Você está na página 1de 25

Programa Formativo: Aprendizagem em Alternância (Dec.

Lei 205/96 – Portaria 1497/2008)


Nível de Educação e Formação III e Qualificação – IV

Técnico Auxiliar de Saúde

MANUAL DO FORMANDO

Formadora:
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

ÍNDICE

1. Introdução 2
2. Objetivos gerais e específicos 3
3. Ciência, Tecnologia e Sociedade 3
4. Conteúdos
4.1. Noções básicas de biologia celular 5
4.2. Informação genética 6
4.3. Manutenção da informação genética 9
4.4. ADN e ARN 10
4.5. Síntese de proteínas 11
4.6. Mitose 13
4.7. Ciclo celular 15
4.8. Diferenciação celular 17
4.9. Interferência dos fatores ambientais na replicação/transcrição do ADN 19
5. Síntese de conhecimentos 20
6. Atividades 21
7. Bibliografia recomendada 25

1. INTRODUÇÃO
A natureza celular da vida foi um dos princípios que se estabeleceu com carácter de universalidade
mais importante. Todos os seres vivos são constituídos por células que provêm de outras células. A
explicação da unidade e variabilidade dos seres vivos será a temática central para poder relembrar e
enriquecer o conceito de célula anteriormente estudado e compreender que, apesar das diferenças
existentes entre os seres vivos, eles são constituídos por uma unidade estrutural e funcional a nível celular
e molecular. Nesta unidade vai poder conhecer a unidade molecular central da vida: o ADN. Este é
encontrado em todos os seres vivos, bem como nos vírus, que ora possuem ADN, ora possuem ARN.
Porém, foi encontrado recentemente um vírus que possui ambos.
Cada ser vivo que habita a Terra possui uma codificação diferente de instruções escritas na mesma
linguagem no seu ADN. Estas diferenças geram as diferenças orgânicas entre os organismos vivos. Assim,
irá tentar dar respostas a estas e outras questões: Quais os processos responsáveis pela unidade e
variabilidade biológica? De que depende a multiplicação celular? E o crescimento e a regeneração de
tecidos? Por que razão as células de um organismo não são todas iguais? De que forma o meio ambiente
pode interferir num ciclo celular e que consequências pode trazer para a saúde de um indivíduo?

Adaptado de Biologia – ensino profissional

2
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

2. OBJETIVOS GERAIS E ESPECÍFICOS


• Distinguir os principais tipos de ácidos nucleicos (ADN e RNA) quanto à estrutura e função.
• Identificar as diferentes características do código genético.
• Reconhecer as principais estruturas e moléculas envolvidas na síntese proteica.
• Identificar os mecanismos de replicação, transcrição e tradução e a sua importância na manutenção
da informação genética.
• Reconhecer os processos de complementaridade de nucleótidos.
• Distinguir as diferentes fases do ciclo celular.
• Compreender a importância da divisão celular para a manutenção da vida.
• Compreender, de modo simplificado, o mecanismo de diferenciação celular.
• Relacionar a ocorrência de mutações genéticas com a replicação e transcrição do ADN e quais os
factores que podem contribuir para aquelas.

3. CIÊNCIA, TECNOLOGIA E SOCIEDADE

3
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

4
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

4. CONTEÚDOS
4.1. NOÇÕES BÁSICA DE BIOLOGIA CELULAR
Todos os seres vivos são constituídos por células, sendo estas as unidades básicas da vida (Teoria
Celular de Schleiden e Schewann – sé. XIX). As células apresentam uma grande diversidade morfológica
(forma) e fisiológica (“funcionamento”), sendo classificadas em tipos diferentes.
As células mais simples designam-se por procarióticas, e estão representadas pelas bactérias (figura
1) e cianobactérias. Terão sido as primeiras a ocupar o planeta quando surgiu a vida e não possuem um
núcleo definido, pelo que o material genético se encontra livre no citoplasma (normalmente uma molécula
circular), constituindo uma estrutura chamada nucleoide.
As células mais complexas classificam-se como eucarióticas e o seu material genético encontra-se
envolvido por uma membrana, constituindo o núcleo. Possuem também várias outras estruturas, que se
designam, de um modo geral, por organelos ou organitos. Do grupo das células eucarióticas fazem parte as
células animais e vegetais, que apresentam diferenças entre si (figura 2).

Figura 1 – Estrutura de uma célula procariótica


(retirado de
http://blog.ccbi.com.pt/blog/media/501/20090215-
bacteria2.GIF)

Figura 2 – estrutura das células animal e vegetal

O quadro abaixo sintetiza algumas características dos vários tipos de células.


Procarióticas Eucarióticas
Características Bactérias Animais Vegetais
Dimensões Entre 1 e 10m Entre 10 e 100m Entre 10 e 100m
Parede celular Sim Não Sim
Membrana celular Sim Sim Sim
Citoplasma Sim Sim Sim
Núcleo Não Sim Sim
Mitocôndrias Não Sim Sim
Cloroplastos Não Não Sim, nas células fotossintéticas

5
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

4.2. INFORMAÇÃO GENÉTICA

A informação genética encontra-se no ADN (ácido desoxirribonucleico), que, encontrando-se no


nucleoide ou no núcleo, pertence ao grupo das biomoléculas designadas por ácidos nucleicos.
As biomoléculas mais complexas são, normalmente, formadas pela união de várias unidades básicas,
designadas monómeros. Deste modo, este tipo de biomoléculas é designado por polímero. O ADN é um
polímero e o monómero respetivo, ou seja, a unidade básica, denomina-se nucleótido.

Mas o que é um nucleótido?

Um nucleótido é uma unidade formada por uma base azotada, uma pentose (açúcar) e um grupo
fosfato. (figura 3). Existem 5 bases azotadas diferentes: adenina e guanina (bases púricas ou de anel duplo)
e timina, citosina e uracilo (bases pirimídicas ou de anel simples) e 2 pentoses: desoxirribose e ribose
(figuras 4 e 5).

