Você está na página 1de 1174

16 a 18 de outubro

CADERNO DE RESUMOS
www.congresso2017.ufba.br
CONGRESSO DA UFBA
PESQUISA, ENSINO E EXTENSO
UNIVERSIDADE FEDERAL Procuradoria Federal Junto UFBA Faculdade de Direito
Roberto de Moraes Cordeiro Celso Luiz Braga de Castro
DA BAHIA
Ouvidoria da UFBA Faculdade de Economia
Reitor Denise Vieira da Silva Henrique Tom da Costa Mata
Joo Carlos Salles Pires da Silva
Sistema Universitrio de Bibliotecas Faculdade de Educao
Vice-Reitor SIBI Cleverson Suzart Silva
Paulo Csar Miguez de Oliveira Ldia Maria Batista Toutain Brando
Escola de Enfermagem
Pr-Reitoria de Aes Afirmativas Editora Universitria EDUFBA Carolina de Souza Machado
e Assistncia Estudantil PROAE Flvia Goulart Mota Garcia Rosa
Cssia Virgnia Bastos Maciel Faculdade de Farmcia
Assessor do Gabinete Tnia Fraga Barros
Pr-Reitoria de Administrao PROAD Joseny Marques Freire
Dulce Guedes Faculdade de Filosofia e Cincias
Assessor Especial Humanas
Pr-Reitoria de Desenvolvimento de Paulo Costa Lima Maria Hilda Baqueiro Paraso
Pessoas PRODEP
Lorene Louise Silva Pinto Assessora de Tecnologia da Informao Instituto de Fsica
Fabola Gonalves Pereira Greve Ricardo Carneiro de Miranda Filho
Pr-Reitoria de Ensino de Graduao
PROGRAD Assessoria de Comunicao Instituto de Geocincias
Penildon Silva Filho Marco Antonio Oliveira de Queiroz Olvia Maria Cordeiro de Oliveira

Pr-Reitoria de Ensino de Assessor para Comunicao Social Instituto de Humanidades, Artes e


Ps-Graduao PROPG e Divulgao Cientfica Cincias Prof. Milton Santos
Olival Freire Junior Mariluce de Souza Moura Messias Guimares Bandeira

Pr-Reitoria de Extenso Universitria Assessoria Jurdica da Reitoria Instituto de Letras


PROEXT Frederico Cezrio Castro de Souza Risonete Batista de Souza
Fabiana Dultra Britto
Assessoria para Assuntos Internacionais Instituto de Matemtica
Pr-Reitoria de Pesquisa, Criao e Mirella Mrcia Longo Vieira Lima Evandro Carlos Ferreira dos Santos
Inovao PROPCI
Olival Freire Jnior Faculdade de Medicina da Bahia
Luis Fernando Fernandes Adan
Pr-Reitoria de Planejamento e
Oramento PROPLAN UNIDADES Escola de Medicina Veterinria e
Eduardo Luiz Andrade Mota UNIVERSITRIAS Zootecnia
Antonio de Lisboa Ribeiro Filho
Chefia do Gabienete Escola de Administrao
Suani Tavares Rubim de Pinho Horcio Nelson Hastenreiter Filho Instituto Multidisciplinar em Sade
Orlando Slvio Caires Neves
Superintendncia de Administrao Faculdade de Arquitetura
Acadmica SUPAC Naia Alban Suarez Escola de Msica
Nancy Rita Ferreira Vieira Jos Maurcio Valle Brando
Escola de Belas Artes
Superintendncia de Avaliao e Nanci Santos Novais Escola de Nutrio
Desenvolvimento Institucional SUPAD Maria da Purificao Nazar Arajo
Antnio Virglio Bittencourt Bastos Instituto de Biologia
Francisco Kelmo Oliveira dos Santos Faculdade de Odontologia
Superintendncia de Educao a Marcel Lautenschlager Arriaga
Distncia SEAD Instituto de Cincia da Informao
Mrcia Tereza Rangel Oliveira Hildenise Ferreira Novo Escola Politcnica
Tatiana Bittencourt Dumt
Superintendncia de Meio Ambiente e Faculdade de Cincias Contbeis
Infraestrutura SUMAI Joseilton Silveira da Rocha Instituto de Psicologia
Fbio Macedo Velame Ilka Dias Bichara
Instituto de Cincias da Sade
Superintendncia de Tecnologia da Roberto Paulo Correia de Arajo Instituto de Qumica
Informao STI Dirceu Martins
Luiz Cludio de Arajo Mendona Faculdade de Comunicao
Suzana Oliveira Barbosa Instituto de Sade Coletiva
Superintendncia de Sade Isabela Cardoso de Matos Pinto
Roberto Jos Meyer Nascimento Escola de Dana
Dulce Tamara da Rocha Lamego da Silva Escola de Teatro
Luiz Cludio Cajaba Soares
CADERNO DE RESUMOS

CONGRESSO DA UFBA
PESQUISA, ENSINO E EXTENSO

16 a 18 de Outubro de 2017
Salvador Bahia
CONGRESSO DA UFBA 2017
Coordenao Geral
Joo Carlos Salles Pires da Silva

Coordenao Executiva
Paulo Costa Lima

Conselho Consultivo e de Gesto


Paulo Miguez, Cssia Virgnia Bastos Maciel, Dulce Guedes,
Eduardo Luiz Andrade Mota, Fabiana Dultra Britto, Lorene
Louise Silva Pinto, Penildon Silva Filho, Olival Freire Jnior,
Suani Rubim de Pinho.

Comisso Executiva
Guilherme Bertissolo, Jos Murilo Philigret de Oliveira Baptista,
Thiago Andrade Ferreira Dria, Ednei de Santana Pereira.

Comisso de Organizao e Seleo de Trabalhos -


Seminrio de Pesquisa, Ensino e Extenso
Guilherme Bertissolo, Joice Neves Reis Pedreira, Iole Macedo
Vanin, Alessandra Santos de Assis, Augusto Cesar Pinto Loureiro
da Costa, Fernanda Mota, Carla Dameane Pereira de Souza,
Ana Maria Bicalho, Cristiana Mercuri, Cludio Romo.

Comisso de Organizao das Mesas


Ednei de Santana Pereira, Thiago Andrade Ferreira Dria.

Comisso Artstica
Fabiana Dultra Britto, Guilherme Bertissolo, Paulo Costa Lima.

Comisso de Comunicao e Tecnologia


Mariluce Moura e Fabola Greve (Coordenadoras),
Luiz Cludio Mendona, Marco Antonio Queiroz, Antonio
Moreno, Fernanda Caldas, Josemara Veloso, Murilo Guerra,
Gisele Santana.

Comisso de Infraestrutura
Dulce Guedes, Eduardo Mota, Fbio Velame.

Secretaria Executiva
Ana Maria Brito, Cludia Lopes, Maria Cristina Barreto Lordo,
Anglica Alves Pereira Rodrigues, Deivison dos Santos Braga,
Alisson G. Silva.

Produo
Ncleo de Produo e Difuso da Extenso (PROEXT), Alena
Jambeiro, Karla Nascimento Cunico.

Equipe Editorial
Flvia Goulart Garcia Rosa (Coord.), Edson Sales,
Lcia Valeska Sokolowicz, Rodrigo Schlabitz.

Programao Visual e Arte do Congresso


Gilson Rabelo

Imagem smbolo dos Congressos da UFBA


Juarez Paraiso
SUMRIO

ESTUDANTE PIBIC 9
PROGRAMAS DE INICIAO PESQUISA CRIAO E INOVAO (PIBIC, PIBIC-AF, PIBITI, E PIBIC-JR) 11
COMIT LOCAL DOS PROGRAMAS DE INICIAO CIENTFICA E TECNOLGICA DA UFBA2017/2018 12
COMIT EXTERNO DOS PROGRAMAS DE INICIAO PESQUISA, CRIAO E INOVAO 2016/2017 14
APOIO 14

ESTUDANTE PAEXDOC 535

ESTUDANTE ACCS 629

ESTUDANTE MONITORIA 653

ESTUDANTE PIBID 685


PR-REITORIA DE ENSINO DE GRADUAO 687

ESTUDANTE PERMANECER 755


PROGRAMA PERMANECER: EXERCICIOS DE AO AFIRMATIVA NA AO AFIRMATIVA 757

ESTUDANTE PET 969

NUPEL 985
O NCLEO PERMANENTE DE EXTENSO EM LETRAS (NUPEL)
NO CONGRESSO DE ENSINO, PESQUISA E EXTENSO 987

ESTUDANTE PROFICI 993


APRESENTAO PROFICI 995
APRESENTAO NUCLI 996

PS-GRADUAO 1001

IMS/CAT 1135
Resumos do Congresso UFBA 2017

ESTUDANTE PIBIC
PROGRAMAS DE INICIAO PESQUISA CRIAO E
INOVAO (PIBIC, PIBIC-AF, PIBITI, E PIBIC-JR)

ESTUDANTE PIBIC
O Programa de Bolsa-pesquisa dirigido a estudantes de graduao na Universidade Federal
da Bahia foi criado h 40 anos. A Coordenao Central de Pesquisa e Ps-graduao criou
este programa com o propsito de incentivar novos talentos e despertar a vocao cientfica
entre os estudantes de graduao. Esta iniciativa foi logo em seguida, fortalecida pela criao
do Programa Institucional de Bolsas de Iniciao Cientfica do CNPq e posteriormente
ampliada com o apoio da Fundao de Amparo Pesquisa do Estado da Bahia (FAPESB).

Desde ento, o Programa de Iniciao Pesquisa da UFBA traduz com grande acuidade
a trajetria dos recursos humanos e valores cientificos que vem construindo os lastros da
pesquisa e de ensino de Ps-graduao na instituio.

Ao longo destes anos, a UFBA ampliou de forma significativa o apoio ao programa de


Iniciao pesquisa e Inovao, seja com recursos prprios, seja atravs de parcerias com
outras instituies (Figura 1).

Evoluo do nmero de bolsas de Iniciao Cientifca por rea do conhecimento (2008-2017)

Estamos realizando o 36 Seminrio Estudantil de Pesquisa com a participao de 1290


bolsistas dos Prorgamas PIBIC, PIBIC-AF, PIBITI e Milton Santos, em um evento integrado
ao Congresso de Pesquisa, Ensino e Extenso, compondo a articulao entre as diversas
temticas dos saberes em defesa de uma Universidade Pblica e de Qualidade.

Olival Freire Junior


PR-REITOR DE PESQUISA, CRIAO E INOVAO

Thierry Corra Petit Lobo


COORDENAO DE PESQUISA

Joice Neves Reis Pedreira


COORDENAO DE INICIAO A PESQUISA, CRIAO E INOVAO

Congresso da UFBA 2017 | Caderno de resumos 11


COMIT LOCAL DOS PROGRAMAS DE INICIAO
CIENTFICA E TECNOLGICA DA UFBA2017/2018
NVEL DT OU
ESTUDANTE PIBIC

SUBCOMITS MEMBROS UNIDADE


PQ
01 - CINCIAS AGRRIAS
MARIA CONSUELO CARIBE AYRES EMV
AMELIA CRISTINA MENDES DE MAGALHES IMS-VC

AGRONOMIA, CINCIA E TECNOLOGIA ALESSANDRA ESTRELA DA SILVA LIMA EMV PQ2


DE ALIMENTOS, ENGENHARIA AGRCOLA, RAPHAEL BERMAL COSTA EMV-ZOO
MEDICINA VETERINRIA, ZOOTECNIA,
RECURSOS FLORESTAIS E ENGENHARIA CLAUDIO VAZ DI MAMBRO RIBEIRO- LDER EMV-ZOO
FLORESTAL, RECURSOS PESQUEIROS E JOS ESLER DE FREITAS JNIOR EMV-ZOO PQ2
ENHENHARIA DE PESCA
SERGIO EDUARDO SOARES FAR
THEREZA CRISTINA B. DOS S. C. DE
EMV
BITTENCOURT
02 - CINCIAS BIOLGICAS
MRIO ANDR TRINDADE DANTAS IMS-VC (ECO)
LUCIANA SANTOS CARDOSOS FAR (IMUNO) PQ2
CRISTIANE FLORA VILLARREAL FAR (FARMA) PQ2
CARLA MENEGOLA IBIO (ZOO) PQ2
BIOFCIA, BIOLOGIA GERAL, BIOQUMICA,
BOTNICA, ECOLOGIA, FARMACOLOGIA, JOS MARCOS DE CASTRO NUNES IBIO (BOTA) PQ2
FISIOLOGIA, GENTICA, IMUNOLOGIA, KELLY REGINA BATISTA LEITE LDER IBIO (BOTA)
MICROBIOLOGIA, MORFOLOGIA,
PARASITOLOGIA, ZOOLOGIA LUZIMAR GONZAGA FERNANDEZ ICS (BIOQ) PQ2
PAULA CARVALHAL LAGE VON B. RISTOW IBIO (MICRO)
DOMINGOS BENCIO OLIVEIRA SILVA
IBIO (BOTA) PQ2
CARDOSO
VANESSA RODRIGUES PAIXO CRTES IBIO (GENE)
03 - CINCIAS DA SADE
GABRIELA BOTELHO MARTINS - FISOTERAPIA ICS
MARILIA CARVALHO SAMPAIO -
ICS
FONOAUDIOLOGIA
DANIELA DA SILVA ROCHA - NUTRIO IMS-VC
VALTERLINDA ALVES DE OLIVEIRA QUEIROZ NUT
FABIANA PAIM ROSA LDER ICS
EDUCAO FSICA, ENFERMAGEM, FARMCIA,
FERNANDA CARNEIRO MUSSI EEN PQ2
FISIOTERAPIA E TERAPIA OCUPACIONAL,
FONOAUDIOLOGIA, MEDICINA, NUTRIO, CLIMENE LAURA DE CAMARGO EEN PQ2
ODONTOLOGIA, SADE COLETIVA
MONIQUE AZEVEDO ESPERIDIO ISC PQ-1D
JOS ANTONIO MENEZES FILHO FAR PQ2
MARCELO SANTOS CASTILHO FAR PQ2
MARIA CRISTINA TEIXEIRA CANGUSSU ODO
PATRICIA RAMOS CURY ODO PQ2
EDNA LUCIA SANTOS DE SOUZA FAMED
04 - CINCIAS EXATAS E DA TERRA

12 Congresso da UFBA 2017 | Caderno de resumos


ANDERSON SANTOS SOUZA IMS-VC PQ2
ANDR TELLES DA CUNHA LIMA IF
ESDRAS SANTANA DOS SANTOS IF
DIEGO CATALANO FERRAIOLI - LDER IM MAT PQ2

ESTUDANTE PIBIC
MARCOS ENNES BARRETO IM COMP
KLEYBER MOTA DA CUNHA IM COMP
ASTRONOMIA, CINCIA DA COMPUTAO,
FSICA, GEOCINCIAS, MATEMTICA, ROSEMEIRE LEOVIGILDO FIACCONE IM - EST
OCANOGRAFIA, PROBABILIDADE E LUIZ CESAR CORREA GOMES IGEO
ESTATSTICA, QUMICA
JANINI PEREIRA IGEO
MARCOS ALBERTO RODRIGUES VASCONCELOS IGEO
NADIA MAMEDE JOS IQ DT-2
RENNAN GEOVANNY OLIVEIRA ARAUJO IQ PQ-2
ZENIS NOVAIS DA ROCHA IQ
BRUNO OLIVEIRA MOREIRA IMS-VC
05 CINCIAS HUMANAS
ANTONIO ANGELO MARTINS DA FONSECA IGEO - CP
CATHERINE PROST IGEO - GEO
CINTIA BEATRIZ MULLER LDER FFCH
FFCH -
NBIA BENTO RODRIGUES
ANTROP
LYGIA DE SOUSA VIEGAS FACED- EDU
EDVALDO SOUZA COUTO FACED EDU PQ-2
ANTROPOLOGIA, ARQUEOLOGIA, CINCIA
POLTICA, EDUCAO, FILOSOFIA, GEOGRAFIA, GEORGE EVERGTON SALES SOUZA FFCH HIS PQ-2
HISTRIA, PSICOLOGIA, SOCIOLOGIA,
FFCH -
TEOLOGIA IRACEMA BRANDO GUIMARES
SOCIOL
FFCH
LUIZ CLAUDIO LOURENO
SOCIOL
CLOVES LUIZ PEREIRA OLIVEIRA FFCH CP
MARCOS EMANOEL PEREIRA FFCH PSI PQ-2
ROSANGELA COSTA ARAUJO FFCH NEIM
SILVIA FAUSTINO DE ASSIS SAES FFCH FIOLO
06 - CINCIAS SOCIAIS APLICADAS
AIDA VARELA VARELA ICI
ANTONIO PEDRO ALVES DE CARVALHO ARQ PQ2
ELISABETH REGINA LOIOLA DA CRUZ SOUZA ADM

ADMINISTRAO, ARQUITETURA E ANA PAULA ROCHA DO BOMFIM DIR


URBANISMO, CINCIA DA INFORMAO, GILCA GARCIA DE OLIVEIRA FCE
CINCIAS CONTBEIS, COMUNICAO,
DEMOGRAFIA, DIREITO, DESENHO HENRIETTE FERREIRA GOMES LDER ICI
INSDUSTRIAL, ECONOMIA, ECONOMIA JOSE CLAUDIO ALVES DE OLIVEIRA FFCH
DOMSTICA, MUSEOLOGIA, PLANEJAMENTO
URBANO E REGIONAL, SERVIO SOCIAL, JUSSARA BORGES LIMA ICI
TURISMO MRCIA SANTANA TAVARES IPSI
LEONOR GRACIELA NATANSOHN FACOM
SONIA MARIA DA SILVA GOMES FCC
ZENY DUARTE DE MIRANDA ICI
07 ENGENHARIAS

Congresso da UFBA 2017 | Caderno de resumos 13


LUIZ ANTONIO MAGALHAES PONTES POLI- EQ
ANDR GUSTAVO SCOLARI CONCEIO POLI - EE PQ2
ELAINE CHRISTINE DE M. C. ALBUQUERQUE-
POLI- EQ
LDER
AEROESPACIAL, BIOMDICA, CIVIL, MATERIAIS
ESTUDANTE PIBIC

MARCIO ANDR FERNANDES MARTINS POLI- EI


E METALRGICA, MINAS, PRODUO,
TRANSPORTES, ELTRICA, MECNICA, NAVAL E ALEX ALVES BANDEIRA POLI DCE
OCENICA, NUCLEAR, QUMICA, SANITRIA
FRANCISCO GAUDENCIO MENDONA FREIRES POLI DEM
JUAN PEDRO MORENO DELGADO POLI- DETG
LUCIANA MARTINEZ POLI DEE
MARCELO STROZI CILLA POLI- DCTM
08 - LETRAS, LINGUSTICA E ARTES
LUCIENE ALMEIDA DE AZEVEDO LDER IL
ALVANITA ALMEIDA SANTOS IL
ELIZABETH SANTOS RAMOS IL
MRCIO RICARDO COELHO MUNIZ IL PQ-2
ARTES ANGELA ELISABETH LUHNING EMUS
LETRAS
LINGSTICA EDILENE DIAS MATOS IHAC
GIL VICENTE TAVARES ETEA
PAULO HENRIQUE CORREIRA ALCANTARA ETEA
ADRIANA BITTENCOURT MACHADO EDAN
MARIA CELESTE DE ALMEIDA WANNER EBA PQ-2
09 MULTIDISCIPLINAR
PATRCIA MARTINS DE FREITAS IMS-VC
RICARDO WAGNER DIAS PORTELA ICS
INTERDISCIPLINAR MEIO AMBIENTE E
AGRRIAS; INTERDISCIPLINAR SOCIAIS FABIO ALEXANDRE CHINALIA LDER ICS PQ-2
E HUMANIDADES; INTERDISCIPLINAR
ANTONIO SRGIO ARAJO FERNANDES ADM
ENGENHARIA, TECNOLOGIA E GESTO;
INTERDISCIPLINAR SADE E BIOLGICAS; LUCAS ROBATTO EMUS
BIOTECNOLOGIA; MATERIAIS
FERNANDA REBELO PINTO IHAC
RAQUEL SOUZAS IMS-VC

COMIT EXTERNO DOS PROGRAMAS DE INICIAO


PESQUISA, CRIAO E INOVAO 2016/2017
Antonio Edmilson Paschoal/Cincias Humanas/UFPR
Joni Augusto Cirelli /Cincias da Sade/UNESP
Carlos Magno Santos Gomes/Letras, Lingingustica e Artes/UFS
Elizabeth Hofling/Cincias Biolgicas/USP
Caetano Moraes/Engenharias/UFRJ
Alan Alves Brito/Cincias Exatas/UFRGS
Nair Yumiko Kobashi/Cincias Sociais Aplicadas/USP
Pierre Castro Soares/Cincias Agrrias/UFRPE
Marcia Helena Mendes Ferraz/Multidisciplinar/PUC-SP

APOIO
Conselho Nacional de Desenvolvimento Cientfico e Tecnolgico CNPq
Fundao de Amparo Pesquisa do Estado da Bahia FAPESB

14 Congresso da UFBA 2017 | Caderno de resumos


Area: ARTES - ARTES VISUAIS espao externo e que no afete a segurana do folio. Para
desenvolver a decorao do carnaval preciso pensar em
TRABALHO: A ESCOLA DE BELAS ARTES equipe, com tarefas definidas para cumprir os prazos. O
DA UFBA E O CARNAVAL DE SALVADOR: trabalho em equipe j comea na elaborao do projeto,
com prottipos e/ou desenhos para vencer a concorrncia.
PRODUO DCADA DOS ANOS DE 1970 A Tendo o projeto aprovado, tem-se incio a setorizao do

ESTUDANTE PIBIC
2000. sistema de produo para viabilizar a produo das peas.
Para a Escola de Belas Artes a criao de setores como
Autor (es): RITA DE CSSIA COSTA ARAGAO, MARIA desenho e fotografia, serraria, cortes e perfurao, pintura,
HERMINIA HERNNDEZ plastificao, carpintaria e ferragem, eletrificao, montagem
e acabamento, implantao das peas e desmontagem,
Resumo: O projeto de pesquisa tem como objetivo permitiu que as instalaes da escola fossem ocupadas, que
geral estudar a participao da Escola de Belas Artes da seus alunos, professores e funcionrios fossem beneficiados
Universidade Federal da Bahia, tambm conhecida como com a oportunidade de aprendizado e trabalho extra. A
EBA/UFBA, na produo da decorao do Carnaval de pesquisa sobre a participao da EBA no Carnaval, em
Salvador no perodo que compreende as dcadas de 1970, sua primeira etapa, evidenciou o quanto a escola e os
1980 e 1990, no intuito de fazer um resgate histrico acerca alunos ganharam em termos de uma prtica profissional,
do papel da instituio e de sua comunidade acadmica de chamada de ateno do pblico para a sua existncia,
na realizao desses festejos. E como objetivos especficos: havendo aparecido em noticirios nacionais e internacionais
construir uma breve contextualizao histrica e cultural pelo trabalho desenvolvido por sua comunidade acadmica.
acerca do perodo de estudo proposto; verificar de que Dessa forma, a pesquisa aponta para uma contribuio no
forma a Escola de Belas Artes fazia parte do processo aprofundamento e ampliao dos conhecimentos relativos
dessas realizaes; identificar os envolvidos na produo historiografia da Universidade Federal da Bahia a prpria
da decorao; levantar conceitos e processos criativos Escola de Belas Artes e seu papel na sociedade.
desenvolvidos em cada edio do carnaval em que a Escola
participou; pesquisar a existncia de peas grficas e escritas Palavras - chaves: Escola de Belas Artes,Decorao,Carnaval
ainda existentes como subsdios ao estudo proposto. Para *******************************************************************
acompanhar historicamente o Carnaval soteropolitano, *******************************************
fundamental refletir sobre esta comemorao antiga e que
acompanha a civilizao h tantos anos. Por ser uma festa
de carter mundial, nascida durante a Idade Mdia, por Area: ARTES - ARTES VISUAIS
volta de 1091 como um subproduto da Igreja Catlica, o TRABALHO: A ARTE ELETRNICA E A
Carnaval descrito por diversos historiadores como uma
festa essencialmente popular. Ele a festa mxima da Bahia NATUREZA
e o Carnaval Baiano a plenitude da Festa de Rei Momo no
Brasil. Na Bahia, a celebrao do Carnaval sintetiza as razes Autor (es): JULIA CERQUEIRA MORAIS, KARLA BRUNET
da festa em suas origens gregas, latinas e lusas, assim como
Resumo: No grupo de pesquisa Ecoarte Arte, tecnologia e
na absoro da magnitude da beleza da cultura africana
ecologia, desenvolvemos pesquisas acerca das intersees
que trouxe o toque de pimenta-de-cheiro para criar o
artsticas com a tecnologia e o meio ambiente. O presente
mais democrtico e etnicamente envolvente carnaval do
projeto tem como foco a pesquisa sobre a ao, criao e
mundo. Carnaval quebra preconceitos e o povo celebra essa
experimentao de obras e prticas artsticas que envolvem
liberdade visceral. Das inmeras formas de comemorao
corpo, deslocamento, movimento, caminhada, espao e
no Brasil, mais especificamente na Cidade de So Salvador,
interao com o ambiente urbano e a natureza, tambm
esta manifestao popular teve modificaes significativas
chamada de arte locativa, a partir de criaes estticas
desde o comportamento das pessoas at a decorao das
interativas. O desenvolvimento do projeto se deu atravs
ruas no decorrer dos anos. Na dcada de 50, o artista Juarez
da realizao de levantamento bibliogrfico sobre arte,
Paraso participou da execuo de vrias esculturas para o
arte eletrnica, espao urbano e natureza, pesquisa sobre
carnaval de Salvador, em conjunto com a equipe do escultor
arte locativa, em meios de locomoo no poluentes a
Manoel Bonfim e Jair Brando. O trabalho foi executado nos
p, bicicletas, skate, barco vela, alm da participao
barraces da Escola de Belas Artes. E foi com este marco que
em projetos desenvolvidos no grupo de pesquisa Ecoarte.
a decorao de rua passou a ser evidenciada no carnaval
Dentre os projetos que participei, est o projeto Velejar:
de Salvador. O carnaval oferece inmeras possibilidades no
arte e experincia no mar, constituiu-se por uma residncia
campo da criao e produo de design e de artes plsticas.
artstica de um dia bordo de um veleiro no mar, onde
A decorao uma roupagem especial que a cidade deve
produzimos variadas obras artsticas, incluindo um vdeo
ter, durante os seus festejos carnavalescos, fazendo jus e
de documentao da residncia; o Jogo Arte & Cidade:
assegurando o ttulo que conquistou de possuir o melhor
Descaminhar, jogo de tabuleiro sobre a cidade de Salvador,
carnaval do mundo. Deve possuir coerncia temtica,
onde visitamos locais especficos da cidade para interao,
criatividade decorativa e contemporaneidade. Os temas
fotografia e elaborao de estratgias para implantao no
devem ser apropriados, sugestivos e adaptados realidade
jogo, reunies de planejamento do jogo, criao de mini-
do carnaval. Decorao de carnaval flor rpida, dura pouco,
estdio para fotografia das peas do jogo, confeccionadas
mas imprescindvel na festa, seus efeitos ficam eternizados
em impressora 3D, filmagem e edio de vdeos-tutoriais
na lembrana do povo. O Carnaval de Salvador decorado
para o jogo Descaminhar; o projeto ElectroPedal, com a
uma grande exposio a cu aberto, um perodo onde
edio de vdeos criativos de trajetos realizados inteiramente
o artista expressa o seu olhar sobre o tema, uma forma de
com bicicleta, que sero projetados a partir da gerao
tornar mais popular o seu trabalho artstico. de extrema
de energia de uma bicicleta ergonmica transformada.
importncia a concorrncia pblica para que todos os
Para alm do desenvolvimento dos projetos, registrei
artistas tenham a possibilidade de apresentar seus projetos
em vdeo cada etapa de cada projeto, uma vez que nos
e terem a oportunidade de expor seu olhar para a sociedade.
interessa a documentao e anlise dos processos criativos
A decorao fortalece e valoriza a festa carnavalesca, ela
em arte eletrnica e natureza.A partir das leituras e do
deve ser capaz de criar um clima, uma atmosfera, que
levantamento bibliogrfico,escrevi posts informativos,
desperte o olhar curioso do folio que sinta prazer ao andar
publicados no site do Ecoarte. Foi possvel, tambm, o
pelas ruas da cidade envolvido pela arte, deve renovar
o espao pblico numa dimenso fsica adequada ao

Congresso da UFBA 2017 | Caderno de resumos 15


acesso e o aprimoramento de tcnicas de filmagem, edio e Area: ARTES - ARTES VISUAIS
montagem de vdeos e animao de imagens.
TRABALHO: OS RETBULOS DA IGREJA
Palavras - chaves: vdeo, natureza, arte
MATRIZ DE SO FELIPE E SO GONALO
*******************************************************************
*******************************************
DOS CAMPOS, RECNCAVO DA BAHIA E OS
ESTUDANTE PIBIC

MODELOS SOTEROPOLITANOS
Area: ARTES - ARTES VISUAIS
Autor (es): CAROLINA MOREIRA ROCHA, LUIZ ALBERTO
TRABALHO: APRESENTAO DOS RIBEIRO FREIRE
RESULTADOS OBTIDOS NO PROJETO Resumo: O presente trabalho aprofunda a relao entre os
IMAGENS E SONS: UMA EXPERINCIA padres estilsticos dos retbulos mores das Igrejas Matrizes
de So Gonalo dos Campos e So Felipe com as Igrejas
MULTIDISCIPLINAR EM AMBIENTE DE das principais cidades do Recncavo e de Salvador. Nas
PRODUO AUDIOVISUAL PARA O LABTEC Igrejas do Recncavo Baiano os entalhadores seguiram
com certa frequncia os modelos retabulares realizados
Autor (es): VITOR ADRIANO DANTAS PARANHOS, MARISE na capital, mas essa relao no foi de total dependncia.
BERTA SOUZA Houve interpretaes e at mesmo modelos concebidos
que distam dos soteropolitanos. O caso mais notvel o dos
Resumo: Durante o semestre letivo 2016.2 e 2017.1, diversas altares mores das igrejas matrizes das cidades de So Felipe
atividades de cunho audiovisual foram desenvolvidas no e So Gonalo dos Campos, que apresentam tipologias
projeto Imagens e Sons: Uma experincia multidisciplinar relacionadas entre si e diferentes dos demais da metrpole
em ambiente de produo audiovisual para o LABTEC. e das demais cidades do recncavo da Baa de Todos os
Como uma iniciativa interdisciplinar, o projeto teve como Santos. Neles a estrutura se aproxima mais da arquitetura
principais pontos de atuao intervenes artsticas dentro neoclssica, ou ecltica, provavelmente informada por
da universidade, as quais, dentro do contexto do ensino, modelos de retbulos em mrmore realizados no perodo
pesquisa e extenso, permitiram aos estudantes bolsistas por marmoristas italianos, ou mesmo a partir de influncias
desenvolverem diversas habilidades tcnicas, artsticas estticas ocorridas no recncavo a partir do sculo XIX com
e produtivas, trabalhando diretamente nas referidas a imigrao italiana. A formulao do retbulo-mor de So
intervenes. Ao longo do projeto, foram discutidas Gonalo contm no grupo de nichos do camarim o conjunto
maneiras de se integrar a produo artstica audiovisual que ser ampliado no de So Felipe. A estrutura maior se
dentro de uma perspectiva inovadora, que favorecesse o compe de arcos romanos concntricos e no interior dos
desenvolvimento de um saber crtico e criativo por parte arcos o grupo de trs nichos, sendo o do centro de maior
dos bolsistas, aliado funo educativa das aes artsticas altura e os dois que ladeiam mais baixos que o central e de
trabalhadas como produto audiovisual reflexivo e crtico, alturas coincidentes. Esse conjunto de nichos se torna o tema
voltado para um pblico que, num primeiro momento, se dominante no altar-mor de So Felipe. O retbulo mor da
encontra na comunidade acadmica da UFBA. Como parte igreja matriz de So Felipe apresenta em sua estrutura os trs
dos produtos desenvolvidos pelo Imagens e Sons, e resultado nichos, sendo o central bastante verticalizado, j que esse
de uma parceria com o coletivo Os Imaginrios da Escola de tema dominaria o p direito da capela-mor. Elimina-se a os
Teatro da UFBA, foram desenvolvidas a verso audiovisual da arcos romanos concntricos.As duas peas parecem ter sado
pea `Protocolo Lunar` e uma entrevista com todo o corpo da mesma oficina de entalhadores, inclusive considerando
do elenco, direo e produo do espetculo. importante os elementos ornamentais. Esses representam o repertrio
destacar que desde a captao das imagens ao posterior constante da talha baiana do sculo XIX. Constituem-se
tratamento e finalizao destes produtos, todos os trabalhos predominantemente de motivos fitomrficos e raros
foram desenvolvidos pelos bolsistas, como oportunidade antropomorfos.
para a prtica audiovisual, em que os saberes propostos
pelo projeto puderam ser concretizados no contexto de Palavras - chaves: Retbulos, tipologia
uma produo efetiva. Alm disso, a orientao docente *******************************************************************
foi fundamental para que o trabalho caminhasse sob uma *******************************************
perspectiva coerente, onde o amadurecimento profissional
e acadmico se tornasse conseqncias dos trabalhos
desenvolvidos pelos bolsistas. Os dois filmes resultantes do Area: ARTES - ARTES VISUAIS
projeto Protocolo Lunares aparecem como uma efetivao TRABALHO: PROTOCOLO CIDADE
das diretrizes propostas pelo Imagens e Sons, de se tornar
uma interlocuo entre a universidade e a sociedade, no Autor (es): ISADORA RAMOS FURLAN, MARISE BERTA
qual o audiovisual aliado ao Teatro surge como uma via SOUZA
democrtica para a construo do discurso crtico e artstico
os quais ambos os projetos se propem a construir. Resumo: Ao longo de minha passagem pelo Pibic,
desenvolvi diversos estudos sobre cinema mediados pela
Palavras - chaves: audiovisual, teatro, produo professora Marise Berta, principalmente voltado pra rea
******************************************************************* do cinema mais documental, trabalhando as questes
******************************************* tericas, mas principalmente aprendizados ligados as
questes prtica, pois os estudos se deram muito atravs
de reflexes sob trabalhos que ns mesmos estvamos
construindo, ou seja, reflexes atreladas a filmagens e
edies de produtos que ns mesmos estvamos realizando
nesse processo. Entretanto, de todos as realizaes, uma
delas foi a mais instigante, que foi nossa experincia com
a professora Sonia Rangel, aonde nos vimos desafiados
em pensar as artes visuais na relao entre cinema e
artes cnicas, onde trabalhamos o dialogo do vdeo na
composio do cenrio da sua pea teatral Protocolo

16 Congresso da UFBA 2017 | Caderno de resumos


Cidade. Para isso, alm de pensar o vdeo de maneira mais estudos nascem uma srie de vdeos onde contextualizamos
fluida, de forma mais texturada, a fim de que o mesmo a linguagem cinematogrfica e de que forma ela se aplica aos
no brigasse e sim conversasse com os outros elementos vdeos de dana, apontando suas diferenas e similaridades.
da pea (como o cenrio fsico, os personagens, que eram
atores e os bonecos animados pelos atores, a trilha sonora, Palavras - chaves: Ferramentas grficas, Registro audiovisual
a iluminao, etc.), sempre buscando o equilbrio nessas *******************************************************************

ESTUDANTE PIBIC
relaes para que as mesmas convergissem para a narrativa *******************************************
que a pea se propunha. Alm disso, tambm houve novos
desafios de instncias tcnicas, pois nos propomos tambm
a operar esse vdeo durante a pea, para que ocorresse Area: ARTES - DANA
a interatividade entre as aes da pea e o vdeo, para TRABALHO: INTERFACES PARA O CORPO
isso trabalhamos com a tcnica do vdeo mapping, que
consiste na ideia de projeo mapeada, onde no s se (TELE) SONORO EM AMBIENTE DE
pensa no contedo do vdeo, mas nas possibilidades de IMPROVISAO EM DANA
recorte e expanso que esse contedo pode abranger a fim
de contribuir com a narrativa da pea teatral Protocolo Autor (es): PRISCILA REGINA RODRIGUES JORGE, IVANI
Cidade. Dessa forma promovemos um espetculo muito LUCIA OLIVEIRA DE SANTANA
impressionante que atravs de pesquisa, captao e edio
de vdeos, atrelado com o mapeamento do espao de Resumo: A participao da bolsista no Congresso de
projeo, promovemos com harmonia o dilogo entre arte Pesquisa, Ensino e Extenso - 2017 visa o compartilhamento
e tecnologia. e exposio das atividades desenvolvidas pela mesma
em cumprimento de seu plano de trabalho referente ao
Palavras- chaves: Protocolo Cidade,Vdeo Mapping,Arte e Programa Institucional de Bolsas de Iniciao Cientfica
Tecnologia (PIBIC) 2016/2017, no Grupo de Pesquisa Potica
******************************************************************* Tecnolgica (Instituto de Humanidades, Artes e Cincias),
******************************************* sob coordenao da Prof. Dr. Ivani Santana. Neste foram
explorados os parmetros dos conceitos de sonoridade
orgnica, acstica e sinttica a fim de utilizar e/ou
Area: ARTES - DANA criar interfaces tecnolgicas. Bem como investigadas
TRABALHO: FERRAMENTAS GRFICAS PARA possibilidades de criao sonora a partir de distintas
interfaces tecnolgicas aplicadas em improvisao de dana.
ANLISE DE REGISTRO AUDIOVISUAL EM Alm disso, aprofundamos o conceito de interface sonora
DANA a partir das reflexes encontradas no estudo do corpo
sonoro atravs de experimentaes, anlises conceituais
Autor (es): GIOVANI SANTOS RUFINO, IVANI LUCIA e fundamentao terica, assim como investigamos as
OLIVEIRA DE SANTANA interfaces corpo/sonoridade na improvisao em dana
mediada pelas novas tecnologias do ponto de vista cognitivo.
Resumo: Este trabalho tem como objetivo apresentar os Tais investigaes tiveram como suporte no campo da prxis
resultados obtidos no plano de trabalho Ferramentas grficas a criao e desenvolvimento do projeto Reentrncias, que
para anlise de registro audiovisual em dana Realizado consiste numa interveno urbana na qual o pblico
pelo bolsista Giovani Santos Rufino e orientado pela Dr guiado pelo aplicativo Trilhas Poticas e que a cada ponto,
Ivani Santana. Para tanto partiremos das reverberaes indicado por GPS, possvel apreciar a cidade junto com
do evento EiDCT (Encontro interdisciplinar em Dana as imagens de micro-videodanas criadas por cinco grupos
Cognio e Tecnologia, 2016) que foi realizado pelo Grupo artsticos de 5 cidades e estados do Brasil: Fortaleza (Cear),
de Pesquisa Poticas Tecnolgicas: Corpoaudiovisual e Macei (Alagoas) Joo Pessoa (Paraba), Salvador/GP Potica
que teve como objetivo investigar, a partir da dana com (Bahia) GP Potica e Florianpolis (Santa Catarina). Por outro
mediao tecnolgica, aspectos da percepo humana - vis, o projeto contou com suporte de pesquisa terica
tanto dos bailarinos como do pblico em um ambiente com objetivo de criao de Catalogao de videodana,
de improvisao. Nessa perspectiva apresentarei uma baseados nos estudo da linguagem cinematogrfica, que
anlise do contedo documental videogrfico de um dos tem como referncia o livro A Linguagem Cinematogrfica,
experimentos realizados no Lab-DCT (Laboratrio de Dana de Marcel Martin. Esta estar disponvel na plataforma
Cognio e Tecnologia) que ocorreu dentro do EiDCT com Airtable, bem como online no site do Grupo de Pesquisa
bailarinos inscritos e convidados, a fim de investigar sobre Potica Tecnolgica: corpo audiovisual. Nestes estudos esto
as percepes de dois danarinos em improvisao num contidas as narrativas de momentos significativos da histria
ambiente mediado tecnologicamente onde o primeiro, D1, do cinema at as produes j inseridas no contexto do
interage com um dispositivo com cmera acoplado em video-dana.
seu corpo, tornando-se uma cmera subjetiva. A imagem
gerada por D1 projetada em uma grande tela translcida Palavras - chaves: Corpo (tele) sonoro, Improvisao
servindo como estmulo para D2, posicionado logo atrs no *******************************************************************
mesmo ambiente. Esse estudo busca investigar e evidenciar *******************************************
de que forma D1 e D2 interagem e so afetados, direta ou
indiretamente, sob o ponto de vista cognitivo, tendo como
base as sutilezas percebidas em seus movimentos, bem Area: ARTES - DANA
como intensidade, ritmo e padres de movimentos. Alm TRABALHO: O CORPO-SONORO NA DANA
da anlise sero apresentados outros resultados decorrentes
das investigaes realizadas em grupo de pesquisa, onde Autor (es): DANILO PEREIRA, IVANI LUCIA OLIVEIRA DE
o bolsista articulado com outros membros do grupo e SANTANA
sob orientao da Dra Ivani Santana conduzem encontros
semanais com o para o desenvolvimento das investigaes e Resumo: A dana uma das manifestaes artsticas
projetos. Os estudos do livro A Linguagem Cinematogrfica mais antigas da histria da humanidade, uma relao
(Dinalivro, Lisboa, 2005) de Marcel Martin, conduziram as estabelecida com o corpo, bem como com o espao ao
investigaes acerca de diversos vdeodanas, de diversos seu redor, que se desenvolveu ao longo dos sculos e se
perodos da histria com luz linguagem do cinema. Destes mostrou plural atravs das mais variadas culturas. Todavia,

Congresso da UFBA 2017 | Caderno de resumos 17


ao entendermos o corpo como uma ferramenta primordial cinematogrfica - de Gustavo Mercado O olhar do
no estabelecimento da dana, isso no exclui o fato de que cineasta: aprenda (e quebre) as regras da composio
ao passar do tempo essa arte foi estabelecendo relaes cinematogrfica. A anlise das videodanas evidenciou as
com os contextos tecnolgicos que foram surgindo, e com necessidades e particularidades da linguagem videodana
isso explorando novos potenciais performticos. Dessa que abrange caractersticas prprias e autnomas. Tais
forma, compreende-se que a dana (e o corpo) sempre leituras e abordagens tericas embasaram a experincia de
ESTUDANTE PIBIC

buscou modos de explorar novas dinmicas e hoje, em pleno criao e produo de um projeto audiovisual, na interface
sculo XXI, a relao com as novas tecnologias esto cada entre dana e cultura digital: Reentrncias. O processo de
vez mais inerentes neste contexto. Assim, tendo em vista criao se deu a partir de propsitos que mantm relaes
as variadas formas com qual o corpo se estabelece perante estreitas com a ideia de corpo sonoro atravs da explorao
os aparatos tecnolgicos atuais (vdeo mapping, telemtica, de sonoridades. Esse trabalho foi desenvolvido no contexto
softwares, por exemplo), esta pesquisa vem investigar as do Grupo de Pesquisa Potica Tecnolgica (Instituto de
sonoridades dos corpos na dana em espaos fsicos e Humanidades, Artes e Cincias/Universidade Federal da
em espaos mediados pela tecnologia, tendo como foco Bahia), sob a orientao da profa. Dr. Ivani Santana.
atentar-se no estudo do udio, analisando a partir disto
o corpo-sonoro. Com o corpo-sonoro estamos lidando Palavras - chaves: Corpo sonoro, Videodana
com uma trade sonora: sonoridade orgnica, sonoridade *******************************************************************
acstica e sonoridade sinttica. A questo principal a ser *******************************************
formulada est em perceber como essas sonoridades se
apresentam e em que nveis, para com isso buscar encontrar
no corpo essa anlise e conseqentemente o modo com que Area: ARTES - MSICA
o bailarino se expe perante esses nveis, que o afeta e faz TRABALHO: A ESCOLA DE MSICA DA UFBA:
com que ele estabelea uma relao distinta diante de cada
ambiente, fazendo-o perceber e estimular a investigao SUA TRAJETRIA CONCEITUAL E SUA(S)
das possibilidades que provem deste dilogo sonoro com IDENTIDADE(S)
o corpo.Dessa forma, a partir das observaes feitas ao
longo da pesquisa foi possvel perceber, de certa forma, uma Autor (es): IZABELLA BALDONO ALMEIDA, ANGELA
progresso nos nveis do estabelecimento do corpo-sonoro, ELISABETH LUHNING
uma intensidade com qual o bailarino expe sua sonoridade,
tendo em vista a trs possibilidades. Assim, faz-se necessrio Resumo: A Escola de Msica da UFBA nacional e
trabalhar cada etapa do corpo-sonoro de forma distinta, internacionalmente conhecida graas a uma reputao
partindo da sonoridade mais prxima ao corpo do bailarino que se construiu em seu entorno durante seus mais de
(sonoridade orgnica), passando pela medio do corpo com 60 anos de existncia, principalmente quando voltamos
o ambiente (sonoridade acstica) e, por fim, a sonoridade o olhar para os efervescentes primeiros anos, que por
que se mostra mais distante, em certos momentos, do algum motivo foram movimentados por msicos, sejam
corpo que a faz surgir (sonoridade sinttica), para por fim estudantes ou professores, de muitos cantos do Brasil e
relacion-las. da Europa. A EMUS tem uma trajetria que passeia por
cenrios polticos e culturais interessantes e marcada pela
Palavras - chaves: dana, corpo, sonoridade presena de vrias pessoas emblemticas, mas pouco se
******************************************************************* discute, mesmo internamente, sobre quais teriam sido as
******************************************* propostas identitrias iniciais para esse espao, enquanto
local de formao de msicos e outros profissionais ligados
rea de msica, e as implicaes dessas propostas e seus
Area: ARTES - DANA desdobramentos no cenrio atual da Escola. O nascimento
TRABALHO: PERCEPES DO CORPO SONORO das escolas de arte da UFBA marcado por uma forte
atuao de professores estrangeiros, fenmeno recorrente
NA VDEODANA tambm em muitas outras reas e universidades, a exemplo
da constituio da rea de Cincias Sociais da USP, contando
Autor (es): VICTORIA DOURADO DE OLIVEIRA, IVANI LUCIA com Claude Levi-Strauss e Roger Bastide, por exemplo. Mas,
OLIVEIRA DE SANTANA talvez caminhando em sentido oposto s demais instituies,
muitos dos nomes de pessoas precursoras na EMUS, como
Resumo: A pesquisa foi desenvolvida a partir da ideia
Hans Joachim Koellreutter, Walter Smetak e Ernest Widmer,
de corpo sonoro e se dedica aos estudos de explorao
tm sido abordados de maneira limitada e muitas vezes,
desse corpo em ambientes videogrficos. O corpo
possivelmente, at afetada por afinidades pessoais, sem
sonoro compreende trs nveis de sonoridade. Tais nveis
que se debata sobre suas contribuies (ou at mesmo
contemplam os sons que podem ser produzidos por
desservios). Durante o desenvolvimento da pesquisa,
um corpo - so eles os sons orgnicos, os acsticos e os
pudemos mergulhar em diversas fontes de informaes e
sintticos. Os sons orgnicos consistem em sons oriundos
nos permitir discutir mais profundamente sobre quais teriam
da respirao e da pulsao do corpo. Os sons acsticos
sido os preceitos iniciais da escola (se que realmente houve
so aqueles resultantes do confronto com o prprio
definies nesse sentido), qual era o contexto social, poltico
corpo, o ambiente e objetos. Por fim, os sons sintticos
e cultural que acolheu o nascimento dessa instituio
so produzidos atravs de processamento e modificao
que, afinal de contas, foi a primeira de ensino superior em
dos sons e movimentos do corpo por sistemas digitais. A
msica no pas, sobre as vrias fases e faces da EMUS, nos
explorao dessas experincias sonoras se deu por meio
diversos perodos e observada sob vrios ngulos, e sobre
de contextos de improvisao tendo em vista a elaborao
como as relaes de poder moldam a tica sob a qual os
de microdanas para ambientes mediados por dispositivos
acontecimentos so vistos no decorrer da histria (e das
digitais e a produo de videodana. A relao entre Dana
estrias).Meu plano de trabalho teve por objetivo amarrar
e linguagem audiovisual reserva especificidades relativas
as informaes colhidas pelos planos dos demais colegas
a movimentos de cmera, captao e edio de sons,
envolvidos no projeto, analisando aspectos internos e
msica e iluminao. A fim de perceb-las e analis-las, foi
externos escola e aos seus personagens, observando fatores
realizada uma investigao da linguagem videodana em
administrativos do germinar de uma universidade e de suas
diferentes perodos histricos e a partir de categorias de
escolas e faculdades e, principalmente, fazendo uma anlise
anlises extradas do livro que apresenta uma linguagem

18 Congresso da UFBA 2017 | Caderno de resumos


dos discursos para alm dos textos e das falas das entrevistas, com o esclarecimento conseguido com toda a informao
que foram se construindo nas entrelinhas dessa trajetria. adquirida at ento, h ainda questes pendentes, visto
que se torna mais difcil a reconstituio dessa histria, j
Palavras - chaves: escola de msica da UFBA, instituio de que seus atores no tm como cont-la, pelo fato de serem
ensino, msica falecidos. Uma dessas questes visa descobrir o que advinha
******************************************************************* dessa ligao dos dois com a msica brasileira, como se

ESTUDANTE PIBIC
******************************************* lidava com isso no espao da Escola de Msica e mesmo
na universidade. Devido a sua relevncia e dada a sua
complexidade, onde a anlise dos discursos envolve, entre
Area: ARTES - MSICA outros pontos, apreenso de conceitos que requerem ainda
TRABALHO: AS CONTRIBUIES E muita discusso para sejam bem assimilados, como o prprio
conceito de msica brasileira, por exemplo, a pesquisa
PROPOSTAS DE WIDMER E LINDEMBERGUE entrar numa segunda fase.
CARDOSO NA EMUS/UFBA Palavras - chaves: Escola de Msica, Ernst Widmer,
Lindembergue Cardoso
Autor (es): CRISTIANO WILSON SILVA DE SOUZA, ANGELA
ELISABETH LUHNING *******************************************************************
*******************************************
Resumo: Toda instituio pressupe uma razo de ser, ou
seja, um conjunto de valores, justificativas, motivaes,
que mantm as estruturas que sustentam a sua existncia. Area: ARTES - MSICA
Investigar a histria da Escola de Msica da UFBA, desde a TRABALHO: AS PROPOSTAS CONCEITUAIS E
sua fundao, como Seminrios Internacionais de Msica
em 1954, at os dias atuais, resulta numa das maneiras OS LEGADOS DE KOELLREUTTER E SMETAK
de trazer luz aquilo que de fato se constitui como sua PARA A EMUS/ UFBA
pedra angular, a base em que se encontram alicerados os
elementos essenciais que compem seu carter distintivo. Autor (es): ANDR CHETTO LIMA, ANGELA ELISABETH
a partir desse entendimento, que este estudo visa examinar LUHNING
se houve algum esforo em construir uma identidade
para a Escola de Msica, tanto por parte daqueles que Resumo: A trajetria da EMUS Escola de Msica da UFBA
compuseram quanto dos que ainda compem os quadros apresenta uma srie de aspectos interessantes diretamente
da instituio. Se houve, de fato, algum movimento nesse ligados com a prpria histria cultural da Bahia e at do
sentido, a pesquisa visa descobrir em que momento ou Brasil. No incio dos anos 50, Salvador ainda era considerada
momentos ocorreu, descrevendo, assim, o processo. No uma provncia em relao ao eixo sul-sudeste do Brasil,
caso especfico desta instituio, que intrinsecamente deve principalmente em relao s artes. Um projeto novo que
abrigar a reflexo sobre a arte musical, o foco da pesquisa visava fortalecer justamente o campo das artes na Bahia,
consiste em elucidar os motivos porque a msica brasileira liderado por Edgard Santos, trouxe em 1954 para Salvador
no tem o lugar prevalecente, o que presumvel diante do diversos msicos estrangeiros para montar um curso, que
fato de que a Escola no apenas integra uma universidade inicialmente chamou-se Seminrio Internacional de Msica.
brasileira, mas tambm est inserida necessariamente em O curso acabou sendo implementado integralmente no ano
todo um contexto social do Brasil. Partindo desse esprito de seguinte, passando a chamarem-se Seminrios Livres de
compreenso, muitos dos agentes desta histria merecem Msica e juntamente com a instalao de outras escolas na
uma ateno individualizada. Este o caso de pessoas que rea de artes logo em seguida, como as de teatro e dana em
fizeram parte da histria da Escola de Msica e cuja trajetria 1956, deram uma nova vida cultural cidade. Desde o incio
merece um exame atento, dadas as suas particularidades. dos Seminrios, ganha destaque Hans-Joachim Koellreutter,
Por isso, compreender a Escola de Msica da UFBA sob msico, compositor e professor de origem alem que foi o
um vis histrico implica tambm desvendar qual o papel principal responsvel por montar a equipe de professores,
desempenhado efetivamente por dois dentre seus diversos assim como definir toda a estrutura do curso. Dentre esses
personagens, so eles Ernst Widmer e Lindembergue professores, outro grande personagem foi Anton Walter
Cardoso. Durante a pesquisa, surgiu a necessidade de Smetak, msico, compositor, escultor, inventor, professor,
lanar um olhar mais minucioso sobre a histria desses dois de origem Sua que se estabeleceu na Bahia desde o incio
professores, cujo reconhecimento enquanto compositores dos cursos da EMUS, ficando mais tarde conhecido por seus
obtiveram alcance nacional, tendo sido ambos vencedores mtodos inspiradores de ensino, que utilizavam os seus
de importantes prmios de msica contempornea brasileira, prprios instrumentos musicais feitos de cabaa, cordas,
e cuja atuao como professores reflete parte da reputao tubos de pvc, etc., como matria-prima sonora nas suas aulas
em nvel nacional que Escola de Msica da UFBA obteve de improvisao.Mas, alm desses personagens, diversos
entre os anos 60 e 70. Com o decorrer do estudo, pode-se outros despertaram a ateno do pesquisador, por estarem
notar que o valor de ambos est para alm do renome no totalmente relacionados com a histria da escola, tal qual:
campo da composio musical, uma vez que se percebe Manuel Veiga, Fernando Cerqueira, Jamary Oliveira, Carlos
que a atividade como compositores corre a par com suas Lacerda, dentre tantos outros, que participaram ativamente
funes no mbito da universidade. No intuito de encontrar da escola, como alunos, professores e at diretores, e
as respostas, o trabalho desenvolveu-se basicamente mereceram, portanto, uma ateno especial. Sem falar, nos
atravs de leituras de livros, artigos e textos disponveis na diversos aspectos relacionados com a escola ao longo da sua
internet, vdeos, e entrevistas. Todo esse material propiciou histria, que provocaram desdobramentos e investigaes
um deslinde sobre a relao que Ernst Widmer tinha com mais profundas, a exemplo da: Criao da orquestra
a msica brasileira, a qual via positivamente como algo sinfnica da Bahia e do madrigal no final dos anos 50, as
valioso. No ocorre diferentemente com Lindembergue parcerias com a escola de teatro, tal qual foi na participao
Cardoso, cuja trajetria como msico popular antes e de msicos da EMUS na pera de Trs Tostes, realizada em
mesmo depois da entrada nos Seminrios Internacionais 1960 nos escombros do TCA. A sada do reitor Edgard Santos
de Msica como estudante, muito conhecida. A pesquisa em 1961, do diretor da Escola de Teatro, Martin Gonalves,
chegou verificao de que Ernst Widmer tambm se no mesmo ano, aps campanha difamatria dos jornais
ocupou com aes j s pocas prementes, como a locais; Sada logo em seguida, em 1963, de Koellreutter da
discusso do lugar da arte na universidade. Contudo, mesmo EMUS; Ditadura Militar em 1964, originando movimentos

Congresso da UFBA 2017 | Caderno de resumos 19


estudantis e manifestos, inclusive na Escola de msica. Palavras - chaves: Tcnicas estendidas, composies
Fundao do grupo de Compositores da Bahia em 1966 didticas, msica contempornea
(Widmer e vrios alunos); Reforma universitria em 1968,
ocorrendo a fuso dos cursos de msica e teatro na EMAC; *******************************************************************
Tropiclia, movimento de renovao na msica brasileira, *******************************************
que iniciou entre 1967 e 1968, tendo frente figuras como:
ESTUDANTE PIBIC

Caetano Veloso e Gilberto Gil, Tom Z, Os Mutantes, Rogrio Area: ARTES - MSICA
Duprat, Jos Carlos Capinan, Torquato Neto, Rogrio Duarte,
dentre outros. A Escola de msica teve papel central em
TRABALHO: AUXLIO NA COMPOSIO
diversos momentos da efervescncia cultural da Bahia, DE OBRAS DIDTICAS E NA CRIAO DE
inclusive tendo certa influncia no movimento da Tropiclia,
assim como na formao de toda uma gerao que envolveu
FERRAMENTAS PARA ENSINO DE TCNICAS
nomes como Tom Z, ex-aluno da escola, alm de Caetano ESTENDIDAS
Veloso e Gilberto Gil. Todos eles tiveram relaes estreitas
com Walter Smetak e frequentavam o ambiente da escola Autor (es): GEORGE CRISTIAN VILELA PEREIRA, GUILHERME
e os eventos correlatos de msica contempornea que BERTISSOLO
aconteciam na Reitoria e em outros locais como o ICBA, o
Teatro Vila Velha, o Teatro Castro Alves, entre outros, que Resumo: O trabalho neste segundo ano do projeto Fermata
traziam novos conceitos e inspiraes estticas para toda consistiu em partir para a linguagem dos estudos musicais
uma nova gerao de msicos da Bahia. no intuito de aplicar tcnicas estendidas em instrumentos
tais como bouzouki, flauta, violo e violoncelo, tendo como
Palavras - chaves: KOELLREUTTER, SMETAK, EMUS base noes de sentido da corporeidade conceitual de obra
******************************************************************* composicional. Cientes da necessidade de reconfigurar o
******************************************* cenrio de estudo da msica contempornea, de modo a
preparar melhor o estudante de instrumento para a lida de
novas tcnicas de execuo que vm sendo intensivamente
Area: ARTES - MSICA trabalhadas desde meados do sculo XX at o presente
TRABALHO: AUXLIO COMPOSIO DE momento musical, os bolsistas em sistemtica colaborao
com o orientador reuniram-se semanalmente no intuito
OBRAS DIDTICAS E NA CRIAO DE de criar e analisar estudos instrumentais.Aproveitando
FERRAMENTAS PARA ENSINO DE TCNICAS parte do arcabouo do ano anterior, a equipe procurou
fontes tanto em estudos acadmicos (em forma de sites ou
ESTENDIDAS E MSICA INTERATIVA A de artigos ou teses) desenvolvidos especialmente para os
PARTIR DA INTERPRETAO MUSICAL referidos instrumentos quanto em peas contemporneas
que serviram de base tanto para pensar a respeito da
execuo, quanto notao. Houve a preocupao tambm
Autor (es): VTOR SILVA RIOS, GUILHERME BERTISSOLO
de estabelecer uma acessibilidade na linguagem da notao,
Resumo: Apesar da Escola de Msica da UFBA exercer uma exeqibilidade do material musical, como tambm a de
um papel importante e destacado na msica de concerto trabalhar artisticamente seguindo firmes propsitos didticos
contempornea e ter seu ensino de composio como de desenvolvimento tcnico por parte do instrumentista. No
referncia em diversos contextos, ainda se nota certa que tange aos estudos que foram desenvolvidos em meu
carncia no que se diz respeito utilizao de ferramentas trabalho: o de bouzouki, que contemplou as possibilidades
didticas para o uso da tcnica estendida. Aspecto to de trabalhar a percussividade no instrumento; os dois
importante para a msica feita hoje em dia e praticada estudos para flauta buscaram, respectivamente, trabalhar
no curso de composio, muitos compositores tem feito a percussividade (uso de lip pizzicatos e tongue stops) e a
obras que se utilizam dessas tcnicas nos mais variados emisso de jet-whistle e harmnicos dentro de um sistema
instrumentos. Dada essa falta no ensino de composio em de classes de conjunto; o estudo para violo explorou uma
nvel de graduao, este trabalho (como desdobramento srie de tcnicas de rasgueados; o para violoncelo procurou
de uma etapa anterior, entre 2015-2016) vem como uma lidar com a microtonalidade tanto nas execues de
tentativa de articular essas ferramentas que podero servir glissandos ou vibratos mesclados a harmnicos.Atualmente,
tanto para o compositor e sua implementao nas obras o sub-projeto est buscando organizar um banco de
quanto para a introduo do intrprete s possibilidades que dados com os links e acervo bibliogrfico das fontes que
algumas tcnicas proporcionam. Logo, o principal objetivo embasaram nossos estudos, alm de, tambm, buscar uma
deste trabalho desenvolver obras didticas - pequenos resoluo quanto organizao e formatao dos estudos
estudos - que utilizem essas possibilidades tcnicas como compostos pelos bolsistas e feitos com a colaborao do
ferramentas e partes estruturantes de uma mecnica que orientador do projeto.
associe as tcnicas tradicionais s tcnicas estendidas. Para
Palavras - chaves: Estudos instrumentais, Peas didticas,
essas composies, foram escolhidos quatro instrumentos:
Tcnicas estendidas
bouzouki, flauta, cello e violo. A partir de pesquisas e
buscando um norte em repertrios de referncia, foi *******************************************************************
utilizada somente uma tcnica por instrumento, tentando *******************************************
explorar as suas possibilidades entre a linguagem tradicional
e de uma forma que preservasse o didatismo do estudo.
No meu trabalho, os estudos foram realizados da seguinte
Area: ARTES - MSICA
maneira: a) Estudo para flauta usando Lip Glissando; b) TRABALHO: AUXLIO COMPOSIO DE
Estudo para Cello usando Overpressure; c) Estudo para violo
usando Bi-tones e d) O estudo para bouzouki foi composto
OBRAS DIDTICAS E NA CRIAO DE
coletivamente, junto aos outros bolsistas e orientador, FERRAMENTAS PARA ENSINO DE MSICA
utilizando ideias que envolvem o uso de acordes em uma
mesma posio em trs espaos diferentes do brao, som
INTERATIVA
atrs da ponte, cordas abafadas e o uso da percussividade
no corpo do instrumento todos envolvidos em uma nica Autor (es): PETER PEREIRA MARQUES, GUILHERME
mecnica. BERTISSOLO

20 Congresso da UFBA 2017 | Caderno de resumos


Resumo: Neste segundo ano da pesquisa intitulada: produo musical com algumas questes e discusses sobre
Composio de obras didticas e criao de ferramentas mulheres negras, indgenas e trans. Atravs do plano de
para ensino de msica interativa e tcnicas estendidas, sob trabalho Feminaria Musical IV: processos criativos, trocas de
orientao de Guilherme Bertissolo, demos continuidade saberes e vivencias potico-musicais, que surgiu como uma
ao projeto Fermata, com foco central na criao das peas emergncia para registrar todas as atividades desenvolvidas
didticas. Inicialmente, fizemos uma pea conjunta para atravs da catalogao e da sistematizao desses materiais

ESTUDANTE PIBIC
Bouzouki a fim testar o modelo que aplicaramos nas diversas como atas e fotografias. O projeto Feminaria Musical ou
peas que em seguida seriam compostas individualmente. epistemologias feministas em msica no Brasil IV: etnografias,
A caracterstica central deste foi o foco na mecnica das saberes e vivncias potico-musicais, iniciou em 2012, tendo
peas. Partimos ento para o processo de criao individual como enfoque terico e metodolgico os estudos da msica
das peas aonde escolhemos trs instrumentos para em suas subreas do conhecimento (educao musical,
compormos as peas individuais: Flauta, Violo e Violoncelo. etnomusicologia, musicologia, performance e composio)
Semanalmente nos encontramos com o orientador aonde em especial a etnomusicologia por ela romper com os
ocorreu um processo alternado de composio e tutoria, padres de msicas eruditas da Europa e por ela definida
sendo que cada instrumento recebeu em mdia quatro como um campo de pesquisas em que o objetivo assenta-
semanas de ateno durante a composio das peas. Na se alm do mero conhecimento de msica. O outro aporte
pea de Flauta, trabalhei com multifnicos, num processo terico e metodolgico utilizado so as epistemologias
aonde o instrumentista apresentando gradualmente feministas que por sua vez os movimentos feministas tem
diferentes multifnicos, que em seguida so usados de como objetivo de subverter a ordem de quem sempre esteve
maneira mais direta. No caso da pea de Violo, o uso de no poder, homens, brancos, heterossexuais e responsvel por
Pizzicatos e Pizzicatos Bartk, ora intercalados entre si, ora toda cientificidades em que historicamente as mulheres no
transitando de um para o outro gradualmente. Finalmente na tiveram poder de fala e nem de escrita, e suas interseces
pea de Violoncelo o uso de Bow Angles, que so angulaes como gnero, relaes tnico-raciais, sexualidades, classes ,
no arco a fim de transitar no brao do instrumento, teorias queer entre outros.
navegando entre as variadas posies, indo de Sul Tasto a Sul
Ponticello. Com as peas prontas, a camada eletroacstica foi Palavras - chaves: Mulheres, Feminismos, Msica
adicionada individualmente por cada compositor, seguindo *******************************************************************
a orientao. Ao fim da pesquisa, com todos os materiais *******************************************
finalizados e entregues ao orientador, uma compilao foi
criada reunindo todos os insights, tcnicas, manuais e peas
com o objetivo de servir como catalogo e material de estudo Area: ARTES - MSICA
para instrumentistas interessados em tcnicas estendidas TRABALHO: INVESTIGAO DE PROCESSOS
e msica interativa. Essa compilao tambm vai estar
presente no site https://fermataweb.wordpress.com servindo DA PRTICA MUSICAL EM CONTEXTOS
como uma camada multimdia, facilitando o aprendizado COLETIVOS E INDIVIDUAIS: UM ESTUDO
dos instrumentistas interessados, contendo textos sobre as
tcnicas, vdeos de execuo, links para peas que utilizam SOBRE MEMORIZAO
as tcnicas, etc. Com isso, essa pesquisa espera ser de grande
utilidade tanto para compositores que querem se aprofundar Autor (es): JONATAS LEAL GONALVES SANTOS, DIANA
em novas sonoridades ou em maneiras funcionais de utiliz- SANTIAGO
las, tanto como instrumentistas que, conhecem o repertorio Resumo: A memorizao parte integrante da vida
e no dominam as tcnicas ou ainda esto a se aventurar profissional do msico, sendo mesmo obrigatria em
nesse universo que vai alm da idiossincrasia natural de seu determinadas situaes. Existe uma tendncia acadmica
instrumento. recente na rea da documentao dos processos de
Palavras - chaves: tcnica estentida, obra didtica memorizao dos msicos. Isso de grande importncia
prtica, pois contribui para formar uma imagem mais
******************************************************************* clara de algo que relevante tanto musical quando
******************************************* educacionalmente para milhares de msicos. Vrios estudos
foram desenvolvidos com msicos adultos, demonstrando
Area: ARTES - MSICA que utiliza na memorizao, uma mistura de cadeia de
associaes e memrias de contedo acessvel. Entretanto,
TRABALHO: FEMINARIA MUSICAL IV: h apenas um estudo que experimenta em iniciantes o
PROCESSOS CRIATIVOS, TROCA DE SABERES mtodo sistemtico de Roger Chaffin, decorrente das
pesquisas sobre memorizao com msicos especialistas
E VIVNCIAS POTICO-MUSICAIS na rea. Este projeto investigou, por meio de um estudo
exploratrio e de natureza mista (quali-quantitativa), como
Autor (es): BRUNA DOS SANTOS JESUS, LAILA ROSA estudantes de msica engajados em orquestras infanto-
juvenis de diferentes nveis de habilidade aprendem e
Resumo: Este trabalho tem como objetivo apresentara
memorizam na prtica individual. Portanto, este trabalho
todas as atividades da Feminaria Musical: grupo de
previu quatro etapas e pretendeu: contribuir para uma
pesquisa e experimento sonoros, que integra a linha de
melhor compreenso de como os msicos de conjuntos
pesquisa Gnero, Arte e Cultura no Ncleo de Estudos
instrumentais estuda e realiza atividades de memorizao
Interdisciplinares sobre as Mulheres (NEIM), vm realizando
individualmente e como seus processos de memorizao
diversas aes que articulam pesquisa e extenso, como
podem ser generalizados para o ambiente orquestral ou
encontros, oficinas, palestras, shows, bate-papos, gravaes
camerstico; compreender como se d o processo de
de vdeos, interlocues e vivencias potico-musicais de
auto-regulao e os procedimentos de memorizao em
cunho feminista, anti-racista, LGBT que incorporamos atravs
estudantes de msica engajados em orquestras infanto-
de performances dentro e fora da Universidade Federal
juvenis; testar a aplicao dos princpios da memorizao
da Bahia. As performances so trabalhadas com potencial
expert em estudantes de msica; e investigar como a
criativo atravs de lentes das epistemologias feministas,
memorizao compartilhada por meio do trabalho coletivo
que trazemos a subjetividade, como parte importante
em grupos instrumentais e, pela primeira vez, em orquestras
para pensar msica nos atos performticos. Os nossos atos
pode auxiliar o desenvolvimento musical individual. O Plano
so sempre voltados para uma problematizao sobre a

Congresso da UFBA 2017 | Caderno de resumos 21


de Trabalho prognosticava a realizao de entrevistas semi- mmica corporal e o drama rapsdico em processos de
estruturada com sujeitos escolhidos das orquestras estudadas. criao cnica, contemplado pelo Programa de Bolsas de
Devido a atrasos que independeram de nossa vontade, as Iniciao Pesquisa (PIBIC 2016-2017), sob a orientao
entrevistas no puderam ser realizadas. Em seu lugar, foram do prof. Dr. George Mascarenhas. A investigao aborda a
aplicados questionrios que delinearam o perfil da prtica explorao dos procedimentos de colagem e montagem
e das estratgias de memorizao dos sujeitos envolvidos. do drama rapsdico de Jean-Pierre Sarrazac em processos
ESTUDANTE PIBIC

Esperou, com isso, contribuir para a fundamentao terico- de criao cnica, a partir da explorao da mmica
prtica da pedagogia da memorizao musical. corporal dramtica de Etienne Decroux. A pesquisa
desenvolveu-se em torno do processo criativo que gerou
Palavras - chaves: Msica, memria, cognio o exerccio cnico A Sopa, simultaneamente um espao
******************************************************************* de experimentao/observao e resultado prtico da
******************************************* pesquisa. Como perspectiva metodolgica, utilizou-se
a prtica como pesquisa, na qual a experincia revela os
prprios caminhos da elaborao potica e crtico-reflexiva.
Area: ARTES - MSICA O trabalho foi realizado em associao com a estudante
TRABALHO: O ARQUIVO MUSICAL DA Iris Faria Barbosa, bolsista de iniciao artstica (PIBIARTES
2016/2017), com quem o exerccio foi construdo e tem sido
BANDA DA POLICIA MILITAR MAESTRO apresentado. Para sua elaborao, foram realizados, ainda,
WANDERLEY estudos dirigidos, levantamento bibliogrfico e treinamento
corporal e vocal. Dentre os resultados, destaca-se a aplicao
Autor (es): PAMELA BRANDAO, PABLO SOTUYO BLANCO dos procedimentos de colagem (como agrupamento de
imagens) e montagem (como descontinuidade temporal)
Resumo: A presente proposta, no mbito do projeto de na composio potica de A sopa. Em cena, os princpios
pesquisa PATRIMNIO MUSICAL NA BAHIA: A BANDA DE da mmica corporal e do drama rapsdico misturam-se
MSICA MAESTRO WANDERLEY DA POLICIA MILITAR DA a referncias pessoais e culturais, imaginrio e memrias,
BAHIA, tem por objetivo apresentar os resultados obtidos revelando elementos das teatralidades contemporneas
at o presente em torno do seu acervo de partituras e as (FERNANDES, 2010). A sopa compe-se de textos e imagens
aes nele iniciadas. Em termos histricos, sabe-se que a aparentemente desconexos, construdos ou selecionados
Banda de Msica Maestro Wanderley (em diante BMMW), pelas bolsistas-pesquisadoras, reagrupados em uma lgica
criada em 17 de setembro de 1849, hoje a terceira Banda expressiva que lhes confere outras possibilidades de
de Msica mais antiga em atividade no Brasil, a mais antiga interpretao. O exerccio tem como princpios bsicos a
em atividade no Estado da Bahia, a mais antiga Banda de colagem e montagem em todas as etapas criativas e em
Msica de carter Policial Militar do Brasil - fundada como seu resultado final. Finalmente, a pesquisa correlaciona
tal oficialmente e com registro; a segunda Banda de Msica poticas contemporneas com a mmica corporal dramtica,
do Brasil a fazer um registro sonoro, a primeira Banda de reafirmando suas possibilidades de insero e utilizao
Msica da Bahia a fazer gravao de msicas em 1917 na no tempo presente e em diferentes modos de composio
Casa Edison (primeira gravadora do Brasil), na cidade do cnica.
Rio de Janeiro; primeira Banda a realizar um concerto em
cima de um trio eltrico, no Porto da Barra, em Fevereiro Palavras - chaves: mmica corporal dramtica, colagem e
de 1994, para comemorar o aniversrio da Policia Militar montagem, criao cnica
da Bahia (PMBA). Nesse contexto, a pesquisa desenvolvida *******************************************************************
cujos resultados pretendemos apresentar, no discute apenas *******************************************
os aspectos quantitativos do repertrio musical histrico
e presente constante no seu acervo de partituras, mas
tambm pretende-se apresentar uma avaliao qualitativa Area: ARTES - TEATRO
da situao e condies do acervo, das medidas que esto TRABALHO: COM O ENDEREO NO BOLSO: A
sendo implementadas para o seu resgate, restauro e gesto
arquivstica, assim contribuindo para a sua preservao, por PRESENA DA PERSONAGEM ROMANA NO
fora da digitalizao e catalogao do mesmo. A norma a FILME ELES NO USAM BLACK-TIE.
ser utilizada para a catalogao do acervo a desenvolvida
no mbito do projeto RISM-Brasil e a ferramenta para Autor (es): LUSA DOMINGOS, PAULO HENRIQUE CORREIA
dita catalogao ser base de dados online do mesmo ALCNTARA
projeto. Para tanto, tem-se realizado, atualmente, a etapa
de fotografia dos documentos, a fim de, posteriormente, Resumo: Mediante apreciao e anlise do filme Eles No
edit-las para assim catalog-las. O processo vigente conta Usam Black-tie (1981), do cineasta brasileiro Leon Hirszman,
atualmente com mais de 150.000 fotos, completando mais baseado na pea teatral homnima do dramaturgo italiano
de 3000 obras. Gianfrancesco Guarnieri, escrita em 1955, destacar-se-
a personagem Romana, representada no filme pela atriz
Palavras - chaves: Patrimnio Histrico, Arcervo, Banda de Fernanda Montenegro. O roteiro foi adaptado da pea
Msica Maestro Wanderley por Hirszman e contou com grande colaborao de
******************************************************************* Guarnieri, inclusive em seus dilogos. O filme integra a lista
******************************************* dos100 melhores filmes brasileiros de todos os tempos
de acordo com a Associao Brasileira de Crticos de
Cinema(Abraccine). A curva dramtica da pelcula ergue-se
Area: ARTES - TEATRO sobre o conflito entre Otvio (representado no filme pelo
TRABALHO: A SOPA prprio Guarnieri) e Tio (Carlos Alberto Riccelli), pai e filho,
que integram a classe do operariado brasileiro do incio
Autor (es): VERIDIANA NEVES, IRIS BARBOSA FARIA da dcada de 1980, e cujos posicionamentos polticos os
ALMEIDA, GEORGE OLIVEIRA fazem divergir radicalmente. Tio, diante da notcia de que
sua namorada, Maria (Bete Mendes), est grvida, resolve
Resumo: Este trabalho apresenta os resultados da se empenhar para ter posio privilegiada na fbrica onde
pesquisa prtico-terica Rapsdia I: colagem e montagem, trabalha a fim de ter melhores condies de sustentar a
integrante do projeto O mimo rapsodo: dilogos entre a noiva e acriana, ao passo que a ameaa de uma greve se

