AWWA Appl Virus Detect Tech

American Water Works Association
RESEARCH FOUNDATION
Application of
PCR Technologies for
Virus Detection in
Groundwater
Subject Area:
Monitoring
and Analysis
Application of
Virus Detection in
Groundwater
The mission oftheAWWA Research Foundation is to advance the science of water to
improve the quality of life. Funded primarily through annual subscription payments from
over 900 utilities, consulting firms, and manufacturers in North America and abroad,
AWWARF sponsors research on all aspects of drinking water, including supply and
resources, treatment, monitoring and analysis, distribution, management, and health
effects.
From its headquarters in Denver, Colorado, the AWWARF staff directs and supports
the efforts of over 500 volunteers, who are the heart of the research program. These
volunteers, serving on various boards and committees, use their expertise to select and
monitor research studies to benefit the entire drinking water community.
Research findings are disseminated through a number of technology transfer activi
ties, including research reports, conferences, videotape summaries, and periodicals.
Application of
Virus Detection in
Groundwater
Prepared by:
Morteza Abbaszadegan,
Peter W. Stewart
American Water Works Service Company, Inc.,
Belleville, IL 62220
Mark W. LeChevaliier
American Water Works Service Company, Inc.,
Voorhees, NJ 08043
Charles P. Gerba
Department of Soil and Water Science,
The University of Arizona, Tucson, AZ 85720
Sponsored by:
AWWA Research Foundation
6666 West Quincy Avenue
Denver, CO 80235-3098
Published by the
AWWA Research Foundation and
Disclaimer
This study was funded by the AWWA Research Foundation (AWWARF).

AWWARF assumes no responsibility for the content of the research study
reported in this publication or for the opinions or statements of fact expressed in the
report. The mention of trade names for commercial products does not represent or imply
the approval or endorsement of AWWARF. This report is presented solely for informational purposes.
Library of Congress Cataloging-in-Publication Data

Application of PCR technologies for virus detection in groundwater /
prepared by Morteza Abbaszadegan ... [et al.].
xxii, 60 p. 21.5x28 cm.
Includes bibliographical references (p.).
ISBN 0-89867-934-6
1. Viral pollution of water. 2. Enteroviruses Analysis.
3. Polymerase chain reaction. 4. Groundwater Analysis.
I. Abbaszadegan, Morteza. II. AWWA Research Foundation.
TD427. V55A66 1998
628. I'61-dc21 97-34412
CIP
Copyright 1998
by
AWWA Research Foundation
and
Printed in the U.S.A.
ISBN 0-89867-934-6 Printed on recycled paper.

Contents
List of Tables ................................................ ix
List of Figures ................................................. xi
Foreword .................................................... xiii
Acknowledgments ............................................ xv
Executive Summary ............................................ xvii
Chapter 1 Introduction ...................................... 1

Enteric Viruses in Water, 1
The Polymerase Chain Reaction, 2
Cell Culture Methods, 4
The Groundwater Disinfection Rule, 6
Objectives, 6
General Objectives, 6
Specific Objectives, 6
Approach and Experimental Design, 7
Chapter 2 Water-Sampling Program ............................ 9

Site Selection, 9
Sampling Kit, 9
Water-Sampling Training Video, 11
Sampling Program, 11
Physicochemical Analysis, 11
Chapter 3 Methods Development................................ 13

Optimization of RT-PCR, 13
Reducing Sample Concentrate Volume, 14
Pre-PCR Concentrate Treatment, 14
Optimization of Reaction Enzymes, 15
Reaction Conditions and Other Reagents, 17
Short, Sequence-Specific Primers, 18
Confirmation and Control, 18
Treatment of Samples Highly Resistant to Amplification, 19
vi PCR Technologies for Virus Detection in Groundwater
Chapter 4 Materials and Methods .............................. 21

Sample Collection, 21
Filter Elution, 21
Virus Flocculation and Reconcentration, 21
Cell Culture Assay, 22
Bacteriophage Assay, 22
Total Coliform Test, 25
Total Organic Carbon Assay, 25
UV-254 Analysis, 25
Chemical Analysis, 25
Primers and Probes Used for Virus Detection, 25
Large-Volume Polymerase Chain Reaction, 26
Pre-PCR Sample Treatment, 26
Reverse Transcription Reaction, 27
cDNA Amplification by PCR, 28
Hybridization Using Radiolabeled DNA Probes, 28
Radiolabeling of DNA Probes, 30
RT-PCR Confirmation of Cell Culture Results, 32
Chapter 5 Results ............................................ 33

RT-PCR Analysis of Environmental Concentrates, 33
Cell Culture Analysis of Environmental Concentrates, 33
Equivalent Volumes Assayed by PCR and Cell Culture
Assay, 34
Bacteriophage Assays, 34
Recovery of Poliovirus by RT-PCR, 36
RT-PCR Analysis of Cell Harvests, 38
Chemical Analyses, 38
Summary of Physicochemical Characteristics of
Groundwater Sites, 41
Statistical Analyses, 41
Chapter 6 Discussion ......................................... 43

A Strategy for the Detection of Viruses by PCR, 43
Positive and Negative Controls for PCR Assays, 44
Confirmation, 44
Statistical Analyses, 45
Sample Inhibition of RT-PCR, 45
Differential Recovery of Infectious Virus,
Heat-Inactivated Virus, and RNA, 45
PCR Assays Compared With Cell Culture Assays, 46
Contents vii
Appendix A: Bacterial Media Used in Bacteriophage Assays ........ 49
Appendix B: Suva Values, Samples 1-150 . ....................... 51
Glossary ..................................................... 53
References. .................................................. 55
List of Abbreviations and Acronyms ............................. 59

Tables
5.1 Summary of viral analyses 35

5.2 Comparative analysis of enterovirus assays 35
5.3 Summary of bacteriophage analyses 36
5.4 Summary of seeded recovery tests 37
5.5 Cell harvest RT-PCR results 39
5.6 Summary of chemical analyses 39
5.7 Summary of physicochemical characteristics 41
5.8 Summary of geological characteristics of groundwater sites 42
IX
Figures
1.1 Detection of enteroviruses by PCR 5
2.1 Sampling kit 10
3.1 Ethidium-stained gel from poliovirus-seeded water

experiment 16
3.2 Sample illustration of target DNA, primers 1 and 2, and
nested primer-probe for semi-nested PCR assay 19
4.1 Cell culture assay 23

4.2 Example gel photograph: Enterovirus-seeded reactions 29
4.3 Example gel photograph: Rotavirus-seeded and nonseeded
reactions 29
4.4 Gel photograph and autoradiograph of the same samples 31
5.1 Agarose gel of recovery of poliovirus by RT-PCR experiments 37
XI
Foreword
The AWWA Research Foundation is a nonprofit corporation that is

dedicated to the implementation of a research effort to help utilities respond to
regulatory requirements and traditional high-priority concerns of the industry. The
research agenda is developed through aprocess of consultation with subscribers and
drinking water professionals. Under the umbrella of a Strategic Research Plan, the
Research Advisory Council prioritizes the suggested projects based upon current
and future needs, applicability, and past work; the recommendations are forwarded
to the Board of Trustees for final selection. The foundation also sponsors research
projects through the unsolicited proposal process; the Collaborative Research,
Research Applications, and Tailored Collaboration programs; and various joint
research efforts with organizations such as the U.S. Environmental Protection
Agency, the U.S. Bureau of Reclamation, and the Association of California Water
Agencies.
This publication is a result of one of these sponsored studies, and it is hoped
that its findings will be applied in communities throughout the world. The following
report serves not only as a means of communicating the results of the water
industry' s centralized research program but also as a tool to enlist the further support
of the nonmember utilities and individuals.
Projects are managed closely from their inception to the final report by the
foundation's staff and large cadre of volunteers who willingly contribute their time
and expertise. The foundation serves a planning and management function and
awards contracts to other institutions such as water utilities, universities, and
engineering firms. The funding for this research effort comes primarily from the
Subscription Program, through which water utilities subscribe to the research
program and make an annual payment proportionate to the volume of water they
deliver and consultants and manufacturers subscribe based on their annual billings.
The program offers a cost-effective and fair method for funding research in the
public interest.
A broad spectrum of water supply issues is addressed by the foundation's
research agenda: resources, treatment and operations, distribution and storage,
water quality and analysis, toxicology, economics, and management. The ultimate
purpose of the coordinated effort is to assist water suppliers to provide the highest
possible quality of water economically and reliably. The true benefits are realized
when the results are implemented at the utility level. The foundation's trustees are
pleased to offer this publication as a contribution toward that end.
A renewed regulatory focus on microbes in groundwater has inspired the
drinking water community to develop better techniques for detecting viruses in the
subsurface. Conventional virus detection methods (e.g., cell culture)
are typically costly and time-consuming. Equipment requirements alone for con
ventional methods are often cost and space prohibitive. This project takes advantage
Xlll
xiv PCR Technologies for Virus Detection in Ground-water
of recent advances in molecular techniques (e.g., polymerase chain reaction, or

PCR) in an effort to develop more efficient virus detection methods. Depending on
the objectives of a groundwater virus monitoring program, PCR may provide
utilities with a simpler effective method for virus detection. This report provides a
detailed description of a PCR-based virus detection method focused on groundwater
applications.
George W. Johnstone James F. Manwaring, P.E.

Chair, Board of Trustees Executive Director
AWWA Research Foundation AWWA Research Foundation
Acknowledgments
The present study has been funded by the American Water Works Associa
tion Research Foundation and the United States Environmental Protection Agency
with support from the American Water Works Service Company Inc. and the
University of Arizona.
The help and guidance of the Project Advisory Committee (PAC) and
Project Officer Robert Alien, as well as the early assistance of Shelly Cline, were
highly appreciated. The PAC members were
G. Shay Fout, US Environmental Protection Agency,

Cincinnati, Ohio
Colin Fricker, Thames Water Utilities, Reading Berkshire,
United Kingdom
Mic Stewart, Metropolitan Water District of Southern California,
La Verne, Calif.
Marylynn Yates, University of California, Riverside, Calif.
In addition, the help of staff at the American Water Works Service

Company Inc., Belleville, 111. especially Raquel Manteiga and Katrina Schneider
on sample processing, Robert Kozik on shipping and receiving of sample kits, and
John Ban for his supervision of the chemical analysis of water samples and the
staff at Charles Gerba's laboratory, University of Arizona, Tucson, Ariz. espe
cially Pamela Watt and Carlos Enriquez for cell culture assays was greatly
appreciated.
The authors wish to acknowledge the generous assistance of the personnel
of the water companies that participated in this study.
xv
Executive Summary
Human enteric viruses may directly or indirectly contaminate water in

tended for drinking. Surface water and groundwater of the United States may be
subjected to fecal contamination from a variety of sources, including sewage
treatment plant effluent, on-site septic waste treatment discharges, land runoff from
urban, agricultural, and natural areas, and leachates from sanitary landfills. Evi
dence for fecal contamination of surface water and groundwater is provided by the
detection of enteric viruses in both types of water and by the occurrence of outbreaks
of virus-caused waterborne disease. Conventional methodology for the detection of
enteric viruses in environmental samples involves cell culture, which is expensive
and time-consuming. The length of time needed to detect viruses in a cell culture
assay ranges from a few days to several weeks. An alternative method for the
detection of enteric viruses in water samples involves the use of advanced molecular
biotechnology.
For this report, the application of the polymerase chain reaction (PCR) for
the detection of enteric viruses in groundwater was evaluated. Additionally, the
occurrence of enteric viruses in 150 groundwater samples was determined, as was
the possible association of virus presence with several potential biological and
physical indicators.
Research Objectives___________________
The primary objective of this research project was to apply advanced

molecular techniques for the development of a rapid, simple, and inexpensive assay
to allow the water industry to detect viral contamination in water. Molecular
techniques are now widely used in environmental research and monitoring, with the
necessary tools and techniques available from a variety of sources. A comprehen
sive research plan was developed to evaluate the application of PCR technology for
virus detection in groundwater and to investigate the applicability of the method for
the detection of enteroviruses, hepatitis A virus, and rotavirus in groundwater
sources. The approach included laboratory studies for the development and optimi
zation of the PCR technology and the determination of the specificity of the PCR
primers for the detection of viruses, followed by a field evaluation of the method
using groundwater sources from different geographical locations and with a variety
of physical, chemical, and geological settings. The specific objectives were as
follows:
1. Develop and evaluate a simple, rapid, and inexpensive method of
detecting human enteric viruses in groundwater samples using the
reverse transcription-polymerase chain reaction (RT-PCR)
XVll
xviii PCR Technologies for Virus Detection in Groundwater
Optimize PCR methodology for the detection of low concentrations

of viruses in groundwater as an alternative to cell culture assays
Develop a sample treatment protocol for removing enzyme
inhibitors from groundwater concentrates
Develop a PCR method to assay a larger equivalent sample volume
of each water concentrate
Conduct a field evaluation of the optimized method for the detection
of enteroviruses, hepatitis A virus, and rotavirus, using 150
groundwater samples
Approach
During the methods development phase of the project and before the actual
testing of water samples, numerous experiments were conducted to learn the
optimum sample pretreatment procedures and the optimum RT-PCR conditions.
For the optimization of RT-PCR, a systematic protocol was followed to evaluate the
reaction components and conditions, such as the concentrations of enzymes,
reaction temperatures, number of reaction cycles, and reaction volume.
A complete field evaluation was performed to examine the applicability of
the method for the detection of viruses in water samples. To ensure a variety of
samples and to best evaluate the method, sites were selected based on different
chemical, physical, and geological criteria.
After the laboratory studies and field evaluation were completed, a strategy
for the detection of viruses in groundwater was developed. The strategy is based on"
the collection of a large sample volume, the removal of inhibitory substances from
the water concentrate, a large-volume RT-PCR that allows for the testing of a larger
equivalent volume of a water sample, testing of the possible inhibitory nature of
each sample by seeding some of each with known quantities of viruses, the inclusion
of reagent positive and negative controls to exclude false positive and false negative
results, and confirmation assays of the PCR product. The strategy outlined here
fulfills the water industry's need for a rapid, reliable, inexpensive, and easily
performed analysis of groundwater for virus contamination.
One hundred fifty groundwater sample concentrates were analyzed for
enterovirus presence by both RT-PCR and cell culture assay. Virus assays were
conducted after concentration of a minimum of 400 gal (1,512 L) of groundwater
by a filter adsorption and elution method. Besides cell culture and PCR assays,
bacteriophage and total coliform analyses were performed on the water samples
collected during this study to investigate the occurrence of bacterio-phages in
groundwater and the possible correlation with human viruses.
The samples were analyzed by RT-PCR for enteroviruses, hepatitis A virus,
and rotavirus. Each sample was assayed twice for each virus once using only the
concentrate as a template for RT-PCR, and once (positive control) using the
concentrate seeded with a low number of either poliovirus, hepatitis A virus, or
rotavirus.
Using primers specific for enteroviruses in the reactions, 17 samples (11.3
percent) failed to exhibit amplification when seeded. Of the samples that could be
Executive Summary xix
assayed, 40 of 133 (30.1 percent) were deemed positive for the presence of
enterovirus ribonucleic acid (RNA).
When primers specific for hepatitis A virus were used in the RT-PCR assay,
11 samples (7.3 percent) failed to exhibit amplification when seeded. Of the samples
that could be assayed, 12 of 139 (8.6 percent) were deemed positive for the presence
of hepatitis A viral RNA.
RT-PCR analysis using rotavirus specific primers resulted in 20 samples
(13.3 percent) unable to be assayed. Of the remaining 130 samples, 18(13.8 percent)
were positive for rotavirus RNA.
For all samples, only five could not be assayed by either the enterovirus,
hepatitis A virus, or rotavirus primers.
The samples were also analyzed for enteroviruses by cell culture techniques
using Buffalo Green monkey (BGM) kidney cells. Thirteen of the 150 samples (8.7
percent) showed cellular cytopathic effects in both the initial and confirmation
phases of the analysis. The most probable number (MPN) of virus per 100 L of
original sample ranged from 0.15 to 1.86 for the samples that were positive. Thirty-
one of the samples (20.7 percent) exhibited cellular toxicity, and three samples (2
percent) were contaminated with bacteria; however, all of these samples were able
to be assayed after toxicity or bacterial contamination was eliminated. Additionally,
all of the samples tested positive when seeded with poliovirus type 1 (LSc strain)
as a positive control.
PCR analysis of water samples for the detection of viruses is feasible if the
samples are first treated to remove inhibitory substances from the water concentrate.
The protocols for inhibitor removal provided in this report will reduce interfering
materials, enabling a successful PCR amplification. The large-volume RT-PCR
protocol allows for sufficient removal or dilution of inhibitors so that more than 95
percent of the samples may be expected to be assayed for at least one virus by PCR.
The specificity and sensitivity of the reactions using the listed primers (for
enteroviruses, hepatitis A virus, and rotavirus) are sufficient for the testing of water
samples for the detection of viruses. Techniques such as Southern hybridization
allow evaluation of samples with even greater sensitivity and allow for confirmation
of initial results.
Conclusions________________________
Given PCR's increased sensitivity over cell culture techniques and its
ability to detect either infectious or noninfectious viruses, PCR analysis would be
expected to reveal more positive results than cell culture analysis. Since both cell
culture analysis and PCR analysis can reveal only a "snapshot" of the quality of the
groundwater being sampled, PCR seems to be a desirable and rapid initial screening
tool.
Although the detection of viral RNA does not necessarily indicate an
infectious level of contamination, the presence of viral RNA does suggest a source
of viral contamination and thus the potential for health risk. The most sensitive
method of detection would be the most desirable, even in the absence of an ability
to confirm the infectivity of the sample contamination. Thus, the following
conclusions are stated:
xx PCR Technologies for Virus Detection in Groundwater
1. Viruses were detected in groundwater sources by both cell culture

