Escolar Documentos
Profissional Documentos
Cultura Documentos
Anticancer Agent
Interferon (IFN) belong to a group of cytokines which perform various biological functions
such as anti-viral, anti-tumor and modulation of immune response (Nadeene and Andrew, 2004;
Murashima et al., 2000; Romerio & Zella, 2002). Interferon alpha (IFN-𝛼) is a widely used
cytokine for treatment of hepatitis and cancer (Ratih, 2014). It binds to receptors on surface of
cells and starts its signaling process through JAK-STAT pathway (Stark & Darnell, 2012). IFN-
α shows its antiviral effect either by inhibiting the intracellular virus life cycle or by regulation of
immune-system T-cell response during infection. IFN-α activate several enzymes such as 2-5
oligoadenylate synthetase (2-5 OAS), which causes activation of endoribonuclease RNAse L,
which further cleavage viral RNA and stops viral replication (Samuel, 2001; Malmgaard, 2004).
IFN-α shows its immunoregulatory effect through induction of other cytokines, expansion
of toxicity of natural killer cells, antibody-dependent cellular cytotoxicity and T cell cytotoxicity
and activation of macrophages and dendritic cells [Biron, 1999; Lukaszewski & Brooks, 2001].
Monocytes are differentiated into activated dendritic cells (DCs) which further generate antitumor
T-cell immunity for cancer immunotherapy (Paola, et al., 2010). Direct anti-proliferative activity
of INF-α occurs through inhibition of cancer cell growth by cell cycle arrest, apoptosis, or
differentiation and indirect activity occurs through activation of immune cells such as T cells and
natural killer cells, inhibition of vascularization (antiangiogenesis), and induction of cytokines.
[Samuel, 1999; Sarkar, et al., 1999]. Interferon alpha 2 (IFN- 2) is a commonly used FDA
approved protein of IFN-𝛼 family and has become world’s leading therapeutic protein. (Romerio
& Zella, 2002).
The hepatitis C virus (HCV) is a global health problem and the leading cause of chronic
liver disease in world. HCV infection effect annually more than one million people in world.
(Williams, 2006; Strader et al., 2004; Minello et al., 2005). Due to higher prevalence of hepatitis
infections and carcinomas in developing countries its demand is increasing very rapidly. In
Pakistan, Hepatitis B and C virus are mostly linked to liver carcinomas. Therefore, there is great
need for the availability of cheaper and more effective recombinant human IFN- 2 protein.
Hepatocellular carcinoma (HCC), the most common type of hepatobiliary cancer, is highly
lethal. The global incidence of HCC has continuously increased, with Asian countries accounting
for almost 80% of victims worldwide [Jemal, et al., 2011; - El-Serag, 2002; Altekruse, et al.,
2009]. IFN type I can improve the underlying liver pathology and reduce the risk of HCC in
patients with HBV or HCV infection [Liaw, 2004; . Camma, et al., 2005; Shamliyan, et al., 2009].
Chronic hepatitis B virus (HBV) infection is a critical risk factor for the carcinogenesis and
progression of hepatocellular carcinoma (HCC).
Thymosin α 1
Many cancer patients have depressed cellular immunity and progression of some cancer
appears to be related to impaired suppression of tumor by immune system. Thymosin-α1 (Tα1) is
a thymic peptide that activate immune response in disorders where immune system is ineffective
such as hepatitis, cancers and vaccine non-responsiveness by maturation and differentiation of
lymphocytes (Billich, 2002).
Tα1is used for treatment of chronic hepatitis B, chronic hepatitis C, and some types of
cancer, particularly hepatocellular carcinoma (Martins, et al., 2000). Tα1 can act on both mature
T cells and lymphoid cells to produce cytokines, induce cytokine receptors, and stimulate the
cytotoxic T lymphocytes mediated cytotoxic responses (Romani et al., 2004; Garaci et al., 2012).
The expression of MHC class I is enhanced in both lymphoid and non-lymphoid tissues by Tα1
(Kageshita et al., 1999). This up regulation of expression of MHC class I explains the anti-tumor
effect of Tα1 (Shrivastava et al., 2004). It also modulates the expression of other cytokines such
as IL-2, IL-3, IL-6, IL-12, IL-15, IFN-α and IFN-γ (Goldstein, 2009).
Tα1 also prevent the overstimulation of immune response by stimulating activity of
indoleamine 2-3 dioxygenase which further causes inhibition of cytokines production by
increasing production of regulatory T cells and increases expression of proteins on the surface of
virally infected and tumor cells as immune escape by virally infected and tumor cells has been
correlated with down regulation of antigen presenting cells (Romani, et al., 2006; Shrivastava,
et al., 2004; Pierluigi, et al., 2010). It increases intracellular glutathione that is important for
antiviral effects. (Palamara, et al., 1998).
