Name __________KEY________________

S.I.D. __________________________
 
MCB 104 MIDTERM #2  March 14, 2013 
 
***IMPORTANT REMINDERS*** 
Print your name and ID# on every page of the exam. 
You will lose 0.5 point/page if you forget to do this. 
 
If you need more space than is available on a page, continue your answer on the back 
of the same page.  The pages will be separated for grading, so no points will be given 
for answers continued on the back of a different page. 
 
This is a closed book, closed note exam. No calculators, phones or any electronic 
device is allowed.  
 
Look through the entire exam before starting.  You should have 9 numbered pages, 
including this cover page. You do not have to start with Question 1.  Read each 
question entirely before beginning. Write legibly. Show all of your work for 
formulas/math questions.  
 
 
(Do not write below this line) 
PAGE 2          ______/15 total 
PAGE 3          ______/13 total 
PAGE 4          ______/14 total 
PAGE 5          ______/11 total 
PAGE 6          ______ /12 total 
PAGE 7          ______ /10 total 
PAGE 8          ______ /12 total 
PAGE 9          ______ /13 total 
     
 
 
 
Total Score _________/100 
   

1   
 Name __________KEY________________

S.I.D. __________________________
 
1. (1 point) What does SNP stand for?  underlined terms are required for points 
 
single nucleotide polymorphism 
 
2. (4 points)  In no more than one sentence, and without drawing any pictures, explain in 
words the difference between a contig and scaffold.   
(2 points for accurate contig definition, 2 points for scaffold definition that explains 
difference) 
A contig is sequence assembled from contiguous or overlapping DNA sequence, while a 
scaffold is sequence assembled from contigs connected with paired‐end reads. 
 
 
 
3. (4 points)  Define what GWAS stands for and outline three key steps explained in lecture 
on how one is carried out:  (1 pt for correct definition, 1 pt. for each step) 
 
Genome wide association study 
1. collect DNA from large number of cases and controls (or phenotyped or diseased/not 
diseased) individuals 
2. genotype genome‐wide SNPs 
3. test for associations between genotype at each SNP and disease/trait/phenotype 
 
 
 
 
4. (4 points) You want to sequence the genome of an organism that turns out to have a 
common class of repetitive elements that is 10 kb long.  In one sentence, how could you 
sequence and assemble a genome so you could connect unique sequence flanking repetitive 
sequence?  
 
Make genomic DNA libraries with inserts larger than 10 kb (2 pts), sequencing paired ends 
from this library, then looking for paired end reads that allow jumping over the repetitive 
element to unique sequence flanking it (2 pts).  
 
 
 
5. (2 points) In one sentence, why are the size of regions of linkage disequilibrium much 
larger in a two generation QTL mapping cross than GWAS?  
 
In a two generation mapping cross, only two rounds of recombination has shuffled genetic 
variation, while many more generations and rounds of recombination have shuffled variation 
in a GWAS.  
 
 

2   
 Name __________KEY________________

S.I.D. __________________________
 
6. a. (4 points) Cystic fibrosis is an autosomal recessive disease caused by loss‐of‐function 
mutations in the gene CFTR.  In Algerians, the allele frequency of the Phe508 deletion 
mutant allele of CFTR is approximately 20%.  Assuming Hardy‐Weinberg equilibrium, 
calculate the percentage of Algerians that are carriers (heterozygotes) for the disease allele, 
and the percentage of affected newborns. You must show all of your work for full credit. 
 
1 pt. each for q, p, 2pq, and q2 
Allele frequency = q = 0.2 
p = 1‐ q = 0.8 
2pq = 2 (0.8)(0.2) =  0.32 or 32% heterozygous carriers  
q2 = 0.2 x 0.2 = 0.04 or 4% of newborns are homozygous affecteds 
 
 
 
b. (3 points) One percent of the global human population is homozygous for a deletion 
allele of CCR5 (CCR5del32) that has been clearly associated with resistance to HIV.  
Calculate the allele frequencies of the wild‐type and deletion alleles, and the frequency of 
heterozygous carriers assuming Hardy‐Weinberg equilibrium.  
 
1 pt each for q2 p, and 2pq  
q2 = .01,  q = 0.1 or 10% for CCR5del32 
p = 1‐q = 0.9 or 90% for wild‐type allele 
2pq = 2 * 0.9*0.1 = 0.18 = 18% frequency of heterozygotes 
 
 
7. (4 points) What are paired end reads, genomic libraries, cDNA, and ESTs?  Define each in 
no more than one sentence each.  Your definition of cDNA should explain how cDNA is 
made. 
 
