Tancredo Souza

Handbook of
Arbuscular
Mycorrhizal
Fungi
Handbook of Arbuscular Mycorrhizal Fungi
Tancredo Souza

Handbook of Arbuscular
Mycorrhizal Fungi
Tancredo Souza
Departament of Soil
Federal University of Paraiba, UFPB
Esperança, PB, Paraíba, Brazil

ISBN 978-3-319-24848-6 ISBN 978-3-319-24850-9 (eBook)

DOI 10.1007/978-3-319-24850-9

Library of Congress Control Number: 2015953773

Springer Cham Heidelberg New York Dordrecht London

© Springer International Publishing Switzerland 2015
This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of
the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation,
broadcasting, reproduction on microfilms or in any other physical way, and transmission or information
storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology
now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication
does not imply, even in the absence of a specific statement, that such names are exempt from the relevant
protective laws and regulations and therefore free for general use.
The publisher, the authors and the editors are safe to assume that the advice and information in this book
are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the
editors give a warranty, express or implied, with respect to the material contained herein or for any errors
or omissions that may have been made.

Printed on acid-free paper

Springer International Publishing AG Switzerland is part of Springer Science+Business Media

(www.springer.com)
“Plants have no roots, they have
mycorrhizae”
(J.L. Harley)
Foreword

The mycorrhizal symbiosis between plant and fungi is one of the most widespread
associations in terrestrial ecosystems. Among the different types of mycorrhizas,
arbuscular mycorrhizas are by far the most prevalent in nature since it is estimated
that 80 % of all plants interact with arbuscular mycorrhizal fungi. Thus, it is clear
that the study of arbuscular mycorrhizas is essential to understand the functioning
of most terrestrial ecosystems. The fungi that enter into arbuscular mycorrhizal
symbiosis belong to the phylum Glomeromycota. These fungi are difficult to grow
in vitro, and their classification has been based traditionally on spore morphology.
Accordingly, the author has made an important effort to incorporate the criteria used
to describe and classify Glomeromycota spores in this book.
This book is intended as a useful reference for practical research in the descrip-
tion and identification of arbuscular mycorrhizal fungi from different ecosystems.
The aim of this book is to help students and researchers to identify the different
structures of arbuscular mycorrhiza and the main characteristics that describe the
fungal species involved in this interaction. It also presents a historical overview of
the study of arbuscular mycorrhizas and an updated taxonomy of the fungi involved
in this interaction. This book can become an essential handbook for many laborato-
ries working on mycorrhiza and with no access to expensive molecular work.

Coimbra, Portugal Susana Rodríguez-Echeverría

June 10, 2015

vii
Preface

When I started to study arbuscular mycorrhizal fungi (AMF) in Brazil, I realized that
it would be a hard work. There are plenty of references on the Internet that confuse
the new student or new researcher in this area, and unfortunately a lot of Brazilian
scientific papers are published in journals with low international impact factor. I only
found one good book and few scientific papers about mycorrhizas that were written
in Portuguese, and that made me start writing this handbook. So, I invited four more
professors of different scientific areas to help me in this adventure.
Here I made a compilation of several classifications and protocols. My focus is
to provide you, a beginner, key information about AMF and how to study and how
to assess these microorganisms. After you finish reading this book, I hope you can
start your bioassays and experiments with more knowledge and accuracy. Trust me,
you will be able to do it.
In fact, you’ll understand that studying AMF is an adventure, because you will
need to know many things about different scientific areas and make a network with
them, like: (1) morphological and molecular classification; (2) molecular biology;
(3) protocols to assess the spores, the AMF structures, and AMF community com-
position; (4) interaction of fungal-host plant and fungal-another microorganism; (5)
AMF impacts and effects on the plant community composition, ecosystem struc-
ture, and function; (6) bioassays and inoculation; and finally (7) the statistical analy-
sis. If you are thinking that it’s a hard adventure. I tell you: It’s true, but once you
finish reading this book, you will able to start your own experiment and bioassays,
everything will be all right. Don’t forget that I went through the same; in the begin-
ning it was hard, but now it’s a pleasure to study AMF. It’s my work.
My focus is to provide you with key information, do you remember? This book
is going to help you. So, it’s a great pleasure for me to introduce you, dear reader,
the Handbook of Arbuscular Mycorrhizal Fungi. This handbook is divided into five
chapters, where we will show you the main concepts, AMF structures, their spores,
and an actual classification at species level. Enjoy!

Federal University of Paraiba, UFPB Tancredo Souza

Esperança, PB, Brazil
January 10, 2015
ix
Contents

1 Overview .................................................................................................... 1
1.1 Arbuscular Mycorrhizal Fungi: Who Are They?
Where Do They Live? ........................................................................ 1
1.2 What Is Their Biological Characteristic? ........................................... 2
1.3 How Do AMF Colonize Plant Roots?................................................ 4
1.4 What Are Their Molecular Characteristics? ...................................... 5
References ................................................................................................... 6
2 An Old Relationship ................................................................................. 9
2.1 An Old Friend? .................................................................................. 9
2.2 AMF Ancestor Characteristics ........................................................... 10
2.3 What About Fungi Kingdom?............................................................ 10
2.4 History of Mycorrhizae (1809–Present Day) ..................................... 11
2.4.1 Phase I: Endogone? Endogonaceae? Why? ........................... 12
2.4.2 Phase II: New Genera, New Perspectives.
It Is About Time!.................................................................... 13
2.4.3 Phase III: An Order, Three New Families,
and a lot of Identification Keys to Endogonaceae
Species. AMF Taxonomy is Becoming Robust! .................... 15
2.4.4 Phase IV: Molecular Studies Begin. It Is About Time! ......... 21
2.4.5 Phase V: New Orders, New Families
and New Genus—Molecular Studies were Helping
So Much! (2001–2010) .......................................................... 24
References ................................................................................................... 34
3 AMF’s Main Structures............................................................................ 43
3.1 Introduction ........................................................................................ 43
3.2 Main Structures .................................................................................. 44
3.2.1 Intraradical Hyphae (IH) ........................................................ 44
3.2.2 Extraradical Hyphae (EH)...................................................... 45
3.2.3 Arbuscules.............................................................................. 45
3.2.4 Vesicles .................................................................................. 46

xi
xii Contents

3.2.5 Auxiliary Cells (AC) ............................................................ 47

3.2.6 Spores................................................................................... 47
3.3 Development of the Symbiosis ........................................................ 48
3.3.1 Asymbiotic Phase................................................................. 49
3.3.2 Pre-symbiotic Phase ............................................................. 51
3.3.3 Symbiotic Phase ................................................................... 52
3.4 Abiotic and Biotic Factors ............................................................... 55
3.5 How Does the Symbiosis Work?...................................................... 55
References ................................................................................................... 58
4 Spores: A Special Tool to Survive ............................................................ 65
4.1 Why Do I Need to Study Spore AMF? ............................................ 65
4.2 Spore Formation Mode .................................................................... 66
4.3 AMF Spore Size............................................................................... 67
4.4 AMF Spore Shape ............................................................................ 69
4.5 AMF Spore Colour .......................................................................... 69
4.6 What about Formation Mode, Shape, and Colour
of AMF Spores? ............................................................................... 73
4.7 Performing AMF Species Identification .......................................... 73
4.8 Spore Walls? .................................................................................... 74
4.9 What Are These Layers? .................................................................. 76
4.10 What About the Model Concept to Classify AMF?......................... 77
4.11 Outer Walls ...................................................................................... 78
4.12 Inner Wall......................................................................................... 80
4.13 Other Spore Structures ..................................................................... 82
4.14 How to Present a Described AMF Species? .................................... 83
References ................................................................................................... 85
5 Glomeromycota Classification ................................................................. 87
5.1 Introduction ...................................................................................... 87
5.2 Phylum Glomeromycota (Walker and Schüßler) ............................. 88
5.2.1 Order Archaeosporales (Walker and Schüßler) ................... 89
5.2.2 Order Diversisporales (Walker and Schüßler) ..................... 95
5.2.3 Order Glomerales (Morton e Benny) ................................... 116
5.2.4 Order Paraglomerales (Walker and Schüßler)...................... 124
References ................................................................................................... 126

Appendices: Keys to Taxa Glomeromycota Species..................................... 129

1.1 Appendix A: Key to Taxa Gigaspora Species
Proposed by Gerdemann and Trappe in 1974 .................................. 129
1.2 Appendix B: Key to Taxa Family Endogonaceae
Proposed by Tandy in 1975.............................................................. 130
1.3 Appendix C: Key to Taxa Family Endogonaceae
Proposed by Nicolson and Schenck in 1979 .................................... 130
1.4 Appendix D: Key to Taxa Family Endogonaceae
Proposed by Hall and Fish in 1979 .................................................. 133
Contents xiii

1.5 Appendix E: Key to Taxa Acaulospora Species

Proposed by Walker and Trappe in 1981 ......................................... 144
1.6 Appendix F: Key to Taxa Gigaspora Species
Proposed by Koske and Walker in 1985 .......................................... 145
1.7 Appendix G: Key to Taxa Glomus Species
Proposed by McGee in 1986 ............................................................ 146
1.8 Appendix H: Key to Taxa Order Glomerales
Proposed by Morton and Benny in 1990 ......................................... 146
1.9 Appendix I: Key to Taxa Pacispora Species
Proposed by Oehl and Sieverding in 2004 ....................................... 147
1.10 Appendix J: Key to Taxa Acaulospora Species
Proposed by Oehl and Co-workers in 2006 ..................................... 148
1.11 Appendix K: Key to Taxa Order Diversisporales
Proposed by Oehl and Co-workers in 2008 ..................................... 149

About the Author ............................................................................................ 153

Chapter 1
Overview

Abstract In this chapter I introduce what are arbuscular mycorrhizal fungi (AMF).
So, I respond four main answers about AMF, their biological characteristics, how
AMF colonize the plant roots, and finally I describe their molecular characteristics.
Basically, AMF are obligate root symbionts that establish a mutualistic symbiosis
with several plants and have key role in increasing plant growth, resistance, and
tolerance to abiotic and biotic stresses. They are incapable of independent growth
(in nature or axenic culture) without host plants and their main structures are: arbus-
cules, vesicles, auxiliary cells, hyphae and spores. Root colonization is mediated by
genetic, morphological and functional interactions between partners of the symbio-
sis that begins even before the physical contact between the host-plant and AMF
species. For their molecular characteristic we can explain that they have a large
variation in their genome (varying greatly between species). For example,
Rhizophagus intraradices has a small genome, close to 16.54 Mb (of which 88.36 %
are single copy DNA, 1.59 % are repetitive sequences and 10.05 % foldback DNA),
while other species, like Scutellospora pellucida and Racocetra gregaria have
genomes with much larger size may vary 127.4 Mb in the 1058.4 Mb respectively.

Keywords Mycorrhizas • Glomeromycota biological characteristics • Taxonomy

of arbuscular mycorrhizal fungi

1.1 Arbuscular Mycorrhizal Fungi: Who Are They?

Where Do They Live?

Arbuscular mycorrhizal fungi (hereafter AMF), phylum Glomeromycota, are obli-

gate root symbionts that are present in most terrestrial ecosystems and establish a
mutualistic symbiosis with several plant species around the world (Lekberg et al.
2013). They produce structures inside plant roots (e.g., arbuscules), thus having an
important role in plant mineral nutrition, (e.g., P-uptake, N-uptake and
micronutrients-uptake) and water absorption (Smith and Read 2008; Hodge and
Storer 2014), resulting in increased plant growth, resistance, and tolerance to abiotic
and biotic stresses, such as soil-borne pathogens and drought (Augé 2001; Cavagnaro
et al. 2001; Koske and Poison 1984; Rodríguez-Echeverría et al. 2009).

© Springer International Publishing Switzerland 2015 1

T. Souza, Handbook of Arbuscular Mycorrhizal Fungi,
DOI 10.1007/978-3-319-24850-9_1
2 1 Overview

We can find AMF associated with host plants in several habitats, such as tropical
forests, grasslands, shrublands, scrublands, temperate forests and highly anthropoge-
nized habitats. They exhibit different community composition and functions (Öpik
et al. 2006). Some AMF have a global distribution (cosmopolitan), like Funneliformis
mosseae (Al-Qarawi et al. 2013), but there is AMF species that have a local distribu-
tion, like Glomus brasilianum (Spain and Miranda 1996). Many works have also
suggested that AMF may exhibit different distribution patterns, resulting in a high
variability of taxon richness and composition between particular habitats or ecosys-
tems (Zhang et al. 2010; Kivlin and Hawkes 2011; Lekberg et al. 2013).

1.2 What Is Their Biological Characteristic?

AMF are strongly dependent on their host plants, being incapable of growing inde-
pendently (in nature or axenic culture) (Fitter 2005). AMF also present differential
levels of host specificity, and there are evidences of highly specific host-fungal pair-
ing (Johnson et al. 2003; Klironomos 2003). Also, AMF are believed to play a key
role in mediating plant development and establishment (Richardson et al. 2000;
Lekberg et al. 2013).
AMF are a monophyletic group. They share a common feature: the formation of
a framework for the exchange of nutrients between the symbionts, the arbuscules
(Smith and Read 2008). Arbuscules are originated among the cell wall and plasma
membrane of root cortical cells by differentiating the intracellular hyphae. It is sur-
rounded by differentiated plasma membrane of plant origin called periarbuscular
membrane (Lambais and Ramos 2010).
Arbuscular mycorrhizal fungi usually have the mycelium absent from septum,
but occasionally you can find it in senescent mycelium parts, especially in genus
Diversispora, Gigaspora, Racocetra and Scutellospora (Schüßler and Walker
2010). Their morphological structures are divided into: arbuscules, vesicles, auxil-
iary cells, hyphae and spores (Table 1.1). These structures are formed inside plant
roots (Hyphae and spores also can be formed outside roots, in the rhizosphere), and
create a massive surface area of membrane-membrane contact between plant root
cells-AMF structures and soil resources-AMF structures (Smith and Read 2008;
Hodge and Storer 2014).
Along with the intraradical growth, it also occur a mass of external mycelium
that grows beyond the host-plant rhizosphere. This mycelium network operates by
searching limited resources, such as water and nutrients from the soil solution
(Cross et al. 2008). After absorption, the mineral resources will be transported to the
intraradical mycelium and transferred to the host plant (Ramos et al. 2009), which
the plant provides carbon and energy to the AMF (Smith and Read 2008).
AMF spores are organized into outer wall, inner wall and pre-germination struc-
tures (from the outer to the inner structure, respectively). The standard colonization
of these structures will depend on the fungal species in question, and differ dramati-
cally in some genera. Another important feature of AMF is their formation of
spores, which is not found in any other group of fungi. The spore varies according
Table 1.1 AMF main structures and functions
Structure Function
Arbuscules (1) Interaction with the host plant
(intracellular) (2) Biochemical regulation and carbon, energy and nutrients exchanges
(3) Structures vary accordingly to the existing orders (Archaeosporales,
Diversisporales, Glomerales and Paraglomerales)
Vesicles (intraradical)a (1) Storage of energy-rich compounds lipids during the development
of mycorrhizae
(2) Responsible for the maintenance and growth of the fungus after
stoppage of root metabolic function
Auxiliary cells (1) Fragile cells responsible for lipid storage
(extraradical)b (2) Macromolecules provide carbon for the formation of spores
during the sporulation
Hyphae (intraradical) (3) Establish the “infection units” in the roots of the host plant
Hyphae (extraradical) (1) Responsible for the absorption of nutrients and water from the
rhizosphere
(2) Provide new entry points along the root of the host plant
(3) Responsible for produce new spores
Spores (1) Structures of survival and resistance
(2) Responsible for the dispersal and establishment of AMF
(3) Taxonomically valuable for AMF species identification
Spore walls (1) Important for growth, survival and spore dispersion in the soil
(2) The outer layers are responsible for interactions with other
microorganisms
Germinative walls (1) Directly involved in the events of germination
Germinative structures (1) Provides the structural basis for the germ tube to grow and break
through the spore walls
a
Structures that are only found in family Archaeosporaceae, Glomeraceae and Paraglomeraceae
b
Characteristic structures of family Diversisporaceae

Table 1.2 AMF genera and their spore forms

Spore
Genera Mode of formation Form
Acaulospora Singly Acaulosporoid
Ambispora Singly Acaulosporoid/glomoid
Archaeospora Singly Acaulosporoid/glomoid
Diversispora Singly Glomoid
Entrophospora Singly Entrophosporoid; Peridium present
Funneliformis Singly Radial-glomoid
Geosiphon Singly Glomoid
Gigaspora Singly Gigasporoid
Glomus Singly, in small clusters or sporocarps Glomoid; Peridium present
Claroideoglomus Singly, or in small clusters Glomoid; Peridium present
Otospora Singly Glomoid
Pacispora Singly Glomoid
Paraglomus Singly or in small to large clusters Glomoid
Racocetra Singly or in small to large clusters Gigasporoid
Redeckera Singly Glomoid
Rhizophagus Singly or in small to large clusters Glomoid
Scutellospora Singly Gigasporoid
Sclerocystis Sporocarps Radial-glomoid with peridium
4 1 Overview

to the specific genera (Table 1.2). Usually we can find spores with single or multiple
layers that make up the sub-cellular structure of the outer and inner wall, which have
structural and germination functions, respectively (Spain 2003). AMF spores sizes
ranges between 22 and 1050 μm in diameter, being the largest spores produced by
representatives of the Fungi Kingdom. Spores can be further divided into: outer
walls, inner walls and pre-germination structures.

1.3 How Do AMF Colonize Plant Roots?

Root colonization is mediated by genetic, morphological and functional interactions

between both partners of the symbiosis, which begins before the physical contact
between host-plant and AMF species (Kiriacheck et al. 2009). Because of the great
diversity of plant and AMF species, there is no standard mode of colonization, since
this feature is highly fungi-specific, as previously described (Moreira and Siqueira
2006; Souza et al. 2010). For example, the arbuscules can take Arum or Paris form

Table 1.3 Standard Arum and Paris made by mycorrhizal fungal species during root colonization
Structure
Type of Intracellular Cell Connect Coils in the Coils in
mycorrhiza hyphae propagation arbuscules to hypodermis the cortex
Arum Present Absent Intercellular hyphae Present Absent
Paris Absent Present Intracellular coil Absent Present

Table 1.4 Properties of AMF root structures and mycorrhiza distribution

AMF families
Archaeosporaceae
Structures Paraglomeraceae Acaulosporaceae Glomaceae Gigasporaceae
Arbuscules Narrow trunks Narrow trunks Narrow trunks Wide bulbous
(<4 μm), finely (<4 μm), finely (<4 μm), finely trunks (>4 μm),
branched, stain branched, stain branched, stain finely branched,
very faint faint dark stain very dark
Vesicles Absent Irregular, knobby, Elliptical, stain Absent
stain moderately dark
Auxiliary cells Absent Absent Absent Present
Spores in roots Present Present Present Present
Intercellular 2–8 μm wide, 2–6 μm wide, 1.5–5 μm 3–10 μm wide,
hyphae mostly smooth mostly smooth wide, smooth knobby, irregular
surface, some surface, some surface, shapes, irregular
coiling, irregular coiling, irregular straight, “H” branching,
branching, stain branching, stain branching, coiling, stain very
faint moderately stain dark dark
(continued)
1.4 What Are Their Molecular Characteristics? 5

Table 1.4 (continued)

AMF families
Archaeosporaceae
Structures Paraglomeraceae Acaulosporaceae Glomaceae Gigasporaceae
Intracellular Frequently coiling, Frequent coiling, Rare coiling, Frequent coiling,
hyphae 3–10 μm wide 4–8 μm wide 2–4 μm wide 4–12 μm wide
Entry point Appressoria, Appressoria, Appressoria, Lobed
frequent hyphal frequent hyphal infrequent Appressoria,
coils coils hyphal coils frequent hyphal
coils
Mycorrhiza Very patchy Patchy Continuous, Continuous, rare
distribution some patchiness
patchiness

(Table 1.3) and the AMF root structures and mycorrhiza distribution can vary
according the AMF family (Table 1.4).

1.4 What Are Their Molecular Characteristics?

The majority of AMF species have been described and named accordingly with the
morphology of their spores (Schüßler and Walker 2010), but this structure is not
always distinguishable among species, genus, families or even orders (Morton and
Redecker 2001; Walker et al. 2007; Walker 2008; Gamper et al. 2009). Thus, recent
genetic studies of mycorrhizal fungi have the potential to improve AMF taxonomi-
cal classification.
Morphological studies of the spores revealed that they are multinucleated and,
depending on the species, they may contain until one million of nuclei. They also
vary color, size and shape (Cooke et al. 1987; Bécard and Pfeffer 1993; Pawlowska
and Taylor 2004). Facing these observations, their molecular characterization is
very appealing, since it is not subject to: (1) intra-species phenotypic variations; (2)
environmental agents; (3) stage of development of the spore; and (4) other factors,
such as pathogens activity that may affect their morphology.
Hijri and Sanders (2004) showed that mycorrhizal fungi are haploid, and their
genome size is largely variable among species. For example, Rhizophagus intrara-
dices has a small genome, close to 16.54 Mb (of which 88.36 % are single copy
DNA, 1.59 % are repetitive sequences and 10.05 % foldback DNA), while other
species, such as Scutellospora pellucida and Racocetra gregaria have much larger
genomes, 127.4 Mb and 1058.4 Mb, respectively.
For many years, this group of fungus was thought to be exclusively clonal (Souza
2007; Souza et al. 2008); however, evidence of recombination were recently
obtained by Gandolfi et al. (2003), Pawlowska and Taylor (2004) and Croll et al.
(2008). These researchers observed the formation of anastomosis (such as the fusion
6 1 Overview

between branches of the same or different hyphae) and exchange of genetic material
among genetically distinct strains of Rhizophagus intraradices.
Giovannettti et al. (2003) have demonstrated vegetative incompatibility between
genetically and geographically diverse strains of Funneliformis mosseae, which is
one of the steps leading to speciation. But, these studies were conducted only with
species from families Glomeraceae and Gigasporaceae (Souza et al 2004; Souza
2005, 2007), and unfortunately there is little information about the ability to anasto-
mosis from other families, which deserves future investigation.
To conclude this topic, molecular studies facilitate the understanding of the
genetics and evolutionary biology of AMF, and especially, enhance the concept of a
species in such as complex group of organisms as is the Fungi Kingdom.

References

Al-Qarawi AA, Mridha MAU, Dhar PP (2013) Report of Funneliformis mosseae (Nicol. & Gerd.)
Gerd. and Trappe from rangeland soil of Saudi Arabia. Res J Biotechnol 8:96–99
Augé RM (2001) Water relations, drought and vesicular arbuscular mycorrhizal symbiosis.
Mycorrhiza 11:3–24
Bécard G, Pfeffer PE (1993) Status of nuclear division in arbuscular mycorrhizal fungi during in-
vitro development. Protoplasma 174:62–68
Cavagnaro TR, Gao LL, Smith FA, Smith SE (2001) Morphology of arbuscular mycorrhizas is
influenced by fungal identity. New Phytol 151:469–475
Cooke JC, Gemma JN, Koske RE (1987) Observations of nuclei in vesicular-arbuscular mycor-
rhizal fungi. Mycologia 79:331–333
Croll D, Wille L, Gamper HA, Mathimaran N, Lammers PJ, Corradi N, Sanders IR (2008) Genetic
diversity and host plant preferences revealed by simple sequence repeat and mitochondrial
markers in a population of the arbuscular mycorrhizal fungus Glomus intraradices. New Phytol
178:672–687
Cross C, Correia P, Ramos AC, Carvalho L, Bago A, Klironomos J, Martins-Loução MA (2008)
Arbuscular mycorrhiza in plant physiological and morphological adaptations. In: Ajit V (ed)
Mycorrhiza: state of the art, genetics and molecular biology, eco-function, biotechnology, eco-
physiology, structure and systematics. Springer, Heidelberg, pp 733–754
Fitter AH (2005) Darkness visible: reflections on underground ecology. J Ecol 93:231–243
Gamper HA, Walker C, Schuessler A (2009) Diversispora celata sp. nov.: molecular ecology and
phylotaxonomy of an inconspicuous arbuscular mycorrhizal fungus. New Phytol
182:495–506
Gandolfi A, Sanders IR, Rossi V, Menozzi P (2003) Evidence of recombination in putative ancient
asexuals. Mol Biol Evol 20:754–761
Giovannettti M, Sbrana C, Strani P, Agnolucci M, Rinaudo V, Avio L (2003) Genetic diversity of
isolates of Glomus mosseae from different geographic areas detected by vegetative compatibil-
ity testing and biochemical and molecular analysis. Appl Environ Microbiol 69:616–624
Hijri M, Sanders IR (2004) The arbuscular mycorrhizal fungus Glomus intraradices is haploid and
has a small genome size in the lower limit of eukaryotes. Fungal Genet Biol 41:253–261
Hodge A, Storer K (2014) Arbuscular mycorrhizal and nitrogen: implications for individual plants
through to ecosystems. Plant Soil 386:1–19
Johnson D, Vandenkoornhuyse PJ, Leake JR, Gilbert L, Booth RE, Grime JP, Young PW, Read DJ
(2003) Plant communities affect arbuscular mycorrhizal fungal diversity and community
composition in grassland microcosms. New Phytol 161:503–515
References 7

Kiriacheck SG, Azevedo LBC, Peres LEP, Lambais MR (2009) Regulação do desenvolvimento de
micorrízas arbusculares. Rev Bras Ciênc Solo 33:1–16
Kivlin SN, Hawkes CV (2011) Differentiating between effects of invasion and diversity: impacts
of aboveground plant communities on belowground fungal communities. New Phytol
189:526–535
Klironomos JN (2003) Variation in plant response to native and exotic arbuscular mycorrhizal
fungi. Ecology 84:2292–2301
Koske RE, Poison WR (1984) Are VA mycorrhizae required for sand dune stabilization? Bioscience
34:420–424
Lambais MR, Ramos AC (2010) Sinalização e transdução de sinais em micorrízas arbusculares.
In: Siqueira JO, Souza FA, Cardoso EJBN, Tsai SM (eds) Micorrizas: 30 anos de ocorrência no
Brasil. UFLA, Lavras, pp 119–132
Lekberg Y, Gibbons SM, Rosendahl S, Rawsey PW (2013) Severe plant invasions can increase
mycorrhizal fungal abundance and diversity. ISME J 7:1423–1433
Moreira FMS, Siqueira JO (2006) Microbiologia e Bioquímica do Solo, 2ª edição revisada e
ampliada. Editora UFLA, Lavras
Morton JB, Redecker D (2001) Two new families of Glomales, Archaeosporaceae and
Paraglomaceae, with two new genera Archaeospora and Paraglomus, based on concordant
molecular and morphological characters. Mycologia 93:183
Öpik M, Moora M, Liira J, Zobel M (2006) Composition of root-colonizing arbuscular mycorrhi-
zal fungal communities in different ecosystems around the globe. J Ecol 94:778–790
Pawlowska TE, Taylor JW (2004) Organization of genetic variation in individuals of arbuscular
mycorrhizal fungi. Nature 427:733–737
Ramos AC, Lima PT, Dias PN, Kasuya MCM, Feijó JA (2009) A pH signaling mechanism
involved in the spatial distribution of calcium and anion fluxes in ectomycorrhizal roots. New
Phytol 181:448–462
Richardson DM, Allsopp N, D’Antonio CM, Milton SJ, Rejmánek M (2000) Plant invasions-the
role of mutualisms. Biol Rev 75:65–93
Rodríguez-Echeverría S, Crisóstomo JA, Nabais C, Freitas H (2009) Belowground mutualists and
the invasive ability of Acacia longifolia in coastal dunes of Portugal. Biol Invasions
11:651–661
Schüßler A, Walker C (2010) The Glomeromycota: a species list with new families and new gen-
era. The Royal Botanic Garden, Edinburgh
Smith SE, Read DJ (2008) Mycorrhizal symbiosis. Academic, San Diego
Souza FA (2005) Biology, ecology and evolution of the family Gigasporaceae, arbuscular mycor-
rhizal fungi (Glomeromycota). NIOO Thesis 42. University of Leiden, Leiden
Souza FA (2007) Sistema reprodutivo e troca de material genético em fungos micorrízicos arbus-
culares. In: V Congresso Brasileiro de Micologia, Universidade Federal de Pernambuco,
Recife, pp 112–121
Souza FA, Kowalchuk G, Leeflang P, van Veen JA, Smit E (2004) PCR-denaturing gradient gel
electrophoresis profiling of interand intraspecies18S rRNA gene sequence heterogeneity is an
accurate and sensitive method to assess species diversity of arbuscular mycorrhizal fungi of the
genus Gigaspora. Appl Environ Microbiol 70:1413–1424
Souza FA, Sidney LS, Carrenho RC, Trufem SFB (2010) Classificação e taxonomia de fungos
micorrízicos arbusculares e sua diversidade e ocorrência no Brasil. In: Siqueira JO, Souza FA,
Cardoso EJBN, Tsai SM (eds) Micorrizas: 30 anos de ocorrência no Brasil. UFLA, Lavras,
pp 15–74
Souza FA, Silva ICL, Berbara RLL (2008) Fungos micorrízicos arbusculares: muito mais diversos
do que se imaginava. In: Moreira FMS, Siqueira JO, Brussaard L (eds) Biodiversidade do solo
em ecossistemas Brasileiros. UFLA, Lavras, pp 482–536
Spain JL (2003) Emendation of Archaeospora and of its type species, Archaeospora trappei.
Mycotaxon 87:109–112
Spain JL, Miranda JC (1996) Glomus brasilianum: an ornamented species in the Glomaceae.
Mycotaxon 60:137–142
8 1 Overview

Walker C (2008) Ambispora and Ambisporaceae resurrected. Mycol Res 112:297–298

Walker CM, Vestberg M, Schüßler A (2007) Nomenclatural clarification in Glomeromycota.
Mycol Res 111:253–256
Zhang Q, Yang R, Tang J, Yang H, Hu S, Chen X (2010) Positive feedback between mycorrhizal
fungi and plants influences plant invasion success and resistance to invasion. PLoS ONE
5:e12380. doi:10.1371/journal.pone.0012380
Chapter 2
An Old Relationship

Abstract In this chapter I discuss about the history of AMF. So, to explain the
evolutionary history of AMF and the several proposed AMF classifications between
1800 and the present day, I divided this long period in six phases. Phase I (1800–
1900)—Characterized for the first AMF taxonomy classification, and the first
description of genus Glomus, Rhizophagus and Sclerocystis. Phase II (1901–
1975)—this phase was characterized for two important events: Genus Geosiphon
was proposed, and important keys to identify Endogonaceae species were proposed.
Phase III (1976–1990)—This phase was characterized: the standardized terminol-
ogy about concepts of spore wall characteristics and murographs, and the new clas-
sification proposed by Morton and Benny in 1990. Phase IV (1991–2000)—In this
phase, the first PCR primer (VANS1) to perform molecular analysis was developed.
Phase V (2001–2010)—The most important event of this phase was the study done
Schüßler and co-workers in 2001, where they proposed a new monophyletic phylum
for AMF. They transferred all AMF species from Zygomycota to Glomeromycota,
and their study was base for other studies until 2009. Phase VI (2011–present
day)—This phase is characterized by two important works: (1) the new phyloge-
netic data for systematics and phylotaxonomy of AMF proposed by Krüger and
co-workers in 2012, and the new classification of Glomeromycota proposed by
Redecker and co-workers in 2013.

Keywords Murocales • Endogonales • Glomales • Glomeromycota

2.1 An Old Friend?

AMF are very old microorganisms. There are studies that show their origins on
earth at least to Ordovician, about 460 million years ago (Heckman et al. 2001).
However, molecular evidences estimate, perhaps as far as 600 million years ago
(Redecker et al. 2000). They are older than earliest land plants (Kingdom Plantae)
that colonize the earth around 500 million years ago (Taylor et al. 1993), and molec-
ular studies indicate that the symbiosis between AMF and plants was originated at
least 460 million years ago (Simon et al. 1993). It occurred when the bryophytes
started to colonize the earth (Souza et al. 2008).

© Springer International Publishing Switzerland 2015 9

T. Souza, Handbook of Arbuscular Mycorrhizal Fungi,
DOI 10.1007/978-3-319-24850-9_2
10 2 An Old Relationship

Thus, have AMF ancestors been associated with the “roots” of the first land
plants? This question remained unanswered for many years, but recently, Wang
et al. (2010) provided molecular evidences for the presence of three AMF genes into
“roots” of the common ancestor of present day land plants. These researchers con-
cluded that AMF genes must have been vertically inherited since the colonization of
earth by plants. So, we can conclude that the earliest land plants benefited from the
symbiosis with “this old friend” for their nutrient uptake (Pirozynski and Malloch
1975; Schüßler 2002).

2.2 AMF Ancestor Characteristics

The ancestors of AMF had, hyaline spores (size between 50 and 200 μm), their
sporogenic hyphae were small (diameter between 200 and 358 μm), their formation
was by glomoid and/or acaulosporoid modes, germination shield was present, and
the root colonization structures stained faintly in trypan blue (Dotzler et al. 2009;
Redecker et al. 2000). There is no evidence of arbuscules, vesicles, auxiliary cells,
hyphae coils, subtending hyphae, sporiferous saccule, septum, and cicatrix to occur
in the AMF ancestors.
These “ancestral” characteristics are very similar to the ones found in present day
families Ambisporaceae, Archaeosporaceae, Geosiphonaceae and Paraglomeraceae
characteristics (Redecker et al. 2000). Family Ambisporaceae and Archaeosporaceae
produce dimorphic propagules (Glomoid spores are bi-layered with a subtending
hyphae; Acaulosporoid spores are formed from a pedicel on the neck of a sporifer-
ous saccule). Geosiphonaceae is the only AMF family that does not live in associa-
tion with vascular plants (Schüßler et al. 2001).

2.3 What About Fungi Kingdom?

The phylogenetic relationships among AMF and other fungi groups remain unclear.
Molecular studies demonstrated that Glomeromycota form a monophyletic group
(Morton and Benny 1990). However, James et al. (2006) and Schüßler et al. (2001)
reported that Glomeromycota evolved from the common ancestors to of Ascomycota
and Basidiomycota. More recently, Lee et al. (2009) based on phylogenetic analysis
concluded that AMF evolved from Zigomycota, because they are very similar in
their biology.
The genus Archaeospora and Paraglomus are considered by many authors as the
representatives of the basal lineages of mycorrhizal fungi. These two genera have
glomoid hyaline spores (Archaeospora is a dimorphic genus—He presents spores
with acaulosporoid and glomoid morphotype), present no vesicles and stain faintly
2.4 History of Mycorrhizae (1809–Present Day) 11

when treated with trypan blue. The lack of spore pigmentation and of vesicles
formation might indicate that these characteristics evolved later during the develop-
ment of the AMF (Redecker et al. 2000).

2.4 History of Mycorrhizae (1809–Present Day)

Arbuscular mycorrhizal fungi taxonomical studies started many years ago, and
besides their taxonomy, phylogenic relationships and diversity are becoming clearer,
taxonomically reliable sequence data is still limited. After the AMF’s classification
proposed by Redecker et al. (2013), many questions and doubts were solved and the
evolutionary history of AMF was clarified. Notwithstanding there is a large number
of tax for which their phylogenetic relationship still unclear (142 species—60.68 %
of Glomeromycota), and given the recent molecular advances, the validity of the
classical characterization of AMF based on the morphology of spores structures is
questionable.
To better explain the history of AMF taxonomy and the several proposed AMF
classifications between 1800 and the present day, I propose to divide this long
period in six phases, and after a short description of each one, I describe each phase
in more detail.
Phase I (1800–1900)—This period occurred simultaneously with the Golden age of
Microbiology (Tortora et al. 2003), and is characterized by the proposal of the first
AMF taxonomically classification (Link 1809). Important AMF genera, as Glomus,
Rhizophagus and Sclerocystis were described (Schüßler and Walker 2010);
Phase II (1901–1975)—For about 74 years, the advent of morphological studies
lead to the reorganization of the taxonomical classification, with many AMF spe-
cies being transferred to another genus. Additionally, three new genera were pro-
posed (Acaulospora, Geosiphon and Gigaspora). However, this phase was
characterized for two important events: (1) Genus Geosiphon (Composed by only
one species—Geosiphon pyriforme) was proposed by Wettstein (1915), later this
AMF species would be used to clarify AMF phylogenetic position; and (2) the
development of identification keys for Endogonaceae species (Gerdemann and
Trappe 1974; Tandy 1975) that were the base for the modern morphological
classifications;
Phase III (1976–1990)—This phase was characterized by an explosion of new spe-
cies described, specially species from the genus Gigaspora, and Glomus, and two
new genera were identified (Entrophospora, and Scutellospora). Apart from these,
(1) the standardized terminology about concepts of spore wall characteristics and
murographs was proposed by Walker (1983); and (2) the new classification pro-
posed by Morton and Benny (1990), including new order (Glomales), two new sub-
orders (Glomineae and Gigasporineae), and three new families (Acaulosporaceae,
Glomaceae, and Gigasporaceae) was brought to light;
12 2 An Old Relationship

Phase IV (1991–2000)—Until the early 90s, the AMF species taxonomical

descriptions were based on spore structures. Despite their importance, these meth-
ods were not enough to clarify many doubts about undescribed new species, espe-
cially the ones with uncertain phylogenetic position, resulting in conflicting
systematic schemes among different works, and several cryptic taxa were misclas-
sified. The need for more concrete and objective tools for classification—lead to
the development of the first PCR primer (VANS1). Undoubtedly, this represented
a great advance in the field of AMF taxonomy, which facilitated detections and
identification of new species;
Phase V (2001–2010)—Based on molecular analyses new orders, new families, and
new genera of AMF were proposed. But the most important advance resulted from
the study of Schüßler et al. (2001), in which they proposed a new AMF monophy-
letic phylum. Also, their study leads to all AMF species to be transferred from
Zygomycota to Glomeromycota. Finally, their findings were the base for many
other studies until 2009.
Phase VI (2011–present day)—This phase is characterized by a lot of serious prob-
lems about AMF taxonomy. Although the molecular studies are becoming clearer,
there still a few molecular sequence data available, and the publication of a large
number of new AMF species resulted in considerable confusion among works.
Fortunately, (1) the new phylogenetic data for systematics and phylotaxonomy of
AMF was proposed by Krüger et al. (2012); and the new classification of
Glomeromycota was proposed by Redecker et al. (2013).

2.4.1 Phase I: Endogone? Endogonaceae? Why?

The mycorrhizal fungi were firstly classified as belonging to the order Murocales,
family Endogonaceae and genus Endogone (Link 1809). This classification was
based on the similarity between mycorrhizal spores and spores produced by
Endogone spp. However, this similarity is not considered a valid criteria since zygo-
spores formed by Endogone spp. are sexual structures, while AMF spores are asex-
ual (Morton 1990).
About genus Endogone, we had some new described species in this phase, like
Endogone australis (Berkeley 1859), Endogone pulvinata, Endogone moelleri
(Henn 1897), and Endogone fuegiana (Spegazzini 1897). The first AMF genus was
Glomus sensu stricto described by Tulasne and Tulasne (1844), which englobed two
species, Glomus microcarpum and Glomus macrocarpum. Later Botrydium pyri-
forme was described by Kützing in 1849.
In 1873, Berkeley and Broome described genus Sclerocystis composed with only
one species, Sclerocystis coremioides. Five years later, Cesati (1878) described the
genus Xenomyces. Finally, in 1896, Dangeard proposed new genus Rhizophagus, with
only one species, Rhizophagus populinus. Thus, at the end of this phase, three impor-
tant AMF genera were described: (1) Glomus; (2) Slerocystis; and (3) Rhizophagus.
2.4 History of Mycorrhizae (1809–Present Day) 13

2.4.2 Phase II: New Genera, New Perspectives. It Is About Time!

In the beginning of the Phase II, two new genus were characterized, Ackermannia
(Ackermannia coccogena and A. dussii; Patouillard 1902) and Sphaerocreas
(Sphaerocreas javanicum; von Höhnel 1908). In 1909, von Höhnel transferred the
Ackermannia to Sphaerocreas, and 1 year later he transferred Xenomyces and
Sphaerocreas to the genus Sclerocystis. Thus, Sclerocystis englobed four species:
Sclerocystis coccogenum, Sclerocystis coremioides, Sclerocystis dussii, and
Sclerocystis pubescens.
In 1915, Wettstein proposed a new genus Geosiphon, with only one species,
Geosiphon pyriformis. This one is very interesting AMF species, because it does not
form symbioses with plants, but instead with cyanobacteria from the genus Nostoc.
Family Endogonaceae was described in 1922 by Thaxter. He moved all Glomus
species to Endogone, keeping Sclerocystis according Berkeley and Broome (1875),
and moved Sclerocystis pubescens from Sclerocystis to Sphaerocreas. So, accord-
ingly with Thaxter (1922), Endogonaceae encompassed four genus: Endogone,
Glaziella, Sclerocystis, and Sphaerocreas. In the same year, based on morphological
similarities between species, Bucholtz moved the family Endogonaceae and
Mortierellaceae as belonging to the order Murocales.
Only in 1953, the Endogonaceae came to be classified in order Endogonales
(Moreau 1953). Moreau described Endogonaceae as englobing three genus:
Endogone, Glaziella and Sclerocystis. Concerning Endogone genus, many things
were done: Patouillard (1903) transferred Paurocofylis fulvum to Endogone, as
Endogone fulva; Beeli (1923) described Endogone minutissima; Zycha (1935)
moved Sphaerocreas pubescens to Endogone, as Endogone pubescens; Tulasne and
Tulasne (1951) described Endogone microcarpus; Lange and Lund (1955) described
Endogone flavispora; and Nicolson and Gerdemann (1968) described several new
species: Endogone calospora, Endogone gigantea, Endogone heterograma,
Endogone macrocarpa var. caledonia, Endogone macrocarpa var. geospora, and
Endogone mosseae.
Gerdemann and Trappe (1974) described two new genera, Acaulospora and
Gigaspora the first encompassing Acaulospora elegans, Acaulospora laevis, and
the second Gigaspora coralloidea, and Gigaspora gilmorei; they also moved some
Endogone spp. from Endogone to genus Gigaspora and Glomus (Table 2.1). They
also described some new Endogone species: Endogone alba, Endogone acrogena,
Endogone multiplex, Endogone oregonensis, Endogone tuberculosa; and proposed
an identification key to Gigaspora species (Appendix A).
One year later, the same authors splitted Endogone sensu lato into four genera,
Endogone sensu stricto, Gigaspora, Glomus, and Modicella. Thus, Gerdemann and
Trappe (1975) moved all species from Endogone to Glomus; and recognized
Sphaerocreas pubescens as Glomus pubescens. They also described new Glomus
species, such as Glomus convolutes, Glomus meianosporus, Glomus monosporus
(See Table 2.2 for more details about the classification proposed by Gerdemann and
Trappe). Simultaneously, based on comparisons between herbarium AMF specimens
14 2 An Old Relationship

Table 2.1 New AMF species
denominations proposed by
Gerdemann and Nicolson
during Phase II
Old AMF name New AMF name
Endogone australis Glomus macrocarpum
Endogone arenacea Glomus fulvum
Endogone borealis Glomus boreale
Endogone calospora Gigaspora calospora
Endogone canadensis Glomus canadense
Endogone fasciculata Glomus fasciculatum
Endogone fuegiana Glomus fuegianum
Endogone gigantea Gigaspora gigantea
Endogone heterograma Gigaspora heterograma
Endogone lignicola Glomus fulvum
Endogone macrocarpa Glomus macrocarpum
Endogone macrocarpa var. caledonia Glomus caledonium
Endogone macrocarpa var. geospora Glomus geosporum
Endogone moelleri Glomus fulvum
Endogone mosseae Glomus mosseae
Endogone nuda Glomus macrocarpum
Endogone pampaloniana Glomus macrocarpum
Endogone pubescens Glomus pubescens
Endogone pulvinata Glomus pulvinatum
Endogone radiata Glomus radiatum
Endogone tenebrosa Glomus tenebrosum
Endogone vesiculifera Glomus vesiculiferum
Paurocotylis fragilis Glomus fragile
Paurocotylis fulva Glomus macrocarpum
Rhizophagites butleri Glomus fulvum

Table 2.2 Classification of AMF at the end of Phase II

Phylum Class Order Family Genera (number of AMF species)
Zygomycota Zygomycetes Endogonales Endogonaceae Acaulospora (2)
Endogone sensu stricto
Gigaspora (5)
Glaziella
Glomusa (30)
Modicella
Sclerocystis (1)
a
Genus Glomus (Including Ackermannia, Rhizophagus, Sphaerocreas, Stigeosporium, and
Xenomyces) was considered as valid and distinct from Endogone

and fresh spores from South Australia and Victoria, Australia, Tandy (1975) described
five new AMF species: Endogone aggregata, Endogone crassa, Endogone reticulata,
Glomus tener and Glomus tubiformis. This author also provided a classification key
to sporocarpic species (Appendix B). In conclusion, during Phase II (1) were
described two important AMF genus (Acaulospora and Gigaspora), and (2) 38 new
AMF species.
2.4 History of Mycorrhizae (1809–Present Day) 15

2.4.3 Phase III: An Order, Three New Families, and a lot

of Identification Keys to Endogonaceae Species. AMF
Taxonomy is Becoming Robust!

Some new AMF species were described at the beginning of this phase (1976–1978).
Based on morphological studies of spores from several parts of the world (India,
Japan, México, New Zealand, and USA), new species were described for the genus
Acaulospora, Gigaspora, Glomus and Sclerocystis. Also, new associations AMF-
plant were described (Table 2.3).
In 1979, Ames and Schneides proposed the genus Entrophospora, and trans-
ferred Glomus infrequens from Glomus to Entrophospora as Entrophospora infre-
quens. In the same year, the Order Endogonales was validated by Benjamim, the
genus Complexipes was proposed by Walker, and two new identification keys to
Endogonaceae species were proposed (Nicolson and Schenck 1979; Hall and Fish
19791; Walker and Trappe 1981) (Appendices C, D and E). In 1982, Trappe and
Schenck transferred the genus Modicella from Family Endogonaceae to
Mortierellaceae; and Danielson transferred the genus Complexipes from
Zygomycetes to Ascomycetes.
In the meanwhile, three Endogone species (Endogone australis, Endogone ten-
ebrosa, Endogone versiformis) were transferred from Endogone to Glomus as
Glomus australis, G. tenebrosa, G. versiformis by Berch (1983); Walker (1983)
introduced the standardized terminology defining the concepts of spore wall charac-
teristics and murographs in AMF species description; and 2 years later, with Koske
and Walker (1985) based on the examination of collected spores from sand dunes of
the eastern seaboard of the USA, proposed a new identification key to species of the
genus Gigaspora, which has rough walled spores (Appendix F).
Between 1979 and 1985, some new AMF species were described. Morphological
studies of spores from Colombia, Costa Rica, Cuba, England, India, Mexico,
Pakistan, Panama, and USA, lead to the description of new species for genus
Acaulospora, Entrophospora, Gigaspora, Glomus, Sclerocystis, among others
(Table 2.4).
In 1986, Walker and Sanders described a new genus to Endogonaceae,
Scutellospora, and among other characteristics, based on details of spore germina-
tion they transferred several Gigaspora species from Gigaspora to Scutellospora
(Table 2.5). In the same year, Gibson et al. transferred Glaziella from Zygomycetes
to Ascomycetes; and McGee (1986) proposed an identification key to Glomus spe-
cies from Australia (Appendix G). Pirozynski and Dalpé (1989) described the fam-
ily Glomaceae, which englobes by two genus, Glomus and Sclerocystis.

