Fish & Shellsh Immunology 28 (2010) 1829

Contents lists available at ScienceDirect

Fish & Shellsh Immunology

journal homepage: www.elsevier.com/locate/fsi

Molecular characterization and expression analysis of nuclear oligomerization

domain proteins NOD1 and NOD2 in grass carp Ctenopharyngodon idella
W.Q. Chen a, b, c, Q.Q. Xu b, c, d, M.X. Chang b, P. Nie b, c, *, K.M. Peng a, **
a
College of Animal Science and Veterinary Medicine, Huazhong Agricultural University, Wuhan, Hubei Province 430070, China
b
State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei Province 430072, PR China
c
Laboratory of Fish Diseases, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei Province 430072, PR China
d
School of Animal Science, Yangtze University, Jingzhou, Hubei Province 434025, PR China

a r t i c l e i n f o a b s t r a c t

Article history: Nuclear oligomerization domains (NODs) are cytosolic pattern recognition receptors (PRRs) to detect
Received 21 June 2009 bacterial component. In this study, the molecular cloning and genomic characterization of grass carp NOD1
Received in revised form (gcNOD1) and grass carp NOD2 (gcNOD2) were reported. The complete open reading frame of gcNOD1
12 September 2009
contains 2814 bp, encoding a 937-amino acid polypeptide. The gcNOD2 cDNA sequence encodes 982-amino
Accepted 13 September 2009
Available online 17 September 2009
acid polypeptide. Both gcNOD1 and gcNOD2 possess three conserved domains: carboxy terminal leucine
rich repeat (LRR) domains, a central NOD, NBS or NACHT domain, and an amino terminal CARD domain
(two in the case of NOD2). At the genomic level, gcNOD1 consists of 11 exons, with 10 intervening introns,
Keywords:
Grass carp spanning approximately 9 kb of genomic sequence. Whereas gcNOD2 has a length of approximately 5 kb
NOD1 with 9 intervening introns. Real time PCR analysis showed gcNOD1 and gcNOD2 were ubiquitously
NOD2 expressed in adult tissues. The highest transcript level of gcNOD1 was detected in brain, but in head kidney
Grass carp reovirus for gcNOD2. Grass carp reovirus signicantly induced the expression of gcNOD1 and gcNOD2 in spleen
(from days 1 to 6). However, expression proles differed in time course response. Induction experiments
with lipopolysaccharide (LPS), peptidoglycan (PGN) and polyI:C revealed the differential expression and
regulation of gcNOD1 and gcNOD2 in blood, head kidney, trunk kidney and spleen. All these data suggest
a potential role of NOD1 and NOD2 in sh innate immune protection to bacterial and virus infections.
2009 Elsevier Ltd. All rights reserved.

1. Introduction NLRs are a recently identied cytoplasmic PRR family [7,8],

Invading pathogens are recognized by pattern recognition
receptors (PRRs) distributed in extracellular, membrane, and cyto-
plasmic compartments. In mammals, three major classes of PRRs
have been identied: Toll-like receptors (TLRs), NOD-like receptors
(NLRs) and retinoid acidinducible gene1 (RIG-1)-like receptors
(RLRs). TLRs are the best-characterized membrane-associated PRRs.
It has been reported that TLRs recognize diverse PAMPs such as LPS,
agellin, and dsRNA from bacteria, viruses, fungi, and parasites [1].
NLRs and RLRs are two major classes of cytoplasmic PRRs. RLRs
mediate antiviral defence [25], whereas NLRs primarily mediate
antibacterial defence [6].
* Corresponding author. State Key Laboratory of Freshwater Ecology and
Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan,
Hubei Province 430072, PR China. Tel.: 86 27 68780736; fax: 86 27 68780123.
** Corresponding author. Tel.: 86 27 87286970; fax: 86 27 87286970.
E-mail addresses: pinnie@ihb.ac.cn (P. Nie), pengkm@mail.hzau.edu.cn (K.M. Peng).
which are composed of three major domains: C-terminal LRRs
recognizing ligands, a central NACHT domain mediating oligomer-
ization, and an N-terminal effector domain generating downstream
signals. The presence of different N-terminal effector domains,
PYD, CARD and BIR, divides NLRs into NALPs (NACHT-, LRR- and
PYD-containing proteins), NODs (NACHT-, LRR- and CARD-con-
taining proteins) and NAIPs (for neuronal apoptosis inhibitor
protein) subfamilies, respectively [8].
The NOD1 and NOD2 genes belong to the subfamily of NLRs
characterized with CARD-containing effector binding domains.
NOD1 possesses an N-terminal CARD domain [9], whereas NOD2
contains two adjacent N-terminal CARD domains [10]. The specic
ligands for NOD1 and NOD2 have been identied. NOD1 is activated
by peptides that contain diaminophilic acid (iE-DAP) derived from
peptidoglycan present in almost all Gram-negative bacteria [11]. By
contrast, NOD2 recognizes muramyl dipeptides, also derived from
peptidoglycan, but present both in the Gram-positive and -negative
bacteria [12]. Upon ligand recognition, both NOD1 and NOD2
recruit RIPK to the receptors via CARDCARD interactions, which
lead to the activation of NF-kB and MAPK pathways [12,13].

