pea, como elaborao dos figurinos
do Norte, no mbito do Programa Novos
e cenrio e composio das personagens, ca-
Talentos da CAPES, tendo uma excelente
ber ao professor coordenar todo o trabalho,
aceitao pelo pblico-alvo.
incentivando e orientando a pesquisa dos

Sociedade Brasileira de Gentica 43


MATERIAIS DIDTICOS

PRATICANDO A ENCENAO O Ambiente:


As personagens devem ser distribudas entre Toda a dramatizao ocorre em um tribu-
os alunos da turma. Vale salientar que toda nal, no dia do julgamento da r, a Mutao.
a turma dever ser envolvida. Para tanto, A sensao no interior do tribunal tensa, o
necessrio que o professor entregue o ro- que est em risco o futuro da Mutao nos
teiro da encenao contendo a descrio e livros de Biologia. As testemunhas de acu-
as falas das personagens para que os atores sao e de defesa so chamadas umas aps
pesquisem e componham cada personagem, as outras para seus depoimentos. Para a en-
alm disso, sero tambm responsveis pelo trada das personagens podem ser utilizadas
figurino e cenrio, que podero ser criados a msicas (pequenos trechos, ou o refro), que
partir de materiais de baixo custo. representem o momento, caractersticas e a
personalidade de cada personagem. Devem
Apresentamos algumas sugestes de figu-
ser escolhidas partes de msicas que melhor
rinos, os quais podero ser adaptados em
representem as personagens. No figurino e
funo da criatividade dos alunos e disponi-
nas falas das personagens podem ser dados
bilidade de recursos na escola. O professor
toques de humor, tornando a dramatizao
dever atuar como diretor, ou delegar essa
mais leve.
funo aos alunos, sob sua superviso. Po-
der tambm adaptar o texto em funo de Personagens:
caractersticas de sua escola ou de sua regio.
Juiz - um personagem sbrio, centrado, que
Por exemplo, se a escola for prxima a uma
conduz todo o julgamento com autoridade.
fonte de contaminao ambiental, poder
Sua principal caracterstica a de observar
incluir esta problemtica na dramatizao. A
bem os fatos e ouvir, com imparcialidade,
durao estimada de aproximadamente 30
ambas as partes. Sempre srio, representa a
minutos.
justia, a verdade, controlando a todo o mo-
Argumento mento o pblico e os nimos mais exaltados
entre os participantes. O figurino compos-
A Mutao est sendo levada a julgamento.
to pela toga e o Juiz est sempre com o mar-
Seria ela vil, causadora de problemas para
telo na mo.
os seres vivos, ao gerar caractersticas desfa-
vorveis? Ou fundamental, ao fornecer novas Mutao a r - Tem poucas falas durante
caractersticas vantajosas que favorecem a todo o julgamento, mas o pblico percebe
evoluo das espcies? O enredo se desen- sua variao de humor e ndole, por meio
volver em um tribunal, com a apresentao de suas expresses. Tem comportamento
dos argumentos da promotoria e da defesa. inconstante, ora deve parecer boa, em outra
Culpada ou inocente? Dever a Mutao ser ocasio, m. quem gera toda a confuso
banida dos livros de Biologia? em cena, s vezes sendo vista como vil, ora
como mocinha. O figurino deve ser criativo,
Cenrio que represente essa dualidade, por exemplo,
A histria se passa em um tribunal. O Juiz a maquiagem bem elaborada de um lado da
estar ao centro, em uma mesa, com marte- face e, na outra metade da face, uma maquia-
lo mo. De um lado, estar a r (a Muta- gem de bruxa. Ou, ento, frente das pesso-
o) sentada. Ao seu lado, a cadeira que ser as, representar uma personagem e, s costas,
usada por sua advogada de defesa, a Seleo outra personagem, com auxlio de mscaras.
Natural. Do outro lado, estar a cadeira para
Gene TP53 o promotor - Deve ser enr-
o senhor promotor TP53. As testemunhas
gico, demonstrando fervorosamente o dese-
entraro uma a uma, conforme forem sendo
jo pela justia. Tem grande poder de argu-
chamadas para depor. O jri estar disposto
mentao e capacidade de gerar a dvida.
no formato de plateia.
Voz grave, cabelos com gel, terno escuro (ou

44 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

toga) e pasta nas mos. Aparenta sempre in- Mutantes - Testemunhas de defesa. Devem
dignao e sede de justia. Um pouco meti- representar indivduos bem sucedidos, que
do, demonstra astcia e rapidez de ao, mas ganharam vantagens no mercado agronmi-
se precipita em algumas ocasies. co por possuirem caractersticas mais produ-
tivas, em decorrncia das variaes de fen-
Seleo Natural a advogada de defesa - Deve
tipo causadas pelas mutaes. Figurino deve
ser elegante, segura de si, irnica, com alta
ser criativo, representando as vantagens que
capacidade de argumentao e deve demons-
cada mutante possui, como frutos maiores,
trar convico pela inocncia de sua cliente.
plantas resistentes a pragas, entre outras.
Defende a tese de que as mutaes so es-
senciais diversidade das espcies. Veste um Tataraneto de Mendel - Testemunha de de-
tailleur (ou um vestido longo, elegante, ou a fesa. o ltimo descendente de Mendel.
toga), sapato de salto alto e bem maquiada e Sempre calmo, expressa-se com tranquilida-
penteada, com os cabelos soltos. de. Veste-se como um monge e argumenta a
respeito das aes benficas da mutao para
Clula-Me - Testemunha de acusao, a
a diversidade das espcies e como as Muta-
personagem deve demonstrar certo dese-
es foram importantes para o trabalho de
quilbrio e funes alteradas, deve tambm
Mendel.
demonstrar desespero pelos problemas que
sua descendente (filha) possui em decorrn- Evoluo - Testemunha de defesa. Deve ter
cia do excesso de mutaes. Apresenta muita as caractersticas de uma nobre soberana.
raiva da Mutao e vontade de que ela seja uma mulher elegante, representa o sucesso
condenada para que possa pagar pelos danos causado pela ao das mutaes ao longo dos
causados a ela e sua filha. O figurino deve anos, fala com tranquilidade, demonstrando
ser criativo, caracterizar deformaes, por intimidade com a Mutao e a Seleo Na-
exemplo, colocar bales por baixo da roupa tural. Como sugesto de figurino, um vestido
e/ou uma maquiagem extica. longo de noite ou uma fantasia de princesa.
Clula-Filha - Testemunha de acusao. Figu- Dra. Catarina Satie Takahashi - Testemunha
ra estranha, deformada aps a ao da Mu- de defesa, Cientista renomada que pesquisa
tao. Culpa a r pela sua desgraa. Figurino sobre mutao e suas consequncias. Repre-
deve ser tambm criativo, indicando que a senta a viso crtica da cincia sobre a Mu-
Clula-Filha acumula mais alteraes que a tao. Est usando roupas usuais, de uma
me. Deve simbolizar o avano do processo professora cientista.
de carcinognese.
Escrivo - Dever fazer o registro de todo o
Enzimas de reparo de DNA - Testemunhas julgamento e auxiliar o Juiz. O figurino suge-
de acusao; so trabalhadoras exaustas e rido: terno ou jeans e blazer.
estressadas pela viglia constante para evitar
Policiais - Faro a segurana do ambiente,
que as mutaes ocorram. Vestem roupas
devero escoltar a r e as testemunhas que
brancas, com jaleco branco, maleta de pri-
so convocadas. Fortes, sempre com cara de
meiros socorros e maquiagem com olheiras
mau. Representam o poder do Estado na
bem ressaltadas.
deciso da justia. Usam colete de policial e
Joaninha - Testemunha de acusao; deve re- cassetete.
presentar um filhote, porm excessivamente
Fotgrafos e reprteres - So figurantes, repre-
grande para sua idade, sendo diferente de ou-
sentam a Imprensa, que far a cobertura do
tras de sua espcie, tendo problemas em sua
julgamento.
famlia e crculo de amigos por causa dessa
anomalia. Sugesto de figurino, vestido de Jri - Ser formado por todos os demais alu-
menina com asas nas costas com bolinhas de nos da turma e pela plateia que assiste pea.
cores bem diferentes, carrega um ursinho de Os componentes do Jri devero ouvir os de-
pelcia nas mos. poimentos com ateno e deliberar no final
pela inocncia ou culpa da Mutao. Figuri-
no pode ser feito com roupas normais.

Sociedade Brasileira de Gentica 45


MATERIAIS DIDTICOS

A REPRESENTAO: O Juiz - Nesse momento convoco a r, a senho-


ra Mutao, a qual est sendo acusada de v-
JULGAMENTO DA MUTAO rios crimes.
A dramatizao comea com o jri espera do
incio do julgamento. O Tribunal est tumul- Mutao - (Entrando escoltada por um poli-
tuado, com muito falatrio e comentrios sobre cial. Est chorando e abatida.)
aquele que seria o mais aguardado de todos os Imprensa - (Tirando muitas fotos e filmando
julgamentos. A imprensa registra cada fato, es- tudo nesse exato momento.)
perando a entrada da r. O jri popular est
Seleo Natural - (Levantando-se, vai em
ansioso espera dos argumentos do promotor
socorro da Mutao, buscando apoi-la.) -
e da advogada de defesa para decidir sobre a
(Trilha sonora: Eu no sou cachorro no, de
condenao ou absolvio.
Waldick Soriano.) - Por favor, troquem essa
Escrivo - (Entrando em cena. Aps acomodar- msica! Ela est deprimindo a minha clien-
-se, fala com clareza e seriedade.) - Solicito si- te! - (Tentando animar sua cliente.)
lncio e que todos fiquem de p para entrada
(Troca-se rapidamente a trilha sonora: Voc
do Meritssimo Juiz.
no vale nada mas eu gosto de voc, do conjun-
Todos ficam de p e em silncio para receber to Calcinha Preta.)
a autoridade que tem em suas mos o destino
Mutao - (Mudando de humor e comeando a
de um dos nomes mais conhecidos da cincia.
danar descontroladamente.)
Suspense geral pois aguarda-se o julgamento e
o destino da Mutao. Sua permanncia nos Juiz - (Enfurecido com aquela desordem, grita,
livros de Biologia est em xeque. (Sugesto de batendo o martelo.) - Ordem nesse tribunal!
trilha sonora para a entrada do Juiz: Imperial
O silncio se faz imediatamente.
March, de John Williams.)
Juiz - (Calmamente reinicia os trabalhos.)
Juiz - (Entrando e ocupando seu lugar na presi-
- Solicito ao senhor promotor que inicie a
dncia do tribunal.) - Todos podem se sentar.
apresentao do caso.
Peo desde j silncio absoluto! Estaremos
iniciando agora o Julgamento da Mutao, TP53 - Meritssimo, senhores jurados, se-
cuja advogada de defesa a senhora Sele- nhoras e senhores aqui presentes, gostaria
o Natural e o promotor do caso, o senhor de comear a minha participao me apre-
TP53. Iniciarei a sesso solicitando a entra- sentando aos que no me conhecem. Eu sou
da da senhora advogada de defesa, Seleo nada mais nada menos que um gene de ex-
Natural. trema importncia para as clulas porque a
protena que codifico controla a proliferao
Seleo Natural - (Entrando em cena e ocupan-
celular. Uma das principais consequncias
do seu lugar no tribunal. Age como se estivesse
de uma proliferao celular desregulada o
desfilando em uma passarela, carregando uma
cncer, que atualmente mata milhes de pes-
pasta nas mos com os documentos do proces-
soas em todo o mundo. Venho trabalhando
so.) - (Trilha sonora: Pretty woman, de Roy
incansavelmente para que este mal seja eli-
Kelton Orbison.)
minado de nossa sociedade. Hoje apresenta-
Juiz - (Olhando atentamente tudo ao seu redor rei provas de que a Mutao s tem causado
e demonstrando certo receio porque sabe que problemas para os seres vivos, sendo no
est comeando um julgamento tenso e longo. apenas causadora de cncer, mas tambm de
Anuncia com gravidade.) - Convoco agora o muitas outras doenas, visto que so delet-
senhor promotor TP53. rias. Gostaria de iniciar minha argumenta-
o solicitando ao Meritssimo Juiz que con-
TP53 - (Entrando em cena e ocupando seu lu-
voque minha primeira testemunha, senhora
gar. Com muita pose e parecendo que a causa
Clula-Me, uma das principais vtimas da
est ganha. Sua imponncia perante o jri
Mutao.
algo que impressiona a todos.) - (Trilha sonora:
Mission Impossible Theme, de Larry Mullen e Juiz - Que entre a senhora Clula-Me.
Adam Clayton.)

46 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

Clula-Me: - (Entrando bem devagar, andan- judicando minha reputao profissional. Foi
do com dificuldade, parecendo ter problemas a que o senhor TP53 comeou a tentar me
devido aparncia fisionmica estranha.) ajudar. Mas, meu crescimento descontrolado
favoreceu a ocorrncia de novas mutaes.
(Trilha sonora: Amanh 23, de Kid Abelha.)
At que minhas clulas-filhas comearam a
Seleo Natural: - (Enquanto Clula-Me en- perder progressivamente suas funes, agora
tra, senta-se de maneira discreta.) se transformaram em clulas malignas.
Juiz: - Desculpe, mas com esse aspecto to TP53 - (Ficando de p e indo at a Clula-
esquisito posso dizer que a senhora uma -Me, olhando para ela e perguntando com voz
clula? estridente.) - Gostaria de saber, foi esse o fu-
Clula-Me - Respeite-me, senhor Juiz, eu turo que sonhou para suas filhas?
sou uma clula muito especializada do sis- Clula-Me - Claro que no, elas teriam um
tema imune, apesar dos meus aspectos de- futuro brilhante se no fosse a Mutao.
formados, acho que d pra perceber minha (Comeando a chorar.)
constituio. Devido a mutaes excessivas,
O pblico fica estarrecido com o sofrimento da-
alguns dos meus genes esto sem funcionar
quela me. O Juiz est bem reflexivo e o promo-
adequadamente.
tor TP53 continua a falar.
Mutao - (Olhando friamente a situao com
TP53 - Obrigado, Clula-Me, estou satis-
uma tranquilidade que impressiona o jri
feito com suas respostas. Vejam, caros jura-
Seleo Natural - (Levantando-se, indignada.) dos e Meritssimo Juiz, a prova dos efeitos
- Protesto, Meritssimo! Isso realmente deletrios da mutao, por isso venho pedir
lastimvel! Gostaria de comear as minhas a pena mxima! Que a Mutao seja abolida
argumentaes dizendo que no acho justo dos livros-textos!
trazerem a Mutao a este tribunal. Gostaria
Pblico - (Gritando de maneira enfurecida.) -
de informar que as mutaes so raras e de
FIM DA MUTAO!!! FIM DA MUTA-
suma importncia para evoluo das esp-
O!!! FIM DA MUTAO!!!
cies. No correto fazer acusaes to graves
minha cliente que s tem trabalhado em Juiz - (Batendo o martelo e falando firmemen-
prol da diversidade. Solicito que o testemu- te.) - Silncio! Ordem no tribunal! Ordem
nho da senhora Clula-Me seja anulado por nesse tribunal! Caso isso se repita, terei que
refletir uma exceo. esvaziar esse tribunal! Com a palavra, a se-
nhora Seleo Natural.
TP53 - (Furiosamente ficando de p, gritando
e interrompendo a fala da Seleo Natural.) Seleo Natural - Como eu estava dizendo,
- A maioria das mutaes so deletrias! A antes de ser grosseiramente interrompida,
probabilidade de uma Mutao ser benfica as mutaes so raras. A frequncia estima-
a um indivduo mnima! da para a ocorrncia de mutaes de uma a
cada milho ou bilho de clulas. lament-
Juiz - (Intervindo de forma enrgica, batendo o
vel que o senhor promotor traga essas figuras
martelo.) - Ordem no tribunal! Protesto ne-
grotescas como testemunhas, isso apelao
gado! Senhor promotor, a testemunha sua.
para sensibilizar o jri. Gostaria que a se-
TP53 - Obrigado, Meritssimo. Peo se- nhora Clula-Me me respondesse apenas
nhora Clula-Me que relate o que aconteceu com um sim ou um no pergunta que farei
com sua filha em decorrncia das mutaes. nesse momento. Sabemos que a senhora
Clula-Me - Eu era uma clula muito de- uma clula de defesa e sabido tambm que
dicada ao meu trabalho, minha funo era as mutaes so a fonte da grande variabili-
produzir anticorpos. A apareceu uma muta- dade de anticorpos existentes, permitindo,
o. Um dos meus alelos HRAS comeou a portanto, o combate de uma grande varieda-
funcionar de forma excessiva. Comecei a s de de doenas. Isso verdade?
pensar em reproduo e passei a me dividir Clula-Me - Eu me recuso a responder essa
de forma descontrolada. Comecei a ficar fa- pergunta, j que a senhora Seleo Natural
lada entre minhas colegas de trabalho, pre- est tentando me induzir a uma resposta.

Sociedade Brasileira de Gentica 47


MATERIAIS DIDTICOS

Juiz - A pergunta pertinente e a senhora milhares de seus semelhantes perdem con-


obrigada a responder. corrncia e muitos esto beira da extino?
Clula-Me - (Vai respondendo de maneira a Mutante 1 - Claro que no, essa a lei do
se mostrar contrariada.) -Sim, verdade. mercado, os mais aptos sobrevivem!
Seleo Natural - (Demonstrando-se radiante Mutante 2 - Que culpa ns temos de estar no
com o favorecimento de sua cliente, responde.) lugar certo, na hora certa?! No escolhemos
- Sem mais perguntas. isso.
Juiz - A testemunha est dispensada, senho- Mutante 3 - Somos a vanguarda! Mas, sabe-
ra advogada, pode chamar sua primeira tes- mos que esse sucesso uma questo de mo-
temunha. mento, o mercado sempre muda.
Seleo Natural - Gostaria ento de chamar TP53 - (Falando indignadamente.) - inacei-
testemunhas importantes que provaro que tvel que para o sucesso de poucos, muitos
a mutao pode ser benfica para as espcies. tenham que padecer! Meritssimo, no te-
Gostaria de pedir permisso ao Meritssimo nho mais perguntas.
para a entrada dos Mutantes. Juiz - As testemunhas esto dispensadas.
Juiz - Que entrem nesse tribunal os senhores Mutantes - (saindo de cena.)
Mutantes.
Seleo Natural e Mutao - (Mantendo ex-
Mutantes - (Entrando sorridentes, aparentando presso de vitria, acompanham a sada dos
estar muito confortveis na situao.) - (Trilha Mutantes.)
sonora- Half the man, de Kopius Few - tema do
filme X-men primeira classe.) Juiz - Senhor promotor, pode chamar sua
prxima testemunha.
Seleo Natural: - Senhores Mutantes, pode-
riam nos relatar o impacto que as mutaes TP53 - Chamo a senhorita Clula-Filha.
causaram nos senhores e que os levou ao su- Juiz - Que entre a testemunha!
cesso no mercado?
Clula-Filha - (Entrando em cena, andando
Mutante 1 - Graas Mutao estou aqui devagar e aparentando descontrole e perturba-
com alta produtividade em gros, desban- o.) - (Trilha sonora: Elas esto descontrola-
quei todos os meus concorrentes. das, de Bonde do Tigro.)
Mutante 2 - Minha linhagem extremamen- Juiz - Senhor promotor, pode interrogar a
te resistente a doenas e pragas, conseguimos testemunha.
produzir com menor custo e ter valores mais
competitivos. TP53 - Senhorita, poderia nos relatar como
era sua vida antes e depois das mutaes?
Mutante 3 - Tenho frutos mais suculentos e
menor nmero de sementes, fao muito su- Clula-Filha - Vejam como eu estou, e tudo
cesso com a clientela. isso culpa da Mutao! Eu era uma clula
de defesa, tinha muitas responsabilidades e
Seleo Natural: - Meritssimo, eu no tenho um futuro maravilhoso, mas agora no sirvo
mais perguntas, esses depoimentos deixam para nada, me transformei nessa coisa dis-
claro o papel benfico da Mutao. forme, no consigo parar de me dividir, s
Juiz - Passo as testemunhas ao senhor pro- causo problemas. Quanto mais me esforo,
motor. mais mutao me aparece! Quem me dera
que apoptose me levasse! Mas nem com isso
TP53 - Mutaes favorveis so rarssimas! eu posso sonhar! Como sou infeliz!
Graas s mutaes temos hoje milhares
de doenas que no tm cura. As prximas Clula-Me - (Partindo para cima da Muta-
geraes sempre sero vtimas, caso a Muta- o, tentando agredi-la, ao ver sua filha naquele
o saia impune desse tribunal. Pergunto s estado. Demonstrando indignao e revolta.)
testemunhas: - No se envergonham de se Policial - (Intervindo na situao, tentando
vangloriarem de suas vantagens, enquanto conter os exaltados.)

48 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

Juiz - (Batendo o martelo.) - Ordem no tri- Joaninha - (Demonstrando medo, fica assusta-
bunal! Ordem no tribunal! Continuemos o da e comea a chorar.
julgamento!
TP53 - (Intervindo.) - Protesto Meritssimo,
TP53 - No tenho mais perguntas. a advogada est intimidando a testemunha!
Juiz - Seleo Natural tem a palavra. Juiz - Protesto aceito!
Seleo Natural - Senhor Juiz, no farei per- Seleo Natural - No tenho perguntas, Me-
guntas testemunha, no vou compactuar ritssimo.
com essa atitude desesperada do senhor pro-
Juiz - A testemunha est dispensada.
motor. Gostaria de ressaltar que a Mutao
um processo vital para a variabilidade gen- Joaninha - (Saindo de cena, chorando.
tica. Senhores jurados, j pensaram como se- Juiz - Que entre a prxima testemunha, o ta-
ria montono se todos ns fossemos iguais? tatatatatatatataraneto de Mendel.
Graas aos feitos da Mutao, podemos nos
deparar com indivduos fenotipicamente di- Tataraneto de Mendel - (Entrando e se acomo-
ferentes. claro que no possvel acertar dando no recinto.) - (Trilha: Bolero, de Mau-
sempre, e aberraes como essas surgem. rice Ravel)
Mas quem quer viver para sempre? O que Juiz - Passo a palavra senhora Seleo Na-
seria do planeta Terra se os seres vivos no tural.
morressem? Os recursos do planeta so limi-
Seleo Natural - A testemunha pode nos re-
tados, estamos sempre competindo. Pensem
latar qual foi a importncia da Mutao para
nisso!
os trabalhos de Mendel?
Juiz - A testemunha pode se retirar. Que en-
Tataraneto de Mendel - Quem no conhece
tre a prxima testemunha, a senhorita Joa-
os estudos do meu tatatatatatarav? Ele es-
ninha.
tudou, por anos, como as caractersticas so
Entrada da Joaninha com a trilha sonora Ur- transmitidas de gerao em gerao. Naquele
sinho pimpo, de A Turma do Balo Mgico.) tempo, ele nem sabia, mas a Mutao esta-
Juiz - Senhor TP53, pode interrogar a tes- va presente nas ervilhas que eram cruzadas.
temunha. Graas Mutao meu ancestral pode estu-
dar os fentipos contrastantes das ervilhas e
TP53 - Senhorita Joaninha, pode nos relatar chegar s leis de segregao cromossmica
o que a Mutao lhe fez? que vigoram at hoje. Como teriam surgido
Joaninha - Vejam s como estou esquisita de- as leis de Mendel? Como teramos essa va-
vido a essa Mutao (Chorando e falando ao riabilidade gentica se no fosse a Mutao?
mesmo tempo.) - Eu era bem pequenininha Viva a Mutao!
e olhe como eu cresci, olhem o meu tama- Pblico - (Parecendo confuso e comea a gritar,
nho... Minha me no consegue mais me dizendo em coro.): VIVA A MUTAO!!!
pegar no colo. Alm disso, essas pintinhas VIVA A MUTAO!!! VIVA A MUTA-
coloridas fizeram meu pai separar-se da mi- O!!!
nha me, achando que eu no era filha dele.
E quem vai querer casar com uma Joaninha Juiz - Ordem no tribunal! Ordem no tribu-
desse tamanho?! (Continua chorando.) nal! (Batendo o martelo e silenciando o Pbli-
co.)
TP53 - Sem mais perguntas, Meritssimo.
TP53 - Protesto, Meritssimo! Mendel era
Juiz - Senhora Seleo Natural, pode inter- um monge! Monges no tm filhos. Se Men-
rogar a testemunha. del no teve filhos, logo tambm no teve
Seleo Natural - (Dizendo em tom ameaador netos. Como a senhora Seleo Natural traz
e irnico.) - Pobre menina, voc realmente o Tatatatatatataraneto de Mendel, se ele no
est em desvantagem, voc sabe o que acon- teve netos???
tece com quem est em desvantagem?

Sociedade Brasileira de Gentica 49


MATERIAIS DIDTICOS

Seleo Natural - Eu explico, Meritssimo! TP53 - Protesto, Meritssimo! Isso uma


claro que Mendel era um monge e no teve calnia e falta de respeito s testemunhas!
filhos. O Tatatatatatataraneto de Mendel , Irei process-la por calnia e difamao!
na verdade, tatatatatatataraneto da irm de
Juiz - Protesto aceito. Senhora advogada,
Mendel. Ou seja, sobrinho-neto. O que im-
deve se dirigir s testemunhas de forma mais
porta que a Mutao foi essencial para o
respeitosa.
sucesso do trabalho de Mendel.
Seleo Natural - Senhoras enzimas, verda-
Juiz - Agradecemos o esclarecimento, senho-
deiro afirmar que as senhoras corrigem uma
ra Seleo Natural. Senhor TP53, deseja in-
Mutao?
terrogar a testemunha?
Enzimas de Reparo - Claro que no, todos sa-
TP53 - Pode dispensar a testemunha, no
bem que a Mutao no tem correo. Ns
tenho perguntas.
tentamos evit-la.
Juiz - Senhor Monge est dispensado.
Seleo Natural - As senhoras poderiam nos
Tataraneto de Mendel - (Saindo de cena.) explicar o que exatamente fazem?
Juiz - Convoco agora as enzimas de reparo Enzimas de reparo - Ns monitoramos o
de DNA. DNA. Quando existem modificaes qu-
Enzimas de reparo de DNA - (Entrandoapa- micas, chamadas de leses de DNA, ns as
rentando muito cansao.). - (Trilha sonora: Es- corrigimos e restauramos a estrutura normal
tivador, de Samuel Rosa e Chico Amaral.) do DNA.