1
The Endogonaceae classification proposed by Hall and Fish (1979) included several new taxa
described by Ames and Linderman (1976), Ames and Schneider (1979), Becker and Hall (1976),
Becker and Gerdemann (1977), Daniels and Trappe (1979), Gerdemann and Bakshi (1976), Hall
(1977), Hayman (1978), Nicolson and Schenck (1979), Redhead (1977), Rose et al. (1979), Sward
et al. (1978), Tandy (1975) and Trappe (1977).
Table 2.3 AMF species described between the years 1976 and 1978
New AMF
Authors (Year) Genus species Distribution (Host-plant)
Ames and Linderman (1976) Acaulospora A. trappei Southern Oregon and Northern California, USA (Lilium longiflorum)
Gerdemann and Bakshi (1976) Glomus G. multicaule India (Diospuyrus peregrina, Fraxinus uhdei, Lagerstroemia speciosa, Podocarpus gracilior,
Acrocarpus fraxinifolius, Aleurites fordii, Albizzia odoratissima, Dendrocalamus strictus, Michelia
champaca, Syzygium cumini, and Tectona grandis)
Sclerocystis S. sinuosa India (Agathis robusta, Cupressus torulosa, Podocarpus gracilior, Acrocarpus fraxinifolius,
Juniperus procera, Albizzia odoratissima, Cinnamomum camphora, Diopyros peregrina, Fraxinus
uhdei, Litsea glutinosa, Syzygium cumini, Dalbergia sissoo, Tectona grandis, Taxodium
mucronatum, Cryptomeria japonica and Salix fragilis)
Becker and Hall (1976) Gigaspora G. margarita Florida, USA (Mycorrhizal association with field plant not described)
Trappe (1977) Acaulospora A. scrobiculata Mexico; Central and Western USA; and Central Japan (Saccharum officinarum; Zea mays, Festuca
viridula; and wild grasses)
Glomus G. constrictum Central California, USA; and Mexico (Cocos spp., Citrus spp., Persea spp., Zea mays, and grasses)
Sclerocystis S. clavispora Mexico (Pastures and Saccharum officinarum )
Becker and Gerdemann (1977) Glomus G. etunicatum Missouri and Florida, USA (Andropogon scoparius, Zea mays)
Hall (1977) Glomus G. infrequens New Zealand (Mycorrhizal associations with field plants not described)
G. invermarium New Zealand (Mycorrhizal associations with field plants not described)
G. magnicaule New Zealand (Mycorrhizal associations not described)
G. pallidum New Zealand (Coprosma robusta, Metrosideros umbellate, Weinmannia racemosa and
Lepctospermum scoparium)
G. tenue New Zealand (Poa colensoi, Zea mays, Lolium perenne, Coprosma robusta, Leptospermum
scoparium, Leptospermum ericoides, Metrosideros umbellate, Weinmannia racemosa, Solanum
laciniatum, Solanum aviculare, Solanum nigrum, Griselinia littoralis, Trifolium repens, Pteridium
aquilium var. esculentum, and Histiopteris incise (Thunb.) J. Smith)
Gigaspora G. aurigloba New Zealand (Mycorrhizal associations with field plants not described)
Table 2.4 New AMF species described between 1979 and 1985
2.4

Authors (Year) Genus New AMF species Distribution (Host-plant)

Rothwell and Trappe (1979) Acaulospora A. bireticulata Western Kentucky, USA (Sassafras albidum)
Daniels and Trappe (1979) Glomus G. epigaeum Central Mexico; and Ecuador (Angiopteris erecta, Araucarua excels, Asparagus
officinalis, Passiflora sp., Philodendron spp., and Sorghum vulgare)
Rose et al. (1979) Glomus G. gerdemannii Oregon, USA (Ceanothus velutinus, C. prostratus, and C. integerrimus)
Trappe (1979) Glomus G. segmentatum Belize (Mycorrhizal association with root plants in field conditions not
described)
Nicolson and Schenck (1979) Acaulospora A. gerdemannii Florida, USA (Mycorrhizal association with root plants in field conditions not
described)
Gigaspora G. rosea North Florida, USA (Paspalum spp.)
G. nigra Nigeria; and Florida, USA (Glycine max, and Paspalum spp.)
G. pellucida North and Central Florida, USA (Paspalum spp.)
G. gregaria Northwest and Central Florida, USA (Glycine max)
History of Mycorrhizae (1809–Present Day)

Glomus G. clarum Florida, USA (Arachis hypogea, Glycine max, and Paspalum spp.)
Rose and Trappe (1980) Glomus G. halonatus Central Oregon, USA; Coastal England; and Mexico (Ceanothus velutinus and
Hippophae rhamnoides )
G. lacteus Central Oregon, USA (Ceanothus velutinus and Purshia tridentate)
G. scintillans Central Oregon, USA (Cercocarpus ledifolias and Purshia tridentate)
Bhattacharjee and Mukerji (1980) Glomus G. reticulatum India (Mycorrhizal association with root plants in field conditions not described)
Iqbal and Perveen (1980) Sclerocystis S. microcarpus Pakistan (Ferns rhizosphere)
S. pakistanica Pakistan (Oryza sativa)
Ferreira and Herrera (1981) Gigaspora G. alborosea Cuba (Hibiscus elatus)
G. minuta Cuba (Mycorrhizal association not described)
G. savannicola Cuba (Mycorrhizal association not described)
G. tricalypta Cuba (Mycorrhizal associations not described)
(continued)
17
 18

Table 2.4 (continued)

Authors (Year)
Walker and Trappe (1981)
Walker and Rhodes (1981)
Schenck and Smith (1982)
Janos and Trappe (1982)
Walker (1982)
Bhattacharjee et al. (1982)
Mukerji et al. (1983)
Koske et al. (1983)
Genus New AMF species Distribution (Host-plant)
Acaulospora A. spinosa Central Iowa, USA; and Mexico (Populus spp., and Fraxinus americana)
Glomus G. albidus Ohio and Iowa, USA (Setaria spp., Bromus inermis, and Triticum aestivum)
Gigaspora G. albida Florida, USA (Cynodon dactylon)
Glomus G. aggregatum Florida, USA (Citrus spp.)
G. claroideum Florida and South Carolina, USA (Glycine max and Paspalum notatum)
G. fecundisporum Brazil; and Florida, USA (Melines minutiflora Beauv.)
G. intraradices Florida, USA (Carica papaya, Lycopersicon esculentum, Apium graveolens,
Citrus sp., Arachis glabrata, Stylosanthes sp., Phaseolus vulgaris, Fragaria
chiloensis var. ananassa, Daucus carota, Solanum tuberosm, Hordeum vulgare,
Avena sativum, and Triticum vulgare )
G. leptotichum California, Georgia and Florida, USA (Liquidambas styraciflua, Pennisetum
glaucum )
G. tortuosum Florida, USA (Glycine max)
Acaulospora A. foveata Costa Rica; Mexico; and Republic of Panama (Saccharum officinarum, Musa x
paradisiaca, Theobroma cacao)
A. tuberculata Costa Rica; and Republic of Panama (Tropical tree species)
Glomus G. occultum Iowa, USA; and Yorkshire, England (Sorghum vulgare and Asparagus
officinalis)
Gigaspora G. candida India (Triticum aestivum)
Glomus G. delhiense India (Trigomela foenum-graecum)
G. multisubstensum India (Maerua arenaria)
Gigaspora G. reticulata New England, USA (Phragmites communis, Ammophila breviligulata, Myrica
pensylvaniv, Malus domestica, Prunus persica, Dactylis glomerata, Agropyron
repens)
2 An Old Relationship
Authors (Year) Genus New AMF species Distribution (Host-plant)
2.4

Schenck et al. (1984) Acaulospora A. appendicula Colombia; and Florida, USA (native grasses)
A. longula Colombia (native grasses)
A. mellea South America; and Florida, USA (Piper nigrum and Coffea arabica)
A. morrowiaw Colombia (native grasses)
Glomus G. manihotis Colombia (Manihot esculenta)
Entrophospora E. colombiana Colombia; and Florida, USA (native grasses)
Koske and Walker (1984) Gigaspora G. erythropus Massachusetts, Rhode Island, Connecticut, New Jersey, Maryland, Virginia,
New York, USA; and Bahamas (Allium breviligulata, Solidago sempervirens, L.
japonicus var. glaber, and Zea mays)
Hall and Abbott (1984) Gigaspora G. decipiens Western Australia (Pennisetum clandestinum )
Rothwell and Victor (1984) Glomus G. botryoides Kentucky, USA (Mycorrhizal association with vascular plants unknown)
Tang and Zang (1984) Glomus G. citricola (Manuscript not found)
Trappe et al. (1984) Glomus G. deserticola Southern California, Arizona and Texas, USA (Parthenium argentatum,
Parthenium incanum, and Simmondsia chinensis)
History of Mycorrhizae (1809–Present Day)

Morton and Walker (1984) Glomus G. diaphanum West Virginia, USA (Andropogon virgnicus and Danthonia spicata)
Walker et al. (1984) Acaulospora A. nicolsonii Great Britain (native plants)
Smith and Schenck (1985) Glomus G. ambisporum Florida, USA (Paspalum notatum, Gossypium hirsutum , Glycine max)
G. heterosporum Florida, USA (Glycine max and an unidentified grass species)
Berch and Trappe (1985) Glomus G. hoi British Columbia, Canada; and Oregon and Washington, USA (native plants
from sand dunes, forests, and roadsides)
Berch (1985) Acaulospora A. sporocarpia Arizona, USA; and West Pakistan (Mycorrhizal associations with root plants not
described)
Koske and Walker (1985) Gigaspora G. dipapillosa Rhode Island and Virginia, USA (Uniola paniculata, Ammophila breviligulata,
Solidago sempervirens, and Panicum sp.)
G. persica East coast of the USA (Ammophila breviligulata, Solidago sempervirens,
Spartina patens, and Myrica pensylvanica)
G. verrucosa New Jersey, South Carolina, Arkansas, USA; Bahamas; and Brazil (Ammophila
breviligulata, Solidago sempervirens, Uniola paniculata, Spartina patens, and
Myrica pensylvanica)
19
20 2 An Old Relationship

Table 2.5 Gigaspora species
transferred to new genus
Scutellospora accordingly
with Walker and Sanders
during Phase III
Old name (Gigaspora spp.) New name (Scutellospora spp.)
Gigaspora alborosea Scutellospora alborosea
Gigaspora aurigloba Scutellospora aurigloba
Gigaspora calospora Scutellospora calospora
Gigaspora coralloidea Scutellospora coralloidea
Gigaspora dipapilosa Scutellospora dipapilosa
Gigaspora erythropus Scutellospora erythropus
Gigaspora gilmorei Scutellospora gilmorei
Gigaspora gregaria Scutellospora gregaria
Gigaspora heterograma Scutellospora heterograma
Gigaspora minuta Scutellospora minuta
Gigaspora nigra Scutellospora nigra
Gigaspora pellucida Scutellospora pellucida
Gigaspora persica Scutellospora persica
Gigaspora reticulata Scutellospora reticulata
Gigaspora savannicola Scutellospora savannicola
Gigaspora tricalypta Scutellospora tricalypta
Gigaspora verrucosa Scutellospora verrucosa

In 1990, the field of arbuscular mycorrhizal fungi taxonomy was richer, mainly
because of the several identification keys of AMF developed until then; but also of
the creation and definition of new concepts, in particularly the concepts of spore
walls and the description of spore ontogeny proposed by Almeida and Schenck
(1990). Concerning taxonomical classification the genus Sclerocystis was reduced
to only one species, S. coremioides, with the remaining (S. clavisporum, S. liquid-
ambaris, S. rubiforme, S. sinuosum and S. taiwanensis) being transferred to Glomus
by Almeida and Schenck (1990). This year was also remarkable because of the
establishment of the distinctive characteristics of members of the Order Endogonales
by Morton and Benny (1990). All fungi presenting hypogeous, epigean, and sapro-
phytic habits, having coenocytic somatic hyphae, sexual spores (Zygospores), and
septa with micropores were placed in the Order Endogonales.
So, Morton and Benny (1990) proposed a new Order, Glomales, which included
all fungi that form arbuscules in obligate mutualistic associations with vascular plants.
This Order was divided into two suborders: Gigasporineae, which is characterized by
the production of azygospores and auxiliary cells; and Glomineae, characterized by
the production of chlamydospores. Gigasporineae englobing only one family,
Gigasporaceae—that is characterized by the production of spores terminally on a
sporogenous cell; and Glomineae encompassing two families, Acaulosporaceae—
that is characterized by production of dimorphic spores formed laterally from or
within a hypha terminating in a sporiferous saccule; and Glomaceae, which is charac-
terized by spores singly production, in aggregates or in compact sporocarps on one or
more cylindrical subtending hyphae. Together, the two suborders englobed six genus
(Acaulospora, Entrophospora, Gigaspora, Glomus, Sclerocystis and Scutellospora),
fifty-seven new AMF species, and resulted in a new identification key to the Order
Glomales (See Table 2.6 and Appendix H for more details).
2.4 History of Mycorrhizae (1809–Present Day) 21

Table 2.6 Classification of AMF at the end of Phase III

Genera (number
Phylum Class Ordera Suborder Family of AMF species)
Zygomycota Zygomycetes Glomales Glomineae Acaulosporaceae Acaulospora (29)
Entrophospora (3)
Glomaceae Glomus (69)
Sclerocystis (8)
Gigasporineae Gigasporaceae Gigaspora (7)
Scutellospora (23)
a
All AMF species were moved from Endogonales to the new Order Glomales

Between 1986 and 1990, a large number of new AMF species were described,
mainly based on spore morphological studies. Several researchers from different parts
of the world reported new species for the genus Acaulospora, Entrophospora,
Gigaspora, Glomus, Scutellospora, among others (Table 2.7); totalizing 139 new
AMF species described.

Did You Know?

The International Culture Collection of VA Mycorrhizal Fungi (INVAM) was
created in 1985, after Dr. Schenck has received funding from the National
Science Foundation. He had envisioned to create a living culture collection
aiming to preserve valuable germplasm and make it available to researchers
and the public of world widely.
INVAM has four main acting lines: to acquire, to propagate, to character-
ize, and to maintain arbuscular mycorrhizal fungi germplasm in living cultures
for preservation and distribution to any person or institution that requires it.
Nowadays the INVAM helps many researchers and graduate students by
providing useful information about AMF classification, methods to assess
AMF, cultures and collections.
More details in: http://invam.wvu.edu/

2.4.4 Phase IV: Molecular Studies Begin. It Is About Time!

The work developed by Morton and Benny (1990) during Phase III was very impor-
tant regarding AMF taxonomy. Their study was the base for the modern AMF clas-
sification; they described many AMF species, and some of them were later
reclassified by Bentivenga and Hetrick (1991) based on more detailed morphologi-
cal analyses (e.g., Glomus mortoni). But the work done by Morton and Benny
(1990) presented many undescribed AMF species, because their spores had not
enough structures to identify them. What about these species, which did not have
enough structures to identify by “classical characterization”?
To avoid the ambiguities inherent of the “classical morphological classifica-
tion” of AMF, molecular characterization was tested for the first time in 1992.
This methodology allows faster, more robust, and more detailed studies on spore
 22

Table 2.7 New AMF species described between 1986 and 1990
Authors (Year) Genus New AMF species Distribution (Host-plant)
Walker et al. (1986) Acaulospora A. delicata Arizona, USA (Sorghum sudanense and Sorghum vulgare)
Schenck et al. (1986) Acaulospora A. myriocarpa Colombia and Peru (Peuraria phaseoloides, Minohot esculenta, Coffea arabica,
Brachyaria sp., Stylosanthes sp., and Allium porrum)
Morton (1986) Acaulospora A. dilatata West Virginia, USA (A. virginicys, Danthonia spicata, Festuca arundinacea, and
A. lacunosa Festuca rubra)
A. rugosa
McGee (1986) Glomus G .arborense South Australia (Forest plants)
G. cerebriforme Central Australia (Eucalyptus sp.)
G. warcupii South Australia (Eucalyptus sp.)
Boyetchko and Tewari (1986) Glomus G. dimorphicum Alberta, Canada (Hordeum vulgare)
Wu and Chen (1986) Glomus G. formosanum Central Taiwan (Pratia nummularia, Colocasia formosana, Asplenium normale,
Phyllostachys pubescens)
Koske and Walker (1986a, b) Glomus G. globiferum New Jersey, and Virginia, USA (Ammophila breviligulata and Artemesia sp.)
Scutellospora S. fulgida Easter North American seaboard (Ammophila breviligulata, Solidago
sempervirens, and Uniola paniculata)
S. weresubiae Virginia, Florida and South Carolina, USA (Ammophila breviligulata, Uniola
paniculata, and Solidago sempervirens)
Koske et al. (1986a) Glomus G. microaggregatum California, Hawaii, Michigan, and the Atlantic coast of the USA (Abronia
maritima, Ambrosia chamisonnis, Ammophila breviligulata, Calamovilfa
longifolia, Ipomea brasiliensis, Malacothrix incana, Pennisetum setaceum,
Sporobolus sp., Prunus pumila, and Uniola paniculata)
Koske et al. (1986b) Glomus G. pustulatum Rhode Island, USA; and Quebec, Canada (Ammophila breviligulata, Honkenya
peploides, Lathyrus maritimus)
Berch and Koske (1986) Glomus G. pansihalos California, New Jersey, and Michigan, USA; and Ontario, Canada (Abronia
maritime, Ambrosia chamisonnis, Andropogon sp., Artemesia sp., Distichlis
spicata, Malacothrix sp., Mesembryanthemum sp., Solidago sempervirens,
Athyrium thelypterioides, and Thelypteris palustris)
2 An Old Relationship

Miller and Walker (1986) Glomus G. maculosum Wisconsin, USA (Sorghum sudanense)
Authors (Year) Genus New AMF species Distribution (Host-plant)
2.4

Sieverding and Toro (1987) Acaulospora A. denticulata Colombia (Pueraria phaseoloides)

Entrophospora E. schenckii
Sieverding (1987) Glomus G. glomerulatum Colombia (Pueraria phaseoloides)
Wu and Chen (1987) Sclerocystis S. liquidambaris Central Taiwan (Pratia nummularia, Colocasia formosana, Asplenium normale,
S. taiwanensis Phyllostachys pubescens)
Sieverding (1988) Glomus G. callosum (Manuscript not found)
Błaszkowski (1988) Acaulospora A. polonica Poland (Mycorrhizal association unknown)
A. gedanensis
A. thomii
Glomus G. dominikii
Morton and Koske (1988) Scutellospora S. dipurpurescens West Virginia, USA (Festuca arundinacea, Trifolium pretense, Lotus
corniculatus, and Festuca rubra)
Sieverding (1988) Acaulospora A. splendida Costa Rica (Quercus costaricensis)
Błaszkowski (1989) Acaulospora A. cavernata Poland (Thuja occidentalis)
History of Mycorrhizae (1809–Present Day)

Skou and Jakobsen (1989) Glomus G. fistulosum Denmark (Triticum aestivum and Hordeum vulgare)
G. fragilistratum Denmark (Hordeum vulgare)
Spain et al. (1989a, b) Gigaspora G. ramisporophora Brazil (Pueraria phaseoloides)
Scutellospora S. biornata Colombia (native grasses)
Walker and Diederichs (1989) Scutellospora S. scutata Brazil (Ananus comosus)
Koske and Gemma (1989) Glomus G. nanolumen Hawaii (Scaevola sericea, and Ipomoea stolonifera)
Koske and Halvorson (1989) Glomus G. trimulares California, New Jersey, Maryland, and Virginia, USA (Abronia maritima and
Ambrosia chamissonis)
Scutellospora S. arenicola San Miguel Island, and California, USA (Abronia maritima, Ambrosia
chamisonnis var. hipinatisecta, Astragalus miguelensis, Calystegia macrostegia
var. Macrostegia)
Błaszkowski (1990) Acaulospora A. capsicula Poland (Pastures and forest trees)
A. laevis
Kramadribata and Hedger (1990) Acaulospora A. walkeri Indonesia (Theobroma cacao)
23
24 2 An Old Relationship

morphology and AMF phylogeny. Simon et al. (1992) reported the first DNA
sequence from AMF, which was obtained by directly sequencing of the nuclear
genes coding for the small subunit rRNA (SSU), and was later used to develop the
first AMF PCR (polymerase chain reaction) primer, VANS1.2 This primer allowed
amplifying a portion of the AMF SSU directly from infected root plants, allowing a
rapid detection, and identification of a limited group of species (Entrophospora
colombiana, Gigaspora gigantea, Gigaspora margarita, Glomus intraradices,
Glomus mosseae and Scutellospora pellucida).
Also, identification and description of new AMF continued during this phase,
and 33 new AMF species were classified (Table 2.8); however, only four of them
were described using molecular tools. The molecular approach was later useful to
reclassify some AMF species, such as Acaulospora appendicula and Glomus lep-
totichum (Morton et al. 1997) (Table 2.9), and to clarify the taxonomic phylogenetic
position of some AMF genus, as Sclerocystis (Redecker et al. 2000).

Did You Know?

The International Bank for the Glomeromycota was created in 1993 with the
mission to provide the scientific community with high-quality culture data-
base of AMF.
Nowadays, this collection have isolates of some AMF, such as Acaulospora,
Cetraspora, Claroideoglomus, Dentiscutata, Diversispora Funneliformis,
Gigaspora, Racocetra, Rhizophagus, and Septoglomus from different regions
of the world; and provide small samples (50 g) for scientific investigation,
only with limit of three cultures per request.
More details in: http://www.i-beg.eu

2.4.5 Phase V: New Orders, New Families and New Genus—

Molecular Studies were Helping So Much! (2001–2010)

During Phase V, it took plat the advent of molecular studies to improve AMF species
description, contributing to a high number of species reclassified, a number larger
than the new described AMF species (Table 2.10). Also, Oehl et al. (2004, 2006,
2008) proposed three new identification keys to described AMF species from genus
Pacispora, Acaulospora, and Gigasporaceae (Appendices I, J, and K respectively).
Schüßler et al. (2001) proposed a new Phylum, Glomeromycota, switching all
AMF species from Zygomycota to Glomeromycota. This major taxonomic change
was based on the phylogenetic analysis of SSU rRNA gene sequences from Geosiphon
pyriformis, concluding that AMF group diverged from the same common ancestor as
the Ascomycota and Basidiomycota. Glomeromycetes was splitted into three Orders,

2
VANS1 primer sequence: GTCTAGTATAATCGTTATACAGG.
Table 2.8 New AMF species described during the Phase IV (1991–2000)
Authors (Year) Genus New AMF species Distribution–Methodology (Host-plant)
Giovanetti et al. (1991) Glomus G. coronatum South of Tuscany, Italy—Morphological, cytochemical, and ontogenetic characteristics
(Anacyclus radiatus)
Błaszkowski (1991) Scutellospora S. nodosa Poland—Morphological characteristics (Salix triandra).
Chou et al. (1991) Gigaspora G. alboaurantiaca Taiwan—Morphological characteristics (Casuarina equisetifolia)
Dalpé (1992) Glomus G. lamellosum Ontario, Canada—Morphological characteristics (Ammophila breviligulata)
Mehrotra and Baijal (1992) Glomus G. sterilum Manuscript not found
Błaszkowski (1992) Scutellospora S; armeniaca Poland—Morphological characteristics (A. arenaria, Artemisia campestris, Crataegus
monogyna, Rosa cantina, and S. arenaria)
Walker et al. (1993) Scutellospora S. castanea France—Morphological characteristics (Lathyrus sylvestris)
Ingleby et al. (1994) Acaulospora A. excavata Cote d’Ivoire, Southwest of Tissale—Morphological characteristics (Terminalia superba
and Terminalia ivorensis)
Cabello et al. (1994) Glomus G. antarcticum Antarctic Peninsula—Morphological characteristics (Deschampsia antarctica)
Wu et al. (1995) Glomus G. chimonobambusae Taiwan—Morphological characteristics (Chimonobambambusa quadrangularis,
Entrophospora E. kentinensis and native grasses)
Błaszkowski (1995a, b) Acaulospora A. koskei Poland—Morphological characteristics (A. stolonifera, A. arenaria, and J. articulate)
Glomus G. corymbiforme Poland—Morphological characteristics (Ammophila arenaria)
Walker et al. (1995) Glomus G. viscosum Tuscany, Italy; Germany, and Russia—Morphological characteristics, EDAX analysis, and
histochemical investigations (native plants)
Koske and Gemma (1995) Scutellospora S. hawaiiensis Hawaii—Morphological characteristics (Sporobolus virginicus)
Pfeiffer et al. (1996) Glomus G. spurcum Arizona, USA—Morphological characteristics (Helianthus annuus. Lycopersicon
esculentum, Medicago sativa, Paspalum notatum, Plantago lanceolata, Sorghum
saccharatum, S. sudanense, and Zea mays)
(continued)
Table 2.8 (continued)
Authors (Year) Genus New AMF species Distribution–Methodology (Host-plant)
Spain and Miranda (1996a, b) Glomus G. brasilianum Brazil—Morphological characteristics (native plants)
Scutellospora S. cerradensis
Błaszkowski (1997) Glomus G. gibbosum Poland—Morphological characteristics (Ammophila arenaria)
Mehrotra (1997) Glomus G. bagyarajii India—Morphological characteristics (native plants)
Zhang and Wang (1997) Glomus G. dolichosporum Manuscript not found
Błaszkowski and Tadych (1997) Glomus G. multiforum Poland—Morphological characteristics (native plants)
G. verruculosum
Błaszkowski et al. (1998) Entrophospora E. baltica Poland—Morphological characteristics (Ammophila arenaria)
Walker et al. (1998) Scutellospora S. spinosissima Venezuela—Morphological characteristics (Mycorrhizal association unknown)
Schultz and Bever (1999) Acaulospora A. colossica North Carolina, USA—Morphological characteristics (Mycorrhizal association unknown)
Kennedy et al. (1999) Glomus G. eburneum Arizona, USA; and Namibia—Morphological characteristics (native grasses)
G. luteum Arizona, USA; and Canada—Morphological characteristics (native trees)
Stürmer and Morton (1999) Scutellospora S. rubra Brazil—Morphological characteristics (Eucalyptus dunnii)
Sinclair et al. (2000) Glomus G. avelingiae South Africa—Morphological characteristics (Acacia saligna)
Błaszkowski et al. (2000) Glomus G. minutum Poland—Morphological characteristics (Plantago lanceolata)
Declerck et al. (2000) Glomus G. proliferum Illinois, USA; and France—Morphological characteristics, biochemical and molecular
analyses (Musa sp.)
Kramadribata et al. (2000) Scutellospora S. projectulata Indonesia—Morphological characteristics, molecular and phylogenetic analyses
(Villebrunea rubescens, Cyathea contaminans, Ficus binnedijkii, and Syzygium pyrifolium)
2.4 History of Mycorrhizae (1809–Present Day) 27

Table 2.9 New AMF species
denominations according
different authors, Phase IV
(1991–2000)
Old AMF name New AMF name
Acaulospora appendicula Acaulospora gerdemannii
Glomus fecundisporum Glomus leptotichum

Table 2.10 Main AMF species taxonomical changes occurred during Phase V (2001–2010)
Author (Year) Old Genus Old AMF name New Genus New AMF name
Morton and Acaulospora A. trappei Archaeospora A. trappei
Redecker (2001) A. gerdemannii A. leptoticha
A. appendicula A. leptoticha
Glomus G. gerdemannii Archaeospora A. gerdemannii
G. leptotichum A. leptoticha
G. fecundisporum A. leptoticha
G. occultum Paraglomus P. occultum
G. brasilianum P. brasilianum
Walker and Glomus G. spurcum Diversispora D. spurca
Schüßler (2004)
Oehl and Glomus G. chimonobambusae Pacispora P. chimonobambusae
Sieverding (2004) G. dominikii P. dominikii
G. scintillans P. scintillans
Sieverding Entrophospora E. colombiana Kuklospora K. colombiana
and Oehl (2006) E. kentinensis K. kentinensis
E. schenckii Intraspora I. schenckii
Spain et al. Acaulospora A. appendicula Appendicispora A. appendicula
(2006) A. gerdemanii A. jimgerdemanii
Archaesopora A. gerdemanii Appendicispora A. gerdemanii
Walker Ambispora A. fennica Appendicispora A. fennica
et al. (2007a, b) A. gerdemannii A. gerdemannii
A. leptoticha A. leptoticha
Glomus G. callosum Appendicispora A. callosa
G. fecundisporum A. fecundicispora
G patagonicum Pacispora P. patagonica
G. dominikii P. scintillans
Gerdemannia G. chimonobambusae Pacispora P. chimonobambusae
G. scintillans P. scintillans
Walker (2007) Appendicispora A. appendicula Ambispora A. appendicula
A. fennica A. fennica
A. callosa A. callosa
A. fecundicispora A. fecundicispora
A. gerdemannii A. gerdemannii
A. jimgerdemannii A. jimgerdemannii
A. leptoticha A. leptoticha
Renker Glomus G. laccatum Paraglomus P. laccatum
et al. (2007)
Sieverding Scutellospora S. heterograma Dentiscutata D. heterograma
(2008) S. erytrophus Quatunica Q. erytrophus
(continued)
28 2 An Old Relationship

Table 2.10 (continued)

Author (Year) Old Genus Old AMF name New Genus New AMF name
Oehl et al. (2008) Scutellospora S. alborosea Racocetra R. alborosea
S. minuta R. minuta
S. castanea R. castanea
S. coralloidea R. coralloidea
S. fulgida R. fulgida
S. gregaria R. gregaria
S. persica R. persica
S. verrucosa R. verrucosa
S. weresubiae R. weresubiae
Oehl et al. (2009) Dentiscutata D. heterograma Fuscutata F. heterograma
Kaonongbua Kuklospora K. colombiana Acaulospora A. colombiana
et al. (2010) K. kentinensis A. kentinensis
Schüßler and Intraspora I. schenckii Archaeospora A. schenckii
Walker (2010) Glomus G. claroideum Claroideoglomus C. claroideum
G. maculosum C. claroideum
G. drummondii C. drummondii
G. fistulosum C. fistulosum
G. etunicatum C. etunicatum
G. lamellosum C. lamellosum
G. luteum C. luteum
G. walkeri C. walkeri
G. aurantium Diversispora D. aurantia
G. eburneum D. eburnea
G. epigaeum D. epigea
G. trimulares D. trimulares
G. africanum Funneliformis F. africanum
G. badium F. badium
G. caledonium F. caledonium
G. coronatum F. coronatum
G. mosseae F. mosseae
G. fragilistratum F. fragilistratum
G. geosporum F. geosporum
G. constrictum F. constrictum
G. verruculosum F. verruculosum
G. xanthium F. xanthium
G. fulvum Redeckera R. fulvum
G. megalocarpum R. megalocarpum
G. pulvinatum R. pulvinatum
G. clarum Rhizophagus R. clarus
G. diaphanum R. diaphanus
G. custos R. custos
G. fasciculatum R. fasciculatus
G. intraradices R. intraradices
G. irregulare R. irregularis
G. manihotis R. manihotis
G proliferum R. proliferus
G. vesiculiferum R. vesiculiferus
2.4 History of Mycorrhizae (1809–Present Day) 29

Table 2.11 Glomeromycota classifications proposed by Schüßler et al. (2001)

Phylum Class Ordera Family Genera
Glomeromycota Glomeromycetes Archaeosporales Archaeosporaceae Archaeospora
Geosiphonaceae Geosiphon
Diversisporales Acaulosporaceae Acaulospora
Entrophospora
Diversisporaceae Glomus-Group Cb
Gigasporaceae Gigaspora
Scutellospora
Glomerales Glomeraceae Glomus-Group Aa
(Glomus-Group A)
Glomeraceae Glomus-Group Bc
(Glomus-Group B)
Paraglomerales Paraglomeraceae Paraglomus
a
Glomus caledonium, Glomus clarum, Glomus coremioides, Glomus coronatum, Glomus fascicu-
latum, Glomus fragilistratum, Glomus geosporum, Glomus intraradices, Glomus manihotis,
Glomus mosseae, Glomus proliferum, Glomus sinuosum, and Glomus verruculosum
b
Glomus spurcum and Glomus versiforme
c
Glomus claroideum, Glomus etunicatum, Glomus lamellosum, Glomus luteum, Glomus vesicu-
liferum, and Glomus viscosum

Archaeosporales, Paraglomerales, and Diversisporales. Morton and Redecker

(2001) proposed two new families (Archaeosporaceae and Paraglomeraceae), each
one with only one new genus (Archaeospora and Paraglomus) (Table 2.11).
Initially, Order Archaeosporales was encompassed two families, Archaeo-
sporaceae and Geosiphonaceae, (Morton and Redecker 2001); Order Diversisporales
englobed three families, Acaulosporaceae, Diversisporaceae, and Gigasporaceae;
Order Glomerales and Paraglomerales were composed by only one genus each one
(Glomeraceae and Paraglomeraceae respectively) (Morton and Redecker 2001), but
new families and genus were described along Phase V.
Three years later, after new Glomeromycota classification (Schüßler et al. 2001),
a new family and genus, Pacisporaceae and Pacispora, respectively, were proposed
by Walker and Schüßler (2004). In the same year, Oehl and Sieverding (2004) pro-
posed Glomus-Group C as genus Diversispora into Diversisporaceae.
Several other new AMF genus and species were proposed based on phylogenetic
data, such as Kuklospora, Intraspora (Sieverding and Oehl 2006); Appendicispora
(Spain et al. 2006); Ambispora (Walker et al. 2007); Otospora (Palenzuela et al.
2008); Dentiscutata, Fuscutata, Quatunica, Cetraspora, and Racocetra (Oehl et al.
2008) (Table 2.12).
In 2010, Walker and Schüßler made a taxonomical revision of Glomeromycota.
Their main changes were: (1) all AMF species for which phylogenic relationships
were unclear remained classified as previously; (2) all AMD species whose their
taxonomic positions were well-supported by molecular evidences were reclassified
in the corresponding taxa; and finally, (3) they proposed three new genus
Claroideoglomus, Funneliformis, and Redeckera (Table 2.13).
Table 2.12 New AMF species proposed during Phase V (2001–2010)
30

Authors (year) Genus New AMF species Distribution (host-plant)

Błaszkowski et al. (2001) Glomus G. arenarium Poland—Morphological characteristics (Plantago lanceolata)
Herrera-Peraza et al. (2001) Scutellospora S. crenulata Venezuela—Morphological characteristics (Gongylolepis benthamiana,
Clusia pusilla, Calliandra sp., and Euphronia guianensis)
McGee and Trappe (2002) Glomus G. atrouva Western South Wales, Australia—Morphological (native forest trees)
G. canum
G. cuneatum
G. pellucidum
Sieverding and Oehl (2006) Glomus G. caesaris Germany—Morphological characteristics (Hieracium pilosella)
Dalpé et al. (2002) Glomus G. kerguelense Kerguelen Island—Morphological characteristics (Agrotis stolonifera)
Hu (2002) Glomus G. spinosum Taiwan (Cunnighamia lanceolata)
Wang and Liu (2002) Glomus G. zaozhuangianus Manuscript not found
Oehl et al. (2003) Glomus G. aureum Germany—Morphological characteristics (Lolium perenne, Trifolium
G. spinuliferum pretense, Plantago lanceolata)
Herrera et al. (2003) Glomus G. brohultii Manuscript not found
Błaszkowski et al. (2004a, b) Glomus G. insculptum Poland—Morphological characteristics (Corynephorus canescens, Elymus
arenarius and Koeleria glauca)
Błaszkowski et al. (2004a, b) Glomus G. aurantium Poland—Morphological and molecular data (Plantago lanceolata)
G. xanthium
Rani et al. (2004) Glomus G. hyderabadensis India—Morphological and molecular data (Allamanda cathartica)
Oehl and Sieverding (2004) Pacispora P. boliviana Austria—Morphological characteristics (Lolium perenne, Trifolium pretense,
P. coralloidae and Plantago lanceolata)
P. franciscana
P. robigina
Oehl et al. (2005) Glomus G. badium Germany—Morphological and molecular data (native grasses)
Novas et al. (2005) Glomus G. patagonicum Manuscript not found
Oehl et al. (2006) Acaulospora A. alpina Switzerland—Morphological and molecular analyses (Carex curvulla, Corex
2 An Old Relationship

sempervirens, Sesleria caerule, and Nardus stricta)

 2.4

Błaszkowski et al. (2006) Glomus G. drummondii Poland—Morphological and Molecular data (Plantago lanceolata)
G. walkeri
Redecker et al. (2007) Glomus G. megalocarpum Manuscript not found
Walker et al. (2007a, b) Ambispora A. fennica Finland—Morphological and molecular analyses (Plantago lanceolata)
Goto et al. (2008) Ambispora A. brasiliensis Southeast Brazil—Morphological characteristics (mycorrhizal formation
unknown)
Velazquez et al. (2008) Acaulospora A. estreriana Argentina—Morphological characteristics (L. perenne, M. sativa,
and P. lanceolata)
Błaszkowski et al. (2008) Glomus G. irregulare Egypt, Denmark, Greece, Poland and Spain—Morphological and molecular
data (Xanthium spinosum)
Oehl et al. (2008) Scutellospora S. pernambucana Brazil—Morphological characteristics (Mycorrhiza formation unknown)
Cuenca and Herrera-Peraza (2008) Scutellospora S. striata Venezuela—Morphological characteristics (Mycorrhizal formation
unknown)
Oehl et al. (2009) Racocetra R. beninensis Manuscript not found
Palenzuela et al. (2008) Otospora O. bareae Spain—Morphological and molecular data (native plants)
History of Mycorrhizae (1809–Present Day)

Gamper et al. (2009) Diversispora D. celata Switzerland—Morphological and molecular data (native plants)
Błaszkowski et al. (2009a) Glomus G. perpusillum Poland—Morphological and molecular data (Plantago lanceolata)
Błaszkowski et al. (2009b) Glomus G. achrum Manuscript not found
G. bistratum
Khade (2010) Glomus G. goaensis Manuscript not found
Goto et al. (2009) Racocetra R. intraornata Brazil—Morphological characteristics (mycorrhizal association unknown)
Cano et al. (2009) Glomus G. custos Spain—Morphological characteristics (mycorrhizal association unknown)
Błaszkowski et al. (2010) Glomus G. indicum Manuscript not found
G. iranicum
Błaszkowski et al. (2010) Glomus G. africanum Manuscript not found
Furrazola and Herrera-Peraza (2010) Glomus G. candidum North America—Morphological and molecular data (Allium vineale,
Anthoxanthum odoratum, Plantago lanceolata and Panicum sphaerocarpon)
Palenzuela et al. (2010) Entrophospora E. nevadensis Manuscript not found
31

Kaonongbua et al. (2010) Acaulospora A. colliculosa Manuscript not found

32 2 An Old Relationship

Table 2.13 Taxonomic classification of Glomeromycota accordingly with Schüßler and Walker (2010)
Order Family Genus Number of species
Archaeosporales Archaeosporaceae Archaeospora 2
Ambisporaceae Ambispora 9
Geosiphonaceae Geosiphon 1
Diversisporales Acaulosporaceae Acaulospora 37
Diversisporaceae Diversispora 6
Otospora 1
Redeckera 3
Entrophosporaceae Entrophospora 3
Gigasporaceae Gigaspora 8
Scutellospora 25
Racocetra 11
Pacisporaceae Pacispora 8
Glomerales Glomeraceae Glomus 76
Funneliformis 12
Rhizophagus 11
Sclerocystis 11
Claroideoglomeraceae Claroideoglomus 7
Paraglomerales Paraglomeraceae Paraglomus 3
Total 11 18 234

Did You Know?

Glomeromycota In vitro Collection (GINCO) was created in 2004 to provide
the scientific community and industrial sectors with high-quality, contami-
nant-free in vitro arbuscular mycorrhizal fungi.
Its website documents GINCO, the largest collection of AMF exclusively
cultured in vitro at the service of the scientific community and industrial
sector.
More details in: http://www.mycorrhiza.be/ginco-bel/index.php
The International Code of Botanical Nomenclature (ICBN), created in
2006 determines the rules and recommendations to correctly name fungi.
Accordingly with Miller et al. (2011), these rules were intended to provide
clear, fair rules that provide stability to the fundamental process of naming
organisms.

Phase VI: Modern Classifications (2011–the present day)

In 2011, Goto et al. transferred Ambispora brasiliensis from Ambispora to
Acaulospora as Acaulospora brasiliensis; Palenzuela and Ferrol described
Ambispora granatensis; Furrazola et al. described Glomus crenatum; Oehl et al.
described Racocetra tropicana; Lin and Yen described Racocetra undulata;
Sieverding and Silva transferred Funneliformis constrictus from Funneliformis to
Septoglomus as Septoglomus constrictum; and Oehl et al. (2011a, b, c, d, e, f)) pro-
posed three new genus characterized by entrophosporoid and glomoid spore forma-
tion (Albahypha, Sacculospora, and Tricispora).
2.4 History of Mycorrhizae (1809–Present Day) 33

In 2012, Oehl et al. described two new species, Acaulospora punctata and
Diversispora clara; and Oehl and Sieverding described Ambispora reticulata based
on morphological evidences without any phylogenetic and molecular support; and
Rodríguez and Dalpé described Glomus cubense. Krüger et al. (2012) proposed new
phylogenetic data for systematics and phylotaxonomy of AMF. They concluded that
the data set presented in their study covers the future primary DNA barcode for
AMF (The ITS region, and the 5′ portion of the LSU). They also provide a reference
guide for molecular species identification and phylotaxonomy that can be important
for future molecular ecological studies.
In 2013, Redecker et al. reviewed numerous publications from Phase V, and con-
cluded that the recent description and publication of numerous genus and species
within the Glomeromycota (namely from Phase V) had created confusion and oper-
ational difficulties for those working with AMF. They reported that: (1) some clas-
sifications were based on erroneous interpretation of poor quality data; and (2)
many taxonomic revisions do not reflected a robust AMF taxonomy and systemat-
ics. Facing these conclusions, they established the goal of reevaluating all the evi-
dence available in the current literature and incorporating new data essential to the
analysis, culminating in a consensus classification (Table 2.14)

Table 2.14 Consensus taxonomic classification of Glomeromycota accordingly with Redecker

et al. (2013)
Phylum Class Ordera Family Genera
Glomeromycota Glomeromycetes Archaeosporales Archaeosporaceae Archaeospora
Ambisporaceae Ambispora
Geosiphonaceae Geosiphon
Diversisporales Acaulosporaceae Acaulospora
Diversisporaceae Corymbiglomusb
Diversispora
Otosporab
Redeckera
Tricisporab
Gigasporaceae Cetraspora
Dentiscutata
Gigaspora
Intraornatosporab
Paradentiscutatab
Racocetra
Scutellospora
Pacisporaceae Pacispora
Sacculosporaceae Sacculospora
Glomerales Claroideoglomeraceae Claroideoglomus
Glomeraceae Funneliformis
Glomus
Rhizophagus
Sclerocystis
Septoglomus
Paraglomerales Paraglomeraceae Paraglomus
a
Order Gigasporales are included within Order Diversisporales according this classification
b
There are insufficient evidences to consider these genera, but no formal actions were taken
34 2 An Old Relationship

Redecker et al. (2013) concluded that all glomeromycotan Orders grouped in

only one Class, Glomeromycetes, and considered that current data about
Glomeromycota proposed by Oehl et al. (2011a, b, c, d, e, f) did not support three
Classes (Archaeosporomycetes, Glomeromycetes and Paraglomeromycetes). They
also rejected Order Gigasporales proposed by Oehl et al. (2011a, b, c, d, e, f),
because there was no molecular phylogeny to support it, and maintained the four
Orders (Archaeosporales, Diversisporales, Glomerales, and Paraglomerales) pro-
posed by Schüßler et al. (2001) and Walker and Schüßler (2004).
Although, Redecker et al. (2013) considered some genus described by Oehl et al.
(2011a, b, c, d, e, f), such as Septoglomus. They did not consider the following
genus described by Oehl et al. (2011a, b, c, d, e, f): Albahypha, Entrophospora,
Fuscutata, Intraspora, Kuklospora, Orbispora, Quatunica, Simiglomus and
Viscospora in their classification, and they consider the strategy of these authors as
retrograde study that seriously compromised the Code’s aim of establishing a stable
and scientifically based nomenclature.

Did you know?

The international Culture Collection of Glomeromycota (CICG) was created
in 2013 with the mission to establish, maintain, characterize and document
cultures of arbuscular mycorrhizal fungi, in order to preserve their functional
and taxonomic diversity and distribute germplasm to researches and institu-
tions word widely.
Nowadays this collection obtain isolates of AMF from different regions
and ecosystems from Brazil and Latin America; and has become a reference
center to deposit fungal isolates, to help in diversity studies and to provide
training in taxonomy and culture of AMF.
More details in: http://www.furb.br/cicg/index.php?lang=EN

References

Almeida RT, Schenck NC (1990) A revision of the genus Sclerocystis (Glomaceae, Glomales).
Mycologia 82:703–714
Ames RN, Linderman RG (1976) Acaulospora trappei sp. nov. Mycotaxon 3:565–569
Ames RN, Schneider RW (1979) Entrophospora, a new genus in the Endogonaceae. Mycotaxon
8:347–352
Becker WN, Gerdemann JW (1977) Glomus etunicatus sp. nov. Mycotaxon 6:29–32
Becker WN, Hall IR (1976) Gigaspora margarita, a new species in the Endogonaceae. Mycotaxon
4:155–160
Bentivenga SP, Hetrick BAD (1991) Glomus mortonii sp. nov., a previously undescribed species in
the Glomaceae isolated from the tallgrass prairie in Kansas. Mycotaxon 42:9–15
Berch SM (1983) Lectotypification of Glomus macrocarpum and proposal of new combinations:
Glomus australe, Glomus versiforme, and Glomus tenebrosum (Endogonaceae). Can J Bot
61:2608–2617
References 35

Berch SM (1985) Acaulospora sporocarpia, a new, sporocarpic species, and emendation of the
genus Acaulospora (Endogonaceae, Zygomycotina). Mycotaxon 23:409–418
Berch SM, Koske RE (1986) Glomus pansihalos, a new species in the Endogonaceae, Zygomycetes.
Mycologia 78:832–836
Berch SM, Trappe JM (1985) A new species of Endogonaceae, Glomus hoi. Mycologia 77:654–657
Berkeley MJ, Broome CE (1875) Enumeration of the fungi of Ceylon. J Linn Soc 14:29–137
Bhattacharjee M, Mukerji KG (1980) Studies on Indian Endogonaceae II. The genus Glomus.
Sydowia 39:14–77
Bhattacharjee M, Mukerji KG, Tewari JP, Skoropad WP (1982) Structure and hyperparasitism of a
new species of Gigaspora. Trans Br Mycol Soc 78:184–188
Błaszkowski J (1988) Four new species of the Endogonaceae (Zygomycotina) from Poland.
Karstenia 27:37–42
Błaszkowski J (1989) Acaulospora cavernata (Endogonaceae)—a new species from Poland with
pitted spores. Crypt Bot 1:204–207
Błaszkowski J (1990) Polish Endogonaceae. VII. Acaulospora capsicula sp. nov. Mycologia
82:794–798
Błaszkowski J (1991) Polish Glomales. VIII. Scutellospora nodosa, a new species with knobby
spores. Mycologia 83:537–542
Błaszkowski J (1992) Scutellospora armeniaca, a new species in Glomales (Zygomycetes) from
Poland. Mycologia 84:939–944
Błaszkowski J (1995a) Acaulospora koskei, a new species in Glomales from Poland. Mycol Res
99:237–240
Błaszkowski J (1995b) Glomus corymbiforme, a new species in Glomales from Poland. Mycologia
87:732–737
Błaszkowski J (1997) Glomus gibbosum, a new species from Poland. Mycologia 89:339–345
Błaszkowski J, Tadych M (1997) Glomus multiforum and G. verruculosum, two new species from
Poland. Mycologia 89:804–811
Błaszkowski J, Madej T, Tadych M (1998) Entrophospora baltica sp. nov. and Glomus fuegianum,
two species in the Glomales from Poland. Mycotaxon 68:165–184
Błaszkowski J, Tadych M, Madej T (2000) Glomus minutum, a new species in Glomales
(Zygomycetes) from Poland. Mycotaxon 76:187–195
Błaszkowski J, Tadych M, Madej T (2001) Glomus arenarium, a new species in Glomales
(Zygomycetes). Acta Societatis Botanicorum Poloniae 70:97–101
Błaszkowski J, Adamska I, Czerniawska B (2004a) Glomus insculptum, a new arbuscular mycor-
rhizal species from Poland. Mycotaxon 89:225–234
Błaszkowski J, Blanke V, Renker C, Buscot F (2004b) Glomus aurantium and G. xanthium, new
species in Glomeromycota. Mycotaxon 90:447–467
Błaszkowski J, Renker C, Buscot F (2006) Glomus drummondii and G. walkeri, two new species
of arbuscular mycorrhizal fungi (Glomeromycota). Mycol Res 110:555–566
Błaszkowski J, Czerniawska B, Wubet T, Schäfer T, Buscot F, Renker C (2008) Glomus irregulare,
a new arbuscular mycorrhizal fungus in the Glomeromycota. Mycotaxon 106:247–267
Blaszkowski J, Kovács GM, Balázs T (2009a) Glomus perpusillum, a new arbuscular mycorrhizal
fungus. Mycologia 101:247–255
Błaszkowski J, Gábor MK, Tímea B (2009b) Glomus perpusillum, a new arbuscular mycorrhizal
fungus. Mycologia 101:247–255
Blaszkowski J, Kovács GM, Balázs TK, Orlowska E, Sadravi M, Wubet T, Buscot F (2010)
Glomus africanum and G. iranicum, two new species of arbuscular mycorrhizal fungi
(Glomeromycota). Mycologia 102:1450–1462
Boyetchko SM, Tewari JP (1986) A new species of Glomus (Endogonaceae, Zygomycotina)
mycorrhizal with barley in Alberta. Can J Bot 64:90–95
Cabello M, Gaspar L, Pollero R (1994) Glomus antarctitum sp. nov., a vesicular-arbuscular mycor-
rhizal fungus from Antarctica. Mycotaxon 51:123–128
Cano C, Bago A, Dalpé Y (2009) Glomus custos sp. nov., isolated from a naturally heavy metal-
polluted environment in southern Spain. Mycotaxon 109:499–512
36 2 An Old Relationship

Chou W-N, Yen C-H, Chung H-H (1991) Species of Gigaspora and Scutellospora (Endogonaceae)
in Taiwan. Trans Mycol Soc ROC 6:1–17
Cuenca G, Herrera-Peraza R (2008) Scutellospora striata sp. nov., a newly described glomeromy-
cotan fungus from la Gran Sabana, Venezuela. Mycotaxon 105:79–87
Dalpé Y (1992) Glomus lamellosum sp. nov.: a new Glomaceae associated with beach grass.
Mycotaxon 43:289–293
Dalpé Y, Plenchette C, Frenot Y, Gloaguen JC, Strullu DG (2002) Glomus kerguelense sp. nov., a
new Glomales species from sub-Antarctic. Mycotaxon 84:51–60
Daniels BA, Trappe JM (1979) Glomus epigaeus sp. nov., a useful fungus for vesicular-arbuscular
mycorrhizal research. Can J Bot 57:539–542
Declerck S, Granenbrouck S, Dalpé Y, Séguin S, Grandmougin-Ferjani A, Fontaine J, Sancholle
M (2000) Glomus proliferum sp. nov.: a description based on morphological, biochemical,
molecular and monoxenic cultivation data. Mycologia 92:1178–1187
Dotzler N, Walker C, Krings M, Hass H, Kerp H, Taylor TN, Agerer R (2009) Acaulosporoid
glomeromycotan spores with a germination shield from the 400 million year old Rhynie chert.
Mycol Res 8:9–18
Ferreira RI, Herrera RA (1981) El género Gigaspora Gerdemann et Trappe (Endogonaceae) en
Cuba. Rev Jardín Bot Nac 1:43–66
Furrazola E, Herrera-Peraza R (2010) Glomus candidum, a new species of arbuscular mycorrhizal
fungi from North America grassland. Mycotaxon 113:101–109
Gamper HA, Walker C, Schussler A (2009) Diversispora celata sp. nov: molecular ecology and
phylotaxonomy of an inconspicuous arbuscular mycorrhizal fungus. New Phytol
182:495–506
Gerdemann JW, Bakshi BK (1976) Endogonaceae of India: two new species. Trans Br Mycol Soc
66:340–343
Gerdemann JW, Trappe JM (1974) Endogonaceae in the Pacific Northwest. Mycologia Mem
5:1–76
Giovanetti M, Avio L, Salutine L (1991) Morphological, cytochemical, and ontogenetic character-
istics of a new species of vesicular-arbuscular mycorrhizal fungus. Can J Bot 69:161–167
Goto BT, Maia LC, Oehl F (2008) Ambispora brasiliensis, a new ornamented species in the arbus-
cular mycorrhiza-forming Glomeromycetes. Mycotaxon 105:11–18
Goto BT, Maia LC, Silva GA, Oehl F (2009) Racocetra intraornata, a new species in the
Glomeromycetes with a unique spore wall structure. Mycotaxon 109:483–491
Hall IR, Fish BJ (1979) A key to the Endogonaceae. Trans Br Mycol Soc 73:261–270
Hall IR (1977) Species and mycorrhizal infections of New Zealand Endogonaceae. Trans Br
Mycol Soc 68:341–356
Hall IR, Abbott LK (1984) Some Endogonaceae from South Western Australia. Trans Br Mycol
Soc 83:203–208
Hayman DS (1978) Mycorrhizal populations of sown pastures and native vegetation in Otago,
New Zealand. N Z J Agric Res 21:271–276
Heckman DS, Geiser DM, Eidell BR, Stauffer RL, Kardos NL, Hedges SB (2001) Molecular
evidence for the early colonization of land by fungi and plants. Science 293:1129–1133
Herrera RA, Ferrer RL, Sieverding E (2003) Glomus brohultii: A new species in the arbuscular
mycorrhiza forming glomerales. J App Bot 77:37–40
Herrera-Peraza RA, Cuenca G, Walker C (2001) Scutellospora crenulata, a new species of
Glomales from La Gran Sabana, Venezuela. Can J Bot 79:674–678
Hu H-T (2002) Glomus spinosum sp. nov. in the Glomaceae from Taiwan. Mycotaxon
83:159–164
Ingleby K, Walker C, Mason PA (1994) Acaulospora excavata sp. nov.—an endomycorrhizal fun-
gus from Cote D’Ivoire. Mycotaxon 50:99–105
Iqbal SH, Perveen B (1980) Some species of Sclerocystis (Endogonaceae) from Pakistan. Trans
Mycol Soc Jpn 21:57–63
James TY, Kauff F, Schoch CL, Matheny PB, Hofstetter V, Cox CJ, Celio G, Guiedan C, Fraker E,
Miadlikowska J, Lumbsch HT, Rauhut A, Reeb V, Arnold AE, Amtoft A, Stajich JE, Hosaka
References 37

K, Sung GH, Johnson D, O’Rourke B, Crockett M, Binder M, Curtis JM, Slot JC, Wang Z,
Wilson AW, Schubler A, Longcore JE, O’Donnell K, Mozley-Standridge S, Porter D, Letcher
PM, Powell MJ, Taylor JW, White MM, Griffith GW, Davies DR, Humber RA, Morton JB,
Sugiyama J, Rossman AY, Rogers JD, Pfister DH, Hewitt D, Hansen K, Hambleton S,
Shoemaker RA, Kohlmeyer J, Volkmann-Kohlmeyer B, Spotts RA, Serdani M, Crous PW,
Hughes KW, Matsuura K, Langer E, Langer G, Untereiner WA, Lucking R, Budel B, Geiser
DM, Aptroot A, Diederich P, Schmitt I, Schultz M, Yahr R, Hibbett DS, Lutzoni F, McLaughlin
DJ, Spatafora JW, Vilgalys R (2006) Reconstructing the early evolution of fungi using a six-
gene phylogeny. Nature 443:818–822
Janos DP, Trappe JM (1982) Two new Acaulospora species from Tropical America. Mycotaxon
15:515–522
Kaonongbua W, Morton JB, Bever JD (2010) Taxonomic revision transferring species in
Kuklospora to Acaulospora (Glomeromycota) and a description of Acaulospora colliculosa sp.
nov. from field collected spores. Mycologia 102:1497–1509
Kennedy LJ, Stutz JC, Morton JB (1999) Glomus eburneum and Glomus luteum, two new species
of arbuscular mycorrhizal fungi, with emendation of Glomus spurcum. Mycologia
91:1083–1093
Khade S (2010) Dentiscutata nigerita—a new species of arbuscular mycorrhizal fungi from India.
Mycosphere 1:241–247
Koske RE, Gemma JN (1989) Glomus nanolumen (Endogonaceae), a new species from Hawaii.
Mycologia 81:935–938
Koske RE, Gemma JN (1995) Scutellospora hawaiiensis: a new species of arbuscular mycorrhizal
fungus from Hawaii. Mycologia 87:678–683
Koske RE, Halvorson WL (1989) Scutellospora arenicola and Glomus trimulares: two new spe-
cies in the Endogonaceae. Mycologia 81:927–933
Koske RE, Walker C (1984) Gigaspora erythropa, a new species forming arbuscular mycorrhizae.
Mycologia 76:250–255
Koske RE, Walker C (1985) Species of Gigaspora (Endogonaceae) with roughened outer walls.
Mycologia 77:702–720
Koske RE, Walker C (1986a) Glomus globiferum: a new species of Endogonaceae with a hyphal
peridium. Mycotaxon 26:133–142
Koske RE, Walker C (1986b) Species of Scutellospora (Endogonaceae) with smooth-walled
spores from maritime sand dunes: two new species and a redescription of the spores of
Scutellospora pellucida and Scutellospora calospora. Mycotaxon 27:219–235
Koske RE, Miller DD, Walker C (1983) Gigaspora reticulata: a newly described endomycorrhizal
fungus from New England. Mycotaxon 16:429–435
Koske RE, Friese C, Walker C, Dalpé Y (1986a) Glomus pustulatum: a new species in the
Endogonaceae. Mycotaxon 26:143–149
Koske RE, Gemma JN, Olexia PD (1986b) Glomus microaggregatum, a new species in the
Endogonacae. Mycotaxon 26:125–132
Kramadibrata K, Walker C, Schwarzotts D, Schussler A (2000) A new species of Scutellospora
with a coiled germination shield. Ann Bot 86:21–27
Kramadribata K, Hedger JN (1990) A new species of Acaulospora associated with cocoa in Java
and Bali (Indonesia). Mycotaxon 37:73–77
Krüger M, Krüger C, Walker C, Stockinger H, Schüßler A (2012) Phylogenetic reference data for
systematics and phylotaxonomy of arbuscular mycorrhizal fungi from phylum to species level.
New Phytol 193:970–984. doi:10.1111/j.1469-8137.2011.03962.x
Lange M, Lund EM (1955) The genus Endogone in Denmark. Friesia 5:90–95
Lee J, Lee S, Young JPW (2009) Improved PCR primers for the detection and identification of
arbuscular mycorrhizal fungi. FEMS Microbiol Ecol 65:339–349
Link HF (1809) Nova plantarum genera e classe Lichenum, Algarum, Fungorum. Neues J Bot
3:1–19
McGee PA (1986) Further sporocarpic species of Glomus (Endogonaceae) from South Australia.
Trans Br Mycol Soc 87:123–129
38 2 An Old Relationship