1050-4648/$ see front matter 2009 Elsevier Ltd. All rights reserved.
doi:10.1016/j.fsi.2009.09.012
 W.Q. Chen et al. / Fish & Shellsh Immunology 28 (2010) 1829
The activation of NF-kB and MAPK mediated by NOD1 and NOD2
could induce transcription and production of inammatory medi-
ators and antimicrobial peptides, and induce apoptosis [9,10].
NOD1 and NOD2 have been cloned from mammals including
human beings [14], mice [15] and porcine [16,17]. An examination
of the zebrash genome suggests that mammalian NOD1 and
NOD2 orthologs also existed in sh [18,19]. Recently, the complete
cDNA sequence of NOD1 and partial cDNA sequence of NOD2 were
identied in channel catsh, and the induced expression of NOD1
by bacterial pathogen was only observed in intestine [20]. In the
current study, the complete cDNA and genomic sequences of grass
carp NOD1 (gcNOD1) and NOD2 (gcNOD2) were reported, together
with expression analysis following reovirus infection or injection of
LPS, polyI:C and peptidoglycan (PGN).
2. Materials and methods
2.1. Cloning cDNA and genomic sequences of gcNOD1 and gcNOD2
The genomic DNA was puried from spleen of healthy grass
carp using Wizard Genomic DNA Purication Kit (Promega). The
cDNA from grass carp spleen was synthesized and amplied using
RevertAid rst strand cDNA synthesis kit (#K1622, Fermentas) by
following the manufacturers instruction. Degenerated primer pairs
D1F/D1R and D2F1/D2R1 (Table 1) were designed to obtain the
internal region of gcNOD1 and gcNOD2. The PCR cycling conditions
were one cycle of 94  C for 5 min, 35 cycles of 94  C for 30 s, 54  C
for 30 s, and 72  C for 90 s, followed by one cycle of 72  C for 7 min.
Specic primers D2F2 (based on the zebrash NOD2 sequence)
and D2R2 (based on the grass carp NOD2 internal region) were
designed to obtain the upstream internal region of gcNOD2. The
PCR cycling conditions were one cycle of 94  C for 5 min, 35 cycles
of 94  C for 30 s, 58  C for 30 s, and 72  C for 60 s, followed by one
cycle of 72  C for 7 min.
For 50 -RACE, the adaptor primers AAP and AUAP were used. The
RNA from grass carp spleen was reverse-transcribed at 42  C using
gene-specic primer D1GSP1a and D2GSP1a, respectively. After
the synthesis of rst strand cDNA, the puried cDNA was used in the
TdT-tailing reaction. Then, tailed cDNA was amplied by prime pairs
D1GSP2/AAP and D2GSP2/AAP, respectively. The annealing tempera-
ture of PCR was 55  C. A dilution of the original PCR (0.1%) was
re-amplied using the AUAP and a nested primer D1GSP3 and D2GSP3.
The annealing temperature of PCR was 62  C and 60  C, respectively.
For 30 -RACE, the adaptor primers used were UPM. For gcNOD1,
the PCR was initially performed with primers UPM/D1Fout followed
by a nested PCR with primers UPM/D1Fin. The annealing temper-
ature of the rst and nested PCR was 58  C and 62  C, respectively.
For gcNOD2, 30 -RACE was performed twice in order to obtain the
complete cDNA sequence. For the rst 30 -RACE, the PCR was initially
performed with primers UPM/D2Fout1 followed by a nested PCR
with primers UPM/D2Fin1. The annealing temperature of the rst
and nested PCR was 64  C and 61  C, respectively. For the second
30 -RACE, the PCR was performed with primers UPM/D2Fout2 fol-
lowed by a nested PCR with primers UPM/D2Fin2. The annealing
temperature of the rst and nested PCR was 58  C.
The sequences of gcNOD1 and gcNOD2 introns were amplied
using primer pairs and annealing temperature shown in Table 1. All
primer sequences mentioned above are shown in Table 1.
2.2. Sequence analysis
Protein prediction was performed using software at the ExPASy
Molecular Biology Server (http://expasy.pku.edu.cn). The putative
ORFs were analyzed for the presence of signal peptides using the
algorithms Signal P 3.0. The intron/exon structures of the identied
19
genomic sequences were determined by alignment of the full-
length cDNA to the genomic sequence using BLAST2. Multiple
alignments were generated by the CLUSTAL 1.8 program within
DNASTAR. Phylogenetic tree was constructed based on the deduced
amino acid sequences using the Neighbour-Joining (NJ) algorithm
within MEGA version 4. Data were analyzed using Poisson correc-
tion, and gaps were removed by pairwise deletion. Reliability of the
tree was assessed by 1000 bootstrap repetitions.
2.3. RNA extraction and cDNA synthesis for expression analysis
Grass carp, 200300 g in body weight, were obtained from
Guanqiao Experimental Base, Wuhan, Hubei Province, China. These
grass carp were maintained in aerated freshwater at 26  0.5  C.
After 10 day acclimatization in a quarantine tank, four groups
of three sh were injected with either 500 ml PBS, 500 ml 1 mg ml1
peptidoglucan from Micrococcus luteus (Sigma, Cat no. 53243),
500 ml 2 mg/ml Poly I: C (Sigma, P9582), or 500 ml 2 mg ml1 LPS
(Sigma, L2880). Twenty-four hours after injection, total RNA was
extracted using TRIzol reagent (Gibco) as described by the manu-
facturer from samples of interest, including blood, head kidney,
trunk kidney and spleen, from both injected and control groups.
2.4. Real time quantitative RT-PCR
The gcNOD1, gcNOD2 and b-actin cDNA fragments were
generated by RT-PCR, and conrmed by sequencing. Amplicons
were gel-puried, and serial tenfold dilution was used as a standard
curve in each PCR run. PCR reactions were performed using Chromo
4 Continuous Fluorescence Detector from MJ Research. Ampli-
cations were carried out at a nal volume of 20 mL, containing 2 mL
DNA sample, 10 mL 2  SYBR green Real time PCR Master Mix
(Toyobo, Japan), 0.1 mL of each primer and 7.8 mL H2O. PCR ampli-
cation was performed in triplicate wells, using the following
conditions: 3 min at 95  C, followed by 45 cycles of 15 s at 94  C,
25 s at 60  C and 25 s at 72  C. The reaction carried out without DNA
sample was used as negative control. Each sample was run in
triplicate, standard curves were run on the same plate. The relative
standard curve method was used for the calculation of relative gene
expression, by normalizing the expression of each target to actin.
2.5. Statistical analyses
Statistical analysis was performed using a one-way analysis of
variance (ANOVA). A probability level of p < 0.05 was considered
signicant. All statistical analyses were based on comparisons
between the control and injection groups.
3. Results
3.1. Sequence analysis
The gcNOD1 cDNA contains 3215-bp. The predicted open reading
frame (ORF) locates between nucleotides 350 and 3163 and encodes
a putative 937-aa protein. The nucleotide sequence of gcNOD1 has
been submitted to the GenBank nucleotide databases under acces-
sion no. FJ937972. The cloned gcNOD2 cDNA (GenBank accession no.
FJ937973) consists of 3130 bp with an 81 bp 50 -UTR, a 2949-bp open
reading frame encoding a 982-aa peptide and a 103 bp 30 -UTR.
gcNOD1 protein was predicted as a non-secretory protein without
a signal peptide, whereas the gcNOD2 protein surprisingly possesses
a putative signal sequence of 24 aa in length, that is predicted to be
cleaved between Ala24 and Glu25. This prediction is in contrast with
the fact that other NOD2 proteins including zebrash NOD2 do not
have a putative signal peptide. Analysis of the putative amino acids
20 W.Q. Chen et al. / Fish & Shellsh Immunology 28 (2010) 1829

