Você está na página 1de 227

DOCÊNCIA EM

SAÚDE
BIOTECNOLOGIA
Copyright © Portal Educação

2013 – Portal Educação


Todos os direitos reservados

R: Sete de setembro, 1686 – Centro – CEP: 79002-130


Telematrículas e Teleatendimento: 0800 707 4520
1
Internacional: +55 (67) 3303-4520
atendimento@portaleducacao.com.br – Campo Grande-MS
Endereço Internet: http://www.portaleducacao.com.br

Dados Internacionais de Catalogação na Publicação - Brasil


Triagem Organização LTDA ME
Bibliotecário responsável: Rodrigo Pereira CRB 1/2167
Portal Educação

P842b Biotecnologia / Portal Educação. - Campo Grande: Portal Educação, 2013.

211p. : il.

Inclui bibliografia
ISBN 978-85-8241-804-8

1.Biotecnologia. I. Portal Educação. II. Título.

CDD 660.6
SUMÁRIO

1 HISTÓRIA DA BIOTECNOLOGIA E REVISÃO DE GENÉTICA ...............................................5


1.1 DEFINIÇÃO E HISTÓRIA ...........................................................................................................5
2 REVISÃO DE GENÉTICA ..........................................................................................................8 2
2.1 ESTRUTURA DO DNA ...............................................................................................................8
2.2 REPLICAÇÃO DO DNA.............................................................................................................13
2.3 MECANISMOS DE REPLICAÇÃO DO DNA .............................................................................16
2.4 TRANSCRIÇÃO .......................................................................................................................19
2.4.1 Estrutura do RNA ......................................................................................................................19
2.4.2 RNA como molécula mensageira ..............................................................................................21
2.5 TRANSCRIÇÃO DO DNA..........................................................................................................22
2.5.1 Mecanismos envolvidos na transcrição gênica ..........................................................................24
2.6 TRADUÇÃO ..............................................................................................................................35
2.6.1 Código Genético ........................................................................................................................35
2.7 SÍNTESE PROTEICA ................................................................................................................39
2.7.1 Ribossomos ...............................................................................................................................39
2.7.2 Iniciação da tradução em procariotos ........................................................................................41
2.7.3 Alongamento da síntese proteica em procariotos ......................................................................43
2.7.4 Tradução em eucariotos ............................................................................................................44
2.8 PROCESSAMENTO PROTEICO ..............................................................................................46
2.9 REGULAÇÃO DA TRANSCRIÇÃO ...........................................................................................47
2.9.1 Regulação da transcrição em procariotos .................................................................................47
2.9.2 Regulação genética em eucariotos............................................................................................52
3 A TECNOLOGIA DO DNA RECOMBINANTE ..........................................................................59
3.1 ISOLAMENTO DE GENES........................................................................................................62
3.1.1 Extração de DNA ......................................................................................................................62
3.1.2 Enzimas de restrição .................................................................................................................64
3.1.3 Ligação enzimática ....................................................................................................................68
3.1.4 Diferença estrutural ente genes eucariotos e procariotos..........................................................70
3.1.5 Obtenção do inserto ..................................................................................................................70
3.2 VETORES DE CLONAGEM ......................................................................................................84
3.2.1 Plasmídeos ................................................................................................................................84
3.2.2 Bacteriófagos.............................................................................................................................80
3.2.3 Cosmideos.................................................................................................................................91
3.2.4 BAC E YAC ...............................................................................................................................93
3.2.5 Vetores de expressão ................................................................................................................96 3
3.3 TRANSFORMAÇÃO DA CÉLULA HOSPEDEIRA.....................................................................96
3.4 AMPLIFICAÇÃO DO DNA RECOMBINANTE ...........................................................................99
3.5 SELEÇÃO DE CLONES TRANSFORMADOS COM O DNA HÍBRIDO ....................................100
3.5.1 Seleção por hibridização de DNA .............................................................................................102
3.5.2 Busca por atividade imunológica ..............................................................................................104
3.5.3 Busca por atividade proteica ....................................................................................................106
3.6 CONFIRMAÇÃO DO INSERTO ...............................................................................................107
4 EXPRESSÃO GÊNICA EM ORGANISMOS PROCARIOTOS E EUCARIOTOS.....................109
4.1 VETORES DE EXPRESSÃO ..................................................................................................109
4.2 SEQUÊNCIAS PROMOTORAS ...............................................................................................111
4.2.1 Isolamento de sequências promotoras .....................................................................................112
4.2.2 Promotores induzíveis ..............................................................................................................116
4.3 INTEGRAÇÃO DO DNA NO CROMOSSOMO DA CÉLULA HOSPEDEIRA............................126
4.4 EFICIÊNCIA DE TRADUÇÃO ..................................................................................................128
4.5 ESTABILIDADE DE PROTEÍNAS ............................................................................................130
4.5.1 Espécie hospedeira ..................................................................................................................130
4.5.2 Aumento da estabilidade proteica pela modificação da sua estrutura ......................................131
4.6 PROTEÍNAS DE FUSÃO..........................................................................................................132
4.7 AUMENTO DA SECREÇÃO DE PROTEÍNAS RECOMBINANTES .........................................133
4.8 EXPRESSÃO EM SISTEMAS EUCARIOTOS .........................................................................136
4.8.1 Sistemas de expressão eucariotos ...........................................................................................138
5 APLICAÇÕES DA BIOTECNOLOGIA ....................................................................................157
5.1 PROJETOS GENOMA .............................................................................................................157
5.2 TERAPIA GÊNICA ...................................................................................................................158
5.3 NOVAS VACINAS ....................................................................................................................159
5.4 NOVOS PRODUTOS ...............................................................................................................161
5.5 NOVOS KITS DE DIAGNÓSTICO ............................................................................................161
5.6 SELEÇÃO ASSISTIDA COM TESTES DE DNA E CLONAGEM..............................................164
5.7 ANIMAIS TRANSGÊNICOS .....................................................................................................166
5.7.1 Animais resistentes a doenças .................................................................................................167
5.7.2 Animais transgênicos como biorreatores ..................................................................................169
5.7.3 Animais transgênicos e as características de interesse econômico .........................................171 4
5.7.4 Animais transgênicos na pesquisa biomédica e de xenotransplante ........................................172
5.8 ALIMENTOS GENETICAMENTE MODIFICADOS ...................................................................174
5.9 BIORREMEDIAÇÃO .................................................................................................................176
6 INTRODUÇÃO À BIOINFORMÁTICA ....................................................................................178
6.1 BANCO DE DADOS .................................................................................................................179
6.1.1 Bancos de dados públicos ........................................................................................................180
6.2 ALINHAMENTO DE SEQUÊNCIAS ........................................................................................181
6.3 A BIOINFORMÁTICA E OS PROJETOS GENOMA E TRANSCRIPTOMA .............................182
6.4 BASE CALLING ........................................................................................................................183
6.5 MASCARAMENTO DE VETORES ...........................................................................................184
6.6 AGRUPAMENTO DE SEQUÊNCIAS .......................................................................................189
6.7 ANOTAÇÃO GÊNICA ...............................................................................................................193
6.7.1 BLAST ......................................................................................................................................194
6.8 A BIOINFORMÁTICA E A ANÁLISE DA ESTRUTURA PROTEICA.........................................211
6.8.1 Análise da estrutura primária de proteínas ...............................................................................211
6.8.2 Análise da estrutura secundária ...............................................................................................219
6.8.3 Modelagem molecular ..............................................................................................................222
6.9 MAPEAMENTO DE EPITOPOS ...................................................................................................224
6.10 MÉTODOS EM FILOGENIA MOLECULAR ..............................................................................225
REFERÊNCIAS BIBLIOGRÁFICAS ..................................................................................................228
1 HISTÓRIA DA BIOTECNOLOGIA E REVISÃO DE GENÉTICA

1.1 DEFINIÇÃO E HISTÓRIA

5
O termo biotecnologia pode ser definido como a aplicação de princípios científicos e
tecnológicos no processamento de materiais por agentes biológicos, visando à produção de
serviços e mercadorias. Nessa visão ampla, a biotecnologia tradicional é uma tecnologia
utilizada desde os primeiros profissionais que utilizaram microrganismos em processos
fermentativos para a geração de iogurtes e cervejas, por exemplo.
No início da década de 70, a biotecnologia tradicional era uma disciplina confinada a
departamentos de engenharia química e a programas de microbiologia. Em 1919, o termo
“biotecnologia” foi criado pelo engenheiro húngaro Karl Ereky. Esse pesquisador utilizou o termo
para descrever seu experimento que visava à produção em larga escala de suínos alimentados
com beterrabas cultivadas com micro-organismos. Karl então definiu biotecnologia como todas
as linhas de pesquisa que envolve a geração de produtos a partir de matérias-primas que
receberam a adição de materiais vivos. Contudo, essa terminologia permaneceu bastante
ambígua entre os cientistas e, somente em 1961, o termo foi então associado com o estudo da
produção industrial de bens e serviços por procedimentos que utilizam organismos, sistemas ou
processos biológicos. Isto se deve ao microbiologista sueco Carl Gören Hedén, que sugeriu a
mudança de título de um jornal de publicação científica na área de microbiologia aplicada e
fermentação industrial, intitulado de “Jornal de Microbiologia e Engenharia Bioquímica e
Tecnologia” para “Biotecnologia e Bioengenharia”.
A biotecnologia tradicional foca em três aspectos principais: (i) preparação da matéria-
prima a ser utilizada como fonte para os microrganismos; (ii) o processo de fermentação do
material em biorreatores, obtendo-se a biotransformação e produção do material desejado; e (iii)
a purificação do produto final.
A obtenção de um determinado produto em escalas industriais é o objetivo principal da
biotecnologia. Então, muitas pesquisas foram realizadas visando melhorar e aperfeiçoar os três
aspectos envolvidos no desenvolvimento da tecnologia. Com esta finalidade, foram realizados
vários investimentos em desenhos de novos biorreatores e no controle e monitoramento dos
processos fermentativos. Apesar de se ter obtido um aumento de produção significativo, a
otimização do processo de biotransformação ainda permanecia aquém do desejado.
As linhagens de microrganismos capazes de sintetizar os produtos de interesse o
faziam em níveis subótimos para uma escala industrial. Mutações aleatórias induzidas por
mutágenos químicos e radiação ultravioleta algumas vezes eram capazes de aumentar os níveis
de produção. Contudo, esse alcance é frequentemente limitado. Normalmente, a indução de 6
mutações afeta não só a característica desejada, como outras importantes para o metabolismo
celular. Por exemplo, mesmo que o microrganismo produza em maiores quantidades o produto
desejado, a mutação pode afetar uma função biológica fundamental, resultando em um
crescimento bacteriano mais lento. Além deste efeito indesejado, o processo de gerar linhagens
é demorado e há a necessidade de selecionar e testar muitas descendentes até que se cheguem
à amostra esperada, aumentado os custos. Outra desvantagem é que essa mutação só é capaz
de aumentar a produção de um bem de interesse que o microrganismo já seja capaz de produzir.
Assim, há a necessidade de pesquisas com diversos outros microrganismos para descobrir quais
proteínas eles expressam.
A revolução da biotecnologia tradicional veio com o desenvolvimento da tecnologia do
DNA recombinante, o que envolve um conhecimento multidisciplinar (Fig. 1). Além da sabedoria
de microbiologistas e engenheiros químicos, a nível industrial, a tecnologia do DNA
recombinante programou as descobertas advindas da biologia molecular e genética. Esta união
passou então a ser denominada biotecnologia molecular.
FIGURA 1

Figura 1: Conhecimento multidisciplinar envolvido com a biotecnologia molecular.

O aprimoramento da biotecnologia tradicional em biotecnologia molecular se deve a


avanços em conhecimentos de diversas áreas, como a engenharia química, a bioquímica, a
biologia molecular, a genética, a microbiologia e a biologia celular.
A biotecnologia molecular abriu a perspectiva de mudanças rápidas. Atualmente, as
novas técnicas permitem uma alta produção e a criação de novas fábricas biológicas em menor
tempo, de forma mais eficiente e com menor custo. A expectativa de resultados promissores,
com a capacidade de sintetizar importantes produtos comerciais é um campo fascinante.
Apesar de a biotecnologia molecular ser uma ciência multidisciplinar, a genética é uma
disciplina fundamental e que merece um grande destaque entre as outras. Ela é tão importante
para o desenvolvimento da biotecnologia que alguns autores de livros mais recentes chegam até
mesmo definir biotecnologia como “tudo da genética que se aplica comercialmente”. Por isso,
este curso será iniciado com uma revisão básica de genética.
2 REVISÃO DE GENÉTICA

2.1 ESTRUTURA DO DNA

8
Muitas descobertas na área de genética foram sendo feitas e acumuladas para
responder a uma pergunta inicial: como ocorria a transmissão da informação genética entre as
gerações e como esta era armazenada. Para a biotecnologia, a mesma pergunta pode ser feita
de outra forma: como o conhecimento da informação genética pode ser aplicado para a geração
de bem comerciais. Nos anos de 1950, os dados a respeito deste assunto eram:
1. Os genes são os fatores hereditários associados a características fenotípicas;
contudo, sua natureza física não era conhecida;
2. A teoria de que um gene corresponde a uma enzima sugeria que eles
codificavam a informação necessária para a síntese proteica;
3. Sabia-se que os genes faziam parte dos cromossomos;
4. Os cromossomos eram constituídos por DNA e proteínas;
5. Em 1958, experimentos com a bactéria Streptococcus pneumoniae feitos por
Frederick Griffth e Oswald Avery, demonstraram que a bactéria expressava um fenótipo diferente
da linhagem selvagem após capturarem DNA derivado de outra amostra. Estes pesquisadores
então apontaram que o DNA era o material genético.
Em 1953, James Watson e Francis Crick postularam o modelo da estrutura do DNA.
Embora não se conhecesse ao certo como era esta estrutura, os elementos básicos constituintes
da molécula de DNA eram conhecidos. Estudos de DNA purificado e parcialmente fragmentado
mostraram que esta molécula é composta por quatro estruturas básicas, os nucleotídeos. Estas
quatro subunidades são idênticas em estrutura, diferindo apenas em sua composição de bases.
Cada nucleotídeo contém um grupo fosfato, um açúcar (a desoxirribose) e uma base
nitrogenada. Estas podem ser de quatro tipos diferentes: adenina (A), guanina (G), citosina (C) e
timina (T) (Fig. 2). Adenina e guanina são similares em sua estrutura e são conhecidas como as
bases purínicas. O mesmo ocorre com as bases citosina e timina, que são as pirimidinas. Na
ausência do grupo fosfato, com o açúcar associado à base nitrogenada, a estrutura básica é
então denominada nucleosídeo.
FIGURA 2: ESTRUTURA QUÍMICA DAS QUATRO BASES NITROGENADAS

Deoxiadenilato (dAMP) Deoxiguanilato (dGMP)

Deoxitimidilato (dTMP) Deoxicitidilato (dCMP)

Os nomes completos dos nucleotídeos são: desoxiadenosina 5´ monofosfato


(desoxiadenilato, dAMP), desoxiguanosina 5´ monofosfato (dGMP), desoxitimidina 5´
monofosfato (dTMP) e desoxicitidina 5´ monofosfato (dCMP). Contudo, por conveniências as
bases são denominadas simplesmente pelas abreviações A, G, T e C, respectivamente.
Após a descoberta de que o DNA desempenha um papel central na hereditariedade,
cientistas então passaram a pesquisar e a propor modelos sobre a estrutura desta molécula. No
decorrer de sua história, dois experimentos são reconhecidos como cruciais para o
estabelecimento da estrutura aceita atualmente.
Rosalina Franklin e Maurice Wilkins realizaram uma difração de raios X da estrutura do
DNA. Os resultados destes experimentos sugeriram que o DNA é uma molécula longa e fina
composta por duas fitas similares que correm ao longo da molécula de maneira paralela a outra.
Os dados ainda demonstraram que a molécula é helicoidal.
Outro experimento trouxe dados complementares aos obtidos por Franklin e Wilkins.
Após anos de pesquisa com DNA de diferentes microrganismos, Erwin Chargaff juntou suas
informações e fez hipóteses a respeito da quantidade em que os componentes do DNA estão
presentes na estrutura: 10
I. A quantidade total de nucleotídeos compostos por pirimidinas (T + C) sempre
equivale aos daqueles compostos por purinas (A + G);
II. A quantidade de T sempre equivale à quantidade de A, sendo que o mesmo se
faz verdadeiro para a proporção entre C e G. Por outro lado, a quantidade de A + T não é
necessariamente igual à de G + C. Esta variação é característica de cada micro-organismo que
esteja sendo utilizado como modelo experimental.
Em 1953, Watson e Crick analisaram estes dois experimentos prévios e juntaram as
informações por eles geradas. Então, esses pesquisadores propuseram o modelo da dupla
hélice de DNA (Fig. 3). Neste, cada fita que a compõe é formada por uma cadeia de
nucleotídeos unidos por ligações fosfodiéster. A figura também demonstra que o empilhamento
dos pares de bases na dupla hélice resulta na formação de dois sulcos na sequência ose-fosfato:
o sulco maior e o sulco menor.
FIGURA 3: MODELO DA DUPLA HÉLICE DO DNA.

11

A figura é um modelo simplificado da estrutura helicoidal do DNA, mostrando o sulco maior e o sulco
menor.

A cuidadosa análise entre as proporções de bases na molécula de DNA feita por


Chargaff foi a base da hipótese gerada por Watson e Crick para explicar como as duas fitas que
correm paralelamente uma a outra são mantidas juntas. Esta união se dá por meio de pontes de
hidrogênio entre pares de bases. Uma regra foi estabelecida para que estas interações ocorram:
cada par de bases é composto por uma purina e por uma pirimidina. Ainda considerando o
experimento de Chargaff, foi proposto que o pareamento se dava de G com C e de A com T.
Estas ligações entre as pontes de hidrogênio estão representadas na Fig. 4.
A Fig. 4 ainda demonstra que as fitas que compõem a dupla hélice correm em direções
opostas: uma se inicia no grupo fostato (5´) e termina no grupo OH (3´). A outra fita, por sua vez,
corre no sentido inverso, de 3 para 5´. Por esta característica, afirma-se que o pareamento entre
as fitas de DNA é antiparalelo.
FIGURA 4: DUPLA HÉLICE DO DNA EM FORMA PLANA

12

Cada fita é formada pela união de nucleotídeos, sendo que a dupla hélice é constituída
pela união entre duas fitas de DNA que se orientam em sentidos opostos: uma corre no sentido
3´ - 5´ e a outra, de 5´ - 3´. Para o pareamento de bases, cada par contém uma base purínica
(adenina – A – ou guanina – G), e uma base pirimidínica (timina – T – ou citosina – C), ligadas
por ponte de hidrogênio. As setas amplificam e demonstram com mais detalhes como ocorre o
pareamento entre as bases. Basicamente, adenina e timina se pareiam pela formação de duas
pontes de hidrogênio; já a citosina e guanina, ligam-se por três pontes de hidrogênio. As pontes
de hidrogênio estão representadas por três barras em azul. (Figura modificada de Griffiths et al.,
2002).
As relações entre as bases durante o pareamento demonstraram que T se pareia
somente com A e C somente com G. Outros tipos de pareamento não ocorrem naturalmente no
DNA. Para explicar esse achado, Watson e Crick demonstraram que este pareamento restrito
permite a formação mais eficiente de pontes de hidrogênio entre as bases, o que implica na
relação ótima para a manutenção da estabilidade da molécula de DNA. Além disso, G e C são
unidas por três pontes de hidrogênio, enquanto a relação entre A e T envolve a formação de
somente duas pontes. Assim, genomas que apresentem um alto conteúdo de GC em sua
constituição são mais estáveis que aqueles onde há maior proporção de AT. Estas observações
têm implicações diretas em muitas técnicas utilizadas rotineiramente em procedimentos
biotecnológicos.
A descoberta da estrutura do DNA causou grande impacto na genética e em outras 13
áreas da biologia. Isto se deve a duas razões principais. Primeiramente, a própria relação entre
os componentes na estrutura sugere como o material genético é duplicado ou replicado. Com a
restrição imposta pelo pareamento específico de bases, provavelmente a fita molde expõe suas
bases que determinam qual nucleotídeo deve ser incorporado à nova molécula filha. Em
segundo lugar, como a informação genética está contida no DNA, a sequência de nucleotídeos
então poderia ditar de alguma forma a sequência de aminoácidos que formariam uma proteína
específica. Assim, um tipo de código genético estaria representado na sequência nucleotídica do
DNA, que seria então traduzida para uma diferente linguagem que compõe as proteínas, os
aminoácidos.

2.2 REPLICAÇÃO DO DNA

A transmissão precisa da informação genética que é um processo essencial para a


manutenção da vida e de sua integridade. Portanto, há a necessidade de que um procedimento
extremamente específico tenha sido desenvolvido durante a evolução. Para desvendá-lo,
inicialmente foram propostos modelos da replicação do DNA baseados na complementaridade
de bases. A fidelidade entre o pareamento específico de bases permitiria então que a fita molde
fizesse uma réplica antiparalela (Fig. 5).
FIGURA 5: O MODELO DA REPLICAÇÃO DO DNA PROPOSTO POR WATSON E CRICK

14

As fitas parentais são desnaturadas, permitindo que as bases dos nucleotídeos sejam
expostas. A formação das fitas filhas se deve à especificidade de bases impostas pelas fitas
parentais. Ao final do processo, são geradas duas fitas filhas de sequências complementares à
das fitas parentais utilizadas como molde.
O modelo de replicação do DNA proposto por Watson e Crick baseado na
especificidade de bases não explica, contudo, de que maneira a molécula de DNA parental pode
ser relacionada às moléculas filhas. Há três possibilidades distintas: semiconservativa,
conservativa e dispersiva.
Na replicação semiconservativa, cada dúplex é formado por uma fita parental e por
outra fita filha recém-sintetizada. Na conservativa, a replicação produz dois dúplex: um formado
por duas fitas molde, e outro, por duas fitas filhas. A terceira hipótese, a replicação dispersiva,
cada dúplex é formada por fragmentos de dupla fita contendo apenas segmentos de DNA
parental e, na mesma molécula, há também fragmentos de dupla fita contendo apenas
segmentos recém-sintetizados.
Para discriminar entre as hipóteses sugeridas como modelo para à replicação do DNA,
Matthew Meselson e Franklin Stahl realizaram um elegante experimento em 1958. Esses
pesquisadores analisaram várias gerações de culturas bacterianas que tiveram como fonte de
nitrogênio duas moléculas que apresentam densidades diferentes, o N15 e o N14. Inicialmente, as
culturas foram supridas somente com N15, os quais foram incorporados às bases nitrogenadas
que estavam sendo formadas durante a replicação do DNA. Após a divisão celular de algumas 15
gerações, as mesmas células bacterianas foram cultivadas em meio contendo somente o N14. O
padrão de replicação foi diferenciado após a separação do DNA em gradiente de cloreto de césio
(Fig. 6). O resultado obtido após a centrifugação demonstrou a presença de uma banda
intermediária entre os dois nitrogênios na primeira geração com N14, e uma intermediária e outra
correspondente a somente o N14. Esse experimento confirmou que a replicação do DNA é
semiconservativa. Os mesmos resultados foram obtidos em experimentos posteriores, validando
então o modelo.

FIGURA 6: PADRÃO DE BANDAS ESPERADO APÓS A REPLICAÇÃO


SEMICONSERVATIVA, CONSERVATIVA OU DISPERSIVA DO DNA EM CLORETO DE CÉSIO.
Dupla fita em vermelho representa fitas compostas somente por N15; as duas fitas
azuis seriam compostas por somente N14. Após a primeira seta da esquerda, são representadas
a primeira e a segunda geração de células crescidas em meio contendo somente N14. O padrão
de bandas da legenda se refere ao obtido após a centrifugação em cloreto de césio. (Figura
modificada de Griffiths et al., 2002).
Diversos modelos experimentais foram propostos para explicar como é a estrutura do 16
DNA. O modelo da dupla hélice explicou bem alguns processos envolvidos com a estrutura do
DNA e o mesmo ainda é aceito atualmente. Após se chegar a este modelo, os cientistas então
passaram a outros processos envolvendo a molécula, como a replicação.

2.3 MECANISMOS DE REPLICAÇÃO DO DNA

No período de 1950, o cientista Arthur Kornberg identificou e purificou uma das


enzimas envolvidas na replicação do DNA, a DNA polimerase I. Esta enzima tem três atividades:
I. Atividade de polimerase, catalisando o crescimento da cadeia na direção 5´- 3´;
II. Atividade exonucleásica 3´- 5´, removendo o pareamento de bases incorretas;
III. Atividade exonucleásica 5´ - 3´, que degrada o DNA dupla fita.
Outras duas DNAP foram descobertas posteriormente. Postula-se que a DNAP II
esteja envolvida no reparo de DNA; contudo, ainda não há uma função específica atribuída a
esta enzima. A DNAP III atua na replicação do DNA, juntamente com a DNAP I. A DNAP III
completa a replicação do DNA fita simples, isto é, se já existir um pequeno fragmento de DNA
dupla fita. Este oligonucleotídeo é conhecido como “primer”.
O ponto específico da sequência de DNA no qual a replicação se inicia é denominado
origem de replicação. Em Escherichia coli, há uma origem de replicação. Uma vez iniciada, a
replicação prossegue de forma bidirecional. Para que se inicie o processo, há a ligação da
proteína DNA A e, em seguida, há a desnaturação do DNA.
Em eucariotos, a replicação é mais complexa. Experimentos com moléculas de DNA
marcadas demonstraram a existência de inúmeras regiões de replicação dentro de um único
braço cromossomal. Estima-se que haja cerca de 400 origens de replicação distribuídas entre os
17 cromossomos de levedura e 10.000 para humanos. Além disso, a replicação em eucariotos é
um processo altamente coordenado dentro de um mesmo cromossomo e em todo o conjunto
celular destas estruturas.
Em presença de nucleotídeos trifosfatos, a DNAP polimeriza uma nova molécula de
DNA dupla fita. Contudo, este procedimento de extensão da fita é dependente da prévia
existência de um pequeno oligonucleotídeo de aproximadamente 30 pb. Este “primer” pode ser
sintetizado tanto por uma RNA polimerase (RNAP) como pela enzima denominada primase. 17
Portanto, somente após a síntese do “primer” complementar a uma determinada sequência de
DNA, haverá a extensão da cadeia pela DNAP.
A síntese de novas cadeias pela DNAP ocorre na direção 5´ - 3´. Pela natureza
antiparalela da fita de DNA, a enzima se move sobre a fita molde na direção 3´ - 5´. A síntese de
uma nova fita, designada “leading” é contínua. Por outro lado, a desnaturação do DNA também
expõe outra fita molde que corre no sentido 5´- 3´, a “lagging”. Então, a forquilha de replicação –
ponto em que as duas fitas de DNA se separam para permitir a replicação de cada fita – tem de
seguir no sentido contrário da outra fita para que a polimerização seja de 5´- 3´.
Para que a replicação ocorra ao mesmo tempo nas duas fitas, a polimerização na
“lagging” é realizada em pequenos segmentos descontínuos. Inicialmente, um “primer” de RNA é
sintetizado de forma complementar ao DNA. Em seguida, ocorre então a polimerização e
elongação da fita de DNA pela DNAP. Estes fragmentos de DNA foram identificados pela
primeira vez por Reiji Okazaki e, por isso, são denominados fragmentos de Okazaki. A atividade
exonucleásica no sentido 5´- 3´da DNAP I remove os “primers” de RNA e preenche esta
sequência com um segmento fita simples de DNA. Estes são então selados pela enzima DNA
ligase, que catalisa a ligação do fosfato 5´ a um grupo 3´ OH adjacente. Esta ligação ocorre
assim que a forquilha expõe a fita “lagging” e prossegue até que o fragmento precedente seja
alcançado.
Para que a replicação seja simultânea, entre as duas fitas do DNA, foi proposto um
modelo que está demonstrado na Fig. 7. A fita “lagging” sofre uma volta sobre o complexo
enzimático responsável pela replicação do DNA. Esta volta permite que a RNAP III sintetize
ambas as fitas filhas. Depois de percorridos aproximadamente 1.000 pb, o fragmento dupla fita
de DNA da fita “lagging” é liberado pela DNAP III, permitindo que uma nova volta seja formada
sobre a molécula de DNA.
FIGURA

18

Figura 7: Modelo proposto para a replicação do filamento descontínuo.

Este modelo possibilita que a holoenzima de DNAP III sintetize ambos os filamentos
filhos.
A replicação do DNA envolve um complexo enzimático. Além da DNAP e da primase,
há outras enzimas envolvidas, como as helicases. Essas são essenciais para o início da
replicação do DNA, pois são as responsáveis por romper as pontes de hidrogênio que mantêm
as duas fitas de DNA unidas. Esta fita simples é estabilizada pela ligação da proteína SSB, que
se liga à fita simples de DNA e, com isso, retarda a formação do dúplex.
Ambas as DNAP I e III possuem atividade exonucleásicas 3´ - 5´, o que permite
verificar e editar bases inseridas erroneamente ou mal pareadas. Esta atividade é fundamental
para a manutenção da fidelidade da informação genética. Mutantes deficientes nesta atividade
apresentam maior taxa de mutação.
Muitos questionamentos foram feitos após a descoberta da estrutura e de outros
processos que envolvem o DNA. Entre eles, o que realmente intrigava e fascinava os 19
pesquisadores era a descoberta de como a informação genética presente em sequências de
DNA são transmitidas até a síntese de proteínas. O primeiro passo para atingir este objetivo foi
entender o processo de transcrição.

2.4 TRANSCRIÇÃO

Após a descoberta do DNA, os pesquisadores então queriam entender como a


informação genética contida nesta sequência de bases era traduzida em proteínas. A primeira
especulação poderia ser que esta transferência era realizada diretamente do DNA em proteínas.
Contudo, a união da genética e da citologia permitiu elucidar muitos fatos. A observação de que
o material genético em células eucariotas se encontrava no núcleo e as proteínas no citoplasma
demonstravam a necessidade de uma molécula intermediária. Posteriormente, o processo foi
elucidado e o intermediário nesta transferência de informações é o RNA.

2.4.1 Estrutura do RNA

A estrutura básica do RNA é bem semelhante a do DNA. Ambos são formados por
uma cadeia constituída pela união de nucleotídeos por meio de ligações fosfodiésteres. Apesar
da semelhança, o RNA apresenta algumas diferenças estruturais se comparado ao DNA:
I. A primeira diferença está na composição dos nucleotídeos. No DNA, eles podem
ser compostos por quatro bases distintas: adenina, citosina, guanina e timina. No RNA, três
bases nitrogenadas são as mesmas daquelas encontradas no DNA: adenina, citosina e guanina.
Contudo, ao invés da timina, a base denominada uracila compõe um dos tipos de nucleotídeos
de RNA. Apesar desta diferença, a uracila forma pontes de hidrogênio com a adenina, assim
como o faz a timina.
II. A segunda diferença ainda está relacionada com o tipo de açúcar que compõe o
nucleotídeo. O açúcar que compõe o DNA é a desoxirribose e no RNA é a ribose. A única
diferença entre estes açúcares é a presença ou a ausência de um átomo de oxigênio na posição 20
do carbono 2, como demonstrado na Fig. 8;

FIGURA 8: DIFERENÇA ESTRUTURAL ENTRE RIBOSE E DESOXIRRIBOSE

III. Por fim, o RNA é constituído por uma fita simples e não por uma fita dupla como
o DNA. Consequentemente, o RNA não forma a estrutura de dupla hélice observada no DNA.
Pelo contrário, a fita simples permite que haja diversas combinações no pareamento de bases.
Assim, a estrutura tridimensional do RNA pode formar diferentes complexos, que são
apresentados sob variados aspectos. Esta característica é importante sobre o ponto de vista
tecnológico, pois a fita simples interfere negativamente com muitos processos de interesse
biotecnológico. Um exemplo é a dificuldade em produzir em larga escala proteínas de interesse
farmacêutico quando o RNA assume uma conformação inadequada.
O conhecimento da estrutura dos ácidos nucleicos foi o primeiro passo para as
pesquisas subsequentes. Apesar do DNA e RNA apresentarem algumas diferenças em sua
estrutura, o que se observa é a grande semelhança quanto a sua constituição. A partir disso, foi
sugerido pelos cientistas que o RNA pudesse ser então a molécula intermediária na
transferência da informação genética contida no DNA em proteínas. Então, estudos foram
dirigidos neste sentido para elucidar o papel do RNA na expressão de proteínas.

2.4.2 RNA como molécula mensageira


21

Para verificar se o RNA poderia funcionar como mensageiros elegantes estudos


genéticos foram realizados. Inicialmente, precursores de RNA marcados radioativamente foram
capturados por células em cultura. A localização deste material a ser utilizado na síntese de
moléculas de RNA foi então observada durante um curto intervalo de tempo por autorradiografia.
Após receberem precursores marcados, em um primeiro momento este material se encontrava
no núcleo. Após certo tempo, o material também pôde ser visualizado no citoplasma (Fig. 9).
Portanto, aparentemente o RNA é sintetizado no núcleo e, em seguida, segue para o citoplasma.

FIGURA 9: SÍNTESE DE RNA

O uso de precursores de RNA pré-marcados demonstrou que o RNA é sintetizado no


núcleo e em seguida, segue para o citoplasma.
O experimento inicial com os precursores pré-marcados foi ainda reforçado com
estudos realizados por Elliot Volkin e Lawrence Astrachan em 1957. O modelo experimental
adotado por estes pesquisadores partiu de estudos de infecção da bactéria E. coli com o fago
T2. Este fago é capaz de inserir seu material genético no cromossomo desta bactéria (profago) e
utilizar a maquinaria da célula infectada para a produção de suas próprias proteínas. Os
pesquisadores então compararam a sequência do RNA sintetizado após a infecção da E. coli
com o DNA do fago inserido no genoma da bactéria e descreveram a grande similaridade entre
os dois. Assim, foi possível concluir que o RNA é sintetizado a partir do DNA e que, de alguma
maneira, o mensageiro é utilizado na síntese proteica. 22
Vale ressaltar que os transcritos podem ter diferentes funções. Alguns RNA têm função
estrutural. O RNA ribossômico (RNAr) é um dos constituintes dos ribossomos. O RNA
transportador (RNAt) tem função de molécula carreadora, transportando os aminoácidos. O
RNAm, por fim, é a molécula intermediária que serve como molde para a síntese proteica.
As semelhanças entre a estrutura do DNA e do RNA foram então os pontos que os
pesquisadores tiveram como hipótese de que o RNA pudesse ser o mensageiro para a síntese
proteica. Após obterem esta confirmação pelos experimentos com precursores marcados, o
passo seguinte é entender o mecanismo da cópia fiel do DNA em RNA.

2.5 TRANSCRIÇÃO DO DNA

O processo em que a sequência de DNA é copiada em um RNA mensageiro (RNAm) é


denominado transcrição. Apesar de ter sido elucidado o papel que desempenha na transferência
da informação, outra dúvida a ser respondida foi: como se dá a cópia do DNA em um RNAm? Ao
analisar a similaridade estrutural entre o RNA e o DNA e já se tendo conhecimento a respeito da
replicação do DNA, sugeriu-se então que a transcrição se baseia também na complementaridade
de bases. Esta suposição foi posteriormente confirmada pela síntese in vitro de RNA, utilizando
uma molécula de DNA como molde. O experimento foi analisado a partir da correlação de bases
entre o DNA e o transcrito. Observou-se que a proporção de bases (A + U)/(C + G) do RNAm
transcrito é similar à proporção (A + T)/(C +G) referente ao DNA molde utilizado. Portanto, a
hipótese de que o RNA era sintetizado a partir do DNA por meio da especificidade do
pareamento de bases era um bom modelo experimental.
A complementaridade de bases entre DNA e RNA ainda pôde ser comprovada em
estudos de hibridização. Inicialmente, a dupla fita de DNA é desnaturada e uma região
complementar a uma determinada sequência é então estudada. Para isso, as moléculas que se
deseja estudar, no caso o RNA, são postas em solução às fitas de DNA. A molécula de RNA
neste tipo de experimento é denominada sonda. Esta mistura é então submetida a condições
que permitem a renaturação das fitas híbridas. Como o dúplex de DNA tem densidade diferente
daquele formado por DNA/RNA, estes híbridos podem ser separados por ultracentrifugação em
cloreto de césio. Após a realização deste experimento, foi possível observar a presença da 23
banda correspondente à formação do híbrido DNA/RNA. Este resultado confirma então a
complementaridade de bases entre DNA e RNA, pois a formação de híbridos ocorre somente
quando há uma grande região com similaridade de bases.
O estudo de complementaridade de bases ainda permitiu elucidar outro aspecto da
transcrição: se o RNAm é ou não transcrito a partir das duas fitas de DNA. As duas fitas
constituintes do dúplex de DNA apresentam diferentes proporções das bases purinas e
pirimidinas. Considerando este fato, Mamur e colaboradores, em estudos com o fago SP8 de
Bacillus subtilis, foram capazes de manter as duas fitas de DNA desnaturadas e então verificar a
quais fitas o RNAm se hibridizava. Os cientistas verificaram que o transcrito se hibridizava a
somente uma das fitas. Devido a esta revelação, a transcrição é dita assimétrica.
Os estudos iniciais sobre a transcrição esclareceram, portanto, que a síntese de RNA
se dá de maneira assimétrica e que a base para a sua realização é a especificidade de
pareamento de bases. O passo seguinte foram então estudos que permitiram desvendar como
ocorre o mecanismo da transcrição de genes.

2.5.1 Mecanismos envolvidos na transcrição gênica

 TRANSCRIÇÃO EM PROCARIOTOS

Para a síntese da molécula de RNAm, é necessária a ação da enzima RNA polimerase


(RNAP). Na maioria dos procariotos, a RNAP transcreve todos os tipos de RNA e é constituída
por cinco subunidades diferentes. Ela possui duas subunidades alfa, duas subunidades beta
diferentes (β e β´) e um fator sigma. Quando constituída por todas estas subunidades, a enzima
é denominada como holoenzima; esta é necessária para o reconhecimento do sítio adequado
onde a transcrição deve iniciar. Entretanto, o fator sigma pode se dissociar do complexo após o
início da transcrição. O complexo sem o fator sigma é então denominado cerne da enzima. Após
o reconhecimento da sequência a ser transcrita e após o início do processo, o cerne é capaz de
finalizar a transcrição.
Didaticamente, a transcrição pode ser dividida em três estágios distintos: início, 24
elongação e terminação.

INICIAÇÃO DA TRANSCRIÇÃO

Para iniciar a transcrição de um gene, a holoenzima da RNAP percorre o DNA e deve


reconhecer o ponto onde a transcrição deve iniciar. Esta sequência é denominada promotor.
Sequências promotoras de alguns genes de Escherichia coli foram isoladas e identificadas.
Estudos comparativos entre elas permitiram o alinhamento de bases similares. O que se
observou foi que, apesar de haver certa variação de bases entre as sequências, algumas são
conservadas, o que gerou então uma sequência consenso.
Além disso, observou-se que há duas sequências consenso descontínuas: uma a -35 e
outra a -10. Esses números se referem ao posicionamento da região em relação ao primeiro
nucleotídeo a ser transcrito (denominado +1) (Fig. 9). Sequências que se localizam antes do
nucleotídeo +1 recebem numerações negativas e são ditas como estando à jusante ou
“upstream” do sítio de início da transcrição. Sequências que se localizam depois do nucleotídeo
+1 recebem numerações positivas e se diz que as mesmas estão “downstream” do sítio de
início. Para finalizar, estudos demonstraram que a RNAP reconhece a sequência promotora e
interage com ambas as sequências - 35 e - 10.
FIGURA 10: SEQUÊNCIA PROMOTORA

25

(A) o promotor antecede o sítio de início da transcrição e a sequência codificadora. (B)


o alinhamento de sequências promotoras diferentes isoladas de E. coli demonstra que o
promotor é formado por duas regiões de sequências similares, -35 e -10. A partir disso, (C) foi
criada uma sequência consenso para estas duas regiões. (Figura modificada de Griffiths et al.,
2002).
A associação do fator sigma ao cerne da RNAP está ligada ao reconhecimento
específico de um promotor. Assim, ele está diretamente relacionado com a regulação gênica,
permitindo que somente determinados genes de interesse sejam expressos em um momento
específico. Inicialmente, a holoenzima reconhece as regiões -35 e -10. Este complexo é
denominado complexo promotor fechado. Após esta ligação, ocorre a separação de bases na
região -10. Quando a RNAP causa esta desnaturação, este complexo é denominado complexo
promotor aberto. Até a formação do último complexo, ainda é necessária a ligação do fator
sigma. Após a formação do complexo aberto, inicia-se então a elongação da transcrição (Fig. 10)

26
FIGURA 10: INÍCIO DA TRANSCRIÇÃO

A holoenzima da RNAP procura um sítio promotor. Ao reconhecê-lo, liga-se fortemente


e forma o complexo fechado. A enzima desnatura o DNA, formando o complexo aberto. A
transcrição finalmente se inicia e o fator sigma é liberado. (Figura modificada de Griffiths et al.,
2002).
ELONGAÇÃO DA TRANSCRIÇÃO

A continuidade da polimerização da cadeia de RNA não requer o fator sigma. Assim, o


fator sigma se dissocia da enzima no início da elongação da transcrição. A síntese do RNAm
ocorre sempre na direção 5' - 3'; ou seja, os nucleotídeos são sempre adicionados na posição 3'
do primeiro nucleotídeo. Como o pareamento de nucleotídeos se dá de maneira antiparalela, isto 27
significa que o RNAm é sintetizado a partir da fita molde de DNA a qual está orientada de 3´ - 5´.
O substrato para esta reação são os nucleotídeos trifosfatos. A energia necessária para o
processo deriva do rompimento do grupo trifosfato de alta energia. A continuação da elongação
é dependente da manutenção da abertura entre as fitas de DNA.

TERMINAÇÃO DA TRANSCRIÇÃO

A terminação da transcrição ocorre após o reconhecimento de sinais, o que resulta na


liberação do DNA nascente e da enzima. Em E.coli, são descritos principalmente dois tipos de
sinais: a formação do grampo ou a terminação dependente do fator rho.
O primeiro mecanismo envolve uma terminação direta, onde a sequência terminadora
de mais ou menos 40pb termina em uma sequência rica em GC seguida de seis ou mais
nucleotídeos compostos por adenina em seu final. As sequências GC são capazes de se
complementarem e formar uma estrutura denominada “hairpin loop”. As sequências de A ao final
acrescentam U ao RNAm, o que representa uma ligação mais fraca. Isto facilita a liberação da
RNAP do complexo de transcrição (Fig. 11).
FIGURA 11: ESTRUTURA EM GRAMPO PARA A FINALIZAÇÃO DA TRANSCRIÇÃO

28

A estrutura forma-se devido ao pareamento de bases complementares dentro da


própria fita de RNAm.
O segundo mecanismo é dependente de uma proteína adicional, o fator rho. Esta
proteína é um hexâmero de seis subunidades idênticas que se liga a um sítio específico do RNA,
denominado rut. Após a ligação ao seu sítio específico, a proteína rho se transloca, ou seja, se
move, sobre o RNAm, retirando-o da RNAP (Fig. 12).

FIGURA 12: MODELO DA TERMINAÇÃO DA TRANSCRIÇÃO PELA AÇÃO DA PROTEÍNA RÔ


(A) a síntese da fita de RNA prossegue e o sítio rho é transcrito o que permite que (B)
a proteína rho o reconheça e se ligue a ele. (C) a ligação desta proteína separa o RNA da RNAP
após se translocar ao longo da molécula de RNAm. (Figura modificada de Griffiths et al., 2002).
A eficiência de ambos os processos envolvidos na terminação da transcrição é
influenciada por outros elementos, tais como sequências próximas ou fatores proteicos. Contudo,
os dois processos são eficientes e acabam permitindo a liberação do RNAm do complexo 29
enzimático e do DNA molde.