Juiz - Passo a palavra ao senhor promotor. Seleo Natural - E o que essas modificaes
qumicas tm a ver com a Mutao?
TP53 - Prezadas senhoras, verdade que
vm sendo exigidas jornadas de trabalho ab- Enzimas de reparo - As leses interferem no
surdas e que tem recado sobre vocs a enor- processo de replicao, enganam a DNA po-
me responsabilidade de evitar a Mutao? limerase, a a Mutao se aproveita da situa-
o e se instala no DNA.
Enzimas de reparo de DNA - verdade sim,
senhor! No aguentamos mais combater as Seleo Natural - Ento, podemos interpretar
Mutaes o tempo todo! Em nome de todos que a Mutao uma vtima das leses no
os sistemas de reparo que existem, porque DNA?
vocs sabem que so muitos, estamos pedin- Enzimas de reparo - (Demonstrando espanto
do frias. No aguentamos mais a Mutao com a fala da Seleo Natural.)
agindo a todo o momento; ns no temos
TP53 - (Levantando exaltado e dizendo for-
sossego. No dormimos, no comemos, tra-
temente.) - Protesto! A senhora Seleo
balhamos o tempo todo em prol da estabi-
Natural est fazendo jogo de palavras para
lidade gentica. Enquanto isso, a Mutao
confundir os jurados! No so as leses de
est o tempo todo tentando se estabelecer
DNA que esto sendo julgadas!
no DNA. O estresse constante e estamos
pensando em entrar em greve! E, fiquem Seleo Natural - Senhor Juiz, eu tenho uma
sabendo que, em um piscar de olhos, sem o tese, solicito que deixem concluir minha ar-
nosso trabalho, a mutao far estragos que gumentao.
ningum poder corrigir. Juiz - Protesto negado! Continue, senhora
Juiz - Seleo Natural, a senhora tem a pa- advogada.
lavra. Seleo Natural - De fato, quem deveria estar
Seleo Natural - Que dramtico! J pensa- nesse tribunal seriam os agentes mutagni-
ram o que seria de vocs se no fosse a Mu- cos. So eles que causam as leses no DNA.
tao? Estariam desempregadas! Essas enzi- E os seres humanos so cmplices desse cri-
mas so muito preguiosas! me! No se espantem! Afinal quem polui o

50 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

ambiente lanando dejetos txicos? Quem super poderosas! A natureza deve continuar
destri a camada de oznio? Quem fuma? evoluindo!
Respondendo a essas questes, todos aqui
TP53 - (Demonstrando inquietao, e se deses-
presentes chegaro concluso de que minha
perando, vendo que sua causa est quase per-
cliente apenas uma vtima. Seu nico erro
dida.)
ser atrada pelas leses de DNA causadas
pelos agentes mutagnicos. O senhor TP53 A plateia mostra-se dividida.
sabe muito bem quantas clulas so levadas Seleo Natural - Sem mais perguntas, Me-
apoptose por carregar leses de DNA, afinal ritssimo.
ele quem se encarrega de lev-las morte!
Minha cliente apenas uma alternativa que Juiz - Passo a palavra ao Senhor Promotor
tem permitido que as clulas sobrevivam, TP53 - Senhora Evoluo, pode nos dizer
que mal h nisso? quantos seres vivos j morreram por causa
TP53 - Senhor Juiz, no tenho mais pergun- das mutaes?
tas. Evoluo - No fao a menor ideia, esses n-
Pblico - (Fica estarrecido ao longo do discurso meros no entram nas minhas estatsticas,
da Seleo Natural. Alguns dizem expresses sou uma mulher que s tem olhos para o
de espanto e comentrios; alguns concordando, futuro, prefiro cuidar dos vivos a ficar olhan-
outros discordando da Seleo Natural.) do para o passado. Senhor promotor, nada
eterno! Minha amiga, Seleo Natural, tem
Juiz - (Batendo o martelo e pedindo silncio.) - sabido escolher muito bem quem deve viver!
As testemunhas esto dispensadas.
TP53 - (Exaltado, argumentando.) - Vejam
Enzimas de reparo - (Saindo de cena.) senhores jurados, quanta crueldade! Volto a
Juiz - Convoco agora a testemunha senhora pedir o apoio de todos vocs para que essa
Evoluo. senhora Mutao saia hoje daqui condena-
da!!! E volto a pedir a pena mxima!!!
Evoluo - (Entrando com muita naturalidade,
como uma soberana olhando seus sditos, cum- Pblico - (Agitando-se, e os comentrios surgem
primenta a Seleo Natural e a Mutao como de todos os lugares, a plateia est dividida.)
se fossem amigas ntimas.) - (Trilha sonora Juiz - Ordem! Ordem! A testemunha est
tema do filme 2001 uma odisseia no espao, dispensada.
Also Sprach Zarathustra, de Richard Strauss.)
Evoluo - Saindo de cena, enquanto a ordem
Juiz - Senhora Seleo Natural, pode inter- se restabelece.)
rogar a testemunha.
Policial - (Um dos policiais vai at a Seleo
Seleo Natural - Senhora Evoluo, pode Natural, cochichando algo em seu ouvido.)
nos relatar como a Mutao tem sido impor-
tante no seu trabalho? Seleo Natural - (Em seguida pedindo a pa-
lavra.) - Senhor Juiz, solicito a incluso de
Evoluo - Querida amiga, voc sabe que mais uma testemunha que de suma impor-
vivemos num mundo em constante trans- tncia. Fui informada de que a Dra. Catarina
formao, os seres vivos devem acompanhar Takahashi est em visita nossa cidade.
as mudanas. Basta lembrar as histrias do uma Cientista renomada com larga experi-
pescoo das girafas, das borboletas da Ingla- ncia nos estudos sobre Mutao, gostaria de
terra e tantas outras histrias de sucesso. Se ter seu depoimento como perita no assunto.
no fosse a existncia desses mutantes, com Ela est aqui e concordou em prestar depoi-
suas variaes de fentipo, essas espcies no mento.
estariam aqui para contar histrias vencedo-
ras. Alis, se no fosse a Mutao, vocs no Juiz - (Chamando a Seleo Natural e o pro-
seriam, nem sequer, bactrias. Agora senhor motor TP53 para uma conversa reservada.) -
Juiz, absolva a Mutao porque Mutao, Advogados, aproximem-se, quero falar com
Seleo Natural e eu formamos um trio de vocs.

Sociedade Brasileira de Gentica 51


MATERIAIS DIDTICOS

Os trs conversam baixinho, ningum conse- clulas diferenciadas e funes especializa-


gue ouvir o que falam. O suspense se instala das, s foi possvel graas s mutaes que
na plateia. vm ocorrendo ao longo do tempo. Porm,
como as mutaes ocorrem aleatoriamente,
Juiz - (Batendo o martelo fazendo um ann-
algumas acabam sendo deletrias, visto que
cio.) - J que temos consenso, que entre a
podem alterar funes dos produtos gnicos,
Dra. Takahashi!
levando a doenas ou at mesmo morte.
Cientista - (Entrando em cena.) - (Trilha sono- Por esta razo, as taxas de mutao devem
ra: A primavera, de Antonio Vivaldi.) - (Sen- ser baixas o suficiente para permitir a vida,
tando-se e aguardando o questionamento.) mas no podem estar ausentes, pois no ter-
Juiz - Senhor promotor, pode arguir a teste- amos variao gentica, e, sem esta variao,
munha. no h evoluo.

TP53 - Doutora, a senhora pode nos esclare- Seleo Natural - Agradeo sua preciosa co-
cer porque to difcil fazer uma vacina para laborao. Senhor Juiz, no tenho mais per-
alguns vrus, como o HIV? guntas.

Cientista - As altas taxas de mutao que es- Juiz - A testemunha est liberada.
ses vrus apresentam so uma das principais Cientista - (Saindo de cena.)
dificuldades para a obteno de uma vacina.
Seleo Natural - (Mantendo-se sorridente e
Novos variantes surgem a todo o momento,
segura da vitria.)
o que dificulta a ao de uma vacina que seja
definitiva. TP53 - (Mostra-se preocupado.)
TP53 - (Mostrando-se satisfeito com a resposta Juiz - Convoco agora a r, a Mutao.
da Cientista.)
Mutao - (Sentando-se na cadeira das teste-
Cientista - (Continuando o depoimento.) - Po- munhas.)
rm, tambm verdade, que algumas pessoas
Juiz - Com a palavra o promotor.
so resistentes aos vrus devido variabili-
dade gentica que existe na populao, que TP53 - Senhora Mutao, lembre-se de que
tambm fruto de Mutao. est sob juramento. A senhora nega que
tenha causado aos seres vivos tantos males
Juiz - Algum outro questionamento?
como cncer e outras doenas?
TP53 - No, no. J estou satisfeito. - (Sen-
Mutao - Promotor, o senhor sabe como
tando-se e tentando se recuperar do peso da res-
esse mundo pode ser cruel para uma moa
posta da Cientista.)
sozinha. Sabe como , aquelas leses no
Juiz - Seleo Natural, a testemunha sua. DNA, algumas so to fortes, atraentes, o
senhor no imagina como um dmero de pi-
Seleo Natural - (Sorrindo, satisfeita, a vit-
rimidina pode ser sedutor. difcil resistir
ria parecendo iminente.) - Obrigada doutora,
tentao. Alm do mais, aquelas DNA poli-
pela presena aqui neste tribunal. A minha
merases no so santas, vivem me chaman-
pergunta bem simples: - Como cientistas
do, mesmo que eu no queira aparecer. Nun-
encaram a Mutao?
ca tive a inteno de fazer mal, mas como eu
Cientista - Nossa concepo muito clara. vou saber onde estou entrando? Aqueles nu-
A Mutao um mal necessrio, pois o cleotdeos so to parecidos, como vou saber
combustvel para a Evoluo. Sem as mu- onde estou me instalando? Afinal, colocar os
taes, a variabilidade gentica seria menor. nucleotdeos emparelhados corretamente
A ocorrncia da variabilidade gentica nas papel das DNA polimerases.
populaes importante para que os orga-
TP53 - Senhora Mutao, deixe de ser dis-
nismos sobrevivam s mudanas ambientais
simulada! De boas intenes o mundo est
ocorridas ao longo do tempo. Se conside-
cheio! Deixe de respostas evasivas, e respon-
rarmos que a vida evoluiu a partir de orga-
da claramente se s ou no responsvel por
nismos unicelulares, o surgimento de novas
inmeras doenas genticas.
clulas e de organismos multicelulares, com

52 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

Seleo Natural - Protesto, Meritssimo! O Escrivo - (Contando os votos e registrando os


promotor est desrespeitando e coagindo resultados.)
minha cliente!
Todos ficam apreensivos.
Juiz - Senhor promotor, acalme-se! Deve res-
Juiz - Agora, levantem o brao aqueles que
peitar a r! Senhora Mutao, deve respon-
julgam a Mutao inocente.
der.
Pblico - (Manifestando-se, respondendo or-
Mutao - Admito que, eventualmente, pos-
dem do juiz.)
sa ter causado algum mal, mas no tenho
conscincia das consequncias de meus atos. Escrivo - (Registrando os votos e, se aproxi-
Acredito tambm que tenha salvado muitas mando do Juiz, diz o resultado de forma reser-
vidas e at contribudo para o surgimento de vada.
muitas outras! Juiz - (Batendo o martelo para anunciar o re-
TP53 - Senhores jurados, como podem ver, a sultado. Depois de anunciar o veredito, encerra
r confessa sua culpa, encerro minha fala, pe- a sesso batendo o martelo.)
dindo mais uma vez a pena mxima! Temos Terminada a encenao, os atores vo ao pal-
a responsabilidade de assegurar a estabilida- co e, de mos dadas, agradecem ao pblico.
de s futuras geraes!
Juiz - Passo a palavra advogada de defesa. CONSIDERAES FINAIS:
Seleo Natural - lamentvel que o senhor Cabe aos estudantes e demais membros da
promotor insista nessa mesma tecla! No plateia a deciso final. Aps as pesquisas
podemos salvar a todos! Vejam o que a es- e debates, caber turma redigir o final do
pcie humana est fazendo com o planeta, o Julgamento da Mutao, se culpada ou ino-
aquecimento global vem a! Se extinguirmos cente.
a Mutao, estaremos todos fadados morte, Essa dramatizao j foi encenada por alunos
seremos extintos, se nas nossas descendn- de iniciao cientfica e de ps-graduao da
cias no houver mais variabilidade gentica. UFRN em doze edies de cursos de frias
verdade que alguns sero sim eliminados, que ofertamos aos professores e alunos do
eu mesma me encarregarei disso, se necess- Ensino Mdio de escolas pblicas do Esta-
rio, mas sem a mutao, no temos futuro. do do Rio Grande do Norte. Ao trmino da
Por isso, eu peo aos senhores jurados que encenao, debatemos os conceitos e tiramos
absolvam minha cliente, ela no mais cul- dvidas, e todos mostraram uma excelente
pada do que os seres humanos, que soltam receptividade dramatizao como uma es-
agentes mutagnicos o tempo todo no am- tratgia de ensino.
biente, eles esto por a solta, lesando o
DNA e provocando a Mutao. Se algum INFORMAES TCNICAS:
precisa ser punido, so os agentes mutagni-
Agentes mutagnicos: so agentes fsicos,
cos e no minha cliente que s mais uma
qumicos e biolgicos que interagem com
vtima do sistema. Peo, portanto, sua absol-
a molcula de DNA alterando sua estru-
vio!
tura qumica. Dentre os agentes fsicos, a
Mutao - (Mantendo-se calma enquanto ouve luz ultravioleta um dos principais fatores
o discurso da advogada de defesa e demonstran- ambientais causadores de cncer. Ao incidir
do uma expresso angelical na esperana de sobre a pele, a luz UV provoca ligaes cova-
convencer os jurados de sua inocncia.) lentes entre pirimidinas (bases nitrogenadas
Juiz - Terminados os interrogatrios, solicito presentes nos nucleotdeos que compem o
o veredito dos jurados. Aqueles que so pela DNA) adjacentes, formando os chamados
condenao levantem o brao. dmeros de pirimidinas. Essa leso pode
provocar mutaes e, desta forma, induzir
Pblico - (Manifestando-se, levantando e abai- cncer de pele. Dentre os agentes qumi-
xando os braos, respondendo ordem do juiz.) cos, podemos citar os agentes oxidativos,

Sociedade Brasileira de Gentica 53


MATERIAIS DIDTICOS

os hidrocarbonetos policclicos aromticos tumores so mais comuns em pessoas idosas.


(HPA) presentes em vrios poluentes am- As mutaes vo sendo acumuladas ao longo
bientais, como na fumaa derivada da quei- do tempo. A frequncia de mutaes pode
ma de combustveis ou do cigarro, ou ainda variar de indivduo para indivduo, estando
medicamentos como quimioterpicos usados relacionada a fatores genticos (por exemplo,
no combate ao cncer. Dentre os agentes bio- deficincia em uma das enzimas de reparo de
lgicos, esto os vrus, cuja simples insero DNA) e ambientais, como dieta e exposio
de seu material gentico em cromossomo da a agentes fsicos (exemplo, luz ultravioleta)
clula hospedeira altera a informao genti- ou qumicos (exemplo, o cigarro).
ca daquele local, assim como os transposons,
TP53: Gene que codifica a protena p53, que
que so segmentos de DNA com capacidade
uma protena multifuncional, dentre suas
de se movimentar dentro do genoma.
funes est a regulao do ciclo celular. Em
Leses de DNA: so alteraes qumicas na presena de danos no DNA, p53 bloqueia o
molcula de DNA, como quebras da cadeia ciclo, se o reparo de DNA ocorrer de forma
fosfodister, perda de uma base do nucleo- satisfatria, o ciclo celular segue sua progres-
tdeo, oxidao de base, ligao covalente so normal, porm, se o nmero de leses for
com outras molculas. Essas leses podem muito alto, p53 ativa o processo de apoptose
interferir no processo de replicao (sntese (morte celular programada), evitando assim
de DNA) levando ocorrncia de mutaes. o estabelecimento de mutaes. Por esta ra-
As vias de reparo de DNA so responsveis zo, classificado como um gene supressor
pela remoo dos danos, restabelecendo a es- tumoral. Quando mutaes inativam o gene
trutura normal da molcula de DNA. Agem TP53, o ciclo celular deixa de ser bloqueado
prevenindo a ocorrncia das mutaes. e o processo de carcinognese pode ocorrer.
Mutao: a alterao na sequncia de nu- Um grande nmero de tumores humanos
cleotdeos do DNA, pode se caracterizar por apresenta deficincia da protena p53.
uma troca, insero ou deleo de nucleot- HRAS: gene que codifica a protena HRAS,
deos. As mutaes no podem ser reparadas que tem funo de regulao do ciclo celu-
uma vez que o DNA est quimicamente lar, age estimulando a diviso celular. O gene
normal. De forma geral, so necessrios dois HRAS normal classificado como um proto-
ciclos de replicao para que uma mutao se -oncogene. Algumas mutaes nesse gene le-
estabelea (ilustrado na figura 1). Quando as vam a uma super ativao, fazendo com que
mutaes ocorrem em clulas somticas, po- a diviso celular ocorra de forma contnua,
dem dar origem ao processo de carcinogne- favorecendo o processo de carcinogenese. O
se. As mutaes tambm podem ocorrer em gene HRAS mutante classificado como um
clulas germinativas (vulos ou espermato- oncogene, por estimular o processo de pro-
zoides) e ser responsveis por doenas gen- gresso tumoral.
ticas como: hemofilia, fibrose cstica, anemia
Dra. Catarina Satie Takahashi: Doutora em
falciforme, entre outras. As mutaes em c-
Gentica pela Faculdade de Filosofia Ci-
lulas germinativas so transmitidas ao longo
ncias e Letras de Ribeiro Preto (1972).
das geraes, sendo a origem de novos alelos
Atualmente professora-titular no Depar-
e de novos genes. Nem toda mutao leva
tamento de Biologia da USP-RP. Pesquisa-
alterao de perda ou ao ganho de funo,
dora brasileira pioneira nos estudos sobre
existem mutaes denominadas silenciosas
mutaes induzidas pela radiao, tornou-se
ou neutras, que no interferem na funo
referncia na gentica toxicolgica brasileira.
dos produtos gnicos. Outras mutaes po-
Possui mais de 100 trabalhos publicados e
dem resultar em novas funes, podendo ser
mais de 60 orientaes de ps-graduao
benficas.
(mestres e doutores) concludas. Conhea
Carcinognese: processo de desenvolvimento mais sobre o trabalho dessa pesquisadora
tumoral. necessrio que ocorram vrias brasileira visitando seu currculo http://lat-
mutaes em diferentes genes para que a tes.cnpq.br/8554309212630138.
progresso tumoral ocorra. Por esta razo, os

54 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

Figura 1.
Esquema ilustrando um dos mecanismos para
origem das mutaes: A- O DNA quimicamente
normal replicado sem erros durante a fase S
da interfase durante o ciclo celular; B- O DNA
contendo leses pode ser reparado antes da
replicao evitando a ocorrncia de mutaes. Se
no houver o reparo do DNA antes da replicao,
as leses de DNA podem causar emparelhamentos
errneos durante a replicao. No havendo reparo
novamente, no prximo ciclo de replicao o
nucleotdeo inserido erroneamente ser usado como
molde para replicao, o que gera uma mutao.
No exemplo ilustrado, um par de nucleotdeos G-C
foi substitudo por um par T-A. Uma vez ocorrida a
mutao, esta no ser reparada, visto que o DNA
encontra-se quimicamente normal. Essa mutao
ser agora passada para descendncia nos prximos
ciclos celulares.

Sociedade Brasileira de Gentica 55


MATERIAIS DIDTICOS

AGRADECIMENTOS HAMBURGER, E. Apontamentos sobre o


ensino de Cincias nas sries escolares
fundao VITAE, FINEP (Financiado-
iniciais. Estudos avanados v. 21, p. 93-
ra de Estudos e Projetos) e CAPES (Coor-
104, 2007
denao de Aperfeioamento de Pessoal de
Nvel Superior) pelo apoio financeiro. QUEIROZ, R. P. C.; BARBOSA-LIMA,
M. C. A. Conhecimento cientfico, seu
SUGESTES DE LEITURA ensino e aprendizagem: atualidade do
RIBEIRO, L. R.; SALVADORI, D. M. F.; construtivismo. Cincia & Educao, v.
MARQUES, E. K. (Org.). Mutagnese 13, p. 273-291, 2007.
Ambiental. 1 ed. Ed. ULBRA, 365p., XAVIER, M. C. F.; FREIRE, A. S.; MO-
2003. RAES, M. O. A nova (moderna) Biolo-
SILVA, J.; ERDTMANN, B.; HENRI- gia e a Gentica nos livros didticos de
QUES, J. A. P. (Org.) Gentica Toxico- Biologia no Ensino Mdio. Cincia &
lgica. 1a ed, Ed. Alcance, 424p., 2003. Educao, v. 12, p. 275-289, 2006.

KRASILCHIK, M. Reformas e realidade:


o caso do ensino das cincias. So Paulo
em Perspectiva, v. 14, p. 85-93, 2000.

ILUSTRAES

Cena 1.
Os advogados e a r so
convocados pelo Juiz.

56 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

Cena 2.
As testemunhas Clula-Me e
Clula-Filha

Cena 3.
Depoimento da Cientista.

Sociedade Brasileira de Gentica 57


INVESTIGAES EM ENSINO DE GENTICA

As concepes alternativas
de estudantes sobre as
implicaes socioambientais
do uso dos transgnicos *

Sofia Valeriano Silva Ratz1, Poliana Cristina de Melo Martins2, Marcelo Tadeu Motokane3
1
Professora Coordenadora do Ncleo Pedaggico, Diretoria de Ensino de So Joo da Boa Vista,
Secretaria da Educao do Estado de So Paulo.
2
Departamento de Gentica e Biologia Evolutiva, Instituto de Biocincias, Universidade de So Paulo.
3
Departamento de Biologia, Faculdade de Filosofia, Cincias e Letras de Ribeiro Preto,
Universidade de So Paulo, Ribeiro Preto.

Autor para correspondncia: sofiaratz@usp.br

*Esse artigo foi fruto do Trabalho de Concluso de Curso de Especializao em Ensino de Biologia para Professores da Rede Pblica oferecido pela Universidade de So
Paulo (USP), em parceria com a Secretaria da Educao do Estado de So Paulo (SEESP), pelo Programa Rede So Paulo de Formao Docente (Redefor).

58 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

O desenvolvimento do conhecimento sobre a Biologia Molecular e Biotecnologia


requer a participao da populao sobre os debates cientficos nessa rea. O
tema dos transgnicos um exemplo que aborda discusses envolvendo a nutrio
humana, impactos ambientais e ticos. Esse trabalho visa ampliar o conhecimento
sobre concepes dos estudantes sobre a utilizao dos transgnicos e suas
consequncias. Os dados mostram que os alunos dizem se interessar pelo tema, mas
tambm que existe fragilidade no entendimento dos conceitos que esto envolvidos.
Essa fragilidade traz dificuldades para que os alunos posicionem-se em relao s
implicaes socioambientais dos transgnicos.

