Você está na página 1de 21
Ciências Biológicas  Física  Química Instruções para a realização da prova • Neste caderno,
Ciências Biológicas  Física  Química Instruções para a realização da prova • Neste caderno,
Ciências Biológicas  Física  Química Instruções para a realização da prova • Neste caderno,
Ciências Biológicas  Física  Química Instruções para a realização da prova • Neste caderno,

Ciências Biológicas Física Química

Ciências Biológicas  Física  Química Instruções para a realização da prova • Neste caderno, deverão

Instruções para a realização da prova

Neste caderno, deverão ser respondidas as questões das provas de Ciências Biológicas (questões de 1 a 6), de Física (questões de 7 a 12) e de Química (questões de 13 a 18).

A prova deve ser feita a caneta esferográfica preta. Utilize apenas o espaço reservado (pautado) para a resolução das questões.

Atenção: nas questões que exigem cálculo, não basta escrever apenas o resultado final. É necessário mostrar a resolução ou o raciocínio utilizado para responder às questões.

A duração total da prova é de quatro horas.

ATENÇÃO Os rascunhos não serão considerados na correção.

Os rascunhos não serão considerados na correção. UNICAMP VESTIBULAR 2018 – 2ª FASE CIÊNCIAS BIOLÓGICAS
Os rascunhos não serão considerados na correção. UNICAMP VESTIBULAR 2018 – 2ª FASE CIÊNCIAS BIOLÓGICAS

UNICAMP VESTIBULAR 2018 – 2ª FASE CIÊNCIAS BIOLÓGICASFÍSICA QUÍMICA

ORDEM

INSCRIÇÃO

ESCOLA

SALA

LUGAR NA

SALA

NOME

ASSINATURA DO CANDIDATO

L U G A R N A SALA NOME ASSINATURA DO CANDIDATO DECLARAÇÃO DE PRESENÇA Declaramos

DECLARAÇÃO DE PRESENÇA

NOME ASSINATURA DO CANDIDATO DECLARAÇÃO DE PRESENÇA Declaramos para os devidos fins que o candidato abaixo,

Declaramos para os devidos fins que o candidato abaixo, inscrito no Vestibular Unicamp 2018, compareceu às provas de Ciências Biológicas, Física e Química, realizadas no dia 16 de janeiro de 2018.

Nome:

Documento:

realizadas no dia 16 de janeiro de 2018. Nome: Documento: Coordenação de Logística Comissão Permanente para

Coordenação de Logística Comissão Permanente para os Vestibulares da Unicamp

As fórmulas necessárias para a resolução de algumas questões são fornecidas no próprio enunciado – leia com atenção. Quando necessário, use:

g = 10 m/s 2 π = 3

são fornecidas no próprio enunciado – leia com atenção. Quando necessário, use: g = 10 m/s
1. Dados genéticos podem ser utilizados para estudar populações de uma espécie no ambiente natural.

1. Dados genéticos podem ser utilizados para estudar populações de uma espécie no ambiente natural. Por exemplo, amostras de DNA podem ser coletadas para identificar espécies, estimar tamanhos populacionais ou identificar indivíduos. Um pesquisador coletou duas amostras de fezes em uma localidade na Índia e sequenciou parte do gene Gapdh dos DNAs extraídos a partir delas. Como resultado, foram obtidas as sequências abaixo (apenas uma das fitas do DNA é mostrada).

Amostra 1

5' ACAGGATCCAATAACCCCGCAGGAATGGTG 3'

Amostra 2

5' ACAGGATCCAATAACCCCTCACGAATGGTG 3'

As sequências da mesma região do gene Gapdh nos genomas do tigre de Bengala (Panthera tigris) e do leopardo (Panthera pardus) são:

Panthera tigris Panthera pardus

5' ACAGGATCCAATAACCCCGCAGGAATGGTG 3' 5' ACAGGATCTAACAACCCCGCAGGAATAGTA 3'

a) De posse desses dados, responda: as amostras de fezes 1 e 2 pertencem, com maior probabilidade, a tigres de Bengala ou a leopardos? As amostras 1 e 2 pertencem ao mesmo indivíduo ou a dois indivíduos diferentes? Justifique sua resposta.

b) Um crítico argumentou que o trabalho do pesquisador não era válido, pois as sequências do gene nuclear Gapdh foram obtidas a partir de amostras de fezes. Segundo o crítico, material genético nuclear de felinos só poderia ser extraído com qualidade a partir de hemácias (eritrócitos) coletadas dos animais. Quem tem razão, o pesquisador ou o crítico? Justifique.