Figura 3 – Estrutura química de um nucleótido (adaptado de Figura 4 – Estrutura das pentoses (adaptado de
http://www.argenbio.org/adc/uploads/imagenes_doc/nucleotido http://sala.clacso.org.ar/gsdl/collect/ensaio/index/assoc/
.JPG) HASH52ab.dir/figura15.jpg)

Figura 5 – Bases azotadas


(adaptado de
http://www.elergonomista.com/
biologia/031.GIF)

Os nucleótidos podem então unir-se, através de reacções químicas de síntese (ou condensação),
formando cadeias polinucleotídicas. Esta ligação sequencial dos nucleótidos não ocorre ao acaso. Cada
nucleótido novo liga-se pelo seu grupo fosfato (carbono 5’) ao carbono 3’ da pentose do último nucleótido da
cadeia, ligação esta designada por fosfodiéster. Assim, diz-se que as cadeias se formam no sentido 5’3’.
6
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

Estudos revelaram outros


aspetos importantes da molécula
de ADN, como sendo os seguintes:
 A quantidade de adenina era
sempre idêntica à de timina e a de
guanina assemelhava-se à de
citosina;
 Interpretando diagramas de
difração de raios X chegou-se à
conclusão da forma da molécula de
ADN.
Estes dados permitiram
concluir que, a molécula de ADN é
constituída por duas cadeias
unidas ao nível das bases
azotadas, através de um sistema
de complementaridade em que a
uma adenina se liga sempre uma
timina e a uma citosina se liga
sempre uma guanina. Por outro
lado, esta dupla cadeia apresenta-
se na forma helicoidal. (figura 6)

Figura 6 – estrutura da molécula de ADN


(http://amaralnascimento.com/blog/adn.gif)

O ADN é responsável pelo controlo celular, uma vez que a sequência de nucleótidos das suas
moléculas constitui um código que, depois de traduzido, permite a síntese (produção) de aminoácidos e,
consequentemente de proteínas. As proteínas são também biomoléculas, apresentando uma enorme
diversidade de funções no organismo e ao nível das próprias células. Dessas funções salientam-se a
enzimática (as enzimas que catalisam reações químicas a nível intra e extracelular são proteínas), de
defesa (anticorpos), estrutural (parte da membrana celular é constituída por proteínas), entre outras.
Ao segmento de ADN com uma determinada informação genética dá-se o nome de gene e o conjunto
dos genes de indivíduo denomina-se genoma.

Sabendo que na molécula de ADN só existem 4 tipos diferentes de nucleótidos (de timina,
adenina, citosina e guanina), como é possível codificar 22 aminoácidos diferentes?
Se cada nucleótido codificasse 1 aminoácido, só poderíamos ter 4 aminoácidos. Conjuntos de 2
nucleótidos também não seriam suficientes, pois só permitiriam codificar 16 aminoácidos. Contudo,
conjuntos de 3 nucleótidos permitem 64 combinações diferentes, pelo que são suficientes para codificar os
diferentes aminoácidos.

 1 nucleótido 1 aminoácido?
41= 4 aminoácidos
Não é suficiente!

 2 nucleótidos 1 aminoácido?
42=16
Não é suficiente!

 3 nucleótidos 1 aminoácido?
43=64 aminoácidos
É suficiente!
7
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

Assim, o código genético funciona de tal modo que a cada conjunto de 3 nucleótidos (tripleto)
corresponde um determinado aminoácido.
O quadro abaixo mostra essa correspondência.
NOTA: nos tripletos está representado o nucleótido de uracilo (letra U) em vez do de timina, por
motivos que compreenderá noutro capítulo.

Daqui resultam algumas características do código genético:


 É universal – trata-se de uma linguagem comum a quase todos os seres vivos, desde os
organismos mais simples aos mais complexos. Até mesmo os vírus, seres acelulares, possuem
este código.
 Não é ambíguo – a um determinado tripleto de nucleótidos corresponde sempre o mesmo
aminoácido.
 É redundante – o mesmo aminoácido pode ser codificado por tripletos diferentes. Este
fenómeno também é conhecido por degenerescência do código genético.
 O terceiro nucleótido não é tão específico como os dois primeiros – significa que os dois
primeiros nucleótidos são iguais nos tripletos que codificam um mesmo aminoácido, mas o
terceiro varia. Por exemplo, o aminoácido arginina pode ser codificado por tripletos todos com
CG, mas a terceira base varia (CGU, CGC, CGA, CGG).
 O tripleto AUG tem dupla função – para além de codificar o aminoácido meteonina, é um
tripleto de iniciação.
 Os tripletos UAG, UGA, UAA são tripletos de finalização ou “stop” – como não codificam
qualquer aminoácido, representam um sinal para o fim da síntese da proteína.

Em síntese…
 O ADN é o suporte universal da informação genética.
 Uma molécula de ADN é constituída por uma dupla hélice formada por duas cadeias. Cada
cadeia tem uma sequência de nucleótidos de quatro tipos diferentes, designados pelas letras A,
T, C e G.
 Devido à complementaridade de bases, estabelecem-se ligações de hidrogénio entre a adenina
e a timina e entre a citosina e a guanina.
 O número de nucleótidos e a sua ordem variam nas diferentes moléculas de ADN.
 A universalidade e variabilidade são características da molécula de ADN.
8
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

4.3. MANUTENÇÃO DA INFORMAÇÃO GENÉTICA

O ADN, que se encontra no


núcleo das células, tem a capacidade
de se autoduplicar, assegurando a
conservação do património genético
de célula para célula, ao longo das
gerações.
Ao processo de duplicação da
molécula de ADN dá-se o nome de
replicação, sendo ela classificada
como semiconservativa. Isto porque
cada uma das novas cadeias
formadas é uma cópia de uma das
cadeias originais. Assim, as novas
moléculas formadas são idênticas à
molécula original e portadoras de
uma cadeia antiga e uma recém-
formada. Conserva-se, portanto, uma
das cadeias originais em cada nova
molécula formada, daí a designação
de modelo semiconservativo. (figura
7)

Figura 7 – Modelo semiconservativo da


replicação da molécula de ADN (retirado de
http://www.esec-
odivelas.rcts.pt/BioGeo/ficha_13.gif)

Mas como e onde ocorre a replicação?