INTRODUO tericos e a realidade da participao da so-


ciedade acerca da temtica cientfica.
A produo de conhecimento acerca da
Biologia Molecular e Biotecnologia
conclama, cada vez mais, a participao da
Consideramos como justificativa para o pre-
sente trabalho a demanda escolar sobre te-
sociedade nos debates e na construo de mas contemporneos da Biologia e o nmero
solues para os problemas atuais advindos incipiente de publicaes acerca do Ensino
dessas reas do conhecimento. Esta parti- de Gentica e Biologia Molecular (melo;
cipao dos cidados um fator positivo se carmo, 2009). Tambm consideramos a uti-
considerarmos que preciso tomar precau- lizao de materiais didticos que, por vezes,
es em relao aos riscos que possam advir no contemplam conceitos da Biologia Mo-
do desenvolvimento tecnolgico, tanto para derna (xavier et al., 2006). E, por ltimo, a
as pessoas e como para o meio ambiente (ca- influncia das concepes dos alunos para o
chapuz et al., 2005). aprendizado de Biologia Molecular e Biotec-
nologia (carvalho; bossolan, 2009). Sendo
H uma grande quantidade de informaes
assim, pretendemos, com esse trabalho, am-
circulando em vrios meios de comunicao
pliar o conhecimento sobre concepes dos
e nas escolas. A pesquisa com clulas-tronco,
alunos sobre a relao dos transgnicos com
por exemplo, um tema discutido ampla-
as questes socioambientais.
mente na sociedade e levado para instncias
como o Supremo Tribunal Federal. Os or-
ganismos geneticamente modificados cons- O QUE SO CONCEPES
tituem outro assunto que envolve a nutri- ALTERNATIVAS?
o humana, impactos ambientais e a tica. Pesquisas na rea do Ensino das Cincias
Portanto, importante que surjam reflexes tm demonstrado que as concepes alterna-
sobre o ensino da Biologia Molecular e da tivas dos alunos so de grande importncia
Biotecnologia, uma vez que tais assuntos tm para o processo de ensino/aprendizagem de
grande potencial para a construo da cida- cincias (Carvalho; Bossolan, 2009). Nesse
dania na escola e para uma aprendizagem processo, os alunos j tm um conceito exis-
mais contextualizada da Biologia. tente sobre determinado assunto, e mesmo
No entanto, apesar de reconhecermos a ne- que esse conceito ou explicao seja invli-
cessidade da discusso de assuntos relacio- do do ponto de vista cientfico, pode servir
nados Biologia Molecular e Biotecnologia como um modelo explicativo eficiente den-
e sabermos que h dispositivos legais que ga- tro de certo contexto. Assim, a aprendizagem
rantem o direito de acesso ao conhecimento significativa somente ocorre quando novos
cientfico, ainda vemos um distanciamento significados so adquiridos por meio de um
entre as orientaes dadas pelos dispositivos processo de interao de novas ideias com

Sociedade Brasileira de Gentica 59


INVESTIGAES EM ENSINO DE GENTICA

conceitos relevantes j existentes na estrutu- na zona urbana do Municpio de So Jos


ra cognitiva (Paiva; Martins, 2005). do Rio Pardo e possui um prdio em bom
estado de conservao, possuindo sala de
Vygotsky (2009) afirma que a formao do
leitura, laboratrios e quadra poliesporti-
conceito um processo que comea desde a
va. A escola participa do projeto Escola da
infncia e acompanha o amadurecimento do
Famlia, abrindo aos fins de semana para
indivduo. Os equivalentes funcionais dos
atividades culturais com a comunidade. Em
conceitos esto relacionados com os concei-
nossa investigao, levantamos dois tipos de
tos verdadeiros assim como o embrio est
dados: quantitativos e qualitativos. Por meio
relacionado com o organismo completamen-
de um questionrio (anexo 1), obtivemos
te desenvolvido. Separ-los significaria no
dados para uma anlise quantitativa. Porm,
compreender a relao entre a fase inicial e a
estivemos tambm interessados em entender
fase final. Com um ponto de vista semelhan-
em mais detalhe as percepes presentes nos
te, Driver (1995) indica que o aprendizado
alunos sobre as implicaes socioambientais
envolve a construo de significados feita
envolvidas no uso dos transgnicos. Para isso
pelo aluno, o que depende de uma ativida-
optamos pela pesquisa qualitativa por con-
de contnua. A partir dessa construo, cada
siderarmos uma abordagem frutfera para a
aluno faz sua avaliao, aceitando ou rejei-
interpretao dos dados quantitativos, pos-
tando novas concepes.
sibilitando o estabelecimento de categorias
As concepes alternativas podem ser clas- para agrupar esses dados e o levantamento
sificadas quanto sua origem em sensorial, de hipteses sobre seu significado (Creswell,
cultural ou escolar (POZO; CRESPO, 2007).
2009). As concepes alternativas de origem
O questionrio aplicado (Anexo 1) foi com-
sensoriais, tambm chamadas de concepes
posto de duas partes. Na primeira parte, que
espontneas, so adquiridas pelos estudantes
denominamos Parte A, estivemos interessa-
por meio dos sentidos, que as formulam para
dos em investigar o perfil da turma em rela-
dar significado s atividades cotidianas.
o ao conhecimento sobre os transgnicos.
As concepes alternativas que tm sua ori- Tambm perguntamos onde os alunos en-
gem na cultura so chamadas de concepes contraram informaes sobre esse tema, seu
induzidas, e se originam no meio social do interesse e se, na opinio deles, h implica-
aluno. So induzidas porque a escola no es sociais ou ambientais na utilizao dos
nem o nico e, por vezes, nem o mais im- transgnicos.
portante meio de transmisso cultural; os
Na segunda parte do questionrio, denomi-
alunos j chegam s salas de aulas induzidos
nada Parte B, as questes tratavam de assun-
por crenas socialmente aceitas. Tm origem
tos especficos da Biologia Molecular e Bio-
cultural e social as concepes biolgicas dos
tecnologia, com nfase em transgnicos. Para
alunos sobre doena, sade, seres vivos etc.
a construo dessas questes, contemplamos
Por ltimo, h as concepes alternativas de definies, relaes existentes entre as enti-
origem escolar, que so tambm chamadas dades moleculares e tambm as consequn-
de concepes analgicas. Nesse caso, apre- cias sociais e ambientais sobre a utilizao de
sentaes deformadas e simplificadas dos transgnicos.
conceitos, presentes nos livros didticos e
Os entrevistados foram orientados a res-
possivelmente nas explicaes do professor,
ponder ao questionrio de forma tranquila e
levam os alunos a uma assimilao errnea.
responsvel. Alertamos que no se tratava de
Essa compreenso equivocada acaba por le-
uma avaliao ou prova e que no tivessem
var a erros conceituais.
preocupaes com o tempo, pois teriam de
90 a 100 minutos para responder as ques-
METODOLOGIA tes. Todos os alunos entregaram os ques-
Investigamos as concepes de quatorze es- tionrios antes do trmino dos 100 minutos,
tudantes da 3 srie do Ensino Mdio em considerando suficiente o tempo para as res-
uma escola estadual do Municpio de So postas. Embora a quantidade de alunos es-
Jos do Rio Pardo, SP. A escola localiza-se tudados no seja grande, os resultados apre-

60 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

sentados a partir das 14 entrevistas merecem guntas muito diretas podem induzir respos-
ateno, uma vez que apontam questes que tas breves ou sem conexo com o assunto
podem ser indicativas de problemas no ensi- tratado. No presente trabalho, foram con-
no de Gentica e podem ser representativas sideradas todas as respostas dadas pelos 14
para o grupo social analisado. alunos, pois todas tinham informaes que
poderiam ser analisadas com mais detalhe.
importante salientar que, como todo ins-
trumento de pesquisa que procura levantar
informaes para a construo de dados, RESULTADOS E DISCUSSES
as entrevistas do presente trabalho tm li- A tabela 1 apresenta os resultados das res-
mitaes que precisam ser consideradas. A postas dos alunos para os itens da Parte A do
primeira delas refere-se ao fato de que per- questionrio (Anexo 1).
Tabela 1.
Frequncias das respostas
relativas parte A do Frequncia
questionrio (anexo 1). Pergunta Respostas
(em %)
Este ano 7
1) Quando foi a ltima vez que Ano passado 57
estudou sobre transgnicos? No lembro 14
H muito tempo 22
Muito 0
2) Quanto voc lembra, caso tenha Mdio 57
estudado? Pouco 43
Nada 0
Livro didtico 14
Internet 79
3) Qual o meio de divulgao em que TV 0
voc encontra esse assunto? Rdio 0
Revistas 0
Escola 7
No h interesse 0
4) Qual o grau de interesse pelo tema? H interesse 71
Extremamente interessado 29
5) H alguma implicao social ou Sim 100
ambiental quando fazemos uso da
biotecnologia? No 0

Por meio da tabela 1, podemos observar que 100% dos alunos afirmam que h uma impli-
o acesso informao sobre transgnicos cao social e ambiental no uso que fazemos
vm prioritariamente da internet (79%). Os da biotecnologia. Tais dados demonstram
dados mostram que o interesse dos alunos que os assuntos relacionados a transgnicos
pelo assunto grande, mesmo que em dife- so de grande importncia e merecem ser
rentes gradaes. O tema tratado na escola discutidos na escola.
uma vez que a maioria dos alunos lembra-se
Na Tabela 2 apresentamos os resultados das
de ter estudado o assunto h relativamente
questes nmero 1 e 2 da Parte B do questio-
pouco tempo. Outro dado interessante que
nrio (Anexo 1).

Sociedade Brasileira de Gentica 61


INVESTIGAES EM ENSINO DE GENTICA

Tabela 2.
Frequncia Frequncias dos agrupamentos
Pergunta Grupos de Respostas
(em %) de respostas da parte B do
questionrio (anexo 1).
Concepes baseadas no
21
conhecimento cientfico

1) O que DNA? Concepes alternativas 71

No respondeu 8

Concepes baseadas no
42
conhecimento cientfico
2) O que so transgnicos?
Concepes alternativas 58

Para esta anlise consideramos como con- So seres vivos geneticamente modificados, so
cepes baseadas no conhecimento cientfico misturas de DNA de uma, junta com outra,
aquelas respostas que, de alguma maneira, dando origem a uma terceira, com outro DNA
mencionaram o DNA como portador de in- diferente do normal. (aluno 05)
formaes genticas; 21% dos alunos deram
So organismos modificados atravs do seu
respostas que se enquadram nessa categoria.
DNA. (aluno 06)
Ao definir DNA (questo 1, Parte B), 71%
Vrios alunos utilizaram uma definio de-
dos alunos apresentaram concepes alter-
masiado genrica, usando simplesmente o
nativas e deram respostas cientificamente
termo geneticamente modificados; consi-
incorretas, como por exemplo: uma clula
deramos tal definio como parcialmente
que diferencia cada ser humano. O DNA
correta, haja vista que no houve meno
uma amostra de sangue onde especialistas
introduo de um gene alterado em um or-
analisam a amostra gentica. DNA uma
ganismo, que seria a definio formalmen-
clula retirada de algum indivduo para po-
te mais correta de transgnico (Griffiths,
der ser estudada e tambm para poder ser
2008). Esse tipo de resposta indica que os
clonada entre outras coisas. Respostas como
alunos tm facilidade em reproduzir a infor-
essas, que indicam uso incorreto dos termos
mao, mas no so suficientemente especfi-
e dos seus significados, foram consideradas
cos a ponto de comprovar uma superao do
concepes alternativas. Pedrancini et al.
senso comum. Quando tentam aprofundar
(2007) sugere que essas ideias, presentes em
suas respostas, no explicam usando concei-
muitos alunos, revelam a influncia da mdia,
tos cientificamente aceitos.
que divulga amplamente os testes de paterni-
dade ou criminalsticos baseados em amos- Os resultados da questo de nmero 1 (O
tras de sangue, ou em antigas concepes de que DNA?) esto conectados com o re-
que a hereditariedade era transmitida pelo sultado da questo de nmero 2 (O que so
sangue. transgnicos?), uma vez que a apropriao
do primeiro conceito parece ser importante
A Tabela 2 mostra ainda que, com relao
para a compreenso do segundo.
aos transgnicos, 42% dos alunos apresenta-
ram respostas que podem ser consideradas Solicitamos aos alunos que respondessem se
corretas do ponto de vista cientfico. A seguir fariam o uso de algum produto transgnico,
apresentamos alguns exemplos de respostas : justificando a resposta. Os resultados foram
categorizados e as frequncias das respostas
So plantas e animais geneticamente modifica-
esto representadas na Tabela 3.
dos. (aluno 02)

62 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

Tabela 3.
Frequncias das respostas Questo 3. Voc faria uso de algum produto transgnico? Justifique sua resposta.
dadas questo sobre o uso de
produtos transgnicos. Frequncia Frequncia
Resposta Justificativa
(%) (%)

Qualidade superior dos transgnicos 20

Produtividade maior dos transgnicos 20

Sim 57 Meio Ambiente mais protegido 20

Curiosidade 20

No h problema no uso 20

Qualidade inferior dos transgnicos 12

No 43 Sade prejudicada 50

Falta de Conhecimento 38

Optariam preferencialmente por produtos


Talvez 7 100
no transgnicos

A tabela 3 indica que mais da metade dos alu- No porque, em minha opinio, os produtos
nos afirmam que utilizariam produtos trans- transgnicos no so bons como os no modifi-
gnicos e no h predominncia de um tipo cados, indicando dvidas com relao quali-
de justificativa sobre as outras. Em contraste, dade dos produtos. (aluno 14)
a maioria das justificativas para no se utilizar
Dentre os alunos pesquisados, 7% indicaram
produtos transgnicos recai sobre questes re-
que talvez utilizassem transgnicos. Exemplo
lacionadas sade e falta de conhecimento
de resposta que se enquadrou nessa categoria:
sobre o assunto. Alguns exemplos:
Se eu for a um supermercado e tiver um pro-
No, porque pode causar doena e uma dessas
duto A natural, tipo sem ser modificado, e um
seria o cncer. (aluno 02)
produto B que esteja escrito que um alimento
No, porque pode provocar algum tipo de aler- transgnico, eu escolheria o produto A, mas, se
gia ou transmite a clulas do corpo uma mu- no houver outra opo, sem nenhum problema
dana gentica celular.(aluno 05) faria o uso do produto B, alm de achar o A
melhor. (aluno 12)
A qualidade do produto aparece como justifi-
cativa tanto para justificar a utilizao quanto Esse resultado foi semelhante ao obtido por
a no utilizao dos transgnicos: Pedrancini et al. (2007), em que as desvanta-
gens da utilizao dos transgnicos mais cita-
Sim, pois pode ser mais resistente que outros pro-
das esto relacionadas sade e aos impactos
dutos normais e ter um grau produtividade maior,
ao meio ambiente.
com maior benefcio para mim. (aluno 04)

Sociedade Brasileira de Gentica 63


INVESTIGAES EM ENSINO DE GENTICA

Tabela 4.
Questo 4. H alguma implicao social na utilizao dos transgnicos? Frequncias das respostas dadas
Se sim ou no, exemplifique. pergunta sobre a implicao
social do uso de transgnicos
Frequncia Frequncia
Respostas Justificativas
(%) (%)

Acesso ao Conhecimento 46

Sim 79 Sade 36

Aspectos econmicos 18

No 7 Falta conhecimento 100

No sabem 7 100

Respostas no analisadas 7 Sem categorizao 100

Dados a respeito da implicao social do uso bem responder e 7% deram respostas fora do
dos transgnicos esto organizados na Tabe- tema, sem condies de categorizao.
la 4. Nas respostas dos alunos predominam
Os dados indicam que os mesmos alunos que
exemplos relacionados sade e ao acesso
afirmam, contraditoriamente, que no h im-
ao conhecimento para sustentar a afirmao
plicaes sociais na utilizao dos transgni-
de que h consequncias sociais no uso dos
cos, alegam que isso aconteceria pela falta de
transgnicos. Os alunos que indicam o aces-
conhecimento do assunto. Porm, a prpria
so ao conhecimento como sendo uma conse-
justificativa dada nos remete a uma implica-
quncia do uso dos transgnicos referem-se
o social que o desconhecimento da popu-
ao fato de que o consumo ir gerar e deman-
lao. O acesso ao conhecimento pela popu-
dar mais acesso s informaes sobre esse
lao permite a sua participao nos debates
tipo de produto. 7% dos alunos responderam
cientficos e nas decises polmicas que a afe-
que no h consequncias sociais da utiliza-
tam diretamente, como por exemplo, a libe-
o dessa tecnologia, 7% alegam que no sa-
rao e utilizao dos produtos transgnicos.

Tabela 5.
Distribuio das respostas
Questo 5. H alguma implicao ambiental na utilizao dos transgnicos? dadas questo 5 da Parte
Se sim ou no, exemplifique. B do questionrio, sobre a
implicao ambiental no uso de
Frequncia Frequncia transgnicos.
Respostas (%) Justificativas (%)

Sim 43% Contaminao ambiental 49%


Desmatamento 17%
Consequncias ambientais 17%
Melhor para o meio ambiente 17%
No 36% Sem justificativa especfica 40%
Danifica pouco 20%
Traz benefcios 40%
Talvez 21% Sem categorizao 100%

64 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

A Tabela 5 traz dados sobre as percepes CONCLUSES


dos alunos a respeito das implicaes am-
As respostas dos alunos mostram que, ape-
bientais do uso de transgnicos. 43% dos alu-
sar de se interessarem bastante por assun-
nos reconhecem implicaes ambientais, dos
tos ligados a transgnicos, a maior parte das
quais 49% citam contaminao ambiental.
informaes que obtm sobre o tema chega
As justificativas dessa categoria baseiam-se
at eles de fora da escola, principalmente
na alegao de que uma plantao de trans-
pela internet. Isso mostra que a percepo
gnicos contamina plantaes prximas, cau-
dos alunos de que a escola no trata desses
sando-lhes mutaes. O Desmatamento foi
temas e h pouca relao entre o que apren-
citado por 17% dos alunos que responderam
dem nas aulas e as discusses que acompa-
que o uso de transgnicos tem consequn-
nham, de maneira fragmentada, na mdia.
cias ambientais. Para eles, a utilizao dessas
Os resultados mostram tambm a fragilida-
plantas demandaria uma maior rea para a
de dos alunos no que diz respeito aos con-
plantao, o que acarretaria desmatamento.
ceitos envolvidos no entendimento do que
17% afirmam que os transgnicos trazem
sejam transgnicos, o que fica evidente no
Consequncias ambientais, mas sem preci-
uso errneo de termos como DNA, mol-
sar exatamente quais seriam essas consequ-
cula e clula. Essa fragilidade traz dificul-
ncias. Para outros 17%, as consequncias
dades para que os alunos posicionem-se em
seriam benficas ao meio ambiente.
relao s implicaes socioambientais dos
Para 36% dos alunos no h consequncias transgnicos.
para o meio ambiente. Desses, 40% no apre-
A noo de perfil conceitual (Mortimer,
sentam justificativas especficas. Alm disso,
1996) auxilia o entendimento da permann-
40% acreditam que os transgnicos trazem
cia de concepes alternativas mesmo entre
benefcios para o meio ambiente e 20% di-
os alunos que passaram por processos de
zem que os danos so mnimos, ou seja, os
ensino de noes cientficas. Nesse processo,
transgnicos danificariam pouco o meio
tem-se o reconhecimento de que as ideias
em que vivemos. Esses dados contm uma
prvias e cientficas podem permanecer e
contradio, pois mesmos alunos que res-
conviver, sendo usadas em contextos varia-
pondem que no h implicaes ambientais,
dos. Ao analisarmos as questes 1 e 2 da par-
justificam essa negao dizendo que o meio
te B, percebemos que os alunos apresentam
ambiente favorecido pelos transgnicos.
pouca proximidade com o conhecimento
Isso sugere que consideram que a palavra
cientfico necessrio para compreender o que
implicao indica apenas consequncias
um organismo transgnico. Com base nas
negativas, ignorando as positivas.
questes 4 e 5, conclumos que os alunos tm
Dos alunos que responderam questo de clareza das implicaes sociais sobre o uso de
nmero cinco, 21% dizem que talvez haja organismos transgnicos, porm no conse-
implicaes ambientais na utilizao dos guem avaliar as implicaes ambientais. Es-
transgnicos, demonstrando incerteza com ses resultados aproximam-se dos de Pedran-
relao a essa questo. cini et al. (2008) que relaciona o fato de as
Existe muita proximidade das frequncias concepes de estudantes de Ensino Mdio
nas categorias sim, no e talvez, o que no ultrapassarem o senso comum falta de
indica fragilidade, na turma como um todo, domnio de conceitos cientficos. Essa falta
em relao aos conceitos envolvidos. Para de domnio pode induzir os estudantes a
responder a questo relacionada s implica- reproduzir o discurso cientificamente pou-
es ambientais do uso dos transgnicos, os co embasado da mdia ou de outros grupos
alunos necessitariam de conceitos de vrias influentes. Contudo, os dados coletados no
reas da Biologia como, por exemplo, Eco- foram extensivos, o que uma limitao
logia e Gentica. Esses conceitos so mais desse estudo; seria interessante apresentar
complexos de se elaborarem se comparados questes em outros contextos para verificar
s implicaes sociais, pois essas so mais se os alunos, de fato, possuem as concepes
prximas do cotidiano dos alunos. detectadas por esse trabalho.

Sociedade Brasileira de Gentica 65


INVESTIGAES EM ENSINO DE GENTICA

No entanto, esses dados so expressivos por Lawrence Erlbaum Associates, p. 385-400,


mostrar que os alunos interessam-se em co- 1995.
nhecer mais os transgnicos e que esse um GRIFFITHS, A. J. F., Gelbart, W. M., Miller,
tema que merece ser considerado pelos pro- J.H., Lewontin, R.C. Introduo Gentica.
fessores do Ensino Mdio ao montarem seus Traduo de Paulo A. Mota. Rio de Janeiro:
planejamentos. Apesar disso, os livros did- Guanabara Koogan, 9 Edio, 2008. 740 p.
ticos quase no tratam de assuntos ligados MELO, J. ; CARMO, E. M. Investigaes sobre
Biotecnologia e do mais nfase Gentica o ensino de gentica e biologia molecular no
Clssica (XAVIER et al.2006). Assim sen- ensino mdio brasileiro: reflexes sobre as
do, conclumos que h necessidade de abor- publicaes cientficas. Cincia & Educao,
dar com mais nfase a Biologia Molecular v.15, n.3, p. 593-611, 2009.
e Biotecnologia nos currculos do Ensino MORTIMER, E. Construtivismo, mudana
Mdio, mesmo que os materiais didticos conceitual e ensino de cincias: para onde
convencionais no tratem desse assunto, de vamos? Investigaes em Ensino de Cin-
maneira que propomos que sejam utilizados cias, Serra Negra, Vol. 1, n. 1, p. 20-39, 1996.
diferentes recursos didticos e tecnolgicos PAIVA. A L. B.; MARTINS, C.M.C. Concep-
para o ensino desses temas. Alm disso, cabe es prvias de alunos de terceiro ano do
aos professores dar mais ateno s compe- ensino mdio a respeito de temas da rea de
tncias envolvidas nas prticas discursivas, gentica. Ensaio- Pesquisa em Educao em
principalmente argumentao e, nesse con- Cincias, Minas Gerais, v.7, n. 3, 2005.
texto, necessrio retratar o conhecimento PEDRANCINI, V. D. et al. Ensino e apren-
cientfico como socialmente construdo. A dizagem de Biologia no ensino mdio e a
habilidade de apresentar e avaliar argumen- apropriao do saber cientfico e biotecnol-
tos, principalmente os veiculados pela mdia, gico. Revista Eletrnica de Enseanza de ls
s ser desenvolvida se os estudantes forem Ciencias, Maring, vol. 6, n. 2, p. 299 309,
capazes de relacionar o conhecimento cient- 2007.
fico escolar s questes que esto em debate PEDRANCINI, V. D. et al. Saber cientfico e
na sociedade. conhecimento espontneo: opinies de alu-
nos do ensino mdio sobre transgnicos. Ci-
REFERNCIAS ncia & Educao, Bauru, v. 14, n. 1, p. 135
146, 2008.
CACHAPUZ, A. GIL-PEREZ, D., VIL-
CHES, A. A necessria renovao do ensino POZO, J. I.; GMEZ CRESPO, M. A. A
das cincias. So Paulo: Cortez, 2005. 263 p. Aprendizagem e o ensino de cincias: do
conhecimento cotidiano ao conhecimento
CARVALHO, J. C. Q.; BOSSOLAN, N. R. S.
cientfico. Traduo Naila Freitas, 5 ed.
Algumas concepes de alunos do ensino
Porto Alegre: Artmed, 2009. 296 p.
mdio a respeito das protenas. VII Encon-
tro Nacional de Pesquisa em Educao em VYGOTSKY, L. S. A construo do pensamen-
Cincias, Florianpolis, 2009. to e da linguagem. Traduo: Paulo Bezerra.
2 Ed. So Paulo: Martins Fontes, 2009. 520
CRESWELL, J. Projeto de Pesquisa: mtodos
p.
qualitativos, quantitativos e mistos. Tradu-
o: Luciana de Oliveira da Rocha. 2 Ed. XAVIER, M. ; FREIRE, A. ; MORAES, M. A
Porto Alegre: Artmed, 2007. 296 p. nova (moderna) biologia e a gentica nos li-
vros didticos de biologia no ensino mdio.
DRIVER, R. Constructivist approaches in
Cincia e Educao, Brasil, vol. 12, n. 3, p.
science teaching. Steffe, L.P.& Gale, J. (Eds).
275-289, 2006.
Constructivism in education. Hillsdale, NJ:

66 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

ANEXO 1 QUESTIONRIO APLICADO AOS ALUNOS PESQUISADOS

PARTE A interesse sobre o assunto; e 3 que voc


1. Quando foi a ltima vez que estudou so- extremamente interessado em assuntos
bre transgnicos? que abordam a Biotecnologia, sobretudo
( ) Este ano os Transgnicos.
( ) Ano passado ( )1
( ) No me lembro ( )2
( ) H muito tempo ( )3

2. Quanto voc lembra, caso tenha estuda- 5. H alguma implicao social ou ambiental
do? quando fazemos o uso da Biotecnologia?
( ) Muito ( ) Sim
( ) Mdio ( ) No
( ) Pouco
( ) Nada
PARTE B
1. O que DNA?
3. Qual o meio de divulgao que voc en-
contra esse assunto?
2. O que so transgnicos?
( ) Livro didtico
( ) Internet
3. Voc faria uso de algum produto transg-
( ) TV
nico? Justifique sua resposta.
( ) Rdio
( ) Revistas
4. H alguma implicao social na utilizao
( ) Outros. Especifique: ____________
dos transgnicos? Se sim ou no, exempli-
______________________________
fique.
4. Qual o grau de seu interesse pelo tema.
5. H alguma implicao ambiental na uti-
Avalie em uma escala crescente de 1 a 3,
lizao dos transgnicos? Se sim ou no,
sendo que 1 indica que no h interes-
exemplifique.
se algum de sua parte; 2 indica que h

Sociedade Brasileira de Gentica 67


CONCEITOS DE GENTICA

Carga gentica
Sergio Russo Matioli

Departamento de Gentica e Biologia Evolutiva,


Instituto de Biocincias, Universidade de So Paulo

Autor para correspondncia: srmatiol@ib.usp.br

68 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

C arga gentica definida como a frao de uma populao que deixa de sobreviver
ou de se reproduzir por causa das caractersticas que so determinadas
geneticamente. Trata-se, portanto, de um conceito que somente tem sentido
populacional. Encontramos, entretanto, esse termo frequentemente empregado
erradamente como sinnimo de outros conceitos, tais como genoma, gentipo
ou patrimnio gentico, especialmente em publicaes no especializadas ou em
tradues descuidadas.