Tα1 increases the effectiveness of chemotherapy due to increase in tumor infiltring
lymphocytes, ur regulation of anti-tumor T cells and enhanced expression of cell surface markers
and decrease the side effect of chemotherapy due to increase in regulatory T cells and decrease in
proinflammatry cytokines. Multiple studies showed that combination of IFN-α 2 with Tα1 may
provide a safe and more effective therapeutic approach in treatment of CHB patients. (Cynthia, et
al., 2013)
Ta1 has a pleiotropic mechanism of action, affecting multiple immune cell subsets that are
involved in immune suppression. (King, et al., 2016)
Evidence has been provided that combined treatments with thymosin alpha 1 (T alpha 1)
and low doses of interferon (IFN) or interleukin (IL)-2 are highly effective in restoring several
immune responses depressed by tumor growth and/or cytostatic drugs. In addition, when combined
with specific chemotherapy, they are able to increase the anti-tumor effect of chemotherapy while
markedly reducing the general toxicity of the treatment (Garaci, et al., 2000)
Combinatorial therapies, in which Tα1 represents one important mediator, are effective
therapeutic strategy against tumors and will be the key focus for the use of Tα1 in treating cancers
in the future. (Juan, et al, 2010)
Both IFN-α 2 and Tα1 are widely used proteins in the treatment of hepatitis B and C
(Molloy, et al., 1996; Arase et al., 2003). A series of clinical trails show that, when compared
with standard therapeutic regimens, combination therapy of IFNα and Tα1 could significantly
enhance antiviral and biochemical response rates in patients with hepatitis B and C, and is well
tolerated (Saruc., et al., 2002; Saruc et al., 2003). Combination of Tα1 with IFN-α is becoming
one of the most promising options in improving the response rate of chronic hepatitis B virus and
hepatitis C virus infection and decreasing its probability of developing into hepatocellular
carcinoma.
Combination therapy of Tα1 with pegylated interferon α 2 (peg-IFN-α2) reduces the viral
replication sufficiently in patients who had difficulties in treating their hepatitis C with an
advantage of having not too much side effects (Rustgi, 2004). As many patients are non-
responsive to standard ribavarin and peg-IFN therapy (Fried et al., 2002), a combinational therapy
including Tα1, ribavarin and peg-IFN-α2 has been devised which is safe (Camerini et al., 2007).
It is an effective therapy for those patients who are non-responsive to conventional therapies (Poo
et al., 2008).
The goal of this study is to produce pharmaceutically important interferon-α 2-thymosin-
α1 fusion protein for using as substitute of interferon-α 2 and Tα1 used separately in combination
therapy to decrease the cost and increase the effectiveness therapy. The use of Tα1 as a fusion
partner with interferon therapy will possibly stimulate the cells of immune system, including NK,
CD4, and CD8 cells and will trigger dendritic cells (DC) maturation through TLR activation
(Romani et al., 2004; Romani et al., 2006) as impaired DC maturation is an issue in many types
of cancer (Wang et al., 2008; Kim et al., 2009; Kirkwood et al., 2008) and accumulation of
immature DCs is also considered to be a hallmark of tumor patients (Nefedova et al., 2004). Tα1
will stimulate a Th1-type immune response (Peng et al., 2008; Yao et al., 2007; Loggi, 2008) as
Th1-type response has therapeutic value in treating tumors. It will also leads to an increase in
specific anti-tumor cytotoxic T-cells (Rasi et al., 1998). It will increase expression of proteins that
mediate antigen presentation, including major histocompatibility (MHC) Class I, MHC Class II,
and beta-2 microglobulin (Liu et al., 2002).
3. Cloning and high level expression of human Interferon alpha 2–Thymosin α 1 fusion
protein
Methodology
Isolation and RT-PCR Amplification of Gene Encoding Interferon alpha 2
Total RNA will be isolated from the human peripheral blood mononuclear cells isolated
from heparinized or citrate blood by density gradient centrifugation over Histopaque (Sigma
Aldrich, USA). Total RNA thereafter will be extracted from the harvested cells by TriZol reagent
(Rio et al., 2010) and be used as template for subsequent reverse transcription and polymerase
chain reaction (RT-PCR). For amplification of interferon alpha 2, gene-specific forward and
reverse primers designed using online Oligonucleotide Properties Calculator/Primer 3.0 computer
software programs, will be used.
Construction of Human Interferon Alpha 2-Thymosin alpha 1 (IFN α 2-Tα 1) Fusion Gene
Amplified interferon alpha 2 gene and Thymosin alpha 1 gene will be fused together by
polymerase chain reaction using a set of primers given below. INFα 2-Tα1 will be a recombinant
fusion gene composed of INFα 2 gene fused with Tα1 gene at its 3' end with oligonucleotide
encoding a linker peptide (Gly-Gly-Gly- Gly-Ser) inserted between them.
Th-F 5’-CAAACTTGCAAGAAAGTTTACGTAGTAAAGAAGGTGGAGGCGGAAGCGAC-3’
INF-R 5’-GTCGCTTCCGCCTCCACCTTCTTTACTACGTAAACTTTCTTGCAAGTTTG-3’
Th-R 5’-CCGCGTCTCCGGTGGTTCTCGGCCTCCTCCACC-3’
IT-F1 5’CCATGGGATGTGATCTGCCTCAA 3’
IT-R1 5’GGATCCTAGTTCTCGGCCTCCTC 3’
IT-F2 5’ CCATGGGATGTGATCTGCCTCAA3’
IT-R2 5’ CTCGAGGTTCTCGGCCTCCTC3’
Cloning and high level expression of human IFN α 2-Tα1 Fusion Protein
IFN α 2-Tα 1 fusion gene will be cloned and expressed in E. coli expression systems
separately. IFN α 2-Tα 1 will be ligated in pTZ57R/T vector by TA cloning method using TA
cloning kit (Thermo). After that, E.coli cells will be transformed with pTZ57-IFN α 2-Tα 1
recombinant vectors by using standard protocol (Sambrook and Russel, 2001). The screening of
white recombinant colonies will be done by colony PCR to confirm the presence of IFN α 2-Tα 1
gene sequences. Plasmid DNA will be isolated from recombinant clones by using the standard
procedure (Sambrook and Russel, 2001) and restriction analysis and Plasmid PCR of recombinant
cloning vectors pTZ57-IFN α 2-Tα 1 will be performed to check for the presence of insert. The
sequence analysis of recombinant plasmids (pTZ57-IFN α 2-Tα 1) will also be performed.