22 Congresso da UFBA 2017 | Caderno de resumos


instaura. Otvio, pai de Tio, acredita na unio da classe cenas/conflitos sobre a questo da mulher trans, da violncia
trabalhadora em prol da reivindicao de direitos, sendo contra o feminino, da afirmao da sexualidade e desejo
a favor da greve. J Tio coloca seus prprios interesses na adolescncia, relaes homoafetivas, transtornos de
acima dos da classe a que pertence. nesse contexto que gnero na infncia, travestimento e performance drag etc.
est inserida Romana, objeto de estudo do artigo. Ela atua Todo o processo desde as leituras, reunies e ensaios com
como mediadora deste conflito. Utilizando-se da bagagem alunos e professores, se deu pelo interesse de tornar a

ESTUDANTE PIBIC
terica de Renata Pallottini (Dramaturgia- Construo do discusso pblica e mostrar de maneira performtica anseios
Personagem), de Etienne Souriau (As Duzentas Mil Situaes que permeiam vidas e constroem identidades diversas e
Dramticas) e de Cleise Furtado Mendes (As Estratgias do diversificadas - do cisgnero ao transgnero. O Ensejo maior
Drama), entre outras, analisar-se- a personagem Romana, consistia em evidenciar, a exemplo de Butler que: Quando o
sobretudo sob a perspectiva da funo dramatrgica status construdo do gnero teorizado como radicalmente
de rbitro, atrelando o exerccio dessa funo s outras independente do sexo, o prprio gnero se torna um artifcio
inerentes ao contexto da personagem no mbito familiar: a flutuante, com a consequncia de que homem e masculino
de esposa e me. Discorrer-se-, tambm, sobre as nuances podem, com igual facilidade, significar tanto um corpo
de Romana no que se refere ao exerccio da autoridade no feminino como um masculino, e mulher e feminino, tanto
lar, estabelecendo relao direta com o embate que permeia um corpo masculino como um feminino (BUTLER, 2003, p.
a tenso entre seu marido e filho. 28).
Palavras - chaves: Eles No Usam Black- ti, Personagem, Palavras - chaves: identidade gnero, dramaturgia
rbitro
*******************************************************************
******************************************************************* *******************************************
*******************************************
Area: ARTES - TEATRO
Area: ARTES - TEATRO TRABALHO: IDENTIDADES EM CENA
TRABALHO: HISTRIAS DELAS: QUESTES PROCESSOS DE CRIAO E MONTAGEM DA
DE GNERO? 2 PEA DA TRILOGIA SOBRE GNERO E
Autor (es): MARIANA DAS VIRGENS LIMA, ANTONIA IDENTIDADE
PEREIRA BEZERRA
Autor (es): DAIANE NASCIMENTO, ANTONIA PEREIRA
Resumo: O presente plano de trabalho, desdobramento do BEZERRA
projeto intitulado Memria, dramaturgia, dramaturgismo:
histria de vida como modelos de ao Fase III resultou Resumo: O presente plano de trabalho, desenvolvido
no espetculo Historias delas: Questes de gnero? a partir do projeto de pesquisa Memria, dramaturgia,
constituindo, assim, o segundo espetculo de uma trilogia dramaturgismo: histria de vida como modelos de ao -
sobre gnero e identidade. A estria teve lugar no dia 08 Fase III problematizou questes de Identidade e de Gnero,
de junho no Teatro Movimento onde permaneceu em com o propsito de interrogar, no palco, a noo de sujeito
cartaz at 17 de junho. Numa produo Cia de Estupor de e de subjetividade, bem como as diferenas advindas
Teatro, o processo e produtos finais foram construdos de de marcadores sociais e polticos vigentes na sociedade
forma colaborativa, interseccionando teatro e performance contempornea. De natureza terico prtica, o estudo
para, a partir das subjetividades e das memrias individuais envolveu leituras e anlises de texto, ancoradas nas teorias
das atrizes envolvidas no processo, discutir questes de de Stuart Hall, socilogo e importante terico cultural que
gnero e de identidade. Tal discusso trouxe para a pesquisa se debruou sobre a questo da identidade cultural na
questionamentos relevante no que diz respeito s nossas Ps Modernidade. Ao que se refere questo de Gnero,
identidades femininas, nas esferas pessoais e poltica. Foi trabalhou-se particularmente a partir dos ensaios da filsofa
por esse caminho que descobrimos a melhor maneira ps-estruturalista estadunidense Judth Bluter, uma das
de mostrar ao pblico histrias de vidas, compartilhadas principais referncias feministas da atualidade, entre outros
e ressignificadas em narrativa de fico, tendo com nomes de importncia para a pesquisa. O projeto teve como
eixo temtico as noes de gnero e de identidade; principal resultado o espetculo Histrias Delas: Questes
problematizando, ainda, a opresso, a dvida, o medo, o de Gnero? segunda pea de uma trilogia sobre Gnero e
desejo e o sexo como anseios que permeiam o imaginrio Identidade. A estria aconteceu no dia 08 de junho, no Teatro
feminino. A pesquisa da prof. Dr. Antnia Pereira Bezerra teve Movimento, localizado na Escola de Dana da UFBA, e ficou
como ponto de partida a memria em funo das vivncias em cartaz at o dia 17 de junho do ano corrente. Histria
nas quais a questo do gnero e da identidade constituam Delas... apresentou uma dramaturgia construda a partir da
problemas reais e conflitantes para as atrizes envolvidas no memria das atrizes envolvidas no processo e ancorada em
projeto. Nos encontros semanais, o debate sobre gnero leituras tericas, relatos e depoimentos que resultaram em
ancorou-se em autoras feministas, a exemplo de Judith cenas sobre opresses de gnero e de identidade. Opresses
Butler, Rita Laura Segato, Chimamanda Adichie, Heleieth que, no cotidiano, permeavam e condicionavam as relaes
Saffioti, entre outras. Sobre o conceito de Identidade, Stuart sociais e pessoais dessas atrizes. Com um olhar sensvel e
Hall e suas asseres acerca da existncia de uma crise atento, o espetculo revelou as subjetividades contidas em
das identidades na ps-modernidade tardia, nos foram de cada relato, demonstrando o quanto o pessoal tambm
extremo aporte. As oficinas de construo dramatrgica e poltico. Com coordenao e Direo da prof. Dr. Antnia
de trabalho corporal acentuaram a rememorao sensvel Pereira Bezerra, a produo de Histria Delas... alm da
de histrias de opresso, partindo antes do corpo para pesquisa terica pressups, ainda, pesquisas documentria
somente, ento, abordar a questo do gnero. O recurso e iconogrfica sobre o tema, lanando mo, tanto, de
ao Teatro Imagem Tcnica do Teatro do Oprimido de entrevistas, quanto de depoimentos de outros personagens
Augusto conduziu elaborao de cenas congeladas e que no apareciam em cena, mas que em algum momento
fotografadas pelas atrizes como ponto de partida para do processo estiveram conosco. Este projeto contou com
animar a imagem e dramatizar o conflito que a imagem/ a colaborao e orientao musical da prof. Dr. Laila
memria sugeria. Assim, na perspectiva de uma cena teatral Rosa, etnomusicloga e musicista, tambm docente da
expandida, discutimos gnero e identidade, apresentando universidade Federal da Bahia. Ao lado da Profa. Laila Rosa

Congresso da UFBA 2017 | Caderno de resumos 23


pudemos usufruir do trabalho da cantora e compositora dos bonecos). A minha pesquisa, portanto, se d no campo
Neila Kadhi, tambm bolsista de IC. Ambas as artistas, da dramaturgia para o teatro de formas animadas, neste
engajadas com as temticas abordadas no contexto desta caso, de bonecos e objetos, visando compreender melhor o
pesquisa, contriburam para configurao de um ncleo lugar destas formas animadas dentro de uma dramaturgia,
potente para realizao do espetculo. Minha participao, do ponto de vista das aes, da relao com os atores-
no contexto deste plano de trabalho, envolveu ainda, o animadores, da relao com a fala e do dilogo com a
ESTUDANTE PIBIC

desenvolvimento de atividades de produo e assistncia msica. Para tal, recorro alguns textos como: Aqui dentro,
na organizao de debates, reflexes acerca dos problemas no Quintal do Mundo, texto de Cleise Mendes para o livro
encontrados no texto escrito e suas possveis resolues/ Protocolo Lunar de Sonia Rangel, Os protocolos teatrais e
solues cnicas (performatividade Versus escrita dramtica, poticos de Sonia Rangel do autor Valmor Nni Beltrame
textos Versus encenaes). Teoricamente, o contato com as e presente no mesmo livro, artigos da revista MIN MIN
teorias de Stuart Hall, a constatao da emergncia de uma (Revista de teatro de formas animadas) e do livro Teatro de
suposta [...] crise de identidade na modernidade tardia, Animao de Ana Maria Amaral.
uma vez que as antigas e estveis identidades estariam em
declnio, o que culminaria na ascenso de novas identidades Palavras - chaves: Dramaturgia, Teatro de Animao
que apontam para a existncia de um sujeito moderno *******************************************************************
fragmentado, elucidou para mim problemticas que me *******************************************
afetam enquanto mulher, negra e feminista. Stuart Hall
prope-se a explorar as questes acerca da identidade, a
fim de avaliar se, realmente, existe uma crise de identidade, Area: ARTES - TEATRO
considerando o conceito de identidade complexo, mas TRABALHO: OFICINAS DE FORMAS
alertando que isso no impede de formular discusses e
suscitar a reflexo em torno da ideia de que as identidades ANIMADAS: ARGUMENTO CONCEITUAL E
esto sendo descentradas, ou seja, deslocadas, fragmentadas. PROPOSTA PEDAGGICA DE OFICINAS
Nesse contexto, a pesquisa terica, o processo e o produto
artstico final ao explorar uma dramaturgia da memria, fruto A SEREM MINISTRADAS EM ESPAOS
das reminiscncias das vivncias das atrizes corroborou em EDUCACIONAIS A PARTIR DA EXPERINCIA
mim a ideia de que: A identidade s se torna uma questo
quando est em crise, quando algo que se supe como fixo, COMO ATOR/ATRIZ-EDUCADOR/RA DO
coerente e estvel deslocado pela experincia da dvida e GRUPO DE TEATRO OS IMAGINRIOS.
da incerteza. (Mercer, 1990.) Palavras-Chave: Dramaturgia,
Opresso, Identidade, Gnero, Memria Autor (es): SONIA LUCIA RANGEL, FLORA SANTANA ROCHA
Palavras - chaves: Dramaturgia, Identidade, Gnero SALES

******************************************************************* Resumo: Ingressei no Grupo de Teatro Os Imaginrios


******************************************* em 2015.1, surgindo o PIBIC e o incio de um projeto de
pesquisa que segue abarcando e enriquecendo minha
experincia acadmica. Meu primeiro plano de trabalho
Area: ARTES - TEATRO (PIBIC 2015/2016) consistia na construo de bonecos a
TRABALHO: DO TEXTO CNICO AO TEXTO serem utilizados em cena e em sala de aula. Os processos
criativos do grupo Os Imaginrios so compartilhados e
DRAMTICO: DIRIOS DE PERCURSO todos os componentes do grupo vivenciam cada etapa
COMO REGISTRO PROTOCOLAR DE CENAS (pesquisa, construo, criao cnica, preparao corporal,
etc.). O novo plano de trabalho foi criado no intuito de
E ENSAIOS VISANDO COLABORAR COM A levar adiante o conhecimento tcnico acerca do Teatro
ESCRITA DO TEXTO DRAMTICO DO QUARTO de Formas Animadas. A partir de uma fundamentao
terico-metodolgica e da experincia enquanto estudante-
ESPETCULO DO GRUPO DE TEATRO OS pesquisadora-atriz no grupo pretende-se ofertar oficinas em
IMAGINRIOS situaes de ensino formal ou no formal. Dentro do meu
atual plano de trabalho do PIBIC realizei uma prtica de
Autor (es): SONIA LUCIA RANGEL, ELISA ALMEIDA estgio na Escola Municipal Vale das Pedrinhas (oficina de
teatro de animao com materiais alternativos), no CEEBA; e
Resumo: Considerando a continuidade dos trabalhos atualmente desenvolvo um estgio no Caps. Cada universo
realizados no grupo de teatro Os Imaginrios, incluindo destes exige uma adaptao de exerccios para o pblico em
debates, leituras dirigidas, laboratrios de criao cnica, especfico. Como experincia mais recente e central deste
mostras de cena com atores e estratgias do teatro de semestre teve a criao do espetculo Protocolo Cidade,
animao: O meu plano de trabalho se trata da pesquisa pelo grupo Os Imaginrios. Trata-se de um espetculo-
acerca da dramaturgia no teatro de formas animadas e do exposio de Sonia Rangel, em criao colaborativa e que
registro de cenas durante o processo de criao e ensaios, o ficou em curta temporada (10 sesses) no Teatro Martim
que resultou no registro de cenas de bonecos e objetos a fim Gonalves. O processo de criao se deu de forma coletiva,
de colaborar com o texto dramtico, do quarto espetculo e estive inserida como Atriz, Atriz-animadora, pesquisadora
do grupo Os Imaginrios intitulado Protocolo Cidade e e futura educadora. Busquei a todo o momento investigar-
apresentado no Teatro Martim Gonalves. Protocolo Cidade me dentro deste processo, para posteriormente sistematizar
ficou em cartaz entre os dias 12 e 16 de julho de 2017 e prticas a serem ensinadas a partir da minha experincia
foi definido como espetculo-exposio por se tratar de como atriz e atriz-animadora. Para tal, recorro a referncias
uma linguagem hbrida, abarcando artes-visuais (atravs como Teatro de Animao de Ana Maria Amaral, Teatro
de projees e pintura ao vivo), cenas de atores, cenas de formas animadas na sala de aula: um recurso pedaggico
de bonecos, cenas mistas e msica ao vivo. Inserida no para o desenvolvimento do ensino de Teatro de Elivania
processo como atriz, atriz-animadora e pesquisadora, minha Lino e tambm os livros Trajeto Criativo e Protocolo Lunar
investigao se deu com foco na dramaturgia para o teatro da minha professora orientadora Sonia Rangel.
de formas animadas, o que resultou no roteiro de cenas
e aes dos personagens-boneco e personagens-objeto Palavras - chaves: Processo Criativo, Teatro de Animao
(composto principalmente de rubricas descritivas das aes

24 Congresso da UFBA 2017 | Caderno de resumos


******************************************************************* definio de Sbato Magaldi. A obra trata de um bicheiro
******************************************* nascido numa pia de gafieira, uma figura quase grotesca
que mandou arrancar todos os dentes para substitu-los por
dentes de ouro. Ao longo do texto sua histria contada
Area: ARTES - TEATRO
em trs verses dadas por sua examante Guigi que envolve
TRABALHO: UM DISCURSO VISUAL A os assassinatos e adultrios cometidos por Bocaat o

ESTUDANTE PIBIC
SETE LGUAS: UMA PERSPECTIVA DE esclarecimento de sua prpria morte. O filme, sustentado
pela carpintaria teatral rodrigueana, indicou umrecorte
ANLISE VISUAL DO FILME O PAGADOR DE que destacou as personagens Guigui eCeleste, partindo
PROMESSAS dealgumas perguntas mote para a anlise, tais como:
Comoas personagensso representadas fisicamente, tanto
na escolha das atrizes quanto nas demais caracterizaes
Autor (es): PAULO HENRIQUE CORREIA ALCNTARA, estticas?; Como possvel fazer uma breve anlise da
MARCOS LEONARDO TELES MACEDO insero social feminina no contexto da obra que data de
Resumo: Um homem humilde, vindo do interior baiano, 1963?. Tais questes funcionam como base maior para
tenta cumprir uma promessa feita a Santa Brbara (Ians), o desenvolvimento do artigo. Pouco foi abordado sobre
por ter a mesma livrado seu burro da morte aps um a representao da mulher no cinema sob o ponto de
acidente com raio. Este homem, em companhia da sua vista feminino/feminista, por isso, opta-se, aqui, por uma
mulher, chega ao seu destino carregando uma cruz maior bibliografia de apoio escrita por mulheres. Assim, o trabalho
que seu corpo, como smbolo de sacrifcio, e depara-se com baseia-se nas abordagens da representao feminina
a negativa de quem poderia concretizar sua promessa, um e teoria feminista do cinema desenvolvidas por Giselle
padre. A persistncia e a no concesso do protagonista Gubernikoff, em conjunto com o livro A Mulher e o cinema
frente ao radicalismo religioso do lder cristo acaba Os dois lados da cmera, de AnnKaplan. A partir das
custando a sua vida. Essa trama delineada por Dias Gomes leituras de Gubernikoff, o artigo tambm se aprofunda no
em O Pagador de Promessas (1960), tendo como pano de trabalho do diretor Nelson Pereira dos Santos. Ao priorizar
fundo a colonial cidade de Salvador. O escopo da obra o protagonismo feminino tanto nos objetos de anlise,
apresenta uma tenso entre a cristalizao de convenes quanto nas escolhas bibliogrficas compreende-se que
ideolgicas, neste caso, representada pela figura do padre, e possvel enriquecer os carentes e emergentes estudos das
a pluralidade e dinmica cultural que a Bahia aporta como questes de gnero no Brasil.
o candombl e outras manifestaes populares. Desta Palavras - chaves: Feminismo, Cinema, Nelson Pereira dos
tenso emergem outras particularidades que classificam esta Santos
dramaturgia como um modelo exemplar de tragdia clssica.
A premiada produo cinematogrfica, dirigida e roteirizada *******************************************************************
por Anselmo Duarte (1962), considerada como uma das *******************************************
obras mais representativas do cinema brasileiro no mundo
ser o objeto de anlise neste estudo. Do ponto de vista que Area: ARTES - TEATRO
compreende a visualidade e seus elementos constituintes,
a luz da pesquisa desenvolvida por Adriana Vaz Ramos TRABALHO: VALORIZAO DA IDENTIDADE:
(2013) sobre a visualidade e aparncia de atores em cena,
juntamente com a perspectiva de anlise da personagem
UMA EXPERINCIA POLTICO-
na dramaturgia e seus cdigos de caracterizao presentes PEDAGGICA NA AULA DE TEATRO NA
nos estudo da pesquisadora Renata Pallottini (2013). Sero
analisados sete aspectos da semiosfera visual do filme e
EDUCAO PBLICA
a sua colaborao na construo do discurso presente na
obra. Este caminho de anlise busca identificar composies Autor (es): CASSIUS FABIAN COSTA SOUZA, CLIDA
imagticas e seus cdigos em dilogo com o discurso textual, SALUME MENDONA
ampliando o campo de percepo sensvel da obra, alm Resumo: O projeto intitulado Identidade sobre o ns em
de situar a importncia da mesma enquanto referncia para cada um desenvolvido atravs do Programa Institucional
o estudo de visualidades cnicas e seus mecanismos de de Iniciao Docncia (PIBID), realizado no perodo de
reproduo e significao cultural. fevereiro a Junho de 2017, na Escola municipal So Braz,
Palavras - chaves: visualidade, discurso, dramaturgia localizada no bairro de Plataforma, subrbio ferrovirio
de Salvador, com crianas de 5 a 8 anos, da disciplina de
******************************************************************* teatro, do ensino fundamental I. As atividades desenvolvidas
******************************************* tiveram com enfoque prticas teatrais que desenvolveram
por meio da ludicidade, jogos teatrais e expressividade, o
empoderamento dos (as) discentes criando possibilidades
Area: ARTES - TEATRO
para ampliar a sua conscincia crtica e (re) conhecer
TRABALHO: UM OLHAR FEMININO SOBE O os elementos da sua identidade sociocultural por meio
CINEMA A REPRESENTAO DA MULHER da histria e da memria. Com base na aplicao da lei
11.645/08 sobre o ensino da cultura afro-brasileira nas
NO FILME BOCA DE OURO escolas, e problematizao sobre os papis de gnero
construdos socialmente, buscou-se o fortalecimento da
Autor (es): PAULA LETCIA BIANCHI, PAULO HENRIQUE identidade dos/as educando para enfrentar s opresses
CORREIA ALCNTARA e a realidade desigual. O educador Tsunessaburo Makiguti
cita o seguinte: Em resumo, a comunidade o mundo
Resumo: A obra teatral Boca de Ouro (Nelson Rodrigues, em miniatura. Se encorajarmos as crianas a observar as
1959) foi adaptada em duas verses para o cinema: sob complexas relaes entre as pessoas e a prpria Terra, entre
a direo de Nelson Pereira dos Santos (1963) e Walter a natureza e a sociedade, elas sero capazes de compreender
Avancini (1990). A presente pesquisa vem analisando a a realidade do lar, da escola, da vizinhana ou localidade
representao das personagens femininas na transposio onde vivem e, assim, podero entender o mundo em toda
do texto teatral para o audiovisual pelas lentes de Nelson sua vastido. A educao direcionada da formao do
Pereira dos Santos. Boca de Ouro uma pea em trs atos, carter uma habilidade transcendente e, por isso, a melhor
pertencente ao grupo das tragdias cariocas segundo

Congresso da UFBA 2017 | Caderno de resumos 25


denominao para ela seria arte. Todos so igualmente Area: BIOTECNOLOGIA
estudantes. Do ponto de vista da educao, que diferena
poderia haver entre eles e os outros? Embora possam estar TRABALHO: ATIVIDADE ENZIMTICA E
cobertos de p ou sujeira, o brilho da vida irradia de suas ANTIFNGICA DE BIOATIVOS DE FUNGOS
roupas encardidas. Por que ningum tenta enxergar isso? O
professor tudo que existe entre eles e a cruel discriminao ENDOFTICOS ASSOCIADOS MANILKARA
ESTUDANTE PIBIC

da sociedade. (IKEDA, Daisaku Educao Soka). E, dessa SALZMANNII, PLANTA DA RESTINGA DE


forma foram desenvolvidos diversos aspectos na construo
identitria scio-artstico-educacional nessa relao. SALVADOR, BA.
Palavras - chaves: Teatro, Identidade, gnero Autor (es): GENZIO UILIAN COSTA OLIVEIRA, JOS
******************************************************************* RAIMUNDO FERREIRA PINTO, MAILANA CERQUEIRA
******************************************* ANUNCIAO, SAMIRA ABDALLAH HANNA
Resumo: Os fungos formam um complexo grupo de
Area: BIOTECNOLOGIA organismos presentes nos mais diversos habitats terrestres
e aquticos, e so produtores de metablitos secundrios,
TRABALHO: ASSOCIAO DE pigmentos, biomateriais, frmacos, precursores para
POLIMORFISMOS NO GENE DENND1B sntese ou semi-sntese de medicamentos diversos, como
antibiticos, antifngicos, antitumorais, antidepressivos,
COM ASMA E ATOPIA EM CRIANAS imunossupressores etc. Entre os fungos, encontram-se
BRASILEIRAS espcies denominadas endofticas, que colonizam o interior
de tecidos vegetais sadios (habitat ecolgico praticamente
Autor(es): BIANCA SAMPAIO DOTTO FIUZA, MILCA SILVA, inexplorado) e compartilham do ciclo de vida vegetal.
NEUZA MARIA ALCNTARA - NEVES, RYAN DOS SANTOS Os fungos endofticos podem apresentar mecanismos
COSTA, CAMILA ALEXANDRINA VIANA DE FIGUEIREDO fisiolgicos e genticos, importantes para a interao com
a planta e tambm como potenciais para a produo de
Resumo: A asma uma doena heterognea associada metablitos ativos com aplicao industrial, na medicina
a uma base complexa envolvendo fatores ambientais e e na agropecuria. Metablitos secundrios de fungos
variabilidades individuais. O gene DENND1B tem um papel endofiticos so particularmente ativos, possivelmente
importante na regulao negativa do receptor de clulas T devido s interaes metablicas com seus hospedeiros. A
(TCR) em clulas Th2 e estudos tm mostrado que mutaes bioprospeco consiste na explorao e investigao de
ou perda deste fator podem estar associadas com respostas plantas, animais e micro-organismos a fim de identificar
Th2 aumentadas e asma. Estudos mostram que o DENND1B genes, protenas e compostos ativos com atividade especfica,
um gene de suscetibilidade asma, como demonstrado para serem utilizados como produtos ou bioprocessos
em estudo de ampla varredura genmica (GWAS) de 2010, em diferentes reas da indstria farmacutica, alimentcia,
em que dois loci no cromossomo 1q31 e o 17q21 foram agropecuria, txtil entre outras. A Manilkara salzmannii,
significativamente associados com asma em indivduos com conhecida como maaranduba, possui importncia
ancestralidade europeia. O objetivo deste trabalho avaliar econmica considervel, devido aos frutos comestveis,
a associao de polimorfismos no DENND1B com fentipos qualidade da madeira e ltex, podendo ser usada na
de asma e marcadores de alergias em crianas brasileiras. A medicina popular e ornamentao. Em um trabalho anterior,
genotipagem foi realizada utilizando um painel comercial da iniciou-se a bioprospeco de fungos endofticos isolados
Illumina (2.5 Human Omni bead chip) em 1.309 participantes desta planta, assim como o potencial antimicrobiano dos
do programa SCAALA (Social Change, Asthma, Allergy in compostos bioativos dos extratos orgnicos. Das folhas
Latin American - Mudana Social, Asma e Alergia na Amrica sadias de Manilkara salzmannii, coletada nas Dunas do
Latina). Regresses logsticas para asma e marcadores de Parque de Ipitanga, rea de Restinga de Salvador BA, foram
atopia foram realizadas usando o software PLINK 1.9. As isolados vrios fungos, mas uma espcie, Lophiostoma
anlises foram ajustadas para sexo, idade, infeces por sp, produziu compostos com atividade antimicrobiana
helmintos e marcadores de ancestralidade. Polimorfismos no frente s bactrias e leveduras patognicas, incluindo-se
gene DENND1B foram associados a diferentes fentipos, tais Staphylococcus aureus, Corynebacterium pseudotuberculosis
como asma e sua gravidade, produo de IgE especfica, teste e Candida albicans. Na primeira fase deste trabalho
cutneo e produo de IL-13. Dentre os 166 SNP analisados, pretendeu-se reproduzir os resultados de isolamento e
72 estavam associados a marcadores de asma e/ou alergias. avaliar as biomolculas, assim como iniciar a caracterizao
Em concluso, polimorfismos no gene DENND1B foram qumica dos bioativos. Foram isoladas 21 colnias, agrupadas
associados com asma e marcadores de alergia na populao em quatro gneros, sendo Lophiostoma sp (referido
avaliada, e podem influenciar o status da asma e/ou atopia, como C2C3) o isolado predominante. Foram preparados
tanto aumentando a susceptibilidade do indivduo em ter extratos metablicos e bioensaios. Dentre os resultados dos
a doena quanto diminuindo este risco. Ademais, este foi bioensaios de antagonismo por cultura pareada, o resultado
o primeiro trabalho a demonstrar associao do gene com mais expressivo foi com relao ao isolado C2C3, que
asma de perfil no atpico, mostrando, assim, a necessidade apresentou atividade antagonista frente a todos os fungos
de identificar por que o DENND1B regula especificamente a testados, como cepas ATCC de fitopatgenos: Alternaria
produo de citocinas efetoras Th2, mas no a produo de alternata, Aspergilus nger, Rhizopus microsporus, Fusarium
citocinas efetoras Th1 ou Th17. oxysporum e Fusarium solanni; patgeno vegetal e humano:
Aspergilus flavus; e patgenos humanos: Microsporum
Palavras-chaves: Asma, Polimorfismo, DENND1B
gypseum, Trichophyton mentagrophytes e Trichophyton
******************************************************************* rubrum. Aps estes ensaios, foi realizado ensaio fungicida,
******************************************* pelo mtodo do ndice de inibio do crescimento, onde
o extrato, puro, de C2C3 foi altamente eficiente em inibir
o crescimento de Fusarium solani e Alternaria alternata e
mesmo a 5% de extrato, houve inibio da maior parte dos
fragmentos viveis de ambos fitopatgenos; o extrato de
C2C1, Aspergillus sp, at 5%, inibiu 36% dos fragmentos
viveis de F. solani. Isolados de Lophiostoma sp apresentaram

26 Congresso da UFBA 2017 | Caderno de resumos


atividade fungicida e fungisttica superior s outras espcies desenvolvimento de novas drogas antimicrobianas, alm do
isoladas. Dentre os metablitos do isolado C2C3 foi potencial emprego de enzimas microbianas na indstria.
detectado e isolado um composto (pigmento) vermelho
que esta sendo identificado e caracterizado. Os estudos Palavras-chaves: Manilkara salzmannii, endofticos, enzima
realizados colaboram com a investigao da diversidade e *******************************************************************
provvel prevalncia de um gnero entre fungos associados *******************************************

ESTUDANTE PIBIC
aos vegetais de ambientes extremos e aponta claramente
para novas perspectivas sobre o potencial que os fungos
endofticos representam para a biotecnologia. Area: BIOTECNOLOGIA
Palavras - chaves: fungo, Endofitico, Bioativo
TRABALHO: AVALIAO DA ASSOCIAO
*******************************************************************
DE POLIMORFISMOS NO GENE IL17A
******************************************* SOBRE OS DIFERENTES FENTIPOS DE
ASMA, INCLUINDO ASMA RESISTENTE
Area: BIOTECNOLOGIA AO GLICOCORTICIDE, EM PACIENTES
TRABALHO: ATIVIDADE ENZIMTICA DE ACOMPANHADOS PELO PROAR
BIOATIVOS DE FUNGOS ENDOFTICOS
ASSOCIADOS MANILKARA SALZMANNII, Autor (es): ROBERTA PEREIRA ESPINHEIRA, MILCA SILVA,
MARIA BORGES RABELO DE SANTANA, ALVARO CRUZ,
PLANTA DA RESTINGA DE SALVADOR, BA. CAMILA ALEXANDRINA VIANA DE FIGUEIREDO, RYAN DOS
SANTOS COSTA
Autor (es): JOS RAIMUNDO FERREIRA PINTO, MAILANA
CERQUEIRA ANUNCIAO, GENZIO UILIAN COSTA Resumo: Asma uma doena inflamatria crnica resultante
OLIVEIRA, SAMIRA ABDALLAH HANNA da interao de fatores genticos e ambientais. Existem
diversos endofentipos relacionados a essa doena, que
Resumo: Fungos endofticos representam uma fonte rica podem influenciar na gravidade e na resposta ao seu
de produtos naturais novos e bioativos. Eles colonizam tratamento. Estudos j reportam que uma subpopulao de
um habitat ecolgico praticamente inexplorado e seus clulas TCD4+, os linfcitos TH17 que produzem ciocinas
metablitos secundrios so particularmente ativos, IL-17, possui um papel na inflamao da asma. Para o
possivelmente devido s interaes metablicas com controle da inflamao e da exacerbao os glicocorticoides
seus hospedeiros. Manilkara salzmannii, conhecida como so os frmacos mais utilizados, porm, subgrupos de
maaranduba, possui importncia econmica considervel, pacientes asmticos podem desenvolver asma resistente
devido aos frutos comestveis, qualidade da madeira e ltex, aos glicocorticoides. Estudos j mostraram evidncias
podendo ser usada na medicina popular e ornamentao. que correlacionam essa condio com as citocinas
Em um trabalho anterior, objetivou-se a bioprospeco Th17. Polimorfismos de nucleotdeo nico (SNPs) so as
de fungos endofticos isolados desta planta, assim como variantes no genoma mais comuns e so responsveis
o potencial antimicrobiano dos compostos bioativos dos por diferenas fenotpicas entre indivduos. Muitos SNPs
extratos orgnicos. Das folhas sadias de Manilkara salzmannii, j foram identificados nos genes IL17 principalmente nos
coletada nas dunas do Parque de Ipitanga - UNIDUNAS, IL17A e IL17F. Nosso objetivo foi investigar a potencial
rea de Restinga de Salvador BA, foram isolados vrios associao entre polimorfismos no gene IL17A com os
fungos, mas uma espcie produziu compostos com atividade diferentes fentipos da asma, principalmente a resistente
antimicrobiana frente s bactrias patognicas e leveduras. ao glicocorticoide. Mtodos: Os SNPs rs227591 e rs3819024
Tcnicas moleculares evidenciaram o gnero Lophiostoma do gene IL17A foram genotipados utilizando amostras de
sp. Em outros ensaios, foi evidenciado atividade antifngica DNA de 1.446 indivduos provenientes do PROAR (Programa
nos extratos de Lophiostoma sp. e em outros endofticos. Para o Controle da Asma e da Rinite Alrgica), usando a
Neste projeto, objetivou-se a deteco de enzimas nos tecnologia TaqMan probe- based 5-nuclease. Regresso
extratos dos fungos endofticos, previamente selecionados logstica e linear para funo pulmonar, marcadores de
em funo de seus resultados anteriores. Foram testados 3 atopia e resposta ao glicocorticoide foram feitas utilizando
fungos isolados de Manilkara salzmannii, ambos do gnero PLINK software 1.7, em trs modelos genticos, ajustados
Lophiostoma sp. Os testes foram realizados em meio de para sexo, idade e cor da pele auto-referida. Funes
cultura slidos especfico para cada grupo de enzima. A regulatrias afetadas pelos SNPs foram analisadas usando
atividade enzimtica foi expressa como ndice enzimtico as plataformas rSNPbase e SNPeffect3D. Tambm foi
(IE), mediante a relao do dimetro mdio do halo de observada in silico a expresso gnica em tecidos atravs
degradao e o dimetro mdio da colnia, aps cinco dias do Gtex, e o desequilbrio de ligaco foi analisado a partir
de incubao em estufa de crescimento a 29C. A partir do Haploview 4.2. Resultados: O alelo G do rs3819024 foi
da metodologia executada neste trabalho, conclui-se que negativamente associado com a falha do controle da asma
dos microrganismos testados quanto ao potencial para a num modelo recessivo (OR: 0.43; CI: 0.22-0.93). Este SNP
produo das enzimas amilases, celulases, lipases e proteases diminui a expresso gnica em clulas do fibroblasto, e est
apresentaram potencial enzimtico (IE 2,00). Todos os trs envolvido numa regulao mediada pela ligao de RNA.
fungos apresentaram potencial enzimtico positivo para Alm disso, o rs3819024 reduz a estabilidade do produto
a produo de mais de uma enzima. Os microrganismos proteico. Concluso: Foi observado nesse estudo que a
testados diferiram quanto ao potencial enzimtico mesmo variante gentica no gene IL17A pode levar proteo do
pertencente ao mesmo gnero. Dentre os isolados testados controle da asma atravs da interferncia das respostas aos
os fungos que apresentaram os maiores ndices enzimticos glicocorticoides. Mais estudos so necessrios para esclarecer
foram C1C2 e C2C4 para atividade amiloltica, C2C3 as funes dos SNPs nos genes da famlia da IL-17 e os
para atividade celulottica. Os resultados obtidos neste impactos na resistncia aos glicocorticoides.
estudo contribuem para o conhecimento do potencial
biotecnolgico da micota endoftica da Manilkara salzmannii, Palavras-chaves: Asma, Glicocorticoide, IL17A
planta da Reestinga de Salvador, Bahia. Estes fungos podem *******************************************************************
representar uma fonte promissora de metablitos para o *******************************************

Congresso da UFBA 2017 | Caderno de resumos 27


Area: BIOTECNOLOGIA de grande importncia socioeconmica, cultivada
principalmente no semirido do Nordeste brasileiro,
TRABALHO: BIORREFINARIA E LQUIDOS onde comumente submetida a condies de restrio
INICOS: UMA ABORDAGEM TECNOLGICA hdrica. A germinao de sementes de mamona segue um
padro trifsico de embebio (Fases I, II e III) em que so
PROMISSORA PARA O DESENVOLVIMENTO demandadas quantidades especficas de gua em cada
ESTUDANTE PIBIC

DE UM BIOPROCESSO SUSTENTVEL fase de embebio (Fases I e II) at que ocorra a protruso


radicular, ou germinao per se (Fase III). Por sua vez, a
Autor(es): BRENDA CARVALHO MUELLER, LARA QUEIRS germinao ocorre sob demanda de energia, geralmente
SATURNINO SILVA, ANA VERENA PORTO LIMA XAVIER, obtida a partir do metabolismo e quebra de carboidratos
SANDRA CERQUEIRA PEREIRA de reserva como processo fundamental para a sntese de
novas biomolculas necessrias germinao e crescimento
Resumo: Os Lquidos Inicos Prticos (LIPs), sais orgnicos inicial da nova plntula. Os carboidratos so armazenados
biodegradveis, atxicos e de baixo custo, tm propriedades principalmente nos cotildones de sementes de mamona, de
fsico-qumicas e caractersticas interessantes, que tornam onde so mobilizados a partir do metabolismo energtico
esse material uma alternativa promissora aos mtodos de respiratrio para a multiplicao celular e formao de novos
pr-tratamento da biomassa lignocelulsica atualmente tecidos e rgos, como parte do processo de organognese e
empregados. Com isso, neste trabalho foi realizado o pr- desenvolvimento da jovem plntula. O objetivo do trabalho
tratamento do bagao da cana-de-acar com dois LIPs foi estudar a mobilizao de carboidratos solveis totais em
e a posterior hidrlise enzimtica do bagao pr-tratado cotildones de sementes de dois gentipos (PARAGUAU e
utilizando Celulose Microcristalina (CMC), com o intuito MPA34) submetidos embebio sob condies de restrio
de avaliar dois parmetros: carga de slidos, teor de gua hdrica. Foram analisadas sementes secas (no embebidas),
no meio de incubao. Assim, partiu-se dos LIPs baseados e sementes embebidas por 12, 24 e 40 horas em gua (0,0
no cido actico, justamente, porque os lquidos inicos MPa) e em polietileno glicol (PEG, -1,0 MPa). A determinao
aprticos (LIAs) reportados na literatura para tal fim so dos carboidratos foi feita pelo mtodo colorimtrico de
acticos. A ttulo de comparao foram preparadas trs Antrona, que se baseia na ao hidroltica e desidratante do
amostras: celulose microcristalina in-natura (CMC-IN), cido sulfrico sobre os carboidratos. Foi possvel observar
celulose microcristalina pr-tratada com 2-HEAAc (CMC-PT- que no houve mudana na concentrao de carboidratos
MEA) e celulose microcristalina pr-tratada com 2-HDEAAc durante a embebio das sementes em ambos os gentipos.
(CMC-PT-DEA). Como previsto inicialmente, o resultado De acordo com resultados anteriores, a germinao das
do rendimento do pr-tratamento mostrou uma alta sementes dos gentipos em questo tem incio aps 48
recuperao de slidos em ambas as amostras e isso indica horas de embebio. Dessa forma, at 40 horas as sementes
que no h degradao de celulose, evidenciando, assim, o ainda se encontram em fase de ativao do metabolismo
alto potencial dos LIPs para pr-tratar CMC. Foram feitas pr-germinativo (Fases I e II), de modo que a mobilizao
anlises por Difrao de Raios-X (DRX) para o clculo do de carboidratos pode ainda no ter sido iniciada.
ndice de Cristalinidade (ICr, %) das amostras antes e aps o Alternativamente, e por ser uma espcie de sementes
pr-tratamento padro e o clculo da recuperao de slidos oleaginosa, possvel que a mobilizao energtica ocorra
e anlises no espectrofotmetro dos hidrolisados obtidos, essencialmente a partir das reservas de lipdeos que
visando quantificar a glicose liberada na sacarificao predominam no endosperma das sementes de mamona.
enzimtica, para a obteno da converso. Os dados
obtidos a partir da anlise por DRX relataram uma menor Palavras-chaves: Ricinus communis L. Restrio hdrica,
cristalinidade da amostra CMC-PT-DEA, seguida pela CMC- Carboidratos
IN e pela CMC-PT-MEA. Os valores de ICr (%) mostram que *******************************************************************
o 2-HDEAAc foi capaz de reduzir a cristalinidade do material, *******************************************
mesmo em uma magnitude pequena de eficincia. O
contrrio foi observado para o 2-HEAAc. Essas observaes
podem ser resultantes de condies mais brandas de pr- Area: BIOTECNOLOGIA
tratamento. Os resultados mostraram que, em todas as TRABALHO: ANLISE FILOGENTICA
anlises, os LIPs foram efetivos na etapa de pr-tratamento,
demonstrando seu alto potencial no processo. COMPARATIVA RCLEA X ATLEA E
Palavras-chaves: Lquidos inicos prticos, Bioprocesso
EXPRESSO GNICA DE PROTENAS
*******************************************************************
ABUNDANTES NA EMBRIOGNESE
******************************************* TARDIA (LEA) EM SEMENTES DE MAMONA
SUBMETIDOS A RESTRIO HDRICA
Area: BIOTECNOLOGIA
TRABALHO: CARACTERIZAO BIOQUMICA Autor(es): TALITA ANDRADE DA ANUNCIAO, RENATO
D. DE CASTRO, LUZIMAR GONZAGA FERNANDEZ, MARTA
DA MOBILIZAO DE CARBOIDRATOS EM BRUNO LOUREIRO, GABRIEL JOALEY BORGES PEREIRA,
SEMENTES DE MAMONA SUBMETIDAS VLADEMIR SILVA, DANIELE TAKAHASHI BERNAL, BIANCA
BOMFIM ANDRADE, VALDIR NETO, PAULO ROBERTO
A EMBEBIO E GERMINAO SOB RIBEIRO
CONDIES DE RESTRIO HDRICA Resumo: A mamona (Ricinus communis L) uma espcie
oleaginosa pertencente famlia Euphorbiaceae. O leo
Autor(es): BIANCA BOMFIM ANDRADE, VALDIR NETO, extrado das sementes de mamona possui caractersticas
TALITA ANDRADE DA ANUNCIAO, GABRIEL JOALEY nicas com aplicaes nas indstrias de qumica fina,
BORGES PEREIRA, DANIELE TAKAHASHI BERNAL, PAULO farmacutica, dentre outras. Trata-se de uma espcie
ROBERTO RIBEIRO, MARTA BRUNO LOUREIRO, LUZIMAR comumente cultivada por agricultores familiares no
GONZAGA FERNANDEZ, RENATO D. DE CASTRO semirido nordestino, regio que sofre bastante com
perodos de seca, o que pode comprometer a germinao
Resumo: A mamona, Ricinus communis L., uma espcie
e o subsequente desenvolvimento das plntulas e da planta
de planta oleaginosa pertencente famlia Euphorbiaceae

28 Congresso da UFBA 2017 | Caderno de resumos


adulta como um todo. As clulas vegetais geralmente ativam campos, no litoral e na beira das estradas. O fungo cresceu
mecanismos protetores quando em condies de estresses em caldo Sabouraud Dextrose para extrao dos compostos
abiticos. As protenas conhecidas como abundantes na a serem analisados. E atravs da reviso bibliogrfica
embriognese tardia (LEA), e que geralmente se acumulam feita foi constatado que a maioria dos trabalhos utiliza o
no final da embriognese e maturao de sementes solvente acetato de etila para realizar a extrao liquido-
ortodoxas, fazem parte dos mecanismos protetores, sendo liquido de compostos bioativos de fungos. E por isso, esse

ESTUDANTE PIBIC
responsveis por proteger a membrana plasmtica em foi o solvente e o mtodo utilizado para fazer a extrao.
situaes de estresses abiticos, a exemplo de restrio Aps a fase orgnica ter sido rotaevaporada, os testes
hdrica ou perodos de seca. Neste trabalho foram realizados antimicrobiogramas foram realizados. O fungo isolado
estudos de bioinformtica comparativos, em que foi feita foi identificado como glomomerella sp. O concentrado
anlise fiologentica de sequncias de aminocidos de fungco, portanto, submetido tcnica de Bioautogrfia, ou
protenas LEA de mamona com as protenas LEA de espcies seja, cromatografia em camada delgada. Foram realizados
modelos como Arabidopsis thaliana, seguido de anlises testes com as bactrias Gram Negativa (Escherichia coli e
de expresso gnica por RT-qPCR, utilizando 4 genes de Pseudomonas sp) e bactria Gram Positiva (Staphylococcus
protenas LEA em radculas de sementes de mamona dos aureus). Comparando com o controle, os resultados mostram
gentipos PARAGUAU e EBDA MPA34. As anlises foram um significativo efeito antimicrobiano da biomolcula
realizadas em amostras de radculas coletadas de sementes da glomomerella sp frente as bactrias Escherichia coli;
secas (controle) e sementes aps 12h (Fase-I), 24h (Fase Pseudomonas sp e Staphylococcus aureus. Os fungos
II) e 40h de embebio (transio para a Fase-III) em gua representam uma importante fonte de recursos genticos
(0,0 MPa) e sob restrio hdrica em solues de polietileno para o avano biotecnolgico e para o desenvolvimento
glicol (PEG8000), nos potenciais osmticos de -0,2; -0,6 e econmico, uma vez que seu isolamento e seleo tm
-1,0 MPa. O objetivo do trabalho foi elucidar a classificao garantido o desenvolvimento de novos frmacos e
e o padro de expresso das protenas LEA de mamona, aplicaes em diversos segmentos industriais como o da
passveis de utilizao como marcadores moleculares para sade.
o estresse hdrico em programas de melhoramento gentico
da mamona. As anlises filogenticas demonstraram que os Palavras - chaves: atividade antimicrobiana, fungos
genes de RcLEA de mamona so evolutivamente distantes endofticos, isolamento
dos genes de AtLEA de Arabidopsis. Sobretudo, a expresso *******************************************************************
dos genes de protenas LEA apresentou padro de expresso *******************************************
semelhante ao gene controle utilizado, demonstrando que
no so bons marcadores para o estresse hdrico durante a
embebio e germinao de sementes de mamona. Portanto, Area: BIOTECNOLOGIA
necessrio continuar as anlises deste grupo essencial de TRABALHO: DESENVOLVIMENTO
genes para se tenha resultados concretos e significativos
com relao as protenas LEA atuantes no estresse hdrico. DE ENSAIO IMUNOENZIMTICO
Os estudos comparativos entre RcLEA X AtLEA podem INDIRETO PARA DETECO DA
levar ao melhor entendimento sobre a importncia destas
protenas para a mamona durante a germinao, e atravs da INFECO POR CORYNEBACTERIUM
expresso gnica de grupos de genes LEA poder se observar PSEUDOTUBERCULOSIS EM CAPRINOS
melhor a resposta da semente quando submetida ao estresse
hdrico. UTILIZANDO PROTENAS RECOMBINANTES
Palavras-chaves: Ricinus communis, restrio hdrica, Autor (es): THIAGO ASSIS DORIA BARRAL, RICARDO
protenas LEA PORTELA
******************************************************************* Resumo: A linfadenite caseosa (LC) uma doena de
******************************************* pequenos ruminantes que se caracteriza por formao
de leses granulomatosas em linfonodos superficiais e
rea: BIOTECNOLOGIA internos, bem como em alguns rgos. A LC encontrada
em rebanhos por todo o mundo, causando significativas
TRABALHO: COMPOSTOS EXTRADOS DE perdas econmicas. O Brasil possui o 22 rebanho mundial
FUNGOS ENDOFTICOS COM ATIVIDADE de caprinos, com cerca de 8.851.879 animais e o 18 maior
rebanho mundial de ovinos, com 17.614.454 animais. Dos
ANTIMICROBIANA. caprinos, a maioria dos animais esto concentrados em
sua maioria na regio nordeste, com cerca de 91,7%. J
Autor (es): FLVIA SOARES CAMPOS DE SOUZA, LILIA com relao ao rebanho de ovinos 57,5% esto na regio
FERREIRA DE MOURA-COSTA, LUANA DE SENA RODRIGUES nordeste e 29,3% na regio sul. Esses dados revelam que a
FREITAS, PAULO RICARDO ALVES BOMFIM VIEIRA caprinovinocultura uma atividade econmica de grande
importncia na Regio Nordeste, e relatado que grande
Resumo: Os fungos endfiticos so micro-organismos
parte desses rebanhos esto localizados principalmente
que vivem nos espaos intracelulares de tecidos vegetais
no semirido. A LC em como agente infeccioso a bactria
sem causar a planta sintomas aparentes e sendo capazes
Corynebacterium pseudotuberculosis e at o momento no
de produzir uma grande variedade de biomolculas como
existe um teste diagnstico com caractersticas satisfatrias
antimicrobianos. Essas biomolculas servem para proteger
como rapidez, baixo custo e alto grau de confiabilidade. O
a planta hospedeira da infestao por outros micro-
objetivo deste trabalho foi desenvolver um ELISA indireto
organismos invasores e/ou auxiliar na manuteno da
utilizando protenas recombinantes de C. pseudotuberculosis
sua associao com a planta. A bioprospeco de fungos
para o diagnstico da infeco por C. pseudotuberculosis.
endfitos para a produo de biomolculas importante
Foram analisados os perfis eletroforticos dos antgenos,
para o desenvolvimento industrial e farmacutico, energtico
expressas em sistema procarioto, por SDS-PAGE e o seu
e txtil. O objetivo desse trabalho foi o de caracterizar
reconhecimento por soros de animais infectados e de rea
a produo e atividade de antimicrobianos produzidos
no endmica por Western Blot. As protenas recombinantes
por fungos endfitos de Pyrostegia venusta, conhecida
foram ento empregadas em sistema checkerboard para
popularmente como cip ou flor de So Joo, que uma
padronizao das condies do ELISA. 80 soros, sendo 40
liana trepadeira sendo encontrada nas orlas das matas, nos

Congresso da UFBA 2017 | Caderno de resumos 29


de animais comprovadamente infectados e 40 de animais sistema soxhlet. Estes foram utilizados para averiguar a
de reas no endmicas, foram usados para obteno atividade antioxidante (atravs da limpeza do radical DPPH)
dos parmetros de validao do ensaio. As protenas e quantificar compostos fenlicos totais (atravs do mtodo
recombinantes foram reconhecidas no Western Blot por de Folin-Ciocalteu). O teste de envelhecimento artificial
um pool de soros de animais infectados, e no houve acarretou em uma queda progressiva da germinao com
reao quando utilizado pool de soros de animais controles o aumento do perodo de deteriorao atingindo valores
ESTUDANTE PIBIC

negativos. O ELISA desenvolvido usando uma combinao de 64, 57, 24 e 6%, respectivamente. No entanto, o teste de
1:1 das protenas recombinantes foi capaz de discriminar tetrazlio demonstrou resultados discrepantes em relao ao
animais positivos e negativos, com sensibilidade de 95%, teste de germinao, no ocorrendo o decaimento gradual
especificidade de 97,5% e acurcia de 99,3%. Conclui-se de viabilidade com o aumento do tempo da deteriorao
ento que o ensaio de ELISA proposto pode ser utilizado controlada. Parmetros fisiolgicos como massa seca,
com alto grau de confiana para o diagnstico da infeco comprimento de radcula e razo massa/comprimento
por C. pseudotuberculosis em caprinos. seguiram o padro de decaimento ao longo da exposio
deteriorao controlada nos perodos de tempo mais longos,
Palavras - chaves: imunodiagnstico, linfadenite caseosa, demonstrando que o processo de deteriorao controlada
pequenos ruminantes provocou a gradual perda de viabilidade das sementes
******************************************************************* de mamona. Foi observado um aumento da atividade
******************************************* antioxidante at o perodo de 96 horas, seguindo de um
declnio no prximo tratamento. Os extratos etanlicos de
sementes secas (quiescentes) e sementes submetidas ao
Area: BIOTECNOLOGIA processo de deteriorao controlada durante 48, 96 e 144
TRABALHO: EFEITOS DA DETERIORAO horas apresentaram atividade antioxidante de 35,22; 37,77;
48,9 e 43,69%, respectivamente, quando avaliados diludos
CONTROLADA NA QUALIDADE FISIOLGICA a uma concentrao de 750 g/mL. Compostos fenlicos
E ASPECTOS BIOQUMICOS DE SEMENTES no foram detectados mesmo aumentando a concentrao
de trabalho em 10x. Estudos mais aprofundados devem ser
DE RICINUS COMMUNIS L. realizados futuramente visando uma maior compreenso
acerca dos mecanismos de defesa (sistema antioxidante) da
Autor (es): MATHEUS FERREIRA, PAULO ROBERTO RIBEIRO, mamona, elucidando o comportamento da espcie quando
MARTA BRUNO LOUREIRO, RENATO D. DE CASTRO, submetida deteriorao controlada ou ao envelhecimento
LUZIMAR GONZAGA FERNANDEZ, DANIELE TAKAHASHI natural.
BERNAL
Palavras - chaves: biotecnologia, semente, viabilidade
Resumo: Ricinus communis L. uma espcie pertencente
famlia Euphorbiaceae, nativa de regies tropicais e *******************************************************************
bem adaptada as regies ridas e semiridas ao redor *******************************************
do mundo. Por apresentar sementes ricas em leos, esta
espcie passou a compor o elenco daquelas sugeridas pelo Area: BIOTECNOLOGIA
PNPB (Programa Nacional para Produo de Biodiesel). O
vigor de sementes uma combinao de caractersticas TRABALHO: ESTUDO DA ASSOCIAO
que determinam o potencial de alta performance aps a DE POLIMORFISMOS NO GENE TGF- E
semeadura. Como consequncia, existem inmeras tcnicas
para sua determinao, incluindo aquelas que, direta ou FENTIPOS DE ASMA
indiretamente, avaliam o estado metablico atual das
sementes para estabelecer uma relao com a emergncia Autor (es): CAMILA ALEXANDRINA VIANA DE FIGUEIREDO,
de plntulas e capacidade de armazenamento. Entre estes, RYAN DOS SANTOS COSTA, TAMIRES CANA BRASIL
pode-se citar o teste de condutividade eltrica, tetrazlio e CARNEIRO, ICANAA BRANDO
testes que avaliem o crescimento de plntulas. Em contraste,
Resumo: A asma e a doena crnica mais comum na
alguns outros testes so utilizados com o objetivo de
infncia e adolescncia. Ela causada por fatores genticos
identificar a capacidade das sementes de tolerar estresses,
e ambientais, e vrios genes tm sido implicados na
tais como envelhecimento acelerado e deteriorao
sua patogenia. Alguns estudos tm demonstrado que
controlada. O objetivo deste trabalho avaliar parmetros
uma serie de genes e seus polimorfismos influenciam os
germinativos e bioqumicos em sementes de mamona no
desenvolvimentos imunes e pulmonares e a resposta a
tratadas e aps serem submetidas deteriorao controlada.
fatores ambientais, contribuindo para o aparecimento e/ou
Para este estudo foram utilizadas sementes de mamona do
gravidade da asma. Para isso so necessrias estratgias e
lote MPA 45 (cedido gentilmente pela Empresa Baiana de
conhecimento detalhado desses mecanismos imunolgicos,
Desenvolvimento Agrcola) com umidade inicial corrigida
genticos e ambientais que podem estar associados asma.
para 30%. O teste de deteriorao controlada foi conduzido
A asma alrgica uma doena caracterizada por inflamao
em cmaras de germinao ajustadas temperatura de
crnica e dano tecidual das vias areas desencadeados por
42C em trs diferentes perodos (48, 96 e 144 horas). As
um perfil de resposta envolvendo citocinas tipo Th2. O
sementes frescas, ou seja, que no foram submetidas ao
controle destas respostas pelo sistema imunolgico se d
tratamento foram utilizadas como controle (0h). A qualidade
atravs clulas regulatrias. As clulas T regulatrias (Treg)
das sementes foi avaliada pelos testes de germinao (em
so as clulas responsveis por suprimirem as respostas
rolo de papel, a 30C, no escuro, por 7 dias) e de tetrazlio.
imunolgicas atravs da produo de TGF-1, alm de outros
Os testes foram conduzidos em 4 repeties de 25 sementes
mecanismos. O fator de transformao do crescimento-1
cada e as mdias comparadas pelo teste t-student ao nvel
(TGF-1) esta localizado no cromossomo 19q13. O TGF-1
de 5% de probabilidade. Ao final do teste, as plntulas
uma citocina multifuncional que esta aumentada no fluido
foram avaliadas quanto ao comprimento atingido utilizando
do lavado brnquico de asmticos quando comparada a de
paqumetro digital. Obteve-se tambm a massa seca das
indivduos no asmticos. Ela importante no crescimento,
plntulas, que foram secas a 60C at atingirem massa
transformao, reparo de tecido, fibrose e modulao de
constante. A partir dos dados obtidos, foi possvel calcular o
respostas imune inflamatrias. Sua funo na asma ainda
SVI (ndice de vigor de plntula) e razo massa/comprimento.
no completamente conhecida. Por isso, atravs de estudos
O extrato etanlico foi obtido atravs de extrao via
de associaes genticas, ns hipotetizamos que variaes

30 Congresso da UFBA 2017 | Caderno de resumos


nesse gene que codifica o TGF-1, molcula esta envolvida do subrbio de Salvador, mais especificamente em uma
no desenvolvimento e funo das clulas Treg, possam estar rua no bairro de Coutos, onde 52 pessoas desenvolveram a
associadas atopia e fentipos de asma. Essas variaes doena. Foram realizadas aspiraes de mosquitos, por meio
tambm podem ser chamadas de SNPs (Polimorfismos do aspirador porttil Prokopack, nas casas onde residiam
de um nico nucleotdeo). A genotipagem o processo casos com infeco laboratorialmente confirmada, com o
pelo qual identificamos essas pequenas regies do DNA objetivo de identificar qual era a espcie mais abundante e

ESTUDANTE PIBIC
denominadas marcadores, que variam de indivduo para test-los para verificar se estavam infectados pelo CHIKV. Um
indivduo. Alguns polimorfismos presentes no gene TGF1 total de 130 culicdeos foram capturados dos quais 102 Culex
podem desempenhar um papel importante nas doenas quinquefasciatus e 28 Aedes aegypti. Todos foram negativos
alrgicas Por isso, o principal foco deste trabalho foi para o CHIKV atravs do isolamento viral em cultura de
avaliar os polimorfismos no gene TGF-1 e associ-los aos clulas e por RT-PCR. A proximidade da moradia das famlias
diferentes fentipos de asma num estudo caso-controle com deve ter favorecido ocorrncia do surto, assim como a
1.500 indivduos (500 controles saudveis, 500 com asma grande quantidade de entulhos e loteamentos abandonados
leve e 500 com asma grave controla da ou no) que fazem na rua. O contnuo monitoramento das reas de ocorrncia
do Ncleo de Excelncia em Asma da Bahia e do Programa de surtos de arboviroses de extrema importncia para
de Controle da Asma e da Rinite Alrgica na Bahia (ProAR), entender a dinmica de transmisso dessas doenas e para
residentes em Salvador-Ba. orientar a adoo de medidas de preveno e controle.
Palavras - chaves: Asma, TGF-B1, polimorfismos Palavras - chaves: entomologia, arboviroses, vetores
******************************************************************* *******************************************************************
******************************************* *******************************************

Area: BIOTECNOLOGIA Area: BIOTECNOLOGIA


TRABALHO: INVESTIGAO ENTOMOLGICA TRABALHO: ISOLAMENTO DE BACTRIAS
EM REAS COM INTENSA TRANSMISSO DE COM POTENCIAL PARA FACILITAR NA
ARBOVIROSES NA CIDADE DE SALVADOR, RECUPERAO DE PETRLEO EM POOS
BAHIA MADUROS
Autor (es): ANNA BEATRIZ PEREIRA SIMES ALVES, Autor (es): FABIO ALEXANDRE CHINALIA, TUILA TAINAM
GUILHERME SOUSA RIBEIRO, RAQUEL LIMA DE SOUZA FONSECA SALES, TATIANA OLIVEIRA DO VALE, SUELI
CARVALHO DOS SANTOS
Resumo: As arboviroses so consideradas um dos principais
problemas de sade pblica do mundo. Com a introduo Resumo: A proposta desse trabalho foi de testar o caldo de
no Brasil do vrus chikungunya (CHIKV) em 2014 e do cultivo de uma bactria redutora de nitrato (desnitrificante)
vrus zika em 2015, a cidade Salvador enfrentou grandes em processos de recuperao de petrleo. A TKII uma
epidemias causadas por estes arbovrus. Mais recentemente, bactria produtora de surfactante e foi isolada pela sua
a partir do fim de 2016, o vrus da febre amarela (VFA) re- capacidade de utilizar o petrleo como fonte de carbono
emergiu no pas, causando centenas de casos da doena e nitrato como aceptor final de eltrons. As bactrias
em humanos e em primatas, gerando grande preocupao desnitrificantes tm sido muito estudadas pela indstria
para a populao e para os servios de sade. Em Salvador de petrleo para fomentar o processo de bioexcluso
a identificao de primatas no humanos mortos em competitiva. Esse processo importante no controle de
diferentes bairros alertou para a circulao do vrus na bactrias redutoras de sulfato, que so as responsveis
cidade, em particular porque 61,9% dos primatas testados pela produo de sulfeto e que causam souring. Foi
para VFA foram positivos. Neste contexto de ocorrncia testado o efeito emulsificante do caldo de cultivo da TKII
de surtos de arboviroses em Salvador, nossa equipe de e observou-se a formao de 60% emulso estvel por
pesquisa realizou investigaes entomolgicas nos bairros mais de 4 dias. Esse valor foi 1,2 vezes maior do que a
onde ocorreram as epizootias pelo VFA e recentes surtos segunda cepa com maior produo de surfactante isolada
de chikungunya, com o objetivo de capturar mosquitos e no trabalho. Comparativamente, a TKII produziu 5,8 vezes
tentar identificar os vetores envolvidos na transmisso desses menos polmero (1 g l-1). Os testes de recuperao foram
vrus na cidade de Salvador. Adicionalmente, tentamos realizados em colunas de areia onde foram quantificadas as
identificar os possveis locais de reproduo desses vetores taxas de recuperao primaria, secundaria e terciria. Para
nos bairros inspecionados. Durante a investigao do surto realizar o teste foi calculado o volume de poro, que um
de febre amarela, a tcnica de captura realizada pela equipe fator importante, tanto para a adio de petrleo na coluna,
caracteriza-se por atrao humana protegida e esclarecida, como tambm, para quantificar a adio de gua de injeo
tendo como objetos auxiliadores pu entomolgico e e do caldo do microrganismo. Os resultados mostraram
tubo de suco oral. As capturas foram realizadas no bairro uma recuperao de petrleo acima de 45% apenas com o
Itaigara e na base Naval da Barragem entre abril e junho caldo microbiano bruto que foi injetado 4 vezes o seu valor
de 2017. No total foram realizadas 10 idas ao campo, de volume de poro. Esse um valor mnimo de volume
subdivididas em 26 pontos de coleta. Foram capturados 435 utilizado pelas industrias em fase de recuperao terciria,
culicdeos, sendo 49 da espcie Aedes aegypti, 139 Aedes que comumente de 10 vezes o volume de poro. Os
albopictus, 4 Aedes scapularis, 10 Aedes serratus, 2 Aedes sp., resultados do experimento com o caldo de cultivo da TKII
58 Culex quinquefasciatus, 21 Limatus sp., 149 Wyeomyia demonstraram sucesso na reduo da viscosidade do leo
sp. e 3 Psorophora ferox. No foram encontradas as espcies aumentando assim o percentual de recuperao da coluna,
sabidamente transmissoras da febre amarela no ambiente em relao ao controle, fazendo desse bioproduto uma
silvestre, as quais pertencem ao gnero Haemagogus e substancia com significativo potencial para aplicao em
Sabethes. Pools dos mosquitos fmeas coletados, definidos processos de recuperao de poos maduros.
pela espcie, foram testadas para o VFA atravs do
isolamento viral em cultura de clulas e por RT-PCR, porm Palavras - chaves: Biossurfactantes, Recuperao de
os resultados foram negativos. Em julho de 2017, nossa petrleo, Poos maduros
equipe investigou um novo surto de chikungunya na regio

Congresso da UFBA 2017 | Caderno de resumos 31


******************************************************************* Area: BIOTECNOLOGIA
*******************************************
TRABALHO: MONITORAMENTO DA
Area: BIOTECNOLOGIA COLONIZAO DE BACTRIAS
TRABALHO: MARCADORES ENZIMTICOS ENDOFTICAS DE CACAU
ESTUDANTE PIBIC

PARA O DESENVOLVIMENTO DE UM TESTE Autor (es): SUSANNA RITA OLIVEIRA SCHUMACHER,


BIOQUMICO RPIDO PARA A AVALIAO ALDINIA OLIVEIRA DAMIO, MILTON RICARDO DE ABREU
ROQUE
DA QUALIDADE DE SEMENTES DE RICINUS
Resumo: Bactrias endofticas so ubquas no interior
COMMUNIS L. de plantas e desempenham funes que vo desde o
estmulo do crescimento at a defesa contra fitopatgenos.
Autor (es): BIANCA ALVES, PAULO ROBERTO RIBEIRO, Os benefcios da interao destas bactrias com as
MARTA BRUNO LOUREIRO, RENATO D. DE CASTRO, plantas podem ser explorados na agricultura e resultar
LUZIMAR GONZAGA FERNANDEZ, DANIELE TAKAHASHI em aumento da produtividade por rea plantada alm
BERNAL de reduzirem significativamente os custos com insumos
Resumo: A mamona (Ricinus communis L.), pertence agrcolas como agrotxicos e fertilizantes. Estas bactrias
famlia das Euphobiaceae, nativa de regies tropicais, pertencem a gneros diversos e relativamente comuns
porm se adapta bem a regies ridas e semiridas. Seu como Enterobacter, Bacillus, Pseudomonas, Burkholderia
principal produto o leo de rcino, presente em altos teores e Azospirillum. A capacidade de colonizao uma das
nas sementes, e que apesar de no ser comestvel desperta caractersticas mais importantes em agentes de controle
muito interesse da indstria de qumica fina. Devido ao alto biolgico e promotores de crescimento de plantas, sendo
teor de leo, esta uma semente que apresenta diversos uma alternativa fcil e acessvel para a agricultura orgnica.
problemas no seu armazenamento. Mas devido a sua fcil Existem poucos conhecimentos sobre os mecanismos
manipulao e no necessitar de muita infraestrutura para que governam a capacidade dessas bactrias colonizarem
o seu cultivo, muito plantada por pequenos agricultores tecidos de plantas. A estratgia mais eficiente para a busca
familiares. Porm, as sementes utilizadas para o plantio, por genes relacionados com a colonizao endoftica
apresentam baixa ou lenta germinabilidade, alm de o sequenciamento de genomas bacterianos associados
germinao desuniforme, resultando em prejuzos na aos estudos de anotao genmica e expresso. No Brasil,
produo. Para retardar o processo de deteriorao, as uma das limitaes a falta de mo de obra qualificada
sementes devem ser armazenadas em condies de baixa em bioinformtica para montagem e anlise de genomas.
umidade relativa e baixa temperatura. O objetivo deste Este trabalho visa desenvolver estudos com genes
trabalho foi avaliar a qualidade fisiolgica de sementes de bacterianos relacionados com capacidade de colonizao
mamona durante o processo de deteriorao controlada, endoftica. Objetiva-se a anlise de dois genomas j
correlacionando a perda de qualidade com a atividade de sequenciados pertencentes s espcies Bacillus subtilis 629
enzimas antioxidantes (peroxidase, superxido dismutase e Serratia marcescens, as quais foram isoladas de tecidos
e catalase). Para isso, foi realizado o teste de deteriorao de Theobroma cacao e classificadas como excelentes
controlada no qual as sementes tiveram o seu teor de gua colonizadoras de diversas espcies de plantas. Nesse intuito,
elevado para 30% e foram incubadas a 42C por perodos de foram utilizadas tcnicas de bioinformtica, como anotao
tempos de 48, 96 e 144 horas. Sementes que no sofreram a funcional do genoma e comparao genmica visando
deteriorao controlada constituram o tratamento controle. seleo de genes relacionados ao endofitismo. Alm
Aps a deteriorao controlada, foram realizados o teste disso, foram realizados testes de endofitismo em plantas
de germinao para avaliar a germinabilidade e vigor das de tomates com Serratia marcescens a fim de avaliar seu
sementes. Foi realizado o teste de tetrazlio para avaliar potencial endofitico e a possvel promoo do crescimento
a viabilidade das sementes. Amostras de sementes foram da planta. Os resultados incluem um maior conhecimento
coletadas em todos os tratamentos para o preparo de sobre genes envolvidos em colonizao endoftica por
extratos enzimticos. A deteriorao controlada diminuiu a anlises genmica e por bioinformtica, e mutantes com
germinabilidade e vigor das sementes quando comparadas capacidade de maior colonizao endoftica para uso em
com aquelas que no sofreram deteriorao. A viabilidade controle biolgico de doenas de plantas. Como resultados,
das sementes pelo teste de tetrazlio diminuiu drasticamente foram encontrados 19 genes relacionados ao endofitismo,
quando as sementes foram submetidas a 144 horas de sendo 13 deles presentes no Bacillus e 18 presentes na
deteriorao controlada. A atividade de enzimas SOD se Serratia.
mostrou bastante elevada nos tratamentos de 96h e 144h. Palavras - chaves: comparao genmica, bactrias,
A APX tambm teve sua atividade elevada em 144h de endofitismo
deteriorao. A anlise dos dados obtidos demonstrou o
potencial da utilizao da enzima SOD como um marcador *******************************************************************
do processo de deteriorao das sementes de mamona. *******************************************
Palavras - chaves: envelhecimento, qualidade, bioqumica
Area: BIOTECNOLOGIA
*******************************************************************
******************************************* TRABALHO: POTENCIAL TERAPUTICO
DE CLULAS-TRONCO MESENQUIMAIS
SUPEREXPRESSANDO IGF-1 EM
MODELO EXPERIMENTAL DE TRAUMA
RAQUIMEDULAR
Autor (es): GIRLAINE CAF SANTOS, ANA QUENIA GOMES
DA SILVA

32 Congresso da UFBA 2017 | Caderno de resumos


Resumo: O Trauma Raquimedular (TRM) acomete controle. Concluso: Este estudo vem demonstrando que
anualmente milhares de pessoas ao redor do mundo, e suas a aplicao de terapia celular combinada com alteraes
causas principais so os acidentes automobilsticos, quedas, genticas, apresentou benefcios aos animais que sofreram
doenas e violncia. Apesar do progresso da assistncia trauma raquimedular, tanto na funo locomotora quanto na
mdica, uma parcela significativa dos pacientes sofre danos proliferao de novas clulas dentro da rea de leso. Alm
permanentes, incluindo perda de funes fisiolgicas disso, os experimentos em biologia molecular apresentaram

ESTUDANTE PIBIC
e motora, sensibilidade, dores crnicas, ou at mesmo alguns dos possveis mecanismos desempenhados pelas
invalidez, o que resulta em sofrimento fsico e emocional, clulas mesenquimais para a recuperao funcional, como
alm de encargos financeiros para o paciente e seus a reduo dos danos secundrios gerados pelas ROS no
familiares. Embora haja uma elevada prevalncia de leses tecido ps-lesionado. Os resultados gerados nesse projeto
da medula espinhal e da gravidade dos danos gerados, ainda demonstraram um novo avano para a criao de uma
no existe um tratamento efetivo para tratar e recuperar a possvel terapia celular com potencial para tratar TRM.
medula lesionada. Terapias com clulas-tronco tm sido Baseado nos resultados obtidos neste modelo sugerimos
empregadas na busca de novos tratamentos para doenas que futuros protocolos para tratamento clnico podem
crnico-degenerativas, incluindo as neurolgicas, como as combinar a terapia celular com alteraes genticas, contudo,
leses medulares. No entanto, ainda no foi estabelecido um muitos estudos ainda precisaro ser realizados para total
protocolo para que terapias celulares possam ser utilizadas compreenso dos mecanismos de reparo do sistema nervoso
em seres humanos. Objetivo: O estudo visa analisar a e desenvolvimento de terapias efetivas.
utilizao de clulas-tronco mesenquimais (BMSC) como
terapia para leses da medula espinhal em um modelo de Palavras - chaves: Terapia Celular, Trauma Raquimedular,
leso padronizada e induzida em camundongos. Alm disso, Clulas Mesenquimais
investiga, in vitro, a influencia da superexpresso, em BMSC, *******************************************************************
do fator de crescimento semelhante insulina tipo-1 (IGF-1) *******************************************
no reparo tecidual por controle dos efeitos causados pela
produo de ROS no tecido lesionado. Metodologia: Para
avaliar o potencial teraputico do transplante de clulas- Area: BIOTECNOLOGIA
tronco em modelo experimental de trauma raquimedular, TRABALHO: PRODUO DE CERVEJA
utilizou-se como modelo animal camundongos da linhagem
C57Bl/6, fmeas, com idade entre 8 e 12 semanas. Trs ARTESANAL COM LEVEDURAS NATIVAS
grupos foram formados (8 animais por grupo), onde um
grupo que recebeu transplante de BMSC, outro grupo foi Autor (es): LUIZ RICARDO FRASER SILVA, ALCIDES JACINTO
tratado com BMSC superexpressando IGF-1 (BMSE-IGF-1) PEREIRA JNIOR, EUDES DA SILVA VELOZO, MILTON
e o ultimo grupo recebeu soluo salina (controle). Todos RICARDO DE ABREU ROQUE
os animais foram submetidos cirurgia de laminectomia na Resumo: O termo cerveja artesanal remete a cervejas
vrtebra torcica 10 para acessar a medula espinal e realizar produzidas com ingredientes selecionados, onde o
a induo da leso raquimedular. Em seguida, nos animais, cervejeiro busca aromas e sabores nicos, diferentemente
foram injetadas as clulas ou salina. Aps as cirurgias, os das cervejas produzidas em grande escala. A fabricao
animais foram avaliadas semanalmente atravs do Basso de cerveja artesanal de forma caseira vem aumentando
Mouse Scale (BMS) pra medir recuperao funcional, at exponencialmente ao longo dos ltimos anos no Brasil. Os
completarem 4 semanas. Paralelo a analise funcional, foram homebrewers (cervejeiros caseiros) como so chamados
realizados procedimentos de histologia e imunofluorescncia conseguem atribuir para suas cervejas caractersticas mais
para observar as alteraes teciduais ocorridas em funo da elaboradas e refinadas quando comparados com as grandes
leso com 2 e 5 dias e 4 semanas aps o trauma, e avaliar a cervejas industriais. Portanto os cervejeiros caseiros esto
evoluo da recuperao mediante o tratamento. Para avaliar sempre em busca de novos produtos para incrementar
o potencial das clulas-tronco mesenquimais na reduo suas receitas. Para se fazer cerveja so necessrios quatro
das espcies reativas de oxignio (ROS) foi realizado um ingredientes; gua, malte, lpulo e levedura (fermento).
experimento in vitro, onde as clulas mesenquimais comuns Com o crescimento no nmero de homebrewers cresce
(BMSC) e as clulas mesenquimais superexpressando IGF-1 tambm o nmero de lojas especializadas na venda destes
foram cultivadas em de 6 poos (1X106 clulas por poo) ingredientes base. Apesar da relativa facilidade em comprar
e foram submetidas a um meio de cultura com perxido os insumos, existe ainda um fator que encarece a produo
de hidrognio em uma concentrao de 10M para caseira, a fermentao. O fermento pode ser comprado de
induo de estresse oxidativo e, posteriormente, ambos duas formas, liofilizado ou com suas clulas vivas inertes,
os grupos submetidos a estresse oxidativo, mais os grupos podendo o valor variar entre 20 e 40 reais. No Brasil as
controle, formados pelas mesmas populaes celulares leveduras usadas para produo so importadas o que
sem o tratamento com perxido de hidrognio, foram reflete no elevado preo do produto. Alm de encarecer
submetidos a anlise de RT-qPCR para avaliar as diferenas o processo produtivo, o transporte pode causar danos
na expresso genica que podem conferir a clula maior o as clulas afetando diretamente a qualidade da cerveja.
menos resistncia a ROS. Resultados: Segundo as anlises Com a problemtica apresentada somada a necessidade
funcionais do BMS, foi observada uma melhora funcional dos cervejeiros caseiros por novos produtos surge uma
significativa no grupo que recebeu transplante de BMSC- oportunidade de interveno a partir da insero de um
IGF-1 a partir da segunda semana e mantendo-se at a novo produto neste crescente mercado. Para a produo
quarta semana de acompanhamento ps-leso, comparado artesanal de cerveja, em todo territrio brasileiro utiliza-se
com os grupos que receberam BMSC e salina. Atravs das levedura importada e somente uma empresa multiplica
tcnicas de imunofluorescncia observamos nas medulas esta levedura no Brasil. Alm do custo de produo e
dos animais sacrificados com 5 dias, um aumento da transporte, o principal problema a perda de viabilidade,
proliferao celular, marcadas com Ki67, no grupo que sendo necessrio um maior custo de partida do processo.
foi transplantado com BMSC-IGF-1, em comparao com Outra oportunidade identificada so trabalhos recentes da
animais que receberam BMSC ou salina. As anlises de UFMG, grupo do pesquisador Carlos Rosa, que conseguiu
PCR do experimento de induo de estresse oxidativo selecionar uma levedura nativa, ao qual deu incio a uma
demonstraram diferenas significativas na expresso de nova empresa de produo de cerveja artesanal (GRIMOR).
genes relacionados com a depurao de ROS pelas clulas, Estes problemas/oportunidades se concretizam a partir da
como os genes SOD (superxido desmutase), CAT (catalase) atividade dos candidatos a bolsistas, na disciplina de ICS
entre os grupos BMSC e IGF-1, e entre IGF-1 e os grupos