HISTRICO dos cidos nuclicos e que no so reparadas


por algum dos mecanismos de reparo que

Mecanismos de reparo
O termo carga gentica uma traduo
do termo em ingls genetic load, que
foi primeiramente empregado pelo evolucio-
existem no interior das clulas. Assim como
a replicao dos cidos nuclicos no 100%
do DNA so conduzidos por perfeita, o reparo tambm no . Assim, em
enzimas que detectam problemas nista norte-americano, ganhador do prmio
cada gerao, sempre podem ser produzidos
na fita de DNA e que podem Nobel, H.J. Muller, em 1950 (Muller, 1950).
corrigir tais problemas, aps mutantes nos gametas que originaro os in-
Segundo o tambm norte-americano Bruce
a replicao da molcula. divduos da prxima gerao. A proporo de
Os problemas resultam de
Wallace, o conceito de carga gentica j ha-
ocorrncia de mutaes muito baixa, muito
incorporao indevida de via sido empregado pelo evolucionista ingls
prxima de zero. Estimou-se recentemente
nucleotdeos, despurinao de J.B.S. Haldane, em 1937, sob o epteto de
nucleotdeos, dimerizao de que, a partir de sequenciamento completo
loss of fitness (perda de aptido darwi-
bases nitrogenadas, entre outros. de genomas de trios formados por pai, me e
niana, Wallace, 1991). Podemos expressar a
As enzimas de reparo reagem filho de seres humanos, existe uma chance de
com a fita de DNA distorcida carga gentica (L) de uma populao como
ocorrer mutao em 1 nucleotdeo para cada
pela presena de um nucleotdeo a diferena relativa entre o valor adaptativo
83 milhes de nucleotdeos replicados por
mal-emparelhado e repem mximo de um gentipo (Wmax) e o valor
sequncias nucleotdicas no lugar gerao. Parece um nmero muito pequeno
daquelas que foram alteradas.
adaptativo mdio da populao ( W ): L = mas, ao sabermos que o genoma humano
(Wmax - W ) / Wmax. Se o valor adapta- possui cerca de trs bilhes de nucleotdeos,
O valor adaptativo um tivo mximo for arbitrariamente estipulado podemos calcular a quantidade de nucleot-
valor numrico que reflete a em 1, a carga gentica da populao reduz- deos mutantes que est presente em cada ga-
probabilidade de sobrevivncia
-se expresso mais simples L = 1 - W . Tal meta produzido. Basta dividir 3 bilhes por
e de reproduo de cada um
dos gentipos. Normalmente definio precisa foi feita por Crow (Crow, 83 milhes, o que resulta em cerca de 3.000
esse valor expresso em relao 1964; Crow e Kimura, 1970). Existem vrias mutantes. Isso mesmo, para cada gameta for-
ao gentipo mais adaptado causas genticas possveis para a diminuio mado, 3.000 posies nucleotdicas estaro
e, nesse caso, chamado de
do valor adaptativo mdio de uma popula- com uma base nitrogenada diferente daque-
valor adaptativo relativo. O
valor adaptativo mdio de uma o. A seguir abordaremos cada uma dessas la que existia na mesma posio em relao
populao a mdia ponderada causas e como elas contribuem para a carga ao genoma do pai (ou da me) que formou
dos valores adaptativos dos gentica de uma populao. o gameta, isto , no mutante a sequncia de
gentipos de um lcus, cada bases nitrogenadas da molcula de DNA
um desses valores adaptativos
sendo multiplicado pela CARGA GENTICA diferente daquela da molcula no mutada.
frequncia do gentipo MUTACIONAL Como as mutaes no podem ser previstas
correspondente. individualmente, esses nmeros so estima-
As mutaes so eventos inevitveis que
tivas mdias.
ocorrem durante os processos de diviso
celular. Se as mutaes ocorrem durante a As mutaes podem variar quanto ao seu
produo de gametas (vulos ou esperma- efeito. As mutaes podem ser classificadas
tozides), elas so chamadas de mutaes de deletrias (ou prejudiciais) caso afetem
genticas, pois podem passar para os descen- negativamente alguma funo desempenha-
dentes. As mutaes originam-se de leses da pela molcula mutada: de neutras, caso
ou erros que ocorrem durante a replicao no afetem a funo dessa molcula ou at

Sociedade Brasileira de Gentica 69


CONCEITOS DE GENTICA

mesmo podem ser benficas, caso a mol- As informaes sobre a neutralidade de mu-
cula mutada possa desempenhar sua funo taes so provenientes de experimentos que
melhor nas condies ambientais nas quais alteram propositadamente a sequncia de
o organismo vive presentemente. Acredita- nucleotdeos em genes escolhidos e tambm
-se que a maioria das mutaes seja neutra a partir da comparao de molculas de dife-
quanto ao seu efeito, uma vez que se sabe rentes organismos, que funcionam da mes-
que, para cada molcula que sintetizada ma maneira. Mesmo sabendo que a maioria
a partir da informao contida na sequn- das mutaes tm efeito neutro, a probabi-
cia de nucleotdeos, uma quantidade muito lidade de haver uma mutao prejudicial
grande de molculas diferentes pode realizar bem maior que a probabilidade de haver
a mesma funo. Uma grande parte das po- uma mutao benfica, j que os organismos
sies das macromolculas equivalente aos resultam de um longo processo de adapta-
coringas das cartas de um baralho. Seja, por o aos seus ambientes e, como se diz em
exemplo, a sequncia de aminocidos de um futebol, em time que est ganhando no se
trecho de uma protena hipottica [leucina, mexe, pois mais fcil estragar que melho-
valina, prolina, glicina]. Se a sequncia for rar. A carga gentica mutacional , portanto
mutada para [leucina, isoleucina, prolina, a frao de indivduos cujas mutaes pro-
glicina] a molcula poder se comportar de duziram algum efeito prejudicial de tal for-
forma semelhante quela anterior, dado que ma que suas probabilidades de sobrevivncia
a isoleucina muito semelhante quimica- ou reproduo ficaram diminudas, ponde-
mente valina. rada pela diminuio dessas probabilidades.

A CARGA GENTICA MUTACIONAL PODE SER ESTIMADA


Comecemos com um exemplo bastante simples, onde h mutaes para um alelo que letal dominante,
ou seja, basta a presena de um nico alelo mutado em um indivduo para que ele no sobreviva at a fase
adulta. Assim, ao nascer, todo indivduo portador desse alelo no deixar descendentes. Evidentemen-
te tais indivduos no herdaram esse alelo de algum dos
pais, j que esses, se o tivessem, no teriam sobrevivido e,
portanto, no teriam deixado descendentes. Assim, todo
indivduo que possua esse alelo seria devido a um evento
de mutao. Como as taxas de mutao so muito bai-
xas, podemos simplesmente desprezar a ocorrncia de
indivduos homozigotos para esse alelo letal. Assumimos,
portanto, que esses indivduos que apresentam tal muta-
o herdaram-na de uma mutao nova que aconteceu na
formao do gameta do qual originrio. Assim, a carga
gentica da populao para um alelo dominante letal
simplesmente igual taxa de mutao para esse alelo.
No caso de um alelo letal (ou de esterilidade) recessivo,
o raciocnio um pouco mais complicado e exige uma
premissa de equilbrio entre mutao e seleo. Assim,
a proporo de alelos que eliminada da populao por
seleo, igual proporo de alelos produzidos por mu-
tao nessa gerao. Matematicamente, a carga gentica
nesse caso a metade do valor da taxa de mutao.

Figura 1.
Carga gentica mutacional.

70 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

CARGA GENTICA (na proporo de para cada um dos tipos).


Assim, uma populao que apresenta supe-
SEGREGACIONAL rioridade do heterozigoto ser polimrfica
Assim como os alelos em um lcus gnico para os alelos implicados e sempre apresen-
Diz-se que uma populao
polimrfica com relao podem apresentar relaes de dominncia/ tar carga gentica que resulta da segregao
a um lcus gnico quando recessividade ou codominncia, eles po- mendeliana enquanto houver essa vantagem.
a frequncia do alelo de dem tambm apresentar uma relao de Existem, entretanto, poucos exemplos bem
frequncia mais baixa sobredominncia. Isso acontece quando a
superior quela que poderia demonstrados da existncia de um polimor-
ser explicada unicamente por
caracterstica do indivduo heterozigoto fismo gentico que seja mantido pelo efeito
mutao recorrente (1%, por superior quelas de ambos os homozigotos de sobredominncia.
conveno). quanto aos alelos presentes no heterozigo-
to. Nesse caso, a populao idealmente mais A heterose, ou o vigor hbrido, um fen-
adaptada seria constituda apenas por indi- meno que ocorre quando duas linhagens
vduos heterozigotos. Entretanto, em uma so cruzadas e os descendentes apresentam
Existe codominncia
populao composta somente por indivduos frequentemente caractersticas superiores
quando se detecta no fentipo
do heterozigoto o efeito heterozigotos, obviamente s poderia haver quelas dos progenitores. Existem exemplos
dos dois alelos presentes cruzamentos entre indivduos heterozigotos. experimentais abundantes da heterose, tanto
cada um em dose dupla nos
Sabemos, a partir da primeira lei de Mendel, em plantas quanto em animais. A real influ-
homozigotos. Quando o ncia da sobredominncia na manifestao
fentipo do heterozigoto que um cruzamento entre indivduos hetero-
claramente distinguvel dos zigotos produzir, na prxima gerao, tan- da heterose, entretanto, ainda objeto de
dois homozigotos, fala-se em to indivduos heterozigotos (na proporo amplo debate entre pesquisadores de gen-
dominncia incompleta. O esperada de ) e indivduos homozigotos tica quantitativa.
caso dominncia incompleta
inclui, portanto, o caso
codominncia.

Figura 2
Carga gentica segregacional.

CARGA GENTICA de interaes epistticas. Isso ocorre quando


os produtos dos diferentes lcus gnicos con-
RECOMBINACIONAL versam bioquimicamente. Por exemplo, exis-
Alm das interaes que existem entre alelos tem lcus gnicos que codificam para horm-
de um mesmo lcus gnico, tais como os efei- nios e lcus que codificam para os receptores
tos de dominncia ou sobredominncia, exis- desses hormnios. Para que haja uma deter-
tem tambm interaes entre alelos de lcus minada resposta ao de um hormnio,
diferentes. A essas interaes se d o nome necessrio que haja um encaixe molecular

Sociedade Brasileira de Gentica 71


CONCEITOS DE GENTICA

entre o hormnio e o receptor. Se esse encai- r [h1h1,r1r1] teria um fentipo timo para a
xe for parcial, a resposta ao do hormnio resposta hormonal, o mesmo ocorrendo com
ser menor e, portanto, ineficiente. Caso haja indivduos homozigotos [h2h2,r2r2]. Um
um encaixe muito estvel, a ao do horm- cruzamento entre esses indivduos homozi-
nio prolongar-se- e tambm ser ineficiente. gotos produziria heterozigotos [h1h2,r1r2],
Assim, pode haver pares diferentes de hor- cuja resposta hormonal no seria adequada,
mnios e receptores que interagem adequa- por possurem pares de hormnios e recepto-
damente. Imagine que o par [hormnio1, res no plenamente compatveis. Os gametas
receptor1], (representado como [h1,r1]) recombinantes produzidos por esse indiv-
seja adequado para a funo e o par [h2,r2] duo duplo heterozigoto, em homozigose, po-
tambm seja igualmente adequado. Imagine deriam produzir gentipos duplamente ho-
tambm que os pares [h1,r2] e [h2,r1] no mozigotos [h1h1,r2r2] e [h2h2,r1r1], bem
apresentem respostas adequadas, por haver mais ineficientes quanto a sua resposta hor-
algum tipo de incompatibilidade entre o hor- monal. A frao de indivduos que possuem
mnio h1 e o receptor r2, ou entre o horm- pares de alelos de lcus diferentes cujos pro-
nio h2 e o receptor r1. Imagine que h1 e h2 dutos no interagem adequadamente e que
sejam codificados por alelos do lcus h e que se originaram por eventos de recombinao
r1 e r2 sejam codificados por alelos do lcus r. corresponde carga gentica recombinacio-
Um indivduo homozigoto para os lcus h e nal da populao.

Figura 3.
Carga gentica recombinacional.
PODE HAVER EVOLUO populaes. Ento a resposta a essa pergunta
sim.
SEM CARGA GENTICA? A deriva gentica o nome
Podemos definir geneticamente a evoluo PODE HAVER CARGA que se d ao fenmeno de
como herana com modificao. Tambm mudana de frequncias allicas
podemos definir evoluo como a alterao GENTICA SEM EVOLUO? ao longo do tempo devida
aleatoriedade dos fenmenos de
de frequncias allicas ao longo do tempo. Com j vimos, no caso da carga gentica segre- transmisso de genes. A deriva
Tais definies so bastante abrangentes pois gacional, com superioridade dos heterozigotos, gentica mais pronunciada
tambm incluem a chamada evoluo neutra, no estado de equilbrio, uma populao sempre em populaes pequenas e
ou seja, a evoluo que se deve deriva ge- produzir indivduos homozigotos, que so os em alelos que alteram nada ou
muito pouco o valor adaptativo
ntica que atua na variao gentica sem in- menos adaptados. Nesse caso, a populao dei-
dos gentipos correspondentes
fluncia na sobrevivncia ou na reproduo xar de evoluir quanto ao lcus gnico envolvi- (mutaes neutras).
dos indivduos. A evoluo neutra no im- do, mas a carga gentica continuar presente na
plica, portanto, qualquer carga gentica nas eliminao de indivduos homozigotos.

72 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

PODE HAVER POPULAES tais como - esse o fardo que eu tenho que
carregar - expressam melhor o significado
SEM CARGA GENTICA? com teor de prejuzo da palavra fardo em
possvel acontecer populaes sem car- relao palavra carga. Assim, se os estu-
ga gentica, mas apenas em populao sem dantes de gentica associarem o termo carga
qualquer variao gentica, ou somente com gentica com um fardo, esse conceito ficar
variao gentica neutra. No entanto, essa mais sedimentado.
uma considerao apenas terica. Como vi-
mos, os eventos de mutao so inevitveis, DEDICATRIA
mesmo se considerarmos os mecanismos de
reparo de DNA. Uma frao dos mutantes Esse artigo dedicado memria do Prof.
produzidos deletria e, na prtica, impos- Luiz Edmundo de Magalhes (1927-2012)
svel conceber-se uma populao completa- com quem aprendi muito sobre essa mara-
mente isenta de carga gentica. vilhosa rea que a gentica de populaes.

CARGA GENTICA COMO AGRADECIMENTOS


Gostaria de agradecer ao pessoal do Ncleo
O PREO DA EVOLUO
de Ilustraes do IB-USP (ilustracaoibusp@
Frequentemente se diz que a carga genti- gmail.com), pelas belas figuras que eles pre-
ca corresponde ao preo que as populaes pararam para esse artigo, Laura Montserrat
pagam ao evoluir. Isso correto somente (ilustrao do fardo), Marina Satie Koidara
quanto chamada evoluo adaptativa, ou de Medeiros (figura 1) e Marcelo Tom Kubo
seja, aquela que implica seleo natural, pois (figura 2). Agradeo tambm aos colegas, ami-
essa definida como a sobrevivncia ou re- gos e professores Dra. Eliana Maria Beluzzo
produo diferencial entre indivduos com Dessen e Dr. Paulo Alberto Otto pelas suges-
gentipos diferentes. Na evoluo neutra, ou tes precisas e preciosas feitas para esse artigo.
seja, aquela que ocorre por deriva gentica
de mutaes neutras, ocorre evoluo sem
seleo natural. Trata-se, portanto, de uma
REFERNCIAS
CROW, J.F. The theory of genetic loads. Gene-
evoluo gratuita, sem esse nus. Por outro
tics today. Pergamon Press, Oxford, 1964,
lado, numa populao que est em equilbrio
pp. 495-506.
e sujeita seleo natural que atua em lcus
gnicos com sobredominncia, h carga ge- CROW, J. F.; KIMURA, M. An introduction to
ntica sem haver evoluo nos lcus gnicos population genetics theory. Harper & Row,
New York, 1970 (reprint by Burgess Pu-
considerados. Nesse caso, a populao paga
blishing).
o preo da carga gentica sem evoluir. Para
generalizar, podemos dizer que a carga gen- HALDANE, J. B. S. The effect of variation on
tica o preo que as populaes pagam ao fitness. American Naturalist, v. 71 p. 337-
sofrerem seleo natural. 349, 1937.
KONG, A.; FRIGGE, M. L.; MASSON, G. et
CONCLUSO al. Rate of de novo mutations and the impor-
tance of fathers age to disease risk. Nature, v.
Embora o termo carga gentica tenha um 488, p. 471-475, 2012.
significado preciso dentro do mbito da
gentica populacional, o seu emprego com MULLER, H. J. Our load of mutations. Ame-
rican Journal of Human Genetics, v. 2 p.
outros significados tem gerado alguma con-
11176, 1950.
fuso. Portanto, muito importante que o
significado correto desse termo seja enfati- WALLACE, B. Fifty years of genetic load: an
zado. A palavra carga pode ser substituda, odyssey. Cornell University Press, Ithaca,
sem prejuzo, pela palavra fardo. Expresses 1991.

Sociedade Brasileira de Gentica 73


GENTICA E SOCIEDADE

ALFRED RUSSEL
WALLACE
Coproponente da seleo natural,
tributo ao centenrio de seu falecimento

Joo Stenghel Morgante

Departamento e Gentica e Biologia Evolutiva, Instituto de Biocincias, Universidade de So Paulo

Autor para correspondncia jsmorgan@ib.usp.br

74 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

C harles R. Darwin e Alfred Russel Wallace revolucionaram o pensamento humano com


a proposio da teoria da Evoluo por Seleo Natural, que acabou sendo conhecida
por revoluo darwiniana, com influncias at mesmo fora da Biologia. Os dois cientistas,
embora com trajetrias muito diferentes, Darwin membro de uma famlia aristocrata e com
formao universitria e Wallace, um autodidata originrio das camadas mais baixas da
sociedade, deram ao mundo uma nova maneira de ver a biodiversidade. Este artigo aborda
aspectos da vida e da obra destes eminentes naturalistas ingleses.

E m 2009, o livro A Origem das espcies


(On the origin of species) de Charles Da-
rwin, completou 150 anos de publicao (DA-
foram apresentadas por Sir Charles Lyell e
Joseph D. Hooker em 1858 e publicadas no
Journal of the Linnean Society (Zoology) no
RWIN, 1859). Esta uma obra seminal que ano seguinte (HOOKER; LYELL, 1859).
causou um grande impacto na forma como
Darwin no compareceu a essa reunio. Ficou
entendemos a natureza, pois provocou signi-
em sua casa em Down, a 24 km de Londres.
ficativas transformaes cientficas, sociais e
Estava de luto, pois seu filho caula Charles
religiosas no Ocidente e continua provocando
Waring Darwin, de dezoito meses, falecera
polmicas at hoje. Mritos para Darwin, pois
em 28 de junho. Wallace estava a milhares
suas ideias levaram a uma das maiores revo-
de quilmetros de distncia, na Indonsia, e
lues cientficas do sculo do sculo XIX,
nada sabia sobre os acontecimentos na So-
contribuindo para destruir o conceito antro-
ciedade Lineana. Quando soube, confessou-
pocentrista do Universo (COHEN, 2001) e
-se espantado e considerou os arranjos para
causando um choque no pensamento da hu-
publicao satisfatrios (BROWNE, 2007).
manidade sem similar a qualquer outro avan-
o cientfico desde o ressurgimento da Cincia Contudo, a apresentao das comunicaes
no Renascimento (MAYR, 1972). no causou impacto na sociedade cientifica,
como expressou o presidente da Sociedade Li-
AS COMUNICAES DE neana, o zologo Thomas Bell (1792-1880),
ao afirmar no relatrio anual da Sociedade
DARWIN E WALLACE que o ano de 1858 no foi marcado por ne-
APRESENTADAS NA nhuma descoberta sensacional que revolucio-
SOCIEDADE LINEANA nasse, por assim dizer, a sociedade cientfica
A primeira referncia sobre a evoluo por se- que ele presidia. O impacto s ocorreu em 24
leo natural foi em uma reunio da Socieda- de novembro de 1859, quando da publicao
de Lineana de Londres (The Linnean Society do livro de Darwin A Origem das Espcies
of London) realizada em 1 de julho de 1858, (DARWIN, 1859). Justas homenagens para
ocasio em que foram apresentadas duas co- Darwin pela publicao de sua obra, que teve
municaes relacionadas ao tema: Sobre a enorme impacto na civilizao ocidental. En-
tendncia das espcies a formar variedades; e tretanto, seria injusto omitir o nome de Alfred
Sobre a perpetuao das variedades e espcies Russel Wallace, pois ele dividiu com Darwin
por meios naturais de seleo, tendo como au- a primeira publicao sobre seleo natural e
tores Charles Robert Darwin e Alfred Russel deve ser creditado como coproponente. Afinal,
Wallace, respectivamente. As comunicaes quem foi Wallace e qual foi a sua contribuio?

Sociedade Brasileira de Gentica 75


GENTICA E SOCIEDADE

DARWIN E WALLACE: 19 anos, um aprendiz de construtor. Os me-


ses que passou em Londres foram importantes
HISTRIAS DE VIDA para seu desenvolvimento intelectual, frequen-
DISTINTAS tou aulas no Instituto de Mecnica de Londres
Darwin pertencia a uma famlia abastada. Seus (London Mechanics Institute), onde tomou
avs Erasmus Darwin e Josiah Wedgwood I conhecimento das ideias polticas de reformas
foram cientistas influentes em seu tempo. Am- sociais radicais de Robert Owen (1771-1858),
bos foram filiados Royal Society do Reino que contriburam para a formao de seu ceti-
Unido e tambm membros fundadores da Lu- cismo religioso e de suas ideias reformistas e
nar Society de Birmingham, sociedade que de- socialistas (CAMERINI, 2002).
sempenhou papel intelectual de destaque nas
Nesse mesmo ano, Darwin, com 28 anos,
atividades da Revoluo Industrial na Inglater-
recm-chegado da viagem do Beagle, passou
ra. Erasmus Darwin foi mdico e dedicava-se a
a residir em Londres e tornou-se amigo do
mltiplas atividades: poeta, inventor de artefa-
gelogo Charles Lyell (1797-1875) e do or-
tos mecnicos, pioneiro em meteorologia, au-
nitlogo John Gould (1804-1881). Iniciou a
tor de Zoonomia, de um tratado mdico. Em
identificao das espcies de aves, coletadas
um poema intitulado The Temple of Nature
durante a sua viagem e, em julho, abriu o pri-
podem ser encontradas referncias s ideias
meiro caderno de notas sobre transmutao
evolutivas, o que o torna considerado um dos
das espcies.
pioneiros a abordar a ideia de transmutao
das espcies (KEYNES, 2004). Ainda em 1837, Wallace deixou Londres e
foi trabalhar em Bedfordshire com seu irmo
Em 1825, aos 16 anos, Charles Darwin des-
William, de quem recebeu treinamento em
loca-se para Edimburgo (Esccia) e ingressa
agrimensura. Durante seis anos trabalhou
no curso de Medicina, que abandona em 1827.
com William em diferentes localidades da
Aos 18 anos, matricula-se no Christs College
Inglaterra e Pas de Gales. Em dezembro de
da Universidade de Cambridge para cursar
1843, os negcios de William sofreram uma
Artes, primeiro passo na carreira de clrigo da
diminuio em atividades e ele foi obrigado a
Igreja Anglicana. Assim, recebeu educao for-
dispensar os trabalhos do irmo.
mal nas prestigiadas Universidades de Edim-
burgo e Cambridge, alm da oportunidade de Em 1844, com 20 anos, Wallace passou a viver
realizar uma viagem de circunavegao (1831- em Leicester, onde encontrou trabalho no Col-
1836) a bordo do brigue HMS Beagle, uma legiate School de Leicester para ensinar arit-
espcie de embarcao vela a servio da Ma- mtica, lgebra, desenho, cartografia e topo-
rinha Real Britnica. Um relato da viagem do grafia. Curioso e determinado, aproveitou seu
Beagle, incluindo informaes adicionais sobre tempo livre para leituras na biblioteca da cida-
a vida e obra de Darwin, pode ser encontrada de. Nesse perodo, ampliou seus conhecimen-
na publicao de Morgante e Meyer (2009). tos e fortaleceu sua formao. Leu, entusiasma-
do, os principais livros sobre Histria Natural
Wallace (1823-1913) nasceu em Usk, Mon-
que relatavam grandes viagens, entre eles o de
moutshire, Gr-Bretanha, em 8 de janeiro de
Alexander von Humboldt (Personal Narrati-
1823. Sua histria de vida contrasta com a de
ve of a Journey to the Equinoctial Regions of
Darwin, pois Wallace nasceu em uma famlia
the New Continent, de 1827) e o de Darwin
pobre e, desde muito jovem, trabalhou para so-
(Journal of Researches into the Geology and
breviver. Em 1828, quando tinha cinco anos,
Natural History of the Various Countries Vi-
sua famlia mudou-se para Hertford onde ele
sited by H. M. S. Beagle London de 1839),
frequentou a escola fundamental (Hertford
que lhe despertaram o interesse em conhecer
Grammar School). As precrias condies fi-
os trpicos. Entre os livros que considerava
nanceiras da famlia no final de 1836 no per-
importantes para sua formao, destaca-se o
mitiram a continuidade de seus estudos. Foi o
Essay of the Principle of Population de Tho-
nico perodo em que recebeu alguma educa-
mas Robert Malthus (1766-1834), alm dos
o formal.
livros de Charles Lyell sobre Geologia que o
Em 1837, com 14 anos, foi morar em Londres ajudaram a interpretar suas observaes sobre
para viver com seu irmo mais velho John, de a sucesso das espcies no espao e no tempo.