 TRANSCRIÇÃO EM EUCARIOTOS

A transcrição em eucariotos é um processo similar ao de procariotos. Entretanto, há


alguns aspectos peculiares aos eucariotos e que são significativos para processos
biotecnológicos.
A primeira diferença nos processos se refere à constituição e função da RNAP.
Enquanto uma única representante desta enzima em procariotos é responsável pela síntese de
todos os tipos de moléculas de RNA, há três enzimas diferentes em eucariotos. As RNAP de
eucariotos ainda apresentam funções distintas, como:
I- RNA polimerase I: sintetiza o RNA ribossômico (RNAr);
II- RNA polimerase II, responsável pela síntese do RNAm;
III- RNA polimerase III, que sintetiza RNA transportador (RNAt) e outros RNAs e
suas moléculas.
Em relação à constituição da enzima, algumas das subunidades constituintes da RNAP
são similares em procariotos e eucariotos. Entretanto, a dos últimos possui outras subunidades
diferentes e são consideradas como macromoléculas mais complexas.
Outra característica distinta entre eucariotos e procariotos que interfere na transcrição
se refere à estrutura do RNAm. Esta diferença estrutural se deve à organização gênica distinta
de procariotos e de eucariotos.
Em procariotos, o RNAm frequentemente apresenta mais de uma sequência
codificadora de proteínas diferentes e são denominados RNA policistrônicos. Isso decorre da
organização gênica nestes organismos, onde genes relacionados à mesma função se encontram
organizados em um operon. Assim, facilita-se que todos os genes relacionados com a mesma
via metabólica sejam expressos simultaneamente. O RNAm de eucariotos, por sua vez,
apresenta a sequência codificadora de somente uma determinada proteína e é chamado de RNA
monocistrônico (Fig. 13).

FIGURA 13: (A) RNAM MONOCISTRÔNICO E (B) RNAM POLICISTRÔNICO.


30

O RNAm de eucariotos ainda sofre diversos tipos de processamento não observados


em procariotos. Logo após o início da transcrição, um resíduo de guanosina metilado é
adicionado à porção 5´ do transcrito. Esta modificação é conhecida como cap (Fig. 14).
Posteriormente, resíduos de adenosina são então adicionados à porção 3´ do RNAm de
eucariotos. Esta cauda poliA é constituída de 150 a 200 resíduos (Fig. 15). Estes
processamentos estão relacionados com o aumento da estabilidade do RNAm, afetando assim a
vida útil dos mesmos.
FIGURA 14: ADIÇÃO DA 7–METILGUANOSINA À PORÇÃO 5´ DO RNAM.

31

Essa modificação do transcrito primário do RNAm é conhecida como cap.


(laguna.fmedic.unam.mx).

FIGURA 15: ACRÉSCIMO DA CAUDA DE POLI A A PORÇÃO 3´DO RNAM


O RNAm de eucariotos também é submetido a outro tipo de processamento.
Estruturalmente, o gene de eucariotos é constituído por duas sequências contíguas distintas: os
exons, que representam segmentos codificadores, e os introns, que são sequências não
codificadoras. Inicialmente, o transcrito primário possui tanto exons como introns. Entretanto,
posteriormente há um processamento em que os introns são removidos. Este processo é
denominado de “splicing” e é uma importante descoberta da genética molecular. 32
O “splicing” foi descoberto a partir de estudos com transcritos de DNA viral de
mamíferos. Analisando a complementaridade de bases entre o material derivado da integração
viral e de seus respectivos transcritos, observou-se que não havia correspondência fiel entre
eles. Esta conclusão se deve à visualização da estrutura que se formou com a presença de alças
no material genético referente ao DNA. Portanto, conclui-se que o transcrito final representava
apenas determinados seguimentos referentes ao material genético do qual o RNAm se originou.
O mecanismo de “splicing” envolve duas reações consecutivas de transesterificações
Estas reações são catalisadas por um complexo ribonucleoproteico, o qual é constituído por
RNAs nucleares pequenos (snRNPs), pelo transcrito primário e pela associação de outros
fatores proteicos. Este complexo recebe a denominação de spliceossomo.
Uma característica interessante do “splicing” é que o mesmo RNAm pode sofrer
diferentes processamentos. Nesse caso, ocorrem junções de exons diferentes do mesmo RNAm
ou mesmo entre exons derivados de diferentes RNAm. O resultado final é que os RNAm
maduros são constituídos por sequências diferentes, o que consequentemente resultará na
geração de proteínas distintas. Este processo é conhecido como “splicing” alternativo (Fig. 16).
As diferentes proteínas geradas por este mecanismo são frequentemente utilizadas em
diferentes tipos celulares, ou mesmo em diferentes estágios de desenvolvimento.
FIGURA 16: “SPLICING” ALTERNATIVO

33

Os exons são unidos de diferentes maneiras, o que proporciona a geração de


proteínas totalmente diferentes.
O processo de transcrição, onde o intermediário para a síntese proteica é gerado, é
apenas um dos pontos de interesse biotecnológico: a expressão de proteínas em larga escala.
Portanto, o passo seguinte à geração do RNAm é o entender como ocorre a interpretação da
sequência de nucleotídeos que compõem o transcrito pela maquinaria celular, até a sua
biotransformação em um polipetídeo. Estudos posteriores vieram então elucidar como ocorre
este processo.
2.6 TRADUÇÃO

O conhecimento de que os genes são sequências de DNA e que o RNAm é a estrutura


intermediária e mensageira da informação para a síntese proteica foi o primeiro passo para a
biotecnologia molecular. Para a síntese de proteínas, surge então uma primeira pergunta: se os 34
genes são segmentos de DNA e se este é formado por uma sequência de nucleotídeos
compostos por somente quatro bases distintas, como esta sequência de bases determina a
sequência de uma proteína? Uma comparação simples para desvendar este dilema é associar
cada um dos quatro nucleotídeos como se fossem letras do alfabeto. A combinação destas letras
formaria palavras; estas então seriam os constituintes das proteínas.
Para entender como se dá a combinação das letras, o ponto de partida é conhecer a
estrutura proteica. A estrutura primária de proteína é formada por diferentes aminoácidos ligados
entre si por ligações peptídicas. Se o RNAm é constituído por uma sequência de nucleotídeos,
as letras, os aminoácidos corresponderiam então às palavras formadas por nucleotídeos. O
conjunto de palavras que os diferentes códons especificam é denominado código genético.

2.6.1 Código Genético

Outro dilema em relação à tradução é como as letras se combinam para constituir as


palavras. Portanto, se cada nucleotídeo representa um aminoácido, a proteína seria composta
por somente quatro aminoácidos. Contudo, são conhecidos 20 aminoácidos naturais. Por esta
insuficiência, supôs-se que um aminoácido é representado no RNAm por uma combinação de
nucleotídeos.
A combinação de nucleotídeos que representasse os aminoácidos foi teoricamente
feita por análises combinatórias. Assim, se o aminoácido fosse composto por duas das quatro
bases que compõem a sequência do RNAm, seria possível então 42, o que daria um total de
dezesseis aminoácidos. Dezesseis combinações ainda seriam insuficientes para representar os
20 aminoácidos existentes. Se as letras fossem compostas de três bases, então as combinações
possíveis seriam 43, o que daria 64 aminoácidos distintos. Esta combinação, portanto, proveriam
mais que os 20 aminoácidos naturais. Assim, supôs-se que um aminoácido é traduzido a partir
de pelo menos três nucleotídeos. Esta trinca de nucleotídeos é denominada códon. Esta
suposição foi posteriormente confirmada em 1961 por Francis Crick e Sidney Brenner e
colaboradores em análises de mutantes do fago T4.
A partir da descoberta do códon, outras questões ainda intrigavam os pesquisadores. A
combinação de três nucleotídeos que compõe o códon pode fornecer 64 combinações 35
diferentes; contudo, há na natureza somente 20 aminoácidos. Se cada códon representasse um
aminoácido distinto, então haveria 44 combinações extras que não teriam função ou que
simplesmente não codificariam aminoácidos? Esta suposição é improvável, pois mutações de
ponto, ou seja, que alterem apenas um único nucleotídeo, poderiam então representar um dos
códons que não codificariam aminoácidos. Consequentemente, a síntese proteica seria
interrompida. Isto é inviável sob o ponto de vista evolutivo, já que a interação parasita-
hospedeiro, por exemplo, demonstram que a natureza desenvolveu mecanismos que
permitissem a evolução e a adaptação dos organismos frente às diversas situações.
Por outro lado, se todas as trincas codificam um aminoácido, este pode ser
representado por mais de um códon. Neste caso, mutações de bases que compõem o códon
induziriam uma alteração de aminoácidos, permitindo mesmo assim a síntese proteica e
possivelmente a geração de variantes. Assim, Crick postulou que os aminoácidos são
codificados por um ou mais códons diferentes. Esta hipótese foi posteriormente confirmada por
análises bioquímicas e, por isso, o código genético é dito degenerado.
Estas descobertas iniciais a respeito do código genético geraram grande entusiasmo
no mundo científico. Com isso, muitas pesquisas foram realizadas com o intuito de desvendá-lo
cada vez mais. Decifrar qual aminoácido é especificado por cada códon foi um dos feitos mais
excitantes da genética nos últimos 50 anos. Isso se deve à descoberta inicial de como sintetizar
um RNAm sintético. Este fato possibilitou a oportunidade de criar sequências variadas de RNAm,
o que permitiu verificar quais aminoácidos as diferentes combinações especificavam.
O uso da matemática nas análises combinatórias permitiram deduzir a frequência de
aminoácidos obtidas a partir da síntese de RNAm realizadas com misturas de diferentes
proporções fixas dos quatro nucleotídeos distintos. Em outras palavras, se os códons codificam
diferentes aminoácidos, espera-se que os aminoácidos gerados a partir desta mistura particular
de nucleotídeos estejam a uma taxa similar àquela das possíveis combinações de códons.
Apesar da redundância do código genético, esta hipótese foi posteriormente comprovada em
experimentos subsequentes. Contudo, este experimento não permitia distinguir a sequência
específica de cada códon em relação a um aminoácido.
Para correlacionar a sequência específica do códon relativo a um determinado
aminoácido, foram utilizados mini RNAs sintéticos. Inicialmente, foram utilizadas sequências
específicas compostas por somente três aminoácidos. Assim, por exemplo:
I. GUU: codifica valina; 36
II. UUG codifica leucina;
III. UGU codifica cisteína.
A produção destes mini RNAs possibilitou a síntese das 64 combinações possíveis de
códons, o que demonstrou que certos aminoácidos podem ser codificados por uma única trinca
ou até mesmo por seis combinações diferentes. Portanto, estes estudos comprovaram a
degeneração do códon.
O estudo com os mini RNAs ainda permitiu outra correlação entre as bases que
compõem o códon e seu papel na degeneração do código genético. A terceira base que compõe
o códon é a mais variável; assim, mudanças nestas bases frequentemente não alteram o
aminoácido codificado. Esta característica é extremamente importante para a biotecnologia, pois
previne mutações espontâneas a que as culturas relacionadas com a produção de proteínas de
interesse estão submetidas não alterem, necessariamente, as cadeias polipeptídicas.
As pesquisas com os mini RNAs, por fim, também demonstraram outro aspecto
interessante do código genético. Apesar da sua redundância, há alguns códons que não
especificam nenhum aminoácido e funcionam como pontos finais no RNAm. Estas trincas são
denominadas códons de parada.
A partir de experimentos baseados na combinação de nucleotídeos em RNAs
sintéticos, foi possível estabelecer qual aminoácido é representado por cada trinca.
A Fig. 17 demonstra as possíveis combinações de três nucleotídeos a partir dos quatro
existentes em RNA com os aminoácidos que cada códon codifica.
FIGURA 17: CÓDIGO GENÉTICO

37

FONTE:

Os experimentos iniciais com o objetivo de desvendar o código genético foram


realizados em organismos procariotos; entretanto, estudos posteriores demonstraram que ele é
universal. Isto quer dizer que o código genético é comum a todos os organismos, desde os vírus
e bactérias até organismos eucariotos e multicelulares, como os humanos.
Mesmo sendo o código genético considerado universal, esta generalidade apresenta
exceções. No DNA mitocondrial, por exemplo, dois códons são traduzidos diferentemente na
mitocôndria. Enquanto AUA representa geralmente isoleucina, na mitocôndria ele é lido como
metionina. Além desse, UGA que normalmente especifica um códon de parada, na mitocôndria
ele codifica o triptofano. A explicação para esta diferença está nas propriedades dos RNAt que
estão confinados ao sistema mitocondrial. Outras exceções foram também observadas quanto a
determinados códons de levedura e de alguns representados por alguns protozoários.
Outra característica do código genético é que a leitura dos códons não ocorre de
maneira sobreposta. Isto tem importância sob o ponto de vista evolutivo e biotecnológico.
Mutações de ponto podem ou não alterar um aminoácido da proteína; contudo, esta variante
pode ainda ser funcional. Se a leitura se desse de maneira sobreposta, uma mutação alteraria
não só um aminoácido, como também toda a proteína. Neste caso, a chance de uma mutação
gerar uma proteína específica e ativa seria extremamente baixa.
O conhecimento mais aprimorado a respeito das características do código genético
permitiu deduzir como é o seu funcionamento. O passo seguinte e essencial para a sua
utilização na biotecnologia é a síntese de proteínas.

2.7 SÍNTESE PROTEICA 38

A síntese de proteínas a partir de um RNAm é dependente da ação conjunta de


diversas estruturas, como: ribossomos, RNAts e uma grande diversidade de fatores proteicos.

2.7.1 Ribossomos

Os ribossomos constituem um complexo importantíssimo para a tradução. Ele é


constituído por muitas moléculas de RNAr diferentes associadas a mais de 50 proteínas. Para a
formação do ribossomo, este complexo se organiza em duas subunidades distintas, a
subunidade maior e a menor.
A diferença entre as duas subunidades, além do tamanho relativo, refere-se aos
componentes que formam cada estrutura. A subunidade menor contém uma única molécula de
RNAr. No caso da subunidade maior, esta é formada por outro tipo de RNAr de alto coeficiente
de sedimentação (“S”) associado com outros RNAr de menor “S”. “S” é a medida da taxa de
sedimentação após a centrifugação de partículas postas em solução. O tipo de RNAr que
compõe cada subunidade difere entre procariotos e eucariotos.
Em procariotos, a subunidade maior é denominada 50S e a menor, 30S. A subunidade
maior é composta pelo RNAr 23S e por um menor, 5S. A subunidade menor contém em sua
composição somente o RNAr 16S. Ao se associarem, formam o ribossomo completo, também
conhecido como 70S.
Em eucariotos, as subunidades 60S e 40S se associam e formam o ribossomo 80S. A
subunidade maior é formada pelo RNAr 28S associado a dois outros RNAr menores, o 5,8S e o
5S. A subunidade menor, assim como em procariotos, é constituída por um único tipo de RNAr.
O que difere é que em eucariotos o RNAr que constitui esta subunidade é o 18S.
Os ribossomos de procariotos e eucariotos diferem não só pelo tamanho das
moléculas de RNAr e do complexo em si. Outros aspectos também são diferentes, como a
quantidade de proteína que compõe cada subunidade. Contudo, apesar desta diferença
estrutural, um fato intrigante é a grande similaridade estrutural e funcional entre os ribossomos 39
de todas as espécies (Fig. 18).

FIGURA 18: ESTRUTURA DOS RIBOSSOMOS

Cada ribossomo contém sítios específicos que permitem a ligação de todos os fatores
associados à síntese proteica, como o RNAm, os RNAt e os fatores proteicos. Além disso, a
subunidade maior do ribossomo possui dois compartimentos, o sítio A e o sítio P. O sítio A é o
local de acesso do RNAt contendo o aminoácido a ser inserido na cadeia proteica. O sítio P é
ocupado pelo RNAt que carrega a cadeia polipeptídica que está sendo formada. Assim que a
polimerização da cadeia polipeptídica prossegue e há a translocação do ribossomo, ou seja, esta
estrutura se move sobre um códon, o RNAt que se encontra no sítio P é liberado do complexo.
Isto permite a transferência do RNAt do sítio A ao P. Para fins didáticos, a síntese proteica é
dividida em três passos distintos: iniciação, alongamento e término.

2.7.2 Iniciação da tradução em procariotos


40

Em procariotos, o primeiro passo da iniciação ocorre com o reconhecimento do códon


de início, que em E. coli pode ser representado tanto por AUG, como por GUG e UUG. Dentre
eles, o mais representativo é o AUG, sendo que os outros dois são denominados códons
alternativos. Observa-se que a escolha de um ou outro códon varia com o gene em questão;
contudo, sequências que contenham códons de início diferentes possuem taxas de tradução
diferenciadas.
Antes de iniciar a tradução, as subunidades ribossômicas encontram-se separadas.
Para iniciar a síntese, a subunidade menor 30S se liga primeiramente ao RNAm. Esta ligação é
estimulada pelo fator proteico de iniciação IF3 e IF1. O fator IF1 se liga somente ao complexo
inicial, sendo que a sua localização impede a ligação da subunidade maior.
Um detalhe interessante é como esta subunidade reconhece o códon de início correto.
Apesar de a maioria dos genes terem como códon de início o AUG, que codifica uma metionina,
a sequência do RNAm possui outros representantes desta mesma trinca, inclusive em locais a
jusante do códon de início. Então, como se dá esse reconhecimento do correto códon?
A questão do reconhecimento do verdadeiro códon de início foi respondida após
estudos realizados por John Shine e Lynn Dalgarno. Estes pesquisadores notaram que o
verdadeiro códon de início era precedido por uma sequência de aproximadamente oito
nucleotídeos, sendo complementar à porção 3´ final do RNAr 16S da subunidade menor do
ribossomo. Em uma homenagem a estes pesquisadores, essa sequência foi denominada de
Shine-Dalgarno. Este passo é fundamental para a síntese correta de uma determinada proteína.
O reconhecimento do códon de início permite que a tradução ocorra na fase de leitura correta
que especifica a sequência de aminoácidos da proteína.
O início da tradução é dependente da disponibilidade de RNAt carregados com seu
respectivo aminoácido. A ligação do aminoácido ao RNAt é dependente da ação específica de
enzimas denominadas aminoacil-sintetase. Assim que o aminoácido se liga ao RNAt, este
complexo passa a ser denominado aminoacil-RNAt. Posteriormente, esta estrutura pode
reconhecer o códon correspondente ao aminoácido que o RNAt carrega. Este procedimento se
dá por uma sequência presente no RNAt que é complementar ao códon, o anticódon.
Ao códon de início é adicionado o primeiro aminoácido. Contudo, este é uma metionina
transformada, a N-formilmetionina. Este aminoácido se liga ao códon de início auxiliado por outro
fator proteico, o IF-2. Posteriormente, a subunidade maior se liga a esta estrutura, formando 41
então o ribossomo completo. O interessante é que este aminoácido inicial se liga inicialmente ao
sítio P, e não ao A como ocorre com os aminoácidos seguintes que serão incorporados à cadeia
proteica nascente. Os fatores IF-3 e IF-2 são liberados durante o estágio de formação da
estrutura ribossomal (Fig. 19).

FIGURA 19: INICIAÇÃO DA TRANSCRIÇÃO EM PROCARIOTOS

(A) subunidade 30S se liga ao RNAm com o auxílio dos fatores IF1 e IF3; (B) IF2 se liga ao RNAt ligado
à N-formilmetionina e controla a sua entrada no ribossomo; (C) os fatores de iniciação são liberados e a subunidade
maior se liga ao complexo inicial, formando o ribossomo completo. (Figura modificada de Lewin, 2004).
2.7.3 Alongamento da síntese proteica em procariotos

O alongamento da cadeia proteica é dependente de três fatores proteicos: EF-Tu, Ef-


Ts e EF-G. O EF-Tu medeia a entrada do RNAt contendo o aminoácido correspondente ao
códon que se encontra no sítio A do ribossomo, um processo dependente de energia. Em 42
seguida, há a ação do fator EF-Ts, responsável pela liberação do primeiro fator do ribossomo.
Este fator ainda consegue regenerar a energia gasta no processo com o fator EF-Tu.
No passo da translocação, a cadeia polipeptídica é transferida ao RNAt carregado com
aminoácido e presente no sítio A. O ribossomo então se move sobre o RNAm na direção 5´ -
3´do mesmo. Este passo é mediado pelo fator de elongação EF-G. Assim, há a liberação do
RNAt presente no sítio P e que não se encontra mais carregado. Posteriormente, há a
transferência do RNAt contendo a cadeia polipeptídica em formação do sítio A para o P.
O término da síntese proteica ocorre quando o códon seguinte ao processo de
translocação, presente no sítio A, é um códon de parada. Estes códons não são reconhecidos
por RNAt, mas sim por fatores proteicos que são designados pelas abreviações RF1, RF2 e
RF3. A diferença entre estes fatores se deve ao reconhecimento diferencial dos códons de
parada. O RF1 reconhece UAA e UAG; o RF-2, os códons UAA e UGA. O RF-3 auxilia em
processos de catálise envolvidos com a terminação da cadeia. O fator de liberação então se liga
ao códon no sítio a e o polipeptídeo é então liberado do sítio P. A finalização do processo se dá
com a dissociação do ribossomo em suas subunidades maior e menor.

2.7.4 Tradução em eucariotos

A tradução em eucariotos ocorre de maneira bastante similar à de procariotos.


Entretanto, alguns detalhes desta etapa são diferentes, como as diferenças quantitativas e
qualitativas dos fatores proteicos. A etapa de maior interesse para o desenvolvimento de
procedimentos em biotecnologia é o início da tradução de eucariotos.

 INICIAÇÃO DA TRADUÇÃO EM EUCARIOTOS


Inicialmente, a primeira diferença do início da tradução em eucariotos em comparação
à de procariotos, além de requererem diferentes e mais diversificados fatores proteicos, refere-se
ao códon de início. Em eucariotos, a única trinca reconhecida com este propósito é o AUG.
Em relação ao reconhecimento do verdadeiro códon de início presente no RNAm, este
frequentemente é o primeiro AUG que se encontra logo após ao CAP 5´. A interação da
subunidade menor com a estrutura do CAP metilado presente em todos os RNAm de eucariotos 43
requer um grupo de proteínas genericamente conhecidas como eIF4. Após o reconhecimento do
CAP pelo eIF4F, qualquer estrutura secundária na região 5´ é removida por uma atividade de
helicase. A subunidade menor realiza então um escaneamento sobre o RNAm, parando assim
que encontra o primeiro AUG (Fig. 20).

FIGURA 20: INICIAÇÃO DA TRADUÇÃO EM EUCARIOTOS

A figura apresenta a complexidade da transcrição em eucariotos em comparação a


procariotos. Muitos fatores de transcrição diferentes estão envolvidos no processo.
Apesar de o primeiro AUG ser o verdadeiro códon de início, foram identificadas outras
estruturas que facilitam seu reconhecimento. Assim como em procariotos, há determinadas
sequências que se localizam na vizinhança do AUG, denominadas sequências de Kozak. Esta é
representada por uma sequência consenso: RNAm 5´ACCAUGG 3´. Apesar de este consenso
ser importante, a eficiência da tradução é afetada pela adenina e pela guanina presentes antes e
após o AUG, respectivamente. 44
Após a montagem do complexo ribossomo-RNAm, há a adição da primeira metionina
ao códon de início. Contudo, ao códon inicial, há a incorporação de uma metionina sem a
modificação por um grupo formil. O processo restante é semelhante ao de procariotos.
Depois de finalizar o processo de tradução, a cadeia polipeptídica ainda passa por
outros processos de transformação. Assim, para obter uma proteína nativa, a cadeia
polipeptídica obtida após a tradução do RNAm é submetida a uma outra etapa, o processamento
proteico.

2.8 PROCESSAMENTO PROTEICO

Após a síntese da proteína, esta ainda pode sofrer várias transformações. Este
processamento é extremamente importante sob o ponto de vista biotecnológico, pois a partir
deste passo final há a geração de proteínas funcionais.
Vários são os tipos de processamento que a proteína pode sofrer o que também
dependerá do tipo celular em que a macromolécula está sendo expressa. Um exemplo de
grande aplicação na biotecnologia é o endereçamento proteico. Este processo pode ocorrer
tanto em procariotos como em eucariotos. Para isso, algumas cadeias proteicas apresentam em
sua porção N-terminal uma sequência de 15 a 25 aminoácidos. Esta estrutura é denominada
peptídeo sinal. Seu reconhecimento por fatores e receptores proteicos medeia o transporte e o
acoplamento à membrana celular. Para que a proteína seja secretada, o peptídeo sinal é
reconhecido pela maquinaria celular, mais especificamente uma peptidase. Esta enzima cliva a
cadeia polipeptídica, separando a proteína de seu peptídeo sinal e permitindo que a proteína
seja finalmente liberada da célula.
Aliado ao peptídeo sinal, a proteína pode conter na sua porção C-terminal uma
sequência conhecida como sinal de ancoramento. Assim, o peptídeo sinal endereça a proteína
até a membrana celular. O sinal de ancoramento, ao contrário do peptídeo sinal, não será
clivado. Por possuir características hidrofóbicas compatíveis com a da membrana celular,
permite que a proteína permaneça ancorada à membrana.
Outros tipos de processamento extremamente importantes para obter proteínas 45
funcionais são processamentos que certas proteínas sofrem quando são expressas em células
eucariotas. Exemplos são sequências que sinalizam a glicosilação. Além da importância deste
processo para gerar proteínas funcionais, este requerimento é uma das preocupações da
indústria farmacêutica. A glicosilação é essencial para a geração de uma resposta imunológica
eficaz, por exemplo.

2.9 REGULAÇÃO DA TRANSCRIÇÃO

As células não expressam todas as proteínas por períodos de tempo indeterminados.


O gasto de energia é demasiadamente alto, prejudicando a homeostase celular. Por isso, as
células desenvolveram mecanismos que permitem que a célula reconheça o momento em que
genes relacionados a uma determinada função sejam expressos.

2.9.1 Regulação da transcrição em procariotos

A obtenção de determinados produtos gênicos é essencial para a biotecnologia.


Apesar de se ter o conhecimento de que a informação genética que determina estes produtos
ser representada por uma sequência de nucleotídeos e que a combinação destes é traduzida em
uma proteína, outro esclarecimento é necessário: como ocorre o controle da síntese proteica?
O controle da expressão gênica é um passo fundamental para a manutenção da
homeostase celular. Um exemplo pode ser observado em bactérias quanto à expressão de
determinados genes envolvidos com o metabolismo de açúcares. Os açúcares constituem uma
fonte de carbono essencial para a produção de energia. Diversos tipos podem ser utilizados com
este propósito, como lactose, glicose, maltose, galactose e xilose. O metabolismo de cada
açúcar é dependente da produção de diferentes enzimas. Se a célula sintetizar todas as
enzimas, mesmo que não haja necessidade, isto representa um gasto energético desnecessário
e inviável para o organismo. Portanto, o controle estrito da síntese de enzimas é um dos passos
chaves para a viabilidade celular e manutenção de culturas responsável pela síntese de produtos 46
biotecnológicos.
A regulação da expressão gênica pode ser obtida pelo controle tanto da transcrição
como de processos subsequentes. Entretanto, normalmente este controle é feito a nível
transcricional, para que a célula evite gastos energéticos e de precursores. Dois passos chaves
são fundamentais para a inibição da síntese de proteínas desnecessárias em determinado
momento:
I. As células precisam ser capazes de inibir a transcrição de um determinado gene
ou de um grupo deles;
II. As células precisam reconhecer determinadas condições ambientais na qual ela
deva ativar ou reprimir a transcrição de genes.
O modelo clássico que esclareceu muitos dados a este respeito foi obtido com estudos
sobre o metabolismo da lactose em E. coli, em 1950. François Jacob e Jacques Monod
estudavam os mecanismos envolvidos com o metabolismo da lactose. Os pesquisadores
compararam os níveis de expressão proteica sob condições fisiológicas e após a adição de
lactose. Após a adição desta molécula, observou-se que havia um aumento de cerca de 1.000
vezes da expressão de algumas proteínas além do que se observava sob condições fisiológicas.
Assim, substâncias que agem como a lactose foram genericamente denominadas indutores.
Jacob e Monod seguiram com outros experimentos. O objetivo destes cientistas era o
de responder como a bactéria é capaz de reconhecer especificamente quando deve haver a
expressão de uma determinada proteína e qual seria o papel dos indutores neste processo. Para
que a bactéria consiga se adaptar frente a esta mudança no suplemento de lactose, duas
enzimas são requeridas: uma permease, responsável pelo transporte da lactose para dentro da
célula, e a beta galactosidase, uma enzima que cliva a molécula de lactose em galactose e
glicose. Estas duas enzimas são codificadas por dois genes distintos e contínuos, o lacZ e o
lacY, respectivamente. Neste metabolismo, um terceiro gene, o lacA, também está envolvido.
Este último codifica uma transacetilase; entretanto, sua função específica ainda não está bem
elucidada.
Uma hipótese que os pesquisadores levantaram com o intuito de explicar como agem
os indutores seria de que estas moléculas ativavam um intermediário da beta galactosidase que
estava previamente acumulada. Contudo, estudos posteriores demonstraram que após a adição
do indutor, havia a síntese de novas moléculas. Assim, tornou-se claro que a célula dispõe de 47
mecanismos capazes de ativar a expressão gênica.
Quando Jacob e Monod induziram o aumento da expressão da galactosidase, eles
também induziram a expressão da permease e da transacetilase. Foram realizadas então
análises de mutantes que confirmaram que estas proteínas são codificadas por genes diferentes.
Portanto, os pesquisadores identificaram três genes distintos, cuja transcrição é controlada de
forma coordenada. Estudos posteriores de mapeamento demonstraram que os genes estavam
proximamente ligados no cromossomo e que estes eram transcritos em um mesmo RNAm. A
transcrição deste RNAm policistrônico demonstrou, portanto, que a regulação da transcrição é
um processo coordenado.
A análise de mutantes permitiu ainda que muitos clones de fenótipos diferentes fossem
analisados. Inicialmente, os pesquisadores isolaram um clone cujas células expressavam as três
enzimas envolvidas no metabolismo da lactose a um nível máximo. O mais intrigante era que isto
ocorria tanto na presença ou mesmo na ausência de um indutor. Assim, isolou-se um mutante
defectivo não na atividade enzimática, mas sim no controle da produção enzimática. A expressão
gênica deste mutante foi definida como constitutiva. A mutação ocorreu em uma região próxima
à região onde os genes destas proteínas se encontravam; contudo, a alteração não ocorria na
sequência codificadora destes genes. Assim, foi descoberto outro gene envolvido na regulação
da transcrição, o gene lacI.
A sequência codificadora relativa ao gene lacI foi localizada no mapa genético a uma
certa distância dos outros genes envolvidos com o metabolismo da lactose. Se mutantes
defectivos nesta enzima apresentavam como fenótipo uma expressão constitutiva, supôs-se que
a proteína LacI tinha uma função reguladora. No caso, ela atuava inibindo a transcrição de genes
do operon Lac. Uma propriedade essencial da molécula repressora é o reconhecimento de uma
determinada sequência de DNA para assegurar sua ligação somente em sítios envolvidos com o
controle da expressão de genes específicos. Assim, evita-se que a ligação aleatória a outras
regiões do DNA cromossomal prejudiquem a expressão de outros genes. Como a expressão dos
genes estruturais do operon Lac é bloqueada na ausência do indutor, diz-se que o operon está
sob controle negativo do repressor LacI.
A molécula repressora contém dois sítios de reconhecimento: um sítio que reconhece
uma sequência de DNA e outro que reconhece a lactose e seus análogos. Quando a lactose se
liga ao repressor, este sofre mudanças alostéricas, o que faz com que a proteína perca afinidade
ao DNA. Assim, o sistema é provido de um dos requerimentos básicos, o de reconhecer 48
determinadas condições nas quais deve haver a indução da expressão gênica. Por este motivo,
moléculas como a lactose e seus derivados são denominadas indutores.
O inibidor se liga a uma sequência de DNA conhecida como operador, que se localiza
próximo ao conjunto de genes que ele controla. No caso, o repressor do operon lactose, o
operador se liga a uma região do DNA próxima ao gene lacZ. A ligação do repressor ao operador
inibe o início da transcrição pela RNA polimerase.
Clones com mutações no operador também foram isolados, o que permitiu esclarecer
melhor o papel desta sequência na regulação do operon Lac. A expressão dos genes nestes
mutantes era constitutiva, mesmo na presença de uma molécula repressora ativa. Assim, outra
terminologia em relação à dominância destas mutações na expressão gênica foi adotada. A
habilidade de um gene afetar a expressão de outros próximos a ele no mesmo cromossomo é
denominada dominância cis. Portanto, este novo conceito se refere à interação física de
proteínas difundíveis com contato direto a uma sequência de DNA; no caso, esta é representada
pelo operador. Esta definição também permitiu que outra terminologia fosse adotada. A
regulação por produtos difusíveis, como a proteína inibidora LacI é conhecida como dominância
trans.
Análises de mutantes ainda revelaram a importância de regiões promotoras. No operon
Lac, elas se localizam entre o operador e o gene lacI. Mutações nesta sequência também são cis
dominantes, o que já é esperado para a sequência reconhecida pela RNAP e responsável pelo o
início da transcrição. Um esquema geral da regulação do operon Lac está representado na Fig.
21.
FIGURA 21: ESQUEMA GERAL DA REGULAÇÃO DO OPERON LAC

49

(Figura modificada de Griffiths et al., 2002).

Estudos adicionais com o operon Lac demonstram que para a expressão de genes
envolvidos com o metabolismo da lactose não bastava apenas à adição do indutor. Quando
havia suplemento de glicose à célula, mesmo na presença da lactose, não induzia a expressão
gênica relativa ao operon Lac. Isto se deve ao fato de que a maquinaria celular utiliza
preferencialmente o metabolismo de glicose quando esta está presente. Assim, a célula inibe a
expressão dos genes do operon Lac quando a glicose está presente, demonstrando outro
controle adicional ao operon.
O metabolismo de glicose inibe a expressão do opero Lac e este controle é
denominado repressão catabólica, o qual é exercido por um produto derivado do catabolismo da
glicose, o monofosfato adenosina cílico (cAMP). Quando a glicose está presente em altas
concentrações, os níveis de cAMP são baixos; por outro lado, quando os níveis de glicose são
baixos, os níveis de cAMP são altos.
Apesar de altos níveis de cAMP serem necessários para a ativação do operon Lac,
uma outra proteína é necessária para iniciar o processo. A proteína CAP, codificada pelo gene
crp, forma um complexo com cAMP, que será então capaz de se ligar ao operon. A proteína
ligada ao DNA interage com a RNAP, aumentando a afinidade desta ao promotor. Portanto, além
do controle negativo exercido pela proteína LacI, o operon ainda está submetido a um controle
positivo. Nesse caso, o ativador cAPM-CAP é requerido para iniciar a expressão gênica.
Para que os ativadores e repressoras sejam capazes de exercer de maneira eficaz
suas atividades, estas moléculas precisam apresentar duas conformações: uma em que sejam
capazes de se ligar ao DNA e outra em que esta ligação não seja possível. Para isso, os
ativadores e repressores apresentam dois sítios de ligação: um ao DNA e outro ao sítio
alostérico; este último interage com os efetores. Quando os efetores, que no caso do operon Lac
são os próprios indutores, ligam-se ao sítio alostérico, eles induzem uma mudança
conformacional na proteína reguladora, induzindo uma alteração na estrutura do domínio que se
liga ao DNA. 50
A ação dos efetores baseadas na sua ligação aos sítios alostéricos varia de acordo
com cada situação. Em algumas, o ativador ou repressor precisam se ligar ao seu efetor para
conseguir se ligar ao DNA; em outros casos, as proteínas reguladoras se ligam ao DNA somente
na ausência de seus efetores.

2.9.2 Regulação genética em eucariotos

O processo de regulação gênica também é essencial para a manutenção da


homeostase de células eucariotas. Muitos dos aspectos envolvidos na regulação da expressão
gênica são similares aos observados em procariotos, apesar de ser um processo mais complexo.
Alguns genes devem responder a mudanças fisiológicas; outros, a produtos reguladores do
desenvolvimento. Portanto, a complexidade se faz necessária devido ao alto grau de
especialização de células eucariotas, sendo que cada tipo celular expressa somente proteínas
específicas envolvidas com determinadas funções.
Assim como em procariotos, a expressão da maioria dos genes eucariotos é regulada
a nível transcricional, sendo que os mecanismos que a controlam também são semelhantes.
Proteínas reguladoras de dominância trans se ligam a seus respectivos alvos, as sequências de
DNA de dominância cis. Contudo, para coordenar a expressão de um organismo multicelular, há
algumas diferenças entre a regulação gênica de procariotos e de eucariotos.

 SEQUÊNCIAS DE DOMINÂNCIA CIS

Para que a RNAP II alcance a máxima taxa de transcrição, é necessário que haja a
cooperação entre vários elementos reguladores de dominância cis. Estes elementos podem ser
classificados em três classes de acordo com a localização relativa dos mesmos. Próximo ao sítio
de início da transcrição se encontra a sequência a qual a RNAP irá se ligar, o promotor. Outras
sequências próximas ao promotor são também sequências reguladoras as quais se ligam
proteínas que auxiliam na ligação da RNAP II à sequência promotora. Uma terceira sequência se
refere aos elementos cis que agem a uma distância considerável; estas sequências são
denominadas de intensificadores ou silenciadores, de acordo com os efeitos que suas ações 51
proporcionam.

 PROMOTORES E SEUS ELEMENTOS PROXIMAIS

Assim como descrito anteriormente, o promotor é uma sequência de DNA que se


localiza a aproximadamente 30 pb do sítio de início da transcrição. Esta sequência é
denominada de TATA boxe.
Além do promotor, outros elementos cis são necessários para que a RNAP II inicie de
maneira eficiente a transcrição gênica. Alguns dos elementos, próximos ao promotor se
localizam cerca de 100 a 200 pb do sítio de início da transcrição. A maioria destes elementos
possui uma citosina na posição -1 e um resíduo de adenina na posição +1. Estudos de
mutagênese nestes sítios demonstraram que esta sequência determina a força do promotor,
afetando então a taxa com que os transcritos são produzidos. Um exemplo destes elementos
são as sequências CCAAT. Contudo, ao contrário da sequência promotora conservada do TATA
boxe, a dos iniciadores é extremamente degenerada.
Há ainda um terceiro elemento de ação cis que auxilia no início da transcrição. Apesar
de o início da transcrição no TATA boxe iniciar em um sítio bem definido, em algumas proteínas
o processo ocorre em um sítio localizado de 20 a 200 pb do sítio de início. Como resultado, estes
genes dão origem a RNAm com múltiplos finais 5´ alternativos. Estes genes são transcritos a
taxas baixas e não contém a sequência TATA boxe. Em seu lugar, há uma região rica em
dinucleotídeos CG compostos por 20 a 50 nucleotídeos, estando localizados a 100 pb a jusante
do sítio de início da transcrição. Estas são denominadas ilhas CpG. A representatividade destes
dinucleotídeos é baixa em DNA de vertebrados, sendo reconhecida pelo fator de transcrição
SP1. Um esquema geral da estrutura da região promotora está representado na Fig. 22.
FIGURA 22: ESQUEMA GERAL DA DO PROMOTOR EUCARIOTO E DE SUAS
REGIÕES PROXIMAIS

52

 ELEMENTOS CIS QUE AGEM A DISTÂNCIA

Em eucariotos, há duas classes de elementos capazes de exercer seus efeitos a uma


considerável distância do promotor. Eles são os intensificadores e os silenciadores.
Os intensificadores são elementos de ação cis que podem aumentar de forma
significativa as taxas de transcrição pela RNAP II a partir de promotores presentes na mesma
molécula de DNA. Por outro lado, os silenciadores são elementos de ação cis que têm efeito
oposto daqueles proporcionados pelos intensificadores. Ao primeiro, se ligam os repressores,
que inibem ou reduzem a transcrição.
Quanto à estrutura destes elementos, elas se assemelham aos dos elementos
proximais aos promotores; logo, estão organizados em série e são reconhecidos por proteínas
trans. Contudo, a diferença é a distância em relação ao sítio de início da transcrição. Para os
intensificadores e silenciadores, esta distância pode chegar a 50 kb ou mais, sendo que ainda
possa se localizar a jusante ou mesmo depois do promotor.
A presença de múltiplas sequências é comum para os intensificadores. Além disso,
elas podem ser distintas. Esta diferença serve como sítio alvo para o reconhecimento por
proteínas reguladoras específicas.

 MECANISMOS PARA AÇÃO A DISTÂNCIA DOS INTENSIFICADORES E DOS


SILENCIADORES
A distância que estes intensificadores ou silenciadores se localizam em relação ao
promotor é algo intrigante e muitas questões são postas a fim de esclarecer como é o
mecanismo de ação destes elementos. O modelo proposto sugere que a molécula de DNA deva
sofrer um “looping”, permitindo que todos os elementos necessários para o início da transcrição
estejam em contato e que se associem às proteínas ligadas aos sítios próximos ao promotor
(Fig. 23). 53

FIGURA 23: MODELO PROPOSTO PARA EXPLICAR O MECANISMO DE AÇÃO DOS


INTENSIFICADORES E DOS SILENCIADORES

Os fatores de transcrição basais, apesar de serem essenciais para iniciar a transcrição,


não podem aumentar ou diminuir a taxa de transcritos. Para isso, outras sequências reguladoras
estão envolvidas, como os intensificadores e os silenciadores. A figura demonstra como os
ativadores e repressores que se ligam aos sítios distantes do promotor interagem. Para isso, o
DNA sofre uma dobra ou “looping”. (Figura modificada de Griffiths et al., 2002).
Em relação às proteínas reguladoras, estas constituem um conjunto extremamente
diversificado de polipeptídeos distintos. Na transcrição, algumas proteínas geralmente se ligam a
RNAP, formando então o complexo de iniciação da transcrição. Alguns destes fatores
normalmente se encontram associados a um determinado complexo e, por isso, são
denominados como fatores de transcrição gerais ou basais. Eles são considerados como os
requerimentos mínimos para que a transcrição se inicie.
Outros fatores de transcrição estão envolvidos na regulação gênica tecido-específico,
sendo que muitos intensificadores estão envolvidos neste caso. A regulação pode ocorrer de
duas maneiras: um intensificador pode agir de maneira tecido-específico se o ativador estiver
presente em somente um tipo celular. Alternativamente, uma molécula repressora pode se ligar a 54
um silenciador que se localiza muito próximo a um intensificador, tornando-o inacessível ao fator
de transcrição e, portanto, inativando-o.
Em eucariotos mais complexos, pode haver numerosos intensificadores envolvidos
com a expressão de um determinado gene. Em Drosophila, por exemplo, o gene dpp, que
codifica uma proteína de sinalização celular, pode conter de dezenas a centenas de
intensificadores. Isto também torna o processo ainda mais complexo. Este requerimento é uma
das explicações para o tamanho de genes de eucariotos.
Apesar da importância destas proteínas reguladoras, poucas são conhecidas
atualmente e os seus mecanismos de ação ainda são pouco esclarecidos. Muitos esforços têm
sido dedicados à identificação destas proteínas e o mecanismo desta para regular a expressão
gênica.

 REGULAÇÃO DOS FATORES DE TRANSCRIÇÃO

A regulação dos diferentes fatores de transcrição ainda é um processo pouco


elucidado. A complexidade envolvida dificulta que todos os elementos sejam estudados mais a
fundo. Por exemplo, fatores envolvidos com a regulação gênica de tecidos específicos são
regulados por diferentes tipos celulares.
A regulação é um processo essencial. Assim como em procariotos, o reconhecimento
do momento adequado para a expressão de determinados genes é essencial para a manutenção
da homeostase celular de células eucariotas. Alguns estudos têm esclarecido mais sobre a
resposta destas células sob mudanças fisiológicas. Uma maneira de regulação é influenciada
pela ação do sistema endócrino. Hormônios são moléculas que podem circular por todo o
organismo até chegar ao seu local de ação.
Por serem moléculas lipossolúveis, elas conseguem passar pela membrana
plasmática, sem exigir mecanismos mais sofisticados. Na célula, hormônios esteroides se ligam
a fatores de transcrição presentes no núcleo e os regulam.

 ESTRUTURA DAS PROTEÍNAS REGULADORAS


55
Análises das sequências e comparações estruturais de proteínas reguladoras
procariotas e eucariotas indicam que as mesmas possuem características em comum. Algumas
apresentam domínios conservados, que podem ser aqueles envolvidos na ligação à molécula de
DNA. Esses motivos são bem característicos dos fatores de transcrição em eucariotos e, por
isso, são classificados de acordo com o tipo de domínio que eles contêm.
Alguns domínios podem estar presentes na porção final 3´ da proteína; contudo, esta
localização pode variar. Algumas proteínas como o repressor LacI e a proteína CAP, apresentam
estruturas em α hélice que se liga ao sulco maior do DNA. Estudos a respeito da interação entre
proteínas reguladoras e DNA demonstraram que estas apresentam duas α hélices conectadas
por um giro na estrutura secundária da proteína que interagem com dois sulcos maiores
consecutivos do DNA e. Este motivo é conhecido como hélice-giro-hélice (Fig. 24).