Congresso da UFBA 2017 | Caderno de resumos 33


028 - Microbiologia I, curso de Biotecnologia. Onde os saproftica de Leptospira, caracterizando-se como o primeiro
discentes isolaram de um solo de plantio de cana de acar, estudo com extratos naturais de cianobactrias utilizando
uma levedura que est sendo caracterizada. No processo de este gnero. A Concentrao Inibitria Mnima MIC para
produo, vislumbramos uma oportunidade de inovao, os testes antimicrobianos variou entre 2,5 e 10 mg/mL1.
a partir da obteno de novas leveduras isoladas de solos Apenas os extratos metanlicos foram capazes de inibir
com plantios de cana de acar. O presente trabalho j pelo menos um dos microrganismos testados. Quanto
ESTUDANTE PIBIC

conseguiu isolar trinta cepas de leveduras nativas oriundas aos testes antioxidantes, todos os extratos metanlicos e
dos frutos; cacau, caju, umbu e uva. Os testes fermentativos apenas um etanlico apresentaram atividade antioxidante
j foram iniciados e alguns resultados promissores j foram 50% para DPPH, enquanto os de cido actico no
obtidos. O seguinte passo a melhor caracterizao do perfil apresentaram este potencial. Para o radical ABTS, quatro
fermentativo dessas cepas e fazer a identificao molecular extratos metanlicos apresentaram atividade antioxidante
destas. 50%. Os resultados obtidos neste estudo evidenciaram
o potencial biotecnolgico dos metablitos secundrios
Palavras - chaves: leveduras, cerveja, artesanal das cianobactrias marinhas, atravs das atividades
******************************************************************* antimicrobianas, antioxidantes e citotxicas, alm da
******************************************* prospeco gnica, sendo esta pesquisa pioneira no Brasil.
Palavras - chaves: cyanobacteria, biotecnologia, compostos
Area: BIOTECNOLOGIA
*******************************************************************
TRABALHO: PROSPECO GNICA DE *******************************************
TOXINAS E AVALIAO DE COMPOSTOS
BIOATIVOS EM CIANOBACTRIAS rea: CINCIAS AGRRIAS - AGRONOMIA
MARINHAS BENTNICAS FILAMENTOSAS TRABALHO: CARACTERIZAO MORFO-
DO LITORAL DA BAHIA, BRASIL FISIOLFICA E BIOQUMICA DE QUATRO
GENTIPOS DE RICINUS COMMUNIS L.
Autor (es): AARON MATHEUS SANTOS DA SILVA, TAIARA
AGUIAR CAIRES, JOS MARCOS DE CASTRO NUNES Autor(es): THIAGO SANTOS, MARTA BRUNO LOUREIRO,
LAIZO SILVA, SABRINA FERREIRA DE SANTANA, ANA
Resumo: Cyanobacteria um grupo de procariotos CAROLINA VALENTE SANTOS CRUZ DE ARAUJO, LUZIMAR
fotossintetizantes que sintetiza metablitos secundrios GONZAGA FERNANDEZ, RENATO D. DE CASTRO
relacionados sua sobrevivncia, podendo ser
biologicamente ativos. Dentre as atividades apresentadas Resumo: Introduo: A caracterizao de sementes de
por estes metablitos, podem ser destacadas as antitumorais, espcies que apresentam interesse agronmico se baseia
antibacterianas, antivirais, antifngicas, antioxidantes, anti- na descrio de aspectos fsicos, qumicos e biolgicos com
inflamatrias e anticolinestersica, alm dos compostos o intuito de auxiliar na utilizao dessas sementes para
txicos denominados cianotoxinas, classificadas por comercializao, semeadura, armazenamento, pesquisas
hepatotoxinas; neurotoxinas e citotoxinas. Este trabalho cientficas e catalogao. Ricinus communis espcie da
teve por objetivo verificar a ocorrncia de genes famlia Euprorbiaceae, conhecida como mamona, apresenta-
propostos para a biossntese de microcistina, saxitoxina e se amplamente distribuda pelo territrio brasileiro. Seu
cilindrospermopsina, e testar extratos orgnicos quanto cultivo para fins de comercializao esta concentrado na
s atividades antibacterianas, antifngicas, antioxidantes regio nordeste, principalmente no estado da Bahia, este
e citotxicas. Foi realizada a extrao do DNA total de visa a comercializao de sementes para posterior extrao
34 cepas, o qual foi utilizado para avaliar o potencial de do leo. O leo da mamona possui vrias propriedades
produo das cianotoxinas atravs da Reao em Cadeia que o tornam especial, como a presena do nico cido
da Polimerase, utilizando as seguintes regies: mcyD, mcyE graxo hidoxilado obtido naturalmente. Tal caracterstica
e mcyG (microcistina); sxtA, sxt1 e OCT (saxitoxina); e contribui para sua boa cotao em vrios setores da
Cynsulf (cilindrospermopsina). Foram obtidos 26 extratos indstria. Objetivo: Elaborar um perfil morfo-fisiolgico e
metanlicos, etanlicos e de cido actico a partir da bioqumico de sementes de quatro gentipos de mamona
biomassa de 10 cepas. Realizaram-se ensaios de letalidade (Nordestina, Paraguau, Energia e EBDA40), atravs da
com Artemia salina utilizando o mtodo de macrodiluio caracterizao de lotes de sementes de diferentes idades.
com 10 nuplios/poo para definir a Concentrao Materiais e Mtodos: Com o intuito de caracterizar e
Letal para 50% da populao (CL50). Para os testes de avaliar a qualidade das sementes e do leo extrado foram
sensibilidade a agentes antimicrobianos, foi utilizada a realizadas anlises morfomtricas, teste de germinao,
metodologia de microdiluio para definir a Concentrao teste de condutividade eltrica, teste de tetrazlio, alm da
Inibitria Mnima (MIC) para as cepas bacterianas Gram- extrao e caracterizao do leo atravs dos ndices de
positivas, negativas e um fungo. Para os testes antioxidantes Iodo, nmero de perxidos e ndice de acidez. Resultados:
utilizaram-se os radicais ABTS e DPPH. Os testes foram Pode-se verificar que os gentipos analisados apresentaram
realizados com concentrao inicial dos extratos em 40 mg/ variao de tamanho, sendo o gentipo Paraguau o que
mL1.Obteve-se 11 amplificaes para os genes propostos apresentou as maiores sementes. O gentipo EBDA 40
para a biossntese da saxitoxina, 10 resultados positivos apresentou a maior porcentagem de Germinao mxima
para pelo menos um dos genes de microcistina, e um para (92%), seguida de Paraguau, com 70%. J o gentipo
cilindrospermopsina. Para os testes com Artemia salina, os Energia exibiu a menor porcentagem, cerca de 20%. Quanto
extratos metanlicos apresentaram maior citotoxicidade, aos resultados para o teste de condutividade eltrica foi
variando entre 0,8 e 6,6 mg/mL1. Entre os extratos verificado o menor valor de condutividade eltrica para
etanlicos, variou entre 3,3 e 6,6 mg/mL1, e para os de gentipo Energia (537,60S.cm-1.g-1) e os maiores para
cido actico, somente na concentrao de 6,6 mg/mL1. Paraguau (1134,75 S.cm-1.g-1) e EBDA 40 (1053,75 S.cm-
Para os testes antimicrobianos, os extratos oriundos dos trs 1.g-1) que no apresentaram diferena estatisticamente
solventes apresentaram atividade antifngica, enquanto significativa entre si. Na anlise dos resultados do teste
ocorreu inibio de bactrias Gram-positivas apenas de tetrazlio pode-se verificar que os quatro gentipos
por um extrato metanlico. Todas as cepas bacterianas apresentaram viabilidade superior 80%, no ocorrendo
Gram-negativas foram inibidas, com destaque para a cepa diferenas significativas entre as mdias. No entanto, tais

34 Congresso da UFBA 2017 | Caderno de resumos


valores no refletem os resultados encontrados no teste de armazenamento. Amostras de sementes armazenadas foram
germinao, sugerindo uma possvel dormncia. Concluso: coletadas mensalmente e submetidas a testes de germinao
O gentipo EBDA40 apresentou maior vigor e viabilidade, para a avaliao da qualidade fisiolgica. A partir dos testes
provavelmente por ser o lote mais novo em relao aos controlados, foi possvel a criao de um banco de dados
demais gentipos. Os gentipos Nordestina, Paraguau e com os resultados destes experimentos, nos levando ao
Energia apresentaram gMx inferior a 70%, valor considerado desenvolvimento de uma equao de regresso linear que

ESTUDANTE PIBIC
baixo para comercializao de sementes. No entanto, se explica as variaes dos parmetros fisiolgicos durante
correlacionar-se estes valores com os encontrados no teste o armazenamento. Com os dados, foi possvel calcular
de tetrazlio, pode-se atribuir tal resultado a uma possvel as constantes do modelo de Elis & Robert e observou-se
dormncia. Quanto a caracterizao bioqumica realizada que a variedade Nordestina apresentou comportamento
atravs da anlise dos leos, pode-se verificar que a maioria concordante com o modelo proposto. J a variedade
dos parmetros qumicos permaneceu dentro dos padres Paraguau no apresentou comportamento que concordasse
de qualidade, podendo o leo ser comercializado, com com o modelo desenvolvido, possivelmente isso devido
exceo do gentipo Paraguau que exibiu valores altos para colheita desta variedade ter ocorrido fora do perodo de
o ndice de Iodo. maturao adequada.
Palavras-chaves: mofometria de sementes, Palavras-chaves: modelo
germinao,teste de tetrazlio,caracterizao do leo matemtico,armazenamento,sementes
******************************************************************* *******************************************************************
******************************************* *******************************************

Area: CINCIAS AGRRIAS - AGRONOMIA rea: CINCIAS AGRRIAS - AGRONOMIA


TRABALHO: MODELOS DE REGRESSO TRABALHO: IMPLANTAO DO BANCO DE
LINEAR PARA A PREDIO DE QUALIDADE GERMOPLASMA (SEMENTES E DNA) DE
DE SEMENTES DE MAMONA DURANTE O MAMONA DO LBBB-UFBA
ARMAZENAMENTO
Autor(es): ANA CAROLINA VALENTE SANTOS CRUZ DE
ARAJO, THIAGO SANTOS, LAIZO SILVA, SABRINA FERREIRA
Autor(es): RICARDO CARIB MIRANDA, THAMIRES SOARES,
DE SANTANA, LUZIMAR GONZAGA FERNANDEZ, RENATO D.
PAULO ROBERTO RIBEIRO, MARTA BRUNO LOUREIRO,
DE CASTRO, DANIELE TAKAHASHI BERNAL, MARTA BRUNO
RENATO D. DE CASTRO, LUZIMAR GONZAGA FERNANDEZ,
LOUREIRO
DANIELE TAKAHASHI BERNAL
Resumo: Introduo: Os bancos de germoplasma so locais
Resumo: A mamona (Ricinus communis L.) uma espcie
adequados ao armazenamento e conservao dos recursos
que pertence famlia das Euforbiceas, nativa de regies
fitogenticos, sejam eles espcies, subespcies ou variedades
tropicais, possuindo boa adaptabilidade s regies ridas
de uma espcie. Esta conservao pode ser realizada nos
e semiridas ao redor do mundo. Por apresentar sementes
habitats naturais de ocorrncia das espcies de interesse
com alto teor de leo, esta espcie passou a compor o
(in situ) ou fora deles, em bancos de germoplasma (ex
elenco daquelas sugeridas pelo PNPB (Programa Nacional
situ). Os bancos de sementes so considerados um mtodo
para Produo de Biodiesel) para serem utilizadas para a
eficiente e econmico de conservao ex situ, no entanto, a
produo de biodiesel. No entanto, esbarra-se em um srio
longevidade das sementes depende da qualidade inicial do
entrave, as sementes utilizadas para o plantio possuem
lote, do grau de umidade inicial da semente a ser conservada,
um baixo grau de germinabilidade, e quando conseguem
das condies do ambiente de armazenamento e das
germinar, sua taxa de germinao lenta e com um alto
caractersticas intrnsecas a cada espcie. Ricinus communis
grau de desuniformidade, resultando em grandes prejuzos
L., popularmente conhecida como mamona, apresenta
no estabelecimento da lavoura. A qualidade fisiolgica das
sementes ortodoxas, ou seja, que toleram a dessecao e o
sementes pode ser testada em um ambiente de laboratrio,
armazenamento a baixas temperaturas, mantendo-se viveis
no entanto, os testes utilizados so bastante demorados,
quando armazenadas em condies adequadas. Dessa
alm de requererem uma mo de obra especializada e
forma, estas sementes podem ser armazenadas baixas
possuir uma demanda de muito espao para a sua realizao.
temperaturas e com baixo teor de umidade, o que resulta
Modelos matemticos como o proposto por Elis & Robert
na diminuio das atividades metablicas e consequente
podem ser utilizados para predizer a perda de vigor das
aumento da durabilidade de suas reservas. Objetivo: Com
sementes durante o armazenamento. O objetivo deste
a implantao do banco de germoplasma (sementes) de
trabalho criar um banco de dados contendo os dados
mamona no LBBB/UFBA objetiva-se conservar (ex situ), sob
fisiolgicos de sementes de mamona, esses dados que vo
baixa temperatura e baixo teor de umidade, a qualidade
desde o envelhecimento natural at elas serem submetidas
fisiolgica e bioqumica das sementes para fins de pesquisa.
ao teste de envelhecimento acelerado, em determinadas
Materiais e Mtodos: Sementes de R. communis foram
condies de armazenamento (com controle de temperatura
acondicionadas em embalagens adequadas (permeveis) e
e umidade alternados em 4 diferentes condies);
armazenadas em cmara fria, a uma temperatura de 15C e
determinar um modelo matemtico que explique o
umidade relativa de 30%. A temperatura e a umidade foram
comportamento fisiolgico de sementes de mamona
monitoradas atravs de registros dirios com auxlio de
durante o envelhecimento natural e aps serem submetidas
dataloggers, visando assim, manter as condies adequadas.
ao teste de envelhecimento acelerado, que consiga predizer
A fim de disponibilizar as informaes sobre cada gentipo
com um alto grau de confiabilidade a viabilidade dessas
armazenado, foram levantadas informaes como origem,
sementes em relao ao tempo determinado dentro do
data de coleta, data do armazenamento, alm da ilustrao
modelo; determinar um modelo estatstico que possa
dos mesmos com auxlio de fotografias, que foram realizadas
analisar e definir o comportamento fisiolgico de sementes
sobre papel milimetrado. Todas as informaes foram
de mamona durante o envelhecimento natural e aps
registradas em um banco de dados criado no Programa Axis.
serem submetidas ao teste de envelhecimento acelerado.
Resultados: Foram armazenados para fins de conservao
Sementes de mamona de duas variedades, Paraguau e
47 acessos de R. communis, sendo que 25 destes acessos
Nordestina, foram mantidas em 4 condies distintas de
foram recm-colhidos no municpio de Iraquara e esto

Congresso da UFBA 2017 | Caderno de resumos 35


armazenados a fim de serem utilizados em experimentos *******************************************************************
no LBBB. As fotografias permitem a visualizao de *******************************************
caractersticas como tamanho, presena de rafe, tamanho
da carncula, colorao do tegumento e tamanho da
rea: CINCIAS AGRRIAS - CINCIA E
semente. Concluso: A manuteno da qualidade das
sementes a longo prazo depende de condies adequadas TECNOLOGIA DE ALIMENTOS
ESTUDANTE PIBIC

de armazenamento. Assim sendo, bancos de germoplasmas TRABALHO: ANLISES DE VIABILIDADE E


surgem como estratgias eficazes, pois permitem o controle
das condies ambientais, podendo minimizar os danos por VITALIDADE DE LEVEDURAS CERVEJEIRAS
envelhecimento: processo natural que ocorre nas sementes. PARA CONTROLE DE QUALIDADE EM
Palavras-chaves: Banco de Germoplasma,conservao ex MICROCERVEJARIAS
situ,Ricinus communis L.
******************************************************************* Autor(es): CEZAR MIGUEL SANTOS JR, PALLOMA DE SOUZA
******************************************* SANTOS, CELSO DUARTE CARVALHO FILHO
Resumo: A cerveja uma bebida popular no Brasil,
rea: CINCIAS AGRRIAS - CINCIA E obtida pela fermentao alcolica de mosto, oriundo de
TECNOLOGIA DE ALIMENTOS malte de cevada e gua potvel, com adio de lpulo. A
fermentao feita pela ao de leveduras, principalmente
TRABALHO: ANLISE CENTESIMAL DE a Saccharomyces cerevisiae. Contudo, de grande
SEQUILHOS DE ARARUTA E BOLOS importncia paraa produo de cervejas que as leveduras
empregadas estejam viveis e com o seu metabolismo
INTEGRAIS, ELABORADOS EM UMA ativo. Atualmente existem tcnicas especficas para anlise
COZINHA SOLIDRIA, EM SALVADOR BA e monitoramento destas duas variveis, como por exemplo,
a tcnica por azul de metileno para pesquisa de leveduras
viveis.Neste mtodo foi preparada uma suspenso
Autor(es): ISABELA ORMONDE FERREIRA, RYZIA CARDOSO celular obtida por meio da diluio de 1:10 do resduo da
Resumo: A procura por produtos de panificao com fermentao foi misturada em mesma quantidade com
apelo nutricional tem aumentado entre a populao. Desta volume igual da soluo aquosa de azul de metileno a
forma, as farinhas integrais e mistas, bem como farinhas 0,1%. Posteriormente uma alquota de 10L foi aplicada em
isentas de glten, como a araruta, vm possibilitando a cmara Neubauer para a contagem.J a vitalidade pode ser
criao de vrios produtos para portadores da doena estudada por acidificao do meio, onde uma suspenso
celaca. Este estudo teve por objetivo elaborar e determinar celular padronizada e centrifugada a 3000rpm teve seu
a composio centesimal e a vida de prateleira das diferentes precipitado lavado com gua destilada e pH ajustado para
formulaes de bolos e sequilhos produzidos artesanalmente 6,5, com monitorao de pH por 20 minutos. Sendo que
em uma cozinha solidria. A composio qumica das destes, 10 minutos foram aps adio de500l de soluo
formulaes dos sequilhos e bolos foi avaliada a partir da de glicose estrilEste trabalho teve como objetivo avaliar a
coleta de trs amostras de cada uma das oito formulaes viabilidade e vitalidade das leveduras cervejeiras e identificar
quatro de bolos e quatro de sequilhos, com anlise sua melhor forma de armazenamento para reutilizao
em triplicata, considerando as seguintes determinaes: aps o processo de fermentao. Para tal, uma cerveja foi
umidade (estufa a 105 C); cinzas (mufla 550C); lipdios produzida em laboratrio, da qual foi coletado o resduo
(extrato etreo em Soxhlet); protena (Kjeldahl), carboidratos da fermentao, sendo que deste, uma parte foi separada
por diferena, conforme metodologia do Instituto Adolfo e submetida a processo de lavagem. Posteriormente foi
Lutz. Para os sequilhos - A, B, C e D, de araruta com cebola, realizado o armazenamento em refrigerao e congelamento
araruta bsico, araruta com queijo e araruta com chocolate, para fins de estudo.Devido escassez de estudos referente
respectivamente, verificou-se que os teores de umidade s leveduras cervejeiras na produo artesanal, e com o
variaram de 0,32% a 2,24%. Quanto s cinzas, houve crescente consumo desse tipo de cerveja pela populao,
diferena entre as formulaes (B e D). Para protenas, se faz necessrio este tipo de estudo a fim de trazer mais
observou-se variao de 1,71% a 7,65%, sendo o maior na conhecimentos para os cervejeiros, de como utilizar as cepas
formulao com queijo. Com relao aos lipdios, houve de leveduras ou reutiliz-las.Cinco tempos distintos foram
maior teor na formulao D. Valores em carboidratos foram designados para anlise da viabilidade e vitalidade, utilizando
encontrados similares a valores de outro estudo (62,01% a tcnica do azul de metileno e acidificao do meio,
a 75,50%). Os valores energticos para A, B e C foram respectivamente. As leveduras armazenadas em refrigerao
semelhantes (mdia de 517,95 Kcal), enquanto D foi inferior. apresentaram contagem de clulas viveis superior quelas
Para os bolos integrais: A, B, C e D, de banana, de banana armazenadas sob congelamento mesmo passo que tiveram
sem acar, de laranja e de ma com aveia, respectivamente, sua funo metablica reduzida com o passar do tempo.
a umidade apresentou teores altos, de 29,98% a 53,87%, Palavras-chaves: Leveduras
em comparao literatura. Quanto s cinzas, foi maior cervejeiras,Viabilidade,Vitalidade
na formulao B, sem acar. Para protenas, houve maior
aporte na formulao com aveia (6,42%) e quanto aos *******************************************************************
lipdios, houve diferena entre as quatro, sendo as C e D, de *******************************************
valores superiores. Em relao aos carboidratos no houve
diferena significativa entre as formulaes A, C e D, no
entanto, para a formulao B, elaborado sem acar, foi
inferior. Os resultados revelaram teores de umidade elevados
nas quatro formulaes de bolo, o que pode reduzir a vida
de prateleira dos produtos, enquanto o uso da fcula de
araruta para a produo de sequilhos mostrou-se uma boa
opo de matria prima para portadores de doena celaca.
Palavras-chaves: Bolos integrais,Sequilhos de
araruta,Composio nutricional

36 Congresso da UFBA 2017 | Caderno de resumos


rea: CINCIAS AGRRIAS - CINCIA E concentraes ao qual a populao est exposta, bem como,
estimar a ingesto por crianas e adultos, comparar os dados
TECNOLOGIA DE ALIMENTOS
obtidos com os valores estabelecidos pela legislao, alm
TRABALHO: AVALIAO DOS TEORES DE de avaliar a influncia da data de validade da gua mineral
BISFENOL A EM FRMULAS LCTEAS EM P sobre os nveis desse contaminante qumico.

POR GC-MS

ESTUDANTE PIBIC
Palavras-chaves: Bisfenol A,Contaminante,Embalagens
*******************************************************************
Autor(es): AUGUSTO CEZAR MARTINS SOUZA DA SILVA, *******************************************
CAROLINA OLIVEIRA SOUZA, JANICE IZABEL DRUZIAN, JAFF
RIBEIRO SILVA
rea: CINCIAS AGRRIAS - CINCIA E
Resumo: O bisfenol A um contaminante qumico TECNOLOGIA DE ALIMENTOS
que provoca a desregulao da homeostasia do corpo,
interferindo no funcionamento dos sistemas endcrino TRABALHO: CARACTERIZAO FSICO-
e reprodutivo. Este composto est presente em resinas QUMICA E ANLISE SENSORIAL DE SUCOS
epxi utilizada no revestimento de latas de alimentos, bem
como em plstico policarbonato usado como embalagens MISTOS DE FRUTAS TROPICAIS
para gua mineral. Estudos j demonstraram a migrao
de bisfenol A a partir de recipientes de policarbonato e de Autor(es): EMANUELE ARAJO DOS ANJOS, BRUNA
latas de alimentos resultando em contaminao qumica do RIBEIRO DE CASTRO, RENATA QUARTIERI NASCIMENTO,
produto embalado. Durante o desenvolvimento infantil, a MARIA EUGENIA DE OLIVEIRA MAMEDE
exposio diria a esse desregulador pode produzir distintas
Resumo: O aumento no consumo de bebidas a base de
modificaes das funes estrognicas, ocasionando
frutas foi promovido pela preocupao com a sade, o que
diversas alteraes. Devido ao alto consumo de gua
elevou a procura por bebidas com caractersticas nutricionais
mineral embalada, a ausncia de valores estabelecidos
importantes para a preveno e controle de doenas
pela legislao e a alta exposio de crianas e adultos em
(FIGUEIRAS, 2010). Estudos de sucos base de caj com
virtude da ingesto diria, foi realizada a substituio das
diferentes misturas de sabor mostrou a viabilidade de propor
anlises para identificao e quantificao de bisfenol A em
sabores mistos que mostram boa aceitao sensorial pelos
frmulas infantis por amostras de gua mineral embalada
consumidores (MAMEDE, 2015). A qualidade sensorial de um
em garrafes de plstico policarbonato. Amostra de gua
produto pode ser avaliada por meio de mtodos sensoriais
mineral comercializada na cidade de Salvador foi analisada
descritivos. Estes mtodos tm como objetivo descrever
por cromatografia gasosa com espectrometria de massa
as propriedades sensoriais do alimento, proporcionando
(CG-EM) para identificao de bisfenol A. Teste preliminares
informaes sobre sua aparncia, aroma, sabor e textura. O
foram realizados para avaliar a influncia da temperatura
conhecimento das propriedades sensoriais de produtos pode
(40, 60 e 80C) na reao de derivatizao do bisfenol com
ser um diferencial durante o desenvolvimento e a melhoria
BSTFA:TMCS (99:1), mantendo-se fixo o tempo da reao
de produtos. (LURDES et al., 2010). Este trabalho teve como
(30 min.), volume do reagente (50 L) e a concentrao
objetivos elaborar novos sabores de sucos utilizando polpas
do padro (0,1 g.mL-1). A quantificao foi feita no
de frutas comerciais (caj, cacau, manga e umbu) usando
modo de monitorizao de ons seletivo (372 e 357 m/z)
desenho experimental, avaliar o perfil sensorial usando a
atravs de curva analtica padro (rea x concentrao)
metodologia Anlise Descritiva por Ordenao (ADO) e
nas concentraes de 0,01, 0,05, 0,10, 0,25 e 0,50 g.mL-1
avaliar dentre os sucos de sabores mistos as caractersticas
(R2=0,98), as amostras foram extradas e injetadas em
fsico- qumicas. Os sucos foram elaborados com um padro
quintuplicatas. A anlise da influncia da temperatura na
sendo 50% de polpas de frutas (manga, caj, cacau e umbu),
reao de derivatizao demonstrou que a temperatura de
10% de acar e 40% de gua. A partir disso, obtiveram-se
60C apresentou os melhores resultados, dessa forma, essa
seis formulaes de sucos que foram divididos em dois
foi a temperatura escolhida para as anlises. O produto da
grupos, grupo A (cacau, caj e umbu), nas composies: suco
derivatizao do bisfenol A (bis-trimethylsilyl-ether), obtido
A1 continha 40% de polpa de cacau, 30% de caj e 30% de
atravs de silanizao com BSTFA:TMCS, foi identificado com
umbu, A2 40% de caj 30% de cacau e 30% de umbu e A3
boa definio no tempo de reteno de 17,28 minutos. O
40% de umbu, 30% de cacau e 30% de caj e as outras 30%
valor de bisfenol A encontrado (0,16 g/L) foi inferior aos
de cada polpa em todos os sucos e o grupo B (cacau, caj e
reportados na literatura para gua armazenada em garrafa de
manga), nas composies: o suco B1 continha 40% de caj,
polietileno tereftalato (0,46 g/L) e policarbonato (0,32 g/L).
30% de cacau e 30% de manga, B2 40% de cacau, 30% de caj
No Brasil, no h na legislao valores limites de bisfenol
e 30% de manga e o B3 40% de manga, 30% de cacau e 30%
A em gua mineral. Todavia, comparando com o valor
de caj. Todas as anlises foram feitas em triplicata, os dados
proposto pela Unio Europeia, de 0,1 g.L-1 para compostos
foram submetidos ANOVA seguida pelo teste de mdias de
sem regulamentao, a concentrao encontrada para o
TuKey, com nvel significncia a 5%, utilizando o programa
BPA (0,16 g.L-1) foi superior em 60%. A dose diria tolervel
SAS University Edition verso 1.7.0_76. Para a anlise de
(TDI - Tolerable Daily Intake) para bisfenol A proposta pelo
pH utilizou-se pHmetro, sendo obtido menor pH em A3
Sistema Integrado de Informao de Risco (USEPA) de
(2,68) e maior pH o B3 (3,21). Na anlise da cor, utilizou-se
50 g/kg-1 de massa corporal/dia, e a FAO/WHO Health
o colormetro, que apresentou maior luminosidade foi o B1
Canad (2010) estabelece o valor de 25g/kg-1 de massa
(50,38) e a menor foi o A3 (38,13). Para analisar os slidos
corporal/dia como dose diria tolervel provisria (pTDI).
solveis totais utilizou-se um refratmetro digital, tendo
Considerando a ingesto diria de 2 L da gua analisada
o B1 maior quantidade (14,2) e o A3 a menor quantidade
por um indivduo adulto (70Kg) a ingesto de bisfenol A
(12,9). A viscosidade foi analisada utilizando viscosmetro
foi de 0,32 g/dia e para uma criana (10Kg) considerando
Brookfield digital, sendo o A1 mais viscoso (277,2) e o A3
a ingesto diria de 1 L da gua analisada, a ingesto de
o menor viscoso (113,3). A acidez foi feita pelo mtodo de
bisfenol A foi de 0,16 g/dia, ambos os valores esto abaixo
titulao e foi obtida maior acidez no A1 (0,293) e menor
dos estabelecidos pela FAO/WHO e pela USEPA. Com o
acidez no B3 (0,165). Conclui-se ento, que as anlises
intuito de dar continuidade aos trabalhos, outras marcas
fsico-qumicas determinou que as formulaes apresentam
de gua mineral embalada em garrafes de policarbonato
caractersticas diferentes entre si e mesmo apresentando
e em outros polmeros sintticos sero analisadas quanto a
pequenas diferenas nas formulaes. O perfil da anlise
presena de bisfenol A. Dessa forma ser possvel avaliar as
sensorial foi feito a partir da metodologia de Anlise

Congresso da UFBA 2017 | Caderno de resumos 37


Descritiva por Ordenao (ADO), onde foram utilizadas as rea: CINCIAS AGRRIAS - CINCIA E
mesmas formulaes de sucos das anlises fsico-qumicas.
TECNOLOGIA DE ALIMENTOS
A ADO foi divida em quatro etapas, a primeira etapa foi o
recrutamento dos avaliadores, sendo recrutadas dezesseis TRABALHO: CULTIVO DE MICROALGAS:
pessoas, que preencheram uma ficha informando dados
pessoais e informaes socioeconmicas. Na prxima etapa
CARACTERIZAO DA BIOMASSA QUANTO A
SUA COMPOSIO NUTRICIONAL
ESTUDANTE PIBIC

os avaliadores fizeram o levantamento de termos atravs do


mtodo rede, sendo orientados a relacionar similaridades
e diferenas entre os grupos de sucos. Na terceira etapa, Autor(es): ISAAC DOS SANTOS, CARO RIBEIRO CAZUMB
reuniram-se os provadores para definir os termos levantados SILVA, JOS NGELO WENCESLAU GOES, RYZIA CARDOSO
Termos levantados, para deliberar as definies para os
termos mais indicados. Na ultima etapa, os avaliadores Resumo: Novos meios de produo sustentvel de alimentos
fizeram para o teste de ordenao, trs anlises, ordenando visam substituir a agricultura tradicional que utilizam grandes
as amostras de acordo com o atributos pr-definidos. Os extenses de terras e de gua potvel do planeta propiciando
resultados obtidos foram avaliados a partir da tabela de grande custo ao meio ambiente. Uma das culturas que tem
Newell e McFarlane foi usando o nvel de significncia de recebido grande interesse por parte dos pesquisadores o
5%. Os avaliadores perceberam diferenas nos sucos A1 e cultivo de microalgas, em especial a Spirulina, que obteve
A2 nos seguintes atributos:cor amarelo gema, cor amarelo melhores respostas em produtividade e seu cultivo no causa
esverdeado, brilho, espuma, viscosidade, adstringncia prejuzos ao meio ambiente. Esta microalga uma potencial
gosto cido e sabor caj. Nos sucos A2 e A3 os atributos fonte produtora de nutrientes como complemento alimentar
foram: cor amarelo gema, cor amarelo esverdeado, brilho, humano, alimentao escolar, rao animal, piscicultura
espuma, odor de caj, odor de umbu e sabor umbu. J e produtos farmacuticos em diversos pases, isso porque,
nos sucos A1 e A3 foram os atributos: Odor umbu, odor a microalga apresenta alta digestibilidade e um alto teor
doce, viscosidade, gosto cido, sabor caj e sabor umbu. protico, que pode chegar a 65% em base seca. Devido a
Em relao aos sucos B, foram percebidas diferenas nos grande necessidade de produzir alimentos sustentveis e de
sucos B1 e B2 nos atributos: cor amarelo alaranjado, cor alto valor nutricional, este estudo objetivou caracterizar a
amarelo manga, brilho, espuma, viscosidade visual, odor de biomassa de Spirulina obtida no nordeste brasileiro quanto
manga, viscosidade, gosto cido, sabor caj e sabor umbu. a sua composio nutricional. A biomassa de Spirulina foi
Os sucos B2 e B3 tiveram nesses atributos: odor de manga, caracterizada quanto ao teor de carboidratos pelo mtodo
odor ctrico, adstringncia, gosto doce e gosto cido. E os fenol-sulfrico descrito por (DUBOIS et al., 1956), o teor de
sucos B1 e B3 obtiveram diferenas nos atributos: amarelo protenas utilizou-se o mtodo descrito por (LOWRY et al.,
alaranjado, amarelo manga, brilho, espuma, viscosidade 1951), e a determinao de lipdeos foi utilizado o mtodo
visual, odor de caj, odor ctrico, viscosidade, adstringncia, descrito por (FOLCH; LEES; STANLEY, 1957), ambos teores
gosto cido, sabor caj, sabor manga e sabor cacau. Como j de umidade e cinzas foram determinados pelo mtodo
foi dito, os sucos s diferem nas propores das polpas, mas gravimtrico com o emprego de calor e diferentes faixas
contm a mesma quantidade de gua e acar em todas as de temperaturas de acordo com os mtodos descritos
formulaes. Mas atributo gosto doce apresentou diferena pela AOAC 2000. Quanto composio nutricional da
em duas amostras. Porm os resultados so coerentes com biomassa, aps anlises em triplicata, foram observados
os encontrados por Loures, M. M. R. et al. (2010), em um os seguintes resultados: 59,41 1,04% de protena, 13,51
estudo sobre iogurtes com anlise descritiva por ordenao, 0,34% de lipdeos, 15,24 0,27% de carboidratos, 6,90%
houve diferena entre as amostras no atributo gosto doce, de resduo mineral fixo e 9,84% de umidade. MATSUDO,
apesar de todas as formulaes apresentarem a mesma (2009) estudando a frao proteica e lipdica encontrou
concentrao de aspartame, o que tambm ocorreu quando 52,25 5,26% de protenas e 15,44 3,88% de lipdeos isso
foi avaliado os sucos B1 e B3. possvel que a percepo demonstra importantes valores nutricionais no presente
do gosto doce tenha sido alterada devido s diferenas na estudo, visto que os meios de obteno da biomassa so
consistncia dos iogurtes, assim como tambm nos sucos, semelhantes tanto quanto valores encontrados. Estudos
j que como foram avaliadas na anlise fsico-qumica, as de temas semelhantes conduzidos por COR, et al.
amostras apresentam diferena na viscosidade. Conclui-se (2015) encontraram valores semelhantes para protenas,
ento, que tanto as anlises fsico-qumicas como a anlise carboidratos lipdeos e cinzas, 42,9 4,5 % e 19,1 0,97%, 9,2
sensorial, determinou que as formulaes apresentaram 0,65% e 28,1 1,9%, respectivamente, o que evidencia uma
caractersticas diferentes entre si e que essas diferenas diminuio nos valores de carboidratos e um aumento nos
detectadas pelas anlises fsico-qumicas, mas tambm valores de protenas que nesses achados corroboram para
so perceptveis na ADO. Pode-se entender tambm, que com o estudo em questo, evidenciando que a biomassa
mesmo as amostras apresentarem pequenas diferenas na analisada possui um aporte nutricional expressivo quando
formulao, elas foram detectadas atravs da ADO porque relacionado a alimentao humana. Assim, podemos
houve um treinamento da equipe. Com isso a metodologia concluir que a biomassa de Spirulina uma importante fonte
competente, permitindo discriminao de amostras nutricional para a utilizao na produo de alimentos, bem
semelhantes e estavam de acordo com a caracterizao como no desenvolvimento de alimentos enriquecidos com
fsico-qumica das amostras. a mesma.

Palavras-chaves: bebidas mistas,frutas tropicais,ADO Palavras-chaves: Spirulina, Alimentao,Nutrientes

******************************************************************* *******************************************************************
******************************************* *******************************************

38 Congresso da UFBA 2017 | Caderno de resumos


rea: CINCIAS AGRRIAS - CINCIA E seu perfil nutricional se faz oportuno para ser aproveitado no
desenvolvimento de novos alimentos.
TECNOLOGIA DE ALIMENTOS
TRABALHO: CULTIVO DE MICROALGAS: Palavras-chaves: Spirulina,Microbiologia,Composio
centesimal
CARACTERIZAO DO PERFIL
*******************************************************************
MICROBIOLGICO DA BIOMASSA DE

ESTUDANTE PIBIC
*******************************************
SPIRULINA PLATENSIS
rea: CINCIAS AGRRIAS - CINCIA E
Autor(es): DANIEL CALHEIROS, JOS NGELO WENCESLAU TECNOLOGIA DE ALIMENTOS
GOES, CARO RIBEIRO CAZUMB SILVA
TRABALHO: CULTIVO DE MICROALGAS:
Resumo: A Spirulina plantesis, pertencente ao filo da
Cyanobacteria que contm cerca de 35 espcies descobertas, TCNICAS PARA OBTENO DE
desse filo alm da mesma a Spirulina mxima e a Spirulina CAROTENIDES.
fusiformis so utilizadas na alimentao humana. O cultivo
se d pela formao de biomassa das espcies em tanques Autor(es): RAFAELA BARBOSA LIMA DOS SANTOS, CARO
com iluminao natural. So utilizadas na indstria como RIBEIRO CAZUMB SILVA, DALVA MARIA DA NOBREGA
corantes e no Brasil j utilizada na alimentao escolar, FURTUNATO, RYZIA CARDOSO, ITACIARA LARROZA NUNES
desde que declarada na lista de ingredientes dos insumos
de acordo com a VII lista dos novos ingredientes aprovados Resumo: A Spirulina platensis uma microalga que tem
pelas Comisses Tcnico-Cientficas de Assessoramento sido alvo de estudos cientficos devido divulgao de
em Alimentos Funcionais e Novos Alimentos (CTCAF) e informaes sobre a sua aplicabilidade ecolgica, econmica
a Anvisa (Agencia Nacional de Vigilncia Sanitria). Fonte e nutricional. A grande vantagem da Spirulina que esta
de -caroteno, Ferro, protena de alta digestibilidade, pode duplicar sua biomassa em 2 a 5 dias e pode apresentar
possuem tambm outros compostos bioativos como as em sua biomassa o pigmento -caroteno em nveis de
ficobiliprotenas, a ficoeritrina (vermelho) e a ficocianina 0,5mg/kg/1-2g/kg de matria seca (CHRISTAKI et al. 2013).
(azul), que funcionam como antioxidantes. O objetivo deste A Spirulina uma fonte protica alternativa muito utilizada
trabalho caracterizar o perfil microbiolgico da Biomassa como complemento alimentar humano, alimentao
de Spirulina platensis obtida no nordeste Brasileiro (Salvador), escolar, rao animal, piscicultura e produtos farmacuticos
a fim de entender quais microrganismos so passiveis de em diversos pases. Isso porque, a microalga apresenta
desenvolvimento na mesma e sua viabilidade na produo alta digestibilidade e um alto teor protico, que pode
de alimentos. A biomassa obtida foi seca a 55 C, triturada, chegar a 65% em base seca (HU, 2004). Os carotenides
peneirada e homogeneizada, desta retirou-se alquotas para tm sido objeto de inmeros estudos, em razo das suas
as anlises e todas foram realizadas em triplicata. Foram importantes funes biolgicas no ser humano, alm
realizadas anlises de Salmonella sp., mesfilos, coliformes de seu papel como pigmentos naturais (CONTATO et. al,
totais e termotolerantes segundo protocolo da American 2010), tem atividade de pr-vitamina A, alm de atuar na
Public Health Association (2001). Foram realizadas anlises proteo de clulas contra radicais livres, sendo, portanto,
de protenas totais conforme Association of Official importantes antioxidantes naturais (KRINSKY, 2005; STAHL
Analytical Chemists (2000), lipdios de acordo com Folch; e SIES, 2003). Desta forma, este estudo objetiva a extrao
Lees e Stanley (1957) e carboidratos por diferena. Como dos carotenides presentes na Spirulina, tendo sempre
resultado a biomassa apresentou ausncia de Salmonella como foco a obteno da sua biomassa em quantidade
sp. em 25 g, coliformes totais e termotolerantes <3,0 NMP/g, suficiente para alavancar atividades futuras do projeto. As
e contagem de aerbios mesfilos igual a 2,7x104 UFC/g. amostras de microalgas utilizadas no presente estudo foram
Quanto aos valores de protenas, lipdios e carboidratos Spirulina sp. cultivada em reatores abertos do tipo raceway,
a biomassa apresentou 59,411,04 %, 13,510,34 %, e utilizando meio de cultivo Zarrouk (ZARROUK, 1966), na
15,240,27 %, respectivamente. Sendo assim, a biomassa Universidade Federal da Bahia (UFBA),onde juntamente
mostrou-se com percentuais elevados de nutrientes. Pode- com a Faculdade de Farmcia, montou-se uma estrutura
se dizer que a mesma foi produzida dentro de padres pertinente a esse tipo de cultivo. A extrao dos carotenides
adequados de higiene, podendo ser utilizada como da microalga Spirulina sp. foi realizada de acordo com o
suplemento alimentar ou adicionada a alimentos. Quanto mtodo convencional (RODRIGUEZ-AMAYA, 1999). Nas
qualidade Microbiolgica, Barros (2010) verificou em seus anlises em triplicata de extrao de carotenides, a relao
estudos resultados de coliformes termotolerantes menores massa:volume variou de 0,5:10g/ml a 0,5:20g/ml, onde os
do que o padro microbiolgico em trs tipos de formulao valores encontrados de carotenides totais (229,18g/g
de macarro, variando na concentrao de biomassa a 250,72g/g) representados por percentuais de 84,18% a
que foram de 5%, 10% e 15% de Spirulina e os valores 92,09% com tempos de extraes de 30 a 35 min. Nota-se
encontrados foram de < 2,0 x 10 NMP/g; < 2,5 x 10 NMP/g; < ento que os melhores resultados em termos de rendimento
1,0 x 10 NMP/g. Mira (2015) tambm encontrou ausncia de de extrao foram obtidos nos experimentos B (250,72g/g;
Salmonella (ufc/g), Enterobactrias (ufc/g), L. monocytogenes razo massa: volume 0,5:15 (g/ml) e extraes de 30
(ufc/g), E. coli (ufc/g) em 25g de suas amostras de iogurte min.).Consequentemente foi escolhida como condio
suplementado com S. plantesis, o que confere segurana tima a qual foi utilizada razo massa:volume 0,5:15 (g/mL) e
da biomassa em usos culinrios. Barros (2010) observou extraes de 30 min., uma vez que o percentual de extrao
que a quantidade de protenas na fase exponencial ou de de carotenides foi de 92,09%, alm das vantagens de menor
crescimento da Spirulina, era em maior quantidade variando tempo total de anlise, menor gasto de solvente e utilizao
49,28% 60,58% e na fase estacionria caia para apenas de etanol, considerado GRAS e portanto seguro para a
10,43% em mdia, quanto aos lipdios os valores encontrados utilizao e aplicao na indstria de alimentos. Dessa forma,
variam de 1,49 a 5,08% e os valores de carboidratos tiveram pensando no menor tempo de anlise e no uso de solvente
valores em mdia 48%, o autor justifica que a variao considerado seguro- GRAS (Generally Recognized As Safe)
na composio da cultura depende do seu estgio de para a obteno dos carotenides, este mtodo pode ser
maturao. Desse modo, observa-se que a biomassa da considerado vivel para aplicao em escala industrial, visto
Spirulina platensis apresenta um padro microbiolgico que a tcnica com o uso de solventes para a extrao de
dentro do recomendado para a produo de alimentos e que carotenides bem estabelecida na indstria de alimentos.

Congresso da UFBA 2017 | Caderno de resumos 39


Agradecimentos: Fundao de Amparo a Pesquisa do Estado atividade antimicrobiana, comparado ao filme controle, a
da Bahia. partir dos padres exigidos pela RDC-12 o aumento de vida
til de queijos fatiados tipo muarela foram de 12 dias.
Palavras-chaves: Microalgas,Spirulina, Carotenides
Palavras-chaves: Amido,embalagem ativa,antimicrobiano
*******************************************************************
******************************************* *******************************************************************
ESTUDANTE PIBIC

*******************************************
rea: CINCIAS AGRRIAS - CINCIA E
TECNOLOGIA DE ALIMENTOS rea: CINCIAS AGRRIAS - CINCIA E
TRABALHO: AVALIAO DA ATIVIDADE TECNOLOGIA DE ALIMENTOS
ANTIMICROBIANA DE FILMES ATIVOS TRABALHO: CARACTERIZAO DE FILMES
BIODEGRADVEIS, INCORPORADOS ATIVOS BIODEGRADVEIS, INCORPORADOS
COM NANOPARTCULAS DE AMIDO E COM NANOPARTCULAS DE AMIDO E
LEO ESSENCIAL DE ORGANO COMO LEO ESSENCIAL DE ORGANO COMO
ANTIMICROBIANO. ANTIMICROBIANO.
Autor(es): PRISCILA SOUSA OLIVEIRA MATOS, ALASE
Autor(es): LUDIMYLLA SOUZA FARIAS, PRISCILA SOUSA
GUIMARES, LUCAS GUIMARES CARDOSO, LUDIMYLLA
OLIVEIRA MATOS, LUCAS GUIMARES CARDOSO, ALASE
SOUZA FARIAS
GUIMARES
Resumo: Os polmeros biodegradveis vm sendo estudados
Resumo: Os polmeros biodegradveis vm sendo estudados
na busca por encontrar materiais polimricos renovveis
na busca por encontrar materiais polimricos renovveis,
e que conferiram um aumento na qualidade dos produtos
ecolgicos e que possam conferir um aumento na qualidade
alimentcios. Porm muitos destes polmeros biodegradveis
dos produtos alimentcios, por meio das embalagens
possuem problemas relacionados ao desempenho, como
antimicrobianas. Materiais biodegradveis como o amido
baixa resistncia mecnica e trmica, alm da fraca barreira
tornaram-se uma alternativa para diminuio deste impacto,
a umidade, limitando o uso de embalagens biodegradveis
no entanto, filmes de amido apresentam pouca flexibilidade
por parte das indstrias. O presente trabalho objetivou
e baixa resistncia, a incorporao de suas nanopartculas
desenvolver filmes ativos biodegradveis, incorporados
visa melhorar essas caractersticas. Embalagens ativas
com leo essencial de organo (Origanum vulgare) e
conferem um aumento na qualidade dos produtos
nanopartculas de amido, e avaliar as propriedades
alimentcios, pela incorporao de um antimicrobiano, por
fsicas, mecnicas, microscpicas e de barreira dos filmes
exemplo, o leo essencial de organo que conhecido por
produzidos. Os filmes foram obtidos atravs do mtodo
possuir ao antimicrobiana. Objetivo do presente estudo
de casting, e foram submetidos a testes mecnicos para
foi avaliar a atividade antimicrobiana dos filmes de amido
avaliao da resistncia carga mxima e alongamento
incorporado de leo essencial de organo em analises in
de acordo com a norma ASTM D88209 (ASTM, 2002). A
vitro frente a diferentes micro-organismos patognicos
anlise termogravimtrica (TGA) foi analisada utilizando
contaminantes de alimentos e em analises in vivo em queijos
um analisador termogravimtrico. O mtodo dessecante,
fatiados do tipo muarela. Os filmes foram produzidos pela
segundo a metodologia ASTM E 96/E 96M 05 (ASTM, 2009),
tcnica de casting, a base de amido de milho, plastificados
foi empregado para determinao da permeabilidade dos
com glicerol, incorporados com nanopartculas de amido
filmes. A anlise de Espectroscopia de Infravermelho com
e leo essencial de organo (OEO) e foram estudadas trs
Transformada de Fourier (FTIR) utilizada para caracterizar as
concentraes do leo essencial de organo (0,0; 5,0; e
mudanas induzidas pela incorporao de leo na matriz
10,0%). Para anlise da eficincia antimicrobiana in vitro
dos filmes foi realizada por meio da tcnica de Refletncia
foram utilizadas culturas de Escherichia coli, Staphylococcus
Total Atenuada (ATR). Foram produzidos filmes em trs
aureus e Salmonella sp, seguindo a metodologia descrita
formulaes distintas, com 0%, 5% e 10% de leo essencial
pelo CLSI. Para anlise da eficincia antimicrobiana in vivo
de organo. Os espectros FTIR apresentaram mudanas na
das fatias de queijo tipo muarela, foram realizadas de
amplitude dos picos na banda de absoro 3500-3000 aps
acordo com a metodologia descrita pela APHA (2001), nos
a adio do leo essencial de organo, demonstrando a
tempos 0, 7, 14, 21 dias, acondicionados em temperatura 8
eficincia da incorporao do OEO. A estabilidade trmica
2C. Os filmes contendo 5,0 e 10,0 g de OEO apresentaram
obtida das formulaes 0%,5%,10% e das nanopartculas
eficincia antimicrobiana in vitro com inibio do
de amido foram, respectivamente, 63,08C, 47,99C,
crescimento das bactrias Escherichia coli medida do halo
45,30C e 50,61C. A anlise da permeabilidade ao vapor
de inibio de (21 mm/5g de OEO e 24 mm/10g de OEO),
de gua apresentou uma relao linear, aumentando a
Staphylococcus aureus (26 mm/5g de OEO e 36 mm/10g de
permeabilidade de acordo com o aumento da concentrao
OEO) e Salmonella sp (21 mm/5g de OEO e 24 mm/10g de
de OEO. As formulaes 0%,5% e 10% demonstraram
OEO), respectivamente. A anlise in vivo,das fatias de queijo
PVA 13,1%,11,73% e 124,77%, respectivamente. Quanto
tipo muarela no tempo 0, encontrou-se dentro dos padres
ao teste mecnico, o aumento da concentrao de OEO
exigidos pela resoluo-RDC N 12, de 02 de janeiro de
diminuiu a resistncia trao, alongamento na ruptura
2001. As analises dos tempos 7, 14 e 21 dias houve inibio
e mdulo de elasticidade. A tenso nas formulaes 0%,
significativa do crescimento microbiano das fatias de queijos
5% e 10% foram 1MPa, 0,33MPa e 0,33MPa, assim como
tipo muarela embalados com os filmes 5,0 e 10g de OEO. A
o alongamento na ruptura foi de 15,67%, 14,33%, 6,67% e
variao de aumento entre os tempos 0 at 21 dias frente a
o mdulo de elasticidade foram 24,33MPa, 16,67MPa e
Staphylococcus aureus foi de (1,41 log UFC/g em 5g de OEO
15,67MPa, respectivamente. Com isso, observou-se que a
e 1,93 log UFC/g em 10g de OEO); Coliformes totais de (2,93
incorporao do leo essencial interfere no desempenho dos
log UFC/g em 5g de OEO e 2,78 log UFC/g em 10g de OEO) e
filmes, a medida que aumenta sua concentrao na soluo
Contagem de Mesfilos de (1,98 log UFC/g em 5g de OEO e
filmognica, modificando propriedades fsicas, mecnicas e
1,86 log UFC/g em 10g de OEO), respectivamente. Conclui-se
de barreira.
que os filmes a base de amido, nanopartculas de amido e
incorporados com leo essencial de organo apresentaram

40 Congresso da UFBA 2017 | Caderno de resumos


Palavras-chaves: Embalagens Palavras-chaves: Feijo-azuqui; Composio centesimal;
ativas,Nanotecnologia,Antimicrobianos Cromatografia
******************************************************************* *******************************************************************
******************************************* *******************************************

ESTUDANTE PIBIC
rea: CINCIAS AGRRIAS - CINCIA E rea: CINCIAS AGRRIAS - CINCIA E
TECNOLOGIA DE ALIMENTOS TECNOLOGIA DE ALIMENTOS
TRABALHO: EXTRAO, ISOLAMENTO TRABALHO: INIBIO DA ENZIMA HMG-
E CARACTERIZAO POR SDS-PAGE DA COA REDUTASE POR DIFERENTES FRAES
PROTENA 7S (VICILINA) DO FEIJO PEPTDICAS ORIUNDAS DA PROTENA
ADZUKI (VIGNA ANGULARIS WILLD.) -VIGNINA DO FEIJO-CAUP
Autor(es): VICTRIA CRUZ, MARIANA BARROS DE Autor(es): CAIO ALEXANDRE DA CRUZ SOUZA, MARIANA
CERQUEIRA E SILVA, FABIANA PACHECO REIS BATISTA, MOTA NOVAIS DA CUNHA, MARIANA BARROS DE
CAROLINA OLIVEIRA SOUZA, JANICE IZABEL DRUZIAN, CERQUEIRA E SILVA, JANICE IZABEL DRUZIAN, EDERLAN
EDERLAN FERREIRA FERREIRA
Resumo: As sementes das leguminosas apresentam uma Resumo: Muitos estudos tm demonstrado a presena de
caracterstica de acumularem elevada quantidade de peptdeos biologicamente ativos derivados de protenas dos
protena no cotildone durante seu desenvolvimento. Por alimentos. Por sua vez, as protenas das leguminosas tm
isso, vrias espcies j domesticadas so consideradas recebido ateno especial devido ao seu envolvimento no
importante fontes de protena para alimentao metabolismo lipdico, em especial na hipercolesterolemia.
humana. Entre essas, encontra-se o feijo adzuki [Vigna Estudos recentes realizados pelo nosso grupo de pesquisa,
angularis (Willd.)] cultivado na maioria dos pases tropicais com a protena -vignina (7S) isolada do feijo-caup (Vigna
e subtropicais. No Brasil, tanto a produo quanto o unguiculata) administrada oralmente em ratos por 28 dias,
consumo do feijo adzuki so incipientes. Porm, nos demonstraram uma significativa diminuio da concentrao
ltimos anos para ambos os casos tm sido observado um plasmtica de colesterol total, LDL-C e dos triacilglicerdeos.
crescimento. Este estudo, teve como objetivo determinar Assim, este estudo avaliou a ao inibitria de diferentes
a composio centesimal, parmetros de otimizao de fraes de peptdeos derivados da protena -vignina do
extrao, isolamento e caracterizao da protena globulina- feijo-caup, sobre atividade da 3-hidroxi-3-metillglutaril
7S (vicilina) do feijo adzuki. Para isso, as sementes do feijo coenzyme A redutase (HMG-CoAr), in vitro. Inicialmente,
foram entumecidas por 12 horas/4C, e o epicarpo separado a protena -vignina foi isolada atravs de processos de
do cotildone manualmente. Em seguida, o material foi solubilizao, fora inica, diluio e precipitao no ponto
seco em estufa por 12 horas/50C. Posteriormente, o isoeltrico a partir da farinha. Posteriormente, amostras
cotildone foi pulverizado e a farinha obtida foi tamisada da -vignina isolada foram cromatografadas em coluna
a 60 mesh de granulao. Os resultados demonstraram de gel filtrao Sepharose CL-6B (1,0 x 100 cm), num fluxo
que a farinha do feijo adzuki apresentou 8,53 0,25% de 0,48 mL/min. O perfil de eluio foi acompanhado
de substncia volteis 105C (umidade). A constituio registrando-se leitura a 280 nm. O pico correspondente
qumica mostrou ser de 4,06 0,10% de resduo mineral a protena foi recolhido, dialisado e liofilizado. O isolado
fixo (minerais totais), 19,37 0,39 de protenas total bruta, proteico total, a -vignina isolada e parcialmente purificada
3,22 0,15 de lipdios totais e 64,79 0,18% de carboidratos, foram analisados por SDS-PAGE. A -vignina foi hidrolisada
em base seca. Com exceo do contedo proteico que sequencialmente pela ao enzimtica da pepsina (1:66, E/S)
foi inferior aos encontrados em outros estudos (entre em pH 1,5 por 3 horas, e pela pancreatina (1:25, E/S) em pH
22-24%), todos os demais resultados foram similares aos 7,0 por 3 horas. Em seguida, o hidrolisado proteico total foi
reportados na literatura. As condies de extrao da fracionado para peptdeos maiores do que 30 kDa, entre 30-
protena foram avaliadas utilizando parmetros de massa/ 10 kDa, entre 10-3 kDa e peptdeos menores do que 3 kDa,
volume da soluo extratora e tempo de extrao, sendo atravs de filtros de ultrafiltrao. As fraes obtidas foram
a quantidade de protena determinada pelo mtodo de caracterizadas por CLAE, com coluna de fase reversa (C18,
Kjedahl (Fator de correo de 5,7). Os resultados observados 0,45 x 25 cm), acoplado em detector UV/VIS, temperatura de
para o parmetro de massa/volume demonstraram que 40 C, fluxo de 1,3 mL/min e registro a 220 nm. Para a eluio
proporo 1:20 mostrou ser mais eficiente para a extrao dos peptdeos foram utilizados os solventes A (0,045% de
da protena, sendo encontrados valores de 87,80% e 92,80%, TFA em gua ultrapura) e B (0,036% de TFA em acetonitrila),
quando utilizado gua destilada e soluo de NaCl (1,0 com o seguinte gradiente: 100% de A por 10 minutos; depois
mol/L) como extratores, respectivamente. O tempo de 10% de A em 95 minutos, permanecendo nessa condio
60 minutos (90,87%) foi mais eficiente para rendimento por mais 10 minutos e retornando condio inicial em 5
proteico. Posteriormente, a protena globulina-7S foi isolada, minutos. Posteriormente, as fraes foram avaliadas quanto
de acordo com procedimentos de solubilizao, fora inica capacidade de inibio da atividade HMG-CoA, in vitro.
e precipitao no ponto isoeltrico. A globulina-7S isolada O hidrolisado total e a frao constituda por peptdeos <
foi cromatografada em coluna de gel filtrao (Sepharose 3 kDa mostram exercer uma diminuio significativa da
CL-6B, 1,0 x 100 cm). O pico correspondente a protena foi atividade de HMG-CoA, quando utilizados 0,5 mg/protena/
recolhido, em seguida a protena foi precipitada e liofilizada. mL. Alm disso, as fraes peptdicas de 30-10 kDa e 10-3
A caracterizao molecular por SDS-PAGE foi realizada a kDa mostraram inibir a atividade HMG-CoA em um nvel
partir de amostra do isolado proteico, protena 7S isolada superior a 50%, nas mesmas condies experimentais. A
e obtida pela cromatografia. Os resultados demonstraram frao peptdica < 3 kDa foi constituda por quatro peptdeos
que os processos de isolamento e cromatogrfico foram majoritrios. Estudos subsequentes esto sendo realizados
eficientes para a obteno da protena, com grau de pureza a partir de peptdeos sintetizados com sequncia primria
superiores a 90%. Estudos subsequentes sero realizados oriunda da protena -vignina (7S) isolada do feijo-caup,
a partir da protena parcialmente purificada para avaliar afim de validarmos o reconhecimento como um agente
a propriedade redutora de colesterol sugerida por alguns hipocolesterolmico.
estudos da literatura.

Congresso da UFBA 2017 | Caderno de resumos 41


Palavras-chaves: Vigna unguiculata,Peptdeos manejo ps-colheita e beneficiamento dos vegetais. Nesse
bioativos,Sntese de colesterol endgeno sentido, importante tambm que sejam implantadas
medidas educativas orientadas para os vendedores, de
******************************************************************* modo a sensibiliz-los quanto adoo das boas prticas
******************************************* e ao melhor manejo dos vegetais, contribuindo assim para
promover a segurana alimentar.
ESTUDANTE PIBIC

rea: CINCIAS AGRRIAS - CINCIA E


Palavras-chaves: perdas ps-colheita,higiene de
TECNOLOGIA DE ALIMENTOS alimentos,segurana alimentar e nutricional
TRABALHO: PERDAS PS-COLHEITA NA *******************************************************************
CEASINHA DE PARIPE, SALVADOR-BA *******************************************

Autor(es): EMILY SODR ANDRADE, SIDIONE FERREIRA rea: CINCIAS AGRRIAS - CINCIA E
DOS SANTOS, RYZIA CARDOSO, AMANDA ALMEIDA TECNOLOGIA DE ALIMENTOS
Resumo: Introduo - O desperdcio de alimentos, TRABALHO: QUANTIFICAO DE
principalmente de frutas e hortalias, bastante evidente
no Brasil e no mundo. Este fato preocupante, tendo COMPOSTOS FENLICOS E DETERMINAO
em vista perdas econmicas e na oferta de alimentos DA ATIVIDADE ANTIOXIDANTE DE
populao, ao mesmo tempo em que contrasta com elevado
ndice de cidados que vivem em situao de pobreza e CHOCOLATES PRODUZIDOS A PARTIR
fome. Objetivo - Analisar as perdas de frutas e hortalias DE CINCO VARIEDADES DE CACAU
comercializadas na Ceasinha de Paripe, de Salvador-BA,
assim como, seus fatores determinantes e solues para THEOBROMACACAO L., CULTIVADOS NA
amenizar o problema. Mtodos - A coleta de dados foi REGIO SUL DA BAHIA
organizada em trs etapas: a primeira foi a ambientao, para
mapeamento do quantitativo de vendedores; na segunda
Autor(es): ALANA LUCIA OLIVEIRA MONTEIRO, ELIETE
etapa, foram realizadas entrevistas com os vendedores, a fim
BISPO
de levantar dados a respeito das perdas de frutas e hortalias;
na terceira etapa, foram realizadas observaes no local, nos Resumo: O interesse pelos compostos bioativos do cacau
dias de recebimento de mercadorias e de maior movimento, tem aumentado devido a sua capacidade antioxidante e
para identificar a sistemtica de aquisio, organizao, outros aspectos positivos e benefcios sade. A explorao
comercializao, por parte dos vendedores e tambm dos da cultura do cacau (Theobroma cacao L.) realizada
consumidores, no momento de compra. As entrevistas com interesse nos seus derivados, entre eles o chocolate.
foram realizadas por meio de questionrio semiestruturado, Esses compostos tm sido estudados devido influncia
previamente testado. O estudo foi aprovado pelo Comit negativa que exercem no sabor, conferindo o amargor e a
de tica da Escola de Nutrio (Parecer n 1.956.642). adstringncia, por outro lado, descobertas mais recentes
Resultados - A Ceasinha de Paripe constituda por 35 boxes sobre os efeitos benficos desses compostos sade
de frutas e hortalias. No total, 20 vendedores participaram humana tm provocado interesse em mant-los durante
da entrevista e 15 recusaram. Ainda que as Ceasinhas sejam o processamento dos produtos, sem causar prejuzo no
locais de distribuio de alimentos, o que se observou sabor. A regio cacaueira da Bahia o principal polo de
foram locais desorganizados, com srios problemas produo da cacauicultura nacional e em funo da crise
estruturais e operacionais. A mdia de idade dos vendedores os cacauicultores baianos vm buscando alternativas
foi de 41 anos, predominando homens. A maioria dos para agregar maior valor ao produto final de cacau, como
entrevistados possuam baixo nvel de escolaridade, o plantaes de cacau monoclonais, buscando novos
que concorda com a maioria dos achados na literatura. mercados de nicho como o de orgnico, fino, gourmet
Verificaram-se muitas inadequaes higinico-sanitrias, e/ou especial; a inovao tecnolgica; e as certificaes
quanto infraestrutura e s prticas dos vendedores, scio ambientais.. Dessa forma este trabalho teve como
como a manipulao simultnea entre vegetais e dinheiro. objetivo estabelecer caractersticas qumicas de chocolates
Tratando da formao em Boas Prticas de Manipulao, proveniente de cinco variedades (SR162, PH16, BN34,
95% relataram nunca ter participado de qualquer curso. CEPEC2002 e TSH1188), atravs da quantificao de
Tambm foram verificadas a presena de animais/vetores, bioativos, buscando agregao de valor e conquistas de
como cachorros, moscas e baratas, circulando entre as novos mercados nacionais e internacionais. O teor de
bancas, lixo acumulado (restos de vegetais) no cho, ao compostos fenlicos totais, flavonides, antocianinas, cafena,
redor das bancas e entre os vendedores, e a formao teobromina, catequina e epicatequina e as atividades
de poas de gua acumulada - fatores que contribuem antioxidantes DPPH, FRAP e CUPRAC foram determinados
potencialmente para a contaminao dos alimentos. Em nas variedades de chocolate. Os resultados da Anlise de
geral, os comerciantes possuam bom planejamento para Componentes Principais, ANOVA e Teste de Tukey (p<0.05)
aquisio dos vegetais, visando evitar perdas financeiras. As mostraram diferenas significativas entre as amostras. Existe
perdas das frutas e hortalias, para a maioria dos produtos, uma variao considervel entre as variedades analisadas
variou entre 5% a 35%, sendo a banana a fruta mais quanto ao seu teor em compostos bioativos e atividade
relatada. Em relao s hortalias, o tomate e o pimento antioxidante. A variedade SR162 mostrou os menores valores
foram os mais citados, sendo justificados pela elevada para compostos fenlicos, flavonoides e antocianinas e maior
sensibilidade destes frutos. As principais causas de perdas valor de DPPH por precisar de uma maior quantidade de
incluram o manuseio excessivo, por parte dos vendedores amostra para exercer a atividade antioxidante. A variedade
e consumidores e o acondicionamento inadequado. Para TSH1188 apresentou os valores mais altos de compostos
aumentar a durabilidade dos vegetais mais sensveis, alguns fenlicos, flavonoides e atividade antioxidante FRAP.
vendedores possuam geladeira e/ou freezer, para auxiliar
no armazenamento. Concluso - Apesar de ser difcil a Palavras-chaves: compostos
padronizao de avaliao das perdas de frutas e hortalias, bioativos,chocolate,antioxidante
pela alta perecibilidade que esses alimentos apresentam, *******************************************************************
o estudo sinaliza a necessidade de melhorias, tanto na *******************************************
parte estrutural quanto nos cuidados de higiene e no

42 Congresso da UFBA 2017 | Caderno de resumos


rea: CINCIAS AGRRIAS - CINCIA E Palavras-chaves: Sucos mistos,Frutas tropicais, Prebitico
TECNOLOGIA DE ALIMENTOS *******************************************************************
TRABALHO: TESTE DE ACEITAO E *******************************************

CARACTERIZAO FSICO-QUMICA E rea: CINCIAS AGRRIAS - CINCIA E


QUMICA DE SUCOS MISTOS DE FRUTAS

ESTUDANTE PIBIC
TECNOLOGIA DE ALIMENTOS
TROPICAIS COM ADIO DE PREBITICO TRABALHO: TRIAGEM IN SLICO
Autor(es): BRUNA RIBEIRO DE CASTRO, EMANUELE DE PEPTDEOS DERIVADOS DA
ARAJO DOS ANJOS, RENATA QUARTIERI NASCIMENTO, -CONGLICININA COM PREDIO DE
MARIA EUGENIA DE OLIVEIRA MAMEDE
INTERAO/ENCAIXE NO STIO DA HMG-
Resumo: O mercado brasileiro de sucos e nctares prontos
para beber est em franca expanso, acompanhando a
COA REDUTASE
tendncia mundial de consumo de bebidas saudveis,
convenientes e saborosas (MAMEDE et al., 2013).Os Autor(es): MARIANA MOTA NOVAIS DA CUNHA,
prebiticos so definidos como ingredientes alimentares EDERLAN FERREIRA, BIANE OLIVEIRA PHILADELPHO, CAIO
que no so digeridos, mas que estimulam a multiplicao ALEXANDRE DA CRUZ SOUZA, JANICE IZABEL DRUZIAN,
e/ou atividade de uma ou mais espcies de bactrias no MARIANA BARROS DE CERQUEIRA E SILVA, MARCELO
clon, afetando beneficamente o hospedeiro (Haarman, CASTILHO
Knol, 2005).Diante do exposto, o objetivo desse estudo foi Resumo: Muitos estudos tm buscado a elucidao do
avaliar a aceitao e caracterizar os atributos fsico-qumicos efeito hipocolesterolmico exercido pela protena da soja
de sucos mistos de frutas tropicais com adio de prebitico. (Glycine max). Nossos estudos anteriores a partir de ensaios
Nesse estudo, foram produzidos sucos mistos a partir de in vitro e in vivo, indicaram que peptdeos derivados da
polpa de frutas nos sabores caj, cacau, manga e umbu, protena -conglicinina seriam os elementos responsveis
tendo estas propores de sabores diferentes, considerado por essa propriedade. Assim, este estudo realizou uma
para cada suco 50% de polpa, 40% de gua, 10% de acar triagem de peptdeos derivados da -conglicinina, com
e para cada 100 ml de suco foi adicionado 0,26g de FOS. As predio inibitria sobre a HMG-CoA redutase, a partir de
propores de polpas utilizadas foram: A1 (30% caj, 30% ferramentas in slico. A sequncia primria da subunidade
umbu, 40% cacau), A2 (40% caj, 30% umbu, 30% cacau), (GenBank:BAE02726.1; UniProtKB: GLCAP_SOYBN)
A3 (30% caj, 40% umbu, 30% cacau); B1 (30% cacau, 30% da protena -conglicinina foi obtida a partir do NCBI e
manga, 40% caj), B2 (40% cacau, 30% manga, 30% caj), confirmada no banco de dados da UniProtKB/TrEMBL. A
B3 (30% cacau, 40% manga, 30% caj). Foram realizadas as mimetizao do processo gastrointestinal para prever
anlises de acidez total titulvel expresso em % de cido os peptdeos gerados foi realizada pela ao sequencial
ctrico mol/L-1, conforme descrito pelo Instituto Adolfo Lutz da enzima pepsina (EC 3.4.23.1), tripsina (EC 3.4.21.4) e
(2008), pH, viscosidade a 60rpm com spindle S63, slidos quimotripsina (EC 3.4.21.1), atravs do programa BIOPEP.
solveis totais expresso em Brix e colorimetria, todos em O resultado demonstrou que o nmero de 102 fragmentos
triplicatas. Alm disso, foram realizados testes de aceitao peptdeos foram gerados. O potencial bioativo dos peptdeos
do consumidor com 100 avaliadores. Estes avaliaram o foi avaliado atravs do servidor web PeptideRanker Score,
suco em escala no estruturada de 0 a 10 e informaram sendo que 11 sequncias primrias foram consideradas
os atributos que mais gostaram e o que menos gostaram potencialmente ativas apresentando score a 0,700 (escala
de cada um dos sucos. Os resultados foram submetidos de 0,000 a 1,000). Em seguida, estes peptdeos foram
anlise de varincia (ANOVA) e teste de mdias por Tukey, avaliados quanto a probabilidade de interao com o
com p 0,05, e foi utilizado o programa SAS, verso 4.2. complexo catalticos da HMG-CoA redutase, a partir dos
Foram encontradas mdias maiores que 7 para os sucos A1 modelos de interao dos seguintes inibidores comerciais:
(7,5) , A2 (7,07), A3 (7,53) e B2 (7,31) e maiores que 6 para simvastatina, mevastatina, rosuvastatina, atorvastatina,
os sucos B1 (6,7) e B3 (6,8). Os seis sucos no apresentaram fluvastatina, cerivastatina e lovastatina, atravs do servidor
diferenas estatsticas, sugere-se que isso pode ter ocorrido web PepSite 2. A confiabilidade do modelo tem como
devido a diferena na formulao de cada suco ser pequena significncia estatstica p < 0,25. No entanto, neste estudo
e pelo fato dos provadores no terem sido treinados. Dentre ns consideramos somente os peptdeos com elevada
os atributos que os avaliadores mais gostaram foi comum predio (p 0,050) tiveram seu modo de interao
para todos os sucos, sabor e viscosidade e dentre os atributos predito por meio de acoplamento molecular, afim de obter
que os avaliadores menos gostaram esto sabor e acidez. informaes sobre suas interaes com aminocidos que
Para os sucos A1, A2, A3, B1, B2, B3, foram encontrados fazem parte do stio ativo da enzima HMG-CoA redutase.
valores de acidez total respectivamente: 0,246; 0,296; 0,294; Inicialmente, o centro do espao de busca, regio onde
0,246; 0,327; 0,342. Para o parmetro de Ph os valores foram os peptdeos podem interagir foi definido a partir das
3,74; 3,67; 3,77; 4,11; 4,25; 4,21. Na anlise de viscosidade coordenadas cristalogrficas da Simvastatina (PDB ID: 1DQ9).
os valores foram 148; 141,3; 149,3; 188; 194,6 ;206,6. E para A seguir as dimenses da caixa de busca (10-14) foram
slidos solveis totais: 13; 12,4; 12,5; 13,1; 13,4; 13,3. Na otimizadas para que a soluo de maior pontuao sugerida
anlise colorimtrica observou-se os seguintes valores para pelo programa AutoDock-VINA gerasse solues (poses)
L* respectivamente: 42,65; 37,49; 37,35; 42,62; 43,16;43,11. que fossem mais prxima (RMSD < 2,0 ) daquela observada
Para o parmetro de acidez total, viscosidade e pH, os no arquivo 1DQ9. Na sequncia, a funo de pontuao
sucos mistos com manga tiveram maiores valores que os padro do programa foi empregada para gerar as poses dos
mistos com umbu. Na anlise da cor as misturas de manga peptdeos dentro do stio ativo. Embora o programa fornea
apresentaram uma maior luminosidade que as bebidas 10 solues possveis, apenas as 4 de maior pontuao
mistas de umbu Portanto, nota-se que apesar dos sucos foram consideradas na etapa de anlise visual. Os resultados
misto de frutas tropicais possurem os mesmos sabores de demonstraram que 3 sequncias primrias (tripeptdeos)
polpas nas suas formulaes, as diferentes concentraes das com massa molecular entre 350,37 e 399,45 daltons,
polpas produzem novos sabores de sucos com caractersticas apresentaram elevada predio de encaixe e interao,
fsico-qumicas e qumicas distintas. Porm, sensorialmente atravs de pontes de hidrognio, interao hidrofbicas
os sucos no apresentaram diferenas estatsticas entre si. e inicas que foram determinadas. Contudo, estudos