McGee PA, Trappe JM (2002) The Australian zygomycetous mycorrhizal fungi. II. Further
Australian sporocarpic Glomaceae. Aust Syst Bot 15:115–124
Mehrotra VS, Baijal U (1992) Glomus sterilum, a new species of VA-mycorrhiza isolated from
patato roots. Phillipp J Sci 121:305–316
Mehrotra VS (1997) Glomus bagyarajii sp. nov., a new species of Glomaceae (Glomales,
Zygomycetes) from India. Philipp J Sci 126:233–242
Miller DD, Walker C (1986) Glomus maculosum sp. nov. (Endogonaceae): an endomycorrhizal
fungus. Mycotaxon 25:217–227
Miller JS, Funk VA, Wagner WL, Barrie F, Hoch PC, Herendeen P (2011) Outcomes of the 2011
Botanical Nomenclature Section at the XVIII International Botanical Congress. PhytoKeys
5:1–3. doi:10.3897/phytokeys.5.1850
Morton JB (1986) Three new species of Acaulospora (Endogonaceae) from high aluminum, low
pH soils in west Virginia. Mycologia 78:641–648
Morton JB, Bever JD, Pfleger FL (1997) Taxonomy of Acaulospora gerdemannii and Glomus
leptotichum, synanamorphs of one anamorphic fungus in Glomales. Mycol Res 101:625–631
Morton JB (1990) Evolutionary relationships among arbuscular mycorrhizal fungi in the
Endogonaceae. Mycologia 82:192–207
Morton JB, Benny GL (1990) Revised classification of arbuscular mycorrhizal fungi (Zygomycetes):
a new order, Glomales, two new suborders, Glomineae and Gigasporineae, and two new fami-
lies, Acaulosporaceae and Gigasporaceae, with an emendation of Glomaceae. Mycotaxon
37:471–491
Morton JB, Koske RE (1988) Scutellospora dipurpurescens, a new species in the Endogonaceae
from West Virginia. Mycologia 80:520–524
Morton JB, Redecker D (2001) Two new families of Glomales, Archaeosporaceae and
Paraglomaceae, with two new genera Archaeospora and Paraglomus, based on concordant
molecular and morphological characters. Mycologia 93:181–195
Morton JB, Walker C (1984) Glomus diaphanum: a new species in the Endogonaceae common in
West Virginia. Mycotaxon 21:431–440
Mukerji KG, Bhattacharjee M, Tewari JP (1983) New species of vesicular-arbuscular mycorrhizal
fungi. Trans Br Mycol Soc 81:641–643
Nicolson TH, Gerdemann JW (1968) Mycorrhizal Endogone species. Mycologia 40:313–325
Nicolson TH, Schenck NC (1979) Endogonaceous mycorrhizal endophytes in Florida. Mycologia
71:179–198
Novas MV, Fracchia S, Menéndez A, Cabral D, Godeas A (2005) Glomus patagonicum sp. nov.
(Glomerales), a new arbuscular mycorrhizal fungus from Argentina. Nova Hedwigia 80:3–4
Oehl F, Sieverding E, Ineichen K, Mäder P, Wiemken A, Boller T (2009) Distinct sporulation
dynamics of arbuscular mycorrhizal fungal communities from different agroecosystems in
long-term microcosms. Agric Ecosyst Environ 134:257–268
Oehl F, Sieverding E (2004) Pacispora, a new vesicular arbuscular mycorrhizal fungal genus in the
Glomeromycetes. J Appl Bot 78:72–82
Oehl F, Wiemken A, Sieverding E (2003) Glomus spinuliferum, a new ornamented species in the
Glomales. Mycotaxon 86:157–162
Oehl F, Redecker D, Sieverding E (2005) Glomus badium, a new sporocarpic mycorrhizal fungal
species from European grasslands with higher soil pH. J Appl Bot Food Qual 7:38–43
Oehl F, Sýkorová Z, Redecker D, Wiemken A, Sieverding E (2006) Acaulospora alpina, a new
arbuscular mycorrhizal fungal species characteristics for high mountainous and alpine regions
of the Swiss Alps. Mycologia 98:286–294
Oehl F, de Souza FA, Sieverding E (2008) Revision of Scutellospora and description of five new
genera and three new families in the arbuscular mycorrhiza-forming Glomeromycetes.
Mycotaxon 106:311–360
Oehl F, Sieverding E, Ineichen K, Mäder P, Wiemken A, Boller T (2009) Distinct sporulation
dynamics of arbuscular mycorrhizal fungal communities from different agroecosystems in
long-term microcosms. Agric Ecosyst Environ 134:257–268
References 39

Oehl F, da Silva DKA, Maia LC, de Sousa NMF, Vieira HEE, da Silva GA (2011a) Orbispora gen.
nov., ancestral in the Scutellosporaceae (Glomeromycetes). Mycotaxon 116:161–169.
doi:10.5248/116.161
Oehl F, da Silva GA, Goto BT, Maia LC, Sieverding E (2011b) Glomeromycota: two new classes
and a new order. Mycotaxon 116:365–379
Oehl F, da Silva GA, Goto BT, Sieverding E (2011c) Glomeromycota: three new genera and glo-
moid species reorganized. Mycotaxon 116:75–120
Oehl F, da Silva GA, Goto BT, Sieverding E (2011d) New recombination in Glomeromycota.
Mycotaxon 117:429–434
Oehl F, da Silva GA, Sánchez-Castro I, Elísio H, Vieira E, Barea JM (2011e) Revision of
Glomeromycetes with entrophosporoid and glomoid spore formation with three new genera.
Mycotaxon 117:297–316
Oehl F, Sieverding E, Palenzuela J, Ineichen K, da Silva GA (2011f) Advances in Glomeromycota
taxonomy and classification. IMA Fungus 2:191–199
Palenzuela J, Ferrol N, Boller T, Azcón-Aguilar C, Oehl F (2008) Otospora bareai, a new fungal
species in the Glomeromycetes from a dolomitic shrub land in Sierra de Baza National Park
(Granada, Spain). Mycologia 100:296–305
Palenzuela J, Barea JM, Ferrol N, Azcon-Aguilar C, Oehl F (2010) Entrophospora nevadensis, a
new arbuscular mycorrhizal fungus from Sierra Nevada National Park (southeastern Spain).
Mycologia 102:624–632. doi:10.3852/09-145
Pfeiffer CM, Walker C, Bloss HE (1996) Glomus spurcum: a new endomycorrhizal fungus from
Arizona. Mycotaxon 59:373–382
Pirozynski KA, Dalpé Y (1989) Geological history of the Glomaceae with particular reference to
mycorrhizal symbiosis. Symbiosis 7:1–36
Pirozynski CA, Malloch DW (1975) The origin of land plants: a matter of mycotrophism.
Biosystems 6:153–164
Rani SS, Kunwas IK, Prasad GS, Manoharachary C (2004) Glomus hyderabadensis, a new species:
its taxonomy and phylogenetic comparison with related species. Mycotaxon 89:245–253
Redhead JF (1977) Endotrophic mycorrhizas in Nigeria: species of the Endogonaceae and their
distribution. Trans Br Mycol Soc 69:275–280
Redecker D, Morton JB, Bruns TD (2000) Molecular phylogeny of the arbuscular mycorrhizal
fungi Glomus sinuosum and Sclerocystis coremioides. Mycologia 92:282–285
Redecker D, Raab P, Oehl F, Camacho FJ, Courtecuisse R (2007) A novel clade of sporocarp-
forming species of glomeromycotan fungi in the Diversisporales lineage. Mycol Progr 6:35–44
Redecker D, Schüßler A, Stockinger H, Stürmer SL, Morton JB, Walker C (2013) An evidence-
based consensus for the classification of arbuscular mycorrhizal fungi (Glomeromycota).
Mycorrhiza 23:515–531. doi:10.1007/200572-013-0486-y
Renker C, Blaszkowski J, Buscot F (2007) Paraglomus laccatum comb. nov. – a new member of
Paraglomeraceae (Glomeromycota). Nova Hedwigia 84:395–407
Rose SL, Trappe JM (1980) Three new endomycorrhizal Glomus spp. associated with actinorhizal
shrubs. Mycotaxon 10:413–420
Rose S, Daniels BA, Trappe JM (1979) Glomus gerdemannii sp. nov. Mycotaxon 8:297–301
Rothwell FM, Trappe JM (1979) Acaulospora bireticulata sp. nov. Mycotaxon 8:471–475
Rothwell FM, Victor BJ (1984) A new species of Endogonaceae: Glomus botryoides. Mycotaxon
20:163–167
Schenck NC, Smith GS (1982) Additional new and unreported species of mycorrhizal fungi
(Endogonaceae) from Florida. Mycologia 77:566–574
Schenck NC, Spain JL, Sieverding E, Howeler RH (1984) Several new unreported vesicular-
arbuscular mycorrhizal fungi (Endogonaceae) from Colombia. Mycologia 76:685–699
Schenck NC, Spain JL, Sieverding E (1986) A new sporocarpic species of Acaulospora
(Endogonaceae). Mycotaxon 25:111–117
Schultz PA, Bever JD (1999) Acaulospora colossica sp. nov. from an old field in North Carolina and
morphological comparisons with similar species, A. laevis and A. koskei. Mycologia 91:676–683
40 2 An Old Relationship

Schüßler A, Walker C (2010) The Glomeromycota: a species list with new families. Arthur
Schüßler & Christopher Walker, Gloucester. Published in December 2010 in libraries at The
Royal Botanic Garden Edinburgh, The Royal Botanic Garden Kew, Botanische Staatssammlung
Munich, and Oregon State University. Printed copy available under ISBN-13: 978-1466388048,
ISBN-10: 1466388048. http://www.amf-phylogeny.com
Schüßler A (2002) Molecular phylogeny, taxonomy, and evolution of arbuscular mycorrhiza fungi
and Geosiphon pyriformis. Plant Soil (in press)
Schüßler A, Schwarzott D, Walker C (2001) A new fungal phylum, the Glomeromycota: phylog-
eny and evolution. Mycol Res 105:1413–1421
Sieverding E (1987) A va-mycorrhizal fungus, Glomus glomerulatum sp. nov., with two hyphal
attachments and spores formed only in sporocarps. Mycotaxon 29:73–79
Sieverding E (1988) Acaulospora splendida, a new species in the Endogonaceae from Costa Rica.
Mycotaxon 33:251–256
Sieverding E, Oehl F (2006) Revision of Entrophospora and description of Kuklospora and
Intraspora, two new genera in the arbuscular mycorrhizal Glomeromycetes. J Appl Bot Food
Qual 80:69–81
Sieverding E (2008) Mycorrhizae and water management in crops, lawn and turf. Land 8:14–16
Sieverding E, Toro S (1987) Entrophospora schenckii: a new species in the Endogonaceae from
Colombia. Mycotaxon 28:209–214
Simon L, Lalonde M, Bruns TD (1992) Specific amplification of 18s fungal ribosomal genes from
vesicular arbuscular endomycorrhizal fungi colonizing roots. Appl Environ Microbiol
58:291–295
Simon L, Bousquet J, Levesque RC, Lalonde M (1993) Origin and diversification of endomycor-
rhizal fungi and coincidence with vascular plants. Nature 363:67–69
Sinclair RC, van Greuning JV, Eicker A (2000) A new species of sporocarpic Glomales from South
Africa. Mycotaxon 74:337–342
Skou JP, Jakobsen I (1989) Two new Glomus species from Arable land. Mycotaxon 36:273–282
Smith GS, Schenck NC (1985) Two new dimorphic species in the Endogonaceae: Glomus ambispo-
rum and Glomus heterosporum. Mycologia 77:566–574
Souza FA, Silva ICL, Berbara RLL (2008) Fungos micorrízicos arbusculares: muito mais diversos
do que se imaginava. In: Moreira FMS, Siqueira JO, Brisssard L (eds) Biodiversidade do solo
em ecossistemas brasileiros. Universidade Federal de Lavras, Lavras, pp 483–536
Spain JL, Miranda JC (1996a) Glomus brasilianum: an ornamented species in the Glomaceae.
Mycotaxon 60:137–142
Spain JL, Miranda JC (1996b) Scutellospora cerradensis: an ornamented species in the
Gigasporaceae (Glomales) from the Cerrado Region of Brazil. Mycotaxon 60:129–136
Spain JL, Sieverding E, Schenck NC (1989a) Gigaspora ramisporophora: a new species with
novel sporophores from Brazil. Mycotaxon 34:667–677
Spain JL, Sieverding E, Toro ST (1989b) Scutellospora biornata: a new species in the Endogonaceae
from the Llanos Orientales of Colombia. Mycotaxon 35:219–227
Spain JL, Sieverding E, Oehl F (2006) Appendicispora: a new genus in the arbuscular mycorrhiza-
forming Glomeromycetes, with a discussion of the genus Archaeospora. Mycotaxon 97:163–182
Stürmer SL, Morton JB (1999) Scutellospora rubra, a new arbuscular mycorrhizal species from
Brazil. Mycol Res 103:949–954
Sward RJ, Hallam ND, Holland AA (1978) Endogone spores in a heathland area of Southeastern
Australia. Austr J Bot 26:29–43
Tandy PA (1975) Sporocarpic species of Endogonaceae in Australia. Austr J Bot 23:849–866
Tang ZJ, Zang M (1984) A supplement to the manual of Endogonaceae and a new species, Glomus
citricolum. Acta Bot Yunnanica 6:295–304
Thaxter R (1922) A revision of the Endogonaceae. Proc Am Acad Sci Arts 89:291–350
Trappe JM (1977) Three new Endogonaceae: Glomus constrictus, Sclerocystis clavispora, and
Acaulospora scrobiculata. Mycotaxon 6:359–366
Trappe JM (1979) Glomus segmentatus sp. nov. Trans Br Mycol Soc 73:362–363
2 An Old Relationship 41

Trappe JM, Bloss HE, Menge JA (1984) Glomus deserticola sp. nov. Mycotaxon 20:123–127
Taylor TN, Remy W, Hass H, Kerp H (1993) Fossil arbuscular mycorrhizae from early Devonian.
Mycologia 87:560–573
Tortora GJ, Funke BR, Case CL (2003) Microbiologia, 6th edn. Artemd, Porto Alegre
Tulasne LR, Tulasne C (1844) Fungi nonnulli hypogaei, novi v. minus cogniti auct. Giron Bot Ital
2:55–63
Velazquez MS, Cabello M, Irrazabal G, Godeas A (2008) Acaulosporaceae from El Palmar
National Park, Entre Ríos, Argentina. Mycotaxon 103:171–187
Walker C (1982) Species in the Endogonaceae: a new species (Glomus occultum) and a new com-
bination (Glomus geosporum). Mycotaxon 15:49–61
Walker C (1983) Taxonomic concepts in the Endogonaceae: spore wall characteristics in species
descriptions. Mycotaxon 18:443–455
Walker C (2007) Ambispora and Ambisporaceae resurrected. Mycol Res 112:297–298
Walker C, Diederichs C (1989) Scutellospora scutata sp. nov., a newly described endomycorrhizal
fungus from Brazil. Mycotaxon 35:357–361
Walker C, Rhodes L (1981) Glomus albidus: a new species in the Endogonaceae. Mycotaxon
12:509–514
Walker C, Schüßler A (2004) Nomenclatural clarifications and new taxa in the Glomeromycota.
Mycol Res 108:981–982
Walker C, Trappe JM (1981) Acaulospora spinosa sp. nov. with a key to the species of Acaulospora.
Mycotaxon 12:515–521
Walker C, Reed LE, Sanders FE (1984) Acaulospora nicolsonii, a new Endogonaceae species from
Great Britain. Trans Br Mycol Soc 83:360–364
Walker C, Pfeiffer CM, Bloss HE (1986) Acaulospora delicata sp. nov.—an endomycorrhizal
fungus from Arizona. Mycotaxon 25:621–628
Walker C, Gianinazzi-Pearson V, Marion-Espinasse H (1993) Scutellospora castanea, a newly
described arbuscular mycorrhizal fungus. Cryptogamie Mycol 14:279–286
Walker C, Giovannetti M, Avio L, Citernesi AS, Nicolson TH (1995) A new fungal species form-
ing arbuscular mycorrhizas: Glomus viscosum. Mycol Res 99:1500–1506
Walker C, Cuenca G, Sánchez F (1998) Scutellospora spinosissima sp. nov., A newly described
Glomalean fungus from acidic, low nutrient plant communities in Venezuela. Ann Bot
82:721–725
Walker C, Vestberg M, Demircik F, Stockinger H, Saito M, Sawari H, Nishmura I, Schüßler A
(2007a) Molecular phylogeny and new taxa in Archaeosporales (Glomeromycota): Ambispora
fennica gen. sp. nov., Ambisporaceae fam. nov., and emendation of Archaeospora and
Archaeosporaceae. Mycol Res 111:137–153
Walker C, Vestberg M, Schüßler A (2007b) Nomenclatural clarifications in Glomeromycota.
Mycol Res 111:253–256
Wang FY, Liu RJ (2002) Arbuscular mycorrhizal fungi in saline-alkaline soils of the Yellos River
Delta. Mycosystema 21:196–202
Wang B, Yeun LH, Xue J-Y, Liu Y, Ane J-M, Qiu Y-L (2010) Presence of three mycorrhizal genes
in the common ancestor of land plants suggests a key role of mycorrhizas in the colonization of
land by plants. New Phytol 186:514–525
Wu CG, Chen ZC (1986) The Endogonaceae of Taiwan. I. A preliminary investigation on
Endogonaceae of bamboo vegetation at Chitou areas, central Taiwan. Taiwania 31:65–87
Wu CG, Chen ZC (1987) The Endogonaceae of Taiwan. II. Two new species of Sclerocystis from
Taiwan. Trans Mycol Soc Rep China 2:73–83
Wu C-G, Liu Y-S, Hwuang Y-L, Wang Y-P, Chao C-C (1995) Glomales of Taiwan: V. Glomus
chimonobambusae and Entrophospora kentinensis, spp. nov. Mycotaxon 53:283–294
Zhang MQ, Wang YS (1997) Glomus dolichosporum, a new species of Glomales from Southern
China. Mycosystema 16:241–243
Chapter 3
AMF’s Main Structures

Abstract In this chapter I discuss about the AMF main structures. So, I introduce
you the main structures of arbuscular mycorrhizal fungi, like: hyphae, arbuscules,
vesicles, and auxiliary cells, as well as, the development of the symbiosis, how does
it work, and the main abiotic and biotic factors that can mediate the development of
the mycorrhiza. The development of the symbioses begins with the spore germina-
tion (Asymbiotic phase) because spore germination does not depend of the host
plant. It depends of biotic and abiotic favorable conditions to occur like: moisture,
temperature, pH, mineral nutrients level, organic matter, soil microorganisms, and
pollutants action. Pre-symbiotic phase starts even before physical contact between
symbionts, where both AMF species and host plants start to exchange chemical and
molecular signals, and its success is very dependent of soil properties (e.g., pH,
moisture and temperature), and the host plant (e.g., root exudates, like flavonoids,
CO2, and unknown ramification factors). After to establish physical contact with
root surface, extraradical hyphae differentiate in appressorium, and here starts the
Symbiotic phase. Once into root, AMF are able to develop extra- and intraradical
hyphae, arbuscules, vesicles, auxiliary cells, and spores.

Keywords Mycorrhiza development • Mycorrhizal symbiosis • Mutualist

dynamics

3.1 Introduction

AMF are unable to growth and to reproduce without a symbiotic association with a
host plant (grasses and some legumes). The spore germination process taking place
in an aqueous medium (Chabaud et al. 2006; Ellouze et al. 2012) without requiring
the presence or activity of the host plant during asymbiotic phase, AMF needs to
colonize the roots of a vascular plant to complete their life cycle (Brundrett 2004),
and there are no reports of spores or vesicles formation in an aqueous or culture
media (e.g., DBA) as occurs in other fungi (Ascomycota or Basidiomycota)
(Kiriacheck et al. 2009).
There are plenty of opportunities for AMF to establish an association with a
vascular plant in nature; but in laboratory conditions, there are a few methods
that allow studying their biology (Redecker et al. 2000). The growth characteristics

© Springer International Publishing Switzerland 2015 43

T. Souza, Handbook of Arbuscular Mycorrhizal Fungi,
DOI 10.1007/978-3-319-24850-9_3
44 3 AMF’s Main Structures

presented by the AMF, as filamentous habit, and hyphae formation by germ tubes
from growing spores is unique in the Fungi Kingdom. These unique features pro-
vide them indefinite growth capacity, since the host plant makes available the
resources to needed for the AMF growth, as carbon. Another distinctive feature of
these fungi is related with their reproduction mode. Spores are formed asynchro-
nously with the mycorrhizal colonization process, in a kind of clonal reproduction
(Schüßler et al. 2001).
So, in this chapter I will introduce you to the main AMF structures, their forma-
tion and function. I will also discuss about the phases of symbiotic association
(Asymbiotic, Pre-symbiotic, and Symbiotic) and how soil factors influence them.

3.2 Main Structures

Phylum Glomeromycota encompasses an enormous diversity of structures with var-

ied origins, morphologies, and functions (Schüßler and Walker 2010), which are
grouped in four Classes, eleven Families, 25 Genus, and 234 described AMF spe-
cies. We can observe hyphae growing inside- and outside roots, with spores, vesi-
cles, and arbuscules assuming different forms (Redecker et al. 2013).
These structures are fundamental to mycorrhizal colonization, and to understand
how they work is essential for any graduate student that aims to initiate their study.
So, I divided this section accordingly with the main structures characteristics of
AMF (Intraradical hyphae, extraradical hyphae, arbuscules, vesicles, auxiliary cells
and spores), and I explain in detail their origin, morphology, and function. I also
provide some examples of AMF species and their structures.

3.2.1 Intraradical Hyphae (IH)

They are originated during the beginning of the symbiotic phase from the appres-
sorium cells with limited growth (Kiriacheck et al. 2009). IH form the infection
unit (colonization), and their length are determined by host-AMF interaction
(Ramos et al. 2008a, b, c). Hyphae cells are composed by coenocytic mycelia, cell
wall, mitochondrion, vacuoles, ergosterol crystal, ribosomes, nuclei, endoplasmic
reticulum, lipid bodies, plasma membrane, spitzenkörper and Golgi apparatus
(Cruz et al. 2008).
Intraradical hyphal are able to transfer nutrients, metabolites and water from the
outside to the root cortex of the host plant, and to exchange these substances for
energetic resources, like hexoses (a very important substrate to AMF nutrition)
(Ramos et al. 2008a, b, c). Once inside the cortical zone IH can differentiate into
vesicles (e.g., Funneliformis mosseae), arbuscules (e.g., Funneliformis mosseae) or
spores (e.g., Rhizophagus intraradices) (Berbara et al. 2006; Al-Qarawi et al. 2013).
3.2 Main Structures 45

3.2.2 Extraradical Hyphae (EH)

They are originated during the pre-symbiotic phase, in one of two moments: (1)
after chemical and molecular exchange between the symbionts from the sporofitic
hyphae; or (2) after establishment of mycorrhizal colonization from appressorium
cells (Cruz et al. 2008; Ramos et al. 2009a). EH have unlimited growth, being able
to expand beyond the rhizosphere zone; however, their growth is determined by soil
factors (e.g., pH, and available P), and peculiarities of the host-plant interaction
(Host-AMF pairing specify, root growth, or digestion of old hyphae in root cells)
(Ramos et al. 2008a, b, c; Kiriacheck et al. 2009).
EH cells are similar to IH cells in terms of composition, with just one morpho-
logical difference: their cell walls are wider than IH cells, providing them with the
capacity to support the stresses from the soil microorganisms (Cruz et al. 2008).
Basically, they are divided in three forms accordingly with their functions (infec-
tion, absorption, and reproduction).
• Infective EH: After spore germination, these cells are able to growth from the
soil to the root surface. Here, the differentiation of the appressorium cells may
take place and preceed the symbiotic phase; depending of the AMF species, they
may have higher or lower infectivity rates. Redecker et al. (2013) reported that
infective propagules of Glomeraceae and Acaulosporaceae (fragments of EH
attached to roots) from host-plant bioassays are more infective than the
Gigasporaceae if in the same soil conditions;
• Absorptive EH: They originate from the appressorium cells, and are able to
increase the nutrients uptake and increase the movement of nutrients from EH to
the host-plant via IH (Cruz et al. 2008);
• Reproductive EH: After colonization, reproductive EH cells are able to produce
new spores in soil surface (e.g., Glomus macrocarpum), into soil (e.g., Funneliformis
caledonium), singly (e.g., Gigaspora margarita), in clusters or forming sporocarps
(Slerocystis coremioides) and auxiliary cells (e.g., Gigaspora and Scutellospora)
(Berbara et al. 2006; Schüßler and Walker 2010; Redecker et al. 2013).

3.2.3 Arbuscules

Arbuscules are originated from IH and are formed within the root cortex cell
(Fig. 3.1). They can occur sporadically along the roots, but in some cases arbuscules
may occur growing nearly from an entry point (Schüßler and Walker 2010).
Arbuscules can assume one of two types of colonization patterns: Arum (Linear
AMF)—mycorrhizal associations that spread predominantly by intercellular hyphae
in roots; and Paris (Coiling AMF)—mycorrhizal associations that spread predomi-
nantly by intracellular hyphal coils within roots (Brundrett 2004). Basically, these
structures are intricately branched haustoria that look like little trees, and are con-
sidered the most important site of exchange between the fungus and host plant
(Sena et al. 2004).
46 3 AMF’s Main Structures

Fig. 3.1 Arbuscules formation process

Their formation occurs 2 days after root colonization, i.e., during the symbiotic
phase and hyphal growth (Brundrett et al. 1985), but in host-plant bioassays, they
require a longer period of time compared to other structures (Walker 1983). Another
distinctive characteristic of the arbuscule is their limited life time, they begin to col-
lapse after a few days, but hyphae and vesicles can remain in roots for months or
even years (Brundrett et al. 1985).
Under greenhouse conditions, host plants colonized by species of Gigasporaceae
begin to show arbuscules after the third month of inoculation (Walker 1983). In spe-
cies of the Order Glomerales their formation occurs between the second and third
month after inoculation (Oehl et al. 2008). Arbuscules morphology also differs
among AMF species. We can observe arbuscules like an intracellular winding (e.g.,
Scutellospora), “clouds” format (e.g., Glomus), or staining weakly in the presence
of acid reagents (e.g., Acaulospora and Paraglomus) (Schüßler and Walker 2010).

3.2.4 Vesicles

They are originated from IH in their terminal or intercalary position, within or

between root cells. Vesicles have a very thin wall layer, especially in old roots,
assuming globular, oblong, irregular lobed or rough format (e.g., Glomus, Pacispora,
Acaulospora and Entrophospora respectively) (Redecker et al. 2013).
Vesicles do not occur in some genus from the Order Diversisporales, such as
Gigaspora and Scutellospora. They play an important role in nutrient storage, since
their cells contain high levels of lipids and glycogen; but in some cases they might
assume a reproductive function, because vesicles may form spores that act as propa-
gules (Berbara et al. 2006).
Vesicles formation process depends on the AMF species. For some species, ves-
icles formation occurs very early after symbiotic phase establishment, while for
other it occurs at the same time of sporulation, or even after the formation of the first
arbuscules (Dalpé et al. 2005). Usually, they can remain in roots for months or years
3.2 Main Structures 47

(e.g., Funneliformis), and their number increases considerably after proliferation.

Schüßler (2000) reported that in older roots (70–90 days in culture) in bioassays
with host plants, it was observed the presence of many vesicles and IH, but few
arbuscules.

3.2.5 Auxiliary Cells (AC)

Auxiliary cells are formed from the EH and their formation occurs only for some
species of the Order Diversisporales (Redecker et al. 2013). They present thin cell
walls and can be found singly or forming clusters outside roots (Morton and Benny
1990). AC are often ornamented by spines (e.g., Gigaspora albida) or knobby (e.g.,
Scutellospora pellucida) (Schüßler et al. 2001). There are no studies reporting them
as propagules, thus assuming a reproductive function, but accordingly with Morton
and Benny (1990), AC have nutritional and storage functions.

3.2.6 Spores

Spores can be originated from EH, IH or vesicles (Ramos et al. 2008a, b, c;

Kiriacheck et al. 2009). They are asexual spherical structures, and are the main
survival units presented by AMF (Gerdemann and Nicolson 1963). Their formation
might take plant in the soil surface (e.g., Glomus), into soil (e.g., Funneliformis),
roots (e.g., Rhizophagus), singly (e.g., Gigaspora), forming clusters (e.g.,
Diversispora) and sporocarps (e.g., Sclerocystis) (Giovannetti et al. 1999; Schüßler
and Walker 2010; Redecker et al. 2013). Usually, AMF spores develop thick walls
with more than one layer and function as propagules. They can also be encased in a
peridium as in Sclerocystis sp. (Walker 1983; Schüßler et al. 2001; Oehl et al. 2008).
They may be metabolic quiescent or active, and this status is modulate by several
factors, like favorable abiotic or biotic conditions (Siqueira et al. 1985a, b; Spain
et al. 2006). AMF spores are formed by lipids, cytoplasm, and many nuclei. Their
morphology varies greatly between species: AMF spores are thick-walled, multi-
nucleate, assuming globose, subglobose or irregular formats, several colors (hya-
line, white, pale, yellow, red, pink, brown, or dark), and sizes (ranging to 22 from
1000 μm diameter) (Dalpé et al. 2005; Souza et al. 2005; Goto and Maia 2006; Oehl
et al. 2008; Redecker et al. 2013).
The AMF spore formation process usually occurs within 3–4 weeks after the
mycorrhizal colonization starts (Berbara et al. 2006). In bioassay conditions with
host plants, it was demonstrated that the sporulation finishes with the root growth
(e.g., Acaulosporaceae and Glomeraceae). AMF spore is assumed as active, i.e.,
infectious, since it forms one or more germ tubes (e.g., Gigaspora species) (Smith
et al. 1985).
To summarize my explanation about AMF structures, Table 3.1 provide a brief
description of each structure.
48 3 AMF’s Main Structures

Table 3.1 Main AMF structures described in Glomeromycota species

Staining
Genusa Vesicles Intraradical hyphae Auxiliary cells intensityb
Acaulospora Irregular Straight or coiled Absent Weakly
and lobed
Ambispora Present Straight, coiled or inflated Absent Weakly
Archaeospora Absent Y-shape connections Absent Weakly
Diversispora Globose H-shape connections Absent Weakly
Entrophospora Rough Straight or coiled Absent Weakly
Funneliformis Globose H-shape connections Absent Darkly
Gigaspora Absent Straight or coiled Smooth or warty, Darkly
spines ornamentation
Glomus Globose H-shaped connections Absent Darkly
Claroideoglomus Globose H-shaped connections Absent Darkly
Otospora Globose Straight, H- or Y-shaped Absent Darkly
connections
Pacispora Oblongs or Straight, H- or Y-shaped Intra- and Darkly
ellipsoids connections extraradical; Warty
Paraglomus Absent Straight or coiled with Absent Weakly
H-shaped connections
Racocetra Absent Straight or inflated Smooth or warty Darkly
Rhizophagus Globose H-shaped connections Absent Darkly
Scutellospora Absent Straight or coiled Smooth or warty, Darkly
with knobby
ornamentation
Sclerocystis Globose H-shaped connections Absent Darkly
a
Accordingly with the classification proposed by Schüßler and Walker (2010)
b
With acid reagents

3.3 Development of the Symbiosis

The development of the symbiosis begins with spore germination (Siqueira et al.
1985a, b). Accordingly with Mosse (1956, 1959) and Siqueira (1983), this phase is
considered to be the Asymbiotic phase, because spore germination does not depend
on the host plant. Instead, it depends on biotic and abiotic favorable conditions to
occur. These include appropriate moisture levels, temperature, pH, mineral nutri-
ents levels, organic matter, soil microorganisms and pollutants action (Dalpé et al.
2005; Juge et al. 2002; Ramos et al. 2008a, b, c; Bartolome-Estebán and Schenck
1994; Lambais 2006; Bais et al. 2006; Besserer et al. 2006; Tamasloukht et al. 2003;
Bécard et al. 2004; Bianciotto et al. 2004; Bonfante 2003; Verdin et al. 2006).
Although spore germination occurs without the need of the host plant, if AMF
mycelium does not find a root to establish the symbiosis relationship, the AMF
species will not complete its life cycle (Oehl et al. 2008; Gamper et al. 2009).
Even before physical contact between symbionts, both AMF species and host
plants start to exchange chemical and molecular signals (Siqueira et al. 1985a, b;
Lambais 2006; Kiriacheck et al. 2009). This constitutes the Pre-symbiotic phase and
its success is very dependent on two conditions: (1) soil properties (e.g., pH, moisture
3.3 Development of the Symbiosis 49

and temperature), and (2) the host plant (e.g., root exudates, like flavonoids, CO2, and
unknown ramification factors) (Buee et al. 2000; Besserer et al. 2006, and Zsögön
et al. 2008). These conditions are able to change AMF metabolism, thus stimulating
mycelium growth and hyphae ramification (Buee et al. 2000; Campelli et al. 2005;
Requena et al. 2007).
After to the establishment of physical contact with the root surface, extraradical
hyphae cells differentiate in appressorium cells, and the Symbiotic phase starts
(Brundrett 2004; Ramos et al. 2009a, b; Kiriacheck et al. 2009). Appressorium are
specialized structures that play an extremely important role in the penetration of
root epidermis by the intraradical hyphae (Cruz et al. 2008; Ramos et al. 2009a, b).
Once inside the root, AMF are able to develop both extra- and intraradical hyphae
(Lanfranco et al. 2005), however this is highly dependent on the nutritional status of
the host plant (Endre et al. 2002; Madsen et al. 2003; Radutoiu et al. 2003).
In order to explain in more details each of these three phases below, I explain
them step by step, and discuss how each phase works, their main events, and show
what factors can mediate plant-AMF pairing process.

3.3.1 Asymbiotic Phase

Basically, this phase begins when AMF spore find favorable conditions, like adequate
soil moisture levels or/and soil pH (Daniels and Graham 1976; Siqueira et al. 1985a,
b). AMF spores have enough metabolites and genetic information to initiate spore
germination and hyphal growth (Dalpé et al. 2005). When the germination process is
activated, several chain events will lead to the development of the germ tube and initial
AMF mycelium (Fig. 3.2). The development of the germ tube and initial AMF

Fig. 3.2 Main events of asymbiotic phase

50 3 AMF’s Main Structures

mycelium growth can be performed in laboratory conditions, by using agar-water cul-

ture medium after a few days of inoculation (Maia and Yano-Melo 2001), however, if
the AMF mycelium does not find a root to colonize, it will be unable to complete its
life cycle and hyphal senescence takes place (Oehl et al. 2008; Gamper et al. 2009).
When the AMF spore finds favorable conditions, the uptake of water and nutri-
ents from the soil takes place, and consequently, its volume increases (Siqueira et al.
1985a, b). Simultaneously, the synthesis of metabolites, such as RNA, proteins,
amino acids, carbohydrates, organic acids, lipids and polysaccharides are increased,
and their cell content is highly improved (Spain et al. 2006). At this moment, the
spore metabolism is totally altered and nuclear division and vesicles production
increase. Cytoplasmic movement is also improved and the metabolites produced are
storaged near the place where the germ tube will be originated (Bécard et al. 2004).
Germ tube emergence is aided by a large physical pressure between the spore walls
and the germ tube itself (Tommerup and Kidby 1980; Oehl and Sieverding 2004).
Depending on the AMF species, the emergence of the germ tube may occur in
three different ways:
• From peripheral components: it usually occurs species from the genus Ambispora
(acaulosporoid form), Cetraspora, Pacispora, Racocetra, and Scutellospora, in
which the germ tube emerges from a germination shield (Spain 1992; Spain et al.
2006; Oehl and Sieverding 2004; Oehl et al. 2008). For Acaulospora spp. and
Entrophospora spp. the germ tube may emerge from pre-germination orb
(Hepper 1984a, b; Sieverding and Oehl 2006; Spain et al. 2006);
• From spore wall: it occurs in Gigaspora spp. and Glomus spp., and the germ tube
emerges directly from the spore wall (Godfrey 1957; Mosse 1959; Siqueira et al.
1982, 1985a, b; Tommerup and Kidby 1980);
• From subtending hyphae: the emergence of germ tube may occur from the basal
septum of subtending hyphae. It generally occurs in Ambispora spp. (glomoid
form), Archaeospora spp., Glomus spp. and Paraglomus spp. (Daniels and
Graham 1976; Siqueira et al. 1985a, b; Spain et al. 2006).
From the germ tube it is produced the initial asymbiotic mycelium, which has
limited growth (Dalpé et al. 2005). This initial mycelium is composed by: granular
cytoplasm, several nuclei and vacuoles (that storage high quantity of polyphos-
phate) (Bécard et al. 2004). Lipids, glucose and fructose are consumed to form tre-
halose and amino acids like arginine and glutamine during germ tube formation
(Kuga et al. 2008), but accordingly with Trépanier et al. (2005), AMF are able to
produce their own lipids only during the symbiotic phase and just if the host-plant
mediates the process (Dalpé et al. 2005). Thus, if the AMF initial mycelium does
not find a root to colonize before the consumption of all lipid content, it will unable
to complete its life cycle, leading to hyphal senescence with septum formation and
autolysis (Oehl et al. 2008; Gamper et al. 2009). On the contrary, if the contact with
plant roots is established, the pre-symbiotic phase starts.
3.3 Development of the Symbiosis 51

3.3.2 Pre-symbiotic Phase

This phase starts when the contact with plant roots and AMF initial mycelium is
established (Siqueira et al. 1985a, b; Lambais 2006; Kiriacheck et al. 2009), how-
ever even before the physical contact between AMF and host plant, the host plants
produces ramification factors that will help asymbiotic mycelium growth until its
root surface (chemotropism) (Zsögön et al. 2008). Buee et al. (2000) and Besserer
et al. (2006) described these ramification factors (RF) as flavonoids, CO2, and
5-desoxiestrigol. The last one is very important in altering AMF metabolism, thus
increasing mitochondrial multiplication, respiration, lipids catabolism, and ATP
synthesis (Besserer et al. 2006; Ramos et al. 2008a, b, c). Available phosphorous
also acts as a RF (Tawaraya et al. 1998), however, it is an edaphic factor, whose
effect on pre-symbiotic phase is mediated by host-plant nutritional status (Ramos
et al. 2009a, b). Thus, it can be concluded that pre-symbiotic phase is very depen-
dent on the host plant, and without it this phase does not occur.
As asymbiotic phase, it is activated by several chain events (Fig. 3.3), which
are mediated by biotic and abiotic factors, like moisture, temperature, strigolac-
tones, pH, [Ca2+], [K+], [Cl−], [H+], RF, and the host plant nutritional status

Fig. 3.3 Main events occurring during pre-symbiotic phase

52 3 AMF’s Main Structures

(Buee et al. 2000; Campelli et al. 2005; Requena et al. 2007). These factors are
important to depolarize AMF cell membrane, and activate specific genes that will
activate lipids catabolism, protein synthesis (Gin1 and P14-3-3) and regulate electro-
chemical potential (Requena et al. 2007; Porcel et al. 2006; Ramos et al. 2008a, b, c).
Pre-symbiotic phase begins when the asymbiotic mycelium starts growing ori-
ented to the root surface (Zsögön et al. 2008). This growth is activated after the
production and liberation of RF by the host plant. Flavonoids, organic acids, CO2
and other root exudates are important activators of the chemotropism, of the H+
efflux, and to depolarize AMF cell membrane creating then a membrane potential
(Siqueira 1983; Tsai and Philips 1991; Sbrana and Giovannetti 2005). But these
changes in the AMF metabolism are not enough to supply all the energy that AMF
requires to growth towards the root surface (Campelli et al. 2005).
Additionally, lipids catabolism and protein synthesis provide energy to
AMF. These processes are activated when strigolactones’ concentration are high in
the rhizosphere (e.g., 5-desoestrigol) (Akiyama et al. 2005). Strigolactones provoke
changes and improve mitochondrial activity, respiration, lipids catabolism and pro-
tein synthesis (e.g., Gin1 and P14-3-3) (Besserer et al. 2006). For example Gin1 is
able to interact with membrane proteins and amplify nuclei molecular signals
(Requena et al. 2002, 2003, 2007). P14-3-3 is able to improve the activity of ATPase,
ionic channels, and increase the H+ efflux generating a great amount of energy and
an electrochemical gradient (Porcel et al. 2006; Ramos et al. 2009a, b).
The electrochemical gradient created is fundamental to improve cations influx
(Ca2+, K+), glucose and inorganic phosphorous uptake (Porcel et al. 2006; Ramos
et al. 2009a, b). In addition, ATP is synthetized, inorganic phosphorous is stored
into vacuoles in the form of polyphosphate, and mycelium growth is increased
(Requena et al. 2003; Ramos et al. 2008a, b, c, 2009a, b). During the physical
contact between AMF mycelium and the plant roots, AMF cells start producing myc
factors that will initialize appressorium formation and give plant to the symbiotic
phase. Myc production may occur by two ways: (1) its production is DMI1-
dependent, and starts near the contact point; or (2) its production is diffusion-
dependent (DMI independent), and starts distant from the contact point (Tamasloukht
et al. 2003; Lanfranco et al. 2005).

3.3.3 Symbiotic Phase

Symbiotic phase starts when AMF mycelium establishes contact and starts to grow
along the root surface (Ramos et al. 2009a, b). Here, the hyphae produce myc factors
and their cells differentiate into appressorium (Lanfranco et al. 2005). Appressorium are
formed between epidermal cells and root penetration starts when they penetrate the

1
DMI (does not make infection)—required gene to start symbiotic phase.
3.3 Development of the Symbiosis 53

Table 3.2 Gene functions Gene Function

activated during the
CASTOR Increases protein synthesis in plastids
symbiotic phase
Actives calcium channels
CYCLOPS Actives unknown molecular signals
Actives coiling-AMF growth
DMI Actives appressorium formation
Actives molecular signals
Actives calcium channels
Mycorrhizal development
Protein synthesis
Enzymes synthesis
Nup AMF nuclei component
SYMRK Arbuscules formation
Leucine synthesis
Actives calcium channels

epidermal tissue to enter the root (Brundrett 2004). After root penetration, appressorium
cells differentiate in intra- and extraradical hyphal (Cruz et al. 2008). Intraradical hyphal
cross the hypodermis and start branching in the outer cortex, while extraradical hyphal
start growing beyond plant root zone (Kiriacheck et al. 2009).
Basically, these processes are mediated by five genes: DMI, SYMRK, CASTOR,
Nup, and CYCLOPS. They are responsible for active appressorium formation, root
penetration, mycorrhiza development, channel activation, molecular signals, pro-
tein synthesis, arbuscules formation, Ca2+ uptake, and enzyme activity (Table 3.2;
Endre et al. 2002; Stracke et al. 2002; Madsen et al. 2003; Radutoiu et al. 2003;
Yoshida and Parniske 2005; Lambais and Takahashi 2006; Kiriacheck et al. 2009).
Based on gene function, Yoshida and Parniske (2005) proposed four categories
of host plants:
• Myc− Type 0: Host plants are unable to stimulate initial mycelium growth;
• Myc− Type I: Host plants stimulate initial mycelium growth during pre-symbiotic
phase, but they prevent appressorium formation;
• Myc− Type II: Appressorium formation occur, but the host plant prevents intra-
and extraradical hyphal growth;
• Myc− Type III: Host plant prevents arbuscule formation.
Symbiosis phase is characterized for molecular signals that will the root coloni-
zation, and arbuscules formation (Kiriacheck et al. 2009). This phase is mediated by
host-plant nutritional status and activity of specific genes, and again, AMF is not
able to complete its life cycle without the host plant, and hyphal senescence takes
place (Fig. 3.4; Endre et al. 2002; Madsen et al. 2003; Radutoiu et al. 2003).
In order to summarize all processes taking place during asymbiotic, pre-
symbiotic and symbiotic phases, a brief outline from spore germination to arbus-
cules formation and symbiosis establishment is present below (Fig. 3.5).
54 3 AMF’s Main Structures

Fig. 3.4 Main events occurring during the symbiotic phase

Quiescent
AMF spore
Spore
Sporulation germination

Extrara dical As Initial

ym
mycelium bi mycelium
ot
development ic development

AMF’s
Intrara dical life cycle
Symb

mycelium Chemotropism
development activated
ic
iotic

ot
bi
ym
e-s
Pr

Physical
Symbiosis contact
establisment with root

Root Appressorium
colonization formation

Fig. 3.5 Major processes during of AMF life cycles

3.5 How Does the Symbiosis Work? 55

3.4 Abiotic and Biotic Factors

AMF quiescent spores are found spread across a variety of soils and ecosystems,
and their germination is mediated by favorable abiotic and biotic factors. Many
studies have attempted to investigate how these factors affect mycorrhizal associa-
tion, mycelium growth and sporulation (Siqueira et al. 1985a, b; Maia and Yano-
Melo 2001; Trépanier et al. 2005; Kuga et al. 2008).
Chemical, physical and biological conditions of the soil, such as temperature,
moisture level, luminosity, pH, mineral nutrients, salinity, organic acids, biomole-
cules, microorganism activities, among others, have the potential to (1) affect the
development of the symbiosis development, and (2) to help the AMF to complete
their life cycle. Below, I summarize the conditions, required ranges, and effects of
abiotic and biotic factors on specific AMF genus (Table 3.3).

3.5 How Does the Symbiosis Work?

After introduce to you the main AMF structures, symbiosis phases, and the abiotic
and biotic factors required for the association between AMF and the host plant, it is
about time to discuss how the symbiosis works after the symbiotic phase. Although
root colonization occurs just in the cortical zone from plant root, its effects can be
observed aboveground during host development (Cavalcante et al. 2001; Sena et al.
2004). Many works had well discussed about nutrients uptake, metabolism alterations
and metabolites use (Krajinski et al. 2002; Ramos 2005; Ramos et al. 2008a, b, c).
Basically, the symbiosis is very H+-dependent because of the required activation
of enzymes H+-ATPase and H+- pyrophosphatase (Ramos 2005; Ramos et al. 2008a,
b, c). These two components improve absorption, translocation, and nutrients
exchange and utilization by the AMF (Ramos et al. 2009a, b), as well, as photosyn-
thesis, metabolites synthesis, translocation and nutrients exchanges by the host-
plant (Krajinski et al. 2002). But it only occurs in colonized roots which the
symbiosis still remains. The H+ ions act as main channel activator, and neurotrans-
mission (Ramos et al. 2009a, b). Without H+, other secondary activators, such as
Ca2+, K+, PO42−, NO3−, SO42−, glucose, sucrose, and amino acids does not work
(Ramos 2005; Ramos et al. 2008a, b, c, 2009a, b).
During intraradical mycelium development, several morphological and physio-
logical chances occur between AMF and the host-plant, leading to the formation of
different exchange interfaces (Cruz et al. 2008; Ramos et al. 2009a, b). Usually, two
different types of exchange interfaces are found: (1) Intercellular interface, when IH
growth between cortex cells; and (2) Intracellular interface, when IH growth into
cortex cells. This last one, is the most important exchange interface, i.e., interface
between periarbuscular and arbuscular membranes, and it is here that the differen-
tiation of IH into arbuscules occurs (Cruz et al. 2008), leading to the formation of a
new cell membrane by the host-plant. This new cell membrane occurs across all
AMF intraradical mycelium, and its formation depends on the host plant status
(Harrison 2005).
 56

Table 3.3 Favorable abiotic and biotic factors required to the symbiosis process
Factor Favorable conditions Acts during phase Effects in AMF genus favored Reference (year)
Temperature 18–25 °C Asymbiotic, Spore germination, Acaulospora, Claroideoglomus, Siqueira et al. (1985a, b),
pre-symbiotic mycelium growth Glomus, Rhizophagus Juge et al. (2002)
Moisture 5–28 % Asymbiotic Spore germination Claroideoglomus, Juge et al. (2002)
Funneliformis, Gigaspora,
Glomus
Luminosity Absent Asymbiotic, Spore germination, Acaulospora, Gigaspora, Siqueira et al. (1985a, b),
pre-symbiotic mycelium growth, Glomus Nagahashi et al. (2000)
chemotropism
Soil pH <6.0 Asymbiotic, Spore germination, Acaulospora, Gigaspora, Moreira and Siqueira (2006),
pre-symbiotic, mycelium growth, root Racocetra, Scutellospora Ramos et al. (2008a, b, c)
symbiotic colonization
6.0–7.0 Asymbiotic, Spore germination, Acaulospora, Lambais and Cardoso (1988),
pre-symbiotic, mycelium growth, molecular Claroideoglomus, Ramos et al. (2008a, b, c)
symbiotic, signals Funneliformis, Glomus,
Rhizophagus, Sclerocystis
>7.0 Asymbiotic, Spore germination, Glomus Siqueira et al. (1984)
pre-symbiotic, mycelium growth, root
symbiotic contact, intra- and
extraradical hyphal growth
Mineral nutrients N (5 mg L−1) Asymbiotic Metabolites synthesis Claroideoglomus, Gigaspora Siqueira et al. (1982),
Bressan (2001)
3

P (>20 mg L−1) Asymbiotic, Energy supply, root Claroideoglomus, Siqueira et al. (1985a, b)
pre-symbiotic, exudates level, host-plant Funneliformis, Gigaspora,
symbiotic nutritional status, root Glomus
colonization
K (not determined) Asymbiotic, Metabolites synthesis, Gigaspora, Glomus Siqueira et al. (1985a, b),
pre-symbiotic and mycelium growth Lambais (2006), Kiriacheck
et al. (2009)
Ca (not determined) Asymbiotic, Membrane potential, Gigaspora, Glomus Siqueira et al. (1985a, b),
AMF’s Main Structures

pre-symbiotic energy supply Lambais (2006), Kiriacheck

et al. (2009)
 S (not determined) Asymbiotic, Amino acids synthesis Gigaspora, Glomus, Siqueira et al. (1985a, b),
pre-symbiotic Scutellospora Lambais (2006), Kiriacheck
et al. (2009)
Micronutrients Asymbiotic, Germ tube formation, Ambispora, Gigaspora, Freitas et al. (2002), Cury et al.
(not determined) pre-symbiotic, mycelium growth, Glomus, Racocetra, (1996), Moreira and Siqueira
symbiotic host-plant nutritional status Scutellospora (2006)
Salinity CE < 2.5 dS m−1 Asymbiotic, Germ tube emergence, Claroideoglomus, Gigaspora Maia and Yano-Melo (2001),
pre-symbiotic, metabolites synthesis, Junniper and Abbott (2006)
symbiotic mycelium growth,
host-plant nutritional status
Glucose 1–4 g L−1 Pre-symbiotic Mycelium growth Gigaspora, Glomus Siqueira et al. (1982), Siqueira
and Sucrose and Hubbell (1986), Vilariño
3.5 How Does the Symbiosis Work?

and Sainz (1997)

Amino acids 2–4 g L−1 Pre-symbiotic Protein synthesis Gigaspora Freitas and Siqueira (1994)
Organic Presence Pre-symbiotic, Mycelium growth, Claroideoglomus, Gigaspora, Fracchia et al. (2001), Silva
molecules symbiotic sporulation Scutellospora et al. (2005)
Root exudates Presence Pre-symbiotic, Chemotropism, mycelium Funneliformis, Gigaspora, Bais et al. (2006), Besserer
symbiotic growth, metabolites Glomus, Rhizophagus et al. (2006), Bécard et al.
synthesis, AMF metabolism, (2004), Lambais (2006),
root colonization Gianinazzi-Pearson et al.
(2007), Carlsen et al. (2008)
Microorganisms Actinomycetes, Asymbiotic, Spore’s parasitism, germ Acaulospora, Siqueira et al. (1984, 1985a, b),
bacteria, fungi pre-symbiotic, tube formation, intra- and Claroideoglomus, Tylka et al. (1991), Maia and
symbiotic extraradical mycelium Funneliformis, Gigaspora, Kimbrough (1993, 1998),
development Glomus, Scutellospora Bianciotto et al. (2003),
Martinez et al. (2004), Lumini
et al. (2007), Alonso et al.
(2008), Soares et al. (2009)
Antibiotics Chloramine T (0.02 %), Asymbiotic Germ tube emergence Funneliformis, Rhizophagus Budi et al. (1999)
Streptomycin (0.01 %),
Gentamicin (0.02 %)
57
58 3 AMF’s Main Structures

Fig. 3.6 Nutrients movement between AMF and the host plant by exchange interfaces

In order to exchange nutrients, a H+-gradient is generated in the exchange inter-

face by the H+-ATPase from AMF and the host-plant, consuming a large amount of
energy in the a lot of ATP from primary transport (Ramos et al. 2008a, b, c). This
H+-gradient is able to active the exchange of metabolites from AMF to the host
plant, such as Pi and other nutrients (Nagy et al. 2005); sucrose and amino acids
from the host plant to AMF (Secondary transport) (Ramos et al. 2009a, b). Exchange
interfaces are very important places in the root where all exchange processes, and
hydrogen accumulation occur (Fig. 3.6).

