Escolar Documentos
Profissional Documentos
Cultura Documentos
org/content/356/6334/186/suppl/DC1
Movies S1 to S3
Schaefer et al. Supplementary Materials 2
Genotyping of the trm6 allele: Wild type allele (TRM6-01/GK_048G03-LP); Mutant allele
(GK_048G03-RP/LBGabi1).
TRM6-01 AGTTGGCTGAGATTGAGTACAT
GK_048G03-LP ATAGGCCGGTTACACTCCTTG
GK_048G03-RP TGTTACTGTCGAAAGTTCGGTC
LBGabi1 CCCATTTGGACGTGAATGTAGACAC
Genotyping of the trm8 allele: Wild type allele (TRM-04/TRM-05); Mutant allele (TRM8-
03/LBSalk2)
TRM8-03 TGTAAACAAGGTTCCAGTGGA
TRM8-04 CCCAAAACGGTCTGCGTAAA
TRM8-05 TTCTCCTCGGCCTTCCATTT
Constructs
To obtain the pTRM7::GUS and pTRM7::TRM71-71-GUS constructs, a region of 2200 bp
upstream of the TRM7 ATG start codon was amplified by PCR from the BAC F20A2 using
Schaefer et al. Supplementary Materials 3
pTRM7-U GGGGACAAGTTTGTACAAAAAAGCAGGCTTGGTTTAAGGAGGAAGGGGACA
TRM771-L GGGGACCACTTTGTACAAGAAAGCTGGGTTCGGGTTGTAAGTTGGGTTC
ProTRM7-ATG GGGGACCACTTTGTACAAGAAAGCTGGGTTCATGATAATTTACCTATGGATCAAAAC
To obtain the TRM6-, TRM7-, and TRM8-3xYFP lines, a 3xYFP tag was fused by
recombineering (23) to the C-terminus of the TRM6, TRM7 and TRM8 genes contained in JAtY
clones 56C09, 53E09 and 79D06 respectively (purchased from the John Innes Centre, Norwich,
UK). In these clones, TRM6 is preceded and followed by 37.7 and 29.7 kb of genomic DNA
respectively, TRM7 coding sequence is preceded and followed by 10.8 and 51.8 kb of genomic
DNA respectively and TRM8 is preceded and followed by 59.0 and 20.0 kb of genomic DNA
respectively. The JAtY transformation-competent bacterial artificial chromosome was
transferred to Escherichia coli strain SW105, kindly provided by S. Creekmore (National Cancer
Institute - Frederick, MD, USA). The recombineering cassette (kind gift of J. Alonso, North
Carolina State University, USA) (24) was inserted downstream of the TRM7 coding sequence as
described previously (23, 24) using primers described below. The junctions between TRM7 and
the 3xYpet tag, as well as the 3xYpet tag itself were sequenced and the JAtY construct carrying
the TRM7-3xYFP construct introduced into Agrobacterium tumefaciens, which was then used to
transform wild type and trm678 Arabidopsis plants. Transformed lines were selected based on
Basta resistance and further characterized by PCR, ensuring the presence of the tagged TRM
genes. The progeny of PCR-positive T1 lines was assessed for YFP fluorescence. For TRM7-
3xYFP lines, 20 lines were analyzed, 14 displaying a weak but consistent fluorescent signal. For
TRM8-3xYFP lines, 34 lines were analyzed, 17 displaying a weak but consistent fluorescent
signal. For TRM6, 20 lines were analyzed and none of them displayed a fluorescent signal.
