Você está na página 1de 9

cidos

Fases da Histria da Gentica

Nucleicos Mendeliana
DNA (identidade)
Dogma Central
C ((DNA - RNA - Protena))
MO640A - Biologia Computacional
Regulao da expresso gnica
DNA recombinante
Felipe Rodrigues da Silva
Totalidade da informao gentica
Embrapa Recursos Genticos e Biotecnologia
Previso do desenvolvimento
Watson, JD (1993). Gene 135: 309-315
Biologia Computacional MO640A
Felipe R. da Silva Unicamp, 1 Sem. 2009

1859: Charles Darwin 1831-1836: Viagem do Beagle


A Origem das Espcies

Biologia Computacional MO640A Biologia Computacional MO640A


Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

1838: l Ensaio sobre o princpio 1857: artigo de Alfred Russel Wallace?


da populao,
de Thomas Malthus (1798)

Biologia Computacional MO640A Biologia Computacional MO640A


Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

1
1866: Gregor Mendel
Experimentos em hibridao de plantas

Biologia Computacional MO640A Redescoberto em 1900 Biologia Computacional MO640A


Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

1869: Johann Friedrich Miescher


descoberta da nuclena

Biologia Computacional MO640A Biologia Computacional MO640A


Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

1909: Wilhelm Johannsen 1928: Frederick Griffith


criao dos termos
gene, fentipo e princpio transformante
gentipo
Griffith, F. (1928) Significance of pneumococcal
types. J. Hygiene 27:113-159. Lisa
(S)

Biologia Computacional MO640A Biologia Computacional MO640A


Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

2
Nucleotdeo
1944: Oswald T. Avery Unidade bsica formadora dos cidos nuclicos
DNA o princpio transformante
Acar (pentose)
Base Nitrogenada
Grupo Fosfato

Avery, O.T., MacLeod, C.M. & McCarty,


M. (1944). Studies on the chemical
nature of the substance inducing
transformation of Pneumococcal types.
J. Exp. Med. 79, 137-159 (1944)
Monmero
Biologia Computacional MO640A Biologia Computacional MO640A
Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

Os Acares Bases Nitrogenadas


Pentose Pirimidinas
Ribose e Desoxirribose

Biologia Computacional MO640A Biologia Computacional MO640A


Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

Bases Nitrogenadas Nucleosdeos


Purinas
Base Nitrogenada Base Nitrogenada + Acar = Nucleosdeo

Adenina

Biologia Computacional MO640A Biologia Computacional MO640A


Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

3
Nucleotdeos e
Nucleotdeos
Desoxirribonucleotdeos

Base Nitrogenada + Acar + Grupo Fosfato = Nucleotdeo Adenina + Acar + Grupo Fosfato = Nucleotdeo

Ribose Desoxirribose

Biologia Computacional MO640A Biologia Computacional MO640A


Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

Contedo de bases
1950: Erwin Chargaff em diferentes espcies
%A = %T e %G = %C

Origem do DNA Adenina Timina Guanina Citosina

Timo de bezerro 1,7 1,6 1,2 1,0


Figado de vaca 1,6 1,5 1,3 1,0
Levedura 1,8 1,9 1,0 1,0
Bacilo da tuberculose 1,1 1,0 2,6 2,4

Biologia Computacional MO640A Biologia Computacional MO640A


Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

1953 Rosalind Franklin e Maurice


Concluses de Chargaff
Wilkins (dama sombria)
A quantidade de nucleotdeos pirimidnicos
(T+C) sempre igual a quantidade total de Resultados com difrao de raio X
nucleotdeos purnicos (A+G) O DNA longo e fino
A Quantidade de T = A; C = G Tem partes semelhantes e paralelas,
correndo ao longo da molcula
A Quantidade de A+T diferente de G + C
helicoidal
A relao A + T / G + C espcie especfica
Raio de 10 ; Ciclo de 34 e 3,4 entre
degraus