References

Akiyama K, Matsuzaki K, Hayashi H (2005) Plant sesquiterpenes induce hypha branching in

arbuscular mycorrhiza fungi. Nature 435:824–827
Alonso LM, Kleiner D, Ortega E (2008) Spores of the mycorrhizal fungus Glomus mosseae host
yeasts that solubilize phosphate and accumulate polyphosphates. Mycorrhiza 18:197–204
Al-Qarawi AA, Mridha MAU, Dhar PP (2013) Report of Funneliformis mosseae (Nicol. & Gerd.)
Gerd. and Trappe from rangeland soil of Saudi Arabia. Res J Biotechnol 8:96–99
Bais HP, Weir TL, Perry LG, Gilroy S, Vivanco JM (2006) The role of root exudates in rhizosphere
interactions with plants and other organisms. Ann Rev Plant Biol 57:233–266
Bartolome-Estebán H, Schenck NC (1994) Spore germination and hyphal growth of arbuscular
mycorrhizal fungi in relation to soil aluminium saturation. Mycologia 86:217–226
Bécard G, Kosuta S, Tamasloukht M, Sájalon-Delmas N, Roux C (2004) Partner communication
in the arbuscular mycorrhizal interaction. Can J Bot 82:1186–1197
Berbara RLL, Souza FA, Fonseca HMAC (2006) Fungos micorrízicos arbusculares: muito além da
nutrição. In: Fernandes MS (ed) Nutrição Mineral de plantas. SBCS, Viçosa, pp 54–79
Besserer A, Puech-Pagès V, Kiefer P, Gomez-Roldan V, Jauneau A, Roy S, Portais J-C, Roux C,
Bécard G, Sejalon-Delmas N (2006) Strigolactones stimulate arbuscular mycorrhizal fungi by
activating mitochondria. PLoS Biol 4:1239–1247
Bianciotto V, Lumini E, Bonfante P, Vandamme P (2003) ‘Candidatus Glomeribacter gigaspo-
rum’ gen. nov. sp. nov., an endosymbiont of arbuscular mycorrhizal fungi. Int J Syst Evol
Microbiol 53:121–124
References 59

Bianciotto V, Genre A, Jargeat P, Lumini E, Bécard G, Bonfante P (2004) Vertical transmission of

endobacteria in the arbuscular mycorrhizal fungus Gigaspora margarita through generation of
vegetative spores. Appl Environ Microbiol 70:3600–3608
Bonfante P (2003) Plants, mycorrhizal fungi and endobacteria: a dialog among cells and genomes.
Biol Bull 204:215–220
Bressan W (2001) Interactive effect of phosphorus and nitrogen on in vitro spore germination of
Glomus etunicatum Becker & Gerdemann, root growth and mycorrhizal colonization. Braz
J Microbiol 32:276–280
Brundrett MC (2004) Diversity and classification of mycorrhizal associations. Biol Rev
79:473–495
Brundrett MC, Piché Y, Peterson RL (1985) A developmental study of the early stages in vesicular-
arbuscular mycorrhiza formation. Can J Bot 63:184–194
Budi SW, Blal B, Gianinazzi S (1999) Surface-sterilization of Glomus mosseae sporocarps for
studying endomycorrhization in vitro. Mycorrhiza 9:65–68
Buee M, Rossignol M, Jauneau A, Ranjeva R, Bécard G (2000) The pre-symbiotic growth of
arbuscular mycorrhizal fungi is induced by a branching factor partially purified from plant root
exudates. Mol Plant Microbe Interact 13:693–698
Campelli LB, Ramos AC, Façanha AR, Campos E (2005) Modulation of phosphohydrolases activ-
ities in apoplastic fluid drom maizes roots by arbuscular mycorrhizal fungus. In: XXXIV
Reunião Anual da Sociedade Brasileira de Bioquímica e Biologia Molecular, SBBQ, Águas de
Lindóia, Sociedade Brasileira de Bioquímica e Biologia Molecular (Org) 236p
Carlsen SCK, Understrup A, Fomsgaard IS, Mortensen AG, Ravnskov S (2008) Flavonoids in
roots of White clover: interaction of arbuscular mycorrhizal fungi and a pathogenic fungus.
Plant Soil 302:33–43
Cavalcante UMT, Maia L, Costa CMC, Santos VF (2001) Mycorrhizal dependency of passion fruit
(Passiflora edulis f. flavicarpa). Fruit 56:317–324
Chabaud M, Harrison M, Carvalho-Niebel F, Bécard G, Barker DG (2006) Inoculation and growth
with mycorrhizal fungi. Medicago truncate handbook. Version November, pp 1–15
Cruz C, Correia P, Ramos AC, Carvalho L, Bago A, Martins-Loução MA (2008) Arbuscular
mycorrhiza in physiological and morphological adaptations of Mediterranean plants. In: Varma
A, Hock B (eds) Mycorrhiza: biology, genetics, novel endophytes and biotechnology. Springer,
Germany, pp 729–749
Cury RS, Klauberg-Filho O, Siqueira JO (1996) Germinação e crescimento do tubo germinativo
de esporos de Glomales em solo contaminado com metais pesados. In: XIII Congresso Latino
Americano de Ciência do Solo, SBBQ, Águas de Lindóia, Sociedade Brasileira de Bioquímica
e Biologia Molecular (Org)
Dalpé Y, Souza FA, Declerck S (2005) The life cycle of Glomus species in monoxenic culture. In:
Declerck S, Strullu D-G, Fortin JA (eds) In Vitro culture of mycorrhizas. Springer, Heidelberg,
pp 49–71
Daniels BA, Graham SO (1976) Effects of nutrition and soil extracts on germination of Glomus
mosseae spores. Mycologia 68:108–116
Ellouze W, Hamel C, Cruz AF, Ishii T, Gan Y, Bouzid S, St-Arnaud M (2012) Phytochemicals and
spore germination: at the root of AMF host preference? Appl Soil Ecol 60:98–104
Endre G, Kereszt A, Kevei Z, Mihacea S, Kalo P, Kiss GB (2002) A receptor kinase gene regulat-
ing symbiotic nodule development. Nature 417:962–966
Fracchia S, Menendez A, Godeas A, Ocampo JA (2001) A method to obtain monosporic cultures
of arbuscular mycorrhizal fungi. Soil Biol Biochem 33:1283–1285
Freitas MH, Siqueira JO (1994) Crescimento micelial de esporos pré-germinados do fungo endo-
micorrízico Gigaspora gigantea em meio líquido suplementado com compostos orgânicos
nitrogenados. Pesq Agropec Bras 29:751–756
Freitas NO, Lins CEL, Silva GA, Lira WL, Maia LC (2002) Efeito de metais pesados sobre o
potencial germinativo e o crescimento micelial de Gigaspora albida. In: IX Reunião Brasileira
Sobre Micorrizas (FertBio), Rio de Janeiro, Sociedade Brasileira de Ciência do Solo, p 45
60 3 AMF’s Main Structures

Gamper HA, Walker C, Schüßler A (2009) Diversispora celata sp. nov: molecular ecology and
phylotaxonomy of an inconspicuous arbuscular mycorrhizal fungus. New Phytol 182:495–506
Gerdemann JW, Nicolson TH (1963) Spores of mycorrhizal endogone species extracted from soil
by wet-sieving and decanting. Trans Br Mycol Soc 46:235–244
Gianinazzi-Pearson V, Sejalon-Delmas N, Genre A, Jeandroz S, Bonfante P (2007) Plants and
arbuscular mycorrhizal fungi: cues and communication in the early steps of symbiotic interac-
tions. Adv Bot Res 46:181–219
Giovannetti M, Azzolini D, Citernesi AS (1999) Anastomosis formation and nuclear and proto-
plasmatic exchange in arbuscular mycorrhizal fungi. Appl Environ Microbiol 65:5571–5575
Godfrey RM (1957) Studies of British species of Endogone. III. Germination of spores. Trans Br
Mycol Soc 40:203–210
Goto BT, Maia LC (2006) Glomerospores: a new denomination for the spores of Glomeromycota,
a group moleculary distinct from the Zygomycota. Mycotaxon 96:129–132
Harrison MJ (2005) Signaling in the arbuscular mycorrhizal symbiosis. Ann Rev Microbiol
59:19–42
Hepper CM (1984a) Germination and growth of Glomus caledonius spores: the effects of inhibi-
tors and nutrients. Soil Biol Biochem 11:269–277
Hepper CM (1984b) Regulation of spore germination of the vesicular-arbuscular mycorrhizal fun-
gus Acaulospora laevis by soil pH. Trans Br Mycol Soc 83:154–156
Juge C, Samson J, Bastien C, Vierheilig H, Coughlan A, Piché Y (2002) Breaking dormancy in
spores of the arbuscular mycorrhizal fungus Glomus intraradices: a critical cold-storage
period. Mycorrhiza 12:37–42
Junniper S, Abbott LK (2006) Soil salinity delays germination and limits growth of hyphae from
propagules of arbuscular mycorrhizal fungi. Mycorrhiza 16:371–379
Kiriacheck SG, Azevedo LBC, Peres LEP, Lambais MR (2009) Regulação do desenvolvimento de
micorrizas arbusculares. Rev Bras Ciênc Solo 33:1–16
Krajinski F, Hause B, Gianinazzi-Pearson V, Franken P (2002) Mtha1, a plasma membrane H+-
ATPase gene from Medicago truncate, shows arbuscule-specific induced expression in mycor-
rhizal tissue. Plant Biol 4:754–761
Kuga Y, Saito K, Nayuki K, Peterson RL, Saito M (2008) Ultrastructure of rapidly frozen and
freeze-substituted germ tubes of an arbuscular mycorrhizal fungus and location of polyphos-
phate. New Phytol 178:189–200
Lambais MR (2006) Unraveling the signaling and signal transduction mechanisms controlling
arbuscular mycorrhiza development. Sci Agric 63:405–413
Lambais MR, Cardoso EJBN (1988) Avaliação da germinação de esporos de fungos micorrízicos
vesículo-arbusculares e da colonização micorrízica de Stylosanthes guianensis em solo ácido e
distrófico. Rev Bras Ciênc Solo 12:249–255
Lambais MR, Takahashi D (2006) Transcriptome analyses in sugarcane mycorrhizal roots under
different phosphate condition. In: Mycorrhiza: Systems Research from genes to Communities.
Zurich, Swiss Federal Institute of Technology, p 13
Lanfranco L, Novero M, Bonfante P (2005) The mycorrhizal fungus Gigaspora margarita pos-
sesses a CuZn superoxide dismutase that is up-regulated during symbiosis with legume hosts.
Plant Physiol 137:1319–1330
Lumini E, Bianciotto V, Jargeat P, Novero M, Salvioli A, Faccio A, Bécard G, Bonfante P (2007)
Presymbiotic growth and sporal morphology are affected in the arbuscular mycorrhizal fungus
Gigaspora margarita cured of its endobacteria. Cell Microbiol 9:1716–1729
Madsen EB, Madsen LH, Radutoiu S, Olbryt M, Rakwalska M, Szcyglowski K, Sato S, Kaneko T,
Tabata S, Sandal N, Stougaard JA (2003) A receptor kinase gene of the LysM type is involved
in legume perception of rhizobial signals. Nature 425:637–640
Maia LC, Kimbrough JW (1993) Ultrastructural studies on spores of a Acaulospora morrowiae
and A. scrobiculata. Mycol Res 97:1183–1189
Maia LC, Kimbrough JW (1998) Ultrastructural studies on spores of a Glomus species. Int J Plant
Sci 159:581–589
References 61

Maia LC, Yano-Melo AM (2001) Germination and germ tube growth of the arbuscular mycorrhi-
zal fungi Gigaspora albida in different substrates. Braz J Microbiol 32:281–285
Martinez A, Obertello M, Oardo A, Ocampo JA, Godeas A (2004) Interactions between
Trichoderma pseudokoningli strains and the arbuscular mycorrhiza fungi Glomus mosseae and
Gigaspora rosea. Mycorrhiza 14:79–84
Moreira FMS, Siqueira JO (2006) Microbiologia e Bioquímica do Solo, 2ª edição revisada e
ampliada. Editora UFLA, Lavras
Morton JB, Benny GL (1990) Revised classification of arbuscular mycorrhizal fungi (Zygomycetes):
a new order, Glomales, two new suborders, Glomineae and Gigasporineae, and two new families,
Acaulosporaceae and Gigasporaceae, with an emendation of Glomaceae. Mycotaxon 37:471–491
Mosse B (1956) Fructifications of an Endogone species causing endotrophic mycorrhiza on fruit
plants. Ann Bot 20:349–362
Mosse B (1959) The regular germination of resting spores and some observations on the growth
requirements of an Endogone sp. causing vesicular-arbuscular mycorrhiza. Trans Br Mycol
Soc 42:274–286
Nagahashi G, Douds D, Buee M (2000) Light-induced hyphae branching of germinated AM fun-
gal spores. Plant Soil 219:71–79
Nagy R, Karandashov V, Chague V, Kalinkevich K, Tamasloukht M, Xu G (2005) The character-
ization of novel mycorrhiza-specific phosphate transporters from Lycopersicon esculentum and
Solanum tuberosum uncovers functional redundancy in symbiotic phosphate transport in sola-
naceous species. Plant J 2:236–250
Oehl F, Sieverding E (2004) Pacispora, a new vesicular-arbuscular mycorrhizal fungus genus in
the Glomeromycetes. J Appl Bot Food Qual 78:72–82
Oehl F, de Souza FA, Sieverding E (2008) Revision of Scutellospora and description of five new
genera and three new families in the arbuscular mycorrhiza-forming Glomeromycetes.
Mycotaxon 106:311–360
Porcel R, Aroca R, Cano C, Bago A, Ruíz-Lozano JA (2006) Identification of a gene from the
arbuscular mycorrhizal fungus Glomus intraradices encoding for a 14-3-3 protein that is up-
regulated by drought stress during the AM symbiosis. Microb Ecol 52:575–582
Radutoiu S, Madsen LH, Madsen EB, Felle HH, Umehara Y, Grønlund M, Sato S, Nakamura Y,
Tabata S, Sandal N, Stougaard J (2003) Plant recognition of symbiotic bacteria requires two
LysM receptor-like kinases. Nature 425:585–592
Ramos AC (2005) Papel da dinâmica do fluxo de prótons na sinalização das diferentes fases da
interação micorrízica arbuscular. Tese de Doutorado. Campos dos Goytacazes, Universidade
Estadual do Norte Fluminense, 108p
Ramos AC, Façanha AR, Feijó JA (2008a) Ion dynamics during the polarized growth of arbuscular
mycorrhizal fungi: from presymbiosis to symbiosis. In: Varma A, Hock B (eds) Mycorrhiza:
biology, genetics, novel endophytes and biotechnology. Springer, Germany, pp 241–261
Ramos AC, Façanha AR, Feijó JA (2008b) Proton (H+) flux signature for the presymbiotic devel-
opment of the arbuscular mycorrhizal fungi. New Phytol 178:177–188
Ramos AC, Façanha AR, Lima PT, Feijó JA (2008c) pH signature for the responses of arbuscular
mycorrhizal fungi to external stimuli. Plant Signal Behav 3:1–3
Ramos AC, Lima PT, Dias PN, Kasuya MCM, Feijó JA (2009a) A pH signaling mechanism
involved in the spatial distribution of calcium and anion fluxes in ectomycorrhizal roots. New
Phytol 181:448–462
Ramos AC, Martins MA, Okorokova-Façanha AL, Olivares FL, Okorokov LA, Sepúlveda N, Feijó
JA, Façanha AR (2009b) Arbuscular mycorrhizal fungi induce differential activation of the
plasma membrane and vacuolar H+ pumps in maize roots. Mycorrhiza 19:69–80
Redecker D, Kodner R, Graham LE (2000) Glomalean fungi from the Ordovician. Science
289:1920–1921
Redecker D, Schüßler A, Stockinger H, Stürmer SL, Morton JB, Walker C (2013) An evidence-
based consensus for the classification of arbuscular mycorrhizal fungi (Glomeromycota).
Mycorrhiza 23(7):515–531. doi:10.1007/200572-013-0486-y
62 3 AMF’s Main Structures

Requena N, Mann P, Hampp R, Franken P (2002) Early developmentally regulated genes in the
arbuscular mycorrhizal fungus Glomus mosseae: GmGIN1 a novel gene encoding a protein
with homology to the C-terminus of metazoan hedgehog proteins. Plant Soil 244:129–139
Requena N, Breuninger M, Franken P, Ocon A (2003) Symbiotic status, phosphate, and sucrose
regulate the expression of two plasma membrane H+-ATPase genes from the mycorrhizal fun-
gus Glomus mosseae. Plant Physiol 132:1540–1549
Requena N, Serrano E, Ocon A, Breuninger M (2007) Plant signals and fungal perception during
arbuscular mycorrhiza establishment. Phytochemistry 68:33–40
Sbrana C, Giovannetti M (2005) Chemotropism in the arbuscular mycorrhizal fungus Glomus
mosseae. Mycorrhiza 15:539–545
Schüßler A (2000) Glomus claroideum forms and arbuscular mycorrhiza-like symbiosis with the
hornwort Anthoceros punctatus. Mycorrhiza 10:15–21
Schüßler A, Walker C (2010) The Glomeromycota: a species list with new families. Arthur
Schüßler & Christopher Walker, Gloucester. Published in December 2010 in libraries at The
Royal Botanic Garden Edinburgh, The Royal Botanic Garden Kew, Botanische Staatssammlung
Munich, and Oregon State University. Printed copy available under ISBN-13: 978-1466388048,
ISBN-10: 1466388048. http://www.amf-phylogeny.com
Schüßler A, Schwarzott D, Walker C (2001) A new fungal phylum, the Glomeromycota: phylog-
eny and evolution. Mycol Res 105:1413–1421
Sena JOA, Labate CA, Cardoso EJBN (2004) Physiological characterization of growth depression
in arbuscular mycorrhizal citrus seedlings under high P levels. Rev Bras Ciênc Solo
28:827–832
Silva FSB, Yano-Melo AM, Brandão JA, Maia LC (2005) Sporulation of arbuscular mycorrhizal
fungi using Tris-HCl buffer in addition to nutrient solutions. Braz J Microbiol 36:327–332
Siqueira JO (1983) Nutritional and edaphic factors affecting spore germination, germ tube growth
and root colonization of the arbuscular mycorrhizal fungi. Doctorate thesis. University of
Florida, Gainesville, 122p
Siqueira JO, Hubbell DH (1986) Effect of organic substrates on germination and germ tube growth
of vesicular-arbuscular mycorrhizal fungus spores in vitro. Pesquisa Agropecuária Brasileira
21:523–527
Siqueira JO, Hubbell DH, Schenck NC (1982) Spore germination and germ tube growth of a
vesicular-arbuscular mycorrhizal fungus “in vitro”. Mycologia 74:952–959
Siqueira JO, Hubbel DH, Mahmud AW (1984) Effect of liming on the spore germination, germ
tube, growth and root colonization by vesicular-arbuscular mycorrhizal fungi. Plant Soil
76:115–124
Siqueira JO, Bruce B, Hubbell DH (1985a) Inibição da germinação de esporos de fungos micor-
rízicos vesicular-arbuscular por substâncias voláteis produzidas por actinomicetos isolados d
solo. In: III Reunião Brasileira sobre Micorrizas, ESAL/FAEPE, Lavras
Siqueira JO, Sylvia D, Gibson J, Hubbel D (1985b) Spores, germination, and germ tubes of
vesicular-arbuscular mycorrhizal fungi. Can J Microbiol 31:965–997
Siverding E, Oehl F (2006) Revision of Entrophospora and description of Kuklospora and
Intraspora, two new genera in the arbuscular mycorrhizal Glomeromycetes. J Appl Bot Food
Qual 80:69–81
Smith SE, St John BJ, Smith FA, Nicholas DJD (1985) Activity of glutamine synthetase and glu-
tamate dehydrogenase in Allium cepa L. and Trifolium subterraneum L.: effect of mycorrhizal
infection and phosphate nutrition. New Phytol 99:211–227
Soares SAG, Mariano RLR, Cavalcante UMT, Maia LC (2009) Efeito de bactérias na germinação
e crescimento micelial de fungus micorrízicos arbusculares e co-inoculação em mudas de aba-
caxizeiro. Revista Caatinga 22:31–38
Souza FA, Declerck S, Smith E, Kowalchuk GA (2005) Morphological, ontogenetic and molecular
characterization of Scutellospora reticulate (Glomeromycota). Mycol Res 109:697–706
Spain JL (1992) Patency of shields in water mounted spores of four species in Acaulosporaceae
(Glomales). Mycotaxon 43:331–339
References 63

Spain JL, Sieverding E, Oehl F (2006) Appendicispora: a new genus in the arbuscular mycorrhiza-
forming Glomeromycetes, with a discussion of the genus Archaeospora. Mycotaxon
97:163–182
Stracke S, Kistner C, Yoshida S, Mulder L, Sato S, Kaneko T, Tabata S, Sandal N, Stougaard J,
Szcyglowski K, Parniske M (2002) A plant receptor kinase required for both bacterial and
fungal symbiosis. Nature 417:959–962
Tamasloukht M, Sejalon-Delmas N, Kluever A, Jauneau A, Roux C, Bécard G, Franken P (2003)
Root factors induce mitochondrial-related gene expression and fungal respiration during the
developmental switch from asymbiosis to pre-symbiosis in the arbuscular mycorrhizal fungus
Gigaspora rosea. Plant Physiol 131:1468–1478
Tawaraya K, Hashimoto K, Wagatsuma T (1998) Effect of root exudate fractions from P-deficient
and P-sufficient onion plants on root colonization by the arbuscular mycorrhizal fungus
Gigaspora margarita. Mycorrhiza 8:67–70
Tommerup IC, Kidby DK (1980) Production of aseptic spores of vesicular-arbuscular endophytes
and their viability after chemical and physical stress. Appl Environ Microbiol 39:1111–1119
Trépanier M, Bécard G, Moutoglis P, Willemot C, Gagne S, Avis TJ, Rioux J-A (2005) Dependence
of arbuscular-mycorrhizal fungi on their plant host for palmitic acid synthesis. Appl Environ
Microbiol 71:5341–5347
Tsai SM, Philips DA (1991) Flavonoids released naturally from alfalfa promote development of
symbiotic Glomus spores in vitro. Appl Environ Microbiol 57:1485–1488
Tylka GK, Hussey RS, Roncadori RW (1991) Axenic germination of vesicular-arbuscular mycor-
rhizal fungi: effects of selected Streptomyces species. Phytopathology 81:754–759
Verdin A, Sahraoui AL-H, Fontaine J, Grandmoungin-Ferjani A, Durand R (2006) Effects of
anthracene on development of an arbuscular mycorrhizal fungus and contribution of the sym-
biotic association to pollutant dissipation. Mycorrhiza 16:397–405
Vilariño A, Sainz MJ (1997) Treatment of Glomus mosseae propagules with sucrose increases
spore germination and inoculum potential. Soil Biol Biochem 29:1571–1573
Walker C (1983) Taxonomic concepts in the Endogonaceae: spore wall concepts in species
descriptions. Mycotaxon 18:443–455
Yoshida S, Parniske M (2005) Regulation of plant symbiosis receptor kinase through serine and
threonine phosphorylation. J Biol Chem 280:9203–9209
Zsögön AA, Lambais MR, Benedito VA, Figueira AVO, Perez LE (2008) Reduced arbuscular
mycorrhizal colonization in tomato ethylene mutants. Scientia Agricola 65:259–267
Chapter 4
Spores: A Special Tool to Survive

Abstract I discuss in this chapter all spore characteristics, structures and functions.
AMF spores are composed by several walls, and each wall has its own function and
characteristics to help AMF to survive. Each spore produces one outer wall, which
is originated from the fertile hypha on which the spore is borne. Within it a number
of layers between one and three layers (although rarely more than three) are synthe-
sized. Usually, these layers are numbered from outermost to innermost (L1, L2, L3,
etc.). Spores also produce an inner wall that is described as a flexible germinal wall
composed by two bilayered walls groups (Gw1 and Gw2). Sometimes, AMF spores
produces different structures, such as subtending hypha, sporiferous saccule, spo-
rogenous cell, pre-germination structures, peridium, cicatrix, or pedicel. These
structures are unique, and just occur in same AMF genus, such as Acaulospora,
Ambispora, Claroideoglomus, Diversispora, Funneliformis, Glomus, Paraglomus,
Rhizophagus, Sclerocystis, and Septoglomus.

Keywords Glomeromycota spores • Acaulosporoid spores • Entrophosporoid

spores • Gigasporoid spores • Glomoid spores • Radial-glomoid spores

4.1 Why Do I Need to Study Spore AMF?

Glomeromycota species produces spores with unique characteristics when com-

pared with other species from Fungi Kingdom (Walker 1983; Goto and Maia 2006).
These structures can be found in several soil conditions and into roots of plants
worldwide (Redecker et al. 2013). In order to perform a good morphological iden-
tification study, it is very important for any student to know how AMF spores are,
how their composition is, how many walls they have, and how these walls are.
Fortunately, the knowledge to know how to respond all these questions you will
find in this chapter. AMF spores are multiwall asexual spherical structures, and their
wall organization is the main morphological attribute used to identify AMF at spe-
cies level (Gerdemann and Nicolson 1963). They are composed by several walls,
and each wall has its own function (structural, reproductive or absorptive) and char-
acteristics to help AMF to survive (Walker 1983; Morton et al. 1995).

© Springer International Publishing Switzerland 2015 65

T. Souza, Handbook of Arbuscular Mycorrhizal Fungi,
DOI 10.1007/978-3-319-24850-9_4
66 4 Spores: A Special Tool to Survive

Although, every AMF spore has unique multinucleate cell, its wall characteris-
tics are very variable, such as formation mode, size, shape, color, structure, wall
organization, germination structures, layers organization, and germ tube emergence
form (Oehl et al. 2008). These characteristics are used to perform a species
identification using keys to taxa Glomeromycota, especially two characteristics
such as sporogenesis and germination mode (Gerdemann and Trappe 1974; Tandy
1975; Nicolson and Schenck 1979; Hall and Fish 1979; Walker and Trappe 1981;
Koske and Walker 1985; McGee 1986; Morton and Benny 1990; Oehl and
Sieverding 2004; Oehl et al. 2006, 2008).

4.2 Spore Formation Mode

Basically, there are five different types of morphotypes (Walker 1983). These five
morphotypes are: Acaulosporoid, entrophosporoid, gigasporoid, glomoid, and
radial-glomoid (Schüßler and Walker 2010) (Fig. 4.1).
Acaulosporoid morphotype is defined by spores borne laterally from the neck of
a pre-differentiated sporiferous saccule. The content of this structure is transferred to
spore during sporulation (Stürmer and Morton 1999). This morphotype occurs in
genus Acaulospora, Ambispora, Archaeospora, and Otospora (Redecker et al. 2013).
Sometimes a beginner can make a mistake, ranking acaulosporoid morphotype
as one entrophosporoid morphotype, because their similarities. Entrophosporoid
morphotypes occurs just in genus Entrophospora, and differ to acaulosporoid mor-
photype by the position of the spore from the saccule neck. Entrophosporoid mor-
photype is defined by spores borne inside the neck of the saccule (Wu et al. 1995;
Kaonongbua et al. 2010).

Fig. 4.1 Main AMF spores morphotypes. Acaulosporoid and entrophosporoid morphotypes dark
structures are AMF spores; gigasporoid dark structure is bulbous hyphae; and radial-Glomoid dark
structure is central plexus
4.3 AMF Spore Size 67

The gigasporoid morphotype occurs in genus Cetraspora, Dentiscutata,

Gigaspora, Racocetra, and Scutellospora, their spore are formed at the apex of
bulbous hyphae (suspensor cell) (Morton 1995; Redecker et al. 2013). For glomoid
morphotype, AMF spores are formed in the terminal or intermediate portion of the
reproductive hyphae. This morphotype occurs in species from genus Acaulospora,
Ambispora, Archaeospora, Diversispora, Geosiphon, Glomus, Pacispora, and
Paraglomus (Schüßler and Walker 2010). Radial-glomoid morphotype have
AMF spores formed and organized from a central plexus of hyphae. Generally,
AMF species from genus Glomus and Sclerocystis produce spores with this
morphotype (Wu 1993).
Based on these five morphotypes, Gerdemann and Trappe (1974) proposed new
AMF genus in their classification: Acaulospora (acaulosporoid), Entrophospora
(entrophosporoid), Gigaspora (gigasporoid), Glomus (glomoid), and Sclerocystis
(radial-glomoid). After Gerdemann and Trappe’s classification, other researchers
like Tandy (1975) and Ames and Schneider (1979) used this morphotypes to iden-
tify AMF species during their studies.
During Phase II and Phase III (See Chap. 2) just know the spore morphotypes
were enough to perform a good genus identification, specially because in these
phases some AMF genus, such as Ambispora, Racocetra, and even Scutellospora
were not described yet. But, at the end of phase III, Walker (1983) concluded that
just spore morphotypes were not enough to perform AMF taxonomy, these charac-
teristics did not help to differentiate Gigaspora from Scutellospora, once both gen-
era have gigasporoid morphotypes; and genus like Archaeospora and Acaulospora
have dimorphic spores (Acaulosporoid and glomoid morphotypes).

4.3 AMF Spore Size

Usually AMF spores size varies from 22 to 1050 μm (Goto and Maia 2006), and we
can classify some genus based on this characteristics (Gerdemann and Trappe 1974;
Nicolson and Schenck 1979; Hall and Fish 1979; Oehl and Sieverding 2004; Oehl
et al. 2006, 2008), specially during protocols to extract spores from the soil or trap
cultures bioassays.
In these protocols just is need the use of some sieves to divide AMF species from
Family Gigasporaceae species that show spores with higher sizes (usually >200 μm)
than other species from Family Glomeraceae or Paraglomeraceae (Oehl et al. 2006)
which their spores can be found with lower dimensions (<200 μm) in soil surface or
into roots (Table 4.1).
Basically, AMF size range is described species by species with minimum, maxi-
mum and mean size (Oehl et al. 2008), and this information is very useful to taxo-
nomic and ecologic studies. For example, if you want to study a hypothetical AMF
species, like the described species from Fig. 4.2, you must use two sieves to collect
it: One sieve higher than 320 μm and another one of 40 μm; or just one higher than
200 μm and another one of 160 μm to collect the maximum number of aimed
spores (180 μm).
68 4 Spores: A Special Tool to Survive

Table 4.1 Size distribution, formation mode, and spore morphotype from AMF genera
Mean size
AMF genus Formation mode/morphotype Size distribution (μm) (μm) (N = 100)
Acaulospora Singly/acaulosporoid 60–380 151
Singly/glomoid 50–80 53
Archaeospora Singly/acaulosporoid 40–80 61
Singly/glomoid 50–70 59
Ambispora Singly/acaulosporoid 160–250 209
Singly/glomoid 50–190 80
Cetraspora Singly/gigasporoid 120–240 189
Claroideoglomus Singly/glomoid 60–180 114.5
Dentiscutata Singly/gigasporoid 120–520 193
Diversispora Singly/glomoid 40–320 143
Entrophospora Singly/entrophosporoid 100–160 125
Funneliformis Singly/glomoid 100–320 192.8
Geosiphon Singly/glomoid Not described
Gigaspora Singly/gigasporoid 160–440 291.8
Glomus Singly/glomoid 45–180 157
Sporocarps/radial-glomoid 315–690 × 424–776 420 × 516
Otospora Singly/acaulosporoid 140–210 182
Pacispora Singly/glomoid Not described
Paraglomus Singly/glomoid 60–140 85
Racocetra Singly/gigasporoid 120–520 326
Redeckera 65–95 × 38–57 81 × 47
Rhizophagus Singly/glomoid 40–260 127
Sporocarps/radial-glomoid 200–1800 × 200–1400 560 × 720
Scutellospora Singly/gigasporoid 120–640 279
Sclerocystis Sporocarps/radial-glomoid 200–360 273
Septoglomus Singly/glomoid 60–140 82

200
180
160
140
120
No. spores

100
80
60
40
20
0
40 60 80 120 160 180 200 240 260 300 320
Spore size (mm)

Fig. 4.2 Hypothetical example for spore size distribution during AMF species taxonomy
4.5 AMF Spore Colour 69

4.4 AMF Spore Shape

There are many described spore-shapes in AMF taxonomy (Walker 1983; Morton
et al. 1995; Oehl et al. 2008). These shapes may vary among species, and within
species (e.g., Funneliformis mosseae can show globose, subglobose and irregular
spores) (Al-Qarawi et al. 2013). Actually, there are nine described shapes: globose,
subglobose, elliptical, oblong, ovoid, irregular, triangular, knobby and pulvinate
(Redecker et al. 2013), but other unofficial denominations can be found in scientific
papers, such as funnel-shaped, rounded dome-shaped or tear-drop shaped (Nicolson
and Schenck 1979; Oehl et al. 2006, 2008).
Sometimes, this information is necessary during AMF species identification,
especially when a doubt occur. For example, if you are identifying two Scutellospora
species with the following characteristics below:
Species A = Spores without ornamentation on outer wall; spores light colored,
subhyaline to creamy to pale straw to greenish yellow; spores ellipsoid to oblong;
Species B = Species A = Spores without ornamentation on outer wall; spores light
colored, subhyaline to creamy to pale straw to greenish yellow; spores globose to
sub-globose;
According the Key to families and genus with spores formed on bulbous sporoge-
nous cells proposed by Oehl et al. (2008), we must classify species A as:
Scutellospora calospora, and species B as: Scutellospora dipurpurescens. Even
they have the same ornamentation kind, and spore colors, their shapes are
different.
This is just an example, but other doubts can surge during identification. Other
example would be: Spores with elliptical or oblong shape classified as
Claroideoglomus species. Is it possible? Of course not! Or a new Claroideoglomus
species was discovered here; or a big mistake occurred during identification, and
these spores are not Claroideoglomus species. This AMF genus just has species
with globose or subglobose spores, so classify its spores with other shape would be
not correct. Below I provide main spore-shape of AMF species (Table 4.2).

4.5 AMF Spore Colour

There are many variations of colors between AMF spores, varying from white to
black, with variants like bright, light, pale, dark for every single colour. These varia-
tions of colour and their variants occur between families, genus, and even in spores
of the same species (Oehl et al. 2006, 2008). Acaulospora capsicula can have dark
red-brown, red brown and orange brown spores, and these colors depend of the
spore maturity and integrity (Schüßler and Walker 2010).
It is a very useful characteristic when we are separating extracted spore for AMF
species identification, and to solve many doubts during AMF taxonomy (e.g., If you
want to describe Gigaspora species, this is a fundamental characteristic) (Gerdemann
and Trappe 1974; Nicolson and Schenck 1979; Hall and Fish 1979; Oehl et al. 2008).
70 4 Spores: A Special Tool to Survive

Table 4.2 Main spore shape from AMF species

Genus Species Shape
Acaulospora A. capsicula Globose/subglobose
A. colombiana Globose/subglobose
A. delicata Globose/subglobose
A. denticulata Globose/subglobose
A. dilatata Globose/subglobose
A. foveata Subglobose/irregular
A. kentinensis Ellipsoid/irregular
A. koskei Globose/subglobose/oblong/irregular
A. lacunosa Globose/subglobose/ellipsoid
A. laevis Globose/subglobose
A. mellea Globose/subglobose/irregular
A. morrowiae Globose/subglobose/irregular
A. rehmii Globose/subglobose/irregular
A. rugosa Globose/subglobose/irregular
A. scrobiculata Globose/subglobose/irregular
A. spinosa Globose/subglobose
A. tuberculata Globose/subglobose
Ambispora A. leptoticha Globose/subglobose/irregular
A. gerdemannii Globose/subglobose/irregular
Archaeospora A. schenckii Globose/subglobose/ellipsoid/ovoid
A. trappei Globose/subglobose/irregular
Cetraspora C. pellucida Globose/subglobose/ellipsoid/oblong
Claroideoglomus C. claroideum Globose/subglobose
C. etunicatum Globose/subglobose
C. lamellosum Globose/subglobose
C. luteum Globose/subglobose
Dentiscutata D. biornata Globose/subglobose
D. erythropa Subglobose/oblong
D. heterograma Globose/subglobose/oblong/ellipsoid
D. nigra Globose
D. reticulata Globose
D. rubra Globose/subglobose
Diversispora D. eburnea Globose/subglobose/irregular
D. epigea Globose/subglobose/ovoid
D. globifera Globose/subglobose/irregular
D. spurca Globose/subglobose
D. tortuosa Globose/subglobose/irregular
D. trimulares Globose/subglobose
Entrophospora E. infrequens Globose/subglobose
Funneliformis F. caledonius Globose/subglobose/irregular
F. coronatum Globose/subglobose/irregular
F. geosporus Globose/subglobose/irregular
F. mosseae Globose/subglobose/irregular
F. verruculosum Globose/subglobose/ovoid
(continued)
4.5 AMF Spore Colour 71

Table 4.2 (continued)

Genus Species Shape
Gigaspora G. albida Globose/subglobose
G. decipiens Globose/subglobose
G. gigantea Globose/subglobose/irregular
G. margarita Globose/subglobose
G. rosea Globose/subglobose
Glomus G. ambisporum Globose/subglobose
G. coremioides Globose/subglobose
G. hoi Globose/subglobose/ellipsoid/irregular
G. lacteum Globose/subglobose
G. multicaule Globose/subglobose/ellipsoid/triangular
Paraglomus P. brasilianum Globose/subglobose/irregular
P. occultum Globose/subglobose
Racocetra R. castanea Globose/subglobose
R. coralloidea Globose/subglobose
R. fulgida Globose/subglobose
R. gregaria Globose/subglobose
R. persica Globose/subglobose
R. verrucosa Globose/subglobose
Rhizophagus R. aggregatum Globose/oblong/irregular
R. clarus Globose/subglobose/ellipsoid/oblong/irregular
R. diaphanus Globose/subglobose/irregular
R. fasciculatus Globose/subglobose
R. irregularis Globose/subglobose/ovoid/oblong/irregular
R. intraradices Globose/subglobose/ellipsoid/oblong/irregular
R. manihotis Globose/subglobose/ellipsoid/oblong/irregular
R. sinuosum Globose/subglobose/pulvinate/irregular
Scutellospora S. calospora Subglobose/oblong/ellipsoid/irregular
S. cerradensis Subglobose/oblong/ellipsoid/irregular
S. dipurpurescens Subglobose/oblong/irregular
S. scutata Globose/subglobose/ellipsoid/oblong

I described below the main spore colour observed from several AMF species between
1974 and 2013 accordingly with Gerdemann and Trappe (1974), Tandy (1975),
Nicolson and Schenck (1979), Hall and Fish (1979), Oehl and Sieverding (2004), Oehl
et al. (2006, 2008):
• White: Occurs in Ambispora gerdemannii, A. leptoticha, Archaeospora schenckii,
A. trappei, Cetraspora pellucida, Dentiscutata heterograma, Diversispora ebur-
nea, D. epigaea, Gigaspora decipiens, G. margarita, Rhizophagus diaphanus,
and R. intraradices species;
• Hyaline: Occurs in Ambispora granatensis, Archaeospora schenckii, A. trappei,
C. pellucida, Paraglomus occultum, Rhizophagus aggregatus, R. diaphanus, R.
irregularis, and Scutellospora scutata species;
• Subhyaline: Occurs in Acaulospora delicata, A. morrowiae, A. rugosa, A. scro-
biculata, Diversispora spurca, and Paraglomus brasilianum species;
72 4 Spores: A Special Tool to Survive

• Cream: Occurs in Acaulospora spinosa, Ambispora gerdemannii, A. leptoticha,

Claroideoglomus claroideum, C. lamellosum, Dentiscucata heterograma,
Diversispora eburnea, D. epigaea, Gigaspora albida, G. decipiens, G. margar-
ita, G. roseae, Paraglomus occultum, Racocetra fulgida, and Rhizophagus intr-
aradices species;
• Pink: Occurs in Gigaspora rosea species;
• Pale yellow: Occurs in Acaulospora delicata, A. scrobiculata, Ambispora gerde-
mannii, A. leptoticha, Claroideoglomus lamellosum, C. luteum, Rhizophagus
manihots, Scutellospora calospora, and S. Dipurpurescens species;
• Light yellow: Occurs in Claroideoglomus claroideum, Diversispora epigaea,
and Funneliformis verruculosus species;
• Yellow: Occurs in Cetraspora pellucida, Diversispora globifera, Funneliformis
caledonius, F. geosporum, Gigaspora decipiens, Glomus pansihalos, and
Scutellospora calospora species;
• Bright yellow-brown: Occurs in Gigaspora gigantea species;
• Pale yellow-brown: Occurs in Acaulospora dilatata, A. koskei, A. morrowiae, A.
rehmii, A. rugosa, C. luteum, Diversispora spurca, D. tortuosa, D. trimulares, F.
mosseae, Gigaspora rosea, Rhizophagus clarus, R. fasciculatus, and R. maniho-
tis species;
• Light yellow-brown: Occurs in Acaulospora spinosa, Diversispora tortuosa,
Entrophospora infrequens, Rhizophagus intraradices, and R. irregularis species;
• Pale orange: Occurs in Acaulospora denticulata species;
• Orange: Occurs in Claroideoglomus etunicatum, and Diversispora epigaea
species;
• Pale orange-brown: Occurs in Acaulospora laevis, A. mellea, and A. spinosa
species;
• Orange-brown: Occurs in Acaulospora capsicula, A. colombiana, A. kentinensis,
A. lacunosa, A. laevis, A. mellea, A. rehmii, Ambispora gerdemannii, A. leptoti-
cha, Dentiscutata reticulata, Diversispora globifera, D. tortuosa, Funneliformis
caledonius, F. coronatum, R. verrucosa, and Sclerocystis sinuosum species;
• Dark Orange-brown: Occurs in Acaulospora colombiana, A. denticulata, A. ken-
tinensis, A. koskei, A. lacunosa, A. mellea, Ambispora gerdemannii, A. leptoti-
cha, Dentiscutata heterograma, D. rubra, Entrophospora infrequens,
Funneliformis coronatum, F. geosporum, and F. verruculosus species
• Red-orange: Occurs in Acaulospora foveata, and A. tuberculata species;
• Red-brown: Occurs in Acaulospora capsicula, Claroideoglomus etunicatum,
Dentiscutata erythropa, D. heterograma, D. rubra, Diversispora epigaea,
Racocetra coralloidea, and Racocetra gregaria species
• Brown: Occurs in Funneliformis mosseae, Glomus ambisporum, G. hoi, and G.
multicaule species;
• Dark red-brown: Occurs in Acaulospora capsicula, A. foveata, A. tuberculata,
Dentiscutata erythropa, D. nigra, D. reticulata, Racocetra coralloidea, and R.
gregaria species;
• Dark red: Occurs in Racocetra castanea, and R. Persica species;
• Black: Occurs in Dentiscutata nigra, and Glomus ambisporum species.
4.7 Performing AMF Species Identification 73

4.6 What about Formation Mode, Shape, and Colour

of AMF Spores?

These characteristics are very useful to divide possible spore types during their
extraction from field soil or trap cultures. AMF spores are manually collected and
separated by every morphotype, shape, and colour for further use, such as (1)
mounting AMF spores on slides to make vouchers or to perform AMF taxonomy;
(2) inoculating seedlings to establish a culture of each species or to assess their
effects on plant growth; (3) to perform germination assays; and finally (4) to extract
DNA and perform molecular characterization.
These steps are very laborious, especially if the researcher does not know all
AMF characteristics like these which I described before (Spore morphotype, size,
and colour). Some taxonomic expertise is needed to perform AMF morphotype
division, but if the spores are in good condition (e.g., spores extracted from trap
cultures), then anyone with observation skills can make the separations and initiate
monospecific cultures and identification to species.
But, for this last activity, other spores characteristics are needed to start AMF
species identification. Characteristics like: spore walls (presence of peridium,
number, and kind of layers), subtending hypha (shape, width, wall structure, com-
posite wall thickness, width of sporogenous cell, sporogenous cell wall structure,
occlusion), spore germination (germ tube emergence, presence of germination orb/
shield, color, shape and size of the germination orb/shield), germinal walls (num-
ber, and kind of layers), and sporiferous saccule (color, shape, size distribution,
saccule wall, saccule neck, distance from saccule to spore, presence of cicatrix,
pedicel, and occlusion).

4.7 Performing AMF Species Identification

After spore morphotypes division, the next step is to mount spores on slides, and to
perform AMF species identification based on spore morphological characteristics
(Schüßler et al. 2001). This procedure is very laborious, and hard to perform for the
first time, especially because a lot of reasons can alter the final result about some
new AMF description, most of which does not depend from researcher expertise
(Oehl et al. 2011; Krüger et al. 2012).
Spore structures consist of discrete elements within a single multinucleate cell
which often are hard to visualize after the cell is crushed (Redecker et al. 2013).
Spore phenotypes also are subject to change from their maturity or from action by a
range of biotic or abiotic factors (Krüger et al. 2012). Because of these, a lot of
disparity between AMF descriptions had occurred after the Phase III, but many
works were done to help us to solve them (Walker 1983, 1986). These works had
assigned a reference protocol based on spore walls and murographs for each unique
morphotype (Fig. 4.3).
74 4 Spores: A Special Tool to Survive

A C E G L M M' P U X
Fig. 4.3 Murographs presentation proposed by Walker (1983) and kind of spore walls: A amorphous
wall, C coriaceous wall, E evanescent wall, G germinal wall, L laminated wall, M membranous wall,
M′ membranous germinal wall, P peridium, U unit wall, X expansive wall

4.8 Spore Walls?

Spores of Glomeromycota have been described using a great range of walls, groups,
and components (Walker 1983; Morton et al. 1995; Oehl et al. 2008). These struc-
tures were known to be taxonomically important because they are highly conserved
and phenotypically stable in almost any environment condition (e.g., soil type, host-
plant or any other biotic or abiotic condition).
The study done by Walker in 1983 was the first work that tried to solve all the
confusion during Phase III (See Chap. 2), especially because new species were
being described at that time based on any detectable difference regardless of how
small were. He organized the various discrete phenotypes of spore subcellular struc-
tures into “wall” classes and then depicted each “wall” in murographs form for
standardization and ease of comparison (See these works for more details about
murographs: Walker 1983, 1986; Koske and Walker 1985; Morton 1986; Walker
and Sanders 1986; Almeida and Schenck 1990; Morton and Benny 1990; Oehl et al.
2006, 2008). The groundwork he laid was widely accepted at the Phase III and the
terminology was expanded as new “wall” phenotypes were discovered (Morton
1986; Walker 1986; Spain et al. 1989). Here, I briefly describe below the spore walls
described by Walker (1983), Berch and Koske (1986), Morton (1986), Walker
(1986) and Morton et al. (1995), Oehl et al. (2008).
• Amorphous wall: Morton (1986) describes this wall as being a colorless wall
inside spores that is highly plastic with applied pressure to crushed spores in
acidic mountants like PVLG or lactophenol. It stains red-purple to dark red-
purple in Melzer’s reagent. The definition of this structure is based on behavior
in an acidic environment, and thus distorts its true representation in nature. In
reality, it is just a thicker wall with longer-chained glucose moieties than a coria-
ceous wall (which in turn is just a thicker membranous wall).
• Coriaceous wall: Walker (1986) defines this structure as a colorless wall in
spores that is thicker than a membranous wall, but also is flexible and thus tough
to break. It was described a having a leather-like appearance in hypertonic solu-
tions. The problem with this structure is that the distinction between it and a
membranous wall sometimes was difficult because of overlapping variation and
phenotype.
4.8 Spore Walls? 75

• Evanescent wall: This wall is defined as “a unit or laminated wall that breaks
down and sloughs as the spore matures” (Walker 1983). Sometimes, phenotypes
that could be classified as laminated or membranous walls also may be evanes-
cent (Morton et al. 1995). Within this definition are embedded many different
phenotypes resulting from compositional differences among mostly unit walls,
like when AMF spores are visualized into Melzer’s reagent (Walker 1986).
• Expansive wall: Berch and Koske (1986) describe this wall as a unit wall which
expands and produces perpendicular striations in some mountants, such as lactic
acid or polyvinyl alcohol (PVLG). It must be the outermost wall of a spore for the
phenotype to be expressed. This wall probably is the most dubious because it is
likely an artefact of spore state (most were parasitized) and mounting conditions.
In reality, it represents a unit wall that has a chemical structure which responds to
acidic conditions by expanding and altering its appearance in the process.
• Germinal wall: Spain et al. (1989) describe this wall as the innermost wall only
in spores of Gigaspora species. It is of similar phenotype to layers of the laminated
wall, but forms warty protuberances or papillae prior to germ tube formation.
This is the only wall named for its function rather than structure (which is obvi-
ous only at the ultra-structural level). There really is no evidence that this is a
separate wall; it appears to have been defined to highlight its difference in func-
tion from the laminated wall.
• Laminated wall: According Walker (1983) this wall is defined as “A rigid wall
made of several layers laid down as the spore matures. Such a wall will have an
increasing number of layers as the spore ages.” Recognition of this wall was
fairly clear-cut as long as the laminations were laid down in such a way that they
could be resolved at the light microscope level. However, this criterion varied
greatly among species and genera.
• Membranous wall: It is defined as “a very thin, often colorless, wall that often
wrinkles and collapses in hypertonic solutions. It may be flexible, and some
times these walls do not break when a spore is crushed” (Walker 1983). The
surface of these walls may be smooth or beaded. This definition embodies very
similar walls based on their width, color, and shape, but which had very different
origins and relationships with neighboring walls (Oehl et al. 2008).
• Peridium: In some species of Claroideoglomus, Funneliformis, Glomus,
Rhizophagus, Sclerocystis, and Septoglomus (for those who fail to see the con-
tinuum in organization of spores of similar formative stages), spores develop a
hyphal network around individual spores and in small to large aggregates of
spores. This network presumably arises from the subtending hypha, although
critical developmental studies are needed.
• Unit wall: This structure is defined as “a single-layered, rigid wall clearly distin-
guished from others and consistent among spores of the same state of maturity
within a species” (Walker 1983). It can be found in all AMF genera, although it
often is confused with a laminated wall when the laminations are so adherent that
they cannot be discerned (e.g., young spores from Glomus species only have
what appear to be unit walls in youth, but these walls then become “laminated”
as new layers are laid down, or “evanescent” as they degrade and slough).
76 4 Spores: A Special Tool to Survive

Then, Walker (1983) developed the concept of spore wall group. He defined it as:
an aggregation of walls that are either adherent, or that remain close together when
a spore is crushed. This concept was very useful during Phase III, but unfortunately
after 90s where the number of new described species significantly growth, Walker’s
concept proved to be useless and very dependent of taxonomist’s expertise and
spore conditions (Morton 1993).
There was high variation within results from species identification until 1990
(Morton et al. 1995). This variation occurred because: (1) the conditions of
spores (fresh, fixed, parasitized, and maturity) often influence the degree of wall
separation; (2) the amount of pressure applied to a spore when it was crushed
on a slide; (3) and the type of mountant in which spores were placed (lactic
acid, PVLG, or PVLG + Melzer’s reagent). So, Walker’s wall definition even
served a very important function during the Phase III, as an organizing principle
for delimitation of taxonomic characters. It possessed two fatal flaws which
I describe below:
• According Morton (1993) these definitions were too “typological”, so that
they had to either change to accommodate new variants or new definitions had to
be erected.
• There was no connection between any biological process and the spore structures
described by Walker (1983), such as spore development (Morton 1993), and
without this connection, the definitions were unusable for systematic and phylo-
genetic approaches to understanding a natural taxonomic hierarchy of
Glomeromycota (Morton et al. 1995).
These both problems became acute when Morton et al. (1995) during their work
about cladistic analysis of AMF indicated that some spore walls were not truly inde-
pendent of each other, but rather were components of more complex structures, as
spore layers. These layers were organized by Morton et al. (1995) in one or more
walls within AMF spore. These walls were described as: Outer wall or just Spore
wall (composed by n layers: L1, L2, L3 … Ln), and Inner wall or Germinal wall (its
layers are described with the letter L but followed by Gw, like L1Gw1, L2 Gw2,
L1Gw2, L2Gw2… LnGwn) (Morton 1995).