assay and the PCR method.
2. The developed PCR-based detection methodology can be used by
water utilities for monitoring purposes. The technique can be
utilized for a rapid screening of samples for identifying viral
contamination of source water.
3. The treatment protocol outlined in this report organic extraction
and size exclusion chromatography enabled more than 95 percent
of the samples to be successfully assayed by PCR for at least one
virus of interest and more than 90 percent of the samples to be
successfully assayed for two of the three viruses. Eighty-four
percent of the samples could be assayed for all three viruses,
whereas only five samples (3.3 percent) could not be assayed for
any virus.
4. Based on the statistical analyses for the 150 samples, the authors did
not see a significant correlation between any of the measured water
quality parameters and enterovirus occurrence when using either
RT-PCR or cell culture assays. The results of this project did not
support reports showing a high correlation between the presence of
F-specific RNA bacteriophages and enteric viruses in fresh water.
5. As results were generated from this study, the authors informed the
participating utilities when a water sample was positive for
enterovirus contamination by cell culture analyses. The authors
advised the utilities that maintaining a disinfection residual is
crucial for the source. However, since the samples were taken before
any disinfection, the positive results do not necessarily indicate a
health risk for the communities served by the water provider.
Recommendations____________________
The authors make the following recommendations:
1. Molecular techniques, such as PCR, are a fast-growing area in
microbiology, and recent advances should be considered to simplify
the procedure further. Close collaborations among laboratories or
companies performing biotechnology research should be established
to further simplify the method presented here and to design a simple
kit for the field detection of viruses.
2. The identification of viable pathogens in water samples is critical to
characterize fully the health risk associated with contaminated
water. Knowing the limitations of the PCR technique is very
important. The standard PCR assay does not determine the viability
of detected microorganisms, and in light of this fact, extreme
caution should be exercised in the interpretation of PCR results.
3. The United States Environmental Protection Agency (USEPA) has
proposed source water monitoring for total culturable viruses as part
of the Information Collection Rule (ICR). It is proposed in the ICR
protocol that a small portion of each sample be archived for future
Executive Summary xxi
analysis. The sample collection procedure and the elution procedure

followed for this research project (using 1MDS filters [CUNO, Inc.,
Meriden, Conn.] and beef extract, respectively) are similar to the
proposed ICR virus protocol. Therefore, for a better identification of
viruses, it is recommended that the protocol for sample pretreatment
for removing inhibitors, as well as the RT-PCR assay developed for
this project, be directly used for the sample concentrates that will be
archived during the ICR study. Based on the results of the field
evaluation of this report's method, it is anticipated that most of the
ICR samples could be analyzed by RT-PCR for some viruses based
on the strategy outlined in this report.
Future Research
Genomic sequence databases are rapidly expanding for all classes of

microorganisms. Based on computer assisted nucleic acid analyses, unique genetic
fragments of microbial pathogens can be identified. A specific fragment can then be
used as a diagnostic tool for the detection of pathogens in water samples. The use
of molecular techniques could lead to vastly improved methods for the rapid
identification of microorganisms in water. In addition to occurrence information,
molecular methods can determine species diversity and help in the identification of
emerging pathogens in the environment. The disadvantages of culture methods for
monitoring purposes are many and have been listed in this report. However, a few
issues remain to be addressed for the application of PCR technology for the
detection of pathogens in water samples. Additional related research is suggested
by this study and briefly stated here:
1. Research related to the identification of other groups of viruses in
groundwater concentrates and cell culture harvests (cell culture flask
contents)
2. Research involving the identification of specific enterovirus strains,
such as distinguishing Coxsackie virus from vaccine-strain
poliovirus
3. Research involving a low-volume sample collection (a grab sample)
for the detection of viruses by RT-PCR
4. Multiplex PCR (use of multiple primer sets in the same reaction) to
detect multiple strains of viruses simultaneously
5. In situ PCR (amplification of viral nucleic acid that is still within a
cell) to identify and determine infectivity of viruses
6. Research in improving virus or viral nucleic acid isolation and
concentration to remove potential inhibitors to a greater degree and
to facilitate the assay of a greater amount of the original sample
7. Research in the applicability of integrated cell culture and
RT-PCR methodology for a rapid detection of infectious enteric
viruses from water samples
Chapter 1 _________
Introduction
Enteric Viruses in Water
Human enteric viruses are excreted in the feces of infected individuals and
may directly or indirectly contaminate water intended for drinking. These viruses
are excreted in high numbers: 106 to 109 per gram of feces of infected individuals.
The enteric viruses include the enteroviruses, rotaviruses, Norwalk and Norwalk-
like viruses, adenoviruses, reoviruses, and others. Surface water and groundwater
of the United States may be subjected to fecal contamination from a variety of
sources, including sewage treatment plant effluent, on-site septic waste treatment
discharges, land runoff from urban, agricultural, and natural areas, and leachates
from sanitary landfills. Evidence for fecal contamination of surface water and
groundwater is provided by the detection of enteric viruses in both types of water
and by the continued occurrence of outbreaks of virus-caused waterborne disease.
For example, between 1971 and 1985, 502 drinking-water-borne outbreaks of
disease involving 111,228 cases of illness were reported in the United States, of
which 49 percent were associated with groundwater sources and 51 percent with
surface water sources (Craun 1988, 1992). Nine percent of the reported outbreaks
(USEPA 1990) were due to enteric viruses (hepatitis A virus, Norwalk virus, and
rotaviruses). It is possible that many waterborne disease outbreaks for which no
etiological agent was identified (half of all reported outbreaks) were caused by
viruses as a result of (1) the failure to look for viruses and (2) the limitations of
current detection methodology.
The enteroviruses (poliovirus, Coxsackie A and B viruses, echovirus) can
cause a variety of illnesses ranging from gastroenteritis to myocarditis and aseptic
meningitis (Melnick 1990). Many studies have documented the presence of en
teroviruses in both raw and (occasionally) treated drinking water (Keswick et al.
1984; Keswick etal. 1982), wastewater (Payment 1981), and sludge (Craun 1984).
Enteroviruses in the environment pose a public health risk because these viruses can
be transmitted via the fecal-oral route through contaminated water (Craun 1984) and
low numbers can initiate an infection in humans.
Rotaviruses are the leading cause of acute infantile gastroenteritis and
diarrhea-related infantile death (Gouvea et al. 1990). The virus has also been
associated with diarrhea outbreaks among the elderly and among immuno-compro-
mised patients (Ball et al. 1996). Rotavirus group A has been documented as a cause
of waterborne outbreaks in humans (Gerba and Rose 1990). The virus has been
isolated from humans, monkeys, cattle, sheep, mice, cats, dogs, and other mammals,
2 PCR Technologies for Virus Detection in Groundwater
as well as from chickens and turkeys; it has been detected in fresh water and sewage
(Estes, Palmer, and Obijeski 1983). Although the various strains of rotavirus are
usually associated with a specific species, reports have been published documenting
infection by interspecies transmission of the virus, such as human infection by a
bovine strain of rotavirus (Nakagomi et al. 1994). Additionally, recent work has
shown that an isolated rotavirus surface protein alone can produce diarrhea in mice
(Ball et al. 1996).
Hepatitis A virus (HAV) is an important waterborne virus because of the
severity of the disease it may cause in susceptible individuals. HAV is the cause of
acute infectious hepatitis and was the first enteric virus identified as being associ
ated with a waterborne disease outbreak in the United States (Sobsey et al. 1988).
The virus was shown to survive more than 4 months at both 5 C (41 F) and at 25 C
(77 F) in water, wastewater, and sediments (Sobsey et al. 1988). Hepatitis A is a
major cause of acute gastroenteritis, and its symptoms may be the most serious of
those caused by the enteric viruses. In one survey, hepatitis A virus was identified
as the causative agent in more than 20 percent (68 of 322 outbreaks) of the
waterborne disease outbreaks in the United States from 1946 through 1980 for
which a causative agent was identified (Lippy and Waltrip 1984).
The calicivirus and the small round structured virus (SRSV) groups have
been implicated or suspected in several outbreaks of acute diarrheal illness. These
groups are composed of members such as Norwalk virus, Snow Mountain agent,
Hawaii virus, Taunton virus, Parramatta virus, and other viruses that are as yet
unnamed (Kapikian and Chanock 1990). Shared morphological and genomic
characteristics of several of these viruses such as having a single-stranded
ribonucleic acid (RNA) as a genome, having a single protein capsid, and sharing
genome organization similarities have led to calling these viruses the Norwalk
group of viruses, with the Norwalk virus as its most typical member.
The Polymerase Chain Reaction____________

All organisms use either deoxyribonucleic acid (DNA) or RNA as the
"blueprint" during the synthesis of the structural proteins, enzymatic proteins, and
hormonal proteins needed to sustain life. DNA and RNA consist of only four
different subunits,* arranged in linear structure. The sequence of the subunits is
unique for each species or strain of single-cell organisms. Knowing the sequence of
the DNA subunits allows a researcher to identify the source of the DNA as a member
of a particular species or even as a particular individual.
The way in which DNA is duplicated within a cell has been known for some
time. DNA, which consists of a double strand, is partially separated into single
strands. An enzyme called DNA polymerase then duplicates each strand. The
strands then reassociate into double strands, and where there was one molecule,
there are now two identical molecules.
* dNTPs refer to an equimolar mixture of deoxyadenosine triphosphate (dATP),

deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), and
deoxythymidine triphosphate (dTTP) the four components of DNA. The "N" is a
common shorthand for either A, G, T, or C.
Introduction 3
In 1985, Kary Mullis was researching the DNA mutations responsible for
sickle-cell anemia. He envisioned a process in which DNA, DNA polymerase, and
the DNA subunits could be combined in a test tube and subjected to the temperature
changes needed for the DNA duplication process to occur. By repeating this process
many times, he was able to generate the large amount of DNA necessary for his
research. This reaction, termed the polymerase chain reaction (PCR) (Mullis and
Faloona 1987; Saiki et al. 1988), can, under ideal conditions, generate millions of
copies of a single DNA molecule in just 20 to 30 repetitions of the temperature
cycle each cycle requiring only a few minutes. One component of the reaction is
a short stretch of DNA called a primer. The primers bind to the separated strands of
DNA at a specific site and enable the polymerase enzyme to function. By being able
to dictate where the enzyme will begin duplication, the researcher can selectively
amplify only a portion of the DNA perhaps a few hundred subunits (or base
pairs) rather than the entire sequence.
Since its invention, PCR has become one of the most widely used biochemi
cal assays. The speed, specificity, and low cost of the procedure have led to its use
in such fields as criminal and pathological forensics, genetic mapping, disease
diagnosis, systematics and evolutionary studies, and environmental science.
PCR can also be used to amplify, to detectable levels, nucleic acids
associated with pathogens that may be present in low numbers in water samples.
PCR assays are intended to detect viruses that have been concentrated from large
volumes (100 to 1,500 L [25 to 400 gal]) of water (APH A, AWWA, and WEF1995).
This concentration is usually accomplished by a filter adsorption and elution
method, resulting in a concentrate containing viruses as well as and organic and
dissolved solids. These other compounds, such as humic substances, once concen
trated, can interfere with the activity of the enzymes used in PCR.
Many of the viruses associated with waterborne disease are termed "RNA
viruses," meaning that their genetic material consists of RNA rather than DNA.
Because the PCR reaction amplifies DNA, this RNA must first be converted to DNA
through an initial step called reverse transcription. This conversion is accomplished
through the use of an enzyme called reverse transcriptase. The enzyme can read the
RNA sequence and synthesize a complementary strand of DNA (cDNA). Once this
reaction is complete, the sample can be subjected to PCR. This two-step process is
referred to as reverse transcription-polymerase chain reaction (RT-PCR).
The RT-PCR procedure can be summarized as follows: First, the water
concentrate is treated to remove substances that may inhibit PCR. The sample is then
heated to denature the virus's protein coat and liberate the genomic material of the
target virus. Viral RNA is than transcribed to a cDNA template, which is utilized in
the PCR amplification. The cDNA of the targeted virus is amplified through cycles
of denaturation, annealing of primers, and extension. After the PCR cycles are
complete, the amplified reaction products are separated by size using gel electro-
phoresis. The PCR products (amplified regions) are then stained using ethidium
bromide (causing the DNA to fluoresce when exposed to ultraviolet [UV] light) and
detected using an ultraviolet transilluminator.
The first part of the process, DNA denaturation, is accomplished by heating
the double-stranded DNA, resulting in two single strands of DNA. Single-stranded
DNA is then available for primer annealing. Primers, or oligonucleotides, are
specific short sequences of DNA used to amplify the desired region of genomic
material. Primer annealing is done at a lower temperature than the denaturation step,
usually between 55 C and 65 C. The annealing temperature can control the
stringency, and subsequently the specificity, of the reaction. During the annealing
process, a set of primers will attach (hybridize) to the complementary DNA
sequences at the boundary of the desired DNA region. Primers are designed to
complement a known sequence within the nucleic acid of a targeted microorganism
and can thus detect a specific organism or group of related organisms. After the
primers are hybridized to the desired sequences of a DNA strand, DNA polymerase
will extend the primer and synthesize a DNA strand complementary to the original
sequence using the deoxynucleotide triphosphates (dNTPs) present in the reaction
buffer. At this point, one PCR cycle is completed. Repeating the cycle 30 times using
an automated thermal cycler (a PCR machine) is common. After 30 cycles, the
targeted region can be amplified to millions of copies. The summary of the
procedure is illustrated in the Figure 1.1.
The advantages of PCR are numerous. When compared with techniques
such as cell culture for the detection of viruses, the time required for the assay can
be reduced from days or weeks to hours. Both the initial and recurring costs for PCR
are much less than for cell culture techniques, and the PCR technique is easily
performed. Additionally, PCR can be used to identify a specific pathogen found in
water. It cannot, however, be used to detect the infectious state of an organism
only the presence or absence of pathogen-specific DNA or RNA. PCR assays have
been applied to the detection of enteroviruses and other pathogens in clinical
samples (Hyypia, Auvinen, and Maaronen 1989; Rotbart 1990) and environmental
samples (Abbaszadegan et al. 1997a; Abbaszadegan et al. 1993; Pillai et al. 1991;
DeLeon et al. 1990).
Cell Culture Methods__________________

Conventional methodology for the detection of enteric viruses from the
environment relies on a few established cell lines. The Buffalo Green monkey
(BGM) kidney cell line is the most commonly used for the detection of enteroviruses
in the environment (Dahling and Wright 1986). This cell is preferred to others,
including primary cells, because it provides high sensitivity to natural isolates of
enteroviruses (Dahling, Safferman, and Wright 1984). Its sensitivity can be further
enhanced by pretreatment of the cells with enzymes or other substances (Benton and
Ward 1982). Unfortunately, the use of other cell lines is required to detect other
groups of enteric viruses (Smith and Gerba 1982). This can greatly increase the cost
and time of assay. Although the cell culture assay can detect infectious viruses in
environmental samples, without additional tests no determination can be made as
to the particular strain of virus present in a sample. Additionally, the length of time
needed to detect infection in the cell culture can vary greatly, from a few days to
several weeks, depending on the number of viruses present.
Introduction 5
Detection of Entero viruses by the

Polymerase Chain Reaction (PCR)
1 Sample Preparation and Lysis

Viral RNA (+) sense
PCR-inhibiling substances are removed
from the sample through size exclusion PI P2 P3
The sample is heated for •AAAAn
The following reaction 3 minutes to denature the
viral protein coat ;•/ ^~RNA"——-——-3
Sample * mixture is prepared:
I Ou,L of sample 3' 5'
Sephadex MgCI,
G-200 ' dNTPs Primer 1: S TCCGGCCCCTGASATGCGGCT 3'
Buffer 445-465
Chclex-100 . Primer 2: 5' TGTCACCATAAGCAGCC 3'
Glass Wool . II*. Mineral oil 577-S94
2 RNA Transcription
Temperature Profile
24 C 10 min
44 C 50 min Viral RNA is transcribed locDNA
The Following is added <)» C 5 min
to the reaction mixure: template for PCR assay
5 C soak
Reverse transcriptasc
RNAasc inhibitor
Random primer
DMA
3 DNA Amplification (PCR) cDNA is amplified through clenaluraiion,

annealing of the primers, and extension
Temperature Profile
94 C I min Primer 1
55 C 45 s Cycle I
Tile following .substances are 72 C 45s cONA
added to the reaction mixture
for the PCR assay:
PCR buffer
MgCU.
Primers specific for enleroviruses
Tat/ polymerasc
Distilled H20 ________
Total reaction volume = 100 (iL Cycle 2
4 Detection
Amplified product is
separated by size using
gel electrophorcsis
The PCR products

arc stained with
cthidium bromide
and examined on a
UV-lransilluminaior
Prepared by: Jeffrey Brendecke