FIGURA 24: MOTIVO HÉLICE-GIRO-HÉLICE DE PROTEÍNAS REGULADORAS QUE


INTERAGEM COM O DNA.
A figura apresenta duas α hélices conectadas por um giro, motivo comum a muitas
proteínas reguladoras. (Figura modificada de Griffiths et al., 2002).
Outros motivos para que as proteínas reguladoras se liguem ao DNA também foram
descritos. Um deles é “zinc-finger” ou “dedos de zinco”. Neste tipo de interação, duas cisteínas e
duas histidinas interagem com um átomo de zinco. Cada dedo de zinco é capaz, aparentemente,
de interagir com uma sequência de DNA específica (Fig. 25). 56

FIGURA 25: MOTIVO “ZINC FINGER”.

A figura mostra uma parte deste motivo, no qual um átomo de zinco se conjuga a
quatro aminoácidos (duas cisteínas e duas histidinas) de uma cadeia polipeptídica.
3 A TECNOLOGIA DO DNA RECOMBINANTE

As descobertas da estrutura e da função do DNA e da síntese proteica foram os


primeiros passos para o isolamento e, consequentemente, uma análise mais detalhada dos
genes. Alguns motivos justificam este interesse: 57
I. O isolamento de um gene permite a determinação da sequência nucleotídica,
caracterizando marcos interno do mesmo, como introns e peptídeos sinais. Esta sequência pode
ainda ser utilizada na genômica comparativa, que consiste em comparações de sequências entre
organismos filogeneticamente próximos. Assim, além de possibilitar estudos de evolução, pode
auxiliar também na descoberta da função do gene isolado;
II. A composição de aminoácidos, assim como a de nucleotídeos, também auxilia
na história da genômica comparativa, deduzindo-se a função de uma determinada proteína;
III. Um gene pode ser transferido de um organismo a outro, possibilitando o
desenvolvimento de organismos transgênicos. Esses possuem diversas utilizações na
biotecnologia, seja na pesquisa básica ou mesmo em aplicações comerciais especializadas. Um
exemplo é a produção de insulina a partir de bactérias transgênicas, as quais contêm e
expressam o gene humano que codifica esta proteína.
As aplicações a que o isolamento e caracterização de um gene permitem são
inúmeras, incluindo a produção de medicamentos e de vacinas, por exemplo. Portanto, o
isolamento gênico se tornou indispensável para a geração de novos bens e serviços
biotecnológicos. Este módulo trata das metodologias envolvidas com este processo, a tecnologia
do DNA recombinante.
O aprofundamento em conhecimentos de genética abriu a imaginação dos
pesquisadores e esta ciência se tornou uma das ferramentas mais importantes para o
desenvolvimento de técnicas biotecnológicas. Aliado a isto, o conhecimento multidisciplinar de
áreas como a biologia molecular e bioquímica permitiu que a biotecnologia avançasse a
aplicações industriais. A metodologia envolvida neste processo abarca diversas técnicas que
englobam a manipulação do DNA visando à produção de bens de interesse comercial. Esta
tecnologia do DNA recombinante, também conhecida como clonagem gênica ou clonagem
molecular, compreende processos de transferência da informação genética (DNA) de um
organismo a outro. Apesar de não haver uma metodologia universal, os experimentos seguem
um protocolo similar (Fig. 26):
I. O primeiro passo consiste em caracterizar um gene de interesse. Tendo-se um
conhecimento prévio do mesmo, o segundo passo consiste em isolar o DNA do organismo que o
contém; este é denominado organismo doador;
II. O DNA de um organismo doador é extraído e sofre uma clivagem ou digestão 58
enzimática. Em seguida, os fragmentos gerados na digestão são ligados a outra molécula de
DNA que deve ter uma replicação autônoma, tais como os plasmídeos bacterianos. Esta
molécula atua como portadora dos fragmentos de DNA e é denominada vetor de clonagem.
Assim, há a formação de um DNA híbrido, ou uma molécula de DNA recombinante. Este é
também designado como DNA quimérico, uma analogia ao monstro grego mitológico Quimera;
III. O passo seguinte à obtenção da molécula de DNA que codifica uma proteína de
interesse é permitir a perpetuação do vetor recombinante até a produção do bem de escolha.
Para isso, há a necessidade de selecionar uma célula hospedeira apropriada a qual será
introduzido o vetor recombinante. A introdução do material genético na célula hospedeira ocorre
por um processo denominado transformação;
IV. As células hospedeiras são então plaqueadas e deixadas crescer em colônias
separadas. Uma célula individual transformada com um único vetor recombinante irá se dividir
em uma colônia com milhões de células, todas portando o mesmo vetor recombinante. Portanto,
esta célula individual é capaz de se multiplicar e gerar uma população que contém cópias
idênticas do DNA híbrido; esta população é designada clone de DNA. Nesse caso, diz-se que o
hospedeiro amplificou a molécula recombinante de interesse;
V. Como o DNA foi digerido em muitos fragmentos que podem conter insertos de
DNA diferentes, é necessário selecionar o clone bacteriano que contenha o material genético
desejado;
VI. Uma vez obtido o clone de interesse, o passo final consiste em submetê-lo a
uma série de análises que permitam verificar se construção recombinante em um determinado
hospedeiro é capaz de expressar, tanto quantitativamente quanto qualitativamente, a proteína de
interesse.
FIGURA 26: METODOLOGIA GERAL UTILIZADA PELA TECNOLOGIA DO DNA
RECOMBINANTE

59

O DNA do organismo doador e o do vetor são digeridos com enzimas de restrição. O


fragmento de interesse e o vetor linearizado são ligados e transformados em uma célula
hospedeira apropriada. Esta permite a expressão da proteína de interesse (representada pelas
três bolinhas vermelhas).
A geração de moléculas recombinantes pela clonagem molecular deve ser diferenciada
daquelas obtidas por processos de “crossing-over” que ocorre entre cromossomos homólogos de
eucariotos. A tecnologia do DNA recombinante consiste em procedimentos de manipulação
experimental que permitem que DNA de fontes diferentes ou heterólogas seja inserido em um
hospedeiro capaz de perpetuar o material genético de interesse, produzindo-o de maneira
apropriada.
3.1 ISOLAMENTO DE GENES

3.1.1 Extração de DNA

60
Como comentado anteriormente, o passo inicial no isolamento de um gene consiste em
extrair o DNA do organismo doador. Diferentes tipos de protocolos estão disponíveis e permitem
que a extração obtenha um material em grande quantidade e com alto grau de pureza. Após
identificar quais genes se deseja estudar, procede-se ao isolamento do DNA genômico de
eucariotos ou de procariotos. Para o vetor, o procedimento a ser adotado é dependente da
natureza do mesmo. No caso de DNA plasmidial, este pode ser purificado do DNA genômico
após a ultracentrifugação em um gradiente de densidade do cloreto de césio contendo brometo
de etídeo. Este material, além de ser um agente intercalante de DNA, que permite que o mesmo
seja visualizado após sua exposição à luz ultravioleta. Permite que o DNA plasmidial se torne
mais denso que o genômico e com isso, os plasmídeos formam uma banda distinta na
centrifugação e podem ser separados (Fig. 27).

FIGURA 27: ISOLAMENTO DE DNA PLASMIDIAL POR ULTRACENTRIFUGAÇÃO


EM CLORETO DE CÉSIO

Inicialmente, um clone é selecionado e certificado se contém o material de interesse, o


que geralmente se faz por seleção a antibióticos. (1) O DNA é então, extraído e colocado em um
gradiente de cloreto de césio e brometo de etídeo; (2) esta mistura é submetida a uma
ultracentrifugação neste gradiente. Devido à ligação diferencial do brometo de etídeo nestas
duas espécies de DNA, o DNA plasmidial se torna mais denso que o cromossômico. Assim, duas
bandas distintas entre as duas espécies de DNA são formadas. Após um furo na porção de baixo
do tubo, pode-se separar o (3) DNA cromossomal e (4) DNA plasmidial.
O DNA plasmidial ainda pode ser extraído por uma técnica rotineiramente utilizada em 61
laboratórios de biotecnologia, a lise alcalina. Este método se baseia na observação de que sob
um determinado pH alcalino, o DNA genômico bacteriano se desnatura, o que não ocorre com os
plasmídeos. Este material desnaturado é então submetido a uma neutralização que precipita o
DNA genômico, mas os plasmídeos permanecem em solução.
Procedimentos semelhantes ao utilizado no isolamento de plasmídeos são utilizados
para outros vetores, como cosmídeos. No caso de fagos, recupera-se uma suspensão pura dos
mesmos e o DNA é obtido após a lise das partículas virais.
Após a extração e purificação do DNA genômico e do vetor, o fragmento de DNA
contendo o gene de interesse precisa ser isolado e ligado a um vetor de clonagem,
proporcionando a perpetuação do DNA híbrido. O primeiro impasse a este procedimento é o
isolamento do fragmento. Inicialmente, o DNA cromossômico era submetido a um processo de
quebras mecânicas aleatórias, o que pode ser obtido por sucessivas passagens do material por
uma seringa ou mesmo por sonicação. Contudo, este procedimento gera desde fragmentos
grandes, como 5 Kb, até mesmo fragmentos muito pequenos. Aliado a isto, esta fragmentação é
aleatória, o que aumenta a probabilidade de a sequência de interesse seja fragmentada e
somente porções desta sejam clonadas. Assim, para o isolamento de uma determinada
sequência, vários clones devem ser analisados.
A fragmentação aleatória de sequências de DNA ainda interfere na eficiência da
clonagem. As extremidades geradas não são complementares, o que dificulta a ligação do
inserto ao seu vetor de clonagem. A eficiência da clonagem ainda é afetada pelo tamanho dos
fragmentos. Fragmentos menores, de baixo peso molecular, são mais fáceis de ligá-los ao vetor.
Contudo, eles são facilmente perdidos ou não recuperados. Por outro lado, a clonagem de
fragmentos de alto peso molecular é um procedimento mais complicado e de baixa eficiência.
Uma grande conquista que permitiu o grande salto da tecnologia do DNA recombinante
foi à descoberta de enzimas que clivam o DNA após o reconhecimento de sequências
específicas. As enzimas responsáveis por esta digestão enzimática são as enzimas de restrição.
3.1.2 Enzimas de restrição

As enzimas de restrição são endonucleases responsáveis pela quebra enzimática da


ligação fosfodiéster do DNA. O termo “restrição” foi adotado devido à história da descoberta
destas enzimas. Durante o estudo da infecção de E. coli por bacteriófagos, observou-se que 62
somente algumas bactérias eram infectadas por estes vírus e, por isso, os pesquisadores
relatavam que a infecção ficava “restrita”. Estudos posteriores demonstraram que após a
penetração do DNA do fago na bactéria, certas enzimas de E. coli eram capazes de reconhecê-
lo e clivá-lo. Estas enzimas foram denominadas genericamente como enzimas de restrição.
A nomenclatura das enzimas de restrição é feita pelas iniciais do organismo a partir do
qual ela foi isolada, incluindo a identificação da linhagem, e por algarismos romanos que indicam
a ordem na qual foi encontrada na cepa. Assim, por exemplo, a EcoRI, uma enzima
extremamente utilizada em procedimentos de biologia molecular, significa que esta foi a primeira
enzima isolada de Escherichia coli, linhagem R. A primeira letra em maiúsculo representa o
gênero e as primeiras duas letras da espécie são escritas em minúsculo. Os números em
algarismos romanos são utilizados para designar a ordem de caracterização de diferentes
enzimas de restrição isoladas do mesmo organismo. Muitas enzimas de restrição já foram
isoladas e seus sítios de restrição identificados (Tabela 1).

Enzima Sítio de restrição Tipo de extremidade


EcoRI G A-A-T-T-C Extensão 5´ fosfato
C-T-T-A-A G
BamHI G G-A-T-C-C Extensão 5´ fosfato
C-C-T-A-G G
PstI C-T-G-C-A G Extensão 3´ fosfato
G A-C-G-T-C
PvuII C-A-G C-T-G Extremidade cega
G-T-C G-A-C
HpaI G-T-T A-A-C Extremidade cega
C-A-A T-T-G
HaeIII G-G C-C Extremidade cega
C-C G-G
NotI G C-G-G-C-C- Extensão 5´ fosfato
G-C
C-G-C-C-G-G-
CG 63
Tabela 1: Sítios de restrição reconhecidos por diferentes enzimas de restrição e o tipo de extremidade
que elas geram. (Tabela modificada de Glick & Paternak, 1994).

As enzimas de restrição são endonucleases que reconhecem regiões específicas de


DNA de 4 a 8 pb, chamados sítios de restrição. Qualquer molécula de DNA, desde vírus até o de
humanos, contém sítios alvos de enzimas de restrição, que se encontram distribuídos ao acaso.
Assim, com a digestão enzimática do DNA obtidos de diversas fontes, os fragmentos gerados
apresentam um tamanho definido e adequado para os procedimentos de clonagem. A clivagem
enzimática ocorre entre o oxigênio do carbono 3´ do açúcar de um nucleotídeo e ao grupo
fosfato do carbono 5´ do carbono do açúcar adjacente.
As enzimas de restrição são classificadas em três tipos: I, II e III. Todas estas enzimas
reconhecem sítios de restrição específicos. Contudo, as enzimas I e III clivam fora desta
sequência. Por sua vez, as do tipo II clivam dentro do sítio reconhecido por elas. Portanto, as
enzimas de restrição do tipo II são mais úteis em procedimentos que envolvem engenharia
genética, pois seu padrão de clivagem é previsível quando a sequência de DNA é conhecida.
O sítio de restrição das enzimas do tipo II possui um duplo eixo de simetria rotacional,
tendo a mesma sequência quando lida no sentido 5' para 3' em ambas as fitas. Em outras
palavras, ambos os filamentos de DNA reconhecidos pelas enzimas de restrição têm a mesma
sequência de nucleotídeos, porém em orientação antiparalela. Sequências que possuem estas
características são denominadas palindrômicas.
As aplicações das enzimas de restrição do tipo II para a tecnologia do DNA
recombinante são inúmeras. Uma delas é a construção de mapas físicos. Como a amostra de
DNA tratada com uma destas enzimas sempre apresentará sítios de restrição reconhecidos na
digestão enzimática, estas enzimas permitem a construção de mapas que representam o
conjunto de restrição reconhecido por enzimas diferentes dentro da mesma sequência. Estes
designam uma ordem linear de sítios de restrição referente a um fragmento de DNA específico.
Este mapa é obtido após a clivagem unicamente com uma determinada enzima e depois com
uma combinação delas. A posição dos sítios de clivagem é deduzida após a análise do peso
molecular destes fragmentos em gel de agarose (Fig. 28).

64
FIGURA 28: MAPA DE RESTRIÇÃO

(A) análise eletroforética representando o peso molecular da amostra de DNA obtida


após a digestão enzimática com as enzimas EcoRI e BamHI separadamente e com as duas
enzimas juntas. (B) mapa de restrição gerado após a digestão enzimática e separação por
eletroforese. (Figura modificada de Glick & Paternak, 1994).
Outras aplicações das enzimas de restrição do tipo II são decorrentes da característica
que a clivagem gera nas extremidades. A posição em que ocorre a clivagem do DNA pode gerar
dois tipos de extremidades: abruptas (ou cegas), quando a clivagem ocorre no centro de
simetria, ou coesivas (pontas adesivas), quando a clivagem ocorre fora do centro de simetria
(Fig. 29). Neste último caso, pode-se gerar uma extremidade saliente 5'ou 3' (Tabela 1).

FIGURA 29: EXTREMIDADES CEGAS E COESIVAS GERADAS APÓS A DIGESTÃO COM


ENZIMAS DE RESTRIÇÃO 65

Enzimas de restrição que clivem o DNA gerando desde extremidades cegas ou mesmo
coesivas podem ser utilizadas com sucesso na clonagem molecular. Contudo, a ligação do
inserto ao seu vetor é facilitada quando ambos sofrem uma digestão enzimática que gerem par
de pontas adesivas unifilamentares idênticas. Essas pontas são chamadas de adesivas porque
permitem que haja um pareamento com sequências complementares que serão unidas
(“grudadas”) por pontes de hidrogênio.
As enzimas de restrição que geram fragmentos de extremidades coesivas são
extremamente interessantes quando se deseja a inserção de uma sequência codificadora em
específico. Isto se deve ao fato de que somente filamentos complementares sejam capazes de
se ligar. Assim, uma digestão dupla com duas enzimas diferentes permite que a clonagem seja
direcional; ou seja, que a sequência codificadora se ligue a um sítio de distância ideal ao seu
promotor e na correta fase de leitura para a proteína.
Analisando a ação das enzimas de restrição, pode-se afirmar que as mesmas têm pelo
menos duas propriedades úteis à clonagem molecular: primeiramente, os fragmentos de
restrição apresentam um peso molecular adequado para a clonagem. Segundo muitas enzimas
de restrição clivam o DNA de forma a gerar extremidades coesivas, facilitando a ligação de
fontes diferentes de DNA que possuam extremidades complementares. Esta ligação ainda
ocorre de forma que a sequência codificadora ocorra de maneira direcional, ou seja, na fase 66
correta de leitura.
O uso unicamente de enzimas de restrição, entretanto, é insuficiente para finalizar o
procedimento de clonagem molecular. As extremidades geradas pela clivagem enzimática
podem se alinhar, mas a força das pontes de hidrogênio envolvidas na complementaridade de
bases não é suficiente para manter as moléculas de DNA referentes ao inserto e ao vetor juntas.
Há a necessidade de refazer a ligação internucleotídica entre o grupo hidroxila 3' e o grupo
fosfato 5' das extremidades onde a quebra das moléculas de DNA foi gerada. A análise da
replicação do DNA forneceu uma alternativa enzimática. Este problema é resolvido após o passo
da ligação enzimática.

3.1.3 Ligação enzimática

Recapitulando, o DNA de um organismo doador sofre uma digestão enzimática a fim


de produzir fragmentos com peso molecular adequado para a clonagem molecular. Para que
este procedimento seja facilitado, rotineiramente se adota como estratégia a digestão, tanto do
inserto como do vetor, com a mesma enzima de restrição. De preferência, utilizam-se enzimas
que produzam sítios de restrição com extremidades coesivas para facilitar a ligação. Embora os
filamentos complementares permitam que as moléculas se liguem por complementaridade de
bases, as sequências açúcar fosfato ainda não estão completas nas duas posições de cada
junção (Fig. 30). Para selar esta ligação, são utilizadas enzimas como a ligase.
FIGURA 30: LIGAÇÃO ENTRE EXTREMIDADES COESIVAS PELA AÇÃO DA LIGASE

67

Após a digestão enzimática, são geradas extremidades coesivas.


Moléculas digeridas com a mesma enzima irão se unir pela complementaridade de
bases. A especificidade entre o pareamento de bases permite a formação de pontes de
hidrogênio. Contudo, a união entre moléculas de DNA é finalizada pela formação de uma ligação
fosfodiéster entre as duas fitas de DNA por ação da enzima ligase.
As ligases são capazes de catalisar a formação de pontes fosfodiéster ao final das fitas
de DNA que estejam mantidas juntas pela complementaridade de bases ou mesmo quando as
extremidades cegas estejam em contato ao se ligarem à enzima. A enzima responsável por este
processo é a DNA ligase e em procedimentos biotecnológicos frequentemente se utiliza a
isolada do bacteriófago T4.
Conhecendo as técnicas e os procedimentos genéricos para a tecnologia do DNA
recombinante, os próximos tópicos tratarão de procedimentos mais específicos, como os
procedimentos para o isolamento de genes específicos. Contudo, inicialmente é preciso ter claro
a diferença de estrutura entre um gene eucarioto e um procarioto.

3.1.4 Diferença estrutural ente genes eucariotos e procariotos


Para a obtenção do inserto, inicialmente deve-se considerar se o gene de interesse
pertence a um organismo procarioto ou a um eucarioto. Esta diferenciação deve-se às
características estruturais dos genes destes dois organismos. Em procariotos, a sequência
codificadora de uma proteína frequentemente representa uma minúscula parcela do DNA
cromossomal (<0,02%). Os genes são sequências de DNA contínuas e organizadas em um
operon. Esta unidade transcricional permite que todos os genes relacionados a uma determinada 68
função sejam transcritos em um único RNAm policistrônico. Por outro lado, o gene de eucariotos
é formado pela sequência codificadora, os exons, que são interrompidos por sequências grandes
e não codificadoras, os introns. Portanto, diferentes estratégias de clonagem devem ser
adotadas para o isolamento e clonagem de genes eucariotos e procariotos.

3.1.5 Obtenção do inserto

 CONSTRUÇÃO DE BIBLIOTECAS GENÔMICAS E DE BIBLIOTECAS DE


cDNA

A obtenção de um determinado gene depende dos objetivos da clonagem, das


características do gene e, enfim, do conhecimento prévio que se tem a respeito do mesmo. Se
não há um conhecimento prévio da sequência, uma das alternativas para o isolamento do inserto
consiste em subdividir o DNA cromossomal em pequenos fragmentos que serão então clonados
em vetores. Em seguida, os vetores recombinantes são transformados em um hospedeiro e
então analisados e caracterizados. Teoricamente, este procedimento é capaz de obter clones
que representem todo o DNA genômico do organismo a ser estudado. Este é o princípio da
criação de uma biblioteca genômica ou banco gênico, elemento básico do processo inicial do
sequenciamento de genomas.
Uma das maneiras de criar uma biblioteca genômica é tratando o DNA com uma
endonuclease de restrição cujo sítio de restrição reconheça quatro pares de bases. Assim,
teoricamente o DNA será clivado aproximadamente a cada 256 pb. Entretanto, como as enzimas
de restrição reconhecem sítios específicos, pode ocorrer que os fragmentos gerados sejam
muito grandes, o que dificulta a clonagem. Se nem todos os fragmentos referentes ao genoma
total são clonados, então a biblioteca disponível para a seleção está incompleta e assim, o
fragmento de interesse pode estar interrompido ou mesmo ausente, dificultando a seleção de um
determinado gene. Para solucionar este problema, o DNA cromossomal é então submetido a
uma digestão parcial. Assim, geram-se fragmentos de diferentes tamanhos, permitindo que todos
os fragmentos estejam representados após a clonagem em um determinado vetor (Fig. 31). 69

FIGURA 31: DIGESTÃO PARCIAL DE UMA AMOSTRA DE DNA COM ENZIMAS DE


RESTRIÇÃO. MODIFICADA DE GLICK & PATERNAK, 1994)

A digestão parcial é realizada por variações no tempo ou na quantidade de enzima


utilizada. O resultado é a geração de fragmentos de vários tamanhos, o que permite que todos
sejam clonados e que a biblioteca genômica seja representativa. (Figura 31).
Além da biblioteca genômica, há a possibilidade de desenvolver uma biblioteca de
DNA complementar ou cDNA. O cDNA é um DNA sintético que tem como molde moléculas de
RNAm total de uma célula. Para este procedimento, utiliza-se uma enzima especial chamada
transcriptase reversa que irá fazer uma fita de DNA a partir de um molde de RNA. Essa enzima
foi originalmente isolada de membros da família Retrovidea, como o vírus da imunodeficiência
humana (HIV).
A geração de cDNA inicialmente se baseia em uma característica estrutural do RNAm,
a cauda poliA. Esta característica é usada para separar a fração composta por RNAm de outros
componentes, inclusive de outros tipos de RNA, como RNAr e RNAt. Isto é possível, pois
somente o RNAm possui a cauda de poliA em sua estrutura. Para a sua purificação, o material
derivado da extração de RNA é passado por uma coluna seletiva, a qual está ligada pequenas
cadeias curtas de resíduos de timina de aproximadamente 15 nucleotídeos. 70
Então, o RNAm se liga à coluna devido ao pareamento de bases entra a cauda poliA e
os resíduos de timina. Por outro lado, os RNAt e os RNAr passam com o fluxo e não são retidos
na coluna, pois não há um pareamento de bases que permita a ligação. Finalmente, o RNAm é
eluído da coluna após um tratamento com um tampão capaz de interromper as pontes de
hidrogênio formadas entre adenina e timina, liberando a molécula de RNAm.
Antes que as moléculas de RNAm possam ser clonadas em um determinado vetor,
elas precisam ser convertidas em uma molécula de DNA dupla fita. O sucesso deste
experimento depende da ação sucessiva de duas enzimas diferentes: a transcriptase reversa e
do fragmento de Klenow da DNAP I. Inicialmente, são adicionadas pequenas moléculas de
oligonucleotídeos compostos somente por timinas ao material de RNAm eluído da coluna
seletiva. Adicionalmente, é adicionada a enzima transcriptase reversa e os quatro
desoxirribonucleotídeos (dATP, dTTP, dGTP e dCTP). Neste procedimento, os pequenos
oligonucleotídeos de timina se pareiam a região da cauda poliA, providenciando uma
extremidade 3´ hidroxila para que a síntese de uma fita de DNA complementar seja iniciada.
A transcriptase reversa utiliza como molde uma fita simples de RNA para polimerizar
uma cadeia de DNA. Assim, os oligonucleotídeos referentes à composição estrutural do DNA
vão sendo incorporados à cadeia que está sendo polimerizada pela transcriptase reversa,
baseando-se na complementaridade de bases. Entretanto, a síntese in vitro realizada por esta
enzima é frequentemente um procedimento incompleto e somente uma fita simples de DNA é
produzida. Contudo, antes que a síntese desta fita simples de DNA seja finalizada, há a
formação de um “looping”, ou uma volta, na porção 5´, onde a fita de DNA se dobra sobre si
mesma. Esta sequência pode então ser utilizada como um “primer” para a polimerização da fita
dupla de DNA.
A segunda fita de DNA é sintetizada após a adição do fragmento de Klenow. Esta
enzima adiciona nucleotídeos complementares aos especificados pela fita simples sintetizada
pela transcriptase reversa, concluindo então a cadeia dupla de DNA. Para isso, o fragmento
utiliza como iniciador a volta formada pela dobra na porção 5´do cDNA.
Para finalizar o processo de geração de uma fita dupla de DNA a partir de RNAm, a
amostra é tratada com a enzima RNase H que tem por finalidade degradar moléculas de RNAm
molde. Finalmente, a volta de DNA formado na extremidade 5´ do cDNA é desfeito pela ação da
nuclease S1, que tem como princípio geral degradar extensões de DNA fita simples. Ao final de 71
todo o procedimento, tem-se uma amostra que apresenta uma mistura composta de cDNA de
dupla fita correspondente aos RNAm que sejam os mais representativos na amostra inicial. Este
material será clonado em um vetor apropriado. Um esquema geral do procedimento envolvido na
geração de cDNA está descrito na Fig. 32.

FIGURA 32: SÍNTESE DE CDNA.

Um iniciador composto de nucleotídeos de timina é adicionado à amostra contendo os


RNAm purificados. A transcriptase reversa e os quatro nucleotídeos constituintes da molécula de
DNA são adicionados ao RNAm. A fita simples de DNA complementar ao RNAm – cDNA – é
polimerizada, sendo que na porção 3´ do cDNA há a formação de uma volta sobre esta molécula
fita simples de DNA, que servirá como iniciador para a fita complementar ao cDNA para a de
DNA fita dupla. O “looping” que serviu de iniciador é rompido pela ação da nuclease S1. As fitas
de RNAm são degradadas pela ação da RNaseH.
A escolha entre as abordagens de construção de uma biblioteca genômica ou de uma
biblioteca de cDNA depende do experimento em questão e das perguntas que se deseja
responder. Se a pesquisa tem por finalidade o sequenciamento de um genoma, a biblioteca
necessita obter clones que representem todo o material genético daquele organismo. Somente 72
assim a sequência pode ser finalizada e anotada. A procura de um determinado gene em
específico e a análise de como ele se encontra estruturado no genoma, como em um operon,
além a análises de sequências reguladoras, requerem que uma determinada sequência grande
esteja contida em um determinado clone. Nesses casos, a melhor opção se faz pela construção
de uma biblioteca genômica.
Há casos em que a intenção de realizar um experimento é a análise de um
determinado produto proteico. Um exemplo é a análise de expressão de um gene específico e
peculiar a um determinado tipo de tecido ou mesmo que se suspeita estar envolvido com o
desenvolvimento de uma determinada patologia. O conhecimento de qual tecido o gene está
sendo expresso facilita a seleção deste gene de interesse, já que o mesmo deve estar
enriquecido de seus transcritos. Portanto, este tecido é utilizado como fonte de extração de
RNAm.
Outro aspecto é se a finalidade em isolar um gene é para que o mesmo seja expresso
em um hospedeiro diferente para fins comercias. Nesses casos, a biblioteca de cDNA é uma
opção. Isto é vantajoso principalmente quando se deseja expressar genes de eucariotos em
células bacterianas. Como o cDNA é uma cópia complementar ao RNAm maduro, que já sofreu
processamentos, então este cDNA não irá conter introns em sua sequência. Como as células
bacterianas não são capazes de remover os introns e unir somente os exons, a biblioteca de
cDNA é mais útil nestes casos. Contudo, deve-se lembrar de que o cDNA não apresenta as
regiões reguladoras que constituem um gene. Assim, neste último caso, a biblioteca genômica é
mais útil.
Em casos em que um determinado gene a ser estudado quanto a sua estrutura e
composição, o que não é possível simplesmente pela análise de cDNA, pode-se restringir a
fração genômica usada na construção da biblioteca genômica. Levando em consideração que
determinados genomas são extremamente grandes e até mesmo composto por um conjunto de
cromossomos, a restrição se faz possível se o pesquisador conhecer previamente em qual
cromossomo o gene está localizado.
Uma das técnicas utilizadas com este processo baseia-se na seleção de cromossomos
com o uso de um instrumento denominado citômetro de fluxo. Uma suspensão de cromossomos
é separada por este aparelho de acordo com o peso molecular e a fração contendo o gene de
interesse é utilizada na construção da biblioteca genômica. 73
Outra técnica possível é fracionar cromossomos inteiros pela técnica de eletroforese
em gel de campo pulsado (PFGE). A eletroforese é uma técnica que separa fragmentos de ácido
nucleico ou proteínas em géis de acordo com o tamanho quando expostos a um campo elétrico.
A PFGE ou “pulse field” é uma eletroforese mais especializada que permite a separação de
moléculas muito longas de DNA.
A técnica consiste em imprimir vários campos elétricos oscilantes orientados em várias
direções diferentes. Essa estratégia permite até mesmo que determinadas moléculas
cromossomais inteiras passem no gel para posições diferentes de acordo com o tamanho de
cada uma (Fig. 33). O cromossomo desejado é então separado do gel, eluído e finalmente
utilizado na construção da biblioteca genômica.
FIGURA 33: METODOLOGIA DO PGFE

74

O gel de agarose com as amostras de DNA são corridas em um aparelho hexagonal


que permite que o campo elétrico seja alternado a 120° a cada 90 segundos por 18 a 24 horas a
14°C. As moléculas de DNA migram paralelamente ao campo elétrico. Os fragmentos de peso
molecular maior levam mais tempo para migrarem no gel em relação às de peso molecular
menor. Isso permite que bandas distintas sejam visualizadas em um gel de agarose. S1, S2 e S3
são amostras diferentes; Mkr: marcador de peso molecular.
A construção de bibliotecas é utilizada quando não há um conhecimento prévio a
respeito da sequência de nucleotídeos que constituem um gene. Em casos de organismos em
que o genoma já foi sequenciado, o isolamento de sequências específicas é extremamente
facilitado, sendo que a produção pode ser sintética ou mesmo por técnicas de biologia molecular,
como o PCR.

 PRODUÇÃO SINTÉTICA DE GENES

A produção química de um gene ou mesmo de seus fragmentos ocorre pela síntese de


cada fita complementar separadamente. Fragmentos curtos, entre 60 a 80 pb, podem ser
produzidos por fitas complementares separadamente que depois são aneladas entre si. Contudo,
para a produção de fragmentos maiores, como acima de 300 pb, técnicas mais apuradas devem
ser utilizadas. Isto se deve ao fato da eficiência de ciclos envolvidos durante a síntese química
não apresentarem uma eficiência de 100%.
Um dos métodos para a síntese de fragmentos maiores consiste na síntese inicial de
oligonucleotídeos complementares e sobrepostos, compostos de 20 a 60 nucleotídeos. O 75
planejamento para a síntese de cada fita ocorre de maneira que após o anelamento, os dois
fragmentos de um gene sejam alinhados de forma que as extremidades de seus fragmentos se
apresentem cegas, sem fitas complementares. Cada fita sintetizada apresenta seu segmento
complementar e as extremidades 5´ e 3´ são também projetadas para que apresentem uma
complementaridade, o que permite a montagem dos fragmentos de acordo com a sequência do
gene (Fig. 34).
Após o anelamento entre os fragmentos, o último passo para concluir a síntese
química de um gene é selar os fragmentos entre as extremidades 5´e 3´ das fitas adjacentes.
Isto é possível pela ação da T4 DNA ligase.
FIGURA 34: SÍNTESE DE UMA SEQUÊNCIA CODIFICADORA A PARTIR DO
ANELAMENTO ENTRE OLIGONUCLEOTÍDEOS

76

Esses são fabricados de forma que o anelamento entre as fitas complementares


permita que uma fita dupla de DNA completa seja formada. Para selar a cadeia, as ligações
fosfodiéster são ligadas por ação da enzima T4 ligase. (Figura modificada de Glick & Paternak,
1994).
Uma modificação deste método foi criada como alternativa para a produção química de
genes. Inicialmente, são sintetizados oligonucleotídeos complementares e sobrepostos por
aproximadamente 40 a 100 nucleotídeos. Após o anelamento entre as fitas complementares,
permanecem grandes regiões de sequências que não anelaram a outra sequência
complementar, ou seja, compostas somente por fita simples (Fig. 35). Apesar disso, as fitas se
mantêm unidas, o que se deve à região de nucleotídeos sobrepostos. Estes buracos constituídos
por fita simples são então completados pela ação de polimerização da DNAP I de E. coli. Após a
finalização deste processo, as fitas são seladas pela ação da enzima T4 DNA ligase.

FIGURA 35: SÍNTESE IN VITRO DE UM GENE A PARTIR DE OLIGONUCLEOTÍDEOS


SINTETIZADOS QUIMICAMENTE 77

As sequências dos oligonucleotídeos são desenhadas de maneira que ao se anelarem


à suas sequências complementares, haja também fitas simples não pareadas (“gaps”). Para a
formação de fita dupla por toda molécula de DNA, os “gaps” são preenchidos por meio de uma
síntese enzimática pela DNAP I e, finalmente, a fita de DNA é selada pela ação da enzima T4
ligase. (Figura modificada de Glick & Paternak, 1994).
Para fragmentos maiores que 1.000 pb, a sequência gênica completa é
frequentemente feita a partir da união de fragmentos de fita dupla de 20 a 60 pb, que se anelam
entre si pela complementaridade entre quatro a seis nucleotídeos sobrepostos. Se há uma
quantidade suficiente de fragmentos fita dupla após a síntese e anelamento, eles são
simplesmente ligados uns aos outros. Caso contrário, cada fragmento deve ser clonado a um
vetor para que a quantidade de DNA seja amplificada. Contudo, em ambos os casos as
construções de fragmentos fita dupla de DNA são ligados de forma sequencial, a fim de formar a
sequência completa de um determinado gene.
Mesmo sendo a síntese química uma estratégia capaz de atingir seus objetivos com 78
sucesso, como mencionado anteriormente ela não é 100% eficaz. Assim, o fragmento obtido por
este procedimento deve ser necessariamente sequenciado. Isso envolve gastos, que se
somados ao alto custo do próprio procedimento de síntese química, pode se tornar inviável.
Alternativas estão disponíveis, e que são capazes de realizar o mesmo procedimento quando se
tem o prévio conhecimento a respeito da sequência de um gene. Uma destas técnicas é a
amplificação do DNA, através da reação em cadeia pela polimerase, o PCR.

 Reação em Cadeia pela Polimerase - PCR

A reação em cadeia pela polimerase (PCR) é muito efetiva em gerar quantidades


extraordinárias do DNA de interesse in vitro. É uma técnica extremamente sensível, sendo capaz
de amplificar DNA a partir de picogramas da amostra. Alguns requerimentos são essenciais para
a realização da técnica:
I. Um par de oligonucleotídeos sintéticos, denominados de oligonucleotídeos
iniciadores (primers), deve ser desenhado de maneira complementar a sequência de interesse.
Esses iniciadores devem ser compostos por aproximadamente 20 pb e sua composição de
nucleotídeos deve ser idealmente balanceada para que haja uma equivalência da proporção A +
T e C + G. Um dos iniciadores deve ser desenhado de maneira complementar à fita molde e o
outro, à codificadora. A sequência dos dois iniciadores deve ser orientada de maneira oposta às
fitas de DNA;
II. A sequência alvo a ser amplificada e que se encontra dentro da amplitude dos
iniciadores deve ser composta de 100 a 5.000 nucleotídeos em sua extensão. Entretanto, a
biologia molecular moderna tem avançado enormemente, e muitos produtos novos têm sido
aprimorados. Portanto, o tamanho do fragmento a ser amplificado deve ser condizente com a
capacidade de polimerização de cada enzima polimerase específica a ser utilizada no processo;
III. A enzima responsável pela a polimerização das cópias referente à sequência
específica, genericamente conhecida como Taq DNA polimerase, deve ser capaz de resistir a
altas temperaturas, como 95°C ou mais;
IV. Para que a reação de polimerização ocorra, devem ser adicionados à mistura
contendo DNA, enzima e tampão, os quatros oligonucleotídeos (dNTPs, dATP, dTTP, dCTP,
dGTP). 79
A metodologia adotada para a amplificação de fragmentos de DNA é muito similar ao
processo de transcrição, sendo que uma das diferenças é que ao final da PCR são obtidas
moléculas de DNA fita dupla ao invés de moléculas de RNA fita simples. A metodologia da PCR
consiste em vários ciclos sucessivos, sendo que cada um têm pelo menos três passos básicos:
I. Desnaturação: o primeiro passo consiste na desnaturação do DNA pelo aumento de
temperatura, geralmente obtido a 95°C. Esta temperatura é mantida por aproximadamente um
minuto;
II. Anelamento: neste passo, realizado a aproximadamente 55ºC, o par de iniciadores
se anela à sequência complementar de DNA da amostra;
III. Polimerização: este passo é realizado com uma temperatura média 72ºC que é
ótima para a função catalítica da Taq DNA polimerase. A síntese se inicia na porção hidroxila 3´
de cada iniciador.
IV. A duração de cada um dos passos e a temperatura utilizada nos mesmos variam
enormemente e, por isso, cada protocolo precisa ser padronizado para a sua utilização. A reação
de amplificação ocorre em um aparelho automatizado e programável, o termociclador.
Para entender como se sucede a amplificação dos fragmentos de DNA, deve-se ter em
mente a localização de cada iniciador durante o anelamento. No primeiro ciclo, os iniciadores se
ligam em direções opostas a cada uma das moléculas geradas pela desnaturação do DNA. Nos
ciclos iniciais, a amplificação vai além da sequência complementar ao outro iniciador (Fig. 36),
gerando fitas mais longas. No segundo ciclo, isto também acontece; porém, há a amplificação de
fragmentos mais curtos, que têm a sequência de um iniciador na extremidade de uma fita e o
outro, na outra extremidade da fita complementar. Em ciclos subsequentes, os fragmentos de
amplificação mais curtos vão se acumulando e, ao final de 30 ciclos, elas predominarão.
FIGURA 36: REAÇÃO DE PCR

80

Durante os estágios iniciais de amplificação, são geradas fitas de DNA mais longas.
Em ciclos subsequentes, o material amplificado consistirá de uma fita de DNA composta pelos
iniciadores em suas extremidades. Estes amplicons mais curtos predominarão ao final de 30
ciclos de amplificação.
Uma das aplicações da PCR na tecnologia do DNA recombinante é o isolamento de
um gene específico, que será produzido em grande quantidade e este pode ser clonado em um
vetor apropriado. Para a clonagem, deve-se considerar que a Taq DNA polimerase têm uma
atividade enzimática incomum, adicionando um nucleotídeo de adenina ao final 3´ de cada fita.
Isto é ideal para a clonagem em vetores do tipo que apresentam um acréscimo de timina na
porção 5´ de cada fita. Apesar de esta característica dificultar a clonagem de fragmentos que
possuem extremidades cegas, este fato nem sempre é verdadeiro. Há diferentes tipos de Taq
DNA polimerases especializadas em diferentes funções e nem todas possuem a característica
de acrescentar adeninas à extremidade 3´ das fitas de DNA.
A clonagem de insertos gerados por PCR é facilitada quando tanto o vetor como os
insertos são digeridos com a mesma enzima de restrição, pois esse procedimento gera
extremidades coesivas que ainda permitem a clonagem direcional. Contudo, alguns insertos não
possuem a sequência a ser reconhecida pela enzima desejada e a digestão com a enzima de
interesse ocorre de maneira que a sequência codificadora seja clonada fora da fase de leitura.
Este é um ponto crítico para procedimentos que têm por objetivo a expressão de proteínas. Para
facilitar estes procedimentos, fragmentos de DNA adaptadores, contendo os fragmentos de
restrição desejados, podem ser adicionados à sequência dos insertos.

 ADAPATADORES 81

Os adaptadores são pequenos fragmentos de nucleotídeos que contêm a sequência


nucleotídica reconhecida por uma determinada enzima de restrição. Uma estratégia muito
utilizada na construção destes adaptadores é inserir a sequência da enzima de restrição ao
desenhar o par de iniciadores a ser utilizado na PCR (Fig. 37). Esta técnica, além de ser de fácil
realização, ainda permite que mesmo após a inserção do sítio de restrição, a sequência
codificadora de uma determinada proteína seja inserida no vetor com a fase de leitura correta.

FIGURA 37: DESENHO DE INICIADORES COM SEQUÊNCIAS ADAPTADORAS

O iniciador 1 é idêntico em sequência à fita codificadora.


O iniciador 2 é complementar à fita codificadora. Os sítios de restrição são acrescidos à porção
5´ de cada iniciador (estão em itálico e sublinhados; a enzima que os reconhece está entre
parênteses).
Os adaptadores constituem, portanto, uma estratégia que facilita a clonagem. O passo
seguinte então é a escolha de um vetor de clonagem mais apropriado para um determinado
inserto e para um dado experimento.

3.2 VETORES DE CLONAGEM 82

O vetor ideal deve reunir em uma molécula diversas características, como:


I- Ser uma molécula pequena e de fácil manipulação;
II- Ser capaz de se replicar de forma autônoma e intensa, o que permite a
amplificação do fragmento de interesse;
III- Deve conter diferentes sequências que permitam o reconhecimento por enzimas
de restrição. Neste caso, sítios únicos são interessantes porque a inserção pode ser direcionada
e não há problema de perda de fragmentos após a digestão enzimática. Com esta finalidade,
vários vetores foram modificados para permitir a inserção de um sítio múltiplo de clonagem. Este
representa uma sequência sintética construída de maneira a portar somente um único sítio de
restrição reconhecido por diferentes enzimas;
IV- Ter um método fácil e rápido de identificação de clones que portam o vetor
recombinante.
Atualmente, estão disponíveis no mercado diversos tipos diferentes de vetores que
permitem que o procedimento de clonagem seja realizado. A escolha entre eles depende
basicamente das características do inserto e da aplicação pretendida para o gene clonado.

