Você está na página 1de 148

EVOLUTION OF MEMBRANE

SIGNALING AND TRAFFICKING


IN PLANTS
Topic Editors
Markus Geisler, Angus S. Murphy,
and Heven Sze

PLANT SCIENCE
FRONTIERS COPYRIGHT
STATEMENT ABOUT FRONTIERS
Copyright 2007-2013 Frontiers is more than just an open-access publisher of scholarly articles: it is a pioneering
Frontiers Media SA.
All rights reserved.
approach to the world of academia, radically improving the way scholarly research is managed.
All content included on this site, The grand vision of Frontiers is a world where all people have an equal opportunity to seek, share
such as text, graphics, logos, button and generate knowledge. Frontiers provides immediate and permanent online open access to all
icons, images, video/audio clips,
downloads, data compilations and its publications, but this alone is not enough to realize our grand goals.
software, is the property of or is
licensed to Frontiers Media SA
(Frontiers) or its licensees and/or
subcontractors. The copyright in the FRONTIERS JOURNAL SERIES
text of individual articles is the
property of their respective authors, The Frontiers Journal Series is a multi-tier and interdisciplinary set of open-access, online
subject to a license granted to
Frontiers.
journals, promising a paradigm shift from the current review, selection and dissemination
The compilation of articles processes in academic publishing.
constituting this e-book, as well as All Frontiers journals are driven by researchers for researchers; therefore, they constitute a service
all content on this site is the
exclusive property of Frontiers. to the scholarly community. At the same time, the Frontiers Journal Series operates on a revo-
Images and graphics not forming lutionary invention, the tiered publishing system, initially addressing specific communities of
part of user-contributed materials
may not be downloaded or copied scholars, and gradually climbing up to broader public understanding, thus serving the interests
without permission. of the lay society, too.
Articles and other user-contributed
materials may be downloaded and
reproduced subject to any copyright
or other notices. No financial
payment or reward may be given for
DEDICATION TO QUALITY
any such reproduction except to the Each Frontiers article is a landmark of the highest quality, thanks to genuinely collaborative interac-
author(s) of the article concerned.
tions between authors and review editors, who include some of the worlds best academicians.
As author or other contributor you
grant permission to others to Research must be certified by peers before entering a stream of knowledge that may eventually
reproduce your articles, including reach the public - and shape society; therefore, Frontiers only applies the most rigorous and
any graphics and third-party
materials supplied by you, in unbiased reviews.
accordance with the Conditions for Frontiers revolutionizes research publishing by freely delivering the most outstanding research,
Website Use and subject to any
copyright notices which you include evaluated with no bias from both the academic and social point of view.
in connection with your articles and By applying the most advanced information technologies, Frontiers is catapulting scholarly
materials.
publishing into a new generation.
All copyright, and all rights therein,
are protected by national and
international copyright laws.
The above represents a summary
only. For the full conditions see the
WHAT ARE FRONTIERS RESEARCH TOPICS?
Conditions for Authors and the Frontiers Research Topics are very popular trademarks of the Frontiers Journals Series: they are
Conditions for Website Use.
collections of at least ten articles, all centered on a particular subject. With their unique mix
of varied contributions from Original Research to Review Articles, Frontiers Research Topics
unify the most influential researchers, the latest key findings and historical advances in a hot
ISSN 1664-8714 research area!
ISBN 978-2-88919-131-4 Find out more on how to host your own Frontiers Research Topic or contribute to one as an
DOI 10.3389/978-2-88919-131-4 author by contacting the Frontiers Editorial Office: researchtopics@frontiersin.org

Frontiers in Plant Science June 2013 | Evolution of Membrane Signaling and Trafficking in Plants | 1
EVOLUTION OF MEMBRANE
SIGNALING AND TRAFFICKING IN
PLANTS
Topic Editors:
Markus Geisler, University of Fribourg, Switzerland
Angus S. Murphy, University of Maryland, USA
Heven Sze, University of Maryland, USA

Membrane proteins are essential determinants


of many biological processes in plants. They
function in metabolic processes, signal
transduction, transport of small molecules and
polymers across endo- and plasma membranes,
and intercompartmental trafficking of proteins,
lipids, and cell wall components. During these
integrative processes, dynamic interactions of
membrane proteins with other membrane or
soluble components are thought to provide
a high degree of flexibility that usually
characterizes higher plants. This concept is
supported by the recent release of a first, partial Arabidopsis interactome by the Arabidopsis
Interactome Mapping Consortium (http://www.sciencemag.org/content/333/6042/601.
full.htm). The Arabidopsis interactome reveals a strong enrichment of a few network
communities, including those for transmembrane transport and vesicle trafficking. Strikingly,
the large transmembrane transport community shares a high amount of proteins with
the vesicle trafficking community suggesting a strong physical and functional overlap and
interaction.

Frontiers in Plant Science June 2013 | Evolution of Membrane Signaling and Trafficking in Plants | 2
Table of Contents

04 Evolution of Membrane Signaling and Trafficking in Plants


Markus Geisler
06 Conserved and Plant-Unique Mechanisms Regulating Plant Post-Golgi Traffic
Masaru Fujimoto and Takashi Ueda
16 Endocytic Signaling in Leaves and Roots: Same Rules Different Players
Christian Craddock and Zhenbiao Yang
21 Evolution of the Land Plant Exocyst Complexes
Fatima Cvrkov, Michal Grunt, Radek Bezvoda, Michal Hla, Ivan Kulich,
Anamika Rawat and Viktor rsk
34 Bundling Actin Filaments from Membranes: Some Novel Players
Clment Thomas
48 Multiple Roles for Membrane-Associated Protein Trafficking and Signaling in
Gravitropism
Allison K. Strohm, Katherine L. Baldwin and Patrick H. Masson
60 Evolution and Structural Diversification of PILS Putative Auxin Carriers in Plants
Elena Feraru, Stanislav Vosolsob, Mugurel I Feraru, Jan Petrek
and Jrgen Kleine-Vehn
73 AUX/LAX Family of Auxin Influx CarriersAn Overview
Ranjan Swarup and Benjamin Pret
84 The Putative K+ Channel Subunit AtKCO3 Forms Stable Dimers in Arabidopsis
Alessandra Rocchetti, Tripti Sharma, Camilla Wulfetange, Joachim Scholz-Starke,
Alexandra Grippa, Armando Carpaneto, Ingo Dreyer, Alessandro Vitale, Katrin
Czempinski and Emanuela Pedrazzini
97 Molecular Evolution of Slow and Quick Anion Channels (SLACs and QUACs/
ALMTs)
Ingo Dreyer, Judith Lucia Gomez-Porras, Diego Mauricio Riao-Pachn,
Rainer Hedrich and Dietmar Geiger
109 Glutamate Receptor Homologs in Plants: Functions and Evolutionary Origins
Michelle Beth Price, John Jelesko and Sakiko Okumoto
119 How Membranes Shape Plant Symbioses: Signaling and Transport in
Nodulation and Arbuscular Mycorrhiza
Laure Bapaume and Didier Reinhardt

Frontiers in Plant Science June 2013 | Evolution of Membrane Signaling and Trafficking in Plants | 3
EDITORIAL
published: 05 March 2013
doi: 10.3389/fpls.2013.00040

Evolution of membrane signaling and trafficking in plants


Markus Geisler*
Plant Biology geislerLab, Department of Biology, University of Fribourg, Fribourg, Switzerland
*Correspondence: markus.geisler@unifr.ch
Edited by:
Wendy A. Peer, University of Maryland, USA
Reviewed by:
Wendy A. Peer, University of Maryland, USA

Membrane proteins are essential determinants of many bio- recent release of a first, partial Arabidopsis interactome
logical processes in plants. They function in metabolic by the Arabidopsis Interactome Mapping Consortium
processes, signal transduction, transport of small molecules [http://interactome.dfci.harvard.edu/A_thaliana; (Arabidopsis
and polymers across endo- and plasma membranes, and Interactome Mapping Consortium, 2011)]. The Arabidopsis
inter-compartmental trafficking of proteins, lipids, and cell interactome reveals a strong enrichment of a few network
wall components. During these highly integrative pro- communities, with the transmembrane transport community
cesses, dynamic interactions of membrane proteins with being the largest. Strikingly, the high degree of shared pro-
other membrane or soluble components are thought to teins among the transmembrane transport and trafficking
provide a high degree of flexibility that usually charac- communities suggests both physical interaction and functional
terizes higher plants. This concept is supported by the overlap (see Figure 1).

FIGURE 1 | The large transmembrane transport community (brown) shares a high amount of proteins with the vesicle trafficking community (blue)
suggesting a strong physical and functional overlap and interaction. AI-1MAIN communities enriched in gene ontology annotations are colored. Modified
from Arabidopsis Interactome Mapping Consortium (2011).

www.frontiersin.org March 2013 | Volume 4 | Article 40 | 4


Geisler Evolution of membrane signaling and trafficking in plants

With no surprise, this current research topic co-hosted This research topic concludes with an integrated view on
by Frontiers in Plant Transport and Traffic and Frontiers in how membranes shape plant nodulation and Arbuscular
Plant Physiology reflects well this outcome of the Arabidopsis mycorrhizae.
Interactome Mapping Consortium. It embraces outstand- As such, this research topic is a timely update presenting
ing current research efforts with a series of reviews and advances in research in the evolution of membrane signaling and
original papers that highlight conserved and plant-specific trafficking in plants, encompassed of outstanding contributions
mechanisms of post-Golgi trafficking, exocytosis and endo- that address fundamental questions in these essential processes in
cytosis and the role of the actin cytoskeleton from an evo- plants.
lutionary perspective. This research topic is comprised of
reviews on PILS and AUX/LAX transmembrane auxin car- ACKNOWLEDGMENTS
riers and reviews, original articles, and hypothesis and the- Work in the authors lab is supported by the Novartis Foundation,
ory articles on plant channels, including potassium channels, the Pol de Recherche of the University of Fribourg and the Swiss
slow and quick anion channels, and glutamate receptors. National Funds.

REFERENCES Received: 28 January 2013; accepted: This article was submitted to Frontiers Attribution License, which permits
Arabidopsis Interactome Mapping 13 February 2013; published online: 05 in Plant Traffic and Transport, use, distribution and reproduc-
Consortium. (2011). Evidence March 2013. a specialty of Frontiers in Plant tion in other forums, provided the
for network evolution in Citation: Geisler M (2013) Evolution Science. original authors and source are cred-
an Arabidopsis interac- of membrane signaling and trafficking Copyright 2013 Geisler. This is an ited and subject to any copyright
tome map. Science 333, in plants. Front. Plant Sci. 4:40. doi: open-access article distributed under notices concerning any third-party
601607. 10.3389/fpls.2013.00040 the terms of the Creative Commons graphics etc.

Frontiers in Plant Science | Plant Traffic and Transport March 2013 | Volume 4 | Article 40 | 5
REVIEW ARTICLE
published: 28 August 2012
doi: 10.3389/fpls.2012.00197

Conserved and plant-unique mechanisms regulating plant


post-Golgi traffic
Masaru Fujimoto 1 and Takashi Ueda 1,2 *
1
Department of Biological Sciences, Graduate School of Science, The University of Tokyo, Tokyo, Japan
2
Japan Science and Technology Agency, Precursory Research for Embryonic Science and Technology, Kawaguchi, Japan

Edited by: Membrane traffic plays crucial roles in diverse aspects of cellular and organelle functions in
Angus S. Murphy, University of
eukaryotic cells. Molecular machineries regulating each step of membrane traffic including
Maryland, USA
the formation, tethering, and fusion of membrane carriers are largely conserved among
Reviewed by:
Stephanie Robert, SLU/Ume Plant various organisms, which suggests that the framework of membrane traffic is commonly
Science Center, Sweden shared among eukaryotic lineages. However, in addition to the common components, each
Frantisek Baluska, University of Bonn, organism has also acquired lineage-specific regulatory molecules that may be associated
Germany
with the lineage-specific diversification of membrane trafficking events. In plants, com-
*Correspondence:
parative genomic analyses also indicate that some key machineries of membrane traffic
Takashi Ueda, Department of
Biological Sciences, Graduate School are significantly and specifically diversified. In this review, we summarize recent progress
of Science, The University of Tokyo, regarding plant-unique regulatory mechanisms for membrane traffic, with a special focus
7-3-1 Hongo, Bunkyo-ku, Tokyo on vesicle formation and fusion components in the post-Golgi trafficking pathway.
113-0033, Japan.
e-mail: tueda@biol.s.u-tokyo.ac.jp Keywords: coat protein complex, dynamin-related protein, membrane trafficking, Rab GTPase, tether, SNARE

INTRODUCTION and Scheller, 2001; Seabra and Wasmeier, 2004; Yu and Hughson,
Eukaryotic cells are distinguished by the presence of internal 2010). Each subfamily of these machinery components performs a
membrane-bound organelles, including mitochondria, plastids, function similar to that of other paralogs, but at a specific subcellu-
peroxisomes, and other single membrane-bound organelles. Two lar location or as part of a distinct transport pathway (Bonifacino
different underlying mechanisms have been proposed for the and Glick, 2004).
emergence of these organelles. Mitochondria and plastids, which Modern phylogenetic studies suggest that eukaryotes are com-
have a double-membrane envelope in principle, arose respec- prised of five major supergroups: Amoebozoa; Opisthokonta;
tively through the symbiotic incorporation of -proteobacteria Archaeplastida; Excavata; and St ramenopiles, Alveolates and
and cyanobacteria by the ancestral eukaryotic cell (Barbrook et al., Rhizaria together with Cryptophyte, Centrohelid, T elonemid,
2006; Embley and Martin, 2006). In contrast, organelles bound by and H aptophyte (SAR + CCTH; Burki et al., 2009). Owing to
a single membrane layer [e.g., the endoplasmic reticulum (ER), the recent accumulation of genomic resources among these five
Golgi apparatus, trans-Golgi network (TGN), plasma membrane supergroups, molecular evolutionary analyses have been yielding
(PM), and a series of endosomal compartments], are thought information about the emergence and establishment of membrane
to have evolved autogenously from preexisting single membrane trafficking components. Comparative genomic and phylogenetic
components in ancient proto-eukaryotic cells (Cavalier-Smith, analyses of CPCs (Schledzewski et al., 1999), DRPs (Elde et al.,
1987, 2002). These single membrane-bound organelles are con- 2005; Miyagishima et al., 2008), Rab GTPases (Brighouse et al.,
nected with each other through a trafficking system mediated by 2010; Elias et al., 2012), tethers (Koumandou et al., 2007), and
vesicular and/or tubular membranous transport carriers, known SNAREs (Dacks and Doolittle, 2002; Yoshizawa et al., 2006) sam-
as membrane trafficking. Membrane trafficking consists of sev- pled from a broad range of eukaryotic lineages have revealed
eral sequential processes: the formation of cargo-bearing vesicles that similar sets of paralogous subgroups of these machinery
or tubules from donor membranes, targeted delivery of transport components are often shared among these supergroups. This
carriers, and tethering of carriers to target membranes, followed conservation suggests that the basic framework of membrane traf-
by membrane fusion (Figure 1). These processes involve specific fic was already established before the last common eukaryotic
sets of regulatory machinery. For example, coat protein complexes ancestor, which is commonly shared among extant descendant
(CPCs) and dynamin-related GTPases (DRPs) participate in the eukaryotic lineages (Dacks et al., 2009). However, these analy-
formation of vesicular or tubular carriers; CPCs facilitate cargo ses also demonstrated that each eukaryotic lineage occasionally
selection and membrane deformation, and DRPs take part in acquired lineage-specific new subgroups and/or expanded spe-
the tubulation and/or scission of donor membranes (Figure 1; cific subfamilies, probably by lineage-specific gene multiplication
Bonifacino and Glick, 2004; Praefcke and McMahon, 2004). Rab and the accumulation of mutations. Such genes are predicted to
GTPase, a member of the Ras superfamily, tethers, and soluble be associated with the lineage-specific differentiation of organelle
N -ethylmaleimide-sensitive factor attachment protein receptors functions and membrane trafficking pathways.
(SNAREs) are responsible for the targeting and subsequent teth- The lineage-specific expansion and diversification of machin-
ering and fusion of carriers to target membranes (Figure 1; Chen ery components for membrane trafficking are also evident in plant

www.frontiersin.org August 2012 | Volume 3 | Article 197 | 6


Fujimoto and Ueda Plant-unique membrane trafficking machineries

endosomes, and lysosomes/vacuoles, and concentrate adaptors


bound with cargo, leading to the loading of proteins and lipids into
forming vesicles (Crowther and Pearse, 1981; Hanover et al., 1984).
Although the overall architecture is well conserved among clathrin
coats in eukaryotic lineages, including plants (Coleman et al.,
1987), the triskelion structure of the plant clathrin coat exhibits
several distinct characteristics. The plant triskelion has a higher
molecular mass and longer arms than the mammalian triskelion
(Mersey et al., 1985; Depta and Robinson, 1986; Coleman et al.,
1987; Depta et al., 1987), suggesting that unique properties were
added to plant clathrin coats during evolution.
Adaptor protein (AP) complexes AP-1 through AP-5 are cen-
tral organizers that mediate cargo recognition at forming vesicles
in post-Golgi trafficking pathways (Pearse and Robinson, 1984;
DellAngelica et al., 1997, 1999; Hirst et al., 1999, 2011; Robinson
and Bonifacino, 2001). Each AP complex consists of four subunits
FIGURE 1 | Model for a general mechanism of membrane trafficking.
called adaptins, which are large //// and subunits, a medium
Coat protein complexes (CPCs) and dynamin-related GTPases (DRPs)
participate in the formation of vesicular or tubular carriers. CPCs facilitate subunit, and a small subunit (Boehm and Bonifacino, 2002;
cargo selection and membrane deformation, and DRPs take part in the Hirst et al., 2011). During vesicle formation, AP complexes link the
tubulation and/or scission of donor membranes. Rab GTPase promotes the clathrin lattice and select membrane cargos and lipids. AP com-
tethering of membrane carriers to the target membrane through effector plexes also bind other accessory proteins, which in turn regulate
molecules (Tethers), which is followed by SNARE-mediated membrane
fusion.
the assembly and disassembly of the coat (Bonifacino and Traub,
2003). All of these AP complexes are observed among all eukaryotic
lineages with sporadic secondary loss in some clades, indicating an
lineages, especially in land plants (Embryophytes). For exam- ancient origin for all five complexes (Hirst et al., 2011). Currently,
ple, some specific Rab GTPase, component of tethering factors, each AP complex is assigned to a distinctive location and func-
and SNARE subfamilies are remarkably expanded and function- tion: bi-directional trafficking between endosomes and the TGN
ally diversified (Vernoud et al., 2003; Sanderfoot, 2007; Woollard for AP-1 (Boehm and Bonifacino, 2002; Robinson et al., 2010),
and Moore, 2008; Saito and Ueda, 2009; Chong et al., 2010). endocytosis from the PM for AP-2 (Bar et al., 2009; Jackson et al.,
Moreover, plant-unique molecular machineries, which are struc- 2010), traffic from early endosomes/TGN to late endosomes and
turally distinct from closely related homologs conserved in a wide lysosomes/vacuoles for AP-3 (DellAngelica, 2009; Niihama et al.,
range of eukaryotic organisms, take part in fundamental mem- 2009; Feraru et al., 2010), TGN-to-endosome trafficking for AP-4
brane trafficking processes in plant cells (Ebine et al., 2008, 2011; (Burgos et al., 2010), and trafficking around the late endosomes
Fujimoto et al., 2010; Van Damme et al., 2011). This review sum- for AP-5 (Hirst et al., 2011). Among these AP complexes, AP-1
marizes recent advances in the study of plant post-Golgi trafficking and AP-2 have been demonstrated to interact with clathrin, while
pathways, focusing on unique aspects of the plant system. other complexes are thought to be able to act without associating
with clathrin. The ancient origin of the AP complexes suggests
COAT PROTEIN COMPLEXES that their functions are also conserved in plants, which should be
A single round of trafficking between two organelles begin with verified in future studies.
the formation of transport vesicles from the donor organelle In addition to the conserved AP complexes, land plants have a
(Figure 1). In this process, cytosolic CPCs perform pivotal roles unique adaptor-like protein, TPLATE, which contains a domain
in membrane deformation and cargo recruitment. Three classes similar to -adaptin and interacts with clathrin (Van Damme
of CPCs are widely utilized in a range of eukaryotic organisms et al., 2006, 2011). TPLATE is specifically targeted to the expand-
(Schledzewski et al., 1999; Singh and Gupta, 2004; Elde et al., ing cell plate and the particular region of the PM around the
2005; Dacks and Field, 2007): coat protein complex II (COPII) site of fusion between the expanding cell plate and the mother
mediates ER-to-Golgi trafficking, coat protein complex I (COPI) cell, to which clathrin is also localized (Van Damme et al., 2011).
mediates intra-Golgi and Golgi-to-ER trafficking (Lee et al., 2004), Thus, TPLATE is expected to act in clathrin-mediated endocyto-
and clathrin-based complexes are involved in multiple steps in sis during cell plate formation. Restriction of the lateral diffusion
post-Golgi trafficking (McMahon and Mills, 2004). These three of KNOLLE, a SNARE protein, at the PM of mother cells dur-
CPCs are likely to have a common ancestral origin, which may be ing cytokinesis and its removal from the PM are accomplished by
also the origin of the nuclear pore complex (Devos et al., 2004). clathrin-mediated endocytosis (Segui-Simarro et al., 2004; Boutte
Clathrin-based complexes mainly comprise clathrin coats and et al., 2010). KNOLLE is a possible cargo of TPLATE-mediated
adaptor molecules such as cargo- or lipid-binding proteins. The endocytosis.
clathrin coat is made up of a three-legged structure called the
triskelion, each leg of which consists of a heavy chain (CHC) DYNAMIN-RELATED PROTEINS
and a light chain (CLC) (Brodsky et al., 2001). Triskelia assemble Dynamin-related proteins (DRPs) are large GTPases that regulate
into a lattice surrounding the membrane bud on the TGN, PM, membrane fission, fusion, and tubulation during diverse cellular

Frontiers in Plant Science | Plant Traffic and Transport August 2012 | Volume 3 | Article 197 | 7
Fujimoto and Ueda Plant-unique membrane trafficking machineries

activities such as endocytosis, cytokinesis, vacuolar sorting, fission DRP1 are required to fulfill the function in clathrin-mediated
and fusion of mitochondria, biogenesis of peroxisomes, and the trafficking events, which animal dynamin executes by itself. In
maintenance of ER morphology (Praefcke and McMahon, 2004; a consistent manner, these two subfamilies of DRPs interact with
Hu et al., 2009). In many cases, distinct DRP proteins are assigned each other and assemble together with clathrin at discrete foci at
to fulfill different cellular functions. However, in Trypanosoma bru- the PM (Fujimoto et al., 2010). Cooperative action of two struc-
cei, a protist belonging to the Excavata supergroup, a single DRP turally distinct DRPs in the same membrane scission event has
mediates both mitochondrial division and post-Golgi trafficking, not been reported in other organisms; thus, plants appear to have
including endocytosis (Chanez et al., 2006). By contrast, in the developed a unique mechanism for endocytic vesicle formation.
SAR + CCTH supergroup, the DRP protein that acts in endomem-
brane trafficking has not been found thus far, while DRPs acting in Rab GTPases
mitochondrial and/or plastid divisions have been identified in this Rab GTPases, which comprise the largest family in the Ras super-
supergroup (Miyagishima et al., 2008; van Dooren et al., 2009). family, act as molecular switches to regulate the targeting and teth-
These lines of evidence might suggest that an ancient function ering of transport carriers to target membranes by cycling between
of DRPs was the regulation of membrane remodeling associated GTP-bound active and GDP-bound inactive states (Figure 1; Saito
with mitochondrial endosymbiosis, although it is also plausible and Ueda, 2009). The activation of Rab GTPases occurs with the
that DRPs for membrane trafficking were secondarily lost during exchange of bound GDP for GTP, which is catalyzed by gua-
evolution of the SAR + CCTH lineage. It has also been reported nine nucleotide exchange factor (GEF). GTP-bound Rab GTPases
that some bacterial species possess DRP-like proteins that are able interact with specific effector molecules that evoke downstream
to deform lipid bilayers, implying a possible prokaryotic origin of reactions including the tethering of transport carriers to target
this protein family (Low and Lowe, 2006; Burmann et al., 2011). membranes by tethers (Grosshans et al., 2006). Tethering between
Among DRP family members, dynamin is the best- two membranes is mediated by a group of multi-subunit com-
characterized member that acts in clathrin-mediated trafficking in plexes (e.g., HOPS, TRAPP, and Exocyst) and/or long fibrous pro-
animal cells (Sever, 2002). During clathrin-coated vesicle (CCV) teins (e.g., EEA1 and p115/Uso1p), most of which act as effectors of
formation, dynamin assembles into helical or ring-shaped struc- Rab GTPases (Cai et al., 2007; Markgraf et al., 2007). Because Rab
tures at the neck of clathrin-coated buds (Takei et al., 1995), and GTPases exhibit a much greater degree of phylogenetic diversifica-
constricts, severing the bud neck membrane in a GTP hydrolysis- tion than other tethering components, they are thought to be vital
dependent manner (Sweitzer and Hinshaw, 1998; Macia et al., players in the diversification of the endomembrane system (Dacks
2006). Animal dynamin contains five distinct domains: the N - and Field, 2007; Gurkan et al., 2007; Elias, 2010). Recent com-
terminal GTPase domain; a middle domain that mediates inter- prehensive genomic analysis has suggested that the last common
molecular interaction during self-assembly; a GTPase-effector eukaryotic ancestor harbored at least 23 groups of Rab GTPases
domain (GED), which stimulates the GTPase activity required (Elias et al., 2012) substantially more than have been found in
to enact structural change in a dynamin polymer; a pleckstrin many extant eukaryotic organisms, including plants. Thus, the
homology (PH) domain, which mediates binding to the mem- secondary loss of Rab GTPases (and the acquisition of new ones)
brane phosphoinositide; and a proline-rich domain (PRD), which occurred in a wide range of eukaryotes during evolution.
is required for the recruitment of dynamin to clathrin-coated pits Plant Rab GTPases also appear to have followed a unique
(Heymann and Hinshaw, 2009). The former three domains are path of diversification and evolution. The genome of A. thaliana
conserved among almost all DRP proteins. DRPs with a domain contains 57 Rab GTPases that are classified into eight groups
configuration similar to that of dynamin, which also harbor the (RABARABH). Each group exhibits a high degree of similarity to
two additional domains, have been observed only in metazoa animal RAB1, RAB2, RAB5, RAB6, RAB7, RAB8, RAB11, or RAB18
and land plants (Chanez et al., 2006; Miyagishima et al., 2008; (Rutherford and Moore, 2002; Vernoud et al., 2003). Most land
Heymann and Hinshaw, 2009). plants possess these eight groups in theory, with a few additional
Most land plants genomes contain six types of DRPs: DRP1- members of unknown function in basal land plants (Rensing et al.,
DRP4, DRP5A, and DRP5B (Hong et al., 2003; Miyagishima 2008; Banks et al., 2011). Compared with other eukaryotic lineages,
et al., 2008). Of these subfamilies, two structurally different DRPs, one distinct feature of the land plant Rab GTPase is extreme expan-
DRP1, and DRP2, are involved in clathrin-dependent trafficking sion of the RABA/RAB11 group (Rutherford and Moore, 2002).
events including endocytosis and cell plate formation (Figure 2; In A. thaliana, 26 of 57 Rab GTPases belong to this group, which
Hong et al., 2003; Kang et al., 2003; Collings et al., 2008; Fujimoto are further divided into six subgroups, RABA1 through RABA6
et al., 2008, 2010; Konopka et al., 2008; Taylor, 2011). DRP2 shares (Rutherford and Moore, 2002). In contrast, three of 66 and two
overall domain organization with animal dynamin, while DRP1 of 11 RAB GTPases in Homo sapiens and Saccharomyces cerevisiae,
lacks the PH domain and PRD; a DRP with a similar structure is respectively, are members of the RAB11 group (Pereira-Leal and
only found in green plants (Hong et al., 2003). In spite of the sim- Seabra, 2001; Stenmark and Olkkonen, 2001).
ilarity in the overall domain structure between plant DRP2 and Yeast and animal RAB11 members function at multiple steps
animal dynamin, the GTPase domain of animal dynamin exhibits of post-Golgi trafficking pathways (Benli et al., 1996; Ullrich et al.,
greater similarity to the GTPase domains of DRP1 members than 1996; Jedd et al., 1997; Chen et al., 1998; Strickland and Burgess,
to that of DRP2 (e.g., 66% identity to A. thaliana DRP1A, and 2004). In addition, in land plants, RABA members have been
27% identity to A. thaliana DRP2B). These lines of evidence raise shown to localize around the TGN (Ueda et al., 1996; de Graaf
the possibility that complementary functions of plant DRP2 and et al., 2005; Chow et al., 2008; Szumlanski and Nielsen, 2009),

www.frontiersin.org August 2012 | Volume 3 | Article 197 | 8


Fujimoto and Ueda Plant-unique membrane trafficking machineries

FIGURE 2 | A schematic illustration of clathrin-coated vesicle formation represent the donor membrane and the clathrin coat, respectively; and green
in land plants. Light blue represents the cytosol; orange, and red lines and blue dots represent DRP1 and DRP2 proteins, respectively.

which also acts as the early endosome in plant cells (Dettmer et al., that ARA6 homologs are well conserved among land plants and
2006; Viotti et al., 2010). The diversity of RABA/RAB11 members rather sporadic in algal lineages, it may be adaptive for land plants
in land plants suggests that plant-unique functions are assigned to to retain the trafficking pathway involving the ARA6-type RAB5
members of this group, some of which are demonstrated by recent for survival in terrestrial conditions.
studies. For example, RABA2 and A3 are involved in cell plate for- Another class of small GTPase, Rho-like GTPases of plants
mation (Chow et al., 2008), and RABA1 and RABA4 are required (ROP), has recently been demonstrated to have regulatory roles
for normal tip growth of pollen tubes and root hairs (Preuss et al., in plant membrane trafficking, which is required for the auxin-
2004; de Graaf et al., 2005; Szumlanski and Nielsen, 2009). It has mediated establishment of cell polarity (Chen et al., 2012; Lin et al.,
also been proposed that the function of RABA is associated with 2012; Nagawa et al., 2012). Directional transport of auxin depends
the biogenesis and degradation of the cell wall during fruit devel- on a family of auxin efflux carriers known as PIN-FORMED
opment (Zainal et al., 1996; Lu et al., 2001; Abbal et al., 2008; Lycett, (PIN) proteins, which undergo constitutive endocytic recycling
2008). (Dhonukshe et al., 2007, 2008; Kleine-Vehn et al., 2011). In the
The diversification of the RAB5 group is another distinctive roots, auxin affects its own transport by inhibiting the clathrin-
feature of the plant Rab GTPase. RAB5 is a broadly conserved Rab mediated endocytosis of PIN1 and PIN2, which is mediated by
GTPase, and regulates a wide range of early endocytic trafficking Auxin Binding Protein 1 (ABP1; Paciorek et al., 2005; Robert et al.,
in animal cells (Somsel Rodman and Wandinger-Ness, 2000; Ben- 2010), as well as the downstream signaling molecules ROP6 and
merah, 2004). Orthologs of animal RAB5 are also conserved in all ROP-interactive CRIB motif containing protein 1 (RIC1; Chen
plant species whose genomes have been sequenced thus far, with et al., 2012; Lin et al., 2012). In addition, ROP and RIC have been
the exception of a unicellular rhodophyte, Cyanidioschyzon mero- shown to act in the morphogenesis of leaf epidermal cells. Auxin
lae (Matsuzaki et al., 2004). Land plants also harbor another plant- and ABP1 promote interdigitation of epidermal pavement cells by
unique type of RAB5 molecule, the ARA6/RABF1 group, which is activating a signaling pathway involving ROP2 and RIC4 (Fu et al.,
structurally distinct from conventional RAB5 (Ebine and Ueda, 2005; Xu et al., 2010), which causes the accumulation of cortical
2009). The A. thaliana genome has three RAB5-related genes: two actin microfilaments, thereby resulting in the local inhibition of
conventional type RAB5, RHA1/RABF2a, and ARA7 /RABF2b; and clathrin-dependent endocytosis and asymmetric distribution of
one plant-unique RAB5, ARA6 /RABF1 (Ueda et al., 2001). All of PIN1 (Nagawa et al., 2012). Rho GTPase-mediated inhibition of
the three RAB5s in A. thaliana have been detected on multivesic- endocytosis is also centrally involved in the establishment of cell
ular endosomes (MVEs) using electron microscopy (Haas et al., polarity in animal systems (Izumi et al., 2004; Harris and Tepass,
2007), and are activated by the same GEF, VPS9a (Goh et al., 2007). 2008). Thus, the plant appears to have developed its multicellu-
However, the subcellular localizations of two types of RAB5 did lar body plan by recruiting the common mechanism of polarity
not overlap completely when their localization was compared in regulation, as well as by adding plant-specific innovations such as
the same cell (Ueda et al., 2004), and the overexpression of con- ABP1 and RICs (Napier et al., 2002; Nagawa et al., 2010).
stitutively active ARA6 and ARA7 conferred different effects on
a partial loss-of-function mutant of VPS9a, vps9a-2 (Goh et al., TETHERS
2007). Some of proteins that mediate the tethering of transport vesicles
Recently, we have successfully demonstrated the functional to target membranes also appear to be diversified in a unique
diversification between these conventional and plant-unique types way in plants. A comparative genomic analysis suggested that
of RAB5 in A. thaliana. Genetic, biochemical, and imaging analyses each tethering complex has an ancient and independent origin;
indicated that ARA6 acts in the trafficking pathway from MVEs a set of non-homologous tethering complexes is conserved across
to the PM, while conventional RAB5 is involved in the traffick- all eukaryotic lineages, with frequent secondary losses (Kouman-
ing pathway between MVEs and vacuoles (Ebine et al., 2011). dou et al., 2007). Acquisition of the non-homologous tethering
The ara6 mutation resulted in hypersensitivity to salinity and complexes may be the other driving force for the diversification
osmotic stresses, and overexpression of constitutive active ARA6 of membrane trafficking pathways, in addition to the paralogous
conferred salinity stress tolerance to A. thaliana plants (Ebine expansion observed in the Rab and SNARE families.
et al., 2011, 2012). Possible involvement of ARA6 homologs in While the obvious orthologs of long fibrous tethers have not
the stress response has also been reported for other land plant been found, the components of tethering complexes are well
species (Bolte et al., 2000; Zhang et al., 2009). Considering with conserved in plants (Koumandou et al., 2007). In A. thaliana,

Frontiers in Plant Science | Plant Traffic and Transport August 2012 | Volume 3 | Article 197 | 9
Fujimoto and Ueda Plant-unique membrane trafficking machineries

components of the HOPS/CORVET complexes residing on vac- R-SNAREs, which are classified according to the presence of a
uolar membranes and pre-vacuolar compartments are involved in conserved glutamine (Q) or arginine (R) residue in a particular
vacuolar biogenesis and transport to vacuoles (Rojo et al., 2001, helical domain called the SNARE domain. In general, Q- and R-
2003; Niihama et al., 2009). The TRAPP complex, which is further SNAREs reside on distinct membrane compartments, and three
divided into TRAPPI and TRAPPII, is required for cell plate for- Q-SNAREs (Qa, Qb, and Qc) and an R-SNARE assemble into
mation (Thellmann et al., 2010). The importance of the exocyst a tight complex in specific combinations, leading to membrane
complex in various secretion-related events, including tip growth fusion between two compartments. Most SNARE proteins, except
of pollen tubes and root hairs, hypocotyl elongation, deposition for SNAP-25-like members, contain one SNARE domain in their
of seed coat pectin, pollen acceptance at the stigma, and pathogen polypeptides (Jahn and Scheller, 2006). Recent comprehensive
responses, has also been reported (Cole et al., 2005; Synek et al., genomic analyses have indicated that a significant increase in the
2006; Hala et al., 2008; Chong et al., 2010; Kulich et al., 2010; number of SNARE family members occurred with the acquisition
Pecenkova et al., 2011). The GARP complex is also involved in of developmental complexity for example, from unicellular to
pollen tube growth (Lobstein et al., 2004; Guermonprez et al., multicellular organisms (there are 17 SNAREs in C. merolae, 24
2008), as well as resistance to heat and osmotic stresses (Lee et al., in S. cerevisiae, 26 in Chlamydomonas reinhardtii, 38 in H. sapi-
2006). ens, and 63 in A. thaliana; Dacks and Doolittle, 2002; Yoshizawa
Among the tethering complexes in land plants, the exocyst et al., 2006; Sanderfoot, 2007; Dacks et al., 2008). This increase is in
complex appears to be assigned to uniquely diversified functions good agreement with the hypothesis that multiplication followed
in exocytosis-related events. The exocyst consists of eight evolu- by the functional diversification of key components of membrane
tionarily conserved subunits, SEC3, SEC5, SEC6, SEC8, SEC10, trafficking, including SNAREs, is a prerequisite for the diversifi-
SEC15, EXO70, and EXO84, whose assembly mediates the tether- cation of membrane trafficking pathways (Dacks and Doolittle,
ing of secretory vesicles to the target PM during the last step of 2002; Yoshizawa et al., 2006; Dacks and Field, 2007; Dacks et al.,
exocytosis (Munson and Novick, 2006). Among the exocyst sub- 2008), which in turn should be required to support increasingly
units, the EXO70 family exhibits remarkable expansion in land complex body plans and life cycles.
plants. In contrast to a single copy of the EXO70 gene in most of One remarkable feature of the post-Golgi SNARE in land plants
opisthokonta genomes, multiple EXO70 genes have been observed is the functional diversification of the PM-localized Qa-SNARE,
in a variety of land plant genomes: 13 in Physcomitrella patens; 23 the SYP1 group, which consists of nine members in A. thaliana.
in A. thaliana and Populus trichocarpa; and 41 in Oryza sativa Phylogenetic relationships to animal and fungal orthologs sug-
(Chong et al., 2010), which can be divided into three families gest that SYP1 group members are involved in membrane fusion
comprising nine subfamilies (Elias et al., 2003; Synek et al., 2006; at the PM (Sanderfoot, 2007); some members of SYP1 group
Chong et al., 2010). have been reported to perform specialized functions at the PM.
Although the functions of the majority of EXO70 family pro- For example, SYP111/KNOLLE is expressed in mitotic cells and
teins remain unknown, several A. thaliana EXO70 members are plays an essential role in membrane fusion at forming cell plates
localized to endosomal compartments including the TGN/early during cytokinesis (Lukowitz et al., 1996; Lauber et al., 1997).
endosome (Chong et al., 2010). Recently, a unique function of an SYP121/PEN1/SYR1, another SYP1 member, takes part in K+
A. thaliana EXO70 family member, Exo70E2, has been reported. uptake through the control of K+ channel gating (Honsbein et al.,
EXO70E2 was localized to spherical double-membrane structures 2009; Grefen et al., 2010). This protein also participates in the non-
resembling autophagosomes and were named exocyst-positive host defense response against attack by fungal pathogens (Collins
organelles (EXPOs; Wang et al., 2010). Intriguingly, standard et al., 2003; Assaad et al., 2004). SYP132 appears to be centrally
markers for conventional organelles (including the Golgi appa- involved in bacterial infection and symbiosis: the silencing of a
ratus; TGN and early endosomes; MVE/late endosomes; and SYP132 ortholog in Nicotiana benthamiana resulted in impaired
autophagosomes) did not occur on EXPOs (Wang et al., 2010), multiple responses against bacterial pathogens (Kalde et al., 2007),
and brefeldin A and wortmannin did not affect EXPO distribution. and an ortholog of SYP132 in Medicago truncatula localizes to
EXPOs have been suggested to mediate a form of unconventional the PM surrounding infection threads and the infection droplet
protein secretion unique to land plants: the transport of cytosolic membrane (Catalano et al., 2007).
proteins to the cell exterior (Wang et al., 2010). Additional studies In addition to the functional diversification of SYP1 group
of other EXO70 family members, as well as functional analyses members, another distinct feature of post-Golgi SNAREs in land
of other exocyst components, would lead to understanding the plants is the expansion of the VAMP7 R-SNARE group (Sander-
unique and diverse exocytic mechanisms that plants have acquired foot, 2007; Ebine and Ueda, 2009). R-SNAREs are divided into two
during the course of evolution. groups, longins and brevins; longins contain an N-terminal lon-
gin domain, while brevins lack this domain (Filippini et al., 2001).
SNARE FAMILY PROTEINS Land plants harbor only longin-type R-SNARE members, which
At the final step of a single round of trafficking, SNARE family pro- are further classified into three major groups: VAMP7, YKT6, and
teins, which are evolutionarily conserved integral or peripheral SEC22. While vertebrates have only one or a few VAMP7 proteins
membrane proteins, execute membrane fusion between trans- that participate in secretory and endocytic trafficking (Chaineau
port carriers and target membranes (Figure 1; Jahn and Scheller, et al., 2009), the VAMP7 group of A. thaliana consists of 12 mem-
2006; Wickner and Schekman, 2008; Saito and Ueda, 2009). The bers, which are further divided into three subgroups: VAMP71,
SNARE family consists of four subgroups, Qa-, Qb-, Qc-, and VAMP72, and VAMP727 (Uemura et al., 2004).

www.frontiersin.org August 2012 | Volume 3 | Article 197 | 10


Fujimoto and Ueda Plant-unique membrane trafficking machineries

A phylogenic analysis has suggested that VAMP71 is a prototype of membrane trafficking, such as TPLATE, DRP1/2, ARA6, and
from which VAMP72 and VAMP727 have been derived (Sander- VAMP727, as well as the functional expansion of evolution-
foot, 2007). VAMP71 members localize to the vacuolar membrane arily conserved components, as observed for RAB11, EXO70,
(Uemura et al., 2004) and are involved in salt and drought stress and SYP1 groups. However, many unsolved questions must
responses (Leshem et al., 2006, 2010). VAMP72 members localize be answered to elucidate the precise function and regulatory
to the TGN and function in the secretory pathway, including cell mechanism of the plant-unique trafficking system. For exam-
plate formation (Zhang et al., 2011). Although VAMP727 exhibits ple, with what APs does TPLATE form a complex to medi-
high sequence similarity to other VAMP72 members, it harbors a ate CCV formation? Does the TPLATE complex-mediated CCV
unique structural characteristic: VAMP727 has an insertion com- formation involve DRP proteins? Why do land plants require
prising acidic amino acid clusters in the longin domain (Ebine and two structurally distinct DRPs for CCV formation? Do they
Ueda, 2009; Vedovato et al., 2009). This type of VAMP7 member in fact polymerize into the same ring- or helix-shaped struc-
is well conserved in seed plants; however, it has not found in lyco- ture?
phytes or moss thus far, indicating relatively recent emergence of Regarding the molecular machinery involved in membrane
this subfamily. tethering and fusion, key questions also remain to be elucidated.
VAMP727 localizes on the RAB5-positive MVE/pre-vacuolar What effector molecules mediate ARA6 function to fulfill higher-
compartment, and mediates membrane fusion between the pre- ordered functions, such as salinity stress tolerance? Is the ARA6
vacuolar compartment and vacuolar membranes by forming a function revealed in A. thaliana shared by all ARA6 group mem-
complex with Qa-SYP22/VAM3, Qb-VTI11, and Qc-SYP51 (Ebine bers throughout the plant lineages? Why and how did plants
et al., 2008). This complex is essential for the efficient transport of expand the RAB11 group, and how are different functions of
storage proteins to protein storage vacuoles during the process of RAB11 members exerted in spite of their high sequence sim-
seed maturation. Moreover, VAMP727 also mediates membrane ilarity? What is the mechanism of molecular evolution of the
fusion at the PM by forming a complex with Qa-SYP121/PEN1 VAMP727 group, and what is the molecular function of the
(Ebine et al., 2011), which is under the control of the plant-unique acidic insertion? Additional studies using model systems like
RAB5 ARA6. These lines of evidence may indicate that the plant A. thaliana are obviously needed to answer these questions,
explored novel trafficking pathways from the MVE to the vacuole and would also be required to challenge distinct lineages of
and PM by acquiring these two plant-unique molecules, leading plants, including basal lineages (e.g., ferns, mosses, liverworts, and
to the current complex and unique post-Golgi trafficking network algae), to yield information regarding aspects of diversity and
in angiosperms. evolution of membrane trafficking. Future experimental studies
employing a wide variety of plant species, together with com-
PERSPECTIVES prehensive genomics analysis in silico, will help us to under-
Plants have elaborated a distinctive post-Golgi trafficking system stand how current plant membrane trafficking pathways have
through the acquisition of plant-specific machinery components evolved.

REFERENCES E. M., Estelle, M., Feng, L., Finet, Selaginella genome identifies genetic Bolte, S., Schiene, K., and Dietz, K.
Abbal, P., Pradal, M., Muniz, L., Sauvage, C., Floyd, S. K., Frommer, W. B., changes associated with the evolu- J. (2000). Characterization of a
F. X., Chatelet, P., Ueda, T., and Tes- Fujita, T., Gramzow, L., Gutensohn, tion of vascular plants. Science 332, small GTP-binding protein of the
niere, C. (2008). Molecular char- M., Harholt, J., Hattori, M., Heyl, A., 960963. rab 5 family in Mesembryanthe-
acterization and expression analysis Hirai, T., Hiwatashi, Y., Ishikawa, M., Bar, M., Sharfman, M., Schuster, S., mum crystallinum with increased
of the Rab GTPase family in Vitis Iwata, M., Karol, K. G., Koehler, B., and Avni, A. (2009). The coiled- level of expression during early
vinifera reveal the specific expres- Kolukisaoglu, U., Kubo, M., Kurata, coil domain of EHD2 mediates salt stress. Plant Mol. Biol. 42,
sion of a VvRabA protein. J. Exp. Bot. T., Lalonde, S., Li, K., Li, Y., Litt, A., inhibition of LeEix2 endocytosis 923936.
59, 24032416. Lyons, E., Manning, G., Maruyama, and signaling. PLoS ONE 4, e7973. Bonifacino, J. S., and Glick, B. S. (2004).
Assaad, F. F., Qiu, J. L., Youngs, T., Michael, T. P., Mikami, K., doi:10.1371/journal.pone.0007973 The mechanisms of vesicle budding
H., Ehrhardt, D., Zimmerli, L., Miyazaki, S., Morinaga, S., Murata, Barbrook, A. C., Howe, C. J., and and fusion. Cell 116, 153166.
Kalde, M., Wanner, G., Peck, S. T., Mueller-Roeber, B., Nelson, D. Purton, S. (2006). Why are plas- Bonifacino, J. S., and Traub, L. M.
C., Edwards, H., Ramonell, K., R., Obara, M., Oguri, Y., Olmstead, tid genomes retained in non- (2003). Signals for sorting of trans-
Somerville, C. R., and Thordal- R. G., Onodera, N., Petersen, B. L., photosynthetic organisms? Trends membrane proteins to endosomes
Christensen, H. (2004). The PEN1 Pils, B., Prigge, M., Rensing, S. A., Plant Sci. 11, 101108. and lysosomes. Annu. Rev. Biochem.
syntaxin defines a novel cellular Riano-Pachon, D. M., Roberts, A. W., Benli, M., Doring, F., Robinson, D. G., 72, 395447.
compartment upon fungal attack Sato, Y., Scheller, H. V., Schulz, B., Yang, X., and Gallwitz, D. (1996). Boutte, Y., Frescatada-Rosa, M., Men,
and is required for the timely assem- Schulz, C., Shakirov, E. V., Shibagaki, Two GTPase isoforms, Ypt31p and S., Chow, C. M., Ebine, K., Gus-
bly of papillae. Mol. Biol. Cell 15, N., Shinohara, N., Shippen, D. E., Ypt32p, are essential for Golgi tavsson, A., Johansson, L., Ueda, T.,
51185129. Sorensen, I., Sotooka, R., Sugimoto, function in yeast. EMBO J. 15, Moore, I., Jurgens, G., and Grebe,
Banks, J. A., Nishiyama, T., Hasebe, M., N., Sugita, M., Sumikawa, N., Tanur- 64606475. M. (2010). Endocytosis restricts Ara-
Bowman, J. L., Gribskov, M., dePam- dzic, M., Theissen, G., Ulvskov, P., Benmerah, A. (2004). Endocytosis: sig- bidopsis KNOLLE syntaxin to the
philis, C., Albert, V. A., Aono, N., Wakazuki, S., Weng, J. K., Willats, naling from endocytic membranes cell division plane during late cytoki-
Aoyama, T., Ambrose, B. A., Ashton, W. W., Wipf, D., Wolf, P. G., Yang, to the nucleus. Curr. Biol. 14, R314 nesis. EMBO J. 29, 546558.
N. W., Axtell, M. J., Barker, E., Barker, L., Zimmer, A. D., Zhu, Q., Mitros, R316. Brighouse, A., Dacks, J. B., and Field,
M. S., Bennetzen, J. L., Bonawitz, T., Hellsten, U., Loque, D., Otillar, Boehm, M., and Bonifacino, J. S. (2002). M. C. (2010). Rab protein evolu-
N. D., Chapple, C., Cheng, C., Cor- R., Salamov, A., Schmutz, J., Shapiro, Genetic analyses of adaptin function tion and the history of the eukaryotic
rea, L. G. G., Dacre, M., DeBarry, H., Lindquist, E., Lucas, S., Rokhsar, from yeast to mammals. Gene 286, endomembrane system. Cell. Mol.
J., Dreyer, I., Elias, M., Engstrom, D., and Grigoriev, I. V. (2011). The 175186. Life Sci. 67, 34493465.

Frontiers in Plant Science | Plant Traffic and Transport August 2012 | Volume 3 | Article 197 | 11
Fujimoto and Ueda Plant-unique membrane trafficking machineries

Brodsky, F. M., Chen, C. Y., Knuehl, a preferential target for GDP disso- Dacks, J. B., and Field, M. C. Dhonukshe, P., Tanaka, H., Goh, T.,
C., Towler, M. C., and Wakeham, D. ciation inhibitor. Mol. Biol. Cell 9, (2007). Evolution of the eukaryotic Ebine, K., Mahonen, A. P., Prasad,
E. (2001). Biological basket weaving: 32413257. membrane-trafficking system: ori- K., Blilou, I., Geldner, N., Xu, J.,
formation and function of clathrin- Chen, X., Naramoto, S., Robert, S., Tejos, gin, tempo and mode. J. Cell. Sci. Uemura, T., Chory, J., Ueda, T.,
coated vesicles. Annu. Rev. Cell Dev. R., Lofke, C., Lin, D., Yang, Z., and 120, 29772985. Nakano, A., Scheres, B., and Friml,
Biol. 17, 517568. Friml, J. (2012). ABP1 and ROP6 Dacks, J. B., Peden, A. A., and Field, M. J. (2008). Generation of cell polar-
Burgos, P. V., Mardones, G. A., Rojas, A. GTPase signaling regulate clathrin- C. (2009). Evolution of specificity in ity in plants links endocytosis, auxin
L., Dasilva, L. L., Prabhu, Y., Hurley, mediated endocytosis in Arabidopsis the eukaryotic endomembrane sys- distribution and cell fate decisions.
J. H., and Bonifacino, J. S. (2010). roots. Curr. Biol. 22, 13261332. tem. Int. J. Biochem. Cell Biol. 41, Nature 456, 962966.
Sorting of the Alzheimers disease Chen, Y. A., and Scheller, R. H. 330340. Ebine, K., Fujimoto, M., Okatani, Y.,
amyloid precursor protein mediated (2001). SNARE-mediated mem- Dacks, J. B., Poon, P. P., and Field, Nishiyama, T., Goh, T., Ito, E., Dain-
by the AP-4 complex. Dev. Cell 18, brane fusion. Nat. Rev. Mol. Cell Biol. M. C. (2008). Phylogeny of endo- obu, T., Nishitani, A., Uemura, T.,
425436. 2, 98106. cytic components yields insight into Sato, M. H., Thordal-Christensen,
Burki, F., Inagaki, Y., Brate, J., Archibald, Chong, Y. T., Gidda, S. K., Sanford, the process of nonendosymbiotic H., Tsutsumi, N., Nakano, A., and
J. M., Keeling, P. J., Cavalier-Smith, C., Parkinson, J., Mullen, R. T., and organelle evolution. Proc. Natl. Acad. Ueda, T. (2011). A membrane traf-
T., Sakaguchi, M., Hashimoto, T., Goring, D. R. (2010). Characteriza- Sci. U.S.A. 105, 588593. ficking pathway regulated by the
Horak, A., Kumar, S., Klaveness, tion of the Arabidopsis thaliana exo- de Graaf, B. H., Cheung, A. Y., plant-specific RAB GTPase ARA6.
D., Jakobsen, K. S., Pawlowski, J., cyst complex gene families by phy- Andreyeva, T., Levasseur, K., Nat. Cell Biol. 13, 853859.
and Shalchian-Tabrizi, K. (2009). logenetic, expression profiling, and Kieliszewski, M., and Wu, H. M. Ebine, K., Miyakawa, N., Fujimoto,
Large-scale phylogenomic analyses subcellular localization studies. New (2005). Rab11 GTPase-regulated M., Uemura, T., Nakano, A., and
reveal that two enigmatic protist lin- Phytol. 185, 401419. membrane trafficking is crucial for Ueda, T. (2012). Endosomal traf-
eages, telonemia and centroheliozoa, Chow, C. M., Neto, H., Foucart, C., tip-focused pollen tube growth in ficking pathway regulated by ARA6,
are related to photosynthetic chro- and Moore, I. (2008). Rab-A2 and tobacco. Plant Cell 17, 25642579. a RAB5 GTPase unique to plants.
malveolates. Genome Biol. Evol. 1, Rab-A3 GTPases define a trans-golgi DellAngelica, E. C. (2009). AP-3- Small GTPases 3, 04.
231238. endosomal membrane domain in dependent trafficking and disease: Ebine, K., Okatani, Y., Uemura, T.,
Burmann, F., Ebert, N., Van Baarle, S., Arabidopsis that contributes sub- the first decade. Curr. Opin. Cell Biol. Goh, T., Shoda, K., Niihama, M.,
and Bramkamp, M. (2011). A bac- stantially to the cell plate. Plant Cell 21, 552559. Morita, M. T., Spitzer, C., Otegui,
terial dynamin-like protein mediat- 20, 101123. DellAngelica, E. C., Mullins, C., and M. S., Nakano, A., and Ueda, T.
ing nucleotide-independent mem- Cole, R. A., Synek, L., Zarsky, V., and Bonifacino, J. S. (1999). AP-4, a (2008). A SNARE complex unique
brane fusion. Mol. Microbiol. 79, Fowler, J. E. (2005). SEC8, a sub- novel protein complex related to to seed plants is required for pro-
12941304. unit of the putative Arabidopsis exo- clathrin adaptors. J. Biol. Chem. 274, tein storage vacuole biogenesis and
Cai, H., Reinisch, K., and Ferro-Novick, cyst complex, facilitates pollen ger- 72787285. seed development of Arabidopsis
S. (2007). Coats, tethers, Rabs, and mination and competitive pollen DellAngelica, E. C., Ohno, H., Ooi, C. thaliana. Plant Cell 20, 30063021.
SNAREs work together to medi- tube growth. Plant Physiol. 138, E., Rabinovich, E., Roche, K. W., and Ebine, K., and Ueda, T. (2009).
ate the intracellular destination of 20052018. Bonifacino, J. S. (1997). AP-3: an Unique mechanism of plant endo-
a transport vesicle. Dev. Cell 12, Coleman, J., Evans, D., Hawes, C., Hors- adaptor-like protein complex with cytic/vacuolar transport pathways. J.
671682. ley, D., and Cole, L. (1987). Struc- ubiquitous expression. EMBO J. 16, Plant Res. 122, 2130.
Catalano, C. M., Czymmek, K. J., Gann, ture and molecular-organization of 917928. Elde, N. C., Morgan, G., Winey,
J. G., and Sherrier, D. J. (2007). Med- higher-plant coated vesicles. J. Cell. Depta, H., Freundt, H., Hartmann, D., M., Sperling, L., and Turkewitz,
icago truncatula syntaxin SYP132 Sci. 88, 3545. and Robinson, D. G. (1987). Prepa- A. P. (2005). Elucidation of
defines the symbiosome mem- Collings, D. A., Gebbie, L. K., Howles, P. ration of a homogeneous coated clathrin-mediated endocytosis in
brane and infection droplet mem- A., Hurley, U. A., Birch, R. J., Cork, vesicle fraction from bean-leaves. tetrahymena reveals an evolu-
brane in root nodules. Planta 225, A. H., Hocart, C. H., Arioli, T., and Protoplasma 136, 154160. tionarily convergent recruitment
541550. Williamson, R. E. (2008). Arabidop- Depta, H., and Robinson, D. G. (1986). of dynamin. PLoS Genet. 1, e52.
Cavalier-Smith, T. (1987). The origin of sis dynamin-like protein DRP1A: a The isolation and enrichment of doi:10.1371/journal.pgen.0010052
eukaryotic and archaebacterial cells. null mutant with widespread defects coated vesicles from suspension- Elias, M. (2010). Patterns and processes
Ann. N. Y. Acad. Sci. 503, 1754. in endocytosis, cellulose synthesis, cultured carrot cells. Protoplasma in the evolution of the eukary-
Cavalier-Smith, T. (2002). The cytokinesis, and cell expansion. J. 130, 162170. otic endomembrane system. Mol.
phagotrophic origin of eukary- Exp. Bot. 59, 361376. Dettmer, J., Hong-Hermesdorf, A., Membr. Biol. 27, 469489.
otes and phylogenetic classification Collins, N. C., Thordal-Christensen, Stierhof, Y. D., and Schumacher, K. Elias, M., Brighouse, A., Castello, C. G.,
of Protozoa. Int. J. Syst. Evol. H., Lipka, V., Bau, S., Kom- (2006). Vacuolar H+-ATPase activ- Field, M. C., and Dacks, J. B. (2012).
Microbiol. 52, 297354. brink, E., Qiu, J. L., Huckelhoven, ity is required for endocytic and Sculpting the endomembrane sys-
Chaineau, M., Danglot, L., and Galli, R., Stein, M., Freialdenhoven, A., secretory trafficking in Arabidopsis. tem in deep time: high resolution
T. (2009). Multiple roles of the Somerville, S. C., and Schulze-Lefert, Plant Cell 18, 715730. phylogenetics of Rab GTPases. J.
vesicular-SNARE TI-VAMP in post- P. (2003). SNARE-protein-mediated Devos, D., Dokudovskaya, S., Alber, F., Cell. Sci. 125, 25002508.
Golgi and endosomal trafficking. disease resistance at the plant cell Williams, R., Chait, B. T., Sali, A., Elias, M., Drdova, E., Ziak, D.,
FEBS Lett. 583, 38173826. wall. Nature 425, 973977. and Rout, M. P. (2004). Components Bavlnka, B., Hala, M., Cvrckova,
Chanez, A. L., Hehl, A. B., Engstler, M., Crowther, R. A., and Pearse, B. M. of coated vesicles and nuclear pore F., Soukupova, H., and Zarsky, V.
and Schneider, A. (2006). Ablation (1981). Assembly and packing of complexes share a common molec- (2003). The exocyst complex in
of the single dynamin of T. bru- clathrin into coats. J. Cell Biol. 91, ular architecture. PLoS Biol. 2, e380. plants. Cell Biol. Int. 27, 199201.
cei blocks mitochondrial fission and 790797. doi:10.1371/journal.bio.0020380 Embley, T. M., and Martin, W. (2006).
endocytosis and leads to a precise Dacks, J. B., and Doolittle, W. F. (2002). Dhonukshe, P., Aniento, F., Hwang, I., Eukaryotic evolution, changes and
cytokinesis arrest. J. Cell. Sci. 119, Novel syntaxin gene sequences from Robinson, D. G., Mravec, J., Stierhof, challenges. Nature 440, 623630.
29682974. Giardia, Trypanosoma and algae: Y. D., and Friml, J. (2007). Clathrin- Feraru, E., Paciorek, T., Feraru, M.
Chen, W., Feng, Y., Chen, D., and implications for the ancient evolu- mediated constitutive endocyto- I., Zwiewka, M., De Groodt, R.,
Wandinger-Ness, A. (1998). Rab11 tion of the eukaryotic endomem- sis of PIN auxin efflux carri- De Rycke, R., Kleine-Vehn, J., and
is required for trans-golgi network- brane system. J. Cell. Sci. 115, ers in Arabidopsis. Curr. Biol. 17, Friml, J. (2010). The AP-3 beta
to-plasma membrane transport and 16351642. 520527. adaptin mediates the biogenesis and

www.frontiersin.org August 2012 | Volume 3 | Article 197 | 12


Fujimoto and Ueda Plant-unique membrane trafficking machineries

function of lytic vacuoles in Ara- ATPase SKD1 is involved in mul- G proteins through IQGAP1 and KNOLLE protein is a cytokinesis-
bidopsis. Plant Cell 22, 28122824. tivesicular endosome function and actin filaments. J. Cell Biol. 166, specific syntaxin. J. Cell Biol. 139,
Filippini, F., Rossi, V., Galli, T., Budillon, interacts with its positive regulator 237248. 14851493.
A., DUrso, M., and DEsposito, M. LYST-INTERACTING PROTEIN5. Jackson, L. P., Kelly, B. T., Mccoy, A. J., Lee, C. F., Pu, H. Y., Wang, L. C., Sayler,
(2001). Longins: a new evolution- Plant Cell 19, 12951312. Gaffry, T., James, L. C., Collins, B. M., R. J., Yeh, C. H., and Wu, S. J.
ary conserved VAMP family shar- Hala, M., Cole, R., Synek, L., Drdova, Honing, S., Evans, P. R., and Owen, (2006). Mutation in a homolog of
ing a novel SNARE domain. Trends E., Pecenkova, T., Nordheim, A., D. J. (2010). A large-scale confor- yeast Vps53p accounts for the heat
Biochem. Sci. 26, 407409. Lamkemeyer, T., Madlung, J., mational change couples membrane and osmotic hypersensitive pheno-
Fu, Y., Gu, Y., Zheng, Z., Wasteneys, Hochholdinger, F., Fowler, J. E., recruitment to cargo binding in the types in Arabidopsis hit1-1 mutant.
G., and Yang, Z. (2005). Ara- and Zarsky, V. (2008). An exocyst AP2 clathrin adaptor complex. Cell Planta 224, 330338.
bidopsis interdigitating cell growth complex functions in plant cell 141, 12201229. Lee, M. C., Miller, E. A., Goldberg,
requires two antagonistic pathways growth in Arabidopsis and tobacco. Jahn, R., and Scheller, R. H. (2006). J., Orci, L., and Schekman, R.
with opposing action on cell mor- Plant Cell 20, 13301345. SNAREs engines for membrane (2004). Bi-directional protein trans-
phogenesis. Cell 120, 687700. Hanover, J. A., Willingham, M. C., fusion. Nat. Rev. Mol. Cell Biol. 7, port between the ER and Golgi.
Fujimoto, M., Arimura, S., Nakazono, and Pastan, I. (1984). Kinet- 631643. Annu. Rev. Cell Dev. Biol. 20, 87123.
M., and Tsutsumi, N. (2008). Ara- ics of transit of transferrin and Jedd, G., Mulholland, J., and Segev, Leshem, Y., Golani, Y., Kaye, Y.,
bidopsis dynamin-related protein epidermal growth factor through N. (1997). Two new Ypt GTPases and Levine, A. (2010). Reduced
DRP2B is co-localized with DRP1A clathrin-coated membranes. Cell 39, are required for exit from the yeast expression of the v-SNAREs
on the leading edge of the form- 283293. trans-Golgi compartment. J. Cell AtVAMP71/AtVAMP7C gene family
ing cell plate. Plant Cell Rep. 27, Harris, K. P., and Tepass, U. (2008). Biol. 137, 563580. in Arabidopsis reduces drought
15811586. Cdc42 and Par proteins stabilize Kalde, M., Nuhse, T. S., Findlay, K., tolerance by suppression of abscisic
Fujimoto, M., Arimura, S., Ueda, T., dynamic adherens junctions in the and Peck, S. C. (2007). The syn- acid-dependent stomatal closure. J.
Takanashi, H., Hayashi, Y., Nakano, Drosophila neuroectoderm through taxin SYP132 contributes to plant Exp. Bot. 61, 26152622.
A., and Tsutsumi, N. (2010). Ara- regulation of apical endocytosis. J. resistance against bacteria and secre- Leshem, Y., Melamed-Book, N., Cagnac,
bidopsis dynamin-related proteins Cell Biol. 183, 11291143. tion of pathogenesis-related protein O., Ronen, G., Nishri, Y., Solomon,
DRP2B and DRP1A participate Heymann, J. A. W., and Hinshaw, J. E. 1. Proc. Natl. Acad. Sci. U.S.A. 104, M., Cohen, G., and Levine,A. (2006).
together in clathrin-coated vesi- (2009). Dynamins at a glance. J. Cell. 1185011855. Suppression of Arabidopsis vesicle-
cle formation during endocytosis. Sci. 122, 34273431. Kang, B. H., Busse, J. S., and Bednarek, S. SNARE expression inhibited fusion
Proc. Natl. Acad. Sci. U.S.A. 107, Hirst, J., Barlow, L. D., Francisco, G. Y. (2003). Members of the Arabidop- of H2O2-containing vesicles with
60946099. C., Sahlender, D. A., Seaman, M. sis dynamin-like gene family, ADL1, tonoplast and increased salt toler-
Goh, T., Uchida, W., Arakawa, S., Ito, N., Dacks, J. B., and Robinson, M. are essential for plant cytokinesis ance. Proc. Natl. Acad. Sci. U.S.A.
E., Dainobu, T., Ebine, K., Takeuchi, S. (2011). The fifth adaptor pro- and polarized cell growth. Plant Cell 103, 1800818013.
M., Sato, K., Ueda, T., and Nakano, tein complex. PLoS Biol. 9, e1001170. 15, 899913. Lin, D., Nagawa, S., Chen, J., Cao, L.,
A. (2007). VPS9a, the common acti- doi:10.1371/journal.pbio.1001170 Kleine-Vehn, J., Wabnik, K., Mar- Chen, X., Xu, T., Li, H., Dhonukshe,
vator for two distinct types of Rab5 Hirst, J., Bright, N. A., Rous, B., and tiniere, A., Langowski, L., Willig, K., P., Yamamuro, C., Friml, J., Scheres,
GTPases, is essential for the develop- Robinson, M. S. (1999). Character- Naramoto, S., Leitner, J., Tanaka, H., B., Fu, Y., and Yang, Z. (2012). A ROP
ment of Arabidopsis thaliana. Plant ization of a fourth adaptor-related Jakobs, S., Robert, S., Luschnig, C., GTPase-dependent auxin signaling
Cell 19, 35043515. protein complex. Mol. Biol. Cell 10, Govaerts, W., Hell, S. W., Runions, J., pathway regulates the subcellular
Grefen, C., Chen, Z., Honsbein, A., 27872802. and Friml, J. (2011). Recycling, clus- distribution of PIN2 in Arabidopsis
Donald, N., Hills, A., and Blatt, M. Hong, Z., Bednarek, S. Y., Blumwald, tering, and endocytosis jointly main- roots. Curr. Biol. 22, 13191325.
R. (2010). A novel motif essen- E., Hwang, I., Jurgens, G., Men- tain PIN auxin carrier polarity at the Lobstein, E., Guyon, A., Ferault, M.,
tial for SNARE interaction with the zel, D., Osteryoung, K. W., Raikhel, plasma membrane. Mol. Syst. Biol. 7, Twell, D., Pelletier, G., and Bon-
K(+) channel KC1 and channel gat- N. V., Shinozaki, K., Tsutsumi, N., 540. homme, S. (2004). The putative Ara-
ing in Arabidopsis. Plant Cell 22, and Verma, D. P. (2003). A uni- Konopka, C. A., Backues, S. K., and bidopsis homolog of yeast vps52p
30763092. fied nomenclature for Arabidop- Bednarek, S. Y. (2008). Dynamics of is required for pollen tube elonga-
Grosshans, B. L., Ortiz, D., and Novick, sis dynamin-related large GTPases Arabidopsis dynamin-related pro- tion, localizes to Golgi, and might be
P. (2006). Rabs and their effectors: based on homology and possi- tein 1C and a clathrin light chain at involved in vesicle trafficking. Plant
achieving specificity in membrane ble functions. Plant Mol. Biol. 53, the plasma membrane. Plant Cell 20, Physiol. 135, 14801490.
traffic. Proc. Natl. Acad. Sci. U.S.A. 261265. 13631380. Low, H. H., and Lowe, J. (2006). A bac-
103, 1182111827. Honsbein, A., Sokolovski, S., Grefen, Koumandou,V. L., Dacks, J. B., Coulson, terial dynamin-like protein. Nature
Guermonprez, H., Smertenko, A., Cros- C., Campanoni, P., Pratelli, R., R. M., and Field, M. C. (2007). Con- 444, 766769.
nier, M. T., Durandet, M., Vrielynck, Paneque, M., Chen, Z., Johansson, trol systems for membrane fusion Lu, C., Zainal, Z., Tucker, G. A., and
N., Guerche, P., Hussey, P. J., Satiat- I., and Blatt, M. R. (2009). A tri- in the ancestral eukaryote; evolu- Lycett, G. W. (2001). Developmen-
Jeunemaitre, B., and Bonhomme, S. partite SNARE-K+ channel com- tion of tethering complexes and SM tal abnormalities and reduced fruit
(2008). The POK/AtVPS52 protein plex mediates in channel-dependent proteins. BMC Evol. Biol. 7, 29. softening in tomato plants express-
localizes to several distinct post- K+ nutrition in Arabidopsis. Plant doi:10.1186/1471-2148-7-29 ing an antisense Rab11 GTPase gene.
Golgi compartments in sporophytic Cell 21, 28592877. Kulich, I., Cole, R., Drdova, E., Cvrck- Plant Cell 13, 18191833.
and gametophytic cells. J. Exp. Bot. Hu, J., Shibata, Y., Zhu, P. P., Voss, ova, F., Soukup, A., Fowler, J., and Lukowitz, W., Mayer, U., and Jurgens, G.
59, 30873098. C., Rismanchi, N., Prinz, W. A., Zarsky, V. (2010). Arabidopsis exo- (1996). Cytokinesis in the Arabidop-
Gurkan, C., Koulov, A. V., and Balch, Rapoport, T. A., and Blackstone, cyst subunits SEC8 and EXO70A1 sis embryo involves the syntaxin-
W. E. (2007). An evolutionary per- C. (2009). A class of dynamin-like and exocyst interactor ROH1 are related KNOLLE gene product. Cell
spective on eukaryotic membrane GTPases involved in the generation involved in the localized deposition 84, 6171.
trafficking. Adv. Exp. Med. Biol. 607, of the tubular ER network. Cell 138, of seed coat pectin. New Phytol. 188, Lycett, G. (2008). The role of Rab
7383. 549561. 615625. GTPases in cell wall metabolism. J.
Haas, T. J., Sliwinski, M. K., Martinez, Izumi, G., Sakisaka, T., Baba, T., Tanaka, Lauber, M. H., Waizenegger, I., Stein- Exp. Bot. 59, 40614074.
D. E., Preuss, M., Ebine, K., Ueda, T., S., Morimoto, K., and Takai, Y. mann, T., Schwarz, H., Mayer, U., Macia, E., Ehrlich, M., Massol, R.,
Nielsen, E., Odorizzi, G., and Otegui, (2004). Endocytosis of E-cadherin Hwang, I., Lukowitz, W., and Jur- Boucrot, E., Brunner, C., and
M. S. (2007). The Arabidopsis AAA regulated by Rac and Cdc42 small gens, G. (1997). The Arabidopsis Kirchhausen, T. (2006). Dynasore,