Figure 1.1 Detection of enteroviruses by PCR
The Groundwater Disinfection Rule

On June 21, 1992, the United States Environmental Protection Agency
(USEPA) proposed a "draft strawman" version of the Groundwater Disinfection
Rule (GWDR). The GWDR is a response to the 1986 amendments to the Safe
Drinking Water Act, which requires disinfection of all public water supplies. The
rule could require an unspecified level of disinfection (expressed as CxT, or
disinfectant concentration multiplied by the contact time) for groundwater supplies.
The rule would be formulated in a manner so as to protect groundwater supplies
from contamination by human enteric viruses.
Unknown in the development of this rule is the percentage of water supplies
at risk from viruses, the levels of viruses in these contaminated groundwater
supplies, the criteria necessary to identify contaminated wells, or the levels of
treatment necessary to ensure safe drinking water. It is expected that the USEPA will
issue the proposed version of the GWDR in mid-1998 and the final version in 2000.
There remains an important need to develop a database of virus occurrence
and virus concentrations in public groundwater systems. Advanced molecular
techniques such as PCR allow routine monitoring of source or finished water
samples for the presence or absence of viruses. It was an objective of this project to
develop a detection technique for use by water utilities to permit an assessment of
the applicability of the GWDR.
Objectives________________________
General Objectives
The overall aim of this research project was to apply advanced molecular
biotechnology for the detection of viruses in groundwater sources used for drinking
water.
Specific Objectives
The specific objectives were as follows:
1. Develop and evaluate a simple, rapid, and inexpensive method of
detecting human enteric viruses in groundwater samples using
RT-PCR
2. Optimize PCR methodology for the detection of low concentrations
of viruses in groundwater as an alternative to cell culture assays
3. Develop a sample treatment protocol for removing enzyme
inhibitors from groundwater concentrates
4. Develop a PCR method to assay a larger equivalent sample volume
of each water concentrate
5. Conduct a field evaluation of the optimized method for the detection
of enteroviruses, hepatitis A virus, and rotavirus, using 150
groundwater samples
Introduction 7
Approach and Experimental Design__________

A comprehensive research plan was developed to evaluate the application
of PCR technology for virus detection in groundwater and to investigate the
occurrence of enteroviruses, hepatitis A virus, and rotavirus in 150 groundwater
sources. The approach included laboratory studies for the development and optimi
zation of the PCR technology and determination of the specificity of the PCR
primers for the detection of viruses, followed by a field evaluation of the method
using groundwater sources in different geographical locations and with a variety of
physical, chemical, and geological settings.
During the methods development stage and before the actual testing of
water samples, numerous experiments were conducted to learn the optimum sample
pretreatment procedures and the optimum RT-PCR reaction conditions. For the
optimization of RT-PCR, a systematic protocol was followed to evaluate the
reaction components and conditions, such as the amounts of all enzymes, reaction
temperatures, number of cycles, and reaction volume.
A complete field evaluation was performed to examine the applicability of
the method for the detection of viruses in water samples. To ensure a variety of
samples and to best evaluate the method, sites were selected based on different
chemical, physical, and geological criteria.
After the laboratory studies and field evaluation were completed, a strategy
for the detection of viruses in groundwater was developed. The strategy is based on
1. Large-volume sample collection
2. Removal of inhibitory substances from water concentrate
3. A large-volume RT-PCR that allows for the testing of a larger
equivalent volume of a water sample
4. Testing of the possible inhibitory nature of each sample by seeding
some of each with known quantities of viruses
5. Use of assay controls reagent positive and reagent negative
controls to exclude false positive and false negative results
6. Confirmation assays of the PCR product
The strategy outlined here fulfills the water industry's need for a rapid,
reliable, inexpensive, and easily performed analysis of groundwater for virus
contamination.
Chapter 2___________
Water-Sampling Program
Site Selection
For this study, 150 water samples were collected. To analyze the PCR
technique on as wide a variety of water quality parameters as possible, sites that
were under the influence of surface water, sites that had previously exhibited high
levels of certain inorganic substances, and sites with extremes of pH and tempera
ture were initially selected. Physical characteristics included well depth; proximity
to surface water, sewer lines, or septic tanks; and the type of geologic setting. All
of the wells were actual drinking water production wells, not monitoring wells.
The site selection criteria can be summarized as follows:
1. Groundwater sites with high concentration of minerals, metals, or
total organic carbon (TOC)
2. Sites with a previous detection of any virus or bacteria in the
groundwater source
3. Potential exposure of groundwater to contaminations:
Agricultural activities near the well
Industrial activities near the well
Septic tanks near the well
4. Sites with different pH values, temperatures, depths, production
capacities, and aquifer types
5. Active pumping wells, not monitoring wells
Sampling Kit_______________________
To provide consistent sampling procedures, 30 identical sample kits were
assembled. Each kit contained all equipment needed to collect a sample, including
all hoses and connectors, a filter and a filter housing, protective gloves, reusable ice
packs, sample bottles, a sample data sheet, and a detailed written protocol. The kits
also included a water meter to enable the sampler to record how much water was
sampled, as well as an in-line flow-restricting device to limit the filtration rate to
Figure 2.1 Sampling kit
4 gpm (15 L/min). The sample kit is illustrated in Figure 2.1. The full list of contents
was as follows:
Filter housing containing a 1MDS filter

A hose with a brass quick-connect, a backflow prevention valve, and
a flow restrictor
Two additional hoses with a quick-connect tap connection
A brass quick-connect tap connection
pH meter
Thermometer
Water meter
Three ice packs
Two 1-L presterilized bottles
Surgical gloves
Sample data sheet
Sample collection protocol
Aluminum foil sheets
Return address label with shipping instructions
Training video
Water-Sampling Program II
Water-Sampling Training Video_____________

Additionally, to help ensure a consistent water-sampling procedure, a
10-minute VHS video was professionally produced detailing and illustrating all of
the procedures. It shows all steps of the sampling protocol from the time the sampler
received the sampling kit until the sample was returned. The training video was
provided to samplers before their first sample collection.
Sampling Program____________________
The sampling kit was provided to the samplers a week before the sample
collection. The minimum sample volume collected was 1,500 L (400 gal) at a
maximum flow rate of 15 L/min (4 gpm). The sampler measured water temperature
and pH at the time of sample collection, then returned the 1MDS filter along with
two 1-L (3.78 gal) samples of the raw water by overnight courier. The efficiency of
the adsorption of viruses to 1MDS filters is greatly reduced when groundwater with
pH values greater than 8.0 are sampled; however, no adjustments were made on the
one sample that had a pH value greater than 8.0. Microbial, general chemistry,
turbidity, and conductivity analyses were conducted at the Quality Control and
Research Laboratory of the American Waterworks Service Company Inc. (Belleville,
111.).
The sampling program can be summarized as follows:
1. Water sampling started in March 1994 and ended in November

1995.
2. One hundred fifty samples were collected.
3. Sampling kits were shipped out to the sites and were returned to the
laboratory via an overnight courier immediately after sampling.
4. Sampling kits were disinfected before being shipped to new sites.
Physicochemical Analysis_______________
Samplers measured water temperature and pH at the time of sampling at the

collection site. Turbidity and UV absorbance at 254 nm were measured upon receipt
of the samples. One liter of water sample was used for the general chemistry
(USEPA method 300.0 for minerals [USEPA 1993] and USEPA methods 200.7 and
200.8 for metals [USEPA 1994]) and the TOC analysis.
To determine whether a water sample had high or low aquatic humic
materials, the specific UV absorbance (SUVA) was measured. The SUVA is
defined as the UV absorbance at 254 nm (expressed as per meter of absorbance)
divided by the dissolved organic carbon (DOC) concentration in mg/L. A SUVA
value above 4 shows that the DOC of a water sample is composed largely of aquatic
humic material. A SUVA value of less than 3 indicates that the DOC is composed
largely of nonhumic material (Edzwald and Van Bens£hoten 1990).
Chapter 3
Methods Development
The PCR technique is a sensitive reaction, but when it is not optimized it can
result in a nonspecific amplification, lower sensitivity, or inhibition of the reaction.
(Nonspecific amplification refers to the amplification of DNA other than the DNA
of interest.) Before the actual testing of environmental samples, numerous experi
ments were performed to determine the optimum sample pretreatment procedures
and the optimum RT-PCR reaction conditions. This chapter details those experi
ments, and Chapter 4 details the protocols and procedures used for the testing of
groundwater samples.
Optimization of RT-PCR_________________
Optimization of RT-PCR involved the following steps:

1. Optimization of the reaction components: The amounts of all
enzymes used reverse transcriptase, RNase inhibitor, and DNA
polymerase were altered to find the most effective enzyme
combination. Additionally, the concentrations and pHs of necessary
reagents were altered to maximize the enzymatic reaction.
2. Optimization of the reaction conditions: The reaction temperatures,
cycle time, number of cycles, and reaction volume were varied to
maximize the reaction effectiveness, as measured by the sensitivity
of virus-seeded samples.
3. Implementation of confirmation and control steps: With each set of
reactions, both positive (virus-seeded water) and negative reagent
controls (water only as the sample) were also performed. Southern
transfer of all gels was performed, and the resulting membranes
were probed with radiolabeled internal probes to confirm or reveal
positive or negative samples.
The following paragraphs summarize the experiments conducted to arrive

at the present sample pretreatment and RT-PCR. The complete protocol including
inhibitor removal and RT-PCR is listed in Chapter 4.
Initially, the reaction volumes used were 30 uL for the reverse transcription
reaction and 100 uL for PCR (including the 30-uL RT reaction). Experiments
designed to optimize the sample treatment and reaction conditions are detailed in
this chapter.
13
Reducing Sample Concentrate Volume

Concentration to 30 mL is common for a sample volume of 1,000-1,500 L
(265^00 gal). Briefly, samples are concentrated by first using a solution of beef
extract for elution. Then, lowering the pH of the beef extract solution allows
proteins and viruses to be precipitated out of the solution. The mixture is then
centrifuged, the supernatant is removed, and the resulting pellet of proteins and
viruses is resuspended in a buffer solution. Since viruses may be present in very low
concentrations in water samples, efforts were made to reduce the buffer volume to
increase the amount of the total equivalent volume assayed by RT-PCR.
An attempt to resuspend the pellet in 10 mL of a buffer, rather than the usual
30 mL, presented some problems. Because the pellets vary in size and viscosity,
10 mL was either an insufficient volume to fully resuspend the pellet or, with larger
pellets, resulted in a resuspension that was greater than 10 mL. Both problems were
overcome when the buffer volume was increased to 15 mL, and this volume was
used for the remainder of the project, resulting in a twofold increase in the amount
of sample assayed by RT-PCR. However, there was no attempt to determine the
effect of reducing the volume from a standard amount of 30 mL to 15 mL on recovery
efficiency. When this volume reduction is combined with the large-volume PCR
reaction (described in Chapter 4), a tenfold increase in the total equivalent volume
assayed by RT-PCR can be accomplished.
Pre-PCR Concentrate Treatment___________

One problematic aspect of applying RT-PCR to environmental water
samples is the removal or neutralization of naturally occurring substances that
inhibit the RT reaction and/or PCR amplification. A goal of this project was to arrive
at a procedure that would render nearly all samples capable of being assayed by
PCR. The approach focused first on isolating potential viruses, either through
chromatographic separation or through filtration based on molecular size, then on
releasing RNA from any viruses present in the sample and isolating the RNA from
other sample components. Included in both approaches was the use of a chelating
resin (Chelex 100, Bio-Rad, Hercules, Calif.) to bind metal ions.
Experiments were performed in which sample concentrates were placed
atop a column of Sephadex G-100 (Pharmacia, Piscataway, N.J.) overlaid with
Chelex 100. The column was then centrifuged, and the portion of the sample not
retained in the column was subjected to RT-PCR. Although this approach was
useful with relatively "clean" samples, several samples continued to resist ampli
fication in PCR.
Experiments were also conducted in which samples were filtered through
membranes designed to allow only molecules larger than 100,000 D to pass
(Microcon 100, Amicon Inc., Beverly, Mass.). This approach was also less than
optimal, as several samples still could not be amplified with RT-PCR.
One possible explanation for the lack of success of both approaches is that
whatever substances that were present to inhibit the reaction were similar in size to
or larger than the virus particles. In the first experiments, based on size separation,
Methods Development 15
any molecules approximately the same size as viruses would co-migrate through the
column with the viruses. In the second approach, inhibitory molecules of the same
size or larger would be trapped on the filter along with the viruses. One suspected
class of inhibitory molecules is the humic acids organic molecules associated with
decaying organic matter spanning a large molecular size range shown to inhibit PCR
(Tsai and Olson 1992).
Another approach used and ultimately incorporated in the authors' pro
tocol relied on the use of an organic solvent to dissolve and separate organic
matter in the sample concentrates. The use of a phenol:chloroform mixture is widely
used to separate nucleic acids from bacterial and other cells by denaturing and
precipitating proteins and lipids (Sambrook, Fritsch, and Maniatis 1989). When the
pH of the phenol solution is less then 7.0, DNA will also be denatured and
precipitated, leaving RNA in the aqueous phase. Since the viruses the authors were
attempting to detect are all RNA viruses, an acidic phenol:chloroform mixture (5:1
ratio) was used for RNA isolation. The sample was mixed volume for volume (500
uL of each) with the acidic phenol:chloroform mixture, and the resulting RNA was
isolated using columns of Sephadex G-100 (Pharmacia, Piscataway, N.J.) (see
Chapter 4). Rather than using centrifugation through Sephadex to isolate the
extracted RNA from extraneous material, it was found that a drip column
fractionization resulted in greater sensitivity in seeded reactions. To determine the
fraction containing the maximum amount of extracted RNA, a virus-seeded sample
of water was extracted with phenol:chloroform and the resulting aqueous portion
applied to the Sephadex column. Nine 500-uL portions of water were then applied
in succession, with each column elution collected in separate tubes. RT-PCR was
then performed on all 10 fractions (fraction 1 represented the elution collected
immediately following application of the sample). Fractions 3, 4, and 5 were the
only fractions that exhibited amplification, with fraction 4 showing the most intense
band on an ethidium stained gel (Figure 3.1). The collection of fraction 4 was shown
to work consistently and was incorporated into the protocol used for the remainder
of the study.
Optimization of Reaction Enzymes__________
Several reactions in which the amount of reverse transcriptase was altered

allowed the determination of the minimum amount of enzymes required to obtain
maximum amplification. It was determined that 9.5 units of reverse transcriptase
were the optimum amounts. This was determined by seeding environmental
samples with a known amount of virus and then subjecting the sample to RT-PCR
using decreasing amounts of the enzyme. The reaction that matched the sensitivity
of a positive control reaction (sterile, nuclease-free water seeded with poliovirus)
was determined to be the reaction containing the optimum amount of the enzyme.
The optimum amount of an RNasin ribonuclease inhibitor (Promega, Madison,
Wis.) was also determined in the same manner. Fifty units of reverse transcriptase
enzyme were optimal for maximum cDNA production. Three different reverse
transcriptase enzymes AMV and M-MLV (Promega) and Superscript II (BRL
Life Technologies) were evaluated. The third was clearly superior and was used
exclusively. Unlike the other reverse transcriptases, Superscript II does not have
12345
388 IP __
288 fcp ,
188 fcp
Key: Lane M 100-base-pair DMA marker

Lane 1 Sephadex G-100 fraction 1
Lane 8 Negative control
Lane 9 Positive control
Lane M 100-base-pair DMA marker
Figure 3.1 Ethidium-stained gel from poliovirus-seeded water experiment (103 pfu/mL;
phenohchloroform extracted; fractionated through Sephadex G-100; 500-uL fractions)
any RNase H activity and therefore does not degrade the RNA template during
cDNA synthesis.
Experiments were performed in which the product of the reverse transcrip
tion was treated with RNase H, intending to degrade the RNA portion of the
reaction, leaving only the cDNA for PCR. Some success was noted (i.e., higher
intensity of PCR products visualized in agarose gels) with this procedure in virus-
seeded water-based reactions. However, similar results were not seen when envi
ronmental concentrates were used, and this additional reaction step was not used in
the final protocol.
Reaction Conditions and Other Reagents_______