3.2.1 Plasmídeos

Plasmídeos são moléculas de DNA dupla fita circular e extracromossomal, que


apresentam a capacidade de autorreplicação. Virtualmente, quase todos os gêneros de bactérias
possuem plasmídeos. Eles podem conter os mais variados tipos de informação. Alguns
carregam informações que os permite se transferirem de uma célula para a outra (plasmídeos F);
podem ainda conter genes de resistência a antibióticos ou codificarem proteínas envolvidas com
metabolismos exóticos. Aparentemente, alguns plasmídeos podem não apresentar nenhuma
função extra, quando são então denominados de crípticos.
Os plasmídeos podem pertencer ao grupo de alto número de cópias com 10 a 100
cópias por célula hospedeira, ou ao grupo de baixo número de cópias com 4 a 10 cópias por
célula hospedeira. Independente do número de cópias, mais de um plasmídeo com funções 83
diferentes pode coexistir numa mesma célula. A literatura já descreveu microrganismos contendo
até mesmo de um a oito plasmídeos diferentes por célula. Além disso, devido à especificidade da
origem de replicação, os plasmídeos podem se replicar em uma espécie específica ou mesmo
em várias espécies de células hospedeiras; por essa característica, os plasmídeos são
denominados como estritos ou não a um hospedeiro.
Por serem moléculas autoreplicativas, os plasmídeos são considerados como
excelentes veículos para a clonagem molecular. Com este objetivo, os plasmídeos naturalmente
isolados de bactérias foram modificados por engenharia genética para permitir a inclusão
características essenciais a um vetor de alta eficiência, como:
I. Serem moléculas de baixo peso molecular, pois a eficiência de transformação
diminui com vetores de peso acima de 15Kb;
II. A presença de um único sítio de restrição a ser reconhecido por uma
determinada enzima de restrição;
III. Possuir um ou mais marcadores de seleção que facilitem o reconhecimento e a
seleção do vetor híbrido.
IV. Dois vetores plasmidiais têm sido utilizados em genética, o pBR322 e pUC (Fig.
38). Eles se derivam de plasmídeos encontrados naturalmente em espécies bacterianas, porém
com modificações genéticas que permitiram sua adaptação como vetores de clonagem
eficientes.
FIGURA 38: PLASMÍDEOS. (A) PBR322; (B) PUC19

84

O pBR322 possui uma estrutura mais simples que a do pUC. Possui dois genes de
resistência a drogas: um codifica a ampicilina e outro, a tetraciclina. Dentro da sequência
codificadora de cada um destes genes há sítios de restrição únicos, os quais têm sido utilizados
na clonagem. Contudo, geralmente a inserção é realizada no sítio de BamHI presente na
sequência codificadora da tetraciclina. Isto tem implicações na seleção dos transformantes,
como será discutido mais adiante.
O vetor pUC é mais avançado e permite uma segunda alternativa de seleção dos
transformantes. Além da resistência ao antibiótico ampicilina, é possível uma seleção fenotípica
por coloração. O vetor é constituído por parte do operon Lac. Uma fração do gene lacZ (Z´) está
sob o controle do promotor indutível do operon Lac e da proteína repressora LacI. Dentro da
região codificadora do gene lacZ´ foi inserido o sítio múltiplo de clonagem.
Outros plasmídeos que permitem uma clonagem eficiente em até 5 minutos são
aqueles que possuem adição de timinas as extremidades 5´ de cada fita do vetor linearizado.
Estes vetores são rotineiramente utilizados em laboratórios para a clonagem de produtos de
PCR. Isto se deve à adição de adeninas às extremidades 3´ dos amplicons, como já referido
anteriormente (Fig. 39).
FIGURA 39: VETOR PARA CLONAGEM DE PRODUTOS DE PCR

85

O vetor apresenta em suas extremidades 5´ um nucleotídeo de timina, que pode se


parear com um resíduo de adenina presente no inserto devido à ação da Taq Polimerase.
Os pequenos plasmídeos que contêm grandes inserções de DNA heterólogo tendem a
perder espontaneamente a inserção. Portanto, a escolha de plasmídeos como vetor de
clonagem deve ser feita quando os fragmentos de inserção contenham até 10 kb de tamanho.
Assim, a clonagem de fragmentos maiores deve levar em consideração as características de
outros vetores.

3.2.2 Bacteriofagos

Para a formação de uma biblioteca genômica, a clonagem de fragmentos maiores


facilita para que a mesma seja mais representativa, contendo todo ou a maior parte do conteúdo
cromossômico. Com essa finalidade, foram desenvolvidos veículos de clonagem como os
bacteriófagos ou fagos lambda.
Em seu ciclo de vida, o bacteriófago infecta a E. coli, e pode culminar em dois destinos
diferentes: no ciclo lisogênico ou no lítico. No ciclo lisogênico, o DNA do fago injetado na célula
hospedeira pode ser integrado ao cromossomo da bactéria. Este material é conhecido como
prófago e pode ser mantido indefinidamente na célula hospedeira. Contudo, sob determinadas
condições de estresse ambiental ou nutricional, o fago pode entrar no ciclo lítico. Nesse caso, o
DNA do fago pode ser excisado e utilizado na formação de novas partículas virais, resultando na
lise da célula hospedeira. Com propósitos de usá-lo na tecnologia do DNA recombinante, o DNA
do fago recombinante contendo o inserto, precisa ser perpetuado como um bacteriófago por
meio de vários ciclos líticos. 86
A formação de partículas completas do fago é uma sequência de eventos altamente
coordenada. Um bacteriófago é formado por uma cauda de proteínas tubulares e por um
capsídeo que comporta cerca de 50 kb de DNA (Fig. 40), sendo que aproximadamente 20 kb são
essenciais para os eventos de integração e excisão deste material genético no cromossomo da
célula hospedeira. Cada extremidade 5’ da molécula linear é composta por uma fita simples de
doze nucleotídeos. Estas sequências são complementares e por isso, conhecidas por
extremidades coesivas ou sequência ‘’cos’’. Por serem complementares, elas permitem que este
DNA linear possa se circularizar como um plasmídeo.

FIGURA 40: COMPOSIÇÃO ESTRUTURAL DO FAGO LAMBA

Na fase inicial do ciclo lítico, há a replicação do material genético do fago com a


criação de uma molécula linear compostas por muitas unidades de 50 kb. Cada capsídeo
comporta entre 38 a 50 kb de DNA e a localização das sequências cos assegura isto (Fig. 41).
FIGURA 41: EMPACOTAMENTO DO DNA NO CAPSÍDEO DO FAGO LAMBA DURANTE O
CICLO LÍTICO

87

As sequências cós asseguram que somente 50 kb de DNA serão utilizados na


formação de cada partícula viral. (Figura modificada de Glick & Paternak, 1994).
Os bacteriófagos foram então manipulados por engenharia genética para permitir a
inclusão de sítios BamHI nas regiões flanqueadoras da sequência que codifica proteínas
relacionadas com a integração do genoma do fago. O uso da enzima gera três fragmentos de
restrição: o L, o I/E e o R. O fragmento L contém a informação genética para a produção do
capsídeo e da cauda. O R codifica os genes relacionados com a replicação do DNA e do ciclo
lítico. O I/E contém os genes necessários para a integração e excisão do DNA do fago.
Com o propósito de utilizar os bacteriófagos na clonagem molecular, as sequências I/E
são substituídas pelo inserto de interesse. Para isso, o DNA de interesse é submetido a uma
digestão enzimática com BamHI e fragmentos de aproximadamente 20 kb são selecionados
como inserto. Estas amostras são então ligadas ao DNA do fago digerido com a mesma enzima
(Fig. 42). O DNA recombinante é então empacotado e utilizado na formação de novas partículas
de fago durante o ciclo lítico.
FIGURA 42: SISTEMA DE CLONAGEM DO BACTERIÓFAGO LAMBDA

88

O Bacteriófago lamba é modificado por engenharia genética para permitir que sítios de
restrição da enzima BamHI sejam inseridos nas extremidades flanqueadoras da região I/E. O
DNA de interesse também é digerido com a mesma enzima e fragmentos resultantes de peso
molecular de 20 kb são selecionados para a clonagem. Com o auxílio da T4 ligase, o inserto
selecionado é ligado às regiões L e R. (Figura modificada de Glick & Paternak, 1994).
A formação da partícula do fago contendo o DNA recombinante foi possível após
estudos in vitro que demonstraram a viabilidade do processo. Partículas infectivas podem ser
produzidas após uma simples mistura dos elementos constituintes da partícula do fago:
capsídeo, a cauda e o DNA recombinante.
Os fagos são, portanto, úteis na clonagem de fragmentos que apresentem peso
molecular variando entre 20 a 25 Kb. Contudo, a obtenção de insertos maiores é desejável em
determinadas situações, como para o sequenciamento de longas moléculas de DNA do
cromossomo eucarioto. Para a clonagem de genes destes organismos, frequentemente é
necessário obter fragmentos superiores a 25 kb. Como os genes de eucariotos podem variar de
30 a 40kb, o que se deve a presença de introns, a clonagem de fragmentos maiores possibilita a
inclusão de toda uma sequência em um único clone. Por esse motivo, outros vetores têm sido
desenvolvidos para a clonagem destes fragmentos. Entre eles estão os cosmídeos, os YACs
(cromossomo artificial de leveduras) e os BACs (cromossomo artificial bacteriano).

89
3.2.3 Cosmideos

Os cosmídeos são vetores híbridos que associam elementos de plasmídeos – origem


de replicação, gene de resistência a antibióticos e o sítio múltiplo de clonagem - e de fagos.
Assim, o inserto de DNA pode ser englobado no capsídeo do fago, responsável por inserir o
DNA recombinante na célula hospedeira. Ao entrar na célula, as sequências cos
complementares, derivadas dos fagos, permitem que o DNA linear do fago possa se circularizar
como um plasmídeo (Fig. 43). A diferença entre fagos e cosmídeos é o tamanho do inserto que
pode ser clonado nos dois vetores. O inserto heterólogo que o cosmídeo carrega é cerca de três
vezes maior que o do fago (aproximadamente 45kb).
FIGURA 43: SISTEMA DE CLONAGEM UTILIZANDO COSMÍDEO COMO VETOR

90

O cosmídeo contém duas sequências intactas de sítios cos flanqueando o sítio único
da enzima ScaI, um único sítio de BamHI e a sequência codificadora da tetraciclina, o que
permite a seleção por antibiótico de clones transformados com os cosmídeos. O vetor é então
digerido com ScaI e BamHI. A fonte de DNA é digerida com BamHI, e os fragmentos de 40kb
são selecionados como insertos. O vetor e o inserto são ligados com o auxílio da T4 ligase e
utilizados na formação de novas partículas infectivas de fagos. Estes infectam E. coli e as
sequências cós permitem que este DNA recombinante se circularize como um plasmídeo.
Finalmente, os transformantes são selecionados por sua capacidade de crescerem em meio
contendo tetraciclina. (Figura modificada de Glick & Paternak, 1994).
Para a construção de um cosmídeo, a maior parte do DNA relacionado com a estrutura
do fago é deletada, permanecendo somente os sítios cos. Esta estrutura modificada permite que
quase toda a sequência do DNA doadora possa ser inserida, desde que não exceda 50 kb,
capacidade máxima de DNA que o capsídeo do fago comporta.
Estratégias similares aos cosmídeos foram desenvolvidas, como os bacteriófagos P1.
A vantagem do uso destes outros vírus é que os mesmos podem acomodar moléculas de DNA 91
de até 100 kb. Fragmentos ainda maiores podem ser clonados em outros vetores, como os BAC
e os YAC.

3.2.4 BAC E YAC

Os BAC são vetores similares a outros plasmídeos, exceto que sua origem de
replicação e as proteínas envolvidas com na replicação são derivadas do plasmídeo “fator F” de
E. coli. Isso permite que os BAC sejam transferidos à célula hospedeira por conjugação (Fig. 44).
Estes vetores podem conter fragmentos de até 300 kb.
92
FIGURA 44: TRANSFERÊNCIA DE BAC ÀS CÉLULAS HOSPEDEIRAS

Por serem derivados do plasmídeo F, que possuem os elementos genéticos


necessários à conjugação bacteriana, o BAC contendo o gene de interesse pode ser transferido
à célula hospedeira por meio da conjugação. Contudo, rotineiramente se tem utilizado a
transformação como meio de transferir o BAC para as bactérias.
A clonagem de fragmentos ainda maiores de DNA foi possível após a descoberta de
elementos funcionais de cromossomos de leveduras, como centrômero, telômero e sequências
que asseguram a replicação autônoma e a segregação correta dos cromossomos. Isto permitiu a
construção de cromossomos artificiais de leveduras que funcionam como vetores de clonagem.
Os YAC são moléculas de DNA fita duplas lineares, as quais podem conter insertos de até um
megabase (1.000 Kb). Assim, podem-se isolar clones que apresentem sequências sobrepostas 93
de insertos e que contenham coletivamente quase um cromossomo humano inteiro (Fig. 45).

FIGURA 45: CONSTRUÇÃO DE YAC


A partir de um vetor que contém todos os elementos necessários para a perpetuação
de um cromossomo eucarioto, é feita uma digestão enzimática para a linearização do vetor. O
DNA de interesse é extraído, purificado e digerido com as mesmas enzimas. Procede-se com a
ligação entre as extremidades coesivas do vetor e do inserto, sendo que este DNA recombinante
será transformado em uma levedura de eleição e os clones recombinantes serão selecionados
por resistência a antibióticos. 94

3.2.5 Vetores de expressão

Os vetores de expressão são vetores de clonagem que possuem todos os elementos


genéticos que permitem a expressão de proteínas recombinantes. Se os elementos genéticos
permitem a expressão em células bacterianas, este é um vetor de expressão procarioto. É o tipo
mais utilizado em pesquisas, pois a manipulação de culturas bacterianas é mais fácil. Contudo,
bactérias não são capazes de processar o RNAm de eucariotos e, neste caso, os insertos a
serem utilizados devem ser derivados de bibliotecas de cDNA. Uma alternativa a esta questão é
o uso de vetores de expressão eucariotos, que possuem um promotor eucarioto e sinais de
poliadenilação, por exemplo.
Os vetores de expressão são utilizados quando a busca de uma determinada
sequência se faz por meio da detecção da proteína por ela codificada. Para isso, o sítio múltiplo
de clonagem é inserido próximo à região promotora.
As desvantagens do uso de vetores de expressão para o isolamento de um
determinado gene de interesse se devem ao desconhecimento da sequência do inserto. Para
que haja a expressão de uma determinada proteína, o inserto deve se ligar ao vetor de forma
que a fase de leitura correta seja reconhecida pela maquinaria celular. Se isto não ocorrer, novas
proteínas serão formadas e, portanto, a sequência de interesse não será detectada, mesmo que
ela esteja presente em um determinado clone.

3.3 TRANSFORMAÇÃO DA CÉLULA HOSPEDEIRA


O processo de transformação refere-se à introdução de um DNA exógeno em uma
célula hospedeira. Esse processo foi inicialmente desenvolvido em células bacterianas e,
posteriormente, adaptado a células de diferentes organismos, como leveduras, fungos, células
vegetais e células de mamíferos.
A transferência de material genético para células bacterianas pode ocorrer por meio de 95
três processos distintos: transdução, conjugação e transformação.
A transdução é o processo em que a aquisição do material genético é mediada pela
ação de bacteriófagos. Para isso, inicialmente o fago deve infectar e realizar o ciclo lítico.
Durante a replicação e formação das partículas do fago, há a aquisição do material genético da
célula infectada, que é considerada como a célula doadora. A troca de material genético ocorrerá
quando a partícula viral infectar a célula receptora e nela introduzir o DNA bacteriano da célula
doadora. Em biotecnologia, esse processo é utilizado em determinados procedimentos, como na
transferência do material genético clonado na sequência do fago ou mesmo de cosmídeos, como
já exposto anteriormente.
A conjugação é o processo por meio do qual o material genético é transferido de uma
célula doadora para uma receptora por meio de contato célula a célula. Para que o material
genético seja transferido de uma célula a outra, é necessário um íntimo contato entre as células,
com a formação de uma junção através da qual o material será transportado. Na biotecnologia, a
realização da conjugação normalmente necessita da presença de plasmídeos que contenham as
funções conjugativas, ou seja, que possibilitem a junção célula a célula. Se o plasmídeo
portando o inseto de interesse não possui estas funções, pode-se introduzir na mesma célula
outro plasmídeo que contenha as funções de conjugação.
O protocolo envolve o uso de três receptores bacterianos distintos: O primeiro,
contendo o plasmídeo conjugável, deve estar em contato com a célula que contém o plasmídeo
recombinante. Neste processo, o conjugável é transferido à segunda célula. Então, a célula
contendo os dois plasmídeos deve entrar em contato com uma terceira. Esta será transformada
com o plasmídeo recombinante graças à ação do plasmídeo conjugável.
Este procedimento não é tão simples, exigindo uma seleção rigorosa dos clones
transformantes. Portanto, em processos biotecnológicos, a conjugação consiste em uma
alternativa quando a transferência do material genético deva ser a uma célula hospedeira cuja
transformação é um processo complicado.
A transformação é o processo natural onde o DNA exógeno liberado após a lise celular
é capturado por outra célula, a receptora. A célula apta a receber um DNA exógeno é dita como
competente. A competência está relacionada à presença de receptores na superfície das células
doadoras, os quais se ligam ao DNA exógeno e o aproximam da superfície celular. Este material
é então internalizado e, finalmente, incorporado ao genoma da célula receptora.
A eficiência da transformação é um processo que depende de vários fatores, tais como 96
o estado fisiológico das células, os componentes presentes na cultura destas bactérias e as
características genéticas da espécie em questão. O processo já foi descrito tanto para bactérias
Gram-positivas como Gram-negativas.
No ambiente, a transformação é um evento raro. Por isso, os cientistas que trabalham
com a tecnologia do DNA recombinante desenvolveram metodologias que permitem o
aprimoramento da técnica. Basicamente, o que se faz é induzir o estado de competência da
célula bacteriana, pelo tratamento com cátions bivalentes, e ou criar poros artificiais na
membrana celular, por meio de choque elétrico ou térmico.
A transformação por choque térmico é um dos métodos corriqueiramente utilizados nos
laboratórios. Essa escolha baseia-se na facilidade de manipulação e por não ser necessária a
aquisição e uso de equipamentos sofisticados. Para isso, a indução de competência se dá por
um tratamento com cátions bivalentes. A hipótese é de que estes sejam capazes de formar uma
ponte salina entre a superfície da membrana bacteriana, que tem carga líquida negativa, e o
DNA a ser inserido, que também é negativamente carregado.
Assim, os íons seriam receptores naturais, facilitando a adsorção do DNA. Foi relatado
que estes íons também facilitam a abertura de poros na superfície bacteriana. As células
bacterianas são então incubadas com o DNA e há um choque térmico entre 37 e 42ºC. Este
método tem uma eficiência de transformação (ou seja, o número de transformantes por
microgramas de DNA adicionados) de 107 a 108.
O método da eletroporação consiste em submeter às células competentes, em
presença do DNA, a uma alta corrente elétrica. O método é diferenciado para cada espécie
bacteriana. Em linhas gerais, inicialmente a célula hospedeira também é submetida a um
tratamento para induzir seu estado de competência. A cultura celular é lavada com uma solução
aquosa, que tem por objetivo a retirada de restos de meios de cultura, cujos componentes
podem aumentar a condutividade do meio, influenciando nas condições do choque elétrico. Em
seguida, a célula é submetida ao choque elétrico que desestabiliza a membrana externa ou
plasmática, provocando a formação de poros nestas estruturas, possibilitando a entrada do DNA
no espaço citoplasmático.
As vantagens deste procedimento incluem sua maior eficiência em relação ao de
choque térmico e é amplamente utilizado para vários tipos celulares, como bactérias Gram-
positivas e Gram-negativas, leveduras, fungos, células vegetais e de mamíferos.
Alternativa na transformação de células consiste em forçar a entrada do DNA 97
recombinante por meio de partículas de ouro ou tungstênio, revestidas pelo DNA exógeno. Estas
partículas sofrem uma aceleração no vácuo com o auxílio de um equipamento especial. Estas
micropartículas revestidas são capazes de perfurar a célula hospedeira, liberando o DNA em seu
interior. Este método é conhecido como biobalística e é eficiente em muitos casos. Contudo, as
desvantagens incluem a necessidade de adquirir equipamentos específicos e caros, além de
determinadas condições experimentais pouco acessíveis à rotina laboratorial.
Após a transformação, muitos procedimentos requerem uma alta quantidade de DNA.
Por isso, os clones podem ser submetidos a um processo que permita que o DNA recombinante
seja amplificado.

3.4 AMPLIFICAÇÃO DO DNA RECOMBINANTE

O DNA quimérico transformado em um hospedeiro apropriado é capaz de se replicar.


Isto ocorre, pois os vetores de clonagem utilizados possuem uma origem de replicação
autônoma. Entretanto, após a ligação, o inserto também faz parte do vetor. Portanto, quando o
vetor se divide, o inserto é automaticamente replicado junto com o seu portador. O resultado é
que cada vetor que entra na célula irá formar múltiplas cópias de si mesmo na célula hospedeira.
A quantidade de DNA recombinante ainda se torna maior após diversos ciclos de divisão da
célula hospedeira. A cultura em que estas bactérias se encontram conterá bilhões de cópias do
inserto de um determinado clone. Este processo é a uma maneira de amplificação do DNA
híbrido.
A amplificação do DNA recombinante produz uma quantidade maior do DNA quimérico,
um pré-requisito para muitos procedimentos de biologia molecular. Além disso, este
procedimento ainda apresenta como vantagem o sistema de verificação da sequência de DNA
após a sua replicação na célula hospedeira, como visto na introdução à genética. Assim, a
possibilidade de mutação é menor que quando a amplificação se realiza por outras técnicas.
Após a transformação, diversos tipos de clones podem ser obtidos. Além daqueles que
capturaram a molécula de DNA recombinante, há outros que capturaram somente o inserto, ou
mesmo o vetor que se anelou nele mesmo. Frente a estas possibilidades, são necessários
mecanismos que permitam a seleção dos clones que contenham somente o inserto desejado. 98

3.5 SELEÇÃO DE CLONES TRANSFORMADOS COM O DNA HÍBRIDO

A seleção de clones que realmente foram transformados com o DNA híbrido


normalmente é feita por seleção a antibióticos. Plasmídeos e cosmídeos possuem em sua
estrutura entre uma a duas sequências codificadoras de polipeptídeos que permitem que a célula
transformada seja resistente a dois antibióticos.
No caso do plasmídeo pBR322, há dois genes que codificam resistência a antibióticos:
um para tetraciclina e outro para ampicilina. Normalmente, para os procedimentos de clonagem,
a digestão enzimática é realizada com a enzima BamHI. O sítio de restrição reconhecido por
esta enzima se localiza na região codificadora da tetraciclina. Assim, a sequência de tetraciclina
é interrompida após a digestão e ligação do inserto neste sítio; logo, todos os clones contendo o
inseto são sensíveis a este antibiótico. Por outro lado, os clones transformados com o vetor que
recircularizou, isto é, sem ter havido a ligação do inserto, é resistente a tetraciclina. Assim, esta é
a primeira seleção de clones transformados, que é realizada após plaquear a cultura de
transformantes em meio contento o antibiótico.
Outra seleção consiste na técnica “réplica plate”. Neste caso, inicialmente as culturas
são plaqueadas em meio contendo o antibiótico ampicilina. Todos os clones transformados com
o vetor são capazes de crescer neste meio. Esta placa servirá de mapa para o próximo
plaqueamento. A placa de ampicilina é demarcada em seus pontos e é pressionada contra um
pano de veludo. Posteriormente, a segunda placa que tem como meio de seleção a tetraciclina é
carimbada neste pano de veludo contra o qual os clones resistentes a ampicilina foram
pressionados. Assim, somente aqueles ao qual o inserto se ligou ao vetor crescerão.
A técnica de réplica plate é um procedimento de difícil execução e, por isso, muitas
vezes ele é eliminado da rotina de laboratórios. Uma alternativa consiste em selecionar os
transformantes plaqueando-os em meio ao qual foram acrescidos os dois antibióticos, tetracilina
e ampicilina. Frente a este problema, outros vetores foram manipulados de forma a proporcionar
outros mecanismos que facilitem a seleção de transformantes.
Vetores tais como os derivados do pUC permitem que a seleção de transformantes 99
seja feita por antibióticos e por um outro sistema, como exemplo, a característica fenotípica entre
colônias brancas e azuis. Este vetor possui um segmento da proteína Lac Z (LacZ´), que
representa uma porção do gene que codifica a enzima beta-galactosidase. A expressão desta
proteína é regulada pelas sequências reguladoras do operon Lac: o promotor e a proteína
repressora LacI.
Portanto, quando os transformantes são crescidos sob a presença do indutor IPTG do
operon Lac, a proteína inibidora é incapaz de se ligar ao promotor e o gene lacZ´ é então
expresso. Para que a enzima beta-galactosidase seja ativa, é necessário que os vetores sejam
transformados em linhagens de bactérias que possuam a inserção da sequência codificadora da
outra fração do gene lacZ´. Para isso, as duas porções expressas pelo vetor e pelo DNA
cromossomal se combinam para formar a proteína ativa da beta-galactosidase. Este processo é
denominado complementação alfa. A enzima ativa é capaz de hidrolisar o substrato
genericamente conhecido como X-gal, o que produz colônias azuis.
Para a clonagem no vetor pUC, são realizados os mesmos procedimentos utilizados
para outros vetores. Tanto o vetor como o inserto sofre digestão enzimática, de preferência com
enzimas que produzem extremidades compatíveis. O sítio múltiplo de clonagem dos vetores pUC
se localizam na região codificadora da proteína LacZ´. Assim, ao sofrer a digestão enzimática, a
sequência codificadora referente à fração LacZ´ é interrompida. Sem esta fração, a célula
hospedeira é incapaz de formar uma enzima com atividade biológica. Portanto, as colônias
transformadas com os vetores que possuem o inserto não são capazes de clivar a X-gal e, por
isso, formam colônias brancas. Portanto, além da seleção por antibiótico, adicionalmente é
possível distinguir os transformantes pela característica fenotípica entre colônias brancas ou
azuis (Fig. 46)
FIGURA 46: PLACA CONTENDO BACTÉRIAS TRANSFORMADAS QUE APRESENTAM A
CARACTERÍSTICA FENOTÍPICA DE COLORAÇÃO BRANCA E AZUL
100

3.5.1 Seleção por hibridização de DNA

Uma determinada sequência de DNA pode ser identificada pela técnica da


hibridização. A especificidade de pareamento de bases por pontes de hidrogênio, primeiramente
descobertas na molécula de DNA, é a base para esta técnica. Inicialmente, o DNA da amostra é
desnaturado quando exposto as altas temperaturas ou a substâncias alcalinas. Estes
tratamentos rompem as pontes de hidrogênio, mas não as ligações fosfodiéster. As fitas abertas
são fixadas a um suporte de nylon ou nitrocelulose e o passo seguinte consistem na busca por
sequências específicas de DNA. Para isso, fragmentos de DNA previamente conhecidos,
compostos geralmente por 100 a 1.000 pb, são sintetizados, desnaturados e então adicionados
em solução ao suporte em que a amostra está fixada.
Este material é denominado sonda. Ao encontrar uma sequência complementar, há o
pareamento de bases, assim como ocorre na replicação do DNA. Frequentemente, este
pareamento requer uma complementaridade acima de 80% dentro de um segmento de 50
bases. Para a identificação do pareamento de bases entre a sonda e o DNA da amostra, a sonda
é marcada por algum método que permite a visualização, como o uso de radioisótopos. A
visualização, neste caso, se faz por autorradiografia. 101
Quando a amostra fixada ao suporte é de DNA, a técnica é denominada Southern Blot.
Esta pode ser feita após a extração do DNA com uma digestão enzimática. Contudo, no caso do
isolamento de genes, os clones de uma biblioteca são plaqueados na placa máster. Esta será
marcada, permitindo a identificação da localização de cada clone.
Os clones são então transferidos ao suporte de nitrocelulose. Estas células sofrem
uma lise, seguida por desproteinização e desnaturação do DNA e ligação do DNA a matriz.
Nesse estágio, a sonda marcada é adicionada. Se há hibridização, um sinal será detectado na
autorradiografia, estas colônias são buscadas novamente na cultura máster, de acordo com a
localização de cada clone plaqueado e identificado antes da transferência (Fig. 47).
FIGURA 47: BUSCA DE UM DETERMINADO CLONE POR HIBRIDIZAÇÃO DE DNA

102

(1) Os clones são plaqueados em uma cultura máster e, em seguida, transferidos a


uma matriz de nitrocelulose. (2) As células são lisadas e o DNA desnaturado. Este então se liga
à matriz. (3) Um oligonucleotídeo com sequência complementar à sequência de um determinado
gene de interesse é utilizado como sonda. Ao se ligar à sua sequência complementar, a sonda
marcada reage e permite a identificação do clone contendo a sequência de interesse. (4)
Sempre se deve manter uma subcultura dos clones da placa máster.
Como a maioria das bibliotecas é criada pela digestão parcial da amostra de DNA,
alguns clones podem gerar um sinal após a hibridização. O próximo passo é determinar qual
clone realmente contém a sequência e, de preferência, completa. Geralmente, o vetor híbrido
utilizado na clonagem é isolado, purificado e sequenciado, mas como isto significa mais gastos,
podem-se selecionar clones a serem submetidos ao sequenciamento por resultados preliminares
de mapeamento por restrição. Este mecanismo revela o tamanho de cada inserto, sendo que os
que possuem um determinado tamanho compatível à sequência do gene em questão são
escolhidos e deste modo é possível montar toda a sequência do gene.
A hibridização, apesar do sucesso em determinadas pesquisas, possui algumas
limitações. Não é possível garantir que a sequência completa de um gene alvo estará presente
em uma determinada biblioteca genômica. Uma alternativa para este problema é a criação de
outra biblioteca a partir da digestão enzimática com enzimas diferentes e que permitam a
geração de fragmentos maiores; assim, aumenta-se a chance de que algum clone contenha toda
a sequência de um gene em específico. 103
A construção de outra biblioteca é um processo caro e trabalhoso. Outras opções
podem ser utilizadas para a busca de um gene de interesse a ser isolado, como a pesquisa por
atividade imunológica ou proteica.

3.5.2 Busca por atividade imunológica

Quando uma sonda de DNA não está disponível ou mesmo a hibridização não está
sendo eficiente, alguns métodos de identificação imunológica podem ser utilizados na busca de
uma determinada sequência codificadora. Para isso, a biblioteca deve ter sido construída de
forma que os fragmentos de DNA tenham sido clonados em vetores de expressão. Estes
sistemas permitirão que a proteína, ou parte dela sejam expressas e possibilita o
reconhecimento das mesmas por anticorpos específicos.
A pesquisa de uma determinada sequência pela ligação de anticorpos específicos é
uma técnica mista de ELISA e hibridização. Os clones da biblioteca são plaqueados em uma
placa máster, permitindo identificar a localização de cada clone. Uma amostra destes clones é
transferida para uma matriz, onde as células são lisadas e as proteínas referentes aos insertos
são liberadas e fixadas à membrana. Esta matriz é tratada com um anticorpo primário, que se
liga especificamente a uma proteína ou parte dela. Prossegue-se então uma lavagem, que retira
materiais e anticorpos não ligados e a amostra então é tratada com o anticorpo secundário, que
reconhece o anticorpo primário. O anticorpo secundário é marcado com uma enzima, como a
fosfatase alcalina, permitindo a visualização das amostras que reagiram (Fig. 48).
FIGURA 48: BUSCA DE UM CLONE PELA ANÁLISE IMUNOLÓGICA

104

As células transformadas são plaqueadas na placa máster, que servirá como fonte de
identificação de cada clone. (1) Todos os clones são transferidos a uma matriz de nitrocelulose.
(2) As células expressando as proteínas recombinantes serão lisadas, o que permite a ligação
das proteínas à matriz. (3) O lisado é então submetido a um tratamento com anticorpos
primários, (4) lavados e tratados com o anticorpo secundário. (5) Após uma segunda lavagem,
faz-se a detecção dos clones que reagiram no teste imunológico. (6) Sempre é interessante
manter uma subcultura dos clones representados na placa máster.
Os clones são posteriormente identificados na cultura máster. Em seguida, eles devem
ser caracterizados e sequenciados, para verificar se algum possui a sequência completa do gene
de interesse.
Esta técnica tem como desvantagem ter que se conhecer previamente alguma
característica da proteína. Além disso, como os anticorpos geralmente reconhecem sequências
conformacionais. Portanto, mesmo que estejam presentes sequências parciais da proteína, o
anticorpo pode não se ligar. Por último, se os insertos foram clonados em uma fase de leitura
errada, a proteína não será expressa de maneira adequada. Nesse caso, mesmo que a
sequência presente em um determinado clone esteja completa, não será possível sua
identificação por este método.
3.5.3 Busca por atividade proteica

Outra opção para a identificação de genes a partir de uma biblioteca consiste na 105
identificação de clones que contêm a sequência codificadora para uma enzima e na seleção dos
transformantes que apresentem atividades específicas do polipeptídeo expresso. Assim, a
biblioteca construída a partir de insertos clonados em vetores de expressão é selecionada pela
capacidade da enzima em utilizar determinado substrato, como diferentes antibióticos.
Este método exibe desvantagens relevantes, como a possibilidade de que a expressão
proteica não esteja sendo realizada a partir da fase de leitura correta, a expressão de somente
determinados fragmentos que não compõe uma enzima ativa e a necessidade de utilizar
linhagens bacterianas com mutações específicas que evitem a interferência no método de
seleção escolhido.
Após terem sido selecionados clones que contenham o inserto de interesse, certos
procedimentos que permitam a confirmação da sequência de interesse devem ser adotados.
Entre os métodos, são muito utilizadas a PCR e a digestão enzimática, além do sequenciamento.

3.6 CONFIRMAÇÃO DO INSERTO

Quando se há um conhecimento prévio a respeito da sequência a ser isolada, a


confirmação de que o inserto foi clonado é feita por PCR. Esse procedimento é um método
rápido e de alta especificidade. Os iniciadores são desenhados a partir de uma sequência
específica e complementar, sendo que a especificidade ainda pode ser aumentada alterando-se
determinados parâmetros envolvidos na reação de amplificação. Os amplicons produzidos são
analisados por eletroforese quanto ao peso molecular esperado para o fragmento determinado.
Mas a PCR é uma análise inicial e frequentemente são necessárias informações adicionais,
como verificar se somente um determinado fragmento foi clonado a um vetor. Estas questões
são então verificadas por digestão enzimática.
A digestão enzimática se baseia no mapa de restrição de uma sequência. Enzimas que
flanqueiam a região de ligação inserto/vetor e que reconhecem sítios específicos dentro de uma
sequência são utilizadas nesta metodologia. Os fragmentos de restrição são analisados assim
como os produtos de PCR, de acordo com o peso molecular obtido após uma eletroforese,
comparando-se ao esperado. Contudo, para realmente confirmar uma sequência e sua estrutura,
como por exemplo, se há alterações de bases, e para analisar sequências das quais não se tem 106
conhecimento prévio, deve-se sequenciar o clone.
O sequenciamento é a técnica que permite determinar a ordem em que os
nucleotídeos se encontram em uma sequência de DNA. O método baseia-se na síntese de DNA
fita simples a partir do DNA molde da amostra. A polimerização das novas cadeias inclui a
incorporação dos quatro nucleotídeos (dNTPs) e de dideoxinucleotídeos (ddNTPs). Os ddNTPs
diferem dos dNTPs por não possuírem o grupo 3’ OH necessário a elongação da cadeia.
Portanto, a adição de um destes ddNTPs impede a formação da ligação fosfodiéster com o
próximo dNTP e a elongação da cadeia termina nesse ponto. A síntese das novas cadeias inicia-
se na posição de um iniciador que se anela a fita molde e cada molécula sintetizada termina com
uma base específica: A, C, G ou T. Utilizando-se os quatros ddNTPs diferentes em quatro
reações independentes, obtêm-se a informação completa da sequência do DNA (Fig. 49).
FIGURA 49: SEQUENCIAMENTO DE DNA

107

A figura mostra o resultado final do sequenciamento, com o padrão de bases a que


cada banda corresponde.
4 EXPRESSÃO GÊNICA EM ORGANISMOS PROCARIOTOS E EUCARIOTOS

Um dos objetivos da biotecnologia é a expressão de proteínas de interesse para a


medicina e para a agropecuária em escalas industriais. Esta perspectiva está baseada na própria
história da transformação da biotecnologia tradicional para a molecular, período no qual o 108
desenvolvimento e a aplicação da tecnologia do DNA recombinante aprimorou a expressão de
proteínas. Isso se deve ao conhecimento de técnicas de clonagem molecular, as quais
permitiram que os genes de interesse fossem isolados e clonados em um vetor de expressão. A
produção de bens de interesse é obtida após a transformação de um hospedeiro de escolha,
sendo que a expressão heteróloga pode ser obtida tanto em organismos procariotos como em
eucariotos.
Inúmeras proteínas heterólogas já foram expressas em células procariotas ou
eucariotas utilizando a tecnologia do DNA recombinante. Isto inclui as de interesses médicos e
comerciais, como a insulina humana e hormônios de uso veterinário. Contudo, a clonagem de
uma sequência codificadora em um determinando vetor de expressão não assegura
necessariamente a expressão da proteína. Outra questão a ser considerada são os níveis de
produção alcançados podem estar aquém do desejado.
Considerando os objetivos da implantação da biotecnologia molecular, pesquisas
foram direcionadas com o objetivo de alcançar níveis satisfatórios de produção de proteínas
recombinantes. Entretanto, não há uma única estratégia que seja eficiente para todos os casos.
Diferentes genes requerem investimentos e tentativas específicas, com distintos protocolos de
indução. Uma opção de aplicação mais ampla é a construção de novos vetores de expressão

4.1 VETORES DE EXPRESSÃO

Vetores de expressão, assim como já definido no módulo II, são aqueles de clonagem
que contém os elementos genéticos necessários à expressão de genes, de acordo com o tipo
celular que está sendo utilizado como hospedeiro. Eles podem ser de dois tipos, os de
expressão procariotos e os de expressão eucariotos. Apesar desta classificação distinta, muitas
características estruturais dos vetores são similares, diferindo apenas no fato de que as
sequências genéticas utilizadas são isoladas de procariotos ou de eucariotos, respectivamente.
Estas estruturas fornecem funcionalidades e resultados distintos.
A biotecnologia é uma ciência de interesse industrial. Por isso, a quantidade em que
determinado bem é produzida se torna fator crucial para a implantação de um determinado
protocolo. Diversas estruturas envolvidas com a produção de proteínas foram manipuladas, 109
visando aperfeiçoar todos os aspectos envolvidos neste processo: a transcrição, a tradução, a
estabilidade da proteína e a sua secreção para o meio. Para isso, diferentes elementos
genéticos têm sido modificados e testados na construção de novos vetores de expressão
procariotos e eucariotos. De maneira geral, as principais características que têm sido
manipuladas para aumentar os níveis de expressão de proteínas recombinantes são:
I. As sequências relacionadas com a transcrição, como os promotores e os
terminadores;
II. O número de cópias do gene clonado, além da localização da sequência
codificadora em um plasmídeo ou integrado ao cromossomo;
III. A eficiência da tradução no organismo hospedeiro;
IV. A afinidade do sítio de ligação do ribossomo;
V. A estabilidade da proteína no hospedeiro;
VI. A localização final da proteína sintetizada.

As características citadas acima permitem concluir que a expressão eficiente de


proteínas recombinantes é dependente do aproveitamento de todos os passos, incluindo a
transcrição, a tradução e o processamento proteico. Neste contexto, um dos aspectos iniciais
que devem ser aperfeiçoados é o nível de transcritos. Para obtê-los em altas quantidades,
estudos vêm sendo realizados na busca de elementos genéticos envolvidos com o início da
transcrição, como o isolamento e caracterização de sequências promotoras.
4.2 SEQUÊNCIAS PROMOTORAS

A eficiente transcrição de genes se inicia pelo reconhecimento das sequências


promotoras. Os níveis de expressão estão diretamente relacionados com a afinidade da RNAP a
esta região, permitindo que a sequência de interesse seja frequentemente transcrita. 110
Para que uma determinada sequência promotora seja utilizada em processos
biotecnológicos, há a necessidade de se controlar de maneira precisa a taxa de transcrição. Para
isso, devem-se conhecer os mecanismos envolvidos com a regulação gênica do promotor. Por
exemplo, a sequência promotora do operon Lac é bem estudada e seus mecanismos de
regulação são bem elucidados. Por isso, frequentemente ela é utilizada na construção de vetores
de expressão. Outros promotores com propriedades distintas também são úteis sob
determinadas condições de expressão gênica e, por isso, pesquisas foram conduzidas de forma
a isolar e caracterizar novas sequências promotoras.
Promotores de diferentes organismos, tanto procariotos como eucariotos, foram
isolados, caracterizados e, finalmente, utilizados na construção dos diferentes vetores de
expressão já disponíveis comercialmente. Apesar disso, a maioria de estudos deste tipo é
conduzida tendo como organismo modelo, a bactéria E. coli. A explicação para esta escolha se
baseia no fato de este microrganismo ter o genoma sequenciado e ter sido bem estudado, o que
facilita a manipulação das ferramentas genéticas. Além disso, a expressão de proteínas de
interesse nesta bactéria é apreciada devido aos níveis elevados do produto de interesse
geralmente alcançados neste sistema. Estas características a tornam o microrganismo de
eleição para estudos iniciais de produção de proteínas recombinantes. Por este motivo, a maioria
das características dos vetores de expressão descrita nesta apostila se refere aos elementos
genéticos de E. coli. Casos específicos de expressão em outros microrganismos serão
detalhados separadamente.
4.2.1 Isolamento de sequências promotoras

O isolamento de sequências promotoras pode ser realizado de diversas maneiras.


Uma delas consiste no uso de genes repórteres, os quais codificam um produto cujas
características fenotípicas podem ser prontamente visualizadas. A maioria destes marcadores 111
permite que a seleção seja realizada por um método colorimétrico, que apresenta uma alta
sensibilidade e praticidade.
O isolamento de sequências promotoras pode ser realizado por meio do uso de vetores
que contenham um gene repórter clonado na ausência de um promotor. A metodologia envolvida
neste processo envolve a ligação de uma sequência de DNA aleatória, ou que se suspeite conter
o promotor, a jusante deste gene. A inserção de uma sequência promotora no vetor é
reconhecida pela visualização das características do agente seletor utilizado. Como a transcrição
se inicia após o reconhecimento do promotor pela RNAP, a expressão do gene marcador
somente ocorrerá caso a sequência clonada contenha uma sequência promotora. Dois tipos de
vetores podem ser utilizados com este propósito: o plasmídeo pBR316 e o pKO1.

 SELEÇÃO DE SEQUÊNCIAS PROMOTORAS PELO PLASMÍDEO pBR316

O plasmídeo pBR316 foi utilizado em E. coli para o isolamento de diversos promotores.


Para alcançar este objetivo, primeiramente alguns procedimentos de modificação do vetor
devem ser realizados. Após a extração e purificação do vetor, ele é submetido a uma digestão
enzimática com a enzima HindIII. O sítio de restrição para esta enzima se localiza na região
promotora do gene codificador do antibiótico tetraciclina. A digestão enzimática resulta na
geração de um plasmídeo linearizado e de extremidades coesivas. Em seguida, estes vetores
podem ser submetidos ao tratamento com duas enzimas diferentes, a nuclease S1 ou a DNAP I.
A proteína S1 digere a sequência de fita simples das extremidades do vetor pBR316; por outro
lado, a DNAP I completa esta sequência. Portanto, ao final desse procedimento, serão gerados
dois plasmídeos distintos, os quais contêm extremidades cegas de DNA fita dupla.
As extremidades das duas versões lineares do vetor pBR316 são então ligadas a um
adaptador contendo o sítio de restrição para EcoRI. Essa alteração final gera dois plasmídeos
diferentes, que apresentam um único sítio de restrição para a enzima EcoRI. Um detalhe desta
modificação é a localização do adaptador, o qual interrompe o promotor do gene da tetraciclina.
Consequentemente, não haverá expressão do gene que codifica o antibiótico e, portanto, os
transformantes alterados são sensíveis e não cresceram no meio onde esta droga é
acrescentada. Os procedimentos utilizados na modificação deste plasmídeo estão ilustrados na
Fig. 50.
112

FIGURA 50: FORMAÇÃO DE DOIS PLASMÍDEOS DISTINTOS A PARTIR DO VETOR PBR316

Inicialmente, o plasmídeo pBR316 é digerido com a enzima HindIII, interrompendo o


promotor do gene da tetraciclina. As extremidades coesivas geradas são então submetidas a
tratamentos diferentes. Uma opção é a digestão de fita simples pela nuclease S1; a outra
corresponde à sua complementação com a DNAP I. Estes procedimentos gerarão extremidades
cegas. Estas são unidas novamente após a ligação a um adaptador contendo um sítio de
restrição para EcoRI. Ao final, são gerados dois plasmídeos diferentes. (Fonte: figura modificada
de Glick & Paternak, 1994).
Os vetores modificados do plasmídeo pBR316 foram testados pelos pesquisadores
quanto ao seu potencial no isolamento de promotores funcionais em E. coli. Para isso, 113
fragmentos derivados da digestão do DNA genômico de diversas espécies procariotas foram
clonados no sítio de restrição de EcoRI. Como o promotor do gene da tetraciclina está inativo,
somente a clonagem dos fragmentos de DNA que contenham uma sequência promotora
funcional em E. coli será capaz de crescer em meio contendo tetraciclina.
O isolamento de promotores funcionais em E. coli obteve sucesso por meio do uso dos
vetores derivados do pBR316. Apesar do potencial apresentado por esta estratégia, o uso deste
plasmídeo exibe como desvantagem a falta de conhecimento a respeito da força do promotor.
Por isso, outros vetores foram construídos, como o plasmídeo pKO1.