Following cloning, both genes (IFN α 2-Tα 1) will be sub-cloned in pET expression
plasmid according to the standard protocols (Sambrook and Russell, 2001) and recombinant
vectors (pET57-IFN α 2-Tα 1) will be proceed to transformation and over expression in E. coli
BL21 DE3 (Codon Plus) strain. The E. coli expression systems will be optimized with respect to
cultivation media, inducer (IPTG, lactose) concentration and time and duration of induction in
shake-flask cultures.
Purification, Refolding and characterization of recombinant IFN α 2-Tα 1 fusion protein
Different chromatographic techniques such as nickel chromatography, ion exchange
chromatography will be used to purify and recover yield of fusion protein. Before purification,
recombinant Interferon alpha 2–Thymosin α 1 fusion protein expressed as inclusion bodies will be
separated by centrifugations and then washed with detergents to remove the membrane proteins
and other contaminants. Following washing steps, the recombinant Interferon alpha 2–Thymosin
α fusion protein will be solubilized either by using strong chaotropic agents or by a combination
of alkaline pH and mild concentration of denaturant.
Purified recombinant proteins will be analyzed by SDS-PAGE, western blotting, RP-HPLC
and MALDI-TOF mass spectrometry. CD spectrometeric analysis will be used for analyzing the
biologically active conformation of recombinant interferon alpha 2b and Interferon alpha 2–
Thymosin α fusion protein.
Biological Activity Assessment
To achieve biologically active 3-D conformation recombinant proteins will be refolded in
the presence of oxidized and reduced species containing solution.
In order to check the biological activity of recombinant Interferon alpha 2–Thymosin α 1
fusion protein, different cell based bioassays will be performed.
Targeted Delivery of Therapeutic Fusion protein to Liver by Specific Antibodies
Therapeutic fusion protein will be chemically fused to antibody specific to hepatocyte
antigen asialoglycoprotein receptor (ASGPR) through sulfo-SMCC linker. The fusion protein-
antibody complex will be injected in mice. To check the presence and effect of fused antibody,
immunohistochemical analysis will be performed,
Time Plan
This project is planned to complete within time schedule of three years. The detail of time
plan is given below.
Time (months)
Objectives 3 6 9 12 15 18 21 24 27 30 33 36
Fusion gene comprising IFN α 2 and Tα 1 was constructed by overlap extension PCR by
using set of primers given in Table 1.
In overlap extension PCR, first 10 cycles were performed with Tα 1 forward primer (T–F
5’-CAAACTTGCAAGAAAGTTTACGTAGTAAAGAAGGTGGAGGCGGAAGCGAC-3’) &
IFNα-2 reverse primer (I-R 5’-GTCGCTTCCGCCTCCACCTTCTTTACTACGTAAACTTTC
TTGCAAGTTTG-3’) in a reaction mixture with purified IFN α 2 and Tα 1 genes as templates, 5
units of Taq DNA polymerase (Thermo scientific, Germany), 1X PCR buffer, 2.5 mM dNTPs, 2
mM MgCl2 and PCR profile was set as denaturation at 95 °C for 1 min, annealing at 55 °C-62 °C
for 1 min and extension at 72 °C for 1 mins.
After 10 cycles of reaction, IT-F (5’CCATGGGATGTGATCTGCCTCAA3’) and IT-R
(5’CTCGAGGTTCTCGGCCTCCTC3’) primers were added in reaction mixture for amplification
of IFN α 2-Tα 1 Fusion Gene and subjected to 30 cycles of denaturation at 95 °C for 1 min,
annealing at 58 °C for 1 min and extension at 72°C for 1 mins followed by final extension at 72
°C for 10 mins. The restriction site of Nco1 (5/ CCATGG 3/) and XhoI (5/ CTCGAG 3/) were
inserted in IT-F and IT-R primers, respectively. PCR product was further analyzed by 1% agarose
gel electrophoresis. INFα 2-Tα1 is recombinant fusion gene composed of INFα 2 gene fused with
Tα1 gene at its 3' end with oligonucleotide encoding a linker peptide (Gly-Gly-Gly-Gly-Ser)
inserted between them.
Table 1: Primer sequences for amplification of IFN α 2 gene & construction of IFN α 2-Tα 1 Fusion Gene
IF 5’ TGTGATCTGCC TCAAACC 3’
IR 5’ TTCTTTACTACGTAAACTTTC 3’
T–F 5’AAACTTGCAAGAAAGTTTACGTAGTAAAGAAGGTGGAGGCGGAAGCGAC-3
IT-F 5’CCATGGGATGTGATCTGCCTCAA3’
IT-R 5’CTCGAGGTTCTCGGCCTCCTC3’
concentrations of inducers (IPTG, lactose) and duration of induction in shake-flask cultures. The
expression of IFN α 2-Tα 1 fusion gene was optimized by using IPTG (0.2 mM-1.0 mM) and
lactose (0. 2 mM and 1.0 mM), media (LB and TB media), time & temperature of incubation.