TRM6-3xYFP construct:
RecF TRM6
TTGTGTCCGAATTAGTTGATGACTTAATTAATGATCTTATCATGTGTTGTGGAGGTGGAGGTGGAGCT
RecR TRM6
AACAATTTCACTCTCATGTTGGAGAGAAGAAGACCAAAGGATTGGTGTCAGGCCCCAGCGGCCGCAGCAGCACC
TestF TRM6 ATTTTGGCAGACCAAGTGTTG
TestR TRM6 GAGTTCGATTCTCGGAACACC
TRM7-3xYFP construct:
RecF TRM7
ATTTAGTTAGTGATATTTTATCTACTAGTGTTCTTAAACGGTCGTTGTTGGGAGGTGGAGGTGGAGCT
RecR TRM7
CAGACAATTTCAGAACCAGAAGAAGCTTCTTACGAAGACAATACAAGTTAGGCCCCAGCGGCCGCAGCAGCACC
TestF TRM7 GAGAGATGATGATCGACGAGC
TestR TRM7 TGAGAAACCGAAGAACTCGTG
Schaefer et al. Supplementary Materials 4
TRM8-3xYFP construct:
RecF TRM8
GGGAAGGGGTAGTTTCTGCTTTAGTTGAGCCTCATCTTCTCTCGGCATTCGGAGGTGGAGGTGGAGCT
RecR TRM8
TCACTTTATCTCAATTCTCATGTCAGAGAAACTATTAGAAGAAGCATCTAGGCCCCAGCGGCCGCAGCAGCACC
TestF TRM8 GAAGGGAGATGGCTTGATTTC
TestR TRM8 TTTGGATTTTCTTGCAGAACC
The vector carrying the 2xPro35S::Cerulean-TUA6 microtubule marker was obtained after
an LR recombination between an entry vector carrying the TUA6 sequence constructed using the
primers TUA6-GW1/TUA6-GW2 and the pSITEII-2C1 destination vector (25). The Cerulean-
TUA6 marker was then introduced into a TRM7-3xYFP line by transformation.
TUA6-GW1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTGATGAGAGAGTGCATTTC
TUA6-GW2 GGGGACCACTTTGTACAAGAAAGCTGGGTTTAGTATTCCTCTCCTT
The vector carrying the pUBI::GFP-MBD microtubules marker was obtained after an LR
recombination between an entry vector carrying the MBD of the mouse MAP4 as defined in (26)
and constructed using the primers MBD-GW1/MBD-GW2, and the pUBN-GFP-Dest destination
vector (27).
MBD-GW1 GGGGACAAGTTTGTACAAAAAAGCAGGCTCCCGGCAAGAAGAAGC
MBD-GW2 GGGGACCACTTTGTACAAGAAAGCTGGGTTTAACCTCCTGCAGGAAAGT
The POK1-YFP construct (13) was obtained from S. Mller (University of Tbingen,
Germany) and the pKN::GFP-MBD construct (28) from S. Huang (Institute of Botany, Beijing,
China). The pSCR::SCR-YFP (29) and pWOX5::erGFP (30) constructs were obtained from B.
Scheres (Wageningen University, Netherlands). All constructs were introduced in the trm678
and the Col0 backgrounds by transformation.
RT-PCR analysis
RNA were isolated from 5 day-old seedlings starting with 100 mg of tissue using the
RNeasy Plant Mini kit (Qiagen). Reverse-transcription was performed from 500 ng of total RNA
with the RevertAid H Minus reverse transcriptase (ThermoFisher) and an Oligo(dT)18 primer,
following the manufacturers protocol. Primers used for semi-quantitative RT-PCR analysis
were:
TRM6 TRM6-03 AGGCTGTTGAGAGGAAACGA
GK_048G03-LP ATAGGCCGGTTACACTCCTTG
Schaefer et al. Supplementary Materials 5
rinsed in water and mounted in Citifluor. Samples were excited at 405 nm with an emission band
of 410-550 nm.
Immuno-localization
Roots of 3 to 4 day-old Arabidopsis seedlings were processed for whole-mount immuno-
localization essentially as described previously (33). Tissues were fixed in 4% paraformaldehyde
and 0.1% Triton X100 in MTSB buffer (25 mM PIPES, 2.5 mM MgSO4, 2.5 mM EGTA, pH
6.9) for 1 hour under vacuum, then rinsed in MTSB buffer with 0.1% Triton X100 buffer for
10 minutes. Samples were then permeabilized in Methanol for 10 minutes and rehydrated in PBS
for 10 minutes. Cell walls were digested using the following buffer for one hour: 25 mM MES
pH 5.5, 8 mM CaCl2, 600 mM mannitol, 0.02% pectolyase and 0.1% macerozyme. Tissues were
hybridized overnight at 4C with the B-5-1-2 monoclonal anti--tubulin (Sigma) and the anti-
KNOLLE antibody described in (34) (kind gift of G. Jrgens, University of Tbingen,
Germany). The next day, tissues were washed for 15 minutes in 50 mM glycine, incubated with
secondary antibodies (Alexa Fluor 555 goat anti-rabbit for KNOLLE antibody and Alexa Fluor
488 goat anti-mouse for the tubulin antibody) for 1 hour and washed again. Seedlings were
mounted in Citifluor and DAPI. A blind counting was set up to count the G2/M microtubule
arrays seen in four roots from the Col0, trm6, trm7, trm8, trm67, trm78, trm68, and trm678
genotypes.