 SELEÇÃO DE PROMOTORES PELO PLASMÍDEO pKO1

O plasmídeo pKO1 foi desenvolvido para ser utilizado na seleção de promotores fortes.
Com esta finalidade, sua estrutura foi construída de forma a apresentar alguns requisitos, como:
I. Um gene repórter que permita a pronta detecção de uma sequência promotora
quando esta for clonada a jusante do gene;
II. Um marcador de seleção, que, no caso, corresponde a um antibiótico;
III. Um sítio múltiplo de clonagem que deve se localizar antes da sequência do gene
repórter;
IV. Um plasmídeo que seja estável na célula hospedeira, com o número de cópias
conhecido.
Estruturalmente, o vetor pKO1 contém como marcador de seleção o gene da
ampicilina, o que permite a seleção de clones que foram transformados com o vetor. Seu sítio
múltiplo de clonagem inclui sítios de restrição únicos reconhecidos por diferentes enzimas. Além
disso, possui três códons de paradas nas três fases de leitura, evitando que a transcrição
continue além da sequência de interesse, o que pode gerar um resultado falso-positivo. O gene
repórter utilizado na construção do plasmídeo pKO1 é uma quinase derivada do operon gal de E.
coli. Este é constituído pelos genes galE, galT e galK, que codificam uma epimerase, uma
transferase e uma quinase, respectivamente. A quinase é uma proteína cuja detecção ocorre por
métodos relativamente simples e sensíveis, medindo os níveis da galactose-1-fosfato.
Para a seleção de promotores funcionais em E. coli, sequências de DNA suspeita de
conterem promotores são digeridas e clonadas no pKO1. A mistura de DNA contendo os
possíveis recombinantes são então utilizadas para transformar uma E. coli de genótipo galE+, 114
galT+ e galK-. Esta linhagem, quando transformada com um plasmídeo expressando a quinase,
são facilmente selecionada por sua habilidade de crescer em meio cuja única fonte de carbono é
a galactose. Os transformantes com o vetor pKO1, nos quais foi clonada uma sequência
promotora, são diferenciados pelas características fenotípicas de coloração no meio McConkey.
A expressão do gene da quinase gera uma enzima com atividade fermentadora, o que
resulta em colônias que apresentam coloração vermelha no meio de eleição. Os vetores cuja
sequência clonada não contém um promotor funcional em E. coli não expressam a quinase,
sendo distinguidas pela coloração branco-amarelada das colônias.
A seleção dos clones pelas características fenotípicas utilizadas no vetor pKO1 ainda
permite a distinção entre a força das sequências promotoras clonadas. Para isso, inicialmente
este vetor foi testado com sequências promotoras já conhecidas. O que se utilizou como base
para a diferenciação foi o crescimento das colônias. Promotores fortes induzem uma
superexpressão da enzima quinase, produzindo colônias vermelhas de crescimento lento. Isto
demonstra que altos níveis de transcrição de genes heterólogos representam um esforço
metabólico significativo para a célula. Este resultado confirma a potencialidade deste vetor no
diferenciamento da força dos promotores.
O plasmídeo pKO1 foi originalmente desenvolvido para o isolamento de sequências
promotoras. Apesar disso, este vetor também demonstrou a sua utilidade no isolamento e
caracterização de sequências terminadoras. Com este propósito, os fragmentos que os
contenham são inseridos entre um promotor conhecido e o gene galK. Os resultados destes
experimentos demonstraram uma redução de 50 vezes nos níveis de expressão da quinase,
apesar das colônias ainda se apresentarem vermelhas. Se o terminador fosse inserido em um
vetor contendo um promotor mais fraco, os níveis de expressão eram reduzidos de tal forma que
as colônias chegavam a apresentar-se de coloração branco-amarelada.
Portanto, a presença destas colônias indica que uma sequência terminadora foi
clonada no vetor pKO1, quando este contém uma sequência promotora conhecida. Estes
resultados demonstram a utilidade do plasmídeo pKO1 para o isolamento e caracterização, tanto
de sequências promotoras, como de terminadoras.
O isolamento e a caracterização de sequências promotoras é um dos passos iniciais
para atingir altas produções de uma proteína de interesse. Contudo, esta característica deve ser
analisada com cautela. Altos níveis de expressão e de forma constitutiva podem ser prejudiciais
à célula hospedeira. Isso constitui um grande gasto energético, podendo até mesmo impedir 115
algumas de suas funções vitais. Por isso, as pesquisas a respeito da caracterização de
promotores prosseguiram, com a finalidade de isolar os que apresentassem uma expressão
indutível ao invés de constitutiva.

4.2.2 Promotores induzíveis

Diversos tipos de promotores induzíveis já foram caracterizados e são frequentemente


operon Lac e do triptofano (trp). Todos interagem com proteínas repressoras, permitindo que a
indução e a repressão da transcrição sejam reguladas.
O promotor do operon Lac, assim como descrito no módulo I, é regulado pela proteína
repressora LacI. Na ausência de lactose, esta proteína se liga ao operador, impedindo que a
RNAP prossiga com a polimerização de uma cadeia de RNA. Portanto, neste caso a transcrição
é inibida. Contudo, na presença de do indutor, a proteína repressora sofre alterações alostéricas,
perdendo sua afinidade ao operador. Isto resulta no desligamento do repressor da sequência de
DNA, permitindo o início da transcrição pela RNAP.
Considerando os conhecimentos genéticos a respeito da regulação da transcrição
gênica do operon Lac, a biotecnologia tem aproveitado o seu promotor e as suas sequências
reguladoras na construção de vetores cuja expressão pode ser regulada. A indução da
transcrição pode ser feita com duas moléculas diferentes: a lactose, como descrito nos estudos
deste operon, e outra molécula sintética e análoga da primeira, o isopropil-β-D-tiogalactosideo
(IPTG).
Os dois indutores têm ações semelhantes na regulação da transcrição do operon Lac,
inibindo a ligação da proteína repressora ao operador, o que permite o acesso e a atividade de
polimerização da RNAP. O uso do IPTG apresenta vantagens significativas sobre a lactose. Ele
não é metabolizado pela célula e, por isso, sua concentração se mantém constante durante o
ciclo celular. Essa característica faz com que o IPTG seja o indutor preferencialmente eleito para
experimentos de expressão gênica.
Os experimentos de expressão com o promotor lac resultaram na expressão de
diversas proteínas. Entretanto, os níveis de expressão obtidos não são significativos e a força do
promotor é considerada moderada. 116
A biotecnologia é uma ciência inovadora, cujas ferramentas estão submetidas a um
processo de aperfeiçoamento contínuo. Sob esse aspecto, novos promotores foram sendo
estudados com o objetivo de obter níveis mais expressivos dos produtos de interesse.
Considerando esta perspectiva, uma opção desenvolvida foi um promotor derivado do promotor
lac, o lacUV5.
O promotor lacUV5 é um variante do promotor lac. A diferença entre os dois consiste
em alterações de nucleotídeos em relação à sequência consenso. O promotor lacUV5 contém
um nucleotídeo diferente da sequência consenso; por outro lado, a mesma comparação pode ser
feita com o promotor selvagem lac, o qual apresenta três nucleotídeos diferentes (Fig. 51). Os
níveis de expressão obtidos pela variante são maiores se comparados aos obtidos pelo promotor
lac selvagem.

FIGURA 51: COMPARAÇÃO DAS SEQUÊNCIAS PROMOTORAS LACUV5 E LAC


SELVAGEM COM A SEQUÊNCIA CONSENSO

Observa-se que o promotor lacUV5 difere da sequência consenso em apenas um


nucleotídeo na região -35. O mesmo nucleotídeo também varia no promotor lac; entretanto, este
ainda apresenta mais duas alterações de nucleotídeos na região -10 se comparado à sequência
consenso. Os nucleotídeos alterados são apresentados na figura na pela cor vermelha.
Outra opção de sequência promotora é a isolada do operon triptofano. O promotor trp é
negativamente regulado pela ligação do complexo formado entre o triptofano e a proteína
repressora. Portanto, a regulação do promotor é realizada de uma maneira distinta da observada
para o promotor lac, pois a proteína repressora se liga ao operador somente na presença do
triptofano (Fig. 52). Para induzir a transcrição gênica, é necessária a remoção do triptofano ou a
adição do ácido 3-indoleacrílico ao meio.

FIGURA 52: REGULAÇÃO DA TRANSCRIÇÃO DO PROMOTOR TRP 117


A figura apresenta as modificações alostéricas que a proteína repressora assume após
a sua ligação ao triptofano, afetando a sua ligação ao operador. Quando esta molécula está
disponível, a proteína repressora assume uma conformação que lhe permite se ligar ao
operador. Esta interação impede fisicamente a ligação da RNAP ao promotor, não havendo
consequentemente a transcrição do gene de interesse. Na ausência de triptofano, a proteína
repressora assume outra conformação que não permite a sua ligação ao operador; assim, a 118
RNAP pode iniciar a transcrição.
A busca por novos promotores que apresentassem altos níveis de expressão não
cessou, e dois outros foram gerados, o tac e o trc. Ambos são variantes híbridas dos promotores
lac e trp, sendo formados pela região -35 do promotor trp e pela região -10 do operon Lac,
incluindo o operador deste último. A diferença entre os dois promotores é a constituição do
espaço intergênico. Ambos exibem níveis de expressão gênica significativamente mais elevados
se comparado aos promotores que lhes deram origem.
Os altos níveis de expressão obtidos com os promotores tac e trc justificam o grande
número de vetores de expressão comercialmente disponíveis portando estas sequências. Um
deles está ilustrado na Fig. 53. A indução da expressão se faz de maneira idêntica à utilizada
para o promotor lac. Apesar de o operador ser o mesmo entre os promotores, os vetores
atualmente disponíveis geralmente utilizam um mecanismo de regulação distinto ao do promotor
lac.
FIGURA 53: VETOR DE EXPRESSÃO PGEX

119

Este vetor de expressão, comercialmente disponível, contém o forte promotor tac (em
destaque no boxe vermelho).
Como os níveis de expressão obtidos pelos promotores tac e trc são significativamente
mais elevados, foi exigido um mecanismo que permitisse uma regulação mais apropriada.
Considerando este fato, os vetores frequentemente utilizam como estratégia para regular a
expressão gênica dos promoteres tac e trc uma variante da proteína repressora LacI, a LacIq
(Fig. 54). A diferença entre as duas é uma mutação na sequência promotora da última, que
permite uma produção mais elevada do repressor. A imposição de uma regulação mais forte é
importante para manter as funções metabólicas da célula e para inibir níveis de expressão basal
de proteínas tóxicas para a hospedeira.
FIGURA 54: VETOR DE EXPRESSÃO PPROEX-HTA (GIBCO)

120

Este vetor contém a sequência do promotor trc, sendo que seus níveis de expressão
são regulados pela proteína repressora LacIq (destacada na figura pelo boxe vermelho). (Fonte:
Coelho, 2007).
A questão de obter níveis de expressão gênica significativos ainda enquadra outro
promotor muito utilizado em vetores de expressão, o pT7. Este promotor é derivado do fago T7 e
representa uma sequência de alta afinidade para a RNAP, gerando altos níveis de transcritos. A
força deste promotor impulsionou o desenvolvimento de vetores de expressão como os pET,
tornando-os a escolha para a expressão de genes de interesse (Fig. 55).
FIGURA 55: FIGURA REPRESENTATIVA DO VETOR DE EXPRESSÃO PET

121

A ilustração mostra os elementos genéticos constituintes do vetor de expressão pET.


Destaque para o promotor pT7, o qual induz altos níveis de expressão gênica. As sequências
reguladoras deste vetor geralmente são aquelas derivadas do operon Lac.
Os mecanismos envolvidos com a transcrição das sequências clonadas nos vetores
pET exige o conhecimento de certas particularidades. A transcrição a partir do promotor pT7 é
dependente da ação da enzima RNAP do fago T7. Isto constitui uma vantagem deste sistema de
expressão, pois, como não há estoques em E. coli desta enzima, não se observa níveis basais
de expressão. Contudo, essa afirmação é um paradoxo, pois ao mesmo tempo em que esta
característica é uma vantagem, ela também representa uma desvantagem. A necessidade da
presença da RNAP do fago T7 impõe a restrição da linhagem de E. coli que pode ser utilizada
como hospedeira na expressão das proteínas de interesse; estas devem ser capazes de
expressar a enzima referida.
A linhagem utilizada na expressão de proteínas a partir do sistema pET é a BL21. Ela
contém a sequência codificadora da RNAP do fago T7 integrada em seu cromossomo sob a
regulação do promotor lacUV5 e das sequências reguladoras do operon Lac (Fig. 56). Assim, de
maneira geral, a adição do IPTG à cultura de células transformadas com o vetor recombinante
induz a expressão da RNAP do fago T7. Esta então é capaz de interagir com o promotor pT7
presente no vetor pET, iniciando então a transcrição do gene de interesse.

FIGURA 56: CONSTITUIÇÃO GENÉTICA DA LINHAGEM BL21


122

A sequência codificadora da RNAP do fago T7 está inserida ao DNA cromossomal da


linhagem BL21 de E. coli. A regulação da transcrição desta proteína está sob a regulação de
sequências derivadas do operon Lac.
Além dos promotores induzíveis pela adição de alguma substância, outros vetores
carregam sequências promotoras induzidas por mudanças de temperatura, como o pL (Fig. 57).
Este promotor é derivado do fago lambda e pode ser controlado pelo repressor termossensível
cI. Em linhas gerais, as células transformadas com vetores que contenham o promotor em
questão são cultivadas a uma temperatura entre 28 a 30°C, faixa dentro da qual o repressor é
capaz de se ligar ao operador. Quando a cultura alcança a fase de crescimento desejada, ela é
submetida a uma mudança de temperatura para 42°C. Sob estas condições, o repressor é
inativado, permitindo o início da transcrição.
FIGURA 57: VETOR DE EXPRESSÃO CONSTITUÍDO PELO PROMOTOR PL

123

A figura ilustra o vetor de expressão pdeltablue, representando um dos vetores


comerciais cuja transcrição se inicia no promotor pL (que está destacado, na figura, pelo boxe
vermelho).
Um dos pontos essenciais para obter níveis de expressão significativos da proteína de
interesse é obter um alto número de transcritos. Este objetivo pode ser alcançado com o uso de
promotores fortes na construção de vetores de expressão, como discutido anteriormente. Apesar
de diversas opções de promotores estarem disponíveis, o aprimoramento do processo de
transcrição somente não garante alcançar este objetivo. Outra opção consiste em clonar em
tandem cópias múltiplas da sequência de interesse no vetor de expressão.
A desvantagem desta escolha está nas dificuldades técnicas de clonagem das
sequências, uma seguida da outra. Os procedimentos envolvidos dificultam obter uma
construção contendo a orientação correta para a transcrição e tradução de todas as sequências
clonadas. Outra desvantagem é a instabilidade em nível de DNA que estas construções podem
apresentar. Por isso, durante a multiplicação da cultura celular, algumas ou todas as cópias são
eliminadas do plasmídeo.
Outra opção para aumentar os níveis de transcritos consiste em aumentar o número de
cópias do vetor utilizado. Contudo, isto representa uma carga metabólica significativa para a
célula. Além da replicação do vetor, há um gasto energético com a transcrição e com a
replicação de todos os genes presentes no plasmídeo. Com isso, algumas células tendem a
expulsar o vetor, permitindo um crescimento celular acelerado se comparadas ao obtido pela
célula portadora do plasmídeo.
Este fato resulta em uma cultura onde haverá o predomínio de células que não
contenham o vetor recombinante após alguns ciclos de divisão celular. Sob o ponto de vista
biotecnológico, isto representa uma perda relevante, pois os níveis de expressão estão 124
diretamente relacionados com a densidade celular que contém o vetor de expressão.
Altos níveis de expressão ainda são responsáveis pelo fenômeno de instabilidade do
plasmídeo. Para a manutenção de células que o contenha, uma opção consiste em adicionar
antibiótico ou metabólitos essenciais para a célula à cultura, mantendo uma pressão seletiva
sobre as transformadas. Apesar de manter em cultura, preferencialmente, as células
transformadas, o uso de drogas seletivas representa um alto custo para a indústria. Além disso,
há uma preocupação quanto à segurança do consumo de produtos derivados deste tipo de
cultura por humanos, uma vez que certos indivíduos apresentam respostas alérgicas após ingerir
estas substâncias.
A instabilidade do plasmídeo e de algumas construções utilizadas nos vetores de
expressão constituem um agravante para a perpetuação da tecnologia de expressão heteróloga.
Apesar de ser um método bastante simples e prático, suas desvantagens são a causa da busca
de alternativas para solucionar este problema. Uma delas que vêm sendo especulada é a
integração da sequência de interesse no cromossomo da célula hospedeira.

4.3 INTEGRAÇÃO DO DNA NO CROMOSSOMO DA CÉLULA HOSPEDEIRA

A integração do material genético, que possui a sequência de interesse, ao DNA


cromossomal da célula hospedeira é uma estratégia que aumenta a estabilidade do DNA
exógeno durante as divisões celulares. O interesse nesta opção ainda apresenta uma vantagem
extremamente relevante sob o ponto de vista tecnológico: a liberação do consumo de micro-
organismos geneticamente modificados.
Este processo permite que as sequências indesejadas dos vetores, como os genes
que codificam antibióticos, sejam eliminadas do microrganismo modificado. Dessa maneira, o
gene de interesse é mantido durante as gerações na ausência de agentes seletivos, facilitando a
liberação deste produto ao consumo de humanos e prevenindo a contaminação ambiental.
A inserção de uma sequência de interesse no DNA cromossomal da célula hospedeira
deve ocorrer em um sítio específico de eleição. A sua localização deve considerar a proximidade
a um promotor forte, o qual deve ser preferencialmente regulável, e excluir aquelas regiões
gênicas que codifiquem produtos essenciais à célula. Estas características assegurarão uma 125
expressão eficiente sob condições normais de crescimento da célula hospedeira.
O vetor onde a sequência de interesse está clonada deve conter uma região homóloga
à sequência de DNA do hospedeiro. Alguns autores sugerem que o tamanho desta homologia
deva ser de aproximadamente 51 nucleotídeos, assegurando a troca física entre as moléculas de
DNA. Este evento é denominado recombinação. Este processo envolve certas etapas, como:
I. Identificar a sequência que será interrompida no DNA cromossomal do
hospedeiro, para a inserção do gene de interesse;
II. Isolar a sequência homóloga selecionada e cloná-la em um vetor do tipo
integrativo. A clonagem do sítio de inserção deve ocorrer nas regiões flanqueadoras da
sequência de interesse a ser clonada;
III. O vetor a ser utilizado com esta finalidade não deve ser do tipo replicativo na
célula hospedeira;
IV. Seleção dos clones que tiveram a sequência de interesse integrada ao seu
genoma.
A inserção do gene clonado é catalisada por uma enzima do hospedeiro, sendo que
somente a sequência de interesse ou mesmo todo o plasmídeo podem ser inseridos. No primeiro
caso, diz-se que houve um duplo crossing-over. Este é o evento ideal, pois evita que as
sequências indesejadas presentes no vetor, como as regiões codificadoras de antibióticos,
estejam presentes na nova linhagem recombinante.
Um evento simples de recombinação, que permite a inserção de todo o vetor,
normalmente é diferenciado do duplo crossing-over pela seleção por antibióticos. Apesar de ser
indesejado, este tipo de seleção pode ser útil para obter clones com duas ou mais cópias do
gene de interesse. Esta estratégia foi utilizada em Bacillus subtilis para obter níveis de expressão
mais elevados da proteína α-amilase. Nesse caso, os transformantes originais foram crescidos
na presença de altos níveis de cloranfenicol. Somente células que tiveram uma duplicação
espontânea do inserto foram capazes de sobreviver sobre estas condições de seleção.
Por métodos imunológicos, foram identificados clones que continham diferentes
números de cópias do gene da α-amilase. Os níveis de expressão obtidos pelo clone que
continha nove cópias da sequência de interesse foram maiores que os obtidos quando o
hospedeiro em questão foi transformado com um plasmídeo com número de 20 a 40 cópias por
célula.
A integração de sequências ao DNA cromossomal também possui desvantagens. Os 126
principais argumentos contra a sua adoção se referem à dificuldade de manipulação para a
integração do DNA, frente a uma simples transformação da célula hospedeira, e a redução dos
níveis de expressão quando somente uma cópia é integrada.
Mesmo diante de opções que permitam aumentar os níveis de transcritos e a
estabilidade das células transformadas, isso não assegura uma quantidade significativa de
proteínas expressas. Outras características devem ser aperfeiçoadas, tais como a eficiência da
tradução da sequência de interesse.

4.4 EFICIÊNCIA DE TRADUÇÃO

A eficiência com que um RNAm é traduzido é o diferencial para obter entre


centenas/milhares de uma cadeia proteica ou entre algumas cópias somente. De fato, os níveis
de transcritos obtidos de diferentes RNAm chega a ser bem diferente em células de procariotos.
Uma explicação para a diferença na eficiência da tradução está nas bases
moleculares, o sítio de ligação do ribossomo (RBS). Esta sequência, que contém o Shine
Dalgarno, está ligada com a afinidade a qual o ribossomo tem pelo RNAm. Quanto maior essa
relação, maiores são os níveis de transcritos.
A relação direta entre a afinidade do ribossomo ao seu sítio de ligação no RNAm e a
eficiência da tradução é utilizada no desenvolvimento de vetores de expressão (Fig. 58). Além de
permitir altos níveis da proteína de interesse, esta estratégia permite o reconhecimento pela
maquinaria celular de sequências codificadora tanto de procariotos como de eucariotos.
FIGURA 58: INCLUSÃO DO SÍTIO DE LIGAÇÃO AO RIBOSSOMO EM VETORES DE
EXPRESSÃO

127

A figura ilustra o vetor de expressão comercial pQE-100 (Qiagen), mostrando o


acréscimo do RBS (destacado na figura pelo boxe vermelho).
A maior eficiência da tradução está ligada a alguns requisitos que devem ser
estabelecidos na construção do vetor de expressão. Em primeiro lugar, o sítio de ligação ao
ribossomo deve estar localizado a uma distância precisa do códon de início. Os vetores de
expressão foram construídos de forma a conterem o RBS, sendo que a distância adotada em
relação ao códon de início é testada para estabelecer a que favorece a tradução. Apesar do sítio
de ligação do ribossomo ser fixo entre os vetores de expressão, vale ressaltar que em
determinadas situações é preciso adaptar a distância para cada gene.
O segundo requisito que deve ser analisado para aumentar a eficiência da tradução é a
própria estrutura do RNAm. A sequência 5´ destes transcritos, região que inclui o sítio de ligação
do ribossomo, não deve conter sequências de nucleotídeos que não sejam complementares
entre si. A complementaridade dentro da cadeia permite a formação de estruturas secundárias
no RNAm, o que dificulta a ligação do ribossomo ao transcrito. Este tipo de problema deve ser
analisado para cada sequência em específico.
A eficiência da tradução ainda pode ser aumentada usando os códons preferenciais de
cada hospedeiro. Como descrito no módulo I, os micro-organismos utilizam com maior
frequência alguns dos códons que codificam um determinado aminoácido. Esta característica
está relacionada com a disponibilidade dos RNAt que são mais transcritos por um determinado
tipo de célula. A incompatibilidade entre os códons apresentados na sequência de um RNAm,
transcrito a partir de uma sequência heteróloga, com aqueles frequentemente utilizados pela
célula hospedeira diminuem a eficiência da tradução.
Em outras palavras, os RNAt cujos anticódons reconhecem códons, que são raramente 128
utilizados pelo micro-organismo estão menos disponíveis, o que dificulta a tradução da
sequência de interesse. Para solucionar esta questão, pode-se sintetizar quimicamente a
sequência de interesse, utilizando os códons preferenciais do organismo que será utilizado como
hospedeiro.
A síntese química de sequências codificadoras, utilizando a estratégia de códons
preferenciais, tem sido adotada com sucesso por alguns grupos de pesquisa. Apesar disso,
como discutido no módulo II, o alto custo deste procedimento pode tornar esta alternativa
inviável.
Nesse contexto, foram desenvolvidas linhagens de E. coli em que o número de RNAt
limitantes para algumas espécies foi aumentado. A linhagem RosettaTM (Novagen) é um exemplo
deste tipo de bactéria modificada. Derivadas da linhagem BL21, a RosettaTM é uma E. coli
transformada com plasmídeos que codificam os RNAt cujos anticódons reconhecem os códons
AGG, AGA, AUA, CUA, CCC e GGA frequentemente utilizados na expressão de genes
eucariotos. Estas bactérias modificadas constituem exemplos de hospedeiros que provêem uma
espécie de “tradução universal” de genes heterólogos.
O aperfeiçoamento de estratégias que permitam aumentar a eficiência da tradução tem
obtido sucesso para aumentar os níveis de expressão de proteínas de interesse.
Complementando isto, outro aspecto que deve ser utilizado com o mesmo propósito é a análise
das opções que permitam aumentar a estabilidade proteica.

4.5 ESTABILIDADE DE PROTEÍNAS

A estabilidade das proteínas é um ponto chave para obter uma alta produção dos
produtos desejados. A instabilidade das mesmas se deve, principalmente, à degradação as que
estão expostas. Este aspecto é dependente de diferentes fatores, como: a espécie hospedeira,
que está sendo utilizada para produzir as proteínas recombinantes, e a própria estrutura da
macromolécula.

4.5.1 Espécie hospedeira 129

A linhagem que está sendo utilizada para a expressão de proteína recombinante afeta
a estabilidade e a estrutura da macromolécula produzida. Este fato está diretamente relacionado
com a presença e concentração de proteases produzidas naturalmente pelas células
hospedeiras.
As proteases podem estar presentes tanto no meio intracelular como na membrana
externa. Dentre elas, as mais estudadas são a proteína Lon, e a OmpT. Linhagens deficientes
para estas duas proteases já se encontram disponíveis comercialmente, como as BL21 (DE3),
BL21 (DE3) pLysS e a BL21 (DE3) pLysE (Invitrogen). A ausência destas duas proteases
demonstrou que a expressão nestas linhagens de bactérias modificadas apresenta uma redução
na degradação das proteínas produzidas.
O uso de bactérias deficientes em proteases demonstrou seu valor na expressão de
proteínas heterólogas e a redução da degradação de macromoléculas aumentou os níveis de
produção. Outra estratégia para alcançar o mesmo objetivo é a modificação da estrutura da
proteína.

4.5.2 Aumento da estabilidade proteica pela modificação da sua estrutura

A estrutura das proteínas é uma característica intrínseca que pode propiciar a


degradação destas cadeias. Sequências internas dentro das proteínas estão envolvidas com o
seu reconhecimento por enzimas proteolíticas. Um exemplo é a presença de sequências internas
ricas em prolina, ácido glutâmico, serina e treonina. Elas são genericamente conhecidas como
sequências PEST. Estes sinais são frequentemente flanqueados por grupos de aminoácidos
carregados positivamente. Alguns autores sugerem que a estabilidade da proteína pode ser
aumentada por manipulações genéticas que possibilitem a alteração destas regiões.
A meia vida de muitas proteínas citosólicas está relacionada com os resíduos de
aminoácidos presentes na porção N-terminal. Alguns autores sugerem que estes resíduos
possibilitam uma rápida ubiquitinação, resultando na degradação das macromoléculas pelo
complexo do proteassoma. 130
A presença dos aminoácidos arginina, lisina, fenilalanina, leucina ou triptofano na
região N-terminal da cadeia proteica tem sido associada com uma meia vida curta das proteínas.
Por outro lado, a presença dos aminoácidos cisteína, alanina, serina, treonina, glicina, valina ou
metionina na mesma região é relacionada com uma meia vida longa. Nesses casos, as cadeias
proteicas são mais resistentes ao ataque proteolítico. Por esta razão, estes aminoácidos são
denominados como estabilizadores. Uma comparação evolutiva interessante é que um
aminoácido estabilizador, a metionina, é adicionado à porção N-terminal das proteínas recém-
sintetizadas, o que suporta a ideia da importância da relação entre a estrutura proteica e a sua
estabilidade.
A alteração da estrutura proteica para aumentar a sua estabilidade tem sido utilizada,
demonstrando resultados promissores. Entretanto, esta opção algumas vezes não é possível,
pois a modificação implica em mudança da sequência da proteína, resultando em perda de
função. Outra estratégia para evitar estes problemas é o uso de proteínas de fusão.

4.6 PROTEÍNAS DE FUSÃO

A construção de uma proteína de fusão significa estabelecer uma união entre a


sequência do gene clonado com outra derivada de uma proteína expressa de maneira estável
pela célula hospedeira. Esta combinação resulta em maiores níveis de expressão, pois há a
proteção da sequência de interesse da ação das proteases celulares. Alguns estudos
compararam a degradação da proteína quando a expressão é feita a partir da sua sequência
somente ou da associação a uma proteína de fusão. Os resultados demonstraram que a proteína
fusionada é mais resistente à proteólise.
Proteínas de fusão são construídas em nível de DNA pela ligação da região
codificadora de dois genes diferentes. Para isto, normalmente se utiliza um vetor que já possui a
sequência de um gene da célula hospedeira e que permite que a outra de interesse seja inserida
e ligada à primeira. As duas sequências devem ser clonadas de forma que a fase de leitura de
ambas esteja correta.
Diversos tipos de proteínas de fusão podem ser utilizados. Um exemplo é a fusão da 131
proteína alvo com o segmento na porção 5´ terminal do gene ompF de E. coli, que codifica uma
proteína de membrana fusionada a uma porção do gene LacZ. Esta proteína de fusão, além de
aumentar a estabilidade da proteína, facilita a identificação da macromolécula expressa.
O uso de proteínas de fusão pode beneficiar o pesquisador de diversas maneiras.
Assim como a proteína LacZ, outras utilizadas com o mesmo propósito podem ter outras
utilidades, como facilitar a purificação da proteína recombinante. Isto se deve à utilização em
colunas de purificação de substâncias que apresentem afinidade à proteína de fusão. Este
protocolo permite selecionar, dentro do extrato bruto de proteínas, somente aquelas de interesse
ao pesquisador.
Diversos vetores de expressão permitem a opção pelo uso de proteínas de fusão. A
maioria dos fabricantes justifica seu uso como escrito no parágrafo anterior: para aumentar a
estabilidade da proteína e facilitar a sua purificação. Estas mesmas características podem ser
obtidas pela escolha de uma estratégia diferente, a secreção de proteínas.

4.7 AUMENTO DA SECREÇÃO DE PROTEÍNAS RECOMBINANTES

A secreção de proteínas recombinantes é uma característica desejável sob alguns


aspectos biotecnológicos. A secreção pode aumentar a estabilidade de determinadas proteínas,
como no caso da insulina. Experimentos demonstraram que a expressão desta proteína em E.
coli e a secreção no espaço periplasmático aumentaram em aproximadamente 10 vezes a
estabilidade da proteína se comparado à ocorrida no citoplasma. Além disso, proteínas
secretadas são mais fáceis de purificar.
A secreção de proteínas é um processo dependente de uma sequência que se localiza
na porção N-terminal da proteína, o peptídeo sinal. Este permite o endereçamento proteico para
a membrana celular. Após isso, a maquinaria de secreção é capaz de reconhecê-lo, clivando-o.
O processo de secreção finaliza com a liberação da proteína para o periplasma, no caso de
bactérias Gram-negativas, ou para o meio extracelular.
Algumas sequências podem ser manipuladas para permitir a sua secreção. Neste
caso, a sequência de interesse é clonada em um vetor de expressão que contenha um peptídeo
sinal. A maioria dos vetores de expressão apresenta duas versões, a que permite a expressão 132
citoplasmática e a que contêm a sequência de um peptídeo sinal, facilitando o endereçamento
proteico. Apesar destas possibilidades já disponíveis comercialmente, esta modificação não
garante altos níveis de proteínas secretadas. Além disso, a secreção de proteínas em bactérias
Gram-negativas frequentemente é direcionada para o espaço periplasmático, e não para o meio
extracelular.
Uma alternativa para aumentar a eficiência da secreção de proteínas para o meio
extracelular consiste em optar por outras células hospedeiras, como as bactérias Gram-positivas.
Estas são os microrganismos de escolha quando o experimento requer a secreção de proteínas
recombinantes, pois as macromoléculas são liberadas diretamente no meio externo. Esta
característica diferencial entre organismos Gram-negativos e Gram-positivos se deve à
organização da parede celular, os últimos não possuem o espaço periplasmático. Portanto,
vetores de expressão que contenham o peptídeo sinal permitem que a proteína expressa,
quando secretada de forma adequada, seja liberada diretamente no meio.
Além do uso de bactérias Gram-positivas para a expressão de proteínas que devam
ser secretadas, certos organismos eucariotos são opções. Entre eles, há relatos de alta
eficiência da secreção de proteínas com o uso de fungos filamentosos, como será discutido mais
adiante.
A eficiência da secreção de proteínas por microrganismos Gram-positivos é
questionada por alguns autores. Apesar desta característica benéfica apresentada, os níveis de
expressão obtidos nestes microrganismos deixam a desejar. Por isso, geralmente os
pesquisadores optam por expressar proteínas na E. coli. Considerando este aspecto, a
tecnologia do DNA recombinante está sendo utilizada na manipulação das características da
sequência que permitam o endereçamento proteico. Além do peptídeo sinal, foi observado um
mecanismo interessante em algumas bactérias Gram-negativas envolvido com a secreção da
proteína bacteriocina. Uma cascata de eventos coordenados resulta na ativação da fosfolipase,
presente na membrana interna da bactéria. Esta proteína age de forma a permeabilizar a
membrana interna e externa da bactéria. Neste momento, algumas proteínas presentes no
citoplasma e no espaço periplasmático são liberadas para o meio.
A partir da elucidação dos mecanismos envolvidos com a secreção da bacteriocina, a
biotecnologia desenvolveu uma estratégia para aumentar a secreção de proteínas expressas ao
meio extracelular. A bactéria deve ser transformada com dois plasmídeos, cuja expressão esteja
sob o controle das mesmas sequências reguladoras. Um dos vetores conterá a sequência do 133
gene da proteína responsável por ativar a fosfolipase D; o outro terá a sequência de interesse
fusionada a um peptídeo sinal. Assim, a indução da expressão ativará a transcrição dos dois
genes, sendo que a proteína que libera a bacteriocina induzirá a permeabilização da membrana,
e a proteína de interesse será então secretada para o meio.
Os sistemas de expressão procariotos são largamente utilizados para a produção de
diferentes tipos proteicos, até mesmo de proteínas eucariotas. Nesses casos, frequentemente se
utiliza o cDNA como sequência codificadora a ser clonada no vetor de expressão. Apesar de que
em alguns casos esta estratégia ser utilizada com sucesso, algumas proteínas eucariotas são
produzidas de maneira instável ou não apresentam atividade biológica.
A funcionalidade de proteínas eucariotas requer que a mesma apresente a maior
identidade possível à sua apresentação original, tanto em níveis bioquímicos como biofísicos. A
ausência de atividade biológica de proteínas expressas em organismos procariotos pode ser
devida à expressão em uma conformação inadequada, principalmente, pela incapacidade destes
sistemas em gerar determinadas modificações pós-traducionais. Entre elas, pode-se citar:
I. Formação de pontes dissulfeto. Esta reação é dependente da atividade da
enzima chamada isomerase dissulfeto. A ausência desta modificação está relacionada com uma
conformação proteica instável e com a falta de atividade biológica;
II. Clivagem proteolítica do precursor da proteína. Neste procedimento,
determinados segmentos da sequência de aminoácidos são removidos para produzir uma
proteína funcional;
III. Glicosilação, onde frequentemente são adicionados resíduos de açúcar à serina
e treonina. Esta modificação está relacionada com a estabilidade e com propriedades
diferenciais da proteína;
IV. Modificação de determinados aminoácidos dentro da cadeia proteica, como a
acetilação e a fosforilação.
Dentre as modificações da cadeia proteica que exibem menor probabilidade de
realização por organismos procariotos são a glicosilação e a modificação de aminoácidos da
cadeia proteica.
A questão conformacional de proteínas expressas em organismos procariotos não é o
único problema na expressão de proteínas eucariotas em sistemas procariotos. Outro ponto
crítico na obtenção de produtos expressos nestes microrganismos se refere à presença de 134
contaminantes tóxicos para humanos, resultando em efeitos colaterais indesejáveis. Para
solucionar estes problemas, pesquisadores têm desenvolvido sistema de expressão eucarioto
para a expressão de proteínas terapêuticas para humanos e animais.

4.8 EXPRESSÃO EM SISTEMAS EUCARIOTOS

Sistemas de expressão eucariotos são muito similares aos de procariotos. Eles são
constituídos por vetores de clonagem que contém os elementos genéticos que permitem a
expressão do gene de interesse em células eucariotas. Logo, estes vetores são constituídos por:
I. Uma sequência que permita a seleção do transformante em células eucariotas;
II. Sequências que permitam uma eficiente transcrição de genes eucariotos, como
um promotor eucarioto,
III. Sequência de poliadenilação, permitindo a adição da cauda poliA ao RNAm.
Um exemplo de vetor de expressão eucarioto está representado na Fig. 59. O pVAX é
um vetor que possui todos os elementos genéticos para a expressão gênica em células de
mamíferos. É um vetor muito utilizado no desenvolvimento de vacinas de DNA.

FIGURA 59: MAPA DO VETOR PVAX (INVITROGEN).


135

FONTE:
Este vetor possui todos os elementos genéticos necessários para a expressão gênica
em células de mamíferos, como o promotor do citomegalovírus humano (CMV), que permite
altos níveis de expressão; o sinal de poliadenilação derivado da sequência codificadora do
hormônio bovino (BGH), que confere maior eficiência na terminação da transcrição e da
poliadenilação do RNAm. Além disso, o vetor foi construído de acordo com as normas do “Food
and Drug Administration (FDA)”, contendo somente as sequências necessárias à replicação em
E. coli ou para a expressão em células de mamíferos. (Fonte: Coelho, 2007).
Assim como discutido para os organismos procariotos, outras sequências importantes
também podem ser adicionadas ao vetor de expressão eucarioto, dependendo dos objetivos. No
caso de o vetor ser um plasmídeo, o qual se replicará de maneira independente aos
cromossomos, este deve conter uma origem de replicação eucariota. Contudo, como a
manipulação deste tipo de células é um processo mais complicado, geralmente os
procedimentos se realizam inicialmente em células procariotas, para depois prosseguirem em
eucariotas.
Para isso, frequentemente se utilizam plasmídeos que possuam duas origens de
replicação: um procariota e outro eucariota. Estes vetores são conhecidos como “shuttle”. Além
da origem de replicação, estes plasmídeos são construídos contendo dois genes que permitam a
seleção das células transfectadas com o vetor recombinante.
Assim como a origem de replicação, uma das sequências está relacionada com a
seleção em células procariotas e, a outra, em células eucariotas. Estes vetores “shuttle” têm sido
desenvolvidos para a expressão de proteínas recombinantes em leveduras e para células de
insetos e de mamíferos.
Uma alternativa à expressão em plasmídeo consiste na integração desta sequência ao
DNA cromossomal da célula hospedeira. Neste caso, o vetor deve conter um segmento de DNA 136
homólogo a uma região do cromossomo do hospedeiro – o sítio de integração cromossomal -
para permitir o processo de recombinação homóloga.
Apesar do desenvolvido e aperfeiçoamento de vetores de expressão eucarioto, não há
um sistema que atenda todas as modificações proteicas de interesse. Por isso, devem-se
analisar as características da proteína de interesse e, a partir disso, examinar diferentes
sistemas de expressão e tipos celulares a serem utilizados na produção da proteína de
interesse.

4.8.1 Sistemas de expressão eucariotos

Diversos tipos de organismos são utilizados como células hospedeiras para a


expressão de proteínas eucariotas, como as leveduras, as células de insetos e as células de
mamíferos. As leveduras compartilham muitas características bioquímicas, genéticas e
moleculares com outros organismos eucariotos. Este fato propicia um ambiente intracelular
favorável às modificações de proteínas, necessárias para que estas apresentem atividade
biológica. Além disso, muitas leveduras contêm uma via de secreção e de sinalização idênticas
às presentes em células de mamíferos, possibilitando então a expressão de proteínas tanto
intracelularmente como na forma secretadas.
As vantagens do uso de leveduras ainda incluem as características de manutenção da
cultura, como a relativa simplicidade e facilidade na manipulação, rapidez de crescimento,
atingindo uma alta densidade celular e o baixo custo de manutenção. Estas são as mesmas
características que favorecem a escolha de E. coli como sistema procarioto para a expressão de
proteínas. Outro fator relevante para a eleição da expressão em leveduras é a segurança do
sistema, que é livre de endotoxinas e de oncogenes.
Outro aspecto vantajoso do uso de leveduras se baseia no fato de que algumas delas
já possuem o genoma completamente sequenciado. Isso facilita as manipulações genéticas,
propiciando o aprimoramento dos vetores de expressão. Este fato permitiu, por exemplo, o
isolamento e a caracterização de promotores fortes que permitem atingir altos níveis de
expressão da proteína de interesse. Isto facilitou a produção de proteínas em larga escala e em
menor custo, se comparado aos níveis obtidos com a expressão em células de mamíferos. 137
Os vetores de expressão desenvolvidos apresentam elementos genéticos específicos
que permitem uma maior produção de acordo com a levedura que está sendo utilizada como
célula hospedeira. Entretanto, uma característica em comum que facilitou a transformação das
leveduras com o vetor de expressão foi o uso de vetores “shuttle”. A ligação do inserto a este
vetor é produzida in vitro e então utilizada para transformar primeiramente E. coli. Este
procedimento é utilizado, pois a manipulação desta bactéria é um processo mais simples e que
permite a construção de uma gama maior de estruturas a serem utilizadas na expressão. Além
disso, este procedimento facilita a seleção da construção correta; depois da confirmação, parte-
se para a transformação da levedura com o vetor recombinante correto.
As vantagens da utilização de leveduras na expressão de proteínas recombinantes
impulsionaram muitas pesquisas no assunto. Um exemplo é a utilização da tecnologia do DNA
recombinante por grupos de pesquisa da Universidade de Brasília e da USP para desenvolver
linhagens de leveduras capazes de utilizar o amido. Estes novos organismos foram modificados
e contém genes de amilases para o processamento do amido presente na mandioca e na batata
doce, o que está sendo testado na produção de etanol.
Diversos tipos de leveduras têm sido testados quanto ao seu potencial na expressão
de proteínas recombinantes. Entre elas, uma das mais utilizadas é a Saccharomyces cerevisiae.

 EXPRESSÃO EM SACCHAROMYCES CEREVISIAE

S. cerevisiae é uma levedura constituída por uma única célula, a qual pode se
apresentar de forma esférica ou oval (Fig. 60A). A multiplicação destas células dá um aspecto
em ágar semelhante a uma bactéria (Fig. 60B).