(Fonte: J. Bhagavatula e L. Singh. BMC Genetics, Londres, v. 7, p. 48, out. 2006.)

Resolução (será considerado apenas o que estiver dentro deste espaço).
Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO

2. A figura A abaixo mostra o claro dimorfismo sexual que ocorre na espécie de

2. A figura A abaixo mostra o claro dimorfismo sexual que ocorre na espécie de besouro neotropical Dynastes hercules (besouro-hércules), um dos maiores besouros do mundo. Nos machos, protuberâncias cefálicas e torácicas formam estruturas semelhantes aos chifres de alguns mamíferos. Um estudo mostrou que, nessa espécie, há três tipos de machos geneticamente distintos, P, M e G, que diferem apenas quanto ao tamanho médio dos "chifres" (figura B). Os dados na figura C indicam a capacidade de machos dos três tipos de copular com fêmeas. Testes genéticos mostraram ainda que 85% dos filhotes em cada geração têm machos do tipo G como pais.

A

B

9 8 7 6 5 4 P M G
9
8
7
6
5
4
P
M
G
(Fonte: Udo Schmidt. Disponível em tamanho médio do "chifre" (cm)
(Fonte: Udo Schmidt. Disponível em
tamanho médio do "chifre"
(cm)

https://www.flickr.com/photos/307032

60@N08. Acessado em 29/10/2017.)

C

Tipo de

Capacidade

macho

de cópula

P

M

G

Capacidade de cópula de

cada tipo de macho (% de encontros com uma fêmea

que resultam em cópula)

a) Os "chifres" são parte do esqueleto do besouro-hércules macho. Cite duas características do esqueleto de artrópodes e duas diferenças em relação ao esqueleto de vertebrados.

b) Darwin acreditava que diferenças entre animais machos e fêmeas como as mostradas na figura A surgem durante a evolução como consequência da seleção sexual, um tipo especial de seleção natural. Defina seleção natural. Utilizando os dados fornecidos acima, explique por que a característica masculina dimórfica do besouro-hércules é uma adaptação, fruto da seleção natural.

Resolução (será considerado apenas o que estiver dentro deste espaço).
Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO

3. As questões a seguir tratam de alimentação e saúde humana. a) Um dos maiores

3. As questões a seguir tratam de alimentação e saúde humana.

a) Um dos maiores problemas de saúde pública no mundo é a obesidade. Considerando separadamente as populações masculina e feminina, em qual faixa etária houve maior crescimento proporcional de obesos entre 1975 e 2009, de acordo com os gráficos abaixo? Sabendo que os carboidratos constituem aproximadamente 50% da dieta diária recomendada pelo Ministério da Saúde, explique a necessidade desse nutriente e por que ele pode causar obesidade.

desse nutriente e por que ele pode causar obesidade. b) O consumo diário de frutas, hortaliças

b) O consumo diário de frutas, hortaliças e legumes é considerado altamente benéfico para a saúde humana. Um estudo realizado no Hospital do Câncer de Barretos (SP) indicou que as hortaliças da família das crucíferas (brócolis, couve-flor, couve, agrião, rúcula, entre outras), após passarem por processamento enzimático no organismo, liberam sulforafano e indol-3-carbinol, substâncias capazes de inibir a proliferação celular. O que é o câncer? Por que as hortaliças da família das crucíferas são consideradas importantes na prevenção dessa doença?

(Fonte: Pesquisa de orçamentos familiares, Instituto Brasileiro de Geografia e Estatística - IBGE. Disponível em www.ibge.gov.br/estatisticas-novoportal. Acessado em 15/10/2017.)

Resolução (será considerado apenas o que estiver dentro deste espaço).
Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO

T3

4. Plantas têm papel crucial na ciclagem de carbono e de água no ambiente, captando

4. Plantas têm papel crucial na ciclagem de carbono e de água no ambiente, captando e liberando o gás carbônico atmosférico e transferindo água do solo para o ar. Os gráficos abaixo representam padrões anuais de variação nas concentrações de vapor d’água do ar e de gás carbônico em regiões ocupadas por duas florestas tropicais distintas, A e B.