4.9 What Are These Layers?

The layers described by Morton et al. (1995) basically are the same kind of spore
walls described by Walker (1983). The problems encountered with Walker’s termi-
nology were solved (Franke and Morton 1994), and other comparative studies then
were initiated to determine if the patterns observed by Morton et al. (1995) extended
to species in other genus and families. These studies led to a developmental model
for Glomeromycota and new terminology which reflected the nature of each struc-
tural character.
4.10 What About the Model Concept to Classify AMF? 77

Thus, to classify a new species or just one known species, we must divide the
classification in three main characters based on Morton’s concept (Morton et al.
1995), with emendation by Spain et al. (2006), and Oehl et al. (2008):
• Primary characters: We must consider primary characters the spore wall, as
described by Morton et al. (1995), where there are two walls (Outer and inner
wall), and these walls are made up by layers. We must consider pre-germination
structures and their several types too;
• Secondary characters: We must consider the spore walls described by Walker
(1983), but we must described them like layers which composed the primary
characters;
• Tertiary characters: Finally, we must describe spore mode of formation, shape,
colour, reaction in Melzer’s reagent, spore size, etc.

4.10 What About the Model Concept to Classify AMF?

The developmental concept presented by Morton et al. (1995), Spain et al. (2006),
and Oehl et al. (2008) was generated from exhaustive comparative studies of AMF
species isolates from trap cultures. The results of these studies provided a pattern
which is predictable for all species described until now. This pattern was used to
define the level of resolution of each discrete morphological spore character. But,
unfortunately we do not have a final universal model for all Glomeromycota yet
(Krüger et al. 2012; Redecker et al 2013).
Nowadays I recommend using the complex model described in specialized web
sites, such as INVAM and Dr. Schüßler web site (schuessler.userweb.mwn.de/
amphylo/) (Table 4.3). This model is distinctly hierarchical, in that there are spore
wall that are made up by layers, and every single layer has unique characteristics
and properties (Schüßler and Walker 2010).

Table 4.3 Main difference between the concept adopted by Walker (1983) and Morton et al.
(1995)+ emendations
Walker’s concept Morton’s concept emended by Spain et al. (2006) and Oehl et al. (2008)
Evanescent wall A layer originating as part of a spore wall (sloughing) which when intact
may be either homogenous or consist of sublayers
Laminated wall A single layer which originating as part of a spore wall which forms
sublayers as it grows in thickness
Unit wall A single layer originating as part of a spore wall (permanent)
Germinal wall A thin inner layer of a spore wall only in Gigaspora which forms a warty
surface prior to germination
Membranous wall A single thin hyaline layer originating as part of a spore wall (one
character) or as part of a separate flexible germinal wall (another character)
Coriaceous wall A thicker hyaline layer originating as part of a flexible germinal wall
Amorphous wall A plastic hyaline layer originating as part of a flexible germinal wall
Beaded wall A thin outer layer with surface excrescences which originates as part of a
flexible germinal wall
78 4 Spores: A Special Tool to Survive

Once it is understood, interpretations of taxonomic structures are more clear and

robust. Basically, the researcher must describe the following items: outer walls
(=spore walls), layers of outer walls, and their properties; inner walls (=germinal
walls), layers of inner walls, and their properties; and finally pre-germination struc-
tures. I introduce to you these items below, to keep them simple to describe.

4.11 Outer Walls

Each spore produces one outer wall, which is originated from the fertile hypha on
which the spore is borne. Within it a number of layers between one and three layers
(although rarely more than three) are synthesized. Usually, these layers are num-
bered from outermost to innermost (L1, L2, L3, etc.) (Schüßler and Walker 2010).
L1: remains continuous with the hyphal wall (e.g., Glomus species) or becomes
detached in sessile spores (e.g., Acaulospora species); this wall can be observed
like: unit (e.g., Diversispora eburnea), evanescent (e.g., Claroideoglomus claroi-
deum), expansive (e.g., Ambispora gerdemannii), membranous wall (e.g.,
Septoglomus constrictum). Rarely, it occurs like laminated wall such as in
Diversispora tortuosum and Sclerocystis sinuosum (Almeida and Schenck 1990;
Walker and Vestberg 1998; Kennedy et al. 1999; Kaonongbua et al. 2010; Schüßler
and Walker 2010; Oehl et al. 2011, and Krüger et al. 2012).
L2: grows within spore and differentiated mostly while the spore is expanding in
size. It occurs like: unit (e.g., Archaeospora schenckii), and laminated wall (e.g.,
Diversispora spurca) (Sieverding and Toro 1987; Pfeiffer et al. 1996).
L3 (and L4): When the spore ceases to expand these layers are formed (e.g.,
Claroideoglomus luteum), and generally, they are very similar to L2, and very hard
to see in young spores (Talukdar and Germida 1993).
All these layers may continue to differentiate their properties such as color (hyaline,
cream, pale, etc.), kind of surface (smooth, mucilaginous, granular, and reticulate),
permanence (permanent, and sloughing) rigidity (rigid, semi-rigid, semi-flexible, and
flexible), ornamentation (knobs, spines) (Schüßler and Walker 2010; Oehl et al. 2011)
(Table 4.4).

Table 4.4 Main types of Species L1 L2 L3 L4

layers of the outer wall found
Acaulospora capsicula E L L –
in different AMF species
A. colombiana U L L –
A. delicata E L – –
A. denticulata E L U –
A. dilatata E L L –
A. foveata E L L –
A. kentinensis E L – –
A. koskei E L L –
(continued)
4.11 Outer Walls 79

Table 4.4 (continued) Species L1 L2 L3 L4

A. lacunosa E L – –
A. laevis E L L –
A. mellea E L L –
A. morrowiae E L U –
A. rehmii E L L –
A. rugosa E L L –
A. scrobiculata E L L –
A. spinosa E L U –
A. tuberculata E L L –
Ambispora gerdemannii (acaulosporoid) X L L –
A. gerdemannii (glomoid) U L – –
A. leptoticha (acaulosporoid) X L L –
A. leptoticha (glomoid) U L – –
Archaeospora schenckii U U U –
A. trappei U U U –
Cetraspora pellucida U L L –
Claroideoglomus claroideum E E L –
C. etunicatum E L – –
C. lamellosum E L L –
C. luteum E E L L
Dentiscutata erythropa U L – –
D. heterograma U L U –
D. nigra U U – –
D. reticulata U L U –
D. rubra U L U –
Diversispora eburnea U L – –
D. epigea U L – –
D. globiferum U L U –
D. spurca U L – –
D. tortuosum L – – –
D. trimulares U L – –
Entrophospora infrequens E U L –
Funneliformis caledonius M U U L
F. coronatum U L – –
F. geosporus U L U –
F. mosseae M L L –
F. verruculosum U L – –
Gigaspora albida U L – –
G. decipiens U L – –
G. gigantea U L – –
G. margarita U L – –
G. rosea U L – –
Glomus ambisporum U L L –
G. clavisporum U U – –
(continued)
80 4 Spores: A Special Tool to Survive

Table 4.4 (continued) Species L1 L2 L3 L4

G. hoi U U – –
G. multicaule U – – –
G. pansihalos X L U –
Paraglomus brasilianum U U U –
P. occultum U U U –
Racocetra castanea U L – –
R. coralloidea U L – –
R. fulgida U L – –
R. gregaria U L – –
R. persica U L – –
R. verrucosa U L – –
Rhizophagus aggregatus U U – –
R. clarus M L L –
R. diaphanus M L L –
R. fasciculatus U L L –
R. intraradices M U L –
R. irregularis M U L –
R. manihotis M L L –
Sclerocystis sinuosum L – – –
Septoglomus constrictum M L – –
S. deserticola E L – –
S. viscosum M U L –
Scutellospora calospora U L – –
S. dipurpurescens U L – –
S. scutata U L L –
E evanescent, L laminated, M membranous, U unit, X expansive

4.12 Inner Wall

The inner wall also described as a flexible germinal wall consists of two bi-layered
walls groups (Gw1 and Gw2—rarely, there is a third inner wall like in same
Dentiscutata and Scutellospora species) (Oehl et al. 2011). Previously, these walls
have been treated as independent structures defined as a membranous wall, coria-
ceous wall, or amorphous wall accordingly with Walker (1983).
Inner walls is named as “flexible” because it folds to varying degrees depending
on its thickness and it is linked with formation of a germination orb (e.g.,
Acaulospora, and Entrophospora species) or a germination shield (e.g., Dentiscutata,
Racocetra, and Scutellospora species) (Kaonongbua et al. 2010; Oehl et al. 2011).
Their layers are described according: (a) degree of thickness; (b) degree of flexibil-
ity; and (c) reaction in Melzer’s reagent. Other significant property of their layers is
the occurrence of some ornamentation (granular excrescences and beads) on the
surface of Gw2.
4.12 Inner Wall 81

Unlike the outer wall, it is not naturally pigmented and thus sometimes may be
very hard to see (especially in Gigaspora and Racocetra species) if it is adherent to
the spore wall and we need to use differential interference optics microscopy or ultra-
structural procedures (Oehl et al. 2008, 2011). Inner wall is distinct from the outer
wall because its origins (It arises after synthesis of all layers of the outer wall), and it
has no physical connection to the subtending hypha (Schüßler and Walker 2010).
This wall does not occur in species from Family Archaeosporaceae,
Claroideoglomeraceae, Diversisporaceae, Geosiphonaceae, Glomeraceae, and
Paraglomeraceae (Schüßler and Walker 2010). So, I describe below several AMF
species that the inner wall (germinal wall) occurs and its kind of layers by every
single species (Table 4.5).

Table 4.5 Main types of layers of the inner wall found in different AMF species
Species L1Gw1 L2Gw1 L1Gw2 L2Gw2 L1Gw3 L2Gw3
Acaulospora capsicula M M Mb M – –
A. colombiana M M Mb A – –
A. delicata M M Mb M – –
A. denticulata M M Mb A – –
A. dilatata M U Mb A – –
A. foveata M M Mb C – –
A. kentinensis M M Mb A – –
A. koskei M M Mb M – –
A. lacunosa M M Mb A – –
A. laevis M M Mb M – –
A. mellea M U Mb A – –
A. morrowiae M M Mb A – –
A. rehmii M M Mb M – –
A. rugosa M M Mb A – –
A. scrobiculata M M Mb M – –
A. spinosa U U Mb M – –
A. tuberculata M M Mb C – –
Ambispora gerdemannii L – – – – –
(acaulosporoid)
A. leptoticha (acaulosporoid) L – – – – –
Cetraspora pellucida M M Mb C – –
Dentiscutata erythropa U U M M M M
D. heterograma Mo M M M – –
D. nigra M M M M – –
D. reticulata M M M M – –
D. rubra M M M M – –
Entrophospora infrequens L – – – – –
Gigaspora albida G/Mo – – – – –
G. decipiens G/Mo – – – – –
G. gigantea G/Mo – – – – –
(continued)
82 4 Spores: A Special Tool to Survive

Table 4.5 (continued)

Species L1Gw1 L2Gw1 L1Gw2 L2Gw2 L1Gw3 L2Gw3
G. margarita G/Mo – – – – –
G. rosea G/Mo – – – – –
Racocetra castanea M M – – – –
R. coralloidea M M – – – –
R. fulgida M M – – – –
R. gregaria M M – – – –
R. persica M M – – – –
R. verrucosa M M – – – –
Scutellospora calospora M M M A – –
S. dipurpurescens M M M A – –
S. scutata M M M A M A
A amorphous germinal wall, C coriaceous germinal wall, G germinal wall, L laminated wall, M
membranous germinal wall, Mb “Beaded” membranous germinal wall, Mo “Ornamented” mem-
branous wall, U unit germinal wall

4.13 Other Spore Structures

Sometimes, just describe subcellular structures of AMF spores are not enough, and
we need to describe other structures, such as subtending hypha, sporiferous saccule,
sporogenous cell, pre-germination structures, presence of peridium, cicatrix, or
pedicel (Schüßler and Walker 2010). These structures are unique, just occur in same
AMF genus, and I described their characteristics below:
• Subtending hypha: Occurs at the spore base in genus like: Acaulospora,
Ambispora, Claroideoglomus, Diversispora, Funneliformis, Glomus,
Paraglomus, Rhizophagus, Sclerocystis, and Septoglomus. Generally, we
describe its width, shape, wall structure, number of layers, and presence of occlu-
sion (Kennedy et al. 1999; Redecker et al. 2013);
• Peridium: A dense layer of hyphae, covering all spore surface and sometimes
must be removed to see AMF spores clearly. This structure generally occurs in
genus such as Diversispora, Glomus, Rhizophagus, and Sclerocystis (Schüßler
and Walker 2010);
• Sporiferous saccule: Occurs in acaulosporoid and entrophosporoid morphot-
ypes. They show several colors, shapes, sizes, number of walls, and distance
from saccule to spore. It occurs in genus like: Acaulospora, Ambispora,
Archaeospora, and Entrophospora. Their content can be disintegrated or hydro-
lyzed gradually with the spore maturity (Kaonongbua et al. 2010);
• Cicatrix: A scar generally formed by L2 of the outer wall that shows the region
of contact between spore and saccule neck during spore synthesis. It occurs in
genus like: Acaulospora, Archaeospora, and Entrophospora (Kaonongbua et al.
2010; Krüger et al. 2012);
4.14 How to Present a Described AMF Species? 83

• Pedicel: A short hyphal branch that links spore with the neck of the sporiferous
saccule when they are attached. This structure is a connecting point of L1 of the
outer wall and the wall of the neck of sporiferous saccule. It occurs in genus as
Acaulospora, and Ambispora (Kaonongbua et al. 2010);
• Sporogenous cell: Occurs at the spore base at several genus like: Cetraspora,
Dentiscutata, Gigaspora, Racocetra, and Scutellospora. Generally, we describe
its width, wall structure, number of layers, and presence of occlusion (Oehl et al.
2008, 2011);
• Pre-germination structures: They are formed as a requisite precursor to germ
tube formation. They differ in design and position among genus in Glomeromycota.
Usually, we can describe two different structures: Germination orb (e.g.,
Acaulospora, and Entrophospora species), and germination shield (e.g.,
Cetraspora, Dentiscutata, Racocetra, and Scutellospora (Oehl et al. 2008, 2011)).

4.14 How to Present a Described AMF Species?

After to perform a laborious work, it is time to organize all spore characteristics, and
you are thinking about how to organize and to present these characteristics. Is there
any model to present and to describe AMF? No, there is not a specific model to
describe AMF, but I recommend a model adopted by INVAM website, where the char-
acteristics of each species are presented together with photos of every characteristic.
This model has the following main information: (1) AMF species name and its
reference code; (2) whole spores; (3) subcellular structure of spores; (4) other struc-
tures information; (5) germination; (6) mycorrhizae; (7) molecular characteristics;
(8) notes and external links (Fig. 4.4).
In the section “AMF species name”, you must refer a name of species according
new Glomeromycota classification (See Chap. 5), and its reference code, accord-
ingly with the rules of the Convention on Biological Diversity (CBD)—Reference
codes can be designed to track country (or state) of origin.
For “Whole spore” section, you must describe: spore mode of formation, shape,
size, and color according I described at the beginning of this chapter. Here, you
must add photographs that will help you or other researchers for a future classifica-
tion or comparison with other described species. Generally, we have four photo-
graphs (but you can use how many you want): Fig. A = describe spore mode of
formation, shape, colour, and size—for young spores; Fig. B = the same information
of Fig. A, but for mature spores; Fig. C = graphical size distribution; and Fig.
D = describe sporocarps (if there is).
“Subcellular structures of spores” section must have all needed information
about outer and inner all (wall structures, number of layers, color, and reaction in
Melzer’s reagent). This is a very important section that will help to solve doubts
for future classifications and comparisons. For our example we used four photo-
graphs, every one for every described layer: Fig. E = L1 characteristics; Fig. F = L2
84 4 Spores: A Special Tool to Survive

Fig. 4.4 Model used to AMF species name (reference code)

describe and to present an
Whole spores
AMF species
Color: Fig.A Fig.B
Shape:
Size distribution: Fig.C Fig.D

Subcellular structure of spores

Outer wall
L1: Fig.E Fig.F
L2:
Inner wall
Gw1: Fig.G Fig.H
Gw2:
Other structures
Width:
Fig.I Fig.J
Shape:
Wall structure:
Germination
Fig.K

Mycorrhizae

Fig.L Fig.M Fig.N Fig.O

Molecular characteristics

Notes and external links

characteristics; Fig. G = Gw1 characteristics; and Fig. H = Gw2 characteristics, but

if you have a different number of layers you must use a compatible number for
your study case.
In “other structures” you must add unique characteristics of your described AMF
species, for example if there are: peridium—you must describe its characteristics;
subtending hypha—you must describe its width, shape, and colour. It is a useful
section to show you any possible mistakes that occur during AMF description.
Generally, Fig. I = shows a main vision about the described structures, and Fig.
J = shows a close vision with more details about pedicel, occlusion, or cicatrix. The
“germination” section is a complementary section of “other structures” used to
describe how the germination occurs, or how germination orb and germination
shield are—This information also is described in the Fig. K.
Also, we must add information about: (1) mycorrhizae (In “mycorrhizae” sec-
tion), like: arbuscules (Fig. L), vesicles (Fig. M), intraradical hyphae and intraradi-
cal spores (Fig. N), and extraradical hyphae and auxiliary cells (Fig. O) to
complement our entire AMF presentation; and (2) molecular characteristics (In its
section) with information about: rRNA genes, and beat-tubulin.
And finally, we must add in “notes and external links” especial information,
details and tips to see more easily a specific structure, references, publications with
this described AMF species, or possible videos about its description—step by step.
References 85

References

Almeida RT, Schenck NC (1990) A revision of the genus Sclerocystis (Glomaceae, Glomales).
Mycologia 82:703–714
Al-Qarawi AA, Mridha MAU, Dhar PP (2013) Report of Funneliformis mosseae (Nicol. & Gerd.)
Gerd. and Trappe from rangeland soil of Saudi Arabia. Res J Biotechnol 8:96–99
Ames RN, Schneider RW (1979) Entrophospora, a new genus in the Endogonaceae. Mycotaxon
8:347–352
Berch SM, Koske RE (1986) Glomus pansihalos, a new species in the Endogonaceae, Zygomycetes.
Mycologia 78:832–836
Franke M, Morton J (1994) Ontogenetic comparisons of arbuscular mycorrhizal fungi Scutellospora
heterogama and Scutellospora pellucida: revision of taxonomic character concepts, species
descriptions, and phylogenetic hypotheses. Can J Bot 72:122–134
Gerdemann JW, Nicolson TH (1963) Spores of mycorrhizal Endogone species extracted from soil
by wet sieving and decanting. Trans Br Mycol Soc 46:235–244
Gerdemann JW, Trappe JM (1974) Endogonaceae in the Pacific Northwest. Mycolgoia Mem
5:1–76
Goto BT, Maia LC (2006) Glomerospores: a new denomination for the spores of Glomeromycota,
a group molecularly distinct from the Zygomycota. Mycotaxon 96:129–132
Hall IR, Fish BJ (1979) A key to the Endogonaceae. Transactions of the Brithish Mycological
Society 73: 261–270
Kaonongbua W, Morton JB, Bever JD (2010) Taxonomic revision transferring species in
Kuklospora to Acaulospora (Glomeromycota) and a description of Acaulospora colliculosa sp.
nov. from field collected spores. Mycologia 102:1497–1509
Kennedy LJ, Stutz JC, Morton JB (1999) Glomus eburneum and Glomus luteum, two new species
of arbuscular mycorrhizal fungi, with emendation of Glomus spurcum. Mycologia
91:1083–1093
Koske RE, Walker C (1985) Species of Gigaspora (Endogonaceae) with roughened outer walls.
Mycologia 77:702–720
Krüger M, Krüger C, Walker C, Stockinger H, Schüßler A (2012) Phylogenetic reference data for
systematics and phylotaxonomy of arbuscular mycorrhizal fungi from phylum to species level.
New Phytol 193:970–984. doi:10.1111/j.1469-8137.2011.03962.x
McGee PA (1986) Further sporocarpic species of Glomus (Endogonaceae) from South Australia.
Trans Br Mycol Soc 87:123–129
Morton JB (1986) Effects of mountants and fixatives on morphology and Melzer’s reaction of
spores of two Acaulospora species (Endogonaceae). Mycologia 78:787–794
Morton JB (1995) Taxonomic and phylogenetic divergence among five Scutellospora species
(Glomales, Zygomycetes) based on comparative developmental sequences. Mycologia
87:127–137
Morton JB, Benny GL (1990) Revised classification of arbuscular mycorrhizal fungi (Zygomycetes):
a new order, Glomales, two new suborders, Glomineae and Gigasporineae, and two new families,
Acaulosporaceae and Gigasporaceae, with an emendation of Glomaceae. Mycotaxon 37:471–491
Morton JB, Bentivenga SP, Bever JD (1995) Discovery, measurement, and interpretation of diver-
sity in arbuscular endomycorrhizal fungi (Glomales, Zygomycetes). Can J Bot 73:25–32
Nicolson TH, Schenck NC (1979) Endogonaceous mycorrhizal endophytes in Florida. Mycologia
71:179–198
Oehl F, da Silva GA, Goto BT, Maia LC, Sieverding E (2011) Glomeromycota: two new classes
and a new order. Mycotaxon 116:365–379
Oehl F, Sieverding E (2004) Pacispora, a new vesicular arbuscular mycorrhizal fungal genus in the
Glomeromycetes. J Appl Bot 78:72–82
Oehl F, Souza F, Sieverding E (2008) Revision of Scutellospora and description of five new genera
and three new families in the arbuscular mycorrhiza forming Glomeromycetes. Mycotaxon
106:311–360
86 4 Spores: A Special Tool to Survive

Oehl F, Sýkorová Z, Redecker D, Wiemken A, Sieverding E (2006) Acaulospora alpina, a new

arbuscular mycorrhizal fungal species characteristics for high mountainous and alpine regions
of the Swiss Alps. Mycologia 98:286–294
Pfeiffer CM, Walker C, Bloss HE (1996) Glomus spurcum: a new endomycorrhizal fungus from
Arizona. Mycotaxon 59:373–382
Redecker D, Schüßler A, Stockinger H, Stürmer SL, Morton JB, Walker C (2013) An evidence-
based consensus for the classification of arbuscular mycorrhizal fungi (Glomeromycota).
Mycorrhiza 23(7):515–531. doi:10.1007/200572-013-0486-y
Schüßler A, Schwarzott D, Walker C (2001) A new fungal phylum, the Glomeromycota: phylog-
eny and evolution. Mycol Res 105:1413–1421
Schüßler A, Walker C (2010) The Glomeromycota: a species list with new families. Arthur
Schüßler & Christopher Walker, Gloucester. Published in December 2010 in libraries at The
Royal Botanic Garden Edinburgh, The Royal Botanic Garden Kew, Botanische Staatssammlung
Munich, and Oregon State University. Printed copy available under ISBN-13: 978-1466388048,
ISBN-10: 1466388048. http://www.amf-phylogeny.com
Sieverding E, Toro S (1987) Entrophospora schenckii: a new species in the Endogonaceae from
Colombia. Mycotaxon 28:209–214
Spain JL, Sieverding E, Oehl F (2006) Appendicispora: a new genus in the arbuscular mycorrhiza-
forming Glomeromycetes, with a discussion of the genus Archaeospora. Mycotaxon
97:163–182
Spain JL, Sieverding E, Schenck NC (1989) Gigaspora ramisporophora: a new species with novel
sporophores from Brazil. Mycotaxon 34:667–677
Stürmer SL, Morton JB (1999) Taxonomic reinterpretation of morphological characters in
Acaulosporaceae based on developmental patterns. Mycologia 91:849–857
Talukdar NC, Germida JJ (1993) Occurrence and isolation of vesicular-arbuscular mycorrhizae in
cropped fields soils of Saskatchewun, Canada. Can J Microbiol 39:567–575
Tandy PA (1975) Sporocarpic species of Endogonaceae in Australia. Aust J Bot 23:849–866
Walker C (1983) Taxonomic concepts in the Endogonaceae: spore wall concepts in species descrip-
tions. Mycotaxon 18:443–455
Walker C (1986) Taxonomic concepts in the Endogonaceae: II. A fifth morphological wall type in
endogonaceous spores. Mycotaxon 25:95–99
Walker C, Sanders FE (1986) Taxonomic concepts in the Endogonaceae: III. The separation of
Scutellospora gen. nov. from Gigaspora Gerd. & Trappe. Mycotaxon 27:169–182
Walker C, Trappe JM (1981) Acaulospora spinosa sp. nov. with a key to the species of Acaulospora.
Mycotaxon 12:515–521
Walker C, Vestberg M (1998) Synonymy amongst the arbuscular mycorrhizal fungi: Glomus cla-
roideum, G. maculosum, G. multisubstensum and G. fistulosum. Ann Bot 82:601–624
Wu C (1993) Glomales of Taiwan. III. A comparative study of spore ontogeny in Sclerocystis
(Glomaceae, Glomales). Mycotaxon 47:25–39
Wu C-G, Liu Y-S, Hwuang Y-L, Wang Y-P, Chao C-C (1995) Glomales of Taiwan: V. Glomus
chimonobambusae and Entrophospora kentinensis, spp. nov. Mycotaxon 53:283–294
Chapter 5
Glomeromycota Classification

Abstract I discuss in this chapter all Orders, Families, Genus and AMF species from
Phylum Glomeromycota. Currently, AMF are divided in four orders (Archaeosporales,
Diversisporales, Glomerales, and Paraglomerales), eleven families (Acaulosporaceae,
Ambisporaceae, Archaeosporaceae, Claroideoglomeraceae, Diversisporaceae,
Geosiphonaceae, Gigasporaceae, Glomeraceae, Pacisporaceae, Paraglomeraceae,
and Sacculosporaceae), twenty-five genus (Acaulospora, Ambispora, Archaeospora,
Cetraspora, Claroideoglomus, Corymbiglomus, Dentiscutata, Diversispora,
Funneliformis, Geosiphon, Gigaspora, Glomus, Intraornatospora, Otospora,
Pacispora, Paradentiscutata, Paraglomus, Racocetra, Redeckera, Rhizophagus,
Sacculospora, Sclerocystis, Scutellospora, Septoglomus, and Tricispora), and more
than 200 species. I also discuss about the type species, their spore characteristics
(outer and inner wall composition, pre-germination structures, and mycorrhiza),
and described an AMF specie list of each AMF genus reported in this chapter.

Keywords Glomeromycota • Archaeosporales • Diversisporales • Glomerales •

Paraglomerales

5.1 Introduction

Arbuscular mycorrhizal fungi is the one of the most important fungal groups that were
included in the order Glomerales by Morton and Benny (1990), and placed in the
Phylum Zygomycota until Phase IV (See Chap. 2), currently this fungal group is
placed in the Phylum Glomeromycota, and it is divided in four orders, eleven families,
twenty-five genus, and more than two-hundred species (Redecker et al. 2013) (Fig. 5.1).
As you know, all the AMF are obligate symbiotic organisms (Schüßler et al. 2001).
For the species described until now, they obtain their organic nutrients through an
obligate symbiosis with host plants (See Chap. 3), and in field condition, where there
are many stressful conditions, AMF hyphae net are the main useful way for mineral
nutrients uptake by host plant (Smith and Read 2008; Hodge and Storer 2014).
Several recent articles have drawn attention to the importance of the AMF.
They influence on plant biodiversity (Zhang et al. 2010), help to control nema-
todes (Rodríguez-Echeverría et al. 2008, 2009), and fungal pathogens (Cavagnaro
et al. 2001), and affect the fitness of plant in polluted and arid environments

© Springer International Publishing Switzerland 2015 87

T. Souza, Handbook of Arbuscular Mycorrhizal Fungi,
DOI 10.1007/978-3-319-24850-9_5
88 5 Glomeromycota Classification

Tricispora*
Otospora*
Diversisporaceae Diversispora
Corymbiglomus*
Redeckera
Acaulosporaceae Acaulospora
Sacculosporaceae Sacculospora*
Diversisporales Pacisporaceae Pacispora
Scutellospora
Gigaspora
Intraornatospora*
Gigasporaceae
Glomeromycota

Paradentistucata*
Dentiscutata
Cetraspora
Racocetra
Claroideoglomeracae Claroideoglomus
Glomus
Glomerales Funneliformis
Glomeraceae Septoglomus
Rhizophagus
Sclerocystis
Ambispora
Archaeosporales Geosiphon
Archaeospora
Paraglomerales Paraglomaceae Paraglomus

Fig. 5.1 AMF taxonomy proposed by Redecker et al. (2013), Krüger et al. (2012), and Oehl et al.
(2011); *Insufficient evidence, but no formal action taken

(Augé 2001; Verdin et al. 2006). The AMF thus have a profound influence on plant
community diversity and functionality, and the knowledge about this important fun-
gal group and its placement with the Kingdom Fungi is so necessary for any
researchers and/or students in this field of study.

5.2 Phylum Glomeromycota (Walker and Schüßler)

All species of this group have coenocytic septate mycelium, and form close symbi-
otic relationships with phoautotrophic organisms and cyanobacteria (= endocyto-
symbioses) (Redecker et al. 2013). Forming asexual spores by blastic development
of hyphal (subtending hypha, sporogenous cell, or sporiferous saccule), followed by
thickening of structural wall components and occlusion (e.g., occlusion by septum,
such as cicatrix or pedicel), spore-wall thickening, or deposition of an amorphous
plug in the lumen of the hyphal and spore (Schüßler and Walker 2010). Their spores
occur in the soil, roots, or on the soil surface, vegetation, or decaying fragments of
substrate (Schüßler and Walker 2010).
Some genus may present complex spores with a rigid, chitinous structural wall
component within a blastic terminal saccule, or by extension of a bulbous base, with
5.2 Phylum Glomeromycota (Walker and Schüßler) 89

or without inner wall components (germinal wall) (Morton and Benny 1990; Oehl
et al. 2011). Generally, spores are produced singly, in loose clusters (= with perid-
ium), in tight clusters (= without peridium), in sporocarps or within the roots of host
plants, like Rhizophagus intraradices species (Schüßler et al. 2001).
Glomeromycota have just one described class, Glomeromycetes, with the same
characters (Schüßler et al. 2001). This class is divided in four orders: Archaeosporales,
Diversisporales, Glomerales, and Paraglomerales (Redecker et al. 2013) which
I describe into this chapter.

5.2.1 Order Archaeosporales (Walker and Schüßler)

All species of this order are hypogeous. They may form two types of symbiotic
association:
• Endocytosymbioses: with photoautotrophic prokaryotes (e.g., Geosiphon
pyriformis);
• Endomycorrhiza: produce mycorrhizae with arbuscules and vesicles inside roots
of host plants (e.g., Archaeospora trappei).
Their spores are lacking pigmentation or reaction to Melzer’s reagent. This order
has with main characteristic the production of dimorphic propagules (acaulosporoid
and glomoid morphotypes) (Morton and Redecker 2001). Acaulosporoid morphot-
ypes are formed from a pedicel on the neck of a sporiferous saccule, and glomoid
morphotypes are formed singly or in loose clusters on or in the soil, acaulosporoid
complex spores formed singly in the soil. Dense spore clusters unknown.
Sometimes its species may be confused with species from family
Acaulosporaceae or Glomeraceae (Schüßler et al. 2001). Differing from other
arbuscular mycorrhizal fungi by the possession of the rRNA SSU gene sequence
YCTATCYKYCTGGTGAKRCG, corresponding to homologous position 691 of
the Saccharomyces cerevisiae SSU rRNA sequence. This order can be considered
the oldest order within Phylum Glomeromycota (Schüßler et al. 2001).
Archaeosporales is currently divided in three families: Ambisporaceae,
Archaeosporaceae, and Geosiphonaceae (Redecker et al. 2013).

5.2.1.1 Family Ambisporaceae (Walker, Vestberg and Schüßler)

AMF species that produces monomorphic or dimorphic propagules: acaulosporoid

and glomoid morphotype (Morton and Benny 1990; Walker et al. 2007a).
Acaulosporoid morphotype are formed from a pedicel on the neck of a sporiferous
saccule, it also has multilayered outer wall with a semi-pilable inner wall. Outer
wall forms crazed surface, cerebriforme folds or both that is highly unstable and
degrades. The inner wall of the spores provides diagnostic features for each species
(Walker et al. 2007b).
90 5 Glomeromycota Classification

Glomoid morphotype generally shows hyaline colour with bilayered outer wall
and subtending hyphae lacking discrete species level characters. This morphotype
may be formed singly or in clusters (Redecker et al. 2000).
AMF species from Family Ambisporaceae are distinguished from other species
from Archaeosporales by: (1) its dimorphism; (2) unique spore morphology; (3) its
rDNA characteristics; (4) biochemical properties; and (5) its AMF structures char-
acteristics—mycorrhizas are mostly arbuscular; vesicles produced rarely; staining
is typically very faint (Wright et al. 1987; Graham et al. 1995; Spain et al. 2006;
Walker et al. 2007a, b).
Genus Ambispora (Walker, Vestberg and Schüßler)
AMF species of this genus may form monomorphic and dimorphic propagules, in
the soil (= fungi hypogeous) (Spain et al. 2006; Walker et al. 2007a).
• Glomoid morphotype:
Glomoid morphotype is formed singly in the soil or in loose clusters, pliable, dif-
fering from the normally brittle nature of such spores in the genus Glomus; usually,
this morphotype have propagules hyaline to pale cream in color, with two-layered
outer wall continuous with a bi-layered subtending hypha. Open-pored sealed by a
septum from the L2 component (Walker et al. 2007a; Walker 2008).
• Acaulosporoid morphotype:
Generally, this morphotype is formed, from a pedicel (= short branch hypha),
with in turn branches from the sporiferous saccule. Saccules expand blastically
at the end of a fertile hypha, and cease its expansion at the onset of spore forma-
tion. Acaulosporoid morphotype may retain the pedicel after saccule detachment
or appear sessile if the pedicel breaks off at the spore base. Usually, this morpho-
type have a three-layered outer wall, which L1 can degrade to varying degrees or
can slough completely; L2 is continuous with inner wall of the pedicel branching
from the neck of the sporiferous saccule; and L3 has unique properties, which, in
combination with L2 are diagnostic for each species of this genus. Inner wall
formation does not occur in this genus (Morton et al. 1997; Walker et al. 2007b).
Ambispora genus differs from other genus in the Archaeosporales by: (1) the
possession of the rRNA SSU gene sequence CAAAACCAATCTCGTCTTCGGGC;
and (2) its mycorrhizae characteristics (See Table 5.1)
Ambispora type species: Ambispora fennica Walker, Vestberg and Schüßler
Acaulosporoid propagules are formed singly in the soil, laterally in the neck of a
sporiferous saccule that collapses and may detach at maturity; they show hyaline to
pale ochraceous spores with globose to subglobose to pyriform shape, 124–
201 × 134–201 μm diam (n = 100), attached to the saccule (199–248 μm diam,
n = 15) by a slightly raised collar or by a thickened stalk.
Outer wall consisting of three layers (L1, L2, and L3):
L1 = a roughened, and granular component (up to 4 μm thick) that tends to disinte-
grate with time; This layer also expand to up to 15 μm thick on crushing in
PVLG, reacting to Melzer’s reagent to become rust-brown or red;
5.2 Phylum Glomeromycota (Walker and Schüßler) 91

Table 5.1 Mycorrhizae characteristics from Ambispora genus

Structures Characteristics
Arbuscules Narrow trunks hypha (<4 μm), with fine branching near tips; It stains
very faint
Vesicles Not described yet
Auxiliary cells Absent
Intraradical hyphae Spread intra- and inter-cellularly, 3–10 μm wide; often coiled and the
latter 2–8 μm wide, with some coiling and irregular branching; It tends
to stain slightly less faintly than arbuscules
Extraradical hyphae Generally, it is thin (2–3 μm wide), but profuse around roots
Entry point Appressoria; They often remain attached to roots in entry point regions
Mycorrhiza Very patchy
distribution

L2 = a semi-rigid layer, 2.5–4 μm thick; continuous with the wall of the pedicel;
consisting of sublayers (laminate) that usually are adherent, but which some-
times separate slightly.
L3 = a hyaline, rigid, relatively thick (up to 4 μm), fracturing and splitting on crush-
ing, becoming yellow in Melzer’s reagent.
Inner wall is hyaline, semi-flexible, 3 μm thick (very thin); consisting of multiple
sublayers that can split into three components: a thin outer and inner layer and thick
middle layer with no reaction in Melzer’s reagent.
Glomoid morphotype, hyaline to white to very pale yellow; globose, subglobose,
often irregular; 38–130 × 38–117 μm (n = 100), with a thin bi-layered outer wall (L1
and L2) which are adherent.
L1 = hyaline to very pale yellow, evanescent, with a flaky surface, less than 1 μm
thick, not reacting visibly with Melzer’s reagent when intact; and adherent to L2
L2 = hyaline to subhyaline, laminated (its sublayers increase in number with thick-
ness), that is up to 3 μm thick; the inner sublayers of L2 may appear wrinkled
within minute folds because of this resiliency, suggesting (erroneously) the pres-
ence of a very thin inner wall (= germinal wall).
Subtending hypha normally funnel-shaped (rarely cylindrical, with a slight con-
striction at the spore base). Pore open or occluded by a distal septum formed by L2.
A. fennica is separated from other species in the Archaeosporales by the possession of
the rRNA SSU gene sequence GGAGAGTCGGCATGTCCTTTGTTGGGTGTGCC.
Other Ambispora species:
• Ambispora appendicula (Spain, Sieverd. & N.C. Schenck) C. Walker (2008).
Mycol. Res. 112(3): 298
• Ambispora brasiliensis B.T. Goto, L.C. Maia & Oehl (2008). Mycotaxon 105: 13
• Ambispora callosa (Sieverd.) C. Walker, Vestberg & A. Schüßler, in Walker,
Vestberg, Demircik, Stockinger, Saito, Sawaki, Nishmura & Schüßler (2007).
Mycol. Res. 111(2): 148
92 5 Glomeromycota Classification

• Ambispora fecundispora (N.C. Schenck & G.S. Sm.) C. Walker (2008). Mycol.
Res. 112(3): 298
• Ambispora gerdemannii (S.L. Rose, B.A. Daniels & Trappe) C. Walker, Vestberg
& A. Schüßler, in Walker, Vestberg, Demircik, Stockinger, Saito, Sawaki,
Nishmura & Schüßler (2007). Mycol. Res. 111(2): 148
• Ambispora granatensis J. Palenzuela, N. Ferrol & Oehl in Palenzuela, Barea,
Ferrol & Oehl (2010). Mycologia 103, published online on 17 Oct 2010 as
doi:10.3852/09-146.
• Ambispora jimgerdemannii (Spain, Oehl & Sieverd.) C. Walker (2008). Mycol.
Res. 112(3): 298
• Ambispora leptoticha (N.C. Schenck & G.S. Sm.) C. Walker, Vestberg &
A. Schüßler, in C. Walker, Vestberg, Demircik, Stockinger, Saito, Sawaki,
Nishmura & Schüßler (2007). Mycol. Res. 111(2): 148 (2007).

5.2.1.2 Family Archaeosporaceae (Morton and Redecker)

All Archaeosporaceae species form mycorrhizae consisting of intraradical hyphae

and arbuscules. These structures are similar between it and Paraglomeraceae, but
distinctive from those other families from Phylum Glomeromycota. Colonization
units stain weakly or not at all in trypan blue and are patchily distributed (Morton
and Benny 1990).
At the molecular level, the fatty acid C16:1 ω7 cis is shared by Ambispora lep-
toticha, Ambispora gerdemannii, and Paraglomus occultum but is absent in 23 spe-
cies examined from other Glomeromycota families (Graham et al. 1995). Both of
these species, along with all taxa in Gigaspora, also lack C16:1 ω5 cis. These fatty
acids are hypothesized to be shared by all taxa in Archaeosporaceae and
Paraglomeraceae. The 18S rDNA primer sequence TGCTAAATAGCCAGGCTGY
uniquely amplifies members of this group as well as members of Paraglomeraceae
(Redecker et al. 2000).
Species in Archaeosporaceae have several unique morphological features:
• Spores formed on the fungal thallus are either monomorphic or dimorphic. When
monomorphic, only acaulosporoid morphotype is formed. When dimorphic,
both acaulosporoid and glomoid morphotypes are formed. All acaulosporoid
morphotypes develop directly from the neck of a sporiferous saccule or on a
hypha (or pedicel) branching from the saccule neck. Glomoid spores develop
blastically from the tip of a subtending hypha and are indistinguishable from
spores of species in Glomeraceae.
• Subcellular morphology of the acaulosporoid spores differs from that of species
in Acaulosporaceae. Subcellular spore structure consists of layers of an outer
wall of which L1 is continuous with the monolayer wall of the neck of the spo-
riferous saccule; spores do not form thin flexible inner wall and germination orb.
5.2 Phylum Glomeromycota (Walker and Schüßler) 93

Table 5.2 Mycorrhizae characteristics from Archaeospora genus

Structures Characteristics
Arbuscules Narrow trunks hypha (<4 μm), with fine branching near tips; It stains very
faint
Vesicles Absent
Auxiliary cells Absent
Intraradical Spread intra- and inter-cellularly, 3–10 μm wide; often coiled and the
hyphae latter 2–8 μm wide, with some coiling and irregular branching; It tends to
stain slightly less faintly than arbuscules
Extraradical Generally, it is thin (2–3 μm wide), but profuse around roots
hyphae
Entry point Appressoria; They often remain attached to roots in entry point regions
Mycorrhiza Very patchy
distribution

Genus Archaeospora (Morton and Redecker)

Spore morphology and development are as described for the family Archaeosporaceae.
Mycorrhizae characteristics are summarized in the Table 5.2.
Archaeospora type species: Archaeospora trappei (Ames and Linderman)
Morton and Redecker
Germination has been observed in only two spores of A. leptoticha, and A. gerde-
mannii despite numerous attempts. The germ tube appears to form in the lumen of
the spore pedicel, a behavior similar to that of Glomus species (Morton and Benny
1990). Elucidation of the full generic potential of all species in this genus for germi-
nation must await more observation in all taxa of the genus (Redecker et al. 2000;
Sieverding and Oehl 2006).
The three species of Archaeospora can be distinguished from Paraglomus and all
other fungi but the signature sequence TCTCKKYTTCGGYSGAGTCC at position
227 of the 18S rDNA gene. This signature and other traits of the genus described
earlier offer powerful diagnostic criteria to establish membership by other mycor-
rhizal species. The degeneracy of this sequence reflects the variation among the taxa
in that genus and leaves room for discovering new members (Schüßler and Walker
2010).
Spores completely hyaline (rarely creamy white in young spores); globose, sub-
globose, or irregular; 40–80 μm in diam (mean = 58 μm, n = 109); tending to float in
water.
The outer wall consists of three hyaline flexible layers (L1, L2, and L3).
L1 = hyaline layer; semi-flexible; less than 1 μm thick; continuous with the wall of
the sporiferous saccule; usually separating easily from L2 in broken spores.
L2 = hyaline layer; semi-flexible; less than 0.7 μm thick; adherent to L3;
L3 = hyaline; semi-flexible; 1.3–2.5 μm thick; with L2, they form an endospore
which separates the spore contents from that of the saccule neck.
94 5 Glomeromycota Classification

The sporiferous saccule is hyaline; oblong; 40–48 × 50–72 μm diam; usually

positioned in a vertical plane in water so that many are partially to completely hid-
den below spores when they are floating. The saccule wall consists of one layer
usually coated with granular material, 0.5–1.0 μm thick. Distance between spore
and saccule is 10–30 μm. The cicatrix, or scar, on the spore where it was attached to
the neck of the sporiferous saccule has a very thin shallow ridge and is 6–8 μm diam
(Morton and Redecker 2001).
Spores are easily mistaken for Paraglomus occultum or P. brasilianum under a
stereomicroscope because of similarities in size and absence of pigmentation.
However, they tend to be more globose and lack a subtending hypha when saccules
become detached (Schüßler and Walker 2010).
Other Archaeospora species:
• Archaeospora schenckii (Sieverding and Toro) Walker and Schüßler =
Entrophospora schenckii Sieverd., E. and S. Toro: a new species in the
Endogonaceae from Colombia (1987). Mycotaxon 28: 209–214

5.2.1.3 Family Geosiphonaceae (Engler and Gilg)

Only one genus (Geosiphon) and one species (Geosiphon pyriformis) comprise this
family, which is defined as fungi with coenocytic mycelium that grows hypogeously
in soil, forming glomoid asexual spores singly or in loose clusters in soil; live in
association with endosymbiotic cyanobacteria in the genus Nostoc. SSU sequence
data place this group as a deeply rooted sister clade together with Archaeosporaceae
and Ambisporaceae (Schüßler et al. 2001). Systematics of the species in this family
was review by Schüßler (2002).
Genus Geosiphon (Kütz) Wettst.
This genus is usually used in many works as an AMF species-model for symbiotic
relationships (Schüßler 2012), since studies involving nutrient exchanges between
AMF and vascular plants are difficult to conduct. Through the symbiosis between
G. pyriformis and bacteria of the genus Nostoc were possible to study the follow-
ing mechanisms: symbiosis phases; AMF nutrients uptake; identification of genes
that play important roles in the exchange of nutrients; cell biology and recognition
of partners; and the evolution of this genus. Despite its simplicity the study of this
kind is of paramount importance in scientific advances in AMF taxonomy
(Schüßler 2002).
Geosiphon type species: Geosiphon pyriformis (Kütz) Wettst. emend. Schüßler
G. pyriformis forms unicellular, multinucleated cells (= bladders) of about 1–2 mm
in size. Its cells results from Nostoc incorporation by a hypha, and every cell repre-
sent a polyenergid cell, coenocytic with the fungal mycelium. Its cells are deformed
during the early symbiosis stages, and some cells may die during this process. The
outgrowing of the hyphal tip form an irregularly shaped structure, which then
swells, and after some days the young cell shows a diameter of up to 100 μm.
5.2 Phylum Glomeromycota (Walker and Schüßler) 95

Individual G. pyriformis cells can reach more then 2 mm in length, and show a
turgor pressure of about 0.6 mPa and live for up to 6 months in laboratory cultures
(Schüßler 2002; Adams et al. 2006)

5.2.2 Order Diversisporales (Walker and Schüßler)

AMF species of this order are hypogeous or partly hypogeous. They form arbuscu-
lar mycorrhizas with arbuscules, often lacking vesicles and auxiliary cells (Schüßler
et al. 2001). Their spores may be produced:
• Within a sporiferous saccule (Acaulosporoid morphotype) (Kaonongbua et al.
2010);
• From a bulbous base on the sporiferous hypha (Gigasporoid morphotype)
(Gerdemann and Trappe 1974);
• From a subtending hyphae (Glomoid morphotype) (Schüßler and Walker 2010).
Their species differ from other Glomeromycota by the possession of the rRNA
SSU gene sequence signature: GGGTTTH and TYACCGGRAGGTRT correspond-
ing to homologous position 234 and 1495, respectively, of the S. cerevisiae SSU
rRNA sequence (Walker and Schüßler 2004). Diversisporales is currently divided in
five families: Acaulosporaceae, Diversisporaceae, Gigasporaceae, Pacisporaceae,
and Sacculosporaceae (Redecker et al. 2013).

5.2.2.1 Family Acaulosporaceae (Morton and Benny)

All species of this family form spores on/or within a cylindrical or funnel-shaped
hypha terminating in a sporiferous saccule; sessile after detachment from the sac-
cule neck. Both sporiferous saccules and spores are borne singly, but occasionally
they may form aggregates (Kaonongbua et al. 2010).
Spores have a bi-layered outer wall (L1 = evanescent layer, and L2 = unit or lami-
nated layer), and two bi-layered inner hyaline flexible walls (L1Gw1, L2Gw1,
L1Gw2, and L2Gw2) on which the germination orb always develops after the spore
has completed all stages. Spore germination occurs with a germ tube emerging from
germination orb between Gw1 and Gw2. Spore wall material appears to seal the
opening to the neck of the sporiferous saccule.
Genus Acaulospora (Gerd. and Trappe) emend. Berch
All species of this genus produce sporiferous saccule that develops blastically from
a hyphal tip. After the saccule has become fully expanded, a spore begins to develop
laterally on the neck of the sporiferous saccule. Spores are formed singly in soil;
generally show globose or subglobose shape; with oily contents. As the spore
matures, the saccule loses its contents and eventually sloughs off so that it often in
not attached to fully mature spores (= sessile) (Gerdemann and Trappe 1974). Spore
96 5 Glomeromycota Classification

Table 5.3 Mycorrhizae characteristics from Acaulospora genus

Structures Characteristics
Arbuscules Narrow trunks (>15 μm); It stains with variable intensity in trypan blue,
ranging from pale to medium blue and moderate contrast
Vesicles Usually oblong to irregular and attached hyphae are distributed mostly in
clusters and usually near entry points
Auxiliary cells Absent
Intraradical hyphae Hyphae coils, 4–6 μm wide; It tends to stain with variable intensity, like
its arbuscules
Extraradical hyphae Frequent coiling, thin (4–8 μm wide), but profuse around roots
Entry point “Foraging” hyphae that grow from entry points; They staining is darkest
here
Mycorrhiza Form small clusters near the entry points
distribution

walls continuous except for a small occluded pore. Germ tubes produced directly
through walls near spore base. Their species may form mycorrhizas with lobed
vesicles and arbuscules (Kaonongbua et al. 2010). The distinction between
Acaulospora and other families of Diversisporales, lies exclusively in its mycor-
rhizae structures (Table 5.3).
Acaulospora type species: Acaulospora laevis Gerd. and Trappe
Acaulospora laevis forms singly sessile spores in soil; salmon to orange-brown,
most pale orange-brown; globose, subglobose shape; 140–240 μm diam, mean
198 μm (n = 85); and with an ovoid scar that indicate region of contact between
spore and saccule neck during synthesis (Gerdemann and Trappe 1974).
Spores are formed laterally on a wide, thin-walled hypha (30–40 μm diam) that
terminates nearby in a globose, thin-walled vesicle. Vesicle approximately the same
size as the spore, developing to full size prior to spore formation, with dense, white
contents, becoming empty and shrunken at spore maturity and then usually lost in
sieving.
Spores consist of three-layered outer wall (L1, L2, and L3), and two bi-layered
inner wall (L1Gw1, L2Gw1, L1Gw2, L2Gw2).
L1 = Hyaline; smooth; 1.2–2.0 μm thick; continuous with wall of the neck of the
sporiferous saccule; evanescent layer;
L2 = Pale orange-brown to darker orange-brown; smooth; 1.6–2.8 μm thick; lami-
nate layer that consist of very fine and often adherent sublayers, with no reaction
in Melzer’s reagent;
L3 = Lighter yellow-brown; 1.6 μm thick; laminate layer that consist of very fine
tightly adherent sublayers, with no reaction in Melzer’s reagent too.
Gw1 = Two tightly adherent hyaline layers (L1 and L2) are formed. L1 is less than
0.5 μm thick. L2 is 1.0–1.8 μm thick;
Gw2 = Two tightly adherent hyaline layers (L1 and L2) are formed. L1 is 0.5–0.8 μm
thick and coated on the surface with granular excrescences (or “beads”) that tend
to become dislodged and float away when pressure is applied to it. These “beads”
5.2 Phylum Glomeromycota (Walker and Schüßler) 97

are stabilized after preservation in formalin, but otherwise may be absent on

mounted spores within a few weeks to months of storage. L2 is 0.5–1.0 μm thick
and generally is nonreactive in Melzer’s reagent (on rare occasion producing a
very pale pink reaction).