Frontiers in Plant Science | Plant Traffic and Transport August 2012 | Volume 3 | Article 197 | 13
Fujimoto and Ueda Plant-unique membrane trafficking machineries

a cell-permeable inhibitor of the TGN-PVC/vacuoles. Plant Cell Robert, S., Kleine-Vehn, J., Barbez, E., via a bidirectional promoter of the
dynamin. Dev. Cell 10, 839850. Physiol. 50, 20572068. Sauer, M., Paciorek, T., Baster, P., AP-3 (adaptor protein-3) mu3A and
Markgraf, D. F., Peplowska, K., and Paciorek, T., Zazimalova, E., Ruthardt, Vanneste, S., Zhang, J., Simon, S., AK (adenosine kinase) genes: dele-
Ungermann, C. (2007). Rab cas- N., Petrasek, J., Stierhof, Y. D., Covanova, M., Hayashi, K., Dhonuk- tion mutants of AK in Chinese ham-
cades and tethering factors in the Kleine-Vehn, J., Morris, D. A., she, P., Yang, Z., Bednarek, S. Y., ster cells extend into the AP-3 mu3A
endomembrane system. FEBS Lett. Emans, N., Jurgens, G., Geldner, Jones, A. M., Luschnig, C., Aniento, gene. Biochem. J. 378, 519528.
581, 21252130. N., and Friml, J. (2005). Auxin F., Zazimalova, E., and Friml, J. Somsel Rodman, J., and Wandinger-
Matsuzaki, M., Misumi, O., Shin, inhibits endocytosis and promotes (2010). ABP1 mediates auxin inhi- Ness, A. (2000). Rab GTPases coor-
I. T., Maruyama, S., Takahara, its own efflux from cells. Nature 435, bition of clathrin-dependent endo- dinate endocytosis. J. Cell. Sci.
M., Miyagishima, S. Y., Mori, T., 12511256. cytosis in Arabidopsis. Cell 143, 113(Pt 2), 183192.
Nishida, K., Yagisawa, F., Yoshida, Y., Pearse, B. M., and Robinson, M. 111121. Stenmark, H., and Olkkonen, V. M.
Nishimura, Y., Nakao, S., Kobayashi, S. (1984). Purification and prop- Robinson, M. S., and Bonifacino, J. (2001). The Rab GTPase family.
T., Momoyama, Y., Higashiyama, T., erties of 100-kd proteins from S. (2001). Adaptor-related proteins. Genome Biol. 2, REVIEWS3007.
Minoda, A., Sano, M., Nomoto, H., coated vesicles and their reconsti- Curr. Opin. Cell Biol. 13, 444453. Strickland, L. I., and Burgess, D.
Oishi, K., Hayashi, H., Ohta, F., tution with clathrin. EMBO J. 3, Robinson, M. S., Sahlender, D. A., and R. (2004). Pathways for mem-
Nishizaka, S., Haga, S., Miura, S., 19511957. Foster, S. D. (2010). Rapid inacti- brane trafficking during cytokinesis.
Morishita, T., Kabeya, Y., Terasawa, Pecenkova, T., Hala, M., Kulich, vation of proteins by rapamycin- Trends Cell Biol. 14, 115118.
K., Suzuki, Y., Ishii, Y., Asakawa, S., I., Kocourkova, D., Drdova, E., induced rerouting to mitochondria. Sweitzer, S. M., and Hinshaw, J.
Takano, H., Ohta, N., Kuroiwa, H., Fendrych, M., Toupalova, H., and Dev. Cell 18, 324331. E. (1998). Dynamin undergoes
Tanaka, K., Shimizu, N., Sugano, S., Zarsky, V. (2011). The role for Rojo, E., Gillmor, C. S., Kovaleva, V., a GTP-dependent conformational
Sato, N., Nozaki, H., Ogasawara, N., the exocyst complex subunits Somerville, C. R., and Raikhel, N. V. change causing vesiculation. Cell 93,
Kohara, Y., and Kuroiwa, T. (2004). Exo70B2 and Exo70H1 in the (2001). VACUOLELESS1 is an essen- 10211029.
Genome sequence of the ultra- plant-pathogen interaction. J. Exp. tial gene required for vacuole for- Synek, L., Schlager, N., Elias, M.,
small unicellular red alga Cyani- Bot. 62, 21072116. mation and morphogenesis in Ara- Quentin, M., Hauser, M. T., and
dioschyzon merolae 10D. Nature Pereira-Leal, J. B., and Seabra, M. C. bidopsis. Dev. Cell 1, 303310. Zarsky, V. (2006). AtEXO70A1, a
428, 653657. (2001). Evolution of the Rab fam- Rojo, E., Zouhar, J., Kovaleva, V., Hong, member of a family of putative exo-
McMahon, H. T., and Mills, I. G. ily of small GTP-binding proteins. J. S., and Raikhel, N. V. (2003). The cyst subunits specifically expanded
(2004). COP and clathrin-coated Mol. Biol. 313, 889901. AtC-VPS protein complex is local- in land plants, is important for
vesicle budding: different pathways, Praefcke, G. J., and McMahon, H. T. ized to the tonoplast and the prevac- polar growth and plant develop-
common approaches. Curr. Opin. (2004). The dynamin superfamily: uolar compartment in arabidopsis. ment. Plant J. 48, 5472.
Cell Biol. 16, 379391. universal membrane tubulation and Mol. Biol. Cell 14, 361369. Szumlanski, A. L., and Nielsen, E.
Mersey, B. G., Griffing, L. R., Ren- fission molecules? Nat. Rev. Mol. Cell Rutherford, S., and Moore, I. (2002). (2009). The Rab GTPase RabA4d
nie, P. J., and Fowke, L. C. (1985). Biol. 5, 133147. The Arabidopsis Rab GTPase fam- regulates pollen tube tip growth in
The isolation of coated vesicles from Preuss, M. L., Serna, J., Falbel, T. G., ily: another enigma variation. Curr. Arabidopsis thaliana. Plant Cell 21,
protoplasts of soybean. Planta 163, Bednarek, S. Y., and Nielsen, E. Opin. Plant Biol. 5, 518528. 526544.
317327. (2004). The Arabidopsis Rab GTPase Saito, C., and Ueda, T. (2009). Chapter Takei, K., Mcpherson, P. S., Schmid, S. L.,
Miyagishima, S. Y., Kuwayama, H., RabA4b localizes to the tips of grow- 4: functions of RAB and SNARE pro- and De Camilli, P. (1995). Tubular
Urushihara, H., and Nakanishi, ing root hair cells. Plant Cell 16, teins in plant life. Int. Rev. Cell Mol. membrane invaginations coated by
H. (2008). Evolutionary linkage 15891603. Biol. 274, 183233. dynamin rings are induced by GTP-
between eukaryotic cytokinesis and Rensing, S. A., Lang, D., Zimmer, A. Sanderfoot, A. (2007). Increases in the gamma S in nerve terminals. Nature
chloroplast division by dynamin D., Terry, A., Salamov, A., Shapiro, number of SNARE genes parallels 374, 186190.
proteins. Proc. Natl. Acad. Sci. U.S.A. H., Nishiyama, T., Perroud, P. F., the rise of multicellularity among Taylor, N. G. (2011). A role for Ara-
105, 1520215207. Lindquist, E. A., Kamisugi, Y., Tana- the green plants. Plant Physiol. 144, bidopsis dynamin related proteins
Munson, M., and Novick, P. (2006). The hashi, T., Sakakibara, K., Fujita, T., 617. DRP2A/B in endocytosis; DRP2
exocyst defrocked, a framework of Oishi, K., Shin, I. T., Kuroki, Y., Toy- Schledzewski, K., Brinkmann, H., and function is essential for plant
rods revealed. Nat. Struct. Mol. Biol. oda, A., Suzuki, Y., Hashimoto, S., Mendel, R. R. (1999). Phyloge- growth. Plant Mol. Biol. 76, 117129.
13, 577581. Yamaguchi, K., Sugano, S., Kohara, netic analysis of components of the Thellmann, M., Rybak, K., Thiele,
Nagawa, S., Xu, T., Lin, D., Dhonuk- Y., Fujiyama, A., Anterola, A., Aoki, eukaryotic vesicle transport system K., Wanner, G., and Assaad, F. F.
she, P., Zhang, X., Friml, J., S., Ashton, N., Barbazuk, W. B., reveals a common origin of adaptor (2010). Tethering factors required
Scheres, B., Fu, Y., and Yang, Barker, E., Bennetzen, J. L., Blanken- protein complexes 1, 2, and 3 and for cytokinesis in Arabidopsis. Plant
Z. (2012). ROP GTPase-dependent ship, R., Cho, S. H., Dutcher, S. K., the F subcomplex of the coatomer Physiol. 154, 720732.
actin microfilaments promote PIN1 Estelle, M., Fawcett, J. A., Gundlach, COPI. J. Mol. Evol. 48, 770778. Ueda, T., Matsuda, N., Anai, T.,
polarization by localized inhibi- H., Hanada, K., Heyl, A., Hicks, K. Seabra, M. C., and Wasmeier, C. (2004). Tsukaya, H., Uchimiya, H., and
tion of clathrin-dependent endo- A., Hughes, J., Lohr, M., Mayer, K., Controlling the location and activa- Nakano, A. (1996). An Arabidop-
cytosis. PLoS Biol. 10, e1001299. Melkozernov, A., Murata, T., Nelson, tion of Rab GTPases. Curr. Opin. Cell sis gene isolated by a novel method
doi:10.1371/journal.pbio.1001299 D. R., Pils, B., Prigge, M., Reiss, B., Biol. 16, 451457. for detecting genetic interaction in
Nagawa, S., Xu, T., and Yang, Z. (2010). Renner, T., Rombauts, S., Rushton, P. Segui-Simarro, J. M., Austin, J. R. II, yeast encodes the GDP dissociation
RHO GTPase in plants: conserva- J., Sanderfoot, A., Schween, G., Shiu, White, E. A., and Staehelin, L. A. inhibitor of Ara4 GTPase. Plant Cell
tion and invention of regulators and S. H., Stueber, K., Theodoulou, F. L., (2004). Electron tomographic analy- 8, 20792091.
effectors. Small GTPases 1, 7888. Tu, H., Van De Peer, Y., Verrier, P. J., sis of somatic cell plate formation Ueda, T., Uemura, T., Sato, M. H.,
Napier, R. M., David, K. M., and Perrot- Waters, E., Wood, A., Yang, L., Cove, in meristematic cells of Arabidopsis and Nakano, A. (2004). Func-
Rechenmann, C. (2002). A short D., Cuming,A. C., Hasebe, M., Lucas, preserved by high-pressure freezing. tional differentiation of endosomes
history of auxin-binding proteins. S., Mishler, B. D., Reski, R., Grigoriev, Plant Cell 16, 836856. in Arabidopsis cells. Plant J. 40,
Plant Mol. Biol. 49, 339348. I. V., Quatrano, R. S., and Boore, J. L. Sever, S. (2002). Dynamin and endo- 783789.
Niihama, M., Takemoto, N., Hashiguchi, (2008). The Physcomitrella genome cytosis. Curr. Opin. Cell Biol. 14, Ueda, T., Yamaguchi, M., Uchimiya,
Y., Tasaka, M., and Morita, M. T. reveals evolutionary insights into the 463467. H., and Nakano, A. (2001). Ara6,
(2009). ZIP genes encode proteins conquest of land by plants. Science Singh, B., and Gupta, R. S. (2004). a plant-unique novel type Rab
involved in membrane trafficking of 319, 6469. Genomic organization and linkage GTPase, functions in the endocytic

www.frontiersin.org August 2012 | Volume 3 | Article 197 | 14


Fujimoto and Ueda Plant-unique membrane trafficking machineries

pathway of Arabidopsis thaliana. Vedovato, M., Rossi, V., Dacks, J. B., Woollard, A. A., and Moore, I. (2008). Zhang, L., Zhang, H., Liu, P., Hao,
EMBO J. 20, 47304741. and Filippini, F. (2009). Compara- The functions of Rab GTPases in H., Jin, J. B., and Lin, J. (2011).
Uemura, T., Ueda, T., Ohniwa, R. L., tive analysis of plant genomes allows plant membrane traffic. Curr. Opin. Arabidopsis R-SNARE proteins
Nakano, A., Takeyasu, K., and Sato, the definition of the Phytolongins: Plant Biol. 11, 610619. VAMP721 and VAMP722 are
M. H. (2004). Systematic analysis a novel non-SNARE longin domain Xu, T., Wen, M., Nagawa, S., Fu, Y., required for cell plate forma-
of SNARE molecules in Arabidopsis: protein family. BMC Genomics Chen, J. G., Wu, M. J., Perrot- tion. PLoS ONE 6, e26129.
dissection of the post-Golgi network 10, 510. doi:10.1186/1471-2164-10- Rechenmann, C., Friml, J., Jones, A. doi:10.1371/journal.pone.
in plant cells. Cell Struct. Funct. 29, 510 M., and Yang, Z. (2010). Cell surface- 0026129
4965. Vernoud, V., Horton, A. C., Yang, Z., and rho GTPase-based auxin sig-
Ullrich, O., Reinsch, S., Urbe, S., Zer- and Nielsen, E. (2003). Analysis of naling controls cellular interdigi-
ial, M., and Parton, R. G. (1996). the small GTPase gene superfamily tation in Arabidopsis. Cell 143, Conflict of Interest Statement: The
Rab11 regulates recycling through of Arabidopsis. Plant Physiol. 131, 99110. authors declare that the research was
the pericentriolar recycling endo- 11911208. Yoshizawa, A. C., Kawashima, S., Okuda, conducted in the absence of any com-
some. J. Cell Biol. 135, 913924. Viotti, C., Bubeck, J., Stierhof, Y. S., Fujita, M., Itoh, M., Moriya, mercial or financial relationships that
Van Damme, D., Coutuer, S., De Rycke, D., Krebs, M., Langhans, M., Van Y., Hattori, M., and Kanehisa, M. could be construed as a potential con-
R., Bouget, F. Y., Inze, D., and Gee- Den Berg, W., Van Dongen, W., (2006). Extracting sequence motifs flict of interest.
len, D. (2006). Somatic cytokinesis Richter, S., Geldner, N., Takano, and the phylogenetic features of
and pollen maturation in Arabidop- J., Jurgens, G., De Vries, S. C., SNARE-dependent membrane traf- Received: 28 May 2012; accepted: 08
sis depend on TPLATE, which has Robinson, D. G., and Schumacher, fic. Traffic 7, 11041118. August 2012; published online: 28 August
domains similar to coat proteins. K. (2010). Endocytic and secre- Yu, I. M., and Hughson, F. M. (2010). 2012.
Plant Cell 18, 35023518. tory traffic in Arabidopsis merge in Tethering factors as organizers of Citation: Fujimoto M and Ueda T
Van Damme, D., Gadeyne, A., Vanstrae- the trans-Golgi network/early endo- intracellular vesicular traffic. Annu. (2012) Conserved and plant-unique
len, M., Inze, D., Van Montagu, M. some, an independent and highly Rev. Cell Dev. Biol. 26, 137156. mechanisms regulating plant post-Golgi
C., De Jaeger, G., Russinova, E., and dynamic organelle. Plant Cell 22, Zainal, Z., Tucker, G. A., and Lycett, traffic. Front. Plant Sci. 3:197. doi:
Geelen, D. (2011). Adaptin-like pro- 13441357. G. W. (1996). A rab11-like gene is 10.3389/fpls.2012.00197
tein TPLATE and clathrin recruit- Wang, J., Ding, Y., Hillmer, S., Miao, Y., developmentally regulated in ripen- This article was submitted to Frontiers in
ment during plant somatic cytoki- Lo, S. W., Wang, X., Robinson, D. ing mango (Mangifera indica L.) Plant Traffic and Transport, a specialty of
nesis occurs via two distinct path- G., and Jiang, L. (2010). EXPO, an fruit. Biochim. Biophys. Acta 1314, Frontiers in Plant Science.
ways. Proc. Natl. Acad. Sci. U.S.A. exocyst-positive organelle distinct 187190. Copyright 2012 Fujimoto and Ueda.
108, 615620. from multivesicular endosomes and Zhang, L., Tian, L. H., Zhao, J. F., This is an open-access article distributed
van Dooren, G. G., Reiff, S. B., Tomova, autophagosomes, mediates cytosol Song, Y., Zhang, C. J., and Guo, Y. under the terms of the Creative Com-
C., Meissner, M., Humbel, B. M., to cell wall exocytosis in Arabidopsis (2009). Identification of an apoplas- mons Attribution License, which per-
and Striepen, B. (2009). A novel and tobacco cells. Plant Cell 22, tic protein involved in the ini- mits use, distribution and reproduction
dynamin-related protein has been 40094030. tial phase of salt stress response in other forums, provided the original
recruited for apicoplast fission in Wickner, W., and Schekman, R. (2008). in rice root by two-dimensional authors and source are credited and sub-
Toxoplasma gondii. Curr. Biol. 19, Membrane fusion. Nat. Struct. Mol. electrophoresis. Plant Physiol. 149, ject to any copyright notices concerning
267276. Biol. 15, 658664. 916928. any third-party graphics etc.

Frontiers in Plant Science | Plant Traffic and Transport August 2012 | Volume 3 | Article 197 | 15
REVIEW ARTICLE
published: 02 October 2012
doi: 10.3389/fpls.2012.00219

Endocytic signaling in leaves and roots: same rules


different players
Christian Craddock* and Zhenbiao Yang*
Center for Plant Cell Biology, Department of Botany and Plant Sciences, University of California, Riverside, CA, USA

Edited by: To take up proteins and other components required by the cell, cells internalize a por-
Angus S. Murphy, University of tion of the plasma membrane (PM), which invaginates to form a closed vesicle within
Maryland, USA
the cytoplasm in a process known as endocytosis. The major plant endocytic mechanism
Reviewed by:
Liwen Jiang, The Chinese University
is mediated by clathrin, a protein that is necessary to generate a coated vesicle on the
of Hong Kong, Hong Kong inner side of the PM. These vesicles bud away from the membrane generating a vesicle
Yi Ma, University of Connecticut, USA whose contents originated from outside of the cell and they can selectively concentrate
*Correspondence: or exclude compounds. The process is therefore of key importance to plant growth, devel-
Christian Craddock and Zhenbiao opment, signaling, polarity, and nutrient delivery. Rho family small GTPases are conserved
Yang, Center for Plant Cell Biology,
Department of Botany and Plant
molecular switches that function in many signaling events. Plants possess only a sin-
Sciences, University of California, gle Rho-like GTPase (ROP) family. ROPs are known to be involved in the control of cell
Riverside, CA, USA. polarity by regulating endocytosis. To contend with the high levels of regulation required
e-mail: christian.craddock@ucr.edu; for such processes, plants have evolved specic regulators, including the Rop-interactive
zhenbiao.yang@ucr.edu
CRIB motif-containing protein (RIC) effectors. Recent ndings have demonstrated that ROP
dynamics and the cytoskeleton (including actin microlaments and microtubules) are inter-
woven. In this review, we summarize the current understanding of endocytosis in plants,
with particular regard to the signaling pathways.
Keywords: auxin, ABP1, ROP RIC actin, endocytosis clathrin, microtubules

INTRODUCTION recently, auxin has been implicated as a self-organizing signal that


The generation of planar cell polarity (PCP) is a process involving causes the polarization of PIN proteins. The auxin signal that
the distribution of cellular structures or molecules asymmetrically. appears to regulate downstream ROPs involved in PCP is medi-
PCP establishment requires a mechanism for the formation of ated through auxin binding protein 1 (ABP1). ABP1 has been
both intra-cell polarity and inter-cell polarity. proposed to regulate clathrin-mediated endocytosis in roots, and
Rho-like GTPases (ROPs) from plants are the sole signaling the ROP-dependent pavement cell (PC) interdigitation in leaves
small GTPases in plants and it is therefore expected that they have (Robert et al., 2010; Xu et al., 2010, 2011).
a role in numerous signaling events. ROPs are already known to The signaling mechanisms involved in the formation of
participate in signaling pathways that regulate cytoskeletal orga- cell polarity, including ROPs, their close relationship with the
nization and vesicular trafcking, and as a consequence have an cytoskeleton and endocytic trafcking are the focus of this review.
impact on cell polarization, polar growth, and cell morphogen- The above-mentioned mechanisms are all conserved in plants and
esis. Microtubules (MTs) and actin microlaments (F-actin) are animals, and consequently advances in knowledge in the plant sys-
the two major cytoskeletal elements that play a key role in many tem may synergize advances in understanding similar mechanisms
cellular processes, including cell polarity and endocytosis. and processes in mammalian systems.
In plants, the phytohormone auxin has a cardinal role in the
coordination of many physiological functions, including growth SIGNALING AND ENDOCYTOSIS IN PAVEMENT CELLS
and the development of cells and organs (Benkova et al., 2003; The formation of the jigsaw puzzle like shape of Arabidopsis leaf
Friml et al., 2003; Blilou et al., 2005; Vieten et al., 2005; Wei- PCs epitomizes a long-standing question in cell and developmental
jers et al., 2005; Scarpella et al., 2006; Wisniewska et al., 2006; biology. How does a eld of cells precisely coordinate uniform
Grieneisen et al., 2007; Gao et al., 2008; Yang, 2008). To function, cell polarity? Importantly, the interdigitation of PCs provides an
auxin must be dynamic both spatially and temporally (Santner and excellent system for the investigation because interdigitation is a
Estelle, 2009; Vanneste and Friml, 2009). In multicellular plants, non-essential process. It is therefore possible to study the signaling
this process is in part mediated by the polar distribution of the mechanism with the use of overexpressing or knockout plant lines.
auxin efux carriers PIN-FORMED (PIN) proteins, which are In leaf PCs, the auxin cell surface receptor ABP1 mediates auxin
required for polar auxin transport and the formation of auxin signaling to coordinately activate two mutually exclusive ROP sig-
gradients. naling pathways. They are activated in complementary lobe and
Asymmetric endocytosis and the recycling of PINs localized indent regions on adjacent sides of the cell (Figure 1). A lobe in a
at the plasma membrane (PM) contribute to the polar localiza- cell corresponds to an indent in the adjacent cell. ROP2 and ROP4
tion of PINs (Geldner et al., 2003; Dhonukshe et al., 2008). More promote lobe formation and are functionally redundant; ROP2 is

www.frontiersin.org October 2012 | Volume 3 | Article 219 | 16

fpls-03-00219 2012/9/29 20:13 page 1 #1


Craddock and Yang Endocytic signaling: same players different rules

with this, the localization of PIN1 to the lobe tips (Fu et al., 2005)
was found to be dependent on ROP2, which is activated in the
same PM region where PIN1 is located (Xu et al., 2010). The evi-
dence is suggestive that PIN1-directed auxin efux is involved in
the positive feedback regulation of ROP2 (Fu et al., 2002, 2005).
This model is consistent with that of roots and guard cells, where
constitutive activation of ROPs inhibited the internalization of the
endocytosis marker FM-64 (Bloch et al., 2005; Sorek et al., 2010;
Hwang et al., 2011). ROP2 was found to inhibit PIN1 endocyto-
sis in the lobe regions of PCs. A series of elegant studies using
the Dendra2 photo-convertible uorescent protein revealed that
in wild type, PIN1 endocytosis was found to occur in the inden-
FIGURE 1 | Rho-like GTPase activation regions and PIN1 localization in
leaf PCs. ROP2 promotes the localization of PIN1 to the lobe tip which
tation regions but not in the lobe regions. In contrast, expression
initiates a positive feedback loop in this region. The mutual exclusivity of of dominant negative ROP2 induced PIN1 endocytosis in the lobe
ROP2 and ROP6 help restrict PIN1 to the lobe region. region. Following the transient expression of PIN1GFP in rop2
mutant PCs, revealed that ROP2 is required for the inhibitory
effect of auxin on PIN1 endocytosis. A nal experiment using ric4
the dominant ROP in lobe promotion and it is common to refer mutant knock down and PIN1GFP demonstrated that RIC4 has a
to ROP2 and ROP4 simply as ROP2. ROP6 is responsible for the role in promoting the accumulation of cortical F-actin in the lobe
promotion of indentations (Fu et al., 2002, 2005). Both ROP2 and region and in turn inhibiting PIN1 endocytosis through RIC4-
ROP6 localize to and are activated at the PM (Xu et al., 2010, 2011). dependent F-actin. Recent data, summarized in Figure 2, show
The localization of the auxin efux carrier PIN1 to the lobe tips that the ROP2/RIC4 pathway inhibits clathrin-dependent PIN1
requires localized ROP2, indicating the existence of a localized endocytosis thereby leading to PIN1 polarization. The direction
auxinROP2PIN1auxin positive feedback loop that could be of auxin movement is dependent on PIN auxin transporters, which
responsible for the generation and maintenance of localized auxin constantly undertake endocytic recycling (Dhonukshe et al., 2007,
levels (Xu et al., 2010). However, it remains to be established how 2008; Kleine-Vehn et al., 2011), with the polar location of PIN
auxin-activated ROP2 regulates PIN1 polarization. ROP2 regu- at the PM determining the direction of auxin ow between cells
lates the formation of multipolarity through its activation of RIC4 (Petrasek et al., 2006).
(Fu et al., 2005), a member of the ROP interacting CRIB motif- Although the nature and morphology of the recycling endo-
containing (RIC) family of ROP effector proteins (Wu et al., 2001). some remains elusive, plant early endosomes (EEs) and late endo-
RIC4 induces the formation of cortical F-actin in the tips of PCs somes (LEs) have been shown to correspond to the trans-Golgi
(Fu et al., 2005). network (TGN) and multivesicular bodies (MVBs), respectively.
In the indenting zone, ROP6 activates RIC1, leading to the Endosomes are cellular organelles that appear to be involved in
formation of well-ordered MT arrays, which promote indentation both the endocytic and biosynthetic pathways in plants (De Mat-
and inhibit ROP2 activation (Fu et al., 2005, 2009). teis and Luini, 2008; Foresti and Denecke, 2008). In the endocytic
ROP2 inactivates RIC1, which causes the suppression of well- pathway, EEs receive internalized material from the PM and either
ordered cortical MTs, thus preventing outgrowth as MTs are recycle it back to the cell surface or target it for degradation, thereby
excluded from outgrowing lobe tips (Fu et al., 2002, 2005). With acting as an important protein sorting station in the endocytic
the local activation of ROP2PIN1 in the lobe region, ROP6 is pathway, which is fundamental to ensure establishment and main-
suppressed at this site, given that the ROP2 and ROP6 pathways tenance of cell polarity and homeostasis (Geldner, 2004; Geldner
are mutually exclusive (Fu et al., 2009). Within an indent region, et al., 2004; Lam et al., 2007b; Otegui and Spitzer, 2008). In addi-
ROP6 activates RIC1, which leads to the creation of highly ordered tion, EEs play a role in the biosynthetic pathway as they can receive
MT arrays, which promote further indentation and inhibit ROP2 newly synthesized material from the TGN and either sort it to the
activity (Fu et al., 2005, 2009). It is hypothesized that the mutual endosome/lysosome or recycle it back to the PM via the recycling
inhibition between the ROP2 and ROP6 pathways transforms the endosome (De Matteis and Luini, 2008).
initial uniform pool of auxin into localized extracellular auxin Studies using the endocytic tracer FM4-64, indicate that the
pools that enable the sustainment of ROP2 and ROP6 activity on VHA1-labeled TGN is an EE given that it displays detectable steady
opposing sides of the extracellular pool of auxin. It is thought state levels of FM4-64 prior to the labeling of the PVC (Dettmer
that this interdigitated patterning of ROP2 and ROP6 activa- et al., 2006; Lam et al., 2007a). These studies in conjunction with
tion could give rise to the lobe and indentation patterning that morphological observations that both the TGN and the EE can
is observed between neighboring cells. It was recently shown that present clathrin budding proles (Payne and Schekman, 1985;
the rapid activation of the antagonizing ROP2 and ROP6 pathways Hillmer et al., 1988; Pearse and Robinson, 1990) further support
require ABP1-dependent auxin perception (Xu et al., 2010). This the TGN and EEs being the same compartment (Geldner, 2004;
work demonstrated that exogenous auxin promotes interdigita- Lam et al., 2007a).
tion in PCs, whereas a reduction in endogenous auxin suppresses Proteins within the EEs that are destined for degradation are
interdigitation (Xu et al., 2010). Auxin inhibits PIN internaliza- sorted into another subdomain, which will form MVB/LEs (Murk
tion (Paciorek et al., 2005; Dhonukshe et al., 2008), and consistent et al., 2002). MVBs/LEs mediate the delivery of vacuolar-destined

Frontiers in Plant Science | Plant Trafc and Transport October 2012 | Volume 3 | Article 219 | 17

fpls-03-00219 2012/9/29 20:13 page 2 #2


Craddock and Yang Endocytic signaling: same players different rules

FIGURE 2 | A model in PCs for PIN1 polarization to the lobe regions of recycling endosomes (Brefeldin A inhibits ADP ribosylation factor GEF and
PCs via a ROP signaling mechanism. ROP2 is activated by extracellular prevents endosomal recycling, the accumulation of internalized PIN1 in
auxin in the lobe region. The activated ROP2RIC4 pathway leads to the aggregates known as BFA bodies in plant cells). Endocytosed material can
inhibition of PIN1 internalization through RIC4-dependent cortical F-actin, then be recycled back to the PM. Material maintained in early endosomes as
leading to PIN1 polarization at the lobe. The PIN1-based export of auxin leads they mature becomes internalized in late endosomes. The multivesicular
to further ROP2 activation for completion of this feed-forward cycle. Recent structure of the late endosomes allows membrane fusion with the vacuole.
data (Nagawa et al., 2012) indicates that the activated ROP2RIC4 pathway Proteins within the late endosomes are delivered to the vacuole for
has a role in the promotion of endosomal trafcking from early endosomes to degradation.

proteins to the vacuole through fusion with the tonoplast. It REGULATION OF ENDOCYTOSIS IN ROOTS
was shown that LE/MVBs contain visibly distinct morphologi- In roots, the mechanisms underlying apical and basal polarization
cal regions together with membrane domains enriched in two appear similar to the coordination of polarity in leaves. In roots,
GTPases, Rab7, and Rab9, that regulate late endocytic traf- recent ndings have shown that a signal module composed of
c and LE/MVB to EE/TGN recycling, respectively (Gruenberg, auxin, ABP1, ROP6/RIC1, clathrin, PIN1/PIN2 act as an integral
2001; Barbero et al., 2002), inferring that LEs/MVBs derive from component of the feedback regulation of auxin transport during
TGN/EEs. Earlier evidence indeed demonstrated that the forma- root development.
tion of LEs/MVBs from EEs/TGN is induced by the ubiquitination Recent evidence indicates that ROP6 affects endocytosis and
of receptors, as illustrated by the epidermal growth factor (EGF; is involved in PIN internalization (Chen et al., 2012). Subsequent
Hicke and Riezman, 1996). More recent evidence also points experiments revealed that the uptake of FM4-64 increased in the
toward LEs/MVBs being derived through the maturation of roots of rop6 or ric1 mutant plant lines, whereas uptake was
EEs/TGN (Scheuring et al., 2011). Importantly, their experiments reduced in the presence of constitutive rop6 expression (Chen
suggest that the inhibition of clathrin-mediated transport does not et al., 2012). In addition, visualization of clathrin heavy chain
halt the transport of soluble cargo bearing vacuolar sorting deter- with the aforementioned plant lines revealed that ROP6 signaling
minants to the vacuole. Therefore the widely held concept of the negatively regulates clathrin-mediated endocytosis (Chen et al.,
anterograde trafcking of proteins occurring via the recognition 2012). rop6 and ric1 mutants displayed lower levels of sensitiv-
of sorting signals and trafcking through vesicles moving between ity to auxin indicating the ROP6/RIC1 pathway is involved in and
stable compartments is not supported by this evidence. Instead acts downstream of both auxin regulation and ABP1 signaling in
the evidence supports the idea that anterograde trafcking occurs the regulation of clathrin-mediated endocytosis in roots (Chen
in the absence of CCVs and the recycling of receptors (Scheuring et al., 2012). The role of the ROP6/RIC1 pathway in endocytosis
et al., 2011). roots is similar to the regulation of PC interdigitation in leaves

www.frontiersin.org October 2012 | Volume 3 | Article 219 | 18

fpls-03-00219 2012/9/29 20:13 page 3 #3


Craddock and Yang Endocytic signaling: same players different rules

begun to link auxin signaling to PIN-mediated pattern forma-


tion and morphogenesis in roots. A genetic screen found that
the absence of SPIKE1 leads to increased lateral root density and
retarded gravitropic responses matching the phenotype observed
in pin2 knockouts (Lin et al., 2012). Mutant spk1 plants induced
PIN2 internalization that could not be suppressed by auxin, equiv-
alent to rop6 and ric1 mutants. Moreover, SPIKE1 was required
for auxin induction of ROP6 activation.
The current model for the polar distribution of PIN2 via the
ROP-based signaling pathway is presented in Figure 3.

CONCLUSION
Recent ndings suggest that PIN internalization by ROP-based
auxin signaling is a mechanism responsible for the regulation of
polar auxin trafcking in plants. The ROP2/RIC4 pathway being
responsible for the induction of F-actin in PCs which leads to the
inhibition of PIN1 internalization necessary for PIN1 polarization
to the lobe tips (Nagawa et al., 2012). The ROP6/RIC1 pathway
functions in roots to inhibit PIN2 internalization through the sta-
bilization of F-actin. A key distinction is that ABP1 activates the
ROP pathway in PCs (Xu et al., 2010; Nagawa et al., 2012), whereas
in roots ABP1 is responsible for inactivation of the ROP pathway
(Chen et al., 2012). Future studies will hopefully elucidate whether
FIGURE 3 | A model in roots for PIN2 polar distribution via a ROP this nding is due to differences in auxin concentration required
signaling mechanism. Data indicate that the auxin-mediated inhibition of
polar PIN2 internalization is regulated by the SPK1ROP6RIC1 pathway.
to activate the ROP pathways in different tissues.
Auxin is proposed to activate the SPK1ROP6RIC1 pathway and inhibit Whilst recent advances strongly suggest that the ROP-based
PIN2 internalization. The localized inhibition of PIN2 internalization via ROP6 auxin signaling that regulates PIN internalization is a widespread
signaling causes PIN2 to be retained in the PM, which generates a positive mechanism for the modulation of auxin transport in plants,
feedback mechanism for maintaining polar PIN2 distribution to the PM.
key questions remain. Including for example the involvement of
the ABP1 pathway in cytoskeletal dynamics and cell polarity. A
resourceful use of biochemistry, forward and reverse genetics, and
(Xu et al., 2010; Nagawa et al., 2012). Both pathways possess the imaging are necessary to identify the remaining components to
auxin feedback module composed of auxinABP1ROPclathrin- obtain a fuller understanding of the signaling events regulating
mediated endocytosis-PIN1/PIN2 localization, although there are endocytosis in plants.
key differences in how the individual steps are performed. In PCs,
auxin acts via ABP1 to activate the ROP2 pathway and inhibits ACKNOWLEDGMENTS
clathrin-dependent endocytosis leading to PIN1 polarization at The authors thank Irene Lavagi for editing this manuscript and
the lobe (Xu et al., 2010; Nagawa et al., 2012). In roots, ABP1 providing thoughtful comments. We thank past and present mem-
seems to act as a positive regulator of clathrin-mediated endocy- bers of the Yang laboratory for stimulating discussions and the
tosis, whereas auxin acts as the inhibitor (Chen et al., 2012). The generation of data that made this review possible. The work
relatively mild phenotype displayed in the analyzed ROP6 geno- is supported by funding from the National Institute of General
types indicates functional redundancy with other ROPs such as Medical Sciences (R01GM081451 and R01GM100130) and the
ROP9 and ROP11 (Bloch et al., 2005). Very recent ndings have Department of Energy (DE-FG02-04ER15555) to Zhenbiao Yang.

REFERENCES K., and Scheres, B. (2005). The clathrin-mediated endocytosis in endocytosis of PIN auxin efux
Barbero, P., Bittova, L., and Pfef- PIN auxin efux facilitator net- Arabidopsis roots. Curr. Biol. 22, carriers in Arabidopsis. Curr. Biol. 17,
fer, S. R. (2002). Visualization work controls growth and pattern- 13261332. 520527.
of Rab9-mediated vesicle transport ing in Arabidopsis roots. Nature 433, De Matteis, M. A., and Luini, A. (2008). Dhonukshe, P., Tanaka, H., Goh, T.,
from endosomes to the trans-Golgi 3944. Exiting the Golgi complex. Nat. Rev. Ebine, K., Mhnen, A. P., Prasad, K.,
in living cells. J. Cell Biol. 156, Bloch, D., Lavy, M., Efrat, Y., Efroni, Mol. Cell Biol. 9, 273284. Blilou, I., Geldner, N., Xu, J., Uemura,
511518. I., Bracha-Drori, K., Abu-Abied, M., Dettmer, J., Hong-Hermesdorf, A., T., Chory, J., Ueda, T., Nakano, A.,
Benkova, E., Michniewicz, M., Sauer, Sadot, E., and Yalovsky, S. (2005). Stierhof, Y.-D., and Schumacher. K. Scheres, B., and Friml, J. (2008).
M., Teichmann, T., Seifertov, D., Jr- Ectopic expression of an activated (2006). Vacuolar H+-ATPase activity Generation of cell polarity in plants
gens, G., and Friml, J. (2003). Local, RAC in Arabidopsis disrupts mem- is required for endocytic and secre- links endocytosis, auxin distribution
efux-dependent auxin gradients as brane cycling. Mol. Biol. Cell 16, tory trafcking in Arabidopsis. Plant and cell fate decisions. Nature 456,
a common module for plant organ 19131927. Cell 18, 715730. 962966.
formation. Cell 115, 591602. Chen, X., Naramoto, S., Robert, S., Dhonukshe, P., Aniento, F., Hwang, I., Foresti, O., and Denecke, J. (2008).
Blilou, I., Xu, J., Wildwater, M., Tejos, R., Lfke, C., Lin, D., Yang, Robinson, D. G., Mravec, J., Stier- Intermediate organelles of the plant
Willemsen, V., Paponov, I., Friml, Z., and Friml, J. (2012). ABP1 and hof, Y. D., and Friml, J. (2007). secretory pathway: identity and
J., Heidstra, R., Aida, M., Palme, ROP6 GTPase signaling regulate Clathrin-mediated constitutive function. Trafc 9, 15991612.

Frontiers in Plant Science | Plant Trafc and Transport October 2012 | Volume 3 | Article 219 | 19

fpls-03-00219 2012/9/29 20:13 page 4 #4


Craddock and Yang Endocytic signaling: same players different rules

Friml, J., Vieten, A., Sauer, M., Wei- Hillmer, S., Freundt, H., and Robinson, Payne, G. S., and Schekman, R. (1985). Weijers, D., Sauer, M., Meurette, O.,
jers, D., Schwarz, H., Hamann, D. G. (1988). The partially coated A test of clathrin function in pro- Friml, J., Ljung, K., Sandberg, G.,
T., Offringa, R., and Jrgens, reticulum and its relationship to the tein secretion and cell growth. Science Hooykaas, P., and Offringa, R. (2005).
G. (2003). Efux-dependent auxin Golgi apparatus in higher plant cells. 230, 10091014. Maintenance of embryonic auxin dis-
gradients establish the apical-basal Eur. J. Cell Biol. 47, 206212. Pearse, B. M., and Robinson, M. S. tribution for apical-basal patterning
axis of Arabidopsis. Nature 426, Hwang, J. U., Jeon, B. W., Hong, D., (1990). Clathrin, adaptors, and sort- by PIN-FORMED-dependent auxin
147153. and Lee, Y. (2011). Active ROP2 ing. Annu. Rev. Cell Biol. 6, 151171. transport in Arabidopsis. Plant Cell
Fu, Y., Gu, Y., Zheng, Z., Wasteneys, GTPase inhibits ABA- and CO2- Petrasek, J., Mravec, J., Bouchard, R., 17, 25172526.
G., and Yang, Z. (2005). Ara- induced stomatal closure. Plant Cell Blakeslee, J. J., Abas, M., Seifer- Wisniewska, J., Xu, J., Seifertov, D.,
bidopsis interdigitating cell growth Environ. 34, 21722182. tov, D., Wisniewska, J., Tadele, Z., Brewer, P. B., Ruzicka, K., Blilou, I.,
requires two antagonistic pathways Kleine-Vehn, J., Wabnik, K., Mar- Kubes, M., Covanov, M., Dhonuk- Rouqui, D., Benkov, E., Scheres, B.,
with opposing action on cell mor- tinire, A., Langowski, L., Willig, K., she, P., Skupa, P., Benkov, E., and Friml, J. (2006). Polar PIN local-
phogenesis. Cell 120, 687700. Naramoto, S., Leitner, J., Tanaka, H., Perry, L., Krecek, P., Lee, O. R., ization directs auxin ow in plants.
Fu, Y., Li, H., and Yang, Z. Jakobs, S., Robert, S., Luschnig, C., Fink, G. R., Geisler, M., Murphy, Science 312, 883.
(2002). The ROP2 GTPase con- Govaerts, W., Hell, S. W., Runions, A. S., Luschnig, C., Zazmalov, E., Wu, G., Gu, Y., Li, S., and Yang,
trols the formation of cortical ne J., and Friml, J. (2011). Recycling, and Friml, J. (2006). PIN proteins Z. (2001). A genome-wide analysis
F-actin and the early phase of direc- clustering, and endocytosis jointly perform a rate-limiting function in of Arabidopsis Rop-interactive CRIB
tional cell expansion during Ara- maintain PIN auxin carrier polarity cellular auxin efux. Science 312, motif-containing proteins that act as
bidopsis organogenesis. Plant Cell 14, at the plasma membrane. Mol. Syst. 914918. Rop GTPase targets. Plant Cell 13,
777794. Biol. 7, 540. Robert, S., Kleine-Vehn, J., Barbez, E., 28412856.
Fu, Y., Xu, T., Zhu, L., Wen, M., Lam, S. K., Siu, C. L., Hillmer, S., Sauer, M., Paciorek, T., Baster, P., Xu, T., Nagawa, S., and Yang, Z.
and Yang, Z. (2009). A ROP GTPase Jang, S., An, G., Robinson, D. G., Vanneste, S., Zhang, J., Simon, S., (2011). Uniform auxin triggers the
signaling pathway controls cortical and Jiang, L. (2007a). Rice SCAMP1 Covanov, M., Hayashi, K., Dhonuk- Rho GTPase-dependent formation of
microtubule ordering and cell expan- denes clathrin-coated, trans-Golgi- she, P., Yang, Z., Bednarek, S. Y., Jones, interdigitation patterns in pavement
sion in Arabidopsis. Curr. Biol. 19, located tubular-vesicular structures A. M., Luschnig, C., Aniento, F., Za- cells. Small GTPases 2, 227232.
18271832. as an early endosome in tobacco BY-2 malov, E., and Friml, J. (2010). ABP1 Xu, T., Wen, M., Nagawa, S., Fu,
Gao, X., Nagawa, S., Wang, G., and cells. Plant Cell 19, 296319. mediates auxin inhibition of clathrin- Y., Chen, J. G., Wu, M. J., Perrot-
Yang, Z. (2008). Cell polarity signal- Lam, S. K., Tse, Y. C., Robinson, D. G., dependent endocytosis in Arabidop- Rechenmann, C., Friml, J., Jones, A.
ing: focus on polar auxin transport. and Jiang, L. (2007b). Tracking down sis. Cell 143, 111121. M., and Yang, Z. (2010). Cell surface-
Mol. Plant 1, 899909. the elusive early endosome. Trends Santner, A., and Estelle, M. (2009). and rho GTPase-based auxin signal-
Geldner, N. (2004). The plant endoso- Plant Sci. 12, 497505. Recent advances and emerging trends ing controls cellular interdigitation in
mal system its structure and role in Lin, D., Nagawa, S., Chen, J., Cao, L., in plant hormone signalling. Nature Arabidopsis. Cell 143, 99110.
signal transduction and plant devel- Chen, X., Xu, T., Li, H., Dhonuk- 459, 10711078. Yang, Z. (2008). Cell polarity signaling
opment. Planta 219, 547560. she, P., Yamamuro, C., Friml, J., Scarpella, E., Marcos, D., Friml, J., and in Arabidopsis. Annu. Rev. Cell. Dev.
Geldner, N., Anders, N., Wolters, H., Scheres, B., Fu, Y., and Yang, Z. Berleth, T. (2006). Control of leaf Biol. 24, 551575.
Keicher, J., Kornberger, W., Muller, (2012). A ROP GTPase-dependent vascular patterning by polar auxin
P., Delbarre, A., Ueda, T., Nakano, auxin signaling pathway regulates the transport. Genes Dev. 20, 10151027.
A., and Jrgens, G. (2003). The Ara- subcellular distribution of PIN2 in Scheuring, D., Viotti, C., Krger, F., Conflict of Interest Statement: The
bidopsis GNOM ARF-GEF mediates Arabidopsis roots. Curr. Biol. 22, Knzl, F., Sturm, S., Bubeck, J., authors declare that the research was
endosomal recycling, auxin trans- 13191325. Hillmer, S., Frigerio, L., Robinson, conducted in the absence of any com-
port, and auxin-dependent plant Murk, J. L., Stoorvogel, W., Kleijmeer, D. G., Pimpl, P., and Schumacher, K. mercial or nancial relationships that
growth. Cell 112, 219230. M. J., and Geuze, H. J. (2002). (2011). Multivesicular bodies mature could be construed as a potential con-
Geldner, N., Richter, S., Vieten, A., The plasticity of multivesicular bod- from the trans-Golgi network/early ict of interest.
Marquardt, S., Torres-Ruiz, R. A., ies and the regulation of antigen pre- endosome in Arabidopsis. Plant Cell
Mayer, U., and Jrgens, G. (2004). sentation. Semin. Cell Dev. Biol. 13, 23, 34633481. Received: 30 June 2012; accepted: 05
Partial loss-of-function alleles reveal 303311. Sorek, N., Segev, O., Gutman, O., Bar, September 2012; published online: 02
a role for GNOM in auxin transport- Nagawa, S., Xu, T., Lin, D., Dhonukshe, E., Richter, S., Poraty, L., Hirsch, J. October 2012.
related, post-embryonic develop- P., Zhang, X., Friml, J., Scheres, B., Fu, A., Henis, Y. I., Lewinsohn, E., Jr- Citation: Craddock C and Yang Z (2012)
ment of Arabidopsis. Development Y., and Yang, Z. (2012). ROP GTPase- gens, G., and Yalovsky, S. (2010). Endocytic signaling in leaves and roots:
131, 389400. dependent actin microlaments An S-acylation switch of conserved same rules different players. Front.
Grieneisen, V. A., Xu, J., Mare, A. promote PIN1 polarization by local- G domain cysteines is required for Plant Sci. 3:219. doi: 10.3389/fpls.2012.
F., Hogeweg, P., and Scheres, B. ized inhibition of clathrin-dependent polarity signaling by ROP GTPases. 00219
(2007). Auxin transport is sufcient endocytosis. PLoS Biol. 10, e1001299. Curr. Biol. 20, 914920. This article was submitted to Frontiers in
to generate a maximum and gradi- doi: 10.1371/journal.pbio.1001299 Vanneste, S., and Friml, J. (2009). Auxin: Plant Trafc and Transport, a specialty of
ent guiding root growth. Nature 449, Otegui, M. S., and Spitzer, C. (2008). a trigger for change in plant develop- Frontiers in Plant Science.
10081013. Endosomal functions in plants. Traf- ment. Cell 136, 10051016. Copyright 2012 Craddock and Yang.
Gruenberg, J. (2001). The endocytic c 9, 15891598. Vieten, A., Vanneste, S., Wisniewska, J., This is an open-access article distributed
pathway: a mosaic of domains. Nat. Paciorek, T., Zazimalova, E., Ruthardt, Benkov, E., Benjamins, R., Beeck- under the terms of the Creative Commons
Rev. Mol. Cell Biol. 2, 721730. N., Petrsek, J., Stierhof, Y. D, Kleine- man, T., Luschnig, C., and Friml, Attribution License, which permits use,
Hicke, L., and Riezman, H. (1996). Vehn, J., Morris, D. A., Emans, N., J. (2005). Functional redundancy distribution and reproduction in other
Ubiquitination of a yeast plasma Jrgens, G., Geldner, N., and Friml, of PIN proteins is accompanied by forums, provided the original authors and
membrane receptor signals its ligand- J. (2005). Auxin inhibits endocyto- auxin-dependent cross-regulation of source are credited and subject to any
stimulated endocytosis. Cell 84, sis and promotes its own efux from PIN expression. Development 132, copyright notices concerning any third-
277287. cells. Nature 435, 12511256. 45214531. party graphics etc.

www.frontiersin.org October 2012 | Volume 3 | Article 219 | 20

fpls-03-00219 2012/9/29 20:13 page 5 #5


ORIGINAL RESEARCH ARTICLE
published: 18 July 2012
doi: 10.3389/fpls.2012.00159

Evolution of the land plant exocyst complexes


Fatima Cvrckov 1 *, Michal Grunt 1 , Radek Bezvoda 1 , Michal Hla 1,2 , Ivan Kulich 1 , Anamika Rawat 1 and
Viktor rsk 1,2
1
Department of Experimental Plant Biology, Faculty of Sciences, Charles University, Prague, Czech Republic
2
Institute of Experimental Botany, Academy of Sciences of the Czech Republic, Prague, Czech Republic

Edited by: Exocyst is an evolutionarily conserved vesicle tethering complex functioning especially in
Markus Geisler, University of
the last stage of exocytosis. Homologs of its eight canonical subunits Sec3, Sec5, Sec6,
Fribourg, Switzerland
Sec8, Sec10, Sec15, Exo70, and Exo84 were found also in higher plants and confirmed
Reviewed by:
Jrgen Kleine-Vehn, University of to form complexes in vivo, and to participate in cell growth including polarized expansion of
Natural Resources and Life Sciences pollen tubes and root hairs. Here we present results of a phylogenetic study of land plant
Vienna, Austria exocyst subunits encoded by a selection of completely sequenced genomes represent-
Frantisek Baluska, University of Bonn,
ing a variety of plant, mostly angiosperm, lineages. According to their evolution histories,
Germany
plant exocyst subunits can be divided into several groups. The core subunits Sec6, Sec8,
*Correspondence:
Fatima Cvrckov, Department of and Sec10, together with Sec3 and Sec5, underwent few, if any fixed duplications in the
Experimental Plant Biology, Faculty of tracheophytes (though they did amplify in the moss Physcomitrella patens), while others
Sciences, Charles University, Vinicn form larger families, with the number of paralogs ranging typically from two to eight per
5, CZ 128 44 Praha 2, Czech Republic.
genome (Sec15, Exo84) to several dozens per genome (Exo70). Most of the diversity,
e-mail: fatima.cvrckova@natur.cuni.cz
which can be in some cases traced down to the origins of land plants, can be attributed to
the peripheral subunits Exo84 and, in particular, Exo70. As predicted previously, early land
plants (including possibly also the Rhyniophytes) encoded three ancestral Exo70 paralogs
which further diversified in the course of land plant evolution. Our results imply that plants
do not have a single Exocyst complex instead, they appear to possess a diversity of
exocyst variants unparalleled among other organisms studied so far. This feature might per-
haps be directly related to the demands of building and maintenance of the complicated
and spatially diverse structures of the endomembranes and cell surfaces in multicellular
land plants.
Keywords: exocyst, phylogeny, land plants, co-evolution, gene duplication

INTRODUCTION in Brassica and Arabidopsis (Samuel et al., 2009), though its spe-
Exocyst, or the Sec6/8 complex, is an evolutionarily conserved cific role remains controversial (Kitashiba et al., 2011) and the
heterooligomeric protein complex, generally believed to function observed phenotypes may be rather due to a generalized secretion
especially in the last stage of exocytosis i.e., vesicle tethering, defect affecting stigma function (Synek et al., 2006).
preceding fusion of trans-Golgi network-derived vesicles with the Exocyst belongs, together with related COG, GARP, and DSL1
plasmalemma, although additional, also mostly vesicle trafficking- complexes, to the large, evolutionarily ancient family of eukaryotic
related, exocyst roles have been described (reviewed, e.g., in He and quatrefoil vesicle tethering complexes (Whyte and Munro, 2002;
Guo, 2009; Zhang et al., 2010; Heider and Munson, 2012). The Koumandou et al., 2007). Structural studies (recently reviewed
eight canonical exocyst subunits, Sec3, Sec5, Sec6, Sec8, Sec10, by Hertzog and Chavrier, 2011) and theoretical sequence-based
Sec15, Exo70, and Exo84, were originally identified in yeast (Ter- modeling revealed common structural elements involving rod-
Bush et al., 1996; Guo et al., 1999). Subsequently, their homologs like helical bundles in all eight subunits, and a model of exocyst
were found also in metazoans (Guo et al., 1997; Kee et al., 1997) architecture based on aggregation of these bundles has been pro-
and higher plants (Eli et al., 2003). Angiosperm exocyst sub- posed (Munson and Novick, 2006; Croteau et al., 2009). Electron
units form complexes in vivo (Hla et al., 2008), and participate microscopy observations consistent with this model have been
in exocytosis- or vesicle trafficking-dependent processes, such as made also in the case of the putative plant exocyst (Segu-Simmaro
cell growth including both tip growth and diffuse surface expan- et al., 2004). Bundled Sec6, Sec8, Sec10 subunits probably form
sion (Cole et al., 2005; Wen et al., 2005; Synek et al., 2006; Hla a core of the complex. At least in the yeast model, Sec6 also
et al., 2008), cell division (Fendrych et al., 2010), delivery of mate- participates in its anchoring to the target membrane, and the
rials to the periplasm and cell wall (Wang et al., 2010), biogenesis remaining, more peripherally located subunits mediate interac-
of specialized cell wall structures such as the myxosperm seed tions with membrane vesicles destined for delivery (as in the case
coat (Kulich et al., 2010), pathogen response (Pecenkov et al., of Sec15, interacting with the vesicle-borne Sec4 GTPase), with
2011), and mycorrhiza (Genre et al., 2012). The Exo70 subunit has the target membrane and associated small GTPases of the Rho
been also previously implicated in the pollen-stigma interaction family (Sec3 and Exo70), and possibly with other structural or

www.frontiersin.org July 2012 | Volume 3 | Article 159 | 21


Cvrckov et al. Exocyst evolution

regulatory proteins (Songer and Munson, 2009). The Exo70 sub- et al., 2012) for Arabidopsis, and COSMOSS7 (Lang et al., 2005)
unit, which can bind to phosphoinositides, is crucial for targeting for Physcomitrella. Final round of searches was performed between
the complex to the destination membrane also in metazoans (He February and May 2012.
et al., 2007). Exo84 is also required for proper localization of the Redundancies within the collection were removed on the basis
exocyst in yeast (Zhang et al., 2005). Surprisingly, the function of of pairwise BLAST alignments. In case of multiple protein predic-
these subunits is not restricted to participation in exocytosis, as tions originating from the same locus, protein sequences closest
Exo70 and Exo84 subunits also participate in pre-mRNA splicing to the most frequent splicing variety were chosen. In some cases,
(Awashi et al., 2001; Dellago et al., 2011). predicted protein sequences were revised based on re-evaluation
While exocyst subunits are encoded by a single gene in yeast of the available gene models, taking into account multiple meth-
or at most a few paralogs in metazoans, a puzzling number of ods of splicing prediction, ESTs, and homologous sequences as
plant isoforms has been identified in particular for the Exo70 sub- described previously (Grunt et al., 2008). The complete collec-
unit, which is encoded by 23 distinct loci in Arabidopsis thaliana tion of sequences including the revised ones is available in the
(Eli et al., 2003; Synek et al., 2006). Some other subunits are also Supplement.
encoded by duplicated or triplicated (as in case of A. thaliana Additional BLAST searches of non-redundant GenBank
Exo84) loci. However, the only published phylogenetic studies sequences where performed to identify homologs of outlier
of the plant exocyst so far are devoted solely to the Exo70 sub- sequences as described in Results.
unit (Eli et al., 2003; Synek et al., 2006) or restricted to a very
limited species selection (Chong et al., 2010). With growing num- PROTEIN SEQUENCE ALIGNMENTS
ber of sequenced genomes, and increasing quality of genomic For initial estimation of sequence similarity and detection of pos-
sequence annotations, a broader coverage of plant lineages can sible problems with gene structure prediction (i.e., missing or
now be achieved. Here we present the results of a phylogenetic extraneous exons), the interactive MACAW tool (Schuler et al.,
analysis of the canonical exocyst subunits encoded by 10 land 1991; Lawrence et al., 1993), or the automated tools ClustalX
plant genomes representing dicot and monocot angiosperms, a (Thompson et al., 1997) and KALIGN (Lassmann and Sonnham-
lycophyte (Selaginella moellendorffii) and a moss (Physcomitrella mer, 2006) have been employed to generate preliminary versions
patens), and propose an evolutionary scenario consistent with our of multiple protein sequence alignments. Final alignments for all
results. subunits except Exo70 have been constructed manually with the
aid of BioEdit (Hall, 1999), taking into account the preliminary
MATERIALS AND METHODS alignments.
IDENTIFICATION OF EXOCYST SUBUNIT SEQUENCES In case of the more numerous and more diverse Exo70
The collection of exocyst subunit sequences has been assembled sequences, a similar manual approach has been employed first with
by exhaustive mining of multiple data sources. For each subunit, a complete collection of A. thaliana, A. lyrata, and P. trichocarpa
a seed collection was generated as a non-redundant union of sequences, resulting in a skeleton alignment into which addi-
sequences originating from A. thaliana, Arabidopsis lyrata, Popu- tional sequences in batches of up to 10 have been merged using
lus trichocarpa, Vitis vinifera, Oryza sativa var. japonica, O. sativa the realign selected sequences feature of ClustalX; the align-
var. indica (omitted in case of Exo70 to keep the project at a man- ments were manually adjusted after each batch using BioEdit with
ageable scale), Sorghum bicolor, Brachypodium distachyon and P. similarity shading for guidance, where considered appropriate.
patens, and identified on the basis of their annotation among Because of the admittedly subjective method of alignment con-
(i) components of the exocyst complex as recorded in the COG struction, we are including the final alignments that have been used
section of the STRING protein interaction database1 (Sklarczyk for phylogeny reconstruction in the Supplement. We have also per-
et al., 2011) and (ii) reference sequences from GenBank (Benson formed parallel phylogeny estimations (as described below) with
et al., 2012). BLAST (McGinnis and Madden, 2004) searches of a manually constructed alignment and a KALIGN-constructed
species-specific portions of the non-redundant section of Gen- one for the Exo84 subunit, producing trees of essentially identical
Bank and several species-specific resources (see below) have been topology (i.e., sharing all significant branches, though differing
employed to identify additional sequences from the above listed somewhat in branch length and bootstrap support).
species, as well as from S. moellendorffii and selected members of To identify conserved motifs in the divergent Exo70 n-termini,
the genus Solanum (see Results). n-terminal sequence portions upstream of the conserved part used
The additional databases mined included Uniprot (The Uniprot in phylogenetic analysis (see below) have been aligned de novo
Consortium, 2012), Phytozome2 (Goodstein et al., 2012), and using ClustalX. Conserved sequence motifs have been identified
JGI3 for multiple species, Solgenomics4 (Bombarely et al., 2011) visually after removal of obviously non-aligned sequences, manu-
and PGSC5 (Potato Genome Sequencing Consortium, 2011) for ally adjusted in BioEdit and colored using the Dayhoff matrix (as
Solanaceae, The Arabidopsis Information Resource6 (Lamesch implemented in BioEdit) for presentation.