A replicação do ADN ocorre no núcleo celular e resume-


se em 2 etapas:
A. Separação das cadeias da dupla hélice por uma
enzima (helicase);
B. Junção de nucleótidos (um a um) a cada uma das
cadeias separadas, por complementaridade de
bases, também pela ação de uma enzima (DNA-
polimerase).
Contudo, há que ter em conta que este processo não
decorre de igual modo nas duas cadeias. Isto porque, como
já foi referido, a adição de nucleótidos faz-se no sentido
5’3’ e sendo as duas cadeias iniciais antiparalelas, a parte
terminal onde se iniciará a replicação é diferente em cada
uma delas, pois uma termina numa extremidade 3’ e a outra
numa extremidade 5’. Portanto, uma das cópias decorrerá
de modo contínuo e a outra de modo descontínuo. (figura 8)

Figura 8 – replicação contínua (lado esquerdo da


figura) e descontínua (lado direito)

9
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

Resumindo:

Intervenientes Funções
Cadeias de ADN Moldes para a síntese das novas cadeias
Nucleótidos de ADN livres Formação das novas cadeias
Helicase Corta a pontes de hidrogénio entre as bases azotadas
DNA-polimerase Adiciona os novos nucleótidos, formando as cadeias novas
Outras enzimas Catalisam outras reações
ATP Transfere energia para o sistema

4.4. ADN E ARN

O ARN (ácido ribonucleico),


tal como o ADN, é um ácido
nucleico. Também ele é formado
por nucleótidos, unidos
sequencialmente de modo a
formar uma cadeia. Contudo,
existem várias diferenças entre
uma molécula de ADN e uma de
ARN. (figura 9)
 A base azotada timina só
existe no ADN, enquanto na
molécula de ARN essa base é
substituída por outra,
designada uracilo.
 Por sua vez, a desoxirribose
apenas existe no ADN e a
ribose apenas existe no ARN
(daí os nomes destes ácidos
nucleicos).
 A molécula de ADN é formada
por 2 cadeias que formam
uma dupla hélice e a molécula
de ARN é de cadeia simples,
mas haverá situações em que
se verifica complementaridade
de bases. Neste caso, como
no RNA não existe timina, à
adenina liga-se o uracilo.

Figura 9 – Cadeias de ADN e RNA (adaptado de


http://www.sobiologia.com.br/conteudos/figuras/Citologia2/ADN10.jpg)

A tabela que se segue resume as diferenças entre os dois tipos de ácidos nucleicos.

ADN RNA
Açúcar (pentose) Desoxirribose Ribose
Bases azotadas Adenina, timina, citosina, guanina Adenina, uracilo, citosina, guanina
Cadeias Cadeia dupla Cadeia simples
Hélice Sim Não

10
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

4.5. SÍNTESE PROTEICA

Tal como já foi atrás referido, a síntese de proteínas depende da informação contida nas moléculas de
ADN. Isto porque são os tripletos de nucleótidos que determinam a sequência de aminoácidos.
Na passagem da linguagem polinucleotídica do ADN para a linguagem polipeptídica das proteínas,
consideram-se essencialmente duas fases:
 Transcrição da mensagem genética – segmentos de ADN codificam a produção de ARN;
 Tradução da mensagem genética – o ARN formado codifica a produção de proteínas.

Transcrição

A transcrição realiza-se no núcleo, formando-se uma cadeia de ARN a partir de uma das cadeias da
molécula de ADN, que serve de molde. O complexo enzimático RNA-polimerase desliza sobre uma das
cadeias de ADN e vai adicionando nucleótidos de ARN sequencialmente, por complementaridade de bases,
no sentido 5’3’. Forma-se uma molécula de ARN, em que no lugar da timina, é inserido um nucleótido de
uracilo. Esta molécula designa-se por ARN mensageiro ou simplesmente mRNA e ainda sofrerá alterações
profundas no núcleo, nomeadamente a extração de pequenas porções de ARN que não codificam
informação, chamadas intrões. Às porções que codificam informação atribui-se a designação de exões.
Assim que o mRNA se encontra funcional, abandona o núcleo e migra para o citoplasma. (figura 10)

Resumindo:
Intervenientes Funções
Cadeia de ADN Molde para a síntese do mRNA
Nucleótidos de ARN livres Formação da cadeia de mRNA
Enzimas Catalisam reações
ATP Transfere energia para o sistema

Tradução

Nesta etapa ocorre a transformação da mensagem contida no mRNA na sequência de aminoácidos,


segundo o código genético, e nela intervêm diversas estruturas, como sendo os ribossomas e o ARN de
transferência (tRNA). (figura 10)
Os ribossomas são organelos que podem encontrar-se livres no citoplasma ou associados às
membranas do retículo endoplasmático. Formam-se ao nível dos nucléolos, sendo constituídos por um
outro tipo de ARN (ARN ribossómico ou rRNA) e proteínas. Cada ribossoma possui duas subunidades de
tamanhos diferentes, que podem encontrar-se unidas ou separadas.
O tRNA, que funciona como intérprete entre a “linguagem” do mRNA e a “linguagem” das proteínas,
tem uma dupla especificidade: selecionar e transportar os aminoácidos para os locais de síntese das
proteínas, que são os ribossomas, onde serão ordenados segundo o código expresso no mRNA. Em
determinadas regiões, a cadeia simples do tRNA dobra-se devido à complementaridade de bases,
estabelecendo-se ligações entre a adenina e o uracilo e entre a citosina e a guanina. Na extremidade 3’
encontra-se o respetivo aminoácido e numa zona especial localiza-se um tripleto de nucleótidos
complementar a outro do mRNA.
Para que se possa compreender todo o processo, é necessário definir três conceitos essenciais:
 Codogene – tripleto da molécula de ADN que se encontra no núcleo;
 Codão – tripleto da molécula de mRNA que transporta informação complementar ao ADN;
 Anticodão – tripleto da molécula de tRNA, complementar ao codão do mRNA.