Congresso da UFBA 2017 | Caderno de resumos 43


subsequentes de IC 50% e cintica enzimtica (definio do rea: CINCIAS AGRRIAS - MEDICINA
tipo de inibio) esto em andamento para a avaliao do
VETERINRIA
potencial inibitrio da HMG-CoA redutase pelos peptdeos
sintetizados e purificados. TRABALHO: CARACTERIZAO
Palavras-chaves: -conglicinina, Tripeptdeos,Inibio SOROLGICA E BACTERIOLGICA DE
CES NATURALMENTE INFECTADOS POR
ESTUDANTE PIBIC

enzimtica
******************************************************************* LEPTOSPIRA SPP.
*******************************************
Autor(es): BRUNA LESSA SILVA, LUCAS NOGUEIRA PAZ,
rea: CINCIAS AGRRIAS - MEDICINA DANIELA SANTOS ALMEIDA, BEATRIZ SOUZA PRASERES,
VETERINRIA EVANE OLIVEIRA SENA, JULIANE ARAJO, EVANDRO NETO,
MARTA VASCONCELOS BITTENCOURT, MELISSA HANZEN
TRABALHO: WOLBACHIA SP EM CES E PINNA
VETORES DA LEISHMANIOSE VISCERAL Resumo: A leptospirose uma enfermidade cosmopolita
E SUAS POSSIBILIDADES PARA USO EM que destaca-se como importante problema de sade
pblica. Em ambiente urbano, os roedores so os principais
CONTROLE BIOLGICO reservatrios de Leptospira spp., em especial a espcie
Rattus norvergicus (Ratazana de esgoto). A transmisso
Autor(es): AMANDA ANDRADE DO ROSRIO, NATHALIA da doena ocorre atravs do contato com animais
ROCHA, FRED DA SILVA JULIO, ARTUR GOMES DIAS LIMA infectados ou sua urina, ou quando um animal sadio
DIAS-LIMA, SABRINA MOTA LAMBERT, BRBARA MARIA exposto ao agente atravs de solo ou gua contaminada.
PARAN DA SILVA SOUZA Os ces tambm desempenham um papel importante na
epidemiologia da enfermidade por apresentar uma estreita
Resumo: Recentemente foi descrita a infeco por
relao de proximidade com os humanos. O diagnstico
Wolbachia em Lutzomyia longipalpis, vetor da leishmaniose
clnico da leptospirose complexo devido variedade de
visceral no Brasil. Esta bactria endomssimbionte est
sinais associados enfermidade, necessitando de tcnicas
presente em 60% dos insetos e tem sido sugerida como
laboratoriais para confirmar a infeco por Leptospira spp. O
mecanismo de controle de insetos vetores por causar
teste de soroaglutinao microscpica (MAT) considerado
uma srie de alteraes no hospedeiro e impedir o
padro ouro para testes sorolgicos e recomendado pela
desenvolvimento do parasito. Nesse contexto, estudos
Organizao Mundial de Sade Animal (OIE) como mtodo
sobre a prevalncia de Wolbachia em populaes de
indireto de diagnstico e o isolamento bacteriolgico, uma
vetores de campo e a avaliao da diversidade gentica da
vez que tal procedimento de fundamental importncia
bactria em flebtomos so relevantes. Assim, o presente
para definir a real epidemiologia da regio, como mtodo
trabalho visa determinar a frequncia de infeco e avaliar
direto de diagnstico. O presente estudo objetivou identificar
a diversidade gentica de Wolbachia em Lu. longipalpis de
a presena de anticorpos anti-Leptospira spp. em animais
populaes de reas endmicas para Leishmania. Coletas
suspeitos de leptospirose atendidos no setor de clnica
foram realizadas nos estados da Bahia, Minas Gerais e Rio
mdica de carnvoros do Hospital de Medicina Veterinria
de Janeiro, Brasil, totalizando 956 espcimes de flebtomos,
da Universidade Federal da Bahia (UFBA), oriundos do
as quais foram triadas, identificadas por morfologia e
municpio de Salvador e regio metropolitana, atravs de
realizada a extrao de DNA individual. Foram feitas reaes
soroaglutinao microscpica com antgenos vivos (MAT),
de PCR para o gene 16S e at o momento, foram obtidas
bem como a obteno de isolados de Leptospira spp.
sequncias de cinco amostras as quais foram submetidas
em amostras de urina e sangue de animais clinicamente
anlise de diversidade de hapltiplos. Foram encontradas
suspeitos. Foram atendidos 11 ces entre agosto de 2016 a
22 amostras positivas para Wolbachia (2,3%) em Lutzomyia
julho de 2017. Dentre as amostras de soro coletadas, 8/11
sp, sendo que uma delas foi da espcie Lu. lenti e as demais
(72%) foram sororreativas e 3/11 (28%) apresentaram ttulos
da Lu. longipalpis. A frequncia por estado variou de 2,3%
<100, consideradas no reativas. Em relao distribuio
(1/42) no Rio de Janeiro a 10,6% (5/47) em Minas Gerais,
das reaes, 2/11 (18,18%) apresentaram ttulos 800, 1/11
enquanto que no estado da Bahia foi de 2,9% (16/537).
(9%) com ttulos de 400, 2/11 (18,18%) foram reativas com
Avaliando a sequncia do gene 16S, das cinco amostras
ttulo de 200 e 3/11 (27,27%) demonstraram ttulo de 100.
sequenciadas, foram obtidos 22 loci polimrficos, dos quais
Na distribuio dos sorovares houve predominncia de
14 foram parcimoniosamente informativos. A partir destes
reatividade para Copenhageni (3/8 37%), seguido por
dados, foram encontrados cinco hapltipos. Os resultados
Canicola (2/8 25%), Grippothyphosa (2/8 25%), RgA
confirmam a presena de Wolbachia em Lu. longipalpis em
(1/8 13%). Para as tentativas de isolamento, as amostras
estados do Brasil e descreve pela primeira vez em Lu. lenti.
de sangue e urina coletadas foram inoculadas em meios
Adicional a isso, possvel observar que existem sequncias
de cultivo especficos para o crescimento de bactrias do
que se aproximam mais das sequncias encontradas em
gnero Leptospira em tubos contendo cinco mL de meio
Wolbachia de Drosophila, enquanto que existem outras mais
lquido EMJH (Difco, BD, Franklin Lakes, NJ, USA), meio
prximas s Wolbachia de Culex, o que nos permite indagar
semisslido Fletcher (Difco, BD, Franklin Lakes, NJ, USA) e
sobre a variabilidade desta bactria endossimbionte para
meio lquido (EMJH) acrescido com 5-fluorouracil 100mg/
os diferentes hospedeiros. Existindo possibilidade de que
mL. As culturas foram mantidas a 28 C em estufas tipo B.O.D
essa proximidade com Drosophila ou Culex, seja devido a
e avaliadas em microscpio de campo escuro semanalmente
diferena de cepa entre os espcimes.
por, no mnimo, 16 semanas. A anlise sorolgica foi
Palavras-chaves: Wolbachia,Flebotomneos,Leishmania realizada de acordo com o procedimento padro, com
antgenos vivos para deteco de anticorpos anti-Leptospira.
******************************************************************* Para caracterizao de sororeatividade, consideram-se
******************************************* como reativas as amostras com ttulo 100. At o presente
momento, obtivemos sucesso no isolamento de uma
amostra proveniente de sangue total (1/11 - 9%). No entanto,
a recuperao de leptospiras a partir de amostras clinicas
proveniente de animais naturalmente infectados possui
diversos fatores limitantes, com destaque para o crescimento

44 Congresso da UFBA 2017 | Caderno de resumos


de bactrias contaminantes, alm da necessidade de meios diferentes graus de degenerao, necrose tubular associado
de cultivo enriquecidos e especficos que devem suprir as nefrite intersticial multifocal aguda, inflamao mononuclear,
exigncias nutricionais das leptospiras. Com base no exposto, regenerao tubular e congesto. Mitose, cilindros hialinos/
ressaltamos a importncia da obteno de isolados, a fim de granulares (33,3%), ectasia tubular (33,3%) e pigmento biliar
definir as espcies circulantes em ces da cidade de Salvador (33,3%), foram observados em apenas alguns casos. A nefrite
e regio metropolitana, sobre tudo pela visvel necessidade intersticial observada foi dividida, conforme a intensidade

ESTUDANTE PIBIC
de reorientaes das medidas profilticas no cenrio do infiltrado, em discreta (16,7%), leve (16,7%) e moderada
epidemiolgico local. (66,7%). Dentre as alteraes circulatrias, destacam-se
congesto leve (16,7%), moderada (66,7%) e acentuada
Palavras-chaves: Leptospirose,Canino,Diagnstico (16,7%), e a presena de hemorragia em dois casos
******************************************************************* (33,3%). Outras alteraes incluem a isquemia glomerular,
******************************************* espessamento da cpsula de Bowman e presena de
pigmentos biliares em algumas clulas tubulares e/ou lmen.
Na imuno-histoqumica houve marcao nos fragmentos
Area: CINCIAS AGRRIAS - MEDICINA provenientes dos ces C20 e C29. Observa-se que leptospiras
VETERINRIA induzem, principalmente, nefrite intersticial em ces, com
TRABALHO: AVALIAO HISTOLGICA DA diferentes graus de inflamao e degenerao, leses estas
compatveis com infeces de carter agudo.
COLONIZAO RENAL POR LEPTOSPIRA
Palavras-chaves: Leptospirose,Biofilme,Histopatologia
SPP. EM CES NATURALMENTE INFECTADOS.
*******************************************************************
Autor(es): BEATRIZ SOUZA PRASERES, MELISSA HANZEN *******************************************
PINNA, EVANDRO NETO, BRUNA LESSA SILVA, DANIELA
SANTOS ALMEIDA, LUCAS NOGUEIRA PAZ, JULIANE rea: CINCIAS AGRRIAS - MEDICINA
ARAJO, EVANE OLIVEIRA SENA, MARTA VASCONCELOS VETERINRIA
BITTENCOURT
TRABALHO: ADEQUAO DE ESPAAMENTOS
Resumo: A leptospirose a doena infectocontagiosa
de carter zoontico com maior distribuio no planeta. PARA O BEM ESTAR DE OVINOS EM
Estima-se que ocorram aproximadamente 1,03 milhes de SISTEMA DE PRODUO INTENSIVA NA
novos casos em todo o mundo a cada ano. Tal enfermidade
determinada pela infeco por bactrias patognicas REGIO SEMIRIDA DO BRASIL
do gnero Leptospira spp., que ocorre atravs de contato
direto ou indireto com guas contaminadas ou urina de Autor(es): ADRIELE ARAJO, MANUELA SILVA LIBNIO
portadores. Todos os mamferos podem ser portadores TOSTO, VINCIUS DE PINHO BAILON ALMEIDA
de Leptospira spp. Os ces so hospedeiros acidentais
Resumo: Atualmente a demanda pela carne ovina tem
para vrios sorovares, sendo considerados importantes
aumentado significativamente no Brasil, para tanto,
na epidemiologia da doena. Nas cidades, o rato (Rattus
faz-se necessrio a utilizao de sistema de produo
norvegicus) e os ces tm sido considerados potenciais
que aperfeioem os resultados produtivos e reduza
reservatrios e fontes de infeco para o ser humano,
os efeitos das adversidades encontradas na cadeia
justificando a relevncia em se estudar a infeco em ces,
produtiva, principalmente na regio de maior efetivo do
uma vez que esses animais vivem em contato direto com
pas, o Nordeste brasileiro. A terminao de ovinos em
seres humanos. Alm disso, as leptospiras tem predileo
confinamentos uma estratgia que mitiga os efeitos de
pelo tbulo renal dos animais, onde se alojam e a partir
estacionalidade na disponibilidade de forragens (BARROS et
do qual so liberadas pela urina intermitentemente. Um
al., 2015), e consequentemente no fornecimento de produtos
fator considervel para sobrevivncia e manuteno da
(carne e pele). No entanto, a adoo de qualquer sistema de
maioria das espcies de bactrias a capacidade de formar
criao animal deve prever o bem estar dos animais como
biofilmes - matrizes de substncias exopolimtricas (EPS). Tal
um dos fatores primordiais para sua boa adaptao e para a
estrutura lhes oferece resistncia a diferentes habitats. Sua
qualidade desses produtos. Deste modo, os animais devem
formao favorece a evaso resposta imune do hospedeiro
ser mantidos em ambientes e em espaamentos adequados
e a diversidade do microambiente na qual esto inseridas.
que garantam a sua homeostermia, o seu comportamento
Acredita-se que a formao do biofilme desempenha
natural e espao de zona de fuga individual dos mesmos,
um papel importante na manuteno do transporte
e assim permitir o adequado consumo e digestibilidade
da Leptospira interrogans em animais. Sendo assim, o
de matria seca e nutriente. Assim o presente trabalho
objetivo principal do presente estudo foi avaliar o modelo
Objetivou verificar o melhor espaamento de ovinos em
de infeco prevalente pela identificao da presena de
confinamento que promova o melhor bem-estar, consumo,
biofilme leptosprico em animais soropositivos que foram
desempenho e comportamento ingestivo, nas condies
atendidos no setor de clnica mdica de carnvoros do
climticas do semirido. Foram utilizados 36 ovinos machos,
Hospital de Medicina Veterinria da Universidade Federal da
com peso corporal inicial de 15 kg , mantidos em diferentes
Bahia (UFBA), oriundos do municpio de Salvador e regio
espaamentos: 0,6; 0,9 e 1,2 m/animal. Utilizou-se quatro
metropolitana e que vieram a bito ou foram eutanasiados
repeties por espaamento e densidade de trs animais por
por deciso do mdico veterinrio responsvel, usando
baia, distribudos em delineamento inteiramente causalizado.
histopatologia convencional e marcadores especficos
As baias experimentais possuam divisria de tela campestre
(imuno-histoqumica). A marcao de Leptospira realizada
e cobertura de tela de polietileno com reteno de 70%
por imunohistoqumica (IHQ) usando anticorpo primrio
de luminosidade. A dieta utilizada foi composta por feno
especfico (anti-LipL32) e com marcao membranar, anti-
de Tifton 85 e concentrado, na proporo de 40:60 (V:C)
Leptospira e o sistema de amplificao estreptavidina-
ajustadas para atender o ganhos de 100g/dia. Os animais
biotina-peroxidase. Foram processados 6 fragmentos de
foram mantidos em confinamento, 10 de adaptao a dieta
parnquima renal provenientes dos animais soropositivos
e manejo e 47 de coleta de dados. O consumo de MS e
(C20, C29, C43, C46, C50 e C51) entre agosto de 2016 a
de outros componentes nutricionais aumentou (P<0,05)
julho de 2017, coletados previamente. Como resultado,
de forma linear em funo da maior disponibilidade de
observou-se, atravs da colorao hematoxilina-eosina
espao por animal. Apesar desses resultados os parmetros
(HE), que todas as amostras (100%) apresentavam leses em

Congresso da UFBA 2017 | Caderno de resumos 45


produtivos (ganho de peso e converso alimentar) e tumor tem influncia sobre o comportamento biolgico
comportamentais de cordeiros confinados em grupo, no do carcinoma inflamatrio, podendo estar associado a
foram alterados (P<0,05) pelos diferentes espaamentos comportamento mais agressivo e pior prognstico. De forma
utilizados. Assim recomenda-se o uso do espaamento de curiosa, o animal do grupo CIM que apresentava infiltrado
0,6 m, por demandar menor espao em baia/animal, por histioctico menos expressivo demonstrou sobrevida mais
no comprometer negativamente o bem-estar dos animais longa. Conclui-se que microambiente tumoral, sobretudo
ESTUDANTE PIBIC

e os parmetros produtivos de ovinos em confinamento, o infiltrado inflamatrio, responsvel pela modulao da


mantidos em regies semiridas. resposta inflamatria antitumoral, por meio da promoo de
um microambiente supressor da resposta imunolgica, sob
Palavras-chaves: Confinamento,Ovinos,Bem-estar influncia das clulas neoplsicas.
******************************************************************* Palavras-chaves: Imunovigilncia,Canino,Carcinoma
******************************************* mamrio
*******************************************************************
rea: CINCIAS AGRRIAS - MEDICINA
*******************************************
VETERINRIA
TRABALHO: ANLISE HISTOPATOLGICA rea: CINCIAS AGRRIAS - MEDICINA
E AVALIAO DAS EXPRESSES DE VETERINRIA
FAS-L POR IMUNO-HISTOQUMICA EM TRABALHO: ANLISE IN SILICO E IN VITRO
CADELAS PORTADORAS DE CARCINOMA DE PROTENAS ESTRUTURAIS NO BIOFILME
INFLAMATRIO MAMRIO DE LEPTOSPIRA BIFLEXA
Autor(es): ESTELA BATISTA BRANDO, ALESSANDRA Autor(es): TNIA REGINA MARQUES DA SILVA, GERGIA
ESTRELA SILVA LIMA, KARINE ARAJO DAMASCENO, FRANA, PAULA CARVALHAL RISTOW, PRISCYLA DOS
RAFAEL DA SILVA CARMO NETO, SAMANTHA HELLEN SANTOS RIBEIRO, PEDRO MEIRELLES
SANTOS FIGUERDO, ALINE MICHELLE DOS SANTOS
CONCEIO, HELENITA SILVA DOS SANTOS, JSSICA Resumo: A leptospirose uma zoonose infectocontagiosa
GUIMARES MAGNANI que afeta cerca de um milho de pessoas por ano no
mundo. A doena causada por bactrias patognicas do
Resumo: O carcinoma inflamatrio de mama (CIM) gnero Leptospira, classe Espiroquetas, as quais formam
uma neoplasia extremamente metasttica caracterizada biofilmes in vitro e em rins de ratos colonizados. Biofilmes
clinicamente pelo curso hiperagudo, com neoformao so comunidades de microrganismos aderidos a uma
em forma de placa em uma ou ambas as cadeias mamrias. superfcie bitica ou abitica e envoltos por PIBIC PIBIC
Observou-se que esta neoplasia tem se tornado cada vez uma matriz produzida pelos prprios microrganismos
mais frequente na rotina clnica de pequenos animais, no associados. A matriz composta principalmente por gua,
entanto ainda no existem protocolos eficazes de tratamento mas tambm por polissacardeos, protenas, lipdeos e
para a doena e a sobrevida mdia das cadelas acometidas DNA extracelular. Sabe-se que durante a formao do
inferior a dois meses. Por este motivo, o carcinoma biofilme ocorre a expresso diferencial de protenas, como
inflamatrio representa um dos maiores desafios da reguladores transcricionais, protenas estruturais e fatores
oncologia, tendo despertado o interesse dos pesquisadores de virulncia. Definimos como protenas estruturais aquelas
no intuito elucidar sua fisiopatogenia e determinar alvos que participam na formao da estrutura dos biofilmes
teraputicos efetivos. Sugere-se que esta neoplasia seja bacterianos, como: adesinas de superfcie bacteriana (BAPs,
capaz de evadir e suprimir a resposta imune antitumoral protenas de associao ao biofilme, autotransportadores),
atravs da infiltrao de clulas imunorreguladoras e da apndices bacterianos (flagelo, fmbria e pili) e protenas
induo da apoptose em clulas inflamatrias efetoras no secretadas (hidrolases, liases e proteases). At o momento,
microambiente tumoral. Desta forma, o objetivo deste pouco conhecido sobre os mecanismos moleculares
estudo foi avaliar os mecanismos de supresso imunolgica relacionados formao de biofilmes por Leptospira. O
e evaso tumoral do carcinoma inflamatrio mamrio objetivo principal deste trabalho foi identificar protenas
canino em comparao ao carcinoma mamrio no estruturais envolvidas na formao do biofilme de
inflamatrio em estadio clnico avanado e comparar com Leptospira, atravs de anlises in slico e da expresso
a sobrevida dos animais. Foram estudados carcinomas proteica diferencial in vitro por Western blot. Inicialmente,
mamrios de 22 cadelas, sendo 12 carcinomas inflamatrios realizamos busca manual na base de dados no redundante
de mama. Para avaliao da evaso tumoral, foi realizada do National Center for Biotechnology Information (NCBI)
imunomarcao de FAS ligante em nove amostras de cada protein por protenas adesinas em espiroquetas. Utilizamos
grupo. O percentual mdio de expresso do FAS ligante no os termos de busca adhesin AND spirochetes e exclumos
grupo CEA foi de 27,4%, superior ao observado no grupo as sequncias parciais. Encontramos 495 adesinas, dentre
CIM, que representou 15 % do infiltrado tumoral. Em relao elas: protenas transportadoras de ferro, autotransportadores,
aos subgrupos, o carcinoma inflamatrio secundrio e o lipoprotenas, protenas periplasmtica que se ligam ao zinco,
carcinoma em tumor misto obtiveram marcao superior em protenas hipotticas, entre outras. A partir de ento, criamos
comparao forma clnica primria e carcinoma simples uma planilha contendo: gene, protena, arquivo FASTA,
no inflamatrio. A presena de FAS-L no microambiente organismo, funo da protena e referncia bibliogrfica. A
tumoral e nas clulas neoplsicas esteve associado a partir das adesinas identificadas, estamos realizando anlise
tipos histolgicos menos agressivos e melhor sobrevida de ortologia utilizando a ferramenta do NCBI Basic Local
nos casos estudados, sugerindo que outro mecanismo Alignment Search Tool (BLASTp). Nesta etapa, as sequncias
de evaso tumoral seja empregado por esta neoplasia. O de aminocidos sero comparadas com o genoma da
tipo histolgico mais frequentemente observado entre espcie saproftica Leptospira biflexa (taxid: 172). Esses
os carcinomas inflamatrios foi o carcinoma slido. A resultados sero apresentados no seminrio Estudantil
avaliao do infiltrado inflamatrio associado ao tumor do PIBIC. Para avaliar a expresso in vitro de protenas
revelou predominncia de linfcitos e macrfagos em estruturais em biofilmes de L. biflexa, realizei treinamentos
ambos os grupos, sendo mais pronunciado no grupo CIM. nas tcnicas de cultivo de leptospiras, eletroforese
Alm disso, a intensidade de macrfagos associados ao unidimensional e Western blot. Incubamos L. biflexa

46 Congresso da UFBA 2017 | Caderno de resumos


em meio EMJH a 29C, por 48 horas, em cultura esttica momento, conclui-se que os usos dos catrticos salinos
(biofilmes) e em agitao (planctnicas). Submetemos o no produzem efeitos adversos sobre os parmetros
extrato proteico total eletroforese unidimensional em gel clnicos, entretanto, o uso do DSS e Hidrxido de Magnsio
de 10% seguido de Western blot para a protena OmpL36 umidificaram s fezes, porm, no umedecem as fezes de
(protena de membrana externa de Leptospira), o qual forma significativa como esperado ou relatado na literatura.
estamos padronizando. Os resultados obtidos sugerem

ESTUDANTE PIBIC
que h expresso de OmpL36 tanto no biofilme quanto Palavras-chaves: Equinos,Compactao de Clon,Clica
no estado planctnico de L. biflexa. Adicionalmente, Equina
estamos padronizando a colorao de gis com Azul de *******************************************************************
Coomassie e Nitrato de Prata, bem como um protocolo *******************************************
de extrao proteica mais eficiente. Esperamos com esse
trabalho contribuir para o conhecimento dos mecanismos
moleculares envolvidos na formao de biofilme por rea: CINCIAS AGRRIAS - MEDICINA
Leptospira e dessa forma enriquecer o conhecimento sobre a VETERINRIA
patognese da leptospirose. TRABALHO: AVALIAO DA
Palavras-chaves: Leptospira,biofilme,protemica ANTIGENICIDADE DE PROTENAS
******************************************************************* DE CORYNEBACTERIUM
*******************************************
PSEUDOTUBERCULOSIS EM AMOSTRAS DE
rea: CINCIAS AGRRIAS - MEDICINA ANIMAIS INFECTADOS
VETERINRIA
Autor(es): MARIA EMLIA ALCNTARA, MARCOS
TRABALHO: AVALIAO CLINICA E BORGES RIBEIRO, MARIANA ARAJO PEREIRA, SAMANTA
LABORATORIAL DOS EFEITOS DOS QUEIROZ SANTOS, ZUNARA VICTORIA SANTANA, EULA
NEVES, EVELIN KEILA DOS SANTOS BOMFIM, MARIA DA
CATRTICOS SALINOS EM EQUINOS. CONCEIO AQUINO S, ROBERTO MEYER, SONGELI
MENEZES FREIRE
Autor(es): TATYANE CRISTINE DA SILVA, MARISTELA DE
CASSIA SEUDO LOPES, MARIA CAROLINA SOARES DE Resumo: Introduo: A linfadenite caseosa, causada por
SOUSA, NATLIA FONTES, EZEQUIEL PEREIRA VIANA NETO, Corynebacterium pseudotuberculosis (Cp), uma doena
EDUARDO DE OLIVEIRA COSTA, ABRAO SANTOS NUNES, cosmopolita de carter crnico e que acomete grande
LENIDAS NETO, WESLEI LIMA GONALVES, GABRIEL parte dos pequenos ruminantes do Nordeste brasileiro
NUNES GUIMARES causando prejuzos criao desses animais devido a
reduo dos rebanhos, da taxa reprodutiva e do valor dos
Resumo: O tratamento clnico, na maioria dos casos, a produtos derivados (FONTAINE, 2007). A resposta imune
primeira escolha como forma teraputica para as clicas contra Cp, bactria intracelular facultativa, envolve aspectos
provenientes de compactaes do intestino grosso, incluindo da imunidade humoral e celular, e pode ser analisada por
suspenso da alimentao at a resoluo da compactao, citometria de fluxo, com dosagem de citocinas. Objetivo:
reidratao da ingesta, frmacos analgsicos e a utilizao Avaliar a antigenicidade do extrato protico semi-purificado
de laxantes e catrticos salinos como frmacos adjuvantes. de Corynebacterium pseudotuberculosis em amostra de
Entretanto, as doses frequentemente utilizadas destes animais com linfadenite caseosa. Metodologia: Quinze
laxantes, principalmente nos equinos, so empricas e ovinos SRD divididos em dois grupos: (Grupo controle-G1)
usualmente vem da medicina humana. O objetivo desde 4 animais inoculados com salina estril; (Grupo infectado-G2)
trabalho foi avaliar os efeitos clnicos e laboratoriais dos 11 animais inoculados com Cp selvagem, cepa VD57. Nos
catrticos salinos empregados na medicina equina, para o dias 0, 2, 7, 14, 28, 42, 49, 60, 70 e 90, 120, 150 e 190, foi
tratamento das compactaes intestinais e seus possveis realizada avaliao clnica e coleta de sangue. Amostra
efeitos adversos. Experimento aprovado pelo Comit de de sangue incubada sem estmulo e com estmulo PWM
tica e Bem-Estar animal da Universidade Federal da Bahia (mitgeno), extrato protico das cepas de Cp PAT10 e
(protocolo 11/2015). Foram utilizados sete equinos, fmeas, VD57. A partir dessas amostras foram realizados os testes
SRD, com idade entre 2-5 anos, peso entre 300 a 400kg. A Bovigam (ELISA) dosagem de IFN- e Imunofenotipagem
escolha do tratamento a ser utilizado para cada animal foi para avaliao da Mdia de Intensidade de Fluorescncia
s cegas usando como desenho experimental Quadrado (MIF) de molculas de superfcie de clulas da resposta
Latino, sendo todos os animais submetidos a todos os imunolgica. Resultados: A produo de IFN- frente ao
tratamentos em intervalos de 15 dias. Administrao da estmulo, nas amostras do grupo controle permaneceu com
fluidoterapia enteral (2l a cada 2 horas/ 12 horas), bem como baixa produo dessa citocina mesmo nas amostras com
dos frmacos laxativos em nica dose (DSS 10mg/kg, Sulfato estmulos in vitro, enquanto que nos animais do grupo
de Magnsio 0,5g/kg e Hidrxido de Magnsio 2l/animal). infectado apresentaram maior produo de FN- durante
Foi avaliado o comportamento dos animais perante qualquer a fase crnica, principalmente no estmulo com extrato
desconforto gstrico e/ou diarreia, FC, f, TC, colorao de antignico da PAT10. Nos Linfcitos T, a infeco diminuiu a
mucosas, motilidade intestinal, hemograma e quantidade de mediana do MIF de CD4 no incio da fase aguda em relao
gua nas fezes, nos seguintes momentos: M0 Basal, M1, M2, ao grupo controle. Ns Linfcitos B, observou-se reduo
M3 e M4 uma, trs, cinco e dez horas aps a administrao significativa tanto na mediana do MIF de CD45 quanto
do frmaco, respectivamente. No foi observada qualquer no de CD21 na fase inicial (2 e 14 dias ps-infeco). O
alterao, como, desconforto gstrico ou quadros de mesmo ocorreu em relao a mediana do MIF de CD45
diarria bem como no houve alterao significativa nos em moncitos. O MIF de CD11b em moncitos no grupo
parmetros clnicos e hematolgicos avaliados. Entretanto, infectado foi menor na etapa inicial da doena, porm
na quantificao de gua nas fezes e avaliao visual das ocorre um aumento na etapa final do experimento (150
mesmas, percebeu-se que com a administrao do DSS e dias). Protenas bacterianas da cepa PAT10 foram antignicos
o Hidrxido de Magnsio as fezes apresentaram-se mais nos ensaios in vitro. Concluso: O extrato da cepa PAT10
umidificadas, observou-se tambm reduo do peso aps de Corynebacterium pseudotuberculosis se mostrou com
anlise bromatolgica, porm sem diferena estatstica maior potencial antignico na produo de IFN- em
significante. Com os resultados obtidos at o presente animais com Linfadenite Caseosa na fase crnica. A infeco

Congresso da UFBA 2017 | Caderno de resumos 47


experimental com esta bactria causou uma reduo na rea: CINCIAS AGRRIAS - MEDICINA
expresso na maioria das molculas de superfcie analisadas,
VETERINRIA
principalmente na fase aguda do experimento. Observamos
que a pouca disponibilidade de anticorpos especficos para TRABALHO: AVALIAO DA RELAO
uso em citometria com amostra de ruminantes dificultou
uma anlise mais detalhada do perfil de marcadores de
ENTRE O EXAME CLNICO, TRATAMENTO E
SOBREVIDA DE CADELAS PORTADORAS DE
ESTUDANTE PIBIC

superfcie.
Palavras-chaves: Linfadenite Caseosa,Corynebacterium CARCINOMA INFLAMATRIO MAMRIO
pseudotuberculosis,Imunofenotipagem
Autor(es): JSSICA GUIMARES MAGNANI, HELENITA SILVA
*******************************************************************
DOS SANTOS, ESTELA BATISTA BRANDO, ALINE MICHELLE
*******************************************
DOS SANTOS CONCEIO, ALESSANDRA ESTRELA SILVA
LIMA, MARLIA CARNEIRO DE ARAJO MACHADO
rea: CINCIAS AGRRIAS - MEDICINA
Resumo: Dentre os tumores malignos de mama, o
VETERINRIA carcinoma inflamatrio mamrio uma neoplasia de
TRABALHO: UTILIZAO DE ANLISE crescimento acelerado em forma de placa difusa, que
cursa com dor, edema e eritema em uma ou mais mamas.
ESTATSTICA MULTIVARIADA PARA A ocorrncia de metstases comum, acometendo
DEFINIO DE AMBIENTES DE PRODUO principalmente linfonodos regionais, pulmo, fgado, bao,
rins, corao e ossos. Este alto potencial metasttico se
E ESTUDO DA INTERAO GENTIPO- correlaciona diretamente com o menor tempo de sobrevida
AMBIENTE EM CARACTERSTICAS DE o que torna o prognstico desfavorvel. Neste contexto,
objetiva-se com o desenvolvimento do presente estudo
INTERESSE ECONMICO NOS BOVINOS DA correlacionar as caractersticas clnicas com a sobrevida de
RAA NELORE NO ESTADO DA BAHIA cadelas portadoras de carcinoma inflamatrio mamrio
(CIM), bem como sua importncia para a definio de um
Autor(es): GUSTAVO PIMENTA SCHETTINI, CAIO VITOR diagnstico e interveno teraputica mais precoce. Assim,
DAMASCENO CARVALHO, THEREZA CRISTINA BORIO DOS foram avaliadas 22 cadelas divididas em dois grupos, no
SANTOS CALMON DE BITTENCOURT, RAPAHEL BERMAL qual 12 animais pertenciam ao grupo de cadelas portadoras
COSTA, GLEB STRAUSS BORGES JUNQUEIRA, RAYSILDO de carcinoma inflamatrio mamrio (CIM) e 10 cadelas
BARBOSA LBO possuam carcinoma de estadio avanado (CEA). Realizou-
se anmnese, levantamento do histrico reprodutivo e
Resumo: A bovinocultura brasileira representa uma fatia de exame fsico em que todos os sistemas foram avaliados,
extrema importncia para o Produto interno bruto (PIB) do bem como o exame especfico de glndula mamria.
agronegcio, na Bahia se mostra presente e de grande fonte Para acompanhamento, se realizou exames laboratoriais
de renda para os produtores. A busca pelo melhoramento (eritrograma, leucograma e bioqumica srica ureia,
gentico do rebanho, elevou a aquisio de animais de alto creatinina, ALT e FA) quinzenalmente para os animais do
valor zootcnico, os quais possuem timos desempenhos grupo CIM e mensalmente para animais do grupo CEA, alm
para as caractersticas de interesse econmico, animais esses de avaliaes radiogrficas e ultrassonogrficas para ambos
que so, por vezes, provenientes de outras regies do estado/ os grupos. Dentre os animais do grupo CIM, observou-se
pas, onde em ambas as situaes h diferenas climticas maior frequncia de cadelas da raa a poodle (3/12) e no
importantes e passveis de influenciar, positivamente ou grupo CEA dos animais sem raa definida (4/10). A idade
negativamente, o desempenho desses animais. Segundo mdia dos animais foi de 10,7 anos do grupo CIM e de 12,4
a literatura, o efeito de Interao gentipo x ambiente anos do grupo CEA. Dentre as cadelas observou-se que
(IGA) de elevada importncia em fase de ps-desmama nove (9/12) no eram castradas no grupo CIM e oito (8/10)
quando comparada s fases de pr-desmama, justificada no grupo CEA; trs animais em cada grupo apresentavam
pelo convvio da cria com a me, no permitindo que o pseudociese intermitente e apenas uma cadela do grupo
mesmo sofra de maneira efetiva os efeitos ambientais ali CIM apresentava cio irregular (1/12). Quanto a utilizao
associados, no entanto o efeito ainda se mostra presente de progestgenos, trs cadelas do grupo CEA (3/10) fizeram
e de importncia para criadores em diferentes fases da uso de contraceptveis injetveis. Na avaliao clnica, foi
bovinocultura, a partir dessa prerrogativa, o objetivo deste observado no grupo CIM que a cadeia mamria direita foi
estudo foi avaliar a presena da interao gentipo x a mais acometida (7/12), seguida da cadeia esquerda (3/12)
ambiente (IGA) entre os pesos padronizados aos 120 dias e ambas cadeias (2/12). As mamas M4 e M5 foram as mais
de idade (P120) e aos 210 dias de idade (P210) em bovinos envolvidas. No grupo CEA as cadelas apresentavam, em sua
da raa Nelore, criados nos estado da Bahia, participantes maioria, nodulaes em ambas cadeias (8/10). Segundo a
do Programa de Melhoramento gentico da Raa Nelore classificao do CIM, sete casos foram diagnosticados como
(Nelore Brasil), conduzido pela Associao Nacional de CIM primrios (7/12), cinco secundrios no ps- cirrgico
Criadores e Pesquisadores, (ANCP), esses bovinos foram (5/12) e dois eram secundrios ps-cirrgico (2/12) Todos
avaliados em duas regies, geoclimaticamente homogneas, os animais do grupo CIM apresentaram acometimento
do estado da Bahia, a regio 2 (R2) e a regio 3 (R3). As de linfonodos inguinais e poplteos, do qual cinco (5/12)
anlises das caractersticas, bem como a avaliao da apresentavam edema de membros. A presena de metstase
IGA, foram realizadas anlises multivariadas pelo mtodo pulmonar foi observada em trs cadelas desse grupo (3/12)
de anlise bayesiana, sob modelo animal. Os resultados no momento do diagnstico. A sobrevida global mxima
encontrados para as correlaes genticas, entre as regies no grupo CIM foi de 126 dias, e no grupo CEA foi de 209
estudadas, foram iguais a 0,32 para P120 e para o P210 foi dias, com mdias de 32,1 e 153 dias, respectivamente. O que
encontrado valor igual a 0,53. Estes resultados indicam a demonstrou taxa de sobrevida significativamente menor nas
presena da IGA para P120 e P210 entre as duas regies do cadelas acometidas por CIM. Esses resultados demonstram
estado Bahia. a importncia de conhecer os sinais caractersticos dessa
neoplasia e do acompanhamento das cadelas acometidas
Palavras-chaves: IGA,zebunos,bovinos de corte
para obter diagnstico e intervenes teraputicas mais
******************************************************************* precoces.
*******************************************

48 Congresso da UFBA 2017 | Caderno de resumos


Palavras-chaves: co,patologia mamria,oncologia rea: CINCIAS AGRRIAS - MEDICINA
******************************************************************* VETERINRIA
******************************************* TRABALHO: CARACTERSTICAS GENTICAS
rea: CINCIAS AGRRIAS - MEDICINA
E PRODUTIVIDADE DAS COLNIAS DE
ABELHA APIS

ESTUDANTE PIBIC
VETERINRIA
TRABALHO: AVALIAO DA SENSIBILIDADE Autor(es): THILA RIBEIRO CAZUMB DA SILVA, GUIDO
CORNEAL DE AVES SILVESTRES LARCIO BRAGANA CASTAGNINO
Resumo: O mercado consumidor hoje em dia tem sido
Autor(es): JOSEANE SILVA VALADARES DIAS, PALOMA cada vez mais exigente em produtividade e qualidade dos
NASCIMENTO COUTINHO, ARIANNE PONTES ORIA produtos de origem animal e a produo apcola no foge
Resumo: Estesiometria uma tcnica de diagnstico a essa regra, sendo ele um mercado em ascenso no pas
bastante utilizada na oftalmologia veterinria com o objetivo e sendo muito reconhecido no exterior, se faz necessrio a
de mesurar a sensibilidade corneana em diferentes espcies insero de novos mtodos para aumentar a produo sem
animais. Esta tcnica balizada na avaliao da sensao que haja perda de qualidade. A observao de caractersticas
ttil da superfcie corneana que pode ser aferida por meio genticas de produo e sua relao com as interferncias
do estesimetro de Cochet-Bonnet. Muitos animais que ambientais se mostram como uma promissora arma para
sofrem leses ou patologias em estruturas oculares tm incremento da produo das abelhas Apis. O presente
seu bem-estar comprometido, porquanto tais afeces no realizou cinco avaliaes no perodo de 12/07/2016 a
raras suscitam dor ocular importante. Neste sentido, torna- 25/07/2017 no apirio da fazenda experimental da UFBA
se primordial maior conhecimento acerca da sensibilidade de Entre Rios, onde foram avaliadas a taxa de infestao
corneana, a fim de manejar com mais propriedade tais pelo caro Varroa destructor, comportamento higinico e
afeces oftlmicas e promover melhor terapia antlgica a defensividade de 18 colnias de abelhas Apis mellifera.
para estes animais. Dada a ausncia de estudos sobre o Durante o perodo do presente estudo, em um primeiro
limiar de sensibilidade corneana notadamente em animais momento foi observada uma interao negativa do
silvestres, objetivou-se com o presente estudo avaliar a ambiente que se apresentava em estiagem severa que fez
sensibilidade da crnea de aves silvestres para determinar o cair taxa de comportamento higinico e a defensividade e
valor de normalidade de estesiometria para diversas espcies. subindo bastante a taxa de infestao pelo caro, tornando
Foram utilizados 51 animais oriundos do Centro de Triagem as colnias suscetveis ao aparecimento de doenas e
de Animais Silvestres (CETAS/IBAMA Salvador), destas tornando as colnias passveis de nidificao. Com o
14 corujas-alba, 12 gavies carij, 8 corujas murucututu, passar do estudo, nas avaliaes restantes, com o uso de
10 gavies- carcar, 7 jandaia-coquinho.Os protocolos alimentao energtica suplementar e o fim do perodo
utilizados na pesquisa estavam de acordo com o SISBIO de estiagem, as caractersticas avaliadas obtiveram uma
(processo n 27489-1). Alm disso, o estudo passou por recuperao bem evidente chegando aos valores aceitos
aprovao pelo CEUA da Escola de Medicina Veterinria pela literatura consultada, porm durante o perodo do
e Zootecnia, Universidade Federal da Bahia (protocolo n. estudo, no houve colheita de mel por conta da grave
33/2015) e todos os procedimentos seguiram os cuidados estiagem. Diante disso o presente obteve como concluso
preconizados pela ARVO. Aps conteno fsica, foi utilizado que as avaliaes de caractersticas genticas so de suma
o estesimetro de Cochet-Bonnet em ambos os olhos dos importncia para abelhas Apis destinada a fins produtivos
animais. O valor obtido foi considerado como o limiar e que as interferncias ambientais presentes em nosso
normal de sensibilidade para a espcie em questo. Ao pas tem papel relevante para que essas caractersticas se
trmino da estesiometria seguiu-se a semiotcnica oftlmica faam presentes. O objetivo do presente trabalho estudar
que consistira da inspeo, seguida da realizao do Teste as caractersticas de comportamento higinico, taxa de
lacrimal de Schirmer 1 (TLS1), avaliao da superfcie dos infestao do caro Varroa destructor e a defensibilidade de
olhos com auxlio de lmpada hlogena com fonte de colnias de abelhas Apis mellifera africanizada e determinar
magnificao. A avaliao da integridade da superfcie se existe uma correlao com a produtividade de mel das
corneana foi realizada atravs do teste da fluorescena com colnias.
auxlio de filtro de cobalto. A mediana e intervalo semi- Palavras-chaves: Comportamento higinico,Varroa
interquartil (S-IQR) da avaliao de sensibilidade ttil da destructor,Produo de mel
crnea pela estesiometria variaram de 0,50 0,50 para as
corujas albas, 1,00 0,50 para os gavies carij, 1,000,50 *******************************************************************
para as corujas murucututu e 1,00 0,00 para os carcars, *******************************************
e 4,39 0,71 para jandaias-coquinho. Os resultados
do presente estudo possibilitam a contribuio para o rea: CINCIAS AGRRIAS - MEDICINA
conhecimento das diferenas entre os parmetros oftlmicos
dos diversos grupos de animais e auxiliam na conduo
VETERINRIA
clnica e cirrgica especfica para estas espcies na rotina TRABALHO: AVALIAO DO EFEITO
veterinria.
ACARICIDA, IN VITRO, DO EXTRATO
Palavras-chaves: aves,estesiometria,animais silvestres
METANLICO E FRAO DE ALCALOIDES DE
******************************************************************* PROSOPIS JULIFLORA SOBRE TELEGINAS
*******************************************
DE RHIPICEPHALUS (BOOPHILUS)
MICROPLUS
Autor(es): RAFAELA JESUS DOS SANTOS, HLIMAR
GONALVES LIMA, MARIA JOS MOREIRA BATATINHA

Congresso da UFBA 2017 | Caderno de resumos 49


Resumo: A bovinocultura brasileira apresenta grande perifrico. Foram estudadas 32 cadelas divididas em trs
destaque mundial por contar com um rebanho de grupos: controle Cadelas hgidas (n=10), carcinoma em
aproximadamente 215,2 milhes de cabeas. Prejuzos estadio avanado - CEA (n=10) e carcinoma inflamatrio
relacionados criao de bovinos esto ligados um mamrio - CIM (n=12). Foram realizadas avaliaes clnica,
controle sanitrio insatisfatrio e manejo inadequado dos acompanhamento com determinao da sobrevida e
animais, o que tem levado ao desenvolvimento de algumas imunofenotipagem de leuccitos no sangue perifrico e
ESTUDANTE PIBIC

doenas, dentre elas o ectoparasitismo atravs do carrapato tumor. Como resultados clnicos foram observados no grupo
Rhipicephalus (Boophilus) microplus, gerando perdas de at CIM maior frequncia da forma primria da neoplasia e
US$13,96 bilhes para a economia nacional. O controle da mdia de sobrevida de 32 dias. A imunofenotipagem de
doena feito quase exclusivamente atravs de acaricidas sangue revelou maior frequncia de TCD8+ (p= 0,0017) e
comerciais, levando a resistncia destes parasitos. Estudos menor frequncia de TCD4+ (p<0,0001) e da razo CD4/
avaliando a atividade biolgica de plantas com potencial CD8 (p= 0,0002) em comparao aos grupos C e CEA. O
efeito acaricida, tm sido conduzidos. O presente estudo ndice mdio de fluorescncia (IMF) de MHC-I e MHC-II
teve como objetivo avaliar in vitro o efeito acaricida em moncitos foi significativamente maior nas cadelas
do extrato metanlico e frao de alcaloides dos frutos portadoras de CIM (p=0,038 e p=0,0117 respectivamente) em
da Prosopis juliflora sobre teleginas de Rhipicephalus comparao a cadelas dos outros dois grupos. No houve
(Boophilus) microplus. Para tanto, foi realizado o teste de diferena significativa entre os grupos nas avaliaes de
imerso de teleginas ingurgitadas (biocarrapaticidograma). imunofenotipagem no tumor. A sobrevida global dos animais
As teleginas foram coletadas de bovinos naturalmente portadores de CIM foi significativamente inferior (p=0,0007)
infestados e mantidas em placas de petri. As fmeas comparada ao grupo CEA. As correlaes entre taxa de
ingurgitadas foram imersas por cinco minutos em 10 mL sobrevida global, frequncia de TCD8+ (r= -0,53 e p=0,048),
do extrato nas seguintes concentraes: 91; 127,6; 178,6; razo CD4/CD8 (r= 0,58 e p= 0,032) foram significativas
250 e 350 mg/mL e em 10 mL da frao de alcalides nas menores no grupo CIM. Esses resultados sugerem
concentraes de 16,9; 33,2; 65,1; 127,6 e 250 mg/mL. Como importante contribuio das clulas TCD8+, na agressividade
controle negativo foi utilizado etanol e gua destilada (70:30 do CIM que pode ser devido a ao de citocinas liberadas
v/v), e como controle positivo foi utilizado o acaricida pelas clulas tumorais ou pelo microambiente tumoral
comercial Colosso, seguindo as instrues do fabricante. Os imunossupressor que pode inativar a ao das clulas TCD8+
percentuais de eficcia do extrato variaram de 24 a 97% para efetoras ou convert-las em clulas TCD8+ reguladoras.
as concentraes citadas acima. E para a frao de alcalides,
foram encontrados percentuais de 45,2 a 100%. No houve Palavras-chaves: patologia
diferena estatstica das maiores concentraes do extrato mamria,imunovigilncia,microambiente tumoral
(250 e 350 mg/mL) e frao de alcaloides (65,1; 127,6 e *******************************************************************
250 mg/mL) para o grupo controle positivo. Os resultados *******************************************
obtidos neste estudo demonstram a atividade carrapaticida
do extrato metanlico e frao de alcaloides de Prosopis
juliflora sobre teleginas de Rhipicephalus (Boophilus) rea: CINCIAS AGRRIAS - MEDICINA
microplus. VETERINRIA
Palavras-chaves: Prosopis juliflora,Rhipicephalus TRABALHO: CARACTERSTICAS DE CARCAA
(Boophilus) microplus,extrato metanlico DE OVINOS EM CRESCIMENTO SUBMETIDOS
******************************************************************* A DIETAS COM DIFERENTES NVEIS DE
*******************************************
CIDO LURICO
rea: CINCIAS AGRRIAS - MEDICINA Autor(es): THADEU MARINIELLO SILVA, LUANDA SOUZA
VETERINRIA CONCEIO SANTOS, DANIELA PIONORIO VILARONGA
TRABALHO: AVALIAO IMUNOFENOTPICA CASTRO

DE LEUCCITOS INFILTRANTES NO Resumo: A suplementao lipdica uma estratgia


importante na produo animal. Porm, o aumento do teor
TUMOR E OBTIDOS A PARTIR DO SANGUE de lipdios na dieta pode provocar reduo do consumo
PERIFRICO DE CADELAS PORTADORAS DE e digestibilidade do alimento, alm de modificaes nos
parmetros ruminais. O experimento foi realizado para
CARCINOMA INFLAMATRIO MAMRIO definir o melhor nvel de incluso de cido lurico na
dieta de ovinos Santa Ins em crescimento, com base nas
Autor(es): HELENITA SILVA DOS SANTOS, JSSICA caractersticas de carcaa. Foram utilizados 40 cordeiros
GUIMARES MAGNANI, ESTELA BATISTA BRANDO, com aproximadamente 4 meses de idade e peso corporal
ALESSANDRA ESTRELA SILVA LIMA, ALINE MICHELLE DOS mdio de 23kg e distribudos em delineamento inteiramente
SANTOS CONCEIO causalizado (DIC). Os animais foram alimentados com feno
de Tifton-85, alm de concentrado composto por farelo de
Resumo: O carcinoma inflamatrio mamrio (CIM) uma
milho e de soja, sal mineral e leo de palmiste como fonte
neoplasia que acomete mulheres, cadelas e gatas e se
de cido lurico nos nveis 0,0%; 1,0%; 2,0%; 2,9% e 3,9%,
destaca por sua agressividade, elevado potencial metasttico
correspondentes aos tratamentos; 40:60 foi a relao de
e baixa sobrevida. Estudos sobre o microambiente tumoral
volumoso:concentrado. Ao final do perodo experimental, os
indicam que o comportamento agressivo dessa neoplasia
animais foram submetidos a jejum e dieta hdrica, pesados
est correlacionado ao processo inflamatrio associado
e abatidos para avaliao de carcaa. Foram mensurados
a ao de citocinas, fatores angiognicos e fatores de
o peso de carcaa quente e o peso de carcaa fria (aps
crescimento. Sabe-se que para uma resposta imunolgica
resfriamento a 4C por 24 horas). A meia carcaa foi dividida
antitumoral mais efetiva necessria a ativao de linfcitos
em cortes como pescoo, paleta, pernil, lombo e costela;
T CD8+, pela apresentao de antgenos ou por meio da
foram coletadas a temperatura e pH da carcaa quente e
ao de citocinas liberadas pelas clulas T CD4+. Com a
fria. Os dados foram submetidos anlise de varincia e
realizao desse estudo objetivou-se identificar as alteraes
teste de regresso com o programa estatstico SAS 9.1.3. A
fenotpicas de leuccitos no sangue e no tumor de cadelas
adio de cido lurico no influenciou a temperatura e
portadoras de CIM a partir da imunofenotipagem do sangue

50 Congresso da UFBA 2017 | Caderno de resumos


nem o pH das carcaas. Contudo, observou-se um efeito Palavras-chaves: Prosopis juliflora,Neurotoxicidade,Teste
linear decrescente (P<0,05) nos parmetros avaliados, devido comportamental
reduo do consumo de matria seca. Com isto, houve
queda do rendimento de carcaa, em consequncia da *******************************************************************
diminuio da deposio de msculos. O peso ao abate foi *******************************************
influenciado negativamente e como consequncia, todos os

ESTUDANTE PIBIC
cortes tambm tiveram seus pesos reduzidos. Com base nos rea: CINCIAS AGRRIAS - MEDICINA
parmetros analisados, no recomendado o uso de cido VETERINRIA
lurico na alimentao de ovinos.
TRABALHO: CONSUMO E DIGESTIBILIDADE
Palavras-chaves: cordeiros,lipdios,leo de palmiste
DOS NUTRIENTES DE DIETAS COM CIDO
*******************************************************************
******************************************* LURICO NA ALIMENTAO DE OVINOS EM
CRESCIMENTO
rea: CINCIAS AGRRIAS - MEDICINA
VETERINRIA Autor(es): MAIARA DA SILVA LIMA, THADEU MARINIELLO
SILVA, DANIELA PIONORIO VILARONGA CASTRO
TRABALHO: CARACTERIZAO DE
Resumo: O aumento da criao de ovinos no Brasil tem
ALTERAES COMPORTAMENTAIS aumentado a preocupao na emisso de gases de efeito
INDUZIDAS POR ALCALOIDES estufa, onde os pequenos ruminantes representam 6,5%
das emisses globais entre os ruminantes de forma geral.
PIPERIDNICOS DA PROSOPIS JULIFLORA Os protozorios existentes no rmen so um dos principais
EM ROEDORES: UM MODELO DE ESTUDO produtores de hidrognio na microbiota ruminal, e
cidos graxos de cadeia mdia, tais como o cido lurico,
DE DOENA NEURODEGENERATIVA EM tm mostrado efeitos anti protozorios significativos. O
PERSPECTIVA objetivo deste projeto foi elucidar o impacto da incluso
de cido lurico na dieta de ovinos em crescimento, a fim
de estabelecer o melhor nvel deste na dieta dos animais,
Autor(es): VICTOR DE CARVALHO FRAGA, VICTOR
avaliando caractersticas de consumo e digestibilidade dos
DIOGENES AMARAL DA SILVA, SILVIA LIMA COSTA
nutrientes, e de desempenho produtivo. O experimento foi
Resumo: Prosopis juliflora uma planta amplamente realizado na fazenda experimental da Escola de Medicina
distribuda na regio semi-rida do Nordeste do Brasil. Os Veterinria e Zootecnia da Universidade Federal da Bahia, em
efeitos neurotxicos de P. juliflora so descritos na literatura So Gonalo dos Campos BA, utilizando cordeiros Santa
cientfica, mas ainda h poucos estudos sobre a elucidao Ins no castrados com idade mdia inicial de 120 dias e
de seus mecanismos. Embora seja utilizada na alimentao peso mdio de 23 kg, previamente vacinados e vermifugados.
de animais, o quadro de intoxicao grave caracterizado Os animais foram devidamente identificados, pesados e
por alteraes neuromusculares, principalmente na face, alojados em gaiolas, submetidos a cinco tipos de tratamentos
condio conhecida como doena da cara torta. Tal na rao e a cinco repeties, sendo os tratamentos: T1- sem
leso decorre de alteraes neuromusculares (incluindo adio de cido lurico; T2- adio de 1,6% de cido lurico;
atrofia muscular dos masseteres) e leses histolgicas T3- adio de 3,3% de cido lurico; T4- adio de 4,9%
como espongiose, gliose, perda de substncia de Nissl de cido lurico e T5- adio de 6,5% de cido lurico no
e vacuolizao dos neurnios do nervo motor trigemial. concentrado. O ensaio de digestibilidade foi realizado com
Danos mitocondriais e autofagia so fenmenos-chave para 25 animais, com durao de 14 dias de adaptao e 7 dias de
a fisiopatogenia de diversas doenas neurodegenerativas coleta. J a avaliao de desempenho foi realizada com 40
que se manifestam a nvel comportamental no indivduo animais, durante 83 dias. Aps a anlise quanto aos teores de
acometido. Em outra situao observada, testes em matria seca e matria mineral, observou-se que a incluso
cultura de primria de astrcitos, o extrato alcaloide do cido lurico na dieta dos animais causou reduo no
total da Prosopis juliflora responsvel por ativao consumo do alimento ofertado, no apresentando influencia
glial, citotoxicidade e produo de xido Ntrico (NO), na digestibilidade da matria orgnica ou da matria seca.
importantes fatores inflamatrios no sistema nervoso central. Quanto a avaliao de desempenho houve uma tendncia
Os mesmos alcaloides em co-cultura de neurnios e clulas a queda de ganho de peso mdio dirio com P= 0,0569.
gliais induzem danos mitocondriais e autofagia. Sendo Com base nestes parmetros no compensa utilizar o cido
assim, o objetivo deste trabalho foi (I) caracterizar mudanas lurico na dieta de ovinos em crescimento.
comportamentais em ratos Wistar aps intoxicao por
Palavras-chaves: matria seca,matria
alcaloides de Prosopis juliflora; (II) e caracterizar populaes
orgnica,desempenho
neuronais alvo em seces enceflicas. Atravs de testes
alteraes comportamentais, como Teste de Campo Aberto, *******************************************************************
Rotarod e Teste da Grade, foram avaliados animais que *******************************************
receberam diferentes doses intraperitoneais de extratos e
fraes contendo os principais alcaloides de P. juliflora. Os
resultados indicam reduo da atividade motora dos animais
rea: CINCIAS AGRRIAS - MEDICINA
testados, alm de alteraes comportamentais com aumento VETERINRIA
de ansiedade. Tal quadro sugestivo de dano motor TRABALHO: CONTROLE DE BACTRIAS
principalmente nos animais avaliados aps uma semana
da aplicao dos alcaloides. Estudos atravs de tcnicas de MESFILAS POR FITOEXTRATOS
histopatologia e imunohistoqumica esto sendo realizados
para caracterizao de regies do encfalo e populaes Autor(es): MARIANA MENEZES MATTOS, PRISCILA
neuronais alvo relacionadas s alteraes comportamentais FERNANDES MENDES FERREIRA, MAURCIO COSTA ALVES
observadas em animais experimentalmente intoxicados pelos DA SILVA, MONICA MATTOS DOS SANTOS SIMAS
alcaloides da P. juliflora.
Resumo: Fitoextratos esto sendo amplamente estudados
para fins teraputicos devido sua diversidade de

Congresso da UFBA 2017 | Caderno de resumos 51


componentes ativos, conduzindo busca de princpios para foi avaliar os perfis bioqumicos e hematolgicos de ces
novos frmacos com funes antifngica, antibacteriana, naturalmente infectados por L. infantum, e verificar se existe
antiviral, antitumoral, entre outros. Deste modo, o objetivo correlao entre o aumento ou diminuio de marcadores
deste trabalho foi avaliar a eficcia de fitoextratos sobre o hematolgicos e bioqumicos com a gravidade do quadro
crescimento de bactrias heterotrficas aerbias mesfilas clnico da LVC. Um estudo de corte transversal foi realizado
totais. Foram utilizados extratos metanlicos e aquosos no municpio de Camaari-BA, rea endmica para LV e LVC.
ESTUDANTE PIBIC

das plantas Mimosa tenuiflora, Lantana camara, Gliricidia No estudo foram includos 75 ces que foram diagnosticados
sepium e Cissampelos fasciculata. Os extratos metanlico e para LVC. Alm disso, foram realizadas avaliaes clnicas e
aquoso da planta Mimosa tenuiflora mostraram atividade avaliao hematolgica e bioqumica. Para o diagnstico da
antimicrobiana contra cepas de Staphylococcus aureus, LVC foram empregados testes sorolgicos, parasitolgico e
inibindo 100% das cepas. O extrato metanlico da Mimosa biomolecular. Durante a avaliao clnica foi calculado um
tenuiflora inibiu 14 das 15 cepas de Escherichia coli escore baseado na presena e intensidade de sinais clnicos
testadas, porm, seu extrato aquoso inibiu o crescimento relacionados a LVC. Os ces infectados foram classificados
de apenas uma das 15 cepas. O extrato metanlico da baseado no escore clnico em: assintomticos (0-3), LVC
Lantana camara tambm inibiu 100% das cepas de S. aureus moderada (4-7) e LVC grave (>7). Em relao a avaliao
e aproximadamente 67% das cepas de Escherichia coli. J hematolgica e bioqumica foram avaliados hemograma
seu extrato aquoso inibiu apenas 40% das Staphylococcus completo, alanina aminotransferase (ALT), bilirrubina
aureus e nenhuma cepa de Escherichia coli. O extrato total - direta e indireta, creatinina, fosfatase alcalina (FA),
metanlico da planta Cissampelos fasciculata inibiu 13 lactato desidrogenase (LDH), uria, protenas totais e
cepas de Staphylococcus aureus de um total de 15 (87%). fraes (albumina e globulina), colesterol total, triglicerdeos,
Seu extrato aquoso inibiu apenas 8 cepas das 15 testadas transferrina, capacidade total de ligao do ferro (CTCF),
(54%). Com as cepas de Escherichia coli, a inibio do capacidade livre de combinao do ferro (CLCF) e ferro
crescimento bacteriano de seus extratos metanlico e srico. As medianas de cada marcador hematolgico ou
aquoso foi de apenas 34% e 7%, respectivamente. A Gliricidia bioqumico foram estratificadas e comparadas entre os
sepium mostrou menor atividade antimicrobiana quando seguintes grupos de animais: no infectados, infectados
comparada com as outras plantas. Seu extrato metanlico assintomticos, com LVC moderada e com LVC grave. As
inibiu 34% das cepas de Escherichia coli e 74% das cepas de diferenas entre as medianas foram avaliadas pelos testes
Staphylococcus aureus e seu extrato aquoso inibiu apenas Kruskal-Wallis, seguido pelo teste de mltiplas comparaes
1% das cepas de Escherichia coli e Staphylococcus aureus. de Dunn e teste de linearidade e de tendncia (IC 95% e
Muitos estudos ainda necessitam ser realizados na rea p<0,05). Comparando os animais no infectados, com os
farmacolgica e em especial na rea toxicolgica, visando ces infectados e classificados em assintomticos, com LVC
fornecer subsdios para a utilizao dessas plantas de forma moderada e com LVC grave, no foi detectada diferena
mais segura pela populao. Alm disso, h o aumento da estatisticamente significativa em nenhum dos parmetros
resistncia bacteriana aos frmacos comuns que vem sendo avaliados. Contudo, anlises adicionais dos dados de forma
considerada como um crescente problema de sade pblica longitudinal podero revelar marcadores hematolgicos
mundial. Portanto, devido seleo de micro-organismos e bioqumicos que podem ser interessantes para serem
patognicos resistentes a esses compostos, h necessidade empregados como marcadores tanto de gravidade como
de encontrar alternativas para o controle microbiano. prognstico da infeco por L. Infantum.
Palavras-chaves: Staphylococcus, Escherichia,Mimosa Palavras-chaves: Leishmaniose visceral
tenuiflora canina,Bioqumico,Hemograma
******************************************************************* *******************************************************************
******************************************* *******************************************

rea: CINCIAS AGRRIAS - MEDICINA rea: CINCIAS AGRRIAS - MEDICINA


VETERINRIA VETERINRIA
TRABALHO: CORRELAO DO PERFIL TRABALHO: DESEMPENHO NUTRICIONAL
HEMATOLGICO E BIOQUMICO DE EM OVINOS ALIMENTADOS COM
CES NATURALMENTE INFECTADOS POR DIETAS CONTENDO SILAGENS DE
LEISHMANIA INFANTUM COM O QUADRO SORGO ADITIVADAS COM UREIA E/OU
CLNICO DA LEISHMANIOSE VISCERAL LACTOBACILLUS BUCHNERI
CANINA
Autor(es): RENAN OLIVEIRA SERRA CONI, LUANA MARTA
RUFINO ALMEIDA, ANA CAROLINE PINHO DOS SANTOS
Autor(es): GABRIELA PORTUGAL FERRAZ PEREIRA,
DEBORAH BITTENCOURT MOTHE FRAGA, MANUELA DA Resumo: Objetivou-se avaliar os efeitos da adio de ureia e/
SILVA SOLC ou Lactobacillus buchneri sobre o consumo e digestibilidade
de ovinos Santa Ins alimentados com silagem de sorgo
Resumo: A leishmaniose visceral (LV) uma zoonose de
aditivadas com ureia e/ou inoculante microbiano. O
carter global e no Brasil causada pela Leishmania infantum.
experimento foi conduzido na Fazenda Experimental de
O parasito transmitido pelo vetor flebotomneo da espcie
So Gonalo dos Campos, Bahia. Foram utilizados 40
Lutzomyia longipalpis. A LV uma doena que acomete
ovinos da raa Santa Ins machos, no castrados, com peso
tanto o ser humano como os ces, que so considerados os
vivo mdio inicial de 22,8 kg. As dietas foram compostas
principais reservatrios urbanos do parasito. Na LV canina
por silagem de sorgo e concentrado, numa relao de
(LVC), os sinais clnicos so pouco especficos, e podem
50:50. As determinaes de matria seca (MS), protena
envolver qualquer tecido, rgo ou fluido corpreo. Os ces
bruta (PB), matria mineral (MM) e extrato etreo (EE) foi
com LVC podem apresentar alteraes bioqumicas como
realizada de acordo com a metodologia descrita por AOAC
hiperglicemia, hipoalbuminemia, e reduo na proporo
(1990). Para determinao da frao da parede celular,
de albumina e globulina. Adicionalmente, podem sofrer
fibra em detergente neutro (FDN) foi realizada de acordo
modificaes na sua hemostasia. O objetivo deste projeto
a metodologia de Van Soest et al. (1991), sendo corrigida

52 Congresso da UFBA 2017 | Caderno de resumos


para cinza e protena (FDNcp), os resduos da digesto em de cromgeno, foram-se utilizados TMB 0,1M, 0,05M e
detergente neutro e detergente cido foram incinerados em 0,01M, preparados em tampo citrato (pH 3,8). Utilizou-
mufla a 600oC por 4 horas, e a correo para protena foi se tambm, nas reaes, soro bovino com concentrao
efetuada mediante protena insolvel em detergente neutro de HP previamente conhecida (100 mg/dL) e soluo
(PIDN), conforme recomendaes de Mertens (2002) e Licitra comercial de perxido de hidrognio (0,02M). A absorbncia
et al. (1996). Foram realizadas coleta total de fezes no 2 e 3 das reaes foi analisada, em um comprimento de onda

ESTUDANTE PIBIC
perodos, para calcular a digestibilidade aparente, todos os de 640 nanmetros, ao longo de trinta minutos em um
animais estavam utilizando bolsas coletora, sendo coletados espectrofotmetro. Todos os testes foram realizados em
as fezes total do dia (24h) por trs dias consecutivos, as fezes triplicata, sendo calculados a mdia e o desvio padro das
eram pesadas e retiradas 20% para serem acondicionadas absorbncias obtidas. De acordo com os resultados obtidos,
em sacolas plsticas e congeladas para demais anlises. Os identificou-se que a concentrao de 5 mg/dL de meta-
dados foram submetidos anlise de varincia e os valores hemoglobina associada com TMB 0,1M, aps dez minutos de
mdios das dietas comparados pelo teste de Tukey, ao nvel reao, foi capaz de gerar poucas reaes inespecficas e as
de 5% de probabilidade, segundo o pacote estatstico SAEG melhores leituras de absorbncia para a quantificao da HP.
(2009) , utilizando como covarivel o peso vivo inicial. O Devido ao fato de o TMB ser um cromgeno muito sensvel,
consumo de matria seca, matria orgnica e protena bruta e a sua reatividade ser diretamente influenciada, dentre
apresentaram diferenas significativas (P<0,05), a silagem outros fatores, pela concentrao de HB e pela quantidade
de sorgo aditivada com inoculante (SSI) e consorciada de tempo em que ele se encontra reagindo, menores
com ureia e inoculante (SSUI) apresentaram menores CMS, concentraes de HB, em associao com TMB 0,1M, so
CMO e CPB, com mdias de 0,855kg e 0,879kg para CMS capazes de gerar os melhores padres de leitura aps dez
respectivamente, com mdias de 0,778kg e 0,820kg para minutos de reao.
CMO respectivamente, com mdias de 0,206kg e 0,209kg
para CPB respectivamente. O consumo de extrato etreo no Palavras-chaves: Quantificao
foi influenciado estatisticamente (P>0,05) pelos tratamentos, Bioqumica,Haptoglobina,TMB
apresentando mdia de 0,029kg. O consumo de fibra em *******************************************************************
detergente neutro foi influenciado estatisticamente (P<0,05), *******************************************
a silagem de sorgo aditivada com o inoculante apresentou
maior consumo de FDN, com mdia de 0,348kg, seguido da
silagem aditivada com ureia e inoculante (0,275kg), a silagem rea: CINCIAS AGRRIAS - MEDICINA
de sorgo e a silagem de sorgo com ureia foram semelhantes, VETERINRIA
apresentando mdias de 0,190kg e 0,228kg respectivamente. TRABALHO: DESENVOLVIMENTO DE UM
A silagem de sorgo aditivada com inoculante e/ou ureia pode
ser utilizada na alimentao de cordeiros, causando poucas SISTEMA FECHADO PARA EXTRAO DE
interferncias no consumo dos animais. LIPOPROTENAS DE BAIXA DENSIDADE
Palavras-chaves: cordeiros digestvel ingesto (LDL) DA GEMA DE OVO
*******************************************************************
******************************************* Autor(es): ISABELA VASCONCELOS, GABRIEL FELIPE
OLIVEIRA DE MENEZES, MAICON PEREIRA LENTS, RODRIGO
FREITAS BITTENCOURT, ADRIELLE DA SILVA LIMA, ELISIANE
rea: CINCIAS AGRRIAS - MEDICINA SATELES DOS SANTOS, RENATA OLIVEIRA BARRETO
VETERINRIA
Resumo: A criopreservao espermtica uma
TRABALHO: DESENVOLVIMENTO DE UM biotecnologia de grande importncia para a disseminao
REAGENTE CONTENDO SIMULTANEAMENTE do melhoramento gentico, pela maior facilidade
de disseminao do material gentico de machos
META-HEMOGLOBINA E CROMGENO geneticamente superiores. Entretanto, alguns fatores
3,3,5,5-TETRAMETILBENZIDINA (TMB) interferem na qualidade das clulas espermticas aps a
criopreservao. Um dos principais fatores est relacionado
PARA USO NA QUANTIFICAO DE a qualidade do diluidor utilizado para minimizar as
HAPTOGLOBINA ANIMAL EM CONDIES crioinjrias espermticas causada pelo processo. A gema de
ovo um dos componentes mais importantes do diluidor
DE CAMPO de criopreservao espermtica, pois confere proteo s
clulas contra o choque trmico. Contudo, existem restries
Autor(es): TALO PAULINO SANTANA, NATLIA DA ROCHA quanto ao seu uso, especialmente relacionadas aos riscos
LOPES, BRUNO LOPES BASTOS de contaminaes sanitrias e a falta de padronizao dos
componentes da gema de acordo com a sua origem. Sabe-
Resumo: A haptoglobina (HP), principal protena de
se que a frao da gema de ovo que confere a proteo aos
fase aguda em ruminantes, sob condies de processos
espermatozoides so as das lipoprotenas baixa densidade
infecciosos ou inflamatrios, pode possuir a sua
- LDL. Porm, as tcnicas existentes para extrao de LDL,
concentrao plasmtica elevada em at cem vezes. Devido
ainda apresentam muitos entraves, dentre eles o tempo de
a isso, detm um grande potencial no monitoramento
manipulao, dificuldade de manuteno da temperatura
sanitrio de animais para abate, atuando como um
preconizada para o processo (5C), o nmero de pessoas
biomarcador inespecfico para infeces. Dessa forma,
envolvidas e o risco de contaminao que ocorre durante o
o presente trabalho visou determinar as melhores
prprio processo de extrao. Diante desse fator, o presente
concentraes dos reagentes envolvidos na quantificao
projeto teve como objetivo criar um sistema fechado para
bioqumica da HP bovina, utilizando-se o cromgeno
a extrao de LDL a partir da gema de ovo, que fosse capaz
3,3-5,5-tetrametilbenzidina (TMB). A quantificao da HP
de manter a temperatura ideal, na tentativa de uma reduo
foi realizada adaptando-se a metodologia de Jones e Mould
do tempo de manipulao, do nmero de operadores e
(1984) para tubos de ensaio e espectrofotmetro. Para a
do risco de contaminao cruzada, que pode acontecer
determinao da melhor concentrao de hemoglobina (HB),
com as tcnicas que j esto sendo utilizadas. O sistema
foram utilizadas solues comerciais de meta-hemoglobina
fechado um equipamento de refrigerao que contm um
bovina em diferentes concentraes (5; 10; 20; 30; 40;
agitador magntico no seu interior, no qual permite agitao
50; 60 mg/dL); na identificao da melhor concentrao

Congresso da UFBA 2017 | Caderno de resumos 53


da amostra por tempo indeterminado, sob temperatura 7,78% (30/386), intoxicaes ou toxi-infeces 4,14%
controlada e principalmente sem variao da mesma. A (16/386), doenas multifatoriais, idiopticas e congnitas
tcnica de extrao foi realizada conforme a metodologia 3,37% (13/386), doenas metablicas ou endcrinas 1,03%
descrita por Moussa et al. (2002) e modificada por Neves (4/386) e outras alteraes 0,78% (3/386). Nos felinos as
(2008), para tanto foram utilizados ovos de galinha frescos, categorias se distriburam da seguinte forma: insuficincia
quebrados manualmente. Foi feita a separao entre a gema de rgos 24,83% (37/149), distrbios causados por agentes
ESTUDANTE PIBIC

e o albmen com auxlio do papel filtro, posteriormente, fsicos 22,82% (34/149), choques 14,09% (21/149), doenas
rompeu-se a membrana vitelina e aspirou-se o contedo, infecciosas e parasitrias 9,40% (14/149), intoxicaes e
identificando o volume obtido. Para a aquisio do plasma, toxi-infeces 9,40% (14/149), inconclusivos 8,05% (12/149),
a gema foi diluda na proporo de 1:2 em soluo salina neoplasias 4,70% (7/149), eutansia por convenincia 3,36%
(NaCl) com 0,17 Mm e homogeneizada por uma hora em (5/149), doenas metablicas ou endcrinas 2,01% (3/149),
agitador magntico sob refrigerao no sistema fechado doenas multifatoriais, idiopticas e congnitas 0,67%
a 5C. Centrifugou-se a soluo a 11.400g por 45 minutos (1/149) e outras alteraes 0,67% (1/149). Os resultados deste
a 5C. Separou-se o sobrenadante do sedimento e o estudo permitem concluir que as principais causas de morte
sobrenadante foi centrifugado novamente a 11.400g por 45 ou motivos para eutansia de ces na cidade de Salvador
minutos mantendo a temperatura de 5C. O sobrenadante foram s doenas infecciosas e parasitrias, insuficincia de
(plasma) foi misturado com uma soluo 50% de sulfato de rgos e choques, enquanto que em gatos, insuficincia de
amnio em uma temperatura de 5C sob agitao dentro rgos e distrbios causados por agentes fsicos obtiveram
do sistema fechado, onde permaneceu durante uma hora maior prevalncia. importante de dizer que, parte dos
sob agitao, sendo posteriormente centrifugada a 11.400g achados desse estudo evidencia que, em alguns casos, a
por 45 minutos a 5C. O sobrenadante obtido foi dialisado morte dos animais poderia ter sido evitada ou a sobrevida
com gua bidestilada como soluo de dilise por 20 horas ter sido maior, caso medidas profilticas como vacinaes,
tambm no sistema fechado com temperatura estabilizada vermifugaes e exames de rotina tivessem sido realizados,
em 5C. Aps a completa eliminao do sulfato de amnio, ou seja, esses dados servem de alerta para que os tutores
a soluo foi novamente centrifugada a 11.400g por 45 tenham uma conduta mais adequada quanto guarda
minutos a 5C sendo coletado o resduo flutuante rico em responsvel de seus animais de companhia. Cabe ressaltar
LDL. Foram realizadas algumas extraes at o presente que, este estudo parte de um trabalho em andamento mais
momento, porm ainda aguardamos os resultados da anlise abrangente, o qual, quando finalizado ir coligir dados de
qumica da LDL, feita atravs do mtodo de eletroforese em 10 anos de diagnsticos realizados pelo LPV-UFBA. Desta
gel policrilamida (SDS-PAGE). forma, o nmero de animais ser maior e, portanto, mais
representativo acerca das principais doenas de ces e gatos
Palavras-chaves: Criopreservao,diluidores que acometem os animais em nosso campo de atuao.
******************************************************************* Palavras-chaves: Necropsia,doenas de ces e gatos,causa
******************************************* mortis
*******************************************************************
rea: CINCIAS AGRRIAS - MEDICINA
*******************************************
VETERINRIA
TRABALHO: DETERMINAO DAS CAUSAS rea: CINCIAS AGRRIAS - MEDICINA
DE MORTE E OS MOTIVOS PARA EUTANSIA VETERINRIA
DE CES E GATOS DA CIDADE DE SALVADOR, TRABALHO: DETERMINAO DAS CAUSAS
BAHIA (2015-2017) DE MORTE E OS MOTIVOS PARA EUTANSIA
DE CES E GATOS DA CIDADE DE SALVADOR,
Autor(es): MARILAINE CARLOS SOUSA, LORENA SOUZA
RIBEIRO, THANIELLE FONTES, CHARMILA SOUZA D`SOARES, BAHIA: SEGUNDO ESTUDO RETROSPECTIVO
ALESSANDRA ESTRELA SILVA LIMA, EDUARDO LUIZ (2008-2009)
TRINDADE MOREIRA, TIAGO DA CUNHA PEIXOTO
Resumo: Investigaes acerca das principais causas de Autor(es): CHARMILA SOUZA D`SOARES, THANIELLE
morte e motivos para eutansia em ces e gatos de FONTES, LORENA SOUZA RIBEIRO, MARILAINE CARLOS
grande importncia, pois auxiliam no monitoramento, SOUSA, TIAGO DA CUNHA PEIXOTO
planejamento e avaliao das aes profilticas, para que
Resumo: Estudos regionais sobre causas de mortalidade
sejam tomadas medidas preventivas prioritrias, com a
em animais de companhia fornecem informaes teis
finalidade de diminuir o nmero de bitos e aumentar a
para os mdicos veterinrios, tornando-os cientes sobre
expectativa e a qualidade de vida desses animais. Objetivou-
as principais causas de bito entre cada espcie, raa, sexo
se com esse estudo determinar a frequncia das doenas
e idade, em sua rea de abrangncia profissional. Tais
que culminaram em bito ou que fizeram com que os ces
informaes geram importantes subsdios para realizao
e gatos da cidade de Salvador (BA) fossem eutanasiados,
de diagnsticos diferenciais, o que auxilia o estabelecimento
dando nfase na faixa etria. Os dados foram obtidos a
de diagnsticos finais corretos. Objetivou-se com esse
partir da reviso de todos os protocolos de necropsia de
trabalho determinar a frequncia das enfermidades que
ces e gatos arquivados entre julho de 2015 a julho de
culminam em morte ou que motivam eutansia de
2017 no Laboratrio de Patologia Veterinria (LPV) da
ces e gatos da cidade de Salvador, BA, dando nfase s
Universidade Federal da Bahia (UFBA).Foram encontrados
diferentes faixas etrias. Os dados foram obtidos a partir
535 protocolos de necropsias de ces e gatos. Dentre esses,
da reviso de todos os protocolos de necropsia de ces
386 pertenciam a ces e 149 pertenciam a gatos. As doenas
e gatos arquivados entre janeiro de 2008 a dezembro de
diagnosticadas foram agrupadas nas seguintes categorias
2009 no Laboratrio de Patologia Veterinria (LPV) da
e frequncias em ces: doenas infecciosas e parasitrias
Universidade Federal da Bahia (UFBA). Foram encontradas
19,17% (74/386), insuficincias de rgos 18,65% (72/386),
123 fichas, sendo 94 selecionadas e 29 excludas, por falta
choques 17,36% (67/386), inconclusivos 10,10% (39/386),
de informaes. Dentre essas, 82 pertenciam a ces e 12
neoplasias 8,80% (34/386), eutansia por convenincia
a gatos. As doenas diagnosticadas foram agrupadas nas
8,80% (34/386), distrbios causados por agentes fsicos
seguintes categorias e frequncias em ces: neoplasmas