Floresta A 90 Floresta B 70 50 30 Umidade relativa do ar (%)
Floresta A
90
Floresta B
70
50
30
Umidade relativa do ar (%)

J

F

M

A

M

J

J

Meses

A

S

O

N

D

420 380 340 300 CO 2 (ppm)
420
380
340
300
CO 2 (ppm)

J

F

M

A

M

J

J

A

Meses

S

O

N

D

As variações mostradas ocorrem como consequência da presença das florestas. A precipitação nas duas áreas ocorre no período quente do ano (setembro a abril). Além disso, a concentração de CO 2 atmosférico seria de 380 ppm se não houvesse cobertura vegetal.

a) Considerando que a transpiração tem relação direta com o consumo hídrico, qual das duas florestas tem maior dependência de disponibilidade de água? Considerando que a fotossíntese e a respiração determinam o padrão anual de variação de CO 2 , qual das duas florestas tem maior produção anual de biomassa? Justifique suas respostas.

b) Em um cenário de redução no regime de chuvas, o que aconteceria com as concentrações de vapor d’água do ar e de CO 2 nas regiões ocupadas pelas florestas? Justifique sua resposta.

Resolução (será considerado apenas o que estiver dentro deste espaço).
Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO

5. A estrutura química do composto puromicina é muito semelhante à estrutura de um RNA

5. A estrutura química do composto puromicina é muito semelhante à estrutura de um RNA transportador. Em virtude dessa semelhança, os ribossomos de procariotos são capazes de interagir com a puromicina como se ela fosse um RNA transportador. O ribossomo catalisa a formação de uma ligação covalente entre a cadeia proteica em crescimento e a puromicina, se este composto estiver presente durante a tradução. Após tal evento bioquímico, novos aminoácidos não podem ser incorporados à cadeia da proteína.

a) Por que a puromicina tem ação antibiótica sobre bactérias? Na presença de puromicina, a massa molecular média de uma dada proteína bacteriana será maior, igual ou menor em relação à massa média da mesma proteína na ausência do antibiótico? Explique seu raciocínio.

b) A puromicina também é utilizada para transgenia. Neste caso, um gene que codifica uma enzima capaz de destruir a puromicina é adicionado, juntamente com o gene de interesse do pesquisador, ao genoma de células cultivadas in vitro. Na presença de puromicina, a taxa de sobrevivência de células que receberam esses genes será igual, maior ou menor em relação à sobrevivência de células não modificadas? Explique seu raciocínio.

Resolução (será considerado apenas o que estiver dentro deste espaço).
Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO

T5

6. O heredograma abaixo representa o padrão de herança, em uma única família, de uma

6. O heredograma abaixo representa o padrão de herança, em uma única família, de uma doença genética humana. Os indivíduos doentes são representados em preto, enquanto os indivíduos não doentes são indicados em branco. Nessa família, a doença é causada por apenas um loco gênico, localizado em um dos dois tipos de cromossomos sexuais. No conjunto dos indivíduos da família, esse loco apresenta dois alelos, A 1 e A 2 .

esse loco apresenta dois alelos, A 1 e A 2 . Legenda: = homens = mulheres

Legenda:

= homens

= homens= mulheres

= mulheres

= mulheres= homens

a) O loco gênico envolvido nessa doença está no cromossomo X ou no cromossomo Y? Considerando que um dos alelos é dominante, o alelo que promove o aparecimento da doença nos indivíduos afetados (alelo A 1 ) é dominante ou recessivo em relação ao alelo A 2 ? Explique como você chegou às suas conclusões.

b) Pesquisas recentes analisaram as alterações causadas nos neurônios de indivíduos doentes pelo alelo A 1 . Nessas pesquisas, fibroblastos coletados da pele de pessoas afetadas foram utilizados para produzir células-tronco pluripotentes (iPSC). As iPSC foram então utilizadas para gerar neurônios. Por que células-tronco podem originar neurônios? Por que não seria adequado aos pesquisadores estudar os efeitos neuronais do alelo A 1 diretamente nos fibroblastos coletados da pele dos indivíduos afetados?