Other Acaulospora species:

• Acaulospora alpina Oehl, Sýkorová & Sieverd., in Oehl, Sýkorová, Redecker,
Wiemken & Sieverding (2006). Mycologia 98(2): 289
• Acaulospora bireticulata F.M. Rothwell & Trappe (1979). Mycotaxon 8(2): 472
• Acaulospora capsicula Błaszk. (1990). Mycologia 82(6): 794
• Acaulospora cavernata Błaszk. (1989). Cryptog. Bot. 1(2): 204
• Acaulospora colliculosa Kaonongbua, J.B. Morton & Bever (2010). Mycologia,
102(6): 1501–1503
• Acaulospora colombiana (Spain & N.C. Schenck) Kaonongbua, J.B. Morton &
Bever (2010). Mycologia, 102(6): 1501
• Acaulospora colossica P.A. Schultz, Bever & J.B. Morton (1999). Mycologia
91(4): 677
• Acaulospora delicata C. Walker, C.M. Pfeiff. & Bloss (1986). Mycotaxon 25(2):
622
• Acaulospora denticulata Sieverd. & S. Toro (1987). Angew. Bot. 61(3–4): 217
• Acaulospora dilatata J.B. Morton (1986). Mycologia 78(4): 641
• Acaulospora elegans Trappe & Gerd. (1974). Mycol. Mem. 5: 34
• Acaulospora entreriana M.S. Velázquez & Cabello (2008). Mycotaxon 103: 179
• Acaulospora excavata Ingleby & C. Walker (1994). Mycotaxon 50: 100
• Acaulospora foveata Trappe & Janos, in Janos & Trappe (1982). Mycotaxon 15:
516
• Acaulospora gedanensis Błaszk. (1988/1987) Karstenia 27(2): 38
• Acaulospora kentinensis (C.G. Wu & Y.S. Liu) Kaonongbua, J.B. Morton &
Bever (2010). Mycologia, 102(6): 1501
• Acaulospora koskei Błaszk. (1995). Mycol. Res. 99(2): 237
• Acaulospora lacunosa J.B. Morton (1986). Mycologia 78(4): 643
• Acaulospora longula Spain & N.C. Schenck, in Schenck, Spain, Sieverding &
Howeler (1984). Mycologia 76(4): 689
• Acaulospora mellea Spain & N.C. Schenck, in Schenck, Spain, Sieverding &
Howeler (1984). Mycologia 76(4): 689
• Acaulospora morrowiae Spain & N.C. Schenck [as ‘morrowae’], in Schenck,
Spain, Sieverding & Howeler (1984). Mycologia 76(4): 692
• Acaulospora myriocarpa Spain, Sieverd. & N.C. Schenck, in Schenck, Spain &
Sieverding (1986). Mycotaxon 25(1): 112
• Acaulospora nicolsonii C. Walker, L.E. Reed & F.E. Sanders (1984). Trans. Br.
Mycol. Soc. 83(2): 360
• Acaulospora paulinae Błaszk. (1988). Bulletin of the Polish Academy of
Sciences, Biological Sciences 36(10–12): 273
• Acaulospora polonica Błaszk. (1988/1987) Karstenia 27(2): 38
• Acaulospora rehmii Sieverd. & S. Toro (1987). Angew. Bot. 61(3–4): 219
98 5 Glomeromycota Classification

• Acaulospora rugosa J.B. Morton (1986). Mycologia 78(4): 645

• Acaulospora scrobiculata Trappe (1977). Mycotaxon 6(2): 363
• Acaulospora spinosa C. Walker & Trappe (1981). Mycotaxon 12(2): 515
• Acaulospora splendida Sieverd., Chaverri & I. Rojas (1988). Mycotaxon 33: 252
• Acaulospora sporocarpia S.M. Berch (1985). Mycotaxon 23: 409
• Acaulospora taiwania H.T. Hu (1988). Quarterly Journal of Chinese Forestry
21(2): 48
• Acaulospora thomii Błaszk. (1988/1987). Karstenia 27(2): 40
• Acaulospora tuberculata Janos & Trappe (1982). Mycotaxon 15: 519
• Acaulospora undulata Sieverd. (1988). Angew. Bot. 62(5–6): 373
• Acaulospora walkeri Kramad. & Hedger (1990). Mycotaxon 37: 73

5.2.2.2 Family Diversisporaceae (Walker and Schüßler)

AMF species of this family produce glomoid, acaulosporoid and entrophosporoid

propagules, and their germination not accompanied by formation of a germination
shield (Walker and Schüßler 2004).
• Glomoid morphotype are formed singly, in clusters, or in large disorganized spo-
rocarps with high spore numbers. In pigmented spores, subtending hyphae con-
spicuously change color, becoming hyaline to white behind the septum;
subtending hyphae generally straight, cylindrical, in some species constricted or
inflated. Spores with 1–3 wall layers; pore often closed with a septum that may
arise from innermost wall lamina, an overlaying laminate layer, or from both;
Subtending hypha pore rarely open.
• Acaulosporoid morphotype are formed laterally on the persistent neck of a ter-
minal or intercalary sporiferous saccule at some distance from the saccule termi-
nus; spore pore generally closed by a septum at spore base.
• Entrophosporoid morphotype are formed within the evanescent neck of a tightly
attached terminal or intercalary sporiferous saccule, closely attached to the sac-
cule terminus which is often smaller in size than the mature spores attached,
rarely equal in size; some spores can show two cicatrices formed by the outer
wall pigmented structural layer.
Diversisporaceae differs from other families in the Diversisporales in the posses-
sion of specific SSU rRNA gene sequence signatures, GGCTCATTYGRRTYTS,
ACYCATTRYCAGGCTTAATT, and TTGGCATTTAGYCA, corresponding to
homologous position 487, 648, and 1389, respectively, of the S. cerevisiae SSU
rRNA sequence.
Genus Corymbiglomus Błaszk. and Chwat, emend.
Species of this genus form glomoid propagules that are individually covered with a
hyphal mantle (= peridium) consisting of non-branched or branched hyphae with or
without terminal vesiculate swellings (Błaszkowski and Chwat 2013).
Corymbiglomus spores are formed singly or in clusters. Clusters with two to
three spores grouped by interwoven hyphae of their hyphal mantle or with 2 to <20
5.2 Phylum Glomeromycota (Walker and Schüßler) 99

spores arisen at the top of sporogenous hyphae dichotomously branched from a

parent hypha continuous with an extraradical mycorrhizal hypha (Błaszkowski
2012; Błaszkowski and Chwat 2013).
Spores pigmented, with a three-layered outer wall (L1, L2, and L3); subtending
hypha straight, cylindrical, funnel-shaped, or constricted; subtending hyphal wall
continuous with L1. Pore open or occluded by a septum continuous with L2, by
thickening of the structural spore wall or by L3 (Błaszkowski 2012).
Corymbiglomus type species: Corymbiglomus corymbiforme (Błaszk.) Błaszk.
and Chwat.
Spores of Corymbiglomus corymbiforme species occur in corymbiforme sporocarps
when formed from branched sporophores (rarely they are formed single in the soil);
sporocarps with globose to subglobose shape; 180–490 μm diam (mean = 336 μm
diam); sometimes sporocarps may be presents ovoid shape; 180–350 × 210–500 μm.
Generally, their sporocarps are composed by 2 to 13 spores, which are enveloped
individually by hyphal mantle (= peridium) (Błaszkowski 1995).
Mantle with 20–90 μm thick, mean = 47.5 μm thick; consisting of a network of
hyphae branching dichotomously three to four times more or less at right angles;
hyphae thin-walled, hyaline to yellowish white, septate; length and diameter of
branches diminishing with each successive dichotomy; initial hypha 9.8–27.2
(mean = 17.7) μm long, 4.2–6.9 (mean = 4.9) μm wide; developing from spore wall
1; final branch 13.5–25 (mean = 19.4) μm long, 1.2–2.9 (mean = 1.8) μm wide; dis-
tance between septa 14.5–31.4 (mean = 25.7) μm; mantle frequently absent in
mature spores (Błaszkowski 1995).
Sporophore hyaline to yellow; coenocytic to sparsely septate; 10.3–17.5
(mean = 14.7) μm wide; with a wall 1.5–1.7 (mean = 1.6) μm thick; usually with two to
three main monopodial branches, rarely straight; main branches frequently with 1–10
monopodial second branches sometimes branched monopodial one to two times; main,
second and third branches slanted at 30–45° towards their parent hyphae; straight and
branched sporophores bearing spores by swelling hyphal tip (Błaszkowski 1995).
Spores pastel yellow to orange; globose to subglobose (sometimes ovoid or pyri-
form); 50–220 μm diam (mean = 142 μm); with a single subtending hypha
(Błaszkowski 1995).
Spore with three-layered outer wall (L1, L2, and L3).
L1 = unit layer; smooth; hyaline to deep yellow; 0.7–1.7 μm thick (mean = 1.1 μm);
closely attached to L2;
L2 = laminated layer; pastel yellow to orange; 3.9–10 μm thick (mean = 7 μm);
L3 = membranous layer; hyaline; 0.5–1.2 μm thick (mean = 0.9 μm); usually tightly
adherent to L2.
Subtending hypha cream to deep orange; straight or funnel-shaped (sometimes
cylindrical or constricted); 9.8–31.1 μm wide (mean = 21 μm) at the spore base.
Wall of subtending hypha cream to deep orange; 2.2–13.7 μm thick (mean = 6.5 μm);
continuous with L1 and L2. Pore occluded by ingrowth of L3; a septum continuous
with L2; spore contents of oil droplets; their mantle and outer wall not reacting in
Melzer’s reagent (Błaszkowski 1995).
100 5 Glomeromycota Classification

Other Corymbiglomus species:

• Corymbiglomus globiferum (Koske and Walker) Błaszk. and Chwat, comb.
nov.=Glomus globiferum Koske and Walker (1986). Mycotaxon 26:133
• Corymbiglomus tortuosum (Schenck and Sm.) Błaszk. and Chwat., comb.
nov.=Glomus globiferum Koske and Walker (1982). Mycotaxon 74: 83

Genus Diversispora Walker and Schüßler

Species in this genus all have spore formed in small open clusters, large multi-
spored clusters, or sporocarps where spores are not organized; spores typically glo-
moid. In pigmented spores subtending hyphae conspicuously change color,
becoming hyaline to white behind the septum. Subtending hyphae generally straight,
cylindrical, sometimes species-specifically constricted, often hyphal attachment
looks like inserted in spore wall (Walker and Schüßler 2004).
Spores with a three-layered outer wall (L1–L3); spore wall structure consisting
of a thin layer (L1), a laminated layer (L2), and a flexible L3 that not react with
Melzer’s reagent; germination not preceded by formation of a germination shield;
pore closure often with a septum that may species-specifically arise from L3 (rarely
pore of attachment open) (Walker and Schüßler 2004). Mycorrhizae as described in
the Table 5.4.
Differ from other genera in the family Diversisporaceae by the possession of the fol-
lowing rRNA SSU gene sequence signatures: CYCATTRGYCAGGCTTAATTGTC,
TATTGGCATTTAGYCA, and CTTTGGATTRGGGTTTAGGGRTC, corresponding
to homologous positions 649, 1387, and 1673, respectively, of the S. cerevisiae SSU
rRNA sequence (Schüßler and Walker 2010).
Diversispora type species: Diversispora spurca (Pfeiff., Walker and Bloss)
Walker and Schüßler
Diversispora spurca species form spores singly or in aggregates in soil or within
roots; generally its propagules are formed terminally on thin-walled, coenocytic
hyphae (rarely sparsely septate hypha) (=sporogenous hyphae); hyaline with a
“frosted” appearance caused by the spores by the roughened nature of a mucilagi-
nous material covering the outer wall; with globose to subglobose shape (rarely
ovoid to obovoid or irregular); 57–130 × 40–115 μm. Usually its spores become
detached from the sporogenous hyphae at maturity (Pfeiffer et al. 1996).

Table 5.4 Mycorrhizae characteristics from Diversispora genus

Structures Characteristics
Arbuscules Finely branched arbuscules; It is darkest and become fainter as its
senescence
Vesicles Globose shape; it tends to stain darker than arbuscules
Auxiliary cells Absent
Intraradical hyphae Hyphae coils, 3–10 μm wide; It tends to stain faintly
Extraradical hyphae Frequent coiling, thin (2–5 μm wide)
Entry point Coiled hyphae clusters near entry points
Mycorrhiza distribution Form small clusters near the entry points
5.2 Phylum Glomeromycota (Walker and Schüßler) 101

Spore with a three-layered outer wall (L1, L2, and L3) (Kennedy et al. 1999):
L1 = hyaline to very pale yellowish cream; flexible unit layer; 0.25–0.75 μm thick;
covered in older spores by a mucilaginous material, 0.5–4 μm thick, which
appears to be formed by overlapping plate-like structures when examined with
the scanning electron microscope. When some specimens are mounted in water,
PVL or PVLG, L1 with its mucilaginous covering rapidly separates from L2,
producing a balloon-like effect; the thickness of wall1 and its mucilaginous cov-
ering remain unchanged;
L2 = hyaline to lightly colored; laminate layer; 1.5–5.0 μm thick with up to 10 sub-
layers, sometimes so thin that can be difficult to detect;
L3 = very thin hyaline membranous layer; less than 0.5 μm thick; often adherent to
L2, and thus difficult to detect; reacting quickly in Melzer’s reagent to become
greenish yellow, whereas the colors of other layers and the mucilaginous mate-
rial are unchanged in this reagent; the mucilaginous material and L1 and L3
cyanophilous in cotton blue; L2 not staining; L2 and L3 sometimes appearing,
by light microscopy, to form and endospore.
Subtending hyphae straight; 3.5–6.0 μm diameter; parallel-sided, not thickened
at the spore base; Walls of the subtending hyphae continuous with L1 of the spore
and the mucilaginous outer material, often with adherent soil particles; 0.5–1.0
thick. The hypha shrivels and collapses at spore maturity and becomes difficult to
see. Spore occlusion apparently by continuation of L2 at the spore base, giving the
appearance of a septum. A thin septum may occur in the subtending hypha 17–35 μm
from the spore base (Pfeiffer et al. 1996; Kennedy et al. 1999).
Other Diversispora species:
• Diversispora arenaria (Błaszk., Tadych & Madej) Oehl, G.A. Silva & Sieverd.,
comb. nov.=Glomus arenarium Błaszk., Tadych & Madej (2001). Acta Soc. Bot.
Pol. 70: 97
• Diversispora aurantium (Błaszk., Blanke, Renker & Buscot) C. Walker &
A. Schüßler comb. nov.=Glomus aurantium Błaszk., Blanke, Renker & Buscot
(2004). Mycotaxon 90: 450
• Diversispora celata C. Walker, Gamper & A. Schüßler, in Gamper, Walker &
Schüßler (2009). New. Phytol.182: 497
• Diversispora eburnea (L.J. Kenn., J.C. Stutz & J.B. Morton) C. Walker &
A. Schüßler comb. nov.=Glomus eburneum L.J. Kenn., J.C. Stutz & J.B. Morton
(1999). Mycologia 91: 1084
• Diversispora epigaea (B.A. Daniels & Trappe) C. Walker & A. Schüßler comb.
nov.=Glomus epigaeum B.A. Daniels & Trappe (1979), Can. J. Bot. 57: 540
• Diversispora gibbosa (Błaszk.) Błaszk. & Kovács, comb. nov.=Glomus gibbo-
sum Błaszk. (1997) Mycologia 89: 339
• Diversispora insculpta (Błaszk.) Oehl, G.A. Silva & Sieverd., comb. nov.=Glomus
insculptum Błaszk. (2004) Mycotaxon 89: 227
• Diversispora przelewicensis (Błaszk.) Oehl, G.A. Silva & Sieverd., comb.
nov.=Glomus przelewicense Błaszk. (1988) Bull. Pol. Acad. Sci., Biol. Sci. 36: 272
102 5 Glomeromycota Classification

• Diversispora pustulata (Koske, Friese, C. Walker & Dalpé) Oehl, G.A. Silva and
Sieverd., comb. nov.=Glomus pustulatum Koske, Friese, C. Walker & Dalpé
(1986). Mycotaxon 26: 143
• Diversispora tenera (P.A. Tandy) Oehl, G.A. Silva & Sieverd., comb.
nov.=Glomus tenerum P.A. Tandy (1975). Austral. J. Bot. 23: 864
• Diversispora trimurales (Koske & Halvorson) C. Walker & A. Schüßler comb.
nov.=Glomus trimurales Koske & Halvorson (1990). Mycologia 81: 930
• Diversispora versiformis (P. Karst.) Oehl, G.A. Silva & Sieverd., comb.
nov.=Glomus versiforme (P. Karst.) S.M. Berch (1993). Can. J. Bot. 61: 2614

Genus Otospora Oehl, Palenz., and Ferrol

Species of this genus have spores formed laterally on the neck of the sporiferous
saccule; with outer and inner walls. Most layers of the outer wall are continuous
with the wall of the sporiferous saccule. One to several septa are formed in the neck
during spore formation; at the beginning of spore formation, the content of the spo-
riferous saccule is separated from the hypha by septa at some distance of the termi-
nus and the not yet developed spore; at later developmental stages additional septa
in the neck, positioned between the saccule terminus and the developing spore, may
separate the collapsing saccule terminus from the spore. A final plug-like septum
usually closes the pore at the spore base (Palenzuela et al. 2008).
Otospora type species: Otospora bareae Palenz. et al.
This AMF species produces singly spores in soil; spores are formed laterally on
the neck of a sporiferous saccule; yellow-brown to brown; globose to subglobose
(rarely ovoid or irregular); 150–200 μm or 145–185 × 175–210 μm diam (Palenzuela
et al 2008).
Spore with four-layered outer wall (L1, L2, L3, and L4):
L1 = hyaline evanescent layer; 0.5–1.0 μm thick;
L2 = subhyaline to light yellow; semi-persistent and sometimes slightly expanding
(=expansive layer) in lactic acid based mountants; 2.0–6.5 μm thick;
L3 = yellow-brown to brown; laminated and tightly adherent to L2; 2.5–6.0 μm
thick;
L4 = concolorous with L3; 0.5–1.5 μm thick; adherent to L3, often difficult to
observe.
The three outer wall layers are continuous with the wall layers of the stalk of the
sporiferous saccule.
Inner wall are formed during spore formation and consists of three hyaline layers
(L1–L3Gw1): L1Gw1 = thin and usually hard to detect in PVLG based moun-
tants because it usually is tightly adherent to L2Gw1;
L2Gw1 = finely laminate layer; 2.0–3.5 μm thick;
L3Gw1 = 0.5–0.8 μm thick and sometimes difficult to observe, especially when
tightly adherent to L2Gw1; sometimes it readily separates from L2Gw1 and then
is clearly visible forming often several folds.
5.2 Phylum Glomeromycota (Walker and Schüßler) 103

Sporiferous saccule subhyaline to light yellow; saccule terminus globose to sub-

globose; 150–210 μm diam or 140–190 × 150–215 μm; with three wall layers (l1, l2,
and l3) formed at the end of the neck; l1 and l2 are hyaline, evanescent and each
0.4–1.0 μm thick; l3 is subhyaline to light yellow, 1.8–2.7 μm thick. Only the glo-
bose terminus of the sporiferous saccule collapses at the neck after the spore wall
has formed (Palenzuela et al. 2008).
Pore at the spore base usually occluded by a plug-like septum, which is 1.5–
3.5 μm thick and arising directly at the spore base from the L3 and adherent L4. The
pore at the spore base rarely appears to be open (Palenzuela et al. 2008).
Genus Redeckera (Walker and Schüßler)
Species of this genus form glomoid spores in relatively large and disorganized spo-
rocarps with a peridium; sporocarps containing hundreds to thousand spores; spores
with 2 (L1–L2) to rarely 3 layers (L1–L3) in the outer wall; L1 fragile, usually
inflating in a short distance to the spore base where L2 becomes invisible in the
subtending hyphae; L2 generally continue over very short distances (2–10 μm) into
subtending hyphae; subtending hyphae generally broad at spore base and with a
conspicuous, thick and broad septum that arises from L2 (Redecker et al. 2007).
Differ from other genera in the family Diversisporaceae by the possession of the
following rRNA SSU gene sequence signatures: ARKTYTGGKMGCGGY
AACGTRA (Schüßler and Walker 2010).
Redeckera type species: Redeckera megalocarpa (Redecker) Walker and
Schüßler
Redeckera megalocarpa species produces sporocarp that contain many densely
packed glomoid spores (generally its sporocarps are larger than other AMF sporo-
carp propagules); brownish with a white-velvety on the surface; irregular shape; up
to 3.8 × 2 cm in size; hyphae of the peridium is ruts-colored; tts spores are oblong to
pyriforme; 65–95 × 38–57 μm (mean = 81 × 47 μm); composed by one single-layered
wall (L1) (Redecker et al. 2007).
L1 = hyaline layer; 1.7–4 μm thick; L1 is continuous with the wall of the subtend-
ing hyphae and splits at the base to form a prominent septum 7–8 μm across; with
reaction in Melzer’s reagent.
Subtending hyphae is flared at the base because it is continuous with L1; very
thin-walled, so it is often detached. Its specific SSU sequence is:
TTGAAGTTTGGGAGCGG (Schüßler and Walker 2010).
Other Redeckera species:
• Redeckera avelingiae (R.C. Sinclair) Oehl, G.A. Silva & Sieverd., comb.
nov.=Glomus avelingiae R.C. Sinclair (2000). Mycotaxon 74: 338
• Redeckera canadensis (Thaxt.) Oehl, G.A. Silva & Sieverd., comb. nov.=Glomus
canadense (Thaxt.) Trappe & Gerd. (1974). Mycol. Mem. 5: 59
• Redeckera fragilis (Berk. & Broome) Oehl, G.A. Silva & Sieverd., comb.
nov.=Glomus fragile (Berk. & Broome) Trappe & Gerd. (1974). Mycol. Mem.
5: 59
104 5 Glomeromycota Classification

• Redeckera fulva (Berk. & Broome) C. Walker & A. Schüßler comb. nov.=Glomus
fulvum (Berk. & Broome) Trappe & Gerd., in Gerdemann and Trappe (1974),
Mycol. Mem. 5: 59
• Redeckera pulvinata (Henn.) C. Walker & A. Schüßler comb. nov.=Glomus pul-
vinatum (Henn.) Trappe & Gerd. [as ‘pulvinatus’], in Gerdemann and Trappe
(1974), Mycol. Mem. 5: 59
Genus Tricispora Oehl, Sieverd., Silva, and Palenz.
The species of this genus produce spores within the neck of closely adherent terminal
or intercalary sporiferous saccules; saccule terminus generally is globose and substan-
tially smaller than the attached mature spore (Palenzuela et al. 2010; Oehl et al. 2011).
Spores have outer and inner wall. At least two layers (L1 and L2) of the outer
wall are continuous with the sporiferous saccule wall. L1 is evanescent, and L2 is
permanent and laminate. After the hyphal neck connections break off, spores show
two cicatrices that are closed by the permanent sublayers of the L2. The inner wall
consists of several layers without granular and beaded appearance and does not
stain with Melzer’s reagent (Oehl et al. 2011, Redecker et al. 2013).
Tricispora type species: Tricispora nevadensis (Palenz. et al.) Oehl et al.
Tricispora nevadensis species produce singly entrophosporoid propagules in soil
(rarely in roots); its spores are formed terminally or intercalary to sporiferous sac-
cule (Palenzuela et al. 2010; Oehl et al. 2011).
Sporiferous saccule hyaline to subhyaline; subglobose to oval; generally broader
than long, 36–50 × 43–75 μm; tightly adherent to the developing spore; it has two
layers (l1 and l2); l1 a evanescent thin (0.6 μm thick), and l2 a semi-persistent layer
(1.5–2.0 mm thick), that are continuous with the L1 and L2 of the outer wall
(Palenzuela et al. 2010); sporiferous saccule decompose rapidly after spore wall
differentiation; the hyphae of the saccule neck rarely remained attached to the
mature spores.
Outer wall with three layers (L1, L2, and L3) (Oehl et al. 2011):
L1 = evanescent; hyaline to subhyaline; 0.6–1.8 μm thick;
L2 = laminate; brown yellow to yellow-brown, darkening with age; 3.5–9.0 μm
thick;
L3 = ornamented; brown-yellow to yellow-brown; generally up to 1.0 mm thick; and
often difficult to detect because it adheres tightly to L2 and also because it was
regularly hidden by the folds of L1, even in crushed spores.
The outer surface of the outer wall has conspicuous, spiny to thorn-like, often
curved projections; 6.0–16.0 μm long and 2.4–3.6 μm wide at their bases tapering
to 0.2–0.4 μm at their tips; they are outgrowths of L1 and L2.
Inner wall are formed after the spore pores has been closed on the outer wall;
generally, it is hyaline; 2.9–4.5 μm thick; composed by three layers (L1Gw, L2Gw,
and L3Gw) (Palenzuela et al. 2010):
L1Gw = adhering tightly to the central layer L2Gw and often forming several con-
spicuous folds after spore crushing; 0.8–1.5 μm;
L2Gw = finely laminate; 2.0–3.5 mm and under pressure in PVLG may expand to
5.5 μm;
5.2 Phylum Glomeromycota (Walker and Schüßler) 105

L3Gw = usually adhering tightly to L2Gw but sometimes slightly separate; 0.6–
1.2 μm thick; form several folds that are more difficult to observe than the folds
of L1Gw. Remarkably, although L2Gw is the most obvious layer of the inner
wall in uncrushed spores, it appears sometimes to be hidden between the folds of
L1Gw and L3Gw in crushed spores.
Its spores present a cicatrix that forms a ring-structure on the spore base. The
germination tubes grow directly through the spore wall, but specific germination
orb has not been observed so far (Palenzuela et al. 2010; Oehl et al. 2011).

5.2.2.3 Family Gigasporaceae (Morton and Benny)

Species of this family produces singly spores in soil (rarely in roots), that are formed
on bulbous sporogenous cells arising from subtending hyphae (sporophore) that dif-
ferentiate from mycelia hyphae in soil, and usually have more than 200 μm diam.
The spore contents are separated from that of the bulbous sporogenous cell by a
plug (rarely by a septum) (Morton and Benny 1999).
Spores show one three-layered outer wall (L1, L2, and L3): a unit, semi-persistent
to persistent (L1), a laminate middle layer (L3), and a thin inner germinal layer
(L3). L3 has multiple, randomly or regularly organized germ warts. From one or
sometimes several of the germ warts a germ tube arises during germination, pene-
trates directly the spore wall and generally branches in a short distance from the
spore. Auxiliary cells are formed in hyphal mycelium with spiny elevations but not
smooth round (Morton and Benny 1990).
Genus Cetraspora Oehl, Souza, and Sieverd.
Genus Cetraspora produce singly spores in soil (rarely in roots) on bulbous sporog-
enous cells that arise terminally on a subtending hypha which is connected to myce-
lium (Oehl et al. 2008).
Outer spore wall generally is three-layered (L1, L2, and L3), and continuous
with the wall of the sporogenous cell:
L1 = generally semi-persistent to persistent; rigid;
L2 = laminate layer;
L3 = membranous layer; very thin; tightly adherent to L2 and thus, often difficult to
observe.
Two inner walls (Gw1 and Gw2) form during spore formation with 1–2 and 2–3
layers, respectively.
A germination shield arises on the outer surface of the L1Gw2; hyaline to sub-
hyaline seldom light yellow; oval to ellipsoid (sometimes subglobose); ornamented
with several (4–12) wave-like lobed projections forming the outer surface of the
shield; large folds separate the lobes on the shield, and each lobe may have an germ
tube initiation (about 2–5 μm in diam) from where the germ tubes arise and pene-
trate the overlaying outer walls.
Subtending hyphae form one to several septa in some distance to the sporoge-
nous cells. Pore between spore and sporogenous cell is narrow and usually closed
106 5 Glomeromycota Classification

Table 5.5 Mycorrhizae characteristics from Cetraspora genus

Structures Characteristics
Arbuscules Many fine tips from a swollen trunk (>4 μm); It stains darkly in roots
Vesicles Absent
Auxiliary cells Aggregate cells borne on coiled brown hyphae; thin-walled (<1 μm
thick); each cell with shallow swelling 0.5–2 μm high and 7–10 μm wide
Intraradical hyphae Hyphae often with knobs or projection; 3–10 μm wide; It tends to stain
darkly
Extraradical hyphae Often amass around the root; 4–12 μm wide
Entry point Hyphae usually densely coiled near entry points
Mycorrhiza Continuous, rare patchiness
distribution

by a plug formed by outer wall material. Auxiliary cells in the hyphal mycelium as
far as they are known knobby without spines on the surface (Oehl et al. 2008;
Redecker et al. 2013). Mycorrhizal association as described below (Table 5.5).
Cetraspora type species: Cetraspora gilmorei (Trappe and Gerd.) Oehl et al.
Cetraspora gilmorei species produce singly hyaline spores in soil; globose to
subglobose (occasionally ellipsoid); with 204–320 μm diam (Gerdemann and
Trappe 1974).
Spore with a three-layered outer wall (L1, L2, L3):
L1 = permanent rigid layer; smooth; hyaline; brittle; up to 11 μm thick; no reactive
in Melzer’s reagent;
L2 = laminate layer; hyaline to pale yellow; thin (1 μm thick) inner layer; reactive in
Melzer’s reagent;
L3 = flexible layer; hyaline; up to 7.4 μm thick;
Inner wall consists of two bi-layered flexible inner wall (L1Gw1, L2Gw1,
L1Gw2, and L2Gw2):
Gw1 = Two layers (L1 and L2) that usually are adherent; L1 < 0.5 μm thick, and L2
is 1.0–2,8 μm thick; both layers reactive in Melzer’s reagent;
Gw2 = Two very adherent layers (L1 and L2); L1 is 2.0–4.8 μm thick; L2 is hyaline,
amorphous layer, 4.0–18.0 μm thick; both layers are reactive in Melzer’s reagent.
At maturity, generally near the spore base, on L2Gw2 the spore produces a ger-
mination shield. It is hyaline; ovoid; with its margins smooth with few folds.
Sporogenous cell light brown; clavate; 27–40 μm width; the walls slightly thick-
ened, 1–1.5 μm near the spore, generally septate below the swollen apex. Hypha
thickened and light brown for a short distance and appearing as a peg, becoming
hyaline, thin-walled and septate along the spore surface, with age only the peg per-
sisting. Auxiliary cells in soil are hyaline to pale brown; borne on tightly coiled
extraradical hyphae in aggregates (3–14); 15–25 μm diam; thin-walled; irregular
with crowded knobs 3–6 × 4–9 μm.
5.2 Phylum Glomeromycota (Walker and Schüßler) 107

Other Cetraspora species:

• Cetraspora armeniaca (Błaszk.) Oehl, F.A. Souza & Sieverd., comb.
nov.=Scutellospora armeniaca Błaszk. (1993). Mycologia 84: 939
• Cetraspora pellucida (T.H. Nicolson & N.C. Schenck) Oehl, F.A. Souza &
Sieverd., comb. nov.=Gigaspora pellucida T.H. Nicolson & N.C. Schenck
(1979). Mycologia 71: 189=Scutellospora pellucida (T.H. Nicolson &
N.C. Schenck) C. Walker & F.E. Sanders (1986). Mycotaxon 27: 181
• Cetraspora spinosissima (C. Walker & Cuenca) Oehl, F.A. Souza & Sieverd.,
comb. nov.=Scutellospora spinosissima C. Walker & Cuenca (1998). Annals
Bot. 82: 723
• Cetraspora striata (Cuenca & R.A. Herrera) Oehl, F.A. Souza & Sieverd., comb.
nov.=Scutellospora striata Cuenca & R.A. Herrera (2008). Mycotaxon 105: 81

Genus Dentiscutata Sieverd., Souza, and Oehl

Species of this genus produces singly spores on bulbous sporogenous cells. These
cells are formed terminally on subtending hypha that arises from mycelia hyphae
(Oehl et al. 2008).
Outer wall is three- to five-layered and continuous with the wall of the sporoge-
nous cell. Pore between the spore and sporogenous cell is narrow and closed by a
plug formed by outer wall material. Inner walls (Gw1 and Gw2) are formed during
spore formation: Gw1 = one- to two-layered; Gw2 = two to three-layered.
Germination shield generally arising on the outer surface of the L2Gw2; yellow-
brown to brown; ellipsoid to oval (rarely reniform); usually with many large folds
separating the shield into 8–30 ‘small compartments’; each small compartment gen-
erally with one circular germ tube initiation; usually from one or a few germ tubes
that may arise and penetrate the Gw1 and the outer wall (Oehl et al. 2008).
Septa often formed in subtending hypha in some distance to the sporogenous
cells. Auxiliary cells formed in hyphal mycelium as far as they are known knobby
without spines on the surface. Arbuscular mycorrhizae as described below
(Table 5.6).

Table 5.6 Mycorrhizae characteristics from Dentiscutata genus

Structures Characteristics
Arbuscules Thick trunk and often short coils (6–8 μm diam) and many finely
tipped branches; It stains darkly in roots
Vesicles Absent
Auxiliary cells Aggregate cells borne on coiled brown hyphae; 5–7 μm diam;
thin-walled (<1 μm thick); each cell with tuberculate surface, with
swellings 1.8–3.2 μm wide and 8.6–12 μm high
Intraradical hyphae Hyphae often with knobs or projection; 5–10 μm diam; It tends to
stain darkly
Extraradical hyphae Consists of very fine dark brown hyphae; < 12 μm diam
Entry point Hyphae usually densely coiled near and around entry points
Mycorrhiza distribution Widely distributed throughout the root cortex
108 5 Glomeromycota Classification

Dentiscutata type species: Dentiscutata nigra (Redhead) Sieverd. et al.

Spores of Dentiscutata nigra species occur singly in soil; with dark red-brown to
black color; globose shape; 240–520 μm diam (Nicolson and Schenck 1979; Oehl
et al. 2008).
Spore with two-layered outer wall (L1, and L2) (Walker and Sanders 1986):
L1 = unit layer tightly adherent to L2; indeterminate color, because it can not be
viewed separately from L2; 2–3 μm thick (mean = 1.1 μm);
L2 = unit layer; dark red-brown to almost black; 6–10 μm thick; with circular to
oblong rings on the upper and lower surface with “wavy” spines in the center
matrix that appear as a semi-circle in the center of each ring.
Inner wall composed by two-bilayered flexible hyaline germinal walls (L1Gw1,
L2Gw1, L1Gw2, and L2Gw2) (Oehl et al. 2008):
Gw1 = Two layers are formed (L1 and L2) that are tightly adherent. L1 is less
than 0.5 μm thick; L2 is slightly thicker (0.8–1.5 μm). Both layers are thin enough
that when tightly adherent, they appear as one layer
Gw2 = Two layers are formed (L1 and L2) that are tightly adherent. The two
germinal walls are not easy to separate or distinguish except when a germination
shield is formed, which is positioned between the two walls.
Subtending hypha dark red-brown, with the spore wall becoming concolorous as
it mature; 24–36 μm width of sporogenous cell; spore contents closed by a plug
concolorous with L2 of the outer wall. Germination shield oblong; pale yellow
brown to darker orange-brown; its margin is fairly smooth, with only few folds and
attendant paired germ holes; positioned on Gw2 (Nicolson and Schenck 1979;
Walker and Sanders 1986).
Other Dentiscutata species:
• Dentiscutata biornata (Spain, Sieverd. & S. Toro) Sieverd., F.A. Souza & Oehl,
comb. nov.=Scutellospora biornata Spain, Sieverd & S. Toro (1989). Mycotaxon
35: 220
• Dentiscutata cerradensis (Spain & J. Miranda) Sieverd., F.A. Souza & Oehl, comb.
nov.=Scutellospora cerradensis Spain & J. Miranda (1996). Mycotaxon 60: 130
• Dentiscutata hawaiiensis (Koske & Gemma) Sieverd., F.A. Souza & Oehl, comb.
nov.=Scutellospora hawaiiensis Koske & Gemma (1995). Mycologia 87: 678
• Dentiscutata heterogama (T.H. Nicolson & Gerd.) Sieverd., F.A. Souza & Oehl,
comb. nov.=Endogone heterogama T.H. Nicolson & Gerd. (1968). Mycologia
60: 319. 1968.=Gigaspora heterogama (T.H. Nicolson & Gerd.) Gerd. & Trappe
(1974). Mycologia Memoir No. 5: 31=Scutellospora heterogama (T.H. Nicolson
& Gerd.) C. Walker & F.E. Sanders (1986), Mycotaxon 27: 180
• Dentiscutata nigra (J.F. Redhead) Sieverd., F.A. Souza & Oehl, comb.
nov.=Gigaspora nigra J.F. Redhead (1979). Mycologia 71: 187=Scutellospora
nigra (J.F. Redhead) C. Walker & F.E. Sanders (1986). Mycotaxon 27: 181
• Dentiscutata reticulata (Koske, D.D. Mill. & C. Walker) Sieverd., F.A. Souza &
Oehl, comb. nov.=Gigaspora reticulata Koske, D.D. Mill. & C. Walker (1983).
Mycotaxon 16: 429=Scutellospora reticulata (Koske, D.D. Mill. & C. Walker)
C. Walker & F.E. Sanders (1986). Mycotaxon 27: 181
5.2 Phylum Glomeromycota (Walker and Schüßler) 109

• Dentiscutata scutata (C. Walker & Dieder.) Sieverd., F.A. Souza & Oehl, comb.
nov.=Scutellospora scutata C. Walker & Dieder. (1989). Mycotaxon 35: 357

Genus Gigaspora (Gerdemann and Trapp)

Species of this genus produce singly spores in soil; very large (>200 μm); variable
in shape (usually globose or subglobose, but often ovoid, obovoid, pyriform, or
irregular, especially when constrained during formation); borne on a bulbous spo-
rogenous cell, usually with a narrow hypha extending from one or more peg-like
projections towards the spore (Gerdemann and Trappe 1974).
Spore wall structure composed by only outer wall; lacking flexible (membra-
nous, amorphous or coriaceous) inner walls. One or more germ tubes produces
directly through the outer wall near the base. Auxiliary cells are formed singly or in
clusters; thin-walled; echinulate or finely papillate; borne in soil, on straight or
coiled hyphae (Bentivenga and Morton 1995). Arbuscular mycorrhizae as described
below (Table 5.7).
Gigaspora type species: Gigaspora gigantea (Nicolson and Gerd.) Gerd.
and Trappe
Spores of Gigaspora gigantea species occur singly in soil; with bright greenish yel-
low to bright yellow-green color; globose to subglobose shape (rarely irregular);
240–400 μm diam (Gerdemann and Trappe 1974).
Spore with three-layered outer wall (L1, L2, and L3) (Bentivenga and Morton
1995):
L1 = unit layer; smooth surface; pale yellow; 2.8–3.6 μm thick; permanent and rigid;
L2 = laminate layer; yellow to brownish-yellow; 8–29 μm thick; reactive in Melzer’s
reagent;
L3 = germinal wall; concolorous and adherent with L2; Numerous “warts” or “papil-
lae” form on the inner surface of this layer, and they are especially concentrated
in regions where germ tubes form (usually in close proximity to the suspensor
cell); warts 1.6–5 μm high in germinating spores and 2–3 μm wide.

Table 5.7 Mycorrhizae characteristics from Gigaspora genus

Structures Characteristics
Arbuscules Fine-branches from a swollen basal hypha; 6–8 μm diam; like tips
degrade; It stains darkly in roots
Vesicles Absent
Auxiliary cells Aggregate cells borne on tightly coiled hyaline hyphae; subglobose
to ovoid to clavate; thin-walled (<1 μm thick); each cell with narrow
projections 1.5–2.0 μm wide and 2.0–10.0 μm high
Intraradical hyphae Hyphae with knob-like projection distributed along length; 3–11 μm
diam; with inflated up to 20 μm; It tends to stain darkly
Extraradical hyphae Consists of very fine dark brown hyphae; < 12 μm diam
Entry point Hyphae usually densely coiled near entry points
Mycorrhiza distribution Widely distributed throughout the root cortex
110 5 Glomeromycota Classification

Subtending hypha hyaline; 38–54 μm width of sporogenous cell; spore contents

closed by a plug concolorous with L2 of the outer wall. Germ tube forms in vicinity
of warty protuberances on inner surface of L3 of the spore wall, 12–16 μm wide
after emergence from the spore; the germ tube holes are 6–10 μm wide (Bentivenga
and Morton 1995).
Other Gigaspora species:
• Gigaspora albida N.C. Schenck & G.S. Sm. (1982). Mycologia 74(1): 85
• Gigaspora candida Bhattacharjee, Mukerji, J.P. Tewari & Skoropad (1982).
Trans. Br. Mycol. Soc. 78(1): 184
• Gigaspora decipiens I.R. Hall & L.K. Abbott (1984). Trans. Br. Mycol. Soc.
83(2): 204
• Gigaspora gigantea (T.H. Nicolson & Gerd.) Gerd. & Trappe (1974). Mycol.
Mem. 5: 29
• Gigaspora margarita W.N. Becker & I.R. Hall (1976). Mycotaxon 4(1): 155
• Gigaspora ramisporophora Spain, Sieverd. & N.C. Schenck (1989). Mycotaxon
34(2): 668
• Gigaspora rosea T.H. Nicolson & N.C. Schenck (1979). Mycologia 71(1): 190

Genus Intraornatospora Goto et al. 2012

Species of this genus form singly spores in soil. These propagules are formed on a
bulbous sporogenous cell that arise terminally on mycelia hyphae; spores with outer
and inner wall; subtending hyphae concolorous with spore (Oehl et al. 2012).
Intraornatospora type species: Intraornatospora intraornata (Goto and Oehl)
Goto et al. 2012
Spores of Intraornatospora intraornata species occur singly in soil; with bright yel-
low to yellow-orange color; globose to subglobose shape (rarely irregular); 150–
260 μm or 145–250 × 165–280 μm diam. They are formed on a subterminal or
intercalary bulbous sporogenous cell (Goto et al. 2009).
Spore with three-layered outer wall (L1, L2, and L3) (Goto et al. 2012):
L1 = semi-persistent to persistent layer; hyaline to subhyaline; 1.1–2.1 μm thick;
L2 = laminate layer; bright yellow to yellow-orange; 7.5–14 μm thick; densely
packed with tube projections on the inner surface, that are 1.0–2.2 μm long and
0.5–1.4 μm broad;
L3 = concolorous with L2; 0.5–1.3 μm tick; profiled by tubes projections of L2.
Inner wall three-layered (L1Gw–L3Gw):
L1Gw = semi-flexible layer; hyaline; 0.8–1.6 μm thick; germination shield is formed
on its surface;
L2Gw = finely laminate layer; 1.9–2.8 μm thick;
L3Gw = flexible layer; thin (0.4–0.8 μm thick); and difficult to observe since tightly
adherent to L2Gw. These three layers do not react in Melzer’s reagent.
The straight pore channel at the spore base (about 2.5–3.6 μm broad) is rarely
closed by a plug formed by L2 and L3, but often appears to be open. Subtending
hypha is concolorous with spore (Goto et al. 2012).
5.2 Phylum Glomeromycota (Walker and Schüßler) 111

Genus Racocetra Oehl, Souza, and Sieverd.

Species of this genus form singly spores in soil (rarely in roots) on bulbous sporog-
enous cells that arise terminally on mycelia hyphae (Oehl et al. 2008).
Outer spore wall is generally three-layered (L1, L2, and L3), and continuous
with the wall of the sporogenous cell (Morton and Msiska 2010).
L1 = rigid layers; semi-persistent to persistent;
L2 = laminate layer;
L3 = membranous layer; thin; tightly adherent to L2 and thus, often difficult to
observe.
A single inner wall is produced during spore formation and has 2 to 3 layers
(L1Gw–L3Gw) (Morton and Msiska 2010).
Pore between spore and sporogenous cell is narrow and usually closed by a plug
formed by spore wall material. A germination shield arises on the L1Gw; it is hya-
line to subhyaline seldom light yellow; oval to ellipsoid or subglobose, with several
(4–12) wave-like lobed projections forming the outer surface of the shield; folds
separate the lobes on the shield, and each lobe may have a germ tube initiation
(about 2–5 μm in diam) from where the germ tubes arise and penetrate the outer
wall. One to several septa formed in some distance to sporogenous cell (Oehl et al.
2008). Arbuscular mycorrhizae as described below (Table 5.8).
Racocetra type species: Racocetra coralloidea (Trappe, Gerd., and Ho) Oehl,
Souza, and Sieverd.
Spores of Racocetra coralloidea species occur singly in soil; with orange-red to
dark red brown color; globose to subglobose shape; 260–480 μm diam (Walker and
Sanders 1986).
Spore with two-layered outer wall (L1, and L2) and an inner wall (Gw) (Oehl
et al. 2008):
L1 = permanent rigid layer; dark brown; ornamented by flattened warts with angular
margins (most 2–12 μm wide × 1–3 μm high);
L2 = laminate layer; brown to dark red-brown; 6.5–10.5 μm thick;

Table 5.8 Mycorrhizae characteristics from Racocetra genus

Structures Characteristics
Arbuscules Form many fine tips from a swollen basal hypha; It stains darkly in roots
Vesicles Absent
Auxiliary cells Aggregate cells borne on coiled hyaline hyphae; subglobose to ovoid to
clavate; thin-walled (<1 μm thick); each cell with tuberculate surface,
with swellings 3.0–10.0 μm wide and 1.0–5.0 μm high
Intraradical hyphae Intraradical hyphae 3–9 μm wide, with knobs, projections and swollen
areas (up to 12 μm wide)
Extraradical hyphae Extraradical hyphae of two morphological types: one wide (3–7 μm) and
the other thinner (1.5–2.0 μm)
Entry point Hyphae usually densely coiled near entry points and in outer cortical cells
Mycorrhiza Widely distributed throughout the root cortex
distribution
112 5 Glomeromycota Classification

Gw = Flexible hyaline layer, it is formed independent of the outer wall and subtend-
ing hypha; generally bi-layered (L1 and L2). L1 is very thin (<0.5 μm thick), and
L2 is slightly thicker, 0.6–1.2 μm thick. Both layers are not reactive in Melzer’s
reagent (Walker and Sanders 1986).
Subtending hypha yellow brown; 41–62 μm width of sporogenous cell; spore
contents closed by a plug concolorous with L2 of the outer wall. Germ tube is
oblong, with length approximately 1.5 times that of the width, and positioned on
Gw (Bentivenga and Morton 1995).
Other Racocetra species:
• Racocetra alborosea (Ferrer & R.A. Herrera) Oehl, F.A. Souza & Sieverd.
(2008). Mycotaxon 106: 336
• Racocetra beninensis Oehl, Tchabi & Lawouin (2010). Mycotaxon 110: 201
• Racocetra castanea (C. Walker) Oehl, F.A. Souza & Sieverd. (2008). Mycotaxon
106: 336
• Racocetra fulgida (Koske & C. Walker) Oehl, F.A. Souza & Sieverd. (2008).
Mycotaxon 106: 336
• Racocetra gregaria (N.C. Schenck & T.H. Nicolson) Oehl, F.A. Souza & Sieverd.
(2008), Mycotaxon 106: 337
• Racocetra minuta (Ferrer & R.A. Herrera) Oehl, F.A. Souza & Sieverd. (2008).
Mycotaxon 106: 337
• Racocetra persica (Koske & C. Walker) Oehl, F.A. Souza & Sieverd. (2008).
Mycotaxon 106: 337
• Racocetra verrucosa (Koske & C. Walker) Oehl, F.A. Souza & Sieverd. (2008).
Mycotaxon 106: 337
• Racocetra weresubiae (Koske & C. Walker) Oehl, F.A. Souza & Sieverd. (2008).
Mycotaxon 106: 337
Genus Scutellospora (Walker and Sanders)
Species of this genus produce spores on sporogenous cells. These cells are
formed terminally on a hypha which arises from mycelia hyphae in soil (Walker and
Sanders 1986).
Outer wall generally is three-layered (L1, L2, and L3), and continuous with the
wall of the sporogenous cell (Oehl et al. 2008).
L1 = generally a rigid layer;
L2 = laminate layers;
L3 = thin, often membranous layer; tightly adherent to L2 and thus, often difficult to
observe.
Inner wall composed by two walls (Gw1 and Gw2) formed during spore forma-
tion. Gw1 is one to two-layered, and Gw2 is two to three-layered forming a germi-
nation shield on its outer surface or between L1 and L2 (Walker and Sanders 1986).
Pore between the spore and sporogenous cell is narrow and usually closed by a
plug formed by outer wall material. Germination shield is hyaline to subhyaline
(seldom light yellow); bi- to mono-lobed; only a few folds cover the shield surface
5.2 Phylum Glomeromycota (Walker and Schüßler) 113

Table 5.9 Mycorrhizae characteristics from Scutellospora genus

Structures Characteristics
Arbuscules Many fine tips from a swollen trunk; It stains darkly in roots
Vesicles Absent
Auxiliary cells Aggregate cells formed individually on closely spaced branches
of coiled hyaline hyphae 3–4 μm in diameter; each cell thin-walled
(<1 μm thick); each cell appearing almost smooth on the surface or
with shallow swellings 0.5–1 μm high and 3–10 μm wide
Intraradical hyphae Intraradical hyphae 3–9 μm wide, with knobs, projections and
swollen areas (up to 12 μm wide)
Extraradical hyphae not described
Entry point Hyphae usually densely coiled near entry
Mycorrhiza distribution Widely distributed throughout the root cortex

where 1–2 rounded germ tube initiations (Gw1 about 2–4 μm in diam) are visible
from where the germ tubes arise which penetrate the outer wall layers. Mycelia
hyphae form one to several septa in some distance to the sporogenous cells.
Arbuscular mycorrhizae as described below (Table 5.9).
Scutellospora type species: Scutellospora calospora (Nicolson and Gerd.)
Walker and Sanders
Spores of Scutellospora calospora species occur singly in soil; with pale yellow
with a greenish tint to yellow-brown with greenish tint color; a wide range of shapes:
this species form subglobose to ellipsoid to oblong, sometimes irregular spores;
120–220 μm diam (Walker and Sanders 1986).
Spore wall consists of a by-layered outer wall (L1, and L2) (Oehl et al. 2008):
L1 = permanent rigid layer; smooth; pale yellow with a green tint; less than 1.0
(–1.2) μm thick; and so adherent to L2;
L2 = laminate layer; yellow with a green tint; 1.8–4.2 μm thick; ornamented with
undulations that be mistaken for an inner flexible wall;
Inner wall is composed by two hyaline flexible walls (Gw1 and Gw2):
Gw1 = Two layers (L1 and L2) that are usually adherent and together are 0.9–2.0 μm
thick. L1 is less than 0.5 μm thick; L2 is 0.5–1.4 μm thick;
Gw2 = also two layers (L1 and L2) that almost always are adherent. L1 is 1.2–3.2 μm
thick and often produces a weak pink reaction in Melzer’s reagent that is detected
only when it separates from the spore wall. L2 is hyaline and plastic enough
(=amorphous layer).
Subtending hypha hyaline; 22–28 μm width of sporogenous cell; spore contents
closed by a plug concolorous with L2 of the outer wall. Germ shield is ovoid to oblong,
with length approximately 1.5 times that of the width. Margins of shields generally are
smooth, with few folds. The shield is fragile enough that it often folds or is easily
fragmented. It also does not contrast from the inner walls with which it is associated
and thus may be hard to detect. Generally it is positioned on Gw2 (Oehl et al. 2008).
114 5 Glomeromycota Classification

Other Scutellospora species:

• Scutellospora arenicola Koske Koske & Halvorson (1990/1989). Mycologia
81(6): 927
• Scutellospora aurigloba (I.R. Hall) C. Walker & F.E. Sanders (1986). Mycotaxon
27: 180 = Gigaspora aurigloba I.R. Hall (1977). Trans. Brit. Mycol. Soc. 68: 351
• Scutellospora crenulata R.A. Herrera, Cuenca & C. Walker (2001). Can. J. Bot.
79(6): 674
• Scutellospora dipapillosa (C. Walker & Koske) C. Walker & F.E. Sanders (186).
Mycotaxon 27: 181 = Gigaspora dipapillosa C. Walker & Koske (1985).
Mycologia 77: 709
• Scutellospora dipurpurescens J.B. Morton & Koske (1988). Mycologia 80(4):
520
• Scutellospora erythropus (Koske & C. Walker) C. Walker & F.E. Sanders [as
‘erythropa’] (1986). Mycotaxon 27: 181
• Scutellospora nodosa Błaszk. (1991). Mycologia 83(4): 537
• Scutellospora pernambucana Oehl, D.K. Silva, N. Freitas & L.C. Maia (2008).
Mycotaxon 106: 363
• Scutellospora projecturata Kramad. & C. Walker, in Kramadibrata, Walker,
Schwarzott & Schüßler (2000). Ann. Bot., Lond., N.S. 86(1): 22
• Scutellospora rubra Stürmer & J.B. Morton (1999). Mycol. Res. 103(8): 951
• Scutellospora savannicola (R.A. Herrera & Ferrer) C. Walker & F.E. Sanders
(1986). Mycotaxon 27: 180
• Scutellospora tricalypta (R.A. Herrera & Ferrer) C. Walker & F.E. Sanders
(1986). Mycotaxon 27: 180
5.2.2.4 Family Pacisporaceae Walker, Błaszk., Schüßler and Schwarzott
Family Pacisporaceae differs from other families in the Diversisporales by posses-
sion of glomoid spores with a combination of amyloid inner wall components and
germination by means of a germination shield, coupled with the formation of
vesicular–arbuscular mycorrhizas and by the possession of the SSU rRNA gene
sequence signature TTATCGGTTRAATC, corresponding to homologous position
650 of the S. cerevisiae SSU rRNA sequence, and ACTGAGTTMATYT, corre-
sponding to homologous position 1481 of the S. cerevisiae SSU rRNA sequence
(Walker et al. 2004).
Genus Pacispora Sieverd. and Oehl
Species of this genus form single spores terminally on hyphae in the soil; its spores
are generally globose, subglobose to ellipsoid in shape; and have usually a three lay-
ered outer wall and an inner wall which usually is three-layered (Walker et al. 2004).
The hyphal attachment is cylindrical or often slightly constricted at the base of
the spore. The wall of the subtending hypha is confluent with the L1 and L2 of the
outer wall. The pore of the hyphal attachment is usually closed by a septum that
arises from L2. Germination of spores is from the inner wall directly through the
outer wall. A germination orb is rarely visible even during the process of germina-
tion. One or several germ tubes are formed (Oehl and Sieverding 2004).
5.2 Phylum Glomeromycota (Walker and Schüßler) 115

Pacispora type species: Pacispora scintillans (Rose and Trappe) emend. Sieverd.
and Oehl
Pacispora scintillans species produce spores subhyaline to white; globose to sub-
globose (180–230 μ m in diam), to broad ellipsoidal (210–237 × 135–225 μm) (Oehl
and Sieverding 2004).
Spores with a three-layered outer wall (L1, L2, and L3):
L1 = with round knobs that are 1.0–2.8 μm long and 0.7–2.8 μm broad often con-
stricted at their base; length and width of a knob about equal; the top of the knobs
frequently with a slight central depression visible in plan view; concolorous with
L2;
L2 = laminate layer; hyaline to shiny white; 1.0–3.0 μm; tightly adherent to L1;
L3 = very thin inner layer (0.5–1.0 μm); usually hardly to observe as usually tightly
adherent to and concolorous with L2.
Inner wall also is hyaline and three-layered (L1Gw, L2Gw, and L3Gw):
L1Gw = membranous layer; 0.4–1.0 μm thick; often easily separating from
L2Gw;
L2Gw = flexible layer; 1.2–4.0 μm thick;
L3Gw3 = highly flexible; very thin (0.5 μm thick); ornamented with several
folds; adherent to L2Gw and then difficult to observe; reactive in Melzer’s
reagent.
Pore closure at the spore base through a bridging septum and the wall thickening
of L2 and through L3 though. Subtending hypha is usually cylindrical (6–8 μm
thick). The wall of the subtending hypha is thinning to 0.5 μm in a distance of
15–30 μm from the spore base (Walker et al. 2004).
Other Pacispora species:
• Pacispora chimonobambusae (C.G. Wu & Y.S. Liu) Sieverd. & Oehl ex
C. Walker, Vestberg & A. Schüßler, in Walker, Vestberg & Schüßler (2007).
Mycol. Res. 111(3): 255
• Pacispora boliviana Sieverd. & Oehl, in Oehl & Sieverding (2004). J. Appl. Bot.
(Angew. Bot.) 78: 79
• Pacispora coralloidae Sieverd. & Oehl, in Oehl & Sieverding (2004). J. Appl.
Bot. (Angew. Bot.) 78: 78
• Pacispora dominikii Blaszk. emend. Sieverd. & Oehl comb. nov.=Glomus
dominikii Blaszk. (1988). Karstenia 27: 3742
• Pacispora franciscana Sieverd. & Oehl, in Oehl & Sieverding (2004). J. Appl.
Bot. (Angew. Bot.) 78: 74
• Pacispora patagonica (Novas & Fracchia) C. Walker, Vestberg & A. Schüßler
(2007). Mycol. Res. 111(3): 255
• Pacispora robigina Sieverd. & Oehl, in Oehl & Sieverding (2004). J. Appl. Bot.
(Angew. Bot.) 78: 75
116 5 Glomeromycota Classification

5.2.2.4 Family Sacculosporaceae Oehl et al.

Sacculosporaceae species form spores within the hyphal neck of closely adherent,
terminal or intercalary sporiferous saccules. Spores with outer and inner wall.
Usually its outer wall have two evanescent layers (L1 and L2), and one permanent
laminate layer (L3) which are continuous with the wall of the sporiferous saccule.
The inner wall consists of several germinal layers with granular and beaded appear-
ance, and does not stain in Melzer’s reagent (Oehl et al. 2008).
Genus Sacculospora Oehl et al.
Species of this genus form spores within the hyphal neck of closely adherent, termi-
nal or intercalary sporiferous saccules. Spores have outer and inner walls as described
for family Sacculosporaceae. After the hyphal neck connections break off, spores
show two cicatrices that are closed by L3. Their layers do not stain in Melzer’s
reagent. The inner wall may be germinal in function, but a germination structure
(germination shield or germination orb) has not yet been found yet (Oehl et al. 2008).
Sacculospora type species: Sacculospora baltica (Błaszk. et al.) Oehl et al.
This species produces singly spores in soil, within the neck of a sporiferous saccule;
spores pale orange to orange; globose to subglobose (sometimes ovoid); 110–
220 μm diam. Its spores and sporiferous saccule may be covered by a hyphal mantle
(=peridium). Mantle is hyaline to pale yellow; 10–40 μm thick; composed of hya-
line interwoven sinuous hyphae (2.5–10 μm wide), and globose vesicles (18–
22.5 μm diam) (Błaszkowski et al. 1998).
Spores with a three-layered outer wall (L1, L2, and L3) (Oehl et al. 2008):
L1 = evanescent layer; hyaline; 1.5–2.5 μm thick;
L2 = unit layer; pale orange to orange; 1.1–1.7 μm thick; ornamented with evenly
distributed warts (0.6–0.8 μm high);
L3 = laminate layer; hyaline; 1.5–2.7 μm thick.
Inner wall consisting of two separable hyaline walls (Gw1 and Gw2):
Gw1 = membranous layer; 0.5–1.3 μm thick;
Gw2 = coriaceous layer; 2.1–3.3 μm thick.
Sporiferous saccule is hyaline to pale yellow; globose to subglobose; 100–
210 μm diam; collapsing at maturity. Saccule wall is granular (rarely smooth); hya-
line; 0.5–0.8 μm thick. Subtending hyphae is pale yellow; 15–25 μm long, 13–16 μm
wide at the spore base, with walls 2.8–3.7 μm thick (Błaszkowski et al. 1998).