54 Congresso da UFBA 2017 | Caderno de resumos


18% (15/82), choque 18% (15/82), doenas infecciosas LEAL NETO, CARLOS PASQUALIN CAVALHEIRO, MAURCIO
ou parasitrias 16% (13/82), eutansia por convenincia COSTA ALVES DA SILVA
15% (12/82), inconclusivos 15% (12/82), insuficincia de
rgos 11% (9/82), distrbios causados por agentes fsicos Resumo: O Brasil est entre os dez maiores produtores de
6% (5/82) e outras alteraes 1% (1/82). Nos felinos as camaro do mundo, sendo a Bahia o estado com a maior
categorias se distriburam da seguinte forma: choque 33% faixa litornea do Pas, mostrando boas condies para a

ESTUDANTE PIBIC
(4/12), inconclusivos 33% (4/12), distrbios causados por atividade de carcinicultura. Durante as etapas de produo,
agentes fsicos 8% (1/12), insuficincia de rgos 8% (1/12), inclusive as de manipulao e distribuio, podem ocorrer a
eutansia por convenincia 8% (1/12) e outras alteraes contaminao desse alimento por diferentes microrganismos,
8% (1/12). A elevada frequncia de casos inconclusivos, nos inclusive de Escherichia coli um patgeno importante que
quais no foi possvel estabelecer uma causa mortis, pode ser pode ser veiculado pela ingesto de alimentos com baixa
justificada devido ao grande nmero de casos com suspeita qualidade sanitria. O objetivo deste trabalho foi avaliar
de intoxicao por carbamatos, a saber, 13% (11/82) em ces a qualidade microbiolgica de camares (Litopenaeus
e 33% (4/12) em gatos. Na maioria desses casos, os achados vannamei) comercializados na cidade de Salvador, Bahia,
anatomopatolgicos foram compatveis com um quadro atravs da determinao do ndice colimtrico - Coliformes
de intoxicao exgena, uma vez que foram encontrados a 35C e Coliformes a 45C (termotolerantes) - bem como
grnulos de colorao enegrecida no intestino, o que indica verificar a ocorrncia de Escherichia coli. Foram analisadas
fortemente que o animal tenha sido intoxicado pelo veneno 30 amostras adquiridas aleatoriamente no comrcio
popularmente conhecido como chumbinho (carbamato), varejista de Salvador, no perodo de outubro de 2017 a
entretanto, para a confirmao diagnstica, necessrio julho de 2017. As amostras foram transportadas em caixas
realizao de exame toxicolgico, mas devido ao elevado isotrmicas contendo gelo reciclvel ao Laboratrio de
custo desse exame, a maioria dos tutores se recusa em Inspeo e Tecnologia de Carnes e Derivados (LABCARNE)
faz-lo. Tal constatao demonstra a falta de fiscalizao no para processamento e isolamento microbiolgico. O cultivo
comrcio dessa substncia de uso ilegal no pas e ressalta e identificao dessas bactrias foi feito pela metodologia de
sua utilizao de forma criminosa no extermnio de animais tubos mltiplos, utilizando os meios Caldo Verde Brilhante
domsticos. Em relao aos casos conclusivos, a entidade Bile 2% e Caldo Escherichia coli (EC), para determinao
especfica dentro de cada categoria mais frequente em ces do ndice colimtrico, e da tcnica de semeadura em
foram: carcinomas mamrios, osteossarcomas, linfomas superfcie por esgotamento em agar eosina azul de metileno
multicntricos, choque sptico, choque hipovolmico, (EMB), para pesquisa de Escherichia coli, com posterior
cinomose, leptospirose e leishmaniose. J para gatos: choque identificao bioqumica das colnias sugestivas isoladas no
sptico, choque hipovolmico, traumas e insuficincia agar. Das 30 amostras analisadas, o ndice de coliformes a
respiratria. No que diz respeito a faixa etria dos animais 35C variou de 23 NMP/g at mais de 2.400 NMP/g, sendo
acometidos, os adultos [51% (42/82) dos ces e 67% (8/12) que 10 amostras (41,7%) apresentaram ndice superior
dos gatos], seguido de idosos [24% (24/82) dos ces e 16,5% a 2.400 NMP/g. O ndice de coliformes a 45C variou de
(2/12) dos gatos], destacaram-se. Em relao raa, a maioria menor que 3 NMP/g a mais de 2.400 NMP/g, sendo que
dos animais [38% (31/82) dos ces e 83% (10/12) dos felinos] trs amostras (13,6%) apresentaram ndice superior a 2.400
eram SRD. Os resultados desse estudo permitem concluir que NMP/g. Apesar da legislao brasileira de no determinar
as principais causas de morte ou motivo para eutansia na padres de tolerncia mxima de coliformes para esse
cidade de Salvador incluem neoplasias, choques e doenas alimento, a quantidade de coliformes a 35C e coliformes a
infecciosas ou parasitrias nos ces e choques e traumas em 45C encontradas demonstrem que as amostras analisadas
felinos. Tais frequncias podem variar de acordo com a faixa apresentavam baixa qualidade higinico-sanitria. J a
etria dos animais, mas se mantm mais altas em adultos. bactria Escherichia coli foi isolada em 16 amostras (53,3%),
Cabe ressaltar que, este estudo parte de um trabalho em revelando que essas amostras encontravam-se imprprias
andamento mais abrangente, o qual, quando finalizado ir para o consumo humano por apresentarem microrganismos
coligir dados de 10 anos de diagnsticos realizados pelo de origem fecal. Os resultados indicam que os camares in
LPV-UFBA. Desta forma, o nmero de animais ser maior e, natura comercializados na cidade de Salvador, Bahia, podem
portanto, mais representativo acerca das principais doenas oferecer riscos sade pblica.
de ces e gatos que acometem os animais em nosso campo Palavras-chaves: coliforme,infeco alimentar,pescado
de atuao.
*******************************************************************
Palavras-chaves: Doenas de animais de companhia,causa *******************************************
mortis,bito
******************************************************************* rea: CINCIAS AGRRIAS - MEDICINA
******************************************* VETERINRIA
TRABALHO: ECTOPARASITAS ASSOCIADOS A
rea: CINCIAS AGRRIAS - MEDICINA
VETERINRIA ANUROS DO MUSEU DE ZOOLOGIA DA UFBA
TRABALHO: DETERMINAO DO Autor(es): ALAN BEANES, THIAGO CAMPANHARO
NDICE COLIMTRICO E PESQUISA BAHIENSE, ARETHA ALVES BORGES SILVA, MARCELO
FELGUEIRAS NAPOLI
DE ESCHERICHIA COLI EM CAMARES
Resumo: O parasitismo uma relao interespecfica,
(LITOPENAEUS VANNAMEI) desarmnica do tipo espoliador de recursos, onde o parasita,
COMERCIALIZADOS EM SALVADOR, BA habitando internamente ou sobre a superfcie do hospedeiro,
drena a substncia essencial a sua sobrevivncia. A literatura
Autor(es): ANISIO IURI LIMA DOS SANTOS ROSRIO, relata a associao de caros do gnero Hannemania em
RAFAEL SEPLVEDA FONSECA TREVISAN PASSOS, EWERTON diversas famlias e de carrapatos, tanto da famlia Argasidae
LUAN DOS SANTOS OLIVEIRA, DENILSON LUIZ DOS quanto da famlia Ixodidade associados a anuros, em maior
SANTOS DE OLIVEIRA, LARCIO DINIZ, NILMA PEREIRA nmero ao gnero Rhinella. Os carrapatos so parasitas
COSTA, EVERTON LIMA DOS SANTOS, ANTENOR FERREIRA hematfagos da classe Arachnida, possuem trs estgios
evolutivos (larva, ninfa e adulto), podendo pertencer a trs
famlias: Ixodidade (carrapatos de corpo duro), Argasidae

Congresso da UFBA 2017 | Caderno de resumos 55


(carrapatos de corpo mole), Nutallillidae e sendo as quanto em superfcies mais elevadas, onde esses parasitos
duas primeiras de importncia veterinria no Brasil. Nos se encontram. Com relao aos caros, o ventre de cabea,
ixoddeos, o corpo das fmeas e dos estgios juvenis so corpo e membros foi o local de predileo para a associao,
cobertos na sua parte anterior por uma estrutura rgida e alm do contato com o solo, esse segmento do corpo tem a
dura, chamada de escudo, nos machos, esse escudo cobre pele mais tnue, o que facilita a penetrao desses parasitos,
toda a extenso do corpo. Os argasdeos no possuem embora a associao com a B. oxenti, embora tambm em
ESTUDANTE PIBIC

escudo, so cobertos por uma estrutura flexvel chamada ventre dos segmentos j citados, tenha sido multifocal em
de cutcula. A infestao pode levar o hospedeiro a anemia, todo o corpo, abrangendo tambm reas de dorso, j que
devido a drenagem de sangue constante pelos parasitos e a pele fina nessas duas faces. Assim como o A. dissimile,
transmisso de patgenos, como a Rickettsia. Os caros do descrito como Carrapato da Jiboia foi encontrado em anuros,
gnero Hannemania vivem como caros de ambiente, em so necessrios novos estudos em busca do Carrapato do
seu estgio de ninfa e adulto, durante a fase de larva, se Sapo (A. rotundatum) em rpteis, levantando dados em prol
comportam como parasita subcutneo de anfbios, onde se da conservao da herpetofauna no Estado. Comprova-se
encapsulam nesse tecido e se alimentam do seu hospedeiro, que no Estado da Bahia existe a associao de ectoparasitos
sua fixao geralmente em tecidos brandos, de baixa a anuros, apresentando ampla distribuio no territrio
dureza. A ordem Anura pertence classe dos anfbios e baiano, aumenta a distribuio para os Estados de Minas
consta de 1.039 espcies divididos em 20 famlias. O estudo Gerais e Alagoas, com essas ocorrncias sendo nas famlias
pretende levantar dados sobre anuros parasitados no estado Leptodactylidae, Hyliae e Bufonidae.
da Bahia. Foram inspecionados animais pertencentes
coleo zoolgica de anfbios do Museu de Histria Natural Palavras-chaves: Ectoparasitos,anuros,parasitologia
da Universidade Federal da Bahia, os parasitos encontrados *******************************************************************
foram recolhidos, conservados em microtubo de reao com *******************************************
lcool 70% e posteriormente identificados. Os carrapatos
foram identificados utilizando chave dicotmica para ninfas
(Martins, 2009), adultos (Barros-Battesti et al., 2006) e as rea: CINCIAS AGRRIAS - MEDICINA
larvas sero identificadas at o txon de famlia por meio VETERINRIA
de sua morfologia. Os caros foram identificados devido ao TRABALHO: EFEITO DA IDADE SOBRE O
mtodo de parasitismo, exclusivo do gnero Hannemania
em anfbios. As verificaes ocorreram no gnero Rhinella, METABOLISMO DE ALGUNS MINERAIS EM
sendo vistoriadas 8 espcies (R. crucifer, R. granulosa, R. EQUINOS JOVENS DA RAA MANGALARGA
hoogmoedi, R. ictrica, R.jimi, R.margaritifer, R. paracnemis,
R. schneideri) e alguns indivduos identificados apenas MARCHADOR CRIADOS EM CLIMA TROPICAL
ao nvel desse gnero, em um indivduo de Leptodactylus
chaquensis e um indivduo da espcie Bookermannohyla Autor(es): ELAINE BORGES, MARIA CONSUELO CARIBE
oxenti. Foram verificados 977 animais, 52 deles apresentando AYRES
associao com ectoparasitas, sendo 47 com carrapatos
e 6 com caros. Nos animais do gnero Rhinella, foram Resumo: O monitoramento do perfil bioqumico srico
encontrados 107 carrapatos e 18 caros. Os carrapatos uma ferramenta importante para auxiliar no diagnstico
foram encontrados em maior nmero em R. crucifer, de doenas na clnica, no estabelecimento de prognsticos
sendo 27 indivduos parasitados, equivalente a 57,45% e na avaliao do status de sade de equinos. Entretanto
das associaes por carrapato, seguido por R. jimi (11 os valores dos parmetros bioqumicos podem sofrer
associaes), R. granulosa (7 associaes) e R. schneideri alteraes devido idade, sexo, atividade fsica do animal,
(1 associao), enquanto a B. oxenti apresentou tambm localizao, entre outros. Este trabalho teve por objetivo
apenas uma associao. Com relao a estgio evolutivo, avaliar a influncia do fator etrio sobre a dinmica de alguns
foram coletadas 76 larvas, 69 da famlia Ixodidae (90,79%), 6 elementos minerais (clcio, fsforo, magnsio e potssio)
da famlia Argasidae (7,89%) e uma larva estava degradada, em equinos jovens de diferentes grupos etrios (desde o
impedindo sua identificao. Apenas um registro de nascimento at os seis meses de idade), da raa Mangalarga
argasdeo aconteceu em B. oxenti, todos os outros foram Marchador criados em clima tropical. Foram includos no
em indivduos Rhinella. Das 29 ninfas, todas encontradas no trabalho 68 animais jovens distribudos em grupos etrios:
gnero Rhinella, 28 foram identificadas como Amblyomma G1 do nascimento at 30 dias de vida (n=13), G2 at 60
rotundatum e uma como Amblyomma dissimile, encontrada dias de vida (n=13), G3 animais com at 90 dias (n=14), G4
no R. crucifer. Os adultos foram encontrados em R. crucifer (2 acima de 90 dias e at 120 dias (n=10), G5 animais com at
exemplares) e R. jimi (1 exemplar), todos identificados como 150 dias (n=8) e G6 animais com at seis meses de idade
A. rotundatum. Os mais de 20 caros foram encontrados (n=10), procedentes do Haras criatrios da raa Mangalarga
em B. oxenti, L. chaquensis e R. granulosa, todos em Marchador mantidos no Estado da Bahia. O processamento
cpsulas em tecido subcutneo, mtodo correspondente das amostras foi realizado com a utilizao de kits
ao gnero Hannemania. Os municpios no qual ocorreram comerciais (Doles) em analisador semiautomtico (BS 250)
as associaes foram: Mata de So Joo (16 ocorrncias), no Laboratrio de Hematologia e Bioqumica da Escola de
Barreiras (6), Salvador e Ilhus (4 cada), Maracs (3), Caetit, Medicina Veterinria da UFBA. Os dados foram submetidos
Camaari, Cura, Ibiraba (2 cada) e Itamaraju, Itapebi, a anlise de varincia e teste de Tukey com valor de p<0,05.
Jacinto/MG, Lenis, Piranhas/AL, Santa Rita de Cssia e Os valores mdios sricos mximo e mnimo encontrados
Valena (1 cada). Houve uma predominncia de larvas nos entre os grupos nos macrominerais foram: Clcio (10,08 a
exemplares coletados, representando 70,37% das amostras 10,46mg/dL); Fsforo (6,92 a 7,38mg/dL); Potssio (4,45 a
coletadas, tendo uma maioria de ixoddeos e corresponde 4,95mmol/L) e Magnsio (1,89 a 2,73 mg/dL). Na literatura
aos dados encontrados em literatura. Para o gnero Rhinella, ainda no h trabalhos avaliando o perfil bioqumico de
esses foram os primeiros achados de parasitismo envolvendo potros da raa Mangalarga Marchador, de forma que
argasdeos no pas. Houve uma associao concomitante comparaes com outras raas de equinos foram utilizadas
entre carrapatos e caros no indivduo de B. oxenti. No para confrontar os achados experimentais. Concluiu-se
houve associao conjunta entre argasdeos e ixodideos. O com este trabalho que o fator etrio exerceu influncia nas
segmento do corpo que apresentou maior grau de infestao, concentraes sricas de clcio e magnsio (p<0,05).
relacionado a carrapatos foi o corpo, mais precisamente a Palavras-chaves: Eletrlitos, Monitoramento, Perfil
lateral, isso pode ser explicado por ser a maior rea do corpo Bioqumico
e ser o segmento que entra em contato tanto com o solo

56 Congresso da UFBA 2017 | Caderno de resumos


******************************************************************* Area: CINCIAS AGRRIAS - MEDICINA
*******************************************
VETERINRIA
rea: CINCIAS AGRRIAS - MEDICINA TRABALHO: EFEITO DA SUBSTITUIO
VETERINRIA DE GORDURA POR PROTENA LCTEA NAS
CARACTERSTICAS FSICO-QUMICAS,

ESTUDANTE PIBIC
TRABALHO: EFEITO DA IDADE SOBRE O
METABOLISMO PROTICO DE EQUINOS TEXTURAIS E ANLISE SENSORIAL DE
JOVENS DA RAA MANGALARGA IOGURTE CAPRINO COM POLPA DE
MARCHADOR CRIADOS EM CLIMA TROPICAL CUPUAU
Autor(es): NATLIA FONTES, MARIA CONSUELO CARIB Autor(es): LUANA SIPABA MORENO BARRETO, MARION
AYRES, CRISTIANA MORAIS COSTA COSTA, UDIMILA SANTOS, VANESSA BARRETO PINHEIRO,
BEATRIZ FRASO
Resumo: A equinocultura uma importante e expressiva
atividade no setor da agropecuria.No mercado nacional Resumo: Com o crescente estimulo a uma alimentao
a equinocultura se consolidou como um importante setor saudvel e ao mesmo tempo saborosa, diversas tecnologias
do agronegcio por gerar renda, empregos fixos e giro do vem sendo empregadas a fim de combinar essas duas
capital que estima-se em 7,3 bilhes de reais. Devido a caractersticas na elaborao de novos produtos lcteos
expanso do agronegcio do cavalo no Brasil nos ltimos funcionais. Os leites fermentados, como por exemplo, o
anos, existe maior demanda de pesquisas cientficas iogurte tem ampla disseminao nos mercados e com
voltadas para a espcie em questo. Neste contexto, a variadas alternativas para o consumidor que atendem esse
bioqumica uma importante ferramenta de auxlio ao estilo de vida, sendo que a maioria tem como matria
diagnstico clnico. As protenas so fundamentais para a prima o leite bovino. Porm, os leites fermentados caprinos
plena funcionalidade de tecidos, rgos e sistemas. Dessa apresentam uma melhor digestibilidade, hipoalergenicidade
forma, so relevantes estudos voltados sobre a dinmica do e elevado valor nutricional, sendo o seu consumo inclusive
metabolismo protico. Esse trabalho teve por objetivo avaliar indicado por mdicos e pediatras para crianas e idosos.
a influncia do fator etrio sobre o perfil dos metablitos Desta forma, produtos derivados do leite de cabra tem
proticos (ureia, albumina, protenas totais e globulinas) sido um excelente substituto ao leite de vaca na nutrio
em potros e potras da raa Mangalarga Marchador, criadas humana. Contudo, no caso dos leites fermentados caprinos,
em clima tropical. O experimento foi desenvolvido na como os iogurtes, devido diferena de consistncia e sabor
regio do Recncavo do estado da Bahia. Foram utilizados caractersticos frente ao leite fermentado bovino, apresentam
68 animais distribudos em grupos de acordo com as menor aceitao em relao aos consumidores no habituais.
distintas faixas etria (do nascimento at seis meses de Tais caractersticas se devem principalmente a presena de
vida). Todos os animais includos no estudo eram sadios e cidos graxos de cadeia curta, como por exemplo cidos
criados em manejo extensivo. Para avaliao dos parmetros caprico, caprlico e cpricos, e as diferenas da micela
bioqumicos foi coletado amostras de sangue a partir da de casena, como menor tamanho da micela, diferente
venopuno jugular em tubos sem EDTA e em seguida foi rearranjo dos grupamentos fosfatos e menor concentrao
realizada a centrifugao para obteno do soro o qual foi da &#945;-s1-casena. Pensando nisso, o desnate do leite
aliquotado em eppendorf e armazenado em freezer a -20C, caprino, alm de promover maior diversidade de produtos
at o momento da realizao dos testes. Como tratamento lcteos desta matriz, minimiza o sabor caracterstico, uma
estatstico foi utilizado o teste de Tukey e adotado nvel de vez que este est diretamente relacionado gordura do leite.
significncia p>0,05. Os resultados obtidos demonstraram Por outro lado, se perderia um dos principais componentes
que as concentraes sricas encontravam-se de acordo associado s caractersticas texturais e reolgicas do iogurte.
com os valores de referncia para a espcie. Os parmetros Com isso, surgem novas alternativas de substituio dessa
bioqumicos, albumina, protenas totais e globulinas no gordura, adicionando novos ingredientes, visando minimizar
apresentaram diferena estatstica p>0,05, entretanto a uria as alteraes de consistncia e reologia do produto, ou at
apresentou aumento gradativo com o desenvolvimento mesmo melhor-las. A partir disso, este projeto tem como
etrio, sendo este significativo (p>0,05). Esses resultados objetivo avaliar a substituio de gordura por protenas
demonstraram o efeito da idade sobre a ureia. Esse estudo lcteas como protena do soro de leite e leite em p
possibilita inferir que os animais estavam em manejo desnatado, nas caractersticas fsico- qumicas, colorimtricas,
alimentar adequado. texturais e sensoriais de iogurtes caprinos adicionando polpa
de cupuau. Alm de melhorar a textura e sabor, elaborando
Palavras-chaves: equinos, bioqumica, protenas um alimento com baixo teor de gordura.
******************************************************************* Palavras-chaves: leite, cabra, desnatado
*******************************************
*******************************************************************
*******************************************

Congresso da UFBA 2017 | Caderno de resumos 57


Area: CINCIAS AGRRIAS - MEDICINA Resumo: O objetivo do presente estudo foi de avaliar o
efeito da reduo dos nveis dietticos de protena bruta
VETERINRIA
(PB) sobre a fermentao ruminal e excreo e reteno de
TRABALHO: EFEITO DA UTILIZAO nitrognio (N) em ovinos mestios da raa Santa Ins. Quatro
DO NVEL DIETTICO ESTTICO E carneiros mestios, castrados e fistulados no rmen, com
peso corporal (PC) mdio inicial de 60,6 10,6 kg, todos
OSCILANTE DE PROTENA BRUTA SOBRE
ESTUDANTE PIBIC

com quinze meses de idade, foram distribudos em oito


O DESEMPENHO E CARACTERSTICAS DE quadrados latinos 2 x 2. A dieta experimental foi constituda
por 50% de feno de Tifton 85 e 50% de concentrado. Os
CARCAA DE OVINOS MESTIOS dados foram analisados utilizando-se o PROC MIXED do
SAS (version 9.2) e adotou-se 5% como nvel crtico de
Autor(es): MARIANA DE QUEIROZ SAMPAIO, FELIPE DA probabilidade para o erro tipo I. O consumo de PB foi
SILVA NERI, CNTIA RAQUEL NUNES DE OLIVEIRA, LAYS maior (P < 0,05) nos animais alimentados com 150g de PB/
DBORA SILVA MARIZ, STEFANIE ALVARENGA SANTOS kg de MS em relao aqueles alimentados com 130g de
PB/kg de MS. No houve efeito (P > 0,05) do contedo de
Resumo: O objetivo deste estudo foi de avaliar os PB diettica sobre a digestibilidade da MS e dos demais
efeitos da reduo no contedo da protena bruta (PB) constituintes da dieta. Como esperado, os animais que foram
diettica, e o efeito das alteraes nos nveis de PB nas alimentados com 150 g de PB/ kg de MS apresentaram
fases de crescimento e terminao sobre o consumo, a maiores concentraes de nitrognio amoniacal (NH3-N)
digestibilidade, o desempenho e as caractersticas da carcaa (P < 0,01) ruminal e de N-ureico no sangue (P = 0,03) em
de ovinos Santa Ins. Foram utilizados 40 ovinos mestios relao aqueles alimentados com 130 g de PB / kg de MS.
Santa Ins, peso corporal mdio inicial de 15 kg 1,6 kg, Similarmente, as excrees de N urinrio foram maiores
todos com dois meses de idade. O experimento teve uma (P = 0,01) nos animais alimentados com 150 g de PB/kg de
durao de 70 dias, sendo constitudo por dois perodos de MS. No entanto, no houve efeito sobre a reteno do N
35 dias. Na fase inicial (FI, dos dias 1 a 35) do confinamento, (P = 0,74) e relaes entre o N retido e N ingerido (P = 0,22)
os animais receberam aleatoriamente um de dois nveis de ou N absorvido (P = 0,09). Nossos resultados indicam que a
PB na dieta (130 ou 150 g de PB/kg de MS). Na fase final utilizao de 130 g de PB/kg de MS promove melhorias na
(FF, dos dias 36 a 70), metade dos animais alimentados com eficincia de utilizao do N e reduz as excrees de N em
cada nvel de PB foram aleatoriamente selecionados para a ovinos Santa Ins, evidenciando um melhor aproveitamento
reverso do nvel de PB na dieta. Desta forma, o experimento da protena por parte do animal.
foi conduzido segundo delineamento inteiramente
causalizado, em um esquema fatorial 2 x 2, em que os Palavras-chaves: excreo,nitrognio,protena
fatores foram dois nveis de PB na FI do confinamento e dois
*******************************************************************
nveis de PB na FF. Os dados foram analisados utilizando-se
*******************************************
o PROC MIXED do SAS (version 9.2) e adotou-se 5% como
nvel crtico de probabilidade para o erro tipo I. A dieta
experimental foi constituda por 50% de feno de Tifton 85 e rea: CINCIAS AGRRIAS - MEDICINA
50% de concentrado. No houve interao (P > 0,05) entre VETERINRIA
a fase inicial (FI) e final (FF) para nenhuma das variveis
avaliadas. Como esperado, o consumo de PB foi maior (P < TRABALHO: ELETROFORESE EM GEL DE
0,05) nos animais alimentados com 150g de PB/kg de MS em POLIACRILAMIDA E WESTERN BLOT
relao aqueles alimentados com 130g de PB/kg de MS. No
houve efeito (P > 0,05) do contedo de PB diettica sobre EMPREGANDO-SE PROTENAS DE OOCISTOS
a digestibilidade da MS e dos demais constituintes da dieta DE TOXOPLASMA GONDII E ANTICORPOS
na FI e FF avaliadas. Os animais que receberam 130 e 150 g
de PB/kg de MS apresentaram em ambas as fases (FI e FF), MONOCLONAIS
ganho mdio dirio (P =0,48) e peso corporal final (P =0,65)
similares. Em adio, no houve efeito dos contedos de PB Autor(es): MARIANA DE CAMARGO, LUIS FERNANDO PITA
sobre a gordura subcutnea (P = 0,58), comprimento interno GONDIM
(P =0,58) e cortes da carcaa (P > 0,05). Nossos resultados
Resumo: A toxoplasmose uma zoonose altamente
indicam que no h benefcios na utilizao de dietas com
disseminada, causada pelo parasito protozorio Toxoplasma
nveis proteicos acima de 130 g/kg MS e nem das alteraes
gondii. O parasito possui trs formas infectantes, oocistos
destes nveis durante a fase de crescimento e terminao
contendo esporozotos, taquizotos, e bradizotos em cistos
sobre o desempenho e caractersticas de carcaa de ovinos
teciduais. O gato seu principal hospedeiro definitivo,
Santa Ins.
no qual ocorre a formao e excreo de oocistos do
Palavras-chaves: Consumo, Crescimento,Terminao parasito no ambiente. Nos hospedeiros intermedirios
(aves e mamferos), ocorre somente a formao de estgios
******************************************************************* assexuados do protozorio. T. gondii apresenta grande
******************************************* tropismo por clulas do sistema nervoso, corao e
msculo esqueltico, mas pode ser encontrado em outros
rea: CINCIAS AGRRIAS - MEDICINA tecidos do hospedeiro. As principais formas de transmisso
da doena so atravs da ingesto de gua e alimentos
VETERINRIA
contaminados com oocistos, por meio da ingesto de
TRABALHO: EFEITO DOS NVEIS tecidos animais contendo bradizotos encistados, alm de
DIETTICOS DE PROTENA BRUTA SOBRE A transmisso transplacentria na maioria dos mamferos. O
diagnstico de exposio ao parasito se d por meio de
DINMICA DA FERMENTAO E BALANO testes sorolgicos, entretanto, no h mtodos capazes
DOS COMPOSTOS NITROGENADOS EM de diferenciar a transmisso via ingesto de oocistos
daquela decorrente de produtos crneos contendo cistos
OVINOS MESTIOS teciduais. Anticorpos monoclonais tm-se mostrado
teis para identificao, purificao e caracterizao de
Autor(es): ANDREI JEFERSON MAGALHES DA SILVA, LAYS antgenos de T. gondii. No estudo corrente, objetivou-se
DBORA SILVA MARIZ testar dois anticorpos monoclonais contra oocistos de T.

58 Congresso da UFBA 2017 | Caderno de resumos


gondii. Realizou-se a infeco oral de seis camundongos contedo, a tnica vaginal foi suturada diretamente
suos com 1 x 103 oocistos de T. gondii para cada animal. musculatura remanescente do diafragma plvico; no grupo
Aps 30 dias, foi realizada a eutansia dos camundongos e 2, o enxerto foi utilizado como reforo aps a sntese
a retirada de corao e crebro. Esses tecidos contendo os primria atravs de herniorrafia clssica. Os ces tiveram
bradizotos encistados foram ofertados a dois gatos, que acompanhamento clnico por um perodo mnimo de 90 dias,
eram sorologicamente negativos para T. gondii. Os dois gatos chegando a 365 dias em alguns casos. Houve recidiva apenas

ESTUDANTE PIBIC
excretaram oocistos do parasito em suas fezes. Entretanto, em dois animais do grupo 1, deiscncia de sutura em dois
a quantidade de oocistos excretados foi muito abaixo do animais do grupo 2, e outras complicaes ps-operatrias
esperado e insuficiente para posterior realizao no Western inerentes ao procedimento cirrgico, como edema, seroma
blot. Desta forma, os dois anticorpos monoclonais foram e tenesmo, em ambos os grupos. Concluiu-se assim que
testados empregando-se taquizotos de T. gondii, da cepa RH, o enxerto autgeno de tnica vaginal em ces, obtido por
como antgeno. Os taquizotos (3 x 107) utilizados na tcnica meio de orquiectomia prvia, apresentou fcil aplicabilidade
foram obtidos em cultivo celular no laboratrio do Grupo nos dois grupos, porm, quando utilizado como reforo para
de Pesquisa de Protozorios Coccdeos-UFBA, purificados, a herniorrafia clssica, alcanou-se maior valor teraputico e
adicionados a um tampo de lise, e em seguida, a amostra efetividade na correo do diafragma plvico.
foi aquecida temperatura de 97C por 10 minutos para
a solubilizao das protenas. A soluo foi centrifugada a Palavras-chaves: herniorrafia,cirurgia,membrana biolgica
14.000 x g por 10 minutos e submetida a eletroforese em gel *******************************************************************
de poliacrilamida contendo SDS (SDS-PAGE). Em seguida, *******************************************
realizou-se uma transferncia eletrofortica das protenas do
gel pra uma membrana de PVDF. As protenas de taquizotos
foram visualizadas por meio de colorao de uma tira da rea: CINCIAS AGRRIAS - MEDICINA
membrana de PVDF com azul de Comassie. O restante da VETERINRIA
membrana de PVDF contendo antgenos de T. gondii foi TRABALHO: ESTIMATIVAS DE
bloqueado em soluo de gelatina a 2% para uso posterior
em immunoblot. HERDABILIDADE E CORRELAES
Palavras-chaves: Toxoplasmose, Imunodiagnstico, GENTICAS ENTRE MEDIDAS LINEARES EM
Imunoglobulinas EQUINOS DA RAA CAMPOLINA
*******************************************************************
******************************************* Autor(es): GLEB STRAUSS BORGES JUNQUEIRA, GREGRIO
MIGUEL FERREIRA DE CAMARGO, MARIANA MARTINS
RGO JESUS, CAIO VICTOR DAMASCENO, RAPAHEL BERMAL
rea: CINCIAS AGRRIAS - MEDICINA COSTA
VETERINRIA
Resumo: O rebanho equino brasileiro bastante
TRABALHO: ENXERTO LIVRE DE TNICA diversificado, sendo que algumas raas se destacam
VAGINAL AUTGENA NO REPARO por apresentar maior importncia econmica como a
Mangalarga Machador, Campolina, Quarto de Milha, Cavalo
DO DIAFRAGMA PLVICO DE CES Pantaneiro, Crioulo e Brasileiro de Hipismo. Esse rebanho
PORTADORES DE HRNIA PERINEAL selecionado de forma subjetiva pelos criadores, que utilizam
como base as caractersticas morfolgicas, o desempenho
Autor(es): GRAZIELA SOUZA DIAS, JOO MOREIRA COSTA em provas e feiras agropecurias. As medidas lineares so os
NETO nicos parmetros utilizado pelas associaes de criadores,
como forma de controle para que as caractersticas de cada
Resumo: A hrnia perineal uma enfermidade de grande raa se perpetuem ao longo do tempo. Assim, o objetivo
importncia na espcie canina, acometendo frequentemente deste estudo foi estimar a herdabilidade e as correlaes
ces machos, idosos e no castrados. Ela se caracteriza pelo genticas entre as medidas lineares da altura da cernelha
enfraquecimento do diafragma plvico, devido a fatores (AC), altura da garupa (AG) e o comprimento da garupa (CG),
traumticos, hormonais ou condies patolgicas, levando em equinos da raa Campolina. Os dados utilizados foram
ao deslocamento de rgos abdominais para o perneo. obtidos dos livros de registro genealgico, cedidos pela
Podem haver ainda anomalias retais concomitantes. Os sinais Associao Brasileira dos Criadores do Cavalo Campolina
clnicos mais comuns so disria ou anria, constipao, (ABCCCAMPOLINA), para estimar a herdabilidade e as
disquezia, tenesmo e aumento de volume perineal (redutvel correlaes genticas entre AC, que corresponde a distncia
ou no). Existem diversas tcnicas cirrgicas para o reparo da vertical do ponto mais alto da regio interescapular at o
hrnia perineal canina, e dentre elas o uso da tnica vaginal solo; AG, que corresponde a distncia vertical do ponto
autgena tem se mostrado adequado para a correo do mais alto da garupa, no espao definido pelo processo
diafragma plvico, sendo utilizada como enxerto livre ou espinhoso de T5 T6 sobre a tuberosidade sacral do leo at
pediculado. Por tratar-se de um autoenxerto, no apresenta o solo, e CG que corresponde a distncia entre as partes
propriedades antignicas, alm de poder ser obtida atravs cranial da tuberosidade ilaca e a caudal da tuberosidade-
de orquiectomia, que por sua vez um procedimento isquitica. Os registros apresentam animais em 22 estados
indicado como terapia adjuvante para diminuir as chances brasileiros e no Distrito Federal, na srie histrica de 1951 a
de recidivas. Por ser uma membrana biolgica, tambm 2016, no total de 107.810 animais e a matriz de parentesco
permite evitar os custos que seriam necessrios com at a ltima gerao conhecida com a composio de
o emprego de materiais sintticos. O objetivo deste 91.483 animais. As medidas dos animais foram obtidas por
trabalho foi avaliar comparativamente a aplicabilidade e tcnicos da associao atendendo aos requisitos mnimos
exequibilidade do enxerto autlogo livre de tnica vaginal da raa para serem inclusos no livro de registro. Para
em nica camada, em 16 ces portadores de hrnia formao dos grupos de contemporneo, foram excludos
perineal. Os animais foram divididos aleatoriamente em dois os animais que continham valores outliers nas observaes
grupos, sendo realizado inicialmente o procedimento de e no continham todas as informaes desejadas para as
orquiectomia aberta, com a coleta das tnicas vaginais e seu medidas estudadas. Os efeitos utilizados foram os de ano
preparo para uso posterior. No grupo 1, aps abordagem de nascimento, estao de nascimento (dividida em quatro
do processo hernirio, com inspeo e reduo do seu classes: animais nascidos nos meses de dezembro a fevereiro,

Congresso da UFBA 2017 | Caderno de resumos 59


maro a maio, junho a agosto e setembro a novembro), rea: CINCIAS AGRRIAS - MEDICINA
mesorregio (dividida de acordo com o IBGE, 2011) e sexo
VETERINRIA
em uma primeira anlise e a incluso da pelagem em uma
anlise posterior. A consistncia dos dados foi realizada TRABALHO: ESTIMATIVAS DE PARMETROS
para cada uma das medidas estudadas, por meio do
software SAS (SAS Inst., Inc., Cary, NC). Em cada grupo de
GENTICOS PARA LARGURA DA CABEA,
LARGURA DAS ANCAS E PERMETRO DO
ESTUDANTE PIBIC

contemporneo foram excludos os animais com medidas


fora do intervalo da mdia trs desvios padro. Foram
excludos grupos de contemporneo que continham apenas
TRAX DE EQUINOS DA RAA CAMPOLINA
animais filhos de um mesmo garanho. Foram excludos os
grupos de contemporneo com menos de trs animais. A Autor(es): MARIANA MARTINS RGO JESUS, RAPHAEL
base de dados foi composta por 19.537, 19.537 e 19.537 BERMAL, GLEB STRAUSS
observaes para as medidas AC, AG e CG na primeira Resumo: O Brasil detentor do maior rebanho de equinos
anlise e 10.522, 10.523 e 10.512 observaes para as na Amrica Latina e o quarto mundial. Dentre as principais
medidas AC, AG e CG na anlise com a incluso da pelagem raas do cenrio nacional o cavalo Campolina destaca-se
no grupo de contemporneo. Os parmetros genticos e segundo o padro racial da ABCCCampolina, um cavalo
foram estimados por inferncia Bayesiana, utilizando um Campolina deve ter, entre outras caractersticas, um porte
modelo animal de mltiplas caractersticas, pelo amostrador alto, ser tipo sela, dcil, atento, de fcil manejo, com a
de Gibbs utilizando o software GIBBS2F90 (Misztal et al., cabea em perfil, de forma trapezoidal tendendo a retangular
2014). O modelo utilizado inclui como efeito fixo a idade e proporcional ao animal de maneira geral, as ancas devem
do animal ao registro, grupo de contemporneo e efeito ser simtricas, harmoniosas e bem cobertas, o ventre
do proprietrio. O efeito de proprietrio foi includo no deve ter forma arredondada, proporcional e com um leve
modelo para caracterizar as tcnicas de manejo semelhantes. levantar na parte posterior. No presente estudo as medidas
A inferncia foi baseada na cadeia de Markov Monte Carlo morfomtricas abordadas foram a largura de cabea, largura
com cadeias de 300.000 ciclos com um perodo de burn-in de anca e permetro do trax de cavalos da raa Campolina
de 50.000 ciclos para a primeira anlise e 1.000.000 de ciclos que podem ser definidas, sequencialmente, como a distncia
com um perodo de queima de 50.000 ciclos para a anlise mxima compreendida entre os globos oculares (largura
com a incluso da pelagem no grupo de contemporneo. de cabea), distncia compreendida entre as tuberosidades
As estimativas de herdabilidade foram moderadas e coxais dos ossos ilacos do lado direito e esquerdo (largura
altas 0,51 0,08, 0,52 0,11, 0,18 0,04 para AC, AG, CG de anca) e a medida compreendida entre os processos
respectivamente, o que sugere que estas medidas devem espinhoso da 11 vrtebra torcica e a regio do 9 espao
responder satisfatoriamente seleo individual. A no intercostal (permetro do trax). O objetivo desse estudo foi
incluso da pelagem no grupo de contemporneo teve estimar parmetros genticos para largura de cabea, largura
efeito de superestimao da varincia gentica aditiva o de ancas e permetro do trax visando a utilizao dessas
que provocou a subestimao da herdabilidade do CG (0,20 caractersticas como critrios de seleo em programas de
0,04) e a superestimao da herdabilidade da AC (0,45 melhoramento de equinos da raa Campolina. Os dados
0,08), e CG (0,44 0,09). Estimativas diferentes foram obtidas empregados nesse estudo foram provenientes dos livros de
por dos Santos (2006), para AC, AG e CG (0,71, 0,68 e 0,49, registros genealgico cedidos pela Associao Brasileira dos
respectivamente) trabalhando com o mesmo banco de Criadores do Cavalo Campolina (ABCCCAMPOLINA) para
dados. Molina et al. (1999) obtiveram resultado superior para estimar a herdabilidade e as correlaes genticas entre
a estimativa da AC (0,58) em cavalos Andaluz. Estimativas Largura de Cabea (LC), Largura de Anca (LA) e Permetro
superiores foram encontradas por Miserani et al. (2002) do Trax (PT). O registro foi composto de animais de 22
trabalhando com o cavalo Pantaneiro, para AC (0,61) e CG estados brasileiros e do Distrito Federal na srie histrica
(0,68) e uma estimativa similar anlise sem a incluso de 1951 a 2016, totalizando 107.810 animais com a matriz
da pelagem no modelo para AG. As correlaes genticas de parentesco at a ltima gerao conhecida com a
estimadas foram altas entre as medidas nos dois modelos composio de 91.483 animais. As medidas lineares foram
estudados, 0.99 0,01 entre AC e AG, 0.79 0,02 entre AC e obtidas por tcnicos da associao que respeitaram os
CG e 0.80 0,02 entre AG e CG, para o modelo sem pelagem. requisitos mnimos exigidos pela ABCCCampolina para
Com a pelagem as correlaes foram, 0.99 0,01 entre AC e serem inclusos no livro de registro. Para a formao dos
AG, 0.74 0,03 entre AC e CG e 0.77 0,03 entre AG e CG. Os grupos de contemporneo foram excludos os animais
valores so similares aos encontrados por dos Santos (2006) que continham valores outliers (valores atpicos) nas
para a correlao entre AC e AG. Indicam que a seleo mensuraes e que no continham todas as informaes
para uma dessas medidas, alteram as demais no mesmo desejadas para as medidas estudadas. Os efeitos utilizados
sentido. As estimativas demostraram que a no incluso da foram ano de nascimento, estao de nascimento (dividida
pelagem no modelo causa uma superestimao da varincia em quatro classes: Animais nascidos entre os meses de
gentica aditiva, refletindo em valores superestimados da dezembro a fevereiro, maro a maior, julho a agosto e
herdabilidade. A seleo para as medidas estudas devem setembro a novembro), mesorregio, sexo do animal e
trazer resultados rapidamente e a seleo para uma pelagem. A consistncia dos dados foi realizada para cada
caracterstica gerar mudanas no mesmo sentido para as uma das medidas estudadas, por meio do software SAS. Em
demais. cada grupo de contemporneo foram excludos os animais
Palavras-chaves: correlao gentica, estimativa de com medidas fora do intervalo da mdia trs desvios
herdabilidade, medidas lineares padro. Foram excludos grupos de contemporneo que
continham apenas animais filhos de um mesmo garanho.
******************************************************************* Foram excludos os grupos de contemporneo com menos
******************************************* de trs animais. A base de dados foi composta por 10.522
observaes para as medidas LA, LC e PT. Os parmetros
genticos foram estimados por inferncia Bayesiana,
utilizando um modelo animal de mltiplas caractersticas,
pelo amostrador de Gibbs utilizando o software GIBBS2F90.
O modelo utilizado inclui como efeito fixo a idade do
animal ao registro, grupo de contemporneo e efeito do
proprietrio. O efeito de proprietrio foi includo no modelo
para caracterizar as tcnicas de manejo semelhantes. A

60 Congresso da UFBA 2017 | Caderno de resumos


inferncia foi baseada na cadeia de Markov Monte Carlo utilizando o procedimento ANOVA e o teste Tukey no SPSS
com cadeias de 1.000.000 de ciclos com um perodo de (P<0,05). A presena do CL no incio do protocolo impactou
descarte de 50.000 ciclos. As estimativas de herdabilidade negativamente no dimetro do folculo no D10 (8,782,04
para as caractersticas de LA, LC e PT foram, respectivamente, e 13,123,52mm), dimetro do folculo pr-ovulatrio
0,24; 0,21 e 0,20, sendo, portanto, de baixa a mdia (9,482,12 e 13,662,58mm) e na rea de vascularizao da
herdabilidade, sugerindo uma baixa resposta seleo. As parede do folculo pr-ovulatrio (0,090,04 e 0,180,09cm),

ESTUDANTE PIBIC
correlaes genticas obtidas foram positivas e de mdia a quando comparado com os animais do grupo S/CL,
alta magnitude com resultado para LA e LC de 0,55; para PT e respectivamente. As vacas do grupo S/CL apresentaram
LC de 0,54 e para PT e LA de 0,79. concentraes de P4 de 1,721,16ng/mL inferiores ao grupo
C/CL que apresentaram 7,563,70ng/mL, no momento
Palavras-chaves: Caractersticas da sincronizao da ovulao (D8). As fmeas do grupo
morfomtricas,Herdabilidade,Correlao gentica C/CL ainda apresentaram menor dimetro (17,661,89
******************************************************************* e 23,254,46mm) e rea de vascularizao (0,820,29
******************************************* e 1,210,27cm) do CL subsequente ao protocolo de
sincronizao (D24) quando comparada s fmeas do grupo
S/CL, respectivamente. Todavia, a concentrao srica de
rea: CINCIAS AGRRIAS - MEDICINA P4 no D24 no diferiu entre os grupos experimentais. Assim,
VETERINRIA conclui-se que elevadas concentraes de P4 no momento
TRABALHO: FUNO FOLICULAR E LUTEAL da sincronizao da ovulao impactam negativamente no
dimetro e vascularizao folicular e luteal de vacas mestias.
DE VACAS MESTIAS COM DIFERENTES
Palavras-chaves: Bovino, corpo lteo, Doppler
CONCENTRAES CIRCULANTES
*******************************************************************
DE PROGESTERONA DURANTE A *******************************************
SINCRONIZAO DA OVULAO EM UM
PROTOCOLO DE IATF rea: CINCIAS AGRRIAS - MEDICINA
VETERINRIA
Autor(es): BIA SANTOS SOUZA CARSO, PRISCILA ASSIS TRABALHO: HERNIORRAFIA PERINEAL EM
FERRAZ, MARCUS VINCIUS GALVO LOIOLA, MARIANA
ALVES DE ANDRADE SILVA, LVARO DOS SANTOS ALVES, CES COM O USO DE ENXERTO AUTLOGO
JOO VICTOR GOMES DA SILVA CARVALHO, ENDRIGO DE TNICA VAGINAL
ADONIS BRAGA DE ARAUJO, ELISIANE SATELES DOS
SANTOS, ANTNIO DE LISBOA RIBEIRO FILHO
Autor(es): FBIA KARINY MENDES MORENO, JOO MOREIRA
Resumo: Tem sido relatado que as concentraes sricas COSTA NETO
de progesterona (P4) no momento da sincronizao
Resumo: A hrnia perineal considerada uma enfermidade
da ovulao em um protocolo de IATF refletem na
frequente na rotina mdico veterinria, ocorre devido
probabilidade de concepo, visto que altera caractersticas
ao enfraquecimento e posterior ruptura ou separao
foliculares e luteais, havendo relao com o tipo racial
dos msculos que compe o diafragma plvico. Devido a
e o grau de produo de leite dos animais. No entanto,
deteriorao da funo de sustentao dessa musculatura
ainda no foi relatado os impactos da concentrao de P4
ocorre a protruso caudal de estruturas anatmicas
durante a sincronizao da ovulao em vacas mestias
abdominais e plvicas para a regio perineal, caracterizado
(Bos taurus taurus x Bos taurus indicus). Diante disso,
pelo aumento de volume. Tem maior ocorrncia em ces
objetivou-se estudar os efeitos das diferentes concentraes
machos, inteiros e idosos. Dentre as tcnicas cirrgicas
circulantes de P4, no momento da sincronizao da
indicadas para tratamento da hrnia perineal em ces,
ovulao em um protocolo de IATF, sob a dinmica folicular
relata-se o emprego de enxertos biolgicos ou sintticos
e caractersticas do corpo lteo (CL). Foram utilizadas 12
para a reparao do diafragma plvico e a orquiectomia
fmeas mestias com mdia de escore de condio corporal
como terapia adjuvante. A tnica vaginal, disponibilizada
de 3,070,38, que foram submetidas a um protocolo de
aps a orquiectomia, exemplo de outras membranas
pr-sincronizao, para garantir que todos os animais
biolgicas possui caractersticas ideais para enxertia e j
apresentassem CL no incio do protocolo, confirmando a
foi empregada na reparao de diversos tecidos, inclusive
presena dessa estrutura atravs da ultrassonografia (US)
do diafragma plvico, sob a forma de enxerto autgeno
trans retal. Em seguida no D0, todos os animais receberam
pediculado ou livre. Objetivou-se estudar a etiologia e a
um dispositivo intravaginal de P4 associado a 2mg de
patognese da hrnia perineal, classificar as hrnias em
benzoato de estradiol via intramuscular (i.m.) e metade
primarias e secundarias de acordo com o tipo e quanto ao
destes foram tratados com 12,5mg de PGF2 i.m. No D8 foi
contedo, avaliar a viabilidade da tcnica de utilizao da
realizada a retirada desse dispositivo de P4 e administrado
tnica vaginal como enxerto livre com reforo , descrever a
12,5mg de PGF2 i.m., seguido por 1mg de cipionato de
tcnica cirrgica para coleta do tecido doador, assim como
estradiol i.m., em todos os animais. Nesse momento, os
as manobras cirrgicas necessrias para sua implantao
animais foram divididos em dois grupos experimentais
no diafragma plvico e avaliar a incidncia de complicaes
de acordo com a aplicao de PGF2 no D0: grupo C/CL
ps-cirrgicas e taxa de recorrncia, diminuindo os riscos
(n=6) e grupo S/CL (n=6). Os animais foram submetidos a
destas. Foram utilizados 14 ces portadores de hrnia
avaliao da dinmica e vascularizao folicular por meio
perineal, sendo nove portadores de hrnia unilateral e
de US em modo B e Doppler colorido a cada 12 horas
cinco bilaterais. Aps a orquiectomia, as tnicas de ambos
a partir do D8 at o momento da ovulao. Alm disso,
os testculos foram coletadas, sobrepostas e fixadas entre
foram realizadas coletas de sangue para determinao da
si por meio de quatro pontos de reparo. Ato contnuo, foi
concentrao srica de P4 pr-ovulatria (D0, D8 e D10 do
realizada abordagem ao processo hernirio, inspeo,
protocolo). No D24 do protocolo foi realizada a avaliao
reduo do contedo hernirio, debridamento muscular e
das caractersticas morfolgicas e funcionais do CL por meio
sntese primria por meio de sutura. O enxerto foi fixado
da US modo B e Doppler colorido e tambm foi coletado
musculatura remanescente por meio de pontos simples
sangue para mensurao da concentrao srica de P4 do
separados e posteriormente ocluso pela sutura intradrmica
CL subsequente ao protocolo. Os dados foram analisados
e sntese cutnea. Foram feitas observaes transoperatrias

Congresso da UFBA 2017 | Caderno de resumos 61


e posteriormente, avaliaes clnicas e ultrassonogrficas por amplicons com peso molecular compatveis com T. vivax.
um perodo de um ano aps cirurgia, que permite sugerir Tais resultados propiciaram a eleio de um mtodo prtico
que a tnica vaginal, da forma que foi empregada, possui de extrao de DNA total a partir de sangue bovino e a
atributos ideais para a reparao do diafragma plvico. realizao do diagnstico molecular de alta especificidade na
Foi de fcil aplicabilidade, forneceu imediata resistncia deteco do hemoparasita nas diferentes fases de evoluo
musculatura remanescente, favoreceu o processo cicatricial da doena, o que servir de parmetro para as autoridades
ESTUDANTE PIBIC

e a integridade tecidual, sendo incorporada e estimulando sanitrias do estado da Bahia na implementao de medidas
a formao de tecido conjuntivo, alm de minimizar o risco de profilaxia e controle desta doena na regio.
de rejeies, recidivas e custos operacionais. Desta forma,
conclui-se que o enxerto autgeno de tnica vaginal, em Palavras-chaves: Tripanossomase, PCR, Trypanosoma vivax
dupla camada aplicvel para o reparo do diafragma plvico *******************************************************************
e tem significativo valor teraputico no tratamento da *******************************************
hrnia perineal em ces, porm seu emprego fica limitado
a apenas um antmero, sendo necessria a associao de
outras tcnicas cirrgicas quando o problema for bilateral ou rea: CINCIAS AGRRIAS - MEDICINA
apresentar outros graus de comprometimento. VETERINRIA
Palavras-chaves: Hrnia Perineal, Tratamento TRABALHO: INDUO DO PARTO EM
Cirrgico,Tnica Vaginal OVELHAS COM DIFERENTES DOSES DE
******************************************************************* GLICOCORTICOIDE.
*******************************************
Autor(es): LVARO DOS SANTOS ALVES, MARCOS
rea: CINCIAS AGRRIAS - MEDICINA CHALHOUB COELHO LIMA, RODRIGO FREITAS
VETERINRIA BITTENCOURT, ELISIANE SATELES DOS SANTOS, ISABELA
VASCONCELOS, BIA SANTOS SOUZA CARSO, JOO VICTOR
TRABALHO: IMPLEMENTAO DE GOMES DA SILVA CARVALHO, MORGANA DUARTE FELIX,
PROTOCOLOS DE DETECO DE MARCUS VINCIUS GALVO LOIOLA, ENDRIGO ADONIS
BRAGA DE ARAUJO
TRYPANOSOMA VIVAX EM BOVINOS
Resumo: A ovinocultura um dos setores da pecuria
VISANDO O DIAGNSTICO MOLECULAR que vem crescendo a cada ano, o efetivo nacional foi de
18,41 milhes em 2015. A regio do Nordeste se destaca na
Autor(es): HAYALA CAROLINE SILVA FERREIRA GOMES, criao de ovinos e concentrou 60,6% do rebanho nacional
LUCIANA VEIGA BARBOSA, IGOR LEONARDO DE JESUS no ltimo ano (IBGE, 2015). Um dos fatores responsveis
GENIPAPEIRO, EPAMINONDAS DO PATROCNIO, SARAH pelo aumento na produtividade do rebanho a utilizao
SANTOS SILVA, ALESSANDRA SELBACH SCHNADELBACH, de biotcnicas da reproduo, dentre elas, se encontra
SUZANA TELLES CUNHA LIMA, CRISTIANE DE JESUS a induo do parto. Essa tcnica uma prtica utilizada
BARBOSA, JORGE RAIMUNDO LINS RIBAS quando deseja uma maior concentrao dos partos com
o intuito de racionalizar tempo e mo de obra, alm de
Resumo: Introduo: A tripanossomase, doena causada
um melhor acompanhamento parturiente e o neonato,
pelo Trypanosoma vivax, veiculada e disseminada por insetos
evitando perdas econmicas. O objetivo desse estudo
hematfagos, possui grande importncia econmica, pois
foi avaliar a eficcia de diferentes doses reduzidas de
tanto sob sua forma aguda quanto subclnica, conduz a
dexametasona, 8mg e 16mg na induo do parto em ovelhas
considerveis perdas relacionadas produo de rebanhos
submetidas inseminao artificial em tempo fixo (IATF)
bovinos. considerada uma enfermidade endmica na
e monta natural controlada no repasse. O experimento foi
regio do Pantanal, mas surtos espordicos j foram
realizado nas fazendas experimentais da Escola de Medicina
relatados em alguns estados brasileiros, como Par, Minas
Veterinria e Zootecniada UFBA, localizada nos municpios
Gerais, Paraba e Pernambuco. Dada a sua importncia
de Entre Rios BA e So Gonalo - BA. Utilizou-se 72
econmica, a definio de um mtodo de deteco precoce
ovelhas da raa Santa Insque foram submetidas a IATF por
do hemoparasito em bovinos necessria e, dentre as
laparoscopia ou cobertas no repasse por monta controlada
possibilidades, destaca-se o diagnstico molecular. Objetivo:
que no emprenharam no momento da IATF. Aos 145 dias
O objetivo deste estudo foi o de eleger um mtodo eficiente
de gestao,os animais foram divididos aleatoriamente em
de extrao de DNA considerando dois protocolos propostos
trs grupos, nos quais foram aplicadas diferentes doses de
na literatura e, em seguida, utilizar da tcnica da Reao
dexametasona (Azium MSD Sade Animal So Paulo, SP,
em Cadeia da Polimerase (PCR) para a deteco do T. vivax
Brasil) por via intramuscular. O grupo 1(n=21) corresponde
em amostras de sangue bovino procedentes de diferentes
ao grupo controle, que no recebeu dexametasona. O
fazendas da regio Sul do estado da Bahia com suspeita
grupo 2 (n=28)corresponde ao grupo que foi administrado
clnica da doena. Metodologia: Inicialmente, 10 amostras
8mg e o grupo 3 (n=23) recebeu uma dose de 16mg de
aleatrias foram submetidas extrao do DNA total
dexametasona. Para avaliar diferena entre os grupos
considerando os dois protocolos propostos na literatura: 1 -
utilizou-se o teste KruskalWallis com valores ajustados pelo
Lahiri e Nurnberg, 1991 adaptado, e 2 - Madruga et al. (2006).
teste de Bonferoni, com nvel de significncia de 5%.A mdia
Estas amostras foram divididas em dois grupos de cinco
de tempo entre induo e parto nos grupos 1, 2 e 3 foram
amostras para posterior extrao de DNA, considerando os
de 130,2041,49, 53,1026,87 e 40,53 12,49 horas. O grupo
dois protocolos. Aps as extraes, o DNA de cada amostra
controle teve maior intervalo de tempo at o parto (P<0,5)
foi quantificado em espectrofotmetro e submetido
e no foi encontrado diferena estatstica entre grupos 2
eletroforese em gel de agarose 1,0% corado com brometo de
e 3.Concluiu-se que, a induo do parto promovida pelo
etedeo para visualizao em UV. Aps comparao e eleio
frmaco mostrou-se eficiente em ambas as doses, sendo
do protocolo 2, foram realizadas as reaes de amplificao,
assim, o uso da dexametasona na dose de 8 mg efetiva
considerando os primers descritos na literatura, 18STnF2
quando se busca concentrar os partos em ovinos.
(5 CAACGATGACACCCATGAATTGGGGA 3) e 18STnR3
(5 TGCGCGACCAATAATTGCAATAC 3), cujo produto de Palavras-chaves: Ovelhas,glicocorticoide,induo
amplificao positivo apresenta 710 pb. Resultados: Dentre
as 520 amostras analisadas, 117 (22,5%) apresentaram *******************************************************************
*******************************************

62 Congresso da UFBA 2017 | Caderno de resumos


rea: CINCIAS AGRRIAS - MEDICINA elas, est a dirofilariose, causada pelos nematoides filardeos
a exemplo da Dirofilaria immitis e D. repens que apresentam
VETERINRIA
uma relao de simbiose com bactrias do gnero
TRABALHO: ISOLAMENTO E TIPIFICAO Wolbachia. Os organismos deste gnero so bactrias Gram
DE SALMONELLA EM AVIRIOS DE negativas intracelulares obrigatrias da ordem Rickettsialles
que infectam artrpodes e nematdeos filariais e parecem
CORTE DA REGIO DO PLO AVCOLA DO

ESTUDANTE PIBIC
desempenhar um papel essencial na biologia destes parasitos
PARAGUAU-BA e na patognese das infeces por esses nematdeos,
aumentando potencialmente a gravidade dos sinais
clnicos. Nos filarideos, a remoo das bactrias tem efeito
Autor(es): RAFAELA DE ALMEIDA OLIVEIRA, LIA MUNIZ negativo no desenvolvimento, sobrevivncia e reproduo
BARRETO FERNANDES, ANTENOR FERREIRA LEAL NETO dos parasitos. O presente trabalho teve como objetivo
Resumo: A Salmonella uma bactria patognica que determinar a frequncia de infeco por Dirofilaria sp e
apresenta carter zoontico, responsvel por causar Wolbachia sp em ces de dois municpios do estado da Bahia,
prejuzos a sade pblica pois tm a capacidade de Brasil. Foram utilizadas 268 amostras de sangue de ces, de
toxinfeco alimentar, podendo levar o indivduo ambos os sexos, com idade e raas variadas, oriundos de
morte. A avicultura industrial brasileira se desenvolveu Salvador e Lauro de Freitas, no estado da Bahia, Brasil. Foi
muito nas ltimas dcadas, apresentando altos ndices realizada extrao de DNA de todas as amostras que foram
de produtividade, com controles rgidos para garantir analisadas quanto presena de Wolbachia sp. e Dirofilaria
uma ave sadia e produtos de qualidade, mas ainda com sp. utilizando a tcnica de PCR. Os produtos amplificados
todo avano, com as medidas preventivas sanitrias bem foram submetidos eletroforese em gel de agarose a 1,5%
definidas, pode existir a chance do produto final estar e corados com sybr gold. Das 268 amostras coletadas, 54
contaminado com Salmonella spp., onde as contaminaes (20,14%)apresentavam antgeno de D. immitis sendo 24
podem ocorrer, por exemplo, por falhas na biosseguridade (44,4%) do municpio de Salvador e 30 (55,6%)de Lauro de
dentro do incubatrio ou no plantel, e pelo contato das Freitas. Para a presena de Wolbachia sp., 35 (13,0%) foram
aves industriais com aves silvestres. De acordo com o positivas, sendo 14 (14,7%) de Salvador e 21 (14,2%) de Lauro
Plano Nacional de Sanidade Avcola (PNSA), a Instruo de Freitas. Doze animais (20,2%) positivos por sorologia
Normativa n78 de 2003, determina as normas tcnicas para D. immitis, tambm foram positivos para Wolbachia
para certificao de estabelecimentos avcolas como livres sp.. Enquanto que, pela PCR, apenas um animal foi positivo
de Salmonella Gallinarum e Salmonella Pullorum e livres para ambas as espcies. A partir disso, possvel notar que,
ou controlados para Salmonella Enteritidis e Salmonella os nematdeos podem ou no ser hospedeiros da bactria
Typhimurium. Esta instruo normativa, estabelece adoo Wolbachia sp, e que o uso de PCR foi decisivo para essa
de medidas de monitoramento, controle permanente e confirmao. A identificao molecular de agentes caninos
eventuais, nos plantis avcolas que realizam o comrcio ou de doena transmitida por vetores, refora a importncia e a
a transferncia nacional e internacional de seus produtos. necessidade de implementar medidas profilticas eficientes
Diante disso o presente estudo teve como objetivo isolar e nas reas geogrficas onde esses agentes so distribudos,
tipificar Salmonella spp. de granjas avcolas, com o intuito com o objetivo de prevenir e evitar o risco de transmisso
de estabelecer um monitoramento do plantel, contribuindo de patgenos por vetores entre ces e outros hospedeiros,
para evitar riscos sade pblica. Foram analisadas 16 incluindo seres humanos.
amostras de swab de arrasto das granjas localizadas no Palavras-chaves: Dirofilaria,Wolbachia,Nematdeos
Plo avcola do Paraguau-Ba, no perodo de outubro de
2016, at o presente momento. Empregou-se a anlise *******************************************************************
microbiolgica para Salmonella spp., onde o processamento *******************************************
das anlises foi realizado no Laboratrio de Sanidade Avcola
da Bahia, localizado na Universidade Federal da Bahia. Em rea: CINCIAS AGRRIAS - MEDICINA
nenhuma das amostras foi possvel isolar Salmonella spp.,
porm outras bactrias foram identificadas: Providencia VETERINRIA
rustigianii, Xenorhabdus luminescens, Enterobacter TRABALHO: OOCISTO DE TOXOPLASMA
agglomerans. Desta forma, de acordo com os resultados
apresentados, percebe-se que o controle de Salmonella GONDII: PURIFICAO E EXTRAO DE
spp nos plantis estudados, est sendo realizado de forma PROTENAS
eficiente, contribuindo para a qualidade da produo.
Palavras-chaves: Samonelose, Avicultura de corte, Autor(es): LINCE SANTOS, LUIS FERNANDO PITA GONDIM
microbiologia Resumo: Toxoplasma gondii um protozorio do filo
******************************************************************* Apicomplexa e da famlia Sarcocystidae.. Protozorios
******************************************* pertencentes a esta famlia possuem ciclos de vida
heteroxnicos, isto , carecem de hospedeiros definitivos
e intermedirios em seus ciclos reprodutivos. T. gondii
rea: CINCIAS AGRRIAS - MEDICINA possui tropismo, principalmente, por clulas do corao,
VETERINRIA msculo esqueltico e sistema nervoso central, e apresenta
TRABALHO: OCORRNCIA MOLECULAR DE trs formas infectantes: taquizotos, bradizotos encistados,
e esporozotos no interior de oocistos. O ciclo de vida
DIROFILARIA SP EM CES DE SALVADOR E do parasito consiste de duas fases: reproduo sexuada
LAURO DE FREITAS com a eliminao de oocistos nas fezes, que ocorre nos
hospedeiros definitivos (felinos), e reproduo assexuada,
por meio da multiplicao de bradizotos encistados e
Autor(es): LARISSA DOS SANTOS SOARES, BRBARA MARIA taquizotos nos tecidos de hospedeiros intermedirios (aves
PARAN DA SILVA SOUZA, SABRINA MOTA LAMBERT e mamferos). Os felinos geralmente se infectam por meio da
Resumo: As doenas transmitidas por vetores caninos so ingesto de cistos teciduais. Os hospedeiros intermedirios
causadas por uma ampla gama de patgenos transmitidos a se infectam atravs da ingesto de oocistos excretados
ces por artrpodes, incluindo carrapatos e insetos. Dentre pelos felinos, assim como por meio da ingesto de cistos
teciduais. O objetivo do estudo foi realizar a purificao

Congresso da UFBA 2017 | Caderno de resumos 63


dos oocistos de T. gondii para posterior extrao dessas de patrulhamento em funo da rota de patrulhamento.
protenas. Para o estudo, foram utilizados seis camundongos A anlise das FCs registradas durante as atividades de
suos, sendo cada um inoculado com oocistos (1 x 103) de patrulhamento, mostrou que os animais apresentaram
T. gondii cada animal. Aps 30 dias, foi feita a eutansia dos variao e picos de batimentos durante a atividade, como
camundongos. Foram retirados crebro e corao de cada exemplo o animal Janus Borba, macho,14 anos teve FC
animal, e em seguida, foi realizado exame microscpico mnima de 20bpm e mxima de 210 bpm, nas 5 horas de
ESTUDANTE PIBIC

com macerados de crebro fresco para a visualizao de atividade. Os parmetros avaliados demonstram que os
cistos teciduais do parasito. Foram ofertados tecidos murinos animais esto bem condicionados ao esforo da atividade
contendo cistos teciduais de T. gondii para dois gatos que e que h diferena de esforo fsico entre as rotas de
eram sorologicamente negativos para o parasito. Em seguida, patrulhamento.
foram coletadas as fezes desses gatos diariamente, por 21
dias, e realizada a tcnica de flutuao em sacarose para a Palavras-chaves: Avaliao fsica, bem-estar,
para a pesquisa e pr-purificao de oocistos nas fezes. No condicionamento
foi encontrada quantidade suficiente de oocistos nas fezes *******************************************************************
excretadas. Como alternativa, foram adquiridas amostras *******************************************
fecais felinas contendo oocistos de T. gondii, as quais foram
cedidas por um colaborador da Universidade Estadual de
Londrina (Dr. Joo Luiz Garcia). As amostras de oocistos rea: CINCIAS AGRRIAS - MEDICINA
acondicionadas a 4C em soluo fecal contendo 2% de VETERINRIA
cido sulfrico em gua destilada esto sendo purificadas TRABALHO: PESQUISA DE ANTICORPOS
para posterior extrao de protenas.
CONTRA SALMONELLA PULLORUM E
Palavras-chaves: Toxoplasmose, Felino, Apicomplexa
SALMONELLA GALLINARUM EM FRANGOS
*******************************************************************
******************************************* DE CORTE PRODUZIDOS NO PLO AVCOLA
DA BAHIA
rea: CINCIAS AGRRIAS - MEDICINA
VETERINRIA Autor(es): LCIA STROBEL BECKER PEREIRA, LIA MUNIZ
BARRETO FERNANDES
TRABALHO: PARMETROS FISIOLGICOS
Resumo: Em pouco mais de trs dcadas a avicultura
DE EQUINOS EM ATIVIDADE DE industrial brasileira passou por mudanas relevantes em
PATRULHAMENTO URBANO relao produo, comercializao e consumo. A avicultura
antes familiar e artesanal, passou a evoluir a partir da
Autor(es): JULIANA MARBACK DE SOUZA BRASIL, CHIARA modernizao e produzir em larga escala. Atualmente a
ALBANO DE ARAUJO OLIVEIRA avicultura industrial do Brasil tem conseguido unir tecnologia,
estruturas produtivas e condies naturais favorveis para
Resumo: Este estudo teve como objetivo avaliar parmetros produzir um dos melhores frangos do mundo nos quesitos
fisiolgicos de equinos de patrulhamento urbano antes, custo e qualidade, e hoje ocupa o segundo lugar como
durante e aps as atividades de patrulhamento. Foram exportador mundial de carne de frango. Contudo essa
avaliados 14 equinos da raa lusitano em atividade de produo requer um nvel de sanidade das aves produzidas,
patrulhamento urbano do Esquadro de Polcia Montada da j que o mercado internacional e nacional exigem carne de
PMBA em esquema inteiramente casualizado. As avaliaes frango de qualidade livres de contaminaes. Com isso o
e coletas sanguneas ocorreram nos perodos da manh PNSA - Programa Nacional de Sanidade Avcola foi criado
e tarde, em duas rotas de patrulhamento (Abaete e Vila no intuito de regulamentar granjas produtoras de frango
Militar), sendo avaliados no mximo 3 animais por rota de corte e certificar estes estabelecimentos como livres ou
por perodo. Foram avaliados 9 machos e 5 fmeas, com controlados de certas doenas, possibilitando assim que os
idade entre 3 e 17 anos e peso vivo mdio de 454kg. Como produtores agreguem valor aos seus produtos, permitindo
indicadores de desempenho foram aferidos antes e aps a eles conseguir exportar para mercado internacional. Uma
a atividade de patrulhamento: frequncia cardaca (FC), das doenas abordadas pelo PNSA a salmonelose. As
temperatura retal (TR), frequncia respiratria (), turgor de salmoneloses so doenas provocadas por bactrias do
ple(TP) e tempo de preenchimento capilar (TPC). Foram gnero Salmonella. Dentre elas, a Salmonella Pullorum e
coletadas amostras de sangue dos animais antes e aps a Salmonella Gallinarum, causadoras da Pulorose Aviria e do
atividade, para a realizao das anlises de volume globular Tifo Avirio respectivamente so bactrias que no devem ser
(VG), protena plasmtica total (PT) e glicose (GLi). O sangue encontradas na produo de frango de corte, pois causam
foi coletado por puno da veia jugular esquerda com agulha perda do desempenho das aves gerando prejuzos para o
prpria para coleta a vcuo em tubos siliconados contendo produtor. Por isso, este estudo objetivou detectar anticorpos
EDTA ou fluoreto de sdio + EDTA, respectivamente. Para a contra Salmonella Pullorum e Salmonella Gallinarum em
mensurao da FC durante a atividade de patrulhamento, foi frangos de corte produzidos em granjas na regio do Plo
colocada no trax do animal, uma faixa com eletrdos e o avcola da Bahia. A pesquisa foi realizada de julho/2016 a
frequencmetro cardaco (Polar Equine RS800) que gravou agosto/2017, no LASAB-UFBA, onde foram analisados 276
os dados durante as 5 horas da atividade. Os dados foram soros de aves. A soroaglutinao rpida em placa (SAR) foi
submetidos a anlise de varincia ANOVA Two Way (antes utilizada como mtodo para a deteco de anticorpos contra
e aps atividade), utilizando-se o procedimento GLM do Salmonella Pullorum e Salmonella Gallinarum. Foi detectada
pacote estatstico SAS (verso 9.3). Os valores mdios das uma amostra positiva no teste de soroaglutinao rpida,
variveis antes e aps a atividade de patrulhamento foram sugerindo que as medidas de controle realizadas por estas
comparados pelo teste de t (P<0,05). Os valores mdios granjas frente a estes microrganismos esto sendo eficazes
observados antes da atividade de patrulhamento foram neste tipo de produo.
FC 38 btm, 22,2 mrpm, TR e TPC 2, TR 36,5oC, VG 33,6%,
PT 7 g/dL% e GLIC 63,4 mg/dL. E aps a atividade foram Palavras-chaves: Salmoneloses, Soroaglutinao rpida,
FC 43 btm, 28,6 mrpm, TP e TPC 2, TR 37,8oC, VG 34,9%, Frango de granja
PT 7 g/dL e GLIC 60,8 mg/dL. Foram observadas diferenas *******************************************************************
significativas nas variveis FC e TR antes e aps a atividade *******************************************

64 Congresso da UFBA 2017 | Caderno de resumos


rea: CINCIAS AGRRIAS - MEDICINA rea: CINCIAS AGRRIAS - MEDICINA
VETERINRIA VETERINRIA
TRABALHO: PREFERNCIA DE CRIADOUROS TRABALHO: PRODUO DE CIDOS GRAXOS
DO FLEBOTOMNEO LUTZOMYA VOLTEIS NA DIETA DE BOVINOS DE CORTE
LONGIPALPIS (DYPTERA: PSYCHODIDADE) ALIMENTADOS COM TANINO.