(Inspirado em Maria C. N. Marchetto e outros, A model for neural development and treatment of Rett Syndrome using human induced pluripotent stem cells. Cell, Cambridge, v. 143, p. 527–539, nov. 2010. Pesquisa realizada pela equipe do brasileiro Alysson Muotri, ex-aluno da UNICAMP e atualmente professor da Universidade da Califórnia, San Diego, EUA.)

Resolução (será considerado apenas o que estiver dentro deste espaço).
Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO

7. Esteiras rolantes horizontais são frequentemente instaladas em grandes aeroportos para facilitar o deslocamento das

7. Esteiras rolantes horizontais são frequentemente instaladas em grandes aeroportos para facilitar o deslocamento das pessoas em longos corredores. A figura ao lado mostra duas esteiras rolantes que se deslocam em sentidos opostos com velocidades constantes

) e de mesmo módulo,

igual a 1,0 m/s. Em um mesmo instante, duas pessoas (representadas por A e B) que se deslocavam com velocidade constante de módulo igual a v A = 1,5 m/s e v B = 0,5 m/s em relação ao piso e em sentidos contrários entram nas esteiras e continuam caminhando como anteriormente, como mostra a figura. As esteiras rolantes têm comprimento total de 120 m.

em relação ao piso em repouso (

v

e1

e

v

e2

a) Calcule o tempo necessário para que a pessoa A chegue até a outra extremidade da esteira rolante.

b) Quanto tempo depois de entrarem nas esteiras as pessoas A e B passam uma pela outra?

nas esteiras as pessoas A e B passam uma pela outra? Resolução (será considerado apenas o
Resolução (será considerado apenas o que estiver dentro deste espaço).
Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO

8. Um gigantesco iceberg desprendeu-se recentemente da Antártida, no extremo sul do planeta. O desprendimento

8. Um gigantesco iceberg desprendeu-se recentemente da Antártida, no extremo sul do planeta. O desprendimento desse iceberg, batizado de A68, foi considerado um dos maiores eventos do gênero já registrados pela ciência moderna. Segundo a NASA, é difícil prever se o iceberg permanecerá como um único bloco, mas é mais provável que ele se fragmente.

a) Considere que o iceberg tem o formato aproximado de uma placa de 6000 km 2 de área e 500 m de espessura. Sendo a densidade do gelo ρ g = 900 kg/m 3 , calcule o empuxo sobre o iceberg que o mantém flutuando.

b) Suponha um iceberg com velocidade de deriva constante. Em um dado momento, tensões internas fazem com que dois blocos de gelo menores, A e B, se desprendam e sejam lançados em sentidos opostos e perpendicularmente à direção da velocidade de deriva do iceberg. As massas dos blocos são m A = 2,0 x 10 5 kg e m B = 5,0 x 10 4 kg. Sabendo que imediatamente após a fragmentação a direção da velocidade de deriva do iceberg se mantém, e que o módulo da velocidade do bloco A é v A = 0,5 m/s, calcule o módulo da velocidade do bloco B imediatamente após a ruptura.

Resolução (será considerado apenas o que estiver dentro deste espaço).
Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO

9. Importantes estudos sobre o atrito foram feitos por Leonardo da Vinci (1452-1519) e por

9. Importantes estudos sobre o atrito foram feitos por Leonardo da Vinci (1452-1519) e por Guillaume Amontons (1663-1705). A figura (a) é uma ilustração feita por Leonardo da Vinci do estudo sobre a influência da área de contato na força de atrito.

sobre a influência da área de contato na força de atrito. a) Dois blocos de massas

a) Dois blocos de massas m 1 = 1,0 kg e m 2 = 0,5 kg são ligados por uma corda e dispostos como mostra a figura (b). A polia e a corda têm massas desprezíveis,

e o atrito nas polias também deve ser desconsiderado. O coeficiente de atrito

cinético entre o bloco de massa m 2 e a superfície da mesa é µ c = 0,8. Qual deve ser a distância de deslocamento do conjunto para que os blocos, que partiram do repouso, atinjam a velocidade v = 2,0 m/s?

que partiram do repouso, atinjam a velocidade v = 2,0 m/s? b) Em certos casos, a

b) Em certos casos, a lei de Amontons da proporcionalidade entre a força de atrito cinético e a força normal continua válida nas escalas micrométrica e nanométrica. A figura (c) mostra um gráfico do módulo da força de atrito cinético, F at , em função do módulo da força normal, N, entre duas monocamadas moleculares de certa substância, depositadas em substratos de vidro. Considerando

N = 5,0 nN, qual será o módulo do trabalho da força de atrito se uma das monocamadas se deslocar de

uma distância d = 2,0 µm sobre a outra que se mantém fixa?