1 http://string-db.org/ PHYLOGENETIC ANALYSES


2 http://www.phytozome.net/ For phylogram construction, alignments except Exo70 were
3 http://genome.jgi.doe.gov/
stripped of all columns containing gaps. For Exo70, which is more
4 http://solgenomics.net/
5 http://potatogenomics.plantbiology.msu.edu/
6 http://www.arabidopsis.org 7 http://www.cosmoss.org/

Frontiers in Plant Science | Plant Traffic and Transport July 2012 | Volume 3 | Article 159 | 22
Cvrckov et al. Exocyst evolution

divergent than the remaining subunits (especially in its n-terminal of analysis. In particular, we found no sequences corresponding to
part) and where several sequences were c- or n-truncated, only Sec5 and Sec8. We therefore located the missing subunits in data
the unreliably aligned n-terminal portion and regions containing from two potato species (S. phureja and S. tuberosum, respectively);
gaps in multiple sequences were removed prior to phylogenetic we shall refer to these asterids collectively as Solanum sp. From the
tree calculation. monocot class, four grass species (rice O. sativa, represented by
Trees were computed by the maximum likelihood (ML) method both japonica and indica varieties, sorghum S. bicolor, and the
using PHYML v3.0 aLRT (Guindon and Gascuel, 2003; Anisimova model grass B. distachyon) have been included. Finally, we also
and Gascuel, 2006) at Phylogeny.fr (Dereeper et al., 2008) with analyzed genome data from one lower vascular plant the lyco-
default settings, using the aLRT test to estimate internal branch phyte S. moellendorffii, and from the model moss P. patens. In total,
reliability. Independently, phylograms were constructed also by the we have collected 392 distinct protein sequences corresponding to
neighbor-joining (NJ) method using ClustalX with 1000 bootstrap presumed exocyst subunits (Table 1).
samples. Trees were visualized with the aid of the MEGA5 software In agreement with the expected essential character of the exo-
(Tamura et al., 2011) and manually colored using CorelDraw for cyst in plants and with previous reports, all genomes encoded at
presentation. least one copy of each subunit, and most of the subunits were
encoded by one or a few loci, except Exo70, which always formed
Ka /Ks ESTIMATIONS an extensive family of paralogs. Among the remaining subunits,
Nucleotide sequences corresponding to selected Exo70 subunits we could upon closer inspection distinguish genuine single-copy
(see Results) have been retrieved from GenBank, and portions cor- or low copy subunits that were never present in more than two
responding to reliably aligned protein parts have been realigned versions in the vascular plants (this was the case for Sec3, Sec5,
manually using BioEdit in the toggle nucleotide to protein mode Sec6, Sec8, and Sec10), and intermediate size gene families with
to re-create the protein alignment used to calculate the phyloge- more than two and less than eight paralogs in at least one of the
netic trees. Resulting nucleotide sequence alignments have been species (Sec15 and Exo84). We shall further discuss these three
analyzed using Selecton (Stern et al., 2007) to obtain codon- groups separately.
specific values of non-synonymous to synonymous mutation rates,
providing information on residue-specific selection in the history LOW COPY SUBUNITS: SEC3, SEC5, SEC6, SEC8, AND SEC10
of the examined sequences. The first group of subunits includes Sec3 (in A. thaliana encoded
by two genes in tandem AtSEC3A/At1g47550/Arath1_Sec3
RESULTS and AtSEC3B/At1g47560/Arath2_Sec3), Sec5 (again two A.
AN INVENTORY OF EXOCYST SUBUNITS IN 10 PLANT SPECIES thaliana genes AtSEC5A/At1g76850/Arath1_Sec5 and AtSEC5B/
We performed exhaustive searches of sequenced genomes of eight At1g21170/Arath2_Sec5), Sec6, Sec8, and Sec10 (all encoded by
angiosperm and two non-seed plant species with the aim to iden- single genes in A. thaliana AtSEC6/At1g71820/Arath_Sec6,
tify all genes encoding putative exocyst subunits. Among the AtSEC8/At3g10380/Arath_Sec8 and AtSEC10/At5g12370/Arath_
angiosperms, we included the eudicots A. thaliana, A. lyrata, Sec10 but see comments on possible Sec10 duplication below).
poplar (P. trichocarpa), and grapevine (V. vinifera) as represen- Though these subunits are single-copy in some species, each of
tatives of the rosids. To gain insight also into the asterid lineage, them is duplicated in at least one angiosperm genome, and all but
we attempted to find the exocyst subunits in the publicly avail- Sec6 are triplicated in P. patens, showing that there is no strict
able tomato (Solanum lycopersicon) genome and cDNA sequences, functional requirement on keeping only a single protein version
which, however, did not yet cover the complete genome at the time in cells. In fact, multiple splicing variants have been proposed

Table 1 | Numbers of exocyst subunit paralogs encoded by the studied plant genomes.

Sec3 Sec5 Sec6 Sec8 Sec10 Sec15 Exo70 Exo84

A. thaliana 2 2 1 1 1 2 23 3
A. lyrata 2 2 1 1 1 2 23 3
P. trichocarpa 2 2 2 2 2 5 29 8
Solanum sp. 22 13 12 14 12 22 222 42
V. vinifera 1 1 2 1 1 2 15 3
O. sativa 1 2(2) 1(1) 1(1) 1(1) 1(1) 4(4) 47 3(3)
S. bicolor 2 1 1 1 1 3 31 3
B. distachyon 2 1 1 1 1 3 27 3
S. moellendorffi 2 1 2 2 2 1 8 2
P. patens 3 3 1 3 3 2 13 7

The complete list of the 392 analyzed genes or proteins including database accession numbers, as well as protein sequences and sequence alignments used in
phylogeny calculations, is provided as Supplementary Material.
1
japonica variety, with numbers for indica in brackets; 2 S. lycopersicon; 3 S. phureja; 4 S. tuberosum.

www.frontiersin.org July 2012 | Volume 3 | Article 159 | 23


Cvrckov et al. Exocyst evolution

for most Arabidopsis subunits in the recent genome annotation The second structural outlier is the P. patens Sec10 paralog
(Lamesch et al., 2012). Phypa2_Sec10, noticed in our previous study (Grunt et al., 2008)
Tandem duplications affecting angiosperm exocyst genes are because of its unique combination of a N-terminally located Sec10
apparently not restricted to Arabidopsis Sec3. The A. thaliana domain with the formin-specific FH2 domain at the c-end of the
genomic assembly might be problematic in the area around Sec10, protein (see sequence Phypa5 in Grunt et al., 2008). An alter-
since inspection of available GenBank sequences suggests a pos- native splicing prediction separates these two domains into two
sible tandem duplication of the Sec10 locus differing by a couple distinct proteins (a short version corresponding to standard Sec10
of silent mutations and variant non-coding ends. The duplicated is included in our phylogeny). The combination of Sec10 and FH2
gene appears to be transcribed (see GenBank cDNAs AF479280.1 domains is again unique in GenBank. However, there is a partial
and AK318699.1 which are in good mutual agreement but differ cDNA of the formin end (GenBank BY987890.1) indicating gene
from the reference genome sequence, though they encode an iden- expression in the moss, albeit it is unclear which splice variants are
tical protein). Also in tomato, we found a single possibly functional biologically relevant.
Sec10 locus and three closely related pseudogenes with multi-
ple stop codons, two of them in tandem (the pseudogenes are INTERMEDIATE SIZE FAMILIES: SEC15 AND EXO84
not included in the phylogeny; see Supplementary Material for The second group of subunits consists of two gene families, Sec15
accession numbers). (with two A. thaliana paralogs AtSEC15A/At3g56640/Arath1_
As a rule, protein sequences of the low copy subunits consist of Sec15 and AtSEC15B/At4g02350/Arath2_Sec15) and Exo84 (with
a single well-defined domain, are well conserved along the whole three paralogs in A. thaliana AtEXO84a/At5g49830/Arath2_
length (exceptions will be discussed below) and their phyloge- Exo84, AtEXO84b, At1g10385/Arath3_Exo84, and AtEXO84c/
netic trees (Figure 1) exhibit striking overall mutual similarity. At1g10180/Arath1_Exo84). In other studied genomes, Sec15 is
Within the angiosperms, all gene duplications except monocot encoded by two to five subunits (except S. moellendorffii, where
Sec3 appear to be relatively recent, resulting in within-species only a single protein was found) and Exo84 by three to eight
paralogs that share at least 80% of identical amino acids in the (again except S. moellendorffii with only two genes). In both cases
most distant pair of the A. thaliana Sec5 paralogs. Duplicated the highest number was found in P. trichocarpa, and the final
paralogs cannot be matched among genomes more distant than poplar subunit count may be even higher, since there is cDNA
the two rice varieties, or the two Arabidopsis species. The only evidence of additional transcripts encoding proteins identical to
exception from this pattern of apparently late gene duplications the Sec15 paralogs included in our analysis but differing in their
is the Sec3 subunit that has obviously split into two paralo- non-translated ends, reminiscent of the situation in A. thaliana
gous lineages early in the evolution of monocots or at least Sec10 (see Supplementary Material).
grasses. Phylogenetic trees of both families indicate that at least a part
Rice and Arabidopsis versions of any of the low copy sub- of the observed diversity is ancient, and can be traced back at least
units share between 59% (Arath1_Sec5 vs. OrysaJ_Sec5) and 81% to the origins of angiosperms (Figure 2). Both gene families can
(Arath_Sec6 vs. OrysaJ_Sec6) of identical amino acids. The Sec6, be split into two branches in seed plants, with multiple additional
Sec10, and Sec8 subunits, believed to form the central core of the within-branch amplifications. In Sec15, most of these later ampli-
complex (Munson and Novick, 2006; Croteau et al., 2009), are the fication events (generating two clusters of poplar genes in both
best conserved ones. Notably, one of the ancient Sec3 branches branches and a pair of rice genes in the B branch) appear to be
(the clade monocot 1 in Figure 1) has considerably diverged fairly recent, reminiscent of those detected for low copy subunits.
from the cluster of dicot sequences and the remaining monocot However, a duplication of the A subunit apparently occurred early
clade, suggesting a possible release of selection pressure followed in the monocot lineage (no later than at the emergence of grasses),
by neo- or subfunctionalization. Compared to the degree of con- resulting in two monocot- or grass-specific subfamilies, A1 and A2.
servation found in the angiosperms, the Physcomitrella paralogs In Exo84, the situation is somewhat more complex. Clearly
exhibit major within-genome differences, with the most distant defined A and B branches (named according to the correspond-
paralogs Phypa1_Sec10 and Phypa3_Sec10 sharing only 51% of ing A. thaliana subunits) were found only in the dicots, while
identical amino acids. related monocot sequences form a rather compact cluster, proba-
Two sequences deviate from the standard overall conserved bly closer to the A branch than to B. The dicot A and B branches
domain structure of the relevant low copy subunits and can be and the monocot cluster will be further referred to as the A/B
perhaps viewed asstructural outliers of their corresponding gene clade (Figure 2). Monocot A/B sequences also bear traces of early
families. In the case of the A. lyrata Sec3 paralog Araly2_Sec3, gene duplication preceding the radiation of grasses, but clearly
the n-terminal part of the conserved domain is replaced by a distinct from the event that produced the A and B branches and fol-
domain related to a family of RING box/E3 ligases, encoded by lowed by little actual sequence divergence (the rice A/B sequences
a single-exon and flanked at least from one side by a sequence OrysaJ1_Exo84 and OrysaJ2_Exo84 share 78% of identical amino
related to Copia-like retroelements, suggesting a very recent acids). Besides of the A/B clade, a second ancient branch (the C
retrotransposition-mediated gene fusion. However, this domain clade) is shared by all examined angiosperms and contains, as
combination appears to be unique in the whole of GenBank, a rule, products of single-copy genes with exception of an appar-
and there are no ESTs documenting that this gene is expressed ently recent cluster of three poplar sequences. Two mutually related
in planta; therefore, its functionality and biological significance dicot outliers (the CX sequences) are apparently related to the C
remains problematic. clade, and proteins similar to them have been predicted also in

Frontiers in Plant Science | Plant Traffic and Transport July 2012 | Volume 3 | Article 159 | 24
Cvrckov et al. Exocyst evolution

Araly1

Ara
Sec3 m
on Sec5

th
o

Ar
c3
co

1S
ath

5
t

3
SBoradi1 Se

ec
1

Sec5
ec

e
2
c3

uS
Solyc2

c5
2S

ec5
Se
Se Araly
Solyc1 S c93

2 Se

ph
c5
rbi 1
I Sec3 c5

di S
sa
Pot

So
Po rryysaJ1 c5
Sec3

Bra
ri1

O
90

Ara t ri2 O
94 Se
ly2 rbi
Se
ec3 6

o
Se Sec c3
92 S

58
c Potri1 Sec5 99
Arath1 3 3
68
Se 99 OrysaI Sec
Sec3
58 Bra
di2 c5 O 5
86

S ec33 74 OrysaI2 Sec3 Se ry


Arath2 Sec 99S O sa
cot 2

c5
or rysaJ2 tri
2
c3

1 J
bi Po

Se
y Sec Se
Se

al 1 3
Ar Se c5
61

mono

in
vin

c3

Viv
Vi

99

Arabidopsis thaliana
Ph
2 Sec33

yp

Arabidopsis lyrata
Selmo Sec

a1
Se

Populus trichocarpa
o1

c3

96
lm

Vitis vinifera
Se

Solanum sp.
Oryza sativa
Sorghum bicolor Ph
ypa
Phypa2 Sec3

Brachypodium distachyon 3S
ec5
Ph

Selaginella moellendorffii

Phypa2 Sec5
ypa

Physcomitrella patens

c5
3S

Se
ec3

lmo

Ph
yp
Se

a1
Se
c5
Sec6 Sec8
Pot
Sol
Vivin1 Sec6

Potri2

Sec10
8
ri1 S

i Sec
yc
Viv

A
8
6

ra
ec Ara
Se
i

ec
n2

Ar
ec8
Sec8

Brad

th
iS
Vi
iS

ath
c

So
vin
Se

rb ly S
c6

Vi
6

Sec10 89
Se
ad

Se Ara So lyc

v
c6 99
c6

Se

aJ Sec8

i
Br

n
t
ec1
s Se
OrysaI
72

Araly Sec6 9 r y hS 0
c8
83

c1
Se
9 99 OOry saI Sec6 ec8 98Orys c1
99 So 99 Se
0

aJ
90

ec6 Potri1 0 c1
1S
rb Sec8 97 Sec a I
0
6

t r i iS Araly 8 Sec1 ys c10


c

Po ec 0 89 OrrysaJ Se
Se

8 99 O
6 ec Se c1094 Brad
ri2

S
tub P otri2 i Se
So
t

c10
Po

So
rb
iS
SSeelm

99

ec
Ph
l m

10

99
yp
o1

0
c1
ec10
o2 Se

Se
Ph

Phypa2 Sec8
Se

Se

o1
y
c6

pa
c6

elm
o2 S

S
3
c6

Se
Selm

Ph
10

yp
Phy

a3
0.1 substitutions/site 8 Se
Phypa1

c
pa1
Selmo2 Sec8

Se c
Phy

8
o1
elm
Sec

pa2

S
S
8

100% support ML
Sec
ec10

(values shown if > 50%)


0 1

100% support ML, > 90% NJ

structural outliers

FIGURE 1 | Unrooted maximum likelihood (ML) phylograms of the low support by both ML and NJ algorithms are marked by black dots. Arrows
copy Exocyst subunits. All SH-like support values above 50% from the aLRT denote structural outliers, i.e., sequences deviating from the standard
test are shown. Consistent trees were obtained also using the domain organization of typical representatives of the protein family. All trees
neighbor-joining (NJ) method with 1000 bootstrap samples; nodes with high are at the same scale.

Ricinus communis (GenBank XM_002526525.1) and Glycine max updating, it is also possible that these patches are vestiges of a lost
(GenBank XM_003541318.1). A genomic DNA sequence frag- gene that may have had a wider distribution.
ment from V. vinifera (GenBank AM443616.2) contains patches of In contrast to the angiosperms, the lycophyte and moss
a possible ORF similar to the CX sequences in an area annotated as Sec15 sequences exhibit only minimum diversification, while
non-coding. While the grapevine genome annotation may require Exo84 underwent duplication in S. moellendorffii and extensive

www.frontiersin.org July 2012 | Volume 3 | Article 159 | 25


Cvrckov et al. Exocyst evolution

Or rysaJ3 Sec15

5
Arabidopsis thaliana

c1
Se
Arabidopsis lyrata

aI4
Populus trichocarpa
OrysaI2 S

ys Vitis vinifera
O

A1 Solanum lycopersicum
Ory

Oryza sativa
ec15 ec15

So
saJ

Sorghum bicolor

Br rbi2 i3 Sec15
Sec15
rb

15
i1 A2
2S

Se Brachypodium distachyon

Sec
Brad

c15
i1 Se c15 Selaginella moellendorffii

OrysaJ1
c15

aI1
So Brad
Sec15

Se
Physcomitrella patens

5
c1
80
5

s
c1

Se
y
Se

O r
B I3 Sec15

i2
ad
sa
99 ry aJ4
99 Orys
Sorbi3 Sec15
99
Ara 82
ly2 94
99

S 9 2
ec1 5
Arath2 Sec15 5 99 91
99
88
Sec1
95 9 91 94 ath1
Araly
Ar
c15 9 1 Sec15
Potri3 Seec15
98
PPootri1
73
5
5

Vi Soly
c1

S
15
c1

tri Sec
tri4
vin

2 15
Se

Se

Po
1 Sec

Se
99

2
5

c1
n1

Se
tri

5
Po

c2
i

c1
Viv

P
Phyp
Solyc

84
hyp

5
Sec

o
A

Ex
4
a2 S
a1 Sec15

15

xo8

o2
Selm

4
lm
ec1

1E
xo8
o84

Se
Phypa5 Exo84
o Se c

ypa
5

3E
a6 Ex
Ph
ypa
15

Phyp

Ph
Araly2 Exo84

A
A r
Solyc3 xo894

Exo84
4
th2
Pot Ex

o8
Po

77

0.2 substitutions/site
Ex

8 4
ri5 o8
tri

Exo

Vi xo
2

a2

vi E
Exo894
E 4

Br n2 a4
yp
84

ad Ex yp Exo84
Ph

h
77

i1So o8 P pa7
rbi3 Ex 4 52 Phy o84
Exoo84 7 o1 Ex
52

Orysa 99 Selm
I1 Ex 84 5 95
4
89
98
98

8
o844
OrysaJ1 Exo8 xo
96

84
1E
5
Exo 8844 9 o
i3 xo Ex
o884

Br a d
aly

E 99 h1
Ex o

rbi
2 rat
J2 Ex

99

Ar
88

So A 4
84

A/B xo8
ysa aI2

1E
o
s

c
Ex

y
ry

l
4

84

So o84
Exo8
O

84
84

3 Ex
Exo
in3

99 Potri
Or

73
o
Arath3 Exo
Viv

92 PPotri6 Exo84
E

yc2
Potri4

Vi otri7
3

vin Ex
Araly
l

99
o

1 o8
S

Ex 4
o8
Br 4
O

ad
Ory
So aJ3 Exo

i2
rys
4

o8 C
xo8

Ex
saI3 Exo84
rbi
1E
i8 E

4
B
xo
tr

84
Po

84
Potri1 Exo84

100% support ML
(values shown if > 50%)
100% support ML, > 90% NJ
Soly
c4 E

structural outliers
CX
xo8
4

FIGURE 2 | Unrooted maximum likelihood (ML) phylograms of Sec15 with high support by both ML and NJ algorithms are marked by black dots.
and Exo84. All SH-like support values above 50% are shown. Consistent Arrows denote structural outliers (see Figure 1). Both trees are at the
trees were obtained also using the neighbor-joining (NJ) method; nodes same scale.

Frontiers in Plant Science | Plant Traffic and Transport July 2012 | Volume 3 | Article 159 | 26
Cvrckov et al. Exocyst evolution

amplification, producing seven rather diversified paralogs, in P. AtExo70E2/At5g61010/ArathE2_Exo70 in clade E, AtExo70F1/


patens. While the branching order is not reliable in the non- At5g50380/ArathF1_Exo70 in clade F, AtExo70G1/At4g31540/
angiosperm sequences, the resulting tree does not exclude the ArathG1_Exo70 and AtExo70G2/At1g51640/ArathG2_Exo70 in
possibility that the two major Exo84 clades might have appeared clade G, and eight paralogs AtExo70H1/At3g55150/ArathH1_
already at the base of the vascular plants. Exo70, AtExo70H2/At2g39380/ArathH2_Exo70, AtExo70H3/
Compared to the low copy subunits, Sec15 and Exo84 sequences At3g09530/ArathH3_Exo70, AtExo70H4/At3g09520/ArathH4_
exhibit greater diversity, with Arabidopsis AtSec15A and AtSec15B Exo70, AtExo70H5/At2g28640/ArathH5_Exo70, AtExo70H6/
sharing 48%, AtExo84A and AtExo84B 59%, and AtExo84B and At1g07725/ArathH6_Exo70, AtExo70H7/At5g59730/ArathH7_
AtExo84C only 34% of identical amino acids. Nevertheless, the Exo70, and AtExo70H8/At2g28650/ArathH8_Exo70 in clade H.
angiosperm branches of the phylogram appear to be rather com- In other studied plants, the number ranges from eight in Selaginella
pact, and the only conspicuously diversified poplar Exo84B para- to 47 in rice (Table 2; see Supplementary Material for a full
log, Potri8_Exo84, may not be expressed, as we could not find any list of genes), albeit the final count might still change in the
corresponding ESTs. genomes whose annotation is still under development (especially
All sequences from each family can be aligned reliably along Solanum sp.).
the whole length, with only three exceptions. The predicted rice Unlike the other seven subunits, Exo70 paralogs are rather
Sec15 paralogs OrysaJ3_Sec15 and OrysaI4_Sec15 are missing a C- diverse and their N-terminal part of up to 300 amino acids could
terminal part of the characteristic Sec15 domain and have instead not be aligned reliably throughout all the 238 studied sequences.
an unrelated sequence. No homologs with such a gene organiza- We have used only the well-aligned portion to construct a phylo-
tion have been found in GenBank, and there are no ESTs matching gram (Figure 3) that essentially corroborates the previous reports
these genes. Together with the long distance from the rest of B but brings some additional new insights. Our analysis confirms
clade Sec15 sequences, indicating relaxed selection, this suggest the existence of three major Exo70 lineages Exo70.1, Exo70.2,
that these O. sativa Sec15 outliers may actually correspond to a and Exo70.3 that contain both angiosperm and lower plant
pseudogene that has arisen not long before the separation of the sequences, as well as the nine clades (AI) with members of
japonica and indica varieties and that is now in the process of both monocot and dicot origin (Synek et al., 2006). The clade
decay. The third structural outlier, Potri1_Exo84, one of the out- I, restricted only to some angiosperms (it is, e.g., missing in both
lier CX sequences with a long C-terminal extension, also lacks Arabidopsis species), clusters within a branch that includes the
cDNA or EST support, and it is thus not clear if it is expressed compact angiosperm G clade and a group of moss sequences, but
at all. none from Selaginella, suggesting loss in the lycophyte lineage. We
will refer to this wider branch, corresponding to the previously
THE ENORMOUS DIVERSITY OF EXO70 PARALOGS proposed Exo70.3 lineage, as the G/I clade.
The large Exo70 family consists of 23 paralogs in A. thaliana, rep- Remarkable is the major expansion of a monocot- or grass-
resenting eight previously identified clades (Synek et al., 2006): specific branch of the F family, the FX clade. Apparently, a single
AtExo70A1/At5g03540/ArathA1_Exo70, AtExo70A2/At5g52340/ family of Exo70 subunits underwent major expansion in both
ArathA2_Exo70, and AtExo70A3/At5g52350/ArathA3_Exo70 in monocots and dicots. Reverse transcription might have con-
clade A, AtExo70B1/At5g58430/ArathB1_Exo70 and AtExo70B2/ tributed to gene amplification in case of the abundant dicot H
At1g07000/ArathB2_Exo70 in clade B, AtExo70C1/At5g13150/ clade with a large proportion of single-exon genes (Synek et al.,
ArathC1_Exo70 and AtExo70C2/At5g13990/ArathC2_Exo70 in 2006; Chong et al., 2010), but not in case of the monocot FX with a
clade C, AtExo70D1/At1g72470/ArathD1_Exo70, AtExo70D2/ large proportion of multi-exon genes (Chong et al., 2010). Some-
At1g54090/ArathD2_Exo70, and AtExo70D3/At3g14090/ArathD3 what surprisingly, a very distant paralog OrysaFX8_Exo84, which
_Exo70 in clade D, AtExo70E1/At3g29400/ArathE1_Exo70 and clusters within the F branch but outside the genuine FX clade,

Table 2 | Numbers of Exo70 paralogs encoded by the studied genomes (in total and in the individual clades).

All A B C D E F (FX) G/I H BNG1

A. thaliana 23 3 2 2 3 2 1(0) 2 8
A. lyrata 23 3 2 2 3 2 1(0) 2 8
P. trichocarpa 29 4 2 3 2 6 2(0) 5 5
S. lycopersicon 22 3 1 3 2 2 1(0) 4 6
V. vinifera 15 2 1 1 1 2 1(0) 4 3
O. sativa 47 4 3 3 2 1 26 (19) 3 5
S. bicolor 31 3 3 2 2 1 16 (12) 3 1
B. distachyon 27 5 2 2 2 1 11(6) 3 1
S. moellendorffi 8 4 4
P. patens 13 3 4 6

1
Basal non-angiosperm group.

www.frontiersin.org July 2012 | Volume 3 | Article 159 | 27


Cvrckov et al. Exocyst evolution

Sorbidi
Bra 10
.3

OrysaI
0 Exo70

12 Ex
o7 G/I Arabidopsis thaliana
1 o7
Exo70
Ex
Exo70
0
I Arabidopsis lyrata
Populus trichocarpa
G
Sorbi

Vitis vinifera
SorbBi1radi1

70
OrysaG12Exo7
29
OrysaG Ex
Bradi7

Solanum lycopersicum 8E
xo
Solyc8
Ex
9 ExoE7xo7 olyc152 E
Ar

Ar X
Potri29 Exo7
Vivin15 Exo70

aF
o7

al
at

Oryza sativa
Solyc21 Exo70

ys
Phypa

yG
hG

Exo70

Or
0

2
2

Exo70 0

Ex
0 o7
Ex

Sorghum bicolor
Phypa1

o
S lyc2 otri1209 Exoo770
So P otri 1 EEx 7700
o7

70
11 Exo370
0
00
0

Phypa

Brachypodium distachyon
Ar al 12 o7

Vivin11 Exo70

Phypa12 Exo70
PoPo n9
Ar trit2ri2 Ex
athyG EExx 0
P G 1 oo

Vi
Vi

vi
Exo Exxo07

Ex

n1
vi

Selaginella moellendorffii
10 Exo
xo70 o700

0
o70 70

Ex
o7
0 Physcomitrella patens

.1 BNG
x o70
E
A
Phyp
Selmo1 Exo770
Selmo7 Exo
Ph

Or BBra
Phpa3 Seelm2 E exo
y

a
Phy 1 xEo7o45 7 70

ys radi
6
ypaE lm o xo

aA di25
D
E

22E S
Pxo7h0yp5a49 EExax8o7E0xo7

2E
Se So

Ph
pa2 xo0 EExx0

xoExxo7 O B elm
hy

Exo70xoo7700
So

P
lm rbi

Phy Phy
yp

7o
Selmo6
Selmo3 o7

o
Exo70

BrSor 0 700 rysraad 8 E


pa
Ex7o0 oo77

h Exoo7700
0

D1i09 E Exxoo7700
x 70
a7 EEx

Ex

0
xxoo77070

ad bi O i
i1514 ry A121
p

xo
2 E x xo 7
OSB ratlhltyyD53EDx11 E
o

700
12Exo
a
70 00

s E 7
BErxaEox7oaA4 Exxoo 0
9

0
xo70

srabdi D22 EE
1E

oo770
p

di1070 E 7700
aat0ly
Exo70
Exo70

OSro
E

EExxo70
c6

ryora hD

ysrbai72EExxo7
o70 0

ri1
lyc
rraiavin
Atri1
0

1D301Ex
Ex
o ly

A3 E xoo7 0
Votr

Solyc Viv i
So

1 Einx1 xE7o0700
PSo

asdai2
AA
P

Pot8ri1 rryrb 0
0

70xo70
Eoxo SBo o7
o7
o7
0

Potri4 70 98 O
Ex0

Ex
F1oo7

Exo 70
7

ArathA22 Exo70 0
Ara0lyA Exo70 o7 0
0.
lyExx

0 1 0
r1a78 E

o77o070 99 hF o 7
3 Ex o7
7 0 ly c7 Exxo
Slyc19in2 xEoox7770700 at 70Ex Ex o7
AratlyhA Ex o o E 3 Ex 0
2
tAtrrii1

Ara A 3 o iv
S V A1 E xoxo E x AEryxco4 F 4 7
8ol sa i2 xo
PPoo

1 E
h E ry adi8 E Exo70
AP o
t
P
A
Araraloytrit2ri3
99 99 Vi
vinS OSBorrbsaF2 Ex
O
o70
Sorbi6 Exo70
ry
Bradi26
F
99 OrysaF5 Exo70
99

aF1 Exo70
SOrys
Bradi27
oB radi6 EExo70
rb
PotPo
ri5tri6Exo Ex70 o7 700
0 i5 Ex xo70
o70
o7o70104 E Exxxooo7o7700
lyB22A
Ex
SE oxly
99

rahB
ArAat thcBB113EEx
AraraVlyivin 0 O ry
sa
B aB
70Soryrrbsaoi1
63E
dbi2i3i51
Eo xo777077000
EExxEExoxoxoo xo0070 0 Exo0
E 7 7o07n4 00 o7
70 SroaFd4i1Exo O
B
rbi 1 E 70 rysa
11 xo X2 E
0Exo O BSBrrasdaBPo1tri7 xxoo7xEoxivi 77 xxo 0 xo70
0

Ex 70
EEoxxx7ooE707x0 70

7 EE
o70o07

xBo2 ry athly E
C 1 9 1 V xx E o oo E 7 o7
i3r0ysEa
1 CEx xo

SorbO
OA r ra oClyoclyc 22oEEttrrii89 Ex 0
OOrryodsrbi1ry42s1a 3 E

Vivi
x 2o

A S S thyCCP o 3
Sa O i yc

a l P i2
Potri16
E151EE

So
Potri

AAr ra rad
n6 Exo70 Po
Vivin7
Br orbSol

BSrO
AAra
saaiC

lyc12

B
o
ad

C
rathlyEE1

rb
ryi4si2a Ex AE
in14 Exo70

2 Ex

00
S

Po

oo77
Exo70
Etrxo

EExx
700 0 0 0

Exo70

EXx1ooE7x0 lyEE22 EExxo7


700o700 xo7700
P Exxoo7 7o0x7ox7o7

1 EExxo

So70
o7

HyH777o70700
6 xxo7 3 Exoo7

i15 5
H447E0 E7x2Eox7EE0
Arath x7o0l1y6c1inr1ti2xo070

h
atal ox o Sor
iv o Eo7o7

70 o7 0
0
x

lyc Exo7
20 Exo7

ArA5r 5EExEx
o770

bi4
ArathPotri25 Eivini243 E
E

Solyc11 Exo70
P 8x x

raxo
Ptri1

Exo
EE

SolycExo70

6
otri1
0

hHyHH So
th70

7
1
aly8 6

Potr PVoottri2

0o7Viv

atraral th rb OOry 0
AtrhaHlyH
aly3 S S H

70 0
r

r i22 ry sa
3Pot
AHra3ExEoolyocV

xxooE

A AA
70

Ex saFXFX15
4Ex
Exo
ar

lyH

O
Ar A

Ex

Eo7
Exo7

xo

0
i2

ry
Solyc13
lyH11 E

o
2E

7 14 Exo
ri28 Exo70

o700
xo0

sa
FXOr O 0 Ex 70
E
10 H2
H

70

o7
AralyH

10ysarysa Bra
Ar hH

13

E
0

0 di1
Arath

o7

F F O
ra

E 6
t

exo rysaF
OrysaFX16 adi17 Exbi

O xo X12X11
a

Solyc
Ar

70
A

Exo70
or

70 X1
Exo70

ry 70 E E 3E
O

SsoaF
S

xo xo
OrysaH3b Exo
1 Exo70

xo7
ry

70 70 0
sa

rb X6
o70

FX

i1 E
OrysaH3a

Ex xo
OrysaH2

7
OrysaHEx
Br

o7 70
Ex
B
O S B B xo

0
ra aF bi1 i20 i19 B rysa bi31

o7 OOryo70 70 0 0

H
ry o ra ra 70
di X9 8

0 ryssa
s
8
Ex Ex xo o7 o7 i18
r
Br
Sorb

ad

aXX4
3 Ex
i3

E
d

o 7

Ex o
i17 E

E
d

o7 70
Ory Or

Ex Ex rad

0
xo70
saF ysaF

So
X5 X4

0 E
Orys Orysa OrysaX7 E

FX
rb
Exo Exo

i28 orbi2
So xo70Sorbxi2
X5 S exo

x
aFX1

o7
70 70

E
S

Ex rb 70

0
OrysaFX2

o
OrysaX6 Exo

70 27
o
Exo7X3 Exo70

4E

i
F
0

E
o70

xo
3E

70
Exo70

xo7
70

100% support ML
Sor
xo70

bi26

(values shown for major branches)


So
Exo

100% support ML, > 90% NJ


rbi
70

25
Ex
o7
0

0.5 substitutions/site

FIGURE 3 | Unrooted maximum likelihood (ML) phylogram of Exo70. SH-like support values above 50% are shown only for major branches for the sake of
legibility. A tree obtained using the neighbor-joining (NJ) method was consistent with the ML one except of placing the FX branch outside the F clade; nodes
with high support by both ML and NJ algorithms are marked by black dots. BNG denotes the basal non-angiosperm group of Exo70 paralogs.

Frontiers in Plant Science | Plant Traffic and Transport July 2012 | Volume 3 | Article 159 | 28
Cvrckov et al. Exocyst evolution

is supported by a full-length cDNA (GenBank AK109785.1) and 2 is present in most, if not all members of all stable Exo70 clades
there are even two closely related ESTs from Lolium perenne (Gen- with exception of FX, and also in the members of the basal non-
Bank GR511301.1) and L. temulentum (GenBank DT673816.1), angiosperm group, i.e., in the sequences of lower plant origin with
indicating that this outlier is functional and possibly specific for unclear mutual relationships that belong to the Exo70.2 super-
some grasses. group. The more N-terminally located motif 1 was found in most
Duplicated genes tend to be rapidly eliminated by natural members of the basal non-angiosperm group and of the A, E, and
selection if they bring no advantage in terms of fitness. Ques- G/I clades. It is present also in members of the F branch except FX,
tion thus arises why there are so many Exo70 varieties main- and also except the distant F outlier OrysaFX8_Exo70. This sug-
tained across large evolutionary distances. One possibility would gests that Motif 1 is also ancestral but was lost in some angiosperm
be sub- or neofunctionalization of the conserved Exo70 domain clades within the Exo70.2 supergroup. The presence of the con-
itself. We have thus examined representative A. thaliana Exo70 served motifs indicates that the variable Exo70 N-termini have
sequences for traces of positive (diversifying) selection by estima- largely evolved through a process of mutations and selection rather
tion of the residue-specific ratio of non-synonymous to synony- than domain-shuffling, although this does not have to be the rule
mous mutation rates (K a /K s ). For this analysis, we chose two in all cases (especially the origin of the diverse and mutually largely
sequence collection eight representatives of the main clades unrelated N-termini of the FX proteins remains unclear).
(AtExo70A1, AtExo70B1, AtExo70C1, AtExo70D1, AtExo70E1,
AtExo70F1, AtExo70G1, and AtExo70H1) to identify markers of DISCUSSION
selection generating or enhancing between-clade differences, and The present study provides the first attempt to reconstruct evo-
eight representatives of the H clade (AtExo70H1, AtExo70H2, lution of the land plant, especially angiosperm, exocyst complex
AtExo70H3, AtExo70H4, AtExo70H5, AtExo70H6, AtExo70H7, in the broader context of higher plant evolution. Our previous
and AtExo70H8) to find traces of selection favoring within-clade works (Eli et al., 2003; Synek et al., 2006) have focused only on the
differences. However, in both cases there was only evidence of most abundant subunit, Exo70, and the only previous phylogenetic
purifying selection throughout the length of the sequence, but no study addressing all the eight canonical exocyst subunits in plants
positive selection, and we thus conclude that differences within the (Chong et al., 2010) was based on only four species Arabidop-
conserved part of the Exo70 subunits are not likely to play a decisive sis, rice and poplar as the representatives of angiosperms, and the
part in determining the function of the individual paralogs. moss P. patens, allowing only a limited possibility of generalization.
Functional diversification, however, may be due to the variable We have included a broader and more representative collection of
N-terminal sequences. We thus examined these regions in more genomes, including a moss (P. patens), a lycophyte, i.e., a non-seed
detail and uncovered two sequence motifs conserved in many, but vascular plant (S. moellendorffii), and eight angiosperms (unfortu-
not all, Exo70 paralogs (Figure 4). Distribution of these motifs nately, there is, to date, no sufficiently well-covered gymnosperm
(see Supplementary Material) suggests that they are ancestral, and genome for an exhaustive search). The angiosperms are repre-
that they have been lost or eroded in some of the sequences. Motif sented by five dicotyledonous and three grass species covering a

Exo70 N-terminal motif 1 Exo70 N-terminal motif 2


ArathA1 DNVVSILGSFDSRLSALETA ArathA1 PHEDLESYLDAIAQLRKIIRYFMSNKSFK------SSDGVLNHANSLLAKA---QSKLEEEFKQLLA
OrysaA1 DAVVSILGSFDSRLSALDAA OrysaA1 PHENLQGFLDAVDRLRSIERFFSSNRSYR------SSDGVLNHVNALLSKA---LVKMEDEFQKQLT
ArathB1 DDILQIFSNFDGRFSREKLA ArathB1 DPADSAAFLDTIDELVAIIREWSPMASEK------PIGICLTRADDMMQQA---MFRIEEEFRSLME
OrysaB1 EDILKVFSNYDGRLSLDKLY OrysaB1 DSADADAFLEAVDDLIGTVQELDAAGTNR---------GLLDRADELLSRC---MARLEDEFRALIE
ArathE1 KNAKNVLGNLLLELSRVVIA ArathE1 GSDEGNLYLDAVNELRSLIDRLDG-----------SEELSLRKAHDVLQIA---MARLEDEFKHLLV
ArathE2 ANLRKLLSDLEMHLSTFGIA ArathE2 GLSEADQFFQALYDVQTVLVGFKALPMKT----NQMEKDVYNQATVALDIA---MLRLEKELCDVLH
ArathF1 EDMLLIFSSFDNRLSNIKTA ArathF1 SPEEATEFLSAVDEIISLLEDLSSENKPD----------MVDRADSALQMA---MSQLEDEFRRILI
OrysaF1 DDMIRILSGFDDRLTFMSDL OrysaF1 SAKDAGDYLGAAAVLVGARGA---------------------RAEAALQAA---MARLEDEFRHLLA
ArathG1 GKTGPRFDEIEQRLPLLEAA Bradi4 DPQNSFEYLEVLYKIRQLSERLGNLDPGEE---AKEHKELTVYADELFEMA---MATLEEEFFYLLT
OrysaG1 ARAGPRVEEIQLALPALEAA Selmo3 SNDDAVDYLHAVDEVQNILESLSLSQ---------RRAG-VERAQTLLHVS---MARLEDEFRCLLE
Selmo3 DDMIEILSKFDNRFHELLSK Phypa4 SEEDSLQFLQAVDEIVHQLDFMKIHN---------RDPGTLERAQNLHHLA---LQKLLEEFRYMLD
Phypa4 DDMLHILSKFDHRFSSMNAK ArathG1 PKNDLSSYLSVLKRLEEALKFLGENCGL-------AIQWLEDIVEYLDDHH(6)LSNLKKSLRGLSE
Phypa10 NEANKRLQMFQDRLSPVRRS OrysaG1 VAGDLAGYLAVLGRLEEALRFLSDNSGL-------AAQWLADIVEYLGDHD(6)LADLAVTLEGLKK
OrysaI1 DAAGDRLGDMYSGLPSSSQL OrysaI1 DAGGAAAFVGRVDRLRDAVEEAVARGDE-------AVRRVEEAVGFLGRTK(6)VRRLAEAAAALRA
OrysaX1 ----MMAAELIKQFSNITLG Phypa10 PRDDFDGYLAALIQLEEAVDYLKHNSIV-------AINWLQEAVAYLNYTG(6)LRRLNESLATLQS
Bradi4 ----MMAAELVKQCSNITLG ArathC1 DETEDSVFIDAVNRISKSVMRLRELKLDS-----TPVSSWLNRASSVQHRA---VSLLDEEFRHLLD
OrysaC1 ANGEPRALLAAISRIAALAAALAKAPEGK------HATAGAHRVTAVLHRA---MAFLEDEFLALLD
ArathD1 DPQEVNLYLNAVDEIQKYVSSGGE---------------IENRANSAIQIA---MARLEDEFRNILV
OrysaD1 DRVEAERFLRAVDDLRRLAPPSPATVGSPRRTS--SASGGGGAASNAVQVA---MARLEDEFRHVLS
OrysaFX6 NPDKVDKYLVAAKNLTRILNLEHPVLTETG--------HLRDRARSLHGTT---ISSIITEFCYLKV
ArathH1 SRKEAKEFIRCVRDLRRAMHFLVSQDSQS---------PKLALAQTLMQIA---MARLEKEFFQILS
OrysaH1 GFADAGRFMSAAVELHRGMLVLASSDVEDARGRGDRGDERLVRAQGVLEDA---MRRLQLELEILLS

FIGURE 4 | Alignment of representative examples of the N-terminal acids from the N terminus. Residues conserved among 75% or more of the
conserved motifs found within the variable N-terminal part of Exo70 sequences containing the motif are shown on a gray background (residue
sequences. Motif 1 is located no more than 70 amino acids from the N conservation was determined using the Dayhoff matrix). Numbers in brackets
terminus and always upstream of motif 2; motif 2 begins less than 250 amino indicate the length of variable insertions removed for clarity.

www.frontiersin.org July 2012 | Volume 3 | Article 159 | 29


Cvrckov et al. Exocyst evolution

rather broad range of diversity (see the simplified scheme of plant genes appear to have two closely related paralogs, albeit this species
evolution in Figure 5). Among dicots, the closest are the two Ara- is believed to be one of the few plants without a recent history of
bidopsis species (A. thaliana and A. lyrata) that have separated whole-genome duplications (Jiao et al., 2011).
approximately five millions of years ago (Koch et al., 2000). Poplar We have found that a subgroup of exocyst subunits, corre-
(P. trichocarpa) is included as somewhat more distant representa- sponding to the previously proposed core of the complex (Munson
tive of the rosid clade, grapevine (V. vinifera) as a basal rosid, and and Novick, 2006; Croteau et al., 2009), underwent little or no
several members of the genus Solanum (where, unfortunately, no amplification in the vascular plants, though even these subunits
genome is annotated well enough to provide data for all subunits) have amplified to a some extent in non-seed plants. These low copy
are representing the asterids. The coverage of the monocot clade subunits, in particular Sec6, Sec8, and Sec10, but to a somewhat
is narrower, as all the available genomes belong to grasses. Thus, lesser extent also Sec5 and Sec3, exhibit evolutionary trees that
although we propose some possible monocot-specific features of are not only topologically similar but also obviously correlated
the exocyst family in this paper on the basis of data from three grass in terms of branch length, which is consistent with co-evolution
species (O. sativa, S. bicolor, and B. distachyon), we do not know at driven by the requirement of maintaining mutual compatibility
present if such features are present also in non-grass monocots. of closely interacting complex subunits (Juan et al., 2008; Lovell
In total, we have analyzed nearly 400 exocyst subunit sequences. and Robertson, 2010). The remaining subunits Sec15, Exo84, and
Our list, however, may not be complete especially in case of the in particular Exo70, exhibit greater diversity consistent with their
Solanum sp. sequences, where genomic annotation is still under function on the periphery of the complex, providing an interface
development, and some loci may have been missed. It is not sur- to a variety of interactors that may be specific to particular lineages
prising that our inventory yielded novel genes especially in the or even to particular paralogs.
Exo70 family in addition to those reported previously for P. tri- Whole-genome duplications have played an important part in
chocarpa and O. sativa (Chong et al., 2010). On the other hand, the evolution of land plants (Van de Peer et al., 2009; Jiao et al.,
in the absence of gene expression data and experimental observa- 2011). They also provided an obvious source of raw materials
tions, distinction between functional genes and pseudogenes may for evolution of divergent paralog families of the exocyst subunits.
be somewhat blurry, especially in case of the extensive Exo70 fam- We were able to pinpoint several of the proposed ancient genome
ily, containing numerous single-exon members that apparently duplication or polyploidization events in a widely accepted sce-
underwent reverse transcription at some point in the course of nario of land plant evolution (Soltis et al., 2008; Van de Peer et al.,
their evolution (Synek et al., 2006). Thus, the determined num- 2009; Jiao et al., 2011; Woodhouse et al., 2011) as possible sources
bers of subunits might still somewhat change in the future, even in of distinct exocyst subunit clades especially in the Sec15 and Exo84
well-characterized models (see the possible undocumented dupli- families (Figure 5). However, it has to be stressed that not every
cation of the Arabidopsis Sec10 locus). Also allelic diversity in gene duplication coincident with a genome duplication must be a
heterozygous diploids may have resulted in identification of extra- result of that duplication. For instance, the tandem duplication of
neous loci in particular in the case of S. moellendorffii, where most A. thaliana Sec3 appears to be a local event, while equally distant A.
thaliana Sec5 paralogs are obviously a product of a whole-genome
duplication (see data from Woodhouse et al., 2011).
genome duplication or amplification The greatest part of the putative exocyst diversity is due to the
extremely amplified Exo70 subunit that apparently existed in at
gene duplication A. thaliana
or amplification a least three paralogs already in the common ancestor of land plants
A. lyrata including Rhyniophytes, and diversified into seven clades prior to
P. trichocarpa the separation of the monocot and dicot lineages (Synek et al.,
f g b V. vinifera 2006). Reverse transcription may have contributed to early ampli-
Solanum sp. fication of some clades, which contain mostly single-exon genes,
d O. sativa among them also the dicot clade H that has expanded into an
e c h S. bicolor extensive family of paralogs. No such expansion, however, took
B. distachyon place in the monocots, which have only a few H-type Exo70s.
S. moelendorffii Instead, a branch of the multi-exon F family has amplified and
P. patens diversified substantially, producing the monocot-specific FX clade.
While there is considerable sequence divergence among the
FIGURE 5 | A possible scenario of exocyst evolution in the context of Exo70 paralogs, we found no evidence of positive selection oper-
land plant evolution and the history of genome duplications. Selected ating across their conserved part. An obvious source of functional
genome duplication and gene amplification events that may have founded diversity, however, would be the variable sequences at both ends of
specific subfamilies of exocyst subunits are denoted by letters. (a)
the Exo70 subunits. A possible participation of C-terminal motifs
Duplication of Arabidopsis sp. Sec5; (b) Duplication of grapevine Sec6; (c)
Origin of two Sec3 clades (monocot1 and monocot2), and of the Sec15 in differential binding to membrane phosphoinositides has been
clades A1 and A2; (d) Origin of Sec15 clades A and B; (e) Origin of Exo84 already proposed (rsk et al., 2009). Here we have uncovered
clades A/B and C/CX; (f) Separation of the Exo84 clades A and B, as well as two obviously ancestral N-terminal motifs that document that
C and CX, the later subsequently lost in some descendants; (g) the N-terminal segments, though highly diversified, have evolved
Amplification of dicot Exo70 clade H; (h) Amplification of the monocot
from a common ancestor at least in most of the sequences, with-
Exo70 clade FX.
out contribution of major domain-shuffling events. Nevertheless,

Frontiers in Plant Science | Plant Traffic and Transport July 2012 | Volume 3 | Article 159 | 30
Cvrckov et al. Exocyst evolution

they have possibly built up enough diversity to mediate interac- tissue or organ space through controlled gene expression of sub-
tions with a variety of cellular components, ensuring thus the unit variants optimized for a particular set of circumstances (e.g.,
apparently required functional diversification. specific cell differentiation stages, tissues, or environmental condi-
Assuming that the alternative paralogs of exocyst subunits are tions). Participation of Exo84B in the establishment of mycorrhiza
co-expressed, and that they can freely combine into complexes (Genre et al., 2012) and, in particular, of distinct Exo70 variants in
(which is by no means guaranteed), literally hundreds of distinct pathogen response (Pecenkov et al., 2011) shows that this indeed
exocysts may exist within plant cells. Were the subunit combi- appears to be the case. Remarkably, one of the Arabidopsis Exo70
nations unrestricted (i.e., each Sec15 paralog working with each paralogs involved in pathogen response is member of the H clade,
Exo84 and each Exo70), Arabidopsis would be capable of produc- expanded specifically in the dicots, and it is thus tempting to spec-
ing 552 distinct exocyst variants, and rice stunning 1128 variants. ulate about a possible analogous role of the even more diversified
Alternative splicing may provide an additional source of exocyst monocot FX clade.
diversity. Even in metazoans, an array of Exo70 splicing variants In summary, both our data and recent experimental observa-
was uncovered, dependent on cell type and age of the tissue (Del- tions show that plants do not have an exocyst complex, but an
lago et al., 2011). It is therefore possible that also in animals hidden enormous variety of diverse exocyst complexes, and that this fea-
multiplicity of exocysts may exist depending on the splice-isoforms ture is at least as old as the land plants. Unraveling its functional
of Exo70 (and possibly also other subunits). On the other hand, the significance will continue to provide interesting challenges for the
actual numbers of plant exocyst varieties are undoubtedly much plant cell biology of the near future.
lower than the numbers of possible subunit combinations, since
not all paralogs are co-expressed, and some may be expressed ACKNOWLEDGMENTS
only under special circumstances or not at all. Nevertheless, we This work has been supported by the European Community
cannot avoid asking what is the biological relevance (or selective 7th Framework Programme (FP7/20072013) Grant No. 238640
advantage) of such a profusion of exocyst varieties. PLANTORIGINS, the Grant Agency of the Czech Republic
One possible reason may be the need to maintain and man- (P305/11/1629), the Ministry of Education of the Czech Republic
age a variety of qualitatively distinct membranes not only of (MSM 0021620858), and the Charles University in Prague (SVV
intracellular compartments, but also within the cell cortex whose 265203/2012).
lateral mobility is restricted by the cell wall. Distinct exocyst
variants in the same cell, defined especially by different land- SUPPLEMENTARY MATERIAL
marking Exo70 subunits, may participate in delimiting specific The Supplementary Material for this article can be found online at
plasmalemma domains (activated cortical domains) engaging in http://www.frontiersin.org/Plant_Traffic_and_Transport/abstract/
distinctly regulated membrane turnover. Together with the under- 31437
lying cytoplasm (in particular the connected recycling endosomes
defined by distinct Rab11 paralogs), the activated cortical domains Cvrckova_S1.xls | List of the 392 exocyst subunit sequences analyzed,
including database accession numbers, phylogenetic classification and domain
form larger functional units (recycling domains) that may play a
composition (Microsoft Excel file).
central part in the control of different cortical or endomembrane
domains of the many-sided plant cells (see detailed discussion in Cvrckova_S2.zip | Protein sequences and alignments used for phylogenetic
rsk et al., 2009; rsk and Potock, 2010). Another possibility analyses (compressed Zip file containing protein sequences in text
is functional separation of the diverse complexes in time and/or in format .txt and alignment sequences in FASTA format .fst).

REFERENCES tomatoes using perl. Nucleic Acids subunits. PLoS ONE 4, e4443. F., Soukupov, H., and rsk, V.
Anisimova, M., and Gascuel, O. (2006). Res. 39, D1149D1155. doi:10.1371/journal.pone.0004443 (2003). The exocyst complex in
Approximate likelihood ratio test Chong, Y. T., Gidda, S. K., San- Dellago, H., Lscher, M., Ajuh, P., plants. Cell Biol. Int. 27, 199201.
for branchs: a fast, accurate and ford, C., Parkinson, J., Mullen, Ryder, U., Kaisermayer, C., Grillari- Fendrych, M., Synek, L., Pecenkov, T.,
powerful alternative. Syst. Biol. 55, R. T., and Goring, D. R. (2010). Voglauer, R., Fortschegger, K., Gross, Toupalov, H., Cole, N., Drdov,
539552. Characterization of the Arabidop- S., Gstraunthaler, A., Borth, N., E., Nebesrov, J., edinov, M.,
Awashi, S., Palmer, R., Castro, M., sis thaliana exocyst complex gene Eisenhaber, F., Lamond, A. I., and Hla, M., Fowler, J. E., and rsk,
Mobarak, C. D., and Ruby, S. W. families by phylogenetic, expres- Grillari, J. (2011). Exo70, a sub- V. (2010). The Arabidopsis exocyst
(2001). New roles for the Snp1 sion profiling, and subcellular local- unit of the exocyst complex, inter- complex is involved in cytokinesis
and Exo84 proteins in yeast pre- ization studies. New Phytol. 185, acts with SNEV(hPrp19/hPso4) and and cell plate maturation. Plant Cell
mRNA splicing. J. Biol. Chem. 276, 401419. is involved in pre-mRNA splicing. 22, 30533065.
3100431015. Cole, R. A., Synek, L., rsk, V., and Biochem. J. 438, 8191. Genre, A., Ivanov, S., Fendrych, M.,
Benson, D. A., Karsch-Mizrachi, I., Fowler, J. E. (2005). SEC8, a sub- Dereeper, A., Guignon, V., Blanc, G., Faccio, A., rsk, V., Bisseling, T.,
Clark, K., Lipman, D. J., Ostell, unit of the putative Arabidopsis exo- Audic, S., Buffet, S., Chevenet, F., and Bonfante, P. (2012). Multi-
J., and Sayers, E. W. (2012). cyst complex, facilitates pollen ger- Dufayard, J. F., Guindon, S., Lefort, ple exocytotic markers accumulate
GenBank. Nucleic Acids Res. 40, mination and competitive pollen V., Lescot, M., Claverie, J. M., and at the sites of perifungal mem-
D48D53. tube growth. Plant Physiol. 138, Gascuel, O. (2008). Phylogeny.fr: brane biogenesis in arbuscular myc-
Bombarely, A., Menda, N., Buels, R. M., 20052018. robust phylogenetic analysis for the orrhizas. Plant Cell Physiol. 53,
Strickler, S., Fischer-York, T., Pujar, Croteau, N. J., Furgason, M. L. M., non-specialist. Nucleic Acids Res. 36, 244255.
A., Leto, J., Gosselin, J., and Mueller, Devos, D., and Munson, M. (2009). W465W469. Goodstein, D. M., Shu, S., Howson,
L. A. (2011). The sol genomics Conservation of helical bundle Eli, M., Drdov, E., iak, D., R., Neupane, R., Hayes, R. D., Fazo,
network (solgenomics.net): growing structure between the exocyst Bavlnka, B., Hla, M., Cvrckov, J., Mitros, T., Dirks, W., Hellsten,

www.frontiersin.org July 2012 | Volume 3 | Article 159 | 31


Cvrckov et al. Exocyst evolution

U., Putnam, N., and Rokshar, D. S. Kee, Y., Yoo, J. S., Hazuka, C. D., Peter- protein-protein interactions. Mol. rsk, V. (2006). AtEXO70A1, a
(2012). Phytozome: a comparative son, K. E., Hsu, S. C., and Scheller, Biol. Evol. 27, 25672575. member of a family of putative exo-
platform for green plant genomics. R. H. (1997). Subunit structure of McGinnis, S., and Madden, T. L. (2004). cyst subunits specifically expanded
Nucleic Acids Res. 40, D1178D1186. the mammalian exocyst complex. BLAST: at the core of a powerful and in land plants, is important for
Grunt, M., rsk, V., and Cvrckov, Proc. Natl. Acad. Sci. U.S.A. 94, diverse set of sequence analysis tools. polar growth and plant develop-
F. (2008). Roots of angiosperm 1443814443. Nucleic Acids Res. 32, W20W25. ment. Plant J. 48, 5472.
formins: the evolutionary history Kitashiba, H., Liu, P., Nishio, T., Nas- Munson, M., and Novick, P. (2006). The Tamura, K., Peterson, D., Peterson,
of plant FH2 domain-containing rallah, J. B., and Nasrallah, M. E. exocyst defrocked, a framework of N., Stecher, G., Nei, M., and
proteins. BMC Evol. Biol. 8, 115. (2011). Functional test of Bras- rods revealed. Nat. Struct. Mol. Biol. Kumar, S. (2011). MEGA5: molec-
doi:10.1186/1471-2148-8-115 sica self-incompatibility modifiers 13, 577581. ular evolutionary genetics analysis
Guindon, S., and Gascuel, O. (2003). in Arabidopsis thaliana. Proc. Natl. Pecenkov, T., Hla, M., Kulich, using maximum likelihood, evolu-
A simple, fast an accurate algo- Acad. Sci. U.S.A. 108, 1817318178. I., Kocourkov, D., Drdov, E., tionary distance, and maximum par-
rithm to estimate large phylogenies Koch, M. A., Haubold, B., and Mitchell- Fendrych, M., Toupalov, H., and simony methods. Mol. Biol. Evol. 28,
by maximum likelihood. Syst. Biol. Olds, T. (2000). Comparative evolu- rsk, V. (2011). The role for 27312739.
52, 696704. tionary analysis of chalcone synthase the exocyst complex subunits TerBush, D. R., Maurice, T., Roth, D.,
Guo, W., Grant, A., and Novick, P. and alcohol dehydrogenase loci in Exo70B2 and Exo70H1 in the and Novick, P. (1996). The exocyst
(1999). Exo84p is an exocyst protein Arabidopsis, Arabis, and related gen- plant-pathogen interaction. J. Exp. is a multiprotein complex required
essential for secretion. J. Biol. Chem. era (Brassicaceae). Mol. Biol. Evol. Bot. 62, 21072116. for exocytosis in Saccharomyces cere-
274, 2355823564. 17, 14831498. Potato Genome Sequencing Consor- visiae. EMBO J. 15, 64836494.
Guo, W., Roth, D., Gatti, E., and Novick, Koumandou,V. L., Dacks, J. B., Coulson, tium. (2011). Genome sequence and The Uniprot Consortium. (2012).
P. (1997). Identification and charac- R. M., and Field, M. C. (2007). Con- analysis of the tuber crop potato. Reorganizing the protein space
terization of homologues of the exo- trol systems for membrane fusion Nature 475, 189195. at the Universal Protein Resource
cyst component Sec10p. FEBS Lett. in the ancestral eukaryote; evolu- Samuel, M. A., Chong, Y. T., Haasen, K. (UniProt). Nucleic Acids Res. 40,
404, 135139. tion of tethering complexes and SM E., Aldea-Brydges, M. G., Stone, S. D71D75.
Hla, M., Cole, R. A., Synek, L., proteins. BMC Evol. Biol. 7, 29. L., and Goring, D. R. (2009). Cel- Thompson, J. D., Gibson, T. J., Plewniak,
Drdov, E., Pecenkov, T., Nord- doi:10.1186/1471-2148-7-29 lular pathways regulating responses F., Jeanmougin, F., and Higgins, D. G.
heim, A., Lamkemeyer, T., Mad- Kulich, I., Cole, R. A., Drdov, E., to compatible and self-incompatible (1997). The ClustalX windows inter-
lung, J., Hochholdinger, F., Fowler, J. Cvrckov, F., Soukup, A., Fowler, pollen in Brassica and Arabidop- face: flexible strategies for multiple
E., and rsk, V. (2008). An exo- J. E., and rsk, V. (2010). Ara- sis stigmas intersect at Exo70A1, a sequence alignment aided by quality
cyst complex functions in plant cell bidopsis exocyst subunits SEC8 and putative component of the exocyst analysis tools. Nucleic Acids Res. 24,
growth in Arabidopsis and tobacco. EXO70A1 and exocyst interactor complex. Plant Cell 21, 26552671. 48764882.
Plant Cell 20, 13301345. ROH1 are involved in the localized Schuler, G. D., Altschul, S. F., and Lip- Van de Peer, Y., Maere, S., and Meyer,
Hall, T. A. (1999). BioEdit: a user- deposition of seed coat pectin. New man, D. J. (1991). A workbench A. (2009). The evolutionary signif-
friendly biological sequence align- Phytol. 188, 615625. for multiple alignment construction icance of ancient genome duplica-
ment editor and analysis program Lamesch, P., Berardini, T. Z., Li, D., analysis. Proteins 9, 180190. tions. Nat. Rev. Genet. 10, 725732.
for Windows 95/98/NT. Nucl. Acids Swarbreck, D., Wilks, C., Sasidharan, Segu-Simmaro, J. M., Austin, J. R., Wang, J., Ding, Y., Wang, J., Hillmer, S.,
Symp. Ser. 41, 9598. R., Muller, R., Dreher, K., Alexan- White, E. A., and Staehelin, L. A. Miao, Y., Lo, S. W., Wang, X., Robin-
He, B., and Guo, W. (2009). The exo- der, D. L., Garcia-Hernandez, M., (2004). Electron tomographic analy- son, D. G., and Jiang, L. (2010).
cyst complex in polarized exocy- Karthikeyan, A. S., Lee, C. H., Nel- sis of somatic cell plate formation EXPO, an exocyst-positive organelle
tosis. Curr. Opin. Cell Biol. 21, son, W. D., Ploetz, L., Singh, S., in meristematic cells of Arabidopsis distinct from multivesicular endo-
537542. Wensel, A., and Huala, E. (2012). The preserved by high-pressure freezing. somes and autophagosomes, medi-
He, B., Xi, F., Zhang, X., Zhang, J., and Arabidopsis information resource Plant Cell 16, 836856. ates cytosol to cell wall exocytosis in
Guo, W. (2007). Exo70 interacts with (TAIR): improved gene annotation Sklarczyk, D., Franceschini, A., Kuhn, Arabidopsis and tobacco cells. Plant
phospholipids and mediates the tar- and new tools. Nucleic Acids Res. 40, M., Simonovic, M., Roth, A., Cell 22, 40094030.
geting of the exocyst to the plasma D1202D1210. Minguez, P., Doerks, T., Stark, M., Wen, T. J., Hochholdinger, F., Sauer,
membrane. EMBO J. 26, 40534065. Lang, D., Eisinger, J., Reski, R., and Muller, J., Bork, P., Jensen, L. J., and M., Bruce, W., and Schnable, P. S.
Heider, M. R., and Munson, M. (2012). Rensing, S. (2005). Representation von Mering, C. (2011). The STRING (2005). The roothairless1 gene of
Exorcising the exocyst complex. and high-quality annotation of the database in 2011: functional interac- maize encodes a homolog of sec3,
Traffic 13, 898907. Physcomitrella patens transcriptome tion networks of proteins, globally which is involved in polar exocytosis.
Hertzog, M., and Chavrier, P. (2011). demonstrates a high proportion integrated and scored. Nucleic Acids Plant Physiol. 138, 16371643.
Cell polarity during motile of proteins involved in metabo- Res. 39, D561D568. Whyte, J. R., and Munro, S. (2002).
processes: keeping on track with the lism among mosses. Plant Biol. 7, Soltis, D. E., Bell, C. D., Kim, S., and Vesicle tethering complexes in mem-
exocyst complex. Biochem. J. 433, 238250. Soltis, P. S. (2008). Origin and early brane traffic. J. Cell Sci. 115,
403409. Lassmann, T., and Sonnhammer, E. evolution of angiosperms. Ann. N. Y. 26272657.
Jiao, Y., Wickett, N. J., Ayyampalayam, L. (2006). Kalign, Kalignvu and Acad. Sci. 1133, 325. Woodhouse, M. R., Tang, H., and Freel-
S., Chanderbali, A. S., Landherr, L., Mumsa: web servers for multiple Songer, J. A., and Munson, M. (2009). ing, M. (2011). Different gene fam-
Ralph, P. E., Tomsho, L. P., Hu, Y., sequence alignment. Nucleic Acids Sec6p anchors the assembled exocyst ilies in Arabidopsis thaliana trans-
Liang, H., Soltis, P. S., Soltis, D. E., Res. 34, W596W599. aomplex at sites of secretion. Mol. posed in different epochs and
Clifton, S. W., Schlarbaum, S. E., Lawrence, C. E., Altschul, S. F., Boguski, Biol. Cell 20, 973982. at different frequencies through-
Schuster, S. C., Ma, H., Leebens- M. S., Liu, J. S., Neuwald, A. Stern, A., Doron-Faigenboim, A., Erez, out the rosids. Plant Cell 23,
Mack, J., and de Pamphilis, C. W. F., and Wootton, J. C. (1993). E., Martz, E., Bacharach, E., and 42414253.
(2011). Ancestral polyploidy in seed Detecting subtle sequence signals: Pupko, T. (2007). Selecton 2007: rsk, V., Cvrckov, F., Potock, M.,
plants and angiosperms. Nature 473, a Gibbs sampling strategy for advanced models for detecting pos- and Hla, M. (2009). Exocytosis and
97100. multiple alignment. Science 262, itive and purifying selection using a cell polarity in plants exocyst and
Juan, D., Pazos, F., and Valencia, 208214. Bayesian inference approach. Nucleic recycling domains. New Phytol. 183,
A. (2008). Co-evolution and Lovell, S. C., and Robertson, D. Acids Res. 35, W506W511. 255272.
co-adaptation in protein networks. L. (2010). An integrated view Synek, L., Schlager, N., Eli, M., rsk, V., and Potock, M. (2010).
FEBS Lett. 582, 12251230. of molecular co-evolution in Quentin, M., Hauser, M. T., and Recycling domains in plant cell

Frontiers in Plant Science | Plant Traffic and Transport July 2012 | Volume 3 | Article 159 | 32
Cvrckov et al. Exocyst evolution

morphogenesis: small GTPase effec- Zhang, Y., Liu, C. M., Emons, A. M. C., Received: 13 June 2012; paper pending Copyright 2012 Cvrckov, Grunt ,
tors, plasma membrane signalling and Ketelaar, T. (2010). The plant published: 25 June 2012; accepted: 29 June Bezvoda, Hla, Kulich, Rawat and
and the exocyst. Biochem. Soc. Trans. exocyst. J. Integr. Plant Biol. 52, 2012; published online: 18 July 2012. rsk. This is an open-access arti-
38, 723728. 138146. Citation: Cvrckov F, Grunt M, Bezvoda cle distributed under the terms of the
Zhang, X., Zajac, A., Zhang, J., Wang, R, Hla M, Kulich I, Rawat A and rsk Creative Commons Attribution License,
P., Li, M., Murray, J., TerBush, D. Conflict of Interest Statement: The V (2012) Evolution of the land plant exo- which permits use, distribution and
R., and Guo, W. (2005). The criti- authors declare that the research was cyst complexes. Front. Plant Sci. 3:159. reproduction in other forums, pro-
cal role of Exo84p in the organiza- conducted in the absence of any doi: 10.3389/fpls.2012.00159 vided the original authors and source
tion and polarized localization of the commercial or financial relationships This article was submitted to Frontiers in are credited and subject to any copy-
exocyst complex. J. Biol. Chem. 280, that could be construed as a potential Plant Traffic and Transport, a specialty of right notices concerning any third-party
2035620364. conflict of interest. Frontiers in Plant Science. graphics etc.

www.frontiersin.org July 2012 | Volume 3 | Article 159 | 33


REVIEW ARTICLE
published: 24 August 2012
doi: 10.3389/fpls.2012.00188

Bundling actin filaments from membranes: some novel


players
Clment Thomas *
Laboratory of Molecular and Cellular Oncology, Department of Oncology, Public Research Centre for Health (CRP-Sant), Luxembourg, Luxembourg