A tradução desenrola-se em 3 momentos: iniciação, alongamento e finalização.(figura 10)


1 – iniciação – a molécula de mRNA liga-se à subunidade menor de um ribossoma e o primeiro codão
a ser “lido” é o AUG, que como se sabe, é o codão de iniciação e codifica o aminoácido meteonina; o tRNA
11
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

complementar, com a meteonina, e a subunidade maior também se ligam à subunidade menor do


ribossoma; o ribossoma encontra-se então, funcional.
2 – alongamento – o ribossoma vai avançando ao longo do mRNA e os diversos codões vão sendo
sucessivamente traduzidos, ligando-se também sucessivamente os tRNA com os anticodões
complementares e respetivos aminoácidos; entre estes vão-se estabelecendo ligações peptídicas, pelo que
de cada vez que se traduz um novo codão, o tRNA que já não é necessário, abandona o ribossoma, mas o
aminoácido permanece.
3 – finalização – quando um dos codões UAA, UGA ou UAG surge, o processo de tradução termina,
uma vez que não existe nenhum tRNA complementar e consequentemente não existe aminoácido
correspondente; a cadeia de aminoácidos formada (cadeia polipeptídica) destaca-se, sofrendo
posteriormente diversas transformações, as subunidades ribossómicas separam-se e ficam livres no
citoplasma e a molécula de mRNA é “reciclada”.

A biossíntese de proteínas apresenta como características fundamentais:


 Complexidade – intervêm diversos agentes;
 Rapidez – a célula eucariótica, por exemplo, junta cerca de 140 a.a. em dois ou três minutos;
 Amplificação – a mesma zona de ADN pode ser transcrita várias vezes, formando-se diversas
moléculas de mRNA; por outro lado, cada cadeia de mRNA pode ser traduzida por diversos
ribossomas ao mesmo tempo.
Resumindo:
Intervenientes Funções
mRNA Contém a informação genética para a síntese de proteínas
Aminoácidos Unidades básicas para a formação de proteínas
tRNA Transfere os aminoácidos para os ribossomas
Ribossomas Sistemas de leitura
Enzimas Catalisam as reações químicas
ATP Transfere energia para o sistema
Em síntese…
transcrição Tradução
ADN (codogenes) mRNA (codões) Proteínas
tRNA (anticodões)

Figura 10 – processo de
biossíntese de proteínas
(adaptado de http://evolution-
textbook.org/content/free/figur
es/02_EVOW_Art/27_EVOW
_CH02.jpg)

12
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

4.6. MITOSE

Todos os seres vivos incluem no seu desenvolvimento períodos de crescimento celular e divisão
celular. Nos organismos unicelulares, como as bactérias ou as leveduras, cada divisão celular corresponde
à reprodução, pois a partir de uma célula formam-se uma ou mais células independentes. Já nos seres
pluricelulares, são necessárias muitas divisões celulares para que se constitua um individuo a partir da
célula-ovo.
Para além da reprodução e crescimento, a divisão celular é também importante para assegurar a
manutenção da integridade física dos indivíduos, substituindo células danificadas ou mortas.
De um modo geral, as células dividem-se, crescem, aumentam o seu conteúdo e voltam a dividir-se.
Por norma, cada célula-mãe origina duas células-filhas, que, à partida, serão geneticamente iguais à inicial
e poderão dar origem a uma nova geração quando se dividirem.
Durante a divisão celular, os organelos, as enzimas e outros constituintes das células são distribuídos
pelas células-filhas. O ADN é autoduplicado e as cópias são rigorosamente distribuídas pelas células
resultantes.

Para que se possam compreender todas as fases da divisão celular, é importante esclarecer a
organização do ADN no núcleo das células. Por exemplo, em cada célula humana existem cerca de 2
metros de ADN. Tendo em conta que o núcleo tem de 5 a 8 m, será o equivalente a acondicionar 20km de
fio numa bola de ténis!
Nas células eucarióticas as moléculas de
ADN encontram-se associadas a proteínas
(histonas), formando estruturas com o nome de
cromossomas. Enquanto o ADN contém a
informação genética, as enzimas são
responsáveis pela forma física do cromossoma e
também regulam a atividade do ADN. Ao conjunto
de cromossomas no núcleo dá-se o nome de
cromatina, podendo esta encontrar-se em dois
estados: condensada (compactada) ou dispersa
(distendida). Quando a cromatina se encontra na
forma condensada, as moléculas passam de um
estado distendido para um estado compacto,
podendo mesmo reduzir o seu tamanho 30 mil
vezes! Assim, os cromossomas individualizam-se
e tornam-se até visíveis ao microscópio ótico.
(figura 11)
Figura 11 – estrutura de um cromossoma (adaptado de
http://3.bp.blogspot.com/_FtkOqKjI51o/R7WAxBOTsDI/AAAAAAAAAF8/bZ
VxlSDIvbg/s400/Imagem1.jpg)

Em alguns períodos da vida celular, cada cromossoma contém, para além das proteínas, apenas uma
molécula de ADN, sendo constituído por um cromatídio. Noutros períodos, a molécula de ADN duplica e
cada cromossoma
passa a possuir
dois cromatídios,
que se encontram
ligados por uma
estrutura sólida e
resistente
chamada
centrómero.
(figura 12)
Figura 12: 1 – molécula de ADN (dupla hélice); 2 – molécula de ADN+proteínas (cromatina); 3 – cromatina dispersa
(cromossoma com um cromatídio); 4 – cromossoma descondensado com dois cromatídios; 5 – cromossoma condensado