ESTUDANTE PIBIC
E O POSSVEL PAPEL DA MICROBIOTA DO
Autor(es): EVERTON VASCONCELOS, RONALDO LOPES
SOLO NA INFECO POR LEISHMANIA. OLIVEIRA

Autor(es): MARIA HELENA DE ATHAYDE MEIRELLES, Resumo: Na cadeia produtiva da bovinocultura torna-
KELSILANDIA AGUIAR MARTINS, TIAGO FEITOSA MOTA, se cada vez mais necessrio a maximizao dos lucros e
DEBORAH BITTENCOURT MOTHE FRAGA minimizao dos custos de produo, para isso tem se
buscado o uso de alimentos alternativos. Temos como
Resumo: O Lutzomyia longipalpis o principal vetor da exemplo, o tanino, que tem sido estudado em recentes
Leishmania infantum ,o principal agente etiolgico da pesquisas, por apresentar dentre outros fatores algumas
Leishmaniose Visceral nas Americas. Observaes sobre vantagens na alimentao animal. Entre estas podemos
ecologia do inseto em reas urbanas sugerem que o seu citar, a diminuio nos custos de produo, melhoria na
ciclo de vida ocorre em microbitat peridomiciliares rico eficincia alimentar, controle de verminose, alm de otimizar
em nutrientes orgnicos, como em restos de folhas, bases o uso da protena pelo animal. Objetivou-se avaliar o perfil
de rvores, criadouros de animais e entre outros. Apesar dos cidos graxos volteis das dietas de bovinos de corte
desses microbitat terem sido bastante explorados, os alimentados com tanino. Foi realizado um experimento com
criadouros originais desses insetos permanecem ainda pouco delineamento em quadrado latino (4x4), com 4 bovinos
conhecidos, especialmente durante sua fase imatura.Alguns adultos, castrados com aproximadamente 446 34 kg de
trabalhos recentes mostraram que a preferncia pelo local peso corporal mdio, canulados no rmen. O experimento
de oviposio, assim como o desenvolvimento do inseto, teve durao de 120 dias, divididos em oito perodos de
podem estar relacionados microbiota de seu habitat. Para 15 dias cada, sendo dez para adaptao e cinco de coleta
a espcie L.longipalpis isso torna-se fundamental uma de dados. Os nveis de tanino condensado inseridos na
vez que a microbiota exerce tambm forte influncia no dieta foram de 0; 1; 3 e 5 % na meteria seca (MS) total da
desenvolvimento da Leishmania no inseto. Dessa forma, dieta. Foram formuladas dietas com proporo volumosa:
este estudo teve como objetivo determinar os criadouros concentrado (40:60) na forma de mistura completa, para
preferenciais de L.longipalpis avaliando a ovipoisio, alcanar um ganho de 1,2kg/dia. Para determinao da
desenvolvimento e sobrevivncia dos insetos em diferentes concentrao dos cidos graxos de cadeia curta no rmen
substratos provenientes de ambientes peridomiciliares, foi realizada atravs de cromatografia lquida-gasosa
alm de avaliar a microbiota relacionada a estes substratos. das amostras nos seguintes horrios, 0, 2, 4, 6h, aps a
Com o propsito de observar uma possvel preferncia de alimentao. As concentraes de nitrognio amoniacal
L. longipalpis por substratos, coletados no municpio de (N-NH3, mg/dL), pH ruminal, concentrao total de cidos
Jau em quatro diferentes locais descritos na literatura como graxos volteis de cadeia curta ( ;mol/Ml) e concentraes
locais de criadouros mais provveis de flebotomneos (folhas molares de acetato, propionato e butirato e da relao
em decomposio, viveiro de galinhas, viveiro de patos, acetato e propionato no foram influenciadas (P> 0,05) com
buracos de rvores), para oviposio, foram feitos testes com a incluso do tanino na dieta. Pode se concluir que utilizando
duas alternativas de substratos em copos plsticos (ovipote) a incluso de at 5 % de tanino oriundo da accia negra na
e um ovipote nas mesmas condies, mas sem qualquer meteria seca no afeta as concentraes dos cidos graxos
substrato foi usado como controle de aleatoriedade. Para volteis de cadeia curta (acetato, butirato e propionato),
a anlise do desenvolvimento, nas diferentes fases, do nitrognio amoniacal e pH ruminal.
L.longipalpis em cada substrato foram coletados por volta
de 30 ovos esterilizados (lavados com hipoclorito a 2% e Palavras-chaves: Alimentos alternativos, Nutrio, Rumen
etanol a 70%) sendo alimentados ad libitum com cada tipo *******************************************************************
de substrato. Avaliando a oviposio dos insetos observamos *******************************************
que houve uma diferena significativa pelas fmeas em
colocar ovos no substrato proveniente do galinheiro em
relao aos outros testados (p<0,005). Para confirmar se essa rea: CINCIAS AGRRIAS - MEDICINA
preferncia estava associada de fato ao tipo de substrato, VETERINRIA
outros dois substratos de diferentes galinheiros foram TRABALHO: QUALIDADE DA CARNE DE
testados, encontrando um perfil similar. At o momento
os insetos esto se desenvolvendo em todos os substratos BOVINOS CONFINADOS SUBMETIDOS A
testados para que futuramente possa ser avaliado o seu perfil DIETAS COM TANINO CONDENSADO.
bacteriano e desafiar os insetos provenientes do substrato de
melhor desempenho para a infeco com Leishmania.
Autor(es): ALINE ROCHA SILVA, REBECA DANTAS XAVIER
Palavras-chaves: L.longipalpis, microhabitats,bactrias RIBEIRO, RONALDO LOPES OLIVEIRA, JUSALINE FERNANDES
VIEIRA
*******************************************************************
******************************************* Resumo: Os taninos, compostos fenlicos resultantes do
metabolismo secundrio dos vegetais, quando se encontram
na forma no oxidada, reagem com protenas atravs de
ligaes hidrofbicas e pontes de hidrognio e quando
oxidados formam ligaes covalentes com alguns grupos
funcionais das protenas. Alm disso, tem sido evidenciado
que os taninos condensados reduzem a biohidrogenao
ruminal in vitro. Deste modo, a hiptese deste estudo de
que a incluso de taninos condensados, na dieta de bovinos
de corte, pode alterar aspectos qualitativos da carne destes

Congresso da UFBA 2017 | Caderno de resumos 65


animais. A conduo deste trabalho tem como objetivo de meia vida longa (at 3 dias) que ao ser administrado liga-
determinar o melhor nvel de incluso de tanino condensado se aos receptores de FSH e LH dos folculos e receptores de
na dieta de bovinos de corte por meio da avaliao da LH do corpo lteo, o que cria condies para o crescimento
qualidade da carne. Foram utilizados 32 animais da raa folicular e ovulao. A dosagem a ser administrada desse
Nelore, machos, no-castrados, com mdia de 24 meses de hormnio bem estabelecida na espcie bovina, mas, ainda
idade e peso mdio inicial de 357,27 23,44 kg, distribudos necessita de padronizao para a espcie ovina. Assim, este
ESTUDANTE PIBIC

em delineamento inteiramente casualizado. O experimento estudo teve como objetivo avaliar diferentes dosagens de
teve durao de 90 dias. Os tratamentos experimentais eCG e determinar a mais eficiente para o protocolo de
consistiram em 4 nveis de incluso de tanino condensado IATF em ovelhas Santa Ins. O experimento foi realizado
(0,0; 1,0; 3,0; e 5,0%, com base na matria seca da dieta na Fazenda Experimental de So Gonalo dos Campos
total). A dieta foi composta por 40% de volumoso (Capim BA(2357.51 na latitude sul e 3852 44.66 na longitude
Tifton-85, Cynodon sp) e 60% de mistura concentrada, oeste), pertencente a Universidade Federal da Bahia, no
composta por milho modo, farelo de soja, mistura mineral, perodo de junho a julho de 2016. Utilizou-se 48 animais,
ureia, leo de soja e extrato de accia negra (Acacia selecionados em fases distintas do ciclo estral, por avaliao
mearnsii), utilizada como fonte de tanino condensado. Aps ginecolgica e de escore corporal variando em 2,5-3. Foram
o perodo experimental, os animais foram submetidos a distribudos uniformemente em trs grupos e submetidos ao
jejum de slidos por 16 horas e encaminhados ao abate. mesmo sistema de manejo de criao semi-intensivo, sob
As carcaas foram ento mantidas sobre refrigerao em pastejo de B. Decumbens, sal mineral e gua ad libitum. Os
cmara fria (4 C) por 24 horas e, aps este perodo, foram animais foram submetidos ao protocolo de sincronizao
divididas longitudinalmente. Da carcaa esquerda retirou- para IATF com administrao de eCG (Novormon MSD
se o lombo (msculo Longissimus dorsi), utilizado como Sade Animal, So Paulo, Brasil) sete dias aps a insero
padro para as anlises, por meio da seco entre a 12 e do implante de progesterona (CIDR, zoetis indstria de
13 costelas. A qualidade da carne foi determinada por meio produtos veterinrios LTDA) Formaram-se ento trs grupos
da anlise da composio centesimal e das caractersticas experimentais: O grupo 1 (G1, n=21), composto por fmeas
instrumentais e sensoriais. Os dados obtidos foram que receberam 100 UI de eCG i.m, grupo 2 (G2, n=22) com
analisados estatisticamente por meio de anlise de varincia 200 UI i.m. e o grupo 3 (G3, n=21300 UI i.m. A retirada do
e teste de regresso. A incluso de deferentes nveis de implante ocorreu um dia aps a administrao do eCG,
tanino condensado na dieta no promoveu alteraes no quando nesse momento ocorreu tambm a aplicao de
pH, contudo, houve reduo linear nos teores de umidade, 0,5ml de PGF2 (ciosin MSD sade animal) e o hCG (200UI,
protena e gordura. No houve efeito da incluso sobre os Vetecor, hertape calier) foi administrado 20h antes da
teores de matria mineral, colgeno, capacidade de reteno inseminao, realizada por laparoscopia, 52h aps a retirada
de gua, perdas por coco e fora de cisalhamento. Em do implante de progesterona. O diagnstico de gestao foi
relao a cor, houve reduo linear na intensidade de realizado 45 dias aps a IATF por ultrassonografia transretal.
amarelo (b*), porm a luminosidade (L*), o teor de vermelho Para anlise estatstica foi utilizado o programa SAS, verso
(a*) e croma (C*) tambm no foram afetados. A incluso 9.0 (2002) com as taxas de concepo comparadas pelo
de at 5% de tanino condensado na dieta de bovinos no teste qui-quadrado. Foi empregado nvel de significncia de
causa alteraes significativas nos parmetros qualitativos 5%. As taxas de concepo obtidas foram as seguintes: G1=
da carne, exceto pela reduo do teor de gordura e protena. 38,46%; G2= 43,75%; G3= 47,37%. Os resultados verificados
A reduo da gordura implica em menor oxidao lipdica demonstraram no haver diferena (P>0,05) entre os
levando a uma maior vida de prateleira, essa reduo pode grupos experimentais, para a taxa de concepo. Dessa
causar efeito negativo no sabor, aroma e suculncia de carne. forma, por questes econmicas, sugere-se utilizar a menor
Entretanto existe um nicho de mercado e consumidores que dose de eCG testada, barateando o custo do protocolo de
preferem carnes com menor teor de gordura por consider- sincronizao para IATF em ovinos, sem comprometer a
las carnes magras e saudveis. eficincia do programa.
Palavras-chaves: accia negra, nutrio, ruminante Palavras-chaves: eCG,Sincronizao de estro,Ovinos
******************************************************************* *******************************************************************
******************************************* *******************************************

rea: CINCIAS AGRRIAS - MEDICINA rea: CINCIAS AGRRIAS - MEDICINA


VETERINRIA VETERINRIA
TRABALHO: USO DE DIFERENTES DOSAGENS TRABALHO: UTILIZAO DA LIPOPROTENA
DE ECG PARA INDUO E SINCRONIZAO DE BAIXA DENSIDADE, EM DIFERENTES
DO ESTRO EM OVINOS CONCENTRAES, EM MEIO DILUIDOR
PARA CRIOPRESERVAO DO SMEN OVINO
Autor(es): JOO VICTOR GOMES DA SILVA CARVALHO,
MARCOS CHALHOUB COELHO LIMA, NATLIA FONTES,
Autor(es): ADRIELLE LIMA, RODRIGO FREITAS
RODRIGO FREITAS BITTENCOURT, LVARO DOS SANTOS
BITTENCOURT, GABRIEL MENEZES, PAOLA PEREIRA DAS
ALVES, ELISIANE SATELES DOS SANTOS, ADRIELLE LIMA,
NEVES SNOECK, EDIVNIA OLIVEIRA JESUS, FERNANDO DE
LUANA ZURITA, BIA SANTOS SOUZA CARSO, LUIZ DI
LIMA CARDOSO, ISABELA VASCONCELOS, GLEICE MENDES
PAOLO MAGGITTI Jr
XAVIER, JOO VICTOR GOMES DA SILVA CARVALHO,
Resumo: A induo e controle do estro e a inseminao ELISIANE SATELES DOS SANTOS
artificial em tempo fixo (IATF), vm se destacando em
Resumo: A criopreservao espermtica representa grande
promover uma melhora nas taxas de ovulao e concepo
importncia na disseminao do melhoramento gentico,
nas ovelhas, sendo amplamente estudadas e difundidas
pois diversas fmeas podem ser inseminadas ao mesmo
para otimizar a eficincia reprodutiva desses animais.
tempo com o smen de um nico reprodutor, aumentando
Os hormnios exgenos so utilizados para a induo
a prognie por macho. Contudo, a qualidade das clulas
do estro e ovulao de forma sincronizada e, dentre os
espermticas aps a criopreservao est diretamente
protocolos hormonais, existem aqueles em que h o uso de
relacionada com a qualidade do diluidor utilizado a fim
Gonadotrofina Corinica Equina (eCG), que um frmaco

66 Congresso da UFBA 2017 | Caderno de resumos


de minimizar as crioinjrias espermticas resultantes do na dieta de bovinos de corte como uma alternativa de
processo. O presente trabalho teve como objetivo avaliar o aproveitamento na absoro de protena no intestino
efeito da utilizao da lipoprotena de baixa densidade (LDL), delgado, alm de possibilitar reduo na excreo desse
em substituio gema de ovo integral, para confeco de nutriente. Por isso, o balano de nitrognio se torna
diluentes para criopreservao espermtica. Para a obteno um parmetro importante para avaliar o metabolismo
dos dados foram utilizados seis animais da raa Santa Ins, de nitrognio e aproveitamento da PB em ruminantes.

ESTUDANTE PIBIC
com idade entre 10 e 36 meses, todos submetidos a um Objetivou-se avaliar o balano de nitrognio das dietas
programa regular de controle de parasitoses e alimentados contendo nveis de tanino condensado na alimentao de
com concentrado balanceado, feno e sal mineral e gua ad bovinos de corte. Foram utilizados quatro bovinos, adultos,
libitum. Previamente s congelaes, foram realizados os castrados com aproximadamente 446 kg de peso corporal
exames androlgicos dos animais e cada um foi submetido mdio, canulados no rmen, sendo distribudos num
duas colheitas de smen atravs de vagina artificial. A fim quadrado latino 4x4 com medidas repetidas no tempo (4
de avaliar a melhor concentrao das LDLs na composio tratamentos e 8 perodos). O experimento teve durao de
dos meios diluidores, foram utilizados 5 diluidores tratados 120 dias, divididos em oito perodos de 15 dias cada, sendo
com diferentes concentraes de LDL, todos a base de TRIS- 10 dias para adaptao e 5 dias de coletas de dados. Os nveis
gema de ovo: Tratamento 1 (T1-6% de LDL), Tratamento 2 de tanino condensado inseridos na dieta foram 0; 2; 4 e 6%
(T2-8% de LDL), Tratamento 3 (T3-12% de LDL), Tratamento de tanino na MS total da dieta. As dietas foram formuladas
4 (T4-16% de LDL) e Tratamento 5 (T5-20% de LDL), alm com proporo volumoso:concentrado (40:60) na forma
do diluidor Controle (CTR-20% de gema de ovo). Aps a de mistura completa, contendo 12% de protena bruta (PB)
descongelao (37C/30s), as amostras foram analisadas e 75% de nutrientes digestveis totais (NDT). Observou-se
de modo subjetivo para os parmetros de motilidade total uma reduo linear (P<0,05) na excreo de nitrognio (N)
(MT %), motilidade progressiva (MP %) e vigor espermtico na urina e nas fezes, e no nitrognio ingerido com a incluso
(VIG 1-5), tal como, integridade de membrana plasmtica dos nveis de tanino. No entanto, o balano de N (g/dia),
a nvel funcional pelo choque hiposmtico com gua no foi afetado (P>0,05) pela incluso do tanino na dieta.
destilada (HOST) e estrutural com corante supravital eosina Conclui-se que a incluso de tanino at 6% da dieta total
(SV %). Foi utilizado o programa estatstico SAS, verso 9.0 pode ser utilizada sem alterar o balano de nitrognio nos
(2002) e nvel de significncia de 5%. As mdias (%) da MT/ animais.
MP obtidas para os grupos foram: CTR (31/34), T1 (34/28),
T2 (34/28), T3 (41/35), T4 (53/45) e T5 (50/43). Para essas Palavras-chaves: alimento alternativo,nutrio,protena
variveis, o T4 apresentou resultados superiores (p<0,05) *******************************************************************
quando comparado aos grupos CTR, T1 e T2 e semelhantes *******************************************
aos grupos T3 e T5 (p>0,05). Em relao ao VIG, as mdias
observadas foram de: CTR (3,15), T1 (3,4), T2 (3,4), T3 (3,4),
T4 (3,6) e T5 (3,6). Para este parmetro, foi observada maior rea: CINCIAS AGRRIAS - ZOOTECNIA
eficincia nos grupos T4 e T5. Quanto ao HOST, foram TRABALHO: BALANO DE NITROGNIO
identificadas as seguintes mdias (%) para os grupos: CTR
(11), T1 (10), T2 (10), T3 (5), T4 (12) e T5 (7), sendo o T4 o E SNTESE DE PROTENA MICROBIANA
grupo que apresentou maior percentual de reatividade. EM OVINOS ALIMENTADOS COM DIETA
Para o parmetro SV, as mdias (%) obtidas foram de CTR
(16), T1 (12), T2 (13), T3 (18), T4 (19) e T5 (24), evidenciando CONTENDO QUITOSANA ASSOCIADA AO
superioridade das mdias percentuais dos grupos T3, T4 e CAROO DE ALGODO
T5 quando comparado ao grupo CTR. A partir dos dados
analisados, foi possvel identificar a superioridade dos Autor(es): SARAH NOGUEIRA DA SILVA E SILVA, GLEIDSON
grupos T4 e T5 tratados com LDL em relao ao grupo CTR, GIORDANO PINTO DE CARVALHO, FABIANO MATOS
demonstrando maior eficincia das LDLs em substituio PEREIRA
gema de ovo na composio do meio diluidor para a
criopreservao do smen ovino. Ainda, foi evidenciado Resumo: No Brasil, a ovinocultura de corte tem se destacado
maior efetividade do T4 (16% de LDL) para a manuteno devido ao aumento na demanda de carne ovina, o que tem
dos parmetros espermticos aps descongelao em impulsionado a produo desses animais, principalmente,
relao ao grupo CTR (20% de gema de ovo). nos estados do Nordeste, regio que apresenta grande
potencial produtivo. Contudo, a carne ovina no Brasil ainda
Palavras-chaves: LDL, espermatozoide, biotecnologias dependente da importao, devido aos baixos ndices
reprodutivas produtivos e a oscilao na qualidade e oferta de forragem,
******************************************************************* desta forma a busca de alternativas alimentares que
******************************************* objetivem otimizar o desempenho produtivo desses animais
crescente, os aditivos moduladores de fermentao ruminal
tem sido utilizado por potencializar a sntese de produtos
rea: CINCIAS AGRRIAS - ZOOTECNIA provenientes do processo de digesto dos alimentos com
TRABALHO: BALANO DE NITROGNIO DE um menor gasto energtico, entre estes, a quitosana tem se
destacado pela reduo na de aminao da protena bruta
BOVINOS DE CORTE ALIMENTADOS COM no rmen favorecendo ao maior fluxo de protena para o
TANINO NA DIETA intestino, consequentemente maior absoro de nitrognio
proteico da dieta. Dessa forma, o presente trabalho teve
Autor(es): CLUDIA LOIANNY SOUZA LIMA, RONALDO como objetivo avaliar o balano de nitrognio e a sntese de
LOPES OLIVEIRA protena microbiana em cordeiros confinados e submetidos
a dieta contendo quitosana associada ao caroo de algodo.
Resumo: O sistema de produo de carne bovina tem Os tratamentos avaliados foram compostos pela incluso
apresentado um aumento na demanda na qualidade do de dois nveis de quitosana (136 mg/kg de peso vivo;
produto, o que se tem buscado nas pesquisas ultimamente 272 mg/kg de peso vivo) e a dieta controle, sem adio
atrelar a qualidade com a reduo dos custos e diminuio de quitosana. Foram utilizados 60 cordeiros Santa Ins,
dos impactos ambientais, por isso tem sido utilizado com peso vivo (PV) mdio de 20,6 2,2kg, vermifugados,
alimentos alternativos, como o tanino para alcanar esses vacinados, suplementados e com idade entre 04 e 05 meses,
objetivos. O tanino um aditivo que vem sendo utilizado distribudos em delineamento inteiramente casualizado. Os

Congresso da UFBA 2017 | Caderno de resumos 67


cordeiros foram alimentados duas vezes ao dia, na forma de consumo e digestibilidade dos nutrientes. Foram utilizados
mistura completa e relao volumoso:concentrado utilizada 4 bovinos mestios, adultos, castrados, canulados no rmen,
foi de 50:50, sendo o volumoso utilizado feno de Tifton-85 com peso corporal mdio de 446 34 kg. Os animais foram
(Cynodon sp) e o concentrado foi composto por uma mistura alojados em baias individuais providas de comedouro e
de gro de milho modo, farelo de soja, ureia, suplemento bebedouro, distribudos em quadrado latino 4x4 repetido
mineral e caroo de algodo. O ensaio de digestibilidade foi no tempo, sendo 4 animais e 4 tratamentos. O experimento
ESTUDANTE PIBIC

realizado em dois perodos experimentais com coleta total teve durao de 120 dias, divididos em oito perodos com
de fezes por trs dias, durante o ensaio de digestibilidade 10 dias para adaptao e 5 dias para coleta de dados. Os
foram coletadas, diariamente, amostras dos alimentos nveis de tanino condensado inseridos na dieta foram de
fornecidos e sobras para determinao do consumo. 0; 1; 3 e 5 % na MS total da dieta. Foram formuladas dietas
Foram feitas 3 dias de coleta de urina realizada 4 horas na proporo volumoso: concentrado (40:60) na forma de
aps a alimentao matinal, sendo analisada a excreo mistura completa, para ganho mdio dirio de 1,2 kg/dia.
urinaria de nitrognio, sntese de protena microbiana Para determinar o consumo os alimentos ofertados e suas
atravs dos derivados de purina e a excreo total de urina sobras foram pesados diariamente, garantindo entre 5 e 10%.
atravs da creatinina. A creatinina excretada (mg/kg de Foi realizado um ensaio de digestibilidade do 12 ao 15 dia,
PC) foi determinada pela multiplicao da concentrao onde foram coletadas fezes parciais nos animais. Os dados
de creatinina pelo peso corporal mdio de cada cordeiro, foram submetidos a anlises de varincia e regresso no
dividido pela concentrao de creatinina (mg/L). A sntese de SAS, tendo sido considerados como significativos (P<0,05).
protena microbiana (g Nmic/dia) foi calculada utilizando-se Houve reduo linear (P<0,05) no consumo de matria seca
a equao descrita por Chen e Gomes (1992), em funo das (MS), matria orgnica (MO), protena bruta (PB), extrato
purinas absorvidas. A avaliao do teor de nitrognio nas etreo (EE), fibra em detergente neutro corrigida para
amostras do material consumido, fezes e urina foi realizada cinzas e protena (FDNcp), carboidrato no fibroso (CNF) e
pelo mtodo Kjeldahl, segundo a metodologia descrita nutrientes digestveis totais (NDT) com a incluso do tanino
pela AOAC (1999). A reteno de nitrognio (N-retido, g/ na dieta. Observou-se a mesma reduo linear (P<0,05) no
dia) foi feita pela subtrao do N ingerido (g) por N nas consumo de MS e FDN em funo do peso corporal dos
fezes (g) e N na urina (g). No foi observado influencia animais. A digestibilidade dos nutrientes teve efeito linear
(P>0,05), entre as dietas, com ou sem quitosana, para o positivo (P<0,05) com a incluso do tanino. No entanto a
teor de nitrognio das fezes e da urina. Entretanto, para o digestibilidade da PB no foi afetada (P>0,5) pela incluso
N ingerido (g/dia) foi observado efeito quadrtico (P<0,05) do mesmo. Pode-se concluir que o tanino condensado
em funo dos nveis de quitosona, com os maiores valores reduz o consumo, no entanto proporciona aumento na
de N ingerido estimado no nvel de 142 mg de quitosana/ digestibilidade dos nutrientes, podendo ser includo na dieta
kg de peso corporal (PC). O N retido tambm apresentou em at 5%.
efeito quadrtico (P<0,05), com valor mximo estimado de
152 mg de quitosana/kg de PC, proporcionando menores Palavras-chaves: alimentao alternativa,nutrio de
perdas de nitrognio e melhor eficincia na dinmica do N ruminantes,otimizao
para sntese microbiana (gPMIC/dia) nesse nvel. A sntese de *******************************************************************
protena microbiana apresentou efeito quadrtico (P<0,05), *******************************************
com menor sntese de protena microbiana encontrado no
maior nvel de quitosana (272 mg/kg de PC), tal fato pode
ser explicado pela menor concentrao de N-NH3, uma rea: CINCIAS AGRRIAS - ZOOTECNIA
vez que duas espcies de bactrias gram-negativas que TRABALHO: DESEMPENHO PRODUTIVO
possuem grande capacidade de produzir amnia ruminal,
mostraram-se sensveis a monoensina sdica (Russel et al. E CONVERSO ALIMENTAR EM OVINOS
1988). A partir da semelhana no padro fermentativo entre ALIMENTADOS COM SILAGENS DE
ionforos e quitosana (Goiri et al., 2010), pode-se inferir que
o desenvolvimento das respectivas bactrias, possivelmente, SORGO ADITIVADAS COM UREIA E/OU
foi afetado com o maior nvel de incluso (272 mg/kg de PC). LACTOBACILLUS BUCHNERI
Palavras-chaves: ovinos, quitosana, nitrognio
Autor(es): ANA CAROLINE PINHO DOS SANTOS, EDSON
******************************************************************* MAURO, GLEIDSON GIORDANO PINTO DE CARVALHO,
******************************************* TAMIRES MORAES FERREIRA, SUSIANE DE CARVALHO
MATOS, SARAH NOGUEIRA DA SILVA E SILVA
rea: CINCIAS AGRRIAS - ZOOTECNIA Resumo: Objetiva-se avaliar os efeitos da adio de ureia e/
TRABALHO: CONSUMO E DIGESTIBILIDADE ou Lactobacillus buchneri sobre o desempenho produtivo
e converso alimentar em ovinos Santa Ins alimentados
POR BOVINOS DE CORTE TERMINADOS EM com silagem de sorgo aditivadas com ureia e/ou inoculante
CONFINAMENTO SUBMETIDOS A NVEIS DE microbiano. O experimento foi conduzido na Fazenda
Experimental de So Gonalo dos Campos, Bahia. Foram
TANINOS CONDENSADOS NA DIETA utilizados 40 ovinos da raa Santa Ins machos, no
castrados, com peso vivo mdio inicial de 22,8 kg. As dietas
Autor(es): JANAINA RIOS SANTOS, RONALDO LOPES foram compostas por silagem de sorgo e concentrado, numa
OLIVEIRA relao de 50:50. Foi avaliado o consumo de matria seca
(CMS) (kg/dia), peso vivo final (PVF) (kg), ganho de peso total
Resumo: O consumo de carne bovina vem crescendo a cada
(GPT) (kg), ganho mdio dirio (GMD) (kg/dia) e a converso
ano, o que torna a atividade rentvel para os produtores,
alimentar (CA). Os dados foram submetidos anlise de
gerando bons resultados e atendendo s exigncias de
varincia e os valores mdios das dietas comparados pelo
mercado. Como fonte alternativa para a nutrio animal, o
teste de Tukey, ao nvel de 5% de probabilidade, segundo o
extrato da accia negra pode ser utilizado trazendo efeitos
pacote estatstico SAEG (2009) , utilizando como covarivel
positivos na digestibilidade da matria seca, reduo
o peso vivo inicial. Foi observada diferena significativa
de metano e melhoria na utilizao da protena pelo
(P<0,05) para o consumo de matria seca (CMS) entre os
animal. Objetivou-se determinar o melhor nvel de tanino
tratamentos, a silagem controle e a silagem aditivada com
condensado na dieta para bovinos de corte atravs do
ureia proporcionaram um maior consumo (1,068 kg e 1,032

68 Congresso da UFBA 2017 | Caderno de resumos


kg, respectivamente) em comparao s demais. O peso data de parto e ps-parto (+7, +14, +21, +28, +35, + 42, +49,
vivo final apresentou diferena significativa (P<0,05) onde +56, +63 e +70 dias). Todos os animais foram monitorados
a silagem controle e aditivada com inoculante obtiveram durante os ltimos 30 dias de gestao e os primeiros 70
menores pesos que as demais silagens, 31,520kg e 32,300kg, dias ps-parto e mantidos no mesmo ambiente e nas
respectivamente. No houve diferenas significativas mesmas condies de alimentao e manejo. As bfalas
(P>0,05) ganho de peso total (11,245 kg), ganho mdio dirio foram ordenhadas mecanicamente, diariamente s 06h00,

ESTUDANTE PIBIC
(0,208 kg), converso alimentar (8,78) entre os tratamentos. e a produo de leite mensurada por meio de medidor
Observa-se que o ganho mdio dirio atingiu o preconizado de leite automtico (Delaval). As amostras de leite foram
para a formulao da dieta. As silagens de sorgo aditivadas coletadas automaticamente (MM6, DeLaval) uma vez
com inoculante, ureia e associada podem ser utilizadas na por semana (7, 14, 21, 28, 35, 42, 49, 56, 63 e 70 dias), de
alimentao animal sem alteraes no seu desempenho, a acordo com a produo de leite de cada animal em cada
silagem aditivada somente com inoculante destacou-se por ordenha. As amostras de leite foram analisadas quanto aos
proporcionar um menor consumo de matria seca e uma teores de gordura, protena, lactose, nitrognio ureico do
a melhor converso alimentar nos animais. Contudo mais leite (NUL) e contagem de clulas somticas (CCS) seguindo
trabalhos com aditivos devem ser realizados para avaliar o Campanile et al. (2006). No houve diferena para os teores
desempenho produtivo e a converso alimentar. de protena entre os grupos. Entretanto, houve efeitos das
semanas de lactao para as concentraes de protena no
Palavras-chaves: ganho de peso, Santa Ins, aditivos leite. O grupo AECCP apresentou maior teor de NUL (P=
******************************************************************* 0,001) do que os bfalos do grupo BECCP (28,7 vs. 21,2 mg/
******************************************* dL, respectivamente). Houve efeito de semana sobre as
concentraes de casena no leite, casena em porcentagem
da protena bruta e NUL. O escore de condio corporal ao
rea: CINCIAS AGRRIAS - ZOOTECNIA parto, em bfalas da raa Murrah, sob o mesmo sistema de
TRABALHO: EFEITO DO ESCORE DE produo altera as concentraes de nitrognio ureico no
leite.
CONDIO CORPORAL AO PARTO SOBRE
Palavras-chaves: Ruminantes, Lactao, Metabolismo
AS CONCENTRAES DAS FRAES
PROTICAS E NITROGNIO URICO NO *******************************************************************
*******************************************
LEITE DE BFALAS MURRAH NO INCIO DE
LACTAO rea: CINCIAS AGRRIAS - ZOOTECNIA
TRABALHO: EFEITO DO PH CIDO (5,5)
Autor(es): IGOR MORENO SOUZA LOPES, JOS ESLER
FREITAS JUNIOR, NELSON DE CARVALHO DELFINO, LUCAS E DENSIDADE DE ESTOCAGEM (BAIXA,
FIALHO DE ARAGO BULCO, FILIPE QUEIROZ MDIA E ALTA) NO DESENVOLVIMENTO DE
Resumo: Diversos fatores podem influenciar a produo JUVENIS TILPIA-DO-NILO
e a composio de leite de bfalas, especialmente o
estgio de lactao, a idade, a alimentao, a raa, e o Autor(es): PEDRO PORTUGAL SOUZA, CLAUDIO VAZ
status metablico. O status metablico pode alterar a RIBEIRO, CARLOS EDUARDO COPATTI, CARLOS HENRIQUE
composio do leite de animais no mesmo sistema de PAIXO LEMOS
produo, devido intensidade do balano energtico
negativo atravs de adaptaes homeorrticas durante Resumo: Atualmente, a demanda pelo o consumo de peixes
a transio do perodo pr-parto para o perodo ps- para o uso na alimentao humana tem crescido muito,
parto. Essas adaptaes compreendem uma srie de e, com o intuito de suprir essa demanda, os sistemas de
reaes metablicas que so iniciadas, com consequente criao vem sendo intensificados. Isso pode expor os peixes
mobilizao de reservas corporais (especialmente gorduras) a situaes estressantes, causando uma diminuio no seu
e reduo do peso corporal. Neste contexto, a caracterstica desempenho, declnio na taxa de sobrevivncia e aumento
nutricional do leite de bfala pode ser avaliada pelo perfil na susceptibilidade a doenas. Dentre esses fatores de
da protena e da gordura, sendo a primeira constituda por estresse que podem causar prejuzos a produo, podemos
nitrognio proteico (89 a 96%), representado pela casena destacar a densidade de estocagem e o pH. Sendo assim, o
e protenas do soro. Objetivou-se com este estudo, avaliar presente trabalho objetivou analisar a taxa de sobrevivncia
a influncia do escore da condio corporal ao parto e o desempenho de juvenis de tilpias-do-Nilo expostos
(ECCP), sobre as concentraes das fraes proteicas e a diferentes nveis de densidade de estocagem (baixa,
nitrognio ureico no leite de bfalas Murrah no incio de mdia e alta) e pH (5,5 e 7,5). Foram utilizados juvenis
lactao. O experimento foi conduzido em uma fazenda machos de tilpia-do-Nilo com peso mdio de 6 g, os quais
comercial, localizada no Municpio de Lamaro, a 60 km foram acondicionados em tanques com volume de 200 L
de Salvador, Bahia. Foram avaliadas trinta e sete bfalas constantemente aerados. Foram testadas trs densidades de
gestantes (multparas) selecionadas e monitoradas durante estocagem (18, 36 e 72 peixes/tanque) nos nveis de pH 5,5
o perodo de transio com base no escore da condio e 7,5. O experimento durou 60 dias. Foram determinados
corporal e na data de pario estimada. Foram formados ganho de peso individual, comprimento total mdio, taxa
dois grupos: 1) bfalas com ECCP> 3,5 (n = 17); Este grupo de crescimento especfico, coeficiente de variabilidade para
foi classificado e denominado ECC elevado ao parto peso e comprimento, biomassa total, fator de condio e
(AECCP); e 2) bfalas com ECCP 3,5 (n = 20); Este grupo concentrao de amnia e amnio. A sobrevivncia variou
foi classificado e denominado `baixo ECC ao parto (BECCP). de 89 a 100%, no diferindo significativamente entre os
Durante o estudo, o ECC foi avaliado utilizando o mtodo tratamentos. Os peixes expostos a DE 72 apresentaram
de pontuao da condio corporal para bfalos da raa peso, ganho de peso e comprimento menores que a DE
Murrah de acordo com Anitha et al. (2011). Um grfico foi 18 em ambos os valores de pH (P<0,05). A biomassa foi
utilizado para classificar a condio corporal em uma escala menor nos pH 7,5 nas DE 18 e 36 (P<0,05). Os valores de
de 1 a 5 usando subunidades de 0,5 pontos. As medies ganho de peso foram significativamente mais baixos para
foram realizadas semanalmente por dois avaliadores as maiores densidades de estocagem, nos dois valores de
treinados, nos perodos pr-parto (-28, -21 e -7 dias), na pH. Os valores de peso total e comprimento total tambm

Congresso da UFBA 2017 | Caderno de resumos 69


foram significativamente menores nas maiores densidades uma estratgia til para melhorar as propriedades saudveis
de estocagem. Os valores obtidos para o amnio foram da carne, no que diz respeito sua composio em cidos
significativamente maiores para os tanques com pH mais graxos, j que foi observado um aumento significativo dos
cido (5,5). A concentrao de amnio foi maior para cidos graxos polinsaturados na carne bovina.
o pH cido, independente da densidade de estocagem,
evidenciando uma relao entre pH e o on amnio. A Palavras-chaves: nutrio,tanino
ESTUDANTE PIBIC

densidade de estocagem parece no ter influenciado os condensado,biohidrogenao


valores desse on. Conclui-se que as maiores densidades de *******************************************************************
estocagem produzem um efeito negativo nos parmetros de *******************************************
desempenho de tilpia-do-Nilo, e que existe uma relao
entre o pH e o amnio.
rea: CINCIAS AGRRIAS - ZOOTECNIA
Palavras-chaves: desempenho,biometria,amnia
TRABALHO: POLIMORFISMO NOS GENES
*******************************************************************
*******************************************
CAPN1 E CAST ASSOCIADOS A ATRIBUTOS
DA CARNE E DA CARCAA EM OVINOS
rea: CINCIAS AGRRIAS - ZOOTECNIA SANTA INS
TRABALHO: PERFIL DOS CIDOS GRAXOS DA
Autor(es): BEATRIZ BASTOS SENES, LUS FERNANDO
CARNE DE NOVILHOS ALIMENTADOS COM BATISTA PINTO
DIETAS CONTENDO NVEIS DE TANINO. Resumo: O objetivo deste estudo foi identificar e descrever
as frequncias allicas e genotpicas de polimorfismos do
Autor(es): PAMELA YANAINA ARAJO BELLOTTO, tipo SNP (Single Nucleotide Polymorphis) nos genes CAPN1
RONALDO LOPES OLIVEIRA, MAIKAL SOUZA BORJA, (Calpain 1) e CAST (calpastatin) em 191 ovinos da raa Santa
JUSALINE FERNANDES VIEIRA Ins e testar se esto associados ao pH ps-abate (pH0) e
24 horas post mortem (pH24), rea de olho de lombo do
Resumo: A manipulao dos taninos condensados com
msculo Longissimus dorsi, caracterizao cromtica da
intuito de modificar a biohidrogenao ruminal dos cidos
carne (L*, a* e b*), fora de cisalhamento, perda de peso
graxos polinsaturados atravs de mudanas na ecologia
por coco, pesos e rendimentos das carcaas quente e fria,
ruminal, pode favorecer um melhor sabor a carne (VASTA
pesos e rendimentos de pescoo, perna, costelas, paleta
E LUCIANO, 2011), alm disso, reduzir a incorporao de
e lombo, comprimentos externo e interno da carcaa, ,
cidos graxos saturados e aumentar a deposio de cidos
g.93396113G>A no gene CAST e g.42628678C>T no gene
graxos insaturados. Objetivou-se com a utilizao de taninos
CAPN1, foram comprimento da perna, larguras da carcaa
condensados elevar o perfil dos cidos graxos insaturados da
nas regies do peito e da garupa, alm de escores de
carne bovina, melhorando o perfil lipdico principalmente
conformao e acabamento de gordura da carcaa. Foram
dos compostos benficos sade humana como o caso
identificados 58 SNPs no gene CAST e 45 no gene CAPN1. A
do cido Linoleico Conjugado (CLA). Foram utilizados 32
maioria dos marcadores foram identificados em regio de
novilhos, machos, mestios, distribudos em delineamento
intron e dois marcadores identificados em exon, mas ambas
inteiramente casualizado, com 4 tratamentos e 8 repeties
so mutaes sinnimas. Um total de 13 SNPs no gene
por tratamento. Os tratamentos consistiram na incluso de
CAST e 11 no CAPN1 ainda no haviam sido depositadas
quatro nveis de taninos condensados nas dietas dos animais:
no NCBI. Os SNPs identificados como g.93395190A>T,
0% (No incluso/Controle), 1%, 3% e 5% de incluso de
g.93395218A>G, g.93395243T>G, g.93395307T>C,
taninos condensados com base na matria seca total. A
g.93395469G>C, g.93395478G>A, g.93395835G>A,
durao do perodo experimental foi de 99 dias logo aps, os
g.93396080A>G, g.93396154T>C, g.93396162T>C,
animais foram abatidos e posteriormente coletadas amostras
g.93396257T>C, g.93396809G>A, g.93397179G>A,
individuais das carcaas esquerdas, correspondendo seo
g.93397600C>G, g.93397718C>T e g.93397780T>C no
da 9 11 costela (seo HH), segundo Hankins & Hower
gene CAST apresentaram efeito aditivo (P<0,05) para pelo
(1946). A incluso do tanino no influenciou de forma
menos um atributo dentre aqueles avaliados. J para o gene
significativa (P>0,05) no perfil dos cidos graxos saturados
CAPN1, foram os polimorfismos tipo SNPs identificados
(C12:0, C14:0, C16:0 e C18:0) na carne bovina com a incluso
como g.42625446C>T, g.42625811G>A, g.42626685G>A,
dos taninos condensados, teores, mdios observados foram
g.42626996T>C, g.42627301T>C, g.42627413T>C,
0,0025; 2,35 e 22,13 g/100 g perfil de steres metlicos de
g.42627702G>C, g.42628173T>C e g.42628421A>G que
cidos graxos (FAME). No foram observados efeitos (P>0,05)
apresentaram efeito aditivo (P<0,05) para pelo menos uma
para o perfil de cidos graxos monoinsaturados (C16:1 c9,
das caractersticas estudadas. Estes SNPs so potenciais
C18:1 c9), com 2,02; 28,98 de teor mdio. A somatria de
marcadores para programas de seleo em ovinos Santa
cidos graxos saturados (AGS) e, somatria de cidos
Ins, mas ressalta-se que, para grande parte destes SNPs,
graxos monoinsaturados (AGMI), no foram alteradas com
h a ocorrncia de variaes nas frequncias genotpicas e
a incluso de taninos condensados na dieta, tendo como
allicas entre os rebanhos Santa Ins e a resposta seleo
valores mdios 30,79 e 63,49 g/100 FAME respectivamente.
depender dessas frequncias.
Os cidos graxos polinsaturados (C18:3 n3, CLA (C18:2 c9-
t11), e DHA) tambm no foram influenciados pela incluso Palavras-chaves: carcaa,ovinocultura,seleo
dos taninos condensados, obtendo mdias de 0,49; 6,2 e
0,09 g/100 FAME respectivamente. Observou-se aumento *******************************************************************
dos cidos graxos insaturados com a incluso do tanino *******************************************
para o cido linoleico (C18:2 c9- c12), cido araquidnico
(C20:4n6), EPA (C20:5n3) e DPA (C22:5) os quais aumentaram
3,3; 1,02; 0,34 e 0,55 g/100 FAME, respectivamente. A
somatria dos cidos graxos polinsaturados (AGPI) foi
observado um aumento de 2,24 g/100 FAME, no seu
teor com a incluso de 5% dos taninos condensados. Os
resultados demonstraram que a incluso de 5% de taninos
condensados nas dietas dos bovinos de corte podem ser

70 Congresso da UFBA 2017 | Caderno de resumos


rea: CINCIAS AGRRIAS - ZOOTECNIA e as diferentes propores de volumoso e concentrado
nas dietas para ovinos tem sido pouco estudadas, o que
TRABALHO: POLIMORFISMOS NOS GENES justifica o objetivo do presente estudo, o qual avaliar a
GH E IGF1 E ASSOCIAES COM ATRIBUTOS interao do feno em diferentes tamanho de partcula
com diferentes relaes volumoso:concentrado (V:C) no
DA CARNE E DA CARCAA DE OVINOS SANTA desempenho produtivo, consumo e digestibilidade. Foram

ESTUDANTE PIBIC
INS utilizados 72 cordeiros da raa Santa Ins, no-castrados,
com peso mdio inicial de 23,5kg e idade entre 2 e 3 meses.
Autor(es): TATIANA CORTEZ SOUZA, LUS FERNANDO Os tratamentos corresponderam a interao entre dois
BATISTA PINTO dimetros de peneira durante o processamento do feno
(13 e 6mm) e duas relaes volumoso:concentrado (70:30
Resumo: polimorfismos nos genes do hormnio do e 50:50). Aps o perodo de adaptao (15 dias), os animais
crescimento (GH) e do fator de crescimento semelhante foram submetidos a fase experimental (72 dias consecutivos),
insulina tipo 1 (IGF1) vem sendo testados para saber se durante esse perodo foram coletadas amostras e dados para
esto associados a caractersticas de interesse econmico avaliao de desempenho, atravs dos ndices de ganho de
em animais de produo. Porm, estudos dessa natureza peso (dirio, total, peso final), consumo e digestibilidade
com ovinos ainda so raros. Assim, este estudo teve como dos nutrientes (matria seca (MS), matria mineral (MM),
objetivo identificar polimorfismos nos genes GH e IGF1 em matria orgnica (MO), estrato etreo (EE), protena bruta
ovinos da raa Santa Ins e testar se esto associados ao (PB), carboidratos no fibrosos (CNF) e fibra em detergente
pH ps-abate (pH0) e 24 horas post mortem (pH24), rea neutro (FDN)). Os resultados foram submetidos a anlise
de olho de lombo do msculo Longissimus, caracterizao estatstica de varincia com auxilio do teste de Tukey, com
cromtica da carne (L*, a* e b*), fora de cisalhamento, nvel de significncia a 5%. Com relao ao desempenho
perda de peso por coco, pesos e aos rendimentos de dos animais, os resultados demonstraram que ao reduzir o
carcaas quente e fria, pesos e rendimentos de pescoo, dimetro da peneira: o peso vivo final passou de 31,28 para
perna, costelas, paleta e lombo, comprimentos externo e 35,09kg na relao V:C 70:30, e de 38,28 para 39,45kg na
interno da carcaa, comprimento da perna, larguras da relao 50:50; o ganho de peso total passou de 7,63 para
carcaa nas regies do peito e da garupa, alm de escores 10,68kg (70:30) e de 14,61 para 15,80kg (50:50); e o ganho
de conformao e acabamento de gordura da carcaa. de peso dirio passou de 0,105 para 0,148g/dia (70:30) e de
Dezoito polimorfismos foram identificados em regio de 0,203 para 0,219g/dia (50:50). Quando se tratou do consumo
intron do gene IGF1 e 21 no gene GH, sendo 18 em intron dos animais, foi constatado que houve diferena significativa
e trs em exon. Dentre os SNPs localizados no gene IGF1, na interao para as variveis de consumo de MS, MO, PB
g.171108499T>G, g.171110428C>T, g.171111426G>A e e FDN, os valores mdios encontrados se comportaram da
g.171112496C>T tiveram efeito sugestivo (P<0,05) para pelo mesma forma que ocorreu com o desempenho dos animais:
menos uma das caractersticas em estudo. Alm disso, o quanto menor o dimetro da peneira e aumentou o volume
SNP g.171108499T>G teve efeito significativo ao nvel da de concentrado na deita, maior foi o consumo desses
correo de Bonferroni (P<0,002023) para peso de carcaa nutrientes. Quanto ao consumo de matria seca, os menores
fria e para os rendimentos de carcaa quente e fria. J valores encontrados foram na interao do tamanho de
para os SNPs localizados no gene GH, g.47486424T>C e 13mm com a relao 70:30 (0,959kg/dia), e os maiores foram
g.47486819C>A apresentaram efeito sugestivo (P<0,05) com a peneira de 6mm e a ralao V:C 50:50. Voltando-se
para diversas caractersticas. Alm disso, observou-se efeito para digestibilidade, observou-se que s houve diferena
significativo ao nvel da correo de Bonferroni (P<0,002023) significativa para os coeficientes mdios de digestibilidade
do SNP g.47486424T>C sobre rendimento da perna e do SNP do CNF que apresentou diferena para as relaes V:C 70:30
g.47486819C>A sobre peso e rendimento de costela, peso e e 50:50, (71,13 e 80,84%, respectivamente). Com base nos
rendimento de lombo, peso de paleta e peso de perna. Logo, resultados obtidos e apresentados, pode-se concluir que
os genes IGF1 e GH possuem mutaes que podem fornecer medida em que se reduziu o tamanho da partcula e
importantes informaes para o processo de seleo da raa aumentou a proporo de concentrado na dieta os animais
Santa Ins para melhoria de carcaa. obtiveram melhores desempenhos produtivos, logo, a
relao 50:50 e o uso da peneira de 6mm foi o mais indicado.
Palavras-chaves: polimorfismo
Palavras-chaves: ovinocultura,tamanho de partcula,relao
*******************************************************************
volumoso:concentrado
*******************************************
*******************************************************************
rea: CINCIAS AGRRIAS - ZOOTECNIA *******************************************

TRABALHO: RELAO rea: CINCIAS AGRRIAS - ZOOTECNIA


VOLUMOSO:CONCETRADO ASSOCIADA TRABALHO: RELAO VOLUMOSO:
AO TAMANHO DE PARTCULA DO FENO CONCENTRADO ASSOCIADA AO
NO CONSUMO E DIGESTIBILIDADE DE TAMANHO DE PARTCULA DO FENO
CORDEIROS NAS CARACTERSTICAS DE CARCAA E
Autor(es): DANIELA COTRIM, ANALVIA MARTINS BARBOSA QUALIDADE DE CARNE DE CORDEIROS
Resumo: A ovinocultura se destaca devido ao grande giro
Autor(es): ANA CAROLINE PORTO GOMES, ANALVIA
do capital visto que o ciclo de produo mais curto, sendo
MARTINS BARBOSA, LARISSA DE OLIVEIRA QUEIROZ
de aproximadamente 10 meses, mesmo assim esse ciclo
pode ser reduzido atravs da maximizao do consumo Resumo: A ovinocultura vem aumentando cada vez mais
dos animais e da taxa de passagem dos alimentos pelo trato a sua participao nos sistemas de produo animal,
gastrointestinal. Para isso, alguns tipos de manejo alimentares principalmente no que se refere ao setor crneo. Diante
podem ser utilizados, como a reduo do tamanho das disso, tm-se a necessidade de pesquisas que venham a
partculas do volumoso e/ou uso de alimentos concentrados. colaborar com o aumento da produtividade mantendo a
Porm, as possveis interaes entre o tamanho da partcula qualidade da carne. Estudos relacionados nutrio so

Congresso da UFBA 2017 | Caderno de resumos 71


fundamentais, uma vez que este fator consiste em cerca dos alimentos, principalmente por suas propriedades
de 75% dos custos totais da produo animal e, interfere antimicrobianas e moduladoras do desenvolvimento desses
diretamente na qualidade do produto. Objetivou-se com microrganismos, podendo ser usada assim, como estratgia
esta pesquisa avaliar o efeito da interao entre tamanho para melhorar o aproveitamento dos nutrientes da dieta e
de partcula do feno e a relao volumoso:concentrado converso alimentar desses animais. Desta forma, objetivou-
nas caractersticas quantitativas da carcaa e qualitativas da se avaliar o efeito de diferentes nveis de quitosana sobre
ESTUDANTE PIBIC

carne de ovinos confinados. Foram utilizados 72 cordeiros o consumo e digestibilidade dos nutrientes em cordeiros
machos, inteiros, da raa Santa Ins, com peso mdio inicial confinados. Foram utilizados 60 cordeiros da raa Santa Ins,
de 23,5kg e idade entre 2 e 3 meses. Os animais foram com peso mdio de 20,6 2,2 kg de PC, e idade de 04 a 05
confinados por um perodo de 87 dias, onde 15 dias foram meses, alojados em baias individuais e distribudos em um
destinados para adaptao s baias e dietas experimentais delineamento inteiramente casualizado (DIC). O experimento
e 72 dias para coleta de dados, sendo alimentados com teve durao de 90 dias com, trs perodos consecutivos de
dietas compostas por feno com partculas de 6mm e 30 dias, precedidos de 15 dias de adaptao dos animais
13mm associadas a relao volumoso:concentrado de as instalaes e a dieta. Os animais foram submetidos aos
70:30 e 50:50. Ao final do experimento realizou-se o abate seguintes tratamentos experimentais: 1) Dieta sem adio de
e avaliou-se os pesos, rendimentos e morfometria das quitosana; 2) Dieta com incluso de 136 mg de quitosana/
carcaas; pesos e rendimentos dos cortes comerciais e kg de peso corporal; 3) Dieta coma incluso de 272 mg de
caractersticas relacionadas a qualidade da carne. Houve quitosana/kg de peso corporal, sendo que as dietas foram
interao significativa (P<0,05) entre os fatores da dieta formuladas para serem isonitrogenadas (16% PB), compostas
para os parmetros de peso vivo ao abate, peso de carcaa por feno de capim Tifton-85 (Cynodon sp) fcomo fonte
quente e fria. Os rendimentos de carcaa no tiveram de alimento volumoso e o concentrado composto por
efeito da interao, mas foram influenciados pelos fatores gro de milho modo, farelo de soja, caroo de algodo,
isoladamente, onde os animais que receberam dietas com ureia e suplemento mineral especfico para ovinos, numa
partcula de 13mm e 50% de concentrado apresentaram os relao volumoso:concentrado de 50:50. Os cordeiros
melhores resultados. Na morfometria, apenas circunferncia foram alimentados duas vezes ao dia, na forma de mistura
da perna, largura da garupa e largura do peito tiveram completa. O ensaio de digestibilidade ocorreu entre o 30 e
efeito significativo de interao (P<0,05). Todas as outras 37 e entre o 60 e 67 dias do perodo experimental, com
caractersticas foram influenciadas pela relao V:C e, os trs primeiros dias destinados adaptao dos cordeiros
somente o permetro da garupa, teve efeito do tamanho s bolsas coletoras seguido de cinco dias subsequentes de
de partcula do feno. Em relao aos cortes comerciais, coleta total de fezes. Aps registrada a produo total de
somente o peso da paleta teve efeito significativo da fezes de cada animal, uma alquota de 10% das amostras
interao (P<0,05), mas sem alteraes em seu rendimento. coletadas foram acondicionadas em sacolas plsticas e
O peso da costela aumentou com a reduo do tamanho armazenadas em freezer a -20C para posteriores anlises.
de partcula, com mdias de 2,210 e 2,278 para 13mm e Da mesma forma, as amostras do ofertado e das sobras
6mm, respectivamente. Todos os cortes comerciais tiveram foram coletadas e armazenadas. Depois de descongeladas,
seus pesos alterados em funo da relao V:C, mas apenas as amostras foram pr-secas numa estufa de ventilao
os rendimentos do pernil e da costela tiveram efeito forada a 55C e posteriormente trituradas em moinho
significativo (P<0,05). No que se refere qualidade da carne, de facas com peneira de 1mm adequando-as s anlises
no houve efeito de interao significativo (P<0,05) para quimico-bromatolgicas. Foram determinadas os teores de
nenhuma das variveis. O tamanho de partcula influenciou matria seca (MS), matria mineral (MM), protena bruta
apenas os teores de protena e de matria mineral da (PB), e extrato etreo (EE), conforme metodologia descrita na
carne e a relao V:C de 50:50 foi responsvel por elevar os AOAC (1990), os teores de fibra em detergente neutro (FDN)
valores de rea de olho de lombo e espessura de gordura e fibra em detergente cido (FDA) foram obtidos conforme
subcutnea e, em contrapartida, houve decrscimo no Van Soest et al. (1991), os teores de protena insolvel em
teor de luminosidade com esta mesma relao. A incluso detergente neutro (PIDN) e cido (PIDA) segundo Licitra et
de at 50% de concentrado independentemente do al. (1996) e a lignina foi determinada por meio de tratamento
tamanho de partcula vivel na alimentao de ovinos do resduo de fibra em detergente cido com cido sulfrico
em confinamento, pois proporcionou aumento nos valores a 72%, de acordo com Silvva & Queiroz (2002). Os valores
quantitativos de carcaa sem afetar na qualidade da carne. de carboidratos totais (CT) e carboidratos no fibroso
(CNF) foram obtidos por meio de equaes dedutivas. Para
Palavras-chaves: Ovino, Granulometria determinao do consumo de nutrientes, as sobras foram
******************************************************************* recolhidas e pesadas diariamente, sendo determinado por
******************************************* meio da subtrao do total de cada nutriente contido nos
alimentos ofertados e o total de cada nutriente contido nas
sobras. O coeficiente de digestibilidade foram mensurados
rea: CINCIAS AGRRIAS - ZOOTECNIA por meio da relao do que foi consumido de cada nutriente
TRABALHO: USO DA QUITOSANA EM DIETAS e sua respectiva excreo fecal, a partir da seguinte equao:
CD= [(kg da frao ingerida kg da frao excretada)] / (kg da
PARA CORDEIRO EM CONFINAMENTO: frao ingerida) X 100. Os dados obtidos foram submetidos
CONSUMO E DIGESTIBILIDADE. anlise de varincia por meio do comando PROC MIXED,
do programa estatstico Statistical Analysis System 9.0 (SAS,
Autor(es): SUSIANE DE CARVALHO MATOS, GLEIDSON 2009). Contrastes polinomiais foram utilizados para obter
GIORDANO PINTO DE CARVALHO, FABIANO MATOS efeito linear ou quadrtico das dietas, considerando um
PEREIRA, SARAH NOGUEIRA DA SILVA E SILVA, TAMIRES nvel de significncia de 5%. No houve efeito na incluso
MORAES FERREIRA de quitosana sobre os consumos de MS (kg e % PC, % peso
metablico - PM), FDN (kg e % PC), PB, EE, MO, CNF e
Resumo: O uso de aditivos alimentares para melhorar o NDT nos cordeiros confinados. No entanto, os valores para
desempenho animal em ruminantes j uma realidade. digestibilidade dos componentes nutricionais apresentaram
Devido a resistncia das bactrias ruminais aos antibiticos efeito quadrtico (P<0,05), com menores valores no nvel
utilizados na nutrio, a busca por aditivos mais naturais de incluso de 272 mg de quitosana/kg de PC e maiores
sade desses animais tem se intensificado. A quitosana, para digestibilidade da PB e MS nas doses de 121,5 e
biopolmero atxico, biodegradvel e de baixo custo, tem 129,75 mg/kg de PC com coeficientes de 78,33 e 73,09%,
notada ateno pelo grande potencial na preservao respectivamente. Para o coeficiente de FDN estima-se que a

72 Congresso da UFBA 2017 | Caderno de resumos


dose de 148 mg/kg de PC de quitosana proporcionou maior Os dados do grupo Gurdjieff so normais no RL (p = 0,200) e
digestibilidade. Conforme observado neste estudo, o uso da na MD (p = 0,200), enquanto os do grupo Raja Yoga so no-
quitosana como aditivo nutricional em dietas de ruminantes normais no RL (p = 0,022) e na MD (p = 0,001). Desse modo,
garante uma melhoria na digestibilidade dos nutrientes, sem aplicou-se um Teste T com de 0,05 para o primeiro grupo
alterar seu consumo pelos animais. (Gurdjieff) e o p valor encontrado foi 0,031, indicando que
h diferena significativa entre RL e MD. Para o grupo Raja

ESTUDANTE PIBIC
Palavras-chaves: Ovinos,Quitosana,Digestibildade Yoga, aplicou-se o Wilcoxon pareado, com de 0,05 e o p
******************************************************************* valor encontrado foi 0,484, indicando que no h diferena
******************************************* significativa entre os estados. Esses resultados indicam que
o tipo de prtica meditativa parece exercer influncia na
conectividade cortical que gera homogeneidade dentro do
rea: CINCIAS BIOLGICAS - BIOFSICA grupo Raja Yoga, enquanto no grupo Gurdjieff, os indivduos
TRABALHO: ANLISE DE REDES CEREBRAIS possuem distribuio mais heterognea durante estas tarefas,
ou seja, existe maior variabilidade individual dentro desse
DE MEDITADORES grupo que aumenta na meditao e pode ser observada no
desvio padro. Embora na literatura at o presente momento
Autor(es): JOEL AUGUSTO MOURA PORTO, JOS MIRANDA no existam trabalhos comparando o estado meditativo
Resumo: Por meio de estudos usando o EEG, as com o relaxamento atravs de uma anlise realizada com
Neurocincias observam as variaes nos espectros das GVT para contrastar nossos achados, alguns autores indicam
frequncias das ondas cerebrais. Durante a meditao, que existem diferenas significativas entre relaxamento e
estudos na literatura tm observado alteraes em ondas meditao, para anlises com EEGq, anlises com fMRI e
theta e alpha, indicando que indivduos atingem um nvel redes complexas no geral. As diferenas encontradas nesses
de descanso mais profundo. Esse relaxamento capaz dois grupos no processo de meditao e relaxamento
de proporcionar benefcios fisiolgicos e emocionais podem ser tambm interpretadas no s pelos objetivos das
mensurveis, tal como j ocorre atravs a prtica do prticas meditativas mas tambm, pela forma de vida que os
Mindfulness. Esta pesquisa trata-se de um estudo voluntrios levam, diferentes em cada grupo. Alm disso, o
observacional transversal. A amostra foi composta por 20 grupo Gurdjieff utiliza o relaxamento mais profundo como
participantes: dez meditadores do grupo Gurdjieff e dez forma meditativa.
meditadores do grupo Raja Yoga do Brahma Kumaris (BK) Palavras-chaves: neurocincias, meditao, redes
da cidade de Salvador, do estado da Bahia/Brasil. As coletas
foram realizadas no Instituto de Cincias da Sade ICS, *******************************************************************
da Universidade Federal da Bahia UFBA, no Laboratrio *******************************************
de Eletroestimulao Funcional LEF entre os meses de
setembro de 2015 a maro de 2016. Os voluntrios meditam rea: CINCIAS BIOLGICAS - BIOLOGIA GERAL
todos os dias, e a faixa etria variou entre 30 e 74 anos,
com tempo acumulado de meditao de 6 anos (51.264 TRABALHO: ADEQUAO DA TCNICA
horas) 35 anos (306.600 horas). Utilizamos o aparelho DE PCR PARA TEDANIA IGNIS
de eletroencefalograma (EEG) BrainNet BNT 36 (EMSA/
Brasil), com disposio 10/10, composto de 30 eletrodos (20 (POECILOSCLERIDA, DEMOSPOGIAE).
principais: F3, F4, F7, F8, T3, T4, T5, T6, C3, C4, P3, P4, O1, O2,
Fz, Cz, Pz, Oz, Fp1 e Fp2 mais 10 intermedirios FC3, FC4, Autor(es): UBALDO UBALDINO PORTO LIMA, EMILIO
CP3, CP4, FT7, FT8, TP7, TP8, FCZ, CPZ), alm de 4 eletrodos LANNA
adicionais, 02 dispostos na regio supra e infraorbital do
Resumo: A PCR (Polymerase Chain Reaction) uma
olho direito e 02 dispostos no trapzio do lado direito.
tcnica in vitro para amplificar o DNA, atravs da qual
A taxa amostral da coleta foi de 600 Hz, a aquisio foi
ocorre uma replicao exponencial de uma regio alvo
monopolar, o Cz foi usado como eletrodo referencial e
do DNA. Para isso, utiliza-se desoxirribonucleotdeos
o terra foi posicionado no centro da testa. A anlise de
fosfatados (dNTPs) sintticos, primers e enzimas estveis a
dados est sendo realizada atravs do EEGLAB do MatLab.
elevadas temperaturas. Os fragmentos de DNA produzidos
Os dados em formato ASC foram filtrados a 0.5 50 Hz,
servem para discriminar espcies ou indivduos, podendo
permanecendo somente as frequncias que esto dentro
assim serem empregados nos mais variados estudos que
deste intervalo. Os parmetros utilizados para anlise foram:
utilizem marcadores genticos. Entretanto, um mesmo
up e o low, threshold de 1000 e -1000, janela 20, limiar de
protocolo para amplificao no adequado para todas
0.9, tau 3, Motif lag 1. Atravs do EEGLAB, foram removidos
as situaes ou para diferentes espcies, mesmo em um
artefatos musculares, movimento ocular e movimento de
mesmo clado. Isso ocorre em razo dos componentes da
cabea. Os arquivos foram divididos em pocas de 1,71
reao de PCR apresentarem interaes complexas entre
com taxa amostral de 600 Hz. Aps separao das pocas,
si e pelas diferentes finalidades para as quais essa tcnica
esto sendo removidas as que contm artefatos. O canal
pode utilizada. Estudos anteriores com eumetazorios,
referncia permaneceu foi o 18, que o Cz. Aps todo
plantas e fungos mostram que a eficincia da amplificao
processo de limpeza dos dados, utilizamos o programa
dos fragmentos de DNA diretamente influenciada pelas
TNetEEG 1.0 para construo das REAs e TVGs. O ndice
concentraes de magnsio, Taq polimerase, primers, DNA,
utilizado foi a mdia do grau ponderado (kp peso mdio
dNTPs e tambm por fatores como a tcnica de extrao
das arestas entre os ns, neste caso o tempo), obtido pela
do DNA, os programas de temperaturas (desnaturao,
sincronizao por motifs na construo do GVT, para cada
anelamento e extenso) e nmero de ciclos. Portanto,
voluntrio tanto no RL quanto na MD. O p valor encontrado
necessrio estabelecer previamente as condies timas
para o teste de normalidade no RL foi 0,062 (normal) e
para de reao de PCR para o desenvolvimento de quaisquer
na MD foi 0,003 (no-normal). Foi aplicado um teste no
estudos a partir dessa tcnica. Nesse sentido o presente
paramtrico, o Wilcoxon pareado para anlise intrassujeito, e
trabalho buscou determinar um protocolo vlido para
os resultados indicam que, para os 16 voluntrios, o estado
amplificao de uma regio do DNA mitocrondrial (o gene
RL significativamente diferente do MD, onde o nvel de
da protena Citocromo C Oxidase subunidade I COI) da
confiana foi de 0,05 e p valor encontrado foi 0,044. Ao
esponja Tedania ignis. Sendo essa uma etapa de um estudo
separarmos os 16 voluntrios em dois grupos, Raja Yoga (08)
que busca confirmar a co-especificidade de populaes de
e Gurdjieff (08), realizamos um novo teste de normalidade.
T. ignis situadas em quatro localidades distintas e muitos

Congresso da UFBA 2017 | Caderno de resumos 73


distantes entre si (Goaina PE, Salvador BA, Angra dos Reis como o aumento exponencial das taxas de germinao,
- RJ e Florianpolis - SC). Para a amplificao, selecionamos possibilidade de alocao de um banco de germoplasma
dois indivduos da populao de Salvador BA e dois em um espao reduzido, ou mesmo altas taxas de
indivduos da populao Angra dos Reis RJ. Os indivduos multiplicao clonal. Tais esforos podem ser teis suprindo
foram limpos, para remoo de simbiontes, e conduzidos o mercado florstico, reduzindo por tanto as presses sobre
para a extrao de DNA que utilizou o QIAmp DNA mini as populaes naturais, ou reintroduzindo indivduos que
ESTUDANTE PIBIC

kit e, por consequncia, seguiu o protocolo prprio do kit foram obtidos pelo cultivo in vitro em seu habitat. Durante
(QIAGEN 2012). De posse do DNA extrado foi realizada a a propagao vegetativa in vitro, o esperado seria que todas
PCR dessas amostras, adaptando o protocolo produzido as plantas obtidas a partir de uma determinada matriz,
por Folmer et al. (1994). Inicialmente, foi utilizado 0,6 l de fossem idnticas geneticamente mesma, no entanto, em
DNA para uma reao de PCR de 15 l, utilizando 0,12 l de uma parcela das plantas micropropagadas frequentemente
Taq polimerase. A reao consistiu em um mix com 8,58 l detectada mudana no material gentico em relao
de gua Mili Q, 12,4 l de dNTP, 1,5 l de Tampo, 0,6 l de planta me. A esse tipo de mutao d-se o nome de
MgCl, 0,6 l de primer foward (LCO 1490) e 0,6 l do primer variao somaclonal. Por tanto, o objetivo deste trabalho
reverse (HCO 2198). As reaes foram realizadas atravs de foi verificar a ocorrncia de variao somaclonal ao longo
35 ciclos com os seguintes parmetros: trs minutos e meio de cinco geraes de C. elongata obtidas in vitro. Para
a 94 C (antes de iniciar os ciclos), um minuto a 95 C, um tanto, 460 plantas de dois tamanhos diferentes (1-2 cm
minuto a 40 C e um minuto e meio a 72 C, seguido por ou 3-5 cm), provenientes do banco de germoplasma do
um passo de extenso final a 72 C durante sete minutos. O LCTV-UFBA, sofreram retirada do meristema apical e foram
gel de eletroforese a 1% mostrou que a PCR no funcionou. inoculadas em tubos de ensaio contendo meio Murashige
Devido a isso, testou-se um gradiente de temperatura para e Skoog (1962) isento de reguladores vegetais, com metade
anelamento com uma amostra de cada localidade. Apenas da concentrao salina, autoclavado por 15 min, a 121C.
a amostra de Salvador BA amplificou a regio do DNA, na Posteriormente o nmero de brotos emitidos por cada
temperatura de 41 C. Suspeitou-se que a amostra de Angra explante foi avaliado e o DNA das plantas foi extrado a partir
dos Reis RJ no amplificou devido alta concentrao das partes areas pelo protocolo CTAB de Doyle e Doyle
de DNA, o que dificultaria o funcionamento correto da (1987), sendo armazenado a -20 oC. Dezenove gentipos
Taq polimerase. A partir disso o DNA da amostra de Angra foram selecionados aleatoriamente e tiveram o DNA de
foi diludo e uma nova PCR foi realizada com as amostras suas cinco geraes amplificado com 6 marcadores ISSR
de ambas localidades utilizando a temperatura de 41 C (MAO, MANNY, UBC 898, CHRIS, UBC 901 e AW3), corado
para o anelamento. Novamente apenas a amostra de com Gelred e analisado em gel de agarose a 1,6%. Aps
Salvador BA amplificou. Foi adicionado ao protocolo BSA 16 meses apenas a parcela de plantas com maior tamanho
(Bovine Serum Albumin) e foi rodado uma nova PCR com se mostrou vivel em tempo hbil para o experimento. Ao
uma amostra de Angra dos Reis RJ mantendo a ltima final do experimento constatou-se uma mdia de 3,8 brotos
temperatura para o anelamento. A amplificao da regio para segunda gerao, 2,6 para a terceira, 2,76 para a quarta
ocorreu, porm houve a formao de uma segunda banda e 3,6 para a quinta gerao. Desta forma observou-se uma
inespecfica mais pesada. Foi feito, ento, um novo teste de tendncia reduo da capacidade de regenerao do
temperatura para o anelamento e constatou-se que com explante com o passar do tempo que retomada com o
49 C apenas a banda de interesse formou. O procedimento estabelecimento de maior tempo entre as repicagens. Dos
com o BSA e a temperatura de 49 C foi repetido para o 19 indivduos analisados, dois (10,52%) sofreram variao
outro individuo de Angra dos Reis RJ e os dois indivduos somaclonal. Foram analisadas 1465 bandas totalizando
Salvador BA. Nos trs indivduos apenas a banda de 62 loci, dos quais 6 (9,67%) foram polimrficos. 66,6% da
interesse (aproximadamente 700 pb) foi formada. Esse peso variao somaclonal detectada ocorreu na segunda gerao,
encontrado similar ao determinado por Folmer et al. (1990) fornecendo indcio de que o primeiro evento de repicagem
quando desenvolveu o primer para essa regio do COI de possa ser o mais crtico. Tal taxa nos permite concluir que
invertebrados marinhos. A partir disso, podemos considerar apesar da variao somaclonal estar presente nas plantas
que obtivemos sucesso em determinar um o protocolo analisadas, sua taxa baixa, caracterizando o protocolo de
para a PCR da esponja T. ignis. Abre-se espao ento para multiplicao como eficiente na manuteno da fidelidade
aprofundar os estudos a cerca dessa regio do DNA. gentica de Cattleya elongata.
Palavras-chaves: PCR, COI, Poecilosclerida Palavras-chaves: Micropropagao, Orqudea, Variao
somaclonal
*******************************************************************
******************************************* *******************************************************************
*******************************************
rea: CINCIAS BIOLGICAS - BIOLOGIA GERAL
TRABALHO: ANLISE DA ESTABILIDADE rea: CINCIAS BIOLGICAS - BIOLOGIA GERAL
GENTICA DE NA PROPAGAO IN VIRO DE TRABALHO: ANLISE DE EEG QUANTITATIVO
CATTLEYA ELONGATA EM MEDITADORES
Autor(es): THAISE GRAZIELE LIMA DE OLIVEIRA TOUTAIN,
Autor(es): GUSTAVO SURLO NASCIMENTO, NAZAR
JOS MIRANDA
MARCHI, MOEMA CORTIZO BELLINTANI, ZAFIRA EVELMA
DA R. GURGEL Resumo: A meditao uma tcnica ancestral usada por
tradies religiosas e no religiosas para alcanar benefcios
Resumo: Cattleya elongata Barb. Rodr. (Orchidaceae)
na sade e espirituais. Esta prtica realizada por muitas
uma espcie endmica da Chapada Diamantina que
pessoas ao redor do mundo, com objetivo principal de
apresenta elevado valor ornamental devido beleza de
auto-conhecimento e desenvolvimento espiritual. Nos
suas flores vermelho-amarronzadas e pseudobulbos
estudos realizados em meditadores por Lagopoulos (2009) e
longos e avermelhados. Devido perda de seu habitat e
Takahashi (2005), foram observadas variaes nos espectros
extrativismo predatrio induzido pelo seu valor ornamental,
das frequncias das ondas cerebrais. Na meditao, estas
C. elongata consta no apndice II do Cites, como espcie
pesquisas indicaram modificaes nas ondas teta e alfa, estas
potencialmente ameaada. Neste cenrio, o cultivo in vitro
expressam que o indivduo atingiu um nvel de relaxamento
traz vantagens significativas para a preservao da espcie,

74 Congresso da UFBA 2017 | Caderno de resumos


mais profundo, capaz de refletir benefcios fisiolgicos e que apontaram para Anaplasmataceae e Ricketsiaceae como
emocionais mensurveis, como diminuio da ansiedade grupos-irmos das mitocndrias eucariticas. Dessa forma,
e depresso. A atividade neural registrada pelo aparelho estendemos nossa investigao compreenso de como
de Eletroencefalograma (EEG) e atravs das descargas dos a origem das mitocndrias tem sido abordada na cincia
potenciais de ao, que so gerados no corpo celular do escolar, por meio de levantamento bibliogrfico dos livros
neurnio, so direcionados pela membrana ao longo do didticos de biologia e entrevistas semiestruturadas sobre

ESTUDANTE PIBIC
axnio e captados pelo aparelho de EEG, desta maneira os como professores de biologia do ensino mdio de escolas
neurnios comunicam-se entre si. O EEG quantitativo (EEGq) pblicas entendem a origem evolutiva das mitocndrias,
um exame onde se realiza anlise da topografia funcional como abordam o assunto em suas salas de aula e como
com base no traado do EEG (ANGHINAH, 2005), chamada os estudantes, pela viso do professor, recepcionam esse
de mapeamento cerebral envolvendo anlise do tempo e das conhecimento. Analisamos 25 livros didticos (aprovados
frequncias (alfa, beta, teta, gamma e delta). O objetivo deste pelo Plano Nacional de Educao PNE) desses, 10 citam a
estudo descrever os estados de Relaxamento, Meditao, evoluo das mitocndrias, porm, no h uma explicao
Meditao com Msica Especfica e Inespecfica, numa evolutiva aprofundada. Obtivemos baixa adeso nas
anlise com EEG quantitativo para as powers alfa, teta, delta entrevistas, sendo entrevistados 3 professores do ensino
e beta. Participaram voluntariamente meditadores da casa mdio. Desses, dois abordam em sala de aula a teoria da
Brahma Kumaris com sede em Salvador BA, que realizam endossimbiose e um no aborda, apesar de todos acharem
a meditao Raja Yoga. O protocolo envolveu os seguintes a teoria interessante e pertinente. H divergncia no quesito
estgios: Meditao (MD), Relaxamento (RL) e Meditao da recepo dos alunos ao assunto. Todos os trs concordam
com Msica Especfica (ME) e Inespecfica (MI). Os resultados que os livros so superficiais no assunto.
indicaram que, para uma comparao entre os estmulos
MD, RL, ME e MI, as regies frontal, central e occipital Palavras-chaves: Educao, Endossimbiose, Livro didtico
apresentaram diferenas significativas para frequncia X *******************************************************************
regio, com p<0.05, anlise realizada com MANOVA. Os *******************************************
maiores powers observados na MD, no RL na ME e MI
foram alfa, teta e delta, sendo que alfa e delta tiveram os
maiores powers. Nos quatro estmulos MD, RL, ME e MI, rea: CINCIAS BIOLGICAS - BIOLOGIA GERAL
alfa esteve presente mais na regio occipital e delta mais TRABALHO: EFEITO DO TAMANHO E DA
na regio frontal, enquanto teta esteve presente com maior
power tanto na regio frontal quanto na occipital, nos quatro PROFUNDIDADE NA FECUNDIDADE DE
estmulos de maneira similar. DYSIDEA JANIAE (DICTYOCERATIDA,
Palavras-chaves: EEG quantitativo, Meditao e DEMOSPONGIAE)
Relaxamento, Msica
******************************************************************* Autor(es): BRUNO CAJADO ALMEIDA GOUVEIA, EMILIO
******************************************* LANNA
Resumo: A esponja (filo Porifera) Dysidea janiae vive em
rea: CINCIAS BIOLGICAS - BIOLOGIA GERAL simbiose obrigatria com a alga calcria endozoica Jania
adhaerens, uma das esponjas mais abundantes na Bahia de
TRABALHO: CONCEPES DE PROFESSORES Todos os Santos (Salvador, Bahia). Todavia, aspectos bsicos
DO ENSINO MDIO DE ESCOLAS PBLICAS de sua biologia reprodutiva, considerados fundamentais
para se compreender o recrutamento e a dinmica
SOBRE A ORIGEM EVOLUTIVA DAS populacional de cada espcie, permanecem desconhecidos.
MITOCNDRIAS Por isso, ns conduzimos um estudo de mais de dois
anos ( Junho 2013 at Dezembro 2015) para descrever a
Autor(es): TALITA PEREIRA GOMES, CHARBEL EL-HANI gametognese e a embriognese desta espcie e analisar
a influncia dos talos algceos no seu sucesso reprodutivo.
Resumo: A origem das mitocndrias um dos eventos Coletamos dez amostras por ms e analisamo-las usando
chave na histria da vida, sendo hoje largamente aceito mtodos histolgicos para descrio e quantificao dos
que mitocndrias tm uma origem evolutiva nica, a partir elementos reprodutivos. Para investigar a influncia do
de endossimbiose com bactrias que viviam dentro de ambiente no ciclo reprodutivo, analisamos a relao de
clulas hospedeiras, na linhagem dos eucariotos. Outro quatro fatores ambientais distintos com a densidade dos
consenso na comunidade cientfica a respeito da origem elementos reprodutivos mediante a utilizao de modelos
evolutiva das mitocndrias que elas se originaram das generalizados lineares (GLM) e a metodologia de seleo de
Alfaproteobactrias. Permanece um objeto de debate modelos. Dysidea janiae era vivpara e gonocrica com um
quando esse evento evolutivo ocorreu e de qual grupo contnuo, porm pequeno, esforo reprodutivo ao longo
entre as Alfaproteobactrias, exatamente, as mitocndrias do ano. Espermatognese e ovognese foram assincrnicas
se originaram. H diversas hipteses na literatura sobre qual entre indivduos, com diferentes coortes coocorrendo
seria o grupo-irmo das mitocndrias entre a diversidade em indivduos masculinos e femininos. A maturao dos
atual de Alfaproteobactrias. Em 2015, propusemos uma espermatozoides tambm foi assincrnica dentro dos cistos
nova hiptese sobre a origem evolutiva das mitocndrias, espermticos, ocorrendo ao menos duas fases ao mesmo
sustentando que o grupo-irmo das mitocndrias tempo no mesmo cisto. Uma camada de clulas nutridoras
o clado Alphaproteobacteria com exceo da ordem apareceu no comeo da maturao dos ovcitos e perdurou
Rickettsiales, que divergiu das demais alfaproteobactrias at a fase embrionria. Inicialmente essas clulas formaram
em tempos evolutivos mais remotos. Este estudo empregou uma monocamada, mas ns observamos um aumento no
uma metodologia ainda no usada nos estudos da nmero de clulas at o embrio juvenil. As clivagens so
origem evolutiva das mitocndrias, utilizando anlises de caticas, gerando clulas com diferentes tamanhos sem um
modularidade de redes de sequncias proteicas. Neste padro claro de distribuio dentro do elemento. At a fase
projeto, damos continuidade aos nossos estudos sobre a embrionria tardia havia um decrscimo no nmero das
origem evolutiva de mitocndrias, estendendo o conjunto camadas de clulas nutridoras e um aumento do tamanho
de protenas submetido a anlises. Trata-se do mesmo do elemento reprodutivo. O desenvolvimento embrionrio
conjunto de protenas investigada por Wang e Wu (2015), se encaminhou larva slida do tipo parenquimela, em

Congresso da UFBA 2017 | Caderno de resumos 75


formato de bala com trs camadas celulares distintas. divergncia dentro e entre espcies foram computadas no
Nos modelos matemticos para explicar a dinmica da MEGA 5.0. Os representantes de H. cornuta e H. stellulifera
reproduo da espcie, o fator ambiental que teve a maior foram encontrados nos estados da Bahia, Piau e Rio de
importncia relativa para os ovcitos foi a precipitao de Janeiro. At o momento foram geradas 20 sequncias de
um ms atrs, nos embries foi a temperatura (0, 2 e 3 meses qualidade satisfatria para a regio ITS1, as quais foram
anteriores), na fecundidade foi a temperatura (2 meses editadas, analisadas e alinhadas manualmente. Estas
ESTUDANTE PIBIC

anteriores) e, finalmente, nos cistos espermticos a clorofila sequncias so referentes a exemplares coletados na costa
(2 meses anteriores) e a precipitao (1 ms anterior). A brasileira. Destas, foram utilizadas treze referentes a amostras
assincronia dentro dos cistos espermticos incomum em de H. cornuta dos estados da Bahia e Rio de Janeiro; quatro
Demospongiae, porm, o seu tamanho e os elementos referentes a H. stellulifera coletadas nos estados da Bahia e
femininos so similares s das outras Dictyoceratida. Apesar Piau. Sequncias brasileiras de H. cornuta e H. stellulifera
do esforo reprodutivo ter sido contnuo, cada elemento foram diferentes entre si em 3pb (3,41%), formando um
reprodutivo teve sua dinmica melhor respondida por grupo irmo com suporte moderado (84%). Das 13 amostras
distintos fatores ambientais, sugerindo a relao direta do identificadas como Hypnea cornuta, duas sequncias do Rio
ambiente com a sua dinmica reprodutiva. de Janeiro diferiram em 2 pares de base (2,27%) das demais.
As sequncias africanas de H. valentiae includas nas anlises
Palavras-chaves: Porfera, Reproduo, Simbiose mostraram uma variao interespecfica de 6 a 14pb (6,82%
******************************************************************* a 15,91%) quando comparadas com as sequncias brasileiras
******************************************* do complexo H. cornuta. At o fim do estudo, novas
sequncias de exemplares da costa brasileira, bem como de
outros pases, incluindo o marcador COI-5P sero obtidas e
rea: CINCIAS BIOLGICAS - BIOLOGIA GERAL includas nas anlises a fim de se averiguar e discutir melhor
TRABALHO: ESTUDOS MOLECULARES os nveis de variao intra e interespecfica. Espera-se que a
informao contida nessas sequncias possa gerar resultados
DO COMPLEXO HYPNEA CORNUTA relevantes que permitiro uma maior compreenso das
(RHODOPHYTA) NO LITORAL BRASILEIRO relaes entre os txons do complexo H. cornuta.
Palavras-chaves: Biossistemtica, Estudos Moleculares,
Autor(es): ADRIELE LEITE COSTA, ALESSANDRA SELBACH Taxonomia
SCHNADELBACH, JOS MARCOS DE CASTRO NUNES,
PRISCILA BARRETO DE JESUS *******************************************************************
*******************************************
Resumo: O gnero Hypnea foi estabelecido por J.V.
Lamouroux em 1813, sendo amplamente distribudo nos
mares tropicais e subtropicais. Atualmente, so referidas rea: CINCIAS BIOLGICAS - BIOLOGIA GERAL
66 espcies vlidas de Hypnea, sendo doze para o Brasil. O TRABALHO: IMPLEMENTAO DE
gnero representa uma fonte de problemas taxonmicos,
provavelmente por tratar-se de um grupo de diferenciao PROTOCOLO DE DETECO DOS
recente, e a combinao de ferramentas (morfolgicas e HEMOPARASITOS BABESIA SPP E
moleculares) tem sido extremamente til para o estudo de
complexos taxonmicos. Em sua descrio original, Hypnea ANAPLASMA MARGINALE PELA TCNICA DE
cornuta foi diferenciada em duas variedades morfolgicas: a ESFREGAO SANGUNEO
variedade cornuta, e a variedade stellulifera. Posteriormente,
estudos realizados com o marcador plastidial rbcL revelaram Autor(es): IGOR LEONARDO JESUS GENIPAPEIRO, HAYALA
divergncia gentica significativa, que resultaram na elevao CAROLINE SILVA FERREIRA GOMES, SARAH DA SILVA
do status taxonmico das duas variedades ao rank de espcie. SANTOS, FABOLA TEXEIRA ANDRADE, PATRCIA CHAVES
Estudos filogenticos incluindo exemplares destas duas SANTANA, TEREZA BERNADETE MATA DE BRITTO MOREIRA,
espcies coletados ao longo do litoral do Brasil revelaram EPAMINONDAS DO PATROCNIO, CRISTIANE DE JESUS
o agrupamento destas em um mesmo clado, indicando BARBOSA, JORGE RAIMUNDO LINS RIBAS, LUCIANA VEIGA
que indivduos brasileiros seriam mais relacionados entre BARBOSA
si do que com representantes da mesma espcie coletados
em outros pases, formando um complexo de espcies. Resumo: A babesiose e a anaplasmose (Tristeza Parasitria
Com a finalidade de analisar as relaes entre as espcies Bovina TPB) so doenas amplamente disseminadas nas
do complexo H. cornuta e detectar a possvel ocorrncia Amricas, sendo de grande importncia econmica. Tanto
de fluxo gnico entre os exemplares coletados no litoral a sua forma aguda quanto a subclnica conduz a um baixo
brasileiro, o presente estudo visa analisar dois marcadores nvel de produo animal, com perdas econmicas que
com alta taxa de substituio nucleotdica de diferentes podem chegar 3,14 bilhes de dlares. A Babesia bovis
compartimentos celulares: o mitocondrial COI-5P e o nuclear e a B. bigemina, agentes etiolgicos da babesiose, so
ITS1. A amostragem foi realizada ao longo de toda a extenso protozorios eucariticos piriformes e de ciclo evolutivo
da costa brasileira e todas os exemplares foram analisados heteroxeno, isto , possuem hospedeiro definitivo (onde
morfologicamente. Segmentos dos pices foram separados podem apresentar as formas de esporozotos, trofozotos,
do talo, dissecados utilizando slica gel e armazenados para merozotos e gametcitos) e intermedirio (apresentando-se
as anlises moleculares. Para obteno do DNA extrado foi nas formas de gametcitos, gametas, zigoto, esporocinetos
utilizado o protocolo CTAB modificado. O DNA extrado e e esporozotos). Neste caso, o carrapato Rhipicephalus
os produtos da reao de PCR foram visualizados atravs (Boophilus) microplus seu principal vetor. Considerando
de eletroforese em gel de agarose. Os gis foram corados o agente etiolgico da anaplasmose, o agente responsvel
com GelRed, e visualizados em transluminador UV. Os pela doena uma bactria do gnero Rickettsia, que
produtos de PCR foram purificados com isoprapanol, e parasita as mesmas clulas sanguneas que a Babesia sp, as
posteriormente enviados para sequenciamento na Fundao hemcias, causando intensa destruio eritroctica em seus
Oswaldo Cruz (Fiocruz). rvores de agrupamento foram hospedeiros. Este trabalho teve por objetivos demonstrar a
construdas utilizando o programa MEGA 5.0 utilizando o eficincia e a importncia da microscopia ptica na deteco
algortimo de Neighbor-Joining (NJ) com base no modelo destes hemoparasitos, a partir da anlise citolgica de
Kimura 2-parmetros com 2.000 rplicas de bootstrap. esfregaos sanguneos de amostras de 530 bovinos oriundos
Para acessar o nvel de variao dos dados, estimativas de do sul da Bahia coletadas em quatro fazendas desta regio.