Edited by: Progress in live-cell imaging of the cytoskeleton has significantly extended our knowledge
Markus Geisler, University of about the organization and dynamics of actin filaments near the plasma membrane of
Fribourg, Switzerland
plant cells. Noticeably, two populations of filamentous structures can be distinguished. On
Reviewed by:
the one hand, fine actin filaments which exhibit an extremely dynamic behavior basically
Benoit Lacroix, State University of
New York at Stony Brook, USA characterized by fast polymerization and prolific severing events, a process referred to as
Frantisek Baluska, University of actin stochastic dynamics. On the other hand, thick actin bundles which are composed
Bonn, Germany of several filaments and which are comparatively more stable although they constantly
*Correspondence: remodel as well. There is evidence that the actin cytoskeleton plays critical roles in
Clment Thomas, Laboratory of
trafficking and signaling at both the cell cortex and organelle periphery but the exact
Molecular and Cellular Oncology,
Department of Oncology, Public contribution of actin bundles remains unclear. A common view is that actin bundles provide
Research Centre for Health the long-distance tracks used by myosin motors to deliver their cargo to growing regions
(CRP-Sant), 84 Val Fleuri, and accordingly play a particularly important role in cell polarization. However, several
L-1526 Luxembourg, Luxembourg.
e-mail: clement.thomas@
studies support that actin bundles are more than simple passive highways and display
crp-sante.lu multiple and dynamic roles in the regulation of many processes, such as cell elongation,
polar auxin transport, stomatal and chloroplast movement, and defense against pathogens.
The list of identified plant actin-bundling proteins is ever expanding, supporting that plant
cells shape structurally and functionally different actin bundles. Here I review the most
recently characterized actin-bundling proteins, with a particular focus on those potentially
relevant to membrane trafficking and/or signaling.
Keywords: actin bundling, fimbrins, formins, LIM proteins, SCAB1, THRUMIN1, V-ATPases, villins

INTRODUCTION modification of the cell boundary by an actin polymerization-


Actin is one of the most abundant, ubiquitous, and conserved based process. However, actin filaments are in close proximity
proteins in eukaryotes. In the cell, globular actin subunits poly- with the cell membrane in plant cells too.
merize into actin filaments which themselves assemble into Recent studies combining advanced imaging approaches, such
higher order structures, such as orthogonal networks and par- as variable-angle epifluorescence microscopy (VAEM), spinning
allel bundles (Figure 1). This system, referred to as the actin disc confocal microscopy, and reliable fluorescent actin mark-
cytoskeleton, exhibits an extraordinary high degree of plastic- ers have advanced our understanding of the organization and
ity allowing the formation, destruction, and recycling of diverse dynamics of the actin cytoskeleton near the cell cortex (Staiger
filamentous structures within a short time scale, and offers count- et al., 2009; Khurana et al., 2010; Smertenko et al., 2010; Henty
less possibilities to cells. The primary level of the regulation of et al., 2011; Wang et al., 2011; Toth et al., 2012; Figure 1).
actin cytoskeleton organization and dynamics consists in vari- Cortical filaments arrange into complex networks whose stochas-
ous (>100) actin-binding proteins which control, in time and tic behavior is largely consistent with the predictions of a
space, actin filament nucleation, elongation, stabilization, cap- biomimetic system (Michelot et al., 2007; Staiger et al., 2009;
ping, severing, and crosslinking (Pollard et al., 2000; Winder and Blanchoin et al., 2010). Single filaments randomly polymerize at
Ayscough, 2005). In animal and yeast cells, cortical actin fila- extremely high growth rates (1.7 m/s in hypocotyl epidermal
ments and the plasma membrane undergo a dynamic interplay cells from Arabidopsis seedlings) and exhibit prominent buck-
(Pollard and Cooper, 2009). For instance, the coordinated poly- ling and straightening behavior. Most filaments are short-lived
merization of actin filaments against the membrane provides the (<30 s), which was demonstrated to be primarily due to prolific
force necessary to modify cell shape and promote cell locomo- severing activity rather than to filament end depolymerization.
tion and division. As a consequence, dysfunctions in the actin Beside single filaments, thicker and longer bundles adopt less con-
polymerization machinery or in its regulation frequently results voluted configurations and tend to align with the long axis of the
in diseases, including cancers (Van Troys et al., 2008a). Although cell (Staiger et al., 2009; Smertenko et al., 2010; Henty et al., 2011).
related mechanisms are not excluded in plant cells, they are In comparison with finer filaments, thick fibers experience slower
obviously not prevalent. The rigid plant cell wall precludes any but qualitatively similar dynamics. Indeed, they elongate, buckle,

www.frontiersin.org August 2012 | Volume 3 | Article 188 | 34


Thomas Novel plant actin bundling proteins

FIGURE 1 | Main reactions controlling actin filament dynamics and process rarely occurs immediately following severing, suggesting intense
organization in plant cells. The G-actin monomer binding protein profilin barbed end capping activity (Staiger et al., 2009). Finally, actin fragments can
inhibits spontaneous actin nucleation in the cytoplasm. Nucleation is serve as building blocks to assemble novel filaments by an end-joining
promoted de novo (1) by nucleating proteins such as formins. In addition, mechanism (5 ). Actin filaments are crosslinked into bundles by bundling
non-processive formins, such as Arabidopsis AtFH1, can also induce proteins (right part of the cartoon). Both in vitro and live cell TIRFM-based
nucleation from the side of pre-existing filaments, a process which likely analyses support that actin bundles form by a catch and zipper mechanism
contributes to the initiation of actin bundles (not illustrated; Michelot et al., (6) (Khurana et al., 2010). Actin bundles subsequently grow by elongation of
2006; Blanchoin et al., 2010). Following nucleation, actin filaments undergo filaments at their ends (7) as well as by end-association of pre-existing
fast polymerization (2) and (2 ) before being capped (3). The aging section of filaments (7 ), a process which might be facilitated by bundling proteins. Like
actin filaments (which contains ADP-loaded actin subunits, not shown) is single filaments, actin bundles are severed although at a lower frequency
fragmented by severing proteins such as actin-depolymerizing factors (4). (Khurana et al., 2010; Smertenko et al., 2010). Current data support that
The resulting fragments can be capped at their barbed end and depolymerize unipolar bundles (here-exemplified) predominate in plant cells. However, the
from their pointed () end to replenish the pool of monomers (5). existence of bundles containing actin filaments of mixed polarity is not
Alternatively, they can re-elongate through polymerization (5) although this excluded.

bundle, and are severed (Staiger et al., 2009; Blanchoin et al., cell growth are however complex as illustrated by contradictory
2010; Smertenko et al., 2010). Although actin filament severing observations. For instance, the growing epidermal cells from
emerges as the leading driver of actin cytoskeleton remodeling, an petioles of adf4 mutants also exhibit enhanced bundling but,
additional mechanism involving filament bundling, unbundling, contrarily to hypocotyl epidermal cells, are shorter than in wild-
and myosin-dependent sliding events was suggested to con- type plants (Henty et al., 2011). Some studies have established
tribute to the permanent reorganization of the cortical actin that in specific cells, such as rice coleoptiles, increased actin
network (Smertenko et al., 2010). Using VAEM and quantitative bundling negatively impacts cell elongation (Nick et al., 2009;
approaches, Henty et al. (2011) provided, for the first time, direct Nick, 2010). As an underlying mechanism, it has been proposed
evidence of the contribution of an ABP, namely Arabidopsis actin that actin bundling prevents efficient delivery of auxin-efflux
depolymerizing factor 4 (AtADF4), to actin stochastic dynamics carriers to their site of action at the plasma membrane, a pro-
in vitro. In agreement with the biochemical actin severing activ- cess which would require a more unbundled actin configuration
ity of AtADF4, hypocotyl epidermal cells from adf4 knockout (Nick, 2010). Actin bundles most likely impact cell growth by dif-
mutants exhibited a 2.53-fold decrease in the rate of severing, ferent ways. Indeed, actin bundling can alter turgor pressure, the
as well as increased filament lengths and lifetimes. The loss of main physical driver of cell expansion (Szymanski and Cosgrove,
AtADF4 also led to excessive actin bundling and cell growth in the 2009), by modifying the thickness of the cell wall and the shape of
apical region of the hypocotyl, where active cell expansion takes the transvacuolar strands and vacuole (e.g., Staiger et al., 1994;
place. Higaki et al., 2010a,b, 2011). Finally, there is much evidence
Actin bundles have been repeatedly reported to play a criti- that actin bundles serve as main tracks used by myosin motors
cal role in cell morphogenesis (Baluska et al., 2001; Smith and to drive endomembrane compartments over long distances to
Oppenheimer, 2005; Thomas et al., 2009; Higaki et al., 2010a). sites of growth (Smith and Oppenheimer, 2005; Thomas et al.,
The relationships between the extent of actin bundling and 2009; Higaki et al., 2010a). Interestingly, the organization and

Frontiers in Plant Science | Plant Traffic and Transport August 2012 | Volume 3 | Article 188 | 35
Thomas Novel plant actin bundling proteins

dynamics of the actin cytoskeleton significantly differ in isotrop- to the previously known villin, formin, fimbrin, and LIM protein
ically and anisotropically growing cells, and this was confirmed families, whereas others define novel families. Some of these pro-
by recent quantitative analyses using VAEM (Smertenko et al., teins are likely direct linkers between actin bundles and the cell or
2010). Therefore, the role of actin bundling in cell growth appears organelle membranes. Here we review the last advances in plant
multiple and cell-type dependent. actin-bundling proteins with a particular interest for those that
In animal cells, the assembly of actin bundles is required for the further move ahead our comprehension about how actin bundles
formation and/or function of various specialized cellular struc- physically or functionally interact with membranes.
tures, such as filopodia, lamellipodia, stress fibers, microvilli, and
invadopodia (Stevenson et al., 2012). In most of these structures, FORMINS
actin bundles are in close connection with the cell membrane and, Over the last years, formins have emerged as a large and major
in some cases, with the extracellular environment referred to as family of plant actin nucleating factors with critical functions in
the extracellular matrix. For instance, the -actinin-induced actin cell growth and division (Blanchoin and Staiger, 2008). Beside
bundles that constitute the ventral stress fibers of non-muscle cells their core nucleating activity, plant formins display additional
are anchored to focal adhesions at each of their extremities. Focal actin regulatory activities including nucleation, capping, sever-
adhesions transmit the force generated by myosin II-dependent ing, and bundling (Staiger and Blanchoin, 2006). The Arabidopsis
stress fiber contraction to the extracellular matrix, allowing to formin AtFH1 (Banno and Chua, 2000), was the first plant formin
pull the cell body during cell migration (Vicente-Manzanares reported to promote the formation of actin bundles both in live
et al., 2009; Ciobanasu et al., 2012). Key players of focal adhesions cells and in vitro (Cheung and Wu, 2004; Michelot et al., 2005). Its
are the cell surface membrane receptors integrins around which overexpression in pollen tubes stimulates the formation of actin
assemble complex networks made of about 160 proteins that con- bundles from the cell membrane and locally induces membrane
tribute to link the extracellular matrix to the actin cytoskeleton deformation, suggesting that a proper density and distribution of
and to create a high-performance environmental sensing system actin bundles is critical for membrane assembly and/or mainte-
(Geiger et al., 2009). Plants lack most focal adhesion compo- nance, and that formins play substantial roles in these processes
nents, including true integrin homologs. However, there is no (Cheung and Wu, 2004). Mechanistic studies, employing total
doubt that plant cells perceive and transduce many external sig- internal reflection fluorescence microscopy (TIRFM), revealed
nals from their cell wall to their cytoskeleton (Baluska et al., 2003; that AtFH1 functions as a non-processive formin which moves
Drobak et al., 2004; Humphrey et al., 2007; Fu, 2010; Higaki et al., from the barbed end to the side of an actin filament after the
2011). Day et al. (2011) recently comprehensively reviewed the nucleation event, and that this property is involved in AtFH1 actin
potential roles played by the actin cytoskeleton in the organiza- bundling activity (Michelot et al., 2006). Recently, several other
tion and activation of host responses to biotic stress. One of the plant formins were shown to promote the formation of actin
earliest and well-documented responses of plant cells to fungal or bundles in an autonomous manner, including Arabidopsis AtFH4,
oomycete pathogens is a reorganization of the actin cytoskeleton AtFH8, and AtFH14 (Deeks et al., 2010; Li et al., 2010; Xue et al.,
and endomembrane components which both focus at the site of 2011), and rice OsFH5 (Yang et al., 2011; Zhang et al., 2011a).
infection (e.g., Kobayashi et al., 1994; Leckie et al., 1995; Xu et al., Interaction of class I plant formins with a membrane is pre-
1998; Opalski et al., 2005; Takemoto et al., 2006; Day et al., 2011). dicted by the characteristic membrane-targeting domain present
Such reorganization is thought to culminate in the formation of in their N-terminal region which consists in a signal peptide fol-
cell wall appositions rich in antimicrobial compounds (Hardham lowed by a transmembrane domain (Deeks et al., 2002; Blanchoin
et al., 2007). During this process actin filaments become more and Staiger, 2008). Accordingly, most class I formins examined
bundled, suggesting an important role for actin-bundling pro- so far were shown to accumulate at the cell periphery or in
teins in the dynamic relocalization of organelles during interac- membrane-rich structures such as the cell plate using immunocy-
tions with pathogens. Interestingly, Hardham et al. (2008) could tochemistry and/or GFP-fusion strategies (Cheung and Wu, 2004;
mimic pathogen-induced actin remodeling by applying a gen- Favery et al., 2004; Van Damme et al., 2004; Deeks et al., 2005;
tle and local pressure on the surface of Arabidopsis cotyledon Ingouff et al., 2005; Cheung et al., 2010). Interestingly, AtFH8-
epidermal cells, indicating that the actin cytoskeleton can read- GPF localizes primarily to the nuclear envelope in interphase
ily reorganize (35 min after stimulation) in response to the cells, suggesting functional differences among class I formins
physical force exerted by pathogens. Considering the continu- (Xue et al., 2011). In addition, biochemical analyses indicate that
ous and fast remodeling of the cortical actin array observed in pollen-specific AtFH3 lacks the ability to generate actin bun-
both growing and non-growing epidermal cells, an emerging and dles in vitro (Ye et al., 2009). Nevertheless, with or without
seducing idea is that cortical actin plays a sentinel role capable intrinsic actin-bundling activities, class I formins were convinc-
of initiating basal defense against pathogen-induced diseases or ingly demonstrated to promote actin bundling in vivo (Cheung
abiotic stress, such as mechanical stress, within short time scales and Wu, 2004; Ye et al., 2009; Cheung et al., 2010). Indeed,
(Staiger et al., 2009). How actin filaments and bundles com- both gain- and loss-of-function genetic studies pointed out a
municate with the cell membrane and cell wall largely remains central role of AtFH3 in regulating the long and thick actin
enigmatic. bundles running along the pollen tube shank and in control-
Since our last review on actin bundling in plants (Thomas ling the direction and velocity of cytoplasmic streaming (Ye
et al., 2009), more than fifteen additional plant actin-bundling et al., 2009). Therefore, AtFH3 likely cooperates with pollen
proteins were isolated and characterized. Several of those belong actin-bundling proteins to assemble the tracks required for long

www.frontiersin.org August 2012 | Volume 3 | Article 188 | 36


Thomas Novel plant actin bundling proteins

distance actomyosin-dependent movement. Beside AtFH3, the the cell cortex are modulated by microtubules (Smertenko et al.,
pollen tube tip-enriched formin AtFH5 was found to play more 2010). Although the underlying mechanism remains unknown, it
specific functions in the formation of the subapical actin structure seems reasonable to speculate that some formin family members
often referred to as the cortical actin fringe, and in membrane- are involved. Interestingly, endogenous OsFH5 localizes to spe-
targeted vesicular trafficking (Cheung et al., 2010). cific regions at the chloroplast surface (Zhang et al., 2011a). Like
It is noteworthy that class I formins exhibit divergent and other class II formins, OsFH5 possesses an N-terminal phosphate
potentially highly glycosylated extracellular domains, and accord- tensin (PTEN)-like domain instead of the typical transmembrane
ingly represent excellent candidates for mediating extracellular domain of most class I formins. Transient expression experiments
stimuli to the actin cytoskeleton (Cvrckova, 2000; Blanchoin indicate that the PTEN-like domain of FH5 is sufficient to tar-
and Staiger, 2008), e.g., during the guidance of pollen tube get a fluorescent protein reporter to the chloroplast outer surface
growth in response to female tissue signals (Cheung and Wu, of tobacco cells, suggesting that it is responsible for the anchor-
2004). In this context, Martiniere et al. (2011) recently provided ing of OsFH5 to chloroplasts. Therefore OsFH5 emerges as a
compelling evidence that the extracellular domain of AtFH1 is potential linker between actin filaments/bundles, microtubules,
anchored to the cell wall and thereby reduces the lateral mobil- and chloroplasts, and might accordingly contribute to chloro-
ity of AtFH1. Domain analyses highlighted the central role in plast motility, a process that has been proposed to rely on both
AtFH1 immobilization of a short, 15 amino acid-long, domain cytoskeletons at least in some species (e.g., Chuong et al., 2006).
which includes a signature peptide of extensins, a class of cell wall-
associated hydroxyproline-rich glycoproteins (Banno and Chua, THRUMIN1
2000; Showalter et al., 2010). Although the biochemical nature Chloroplasts change their subcellular location in response to light.
of formin-cell wall interactions has not been resolved yet, it is They move toward weak light to optimize light capture for photo-
tempting to propose that cell wall heterogeneity is responsible synthesis and away from intense light to minimize photodamage,
for targeting formins to specific plasma membrane subdomains. the latter process being referred to as the avoidance response
For instance, the accumulation of AtFH4 in cell-to-cell contact (Kasahara et al., 2002; Suetsugu and Wada, 2007). In plants,
areas and of AtFH5 in the pollen-tube apical dome (Deeks and organelle movement primarily relies on class XI myosins which
Hussey, 2005; Cheung et al., 2010) might reflect specificities in are predicted to transport their cargos along cytosplasmic actin
cell wall composition at these locations. Interestingly, the extra- bundles (Avisar et al., 2008; Peremyslov et al., 2008; Sparkes et al.,
cellular domain responsible for anchoring AtFH1 to the cell wall 2008). Although myosin inhibitor studies support that chloro-
was required for AtFH1-mediated actin cytoskeleton remodeling plast movement also depends on myosin activity to some extent
in overexpression experiments (Martiniere et al., 2011). Although (e.g., Paves and Truve, 2007), recent data indicate that chloro-
this remains speculative, anchoring of AtFH1 has been suggested plasts primarily use another type of actin-based mechanism to
to contribute to the formation and/or stabilization of AtFH1 rapidly change their direction in response to light. A population
functional dimers. Together these data support that AFH1, and of so-called chloroplast actin filaments (cp-actin filaments) was
most likely other class I formins, provide stable anchor points shown to anchor chloroplasts to the plasma membrane suggesting
for the actin cytoskeleton at the cell membrane and can induce that they are involved in light-induced chloroplast repositioning
actin remodeling upon external signal perception. It is notewor- (Kadota et al., 2009; Suetsugu et al., 2010a,b). In this context,
thy that time lapse imaging analyses suggested that some of the THRUMIN1 was recently identified as a novel actin-bundling
AtFH5-nucleated and membrane-anchored actin filaments in the protein with a potential critical role in linking phototropin pho-
subapical region of pollen tubes are fragmented and released to toreceptor activity at the plasma membrane and actin-dependent
the cytoplasm, providing precursors of some long actin bundles in chloroplast movements (Whippo et al., 2011).
the core cytoplasm (Cheung et al., 2010). Membrane-associated Compared to wild-type plants, thrumin1 mutants exhibit
formins might therefore also indirectly contribute to the forma- slower and more randomized chloroplast movements in response
tion of more internal actin structures. to light stimuli. In vitro biochemical analyses indicate that
In addition to their function as interface between cell mem- THRUMIN1 binds to actin filaments in a direct manner and
brane and actin cytoskeleton, plant formins recently emerged promotes the formation of actin bundles. Consistent with these
as central links between actin filaments and microtubules. For data and the previously reported association of THRUMIN1
instance, class I AtFH4, class II AtFH14, and the closely related with the plasma membrane (Alexandersson et al., 2004), YFP-
rice OsFH5 bind to and bundle both actin filaments and micro- fused THRUMIN1 (THRUMIN1-YFP) extensively decorates the
tubules and are accordingly expected to functionally coordinate filamentous actin cytoskeleton along the plasma membrane,
the corresponding cytoskeletons (Deeks et al., 2010; Li et al., 2010; and in association with chloroplasts (Whippo et al., 2011).
Yang et al., 2011; Zhang et al., 2011a). There is accumulating evi- Upon stimulation of the chloroplast avoidance response by a
dence that such coordination is crucial for many developmental localized blue-light irradiation, THRUMIN1-YFP further accu-
processes such as intracellular transport, directional cell growth, mulates along actin filaments and apparently increases actin-
and cell division (e.g., Fu et al., 2005; Collings, 2008; Wightman bundling locally. The underlying mechanism was proven to be
and Turner, 2008; Crowell et al., 2009; Petrasek and Schwarzerova, dependent on the phototropin blue-light photoreceptors PHOT1
2009). A recent quantitative study using VAEM revealed that and PHOT2. Indeed, no elevation of THRUMIN1-YFP fluo-
microtubule depolymerization induces faster elongation and rescence occurred in phot1phot2 double mutants upon blue
shortening of actin filaments, suggesting that actin dynamics at light stimulation. Together these data support that THRUMIN1

Frontiers in Plant Science | Plant Traffic and Transport August 2012 | Volume 3 | Article 188 | 37
Thomas Novel plant actin bundling proteins

promotes the formation of actin bundles from the plasma mem- Therefore, the multiple actin-binding sites responsible for the
brane in response to light and in a phototropin-dependent in vitro actin bundling activity of AtAVB1-3 may confer these
manner. However, the exact role of such actin bundles in chloro- proteins an increased affinity for actin filaments/bundles and
plast movement remains to be established. In addition, how trigger their clustering and/or recycling upon actin polymeriza-
THRUMIN1 cooperates with CHUP1, a chloroplast outer enve- tion. Such a scenario of an actin-mediated sorting mechanism
lope ABP involved in cp-actin filament formation (Oikawa et al., in plants remains however highly hypothetical. As an alternative,
2003, 2008; Schmidt Von Braun and Schleiff, 2008a,b; Kadota plant V-ATPases might serve as more passive points for anchor-
et al., 2009), to remodel the actin cytoskeleton and drive chloro- ing organelles to actin bundles. A last possibility is that AtAVB1-3
plast movement upon light perception by PHOT1 and PHOT2 function in a complex dissociated form in the cytoplasm, and
are central questions that should be addressed in future studies. therefore contribute to increase actin-bundling upon V-ATPase
As already stated in the previous section, class II formins repre- complex dissociation. Obviously, much work is required to exam-
sent additional potential linkers between chloroplasts and actin ine each of these possibilities. Nevertheless, V-ATPases emerge
bundles (Zhang et al., 2011a). as potential additional links between the actin cytoskeleton and
membrane trafficking.
VACUOLAR H+ -ATPases B SUBUNITS
Vacuolar H+ -ATPases (V-ATPases) are evolutionary-conserved SCAB1
multisubunit complexes that consist in a cytosolic ATP- Stomatal movement is driven by modifications in turgor pres-
hydrolyzing V1 subcomplex and a membrane-associated sure of the guard cells. Stomata open when the guard cell volume
proton-translocating V0 subcomplex (Nishi and Forgac, 2002; increases, and they close when the guard cell volume decreases.
Nelson, 2003; Ma et al., 2011). They mediate ATP-dependent It is well established that stomatal closure and opening involves
transport of protons across plasma and intracellular membranes reorganization of the actin cytoskeleton at the cell cortex and that
and thereby contribute to (1) the acidification of the lumen of such reorganization plays a key role in stomatal movement (e.g.,
various organelles such as vacuoles, secretory vesicles, endo- Kim et al., 1995; Eun and Lee, 1997; Liu and Luan, 1998; Hwang
somes, Golgi apparatus, and lysosomes and (2) the production and Lee, 2001; Lemichez et al., 2001; Macrobbie and Kurup, 2007;
of the energy required for various coupled transport processes. Choi et al., 2008; Gao et al., 2008). Recently, Higaki et al. (2010b)
Accordingly, V-ATPases are involved in a wide range of critical developed a novel quantitative image analysis method allow-
processes including membrane trafficking and fusion, and cell ing a more detailed and reliable characterization of the changes
expansion (Schumacher et al., 1999; Padmanaban et al., 2004; in actin configurations during the diurnal cycles of Arabidopsis
Dettmer et al., 2006; Brux et al., 2008). In mammals and yeast, guard cells. Data confirmed previous observations that actin fil-
both B and C subunits of the V1 subcomplex were previously aments adopt a well-organized and radial orientation in open
reported to directly bind to F-actin with high affinity (Lee et al., stomata and a more longitudinal orientation in closed stomata.
1999; Holliday et al., 2000; Vitavska et al., 2003, 2005; Chen et al., They also provide clear evidence that actin-bundling transiently
2004; Zuo et al., 2008). increases during stomatal opening, and drastically reduces once
Functional studies support that the actin binding activity of this process is completed. Interestingly, the abnormally thick and
V-ATPase B and C subunits is not involved in the regulation of V- long-lasting actin bundles induced by the expression of a mouse
ATPase assembly or activity. However, under stress conditions, it talin-derived actin reporter compromised stomatal opening. This
provides a significant survival advantage in yeast, supporting that is in good agreement with previous pharmacological and genetic
it is biologically relevant (Xu and Forgac, 2001; Zuo et al., 2008). studies indicating that changes in actin dynamics control stom-
In addition, several studies have highlighted that the targeting of atal movement (Kim et al., 1995; Liu and Luan, 1998; Dong et al.,
V-ATPases to specific sites relies on their interaction with the actin 2001; Lemichez et al., 2001; Macrobbie and Kurup, 2007).
cytoskeleton (Lee et al., 1999; Adams et al., 2006; Zuo et al., 2006). Higaki et al. (2010a,b) suggest that unbundling of actin bun-
Carnell et al. (2011) recently suggested a novel and elegant model dles (rather than their complete depolymerization; Liu and Luan,
in which nucleation-promoting factor WASH-dependent actin 1998) stimulates membrane trafficking and increases the num-
polymerization on mature lysosomes from Dictyostelium would ber of activated potassium channels in the plasma membrane,
sort V-ATPases to recycling vesicles, leading to subsequent lyso- which in turn promotes an increase of turgor pressure. In this
some neutralization and exocytosis. In the absence of WASH, no context, a novel plant-specific actin-bundling protein, termed
polymerization would occur and V-ATPases would remain on the STOMATAL CLOSURE-RELATED ACTIN BINDING PROTEIN
lysosome, which in turn would remain acidic and unable to exo- 1 (SCAB1), was isolated from a genetic screen aimed at identi-
cytose. Such a model assumes that the actin-binding activity of fying Arabidopsis mutants defective in stomatal movement (Zhao
V-ATPases functions as tags for actin-mediated sorting. et al., 2011). In vitro biochemical data revealed that SCAB1 is a
A similar mechanism in plant cells is plausible since homologs simple actin bundling protein unable to promote actin nucleation
of V-ATPases (Zimniak et al., 1988; Krebs et al., 2010), ARP2/3 or capping. Depletion of SCAB1 reduces actin filament stability,
complex and associated nucleation-promoting factors have been delays the switch from a radial to a longitudinal actin filament
identified (Deeks and Hussey, 2005; Szymanski, 2005). In addi- configuration in guard cells during stomatal closure, and reduces
tion, the three Arabidopsis V-ATPase B subunits (AtAVB1, stomatal closure sensitivity to abscisic acid, H2 O2 , and CaCl2 . In
AtVAB2, and AtVAB3) were recently shown to display direct contrast, the overexpression of SCAB1 increases actin filament
actin binding and bundling activities in vitro (Ma et al., 2012). stability and promotes excessive bundling. Both SCAB1 knockout

www.frontiersin.org August 2012 | Volume 3 | Article 188 | 38


Thomas Novel plant actin bundling proteins

and overexpressing lines exhibit a retardation of stomatal closure, The analysis of vln2vln3 double T-DNA insertion mutants sup-
suggesting that proper levels of SCAB1 and actin bundling are ports that AtVLN2 and AtVLN3 together play a major role in
required for normal stomatal movements. the generation of thick actin bundles in tissues other than pollen
Structural and domain analyses indicate that SCAB1 func- and root hairs, and that such bundles are involved in the regula-
tions as a single actin-binding domain protein that dimerizes tion of directional organ growth (van der Honing et al., 2012).
through its central coiled coils to achieve the bivalent organiza- Indeed, unlike single vln2 and vln3 mutants, double mutants
tion required for actin filament crosslinking (Zhang et al., 2012). exhibit much thinner actin bundles as compared to wild type
Contrary to some other ABPs, SCAB1 activities are insensitive plants, and develop twisted leaves, stems, siliques, and roots. Only
to pH and Ca2+ in vitro (Zhao et al., 2011). Nevertheless, the full-length AtVLN3, but not a truncated version lacking the head-
SCAB1 C-terminal pleckstrin homology domain was shown to piece region which is required for actin bundling in vitro, could
weakly bind to inositol phosphates, suggesting a possible SCAB1 rescue both actin and developmental phenotypes of vln2vln3 dou-
regulation by phosphoinositides at the cell membrane (Zhang ble mutants, supporting that villin-induced thick bundles are
et al., 2012). In addition to its potential impact on potassium required for proper regulation of coordinated cell expansion. It
channel density at the membrane of guard cells, actin bundling is noteworthy that cell shape and size and plant growth rates are
might also play a structural role in the control of the vacuolar similar in control and double mutant plants, indicating that cell
shape and volume. Indeed, the radial actin filament configura- expansion itself is unaffected. Surprisingly, another recent study,
tion in open stomata allows the vacuole to occupy a maximal which also focused on vln2vln3 double T-DNA insertion mutants
volume. In contrast, the long and heavy bundles spanning along (Bao et al., 2012), reported a morphological phenotype differ-
the longitudinal axis of the guard cells of closed stomata might ing from the one described by van der Honing et al. (2012). In
contribute to reduce the vacuole volume. Although the exact roles this study, the inflorescence stem of vln2vln3 seedlings developed
of actin bundles and the newly discovered actin bundling protein a pendent phenotype which was correlated to defects in scle-
SCAB1 in stomatal movement remain to be established, there is renchyma development (Bao et al., 2012). Although petioles were
accumulating evidence that they are central players. modestly twisted, this malformation was obviously milder than
the prominent twisted phenotype exhibited by various organs of
VILLINS van der Honings double mutants. Both the pendent and faint
Plant villins define a class of multifunctional ABPs which can twisted phenotypes of Baos double mutants could be rescued
combine several actin regulatory activities, including actin fila- by the expression of either VLN2 or VLN3. In addition, quan-
ment severing, barbed-end capping, and bundling activities. The titative analyses indicate that xylem fiber cells of double mutant
Arabidopsis genome contains five villin genes (AtVLN1-5), each inflorescence stems contain abnormally fine actin bundles, sup-
of which being highly expressed in a wide range of tissues (Klahre porting van der Honings conclusions that VLN2 and VLN3 work
et al., 2000; Huang et al., 2005). Whereas atypical AtVLN1 was as effective and functionally redundant actin-bundling proteins
reported to function as a simple and calcium-insensitive bundling in vitro. The morphological differences between the Bao and van
protein (Huang et al., 2005; Khurana et al., 2010), recent bio- der Honing phenotypes remain intriguing and might reflect the
chemical work supports that the rest of the family, including presence of truncated forms of VLN3 (the same vln2 mutant is
AtVLN2-5, retains the full set of typical villin activities and is used as a parental line in both studies) and/or the use of dissimilar
calcium-responsive (Khurana et al., 2010; Zhang et al., 2010, plant growth conditions.
2011b; Bao et al., 2012; van der Honing et al., 2012). The anal-
ysis of AtVLN4 and AtVLN5 loss-of-function mutants (Zhang LIM PROTEINS
et al., 2010, 2011b) confirmed the predicted roles of villins in Plant LIM proteins or LIMs (the acronym LIM derived from the
the formation and/or stabilization of the long actin bundles run- first letter of the three first identified LIM domain-containing
ning along the shank of pollen tubes and root hairs (e.g., Yokota proteins, namely LIN-11, ISl1, and MEC-3; Way and Chalfie,
et al., 1998, 2003; Tominaga et al., 2000; Ketelaar et al., 2002). 1988; Freyd et al., 1990; Karlsson et al., 1990) define a ubiqui-
These studies also further validated the primary role of such actin tous family of actin-bundling proteins. Since our first report on
bundles in the intracellular transport of organelles and vesicles tobacco NtWLIM1 describing the promotion of actin-bundle for-
in tip-growing cells (e.g., Miller et al., 1999; Sheahan et al., 2004; mation both in vitro and in live cells (Thomas et al., 2006, 2007),
Lovy-Wheeler et al., 2005; Ye et al., 2009). Interestingly, the fact several additional LIMs, including the six Arabidopsis AtLIMs
that beside their bundling activity, AtVLN4 and AtVLN5 possess (Papuga et al., 2010; Ye and Xu, 2012), lilium LlLIM1 (Wang et al.,
calcium-dependent actin severing and capping activities suggests 2008), and tobacco NtWLIM2 (Moes et al., 2012), were biochem-
that they also actively contribute to assembling and disassembling ically characterized and recognized as actin-bundling proteins.
the typical short actin bundle-based structures observed in the Contrary to formins and villins, no other actin-regulatory activity
subapical region of pollen tubes and root hairs (Zhang et al., 2010, has been attributed to any plant LIM protein so far, support-
2011b). As these structures remain at a constant distance from ing that they function as simple actin bundlers. In Papuga et al.
the growing cell tip, they inevitably undergo continuous cycles of (2010), we showed that the actin bundling activity of the three
disassembly/reassembly, a process which is thought to be primar- pollen-enriched Arabidopsis LIMs (AtPLIM2ac) is regulated by
ily regulated by changes in the concentration of ions including pH and calcium (AtPLIM2c), whereas that of the three widely-
[Ca+ ] and [H+ ], and reactive oxygen species (Holdaway-Clarke expressed LIMs (AtWLIM1, AtWLIM2a, and AtWLIM2b) is not.
and Hepler, 2003; Knight, 2007; Cheung and Wu, 2008). These data are particularly relevant considering the central roles

Frontiers in Plant Science | Plant Traffic and Transport August 2012 | Volume 3 | Article 188 | 39
Thomas Novel plant actin bundling proteins

previously proposed for pH and calcium gradients/oscillations fibers (Knoll et al., 2002; Kim-Kaneyama et al., 2005). It is there-
in the regulation of ABPs activities and cytoskeletal organiza- fore tempting to propose that plant LIMs function as sensors
tion during pollen tube elongation (Staiger et al., 2010). Using an able to perceive mechanical signals and to regulate in turn the
Arabidopsis cell suspension-based system, we could demonstrate mechanical properties of the cell by regulating gene expression
that the interaction of PLIMs with the actin cytoskeleton can be (Kawaoka et al., 2000; Kaothien et al., 2002) and remodeling the
specifically and reversibly inhibited by a controlled increase of the actin cytoskeleton. In addition, recent expression analyses have
intracellular pH (Papuga et al., 2010). Overexpression of LlLIM1 highlighted that a subset of poplar LIMs is up-regulated in ten-
modifies the actin cytoskeleton architecture in growing pollen sion wood (Arnaud et al., 2012), further indicating a connection
tubes of lily, disturbs endomembrane trafficking, including the between plant LIMs and mechanical stress. Such a hypothesis is
Golgi apparatus and endo/exocytic vesicles, and impairs normal currently tested in our lab.
targeting of signaling molecules, including phosphatidylinositol-
4,5-bisphosphate, phospholipase C, and diacyl glycerol (Wang FIMBRINS
et al., 2008). As an additional proof of the biological functions of Fimbrins (also known as plastins in humans) define an
LIMs in pollen, the partial co-suppression of the three AtPLIMs evolutionary-conserved family of actin bundling proteins whose
by an RNAi approach was recently shown to provoke important activities, biological functions, and roles in diseases have been
defects in pollen development and tube growth (Ye and Xu, 2012). extensively analyzed in animals/humans and yeast (e.g., Bretscher,
Beside their cytosplasmic functions, plant LIMs were repeat- 1981; Samstag and Klemke, 2007; Al Tanoury et al., 2010; Skau
edly reported to enter the nucleus, although their roles in this et al., 2011; Morley, 2012; Shinomiya, 2012). The Arabidopsis
compartment have been comparatively less studied (Mundel genome encodes five fimbrins (AtFIM1-5; Staiger and Hussey,
et al., 2000; Kawaoka and Ebinuma, 2001; Briere et al., 2003; 2004). Although the structural bases underlying the actin binding
Thomas et al., 2006; Papuga et al., 2010). One of the first and crosslinking activities of AtFIM1 were characterized in detail,
hints of the nuclear roles of plant LIMs was the identification only few studies have directly addressed the biological functions
of tobacco NtWLIM1 as a trans factor binding to a PAL-box of plant fimbrins (Kovar et al., 2000, 2001; Klein et al., 2004;
motif of the horseradish C2 peroxidase (prxC2) gene whose Wang et al., 2004). Wu et al. (2010) recently provided evidence
product is involved in phenylpropanoid biosynthesis (Kawaoka that pollen-enriched AtFIM5 is required for the proper organiza-
et al., 1992, 2000). Supporting the biological relevance of this tion of the actin cytoskeleton in pollen grains and growing pollen
finding, transgenic tobacco plants with an antisense NtWLIM1 tubes. The loss of AtFIM5 disorganizes the typical longitudinal
exhibited abnormally low levels of transcripts of several key configuration of actin bundles in the shank of the pollen tube
phenylpropanoid pathway genes as well as a 27% reduction in and causes some bundles to invade the extreme tip. Such aberrant
lignin content (Kawaoka et al., 2000; Kaothien et al., 2002). We cytoskeletal organization in turn alters the pattern and velocity of
recently evaluated the nuclear functions of the tobacco NtWLIM2 cytoplasmic streaming. Biochemical data revealed that AtFIM5 is
and found that NtWLIM2 can specifically and directly bind a calcium-insensitive actin bundling factor. Although the mecha-
to the conserved octamer cis-element of the histone AtH4A748 nism by which the loss-of-function of an actin-bundling protein
promoter and activate the corresponding promoter in live cell leads to an increase in actin bundles a the tip of pollen tubes
reporter-based experiments (Moes et al., 2012). Similar activi- remains obscure, together these data highlight an important role
ties were also shown for the Arabidopsis homolog of NtWLIM2, for FIM5 in maintaining the normal actin organization and/or
namely AtWLIM2a, whereas the more distant NtWLIM1 and dynamics in pollen tubes.
AtWLIM1 proteins were unable to bind to and to activate the
AtH4A748 promoter, suggesting a specialization of LIM protein SB401
subfamilies in their nuclear targets. SB401 is a pollen-specific protein from Solanum berthaultii (Liu
Like all the other plant LIMs previously characterized, et al., 1997) which was previously reported to bind to and bundle
NtWLIM2 decorates the actin cytoskeleton in live cells, and both microtubules and actin filaments and proposed to func-
binds to and bundles actin filaments in vitro (Moes et al., 2012). tion as a linker between microtubule and actin cytoskeletons
Interestingly, we observed that the NtWLIM2 nuclear fraction (Huang et al., 2007). In agreement with its higher in vitro affinity
readily increases after cell treatment with the F-actin disrupting for microtubules, SB401 was observed to preferentially inter-
drug latrunculin B, suggesting that the compartmentalization of act with the microtubule cytoskeleton in immunolabeled pollen
NtWLIM2 is modulated by the cytoskeletal status of the cell. It tubes. However, recent in vitro biochemical analyses support that
is noteworthy that the mammalian counterparts of plant LIMs, phosphorylation of SB401 by casein kinase II specifically inhibits
namely the cysteine-rich proteins (CRP1-3) were also reported SB401 microtubule regulatory activities, suggesting that phos-
to shuttle between the cytoplasm and the nucleus where they phorylation can switch the protein toward its actin regulatory
function as co-activators of genes involved in muscle differenti- function(s) (Liu et al., 2009). Future work should validate SB401
ation (Arber et al., 1994; Arber and Caroni, 1996; Kong et al., cytoskeleton regulatory activities in a live cell context and provide
1997; Chang et al., 2003, 2007). In addition, some data support an insight into its biological function(s) in potato pollen tubes.
that CRP3 translocates to the nucleus in response to mechani-
cal cues (Boateng et al., 2007, 2009) and that both CRP2 and AtADF9
CRP3 are involved in the stretch response and the regulation of Members of the ADF/cofilin family are well-established ABPs able
the cell contractile force through their interaction with actin stress to bind both actin monomers and filaments and whose main

www.frontiersin.org August 2012 | Volume 3 | Article 188 | 40


Thomas Novel plant actin bundling proteins

Table 1 | List of the actin bundling promoting proteins cited in this article.

Name Remarkable features Reported subcellular Identified or suggested Key references


locations biological functions

FORMINS
AtFH1 Non-processive formin; Cell membrane Pollen tube growth, cell Cheung and Wu, 2004;
anchors in the cell wall expansion Michelot et al., 2005, 2006;
Martiniere et al., 2011
AtFH3 Lacks in vitro actin bundling Nuclear envelope; cell plate Pollen tube growth polarity Ye et al., 2009
activity
AtFH4 Bundles both AFs and MTs; Cell membrane at cell-to-cell Cell expansion Deeks et al., 2005, 2010
AtFH4-GFP co-aligns the ER contacts; ER membrane
and MTs
AtFH5 In vitro actin bundling Growing cell plate; cell Cell cytokinesis; pollen tube Ingouff et al., 2005; Cheung
activity not reported so far membrane in the pollen growth et al., 2010
tube tip
AtFH8 AtFH8(FH1FH2) induces Cell membrane at cell-to-cell Primary root growth; lateral Deeks et al., 2005; Yi et al.,
stellar structures in vitro contacts; nuclear envelope root initiation; cell expansion 2005; Xue et al., 2011
and division
AtFH14 Bundles both AFs and MTs; Preprophase band; Cell division Li et al., 2010
crosslinks AFs and MTs phragmoplast
together
OsFH5 Bundles both AFs and MTs Chloroplast surface Cell expansion Yang et al., 2011; Zhang et al.,
2011a
AtTHRUMIN1 Light-dependent actin Cell membrane Chloroplast movement Whippo et al., 2011
bundling activity
AtAVB1-3 Part of the V-ATPase Endomembrane system Ma et al., 2012
multimeric complex
AtSCAB1 Dimerizes; likely regulated Cytoplasm Stomatal movement Zhao et al., 2011; Zhang et al.,
by phosphoinositides 2012
VILLINS
LlP-135-ABP and Ca2+ sensitive; bundle AFs Cytoplasm Direction of cytoplasmic Yokota et al., 1998, 2000,
LlP-115-ABP with uniform polarity streaming in pollen tubes 2003, 2005; Yokota and
and root hair cells Shimmen, 1999; Tominaga
et al., 2000
AtVLN1 Ca2+ insensitive; lacks Huang et al., 2005; Khurana
severing and capping et al., 2010
activities
AtVLN2 Ca2+ sensitive; has severing Cytoplasm Directional organ growth; Bao et al., 2012; van der
and capping activities Sclerenchyma development Honing et al., 2012
AtVLN3 Ca2+ sensitive; has severing Cytoplasm Directional organ growth; Khurana et al., 2010; Bao
and capping activities; can Sclerenchyma development et al., 2012; van der Honing
sever AtVLN1-induced et al., 2012
bundles in vitro
AtVLN4 Ca2+ sensitive; has severing Cytoplasm Root hair growth and Zhang et al., 2011b
and capping activities cytoplasmic streaming
AtVLN5 Ca2+ sensitive; has severing Cytoplasm Pollen tube growth Zhang et al., 2010
and capping activities
LIM PROTEINS
NtWLIM1 Interacts directly with DNA Cytoplasm; nucleus Gene expression (lignin Kawaoka et al., 2000;
biosynthesis) Kaothien et al., 2002; Thomas
et al., 2006, 2007
NtWLIM2 Interacts directly with DNA; Cytoplasm; nucleus Gene expression (Histones) Moes et al., 2012
dimerizes

(Continued)

Frontiers in Plant Science | Plant Traffic and Transport August 2012 | Volume 3 | Article 188 | 41
Thomas Novel plant actin bundling proteins

Table 1 | Continued

Name Remarkable features Reported subcellular Identified or suggested Key references


locations biological functions

AtWLIM1, 2a and b Ca2+ and pH insensitive Cytoplasm; nucleus Papuga et al., 2010
AtPLIM2a and b Only pH sensitive Cytoplasm; nucleus Pollen tube growth Papuga et al., 2010; Ye and Xu,
2012
AtPLIM2c Ca2+ and pH sensitive Cytoplasm; nucleus Pollen tube growth Papuga et al., 2010; Ye and Xu,
2012
LlLIM1 Ca2+ and pH sensitive Cytoplasm; nucleus Pollen tube growth Wang et al., 2008
FIMBRINS
AtFIM1 Ca2+ insensitive Cytoplasm Cytoplasmic streaming Kovar et al., 2000, 2001
AtFIM5 Ca2+ insensitive Cytoplasm Pollen tube germination and Wu et al., 2010
growth
OTHER ABP FAMILIES
Sb401 Bundles both AFs and MTs; Cytoplasm; cell cortex Huang et al., 2007; Liu et al.,
activity possibly switched 2009
toward actin bundling by
phosphorylation;
genus-specific protein
AtADF9 Expression induced by Cytoplasm; nucleus Gene expression (repression Burgos-Rivera et al., 2008;
hormones; lacks of flowering); development Tholl et al., 2011
conventional ADF AF
severing activity

In the column "Reported subcellular locations," the term "cytoplasm" means no association with any specific organelle. Note that, in some cases, the "Identified
or suggested biological functions" is not directly related to the actin bundling activity of the protein, e.g., nuclear functions. AFs, actin filaments; ER, endoplasmic
reticulum; MT, microtubules.

function is to increase actin dynamics (Staiger and Blanchoin, the thickness of actin fibers. Interestingly, similar data were
2006; Ono, 2007; Van Troys et al., 2008b; Bernstein and Bamburg, obtained with AtADF5 (unpublished data), the other member
2010). Whereas vertebrates typically possess three ADFs/cofilins, of Arabidopsis ADF subclass III. Future work should identify
plant ADF families are particularly large. Indeed, Arabidopsis the structural features responsible for the unconventional activ-
expresses 11 functional ADFs (AtADF1-11) which can be divided ities of subclass III ADFs, and compare the developmental and
into 5 subclasses according to their tissular expression and phy- actin cytoskeleton phenotypes of adf5 and adf9 mutants to those
logeny (Ruzicka et al., 2007). Recently, time-lapse TIRFM analyses recently reported for the knockout mutant of the conventional
provided direct evidence that subclass I AtADF1 and AtADF4 ADF AtADF4 (Henty et al., 2011).
sever actin filaments in vitro (Khurana et al., 2010; Henty et al., Table 1 lists the actin bundling proteins cited in the present
2011), an activity displayed by most animal, protozoa, and yeast article and emphasizes some of their important features.
ADFs/cofilins (e.g., Andrianantoandro and Pollard, 2006; Chan
et al., 2009). In agreement with these data and the role predicted CONCLUSIONS
for actin severing in the stochastic dynamics of plant actin fila- The growing number and diversity of actin-bundling proteins
ments (Michelot et al., 2007; Blanchoin et al., 2010; Staiger et al., identified in plants indicate that, like animals, plants elaborate
2010), Henty et al. (2011) established that Arabidopsis adf4 knock- various types of actin-bundles with specific structural features
out mutants exhibit a 2.5-fold reduced severing frequency as well and distinct functions (Table 1). This implies that the functions
as other characteristics of reduced actin dynamics in the cortical of actin bundles extend beyond the traditional definition of stable
region of hypocotyl epidermal cells. tracks for long distance intracellular transport. The characteriza-
We recently compared the biochemical activities of Arabidopsis tion of novel types of actin-bundling proteins points out potential
ADFs from different subclasses (unpublished data). We found functions for actin bundles in stomatal movement, ion chan-
that, contrary to other ADFs, subclass III AtADF9 is unable nel trafficking and/or activities, and chloroplast movement. In
to enhance actin depolymerization in vitro (Tholl et al., 2011). addition, actin bundles most likely play an important role in the
Instead, AtADF9 stabilizes and crosslinks actin filaments into regulation of hormone carriers cycling between plasma mem-
large bundles. By transiently expressing GFP-tagged and untagged brane and intracellular compartments (Nick, 2010). The specific
AtADF9 recombinant proteins in tobacco BY2 cells, we con- actin bundling proteins involved in this process as well as their
firmed the actin-bundling activity of AtADF9 in a live cell context. mode of regulation however remain to be identified.
Indeed, contrary to AtADF1 which induced many breaks in the Precise actin filament dynamics and organization near the
actin cytoskeleton, AtADF9 reduced the density and increased plant cell cortex have been resolved only recently, and the

www.frontiersin.org August 2012 | Volume 3 | Article 188 | 42


Thomas Novel plant actin bundling proteins

elucidation of the roles of actin filaments and bundles at this loca- contribution of formins to actin nucleation and bundling near
tion will keep researchers busy during the years to come. Future the cell cortex, and more generally to the actin stochastic dynam-
work should establish why epidermal plant cells keep their cortical ics, will be soon characterized. During the reviewing process of
actin network so dynamic and whether the other cell types do the the present article, a publication by Deeks et al. (2012) report-
same. A number of actin-bundling proteins reviewed in this arti- ing the identification of a novel and plant-specific superfamily of
cle support the existence of a physical linkage between actin bun- ABPs termed Networked (NET) was released. Localization analy-
dles and membranes. Among those, formins emerge as key mul- ses strongly suggest that the Arabidopsis NET proteins function as
tifunctional ABPs able to initiate polymerization and bundling linkers between the actin cytoskeleton and diverse types of mem-
of filaments from diverse types of subcellular locations includ- branes, including specific subdomains of the plasma membrane,
ing the cell membrane. Noticeably, the recent work by Martiniere the tonoplast and the nuclear membrane. There is no doubt that
et al. (2011) provides compelling evidence that the Arabidopsis such an exciting discovery will boost the field and contribute to a
formin AtAFH1 is anchored by its predicted extracellular domain better understanding of how AFs and actin bundles are coupled
within the cell wall and bridges the latter to the actin cytoskeleton. to membranes in plant cells.
A next important step consists in identifying the external sig-
nals that target the extracellular domain of class I formins and in ACKNOWLEDGMENTS
characterizing how such signals modulate the intracellular activ- Work in the authors lab is supported by the Ministry of Culture,
ities of formins. In addition, one can expect that, following the Higher Education, and Research and the National Research Fund
pioneering work on AtADF4 by Henty et al. (2011), the exact from Luxembourg (project: HUMCRP, C10/BM/784171).

REFERENCES G. (2012). Expression analysis of proteins orchestrates this very fast- Burgos-Rivera, B., Ruzicka, D. R., Deal,
Adams, D. S., Robinson, K. R., LIM gene family in poplar, toward paced game. Curr. Opin. Plant Biol. R. B., McKinney, E. C., King-Reid,
Fukumoto, T., Yuan, S., Albertson, an updated phylogenetic classifica- 13, 714723. L., and Meagher, R. B. (2008).
R. C., Yelick, P., Kuo, L., McSweeney, tion. BMC Res. Notes 5, 102. Blanchoin, L., and Staiger, C. J. (2008). ACTIN DEPOLYMERIZING
M., and Levin, M. (2006). Early, Avisar, D., Prokhnevsky, A. I., Plant formins: diverse isoforms FACTOR9 controls development
H+-V-ATPase-dependent proton Makarova, K. S., Koonin, E. V., and unique molecular mecha- and gene expression in Arabidopsis.
flux is necessary for consistent left- and Dolja, V. V. (2008). Myosin nism. Biochim. Biophys. Acta. 1803, Plant Mol. Biol. 68, 619632.
right patterning of non-mammalian XI-K is required for rapid traffick- 201206. Carnell, M., Zech, T., Calaminus, S. D.,
vertebrates. Development 133, ing of Golgi stacks, peroxisomes, Boateng, S. Y., Belin, R. J., Geenen, D. Ura, S., Hagedorn, M., Johnston, S.
16571671. and mitochondria in leaf cells L., Margulies, K. B., Martin, J. L., A., May, R. C., Soldati, T., Machesky,
Alexandersson, E., Saalbach, G., of Nicotiana benthamiana. Plant Hoshijima, M., De Tombe, P. P., and L. M., and Insall, R. H. (2011). Actin
Larsson, C., and Kjellbom, P. Physiol. 146, 10981108. Russell, B. (2007). Cardiac dysfunc- polymerization driven by WASH
(2004). Arabidopsis plasma Baluska, F., Jasik, J., Edelmann, H. tion and heart failure are associated causes V-ATPase retrieval and vesi-
membrane proteomics identi- G., Salajova, T., and Volkmann, with abnormalities in the subcel- cle neutralization before exocytosis.
fies components of transport, D. (2001). Latrunculin B-induced lular distribution and amounts of J. Cell Biol. 193, 831839.
signal transduction and membrane plant dwarfism: plant cell elonga- oligomeric muscle LIM protein. Am. Chan, C., Beltzner, C. C., and Pollard, T.
trafficking. Plant Cell Physiol. 45, tion is F-actin-dependent. Dev. Biol. J. Physiol. Heart Circ. Physiol. 292, D. (2009). Cofilin dissociates Arp2/3
15431556. 231, 113124. H259H269. complex and branches from actin
Al Tanoury, Z., Schaffner-Reckinger, Baluska, F., Samaj, J., Wojtaszek, Boateng, S. Y., Senyo, S. E., Qi, filaments. Curr. Biol. 19, 537545.
E., Halavatyi, A., Hoffmann, C., P., Volkmann, D., and Menzel, L., Goldspink, P. H., and Russell, Chang, D. F., Belaguli, N. S., Chang,
Moes, M., Hadzic, E., Catillon, M., D. (2003). Cytoskeleton-plasma B. (2009). Myocyte remodeling in J., and Schwartz, R. J. (2007). LIM-
Yatskou, M., and Friederich, E. membrane-cell wall continuum in response to hypertrophic stimuli only protein, CRP2, switched on
(2010). Quantitative kinetic study plants. Emerging links revisited. requires nucleocytoplasmic shut- smooth muscle gene activity in
of the actin-bundling protein L- Plant Physiol. 133, 482491. tling of muscle LIM protein. J. Mol. adult cardiac myocytes. Proc. Natl.
plastin and of its impact on actin Banno, H., and Chua, N. H. (2000). Cell. Cardiol. 47, 426435. Acad. Sci. U.S.A. 104, 157162.
turn-over. PLoS ONE 5:e9210. doi: Characterization of the arabidop- Bretscher, A. (1981). Fimbrin is a Chang, D. F., Belaguli, N. S., Iyer, D.,
10.1371/journal.pone.0009210 sis formin-like protein AFH1 and cytoskeletal protein that crosslinks Roberts, W. B., Wu, S. P., Dong,
Andrianantoandro, E., and Pollard, T. its interacting protein. Plant Cell F-actin in vitro. Proc. Natl. Acad. Sci. X. R., Marx, J. G., Moore, M. S.,
D. (2006). Mechanism of actin fil- Physiol. 41, 617626. U.S.A. 78, 68496853. Beckerle, M. C., Majesky, M. W.,
ament turnover by severing and Bao, C., Wang, J., Zhang, R., Zhang, B., Briere, C., Bordel, A. C., Barthou, and Schwartz, R. J. (2003). Cysteine-
nucleation at different concentra- Zhang, H., Zhou, Y., and Huang, H., Jauneau, A., Steinmetz, A., rich LIM-only proteins CRP1 and
tions of ADF/cofilin. Mol. Cell 24, S. (2012). Arabidopsis VILLIN2 Alibert, G., and Petitprez, M. CRP2 are potent smooth muscle dif-
1323. and VILLIN3 act redundantly in (2003). Is the LIM-domain pro- ferentiation cofactors. Dev. Cell 4,
Arber, S., and Caroni, P. (1996). sclerenchyma development via tein HaWLIM1 associated with 107118.
Specificity of single LIM motifs in bundling of actin filaments. Plant cortical microtubules in sunflower Chen, S. H., Bubb, M. R., Yarmola,
targeting and LIM/LIM interactions J. doi: 10.1111/j.1365-313X.2012. protoplasts? Plant Cell Physiol. 44, E. G., Zuo, J., Jiang, J., Lee, B. S.,
in situ. Genes Dev. 10, 289300. 05044.x. [Epub ahead of print]. 10551063. Lu, M., Gluck, S. L., Hurst, I. R.,
Arber, S., Halder, G., and Caroni, P. Bernstein, B. W., and Bamburg, J. R. Brux, A., Liu, T. Y., Krebs, M., Stierhof, and Holliday, L. S. (2004). Vacuolar
(1994). Muscle LIM protein, a novel (2010). ADF/cofilin: a functional Y. D., Lohmann, J. U., Miersch, O., H+-ATPase binding to microfil-
essential regulator of myogenesis, node in cell biology. Trends Cell Biol. Wasternack, C., and Schumacher, K. aments: regulation in response
promotes myogenic differentiation. 20, 187195. (2008). Reduced V-ATPase activity to phosphatidylinositol 3-kinase
Cell 79, 221231. Blanchoin, L., Boujemaa-Paterski, R., in the trans-Golgi network causes activity and detailed characteri-
Arnaud, D., Dejardin, A., Leple, J. C., Henty, J. L., Khurana, P., and Staiger, oxylipin-dependent hypocotyl zation of the actin-binding site
Lesage-Descauses, M. C., Boizot, N., C. J. (2010). Actin dynamics in plant growth Inhibition in Arabidopsis. in subunit B. J. Biol. Chem. 279,
Villar, M., Benedetti, H., and Pilate, cells: a team effort from multiple Plant Cell 20, 10881100. 79887998.