Resolução (será considerado apenas o que estiver dentro deste espaço).
Resolução (será considerado apenas o que estiver dentro deste espaço).
Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO

10. Termômetros clínicos convencionais, de uso doméstico, normalmente baseiam-se na expansão térmica de uma coluna

10. Termômetros clínicos convencionais, de uso doméstico, normalmente baseiam-se na expansão térmica de uma coluna de mercúrio ou de álcool, ao qual se adiciona um corante. Com a expansão, o líquido ocupa uma parte maior de uma coluna graduada, na qual se lê a temperatura.

a) O volume de álcool em um termômetro é V 0 = 20 mm 3 a 25 o C, e corresponde à figura (a). Quando colocado em contato com água aquecida, o termômetro apresenta a leitura mostrada na figura (b). A escala está em milímetros, a área da secção reta da coluna é A = 5,0 x 10 - 2 mm 2 . O aumento do

. Se para o álcool

ΔV =

V

0

γ

volume, V, produzido pelo acréscimo de temperatura T, é dado por

ΔT

γ = 1,25 x 10 - 3 o C - 1 , qual é a temperatura T da água aquecida?

b) Os termômetros de infravermelho realizam a medida da temperatura em poucos segundos, facilitando seu uso em crianças. Seu funcionamento baseia-se na coleta da radiação infravermelha emitida por parte do corpo do paciente. A potência líquida radiada por unidade de área do corpo humano é dada por

Φ = 4 σ T 0 3 T, sendo σ ~ 6 x 10 - 8 W/m 2 K 4 a constante de Stefan-Boltzmann, T 0 = 300 K a temperatura

– T 0 a diferença entre a temperatura do corpo, que deve ser medida, e a

temperatura ambiente. Sabendo que em certa medida de temperatura Φ = 64,8 W/m 2 , encontre a

ambiente e T = T

corpo

temperatura do paciente em o C. Lembre-se que θ ( o C) ~ T (K) - 273.

Resolução (será considerado apenas o que estiver dentro deste espaço).
Resolução (será considerado apenas o que estiver dentro deste espaço).
Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO

T10

11. Geradores de Van de Graaff têm a finalidade de produzir altas diferenças de potencial.

11. Geradores de Van de Graaff têm a finalidade de produzir altas diferenças de potencial. Consistem em uma esfera metálica onde é acumulada a carga proveniente de uma correia em movimento. A carga é inicialmente depositada na parte inferior da correia, que está aterrada (potencial V = 0, ver figura), e é extraída da correia quando atinge a parte superior, que está no potencial V 0 , fluindo para a esfera metálica. O movimento da correia é mantido por um pequeno motor.

a) Em um gerador em operação, a carga transportada por unidade de comprimento da correia é igual a λ = 1,25 x 10 - 7 C/m. Se a taxa com que essa carga é transferida para a esfera metálica é dada por i = 5,0 x 10 - 9 C/s, qual é a velocidade da correia?

= 5,0 x 10 - 9 C/s, qual é a velocidade da correia? b) Um fenômeno

b) Um fenômeno muito atraente que ocorre em pequenos geradores usados em feiras de ciências é a produção de faísca, decorrente de uma descarga elétrica, quando um bastão metálico aterrado é aproximado da esfera carregada do gerador. A descarga elétrica ocorre quando o módulo do campo elétrico na região entre a esfera e o bastão torna-se maior que a rigidez dielétrica do ar, que vale E rd = 3,0 x 10 6 V/m. Para simplificar, considere que a esfera de um gerador e a extremidade do bastão equivalem a duas placas metálicas paralelas com uma diferença de potencial de V = 7,5 x 10 4 V. Calcule a distância entre elas para que a descarga ocorra.