(1 pt/definition) 
Paired end reads are sequencing reads of both ends of a DNA molecule. Genomic libraries are 
collections of genomic DNA fragments, cloned into vectors. cDNA is complementary DNA 
made from mRNA by reverse transcriptase.  ESTs are expressed sequence tags (0.5 pt), or 
paired end reads from a cDNA library (0.5 pt).  
 
 
8. (2 points) In no more than two or three words, why are haplotypes on average smaller 
in older populations?  
 only 1 point if use more than 3 words 
More historical recombination (or more meioses, more recombination, more historical 
meioses) 

3   
 Name __________KEY________________

S.I.D. __________________________
 
9.  (8 points) Kernel color in wheat is a simple quantitative trait, controlled by two unlinked 
loci, each with two alleles that make purple pigment.  Plants homozygous for purple alleles 
at both loci (AABB) have purple kernels.  Plants homozygous for white alleles at both loci 
(aabb) have white kernels.  The total number of A and B alleles determines kernel color in a 
simple additive way: one allele of either A or B makes kernels light red, two alleles of either 
A or B makes kernels red, and three alleles of A or B makes kernels dark red.  You cross 
AABB purple plants to aabb white plants and get all red AaBb F1 hybrids.  You then 
intercross these AaBb F1 hybrids.   
 
What are the expected ratios of F2 genotypes and phenotypes, using the Aa Bb convention 
above?  
(4 points for correct genotype ratios, 4 points for correct phenotype ratios) 
 
AaBb x AaBb 
F2 phenotype and genotype ratios: 
1/16 purple,  AABB 
4/16 dark red,  (1/8 or 2/16 AaBB + 1/8 or 2/16 AABb) 
6/16 red, (1/16 AAbb, 1/ 4 or 4/16 AaBb, 1/16 aaBB) 
4/16 light red (1/8 or 2/16 Aabb + 1/8 or 2/16 aaBb) 
1/16 white,  aabb 
 
 
10. a. (3 points) Two SNPs are in absolute linkage disequilibrium. SNP1 has allele 
frequencies of 40% G and 60% C, and SNP2 has allele frequencies of 40% A and 60% C.  
Calculate the observed frequencies of haplotypes in this population.  
 
1.5 pts/each haplotype frequency 
40% GA 
60% CC , SNPS are in complete linkage disequilibrium, so GC and CA are never observed. 
 
b. (3 points) If SNP1 has allele frequencies of 40% G and 60% C and SNP2 has allele 
frequencies of 40% A and 60% C, calculate the observed frequencies of haplotypes in the 
absence of linkage disequilibrium.  
 
0.5 pts/each haplotype frequency, 1 pt. for showing work 
If allele frequencies are 0.4 G and 0.6 C at SNP1 and 0.4 A and 0.6 C at SNP2, haplotype 
frequencies in the absence of linkage disequilibrium would be:  
0.4*0.4 = 0.16 GA 
0.4*0.6 = 0.24 GC 
0.6*0.4 = 0.24 CA 
0.6*0.6 = 0.36 CC 
 
 

4   
 Name __________KEY________________

S.I.D. __________________________
 
11.  (4 points)  Shown below are a matrix of human SNP genotypes.  Each row is a haploid 
human chromosome, and each column is a specific SNP position, aligned in physical order.  
 
G  A  T  C  G  G  C  A  A  C  G  A 
A  T  C  A  C  A  T  G  T  T  T  C 
G  A  T  C  G  G  C  A  A  T  T  C 
A  T  C  A  C  A  T  G  T  C  G  A 
G  A  T  C  G  G  C  A  A  T  T  C 
G  A  T  C  G  G  C  A  A  T  T  C 
G  A  T  C  G  G  C  A  A  C  G  A 
G  A  T  C  G  G  C  A  A   C  G  A 
A  T  C  A  C  A  T  G  T  T  T  C 
A  T  C  A  C  A  T  G  T  C  G  A 
 
Do the observed genotypes suggest a recombination hotspot? Answer yes or no, and 
explain your answer in one sentence.  If you answered yes, indicate with a line where the 
hotspot it.  
 
Yes (1 pt). Hotspot is vertical line between 4th from right and 3rd from right columns (1 pt).  
Here linkage disequilibrium breaks down and is not present, as all 4 haploid genotypes (AC, 
TT, AT, TC) are observed at the expected frequency (2 pts).  
 
 
 
12. (4 points) In dogs, regions of linkage disequilibrium are about 100 times larger than 
they are in humans.  For the next two questions, consider only the relative size of linkage 
disequilibrium in dogs and humans. Compared to a human GWAS, would a dog GWAS on 
average be more or less likely to identify a linked SNP?  Once a linked SNP was found, 
compared to a human GWAS, would a dog GWAS offer better or worse resolution?  Answer 
both questions in no more than one sentence each.  
 