Biologia Computacional MO640A Biologia Computacional MO640A


Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

4
Descobertas que ajudaram na A famosa imagem 51
elucidao da estrutura do DNA

1953 Rosalind
Franklin e Maurice
Hugh Frederick Wilkins

1920 - 1958
(dama sombria)
1916 - 2004
Biologia Computacional MO640A Biologia Computacional MO640A
Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

As bases e as medidas sugeridas por 1953: Watson, J.D. & Crick, F.H.C.
Rosalind

Biologia Computacional MO640A Biologia Computacional MO640A


Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

Sulco
Menor

Sulco
Maior

Biologia Computacional MO640A Biologia Computacional MO640A


Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

5
1957: Francis Crick
dogma central

DNA
protena
RNA
Biologia Computacional MO640A Biologia Computacional MO640A
Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

1958 - Meselson e Stahl


A natureza semiconservativa do Replicao DNA
DNA

animao
Biologia Computacional MO640A Biologia Computacional MO640A
Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

1960: Sydney Brenner, Francis Crick, Dogma central


Franois Jacob e Jacques Monod
descoberta do mRNA DNA

RNA

prote
protena
Biologia Computacional MO640A Biologia Computacional MO640A
Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

6
Dogma central 1961: Marshall Nirenberg
quebra o cdigo gentico
Nobel 1968
pela interpretao do
cdigo gentico e sua
funo na sntese protica

Nirenberg, M. W. and Matthaei, J. H. (1961)

The dependence of cell-free protein synthesis


in E. coli upon naturally occurring or
synthetic polyribonucleotides.

Proc. Natl. Acad. Sci. USA 47, 1588-1602


Biologia Computacional MO640A Biologia Computacional MO640A
Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

Cdigo Gentico 1970: Hamilton O. Smith


primeira enzima de restrio
Nobel 1978
pela descoberta das enzimas de
restrio e sua aplicao nos
pproblemas de gentica
g molecular
Hamilton O. Smith and K. W. Wilcox (1970).

A restriction enzyme from Haemophilus


influenzae. I. Purification and general
properties.

Journal of Molecular Biology 51, 379-391.

Biologia Computacional MO640A Biologia Computacional MO640A


Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

1977: Walter Gilbert


1972: Paul Berg e Frederick Sanger
primeira molcula de DNA recombinante seqenciamento de DNA
Nobel 1980
pelos estudos da bioqumica de
cidos nucleicos, especialmente de
DNA recombinante
bi t
Jackson, DA, Symons, RH and Berg, P (1972).

A Biochemical Method for Inserting New Genetic


Information into SV40 DNA: Circular SV40 DNA
Molecules Containing Lambda Phage Genes and
the Galactose Operon of E. coli.

Proc. Nat. Sci. USA 69: 2904-2909. Nobel 1980


pelas contribuies na determinao de seqncias
Felipe R. da Silva de cidos nucleicos
Biologia Computacional MO640A Biologia Computacional MO640A
Felipe R. da Silva Unicamp, 1 Sem. 2009 Unicamp, 1 Sem. 2009

7
1983: Kary B. Mullis 1991: J. Craig Venter
PCR ESTs na descoberta de genes
Nobel de Qumica 1993
pela inveno da PCR

M.D. Adams et al. (1991)

Complementary DNA sequencing: 'expressed


sequence tags' and the Human Genome
Mullis, K.B (1983). The unusual origin of the polymerase chain reaction. Sci Am, 4: 56-65. Project,"

Saiki R, K.; Scharf S; Faloona F; Mullis K. B; Horn G. T; Erlich H. A.; Arnheim N. (1985). Science, 252:1651-1656.
Enzymatic amplification of beta-globin genomic sequences and restriction site analysis
for diagnosis of sickle cell anemia. Science, 230(4732):1350-4.
Biologia Computacional MO640A Biologia Computacional MO640A
Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