Resolução (será considerado apenas o que estiver dentro deste espaço).
Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO

12. A acomodação da visão consiste na mudança da distância focal do cristalino, que é

12. A acomodação da visão consiste na mudança da distância focal do cristalino, que é uma lente convergente do olho, de modo que a imagem se forme exatamente na retina, tanto para objetos a grandes distâncias quanto para objetos próximos. A catarata é uma doença que torna o cristalino opaco. Seu tratamento consiste na substituição do cristalino doente por uma lente intraocular. Neste caso, a acomodação visual pode ser obtida através do deslocamento da lente implantada, para frente e para trás, com o auxílio do músculo ciliar.

a) Uma lente de distância focal fixa forma a imagem de um objeto localizado a uma grande distância em um anteparo, conforme mostra a figura (a). Qual é a distância focal da lente, e quanto ela deve ser afastada para formar, no anteparo, a imagem de um objeto localizado a 50 cm da posição final da lente, conforme mostra a figura (b)?

da posição final da lente, conforme mostra a figura (b)? b) Lasers que emitem pulsos de

b) Lasers que emitem pulsos de luz no infravermelho de duração de vários femtossegundos (1 fs = 10 - 15 s) vêm sendo empregados nas cirurgias oculares. Considere que um laser emite radiação de comprimento de onda λ = 1050 nm, e que cada um de seus pulsos dura t = 70 fs. Qual é o período da onda eletromagnética radiada e qual é o número de comprimentos de onda contidos em um pulso? A velocidade da luz no vácuo é c = 3,0 x 10 8 m/s.

Resolução (será considerado apenas o que estiver dentro deste espaço).
Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO

13. O Brasil é o maior produtor não asiático de arroz. Em 2015, importou cerca

13. O Brasil é o maior produtor não asiático de arroz. Em 2015, importou cerca de 370 mil toneladas do produto e exportou 960 mil. Esse cereal é uma importante fonte de nutrientes para bilhões de pessoas, fornecendo 15% das necessidades diárias de proteína de um adulto. O arroz é também importante fonte de minerais como cálcio, fósforo, potássio e, em menor quantidade, ferro, manganês e zinco. Dependendo de alguns fatores, como o local de produção ou o uso de fertilizantes e defensivos agrícolas, o arroz pode conter pequenas quantidades de arsênio, cádmio, chumbo, entre outros elementos.

a) Um estudo comparou três modos diferentes de cozinhar o arroz para verificar como a forma de preparo pode modificar a quantidade de minerais no cereal cozido.

1. O arroz foi cozido na proporção de cinco partes de água para uma parte de arroz. O excesso de água foi drenado após o cozimento.

2. O arroz foi embebido em água durante a noite, a água foi drenada e o arroz foi lavado até a água clarear. Drenou-se a água, e o arroz foi cozido na proporção de cinco partes de água para uma parte de arroz. O excesso de água foi drenado após o cozimento.

3. O arroz foi cozido na proporção de duas partes de água para uma de arroz. O excesso de água evaporou durante o processo de cozimento.

Do ponto de vista químico, qual tipo de cozimento deve ter levado à menor presença de minerais no arroz cozido: 1, 2 ou 3? Justifique sua resposta.

b) Em outro estudo, determinaram-se as concentrações totais de arsênio, cádmio e chumbo, em diferentes tipos comerciais de arroz (polido, integral e parboilizado) provenientes de várias regiões brasileiras, visando à promoção da saúde pública. Explique de que forma esse estudo estaria promovendo a saúde pública ao se preocupar com a presença desses elementos químicos e suas concentrações em diferentes tipos comerciais de arroz.

Resolução (será considerado apenas o que estiver dentro deste espaço).
Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO

T13

14. Uma das formas de se prevenir a transmissão do vírus H1N1, causador da gripe

14. Uma das formas de se prevenir a transmissão do vírus H1N1, causador da gripe suína, é usar álcool 70% para higienizar as mãos. É comum observar pessoas portando álcool gel na bolsa ou encontrá-lo em ambientes públicos, como restaurantes, consultórios médicos e hospitais. O álcool 70% também possui ação germicida contra diversas bactérias patogênicas. A tabela abaixo mostra a ação germicida de misturas álcool/água em diferentes proporções contra o Streptococcus pyogenes, em função do tempo de contato.

o Streptococcus pyogenes , em função do tempo de contato. a) Recomenda-se descartar uma garrafa com

a) Recomenda-se descartar uma garrafa com álcool 70% deixada aberta por um longo período, mesmo que ela esteja dentro do prazo de validade. Justifique essa recomendação levando em conta os dados da tabela ao lado e considerando o que pode acontecer à solução, do ponto de vista químico.

b) Além da higienização com álcool 70%, também estamos acostumados a utilizar água e sabão. Ambos os procedimentos apresentam vantagens e desvantagens. As desvantagens seriam a desidratação ou a remoção de gorduras protetoras da pele. Correlacione cada procedimento de higienização com as desvantagens citadas. Explique a sua resposta explicitando as possíveis interações químicas envolvidas em cada caso.