Table 1
Primer sequences used in this study.

Application Primer name Sequences Annealing temperature

NOD1 internal region D1F ACCAGTG(GA)TTAACACAGACCC 54
D1R GACTCCCA(GA)(GA)TGCTTCCTAC
NOD2 internal region 1 D2F1 TTGGATGACAT(CT)TACACTGATGG 54
D2R1 ACAGG(CA)CC(AG)ATGTTACAGTAGGT
NOD2 internal region 2 D2F2 TCTGGCAGTTCTATGTGGTGGAGG 58
D2R2 GTCCATCGGTGTAAATATCATCCAAG
Adaptor primers of RACE long UPM CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT
short UPM CTAATACGACTCACTATAGGGC
NUP AAGCAGTGGTATCAACGCAGAGT
AAP GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG
AUAP GGCCACGCGTCGACTAGTAC
Reverse-transcribed primers D1GSP1a TGAAGGACGATTGATTT 42
D2GSP1a TCGGCAGAAAGGTG 42
5RACE, rst nested PCR D1GSP2 CTGCTGGTTGAAGACTCCCT 55
D2GSP2 CTCCGCCACTCGTATGTTTA 55
5RACE, 2nd nested PCR D1GSP3 TCCTCCAGCGGCGTCTCCTCACTTT 62
D2GSP3 CACATTCCAGAGGTTCGGCACT 60
3RACE, rst nested PCR D1Fout CATCTCGTTCCACCAGTATCATTG 58
3RACE, 2nd nested PCR D1Fin CGCAAGACGCTCAAGTCCTACC 62
3RACE, rst nested PCR D2Fout1 TTCGGTTGAGGAGGCGGAGTC 64
3RACE, 2nd nested PCR D2Fin1 TCCTCGTCCTGTAAAGGGTGAA 61
3RACE, rst nested PCR D2Fout2 ACCCAACACTTTGCTTGTCTGC 58
3RACE, 2nd nested PCR D2Fin2 AGCAGAACTTCCTGGCTTTGAG 58

Genomic sequence
NOD1 rst intron D1F1 GCACCACCAAAACTGACC 50
D1R1 CTCCTTTACTCTGAACCA
NOD1 second intron D1F2 GCGTTGAACTTTGTCCTCCAT 55
D1R2 TCCTCTGCCAGAACCTCAATAC
NOD1 third intron D1F3 CACAGACAGCAGTATTGAGGT 50
D1R3 CTTTGCTACTAGTTTGGCTCC
NOD1 fourth intron D1F4 AGCCAAACTAGTAGCAAAGATC 50
D1R4 CAAGGTATTTCCCACCCACA
NOD1 fth and sixth introns D1F5-6 TGTGGGTGGGAAATACCTTGCC 56
D1R5-6 GCTTCAGCGCTTTTGCCAGACT
NOD1 seventh intron D1F7 TGGCATTACTTCTCATGGTGG 55
D1R7 GAGTTGGACTTGAAGGCATCG
NOD1 eighth intron D1F8 CTTCAAGTCCAACTCTGCTCT 50
D1R8 GTTGTTTGTCAAGCCTTCAGA
NOD1 ninth intron D1F9 AGGCTTGACAAACAACACTAC 50
D1R9 TCACGTTTTACTTTTCCTTCT
The rst and second introns of NOD2 geD2F1 GGGAAAGGATGTGCTGTGG 55
geD2R1 TGCTAAGGAAGAGGGACTGG
The third to seventh introns of NOD2 geD2F2 TGGACAACAATTCAGTGGGAGA 53
geD2R2 CACTGCCAACACCATTATCCAC
The eighth to ninth introns of NOD2 geD2F3 TCTGGTGGATAATGGTGTTGGC 55
geD2R3 CTGGATTTGGAAGTTTGGTGGC
Real time PCR b-actin F CCTTCTTGGGTATGGAGTCTTG 60
b-actin R AGAGTATTTACGCTCAGGTGGG
QTNOD1F ATGGTGGAAGAAGTCTGGCA 60
QTNOD1R CTCGTTTTGTATTAGCATCAG
QTNOD2F CAGCAGGGACGGAGTTGAGTGT 60
QTNOD2R CTGGATTTGGAAGTTTGGTGGC