FIGURA 60: (A) CÉLULAS DE S. CEREVISIAE E (B) COLÔNIAS DA MESMA LEVEDURA


A B

138

FONTE:

S. cerevisiae foi um dos primeiros organismos de eleição para a expressão de


proteínas eucariotas. Muitos fatores contribuem para esta escolha:
I. É uma levedura cujas condições fisiológicas são bem conhecidas;
II. Seu genoma já foi totalmente sequenciado;
III. Cresce facilmente tanto a nível laboratorial como em escala industrial;
IV. Diversas sequências promotoras fortes já foram isoladas e caracterizadas;
V. Foram isolados plasmídeos naturais de S. cerevisiae, os quais podem ser
utilizados na construção de vetores de expressão;
VI. S. cerevisiae é capaz de realizar diversas modificações pós-traducionais;
VII. É capaz de secretar proteínas para o meio, característica utilizada pela
engenharia genética para facilitar o processo de purificação;
VIII. Este organismo é considerado como seguro. Isso explica porque ele tem sido
muito utilizado na indústria para a produção de diversos bens com fins terapêuticos para
humanos, sem ter que passar por experimentações que comprovem o seu uso.
Algumas proteínas produzidas por S. cerevisiae estão sendo testadas em fins
diagnósticos ou terapêuticos; outras já estão disponíveis comercialmente como antígenos
vacinais.
Os estudos de genética molecular com S. cerevisiae se aprofundaram no final da
década de 70, quando esta levedura foi então sequenciada. A partir disso, vários tipos de
vetores de expressão foram desenvolvidos.

 VETORES DE EXPRESSÃO DE S. CEREVISIAE


139
Há três classes de vetores utilizados na expressão de proteínas recombinantes por S.
cerevisiae:
I. Plasmídeo;
II. Vetores de integração;
III. Cromossomo artificial de levedura.
Os plasmídeos foram testados com sucesso para a expressão de proteínas, tanto na
forma extracelular como na intracelular. Contudo, sua desvantagem é a instabilidade que esta
construção apresenta sob grandes escalas de produção, como acima de 10 litros. Além disso, os
níveis de expressão obtidos ainda são considerados baixos. Alguns pesquisadores tentaram
clonar a sequência codificadora em tandem, com várias cópias. Contudo, esta construção é
instável. Tentativas para aumentar os níveis de expressão consistem em estudos de crescimento
da levedura, visando reconhecer as condições mais adequadas que aumentem a estabilidade do
plasmídeo.
A vantagem de utilizar vetores de integração em relação aos plasmídeos é que após a
integração da sequência de interesse no genoma do hospedeiro, ela apresentará maior
estabilidade. Contudo, as desvantagens incluem a complexidade do processo, e somente uma
cópia é inserida, o que resulta em baixos níveis de expressão.
Assim como os vetores de integração, os cromossomos artificiais de levedura
apresentam como principal vantagem à estabilidade da construção recombinante. Contudo, essa
estratégia não tem sido utilizada comercialmente para a expressão de proteínas recombinantes,
mas para outras opções como a formação de bibliotecas genômicas de DNA de cromossomos
humanos individualmente.

 EXPRESSÃO DIRETA EM S. CEREVISIAE


A “expressão direta” é um termo utilizado para descrever vetores que permitem o
acúmulo de proteínas no citoplasma após a sua expressão. Muitos grupos de pesquisa têm
dedicado uma atenção especial a este tipo de vetor de expressão, os quais possuem
estruturalmente a mesma característica básica.
Um exemplo destes vetores inclui um vetor “shuttle”, com uma origem de replicação de
E. coli e outro para a levedura. O plasmídeo possui um marcador de seleção derivado do gene 140
de ampicilina, um gene que codifica a síntese de leucina (leu2) e um sítio para a clonagem de
cDNA (pois, células de levedura não são eficientes na remoção de introns, e, por isso, deve-se
usar cDNA ou insertos sintetizados quimicamente). O sítio de clonagem do inserto é flanqueado
pelo promotor do gene da dehidrogenase gliceraldeído fosfato (GAPD), que apresenta expressão
constitutiva, e pela sequência contento os sinais de terminação da transcrição e de
poliadenilação do RNAm do mesmo gene.
Este vetor recombinante é utilizado na transformação de uma linhagem de levedura
defectiva para leucina (leu2-). Em seguida, a cultura é plaqueada em um meio onde falta a
leucina. Esse permite então a seleção dos transformantes, os quais estarão expressando este
aminoácido. Esta estratégia foi utilizada com sucesso na expressão da proteína
superoxidismutase de humanos.
A primeira iniciativa para a expressão dela foi em E. coli. Contudo, a expressão neste
sistema não produziu a acetilação da cadeia proteica, como ocorre com a proteína de humanos.
Assim, a tentativa seguinte foi a expressão em S. cerevisiae. Neste experimento, altos níveis de
expressão proteica da superoxidismutase foram obtidos, sendo que a mesma apresentava-se
acetilada, assim como a proteína isolada de humanos. Portanto, este exemplo ilustra a eficácia
da expressão de proteínas eucariotas em S. cerevisiae.
O sistema de expressão de proteínas recombinantes deve ser dinâmico, permitindo ao
pesquisador testar diferentes estratégias de clonagem e expressão. Diferentes vetores que
proporcionam meios eficazes de expressão em S. cerevisiae foram construídos. Além de
alcançar altos níveis de produção de proteína eucariotas em uma conformação adequada, os
vetores ainda oferecem opções ao pesquisador, como o endereçamento proteico. Sobre este
aspecto, um dos mais visados em processos biotecnológicos é a possibilidade de produzir
proteínas e secretá-las ao meio externo.

 SECREÇÃO DE PROTEÍNAS HETERÓLOGAS POR S. CEREVISIAE


A secreção de proteínas heterólogas por S. cerevisiae exerce um papel chave nas
modificações pós-traducionais, como a glicosilação. Somente as proteínas secretadas por esta
levedura recebem a adição de açúcares à cadeia proteica.
A construção de vetores de expressão que permitam a secreção de proteínas
recombinantes é muito similar ao protocolo utilizado em procariotos. Com este propósito, um 141
peptídeo sinal é clonado a jusante da sequência codificadora. Esta sequência sinal é
reconhecida pela maquinaria de secreção de S. cerevisiae, permitindo que a proteína assim
expressa seja eficientemente secretada.
Durante o processo compreendido entre a tradução e a secreção da proteína de
interesse, estas macromoléculas sofrem algumas modificações pós-traducionais, como a
formação de pontes dissulfeto e a clivagem proteolítica. Ao chegar à membrana celular, o
peptídeo sinal permite que a proteína passe por meio dela.
Em seguida, o peptídeo sinal é reconhecido e removido da proteína recombinante por
uma endoprotease que reconhece o dipeptídeo Lys-Arg. Esta sequência é posicionada
imediatamente antes da sequência codificadora da proteína de interesse. Assim, a proteína
exibirá a sequência de aminoácidos correta na sua porção N-terminal. A liberação da proteína
para o meio se completa após a clivagem do peptídeo sinal.
A utilização primordial de vetores que permitam a secreção de proteínas expressas em
S. cerevisiae é a glicosilação de proteínas eucariotas. Entretanto, outros proveitos de interesse
biotecnológico podem ser obtidos com esta estratégia. Assim como a escolha destes vetores
para organismos procariotos, a secreção das proteínas expressas facilita a purificação de
proteínas recombinantes. Portanto, o uso de vetores de expressão de S. cerevisiae contendo a
sequência do peptídeo sinal tem como vantagem a indução de modificações pós-traducionais e
purificação facilitada das proteínas expressas neste hospedeiro.
Muitas proteínas têm sido expressas com sucesso em S. cerevisiae, como o antígeno
de superfície do vírus da Hepatite B. Contudo, a expressão nesta levedura também apresenta
desvantagens, como os baixos níveis de expressão obtidos para algumas proteínas. Outros
problemas relatados incluem:
I. A perda de plasmídeos no decorrer de gerações em produções de larga escala;
II. A hiperglicosilação de proteínas heterólogas. Nesse caso, observa-se que os
resíduos de manose receberam cerca de 100 resíduos de açúcar, sendo que o normal varia de 8
a 13. Estas unidades extras podem alterar a atividade biológica ou mesmo mudar a
imunogenicidade da proteína;
III. Em alguns casos, observou-se que proteínas secretadas ficam presas no
espaço periplasmático, o que prejudica a purificação de proteínas.
Frente a estas desvantagens apresentadas pelo sistema de expressão em S.
cerevisiae, pesquisadores estudaram métodos para aperfeiçoar a expressão de proteínas. Para 142
isso, tem-se estudado alternativas, como a construção de novos vetores de expressão, além da
possibilidade de utilizar diferentes hospedeiros.
A escolha de novas leveduras como sistema de expressão depende da apresentação
de algumas características desejadas para a expressão de proteínas. Dentre elas, incluem-se:
I. A disponibilidade de vetores apropriados;
II. Sistemas de expressão com sequências reguladoras apropriadas para cada
hospedeiro em específico;
III. A habilidade de transformar os diferentes hospedeiros com os vetores de
interesse;
IV. Obtenção de altos níveis de expressão;
V. Habilidade do organismo hospedeiro em crescer sob condições industriais.
Candidatos de leveduras para a expressão de proteínas heterólogas incluem Pichia
pastoris e Schizosaccharomyces pombe. Estas leveduras são denominadas como
“convencionais”, pois são as mais utilizadas atualmente com propósitos biotecnológicos. Outras
“não convencionais” incluem: Kluyveromyces lactis, que foi utilizado comercialmente para a
produção da β-galactosidase; Yarrowia lipolytica; Hansenula polymorpha; Arxula adeninivorans.
Dentre as duas opções de “leveduras convencionais”, grupos de pesquisa têm relatado
sucesso obtido após a expressão de proteínas na levedura Pichia pastoris. Por isso, grande
atenção e investimentos têm sido direcionados para esta levedura, visando seu aperfeiçoamento
como sistema de expressão.

 PICHIA PASTORIS

Pichia pastoris é uma levedura metilotrófica, o que significa que ela é capaz de crescer
em meio de cultura contendo metanol como única fonte de carbono. Historicamente, o que
chamou a atenção quanto a esta levedura é que a mesma cresce facilmente em meio de cultura
barato sob produções a nível industrial.
Outros aspectos, além dos baixos custos de manutenção da cultura de Pichia pastoris,
são vantajosos para a utilização desta levedura para processos biotecnológicos. A sua cultura
não apresenta um alto nível de fermentação. Este processo resulta na geração de etanol, um
componente que em culturas de alta densidade celular pode atingir níveis tóxicos. A toxicidade 143
desta substância inviabiliza o crescimento da cultura de leveduras.
Por apresentar baixos níveis de fermentação, isto constitui uma vantagem do uso de
Pichia pastoris como hospedeiro para a expressão de proteínas em comparação a S. cerevisiae,
pois a cultura de Pichia pastoris pode alcançar altas densidades celulares. Há relatos de que o
crescimento em peso seco obtido pode atingir cerca de 100g/L, ou mesmo, quantidades maiores.
Considerando todas as vantagens descritas e o fato de que a densidade celular está diretamente
relacionada com a quantidade de proteínas produzidas, ideias surgiram com a finalidade de
transformar Pichia pastoris como um sistema de produção de proteínas recombinantes.
Um dos experimentos iniciais com a levedura para a expressão de proteínas de
interesse comercial foi à tentativa de expressar, em altos níveis, o antígeno de superfície do
vírus da hepatite B. Para isso, foi desenvolvido um sistema de expressão do tipo integrativo, que
continha a sequência promotora e a terminadora derivadas do gene da enzima álcool oxidase.
Atualmente, esta é uma das características que tornam esta levedura como uma
hospedeira atraente para a expressão de proteínas heterólogas, pois este vetor permite obter
altos níveis de expressão proteica.
O vetor de expressão é constituído do promotor, da sequência terminadora e do sinal
de poliadenilação derivados do gene que codifica a enzima álcool oxidase. O plasmídeo é um
vetor “shuttle”, contendo uma origem de replicação para Pichia pastoris e outra para E. coli. Além
disso, o vetor contém a sequência codificadora da ampicilina, o que permite a seleção dos
plasmídeos recombinantes em E. coli. Outro gene encontrado no plasmídeo é o codificador da
enzima histidiol desidrogenase (his4). Esta marca permite a seleção de transformantes
prototróficos His+ quando os vetores são transformados em uma linhagem de Pichia pastoris
deficiente para a expressão deste gene, as his4. Portanto, somente as células transformadas
serão hábeis de crescer em meio deficiente em histidina. O mapa do vetor está demonstrado na
Fig. 61.
144

FIGURA 61: MAPA DO VETOR PPICZ PARA A EXPRESSÃO EM PICHIA PASTORIS


(INVITROGEN)

FONTE:
Os vetores de expressão utilizados em Pichia pastoris geralmente são integrativos. O
objetivo é permitir que a sequência de interesse, clonada entre a região promotora e
terminadora, se integre ao genoma do hospedeiro, a fim de evitar problemas de instabilidade do
plasmídeo. Estes vetores possuem em sua estrutura sequências de DNA homólogas às do DNA 145
do cromossomo da levedura nas regiões proximais do gene histidiol desidrogenase, o que tem
por finalidade facilitar a integração do material genético transformado por recombinação
homóloga.
O processo de recombinação homóloga está envolvido com dois fatos interessantes. O
primeiro, é que a sua conclusão ocorre com a troca do gene AOX1 pela sequência de interesse.
Isto permite uma segunda forma de seleção dos transformantes. Há um segundo gene funcional
presente no cromossomo da célula hospedeira, o AOX2. Este gene, apesar de funcional, ele é
menos efetivo, resultando em um crescimento lento da levedura na presença de metanol. Outro
ponto a considerar, é que várias cópias podem ser integradas ao genoma, o que está
relacionado com os níveis de expressão.
O promotor AOX1 é regulado transcricionalmente pelo substrato metanol. O uso deste
indutor é vantajoso sob o ponto de vista econômico, pois seu custo é considerado como
relativamente barato. A regulação da transcrição, a partir deste promotor, também é regulada
pela presença de glicose na cultura. A ativação de AOX1 e, portanto, o início da transcrição
somente se inicia na ausência completa de glicose.
Após a indução da expressão com o metanol, são obtidos altos níveis de expressão,
equivalentes àqueles obtidos por genes altamente expressos e que estão sob o controle dos
promotores envolvidos com a via glicolítica. Na presença de metanol, observa-se que os níveis
de expressão da enzima álcool oxidase representam cerca de 30% da proteína celular total de
Pichia pastoris, o que confirma os altos níveis de expressão obtidos a partir deste promotor.
Além disso, esta sequência promotora é fortemente regulada, sendo reprimida em condições de
crescimento com a ausência de metanol.
Assim, por a transcrição ser fortemente regulada, a expressão da proteína de interesse
é acionada e desligada em tempos determinados. Essa característica impede a expressão por
períodos inapropriados de proteínas tóxicas à cultura celular e dificulta a proliferação, na cultura
de leveduras, daquelas que não expressem o gene de interesse.
As proteínas expressas por este sistema podem ser apresentadas tanto como
intracelulares como sendo secretadas. Essa característica depende da adição ao vetor de
expressão de um peptídeo sinal que permita o endereçamento proteico. Nestes casos,
frequentemente é utilizado o peptídeo sinal derivado de S. cerevisiae (Fig. 62).

146

FIGURA 62: MAPA DO VETOR PMET (INVITROGEN)


FONTE:

A figura ilustra as duas versões de vetores disponíveis comercialmente, uma para a


147
expressão citoplasmática e outra para a secretada. Neste último caso, o vetor é construído com
a adição do peptídeo sinal derivado de S. cerevisiae, o fator alfa.
A secreção de proteínas recombinantes está relacionada com uma característica
essencial da estrutura da proteína expressa, a glicosilação. Assim como ocorre em S. cerevisiae,
a glicosilação de proteínas somente ocorre com aquelas que são secretadas. Os tamanhos das
cadeias de carboidratos adicionados por Pichia pastoris são menores que os observados em S.
cerevisiae. Portanto, a glicosilação em Pichia pastoris é outra vantagem sobre a expressão em
S. cerevisiae, pois neste último há a hiperglicosilação que altera a atividade das proteínas.
O uso desta levedura como vetor de expressão tem se tornado popular, sendo relatada
a expressão de mais de 200 proteínas de vírus, bactérias, fungos, animais, plantas e de
humanos. Contudo, a expressão em Pichia pastoris também apresenta algumas desvantagens.
Uma delas está relacionada aos vetores de expressão disponíveis.
Embora muito utilizados, os vetores de expressão apresentam como desvantagem o
grande tamanho que varia em torno de 8kb. Outra desvantagem dos mesmos consiste no fato de
possuírem poucos sítios de restrição que permitam a clonagem do gene heterólogo.
Há vetores de expressão alternativos, que são plasmídeos menores. Um exemplo é
uma família de vetores que apresenta como mecanismo de seleção dos transformantes o gene
sh ble, conferindo resistência à droga zeomicina. Apesar de esta seleção ser eficiente tanto em
E. coli como em Pichia pastoris, a droga apresenta um custo elevado, o que inviabiliza a sua
utilização.
Outro vetor desenvolvido consiste em um plasmídeo cuja expressão está sob o
controle do promotor gap. Essa sequência é derivada do gene gliceraldeído-3-fosfato
desidrogenase e apresenta uma forte expressão constitutiva. A expressão obtida a partir deste
promotor em culturas crescidas em glicose apresenta níveis de expressão comparáveis àqueles
obtidos com o promotor AOX1 em culturas crescidas em metanol. A vantagem do promotor gap
consiste em não ser necessária a troca do meio de cultura antes de induzir a expressão do gene
de interesse. A desvantagem da sua utilização consiste no fato de que a expressão constitutiva
não é desejável para a expressão de genes deletérios para a célula. Além disso, o gasto celular
para este tipo de expressão é significante para a cultura se comparada à obtida por um promotor
regulável, como o AOX1.
Outra desvantagem da expressão em Pichia pastoris consiste em baixos níveis de
expressão obtidos para algumas proteínas. A solução para este problema está em aprimorar 148
novos vetores de expressão. Contudo, assim como em outros organismos eucariotos, a
regulação da expressão é complicada, o que exige tempo para desenvolver estratégias eficazes.
O aumento dos níveis de expressão foi verificado em linhagens que continham três
cópias integradas ao genoma. A detecção destes clones se dá por métodos imunológicos. Nesse
caso, é necessária a disponibilidade de anticorpos específicos para a proteína heteróloga. O
método permitiu a identificação de clones que expressam a proteína de interesse em diferentes
níveis.
A glicosilação efetuada por Pichia pastoris nem sempre se dá com a conformação
adequada. Apesar de ser similar à que ocorre em mamíferos, esta levedura não se é capaz de
adicionar manoses terminais com ligações α-1,3, como em S. cerevisiae, o que faz com que as
proteínas expressas em Pichia pastoris sejam menos imunogênicas que as expressas em S.
cerevisiae.
Ainda, assim como em S. cerevisiae, outro problema relacionado com a glicosilação
que ocorre em algumas proteínas expressas em Pichia pastoris é a hiperglicosilação. Apesar de
algumas proteínas receberem cadeias curtas de oligossacarídeos, não se conhece um fenômeno
capaz de explicar os diferentes padrões de glicosilação apresentados pela Pichia pastoris.
As leveduras apresentam vantagens significativas que justificam seu uso na expressão
de proteínas eucariotas, como os altos níveis de expressão a baixo custo, além de sua
capacidade de realizar modificações pós-traducionais. Quanto a esta última característica, ela
pode ser considerada um paradoxo. Apesar de ser uma vantagem, estas modificações também
são pontos de desvantagem da expressão em leveduras. A explicação para esta ambiguidade de
afirmações está ligada ao fato da falta de identidade destas modificações pós-traducionais que
ocorrem entre a expressão em leveduras e em células de mamíferos. A forma com que os
oligossacarídeos são adicionados à cadeia proteica por leveduras difere estruturalmente da que
ocorre em mamíferos. Este ponto é crítico na produção de proteínas de interesse terapêutico,
pois a diferença estrutural pode afetar a atividade biológica da macromolécula expressa.
Alternativas promissoras vêm sendo desenvolvidas com a finalidade de expressar
proteínas eucariotas de maneira a apresentar a maior identidade àquelas expressas em células
de mamíferos. Entre elas, especula-se a possibilidade de produzir leveduras capazes de realizar
a glicosilação de forma mais similar à observada em humanos. Além destas estratégias, outros
tipos de hospedeiro também vêm sendo testados, como os fungos filamentosos.
149
 FUNGOS FILAMENTOSOS

Os fungos filamentosos são assim, como as leveduras, um sistema em teste que tem
ganhado cada vez mais espaço na biotecnologia para a expressão de proteínas recombinantes.
Entre os fungos utilizados com este propósito estão o Filamentous fungus, o qual exibe alta
capacidade de secreção de proteínas, e os fungos Aspergillus niger e Aspergillus oryzae, que
têm sido, há algum tempo, utilizados na produção de alimentos. Outros fungos, como o
Metarhizium anisopliae, vêm sendo testados quanto ao seu potencial no controle de insetos.
O uso de fungos filamentosos apresenta propriedades que os tornam hospedeiros
potenciais para a expressão de proteínas eucariotas. Contudo, este sistema também apresenta
desvantagens como o baixo nível de expressão. Apesar de estudos na área terem apontado
alternativos potenciais para solucionar o problema, estes hospedeiros ainda apresentam como
desvantagem a escassez de conhecimentos, o que dificulta a sua manipulação e o
desenvolvimento de ferramentas para a expressão de proteínas. Enquanto isso, uma opção é o
uso de outros hospedeiros, como os baculovírus.

 BACULOVÍRUS

A produção de proteínas recombinantes por meio de baculovírus é uma opção


interessante para a expressão de proteínas eucariotas. O uso deste sistema foi utilizado com
sucesso para a produção de diversas proteínas. Os baculovírus exibem uma alta especificidade
em relação a seus hospedeiros. Eles infectam exclusivamente os invertebrados, sendo limitada a
células de insetos. O seu ciclo de infecção inclui a produção de duas formas virais. Uma consiste
na produção de vírions que são liberados pela célula infectada, permitindo a infecção de outras
células livres. A segunda forma consiste na produção de vírus que são presos a uma matriz
proteica, a poliedrina. Esta matriz contendo os vírus é liberada após a morte e lise da célula
infectada.
A segunda opção de ciclo celular parece ter a função de proteção contra a inativação
por agentes ambientais. Após a infecção de outras células pela matriz com os vírus, a proteína
poliedrina é solubilizada, liberando os vírus, os quais são capazes de estabelecer uma nova
infecção. Durante os últimos estágios de infecção, a poliedrina é sintetizada em quantidades 150
massivas, o que se inicia aproximadamente 36 a 46 horas após a infecção e continua por 4 a 5
dias até que haja a morte celular.
Os estudos que dissecaram a infecção por baculovírus demonstraram que o promotor
responsável pela transcrição da poliedrina é extremamente forte, característica ideal para a sua
utilização em processos biotecnológicos. Além disso, a produção desta proteína não é essencial
para o ciclo de reprodução viral, o que gerou a hipótese de que esta sequência poderia ser
usada para a clonagem de uma sequência de interesse.
Considerando a similaridade das modificações pós-traducionais que ocorrem em
células de insetos e de mamíferos, hipotetizou-se que as proteínas expressas por este sistema
poderiam mimetizar ou até mesmo serem idênticas às proteínas expressas em células de
mamíferos. Com o promotor forte, as proteínas recombinantes podem ser expressas em altas
quantidades e, por isso, o gene da poliedrina foi utilizado como sítio de clonagem para a
sequência de interesse.
Os baculovírus que têm sido muito utilizados na construção de vetores de expressão
são o Acetographa californica ou o vírus Bombyxmori. A razão de utilização destas cepas se
deve ao bom crescimento que elas apresentam em muitas linhagens de células de insetos.
Níveis de expressão significativos de proteínas expressas por este sistema, e ainda
apresentando modificações pós-traducionais semelhantes às observadas naquelas expressas
por células de mamíferos, justificam o uso de baculovírus como sistema de expressão.

 PROBLEMAS DERIVADOS DA EXPRESSÃO EM BACULOVÍRUS

Uma das desvantagens de utilizar baculovírus para a expressão de proteínas


recombinantes consiste no elevado custo de manutenção da cultura de células de insetos. Além
do meio utilizado para o crescimento destas células serem oneroso, a cultura exige que a
manipulação seja realizada por profissionais e equipamentos especializados. Outra
desvantagem é o tempo considerável gasto na manipulação destas células.
Alternativas para driblar a desvantagem da cultura de células de insetos têm sido
estudadas. Uma opção surgiu a partir da observação de que os baculovírus podem infectar com
sucesso não só células de inseto, como também suas larvas. Então, a ideia foi a de utilizar as
larvas como fábricas de produção de proteínas a baixo custo (Fig. 63). 151

FIGURA 63: USO DE LARVAS COMO BIOFÁBRICAS NA EXPRESSÃO DE PROTEÍNAS


RECOMBINANTES

FONTE:

Os baculovírus recombinantes são utilizados na infecção de larvas, que são capazes


de produzir grandes quantidades da proteína de interesse. A escolha desta opção se baseia
principalmente no menor custo de produção.
O uso de larvas como biofábricas para a expressão de proteínas recombinantes foi
testada com Trichoplusia ni, a qual foi transfectada com um baculovírus recombinante contendo
a sequência do cDNA que codificava a adenosina deaminase de humanos. Após quatro dias de
infecção, a produção da proteína recombinante representava cerca de 2 a 5% da proteína total
do inseto, sendo que se obteve cerca de 9 mg de proteína purificada a partir de 22 larvas.
Comparando-se à expressão em células, as vantagens ainda incluem uma manipulação para a 152
manutenção das larvas de somente três horas por semana.
O uso de baculovírus, mesmo utilizando as larvas como biofábricas, apresenta outras
desvantagens além do alto custo de manutenção. Uma delas inclui a vida curta, tanto da cultura
de células como das larvas. A lise celular e a morte da larva ocorrem após quatro a cinco dias
após a infecção. Esta característica também representa um custo significativo se comparada à
manutenção dos meios de infecção e da produção de proteínas recombinantes.
A manutenção de uma produção contínua é uma característica desejável e que tornaria
este processo mais viável financeiramente. Com esta finalidade, alguns autores sugerem o
desenvolvimento de sistemas de biorreatores em tandem. Nesse sistema, as células a serem
infectadas crescem em um primeiro biorreator e, em seguida, são repassadas a um segundo e
assim por diante. Dessa maneira, há uma síntese contínua da proteína de interesse, tornando o
sistema mais produtivo sob o ponto de vista comercial.
Alternativas para a produção contínua de proteínas recombinantes também vêm sendo
estudadas. Entre elas, inclui-se o teste de novas sequências promotoras que induzem uma
expressão constitutiva. Um exemplo é o promotor IE1, que controla a expressão de genes
expressos na fase inicial da infecção. A vantagem deste promotor é sua independência quanto a
outros produtos virais para iniciar a expressão, sendo que os níveis obtidos são significativos em
células de insetos. Testes com este promotor demonstraram que as linhagens celulares
produziram de forma contínua a proteína, cuja sequência codificadora foi clonada no vetor de
expressão. Isto, portanto, mostrou que o promotor IE1 é um candidato potencial a ser utilizado
na construção de novos vetores de expressão.
Um sistema que permita que as proteínas recombinantes sejam expressas de maneira
constitutiva é interessante quando se deseja que as mesmas sofram modificações pós-
traducionais. Algumas proteínas expressas a partir do promotor da poliedrina demonstraram uma
deficiência na glicosilação, o que pode estar relacionado com o fato de que proteínas expressas
no estágio final da infecção não são modificadas de maneira apropriada.
Mesmo diante das vantagens apresentadas por uma expressão constitutiva, este
sistema tem a desvantagem do desgaste que a célula terá o que, consequentemente, resultará
em uma menor produção. Portanto, para solucionar este problema, fazem-se necessários
estudos que permitam caracterizar sequências reguladoras que permitam o controle mais
adequado da expressão proteica em baculovírus.
A expressão de proteínas recombinantes em baculovírus ainda apresenta alterações 153
de conformação. Apesar de similares às obtidas em células de mamíferos, pequenas
modificações podem prejudicar a função das macromoléculas. Por isto, um último sistema está
disponível para a expressão de proteínas eucariotas, as células de mamíferos.

 SISTEMAS DE EXPRESSÃO EM CÉLULAS DE MAMÍFEROS

A expressão em células de mamíferos é um procedimento extremamente complexo.


Os elementos genéticos utilizados na construção dos vetores de expressão exibem as
sequências reguladoras derivadas de viroses animais, tais como SV40, poliovírus, herpesvírus e
o papilomavírus de bovinos.
A manipulação destes sistemas é um processo complicado e que, frequentemente,
resulta em uma expressão transiente e de baixos níveis. Por esta razão, inicialmente a
expressão: em células de mamíferos foi utilizada para estudos sobre a função e a regulação de
genes. A expressão “de proteínas de interesse” foi confinada a sistemas mais simples, como
leveduras e baculovírus. Contudo, certas proteínas de grande interesse na terapêutica humana
só adquirem a conformação adequada quando expressas em células de mamíferos. Por este
motivo, a expressão: de proteínas recombinantes em células de mamíferos está sob contínuo
aprimoramento.
A estratégia utilizada na construção de vetores de expressão para células de
mamíferos consiste no desenvolvimento de vetores “shuttle” compostos por elementos genéticos
derivados de diferentes fontes. Cada vetor funciona sob determinadas condições e em tipos
celulares específicos. Estes sistemas podem ser utilizados tanto para uma expressão transiente
ou mesmo para uma estável. Para isso, frequentemente são utilizadas as células COS TES e as
CHO SES, respectivamente.
As células COS TES são derivadas de uma linhagem de células do macaco verde
africano. Os vetores utilizados são constituídos pela origem de replicação do vírus Simian
(SV40). A linhagem celular é uma recombinante que expressa de forma constitutiva o antígeno T
do SV40. Após a infecção com o DNA viral contendo a sequência codificadora de interesse, a
proteína T se liga à origem de replicação viral, permitindo que este DNA se replique pela ação da
DNAP da célula hospedeira. Ao final, a célula transfectada morre devido à replicação ilimitada do
DNA exógeno. Portanto, este sistema se assemelha à replicação do baculovírus, no qual a
produção da proteína recombinante se dá por um intervalo de tempo determinado. 154
A limitação da expressão proteica por lise da célula hospedeira pode ser transpassada
pela possibilidade de expressão constitutiva nas células CHO SES, as quais são derivadas do
ovário do hamster chinês. Este tipo de expressão ocorre após a integração do material genético
recombinante ao genoma da célula hospedeira. Este sistema é apropriado para a expressão de
diversos tipos de proteínas, tanto na forma intracelular como de outras secretadas. Outra
vantagem é a adaptação destas células a diversos tipos de meios e condições de cultura. Outros
tipos celulares, além das CHO SES, também vêm sendo utilizados com o mesmo propósito,
como as células do rim de hamster novos (BHK), as células 293 derivadas do rim embrionário de
humanos (HEK) e as linhagens de células de mielomas como as J558 e as Sp2/0.
As desvantagens do uso de células de mamífero para a expressão de proteínas
recombinantes incluem a dificuldade de manipulação, os baixos níveis de expressão e o alto
custo de manutenção das culturas. Outro ponto relevante consiste na possibilidade de
contaminação do produto de interesse com viroses animais de células contaminadas.
Mesmo frente às desvantagens consideráveis do uso das células de mamíferos como
sistema de expressão, as vantagens frente a outros métodos para a expressão de proteínas
eucariotas são significativas. Entre eles, pode-se citar a correta síntese, processamento,
secreção e a modificação pós-traducional, processos que ocorrem de maneira idêntica à
encontrada em proteínas naturais expressas em células eucariotas. Esta similaridade estrutural é
fundamental para a funcionalidade das proteínas. Portanto, muitos investimentos têm sido
realizados a fim de aprimorar a expressão: em células de mamíferos a níveis industriais,
viabilizando este sistema de expressão.
155

5 APLICAÇÕES DA BIOTECNOLOGIA

A tecnologia do DNA recombinante forneceu as ferramentas que permitiram desvendar


a molécula de DNA. A principal aplicação desta descoberta foi o sequenciamento de genomas.
Com estas sequências, o passo seguinte consiste em revelar a função de cada uma, o que tem
aplicações diretas em diversas áreas do conhecimento, como a de saúde e a ambiental. Este
módulo tem por objetivo fornecer uma visão geral a respeito das diversas aplicações que a
biotecnologia pode trazer em benefício da sociedade.

5.1 PROJETOS GENOMA

Biotecnologia e genoma são termos inter-relacionados. Enquanto o primeiro significa a


aplicação dos conhecimentos, o segundo representa a descoberta e o entendimento necessários
para implantar os benefícios. A sequência e a ordenação dos nucleotídeos que compõe o
genoma contêm a diversidade de informações necessárias para gerar todas as formas de vida
existentes no planeta. Desse modo, o sequenciamento dos genes permite a leitura, a
compreensão e a utilização destes dados, características que impulsionam, então, o
desenvolvimento de projetos genoma.
O primeiro genoma sequenciado de um organismo vivo diferente de vírus foi o da
bactéria Hemophilus influenzae. Este tipo de projeto também prosseguiu para outros organismos
e espécies. Em 1990, uma associação internacional entre pesquisadores de diferentes países
iniciou o projeto Genoma Humano. Em 2000, o Brasil finalizou o sequenciamento do genoma da 156
bactéria Xylella fastidiosa, o que foi realizado por pesquisadores do estado de São Paulo.
Atualmente, diversos grupos de pesquisa investem esforços consideráveis no sequenciamento
de todo o material genético de diferentes microrganismos, principalmente. Só no Brasil, estão em
andamento mais de 10 projetos para desvendar a sequência de nucleotídeos de bactérias e
fungos. Estas tecnologias estão avançadas de tal maneira que este tipo de estudo pode ser
finalizado em apenas poucos dias.
O grande interesse manifestado por pesquisadores quanto ao desenvolvimento de
projetos genoma se deve às grandes aplicações que suas informações podem proporcionar. O
pleno conhecimento das informações genéticas de diferentes organismos possibilitará um melhor
entendimento da diversidade genética, o que permitirá desvendar muitas questões, como a
relação, parasita-hospedeiro. O desenvolvimento de vacinas e de testes diagnósticos e,
finalmente, guiará a produção de novas drogas e terapias efetivas para o tratamento de diversas
doenças.
Um equívoco das pessoas em relação aos projetos genoma se refere à sua associação
de resolução e cura de doenças. Na verdade, o que este tipo de projeto fornece são informações
sobre as coordenadas iniciais de onde se localiza um determinado defeito genético. Por
exemplo, atualmente já se tem conhecimento de onde buscar a informação genética que
predispõe para a Doença de Alzeimer e do câncer de reto. Apesar disto, não há garantias de que
a cura destas doenças será descoberta. Os projetos genoma constituem, portanto, o
conhecimento básico que dará suporte, no futuro, a uma aplicabilidade das informações por ele
geradas.
As pesquisas sobre o genoma constituem o ponto de partida para a era pós-genômica.
Os cientistas acreditam que, por exemplo, compreendendo a fundo o que acontece de errado
quando uma doença aparece, a medicina entrará em uma nova era, como o estabelecimento de
terapias mais eficientes. Uma delas é a terapia gênica.
5.2 TERAPIA GÊNICA

Entende-se como terapia gênica a transferência de material genético para as células


de um indivíduo, resultando em substituição ou mesmo na complementação dos genes 157
defeituosos. Esse conceito atualmente é mais amplo e abrange o tratamento de doenças
degenerativas, infecciosas e do câncer.
A terapia gênica constitui uma esperança para o tratamento de diversas doenças que
atualmente não apresentam um tratamento adequado. Cerca de quatro mil doenças genéticas
são conhecidas, sendo, portanto, alvos potenciais da terapia gênica. Outras aplicações
sugeridas para esta tecnologia também incluem a liberação de proteínas que permitam controlar
os níveis hormonais ou estimular o sistema imunológico.
O primeiro exemplo de aplicação da terapia gênica foi realizado, em uma criança de
quatro anos que sofria de uma desordem no sistema imunológico, nos Estados Unidos. Desde
então, aproximadamente dez anos de pesquisa têm sido conduzidos na área. Um deles
apresentou um resultado significativo, que foi a reversão dos efeitos da doença hereditária da
Imunodeficiência ligada ao cromossomo X. Apesar deste resultado promissor, a maioria deste
tipo de terapia não tem apresentado tanto sucesso. Novas pesquisas devem ser concluídas de
forma a aperfeiçoar este tipo de tratamento.
A terapia gênica constitui uma estratégia promissora para o tratamento de diversas
doenças infecciosas. Entretanto, frente a tratamentos ainda ineficazes, a biotecnologia também
revolucionou a área da medicina preventiva, como o desenvolvimento de novas vacinas.

5.3 NOVAS VACINAS

Diversos tipos de vacinas estão disponíveis ou em desenvolvimento, cada qual


apresentando diferentes vantagens e desvantagens. As que utilizam micro-organismos vivos
atenuados ou mortos têm a vantagem de apresentarem múltiplos epitopos para reconhecimento
pelo sistema imunológico, sendo que seu custo e produção dependem basicamente do
fornecimento de material contendo os micro-organismos em questão. Contudo, sua segurança é
questionável. A instabilidade da vacina atenuada torna difícil a sua distribuição, particularmente
em países em desenvolvimento.
Além disso, as vacinas que utilizam todo o micro-organismo podem apresentar reações
cruzadas com outros antígenos, o que interfere com os testes sorológicos. No caso de vacinas
mortas, apesar de serem mais seguras, frequentemente necessitam de múltiplas inoculações 158
associadas a adjuvantes, o que pode induzir efeitos colaterais indesejados. Dentro destes
aspectos, percebe-se a necessidade do desenvolvimento de vacinas mais seguras e eficazes.
A tecnologia do DNA recombinante tem sido utilizada no aprimoramento de vacinas.
Na era dos ‘omas’, as análises de genomas, transcriptomas e proteomas permitem um melhor
atendimento das vias moleculares relacionadas à biologia do patógeno e das interações
parasita-hospedeiro. A partir destas informações, proteínas alvos têm sido obtidas a partir da
expressão em vetores de expressão procariotos e eucariotos, constituindo as vacinas de
subunidades proteicas.
As vacinas de subunidade têm sido muito utilizadas para a prevenção de doenças.
Mesmo que sejam necessários vários antígenos para a estimulação da resposta imunológica
adequada, ela ainda possui vantagens sobre a utilização de drogas como tratamento ou como
método preventivo de doenças. Por exemplo, o controle de parasitas geralmente utiliza drogas
em um sistema de rotação, o que pode induzir a resistência aos medicamentos utilizados. Além
disso, outro ponto atualmente muito discutido se refere à contaminação ambiental pelo uso
excessivo e descontrolado destas drogas.
Outras apresentações vacinais estão sob contínuo aprimoramento. Uma das mais
recentes é a vacina de DNA. O antígeno destas vacinas é expresso pela própria célula do
hospedeiro, sendo capazes de induzir uma potente resposta imunológica, principalmente em
nível de linfócitos citotóxicos. Esta característica a torna uma estratégia promissora no combate
de parasitas intracelulares.
A tecnologia do DNA recombinante ainda auxilia no desenvolvimento de novas formas
para a apresentação de antígenos, como o uso de lipossomas, nanopartículas, ou mesmo o uso
de vírus e bactérias carreadoras. Esta última opção tem grande interesse, principalmente no
desenvolvimento de vacinas veterinárias, pois apresenta a oportunidade de induzir a imunidade
de mucosa. A maioria das doenças infecciosas de animais é adquirida por via oral ou por
inalação, o que é facilitado pelas condições de criação em que os animais estão submetidos.
Assim, vias que gerem a imunidade de mucosa poderiam ser a via de imunização mais eficaz
para determinadas doenças de animais.
A biotecnologia ainda pode ser utilizada para resolver um problema decorrente da
vacinação: a distinção entre indivíduos vacinados e infectados. Para que isto seja possível, uma
estratégia é a identificação de antígenos que induzam uma intensa resposta humoral (por
anticorpos) durante a infecção e que não sejam essenciais para a imunidade induzida ou para a 159
sobrevivência da bactéria. Esta informação pode ser utilizada na construção de uma linhagem
mutante para o gene em questão.
Assim, animais infectados podem ser identificados pela resposta humoral contra o
antígeno que foi deletado da linhagem vacinal; por outro lado, os animais vacinados e não
infectados não reagiram no mesmo teste. Estudos nessa área estão recebendo intensos
investimentos e os resultados experimentais já obtidos demonstram-se promissores.
A biotecnologia tem um profundo aproveitamento na área da saúde. Além do
desenvolvimento de terapias e de vacinas, ela ainda pode ser utilizada na geração de novos
produtos e kits de diagnóstico.

5.4 NOVOS PRODUTOS

Muitos produtos de interesse comercial e de saúde pública já são obtidos atualmente


por meio de técnicas biotecnológicas. Exemplos como a insulina humana, o hormônio de
crescimento bovino, suíno e equino e substâncias beta-agonistas, foram obtidos com sucesso.
Frequentemente, a tecnologia envolvida em sua geração é a expressão em sistemas procariotos
e eucariotos. Contudo, o mesmo objetivo pode ser alcançado utilizando animais transgênicos
como biofábricas.

5.5 NOVOS KITS DE DIAGNÓSTICO


O método de diagnóstico mais utilizado na clínica médica e veterinária é o
microbiológico. Contudo, o isolamento e a caracterização dos diversos micro-organismos
possuem limitações, principalmente no caso de linhagens em que o cultivo in vitro não é tão
eficiente. A necessidade de meios de cultura específicos para cada patógeno, o tempo de
crescimento in vitro, que pode variar de semanas a meses, e a presença de contaminantes são
fatores limitantes quanto à utilização do método em questão. Portanto, há a necessidade de 160
métodos diagnósticos capazes de obter um resultado de alta sensibilidade e especificidade em
menor tempo, sendo o diagnóstico molecular uma alternativa promissora.
O diagnóstico molecular utiliza como base a identificação de sequências de DNA
específicas e características de cada patógeno. A técnica de eleição para este fim é a reação em
cadeia da amplificação de ácidos nucleicos (PCR). Vários grupos de pesquisa desenvolvem este
tipo de teste, comparando a sua vantagem frente a métodos de diagnóstico tradicionais. Dentro
deste contexto, um trabalho comparou a sensibilidade entre a microscopia óptica, a
imunofluorescência indireta e o PCR para a detecção de Brucella equi em equinos cronicamente
infectados.
O ensaio mostrou que 38,8%, 50% e 78% dos animais formam positivos utilizando as
técnicas anteriormente citadas, respectivamente. Ainda foi relatado o fato de o PCR ter
detectado o agente etiológico até mesmo em baixos níveis de parasitemia. Estes resultados
demonstram que o PCR é uma técnica bastante eficiente quanto ao diagnóstico de doenças
infecciosas.
As provas de diagnóstico molecular são amplamente trabalhadas, o que se deve a sua
alta sensibilidade e especificidade. O PCR é uma técnica capaz de amplificar uma sequência de
interesse a partir de picogramas do DNA da amostra, o que caracteriza sua alta sensibilidade. A
alta especificidade das técnicas moleculares está relacionada com a amplificação de somente
uma sequência de DNA específica de cada patógeno, evitando respostas cruzadas com outros
agentes que possuam características similares. Isto constitui uma vantagem em relação ao
diagnóstico por testes sorológicos, uma vez que o mesmo pode identificar características
compartilhadas por outros agentes etiológicos.
A escolha por um método de diagnóstico molecular baseado no PCR deve ser
analisada com cautela. Apesar da alta sensibilidade e especificidade, os testes moleculares
também apresentam limitações e problemas frequentes. A reação pode gerar desde um falso-
positivo, devido à presença de contaminantes, ou mesmo um falso negativo, pela presença de
inibidores da reação na amostra clínica.
Além destes problemas, outra questão se refere à falta de controles internos na
reação, dificultando diferenciar entre um diagnóstico negativo verdadeiro e uma falha da técnica.
Portanto, o aprimoramento da técnica e dos métodos de análise padrão constitue passos
fundamentais para a implantação do diagnóstico molecular. 161
Uma opção ao diagnóstico por PCR é a utilização de uma de suas variantes, o PCR
multiplex. Esta técnica se baseia na inclusão, em uma mesma reação de PCR, de pares de
iniciadores capazes de amplificar diferentes sequências de um determinado agente etiológico,
incluindo uma que será amplificada com certeza em qualquer amostra clínica. Este tipo de
controle interno diferenciará se o resultado é realmente negativo ou se decorre de um problema
que tenha inibido a reação.
O PCR multiplex, apesar de ser uma variante com vantagens consideráveis sobre o
PCR convencional, também possui suas limitações. Dependendo dos agentes que se queiram
identificar, o número de pares de iniciadores a serem adicionados em uma mesma reação
também é um fator limitante para uma amplificação adequada. Quando muitos são adicionados,
observa-se uma diminuição, até mesmo expressiva, da sensibilidade do teste. Mesmo sendo
possível a manipulação em alguns casos, a solução para este problema pode exigir o uso de
outra técnica, como a hibridização reversa.
A hibridização reversa consiste de uma reação de PCR que utiliza um primer universal
capaz de amplificar sequências conservadas entre os agentes etiológicos a serem
diagnosticados. Apesar de a região de anelamento dos iniciadores ser conservada, a porção
interna da mesma deve conter sequências variáveis e singulares a cada patógeno. A
diferenciação entre eles é feita com o auxílio da hibridização.
Para isso, utiliza-se um aparato especial que permite que várias amostras de PCR
sejam analisadas ao mesmo tempo, em relação a diferentes agentes. Além disso, essa técnica é
a de eleição em casos em que o objetivo seja o de diagnosticar infecções múltiplas, sendo ainda
uma técnica de maior sensibilidade que o PCR.
Diante do exposto, a escolha do teste de diagnóstico a ser utilizado depende dos
objetivos do pesquisador e das condições limitantes. Para diferentes situações são exigidas
adaptações distintas. Por isso, novas técnicas estão sendo desenvolvidas, como:
I. O PCR em tempo real, que permite a quantificação do material referente aos
possíveis alvos. Sua vantagem está na possibilidade de diferenciar entre a presença de uma
sequência de DNA e a sua expressão ativa;
II. A tecnologia do microarray, o qual pode ser utilizado na identificação de
espécies, sorotipos, marcadores de virulência e resistência a antibióticos;
III. O sequenciamento de genes derivados dos micro-organismos. 162

A biotecnologia tem múltiplas aplicações em diversas áreas do conhecimento. Além da


área da saúde, como o desenvolvimento da medicina terapêutica e preventiva, as técnicas
derivadas da engenharia genética podem trazer benefícios para a agropecuária. Exemplos são a
seleção assistida por testes de DNA e a clonagem.