76 Congresso da UFBA 2017 | Caderno de resumos


As amostras foram coletadas e utilizadas para preparao de lipdeos totais, pde-se observar que as sementes das
de esfregaos considerando trs repeties por amostra duas cultivares estudadas apresentaram comportamento
(triplicata), perfazendo um total de 1590 lminas. O mtodo semelhante quanto degradao destes lipdeos ao longo
de preparo das lminas foi feito pela tcnica tradicional onde do perodo de armazenamento em todas as condies
uma pequena gota de sangue foi colocada sobre a lmina estudadas. A anlise do ndice de acidez revelou que apesar
principal e arrastada com a ajuda de uma lmina extensora. de existirem diferenas significativas entre as cultivares

ESTUDANTE PIBIC
Aps secagem dos esfregaos, as lminas foram coradas pelo em uma mesma condio de armazenamento, as mesmas
Mtodo Pantico, que faz uso de trs corantes distintos e foram capazes de manter a qualidade do leo extrado
consecutivos, a saber: triarilmetano (0,1%), xantenos (0,1%) das duas cultivares avaliadas, mantendo o produto dentro
e tiazina (0,1%). Foi detectada a presena Babesia sp em das condies exigidas para sua comercializao no
3.39% das amostras analisadas, porm, no foi identificada mercado internacional. Foi verificada uma tendncia geral
a ocorrncia do hemoparasita A. marginale. Embora ao aumento no teor de perxidos no leo para as duas
este ltimo hemoparasito no tenha sido observado nos cultivares estudadas (Nordestina e Paraguau) em todas as
esfregaos sanguneos, foi identificada em uma das amostras condies de armazenamento, no entanto, na condio
a presena do Trypanossoma vivax, um hemoparasita que, de armazenamento UC esse aumento no foi significativo
at o momento, no haviam relatos de sua ocorrncia no para ambas as cultivares. Concluso: As cultivares estudadas
estado da Bahia, apenas no Par Paraba, Minas Gerais, apresentaram comportamento distinto na maioria das
Mato Grosso, Mato Grosso do Sul e em Pernambuco. Este condies de armazenamento para os parmetros analisados,
hemoparasita tem levado a grandes perdas econmicas este fato evidencia as particularidades de cada cultivar e
nestes estados, o que leva a concluir, a partir desse estudo, demonstra os desafios encontrados pelos agricultores,
a eficincia e a importncia do uso da tcnica citolgica de que necessitam realizar o armazenamento de diferentes
anlise de esfregaos sanguneos para a deteco diferentes cultivares em uma mesma condio. No entanto, pode-se
hemoparasitas que acometem o rebanho bovino. afirmar que a condio onde houve controle de umidade
(UC) foi a mais efetiva no controle da qualidade do leo.
Palavras-chaves: Hemoparasitas, Microscopia tica, Anlise
Citolgica Palavras-chaves: BRS Nordestina, BRS Paraguau, lipdeos
totais
*******************************************************************
******************************************* *******************************************************************
*******************************************
rea: CINCIAS BIOLGICAS - BIOQUMICA
TRABALHO: AVALIAO DA QUALIDADE rea: CINCIAS BIOLGICAS - BIOQUMICA
DO LEO DE DUAS CULTIVARES DE TRABALHO: CARACTERIZAO
RICINUS COMUNNIS L. DURANTE O FISIOLGICA DE SEMENTES DE
ARMAZENAMENTO ARABIDOPSIS THALIANA QUE
SUPEREXPRESSAM GENES QUE CODIFICAM
Autor(es): LAIZO SILVA, SABRINA FERREIRA DE SANTANA, DUAS PROTENAS HEAT-SHOCK ORIUNDAS
THIAGO SANTOS, ANA CAROLINA VALENTE SANTOS CRUZ
DE ARAJO, Paulo Roberto Ribeiro, DANIELE TAKAHASHI DA ESPCIE RICINUS COMMUNIS
BERNAL, RENATO D. DE CASTRO, LUZIMAR GONZAGA
FERNANDEZ, MARTA BRUNO LOUREIRO Autor(es): ROBERTA SERRA, JEFFERSON SODRE MENESES,
CRISTIANE DANTAS BRITO, VALDIR NETO, SILVIA SANTOS,
Resumo: O leo extrado das sementes o principal produto DANIELE TAKAHASHI BERNAL, MARTA BRUNO LOUREIRO,
da mamoneira, sendo assim, estudar e conhecer suas RENATO D. DE CASTRO, LUZIMAR GONZAGA FERNANDEZ,
caractersticas de fundamental importncia para a indstria PAULO ROBERTO RIBEIRO
oleoqumica, pois o mesmo pode ser utilizado em vrios
produtos tais como leos lubrificantes, tintas e vernizes, Resumo: A espcie modelo Arabdopsis thaliana vem sendo
anilinas, desinfetantes, corantes e etc. O leo composto amplamente utilizada em vrios locais do mundo, por
por triacilglicerdeos, e cerca de 90% da sua constituio ser uma espcie simples de ser cultivada e por apresentar
de cido ricinolico e ricinolena. Durante o armazenamento facilidade aos ensaios e experimentos. Apresenta um perodo
de sementes oleaginosas vrios fatores podem interferir na de crescimento at a produo das sementes que dura em
qualidade do leo, portanto compreender estes mecanismos torno de 90 a 120 dias. As protenas de choque trmico
de fundamental importncia para a manuteno da desempenham um papel fundamental para o funcionamento
qualidade do mesmo. Objetivo: Avaliar a qualidade do correto das clulas vegetais, em especial em condies de
leo extrado de sementes de duas cultivares de mamona estresse. O objetivo principal deste estudo foi caracterizar
(BRS Nordestina e BRS Paraguau) armazenadas em quatro o comportamento fisiolgico de sementes de A. thaliana
condies distintas de temperatura e umidade durante (planta modelo) que apresentam superexpresso de genes
dezoito meses. Materiais e Mtodos: As sementes foram que codificam duas protenas heat-shock oriundas da
armazenadas nas seguintes condies: 1) Umidade relativa espcie R. communis. O trabalho desenvolvido baseou-se
e Temperatura Controladas (UTC), 2) Umidade Controlada no crescimento de 6 linhagens de A. thaliana transgnicas,
(UC), 3) Temperatura Controlada (TC) e 4) Umidade e superexpressando protenas de choque trmico e uma
Temperatura no Controladas (UTSC). Trimestralmente linhagem do tipo selvagem (Col- 0). As plantas foram
foram realizadas avaliaes da qualidade do leo, para tal submetidas, durante o crescimento, a um fotoperodo
foram analisados os seguintes parmetros: determinao de 16h/8h e temperatura de 22C/16C, respectivamente.
teor de gua (%), quantificao de lipdeos totais (%) e A dormncia das sementes foi removida mediante um
caracterizao de lipdeos totais pela determinao do tratamento no qual as sementes eram colocadas em placa de
ndice de acidez (IA) e ndice de perxidos (IP). Resultados: Petri forradas com papel de germinao, umedecidas com
De modo geral as condies UC, UTSC e UTC mantiveram gua e alocadas dentro de uma geladeira 4C por 72 horas.
o baixo teor de gua das sementes de mamona das duas Posteriormente, as placas de Petri eram transferidas para
cultivares estudadas, o que de grande importncia para cmaras de germinao onde ficavam em torno de 2 dias
a manuteno da qualidade das mesmas. Quanto ao teor at as sementes comearem a germinar e por mais 3 dias

Congresso da UFBA 2017 | Caderno de resumos 77


at as plntulas terem um tamanho propcio (cotildones induzem a liberao de fatores neurotrficos.O objetivo
completamente abertos) para transferncia. Essa se dava do presente estudo foi investigar a atividade moduladora
para copos descartveis de 200 mL (6 por bandeja) com de clulas gliais de ratos infectados com taquizotos Nc, na
vermiculita (substrato mineral bastante aerado). As plantas induo de diferenciao neuronal. A metodologia consistiu
eram molhadas com 60 mL soluo nutritiva 3x por semana na realizao de culturas primrias de clulas gliais de ratos
ou com gua destilada nos demais dias. Observou-se que Wistar, sob controle de condies, estimuladas pelo IFN-,
ESTUDANTE PIBIC

esse processo para crescimento no estava funcionando, infectadas por Nc e por estimulao com IFN- e infeco
uma vez que mesmo depois de repetir o experimento por por Nc. Cada meio condicionado pelo tratamento respectivo
algumas vezes era observado a morte das plantas aps 15 foi utilizado para cultivar neurnios, em co-culturas com
ou 20 de serem transferidas para o copo. Nesse sentido, glia durante 24 horas. Posteriormente, foram avaliadas por
algumas hipteses foram levantadas: 1) o substrato poderia imunocitoqumica astrocitos e perfis fenotpicos neuronais,
no ser adequado ou 2) a soluo nutritiva no estava de marcados respectivamente com GFAP e -III-tubulina,
acordo com as necessidades das plantas. Dessa forma novas tambm foi avaliada a atividade das desidrogenases
alternativas para o crescimento de Arabdopsis thaliana mitocondrias, por meio do ensaio MTT, enquanto a
foram buscadas, como por exemplo uso de outros tipos de expresso dos fatores neurotrficos NGF, BDNF, GDNF,
substratos (terra vegetal, vermiculita fina, vermiculita grossa, NTF4 e O gene da Tirosina Cinase 2 (NTRK2) do Receptor
areia e solo coletado no estacionamento do Instituto de Neurotrfico, foram avaliados por qRT-PCR. os resultados
Cincias da Sade-UFBA). A comparao dos diferentes apresentaram astrogliose em todas as condies de culturas
substratos mostrou que o substrato em que a Arabdopsis primrias, quando comparados ao grupo controle e aumento
thaliana apresentou o melhor crescimento foi o solo da atividade da desidrogenasa mitocondrial em clulas
coletado no estacionamento do Instituto de Cincias da infectadas por Nc. A infeco das clulas gliais tambm
Sade-UFBA. Alm disso, passou-se a desinfestar as sementes induziu a expresso do fator de crescimento do nervo (NGF)
numa soluo contendo 800 L de gua destilada e 200 L e a expresso reduzida do BNDF. A infeco promoveu
de hipoclorito de sdio comercial. Aps desinfestao as a diferenciao neuronal e a expresso do gene NTRK2
sementes foram colocadas em placas de Peri contendo meio induzida por meios condicionados nas culturas co neurnio-
MS (1 mg/mL) e armazenadas dentro de uma geladeira a glia. Esses achados podem justificar a modulao glial e
4C por 72 horas. Por fim, a soluo nutritiva foi reajustada proteo neuronal quando o SNC infectado por parasitas
seguindo os padres das solues usadas em estudos mais
recentes, e a rega sendo efetuada 2 vezes na semana com Palavras-chaves: glia, neuroinflamao, neuroproteo
80 mL da soluo nutritiva e nos outros dias com 5 mL de *******************************************************************
gua por cada copo 2 vezes ao dia. Com esses ajustes as *******************************************
plantas esto crescendo de forma mais uniforme e vigorosa,
inclusive as mesmas j esto em perodo de florao. Assim
esperasse que a coleta das sementes seja realizada entre final rea: CINCIAS BIOLGICAS - BIOQUMICA
do ms de agosto e inicio do ms de setembro e que a partir TRABALHO: PRODUO DE LINHAS DE
desse ponto seja feita a fenotipagem da germinao dessas
sementes em diferentes temperaturas. RICINUS COMMUNIS RESISTENTES/
Palavras-chaves: Arabdopsis thaliana, germinao,
TOLERANTES A ESTRESSES ABITICOS
protenas de choque trmico POR MEIO DE TRANSFORMAO ESTVEL
******************************************************************* MEDIADA POR AGROBACTERIUM
*******************************************
TUMEFACIENS
rea: CINCIAS BIOLGICAS - BIOQUMICA Autor(es): DANILO BATISTA, CRISTIANE DANTAS BRITO,
TRABALHO: INFECO DE N. CANINUM VALDIR NETO, SILVIA SANTOS, DANIELE TAKAHASHI
BERNAL, MARTA BRUNO LOUREIRO, LUZIMAR GONZAGA
NO TECIDO NERVOSO INDUZ A GLIOSE E FERNANDEZ, RENATO D. DE CASTRO, PAULO ROBERTO
PROMOVE A DIFERENCIAO NEURONAL RIBEIRO

PELAS EXPRESSES DE FATORES Resumo: A mamona (Ricinus communis L.) uma cultura
importante em todo o mundo, sendo principalmente
NEUROTROFICOS cultivada em regies tropicais e subtropicais. O leo
extrado de suas sementes usado em uma variedade de
Autor(es): DEIVISON SILVA ARGOLO, MARIA SOCORRO setores incluindo as indstrias txtil, de papel, de borracha,
GRANGEIRO, MARIA DE FTIMA DIAS COSTA, RAMON DOS de plsticos, alm de possuir aplicaes farmacuticas
SANTOS EL-BACH, SILVIA LIMA COSTA, VICTOR DIOGENES devido sua composio qumica nica. Condies
AMARAL DA SILVA, CLEIDE DOS SANTOS SOUZA, LIVIA drsticas de temperatura e disponibilidade de gua geram
BACELAR JESUS, DIGO OLIVEIRA, NILMARA BORGES DE fatores de estresses que prejudicam desde a germinao
SOUSA de sementes, at a produtividade dos cultivares. Em
situaes de estresse as plantas ativam mecanismos de
Resumo: As clulas gliais so responsveis por vrios
sntese de protenas chamadas de Protenas de Choque
papis que garantem a homeostase no sistema nervoso
Trmico, que so responsveis pelo correto dobramento de
central (SNC), incluindo a sua imunoproteo. Neospora
outras protenas e pela preveno da agregao protica.
caninum (Nc), um protozorio intracelular que possui
A engenharia gentica tem se tornado uma ferramenta
tropismo especial para o tecido nervoso tem sido usado
muito importante para a melhoria de cultivares de R.
como modelo de neuroinflamao, com foco especial na
communis, no processo de resistncia aos estresses biticos
anlise dos aspectos de interao glia-neurnio. Dados
e abiticos. O objetivo deste trabalho foi produzir sementes
anteriores mostram que as culturas primrias de clulas
de R. communis tolerantes a estresses abiticos por meio
gliais de rato infectadas com taquitodos Nc liberam IL-10
de transformao estvel mediada por Agrobacterium
e apresentam modificaes morfofuncionais, conhecidas
tumefaciens. Foram pesquisados protocolos de produo
como gliosis que modula a resposta inflamatria e preserva
de linhagens transgnicas com um sistema de regenerao
os neurnios. Estudos tambm indicam que os parasitas,
in vitro eficiente, rpido, reprodutvel e aplicvel a uma
infectando o tecido nervoso na tentativa de sobreviver,

78 Congresso da UFBA 2017 | Caderno de resumos


ampla gama de gentipos. Inicialmente, sementes maduras foram os eixos cultivados com TDZ, apresentando-se
de R.communis (cv. IAC80) foram desinfestadas com necrosados no ltimo dia de co-cultivo. J os embries
NaClO (0,5% de cloro ativo). Os eixos embrionrios foram cultivados com a citocinina BA (0,1 mg.L-1) apresentaram
removidos e cultivados em meio de cultura Murashige um maior nmero de regenerantes com aparncia saudvel
e Skoog MS, suplementado com a citocinina BA - N6- e sobreviveram at a segunda etapa ciclo de seleo. Com
benziladenina (0,1 mg.L-1) durante sete dias 26C, com base nesses resultados, os eixos embrionrios passaram a ser

ESTUDANTE PIBIC
fotoperodo 16/8h e pH ajustado para 5.8. Em paralelo, cultivados em meio MS, suplementado com BA (0,1 mg.L-
realizou-se a inoculao das linhagens de Agrobacterium 1). Diante do exposto, ainda no foi possvel regenerar a
tumefaciens que contm genes que codificam as protenas planta inteira de R. Communis e estabelecer um protocolo
de choque trmico oriundas da espcie R. communis completo para transformao estvel da espcie, pois. Alm
em meio LB slido. As bactrias recm cultivadas, foram disso, os resultados obtidos foram diferentes do protocolo
inoculadas em meio LB liquido e tiveram seu crescimento modelo de transformao gentica estvel. Evidenciamos
exponencial monitorado o at atingirem a densidade ptica que os eixos embrionrios transformados foram capazes de
de 580-600 nm. Aps essa etapa de crescimento, a cultura se dividir e formar partes areas, indicando que os mesmos
lquida foi centrifugada e ressuspendida em meio MS lquido. poderiam dar origem a regenerantes transformados. Nessa
No stimo dia de cultivo, os eixos embrionrios sofreram um investigao foi possvel padronizar os melhores mtodos
dano mecnico na regio meristemtica, que se distingue e condies para de desinfestao das sementes e eixos
pelo seu inchao caracterstico, e submersos na soluo embrionrios, suplementao com a citocinina adequada,
bacteriana. Para melhorar a eficincia e garantir a penetrao controle do pH do meio de cultura e fotoperodo, que so
do vetor nos tecidos alvos, foi adicionado um composto fatores importantes no processo de regenerao dos tecidos
fenlico, acetoseringona (200 mg.L-1), e os embries foram transformados.
submetidos ao tratamento vcuo. Aps a transformao,
os eixos embrionrios foram co-cultivados em meio de Palavras-chaves: Eixos embrionrios, Engenharia gentica,
cultura com citocininas durante vinte dias, inicialmente Proteinas de choque trmico
suplementados por dez dias com BA - N6-benziladenina (0,1 *******************************************************************
mg.L-1)) e depois mais dez dias com TDZ Thidiazuron (0,5 *******************************************
mg.L-1) para induo do desenvolvimento das partes areas.
Para determinar quais explantes estavam transformados,
os mesmos foram submetidos a trs ciclos de seleo rea: CINCIAS BIOLGICAS - BOTNICA
(quinze dias cada ciclo), com o antibitico canamicina nas TRABALHO: A RESOLUO DO
concentraes (20, 40 e 60 mg.L-1), cuja A. tumefaciens
contm um gene de resistncia. Entretanto os explantes POSICIONAMENTO FILOGENTICO
ficaram necrosados no quinto dia do segundo ciclo de DE DERMATOPHYLLUM REVELA A
seleo, com canamicina (40 mg.L-1). Devido dificuldade
na desinfestao das sementes, foram testados diversos EVOLUO NICA DE ALCALOIDES
protocolos, desde o uso de solues do cloreto de mercrio QUINOLIZIDNICOS EM LEGUMINOSAS
seguida de lcool etlico 70%, soluo de hipoclorito
de sdio a 0,5%. Porm o protocolo de desinfestao foi Autor(es): LUCAS QUARESMA, DOMINGOS CARDOSO
ajustado para lavagem com soluo de tween 20 (1 gota
tween a cada 100 mL), por 5 minutos, seguido de soluo de Resumo: Metablitos secundrios alcaloides surgiram
hipoclorito de sdio a 0,5% por 3 minutos, depois lavagem independentemente em diversas famlias de angiospermas,
com gua destilada. Outro aspecto analisado durante a podendo ter funo contra herbivoria, defesa contra
remoo dos eixos embrionrios, foi a esterilizao com a patgenos e outras plantas competidoras, alm de
soluo de etanol 70% durante 2 minutos. Observou-se que atrarem insetos polinizadores, dispersores de sementes
essa soluo estava desidratando os tecidos e prejudicando e bactrias que desempenham papel fundamental na
o seu desenvolvimento. No intuito de analisar a influncia fixao do nitrognio. Nas Leguminosae, os alcaloides
desta soluo e estabelecer o tamanho ideal dos embries quinolizidnicos esto entre os principais tipos de alcaloides,
para na transformao gentica, foram testadas algumas sendo importantes tambm pelas propriedades txicas e
condies de cultivos. Inicialmente, eixos embrionrios farmacolgicas. No entanto, a falta de resoluo filogentica
foram desinfestados com soluo de etanol 70%, enquanto nos ramos profundos das leguminosas Papilionoideae no
outros foram lavados somente com gua estril. Alm nos permite compreender como se deu a origem e evoluo
disso, uma parte dos eixos foram cultivados em meio dessa rota metablica importante. Estudos filogenticos
suplementados com BA e outros com TDZ. Aps o perodo moleculares tm resolvido um grande clado Genistoid,
de cultivo, observou-se que os embries desinfestados onde praticamente todos os gneros acumulam alcaloides
com soluo de etanol 70% sofreram uma inibio no seu quinolizidnicos nas folhas, porm Dermatophyllum, que
desenvolvimento, em relao aos lavados com gua estril, tambm possui estes alcaloides, aparece isolado ou no
independente da suplementao com a citocinina. Sobre resolvido. Este gnero possui 5 espcies e distribuio
essa anlise, constatou-se que, os explantes que inicialmente restrita ao Sudoeste americano e regies centrais e norte
foram desinfetados com gua estril, sobreviveram at a do Mxico, predominantemente em ambientes secos
primeira etapa do ciclo de seleo, em contrapartida, os no bioma das suculentas e temperado. A taxonomia de
embries desinfestados com lcool ficaram necrosados Dermatophyllum sempre foi confundida na classificao de
durante a etapa do co-cultivo. Em relao a suplementao Sophora devido presena de frutos moniliformes e flores
com citocinas BA e TDZ, foi analisado qual o melhor indutor papilionadas com estames livres. Resolver o posicionamento
da regio meristemtica nos eixos embrionrios durante enigmtico de Dermatophyllum , portanto, chave para
o cultivo. No primeiro dia de cultura foi possvel observar entender a evoluo dos alcaloides quinolizidnicos durante
que no houve diferena no tamanho e diferenciao dos a diversificao das Papilionoideae. Este estudo procurou
meristemas. No quarto dia de cultura pode-se notar a demonstrar a hiptese de que os alcaloides quinolizidnicos
formao de gemas adventcias e um inchao na regio do no so apenas uma sinapomorfia qumica do clado
meristema nos embries cultivados com TDZ. Entretanto, Genistoid, mas de uma linhagem mais inclusiva, que
nos embries cultivados com BA, pode-se notar a envolve tambm Dermatophyllum. Para isso, reconstrumos
formao de gemas adventcias e meristema apical pouco a histria evolutiva inicial das Papilionoideae atravs da
desenvolvido. Quando os eixos passaram para o processo de primeira anlise filogentica combinada de sequncias do
transformao gentica, o menor nmero de regenerantes gene nuclear ITS/5.8S e dos genes plastidiais matK, rbcL e

Congresso da UFBA 2017 | Caderno de resumos 79


trnL intron. A anlise de parcimnia e inferncia bayesiana Japnica Maxim e Bauhinia guianensis Aubl. Abundancia de
demonstraram com alto suporte que Dermatophyllum parnquima axial ocorre em todas as espcies, porm nas
distinto de Sophora, aparecendo como grupo irmo de espcies Bauhinia rufescens Lam. e Bauhinia roxburghiana
todas as demais Genistoids. Estes resultados evidenciam, Voigt ocorre uma maior frequncia em relao as outras
portanto, a origem nica dos alcaloides quinolizidnicos em espcies. Em riqueza de vasos, destacam-se Bauhinia
leguminosas, sugerindo que estes compostos podem ter sido guianensis Aubl., Bauhinia Japnica Maxim, Bauhinia
ESTUDANTE PIBIC

uma inovao-chave para explicar a diversidade espetacular aculeata L e Bahunia rufescens Lam. Essas espcies possuem
das mais de 2400 espcies e 95 gneros atualmente abundancias aproximadas. Sendo que Bauhinia aculeata
conhecidos na irradiao das Genistoids. L e Bahunia rufescens Lam. possuem quantidade maior
de vasos mltiplos do que de vasos solitrios. No que se
Palavras-chaves: Leguminosa, Filogenia, Alcaloides refere a abundancia, largura e altura dos raios, a maioria
******************************************************************* das espcies apresentaram raios predominantemente
******************************************* unisseriados. Nas espcies Bauhinia roxburghiana Voigt,
Bauhinia variegata L., Bauhinia rufescens Lam., e Bauhinia
subrotundifolia Cav., houve uma ocorrncia maior do
rea: CINCIAS BIOLGICAS - BOTNICA que nas outras espcies de raios bisseriados. Dentre as 11
TRABALHO: ANATOMIA DO LENHO DE espcies de Bauhinia analisadas, duas se destacaram por
possurem um padro de ocorrncia diferente das demais
QUATRO ESPCIES DO GNERO BAUHINIA: espcies, Bauhinia forficata Link., e Bauhinia odoratissima
BAUHINIA RUFESCENS LAM., BAUHINIA Moric., apresentaram raios predominantemente trisseriados.
Dessa forma, as composies dos raios nas espcies aqui
ODORATISSIMA MORIC. BAUHINIA estudadas de Bauhinia possuem representatividade de raios,
ROXBURGHIANA VOIGT, BAUHINIA quando: unisseriados (43,7 %), bisseriados (37,3%), menos
comumente trisseriados (11,5%) ou tetrasseriados (4,7 %) e
SUBROTUNDIFOLIA CAV. raramente com mais de 4 clulas de largura (2,8%).

Autor(es): ANDREIA MORAES FERREIRA, CLAUDIA DIAS Palavras-chaves: Anatomia, Madeira, Bauhinia
LEME *******************************************************************
Resumo: A famlia Leguminosae de grande importncia *******************************************
econmica e nela observa-se cerca de seis tipos de variao
cambial. As espcies do gnero Bauhinia L. pertencem rea: CINCIAS BIOLGICAS - BOTNICA
tribo Cercideae, subfamlia Caesalpinioideae, famlia
Leguminosae. No Brasil ocorrem cerca de 200 espcies TRABALHO: ATTALEA KUNTH: ANLISE
nativas de Bauhinia, distribudas em trs subgneros e nove ESTRUTURAL DA LMINA FOLIAR DE
sees. Espcies de plantas do gnero Bauhinia podem
ser utilizadas na arborizao pblica e como ornamentais, ESPCIES OCORRENTES NA BAHIA PARA
a madeira de algumas espcies utilizada para lenha e FINS TAXONMICOS
carvo. Representantes de Bauhinia tambm apresentam
importncia medicinal, sendo utilizada como fitoterpicas Autor(es): ISADORA ALMEIDA MELO SANTOS, KELLY
para o tratamento de vrias enfermidades, principalmente REGINA LEITE, LAZARO BENEDITO SILVA
diabetes, processos dolorosos e infeces. Apesar de sua
considervel importncia, existe uma grande dificuldade Resumo: O gnero Attalea nativo dos Neotrpicos, sendo
de acesso s estruturas reprodutivas em algumas matas estimada a ocorrncia de cerca de 70 espcies. A delimitao
para a sua coleta, como um fator que limita a identificao entre as espcies imprecisa, devido a formao de
de espcies arbreas. Para melhorar a identificao das hbridos e casos de sinonmia. O gnero tem como centro
espcies, a anatomia de madeiras, que uma ferramenta de diversidade brasileiro, o Estado da Bahia, sendo referidas
da dendrologia, possibilita a identificao atravs de 13 espcies das 34 aceitas para o Brasil. Por ser um gnero
seu lenho, procurando conhecer o arranjo estrutural complexo so necessrios estudos anatmicos, que tm sido
dos diversos elementos que constituem o xilema. A bastante utilizados em vrios grupos para fins taxonmicos,
identificao de espcies atravs de suas madeiras baseia- sendo teis em anlises das relaes interespecficas.
se nas caractersticas anatmicas do lenho e processa-se Algumas dessas palmeiras tm status de endemismo, e
sobre uma amostra de tronco, independente de outras sofrem extrativismo vegetal, o que aumenta a importncia de
caractersticas da planta. Considerando o valor das lianas estudos que contribuam para continuidade da diversidade
e arvores deste gnero, tanto estrutural para as florestas, e preservao das espcies. O objetivo desse trabalho foi
como medicinal, este trabalho teve como objetivo descrever analisar anatomicamente a folha das espcies de Attalea que
a estrutura do lenho de 11 espcies do gnero Bauhinia: ocorrem na Bahia, a fim de compreender a organizao dos
Bauhinia odoratissima Moric., Bauhinia roxburghiana tecidos vegetais buscando fornecer e reconhecer caracteres
Voigt, Bauhinia variegata L., Bauhinia purpurea L., Bauhinia que auxiliem na delimitao taxonmica. As amostras foram
aculeata L., Bauhinia japnica Maxim, Bauhinia forficata obtidas das colees do Herbrio Radam Brasil (HRB) e
Link., Bauhinia rufescens Lam., Bauhinia Taitensis Taub., do Herbrio da Universidade Estadual de Feira de Santana
Bauhinia subrotundifolia Cav. e Bauhinia guianensis Aubl. (HUEFS). Para este trabalho foram estudadas as espcies: A.
Para a anlise microscpica foram consideradas amostras barreirensis, A. brejinhoensis, A. burretiana, A. eichleri, A.
retiradas da regio mais externa do caule, envolvendo ou exigua, A. funifera, A. humilis, A. x piassabassu, A. pindobassu,
no a casca. Sees transversais e longitudinais (tangencial e A. seabrensis e A. vitrivir. A caracterizao anatmica
radial) foram analisadas qualitativa e quantitativamente. Para foliar foi feita a partir da anlise de segmentos foliares da
este trabalho foram analisadas variaes anatmicas entre regio mediana, atravs de cortes transversais seccionados
s 11 espcies do gnero Bauhinia. Caractersticas estas que com o auxlio de micrtomo rotativo, corados com Azul
se refere principalmente quanto: ao tipo e abundancia de de Toluidina 0,05%, e Fucsina Bsica 0,05% com Azul de
parnquima axial; ao tipo, dimetro e frequncia dos vasos; Toluidina 0,05%, em seguida montadas lminas permanentes
a ocorrncia e frequncia de fibras; e aos raios variando com Entellan. Verificou-se que as folhas tm epiderme
na largura, na altura e na composio celular. As espcies unisseriada revestida por cutcula espessa e clulas de
que apresentaram maior riqueza de fibras foram Bauhinia formato retangular, o mesofilo dorsiventral e h a presena

80 Congresso da UFBA 2017 | Caderno de resumos


de parnquima aqufero na face abaxial da nervura central, 90 minutos em ambiente ex vitro, os tratamentos com 0
que pode ser encontrado inteiro ou dividido; os feixes g/L de sacarose vedados com PVC da casa de vegetao
vasculares so do tipo colateral e esto distribudos por todo apresentaram maior reduo (35,9%) de seu peso fresco por
parnquima clorofiliano. Houve variao quanto presena transpirao. As menores taxas de reduo do peso fresco
de estmatos, algumas espcies eram anfiestomticas dos tratamentos (uma mdia de 11,6%) foram observadas
(A. barreirensis e A. pindobassu) outras hipoestomticas naqueles com vedao de algodo em sala de crescimento

ESTUDANTE PIBIC
(A. burretiana, A. eichleri, A. humilis e A. seabrensis); e de para todas as concentraes de sacarose. Os tratamentos
tricomas, encontrados na face abaxial (A. pindobassu) ou em com 15 e 30 g/L de sacarose em sala de crescimento vedados
ambas (A. barreirensis, A.burretiana, A. eichleri, A. humilis, A. com algodo ou PVC apresentaram um crescimento mais
seabrensis), quanto ocorrncia de tricomas em depresses acentuado da maior raiz. Quanto ao nmero mdio de razes
ou no da epiderme, assim como de estmatos no mesmo por planta cultivada, as menores taxas foram registradas nos
nvel das demais clulas, no tamanho e formato da tratamentos com algodo na casa de vegetao em todas as
hipoderme, e tambm quanto disposio e o comprimento 3 diferentes concentraes de sacarose, no havendo muitas
dos cordes de fibra esclernquimticos, havendo tambm diferenas entre os outros tratamentos. O crescimento da
variao na distribuio dos feixes vasculares. Alguns desses maior folha foi mais robusto nos tratamentos com 15 e 30
caracteres anatmicos, como a grande quantidade de fibras, g/L de sacarose em sala de crescimento com algodo ou
de parnquima aqufero e a maior presena de estmatos na PVC. Os tratamentos com 15 g/L de sacarose em casa de
face abaxial, so vistos como evidncias para evitar a perda vegetao, vedados com PVC, apresentaram uma maior
excessiva de gua, sendo caractersticas comuns das plantas mdia de folhas por planta. Uma maior mdia do nmero de
de ambiente mais seco a submido. A partir dessas anlises brotos foi observado nos tratamentos em casa de vegetao
observou-se a formao de dois grupos de espcies, um vedados com PVC nas concentraes de 15 e 30 g/L de
deles formado por A. burretiana, A. eichleri, A. humilis e A. sacarose. Priorizando-se a menor perda de gua para o meio
seabrensis e outro com as demais espcies. e o tamanho da raiz, os tratamentos vedados com algodo
apresentaram resultados mais satisfatrios, mesmo que em
Palavras-chaves: Anatomia,Bahia, Attalea diferentes concentraes de sacarose. Estudos posteriores
******************************************************************* precisam ser feitos para verificar a sobrevivncia das plantas
******************************************* no ambiente.
Palavras-chaves: Orqudea, Cultura de tecidos vegetais
rea: CINCIAS BIOLGICAS - BOTNICA
*******************************************************************
TRABALHO: AVALIAO DO CRESCIMENTO *******************************************
FOTOAUTOTRFICO SOB DIFERENTES
OFERTAS DE SACAROSE E DIFERENTES rea: CINCIAS BIOLGICAS - BOTNICA
VEDAES EM CATTLEYA ELONGATA IN TRABALHO: BIOLOGIA REPRODUTIVA DA
VITRO EPFILA CYCLOLEJEUNEA CONVEXISTIPA
(LEJEUNEACEAE, MARCHANTIOPHYTA)
Autor(es): MOEMA CORTIZO BELLINTANI, LUCAS BARBOSA NA SERRA DA JIBIA, SANTA TERESINHA,
DE AMORIM CONCEIO, IZABELA LEONARDO RUAS
BAHIA, BRASIL.
Resumo: A espcie exclusivamente rupcola de orqudea,
Cattleya elongata, endmica da regio da Chapada Autor(es): CINTIA CARVALHO, CID JOS PASSOS BASTOS
Diamantina (BA). Processos de extrativismo e reduo de
habitat, relacionados com o alto valor ornamental desta Resumo: Com 800m de altitude, a Serra da Jibia est
planta, indicada no apndice II do CITES, levaram essa situada em uma rea de transio entre mata atlntica e
espcie ao risco de extino. Uma sada para este quadro caatinga. Estudos realizados em regies serranas do Domnio
a cultura de tecidos com micropropagao fotoautotrfica, caatinga, na Bahia, possibilitaram inferir a grande riqueza de
que tem como objetivo diminuir os gastos dentro da espcies de brifitas que fazem parte da vegetao desses
cultura de tecidos vegetais e fornecer uma multiplicao ambientes. As brifitas so plantas pequenas e avasculares
em massa de indivduos da espcie, desempenhando um que formam um grupo parafiltico composto por musgos
papel importante na transio das plantas do ambiente (Bryophyta), antceros (Anthocerotophyta) e hepticas
in vitro para o ex vitro, bem como auxiliando no processo (Marchantiophyta). Sua reproduo pode ser sexuada
de recuperao de populaes nativas. O objetivo deste (quando h formao de gametas e, posteriormente, aps
trabalho foi a criao de um protocolo de cultura in vitro a formao do zigoto, de meisporos) ou assexuada, por
para a espcie C. elongata, avaliando tipos diferentes de multiplicao vegetativa (formao de gemas, propgulos
vedao dos recipientes de cultivo, diferentes concentraes ou fragmentao talina). O presente trabalho teve como
de sacarose no meio e diferentes incidncias luminosas. objetivo analisar se o tamanho das populaes da heptica
Houve a transferncia de plantas de C. elongata do banco Cyclolejeunea convexistipa (Lehm. & Lindenb.) A. Evans
de germoplasma para meio MS, contendo gar, carvo varia de acordo com a idade da folha da forfita e qual a
ativado e diferentes concentraes de sacarose (0, 15 e 30 representatividade de reproduo sexuada e multiplicao
g/L), em recipientes vedados com algodo ou PVC, cultivadas vegetativa. A hiptese foi de que folhas velhas abrigariam
em casa de vegetao ou em sala de crescimento onde populaes maiores e com multiplicao vegetativa mais
receberam diferentes taxas de incidncias luminosas. O frequente que reproduo sexuada. As amostras foram
experimento durou 120 dias. O programa usado para o coletadas na Serra da Jiboia, municpio de Santa Teresinha,
processamento dos dados foi o SISVAR 5.3 e o teste de Bahia, em que foram demarcadas cinco parcelas de 50 50
Scott-knot foi usado para comparao das mdias. A Taxa m. Em cada parcela foram coletadas duas folhas (uma folha
de Sobrevivncia foi alta (>70%) para todos os diferentes jovem e uma folha velha) de cada cinco indivduos da famlia
tratamentos, com exceo dos tratamentos a 0 g/L de Marantaceae, as quais foram devidamente identificadas
sacarose vedados com PVC. Tubos vedados com algodo e prensadas conforme metodologia usual. A populao
apresentaram maiores taxas de contaminao. Observou- de Cyclolejeunea convexistipa foi definida por folha, ou
se mudana na colorao das folhas, variando juntamente seja, uma folha igual a uma populao. A populao em
com a concentrao de sacarose por tratamento. Aps cada folha foi quantificada sobrepondo-se uma grade

Congresso da UFBA 2017 | Caderno de resumos 81


de papel transparente subdividida em quadrculas de das placas. O delineamento experimental foi inteiramente
1cm2, e somando-se o nmero de quadrculas ocupadas casualizado, com quatro repeties de 25 sementes por
pelos gametfitos. Para cada populao foram contados: tratamento. A avaliao da germinao foi realizada
nmero de gametngios femininos e masculinos, nmero diariamente por 21 dias. Foram consideradas germinadas as
de esporfitos e nmero de ramos gemparos. Todos esses sementes que emitiram radcula com no mnimo 1 mm. Os
dados foram organizados em planilhas do Excel. Os parmetros avaliados foram germinabilidade (%G), ndice
ESTUDANTE PIBIC

resultados mostram que as populaes de C. convexistipa de velocidade de germinao (IVG) e tempo mdio de
tendem a ser maiores e mais variveis nas folhas velhas. germinao (TM). Os dados foram submetidos anlise
Quanto a ocorrncia de reproduo sexuada e multiplicao de varincia e as mdias foram comparadas pelo teste
vegetativa, apesar da presena de esporfitos (o que Tukey a 5%, utilizando o programa Sisvar. Na condio de
mostra que ocorreu fecundao), a segunda teve maior deficit hdrico, a germinao se manteve acima de 85%,
representatividade, uma vez que a quantidade de ramos no diferindo do controle (100%) at o potencial -0,6 Mpa
gemparos foi maior em relao ao nmero de esporfitos. (97%), sendo reduzida a -0,9 Mpa (6%) e inibida a -1,2 Mpa.
Tratamentos estatsticos sero posteriormente utilizados. No estresse salino, a maior porcentagem de germinao
Sendo assim, concluiu-se que o tamanho das populaes foi obtida no potencial -0,3 Mpa (88%), sendo reduzida em
varia de acordo com a idade da forfita, pois, as folhas so -0,6 Mpa (35%) e inibida a partir de -0,9 Mpa. Com relao
gradativamente colonizadas. Tambm foi possvel observar ao IVG, os valores observados para todos os potenciais ao
que, apesar dos gametngios femininos encontrados j utilizar PEG e NaCl foram significativamente inferiores ao
estarem fecundados, houve um investimento maior em observado no controle (89,5). O maior valor para IVG foi
multiplicao vegetativa devido ao alto nmero de ramos observado nas sementes embebidas em soluo de PEG -0,3
gemparos encontrados. Mpa (47,5). Para o mesmo potencial hdrico em NaCl, o IVG
foi 29,73. A partir desses resultados possvel concluir que
Palavras-chaves: Cyclolejeunea; Populao; Reproduo. as sementes de M. arenosa so mais tolerantes a condies
******************************************************************* de seca e mais sensveis a salinidade, sendo este ltimo, um
******************************************* fator mais limitante a propagao desta espcie.
Palavras-chaves: Caatinga; Deficit hdrico; Leguminosae
rea: CINCIAS BIOLGICAS - BOTNICA
*******************************************************************
TRABALHO: GERMINAO DE SEMENTES *******************************************
DE MIMOSA ARENOSA (WILLD.) POIR. SOB
DFICIT HDRICO E SALINIDADE rea: CINCIAS BIOLGICAS - BOTNICA
TRABALHO: LEVANTAMENTO FLORSTICO
Autor(es): EDVANIA DA SILVA CARVALHO, ANA CAROLINA DE MYRTACEAE NA RESTINGA DA PRAIA DO
RIBEIRO LIMA, SHEILA VITRIA RESENDE
FORTE, BAHIA, BRASIL.
Resumo: As projees sobre o impacto das mudanas
climticas no Nordeste brasileiro apontam a intensificao Autor(es): JANINE DIAS DE OLIVEIRA MELO, ALINE MARIA
de secas e da salinizao dos solos no bioma Caatinga. SOUZA STADNIK, NDIA ROQUE
Ambas as condies reduzem a gua disponvel no
ambiente, que um fator determinante para o processo de Resumo: A famlia Myrtaceae uma das famlias mais
germinao, considerada a fase crtica para o sucesso no importantes economicamente e compreende 142 gneros
estabelecimento de plntulas. Nesse contexto, pesquisas e mais de 5.500 espcies com distribuio pantropical.
sobre a tolerncia das sementes s condies de seca e No Brasil, a quarta famlia mais diversa dentre as
salinidade so necessrias para subsidiar estratgias de eudicotiledneas e est representada por 23 gneros e
propagao de plantas de valor econmico e ecolgico, cerca de 1.000 espcies, sendo que 97% so endmicas.
em regies com condies ambientais desfavorveis ao Myrtaceae est distribuda em todas as fitofisionomias
desenvolvimento vegetal. Este trabalho teve como objetivo, brasileiras, entretanto, a dominante arbrea nas formaes
investigar a tolerncia das sementes da espcie Mimosa vegetacionais do Domnio Atlntico, um importante centro
arenosa a condies de deficit hdrico e salinidade. Essa de megadiversidade e endemismo do planeta. Do ponto
espcie uma leguminosa nativa da Amrica do Sul, de de vista biogeogrfico, a Mata Atlntica do Nordeste
porte arbustivo arbreo, com ampla distribuio na Caatinga. abriga quatro dos cinco centros de endemismo do
Popularmente conhecida como jurema branca e possui bioma. Por sua vez, o litoral norte da Bahia compreende
potencial madeireiro, forrageiro, medicinal e ornamental. a maior rea florestada do corredor da Mata Atlntica do
As sementes foram obtidas a partir de frutos coletados no Nordeste e, apesar da grande importncia ecolgica, a
municpio de Santa Terezinha (BA), em junho de 2016. Aps rea vem sofrendo aes antrpicas principalmente pela
o beneficiamento, as sementes foram acondicionadas em especulao hoteleira e imobiliria, associados aos escassos
potes de vidros temperatura ambiente (22-25C) por 12 levantamentos florsticos. Sendo assim, o objetivo do
meses, at a conduo do experimento. As sementes foram trabalho foi realizar um levantamento florstico para a famlia
escarificadas com bisturi na regio oposta ao hilo e em Myrtaceae na Praia do Forte, um dos principais distritos em
seguida, desinfestadas em hipoclorito de sdio (NaClO), a desenvolvimento urbano do municpio de Mata de So Joo,
2% por 10 minutos, e lavadas trs vezes em gua destilada. O litoral norte da Bahia. Foram feitas quatro viagens ao campo,
deficit hdrico foi simulado com solues de polietilenoglicol sendo que as coletas foram realizadas atravs de caminhadas
(PEG 6000) e o estresse salino com solues de NaCl. Os aleatrias, objetivando percorrer toda a rea de estudo.
potenciais hdricos testados foram: 0,0; 0,3; 0,6; 0,9 e 1,2 Foram analisadas as colees dos herbrios ALCB e HRB e at
Mpa. Ambas as solues foram esterilizadas quimicamente o momento, foram encontrados sete gneros e 16 espcies
com 0,0005% de NaClO, para inibir o crescimento de de Myrtaceae para a rea de estudo: Calycolpus legrandii
microorganismos nas sementes. A semeadura foi realizada Mattos, Campomanesia dichotoma (O.Berg) Mattos, Eugenia
em placas de Petri, sobre duas folhas de papel germitest, astringens Cambess., Eugenia candolleana DC., Eugenia
umedecidas com 7 mL de soluo e mantidas em cmaras hirta O.Berg, Eugenia punicifolia (Kunth) DC., Malierea
de germinao sob temperatura de 30C, e fotoperodo de regeliana O.Berg, Myrcia bergiana O.Berg, Myrcia guianensis
16h/luz. Para manter o potencial hdrico constante, a cada (Aubl.) DC., Myrcia hirtiflora DC., Myrcia splendens (Sw.)
2 dias foi efetuada a troca do papel germitest e da soluo DC., Myrcia multiflora (Lam.) DC., Myrcia neuwiediana (O.

82 Congresso da UFBA 2017 | Caderno de resumos


Berg) E. Lucas & C. E. Wilson, Myrcia ramuliflora (O.Berg) *******************************************************************
N.Silveira, Myrciaria floribunda (H.West ex Willd.) O.Berg e *******************************************
Psidium oligospermum Mart. ex DC. Destaca-se o primeiro
registro de M. multiflora e M. regeliana para o municpio
rea: CINCIAS BIOLGICAS - BOTNICA
de Mata de So Joo e de E. candolleana, M. multiflora e P.
oligospermum para a fitofisionomia de restinga. Como parte TRABALHO: SISTEMTICA MOLECULAR

ESTUDANTE PIBIC
dos resultados, sero confeccionadas chave de identificao
especfica e ilustraes.
DE AMPHIMAS, UM RAMO AFRICANO
ENIGMTICO NA RVORE FILOGENTICA
Palavras-chaves: Inventrio, litoral norte da Bahia, Mata
Atlntica DE PAPILIONOIDEAE (LEGUMINOSAE)
*******************************************************************
Autor(es): DANILO SANTOS PORTELLA, DOMINGOS
*******************************************
CARDOSO

rea: CINCIAS BIOLGICAS - BOTNICA Resumo: Os dados moleculares so de grande


importncia para compreender classificao e iluminar
TRABALHO: MUSGOS (BRYOPHYTA) DE a histria evolutiva, padres biogeogrficos e processos
AMBIENTES SERRANOS DA CAATINGA NA de diversificao, especialmente em linhagens
filogeneticamente enigmticas ou recalcitrantes, como
BAHIA, BRASIL: ASPECTOS FLORSTICOS E o caso de Amphimas (Leguminosae, Papilionoideae). Este
ECOLGICOS gnero compreende apenas quatro espcies confinadas
ao continente africano (Amphimas pterocarpoides, A.
ferrugineus, A. klaineanus e A. Tessmannii), sendo constitudo
Autor(es): CARINA SANTOS, CID JOS PASSOS BASTOS por rvores de grande porte, podendo chegar at 50m de
Resumo: O filo Bryophyta, representado pelos musgos, altura, o que as tornam amplamente comercializadas pelo
constitui uma das maiores linhagens de plantas terrestres, potencial madeireiro. As espcies de Amphimas possuem
sendo caracterizados pelos gametfitos sempre folhosos, distribuio geogrfica restrita aos pases da frica Ocidental
em geral radialmente simtricos. Para o Brasil so referidas e Central, onde so comuns em florestas tropicais midas
ca. 880 espcies, das quais 313 ocorrem no estado da e florestas tropicais sazonalmente secas. A combinao de
Bahia, distribudas entre os vrios tipos vegetacionais, frutos indeiscentes e flores no-papilionadas, envolvendo
sendo bem representadas nas florestas ombrfilas, tanto de simetria radial, ptalas indiferenciadas e estames livres,
terras baixas como de altitude. Alguns ambientes como as foram cruciais para classificar Amphimas prximo de
florestas serranas da Caatinga se destacam no apenas no Riedeliella, Inocarpus e Etaballia na tribo Dalbergieae, ou
contexto florstico, mas biogeogrfico, dada sua ligao na tribo Sophoreae como atualmente circunscrito. Estudos
ancestral com a floresta atlntica, sendo consideradas como filogenticos a partir de dados moleculares de genes
relictos ou refgios, como confirmado pelos estudos feitos plastidiais individuais (trnL intron e matK) no sustentam
com fanergamos. O presente estudo objetivou obter a a classificao tradicional de Amphimas, porm tambm
composio e o perfil brioflorstico de musgos dos ambientes no resolvem completamente suas relaes filogenticas,
serranos do Domnio Caatinga, aqui representados pela Serra tornando-o ainda enigmtico em uma grande politomia
da Jiboia, localizada no municpio de Santa Teresinha e pelo na histria evolutiva inicial das Papilionoideae. Caracteres
Parque Estadual de Sete Passagens, situado no municpio do fruto, da folha e a presena de resina, bem como
de Miguel Calmon. Alm de coletas que foram realizadas de estipelas poderiam explicar uma possvel relao
na Serra da Jiboia, foram utilizados dados oriundos da de Amphimas com os gneros do clado Andira (Andira,
literatura, sendo reconhecidas 53 espcies distribudas em Hymenolobium e Aldina). Neste trabalho, realizamos a
39 gneros e 20 famlias. Com relao ao Parque Estadual primeira anlise filogentica combinada de sequncias do
de Sete Passagens, foram identificadas amostras de musgos gene nuclear ITS/5.8S e dos genes plastidiais matK, rbcL e
oriundas de coletas anteriores, em adio aos dados obtidos trnL intron, com o objetivo de resolver o posicionamento
da literatura, o que resultou no reconhecimento de 32 filogentico de Amphimas. As anlises de parcimnia e de
espcies distribudas em 21 gneros e 11 famlias. Na Serra inferncia bayesiana revelaram um resultado inesperado
da Jiboia, as famlias mais representativas em nmero de jamais sugerido na literatura. Amphimas sustentado
espcies foram Leucobryaceae e Orthotrichaceae, ambas como filogeneticamente prximo (grupo-irmo) do clado
com seis espcies, Calymperaceae com cinco e Dicranaceae Lecointeoid, uma linhagem exclusivamente neotropical
com quatro. Para o Parque Estadual das Sete Passagens, as marcada principalmente por flores radialmente simtricas,
famlias mais bem representadas em nmero de espcies mas que tambm inclui gneros com simetria bilateral.
foram Sematophyllaceae e Orthotrichaceae, ambas com seis Esse resultado no s ilumina um novo posicionamento
espcies, e Brachytheciaceae e Leucobryaceae, ambas com filogentico de Amphimas como tambm corrobora para um
quatro espcies. Com relao ao espectro ecolgico, para futuro entendimento sobre sua histria biogeogrfica.
a Serra da Jiboia observou-se que o grupo briocenolgico Palavras-chaves: Evoluo, Fabaceae, Sophoreae
corticcolo predominou, ocorrendo em 47,5% das amostras,
seguido do epxilo, com 27,5%, rupcolo com 12,5%, terrcolo *******************************************************************
com 3,7% e casmfito com 1,2%. Para o Parque Estadual das *******************************************
Sete Passagens, foi observado que os grupos briocenolgicos
corticcolo e terrcolo predominaram, ocorrendo em 35,2%
das amostras, seguido do epxilo, com 25,4%, terrcolo,
com 7,8% e epifilo, com 1,9%. Isso indica que, em ambas as
localidades, o substrato preferencial foi o tronco de rvore
viva. No presente estudo foram adicionadas 32 espcies
aos dados j existentes reportados na literatura, sendo 23
referentes a Serra da Jiboia e nove ao Parque Estadual das
Sete Passagens.
Palavras-chaves: Brifitas, Musgos, Caatinga

Congresso da UFBA 2017 | Caderno de resumos 83


rea: CINCIAS BIOLGICAS - BOTNICA aspectos dessa tecnologia necessitam ainda ser investigados,
como por exemplo, os modelos de dispensadores utilizados
TRABALHO: UTILIZAO DE para facilitar a aderncia dos MCAs ao corpo do vetor.
MARCADORES ISSR PARA A ANLISE Esse estudo objetivou avaliar o efeito de dois tipos de
dispensadores sobre a atividade de forrageio da abelha Apis
DA FIDELIDADE GENTICA DE BROTOS mellifera. Foram testados dois tipos de dispensadores: um
ESTUDANTE PIBIC

DE STEPHANOCEREUS LUETZELBURGII dispensador unidirecional e outro bidirecional, os quais


foram instalados em quatro e seis colnias de abelhas A.
REPICADOS POR QUATRO GERAES DE mellifera, respectivamente. No dispensador unidirecional
CULTIVO foi adicionada farinha de milho (Maisena) em trs ninhos
e o fungo entomopatognico Bauveria bassiana em um
Autor(es): EVA PIRES SANTA BRBARA, NAZAR MARCHI, ninho a fim de avaliar se as abelhas estavam carregando
MOEMA CORTIZO BELLINTANI esses materiais ao passar pelo dispensador, enquanto que
no dispensador bidirecional utilizamos trs tratamentos:
Resumo: Uma das principais vantagens da micropropagao + dispensador + farinha de milho + p florescente; +
a produo de clones idnticos a planta me. Alguns dispensadores farinha sem p; - dispensadores farinha
fatores relacionados ao cultivo in vitro como os reguladores de milho p florescente. Foram utilizadas trs colnias
vegetais e as inmeras repicagens podem gerar variao por tratamento a fim comparar a atividade de forrageio
somaclonal, indesejvel quando o objetivo do trabalho a entre os tratamentos. Observamos o nmero de abelhas
conservao de determinado recurso gentico vegetal. Desta que saiam e entravam nas colnias e seu comportamento
forma, o objetivo geral deste trabalho foi analisar a fidelidade quanto presena do dispensador e do inculo, bem como
gentica de brotos de Stephanocereus luetzelburgii por o quanto de inculo estava sendo carregado por essas
meio de marcadores ISSR (Inter Simple Sequence Repeats) abelhas. Foram notadas alteraes no comportamento das
ao longo de quatro geraes de cultivo e suas respectivas abelhas com o dispensador unidirecional, e que houve
plantas me. Durante o cultivo in vitro os brotos foram diferenas no carregamento da farinha de milho e do agente
propagados in vitro em meio Murashigue e Skoog (1962), B. Bassiana. O inculo de farinha de milho foi carregado por
suplementado com 30 g L-1 de sacarose e solidificado com completo na maioria das colnias enquanto que o inculo
6,5 g L-1 de gar. Para tanto, os testes de otimizao foram de B. bassiana somente a metade foi carregado. Entretanto,
realizados com extrao do DNA da planta me, partir do notamos que as abelhas estavam coletando a farinha em
mtodo CTAB (brometo de cetiltrimetilamnio) descrito por suas corbculas para armazenarem ao passo que no tinham
Doyle e Doyle (1987). Em seguida, o DNA foi purificado com esse comportamento com o B. bassiana. No segundo
acetato de amnio. Realizou-se a quantificao dos DNAs experimento a presena do dispensador bidirecional no
extrados atravs de espectofotmetro e gel de agarose e, interferiu na atividade de forrageio das abelhas, entretanto a
posteriormente, teste de 20 primers ISSR descritos por Wolfe presena o inculo de farinha da milho com o p florescente
et al. (1998). Alm disso, para reaes de amplificao por interferiu negativamente, e foi observado que as abelhas
PCR utilizou-se gradiente de temperatura para o anelamento. coletavam o inculo em suas corbculas. Esses resultados
Foram selecionados cinco primers (MAO, OMAR, 844, 899 so essenciais para clarear nosso entendimento sobre o
e JONH) baseando-se no potencial para reprodutibilidade e funcionamento dessa tecnologia e desse modo poder realizar
clareza das bandas. A partir disto, os primers foram utilizados pesquisas mais detalhadas nessa perspectiva.
para anlise de indivduos aps quatro subculturas de cinco
acessos: 1, 4, 7, 13 e 16. Cada primer foi trabalhado por vez, Palavras-chaves: Entomovectoring, Biocontrole, MCAs
contemplando a extrao de 10 indivduos (9 da gerao *******************************************************************
F4 e 1 da planta me), dos respectivos acessos (exceto o *******************************************
acesso 1 que foram 5 indivduos mais a planta me), para
ento poderem ser analisados posteriormente. A anlise
das imagens de gis e posterior lanamento de dados no rea: CINCIAS BIOLGICAS - ECOLOGIA
Software GenAlex 6.2, demonstrou que brotos derivados TRABALHO: ANLISE DA COMPATIBILIDADE
da quarta gerao de cultivo apresentaram coeficiente
de similaridade de Jaccard variando entre 92-100%, SEXUAL, PADRO DE EMISSO DE
demonstrando assim, elevado percentual de similaridade em FEROMNIO E COMPORTAMENTO DE CORTE
relao planta me.
ENTRE DUAS POPULAES DE ANASTREPHA
Palavras-chaves: marcadores moleculares, variao
somaclonal, cultura de tecidos
FRATERCULUS (DIPTERA: TEPHRITIDAE)
*******************************************************************
PROVENIENTES DO SUL E SUDESTE DO
******************************************* BRASIL
rea: CINCIAS BIOLGICAS - ECOLOGIA Autor(es): AMANDA AMORIM DA SILVA CARDOSO, IARA
SORDI JOACHIM BRAVO
TRABALHO: ABELHAS COMO
Resumo: A mosca-das-frutas Anastrepha fraterculus
VETORES DE AGENTES DE CONTROLE (Wiedemann) (Diptera: Tephritidae) uma espcie polfaga
MICROBIOLGICOS: A IMPORTNCIA DO e a mais importante praga de frutos da Amrica do Sul,
causando enormes prejuzos a fruticultura. O nvel de
DESING DOS DISPENSADORES variabilidade entre as populaes de A. fraterculus sugere
que ela seja um complexo de espcies crpticas. No Brasil,
Autor(es): MIQUEIAS PEREIRA, JULIANA MACEDO DE sabe-se que existem pelo menos trs morfotipos dentro
SOUZA, BLANDINA VIANA desse complexo, conhecidos como Brasil-1, Brasil-2 e
Brasil-3. A avaliao do grau de isolamento reprodutivo entre
Resumo: As abelhas tm sido testadas como dispersoras/
esses morfotipos localizados em diferentes regies do Brasil
vetores de agentes de controle microbiolgicos de pragas
imprescindvel para tentar definir seu status taxonmico e
(MCAs), uma alternativa mais eficaz do que a aplicao
distribuio e dar suporte para a implantao da Tcnica do
normalmente utilizada, a pulverizao. Entretanto alguns
Inseto Estril (TIE) para esta espcie no Brasil. Nesse trabalho

84 Congresso da UFBA 2017 | Caderno de resumos


foram avaliados fatores referentes a compatibilidade sexual, (fitness, effect, adaptation e function), embora 21 dos 22
padro de emisso de feromnios e comportamento de artigos no os tenham definido, no houve inconsistncia no
corte de machos de duas populaes do Brasil, provenientes uso de nenhum deles. Tambm no encontramos problemas
da cidade de Bento Gonalves (RS) e So Sebastio (SP). de comunicao referentes ao tempo da questo e aos
Sabe-se que a populao proveniente do Sul do Brasil termos usados para se referir utilidade do comportamento
constituda pelo morfotipo Brasil-1, porm a populao da nos 16 eventos de citaes analisados. Apesar da baixa

ESTUDANTE PIBIC
regio costeira de So Paulo ainda no foi definida como um frequncia de problemas encontrados, eles existiram.
morfotipo especfico, devido a ocorrncia em simpatria com Desse modo, sugerimos que futuros artigos superem essas
outros morfotipos. Os resultados encontrados mostraram limitaes de modo a evitar problemas de comunicao no
que existe incompatibilidade sexual entre essas duas campo.
populaes e que existem diferenas marcantes em relao
ao padro de emisso de feromnios e comportamento de Palavras-chaves: Concept - Polysemy - Scientific
corte. Tais dados sugerem que a populao de So Sebastio communication
pertence a um morfotipo diferente da populao de Bento *******************************************************************
Gonalves. Dessa forma, o uso de apenas uma linhagem de *******************************************
moscas para a TIE no seria eficiente nessas regies do Brasil.
Novos estudos de compatibilidade sexual e comportamento
entre diferentes populaes do Brasil precisam ser realizados rea: CINCIAS BIOLGICAS - ECOLOGIA
ampliando-se o nmero de populaes para aprimorar o TRABALHO: ATRATIVOS ALIMENTARES
conhecimento sobre a distribuio dos diferentes morfotipos
pelo Brasil. preciso tambm definir quais caractersticas PARA ARMADILHAS DE MONITORAMENTO/
comportamentais relacionadas ao padro de emisso de CONTROLE DE ADULTOS DE MOSCAS-DAS-
feromnios e ao comportamento de corte dos machos
seriam importantes para distino entre os morfotipos, FRUTAS.
contribuindo, assim, para a definio dos protocolos de
implantao da TIE para A. fraterculus no Brasil. Autor(es): LORENA ARAUJO PEIXOTO CORREIA, IARA SORDI
JOACHIM BRAVO
Palavras-chaves: complexo crptico de espcies,mosca-das-
frutas,Tcnica do Inseto Estril Resumo: As moscas-das-frutas so pragas agrcolas
pertencentes famlia Tephritidae. Elas so caracterizadas
******************************************************************* pelos danos diretos causados as plantaes de frutferas e
******************************************* consequentemente pelas perdas econmicas. As fmeas
dessa famlia escolhem seus stios de oviposio em frutos
rea: CINCIAS BIOLGICAS ECOLOGIA verdes e estes sofrem danos pela ao das larvas, que
consomem a polpa do fruto, levando-o a perder de seu
TRABALHO: ANALYSIS OF THE ACCURACY valor de exportao. Existem muitas espcies de importncia
AND CONSISTENCY OF THE BEHAVIORAL econmica como por exemplo a Ceratitis capitata que
se dissipou mundialmente e o gnero Anastrepha que
ECOLOGY LITERATURE THAT INVESTIGATES possui noventa e cinco espcies somente no Brasil. Esse
THE TINBERGEN QUESTION WHAT DOES gnero possui trs principais representantes de importncia
econmica: A. fraterculus, A. obliqua e A. sororcula, que
THE BEHAVIOR EXIST FOR? esto distribudas por todo territrio brasileiro. Devido aos
problemas fitossanitrios que elas causam, muitas barreiras
Autor(es): EMERSON CAMPOS BARBOSA JNIOR, PEDRO foram criadas pelos pases importadores, com intuito de
LUS BERNARDO DA ROCHA evitar a implantao dessa praga em seu pas. Uma delas
a medida quarentenria. Diante de tal contexto, muito
Resumo: Tinbergen props que necessrio responder
trabalhos atuais visam a utilizao do manejo integrado de
quatro perguntas complementares para que se compreenda
pragas (MIP), para conseguir controlar a incidncia dessa
completamente um comportamento e considera-se que uma
praga sobre o cultivo agrcola do pas. O MIP consiste no
delas, para que existe o comportamento?, contribuiu com
uso concomitante de algumas tcnicas, como o controle
o estabelecimento da disciplina ecologia comportamental.
biolgico, iscas atrativas ou monitoramento populacional,
Contudo, sabe-se: que essa pergunta pode se referir a
que atuam suprimindo o tamanho populacional desses
escopos temporais distintos (para que servia na origem
insetos, sem agredir o meio ambiente. Entretanto, a eficcia
evolutiva do comportamento ou nas condies atuais);
do uso de iscas atrativas para monitoramento depende
que respond-la para cada escopo demanda abordagens
diretamente da disponibilidade de atrativos e armadilhas
metodolgicas distintas; e que interpretaes distintas sobre
que sejam eficientes e acessveis. As principais substncias
a pergunta (p.ex., qual a utilidade atual, valor adaptativo,
usadas como atrativos no combate as moscas-das-frutas,
funo) se referem a diferentes processos. Neste trabalho,
so os compostos orgnicos volteis (COVs), liberados pelas
avaliamos o quanto esses problemas de interpretao
plantas e seus frutos. Assim, o objetivo desse trabalho foi
ainda afetam o desenvolvimento da disciplina por gerar
testar novos atrativos alimentares proticos e de extratos de
problemas de comunicao. Analisamos 22 artigos recentes
frutos para moscas-das-frutas das espcies de Anastrepha
da disciplina vinculados pergunta para que existe o
fratecurlus, A. sororcula e A. obliqua e Ceratitis capitata.
comportamento? avaliando se os mesmos: (a) so precisos
Os testes foram realizados em gaiola de campo (2x2x2m),
ao delimitar o escopo temporal da pergunta e usar a
onde foram liberados 150 machos e 150 fmeas de Ceratitis
metodologia adequada a ele; e (b) so precisos ao definirem
capitata, para observao da eficincia na atratividade dos
os termos usados para se referir valor de sobrevivncia
compostos de acordo com a quantidade de espcimes
do comportamento e os usam de modo consistente. Alm
capturadas. Para tal, foram colocadas duas armadilhas do
disso, avaliamos se o processo de citao desses artigos inclui
tipo McPhail, uma em cada extremidade da gaiola. Junto a
falhas de interpretao quanto ao escopo temporal e aos
essas armadilhas foram dispostas plantas (Ficus sp). Foram
termos associados pergunta nos artigos citados. Dos 22
testadas armadilhas contendo gua como controle e outra
artigos que procuram responder a pergunta para que serve
contendo a essncia de manga (100%), durante sete dias
o comportamento, 3 artigos de baixo impacto apresentaram
consecutivos, com contagem de animais capturados aps
problemas na definio do tempo da questo. Quatro termos
8, 24 e 48 horas. Os dados obtidos nesse experimento
foram usados para se referir a utilidade do comportamento

Congresso da UFBA 2017 | Caderno de resumos 85


demonstraram uma alta capacidade de atrao da essncia *******************************************************************
de manga durante as 8h iniciais para machos de Ceratitis *******************************************
capitata, porm houve baixa atrao de fmeas.
Palavras-chaves: atrativo alimentar,moscas-das- rea: CINCIAS BIOLGICAS - ECOLOGIA
frutas,controle de pragas TRABALHO: AVALIAO DA EFICCIA
ESTUDANTE PIBIC

******************************************************************* ATRATORA DE VOLTEIS DE FRUTOS E DE


*******************************************
FONTE PROTEICAS PARA AS ESPCIES
rea: CINCIAS BIOLGICAS - ECOLOGIA DE MOSCAS-DAS-FRUTAS, ANASTREPHA
TRABALHO: AVALIAO DA EFETIVIDADE OBLIQUA E CERATITIS CAPITATA
E EFICINCIA DE APIS MELLIFERA NA Autor(es): IASMIN DE BORBA CARQUEIJA, JAMILE CMARA
POLINIZAO, PRODUO E QUALIDADE AQUINO, IARA SORDI JOACHIM BRAVO
DOS FRUTOS DE CAF COFFEA ARABICA. Resumo: O Brasil um pas de economia forte, possuindo
a segunda maior do continente americano, ficando atrs
Autor(es): DAIANA DE OLIVEIRA NUNES, BLANDINA VIANA, apenas dos EUA considerando seu PIB. Dessa economia, a
CATALINA COCA agricultura tem um importante valor histrico e at hoje
se faz presente no PIB e na Fora de trabalho, levando o
Resumo: O processo de polinizao essencial reproduo pas ao terceiro lugar do mundo em exportao agrcola
da maioria das plantas, sustentando 78% da produo em 2010, segundo a OMC. Dentro desse cenrio, impactos
global de plantas floridas. Quando desempenhado por em um ramo da agricultura como a fruticultura so dignos
polinizadores, tal servio pode maximizar a produo de preocupao. Os danos causados pela mosca-da-fruta
agrcola, aumentando a produtividade e qualidade dos (Diptera: Tephritidae) so exemplos de impactos diretos
frutos e sementes formadas, demonstrando a relevncia e indiretos em frutos de importncia na exportao. Esse
desses animais na disponibilidade de recursos e conservao inseto possui como estgio em seu ciclo de vida a insero
da biodiversidade. O caf Coffea arabica, uma planta de seus ovos dentro do fruto, onde ento iro eclodir
autocompatvel, no necessitando obrigatoriamente de e as larvas nascidas se alimentaro de sua polpa. Esse
polinizadores, embora estudos revelem um aumento comportamento alm de prejudicar a qualidade ou at
na produo e qualidade do caf com o auxlio desses a viabilidade de consumo do fruto implica em barreiras
animais. No existem estudos que avaliem a efetividade quarentenrias impostas por pases importadores de frutos
(contribuio do polinizador para deposio de plen no frescos. Por esses motivos, esses insetos so considerados
estigma) e a eficincia (contribuio do polinizador para pragas agrcolas. Visando a diminuio dos problemas
formao do conjunto de sementes) de Apis mellifera na supracitados e a reduo das populaes da praga, diversos
polinizao e frutificao de C. arbica, de modo que, os mecanismos foram desenvolvidos e so utilizados de
objetivos desse trabalho so: 1) Analisar a contribuio de forma integrada (MIP). Para a implantao bem sucedida
visitas nicas de Apis mellifera na deposio de plen no e manuteno da MIP, uma srie de procedimentos so
estigma, na frutificao e na qualidade do fruto; 2) Analisar necessrios, dentre eles est o monitoramento das espcies
a relao entre o nmero de gros de plen depositados de Tephritidae atravs de armadilhas com substncias
no estigma e a formao e qualidade do fruto. Nossa atrativas. Os COVs, compostos orgnicos volteis obtidos a
hiptese que: a visita nica de Apis mellifera mais partir de frutos hospedeiros, so comumente usados para
eficiente e efetiva na produo de frutos em C. arabica do essa prtica e com o objetivo de se garantir a eficcia da
que a autopolinizao espontnea (sem interveno do captura necessrio testar a atratividade destes. Com esse
polinizador ou pesquisador). O trabalho foi desenvolvido pensamento, este trabalho foi realizado visando analisar
em uma fazenda de caf situada em Ibicoara - Chapada a capacidade atrativa dos COVs e atrativos alimentares
Diamantina, onde realizamos os tratamentos: visita nica proteicos em relao s moscas das espcies Anastrepha
pela abelha Apis mellifera, polinizao manual, polinizao obliqua e Ceratitis capitata. Testes preliminares foram
aberta e a restrita aos polinizadores. Posteriormente, realizados com o intuito de indicar o grau de maturao
coletamos os estigmas das flores e contamos os gros de do fruto preferido por essas moscas, no caso a goiaba. Os
plen depositados, os tubos polnicos e a qualidade (peso, experimentos foram realizados em gaiolas de acrlico de
altura, largura e nmero de sementes) dos frutos formados 49x45x49 utilizando 20 casais na idade de pico de oviposio,
entre os tratamentos. Encontramos relao entre o nmero com 10 rplicas para cada espcie. As gaiolas foram mantidas
de gros de plen e o nmero de tubos polnicos formados, a 25C e iluminao de 2000 lux por 12 horas. A anlise foi
embora a deposio de plen sozinha no explique o peso feita atravs do teste t onde foi observada uma preferncia
do fruto em C. arabica. A polinizao aberta resultou em pelos frutos verdes por ambas as espcies.
82% de frutos desenvolvidos, seguido de A. mellifera com
79%, demonstrando que uma nica visita dessa espcie Palavras-chaves: mosca-da-fruta, armadilhas atrativas,
de abelha suficiente para promover uma alta taxa de controle de pragas
frutificao nessa espcie de caf. No que se refere a
*******************************************************************
qualidade dos frutos formados, o tratamento de polinizao
*******************************************
aberta e visita nica de Apis mellifera tiveram mdias muito
similares, embora o peso dos frutos polinizados por vista
nica tenha apresentado menos variao entre as amostras.
Esse resultado evidencia que, outros fatores no analisados
aqui, podem ser mais importantes do que a deposio de
plen para qualidade dos frutos em C. arabica, embora as
abelhas apresentem um papel importante nessa deposio,
apresentando frutos de qualidade (peso e altura) mais
uniformes.
Palavras-chaves: Polinizao. Efetividade. Eficincia

86 Congresso da UFBA 2017 | Caderno de resumos


rea: CINCIAS BIOLGICAS - ECOLOGIA V. bahiana. Paralelamente, diante da evidente expanso
imobiliria nos bairros litorneos do municpio de
TRABALHO: AVALIAO DE PADRES Salvador, esforos conservacionistas so desejveis e aes
DE ABUNDNCIA E DE DIVERSIDADE de restaurao ecolgica em remanescentes de restinga
devem ser implementadas. Desse modo, objetivou-se:
MACROZOOBENTNICA EM ESTURIOS DA (1) acompanhar o processo de maturao de frutos de V.