different concentrations of IPTG and lactose separately when OD600nm reached 0.6 and incubated
for different time durations. After incubation, OD600nm of all cultures was measured and cells were
harvested at 6000 rpm for 20 minutes at 4C. Cell pellets were resuspended in I ml (10 X dilution)
of Lysis buffer (50mM Tris-Cl pH 6.3, 100 mM NaCl, 5mM EDTA and 1mM PMSF) separately
and subjected to lysis by sonication. All cell lysates were centrifuged at 6000 rpm for 20 minutes
at 4C and cell pellets and supernatants were analyzed by 12 % SDS-PAGE for screening of
expression level, localization and solubility. Total cell proteins fraction, soluble cytoplasmic
After that, insoluble cytoplasmic fraction was washed with 100 ml of wash buffer I (50
mM Tris-Cl, pH 6.31, 5mM EDTA, 0.5 % Triton X100, 5mM PMSF) and incubated on ice for 1
hour. The pellet was collected by centrifugation at 8000 rpm for 30 minutes at 4C and washed with
100 ml of wash buffer II (50mM Tris-Cl pH=6.3 5mM PMSF) followed by washing in 100 ml of
50 mM Tris-Cl pH 6.31. At each steps, the supernatants were analyzed by 12 % SDS-PAGE for
To determine the best solubilization condition, aliquots of the cell pellet with equal
amounts of the insoluble protein were resuspended in each of the solubilizing solution (table) and
The solubilized IBs were centrifuged at 12000 rpm for 15 minutes at 4°C to remove the
insoluble particles. The clear solution was processed for refolding of recombinant fusion protein.
Recombinant protein was refolded by dialysis of the solubilized solution of IBs (containing
recombinant IT) against the refolding buffer (50mM Tris-Cl pH 6.31, 5mM L-cysteine, 1mM L-
cystine, 10% glycerol, 5% sucrose, 1mM PMSF, and 1% SDS). The refolding buffer volume was
50 times the volume of inclusion body solution. The solution was kept at 4°C with the change of
buffer after every 4 hours. The solution was then dialyzed against the Dialysis Buffer I (50mM
Tris-Cl pH 6.31, 10% glycerol, 1mM PMSF), Dialysis Buffer II (50mM Tris-Cl pH 6.31, 1mM
PMSF), Dialysis Buffer III (25mM Tris-Cl pH 6.31, 1mM PMSF) and Dialysis Buffer IV (10mM
Tris-Cl pH 6.31, 1mM PMSF). After refolding, the protein was analyzed on 12% SDS-PAGE and
% age of protein in each fraction was measured by Gel Documentation System (SynGene). Protein
contents in the liquid samples were estimated either by Bradford assay by using bovine serum
After refolding process, the protein was subjected to purification by Ni2+ affinity
chromatography by using Ni-NTA resin (Invitrogen). The protein sample was loaded onto column
(1.5 X 7.5cm) packed with Ni2+-NTA resin (Invitrogen) and equilibrated with denaturing binding
buffer (8 M urea, 20 mM sodium phosphate pH 7.8 and 500 mM NaCl). Wash the resin with 20
column volumes of wash buffer (50 mM NaH2PO4 pH 8, 300mM NaCl, 10 mM imidazole pH to
8). Elution of adsorbed fusion proteins was achieved with buffer containing 200 mM imidazole.
Eluted fractions were dialysed against 1X PBS for 3hr on magnetic stirrer at 40C to remove
imidazole. After dialysis, fractions were lyophilized and analyzed by 12 % SDS-PAGE for desired
protein.
Both purified and unpurified protein samples were resolved by 12% SDS-PAGE and
transferred on to nitrocellulose membrane by using transblot semi dry apparatus (Biorad) at 20 V
for 1 h by using transfer buffer (25 mM Tris-Cl (pH 8.3), 192 mM glycine, and 20 % (v/v)
methanol). To block the non-specific membrane sites, the blot was incubated in 5% (w/v) skimmed
milk in TBS-T buffer [20 mM Tris (pH 7.6), 13 mM NaCl, 0.1 % (v/v) Tween 20] for 1 hour at
4oC to block nonspecific binding sites for 30 min. After blocking, the membrane was incubated
with mouse anti-interferon antibody (1:3000 dilutions) for 1 h at room temperature with gentle
shaking on a rotatory shaker. The blot was washed three times with 1X TBS-T buffer (10
minutes/wash) and the membrane was incubated in mouse anti-human IgE conjugated with
alkaline phosphatase (1:5000 diluted in 1X TBS-T) at room temperature for 2 hours. After
washing, the colour reaction was developed by incubating the blot in BCIP/NBT substrate solution
in carbonate buffer (pH 9.8) containing 0.1M NaHCO3 and 1 mM MgCl2. The reaction was
stopped by washing the membrane in several changes of water. Finally, the strip was air dried and
then analysed.
MALDI-TOF analysis
The HPLC purified protein fractions (1 mg/ml) were subjected to MALDI-TOF analysis.
1 µl (50 pmol) protein sample was mixed with 20 µl of matrix B (5 mg Sinapinic acid dissolved
in 1 ml of 30 % acetonitril containing 0.3 % TFA). From this mixture, 5 µl of sample was spotted
on stainless steel mass spectrometric plate and allowed to dry for 20-25 minutes. Before doing the
mass analysis of interferon alpha 2b, the mass spectrophotometer was calibrated with standard
protein such as myoglobin (16 kDa). The mass spectra of protein fractions were recorded while
number of laser shots per spectrum was 100. On X-axis of mass spectrum, mass (m/z) was
described while on Y-axis % intensity of laser shot was described. The mass spectrophotometer
used in this study was of Bruker Autoflex.
Results
Construction of INFα 2-Tα1 Fusion Gene & Cloning
A cDNA prepared from human blood poly (A+) RNA was used as template to amplify and
clone human IFN α 2 gene. Gradient PCR analysis revealed a product of approximately 495bp.