The PCR temperature and time parameters were altered to give maximum
amplification with minimum nonspecific products. Annealing temperatures below
55 C resulted in excessive nonspecific products, as did more than 35 reaction
cycles. The concentration of dNTPs in the reaction was optimized, and experiments
using different sources of water autoclaved Milli-Q water (Millipore Corp.,
Bedford, Mass.), HPLC-grade water (Fisher Scientific, Pittsburgh, Pa.), and sterile,
nuclease-free water (Amresco, Solon, Ohio) in the reaction were performed. The
sterile, nuclease-free water gave the most consistent results.
Several different primer pairs were evaluated before the current pair was
selected. The concentration of the primers was also varied in several experiments
to arrive at the optimum level.
The Optiprime PCR Optimization Kit (Stratagene, La Jolla, Calif.) was
used to vary several reaction conditions and component concentrations simulta
neously, such as pH, Mg++ concentration, and KC1 concentration. The kit also
includes for evaluation several commonly used reaction additives, such as dithiotreitol
(DTT), dimethyl sulfoxide (DMSO), and bovine serum albumin (BSA). Provided
with the kit are 12 different buffers that cover pHs of 8.3, 8.8, and 9.2; Mg++ at
1.5mM and 3.5mM; and KC1 at 25mM and 75mM. Twelve different control
reactions were performed using a different buffer in each reaction. Buffer 12,
supplied with the kit and containing 3.5mM Mg++ and 75mM KC1 at pH 9.2,
provided superior amplification in the large-volume reaction based on visual
analysis of an ethidium bromide stained agarose gel; it was used for the remainder
of the study. Once the optimal buffer was determined, the adjunct substances
provided with the kit were tested in buffer 12. These adjuncts included formamide,
DMSO, glycerol, BSA, 750mM ammonium sulfate, and Perfect Match DNA
Polymerase Enhancer (Stratagene, La Jolla, Calif.). None of the reaction additives
demonstrated an increased sensitivity over the use of the buffer alone.
Experiments were conducted to increase the reaction size by performing a
300-uL reverse transcription reaction and using increasing amounts from this
reaction (10, 20, and 50 uL) in a 100-uL PCR reaction. Each increase in the RT
reaction amount caused a greater PCR amplification. Eventually the authors
decided to use the entire RT reaction in the PCR, setting up a 290-uL RT reaction
and adding 10 uL of PCR cocktail consisting of primers and AmpliTaq (Perkin
Elmer, Foster City, Calif.) to the entire reaction. This proved successful and is the
method currently used.
The optimal amount of sample concentrate added to the RT reaction was
also investigated. Reactions were performed using 200, 150, 100, and 50 uL of the
treated sample. It was determined that 50 uL of the concentrate resulted in the
maximum amplification, presumably because of sufficient dilution of inhibitors
without significant loss of detectable viruses.
Short, Sequence-Specific Primers

A number of experiments were conducted to evaluate the usefulness of
short, sequence-specific (SSS) primers in the reverse transcription phase of virus
detection. These primers, used instead of random hexamers, are short (10 to 1.4 base
pairs in length) and are specific to the area near the 5-prime end of the amplicon. The
use of the short, sequence-specific primers, as opposed to random primers, has been
shown to increase the detection of low-copy-number cDNA by RT-PCR (Pfeffer,
Fecarotta, and Vidali 1995) to generate more cDNA containing the desired amplicon.
The short primers have a melting temperature lower than temperatures used in the
PCR reaction; thus, they fail to anneal to the template during the amplification
reaction.
Two SSS primers were selected for evaluation using the Gene Runner
computer software program (Hastings Software Inc., Hastings, N. Y.). Both primers
corresponded to an area very close to the 5-prime end of the amplicon. One primer
was 14 base pairs long, and the other was 12 base pairs in length. The selection was
based on their proximity to the beginning of the amplicon and on the computer
analysis prediction of a lack of secondary structure and melting temperatures in the
proper range (less than 40 C).
In controlled, seeded experiments (high-performance liquid chromatogra-
phy [HPLC] grade water and seeded poliovirus), these primers showed improved
sensitivity. However, when the primers were used with environmental samples, this
improvement was not seen. One sample showed a positive result when SSS primers
were used in place of random primers, but several showed the opposite result. The
reason for this is not known but may suggest that any inhibitors present in the sample
act on the ability of primer to anneal to the template. Overall, upon comparing those
samples assayed using both random hexamers and SSS primers, the authors decided
to continue the use of random hexamers.
Confirmation and Control________________
Under suboptimal conditions, DNA sequences different from the desired

sequence may be amplified in a PCR reaction and may be approximately the same
size as the desired PCR product. It is therefore important to confirm that the PCR
product observed on a gel is the actual desired product. The confirmation of PCR
amplification was evaluated by two different techniques: Southern hybridization
and semi-nested PCR assays.
Southern hybridization is a technique in which the PCR product (or any
DNA in a gel) is transferred to a membrane, usually made of nitrocellulose or nylon.
The DNA is then fixed to the membrane, either by baking or by exposure to
ultraviolet light, resulting in cross-linking of the DNA to the membrane material.
The membrane is then soaked in a solution containing a 32P-labeled DNA probe
having a sequence that matches some of the sequence expected in the PCR product.
Following this hybridization step, the membrane is allowed to expose a sheet of
X-ray film. If the desired PCR product was on the membrane, a dark band of the
appropriate size (as compared to a positive control) will appear on the film. A
AGCATCGATC (primer !)->

TCGTAGCTAGCTAGCTATATCGCGGCTATCGCGATCGCGATATCGCGATCGCAGCTAGCGA(torge^A^)
<--CGCTAGCGCTA <- CGTCGATCGCT (primer 2)
(nestedprimer /probe)
Figure 3.2 Sample illustration of target DMA, primers 1 and 2, and nested primer-probe
for semi-nested PCR assay
complete description of this procedure and an illustration of the results are included
in Chapter 4.
The same DNA probe as used in Southern hybridization was also employed
as a primer in a semi-nested PCR reaction. This technique employs a second PCR
amplification, into which a small portion of the first PCR product has been added.
In the second reaction, one of the original primers is reutilized, whereas the second
primer is replaced with a primer having a sequence that matches a portion of the
target DNA between the first two primers, as illustrated in Figure 3.2.
In the first PCR reaction, the entire target DNA should be amplified,
whereas in the second reaction, if the target DNA is actually present, only the portion
in bold type would be amplified. If the target DNA is not present, the nested primer
should fail to anneal to the targeted region, and the reaction will fail. Because of its
speed and sensitivity, the semi-nested reaction can be incorporated into a basic assay
strategy.
Treatment of Samples Highly Resistant to

Amplification_______________________
Five samples were shown to be highly inhibitory to RT-PCR. The samples
had very dark coloration in common. Inhibition was shown by an inability for
poliovirus to be detected when it was seeded into these samples and by the absence
of "primer-dimers" in unseeded reactions. Primer-dimers are PCR artifacts result
ing from the amplification of the primers themselves during PCR. They usually
approximate the combined size of both primers and are common in certain reactions,
i.e., for certain primer pairs.
Several tactics were tested to overcome this inhibition. First, semi-nested
PCR was performed on the samples that failed to show amplification when seeded.
One sample exhibited amplification in the second reaction when the sample was
initially seeded with 10 pfu. One other sample showed primer-dimer product but no
PCR product.
Next, the amount of the sample used in the reaction was reduced from
50 uL to either 10 fiL or 25 uL. The rationale was that further dilution of the
inhibitors would facilitate the reaction. No improvement was seen with this
20 PCR Technologies for Virus Detection in Ground-water
approach. A reduction in the PCR annealing temperature was also examined. This
too did not affect the resistant samples, although the positive controls showed the
expected decrease in specificity.
DNA polymerase requires magnesium to function and is always present in
a PCR reaction'. If a sample contained material that would somehow remove the
magnesium added to the reaction, inhibition could occur. To test whether additional
magnesium in the PCR reaction was beneficial, reactions were run using a twofold
increase in the concentration of Mg++ . This also did not affect the seeded samples
(i.e., there was still no amplification), but it greatly reduced the reaction product in
the positive control tube.
The five samples were finally reverse transcribed using SSS primers, as
discussed earlier. One sample showed amplification when seeded with these
primers as opposed to the random hexamer primers.
Finally, the two remaining resistant samples were used as substrate in
reactions in which cDNA generated in a positive control was seeded into the samples
and subjected to PCR. No reaction products, either amplicons or primer-dimers,
were shown, suggesting that the inhibition may occur in either the RT reaction, the
PCR reaction, or both.
The following conclusions may be drawn from these experiments:
1. The authors' basic protocol phenol xhloroform extraction followed
by Sephadex G-100 (Pharmacia, Piscataway, N.J.) fractionization
and large-volume RT-PCR allows for sufficient removal or
dilution of inhibitors so that more than 95 percent of the samples
can be assayed by RT-PCR using the three sets of primers designed
to detect enterpviruses, hepatitis A virus, and rotavirus.
2. Inhibiting substances vary by sample and seem to inhibit either the
reverse transcription or the PCR amplification.
3. Reassaying samples resistant to amplification by performing a
second reaction using a different volume of concentrate or semi-
nested primer pairs (or a different set of primers) may allow the
samples to be assayed by RT-PCR.
4. Certain groundwater samples, when eluted, reconcentrated, and
pretreated, may still contain too many inhibitors to be removed,
neutralized, or diluted. RT-PCR may not be possible with these
samples.
Chapter 4
Materials and Methods

Chapter 3 detailed experiments designed to optimize the sample pretreat-
ment and RT-PCR reaction conditions. The present chapter provides the complete
details of the finalized procedures used in testing environmental samples.
Sample Collection____________________
Groundwater samples were obtained by passing a minimum of 400 gal
(1,500 L) of raw groundwater (before any treatment) through a 1MDS filter (CUNO,
Inc., Meriden, Conn.) at a flow rate of no more than 4 gpm (15 L/min). The filters
remained in the filter housing and were shipped by overnight courier at 4 C (39 F)
and processed within 48 hours of the completion of sample collection.
Filter Elution________________________
The filters were eluted using an autoclaved solution of 1.5 percent beef
extract (Becton Dickinson, Cockeysville, Md.), 0.05M glycine (U.S. Biochemical,
Cleveland, Ohio), pH 9.4. One liter of the beef extract solution was poured into the
filter housing containing the 1MDS filter and left for 15 minutes. The solution was
then forced from the filter housing into a sterile 2-L beaker using nitrogen gas (N2).
The eluan was then poured back into the filter housing and again forced out using
N2 into the same beaker. The pH of the solution was then lowered to 7.1-7.3 using
IM HCI and stirred for 15 minutes. Then 40 mL of the eluant was mixed with 4 mL
glycerol (10 percent) and stored at -80 C until the bacteriophage assay was
performed. Another 100 mL was stored at -80 C for archival purposes.
Virus Flocculation and Reconcentration________

The elution solution was either stored at -20 C or immediately adjusted to
pH 3.5 and stirred for 15 minutes. The solution was then centrifuged for 30 minutes
at 4,000xg at 4 C. The resulting pellet was resuspended in 0.15MNa2HPO4 (pH 9.4)
and transferred to a 50-mL centrifuge tube. The pH was adjusted to 7.2 and the
volume brought to 15 mL with 0.15M Na2HPO4 (pH 7.2). The solution was then
27
mixed with an equal volume of FREON (Fisher Scientific, Pittsburgh, Pa., and
Aldrich Chemical, Milwaukee, Wis.), vortexed for 2 minutes, and centrifuged at
2,700xg for 10 minutes. The upper, aqueous portion was removed and transferred
to a fresh 15-mL tube, and the volume was brought to 15 mL using 0.15M Na2HPO4
(pH 7.2). One-half of this 15-mL volume (7.5 mL) was stored at -80 C for use in
PCR analysis. The other half (50 percent of the original pellet) was brought to
15 mL with 0.1 5M Na2HPO4, pH 7.2, and was stored at -80 C until used in the cell
culture analysis.
Cell Culture Assay____________________

Buffalo Green monkey kidney cells were grown to confluent monolayers in
25-cm2 and 75-cm2 plastic flasks using Eagle's minimum essential medium with
Earle's salts (Irvine Scientific, Irvine, Calif.) containing 10 percent fetal bovine
serum (Sigma Chemical, St. Louis, Mo.). Included in the maintenance media were
antibiotics and antimycotic solutions (BRL Life Technologies, Gaithersburg, Md.)
containing 100 units/mL penicillin, 100 ug/mL streptomycin, and 0.25 ug/mL
amphotericin B. Before the actual assay, 1 mL of the concentrate was placed on
BGM cells in a 25-cm2 flask, and the monolayer was observed for up to 1 week for
toxicity or bacterial contamination. If toxicity was observed, the sample was diluted
1:3 in 0.1 5M sodium phosphate (pH 7.0-7.5) for the actual assay. If bacterial
contamination was observed, concentrate was filtered through a 0.2-uM filter
(Millipore, Bedford, Mass.) through which 10 mL of 1.5 percent beef extract had
been passed. Before exposure to the sample, the growth medium was poured off and
the cell monolayer was washed twice with Tris (Sigma Chemical) buffered saline
solution. For each sample, a 3-mL volume of the final concentrate was inoculated
into each of four 75-cm2 flasks. A total of 12 mL volume of the final concentrate was
assayed for each sample. The flasks were incubated at 37 C for 60 minutes and
rocked every 15 minutes to facilitate virus adsorption to the cells. Twenty milliliters
of maintenance medium consisting of Eagle's minimum essential medium supple
mented with 2 percent fetal bovine serum and 1 mL of gentamicin (BRL Life
Technologies) (50 ug/mL) was added to each flask. The flasks were incubated at
37 C and examined daily for 14 days for viral cytopathic effect (CPE). Any flask
with suspected viral CPE was confirmed by inoculation of the medium onto a fresh
monolayer of BGM and the cells observed for CPE. The analysis is summarized in
Figure 4.1.
All samples that were negative for CPE on the first passage were passed a
second time on BGM cells. All samples that exhibited CPE were confirmed by two
additional passages on BGM cells.
Bacteriophage Assay__________________
Bacteriophages are viruses that infect bacteria and use bacterial cells as
their replicative hosts. Coliphages are bacteriophages associated with the E. coli
family of bacteria. Bacteriophages are also classified according to their mode of
infection. Male-specific (also called F-specific) bacteriophages attach to the cells'
Materials and Methods 23
BGM CELLS
(15 mL of Sample Concentrate)
I I 1 I I 1
3.3 mL 3mL 3mL 3mL 3mL Save 2.7 mL
Positive control with 75cm2 75cm2 75cm2 75cm2
5-lOPFUof flask flask flask flask
poliovirus
Observed for CPE for 14 days
If Positive, cell harvest was

filtered and passed onto a
fresh monolayer for
confirmation.
V A
Passed on from each flask onto fresh
monolayers of BGM cells in 25cm2 flasks.
Observed for CPE for 14 days.
If positive, after the second 14 days
PCR for viruses

An Aliquot of sample concentrate and cell harvest were used for the PCR assay.
Figure 4.1 Cell culture assay

short, hairlike projections called pili whereas somatic bacteriophages attach

directly to the bacterial cell wall. Bacteria without the hairlike projections cannot
be infected by male-specific bacteriophages.
Recent research (Sobsey 1990) suggests that male-specific bacterio-phages
are similar to enteric viruses in terms of size, shape, survival, and transport behavior
in the environment. In addition, their removal during coagulation practices is similar
to that for enteroviruses (Abbaszadegan et al. 1997b). A good correlation between
the presence of F-specific RNA bacteriophages and enteric viruses in fresh water
has also been reported (Havelaar, Van Olphen, and Drost 1993).
Besides cell culture and PCR assays, bacteriophage analyses were per
formed on the water samples collected during this study to investigate the occur
rence of bacteriophages in groundwater samples and possible correlations with both
RT-PCR and cell culture results.
The following phage hosts were used for the coliphage assays:
1. E. coli C (American Type Culture Collection [ATCC] 13706): This
host was proposed for the Information Collection Rule (ICR)
protocol. It is also listed in Standard Methods for the Examination
of Water and Wastewater- as the proposed host for coliphage
detection.
2. E. coli C-3000 (ATCC 15597): This organism is the host used to
detect F-specific coliphage MS-2 (MS-2 phage). This host has been
widely used in groundwater sampling.
3. Salmonella typhimurium WG-49: This strain, constructed by
Havelaar's group (Havelaar, Van Olphen, and Drost 1993), is
specific for male-specific (FRNA) bacteriophage. This host can be
infected by somatic Salmonella phages and by male-specific RNA
and DNA bacteriophages. Havelaar's group found a good
correlation between the presence of enteric viruses and F-specific
RNA bacteriophages in fresh surface water.
The following bacteriophages were used as positive controls:
1. MS-2 (ATCC 15597-B1) was used with the hosts E. coli C-3000 and
Salmonella typhimurium WG-49.
2. O XI74 (ATCC 13706-B1) was used with the host£. coli C.
The day prior to the phage assay, liquid bacterial cultures were started from
glycerol frozen stocks by adding one loopful of bacterial stock to 30 mL of liquid
media (see Appendix A for media used in bacteriophage assays). The cultures were
grown overnight, with vigorous shaking, at 37 C. On the day of the assay, 1 mL of
the overnight culture was transferred to 25 mL of fresh liquid media, and the culture
was grown, with shaking, for 4 hours at 37 C.
A total of 10 mL of the pH 7.2 filter eluant was assayed for bacterio-phage.
For each assay, 5 mL of the eluant was added to 0.1 mL of the appropriate 4-hour
bacterial culture and 4 mL of warmed agar (48 C). The mixture was vortexed briefly
and immediately poured onto a room-temperature bottom agar plate. The plates
were inverted and incubated overnight at 37 C and examined for plaques the
following day. The equivalent volume assayed for each host was approximately
15 L.
Total Coliform Test____________________

At the time of the sample collection, a 1-L sample of raw water was
collected into a sterile polypropylene container and returned, on ice, in the sampling
kit. Within 24 hours of receipt, three 100-mL portions of this sample were assayed
for total coliforms by membrane filtration through a 0.45-um filter, which was then
incubated on m Endo Agar LES (Difco Laboratories, Detroit, Mich.) for 24 hours
at 35 C. Results were reported as either positive or negative for total coliform
colonies. Negative controls, consisting of 100 mL of autoclaved Milli-Q water
(Millipore Inc., Bedford, Mass.), were run along with each set of raw water samples.
Total Organic Carbon Assay______________