sequence by TMPRED program suggests that both gcNOD1 and
gcNOD2 contain alpha helical regions, three in gcNOD1 which are
between amino acids 374392, 404424 and 563586 and ve in
gcNOD2 which are located between amino acids 213229, 292309,
447470, 577595 and 898918. Search for conserved domains
with Pfam (http://www.sanger.ac.uk/Software/Pfam) revealed that
gcNODs had very similar domains and architectures as the zebrash
and mammalian counterparts. For gcNOD1, 2 C-terminal LRR
domains (residues 769791 and 825851), a central NACHT domain
(residues 186359) and an N-terminal effector domain that contains
one CARD domain (residues 1173) were identied (Fig. 1A). For
gcNOD2, 2 N-terminal CARD domains (residues 2781 and 111200),
a central NACHT domain (residues 271441), and 7 tandem
C-terminal LRR domains were identied (Fig. 1B).
The alignment of gcNODs with zebrash, human, pig and mouse
NODs showed that NACHT domain is most conserved among three
domains of vertebrate NODs (Fig. 1 and Table 2), with the highest
identity varying from among 58.092.5% for NOD1 and 56.790.1%
for NOD2 (Table 2). The identities of full-length, CARDs, NACHT and
LRRs between gcNOD1 and NOD1 from other species were higher
than that of gcNOD2 and NOD2 from other species.
3.2. Gene structure
The gcNOD1 gene (GenBank accession no. GQ141737) consists of
11 exons, with 10 intervening introns, spaced over approximately
9 kb of genomic sequence. The rst exon is 524 bp in length and
contains 50 UTR and 58 aa of ORF. Exon 2 is 175 bp encoding 58 aa of
ORF. Exon 1 and 2 encode N-terminal CARD domain. Exon 3 is
1804 bp encoding the conserved NACHT domain. Exons 411 is 84,
84, 84, 84, 84, 84, 84 and 124 bp, respectively. The intervening ten
introns are 974, 96, 81, 715, 2324, 131, 99, 96, 471 and 895 bp,
 W.Q. Chen et al. / Fish & Shellsh Immunology 28 (2010) 1829 21

Fig. 1. Multiple alignments of NOD1 and NOD2 protein sequences from human, pig, mouse, zebrash and grass carp. Identical amino acids are indicated with asterisks, and
conservative substitutions are indicated with . or :. CARD domains and NACHT domains are underlined. LRR domains are boxed. (A) gcNOD1 and (B) gcNOD2. (1) denotes the
original start in the canonical exon 1 of human NOD2, (2) denotes the alternative start in exon 2 used by the two novel transcript isoforms of human NOD2.
22 W.Q. Chen et al. / Fish & Shellsh Immunology 28 (2010) 1829

Fig. 1. (continued).
 W.Q. Chen et al. / Fish & Shellsh Immunology 28 (2010) 1829 23

Fig. 1. (continued).
24 W.Q. Chen et al. / Fish & Shellsh Immunology 28 (2010) 1829

Fig. 1. (continued).
 W.Q. Chen et al. / Fish & Shellsh Immunology 28 (2010) 1829 25

Fig. 1. (continued).

respectively (Fig. 2A), with the phases 0, 1, 2, 2, 2, 2, 2, 2, 2 and 2
(Table 3). All exonintron junctions follow the consensus rule of the
splice acceptor-AG/GT-splice donor for splicing.
The gcNOD2 gene has a length of approximately 5 kb (Gen-
Bank accession no. GQ141736), and is composed of ten exons and
nine introns (Fig. 2B). The rst exon is 561 bp in length and
contains the short 50 UTR and 160 aa of ORF, which includes the
signal peptide. Exon 2 is 127 bp encoding 42 aa of ORF. Exon 1
and 2 encode two N-terminal caspase recruitment domains.
Exon 3, the longest exon, encodes the conserved NACHT domain.
Exon 4 to 10 encode 7 tandem leucine rich repeat in the
C-terminal, with a length of 84, 84, 84, 84, 84, 84 and 173 bp,
respectively. The intervening nine introns are 319, 266, 147, 108,
87, 89, 190, 90 and 511 bp, respectively, with the phases 0, 1, 2, 2,
2, 2, 2, 2 and 2 (Table 3). Similar to the phases of NOD1 introns,
the phases of NOD2 introns were also rather conserved among
grass carp, zebrash and human NOD2 (Table 3). All exonintron
junctions follow the consensus rule of the splice acceptor-AG/
GT-splice donor for splicing.
Table 2
Amino acid identity/similarity (%) between gcNODs and NODs from zebrash,
human, pig and mouse.
The genomic organization of gcNOD1 coding region is very
similar to that of NOD1 genes from human and zebrash
(Fig. 2A), since it is distributed in a similar manner across 11
exons. Whereas the genomic organization of sh NOD2 coding
regions is different from that of human NOD2 gene (Fig. 2B). The
report from Rosenstiel et al. [21] showed that two novel 50
untranslated exons of human NOD2 exhibit a distinct splicing
pattern under pro-inammatory conditions with two alternative
transcript isoforms. BLAST analysis of the gcNOD2 sequences
gave top hits to known NOD2 molecules in the database, sug-
gesting gcNOD2 are likely the orthologs of the mammalian
NOD2. The alignment of NOD2 from mammalian and teleost sh
showed that the identied sh NOD2 may represent the short
isoform of NOD2.
3.3. Phylogenetic analysis
In a phylogenetic tree based on amino acid sequences from
mammalian, avian and teleost sh NODs, the grass carp NOD1 and
NOD2 were clustered with zebrash NOD1 and NOD2, respectively,
with 100% bootstrap value (Fig. 3).