PCR conditions were optimized at different annealing temperatures and the best gene amplification
was found to be at 56.7°C (Figure 1). Purified IFN α 2 gene fragment was fused with synthetic Tα
1 by overlap extension PCR and analyzed by 1% agarose gel electrophoresis (Figure 1). INFα 2-
Tα1 is recombinant fusion gene composed of INFα 2 gene fused with Tα1 gene at its 3' end with
oligonucleotide encoding a linker peptide (Gly-Gly-Gly-Gly-Ser) inserted between them (figure
2).
Purified INFα 2-Tα1 fusion gene was ligated into pTZ57R/T vector (Thermo Scientific) to
construct the recombinant pTZ- INFα 2-Tα1 vector. This vector was transformed into E. coli strain
DH5α. Transformation was confirmed by colony PCR of selected clones. PCR product was
analyzed on 1% agarose gel revealed a band of bp thus confirming the presence of gene.
Recombinant plasmid was isolated by alkaline lysis method (Sambrook and Russell, 2001) and
subjected to restriction digestion by Nco1 and Xho 1 for restriction analysis.
Fig. 1: Analysis of INFα 2-Tα1 fusion gene (a) and amplified IFN α 2 gene (b) by 1% agarose
gel electrophoresis
IT Reference Sequence
TGTGATCTGCCTCAAACCCACAGCCTGGGTAGCCGTCGTACCTTGATGCTCCTGGCACAGATGCGTCGT
ATCTCTCTTTTCTCCTGCTTGAAAGACCGTCATGACTTTGGCTTTCCGCAGGAAGAATTTGGCAACCAG
TTCCAAAAGGCTGAAACCATCCCTGTCCTCCATGAGATGATCCAGCAGATCTTCAATCTCTTCAGCACA
AAGGACTCATCTGCTGCTTGGGATGAGACCCTCCTAGACAAATTCTACACTGAACTCTACCAGCAGCT
GAATGACCTGGAAGCCTGTGTGATACAGGGGGTGGGGGTGACAGAGACTCCGCTGATGAAAGAAGAC
TCCATTCTGGCTGTGAGGAAATACTTCCAAAGAATCACTCTCTATCTGAAAGAGAAGAAATACAGCCC
TTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCTTTTTCTTTGTCAACAAACTTGCAAGAAA
GTTTACGTAGTAAAGAAGGTGGAGGCGGAAGCGACGCCGCCGTGGACACCAGCAGCGAGATCACCAC
CAAGGACCTGAAGGAGAAGAAGGAGGTGGTGGAGGAGGCCGAGAAC
IT vs IFNR2
IT vs. Toll like receptors
The recombinant fusion protein TMa1–cBLyS was roduced in 500 ml cultures. After the cells were
disrupted by sonication, 50% of the fusion proteins could be detected in the supernatants and the
others in intracellular precipitate. While only cBLyS was expressed with the same vector, host and
same culture conditions, 80% of expressed protein was inclusion bodies. We assume it was due to
TMa1 being a heat-stable, acidic polypeptide which might improve the solubility of the
recombinant fusion protein.
Expression vector pET-28a was selected because the target protein was expressed as a fusion
protein with a (His)6-tag in order to facilitate subsequent purification. So, the fusion protein was
purified in one-step procedure by Ni-NTA affinity sepharose column. Different concentrations of
the imidazole were tested in equilibrium buffer. The most unspecific binded proteins could be
eluted by 30 mM imidazole. TMa1–BLyS was eluted with buffer containing 200 mM imidazole.
The result of SDS-PAGE analysis showed that the purity was no less than 85% (Figure 2). No
attempts were made to remove the impurities by further purification steps.
Purified to near homogeneity by fast protein liquid chromatography on aQFF anion exchange
column.
Circular dichroism spectroscopic analysis showed that the secondary structure contents of the
purified GCSF are similar to the commercially available GCSF.
MALDI-TOF analysis of recombinant human interferon alpha 2b after HPLC
The purified human interferon alpha 2b protein peaks after HPLC were subjected to
MALDI-TOF analysis. The peaks obtained from HPLC analysis were labeled as I, II and III before
proceeding for MALDI-TOF analysis. Each peak was subjected separately to MALDI-TOF
analysis and results indicated that peak I’s experimental mass was e~19264.3 Dalton (Figure 29)
while peak III’s experimental mass was ~19411 Dalton (Figure 29) corresponding to human
interferon alpha 2b and the latter with an N-terminal methionine respectively. However, peak II’s
experimental mass was found to be ~19309 Dalton. This indicated the oxidation of certain amino
acid residues as a result the cumulative mass increased from 19264.3 Dalton to 19309 Dalton with
a difference of 44 Dalton (Figure 29, Table 20). As pointed out above, the theoretical values of
human interferon alpha 2b protein with and without methionine, as determined from Protparam
are19269 Dalton and 19400 Dalton (appendix-B). Thus peak I (~19264.3 Dalton) is assigned to
human interferon alpha 2b with out methionine at N-terminal while peak III (~19411 Dalton) to
interferon alpha 2b species with methionine at N-terminal region. However peak II (19309 Dalton)
could be oxidized form of human interferon alpha 2b with out methionine at the N-terminal region
with ~ 3 oxygen atoms attached to protein, so mass had increased from 19264.3 Dalton to ~19309
Dalton. The theoretical increase in mass, for 3 oxygen atoms, should be 48 Dalton and 44 Daltons
observed in the present study is within experimental error, since MALDI analysis by Autoflex
used in the present work, in the 20,000 mass range shows a fluctuation of 5-10 Dalton
hybrid expression vector (pET28a-IT). The IT gene was directionally subcloned between NcoI and XhoI restriction
sites.