5.2.3 Order Glomerales (Morton e Benny)

AMF species of this order are hypogeous, sometimes epigeous. They form arbuscu-
lar mycorrhizas or mycorrhiza-like symbiosis with spores, vesicles and/or arbus-
cules in plants. They produce spores terminally on or intercalary in hyphae
5.2 Phylum Glomeromycota (Walker and Schüßler) 117

(=glomoid morphotype) or within the necks of sporiferous saccules (=entrophospo-

roid morphotype); spores may be formed in soil (or sometimes roots) singly or also
in spore clusters or multi-spored loose to compact sporocarps (when glomoid);
when in compact sporocarps (with or without peridium), spores randomly distrib-
uted or organized around a central hyphal plexus (Schüßler et al. 2001).
Glomoid propagules present one single or multiple-layered outer wall; wall of
the subtending hyphae conspicuously continuous with the outer wall; it has funnel-
shaped, cylindrical, or constricted shape; and concolorous with spore.
Entrophosporoid propagules with two walls: outer wall and inner wall. Outer wall
layers are discontinuous with the hyphal wall distal to the sporiferous saccule
(Walker and Schüßler 2004).
Glomerales differ from other Glomeromycota by the possession of the rRNA
SSU gene sequence signature: YTRRY/2-5/RYYARGTYGNCARCTTCTTAGAGG
GACTATCGGTGTYTAACCGRTGG, corresponding to homologous position 1353
of the S. cerevisiae SSU rRNA sequence, with the underlined nucleotides being
specific for the taxon (Walker and Schüßler 2004). Glomerales is currently divided
in two families: Claroideoglomeraceae, and Glomeraceae (Redecker et al. 2013).

5.2.3.1 Family Glomeraceae Piroz. and Dalpé emend Oehl, Silva

and Sieverd

Glomeraceae species produce spores terminally on or intercalary in hyphae, in soil

and sometimes in roots. They can be formed singly, in clusters, or in sporocarps
(with or without peridium). Spores with one mono-to-multiple layered outer wall.
Initially this family included all species of Glomus lato sensu, that presented purely
glomoid spores, but with unknown phylogenetic relationships. Currently some spe-
cies of Glomeraceae family were reclassified as the Claroideoglomeraceae family,
in addition to this change were created new genera based on morphological, phylo-
genetic and molecular evidence. The current family Glomeraceae has as type spe-
cies Glomus macrocarpum (Walker and Schüßler 2010).
A diagnostic (but fairly degenerate) sequence from the rRNA SSU gene sequence
is: TGTYADGGCAYYRCACYGG (Walker e Schüßler 2010). All species formerly
classified as members of Funneliformis, Glomus, Rhizophagus, Sclerocystis and
Septoglomus are included except for those now grouped in the families
Claroideoglomeraceae, Diversisporaceae or Paraglomeraceae (Redecker et al. 2013).
Genus Glomus (Tulasne and Tulasne, emend. Walker and Schüßler)
Species of this genus form singly spores within soil or sometimes roots, in clusters
or in compact sporocarps (without or with peridium). Spores with a mono-to-
multiple layered outer wall. Wall of the suspensor hyphae is conspicuously continu-
ous and concolorous with L1 of the outer wall. Spore pore closure often by
introverted wall thickening, sometimes supported by a short bridging septum (rarely
open) (Gerdemann and Trappe 1974). A diagnostic (but fairly degenerate) sequence
from the rRNA SSU gene sequence is: GGTACGYACTGGTATCATTGG and
TCGGCTGTAAAAGGCYYTTG (Walker e Schüßler 2010). Arbuscular mycorrhi-
zae as described below (Table 5.10).
118 5 Glomeromycota Classification

Table 5.10 Mycorrhizae characteristics from Glomus genus

Structures Characteristics
Arbuscules Narrow trunks; finely branched (<4 μm); It stains darkly in roots
Vesicles Oblong to elliptical in shape; stain darkly as arbuscules
Auxiliary cells Absent
Intraradical hyphae Usually grow parallel to each other and to the root axis, generally
vary from 1.5 to 4 μm wide, and interconnect via right-angle
or acute-angle branches (often referred to as “H connections”).
They usually stain darkly in trypan blue and other stains
Extraradical hyphae Varying considerably in abundance, distribution, and morphology
among species
Entry point Hyphae usually densely coiled near entry
Mycorrhiza distribution Widely dispersed throughout the root cortex

Glomus type species: Glomus macrocarpum (Tulasne and Tulasne)

Glomus macrocarpum species produce spores in clusters, sporocarps or singly in soil.
Sporocarps up to 12 mm broad with globose to ellipsoid shape (rarely irregular). Their
spores have a white and cottony peridium, that collapses when touched (often partially
or completely absent). Spores are usually globose to subglobose (occasionally ellip-
soid to obovoid); 93–230 μm; smooth or roughened from adherent soil particles.
Outer wall up to 14 μm thick, light yellow-brown to brown; Spores with thick-walled
subtending hyphae have a thin, outer wall (Gerdemann and Trappe 1975).
Other Glomus species:
• Glomus achrum Błaszk., D. Redecker, Koegel, Schützek, Oehl & Kovács (2009).
Botany 87: 262
• Glomus aggregatum N.C. Schenck & G.S. Sm. (1982). Mycologia 74: 80
• Glomus ambisporum G.S. Sm. & N.C. Schenck (1985). Mycologia 77: 566
• Glomus antarcticum Cabello (1994). Mycotaxon 51: 124
• Glomus arborense McGee (1986). Trans. Br. Mycol. Soc. 87: 123
• Glomus atrouva McGee & Pattinson (2002). Austral. Syst. Bot. 15: 115
• Glomus aureum Oehl & Sieverd. (2003). J. Appl. Bot. 77: 111
• Glomus australe (Berk.) S.M. Berch (1983). Can. J. Bot. 61: 2611
• Glomus bagyarajii V.S. Mehrotra (1997). Philipp. J. Sci. 126: 235
• Glomus bistratum Błaszk., D. Redecker, Koegel, Symanczik, Oehl & Kovács
(2009). Botany 87: 267
• Glomus boreale (Thaxt.) Trappe & Gerd. (1974). Mycol. Mem. 5: 58
• Glomus botryoides F.M. Rothwell & Victor (1984). Mycotaxon 20(1): 163
• Glomus brohultii Sieverd. & R.A. Herrera (2003). J. Appl. Bot. 77: 37
• Glomus canum McGee (2002). Austral. Syst. Bot. 15: 116
• Glomus cerebriforme McGee (1986). Trans. Br. Mycol. Soc. 87: 123
• Glomus citricola D.Z. Tang & M. Zang (1984). Acta Bot. Yunn. 6: 301
• Glomus convolutum Gerd. & Trappe (1974). Mycol. Mem. 5: 42
• Glomus corymbiforme Błaszk. (1995). Mycologia. 87: 732
• Glomus cuneatum McGee & A. Cooper (2002). Austral. Syst. Bot. 15: 117
5.2 Phylum Glomeromycota (Walker and Schüßler) 119

• Glomus delhiense Mukerji, Bhattacharjee & J.P. Tewari (1983). Trans. Br.
Mycol. Soc 81: 643
• Glomus dolichosporum M.Q. Zhang & You S. Wang (1997). Mycosystema 16: 241
• Glomus flavisporum (M. Lange & E.M. Lund) Trappe & Gerd. (1974). Mycol.
Mem. 5: 58
• Glomus formosanum C.G. Wu & Z.C. Chen (1986). Taiwania 31: 71
• Glomus fuegianum (Speg.) Trappe & Gerd. (1974). Mycol. Mem. 5: 58
• Glomus globiferum Koske & C. Walker (1986). Mycotaxon 26: 133
• Glomus glomerulatum Sieverd. (1987). Mycotaxon 29: 74
• Glomus goaensis Khade (2010). Mycorrhiza News 20(4): 21
• Glomus heterosporum G.S. Sm. & N.C. Schenck (1985). Mycologia 77: 567
• Glomus hoi S.M. Berch & Trappe (1985). Mycologia 77(4): 654
• Glomus hyderabadensis Swarupa, Kunwar, G.S. Prasad & Manohar. (2004).
Mycotaxon 89:247
• Glomus indicum Błaszk., Wubet & Harikumar (2010). Botany 88: 134
• Glomus invermarium I.R. Hall (1977). Trans. Br. Mycol. Soc. 68: 345
• Glomus magnicaule I.R. Hall (1977). Trans. Br. Mycol. Soc. 68: 345
• Glomus melanosporum Gerd. & Trappe (1974). Mycol. Mem. 5: 46
• Glomus microaggregatum Koske, Gemma & P.D. Olexia (1986). Mycotaxon 26: 125
• Glomus microcarpum Tul. & C. Tul. (1845). Giorn. Bot. Ital., Anno 1, 2(7–8): 63
• Glomus minutum Błaszk., Tadych & Madej (2000). Mycologia 76: 189
• Glomus mortonii Bentiv. & Hetrick (1991). Mycotaxon 42: 10
• Glomus multicaule Gerd. & B.K. Bakshi (1976). Trans. Br. Mycol. Soc. 66: 340
• Glomus nanolumen Koske & Gemma (1990). Mycologia 81: 935
• Glomus pallidum I.R. Hall (1977). Trans. Br. Mycol. Soc. 68: 343
• Glomus pansihalos S.M. Berch & Koske (1986). Mycologia 78: 832
• Glomus pellucidum McGee & Pattinson (2002). Austral. Syst. Bot. 15: 120
• Glomus perpusillum Błaszk. & Kovács (2009). Mycologia 101: 249
• Glomus radiatum (Thaxt.) Trappe & Gerd. (1974). Mycol. Mem. 5: 46
• Glomus segmentatum Trappe, Spooner & Ivory (1979). Trans. Br. Mycol. Soc.
73: 362
• Glomus spinosum H.T. Hu (2002). Mycotaxon 83: 160
• Glomus spinuliferum Sieverd. & Oehl (2003). Mycotaxon 86: 158
• Glomus tenebrosum (Thaxt.) S.M. Berch. Can. J. Bot. 60: 2615
• Glomus tortuosum N.C. Schenck & G.S. Sm. (1982). Mycologia 74: 83
• Glomus viscosum T.H. Nicolson, in Walker, Giovannetti, Avio, Citernesi &
Nicolson (1995). Mycol. Res. 99(12): 1502
• Glomus warcupii McGee (1986). Trans. Br. Mycol. Soc. 87: 125
• Glomus zaozhuangianum F.Y. Wang & R.J. Liu (2002). Mycosystema 21: 522.
2002.
Genus Funneliformis (Walker and Schüßler)
Species of this genus form spores within soil (rarely roots); singly or sometimes in
clusters with a few to several spores per cluster only; its subtending hyphae is con-
colorous with outer wall color (hyaline) and generally funnel-shaped to cylindrical.
Pore regularly closed by a conspicuous septum that arises from the outer wall
(Walker and Schüßler 2010).
120 5 Glomeromycota Classification

Funneliformis differ from other genera in Glomeraceae by the possession of the

rRNA SSU gene sequence signature: CGGTCATGCCGTTGGTATGY, correspond-
ing to homologous position 1353 of the S. cerevisiae SSU rRNA sequence, with the
underlined nucleotides being specific for the taxon (Redecker et al. 2013).
Funneliformis type species: Funneliformis mosseae (Nicolson and Gerd.)
Walker and Schüßler
Funneliformis mosseae species produces yellow-brown to brown clusters with a
peridium around its spores. Peridium is a robust hyphae (8–18 μm thick) mixed with
many fine branching hyphae (2–5 μm wide, walls < 1 μm thick), that does not alter
spore wall structure. Spores are straw to dark orange-brown; globose to subglobose;
100–260 μm diam (Walker and Schüßler 2010).
Spores compose by a three-layered outer wall (L1, L2, and L3):
L1 = mucilaginous/evanescent layer; smooth to granular; hyaline; 1.4–2.5 μm thick;
reactive in Melzer’s reagent;
L2 = unit layer; rigid; hyaline and very refractile when viewed with differential con-
trast; 0.8–1.6 μm thick; no reactive in Melzer’s reagent;
L3 = laminate layer; 3.2–6.4 μm thick; yellow-brown to pale orange-brown; orna-
mented with minute depressions that cover the surface of the outer wall.
Subtending hypha flared to funnel-shaped; 16–32 μm width; with a recurved
septum formed from the point to attachment to the spore, where the germ tube
emerges from the lumen of the subtending hypha. These germ tubes branch exten-
sively after emergence from the hypha. Sporocarps are most dramatic in producing
numerous infective hyphae (Gerdemann and Trappe 1974).
Other Funneliformis species:
• Funneliformis caesaris (Sieverd. & Oehl) Oehl, G.A. Silva & Sieverd., comb.
nov. = Glomus caesaris Sieverd. & Oehl (2002). Mycotaxon 84: 381
• Funneliformis caledonius (T.H. Nicolson & Gerd.) C. Walker & A. Schüssler
(2010). The Glomeromycota—a species list: 13 = Glomus caledonium
(T.H. Nicolson & Gerd.) Trappe & Gerd. (1974). Mycol. Mem. 5: 56
• Funneliformis coronatus (Giovann.) C. Walker & A. Schüssler (2010). The
Glomeromycota—a species list: 13 = Glomus coronatum Giovann. (1990). Can.
J. Bot. 69: 162
• Funneliformis dimorphicus (Boyetchko & J.P. Tewari) Oehl, G.A. Silva &
Sieverd., comb. nov.=Glomus dimorphicum Boyetchko & J.P. Tewari (1986).
Can J. Bot. 64: 90
• Funneliformis fragilistratus (Skou & I. Jakobsen) C. Walker & A. Schüssler
(2010). The Glomeromycota—a species list: 13 = Glomus fragilistratum Skou &
I. Jakobsen (1989). Mycotaxon 36: 276
• Funneliformis geosporus (T.H. Nicolson & Gerd.) C. Walker & A. Schüssler
(2010). The Glomeromycota—a species list: 14 = Glomus macrocarpum var.
geosporum (T.H. Nicolson & Gerd.) Gerd. & Trappe (1974). Mycol. Mem. 5:
55 = Glomus geosporum (T.H. Nicolson & Gerd.) C. Walker (1982). Mycotaxon
15: 56
5.2 Phylum Glomeromycota (Walker and Schüßler) 121

• Funneliformis halonatus (S.L. Rose & Trappe) Oehl, G.A. Silva & Sieverd.,
comb. nov.=Glomus halonatum S.L. Rose & Trappe (1980). Mycotaxon 10: 413
• Funneliformis kerguelensis (Dalpé & Strullu) Oehl, G.A. Silva & Sieverd.,
comb. nov.=Glomus kerguelense Dalpé & Strullu (2002). Mycotaxon 84: 53
• Funneliformis monosporus (Gerd. & Trappe) Oehl, G.A. Silva & Sieverd., comb.
nov.=Glomus monosporum Gerd. & Trappe (1974). Mycol. Mem. 5: 41
• Funneliformis multiforus (Tadych & Błaszk.) Oehl, G.A. Silva & Sieverd., comb.
nov.=Glomus multiforum Tadych & Błaszk. (1997). Mycologia 89: 805
• Funneliformis verruculosus (Błaszk.) C. Walker & A. Schüssler (2010). The
Glomeromycota—a species list: 14 = Glomus verruculosum Błaszk. (1997).
Mycologia 89: 809
Genus Sclerocystis Berkeley and Broome
Described by Berkeley and Broome (1875), this genus has the main characteristic
sporocarps formed by numerous glomoid and rigid spores with peridium around
them. Spores usually clavate (sometimes obovate to elliptical), and organized in a
singly layer from a central plexus of hyphae (Gerdemann and Bakshi 1976)
Sclerocystis type species: Sclerocystis coremioides Berk. and Broome
This species produces sporocarps like a coremium; orange when immature, becom-
ing orange-brown to dark orange-brown when mature; head globose (=radial-glomoid
morphotype); hard and compact; 200–360 μm diam. A dense layer of hyphae
(=peridium), with 9–19 μm thick that cover all spores and keep them tightly packed.
Clavate spores organized in a singly layer from a central plexus of hyphae; it is com-
posed by only one mono-layered outer wall. This layer is laminate, with 1.5–6.0 μm
(Berkeley and Broome 1873; Gerdemann and Bakshi 1976; Redecker et al. 2000).
Other Sclerocystis species:
• Sclerocystis alba Petch (1925). Ann. R. Bot. Gdns Peradeniya 9: 322
• Sclerocystis clavispora Trappe (1977). Mycotaxon 6: 359
• Sclerocystis coccogenum (Pat.) Höhn. (1910) Sber. Akad. Wiss. Wien, Math.-
Naturw. Kl., Abt. 1 119: 399 [7 repr.]
• Sclerocystis dussii (Pat.) Höhn. (1910). Sber. Akad. Wiss. Wien, Math.-Naturw.
Kl., Abt. 1 119: 399 [7 repr.]
• Sclerocystis liquidambaris C.G. Wu & Z.C. Chen (1987). Trans. Mycol. Soc.
Rep. China 2(2): 74
• Sclerocystis microcarpus S.H. Iqbal & Perveen (1980). Trans. Mycol. Soc. Japan
21: 58
• Sclerocystis pachycaulis C.G. Wu & Z.C. Chen (1986). Taiwania 31: 74
• Sclerocystis pubescens (Sacc. & Ellis) Höhn. (1910). Sber. Akad. Wiss. Wien,
Math.-Naturw. Kl., Abt. 1 119: 399 [7 repr.]
• Sclerocystis rubiformis Gerd. & Trappe (1974). Mycol. Mem. 5: 60
• Sclerocystis sinuosa Gerd. & B.K. Bakshi (1976). Trans. Br. Mycol. Soc.
66(2): 343
• Sclerocystis taiwanensis C.G. Wu & Z.C. Chen (1987). Trans. Mycol. Soc. Rep.
China 2(2): 78
122 5 Glomeromycota Classification

Genus Rhizophagus Dang.

Species of this genus produces white glomoid propagules (100–260 μm diam)
within root plants (sometimes in soil). Its spores may be formed singly, in small to
large clusters. Rhizophagus genus is also described as Glomus subgroup Ab by
Schüßler and Walker (2010). It forms typical arbuscular-vesicular mycorrhizas,
although vesicles tend to form earlier (at entry points) than other genus in
Glomeraceae (Gerdemann and Trappe 1974).
Spores compose by a three-layered outer wall (L1, L2, and L3):
L1 = mucilaginous/evanescent layer; smooth; hyaline; 1.0–1.7 μm thick; reactive in
Melzer’s reagent;
L2 = permanent laminate layer; rigid; 9.0–14.5 μm thick; no reactive in Melzer’s
reagent;
L3 = laminate layer; 1.2–3.5 μm thick.
Subtending hypha with cylindrical shaped; 18–24 μm width; and with a recurved
septum formed from the point to attachment to the spore, where the germ tube
emerges from the lumen of the subtending hypha (Gerdemann and Trappe 1974).
Rhizophagus type species: Rhizophagus populinus Dang.
Rhizophagus populinus forms spores in larger clusters within root plants; white,
pale cream to yellow brown;; globose, subglobose, or irregular; 40–140 μm diam,
mean 93 μm (n = 170) (Gerdemann and Trappe 1974).
Spores consist of three-layered outer wall (L1, L2, and L3):
L1 = mucilaginous layer; hyaline; 0.6–3.2 μm thick; reactive in Melzer’s reagent;
L2 = mucilaginous layer; granular; hyaline; 1.5–4.9 μm thick; very adherent to L1;
L3 = laminate layer; pale yellow-brown; 3.2–12 μm thick; continuous with the wall
of the subtending hypha.
Subtending hypha cylindrical to slightly flared, occasionally slightly constricted;
11–18 μm width; a germ tube emerges from the lumen of the subtending hypha. It
appears to arise from L3 (Gerdemann and Trappe 1975).
Other Rhizophagus species:
• Rhizophagus clarus (T.H. Nicolson & N.C. Schenck) C. Walker & A. Schüßler
comb. nov.
• Rhizophagus custos (C. Cano & Y. Dalpé) C. Walker & A. Schüßler comb. nov.
• Rhizophagus diaphanus (C. Cano & Y. Dalpé) C. Walker & A. Schüßler comb.
nov.
• Rhizophagus fasciculatus (Thaxt.) C. Walker & A. Schüßler comb. nov.
• Rhizophagus intraradices (N.C. Schenck & G.S. Sm.) C. Walker & A. Schüßler
comb. nov.
• Rhizophagus iranicus (Błaszk., Kovács & Balázs) C. Walker & A. Schüßler
comb. nov.
• Rhizophagus irregulare (Błaszk., Wubet, Renker & Buscot) C. Walker &
A. Schüßler comb. nov.
5.2 Phylum Glomeromycota (Walker and Schüßler) 123

• Rhizophagus manihotis (R.H. Howeler, Sieverd. & N.C. Schenck) C. Walker &
A. Schüßler comb. nov.
• Rhizophagus proliferus (Błaszk., Kovács & Balázs) C. Walker & A. Schüßler
comb. nov.

Genus Septoglomus Sieverd. Silva and Oehl

Species of this genus form spores in very loose, small clusters (rarely singly).
Spores with a mono-to-multiple layered outer wall. Wall of the subtending hypha is
continuous and concolorous with the outer wall. Subtending hyphae are cylindrical
or slightly funnel shaped at spore base. Pore at spore base or in some distance from
spore based closed by a septum (Oehl et al. 2011)
Septoglomus type species: Septoglomus constrictum (Trappe) Sieverd. et al.
Spores of this species arise in soil singly or in loose clusters lacking a peridium;
yellow to light brown; globose to subglobose; 19–135 μm diam (Oehl et al. 2011).
Spore wall composed by a two-layered outer wall (L1 and L2):
L1 = evanescent layer; hyaline; 0.5–2.3 μm thick; frequently completely sloughed in
mature spores; not reactive in Melzer’s reagent;
L2 = laminate layer; smooth; deep yellow to light brown; 1.8–3.8 μm thick; fre-
quently thickened at the spore base to form a collar; not reactive in Melzer’s
reagent.
Subtending hypha is straight or curved, flared, funnel-shaped; deep yellow to
light brown; 6.3–16.8 μm wide. Wall of subtending hypha is deep yellow to light
brown. Pore open, 0.8–10.8 μm wide at the spore base (Oehl et al. 2011).
Other Septoglomus species:
• Septoglomus africanum (Błaszk. & Kovács) Sieverd., G.A. Silva & Oehl, comb.
nov.=Funneliformis africanus (Błaszk. & Kovács) C. Walker & A. Schüßler
(2010) The Glomeromycota—a species list: 14
• Septoglomus deserticola (Trappe, Bloss & J.A. Menge) G.A. Silva, Oehl &
Sieverd., comb. nov.=Glomus deserticola Trappe, Bloss & J.A. Menge (1984).
Mycotaxon 20: 123
• Septoglomus xanthium (Błaszk., Blanke, Renker & Buscot) G.A. Silva, Oehl &
Sieverd., comb. nov.=Funneliformis xanthius (Błaszk.) C. Walker & A. Schüßler
(2010) The Glomeromycota—a species list: 14

5.2.3.2 Family Claroideoglomeraceae Walker and Schüßler

This family produces singly spores or small clusters (rarely in sporocarps); in soils
(rarely in roots); its subtending hyphae is hyaline to white, rarely subhyaline, often
conspicuously bill-shaped. Spores with mono- to multi-layered outer wall; pore clo-
sure at spore base often with a septum that may arise from the outer L2 or L4, or
from both layers (Walker and Schüßler 2010).
124 5 Glomeromycota Classification

Genus Claroideoglomus Walker and Schüßler

Species of this genus produces its spores on subtending hyphae; Spores generally
formed singly in soil (rarely in roots). Subtending hyphae are hyaline to white
(rarely subhyaline); its shape is funnel- or bill-shaped with widths > 2.5 times greater
at the spore base than at 10–20 μm from the spore. Spores with mono- or multi-
layered outer wall; pore closure at spore base often with a septum that arises from
the L2 or L4, or both innermost layers (Walker and Schüßler 2010).
Claroideoglomus type species: C. claroideum (Schenck and Sm.) Walker and
Schüßler
Spores of this species arise in soil singly lacking a peridium; cream to light yellow;
globose to subglobose; 80–160 μm diam (Walker and Schüßler 2010).
Spore wall composed by a four-layered outer wall (L1, L2, L3 and L4):
L1 = Hyaline mucilaginous layer; 0.6–1.8 μm thick; generally this layer appears
granular as it decompose; reactive in Melzer’s reagent;
L2 = Hyaline evanescent layer; 0.6–2.0 μm thick; degrading concomitant with L1;
not reactive in Melzer’s reagent;
L3 = Pale yellow laminated layer; 2.8–6.2 μm thick;
L4 = Concolorous with L3; Laminated layer; thin than 0.5 μm.
Subtending hypha is cylindrical to slightly flared; 6–8 μm width. Wall of sub-
tending hypha is composed by a three-layered wall (L1, L2, and L3) continuous
with the outer layers of the outer wall.
Other Claroideoglomus species:
• Claroideoglomus candidum (Furrazola, Kaonongbua & Bever), Oehl, G.A. Silva
& Sieverd., comb. nov.=Glomus candidum Furrazola, Kaonongbua & Bever
(2010). Mycotaxon 113: 103
• Claroideoglomus drummondii (Blaszk. & C. Renker) C. Walker & A. Schüßler
comb. nov.=Glomus drummondii Błaszk. & Renker (2006). Mycol. Res. 110: 559
• Claroideoglomus etunicatum (W.N. Becker & Gerd.) C. Walker & A. Schüßler
comb. nov.=Glomus etunicatum W.N. Becker & Gerd. (1977). Mycotaxon 6: 29
• Claroideoglomus lamellosum (Dalpé, Koske & Tews) C. Walker & A. Schüßler
comb. nov.=Glomus lamellosum Dalpé, Koske & Tews (1992). Mycotaxon 43: 289
• Claroideoglomus luteum (L.J. Kenn., J.C. Stutz & J.B. Morton) C. Walker &
A. Schüßler comb. nov.=Glomus luteum L.J. Kenn., J.C. Stutz & J.B. Morton
(1999). Mycologia 91: 1090
• Claroideoglomus walkeri (Blaszk. & C. Renker) C. Walker & A. Schüßler comb.
nov.=Glomus walkeri Błaszk. & Renker (2006). Mycol. Res. 110: 563

5.2.4 Order Paraglomerales (Walker and Schüßler)

Fungi of this order are hypogeous and forming mycorrhizas with arbuscules and
intraradical mycelium. It produces hyaline glomoid spores. Paraglomerales differ
from other orders in Glomeromycota by the possession of the rRNA SSU gene
5.2 Phylum Glomeromycota (Walker and Schüßler) 125

sequence signature (this sequence is based on only two species) GCGAAGCGTCA

TGGCCTTAACCGGCCGT corresponding to homologous position 703 of the
S. cerevisiae SSU rRNA sequence, with the underlined nucleotides being specific
for the taxon (Walker and Schüßler 2004).

5.2.4.1 Family Paraglomeraceae (Morton and Redecker)

This family has its mycorrhizal morphology very similar to that Archaeosporaceae.
Species of Paraglomeraceae differ from other species in Glomeromycota, especially
Glomus species because its: (1) features of its mycorrhizae; (2) its biochemical
composition (Graham et al. 1995); and (3) by the possession of the rRNA SSU gene
sequence signature TGCTAAATAGCCAGGCTGY that uniquely amplifies mem-
bers of this group as well as members of Archaeosporaceae (Redecker et al. 2000;
Morton and Redecker 2001).
Genus Paraglomus (Morton and Redecker)
The main characteristics of species from Paraglomus genus are: (1) its biochemical
composition (Wright et al. 1987; Graham et al. 1995); (2) rDNA sequence=GGCA
TGTCTGTTTGAGGGCACCA (Redecker et al. 1999, 2000); and (3) its mycor-
rhizae characters (See Table 5.11).
Paraglomus type species: Paraglomus occultum (Walker) Morton and Redecker
Paraglomus occultum species produces hyaline spores that become slightly yellow
with their maturity. Usually presents many shapes: globose, subglobose, ellipsoid,
obovoid, and irregular; 60–100 μm (mean = 72 μm, n = 120). Spore wall consisting
of three-layered outer wall (L1, L2, and L3). Its layers are hyaline, usually adherent,
and reactive in Melzer’s reagent. L1 is an evanescent layer; slough; 0.5–1.4 μm
thick when intact. L2 is finely laminate layer; less than 0.5–1.2 μm thick; continu-
ous with the wall of the subtending hypha. L3 also is finely laminate layer; less than
0.5–1.2 μm thick; continuous with the wall of the subtending hypha. Its subtending
hypha is cylindrical to slightly flared; 3.0–5.2 μm wide (mean = 4.1 μm, n = 60); and
has two hyaline layers that are continuous with the L2 and L3 of the outer wall
(Morton and Redecker 2001).

Table 5.11 Mycorrhizae characteristics from Paraglomus genus

Structures Characteristics
Arbuscules Narrow trunks (<4 μm), finely branched, stain very faint
Vesicles Absent
Auxiliary cells Absent
Intraradical hyphae Some coiling and irregular branching into roots; 2–8 μm wide;
smooth surface. Usually stain faint.
Extraradical hyphae Frequently coiling, 3–10 μm wide
Entry point Hyphae usually densely coiled near and around entry points
Mycorrhiza distribution Very patchy
126 5 Glomeromycota Classification

Other Paraglomus species:

• Paraglomus albidum (C. Walker & L.H. Rhodes) Oehl, G.A. Silva & Sieverd.,
comb. nov.=Glomus albidum C. Walker & L.H. Rhodes (1981). Mycotaxon 12: 509
• Paraglomus brasilianum (Spain & J. Miranda) J.B. Morton & D. Redecker
(2001). Mycologia 93(1): 190 = Glomus brasilianum Spain & J. Miranda (1996).
Mycotaxon 60: 139
• Paraglomus laccatum (Błaszk.) Renker, Błaszk. & Buscot (2007). Nova
Hedwigia 84(3–4): 400 = Glomus laccatum Błaszk. (1988). Bull. Pol. Acad. Sci.,
Biol. Sci. 36: 271
• Paraglomus lacteum (S.L. Rose & Trappe) Oehl, G.A. Silva & Sieverd. comb.
nov.=Glomus lacteum S.L. Rose & Trappe (1980). Mycotaxon 10: 415

References

Adams DG, Bergman B, Nierzwicki-Bauer SA, Rai AN, Schüßler A (2006) Cyanobacterial-plant
symbioses. In: Dworkin M, Falkow S, Rosenberg E, Schleifer K-H, Stackebrandt E (eds) The
prokaryotes. A handbook on the biology of bacteria, 3rd ed. vol 1, Symbiotic associations,
biotechnology, applied microbiology, Springer, New York. doi:10.1007/0-387-30741-9_14
Augé RM (2001) Water relations, drought and vesicular arbuscular mycorrhizal symbiosis.
Mycorrhiza 11:3–24
Bentivenga SP, Morton JB (1995) A monograph of the genus Gigaspora, incorporating develop-
mental patterns of morphological characters. Mycologia 87:720–732
Berkeley MJ, Broome CE (1873) Enumeration of the fungi of Ceylon. Part II. J Linn Soc London
Bot 14:137
Błaszkowski J (1995) Glomus corymbiforme, a new species in Glomales from Poland. Mycologia
87:732–737
Błaszkowski J (2012) Glomeromycota. W. Szafer Institute of Botany, Polish Academy of Sciences,
Kraków
Błaszkowski J, Chwat G (2013) Septoglomus deserticola emended and new combinations in the
emended definition of the family Diversisporaceae. Acta Mycológica 48:89–103. doi:10.5586/
am.2013.011
Błaszkowski J, Madej T, Tadych M (1998) Entrophospora baltica sp. nov. and Glomus fuegianum,
two species in the Glomales from Poland. Mycotaxon 68:165–184
Cavagnaro TR, Gao LL, Smith FA, Smith SE (2001) Morphology of arbuscular mycorrhizas is
influenced by fungal identity. New Phytol 151:469–475
Gerdemann JW, Bakshi BK (1976) Endogonaceae of India: two new species. Trans Br Mycol Soc
66:340–343
Gerdemann JW, Trappe JM (1974) The Endogonaceae in the Pacific Northwest. Mycol Memoir
5:1–76
Goto BT, Maia LC, Silva GA, Oehl F (2009) Racocetra intraornata, a new species in the
Glomeromycetes with a unique spore wall structure. Mycotaxon 109:483–491
Goto BT, Assis DMA, Souza RG, Silva DKA, Ferreira ACA, Jobim K, Mello CMA, Vieira HEE,
Maia LC, Silva GA, Oehl F (2012) Intraornatosporaceae (Gigasporales), a new family with two
new genera and two new species. Mycotaxon 119:117–132
Graham JH, Hodge NC, Morton JB (1995) Fatty acid methyl ester profiles for characterization of
glomalean fungi and their endomycorrhizae. Appl Environ Microbiol 61:58–64
Hodge A, Storer K (2014) Arbuscular mycorrhizal and nitrogen: implications for individual plants
through to ecosystems. Plant Soil 386:1–19
References 127

Kaonongbua W, Morton JB, Bever JD (2010) Taxonomic revision of the genus Acaulospora
(Glomeromycota) and description of Acaulospora colliculosa sp. nov. from a tallgrass prairie.
Mycologia 102:1497–1509
Kennedy LJ, Stutz JC, Morton JB (1999) Glomus eburneum and G. luteum, two new species of
arbuscular mycorrhizal fungi, with emendation of G. spurcum. Mycologia 91:1083–1093
Krüger M, Krüger C, Walker C, Stockinger H, Schüßler A (2012) Phylogenetic reference data for
systematics and phylotaxonomy of arbuscular mycorrhizal fungi from phylum to species level.
New Phytol 193:970–984. doi:10.1111/j.1469-8137.2011.03962.x
Morton JB, Benny GL (1990) Revised classification of arbuscular mycorrhizal fungi (Zygomycetes):
a new order, Glomales, two new suborders, Glomineae and Gigasporineae, and two new fami-
lies, Acaulosporaceae and Gigasporaceae, with an emendation of Glomaceae. Mycotaxon
37:471–491
Morton JB, Msiska Z (2010) Genetic and morphological characters do not support revised ranking
of Scutellospora species (Gigasporaceae, Glomeromycota) into three families and four genera.
Mycorrhiza 20:483–496
Morton JB, Redecker D (2001) Two new families of Glomales, Archaeosporaceae and
Paraglomaceae, with two new genera Archaeospora and Paraglomus, based on concordant
molecular and morphological characters. Mycologia 93:181–195
Morton JB, Bever JD, Pfleger FL (1997) Taxonomy of Acaulospora gerdemannii and Glomus
leptotichum, synamorphs of an arbuscular mycorrhizal fungus in Glomales. Mycol Res
101:625–631
Nicolson TH, Schenck NC (1979) Endogonaceous mycorrhizal endophytes in Florida. Mycologia
71:178–198
Oehl F, Sieverding E (2004) Pacispora, a new vesicular arbuscular mycorrhizal fungal genus in the
Glomeromycetes. J Appl Bot 78:72–82
Oehl F, Souza F, Sieverding E (2008) Revision of Scutellospora and description of five new genera
and three new families in the arbuscular mycorrhiza forming Glomeromycetes. Mycotaxon
106:311–360
Oehl F, da Silva GA, Goto BT, Maia LC, Sieverding E (2011) Glomeromycota: two new classes
and a new order. Mycotaxon 116:365–379
Palenzuela J, Ferrol N, Boller T, Azcón-Aguilar C, Oehl F (2008) Otospora bareai, a new fungal
species in the Glomeromycetes from a dolomitic shrub land in Sierra de Baza National Park
(Granada, Spain). Mycologia 100:296–305
Palenzuela J, Barea JM, Ferrol N, Azcón-Aguilar C, Oehl F (2010) Entrophospora nevadensis, a
new arbuscular mycorrhizal fungus from Sierra Nevada National Park (southeastern Spain).
Mycologia 102:624–632. doi:10.3852/09-145
Pfeiffer CM, Walker C, Bloss HE (1996) Glomus spurcum: a new endomycorrhizal fungus from
Arizona. Mycotaxon 59:373–382
Redecker D, Morton JB, Bruns TD (2000) Ancestral lineages of arbuscular mycorrhizal fungi
(Glomales). Mol Phylogenet Evol 14:276–284
Redecker D, Raab P, Oehl F, Camacho FJ, Courtecuisse R (2007) A novel clade of sporocarp-
forming species of glomeromycotan fungi in the Diversisporales lineage. Mycol Progr
6:35–44
Rodríguez-Echeverría S, Hol G, Freitas WH, Eason HW, Cook R (2008) Arbuscular mycorrhizal
fungi of Ammophila arenaria (L.) Link: spore abundance and root colonisation in six locations
of the European coast. Eur J Soil Biol 44:30–36
Rodríguez-Echeverría S, Crisóstomo JA, Nabais C, Freitas H (2009) Belowground mutualists and
the invasive ability of Acacia longifolia in coastal dunes of Portugal. Biol Invasions
11:651–661
Redecker D, Schüßler A, Stockinger H, Stürmer S, Morton JB, Walker C (2013) An evidence-
based consensus for the classification of arbuscular mycorrhizal fungi (Glomeromycota).
Mycorrhiza. doi:10.1007/s00572-013-0486-y
Schüßler A (2002) Molecular phylogeny, taxonomy, and evolution of Geosiphon pyriformis and
arbuscular mycorrhizal fungi. Plant Soil 244:75–83
128 5 Glomeromycota Classification

Schüßler A (2012) The Geosiphon–Nostoc endosymbiosis and its role as a model for arbuscular
mycorrhiza research. In: Hock B (ed) The Mycota IX—fungal associations, 2nd edn. Springer,
Berlin, pp 77–91
Schüßler A, Walker C (2010) The Glomeromycota: a species list with new families and new gen-
era. The Royal Botanic Garden, Edinburgh. www.amf-phylogeny.com
Schüßler A, Schwarzott D, Walker C (2001) A new fungal phylum, the Glomeromycota: phylog-
eny and evolution. Mycol Res 105:1413–1421
Sieverding W, Oehl F (2006) Revision of Entrophospora and description of Kuklospora and
Intraspora, two new genera in the arbuscular mycorrhizal Glomeromycetes. J Appl Bot Food
Qual 80:69–81
Smith SE, Read DJ (2008) Mycorrhizal symbiosis. Academic, San Diego
Spain JL, Sieverding E, Oehl F (2006) Appendicispora: a new genus in the arbuscular mycorrhiza-
forming Glomeromycetes, with a discussion of the genus Archaeospora. Mycotaxon
97:163–182
Verdin A, Sahraoui AL-H, Fontaine J, Grandmoungin-Ferjani A, Durand R (2006) Effects of
anthracene on development of an arbuscular mycorrhizal fungus and contribution of the sym-
biotic association to pollutant dissipation. Mycorrhiza 16:397–405
Walker C (2008) Ambispora and Ambisporaceae resurrected. Mycol Res 112:297–298
Walker C, Sanders FE (1986) Taxonomic concepts in the Endogonaceae: III. The separation of
Scutellospora gen. nov from Gigaspora Gerd. & Trappe. Mycotaxon 27:169–182
Walker C, Schüßler A (2004) Nomenclatural clarifications and new taxa in the Glomeromycota.
Mycol Res 108:981–982
Walker C, Błaszkowski J, Schwarzott D, Schüßler A (2004) Gerdemannia gen. nov., a genus sepa-
rated from Glomus, and Gerdemanniaceae fam. nov., a new family in the Glomeromycota.
Mycol Res 108:707–718
Walker C, Vestberg M, Demircik F, Stockinger H, Saito M, Sawaki H, Nishmura I, Schüßler A
(2007a) Molecular phylogeny and new taxa in the Archaeosporales (Glomeromycota):
Ambispora fennica gen. sp. nov., Ambisporaceae fam. nov., and emendation of Archaeospora
and Archaeosporaceae. Mycol Res 111:137–153
Walker C, Vestberg M, Schüßler A (2007b) Nomenclatural clarification in Glomeromycota. Mycol
Res 111:253–256
Wright SF, Morton JB, Sworobuk JE (1987) Identification of a vesicular-arbuscular mycorrhizal
fungus by using monoclonal antibodies in an enzyme-linked immunosorbent assay. Appl
Environ Microbiol 53:2222–2225
Zhang Q, Yang R, Tang J, Yang H, Hu S, Chen X (2010) Positive feedback between mycorrhizal
fungi and plants influences plant invasion success and resistance to invasion. PLoS One 5,
e12380. doi:10.1371/journal.pone.0012380
Appendices: Keys to Taxa Glomeromycota
Species

1.1 Appendix A: Key to Taxa Gigaspora Species Proposed

by Gerdemann and Trappe in 1974

1a Azygospores hyaline to yellow or yellowish green, smooth 2

1b Azygospores light to dark brown 4
2a Spores hyaline when fresh, with brown suspensor-like cells and G. gilmorei
brown knobby, clustered soil-borne vesicles
2b Spores hyaline to yellow or greenish-yellow with concolorous 3
suspensor-like cells smooth to echinulate soil-borne vesicles
3a Globose spores less than 300 μm diam; vesicles smooth to knobby, G.
formed singly calospora
3b Globose spores generally larger than 300 μm; vesicles echinulate G. gigantea
formed in clusters
4a Globose spores larger than 300 μm, ornamented with scattered, G.
irregularly shaped, hyaline warts and ridges 2 μm tall; vesicles coralloidea
coralloid
4b Globose spores less than 300 μm, ornamented with minute spines; G.
vesicles smooth (extra-limital species). heterograma

© Springer International Publishing Switzerland 2015 129

T. Souza, Handbook of Arbuscular Mycorrhizal Fungi,
DOI 10.1007/978-3-319-24850-9
130 Appendices: Keys to Taxa Glomeromycota Species

1.2 Appendix B: Key to Taxa Family Endogonaceae

Proposed by Tandy in 1975

Chlamydospores are subtended by one hypha, and the spore and sporophore contents are
directly connected or divided by a distinct septum. Zygospores are subtended by two hyphae
and the endospore in continuous
1a Sporocarp containing zygospores 2 (Endogone spp.)
1b Sporocarp containing chlamydospores 6 (Glomus spp.)
2a Zygospores aggregated in distinct groups 3
2b Zygospores not aggregated, scattered throughout 5
fructification
3a Zygospore wall in one thick (9–22 μm) layer Endogone crassa
3b Zygospore wall in two distinct layers, 25 μm together 4
4a Gametangia usually widely separated, discrete Endogone aggregata
4b Gametangia fused Endogone
tuberculosa
5a Zygospore surrounded by a whorled sheath in surface Endogone
view resembling a fingerprint flammicorona
5b Zygospore surrounded by a ramifying sheath, reticulate Endogone reticulata
in surface view
6a Chlamydospore with septum at its base Glomus pulvinatus
6b Chlamydospore without septum at its base 7
7a Chlamydospore mostly more than 130 μm in diameter Glomus
macrocarpus var.
macrocarpus
7b Chlamydospores less than 130 μm in diameter 8
8a Chlamydospore wall in one thick (3–4 μm) layer, Glomus tubiformis
sporophore usually occlused
8b Chlamydospore wall in two layers, to 8 μm together, Glomus tener
sporophore open

1.3 Appendix C: Key to Taxa Family Endogonaceae

Proposed by Nicolson and Schenck in 1979

Key to Florida Endogonaceae

1a Forming chlamydospores free in the soil, in sporocarps or within 2
roots
1b Forming azygospores on terminally swollen hyphae 3
2a Chlamydospores only in sporocarps containing a single tightly Sclerocystis
packed layer of spores around a central plexus of hyphae
2b Chlamydospores usually free in soil or within roots; if in a Glomus
sporocarp, not as in 2 above
(continued)
(continued)
3a Azygospores terminally attached to a swollen hyphal tip Gigaspora
(suspensor-like cell) that frequently bears a smaller hypha
projecting towards the spore; Spores usually free in soil with a
bulbous (suspensor-like cell) attachment
3b Azygospores laterally attached to a swollen hypha tapering to a Acaulospora
large terminal vesicle which collapses with age; spores usually
free in the soil with no hyphal attachment
Glomus
1a Chlamydospore walls on mature spores predominantly hyaline, 2
white or yellow occasionally becoming dark yellow to brown with
age
1b Chlamydospore walls on mature spores predominantly brown to 5
black, occasionally yellow brown when young
2a Chlamydospore walls hyaline (becoming yellow with age), walls Glomus clarus
7–31 μm thick, frequently formed within the roots
2b Chlamydospore walls yellow to yellow brown, not formed within 3
the roots
3a Hyphal attachment to spore frequently funnel shaped, spores Glomus
100–300 μm in diam, spores formed ectocarpically or within mosseae
sporocarps of 1–10 spores
3b Hyphal attachment not funnel shaped, spores usually less than 4
100 μm
4a Spores greater than 50 μm in diam, usually formed in sporocarps Glomus fulvus
above the soil surface
4b Spores 50 μm in diam or less, hypogeous Glomus
microcarpus
4c No spores usually formed, when present 10–12 μm in diam; Glomus tennis
hyphae on roots thin (0.5–3.0 μm wide), with irregular swellings
5a Spores formed ectocarpically or in old roots, spore diam not 6
exceeding 150 μm
5b Spores not formed in old roots, spore diam frequently exceeding 7
150 μm
6a Young spores with an ephemeral outer wall up to 5 μm thick and a Glomus
laminate inner wall 2–8 μm thick etunicatus
6b Spore without an ephemeral outer wall; spore wall yellow brown, Glomus
3–17 μm in diam; spores frequently tightly packed in sporocarps fasciculatus
7a Chlamydospores dark brown to black; not formed in sporocarps G.
macrocarpus v.
geosporus
7b Chlamydospores yellow brown; spores formed ectocarpically or in G.
sporocarps macrocarpus v.
macrocarpus
Sclerocystis
1a Sporocarps enclosed in a peridium 2
1b Sporocarps not in a peridium; resembling a miniature blackberry Sclerocystis
rubiformis
2a Sporocarp peridium composed of thick walled, sinuous hyphae Sclerocystis
tightly enclosing the spores sinuosa
2b Sporocarp peridium without sinuous hyphae Sclerocystis
coremioides
(continued)
132 Appendices: Keys to Taxa Glomeromycota Species