Given the larger blocks of LD, a linked SNP would be more likely to be found in dogs than 
humans (2 pts). However, once a linked SNP was found, the resolution would be better in 
humans than dogs (again, given the larger blocks of LD) (2 pts).  
 
 
13. (3 points) You pay to have your own genome genotyped for 300,000 tagSNPs, and are 
sent a long list of disease risks based on a subset of your specific SNP genotypes and many 
published human GWAS studies.   Are any of these SNPs causative for diseases you might 
have or get?  Answer yes, no, maybe, and explain why in no more than two sentences.   
 
Maybe (1 pt).  The SNPs are simply tagging blocks of genetic variation, so could just be linked 
to the causative mutation (1 pt).  However, the SNP could itself be causative (1 pt). 

5   
 Name __________KEY________________

S.I.D. __________________________
 
14.   In a recent GWAS of heart disease, the SNP rs1333040 was genotyped in disease cases 
and controls.  The results are shown in the following table: 
 
  genotype  Disease  Controls 
  TT  350  250 
  TC  300  500 
  CC        110  270 
A. (4 points)  For both disease and controls, calculate the total number of T and C alleles, 
showing your work:    For each cell, 0.5 pt for correctly setting up equation, 0.5 pt for 
correct number 
 
Allele  Heart disease  Controls 

T  350*2 +300 =700+300 =  250*2 + 500 = 500+500 
1000  = 1000 

C  110*2 + 300 = 220+300=520  270*2 + 500 = 540+500 
=1040 

 
   
B.  (6 points) Set up the equation to calculate the allelic odds ratio (for T against C) for 
heart disease risk?  Show all of your work in setting up all equations for full credit.   
    
odds of getting disease with T = 1000/1000 = 1  (2 pts) 
odds of getting disease with C = 520/1040 = 0.5  (2 pts) 
odds ratio for T against C = (1000/1000)/(520/1040)  = 1/0.5  = 2  (full credit if all equations 
set up correctly)  (2 pts) 
 
 
 
 
 
C. (2 points) One of the 317,503 SNPs genotyped in this study gave a p‐value of 0.03 for 
association with heart disease. Is this association significant? Answer yes or no, and justify 
your answer in one sentence.  
 
No. Multiple hypotheses are being tested, so Bonferroni correction is needed and p‐value for 
significance would be 0.05/317,503. Need to either say Bonferroni correction is needed or set 
up the fraction for significance for full credit.  
 
 

6   
 Name __________KEY________________

S.I.D. __________________________
 
15. In trying to determine the genetic basis of a human disease, you genotype a human 
pedigree shown below, where an autosomal dominant phenotype present in one parent is 
transmitted to four of eight offspring.  Your molecular genotyping assay is a microsatellite 
known to be tightly linked to the disease locus. You amplify the microsatellite with PCR and 
size‐separate by electrophoresis.  Molecular genotypes are shown beneath the pedigree. In 
the following questions, the lanes on the far left and far right of the pedigrees are DNA size 
fragments of (from top to bottom): 200 bp, 150 bp, and 100 bp.  
 
A. (2 points) In this pedigree, circle the disease‐
linked allele beneath the affected parent.  200 
bp band beneath top black square. Mom’s 200 bp 
allele is the same size in bp, but is not linked to 
disease causing allele. 
 
B. (2 points) What are the odds that a child of 
the last unaffected male (last white square to 
the right) and a homozygous wild‐type mother will be affected?  Zero.  This male has mom’s 
200 bp allele that is not linked to disease allele (since he got 100 bp paternal allele, you know 
200 bp allele in this male must be from mom). 
 
In a different human pedigree, a simple Mendelian autosomal recessive disease is 
segregating and you have genotyped a tightly linked microsatellite.  Again molecular 
genotypes are shown beneath the pedigree. 
C.  (2 points) In this pedigree, circle all of the 
alleles linked to the disease allele in both 
parents and offspring. Must have circled all  
eight lower 100 bp bands for full credit.  
 
 D. (4 points) In a third pedigree, you genotype 
a molecular marker that is a SNP that alters a 
restriction enzyme recognition site.  This 
marker consists of a pair of PCR primers that amplify a 150 base pair band. Within this 150 
bp region, the wild‐type allele does not have the cut site but the mutant allele does, and 
when cut results in a 100 and 50 bp.  If this marker is tightly linked to the disease to the 
dominant disease in the pedigree below, fill in the box below for what these molecular 
markers would look like on a gel.  In this case the DNA size makers to the far left and far 
right are 150, 100, and 50 base pairs.    1 pt/parent, 1 pt@ for affected and unaffected kids                  
   

7   
 Name __________KEY________________

S.I.D. __________________________
 
 
16. (4 points) In what linear order would these five sequences assemble into a contig? 
 