TOC analyses were done in triplicate in the Belleville, 111., laboratory of the
American Water Works Service Company Inc. Three 5-mL portions of each raw
water sample were analyzed with a TOC-5000 total organic carbon analyzer
(Shimadzu Inc., Columbia, Md.).
UV-254 Analysis______________________
Two 2-mL portions of each raw water sample were analyzed for spectral
absorbance at 254 nm (i.e., a UV-254 analysis was conducted) using a Milton Roy
Spectronic 21-D spectrophotometer (Milton Roy, Rochester, N.Y.). The water
sample was placed in a quartz cuvette (Spectrocell Corp., Oreland, Pa.), and
duplicate readings were taken. The instrument was zeroed using Milli-Q water
(Millipore Inc., Bedford, Mass.).
Chemical Analysis____________________
At the time of the sample collection, a 1,000-mL sample of raw water was
collected in a sterile polypropylene container and was used for chemical analysis
performed in the Belleville, 111., laboratory of the American Water Works Service
Company Inc. Tests were performed according to current USEPA accepted proto
cols. A summary of the chemical assays and methods used is detailed in Table 5.6
(p.39).
Primers and Probes Used for Virus Detection_____

The primers used for the detection of enteroviruses in the sample concen
trates (5' - CCT CCG GCC CCT GAA TG - 3') and (5' - ACC GGA TGG CCA
ATC CAA - 3') produce a 196-base-pair product (DeLeon et al. 1990). The
internal probe used for hybridization consisted of (5' CCC AAA GTA GTC GOT
TCC CGC 3') (Abbaszadegan et al. 1993).
The hepatitis A virus primers (5' - CAG CAC ATC AGA AAG GTG AG
3') and (5' CTC CAG AAT CAT CTC CAA C - 3') produce a 192-base-pair
product (DeLeon et al. 1990). The hybridization probe consisted of the sequence
(5' AAT GTT TAT CTT TCA GCA A 3').
The upstream primer for rotavirus (CON 1,5'- TTG CCA CCA ATT
CAG AAT AC - 3') and downstream primer (CON 2,5' - ATT TCG GAC CAT
TTA TAA CC - 3') produce a 211-base-pair product. The rotavirus primer
sequences were kindly provided by Jon Gentsch at the Centers for Disease Control,
Viral Gastroenteritis Unit, Atlanta, Ga., as was the sequence for the hybridization
probe, AVP4-C: (5' AGA GAG CAC AAG TTA ATG AAG 3').
Large-Volume Polymerase Chain Reaction_______

Most manufacturers of the enzymes needed for PCR describe reaction
protocols in which the total reaction volume ranges between 30 and 100 uL. These
are also the most commonly described reaction volumes in the scientific literature,
although reactions of 10 uL or less are common. A trend has been observed in which
the reaction volume is reduced to conserve reagents and to facilitate many reactions
being run simultaneously. The drawback to this approach, with respect to analyzing
environmental samples, is the examination of smaller portions of a potentially dilute
source.
The authors initially followed their own previous protocol (Abbaszadegan
et al. 1993) using 10 uL of a sample in 30 uL of reverse transcription reaction. This
10 uL represented 0.5 L of the original sample. Because viral contamination may
be at very low concentrations and still present health problems, the authors wished
to maximize the sample size. The authors have accomplished this by increasing the
sample to 50 uL, representative of 5 L of original sample (1,500 L is concentrated
to 15 mL) without a five-fold increase in the reaction size or reagents. The amount
of RNase inhibitor is 3.3 times the amount used in the smaller reaction, and the
amount of reverse transcriptase is only twice the amount used in the smaller
reaction, so a tenfold increase in reaction volume is accomplished with about a
2.5-fold increase in cost. Additionally, the sensitivity of the reaction is greater and
the results more consistent.
Pre-PCR Sample Treatment_______________
Before PCR analysis, each sample concentrate was extracted once with
phenol:chloroform (5:1, pH 4.7) (Amresco Inc., Solon, Ohio) and once with
chloroform (Amresco). The concentrate was combined 1:1 with the
phenol:chloroform mixture and vortexed for 3 minutes. The sample was then
centrifuged for 15 minutes at 14,000xg. The aqueous portion was removed and
combined with an equal volume of chloroform, vortexed for 1 minute, and
centrifuged for 5 minutes at 14,000xg. The resulting aqueous portion (500 to
750 uL) was applied to the top of a column consisting of 5 mL of autoclaved DNA
Grade Sephadex G-100 (Pharmacia Biotech, Piscataway, N.J.), equilibrated in

HPLC grade water, in a 5-mL syringe plugged at the bottom with a
1-in. (25-cm) square piece of sterile Kirn-Wipe tissue (Kimberly-Clark Corp.,
Roswell, Ga.). The initial column eluant was discarded. Three successive
750-uL aliquots of HPLC grade H2O were applied, the column being allowed to
drain between each application. The first two column eluants were discarded. The
final 750-uL eluant fraction was collected in a 1.5-mL microcentrifuge tube
containing approximately a 50-uL volume of autoclaved Chelex 100 resin (Bio-Rad
Laboratories, Hercules, Calif.) and was stored at -20 C until RT-PCR analysis.
Reverse Transcription Reaction_____________

Two RT-PCR reactions were performed on each sample concentrate. One
50-uL reaction (total reaction volume) was seeded with 10 pfu of poliovirus or
hepatitis A virus or 10 TCID50 (tissue culture infective dose 50) of rotavirus,
whereas the other reaction consisted only of the sample and was performed in a final
volume of 300 uL. (The amount of virus used in the seeded samples is more than
might be expected in an environmental sample; however, the purpose of seeding the
concentrates was to provide a rapid and definitive indication of whether or not the
sample would permit amplification of virus. A sample seeded with less virus may
undergo amplification, but the amount of reaction product may be difficult or
impossible to detect without additional, time-consuming confirmation steps such as
Southern hybridization.)
The smaller-volume, seeded reverse transcription reactions were per
formed as follows: 10 uL of the sample was combined with 5 uL of sterile, nuclease-
free water containing either 10 pfu or 10 TCID50 of the virus along with 0.7 uL
random hexamers (250uM stock) in a 500-uL microcentrifuge tube. The mixture
was heated at 99 C for 4 minutes and then placed on ice. A reaction cocktail of 33
uL was then added, consisting of 18.3 uL of sterile, nuclease-free water, 6 uL lOx
buffer (35mM MgCl2 , 750mM KC1, lOOmM Tris, pH 9.5), 6 uL dithiothreitol
(0.1 M), 1.3 uL dNTP mix (lOmMeach dNTP), 0.8 uL of RNasin RNase inhibitor
(40 units/uL) (Promega, Madison, Wis.), and 0.4 uL Superscript II Reverse
Transcriptase (200 units/uL) (BRL Life Technologies, Gaithersburg, Md.). The
reverse transcription reaction, 48.5 uL total volume, was then incubated at 25 C for
15 minutes and 42 C for 45 minutes and then heated to 99 C for 5 minutes. The
reaction product was then stored at 4 C until the amplification reaction was
performed.
For the large-volume, unseeded reaction, 50 uL of sample and 50 uL
of sterile, nuclease-free water were combined with 4 uL of random hexamers
(250uA/ stock) (Pharmacia Biotech, Piscataway, N.J.) in a 500-uL microcentrifuge
tube. The mixture was heated at 99 C for 4 minutes and then placed on ice. A
reaction cocktail of 186 uL was prepared by combining 110.5 uL sterile, nuclease-
free water, 30 uL lOx buffer (35mM MgCl2, 750mM KC1, lOOmM Tris, pH 9.5),
30 uL DTT (0.1M), 8 uL dNTP mix (1 OmM each dNTP) (Pharmacia Biotech), 5 uL
of RNasin (40 units/uL) (Promega) and 2.5 uL Superscript II Reverse Transcriptase
(200 units/uL) (BRL Life Technologies) and added to the tube containing the
sample. The reverse transcription reaction, 290 \\L total volume, was then incubated
at 25 C for 15 minutes and 42 C for 45 minutes and then heated to 99 C for
5 minutes. The reaction product was then stored at 4 C until the amplification
reaction was performed.
cDNA Amplification by PCR_______________
PCR, using the entire reverse transcription reaction, was performed by the
addition of a reaction cocktail consisting of primers and AmpHTaq DNA poly-
merase (Perkin Elmer, Foster City, Calif.).
For the small-volume, virus-seeded reaction, a 1.5-uL cocktail
consisting of 0.3 uL of each primer (75uM), 0.3 uL of AmpliTaq DNA polymerase
(1.5 units), and 0.6 uL of water was added to the reverse transcription reaction.
The reaction volume was then incubated for 3 minutes at 96 C and subjected to 35
temperature cycles of 45 seconds at 94 C, 30 seconds at 55 C, and 45 seconds at
72 C. A final annealing phase was performed for 7 minutes at 72 C. The reaction
products were stored at 4 C until analyzed by agarose gel electrophoresis.
For each large-volume (300-uL) reaction, a 10-uL cocktail consisting of
2 uL of each primer (75uM), 2 uL of AmpliTaq DNA polymerase, and 4 uL of
water was prepared and added to the reverse transcription reaction. The reaction
volume was then incubated for 4 minutes at 96 C and then subjected to 35 cycles,
each consisting of 75 seconds at 94 C, 60 seconds at 55 C, and 75 seconds at 72 C.
A final extension phase was performed at 72 C for 7 minutes. The reaction products
were stored at 4 C until analyzed by agarose gel electrophoresis.
Agarose gel electrophoresis was performed in 1.6 percent agarose I gel
(Amresco Inc., Solon, Ohio) containing 1.5 ug/mL of ethidium bromide. The gels
were run for 2 hours at 100 constant volts and analyzed by photographing the gels
as they were exposed to ultraviolet light using a UV transilluminator (UVP Inc.,
Upland, Calif.). Example illustrations of gel photographs are shown in Figures 4.2
and 4.3.
Hybridization Using Radiolabeied DNA Probes____
Following electrophoresis, agarose gels were soaked in 0.4A/ HC1 for 15

minutes, rinsed in Milli-Q water (Millipore, Bedford, Mass.), then soaked in 0.4M
NaOH for 15 minutes to denature the double-stranded PCR product. The DNA was
then Southern transferred (Southern 1975) to a charged nylon membrane (GeneScreen
Plus, DuPont NEN Research, Boston, Mass.) using a vacuum blotter (Model 785,
Bio-Rad, Hercules, Calif.). The membrane was soaked for 30 minutes in lOx SSC
(1.5M sodium chloride, 0.15A/ sodium citrate, pH 7.0) and then placed atop a piece
of blotting paper on the vacuum blotter surface. The blotter's surface was then
overlaid with a plastic sheet in which a window smaller than the membrane was cut.
The gel was placed over the membrane, 1 L of lOx SSC was added to the blotter
chamber, and vacuum (5 in. [25.4 torr] Hg) was applied for 90 minutes. Following
1357 11 13 ' 15 17 19 P
E133-158 SEEPED
1/10/96
Key: Lane 1 123-base-pair marker

Lanes 2-19 Samples 133-150
Lane P Positive control 10 pfu poliovirus
Lane N Negative control
Lane 22 123-base-pair marker
Figure 4.2 Example gel photograph: Enterovirus-seeded reactions
1 2 3 4 5 6 7 8 9 10 11 1213

Lanes 2-6 Seeded reactions, samples 80-84
Lane 7-11 Nonseeded reactions, samples 80-84
Lane 12 Positive control 10 TCID50 rotavirus
Figure 4.3 Example gel photograph: Rotavirus-seeded and nonseeded reactions
transfer, the membrane was soaked for 1 minute in 0.4MNaOH to denature the DNA
on the membrane completely and then soaked in 1 .OM Tris-HCl (pH 7.5) (Sigma,
St. Louis, Mo.) and 5x SSC for 1 minute to neutralize the NaOH. The membrane was
placed between two pieces of blotting paper to remove excess moisture and then
placed in an ultraviolet light chamber (UVC 500 UV Crosslinker, Pharmacia,
Piscataway, N.J.) and exposed to 120,000 uJ/cm2 of UV-254 light. UV exposure
resulted in the permanent fixation of transferred DNA to the nylon membrane, as
recommended by the membrane manufacturer.
Following fixation of the DNA to the membrane, the membrane was placed
in a glass roller bottle (Robbins Scientific, Sunnyvale, Calif.), and sufficient
hybridization buffer (Rapid-Hyb, Amersham Life Sciences, Arlington Heights,
111.), prewarmed to 42 C, was added to the tube to soak the membrane completely.
The hybridization buffer both facilitates the binding of the probe to the target DNA
fixed to the membrane and prevents nonspecific binding of the probe to the
membrane itself. The tube was placed in a hybridization incubator (Model 400,
Robbins Scientific) equipped with a rotating tube holder, and the tube was rotated
for 30 minutes at 42 C, after which 5 uL of radiolabeled DNA probe was added to
the buffer in the tube. The tube was returned to the incubator and rotated for an
additional 120 minutes at 42 C.
Following hybridization, the hybridization buffer was poured off and 30
mL of 2x SSC (0.3A/ sodium chloride, 0.03M sodium citrate, pH 7.0) was added to
the bottle. The bottle was gently shaken by hand for 10 minutes at room temperature.
The wash solution was then poured off and an additional 30 mL of 2x SSC was added
to the tube, which was again gently shaken for 10 minutes at room temperature. The
wash solution was discarded, and approximately 30 mL of 2x SSC and 1 percent
(SDS), prewarmed to 42 C, was added to the bottle, the bottle was rotated in the
hybridization incubator for 20 minutes at 42 C. After 20 minutes, the wash solution
was poured off, and 30 mL of 0.2x SSC and 1 percent SDS, prewarmed to 42 C, was
added to the bottle. The bottle was again rotated in the incubator for 20 minutes at
42 C.
The membrane was blotted to remove excess moisture and placed in a
scalable plastic envelope (Kapak Corp., Minneapolis, Minn.). The envelope was
placed in a photographic exposure cassette (TMC International, Glenview, 111.) and
allowed to expose a sheet of X-ray film (X-OMAT AR, Eastman Kodak Co.,
Rochester, N.Y.) overnight at -80 C. Depending on the intensity of the signal
observed on the film, some exposures were repeated for as little as 2 hours or as long
as 48 hours. The film was developed according to the film manufacturer's direc
tions. An example of an autoradiograph is illustrated in Figure 4.4.
Radiolabeling of DNA Probes______________
DNA probes were 3-prime end-labeled with 32P dATP (Amersham Life
Sciences, Arlington Heights, 111.) using the DNA 3' End Labeling System (Promega,
Madison, Wis.). For a 20-uL reaction, 4 uL of 5x Terminal Transferase buffer
(supplied with the End Labeling Systems Kit), 1 uL of DNA probe (2 picomoles
[pmol]), 1 uL of Terminal Transferase (10-20 units/uL), 1.6 uL of 32P-labeled
dATP (800 Ci/mmol), and 12.4 uL of water were added to a 50-uL microcentrifuge
2 3 4 S 6 7 8 9 10 11 12 13 14 15

Lanes 2-9 Samples 1, 6, 16, 31, 32, 46, 47, 54
Lane 11 Positive control 10 TCID50 rotavirus
Figure 4.4 Gel photograph and autoradiograph of the same samples (assayed for
rotavirus positive samples in lanes 6, 7, and 9)
tube. The tube was incubated for 60 minutes at 37 C, and the reaction was stopped
by heating for 10 minutes at 70 C. The labeled probe was stored at
-20 C for 10 days or less, until used.
RT-PCR Confirmation of Cell Culture Results_____
To confirm the cell culture results, the culture flask contents were subjected
to RT-PCR using enterovirus-specific primers. Following the cell culture analysis,
the flasks were frozen at-80 C and then thawed. The resulting lysed cells and media
were then stored until the RT-PCR assay.
Two hundred microliters of the cell harvest was placed in a 100,000-D
molecular weight cutoff filter (Microcon 100, Amicon Inc., Bedford, Mass.), which
was then placed in a 1.5-mL centrifuge tube and centrifuged at 500xg for 15 minutes
at room temperature, according to the filter manufacturer's protocol. Fifty micro-
liters of water was placed on the filter to resuspend any virus particles and the filter
was inverted in a fresh 1.5-mL tube and centrifuged for 1 minute at 14,000xg. The
supernatant collected was then subjected to RT-PCR as described previously
(50-uL reaction).
Chapter 5
Results
RT-PCR Analysis of Environmental Concentrates
One hundred fifty samples were analyzed by RT-PCR for enteroviruses,

hepatitis A virus, and rotavirus. Each sample was assayed twice for each virus
once using only the concentrate as a template for RT-PCR, and once using the
concentrate seeded with either 10 pfu of poliovirus, 10 pfu of hepatitis A virus, or
10TCID50 of rotavirus.
When primers specific for enteroviruses in RT-PCR reactions were used,
17 samples (11.3 percent) failed to exhibit amplification when seeded. Of the
samples that could be assayed, 40 of 133 (30.1 percent) were deemed positive for
the presence of enterovirus RNA.
When primers specific for hepatitis A virus were used in the RT-PCR
reactions, 11 samples (7.3 percent) failed to exhibit amplification when seeded. Of
the samples that could be assayed, 12 of 139 (8.6 percent) were deemed positive for
the presence of hepatitis A viral RNA.
RT-PCR analysis using rotavirus-specific primers resulted in 20 samples
(13.3 percent) unable to be assayed. Of the remaining 130 samples, 18 (13.8 percent)
were positive for rotavirus RNA.
For all samples, only five could not be assayed with any of the enterovirus,
hepatitis A virus, or rotavirus primers.
Cell Culture Analysis of Environmental Concentrates
One hundred fifty samples were analyzed for enteroviruses by cell culture
techniques using BGM cells. Thirteen of the 150 samples (8.7 percent) showed
cellular cytopathic effects in both the initial and confirmation phases of the analysis.
The most probable number (MPN) of virus per 100 L of original sample ranged from
0.15 to 1.86 for the samples that were positive. Thirty-one of the samples (20.7
percent) exhibited cellular toxicity, and three samples (2 percent) were contami
nated with bacteria; however, all of these samples were able to be assayed after
toxicity or bacterial contamination was eliminated. Additionally, all of the samples
tested positive when seeded with poliovirus type 1 (LSc strain) as a positive control.
There seemed to be no relationship between a sample being toxic to BGM
cells and being inhibitory to the RT-PCR analysis. The five samples that could not
be assayed by RT-PCR for any of the three viruses showed no cytotoxicity when on
33
34 PCR Technologies for Vims Detection in Groundwater
cells. Of the samples that were inhibited for either one or two (but not all three) of
the RT-PCR assays, six showed cytotoxicity, whereas six showed no toxic effect
when applied to cells.
The cell culture and RT-PCR results are summarized in Table 5.1, and in
Table 5.2, cell culture results are compared to RT-PCR and bacteriophage results.
Equivalent Volumes Assayed by PCR and

