Você está na página 1de 3

EXERCICOS BIOLOGIA MOLECULAR

Aluno(a):

1. Por que o DNA de algumas espcies mais longo do que o de outras?

2. Qual a consequncia da haploidia em procariotos?

3. O tamanho do genoma proporcional ao nmero de genes seres


procariotos?

4. Qual a conseqncia das diferenas de contedo G+C de genomas


diferentes?

5. ) Um pesquisador est estudando um gene relacionado com a Distrofia


Muscular (DMa). Para iniciar os experimentos gostaria de clonar o gene DMa
de clulas musculares de camundongos (esquematizado na figura abaixo) em
um vetor de expresso e produzir a protena em larga escala. Os nmeros
indicados correspondem posio dos nucleotdeos. O cdon de iniciao
(ATG) se encontra na posio 1-3 e o de terminao (TGA) na posio 658-
660.

gene DMa

Exon1 Intron Exon2

1 210 360 660

Considerando que 1 aminocido codificado por 3 nucleotdeos, qual o


nmero de aminocidos da protena DMa traduzida a partir do RNA
mensageiro?

6- Abaixo est a seqncia de nucleotdeos do RNA mensageiro que codifica


um pequeno peptdeo.

5- AUGCCCAAACAUUAUACUUUUGUCGCCUAGUAAUAGA n=50

Com auxlio da tabela de cdons determinar a seqncia de


aminocidos do peptdeo traduzido a partir deste mRNA. Considere a
primeira trinca de nucleotdeos (AUG) como codon de iniciao.
7- ) Um hormnio hipofisirio de mamfero conhecido como MHH-9
constitudo por uma cadeia polipeptdica de 9 aminocidos (Cys-Tyr-Ile-Gln-
Asn-Cys-Pro-Leu-Gly) como indicado abaixo. Baseando-se na sequncia do
gene MHH-9, os anticdons dos tRNAs envolvidos na sntese de MHH-9
tambm esto indicados. Pergunta-se :

a) Qual a sequncia do RNA mensageiro (mRNA) que codifica o hormnio


MHH-9?

b) Qual a sequncia do gene que codifica o hormnio MHH-9.

c) Recentemente foi isolada uma variante denominada MHH-9A que apresenta


uma duplicao de 3 aminocidos (Tyr-Ile-Gln) inserida entre as posies 8 e 9
de MHH-9. Definir a sequncia do mRNA MHH-9A.

Posio 1 2 3 4 5 6 7 8 9
nacadeia
Aminocido Cistena Tirosina Isoleucina Glutamina Asparagina Cistena Prolina Leucina Glicina

Cys Tyr Ile Gln Asn Cys Pro Leu Gly


Anticodon ACA AUG UAU GUU UUG ACG GGA GAA CCA

8- Compare a organizao e expresso de genes procariticos e eucariticos e


responda as questes abaixo:

a) Como est organizado na clula o material gentico dos eucariotos e


procariotos?
b) Qual o grau de acoplamento entre transcrio e traduo nos
procariotos?
c) Por que motivo vrios antibiticos inibem a expresso gnica
(transcrio ou traduo) na bactria mas no tem efeito sobre a clula
eucaritica?