Alguns conceitos Estrutura de um gene


tgaggaacggtgcctggaaaagggcaagaatatccggcatgggcatgagtagcttgaaactgctgaagtatgtcctgtgttt
cttcaacttgccttttggatctgtgtctgctgcattttgggctttgggatctacctgctgatccacaacacttcggagtgct
Fita Codificante cttccataacctcccctccctcacgctgggcaatgtgtttgtcatcggggctctattatcatggtagttgccttcctgggct
gcatgggctctagcaaggaaaacagtgtctgcttatgtcgttcttcatcctgctgctgattatcctccttgctgaggtgacc
tggccatcctgctctttgtatatgaacagaagctgaatgagtatgtggctaagggtctgacgacagcatccaccgttaccac
a que tem a mesma seqncia que o mRNA tcagacgttagcaccaaggcagcgtgggactccatccgtcatttctgcagtgttgtggtataaatggcacgagtgattggac
cagtggcccaccagatcttgcccctcagatcgaaaagtggagggttgctatgcgaaagcaagactgtggtttcttccaattt
cctgagtatcggaatcatcaccatctgtgtatgtgtgattgaggtgttgggatgtcctttgcactgaccctgaactgccaga
ttgacaaaaccagccagaccatagggcatgatctgcagtagttctgtggtgaagagacttgtttcatctccggaagtgcaaa
accattatagcatgaagccctacatgatcactgcaggatgatcctcctcccatcctttcccttttaggtccctgtcttatac
aaccagagaagtgggtgttggccaggcacatcccatctcagcagcaagacaatctttcactcactgacggcagcagccatgt
ctctcaaagtggtgaagtaatatctgagcatcttttagacaagagaggcaaagacaaactggatttaatggcccaaatcaaa
gggtgaacccaggatatgaatttttgcatcttcccattgtcgaattagtctccgcctctaaataatgcccagtcttctcccc
aaagtcaagcaagagactagttgaagggagtctggggccaggctcactggaccattgtcacaaccctctgtttctctttgac
taagtgcctggctacaggaattacacagttctctttctccaaagggcaagatctcatttcaatttcttattagagggcctta
ttgatgtgttctaagtctttccagaaaaaaactatccagtgattatatcctgatttcaaccagtcacttagctgataatcac
agtaagaagacttctggtatatctctctatcagataagattttgttaatgtactattttactcttcaataaataaaacattt
attatctcaaaatagccccggatatctgtgttaccagccttgtctcggccacctcaaggaaatcactaaatttagccgaaag
gactgaggaacggtgcctggaaaagggcaagaatatccggcatgggcatgagtagcttgaaactgctgaagtatgtcctgtt
tttcttcaacttgccttttggaaataaagctgctgcattttgggctttgggatctacct

Introns Exons

Biologia Computacional MO640A Biologia Computacional MO640A


Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

Splicing
Estrutura e Expresso Gnica
xons
Promotor
I II III DNA
5-UTR OH 3-UTR
O-Me O-Me
ntrons
Transcrio

RNA primrio I II III


(Temporrio)
Splicing
Protena
mRNA I II III
(Maduro) Modificao
Biologia Computacional MO640A
Exons Traduo Ps-Traducional
Biologia Computacional MO640A
Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

8
Alguns conceitos Estrutura de um promotor
Fita Codificante
a que tem a mesma seqncia que o mRNA

Intron x Exon
UTR
poliA

Biologia Computacional MO640A Biologia Computacional MO640A


Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009

Desnaturao e renaturao do DNA


Garfo de replicao
Falar dos formatos de DNA (circular,
linear etc): material gentico
Splice alternativo
Gentipo / Fentipo.

Desnaturao Renaturao

Biologia Computacional MO640A Biologia Computacional MO640A


Felipe R. da Silva Unicamp, 1 Sem. 2009 Felipe R. da Silva Unicamp, 1 Sem. 2009