Ceil Culture Assay____________________
Although RT-PCR and cell culture methods assay different equivalent
volumes of the original sample (5 L versus 600 L, respectively), the difference in
the assays' sensitivities needs to be considered when one is comparing the assay
results in order to assess the methods' practical applications in water analysis. The
minimum detection level of viruses using a cell culture assay is 1 pfu in a given
sample volume. Since hundreds of virus particles may be required to produce a
single pfu, assay methods such as PCR that detect virus particles directly will result
in significantly greater sensitivity. The minimum detection limit of viruses for
RT-PCR is one virus particle, and studies have shown that PCR can consistently
detect 10"2 pfu of virus (Abbaszadegan et al. 1993). Thus, the RT-PCR assay is
approximately 100 times more sensitive, which approximately counters the greater
equivalent volume for cell culture methods.
The equivalent assay volumes were calculated based on the total volume of
sample concentrates analyzed. For cell culture, a total of 12 mL of a sample
concentrate was divided among four 75-cm2 flasks (3 mL per flask, corresponding
to 150 L equivalent sample volume). For the 150 concentrates assayed by cell
culture, no sample exhibited CPE in all four cell culture flasks. For this study, a
single reaction tube of RT-PCR corresponded to an equivalent volume of 5 L. This
comparatively small sample volume may be more than offset by the hundredfold
increase in sensitivity offered by the method.
Bacteriophage Assays__________________
One hundred forty-four groundwater concentrates were assayed for bacte
riophage presence using three different bacterial hosts: Salmonella WG-49, E. coli
C-3000, and E. coli C.
Twenty-seven of the samples (18.8 percent) tested positive using host
WG-49, 13 samples (9.0 percent) tested positive using host E. coli C-3000, and
11 samples (7.6 percent) tested positive using host E. coli C. Forty-four samples
(30.6 percent) tested positive on at least one host, and seven samples (4.9 percent)
tested positive on two different hosts. The amount of the sample analyzed repre
sented approximately 4.5 L of the original 1,500-L sample (1,500 L eluted in 1 L;
3 mL of eluant sampled for bacteriophage). Of the samples testing positive, the
average number of plaques per 100 L was less than 14. The complete results are
summarized in Table 5.3.
Results 35
Table 5.1 Summary of viral analyses

Type of assay Finding
Cell culture assays

Enterovirus positive 13 (8.7%)
Enterovirus negative 136 (91.3%)
Sample did not precipitate 1 (0.01%)
Sample analyses completed Tso
Enterovirus PCR assays
Positive 40 (26.7% of total, 30.1% of assayed)
Negative 93 (62.0% of total, 69.9% of assayed)
Reaction failed 17 (11.3% of total)
Sample analyses completed 150
Hepatitis A PCR assays

Rotavirus PCR assays
Table 5.2 Comparative analysis of enterovirus assays
Cell culture assay versus RT-PCR enterovirus assay
PCR positive PCR negative PCR unknown
Cell culture positive 6 6 1

Cell culture negative 34 89 14
Cell culture assay versus bacteriophage assays
Salmonella WG-49 positive Salmonella WG-49 negative

Cell culture positive 3 10
Cell culture negative 24 107
E. coli C positive E. coli C negative

E. coli C-3000 positive E. coli C-3000 negative

Table 5.3 Summary of bacteriophage analyses

Host Finding
Salmonella WG-49
Positive 27 (18.8%)
Negative 117 (81.2%)
Samples analyzed 144
Average pfu value
of positive samples 10 pfu/100L
E. coli C-3000
Positive 13 (9.0%)
Average pfu value
of positive samples 12 pfu/100L
E. coli C
Positive 11 (7.6%)
Average pfu value
of positive samples 13.3 pfu/100L
Recovery of Poliovirus by RT-PCR
Three recovery tests were performed in which approximately 30 gal

(113 L) of reverse osmosis water was seeded with either infectious poliovirus, heat-
inactivated poliovirus, or poliovirus that had been phenol:chloroform extracted to
isolate only the viral RNA. The heat-inactivated poliovirus was inactivated by
heating for 5 minutes at 56 C. Both the heat-inactivated and infectious virus tests
were seeded into the water at a concentration of IxlO6 pfu per 113 L. When the
authors used phenol extracted viral RNA, the equivalent of 1 x 107 pfu was seeded
into 113 L. (This was to compensate for any potential loss of material during the
phenol extraction.) These seeded water samples were filtered through 1MDS filters,
eluted, and concentrated as described previously; they were then subjected to
RT-PCR. All of the concentrates were then extracted with phenol:chloroform and
then with chloroform, followed by Sephadex fractionization, as described previ
ously. When used in the RT-PCR assays, the resulting treated concentrates from the
infectious and heat-inactivated virus trials were diluted 10, 100, and 1,000 times in
sterile, nuclease-free water (Amresco, Solon, Ohio). The RNA-seeded concentrate
was used undiluted, tenfold diluted, and hundredfold diluted. Results of gel analysis
is shown in Figure 5.1.
The results of these experiments (summarized in Table 5.4) suggest that the
recovery and subsequent detection of enteroviruses by PCR are greater for intact
virus particles than for free viral RNA. This result is not surprising, given that RNA,
unprotected by the viral protein capsule, is subject to rapid deterioration in the
environment. The finding that substantially less heat-inactivated virus was recov
ered is less easily explained. One possible interpretation concerns the effect of heat
on the surface proteins of the virus particles. The capture of viruses by the positively
Results 37
Lane # 12 3 4 5 6 7 8 9 10 11 12 13

Lanes 2-4 Heat inactivated poliovirus—100, 10, 1 pfu
Lanes 5-7 Extracted poliovirus RNA—100, 10, 1 pfu
Lanes 8-10 "Live" poliovirus—100, 10, 1 pfu
Lane 11 Positive control—10 pfu
Lane 13 123-base-pair marker
Figure 5.1 Agarose gel of recovery of poliovirus by RT-PCR experiments
Table 5.4 Summary of seeded recovery tests

Virus type 100 pfu/reaction 1 0 pfu/reaction 1 pfu/reaction
Infectious
Inactivated
RNA
+ = faintest positive band

++ = next brightest positive brand
+++ = next brightest positive band
++++ = brightest possible band
+/- = questionable result
- = negative result
charged filter depends upon the charge interaction of the filter with the proteins
surrounding the viral RNA. These proteins, in their native state, assume a particular
three-dimensional shape, but when the proteins are heated, this shape may perma
nently change. The charged sites on a protein are largely dependent on the shape of
protein; thus, changing the shape may change the charges and prevent their
interaction with the filter during sampling. This same configuration change is likely
responsible for the loss of infectivity encountered in the cell culture assay.
RT-PCR Analysis of Cell Harvests___________
RT-PCR was performed on the cell culture flask contents of the first 44
samples. These "cell harvests" consisted of cell culture flask contents that, at the
conclusion of the cell culture assay, were frozen and thawed several times to disrupt
the cells and release virus particles from the cells. The resulting mixture of cellular
debris and cell culture media was filtered through a molecular weight cutoff filter
to concentrate any potential viruses and then subjected to PCR analysis. The
purpose of this experiment was to confirm the presence of enterovirus in the cultures
deemed positive. All samples determined to be positive by cell culture also
exhibited amplification when the cell harvest was subjected to RT-PCR. In addition,
one sample thought to be negative by cell culture also showed amplification of
nucleic acid by RT-PCR. This sample was obtained from a well that had previously
tested positive by both cell culture and RT-PCR for enterovirus contamination and
had a history of fecal coliform contamination problems. A summary of the results
of RT-PCR on cell culture harvests is presented in Table 5.5.
Chemical Analyses___________________
With each sample collected, a 1-L portion of the raw water was also
obtained and subjected to a complete minerals and metals analysis and TOC
analysis. The results were then statistically analyzed, comparing virus PCR results
with the chemical analyses. The objectives of these analyses were to investigate any
possible relationship between the concentrations of organic and inorganic sub
stances and inhibition of the PCR reaction. A descriptive summary of the various
substances assayed is listed in Table 5.6.
Several statistical analyses were done on the chemical data using the
computer software product SigmaStat (Jandel Scientific Software, San Rafael
Calif.). First, an analysis of the data's normality was performed. None of the
measured values were normally distributed, i.e., distributed in the familiar "bell-
shaped" curve. This fact dictated the use of nonparametric statistical tests.
Correlation analysis measures the strength of association between two
variables, without the assumption that a change of one variable causes a change in
the other. The correlation coefficient may be either positive or negative. A positive
correlation coefficient results when the values of two variables both increase or both
decrease. A negative correlation coefficient results when the values of the variables
move in opposite directions i.e., one increases while the other decreases. Regres
sion analysis tests whether the value of one variable, the dependent variable, can be
Results 39
Table 5.5 Cell harvest RT-PCR results

PCR positive PCR negative

Table 5.6 Summary of chemical analyses

Mean Median Low High USEPA
Substance (mg/L) (mg/L) (mg/L) (mg/L) method used
Aluminum 0.009 0.000 0.000 0.426 200.8 (USEPA 1994)

Barium 0.113 0.060 0.000 1.040 200.8
Beryllium 0.000 0.000 0.000 0.003 200.8
Boron 0.059 0.000 0.000 1.360 200.8
Cadmium 0.000 0.000 0.000 0.003 200.8
Calcium 63.678 50.440 0.020 257.400 200.7 (USEPA 1994)
Chloride 43.618 27.900 1.300 906.100 300.0 (USEPA 1993)
Chromium 0.001 0.000 0.000 0.033 200.8
Cobalt 0.029 0.000 0.000 0.100 200.8
Copper 0.010 0.000 0.000 0.350 200.8
Fluoride 0.255 0.200 0.000 2.900 300.0
Iron 0.630 0.050 0.000 13.980 200.7
Lead 0.001 0.000 0.000 0.019 200.8
Mercury 0.000 0.000 0.000 0.001 200.8
Magnesium 20.268 14.810 0.050 151.680 200.7
Manganese 0.145 0.020 0.000 4.500 200.8
Molybdenum 0.117 0.000 0.000 0.400 200.8
Nickel 0.004 0.000 0.000 0.010 200.8
Nitrate 1.300 0.560 0.000 15.200 300.0
Potassium 2.930 2.250 0.050 20.150 200.7
Selenium 0.001 0.000 0.000 0.007 200.8
Silver 0.000 0.000 0.000 0.001 200.8
Sodium 30.084 20.130 0.000 331.040 200.7
Strontium 1.170 0.220 0.000 34.980 200.8
Sulfate 58.513 35.400 1.000 507.500 300.0
Thallium 0.000 0.000 0.000 0.001 200.8
Vanadium 0.003 0.000 0.000 0.030 200.8
Zinc 0.027 0.000 0.000 0.480 200.8
predicted by another, independent variable. The relationship between the two

variables is assumed to be causal.
Statistical tests were performed analyzing the relationship of individual
minerals or metals, as well as various combinations of minerals and metals, to cell
culture results and PCR results. Neither the correlation analyses nor the regression
analyses revealed any relationship between virus PCR results and any of the
chemical measurements, suggesting that the presence and viability of viruses in
groundwater do not depend on the chemical composition of the water.
An attempt was made to learn whether any particular organic or inorganic
substance in the source water was related to the inhibition of the PCR reaction. In
this effort, based on an analysis of variance, chemical levels of samples that

inhibited the PCR reaction were compared with chemical levels of samples that did
not inhibit reactions. Again, no relationship was observed between the concentra
tion or presence of any particular substance in the source water and the inhibition
of the PCR reaction. Also analyzed was the possible effect of the specific ultraviolet
absorbance on PCR inhibition. The SUVA is a derived number and is defined as the
absorbance of the raw water sample at 254 nm divided by the measured TOC. A
SUVA value higher than 4.0 represents TOC composed largely of humic sub
stances, whereas SUVA values below 3.0 represent TOC consisting of nonhumic
material. No significant differences were seen between the SUVAs of inhibited and
noninhibited samples, nor was any correlation noted between SUVA and the results
of the PCR analyses. The SUVA results are listed in Appendix B.
The exact nature of inhibitors of the PCR reaction remains undetermined.
Many different substances such as humic substances, proteases, DNase and
RNase, or excessive amounts of magnesium, iron, and chelating materials are
known to be inhibitory. The pretreatment protocol outlined earlier in this report was
designed to eliminate or neutralize as many of these as possible. Phenol and
chloroform, for example, are effective at dissolving and segregating proteins, such
as DNase and RNase, from RNA and DNA in aqueous solution. The passage of the
sample through a column of Sephadex (Pharmacia, Piscataway, NJ.) separates the
molecules in the sample according to size, and Chelex (Bio-Rad, Hercules, Calif.)
removes metallic ions. The fact that certain samples inhibit PCR after this treatment
seems to suggest that the inhibitors are nonprotein, nonmetallic, and of approxi
mately the same size as the RNA collected following fractionization through
Sephadex. Humic material, which comprises a range of differently sized and diverse
macromolecules, is the likely source of the observed inhibition.
DNA is a long, linear molecule much longer than it is wide. For example,
the DNA of the E. coli bacteria possesses a length-to-width ratio of approximately
700,000 (Stryer 1988). Because of their unusual shape, DNA molecules are
susceptible to conformation changes caused by twisting, looping, and turning due
either to conditions of the physical environment, such as temperature and pH, or to
interactions with other molecules. Many organic molecules, such as certain dyes
and some antibiotics, bind to DNA and cause changes in the three-dimensional
structure (Brock and Madigan 1991). In order for a PCR reaction to succeed, the
DNA polymerase enzyme must bind to the site of the DNA-primer complex. If
another molecule occupies this site or if a structural change, such as a loop or turn,
has occurred at the site, the DNA polymerase enzyme cannot bind and function.
Since only 3.3 percent of the samples showed inhibition with all three sets of primers
(enterovirus, rotavirus, and hepatitis A virus), it seems that some of the inhibitors
act at specific sites on the DNA complex and adversely alter the desired interaction
of the template DNA and the reaction primers. It is unlikely that inhibitors are
inactivating or impairing the reaction enzymes, reverse transcriptase, or AmpliTaq
polymerase (Perkin Elmer, Foster City, Calif.) since all but three of the samples
showed amplification when seeded with at least one of three viruses.
Results 41
Summary of Physicochemical Characteristics of

Groundwater Sites____________________
The average depth of the wells surveyed was 269 ft. (82.3 m) and ranged
from 19 ft (6.9 m) to 2,247 ft (816.4 m). The sites positive by cell culture had an
average well depth of 418 ft (151.9 m) whereas the average depth of the sites positive
by RT-PCR was 213 ft (77.4 m). The average pH was 7.16 for all wells and ranged
from 4.83 to 9.20. The average pH was 7.18 for cell culture positive samples and
7.10 for samples positive for RT-PCR. The average temperature for all wells was
14.8 C (58.6 F), with a range of 7.0 to 34.0 C (44.6 to 93.2 F). The average
temperature was 12.9 C (55.2 F) for samples positive by cell culture and 13.5 C
(56.3 F) for all RT-PCR positive samples. The average turbidity was 1.4 ntu and
ranged from 0.039 to 15.6 ntu. The average TOC was 0.97 mg/L, ranging from 0.12
to 5.21 mg/L. The physicochemical characteristics of the groundwater sites are
summarized in Table 5.7.
Site selection for the project was based on different chemical and physical
criteria. Geological settings were also used in the selection process to ensure a
variety of samples and to ensure the best evaluation of the applicability of the PCR
method for the detection of viruses in groundwater. Table 5.8 shows the number of
wells sampled within each geology type and deposit type. The percentages of water
production for wells sampled (relative to the total production for all wells sampled)
are also listed in terms of geology type and deposit type.
Statistical Analyses___________________
The analyses performed for this study included some basic statistics and
assessment of distributions for all variables. Exploratory analyses were also
performed to determine correlations between each of the variables. Correlation
analyses were conducted in the form of both numeric analyses using Pearson
correlations and rank analyses using Spearman correlations.
Cross tabulations were done to determine whether there was a relationship
between (1) cell culture and (2) the parameters of microbial indicators and PCR. The
Table 5.7 Summary of physicochemical characteristics