76 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

Meses aps sua chegada em Leicester, conhe- Darwin, que em 1844 j tinha um ensaio de
ceu Henry Walter Bates (1825-1892), filho 231 pginas sobre a Evoluo, escreveu uma
de um fabricante de meias que fora aprendiz carta a sua esposa Emma Darwin (1808-
na fbrica do pai. Aos 14 anos, Bates deixou 1896), em julho do mesmo ano na qual afir-
a escola e passou a frequentar aulas noturnas ma que, caso ele sofresse uma morte sbita,
no Instituto de Mecnica. Como naturalista ela deveria contratar um editor para fazer
foi um autodidata e suas atividades transfor- uma publicao pstuma. Acredita-se que,
maram Wallace em entusiasmado coletor de depois da leitura do livro de Chambers, Da-
insetos com destaque para os besouros. Foi rwin teve um choque, pois em termos gerais,
um memorvel encontro para a vida dos dois a tese central do livro era semelhante s suas,
e com repercusso significativa no desenvolvi- conforme descritas no ensaio de 1844. Em-
mento da Biologia (FERREIRA, 1990). bora muitos fatos apresentados por Cham-
bers fossem incorretos, o livro continha o
A sociedade vitoriana foi abalada quando, em
princpio essencial das origens progressivas
1844, foi publicado anonimamente o livro
e naturais das espcies (BROWNE, 2007).
Vestiges of the Natural History of Creation
A comoo causada pelo livro de Chambers
(Vestgios da Histria Natural da Criao),
teria sido uma das razes da no publicao
que se tornou um fenmeno editorial. O livro
do ensaio de Darwin.
pode ser considerado como uma das mais im-
portantes contribuies pr-darwinianas so- Wallace, o autodidata mais jovem e fora do
bre a evoluo das espcies. Foram publicadas ambiente cientfico vitoriano, leu o livro de
12 edies e somente na ltima, a de 1884, foi Chambers no final de 1845 e considerou a
revelado o nome do autor, Robert Chambers engenhosa tese apresentada como um desa-
(1802-1871), um jornalista e editor escocs fio para buscar novos dados que deveriam
bem sucedido e que j havia falecido. Ao co- ser confrontados com aqueles apresentados
mentar o livro, Browne (2007) destacou que no livro.
ele transformara o debate sobre a evoluo,
Em 1846, Darwin iniciou seu o trabalho
pois causara irritao entre cientistas e telo-
com cracas (Cirripedia), crustceos mari-
gos alm de intenso debate na sociedade vito-
nhos ssseis que vivem fixados a rochas e
riana com impacto constrangedor para alguns
em outros objetos flutuantes, encerrados em
e fascinao para outros.
uma carapaa calcria, com formato seme-
lhante a um pequeno vulco. Dedicou oito
anos de pesquisa anatomia e taxonomia
desses animais, resultando na publicao de
duas monografias em 1854.
Em fins de 1847, motivados provavelmen-
te pela leitura do livro Willian H. Edward
(1822-1909) Voyage up the River Amazon,
Wallace, ento com 25 anos, e Bates, com 23,
decidiram planejar uma viagem ao Brasil.
Bates (1863) relata no prefcio de seu livro
The Naturalist on the River Amazons que:
O plano consistia em fazer uma coleo de
objetos, isto , insetos, pssaros, peixes, etc,
vender as duplicatas em Londres para pagar
as despesas, e assim obter dados com o obje-
tivo, como o Sr. Wallace expressou em uma
de suas cartas, de resolver o problema da ori-
gem das espcies, um assunto sobre o qual
ns tnhamos conversado muito e discutido
na nossa correspondncia (FERREIRA,
1990 apud BATES, 1863).

Sociedade Brasileira de Gentica 77


GENTICA E SOCIEDADE

CRONOLOGIA 1809-1862
Alfred R. Wallace

1828
1823

Passa a residir em Hertford e


frequenta a Hertford Grammar
School, o nico perodo de
ensino formal em sua vida.

As condies

1836
econmicas
da famlia
08/01/1823 impedem a
Nasce Alfred Russel Wallace continuidade
em Monmouthshire, USK. dos seus
estudos.

1809

Inicia suas atividades no


Christs College -
12/02/1809 Universidade de Cambridge.
Nasce Charles Robert Darwin 27/12/1831 a 02/10/1836
em Shrewsbury, Shopshire, Viagem no HMS BEAGLE
Inglaterra. (5 anos e 10 meses) Passa
a residir em Londres e a
distribuir os espcimens
1828

coletados para identificao.


As aves so identificadas
por John Gould e estabelece
amizade com o gelogo
Charles Lyell. Inicia seu
primeiro caderno de notas
1809

sobre a transmutao das


espcies.
1831

Charles R. Darwin
78 Gentica na Escola | Vol. 8 | N 1 | 2013
Gentica na Escola ISSN: 1980-3540

03/1837
1837

01/03/1854

1854
Muda-se para Londres Inicia sua viagem de
a fim de morar com seu coleta e observao no
irmo John e permanece Arquiplago Malaio:
com ele por 7 anos. Casa de Wallace em Ternate:

1858
Malsia, Indonsia,
Nesse mesmo ano Timor Leste e Papua
inicia em Bedford, 25/04/1848 Nova Guin.

1848
na companhia de seu Inicia sua expedio 04/1854
irmo mais velho, para a Amaznia junto Chega a Cingapura.
o treinamento em com Henry Walter Bates
agrimensura.

contratado para 02/1858


1844

lecionar desenho, Principal concluso Escreve On the tendency of

1855
levantamento da Lei de Sarawak: varieties to depart indefinitely
topogrfico, lngua Toda espcie surgiu from the original type (Sobre
inglesa e aritmtica coincidente no tempo a tendncia das variedades
no Collegiate e no espao com uma em divergir indefinidamente
School em Leisceter. espcie preexistente do tipo original) e envia para
intimamente Darwin para comentrios.
Encontra-se com 12/07/1852
1852

Henry Walter Bates. relacionada. III. On the Tendency of


Na viagem de Entretanto, no
volta Inglaterra, Varieties to Depart Indefinitely
apresenta o from the Original Type
o navio se mecanismo pelo qual
incendeia e By Alfred Russel Wallace J.
uma espcie poderia Proc. Linn. Soc.: Zoo. 1958 3:
afunda. dar origem a outra
O resgate 53-62.
(transmutao).
acontece aps
10 dias.
01/04/1862

1862
Retorna para a
Inglaterra.

1862
29/01/1839 1862
Casa-se com Origin of
1839

Publica um trabalho species na sua


Emma Wedgwood
1854

sobre Cirripedia, terceira edio.


e passa a residir
crustceos marinhos
em Londres. 18/06/1858
(cracas).
Acusa o recebimento do
manuscrito. Sobre a origem das
espcies por meio da
Excerto de um trabalho indito seleo natural, ou a
sobre espcies de C. Darwin, preservao de raas
esq., que consiste em uma favorecidas na luta
parte do captulo intitulado pela vida.
Sobre a Variao dos Seres
Orgnicos em estado Natural; On the origin of
sobre o Meio Natural de species by means of
Seleo; sobre a Comparao natural selection, or
1859

de Raas Domsticas e Espcies the preservation of


14/09/1842 favoured races in the
verdadeiras.
Muda-se para a Down House - struggle of life.
na village de Downe, Kent. On the Variation of Organic
Beings in a state of Nature; on
Redige um manuscrito a lpis de the Natural Means of Selection;
1858

35 pginas denominado Esboo on the Comparison of Domestic


de Minha Teoria Sobre Espcie. Races and true Species. J. Proc.
Elabora um novo manuscrito de Linn. Soc. 3: 45-53.
240 pginas que denomina de
Teoria da Espcie.
1842

Determina instrues para a


publicao em caso de sua
morte sbita.

Sociedade Brasileira de Gentica 79


GENTICA E SOCIEDADE

WALLACE E BATES incapaz de falar e mal pde virar-se em sua


rede. Tomou quinino por alguns dias sem
NA AMAZNIA qualquer benefcio aparente. Depois de
Em 26 de abril de 1848, os dois embarcaram duas semanas, os sintomas cessaram tem-
em Liverpool a bordo do navio Mischief para porariamente, deixando-o magro e fraco,
o Brasil onde desembarcaram em 26 de maio mas febres e suores continuavam a ocorrer.
na cidade do Par (atual Belm). Chegaram Ele permaneceu em estado grave, at final
Amaznia como entusiasmados estudiosos de janeiro de 1852. Seu estado fsico me-
da histria natural e, como escreve Anthony lhorou progressivamente e aps 2 meses e
Smith, em seu livro Os Conquistadores do 23 dias, em 21 de fevereiro de 1852, reto-
Amazonas (SMITH, 1990) Fizeram isso mou sua jornada pelo Rio Uaups, subindo
sem recorrer s prticas normais do impe- o rio at a confluncia com o Rio Cuquiari
rialismo. Simplesmente se apossaram, sem na Colmbia.
Bblia, rifle e nem colonialismo.
Nos trechos introdutrios do livro Peixes
Trabalharam juntos em coletas e observa- do Rio Negro, organizado por Mnica de
es por cerca de dois anos na regio do bai- Toledo-Piza Ragazzo (WALLACE, 2002),
xo Rio Amazonas entre Belm e Santarm consta um minucioso relato sobre a viagem
incluindo o Rio Tocantins e chegaram Bar- de Wallace aos rios Negro e Uaps com
ra do Rio Negro (hoje Manaus) em dezem- comentrios de Wallace sobre os peixes do
bro de 1849. Em maro de 1850, decidiram Rio Negro, cronologia da expedio (1850-
tomar rumos distintos: Wallace escolheu 1852) e ilustraes de peixes e mapas feitos
explorar o Rio Negro e Bates, o Rio Soli- por Wallace.
mes e seus tributrios. A separao parece
ter sido de ordem prtica, pois as coletas em WALLACE RETORNA
reas diferentes seriam mais convenientes.
Provavelmente a diferena de temperamen- INGLATERRA
tos tambm contribuiu: Bates era um cole- Em 1852, com a sade abalada, Wallace de-
cionador paciente, o que contrastava com a cidiu voltar para a Inglaterra e teve um retor-
impetuosidade de Wallace. Entretanto, no no dramtico. Em 12 de julho de 1852 ele
houve ruptura entre eles, como prova a cor- embarcou no navio Helen com uma grande
respondncia que mantiveram depois (FER- quantidade de material coletado e alguns
REIRA, 1990). animais vivos. Em 6 de agosto, no meio da
viagem (latitude 3030N, longitude 52O)
WALLACE NO RIO NEGRO foi detectada fumaa saindo das escotilhas.
A fumaa aumentou, impossibilitando a
Num perodo de dois anos, Wallace sobiu o
retirada de qualquer coisa que estava a bor-
rio Negro por duas vezes. Na primeira via-
do. A tripulao abandonou a embarcao e
gem, chegou at os povoados de Pimichin e
refugiou-se nos botes. Aps 10 dias em alto
Yavita, onde ficam as nascentes do Rio Ne-
mar, os nufragos foram resgatados pelo na-
gro e Orinoco na Venezuela. Continuou suas
vio Jordeson, procedente de Cuba. Aps dias
exploraes pelo Rio Cubate, um afluente
angustiantes, chegou Inglaterra em 01 de
do rio Iana, no alto rio Negro e sobiu o rio
outubro de 1852, oitenta dias depois de ter
Uaps at Iauaret. Esta primeira expedio
deixado o Par. Wallace conseguiu salvar
durou pouco mais de 1 ano, com sada de
apenas seu relgio, cadernos de anotaes
Manaus em 31 de agosto de 1850 e retorno
e seus desenhos de palmeiras e peixes. A
em 15 de setembro de 1851.
maioria das notas sobre os hbitos dos ani-
Na segunda viagem, iniciada em outubro de mais e os desenhos dos insetos e a coleo
1851, sobiu o Rio Uaps at a confluncia resultante de suas coletas foi perdida.
do Rio Cuquiari na Colmbia. Retornou a
Com o pouco que restou de sua trgica via-
Manaus em maio de 1852. Nessa expedi-
gem, publicou em 1853, dois livros: Palm
o, ao chegar localidade de So Joaquim,
Trees of the Amazon and Their Uses
em novembro de 1851, foi acometido por
(Wallace, 1853) e A Narrative of Travels
uma crise de malria. Por dias, Wallace foi

80 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

on the Amazon and Rio Negro, traduzido


como Viagens pelo Amazonas e rio Negro
(WALLACE, 1939).
Apresentou trabalhos nas Sociedades Zo-
olgica e Entomolgica, mas no conseguiu
abrigo em instituies de pesquisa, pois al-
guns o criticavam por ser um mero colecio-
nador, j que no possua ttulo universitrio
ou qualquer outra credencial. Alm disso,
no teve qualquer apoio financeiro e mesmo
com todas essas restries manteve-se deter-
minado e entusiasmado, dando continuidade
s suas pesquisas.

WALLACE NO
ARQUIPLAGO MALAIO
Com perseverana, em 1854, conseguiu
apoio de Sir Roderick Murchison, presiden-
te da Real Sociedade de Geografia, para uma
nova expedio, dessa vez para o Arquipla-
go Malaio (hoje Malsia, Indonsia, Timor
Leste e Papua-Nova Guin). Ele chegou a
Cingapura em abril de 1854 e passou oito
anos (1854-1862) explorando as diversas
ilhas.
Como meio de transporte, utilizou diversos
tipos de embarcao existentes na regio e
navegou cerca de 22.000 quilmetros. Vi-
via como os nativos e coletou mais de 125
mil espcimes: 310 mamferos, 100 rpteis,
8.050 aves, 7.500 conchas, 13.100 lepidpte-
ros, 83.200 colepteros e 13.400 outros inse-
tos (WALLACE, 2010). Escreveu um livro
sobre seu trabalho e suas experincias The
Malay Archipelago: The Land of the Orang-
-utan and Bird of Paradise (WALLACE,
1869). Essa obra considerada um dos me-
lhores livros cientficos de viagens do sculo
XIX.

Sociedade Brasileira de Gentica 81


GENTICA E SOCIEDADE

A LEI DE SARAWAK
Na sua autobiografia, ele escreveu que em
fevereiro de 1855, menos de ano aps sua
chegada ao Arquiplago Malaio, vivia isola-
do em uma pequena casa em Sarawak (hoje
Kuching-Bornu) e contava somente com a
companhia de um rapaz malaio, chamado
Ali, seu cozinheiro. Durante a estao chu-
vosa, sem qualquer tipo de atividade de co-
leta, dedicava seus dias a ler alguns livros e
a pensar sobre a questo da origem das es-
pcies.
Nessa ocasio ele escreveu o artigo On the
Law Which Has Regulated the Introduc-
tion of New Species (WALLACE, 1855),
cujo tema central est relacionado com as
mudanas geolgicas graduais e a distribui-
o geogrfica de plantas e animais, vivos e
fsseis. O artigo trata de como essas mudan-
as poderiam contribuir para a diversificao,
uma vez que espcies prximas apresentam
distribuies geogrficas similares e so si-
multneas no tempo, assim como as espcies
fsseis com as mesmas caractersticas so
encontradas no mesmo extrato geolgico.
Nessas circunstncias, ele concluiu que o
processo evolutivo pode gerar diversidade
e que cada espcie apareceu coincidente no
espao e no tempo com uma espcie seme- A SOLUO EM TERNATE
lhante pr-existente. Essa ideia passou a ser Ao completar 35 anos, Wallace chegou a
conhecida como lei de Sarawak. Ternate e o grande desafio continuou sendo
A influncia do espao e do tempo na Bio- o problema das espcies: como uma espcie
logia uma das marcas do pensamento de se transforma em outra e como as espcies
Wallace. Entretanto, ele no tinha ideia de divergem no decorrer do tempo. Diante des-
qual seria o possvel mecanismo para a di- sas incertezas, ele escreveu: no cheguei a
versificao das espcies. Esse artigo con- nenhuma concluso satisfatria at fevereiro
siderado uma contribuio pioneira sobre o de 1858, pois faltava encontrar um mecanis-
problema da origem das espcies, antes da mo dinmico pelo qual se processa a evolu-
proposio da seleo natural. o dos seres vivos na natureza.
O artigo despertou o interesse de Charles Em sua autobiografia (WALLACE, 1905)
Lyell, dadas as suas possveis implicaes ele escreveu que o problema no era s sa-
para o entendimento da mudana evoluti- ber como e por que as espcies mudam, mas
va. Em abril de 1856, quando visitou Da- como e por que elas se transformam em es-
rwin, alertou-o sobre o contedo do artigo pcies novas bem definidas e que se distin-
de Wallace, cujas ideias eram semelhantes guem umas das outras em muitos aspectos.
s do ensaio de Darwin, de 1844, que ainda Alm disso, o problema inclua tambm
no tinha sido publicado. A advertncia de propor uma explicao por que e de como as
Lyell foi um estmulo e Darwin comeou a espcies se tornam bem adaptadas a novos
escrever o que chamou de grande livro so- modos de vida e por que formas intermedi-
bre a origem das espcies. No entanto, esse rias desaparecem deixando a espcie clara-
trabalho foi interrompido. mente definida.

82 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

Na poca, estava sofrendo ataques bastante WNE, 2007). Em 18 de junho de 1858, Da-
severos de febre intermitente e, certo dia, dei- rwin escreveu a Lyell relatando que a ameaa
tado na cama durante um acesso de calafrios, sua precedncia se concretizou e exprimiu
embrulhado em cobertores embora estivesse seu desespero ao escrever: nunca vi uma
31oC l fora, o problema das espcies voltou a coincidncia to impressionante. Se Wallace
se apresentar e algo o levou a pensar nas res- tivesse lido meu manuscrito de 1842 no fa-
tries ao crescimento populacional. Essas ria um resumo melhor! At as expresses que
eram as ideias descritas por Malthus em seu ele usa so ttulos de meus captulos.
Ensaio sobre a populao, uma obra que ele
Darwin consultou seus dois melhores ami-
lera alguns anos antes e que deixara impres-
gos, Lyell e Hooker, sobre como proceder.
so profunda e permanente em minha men-
Deveria silenciar e deixar que Wallace rece-
te1. Recordou das restries ao crescimento
besse as honras? Os amigos tinham conheci-
populacional, como doena e fome, que po-
mento de que ele vinha trabalhando sobre o
dem atuar tanto sobre os humanos como nos
assunto h mais tempo que Wallace e conhe-
animais. Deste modo, o crescimento mais r-
cimento da quantidade de informaes que
pido das populaes animais, possibilita que
Darwin havia acumulado. Finalmente deci-
tais restries atuem com muito mais eficcia
diu-se que a soluo mais justa seria apresen-
do que em humanos; e, enquanto ele ponde-
tar numa reunio na Sociedade Lineana, uma
rava vagamente sobre esse fato, ocorreu-lhe,
comunicao em conjunto. Nessa ocasio, foi
de sbito, a ideia de sobrevivncia dos mais
apresentado um resumo do manuscrito de
aptos, que os indivduos eliminados por es-
Darwin de 1844 (Sobre a variao dos seres
sas restries devem, no geral, serem inferio-
orgnicos em estado natural; sobre os meios
res aos que sobrevivem. Nas duas horas que
naturais de seleo; sobre a comparao das
transcorreram at que os tremores de febre
raas domesticadas e espcies verdadeiras),
cessassem, preparou um rascunho de sua
o resumo de uma carta de Darwin a Asa
tese. Nas duas noites seguintes, terminou a
Gray, professor de Botnica na Universidade
redao do manuscrito.
de Harvard, postada em Down em 5 de se-
Wallace escreveu duas cartas, uma para Da- tembro de 1857, e o artigo de Wallace (So-
Adaptado de: CAMERINI, J. R. 2002. rwin, anexa ao manuscrito do trabalho, pe- bre a tendncia das variedades de divergir in-
dindo para que, se achasse o artigo de algum definidamente do tipo original). Os textos
1. Em 1838 Darwin tambm foi
valor, enviasse para Lyell providenciar sua de Darwin e Wallace foram apresentados em
influenciado pelos conceitos publicao. A segunda carta, datada de 2 de 1 de julho de 1858 e publicados no Journal
maltusianos das restries do maro de 1858, foi enviada ao irmo mais of the Linnean Society (Zoology)2. Nessa
crescimento populao em se- moo de Bates, Frederick, que tambm era publicao, a contribuio de Darwin ante-
res humanos, que poderiam ter
entomlogo. As cartas foram despachadas rior de Wallace e, desse modo, a prioridade
equivalncia nas espcies no
humanas. em 9 de maro, e seguiram para Europa via da ideia, ao menos em termos formais, passa
Cingapura (FERREIRA, 1990). a ser de Darwin.
2. Disponvel em: http://
darwin-online.org.uk/content/ Dois homens, em lados opostos do mundo,
frameset?pageseq=1&itemID=- DARWIN E A CARTA fizeram a mesma extraordinria descoberta
F350&viewtype=text
DE TERNATE ao mesmo tempo. Tudo o que tinham em
Em julho de 1858, Darwin recebeu um pa- comum era a lngua, uma pergunta a ser res-
cote e, surpreso, pensou em quem poderia pondida, oportunidade de viajar, disposio
ter-lhe enviado uma correspondncia pro- de trocar cartas, uma vaga familiaridade com
cedente de Ternate, nas ndias Orientais Malthus e apreciao da importncia da bio-
holandesas, entre Clebes e Nova Guin. geografia de ilhas (QUAMMEM, 2009).
Verificou tratar-se de um manuscrito do
naturalista Alfred Russel Wallace expon- SOBRE AS COMUNICAES
do ideias semelhantes s de seu manuscrito SOCIEDADE LINEANA
de 1844 sobre evoluo por seleo natural.
Tanto Darwin como Wallace realizaram ex-
Nunca se saber ao certo a data em que o ma-
pedies que contriburam significativamen-
nuscrito chegou s mos de Darwin (BRO-
te para a sua formao cientfica. Entretanto,

Sociedade Brasileira de Gentica 83


GENTICA E SOCIEDADE

apesar das semelhanas nos aspectos te- Desde o incio de sua carreira como evolu-
ricos dos trabalhos apresentados, h diver- cionista (1858), Wallace rejeitava os con-
gncias nas fundamentaes empricas. Pri- ceitos lamarckistas de herana dos carac-
meiramente Wallace formulou suas teorias teres adquiridos durante a vida. O termo
em grande parte com base em observaes seleo natural no usado por Wallace.
de campo, pois suas coletas, sempre com um Darwin o utiliza em muitas sentenas.
grande nmero de espcimes, permitiram Wallace introduz os termos adaptao e
reconhecer que dentro de uma mesma esp- populao com sentido semelhante ao que
cie existe considervel variao. Darwin, por usamos no presente. Ambos usam o termo
outro lado, conduziu experimentos, coletou espcie, mas no a definem claramente em
dados sobre a variao sob domesticao e os suas primeiras publicaes. Trata-se de
resultados obtidos foram fundamentais para discusso fundamental que ser discutida
construir sua teoria. Adicionalmente, du- em um trabalho futuro.
rante quase vinte anos, Darwin colecionou
Darwin escreve apressadamente uma ver-
dados de outros naturalistas que pudessem
so resumida do grande livro que comea-
apoi-lo. O caminho do raciocnio dos dois
ra a redigir aps a advertncia de Lyell so-
tambm foi diferente: Darwin iniciou por
bre as ideias de Wallace. O livro A origem
desenvolver o conceito de seleo natural,
das espcies chegou s livrarias em 24 de
que mais tarde ligaria ao princpio da di-
novembro de 1859 e a primeira edio es-
vergncia; por outro lado, Wallace, de incio
gotou-se imediatamente. Uma nova edio
postulou a divergncia das espcies, publica-
foi publicada em 1860.
da em seu artigo de 1855, e depois chegou
seleo natural. Finalmente, os avanos prin-
cipais de Wallace foram o resultado de mo-
WALLACE RETORNA
mentos de inspirao, enquanto a descoberta INGLATERRA
de Darwin veio aps cuidadosas anlises ao Wallace estava de volta Inglaterra em
longo de vrios anos. 1862, quando A Origem das Espcies es-
Kutschera (2003) fez uma anlise compa- tava na sua terceira edio e j tinha reno-
rativa das comunicaes de Darwin e de me internacional entre seus admiradores e
Wallace no desenvolvimento do conceito de detratores. Para Wallace, a vida no foi fcil.
seleo natural e as mais significativas esto Perdeu suas economias em investimentos
sumarizadas a seguir: desastrosos e no conseguiu emprego para
exercer seu trabalho. Escreveu artigos e li-
Wallace ressalta a distino entre varie- vros que lhe deram notoriedade intelectual,
dades domesticadas e naturais. Para ele, mas pouco retorno financeiro. Os problemas
os animais domesticados so anormais e continuaram e em 1880, Darwin o auxiliou,
no podem ser utilizados como sistema conseguindo uma penso especial do gover-
modelo aplicveis a animais na natureza. no britnico.
Darwin salienta as similaridades entre as
variedades domsticas e naturais e as uti- Em 1889, Wallace publicou um livro sobre
lizou na construo de sua argumentao. seleo natural que generosamente intitu-
lou Darwinismo traduzido recentemente
Wallace usa apenas exemplos animais na pela Editora da Universidade de So Paulo
luta para existncia. Por outro lado, Da- (WALLACE, 2012). Assim, manteve-se livre
rwin faz referncias a plantas e animais, de preocupaes sobre quem levou crdito
isto , organismos mveis e ssseis. pelas descobertas. Para Wallace, o importan-
Wallace d nfase competio de animais te eram as ideias. Ele teve uma vida fecunda
em relao ao seu meio (vivo ou inorgni- para algum sem boa educao formal ou
co) e outras espcies: a luta contra inimigos dinheiro. Viajou muito para longe, tanto em
e predadores decisiva para o processo. J termos de espao geogrfico quanto de am-
Darwin destaca a competio entre esp- plitude intelectual. Traou a prpria linha e
cies prximas. soube andar nela (QUAMMEN, 2008).