13
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

As células humanas possuem 46 cromossomas, que formam 23 pares de cromossomas homólogos. O


conjunto de cromossomas (guarnição cromossómica) das células de uma espécie designa-se cariótipo.
(figura 13)

Cariótipo humano Cromossomas de uma espécie de mosca


Figura 13 – cariótipo humano e de uma mosca

A divisão celular engloba uma série de fases, que se repetem, geração após geração celular. Ao
conjunto dessas fases, pelas quais uma célula passa desde que se forma até se dividir em duas, designa-se
ciclo celular. Uma das fases mais importante do ciclo celular diz respeito ao conjunto de transformações
durante as quais o núcleo das células eucarióticas se divide e chama-se mitose.
A mitose compreende quatro subfases: profase, metafase, anafase e telofase.(figura 14)

Figura 14 – Subfases da mitose numa célula vegetal (retirado de


http://biologiacesaresezar.editorasaraiva.com.br/navitacontent_/userFiles/File/Biologia_Cesar_Sezar/BIO1_173.jpg)

A profase é, de um modo geral, a subfase mais longa da mitose e ocorrem transformações no núcleo e
no citoplasma. Primeiramente, a cromatina começa a condensar, de modo que os filamentos de ADN e
proteínas começam a enrolar-se, tornando-se cada vez mais grossos e mais curtos. Nesta altura, os
cromossomas encontram-se duplicados, pelo que cada um possui 2 cromatídios unidos na zona do
centrómero. Os dois pares de centríolos existentes no citoplasma das células animais afastam-se em
sentidos opostos, um para cada pólo da célula. Assim, formam um sistema de microtúbulos proteicos que se
agregam para formar fibrilas, que se designa por fuso acromático ou mitótico. Finalmente, assim que os
centríolos atingem os pólos, a membrana nuclear fragmenta-se e os nucléolos desaparecem. Nas células
vegetais também se forma o fuso acromático, contudo não através de estruturas individualizadas como os
centríolos.

14
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

Na metafase, os cromossomas atingem o seu máximo de encurtamento e o fuso acromático completa


o seu desenvolvimento, verificando-se que algumas fibrilas vão de pólo a pólo e outras encontram-se
ligadas aos cromossomas na zona do centrómero. A principal característica visual desta fase é a disposição
dos cromossomas na zona média da célula (plano equatorial da célula e equidistante entre os dois pólos),
com os centrómeros nesse plano e os “braços” dirigidos para fora. Encontra-se formada a placa equatorial,
facilmente identificável ao microscópio ótico.

Na anafase ocorre a clivagem de cada um dos centrómeros, de modo que os cromatídios de cada
cromossoma se separam, passando a constituir cada um deles um cromossoma independente. As fibrilas
ligadas aos cromossomas encurtam e os cromossomas filhos começam a afastar-se em direção aos pólos.
Diz-se que ocorre a ascensão polar, também ela facilmente identificável ao microscópio. No final da anafase
cada pólo da célula possui coleções completas e equivalentes de cromossomas, ou seja, de ADN.

Finalmente, na telofase, ocorre praticamente o contrário do que acontece na profase. A membrana


nuclear reorganiza-se em volta dos cromossomas e os nucléolos de cada núcleo recém-formado
reaparecem. O fuso mitótico desintegra-se e a cromatina descondensa, voltando a formar-se filamentos
mais finos e alongados, logo, menos visíveis. A célula fica assim constituída por dois núcleos, terminando a
mitose.

4.7. CICLO CELULAR

Tal como já foi referido, o ciclo celular inclui todas as transformações de uma célula desde que se
forma até que se divide. Divide-se em duas grandes fases: a interfase e a fase mitótica.

A interfase é o período compreendido entre o fim de uma divisão celular e o princípio da seguinte, não
sendo possível observar os cromossomas ao microscópio ótico. Esta fase divide-se em 3 períodos: intervalo
G1 (G de gap=intervalo), período S e intervalo G2.
Intervalo G1 ou pós-mitótico: corresponde ao intervalo entre o fim de uma fase mitótica e o início da
replicação do ADN. Caracteriza-se por uma intensa atividade biossintética, nomeadamente de proteínas
(como enzimas) e ARN, havendo ainda a formação de organelos celulares e um notório crescimento da
célula.
Período S ou período de síntese de ADN: ocorre a replicação de cada uma das moléculas de ADN. É
neste momento que cada cromossoma, ainda na forma distendida, passa a ser constituído por dois
cromatídios. Nas células animais ocorre ainda a duplicação dos centríolos no citoplasma, formando-se dois
pares dessas estruturas.
Intervalo G2 ou pré-mitótico: ocorre entre o final da síntese do ADN e o princípio da fase mitótica,
sendo caracterizado essencialmente pela síntese de biomoléculas essenciais à divisão celular.

A fase mitótica pode variar em alguns aspetos de organismo para organismo, mas na maior parte das
células eucarióticas é semelhante. Inclui duas fases, a mitose e a citocinese. A mitose, ou cariocinese, já foi
atrás descrita, envolvendo todas as alterações relativas à divisão do núcleo.

A citocinese diz respeito à divisão do citoplasma, ocorrendo, obviamente, depois da mitose. Nesta
fase formam-se as duas células-filhas através da formação de um anel contráctil de filamentos proteicos na
zona do plano equatorial. Estes anéis contraem e puxam a membrana celular para dentro, causando um
sulco de clivagem que vão estrangulando o citoplasma até à separação das duas células.