Dissected shoot apical meristems were processed through fixation, sectioning and immuno-
localization as described previously (35).
Segmentation for extraction of root cell layers and recently divided cells
Image analysis of 3D root organization was performed using the ImageJ/Fiji software (36).
We applied a marker based watershed segmentation on propidium iodide stained root images
with the Morphological Segmentation plugin of the MorpholibJ package ((37);
http://imagej.net/MorphoLibJ). Over-segmentation (one cell split in several parts) and under-
segmentation (merged cells) errors were corrected by manually modifying markers before re-
running the watershed transform. The process was repeated until no segmentation error
remained. On the obtained labeled image, we then used in-house developed tools
(https://github.com/L-EL/labeledImg_tools) to manually extract cells of interest from cell files or
to select daughter cells. The volume ratios between daughter cells (volume of the quiescent
center proximal cell/volume of the quiescent center distal cell) were quantified using the
"MorpholibJ>Analyze>Particule Analysis3D" plugin of Fiji. To obtain the flattened view of the
epidermis (Fig. S12A), cortex or endodermis, we used the 3D Viewer plugin from Fiji on
each segmented cell file, to get a snapshot from the external view of the cell file. The flattened
view was then reconstituted putting each snapshot side by side.
section images to produce a final dataset of 1701 division angles for the wild type and 2489 for
the trm678 mutant.
Image processing workflow was developed with the Matlab software (the Mathworks,
Natick, MA), using the Image Processing Toolbox, and custom procedures.
Statistical methods
Statistics analyses were performed using the R package (42) and the XLStat tool
(Addinsoft). Graphs were produced in R using the ggplot2 library and the JGR/Deducer
packages (http://www.deducer.org; http://rforge.net/JGR/). As all datasets strongly departed from
normality (Shapiro-Wilk), non parametric tests were used for comparing samples (Mann-
Whitney). For comparing variances, the Levene's statistic was used under its median form as it is
not sensitive to normality of data.
Schaefer et al. Supplementary Materials 9
Fig. S2. The TTP complex is a major regulator of cortical microtubule arrays in plants
The TTP complex is composed of three components involved in regulation (TON1),
assembly/targeting (TRM) and phosphatase activity (PP2A) of the complex: the Protein
Phosphatase 2A is a heterotrimeric enzyme composed of a scaffolding (A), a catalytic (C), and a
B-type regulatory subunit, here FASS (5). The targets of FASS- PP2A activity are yet unknown.
TON1, a small acidic protein, is required for TTP activity and interacts with Centrin (4) and a
Cyclin-Dependent Kinase (43), connecting the TTP to centrosome-like functions and the cell
cycle machinery. The third TTP component is a member of a plant-specific protein family named
TRM, with 34 members grouped in 8 sub-families in Arabidopsis (8). TRMs directly bind MTs
in vivo and in vitro and control the recruitment of the TON1-FASS complex to microtubules
through specific interaction motifs (7, 8). Mutations in core TTP components like TON1, FASS
or PP2A-A and C lead to absence of PPB, mispositioning of division planes in Arabidopsis,
maize and moss (3-7, 44, 45), and disorganization of the interphase cortical array. Therefore, the
TTP complex has both interphasic and mitotic functions and is a central regulator of MT
organization at the cell's cortex, notably through its action on nucleation geometry (46). Most
TTP components are present in several isoforms in Arabidopsis (PP2A-A: 3; PP2A-C: 2; TON1:
2; TRM: 34), suggesting a high combinatorial diversity of TTP composition and function,
especially in link with the highly variable TRM component (7). Composition, localization and
activity of the TTP complex are consequently expected to vary significantly during the cell
cycle. All TTP components and interactants display various degrees of sequence similarity with
animal centrosomal proteins (4, 8), pointing to an ancient eukaryotic network involved in MT
regulation.