(Adaptado de G. H. Talbot e outros, 70% alcohol disinfection of transducer heads: experimental trials. Infect Control, v. 6, n. 6, p. 237-239, jun. 1985.)

Resolução (será considerado apenas o que estiver dentro deste espaço).
Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO

T14

15. Apesar de ser um combustível alternativo em relação aos combustíveis fósseis, o gás hidrogênio

15. Apesar de ser um combustível alternativo em relação aos combustíveis fósseis, o gás hidrogênio apresenta alguns problemas em seu uso direto. Uma alternativa é produzir o gás hidrogênio por eletrólise da água, para depois utilizá-lo na síntese do ácido fórmico, a partir da hidrogenação catalítica de gás carbônico. A possibilidade de utilizar o ácido fórmico como combustível tem feito crescer a demanda mundial por esse produto. A figura abaixo ilustra como seria o ciclo de produção e consumo do ácido fórmico, conforme indica o texto.

a) Considerando as informações do texto e a figura ao lado, cite duas vantagens em se adotar a alternativa descrita.

b) A reação de síntese do ácido fórmico a partir da hidrogenação catalítica de gás carbônico, em fase gasosa, apresenta um valor muito pequeno de constante de equilíbrio. Visando a aumentar o seu rendimento, imagine que sejam promovidos, separadamente, um aumento do volume e um aumento da temperatura da mistura reacional em equilíbrio. Preencha a tabela abaixo de modo a informar o que ocorre com a quantidade de ácido fórmico. Use as palavras aumenta ou diminui e justifique cada escolha no espaço correspondente.

Na temperatura da síntese, considere que as entalpias de

formação do gás

carbônico,

do

ácido

fórmico

e

do

hidrogênio são respectivamente.

(em

kJ∙mol -1 )

-394,

-363

e

0,

( em kJ∙mol - 1 ) -394, -363 e 0, (Adaptado de Team Fast. Disponível em

(Adaptado de Team Fast. Disponível em https://www.teamfast.nl/hydrozine/. Acessado em

10/08/2017.)

Resolução (será considerado apenas o que estiver dentro deste espaço).
Resolução (será considerado apenas o que estiver dentro deste espaço).
Aumento de volume Aumento de temperatura Quantidade de ácido fórmico Justificativa
Aumento de volume
Aumento de temperatura
Quantidade de
ácido fórmico
Justificativa

RASCUNHO

16. Graças a sua alta conversão energética e à baixa geração de resíduos, o gás

16. Graças a sua alta conversão energética e à baixa geração de resíduos, o gás hidrogênio é considerado um excelente combustível. Sua obtenção a partir da fermentação anaeróbia de biomassas, como bagaço de cana, glicerol, madeira e resíduos do processamento da mandioca, abundantes e de baixo custo, parece ser uma boa alternativa tecnológica para o Brasil. A velocidade da fermentação, bem como os diferentes produtos formados e suas respectivas quantidades, dependem principalmente do tipo de substrato e do tipo de microrganismo que promove a fermentação. As equações e a figura abaixo ilustram aspectos de uma fermentação de 1 litro de solução de glicose efetuada pela bactéria Clostridium butyricum.