15
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

Nas células vegetais o


processo é diferente, uma vez que a
existência da parede celular impede
o referido estrangulamento. Neste
caso, vesículas derivadas do
complexo de Golgi alinham-se na
região equatorial e fundem-se para
formar uma estrutura, que será a
membrana celular de cada célula
filha. Mais tarde, pela deposição de
fibrilas de celulose, formam-se as
paredes celulares de cada célula.
(figura 15)

Figura 15 – citocinese animal e vegetal


(retirado de
http://2.bp.blogspot.com/_fs4X2Qr4o3s/SPfB8
Hw4WOI/AAAAAAAAAOI/Hl1n7HrMy8Y/s400
/citocinese.jpg)

Apesar dos mecanismos de divisão celular serem idênticos nos diversos seres vivos, o ritmo a que
ocorrem pode variar muito. Daqui se conclui que o ciclo celular é regulado por rigorosos mecanismos de
controlo, os quais atuam fundamentalmente em dois pontos: no final de G1 e de G2.
No final de G1 as células podem prosseguir para um novo ciclo ou permanecer num estádio
denominado G0. O tempo de permanência em G0 depende não só do tipo de célula como das circunstâncias
que a rodeiam. Alguns tipos de células não abandonam nunca o estádio G0, permanecendo nele por
semanas ou até anos, como sucede com a maioria dos neurónios e as fibras musculares de um adulto.
No final de G2 ocorre novo momento de controlo, determinando mais uma vez o prosseguimento do
ciclo ou a sua interrupção. Uma interrupção pode, por exemplo, ocorrer se tiver havido anomalias na
duplicação do ADN.

Em resumo tem-se o seguinte:

Principais acontecimentos
G1 Preparação para a duplicação do ADN
Interfase

S Duplicação do ADN (síntese)


G2 Preparação para a divisão celular (energia e materiais)
Condensação da cromatina
Formação do fuso acromático a partir dos centríolos
Profase
Desaparecimento do nucléolo
Ciclo Celular

Desintegração da membrana nuclear


Disposição dos cromossomas no plano equatorial da célula – formação da
Fase Mitótica

Metafase
placa equatorial
Mitose
Migração dos cromatídios de cada cromossoma para os pólos da célula –
Anafase
ascensão polar
Descondensação da cromatina
Desaparecimento do fuso mitótico
Telofase
Formação dos nucléolos
Reorganização da membrana nuclear
Citocinese Divisão citoplasmática

16
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

A importância da divisão celular pode constatar-se se considerarmos que uma pessoa adulta possui
cerca de 1014 células, todas derivadas de uma só, o ovo. Mesmo nos adultos, a intensidade da multiplicação
das células é impressionante. Veja-se o exemplo dos glóbulos vermelhos, uma vez que um ser humano
possui cerca de 2,5x1013 destas células e as mesmas duram aproximadamente 120 dias, logo, para este
número se manter constante é necessário que se produzam cerca de 2,5 milhões de glóbulos vermelhos
por segundo! Outro exemplo é o da camada superficial da pele que é renovada a cada 28 dias. Assim, a
renovação celular só é assegurada graças à divisão celular das células.
Por outro lado, a regeneração celular também se deve à divisão celular. Este processo consiste na
restituição da integridade anatómica e funcional de um tecido. Contudo, esta capacidade de regeneração
não é igual em todos os tipos de células nem em todos os seres vivos. Uma estrela-do-mar consegue
regenerar um organismo completo a partir de apenas um “braço”, desde que contenha parte do disco
central. Do mesmo modo, uma lagartixa consegue regenerar a sua cauda. O ser humano tem alguma
capacidade de regeneração, mas variável de tecido para tecido. Por exemplo as células da pele têm
facilidade em regenerar-se (cicatrização), o que não sucede com as células nervosas, cuja regeneração é
muito limitada ou até inexistente.

4.8. DIFERENCIAÇÃO CELULAR

As células somáticas (todas as células de um organismo, excetuando as sexuais) de um ser vivo


contêm no seu núcleo, exatamente os mesmos cromossomas e, como tal, a mesma informação genética.
Contudo, verifica-se que as células formam diferentes tecidos e órgãos tão diversos, assumindo formas e
funções completamente distintas.

Como tal é possível?

Ao longo do desenvolvimento de um indivíduo, ocorre, normalmente, um conjunto de processos,


através dos quais as células geneticamente idênticas se especializam no sentido de desempenharem uma
ou várias funções. Esta especialização tem o nome de diferenciação celular, implicando alterações não só
na função das células, mas também na sua estrutura.

Verifica-se então que nem todo o material genético é descodificado, estando algumas partes como que
“adormecidas”, dependendo do tipo de célula. Aliás, em 1965 François Jacob e Jacques Monod receberam
o prémio Nobel da Fisiologia/Medicina pelo seu contributo em esclarecer a seletividade que existe na
expressão de porções do ADN (genes). Os trabalhos destes investigadores foram realizados com uma
bactéria muito comum, Escherichia coli, baseando-se no modo como era regulada a atividade dos genes
responsáveis pelo metabolismo da lactose, isto é, os genes responsáveis pela codificação de três enzimas
diferentes necessárias para a utilização da lactose pela bactéria.

17
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

É utilizando esse
exemplo que se
compreenderá o mecanismo
de regulação da expressão
seletiva dos genes e
consequente diferenciação
celular. (figura 16)

O ADN dos organismos


codifica quer o ARN, quer
as proteínas necessárias à
vida da célula. Mas mais
importante que o ADN de
uma célula conter toda uma
sequência de nucleótidos, é
saber que sequências de
ADN estão ativas numa
dada célula e quais os
mecanismos reguladores
que determinam essa
atividade.

Figura 16 –
regulação da
expressão dos genes
responsáveis pelo
metabolismo da
lactose

No caso estudado, existem os seguintes intervenientes:


 Três genes estruturais (D, E e F) que codificam a produção das três enzimas necessárias ao
metabolismo da lactose;
 Um gene regulador (A) responsável pela produção de um repressor, que é uma proteína;
 Um gene operador (C), onde se fixa o repressor, impedindo assim a transcrição dos 3 genes
estruturais;
 Um gene promotor (B) onde se liga a RNA-polimerase para iniciar a transcrição dos genes
estruturais.
Na ausência da lactose, a proteína repressora liga-se ao gene operador e bloqueia a transcrição.
Assim, não se formam as enzimas responsáveis pelo metabolismo da lactose. Quando a lactose está
presente, liga-se à proteína repressora, de modo que esta fica impossibilitada de se ligar ao gene operador.
Consequentemente, a RNA-polimerase liga-se ao promotor e ocorre a transcrição dos genes estruturais,
formando-se as proteínas necessárias ao metabolismo da lactose.