Frontiers in Plant Science | Plant Traffic and Transport August 2012 | Volume 3 | Article 188 | 43
Thomas Novel plant actin bundling proteins

Cheung, A. Y., Niroomand, S., Zou, Y., Higher Plants. Curr. Biol. doi: Fu, Y. (2010). The actin cytoskeleton vacuolar H+-ATPase contains a fil-
and Wu, H. M. (2010). A trans- 10.1016/j.cub.2012.06.041. [Epub and signaling network during pollen amentous actin binding site. J. Biol.
membrane formin nucleates sub- ahead of print]. tube tip growth. J. Integr. Plant Biol. Chem. 275, 3233132337.
apical actin assembly and controls Deeks, M. J., Cvrckova, F., Machesky, 52, 131137. Huang, S., Jin, L., Du, J., Li, H., Zhao,
tip-focused growth in pollen tubes. L. M., Mikitova, V., Ketelaar, T., Fu, Y., Gu, Y., Zheng, Z., Wasteneys, G., Q., Ou, G., Ao, G., and Yuan,
Proc. Natl. Acad. Sci. U.S.A. 107, Zarsky, V., Davies, B., and Hussey, and Yang, Z. (2005). Arabidopsis M. (2007). SB401, a pollen-specific
1639016395. P. J. (2005). Arabidopsis group interdigitating cell growth requires protein from Solanum berthaultii,
Cheung, A. Y., and Wu, H. M. (2004). Ie formins localize to specific cell two antagonistic pathways binds to and bundles microtubules
Overexpression of an Arabidopsis membrane domains, interact with with opposing action on cell and F-actin. Plant J. 51, 406418.
formin stimulates supernumerary actin-binding proteins and cause morphogenesis. Cell 120, 687700. Huang, S., Robinson, R. C., Gao,
actin cable formation from pollen defects in cell expansion upon aber- Gao, X. Q., Chen, J., Wei, P. C., L. Y., Matsumoto, T., Brunet, A.,
tube cell membrane. Plant Cell 16, rant expression. New Phytol. 168, Ren, F., and Wang, X. C. (2008). Blanchoin, L., and Staiger, C. J.
257269. 529540. Array and distribution of actin (2005). Arabidopsis VILLIN1 gen-
Cheung, A. Y., and Wu, H. M. (2008). Deeks, M. J., Fendrych, M., Smertenko, filaments in guard cells contribute erates actin filament cables that are
Structural and signaling networks A., Bell, K. S., Oparka, K., Cvrckova, to the determination of stom- resistant to depolymerization. Plant
for the polar cell growth machin- F., Zarsky, V., and Hussey, P. J. atal aperture. Plant Cell Rep. 27, Cell 17, 486501.
ery in pollen tubes. Annu. Rev. Plant (2010). The plant formin AtFH4 16551665. Humphrey, T. V., Bonetta, D. T., and
Biol. 59, 547572. interacts with both actin and Geiger, B., Spatz, J. P., and Bershadsky, Goring, D. R. (2007). Sentinels at
Choi, Y., Lee, Y., Jeon, B. W., microtubules, and contains a A. D. (2009). Environmental sensing the wall: cell wall receptors and sen-
and Staiger, C. J. (2008). newly identified microtubule- through focal adhesions. Nat. Rev. sors. New Phytol. 176, 721.
Phosphatidylinositol 3- and 4- binding domain. J. Cell Sci. 123, Mol. Cell Biol. 10, 2133. Hwang, J. U., and Lee, Y. (2001).
phosphate modulate actin filament 12091215. Hardham, A. R., Jones, D. A., and Abscisic acid-induced actin reorga-
reorganization in guard cells of Deeks, M. J., and Hussey, P. J. (2005). Takemoto, D. (2007). Cytoskeleton nization in guard cells of dayflower
day flower. Plant Cell Environ. 31, Arp2/3 and SCAR: plants move to and cell wall function in penetration is mediated by cytosolic calcium
366377. the fore. Nat. Rev. Mol. Cell Biol. 6, resistance. Curr. Opin. Plant Biol. levels and by protein kinase and
Chuong, S. D., Franceschi, V. R., 954964. 10, 342348. protein phosphatase activities. Plant
and Edwards, G. E. (2006). Deeks, M. J., Hussey, P. J., and Davies, Hardham, A. R., Takemoto, D., and Physiol. 125, 21202128.
The cytoskeleton maintains B. (2002). Formins: intermediates White, R. G. (2008). Rapid and Ingouff, M., Fitz Gerald, J. N., Guerin,
organelle partitioning required in signal-transduction cascades that dynamic subcellular reorganization C., Robert, H., Sorensen, M. B., Van
for single-cell C4 photosynthesis in affect cytoskeletal reorganization. following mechanical stimulation of Damme, D., Geelen, D., Blanchoin,
Chenopodiaceae species. Plant Cell Trends Plant Sci. 7, 492498. Arabidopsis epidermal cells mimics L., and Berger, F. (2005). Plant
18, 22072223. Dettmer, J., Hong-Hermesdorf, A., responses to fungal and oomycete formin AtFH5 is an evolutionarily
Ciobanasu, C., Faivre, B., and Le Stierhof, Y. D., and Schumacher, K. attack. BMC Plant Biol. 8, 63. conserved actin nucleator involved
Clainche, C. (2012). Actin dynamics (2006). Vacuolar H+-ATPase activ- Henty, J. L., Bledsoe, S. W., Khurana, P., in cytokinesis. Nat. Cell Biol. 7,
associated with focal adhesions. Int. ity is required for endocytic and Meagher, R. B., Day, B., Blanchoin, 374380.
J. Cell Biol. 2012, 941292. secretory trafficking in Arabidopsis. L., and Staiger, C. J. (2011). Kadota, A., Yamada, N., Suetsugu, N.,
Collings, D. (2008). Crossed-wires: Plant Cell 18, 715730. Arabidopsis actin depolymerizing Hirose, M., Saito, C., Shoda, K.,
interactions and cross-talk between Dong, C. H., Xia, G. X., Hong, Y., factor4 modulates the stochastic Ichikawa, S., Kagawa, T., Nakano,
the microtubule and microfil- Ramachandran, S., Kost, B., and dynamic behavior of actin filaments A., and Wada, M. (2009). Short
ament networks in plants, in Chua, N. H. (2001). ADF proteins in the cortical array of epidermal actin-based mechanism for light-
Plant Microtubules, Plant Cell are involved in the control of flow- cells. Plant Cell 23, 37113726. directed chloroplast movement in
Monographs, ed N. Peter (Berlin: ering and regulate F-actin organi- Higaki, T., Kojo, K. H., and Hasezawa, Arabidopsis. Proc. Natl. Acad. Sci.
Springer), 4779. zation, cell expansion, and organ S. (2010a). Critical role of actin U.S.A. 106, 1310613111.
Crowell, E. F., Bischoff, V., Desprez, growth in Arabidopsis. Plant Cell bundling in plant cell morphogen- Kaothien, P., Kawaoka, A., Ebinuma,
T., Rolland, A., Stierhof, Y. D., 13, 13331346. esis. Plant Signal. Behav. 5, 15. H., Yoshida, K., and Shinmyo, A.
Schumacher, K., Gonneau, M., Drobak, B. K., Franklin-Tong, V. E., Higaki, T., Kutsuna, N., Sano, T., (2002). Ntlim1, a PAL-box binding
Hofte, H., and Vernhettes, S. and Staiger, C. J. (2004). The role of Kondo, N., and Hasezawa, S. factor, controls promoter activity
(2009). Pausing of Golgi bodies on the actin cytoskeleton in plant cell (2010b). Quantification and cluster of the horseradish wound-inducible
microtubules regulates secretion signaling. New Phytol. 163, 1330. analysis of actin cytoskeletal struc- peroxidase gene. Plant Mol. Biol. 49,
of cellulose synthase complexes Eun, S. O., and Lee, Y. (1997). Actin fila- tures in plant cells: role of actin 591599.
in Arabidopsis. Plant Cell 21, ments of guard cells are reorganized bundling in stomatal movement Karlsson, O., Thor, S., Norberg, T.,
11411154. in response to light and abscisic during diurnal cycles in Arabidopsis Ohlsson, H., and Edlund, T. (1990).
Cvrckova, F. (2000). Are plant formins acid. Plant Physiol. 115, 14911498. guard cells. Plant J. 61, 156165. Insulin gene enhancer binding pro-
integral membrane proteins? Favery, B., Chelysheva, L. A., Lebris, Higaki, T., Kurusu, T., Hasezawa, S., tein Isl-1 is a member of a novel
Genome Biol. 1, RESEARCH001. M., Jammes, F., Marmagne, A., and Kuchitsu, K. (2011). Dynamic class of proteins containing both
Day, B., Henty, J. L., Porter, K. J., De Almeida-Engler, J., Lecomte, intracellular reorganization of a homeo- and a Cys-His domain.
and Staiger, C. J. (2011). The P., Vaury, C., Arkowitz, R. A., and cytoskeletons and the vacuole in Nature 344, 879882.
pathogen-actin connection: a Abad, P. (2004). Arabidopsis formin defense responses and hypersensi- Kasahara, M., Kagawa, T., Oikawa, K.,
platform for defense signaling in AtFH6 is a plasma membrane- tive cell death in plants. J. Plant Res. Suetsugu, N., Miyao, M., and Wada,
plants. Annu. Rev. Phytopathol. 49, associated protein upregulated 124, 315324. M. (2002). Chloroplast avoidance
483506. in giant cells induced by para- Holdaway-Clarke, T. L., and Hepler, movement reduces photodamage in
Deeks, M. J., Calcutt, J. R., Ingle, E. sitic nematodes. Plant Cell 16, P. K. (2003). Control of pollen plants. Nature 420, 829832.
K., Hawkins, T. J., Chapman, S., 25292540. tube growth: role of ion gradi- Kawaoka, A., and Ebinuma, H. (2001).
Richardson, A. C., Mentlak, D. Freyd, G., Kim, S. K., and Horvitz, H. ents and fluxes. New Phytol. 159, Transcriptional control of lignin
A., Dixon, M. R., Cartwright, F., R. (1990). Novel cysteine-rich motif 539563. biosynthesis by tobacco LIM pro-
Smertenko, A. P., Oparka, K., and and homeodomain in the prod- Holliday, L. S., Lu, M., Lee, B. S., tein. Phytochemistry 57, 11491157.
Hussey, P. J. (2012). A Superfamily uct of the Caenorhabditis elegans Nelson, R. D., Solivan, S., Zhang, L., Kawaoka, A., Kaothien, P., Yoshida,
of Actin-Binding Proteins at cell lineage gene lin-11. Nature 344, and Gluck, S. L. (2000). The amino- K., Endo, S., Yamada, K., and
the Actin-Membrane Nexus of 876879. terminal domain of the B subunit of Ebinuma, H. (2000). Functional

www.frontiersin.org August 2012 | Volume 3 | Article 188 | 44


Thomas Novel plant actin bundling proteins

analysis of tobacco LIM protein Kobayashi, I., Kobayashi, Y., and Liu, K., and Luan, S. (1998). Voltage- involved in actinbundling and
Ntlim1 involved in lignin biosyn- Hardham, A. R. (1994). Dynamic dependent K+ channels as targets histone gene transcription. Mol.
thesis. Plant J. 22, 289301. reorganization of microtubules and of osmosensing in guard cells. Plant Plant. doi: 10.1093/mp/SSS075.
Kawaoka, A., Sato, S., Nakahara, K., microfilaments in flax cells during Cell 10, 19571970. [Epub ahead of print].
Matsushima, N., Okada, N., Sekine, the resistance response to flax rust Lovy-Wheeler, A., Wilsen, K. L., Baskin, Morley, S. C. (2012). The actin-
M., Shinmyo, A., and Takano, M. infection. Planta 195, 237247. T. I., and Hepler, P. K. (2005). bundling protein L-plastin: a
(1992). Expression and promoter Kong, Y., Flick, M. J., Kudla, A. J., Enhanced fixation reveals the apical critical regulator of immune cell
activity of genes for isozymes of and Konieczny, S. F. (1997). Muscle cortical fringe of actin filaments as a function. Int. J. Cell Biol. 2012,
horseradish peroxidase. Plant Cell LIM protein promotes myogenesis consistent feature of the pollen tube. Article ID: 935173.
Physiol. 33, 11431150. by enhancing the activity of MyoD. Planta 221, 95104. Mundel, C., Baltz, R., Eliasson, A.,
Ketelaar, T., Faivre-Moskalenko, C., Mol. Cell. Biol. 17, 47504760. Ma, B., Qian, D., Nan, Q., Tan, Bronner, R., Grass, N., Krauter,
Esseling, J. J., De Ruijter, N. C., Kovar, D. R., Gibbon, B. C., McCurdy, C., An, L., and Xiang, Y. (2012). R., Evrard, J. L., and Steinmetz,
Grierson, C. S., Dogterom, M., and D. W., and Staiger, C. J. (2001). Arabidopsis vacuolar H+-ATPase A. (2000). A LIM-domain protein
Emons, A. M. (2002). Positioning Fluorescently-labeled fimbrin deco- (V-ATPase) B subunits are involved from sunflower is localized to the
of nuclei in Arabidopsis root rates a dynamic actin filament net- in actin cytoskeleton remodeling via cytoplasm and/or nucleus in a wide
hairs: an actin-regulated pro- work in live plant cells. Planta 213, binding to, bundling, and stabi- variety of tissues and is associated
cess of tip growth. Plant Cell 14, 390395. lizing F-actin. J. Biol. Chem. 287, with the phragmoplast in dividing
29412955. Kovar, D. R., Staiger, C. J., Weaver, E. A., 1900819017. cells. Plant Mol. Biol. 42, 291302.
Khurana, P., Henty, J. L., Huang, S., and McCurdy, D. W. (2000). AtFim1 Ma, B., Xiang, Y., and An, L. (2011). Nelson, N. (2003). A journey from
Staiger, A. M., Blanchoin, L., and is an actin filament crosslinking Structural bases of physiological mammals to yeast with vacuolar
Staiger, C. J. (2010). Arabidopsis protein from Arabidopsis thaliana. functions and roles of the vacuo- H+-ATPase (V-ATPase). J. Bioenerg.
VILLIN1 and VILLIN3 have over- Plant J. 24, 625636. lar H(+)-ATPase. Cell. Signal. 23, Biomembr. 35, 281289.
lapping and distinct activities Krebs, M., Beyhl, D., Gorlich, E., Al- 12441256. Nick, P. (2010). Probing the actin-auxin
in actin bundle formation and Rasheid, K. A., Marten, I., Stierhof, Macrobbie, E. A., and Kurup, S. (2007). oscillator. Plant Signal. Behav. 5,
turnover. Plant Cell 22, 27272748. Y. D., Hedrich, R., and Schumacher, Signalling mechanisms in the reg- 9498.
Kim, M., Hepler, P. K., Eun, S. O., Ha, K. (2010). Arabidopsis V-ATPase ulation of vacuolar ion release Nick, P., Han, M. J., and An, G. (2009).
K. S., and Lee, Y. (1995). Actin fil- activity at the tonoplast is required in guard cells. New Phytol. 175, Auxin stimulates its own transport
aments in mature guard cells are for efficient nutrient storage but 630640. by shaping actin filaments. Plant
radially distributed and involved in not for sodium accumulation. Martiniere, A., Gayral, P., Hawes, C., Physiol. 151, 155167.
stomatal movement. Plant Physiol. Proc. Natl. Acad. Sci. U.S.A. 107, and Runions, J. (2011). Building Nishi, T., and Forgac, M. (2002). The
109, 10771084. 32513256. bridges: formin1 of Arabidopsis vacuolar (H+)-ATPasesnatures
Kim-Kaneyama, J. R., Suzuki, W., Leckie, C. P., Callow, J. A., and Green, forms a connection between the most versatile proton pumps. Nat.
Ichikawa, K., Ohki, T., Kohno, Y., J. R. (1995). Reorganization of the cell wall and the actin cytoskeleton. Rev. Mol. Cell Biol. 3, 94103.
Sata, M., Nose, K., and Shibanuma, endoplasmic reticulum in pea leaf Plant J. 66, 354365. Oikawa, K., Kasahara, M., Kiyosue, T.,
M. (2005). Uni-axial stretching reg- epidermal cells infected by the pow- Michelot, A., Berro, J., Guerin, C., Kagawa, T., Suetsugu, N., Takahashi,
ulates intracellular localization of dery mildew fungus Erysiphe pisi. Boujemaa-Paterski, R., Staiger, C. F., Kanegae, T., Niwa, Y., Kadota, A.,
Hic-5 expressed in smooth-muscle New Phytol. 131, 211221. J., Martiel, J. L., and Blanchoin, and Wada, M. (2003). Chloroplast
cells in vitro. J. Cell Sci. 118, Lee, B. S., Gluck, S. L., and Holliday, L. L. (2007). Actin-filament stochastic unusual positioning1 is essential
937949. S. (1999). Interaction between dynamics mediated by ADF/cofilin. for proper chloroplast positioning.
Klahre, U., Friederich, E., Kost, B., vacuolar H(+)-ATPase and Curr. Biol. 17, 825833. Plant Cell 15, 28052815.
Louvard, D., and Chua, N. H. microfilaments during osteo- Michelot, A., Derivery, E., Paterski- Oikawa, K., Yamasato, A., Kong, S. G.,
(2000). Villin-like actin-binding clast activation. J. Biol. Chem. 274, Boujemaa, R., Guerin, C., Huang, Kasahara, M., Nakai, M., Takahashi,
proteins are expressed ubiquitously 2916429171. S., Parcy, F., Staiger, C. J., and F., Ogura, Y., Kagawa, T., and
in Arabidopsis. Plant Physiol. 122, Lemichez, E., Wu, Y., Sanchez, J. P., Blanchoin, L. (2006). A novel mech- Wada, M. (2008). Chloroplast outer
3548. Mettouchi, A., Mathur, J., and Chua, anism for the formation of actin- envelope protein CHUP1 is essen-
Klein, M. G., Shi, W., Ramagopal, U., N. H. (2001). Inactivation of AtRac1 filament bundles by a nonprocessive tial for chloroplast anchorage to
Tseng, Y., Wirtz, D., Kovar, D. R., by abscisic acid is essential for formin. Curr. Biol. 16, 19241930. the plasma membrane and chloro-
Staiger, C. J., and Almo, S. C. (2004). stomatal closure. Genes Dev. 15, Michelot, A., Guerin, C., Huang, S., plast movement. Plant Physiol. 148,
Structure of the actin crosslinking 18081816. Ingouff, M., Richard, S., Rodiuc, 829842.
core of fimbrin. Structure (Camb.) Li, Y., Shen, Y., Cai, C., Zhong, C., Zhu, N., Staiger, C. J., and Blanchoin, Ono, S. (2007). Mechanism of depoly-
12, 9991013. L., Yuan, M., and Ren, H. (2010). L. (2005). The formin homol- merization and severing of actin
Knight, M. R. (2007). New ideas on The type II Arabidopsis formin14 ogy 1 domain modulates the actin filaments and its significance in
root hair growth appear from the interacts with microtubules and nucleation and bundling activity of cytoskeletal dynamics. Int. Rev.
flanks. Proc. Natl. Acad. Sci. U.S.A. microfilaments to regulate cell divi- Arabidopsis FORMIN1. Plant Cell Cytol. 258, 182.
104, 2064920650. sion. Plant Cell 22, 27102726. 17, 22962313. Opalski, K. S., Schultheiss, H., Kogel,
Knoll, R., Hoshijima, M., Hoffman, Liu, B. Q., Jin, L., Zhu, L., Li, J., Miller, D. D., De Ruijter, N. C., K. H., and Huckelhoven, R. (2005).
H. M., Person, V., Lorenzen- Huang, S., and Yuan, M. (2009). Bisseling, T., and Emons, A. M. The receptor-like MLO protein and
Schmidt, I., Bang, M. L., Hayashi, Phosphorylation of microtubule- (1999). The role of actin in root the RAC/ROP family G-protein
T., Shiga, N., Yasukawa, H., Schaper, associated protein SB401 from hair morphogenesis: studies with RACB modulate actin reorganiza-
W., McKenna, W., Yokoyama, Solanum berthaultii regulates its lipochito-oligosaccharide as a tion in barley attacked by the
M., Schork, N. J., Omens, J. H., effect on microtubules. J. Integr. growth stimulator and cytochalasin biotrophic powdery mildew fungus
McCulloch, A. D., Kimura, A., Plant Biol. 51, 235242. as an actin perturbing drug. Plant J. Blumeria graminis f.sp. hordei. Plant
Gregorio, C. C., Poller, W., Schaper, Liu, J., Seul, U., and Thompson, R. 17, 141154. J. 41, 291303.
J., Schultheiss, H. P., and Chien, K. (1997). Cloning and characteriza- Moes, D., Gatti, S., Hoffmann, C., Padmanaban, S., Lin, X., Perera, I.,
R. (2002). The cardiac mechanical tion of a pollen-specific cDNA Dieterle, M., Moreau, F., Neumann, Kawamura, Y., and Sze, H. (2004).
stretch sensor machinery involves encoding a glutamic-acid-rich pro- K., Schumacher, M., Diederich, M., Differential expression of vacuolar
a Z disc complex that is defec- tein (GARP) from potato Solanum Grill, E., Shen, W. H., Steinmetz, H+-ATPase subunit c genes in tis-
tive in a subset of human dilated berthaultii. Plant. Mol. Biol. 33, A., and Thomas, C. (2012). A sues active in membrane traffick-
cardiomyopathy. Cell 111, 943955. 291300. LIM domain protein from tobacco ing and their roles in plant growth

Frontiers in Plant Science | Plant Traffic and Transport August 2012 | Volume 3 | Article 188 | 45
Thomas Novel plant actin bundling proteins

as revealed by RNAi. Plant Physiol. fimbrin highlights new features of in plant cells by rapidly depolymer- bundling in plants. Cell. Motil.
134, 15141526. a dynamic actin cytoskeleton in izing actin microfilaments. Curr. Cytoskeleton 66, 940957.
Papuga, J., Hoffmann, C., Dieterle, live plant cells. Plant Physiol. 136, Biol. 4, 215219. Tominaga, M., Yokota, E., Vidali, L.,
M., Moes, D., Moreau, F., Tholl, 39683978. Stevenson, R. P., Veltman, D., and Sonobe, S., Hepler, P. K., and
S., Steinmetz, A., and Thomas, Shinomiya, H. (2012). Plastin fam- Machesky, L. M. (2012). Actin- Shimmen, T. (2000). The role of
C. (2010). Arabidopsis LIM pro- ily of actin-bundling proteins: its bundling proteins in cancer pro- plant villin in the organization of
teins: a family of actin bundlers functions in leukocytes, neurons, gression at a glance. J. Cell Sci. 125, the actin cytoskeleton, cytoplasmic
with distinct expression patterns intestines, and cancer. Int. J. Cell 10731079. streaming and the architecture of
and modes of regulation. Plant Cell Biol. 2012, 213492. Suetsugu, N., Yamada, N., Kagawa, the transvacuolar strand in root hair
22, 30343052. Showalter, A. M., Keppler, B., T., Yonekura, H., Uyeda, T. Q., cells of Hydrocharis. Planta 210,
Paves, H., and Truve, E. (2007). Lichtenberg, J., Gu, D., and Welch, Kadota, A., and Wada, M. (2010a). 836843.
Myosin inhibitors block accumu- L. R. (2010). A bioinformatics Two kinesin-like proteins mediate Toth, R., Gerding-Reimers, C., Deeks,
lation movement of chloroplasts approach to the identification, actin-based chloroplast move- M. J., Menninger, S., Gallegos, R.
in Arabidopsis thaliana leaf cells. classification, and analysis of ment in Arabidopsis thaliana. M., Tonaco, I. A., Hubel, K., Hussey,
Protoplasma 230, 165169. hydroxyproline-rich glycoproteins. Proc. Natl. Acad. Sci. U.S.A. 107, P. J., Waldmann, H., and Coupland,
Peremyslov, V. V., Prokhnevsky, A. I., Plant Physiol. 153, 485513. 88608865. G. (2012). Prieurianin/endosidin
Avisar, D., and Dolja, V. V. (2008). Skau, C. T., Courson, D. S., Bestul, Suetsugu, N., Dolja, V. V., and Wada, 1 is an actin-stabilizing small
Two class XI myosins function in A. J., Winkelman, J. D., Rock, R. M. (2010b). Why have chloroplasts molecule identified from a chemical
organelle trafficking and root hair S., Sirotkin, V., and Kovar, D. R. developed a unique motility system? genetic screen for circadian clock
development in Arabidopsis. Plant (2011). Actin filament bundling by Plant Signal. Behav. 5, 11901196. effectors in Arabidopsis thaliana.
Physiol. 146, 11091116. fimbrin is important for endocy- Suetsugu, N., and Wada, M. (2007). Plant J. 71, 338352.
Petrasek, J., and Schwarzerova, K. tosis, cytokinesis, and polarization Chloroplast photorelocation move- Van Damme, D., Bouget, F. Y., Van
(2009). Actin and microtubule in fission yeast. J. Biol. Chem. 286, ment mediated by phototropin fam- Poucke, K., Inze, D., and Geelen,
cytoskeleton interactions. Curr. 2696426977. ily proteins in green plants. Biol. D. (2004). Molecular dissection of
Opin. Plant Biol. 12, 728734. Smertenko, A. P., Deeks, M. J., and Chem. 388, 927935. plant cytokinesis and phragmoplast
Pollard, T. D., Blanchoin, L., and Hussey, P. J. (2010). Strategies of Szymanski, D. B. (2005). Breaking structure: a survey of GFP-tagged
Mullins, R. D. (2000). Molecular actin reorganisation in plant cells. J. the WAVE complex: the point of proteins. Plant J. 40, 386398.
mechanisms controlling actin fila- Cell Sci. 123, 30193028. Arabidopsis trichomes. Curr. Opin. van der Honing, H. S., Kieft, H.,
ment dynamics in nonmuscle cells. Smith, L. G., and Oppenheimer, D. Plant Biol. 8, 103112. Emons, A. M., and Ketelaar, T.
Annu. Rev. Biophys. Biomol. Struct. G. (2005). Spatial control of cell Szymanski, D. B., and Cosgrove, D. (2012). Arabidopsis VILLIN2
29, 545576. expansion by the plant cytoskele- J. (2009). Dynamic coordination of and VILLIN3 are required for
Pollard, T. D., and Cooper, J. A. ton. Annu. Rev. Cell Dev. Biol. 21, cytoskeletal and cell wall systems the generation of thick actin fila-
(2009). Actin, a central player in cell 271295. during plant cell morphogenesis. ment bundles and for directional
shape and movement. Science 326, Sparkes, I. A., Teanby, N. A., and Curr. Biol. 19, R800 R811. organ growth. Plant Physiol. 158,
12081212. Hawes, C. (2008). Truncated Takemoto, D., Jones, D. A., and 14261438.
Ruzicka, D. R., Kandasamy, M. K., myosin XI tail fusions inhibit Hardham, A. R. (2006). Re- Van Troys, M., Vandekerckhove, J., and
McKinney, E. C., Burgos-Rivera, peroxisome, golgi, and mitochon- organization of the cytoskeleton Ampe, C. (2008a). Actin and actin-
B., and Meagher, R. B. (2007). The drial movement in tobacco leaf and endoplasmic reticulum in the binding proteins in cancer pro-
ancient subclasses of Arabidopsis epidermal cells: a genetic tool for Arabidopsis pen1-1 mutant inocu- gression and metastasis, in Actin-
actin depolymerizing factor genes the next generation. J. Exp. Bot. 59, lated with the non-adapted powdery Binding Proteins and Disease, Protein
exhibit novel and differential 24992512. mildew pathogen, Blumeria grami- Reviews, eds C. G. Dos Remedios
expression. Plant J. 52, 460472. Staiger, C. J., and Blanchoin, L. (2006). nis f. sp. hordei. Mol. Plant Pathol. and D. Chhabra (New York, NY:
Samstag, Y., and Klemke, M. (2007). Actin dynamics: old friends with 7, 553563. Springer), 229277.
Ectopic expression of L-plastin new stories. Curr. Opin. Plant Biol. Tholl, S., Moreau, F., Hoffmann, C., Van Troys, M., Huyck, L., Leyman, S.,
in human tumor cells: diagnostic 9, 554562. Arumugam, K., Dieterle, M., Moes, Dhaese, S., Vandekerkhove, J., and
and therapeutic implications. Adv. Staiger, C. J., and Hussey, P. J. (2004). D., Neumann, K., Steinmetz, A., and Ampe, C. (2008b). Ins and outs of
Enzyme Regul. 47, 118126. Actin and actin-modulating pro- Thomas, C. (2011). Arabidopsis ADF/cofilin activity and regulation.
Schmidt Von Braun, S., and Schleiff, teins, in The Plant Cytoskeleton actin-depolymerizing factors Eur. J. Cell Biol. 87, 649667.
E. (2008a). The chloroplast outer in Cell Differentiation and (ADFs) 1 and 9 display antag- Vicente-Manzanares, M., Ma, X.,
membrane protein CHUP1 inter- Development, ed P. J. Hussey onist activities. FEBS Lett. 585, Adelstein, R. S., and Horwitz, A. R.
acts with actin and profilin. Planta (Oxford, UK: Blackwell Publishing), 18211827. (2009). Non-muscle myosin II takes
227, 11511159. 3280. Thomas, C., Hoffmann, C., Dieterle, centre stage in cell adhesion and
Schmidt Von Braun, S., and Schleiff, E. Staiger, C. J., Poulter, N. S., Henty, M., Van Troys, M., Ampe, C., and migration. Nat. Rev. Mol. Cell Biol.
(2008b). Moving the green: CHUP1 J. L., Franklin-Tong, V. E., and Steinmetz, A. (2006). Tobacco 10, 778790.
and chloroplast movement-an Blanchoin, L. (2010). Regulation WLIM1 is a novel F-actin binding Vitavska, O., Merzendorfer, H.,
obvious relationship? Plant Signal. of actin dynamics by actin-binding protein involved in actin cytoskele- and Wieczorek, H. (2005). The
Behav. 3, 488489. proteins in pollen. J. Exp. Bot. 61, ton remodeling. Plant Cell 18, V-ATPase subunit C binds to
Schumacher, K., Vafeados, D., 19691986. 21942206. polymeric F-actin as well as to
McCarthy, M., Sze, H., Wilkins, Staiger, C. J., Sheahan, M. B., Khurana, Thomas, C., Moreau, F., Dieterle, M., monomeric G-actin and induces
T., and Chory, J. (1999). The P., Wang, X., McCurdy, D. W., and Hoffmann, C., Gatti, S., Hofmann, cross-linking of actin filaments. J.
Arabidopsis det3 mutant reveals Blanchoin, L. (2009). Actin filament C., Van Troys, M., Ampe, C., Biol. Chem. 280, 10701076.
a central role for the vacuolar dynamics are dominated by rapid and Steinmetz, A. (2007). The Vitavska, O., Wieczorek, H., and
H(+)-ATPase in plant growth growth and severing activity in the LIM domains of WLIM1 define Merzendorfer, H. (2003). A novel
and development. Genes Dev. 13, Arabidopsis cortical array. J. Cell a new class of actin bundling role for subunit C in mediating
32593270. Biol. 184, 269280. modules. J. Biol. Chem. 282, binding of the H+-V-ATPase to the
Sheahan, M. B., Staiger, C. J., Rose, R. J., Staiger, C. J., Yuan, M., Valenta, R., 3359933608. actin cytoskeleton. J. Biol. Chem.
and McCurdy, D. W. (2004). A green Shaw, P. J., Warn, R. M., and Lloyd, Thomas, C., Tholl, S., Moes, D., 278, 1849918505.
fluorescent protein fusion to actin- C. W. (1994). Microinjected pro- Dieterle, M., Papuga, J., Moreau, Wang, H. J., Wan, A. R., and Jauh, G.
binding domain 2 of Arabidopsis filin affects cytoplasmic streaming F., and Steinmetz, A. (2009). Actin Y. (2008). An actin binding protein,

www.frontiersin.org August 2012 | Volume 3 | Article 188 | 46


Thomas Novel plant actin bundling proteins

LlLIM1, mediates Ca and H regu- glucose-dependent dissociation Yokota, E., Vidali, L., Tominaga, M., and regulates stomatal movement
lation of actin dynamics in pollen of the yeast vacuolar [H+]- Tahara, H., Orii, H., Morizane, in Arabidopsis. Plant Cell 23,
tubes. Plant Physiol. 47, 16191636. ATPase in vitro. J. Biol. Chem. 276, Y., Hepler, P. K., and Shimmen, 23142330.
Wang, X. L., Gao, X. Q., and Wang, 2485524861. T. (2003). Plant 115-kDa actin- Zimniak, L., Dittrich, P., Gogarten, J.
X. C. (2011). Stochastic dynamics of Xue, X. H., Guo, C. Q., Du, F., Lu, Q. filament bundling protein, P-115- P., Kibak, H., and Taiz, L. (1988).
actin filaments in guard cells regu- L., Zhang, C. M., and Ren, H. Y. ABP, is a homologue of plant villin The cDNA sequence of the 69-
lating chloroplast localization dur- (2011). AtFH8 is involved in root and is widely distributed in cells. kDa subunit of the carrot vacuo-
ing stomatal movement. Plant Cell development under effect of low- Plant Cell Physiol. 44, 10881099. lar H+-ATPase. Homology to the
Environ. 34, 12481257. dose latrunculin B in dividing cells. Yokota, E., Tominaga, M., Mabuchi, beta-chain of F0F1-ATPases. J. Biol.
Wang, Y. S., Motes, C. M., Mol. Plant 4, 264278. I., Tsuji, Y., Staiger, C. J., Oiwa, Chem. 263, 91029112.
Mohamalawari, D. R., and Yang, W., Ren, S., Zhang, X., Gao, M., K., and Shimmen, T. (2005). Plant Zuo, J., Jiang, J., Chen, S. H., Vergara,
Blancaflor, E. B. (2004). Green Ye, S., Qi, Y., Zheng, Y., Wang, J., villin, Lily P-135-ABP, possesses S., Gong, Y., Xue, J., Huang, H.,
fluorescent protein fusions to Zeng, L., Li, Q., Huang, S., and G-actin binding activity and accel- Kaku, M., and Holliday, L. S. (2006).
Arabidopsis fimbrin 1 for spatio- He, Z. (2011). BENT UPPERMOST erates the polymerization and Actin binding activity of subunit B
temporal imaging of F-actin INTERNODE1 encodes the class II depolymerization of actin in a of vacuolar H+-ATPase is involved
dynamics in roots. Cell. Motil. formin FH5 crucial for actin organi- Ca2+-sensitive manner. Plant Cell in its targeting to ruffled mem-
Cytoskeleton 59, 7993. zation and rice development. Plant Physiol. 46, 16901703. branes of osteoclasts. J. Bone Miner
Way, J. C., and Chalfie, M. (1988). mec- Cell 23, 661680. Zhang, H., Qu, X., Bao, C., Khurana, Res. 21, 714721.
3, a homeobox-containing gene that Ye, J., and Xu, M. (2012). Actin bundler P., Wang, Q., Xie, Y., Zheng, Y., Zuo, J., Vergara, S., Kohno, S., and
specifies differentiation of the touch PLIM2s are involved in the regu- Chen, N., Blanchoin, L., Staiger, Holliday, L. S. (2008). Biochemical
receptor neurons in C. elegans Cell lation of pollen development and C. J., and Huang, S. (2010). and functional characterization of
54, 516. tube growth in Arabidopsis. J. Plant Arabidopsis VILLIN5, an actin the actin-binding activity of the
Whippo, C. W., Khurana, P., Davis, Physiol. 169, 516522. filament bundling and severing B subunit of yeast vacuolar H+-
P. A., Deblasio, S. L., Desloover, Ye, J., Zheng, Y., Yan, A., Chen, N., protein, is necessary for normal ATPase. J. Exp. Biol. 211, 11021108.
D., Staiger, C. J., and Hangarter, Wang, Z., Huang, S., and Yang, Z. pollen tube growth. Plant Cell 22,
R. P. (2011). THRUMIN1 is a (2009). Arabidopsis Formin3 directs 27492767.
light-regulated actin-bundling pro- the formation of actin cables and Zhang, W., Zhao, Y., Guo, Y., and Conflict of Interest Statement: The
tein involved in chloroplast motility. polarized growth in pollen tubes. Ye, K. (2012). Plant actin-binding author declares that the research
Curr. Biol. 21, 5964. Plant Cell 21, 38683884. protein SCAB1 is dimeric actin was conducted in the absence of any
Wightman, R., and Turner, S. R. Yi, K., Guo, C., Chen, D., Zhao, cross-linker with atypical pleckstrin commercial or financial relationships
(2008). The roles of the cytoskele- B., Yang, B., and Ren, H. (2005). homology domain. J. Biol. Chem. that could be construed as a potential
ton during cellulose deposition at Cloning and functional character- 287, 1198111990. conflict of interest.
the secondary cell wall. Plant J. 54, ization of a formin-like protein Zhang, Z., Zhang, Y., Tan, H., Wang,
794805. (AtFH8) from Arabidopsis. Plant Y., Li, G., Liang, W., Yuan, Z.,
Winder, S. J., and Ayscough, K. R. Physiol. 138, 10711082. Hu, J., Ren, H., and Zhang, D. Received: 03 July 2012; paper pending
(2005). Actin-binding proteins. J. Yokota, E., Takahara, K., and Shimmen (2011a). RICE MORPHOLOGY published: 19 July 2012; accepted: 01
Cell Sci. 118, 651654. Ki, T. T. (1998). Actin-bundling DETERMINANT encodes the type August 2012; published online: 24 August
Wu, Y., Yan, J., Zhang, R., Qu, X., Ren, protein isolated from pollen tubes II formin FH5 and regulates rice 2012.
S., Chen, N., and Huang, S. (2010). of lily. Biochemical and immunocy- morphogenesis. Plant Cell 23, Citation: Thomas C (2012) Bundling
Arabidopsis FIMBRIN5, an actin tochemical characterization. Plant 681700. actin filaments from membranes: some
bundling factor, is required for Physiol. 116, 14211429. Zhang, Y., Xiao, Y., Du, F., Cao, L., novel players. Front. Plant Sci. 3:188. doi:
pollen germination and pollen Yokota, E., and Shimmen, T. (1999). Dong, H., and Ren, H. (2011b). 10.3389/fpls.2012.00188
tube growth. Plant Cell 22, The 135-kDa actin-bundling Arabidopsis VILLIN4 is involved in This article was submitted to Frontiers in
37453763. protein from lily pollen tubes root hair growth through regulat- Plant Traffic and Transport, a specialty of
Xu, J. R., Staiger, C. J., and Hamer, J. E. arranges F-actin into bundles ing actin organization in a Ca(2+) Frontiers in Plant Science.
(1998). Inactivation of the mitogen- with uniform polarity. Planta 209, -dependent manner. New Phytol. Copyright 2012 Thomas. This is
activated protein kinase Mps1 from 264266. 190, 667682. an open-access article distributed under
the rice blast fungus prevents pene- Yokota, E., Muto, S., and Shimmen, Zhao, Y., Zhao, S., Mao, T., Qu, X., the terms of the Creative Commons
tration of host cells but allows acti- T. (2000). Calcium-calmodulin Cao, W., Zhang, L., Zhang, W., Attribution License, which permits use,
vation of plant defense responses. suppresses the filamentous actin- He, L., Li, S., Ren, S., Zhao, J., distribution and reproduction in other
Proc. Natl. Acad. Sci. U.S.A. 95, binding activity of a 135-kilodalton Zhu, G., Huang, S., Ye, K., Yuan, forums, provided the original authors
1271312718. actin-bundling protein isolated M., and Guo, Y. (2011). The and source are credited and subject to any
Xu, T., and Forgac, M. (2001). from lily pollen tubes. Plant Physiol. plant-specific actin binding protein copyright notices concerning any third-
Microtubules are involved in 123, 645654. SCAB1 stabilizes actin filaments party graphics etc.

Frontiers in Plant Science | Plant Traffic and Transport August 2012 | Volume 3 | Article 188 | 47
REVIEW ARTICLE
published: 11 December 2012
doi: 10.3389/fpls.2012.00274

Multiple roles for membrane-associated protein


trafcking and signaling in gravitropism
Allison K. Strohm1,2 , Katherine L. Baldwin1,2 and Patrick H. Masson1 *
1
Laboratory of Genetics, University of Wisconsin-Madison, Madison, WI, USA
2
Graduate Program in Cellular and Molecular Biology, University of Wisconsin-Madison, Madison, WI, USA

Edited by: Gravitropism is a process that allows plant organs to guide their growth relative to the
Markus Geisler, University of gravity vector. It requires them to sense changes in their orientation and generate a bio-
Fribourg, Switzerland
chemical signal that they transmit to the tissues that drive organ curvature. Trafcking
Reviewed by:
Stephanie Robert, Swedish University
between the plasma membrane and endosomal compartments is important for all of these
of Agricultural Sciences/Ume Plant phases of the gravitropic response. The sedimentation of starch-lled organelles called
Science Centre, Sweden amyloplasts plays a key role in sensing reorientation, and vacuolar integrity is required for
Nadine Paris, Centre National de la amyloplast sedimentation in shoots. Other proteins associated with the vesicle trafcking
Recherche Scientique, France
pathway contribute to early gravity signal transduction independently of amyloplast sedi-
*Correspondence:
Patrick H. Masson, Laboratory of
mentation in both roots and hypocotyls. Phosphatidylinositol signaling, which starts at the
Genetics, University of plasma membrane and later affects the localization of auxin efux facilitators, is a likely
Wisconsin-Madison, 425G Henry second messenger in the signal transduction phase of gravitropism. Finally, membrane-
Mall, Madison, WI 53706, USA. localized auxin inux and efux facilitators contribute to a differential auxin gradient across
e-mail: phmasson@wisc.edu
the gravistimulated organs, which directs root curvature.
Keywords: gravitropism, Arabidopsis, endomembrane, vacuole, trafficking, PIN, phosphatidylinositol, auxin
transport

INTRODUCTION TO GRAVITROPISM process. One possible model for signal perception involves the acti-
Gravitropism is a dynamic process that involves the perception vation of stretch-activated mechanosensitive ion channels within
of an organs abnormal orientation within the gravity eld, a membranes pressed upon by sedimenting amyloplasts (Leitz et al.,
transduction of the corresponding information into a biochemi- 2009). Alternatively, in the ligand-receptor model, the activation
cal signal, the transmission of this signal to a site of response, and of a transduction pathway occurs through productive interac-
organ curvature. Proper curvature therefore requires the coordi- tions between sedimenting plastid-borne molecules and receptors
nation of multiple cellular activities including signal transduction, associated with lower membranes (Braun, 2002). Lastly, in the
phytohormone transport, and cell expansion. Published work dis- hydrostatic pressure model, cellular machinery detects a pressure
cussed in this review, mostly on Arabidopsis, indicates that protein differential between the upper and lower sides of the statocytes
trafcking through the endomembrane system plays a critical role caused by the weight of the entire protoplast on the cell wall
in all of these processes. (Staves, 1997). There is also substantial evidence for root grav-
Gravitropism begins with signal perception. In Arabidopsis ity sensing outside of the columella cells that could involve an
roots, the specialized cells that sense gravity, or statocytes, are amyloplast-independent mechanism (Wolverton et al., 2002).
located in the root tips within the columella region of the cap Researchers have proposed that several secondary messengers
(Blancaor et al., 1998; Tsugeki and Fedoroff, 1999; Kiss, 2000); contribute to the signal transduction phase of gravitropism. For
in shoots, the endodermis contains the statocytes (Fukaki et al., example, Ca2+ changes occur in response to gravistimulation,
1998). Both root columella and shoot endodermal cells contain although studies have not found them in the columella cells (Pli-
dense, starch-lled amyloplasts that sediment to the lower sides of eth and Trewavas, 2002; Toyota et al., 2008). Cytosolic pH changes,
the statocytes upon gravistimulation (Caspar and Pickard, 1989; however, do occur in the columella cells upon gravistimulation,
Kiss et al., 1989; Leitz et al., 2009). After amyloplast sedimentation, and changing the pH alters the gravitropic response (Scott and
an auxin gradient is generated (part of the biochemical signal dis- Allen, 1999; Monshausen et al., 2011). Inositol 1,4,5-triphosphate
cussed above) and transmitted so that the auxin concentration on (InsP3 ) also appears to contribute to the formation of the auxin
the lower side of the organ is higher than the concentration along gradient possibly through a role in vesicle trafcking (Perera et al.,
its upper side (Ottenschlager et al., 2003). This typically promotes 1999; Wang et al., 2009).
downward curvature of roots and upward curvature of shoots In contrast to the signal perception phase of gravitropism, how
(Salisbury et al., 1988; Young et al., 1990). a plant generates, maintains, and transmits the auxin gradient, as
The steps connecting amyloplast sedimentation and auxin well as how this gradient dictates differential cell expansion, are
redistribution in the signal transduction phase of gravitropism better understood. The auxin efux facilitators PIN-FORMED
are still unclear, although several genes have been implicated in 3 (PIN3) and PIN7 show a distinct relocalization to the lower
this phase. The molecular and functional analysis of some of these side of the root cap columella cells in response to gravistimula-
genes has suggested roles for endomembrane trafcking in this tion that initiates the differential ow of auxin toward the lower

www.frontiersin.org December 2012 | Volume 3 | Article 274 | 48

fpls-03-00274 2012/12/8 13:20 page 1 #1


Strohm et al. Protein trafcking in gravitropism

ank of the root (Friml et al., 2002b; Kleine-Vehn et al., 2010). SGR8/GRV2/KAM2 is a DnaJ domain-containing peripheral
Other auxin transporters help to generate and propagate this gra- membrane protein that localizes to late endosomes (Silady et al.,
dient along the root, and protein trafcking is critical in this 2004, 2008). Lastly, SGR2 encodes a vacuole-localized protein
step. Auxin then may bind to one of two proposed auxin recep- homologous to the bovine testis phosphatidic acid-preferring
tor classes, the AUXIN-BINDING PROTEIN 1 (ABP1) receptor phospholipase A1 (PA-PLA1; Kato et al., 2002).
or the TRANSPORT-INHIBITOR-RESISTANT 1 (TIR1)/AUXIN
SIGNALING F-BOX (AFB) proteins. TIR1/AFB receptors bind sgr2, sgr3, sgr4, and sgr8 share reduced shoot gravitropic responses,
auxin in a complex with an Aux/indole-3-acetic acid (IAA) regu- abnormal amyloplast localization, and altered vacuole structures
latory protein, which is degraded upon auxin binding (Dharmasiri sgr2, sgr3, sgr4, and sgr8 mutants all exhibit strongly reduced shoot
et al., 2005; Kepinski and Leyser, 2005). This de-represses auxin- gravitropic responses but normal or slightly enhanced phototropic
response factors, which can then activate or suppress target genes and root gravitropic responses; sgr2 and sgr4 mutants also display
to cause differential cell expansion on the upper and lower sides very slow hypocotyl gravitropism (Fukaki et al., 1996b; Yamauchi
of roots and shoots. Although its mechanism of action is less clear, et al., 1997; Kato et al., 2002; Yano et al., 2003; Silady et al., 2004).
ABP1 is required for auxin responses at the plasma membrane and All of these mutants show a generally intact tissue structure con-
auxin-responsive gene expression changes, and it has been pro- sisting of a single layer of epidermis, three to four layers of cortex,
posed to coordinate cell division and cell expansion (Shi and Yang, and one layer of endodermis, although the sgr2, sgr4, and sgr8
2011). For more information on the overall gravitropic response, mutants show some pleiotropic phenotypes including altered cell
please see a recent review (Morita, 2010; Strohm et al., 2012). size and shape (Kato et al., 2002; Yano et al., 2003; Silady et al.,
2004). This suggests that these genes are likely to function directly
ENDOMEMBRANE SYSTEM COMPONENTS ARE IMPORTANT in gravitropism and do not simply have missing or disorganized
FOR GRAVITY PERCEPTION AND EARLY GRAVITY SIGNAL statocytes.
TRANSDUCTION In wild-type plants, amyloplasts in shoot endodermal cells are
Endomembrane system components are required for normal found sedimented on the lower sides of the cells (Morita et al.,
shoot and root gravitropism in Arabidopsis. Endocytotic pathways 2002). They are wrapped in thin, tunnel-like cytoplasmic layers
mediate the transport of proteins from the plasma membrane in surrounded by vacuolar membranes that are called transvacuo-
order to control their recycling via the endosome or their degra- lar strands, which pass through the vacuole and are connected
dation. Many proteins targeted to vacuoles are transported from to the peripheral cytoplasm. Amyloplasts can pass through these
the ER, to the Golgi, and then to the vacuole, although a Golgi- transvacuolar strands (Saito et al., 2005). However, in sgr2, sgr3,
independent pathway also exists. Furthermore, some endocytosed sgr4, and sgr8 mutants, the endodermal amyloplasts are found
plasma membrane proteins are also targeted to the vacuole. Pre- throughout both the upper and lower sides of the cells where they
vacuolar compartments (PVCs), also called multivesicular bodies localize outside of the vacuole (instead of within the transvacuo-
(MVBs), mediate Golgi or plasma membrane to vacuole transport. lar strands), often pressed against the cell periphery (Morita et al.,
For more information, see a recent review on this process (Reyes 2002; Yano et al., 2003; Silady et al., 2004). At least sgr2 and sgr4
et al., 2011). Genetic screens for shoot gravitropism mutants amyloplasts can be stained with potassium iodide, suggesting that
revealed a contribution of vesicular trafcking to vacuoles in grav- they do accumulate starch, although a few amyloplasts appeared
itropism. Similarly, a screen designed to nd compounds that to contain slightly less starch than wild-type (Morita et al., 2002).
reduced hypocotyl gravitropic responses identied several small Together, these data suggest that altered amyloplast localization,
molecules that link gravitropism and endomembrane trafck- rather than reduced starch accumulation, results in the abnormal
ing. Although characterization of the proteins that interact with gravitropic responses of these mutants.
these molecules is still underway, two of the compounds reduce sgr2, sgr3, sgr4, and sgr8 also all show altered vacuolar pheno-
gravitropic responses and disrupt the endomembrane system types. sgr2 and sgr4 both have aberrant vacuolar components in the
despite having no apparent effect on auxin, suggesting an auxin- cytoplasm, although these compartments differ between mutants
independent role for endomembrane trafcking in gravitropism (Morita et al., 2002). sgr3 vacuolar membranes form irregular
(Surpin et al., 2005). curves and do not properly surround the amyloplasts (Yano et al.,
2003). sgr8 mutants have irregularly shaped vacuoles and aggre-
VACUOLAR INTEGRITY IS ESSENTIAL FOR AMYLOPLAST gates of endosomes, which suggests that they might not properly
SEDIMENTATION IN SHOOTS fuse the tonoplast and vesicular membranes (Silady et al., 2008).
Four shoot gravitropism (sgr) mutants have been identied that
share similar phenotypes and suggest a connection between Golgi-to-vacuole targeting is critical for proper amyloplast
vacuole integrity, amyloplast sedimentation, and shoot gravit- localization in shoots
ropic responses. SGR3/VAM3 and SGR4/VTI11/ZIG are SNARES, SGR2, SGR3, SGR4, and SGR8 are all expressed in all tissues exam-
which are named for SNAP (soluble NSF attachment protein) ined, and at least for SGR2, SGR3, and SGR4, expression in the
receptors and are small proteins that mediate vesicle fusion. endodermis is sufcient to rescue the gravitropic defects of the
They are divided into vesicle-SNAREs (v-SNAREs), which are mutants (Zheng et al., 1999; Morita et al., 2002; Yano et al., 2003;
located on vesicle membranes, and target-SNARES (t-SNAREs), Silady et al., 2004). This indicates that these proteins contribution
which are located on target membranes. SGR3 is a t-SNARE to gravitropism occurs within the statocytes. In root cells, SGR4
(Sato et al., 1997), and SGR4 is a v-SNARE (Zheng et al., 1999). colocalizes with ELP, a vacuolar cargo receptor located on the

Frontiers in Plant Science | Plant Trafc and Transport December 2012 | Volume 3 | Article 274 | 49

fpls-03-00274 2012/12/8 13:20 page 2 #2


Strohm et al. Protein trafcking in gravitropism

trans-Golgi network, as well as with PEP12, a t-SNARE located phototropism, amyloplast starch accumulation, amyloplast sedi-
at the PVC (Zheng et al., 1999). Experiments have shown that mentation, responses to phytohormones, and responses to auxin
SGR4 can substitute for yeast Vti1p in vesicle transport from the transport inhibitors (Fukaki et al., 1997; Sedbrook et al., 1999;
Golgi to the PVC (Zheng et al., 1999). SGR3 localizes to the vac- Guan et al., 2003; Stanga et al., 2009). Although the specic molec-
uole or the PVC, and coimmunoprecipitation experiments suggest ular function of ARG1 and ARL2 remains unclear, these data
that it forms a complex with SGR4 (Yano et al., 2003). Similarly, suggest that they play a role in the early gravity signal trans-
SGR8 plays a role in trafcking from the PVC to the tonoplast duction steps that connect amyloplast sedimentation and auxin
(Silady et al., 2008). Together, these data suggest that trafck- redistribution.
ing from the Golgi to the vacuole plays an important role in
shoot and hypocotyl gravitropism, possibly by providing a cel- PHOSPHATIDYLINOSITOL SIGNALING MEDIATES VESICLE
lular environment that is favorable to amyloplast sedimentation TRAFFICKING, AUXIN GRADIENT FORMATION, AND THE
upon gravistimulation. GRAVITROPIC RESPONSE
The putative phospholipase SGR2 also localizes to vacuolar Phosphatidylinositol monophosphate 5-kinase (PIP5K) catalyzes
membranes (Morita et al., 2002). It is therefore possible that SGR3, the synthesis of phosphatidylinositol 4,5-bisphosphate (PIP2 ), a
SGR4, or SGR8 directly mediates the localization of SGR2 or that plasma membrane-localized phospholipid. PIP2 is then cleaved
another cargo protein transported by SGR3, SGR4, or SGR8 is by phospholipase C (PLC) to produce the second messenger
important for the localization or activity of SGR2. Alternatively, InsP3 , which diffuses throughout the cell, and diacylglycerol
SGR2 may contribute to gravitropism independently of SGR3, (DAG), which stays in the membrane. Inositol polyphosphate 5-
SGR4, and SGR8. While the exact function of SGR2 is still unclear, phosphatases (InsP 5-ptases) dephosphorylate InsP3 to stop its
it is possible that it mediates the degradation of phospholipids activity. In animals, InsP3 can trigger Ca2+ release from the ER
that dictate the composition of membranes in order to modify and the vacuole, and Ca2+ itself is another possible second messen-
their properties. This could consequently result in altered amy- ger in gravity signal transduction in plants (Plieth and Trewavas,
loplast sedimentation and slow gravitropic curvature. Another 2002; Monshausen et al., 2011). Additional research in both ani-
possibility is that cleavage of phospholipids by SGR2 creates signal- mals and plants has shown that PIP2 can bind actin-interacting
ing molecules required for gravitropism (Kato et al., 2002; Morita enzymes, endocytic and exocytic-related proteins, ion channels,
et al., 2002). and regulators of vesicle trafcking. Please see the following
Unlike amyloplasts in shoots, those in root columella cells are reviews for additional information (Wasteneys and Galway, 2003;
not enveloped in vacuolar membranes and move through the Haucke, 2005).
cytoplasm instead of within transvacuolar strands (Zheng and
Staehelin, 2001; Leitz et al., 2009). There is also no large central InsP3 MAY ACT AS A SECOND MESSENGER IN GRAVITROPISM
vacuole in columella cells like there is in shoot endodermal cells. SIGNALING
Consistent with these observations, none of the mutations iden- Multiple lines of evidence point to a role for phosphatidylinosi-
tied thus far as affecting root gravitropism have been associated tol signaling in gravity signal transduction. InsP3 levels increase
with defects in vacuolar biogenesis or function. threefold on both the upper and lower sides of gravistimulated oat
pulvini after only 15 s. Over the next 30 min, InsP3 uxes con-
SOME ENDOMEMBRANE SYSTEM-ASSOCIATED PROTEINS MEDIATE tinue, resulting in a threefold increase in the levels on the upper
EARLY GRAVITY SIGNAL TRANSDUCTION INDEPENDENTLY OF compared to the lower side. After about an hour, InsP3 returns
AMYLOPLAST SEDIMENTATION to its basal level (Perera et al., 2001). Several other observations
ALTERED RESPONSE TO GRAVITY 1 (ARG1/RHG) and its para- also support a role for InsP3 in gravitropism. Phosphatidylinositol
log ARG1-LIKE 2 (ARL2/GPS4) encode DnaJ-domain-containing 4-phosphate 5-kinase levels increase in the lower halves of grav-
peripheral membrane proteins that are necessary for full root istimulated pulvini, suggesting that PIP2 biosynthesis increases
and hypocotyl gravitropism (Fukaki et al., 1997; Sedbrook et al., in this region (Perera et al., 1999). Additionally, inhibiting PLC
1999; Boonsirichai et al., 2003; Guan et al., 2003; Luesse et al., also blocks the long-term InsP3 increase and reduces gravitropic
2010). GFP-ARG1 fusions localize to components of the vesi- bending (Perera et al., 2001). Some genes show InsP3 -dependent
cle trafcking pathway including the ER, the Golgi, and vesicles changes in expression in response to gravitropic and/or pho-
near the plasma membrane, as well as the cell plate. Addition- totropic stimuli, suggesting that this second messenger may play a
ally, upon treatment with brefeldin A (BFA), which disrupts key role in coordinating these two responses (Salinas-Mondragon
vesicle trafcking, cMyc-ARG1 accumulates in BFA-induced com- et al., 2010).
partments as do many proteins known to be associated with Arabidopsis inorescence stems can perceive a change in ori-
vesicle trafcking (Boonsirichai et al., 2003). ARG1 and ARL2 entation while at 4 C but cannot respond until after they are
are required for the relocalization of PIN3 to the new lower returned to room temperature (Fukaki et al., 1996a). InsP3 changes
sides of the columella cells upon gravistimulation, and at least are similar in plants gravistimulated at 4 C and at room temper-
ARG1 is required for the gravity-induced cytoplasmic alka- ature, and plants expressing a constitutively active InsP 5-ptase
linization of the columella cells. Both of these processes are show decreased bending after gravistimulation at 4 C and a subse-
important in generating an auxin gradient (Boonsirichai et al., quent return to room temperature (Perera et al., 2001, 2006). These
2003; Harrison and Masson, 2008). These genes are espe- results support the hypothesis that phosphatidylinositol signaling
cially interesting because arg1 and arl2 mutants display normal functions early in gravity signal transduction.

www.frontiersin.org December 2012 | Volume 3 | Article 274 | 50

fpls-03-00274 2012/12/8 13:20 page 3 #3


Strohm et al. Protein trafcking in gravitropism

PLANTS CARRYING MUTATIONS IN GENES ASSOCIATED WITH AUXIN TRANSPORT ACROSS CELL MEMBRANES RESULTS
PHOSPHATIDYLINOSITOL SIGNALING SHOW ALTERED IN AN AUXIN GRADIENT THAT DIRECTS DIFFERENTIAL
GRAVITROPIC AND AUXIN-RELATED PHENOTYPES CELL EXPANSION
PIP5K and InsP 5-ptases are each encoded by 15 genes in Ara- The major natural auxin, IAA, is a weak acid that can diffuse
bidopsis. pip5k2 seedlings have decreased PIP2 levels, and 5-ptase13 through membranes only when protonated (Rubery and Shel-
mutants are likely to have a decreased ability to dephospho- drake, 1974; Raven, 1975). The pH in the apoplast remains low,
rylate InsP3 (Wang et al., 2009; Mei et al., 2012). Therefore, and so a proportion of IAA molecules are protonated, which
it is not surprising that these mutants share many opposite allows them to diffuse across the membrane into the cytoplasm
phenotypes. pip5k2 seedlings respond slowly to gravity, while (Rubery and Sheldrake, 1974; Raven, 1975). Additional apoplas-
5-ptase13 mutants show an enhanced response (Wang et al., tic IAA can be actively imported by the AUX1 and LIKE-AUX1
2009; Mei et al., 2012). In agreement with this nding, plants (LAX) permeases and at least one ATP-binding cassette (ABC)
expressing a constitutively active InsP 5-ptase do not exhibit transporter/P-glycoprotein (PGP) (Marchant et al., 1999; Santelia
the characteristic InsP3 increase in response to gravistimulation et al., 2005; Yang et al., 2006; Yang and Murphy, 2009; Pret et al.,
and show decreased gravitropic bending (Perera et al., 2006). 2012). Once in the cytoplasm, far fewer IAA molecules are proto-
pip5k2 mutants are more sensitive to the polar auxin transport nated, being exposed to more neutral pH, and active auxin efux
inhibitor 1-N-naphthylphthalamic acid (NPA) than are wild- mediated by PIN proteins and some ABC transporters is required
type plants, which suggests impaired polar auxin transport in (Figure 1F). The polar localization of these proteins at the plasma
this mutant (Mei et al., 2012). In contrast, 5-ptase13 mutants membrane can dictate directional auxin transport within cell les
show a reduced response to NPA, which indicates increased (Wisniewska et al., 2006). In vertically growing roots, this results
polar auxin transport (Wang et al., 2009). Plants carrying the in the ow of auxin down the vasculature to the columella cells
constitutively active InsP 5-ptase also show decreased basipetal where it is redirected along the outer layers of the root in what is
auxin transport (Perera et al., 2006). Indeed, a greater percent- termed the reverse fountain model of auxin transport (Swarup and
age of 5-ptase13 mutants and a smaller percentage of pip5k2 Bennett, 2003). Upon gravistimulation, the PIN3 and PIN7 auxin
mutants generate an asymmetric auxin gradient in roots in efux carriers switch from a non-polar localization to a preferen-
response to gravistimulation compared to wild-type seedlings, tial distribution at the lower side of the plasma membrane (Friml
resulting in altered gravitropic phenotypes (Wang et al., 2009; Mei et al., 2002b; Kleine-Vehn et al., 2010). This causes auxin to accu-
et al., 2012). mulate in the lower sides of shoots and roots where it alters cell
expansion rates to cause organ curvature (Salisbury et al., 1988;
PHOSPHATIDYLINOSITOL SIGNALING AFFECTS VESICLE TRAFFICKING Young et al., 1990). Vesicle trafcking therefore plays a critical role
AND PIN PROTEIN TURNOVER in mediating this auxin gradient through its effects on the abun-
Phosphatidylinositol signaling is required for proper vesicle traf- dance, activity, and subcellular localization of auxin efux and
cking that leads to the establishment of an auxin gradient. PIN inux carriers. Membrane composition and differences in the sen-
auxin efux facilitators play important roles in controlling the sitivity of certain cells to auxin over time also inuence curvature
direction and rate of auxin uxes that allow for differential cell kinetics (Willemsen et al., 2003; Benjamins and Scheres, 2008).
expansion upon gravistimulation (see The PIN Family of Auxin
Efux Facilitators). Normally PIN proteins cycle between the THE PIN FAMILY OF AUXIN EFFLUX FACILITATORS
plasma membrane and endosomal compartments. This process There are eight PIN proteins in Arabidopsis, and at least ve of them
is sensitive to BFA and requires clathrin-mediated endocytosis function directly or indirectly in gravitropism. This is achieved
(Steinmann et al., 1999; Friml et al., 2002b; Geldner et al., 2003; through their asymmetric localization at the plasma membrane,
Dhonukshe et al., 2007; Kleine-Vehn et al., 2010). Compared to which can determine the direction of auxin ow (Wisniewska et al.,
wild-type, 5-ptase13 mutants have an increased ability to inter- 2006). These proteins often have overlapping functions; when one
nalize the endocytosis marker FM4-64, are less sensitive to BFA, protein is non-functional, auxin-dependent ectopic expression of
and show faster resumption of PIN1 and PIN2 polar localiza- other PIN proteins can sometimes compensate for the loss (Blilou
tion at the plasma membrane after BFA removal (Wang et al., et al., 2005; Vieten et al., 2005).
2009). In contrast, pip5k2 mutants show a decreased ability to
internalize FM4-64, increased sensitivity to BFA, slower recovery PIN proteins are required for the generation and propagation of the
after BFA removal, and decreased cycling of PIN2 and PIN3 (Mei gravity-induced auxin gradient
et al., 2012). The phosphatidylinositol-3-kinase (PI3K) inhibitor PIN1 localizes to the rootward sides of the cells that form the
wortmannin also results in altered PIN protein localization and vasculature whereas PIN4 localizes to the rootward sides of the
gravitropic defects (Jaillais et al., 2006; Kleine-Vehn et al., 2008). proximal meristem cells; the latter also shows non-polar local-
Together, these data indicate a role for phosphatidylinositol signal- ization in the columella cells (Friml et al., 2002a). These patterns
ing in vesicle trafcking that affects PIN protein turnover and the suggest that PIN1 and PIN4 play indirect roles in gravitropism
generation of the auxin gradient that is required for differential by contributing to auxin efux through the vasculature to the
cell elongation in response to a gravity stimulus. It remains possi- columella cells (Glweiler et al., 1998; Geldner et al., 2001; Friml
ble, however, that the 5-ptase13 and pip5k2 mutants have altered et al., 2002a). This is important for auxin to be transported to
membrane lipid composition, which is known to affect PIN cycling the root tip so that it can later be distributed laterally across
(Men et al., 2008). the cap and up to the elongation zones upon gravistimulation.

Frontiers in Plant Science | Plant Trafc and Transport December 2012 | Volume 3 | Article 274 | 51

fpls-03-00274 2012/12/8 13:20 page 4 #4


Strohm et al. Protein trafcking in gravitropism

FIGURE 1 | Cellular control of auxin carriers. (A) Phosphorylation by called GNOM, which removes the used GDP and allows fresh GTP to reload.
PINOID kinase and dephosphorylation by PP2A regulate PIN protein (E) Treating plants with BFA inhibits GNOM, which likely inactivates the ARF
localization. (B) PIN proteins are removed from the plasma membrane GTPase. As a result, PIN proteins accumulate in intracellular aggregates
through clathrin-mediated endocytosis into endocytic compartments. (C) PIN termed BFA bodies. (F) Auxin can be actively transported across the plasma
proteins may also be ubiquitylated and targeted to the vacuole via PVCs for membrane. PIN proteins are gradient-powered auxin efux carriers. Members
degradation. (D) Alternatively, following endocytosis PIN proteins may be of the ABC transporter family are ATP-driven and act as either auxin inux or
exocytosed in a selective, polar manner that requires the activity of an efux facilitators. AUX1 and its relative LAX are auxin inux carriers that use
unidentied ARF GTPase. The activity of the GTPase is controlled by a GEF an existing ion gradient to allow auxin into cells.