Depth Turbidity Temperature TOC
(«) PH (ntu) (°C) (mg/L)
Average (n = 150) 269 7.16 1.40 14.8 0.97

Minimum 19 4.83 0.039 7.0 0.12
Maximum 2,247 9.20 15.6 34.0 5.21
Average —cell culture 418 7.18 1.75 12.9 1.18
positive (n = 13)
Average— enterovirus PCR 213 7.10 1.02 13.5 0.97
positive (n = 40)
Table 5.8 Summary of geological characteristics of groundwater sites

Percentage Percentage
Percentage of total of water
Number of of water production production,
Geology or wells wells (relative to national
deposit type sampled sampled all wells sampled) average*
Unconsolidated
Alluvial sand and gravel 44 29.33 45.27 32.7
Coastal plain 5 3.33 3.44 17.1
Fluvial and eolian 0 0.00 0.00 2.4
Glacial valley 8 5.33 4.23 2.3
Glacial outwash 2 1.33 0.90 13.8
Glacial valley and outwash 0 0.00 0.00 1.2
Other 3 2.00 1.89
Unknown 8 5.33 6.75
70 46.67 "62A8 69.5
Bedrock
Carbonates 13 8.67 5.88 18.1
Sandstone and 15 10.00 4.88 8.3
conglomerate
Siltstone 2 1.33 1.57 0.2
Plutonic igneous and 0 0.00 0.00 0.6
metamorphic
Volcanic 0 0.00 0.00 3.4
Unknown 4 2.67 0.65 —
34 22.67 12.98 30.5
Unknown 46 30.67 24.54 —
Total 150
* Data are from USGS 1990 and from the firm of Leggette, Brashears, and Graham, Inc., Professional Ground-Water and
Environmental Services, Trumbull, Conn.
— indicates <0.1%
results indicated that there was no positive relationship between the cell culture
results and any of the parameters tested.
In addition, analyses of variance on cell culture and PCR values by well
depth, by distance from surface water sources, and by distance from sewage sources
were performed. The results indicated that the mean distances for cell culture
positive and negative values were not significantly different at any of the distance
parameters tested. The mean distances for PCR positive and negative values were
not significantly different by well depth or by distance from surface water sources,
but they were significantly different by distance from sewage sources.
Chapter 6
Discussion
The objective of this project was to develop a simple, rapid, and low-cost
PCR-based assay to be used by water utilities for virus monitoring in groundwater
samples. Molecular techniques are now widely used in environmental research and
monitoring, with the necessary tools and techniques available from a variety of
sources. The strategy outlined here fulfills the water industry's need for a rapid,
reliable, inexpensive, and easily performed analysis of groundwater for virus
contamination.
As results were generated during the course of this study, the authors have
informed the participating utilities when a water sample was positive for enterovirus
contamination by cell culture analyses. The authors advised the utilities that
maintaining a disinfection residual is crucial for the source. However, since the
samples were taken before any disinfection, the positive results did not necessarily
indicate a health risk for the communities served by the water provider.
A Strategy for the Detection of Viruses by PCR____
PCR is a powerful technique for the detection of organism-specific nucleic

acids and can differentiate types of enteric viruses, such as enterovirus, rotavirus,
hepatitis A virus, and Norwalk virus. The strategy developed in this research project
involves the following: the removal or inactivation of PCR-inhibiting substances,
the use of a large-volume PCR that allows for analysis of a larger equivalent volume
of a water sample, the seeding of water concentrates with viruses to test the
applicability of PCR to each sample, and the use of assay controls.
PCR cannot be performed on most of the concentrated water samples unless
interfering substances are removed before the reverse transcription and amplifica
tion reactions. The treatment protocol outlined in this report organic extraction
and size exclusion chromatography enabled more than 95 percent of the samples
to be successfully assayed by PCR for at least one virus of interest and more than
90 percent of the samples to be successfully assayed for two of the three viruses.
Eighty-four percent of the samples could be assayed for all three viruses, whereas
only five samples (3.3 percent) could not be assayed for any virus. Other treatment
protocols are available, such as the use of magnetic beads conjugated to DNA
sequence-specific probes, that may increase the percentage of samples that could be
assayed, but they are more costly and more technically challenging.
43
Although virus contamination of groundwater may be at very low concen

trations, RT-PCR techniques can potentially reveal the presence of the viral RNA
molecule. This report has shown that some untreated environmental samples, even
when seeded with high virus concentrations, will mask detection of the viral RNA
by this technique. However, in dilution experiments, the authors have shown that
simply diluting a sample concentrate lowers the level of inhibitors and allows
amplification. For instance, a 100-uL environmental sample, that had been seeded
with 100 pfu was subjected to RT-PCR and failed to show any DNA amplification;
the same sample diluted 10 times and 100 times showed increasing amplification
with each dilution.
Positive and Negative Controls for PCR Assays

Two different types of positive control reactions were used in this study.
First, to determine whether a sample could be assayed by PCR, each sample was
assayed after the addition of either (1) 10 pfu of poliovirus or hepatitis A virus, or
(2) 10 TCID50 of rotavirus. The presence or absence of the correctly sized PCR
product following the reaction demonstrated whether the sample still contained
excessive amounts of inhibitory substances. The other type of positive control, the
"reagent positive control," consisted of 10 pfu or 10 TCID50 of virus seeded into
sterile, nuclease-free water and then subjected to PCR. One reagent positive control
was performed with each set of sample assays, usually 10 to 30 reactions. The
presence of the correctly sized PCR product confirmed that the reaction was
properly set up and executed. A lack of a PCR product suggested a problem with
technique or a reaction component, in which case the associated samples were
reassayed.
Each set of sample assays also included a negative control. This reaction
was identical to the reagent positive control except that the virus was excluded. The
purpose of this control reaction was to ensure the lack of virus or PCR product
contamination of reagents. One negative control reaction was performed with each
set of sample assays, usually 10 to 30 reactions. If a negative control reaction
resulted in the presence of a PCR product, the associated sample reactions were
reassayed.
Confirmation
The visualization of a PCR product on an ethidium-stained gel confirms
only that the PCR reaction succeeded at amplifying some DNA, not necessarily the
DNA sequence intended. It is possible especially if one is using environmental
samples that may contain bacterial, algal, or eukaryotic DNA that the PCR
product visualized could be similar in size to the expected product but composed of
a different sequence. The possibility of this occurrence can be reduced through
careful selection of the PCR primers, but the use of a confirmation procedure is
needed to report success or failure of the assay reliably. The confirmation process,
as described here, also greatly increases the sensitivity of PCR product detection.
One to ten nanograms of DNA can be visualized when stained with ethidium
bromide and exposed to ultraviolet light, whereas as little as 0.1 pg of DNA can be
detected when DNA is hybridized to a radioactive complementary probe an
Discussion 45
increase in sensitivity of 10,000 to 100,000 times (Sambrook, Fritsch, and Maniatis

1989). The confirmation process used in this report utilized a hybridization probe:
a strand of DNA exactly complementing the DNA expected in the PCR product and
labeled with a radioactive substance. When the correct PCR product has been
generated in a reaction, the matching probe will adhere to and allow for the
confirmation of the expected PCR product. If the wrong sequence has been
amplified in the PCR reaction, the probe will fail to adhere to the product, allowing
the researcher to confirm the absence of the targeted PCR product.
Statistical Analyses___________________
Based on the statistical analyses for the 150 samples, the authors did not see
a significant correlation between any of the measured water quality parameters and
enterovirus occurrence for either RT-PCR or cell culture assays. The results of this
project do not support reports showing a high correlation between the presence of
F-specific RNA bacteriophages and enteric viruses in fresh water. However, sample
collection and processing for bacteriophage analysis were included as part of the
enterovirus detection methodology. The adsorption-elution protocol, using a 1MDS
filter and beef extract elution at pH 9.5, has been fully optimized for the maximum
recovery of human enteric viruses. Despite a good recovery for enteric viruses, this
method has not been fully characterized for the maximum recovery of bacterioph
ages from water sources. Therefore, additional research is needed to optimize the
detection methodology for bacteriophages in groundwater samples.
Sample Inhibition of RT-PCR______________

Several samples assayed by PCR resisted amplification when seeded with
the appropriate virus. Many of the same samples could be assayed by PCR when
steps were taken to neutralize inhibitors and isolate viruses from the sample. Some
samples showed amplification after the initial phenol:chloroform and Sephadex
treatment previously described, whereas other samples required a second PCR in
which a semi-nested primer (a third primer situated between the initial two primers)
was used. Interestingly, several samples that resisted amplification with the primers
specific to enterovirus were amplifiable when seeded with rotavirus and assayed
using primers specific to rotavirus. This would seem to indicate that inhibition of
the reaction may be associated with the annealing of the primers to the template,
rather than with the action of the reaction enzymes. It is possible that the use of
different primers, or the use of more than two primers in a reaction, may further
enhance the detection of viruses.
Differential Recovery of Infectious Virus,

Heat-Inactivated Virus, and RNA____________
The results of the recovery efficiency tests using infectious virus, heat-
inactivated virus, and RNA suggest that a positive RT-PCR assay is most likely the
result of amplification of intact virus particles rather than "naked" RNA in the
sample. This result is expected, in that isolated RNA in the environment is more
subject to degradation than the protein-encapsulated virus particle. The lower
recovery of heat-inactivated viruses compared with infectious viruses was not
expected. The reason for the lower recovery is not known but may be related to
changes in viral surface proteins resulting in charge neutralization or disruption of
the virus capsule. Either of these phenomena could result in less capture of virus
particles by the positively charged 1MDS filter.
PCR Assays Compared With Ceil Culture Assays

The use of cell culture for virus detection differs significantly from the PCR
assay for viruses in several ways. However, it may be expected that the results of
PCR and cell culture analyses of water samples will correlate well.
The minimum detection level of viruses in any sample by cell culture is, by
definition, 1 pfu a quantity of virus that may range from just a few particles to
many more at least some of which must be infectious. When a sample tests
positive for viral infectivity by cell culture, the infectious agent is not necessarily
known. The BGM cell line, routinely used for enterovirus assays, is also susceptible
to infection by reoviruses (such as rotavirus), a pathogen often present in environ
mental samples in numbers greater than enterovirus (Puigetal. 1994). Additionally,
cell culture protocols have yet to be developed for all viruses known to infect
humans. Norwalk virus, for instance, has yet to be successfully grown in cell
cultures, and therefore environmental samples cannot be assayed for this pathogen.
Finally, since each environmental sample is unique, little is known of what possible
components of the sample may inhibit the viral infectivity of cells in culture.
However, cell culture does offer the advantages of identifying a viral pathogen as
infectious and of being widely accepted as the standard method for viral detection.
Conversely, RT-PCR is a potentially much more sensitive assay technique
for virus detection, in that it allows one to detect as little as a single molecule of
RNA. The technique has often been used to detect less than 1 pfu of a virus, and the
viruses may be either infectious or noninfectious. Also, there is the possibility that
"naked" viral RNA (RNA without the protein coat) could be detected in the assay.
However, the results presented in Table 5.4 (p. 37) indicate that RT-PCR assays
detect intact virus particles, not naked RNA in the sample. The disadvantages of
PCR are (1) the possibility of the reaction being inhibited when environmental
samples are used, and (2) the inability to easily confirm or deny the infectivity of a
viral pathogen when detected. These two different approaches to viral detection
differ significantly in capabilities and limitations, and it may not be possible to fully
compare the results of both assays on the same set of samples.
The two techniques also differ in their time and cost requirements. Most cell
culture protocols (including the proposed Information Collection Rule procedure)
call fora 14-day initial passage and a 14-day second passage of the sample on cells,
followed by a 7-day confirmation passage of putative positive samples. To test for
different viruses, multiple cell lines must be maintained, different growth media
must be purchased and stored, and different protocols must be followed. The cost
Discussion 47
of a cell culture assay of one sample, as calculated in the authors' lab, is approxi
mately $625. An RT-PCR virus assay of one water sample can easily be accom
plished in 2 to 3 days, including the confirmation phase, and costs less than $225.
This includes the cost of a large-volume sample collection using a 1MDS filter,
elution, and concentration. However, an amplification reaction (RT-PCR) assay
costs less than $20.
Given its increased sensitivity and ability to detect any intact virus particle,
PCR analysis would be expected to reveal more positive results than cell culture
analysis. Since either cell culture analysis or PCR can reveal only a "snapshot" of
the quality of the groundwater being sampled, PCR represents a desirable and rapid
initial screening tool, in that the presence of even noninfectious ornonintact viruses
would suggest that a groundwater supply was subject to contamination.
Although the detection of viral RNA does not show an infectious level of
contamination, the presence of viral RNA does suggest a source of viral contami
nation and thus the potential for health risk. The most sensitive method of detection
would be the most desirable, even in the absence of an ability to confirm the
infectivity of the sample contamination.
Appendix A
Bacterial Media Used in

Bacteriophage Assays
E. Con
Media used for growing both of the E. Coli strains consisted of the
following components:
Component Amount per liter

Tryptone 10 g
Yeast extract 1g
Glucose 1 g
NaCl 8g
CaCl2 0.22 g
Agar 15 g for bottom agar, 7 g for top agar,
0 g for liquid growth media
Solutions were autoclaved for 20 minutes at 121 .
Salmonella_______________________
Media for Salmonella WG-49 consisted of the following components:

Tryptone 10 g
Yeast extract 1 g
NaCl 8g
Agar 15 g for bottom agar, 7 g for top agar,
0 g for liquid media
49
The following filter-sterilized solutions were added after the medium just described
was autoclaved:

Kanamycin sulfate (2 mg/mL) lOmL
CaCl2 (0.3 g/mL) lOmL
Glucose (0.1 g/mL) 10 mL
Naladixic acid (0.1 g/mL) 10 mL
MgSO4 10 mL
Appendix B
SUVA Values, Samples 1-150

Sample SUVA Sample SUVA Sample SUVA Sample SUVA Sample SUVA Sample SUVA
1 26 51 0.78 76 0.32 101 0.22 126 1.52
2 27 52 0.97 77 1.79 102 4.04 127 0.80
3 28 53 7.13 78 4.50 103 0.19 128 0.88
4 29 1.54 54 1.06 79 0.83 104 2.46 129 1.27
5 30 55 7.36 80 0.41 105 1.98 130 2.46
6 31 56 0.59 81 1.70 106 3.27 131 0.60
7 32 57 5.89 82 5.45 107 0.69 132 1.18

8 33 5.27 58 4.72. 83 1.50 108 2.31 133 1.70
9 34 3.61 59 6.49 84 3.45 109 5.13 134 1.55
10 35 2.81 60 1.47 85 1.02 110 4.01 135 2.48
11 36 4.48 61 2.98 86 1.09 111 1.15 136 2.15
12 37 3.02 62 9.55 87 0.52 112 20.26 137 3.24
13 38 3.91 63 0.41 88 113 25.13 138 1.06
14 39 1.80 64 4.91 89 12.75 114 0.34 139 0.15
15 40 1.16 65 3.41 90 0.64 115 0.49 140 0.32
16 41 3.41 66 1.90 91 0.87 116 0.86 141 1.53
17 42 3.42 67 4.25 92 2.07 117 1.10 142 1.14
18 43 4.66 68 0.99 93 1.68 118 3.42 143 1.34
19 44 3.86 69 1.63 94 1.38 119 2.14 144 0.50
20 45 3.32 70 1.99 95 5.42 120 1.49 145 1.92
21 46 3.15 71 0.77 96 1.64 121 1.29 146 0.59
22 47 18.30 72 10.72 97 2.02 122 2.10 147 1.36
23 48 2.94 73 5.81 98 8.56 123 8.67 148 2.80
24 49 4.81 74 2.13 99 0.51 124 0.31 149 8.83
25 50 3.82 75 2.10 100 0.38 125 0.18 150 3.82
57
Glossary
1MDS. An electropositively charged, glass-and-cellulose medium used as a virus

collection filter. Cartridge filters are constructed using two layers of pleated
medium and are manufactered by Cuno Inc., Meriden, Conn.
amplicon. The portion of DNA that is amplified during a PCR reaction.
complementary DNA (cDNA). DNA that is synthesized using RNA as a tem

plate and the enzyme reverse transcriptase. It may subsequently be used in a
polymerase chain reaction.
cytopathic effect (CPE). Morphological changes observed in a cell culture when

the latter is infected with virus. The effect is often characteristic of the particular
virus infecting the cells.
dalton (D). A unit of mass nearly equal to that of a hydrogen atom.
DNA polymerase. The enzyme that synthesizes DNA from deoxynucleoside

triphosphates, using a single-stranded nucleic acid as a template.
eluant. The resulting beef extract-glycine mixture following extraction of a

1MDS virus collection filter.
5-prime (5'). One of the ends of a DNA or RNA strand. The 3-prime end is the
opposite end.
polymerase chain reaction (PCR). An in vitro method for the enzymatic

synthesis of specific DNA sequences, using oligonucleotide primers that hybridize
to opposite strands and flank the region of interest in the target DNA. Starting with
even trace amounts of the DNA of interest, PCR can generate millions or billions
of exact copies, thereby making analysis relatively simple.
primers. Short (20-50-base-pair) strands of DNA that are chosen for their
complementarity to the DNA of interest. Primers bind to the complementary target
DNA sequence during an amplification reaction and initiate the action of DNA
polymerase.
primer-dimer. An artifact of some PCRs, consisting of primers that have

annealed to each other and undergone some amplification. The size of the primer-
dimer is usually close to the combined size of the two primers used in the reaction.
53
reverse transcriptase. An enzyme capable of synthesizing single-stranded DNA

from RNA template.
RNase. An enzyme that degrades RNA molecules.
RNase inhibitor. An enzyme (RNasin) capable of inhibiting RNase activities.