Physical interactions are indicated by blue arrows. A typical TRM is shown, with (in light blue)
the M2 and M3 motifs involved in interaction with TON1 and FASS respectively, and the
Microtubule Binding Domain (MBD) involved in interaction with microtubules (8).
Schaefer et al. Supplementary Materials 11
Fig. S3. The TRM7 promoter contains a M-specific activator (MSA) element
(A) Sequence analysis of the TRM7 promoter in Arabidopsis and related Brassicaceae. Here is
shown a DNA sequence alignment of the TRM7 promoter from Arabidopsis thaliana,
Arabidopsis lyrata, Thelungiella halophila, Capsella rubella and Brassica rapa. A red box
indicates the position of the MSA element.
(B) Alignment of the MSA element found in the TRM7 promoter from Arabidopsis thaliana,
Arabidopsis lyrata, Thelungiella halophila, Capsella rubella and Brassica rapa. The MSA
element consensus sequence is as defined in (47).
Schaefer et al. Supplementary Materials 12
Fig. S5. The TRM7-3xYFP construct complements the trm678 mutant phenotype
In order to check the functionality of the TRM7-3xYFP fusion, we assessed its ability to
complement the trm7 phenotype. Since the trm7 mutant phenotype is rather mild,
complementation was easier to assess in a triple trm678 mutant (ie trm6 trm7 trm8) background.
Therefore, we introduced the TRM7-3xYFP construct in the trm678 triple mutant and assessed
its ability to revert the triple mutant phenotype to a trm68 one (ie trm6 trm8). Out of 24
transgenic lines obtained, 20 displayed a phenotype similar to the wild type and the trm68
mutant, demonstrating the functionality of the TRM7-3xYFP construct. Here are shown 3-week-
old plants.
Schaefer et al. Supplementary Materials 14
Fig. S8. Phenotype of combinations of the trm6, trm7 and trm8 mutations
Pictures of rosettes of 18-day-old plants (A), and of 49-day-old mature plants of wild-type, trm6,
trm7, trm8, trm6 trm7, trm7 trm8, trm6 trm8, trm6 trm7 trm8 genotype.
Schaefer et al. Supplementary Materials 17
Fig. S9. PPB defects in root and shoot apical meristem cells
(A-B) Wild-type (A) and mutant (B) premitotic cells of a 3 day-old seedling expressing a
pCycB1;1::CycB1;11-116-GFP-MBD construct. Images were acquired at a z-resolution of ~200
nm and deconvoluted using the DeconvolutionLab ImageJ plugin (Thikonov-Miller algorithm),
using a theoretical Born and Wolf PSF generated by the PSF Generator plugin
(http://bigwww.epfl.ch/) A single confocal section bissecting the nucleus is shown.
(C-D) Plot of the average gray value along a rectangular region of interest (indicated in red in A,
B), showing a strong accumulation of PPB microtubules at the cortex and a minor peak around
the nucleus in the wild-type (C), and a strong signal of perinuclear MTs with an absence of
Schaefer et al. Supplementary Materials 18
cortical signal in the mutant (D). Red arrows point to the cortex, whereas blue arrowheads point
to the nuclear periphery.
(E, F) Orthogonal (xz) views of the same cells corresponding to the top-bottom direction of
images A and B, showing the PPB cortical ring in the wild-type (E), and its absence in the
mutant (F). Both views are y-projections of the ~2 m central regions of the z-resliced original
stacks. Arrowheads in E and F indicate the optical section planes corresponding to images A and
B respectively. Scale bar, 10 m.