While mutations in PIN4 cause root meristem disorganization show gravitropism defects, and the pin3 pin7 double mutant shows
that makes it difcult to analyze their gravitropic responses, pin1 stronger defects than either single mutant (Friml et al., 2002b;
mutants have normal roots with no gravitropic defects, suggesting Kleine-Vehn et al., 2010).
that other PINs are able to compensate for the loss of this gene PIN2/EIR1/AGR1/WAV6 localizes to the shootward sides of lat-
(Friml et al., 2002a). eral root cap and epidermal cells where it plays a critical role in
In contrast, PIN3 and PIN7 may function immediately upon transporting auxin from the cap to the elongation zone both in ver-
gravistimulation to generate the initial auxin gradient across the tically growing roots and upon gravistimulation. It also localizes
cap. PIN3 is normally expressed in the upper S1 and S2 layers of to the rootward sides of the cortical cells in the meristem, where it
the columella cells, while PIN7 localizes to the S2 and S3 tiers. may play a negative regulatory role that allows for optimal auxin
However, PIN7 expands its expression into the S1 layer in pin3 uxes in this region (Mller et al., 1998; Blilou et al., 2005; Abas
mutants, suggesting its ability to compensate for the loss of PIN3 et al., 2006; Rahman et al., 2010). Here it may also contribute to
(Kleine-Vehn et al., 2010). In roots growing vertically, these pro- an auxin reux loop through the root epidermal and cortical cells
teins show a generally non-polar localization in the columella cells, in which the auxin maximum that forms on the lower side of the
but upon gravistimulation they are internalized and resorted into root is reinforced. pin2 mutants do not establish an auxin gradient
vesicles that direct them to the lower plasma membrane. This upon gravistimulation and therefore exhibit gravitropic defects
gravity-induced relocalization of the PIN3 and PIN7 proteins (Luschnig et al., 1998; Mller et al., 1998; Abas et al., 2006).
within the statocytes may be responsible for the development of
a lateral auxin gradient across the cap, with accumulation on the PIN protein regulation affects gravitropic responses
new lower side of the root (Friml et al., 2002b; Kleine-Vehn et al., PIN proteins can be regulated at the levels of transcription, protein
2010). Consistent with this conclusion, the pin3 and pin7 mutants stability, subcellular localization, and transport activity (Petrsek

www.frontiersin.org December 2012 | Volume 3 | Article 274 | 52

fpls-03-00274 2012/12/8 13:20 page 5 #5


Strohm et al. Protein trafcking in gravitropism

and Friml, 2009). Because auxin efux requires a membrane H+ endocytosis and targeting to the vacuole are normally triggered by
gradient and because PIN proteins do not have recognizable ATP- ubiquitylation (Figure 1C). However, in pin2 mutants in which
binding motifs, PIN proteins are thought to be gradient-driven six or more potential ubiquitylation sites are mutated, PIN2 is not
secondary transporters (Krecek et al., 2009). However, they can internalized and targeted to the vacuole upon gravistimulation.
act together with ATP-dependent ABC transporters when needed Therefore, PIN2 levels stay constant at the plasma membrane in
(Blakeslee et al., 2007). these mutants, and these seedlings do not form a robust auxin gra-
dient upon reorientation (Leitner et al., 2012). Short-term auxin
Guanine nucleotide exchange factors regulate PIN protein treatment also interferes with intracellular PIN2 accumulation,
localization. Intracellular trafcking is required for the polar but long-term treatment causes PIN2 internalization and degra-
localization of PIN proteins, which cycle between the plasma dation (Abas et al., 2006). This may reect a feedback mechanism
membrane and endosomal compartments (Steinmann et al., 1999; in which PIN2 is degraded after the auxin level reaches a threshold,
Figure 1B). GNOM is a GTPGDP exchange factor (GEF) for ADP preventing additional auxin transport and excessive root curva-
ribosylation factor (ARF) small G-proteins, which are important ture. Ubiquitylation could control the rate of PIN2 degradation in
for cargo selection and vesicle budding (Figure 1D). BFA binds this process.
to ARF-GEF/ARF-GDP complexes and prevents ARF activation BFA inhibits the targeting of PIN2 to the vacuole, which sug-
(Peyroche et al., 1999; Robineau et al., 2000). When this hap- gests the involvement of an ARF-GEF. However, plants expressing
pens, PIN1 and PIN3 endocytosis continues, but these proteins the BFA-resistant GNOM showed BFA-sensitive PIN2 vacuolar
are no longer secreted, causing them to accumulate in intra- targeting, indicating that the ARF-GEF of interest is not GNOM.
cellular compartments (Geldner et al., 2001; Kleine-Vehn et al., Like GNOM, SORTING NEXIN 1 (SNX1) localizes to endoso-
2010; Figure 1E). Therefore, BFA treatment blocks the relocaliza- mal compartments and is BFA-sensitive; however only SNX1 is
tion of PIN3 to the lower membrane upon reorientation, alters sensitive to the PI3K inhibitor wortmannin (Jaillais et al., 2006;
auxin transport, and reduces gravitropism (Geldner et al., 2001; Kleine-Vehn et al., 2008). snx1 mutants resemble weak allele gnom
Kleine-Vehn et al., 2010; Rahman et al., 2010). Plants expressing a mutants, and snx1 gnom double mutants show enhanced abnormal
BFA-resistant version of GNOM, however, show proper PIN1 and phenotypes compared to the single mutants (Jaillais et al., 2006).
PIN3 localization, robust auxin gradients after gravistimulation, This suggests that these genes function in different pathways but
and normal gravitropism even in the presence of BFA (Geldner contribute to some of the same developmental processes. Upon
et al., 2003; Kleine-Vehn et al., 2010). This conrms that GNOM wortmannin-treatment, PIN2 and SNX1 colocalize in compart-
regulates PIN1 and PIN3 localization and demonstrates that ARF- ments, and PIN2 levels at the plasma membrane are reduced in
GEFs can modulate certain endosomal trafcking routes. BFA also snx1 mutants (Jaillais et al., 2006; Kleine-Vehn et al., 2008). How-
partially affects PIN2 localization, suggesting that the gravitropic ever, SNX1 does not appear to directly mediate the localization or
defects associated with BFA treatment might not be due entirely recycling of PIN2 (Kleine-Vehn et al., 2008). Instead, wortmannin
to its effects on PIN1 and PIN3 (Geldner et al., 2003). likely causes PIN protein mislocalization through its interference
SPIKE1 (SPK1) acts as a GEF for Rho-like GTPase from Plants with sorting between the PVC and the Golgi (Matsuoka et al.,
6 (ROP6; Basu et al., 2008). In spk1 mutants, PIN2 levels at 1995). Proper PIN2 localization depends on its targeting to the
the plasma membrane are decreased. Consistent with this, spk1 vacuole where it is degraded, and wortmannin blocks this (Jaillais
mutants show a less robust auxin gradient upon reorientation and et al., 2006; Kleine-Vehn et al., 2008). Accordingly, long-term wort-
a slow gravitropic response (Lin et al., 2012). Plants carrying muta- mannin treatment results in phenotypes reminiscent of altered
tions in ROP6 or its effector ROP-INTERACTIVE CRIB MOTIF auxin transport, including defective root and hypocotyl gravit-
1 (RIC1) share some of these phenotypes, whereas ROP6 over- ropism (Jaillais et al., 2006). SNX1 may therefore contribute to
expression causes an increased gravitropic response (Chen et al., a feedback mechanism involved in PIN2 retrieval for recycling
2012; Lin et al., 2012). Normally auxin increases active ROP6 lev- through its ability to mediate PIN2 translocation from the PVC to
els, but this does not happen in spk1 mutants. Additionally, while the vacuole.
exogenous application of the synthetic auxin 1-naphthalene acetic PIN protein localization also depends on its phosphorylation
acid (1-NAA) normally prevents BFA-induced PIN2 accumula- state, which is mediated in part by the serine-threonine kinase
tion in internal BFA compartments, spk1, rop6, and ric1 mutants PINOID (PID) and type 2A protein phosphatase (PP2A), which
do not show this effect (Lin et al., 2012). These data suggest that act antagonistically (Michniewicz et al., 2007 Figure 1A). PP2A
SPK1, ROP6, and RIC1 inhibit PIN2 internalization through their subunits are encoded by multiple genes including ROOTS CURL
effects on auxin signaling. IN NPA 1 (RCN1). Plants that overexpress PID, rcn1 mutants,
and wild-type plants treated with the phosphatase inhibitor can-
Protein degradation, protein phosphorylation, and small pep- tharidin all show increased shootward auxin transport, delayed
tides also regulate PIN2 localization. PIN2 is also clearly auxin gradient formation upon gravistimulation, and randomized
regulated at the protein stability level. Upon gravistimulation, root growth; these phenotypes are rescued by blocking polar auxin
PIN2 is internalized and degraded preferentially on the upper transport (Christensen et al., 2000; Benjamins et al., 2001; Rashotte
side of the root, which is required for the generation of the et al., 2001). The elevated auxin transport in these plants probably
auxin gradient. When BFA or the proteasome inhibitor MG132 leads to auxin depletion in the root meristem, which prevents
is applied, this asymmetry is disrupted and PIN2 levels increase; auxin gradient formation (Benjamins et al., 2001; Rashotte et al.,
this correlates with gravitropism defects (Abas et al., 2006). PIN2 2001). This increased auxin transport is attributed to a rootward

Frontiers in Plant Science | Plant Trafc and Transport December 2012 | Volume 3 | Article 274 | 53

fpls-03-00274 2012/12/8 13:20 page 6 #6


Strohm et al. Protein trafcking in gravitropism

to shootward shift in the localization of some PIN proteins (Friml THE ABC TRANSPORTER FAMILY OF AUXIN EFFLUX AND INFLUX
et al., 2004). PINOID and RCN1 partially colocalize with PIN FACILITATORS
proteins and mediate the phosphorylation states of their cen- Members of the family of ATP-binding cassette (ABC) transporters
tral hydrophilic loops (Michniewicz et al., 2007). This means that couple ATP hydrolysis with the import and export of molecules
they can affect PIN2-mediated auxin uxes upon gravistimula- such as xenobiotics, ions, sugars, lipids, peptides, and hormones
tion (Shin et al., 2005). More specically, PP2A and a PINOID including auxin across cell membranes. There are several lines of
kinase family member are known to mediate the polar target- evidence that these proteins play critical roles in maintaining the
ing of PIN2 in meristematic cortical cells, which is necessary for auxin gradient that results in gravitropism.
a full gravitropic response (Rahman et al., 2010). These exper-
iments show that the phosphorylation status of PIN proteins ABC transporters regulate auxin uxes
affects their localizations and in turn their abilities to regulate Multiple pieces of evidence support a role for several ABC-
gravitropism. type transporters in auxin transport. First, the Arabidopsis
In addition to intracellular trafcking, protein degradation, PGP19/MDR1/ABCB19 protein and its closest relative ABCB1
and phosphorylation, a recent study suggests that small secre- directly act as auxin transporters when expressed in mammalian
tory peptides can also regulate PIN protein localization and affect and yeast cells as well as in protoplast assays (Geisler et al., 2005;
gravitropism. GOLVEN (GLV ) genes encode these peptides, and Yang and Murphy, 2009). Furthermore, abcb19 single mutants and
overexpression or knockdown of these genes generally results in to a greater extent abcb19 abcb1 double mutants show decreased
reduced root and hypocotyl gravitropism. Treatment with some of rootward auxin transport (Noh et al., 2001; Lewis et al., 2007).
these peptides, which act locally, also correlates with reduced auxin Similarly, plants carrying mutations in ABCB4/PGP4/MDR4,
gradient formation upon reorientation and results in gravitropic another ABC-type transporter with sequence similarity to ABCB1
defects. pin2 mutants are resistant to GLV peptide treatment, and and ABCB19, show decreased shootward auxin transport (Santelia
PIN2 levels increase in the membrane fractions of wild-type plants et al., 2005; Terasaka et al., 2005; Lewis et al., 2007).
treated with GLV peptides (Whitford et al., 2012). Therefore, it is Interestingly, ABCB1 shows a distinct polar localization in dif-
thought that the GLV peptides, along with auxin, mediate PIN2 ferent cell types at the upper edge of the distal elongation zone. In
trafcking in order to generate the auxin gradient necessary for the endodermal cells its localization is always shootward, and in
root curvature. the cortical cells it is most often shootward (Geisler et al., 2005).
A similar result was found for ABCB19 (Blakeslee et al., 2007). On
PIN proteins may promote growth in the organ curvature phase of the other hand, ABCB4 shows rootward localization in the epi-
gravitropism dermal cells at the upper edge of the distal elongation zone while
Auxin can inhibit the internalization of many PIN proteins and displaying apolar localization in S3 columella and adjacent root
prevent their constitutive cycling. This results in increased levels cap cells (Terasaka et al., 2005). These distinct localization pat-
of PIN proteins at the plasma membrane, and so auxin stimulates terns may help generate differential levels of auxin accumulation
its own efux from cells. After gravistimulation, the inhibition of in different cells.
endocytosis corresponds with the formation of the auxin gradient A phenotypic analysis of these mutants is also compatible
(Paciorek et al., 2005). Therefore, the increased level of plasma with a role for these proteins in auxin transport. Indeed, abcb19
membrane-associated PIN2 on the lower ank of gravistimulated and abcb19 abcb1 mutants show epinastic, or downward-folding,
roots may further enhance the auxin gradient. cotyledons and rst true leaves as do wild-type plants when treated
Auxin also triggers cell wall loosening that is necessary for cell with exogenous auxin (Noh et al., 2001). This is likely due to the
elongation during root curvature. In Arabidopsis, PIN1 mediates improper accumulation of auxin in the cotyledons. These mutants
local auxin accumulation, and its polar localization corresponds also show increased sensitivity to 1-NAA, decreased sensitivity
to the direction of mechanical stress in shoot apices (Heisler et al., to NPA, and decreased auxin-responsive DR5::GUS expression
2010). Work done in tomatoes shows that as tissue becomes more (Geisler et al., 2005; Lin and Wang, 2005).
strained during growth, PIN1 shows an increase in overall abun- Together, these studies strongly suggest that these transporters
dance and a preferential localization at the plasma membrane. help maintain proper auxin ow patterns, and additional work has
This contributes to auxin accumulation, which then promotes shown that interactions between ABC transporters and other pro-
growth in a feed-forward loop. One possible mechanism for this teins play important roles in this process. Genetic interactions have
is that local cell wall strain increases plasma membrane ten- been observed between ABCBs and PIN s, and coimmunoprecip-
sion, which promotes exocytosis and blocks endocytosis. This itation and yeast two-hybrid experiments have shown that both
could increase the amount of membrane-localized PIN1 relative ABCB1 and ABCB19 interact with PIN1 (Blakeslee et al., 2007).
to cytoplasmically-localized PIN1, although more complex models Additionally, abcb19 and especially abcb19 abcb1 mutants show
are also possible (Nakayama et al., 2012). It is possible that a similar diffuse, punctate, and discontinuous PIN1 localization, which
process takes place upon gravistimulation, although this has not is likely to result in randomized directions of auxin efux (Noh
yet been addressed experimentally. For example, tissue strain et al., 2003). Heterologous coexpression studies have also shown
during curvature could increase plasma membrane-localized PIN2 that the rate of auxin transport is increased when these proteins
levels on the lower side of the root. This would increase the auxin colocalize compared to when only one of them is present. In con-
concentration in this region and further inhibit curvature in a trast, when PIN2 and either ABCB1, ABCB4, or ABCB19 are
feed-forward manner. coexpressed in HeLa cells, IAA efux decreases when compared

www.frontiersin.org December 2012 | Volume 3 | Article 274 | 54

fpls-03-00274 2012/12/8 13:20 page 7 #7


Strohm et al. Protein trafcking in gravitropism

to when only one protein is expressed (Blakeslee et al., 2007). the auxin inux carriers AUX1 and LAX can also actively import
AGC kinases also mediate both PIN protein polarity and the auxin IAA (Marchant et al., 1999; Yang et al., 2006; Yang and Mur-
efux activity of ABCB1 and ABCB19, suggesting that they reg- phy, 2009; Pret et al., 2012). Active auxin inux into particular
ulate crosstalk between these auxin transporters (Christie et al., cells might maintain proper auxin uxes by counteracting auxin
2011; Henrichs et al., 2012). From these experiments, it appears diffusion into other cells. aux1, but not lax, mutants are agravit-
that the ABC transporters and PIN proteins function separately ropic, suggesting functional specialization within this gene family
but synergistically to provide both the specicity and the high rate (Bennett et al., 1996; Pret et al., 2012). Because aux1 mutants
of long-distance auxin transport. are defective in active auxin uptake, they are therefore resis-
Additionally, the immunophilin-like integral membrane tant to exogenous IAA and the auxin 2,4-dichlorophenoxyacetic
protein required for brassinosteroid perception or signaling, acid (2,4-D), but not 1-NAA, which can diffuse easily through
TWISTED DWARF 1, interacts with both ABCB1 and ABCB19 membranes (Maher and Martindale, 1980; Bennett et al., 1996).
(Geisler et al., 2003). twd1 mutants exhibit epinastic cotyledons Similarly, 1-NAA, but not 2,4-D, rescues the aux1 agravitropic
and a strong reduction in polar auxin transport like abcb1 abcb19 root phenotype (Marchant et al., 1999). It is likely that 1-NAA
double mutants, suggesting that ABCB1 and ABCB19 form a com- is taken up by the root and redirected by an auxin efux facil-
plex with TWD1 (Geisler et al., 2003). It is possible that TWD1 itator such as PIN2, which is expressed in the cortical and
regulates the transport activity of ABCB1 and ABCB19 or that it epidermal root tip cells like AUX1 (Mller et al., 1998; Marchant
mediates ABCBPIN interactions. et al., 1999).
AUX1 functions in the signal transmission and curvature
ABC transporters are required for normal gravitropic responses response phases, not the perception phase, of gravitropism. This is
Several experiments show that ABC transporters function in suggested by its expression in the regions of the root that respond
the auxin transport phase of gravitropism. Interestingly, abcb19 to gravity (Marchant et al., 1999). Consistent with this result,
hypocotyls respond to gravistimulation twice as quickly as wild- AUX1 expression in only the lateral root cap and epidermal cells
type plants, and they also exhibit an enhanced phototropic is sufcient to rescue the aux1 agravitropic phenotype (Swarup
response (Noh et al., 2003). Similarly, the abcb4 mutant shows et al., 2005). This suggests that AUX1 contributes to gravitropism
a faster root gravitropic response than wild-type plants (Lewis by facilitating shootward auxin transport from the root cap to the
et al., 2007). Experiments using the auxin-responsive DR5::GUS elongation zone (Swarup et al., 2005).
construct showed that these mutants form a more robust asym- AUX1 also affects pH changes upon gravistimulation, suggest-
metric auxin gradient across the root tip than wild-type plants ing a relationship between pH and auxin in gravitropism. Shortly
(Lin and Wang, 2005; Lewis et al., 2007). The altered auxin efux after reorientation, wild-type roots show a decrease in pH on
may therefore result in a steeper, although transient, auxin gra- the upper side of the extracellular root surface and an increase
dient upon gravistimulation. One possible explanation for this on the lower side; this gradient occurs in the root cap as well
comes from studies showing that PIN2 mRNA levels decrease with as throughout the elongation zone (Monshausen et al., 2011). It
distance from the root tip, while ABCB4 mRNA levels increase might contribute to cell wall loosening to allow for cell expan-
(Birnbaum et al., 2003). If this correlates with their contribu- sion or even to signal transmission itself. aux1 mutants, however,
tions to auxin transport, the reduced shootward auxin transport do not show this pH change. In fact, even when growing verti-
as a result of the loss of ABCB19 or ABCB4 may cause auxin cally, aux1 mutant extracellular root surfaces are uniformly acidic
buildup in the elongation zone where it leads to an enhanced instead of showing dynamic pH uctuations like wild-type roots.
curvature response (Lewis et al., 2007). Surprisingly, despite the Both the pH gradient and the pH dynamics are rescued by intro-
large reduction in rootward auxin transport, root gravitropic ducing AUX1 into only the lateral root cap and epidermal cells
responses of abcb19 mutants are normal (Lewis et al., 2007). This (Monshausen et al., 2011). It is possible that the pH gradient con-
could be due to compensation by other ABC transporters or PIN tributes to feedback mechanisms that regulate the gravity response
proteins. by affecting AUX1-mediated auxin uptake.
A screen for compounds that reduce hypocotyl gravitropic
responses identied a molecule called Gravacin that also causes CONCLUSION
decreased auxin sensitivity, decreased auxin transport, and Upon gravistimulation, amyloplasts sediment to the lower sides
endomembrane system defects (Surpin et al., 2005; Rojas-Pierce of the statocytes. In endodermal cells, SGR proteins play a key
et al., 2007). Subsequent work showed that abcb19 and twd1, but role in this process by maintaining vacuolar membrane integrity.
not abcb1, are resistant to Gravacin (Rojas-Pierce et al., 2007). The amyloplasts then trigger a signal transduction cascade that
Gravacin targets ABCB19 and disrupts the ABCB19PIN1 com- may involve protons, calcium, and phosphatidylinositol signaling,
plexes, thereby interfering with their auxin transport activity which begins at the plasma membrane. Phosphatidylinositol sig-
(Rojas-Pierce et al., 2007). Using Gravacin to perturb ABCB19 naling affects the cycling of auxin transporters, and changes in
but not PIN proteins may be useful in further characterizing the their localization at the plasma membrane cause auxin to accu-
role of ABC transporters in auxin uxes and gravitropism. mulate in the lower side of the root and shoot. Here it affects cell
elongation and causes the plant to realign itself with the gravity
THE AUX AND LAX FAMILY OF AUXIN IMPORT CARRIER PROTEINS vector (Figure 2).
In addition to auxin efux, auxin ow into cells also contributes Therefore, through their roles in amyloplast sedimentation,
to the auxin gradient. While auxin inux can occur by diffusion, phosphatidylinositol signaling, and auxin carrier localization,

Frontiers in Plant Science | Plant Trafc and Transport December 2012 | Volume 3 | Article 274 | 55

fpls-03-00274 2012/12/8 13:20 page 8 #8


Strohm et al. Protein trafcking in gravitropism

FIGURE 2 | Gravitropism overview. The steps of gravitropism are shown to activate signal transduction through second messengers, possibly
down the center core of the diagram. During plant reorientation, a plant calcium ions or protons. Another second messenger is InsP3 , which is
is rotated relative to the gravity vector. This results in the sedimentation produced by cleavage of the phospholipid, PIP2 . In a process that is not
of dense amyloplasts within the statocytes. In roots the statocytes are completely understood, the second messengers activate the
the columella cells, whereas in stems they are the endodermal cells. relocalization of auxin transporters, such as PIN3 and PIN7 in the
Each endodermal cell contains a large vacuole, and the amyloplasts columella cells. The new polarized distribution of these auxin efux carriers
must traverse it by tunneling through transvacuolar strands in order to changes the ow of auxin throughout the plant. This differential auxin
reach the new lower side of the cell. This requires proper vacuole structure, transport affects cell elongation rates, thereby resulting in organ curvature as
which the SGR proteins mediate. Amyloplast sedimentation is then thought the plant grows.

membranes contribute in multiple ways to all phases of gravit- ACKNOWLEDGMENTS


ropism. The evolution of these complex processes allows plants to This review was made possible due to grants to Patrick H. Mas-
adapt to changing environments and to integrate their responses son from the National Science Foundation (#IOS-0821884 and
to gravity with those to a wide variety of other stimuli includ- #IOS-1121694) and the College of Agricultural and Life Sciences
ing touch and moisture gradients. Future work in this area will HATCH program. Allison K. Strohm is supported by a National
continue to clarify how membrane-associated signaling and traf- Science Foundation Graduate Research Fellowship. We thank
cking contribute to gravitropism and other areas of plant growth Sebastian Bednarek and Marisa Otegui for their helpful comments
and development. on the manuscript.

REFERENCES by enhancing polar auxin transport. B., Sauer, M., et al. (2007). Inter- modulates gravity-induced cytoplas-
Abas, L., Benjamins, R., Malenica, Development 128, 40574067. actions among PIN-FORMED and mic alkalinization and lateral auxin
N., Paciorek, T., Wisniewska, J., Benjamins, R., and Scheres, B. (2008). P-glycoprotein auxin transporters in transport in plant statocytes. Plant
Wirniewska, J., et al. (2006). Intra- Auxin: the looping star in plant devel- Arabidopsis. Plant Cell 19, 131147. Cell 15, 26122625.
cellular trafcking and proteolysis opment. Annu. Rev. Plant Biol. 59, Blancaor, E. B., Fasano, J. M., and Braun, M. (2002). Gravity perception
of the Arabidopsis auxin-efux facil- 443465. Gilroy, S. (1998). Mapping the func- requires statoliths settled on specic
itator PIN2 are involved in root Bennett, M. J., Marchant, A., Green, tional roles of cap cells in the response plasma membrane areas in characean
gravitropism. Nat. Cell Biol. 8, H. G., May, S. T., Ward, S. P., Mill- of Arabidopsis primary roots to grav- rhizoids and protonemata. Proto-
249256. ner, P. A., et al. (1996). Arabidopsis ity. Plant Physiol. 116, 213222. plasma 219, 150159.
Basu, D., Le, J., Zakharova, T., Mallery, AUX1 gene: a permease-like regula- Blilou, I., Xu, J., Wildwater, M., Willem- Caspar, T., and Pickard, B. G. (1989).
E. L., and Szymanski, D. B. (2008). tor of root gravitropism. Science 273, sen, V., Paponov, I., Friml, J., et al. Gravitropism in a starchless mutant
A SPIKE1 signaling complex controls 948950. (2005). The PIN auxin efux facilita- of Arabidopsis: implications for the
actin-dependent cell morphogenesis Birnbaum, K., Shasha, D. E., Wang, tor network controls growth and pat- starch-statolith theory of gravity
through the heteromeric WAVE and J. Y., Jung, J. W., Lambert, G. M., terning in Arabidopsis roots. Nature sensing. Planta 177, 185197.
ARP2/3 complexes. Proc. Natl. Acad. Galbraith, D. W., et al. (2003). A 433, 3944. Chen, X., Naramoto, S., Robert, S.,
Sci. U.S.A. 105, 40444049. gene expression map of the Ara- Boonsirichai, K., Sedbrook, J. C., Tejos, R., Lfke, C., Lin, D., et al.
Benjamins, R., Quint, A., Weijers, D., bidopsis root. Science 302, 1956 Chen, R., Gilroy, S., and Mas- (2012). ABP1 and ROP6 GTPase
Hooykaas, P., and Offringa, R. (2001). 1960. son, P. H. (2003). ALTERED signaling regulate clathrin-mediated
The PINOID protein kinase regulates Blakeslee, J. J., Bandyopadhyay, A., Lee, RESPONSE TO GRAVITY is a endocytosis in Arabidopsis roots.
organ development in Arabidopsis O. R., Mravec, J., Titapiwatanakun, peripheral membrane protein that Curr. Biol. 22, 13261332.

www.frontiersin.org December 2012 | Volume 3 | Article 274 | 56

fpls-03-00274 2012/12/8 13:20 page 9 #9


Strohm et al. Protein trafcking in gravitropism

Christensen, S. K., Dagenais, N., Chory, efux of auxin catalyzed by the Kepinski, S., and Leyser, O. (2005). The Luesse, D. R., Schenck, C. A., Berner, B.
J., and Weigel, D. (2000). Regula- Arabidopsis MDR/PGP transporter Arabidopsis F-box protein TIR1 is an K., Justus, B., and Wyatt, S. E. (2010).
tion of auxin response by the protein AtPGP1. Plant J. 44, 179194. auxin receptor. Nature 435, 446451. GPS4 is allelic to ARL2: implications
kinase PINOID. Cell 100, 469478. Geisler, M., Kolukisaoglu, H. U., Kiss, J. Z., Hertel, R., and Sack, F. for gravitropic signal transduction.
Christie, J. M., Yang, H., Richter, G. Bouchard, R., Billion, K., Berger, D. (1989). Amyloplasts are necessary Gravit. Space Biol. 23, 9596.
L., Sullivan, S., Thomson, C. E., Lin, J., Saal, B., et al. (2003). TWISTED for full gravitropic sensitivity in roots Luschnig, C., Gaxiola, R. A., Grisa, P.,
J., et al. (2011). phot1 inhibition of DWARF1, a unique plasma mem- of Arabidopsis thaliana. Planta 177, and Fink, G. R. (1998). EIR1, a root-
ABCB19 primes lateral auxin uxes brane-anchored immunophilin-like 198206. specic protein involved in auxin
in the shoot apex required for pho- protein, interacts with Arabidop- Kiss, J. Z. (2000). Mechanisms of the transport, is required for gravit-
totropism. PLoS Biol. 9:e1001076. sis multidrug resistance-like trans- early phases of plant gravitropism. ropism in Arabidopsis thaliana. Genes
doi: 10.1371/journal.pbio.1001076 porters AtPGP1 and AtPGP19. Mol. CRC Crit. Rev. Plant Sci. 19, 551573. Dev. 12, 21752187.
Dharmasiri, N., Dharmasiri, S., and Biol. Cell 14, 42384249. Kleine-Vehn, J., Ding, Z., Jones, A. Maher, E. P., and Martindale, S.
Estelle, M. (2005). The F-box protein Geldner, N., Anders, N., Wolters, H., R., Tasaka, M., Morita, M. T., and J. (1980). Mutants of Arabidopsis
TIR1 is an auxin receptor. Nature 435, Keicher, J., Kornberger, W., Muller, P., Friml, J. (2010). Gravity-induced PIN thaliana with altered responses to
441445. et al. (2003). The Arabidopsis GNOM transcytosis for polarization of auxin auxins and gravity. Biochem. Genet.
Dhonukshe, P., Aniento, F., Hwang, I., ARF-GEF mediates endosomal recy- uxes in gravity-sensing root cells. 18, 10411053.
Robinson, D. G., Mravec, J., Stierhof, cling, auxin transport, and auxin- Proc. Natl. Acad. Sci. U.S.A. 107, Marchant, A., Kargul, J., May, S. T.,
Y. D., et al. (2007). Clathrin-mediated dependent plant growth. Cell 112, 2234422349. Muller, P., Delbarre, A., Perrot-
constitutive endocytosis of PIN auxin 219230. Kleine-Vehn, J., Leitner, J., Zwiewka, Rechenmann, C., et al. (1999). AUX1
efux carriers in Arabidopsis. Curr. Geldner, N., Friml, J., Stierhof, Y. M., Sauer, M., Abas, L., Luschnig, regulates root gravitropism in Ara-
Biol. 17, 520527. D., Jrgens, G., and Palme, K. C., et al. (2008). Differential degra- bidopsis by facilitating auxin uptake
Friml, J., Benkov, E., Blilou, I., Wis- (2001). Auxin transport inhibitors dation of PIN2 auxin efux carrier by within root apical tissues. EMBO J.
niewska, J., Hamann, T., Ljung, block PIN1 cycling and vesicle traf- retromer-dependent vacuolar target- 18, 20662073.
K., et al. (2002a). AtPIN4 mediates cking. Nature 413, 425428. ing. Proc. Natl. Acad. Sci. U.S.A. 105, Matsuoka, K., Bassham, D. C., Raikhel,
sink-driven auxin gradients and root Guan, C., Rosen, E. S., Boonsirichai, K., 1781217817. N. V., and Nakamura, K. (1995).
patterning in Arabidopsis. Cell 108, Poff, K. L., and Masson, P. H. (2003). Krecek, P., Skupa, P., Libus, J., Different sensitivity to wortmannin
661673. The ARG1-LIKE2 gene of Arabidopsis Naramoto, S., Tejos, R., Friml, J., et al. of two vacuolar sorting signals indi-
Friml, J., Wisniewska, J., Benkov, E., functions in a gravity signal trans- (2009). The PIN-FORMED (PIN) cates the presence of distinct sorting
Mendgen, K., and Palme, K. (2002b). duction pathway that is genetically protein family of auxin transporters. machineries in tobacco cells. J. Cell
Lateral relocation of auxin efux distinct from the PGM pathway. Plant Genome Biol. 10, 249. Biol. 130, 13071318.
regulator PIN3 mediates tropism in Physiol. 133, 100112. Leitner, J., Petrsek, J., Tomanov, K., Mei, Y., Jia, W.-J., Chu, Y.-J.,
Arabidopsis. Nature 415, 806809. Harrison, B. R., and Masson, P. H. Retzer, K., Parezov, M., Korbei, B., and Xue, H.-W. (2012). Arabidop-
Friml, J., Yang, X., Michniewicz, M., (2008). ARL2, ARG1 and PIN3 dene et al. (2012). Lysine63-linked ubiqui- sis phosphatidylinositol monophos-
Weijers, D., Quint, A., Tietz, O., et al. a gravity signal transduction path- tylation of PIN2 auxin carrier protein phate 5-kinase 2 is involved in root
(2004). A PINOID-dependent binary way in root statocytes. Plant J. 53, governs hormonally controlled adap- gravitropism through regulation of
switch in apical-basal PIN polar tar- 380392. tation of Arabidopsis root growth. polar auxin transport by affecting the
geting directs auxin efux. Science Haucke, V. (2005). Phosphoinosi- Proc. Natl. Acad. Sci. U.S.A. 109, cycling of PIN proteins. Cell Res. 22,
306, 862865. tide regulation of clathrin-mediated 83228327. 581597.
Fukaki, H., Fujisawa, H., and Tasaka, endocytosis. Biochem. Soc. Trans. 33, Leitz, G., Kang, B.-H., Schoenwaelder, Men, S., Boutt, Y., Ikeda, Y., Li,
M. (1996a). Gravitropic response 12851289. M. E. A., and Staehelin, L. A. (2009). X., Palme, K., Stierhof, Y.-D.,
of inorescence stems in Arabidop- Heisler, M. G., Hamant, O., Krupin- Statolith sedimentation kinetics and et al. (2008). Sterol-dependent endo-
sis thaliana. Plant Physiol. 110, ski, P., Uyttewaal, M., Ohno, force transduction to the cortical cytosis mediates post-cytokinetic
933943. C., Jnsson, H., et al. (2010). endoplasmic reticulum in gravity- acquisition of PIN2 auxin efux
Fukaki, H., Fujisawa, H., and Tasaka, M. Alignment between PIN1 polarity sensing Arabidopsis columella cells. carrier polarity. Nat. Cell Biol. 10,
(1996b). SGR1, SGR2, SGR3: novel and microtubule orientation in the Plant Cell 21, 843860. 237244.
genetic loci involved in shoot gravit- shoot apical meristem reveals a Lewis, D. R., Miller, N. D., Splitt, B. L., Michniewicz, M., Zago, M. K., Abas,
ropism in Arabidopsis thaliana. Plant tight coupling between morphogen- Wu, G., and Spalding, E. P. (2007). L., Weijers, D., Schweighofer, A.,
Physiol. 110, 945955. esis and auxin transport. PLoS Biol. Separating the roles of acropetal Meskiene, I., et al. (2007). Antago-
Fukaki, H., Fujisawa, H., and Tasaka, 8:e1000516. doi: 10.1371/journal. and basipetal auxin transport on nistic regulation of PIN phosphory-
M. (1997). The RHG gene is involved pbio.1000516 gravitropism with mutations in two lation by PP2A and PINOID directs
in root and hypocotyl gravitropism Henrichs, S., Wang, B., Fukao, Y., Arabidopsis multidrug resistance-like auxin ux. Cell 130, 10441056.
in Arabidopsis thaliana. Plant Cell Zhu, J. Charrier, L., Bailly, A., et al. ABC transporter genes. Plant Cell 19, Monshausen, G. B., Miller, N.
Physiol. 38, 804810. (2012). Regulation of ABCB1/PGP1- 18381850. D., Murphy, A. S., and Gilroy,
Fukaki, H., Wysocka-Diller, J., Kato, catalysed auxin transport by linker Lin, D., Nagawa, S., Chen, J., S. (2011). Dynamics of auxin-
T., Fujisawa, H., Benfey, P. N., phosphorylation. EMBO J. 31, 2965 Cao, L., Chen, X., Xu, T., et al. dependent Ca+ and pH signaling in
and Tasaka, M. (1998). Genetic evi- 2980. (2012). A ROP GTPase-dependent root growth revealed by integrating
dence that the endodermis is essential Jaillais, Y., Fobis-Loisy, I., Mige, C., auxin signaling pathway regulates the high-resolution imaging with auto-
for shoot gravitropism in Arabidopsis Rollin, C., and Gaude, T. (2006). subcellular distribution of PIN2 in mated computer vision-based analy-
thaliana. Plant J. 14, 425430. AtSNX1 denes an endosome for Arabidopsis roots. Curr. Biol. 22, sis. Plant J. 65, 309318.
Glweiler, L., Guan, C., Mller, A., Wis- auxin-carrier trafcking in Arabidop- 13191325. Morita, M. T. (2010). Directional grav-
man, E., Mendgen, K., Yephremov, sis. Nature 443, 106109. Lin, R., and Wang, H. (2005). ity sensing in gravitropism. Annu.
A., et al. (1998). Regulation of polar Kato, T., Morita, M. T., Fukaki, Two homologous ATP-binding cas- Rev. Plant Biol. 61, 705720.
auxin transport by AtPIN1 in Ara- H., Yamauchi, Y., Uehara, M., sette transporter proteins, AtMDR1 Morita, M. T., Kato, T., Nagafusa, K.,
bidopsis vascular tissue. Science 282, Niihama, M., et al. (2002). SGR2, and AtPGP1, regulate Arabidop- Saito, C., Ueda, T., Nakano, A., et al.
22262230. a phospholipase-like protein, and sis photomorphogenesis and root (2002). Involvement of the vacuoles
Geisler, M., Blakeslee, J. J., Bouchard, ZIG/SGR4, a SNARE, are involved in development by mediating polar of the endodermis in the early process
R., Lee, O. R., Vincenzetti, V., Bandy- the shoot gravitropism of Arabidop- auxin transport. Plant Physiol. 138, of shoot gravitropism in Arabidopsis.
opadhyay, A., et al. (2005). Cellular sis. Plant Cell 14, 3346. 949964. Plant Cell 14, 4756.

Frontiers in Plant Science | Plant Trafc and Transport December 2012 | Volume 3 | Article 274 | 57

fpls-03-00274 2012/12/8 13:20 page 10 #10


Strohm et al. Protein trafcking in gravitropism

Mller, A., Guan, C., Glweiler, L., Tn- family of auxin inux transporters et al. (2005). MDR-like ABC trans- mechanisms of root gravity sens-
zler, P., Huijser, P., Marchant, A., that perform distinct functions dur- porter AtPGP4 is involved in auxin- ing and signal transduction. Wiley
et al. (1998). AtPIN2 denes a locus ing Arabidopsis development. Plant mediated lateral root and root hair Interdiscip. Rev. Dev. Biol. 1,
of Arabidopsis for root gravitropism Cell 24, 28742885. development. FEBS Lett. 579, 5399 276285.
control. EMBO J. 17, 69036911. Plieth, C., and Trewavas, A. J. (2002). 5406. Surpin, M., Rojas-Pierce, M., Carter, C.,
Nakayama, N., Smith, R. S., Mandel, T., Reorientation of seedlings in the Sato, M. H., Nakamura, N., Ohsumi, Hicks, G. R., Vasquez, J., and Raikhel,
Robinson, S., Kimura, S., Boudaoud, earths gravitational eld induces Y., Kouchi, H., Kondo, M., Hara- N. V. (2005). The power of chemical
A., et al. (2012). Mechanical regula- cytosolic calcium transients. Plant Nishimura, I., et al. (1997). The genomics to study the link between
tion of auxin-mediated growth. Curr. Physiol. 129, 786796. AtVAM3 encodes a syntaxin-related endomembrane system components
Biol. 22, 14681476. Rahman, A., Takahashi, M., Shibasaki, molecule implicated in the vacuolar and the gravitropic response. Proc.
Noh, B., Bandyopadhyay, A., Peer, W. K., Wu, S., Inaba, T., Tsurumi, S., et al. assembly in Arabidopsis thaliana. J. Natl. Acad. Sci. U.S.A. 102, 4902
A., Spalding, E. P., and Murphy, (2010). Gravitropism of Arabidopsis Biol. Chem. 272, 2453024535. 4907.
A. S. (2003). Enhanced gravi- and thaliana roots requires the polariza- Scott, A. C., and Allen, N. S. (1999). Swarup, R., and Bennett, M. (2003).
phototropism in plant mdr mutants tion of PIN2 toward the root tip in Changes in cytosolic pH within Auxin transport: the fountain of life
mislocalizing the auxin efux protein meristematic cortical cells. Plant Cell Arabidopsis root columella cells play a in plants? Dev. Cell 5, 824826.
PIN1. Nature 423, 9991002. 22, 17621776. key role in the early signaling pathway Swarup, R., Kramer, E. M., Perry, P.,
Noh, B., Murphy, A. S., and Spalding, Rashotte, A. M., DeLong, A., and for root gravitropism. Plant Physiol. Knox, K., Leyser, H. M. O., Haseloff,
E. P. (2001). Multidrug resistance- Muday, G. K. (2001). Genetic and 121, 12911298. J., et al. (2005). Root gravitropism
like genes of Arabidopsis required for chemical reductions in protein phos- Sedbrook, J. C., Chen, R., and Masson, requires lateral root cap and epider-
auxin transport and auxin-mediated phatase activity alter auxin transport, P. H. (1999). ARG1 (altered response mal cells for transport and response
development. Plant Cell 13, 2441 gravity response, and lateral root to gravity) encodes a DnaJ-like pro- to a mobile auxin signal. Nat. Cell
2454. growth. Plant Cell 13, 16831697. tein that potentially interacts with the Biol. 7, 10571065.
Ottenschlager, I., Wolff, P., Wolver- Raven, J. A. (1975). Transport of cytoskeleton. Proc. Natl. Acad. Sci. Terasaka, K., Blakeslee, J. J., Titapi-
ton, C., Bhalerao, P., Sandberg, G., indoleacetic acid in plant cells in U.S.A. 96, 11401145. watanakun, B., Peer, W. A., Bandy-
Ishikawa, H., et al. (2003). Gravity- relation to pH and electrical poten- Shi, J.-H., and Yang, Z.-B. (2011). Is opadhyay, A., Makam, S. N., et al.
regulated differential auxin transport tial gradients, and its signicance for ABP1 an auxin receptor yet? Mol. (2005). PGP4, an ATP binding cas-
from columella to lateral root cap polar IAA transport. New Phytol. 74, Plant 4, 635640. sette P-glycoprotein, catalyzes auxin
cells. Proc. Natl. Acad. Sci. U.S.A. 100, 163172. Shin, H., Shin, H.-S., Guo, Z., Blan- transport in Arabidopsis thaliana
29872991. Reyes, F. C., Buono, R., and Otegui, M. caor, E. B., Masson, P. H., and roots. Plant Cell 17, 29222939.
Paciorek, T., Zazimalova, E., Ruthardt, S. (2011). Plant endosomal trafck- Chen, R. (2005). Complex regu- Toyota, M., Furuichi, T., Tatsumi,
N., Petrasek, J., Stierhof, Y. D., Kleine- ing pathways. Curr. Opin. Plant Biol. lation of Arabidopsis AGR1/PIN2- H., and Sokabe, M. (2008). Criti-
Vehn, J., et al. (2005). Auxin inhibits 14, 666673. mediated root gravitropic response cal consideration on the relationship
endocytosis and promotes its own Robineau, S., Chabre, M., and Antonny, and basipetal auxin transport by between auxin transport and calcium
efux from cells. Nature 435, 1251 B. (2000). Binding site of brefeldin cantharidin-sensitive protein phos- transients in gravity perception of
1256. A at the interface between the small phatases. Plant J. 42, 188200. Arabidopsis seedlings. Plant Signal.
Perera, I. Y., Heilmann, I., and Boss, G protein ADP-ribosylation factor 1 Silady, R. A., Ehrhardt, D. W., Jack- Behav. 3, 521524.
W. F. (1999). Transient and sus- (ARF1) and the nucleotide-exchange son, K., Faulkner, C., Oparka, K., Tsugeki, R., and Fedoroff, N. V. (1999).
tained increases in inositol 1,4,5- factor Sec7 domain. Proc. Natl. Acad. and Somerville, C. R. (2008). The Genetic ablation of root cap cells in
trisphosphate precede the differential Sci. U.S.A. 97, 99139918. GRV2/RME-8 protein of Arabidop- Arabidopsis. Proc. Natl. Acad. Sci.
growth response in gravistimulated Rojas-Pierce, M., Titapiwatanakun, B., sis functions in the late endocytic U.S.A. 96, 1294112946.
maize pulvini. Proc. Natl. Acad. Sci. Sohn, E. J., Fang, F., Larive, C. K., pathway and is required for vac- Vieten, A., Vanneste, S., Wisniewska,
U.S.A. 96, 58385843. Blakeslee, J., et al. (2007). Arabidop- uolar membrane ow. Plant J. 53, J., Benkov, E., Benjamins, R.,
Perera, I. Y., Heilmann, I., Chang, S. sis P-glycoprotein19 participates in 2941. Beeckman, T., et al. (2005). Func-
C., Boss, W. F., and Kaufman, P. the inhibition of gravitropism by Silady, R. A., Kato, T., Lukowitz, W., tional redundancy of PIN proteins
B. (2001). A role for inositol 1,4,5- gravacin. Chem. Biol. 14, 13661376. Sieber, P., Tasaka, M., and Somerville, is accompanied by auxin-dependent
trisphosphate in gravitropic signaling Rubery, P. H., and Sheldrake, A. C. R. (2004). The gravitropism defec- cross-regulation of PIN expression.
and the retention of cold-perceived R. (1974). Carrier-mediated auxin tive 2 mutants of Arabidopsis are Development 132, 45214531.
gravistimulation of oat shoot pulvini. transport. Planta 118, 101121. decient in a protein implicated in Wang, Y., Lin, W.-H., Chen, X., and Xue,
Plant Physiol. 125, 14991507. Saito, C., Morita, M. T., Kato, T., and endocytosis in Caenorhabditis ele- H.-W. (2009). The role of Arabidop-
Perera, I. Y., Hung, C.-Y., Brady, S., Tasaka, M. (2005). Amyloplasts and gans. Plant Physiol. 13.6, 30953103: sis 5PTase13 in root gravitropism
Muday, G. K., and Boss, W. F. (2006). vacuolar membrane dynamics in the discussion 3002. through modulation of vesicle traf-
A universal role for inositol 1,4,5- living graviperceptive cell of the Ara- Stanga, J. P., Boonsirichai, K., Sedbrook, cking. Cell Res. 19, 11911204.
trisphosphate-mediated signaling in bidopsis inorescence stem. Plant Cell J. C., Otegui, M. S., and Masson, P. Wasteneys, G. O., and Galway, M. E.
plant gravitropism. Plant Physiol. 17, 548558. H. (2009). A role for the TOC com- (2003). Remodeling the cytoskeleton
140, 746760. Salinas-Mondragon, R. E., Kajla, J. D., plex in Arabidopsis root gravitropism. for growth and form: an overview
Petrsek, J., and Friml, J. (2009). Auxin Perera, I. Y., Brown, C. S., and Plant Physiol. 149, 18961905. with some new views. Annu. Rev.
transport routes in plant develop- Sederoff, H. W. (2010). Role of Staves, M. P. (1997). Cytoplasmic Plant Biol. 54, 691722.
ment. Development 136, 26752688. inositol 1,4,5-triphosphate signalling streaming and gravity sensing in Whitford, R., Fernandez, A., Tejos,
Peyroche, A., Antonny, B., Robineau, S., in gravitropic and phototropic gene Chara internodal cells. Planta 203, R., Prez, A. C., Kleine-Vehn, J.,
Acker, J., Cherls, J., and Jackson, C. expression. Plant Cell Environ. 33, S7984. Vanneste, S., et al. (2012). GOLVEN
L. (1999). Brefeldin A acts to stabilize 20412055. Steinmann, T., Geldner, N., Grebe, M., secretory peptides regulate auxin car-
an abortive ARF-GDP-Sec7 domain Salisbury, F. B., Gillespie, L., and Mangold, S., Jackson, C. L., Paris, rier turnover during plant gravitropic
protein complex: involvement of spe- Rorabaugh, P. (1988). Gravitropism S., et al. (1999). Coordinated polar responses. Dev. Cell 22, 678685.
cic residues of the Sec7 domain. in higher plant shoots. V. Changing localization of auxin efux carrier Willemsen, V., Friml, F., Grebe,
Mol. Cell 3, 275285. sensitivity to auxin. Plant Physiol. 88, PIN1 by GNOM ARF GEF. Science M., van den Toorn, A., Palme,
Pret, B., Swarup, K., Ferguson, A., 11861194. 286, 316318. K., and Scheres, B. (2003). Cell
Seth, M., Yang, Y., Dhondt, S., et al. Santelia, D., Vincenzetti, V., Azzarello, Strohm, A. K., Baldwin, K. L., and polarity and PIN protein position-
(2012). AUX/LAX genes encode a E., Bovet, L., Fukao, Y., Dchtig, P., Masson, P. H. (2012). Molecular ing in Arabidopsis require STEROL

www.frontiersin.org December 2012 | Volume 3 | Article 274 | 58

fpls-03-00274 2012/12/8 13:20 page 11 #11


Strohm et al. Protein trafcking in gravitropism

METHYLTRANSFERASE1 function. 1 and PIN auxin transporters in Zheng, H. Q., and Staehelin, L. Received: 07 September 2012; accepted:
Plant Cell 15, 612625. Schizosaccharomyces pombe. Plant J. A. (2001). Nodal endoplasmic 21 November 2012; published online: 11
Wisniewska, J., Xu, J., Seifertov, D., 59, 179191. reticulum, a specialized form of December 2012.
Brewer, P. B., Ruzicka, K., Blilou, I., Yang, Y., Hammes, U. Z., Taylor, C. G., endoplasmic reticulum found in Citation: Strohm AK, Baldwin KL and
et al. (2006). Polar PIN localization Schachtman, D. P., and Nielsen, E. gravity-sensing root tip columella Masson PH (2012) Multiple roles for
directs auxin ow in plants. Science (2006). High-afnity auxin transport cells. Plant Physiol. 125, 252265. membrane-associated protein trafcking
312, 883. by the AUX1 inux carrier protein. Zheng, H., von Mollard, G. F., Kovaleva, and signaling in gravitropism. Front.
Wolverton, C., Ishikawa, H., and Evans, Curr. Biol. 16, 11231127. V., Stevens, T. H., and Raikhel, N. V. Plant Sci. 3:274. doi: 10.3389/fpls.2012.
M. L. (2002). The kinetics of root Yano, D., Sato, M., Saito, C., Sato, M. (1999). The plant vesicle-associated 00274
gravitropism: dual motors and sen- H., Morita, M. T., and Tasaka, M. SNARE AtVTI1a likely mediates vesi- This article was submitted to Frontiers in
sors. J. Plant Growth Regul. 21, (2003). A SNARE complex contain- cle transport from the trans-Golgi Plant Trafc and Transport, a specialty of
102112. ing SGR3/AtVAM3 and ZIG/VTI11 network to the prevacuolar compart- Frontiers in Plant Science.
Yamauchi, Y., Fukaki, H., Fujisawa, H., in gravity-sensing cells is important ment. Mol. Biol. Cell 10, 22512264. Copyright 2012 Strohm, Baldwin and
and Tasaka, M. (1997). Mutations in for Arabidopsis shoot gravitropism. Masson. This is an open-access article dis-
the SGR4, SGR5 and SGR6 loci of Proc. Natl. Acad. Sci. U.S.A. 100, tributed under the terms of the Creative
Arabidopsis thaliana alter the shoot 85898594. Conflict of Interest Statement: The Commons Attribution License, which
gravitropism. Plant Cell Physiol. 38, Young, L. M., Evans, M. L., and Hertel, authors declare that the research was permits use, distribution and reproduc-
530535. R. (1990). Correlations between grav- conducted in the absence of any com- tion in other forums, provided the origi-
Yang, H., and Murphy, A. S. (2009). itropic curvature and auxin move- mercial or nancial relationships that nal authors and source are credited and
Functional expression and character- ment across gravistimulated roots of could be construed as a potential con- subject to any copyright notices concern-
ization of Arabidopsis ABCB, AUX Zea mays. Plant Physiol. 92, 792796. ict of interest. ing any third-party graphics etc.

Frontiers in Plant Science | Plant Trafc and Transport December 2012 | Volume 3 | Article 274 | 59

fpls-03-00274 2012/12/8 13:20 page 12 #12


REVIEW ARTICLE
published: 12 October 2012
doi: 10.3389/fpls.2012.00227

Evolution and structural diversification of PILS putative


auxin carriers in plants
Elena Feraru 1 , Stanislav Vosolsobe 2 , Mugurel I. Feraru 1 , Jan Petrek 2,3 and Jrgen Kleine-Vehn 1 *
1
Department of Applied Genetics and Cell Biology, University of Natural Resources and Life Sciences, Vienna, Austria
2
Department of Faculty of Science, Experimental Plant Biology, Charles University, Prague, Czech Republic
3
Institute of Experimental Botany of the Academy of Sciences of the Czech Republic, Prague, Czech Republic

Edited by: The phytohormone auxin contributes to virtually every aspect of the plant development.
Markus Geisler, University of
The spatiotemporal distribution of auxin depends on a complex interplay between auxin
Fribourg, Switzerland
metabolism and intercellular auxin transport. Intracellular auxin compartmentalization pro-
Reviewed by:
Viktor Zarsky, Charles University, vides another link between auxin transport processes and auxin metabolism.The PIN-LIKES
Czech Republic (PILS) putative auxin carriers localize to the endoplasmic reticulum (ER) and contribute to
Eric M. Kramer, Bard College at cellular auxin homeostasis. PILS proteins regulate intracellular auxin accumulation, the rate
Simons Rock, USA
of auxin conjugation and, subsequently, affect nuclear auxin signaling. Here, we investigate
*Correspondence:
sequence diversification of the PILS family in Arabidopsis thaliana and provide insights into
Jrgen Kleine-Vehn, Department of
Applied Genetics and Cell Biology, the evolution of these novel putative auxin carriers in plants. Our data suggest that PILS
University of Natural Resources and proteins are conserved throughout the plant lineage and expanded during higher plant
Life Sciences, Muthgasse 18, A-1190 evolution. PILS proteins diversified early during plant evolution into three clades. Besides
Vienna, Austria.
the ancient Clade I encompassing non-land plant species, PILS proteins evolved into two
e-mail: juergen.kleine-vehn@
boku.ac.at clades. The diversification of Clade II and Clade III occurred already at the level of non-
vascular plant evolution and, hence, both clades contain vascular and non-vascular plant
species. Nevertheless, Clade III contains fewer non- and increased numbers of vascular
plants, indicating higher importance of Clade III for vascular plant evolution. Notably, PILS
proteins are distinct and appear evolutionarily older than the prominent PIN-FORMED auxin
carriers. Moreover, we revealed particular PILS sequence divergence in Arabidopsis and
assume that these alterations could contribute to distinct gene regulations and protein
functions.
Keywords: PILS proteins, auxin, evolution, phylogeny, auxin metabolism, auxin homeostasis

INTRODUCTION the cell cycle (Jurado et al., 2010). Rapid and non-genomic auxin
Plant development is particularly flexible due to its postembry- effects appear to be mainly perceived by the AUXIN BINDING
onic growth behavior, allowing individual adjustment of the body PROTEIN1 (ABP1; Jones and Venis, 1989; Robert et al., 2010;
plan according to the environment (Finet and Jaillais, 2012). Xu et al., 2010). However, ABP1 action might also affect auxin-
The phytohormone auxin is crucial for these adaptive responses dependent gene transcription and cell cycle regulation (Braun
and, hence, has drawn enormous research attention (Teale et al., et al., 2008; Tromas et al., 2009).
2008). The importance of auxin for plant development seems Beside the complex cell type-dependent regulation of auxin sig-
to be also reflected in the complex regulation of auxin percep- naling, also auxin metabolism is multifaceted. Several redundant
tion and its spatiotemporal distribution (Vanneste and Friml, auxin biosynthesis pathways determine auxin levels in various tis-
2009). Up to date three auxin receptor classes have been sug- sues and the decay/inactivation of auxin is regulated via oxidation
gested to jointly regulate auxin-signaling output. Most auxin or mostly reversible conjugation (Woodward and Bartel, 2005;
responses have been assigned to the F-box proteins TRANS- Ruiz Rosquete et al., 2012; Zhao, 2012). Auxin metabolism is highly
PORT INHIBITOR RESPONSE1/AUXIN SIGNALING F-BOX dynamic and has pronounced importance for the spatiotemporal
(TIR1/AFB). Auxin binding to the co-receptors TIR1/AFB and regulation of auxin.
the AUXIN/INDOLE-3-ACETIC ACID (Aux/IAA) will initiate the Intercellular (polar) auxin transport also determines cellular
proteasome-dependent degradation of the transcriptional repres- auxin levels (Zazmalov et al., 2010). The most prominent auxin
sors Aux/IAAs. The subsequent release of AUXIN RESPONSE carriers are AUXIN-RESISTANT1/LIKE AUX1 (AUX/LAX) influx
FACTOR (ARF) transcription factors eventually leads to the tran- carriers, ATP BINDING CASSETTE (ABC) auxin transporters of
scriptional reprogramming of the respective cell (Leyser, 2006; a MULTIDRUG RESISTANCE (MDR) subfamily, and the PIN-
Chapman and Estelle, 2009). Another F-box protein S-PHASE FORMED (PIN) auxin carriers (Bennett et al., 1996; Chen et al.,
KINASE-ASSOCIATED PROTEIN 2A (SKP2A) also binds to 1998; Glweiler et al., 1998; Luschnig et al., 1998; Mller et al.,
auxin and might contribute to auxin-dependent modulation of 1998; Utsuno et al., 1998; Geisler et al., 2005). PIN proteins have a

www.frontiersin.org October 2012 | Volume 3 | Article 227 | 60


Feraru et al. PILS evolution and structural diversification

particular developmental importance as their polar localization MATERIAL AND METHODS


at a given cell side determines the direction of the intercellu- SEQUENCE INFORMATION
lar auxin flow (Wisniewska et al., 2006). PIN proteins can be Sequences were downloaded from PLAZA1 , NCBI2 by using
grouped into two subclasses according to the length of the central tblastx program (Altschul et al., 1997; nr/nt database, PILS and PIN
hydrophilic loop. Canonical PIN1-type auxin efflux carriers have sequences from A. thaliana as queries) or Phytozome3 servers. The
a long loop, localize to the plasma membrane (PM) and perform information and the ID of the presented sequences can be found
a rate-limiting function in cellular auxin efflux (Petrsek et al., in the Supplementary Data.
2006). In contrast, PIN5 and PIN8 have a dramatically reduced
central hydrophilic loop, localize to the endoplasmic reticulum ONLINE SERVERS
(ER) and regulate intracellular auxin compartmentalization and The online available servers used to perform in silico analyses
homeostasis (Mravec et al., 2009; Bosco et al., 2012; Ding et al., of PILSes are found at: http://www.arabidopsis.org (chromosome
2012). localization; alternative splicing), http://bioinformatics.psb.ugent.
We have recently discovered a novel putative auxin carrier fam- be/plaza/ (intron/exon organization; sequence information),
ily of seven members in Arabidopsis thaliana (Barbez et al., 2012) www.genevestigator.com (expression), http://bar.utoronto.ca/efp/
and designated them as PIN-LIKES (PILS), because their predicted cgi-bin/efpWeb.cgi (expression), http://www.enzim.hu/hmmtop/
protein topology is highly similar to the topology of the PIN pro- index.php (prediction of protein topology), http://biophysics.
teins. Similar to PIN proteins, PILS contain the so-called Interpro biol.uoa.gr/TMRPres2D (visual representation of transmembrane
auxin carrier domain, an in silico defined domain to predict auxin protein models), http://weblogo.berkeley.edu/logo.cgi (sequence
transport function. Functional PILS5-GFP fusion proteins local- logo), http://www.cbs.dtu.dk/services/NetPhos/ (prediction of
ize to the ER and stimulate intracellular auxin accumulation in phosphorylation sites), http://www.cbs.dtu.dk/services/NetPhosK
plant and yeast cells (Barbez et al., 2012). PILS2 and PILS5 activ- (prediction of phosphorylation sites), http://www.ebi.ac.uk/Tools/
ity increases amide auxin conjugates, thereby reducing the free msa/clustalw2/ (multiple amino acid sequences alignment), http:
auxin levels, and negatively affecting nuclear auxin signaling (Bar- //blast.ncbi.nlm.nih.gov/ (sequence information), http://www.
bez et al., 2012). Our current working model proposes that PILS2 phytozome.net/ (sequence information), http://www.r-project.
and PILS5 proteins regulate auxin compartmentalization into the org/ (analysis of collinearity).
ER lumen, where auxin might be the substrate for compartmen-
talized auxin metabolism (Figure 1). It needs to be experimentally ANALYSIS OF COLLINEARITY
tested whether PILS proteins affect nuclear auxin signaling mainly We investigated possible collinearity among A. thaliana PILS
by limiting the excess of auxin to diffuse into the nucleus or by the genes by comparing 200 surrounding translated genes for each
effect on presumably compartmentalized auxin conjugation. This PILS. The comparison was performed for pairs of PILS genes by
mode of action is reminiscent to auxin carrier PIN5 that has been using blastp program (Altschul et al., 1997). The homology was
shown to regulate intracellular auxin homeostasis by modulating
auxin compartmentalization and metabolism at the ER (Mravec 1 http://bioinformatics.psb.ugent.be/plaza/

et al., 2009). Further research will address whether the distinct 2 http://www.ncbi.nlm.nih.gov/
3 http://www.phytozome.net/
protein families have redundant and interchangeable function at
the ER.
PILS overexpression strongly distorts plant patterning and
development, while pils2 and pils5 loss of function mutants show
comparably weaker defects in plant growth regulation. Moderate
PILS5 gain and pils2pils5 loss of function phenotypes can be largely
explained by low and high auxin content, respectively. For exam-
ple, PILS5 overexpressors have reduced free auxin levels/signaling,
shorter hypocotyls and fewer lateral roots, while pils2pils5 dou-
ble mutants display higher free auxin levels, enhanced hypocotyl
growth and lateral rooting. In contrast, PILS5 gain andpils2pils5
loss of function leads to reduced and enhanced root growth,
which might be not related to the overall changes in auxin con-
tent, but could indicate a more specific PILS2 and PILS5 func-
tion in the cellular regulation of root growth (Barbez et al.,
2012).
The identification of PILS proteins and their role in auxin FIGURE 1 | Model of PILS protein function in Arabidopsis thaliana.
homeostasis at the ER reveal the molecular complexity of intra- PILS2 and PILS5 proteins localize to the ER and mediate intracellular
cellular auxin compartmentalization and its eminent impor- auxin accumulation. We hypothesize that PILS proteins are putative
tance for the plant development. Here we present in silico auxin carriers that regulate the auxin transport from the cytosol into
the lumen of the ER (black arrow). PILS activity affects auxin
analysis to further reveal insight into the organization and
metabolism and might control the cytoplasmic availability of auxin
regulation of this novel family of putative auxin transport (adapted from Barbez et al., 2012).
facilitators.

Frontiers in Plant Science | Plant Traffic and Transport October 2012 | Volume 3 | Article 227 | 61
Feraru et al. PILS evolution and structural diversification

Table 1 | Size of PILS gene families in different plant species.


determined according to E-value from blast results. The analysis
was performed in R environment4 . Lineage Species Number of genes*

PHYLOGENETIC ANALYSIS Eukaryota


A multiple alignment was built by using Muscle in MEGA5 soft- Viridiplantae
ware (Tamura et al., 2011). Only the conserved domains were Chlorophyta Micromonas sp. 1
used and all positions with less than 80% site coverage were Micromonas pusilla 1
eliminated. The evolutionary history was inferred by using the Ostreococcus lucimarinus 1
Maximum Likelihood method based on the Whelan and Gold- Ostreococcus tauri 1
man (2001) + Freq. model with discrete Gamma distribution (five Chlamydomonas reinhardtii 2
categories, G parameter = 3.0640) for analysis of PILS amino acid Volvox carteri 2
sequences or on the Whelan and Goldman model with discrete Bryophyta Physcomitrella patens 5
Gamma distribution (five categories, G parameter = 2.9920) for Lycopodiophyta Selaginella moellendorffii 8
analysis of PIN-PILS dataset. The trees are drawn to scale, with Euphyllophyta
branch lengths measured in the number of substitutions per site. Monocots Oryza sativa japonica 6
The PILS analysis involved 42 amino acid sequences and 322 Oryza sativa indica 6
positions in the final dataset. The PIN-PILS analysis involved 67 Sorghum bicolor 7
amino acid sequences and 354 positions. Evolutionary analyses Brachypodium distachyon 8
were conducted in MEGA5 (Tamura et al., 2011). For the sequence Zea mays 10
alignments see Figures S2 and S3 in Supplementary Material. Dicots Carica papaya 4
Arabidopsis lyrata 6
RESULTS Arabidopsis thaliana 7
PHYLOGENY OF PILS PROTEINS Ricinus communis 7
Using available online tools, we previously showed that PILS pro- Fragaria vesca 8
teins are highly conserved among plant species (Barbez et al., Manihot esculenta 9
2012). To further investigate the evolution of PILS protein diver- Lotus japonicus 12
sification, we analyzed PILS protein sequences from all sequenced Medicago truncatula 13
taxa of Viridiplantae. The PILS family is present in all the 26 avail- Vitis vinifera 13
able sequenced genomes and is represented by 202 genes (Table 1; Malus domestica 14
Van Bel et al., 2012; confirmed by reciprocal blast, Altschul et al., Theobroma cacao 16
1997). PILS family obviously diversified in the different plant lin- Glycine max 17
eages (Table 1). Ancient species, such as algae (12), mosses (5), Populus trichocarpa 18
and spike mosses (8), have 18 PILS genes, while seed plants, such
*Gene information and sequences were retrieved from PLAZA platform (Van Bel
as Oryza (6), Zea (10), Medicago (13), or Populus (18), have 6 to
et al., 2012) and candidates were evaluated by reciprocal blasts (Altschul et al.,
18 PILS genes (Table 1). The steadily increasing number in seed
1997).
plants suggests that PILS genes have duplicated independently in
several plant lineages and indicate a more diversified function of
PILS proteins in higher plants. include these sequences in the phylogenetic analysis because they
To assess the evolutionary relationship among PILS proteins, we were incomplete (only EST fragments are currently available).
constructed phylogenetic trees with PILS sequences from selected The evolutionary Clade II and III already emerged early dur-
model organisms such as available green algae, Physcomitrella, ing non-vascular plant evolution and both contain PILS sequences
Selaginella, Picea, Brachypodium, Oryza, Medicago, Arabidopsis, from Embryophytes (land plants; Figure 2). The main lineages of
and Populus sequences (Figure 2; Figure S1 in Supplementary land plants are mosses, liverworts, hornworts, lycophytes, ferns,
Material; for sequence alignment see Figure S2 in Supplementary gymnosperms, and angiosperms. Clade II includes the well-
Material). The phylogenetic tree presented in Figure 2 shows that conserved PILS2- and PILS6-like subclades, including orthologs of
PILSes from Viridiplantae can be grouped into three evolutionary PILS2 and PILS6 from Physcomitrella, Selaginella, Brachypodium,
clades: Clade I, Clade II, and Clade III. or Oryza (Figure 2).
The available green algae genomes from the lineage Chlorophyta Clade III encompasses the PILS1/PILS3/PILS4- and PILS5/PILS7-
have a relatively low number of only one or two PILS genes per like subclades and displays particular expansion in higher seed
species. All these PILS algae orthologs cluster together and define plants (Figure 2; Figure S1 in Supplementary Material). Accord-
the Clade I that contains the so far oldest known PILS genes of ingly, this clade encompasses also most Brachypodium and Oryza
the Viridiplantae (Figure 2). We could also identify putative PILS orthologs (Figure 2; Figure S1 in Supplementary Material). Inter-
genes in the genomes of sequenced algae from lineage Strepto- estingly, one Physcomitrella and two Selaginella PILS sequences
phyta from which the land plants evolved. However, we did not are present at the root of the Clade III (Figure 2). The relatively
low number of moss and the relative over amount of higher plant
sequences in Clade III may suggest particular importance of this
4 http://www.r-project.org/ clade in vascular plant evolution.

www.frontiersin.org October 2012 | Volume 3 | Article 227 | 62


Feraru et al. PILS evolution and structural diversification

FIGURE 2 | Phylogeny of PILS proteins. The phylogenetic tree of PILS Likelihood molecular phylogenetic analysis was performed in MEGA5 (Tamura
proteins can be divided into three clades: Clade I (blue), Clade II (green), and et al., 2011) by using 42 amino acid PILS sequences from algae,
Clade III (red). The Arabidopsis PILSes are found in the Clade II and Clade III, Physcomitrella, Selaginella, Brachypodium, Oryza, and Arabidopsis as
while Clade I is represented only by PILS proteins from algae. The Maximum explained in the Materials and Methods.

Frontiers in Plant Science | Plant Traffic and Transport October 2012 | Volume 3 | Article 227 | 63
Feraru et al. PILS evolution and structural diversification

FIGURE 3 | Phylogeny of PILS and PIN proteins. PILS proteins are amino acid sequences from algae, Physcomitrella, Selaginella,
evolutionarily distinct of PIN proteins. Note the two separated Brachypodium, and Arabidopsis. For a better visualization the algae
subtrees. The Maximum Likelihood phylogenetic analysis was and sometimes the Physcomitrella and Selaginella branches were
performed in MEGA5 (Tamura et al., 2011) by using PILS and PIN collapsed.

www.frontiersin.org October 2012 | Volume 3 | Article 227 | 64


Feraru et al. PILS evolution and structural diversification

Our analysis reveals that PILS proteins are evolutionarily


conserved throughout plant evolution and might uncover the
versatile importance of compartmentalized auxin homeostasis
throughout the plant kingdom.

PILS PROTEINS ARE EVOLUTIONARILY DISTINCT OF PIN PROTEINS


The canonical PIN proteins act in the cellular efflux of auxin at the
plasma membrane, but the most ancient members of PIN proteins
(PIN5-type) localize to the ER and regulate the subcellular com-
partmentalization of auxin and auxin metabolism (Mravec et al.,
2009). Hence, both PILS and PIN5-like proteins localize to the ER
and regulate auxin homeostasis, presumably by mediating auxin
transport at the ER (Mravec et al., 2009; Barbez et al., 2012; Bosco
et al., 2012; Ding et al., 2012).
Next, we investigated the evolutionary relationship between
PILS and PIN proteins (Figure 3; for sequence alignment see
Figure S3 in Supplementary Material). The phylogenetic analysis
of PILS and PIN sequences from algae, moss, spikemoss, and sev-
eral Angiosperms revealed that PILSes and PINs form two distinct
phylogenetic clades (Figure 3). Although having a similar pre-
dicted protein structure and possibly similar function at the ER,
PIN and PILS proteins are evolutionarily distinct in plants. In con-
trast to PILSes, we could not find any PIN sequence in the genomes
of Chlorophyta algae, such as Chlamydomonas, Micromonas, Ostre-
ococcus, or Volvox. Notably, a truncated PIN sequence has been
found in the genome of Spirogyra (De Smet et al., 2011). These
findings indicate that PILS proteins are more conserved during
plant evolution and seem evolutionarily older than PIN pro-
teins. Therefore, we assume that the PILS proteins are central to
the evolution of intracellular auxin transport, which presumably
has preceded the evolution of PIN-dependent intercellular and
intracellular auxin transport.