Full-length CARDs NACHT LRRs 3.4. Expression of gcNOD1 and gcNOD2 in different tissues
Zebrash NOD1 81.3/86.7 73.1/75.6 92.5/95.4 88.2/94.9
Human NOD1 50.2/70.9 38.4/54.7 58.0/73.0 57.9/78.5 In healthy grass carp, the expressions of gcNOD1 and gcNOD2
Pig NOD1 51.1/71.5 34.9/52.3 58.6/74.7 57.9/76.9 were observed in all the tissues examined. The expression of
Mouse NOD1 50.4/70.9 39.5/52.3 58.0/76.4 54.9/74.4 gcNOD1 was highest in brain, then in liver, head kidney and
Zebrash NOD2 83.8/92.0 68.5/77.6 90.1/95.9 82.8/91.8 intestine. Whereas the highest expression of gcNOD2 was
Human NOD2 45.6/62.6 29.6/46.5 57.3/73.1 54.1/67.8 observed in head kidney, then in gill and blood. The lowest
Pig NOD2 46.8/65.2 27.6/47.4 56.7/73.7 52.6/69.3 expressions of gcNOD1 and gcNOD2 were detected in trunk
Mouse NOD2 47.0/64.7 28.5/48.4 59.6/74.3 53.0/67.0
kidney (Fig. 4).
26 W.Q. Chen et al. / Fish & Shellsh Immunology 28 (2010) 1829

A
524 175 1804 84 84 84 8484 84 84 124
grass carp NOD1
974 96 81 715 2324 131 99 96 471 895

510 175 1801 84 84 84 84 84 84 84 456

zebrafish NOD1
1046 2077 2174 77 270 1057 3804 81 719 10896

172 141 89 322 175 1825 84 84 84 84 84 84 84 116

human NOD1
18564 660 2109 1409 2096 2834 1247 742 8484 1491 2818 3638 3663

B 561 127 1765 8484 84 84 84 84 173

grass carp NOD2
319 266 147 108 87 89 190 90 511

240 525 127 1759 84 8484 8484 84 628

zebrafish NOD2
326 1485 100 1283 106 140 83 189 77 282

178 467 106 1816 84 84 84 84 84 84 84 1330

human NOD2
2171 7900 2597 4213 220 2950 2613 595 2104 4245 1845

Fig. 2. Diagrammatic comparison of NOD1 and NOD2 gene from grass carp, zebrash, and human. Exons are represented by boxes; black areas represent the coding region of the
gene. Intron lengths in base pairs are shown on the bottom of each gure and exon lengths are on the top.

3.5. Modulation of gcNOD1 and gcNOD2 in tissues then gradual decreased. The highest induced fold changes of
gcNOD2 in spleen were observed on day 2 (36-fold).
Expressions of gcNOD1 and gcNOD2 gene were examined by
real time PCR in grass carp after i.p. injection with PBS, LPS, PGN or 4. Discussion
polyI:C. As shown in Fig. 5, PGN signicantly induced gcNOD2
expression in all tissues assayed (p < 0.05), with the highest In mammals, NOD1 and NOD2 are important intracellular
fold changes in spleen (17.3-fold), then in blood (7.3-fold) and head pattern recognition receptors in bacterial recognition and innate
kidney (3.8-fold). In contrast, the expression of gcNOD1 was immunity [6,20]. In sh, NOD1 and NOD2 have been described
signicantly increased by PGN only in spleen (p < 0.05). The in zebrash and channel catsh, but their expression in response to
expression patterns of gcNOD1 and gcNOD2 induced by LPS were viral challenge and immunostimulants have not been demon-
similar with the highest fold changes in trunk kidney, then in strated in teleost sh. In this study, we identied grass carp NOD1
spleen and blood. No signicant changes were observed in head and NOD2, and characterized the gene structure, tissue expression
kidney (p > 0.05). The induced expressions of gcNOD1 and gcNOD2 distribution, and induced expression upon viral and immunosti-
by polyI:C were signicant in head kidney, trunk kidney and spleen mulants such as PGN, LPS and polyI:C.
(p < 0.05). PolyI:C resulted in 13.4-fold increase of gcNOD1 in head Expressions of NOD1 and NOD2 genes have been studied in
kidney, the highest fold changes among the four tissues. However, zebrash and channel catsh [19,20]. Surveying the selected tissues
the highest fold changes of gcNOD2 induced by polyI:C was from nave zebrash, Laing et al. [19] detected constitutive expres-
observed in spleen (10.7-fold). sion of NOD1 and NOD2 in zebrash intestine, liver, spleen. NOD1
and NOD2 genes are also widely expressed in tissues of channel
3.6. Kinetics of gcNOD1 and gcNOD2 gene expression catsh and leukocyte cell lines including cytotoxic T-cell lines,
in spleen following reovirus infection macrophage cell line, and B-cell lines [20]. In the present study,
gcNOD1 and gcNOD2 transcripts were detected in all tested tissues,
As shown in Fig. 6, gcNOD1 and gcNOD2 expressions were reecting the wide-spread distribution as observed in channel
induced in the spleen over the 6 days period. The induced fold catsh [20] and murine NODs [9,15].
changes of gcNOD1 by reovirus was highest on day 1 (16.3-fold), Mammalian NOD1 and NOD2 are known to be pattern recognition
receptors in recognizing pathogens [22]. Although work in channel
catsh has shown that bacterial pathogen Edwardsiella ictaluri,
Table 3 a causative agent of enteric septicemia of catsh (ESC), was able to
The phases of NOD1 and NOD2 introns from grass carp, zebrash and human. induce NOD1 gene expression, it had no effect on channel catsh
1 2 3 4 5 6 7 8 9 10
NOD2 transcript level. PGN, present in Gram-positive and Gram-
negative bacterial cell walls, has been shown to contain the ligands of
gcNOD1 0 1 2 2 2 2 2 2 2 2
zfNOD1 0 1 2 2 2 2 2 2 2 2 NOD1 and NOD2. In the present study, the effects of PGN on gcNOD1
hNOD1 0 1 2 2 2 2 2 2 2 2 and gcNOD2 gene expression were examined in vivo 24 h after
gcNOD2 0 1 2 2 2 2 2 2 2 injection. The differential regulation of gcNOD1 and gcNOD2 by
zfNOD2 0 1 2 2 2 2 2 2 2 PGN demonstrated that NOD1 has a more restricted specicity than
hNOD2 0 1 2 2 2 2 2 2 2
NOD2, which was supported by the fact that NOD1 detects only
 W.Q. Chen et al. / Fish & Shellsh Immunology 28 (2010) 1829 27