Induction (5hr, 1mM IPTG)
Lane 2 Uninduced fraction, lane 3 total cell protein fraction, lane 4 soluble cytoplasmic fractions,
lane 6 inclusion bodies/insoluble lane 7 cytoplasmic fraction, lane 8 washed inclusion bodies, lane
9 solubilized inclusion bodies, lane 10 refolded protein
Helix 16.5%
Antiparralel beta sheets 43.4%
Parallel betasheet14%
Beta turns 21.6%
Control
References
Andreone, P., Cursaro, C., Gramenzi, A., Margotti, M., Ferri, E., Talarico, S., et al. (2001). In vitro
effect of thymosin-a1 and interferon-a on Th1 and Th2 cytokine synthesis in patients with
chronic hepatitis C. Journal of Viral Hepatitis, 8,194-201
Arase, Y., Tsubota, A., Suzuki, Y., Suzuki, F., Kobayashi, M., Someya, T., Akuta, N., Hosaka, T.,
Saitoh, S., Ikeda, K., Kobayashi, M. and Kumada, H. (2003) A pilot study of thymosin alpha1
therapy for chronic hepatitis B patients. Intern Med, 42, 941-946
Bach, E.A., Aguet, M. and Schreiber, R.D. (1997). The IFN gamma receptor: a paradigm for
cytokine receptor signaling. Annu. Rev. Immunol., 15, 563-591.
Bekisz, J., Baron S., Balinsky, C., Morrow, A. and Zoon. K.C. (2010). Antiproliferative Properties
of Type I and Type II Interferon. Pharmaceuticals, 3, 994-1015
Billich A. (2002). Thymosin alpha1. SciClone Pharmaceuticals. Curr Opin Investig Drugs, 3, 698-
707
Biron, C.A., Nguyen, K.B., Pien, G.C., Cousens, L.P. and Salazar-Mather, T.P. (1999). Natural
killer cells in antiviral defense: Function and regulation by innate cytokines. Annu. Rev.
Immunol., 17, 189–220.
Biron, CA. and Sen, GC. 2001. Interferons and other cytokines, p. 321-351. In D. M. Knipe, P. M.
Howley, D. E. Griffin, M. Martin, B. Roizman, and S. E. Straus (ed.), Fields virology, 4th
ed. Lippincott-Raven, Philadelphia, Pa.
Camerini, R., Ciancio, A., De Rosa, A., and Rizzetto, M. (2007). Studies of therapy with thymosin
alpha 1 in combination with pegylated interferon alpha2a and ribavirin in no responder
patients with chronic hepatitis C. Ann NY Acad Sci., 1112, 368–74.
Coulstock, E., Sosabowski, J., Ovecka1, M., Rob, P., Laura, G., Clare, M., Armin S., Marie, D.,
Julie. F., Jerome, B., Grainne, D., Adam, W. (2013). Liver-Targeting of Interferon-Alpha
with Tissue-Specific Domain Antibodies. PLoS ONE, 8.
Dieperink, E., Ho, S.B., Thuras, P., Willenbring, M.L. (2003). A prospective study of
neuropsychiatric symptoms associated with interferon-alpha-2b and ribavirin therapy for
patients with chronic hepatitis C. Psychosomatics, 44, 104–112.
Dusheiko, G. (1997) Side effects of alpha interferon in chronic hepatitis C. Hepatology, 26, 112–
121.
Fried, M.W., Shiftman, M.X., Reddy, K.R., Smith, C., Marinos, G., GoncalesJr, F.L., et al. (2002).
Peginterferon alfa-2a plus ribavirin for chronic hepatitis C vious infection. N Engl J Med.,
347, 975–982.
Goldstein, A.L. (2009). From lab to bedside: emerging clinical applications of thymosin alpha 1.
Expert Opin Biol Ther. 9,593–608.
Garaci, E., Pica, F., Serafino, A., Balestrieri, E., Matteucci, C., Moroni, G., Sorrentino, R.,
Zonfrillo, M. and Sinibaldi-Vallebona, P. (2012). Thymosin α1 and cancer: action on
immune effector and tumor target cells. Ann. N.Y. Acad. Sci., 1269, 1–9
Garaci, E., Pica, F., Sinibaldi-Vallebona, P., Pierimarchi, P., Mastino, A., Matteucci, C., et al.
2003. Thymosin alpha 1 in combination with cytokines and chemotherapy for the treatment
of cancer. Int Immunopharmacol., 3, 1145–50.
George, C.X. and Samuel, C.E. (1999). Human RNA specific adenosine deaminase ADAR1
transcripts possess alternative exon 1 structures that initiate from different promoters, one
constitutively active and the other interferon-inducible. Proc. Natl. Acad. Sci., 96, 4621-
4626.
Heim, M.H. (1999). The Jak-STAT pathway: cytokine signalling from the receptor to the nucleus.
J. Receptor Signal Transduction Res., 19, 75-120.
Iorio, R, Pensati, P, Botta, S, Moschella, S, Impagliazzo, N, et al. (1997). Side effects of alpha-
interferon therapy and impact on health-related quality of life in children with chronic viral
hepatitis. Pediatr Infect Dis J., 16, 984–990.
Iyer, U. and Kadambi, V.J. (2011). Antibody drug conjugates - Trojan horses in the war on cancer.
J Pharmacol Toxicol Methods, 64, 207–212.
Kageshita, T., Hirai, S., Ono, T., Hicklin, D.J. and Ferrone, S. (1999). Down-regulation of HLA
class I antigen-processing molecules in malignant melanoma: association with disease
progression. American Journal of Pathology, 154,745-754.