(G-H) Co-immunolocalization in wild type and trm678 shoot apical meristem (A) and floral
meristem cells (B) using an anti-KNOLLE antibody as a G2/M marker (red) and an anti-Tubulin
antibody as a microtubule marker (green). Nuclei were counter-stained with DAPI (blue).
Asterisks indicate G2/M cells defined as KNOLLE-positive without spindle or phragmoplast/cell
plate. Scale bars, 10 m.
(I) Quantification of normal PPBs, abnormal frailed PPBs with sparse microtubules at the cortex
and a high density of perinuclear microtubules and absence of PPB in Col0 and trm678
genotypes. The number of G2/M cells, defined as KNOLLE-positive without spindle or
phragmoplast/cell plate is indicated.
Schaefer et al. Supplementary Materials 19
Fig. S11. Microtubule arrays dynamics during G2/M transition in Col0 and trm678 cells
(A-D) Time lapse analysis of wild type (A) and trm678 (B-D) root tip cells expressing the
pKN::GFP-MBD marker (28) introduced in these two genetic backgrounds by transformation. In
the wild type, cell division is preceded by PPB formation and at prophase by a polarized
accumulation of microtubules on the nuclear surface forming so-called polar caps that mark the
spindle poles upon nuclear envelope breakdown. In contrast, cell divisions in the trm678
background occur without the formation of PPB and polar caps as shown in B-D. The time frame
in minutes and seconds is indicated within all images. Scale bars, 10 m.
Schaefer et al. Supplementary Materials 21
Schaefer et al. Supplementary Materials 22
Fig. S12. Root morphology in trm678, pok1 pok2, and fass mutants
(A) Flattened views of a 100-m-long section of 3D-segmented epidermis, cortex and
endodermis cell layers of wild type and trm678.
(B-I) Longitudinal (B-E) and transverse (F-I) sections of calcofluor white-stained root of 5 day-
old seedlings of wild type (B, F), trm678 (C, G), pok1-1 pok2-3 (D, H) and fass/ton2-5 (E, I)
genotype. Scale bars = 50 m.
(J-M) Five-day-old seedlings of wild type (J), trm678 (K), pok1-1 pok2-3 (L) and fass/ton2-5
(M). Scale bars = 5 mm in J-M and 1 mm in the inset showing a close-up of a fass seedling.
(N-P) Cell identity markers in Col0 and trm678 root tips. (N) Visualization of the endodermis
layer using a SCR-YFP marker (29). Left panels: SCR-YFP signal (orange); right panel: same
overlaid with DAPI staining (cyan). On the left are shown longitudinal median sections through
the middle of the root, and on the right tangential sections passing through the endodermal layer.
This shows the continuity of the endodermis in mutant roots, with rare instances of misalignment
of the cell file. (O) Visualization of the quiescent center using a WOX5 marker (30). Left panels:
WOX5-GFP signal (orange); right panel: same overlaid with DAPI staining in cyan. In mutant
root tips, the QC was readily marked at the origin of root cell files, although WOX5 expression
appeared to encompass a larger number of cells. (P) Differentiating and differentiated
protophloem cells (arrows) in Col0 and trm678 identified on the basis of their characteristic
shape and thickened cell walls in PI stained root tips (31). Scale bars, 20 m (N), 10 m (O), and
50 m (P).
Schaefer et al. Supplementary Materials 23
Fig. S14. Visual classes used for comparing the trm678 mutant with the wild type
(A) Examples of visual classes for assessing TRM7-3xYFP localization in root tip cells (Figure 1
and Table S1). TRM7-3xYFP fluorescence is in grey and microtubules labelling using the Cer-
TUA6 marker in blue.
(B) Examples of visual classes for assessing PPB defects in trm mutants (Figure 2 and Table S2).
(a-h) Abnormal PPB stages (a, b, h: trm78; c-e: trm67; f, g: trm68). (i-l) Normal PPBs in the
wild-type background. (m-p) Absence of PPB in trm678. Arrowheads point to faint/or
asymmetric cortical signals in abnormal PPBs. Microtubules are false colored in yellow, and the
KNOLLE signal in grey.