Equação 1: C 6 H 12 O 6 (aq) + 2H 2 O( l ) → 2CH 3 COOH(aq) + 4H 2 (g) + 2CO 2 (g)

Equação 2: C 6 H 12 O 6 (aq) + 2H 2 O( l ) → CH 3 CH 2 CH 2 COOH(aq) + 2H 2 (g) + 2CO 2 (g)

CH 2 CH 2 COOH(aq) + 2H 2 (g) + 2CO 2 (g) conta as informações

conta as informações

presentes no texto e na figura, e considerando que a fermentação tenha ocorrido, concomitantemente, pelas

duas reações indicadas, qual ácido estava presente em

) ao final da fermentação, o

maior concentração (mol∙L

butanoico ou o etanoico? Justifique sua resposta.

b) A velocidade instantânea da fermentação,

em qualquer ponto do processo, é dada pela relação entre a variação da quantidade de hidrogênio formado e a variação do tempo. De acordo com o gráfico, quanto tempo após o início da fermentação a velocidade atingiu seu valor máximo? Justifique sua resposta.

a)

Levando

em

-1

Dados: massa molar da glicose: 180 g∙mol -1 ; volume molar do hidrogênio: 25 L∙mol -1 .

Resolução (será considerado apenas o que estiver dentro deste espaço).
Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO

T16

17. Fertilizantes são empregados na agricultura para melhorar a produtividade agrícola e atender à demanda

17. Fertilizantes são empregados na agricultura para melhorar a produtividade agrícola e atender à demanda crescente por alimentos, decorrente do aumento populacional. Porém, o uso de fertilizantes leva a alterações nas características do solo, que passa a necessitar de correções constantes. No Brasil, o nitrogênio é adicionado ao solo principalmente na forma de ureia, (NH 2 ) 2 CO, um fertilizante sólido que, em condições ambiente, apresenta um cheiro muito forte, semelhante ao da urina humana. No solo, a ureia se dissolve e reage com a água conforme a equação

(NH 2 ) 2 CO(s) + 2H 2 O(aq) → 2NH 4 + (aq) + CO 3 2- (aq).

Parte do nitrogênio, na forma de íon amônio, se transforma em amônia, conforme a equação

NH 4 + (aq) + H 2 O(aq) → NH 3 (aq) + H 3 O + (aq).

Parte do nitrogênio permanece no solo, sendo absorvido através do ciclo do nitrogênio.

a) Na primeira semana após adubação, o solo, nas proximidades dos grânulos de ureia, torna-se mais básico. Considerando que isso se deve essencialmente à solubilização inicial da ureia e à sua reação com a água, explique como as características dos produtos formados explicam esse resultado.

b) Na aplicação da ureia como fertilizante, ocorrem muitos processos que levam à perda e ao não aproveitamento do nitrogênio pelas plantas. Considerando as informações dadas, explique a influência da acidez do solo e da temperatura ambiente na perda do nitrogênio na fertilização por ureia.

Resolução (será considerado apenas o que estiver dentro deste espaço).
Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO

18. A derrubada de florestas para mineração causa indignação em muitos cidadãos preocupados com a

18. A derrubada de florestas para mineração causa indignação em muitos cidadãos preocupados com a

proteção ambiental. Contudo, não se observa o mesmo nível de preocupação em relação à atividade pecuária. A produção de carne é também responsável pelo desmatamento e por cerca de 18% da emissão de gases do efeito estufa. A evolução da emissão total de gás carbônico equivalente da humanidade (em Gt CO 2 eq por ano) é mostrada na figura A. Já a figura B mostra a emissão anual média de gás carbônico equivalente (em t CO 2 eq por pessoa por ano) somente com a alimentação, para duas diferentes dietas.

a) Considerando que toda a população mundial seja “amante de carne”, qual é a porcentagem de emissão de CO 2 equivalente devida somente à alimentação, em relação à emissão total? Mostre os cálculos.

em relação à emissão total? Mostre os cálculos. (Figura A : adaptada de PBL Netherlands Environment

(Figura A: adaptada de PBL Netherlands Environment Agency. Disponível em www.pbl.nl. Figura B: adaptada de Shrink That Footprint. Disponível em www.shrinkthatfootprint.com. Acessados em 15/10/2017.)

b) Se, em 2018, toda a população da Terra resolvesse adotar uma dieta vegana, a emissão total de gases voltaria ao nível de qual ano? Justifique sua resposta. Considere que toda a população atual seja “amante de carne”.

Dados: a população mundial atual é de

habitantes; Giga-toneladas (Gt)

= 1,0x10 9 toneladas.

7,6x10 9

Resolução (será considerado apenas o que estiver dentro deste espaço).
Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO

Não destacar esta folha

Não destacar esta folha

Não destacar esta folha