Kim, H.A., Ko, H.M. and Hu, H.W. (2009). CpG-ODN-based immunotherapy is effective in
controlling the growth of metastasized tumor cells. Cancer Letters, 274, 160-164.
Kirkwood, J.M., Tarhini, A.A. and Panelli, M.C. (2008). Next generation of immunotherapy for
melanoma. Journal of Clinical Oncology, 26, 3445-3455.
Knutsen, A.P., Freeman, J.J., Mueller, K.R., et al. (1999). Thymosin α1 stimulates maturation of
CD 34+ stem cells into CD3+4+ cells in an in vitro thymic epithelia organ coculture model.
Int J Immunopharmacol., 21, 15-6
Kontsek, P. and Kontsekova, E. (1998). Present views on interferons. Bratisl Lek Listy, 99, 226-
30.
Kouttab, N.M., Goldstein, A.L. and Lu, M. et al. (1988). Production of human B and T cell growth
factors is enhanced by thymic hormones. Immunopharmacology, 16, 97–105.
Leichtling, K.D., S.A. Serrate & M.B. Sztein. 1990. Thymosin alpha 1 modulates the expression
of high affinity interleukin-2 receptors on normal human lymphocytes. Int.J.
Immunopharmacol. 12: 19–29.
Liu, C., Patel, A. and Zhu, H. (2002). In vitro studies to identify host genes or pathways involved
in immune-mediated response to thymosin alpha 1 and peginterferon. Hepatology and
Gastroenterology, 12, 23-29.
Loggi, E., Gramenzi, A., Margotti, M., Cursaro, C., Galli, S., Vitale, G., Grandini, E., Scuteri,
A., Vukotic, R., Andreone, P. and Bernardi M. (2008). In vitro effect of thymosin alpha 1
and interferon alpha on Th1 and Th2 cytokine synthesis in patients with HbEAg-negative
chronic hepatitis B. J Viral Hepat., 15, 442-8
Lopez, M., Carpano, S., Cavaliere, R., Di Lauro L., Ameglio, F., Vitelli G., et al. Biochemotherapy
with thymosin α 1, interleukin-2 and dacarbazine in patients with metastatic melanoma:
clinical and immunological effects. (1994). Ann Oncol, 5, 741–6.
Maio, M., Andrzej, M, Alessandro, T, Uwe, T, Virginia, F, Jacek, J, Claus, G, Thierry, L, Bernard,
G, Pere, G, Katalin, G, Roberto, C, and Francesco, C. (2010). Large Randomized Study of
Thymosin α 1, Interferon Alfa, or Both in Combination With Dacarbazine in Patients With
Metastatic Melanoma. J Clin Oncol, 28, 1780-1787.
Mastino, A., Favalli, C. and Grelli, S. (1992). Combination therapy with thymosin alpha 1
potentiates the antitumor activity of interleukin-2 with cyclophosphamide in the treatment of
the Lewis Lung carcinoma in mice. International Journal of Cancer, 50, 493-499.
Mogensen, K.E., Lewerenz, M., Reboul, J., Lutfalla, G. and Uze, G. (1999). The type I interferon
receptor: structure, function, and evolution of a family business. J. Interferon Cytokine Res.,
19, 1069-1098.
Molloy, P.J., Azzouz, M. and Van, T. (1996). Treatment of chronic hepatitis B and hepatitis C
with interferon alfa-2b. Am Fam Physician, 54, 1598-1605
Murashima, S., Kumashiro, R., Ide, T., Miyajima, .I, Hino, T., Koga, Y., Ishii, K., Ueno, T.,
Sakisaka, S. and Sata, M. (2000). Effect of interferon treatment on serum 2, 5’-
oligoadenylate synthetase levels in hepatitis C-infected patients. J. Med. Virol., 62, 185–190.
Nadeene, P. and Andrew, C.G.P. (2004). Identification of a novel gene family that includes the
interferon-inducible human genes 6–16 and ISG12. BMC Genomics, 5, 8-19.
Naylor, P.H., Quadrini, K., Garaci, E., Rasi, G., Hadden, J.W. (2007). Immunopharmacology of
thymosin alpha 1 and cytokine synergy. Ann NY Acad Sci., 1112, 235–44.
Nefedova, Y., Huang, M. and Kusmartsev, S. (2004). Hyperactivation of STAT3 Is Involved in
Abnormal Differentiation of Dendritic Cells in Cancer. Journal of Immunology, 172, 464-
474
Nowak, A.K., Lake, R.A., Marzo, A.L., et al. (2003). Induction of tumor cell apoptosis in vivo
increases tumor antigen cross-presentation, cross-priming rather than cross-tolerizing host
tumor-specific CD8 T cells. J Immunol, 170, 4905-4913.
Pardridge, W.M. (2010). Biopharmaceutical drug targeting to the brain. J Drug Targeting, 18, 157–
167.
Peng, Y., Chen, Z., Yu, W., Zhou, Q., Xu, L., Mao, F.F., et al. (2008). Effects of thymic
polypeptides on the thymopoiesis of mouse embryonic stem cells. Cell Biol Int. 32, 1265–
71.
Pestka, S. (2007). Purification and cloning of interferon alpha. Curr. Top. Microbiol. Immunol.,
316, 23-37.
Poo, J.L., Sánchez, A, F., Kershenobich, D., García Samper, X., Torress-Ibarra, R., Góngora, J.,
et al. (2008). Efficacy of triple therapy with thymalfasin, peginterferon alpha-2a, and
ribavirin for the treatment of hispanic chronic HCV nonresponders. Ann Hepatol., 7, 369–
75.