Trata-se de um caso particular, mas que permite retirar algumas conclusões:


 As moléculas de ADN contêm muito mais informação que aquela que se vê nos indivíduos, pois
muitos genes destinam-se a regular o funcionamento de outros genes;
 Os genes que se expressam num determinado contexto dependem das relações que se
estabelecem entre o ADN e o ambiente desse contexto;
 Muitas das potencialidades genéticas das células diferenciadas encontram-se inibidas e nunca
chegam a expressar-se.

Assim sendo, embora o património genético de um indivíduo seja igual, dependendo dos genes que
estão ativos determinam o tipo de células. Por exemplo, o cromossoma 11 humano contém quer os genes
responsáveis pela produção da insulina (hormona produzida no pâncreas), quer os genes responsáveis pela
18
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

produção de hemoglobina (proteína dos glóbulos vermelhos responsável pelo transporte de gases).
Contudo, estes genes nunca se expressam ao mesmo tempo. Dependendo se se encontram em células do
pâncreas ou em células sanguíneas, serão ativados os genes correspondentes e “adormecidos” os outros.
Por vezes, células diferenciadas podem perder a sua especialização, tornando-se células
indiferenciadas e com a capacidade de formar novos tecidos. Este fenómeno de células indiferenciadas
serem capazes de se transformar num outro tipo qualquer de célula denomina-se totipotência e é muito
importante nos mecanismos de clonagem e desenvolvimento de órgãos.

4.9. INTERFERÊNCIA DOS FATORES AMBIENTAIS NA REPLICAÇÃO/


TRANSCRIÇÃO DO ADN

Tal como já foi referido, a atividade dos genes encontra-se rigorosamente controlada, mas é afetada
por agentes do ambiente envolvente às células. Tal influência pode ser conveniente, mas muitas vezes é
nefasta.
As alterações físicas ou químicas da sequência de nucleótidos que ocasionem mudanças nas
características dos indivíduos denominam-se mutações génicas. Se essas alterações ocorrem ao nível da
estrutura de um cromossoma, chamam-se mutações cromossómicas.
As mutações podem ter diversas origens:
a) Serem ocasionais, devido à pequena probabilidade que existe de ocorrerem erros na duplicação do
ADN;
b) Serem provocadas por agentes mutagénicos físicos (raios X, raios UV, raios gama, beta e alfa…),
químicos (substâncias do fumo do tabaco, álcool, outras drogas…) e biológicos (ação de vírus e
bactérias que injetam parte do seu ADN no ADN da célula hospedeira).
Dependendo do tipo de alteração, a mutação pode originar diferentes consequências, com diferentes
gravidades. Assim, podem ocorrer as seguintes situações:
 Alterações letais, caso seja afetada a produção de enzimas e proteínas essenciais à
sobrevivência do organismo;
 Alterações que provoquem doenças ou deficiências (por exemplo a trissomia 21 e a anemia
falciforme – figura 17);
 Mutações que conferem maior viabilidade ao indivíduo, favorecendo a sua sobrevivência;
 Podem não ocorrer alterações por vários motivos: o codão que sofreu a alteração pode
codificar o mesmo aminoácido (redundância do código genético), o novo aminoácido pode ter
propriedades semelhantes ao que deveria existir, a mutação pode levar a alterações num local
da proteína que não afete a sua função.

Figura 17 – A mutação responsável pela anemia falciforme

19
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

Uma das mais preocupantes alterações que ocorre nas células é a perda dos mecanismos de
regulação celular. Nesta situação, as células dividem-se de forma descontrolada, até que não existam
nutrientes disponíveis. O resultado desta divisão é a formação de grandes aglomerados celulares, que
constituem os tumores. Se as células destes tumores se espalharem pelo organismo, invadindo outros
tecidos, diz-se que formam metástases e tal sucede quando o tumor é maligno. A metastização leva à
formação de novos tumores noutros locais do organismo, impedindo o seu normal funcionamento e levando
à morte. Este problema é vulgarmente conhecido como cancro.

5. SÍNTESE DOS CONHECIMENTOS

20
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

6. ATIVIDADES
1. Corresponda a cada alínea das frases os termos adequados.

1.1. A molécula de ADN tem mensagens codificadas em sequências de _____a)_____ que contêm as
seguintes bases azotadas: ___b)______, _______c)______, ______d)________ e _____e)______.
1.2. No mRNA, cada grupo de três ____f)______ que codifica um _______g)______ recebe o nome de
____h)____ .
1.3. Os _____i)_______são constituídos por subunidades de tamanhos diferentes que participam na
_____j)______ do ____l)_____.
1.4. Entre as duas cadeias _____m)_______ da molécula de ADN estabelecem-se ligações _____n)_____
segundo a regra de complementaridade das ______o)______.

2. Estabeleça a correspondência entre as afirmações da coluna I com uma letra da chave da coluna II.

AFIRMAÇÕES CHAVE
1- Cadeias de nucleótidos.
2- Composto por uma sequência específica de
aminoácidos.
3- Contém uracilo.
A- Molécula de ADN
4- Encontra-se no núcleo.
B- Molécula de ARN
5- Contém citosina.
C- Ambas as moléculas
6- Encontra-se, pelo menos, em três formas
D- Nenhuma das moléculas
diferentes.
7- Contém ribose.
8- Estrutura de dupla hélice.
9- Capaz de autoreplicação em plantas e
animais.

3. Observe a figura 1.

Figura 1

3.1. Indique o fenómeno evidenciado na figura 1.


3.2. Descreva esse fenómeno.
3.3. Indique em que organelo celular se efetua o processo referido, nas células eucarióticas.
3.4. Explique a importância biológica deste processo.