84 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

AGRADECIMENTOS nvel em: http://www.darwinproject.


ac.uk/entry-2299
Marta Svartman, Nadia de Moraes-Barros
e Juliana Machado Ferreira pelas criticas e KEYNES, R. Aventuras e descobertas de
sugestes. Darwin a bordo do Beagle, 1832-1836.
Rio de Janeiro, Jorge Zahar Ed., 2004.
REFERNCIAS KUTSCHERA, U. A Comparative Analy-
BROWNE, J. A Origem das Espcies de sis of Darwin-Wallace Papers and the
Darwin: uma biografia. Rio de Janeiro, Development of the Concept of Natural
Jorge Zahar Ed., 2007. Selection. Theory Bioscience, 122, n.4,
CAMERINI, J. R. The Alfred Russel Walla- p. 343-359, 2003.
ce reader: a selection of writing from the MAYR, E. The Nature of the Darwinian
field. Baltimore, The John Hopkins Uni- Revolution. Science 176, p. 981-989.
versity Press, 2002.
MORGANTE, J. S.; MEYER, D. Darwin
COHEN, I. B.: The Darwinian Revolution. e a Biologia. O Bilogo, no. 10, p. 13-20,
In: Cohen, I. B. Revolution in Science, 2009. (www.crbio01.org.br/)
p.283-300, 8 ed. Cambridge, The Belk-
QUAMMEN, D. O canto do Dod: bioge-
nap Press of Harvard University Press,
ografia de ilhas numa era de extines.
2001.
So Paulo, Companhia de Letras, 2008.
DARWIN, C. On the origin of species.
QUAMMEN, D. O outro Darwin. Natio-
London. John Murray, Albemarle Street,
nal Geographic Brasil, 105, p. 100-125,
1859.
2008.
FERREIRA, R. Bates, Darwin, Wallace a
SMITH, A. Os conquistadores do Amazo-
Teoria da Evoluo. Braslia: Editora
nas. Rio de Janeiro, Editora Beste Seller,
da Universidade de Braslia; So Paulo:
1990.
Editora da Universidade de So Paulo,
1990. WALLACE, A. R. On the Law which has
regulated the introduction of new spe-
HOOKER, J. D.; LYELL, C. Communicate
cies. Tha annals and Magazine of Natu-
papers by CD and A. R. Wallace on The
ral History, vol 16, p 184-196, 1855.
Laws which affect the Production of Va-
rieties, Races, and Species. J. Proc. Linn. WALLACE, A, R. My life A record of
Soc. Lond. (Zool.) 3 1859: 45. Dispo- Events and opinions. (Edio Facsimile).
Londres, Chapman & Hall, 1905.
WALLACE, A. R. Viagens pelo Amazonas
e rio Negro. So Paulo, Companhia Edi-
tora Nacional, 1939.
WALLACE, A. R. Os peixes do Rio Negro.
Organizao Mnica de Toledo Piza
Ragazzo. So Paulo EDUSP; Imprensa
Oficial. 2002.
WALLACE, A. R. The Malay archipelago
The Land of Orang-utan, and the Bird
of Paradise. A Narrative of Travel, with
Studies of Man and Nature v 1. New
York, Cambridge University Press, 2010.
WALLACE, A. R. Darwinismo: Uma Ex-
posio da Teoria da Seleo Natural
com algumas de suas aplicaes. So
Paulo, EDUSP, 2012.

Sociedade Brasileira de Gentica 85


RESENHAS

Experimento
de hibridao
de plantas
o artigo de Gregor Mendel

Rodrigo Venturoso Mendes

Colgio Mbile, So Paulo.

86 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

A importncia das ideias apresentadas por Mendel indiscutvel. Um


modo de avaliar essa importncia verificar a presena desse contedo
nos livros didticos de Biologia do Ensino Mdio. De acordo com todos eles,
para um estudante compreender bem o funcionamento da Cincia da Vida,
ele deve conhecer os conceitos propostos por Mendel em seu trabalho Expe-
rimentos em hibridao de plantas.
O trabalho original Versuche ber Planzen-Hybriden foi publicado em um
volume da Verhandlungen des Naturforschenden vereines in Brnn, hoje
Brno, na atual Repblica Checa, em 1866. J a traduo para o ingls, a partir
da edio original em alemo, foi publicada em 1901 em Londres, no Jour-
nal of the Royal Horticultural Society por Willian Bateson, bilogo ingls
e grande defensor e divulgador das ideias apresentadas por Mendel. Nessa
traduo, Bateson fez anotaes de rodap e sugeriu pequenas mudanas no
texto original, sendo todas elas colocadas entre parnteses.
Esse volume da revista Gentica na Escola, contm uma verso em portu-
gus, feita em 1986 pela professora Dra. Maria Augusta Querubim Rodrigues
Pereira a partir da traduo elaborada por Bateson.
Acreditamos que esse material pode ser muito til para professores e estudan-
tes, pois possibilita a visualizao do processo de criao das ideias apresen-
tadas por Mendel. Muitas vezes, nos manuais de Biologia, as leis de Mendel
so apenas descritas e explicadas, permitindo a formao de uma concepo
equivocada da Cincia. De acordo com essa viso, os cientistas so seres espe-
ciais que, em dias inspirados, revelam as leis da Natureza a partir da simples
observao.
J o texto mostra um monge que elabora uma longa e elegante sequncia de
experimentos para testar seu modelo explicativo. Alm disso, ele analisou mais
de mil plantas diversas vezes para a obteno de dados robustos que permitis-
sem avaliar as suas hipteses. Fica tambm evidente, ao longo do artigo, a ino-
vadora abordagem matemtica na anlise de dados referentes transmisso de
caractersticas ao longo das geraes.
Por fim, interessante verificar que alguns conceitos geralmente atribudos a
Mendel no so citados ao longo do texto: genes, alelos, homozigotos e hetero-
zigotos. Os dois ltimos, por exemplo, foram propostos por Willian Bateson
(para saber mais sobre o papel desse pesquisador, leia o artigo de Lilian Al-
-Chueyr Pereira Martins: Bateson e o programa de pesquisa mendeliano em
Episteme, Porto Alegre, n. 14, p. 27-55, jan./jul, 2002).
http://www.ilea.ufrgs.br/episteme/portal/pdf/numero14/episteme14_artigo_
martins.pdf

Sociedade Brasileira de Gentica 87


RESENHAS

Experimentos de
Hibridao em Plantas
Realizados por
Gregor Mendel (1865) *

* O artigo de Gregor Mendel possui tambm um item


denominado Experimentos com hibridos de outras
espcies de plantas que ser objeto de publicao futura.

88 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

Artigo original:
MENDEL, GREGOR Versuche ber Plflanzenhybriden. Verhandlungendes naturforschenden
Vereines in Brnn, Bd. IV fr das Jahr 1865, Abhandlungen, 347. Apresentado nas reunies de 08 de
fevereiro e 08 de maro de 1865 da Sociedade de Histria Natural de Brnn.
http://www.mendelweb.org/MWGerText.html

Verso comentada para o ingls do artigo original de Mendel:


BATESON, WILLIAM Experiments in Plant Hybridization (1865) by Gregor Mendel
http://www.mendelweb.org/Mendel.plain.html

Traduo da verso em ingls:


PEREIRA, MARIA AUGUSTA RODRIGUES. Instituto de Biocincias, Universidade de So Paulo.
Colgio Guilherme Dumont Villares, So Paulo. guquerubim@gmail.com.

OBSERVAES natureza. S poder chegar-se a uma deciso


final quando dispusermos dos resultados de
INTRODUTRIAS experimentos detalhados realizados com plan-

E xperincias de polinizao artificial, como


as efetuadas com plantas ornamentais
visando obteno de novas variedades de
tas pertencentes s mais diferentes ordens.
Aqueles que conheceram trabalhos neste
cor, levaram aos experimentos que sero dis- campo chegaro concluso de que, entre
cutidos a seguir. A notvel regularidade com os numerosos experimentos realizados, ne-
que reapareceram as mesmas formas hbridas, nhum foi executado em extenso e maneira
toda vez que ocorre polinizao entre as mes- tais que torne possvel determinar o nmero
mas espcies, influenciou experimentos adi- de formas diferentes que aparecem na des-
cionais cujo objetivo foi acompanhar o desen- cendncia dos hbridos, ou que permitam
volvimento dos hbridos na sua descendncia. classificar estas formas com segurana, de
acordo com as geraes, ou ainda estabelecer
A este objetivo, numerosos observadores, com preciso suas relaes estatsticas(1).
tais como Klreuter, Gartner, Herbert, Le-
coq, Wichura e outros, dedicaram parte de Empreender um trabalho to extenso, real-
suas vidas com inesgotvel perseverana. Es- mente requer alguma coragem; entretanto,
pecialmente Grtner, em seu trabalho Die parece ser o nico caminho correto pelo qual
Bastard-Erzeungung im Pflanzenreiche (A podemos finalmente alcanar a soluo de
produo de hbridos no reino vegetal) apre- uma questo de tal importncia para a hist-
sentou observaes muito importantes; re- ria da evoluo das formas orgnicas.
centemente Wichura publicou os resultados O trabalho aqui apresentado rene os resul-
de algumas investigaes detalhadas sobre os tados de um experimento detalhado. Esse ex-
hbridos de salgueiro. perimento limitou-se a um pequeno nmero
(1. O grande mrito do trabalho O fato de at agora no ter sido formulada de plantas e agora, aps 8 anos de durao,
de Mendel deve-se sua uma lei geral, aplicvel formao e desenvol- est concludo em seus aspectos essenciais.
clara concepo a respeito vimento dos hbridos, no deve surpreender deixado ao leitor decidir se o plano segundo
desses trs requisitos o qual os experimentos foram conduzidos e
bsicos. Tanto quanto eu
ningum que esteja familiarizado com a exten-
so do trabalho e possa avaliar as dificuldades executados foi o mais adequado para alcan-
saiba, ela foi totalmente
inovadora para a sua poca.) a serem enfrentadas em experimentos dessa ar os fins desejados.

Sociedade Brasileira de Gentica 89


RESENHAS

SELEO DAS PLANTAS mos e localizados dentro da carena, de tal forma


que a antera se abre dentro do boto, ficando
EXPERIMENTAIS o estigma coberto de plen antes da abertura
O valor e a utilidade de qualquer experimento da flor. Esta caracterstica especialmente im-
so determinados pela adequao do material portante. A polinizao artificial certamente
finalidade para a qual ele usado, e no nos- um processo elaborado, mas quase sempre tem
so caso interessa o tipo de planta utilizada nos sucesso. Para realiz-la, o boto aberto antes
experimentos e a maneira com que eles so re- de estar completamente desenvolvido, a carena
alizados. removida, por meio de pinas, os estames so
Caso se pretenda evitar, desde o incio, todos cuidadosamente extrados; posteriormente, o
os riscos de se obterem resultados duvidosos, estigma pode ser polvilhado com plen deseja-
a seleo do grupo de plantas adequadas para do. Outras vantagens a serem sustentadas so:
experimentos deste tipo deve ser extremamente a facilidade de cultivo dessas plantas em hortas
cuidadosa. ou vasos, e seu perodo de crescimento relativa-
mente curto.
Essas plantas devem, necessariamente:
No total, 34 variedades distintas de ervilha
1. possuir caracteres contrastantes e constan-
foram obtidas de diversos produtores e sub-
tes;
metidas a dois anos de triagem. Em uma das
2. produzir hbridos que, durante o perodo de variedades, entre um grande nmero de plantas
florao, possam ser protegidos da influncia semelhantes, foram observadas algumas formas
de qualquer plen estranho, ou apresentem, nitidamente diferentes. Essas, entretanto, no
naturalmente, tal proteo. Esses hbridos e variaram no ano seguinte e coincidiram inteira-
sua descendncia no devem apresentar re- mente com outra variedade obtida do mesmo
dues drsticas de fertilidade nas geraes produtor; portanto, as sementes foram, sem
sucessivas. dvida, acidentalmente misturadas. Todas as
demais variedades produziram descendncia
Se durante os experimentos ocorrerem aci-
perfeitamente constante e nenhuma diferen-
dentalmente fecundao por plen estranho e
a essencial foi notada durante os dois anos
este fato no for detectado, podero ser tiradas
de observao. Para a polinizao, 22 dessas
concluses completamente erradas. Fertilida-
variedades foram selecionadas e cultivadas du-
de reduzida ou esterilidade completa de certas
rante o perodo de experimentao. Todas, sem
formas, como ocorre na descendncia de muitos
exceo, permaneceram constantes. Sua clas-
hbridos, poderia dificultar os experimentos ou
sificao sistemtica difcil e incerta. Se ns
torn-los impraticveis. Para descobrir as rela-
adotarmos a definio mais estrita de espcie,
es entre as formas hbridas e tambm entre
segundo a qual pertencem uma mesma espcie
elas e seus progenitores, parece ser necessrio
os indivduos que, em circunstncias idnticas,
que todos os membros das classes obtidas em
apresentam caracteres semelhantes, nenhuma
cada gerao sejam, sem exceo, objeto de ob-
dupla dessas variedades poderia ser classificada
servao.
como pertencente mesma espcie. Entretan-
Desde o incio, ateno especial foi devotada s to, de acordo com a opinio de especialistas, a
leguminosas, devido a sua estrutura floral pe- maioria dessas variedades pertence espcie
culiar. Experimentos realizados com diversos Pisum sativum, enquanto as restantes so consi-
membros desta famlia levaram concluso de deradas e classificadas, ou como subespcies de
que o gnero Pisum possua as caractersticas P. sativum ou como espcies independentes, tais
necessrias. como P. quadratum e P. umbellatum. Entretan-
Neste gnero, algumas variedades inteiramente to, a posio na qual podem ser colocadas em
distintas possuem caractersticas que so cons- um sistema de classificao no tem qualquer
tantes e de fcil reconhecimento; e, quando seus importncia, quando se considera a finalidade
hbridos so cruzados entre si, produzem des- do experimento em questo. At agora, tem-se
cendncia totalmente frtil. Alm disso, dificil- visto que impossvel traar uma linha defini-
mente ocorre fecundao por plen estranho, j da separando as espcies e as variedades, bem
que os rgos reprodutores esto muito prxi- como os hbridos entre as espcies e entre va-
riedades.

90 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

DIVISO E ORGANIZAO 3. A diferena na cor do tegumento das semen-


tes. Ele branco, carter com o qual a cor
DOS EXPERIMENTOS branca das flores est constantemente cor-
Numerosos experimentos tm demonstrado relacionada; pode tambm ser cinza, cinza-
que, quando se cruzam duas plantas que di- -pardo ou marrom-couro, com ou sem pintas
ferem com relao a um ou mais caracteres, violetas, e nestes casos, a cor do estandarte da
aqueles comuns a ambas so transmitidos inal- flor violeta e, a das alas, prpura, tendo
terados para os hbridos e sua descendncia, o caule, nas axilas das folhas, um matiz aver-
mas cada par de caracteres diferentes une-se no melhado. As sementes com tegumento cinza
hbrido para formar um novo carter, o qual tornam-se marrom-escuras em gua fervente;
geralmente varivel na descendncia desse h-
brido. O objetivo deste trabalho foi observar 4. A diferena na forma das vagens maduras.
essas variaes em cada par de caracteres dis- Elas so intumescidas, sem estreitamento, ou
tintos e deduzir a lei segundo a qual eles apa- tm constries profundas entre as sementes,
recem nas geraes sucessivas. Portanto, foram sendo mais ou menos enrugadas (Pisum sac-
realizados experimentos envolvendo cada um charatum);
dos caracteres distintos presentes nas plantas 5. As diferenas na cor das vagens no maduras.
experimentais. Elas podem ser verdes (claras ou escuras) ou
As variedades de ervilhas selecionadas para amarelo-brilhantes; desta colorao partici-
cruzamento mostravam diferenas no compri- pam os caules, as nervuras das folhas e o cli-
mento e cor do caule; no tamanho e forma das ce(3);
folhas; na posio, cor e tamanho das flores; no 6. As diferenas na posio das flores. So axiais,
comprimento do pednculo floral; e na forma, isto , esto distribudas ao longo do caule
cor e tamanho das vagens; na forma e tamanho principal ou so apicais, isto , esto agrupa-
das sementes e na cor do endosperma (cotil- das no topo do caule, arranjadas em uma falsa
dones) e do tegumento das sementes. Alguns umbela; neste caso, a parte superior do caule
desses caracteres mencionados no permitem mais ou menos subdividida (P. umbellatum);
uma separao ntida e segura, j que a diferen-
7. As diferenas no comprimento do caule. O
a mais ou menos, gradual e frequentemente
comprimento do caule muito varivel entre
difcil de ser definida. Tais caracteres no po-
algumas formas; entretanto, um carter cons-
dem ser utilizados em experimentos isolados,
tante em cada uma delas, j que plantas sadias,
os quais somente podem ser realizados com
crescendo no mesmo solo, esto sujeitas a va-
caracteres que se apresentem claramente de-
riaes pouco importantes para esta caracters-
finidos. Finalmente, o resultado deve mostrar
tica. Para poder discriminar, com certeza, nos
se todos eles tm um comportamento regular
experimentos envolvendo este carter, sempre
em suas unies hbridas e se alguma concluso
foram cruzadas plantas de caules mais longos
pode ser tirada a partir desses fatos.
(entre 182 a 213 cm) com aquelas de caule mais
Os caracteres selecionados para os experimen- curtos (entre 23 a 46 cm);
tos esto relacionados com:
Cada par de caractersticas enumerado acima
(2. Mendel usa tanto o 1. A diferena na forma das sementes maduras. foi unido por fecundao cruzada. Foram re-
termo albmen como Estas so redondas ou arredondadas, com alizados:
endosperma para designar depresses na superfcie, se as possuir, sem-
os cotildones que contm
o material de reserva na pre pouco profundas (praticamente lisas); 1 teste 60 fecundaes em 15 plantas
semente.) ou so irregularmente angulosas e fortemen-
2 teste 58 fecundaes em 10 plantas
te enrugadas (P. quadratum);
(3. Uma espcie possui vagem 3 teste 35 fecundaes em 10 plantas
vermelho-amarronzada que, 2. A diferena na cor do albmen da semente
quando madura, torna-se (endosperma)(2). O endosperma das se- 4 teste 40 fecundaes em 10 plantas
violeta e azul. Experimentos mentes maduras amarelo-plido, amarelo-
utilizando esta variedade 5 teste 23 fecundaes em 5 plantas
-brilhante e cor de laranja, ou possui um tom
foram iniciados apenas no
ano passado. Os resultados verde mais ou menos intenso. Essa diferena 6 teste 34 fecundaes em 10 plantas
desses experimentos nunca de cor facilmente vista nas sementes se seus
7 teste 37 fecundaes em 10 plantas
foram publicados.) tegumentos forem transparentes;

Sociedade Brasileira de Gentica 91


RESENHAS

De um grande nmero de plantas de uma tas que foram cuidadosamente examinadas,


mesma variedade somente as mais vigorosas houve apenas poucos casos em que indubi-
foram escolhidas para polinizao. Plantas tavelmente ocorreu polinizao indesejada.
fracas sempre proporcionam resultados incer- Desde que na estufa tais casos nunca foram
tos, pois mesmo na primeira gerao de hbri- observados, pode-se supor que Bruchus pisi
dos e mais ainda nas geraes subsequentes, e tambm as anormalidades descritas nas es-
muitos dos descendentes ou no florescem, ou truturas florais tenham sido os responsveis.
formam somente poucas sementes defeituo- (5)
sas. (F1) A FORMA DOS HBRIDOS
Alm disso, em todos os experimentos foram Os experimentos que foram realizados, ante-
efetuados cruzamentos recprocos, de tal ma- riormente, com plantas ornamentais fornece-
neira que uma variedade que serviu, em um ram evidncias de que os hbridos, via de re-
experimento, como produtora de sementes, gra, no so exatamente intermedirios entre
no outro experimento foi usada como produ- as espcies parentais. Em alguns dos caracte-
tora de plen. res mais visveis, por exemplo, aqueles que se
referem forma e ao tamanho das folhas,
As plantas foram cultivadas em canteiros, pubescncia de diversas partes etc, o interme-
algumas em vasos, e foram mantidas em po- dirio quase sempre pode ser visto; em outros
sio vertical por meio de varas, galhos e fios casos, entretanto, um dos dois caracteres pa-
esticados entre elas. Para cada experimento, rentais to preponderante que difcil ou
certo nmero de vasos foi colocado, durante totalmente impossvel detectar, no hbrido, o
o perodo de florao, em uma estufa para outro carter. Este precisamente o caso dos
servir como plantas-controle do experimen- hbridos de ervilhas. Em cada um dos sete
to principal realizado a cu aberto, quanto a cruzamentos o carter do hbrido assemelha-
possveis alteraes causadas por insetos. En- -se de tal modo a uma das formas parentais
tre os insetos que visitam ervilhas, o besouro que, a outra ou escapa totalmente observa-
Bruchus pisi(4), se em grande nmero, poderia o, ou no pode ser detectada com certeza.
prejudicar o experimento. A fmea desta es- Esta circunstncia de grande importncia
pcie coloca ovos nas flores e deste modo abre na determinao e classificao das formas
a carena; alguns gros de plen puderam ser que aparecem na descendncia dos hbridos.
vistos claramente na lupa sobre os tarsos de
um espcimen coletado em uma flor. Neste trabalho, daqui por diante, aqueles ca-
racteres que so transmitidos intactos ou qua-
Deve-se fazer meno a outras circunstncias se sem mudanas na hibridao e que consti-
que tornam possvel a introduo de plen tuem, portanto, os caracteres do hbrido sero
estranho. Isto ocorre, por exemplo, em alguns denominados dominantes, e aqueles que no
casos raros em que certas partes de uma flor, processo permanecem latentes, recessivos.
que em outros aspectos completamente A expresso recessivo foi escolhida, pois os
normal, murcham resultando na exposio caracteres assim designados retraem-se ou
parcial dos rgos reprodutores. Foi tambm desaparecem completamente no hbrido, mas
observado um desenvolvimento defeituoso da reaparecem sem mudanas na sua descendn-
carena que faz com que o estigma e as anteras cia, como ser demonstrado mais tarde.
permaneam parcialmente descobertos. Algu- (4. Mendel publicou uma nota
Alm disso, foi demonstrado, em todos os sobre este inseto em 1854
mas vezes acontece que o plen no atinge seu no Verh. Zool. Bot., Wien
perfeito funcionamento. Neste caso, ocorre experimentos, que no importa se o carter IV, p.27.)
um alongamento gradual do pistilo durante o pertence ao parental formador da semente ou
perodo de florao at que a extremidade do ao parental doador do plen, pois a forma do (5. Mendel emprega o termo
hbrido sempre a mesma. Este fato foi tam- hbridos para designar
estigma saia na ponta da carena. Este aspecto os descendentes dos
tambm observado em hbridos de Phaseolus bm enfatizado por Grtner, que chamou a
seus cruzamentos com
e Lathyrus. ateno para o fato de que at o especialista ervilha, embora muitos
mais experiente no seria capaz de determi- pesquisadores utilizem
O risco de polinizao por plen estranho nar em um hbrido, qual das duas espcies este termo estritamente
desprezvel em Pisum e incapaz de perturbar o parentais foi a planta formadora de semente para os descendentes de
resultado geral. Entre as mais de 10.000 plan- cruzamentos entre espcies
ou a planta que originou o plen. distintas.)

92 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

Dos caracteres analisados nos experimentos uma, o recessivo. Isto acontece, sem exceo,
so dominantes: com todos os caracteres que foram investiga-
dos nos experimentos. A forma rugosa das
1. a forma redonda (lisa)(6) da semente, com
sementes; a cor verde do endosperma; a cor
ou sem depresses suaves;
branca do tegumento e flores; as constries
2. a cor amarela do endosperma da semente; da vagem; a cor amarela das vagens no madu-
3. a cor cinza, cinza-parda ou marrom-couro ras, do pednculo, do clice e das nervuras das
do tegumento da semente, associada a flo- folhas; a forma de umbela das inflorescncias
res violetas e manchas avermelhadas nas e o caule ano, todos reaparecem na referida
axilas das folhas; proporo numrica, sem qualquer alterao
essencial. Em nenhum experimento foram
4. a forma intumescida da vagem; observadas formas de transio.
5. a colorao verde da vage m no madura, Desde que os hbridos resultantes de cruza-
associada com a mesma cor nos estames, mentos recprocos formam-se igualmente e
nervuras das folhas e do clice; no apresentam diferenas apreciveis em
6. a distribuio das flores ao longo do caule; seu desenvolvimento subsequente, os resulta-
dos (dos cruzamentos recprocos) podem ser
7. o maior comprimento do caule.
agrupados em cada experimento. Os nmeros
Com respeito a este ltimo carter, deve-se relativos que foram obtidos para cada par de
dizer que o caule mais longo dos pais usu- caracteres so os seguintes:
almente superado pelo hbrido, fato este pos-
Exp. 1. Forma da semente de 253 h-
sivelmente devido maior exuberncia que
bridos foram obtidos 7.324 sementes
aparece em todas as partes quando se cruzam
no segundo ano de pesquisa. Entre elas
plantas com caules de comprimentos muito
5.474 lisas e 1.850 rugosas. Da, pode-se
diferentes. Em vrios experimentos, plantas
deduzir a proporo de 2,96 para 1.
com caules de 30 e 182 cm produziram hbri-
dos cujo comprimento de caule variava entre Exp. 2. Cor do endosperma 258 plan-
182 e 228 cm. tas produziram 8.023 sementes, 6.022
amarelas e 2.001 verdes, sua proporo ,
Nos experimentos analisados, a cor do tegu-
portanto, 3,01 para 1.
mento, as sementes hbridas so frequentemen-
te mais pintadas e as pintas s vezes se fundem Nestes dois experimentos cada vagem pro-
em pequenas manchas violeta-azuladas. Fre- duz, geralmente, os dois tipos de sementes.
quentemente as pintas aparecem mesmo quan- Em vagens bem desenvolvidas que contm,
do no esto presentes como carter parental. em mdia, de seis a nove sementes, ocorreu,
com frequncia, que todas as sementes eram
A forma das sementes e a cor do endosperma
lisas (Exp. 1), ou todas amarelas (Exp. 2); por
dos hbridos desenvolvem-se imediatamente
outro lado, nunca foram observadas mais que
aps a fecundao artificial, por mera influ-
cinco sementes rugosas ou cinco verdes em
ncia do plen estranho. Portanto, podem ser
uma mesma vagem. Parece no fazer dife-
observados ainda no primeiro ano do experi-
rena se no hbrido as vagens desenvolvem-se
mento, enquanto todos os outros caracteres s
antes ou depois, ou se elas se formam sobre
aparecem no ano seguinte, pois se desenvol-
o eixo principal ou sobre o ramo lateral. Em
vem a partir das sementes hbridas.
algumas plantas somente poucas sementes se
desenvolveram nas primeiras vagens forma-
(F2) A 1 GERAO (OBTIDA A das, e essas possuam exclusivamente um dos
PARTIR) DOS HBRIDOS dois caracteres. Nas vagens que se desenvol-
Nesta gerao reaparecem, junto com os carac- veram a seguir, as propores normais foram
teres dominantes, tambm os recessivos com mantidas. Assim como em vagens diferentes,
suas peculiaridades completamente desenvol- a distribuio dos caracteres tambm variou
(6. Por ser consagrado pelo
uso, o termo lisa ser vidas em uma proporo mdia definida de em plantas diferentes. Servem como exemplo
utilizado em substituio ao 3 para 1, isto , de cada quatro plantas desta os primeiros dez indivduos das duas sries de
termo redonda utilizado gerao, trs mostram o carter dominante e experimentos.
originalmente por Mendel.)