5.6 SELEÇÃO ASSISTIDA COM TESTES DE DNA E CLONAGEM

A tecnologia do DNA recombinante permite ainda fornecer instrumentos para o


melhoramento animal. A produção agropecuária exerce um importante patamar na economia e
comércio internacional brasileiro. Assim, a pesquisa busca métodos eficientes para aperfeiçoar o
potencial genético dos animais, resultando em uma produção mais rentável, com elevada
produtividade e/ou agregação ao valor do produto.
Uma alternativa utilizada no melhoramento de animais utiliza a genética clássica de
Mendel. Durante séculos este modelo tem sido empregado com sucesso para a seleção artificial
de características benéficas. Contudo, esta metodologia apresenta desvantagens relevantes.
Vários cruzamentos são necessários, tendo ainda que levar em consideração o tempo de
amadurecimento sexual e do intervalo entre partos dos animais. Estas afirmações demonstram
que se leva muito tempo até alcançar a característica desejada.
Além disso, os resultados obtidos podem ser insatisfatórios, pois pode ocorrer de que
outros genes ligados ao de interesse, que codificam características indesejadas, sejam
repassados também. Diante destes fatos, percebe-se a necessidade de implantar estratégias
que permitam trabalhar o melhoramento genético em um menor tempo de gerações para o
surgimento da característica desejada. Uma destas estratégias é por meio das técnicas
derivadas da biotecnologia molecular.
O melhoramento genético tem sido beneficiado de estudos com a genômica. Esta
ciência envolve uma verdadeira anatomia molecular, como o mapeamento de cromossomos,
iniciativas de estudos de transcriptomas em tecidos e órgãos, ou mesmo em fases da evolução
embrionária. Contudo, estas informações são muito amplas e ainda restritas sobre a sua 163
funcionalidade, dificultando a sua aplicação no melhoramento de animais. Um dos métodos mais
promissores para a produção animal é o estudo de polimorfismos genéticos.
Os polimorfismos genéticos são variações nos alelos de um gene, o que resulta em
diferentes genótipos. Esses marcadores moleculares podem estar ligados às características de
interesse, como a taxa de ovulação, de crescimento e de composição corporal, da qualidade e
função do sistema imunológico e, até mesmo, com a eficiência reprodutiva. Nestes casos, eles
são pontos de partida para avaliar e escolher genótipos que devam ser propagados até alcançar
a característica de interesse.
Os polimorfismos se aplicam, inicialmente, em estudos populacionais. As variações em
alelos podem ser documentadas em estudos genealógicos, permitindo a montagem da estrutura
da população. As vantagens da genômica para a análise de pedigrees na genética quantitativa
se traduzem em uma maior acurácia, tendo-se que inferir menos a respeito das observações
feitas a partir da prole obtida.
Estudos de pedigrees foram realizados na identificação de características de interesse
e, consequentemente, para a seleção animal. Um exemplo foi o estudo sobre a deficiência do
fator XI em gado, patologia que pode ser assintomática. Contudo, esta anomalia é pleiotrópica,
afetando outras características de interesse econômico, como a reprodução e o estado
imunológico dos animais. Sugere-se que o gado deficiente no fator XI, incluindo tanto os
homozigotos quanto os heterozigotos, dá menor número de bezerros, além de serem mais
susceptíveis às doenças infecciosas.
Diante do impacto econômico que a deficiência do fator XI tem sobre a produção
animal, foram realizados estudos sobre a sua transmissão. Para isso, utilizou-se a análise de
pedigree, que mostrou tratar-se de uma deficiência autossômica recessiva. Diante deste fato, um
trabalho de genotipagem de gado foi desenvolvido com o objetivo de avaliar a frequência da
mutação gênica na população.
A deficiência se deve a inserção que acrescenta aproximadamente 76b de uma
espécie de cauda poliA. A diferenciação entre homozigotos e heterozigotos pode ser feita após a
amplificação das sequências alélicas pó PCR, sendo que o resultado pode ser visualizado após
a eletroforese dos amplicons. Os animais homozigotos apresentam uma única banda, sendo que
a de maior peso molecular indica que os animais são homozigotos recessivos. Diferentemente,
os indivíduos heterozigotos são distinguidos dos demais pela visualização de duas bandas 164
distintas no gel após a eletroforese da amostra.
Testes de genotipagem já vêm sendo realizados nos programas de melhoramento
genético e nas centrais de inseminação artificial, permitindo o descarte de características
indesejadas e as de baixa herdabilidade. Um exemplo é o teste para a susceptibilidade à
síndrome do estresse suíno, o qual já se encontra disponível comercialmente. Outros testes
disponíveis incluem os que permitem a análise de crescimento, reprodução e outros que afetam
a qualidade dos produtos animais.
O estudo de pedigree vem sendo também utilizado na reprodução animal para a
seleção de reprodutores. A análise preliminar de alguns grupos ancestrais visa utilizar, de
maneira mais racional, a variabilidade genética existente nos plantéis, ordenando quais seriam
os melhores pares para o acasalamento. Esse tipo de análise vem sendo feito na Amazônia para
a seleção de avestruzes. O mesmo estudo de polimorfismo é utilizado para este fim.
O potencial da biotecnologia para a reprodução também tem sido aplicado em
processos de sexagem de espermatozoides e de embriões. Estas técnicas são de grande
interesse, principalmente para gado de leite, podendo selecionar somente os espermatozoides
ou embriões que dêem origem a fêmeas. Isto evitaria o descarte de bezerros machos.
Outra tecnologia que foi testada ainda dentro do tema reprodução é a clonagem de
animais. O primeiro animal clonado foi a ovelha Dolly, sendo que no Brasil foi a bezerra Vitória.
Um dos ideais da clonagem consiste em aumentar a produção animal. Contudo, o custo
envolvido com esta tecnologia a torna inacessível para esta finalidade. Outros aspectos são: a
falta de conhecimento a respeito do funcionamento do genoma, além das questões éticas. Por
isso, centros de pesquisas que trabalham na área estão investigando o comportamento
fisiológico dos clones, para averiguar a viabilidade do processo.
O melhoramento genético de animais, com a introdução de uma característica de
interesse em menor tempo, tem um grande interesse comercial. Além de inferir com mais
acurácia os animais a serem cruzados, a biotecnologia ainda vem testando uma maneira mais
rápida para obter a qualidade almejada, como o uso de animais transgênicos. Além desta
aplicação, estes animais geneticamente modificados apresentam ainda outras aplicações
extremamente interessantes.

5.7 ANIMAIS TRANSGÊNICOS 165

A transgenia animal é a criação de indivíduos contendo genes heterólogos de


interesse, sem a necessidade de intercruzamento. Este objetivo é alcançado após a transfecção
da celular, o que permite que a sequência exógena seja inserida no material genético do
hospedeiro. Sua justificativa consiste no estabelecimento, em curto prazo e a um custo menor,
de características não alcançadas facilmente por outros meios, como a obtenção da
conformação correta de proteínas de interesse.
A aplicação de animais transgênicos é ampla e inclui estudos básicos, como:
I. Pesquisas médicas, como modelos de enfermidades humanas para a identificação
e estudo de fatores envolvidos em sistemas homeostáticos;
II. Em toxicologia, como organismos destinados a testes biológicos;
III. Na produção industrial, para obter proteínas específicas;
IV. Na agricultura e zootecnia, para o melhoramento da carne e de outros produtos de
origem animal; e
V. Na geração de animais resistentes a doenças.
Novos modelos animais vêm sendo utilizados também para avaliar mecanismos
patogênicos, procedimentos terapêuticos e de diagnóstico, nutrição e doença metabólica, além
de eficácia de novas drogas desenvolvidas. Contudo, esta apostila irá destacar somente
algumas destas aplicações.

5.7.1 Animais resistentes a doenças


Uma grande preocupação na produção agropecuária inclui os gastos relacionados com
o controle e o tratamento de doenças infecciosas, o que tem sido estimado em cerca de 10-20%
dos custos de produção total. Além disso, uma das características da criação de animais
consiste na aglomeração dos mesmos, o que permite a rápida disseminação dos patógenos.
Animais transgênicos gerados para serem mais resistentes a uma determinada doença
constituem então uma alternativa interessante para o problema. 166
Vários genes estão sendo testados para a geração de transgênicos resistentes às
patologias. Estudos iniciais foram realizados em camundongos. Um dos testes nesta espécie foi
o de obter animais com menor propensão a desenvolver mastite. Com este objetivo, células de
camundongos foram transfectadas com o gene da lisostafina. Esta proteína possui potente
atividade contra Staphylococcus sp, um dos agentes etiológicos frequentemente envolvidos em
casos de mastite. Os animais transgênicos foram testados contra o desafio por esta bactéria. Os
camundongos, cujas células da glândula mamária eram capazes de secretar proteínas
antibacterianas, mostraram-se mais resistentes à infecção em comparação com aqueles que não
tinham essa capacidade. Isto demonstra o potencial da transgenia na criação de animais
resistentes. Caso contrário, o uso desse tipo de antibacterianos por via oral ou outra forma de
administração não é utilizada, pois perde sua atividade após destruição na via digestiva ou há
uma resposta imune mediada contra ela. No animal transgênico, esta proteína não será
reconhecida como exógena.
Camundongos transgênicos ainda foram testados quanto ao seu potencial em resistir a
infecções virais. Para isto, células destes animais foram transfectadas com os alelos do gene
MXl. Este gene codifica uma proteína que interfere na replicação do vírus de influenza,
prevenindo o crescimento, tanto in vitro como in vivo. Esta proteína ainda tem a mesma ação
contra vírus de RNA fita simples, como outros da família Orthomixoviridae.
A metodologia utilizada para prevenir a infecção pelo vírus da Influenza consistiu na
observação de que a citocina interferon beta tem seus níveis de expressão aumentados após a
infecção. Esta proteína estimula o sistema imunológico de forma a polarizar a resposta contra o
ataque viral. A associação desta informação com as características da ação antiviral da proteína
MXI foi a responsável pela metodologia adotada na construção genética para a criação de
animais resistentes. Colocando-se o gene MXI sob o comando de um promotor induzido por
interferon, o gene é ativado somente no local de infecção, impedindo assim a propagação do
vírus. Esse processo, denominado de imunização intracelular, aliado à transfecção de uma
linhagem germinativa, gerou camundongos transgênicos que expressavam a proteína MXI. A
introdução deste gene em camundongos susceptíveis os tornou resistentes ao ataque viral.
A resistência contra doenças infecciosas é extremamente importante para os animais
de produção e, por isso, testes de transgenia em espécies alvos também têm sido realizados.
Em aves, a expressão da capa viral do vírus da Leucose em alguns de seus receptores protegeu
esses animais do desafio com o vírus em questão, sugerindo a possibilidade de se conseguir a 167
resistência viral nesta espécie animal. Gado transgênico também foi testado quanto à sua
susceptibilidade ao ataque viral. Para isso, utilizaram-se métodos que permitiram atingir altos
níveis de expressão do interferon beta e a expressão de anticorpos contra um determinado
agente etiológico. Estas metodologias demonstraram resultados promissores.
Em suínos, a metodologia utilizada para criar animais resistentes ao ataque viral foi a
mesma da adotada em camundongos. A expressão da proteína MXI induzida pelo interferon teve
sucesso em duas linhagens transgênicas. Apesar disso, este modelo adotado também é um bom
exemplo dos problemas enfrentados na produção de animais transgênicos resistentes à
doenças. A introdução de um único gene pode não ser totalmente eficaz. No caso da proteína
MXI, sua ação é diferenciada de acordo com o estágio celular, resultando em uma eficácia
diferente na proteção das células alvo. Além disso, a expressão dessa proteína é suprimida após
meses, processo cuja causa ainda não foi esclarecido.
Outro problema discutido a respeito da produção de animais transgênicos se refere às
determinadas construções genéticas utilizadas para este propósito. Em suínas, houve rearranjo
das sequências que aboliram a síntese proteica. O uso de determinados elementos genéticos
podem ser prejudiciais, como um promotor constitutivo de humano que se mostrou deletério para
a espécie em questão. Portanto, percebe-se a necessidade de obter mais conhecimentos de
cada via envolvida no processo, além da genômica funcional para melhorar os sistemas
genéticos a serem utilizados na criação de animais transgênicos.

5.7.2 Animais transgênicos como biorreatores

Um grande interesse industrial e da área da saúde é a produção de proteínas


recombinantes, como enzimas, hormônios e fatores de crescimento. As proteínas
recombinantes, como discutido no módulo III, podem ser obtidas a partir de sistemas de
expressão procariotos ou eucariotos. Os procariotos são úteis, pois crescem facilmente; contudo,
são limitados em suas habilidades quanto às modificações pós-traducionais.
Esse problema pode ser solucionado pela expressão em sistemas eucariotos, como as
leveduras. As desvantagens deste incluem a falta de identidade nas modificações pós-
traducionais, afetando a imunogenicidade e a atividade da proteína gerada. As células 168
mamíferas são as hospedeiras que produzem com maior eficiência proteínas eucariotas. Apesar
disso, sua produção não é satisfatória em escala industrial, exigindo um alto custo de
manutenção. Uma opção para driblar estas desvantagens é o uso de animais transgênicos como
biorreatores.
Animais transgênicos são considerados como biofábricas alternativas para a produção
de proteínas. Este sistema apresenta vantagens relevantes sobre a cultura de células. Em
primeiro lugar, as proteínas recombinantes são expressas em células de mamíferos e, por isso,
as macromoléculas são submetidas a todas as modificações pós-traducionais necessárias para
que a proteína tenha a conformação e a atividade biológica adequada. Em segundo lugar, estes
animais podem ser considerados como fermentadores de larga escala. Aliado a este fato, a alta
produção da proteína de interesse é obtida a um baixo custo.
As vantagens do uso de animais transgênicos como biorreatores incluem um aspecto
relevante para a comercialização de produtos humanos. Além de preservar a conformação
proteica, outro ponto inclui a redução da contaminação do material com algo patogênico, como o
HIV e o vírus da hepatite, se comparado aos produtos isolados do sangue humano, por exemplo.
Alguns modelos já foram testados quanto à possibilidade de produção em animais
transgênicos. Este sistema utiliza como ferramenta genética a expressão regulada por
promotores tecido-específico. Um exemplo são as proteínas expressas no leite através da
expressão dirigida na glândula mamária. Outro exemplo é o fator VIII, cuja deficiência está
relacionada com o desenvolvimento da hemofilia. Esta macromolécula pode ser obtida após a
purificação do sangue de humanos. Entretanto, o custo envolvido neste processo é
extremamente alto, inviabilizando-o. Outra desvantagem é a possibilidade de contaminação do
produto purificado por outros compostos de origem humana. Estes aspectos restringem o uso do
fator VIII na profilaxia e terapia dos pacientes afetados. Além das vantagens já relatadas da
produção de proteínas de interesse em animais transgênicos, neste caso específico se destaca a
alta produção deste fator no leite de vacas, que foi de 35 a 200 vezes maior se comparado ao
obtido a partir do plasma sanguíneo humano.
A expressão de proteínas recombinantes em animais transgênicos também tem sido
obtida em outras espécies alvo, como as cabras. Um exemplo do uso deste sistema é a
produção da antitrombina III em leite de cabras, processo que se encontra na fase III de teste
clínico. Este último fato demonstra o potencial do uso de animais transgênicos como biorreatores 169
na produção de proteínas de interesse.
As proteínas podem ainda ser expressas em diferentes localizações, além da glândula
mamária. Outros fluidos, como espaço extracelular, urina, plasma seminal, leite e sangue, são
alternativos potenciais. Estas opções são extremamente vantajosas, uma vez que constituem
fluidos de fácil acesso e que são produzidos constantemente.
A escolha do tipo de animal transgênico a ser utilizado depende da finalidade do
estudo. Fatores como produção anual e com que velocidade ela é alcançada devem ser vistas
para a escolha do sistema de animais transgênicos mais apropriados. As regras seriam:
I. Gado, para produção em toneladas;
II. Caprinos e ovinos, para produção em centenas de kilogramas;
III. Coelhos, para produção em kilograma.

Modelos de estudos em aves também vêm sendo realizados. As vantagens da


produção em ovos em relação a outros sistemas são bem mais interessantes. As proteínas
expressas por esta espécie apresentam modificações pós-traducionais corretas, além de ser um
procedimento de baixo custo em relação à cultura de células e a outros animais transgênicos.
Além disso, considerando que a produção derivada destes animais se dá em um período
relativamente rápido, os produtos são obtidos em um menor tempo.
A produção de proteínas recombinantes em aves ainda apresenta outras
peculiaridades que as tornam bons veículos de produção. Alguns dos oligossacarídeos
adicionados aos peptídeos das aves têm grandes similaridades com o de humanos em relação a
outros mamíferos. Aves não produzem 1,3-Gal, reduzindo risco potencial de uma resposta
imunológica adversa a proteínas farmacêuticas produzidas no ovo. Aliado a este fato, a
produção no ovo poderia ser o método de escolha para proteínas tóxicas a mamíferos. Ainda, o
ovo é um veículo atrativo de recuperação das proteínas, já que o seu conteúdo é relativamente
estéril e as proteínas em ovos brancos são estáveis, sugerindo que as proteínas terapêuticas
poderiam ter uma meia vida maior neste produto de aves.

5.7.3 Animais transgênicos e as características de interesse econômico


170

A obtenção de características de interesse, sem a necessidade de intercruzamentos


seguidos de outras seleções para o melhoramento animal, pode ser obtida com o auxílio da
tecnologia do DNA recombinante. Este melhoramento genético visa introduzir de maneira rápida
uma modificação da anatomia e fisiologia do animal, propiciando o aparecimento de
características como a maior produção de carne e leite, melhora no desempenho reprodutivo,
melhora na conversão alimentar e da composição da carcaça.
Diversas espécies animais foram submetidas ao melhoramento genético por meio de
técnicas biotecnológicas. Suínos transgênicos apresentaram maior taxa de crescimento com
uma qualidade de carne superior, o que se deve a melhora na conversão alimentar. Ovelhas
transgênicas demonstraram maior produção de lã, sem a necessidade de suplementar a dieta
com aminoácidos. Salmões transgênicos apresentaram uma maior taxa de crescimento (de 30%
a 60%) quando comparado aos controles. Estes mesmos animais ainda estão sendo analisados
quanto à possibilidade de criar uma geração que expresse uma proteína anticongelamento,
permitindo a sobrevivência dessa espécie em baixas temperaturas. Estes exemplos suportam a
afirmação de que a biotecnologia é uma ferramenta potencial para o melhoramento genético de
animais em menor tempo.

5.7.4 Animais transgênicos na pesquisa biomédica e de xenotransplante

O objetivo da pesquisa biomédica que utiliza modelos animais é conciliar fenômeno


biológico entre as espécies, onde o conhecimento adquirido de uma possa ser extrapolado para
outra. Apesar dos principais modelos atualmente utilizados (camundongos e cobaias, por
exemplo), serem bem caracterizados e de custo mais acessível para tal finalidade, animais
domésticos também vêm sendo testados para este fim. Isso se deve às similaridades
anatômicas e fisiológicas que estas espécies apresentam em relação aos humanos. Isto justifica
o crescimento de pesquisas biomédicas para xenotransplantes com animais domésticos, o que
tem sido caracterizado em um aumento de 10-20% por ano.
Modelos animais transgênicos têm sido utilizados com a finalidade de compreensão
das causas, progressão, estágios e sintomas de uma determinada doença. Acredita-se que eles 171
desempenhem um papel fundamental na pesquisa terapêutica das patologias, constituindo
fontes para novas formas de tratamento, desenvolvimento de testes de diagnósticos, agentes
terapêuticos mais eficazes e baratos, além de teste para a terapia gênica.
Para isto, os animais a serem utilizados na pesquisa devem apresentar uma alta
similaridade a humanos. Este fato está baseado na observação de que os genes humanos têm
uma versão equivalente em outros animais, aumentando a probabilidade de elucidar
determinados processos e reações do organismo, e, consequentemente, a patogênese de
enfermidades até a sua progressão e resolução.
As áreas de pesquisa nos estudos biomédicos incluem: fisiologia, farmacologia,
toxicologia, radiologia, cirurgia e transplantes de órgãos, traumatologia, patologia, embriologia,
gastroenterologia, nefrologia e pediatria, sendo intensivamente estudados na área de
cardiovascular (dietas com alto colesterol apresentam lesões arteroescleróticas histologicamente
similares a de humanos). Exemplos de patologias em que os animais transgênicos servem como
modelo é o diabetes melitus (até mesmo com o processo de catarata), a hipercolesterolemia
(onde a elucidação do processo poderia prover um modelo para terapia gênica) e o modelo de
estudo da obesidade humana, já que um lócus mapeado no cromossomo quatro dos suínos é
similar a outro presente no cromossomo 1q humano.
Geralmente, os suínos são os animais de eleição para os estudos de xenotransplantes.
Isto se deve as grandes similaridades anatômicas e fisiológicas desta espécie em relação aos
humanos. Por isso, muitas pesquisas têm sido desenvolvidas na área, como a utilidade e
aplicação de órgãos de suínos em transplantes, além de sua aplicação em cirurgias plásticas e
reconstitutivas.
O principal objetivo dos xenotransplantes se refere à possibilidade de fornecimento
ilimitado de órgãos para uso em transplantes humanos. A espécie suína e a sua miniatura
(pequeno o suficiente na maturidade e facilmente manipulado em condições de laboratório,
mantendo a similaridade anatômica e fisiológica quanto aos humanos) estão sendo muito
estudadas. Um dos principais estudos a respeito dos xenotransplantes inclui as pesquisas com
as ilhotas pancreáticas. Contudo, os suínos apresentam um epitopo de galactose em suas
glicoproteínas e glicolipídeos, o qual é reconhecido pelo sistema imunológico humano. Por isso,
esta sequência é responsabilizada pelo fenômeno de rejeição aguda dos xenotransplantes.
Alternativas para que o xenotransplante suíno se torne efetivo incluem o knockout ou a
inativação da sequência codificadora de um gene, como forma imunoreguladora para permitir a 172
tolerância aos órgãos transplantados. Outra consiste na geração de suínos transgênicos
contendo o gene da fucosiltransfease. Esta enzima está envolvida com a apresentação dos
epitopos H na superfície das células, os quais são universalmente tolerados.
Argumentos contra o uso de animais para a pesquisa biomédica e de xenotransplantes
têm sido debatidos. O primeiro ponto consiste na presença de retroviroses de animais que
podem ser expressas após o transplante. Para solucionar este problema, o uso de RNAi (RNA
de interferência) para suprimir a expressão de retrovírus suínos foi testado. Esta estratégia se
baseia no anelamento ao RNAm complementar, inativando a expressão do produto neste
codificado. Essa solução demonstrou ser efetiva contra a expressão de retroviroses suínas. Além
da questão moral, muitas inferências a respeito da progressão e, principalmente, do tratamento a
partir desses modelos animais devem ser analisados com cautela. As respostas geradas diferem
entre as espécies, interferindo com a análise e a associação dos fenômenos observados.
As aplicações da biotecnologia na agropecuária vão além de testes em animais. Várias
plantas transgênicas têm sido obtidas, sendo que os alimentos geneticamente modificados
merecem atenção especial.

5.8 ALIMENTOS GENETICAMENTE MODIFICADOS

Os estudos iniciais sobre as aplicações da biotecnologia nos produtos agrícolas se


iniciaram entre 1986 e 1995. A transferência de tecnologia para esta área se deve à demanda de
melhorar a produção e a distribuição de gêneros alimentícios para a população mundial
crescente, ao mesmo tempo em que são reduzidos os impactos ambientais.
A tecnologia dos transgênicos tem sido utilizada para produzir as características
preferidas pelo mercado, tendo uma grande aplicação tanto na alimentação como no vestuário.
Entre as mais pesquisadas, estão à tolerância a herbicidas, resistência a insetos, qualidade do
produto e a resistência a vírus. No entanto, as características que visam aumentar a qualidade
nutricional dos alimentos vêm se tornando progressivamente mais importante e deverão
prevalecer nas próximas gerações de produtos transgênicos.
Diversos exemplos de produtos agrícolas modificados pela tecnologia do DNA
recombinante estão em testes, sendo que alguns já foram disponibilizados ao mercado. Dentre 173
eles, podem ser utilizados como exemplo:
I. Plantas resistentes aos ataques virais, como o arroz transgênico resistente ao
vírus Mottle Amarelo do arroz (RYMV), que devasta os arrozais africanos. Outro exemplo é a
papaia resistente ao vírus Ringspot e que tem sido comercializada e plantada no Havaí desde
1996. Este exemplo demonstra a eficiência da modificação genética em vegetais, visando obter
maior resistência a uma praga específica;
II. Plantações transgênicas resistentes aos insetos do Bacillus thuringiensis e o
algodão transgênico, o qual possui o gene de resistência à infestação por larvas. Um dos
benefícios deste tipo de plantas é a redução significativa no uso de inseticidas. Além disso, a alta
resistência do algodão transgênico aumenta consequentemente, a sua produção, beneficiando a
indústria de vestuários;
III. Alimentos de altorendimento, como o trigo semianão. Esta planta modificada é
mais baixa, mais forte e aumenta o rendimento da safra diretamente, uma vez que se reduz o
alongamento das células na parte vegetativa. Dessa forma, a planta desenvolve mais sua parte
reprodutiva (comestível);
IV. Transgênicos cujo cultivo possa ser feito em terras marginalizadas. Um exemplo
é o tomate resistente ao excesso de sal. Este transgênico contém um gene capaz de crescer e
se desenvolver em um ambiente com excedente de sal nas plantações;
V. Benefícios nutricionais, como a maior produção de beta caroteno, precursor da
vitamina A, cuja deficiência nos animais causa cegueira. Outro caso é o arroz transgênico, que
apresenta elevados níveis de ferro, de forma a combater a anemia.
A aplicação da tecnologia do DNA recombinante na geração de alimentos transgênicos
não é apenas um campo de pesquisa em desenvolvimento. Na década de 90, os E.U.A.
aprovaram dezenas de produtos geneticamente modificados e outra grande quantidade
apareceu também no mercado europeu. No Brasil, muitos alimentos transgênicos importados já
são comercializados e o país planeja importar três milhões de toneladas de milho da Argentina e
E.U.A., onde as lavouras transgênicas são liberadas oficialmente.
Atualmente, há sementes manipuladas sendo cultivadas no mundo em uma área de 30
milhões de hectares e seu mercado deverá movimentar cerca de US$ 3 bilhões. Além disso, o
ritmo atual de liberação de Organismos Geneticamente Modificados indica que uma centena de
produtos geneticamente modificados nas prateleiras dos supermercados chegará na casa dos 174
milhares em algumas décadas.
Alimentos produzidos através de modificação genética possuem diversas vantagens
que devem ser consideradas para a sua liberação. Eles podem ser mais nutritivos e estáveis
quando armazenados. Aliado a este fato, eles podem, em princípio, trazer benefícios,
promovendo saúde aos consumidores, seja em nações industrializadas ou em desenvolvimento.
Esforços organizados devem ser feitos para investigar os efeitos potenciais no meio ambiente
(positivos ou negativos) dos vegetais transgênicos em suas aplicações específicas. Eles devem
ser avaliados tomando-se como referência os efeitos de tecnologias convencionais da
agricultura, que estejam atualmente em uso.
Assim como comentado no parágrafo anterior, uma das grandes preocupações da
população atual são os problemas ambientais. O crescimento industrial e populacional
desordenado utilizou fontes naturais como matéria-prima, sem considerar o seu tempo de
reposição na natureza. Além disso, a falta de saneamento básico e os acidentes industriais são
frequentemente noticiados na mídia como contaminantes severos do meio ambiente.
Considerando estes fatos, a tecnologia do DNA recombinante também pode ser aplicada para
solucionar esta questão. Um dos exemplos que vem recebendo pesquisas contínuas é a
biorremediação.

5.9 BIORREMEDIAÇÃO

Acidentes que resultam em despejo de substâncias inadequadas ao ambiente são


responsáveis pela contaminação dos solos, águas superficiais e subterrâneas, e do ar. Diversos
casos de contaminação ambiental estão sempre sendo notícias de destaque nos meios de
comunicação, como os que envolvem os navios petroleiros e o descarte de dejetos industriais
em rios e lagos. O isolamento dos agentes contaminantes e o tratamento de recursos naturais
representam perdas financeiras significativas. A estimativa mundial de gastos com a despoluição
ambiental gira em torno de 25 a 30 bilhões de dólares. O que demonstra a necessidade de
alternativas para solucionar o problema. Entre elas, uma opção de baixo custo é a
biorremediação.
A biorremediação consiste na eliminação de contaminantes ambientais com o uso de 175
microrganismos vivos. As vantagens deste método incluem o uso de agentes naturais, que
perturbam menos o ambiente, e é uma alternativa de baixo custo. Para a implantação deste
processo, preconiza-se que os contaminantes sejam susceptíveis ao ataque pelos
microrganismos e que os compostos produzidos por este procedimento não devam ter efeitos
adversos ao meio ambiente. À medida que os conhecimentos a este respeito aumentam, esta
estratégia se torna bastante promissora.
Inicialmente, um dos pontos que devem ser satisfeitos para a implantação da
biorremediação deve-se ter grandes conhecimentos sobre a genética de cada micro-organismo
em particular. Isto permitirá conhecer quais microrganismos são capazes de biotransformar um
determinado contaminante ambiental. Dentro deste aspecto, a biotecnologia pode ser aplicada,
uma vez que o genoma sequenciado pode informar a função de um determinado gene. Outro
aspecto envolve o conhecimento das condições presentes nas quais o microrganismo será
utilizado e se estas favorecem a atividade microbiana. Entre os parâmetros que devem ser
observados, estão: teor de nutrientes, oxigenação, temperatura e pH.
A tecnologia do DNA recombinante ainda pode beneficiar a biorremediação de outra
maneira. As bactérias de interesse adaptadas ao ambiente que se desejam tratar são
transformadas com um vetor de expressão. Neste estará clonado o gene que codifica o produto
responsável por solucionar um determinado problema ambiental. Em outras palavras, a
clonagem molecular pode fornecer uma característica útil para a biorremediação, transformando
um determinado microrganismo capaz de se proliferar nas condições impostas em ambientes
contaminados.
6 INTRODUÇÃO À BIOINFORMÁTICA

Os módulos I e II apresentaram uma introdução à genética e à biologia molecular sob


um contexto histórico. A curiosidade sobre a transmissão das características genéticas entre as
gerações impulsionou pesquisas direcionadas na descoberta da molécula de DNA. As 176
informações iniciais eram entusiasmantes, e os estudos prosseguiram para desvendar o papel
desta molécula até a geração de proteínas. Todas estas pesquisas foram revolucionadas com a
tecnologia do DNA recombinante.
A biologia molecular foi e atualmente ainda é uma importante ferramenta que vem
permitindo novas descobertas e aplicações na área de biologia e ciências da saúde. A busca de
novos genes e a descoberta de suas funções são passos fundamentais para que sejam
implantadas aplicações cada vez mais eficientes da biotecnologia nos mais diversos campos.
Dentro da perspectiva de novas descobertas e de aplicações benéficas para a
humanidade, diversos esforços vêm sendo feitos nas áreas “ômas”, como os projetos genoma,
transcriptoma e o proteoma. Diversos microrganismos procariotos e eucariotos estão sendo
sequenciados e estudados, sendo que um grande número de sequências foi obtido a partir da
década de 90, período que marca o surgimento dos sequenciadores automáticos.
A explosão que gerou a disposição de um grande número de sequências de DNA
derivadas de projetos genoma exigiu a implantação de recursos computacionais cada vez mais
sofisticados. Esta exigência se deve não somente à necessidade de armazenamento destas
sequências, como também à indispensável utilização de mecanismos eficientes que permitam a
interpretação mais rápida e eficiente dos dados obtidos. Dentro deste contexto na era dos
“omas” surgiu a bioinformática.
A bioinformática é definida como a ciência que permitiu a união e a integração de
linhas de conhecimento diferentes, como a engenharia de softwares, a matemática, a estatística,
a ciência da computação, a genética e a biologia molecular. Para a utilização das ferramentas
disponíveis on line de bioinformática, o usuário deve estar familiarizado aos principais conceitos
relacionados à genética e biologia molecular, além dos correspondentes à computação, incluindo
os softwares mais utilizados.
6.1 BANCO DE DADOS

Os bancos de dados representam atualmente um pré-requisito de suma importância


para a bioinformática. Ele pode ser definido como uma coleção de dados inter-relacionados,
desenhados de forma a suprir as necessidades de um grupo específico de aplicações e 177
usuários. A sua principal função consiste em organizar e estruturar milhares de informações
produzidas por projetos como o genoma, transcriptoma e proteoma, de forma a facilitar
consultas, atualizações e deleções de dados.
A construção de bancos de dados está correlacionada a outros sistemas
computacionais, como por exemplo, o sistema SGBD (Sistema de Gerenciamento de Banco de
Dados). Este está envolvido na construção, manipulação e administração do banco de dados
solicitados pelo usuário e/ou por outras aplicações.
Estão disponíveis diversos sistemas de gerenciamento de banco de dados. A opção
por um deles deve considerar as vantagens e as desvantagens de cada um em relação ao
objetivo do estudo do pesquisador. Entre eles, pode-se citar o mysql, um programa gratuito, com
acesso veloz aos dados. Estas características são os motivos de escolha dos representantes
acadêmicos envolvidos com projetos genoma. A principal desvantagem do sistema é a limitação
imposta a algumas de suas ferramentas. Esta desvantagem não ocorre com o postgreSQL, outro
sistema gratuito, assim como o mysql. A sua desvantagem se baseia na dificuldade de
gerenciamento do sistema. A alternativa mais sofisticada inclui o sistema racle e o Server.
Contudo, o uso destes é limitado pelo alto custo para a licença, o que muitas vezes inviabiliza o
acesso.
A importância dos bancos de dados na organização das informações produzidas por
projetos como o genoma, transcriptoma e proteoma é extremamente importante diante das
informações geradas. Isto facilita a consulta e a atualização de dados pelos pesquisadores.
Contudo, este processo somente será alcançado por bancos de dados que permitam o livre
acesso aos usuários. Por isso, percebe-se a necessidade da implantação de bancos de dados
públicos.
6.1.1 Bancos de dados públicos

A construção e a disponibilização de bancos de dados públicos têm recebido


atualmente grandes investimentos. Isto é de suma importância para permitir a organização dos
dados e seu acesso on line, permitindo a troca de informações entre a comunidade científica. A 178
grande evolução de projetos genoma é atribuída, entre outros fatores, à construção destes tipos
de banco.
Os bancos de dados podem armazenar diferentes tipos de sequência, como as de
nucleotídeos, de aminoácidos e até mesmo, de estruturas proteicas. Para facilitar a organização,
eles podem ser subdivididos em bancos de sequências primários ou secundários.
Os bancos de sequência primários se referem àqueles em que a sequência de
nucleotídeos, aminoácidos ou a estrutura proteica foram armazenas logo após serem obtidos
diretamente do sequenciamento ou de um processamento inicial. Isto quer dizer que as
sequências não sofreram análises prévias. Logo após a sua obtenção e caracterização, o
pesquisador deve disponibilizar a sequência a um destes bancos de dados. Isto constitui uma
exigência para a publicação de trabalhos que relatam a descoberta ou a caracterização de uma
nova sequência ou estrutura. Entre os principais bancos de dados primários para a sequência de
nucleotídeos são: o GenBank, o EBI (European bioinformatics Institute), o DDBJ (DNA Data
Bank of Japan); para a sequência de aminoácidos, se destacam o PDB (Protein Data Bank) e o
Uniprot. Os dados são apresentados de forma bastante semelhante entre eles. Apesar de serem
bancos de dados distintos, as informações são trocadas entre eles diariamente, o que permite a
atualização dos dados.
Os bancos de dados secundários são aqueles cuja formação levou em consideração
as informações depositadas nos bancos de dados primários. Um exemplo é o SWISS-PROT,
que correlaciona as sequências de proteínas já depositadas com a sua homologia a outras
proteínas, sugerindo uma função e a presença de domínios funcionais.
Os bancos de dados ainda podem ser subdivididos de maneira mais específica, como
os bancos estruturais e funcionais. Por exemplo, os bancos estruturais tratam da estrutura de
proteínas. Esta subdivisão consiste em uma maneira de organizar as diferentes representações
de uma determinada sequência.
Dentre os bancos de dados funcionais, um dos mais utilizados é o KEGG (Kyoto
Encyclopedia of Genes and Genomes). A partir de sequências ou buscas por palavra chave, são
disponibilizados links que permitem a visualização de mapas metabólicos de organismos que
apresentam o genoma completamente ou mesmo parcialmente sequenciado.

179
6.2 ALINHAMENTO DE SEQUÊNCIAS

O alinhamento de sequências constitui uma das ferramentas mais importantes da


bioinformática. Este programa permite estabelecer comparações entre diferentes sequências,
indicando qual o grau de similaridade que existe entre elas.
Atualmente, há vários tipos de programas para executar esta tarefa. Eles se encontram
disponíveis on line, são de fácil execução e não há a necessidade de instalá-los. Exemplos deste
tipo de programas são: ClustalW, Multialin, FASTA, Blast 2 etc.
O procedimento que os programas adotam consiste em introduzir espaços (gaps) entre
os monômeros de uma ou mais sequências para que seja obtido o melhor alinhamento possível.
A confiança a respeito do resultado é determinada pela soma dos pontos que demonstraram
pareamento (match), subtraindo os pontos de gap e de sequências não pareadas (mismatch).
O alinhamento pode ser obtido para toda a sequência de interesse ou mesmo, para
fragmentos dela e, por isso, ele pode ser classificado em dois tipos: global ou local.
O alinhamento global corresponde ao processo de análise de similaridade de toda a
sequência, de uma extremidade a outra. Isto gera apenas um único resultado. Este tipo de
alinhamento geralmente é utilizado para determinar regiões mais conservadas entre sequências
homólogas. Essas podem ser definidas como aquelas que apresentam similaridade com uma
relação evolutiva. Neste caso, duas sequências são ditas homólogas se derivam de um mesmo
ancestral comum. Se não há esta relação, as sequências podem até serem similares, mas não
são consideradas homólogas. Um dos programas mais utilizados para o alinhamento global é o
ClustalW. Detalhes de como utilizar este programa serão abordados no tópico a estrutura
proteica.
O alinhamento local é frequentemente utilizado na busca por sequências homólogas ou
análogas (ou seja, apresentam funções semelhantes) a partir da comparação com outras
sequências depositadas em bancos de dados. O programa mais utilizado com este propósito é o
BLAST, o qual será discutido com mais detalhes adiante.
Muitos programas de bioinformática estão atualmente disponíveis on line como
ferramentas de livre acesso aos usuários. Diversos deles possuem até mesmo funções
semelhantes; contudo, podem apresentar recursos diferentes ou mesmo apresentações
diferentes. Exemplos são os programas que fazem a análise de sequências proteicas, mas 180
alguns deles são especializados para proteínas eucariotas e outros, para procariotas.
Os casos que possuem a mesma função para o mesmo tipo de organismo, como a
análise de estruturas secundárias de proteínas, a apresentação dos dados pode ser diferente.
Um exemplo é a análise da porcentagem de folhas betas, a qual pode estar como um grupo a
parte, ou mesmo incluso em conjunto com estruturas randômicas. As diferenças apresentadas
entre os programas denotam diferentes utilizações. Isto quer dizer que, apesar de muitos
programas estarem disponíveis, a escolha de um deles depende dos objetivos específicos de
cada usuário.
Este módulo visa introduzir o estudante à bioinformática. Por isso, algumas das
ferramentas de bioinformática mais utilizadas serão comentadas sob um contexto, para
solucionar e facilitar alguns estudos dentro das diversas áreas de aplicação da biotecnologia.

6.3 A BIOINFORMÁTICA E OS PROJETOS GENOMA E TRANSCRIPTOMA

A relação dos projetos genoma e transcriptoma com a bioinformática vêm desde a


história do surgimento da última. Atualmente, o sequenciamento de genomas e a análise dos
transcritos de um grande número de microrganismos distintos vêm sendo realizada por
diferentes grupos de pesquisa. Assim, como descrito no módulo II, à abordagem adotada para o
sequenciamento de genomas consiste em fragmentar o DNA, cloná-lo em um vetor apropriado e
sequenciá-lo. Estes procedimentos se devem à limitação do tamanho das sequências que
podem ser lidas pelos sequenciadores. Estas máquinas, até mesmo as mais modernas,
conseguem ler somente cerca de 1.000 pb em cada corrida.
As estratégias utilizadas para o sequenciamento de genomas diferem entre
microrganismos procariotos e eucariotos. Em procariotos, há a fragmentação do DNA
cromossômico, a digestão enzimática do mesmo e, finalmente, a sua clonagem em vetores
apropriados. O sequenciamento é feito a partir das extremidades dos fragmentos clonados.
Estes fragmentos são então analisados quanto à presença de sequências sobrepostas, o que
permite uma primeira montagem da sequência do genoma inteiro. Contudo, este procedimento
geralmente obtém sequências incompletas, que apresentam muitos gaps. Por isso, fragmentos
maiores são clonados em vetores apropriados, como BACs. Em seguida, estes segmentos de 181
DNA são então sequenciados.
No caso de organismos eucariotos, o procedimento é praticamente o inverso do
adotado para o sequenciamento de genomas de procariotos. Após a extração e digestão
enzimática do genoma de eucariotos, os fragmentos são clonados em vetores que permitem que
sequências grandes de DNA sejam clonadas, como os BACs e os YACs. Em seguida, os
insertos destes vetores são fragmentados e clonados em vetores plasmidiais e estas sequências
são então sequenciadas. Este procedimento é utilizado preferencialmente, pois permite a
reconstituição da informação genômica inicial.
Os dados gerados após o sequenciamento do genoma são então analisados. O
primeiro passo consiste no uso de um programa capaz de processar os dados brutos obtidos
logo após o sequenciamento, denominado base calling.