61 human NOD1
100 pig NOD1
89 mouse NOD1

99
chicken NOD1
100 zebra finch NOD1

100
frog NOD1
100 grass carp NOD1
zebrafish NOD1
100 fugu NOD1
100 stickleback NOD1
77 medaka NOD1
79 fugu NOD2
100 stickleback NOD2
100 medaka NOD2
grass crap NOD2
100 zebrafish NOD2
100
mouse NOD2
100 human NOD2
100
chimpanzee NOD2
96 pig NOD2
100 cattle NOD2
mouse CARD12
100 monkey CARD12
100 human CARD12
100 chimpanzee CARD12

0.2

Fig. 3. Phylogenetic relationship of vertebrate NOD1 and NOD2 genes. CARD12 genes are used as out-group. Full-length amino acid sequences were aligned using the CLUSTAL
program within DNASTAR and the phylogenetic tree was constructed using the Neighbour-Joining algorithm within MEGA version 4. The tree was boosted for 1000 times and
percentage of the bootstrap value is shown. The sequences used for tree construction are as follows: human NOD1, NP_006083; pig NOD1, NP_001107749; mouse NOD1, NP_766317;
chicken NOD1, XP_418777; zebra nch NOD1, ENSTGUG00000003926; zebrash NOD1, ENSDARG00000036308; fugu NOD1, ENSTRUG00000014043; stickleback NOD1, ENS-
GACG00000004511; medaka NOD1, ENSORLG00000003812; human NOD2, NP_071445; mouse NOD2, NP_665856; pig NOD2, NP_001098765; cattle NOD2, NP_001002889;
chimpanzee NOD2, NP_001098710; zebrash NOD2, ENSDARG00000010756; fugu NOD2,ENSTRUG00000008459; stickleback NOD2, ENSGACG00000016710, medaka NOD2,
ENSORLG00000013891; human CARD12, AAQ88519; mouse CARD12,EDL38434; monkey CARD12, XP_001105888; chimpanzee CARD12, XP_001164479.

12 mesodiaminopimelic-acid-containing peptidoglycan, which is found

in most Gram-negative, but not Gram-positive bacteria [11].
Fo ld ch an g es relat iv e t o t ru n k k i dn ey

10 In mammals, the bacterial component, LPS, has been shown to

NOD1 inuence NOD1 and NOD2 mRNA expression in immune, epithelial
8 NOD2 and endothelial cells [2325]. We further assessed the inuence of
LPS on the expression of gcNOD1 and gcNOD2 and found that the
6 induced expression patterns of gcNOD1 were similar with that of
gcNOD2 in all four tissues analyzed. In consistent with some of in
4 vitro studies [15,26], the expressions of gcNOD1 and gcNOD2 were
signicantly induced by LPS. It is known that Toll-like receptor
2 (TLR) 4 is the pattern recognition receptor for recognizing LPS in
mammals [27]. It is likely that NOD1 and NOD2 expression was
0 upregulated by bacterial LPS through TLR4, which was suggested by
TK L BL HK Br G SP I
tissues the results from Takahashi et al. [24] and Mulla et al. [26].
It has been reported that IFN-g is produced during infection and
Fig. 4. gcNOD1 and gcNOD2 tissue expression distribution in adult grass carp trunk can enhance the responses induced by many different PRRs, thus
kidney (TK), liver (L), blood (BL), head kidney (HK), brain (Br), gill (G), spleen (SP) and
intestin (I). Gene expressions of gcNOD1 and gcNOD2 were normalized to actin and fold
profoundly inuencing the course and clinical outcome of infectious
change obtained by comparison of normalized expression between tested tissue and disease [28,29]. The results from Hisamatsu et al. [30] and Iwanaga
trunk kidney. et al. [15] also showed that IFN-g upregulated NOD1 protein and
28 W.Q. Chen et al. / Fish & Shellsh Immunology 28 (2010) 1829