Sociedade Brasileira de Gentica 93


RESENHAS

EXPERIMENTO 1 EXPERIMENTO 2
Forma da semente Cor do endosperma
Planta lisa rugosas Planta amarelas verdes
1 45 12 1 25 11
2 27 8 2 32 7
3 24 7 3 14 5
4 19 10 4 70 27
5 32 11 5 24 13
6 26 6 6 20 6
7 88 24 7 32 13
8 22 10 8 44 9
9 28 6 9 50 14
10 25 7 10 44 18

Como extremos da distribuio dos dois carac- do e 224, flores e tegumento da semente
teres foram observadas no experimento 1, uma brancos, dando proporo 3,15 para 1.
planta com 43 sementes lisas para apenas 2 ru-
Exp. 4. Forma da vagem de 1.181 plan-
gosas, e outra com 14 sementes lisas para 15 ru-
tas, 882 tinham vagens intumescidas e 299,
gosas; no experimento 2, houve um caso de uma
com constries, resultando 2,95 para 1.
de 20 sementes amarelas para 19 verdes.
Exp. 5. Cor da vagem no madura o n-
Esses dois experimentos so importantes para a
mero de plantas analisado foi 580, das quais
determinao das propores mdias, pois evi-
428 tinham vagens verdes e, 152, amarelas.
denciam a considervel flutuao que pode ocor-
Consequentemente estavam na proporo
rer com um nmero pequeno de plantas experi-
2,82 para 1.
mentais. Para contar as sementes, especialmente
no experimento 2, necessrio algum cuidado, Exp. 6. Posio das flores entre 858 ca-
j que em algumas sementes de muitas plantas sos, 651 tinham inflorescncias axiais e
a cor verde do endosperma encontra-se menos 207, apicais. Proporo: 3,14 para 1.
desenvolvida e, a princpio, pode passar desper- Exp. 7. Comprimento do caule das 1064
cebida. Este desaparecimento parcial da colora- plantas, em 787 casos os caules eram lon-
o verde no tem relao com o carter hbrido gos e em 277, curtos. Por conseguinte, a
das plantas, j que ocorre tambm na variedade razo foi de 2,84 para 1. Neste experimen-
parental. Esta peculiaridade (descolorao) limi- to as plantas ans foram cuidadosamente
ta-se ao indivduo e no herdada pela descen- transplantadas para um canteiro especial.
dncia. Em plantas vigorosas, esta aparncia foi Esta precauo foi necessria, pois de outro
notada frequentemente. As sementes que foram modo elas teriam perecido, cobertas pelas
danificadas por insetos durante o seu desenvol- plantas altas. Elas podem ser facilmente
vimento variam com a frequncia quanto cor identificadas nas fases mais jovens por seu
e forma, mas com um pouco de prtica para crescimento compacto e sua folhagem ver-
classific-las esses erros so facilmente evitados. de-escura.
quase suprfluo mencionar que as vagens de-
vem permanecer na planta at terem amadureci- Se reunirmos agora os resultados de todos os
do completamente e secado; somente a que a experimentos, encontraremos para o conjunto
forma e a cor da semente estaro completamente de formas com caracteres dominantes e recessi-
desenvolvidas. vos uma proporo mdia de 2,98 para 1 ou 3:1.

Exp. 3. Cor do tegumento das sementes O carter dominante pode ter aqui duplo sig-
Entre 929 plantas, 705 produziram flores nificado, a saber, o de um carter parental ou o
violetas e tegumento da semente cinza-par- de um carter hbrido. Somente na gerao se-

94 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

guinte pode ser determinado a qual dos dois sig- Exp. 3. A descendncia de 36 plantas
nificados se refere cada caso particular. Quando produziu sementes com tegumento cinza-
se trata de um carter parental, ele deve passar -pardo, enquanto da descendncia de 64
sem alterao para toda a descendncia; como plantas, algumas tinham tegumento cinza-
um carter hbrido; por outro lado, deve manter -pardo e outras, branco.
o mesmo comportamento que na primeira gera-
Exp. 4. A descendncia de 29 plantas apre-
o (F2).
sentou vagens intumescidas; da descendn-
cia de 71, por outro lado, algumas tinham
(F3) A SEGUNDA GERAO vagens intumescidas e outras vagens com
(OBTIDA A PARTIR) DOS constries.
HBRIDOS Exp. 5. A descendncia de 40 plantas deu
As formas, que na primeira gerao (F2) apre- somente vagens verdes; da descendncia de
sentavam o carter recessivo, no variam na ge- 60 plantas, algumas tinham vagens verdes e
rao seguinte (F3) com relao a este carter, outras, amarelas.
permanecendo constantes na descendncia. Exp. 6. A descendncia de 33 plantas apre-
O comportamento daquelas que possuem o sentou somente flores axiais; da descendn-
carter dominante na primeira gerao (des- cia de 67, por outro lado, algumas tinham
cendentes dos hbridos) , entretanto, diferente. flores axiais e, outras, apicais.
Destas, dois teros produzem descendncia que Exp. 7. De 28 plantas, os descendentes
exibe caracteres dominantes e recessivos na pro- herdaram caules longos e, das outras, 72,
poro de 3:1 e, portanto, mostram exatamen- alguns longos e outros curtos.
te a mesma proporo que as formas hbridas,
enquanto apenas um tero conserva constante o Em todos esses experimentos, um certo n-
carter dominante. mero de plantas manteve constante o carter
dominante. Os dois primeiros experimentos
OS EXPERIMENTOS ISOLADOS tm especial importncia para determinar as
propores em que aparecem as formas com o
PRODUZIRAM O SEGUINTE carter constante, pois neles um grande nmero
RESULTADO: de plantas pode ser comparado. As propores
Exp. 1. Entre 563 plantas que nasceram 1,93:1 e 2,13:1 do juntas quase exatamente a
de sementes lisas, 193 produziram apenas proporo mdia de 2:1. O sexto experimento
sementes lisas e portanto, permaneceram deu um resultado completamente concordante.
constantes para este carter; 372, entre- Nos outros, as propores variam para mais ou
tanto, deram sementes lisas e rugosas na para menos, conforme esperado em vista do pe-
proporo de 3:1. Portanto, o nmero de queno nmero (100) de plantas analisadas. O
hbridos comparando com o nmero de experimento 5, que mostrou o maior desvio, foi
constantes de 1,93 para l. repetido e no lugar da proporo 60 para 40, ob-
servou-se 65:35. Portanto, a razo mdia de
Exp. 2. De 519 plantas desenvolvidas de
2 para 1 aparece certamente como constante.
sementes da primeira gerao com endos-
perma amarelo, 166 produziram exclusi- Est demonstrado que, aquelas formas que
vamente sementes amarelas enquanto 353 possuem o carter dominante na primeira
produziram sementes amarelas e verdes na gerao, dois teros tm carter hbrido, en-
proporo de 3:1, o que resulta numa pro- quanto um tero permanece com o carter do-
poro de 2,13 para 1 entre plantas hbri- minante. A proporo 3:1 segundo a qual se
das e constantes. distribuem os caracteres dominantes e reces-
sivos na primeira gerao transforma-se, em
Nos cruzamentos seguintes foram selecionadas,
todos os experimentos, na proporo 2:1:1, se
para cada anlise, 100 plantas que apresentavam
o carter dominante for diferenciado, de acor-
o carter dominante na primeira gerao e para
do com seu significado, em um carter hbrido
assegurar a significncia disto, 10 sementes de
ou um carter parental. Desde que os mem-
cada uma foram cultivadas
bros da primeira gerao (F2) nascem direta-

Sociedade Brasileira de Gentica 95


RESENHAS

mente das sementes dos hbridos (F1), agora Se A for usado como smbolo de um dos dois
est claro que os hbridos formam sementes caracteres constantes, por exemplo, o dominan-
contendo um ou outro dos dois caracteres te; a do recessivo e Aa da forma hbrida, em que
diferentes; e desses, a metade desenvolve esto reunidos os dois, a expresso
novamente a forma hbrida, enquanto a
A + 2Aa + a
outra metade produz plantas que perma-
necem constantes e recebem os caracteres mostra os termos da srie da descendncia de
dominantes ou recessivos (respectivamente), hbridos para 2 caracteres diferentes. As obser-
em igual nmero. vaes feitas por Grtner, Klreuter e outros
de que os hbridos tendem a reverter s formas
AS GERAES parentais, tambm se confirmaram nos experi-
mentos descritos. Verificou-se que o nmero de
SUBSEQUENTES (OBTIDAS A hbridos que se origina de uma autofecundao
PARTIR) DOS HBRIDOS diminui a cada gerao quando comparado com
As propores nas quais os descendentes dos o nmero de formas constantes, embora no
hbridos desenvolvem-se e segregam na pri- desapaream totalmente. Se assumirmos que,
meira e segunda geraes so, provavelmente, em todas as geraes, a fertilidade mdia igual
as mesmas em toda a descendncia subse- para todas as plantas, e que cada hbrido forma
quente. Os experimentos 1 e 2 foram condu- sementes, das quais metade produz novamente
zidos por seis geraes; o 3 e o 7, por cinco; o hbridos, e metade constante para ambos os
4, 5 e 6, por quatro. Esses experimentos con- caracteres, os quais aparecem em propores
tinuaram, a partir da terceira gerao, com um iguais, a proporo do nmero de descendentes,
nmero pequeno de plantas e desvios percep- em cada gerao, pode ser resumida no quadro
tveis no foram encontrados. A descendncia abaixo, onde A e a denominam os dois caracte-
dos hbridos segregou-se em cada gerao na res parentais e Aa as formas hbridas. Para abre-
proporo de 2:1:1 entre as formas hbridas e viar os clculos foi suposto que cada planta, em
formas constantes. cada gerao fornea apenas 4 sementes:

Propores
Gerao A Aa a A: Aa: a
1 1 2 1 1 2 1
2 6 4 6 3 2 3
3 28 8 28 7 2 7
4 120 16 120 15 2 15
5 496 32 496 31 2 31
n 2n-1 2 2n-1

Na 10 gerao, por exemplo, 2n-1 = 1.023. Isso rificar se o que foi observado para cada par de
significa que, de cada 2.084 plantas que se ori- caracteres, quando isolado, aplicvel a vrios
ginam nesta gerao, 1023 tm o carter domi- caracteres diferentes quando associados, por
nante constante, 1.023, o carter recessivo e ape- cruzamentos, em um mesmo hbrido. Nestes
nas duas so hbridas. casos, com relao forma dos hbridos, os ex-
perimentos demonstram que estes, invariavel-
A DESCENDNCIA DOS mente, aproximam-se mais do progenitor que
HBRIDOS NOS QUAIS tem maior nmero de caracteres dominantes.
Se, por exemplo, a planta produtora de sementes
VRIOS CARACTERES ESTO tem caule curto, flores brancas apicais e vagens
ASSOCIADOS intumescidas e a planta produtora de plen cau-
Nos experimentos descritos acima foram usa- le longo, flores violeta distribudas ao longo do
das plantas que diferiam em apenas um carter caule e as vagens com constries, o hbrido se
essencial. O passo seguinte constitui em ve- parece com o progenitor produtor de sementes

96 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

apenas quanto forma da vagem; para os outros Das sementes amarelas rugosas resultaram 96
caracteres, ele se assemelha ao parental produtor plantas, das quais:
de plen. Se um dos dois parentais possui ape-
28 produziram apenas sementes amarelas
nas caracteres dominantes, o hbrido raramente
rugosas aB
, se que pode ser, distinguvel dele.
68 produziram apenas sementes rugosas,
Dois experimentos foram feitos com um nme-
amarelas e verdes ABB
ro considervel de plantas. No primeiro, as plan-
tas parentais diferiam quanto forma da semen- Das 108 sementes lisas e verdes, 102 plantas fru-
te e cor do endosperma; no segundo, quanto tificaram, das quais:
forma da semente, cor do endosperma e cor 35 s produziram sementes lisas verde Ab
do tegumento. Experimentos com caracteres das
sementes do resultados mais simples e mais se- 67 sementes verdes, lisas ou rugosa Aab
guros. As sementes rugosas verdes produziram 30
Para facilitar a anlise dos resultados, nesses ex- plantas que deram sementes com os mesmos
perimentos, os diferentes caracteres da planta caracteres, isto , permaneceram constantes ab.
produtora de semente sero indicados por A, B Na descendncia dos hbridos apareceram, por-
e C; os da planta produtora de plen, por a, b tanto, 9 formas diferentes, algumas das quais em
e c e as formas hbridas dos caracteres por Aa, nmeros muitos desiguais. Quando foram cole-
Bb e Cc. cionadas e ordenadas encontrou-se:
Exp. 1.
AB parental produtor de semente (A 38 plantas AB
forma lisa; B endosperma amarelo) 35 plantas Ab
ab parental produtor de plen (a forma 28 plantas aB
rugosa; b endosperma verde) 30 plantas ab
As sementes fecundadas resultaram lisas e ama- 65 plantas ABb
relas como as das plantas parentais produtoras 68 plantas aBb
de sementes. As plantas que delas se desenvolve- 60 plantas AaB
ram produziram sementes de quatro tipos, fre-
quentemente presentes em uma mesma vagem. 67 plantas Aab
De 15 plantas foram obtidas 556 sementes: 138 plantas AaBb
315 lisas e amarelas
O conjunto de formas pode ser classificado em
101 rugosas e amarelas trs grupos essencialmente diferentes. O primei-
108 lisas e verdes ro inclui os tipos AB, Ab, aB e ab; que possuem
apenas caracteres constantes e no variam na
32 rugosas e verdes gerao seguinte. Cada uma dessas formas est
Todas foram plantadas no ano seguinte. Das representada, em mdia, 33 vezes. O segundo
sementes lisas e amarelas, onze no produziram grupo inclui os tipos ABb, aBb, AaB, Aab que
plantas e trs plantas no produziram sementes. so constantes para um carter e hbridos para o
Entre as restantes, foram obtidas: outro, variando na gerao seguinte apenas com
respeito ao carter hbrido. Cada um deles apa-
38 plantas com sementes lisas e amarelas rece em mdia 65 vezes. A forma AaBb ocorre
AB 138 vezes; ela hbrida para os dois caracteres
65 plantas com sementes lisas, amarelas ou e comporta-se como o hbrido do qual derivou.
verdes ABb Se forem comparados os nmeros com que apa-
60 plantas com sementes amarelas, lisas ou recem as formas pertencentes a essas classes, a
rugosas AaB proporo 1:2:4 fica evidente. Os nmeros 33,
65 e 138 esto muito prximos de 33, 66 e 132.
138 plantas com sementes lisas, amarelas
ou verdes e sementes rugosas, amarelas ou O desenvolvimento da srie consiste das nove
verdes AaBb. classes observadas: quatro aparecem apenas uma

Sociedade Brasileira de Gentica 97


RESENHAS

vez e so constantes para os dois caracteres; as A + 2Aa + a


formas AB e ab se parecem com as formas pa-
B + 2Bb + b
rentais, as outras duas apresentam associaes
entre os caracteres A, a, B, b cujas combinaes Experimento 2
parecem tambm ser constantes. Quatro classes ABC parental produtor de sementes (A
aparecem sempre duas vezes e so constantes forma lisa; B endosperma amarelo; C te-
para um carter e hbridas para o outro. Uma gumento cinza-pardo)
classe aparece quatro vezes e hbrida para os
dois caracteres. Consequentemente, a descen- abc parental produtor de plen (a forma
dncia de hbridos, onde esto combinados dois rugosa; b endosperma verde; c tegumento
tipos de caracteres diferentes, representada branco)
pela expresso: Esse experimento foi realizado da mesma
AB + Ab + aB + ab + 2ABb + 2aBb + maneira que o anterior. De todos os expe-
2AaB + 2Aab + 4AaBb rimentos foi o que necessitou mais tempo
e cuidados. De 24 hbridos foram obtidos
Esta expresso , sem dvida, uma srie com- 687 sementes, todas pintadas, cinza-pardo
binatria na qual duas expresses, uma para os ou verde-acinzentado, lisas ou rugosas(7).
caracteres A e a e, outra para, B e b, so combi- Dessas, no ano seguinte 639 plantas fru-
nadas. Chegamos ao nmero total de classes da tificaram e anlises posteriores mostraram
srie pela combinao das expresses: entre elas:

8 plantas ABC 22 plantas ABCc 45 plantas ABbCc 78 plantas AaBbCc


14 plantas ABc 17 plantas AbCc 36 plantas aBbCc
9 plantas AbC 25 plantas aBCc 38 plantas AaBCc
11 plantas Abc 20 plantas abCc 40 plantas AabCc
8 plantas aBC 15 plantas ABbC 49 plantas AaBbC
10 plantas aBc 18 plantas ABbc 48 plantas AaBbc
10 plantas abC 19 plantas aBbC

A expresso completa contm 27 termos. Des- Aqui tambm se trata de uma srie combinat-
ses, 8 so constantes para todos os caracteres ria, na qual as expresses para os caracteres A e
e cada um aparece em mdia 10 vezes; 12 so a, B e b, C e c esto reunidas. As expresses:
constantes para 2 caracteres e hbridos para o
A + 2Aa + a
terceiro, cada um aparece em mdia 19 vezes;
6 so constantes para um carter e, hbrido, os B + 2Bb + b
outros dois, cada um aparece em mdia 43 vezes. C + 2Cc + c
Uma forma aparece 78 vezes e hbrida para to-
dos os caracteres. As propores 10, 19, 43, 78 do origem a todas as classes da srie. Ocorrem
aproximam-se tanto das propores 10, 20, 40, todas as combinaes possveis entre os carac-
80 ou 1, 2, 4, 8 que estes ltimos, indubitavel- teres A, B, C, a, b, c; duas delas, ABC e abc
mente, representam os valores verdadeiros. parecem com os estoques parentais originais.

O desenvolvimento dos hbridos, quando os pa- Alm destes, outros experimentos foram reali-
rentais diferem em trs caracteres, est de acordo zados com um nmero menor de plantas, nos
com a seguinte expresso: quais os caracteres restantes uniram-se de 2 em
2 ou de 3 em 3; todos produziram aproxima-
ABC + ABc + AbC + Abc + aBC + aBc + damente os mesmos resultados. Portanto, no
abC + abc + 2ABCc + 2AbCc + 2aBCc + (7. Observe que Mendel no se
h dvida de que para todos os caracteres en- refere cor dos cotildones,
2 abCc + 2ABbC + 2ABbc + 2aBbC + volvidos nos experimentos aplica-se o princpio pois devido espessura do
2aBbc + 2AaBC + 2AaBc + 2AabC + de que a descendncia dos hbridos nos quais tegumento, sua cor no
2Aabc + 4ABbCc + 4aBbCc + 4AaBCc + esto combinados diversos caracteres essen- podia ser observada sem
4AabCc + 4AaBbC + 4AaBbc + 8AaBbCc descascar as sementes.)

98 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

cialmente diferentes exibe os termos de uma outra metade constante, ocorrendo em igual
srie combinatria resultante das sries de proporo os caracteres dos parentais produto-
cada um dos pares de caracteres. Ao mesmo res de sementes e plen, respectivamente.
tempo se demonstra que: a relao de cada par
Se diversos caracteres diferentes so combi-
de caracteres na unio hbrida independente
nados nos hbridos por fecundao cruzada,
das outras diferenas existentes entre os dois
a descendncia forma os termos de uma srie
estoques parentais originais.
combinatria, que resulta da reunio das sries
Se N representa o nmero de caracteres diferen- combinatrias de cada par de caracteres.
tes nos dois estoques, 3N d o nmero de ter-
A uniformidade de comportamento, mostrada
mos da srie de combinaes; 4N o nmero de
pelo conjunto dos caracteres submetidos aos
indivduos que pertencem srie, e 2N, o nmero
experimentos, permite e justifica a aceitao do
de unies que permanecem constantes. Se os es-
princpio de que outros caracteres, que apare-
toques originais diferem em quatro caracteres, a
cem menos claramente definidos nas plantas e,
srie conter 34 = 81 classes, 44 = 256 indivduos
portanto, no puderam ser includos nos diver-
e 24 = 16 formas constantes ou, em outras pala-
sos experimentos, devem se comportar de ma-
vras, que em 256 descendentes hbridos, h 81
neira semelhante. Um experimento envolvendo
combinaes diferentes, das quais 16 so cons-
pednculos de diferentes comprimentos deu,
tantes. Todas as combinaes constantes que so
em conjunto, resultados bastante satisfatrios,
possveis em ervilhas pela combinao dos sete
embora a diferenciao e o arranjo em srie das
caracteres citados foram obtidas em repetidos
formas no pudessem ser efetuados com segu-
cruzamentos. Seu nmero dado por 27 = 128.
rana necessria para que os experimentos sejam
Portanto, fica demonstrado que os caracteres
considerados corretos.
constantes que aparecem em diferentes varie-
dades de um grupo de plantas podem ser obti-
dos em todas as associaes possveis de acor-
AS CLULAS REPRODUTORAS
do com as leis (matemticas) da combinao DOS HBRIDOS
por meio de repetidas fecundaes artificiais. Os resultados dos experimentos descritos ante-
No que se refere ao tempo que os hbridos le- riormente levaram a novos experimentos cujos
vam para florir, os experimentos ainda no es- resultados permitem algumas concluses a res-
to concludos. Entretanto, pode-se dizer que peito da composio das clulas-ovo e dos gros
intermedirio ao dos parentais, e que a consti- de plen dos hbridos. Um ponto importante
tuio dos hbridos com respeito a esse carter, resolvido com os experimentos em Pisum, pois
provavelmente segue a mesma regra dos demais entre a descendncia dos hbridos aparecem for-
caracteres. As formas que so selecionadas para mas constantes para todas as combinaes de
experimentos deste tipo devem ter uma diferen- caracteres associados. De acordo com o obser-
a de pelo menos 20 dias entre o tempo mdio vado nas experincias, descendncia constante
de florao de uma em relao a outra. Alm s pode ser formada quando clula-ovo e gro
disso, as sementes devem ser colocadas na terra de plen tm caracteres iguais, de maneira que
com a mesma profundidade para que germinem ambos, assim como no caso da autofecundao
simultaneamente. Durante todo o perodo de de espcies puras, possuem material para criar
florao, devem tambm ser levadas em consi- indivduos semelhantes. Portanto, devemos con-
derao as variaes bruscas de temperatura e siderar que tambm nas plantas hbridas, fatores
o adiantamento ou atraso na florao que pode exatamente iguais entre si devem atuar na pro-
resultar disso. evidente que esse experimento duo das formas constantes. Desde que as v-
apresenta muitas dificuldades e necessita grande rias formas constantes so produzidas por uma
ateno. planta, ou mesmo em uma flor da planta, parece
lgico concluir que nos ovrios dos hbridos so
Se resumirmos os resultados conseguidos, en- formados tantos tipos de clulas-ovo, e nas ante-
contraremos que todos os caracteres de reco- ras, tantos tipos de gros de plen quantas forem
nhecimento fcil e seguro comportam-se exata- as combinaes constantes possveis. Pode-se
mente da mesma maneira em suas associaes tambm concluir que essas clulas-ovo e esses
hbridas. A descendncia dos hbridos para cada gros de plen tm composio interna corres-
par de caracteres metade hbrida, enquanto a pondente a cada uma das variedades separadas.