Rasi, G., Silecchia, G. and Sinibaldi-Vallebona, P. (1994). Anti-tumor effect of combined
treatment with thymosin alpha 1 and interleukin-2 after 5-fluorouracil in liver metastases
from colorectal cancer in rats. International Journal of Cancer, 57, 701-705.
Roberts, R.M., Liu, L., Guo, Q., Leaman, D. and Bixby, J. (1998). The evolution of the type I
interferons. J. Interferon Res., 18, 805-816.
Romani, L., Bistoni, F. and Perruccio, K. (2006). Thymosin alpha1 activates dendritic cell
tryptophan catabolism and establishes a regulatory environment for balance of inflammation
and tolerance. Blood, 108, 2265-2274.
Romani, L., Bistoni, F., Gaziano, R., Bozza, S., Montagnoli, C., et al. (2004). Thymosin α1
activates dendritic cells for antifungal Th1 resistance through toll-like receptor signaling.
Blood, 103, 4232-9
Romani, L., Bistoni, F., Montagnoli, C., et al. (2007). Thymosin alpha1: An endogenous regulator
of inflammation, immunity, and tolerance. Ann N Y Acad Sci., 1112, 326-338.
Romerio F, Zella D. (2002). MEK and ERK inhibitors enhance the anti-proliferative effect of
interferon-alpha 2 b. FASEB J, 16, 1680-1682
Rustgi, V. (2004). Combination therapy of thymalfasin (thymosin-alpha 1) and peginterferon alfa-
2a in patients with chronic hepatitis C virus infection who are non-responders to standard
treatment. J Gastro enterol Hepatol., 19, 76–80.
Rustgi, V.K. (2005). Thymalfasin for the treatment of chronic hepatitis C infection. Expert Rev
Anti Infect Ther., 3, 885–92.
Sambrook, J. and Russel, DW. 2001. Molecular cloning: a laboratory manual. 3ed. New York;
Cold Spring Harbor Laboratory Press, ISBN 0-87969-577-3.
Samuel, C.E. (1993). The eIF-2α protein kinases, regulators of translation in eukaryotes from yeasts
to humans. J. Biol. Chem., 268, 7603-7606.
Samuel, C.E. (2001). Antiviral Actions of Interferons. Clinical Microbiology Reviews, 14, 4778-
809.
Saruc, M., Ozden, N., Turkel, N., Ayhan, S., Hock, L.M., Tuzcuoglu, I. and Yuceyar H. (2003).
Long-term outcomes of thymosin-alpha 1 and interferon alpha-2b combination therapy in
patients with hepatitis B e antigen (HBeAg) negative chronic hepatitis B. J Pharm Sci., 92,
1386-1395
Saruc, M., Yuceyar, H., Kucukmetin, N., Demir, M.A. and Kandiloglu, A.R. (2002). Combination
thymosin-alpha 1 and interferon-alpha 2b in the treatment of anti-HBe-positive chronic
hepatitis B in Turkey. Hepatogastroenterology,49, 798-802
Shrivastava, P., Singh, S.M. & Singh. N. (2004). Effect of thymosin alpha 1 on the antitumor
activity of tumor–associated macrophage-derived dendritic cells. J. Biomed. Sci., 11, 623–
630.
Stark, G.R., Kerr, I.M., Williams, B.R., Silverman, R.H. and Schreiber, R.D. (1998). How cells
respond to interferons. Annu. Rev. Biochem., 67, 227-264.
Sztein, M.B. & S.A. Serrate. (1989). Characterization of the immunoregulatory properties of
thymosin alpha 1 on interleukin-2 production and interleukin-2 receptor expression in normal
human lymphocytes. Int. J. Immunopharmacol., 11, 789–800
Tete, S., Pappalardo, S., Fioroni, M., Salini, L., Imperatrice, A.M. and Perfetti, E.G. (1999). Bcl-
2, p53, Ki-67 and apoptotic index in cancerous and precancerous lesions of the oral
leukoplakia with isotretinoin. Minerva Stomatol., 48, 411-8
Van Broekhoven, C.L., Parish, C.R., Demangel, C., Britton, W.J and, Altin, J.G. (2004). Targeting
dendritic cells with antigen-containing liposomes: a highly effective procedure for induction
of antitumor immunity and for tumor immunotherapy. Cancer Res, 64, 4357–4365.
van der Most, R.G., Currie, A., Robinson, B.W., et al. (2006). Cranking the immunologic engine
with chemotherapy: Using context to drive tumor antigen cross presentation towards useful
antitumor immunity. Cancer Res, 66, 601-604.
Wang, R.F., Miyahara, Y. and Wang, H.Y. (2008). Toll-like receptors and immune regulation:
implications for cancer therapy. Oncogene, 27, 181-189.
Wu, A.M. and Senter, P.D. (2005). Arming antibodies: prospects and challenges for
immunoconjugates. Nat Biotechnol., 23, 1137–1146.
Yao, Q., Doan, L.X. and Zhang, R. (2007). Thymosin alpha 1 modulated dendritic cell
differentiation and functional maturation from peripheral blood CD14+ monocytes.
Immunology Letters, 110, 110-120.
Yao, W., Zhu, Q., Yuan, Y., Qiao, M., Zhang, Y., and Zhai, Z. (2007). Thymosin alpha 1 improves
severe acute pancreatitis in rats via regulation of peripheral T cell number and cytokine serum
level. J Gastroen Hepatol., 22, 1866–71.
Zhang, P., Chan, J., Dragoi, A.M., et al. (2005). Activation of IKK by thymosin α1 requires the
TRAF6 signaling pathway. EMBO Rep., 6, 531-7