6.4 BASE CALLING

O base calling é um programa que permite a leitura dos dados gerados pelo
sequenciador, reconhecendo a sequência nucleotídica obtida a partir dos dados brutos da
sequência e, ainda, atribuindo valores de qualidade sobre a sequência gerada. Alguns
programas podem ser utilizados neste tipo de processamento, e geralmente, cada sequenciador
vem com um determinado programa. Contudo, um dos mais utilizados com esta finalidade é o
PHRED.
O PHRED é um software desenvolvido na Universidade de Washington e é
referenciado como o programa padrão para o base calling. Inicialmente, ele reconhece a
sequência de nucleotídeos gerada a partir de determinados arquivos, como os de
cromatogramas de sequenciadores automáticos de DNA. Em seguida, o programa atribui valores
de qualidade a cada nucleotídeo gerado, determinando a precisão do resultado obtido pelo
sequenciamento. Estes valores são importantes, pois determina a confiabilidade de uma
sequência obtida, indicando qual deve ser submetida a um novo sequenciamento.
Após o processamento da sequência de dados brutos, o passo seguinte consiste na
análise da sequência propriamente dita. O passo inicial é a busca de contaminantes na
sequência obtida, ou o mascaramento de vetores. 182

6.5 MASCARAMENTO DE VETORES

O mascaramento de vetores consiste na busca de sequências contaminantes


presentes no inserto sequenciado. Por contaminação se entende qualquer sequência que não
representa uma informação genética a partir de fontes biológicas, contendo então uma ou mais
sequências de origem exógena.
As sequências contaminantes correspondem à sequência do vetor aos quais os
fragmentos de DNA foram clonados. Adicionado a isto, ainda são incluídos a sequência de
adaptadores e de iniciadores presentes no inserto. Assim, o mascaramento de vetores inclui a
análise de todas as sequências utilizadas na estratégia de clonagem e que não fazem parte do
inserto de interesse.
As sequências de DNA contaminantes devem ser excluídas da análise do DNA
sequenciado. Apesar de ser um passo da análise de sequências considerado como opcional, há
algumas razões que justificam a exclusão de sequências contaminantes:
I. O tempo de análises gasto com a sequência exógena, já que os resultados
podem ser direcionados para a similaridade entre a sequência de DNA contaminante com as
depositadas em bancos de dados, ao invés da sequência de interesse;
II. Alinhamentos errôneos entre as sequências, uma vez que o mesmo vetor pode
ser utilizado como a sequência similar a partir do qual se iniciará o alinhamento;
III. Conclusões errôneas sobre o significado biológico da sequência, pois os
contaminantes podem gerar erros sobre a função e relações filogenéticas;
IV. Atrasos na liberação da sequência para o banco de dados, pois a contaminação
aumenta o tempo necessário para o processamento da submissão;
V. Poluição dos bancos de dados públicos, uma vez que as sequências
contaminantes podem confundir os diversos tipos de análises utilizadas a partir dos bancos de
dados.
Diante da importância da análise e exclusão das sequências contaminantes, diversos
programas foram desenvolvidos para realizar o mascaramento destas sequências. Entre eles,
um dos mais utilizados é o Cross_match. 183
O Cross_match é um programa que utiliza à comparação de duas sequências, sendo
necessária a utilização de um arquivo que contenha as referentes aos vetores que se deseja
mascarar. Após estabelecer a comparação com o arquivo introduzido e a sequência do material
amostral, as regiões que correspondem ao vetor são apresentadas com a letra “X”. Esta
alteração impede que as análises de sequências sejam prejudicadas nos processos posteriores.
Outro programa muito utilizado e de fácil manipulação é o VecScreen, que se encontra
disponível no portal do NCBI. A metodologia adotada por este programa é muito semelhante ao
do Cross_match, onde a sequência a ser analisada será submetida a um alinhamento local. A
busca de similaridade é feita contra o banco de dados de vetores, o UniVec. Deste, foram
eliminadas as sequências redundantes para criar um banco de dados que contenha somente
uma cópia de cada vetor. O VecScreen age de maneira a categorizar as sequências alinhadas,
eliminando as redundantes, e mostra a localização das sequências contaminantes e dos
fragmentos suspeitos.
Para utilizar o programa VecScreen, inicialmente o usuário deve acessar a página do
NCBI. O usuário deve então optar pelo BLAST, como demonstrado na Fig. 64.
FIGURA 64: PÁGINA PRINCIPAL DO NCBI

184

FONTE:

A seta vermelha indica onde o usuário deve clicar (BLAST) para ter acesso ao
programa VecScreen.

FIGURA 65: PÁGINA DO BLAST DISPONÍVEL NO NCBI.

FONTE:
Ao clicar sobre “BLAST”, imediatamente, a página abrirá, e, ao final dela, haverá o
quadro representado na Fig. 65.
Ao final dela, o usuário encontrará diversas opções de programas de BLAST
especializados. Dentre eles, o VecScreen (representado em roxo na figura) pode ser utilizado
para analisar a sequência de interesse quanto à presença de contaminantes.
O usuário deve escolher a opção vetor contaminação (VecScreen). Esta escolha 185
permitirá a abertura da página (Fig. 66). A sequência a ser analisada deve ser depositada no
quadro que aparece abaixo da palavra “FASTA”. A sequência é então submetida pela escolha
“run VecScreen”.

FIGURA 66: PÁGINA DE ACESSO AO PROGRAMA VECSCREEN

FONTE:
A figura apresenta o quadro onde a sequência a ser analisada deve ser depositada (já
representada aqui por uma aleatória). Após este passo, a análise prosseguirá após o comando
do usuário, que deve clicar sobre “Run VecScreen”.
O formato “FASTA” se refere a uma sequência identificada por uma terminologia
iniciada pelo símbolo “>”. Isto significa que uma nova sequência está sendo iniciada. A
sequência propriamente dita é dita estar neste formato quando não apresenta qualquer espaço 186
ou quebra.
O resultado obtido após a utilização do programa VecScreen é apresentado sob uma
forma gráfica, como demonstrado na Fig. 67.

FIGURA 67: RESULTADO GRÁFICO OBTIDO PARA A ANÁLISE DE SEQUÊNCIAS


CONTAMINANTES PELO PROGRAMA VECSCREEN

FONTE:

O retângulo, que demonstra o número de nucleotídeos (no caso, de 1 a 316),


representa todo o comprimento da sequência em análise. Dentro dele são representadas, sob
diferentes colorações, as sequências com suspeita da presença de contaminantes. O resultado
pode variar de forte (vermelho), moderado (rosa), fraco (verde) ou simplesmente suspeito
(amarelo). O resultado ainda fornece o número de nucleotídeos envolvidos (no caso, está
representado ao final do quadro, mostrando que a sequência contaminante se apresenta do
primeiro ao 257 nucleotídeo dentro dos 316 analisados).
Como demonstrado na Fig. 67, o programa VecScreen apresenta o resultado em
possibilidades de contaminação da sequência, variando de forte, moderada, fraca e mesmo
suspeita de ser uma sequência exógena àquela a ser analisada. Para as análises seguintes, o
ideal é excluir qualquer sequência que esteja marcada, até mesmo aquelas que somente são
suspeitas de serem contaminantes.
Após a identificação e eliminação das sequências que correspondem aos vetores de 187
clonagem, o passo seguinte consiste em agrupá-las quanto a sua similaridade. Esse
procedimento é conhecido como agrupamento de sequências.

6.6 AGRUPAMENTO DE SEQUÊNCIAS

O agrupamento de sequências consiste na montagem de fragmentos pequenos de


DNA, obtidos após o sequenciamento, em segmentos maiores, os contíguos (contigs). Este
agrupamento pode ser realizado por diferentes softwares, como o PHRAP, o CAP3, o CONSED
e o TIGR Assembler.
Os softwares apresentam objetivos semelhantes. A partir de uma sequência de DNA
de alta qualidade, realiza-se a construção de um segmento contíguo, apresentando ainda dados
sobre a qualidade de suas sequências. Além disso, os programas também permitem a
implementação de estratégias que permitam aos usuários aumentar a qualidade da montagem.
As perspectivas com a montagem das sequências são a de obter um contíguo
genômico, no caso de projetos genomas. Quando as análises se referem às sequências de
cDNA, espera-se obter um único contíguo representando os transcritos processados de cada
gene expresso. Esta é a mesma expectativa para outras sequências, como as clonadas em
vetores de expressão. Neste caso, geralmente cada fita de DNA é sequenciada de 2 a 3 vezes.
Ao final, faz-se uma montagem do contíguo, estratégia que permite até mesmo aumentar a
qualidade da sequência.
A formação de contíguos de cDNAs, utilizando o programa CAP3, está demonstrado
nas Fig. 68. A abertura da página representa o acesso ao referido programa, o que está
representado na Fig. A página inicial do programa fornece um quadro onde a sequências a
serem agrupadas devem ser depositadas.
FIGURA 68: PÁGINA INICIAL DO PROGRAMA CAP3 PARA O AGRUPAMENTO DE
SEQUÊNCIAS

188

FONTE:

A figura mostra um quadro onde as sequências a serem agrupadas são depositadas


(representado por uma amostra aleatória, denominada “A1”). Para proceder às análises
seguintes, o usuário deve clicar sobre a tecla “Submit”.
Um detalhe é que todas as sequências obtidas devem ser submetidas juntas, mesmo
as referentes ao sequenciamento de fitas diferentes. Para isso, elas devem ser dispostas com o
símbolo “>” seguido de nomes diferentes para cada sequência, como representada na Fig. 69.
FIGURA 69: EXEMPLO DE COMO AS SEQUÊNCIAS A SEREM AGRUPADAS DEVEM SER
SUBMETIDAS AO PROGRAMA CAP3

>A1

GTACAAAAAAGTTGGGCGCCTCGCCCAAAAGAGTTTGGTTAATAACCTCGTGAGAGGATATGCGAAAGA
TGTTAAGTTTGGTGCTGAGGGTAGGAAAGCAATGCTTGTTGGTGTCAACCTCCTAGCTGATGCTGTATC
TGTAACAATGGGTCCAAAGGGTAGGAATGTCATCATTGAACAATCTTGGGGAAGTCCGAAAATTACCAA 189
AGATGGAGTCACAGTGGCCAAAGCTATTGACTTGAAAGACAAGTATCACAACCTTGGAGCTAAACTTAT
TCAGGATGTAGCAAATAAAGCCAATGAGGAAGCGGGAGATGGAACTACTTGCGCTACTGTTCTTGCTAG
ATCTATTGCTAAAGAGGGATTCGATAATATTAGCAAGGGTGCAAATGCCGTTGAAATCAGACGTGGAGT
CATGGCTGCTGTTGATATTATCGTGCAAGAGCTTAAAGGTCTCAGCAGGCAGGTTACTACTCCTGAAGA
GATAGCTCAGGTTGCTACAATCTCTGCTAATGGTGATCAAACTATCGGAAATTTGATTTCCGAGGCAAT
GAAGAAGGTGGGCAATAAAGGTGTTATCACGGTCAAGGATGGAAAAACTCTTACGGATGAACTAGAACT
TATTGAGGGAATGATATTTGATCGCGGATATATTTCTCCATATTTTATACACACTTCTAAGGGAGC

>A2

GTACAAAAAAGTTGGGCGCCTCGCCCAAAAGAGTTTGGTTAATAACCTCGTGAGAGGATATGCGAAAGA
TGTTAAGTTTGGTGCTGAGGGTAGGAAAGCAATGCTTGTTGGTGTCAACCTCCTAGCTGATGCTGTATC
TGTAACAATGGGTCCAAAGGGTAGGAATGTCATCATTGAACAATCTTGGGGAAGTCCGAAAATTACCAA
AGATGGAGTCACAGTGGCCAAAGCTATTGACTTGAAAGACAAGTATCACAACCTTGGAGCTAAACTTAT
TCAGGATGTAGCAAATAAAGCCAATGAGGAAGCGGGAGATGGAACTACTTGCGCTACTGTTCTTGCTAG

FONTE:

Cada uma deve ser iniciada pelo símbolo “>” seguidas por nomes diferentes.
Após submeter às sequências para a análise, uma página será aberta com tópicos à
disposição da escolha do usuário. Neste caso, deve-se optar pela formação de “contigs” (Fig.
70).
FIGURA 70: OPÇÕES DE ANÁLISES DAS SEQUÊNCIAS OFERECIDAS PELO PROGRAMA
CAP3

190

FONTE:

Para o agrupamento de sequências, o usuário deve clicar sobre “Contigs”, o que está
representado em roxo na figura.
O resultado ideal é a apresentação de apenas uma única sequência, demonstrando
que apenas um contíguo se formou (Fig. 71). A presença de duas ou mais sequências implica na
ausência de similaridade ou mesmo de uma sobreposição adequada para a formação de um
contíguo.
FIGURA 71: RESULTADO DO AGRUPAMENTO DE SEQUÊNCIAS PELO PROGRAMA CAP3

191

FONTE:

A figura representa o agrupamento de sequências com a formação final de um único


contíguo.
Após a obtenção do contíguo, o processamento seguinte consiste na análise da
representatividade da sequência obtida. Este passo é conhecido como anotação gênica.

6.7 ANOTAÇÃO GÊNICA

A anotação gênica é a identificação da função e do que cada sequência obtida


representa. Este processo é frequentemente realizado em três etapas, com a análise de:
I. Sequências de nucleotídeos;
II. Sequências proteicas;
III. Processos biológicos.
A primeira etapa de anotação gênica é feita utilizando basicamente as ferramentas de
bioinformática. Diversos programas podem ser utilizados nesta fase, os quais ajudarão na
identificação das sequências obtidas. Para isso, as ferramentas de bioinformática são utilizadas
para predizer se há alguma relação com outras sequências já depositadas em bancos de dados.
As características similares permitem agrupá-las quanto a sua natureza, como, por exemplo, se
a sequência representa uma região gênica, um RNAt, um RNAr, uma região não codificadora e 192
repetitiva, ou mesmo se contém alguma homologia com outra sequência já conhecida. Neste
caso, esta busca de similaridades pode ser feita pelo BLAST.

6.7.1 Blast

O programa BLAST (“Basic Local Alignment Search Tool”) realiza um alinhamento local
de sequências, sendo comumente utilizado na análise de similaridades. Ele representa um
programa de busca projetado para explorar todas as bases de dados disponíveis de sequências
de DNA ou de proteínas presentes em bancos de dados. A sua implementação mais conhecida é
aquela presente no NCBI - National Center for Biotechnology - e o da Universidade de
Washington, conhecido como WU-BLAST.
O Programa BLAST exposto pelo NCBI representa um conjunto de serviços, os quais
podem beneficiar os usuários de diversas maneiras. As opções aos pesquisadores variam de
acordo com o tipo de sequência inicial a ser analisada, se é de nucleotídeos ou de aminoácidos,
se o banco de dados utilizado na busca é de nucleotídeos ou de aminoácidos, se a pesquisa
está restrita a um determinado microrganismo. Além de parâmetros relacionados aos algoritmos
de busca. Para melhor exposição das diversidades que o BLAST oferece para a busca de
sequências, este programa pode ser dividido em:
I. blastp, o qual é utilizado para comparar sequências de aminoácidos em bancos
de dados de proteínas;
II. blastn, programa formulado para comparar sequências de nucleotídeos em
bancos de dados de DNA;
III. blastx, para a comparação de uma sequência de nucleotídeos, representadas
em todas as fases de leitura (ORFs), com bancos de dados de proteínas;
IV. tblastn, utilizado na comparação de sequências de proteínas com um banco de
dados de sequências de nucleotídeos representados em todas as ORFs;
V. tblastx para comparar as ORFs de uma sequência de nucleotídeos com as
ORFs de todos os nucleotídeos depositados em um banco de dados de nucleotídeos.
A subdivisão do BLAST encontrada na página está demonstrada na Fig. 72.
193

FIGURA 72: SUBDIVISÃO ESPECIALIZADA DO BLAST DISPONÍVEL NO NCBI

FONTE:

Os pesquisadores podem optar por uma das subdivisões disponíveis nesta página, de
acordo com o tipo de sequência inicial a ser analisada e com o se banco de dados utilizado na
busca.
A análise de sequências pelo BLAST pode ser realizada de diversas maneiras. O
primeiro ponto consiste em delimitar o espaço da busca, como:
a. O banco de dados a ser utilizado na busca; e
b. O organismo específico.
II. Para que uma determinada sequência seja submetida à busca de
similaridades pelo BLAST, ela deve se apresentar sob determinados formatos específicos, como:
III. Formato FASTA;
IV. Por identificadores, que geralmente são códigos para acesso aos bancos de
dados mantidos pelo NCBI como o GenBank;
V. Sequências puras, que podem ou não ser intercaladas por caracteres 194
brancos ou numéricos.
As buscas de BLAST serão exemplificadas aqui, nesta apostila, pelo BLASTn, pois é
um dos programas de alinhamento local mais utilizado pelos pesquisadores. Para iniciar as
buscas de similaridade pelo BLASTn, inicialmente deve-se clicar sobre a opção de escolha
(Fig.73).

FIGURA 73: OPÇÃO PELA UTILIZAÇÃO DO PROGRAMA BLASTN

FONTE:

O usuário deve clicar sobre “nucleotide blast”, local apontado pela seta vermelha na
figura.
A opção, que no caso específico foi a análise de nucleotídeos pelo alinhamento do
mesmo tipo de sequência depositada no banco de dados, abre a página demonstrada na Fig. 74.
Esta página inclui alguns tópicos que permitem que a pesquisa seja refinada em uma direção
específica.
FIGURA 74: PÁGINA DE ACESSO AO PROGRAMA BLASTN

195

FONTE:

O passo seguinte consiste em depositar a sequência a ser analisada no quadro


indicado pela seta vermelha (Fig. 75).
FIGURA 75: QUADRO DEMONSTRATIVO DE SUBMISSÃO DE UMA SEQUÊNCIA
PELO BLASTN

196

FONTE:

A sequência de nucleotídeos a ser analisada deve ser depositada no local apontado


pela seta vermelha.
Dentro da página inicial do BLASTn, são oferecidas diferentes opções que permitem ao
pesquisador refinar a sua pesquisa. Inicialmente, pode-se delimitar contra quais organismos se
deseja submeter à amostra para a busca de similaridades. A escolha pode limitar a busca no
banco de dados de humanos, de camundongos e de outras sequências (Fig. 76).
FIGURA 76: DELIMITAÇÃO DE ORGANISMOS QUE DEVEM SER UTILIZADOS NA
BUSCA DE SIMILARIDADES CONTRA A SEQUÊNCIA DE INTERESSE

197

FONTE:

O mesmo quadro representado na Fig. ainda oferece a oportunidade de limitar ainda


mais a pesquisa dentro das três opções de organismos, como exemplificado na Fig. 77.

FIGURA 77: REFINAMENTO DA PESQUISA DENTRO DAS OPÇÕES DE ORGANISMOS A


SEREM UTILIZADOS NO BLASTN

FONTE:
No caso da Fig., onde não há uma especificação do organismo a ser pesquisado,
podem-se utilizar as iniciais do nome científico do organismo, ou mesmo de seu táxon. Após esta
inclusão, alguns nomes de organismos aparecerão, o que pode ser utilizado na busca (Fig. 78).

FIGURA 78: REFINAMENTO DA PESQUISA QUANDO NÃO HÁ UM ORGANISMO 198


EM ESPECÍFICO A SER UTILIZADO NA PESQUISA

FONTE:

Quando o pesquisador opta por outros organismos (“others”) a serem utilizados na


busca de similaridades, a inscrição das iniciais de um organismo de interesse permite que o
direcionamento da busca.
O BLASTn ainda oferece a opção de a pesquisa abranger diferentes cenários, de
acordo com o grau de identidade que o pesquisador deseja incluir na busca. A escolha é feita
optando pelo megablast, pelo megablast descontínuo ou pelo BLASTn, simplesmente (Fig. 79).
FIGURA 79: OPÇÃO DE BUSCA PELO BLASTN DE ACORDO COM O GRAU DE IDENTIDADE
ENTRE AS SEQUÊNCIAS UTILIZADAS NA BUSCA

199

FONTE:

Dentro dessa escolha, o BLAST oferece como opção o megablast, o megablast


descontínuo e o BLASTn. Para maiores detalhes sobre estas opções, vide o texto.
O megablast é realizado a partir do alinhamento com sequências que tenham uma
relação filogenética muito próxima. Seus resultados são mais significativos quando o grau de
identidade entre as sequências é superior a 95%. O megablast descontínuo utiliza um
alinhamento que desconsidera algumas bases não pareadas. É mais utilizado quando se deseja
comparar espécies cruzadas. O BLASTn é a opção que permite um alinhamento mais amplo,
onde o grau de identidade entre os nucleotídeos não é muito alto.
O BLASTn oferece todas as opções acima expostas como forma de refinar a pesquisa.
Apesar disso, algumas são opcionais. Depois de ter feito as opções, o pesquisador então deve
iniciar a sua pesquisa de alinhamento global. Para isso, deve-se apertar o botão “BLAST” (Fig.
80) que se encontra ao final da página.

FIGURA 80: COMANDO PARA INICIAR A BUSCA PELO PROGRAMA BLASTN.

FONTE:
Os resultados obtidos a partir de buscas no BLASTn são representados em formas
gráficas, como demonstrado na Fig. 81. A Fig 81A representa graficamente o grau de
similaridade, em cores, por de toda a sequência de nucleotídeos. A Fig. 81B apresenta uma
tabela de dados, onde sequências similares são representadas pelo seu número de acesso ao
GenBank, por uma breve descrição do que ela representa, e pelo e-value. Este valor é mais
significativo quanto menor ele for. 200

FIGURA 81: RESULTADOS GRÁFICOS DO BLASTN

FONTE: COELHO, 2007.


O BLASTn ainda apresenta os resultados dos alinhamentos, fornecendo o escore, o
grau de identidade e os buracos (gaps) entre as sequências alinhadas. O segmento em análise e
a sua similaridade a outras depositadas no banco de dados é apresentada pelo BLASTn, de
nucleotídeo a nucleotídeo (Fig. 82).

201
FIGURA 82: RESULTADO DO ALINHAMENTO ENTRE A SEQUÊNCIA DE INTERESSE E
OUTRA DO BANCO DE DADOS PELO BLASTN

FONTE:

As duas sequências são representadas pelo alinhamento entre cada nucleotídeo. Os


que são idênticos são representados por barras verticais; os buracos (“gaps”), por traços (-). Os
locais que contêm nucleotídeos distintos são apresentados um abaixo do outro, sem qualquer
representação gráfica.
A sequência de nucleotídeos ainda é utilizada na busca de outros elementos que
facilitem a caracterização da sequência. No caso de projetos genoma, um dos principais
objetivos da primeira etapa de anotação gênica consiste em montar as regiões intergênicas e as
não codificadoras em um mapa do organismo. Alguns programas ainda são úteis na predição de
regiões gênicas, com a identificação de códons de início e de terminação, além de possíveis
ORFs. Outros podem até mesmo relacionar regiões de exons e de introns. Essa última
abordagem não é utilizada para bibliotecas de cDNA, pois estas já constituem sequências
gênicas.
A segunda etapa da anotação gênica consiste na identificação das proteínas
codificadas pelas sequências codificadoras. Nesta fase, o principal objetivo é a caracterização de
proteínas correspondentes à sequência de DNA, no caso do projeto genoma, e dos RNAm 202
expressos sob determinadas condições, para projetos de transcriptoma. Este período tem por
objetivo correlacionar a um gene com uma determinada função, incluindo a análise da estrutura
proteica (que será abordada em detalhes mais adiante). Para uma análise inicial da função de
uma determinada sequência, o usuário pode utilizar o programa BLASTx.
Os passos iniciais para utilizar o programa BLASTx são os mesmos daqueles feitos
para o BLASTn. Inicialmente, clica-se na opção BLASTx, o que abrirá a página inicial
representada na Fig. 83.

FIGURA 83: PÁGINA DO NCBI QUE PERMITE SELECIONAR A OPÇÃO DO PROGRAMA


BLASTX

FONTE:
FIGURA 84: PÁGINA INICIAL DO PROGRAMA BLASTX.

Esta opção abre a página inicial referente ao programa BLASTx (Fig. 84).

203

FONTE:

Na página mostrada na Fig. 84, o usuário deve depositar a sequência de nucleotídeo a


ser analisada (Fig. 85-1). Nesta mesma página, pode-se optar pelo código genético a ser
utilizado na pesquisa (Fig. 85-2).
FIGURA 85: PROCEDIMENTOS INICIAIS PARA A ANÁLISE DA SEQUÊNCIA NUCLEOTÍDICA
PELO PROGRAMA BLASTX

204

FONTE:

(1) Local onde a sequência de interesse deve ser depositada; (2) seleção do código
genético referente ao organismo de análise.
O BLASTx ainda permite selecionar o tipo de sequência depositada no banco de dados
contra a qual a sequência de interesse deve ser alinhada. As sequências no banco de dados
estão organizadas pelo seu conteúdo informacional ou mesmo pela técnica de sequenciamento
adotada (Fig.). O último passo é clicar no “Blast”, assim como feito para o BLASTn, permitindo o
alinhamento das sequências.
FIGURA 86: REFINAMENTO DO ALINHAMENTO PELO BLASTX DE ACORDO COM O TIPO
DE SEQUÊNCIAS DEPOSITADAS NO BANCO DE DADOS

205

FONTE:

Os resultados do BLASTx são apresentados sob uma forma gráfica (Fig. 87) e de
alinhamentos (Fig. 88), assim como o BLASTn. Contudo, vale ressaltar que os resultados se
referem ao alinhamento entre aminoácidos, e não de nucleotídeos.
FIGURA 87: RESULTADO GRÁFICO DO ALINHAMENTO PELO PROGRAMA BLASTX

206

FONTE:

A mesma sequência de nucleotídeos utilizada para a análise do BLASTn foi utilizada


para o BLASTx. (Fonte: Coelho, 2007).
FIGURA 88: RESULTADO DO ALINHAMENTO ENTRE AS SEQUÊNCIAS DE AMINOÁCIDOS
PELO PROGRAMA BLASTX

207

FONTE: Coelho, 2007.

Assim como para o BLASTn, o resultado do alinhamento apresenta o escore, o grau de


identidade e os gaps (representados por - ). Além disso, o BLASTx acrescenta no resultado os
alinhamentos “positivos”, os quais representam a troca de aminoácidos que pertencem ao
mesmo grupo bioquímico. As trocas por aminoácidos de grupos distintos são representadas por
espaços vazios no alinhamento.
O BLASTx, assim como o BLASTn, realiza uma análise de similaridade entre a
sequência de nucleotídeos, correlacionando-a com a sua de aminoácidos entre outras já
existentes no banco de dados. Apesar de a análise pelo BLASTn gerar uma ideia da função
daquela sequência específica, a predição de funcionalidade pela sequência de aminoácido é
mais significativa. Isso se deve à própria característica do código genético. Este, como descrito
no Módulo I, é degenerado, o que permite que resultados mais diversificados da análise de
similaridade sejam obtidos. Por outro lado, assim como exposto nos módulos anteriores, a
sequência de aminoácidos de uma proteína, geralmente, é mantida durante o processo
evolutivo, o que também é uma consequência da degeneração do código.
Assim, a possibilidade de alterações de sua estrutura por mutações que gerem um
produto não funcional é protegida. Isto pode ser visualizado ao comparar os resultados gráficos 208
obtidos nas duas análises, já que a mesma sequência foi utilizada em ambas.
O que geralmente se observa nas análises de BLASTx é que os resultados de
similaridade mais significativos são aqueles entre organismos que pertencem à mesma família e
gêneros. Isto se deve à relação entre organismos homólogos e que apresentam uma relação
filogenética mais próxima. Por isso, estes organismos são bastante semelhantes.
A terceira e última etapa da anotação gênica consiste na correlação dos dados
genômicos com os processos biológicos. Isto permite estabelecer um mapa funcional do
organismo, como por exemplo, as vias bioquímicas. Esta é a etapa fundamental de projetos
como o genoma e o transcriptoma, correlacionando o metabolismo de um organismo com o seu
desenvolvimento e condições de adaptação a um determinado ambiente. Para isso, há a
necessidade de profissionais especialistas e interdisciplinares. Além disso, esta predição deve
ser confirmada posteriormente por experimentos que comprovem a sua função biológica.
A grande revolução dos projetos genoma, que permitiram o sequenciamento dos mais
diversos microrganismos, representa apenas o ponto inicial da caminhada à sua aplicação. A era
pós-genômica tem por finalidade estudar a expressão de genes codificados pelo genoma dos
diferentes microrganismos, correlacionando-os com a sua função e adaptação às determinadas
condições nas células e tecidos. Esse conhecimento permitirá uma maior aplicação à sociedade,
como a caracterização de possíveis alvos para uma terapia mais eficaz e mais segura. Para
estas análises, a bioinformática disponibiliza ferramentas que permitem predizer a estrutura e a
função de proteínas.
6.8 A BIOINFORMÁTICA E A ANÁLISE DA ESTRUTURA PROTEICA

Outra abordagem da bioinformática, além dos projetos genoma e transcriptoma,


incluem o proteoma. Para este tipo de projeto, programas computacionais fornecem subsídios
para a predição de determinadas estruturas proteicas, como: 209
I. A estrutura primária;
II. A estrutura secundária;
III. A modelagem molecular.

Estas predições utilizam as informações contidas em bancos de dados, de forma a


comparar a similaridade entre as sequências e, consequentemente, predizer uma determinada
função.

6.8.1 Análise da estrutura primária de proteínas

A análise da estrutura primária de proteínas consiste no estudo da sequência de


aminoácidos traduzida a partir de um RNAm. As análises da estrutura primária podem ser
abordadas de diversas maneiras e utilizadas em vários propósitos, como:
I. A análise das características físico-químicas;
II. Comparação entre as sequências homólogas;
III. A busca por sinais;
IV. Análise imunológica (que será tratado como um tópico a parte).

Vários programas podem ser utilizados com este objetivo. Para tanto, um conjunto de
ferramentas de bioinformática disponíveis on line está presente no NCBI e no portal Expasy (Fig.
89).
FIGURA 89: FERRAMENTAS PARA A ANÁLISE DE PROTEÍNAS APRESENTADAS NO
PORTAL EXPASY

210

FONTE:

As análises das características físico-químicas de uma proteína a partir da sua


sequência de aminoácidos podem ser feitas por diversos programas. Entre eles, um muito
utilizado e disponível no portal Expasy é o “Compute PI Mw tool” (Fig. 90). Ele informará o peso
molecular e o ponto isoelétrico da proteína.
FIGURA 90: PÁGINA DE ACESSO AO PROGRAMA “PI MW TOOL”.

211

FONTE:
Outros programas similares ao “pI Mw tool” também são muito utilizados, como o
Protparam. Este fornece os mesmos dados do outro programa, porém com informações
adicionais (Fig. 91)

212
FIGURA 91: RESULTADO DA ANÁLISE DE CARACTERÍSTICAS FÍSICO-QUÍMICAS COM O
PROGRAMA PROTPARAM

213

FONTE:
A figura demonstra que, além do peso molecular e do ponto isoelétrico, este programa
fornece dados extras como a composição atômica e de aminoácidos da proteína. Além disso, ele
ainda prediz a meia-vida da proteína após a expressão em células de mamíferos de leveduras e
em E. coli e o coeficiente que estima a estabilidade da proteína (dados não demonstrados).
A análise molecular permitiu aprofundar ainda mais as comparações entre as
sequencias de diferentes organismos. Observou-se que quanto mais próximo os organismos 214
estão na escala evolutiva, maior a similaridade em nível de nucleotídeos e de aminoácidos.
Estas são a base de uma ciência, a genômica comparativa.
As observações feitas pela genômica comparativa são utilizadas em estudos da
estrutura primária da proteína. Um dos pontos iniciais é a realização de um alinhamento entre as
sequências de aminoácidos. Isto pode ser realizado facilmente pelo ClustalW, programa
disponível no portal do Expasy. Para isso, as sequências devem ser depositadas na página
inicial deste programa (Fig.), assim como demonstrado na Fig. 92.
FIGURA 92: PÁGINA DO PROGRAMA CLUSTALW

215

FONTE:

Ao final da figura está representado o quadro onde as sequências a serem alinhadas


devem ser depositadas.
Os resultados obtidos no ClustalW (Fig. 93) demonstram os aminoácidos que são
idênticos entre as sequências e os que sofreram algumas alterações. As alterações podem ser
de uma modificação para um aminoácido do mesmo grupo ou mesmo de grupos diferentes. Isto
influencia na característica da proteína como um todo, pois a troca por aminoácidos semelhantes
geralmente não induz uma mudança conformacional da proteína, diminuindo as chances de
alteração de função.
FIGURA 93: ALINHAMENTO DE SEQUÊNCIAS HOMÓLOGAS PELO CLUSTALW

216

(*) significa identidade; (:) representa aminoácidos semelhantes em tamanho e carga; (.), aminoácidos
semelhantes em tamanho ou carga. FONTE: Coelho, 2007.

A importância da comparação entre sequências homólogas permitiu desvendar a


função de muitas proteínas. Comparando-se organismos semelhantes, geralmente se observa
que a grande similaridade implica em funções até mesmo idênticas. Nesse sentido, estudos com
microrganismos patogênicos, por exemplo, demonstraram que a similaridade não se restringe à
estrutura, mais aos mecanismos de patogenia e de infecção são muito semelhantes. Esta
conservação é um dos fenômenos evolutivos que conservaram características vantajosas aos
organismos.
A estrutura primária ainda fornece detalhes úteis na predição da localização celular da
proteína. A bioinformática oferece subsídios para a análise da presença de peptídeos sinais e de 217
ancoramento. Esses são necessários para a maquinaria celular reconhecer o correto
endereçamento de cada proteína em específico, como a sua secreção ao meio ou o
ancoramento à membrana celular, respectivamente. Dentre os programas disponíveis para
alcançar este objetivo estão o PSORT e TargetP, ambos disponíveis no portal do Expasy.
A estrutura primária fornece aspetos de conhecimento fundamental para a função de
uma proteína. Contudo, a ação biológica das proteínas é extremamente dependente da sua
estrutura terciária. Portanto, os diferentes graus de conformação encontrados nas proteínas
também são objetos de estudos, como a estrutura secundária.

6.8.2 Análise da estrutura secundária

A estrutura secundária da proteína correlaciona as áreas da sequência de aminoácidos


com a possível existência de formação de folhas alfa, betas e loops. Há diferentes programas
disponíveis para a análise da estrutura secundária, como o programa Gor disponível no portal
Expasy. Ao abrir a página citada, é apresentada a página de acesso inicial ao programa (Fig.
94).
FIGURA 94: PÁGINA DE ACESSO AO PROGRAMA GOR DE ANÁLISE DA ESTRUTURA
SECUNDÁRIA DE PROTEÍNAS

218

FONTE:

A página de acesso ao programa Gor apresenta um quadro em que a sequência de


aminoácidos a ser analisada deve ser depositada. Para submetê-la à pesquisa, o usuário deve
clicar em “Submit”. O resultado é apresentado sob uma forma gráfica, sendo que as
porcentagens correspondentes a cada formação em particular, como folhas alfas presentes em
toda a estrutura estudada, também estão disponíveis (Fig. 95).
Figura 95: Resultados gráficos e em porcentagem da estrutura secundária fornecidos
pelo programa Gor.
FIGURA 95: RESULTADOS GRÁFICOS E EM PORCENTAGEM DA ESTRUTURA
SECUNDÁRIA FORNECIDOS PELO PROGRAMA GOR

219

FONTE:

Além da estrutura secundária, a bioinformática ainda permite realizar a modelagem


molecular da estrutura proteica. Esta função é um método alternativo, que permite prever as
conformações que a sequência de aminoácidos assume a partir dos conhecimentos de
estereoquímica dos aminoácidos e de estruturas terciárias já resolvidas.

6.8.3 Modelagem molecular


220

A modelagem molecular pode ser feita com o auxílio de diferentes programas. A


metodologia adotada nestes programas é o uso de uma ou mais referências a partir da estrutura
terciária de proteínas homólogas já conhecidas. Essa abordagem é conhecida como modelagem
por homologia ou modelagem comparativa, sendo a que apresenta, atualmente, os melhores
resultados.
O primeiro passo da modelagem comparativa é a pesquisa de proteínas homólogas em
bancos de dados de estrutura terciária de proteínas. Com esta finalidade, o programa mais
utilizado é o PDB (Protein Database Bank). Em seguida, realiza-se o alinhamento entre as
sequências primárias da proteína de interesse e de outras homólogas correspondentes.
A modelagem propriamente dita é realizada por programas como o MOdeller, SWISS-
Model e o 3D-PSSM. Estes procuram as estruturas terciárias que permitam a melhor disposição
dos átomos da proteína utilizada como modelo, de forma que atenda às restrições
estereoquímicas. Esta estrutura inicial é então verificada por outros softwares quanto às
restrições estereoquímicas, como o Procheck.
A modelagem por homologia é um processo que exige um ajuste de parâmetros e a
verificação dos resultados. Normalmente, são necessárias várias repetições até que a estrutura
terciária mais adequada seja obtida. Apesar disso, deve-se lembrar de que este processo não é
perfeito. Mesmo que a estrutura final obtida se apresente de maneira em que todos os
parâmetros tenham sido dispostos de maneira adequada, não há garantias de que esteja
correta. Uma estrutura bastante próxima da que a proteína assume in vivo pode ser utilizada
para desenvolver outros modelos que auxiliem o pesquisador. Entretanto, mesmo sendo muito
semelhante da estrutura real, pode ocorrer que os resultados gerados a partir da especulação
não sejam aplicáveis in vivo.
Outro programa mais recente de modelagem de proteínas é o Threading. Este se
baseia na comparação da proteína de interesse com modelos descritivos dos enovelamentos de
proteínas homólogas. Para isso, é utilizada como parâmetro a distância entre os resíduos de
aminoácidos, a estrutura secundária de cada fragmento e as características físico-químicas de
cada resíduo. Esta técnica tem gerado resultados satisfatórios.
Um interesse dos usuários deste tipo de ferramenta de bioinformática é a predição da
estrutura terciária a partir da sequência primária da própria proteína. Já está disponível este tipo
de programa, que se baseia somente na informação da sequência de aminoácidos e considera 221
as interações físico-químicas entre a cadeia e com o meio. Entretanto, este tipo de programa não
tem apresentado resultados satisfatórios. Porém, devido ao interesse dos pesquisadores neste
campo, novos investimentos têm sido realizados na área.
A informação gerada pela modelagem molecular é extremamente valiosa, pois permite
identificar sítios catalíticos envolvidos com a função proteica. Além disso, podem-se guiar
pesquisas direcionadas que permitam a caracterização de inibidores, ativadores, entre outros,
tendo em vista a produção de fármacos mais eficientes e específicos.
A modelagem molecular de proteínas por ferramentas de bioinformática é uma
estratégia cuja implantação é recente e tem sido muito útil aos pesquisadores para gerar
hipóteses.
Contudo, a sua eficiência não é totalmente comprovada, sendo necessárias pesquisas
biológicas que comprovem o que foi predito pela informática. Isto é feito por meio de técnicas de
realizações complexas, como a difração de raios X. Estas, além de serem de difícil manipulação,
representam um alto custo, exigindo equipamentos específicos e caros. Além disso, a dificuldade
da técnica ainda é aumentada por algumas questões biológicas.
O estudo da estrutura terciária pelas técnicas biológicas exige uma grande quantidade
de material purificado, procedimento que nem sempre é facilmente executado para determinadas
proteínas.
O estudo sobre a estrutura de proteínas por ferramentas de bioinformática é uma área
em expansão. Sua utilidade tem sido aplicada na área de imunologia para o desenvolvimento de
vacinas, o que se deve à capacidade dos programas computacionais em mapear epitopos.
6.9 MAPEAMENTO DE EPITOPOS

O mapeamento de epitopos a partir de programas de bioinformática tem sido testado


quanto ao seu potencial no desenvolvimento de novas vacinas. A justificativa desta metodologia
consiste em inserir na composição vacinal somente as sequências que serão realmente 222
reconhecidas pelas células do sistema imunológico.
Um dos programas gratuitos mais utilizados para o mapeamento de epitopos é o
SYFPEITHI, o qual está disponível no portal Expasy (Fig. 96). Ele é capaz de predizer epitopos
de células T.

FIGURA 96: PÁGINA DO PROGRAMA SYFPEITHI DE MAPEAMENTO DE EPITOPOS

FONTE:

O programa é útil para predizer os epitopos de células T que se ligam tanto ao


complexo de histocompatibilidade (MHC) I e II.
O resultado da análise da sequência é apresentado como um conjunto de epitopos
potenciais que podem se ligar aos MHC de escolha (Fig. 97). A probabilidade de isso acontecer
é apresentada por um escore.
FIGURA 97: MAPEAMENTO DE EPITOPOS OBTIDOS PELO PROGRAMA SYFPEITHI

223

FONTE:

Além de estudos sobre a estrutura de proteínas, a bioinformática ainda possui outras


aplicações para a biotecnologia. Uma delas é o auxílio em estudos das relações filogenéticas
entre os diferentes organismos.

6.10 MÉTODOS EM FILOGENIA MOLECULAR

A bioinformática é uma ferramenta muito utilizada no estabelecimento de relações


evolutivas entre os organismos. Estas podem ser estabelecidas a partir de sequências de DNA
ou mesmo de proteínas, reconstituindo as relações de parentesco entre as espécies, o que é
chamado de sistemática molecular. A reconstituição ainda pode ser estabelecida utilizando-se
uma escala temporal. Nesse caso, o processo é denominado de filogenia molecular.
As relações de parentesco são apresentadas sob uma forma gráfica, que é
denominada árvore filogenética. Estes gráficos possuem as mais diversas aplicações que
facilitam o entendimento das histórias evolutivas, como o estudo de relações de parentesco ou
até mesmo a origem e a história epidemiológica de organismos patogênicos a partir de dados do
genoma. Esta apresentação dos dados é muito utilizada em trabalhos da área biológica, o que
reflete o seu reconhecimento como uma maneira legítima de apresentar os dados biológicos
dentro de uma escala evolutiva.
O primeiro passo para a construção da história evolutiva consiste na escolha de um
marcador filogenético. Para isto, deve-se optar por uma sequência de DNA ou de proteínas
homólogas, ou seja, que apresentam uma ancestralidade comum. Esta escolha está diretamente 224
relacionada com a confiabilidade da árvore genética gerada, pois este marcador, que apresenta
uma origem comum, garante que os organismos em análise apresentam um ancestral
compartilhado. A simples escolha de sequências por similaridade, sem que apresentem
homologias, é um erro que diminui a confiabilidade dos dados gerados. Isto se deve à inclusão
de sequências que apresentem histórias evolutivas diferentes. Uma maneira de aumentar a
confiabilidade é a inclusão de sequências de grupos externos, cujas histórias evolutivas sejam
conhecidas. Isso representará os parâmetros controles para verificar a precisão da construção
obtida.
Após a seleção da sequência a ser utilizada como marcador e da inclusão de
sequências controle, o próximo passo é o alinhamento múltiplo das sequências. Diversos
programas podem ser utilizados com esta finalidade, sendo que um dos mais utilizados com este
propósito é o Mega 4.0. Contudo, programas mais simples também podem realizar esta tarefa,
como o BLAST (Fig. 98) e o ClustaW. As inferências das relações filogenéticas podem então ser
feitas a partir da construção das árvores filogenéticas.
FIGURA 98: REPRESENTAÇÃO DE UMA ÁRVORE FILOGENÉTICA OBTIDA COM O AUXÍLIO
DO PROGRAMA BLASTN

225

FONTE:
REFERÊNCIAS BIBLIOGRÁFICAS

COELHO, K. S. Isolamento, clonagem e caracterização molecular do gene hsp60 de


Corynebacterium pseudotuberculosis e sua utilização na construção uma vacina de DNA
e de subunidade proteica. Dissertação de Mestrado defendida na Universidade Federal de
Minas Gerais, UFMG, Brasil. 2007. 226

GLICK, B. R. & PASTERNAK, J. J. Molecular Biotecnology: Principles & Applications of


Recombinant DNA. ASM Press, 1994.

GRIFFITHS, A. J. F.; MILLER, J. H.; SUZUKI, D. T.; LEWONTIN, R. C.; GELBART, W. M.


Introdução à genética. Sétima edição, Ed. Guanabara Koogan, 2002.

LEWIS, B. Genes VIII. Cidade: Pearson Prentice Hall, 2004.

PROSDOCIMI et al. Bioinformática: Manual do usuário. Biotecnologia, Ciência e


Desenvolvimento. n. 29; p. 12 – 25.

LOODISH, H. et al. Molecular Cell Biology. 4. ed. Cidade: Media Connected, 1999.

YIN, J.; LI, G.; REN, X.; HERRLER, G. Select what you need: A comparative evaluation of the
advantages and limitations of frequently used expression systems for foreign genes. Journal of
Biotechnology. V. 127, p. 335-347, 2007.

Você também pode gostar