Sociedade Brasileira de Gentica 99


RESENHAS

De fato, possvel demonstrar teoricamente que Alm disso, se as diversas formas de clulas-
esta hiptese seria suficiente para explicar o de- -ovo e de gros de plen dos hbridos forem
senvolvimento dos hbridos em geraes sepa- produzidas com nmero mdio igual, em
radas, se pudssemos ao mesmo tempo assumir cada experimento as quatro combinaes
que os vrios tipos de clulas-ovo e de gros de deveriam estar na mesma proporo. En-
plen so em mdia, formados no hbrido em tretanto, no era de se esperar uma concor-
igual nmero(8). dncia perfeita na relao numrica, pois em
cada fecundao, mesmo em casos normais,
Para submeter essas suposies a uma prova
algumas clulas-ovo no se desenvolvem ou
experimental, os seguintes experimentos fo-
morrem posteriormente, e algumas semen-
ram planejados. Duas classes que so diferentes
tes bem formadas no germinam quando se-
quanto forma das sementes e cor do endos-
meadas. A suposio anterior tambm est
perma foram unidas por fecundao. Se os di-
limitada pelo fato de que, enquanto requer a
ferentes caracteres forem novamente indicados
formao de nmeros iguais dos vrios tipos
por A, B, a, b estas tm:
de clulas-ovo e gros de plen, no neces-
AB parental produtor de sementes (A for- srio que isto se aplique a cada hbrido com
ma lisa; B endosperma amarelo) exatido matemtica.
ab parental produtor de plen (a - forma rugo- O primeiro e o segundo experimentos ti-
sa; b endosperma verde) nham como objetivo principal provar a com-
As sementes fecundadas artificialmente foram posio das clulas-ovo dos hbridos, en-
semeadas com diversas sementes dos dois es- quanto o terceiro e quarto, decidir sobre os
toques e os exemplares mais vigorosos foram gros de plen. Como evidenciado pela de-
escolhidos para cruzamentos recprocos. Foram monstrao acima, o primeiro e terceiro, as-
fecundados: sim como o segundo e quarto experimentos
deveriam ser parcialmente visveis na forma
1. os hbridos com o plen AB e na cor das sementes fecundadas artificial-
2. os hbridos com o plen ab mente.
3. AB com o plen dos hbridos No primeiro e terceiro experimentos, os ca-
racteres dominantes para forma e cor A e B
4. ab com o plen dos hbridos
aparecem em cada unio e so, em parte, cons-
Para cada um desses quatro experimentos, todas tantes e, em parte, em unio hbrida com os
as flores de trs plantas foram fecundadas. Se a caracteres recessivos a e b e por isso devem
teoria acima estiver correta, desenvolver-se-o expressar suas peculiaridades em todas as se-
clulas-ovo e gros de plen AB, Ab, aB e ab, mentes. Portanto, se a teoria estiver correta,
que podero ser combinadas: todas as sementes devem ser lisas e amarelas.
1. clulas-ovo AB, Ab, aB e ab com gros de Por outro lado, no segundo e quarto experi-
plen AB mentos, uma unio hbrida na forma e na
cor e, consequentemente, as sementes so lisas
2. clulas-ovo AB, Ab, aB e ab com gros de e verdes; a terceira constante para o carter
plen ab recessivo para forma, mas hbrida para cor e,
3. clulas-ovo AB com gros de plen AB, Ab, consequentemente as sementes so rugosas
aB e ab e amarelas; a quarta constante para os dois
caracteres recessivos e, ento as sementes so
4. clulas-ovo ab com gros de plen AB, Ab,
rugosas e verdes. Portanto, nesses experimen-
aB e ab
tos eram esperados quatro tipos de sementes:
De cada um desses experimentos poderiam re- lisa e amarela, lisa e verde, rugosa e amarela, e
sultar apenas as seguintes formas: rugosa e verde.
1. AB, ABb, AaB, AaBb Os resultados concordaram perfeitamente
2. AaBb, Aab, aBb, ab com essas previses. Foram obtidas:
(8. Esse e o pargrafo anterior,
3. AB, ABb, AaB, AaBb 1 Exp. 98 sementes lisas e amarelas contm a essncia dos
princpios Mendelianos da
4. AaBb, Aab, ABb, ab 3 Exp. 94 sementes lisas e amarelas hereditariedade.)

100 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

2 Exp. 31 sementes lisas e amarelas, 26 Agora, devem existir poucas dvidas quanto
lisas e verdes, 27 rugosas e amarelas e 26 ao sucesso do experimento e a prxima gera-
rugosas e verdes. o deve fornecer a prova final. No primeiro
experimento, das sementes semeadas resul-
4 Exp. 24 sementes lisas e amarelas, 25
taram 90 plantas e no terceiro, 87, as quais
lisas e verdes, 22 rugosas e amarelas e 27
produziram:
rugosas e verdes.

1 Exp. 3 Exp.
20 25 lisas e amarelas (AB)
23 19 lisas, amarelas e verdes (ABb)
25 22 amarelas, lisas e rugosas (AaB)
22 21 amarelas e verdes, lisas e rugosas (AaBb)

No segundo e quarto experimentos, as se- Das sementes verdes e rugosas, as plantas


mentes lisas e amarelas produziram plantas nascidas produziram novamente apenas se-
com sementes lisas ou rugosas, amarelas ou mentes verdes e rugosas, ab.
verdes, AaBb.
Ainda que tambm nesses dois experimen-
Das sementes lisas e verdes resultaram plan- tos (provavelmente) algumas sementes no
tas com sementes verdes, lisas ou rugosas, tenham germinado, nmeros obtidos no ano
Aab. anterior no foram afetados, j que cada tipo
de semente originou plantas que, com rela-
As sementes amarelas e rugosas deram plan-
o s suas sementes, eram iguais entre si e
tas rugosas, amarelas ou verdes, aBb.
diferentes das outras. Portanto, resultaram:

2 Exp. 4 Exp.
31 24 plantas AaBb
26 25 plantas Aab
27 22 plantas aBb
26 27 plantas ab

Em todos os experimentos, portanto, apare- No segundo ano, foram usados como parental
cem todas as formas que a teoria prev, e em produtor de sementes, o hbrido Aab e como
nmeros quase iguais. parental fornecedor de plen, o hbrido aBb.
Em experimento posterior foram usados os Parental produtor de sementes Aab.
caracteres cor da flor e comprimento do caule
Clulas-ovo possveis Ab e ab(9).
e a seleo foi feita de modo que, no terceiro
ano de experimentao, cada carter deveria Parental fornecedor de plen ABB.
aparecer em metade das plantas, se a teoria Gros de plen possveis aB e ab(10).
anterior estivesse correta. A, B, a e b servem
para indicar os vrios caracteres. Da fecundao entre as clulas-ovo e os gros
de plen deveriam resultar quatro combina-
A flor vermelho-violeta a flor branca es:
B caule longo b caule curto AaBb + aBb + Aab + ab
O tipo Ab foi fecundado por ab produzindo Disto se deduz que, segundo a teoria anterior,
(9. No original consta Abab.) o hbrido Aab. Alm disso, aB foi tambm no terceiro ano do experimento, de todas as
(10. No original consta aBab.)
fecundado por ab obtendo-se o hbrido aBb. plantas:

Sociedade Brasileira de Gentica 101


RESENHAS

metade deveria ter flores vermelho-vio- metade deveria ter caules curtos (b)
letas (Aa) classes 1 e 3. classes 3 e 4.
metade deveria ter flores brancas (a) Das 45 fecundaes realizadas no segundo
classes 2 e 4. ano resultaram 187 sementes, das quais s
166 alcanaram a fase de florao no terceiro
metade deveria ter caules longos (Bb)
ano. Entre essas, as classes separadas apare-
classes 1 e 2.
ceram com os seguintes valores:

classe cor da flor caule n de vezes


1 vermelho-violeta longo 47
2 branca longo 40
3 vermelho-violeta curto 38
4 branca curto 41

Portanto apareceram: participam na fecundao com igual frequncia.


Portanto, cada forma ocorre duas vezes, j que
cor vermelho-violeta da flor (Aa) em 85
quatro indivduos so formados. Consequente-
plantas
mente, participam da fecundao:
cor branca da flor (a) em 81 plantas
Os gros de plen A + A + a + a
caule longo (Bb) em 87 plantas
As clulas-ovo A + A + a + a
caule curto (b) em 79 plantas.
O tipo de plen que se unir com cada tipo de
A teoria citada , portanto, satisfatoriamente clula-ovo , portanto, simplesmente uma ques-
confirmada tambm por este experimento. to de acaso. De acordo com a lei da probabilida-
Para os caracteres cor e forma da vagem e posi- de sempre acontecer, na mdia de muitos casos
o das flores foram realizados experimentos em que, cada tipo de plen, A e a, se unir com igual
pequena escala, e os resultados obtidos concor- frequncia com cada tipo de clula-ovo A e a.
daram plenamente. Todas as combinaes que Consequentemente, na fecundao um dos dois
eram possveis pela unio dos diferentes caracte- gros de plen A se unir com a clula-ovo A e
res apareceram em propores semelhantes. o outro com a clula-ovo a, do mesmo modo que
Portanto, est confirmada experimentalmente a um dos gros de plen se unir com a clula-ovo
teoria de que os hbridos de ervilhas formam A e o outro com a clula-ovo A.
clulas-ovo e gros de plen que, em suas Gros de plen A A a a
constituies, apresentam em igual nmero
todas as formas constantes que resultam da
combinao dos caracteres unidos na fecun- Clulas-ovo A A a a
dao.
O resultado da fecundao pode se tornar claro
A diferena de formas na descendncia dos h- colocando-se sob a forma de frao os smbolos
bridos, bem como as propores em que so dos gros de plen e clulas-ovo que se unem;
observveis podem ser explicadas pelo princpio aqueles para os gros de plen, acima da linha,
deduzido anteriormente. O caso mais simples a e aqueles para as clulas-ovo, abaixo da mesma.
srie de desenvolvimento de cada par de caracte- Assim teremos:
res diferentes. Esta srie representada pela ex-
presso A + 2Aa + a, na qual A e a significam as A/A + A/a + a/A + a/a
formas com caracteres constantes e Aa a forma No primeiro e quarto termos, as clulas-ovo e os
hbrida. Inclui quatro indivduos, em trs clas- gros de plen so do mesmo tipo, consequente-
ses diferentes. Na formao destes, clulas-ovo mente, o produto da unio dever ser constan-
e gros de plen das formas A e a, em mdia, te, isto , A e a. Por outro lado, no segundo e

102 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

terceiro voltam a se unir os dois caracteres que Gros de plen


diferenciam os estoques; portanto, as formas re-
AB + AB + AB + AB +
sultantes desta fecundao so idnticas aos h-
bridos dos quais vieram. Ocorre, portanto, uma Ab + Ab + Ab + Ab +
hibridao repetida. Isto explica o fato notvel aB + aB + aB + aB +
de que os hbridos so capazes de produzir, alm
das duas formas parentais, descendentes iguais a ab + ab + ab + ab
si prprios, A/a e a/A que do a mesma unio Clulas-ovo
Aa, j que, como anteriormente citado, a pro-
AB + AB + AB + AB +
cedncia dos dois caracteres, se do plen ou do
ovo, no altera o resultado da fecundao. Ns Ab + Ab + Ab + Ab +
podemos escrever ento:
aB + aB + aB + aB +
A/A + A/a + a/A + a/a = A + 2Aa + a
ab + ab + ab + ab
Isto representa o resultado mdio da autofecun-
No processo de fecundao cada forma de
dao dos hbridos quando um par de caracte-
plen une-se, em mdia, com igual frequncia
res est presente neles. Entretanto, em flores e
com cada forma de clula-ovo. Desta maneira,
plantas individuais as propores nas quais as
cada um dos quatro gros de plen AB une-se
diferentes formas so produzidas podem sofrer
uma vez com cada uma das formas de clula-
variaes considerveis.
-ovo AB, Ab, aB, ab. Precisamente da mesma
Alm do fato de que as propores nas quais os maneira os demais gros de plen das formas
dois tipos de celulas-ovo ocorrem nos ovrios Ab, aB e ab unem-se com todas as outras c-
somente poderem ser consideradas como iguais, lulas-ovo.
em mdia; o tipo de plen que fertilizar cada
Obteremos, portanto:
um dos tipos de clula-ovo mera questo de
acaso. Por esta razo, os diversos valores devem AB/AB + AB/Ab + AB/aB + AB/ab +
necessariamente estar sujeitos flutuao e, in- Ab/AB + Ab/Ab + Ab/aB + Ab/ab +
clusive, so possveis casos extremos, como os aB/AB + aB/Ab + aB/aB + aB/ab +
descritos anteriormente nos experimentos sobre ab/AB + ab/Ab + ab/aB + ab/ab
a forma da semente e a cor do endosperma. As ou
propores numricas verdadeiras s podem
ser deduzidas atravs de uma mdia obtida pela AB + ABb + AaB + AaBb + ABb + Ab +
soma de tantos valores individuais quantos se- AaBb + Aab + AaB + AaBb + aB +aBb +
jam possveis. AaBb +Aab + aBb + ab = AB + Ab +
aB + ab + 2ABb + 2aBb + 2AaB +
Quanto maior a amostragem, maior ser a elimi- 2Aab + 4AaBb.
nao dos efeitos do acaso.
De uma maneira exatamente igual se apresenta
A srie de desenvolvimento para hbridos, nos a srie de desenvolvimento dos hbridos, quando
quais dois tipos de caracteres esto unidos, con- trs tipos de caracteres esto neles reunidos. Os
tm nove formas diferentes, entre 16 indivduos, hbridos formam oito tipos distintos de clulas-
a saber: -ovo e gros de plen ABC, Abc, AbC, Abc,
AB + Ab + aB + ab + 2Abb + 2aBb + aBC, aBc, abC, abc e cada forma de plen une-
2AaB + 2Aab + 4AaBb -se novamente, em mdia, uma vez com cada for-
ma de clula-ovo.
Entre os caracteres contrastantes dos estoques
originais Aa e Bb, so possveis quatro combina- A lei das combinaes de diferentes caracteres
es constantes. Consequentemente, os hbridos que governa o desenvolvimento dos hbridos
produzem as quatro formas correspondentes de tem fundamento e explicao no princpio enun-
clula-ovo e gros de plen, AB, Ab, aB, ab, e ciado de que os hbridos produzem clulas-ovo e
cada uma delas dever aparecer, em mdia, qua- gros de plen, os quais representam, em nme-
tro vezes na fecundao, j que 16 indivduos es- ros iguais, todas as formas constantes que resul-
to includos na srie. Portanto, os participantes tam da combinao dos caracteres agrupados na
na fecundao so: fecundao.

Sociedade Brasileira de Gentica 103


UM GENE

104 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

Gene tnaA:
bactrias resistentes
altrustas socorrem
vizinhas menos
resistentes
Sergio Olavo Pinto da Costa

Departamento de Microbiologia. Instituto de Cincias


Biomdicas. USP. So Paulo.

Autor para correspondncia: sopdcost@usp.br

B actrias com alto nvel de resistncia a um dado antibitico


podem, curiosamente, ajudar altruisticamente bactrias
vizinhas, menos resistentes a esse antibitico, graas
produo de indol que leva estas bactrias menos resistentes
a expulsar o antibitico de seu interior.

A SURPREENDENTE ESTRIA verificar que as bactrias mais resistentes


Indol ajudavam a sobrevivncia das suas vizinhas
um composto orgnico DAS BACTRIAS CARIDOSAS menos resistentes. Essas bactrias altrus-

R
aromtico heterocclico que
ecentemente, pesquisadores analisan- tas assim agem ao liberar uma substncia
pode ser produzido por diversas
espcies de bactrias como do como uma populao bacteriana se sinalizadora, o indol, que leva as bactrias
um produto da degradao do comporta quando cultivada na presena de menos resistentes expulsar o antibitico de
aminocido triptofano. um dado antibitico se surpreenderam ao seu interior.

Sociedade Brasileira de Gentica 105


UM GENE

ANTIBITICOS FORAM no somente com o estafilococo. Inmeras


bactrias patognicas esto reagindo dessa
FEITOS PARA MATAR mesma forma aos mais recentes antimicro-
EFICIENTEMENTE BACTRIAS bianos produzidos.
Quando o primeiro e muito poderoso an- Os estafilococos so bactrias
Cerca de setenta anos aps a introduo da esfricas (cocos), imveis e
tibitico - a penicilina - passou a ser usado,
antibioticoterapia, contamos hoje com mais piognicas (produzem infeco
quase no final da Segunda Grande Guerra purulenta) por excelncia. So
de 160 antibiticos, o que corresponde a
Mundial deu o incio a uma nova era no tra- coradas em roxo pela colorao
mais de 10 antibiticos para cada bactria diferencial de Gram (Gram-
tamento de infeces causadas por certos mi-
importante em clnica e, a cada dia se depa- positivas) e crescem em forma
crorganismos, principalmente o conhecido
ra com bactrias que apresentam resistncia de cachos de uva.
estafilococo. Realmente, os primeiros anos
a todos os novos antibiticos. Pelo andar
que se sucederam, foram suficientes para de-
da carruagem corre-se o risco de ter-se que
monstrar o valor dessa droga, tida na poca,
voltar, em futuro prximo, ao perodo pr-
como milagrosa por salvar milhares de vti-
-antibitico para o tratamento das doenas
mas da guerra.
infecciosas. Isso no parece nada animador!
Para o desaponto geral esse milagre durou
pouco e no esforo para substituir essa dro- AS DROGAS MILAGROSAS
ga foi realizado um grande empreendimento FORAM SUPERADAS PELOS
mundial para se isolar novos antibiticos.
Mas por qual razo a to poderosa penicilina ORGANISMOS MAIS ANTIGOS
deixou de ser eficiente na destruio de bact- DA TERRA
rias, antes to sensveis a ela? Estima-se que as bactrias tenham surgido
Foi, realmente, bastante desapontador para na Terra h cerca de 3,5 bilhes de anos.
o mundo quando nos primeiros anos de uso Durante todo esse tempo elas tm supera-
da penicilina se verificou um considervel au- do os mais diversos ambientes: temperatu-
mento de bactrias resistentes a esse antibiti- ras altas, radiaes ultravioleta, diferentes
co, principalmente no caso, o estafilococo, que nutrientes, fontes de energia, etc. A causa
se tornou insensvel, ou resistente, a qualquer primria da resistncia a drogas a capaci-
quantidade dessa droga nos hospitais ingle- dade extraordinria de adaptao ao meio
Adaptao
ses. O pior que a frequncia dessa resistncia graas variabilidade gentica. Sua eficiente a resposta de clulas ao
foi aumentada de tal jeito que em poucos anos evoluo est associada estrutura genmica estresse fisiolgico ou a
a grande maioria desses germes, tornaram-se que garante mutaes cromossmicas, trocas estmulos patolgicos.
totalmente resistentes penicilina. e rearranjos de genes dentro e entre as bac-
trias e, principalmente, bactrias portado-
O HOMEM APERFEIOA ras de pequenos elementos de DNA extra-
-cromossmicos (plasmdeos) que carregam
RATOEIRA E A NATUREZA genes responsveis pela resistncia mltipla
ADESTRA O RATO aos antimicrobianos. Em outras palavras, as
Durante os primeiros anos da dcada de causas desse malogro decorrem das prprias
1950, outros antibiticos foram introduzi- leis da natureza gentica bacteriana que ti-
dos, incluindo os hoje bem conhecidos es- ram proveito do uso extensivo e indiscrimi-
treptomicina, cloranfenicol, tetraciclinas, eri- nado de antibiticos.
tromicinas e novobiocina. Mais uma vez, o Bactrias que apresentam resistncia cro-
fenmeno da resistncia bacteriana ocorreu mossmica podem possuir o sistema de
igualmente em pouco tempo de administra- resistncia multidroga (MDR) tambm co-
o desses novos compostos. nhecido por bomba de efluxo ou expul- Bomba de efluxo
o bombeamento ativo de
A subsequente introduo, a partir de 1960, so. O sistema de efluxo chama ateno pelo
antimicrobianos do meio
de dezenas de outros poderosos agentes an- fato de um nico mecanismo de resistncia intracelular para o extracelular,
timicrobianos, no ofereceu um controle per- diminuir a suscetibilidade da bactria a um comandado pela induo de um
manente da infeco e, mais uma vez, ocor- nmero de diferentes drogas o que permite grupo de genes exportadores
a sua convivncia em diferentes nichos eco- tornando a clula bacteriana
reu a emergncia de linhagens resistentes a menos sensvel a um grupo de
todos eles. Esse fenmeno tem se repetido lgicos. antibiticos.

106 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

UM GESTO ALTRUSTICO clulas bacterianas mais resistentes serve


para ativar um conjunto de genes (existem
ENTRE BACTRIAS cerca de 20 diferentes genes), os xenobiticos
Biorreator
refere-se a um recipiente
Tudo comeou, recentemente quando pes- exportadores, responsveis pela expulso do
utilizado para a cultura aerbica quisadores americanos decidiram conhecer antibitico pela bomba de efluxo.
continua de clulas, no caso a dinmica da resistncia populacional de
bacterianas, que se duplicam uma conhecida bactria que frequenta o nos-
em constante fase exponencial A MOLCULA DE
so corpo, Escherichia coli, quando submeti-
de crescimento.
da ao crescimento contnuo em biorreator INDOL UMA GRANDE
(nesse sistema as bactrias esto sempre em CONTROLADORA CELULAR
crescimento exuberante) em presena de n- Muitas bactrias Gram-negativas e Gram-
A colorao de Gram permite
diferenciar bactrias com
veis crescentes de um conhecido antibitico, -positivas codificam uma nica cpia do
diferentes estruturas de norfloxacina. Verificaram, esses pesquisado- gene tnaA em seu cromossomo, responsvel
parede celular a partir das res, que a grande maioria dos isolados era pela sntese da enzima triptofanase. O indol
coloraes que estas adquirem menos resistentes que a populao como um sintetizado a partir da quebra do triptofano
aps tratamento com agentes
todo. Mais ainda, algumas poucas bactrias pela triptofanase. uma molcula sinaliza-
qumicos especficos. As
bactrias que adquirem a mutantes, altamente resistentes (cerca de dora envolvida na tolerncia ao estresse em
colorao azul violeta so 1%), melhoraram a sobrevida da populao E.coli. Como uma molcula sinalizadora in-
chamadas de Gram-positivas menos resistente, em parte, por produzirem tercelular, ela controla diversos aspectos da
e aquelas que adquirem indol, um velho conhecido composto excre-
a colorao vermelha so
fisiologia celular, como a formao de espo-
chamadas de Gram-negativas.
tado por diferentes espcies bacterianas. Ve- ros, formao de biofilmes, controle da vi-
rificaram ainda, que o indol produzido pelas rulncia, e resistncia a drogas.
Biofilmes
so complexos ecossistemas
microbianos embebidos numa
matriz de exopolissacardeo
aderidos a uma superfcie. No
biofilme os microrganismos
tornam-se mais resistentes a
ao de agentes qumicos e
fsicos.

Sociedade Brasileira de Gentica 107


UM GENE

O GENE tnaA DA responsvel pela sntese da triptofanase,


gene tnaB que codifica para uma permease e
TRIPTOFANASE o gene tnaC que codifica um peptdeo lder.
O gene tnaA codifica um peptdeo com 471 Esse operon induzido pelo triptofano que
aminocidos, mas a triptofanase ativa for- o substrato da triptofanase. A estrutura des-
mada por 4 dessas unidades peptdicas. Este se operon revela que ele deve ter sido intro-
gene est localizado num ponto especfico do duzido no cromossomo da E.coli h milhes
mapa cromossmico (83.8 min.) da E. coli de anos atrs como um elemento gen-
e faz parte de um operon, estrutura cons- Os elementos genticos
tico mvel, via transferncia gentica mveis so segmentos do
tituda por trs genes: gene estrutural tnaA, horizontal (ou lateral). genoma podem mudar de
posio no cromossomo ou
se transferirem para outro
cromossomo.

Os genes de bactrias esto organizados em operons, conjuntos


Transferncia horizontal
de genes que so co-regulados. Alm de estarem fisicamente de genes
prximos os genes que compem um operon esto sob o controle ou transferncia lateral de
genes um processo em que
de uma nica regio promotora ou promotor,que fornece um local um organismo transfere material
para ligao da RNA polimerase. Assim sendo, todos os genes de gentico para outra clula que
no sua descendente.
um operon so ligados (ou transcritos) ou desligados (ausncia
de transcrio) juntos. O agrupamento de genes relacionados sob
um controle regulatrio comum possibilita respostas rpidas s
mudanas do ambiente como, por exemplo, das fontes de carbono
e de outros nutrientes.

PRODUZIR INDOL SAI o tratamento por antibiticos poder ser fa-


cilitado em menores doses se a ao do indol
CARO PARA AS BACTRIAS fosse impedida.
PRODUTORAS, MAS
COMPENSA
O admirvel que a energia gasta pelas clu-
las mais resistente para produzir esses meca-
nismos que fortalecem as bactrias vizinhas,
menos resistentes, evitando a sua morte, tem
um custo adicional para essas bactrias que
se manifesta por um crescimento menor.
Por outro lado, d para entender o com-
portamento das bactrias generosas, mais
resistentes, ao ajudar a populao mais nu-
merosa e menos resistente, como compensa-
o biolgica: sem a ajuda das mais fortes, a
populao poderia ser reduzida a um nivel
crtico, o que facilitaria um contra-ataque
das defesas do organismo contra as bact-
rias. Obviamente, para quem toma antibi-
tico, no bom negcio essa generosidade
entre bactrias. provvel que futuramente
Figura 1.
Estrutura da triptofanase.

108 Gentica na Escola | Vol. 8 | N 1 | 2013


Gentica na Escola ISSN: 1980-3540

PARA SABER MAIS JIN-HYUNG, L.; JINTAE, L. Indol as inter-


cellular signal in microbial communities.
FEMS Microbial Rev. v 34, p 462-444, 2010.
1. Obra Geral. LEE, H. H.; MOLLA, M.; CANTOR, C. R.;
ROSSI, F.; ANDREAZZI, D. Resistncia bac- COLLINS, J. J. Bacterial charity work leads
teriana. So Paulo. Atheneu. 2005. 118 pp. to population-wide resistance. Nature v. 467,
n 7311, p 82-85, 2010.
MARTIN, K.; MORLIN, G.; NORDYKE, A.;
2. Altrusmo bacteriano, indol e genes EISENSTARK, A.; GOLOMB, M. The trip-
xenobiticos exportadores. tophanase gene cluster of Hemophilus influen-
zae tipe B: evidence for horizontal gene trans-
HIRAKAWA, H.; INAZUMI, Y.; MASAKI,
fer. J. Bacteriol. v 180, n.1, p 107-118, 1998.
T.; HIRATA, T.; YAMAGUCHI, A. Indol
induces the expression of multidrug export- NIKAIDO. H. Multidrug efllux pumps in gram-
er genes in Escherichia coli. Molecular Micro- negative bacteria. J. Bacteriol. v. 178, n. 20, p
biology v.55, n(4, p. 1113-1126, 2005. 5853-5859, 1996.

Sociedade Brasileira de Gentica 109