1: TGTGACGTAGCAATCTTGGTTGCTGGAA 
2: TTCCCGGTTTCCCCCCTCGTTGGTAAGG 
3: GTTTTTATAGTTTATGTGACGTAGCAA 
4: CTTGGTTGCTGGAATGGCTGTATCATAGC 
5: CTCGTTGGTAAGGCGTTTTTATAGTTTA 
 
Answer just with the linear order of sequence reads from 5’ to 3’.  
 
2‐5‐3‐1‐4  (partial credit if part of sequence is correct, 0 pts for 1 bp overlaps) 
 
17. You want to test a non‐coding genomic sequence containing tagSNPs linked to a human 
disease for enhancer activity.  You make a reporter gene with this non‐coding human 
sequence, a minimal promoter, and the lacZ reporter gene, then inject this construct into 
many one‐celled mouse embryos.  You raise these embryos until embryonic day 11, then 
stain embryos for lacZ expression.  In total, you observe ten embryos with blue domains 
indicating lacZ expression.  In all ten embryos, the embryonic heart is blue.  In two of these 
embryos, there is also lacZ expression in other domains, one embryo also has a blue lacZ 
expression domain in the brain, and another embryo also has a blue lacZ expression 
domain in the limb. 
 
A.(3 points) In one sentence, what can you conclude about the non‐coding sequence of 
interest?  
 
It is a heart enhancer.  
 
B.(3 points) In one sentence, how can you explain the single embryos with additional brain 
or limb expression domains?  
 
These ectopic expression domains are likely due to other enhancers (1.5 pts) nearby the 
integration site of the transgene (1.5 pts).   
 
 
 
18.  (2 points) In one sentence, why do some stretches of SNPs covary?   
 
Because they have not been separated by historical meiotic recombination. Partial credit for 
“linkage disequilibrium”, but must mention no recombination between them for full credit). 
 
 
 
 

8   
 Name __________KEY________________

S.I.D. __________________________
 
19. (3 points) If you used Sanger sequencing to sequence with two vector primers the 
paired end reads of one 10 kb clone from a genomic library, would you get the entire 10 kb 
of sequence or would you have a gap in the sequence of the clone?  Answer this question 
and explain your answer in no more than one sentence.  
 
You would have a gap in the sequence (1 pt), because you only get about 1 kb of sequence 
with Sanger sequencing (1 pt), so by sequencing 1 kb from either end, there’d be a gap of 
about 8kb between these sequences (1 pt).   
 
 
20. a. (3 points) Some human genes have ESTs in all human cDNA libraries, while other 
genes have ESTs present only in certain tissues.  Explain this observation in no more than 
one sentence.  
 
Some genes are only expressed in certain tissues (1 pt), due to tissue‐specific enhancers (1 pt), 
while other genes are ubiquitously expressed (i.e. transcribed in all cells) (1 pt).    
 
b.  (3 points) Many human genes have 3’ ESTs that align to different genomic regions.  Many 
human genes also show variation in the number of cDNA segments that align to the 
genome.  Explain these two observations in one sentence each.  
 
Many genes have multiple polyadenylation (transcription stop) sites, so 3’ ESTs can align to 
different genomic regions (1.5 pts).  Many genes are differently spliced, so cDNAs of those 
genes can vary in which exons are included in the mRNA (1.5 pts).  
 
 
21.  (4 points) Recent transcriptome sequencing studies have surprisingly revealed a class 
of circular RNA molecules, that are transcribed as linear mRNAs and then the 5’ and 3’ ends 
of the mRNA are ligated to make a circular mRNA. The evidence for these circular mRNAs 
comes in part from two observations made from cDNA sequencing, and how cDNA 
sequences align to the genomic DNA sequence.  What two observations in cDNA sequences 
are predicted if mRNA molecules are circularized after being transcribed?  (Hint: the first 
observation is made from a subset of single end transcriptome reads, and the second 
observation is made from comparing the pattern and orientation of paired end read 
alignments to the human genome.) 
 
Some single end transcriptome reads align to two distinct genomic locations, with the 
circularization junction spanned by the read (i.e. sequencing reads that span the 5’‐3’ ligation 
junction would have two parts that align to distinct regions of the genome – one 5’ and one 3’) 
(2 pts).  The second prediction is that some paired end reads would map with their 5’ and 3’ 
reads pointing away from each other (i.e. sequence of paired end reads starts at two positions, 
and heads outwards from both points, instead of inwards towards each other, like most 5’ and 
3’ EST sequences coming from linear transcripts) (2 pts).   
 

9