(continued)
Acaulospora
1a Azygospores over 100 μm in diam 2
1b Azygospores less than 100 μm in diam Acaulospora
trappei
2a Azygospores with two readily separable walls; outer spore wall Acaulospora
with cerebriforme folds up to 12 μm tall gerdemannii
2b Azygospores without readily separable walls, walls smooth Acaulospora
laevis
Gigaspora
1a Azygospores light brown to dark brown or black 2
1b Azygospores hyaline, white, yellow or greenish yellow 5
2a Azygospores wall black, pitted with pores; spores over 250 μm Gigaspora
diam; accessory vesicles in clusters nigra
2b Azygospores light to dark brown 3
3a Azygospores 250 μm or larger 4
3b Azygospores usually less than 250 μm; outer wall with minute Gigaspora
spines; accessory vesicles in clusters heterograma
4a Accessory vesicles in clusters; outer wall continuous with Gigaspora
irregular shaped projections 1–7 × 3–12 μm gregaria
4b Accessory vesicles borne singly, coralloid; wall surface with Gigaspora
openly spaced hyaline ridges 2 μm tall by 0.5 6 μm broad (not coralloidea
known to occur in Florida)
5a Azygospores with an outer wall readily separating under pressure 6
from the inner wall; azygospores hyaline
5b Azygospores without separable walls 7
6a Azygospores under 250 μm in diam; suspensor cell hyaline; Gigaspora
accessory vesicles brown, knobby, borne singly or in clusters pellucida
6b Azygospores over 250 μm in diam; suspensor cell light brown; Gigaspora
accessory vesicles pale brown, knobby, borne in clusters (not gilmorei
known to occur in Florida)
7a Azygospore walls consisting of one layer, usually less than 5 μm Gigaspora
thick; spores hyaline, white or shades of yellow; accessory calospora
vesicles knobby, borne singly (not known to occur in Florida)
7b Azygospore walls consisting or more than one layer; accessory 8
vesicles borne in clusters
8a Azygospores predominantly some shade of yellow 9
8b Azygospores predominantly some shade of white 10
9a Azygospores yellow to greenish yellow; accessory vesicles spiny, Gigaspora
borne in clusters; suspensor-like cell 41–51 μm in diam gigantea
9b Azygospores pale yellow to dull yellow, never turning greenish Gigaspora
yellow; accessory vesicles in clusters, spiny to knobby; suspensor- aurigloba
like cell 40–70 μm diam
10a Azygospores white to cream with a pink tint in the area of the Gigaspora
suspensor-like cell; spores usually less than 300 μm in diam rosea
10b Azygospores white to cream; usually greater than 300 μm in diam Gigaspora
margarita
Appendices: Keys to Taxa Glomeromycota Species 133

1.4 Appendix D: Key to Taxa Family Endogonaceae

Proposed by Hall and Fish in 1979

1a Sporocarps present, may be fused into mats; if few spores 2

in sporocarp (1–4) then peridium well-developed
1b Sporocarps absent but spores may be aggregated into loose 57
clusters
2a Spore sessile or spore attachments not seen (attachments 3
may be obscured by peridial hyphae)
2b Spore not as above 11
3a Spore wall single, or, if double, outer wall thin and difficult 4
to discern; if single may be laminate
3b Spore wall double or multiple 7
4a Sporocarp often exuding a sticky latex when cut; spores Glomus melanosporus
containing a white latex; spore wall grading in colour from Gerdemann and Trappe
dark at outer surface to subhyaline near inner surface
4b Sporocarp not exudes sticky latex when cut; spores not 5
containing White latex; spore wall uniform in colour
5a Spores in sporocarps arranged in single layer around a Sclerocystis sinuosa
central plexus of sterile hyphae; peridium of tightly Gerdemann and Bakshi
5b Spores in sporocarps arranged randomly 6
6a Spores enclosed in tightly appressed hyphal mantles Glomus convolutus
(cursory exanimation may suggest that the mantle is an Gerdemann and Trappe
ornamentation of the spore wall); diam of sporocarps
greater than 1 mm
6b Spores not enclosed in hyphal mantles; diam of sporocarps 21
less than 1 mm
7a Sporocarps often exuding sticky latex when cut; hyphal 46
mantle may be present
7b Sporocarps never exuding sticky latex when cut; Hyphal 8
mantle never present
8a Spores sessile or almost sessile, borne in a cluster on the Glomus fuegianus (Speg.)
end of a swollen hyphal tip Trappe and Gerdemann
8b Spore not as above 9
9a Diam of sporocarps less than 1 mm but sporocarps may be 10
fused in pulvinata masses
9b Diam of sporocarps greater than 1 mm 48
10a Sporocarps containing many spores and whitish to light Endogone alba (Petch)
grey (may be fused together in pulvinata masses) Gerdemann and Trappe
10b Sporocarps containing 1–12 spores and coloured but may 75
be pale if immature
11a Spore wall single, or, if double, outer wall thins and 12
difficult to discern; wall may be laminate
11b Spore wall double or multiple 36
12a Sporocarp with a covering of large thin-walled vesicles or 13
spores interspersed with large thin-walled vesicles
(continued)
134 Appendices: Keys to Taxa Glomeromycota Species

(continued)
12b Sporocarp not as above 15
13a Spores in sporocarps arranged in a single layer around a Sclerocystis dussii (Pat.)
central plexus of sterile hyphae; sporocarp diam less than Höhn.
1 mm; sporocarps fused to form a tuberculata crust on soil
surface with the upper surface of the crust covered with
thin-walled vesicles; fish-like odour when fresh,
particularly if kept moist in a closed container
13b Spores in sporocarps arranged randomly or in discrete 14
clusters; sporocarp diam greater than 1 mm; sporocarps not
fused but may form a crust on the soil surface; odour not
distinctive
14a Spores in sporocarps may be arranged in clusters; pore Glomus vesiculifer
partially occlused by wall thickening, never with a distinct (Thaxter) Gerdemann and
septum; sporocarp with a well-developed peridium; spore Trappe
length 150–230 μm
14b Spores in sporocarps arranged randomly; pore with a Glomus flavisporus
distinct septum, not occlused; sporocarp with a well- (Lange and Lund)
developed peridium; spore length 150–230 μm Gerdemann and Trappe
15a Spores with thin walls and always containing few to many 16
thin-walled sporangiospores
15b Spore not as above but internal spores may be present in 17
some spores
16a Sporangia 55–118 μm diam, containing more than 20 Modicella malleola
sporangiospores with 7–17 μm diam (Harkn.) Gerdemann and
Trappe
16b Sporangia generally less than 60 μm diam, containing Modicella reniformis
4–12, rarely more, sporangiospores with 12–38 μm diam (Bres.) Gerdemann and
Trappe
17a Spores clavate, much longer than broad, 140– Sclerocystis clavispora
185 × 20–50 μm, with a very thick-walled tip Trappe
17b Spore not as above 18
18a Outer surface of sporocarp a thick gelatinous wall. Glaziella aurantiaca
Sporocarps hollow and bright orange, yellow or scarlet (Berk. and Curt.) Cke
when fresh, up to 50 mm diam
18b Sporocarps not as above 19
19a Diam of sporocarps less than 1 mm (sporocarps may be 20
fused into pulvinata masses)
19b Diam of sporocarps greater than 1 mm 25
20a Spores in sporocarps arranged randomly; spores generally 21
globose, occasionally longer than broad
20b Spores in sporocarps arranged in a single layer around a 22
central plexus of sterile hyphae; spores often longer than
broad (ellipsoid, ovoid, obovoid, or clavate)
21a Diam of spores 18–48 μm; sporocarps containing many Glomus pubescens (Sacc.
spores; subtending hyphae inconspicuous, approximately and Ell.) Trappe and
2 μm diam Gerdemann
21b Diam of spores greater than 105 μm, sporocarps containing 75
1–12 spores; subtending hyphae greater than 8 μm diam
(continued)
Appendices: Keys to Taxa Glomeromycota Species 135

(continued)
22a Peridium containing scattered small globose Sclerocystis coccogena
chlamydospores (Pat.) Höhn.
22b Peridium not as above or poorly-developed or absent 23
23a Pore usually with a distinct septum Sclerocystis coremioides
Berk. and Br.
23b Pore never with a distinct septum 24
24a Peridium partially covering sporocarp or poorly developed Sclerocystis rubiformis
or absent Gerdemann and Trappe
24b Peridium completely covering sporocarp, consisting of Sclerocystis sinuosa
thick-walled sinuous hyphae completely enclosing Gerdemann and Trappe
sporocarp
25a Spores with two subtending hyphae; spores in sporocarps Endogone crassa Tandy
arranged in discrete clusters
25b Spores with one subtending hyphae; spores in sporocarps 26
random or arranged in radiate rows
26a Sporocarps often exuding a sticky latex when cut; spores Glomus melanosporus
containing a white latex; spore wall grading in colour from Gerdemann and Trappe
dark at outer surface to subhyaline near inner surface;
subtending hyphae inconspicuous
26b Sporocarps not exuding a sticky latex when cut; spores not 27
containing a whit latex; spore wall uniform in colour
27a Spores in sporocarps produced acrogenously, arranged in Glomus radiatus
radiate rows; Mature spore often filled with hyphae similar (Thaxter) Trappe and
to the glebal hyphae Gerdemann
27b Spores in sporocarps random; mature spores rarely filled 28
with hyphae
28a Pore often with a distinct septum 29
28b Pore never with a septum 34
29a Sporocarps containing 1–2 spores Red-brown laminate
(Mosse and Bowen)
29b Sporocarps containing many spores 30
30a Spores often longer than broad (ellipsoid, ovoid, or 31
obovoid)
30b Spore generally globose 33
31a Spore wall reddish-brown, up to 8 μm thick; sporocarps Glomus borealis
naked, without a peridium (Thaxter) Trappe and
Gerdemann
31b Spore wall hyaline to pale yellow, up to 4 μm thick; 32
sporocarps generally but not always with a peridium
32a Spores 55–160 μm in length; diam of subtending hypha at Glomus fulvus (Berk. and
widest part 5–15 μm Br) Trappe and
Gerdemann
32b Spores 70–100 μm in length; diam of subtending hyphae at Glomus canadensis
widest part 4–6 μm (Thaxter) Trappe and
Gerdemann
33a Pore not occluded and always with a distinct septum; Glomus pulvinatus
spores 48–100 × 45–105 μm; wall becoming laminate with (Henn.) Trappe and
age Gerdemann
(continued)
136 Appendices: Keys to Taxa Glomeromycota Species

(continued)
33b Pore partially occlused with septum present in mature Glomus pallidus Hall
spores; spores 32–78 × 28–68 μm; wall becoming laminate
with age
34a Spores enclosed in tightly appressed hyphal mantles; Glomus convolutus
spores containing a yellow oil Gerdemann and Trappe
34b Spores not enclosed in hyphal mantles; spores not 35
containing a yellow oil
35a Spores in sporocarps interspersed with trumpet-shaped Glomus tubiformis Tandy
hyphae
35b Spores in sporocarps not interspersed with trumpet-shaped 70
hyphae
36a Spores with one subtending hypha 37
36b Spores with two subtending hyphae 45
37a Spore with a distinct septum 38
37b Pore never with a septum 40
38a Spore outer wall hyaline, 1–8 μm thick, extending up to Glomus caledonius
35 μm along subtending hypha as a loose sleeve (Nicol. and Gerd.)
Gerdemann and Trappe
38b Spore outer wall hyaline, less than 1 μm thick, not 39
extending along subtending hypha
39a Sporocarps containing many spores; spores 49–73 μm Glomus fragilis (Berk.
diam and Br.) Trappe and
Gerdemann
39b Sporocarps containing 1–12 spores; spores 100–330 μm 75
diam
40a Spore wall multiple, consisting of 3–5 distinct layers Glomus gerdemannii
Rose, Daniels and Trappe
40b Spore wall double 41
41a Sporocarps with a covering of large thin-walled vesicles or Glomus vesiculifer
spores interspersed with large thin-walled vesicles (Thaxter) Gerdemann and
Trappe
41b Sporocarp not as above 42
42a Spores sessile or almost sessile, borne in a cluster on the Glomus fuegianus (Speg.)
end of a swollen hyphal tip; spores outer wall thicker than Trappe and Gerdemann
inner wall
42b Spore not as above; spore outer wall much thinner than 43
inner wall
43a Outer surface of inner wall of mature spores ornamented Glomus monosporus
with minute echinulate projections; projections and thin Gerdemann and Trappe
outer wall may not be obvious on all spores; spores often
filled with hyphae
43b Outer surface of inner wall not ornamented; spores rarely 44
filled with hyphae
44a Spore inner wall always hyaline; subtending hypha often Glomus tener Tandy
constricted at point of attachment
44b Spore inner wall yellow to brown though may be hyaline 101
in young spores; subtending hyphae not constricted at
point of attachment
(continued)
Appendices: Keys to Taxa Glomeromycota Species 137

(continued)
45a Sporocarps often exuding a sticky latex when cut 46
45b Sporocarps not exuding a sticky latex when cut 48
46a Spore outer wall generally slightly thicker than inner wall; Endogone oregonensis
spores in sporocarps arranged in discrete clusters; spores Gerdemann and Trappe
not enclosed in hyphal mantles
46b Spore outer wall much thinner than inner wall; spores in 47
sporocarps random; spores enclosed in tightly appressed
hyphal mantles
47a Subtending hyphae persistent and up to 80 μm wide; Endogone lactiflua Berk.
hyphal mantle consisting of more than one layer of and Br.
interwoven hyphae; width of spores 94–190 μm
47b Subtending hyphae less than 40 μm wide; subtending Endogone flammicorona
hyphae generally disappearing by maturity; hyphal mantle Trappe and Gerdemann
consisting of a single layer of spirally arranged hyphae;
width of spores 42–99 μm
48a Spore outer wall much thinner than inner walls 49
48b Spore outer wall thicker than inner or walls of 52
approximately equal thickness
49a Sporocarps brick-red when fresh; spores enclosed in Endogone reticulata
tightly appressed hyphal mantles; subtending hyphae Tandy
generally persistent
49b Sporocarps orange to yellow when fresh; spores not 50
enclosed in hyphal mantles; subtending hyphae
inconspicuous
50a Sporocarps often with a cavity opening to the exterior at Endogone pisiformis Lk
maturity; spores in sporocarps random ex Fr.
50b Sporocarps without a cavity; spores arranged in discrete 51
clusters or radiate rows
51a Spores in sporocarps produced acrogenously in radiate Endogone acrogena
rows; sporocarp surface covered at maturity by matted Gerdemann, Trappe and
glebal hyphae (not a true peridium); sporocarps generally Hosford
epigeous
51b Spores in sporocarps arranged in discrete clusters; Endogone verrucosa
sporocarps surface naked; sporocarps generally hypogeous Gerdemann and Trappe
52a Spores in sporocarps random; sporocarps always globose Endogone incrassata
to subglobose; sporocarps when fresh smelling of onions; Thaxter
internal cavity present in mature sporocarps
52b Spores in sporocarps arranged in radiate rows and spores 53
produced acrogenously in discrete clusters, or in thin
strata; sporocarps much lobed, irregular or variable; odour
not distinctive; sporocarps without an internal cavity
53a Spores in sporocarps arranged in discrete clusters 54
53b Spores in sporocarps in radiate rows or smooth to 56
verrucose, folded and convoluted strata
54a Spores enclosed in tightly appressed hyphal mantles; Endogone multiplex
sporocarps dirty whitish Thaxter
54b Spores not enclosed in hyphal mantles; sporocarps 55
yellowish but may be pale if immature
(continued)
138 Appendices: Keys to Taxa Glomeromycota Species

(continued)
55a Spore outer wall much thicker than inner wall (4 μm and Endogone tuberculosa
1–2 μm thick respectively); spores 44–90 × 42–150 μm Lloyd
55b Spore walls approximately the same thickness (4–13 μm Endogone aggregata
each); spores 78–103 × 118–182 μm Tandy
56a Spores in sporocarps arranged in smooth to verrucose Endogone stratosa
folded strata, the spores within strata arranged randomly or Trappe, Gerdemann and
in discrete clusters; spores enclosed in tightly appressed Fogel
hyphal mantles; spores 113–177 × 82–149 μm
56b Spores in sporocarps produced acrogenously, arranged in Endogone acrogena
radiate rows; spores not enclosed in hyphal mantles; spores Gerdemann, Trappe and
15 × 30–80 × 59 μm; subtending hyphae often disappearing Hosford
by maturity
57a Spore surface covered in projections 4–30 × 2–5 μm, often 58
with the tips reflexed
57b Spore surface not as above 60
58a Spores and subtending hyphae light to dark brown; Crenulate spore (Hall;
subtending hyphae with 2–5 distinct septa Mosse and Bowen)
58b Spores and subtending hyphae hyaline; subtending hyphae 59
without septa, fragile and often disappearing by maturity
59a Projections on spore surface 12–30 μm high White reticulate spore
(Hayman)
59b Projections on spore surface less than 6 μm high WUM4
60a Spore wall single, or, if double, outer thin and difficult to 61
discern. If wall single may be laminate
60b Spore wall double or multiple 76
61a Diam of spores less than 15 μm, associated with vesicular Glomus tenuis (Geenall)
arbuscular mycorrhizas with hyphae rarely exceeding 2 μm Hall
diam and with vesicles less than 15 μm diam
61b Diam of spores greater than 15 μm and if associated with 62
vesicular arbuscular mycorrhizas then with hyphae and
vesicles not as above
62a Spores with 1–4 subtending hyphae, generally attached at Glomus multicaulis
opposite ends of spores; spore wall thick (8–34 μm) with Gerdemann and Bakshi
rounded projections 1.2–3.7 μm high and regularly
distributed over spore surface
62b Spore attachment generally single or spore sessile; spore 63
wall not ornamented
63a Spore sessile, borne laterally on a thin-walled hypha Acaulospora trappei
ending in thin-walled mother spore; spores Ames and Lindermann
50–82 × 42–72 μm, always hyaline
63b Spore not sessile; if subtending hyphae not seen spores 64
generally generate than 100 μm diam; spores hyaline or
coloured
64a Subtending hypha with a single lateral projections; spores WUM8
always hyaline; spore wall approximately 4 μm thick;
subtending hyphae may be inconspicuous
64b Subtending hypha lacking a lateral projection; spores 65
hyaline or coloured; subtending hyphae generally
persistent and conspicuous
(continued)
Appendices: Keys to Taxa Glomeromycota Species 139

(continued)
65a Subtending hypha simple; spores hyaline or coloured 66
65b Subtending hypha funnel-shaped; spores and subtending 74
hyphae coloured
66a Subtending hypha constricted at point of attachment to Glomus constrictum
spore and with many attached fine hyphae; pore never with Trappe
a septum
66b Subtending hypha not constricted at point of attachment 67
and generally without fine hyphae attached; pore may have
a septum;
67a Spore surface ornamented with minute echinulations, a Glomus monosporus
thin outer wall should be present on some spores; spores Gerdemann and Trappe
often filled with hyphae at maturity
67b Spore surface not ornamented; spores rarely filled with 68
hyphae
68a Pore often with a distinct septum 69
68b Pore never with a septum 70
69a Spores 32–78 × 28–68 μm, white to pale yellow Glomus pallidus Hall
69b Spores greater than 68 μm wide, yellow, brown or reddish 119
brown
70a Width of spores 25–35 μm but generally less than 50 μm; Glomus microcarpus Tul.
spore wall up to 7 μm thick and Tul.
70b Width of spores 35–400 μm but generally greater than 71
50 μm; spore wall up to 17 μm thick
71a Spores dark brown to black; subtending hypha yellow to Glomus macrocarpum
dark brown with wall thickenings extending 50–150 μm var. geosporus (Nicol.
along hypha; spores always ectocarpic and Gerd.) Gerdemann
and Trappe
71b Spores hyaline, yellow, brown, or reddish-brown; 72
subtending hypha not as above; spores ectocarpic or
sporocarpic
72a Width of spores 35–105 μm Glomus fasciculatus
(Thaxter sensu
Gerdemann) Gerdemann
and Trappe
72b Width of spores 95–400 μm 73
73a Spore reddish-brown; spore wall always laminate; thin Red-brown laminate
outer wall never present; sporocarps if present containing (Mosse and Bowen)
1–2 spores
73b Spores hyaline, yellow or brown; spore wall may be Glomus macrocarpus var
laminate; spores with thick-walled subtending hyphae may macrocarpus Tul. and
have a thin outer wall; sporocarps if present. Containing Tul.
many spores
74a Pore never with a distinct septum WUM2
74b Pore often with a distinct septum 75
75a Spores often filled with hyphae; sporocarp containing 1–3 Glomus monosporus
spores; diam of subtending hyphae at widest part 8–26 μm; Gerdemann and Trappe
outer surface of inner wall of mature spore ornamented
with minute echinulate projections; projections and thin
outer wall may not be obvious on all spores
(continued)
140 Appendices: Keys to Taxa Glomeromycota Species

(continued)
75b Spores rarely filled with hyphae; sporocarp containing Glomus mosseae (Nicol.
1–10 spores; diam of subtending hyphae at widest part and Gerd.) Gerdemann
18–50 μm; outer surface of inner wall not ornamented; thin and Trappe
hyaline outer wall may no be obvious on all spores
76a Double spore wall 77
76b Spore wall multiple consisting of 3 or more distinct layers 103
77a Spores hyaline to white at maturity 78
77b Spores coloured though may be pale when young 82
78a Subtending hypha bulbous, often with one or more lateral 79
projections; soil-borne vesicles may be present
78b Subtending hypha simple or funnel-shaped or not seen; 81
soil-borne vesicles never present
79a Spore wall consisting of 2–5 layers, each layer 1–2 μm Gigaspora rosea
thick; portion of spore wall around subtending hypha with Nicolson and Schenck
a distinct to barely detectable rose-pink tint
79b Spore wall always double; spore wall never with a 80
rose-pink tint
80a Warts formed on inner wall surrounding the bases of the WUM7
germ tubes; germ tube not arising from compartments in
the spore wall; spores globose to subglobose
80b Warts not formed during germination; germ tubes arising Type 3 (Sward et al.)
from compartments in spore wall; spores generally broader
than long
81a Subtending hypha funnel-shaped and fragile; spore outer WUM3
wall thinner than inner walls of approximately the same
thickness; walls readily separable; outer surface of inner
wall with smooth to irregular bumps and hollows up to
1 μm high with the inner surface of the outer wall
matching
81b Subtending hypha simple and generally persistent; spore WUM5
outer wall thicker than inner wall; walls not readily
separable; outer surface of inner wall not ornamented
82a Spore surface ornamented with warts and ridges, minute 83
spines, or cerebriforme folds
82b Spore surface not ornamented 85
83a Spores sessile, borne laterally on a thin-walled hypha Acaulospora gerdemannii
ending in a thin-walled mother spore; parent hypha often Schenck and Nicolson
not seen; soil-borne vesicles never present; spore surface
ornamented with cerebriforme folds up to 10–12 μm high
83b Spores not sessile; subtending hypha bulbous and 84
persistent; soil-borne vesicles may be present; spore
surface ornamented with warts and ridges or minute spines
84a Spore surface ornamented with scattered irregularly shaped Gigaspora coralloidea
warts and ridges about a 2 μm high; diam of spores greater Trappe, Gerdemann and
than 300 μm; soil-borne vesicles if present, coralloid and Ho
borne singly
84b Spore surface ornamented with minute spines; diam of Gigaspora heterograma
spores less than 300 μm; soil-borne vesicles, if present, (Nicol. and Gerd.)
smooth and borne in clusters of 1–10 Gerdemann and Trappe
(continued)
Appendices: Keys to Taxa Glomeromycota Species 141

(continued)
85a Ornamentation of outer surface of inner wall generally 86
present in mature spores (polygonal projections, small
echinulations, or irregular)
85b Ornamentation of outer surface of inner wall not occurring 88
or not a regular feature
86a Spore outer wall much thinner than inner wall; outer Glomus monosporus
surface of inner wall ornamented with minute Gerdemann and Trappe
echinulations
86b Spore outer wall thicker than inner wall or walls of equal 87
thickness; outer surface of inner wall ornamented with
polygonal projections or irregular
87a Spore walls of equal thickness; outer surface of inner wall WUM1
irregular; spore develops terminally on a simple hypha
87b Spore outer wall thicker than inner wall; outer surface of Entrophospora infrequens
inner wall ornamented with polygonal projections; spore (Hall) Ames and
develops in a hyaline hypha which subtends a hyaline Schneider
vesicle. Spore thus with a smooth hyaline outer wall and a
brown, ornamented inner wall. A stalk continuous with the
inner spore wall joins the contents of the spore and those
of the vesicle
88a Spores sessile or almost sessile borne in a cluster on the Glomus fuegianus (Speg.)
end of a swollen hyphal tip Gerdemann and Trappe
88b Spores not as above 89
89a Subtending hypha bulbous; soil-borne vesicles may be 90
present
89b Subtending hypha simple or funnel-shaped; spol borne 94
vesicles never present
90a Portion of spore wall surrounding subtending hypha with a Gigaspora rosea
distinct to barely detectable rose-pink tint; spores whitish Nicolson and Schenck
to cream
90b Spore wall surrounding subtending hypha without a 91
rose-pink tint; spores yellowish or greenish
91a Spore outer wall much thinner than inner wall; soil-borne Gigaspora gigantea
vesicles, if present, with septate echinulations at apex (Nicol. and Gerd.)
Gerdemann and Trappe
91b Spore outer wall much thicker than inner wall or walls of 92
approximately equal thickness; soil-borne vesicles if
present, smooth to echinulate to knobby
92a Spore walls of approximately equal thickness, outer brittle, WUM6
inner flexible each of a layers which are not always
obvious
92b Spore outer wall much thicker than inner wall 93
93a Mature spores pale yellow to pale greenish yellow; Gigaspora calospora
soil-borne vesicles, if present, 23–33 μm diam, smooth to (Nicol. and Gerd.)
knooby, borne singly; germ tubes arising directly through Gerdemann and Trappe
the spore wall
(continued)
142 Appendices: Keys to Taxa Glomeromycota Species

(continued)
93b Mature spores bright Golden yellow, becoming dull yellow Gigaspora aurigloba Hall
with age and brown when moribund; soil-borne vesicles, if
present, up to 100 μm diam, echinulate to knooby to
polymorphic, borne in loose clusters; germ tubes arising
from compartments in spore wall
94a Pore usually with a distinct septum 95
94b Pore never with a distinct septum 98
95a Spore outer wall honey brown, thicker than hyaline inner Type 8 (Sward et al.)
wall
96a Spore outer wall 1–8 μm thick, extending up to 35 μm 120
along subtending hypha
96b Spore outer wall less than 1 μm thick, not extending along 97
subtending hypha
97a Spores 49–73 μm diam; diam of subtending hypha at Glomus fragilis (Berk.
widest part 6–13 μm and Br.) Trappe and
Gerdemann
97b Spores 105–310 μm diam; diam of subtending hypha at Glomus mosseae (Nicol.
widest part 20–50 μm and Gerd.) Gerdemann
and Trappe
98a Spore outer wall extending up to 100 μm along subtending Glomus invermaius Hall
hypha as a tightly sleeve; spores 50 75 wide
98b Spore outer wall not extending along subtending hypha; 99
spores greater than 93 μm in width
99a Subtending hypha simple, may be constricted 100
99b Subtending hypha funnel-shaped 102
100a Subtending hypha constricted at the point of attachment Glomus constrictus
and with fine hyphae attached Trappe
100b Subtending hypha not constricted at the point of 101
attachment and generally without attached fine hyphae
101a Spores bright yellow to bright brownish yellow, Glomus epigaeus Daniels
95–104 μm wide; diam of subtending hypha at the widest and Trappe
part usually less than 10 μm; subtending hypha often
inserted into the spore wall; pore at point of attachment of
subtending hypha occluded by a septum-like plug; spores
borne singly, in loose clusters, or in epigeous sporocarps
101b Spore yellowish brown to dark brown, 95–400 μm wide; Glomus macrocarpus var.
diam of subtending hypha at widest part usually greater macrocarpus Tul and Tul.
than 10 μm; subtending hypha not inserted; pore without a
plug but may be occluded by wall of subtending hypha;
spores borne singly, in loose clusters, or in generally
hypogeous sporocarps
102a Spore outer wall 9–20 μm thick, inner wall up to 4 μm Glomus magnicaulis Hall
thick; subtending hypha with a sing wall
102b Spore walls of approximately the same thickness (total WUM2
3–6 μm); subtending hypha with a distinctly double wall
103a Spores creamy white; walls a total of (25)–45–45 μm Type 7 (Sward et al.)
thick; outer wall rough; subtending hypha simple,
generally disappearing by maturity
(continued)
Appendices: Keys to Taxa Glomeromycota Species 143

(continued)
104a Spore sessile, borne laterally on a thin-walled hypha 105
ending in a thin-walled mother spore; parent hypha often
not seen; soil-borne vesicles never present
104b Spore not sessile; subtending hypha obvious, either simple, 108
funnel-shaped, or bulbous; soil-borne vesicles may be
present
105a Spore surface distinctly ornamented with regular pits, 106
spines or ridges
105b Spore surface generally not ornamented but may appear 107
minutely perforate at maturity
106a Spore surface evenly covered with pits 1–1.5 × 1–3 μm Acaulospora scrobiculata
separated by ridges 2–4 μm thick; spores subhyaline to Trappe
pale green to light brown
106b Spore surface covered by a distinct reticulum with small Acaulospora elegans
spines within the spaces of the reticulum; spores yellow to Trappe and Gerdemann
brown
107a Spores deep red to reddish-brown, 288–800 μm diam Acaulospora large red
species (Hall)
107b Spores pale yellow, pink, yellow brown, red brown or olive Acaulospora laevis
brown, 119–520 μm diam. Wall minutely perforate in older Gerdemann and Trappe
spores with the outer surface sloughing off
108a Spores hyaline to white at maturity, but portion of spore 109
wall surrounding the subtending hypha may have a
rose-pink tint
108b Spore coloured though may be hyaline when young 113
109a Subtending hypha simple or funnel-shaped, without lateral Glomus clarus Nicolson
projections; wall of subtending hypha from 7–39 μm thick and Schenck
extending up to 400 μm below the spore
109b Subtending hypha bulbous, sometimes with a single lateral 110
projection
110a Spore wall consisting of 2–10 layers each layer 1–4 μm 111
thick
110b Spore wall consisting of 3–5 layers of unequal thickness; 112
outer two layers brittle, readily separable from 1 to 3
flexible inner layers
111a Spore wall consisting of 4–10 layers, each layer 1.5–4 μm Gigaspora margarita
thick; spores always hyaline to white Becker and Hall
111b Spore wall consisting of 2–5 layers, each layer 1–2 μm Gigaspora rosea
thick; portion of spore wall surrounding subtending hypha Nicolson and Schenck
with a distinct to barely detectable rose-pink tint
112a Spores generally greater than 200 μm in length Gigaspora gilmorei
Trappe and Gerdemann
112b Spores generally less than 200 μm in length Gigaspora pellucida
Nicolson and Schenck
113a Subtending hypha bulbous, sometimes with a single lateral 114
projection; soil-borne vesicles may be present
113b Subtending hypha simple, without a lateral projection; soil 118
borne vesicles never present
(continued)
144 Appendices: Keys to Taxa Glomeromycota Species

(continued)
114a Spore surface ornamented with pores or irregular 115
projections
114b Spore surface not ornamented 116
115a Spore surface ornamented with large pores 7–10 μm diam Gigaspora nigra Redhead
with smaller pores within them
115b Spore surface ornamented with irregular projections Gigaspora gregaria
1–7 × 3–12 μm Schenck and Nicolson
116a Spore wall of three layers, outer up to 15 μm thick, inner Type 4 (Sward et al.)
up to 20 μm, middle up to 2 μm thick
116b Spore outer wall much thicker than inner walls, or wall of 117
approximately equal thickness
117a Spore outer wall 6–16 μm thick; 1–3 hyaline inner wall Gigaspora aurigloba Hall
each approximately 1 μm thick
117b Spore wall of two layers of approximately equal thickness, WUM6
outer brittle, inner flexible, each of two layers of
approximately equal thickness
118a Spore wall 5–16 μm thick, consisting of many layers each Glomus laminated spores
approximately 1 μm thick var. macrocarpus (Hall)
118b Spore wall 5–13 μm thick, in mature spores consisting of Glomus gerdemannii
three thin layers enclosed in the rough amorphous Rose, Daniels and Trappe
remnants of the degenerating outer wall
119a Spores reddish-brown; outer wall never present Red-brown laminate
(Mosse and Bowen)
119b Spores yellow to brown; ephemeral hyaline outer wall Glomus etunicatus
intact only on immature spores Becker and Gerdemann
120a Outer wall ephemeral, rarely intact on mature spores Glomus etunicatus
Becker and Gerdemann
120b Outer wall usually persistent Glomus caledonius
(Nicol. and Gerd.)
Gerdemann and Trappe

1.5 Appendix E: Key to Taxa Acaulospora Species Proposed

by Walker and Trappe in 1981

1a Spores less than 100 μm broad, hyaline to very pale yellow; wall Acaulospora
apparently single, roughened so minutely as to appear smooth trappei
1b Spores broader than 100 μm, hyaline to olive, brown, or dark reddish 2
brown; wall with two or more layers; surface shiny-smooth or distinctly
ornamented
2a Spores shiny-smooth, globose to ellipsoid or reniform, 119–300 × 119– Acaulospora
520 μm, olive to yellowish brown or reddish brown; wall with a rigid laevis
outer layer 2–4 μm thick and two thin inner layers
2b Spores distinctly ornamented 3
(continued)
Appendices: Keys to Taxa Glomeromycota Species 145

(continued)
3a Spores with spines or polygonal projections, with or without a reticulum 4
3b Spores with pits or cerebriforme folds, lacking a surface reticulum 6
4a Reticulum lacking; spores with crowded spines 0.5–2 μm tall, sometimes Acaulospora
overlaid with irregular, patchy hyaline encrustations spinosa
4b Reticulum present; spores surface between reticulum walls with crowded 5
spines or polygonal projections
5a Spore surface with crowded spines 2 × 0.5 μm, with a hyaline, alveolate Acaulospora
reticulum overlaid on the spines at maturity; reticulum wall 1—layered, elegans
1 μm thick; spores globose to ellipsoid, 140–285 × 145–330 μm, olive to
brown or reddish brown
5b Spore surface with polygonal projection 1 × 1 μm, enclosed by a grayish Acaulospora
green, alveolate reticulum with 3—layered walls 1.5–2 μm broad; spores bireticulata
globose, 150–155 μm in diam, light brown
6a Spore surface with cerebriforme folds up to 12 μm tall; spores globose, Acaulospora
200–250 μm in diam, brown; walls 2—layered, the inner layer reticulate gerdemannii
6b Spore surface pitted 7
7a Spores white to light olive brown, 100–240 × 100–220 μm, the surface Acaulospora
with pits 1–1.5 × 1–3 μm separated 2–4 μm scrobiculata
7b Spores dark reddish brown to nearly black, 200–260 × 220–260 μm, the Acaulospora
surface with pits 4–8 × 4–16 μm irregularly separated by 1–12 μm foveolata

1.6 Appendix F: Key to Taxa Gigaspora Species Proposed

by Koske and Walker in 1985

1a Outer wall with low warts and with blunt projections 4–10 μm long Gigaspora
dipapillosa
1b Outer wall with warts or patches, not with long, blunt projections 2
2a Warts widely scattered, patch-like, flattened, with angular to Gigaspora
subangular margins coralloidea
2b Warts crowded, mostly rounded or conical, occasionally irregular 3
3a Inner wall group hyaline to pale yellow, 0.5–3 μm thick, composed Gigaspora
of two apparently fused membranous walls when viewed in optical heterograma
sections; warts mostly 0.5–1 μm diam
3b Inner wall group of a single hyaline to pale yellow membranous wall 4
0.5–1 μm thick; warts as above or larger
4a Warts 2–10 μm diam (ca. 4 μm average), brown, very conspicuous; Gigaspora
spores dark brown or dark red-brown gregaria
4b Warts mostly less than 5 μm diam (average <2 μm); spores hyaline 5
to brownish-orange
5a Warts mostly 0.5–1.5 (–3) μm diam, readily observable at 400× Gigaspora
verrucosa
5b Warts almost all smaller than 1 μm diam, mostly about 0.5 μm, Gigaspora
indistinct at 400× persica
(continued)
146 Appendices: Keys to Taxa Glomeromycota Species

1.7 Appendix G: Key to Taxa Glomus Species Proposed

by McGee in 1986

1a Spores in sporocarp mostly 10–80 μm diam 2

1b Spores in sporocarp mostly 70–350 μm diam 5
2a Spores mostly with septum when mature 3
2b Spores without septum 4
3a Spores with one wall Glomus
arborense
3b Spores with more than one wall Glomus
cerebriforme
4a Forms ectomycorrhizae, spores 10–40 μm diam Glomus
tubiforme
4b Forms VA mycorrhizae, spores 20–60 μm diam Glomus
microcarpum
5a Mucilage over all structure 6
5b No mucilage 7
6a Forms epigeous sporocarps, spores in sporocarps mostly Glomus
200–300 μm warcuppi
6b Forms hypogeous sporocarps, spores in sporocarps mostly Glomus
80–150 μm clarum
7a Subtending hyphae 15–35 μm 8
7b Subtending hyphae 4–9 μm, spores yellow to orange Glomus
tenerum
8a Sporocarps firm, rounded, with peridium, spores with fine outer Glomus
wall, thicker inner wall caledonium
8b Sporocarps fragile, open, lacking peridium, spores with two walls of Glomus
similar thickness macrocarpum

1.8 Appendix H: Key to Taxa Order Glomerales Proposed

by Morton and Benny in 1990

1a Only arbuscules formed in mycorrhizal roots; Azygospores Gigasporineae (2)

produces on the apex of a sporogenous cell of a fertile hypha;
Auxiliary cells formed
1b Arbuscules and vesicles formed in mycorrhizal roots; Glomineae (3)
Chlamydospores produces terminally or laterally on or within
fertile hyphae; Auxiliary cells not produced
2 With a single family Gigasporaceae (4)
3a Chlamydospores formed apically from fertile hyphae Glomaceae (5)
(continued)
Appendices: Keys to Taxa Glomeromycota Species 147

(continued)
3b Chlamydospores formed from or within the “neck” of a Acaulosporaceae
sporiferous saccule (6)
4a Germ tubes produces directly through spore wall; Inner flexible Gigaspora
wall group absent; Auxiliary cells finely papillate or echinulate
4b Germ tubes from germination shield; Inner flexible wall group Scutellospora
always present; Auxiliary cells knobby, broadly papillate, or
smooth
5a Fruiting body of a sporocarp composed of spores will lateral walls Sclerocystis
adherent to one another; Connecting hyphae embedded in a
central hyphal plexus; Chlamydospores in a single layer except at
the base; Base composed of sterile hyphae
5b Fruiting structure a sporocarp not formed as in “D” above; Spores Glomus
also produced singly or in loose to tight aggregates in soil; Less
commonly in roots
6a Spores arise laterally from the neck of a sporiferous saccule Acaulospora
6b Spores formed in the neck of the sporiferous saccule Entrophospora

1.9 Appendix I: Key to Taxa Pacispora Species Proposed

by Oehl and Sieverding in 2004

1a Spores generally with smooth surface 2

1b Spores with ornamented surface 3
2a Spore generally hyaline to subhyaline Pacispora franciscana
2b Spores rusty brown in colour Pacispora robigina
3a Spores with tubes, warts or knobs on the outer spore 4
wall layer
3b Spores with pits on the second layer of the outer wall Pacispora boliviana
4a Tiny tuber longer than 5 μm, generally 4–5 times Pacispora chimonobambusae
longer than broad
4b Fine tuber (0.5–1.2 μm in diam) shorter than 5 μm, Pacispora dominikii
usually 1.2–3 times longer than broad, spores
generally <175 μm in diam
4c Knobs with length and width usually equal (1–3 μm), Pacispora scintillans
spores generally >175 μm in diam, outer wall
generally <5 μm thick
4d Warts with length and width usually equal (3–5 μm) Pacispora coralloidea
or broader than high; spores generally <165 μm in
diam; outer wall generally >5 μm thick
148 Appendices: Keys to Taxa Glomeromycota Species

1.10 Appendix J: Key to Taxa Acaulospora Species Proposed

by Oehl and Co-workers in 2006

1a Spores with spines or polygonal projections with or without a 2

reticulum
1b Spores with depressions (pits) or cerebriforme folds 6
2a Spore spines or projections with a reticulum 3
2b Spore spines or projections without a reticulum 4
3a Reticulum three-layered enclosing polygonal projections Acaulospora
1 × 1 μm; spores generally 150–200 μm bireticulata
3b Reticulum one-layered, overlaid over crowded, densely- Acaulospora
organized spines 2 μm high; spores 140–280 μm elegans
4a Spores with fine spines or tubercles 5
4b Spores with circular to oblong projections, 4–5 (–9) μm wide Acaulospora
and up to 3.2 μm high; each projection with a center cavity denticulata
5a Spores with fine crowded, densely organized spines, 1–4 μm tall, Acaulospora
1 μm at base and tapering to 0.5 at the tip spinosa
5b Spores with fine tubercles 0.7–3.5 μm long and 1.5 μm broad at Acaulospora
the base, tapering to 0.7–1.1 at the rounded tip, irregular tuberculata
distances (0.5–3 μm) between single tubercles
6a Spores with pits 7
6b Spores with cerebriforme folds Acaulospora
rehmii
7a Spores in sporocarps, spores 75–80 μm diam, ornamentation of Acaulospora
0.5–1 μm wide, 4–5 side pits, 1.2 × 0.5–1 μm across, ridges from taiwania
mesh
7b Spores formed singly in soil, not in sporocarps 8
8a Pits of irregular shape 9
8b Pits of regular round shape 10
9a Spores 100–240 μm diam, subhyaline to light olive, circular to Acaulospora
ellipsoid to y-shaped pits, 1.0–1.5 × 1.0–3 μm diam scrobiculata
9b Spores 100–180 μm diam reddish-yellow to yellow-brown, with Acaulospora
irregular, saucer-shaped pits, 0.2–3 × 0.2–6 μm diam lacunosa
10a Spores with regular round pits, spores regularly <100 μm diam 11
10b Spores with regular round pits, spores regularly >100 μm diam 12
11a Spores hyaline to subhyaline 13
11b Spores yellow to orange brown, truncated cone shape pits of Acaulospora
widest diameter of 1.5–2.2 μm alpina
12a Spores regularly 100–180 μm diam 14
12b Spores regularly >185 μm diam with concave round pits of Acaulospora
widest diameter 4–10 μm foveata
13a Spores hyaline to subhyaline, concave round pits of widest Acaulospora
diameter <3.5 μm paulinae
13b Spores hyaline to subhyaline, concave round pits of widest Acaulospora
diameter >3.5 μm undulata
14a Spores yellow brown, 115–170 μm diam with concave round pits Acaulospora
of widest diameter 2–5 μm cavernata
14b Spores ochre to brown, 100–180 (–200) μm diameter with Acaulospora
concave round pits of widest diameter 4–20 μm excavata
Appendices: Keys to Taxa Glomeromycota Species 149

1.11 Appendix K: Key to Taxa Order Diversisporales

Proposed by Oehl and Co-workers in 2008

1a Spores with one spore wall; generally with germ warts on inner Family 1:
surface of the wall in mature spores Gigasporaceae
(Gigaspora)
1b Spores with outer spore wall and one to three inner walls; 2
germination shield on innermost wall
2a Spores with a hyaline to subhyaline seldom light yellow 3
germination shield
2b Spores with a yellow brown to brown germination wall Family 4:
Dentiscutataceae
(3 genera) 4
3a Germ shield simples, generally bi-lobed, (but sometimes Family 2:
mono-lobed) thus (1–) 2 germ tube initiations (gtl); spores with Scutellosporaceae
three walls (Scutellospora)
3b Germ shield multiple-lobed, four or more compartments with Family 3:
each one gtl Racocetraceae (2
genera) 5
4a Germination shield simple, generally bi-lobed; spores with three Fuscutata
walls
4b Germination shield complex, >8 compartments, each with a gtl; 6
shield periphery generally dentate in planar view; spores with
three or more wall
5a Spores with two walls Racocetra
5b Spore with three walls Cetraspora
6a Spore with three walls Dentiscutata
6b Spores with >3 walls Quatunica
Gigaspora
1a Mean diameter of mature spores <250 μm; spores rarely 2
>300 μm
1b Mean diameter of mature spores >250 μm; spores generally 3
>300 μm
2a Spores white when young 4
2b Spores white to cream, usually with a rose-pink tint; 230– Gigaspora rosea
300 μm in diam; sporogenous hyphae darker than the spore wall
color
3a Spores pearly white when young, 200–490 μm in diam 5
3b Spores generally pigmented already when young; 290–810 μm Gigaspora
in diam; mature spores brilliant yellow-green, color associated gigantea
with spore contents; spore contents turning bright red in alkaline
solutions; laminae of spore wall not turning dark purple in
Melzer’s reagent; composite wall thickness generally <10 μm
4a Mature spores dull white with sporogenous hyphae similar in 6
color with spore wall
4b Spores (orange) white to white orange, 140–270 μm in diam Gigaspora
alboaurantiaca
(continued)
150 Appendices: Keys to Taxa Glomeromycota Species

(continued)
5a Spores with one sporogenous hyphae, 260–480 μm in diam Gigaspora
mature spores pearly white to an opaque, creamy yellow color; margarita
composite wall thickness generally <25 μm in diam
5b Spores with composite spore wall thickness generally >25 μm, 7
200–500 μm in diam; mature spores yellow to brown
6a Spores with composite spore wall thickness generally <8 μm, Gigaspora
200–300 μm in diam, average 250 μm, sporogenous cell dull candida
white 30–50 μm diam
6b Spore with composite spore wall thickness <12 μm, 143–350 μm Gigaspora albida
in diam, average 265 μm, sporogenous cell hyaline to yellow
24–50 μm in diam, average 265 μm, sporogenous cell hyaline to
yellow 24–50 μm diam
7a Spores with composite spore wall thickness generally >25 μm, Gigaspora
320–490 μm in diam; mature spores golden yellow to brown, decipiens
with one sporogenous cell
7b Spores as in 6a, subtending hypha forms one or more Gigaspora
sporogenous cells one on top of other appearing as beads, spores ramisporophora
formed on last cell; from any of the sporogenous cell another
subtending hypha can emerge and may or may not form another
sporogenous cell from which another spore forms
Scutellospora
1a Spores without ornamentation on outer wall 2
1b Spores with ornamentation on outer wall 3
2a Spores light colored; subhyaline, pink, creamy, straw to greenish 4
or brownish yellow
2b Spores yellow brown to black 5
3a Spores with one homogenous ornamentation on spore surface 6
3b Spores with two-type ornamentation on spore surface 7
4a Spores subhyaline to creamy to pale straw to greenish yellow 8
4b Spores dark yellow to golden yellow to brown yellow 9
5a Spores yellow brown to orange-brown, 160–360 μm in diam, Scutellospora
outer and innermost wall strongly staining in Melzer’s reagent arenicola
5b Spores dark brown to black, 300–460 μm in diam Scutellospora
tricalypta
6a Spores hyaline to pale yellow, 160–270 μm in diam; with knobs Scutellospora
3.5–6.5 μm high and 7.0–10.5 μm wide at base nodosa
6b Spores golden yellow to ochraeous to sienna, 100–180 μm; with Scutellospora
2.0–4.0 μm long protuberances formed by the structural, projecturata
laminated layer of the outer wall
7a Spores with two-type ornamentation on spore surface; spores Scutellospora
pale orange brown to dark orange brown, 130–180 μm in diam; dipapillosa
with small conical warts and additional blunt, bacilliform larger
projections on the spore surface
7b Spores with warted projections having central secondary Scutellospora
projections in the tip; spores cream to yellow, 100–170 μm in crenulata
diam
(continued)
Appendices: Keys to Taxa Glomeromycota Species 151

(continued)
8a Spores subhyaline to pale straw to pale greenish-yellow, (100–) Scutellospora
150–300 (–500) μm in diam, generally ellipsoid to oblong, with calospora
bi-layered middle wall
8b Spore yellow to greenish-yellow; 140–240 μm in diam, Scutellospora
generally globose to subglobose, with one layered middle wall dipurpurescens
9a Spores golden yellow to dull yellow, (130–) 200–420 (–520) μm Scutellospora
aurigloba
9b Spores dark yellow to brown yellow (to yellow brown), Scutellospora
105–150 μm, outer spore wall strongly expanding in lactic acid pernambucana
based mountants
Racocetra
1a Spores without ornamentation on outer wall 2
1b Spores with ornamentation on outer wall 3
2a Spores light colored 4
2b Spores creamy-brown to brown-sienna, 170–370 μm in diam Racocetra
castanea
3a Surface ornamentation with spines or warts generally <2.5 μm in 5
diam
3b Surface ornamentation with projections generally >2.5 μm in 6
diam
4a Spores hyaline to pale straw to pale yellowish-cream, 160– Racocetra fulgida
250 μm in diam
4b Spores pale to dark pink, 120–170 × 130–420 μm in diam; outer Racocetra
wall staining yellow to yellow orange in Melzer’s reagent alborosea
5a Spore surface with fine spines; spores pinkish-orange to Racocetra persica
brownish orange, 270–390 μm in diam
5b Spore surface with crowded rounded warts, spores pale straw to Racocetra
yellow to light orange brown, 220–480 μm in diam verrucosa
6a Spores red brown to dark brown with rounded projection on 7
surface
6b Spores dark brown, 300–460 μm in diam, with coralloidic warts Racocetra
coralloidea
7a Spores red brown to dark brown, 250–450 μm in diam; with Racocetra
rounded dome-shaped warts gregaria
7b Spores brown to dark brown; 90–180 μm in diam; warts on top Racocetra minuta
with central depressions
Cetraspora
1a Spores without ornamentation on outer wall 2
1b Spores with ornamentation on outer wall 3
2a Spores hyaline to white 4
2b Spores apricot yellow to yellow brown, 140–240 μm in diam Scutellospora
armeniaca
3a Spores with a fine dense spiny ornamentation on outer spore Cetraspora
wall; spores ochraeous to fulvous or rust, 130–230 μm in diam spinosissima
3b Spores ornamented with finger-pink-like processes in planar Cetraspora
view; spores ochraeous yellow with a pinkish tint, 110–190 in striata
diam
(continued)
152 Appendices: Keys to Taxa Glomeromycota Species

(continued)
4a Spores brilliant hyaline, white to rarely pale grey, generally Cetraspora
globose to subglobose; germination shield generally not seen pellucida
4b Spores hyaline, becoming creamy under storage in formalin; Cetraspora
globose to subglobose to ellipsoid; 200–320 μm in diam; gilmorei
sporogenous cell brown; germination shield generally easy to
observe
Dentiscutata
1a Spores without ornamentation on outer wall 2
1b Spores with ornamentation on outer wall 3
2a Spores hyaline, white to light olive, 350–750 μm in diam Dentiscutata
scutata
2b Spores pale orange brown to red brown, 200–300 μm in diam; Dentiscutata
outer wall not staining in Melzer’s reagent; second middle wall hawaiiensis
layer fracturing with a series of rectangular and V-shaped
notches
3a Spores with a single ornamentation on outer spore wall 4
3b Spores with double ornamentation on outer spore wall 5
4a Spores hyaline to white, globose to ovoid, 170–370 μm in diam; Dentiscutata
with spiny papillae ornamentation cerradensis
4b Spore with papillae surface ornamentation on outer wall; Spores Dentiscutata
light brown, globose to ellipsoid, 150–260 μm in diam heterograma
5a Spores with double ornamentation on the outer spore surface 6
5b Spores with each one papillae ornamentation both on outer and Dentiscutata
inner surface of the outer wall; yellow-brown to brown, biornata
120–260 × 450–500 μm in diam
6a Spores orange brown to dark red brown, 200–470 μm in diam; Dentiscutata
having spines in the depressions of a reticulum reticulata
6b Spores dark brown to black, 290–500 (–1050); with rounded pits Dentiscutata
and a sinuous secondary ornamentation below nigra
Fuscutata
1a Spore without surface ornamentation on outer wall 2
1b Spore with surface ornamentation on outer wall 3
2a Spores hyaline to white; oblong-ellipsoid to long ellipsoid, Fuscutata
280–580 × 210–370 μm in diam savannicola
2b Spores dark orange brown to dark red brown, 140–220 μm in Fuscutata rubra
diam, outer and innermost wall strongly staining in Melzer’s
reagent
3a Spores hyaline to subhyaline, globose to oval, μm in diam; Fuscutata
spores with fine spiny ornamentation on the surface of the outer trirubiginopa
wall
3b Spore with papillae ornamentation on the surface of the outer Fuscutata
wall; spores red brown to dark brown, globose to oval, heterograma
159–295 μm in diam
Quatunica
1a Spores white-yellow, to yellow-brown, 340–640 μm in diam Quatunica scutata
1b Spores orange-brown to dark red brown, 200–650 μm in diam Quatunica
erythropus
About the Author

This handbook was written while Tancredo Souza was an exchange student at
the Department of Life Sciences, University of Coimbra, Portugal. His research
focus on the effects of biological invasions on the arbuscular mycorrhizal diversity
from the Brazilian xeric shrubland. His interests are in the Plant-AMF interactions,
ecology of mycorrhizal fungi, microbiology and symbiosis process. He holds degree
in Agronomy (B.Sc.), Soil and water management and conservation (M.S.) and Soil
sciences (Ph.D.) from the Federal University of Paraíba, Brazil and University of
Coimbra, Portugal.

© Springer International Publishing Switzerland 2015 153

T. Souza, Handbook of Arbuscular Mycorrhizal Fungi,
DOI 10.1007/978-3-319-24850-9