PGN 45
40 *
25
35
20 *
30 NOD1
Fold changes

Fold changes
15 * 25
* NOD2
NOD1
20 *
10 NOD2 * *
* 15 * *
5 * *
* 10
0 5 * * *
BL HK TK SP *
0
tissues 1d 2d 3d 4d 5d 6d
Days

LPS Fig. 6. Kinetics of gcNOD1 and gcNOD2 expression in spleen during infection of grass
carp reovirus (GCRV). Fish were i.p. injected with GCRV and spleen was collected every
1000 day for one week. Total RNA was extracted and used for real time PCR analysis. Gene
* expressions of gcNOD1 and gcNOD2 were normalized to actin and fold change obtained
by comparison of normalized expression between different sample sets. The mean of
Fold changes

100 three independent experiments is shown and the SEMs are indicated. Asterisks indicate
* NOD1 signicant difference between healthy and infected sh (*P < 0.05).
* * NOD2
10 * *
In summary, we rst demonstrate the expression and regulation
of gcNOD1 and gcNOD2 by different immunostimulants, suggesting
1
BL HK TK SP a potential role of NOD1 and NOD2 in sh innate immunity against
tissues bacterial and virus infections.

Acknowledgement
poly I:C
20 The present study was nancially supported by a grant (no.
30830083) from the National Natural Science Foundation of China.
15 We thank Dr Jun Zou, University of Aberdeen, for his constructive
Fold changes

* * comments on the manuscript.