RNasin is added to a sample to eliminate degradation of RNA template.
sample concentrate. The resulting 15-30 mL of solution following a filter

elution, flocculation, and centrifugation.
semi-nested PCR. A technique employing a second PCR amplification into

which a small portion of the first PCR product has been added. In the first PCR
reaction, the entire target DNA should be amplified, whereas in the second reaction,
if the target DNA is actually present, only a portion of the target DNA will be
amplified. If the target DNA is not present, the nested primer should fail.
Southern hybridization. A technique (named for E.M. Southern) for transfer

ring DNA in gels to nylon or nitrocellulose membranes.
3-prime (3'). One of the ends of a DNA or RNA strand. The 5-prime end is the
opposite end.
References
Abbaszadegan, M., M.S. Huber, C.P. Gerba, and I.L. Pepper. 1993. Detection of
Enteroviruses in Groundwater With the Polymerase Chain Reaction. Applied
and Environmental Microbiology, 59:1318-1324.
Abbaszadegan, M., R. Manteiga, D. Verges, E. Ibrahim, and M. LeChevallier. 1996.
Enhanced and Optimized Coagulation for Removal of Microbial
Contaminants. Paper presented at the 96th General Meeting of the American
Society for Microbiology: New Orleans, La.
Abbaszadegan, M., M.S. Huber, C.P. Gerba, and I.L. Pepper. 1997a. Detection of
Viable Giardia Cysts by Amplification of Heat Shock-Induced mRNA.
Applied and Environmental Microbiology, 63:324-328.
Abbaszadegan, M., R. Manteiga, K. Bell, and M. LeChavallier. 1997b. Enhanced
Coagulation for Removal of Microbial Contaminants. In Proc. of the 1997
AWWA Water Quality Technology Conference. Denver, Colo.: AWWA.
APHA, AWWA, and WEE (American Public Health Association, American Water
Works Association, and Water Environment Federation). 1995. Standard
Methodsfor the Examination of Water andWastewater. 9th ed. Washington,
D.C.: APHA.
Ball, J.M., P. Tian, C. Zeng, A.P. Morris, and M.K. Estes. 1996. Age-Dependent
Diarrhea Induced by a Rotaviral Nonstructural Glycoprotein. Science,
272:101-104.
Benton, W.H., and R.L. Ward. 1982. Induction of Cytopathogenicity in Mammalian
Cell Lines Challenged With Culturable Enteric Viruses and Its Enhancement
by 5-Iododeoxyuridme. Applied and Environmental Microbiology, 43:861-
868.
Brock, T.D., and M.T. Madigan. 1991. Biology of Microorganisms. 6th ed.
Englewoods Cliffs, N.J.: Prentice Hall.
Craun, G.F. 1984. Health Aspects of Groundwater Pollution. In Groundwater
Pollution Microbiology. Edited by G. Bitton and C.P. Gerba. New York:
John Wiley & Sons.
. 1988. Surface Water Supplies and Health. Jour. AWWA, 80(2):40-52.
. 1992. Waterborne Disease Outbreaks in the United States of America:
Causes and Prevention. World Health Statistics Quarterly. Rapport
Trimestriel de Statistiques Sanitaires Mondiales, 45(2-3): 192-9.
Dahling, D.R., and B .A. Wright. 1986. Optimization of the BGM Cell Line Culture
and Viral Assay Procedures for Monitoring Viruses in the Environment.
Dahling, D.R.,R.S. Safferman, andB.A. Wright. 1984. Results of a Survey of BGM
Cell Culture Practices. Environ. Int., 10:309-313.
55
DeLeon, R.,C. Shieh.R.S. Baric, andM.D. Sobsey. 1990. Detection of Enteroviruses

and Hepatitis A Virus in Environmental Samples by Gene Probes and
Poly merase Chain Reaction. In Proc. 1990AWWA Water Quality Technology
Conference. Denver, Colo.: AWWA.
Edzwald, J.K., and J.E. Van Benschoten. 1990. Aluminum Coagulation of Natural
Organic Matter. Proceedings ofthe 4th Cothenburg Symposium on Chemical
Water and Wastewater Treatment, Madrid, Spain.
Estes, M.K., E.L. Palmer, and J.F. Obijeski. 1983. Rotaviruses: A Review. Current
Topics in Microbiological Immunity, 105:123-184.
Gerba, C.P., and J.B. Rose. 1990. Viruses in Source and Drinking Water. In
Drinking Water Microbiology. Edited by G.A. McFeters. New York:
Spring-Verlag.
Gouvea, V., R.I. Glass, P. Woods, K. Taniguchi, H.F. Clark, B. Forrester, and Z-Y.
Fang. 1990. Polymerase Chain Reaction Amplification and Typing of
Rotavirus Nucleic Acid for Stool Specimens. Journal of Clinical
Microbiology, 28:276-282.
Havelaar, A.H., M. Van Olphen, and Y.C. Drost. 1993. F-Specific RNA
Bacteriophage Are Adequate Model Organisms for Enteric Viruses in
Fresh Water. Applied and Environmental Microbiology, 59:2956-2962.
Hyypia, T., P. Auvinen, and M. Maaronen. 1989. Polymerase Chain Reaction for the
Human Picornaviruses. Journal of General Virology, 70:3261-3268.
Jofre, J., E. Olle, F. Ribas, A. Vidal, and F. Lucena. 1995. Potential Usefulness of
Bacteriophages That Infect Bacteriodes fragilis as Model Organisms for
Monitoring Virus Removal in Drinking Water Treatment Plants. Applied
and Environmental Microbiology, 6 1:3227-3231.
Kapikian, A.Z., and R.M. Chanock. 1990. Norwalk Group of Viruses. In Virology.
2nd ed. Edited by B.N. Fields. New York: Raven Press.
Keswick, B.H., C.P. Gerba, S.L. Secor, and I. Cech. 1982. Survival of Enteric
Viruses and Indicator Bacteria in Groundwater. Journal of Environmental
Science and Health, A17:903-912.
Keswick, B.H., C.P. Gerba, H.L. DuPont, and J.B. Rose. 1984. Detection of
Enteroviruses in Treated Drinking Water. Applied and Environmental
Lippy, E.G., and S.C. Waltrip. 1984. Waterborne Disease Outbreaks, 1946-1980:
A Thirty-Five-Year Perspective. Jour. AWWA, 72(2):60-67.
Melnick, J.L. 1990. Enteroviruses: Polioviruses, Coxsackieviruses, Echoviruses
and Newer Enteroviruses. In Virology. 2nd ed. Edited by B.N. Fields. New
York: Raven Press.
Mullis, K.B., and F.A. Faloona. 1987. Specific Synthesis of DNA in Vitro via a
Polymerase-Catalyzed Chain Reaction. Methods in Enzymology, 155:335-
351.
Nakagomi, O., Y. Isegawa, R.L. Ward, D.R. Knowlton, E. Kaga, T. Nakagomi, and
S. Ueda. 1994. Naturally Occurring Dual Infection With Human and
Bovine Rotaviruses as Suggested by the Recovery of G1P8 and G1P5
Rotaviruses From a Single Patient. Archives of Virology, 137:381-388.
Payment, P. 1981. Isolation of Viruses From Drinking Water at the Pont-Viau Water
Treatment Plant. Canadian Journal of Microbiology, 21:411-420.
References 57
Pfeffer, U., E. Fecarotta, and G. Vidali. 1995. Efficient One-Tube RT-PCR

Amplification of Rare Transcripts Using Short, Sequence-Specific Reverse
Transcription Primers. Biotechniques, 18(2):204-206.
Pillai, S.D, K.L. Josephson, R.L. Baily, C.P. Gerba, and I.L. Pepper. 1991. Rapid
Method for Processing Soil Samples for Polymerase Chain Reaction
Amplification of Specific Gene Sequences. Applied and Environmental
Puig, M., J. Jofre, F. Lucena, A. Allard, G. Wadell, and R. Girones. 1994. Detection
of Adenoviruses and Enteroviruses in Polluted Waters by Nested PCR
Amplification. Applied and Environmental Microbiology, 60:2963-2970.
Rotbart, H.A. 1990. Enzymatic RNA Amplification of the Enteroviruses. Journal
of Clinical Microbiology, 28:438^142.
Saiki, R.K., D.H. Gelfand, S. Stoffel, S.J. Scharf, R. Higuchi, G.T. Horn, K.B.
Mullis, and H.A. Erlich. 1988. Primer-Directed Enzymatic Amplification
of DNA With a Thermostable DNA Polymerase. Science, 239:487-494.
Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory
Manual. 2nd ed. Plainview, N.Y.: Cold Spring Harbor Laboratory Press.
Smith, E.M., and C.P. Gerba. 1982. Laboratory Methods for the Growth and
Detection of Animal Viruses. In Methods in Environmental Virology.
Edited by C.P. Gerba and S.M. Goyal. New York: Marcel Dekker.
Sobsey, M.D. 1990. Simple Membrane Filter Method to Concentrate and Enumerate
Male-Specific RNA Coliphages. Jour. AWWA, 82(9): 52-59.
Sobsey, M.D., P.A. Shields, F.S. Hauchman, A.L. Davis, V.A. Rullman, and A.
Bosch. 1988. Survival and Persistence of Hepatitis A Virus in Environmental
Samples. In Viral Hepatitis and Liver Disease. Edited by A.J. Zuckerman.
New York: Alan R. Liss, Inc.
Southern, E.M. 1975. Detection of Specific Sequences Among DNA Fragments
Separated by Gel Electrophoresis. Journal of Molecular Biology, 98:503.
Stryer, L. 1988. Biochemistry. 3rd ed. New York: W.H. Freeman Co.
Tsai, Y.-L., and B.H. Olson. 1992. Rapid Method for Separation of Bacterial DNA
From Humic Substances in Sediments for Polymerase Chain Reaction.
USEPA (United States Environmental Protection Agency). 1990. Methods for the
Investigation and Prevention of Waterborne Disease Outbreaks. EPA/600/
l-90/005a. Washington, D.C.: USEPA, Office of Research and Development.
. 1993. Methods for the Determination of Inorganic Substances in
Environmental Samples. EPA-600/R-93/100. Cincinnati, Ohio: USEPA.
. 1994. Methodsfor the Determination ofMetals in Environmental Samples-
Supplement 1. EPA-600/R-94/111. Cincinnati, Ohio: USEPA.
USGS (United States Geological Survey). 1990. Estimated Use of Water in the
United States in 1990. U.S. Geological Survey Circular 1081. Denver,
Colo.: USGS.
Wayne, S.B., R.R. Pierce, and H.A. Perlman. 1993. Estimated Use of Water in the
United States in 1990. U.S. Geological Survey Circular 1081. Denver,
Colo.: U.S. Geological Survey.
Abbreviations and Acronyms
A adenine HPLC high-performance liquid

ATCC American Type Culture Collection chromatography
AWWA American Water Works Association
AWWARF American Water Works Association ICR Information Collection Rule
Research Foundation in. inch
BGM Buffalo Green monkey L liter

bp base pair
BSA bovine serum albumin M molar
m meter
C cytosine mg milligram
C degrees Celsius Mg++ magnesium ion
Ci curie jag microgram
cm centimeter uJ microjoule
CPE cytopathic effect jaL microliter
CxT disinfectant concentration times \\M micromolar
contact time min minute
cDNA complementary DNA mL milliliter
mM millimolar
mmol millimole
D dalton
MPN most probable number
ddH2O double distilled water
MS-2 phage F-specific coliphage MS-2
DMSO dimethyl sulfoxide
DNA deoxyribonucleic acid
n number of samples
dNTP deoxynucleotide triphosphate
N2 nitrogen gas
DOC dissolved organic carbon
nm nanometer
DTT dithiothreitol
NTR nontranslated region
ntu nephelometric turbidity unit
ESWTR Enhanced Surface Water Treatment
Rule 32P phosphorus-32, radioactive form
PI, P2, P3 primer 1, primer 2, primer 3
F degrees Fahrenheit PAC Project Advisory Committee
ft feet PBS phosphate buffered saline
PCR polymerase chain reaction
g gravity force; gram pfu plaque-forming unit
G guanine pg picogram
gal gallon pH negative log of hydrogen ion
gpm gallons per minute concentration (measure of acidity
GWDR Groundwater Disinfection Rule or basicity)
HAV hepatitis A virus pmol picomole
59
RNA ribonucleic acid SUVA specific ultraviolet absorbance

RT reverse transcription or reverse
transcriptase T thymine
RT-PCR reverse transcription followed by TCID50 tissue culture infectious dose
polymerase chain reaction resulting in the development of
CPE in 50 percent of cultures
s second TOC total organic carbon
SDS sodium dodecyl sulfate
SRSV small round structured virus USEPA United States Environmental
SSC sodium chloride-sodium citrate Protection Agency
buffer UV ultraviolet
SSS primer short, sequence-specific primer (a UV-254 ultraviolet light of 254-nm
type of PCR primer) wavelength
American Waterworks Association
RESEARCH FOUNDATION
6666 W. Quincy Avenue, Denver, CO 80235
(303)347-6100
1P-3C-90740-5/98-CG ISBN 0-89867-934-6

AWWA Appl Virus Detect Tech

Enviado por

Dados do documento

Direitos autorais

Formatos disponíveis

Compartilhar este documento

Compartilhar ou incorporar documento

Opções de compartilhamento

Você considera este documento útil?

Este conteúdo é inapropriado?

Direitos autorais:

Formatos disponíveis

AWWA Appl Virus Detect Tech

Enviado por

Direitos autorais:

Formatos disponíveis

American Water Works Association

This study was funded by the AWWA Research Foundation (AWWARF).

Library of Congress Cataloging-in-Publication Data

ISBN 0-89867-934-6 Printed on recycled paper.

List of Tables ................................................ ix

List of Figures ................................................. xi

Foreword .................................................... xiii

Executive Summary ............................................ xvii

Chapter 1 Introduction ...................................... 1

Chapter 2 Water-Sampling Program ............................ 9

Chapter 3 Methods Development................................ 13

Chapter 4 Materials and Methods .............................. 21

Chapter 5 Results ............................................ 33

Chapter 6 Discussion ......................................... 43

Appendix A: Bacterial Media Used in Bacteriophage Assays ........ 49

Appendix B: Suva Values, Samples 1-150 . ....................... 51

List of Abbreviations and Acronyms ............................. 59

5.1 Summary of viral analyses 35

1.1 Detection of enteroviruses by PCR 5

2.1 Sampling kit 10

3.1 Ethidium-stained gel from poliovirus-seeded water

4.1 Cell culture assay 23

5.1 Agarose gel of recovery of poliovirus by RT-PCR experiments 37

The AWWA Research Foundation is a nonprofit corporation that is

of recent advances in molecular techniques (e.g., polymerase chain reaction, or

George W. Johnstone James F. Manwaring, P.E.

G. Shay Fout, US Environmental Protection Agency,

In addition, the help of staff at the American Water Works Service

Human enteric viruses may directly or indirectly contaminate water in

The primary objective of this research project was to apply advanced

Optimize PCR methodology for the detection of low concentrations

1. Viruses were detected in groundwater sources by both cell culture

analysis. The sample collection procedure and the elution procedure

Genomic sequence databases are rapidly expanding for all classes of

The Polymerase Chain Reaction____________

* dNTPs refer to an equimolar mixture of deoxyadenosine triphosphate (dATP),

Cell Culture Methods__________________

Detection of Entero viruses by the

1 Sample Preparation and Lysis

3 DNA Amplification (PCR) cDNA is amplified through clenaluraiion,

The PCR products

Prepared by: Jeffrey Brendecke

The Groundwater Disinfection Rule

Approach and Experimental Design__________

Figure 2.1 Sampling kit

Filter housing containing a 1MDS filter

Water-Sampling Training Video_____________

1. Water sampling started in March 1994 and ended in November

Samplers measured water temperature and pH at the time of sampling at the

Optimization of RT-PCR involved the following steps:

The following paragraphs summarize the experiments conducted to arrive

Reducing Sample Concentrate Volume

Pre-PCR Concentrate Treatment___________

Optimization of Reaction Enzymes__________

Several reactions in which the amount of reverse transcriptase was altered

Key: Lane M 100-base-pair DMA marker

Reaction Conditions and Other Reagents_______

Short, Sequence-Specific Primers

Confirmation and Control________________

Under suboptimal conditions, DNA sequences different from the desired

AGCATCGATC (primer !)->

Treatment of Samples Highly Resistant to

Materials and Methods

Virus Flocculation and Reconcentration________