PILS DIVERSIFICATION IN ARABIDOPSIS THALIANA


FIGURE 4 | Chromosomal distribution of Arabidopsis thaliana PILS
The seven Arabidopsis PILS genes are placed on chromosome 1, genes. A. thaliana PILS genes are found on chromosome 1, 2, and 5.
2, and 5 (Figure 4). PILS1 to PILS4 are found on chromosome
1, PILS5 on chromosome 2, while PILS6 and PILS7 are both
placed at the ends of the chromosome 5 (Figure 4). PILS3 and
PILS4 are neighboring genes at the bottom arm of the chromo- To further elaborate on the recent duplication of PILS3 and
some 1 (Figure 4), indicating that PILS3 and PILS4 may resulted PILS4, we analyzed the microevolutionary relationship between
from a gene duplication event. To investigate PILS paralogs in A. PILS sequences of A. thaliana and A. lyrata (Figure S1 in Sup-
thaliana we performed comparative sequence analysis of genes plementary Material). A. lyrata is the closest known relative of A.
that surround the seven PILS genes (Figure 5). Rows of 200 thaliana and has a genome of eight chromosomes and six PILS
translated genes surrounding each of the seven PILS genes were proteins (Van Bel et al., 2012). In contrast, A. thaliana has five
analyzed in pairs by blastp program (Altschul et al., 1997) and chromosomes and seven PILS proteins (Barbez et al., 2012; Van Bel
homology between all genes in all unique pairs of gene rows were et al., 2012). It has been shown that the reduction of genome size in
determined according to E-value from blast results. Pairs of gene A. thaliana is the result of chromosomes fusion that presumably
rows with high diagonal homology were assigned as collinearity. occurred about 5 Mya (Yogeeswaran et al., 2005). The phyloge-
In the PILS1/PILS3/PILS4 group we found very high collinearity netic analysis revealed that all six A. lyrata PILSes have highly
between PILS3 and PILS4 (Figure 5A). These genes appear to be similar orthologs in A. thaliana, while AtPILS4 is a lineage-specific
products of very recent gene duplication. Between PILS1 and the gene (Figure S1 in Supplementary Material). This indicates that
PILS3/PILS4 pair we also found high collinearity (Figures 5B,C) AtPILS4 is a duplicated gene that has arisen after the separation of
and assume that these genes arose during full-genome duplication A. thaliana from A. lyrata 5 Mya.
at Brassicaceae family level (20 million years ago; Mya). Only very Next we addressed the sequence diversifications among the
weak or no collinearity was detectable between PILS5 and PILS7 A. thaliana PILS proteins and performed a ClustalW Multiple
(Figure 5D). sequence alignment (Larkin et al., 2007; Table 2; for sequence

Frontiers in Plant Science | Plant Traffic and Transport October 2012 | Volume 3 | Article 227 | 65
Feraru et al. PILS evolution and structural diversification

FIGURE 5 | Origin of PILS paralogs in Arabidopsis thaliana. (AD) PILS genes show high collinearity between gene pairs PILS3/PILS4 (A), PILS1/PILS3 (B),
and PILS1/PILS4 (C). No or only very weak collinearity could be detected between PILS5 and PILS7 (D).

alignment see Figure S4 in Supplementary Material). PILS3/PILS4 PILS GENE REGULATION AND ORGANIZATION IN ARABIDOPSIS
showed the highest identity (82%), followed by PILS1/PILS3 THALIANA
(69%), PILS5/PILS7 (64%), and PILS1/PILS4 (61%; Table 2). To get further insight into the regulation of PILS activity, we ana-
Interestingly, PILS2 and PILS6 showed sequence identity of lyzed in silico PILS gene organization and expression. A. thaliana
only 39% (Table 2). Taking together, the amino acid iden- PILS gene transcripts organization is pretty well-conserved regard-
tity proposes that A. thaliana PILS proteins belong to three ing the number and size of the exons (Figure 6). PILS3 to PILS6
subgroups: (i) PILS1/PILS3/PILS4, (ii) PILS5/PILS7, and (iii) genes contain nine exons with more or less conserved size and
PILS2/PIL6. placements (Figure 6). In contrast, PILS1, PILS2, and PILS7 have

www.frontiersin.org October 2012 | Volume 3 | Article 227 | 66


Feraru et al. PILS evolution and structural diversification

Table 2 | Percentages* of Arabidopsis thaliana PILS amino acid Our results show that PILS intron/exon organization is largely
sequence identity calculated by ClustalW multiple sequence conserved among PILS orthologous (Figure 7). The variations of
alignment (Larkin et al., 2007). 12 more or less exons may be the result of insertions, deletions, or
both processes along the lineage evolution. The subfamily of PILS2
PILS7 genes is most particular, because they display single-exon genes in
31 PILS6 Angiosperms and Selaginella and 3-exons genes in Physcomitrella
31 64 PILS5 (Figure 7). Thus, PILS genes belong to two structural groups with
39 28 43 PILS4 13 exons (PILS2 orthologs and PILS genes from Ostreococcus and
82 41 31 43 PILS3 Micromonas) and 712 exons (all the other PILSes; Figure 7).
32 28 29 39 30 PILS2 PILS gene activity can be detected in all tissues of A. thaliana
28 69 61 40 29 42 PILS1 as shown by RT-PCR (Barbez et al., 2012) or by micro array-
PILS1 PILS2 PILS3 PILS4 PILS5 PILS6 PILS7 based online tools such as Genevestigator5 . PILS genes display
either relatively low (PILS1, PILS4, PILS7 ), medium (PILS6 ) or
*The identity percentages were calculated as the identities between two PILS
high (PILS2, PILS3, and PILS5) expression levels (see text foot-
sequences, divided by the length of the alignment.
note 5). PILS2-to-AtPILS6 are expressed in seedlings, leaves, and
flowers (Figure 8; Barbez et al., 2012; see text footnote 5). PILS4
displays the strongest expression in the rosette leaves (Barbez et al.,
2012). PILS6 transcripts are particularly abundant in the stem and
together with PILS5 in the cauline leaves and flowers, while PILS2
is highest in siliques (Barbez et al., 2012). Interestingly, some PILS
gene products were excluded from certain tissues. PILS1 was found
to be expressed only in flowers, PILS2 and PILS3 are not expressed
in the stem, PILS5 is absent in the rosette leaves, stem, and siliques,
while PILS6 and PILS7 were present in all plant organs but not
in siliques (Barbez et al., 2012). Except PILS1, all the other PILSes
were expressed in seedlings, with PILS5 and PILS2 having the
highest expression (Barbez et al., 2012). PILS2-to-PILS6 showed
expression in pollen with PILS5 being the most abundant (see text
footnote 5). Based on these evidences it seems that PILS genes
show specific and partially overlapping expression patterns in all
plant tissues.
Alternative splicing might furthermore contribute to the regu-
latory complexity and diversity for PILS gene activity. PILS3 and
PILS5 appear to bear two and four alternative transcripts, respec-
tively6 . In both cases the alternative gene splicing seems to occur
in the 50 region and may modulate PILS3 and PILS5 function.
However, the importance of PILS transcript splicing remains to be
demonstrated.
The pronounced differences in the expression levels and tis-
sue distributions might indicate that PILS-mediated regulation of
plant growth and development may be largely determined by gene
FIGURE 6 | Organization of Arabidopsis thaliana PILS genes. Schematic regulation.
intron/exon representation of A. thaliana PILS genes (Van Bel et al., 2012).
Exons and introns are depicted in blue and gray, respectively. 30 UTR and 50
PILS PROTEIN ORGANIZATION IN ARABIDOPSIS THALIANA
UTR are in green. Stars are showing exons of similar sizes (nucleotides):
red (80), green (125), blue (122), yellow (93), gray (101), and black (125).
The temporal and spatial regulation of PILS genes will give rise
to tissue specific distribution of distinct PILS proteins. Next we
analyzed predicted PILS protein organization and searched for
a divergent exon/intron structure. PILS1 has 12 exons, PILS7 bares domains to speculate on PILS function. PILS proteins range in
eight exons and PILS2 is even intron less. The size of exon number size from 390 (43 kDa; PILS3) to 472 (52 kDa; PILS1) amino acids.
2 (80 nucleotides), 3 (125 nucleotides), and 4 (122 nucleotides) However, the predicted protein topology is highly similar for all
is largely kept in AtPILS genes and encode for a highly conserved PILS proteins. PILS proteins are presumably characterized by two
region of the predicted transmembrane helices 24 (109 aa in hydrophobic transmembrane regions found at N- and C-termini
total). Also a C-terminal transmembrane domain seems to be (Figure 9A; Tusndy and Simon, 1998, 2001; Spyropoulos et al.,
encoded by the last exon (125 nucleotides) in almost all AtPILS 2004). The two transmembrane regions flank a short hydrophilic
genes (Figure 6).
Next, we analyzed the intron/exon organization of PILS genes 5 www.genevestigator.com

from algae, Physcomitrella, Selaginella, and several Angiosperms. 6 http://www.arabidopsis.org

Frontiers in Plant Science | Plant Traffic and Transport October 2012 | Volume 3 | Article 227 | 67
Feraru et al. PILS evolution and structural diversification

FIGURE 7 | Organization of PILS orthologs. Schematic intron/exon Ostreococcus lucimarinus (OL), Ostreococcus tauri (OT),
representation of PILS genes from Arabidopsis lyrata (AL), Arabidopsis Physcomitrella patens (PP), Selaginella moellendorffii (SM), and Volvox
thaliana (AT), Brachypodium distachyon (BD), Chlamydomonas carteri (VC; Van Bel et al., 2012). Exons are depicted in blue boxes,
reinhardtii (CR), Micromonas (MRCC299), Oryza sativa (OS), introns in gray lines.

region (loop) with a presumable cytosolic orientation (Figure 9A). among the PILS proteins (Figure 9). In contrast, the loop is less
Each hydrophobic region appears to be organized in five trans- conserved and is the most divergent part of the PILS sequences.
membrane helices that are very similar and highly conserved We assume that the transmembrane domains have central roles in

www.frontiersin.org October 2012 | Volume 3 | Article 227 | 68


Feraru et al. PILS evolution and structural diversification

FIGURE 8 | Transcription pattern of Arabidopsis thaliana PILS published in Barbez et al. (2012). (A) As predicted by online server
genes. (A,B) Transcription of PILS genes in A. thaliana plant (A) Arabidopsis eFP Browser (http://bar.utoronto.ca/efp/cgi-bin/
and root (B). Based on the RT-PCR data from individual organs efpWeb.cgi); (B).

the putative carrier function, while the presumably cytosolic loop for PILS proteins by available online servers such as NetPhos
might have rather regulatory functions. (Blom et al., 1999) and NetPhosK (Blom et al., 2004). Interest-
PILS and PIN proteins share only 1018% sequence identity ingly, according with the number of the predicted serine, thre-
and belong to distinct protein families (Figure 3; Barbez et al., onine, and tyrosine phosphorylation sites, PILS proteins can be
2012). However, the predicted topology of PILS proteins is rem- grouped into three classes: (i) less than 10 (PILS5 and PILS7), (ii)
iniscent to the predicted topology of PIN proteins (Krecek et al., between 10 and 15 (PILS2 and PILS6), and (iii) more than 15
2009) and allowed the identification of this novel putative auxin (PILS1, PILS3, and PILS4). This finding may indicate the func-
carrier family (Barbez et al., 2012). Based on the hydrophilic loop tional diversification among the PILS members and may suggest
size, PIN proteins are sub-grouped into two subfamilies. The sub- that different phosphorylation-based mechanisms are required for
family of PIN1-type encompasses the PIN members with a long the regulation of PILS activity.
hydrophilic loop and PM localization (PIN1PIN4, PIN7), while
the subfamily of PIN5-type encompasses PIN5 and PIN8 that have DISCUSSION
very short hydrophilic loops and ER localization. Although PIN6 Auxin has pronounced importance for the plant development.
shows a reduction of the loop size, PIN6 is often included in Recent research shed light on a particular link between intracel-
the PIN1-type subfamily due to high sequence similarity in the lular auxin transport processes and auxin metabolism (Mravec
transmembrane regions (Krecek et al., 2009). However, it is also et al., 2009; Barbez et al., 2012; Bosco et al., 2012; Ding et al.,
localized to the ER in transient localization studies (Mravec et al., 2012). Here, we report in silico analyses of PILS putative auxin
2009). flux facilitator sequences from A. thaliana and revealed certain
Similarly to PIN proteins, PILS family members are character- features that might be functionally important for PILS activity.
ized by the presence of the Interpro auxin carrier domain. This The phylogenetic analysis of PILS sequences revealed that four
Interpro domain is relatively long and spans almost the whole Physcomitrella PILSes are found in Clade II, while only one is found
length of the PILS protein and, hence, it is difficult to ascertain in Clade III (Figure 2). Moreover, two Selaginella PILSes are found
functional residues within the domain. in each, Clade III and Clade II-PILS2 subclade, while four paralogs
Nothing is yet known about the post-translational modification are found in the Clade II-PILS6 subclade (Figure 2). This, together
of PILS proteins but generic phosphorylation sites (non-kinase- with the distribution of the Brachypodium, Oryza, and Arabidopsis
specific, such as serine, threonine, and tyrosine), kinase-specific PILS sequences, indicates that the initial PILS divergence occurred
phosphorylation sites and isoform variations could be predicted in two separate clades already at the level of Bryophytes. We do not

Frontiers in Plant Science | Plant Traffic and Transport October 2012 | Volume 3 | Article 227 | 69
Feraru et al. PILS evolution and structural diversification

FIGURE 9 | Structure of Arabidopsis thaliana PILS proteins. (A) by WebLogo (Schneider and Stephens, 1990) representing a ClustalW
Predicted topology of A. thaliana PILS5 protein. The prediction was multiple sequence alignment (Larkin et al., 2007) of 109 amino acids
done by HMMTOP 2.0 (Tusndy and Simon, 1998, 2001) and visualized from N-terminal region of A. thaliana PILS proteins (exons 24). Note
by TMRPres2D (Spyropoulos et al., 2004). Conserved amino acids in all the PILS sequence conservation at the highest, single symbol
seven PILS proteins are marked in red. (B) Sequence logos generated positions.

know if PILSes are present in the genome of Rhodophytes, but we derived from gametophyte of fern Adiantum can be found on
can speculate that Clade II- and Clade III-PILSes may have origi- NCBI but we could not identify any PILS sequence which indicates
nated before land plant evolution at the level of Streptophytes, as that PILSes might be not transcribed in gametophyte.
these algae are direct ancestors of land plants. Moreover, Clade II Combining the gene and protein analyses, AtPILS4 is likely to
presumably diverged before or during the origin of Embryophytes, be a recent duplication of AtPILS3, because they show very high
because this clade is already diversified in PILS2- and PILS6-like amino acid identity (Table 2), strong gene collinearity (Figure 5A),
subclades in mosses (Figure 2). Clade III particularly expanded and no particular PILS4 orthologs could be identified in the
during higher plant evolution (Figure 2; Figure S1 in Supple- genomes of the other sequenced species. PILS3/PILS4 seem to be
mentary Material). This clade is divided in PILS1/PILS3/PILS4 originally derived from PILS1 (69% amino acid identity; Table 2).
and PILS5/PILS7 subclades (Figure 2; Figure S1 in Supplementary Accordingly, by analyzing the amino acid sequence similarities and
Material). We could not estimate when these subclades emerged the PILS phylogeny, we can conclude that from seven PILSes in A.
because PILS sequences from conifers and ferns are either incom- thaliana genome, six in Oryza sativa ssp japonica and eight in
plete (only ESTs available) or not available. More than 30000 ESTs Brachypodium distachyon genome only four are true orthologs.

www.frontiersin.org October 2012 | Volume 3 | Article 227 | 70


Feraru et al. PILS evolution and structural diversification

The other PILS members presumably represent lineage-specific Figure S1 | Molecular phylogenetic analysis of PILS proteins. The diagram
duplications that occurred after the separation of the dicots and shows an extended phylogentic tree of PILS proteins with collapsed branches
for algae, Physcomitrella, and Selaginella. Note the high diversification of PILSes
monocots about 200250 Mya.
in Medicago and Populus. Because of incomplete sequences some of the
The existence of PILS2 as a single-exon gene in most species is PILSes were eliminated. The evolutionary history was inferred by using the
intriguing since single-exon genes are rather typical for prokary- Maximum Likelihood method based on the Data specific model (Nei and Kumar,
otes. However, single-exon or intronless genes are present in 2000). The tree with the highest log likelihood (55875.7936) is shown. The
eukaryotic genomes (Sakharkar et al., 2004) and can have many percentage of trees in which the associated taxa clustered together is shown
above the branches. Initial tree(s) for the heuristic search were obtained
origins, but could pinpoint the relatedness to a prokaryotic
automatically as follows. When the number of common sites was <100 or less
gene (Zou et al., 2011). However, moss PILS2 orthologs display than one fourth of the total number of sites, the maximum parsimony method
intronexon structure (Figure 7) and might suggest that PILS2 was used; otherwise BIONJ method with MCL distance matrix was used. A
genes lost the intron structure during evolution. discrete Gamma distribution was used to model evolutionary rate differences
Our findings might highlight certain functional diversifications among sites [five categories (+G, parameter = 2.6899)]. The rate variation model
allowed for some sites to be evolutionarily invariable ([+I], 3.7299% sites). The
among PILS proteins. Notably, PILS2 and PILS5 have only 29% tree is drawn to scale, with branch lengths measured in the number of
amino acid sequence identities (Table 2), display very diverged substitutions per site. The analysis involved 75 nucleotide sequences. All
gene organization (Figure 6), and belong to diverse evolutionary positions with less than 0% site coverage were eliminated. That is, fewer than
sub clades (Figure 2). However, their gene regulation and function 100% alignment gaps, missing data, and ambiguous bases were allowed at any
seem to be highly similar in Arabidopsis, because PILS2 and PILS5 position. There were a total of 1113 positions in the final dataset. Evolutionary
analyses were conducted in MEGA5 (Tamura et al., 2011).
have overlapping expression pattern in the root transition zone
and redundantly control seedling growth and development (Bar- Figure S2 | Alignment of PILS amino acid sequences. The multiple amino
bez et al., 2012). Therefore, defined research is needed to evaluate acid alignment of PILSes was generated by using Muscle in MEGA5 software
the functional importance of the distinct features of the respective (Tamura et al., 2011). This alignment was generated for the phylogenetic analysis
PILS genes and PILS proteins. presented in the Supplementary Figure 1. The alignment for the smaller tree
presented in the Figure 2 is similar but with less sequences.

ACKNOWLEDGMENTS
Figure S3 | Alignment of PILS and PIN amino acid sequences. The multiple
We are indebted to the Vienna Science and Technology Fund
alignment was generated by using Muscle in MEGA5 software (Tamura et al.,
(WWTF; to Elena Feraru, Mugurel I. Feraru, Jrgen Kleine- 2011).
Vehn), Czech Science Foundation Grant GAP305/11/2476 (to Jan
Petrek) and Charles University in Prague, SVV 265203/2012 (to Figure S4 | Alignment of Arabidopsis thaliana PILS amino acid sequences.
Jan Petrek and Stanislav Vosolsobe). We thank Elke Barbez for A multiple sequence alignment generated by ClustalW server (Larkin et al.,
helpful discussions. 2007) of the seven PILSes is shown. Amino acids are color coded: red (small,
hydrophobic, aromatic, not Y), blue (acidic); magenta (basic), green (hydroxyl,
amine, amide, basic), gray (others). , Identical amino acids; :, conserved
SUPPLEMENTARY MATERIAL substitutions (same color group); ., semi-conserved substitution (similar
The Supplementary Material for this article can be found online at shapes).
http://www.frontiersin.org/Plant_Traffic_and_Transport/10.3389/
fpls.2012.00227/abstract Table S1 | Sequence information.

REFERENCES Blom, N., Sicheritz-Ponten, T., Gupta, expression in plants. Annu. Rev. Glweiler, L., Guan, C., Mller, A., Wis-
Altschul, S. F., Madden, T. L., Schf- R., Gammeltoft, S., and Brunak, Genet. 43, 265285. man, E., Mendgen, K., Yephremov,
fer, A. A., Zhang, J., Zhang, Z., S. (2004). Prediction of post- Chen, R., Hilson, P., Sedbrook, J., A., et al. (1998). Regulation of polar
Miller, W., et al. (1997). Gapped translational glycosylation and Rosen, E., Caspar, T., and Mas- auxin transport by AtPIN1 in Ara-
BLAST and PSI-BLAST: a new gen- phosphorylation of proteins from son, P. H. (1998). The Arabidop- bidopsis vascular tissue. Science 282,
eration of protein database search the amino acid sequence. Proteomics sis thaliana AGRAVITROPIC 1 222622230.
programs. Nucleic Acids Res. 25, 4, 16331649. gene encodes a component of the Geisler, M., Blakeslee, J. J., Bouchard,
33893402. Bosco, C. D., Dovzhenko, A., Liu, X., polar-auxin-transport efflux carrier. R., Lee, O. R., Vincenzetti, V.,
Barbez, E., Kube, M., Rolck, J., Bziat, Woerner, N., Rensch, T., Eismann, Proc. Natl. Acad. Sci. U.S.A. 95, Bandyopadhyay, A., et al. (2005).
C., Penck, A., Wang, B., et al. M., et al. (2012). The endoplas- 1511215117. Cellular efflux of auxincatalyzed
(2012). A novel putative auxin car- mic reticulum localized PIN8 is a De Smet, I., Voss, U., Lau, S., Wilson, by the Arabidopsis MDR/PGP
rier family regulates intracellular pollen specific auxin carrier involved M., Shao, N., Timme, R. E., et al. transporter AtPGP1. Plant J. 44,
auxin homeostasis in plants. Nature in intracellular auxin homeostasis. (2011). Unraveling the evolution of 179194.
485, 119122. Plant J. 71, 860870. auxin signaling. Plant Physiol. 155, Jones, A. M., and Venis, M. A.
Bennett, M. J., Marchant, A., Green, H. Braun, N., Wyrzykowska, J., Muller, 209221. (1989). Photoaffinitylabeling
G., May, S. T., Ward, S. P., Mill- P., David, K., Couch, D., Perrot- Ding, Z., Wang, B., Moreno, I., of indole-3-acetic acid-binding
ner, P. A., et al. (1996). Arabidopsis Rechenmann, C., et al. (2008). Con- Duplkov, N., Simon, S., Carraro, proteins in maize. Proc.
AUX1 gene: a permease-like regula- ditional repression of AUXIN BIND- N., et al. (2012). ER-localized auxin Natl. Acad. Sci. U.S.A. 86,
tor of root gravitropism. Science 273, ING PROTEIN1 reveals that it coor- transporter PIN8 regulates auxin 61536156.
948950. dinates cell division and cell expan- homeostasis and male gametophyte Jurado, S., Abraham, Z., Manzano, C.,
Blom, N., Gammeltoft, S., and Brunak, sion during postembryonic shoot development in Arabidopsis. Nat. Lpez-Torrejn, G., Pacios, L. F.,
S. (1999). Sequence- and structure- development in Arabidopsis and Commun. 3, 941. and Del Pozo, J. C. (2010). The
based prediction of eukaryotic pro- tobacco. Plant Cell 20, 27462762. Finet, C., and Jaillais, Y. (2012). AUX- Arabidopsis cell cycle F-box protein
tein phosphorylation sites. J. Mol. Chapman, E. J., and Estelle, M. (2009). OLOGY: when auxin meets plant SKP2A binds to auxin. Plant Cell 22,
Biol. 294, 13511362. Mechanism of auxin-regulated gene evo-devo. Dev. Biol. 369, 1931. 38913904.

Frontiers in Plant Science | Plant Traffic and Transport October 2012 | Volume 3 | Article 227 | 71
Feraru et al. PILS evolution and structural diversification

Krecek, P., Skupa, P., Libus, J., Naramoto, Ruiz Rosquete, M., Barbez, E., and topology prediction. J. Mol. Biol. rearrangement events in the evo-
S., Tejos, R., Friml, J., et al. Kleine-Vehn, J. (2012). Cellular 283, 489506. lutionary history of A. thaliana.
(2009). The PIN-FORMED (PIN) auxin homeostasis: gatekeeping Tusndy, G. E., and Simon, I. (2001). Genome Res. 15, 505515.
protein family of auxin transporters. is housekeeping. Mol. Plant 5, The HMMTOP transmembrane Zazmalov, E., Murphy, A. S., Yang, H.,
Genome Biol. 10, 249. 772786. topology prediction server. Bioinfor- Hoyerov, K., and Hosek, P. (2010).
Larkin, M. A., Blackshields, G., Brown, Sakharkar, M. K., Chow, V. T. K., matics 17, 849850. Auxin transporters why so many?
N. P., Chenna, R., McGettigan, P. Chaturvedi, I., Mathura, V. S., Shap- Utsuno, K., Shikanai, T., Yamada, Y., and Cold Spring Harb. Perspect. Biol. 2,
A., McWilliam, H., et al. (2007). shak, P., and Kangueane, P. (2004). Hashimoto, T. (1998). Agr, an agrav- a001552.
ClustalW and clustalX version A report on single exon genes itropic locus of Arabidopsis thaliana, Zhao, Y. (2012). Auxin biosynthesis: a
2 (2007). Bioinformatics 23, (seg) in eukaryotes. Front. Biosci. 9, encodes a novel membrane-protein simple two-step pathway converts
29472948. 32623267. family member. Plant Cell Physiol. tryptophan to indole-3-acetic acid in
Leyser, O. (2006). Dynamic integration Schneider, T. D., and Stephens, R. M. 39, 11111118. plants. Mol. Plant 5, 334338.
of auxin transport and signalling. (1990). Sequence logos: a new way to Van Bel, M., Proost, S., Wischnitzki, E., Zou, M., Guo, B., and He, S. (2011).
Curr. Biol. 16, R424-33. display consensus sequences. Nucleic Movahedi, S., Scheerlinck, C., Van de The roles and evolutionary patterns
Luschnig, C., Gaxiola, R. A., Grisafi, P., Acids Res. 18, 60976100. Peer,Y., et al. (2012). Dissecting plant of intronless genes in deuterostomes.
and Fink, G. R. (1998). EIR1, a root- Spyropoulos, I. C., Liakopoulos, T. D., genomes with the PLAZA compara- Comp. Funct. Genomics 2011, 18.
specific protein involved in auxin Bagos, P. G., and Hamodrakas, S. tive genomics platform. Plant Phys-
transport, is required for gravitro- J. (2004). TMRPres2D: high quality iol. 158, 590600. Conflict of Interest Statement: The
pism in Arabidopsis thaliana. Genes visual representation of transmem- Vanneste, S., and Friml, J. (2009). Auxin: authors declare that the research was
Dev. 12, 21752187. brane protein models. Bioinformat- a trigger for change in plant develop- conducted in the absence of any com-
Mravec, J., Skupa, P., Bailly, A., ics 20, 32583260. ment. Cell 136, 10051016. mercial or financial relationships that
Hoyerov, K., Krecek, P., Bielach, Tamura, K., Peterson, D., Peterson, Whelan, S., and Goldman, N. (2001). could be construed as a potential con-
A., et al. (2009). Subcellular home- N., Stecher, G., Nei, M., and A general empirical model of pro- flict of interest.
ostasis of phytohormone auxin is Kumar, S. (2011). MEGA5: molec- tein evolution derived from multiple
mediated by the ER-localized PIN5 ular evolutionary genetics analysis protein families using a maximum- Received: 12 September 2012; accepted:
transporter. Nature 459, 11361140. using maximum likelihood, evolu- likelihood approach. Mol. Biol. Evol. 21 September 2012; published online: 12
Mller, A., Guan, C., Glweiler, L., Tn- tionary distance, and maximum par- 18, 691699. October 2012.
zler, P., Huijser, P., Marchant, A., et simony methods. Mol. Biol. Evol. 28, Wisniewska, J., Xu, J., Seifertov, D., Citation: Feraru E, Vosolsobe S, Fer-
al. (1998). AtPIN2 defines a locus 27312739. Brewer, P. B., Ruzicka, K., Blilou, I., aru MI, Petrek J and Kleine-Vehn J
of Arabidopsis for root gravitropism Teale, W. D., Ditengou, F. A., et al. (2006). Polar PIN localization (2012) Evolution and structural diversi-
control. EMBO J. 17, 69036911. Dovzhenko, A. D., Li, X., Molendijk, directs auxin flow in plants. Science fication of PILS putative auxin carriers
Nei, M., and Kumar, S. (2000). Molecu- A. M., Ruperti, B., et al. (2008). 312, 883. in plants. Front. Plant Sci. 3:227. doi:
lar Evolution and Phylogenetics. New Auxin as a model for the integration Woodward, A. W., and Bartel, B. (2005). 10.3389/fpls.2012.00227
York: Oxford University Press. of hormonal signal processing and A receptor for auxin. Plant Cell 17, This article was submitted to Frontiers in
Petrsek, J., Mravec, J., Bouchard, R., transduction. Mol. Plant 1, 229237. 24252429. Plant Traffic and Transport, a specialty of
Blakeslee, J. J., Abas, M., Seifer- Tromas, A., Braun, N., Muller, P., Kho- Xu, T., Wen, M., Nagawa, S., Fu, Y., Frontiers in Plant Science.
tov, D., et al. (2006). PIN proteins dus, T., Paponov, I. A., Palme, K., Chen, J.-G., Wu, M.-J., et al. (2010). Copyright 2012 Feraru, Vosolsobe, Fer-
perform a rate-limiting function in et al. (2009). The AUXIN BIND- Cell surface- and rho GTPase-based aru, Petrek and Kleine-Vehn. This is an
cellular auxin efflux. Science 312, ING PROTEIN 1 is required for dif- auxin signaling controls cellular open-access article distributed under the
914918. ferential auxin responses mediating interdigitation in Arabidopsis. Cell terms of the Creative Commons Attribu-
Robert, S., Kleine-Vehn, J., Barbez, root growth. PLoS ONE 4, e6648. 143, 99110. tion License, which permits use, distrib-
E., Sauer, M., Paciorek, T., Baster, doi:10.1371/journal.pone.0006648 Yogeeswaran, K., Frary, A., York, T. L., ution and reproduction in other forums,
P., et al. (2010). ABP1 medi- Tusndy, G. E., and Simon, I. (1998). Amenta, A., Lesser, A. H., Nasrallah, provided the original authors and source
ates auxin inhibition of clathrin- Principles governing amino acid J. B., et al. (2005). Comparative are credited and subject to any copy-
dependent endocytosis in Arabidop- composition of integral mem- genome analyses of Arabidopsis right notices concerning any third-party
sis. Cell 143, 111121. brane proteins: applications to spp.: inferring chromosomal graphics etc.

www.frontiersin.org October 2012 | Volume 3 | Article 227 | 72


REVIEW ARTICLE
published: 18 October 2012
doi: 10.3389/fpls.2012.00225

AUX/LAX family of auxin influx carriersan overview


Ranjan Swarup 1* and Benjamin Pret 2
1
School of Biosciences and Centre for Plant Integrative Biology, University of Nottingham, Loughborough, UK
2
Laboratory of Plant Development Biology, SBVME/Institute for Biotechnology and Environmental Biology, CEA Cadarache, St. Paul lez Durance, France

Edited by: Auxin regulates several aspects of plant growth and development. Auxin is unique among
Markus Geisler, University of plant hormones for exhibiting polar transport. Indole-3-acetic acid (IAA), the major form of
Fribourg, Switzerland
auxin in higher plants, is a weak acid and its intercellular movement is facilitated by auxin
Reviewed by:
influx and efflux carriers. Polarity of auxin movement is provided by asymmetric localization
Christian Luschnig, University of
Natural Resources and Life of auxin carriers (mainly PIN efflux carriers). PIN-FORMED (PIN) and P-GLYCOPROTEIN
Sciences, Austria (PGP) family of proteins are major auxin efflux carriers whereas AUXIN1/LIKE-AUX1
Eva Zazimalova, Institute of (AUX/LAX) are major auxin influx carriers. Genetic and biochemical evidence show that
Experimental Botany of the
Academy of Sciences of the Czech
each member of the AUX/LAX family is a functional auxin influx carrier and mediate auxin
Republic, Czech Republic related developmental programmes in different organs and tissues. Of the four AUX/LAX
*Correspondence: genes, AUX1 regulates root gravitropism, root hair development and leaf phyllotaxy
Ranjan Swarup, School of whereas LAX2 regulates vascular development in cotyledons. Both AUX1 and LAX3
Biosciences and Centre for Plant have been implicated in lateral root (LR) development as well as apical hook formation
Integrative Biology, University of
Nottingham, Sutton Bonington
whereas both AUX1 and LAX1 and possibly LAX2 are required for leaf phyllotactic
Campus, Loughborough, patterning.
LE12 5RD, UK.
e-mail: ranjan.swarup@ Keywords: AUXLAX, auxin transport, auxin, AUX1, LAX1, LAX2, LAX3, influx carriers
nottingham.ac.uk

INTRODUCTION AUXIN DISTRIBUTION: SIMPLY COMPLEX


Genetic, molecular and pharmacological approaches have ele- Use of auxin response reporters for example DR5 (Ulmasov et al.,
gantly demonstrated that auxin regulates several aspects of plant 1997) and IAA2 (Abel et al., 1994) and auxin sensors DII 28
growth and development including embryo (Steinmann et al., (Brunoud et al., 2012) have provided great insight into auxin
1999; Wolters et al., 2011), root (Swarup et al., 2001, 2004, 2005), accumulation and distribution in plant tissues. These studies
lateral root (LR) (Swarup et al., 2008; Pret et al., 2009a,b), leaf show that auxin gradients are crucial for several aspects of plant
(Bainbridge et al., 2008; Guenot et al., 2012) and flower devel- development including tropic responses, organ development and
opment. Auxin also plays a key role in plant tropic responses meristem size. For example, several studies show that differen-
(Swarup et al., 2001, 2004, 2005), vascular development (Sieburth tial accumulation of auxin between lower and upper side of a
and Deyholos, 2006; Pret et al., 2012) and regulation of apical gravistimulated root regulate root bending (Ottenschlger et al.,
dominance (Aloni et al., 2006; Prusinkiewicz et al., 2009). At cel- 2003; Swarup et al., 2005); auxin maxima are known to reg-
lular level, auxin regulates cell division, cell elongation and cell ulate organ development (Sabatini et al., 1999; Benkov et al.,
differentiation (Petrsek and Friml, 2009; Vanneste and Friml, 2003; Blilou et al., 2005; Grieneisen et al., 2007) and even auxin
2009). minimum has been implicated in regulating seed dispersal in
Indole-3-acetic acid (IAA) is the major form of auxin in higher Arabidopsis (Sorefan et al., 2009). Genetic and pharmacological
plants and was the first plant hormone to be discovered (Went, studies show that auxin transport is crucial for establishment of
1926). Besides, there are a few other naturally occurring auxins. auxin gradients and disruption of these gradients result in sev-
Auxins are organic compounds composed of an indole ring cova- eral auxin related developmental defects. Besides auxin transport,
lently linked to a carboxylic acid group (or a benzene ring in the local auxin biosynthesis, metabolism, conjugation/deconjugation
case of phenylacetic acidPAA). In addition, several synthetic of active auxins to/from their inactive conjugated forms and
compounds with auxin like activities have also been identified. Of intracellular auxin movement can also control and fine tune auxin
them 2,4-dichlorophenoxyacetic acid (2,4-D) is one of the most accumulation in specific cell or tissues types (Chandler, 2009;
widely used in auxin research. Ikeda et al., 2009; Petrsek and Friml, 2009; Vanneste and Friml,
Auxin is unique among all plant hormones for exhibiting polar 2009).
transport. It is primarily synthesized in the shoot apex and devel-
oping leaf primordia and is then transported either through the AUXIN TRANSPORTERS: PROVIDING DIRECTION
bulk flow in the phloem in a non-polar fashion or actively in As per chemiosmotic polar diffusion hypothesis, the term first
a polar manner to distal target tissues (Swarup and Bennett, coined by Goldsmith (1977) based on the famous work of Rubery
2003). and Sheldrake (1974) and Raven (1975) cellular IAA movement is

www.frontiersin.org October 2012 | Volume 3 | Article 225 | 73


Swarup and Pret AUX/LAX Auxin influx carriers

facilitated by combined activities of auxin influx and efflux carri- In Arabidopsis, evidence has been provided that
ers. IAA is a weak acid (pKa 4.75) and at mildly acidic apoplastic AUXIN1/LIKE-AUX1 (AUX/LAX) family of auxin transporters
pH, only a small portion of IAA (IAAH 15%) is able to passively are major influx carriers whereas PIN-FORMED (PIN) and
diffuse inside the cell but the majority (85%) of IAA remains in P-GLYCOPROTEIN (PGP) family members are major auxin
its dissociated form (IAA ) and would require a carrier for its efflux carriers (Figure 1B). Among the efflux carriers, PIN family
active uptake across the cell (Figure 1A). Inside the cell, at pH 7.0, is most well studied and PIN homologs are found throughout
all IAA remains in its polar IAA form and would require auxin the plant kingdom (Paponov et al., 2005; Pattison and Catal,
efflux carriers (Zazmalov et al., 2010). Chemiosmotic hypothe- 2011; Wang et al., 2011; Carraro et al., 2012). In Arabidopsis,
sis also predicted that the polarity of auxin movement is provided PINs are encoded by a small gene family comprising of eight
by asymmetric localization of auxin carriers. members (Grunewald and Friml, 2010; Bosco et al., 2012).
They have been shown to play crucial roles in several aspects
of plant growth and development including root meristem
patterning, LR development, vascular development and embryo
development (Friml et al., 2002; Benkov et al., 2003; Friml
et al., 2003; Reinhardt, 2003; Blilou et al., 2005; Sieburth and
Deyholos, 2006). PIN proteins are localized either on the plasma
membrane (PIN1, 2, 3, 4, and 7) or in the ER (PIN5 and 8)
and thus play a key part in both intercellular and intracellular
auxin movement and regulation of auxin homeostasis (Mravec
et al., 2009; Bosco et al., 2012). It is now well established that
directionality of auxin movement is provided by asymmetric
localization of PIN proteins. For example, PIN1 is localized on
the basal rootward face of vascular cells (Glweiler et al., 1998)
facilitating rootward movement of auxin. In contrast, PIN2 is
asymmetrically localized at the apical shootward face of LRC
and epidermal cells and basal rootward face of cortical cells of
the meristem thus creating an auxin reflux loop (Blilou et al.,
2005; Wisniewska et al., 2006; Rahman et al., 2010). In response
to gravity PIN3 is asymmetrically localized on the lateral face
of the root to facilitate differential movement of auxin between
upper and lower faces of a gravi-stimulated root (Friml et al.,
2002).
In addition to PINs, a novel PIN like family of auxin trans-
port facilitators termed PILS (PIN-LIKES) has recently been
discovered by in silico studies and appears to be involved in the
regulation of auxin homeostasis in Arabidopsis (Barbez et al.,
2012).
Three members of the PGP class of ABC transporters PGP1,
PGP4, and PGP19 have also been implicated in regulating auxin
transport. Both PGP1 and PGP19 are involved in auxin efflux
(Noh et al., 2003; Blakeslee et al., 2007), PGP4 has been demon-
strated to participate in the shootward (basipetal) redirection of
auxin from the root apex and there is some evidence to suggest
that PGP4 functions as an auxin influx carrier (Terasaka et al.,
2005; Kube et al., 2012). However, Cho et al. (2007) showed that
PGP4 functions as an auxin efflux carrier. Direct auxin measure-
ment experiment in heterologous expression system suggests that
PGP4 can indeed function both as an efflux and influx carrier
(Yang and Murphy, 2009).
Recently, a role for the nitrate transporter NRT1.1 in auxin
FIGURE 1 | Auxin chemical properties and chemioosmotic hypothesis
influx has been demonstrated in heterologous system, providing
of auxin transport. The percentages of the anionic and protonated forms an explanation for its ability to alter LR formation depend-
of IAA (indole acetic acid) are given as a funtion of pH with an emphasis on ing on the nitrogen status of the plant (Krouk et al., 2010).
the apoplastic and cytosolic pH ranges (A). Chemiosmotic auxin transport Interestingly, NRT1.1 acts as a transceptor as it is also involved
model showing the different families of transporters: AUX/LAX, PIN,
in the perception/transduction of the nitrate signal (Ho et al.,
and PGP. The artificial form of auxin 1-NAA (1-Naphthalene acetic acid) is
lipophilic and diffuses freely inside the cell (B).
2009). Further understanding of the auxin transport function of
NRT1.1 is of great interest as this provides a direct mechanism for

Frontiers in Plant Science | Plant Traffic and Transport October 2012 | Volume 3 | Article 225 | 74
Swarup and Pret AUX/LAX Auxin influx carriers

developmental effects of auxin in response to nutrient status of In Arabidopsis, AUX1 belongs to a small gene family compris-
the soil. ing of four highly conserved genes, AUX1 and LIKE-AUX1 (LAX)
genes, LAX1, LAX2, and LAX3 and form a plant- specific sub-
THE AUX/LAX FAMILY OF AUXIN INFLUX CARRIERS: class within the amino acid/auxin permease (AAAP) super family
HISTORICAL PERSPECTIVE (Young et al., 1999; Pret et al., 2012) (Figure 2). These genes
The existence of auxin influx carriers was first suggested by encode multi membrane spanning transmembrane proteins. In a
(Rubery and Sheldrake, 1974) when they showed a saturable very elegant study, Swarup et al. (2004) using a pH sensitive YFP
component for auxin uptake in Parthenocissus tricuspidata crown as a probe to determine the topology of AUX1 showed that AUX1
gall suspension cells. Using sealed zucchini membrane vesicles, has 11 transmembrane segments with N terminal residing inside
Lomax et al. (1985) provided further evidence that IAA uptake the cell and C-terminal outside. AUX/LAX genes share extensive
is an active process and is driven by proton motive force. They sequence similarity (Pret et al., 2012). There is ample evidence to
also proposed that auxin influx carrier acts as a proton sym- suggest that these genes have originated from a common ances-
porter that was later confirmed by Sabater and Rubery (1987). tor through gene duplication. For example, AUX1 shares 82,
In 1996, Delbarre et al. showed that the synthetic auxin 2, 4-D 78, and 76% identity with LAX1, LAX2, and LAX3, respectively,
was a substrate for auxin influx carrier but not the lipophilic and they also show well conserved gene structure (Pret et al.,
auxin 1-naphthalene acetic acid (1-NAA) that is able to diffuse 2012) (Figure 2), At functional level evidence has been provided
freely into the cells (Figure 1B). They also showed that almost that these genes encode functional auxin influx carriers (Yang
75% of 2,4-D uptake was carrier mediated thus underlining the et al., 2006; Swarup et al., 2008; Pret et al., 2012) and muta-
importance of auxin influx carriers in auxin uptake. tions in these genes result in auxin related developmental defects
In the same year Bennett et al. (1996) cloned the AUX1 (Figure 3; Bennett et al., 1996; Swarup et al., 2001, 2004, 2005,
gene. aux1 mutants are agravitropic and were first identified in 2007, 2008; Bainbridge et al., 2008; Pret et al., 2012). Despite the
an screen for auxin (2,4-D) resistance (Maher and Martindale, conservation of biochemical function, these genes show mostly
1980). AUX1 gene showed similarity to amino acid transporters non-redundant expression and during the course of evolution
and the fact that IAA is structurally similar to tryptophan have subfunctionalized to facilitate auxin related developmen-
led Bennett et al. to propose that AUX1 encodes a putative tal programmes in different plant organs and tissues as reviewed
auxin influx permease. Detailed characterization of aux1 mutants below.
revealed that they show selective resistance to various auxins
and root agravitropic defect of aux1 can be rescued by applica- ROOT GRAVITROPISM: AUX1 AT THE HELM
tion of lipophilic auxin 1-NAA (Yamamoto and Yamamoto, 1998; The founder member of the AUX/LAX family, AUX1 is well doc-
Marchant et al., 1999). Swarup et al. (2001) later showed that in umented to play a key role in root gravitropic response. AUX1
Arabidopsis roots, besides in protophloem, AUX1 is expressed in is expressed in tissues that are involved in gravity perception,
tissues that are involved in gravity perception (columella), sig-
nal transmission (LRC) and response (epidermis). They also were
able to provide a molecular basis of aux1 root gravitropic phe-
notype when they showed that aux1 mutants were defective in
basipetal auxin transport. The first direct evidence to show that
AUX1 is an auxin permease came from Erik Nielsens group when
they expressed AUX1 in Xenopus laevis oocytes and showed a sat-
urable, pH dependent increase in IAA uptake (Yang et al., 2006).
Their experiments provided the first direct evidence that AUX1 is
a high affinity auxin transporter. Later Carrier et al. (2008) pro-
vided first direct evidence of the affinity of an auxin influx carrier
for its cognate ligand. They provided evidence that IAA binds to
AUX1 in a pH dependent fashion with maximal binding taking
place between pH5 and 6.

THE AUX/LAX FAMILY: A CASE FOR


SUBFUNCTIONALIZATION
AUX/LAX homologs have been reported to be present through-
out the plant kingdom (Hochholdinger et al., 2000; de Billy et al.,
2001; Kamada et al., 2003; Schrader et al., 2003; Schnabel and
Frugoli, 2004; Pret et al., 2007; Hoyerov et al., 2008; Oliveros- FIGURE 2 | The AUX/LAX family of auxin influx transporters. Genetic
Valenzuela et al., 2008; Shen et al., 2010; Pattison and Catal, organization of the AUX/LAX genes sequences showing exons (gray boxes)
2011; Carraro et al., 2012) and may have evolved before the and introns (bars) (Pret et al., 2012) (A). Phylogenetic tree of the AUX/LAX
evolution of land plants as AUX/LAX like sequences have been protein sequences generated from a ClustalW alignment (B). Percentage of
identity between the members of the AUX/LAX family (identity is given a
reported to be present in several single-celled and colony-forming the score returned upon the ClustalW alignment) (C).
Chlorophyta species (De Smet et al., 2011).

www.frontiersin.org October 2012 | Volume 3 | Article 225 | 75


Swarup and Pret AUX/LAX Auxin influx carriers

FIGURE 3 | Mutations in AUX/LAX genes result in auxin related primordia whereas LAX3 in the cortical and epidermal cells in contact with
developmental defects. AUX1 regulates root gravitropism (Swarup et al., the primordia and aux1 lax3 double mutants have severely delayed lateral
2001, 2004, 2005). AUX1 is expressed in tissues that are involved in root emergence (B). LAX2 regulates vascular patterning in cotyloedons
gravity perception, signal transmission, and response and mutation in (Pret et al., 2012). LAX2 is expressed in the vascular tissues during
aux1 cause agravitropic roots (A). Both AUX1 and LAX3 regulate lateral root embryo development and lax2 mutants show vascular breaks in the
development (Swarup et al., 2008). AUX1 is expressed in lateral root cotyledons (C). (Scale bars 20 m).

signal transmission and response (Figure 3A). Mutation in AUX1 because protonated IAA is membrane permeable, influx carriers
results in severely agravitropic roots. Using an auxin respon- play only a supplemental role and backs up computer simula-
sive IAA2:GUS reporter, Swarup et al. (2001) showed that aux1 tion studies that estimate that carrier mediated IAA uptake is 15
mutants had defects in auxin movement from the root apex to times greater than the diffusion when AUX1 is expressed in the
the distal elongation zone. Later using a transactivation based root epidermal cells (Swarup et al., 2005; Kramer and Bennett,
approach, Swarup et al. (2005) mapped the auxin transport route 2006).
during a gravitropic response and provided evidence that AUX1 Except AUX1, no other member of the AUX/LAX family plays
was important for facilitating movement of auxin from the site a role in root gravitropic response (Pret et al., 2012). Apart from
of gravi-perception to gravi-response. Computer simulations of some expression of LAX2 and LAX3 in the columella cells, none of
auxin fluxes through elongation zone tissues suggest that expres- them are expressed in the tissues that are involved in gravity signal
sion of auxin influx carrier AUX1 and efflux carrier PIN2 in the transmission (LRC) or response (epidermis). Also both lax2 and
epidermis minimize the effect of radial diffusion while facilitat- lax3 single mutants do not show any root gravitropic defect and
ing basipetal auxin transport (Swarup et al., 2005). Thus while lax2 aux1 double mutants are no more severe than aux1 (Pret
PIN2 provides directionality of auxin movement, AUX1 appears et al., 2012).
essential for the efficient auxin uptake by expanding epidermal
cells. More recently, Monshausen et al. (2011) have provided fur- LATERAL ROOT DEVELOPMENT: THE EMERGING STORY
ther insight into the importance of AUX1 in root gravitropism. LRs originate from the pericycle cells that divide and self organize
Using confocal microscopy and fluorescent pH sensors, they show to create a new primordium (Dubrovsky et al., 2000, 2001). As the
that there is an increase in the surface pH on the lower side of LR formation process occurs deep inside the primary root tissues
a gravistimulated wildtype but not aux1 roots. One important (Figure 4A), the newly formed organ has to penetrate through
implication of this finding is that increase in the root apoplas- several layers of cells ranging from 3 in Arabidopsis (Swarup et al.,
tic pH will result in more IAA in its ionic IAA form. IAA is not 2008; Pret et al., 2009a,b) to as many as 15 in rice (Rebouillat
membrane permeable and will require a carrier (AUX1) mediated et al., 2008). Several lines of evidences implicate auxin in LR
uptake. This work helps to clarify a common misconception that initiation and development (Pret et al., 2009a,b).

Frontiers in Plant Science | Plant Traffic and Transport October 2012 | Volume 3 | Article 225 | 76
Swarup and Pret AUX/LAX Auxin influx carriers

expression in front of the primordia. Indeed, LAX3 turned out


to be auxin inducible. But how does LAX3 facilitate emergence?
To find answer, Swarup et al. (2008) used a substractive transcrip-
tomics approach to identify genes that are co expressed with LAX3
in outer tissues and discovered that several cell wall remodeling
genes were expressed in these cells in LAX3 dependent fashion.
Progression of the primordium inside the root tissues has long
been associated with production of cell wall remodeling enzymes
(Cosgrove, 2000, 2005) and this led Swarup et al. (2008) to pro-
pose that auxin from the LR primordia enters the cortical cells
and induces LAX3 expression (Figure 4). The activity of LAX3 at
the plasma membrane is then proposed to facilitate auxin uptake
in the same cell and would reinforce LAX3 expression. As a result
more and more auxin would accumulate in the cortical cells that
will result in the induction of cell wall remodeling enzymes that
is then proposed to facilitat smooth passage of the primordium
through the cortex. The similar mechanism can then allow pri-
mordia passage through the epidermis. Therefore, as per this
hypothesis, LAX3 participates in the creation of an auxin sink in a
few cells and its expression in the outer tissues is dependent on its
position compared to the source of auxin (the LR primordium)
FIGURE 4 | Lateral root are formed within the pericycle deep inside the
resulting in a typical all or nothing response.
primary root and have to emerge through the outer tissue, passing
through the endodermal, cortical (blue), and epidermal cells (A).
Mechanism proposed by Swarup et al. (2008) describing how auxin (IAA) ROOT HAIR DEVELOPMENT: BACK SEAT DRIVING
entering the cortical cell induces the expression of LAX3. This generates As the roots grow, old cells are continuously being pushed
the establishment of a positive feedback loop that triggers high auxin levels
upwards and they pass through zones of elongation and differ-
and subsequent induction of cell wall remodeling (CWR) genes, such as the
polygalacturonase (PG) (B). entiation. Root hairs are produced from a subset of epidermal
cells in the differentiation zone. Auxin plays a key role in several
aspects of root development including maintenance of the root
The initiation phase starts when two adjacent pericycle cells apical meristem (Blilou et al., 2005); epidermal cell development
start to divide asymmetrically and create a LR primordium (Pret (Sabatini et al., 1999; Grieneisen et al., 2007) and initiation and
et al., 2009a,b). This process is associated with the creation of an continued growth of root hairs (Pitts et al., 1998; Grebe et al.,
auxin maximum in the pericycle founder cells (Benkov et al., 2002; Rahman et al., 2002; Knox et al., 2003; Fischer et al., 2006).
2003; De Smet et al., 2007). Auxin influx carriers have been impli- Interestingly, despite the importance of auxin in root hair devel-
cated in regulating LR development (Marchant et al., 2002; De opment, no auxin influx carrier is expressed in the root hair cells.
Smet et al., 2007; Swarup et al., 2008) Marchant et al. (2002) Jones et al. (2009) discovered that AUX1 is expressed in the neigh-
demonstrated that AUX1 is expressed in the pericycle cells before boring non-hair cells. In contrast to AUX1, auxin efflux carrier
the first periclinal division and the aux1 mutant displays a 50% PIN2 is expressed in both hair and non-root hair cells. Despite
reduction in the number of LRs (Hobbie and Estelle, 1995). no AUX1 being expressed in the hair cells, root hair length in the
Analysis of the auxin response reporter IAA2:GUS revealed that aux1 mutant was shorter but can be restored to wildtype levels
auxin content and distribution is altered in the aux1 mutant that by treatment with exogenous auxin clearly implicating AUX1 in
led Marchant et al. (2002) to conclude that AUX1 facilitates IAA root hair growth. Furthermore, epidermal expression of AUX1
loading into the vascular transport system. was not detected in werewolf/myb23 mutants that lack non-hair
Working on LAX3, Swarup et al. (2008) provided evidence that cells. These mutants have shorter root hairs but can be restored to
auxin influx carriers also regulate LR emergence (Swarup et al., wildtype levels by auxin treatment. This led Jones et al. (2009)
2008). They discovered that mutations in auxin influx carrier to conclude that non-hair cells affect auxin abundance in hair
LAX3 resulted in reduced number of emerged LR. Interestingly cells. Computer simulation studies indicate that expression of
they found that the total number of initiation events was AUX1 in the non-hair cells result in over 10 fold accumulation
increased in lax3 and this led them to suggest that initiation and of auxin in these cells compared to the adjacent hair cells. Due
emergence compete for the same source of auxin (Lucas et al., to the PIN2 activity, auxin can be effluxed out of the non-hair
2008a,b). cells and into the apoplast and despite the lack of AUX1 in the
Molecular characterization of LAX3 by Swarup et al. (2008) hair cells, high auxin concentration can still be maintained in the
revealed that LAX3 is expressed in the cortical and epidermal cells hair cells in the differentiation zone up to 500 m from the root
specifically situated in front of the LR primordia (Figure 3B). apex. In contrast, in the aux1 mutants, there will be significantly
From Benkov et al. (2003) work, they knew that auxin maxima less accumulation of auxin in the root hair cells as due to the
is localized in the LR primordia and this led them to test the tan- slow rate of diffusion, most of the auxin will either be recycled
talising possibility that auxin itself could be the signal for LAX3 to the vascular tissues or will be lost through the epidermis before

www.frontiersin.org October 2012 | Volume 3 | Article 225 | 77


Swarup and Pret AUX/LAX Auxin influx carriers

it reaches the differentiation zone (Jones et al., 2009). Thus their mutant combinations, they showed that lax3 mutants had par-
work suggests that AUX1 helps to maintain high auxin levels in tial hookless phenotype. They also showed that upon treatment
the differentiation zone and facilitates root hair growth. with ethylene, both aux1 and lax3 had less exaggerated api-
AUX1 has also been implicated in maintenance of hair cell cal hook and aux1 lax3 double mutants apical hook defect
polarity (Grebe et al., 2002). Root hairs are formed on the basal was as severe as seen when treated with auxin influx inhibitor
side of the hair cells but they initiate from a more basal position 1-NOA (1-naphthoxyacetic acid). More detailed characterization
in presence of auxin. Mutation in aux1 results in apical shifting of including kinetics of hook development led Vandenbussche et al.
the root hairs. aux1 mutants also had 30 times higher frequency of (2010) to conclude that LAX3 is the major auxin influx carrier in
double hair formation compared to wildtype. These results pro- hook development assisted by AUX1 and AUX1 appears to play a
vided a clear link between auxin transport and the establishment major role in ethylene-mediated hook exaggeration.
of apical-basal epidermal polarity in Arabidopsis.
PHYLLOTACTIC PATTERNING: TEAM WORK
EMBRYONIC ROOT CELL ORGANIZATION: SIZE MATTERS Phyllotaxy is the arrangement of organ primordia on a plant
Arabidopsis root meristem is highly organized and a combination stem. Spiral phyllotaxy is the most common phyllotactic pat-
of apical basal and radial patterning inputs establish the position- terns in nature where new organ primorida initiates roughly at
ing of the stem cell niche (Scheres, 2007). Both genetic and phar- an angle of 137.5 and has intrigued biologists for generations
macological approaches show that auxin transport plays a key (Fleming, 2005). Auxin transport appears to be crucial for the
role in this process. Working in Arabidopsis embryo, Ugartechea- development of phyllotactic patterns. Auxin response reporter
Chirino et al. (2010) provided first evidence for the role of auxin DR5 based studies in Arabidopsis show that auxin maxima is
influx carriers in patterning of the embryonic root. They showed localized at the site where new primordia originate (Benkov
that the quadruple aux/lax mutants had severely disorganized et al., 2003; Heisler et al., 2005; Smith et al., 2006). Reinhardt
radicle apex and had significant increase in the root-cap cell et al. (2003) showed that asymmetric localization of auxin efflux
number, average cell size, or both. carrier PIN1 is important for the establishment of this auxin
maxima that provides instructive signal for the formation of pri-
VASCULAR DEVELOPMENT: A ROLE FOR LAX2 mordia. Stieger et al. (2002) provided evidence for a role for
Genetic and pharmacological studies have clearly shown that auxin influx carriers in phylltactic patterning. Using inhibitors of
auxin regulates vascular development (Reinhardt, 2003; Petrsek auxin influx carrier (Parry et al., 2001; Lankova et al., 2010), they
and Friml, 2009). Recently, Pret et al. (2012) provided evidence revealed that auxin influx carriers were required for proper local-
that LAX2 is important for vascular development in cotyledons ization of leaf primordia. Further proof for the involvement of
(Figure 3C). Using a promoter:GUS approach they show that auxin influx carriers in phyllotactic patterning was provided by
LAX2 is expressed in procambial and vascular tissues during Reinhardt et al. (2003) and Bainbridge et al. (2008). Working on
embryogenesis. Examination of the lax2 mutants revealed that pin1 mutants, Reinhardt et al. (2003) showed that localized auxin
they had higher propensity of discontinuity in vascular strands application on pin1 meristem can restore primordia formation
in the cotyledons. Though LAX2 expression is also detected very but such localized auxin application on aux1 pin1 double mutants
early in developing leaves at the sites of initiating veins surpris- resulted in wider primordia formation. Using single and multiple
ingly, Pret et al. (2012) did not find any apparent defect in aux lax mutants and their combinations Bainbridge et al. (2008)
vascular patterning in lax2 leaves. AUX1 is also expressed in devel- then showed that AUX/LAX genes act redundantly to regulate
oping leaves and it will be interesting to see if lax2 aux1 and phyllotactic patterning in Arabidopsis. They revealed that in the
quadruple aux/lax mutants show any defect in vascular patterning aux/lax quadruple mutant, primordia formed at irregular angles
in leaves. (as compared to 137.5 in controls) and unusually often showed
primordia clusters. Study of the multiple aux/lax mutant com-
APICAL HOOK DEVELOPMENT: CROSS TALK AT ITS BEST binations revealed that besides quadruple, aux1 lax1 lax2, aux1
In dicotyledonous seedlings, apical hook protects the meris- lax1 lax3, and aux1 lax1 combinations had defect in phyllotac-
tem when seedlings emerge from the soil. In the light, apical tic patterning. They also reported that patterning in inflorescence
hooks opens, cotyledons expand and the photosynthesis begins meristem was also defective in the same mutant combinations.
(Chen and Chory, 2011). Besides light, plant hormones auxin, This led them to conclude that AUX1 and LAX1 act redundantly
ethylene, gibberellins, and brassinosteroids are crucial for the to regulate phyllotactic patterning in Arabidopsis. They also dis-
maintenance and development of apical hook. Using a very ele- covered that the phyllotactic defect in quadruple and aux1 lax1
gant transactivation based approach Vandenbussche et al. (2010) lax2 mutants was more severe compared to aux1 lax1 lax3 and
showed that the auxin response maximum on the concave side aux1 lax1 mutants combination. On this basis they conclude that
is essential for correct hook development. The first evidence to LAX2 may have a redundant function in regulating phyllotactic
implicate auxin influx carriers in apical hook development was patterning. Interestingly LAX2 is expressed in the vasculature but
provided by Roman et al. (1995) when they showed that aux1 not expressed in the shoot apical meristem itself and to account
mutants are defective in hook development, a finding later con- for its involvement in phyllotactic patterning, Bainbridge et al.
firmed by Stepanova et al. (2007). More recently, Vandenbussche (2008) propose that LAX2 may increase the sink strength by
et al. (2010) have provided evidence that LAX3 is also involved pulling auxin out of the L1 layer and thus inhibiting primordium
in apical hook development. Using single and multiple aux/lax formation in this region.

Frontiers in Plant Science | Plant Traffic and Transport October 2012 | Volume 3 | Article 225 | 
Swarup and Pret AUX/LAX Auxin influx carriers

ROLE OF AUX-LAX GENES IN BIOTIC INTERACTIONS may also play a key role in both symbiotic and pathogenic plant
Many plant-associated bacteria are known to synthesize auxins, microbe interactions affecting penetration of auxin in the host
including IAA, which leads to diverse outcomes for the plant plant cell.
ranging from simple growth stimulation to promoting symbi- In actinorhizal plant Casuarina glauca, a symbiotic interaction
otic interactions and even pathogenesis (Spaepen et al., 2007). with soil actinobacteria from the Frankia species leads to infection
Sequencing of several bacterial genomes has revealed the existence of the host plant cell and subsequent development of a new organ
of different auxin synthesis pathways with a high degree of sim- the actinorhizal nodule the site of bacterial nitrogen fixation.
ilarity with plant pathways (Spaepen et al., 2007). For example, Nodule formation in Casuarina glauca, can be severely impaired
in actinobacterium Frankia, at least two auxin synthesis path- by treatment with auxin influx inhibitor 2-NOA suggesting that
ways have been identified correlating with the production of auxin influx activity is associated with nodule formation (Pret
two naturally occurring auxins: IAA and PAA. Interestingly, pro- et al., 2007). This is further supported by molecular studies that
duction of both these auxins is increased in nitrogen-deprived show that a homolog of Arabidopsis AUX1 CgAUX1 is expressed
medium (Perrine-Walker et al., 2010). Furthermore, nitrogen in all the infected cells, underlining its importance in the infection
deprivation promotes nitrogen-fixing symbiosis demonstrating process (Figure 5A).
that the establishment of this symbiotic interaction can be modu- Auxin transport has also been implicated in plant pathogen
lated by environmental (and genetic) factors. On the other hand, interactions. The cyst nematode is a sedentary endoparasite of
manipulation of auxin perception in the plant hosts appears to plant roots that penetrate the root and migrate toward a cell
be a common mechanism during plant-microbe interactions. located near the vasculature to initiate feeding. The nematode
For instance, a plant miRNA induced by Pseudomonas syringae then secretes effector proteins in the host cell, leading to genetic
flagellin-derived peptide reduces the expression of the auxin reprogramming into a feeding site called a syncytium (Davis
receptor TIR1 and its homologs AFB2 and AFB3 (Navarro et al., et al., 2008). One of these effector proteins (19C07) identified in
2006). In recent years evidence is emerging that auxin transport Heterodera schachtii was found to interact with Arabidopsis LAX3

FIGURE 5 | Auxin influx transporters are involved in biotic effector proteins are released in the plant cell. The 19C07 protein has
interactions. During the actinorhizal symbiosis, Frankia infects the plant been shown to directly interact with LAX3. High expression levels of
cell and triggers the expression of CgAUX1, resulting in auxin (IAA) LAX3 in the feeding site and adjacent cells participates in the
uptake by the plant. Auxin is presumably synthesized by the incorporation of these cells in the feeding sites by promoting cell wall
actinobacteria (Pret et al., 2007) (A). During cyst nematode infection, remodeling (CWR) (Lee et al., 2011) (B).

www.frontiersin.org October 2012 | Volume 3 | Article 225 | 79


Swarup and Pret AUX/LAX Auxin influx carriers

auxin transporter in a yeast two-hybrid assay (Lee et al., 2011). in the root epidermis is necessary for gravitropic response but
The auxin transporter is strongly expressed in the syncytium, not for LR initiation. LR formation occurs preferentially at the
together with the auxin inducible cell wall related gene polygalac- convex side of roots. Lucas et al. (2008a,b) showed that the
turonase that is likely to be involved in cell wall loosening. Auxin LR formation can also be induced by forcing root gravitropic
accumulation in the cells near the syncytium and subsequent response and proposed a mechanistic model based on an auxin
cell wall modification would prime the cells for incorporation budget system to describe auxin consumption by LR initiation
into the syncytium (Figure 5B). This suggests that the nema- and gravitropic response. Thus, modeling approaches are provid-
tode manipulates auxin flow to promote formation of its own ing greater insight into the dynamics of auxin distribution and are
feeding site. This is supported by the fact that nematode infec- likely to be at the forefront in the prediction of testable hypothesis
tivity is reduced in the aux1 lax3 double mutant (Lee et al., of how auxin fluxes control plant development.
2011).
Among the myriad of biotic interactionsboth pathogenic CONCLUSION AND PERSPECTIVES
and symbiotic, it can be expected that auxin import is involved In the last decade, genetic and cell biology approaches have
in a vast number of mechanisms underlying plant interactions resulted in greater understanding of molecular basis of cellular
with other organisms. A comprehensive study of AUX-LAX genes auxin transport. Auxin concentration in plant is affected by either
expression during these interactions associated with their func- changes in its metabolism or transport, both of which are altered
tional role both in the model plant Arabidopsis and other non- to control plant development (Petrsek and Friml, 2009; Vanneste
model organisms would greatly improve our understanding of and Friml, 2009). Auxin influx carriers play a key role in regulat-
these mechanisms. ing auxin homeostasis. It has been shown that their targeting is
cell type specific (Pret et al., 2012) and this adds another level of
MODELING AUXIN TRANSPORT regulation at tissue level. Identification of proteins that regulate
Modeling studies have provided greater insight into the role their targeting will provide further insight into their localization
of auxin transport in auxin related developmental programmes and how this affects auxin distribution. Modeling studies have
(Swarup et al., 2005; Kramer and Bennett, 2006; Kramer, 2008; also been crucial in highlighting the role of auxin influx carriers
Laskowski et al., 2008; Jones et al., 2009; Prusinkiewicz et al., 2009; in establishing and maintaining auxin gradients during root grav-
Mironova et al., 2010; Szymanowska-Puka and Nakielski, 2010; itropism (Swarup et al., 2005) and root hair development (Jones
Vernoux et al., 2011; Bridge et al., 2012). Modeling auxin fluxes et al., 2009). Further refinement of the models taking into account
help us to understand how these fluxes are established and main- all auxin transporters including AUX/LAX, PIN, PGP, and PILS
tained, as well as their effect on growth and development. For promise to provide further understanding of the role of auxin
example, recently, a computational approach studied the dynam- transporters in auxin distribution.
ics of auxin transport by taking into account pH modifications
(Steinacher et al., 2012). The model predicts that auxin-induced ACKNOWLEDGMENTS
acidification of cell wall compartments increases the rate of both Authors acknowledge the support of the Biotechnology and
auxin influx and efflux. This study also emphasizes the role of Biological Sciences Research Council (BBSRC) and Engineering
proton fluxes, an aspect of the auxin transport machinery that and Physical Sciences Research Council (EPSRC) funding to
has been poorly studied. Modeling studies have already provided the Centre for Plant Integrative Biology (CPIB); Marie Curie
unparalleled insight into the role of AUX1 in establishing and Intra-European Fellowship within the 7th European Community
maintaining auxin gradients during root gravitropism (Swarup Framework Programme PIEF-GA-2008-220506 (Benjamin Pret)
et al., 2005) and root hair development (Jones et al., 2009). and a grant from the Agence Nationale de la Recherche Retour
Modeling studies also suggest that AUX1-dependent transport post-doctorants 2011 EmPhos to Benjamin Pret.

REFERENCES Barbez, E., Kube, M., Rolck, J., Bziat, Blakeslee, J. J., Bandyopadhyay, A., Lee, carrier involved in intracellular
Abel, S., Oeller, P. W., and Theologis, A. C., Penck, A., Wang, B., et al. O. R., Mravec, J., Titapiwatanakun, auxin homeostasis. Plant J. 71,
(1994). Early auxin-induced genes (2012). A novel putative auxin car- B., Sauer, M., et al. (2007). 860870.
encode short-lived nuclear proteins. rier family regulates intracellular Interactions among PIN-FORMED Bridge, L. J., Mirams, G. R.,
Proc. Natl. Acad. Sci. U.S.A. 91, auxin homeostasis in plants. Nature and P-glycoprotein auxin trans- Kieffer, M. L., King, J. R., and
326330. 485, 119122. porters in Arabidopsis. Plant Cell 19, Kepinski, S. (2012). Distinguishing
Aloni, R., Aloni, E., Langhans, M., Benkov, E., Michniewicz, M., Sauer, 131147. possible mechanisms for auxin-
and Ullrich, C. I. (2006). Role of M., Teichmann, T., Seifertov, D., Blilou, I., Xu, J., Wildwater, M., mediated developmental control
cytokinin and auxin in shaping Jrgens, G., et al. (2003). Local, Willemsen, V., Paponov, I., Friml, in Arabidopsis: models with two
root architecture: regulating vascu- efflux-dependent auxin gradi- J., et al. (2005). The PIN auxin Aux/IAA and ARF proteins, and
lar differentiation, lateral root ini- ents as a common module for efflux facilitator network con- two target gene-sets. Math. Biosci.
tiation, root apical dominance and plant organ formation. Cell 115, trols growth and patterning in 235, 3244.
root gravitropism. Ann. Bot. 97, 591602. Arabidopsis roots. Nature 433, Brunoud, G., Wells, D. M., Oliva, M.,
883893. Bennett, M. J., Marchant, A., Green, H. 3944. Larrieu, A., Mirabet, V., Burrow,
Bainbridge, K., Guyomarch, S., Bayer, G., May, S. T., Ward, S. P., Millner, Bosco, C. D., Dovzhenko, A., Liu, A. H., et al. (2012). A novel
E., Swarup, R., Bennett, M., Mandel, P. A., et al. (1996). Arabidopsis X., Woerner, N., Rensch, T., sensor to map auxin response
T., et al. (2008). Auxin influx AUX1 gene: a permease-like regu- Eismann, M., et al. (2012). The and distribution at high spatio-
carriers stabilize phyllotactic pat- lator of root gravitropism. Science endoplasmic reticulum localized temporal resolution. Nature 482,
terning. Genes Dev. 22, 810823. 273, 948950. PIN8 is a pollen specific auxin 103106.