ESTUDANTE PIBIC
BAA DE TODOS OS SANTOS bahiana no Parque Municipal das Dunas, visando determinar
se a ausncia de plntulas decorrente do desenvolvimento
Autor(es): AMANDA MARTINS, FRANCISCO BARROS, YURI incompleto dos frutos; (2) iniciar um projeto piloto de
COSTA introduo de V. bahiana em reas impactadas/alteradas
do Parque Municipal das Dunas. Para obteno dos frutos,
Resumo: O conhecimento dos padres de distribuio foram realizadas 16 autopolinizaes e 19 polinizaes
espacial e temporal da macrofauna bentnica ao longo dos cruzadas (uma flor por inflorescncia e usando-se todo o
esturios pode ajudar a identificar processos ecolgicos plen). O desenvolvimento dos frutos foi acompanhado
e nas formulaes de questes relacionadas sobre o atravs de registros fotogrficos e medies com fita
funcionamento dos ecossistemas estuarinos. O presente mtrica a cada 15 dias, durante 12 meses com incio em
trabalho rene uma dcada de dados a cerca da distribuio maro de 2016. Foram obtidas a mdia e o desvio-padro
dos invertebrados bentnicos nos principais tributrios do comprimento, largura e circunferncia dos frutos. Para
da Baa de Todos os Santos, os esturios do rio Suba, o projeto piloto de reintroduo, foram obtidas 60 mudas
Jaguaripe e Paraguau e nos esturios do Mataripe e So de V. bahiana (todas com sete ns cada) e plantadas por
Paulo. Uma planilha geral contendo os dados da abundncia estaquia, adotando-se quatro tratamentos: (1) 15 mudas
das famlias de invertebrados bentnicos que compe os aderidas aos forfitos (AF) e sem serapilheira; (2) 15 mudas
grupos de poliquetas, moluscos e crustceos em cada uma AF e com camadas de serapilheira; (3) 15 mudas sem adeso
das estaes amostrais em cada esturio foi organizada, forfitos (SF) e sem serrapilheira; (4) 15 mudas SF e com
totalizando 11.704 indivduos. Alm disso, foram reunidos camadas de serrapilheira. De Maio 2016 a Julho 2017, o
e sintetizados os dados referentes a distribuio das fraes comprimento e largura das folhas novas, comprimento total
granulomtricas e a salinidade ao longo do gradiente da planta e das razes foram quinzenalmente mensurados
estuarino para cada um dos anos amostrados ao longo com fita mtrica ou paqumetro e registrados atravs
das mesmas estaes amostrais em que se identificaram de fotos. A autopolinizao teve sucesso de 68,7% (11
os organismos da macrofauna. Grficos da distribuio de frutos) e a polinizao cruzada, de 89,4% (17 frutos). O
abundncia e riqueza para as famlias de invertebrados desenvolvimento dos frutos resultantes de autopolinizao
bentnicos foram confeccionados para todos os anos em (AP) e de polinizao cruzada (PC) foi mais acentuado na
cada um dos esturios assim como grficos da distribuio primeira quinzena, com dimenses maiores em todos os
das variveis ambientais (salinidade e granulometria). Um caracteres mensurados nos frutos AP [p.ex. compr. 8,350,55
padro geral foi observado como proposto em estudos vs. 7,390,73]. A fase crtica ocorre entre 45-60 dias aps
anteriores com assembleias bentnicas, no qual notou-se a polinizao, pois concentra 66% e 83,3% das quedas dos
um decrscimo tanto da riqueza como da abundncia em frutos AP e PC, respectivamente. A temperatura elevada e
direo a montante do esturio. Um padro para distribuio chuvas fortes, fatores comumente relacionados queda de
das variveis ambientais nos esturios tambm foi observado, frutos em Vanilla Mill., so descartadas, pois junho-agosto
com a diminuio da salinidade e aumento de gros mais (pico das quedas) correspondem estao de temperaturas
grossos em direo a montante. sugerido com observaes mais baixas na regio e o regime de chuvas apresentou-se
do presente estudo que as variaes de riqueza e abundancia disperso e abaixo da mdia em 2016. Prope-se a ao
estejam sendo influenciadas pelas variaes tanto do isolada ou conjunta de herbvoros, fungos e bactrias
tamanho dos gros como da salinidade ao longo do esturio. como provveis responsveis. J a anlise prvia dos dados
Os dados do presente estudo auxiliam na compreenso dos da implantao de V. bahiana permite apontar que o
padres gerais de distribuio das assembleias bentnicas comprimento total de AF com serrapiheira (3,340,79) e
e na investigao das possveis causas de alteraes que sem serrapilheira (3,83,1) foi mais acentuado nos intervalos
estejam ocorrendo no ambiente. iniciais, respectivamente, de 0-15 dias aps o plantio e de
30-45 dias,enquanto que em SF, para ambos os tratamentos
Palavras-chaves: Padro De Distribuio, Macrofauna,
(com e sem serapilheira), o crescimento foi mais acentuado
Esturio
nos primeiros 15 dias (3,681,2;3,51,21, respectivamente). O
******************************************************************* crescimento foliar tambm foi notrio na primeira quinzena
******************************************* (28 mudas emitiram uma folha nova durante o perodo),
enquanto que o crescimento radicular foi mais expressivo
nos primeiros 30 dias para SF (16 mudas emitiram raiz) e
rea: CINCIAS BIOLGICAS - ECOLOGIA em AF aps 45 dias (8 mudas emitiram raiz). Durante os
TRABALHO: DESENVOLVIMENTO DE FRUTOS meses seguintes (45 dias - 345 dias), como via de regra, foi
observado decrscimo nos trs parmetros de crescimento
E REINTRODUO DE VANILLA BAHIANA analisados (planta, foliar e radicular), em razo de eventos
HOEHNE (ORCHIDACEAE) EM REAS constantes de herbivoria. Do total de mudas, apenas 19%
das plantas (11 indivduos) apresentaram crescimento
ALTERADAS DO PARQUE MUNICIPAL DAS contnuo aps 14 meses do plantio. Aparentemente, no
DUNAS, SALVADOR, BAHIA. h relao com o tratamento adotado. Apesar das baixas
taxas de maturao (18%-23%), a ausncia de plntulas no
Autor(es): TAILANE ALVES DO NASCIMENTO, FELIPE est associada ao desenvolvimento incompleto dos frutos.
FAJARDO VILLELA ANTOLIN BARBERENA Aparentemente, a reproduo assexuada responsvel pela
manuteno da populao local. Pressupe-se tambm que
Resumo: Vanilla bahiana Hoehne (Orchidaceae) uma os primeiros meses ps-plantio correspondam a perodos de
hemiepfita endmica do Brasil e indicativa de vegetao menor crescimento, dada a adaptao necessria ao novo
clmax nas restingas do estado da Bahia. No Parque ambiente e a influncia das interaes ecolgicas, conforme
Municipal das Dunas, um remanescente de restinga no registros (ex: herbivoria). Por isso, estudos em um novo ano
municpio de Salvador (BA), observou-se baixa taxa de so necessrios para melhor compreenso da sua ecologia e
frutificao natural (ca. 2%) e ausncia de plntulas de monitoramento do plantio.

Congresso da UFBA 2017 | Caderno de resumos 87


Palavras-chaves: ecologia,maturao,restaurao ecolgica rea: CINCIAS BIOLGICAS - ECOLOGIA
******************************************************************* TRABALHO: ECOTOXICOLOGIA E
*******************************************
BIOMONITORAMENTO AMBIENTAL EM
rea: CINCIAS BIOLGICAS - ECOLOGIA PEIXES DA BAA DE TODOS OS SANTOS,
ESTUDANTE PIBIC

TRABALHO: DESTRUIO DE HABITAT E A BAHIA: ESTUDO ESTRUTURAL DAS


EXTINO DE ESPCIES: UMA ANLISE BRNQUIAS DE MUGIL SP.
GLOBAL POR ECORREGIES Autor(es): KAREN SOPHIA OLIVEIRA DOS SANTOS SOUZA,
ANDR LUIS DA CRUZ
Autor(es): DANIEL GONALVES SOUZA, RICARDO
DOBROVOLSKI Resumo: A Bahia de Todos os Santos (BTS) um dos maiores
sistemas estuarinos do Brasil, contando com uma vasta
Resumo: O mundo est passando por uma acelerada riqueza natural, composta por extenses de recifes de corais,
reduo da biodiversidade. Essa crise da biodiversidade esturios e mangues, sendo tambm de grande importncia
provocada principalmente pelas atividades humanas. econmica, sobretudo pelas atividades industriais e
Podemos listar como principais ameaas para a agrcolas que so realizadas no seu entorno, tornando-a
biodiversidade a poluio, a superexplorao das espcies, assim suscetvel ao impacto dos poluentes, como metais
a introduo de espcies invasoras, as alteraes climticas traos resultante destas atividades, problema que afeta
e a perda de habitat. Sendo a quantidade de habitat o a maioria dos esturios do mundo inteiro. Nos peixes, as
determinante mais importante da riqueza de espcies, brnquias so o primeiro local de contato do organismo
consequentemente, a perda de habitat o principal com o ambiente aqutico e a exposio prolongada a
causador de extino de espcies. No presente estudo, concentraes potencialmente txicas de xenobiticos
fizemos previses de extino nas ecorregies terrestres quando presentes neste ambiente pode causar mudanas
do mundo baseadas na destruio de habitat natural e estruturais ou patologias de diferentes tipos e intensidades.
avaliamos o panorama global da crise da biodiversidade. Nesse contexto, a anlise das alteraes histopatolgicas
Para isso, quantificamos a proporo de habitats naturais nas brnquias constitui-se como um mtodo eficiente
remanescentes e, a partir da aplicao da relao para determinao dos efeitos causados pela exposio a
endemismo-rea derivada da teoria de biogeografia de poluentes, principalmente em peixes, um grupo de grande
ilhas, realizamos previses do nmero de vertebrados importncia nas avaliaes de impacto ambiental. Assim, o
terrestres ameaados de extino. Alm disso, ns usamos objetivo deste trabalho foi avaliar histopatologias branquiais
uma projeo de uso do solo para o ano de 2040 a fim de em peixes do gnero Mugil atravs de uma anlise qualitativa
quantificar o nmero de espcies que possivelmente estaro e quantitativa em dois esturios com diferentes histricos
ameaadas no futuro. Finalmente, comparamos nossas de contaminao ambiental, os sistemas estuarinos de
predies com a porcentagem de reas protegidas presentes Aratu e Jaguaripe. De cada um dos quatro espcimes
nas ecorregies, testando a adequabilidade dessas reas capturados uma hemibrnquia foi retirada e seccionada na
protegidas em preservar a biodiversidade. Como resultado, regio mediana dos arcos branquiais em seis fragmentos
ns quantificamos 250 vertebrados terrestres endmicos que que foram fixados em soluo de formalina tamponada
esto ameaados de extino devido a atual perda de habitat 10% durante oito horas. Posteriormente estes fragmentos
e esse nmero pode aumentar para 313 com a mudana do foram desidratados em etanol, includos em historesina e
uso do solo pela expanso da agricultura e urbanizao. Os emblocados. Os blocos foram ento seccionados em seces
nossos resultados se mostraram consistentes com a Lista com espessura de 5 m que foram dispostos sobre lminas
Vermelha da IUCN de espcies ameaadas de extino. histolgicas. No total, duas lminas contendo cinco seces
Quando comparamos nossas predies de extines nas aleatrias de um mesmo bloco de resina foram montadas
ecorregies com a porcentagem de rea protegida, nenhuma e coradas com azul de toluidina. Em cada seco disposta
correlao significativa foi encontrada, o que significa que sobre a lmina, quatro lamelas foram fotomicrografadas
as reas com maior nmeros de espcies ameaadas no em dois campos distintos utilizando objetiva de 40x atravs
so as mais protegidas. O presente estudo mostra o efeito de cmera digital acoplada microscpio de luz. Para
da destruio de habitat sobre os vertebrados terrestres avaliar a gravidade das leses branquiais, identificadas
ao redor do mundo e demonstra que a perda de habitat com base em Monteiro et al., 2008, o grau de mudana de
um bom preditor para a extino das espcies. Ademais, tecido (DTC) foi calculado juntamente com a frequncia
mostramos que os atuais esforos de conservao no so de ocorrncia de cada leso observada. A quantificao
ideais para mitigar as futuras extines causadas pela perda histopatolgica foi obtida atravs da porcentagem da regio
de habitat e portanto, esperado que a atual tendncia de lesionada. Cada histopatologia foi classificada em estgios
diminuio de habitat leve a uma perda de biodiversidade progressivos de dano ao tecido com base na possibilidade
ainda mais severa. de restaurao tecidual: estgio I, alteraes que no
interferem no funcionamento normal do tecido; Estgio II,
Palavras-chaves: espcies ameaadas, perda de habitat,
que so mais graves e afetam o funcionamento normal do
reas protegidas
tecido e rgo; E estgio III, que so muito graves e causam
******************************************************************* danos irreparveis. Um valor de DTC foi calculado para cada
******************************************* animal pelo ndice: DTC = (1.SI) + (10.SII) + (100.SIII) onde I,
II e III correspondem ao nmero de alteraes dos estgios
I, II e III, respectivamente. O valor DTC obtido para cada
peixe foi utilizado para calcular o ndice mdio para cada
esturio amostrado. Valores de DTC entre 0 a 10 indicam
o funcionamento normal do rgo; Valores entre 11 e 20
indicam danos leves ao rgo; Valores entre 21 e 50 indicam
mudanas moderadas no rgo; Valores entre 51 e 100
indicam leses graves e valores acima de 100 indicam danos
irreversveis ao rgo (POLEKSIC e MITROVIC-TUTUNDZIC,
1994). Alm disso, as histopatologias foram quantificadas

88 Congresso da UFBA 2017 | Caderno de resumos


atravs do programa Stepanizer por meio da contagem de tem sido alto. A Tcnica do Inseto Estril constitui como
leses e posteriormente porcentagem da regio lesionada. uma potencial ferramenta no controle destes dpteros.
Nos espcimes estudados, foram identificadas 10 leses Esta tcnica constitui na criao em massa destes insetos
histopatolgicas (vasodilatao, aneurismas, descolamento em biofbricas, seguida por esterilizao ainda no estgio
do epitlio lamelar, dilatao da borda do canal central da de pupa e posterior liberao dos adultos esterelizados
lamela, edema, proliferao do epitlio lamelar, proliferao em uma rea alvo, geralmente um pomar comercial. Ao

ESTUDANTE PIBIC
do epitlio filamentar, fuso lamelar, fuso entre filamentos serem liberados, os machos esterilizados nas biofbricas
adjacentes e necrose). A frequncia de ocorrncia das devem copular com as fmeas selvagem, no produzindo
principais leses identificadas foi maior nos peixes prole e assim, reduzindo sua populao em campo. No
capturados em Aratu do que no esturio de Jaguaripe. Na entanto, diversos fatores ainda precisam ser aprimorados
anlise quantitativa foi possvel constatar que a maioria das para que esta ferramenta torne-se mais eficaz no controle
leses foram mais evidentes nos peixes coletados em Aratu destas pragas. Um destes aspectos a serem melhorados a
(A) em relao Jaguaripe ( J), respectivamente, aneurisma dieta dos adultos, visto que a mesma apresenta um papel
com 17,4% (A) e 9% ( J); descolamento do epitlio lamelar fundamental no sucesso de cpula de machos desta espcie.
13,8% (A) e 3,9% ( J), dilatao da borda central da lamela Portanto, visando aumentar o sucesso de cpula de machos
7,7% (A) e 0% ( J), proliferao do epitlio filamentar 5,8% de laboratrio frente a machos selvagens. O guaran em p
(A) e 1,3% ( J), fuso entre lamelas de filamentos adjacentes conhecido por apresentar um efeito estimulante, e com isso,
8,4% (A) e 2,6% ( J), necrose 1,8% (A) e 0% ( J). Entretanto, apresenta potencial para ser um aditivo dieta de adultos de
as leses vasodilatao, edema, proliferao do epitlio machos de C. capitata, buscando a potencializao do seu
lamelar efuso lamelar foram mais evidentes em Jaguaripe. sucesso de cpula. Portanto, o presente trabalho teve como
Os valores (Mdia e Desvio padro) estimados de DTC objetivo testar o sucesso de cpula de machos alimentados
branquial apresentados em Jaguaripe foram 5,49 2,35 e com uma dieta enriquecida com guaran em p frente a
15,13 10,4 em Aratu, indicando funcionamento normal machos alimentados com uma dieta padro. Para isto foram
das brnquias dos indivduos capturados em Jaguaripe utilizadas formuladas duas dietas diferentes: (1) Dieta padro:
e danos leves nos indivduos capturados em Aratu, at Protena Hidrolisada + Acar, em uma proporo de 1:3
mesmo incluindo necrose, leso categorizada como mais (proporo em gramas) e (2) Dieta enriquecida: Dieta padro
grave (estgio III) que no esteve presente nos espcimes + 30% de guaran em p em relao ao peso da Protena
capturados no esturio do rio Jaguaripe. Uma das mais Hidrolisada. Ao emergirem os machos foram separados em
presentes histopatologias encontradas foi o aneurisma dois grupos, cada um alimentado com um tipo de dieta e as
(estgio II), que geralmente resulta do colapso do sistema fmeas tambm foram separadas ao nascerem, para garantir
de clulas pilares, que prejudica a integridade vascular com que as mesmas estivessem virgens no dia do experimento. Os
a liberao de grande quantidade de sangue, empurrando experimentos foram realizados sob condies controladas de
o epitlio lamelar para fora, o que pode causar ruptura laboratrio (T= 251C e H= 7010%). Em cada teste foram
do epitlio e consequentemente hemorragia. Esta leso liberados 10 machos de cada tratamento e 10 fmeas virgens.
mostrou-se presente quase em totalidade nos exemplares O sucesso de cpula foi medido a partir da contabilidade do
de Mugil capturados na regio de Aratu e pouco menos nmero de cpulas de machos de cada tratamento. Foram
frequente em Jaguaripe. Os aneurismas, assim como o feitas 6 rplicas independentes do mesmo experimento.
descolamento do epitlio lamelar e a fuso entre filamentos Foi aplicado um Teste-t student (alfa = 5%) para amostras
adjacentes, observados com maior frequncia nos peixes independentes. O teste no indicou diferenas estatsticas
de Aratu que de Jaguaripe, esto relacionadas com a no nmero de cpulas entre machos alimentados com a
contaminao por metais relatada para este ambiente. A dieta enriquecida e com a dieta padro (p = 0,1935). Logo,
investigao histopatolgica representa, portanto, uma conclumos que o guaran na concentrao utilizada neste
ferramenta importante para o entendimento da etiologia, trabalho no funciona como aditivo funcional na melhora do
progresso e consequncias das leses que comprometem o sucesso de cpula de machos de C. capitata. A partir desses
funcionamento dos sistemas e a vida dos peixes. resultados, outros experimentos esto sendo realizados com
uma dieta enriquecida com 60% de guaran em p (em
Palavras-chaves: ecotoxicologia, brnquias, metais relao ao peso da protena hidrolisada).
******************************************************************* Palavras-chaves: Ecologia Aplicada, Moscas-das-frutas,
******************************************* Ceratitis capitata
*******************************************************************
rea: CINCIAS BIOLGICAS - ECOLOGIA
*******************************************
TRABALHO: EFEITO DA ADIO DE
GUARAN EM P (PAULLINIA CUPANA) rea: CINCIAS BIOLGICAS - ECOLOGIA
DIETA NO SUCESSO DE CPULA TRABALHO: DESTRUIO DE HABITAT E O
DE CERATITIS CAPITATA (DIPTERA: DESENVOLVIMENTO HUMANO NA BAHIA
TEPHRITIDAE)
Autor(es): FLORA ASSIS, PALOMA PONCHET BORGES,
RICARDO DOBROVOLSKI
Autor(es): ALEXANDRE ARAJO, IARA SORDI JOACHIM
BRAVO Resumo: A modificao do solo um dos temas mais
discutidos na atualidade, sua contnua e acelerada
Resumo: Ceratitis capitata, conhecida popularmente
modulao sobre a superfcie terrestre promove
como mosca do mediterrneo, apresenta um ciclo de vida
uma resposta negativa sobre os ecossistemas e
caracterstico, pois utilizam frutos durante seu processo de
consequentemente sobre todos os processos econmicos
amadurecimento, como stio para deposio dos seus ovos.
que dependem dos recursos naturais. Essa alterao tem
Este fator tem levado a prejuzos diretos na fruticultura
acontecido principalmente nos trpicos, onde a remoo
mundial, pois acabam por comprometer a integridade fsica
da floresta nativa causa a fragmentao do habitat, perda
dos frutos, impedindo a sua comercializao e exportao.
da biodiversidade, aumento do grau de intemperismo,
Por constituir uma das principais atividades econmicas
alteraes climticas, modificao na ciclagem de nutrientes
do Brasil, a aplicao de tcnicas de controle se fazem
e at a extino de espcies, muitas delas endmicas. Apesar
necessrias, j que o prejuzo causado por estes insetos

Congresso da UFBA 2017 | Caderno de resumos 89


de que esse processo vem se intensificado ao longo dos anos sendo convertida em investimentos locais que promovam a
devido ampliao da ocupao territorial, consequncia melhoria da qualidade de vida da populao.
do aumento do nmero de pessoas ao redor do mundo, as
demandas globais por produtos agropecurios um fator Palavras-chaves: desmatamento, desenvolvimento humano,
de influencia complexa e que age diretamente sobre o meio, produo agropecuria
disparando entre todas as causas, a de maior impacto sobre *******************************************************************
ESTUDANTE PIBIC

os recursos naturais. O estado da Bahia caracterizado *******************************************


por um territrio divido em trs biomas: Caatinga, Cerrado
e Mata Atlntica, e suas peculiaridades, so responsveis
por gerir o bem estar populacional, servir como fonte rea: CINCIAS BIOLGICAS - ECOLOGIA
de renda de agricultores familiares e ser importante TRABALHO: MICROALGAS
economicamente para empresas multinacionais. O presente
estudo possui o objetivo de saber se existe relao entre FITOPLANCTNICAS NA BAA DE CAMAMU
o desmatamento e o desenvolvimento humano no estado
da Bahia, com o propsito compreender quais fatores Autor(es): LORENA PETERSEN NASCIMENTO SANTOS,
que motivam o desmatamento no territrio. Os dados de HELEN MICHELLE DE JESUS AFFE, JOS MARCOS DE CASTRO
uso do solo foram obtidos atravs do GlobCover Project NUNES
2009, retirados do banco de dados da European Space Resumo: A Baa de Camamu um sistema estuarino ainda
Agency (ESA), que consistiu em um arquivo no formato com baixos sinais de presso antrpica, apesar das atividades
shapefile, especificando os tipos de cobertura florestal com potencial impacto ambiental desenvolvidas na rea,
remanescente alm de atividades humanas na superfcie tais como o intenso turismo e explorao de gs natural na
terrestre. Os dados socioeconmicos e demogrficos foram regio de plataforma adjacente. Tendo em vista os riscos
obtidos na plataforma do Instituto Brasileiro de Geografia oferecidos pelo aumento dessas atividades, e dado que a
e Estatstica (IBGE) e o seu Sistema IBGE de Recuperao comunidade fitoplanctnica um importante indicador
Automtica (SIDRA) para o ano de 2010, onde foi possvel de impactos ambientais, uma vez que sua composio
obter as informaes de todos os 417 municpios do estado especifica, abundncia e distribuio das espcies so
da Bahia. Como varivel socioeconmica utilizou-se o importantes fatores para o funcionamento dos sistemas
ndice de Desenvolvimento Humano (IDH) mais os trs aquticos, o presente estudo teve como objetivo identificar
subndices: renda, educao e longevidade; informaes dos as espcies microfitoplanctnicas e sua distribuio na Baa
limites municipais; rea das unidades territoriais (km) dos de Camamu. As amostras foram coletadas em duas estaes
municpios, nmero populacional; levantamento do nmero pluviomtricas, nas pores norte, central e sul da baa.
de cabeas de gado; valor da produo de agricultveis Foram aferidos in situ os parmetros fsicos de temperatura,
(em unidades de mil reais) e o mapa representativo dos salinidade, pH, oxignio dissolvido, utilizando-se uma sonda
biomas. Dividimos em cinco categorias os remanescentes multiparmetros e transparncia da gua com disco de
de vegetao da Bahia, no intuito de classificar o estado Secchi. As espcies fitoplanctnicas foram identificadas com
atravs do grau de desmatamento ocorrente, onde na classe base em bibliografia especializada e as anlises quantitativas
A esto os municpios que tem 89% a 60% da vegetao (densidades celulares) foram realizadas segundo o mtodo
nativa, classe B os municpios tem 60% a 45%, classe C tem de Utermhl (1958). Registrou-se no primeiro perodo de
45% a 30%, na classe D tem de 30% a 15% e na classe E coleta guas mais frias, com maiores taxas de oxignio
esto os municpios com 15% a 0% de vegetao. Utilizou- dissolvido e menores transparncias enquanto no segundo
se a tcnica da Analise da Varincia (ANOVA), onde so perodo de coleta, foram registradas guas mais quentes,
realizadas comparaes das mdias de todas as classes em com menores taxas de oxignio dissolvido e maiores
relao a varivel socioeconmica. Todo procedimento de transparncias. Foram identificados um total de 150
refinamento dos dados e anlises estatsticas foram feitas txons, dentre os quais 27 so classificados pela literatura
com o software R. De acordo com os resultados obtidos, especializada como sendo espcies potencialmente nocivas.
no houve relao entre os remanescentes de vegetao A composio da comunidade fitoplanctnica apresentou
nativa e o desenvolvimento humano. Das dez variveis um padro comumente registrado em ambientes costeiros
analisadas, cinco tiveram uma relao significante com tropicais, no qual as classes Bacillariophyceae e Dinophyceae,
o desmatamento: valor de produo (F=3.846, gl=4;412, respectivamente, so as mais representativas em nmero de
p-value=0.004416), valor de produo por km (F=4.12, espcies. As maiores riqueza (81) e densidade de espcies
gl=4;412, p-value=0.002763), cabeas de gado (F=3.583, foram registradas na poro norte da baa, na primeira
gl=4;412, p-value=0.006914), cabeas de gado por pessoa coleta, perodo de maior pluviosidade. As diatomceas
(F=5.083, gl=4;412, p-value=0.0005238) e cabeas de foram o grupo de maior abundncia em ambas as coletas,
gado por km (F=9.476, gl=4;412, p-value=2.455e-07). nas trs pores da baa, com destaque para as espcies:
As outras cinco variveis que no foi encontrada Paralia sulcata (poro norte) e Odontella longicruris (nas
relao com o desmatamento foram: IDH (F=0.4337, pores sul e central). Apesar da grande abundncia dessas
gl=4;412, p-value=0.7843), educao (F=0.5779, gl=4;412, espcies, pela anlise de equabilidade ( J ~ 0,8), em ambas
p-value=0.6788), renda (F=0.2369, gl=4;412, p-value=0.9175), coletas, observou-se que na Baa de Camamu as espcies so
longevidade (F=0.2477, gl=4;412, p-value=0.911), valor de distribudas uniformemente ao longo do sistema estuarino,
produo por pessoa (F=1.107, gl=4;412, p-value=0.3526). no existindo dominncia de espcies. A diversidade
Diferente de alguns estudos, as anlises no encontraram especfica do fitoplncton (H) variou entre 3,3 e 3,5 bits.ind.-
um padro de desenvolvimento boom-and-bust, mas 1 na primeira coleta e entre 3,2 e 3,5 na segunda coleta. Esses
medida que o desmatamento progredia na fronteira, pode- resultados indicam uma alta diversidade na regio, maior
se perceber que o desenvolvimento permanecia constante, do que em outras baas do litoral brasileiro como Baa de
ou seja, a qualidade de vida da populao independente dos Sepetiba, Baa de Guanabara e Baa de Ilha Grande
nveis de desmatamento, os municpios mais desmatados
com uma vegetao de quase 15% possuem um IDH Palavras-chaves: Fitoplncton, Baixo Sul da Bahia, Sistema
semelhante aos municpios em que suas florestas so Estuarino
mantidas de p (89% de vegetao). vista disso, possvel
*******************************************************************
concluir que o desmatamento no traz desenvolvimento e
*******************************************
que nos municpios mais desmatados e desenvolvidos, a
economia gerada com a produo agropecuria no est

90 Congresso da UFBA 2017 | Caderno de resumos


rea: CINCIAS BIOLGICAS - ECOLOGIA rea: CINCIAS BIOLGICAS - FARMACOLOGIA
TRABALHO: PALEOECOLOGIA DA ESPCIE TRABALHO: ANLISE DO EFEITO
PALEOLAMA MAJOR ATRAVS DA ANLISE DO FLAVONOIDE APIGENINA NA
DA RAZO ISOTPICA DE CARBONO E TUMORIGNESE E ATIVAO MICROGLIAL

ESTUDANTE PIBIC
OXIGNIO DE CLULAS DE GLIOBLASTOMA
HUMANO XENOTRANSPLANTADAS
Autor(es): CARLOS MICAEL BONFIM LESSA, MRIO ANDR
TRINDADE DANTAS INTRACRANIALMENTE EM RATOS
Resumo: Nos ltimos trinta anos o uso da tcnica de Autor(es): SILVIA LIMA COSTA, Alessandra Bispo Silva, Paulo
anlise de istopos estveis vem sendo utilizada nos mais Lucas Cerqueira Coelho, JESSIKA ALVES OLIVEIRA AMPARO
diferentes campos da Cincia. A anlise de istopos estveis
vem sendo usado por eclogos, e tm demonstrado que os Resumo: Glioblastomas so tumores primrios enceflicos
dados isotpicos encontrados so comparveis ao espao astrocticos, localizados preferencialmente nos hemisfrios
N-dimensional, pois a composio qumica de determinado cerebrais, na substncia branca sub-cortical, com alto grau
animal influenciado pelo o que ele consome no habitat de malignidade e resistente a terapias agressivas, inclusive
que vive. Sendo assim, esta tcnica uma ferramenta associada falta de resposta de clulas imunoefetoras do
poderosa para avaliar muitas caractersticas ecolgicas Sistema Nervoso Central (SNC), como a microglia, que
sobre organismos, viventes e extintos, contribuindo para limita o paciente a uma sobrevida geralmente inferior a 12
investigao de nichos ecolgicos e revelar como os meses mesmo aps terapia agressiva, em funo da sua
componentes do ecossistema esto conectados. Sendo elevada recorrncia, o que leva necessidade de avanar nos
assim este trabalho teve como objetivo principal inferir, estudos de uma nova teraputica antitumoral. Microglias
atravs da anlise da razo isotpica de carbono e oxignio, so consideradas como a primeira linha de defesa da
a dieta e nicho ecolgico da espcie Palaeolama major na resposta imune no SNC, e dentre as doenas com as quais
Regio Intertropical Brasileira durante o Pleistoceno final. as clulas da microglia so associadas, esto os tumores
Inicialmente as amostras foram enviadas para o laboratrio cerebrais, que representam um desafio cincia devido a
de Biogeologia, coordenado pelo professor Dr. Herv sua complexidade. Os flavonoides, compostos polifenlicos
Bocherens (University of Tubingen, Tubingen, Alemanha) que esto frequentemente presentes em quase todos os
para testar se possuem colgeno, onde foi constatado alimentos de origem vegetal e fazem parte da dieta alimentar
que no havia presena sendo invivel realizar as anlises. cotidiana da populao, por meio de diversos trabalhos
Atravs de dados j publicados da razo isotpica de do nosso grupo de pesquisa, tm sido demonstrados
carbono foi possvel obter informaes sobre a dieta de com vrias propriedades biolgicas, como a capacidade
Palaeolama major que seria principalmente de plantas antitumoral, antiangiognica e o efeito morfognico do
C3. Onde na Amrica do Norte os valores de 13C para o flavonoide apigenina. O presente estudo buscou analisar o
gnero Palaeolama variou entre -15,7 e -10,4 (mdia tratamento com a apigenina na tumorignese de clulas de
= -13,05 , desvio padro 3,75), apresentando largura glioblastoma humano da linhagem U251 xenotransplantadas
de nicho padronizado, tendo grande variao onde a intracranialmente em ratos Wistar e caracterizar a
espcie Palaeolama mirifica (0) e o gnero Palaeolama (0,79) populao de clulas microgliais na regio cerebral de
(mdia= 0,39, desvio padro 0,56) sugerindo que nessa xenotransplantes de clulas de glioblastoma em condies
regio era um especialista, com uma dieta a base de plantas controle e submetidas ao tratamento com apigenina atravs
do tipo C3 em ambientes de mata fechada, mas tambm de marcao imunocitoqumica para a protena Iba-1. Foi
poderiam consumir plantas do tipo C4. Na Amrica do Sul, verificado por meio do Teste de MTT, que a viabilidade
Palaeolama teria uma dieta a base de plantas C3 ( 13C das clulas de glioma reduziu aps a modulao com a
= - 8,5 ), largura de nicho padronizado de 0,99 sugerindo apigenina quando comparado com a condio controle
que nesta regio seria generalista, com dieta mista com (DMSO 0,1%), havendo uma toxicidade sobre as clulas alvo
preferncia por plantas do tipo C3 em ambientes de mata dose-dependente. Atravs de microscopia por contraste
fechada, mas tambm poderiam se alimentar de plantas de fase, foram observadas alteraes quantitativas e
do tipo C4. No municpio de Iraquara no interior da Bahia fenotpicas nas clulas tumorais e atravs dos ensaios de
a Palaeolama apresentou valor de 13C (-11,90), e largura migrao realizados em culturas de clulas de glioma foi
de nicho (BA=0,53), sendo considerada um generalista com possvel observar o efeito antimigratrio proporcionado
preferncia para plantas do tipo C3. Comparando os dados pelo flavonoide apigenina. Nos modelos animais
publicados para essas regies houve variao no valores de xenotransplantados com clulas tumorais tambm foram
&#948;13C de -15,7 e - 8,5 , onde sugerimos no Brasil verificadas por meio de colorao de hematoxilina-eosina,
e Amrica do Sul a Paleolama seria generalistas com dieta grandes leses com aumento no nmero de clulas tumorais
mista e na Amrica do Sul especialista em plantas do tipo C3. e rea necrosada dos animais controle quando comparados
com os animais que receberam injeo de clulas tumorais
Palavras-chaves: Paleoecologia,Istopos pr-tratadas com a apigenina. fim de avaliar a reatividade
******************************************************************* microglial frente ao ambiente tumoral, foram realizadas
******************************************* imunomarcaes citoqumicas para a protena IBA-1.
Dessa forma, notvel o aumento da expresso de clulas
microgliais assim como alterao da sua morfologia para um
estado ativado da regio tumoral nas condies controle e
uma menor expresso destas clulas na rea peritumoral. Por
conseguinte, no grupo de animais injetados com as clulas
pr-tratadas por apigenina, as microglias da rea tumoral
mostraram-se ativadas, enquanto na rea peritumoral no
houve alterao morfolgica. Estes achados demonstram
que o flavonoide apigenina apresenta capacidade
inibitria ao crescimento tumoral, com propriedades
antiproliferativa, morfognica, antimigratria e indutiva
da microgliose alterando o perfil regulatrio de protenas

Congresso da UFBA 2017 | Caderno de resumos 91


imunomodulatrias em interao com o glioblastoma, rea: CINCIAS BIOLGICAS - FARMACOLOGIA
sugerindo assim que estas molculas podem coadjuvar na
terapia desta patologia. TRABALHO: ANLISE IN VITRO DOS
Palavras-chaves: Glioblastoma, Microglia, Apigenina EFEITOS DO FLAVONOIDE BIS-APIGENINA
*******************************************************************
SOBRE A ATIVAO MICROGLIAL E
ESTUDANTE PIBIC

******************************************* INTEGRIDADE NEURONAL EM CO-CULTURAS


NEURNIO/GLIA
rea: CINCIAS BIOLGICAS - FARMACOLOGIA
TRABALHO: ANLISE FARMACOCINTICA Autor(es): SILVIA LIMA COSTA, JANAINA RIBEIRO

DO TACROLIMUS EM PACIENTES Resumo: O Sistema Nervoso Central (SNC) possui


caractersticas peculiares que distinguem a sua resposta
TRANSPLANTADOS RENAIS inflamatria de outros sistemas no organismo. A inflamao
envolve principalmente a ativao da microglia, que so as
Autor(es): BRUNO JOS DUMT FERNANDES, FABIANE clulas imunoefetoras residentes do SNC e cuja liberao
FERNANDES NEVES de fatores neurotxicos e pr-inflamatrios, incluindo
radicais livres, xido ntrico, citocinas e eicosanoides induz
Resumo: Os estudos sobre o monitoramento teraputico
neurodegenerao. Estudos apontam que a microglia pode
do tacrolimus sugerem um regime de dosagem mais seguro
apresentar diferentes fentipos como: M1 ou ativao
e efetivo, baseado na interpretao das concentraes
clssica (pr-inflamatria) e M2 ou ativao alternativa (anti-
sanguneas do frmaco, e no em decises empricas, como
inflamatria). Uma inflamao extensiva, prolongada ou no
ocorre habitualmente. O monitoramento teraputico
regulada altamente prejudicial ao organismo. Flavonoides
indicado para o tacrolimus devido sua estreita janela
so uma das mais importantes famlias de compostos
teraputica e significativa variabilidade interindividual
fenlicos presentes na natureza, no s pela sua abundncia
na concentrao sangunea. Portanto, a fim de avaliar a
no reino vegetal, mas tambm pelo amplo conjunto de
exposio individual a esse frmaco e determinar o ajuste
atividades biolgicas j demonstradas, incluindo capacidade
do regime de dosagem, o monitoramento teraputico
anti-inflamatria. O objetivo deste trabalho foi analisar os
do tacrolimus altamente recomendado na prtica
efeitos do flavonoide bis-apigenina (FAB) sobre a ativao
clnica. Nesse contexto, as anlises farmacocinticas,
microglial e viabilidade neuronal em co-culturas neurnio/
farmacodinmicas e farmacogenticas surgem como
glia, em modelos experimentais in vitro de neuroinflamao
ferramenta chave na otimizao do regime teraputico,
induzida por IL-1. Para tanto, as clulas foram obtidas do
pois permite o uso de dados para o clculo dos parmetros
crtex cerebral de ratos Wistar neonatos (P0-P2) e cultivadas
farmacocinticos individuais e, subsequentemente,
em meio DMEM F12 suplementado, mantidas em estufa
individualizao do regime de dosagem e imunossupresso
a 37C com 5% de CO2 por 15 dias, com troca de meio
adequada. Embora a anlise de um nmero limitado
a cada 48 h. Posteriormente, foram adicionados, sob a
de amostras seja empregada para determinar o ASC
monocamada de clulas gliais, neurnios obtidos do crtex
do tacrolimus, por enquanto, o monitoramento das
cerebral de embries de ratas Wistar (E14-E16) e as clulas
concentraes sanguneas de vale o mtodo de escolha.
foram mantidas por mais 8 dias sob as mesmas condies.
Objetivos: Analisar a farmacocintica do tacrolimus atravs
As clulas foram submetidas a estimulo neuroinflamatrio
da concentrao de vale, concentrao sangunea e
com IL-1; 10 ng/mL por 24 h e depois foram tratadas
ASC; Propor o ajuste da dose medicamentosa em funo
com FAB a 1M por mais 24 h. Posteriormente foi
da farmacocintica e farmacodinmica do tacrolimus.
realizada imunonocitoqumica para IBA-1, para anlise
Metodologia: participaro da investigao 10 a 30 pacientes
da morfologia microglial. A avaliao neuroprotetora do
(idade entre 5 e 70 anos), de ambos os sexos, em uso
FAB foi realizada atravs da mensurao do xido Ntrico
do tacrolimus, sob a forma de cpsulas (1mg/12h ou
e da anlise de viabilidade neuronal por Fluoro Jade B. Os
5mg/12h), que poder ser administrado por via oral, de
resultados mostraram que, aps insulto neuroinflamatrio,
acordo com a funo renal. As concentraes do tacrolimus
o tratamento com FAB foi capaz de reduzir a produo
em sangue total sero determinadas, qualitativamente,
de xido ntrico, preservar a integridade dos neurnios e
atravs de teste imunoenzimtico com micropartculas por
manter a morfologia glial similar a condies controle. Esses
quimioluminescncia (CMIA) e a creatinina srica por ensaio
resultados reafirmam o potencial neuroprotetor da FAB. No
cintico de dois pontos. Os parmetros farmacocinticos e o
entanto, novos estudos tornam-se necessrios para analisar
regime de dosagem individualizado sero estimados atravs
seu mecanismo de ao.
do programa PK Solution, com o objetivo de alcanar a
concentrao alvo do tacrolimus. A concentrao de IL-2 em Palavras-chaves: SNC, Neuroinflamao, Flavonoides
amostras de plasma ser determinada atravs de ELISA. Os
resultados sero expressos atravs das medianas, mdias e *******************************************************************
intervalos de confiana de 95% (IC 95). *******************************************

Palavras-chaves: Tacrolimus, Farmacocintica,


Monitoramento Teraputico rea: CINCIAS BIOLGICAS - FARMACOLOGIA
*******************************************************************
TRABALHO: AVALIAO DOS EFEITOS
******************************************* DO TRATAMENTO SUBCRNICO COM
CARVACROL SOBRE A HEMODINMICA
CARDIOVASCULAR DE ANIMAIS
ESPONTANEAMENTE HIPERTENSOS
Autor(es): CARLA FIAMA AZEVEDO MEDEIROS, SAMUEL
BARBOSA CAMARGO, DARZY FLVIA SILVA, LILIANE
BARRETO SILVA

92 Congresso da UFBA 2017 | Caderno de resumos


Resumo: Introduo: A hipertenso arterial uma Diante das limitaes dos inibidores de COX, seletivos ou
doena cardiovascular crnica, de alta prevalncia e suas no seletivos, novos alvos teraputicos tm sido explorados
complicaes so responsveis por milhes de mortes em para o desenvolvimento de frmacos mais eficientes e
todo o mundo. Faz-se necessria a busca de tratamentos seguros. Nesse cenrio, a enzima mPGES-1 surge como alvo
alternativos para seu controle e os leos essenciais extrados teraputico promissor. Os produtos naturais tm um papel
de plantas, apresentam aes biolgicas importantes e de destaque em vrios programas de desenvolvimento de

ESTUDANTE PIBIC
podem servir como fontes promissoras de novos frmacos. frmacos. Todavia, uma das limitaes para seu emprego
Dentre os monoterpenos, componentes dos leos essenciais, no desenvolvimento de frmacos a escassez de estudos
o carvacrol (CARV) exerce funes biolgicas variadas e demonstrando a absoro dos princpios ativos, pois,
desempenha atividades no sistema cardiovascular. Objetivo: so raros os estudos que identificam e quantificam as
Avaliar, no sistema cardiovascular, os efeitos do tratamento substncias e seus metablitos no plasma e tecidos de
subcrnico em animais espontaneamente hipertensos. animais que receberam essas drogas. Visando contribuir para
Mtodos: Foram utilizados animais espontaneamente o desenvolvimento de antiinflamatrios e/ou antipirticos
hipertensos (SHR) com 9 a 12 semanas de idade, efetivos e com menor incidncia de efeitos colaterais, a
divididos em dois grupos: carvacrol (50 mg/kg) e veculo presente proposta inclui o uso do leo essencial de Lippia
(cremophor+salina). Durante o tratamento subcrnico Grata complexado com ciclodextrina, passando pela
foi medido peso corporal, consumo de gua e rao dos avaliao farmacolgica dessa substncia na inflamao e
animais tratados com carvacrol, assim como o veculo, febre. Utilizando-se de modelo in vivo, os camundongos
administrados via orogstrica. A cada 5 dias foram realizados sero operados para implantao intraperitoneal dos
procedimentos de medida indireta da presso arterial. mini transmissores (SubCue) para medida de temperatura
Aps tratamento, o corao foi removido, medido o seu corporal pela tcnica de radiotelemetria uma semana
peso mido, colocado em estufa a 60C durante 24 horas e antes do experimento. No dia do experimento os animais
avaliado seu peso seco. Resultados: Os ratos tratados durante recebero diferentes concentraes de estmulos pirognicos
21 dias apresentaram desenvolvimento corporal semelhante (LPS ou Escherichia coli) e a temperatura ser aferida por 8h.
entre os grupos, assim como no foram observadas Esse procedimento para que seja construda uma curva
diferenas estatisticamente significantes nos valores de dose-resposta para a obteno da dose capaz de induzir
consumo de rao (VEI: 20.500.8 g, n=4; CARV: 20,01.8g, febre que ser utilizada nos experimentos posteriores. Com
n=6;), e gua (VEI: 34.752.2 mL, n=4; CARV: 42.8311.5 a curva de induo de febre estabelecida, 30 minutos antes
mL, n=6;). Em nenhum dos grupos tratados foi observada do estmulo pirognico, passaremos a pr-tratar os animais
alteraes significantes nos valores de frequncia cardaca com leo essencial de Lippia Grata complexado com
(VEI: 322.7522.0 bpm, n=4; CARV: 342.8322.4 bpm, n=6;). ciclodextrina. No estudo, sero utilizados um total de vinte e
Os animais tratados com veculo apresentaram um crescente um camundongos, dos quais foram divididos em 3 grupos de
aumento da presso arterial mdia, assim como o grupo 7 camundongos cada: grupo controle que receber apenas
de animais tratado com carvacrol, que apresentou nveis a injeo do leo essencial de Lippia Grata complexado
de presso arterial semelhantes estatisticamente ao grupo com ciclodextrina, um grupo A que recebera apenas injeo
veculo ao final do tratamento (VEI: 181,110,7mmHg, contendo LPS e grupo B que receber primeiro a injeo
n=4; CARV: 164,26,4mmHg, n=6;). Com relao ao peso com Lippia Grata e 30 minutos depois a injeo com LPS.
cardaco, no foram observadas diferenas estatisticamente
significantes do ndice de massa cardaca entre os grupos. Palavras-chaves: Inflamao, Febre, Lippia Grata
Concluso: Os resultados sugerem que o tratamento *******************************************************************
subcrnico com carvacrol por 21 dias, pelo menos na *******************************************
dose de 50 mg/kg no apresentou potencial efeito anti-
hipertensivo em animais espontaneamente hipertensos,
sendo capaz apenas de manter os nveis de presso arterial, rea: CINCIAS BIOLGICAS - FARMACOLOGIA
sem significantes alteraes na frequncia cardaca e no TRABALHO: INFLUNCIA DO
ndice de massa do corao.
HIPOTIREOIDISMO NO INFLUXO
Palavras-chaves: Carvacrol, anti-hipertensivo,
monoterpenos
LEUCOCITRIO APS ENVENENAMENTO
*******************************************************************
EXPERIMENTAL PELO VENENO DE
******************************************* BOTHROPS LEUCURUS

rea: CINCIAS BIOLGICAS - FARMACOLOGIA Autor(es): LUCIANA LYRA CASAIS E SILVA, GSSICA
MIRANDA SANTOS MATOS, SEILMA SANTOS
TRABALHO: EFEITO DA INIBIO DA
Resumo: Os casos de acidente envolvendo serpentes
ENZIMA PROSTAGLANDINA E SINTASE afetam grande parte da populao e responsvel pelo
(PGES)-1 COM COM LEO ESSENCIAL risco de morbi-mortalidade dos envenenados. Alm disso,
constituem um problema de Sade Pblica em regies
DE LIPPIA GRATA COMPLEXADO COM tropicais do mundo. O gnero Bothrops causa cerca de
CICLODEXTRINA SOBRE A FEBRE INDUZIDA 90% desses acidentes no Brasil, e Bothrops leucurus a
principal responsvel pelos acidentes ofdicos ocorridos
PELA INJEO DE LPS EM CAMUNDONGOS na Bahia. Em um acidente ofdico, podem ocorrer efeitos
sistmicos, como alterao na coagulao sangunea, cefalia,
Autor(es): JOO PEDRO ASSUNO SANTOS, DENIS DE vmitos, que geralmente melhoram aps a aplicao do
MELO SOARES soro antibotrpico, e efeitos locais, como hemorragia, dor,
necrose, que no so totalmente neutralizados aps a
Resumo: Estima-se que em 2010, foram gastos R$ 1,5
administrao de soro. Os efeitos locais podem resultar em
bilho na compra de anti-inflamatrios no-esteroidais
perda funcional/tecidual do membro lesado. A partir da,
no Brasil. O principal alvo destes frmacos o bloqueio
busca-se elaborar estudos de investigao dos mecanismos
das ciclooxigenases (COX) 1 e 2 e, consequentemente, da
envolvidos na gnese, no desenvolvimento destes efeitos
prostaglandina E2 (PGE2). Entretanto efeitos colaterais
e alternativas para minimizar as leses. No mecanismo de
cardiovasculares e renais limitam o uso desses frmacos.
resposta do envenenamento, leuccitos so recrutados

Congresso da UFBA 2017 | Caderno de resumos 93


para o local de foco da leso, tanto polimorfonucleares heparina para contagem de clulas, em diferentes intervalos
(neutrfilos) quanto os mononucleares (macrfagos), que de tempo. O veneno de B.leucurus induziu um aumento de
migram dos vasos para os tecidos lesionados para destrurem leuccitos para cavidade peritoneal de ratos, com pico s 6
o agente causador da leso. Entretanto, a caracterizao do horas. Para investigar os mediadores envolvidos na resposta,
perfil leucocitrio nas diferentes espcies de Bothrops ainda grupos de animais foram tratados com antagonistas de
no est totalmente esclarecida. A presena dessas clulas receptores ou inibidores de sntese de alguns mediadores
ESTUDANTE PIBIC

inflamatrias na rea lesionada de grande importncia, e inflamatrios: Prometazina (antagonista do receptor de


no processo de reparo, vale mencionar que os macrfagos histamina do tipo H1), Dexametasona (inibidor da enzima
e neutrfilos so bons modelos experimentais para estudos fosfolipase A2), Celecoxib (inibidor seletivo da ciclo-
e investigaes pr-inflamatrias de venenos e toxinas oxigenase 2), Zileuton (inibidor da 5- lipoxigenase) e L-NAME
de serpentes. A participao de hormnios tambm (inibidor inespecfico da xido ntrico sintase). Os animais
fator importante nos processos da cicatrizao. Estudos controle receberam apenas veneno. Celecoxib reduziu o
prvios, ainda que seja um aspecto pouco estudado, nmero de leuccitos totais no local da inflamao, mas no
demonstraram que o hipotireoidismo reduz a resposta local o nmero de polimorfonucleares; Dexametasona e L-NAME
do envenenamento botrpico. Os hormnios tireoideanos reduziram o influxo de polimorfonucleares; Zileuton e
estimulam a proliferao epidrmica e, dessa forma, nveis Prometazina no alteraram a migrao de leuccitos para
sricos alterados deste hormnio, como acontece no a regio peritoneal. Estes resultados demonstram que
hipertireoidismo e hipotireoidismo, alteram o processo de o veneno de B.leucurus ativa a migrao de leuccitos
cicatrizao, O objetivo do presente estudo foi demonstrar para a cavidade peritoneal e este efeito dependente da
a influncia do hipotireoidismo no influxo leucocitrio aps participao de xido ntrico, fosfolipases e da ativao de
envenenamento experimental pelo veneno de Bothrops COX-2 com liberao de prostaglandinas.
leucurus. Foram utilizados ratos Wistar machos inoculados
i.p. com veneno de Bothrops leucurus (125 g/Kg/3 mL). A Palavras-chaves: Bothrops leucurus, Leuccitos, Mediadores
determinao do nmero total e diferencial de leuccitos inflamatrios
peritoneais, em diferentes tempos, foi determinada em *******************************************************************
cmara de Neubauer e lminas coradas com Hema 3. O *******************************************
projeto foi aprovado pela CEUA-ICS (no 083/2015). Os
resultados demonstraram que o estado hipotireoidiano
diminuiu o influxo leucocitrio e parece alterar a ativao de rea: CINCIAS BIOLGICAS - FARMACOLOGIA
clulas induzidas pelo veneno, o que pode alterar a resposta TRABALHO: REINSTALAO DA
local em pacientes portadores desta condio clnica aps o
envenenamento botrpico. AUTOADMINISTRAO DE ETANOL
Palavras-chaves: Hipotireoidismo, Inflamao
INDUZIDA POR ESTRESSE E POR ETANOL EM
*******************************************************************
RATOS.
*******************************************
Autor(es): LAS PEIXOTO MACHADO, RODRIGO MOLINI
LEO
rea: CINCIAS BIOLGICAS - FARMACOLOGIA
Resumo: A dependncia do lcool um problema de
TRABALHO: PARTICIPAO DE LEUCCITOS sade pblica que afeta a populao brasileira e mundial.
NA INFLAMAO INDUZIDA PELO VENENO Atualmente os mtodos utilizados para tratar indivduos
no so eficientes, visto uma grande parcela das pessoas
DE BOTHROPS LEUCURUS que tentam se abster do uso de etanol e recaem ao uso
dessa substncia mesmo aps muitos anos de tratamento
Autor(es): SEILMA SANTOS, LUCIANA LYRA CASAIS E SILVA e abstinncia. Diversos fatores podem contribuir para
a recada ao uso de substncias psicoativas, como a
Resumo: Seilma Santos da Cruz, Gessica Miranda Santos
exposio prpria droga, a ambientes previamente
Matos, Luciana L Casais-e-Silva. No Brasil, acidentes ofdicos
associados com o uso da droga e a eventos aversivos como
representam um problema de sade pblica negligenciado
o estresse. Este ltimo fator tem sido apontado como um
e na Regio Metropolitana de Salvador, Bothrops leucurus
estmulo importante sendo observado um grande ndice
o principal agente etiolgico dos acidentes ofdicos. As
de recidivas ao uso de etanol aps serem expostos a
manifestaes sistmicas incluem alteraes da hemostasia,
situaes estressantes. Dentre os modelos de reinstalao
caracterizadas por distrbios da coagulao e da agregao
temos o condicionamento operante (autoadministrao)
plaquetria, que so geralmente neutralizadas pela
onde os animais so inicialmente treinados para auto
soroterapia, porm, nas manifestaes locais, caracterizadas
administrar a droga pela via intravenosa ou oral. Aps a
por dor, edema, hemorragia e mionecrose, a soroterapia no
extino do comportamento, a capacidade de uma nica
tem se mostrado to eficaz. Neste sentido a investigao dos
injeo da droga ou a exposio ao estresse em reinstalar o
efeitos locais causados por envenenamento botrpico se
comportamento operante avaliada. Esses procedimentos
reveste de importncia. Estudos tm demonstrado grande
demonstram que de forma semelhante ao observado em
influxo de leuccitos, tanto polimorfonuclear quanto
humanos, a reexposio droga ou a exposio a estresse
mononuclear no local do envenenamento botrpico. O
pode reinstalar a autoadministrao (AA). Desta forma, no
veneno botrpico tambm tem se mostrado responsvel
presente estudo analisamos a influncia da exposio do
pela induo e liberao de mediadores inflamatrios em
estresse na recada do comportamento de busca de etanol
diferentes espcies do gnero Bothrops. Entretanto, no
em ratos. Utilizamos ratos das linhagens Wistar e SHR (270g
existem estudos sobre a migrao leucocitria e mediadores
20g). Para habituao s condies experimentais, os animais
inflamatrios induzidos por esta espcie. Deste modo, o
foram treinados para auto administrar uma soluo de etanol
objetivo deste estudo foi demonstrar o perfil leucocitrio no
10%, atravs do pressionamento de barras ativas da caixa de
envenenamento causado por B. leucurus e posteriormente,
AA. Uma barra inativa tambm era apresentada, porm a
investigar a participao dos mediadores inflamatrios no
presso nessa barra no resultava na liberao de um reforo.
influxoleucocitrio induzido por B. leucurus. O veneno de
O treino da AA foi iniciado com sesses dirias de 60 min
B. leucurus (125 g/kg) ou soluo salina estril foi injetado
em que as respostas eram reforadas com uma soluo de
na cavidade peritoneal de ratos e em seguida, os animais
0,2% de sacarina por um perodo de 4 dias. Seguida por 2
foram anestesiados e a cavidade peritoneal lavada com PBS/

94 Congresso da UFBA 2017 | Caderno de resumos


sesses com uma soluo mista de 0,2% de sacarina e etanol ICS 72/2014). Para caracterizao do perfil hiperalgsico
10%; e outras 2 sesses com uma soluo mista de 0,05% do VBL, os animais foram inoculados com VBL (1, 5, 10 ou
de sacarina e etanol 10%. Aps a etapa de treino as sesses 15 g/pata). Para determinao dos provveis mediadores
de AA eram reforadas apenas com soluo de etanol 10% inflamatrios os animais receberam tratamento com
durante aproximadamente 20 dias ou at estabelecer uma frmacos antagonistas de receptor ou inibidores de sntese
estabilizao da AA onde os animais apresentavam durante de alguns mediadores envolvidos na resposta nociceptiva:

ESTUDANTE PIBIC
as trs ltimas sesses uma diferena de menos de 10% no prometazina e metisergida (antagonistas de receptores H1
nmero de repostas. Aps a estabilizao da AA os animais e de 5-HT, respectivamente); dexametasona (inibidor de
foram submetidos ao processo de extino. A etapa de FLA2); celecoxibe (inibidor especfico de COX-2); zileuton
extino consistiu de sesses dirias onde as respostas no (inibidor da 5-lipoxigenase); ou L-NAME (inibidor da NO
eram mais reforadas pela liberao de etanol e os animais sintase). A avaliao da hiperalgesia mecnica foi feita
diminuam o nmero de respostas na barra ativa. A etapa atravs do mtodo de von Frey eletrnico. Os animais foram
de extino era finalizada quando os animais alcanavam o estimulados na pata posterior direita com fora crescente at
critrio de extino (nmero de respostas inferior a 30% da exibirem uma resposta positiva, caracterizada por lambida
mdia da trs ltimas sesses de aquisio da AA). O teste ou retirada da pata. Nossos resultados indicam que a
de reinstalao foi realizado 24 horas aps a ltima sesso hiperalgesia induzida pelo VBL no depende da dose e de
de extino do comportamento e consistiu na exposio longa durao, persistindo at, pelo menos, 24 horas aps o
prvia dos ratos ao estresse de imobilizao por 30 minutos. envenenamento. Esta ao do veneno mediada por FLA2s,
Em seguida os animais foram colocados nas caixas de AA, prostaglandinas, leucotrienos e xido ntrico, mas no por
nos mesmos parmetros da fase de extino. Os resultados receptores de histamina e serotonina, sugerindo mediadores
representam os procedimentos de padronizao do que podem ser alvos de terapias alternativas no tratamento
protocolo de reinstalao da autoadministrao de etanol do envenenamento.
10% induzida por estresse de imobilizao onde foram
utilizadas duas linhagens diferentes de animais. Aps a Palavras-chaves: Veneno, Bothrops leucurus,
exposio ao estresse foi observado aumento do nmero de Hipernocicepo mecnica
respostas na barra ativa dos ratos Wistar quando comparado *******************************************************************
com a etapa de extino. Porm os resultados apresentam *******************************************
uma tendncia para reinstalao da AA de etanol em ratos
Wistar, o que pode ser comprovado com o aumento do
nmero de animais no grupo. No foi observado alterao rea: CINCIAS BIOLGICAS - FISIOLOGIA
do nmero de respostas na barra inativa. Apesar dos ratos TRABALHO: CARACTERIZAO DA
SHR apresentarem uma maior busca pelo etanol na fase de
treinamento quando comparados com os ratos Wistar, a ATIVIDADE FSICA REALIZADA POR
reinstalao da autoadministrao de etanol em ratos SHR MULHERES NO PS-MENOPAUSA E SUAS
no foi observada. Diante dos resultados observamos um
melhor comportamento de busca por etanol na linhagem COMORBIDADES ASSOCIADAS
Wistar porm o aumento do nmero de animais se faz
necessrio. Nas prximas etapas de padronizao algumas Autor(es): STFANO CALADO, DIEGO LOPES, DEBORAH
alteraes sero testadas como a utilizao de outra SANTOS, DANIELA DA SILVA PATEZ SOUZA, ANDRESSA
linhagem de rato (Long-Evans), inverso do ciclo claro- ANTNIA SANTOS COSTA, ALICE OLIVEIRA PRADO,
escuro de luz e a exposio a outros tipos de estresse. GILVANIA SILVA SANTOS, ROBSON AMARO AUGUSTO DA
SILVA
Palavras-chaves: Etanol, Recada, Estresse
Resumo: Mulheres na fase ps-menopausal apresentam
******************************************************************* diversos agravos crnicos associados com a reduo do
******************************************* estrgeno. A obesidade, a hipertenso arterial e diabetes
mellitus aparecem como as principais doenas desse perodo
rea: CINCIAS BIOLGICAS - FISIOLOGIA da vida, sendo que o sedentarismo tem sido associado
com formas mais graves dessas doenas. Este trabalho teve
TRABALHO: AVALIAO DA ATIVIDADE como objetivo avaliar a influncia da atividade fsica na
HIPERNOCICEPTIVA MECNICA DO percepo da qualidade de vida dessas idosas ao quantificar
as principais comorbidades em portadoras de diabetes
VENENO DE BOTHROPS LEUCURUS e hipertenso. Para a realizao do estudo, uma amostra
de 163 mulheres com idades entre 60 e 80 anos, sendo
Autor(es): RODRIGO MAIA MARQUES, ELLEN CAROLINE 64 mulheres ativas e 99 sedentrias, tendo diagnstico
PINHEIRO SILVA, SORAIA DA SILVA CAMARGO, LUCIANA positivo de hipertenso arterial e diabetes mellitus, assistidas
LYRA CASAIS E SILVA nas Unidades de Sade da Famlia (USF) de Vitria da
Conquista-BA foi utilizada. Questionrios de caracterizao
Resumo: Dor uma experincia sensorial e emocional
sociodemogrfica, qualidade de vida e o Questionrio
desagradvel associada a danos teciduais reais ou potenciais
Internacional de Atividade Fsica (IPAQ) foram utilizados
ou descritos em tais termos. tambm o sintoma local
para traar o perfil das pacientes, avaliar as condies de
mais comum presente nos casos de envenenamento por
estilo de vida e a separao das praticantes de atividade fsica
serpentes do gnero Bothrops. A serpente B. leucurus
das sedentrias. Em relao aos dados sociodemogrficos,
apresenta grande distribuio na Bahia e o principal
o estudo indicou que a maioria das idosas eram casadas,
agente etiolgico dos casos de acidentes por animais
donas de casa, apresentavam mdias de paridade de 4,391
peonhentos do Estado. Estudos sobre os eventos locais do
para ativas e 4,465 para sedentrias, moravam em casa
envenenamento so importantes, uma vez que a soroterapia
prpria com mdias de 3,094 residentes para as ativas e
no completamente eficaz na reverso destes sintomas.
3,283 para as sedentrias, eram catlicas, no trabalhavam
Desta forma, o objetivo deste trabalho foi caracterizar a
fora, possuam renda entre 1 e 2 salrios mnimos com
hiperalgesia mecnica promovida pelo veneno da B. leucurus
mdias de dependentes de 2,875 para as ativas e 3,081 para
(VBL) e investigar os mediadores inflamatrios envolvidos
as sedentrias. Em relao aos dados de estilo de vida e
nesta resposta. Foram utilizados camundongos Swiss,
sade, constatou-se, relao direta entre hipertenso arterial,
machos, pesando entre 20 e 30 g, mantidos em biotrio com
diabetes mellitus, dislipidemia relatado em 28 idosas ativas e
gua e rao ad libitum (protocolo aprovado pela CEUA-

Congresso da UFBA 2017 | Caderno de resumos 95


50 idosas sedentrias, excesso de peso relatado em 27 idosas relao s suas histopatologias por meio de quantificao
ativas e 30 idosas sedentrias, asma/bronquite relatada morfomtrica. Para a execuo do seguinte trabalho foi
em 8 idosas ativas e 21 idosas ativas, e doenas cardacas coletada a espcie Sphoeroides testudineus (LINNAEUS,
relatadas em 7 idosas ativas e 22 idosas sedentrias. Foi 1758), conhecido popularmente como baiac (n=4), que
observada maior prevalncia de comorbidades em idosas apresenta ampla distribuio desde o EUA at a costa do
sedentrias, estabelecendo a atividade fsica como agente sul do Brasil; os exemplares foram coletados em dois locais
ESTUDANTE PIBIC

importante contra essas comorbidades associadas a diabetes diferentes, no esturio de rio Jaguaripe sendo considerado
mellitus e hipertenso. Em concluso, foi observado que as o de menor impacto pelas aes antrpicas e na Baa
idosas ativas apresentam um envelhecimento mais saudvel de Aratu na cidade de Salvador, que contm indstrias
quando comparadas as idosas sedentrias, com uma menor em suas proximidades. De cada indivduo foi retirada
frequncia de comorbidades associadas a hipertenso e uma hemibrnquia que, posteriormente, foi submetida
diabetes mellitus, sendo a prtica regular de atividade fsica ao processamento histolgico. Aps o processamento,
uma importante aliada para uma maior qualidade de vida. ocorreu a montagem e colorao das lminas com o
tecido branquial que foram vistas microscopicamente, e
Palavras-chaves: Diabetes mellitus, Hipertenso arterial, de onde foram realizadas micrografias para anlise. Aps
Atividade fsica isso, as leses foram submetidas s quantificaes, com o
******************************************************************* mtodo de contabilizao de pontos, com a utilizao do
******************************************* programa computacional Stepanizer. Para as quantificaes
houve a construo de duas tabelas seguindo a ordem de 4
espcimes representando os dois locais, com dois blocos de
rea: CINCIAS BIOLGICAS - FISIOLOGIA historesina, 4 lminas e imagens de trs diferentes seces,
TRABALHO: ECOTOXICOLOGIA E foram utilizadas um total de 192 imagens. Foram feitas
as quantificaes das mdias, com a utilizao da tabela
BIOMONITORAMENTO AMBIENTAL de presena e ausncia de leses, para que ento fosse
EM PEIXES DA BAA DE TODOS OS calculada o nmero de leses de acordo com o tipo I, II ou III
(segundo Mallat, 1985), e feita a mdia que representaria o
SANTOS, BAHIA: ESTUDO ESTRUTURAL local no ndice. Com relao estrutura das brnquias, todas
DAS BRNQUIAS DE SPHOEROIDES apresentavam organizao geral das brnquias de telesteos.
Cada arco branquial possua uma estrutura cartilaginosa,
TESTUDINEUS uma fileira dupla de filamentos branquiais achatados dorso-
ventralmente. Esses filamentos subdividem-se em lamelas
Autor(es): LORENA MARCELA RIBEIRO, ANDR LUIS DA branquiais que se encontram dispostas perpendicularmente.
CRUZ Com a classificao das leses, se obteve a severidade das
Resumo: O ambiente aqutico vem sofrendo com grandes leses, que foram dos tipos I e II, no se obteve leses do
impactos antrpicos, principalmente pela descarga de tipo III. A somatria das leses do tipo I e tipo II em Aratu,
efluentes que podem ser resduos industriais, agrcolas ou foram de 6,97 e 17,4 respectivamente. Para Jaguaripe
o prprio lixo domstico gerado pela populao. medida foram observadas as somatrias de 6,29 e 11,7 para leses
que a densidade populacional aumenta tambm cresce do tipo I e II, respectivamente. Sendo assim, Aratu obteve
a quantidade de lixo domstico descartado, assim como valores mdios de 12,18 7,37 e Jaguaripe de 8,99 3,82
tambm h maior demanda industrial e agrcola, desse jeito para todas as leses encontradas. Em Aratu foi visto que as
aumentando a descarga desses materiais nesses ambientes. vasodilataes ocuparam cerca de 27% dessas leses, seguida
Um das substncias que mais preocupam a atual sociedade de aneurismas com 17%. Em Jaguaripe as vasodilataes
so os metais por no serem degradveis ou decompostos foram semelhantes em nmero qualitativo de leses
em formas menos txicas, acabam por bioacumularem-se e ocupando o primeiro lugar, com cerca de 30%, seguida
biomagnificarem-se. O resultado dessa poluio so efeitos de aneurismas com 15% e proliferaes lamelares, com as
negativos, como diminuio das espcies, comprometimento outras leses se mostrando em pequenas porcentagens.
na qualidade da gua ou da sade humana, tornando-se, Estudos anteriores, inseridos neste projeto (OLIVEIRA et
assim, uma prioridade nos estudos e programas de controle al., 2017) mostrou que as espcies Diapterus rhombeus e
ambiental no mundo. A biota aqutica de uma diversidade Ogcocephalus vespertilio apresentaram brnquias mais
impressionante e essa a que mais sofre com esses impactos. lesionadas na regio de Aratu, considerada previamente
Por isso tem aumentado o nmero de pesquisas utilizando como impactada, devido as atividades que so desenvolvidas
esses organismos, para inferir o quo esto sofrendo nesta rea.
medida que essa poluio cresce, esses so chamados Palavras-chaves: ecotoxicologia, brnquias, metais
de bioindicadores. Nesse sentido, o uso de peixes como
bioindicadores ambientais frequente, esses organismos *******************************************************************
fazem parte do mais numeroso grupo dentre os vertebrados *******************************************