* NOD1
10
* NOD2
5 *
* [1] Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity.
0 [2] Andrejeva J, Childs KS, Young DF, Carlos TS, Stock N, Goodbourn S, et al. The V
BL HK TK SP
tissues
Fig. 5. In vivo expression of grass carp NOD1 and NOD2 genes after injection of LPS PGN
and polyI:C. Fish were intraperitoneally injected with 500 ml PBS, 500 ml polyI:C
(2 mg ml1), 500 ml peptidoglucan (PGN, 1 mg ml1) or 500 ml LPS (2 mg ml1). Total RNA
was extracted from grass carp blood (BL), head kidney (HK), trunk kidney (TK) and spleen
(SP) and used for real time PCR analysis. Gene expressions of gcNOD1 and gcNOD2 were
normalized to actin and fold change obtained by comparison of normalized expression
between different sample sets. The mean of three independent experiments is shown and
the SEMs are indicated. Asterisks indicate signicant difference between experimental
group and control group (*P < 0.05).
NOD2 mRNA expression, respectively. Since it has well been estab-
lished that viral infection lead to dramatic increase of IFN-g tran-
scripts in sh regardless of viral types, it is possible that viral infection
also will lead to induced expression of NOD1 and NOD2. In the
present study, we have shown for the rst time that the gcNOD1 and
gcNOD2 were also signicantly upregulated after in vivo infection
with grass carp reovirus, even after polyI:C stimulation. Rosenzweig
et al. [31] recently demonstrated that activation of NOD2 resulted in
increased production of IFN-g. Our unreported results also showed
that NOD2 expression was correlated with that of gcIFN-grel in
examined tissues of sh when stimulated with PGN and in spleen of
sh infected with grass carp reovirus. Taking together, this may
suggest that NOD1 and NOD2 are involved in immune response to
viral infection through the cross talk with IFN-g gene.
References
Cell 2006;124:783801.
proteins of paramyxoviruses bind the IFN-inducible RNA helicase, mda-5, and
inhibit its activation of the IFN-beta promoter. Proc Natl Acad Sci USA
2004;101:172649.
[3] Yoneyama M, Kikuchi M, Natsukawa T, Shinobu N, Imaizumi T, Miyagishi M,
et al. The RNA helicase RIG-I has an essential function in double-stranded
RNA-induced innate antiviral responses. Nat Immunol 2004;5:7307.
[4] Kato H, Sato S, Yoneyama M, Yamamoto M, Uematsu S, Matsui K, et al. Cell
type-specic involvement of RIG-I in antiviral response. Immunity 2005;
23:1928.
[5] Kato H, Takeuchi O, Sato S, Yoneyama M, Yamamoto M, Matsui K, et al.
Differential roles of MDA5 and RIG-I helicases in the recognition of RNA
viruses. Nature 2006;441:1015.
[6] Rietdijk ST, Burwell T, Bertin J, Coyle AJ. Sensing intracellular pathogens-NOD-
like receptors. Curr Opin Pharmacol 2008;8:2616.
[7] Inohara N, Chamaillard M, McDonald C, Nunez G. NOD-LRR proteins: role in
host-microbial interactions and inammatory disease. Annu Rev Biochem
2005;74:35583.
[8] Martinon F, Tschopp J. NLRs join TLRs as innate sensors of pathogens. Trends
Immunol 2005;26:44754.
[9] Inohara N, Koseki T, del Peso L, Hu Y, Yee C, Chen S, et al. Nod1, an Apaf-1-like
activator of caspase-9 and nuclear factor-kappa B. J Biol Chem 1999;274:145607.
[10] Ogura Y, Inohara N, Benito A, Chen FF, Yamaoka S, Nunez G. Nod2, a Nod1/
Apaf-1 family member that is restricted to monocytes and activates NF-
kappaB. J Biol Chem 2001;276:48128.
[11] Chamaillard M, Hashimoto M, Horie Y, Masumoto J, Qiu S, Saab L, et al. An
essential role for NOD1 in host recognition of bacterial peptidoglycan
containing diaminopimelic acid. Nat Immunol 2003;4:7027.
[12] Strober W, Murray PJ, Kitani A, Watanabe T. Signalling pathways and molec-
ular interactions of NOD1 and NOD2. Nat Rev Immunol 2006;6:920.
[13] Park JH, Kim YG, McDonald C, Kanneganti TD, Hasegawa M, Body-Malapel M,
et al. RICK/RIP2 mediates innate immune responses induced through Nod1
and Nod2 but not TLRs. J Immunol 2007;178:23806.
[14] Bertin J, Nir WJ, Fischer CM, Tayber OV, Errada PR, Grant JR, et al. Human
CARD4 protein is a novel CED-4/Apaf-1 cell death family member that acti-
vates NF-kappaB. J Biol Chem 1999;274:129558.
 W.Q. Chen et al. / Fish & Shellsh Immunology 28 (2010) 1829
[15] Iwanaga Y, Davey MP, Martin TM, Planck SR, DePriest ML, Baugh MM, et al.
Cloning, sequencing and expression analysis of the mouse NOD2/CARD15
gene. Inamm Res 2003;52:2726.
[16] Tohno M, Shimazu T, Aso H, Uehara A, Takada H, Kawasaki A, et al.
Molecular cloning and functional characterization of porcine nucleotide-
binding oligomerization domain-1 (NOD1) recognizing minimum agonists,
meso-diaminopimelic acid and meso-lanthionine. Mol Immunol 2008;45:
180717.
[17] Tohno M, Ueda W, Azuma Y, Shimazu T, Katoh S, Wang JM, et al. Molecular
cloning and functional characterization of porcine nucleotide-binding oligo-
merization domain-2 (NOD2). Mol Immunol 2008;45:194203.
[18] Stein C, Caccamo M, Laird G, Leptin M. Conservation and divergence of gene
families encoding components of innate immune response systems in
zebrash. Genome Biol 2007;8:R251.
[19] Laing KJ, Purcell MK, Winton JR, Hansen JD. A genomic view of the NOD-like
receptor family in teleost sh: identication of a novel NLR subfamily in
zebrash. BMC Evol Biol 2008;8:42.
[20] Sha Z, Abernathy JW, Wang S, Li P, Kucuktas H, Liu H, et al. NOD-like subfamily
of the nucleotide-binding domain and leucine rich repeat containing family
receptors and their expression in channel catsh. Dev Comp Immunol 2009.
doi:10.1016/j.dci.2009.04.004.
[21] Rosenstiel P, Huse K, Franke A, Hampe J, Reichwald K, Platzer C, et al. Func-
tional characterization of two novel 50 untranslated exons reveals a complex
regulation of NOD2 protein expression. BMC Genomics 2007;8:472.
[22] Bourhis LL, Werts C. Role of Nods in bacterial infection. Microbes Infect
2007;9:62936.
29
[23] Oh HM, Lee HJ, Seo GS, Choi EY, Kweon SH, Chun CH, et al. Induction and locali-
zation of NOD2 protein in human endothelial cells. Cell Immunol 2005;237:3744.
[24] Takahashi Y, Isuzugawa K, Murase Y, Imai M, Yamamoto S, Iizuka M, et al.
Up-regulation of NOD1 and NOD2 through TLR4 and TNF-alpha in LPS-treated
murine macrophages. J Vet Med Sci 2006;68:4718.
[25] Muhlbauer M, Cheely AW, Yenugu S, Jobin C. Regulation and functional impact
of lipopolysaccharide induced Nod2 gene expression in the murine epidid-
ymal epithelial cell line PC1. Immunology 2008;124:25664.
[26] Mulla MJ, Yu AG, Cardenas I, Guller S, Panda B, Abrahams VM. Regulation of
Nod1 and Nod2 in rst trimester trophoblast cells. Am J Reprod Immunol
2009;61:294302.
[27] Hoshino K, Takeuchi O, Kawai T, Sanjo H, Ogawa T, Takeda Y, et al. Cutting edge:
toll-like receptor 4 (TLR4)-decient mice are hyporesponsive to lipopolysaccha-
ride: evidence for TLR4 as the Lps gene product. J Immunol 1999;162:374952.
[28] Jones BD. Host responses to pathogenic Salmonella infection. Genes Dev
1997;11:67987.
[29] Bosisio D, Polentarutti N, Sironi M, Bernasconi S, Miyake K, Webb GR, et al.
Stimulation of toll-like receptor 4 expression in human mononuclear phago-
cytes by interferon-g: a molecular basis for priming and synergism with
bacterial lipopolysaccharide. Blood 2002;99:342731.
[30] Hisamatsu T, Suzuki M, Podolsky DK. Interferon-gamma augments CARD4/
NOD1 gene and protein expression through interferon regulatory factor-1 in
intestinal epithelial cells. J Biol Chem 2003;278:329628.
[31] Rosenzweig HL, Kawaguchi T, Martin TM, Planck SR, Davey MP, Rosenbaum JT.
Nucleotide oligomerization domain-2 (NOD2)-induced uveitis: dependence
on IFN-gamma. Invest Ophthalmol Vis Sci 2009;50:173945.