21
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

4. Um gene da molécula de ADN apresenta a seguinte sequência de bases azotadas:

5’ T A C A C AT T T C G C C G G AG A A G G AT T 3’

4.1. Indique a sequência de bases azotadas da cadeia complementar da mesma molécula de ADN.
4.2. Replique a molécula de ADN referida.
4.3. Mencione a sequência de bases do mRNA que o gene indicado origina.
4.4. Refira o número de codões que o mRNA apresenta.
4.5. Apresente a sequência correta dos anticodões.
4.6. Considere que no ADN de um organismo existem 30% da base azotada adenina. Refira as
percentagens das restantes bases.

5. Observe atentamente a seguinte figura 2.

Figura 2

5.1. Atribua um título ao processo esquematizado na figura.


5.2. Designe as fases assinaladas por 1 e 2.
5.3. Legende a figura esquematizada para os números 1, 3, 4, 5, 6 e 7.
5.4. A molécula 6, antes de migrar para o citoplasma, sofre uma maturação que o torna funcional. Em que
consiste essa maturação?
5.5. Descreva os acontecimentos que caracterizam a etapa de iniciação da fase 2.
5.6. Justifique a seguinte afirmação: “A molécula 1 é formada por duas cadeias de nucleótidos
antiparalelas”.

22
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

6. A figura 3 representa o conjunto de etapas na clonagem de um sapo.

Figura 3

6.1. Refira o procedimento para obter a célula que originou o sapo albino?
6.2. A informação genética que permitiu a formação de um sapo albino teve origem:
A- no óvulo do sapo verde.
B- no núcleo do óvulo e no núcleo do girino albino.
C- no núcleo da célula proveniente do girino albino.
D- no núcleo do óvulo do sapo verde.
Selecione a opção correta
6.3. O sapo albino obtido constitui um clone do girino albino. Fundamente esta afirmação.
6.4. Distinga células totipotentes de células indiferenciadas

23
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

SUGESTÃO DE CORREÇÃO

Questão Correção

1. 1.1. a) nucleótidos; b) timina; c) adenina; d) citosina; e) guanina


1.2. f) nucleótidos; g) aminoácido; h) codão
1.3. i) ribossomas; j) transcrição; l) mRNA
1.4. m) polinucleotídicas; n) de hidrogénio; o) bases

2. 1- C; 2 – D; 3 – B; 4 – C; 5 – C; 6 – B; 7 – B; 8 – A; 9 – A

3.1 Replicação semiconservativa do ADN

3.2 O processo inicia-se quando a ADN polimerase abre as duas cadeias de ADN quebrando as
pontes de hidrogénio que ligam as bases complementares. A molécula de ADN abre e fica
assim, pronta para que se liguem nucleótidos livres de ADN que se encontram no nucleoplasma.
Estes ao ligarem-se por complementaridade aos nucleótidos da cadeia já existente de ADN vão
formar progressivamente uma nova cadeia complementar e antiparalela. O mesmo acontece na
outra cadeia da molécula-mãe. Quando o processo termina temos duas moléculas-filhas
semelhantes à molécula-mãe e semelhantes entre si.

3.3 Núcleo

3.4 Permite que, antes da ocorrência da divisão celular, o material genético se duplique para que a
quantidade de ADN seja igual nas células filhas.

4.1 3’ – ATGTGTAAAGCGGCCTCTTCCTAA – 5’

4.2 5’ T A C A C A T T T C G C C G G A G A A G G A T T 3’
3’ ATA T G T A A A G C G G C C T C T T C C T A A 5’

5’ T A C A C A T T T C G C C G G A G A A G G A T T 3’
3’ ATA T G T A A A G C G G C C T C T T C C T A A 5’

4.3 5’ – UACACAUUUCGCCGGAGAAGGAUU – 3’

4.4 8

4.5 AUG UGU AAA GCG GCC UCU UCC UAA

4.6 30% Timina; 20% guanina; 20% citosina

5.1 Síntese proteica

5.2 1 – Transcrição; 2 – Tradução

5.3 1 – ADN; 3 – tRNA; 4 – aminoácidos; 5 – ribossoma; 6 – mRNA; 7 – polipéptido/proteína

5.4 Consiste na remoção de sequências de genes que não codificam informação (intrões)

5.5 A subunidade menor do ribossoma liga-se à extremidade do mRNA; a subunidade menor do


ribossoma desliza ao longo da molécula de mRNA até encontrar o codão de iniciação (AUG); o
tRNA que transporta o aminoácido metionina liga-se por complementaridade ao codão de
iniciação; As subunidades menor e maior ligam-se.

5.6 A molécula de ADN é formada por duas cadeias de nucleótidos que se encontram ligadas lado-
a-lado, mas que crescem em sentidos opostos, pelo que se designam anti-paralelas.

6.1. Clonagem

6.2 C

6.3 Porque não houve mistura de informação genética. O único dador de informação foi o girino do
sapo albino, logo é reprodução assexuada – clonagem.

6.4 Uma célula totipotente tem as potencialidades para originar todas as outras células. Células
indiferenciadas são semelhantes entre si e semelhantes à célula totipotente inicial que lhes deu
origem.

24
Ana Mafalda Torres
Biologia UFCD 1 – Renovação Celular

7. BIBLIOGRAFIA RECOMENDADA

Manuais escolares

 Biologia 10/11º ano; Areal Editores


Matias, Osório e outros (2007); Biologia – 10º/11º; Areal Editores; Porto, Lisboa
 Terra, Universo de Vida – 11º ano; Porto Editora
Silva, Amparo Dias e outros (2004); Terra, Universo de Vida – 11º ano; Porto Editora; Porto
 Biologia – 11º ano; Areal Editores
Matias, Osório e outros (2004); Biologia – 11º; Areal Editores; Porto, Lisboa
 Biologia – ensino profissional – Porto Editora
Soares, Rosa e outros (2007); Biologia – ensino profissional – nível 3; Porto Editora; Porto

25
Ana Mafalda Torres

Você também pode gostar