(C-D) Examples of visual classes for assessing POK1-YFP localization in Col0 (C) and trm678
(D) root tip cells (Figure 4 and Table S4). The POK1-YFP fluorescence is in grey and
microtubules in red.
Scale bars, 10 m.
Schaefer et al. Supplementary Materials 27
Table S1: Localization of the TRM7-3xYFP signal in root tip cells (Figure 1)
Localization of the TRM7-3xYFP signal in Arabidopsis root tip cells at different mitotic stages.
The Cer-TUA6 marker was used to identify mitotic stages (Figure 1). The number of cells
observed in 16 independent roots is indicated. Examples of visual classes for assessing TRM7-
3xYFP localization in root tip cells are shown in Fig. S14.
Schaefer et al. Supplementary Materials 28
Proportion of cells with normal (PPB), abnormal (Abnormal PPB) or absence of PPB (No PPB)
in combinations of trm6, trm7, and trm8 mutations (Figure 2). Abnormal PPB refers to faint
and/or asymmetric PPB with sparse microtubules at the cortex and a high density of perinuclear
microtubules. Examples of visual classes for assessing PPB defects in trm mutants are displayed
in Fig. S14. The number of G2/M cells scored is indicated. Root tip cells were co-
immunolocalized using an anti-KNOLLE antibody and an anti-Tubulin antibody as a
microtubule marker. G2/M cells are defined as KNOLLE-positive with no spindle or
phragmoplast/cell plate.
Schaefer et al. Supplementary Materials 29
Table S3: PPB absence and robustness of cell division orientation (Figure 3)
(A) 2D division angles in the three external cell layers of the root tip (Figure 3). Angles between
the division plane and the cell file's axis are expressed in degrees. The average division angle
was identical between the mutant and the wild type, whereas its variance was significantly
increased in all mutant tissues, showing a 2 to 3-fold increase. All datasets were non-normal. The
Mann-Whitney test was used for comparing samples, and the Levene's statistics in its median
form for comparing variances.
(B) Distributions of division angles in wild type (red) and trm678 mutant (blue) tissues.
Schaefer et al. Supplementary Materials 30
(C) Volume ratio of sister cells originating from a recent division. Recently divided cells with a
thin transverse wall were identified in 2D sections, and their volumes computed from 3D-
segmented root tips. The volume ratio was obtained by dividing the volume of the cell proximal
to the quiescent center by the volume of the distal cell. The average volume ratio was identical in
the mutant and the wild type, while its variance was significantly (1.6-fold) increased in mutant
roots. All datasets were non-normal. The Mann-Whitney test was used for comparing samples,
and the Levene's statistics in its median form for comparing variances.
(D) Distributions of 3D volume ratios in the wild type (red) and the trm678 mutant (blue).
Schaefer et al. Supplementary Materials 31
(E) Spindle rotation in metaphase root-tip cells. Angles are in degrees with respect to the cell
file's axis. Off-site divisions refer to complete switches of the metaphase plate from a normally
anticlinal to a periclinal orientation. These represent ~10% of the cases in the trm678 mutant,
and are never observed in the wild-type. In addition, for cells where an angle could be measured,
the variance of metaphase plate orientation is 3.7-fold higher in the mutant compared to the wild
type. Despite this large increase in variance, the average angle is not significantly different
between the mutant and the wild type.
(F) Distributions of spindle angles in the wild type (red) and the trm678 mutant (blue), after
exclusion of the 10 cases of extreme rotations in the mutant.
Schaefer et al. Supplementary Materials 32
Table S4: POK1 localization in Col0 and trm678 root tip cells (Figure 4)
(A) Classification of root tip cells according to the partitioning of the POK1-YFP signal between
the cytoplasm and the cortex (Figure 4). Root tips expressing the POK1-YFP construct in the
Col0 and trm678 background were processed through immuno-localization of tubulin and
imaged. Cells were visually classified into 5 categories, from exclusively cytoplasmic to
exclusively cortical, as exemplified in Fig. S14.
(B) Cell counts with normal (continuous) or abnormal (discontinuous or loosely defined) POK1
cortical ring in Col0 and trm678 backgrounds at phragmoplast stage.
Schaefer et al. Supplementary Materials 33