Frontiers in Plant Science | Plant Traffic and Transport October 2012 | Volume 3 | Article 225 | 80
Swarup and Pret AUX/LAX Auxin influx carriers

Carraro, N., Tisdale-Orr, T. E., L. (2000). Pericycle cell prolifer- inflorescence meristem. Curr. Biol. Lankova, M., Smith, R., Pesek, B.,
Clouse, R. M., Knller, A. S., and ation and lateral root initiation 15, 18991911. Kubes, M., Zazimalova, E., Petrasek,
Spicer, R. (2012). Diversification in Arabidopsis. Plant Physiol. 124, Ho, C. H., Lin, S. H., Hu, H. C., and J., et al. (2010). Auxin influx
and expression of the PIN, 16481657. Tsay, Y. F. (2009). CHL1 functions as inhibitors 1-NOA, 2-NOA and
AUX/LAX, and ABCB families Dubrovsky, J. G., Rost, T. L., Coln- a nitrate sensor in plants. Cell 138, CHPAA interfere with membrane
of putative auxin transporters in Carmona, A., and Doerner, P. 11841194. dynamics in tobacco cells. J. Exp.
Populus. Front. Plant Sci. 3:17. doi: (2001). Early primordium morpho- Hobbie, L., and Estelle, M. (1995). Bot. 61, 35893598.
10.3389/fpls.2012.00017 genesis during lateral root initiation The axr4 auxin-resistant mutants of Laskowski, M., Grieneisen, V. A.,
Carrier, D., Abu Bakar, N., Swarup, R., in Arabidopsis thaliana. Planta 214, Arabidopsis thaliana define a gene Hofhuis, H., Hove, C. A., Hogeweg,
Callaghan, R., Napier, R., Bennett, 3036. important for root gravitropism and P., Mare, A. F., et al. (2008).
M. J., et al. (2008). The binding of Fischer, U., Ikeda, Y., Ljung, K., lateral root initiation. Plant J. 7, Root system architecture from
auxin to the Arabidopsis auxin influx Serralbo, O., Singh, M., Heidstra, 211220. coupling cell shape to auxin
transporter AUX1. Plant Physiol. R., et al. (2006). Vectorial informa- Jones, A. R., Kramer, E. M., Knox, K., transport. PLoS Biol. 6:e307. doi:
148, 529535. tion for Arabidopsis planar polarity Swarup, R., Bennett, M. J., Lazarus, 10.1371/journal.pbio.0060307
Chandler, J. W. (2009). Local auxin pro- is mediated by combined AUX1, C. M., et al. (2009). Auxin trans- Lee, C., Chronis, D., Kenning, C., Pret,
duction: a small contribution to a EIN2, and GNOM activity. Curr. port through non-hair cells sus- B., Hewezi, T., Davis, E. L., et al.
big field. Bioessays 31, 6070. Biol. 16, 21432149. tains root-hair development. Nat. (2011). The novel cyst nematode
Chen, M., and Chory, J. (2011). Fleming, A. J. (2005). Formation of pri- Cell Biol. 11, 7884. effector protein 19C07 interacts
Phytochrome signaling mecha- mordia and phyllotaxy. Curr. Opin. Hochholdinger, F., Wulff, D., Reuter, with the Arabidopsis auxin influx
nisms and the control of plant Plant Biol. 8, 5358. K., Park, W., and Feix, G. (2000). transporter LAX3 to control feeding
development. Trends Cell Biol. 21, Friml, J., Vieten, A., Sauer, M., Weijers, Tissue-specific expression of AUX1 site development. Plant Physiol. 155,
664671. D., Schwarz, H., Hamann, T., et al. in maize roots. J. Plant Physiol. 157, 866880.
Cho, M., Lee, S. H., and Cho, H. (2003). Efflux-dependent auxin 315319. Lomax, T. L., Mehlhorn, R. J., and
T. (2007). P-glycoprotein4 dis- gradients establish the apical-basal Hoyerov, K., Perry, L., Hand, P., Briggs, W. R. (1985). Active auxin
plays auxin efflux transporter-like axis of Arabidopsis. Nature 426, Lankov, M., Kocbek, T., May, S., uptake by zucchini membrane vesi-
action in Arabidopsis root hair cells 147153. et al. (2008). Functional charac- cles: quantitation using ESR vol-
and tobacco cells. Plant Cell 19, Friml, J., Wisniewska, J., Benkov, terization of PaLAX1, a putative ume and delta pH determinations.
39303943. E., Mendgen, K., and Palme, K. auxin permease, in heterologous Proc. Natl. Acad. Sci. U.S.A. 82,
Cosgrove, D. J. (2000). Loosening of (2002). Lateral relocation of auxin plant systems. Plant Physiol. 146, 65416545.
plant cell walls by expansins. Nature efflux regulator PIN3 mediates 11281141. Lucas, M., Godin, C., Jay-Allemand,
407, 321326. tropism in Arabidopsis. Nature 415, Ikeda, Y., Men, S., Fischer, U., C., and Laplaze, L. (2008a). Auxin
Cosgrove, D. J. (2005). Growth of the 806809. Stepanova, A., Alonso, J., Ljung, K., fluxes in the root apex co-regulate
plant cell wall. Nat. Rev. Mol. Cell Glweiler, L., Guan, C., Mller, et al. (2009). Local auxin biosyn- gravitropism and lateral root initia-
Biol. 6, 850861. A., Wisman, E., Mendgen, K., thesis modulates gradient-directed tion. J. Exp. Bot. 59, 5566.
Davis, E. L., Hussey, R. S., Mitchum, Yephremov, A., et al. (1998). planar polarity in Arabidopsis. Nat. Lucas, M., Gudon, Y., Jay-
M. G., and Baum, T. J. (2008). Regulation of polar auxin transport Cell Biol. 11, 731738. Allemand, C., Godin, C., and
Parasitism proteins in nematode- by AtPIN1 in Arabidopsis vascular Kamada, M., Yamasaki, S., Fujii, N., Laplaze, L. (2008b). An auxin
plant interactions. Curr. Opin. Plant tissue. Science 282, 22262230. Higashitani, A., and Takahashi, transport-based model of
Biol. 11, 360366. Goldsmith, M. H. (1977). The polar H. (2003). Gravity-induced root branching in Arabidopsis
de Billy, F., Grosjean, C., May, S., transport of auxin. Ann. Rev. Plant modification of auxin transport and thaliana. PLoS ONE 3:e3673. doi:
Bennett, M., and Cullimore, J. Physiol. 28, 439478. distribution for peg formation in 10.1371/journal.pone.0003673
V. (2001). Expression studies on Grebe, M., Friml, J., Swarup, R., Ljung, cucumber seedlings: possible roles Maher, E. P., and Martindale, S. J.
AUX1-like genes in Medicago trun- K., Sandberg, G., Terlou, M., et al. for CS-AUX1 and CS-PIN1. Planta (1980). Mutants of Arabidopsis
catula suggest that auxin is required (2002). Cell polarity signaling in 218, 1526. thaliana with altered responses to
at two steps in early nodule devel- Arabidopsis involves a BFA-sensitive Knox, K., Grierson, C. S., and Leyser, auxins and gravity. Biochem. Genet.
opment. Mol. Plant Microbe Interact. auxin influx pathway. Curr. Biol. 12, O. (2003). AXR3 and SHY2 interact 18, 10411053.
14, 267277. 329334. to regulate root hair development. Marchant, A., Bhalerao, R., Casimiro,
Delbarre, A., Muller, P., Imhoff, V., and Grieneisen, V. A., Xu, J., Mare, A. Development 130, 57695777. I., Eklf, J., Casero, P. J., Bennett,
Guern, J. (1996). Comparison F., Hogeweg, P., and Scheres, B. Kramer, E. (2008). Computer models of M., et al. (2002). AUX1 promotes
of mechanisms controlling (2007). Auxin transport is sufficient auxin transport: a review and com- lateral root formation by facilitat-
uptake and accumulation of 2, to generate a maximum and gra- mentary. J. Exp. Bot. 59, 4553. ing indole-3-acetic acid distribution
4-dichlorophenoxy acetic acid, dient guiding root growth. Nature Kramer, E. M., and Bennett, M. J. between sink and source tissues in
naphthalene-1-acetic acid, and 449, 10081013. (2006). Auxin transport: a field in the Arabidopsis seedling. Plant Cell
indole-3-acetic acid in suspension- Grunewald, W., and Friml, J. (2010). flux. Trends Plant Sci. 11, 382386. 14, 589597.
cultured tobacco cells. Planta 198, The march of the PINs: develop- Krouk, G., Lacombe, B., Bielach, Marchant, A., Kargul, J., May, S.,
532541. mental plasticity by dynamic polar A., Perrine-Walker, F., Malinska, Muller, P., Delbarre, A., Perrot-
De Smet, I., Tetsumura, T., De Rybel, B., targeting in plant cells. EMBO J. K., Mounier, E., et al. (2010). Rechenmann, C., et al. (1999).
Frey, N. F., Laplaze, L., Casimiro, I., 29, 27002714. Nitrate-regulated auxin transport AUX1 regulates root grav-
et al. (2007). Auxin-dependent reg- Guenot, B., Bayer, E., Kierzkowski, D., by NRT1.1 defines a mechanism for itropism in Arabidopsis by
ulation of lateral root positioning in Smith, R. S., Mandel, T., Zadnikova, nutrient sensing in plants. Dev. Cell facilitating auxin uptake within
the basal meristem of Arabidopsis. P., et al. (2012). PIN1- leaf initia- 18, 927937. root apical tissues. EMBO J. 18,
Development 134, 681690. tion in Arabidopsis thaliana. Plant Kube, M., Yang, H., Richter, G. 20662073.
De Smet, I., Vo, U., Lau, S., Wilson, Physiol. 159, 15011510. L., Cheng, Y., Modzinska, E., Mironova, V. V., Omelyanchuk, N.
M., Shao, N., Timme, R., et al. Heisler, M. G., Ohno, C., Das, P., Wang, X., et al. (2012). The A., Yosiphon, G., Fadeev, S. I.,
(2011). Unraveling the evolution of Sieber, P., Reddy, G. V., Long, J. A., Arabidopsis concentration- Kolchanov, N. A., Mjolsness, E.,
auxin signaling. Plant Physiol. 155, et al. (2005). Patterns of auxin trans- dependent influx/efflux transporter et al. (2010). A plausible mecha-
209221. port and gene expression during ABCB4 regulates cellular auxin nism for auxin patterning along the
Dubrovsky, J. G., Doerner, P. W., primordium development revealed levels in the root epidermis. Plant J. developing root. BMC Syst. Biol.
Coln-Carmona, A., and Rost, T. by live imaging of the Arabidopsis 69, 640654. 4:98. doi: 10.1186/1752-0509-4-98

www.frontiersin.org October 2012 | Volume 3 | Article 225 | 81


Swarup and Pret AUX/LAX Auxin influx carriers

Monshausen, G. B., Miller, N. D., Petrsek, J., and Friml, J. (2009). Auxin Regulation of phyllotaxy by polar Spaepen, S., Vanderleyden, J., and
Murphy, A. S., and Gilroy, S. (2011). transport routes in plant develop- auxin transport. Nature 426, Remans, R. (2007). Indole-3-
Dynamics of auxin-dependent ment. Development 136, 26752688. 255260. acetic acid in microbial and
Ca2+ and pH signaling in root Pret, B., De Rybel, B., Casimiro, I., Roman, G., Lubarsky, B., Kieber, J. J., microorganism-plant signaling.
growth revealed by integrating Benkov, E., Swarup, R., Laplaze, Rothenberg, M., and Ecker, J. R. FEMS Microbiol. Rev. 31, 425448.
high-resolution imaging with L., et al. (2009a). Arabidopsis lat- (1995). Genetic analysis of ethylene Steinmann, T., Geldner, N., Grebe, M.,
automated computer vision-based eral root development: an emerging signal transduction in Arabidopsis Mangold, S., Jackson, C. L., Paris,
analysis. Plant J. 65, 309318. story. Trends Plant Sci. 14, 399408. thaliana: five novel mutant loci inte- S., et al. (1999). Coordinated polar
Mravec, J., Skupa, P., Bailly, A., Pret, B., Larrieu, A., and Bennett, M. grated into a stress response path- localization of auxin efflux carrier
Hoyerov, K., Krecek, P., Bielach, J. (2009b). Lateral root emergence: way. Genetics 139, 13931409. PIN1 by GNOM ARF GEF. Science
A., et al. (2009). Subcellular home- a difficult birth. J. Exp. Bot. 60, Rubery, P. H., and Sheldrake, A. 286, 316318.
ostasis of phytohormone auxin is 36373643. R. (1974). Carrier-mediated auxin Steinacher, A., Leyser, O., and Clayton,
mediated by the ER-localized PIN5 Pret, B., Swarup, K., Ferguson, A., transport Planta 118, 101121. R. H. (2012). A computational
transporter. Nature 459, 11361140. Seth, M., Yang, Y., Dhondt, S., et al. Sabater, M., and Rubery, P. H. (1987). model of auxin and pH dynamics in
Navarro, L., Dunoyer, P., Jay, F., Arnold, (2012). AUX/LAX genes encode a Auxin carriers in Cucurbita vesi- a single plant cell. J. Theor. Biol. 296,
B., Dharmasiri, N., Estelle, M., family of auxin influx transporters cles. 1. Imposed perturbations of 8494.
et al. (2006). A plant miRNA that perform distinct functions dur- transmembrane pH and electri- Stepanova, A. N., Yun, J., Likhacheva,
contributes to antibacterial resis- ing Arabidopsis development. Plant cal potential gradients characterized A. V., and Alonso, J. M. (2007).
tance by repressing auxin signaling. Cell 24, 112. by radioactive probes. Planta 171, Multilevel interactions between
Science 312, 436439. Pret, B., Swarup, R., Jansen, L., Devos, 501506. ethylene and auxin in Arabidopsis
Noh, B., Bandyopadhyay, A., Peer, W. G., Auguy, F., Collin, M., et al. Sabatini, S., Beis, D., Wolkenfelt, H., roots. Plant Cell 19, 21692185.
A., Spalding, E. P., and Murphy, (2007). Auxin influx activity is asso- Murfett, J., Guilfoyle, T., Malamy, J., Stieger, P., Reinhardt, D., and
A. S. (2003). Enhanced gravi- and ciated with Frankia infection dur- et al. (1999). An auxin-dependent Kuhlemeier, C. (2002). The auxin
phototropism in plant mdr mutants ing actinorhizal nodule formation distal organizer of pattern and influx carrier is essential for cor-
mislocalizing the auxin efflux pro- in Casuarina glauca. Plant Physiol. polarity in the Arabidopsis root. Cell rect leaf positioning. Plant J. 32,
tein PIN1. Nature 423, 9991002. 144, 18521862. 99, 463472. 509517.
Oliveros-Valenzuela, M., Reyes, D., Pitts, R. J., Cernac, A., and Estelle, M. Scheres, B. (2007). Stem-cell niches: Swarup, K., Benkov, E., Swarup, R.,
Sanchez-Bravo, J., Acosta, M., and (1998). Auxin and ethylene promote nursery rhymes across king- Casimiro, I., Pret, B., Yang, Y.,
Nicolas, C. (2008). Isolation and root hair elongation in Arabidopsis. doms. Nat. Rev. Mol. Cell Biol. 8, et al. (2008). The auxin influx
characterization of a cDNA clone Plant J. 16, 553560. 345354. carrier LAX3 promotes lateral
encoding an auxin influx carrier Prusinkiewicz, P., Crawford, S., Smith, Schnabel, E., and Frugoli, J. (2004). root emergence. Nat. Cell Biol. 10,
in carnation cuttings. Expression in R. S., Ljung, K., Bennett, T., Ongaro, The PIN and LAX families of auxin 946954.
different organs and cultivars and its V., et al. (2009). Control of bud acti- transport genes in Medicago trun- Swarup, R., and Bennett, M. (2003).
relationship with cold storage. Plant vation by an auxin transport switch. catula. Mol. Genet. Genomics 272, Auxin transport: the fountain of life
Phys. Biochem. 46, 10711076. Proc. Natl. Acad. Sci. U.S.A. 106, 420432. in plants? Dev. Cell 5, 824826.
Ottenschlger, I., Wolff, P., Wolverton, 1743117436. Schrader, J., Baba, K., May, S., Palme, Swarup, R., Friml, J., Marchant, A.,
C., Bhalerao, R. P., Sandberg, G., Rahman, A., Hosokawa, S., Oono, K., Bennett, M., Bhalerao, R., Ljung, K., Sandberg, G., Palme,
Ishikawa, H., et al. (2003). Gravity- Y., Amakawa, T., Goto, N., and et al. (2003). Polar auxin trans- K., et al. (2001). Localization of
regulated differential auxin trans- Tsurumi, S. (2002). Auxin and port in the wood-forming the auxin permease AUX1 suggests
port from columella to lateral root ethylene response interactions tissues of hybrid aspen is under two functionally distinct hormone
cap cells. Proc. Natl. Acad. Sci. U.S.A. during Arabidopsis root hair devel- simultaneous control of develop- transport pathways operate in the
100, 29872991. opment dissected by auxin influx mental and environmental signals. Arabidopsis root apex. Genes Dev.
Paponov, I. A., Teale, W. D., Trebar, modulators. Plant Physiol. 130, Proc. Natl. Acad. Sci. U.S.A. 100, 15, 26482653.
M., Blilou, I., and Palme, K. (2005). 19081917. 1009610101. Swarup, R., Kargul, J., Marchant, A.,
The PIN auxin efflux facilitators: Rahman, A., Takahashi, M., Shibasaki, Shen, C., Bai, Y., Wang, S., Zhang, Zadik, D., Rahman, A., Mills, R.,
evolutionary and functional per- K., Wu, S., Inaba, T., Tsurumi, S., Wu, Y., Chen, M., et al. et al. (2004). Structure-function
spectives. Trends Plant Sci. 10, S., et al. (2010). Gravitropism (2010). Expression profile of PIN, analysis of the presumptive
170177. of Arabidopsis thaliana roots AUX/LAX and PGP auxin trans- Arabidopsis auxin perme-
Parry, G., Delbarre, A., Marchant, A., requires the polarization of PIN2 porter gene families in Sorghum ase AUX1. Plant Cell 16,
Swarup, R., Perrot-Rechenmann, toward the root tip in meristem- bicolor under phytohormone 30693083.
C., and Bennett, M. (2001). atic cortical cells. Plant Cell 22, and abiotic stress. FEBS J. 277, Swarup, R., Kramer, E. M., Perry, P.,
Physiological characterization 17621776. 29542969. Knox, K., Leyser, H. M., Haseloff,
of a novel class of auxin influx Raven, J. A. (1975). Transport of Sieburth, L. E., and Deyholos, M. K. J., et al. (2005). Root gravit-
carrier inhibitors. Plant J. 25, indoleacetic acid in plant cells in (2006). Vascular development: the ropism requires lateral root cap
399406. relation to pH and electrical poten- long and winding road Curr. Opin. and epidermal cells for trans-
Pattison, R. J., and Catal, C. (2011). tial gradients, and its significance Plant Biol. 9, 4854. port and response to a mobile
Evaluating auxin distribution in for polar IAA transport. New Phytol. Smith, R. S., Guyomarch, S., Mandel, auxin signal. Nat. Cell Biol. 7,
tomato (Solanum lycopersicum) 74, 163172. T., Reinhardt, D., Kuhlemeier, C., 10571065.
through an analysis of the PIN and Rebouillat, J., Dievart, A., Verdeil, J. and Prusinkiewicz, P. (2006). A Swarup, R., Perry, P., Hagenbeek, D.,
AUX/LAX gene families. Plant J. A., Escoute, J., Giese, G., Breitler, J. plausible model of phyllotaxis. Van Der Straeten, D., Beemster,
70, 585598. C., et al. (2008). Molecular genet- Proc. Natl. Acad. Sci. U.S.A. 103, G. T., Sandberg, G., et al. (2007).
Perrine-Walker, F., Doumas, P., Lucas, ics of rice root development. Rice 2, 13011306. Ethylene upregulates auxin biosyn-
M., Vaissayre, V., Beauchemin, N. J., 1534. Sorefan, K., Girin, T., Liljegren, S. thesis in Arabidopsis seedlings
Band, L. R., et al. (2010). Auxin car- Reinhardt, D. (2003). Vascular pattern- J., Ljung, K., Robles, P., Galvn- to enhance inhibition of root
riers localization drives auxin accu- ing: more than just auxin? Curr. Ampudia, C. S., et al. (2009). cell elongation. Plant Cell 19,
mulation in plant cells infected by Biol. 13, R485R487. A regulated auxin minimum 21862196.
Frankia in Casuarina glauca acti- Reinhardt, D., Pesce, E., Stieger, is required for seed disper- Szymanowska-Puka, J., and Nakielski,
norhizal nodules. Plant Physiol. 154, P., Mandel, T., Baltensperger, sal in Arabidopsis. Nature 459, J. (2010). The tensor-based model
13721380. K., Bennett, M., et al. (2003). 583586. for growth and cell divisions of the

Frontiers in Plant Science | Plant Traffic and Transport October 2012 | Volume 3 | Article 225 | 82
Swarup and Pret AUX/LAX Auxin influx carriers

root apex. II. Lateral root formation. thaliana seedlings. Development (2011). Coordination of apical (2010). Auxin transporters-why so
Planta 232, 12071218. 137, 597606. and basal embryo development many? Cold Spring Harb. Perspect.
Terasaka, K., Blakeslee, J. J., Vanneste, S., and Friml, J. (2009). revealed by tissue-specific GNOM Biol. 2, a001552.
Titapiwatanakun, B., Peer, W. Auxin: a trigger for change in plant functions. Development 138,
A., Bandyopadhyay, A., Makam, development. Cell 136, 10051016. 117126.
S. N., et al. (2005). PGP4, an ATP Vernoux, T., Brunoud, G., Farcot, E., Yamamoto, M., and Yamamoto, Conflict of Interest Statement: The
binding cassette P-glycoprotein, Morin, V., Van den Daele, H., K. (1998). Differential effects authors declare that the research
catalyzes auxin transport in Legrand, J., et al. (2011). The of 1-naphthaleneacetic acid, was conducted in the absence of any
Arabidopsis thaliana roots. Plant auxin signalling network translates indole-3-acetic acid and 2, commercial or financial relationships
Cell 17, 29222939. dynamic input into robust pattern- 4-dichlorophenoxyacetic acid that could be construed as a potential
Ugartechea-Chirino, Y., Swarup, R., ing at the shoot apex. Mol. Syst. Biol. on the gravitropic response of conflict of interest.
Swarup, K., Pret, B., Whitworth, 7, 508. roots in an auxin-resistant mutant
M., Bennett, M., et al. (2010). Wang, L., Li, Z., Qian, W., Guo, of Arabidopsis, aux1. Plant Cell
The AUX1 LAX family of auxin W., Gao, X., Huang, L., et al. Physiol. 39, 660664. Received: 01 July 2012; accepted: 20
influx carriers is required for (2011). The Arabidopsis purple acid Yang, H., and Murphy, A. S. (2009). September 2012; published online: 18
the establishment of embry- phosphatase AtPAP10 is predom- Functional expression and charac- October 2012.
onic root cell organization in inantly associated with the root terization of Arabidopsis ABCB, Citation: Swarup R and Pret B (2012)
Arabidopsis thaliana. Ann. Bot. 105, surface and plays an important AUX 1 and PIN auxin transporters AUX/LAX family of auxin influx
277289. role in plant tolerance to phos- in Schizosaccharomyces pombe. carriersan overview. Front. Plant Sci.
Ulmasov, T., Murfett, J., Hagen, G., phate limitation. Plant Physiol. 157, Plant J. 59, 179191. 3:225. doi: 10.3389/fpls.2012.00225
and Guilfoyle, T. J. (1997). Aux/IAA 12831299. Yang, Y., Hammes, U. Z., Taylor, C. This article was submitted to Frontiers in
proteins repress expression of Went, F. W. (1926). On growth G., Schachtman, D. P., and Nielsen, Plant Traffic and Transport, a specialty of
reporter genes containing natural accelerating substances in the E. (2006). High-affinity auxin Frontiers in Plant Science.
and highly active synthetic auxin coleoptile of Avena sativa. Proc. transport by the AUX1 influx Copyright 2012 Swarup and Pret.
response elements. Plant Cell 9, Kon. Ned. Akad. Weten. 30, carrier protein. Curr. Biol. 16, This is an open-access article dis-
19631971. 1019. 11231127. tributed under the terms of the Creative
Vandenbussche, F., Petrsek, J., Wisniewska, J., Xu, J., Seifertov, D., Young, G. B., Jack, D. L., Smith, D. Commons Attribution License, which
Zdnkov, P., Hoyerov, K., Brewer, P. B., Ruzicka, K., Blilou, I., W., and Saier, M. H. (1999). The permits use, distribution and repro-
Pesek, B., Raz, V., et al. (2010). et al. (2006). Polar PIN localization amino acid/auxin:proton symport duction in other forums, provided
The auxin influx carriers AUX1 directs auxin flow in plants. Science permease family. Biochim. Biophys. the original authors and source are
and LAX3 are involved in auxin- 312, 883. Acta 1415, 306322. credited and subject to any copyright
ethylene interactions during apical Wolters, H., Anders, N., Geldner, Zazmalov, E., Murphy, A. S., Yang, notices concerning any third-party
hook development in Arabidopsis N., Gavidia, R., and Jrgens, G. H., Hoyerov, K., and Hosek, P. graphics etc.

www.frontiersin.org October 2012 | Volume 3 | Article 225 | 83


ORIGINAL RESEARCH ARTICLE
published: 12 November 2012
doi: 10.3389/fpls.2012.00251

The putative K+ channel subunit AtKCO3 forms stable


dimers in Arabidopsis
Alessandra Rocchetti 1 , Tripti Sharma 2 , Camilla Wulfetange 2 , Joachim Scholz-Starke 3 ,
Alexandra Grippa 1 , Armando Carpaneto 3 , Ingo Dreyer 2,4 , Alessandro Vitale 1 ,
Katrin Czempinski 2 and Emanuela Pedrazzini 1 *
1
Istituto di Biologia e Biotecnologia Agraria, Consiglio Nazionale delle Ricerche, Milano, Italy
2
Institute of Biochemistry and Biology, University of Potsdam, Potsdam-Golm, Germany
3
Istituto di Biosica, Consiglio Nazionale delle Ricerche, Genova, Italy
4
Centro de Biotecnologa y Genmica de Plantas, Universidad Politcnica de Madrid, Madrid, Spain

Edited by: The permeation pore of K+ channels is formed by four copies of the pore domain. AtKCO3
Markus Geisler, University of is the only putative voltage-independent K+ channel subunit of Arabidopsis thaliana with a
Fribourg, Switzerland
single pore domain. KCO3-like proteins recently emerged in evolution and, to date, have
Reviewed by:
Jianhua Zhu, University of Maryland,
been found only in the genus Arabidopsis (A. thaliana and A. lyrata). We show that the
USA absence of KCO3 does not cause marked changes in growth under various conditions.
Gerhard Obermeyer, University Only under osmotic stress we observed reduced root growth of the kco3-1 null-allele
Salzburg, Austria line. This phenotype was complemented by expressing a KCO3 mutant with an inactive
*Correspondence: pore, indicating that the function of KCO3 under osmotic stress does not depend on its
Emanuela Pedrazzini, Istituto di
Biologia e Biotecnologia Agraria,
direct ability to transport ions. Constitutively overexpressed AtKCO3 or AtKCO3::GFP are
Consiglio Nazionale delle Ricerche, efciently sorted to the tonoplast indicating that the protein is approved by the endoplasmic
via Bassini 15, 20133 Milano, Italy. reticulum quality control. However, vacuoles isolated from transgenic plants do not have
e-mail: pedrazzini@ibba.cnr.it signicant alterations in current density. Consistently, both AtKCO3 and AtKCO3::GFP are
Alessandra Rocchetti and Tripti detected as homodimers upon velocity gradient centrifugation, an assembly state that
Sharma have contributed equally
would not allow for activity. We conclude that if AtKCO3 ever functions as a K+ channel,
to the work.
active tetramers are held by particularly weak interactions, are formed only in unknown
specic conditions and may require partner proteins.
Keywords: Arabidopsis, membrane proteins, potassium channels, protein assembly, tonoplast

INTRODUCTION identied in the genus Arabidopsis (A. thaliana and A. lyrata),


Homeostasis of potassium, the most abundant cation of plants, so far. They were not found in other known plant genomes
is maintained by the activity of transporters and channels of (Gomez-Porras et al., 2012). Upon transient expression in pro-
the plasma membrane and the tonoplast (Dreyer and Uozumi, toplasts from Arabidopsis cell cultures, AtKCO3::GFP localizes
2011). Arabidopsis thaliana contains 15 genes encoding K+ at the tonoplast, like similar fusions of AtTPK1, 2, 3, and 5
channel subunits. Among these are the ve members (AtTPK1 (Voelker et al., 2006). Homomeric AtKCO3 interactions have
5) of the voltage-independent, tandem-pore family (Voelker been detected by FRET and BiFC (Voelker et al., 2006) but it
et al., 2010). The key signature of K+ channels is the pore is not known whether the polypeptide forms tetramers, a pre-
(P) domain which must be present in four copies in an requisite for activity in the case of this one-pore subunit. Here
active channel complex. Tandem-pore channels are therefore we have applied a number of experimental approaches in order
expected to be dimers. Consistently, uorescence resonance to get insights on the assembly state and possible function of
energy transfer (FRET) and bimolecular uorescence comple- AtKCO3.
mentation (BiFC) experiments conducted on AtTPK1 or AtTPK5
in transiently transformed plant cells strongly support the exis- MATERIALS AND METHODS
tence of homodimers (Voelker et al., 2006). Stable heteromeric PLANT GENOTYPING AND ANALYSIS
interactions between different AtTPK members were instead The A. thaliana knock-out mutant kco3-1 (Salk_096038) was
not detected (Voelker et al., 2006). The assembly of AtTPK1 ordered from the Salk Institute. Genomic DNA was extracted from
into stable dimers has been directly conrmed in transgenic frozen leaves with 1 ml of CTAB extraction buffer (0.8% CTAB,
Arabidopsis constitutively expressing an AtTPK1::GFP fusion 0.14 M sorbitol, 0.22 mM TrisHCl, pH 6, 0.022 mM EDTA,
(Matrejean et al., 2011). An additional polypeptide with one 0.8 M NaCl, 1% N -Lauroylsarcosine). Conrmation of the T-
pore domain only, AtKCO3 (locus AT5G46360), is most closely DNA insertion in kco3-1 was done using the following primers:
related to AtTPK2 and believed to have originated from gene 5 GCGTGGACCGCTTGCTGCAACT3 (T-DNA-LB), 5 CACGA-
duplication followed by a partial deletion event (Marcel et al., TTTCTATGCCAATGACTCCATCGG3 (KCO3-fwd), 5 AAAAA-
2010; Voelker et al., 2010). KCO3-like proteins have only been GAGCTCTTAAACTGGTTCAACTATATCC3 (KCO3-rev).

www.frontiersin.org November 2012 | Volume 3 | Article 251 | 84

fpls-03-00251 2012/11/9 12:18 page 1 #1


Rocchetti et al. Arabidopsis KCO3 protein

For phenotypic analysis, seeds were plated on MS media sup- mutation F141R. PCR product was digested with SalISacI and
plemented with 3% sucrose in axenic condition. One-week-old inserted in SalISacI digested pBS generating pBS-dnKCO3. To
seedlings were transferred to media containing the appropriate generate pBIBhygro-dnKCO3, amplication was done on pBS-
solute for the growth test in different abiotic stress conditions and dnKCO3 with pKCO3-fwd (5 ATTTAGTCGACACACATCACAA-
were vertically grown in 16 h day/8 h night conditions. Differ- CATGATTGAAGATGACAATG3 ) and KCO3-rev primers
ent potassium concentration: seedlings were transferred on K+ (Figure 1B). Amplication product was double digested with
decient medium [2.5 mM NaNO3 , 2.5 mM Ca(NO3 )2 , 2 mM SalISacI and cloned in SalISacI digested pBibHygro. Positive
NH4 (H2 PO4 ), 2 mM MgSO4 , 0.1 mM FeNaEDTA, 25 M CaCl2 , clones were further conrmed by sequencing and transformed in
25 M H3 BO3 , 2 M ZnSO4 , 2 M MnSO4 , 0.5 M CuSO4 , Agrobacterium tumefaciens strain GV1301. The positive Agrobac-
0.2 M Na2 MoO4 , 0.01 M CoCl2 , 1% sucrose, pH 5.7; jelli- terium clones were detected through PCR with gene-specic
ed with 0.8% Phytagel (Sigma Aldrich)] supplemented with low primers on mini preparation of DNA from Agrobacterium. Over-
(100 M) or high (2.5 mM) K+ ; salt stress: 75 mM NaCl; osmotic night grown culture of Agrobacterium was inltrated in Col-0
stress: 100 mM mannitol. Oxidative stress: 15 days after sowing wild-type plants through oral dip method. Seeds from inltrated
the seedlings were moved to liquid MS media with 10 mM H2 O2 . plants were screened on hygromycin-containing medium to select
For mock treatment, plants were transferred to liquid MS media. transgenic plants. Seedlings surviving on hygromycin-containing
Plants were grown on a shaker for 5 days, with daily change of medium were used for genotyping to detect the presence of
media. transformed transgene.
To generate kco3-1 dnKCO3 transgenic plants, homozygous
GENERATION OF TRANSGENIC PLANTS lines of dnKCO3 were crossed with kco3-1 null-allele (Salk_96038)
Plasmid DNA required for sequencing purposes was prepared mutant. The seeds obtained from the crossed plants were then
using Qiagen columns (Qiagen, Hilden, Germany). Sequence screened to procure dominant-negative knockout mutant plants
determinations were performed by MWG-Biotech (Ebersberg, of KCO3. These kco3-1 dnKCO3 were grown again in the next
Germany) and Replicon (Berlin, Germany). For sequence analysis generation under self-fertilization condition. Seeds thus inher-
the BLAST server at the National Center of Biological Information ited after self-cross were screened by performing PCR reactions to
(NCBI, Bethesda, USA), or the University of Wisconsin GCG soft- obtain homozygous kco3-1 dnKCO3.
ware package, version 8 (Devereux et al., 1984) were used. Either AtKCO3 cDNA clones were isolated from cDNA prepa-
Pfu polymerase (Stratagene, Heidelberg, Germany) or Taq poly- rations of A. thaliana seedlings (C24 ecotype) using
merase (Gibco BRL, Eggenstein, Germany) was employed for PCR. primers 5 CAACAACAAGGACCCATTACACC3 (KCO3.seq) and
All PCR-derived fragments were sequenced to ensure the absence 5 CCACTGCCATCTTCAATCATG3 (KCO3.rev). Fragments cor-
of amplication errors. responding to the AtKCO3 cDNA were subcloned into pPCRII
To produce dnKCO3 transgenic plants, site directed mutagene- (Stratagene, Heidelberg, Germany) giving rise to the plasmid
sis was performed on the KCO3 gene to insert dominant negative pCRII-KCO3. Sequence determination was done for three clones

FIGURE 1 | Genotyping of kco3-1 null-allele, dnKCO3 and dnKCO3 does not show any amplication product with the T-DNA primer
kco3-1 dnKCO3 mutant plants. (A) Schematic representation of the sets. (E) PCR was performed with the indicated gene specic primer
Salk_96038 T-DNA insertion line that contains two head to head T-DNA pair. Amplication can be observed in Col-0 wild-type, dnKCO3 and
insertions at position 420 in the rst exon of the KCO3 gene. (B) Schematic kco3-1 dnKCO3. No amplication product is detectable in the homozygous
representation of dnKCO3 mutant, where, in the rst exon of the KCO3 T-DNA insertion line (kco3-1). (F) SacII restriction digestion of the PCR
gene, a dominant negative mutation has been created by mutating the GFGD products obtained by amplication with the gene specic primer pair. PCR
motif to GRGD. Additionally, a recognition site of the restriction enzyme SacII product from Col-0 wild-type was not digested. The amplication product
has been inserted. (C,D) PCR was performed on genomic DNA with the from the dnKCO3 mutant was digested but some undigested product can
indicated primer sets specic for T-DNA amplication. Amplication was also be seen. The PCR product from kco3-1 dnKCO3 shows complete
attained in case of kco3-1 and kco3-1 dnKCO3 while the wild-type and digestion.

Frontiers in Plant Science | Plant Trafc and Transport November 2012 | Volume 3 | Article 251 | 85

fpls-03-00251 2012/11/9 12:18 page 2 #2


Rocchetti et al. Arabidopsis KCO3 protein

as described above. Plasmid p35S-KCO3 was generated by insert- ltered at 200 Hz with a 4-pole Bessel lter Kemo VBF8 (Kemo,
ing the AtKCO3 cDNA (KpnI/blunt/EcoRV pCRII-KCO3) into Beckenham, UK) and sampled at a frequency of 1 kHz. All patches
SmaI site of pBinAR-Kan (Hfgen and Willmitzer, 1988). A with seal resistance lower than 3 GOhm were systematically dis-
C-terminal GFP-fusion construct was created using pBI-35S-10H- carded. Membrane capacitance (C m ) and access resistance (Ra )
GFP-JFH1 (Hong et al., 1999). The AtKCO3 cDNA was amplied were estimated by using the compensation circuit of the ampli-
using the primers 5 CGCGTCGACATGCCAATGACTCCATC- er; Ra varied from 6 to 10 MOhm and was not corrected, since
GG3 (KCO3-FSI.seq) and 5 ATCACTAGTACAGAAGTTGCGG- the resulting voltage error did not exceed 5 mV. C m and Ra were
TGGTTAAATCCAA3 (KCO3-FSII.rev) and fused to GFP coding monitored throughout the experiment. No leak current subtrac-
sequence via SalI/XhoI/SpeI sites to generate p35S-KCO3::GFP. tion procedure was applied. Patch pipettes had resistance values
Transgenic Arabidopsis plants expressing KCO3 or KCO3::GFP of 3.54 MOhm, when lled with pipette solution (vacuolar side)
were generated by vacuum inltration with Agrobacterium tume- containing 200 mM KCl, 2 mM CaCl2 , 2 mM MgCl2 , 10 mM MES-
faciens strain GV3101 transformed with the constructs p35S- KOH, pH 5.5. All bath solutions contained 100 mM KCl, 1 mM
KCO3 or 35S-KCO3::GFP. Kanamycin-resistant plants (T0) were dithiothreitol (DTT), 5 mM Tris and additionally 1 mM EGTA for
identied. Experiments were conducted using T3 or T4 plants. low-calcium conditions or 100 M CaCl2 for high-calcium condi-
tions. The pH value of the bath solutions was set either to pH 7.5
ANTIBODIES (by addition of HEPES) or to pH 6.5 (by addition of MES). The
The following antibodies were used in this study: rabbit polyclonal osmolarity of the pipette and bath solutions was adjusted to 500
anti-GFP (1:1000 dilution, Invitrogen), rabbit polyclonal anti- and 540 mOsm, respectively, by the addition of D-sorbitol. Liq-
endoplasmin/GRP94 (1:1,000 dilution; Klein et al., 2006), rabbit uid junction voltages in our experimental conditions were smaller
polyclonal anti-PiP2 (1:10,000 dilution; Santoni et al., 2003), or than 1 mV.
chicken polyclonal anti-TIP raised against a synthetic peptide Immediately after the establishment of the whole-vacuole con-
corresponding to the C-terminal nine amino acids of Arabidopsis guration, current recordings reproducibly displayed background
TIP (1:1,000 dilution, a gift from N. V. Raikhel). currents with negative reversal potentials (Figure A1A). These cur-
An anti-KCO3 antiserum was raised against a synthetic peptide rents gradually decreased at all membrane potentials and nally
(NH2 -SEFKNRLLFGSLPRC-COOH) located at the N-terminus stabilized at a slightly positive reversal potential after 1530 min in
of AtKCO3 and provided by Covalab (Villeurbanne, France). the whole-vacuole conguration (Figure A1B), depending on the
The total IgG fraction from immunized rabbit was then puried vacuole size. Only vacuoles which reached this point were con-
using protein A bead column. The afnity-puried antibod- sidered for data analysis and successively exposed to other bath
ies were then subjected to immuno-afnity purication, passing solutions by means of a gravity-driven perfusion system coupled to
through a resin-column containing the antigenic peptide. This a peristaltic pump. Steady-state current amplitudes were normal-
afnity-puried rabbit polyclonal anti-KCO3 was used at 1:2,000 ized to the vacuolar membrane capacitance, which was on average
dilution. 30 3 pS (n = 22). Data are represented as mean values SEM
(for the number n of vacuoles).
VACUOLE ISOLATION, PATCH-CLAMP RECORDINGS,
AND DATA ANALYSIS TOTAL PROTEIN ANALYSIS
Mesophyll tissue of Arabidopsis plants was enzymatically digested Arabidopsis wild-type or transgenic plants were grown in sterile
for 30 min at 30 C. The enzyme solution contained 0.3% (w/v) cel- conditions on half-concentrated MS media (Duchefa Biochemie)
lulase R-10, 0.03% (w/v) pectolyase Y-23, 1 mM CaCl2 , 500 mM supplemented with 10 g/l sucrose and 0.8% (w/v) phyto agar
sorbitol, 10 mM 2-(N -morpholino)ethanesulfonic acid (MES), (Duchefa Biochemie) at 23 C under a 16/8 h light/dark cycle.
pH 5.3. Protoplasts were washed twice and maintained in W5 36 weeks old leaves were homogenized in ice-cold homog-
solution (125 mM CaCl2 , 154 mM NaCl, 5 mM KCl, 2 mM MES- enization buffer [200 mM NaCl, 1 mM EDTA, 0.2% Triton
KOH, pH 5.6; Yoo et al., 2007). Vacuoles were released by the X-100, 2% 2-mercaptoethanol, 100 mM TrisCl pH 7.8, sup-
addition of 10 volumes of a solution containing 100 mM malic plemented with Complete protease inhibitor cocktail (Roche)].
acid, 160 mM 1,3-bis(tris(hydroxymethyl)methylamino)propane After centrifugation at 5,000 g for 10 min at 4 C, the result-
(BTP), 5 mM ethylene glycol-bis(2-aminoethylether)-N,N,N  ,N  - ing supernatant was considered as the total protein extract and
tetraacetic acid (EGTA), 3 mM MgCl2 , pH 7.5, adjusted to analyzed by SDS-PAGE followed by western blot, as follows. Sam-
450 mOsm with D-sorbitol. After settling of the vacuoles, the ples were adjusted to 1% SDS, 0.3% 2-mercaptoethanol, 8.3%
recording chamber was carefully perfused with fresh bath solu- glycerol, 20 mM TrisCl, pH 8.6 and denatured by heating at
tion. Membrane currents of isolated vacuoles were recorded using 95 C for 4 min. SDS-PAGE was performed in 15% acrylamide
the patch-clamp technique, as described elsewhere (Scholz-Starke gels using a Tris-glycine running buffer. After electrophoresis,
et al., 2006; Gradogna et al., 2009). Trans-membrane voltages and proteins were transferred to nitrocellulose membrane (Protran,
ionic currents were controlled and monitored with an Axon 200-A Whatman) using a Tris/glycine/methanol (25 mM/192 mM/ 20%,
current-voltage amplier interfaced with a 16 bit AD/DA board respectively) buffer in a wet electroblotting system (Trans-Blot
(ITC-16 Instrutech, Elmont, NY, USA). A Macintosh personal Cell, Bio-Rad). We veried that even protein polymers larger than
computer running the Pulse program (Heka Electronic, Lam- 600 kDa are efciently transferred using this protocol. Molec-
brecht, Germany) was used to generate the stimulation protocol ular weight markers (Fermentas) were used as molecular mass
and to acquire the current records. Current records were low-pass markers.

www.frontiersin.org November 2012 | Volume 3 | Article 251 | 86

fpls-03-00251 2012/11/9 12:18 page 3 #3


Rocchetti et al. Arabidopsis KCO3 protein

SUBCELLULAR FRACTIONATION medium under long day conditions. No signicant (Students t-


Total microsomes were prepared as follows: leaf tissues were test) differences were observed in root development, leaf number,
homogenized in a medium containing 50 mM Tris-acetate (pH and leaf size (Figure 2A). The response to osmotic stress or salt
7.5), 250 mM sorbitol, 2 mM EGTA, 2 mM MgCl2 , 2 mM DTT stress was tested by supplementing the MS medium with 100 mM
supplemented with Complete. The homogenate was ltered and mannitol or 75 mM NaCl. Mannitol caused a small but signif-
centrifuged at 10,000 g for 10 min at 4 C. The supernatant was icant decrease of root growth in kco3-1 plantlets with respect
further centrifuged at 100,000 g (rav ) in a Beckman SW55Ti to Col-0 (Figure 2B). This phenotype could be complemented
rotor (Beckman Instruments) for 30 min at 4 C. The resulting by expressing a dominant-negative KCO3-mutant under control
pellet, containing total microsomes, was resuspended in 10 mM of the AtKCO3 promoter in the kco3-1 background (Figure 2B;
Tricine-KOH (pH 7.5), 1 mM EGTA, 2 mM MgCl2 , 5% (w/w) dnKCO3 kco3-1). Expressing the dominant-negative mutant in
sucrose, and was loaded on a sucrose-density gradient (10.4 ml, the wild-type background had no benecial effect for the plant
1545% w/w sucrose in 10 mM Tricine-KOH (pH 7.5), 1 mM (Figure 2B; dnKCO3). Upon NaCl treatment no difference was
EGTA and 2 mM MgCl2 ), centrifuged at 77,000 g (rav ) for 19 h observed (Figure 2C). The effect of oxidative stress was tested by
in a Beckman SW40 rotor and collected in 0.6-ml fractions. Equal growing plantlets for 5 days in the presence of 10 mM H2 O2 . Both
volumes of each fraction were analyzed by SDS-PAGE followed by Col-0 and kco3-1 showed similar symptoms of bleaching and plant
western blot with the appropriate antibody. decay (Figure 2D). Finally, growth in medium supplemented with
100 M K+ (K+ decient) or 2.5 mM K+ (K+ sufcient) was
VELOCITY SUCROSE GRADIENT CENTRIFUGATION analyzed (Figure 2E). No signicant differences were observed in
Arabidopsis leaves (36 weeks old) were homogenized in ice-cold the mean values for increase in root length.
buffer containing 40 mM KCl or 200 mM NaCl, 0.2% Triton X- Altogether, these analyses indicate that the absence of KCO3
100, 50 mM TrisCl pH 7.8 (2 ml/g of leaf tissue), supplemented causes small defects in the early stages of plant growth under
with Complete. Lysate was cleared by centrifugation at 700 g for osmotic stress. These defects could be complemented by a
10 min, loaded on a linear 525% (w/v) sucrose gradient (20 mM dominant-negative mutant of KCO3.
KCl or 150 mM NaCl, 0.1% Triton X-100, 25 mM TrisCl, pH 7.5)
and centrifuged at 200,000 g (rav ) for 25 h at 4 C in a Beckman KCO3 AND KCO3::GFP CONSTITUTIVELY EXPRESSED IN ARABIDOPSIS
SW40 rotor. An additional gradient was loaded with a mixture of TRANSGENIC PLANTS LOCALIZE AT THE TONOPLAST
molecular mass markers containing 200 g each of cytochrome c Endogenous expression levels of KCO3 are very low (Schnknecht
(12.4 kDa), ovalbumin (43 kDa), bovine serum albumin (67 kDa), et al., 2002, and see eFP developmental map: http://bbc.botany.
aldolase (161 kDa), and catalase (232 kDa). Equal volumes of each utoronto.ca/efp/cgi-bin/efpWeb.cgi), hampering biochemical and
fraction were analyzed by SDS-PAGE followed by western blot with cell biology studies. Arabidopsis transgenic plants expressing
the appropriate antibody. KCO3::GFP under the constitutive CaMV 35S promoter were
therefore produced. Transgenic lines, selected on the basis of their
MICROSCOPY kanamycin resistance, were tested for KCO3::GFP accumulation
Epiuorescence microscopy on plant tissues was performed using by western blot analysis of leaf extracts using anti-GFP anti-
a Zeiss Axiovert 200 microscope (Carl Zeiss) equipped for epiuo- serum (Figure 3A). Extracts from wild-type plants (Figure 3A,
rescence, followed by the collection of optical sections using Zeiss Co) did not react with the antiserum. A polypeptide with appar-
Apotome and Axiovision 4.1 software. Figures were assembled ent molecular mass around 60 kDa was specically detected in
with Adobe Photoshop 10.0. the kanamycin-resistant plants. This is in good agreement with
the predicted mass of the fusion between KCO3 (29 kDa) and
GFP (27 kDa), indicating that the 60 kDa polypeptide is intact
RESULTS or nearly intact KCO3::GFP (Figure 3A, KCO3::GFP). An addi-
THE ABSENCE OF KCO3 CAUSES SLIGHT GROWTH DEFECTS tional polypeptide around 25 kDa was also detected in some of
UNDER OSMOTIC STRESS the transgenic plants, often when accumulation of KCO3::GFP
Inactivation of the KCO3 gene could provide insights on the func- was higher. Its molecular mass suggests that it corresponds to
tion of the protein. The Salk_96038 T-DNA insertion mutant was the entire or nearly entire GFP sequence, released from fusion
analyzed using T-DNA left border primer and KCO3-specic for- protein (Figure 3A, plants 1, 2, 4, 11 free GFP). Accu-
ward and reverse primers. Amplication was obtained with both mulation of KCO3::GFP in T1 and T2 generations was highly
primer sets and showed two head-to-head T-DNA insertions at variable but it became stable in a number of T3 plants and
position 420 bp within KCO3 exon 1, as shown schematically in generations. These plants did not show evident morphological
Figure 1. End-point PCR, with a couple of KCO3-specic primers, and developmental differences compared to the wild-type. We
performed on genomic DNA from Arabidopsis T-DNA insertion reasoned that the detection of KCO3::GFP using the anti-GFP
line did not give rise to any product (Figure 1E, kco3-1), while antiserum could limit our studies, because this does not allow
a fragment of the correct length was obtained from wild-type to follow the destiny of KCO3 once GFP has been released.
plant DNA (Figure 1E, wt). The insertion line is therefore a We therefore produced a specic antiserum against KCO3 (anti-
full loss of function mutant and was termed kco3-1. Col-0 and KCO3), using as antigen 15 amino acids near the N-terminal end
kco3-1 seeds were sown on MS medium with 3% sucrose. Seven (residues 620). To test the specicity of this antiserum, equal
days after sowing, the seedlings were grown for 15 days on MS amounts of total leaf homogenate from KCO3::GFP transgenic

Frontiers in Plant Science | Plant Trafc and Transport November 2012 | Volume 3 | Article 251 | 87

fpls-03-00251 2012/11/9 12:18 page 4 #4


Rocchetti et al. Arabidopsis KCO3 protein

FIGURE 2 | Phenotypic analysis of kco3-1. (A) Growth on MS medium is representative for three independent experiments. Right panel: increase
supplemented with 3% sucrose. The wild-type and the kco3-1 knock-out in root length after 15 days. The values shown are mean of six repeats
mutant do not show signicant differences in shoot development and root SD (indicated by error bars). Students t -test revealed that Col-0 and
length. Figure is representative of three independent experiments. kco3-1 are not signicantly different (P > 0.1). (D) Oxidative stress.
(B) Osmotic stress. The gure is representative of three independent After ve days of H2 O2 stress, Col-0 and kco3-1 plants showed symptoms
experiments. Lower panel: increase in root length after 15 days. The values such as bleaching of leaves and plant decay. The gure is representative
shown are mean of six repeats SD (indicated by error bars). Data were for two independent experiments. (E) K+ decient and K+ sufcient
analyzed using Students t -test. The values obtained for kco3-1 are medium. Lower panel: increase in root length after 15 days was plotted
signicantly different from those of the WT control, dnKCO3 and as means SD (indicated by error bars) of six repeats. Students t -test
kco3-1 dnKCO3 plants (P < 0.001). (C) Salt stress. Growth of Col-0 and did not reveal any signicant difference between Col-0 and kco3-1
kco3-1 plants was severely hampered by the presence of NaCl. The gure (P > 0.1).

www.frontiersin.org November 2012 | Volume 3 | Article 251 | 88

fpls-03-00251 2012/11/9 12:18 page 5 #5


Rocchetti et al. Arabidopsis KCO3 protein

detected in both control and KCO3 plants (Figure 3C, asterisk);


however, this was not related to KCO3, because it was also recog-
nized by the pre-immune serum (not shown). We propagated line
6 from T3 generation, but also in T4 the accumulation levels of
KCO3 were variable. We were unable to obtain a line giving con-
stant KCO3 levels in the progeny, possibly because of transgene
silencing.
The subcellular localization of KCO3::GFP was analyzed by epi-
uorescence microscopy in leaf and hypocotyl tissues (Figure 4).
In leaf epidermal cells, GFP uorescence was clearly detected on
the tonoplast (Figures 4AC). In different cells, the GFP uo-
rescence appeared either continuous or irregularly distributed on
the tonoplast, with several highly uorescent spots. No colocal-
ization with the plasma membrane was observed when the GFP
and the brighteld images were superimposed (Figures 4GI).
The tonoplast localization was also observed in hypocotyl cells
(Figures 4DF). The results were conrmed by subcellular
fractionation followed by western blot. Total microsomes were
FIGURE 3 | Selection of Arabidopsis plants overexpressing KCO3::GFP prepared from KCO3::GFP or KCO3 leaf homogenates, loaded
and KCO3. (A) Equal amounts of leaf extracts (50 g of total protein) from onto a continuous sucrose gradient and subjected to isopycnic
wild-type plants (Co) and independent transgenic Arabidopsis plants ultracentrifugation (Figure 5). The distributions of KCO3::GFP,
expressing KCO3::GFP (plants 111) were subjected to SDS-PAGE and
western blot analysis with anti-GFP antiserum. The positions of the entire
KCO3, and the tonoplast aquaporin TIP were similar and
fusion protein and of free GFP are indicated. (B) Leaf extracts from one they markedly differed from those of the plasma membrane
wild-type plant (lane 1) and transgenic plant n 6 of panel A (lane 2) were aquaporin PIP2 or the endoplasmic reticulum marker endo-
analyzed by western blot using anti-KCO3 antibodies. The positions of
plasmin/GRP94. TIP monomers have a calculated molecular
monomers (arrowhead) and putative dimers (circle) are indicated. (C) Equal
amounts (50 g of total protein) of leaf extracts from wild-type (Co) or mass around 20 kDa, but a relevant proportion of the pro-
independent transgenic Arabidopsis plants overexpressing KCO3 (plants tein is detected as oligomers, most probably corresponding to
27) were analyzed by western blot with anti-KCO3 antiserum. The dimers; incomplete denaturation, resulting in the detection of
positions of KCO3 (arrow) and an unspecic, cross-reacting polypeptide
(asterisk) are indicated. In each panel, numbers on the left indicate the
dimers and tetramers upon SDS-PAGE is a common characteris-
position and size (in kDa) of molecular mass markers. tic of aquaporins (Kammerloher et al., 1994; Karlsson et al., 2000).
It can be concluded that both KCO3::GFP and KCO3 localize
at the tonoplast when overexpressed in Arabidopsis transgenic
or control plants were subjected to SDS-PAGE and western blot plants.
with anti-GFP or the immuno-afnity puried anti-KCO3 anti-
serum (Figure 3B). No bands were visible in the control sample, VACUOLES FROM WILD-TYPE AND KCO3-OVEREXPRESSING PLANTS
consistent with the known very low endogenous expression level DO NOT SHOW SIGNIFICANTLY DIFFERENT CURRENT DENSITIES
of KCO3. In the transgenic extract the anti-KCO3 antiserum In order to investigate the functional properties of KCO3, we
specically recognized two polypeptides around 60 and 120 kDa performed patch-clamp recordings on whole-vacuoles isolated
(Figure 3B, lane 4, arrowhead and empty circle, respectively) from leaves of KCO3-overexpressing plants. Experiments were
and, as expected, did not recognize the 25 kDa fragment. The designed in a way to minimize background currents. The activ-
60 kDa polypeptide corresponds to the entire KCO3::GFP fusion ity of the major cationic ion channels at resting and elevated
also detected by anti-GFP. At this stage of investigation the 120 kDa cytosolic [Ca2+ ] the Fast Vacuolar (FV) and the Slow Vacuo-
polypeptide was tentatively identied as a minor proportion of lar (SV) channel, respectively (Hedrich and Neher, 1987; Allen
KCO3 polypeptides not completely denatured and still assem- and Sanders, 1996) was greatly reduced by divalent cations, i.e.,
bled into dimers. The ratio between these putative dimers and calcium (Tikhonova et al., 1997; Dadacz-Narloch et al., 2011) and
monomers was variable in different experiments. We tested differ- magnesium (Pei et al., 1999; Pottosin et al., 2004), which were
ent extraction and denaturation procedures, but we were unable present in the pipette solution at 2 mM concentration. Prelim-
to determine conditions in which such a variability could be inary experiments had revealed normal FV- and SV-type currents
avoided. in vacuoles from kco3-1 mutant plants (data not shown). These
Having conrmed the ability of the antiserum to detect KCO3, data, together with the presence of a K+ channel signature within
transgenic Arabidopsis overexpressing KCO3 under the CaMV 35S the KCO3 protein sequence, argue against a possible participa-
promoter were prepared. Leaf homogenates were analyzed by tion of KCO3 in the pore formation of these non-selective cation
SDS-PAGE and western blot with the anti-KCO3 antiserum. A channels.
polypeptide with apparent molecular mass around 30 kDa, con- The K+ channel signature in the pore loop and two calcium-
sistent with the 29 kDa calculated mass of KCO3, was detected in binding EF hand motifs present in the KCO3 sequence are
the transgenic lines but not in control plants (Figure 3C, plants features shared by TPK1, which has been previously shown to
27 and Co, respectively). A polypeptide around 20 kDa was also encode a Ca2+ -activated K+ -selective conductance in the vacuolar

Frontiers in Plant Science | Plant Trafc and Transport November 2012 | Volume 3 | Article 251 | 89

fpls-03-00251 2012/11/9 12:18 page 6 #6


Rocchetti et al. Arabidopsis KCO3 protein

FIGURE 4 | KCO3::GFP is located at the tonoplast. Leaf epidermis (AC, GI) or hypocotyl (DF) from KCO3::GFP transgenic plant were analyzed by
epiuorescence microscopy. (A,D,G): GFP uorescence; (C,F,I): brighteld; (B,E,H): Merge of uorescence and brighteld. The arrow indicates the cell surface.

membrane (VK channel; Gobert et al., 2007; Latz et al., 2007). western blot with anti-GFP (Figure 7A) or anti-KCO3 (Figure 7B)
Furthermore, the activity of VK channels is stimulated by acidic antisera. KCO3::GFP sedimented slightly slower than the 150 kDa
cytosolic pH (Allen et al., 1998; Gobert et al., 2007). Consequently, marker, indicating a dimer of the 60 kDa polypeptide. Each
we probed KCO3 activity by recording membrane currents from gradient fraction contains a similar ratio between polypeptides
isolated vacuoles successively exposed to four different experi- that are fully denatured upon SDS-PAGE and polypeptides that
mental conditions, varying the cytosolic Ca2+ concentration (low remain assembled into putative dimers (Figures 7A,B, fractions
versus high Ca2+ ) at two cytosolic pH values (pHcyt 7.5 and 912). The co-migration of the two forms along the gradient
pHcyt 6.5). As summarized in Figure 6, the current densities strongly suggests that the component around 120 kDa really
of KCO3-overexpressing vacuoles were almost identical to those represents dimers. No polypeptides recognized by anti-GFP or
determined for wild-type vacuoles at either pHcyt . Increases of anti-KCO3 antisera peaked in the expected position of puta-
cytosolic [Ca2+ ] generally caused only minor changes in the cur- tive tetramers (their migration should be slightly faster than the
rent amplitudes: the slight decrease at pHcyt 7.5 (Figure 6C) was 232 kDa marker). Free GFP released from the fusion protein
possibly due to a further reduction of residual FV channel activity, migrated as a monomer and was recognized by the anti-GFP
while the small increase at pHcyt 6.5 (Figure 6F) may correspond antiserum (Figure 7, compare Figure 7A and Figure 7B, frac-
to the activation of a small population of VK channels. tions 45). This strongly suggests that the GFP moiety does not
In summary, these data strongly suggest that KCO3, present in have a role in the dimerization of KCO3::GFP. The same behav-
the vacuolar membrane of overexpressing plants, does not consti- ior had been observed for free GFP released from TPK1::GFP
tute a functional ion channel in our experimental conditions. (Matrejean et al., 2011). Partial proteolysis also seems to occur,
as indicated by the additional bands detected below the major
KCO3 AND KCO3::GFP ARE DETECTED AS DIMERS 66 kDa band.
The formation of a tetrameric complex is a prerequisite for ion To exclude that GFP appended at the C-terminal end of
channel activity in the case of the one-P subunit KCO3. We KCO3 impaired tetramerization, velocity gradient centrifugation
therefore investigated on the oligomerization state of KCO3 and analysis was performed on leaf extracts from KCO3 transgenic
KCO3::GFP. Total leaf homogenate from KCO3::GFP plants was plants. Fractions were analyzed by western blot with anti-KCO3
fractionated by velocity sucrose gradient centrifugations in the antiserum. KCO3 sedimented slightly slower than the 67 kDa
presence of non-ionic detergent. Using this assay, we have previ- marker (Figure 7C, fractions 79), indicating that also the
ously conrmed that TPK1::GFP is a dimer, as expected (Matre- wild-type protein is a dimer in the conditions used in our anal-
jean et al., 2011). Equal volumes of fractions were analyzed by ysis. We then tested whether the assembly grade of another

www.frontiersin.org November 2012 | Volume 3 | Article 251 | 90

fpls-03-00251 2012/11/9 12:18 page 7 #7


Rocchetti et al. Arabidopsis KCO3 protein

FIGURE 5 | KCO3::GFP and KCO3 co-fractionate with a tonoplast analyzed by SDS-PAGE and western blot with antibodies against KCO3
marker in isopycnic gradients. Young leaves from transgenic Arabidopsis (to detect KCO3::GFP or KCO3), TIP (tonoplast marker), PIP2 (plasma
plants expressing KCO3::GFP (AD) or KCO3 (EG) were homogenized membrane marker) or endoplasmin (GRP94, endoplasmic reticulum
in the presence of sucrose and the absence of detergent. Microsomes marker), as indicated at the right of each panel. Top of each gradient
were pelleted and further separated by centrifugation on isopycnic is at left; numbers on top or bottom of the gure indicate fraction
sucrose gradient. Proteins in each fraction (1/10 of fraction volume) were density (g/ml).

multispanning tonoplast protein was preserved in our assay. preserve the correct assembly of another multispanning tonoplast
Western blots of gradient fractions were therefore visualized protein.
with anti-TIP antiserum: TIP, which is a tetramer, peaked It has been previously reported that tetramerization of the
as expected between the 67 and 150 kDa markers (Figure 7D, viral K+ channel Kcv was perturbed in the presence of a high
fractions 910). We conclude that our experimental conditions concentration of sodium ions, but was maintained if 40 mM

Frontiers in Plant Science | Plant Trafc and Transport November 2012 | Volume 3 | Article 251 | 91

fpls-03-00251 2012/11/9 12:18 page 8 #8


Rocchetti et al. Arabidopsis KCO3 protein

FIGURE 6 | Current density versus voltage characteristics recorded contained either low calcium (A) or high calcium (B). The current density
in different experimental conditions from vacuoles of Arabidopsis difference (Ddif) between high and low calcium conditions was calculated
wild-type and KCO3-overexpressing plants. (AC) Current densityvoltage for individual vacuoles and averaged (C). (D,F) As in (AC), but in bath
relationships recorded in the whole-vacuole conguration (see Figure A1) solutions of pH 6.5, in low calcium (D), in high calcium (E), difference
from vacuoles of Arabidopsis wild-type (open blue symbols) and (F; Ddif). In each panel, the number of WT or KCO3 vacuoles analyzed is
KCO3-overexpressing plants (lled red symbols). Bath solutions of pH 7.5 given in brackets.

www.frontiersin.org November 2012 | Volume 3 | Article 251 | 92

fpls-03-00251 2012/11/9 12:18 page 9 #9


Rocchetti et al. Arabidopsis KCO3 protein

FIGURE 7 | KCO3::GFP and KCO3 are dimers. Leaves from KCO3::GFP SDS-PAGE and western blot using anti-GFP antiserum to detect KCO3::GFP
(A,B,DF,H) or KCO3 (C,G) transgenic Arabidopsis plants were homogenized (A,E), anti-KCO3 antiserum to detect KCO3::GFP (B,F) or KCO3 (C,G),
in the presence of non-ionic detergent and either 200 mM NaCl (AD) or anti-TIP (D,H). Top of each gradient is at left. Numbers on top indicate the
40 mM KCl (EH). The homogenates were then subjected to sedimentation position along the gradient and the molecular mass (in kDa) of sedimentation
velocity centrifugation on a continuous 525% (w/v) sucrose gradient. markers. Numbers at left indicate the positions of SDS-PAGE molecular mass
One-tenth of the total volume of each gradient fraction were analyzed by markers.

KCl was used instead of 200 mM NaCl (Pagliuca et al., 2007). Therefore, stable KCO3 or KCO3::GFP homodimers are
We therefore analyzed the assembly state substituting NaCl detected in experimental conditions in which the related TPK1
with KCl in the homogenization and gradient buffers. Neither protein and the other multispanning tonoplast protein TIP main-
tetramers or monomers of KCO3::GFP and KCO3 could be tain their correct assembly properties. This indicates that KCO3
detected, and the assembly state of TIP was not altered as well tetramers are either held together by weaker or very transient
(Figures 7EH). interactions, or are never formed.

Frontiers in Plant Science | Plant Trafc and Transport November 2012 | Volume 3 | Article 251 | 93

fpls-03-00251 2012/11/9 12:18 page 10 #10


Rocchetti et al. Arabidopsis KCO3 protein

DISCUSSION as defective proteins by the endoplasmic reticulum quality


In this study, we applied different experimental approaches with control.
the aim to shed light on the functional properties and physio- The stable assembly of a dimeric form of a cation channel sub-
logical roles of AtKCO3, a putative potassium channel subunit in unit with one P-domain is thus compatible with trafc, but it
A. thaliana, which has remained enigmatic until now. is clearly incompatible with activity. KCO3 is not the only Ara-
The features of the kco3-1 null-allele mutant observed in the bidopsis K+ channel that does not show activity. AtKC1, which
presence of mannitol indicate that under certain conditions KCO3 belongs to the Shaker-like family is also inactive, but, unlike
exhibits a small effect on root elongation. The absence of KCO3 KCO3, remains located in the endoplasmic reticulum when over-
could be compensated by a dominant-negative version of this expressed alone (Dreyer et al., 1997; Duby et al., 2008). Interaction
subunit. This indicates that, whatever the function of KCO3, it of AtKC1 with other Shaker-like subunits allows the formation
does not depend on putative direct ability to transport ions. It is of trafc-competent, active heterotetramers with differences in
however clear that in most conditions no signicant alteration in activity compared to the respective homotetramers. AtKC1 thus
growth was detected. acts as a modulator of channel activity. Furthermore, it has
Using transgenic