Você está na página 1de 87

1

UNIVERSIDADE FEDERAL DO RIO GRANDE DO NORTE

CENTRO DE BIOCIÊNCIAS

PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS BIOLÓGICAS

CURSO DE MESTRADO

JAYRA JULIANA PAIVA ALVES ABRANTES

AVALIAÇÃO DO PERFIL DA RESPOSTA IMUNE PRESENTE NA MUCOSA


DA CÉRVICE UTERINA DE MULHERES INFECTADAS PELO HPV

NATAL/ RN

2016
2

JAYRA JULIANA PAIVA ALVES ABRANTES

AVALIAÇÃO DO PERFIL DA RESPOSTA IMUNE PRESENTE NA MUCOSA


DA CÉRVICE UTERINA DE MULHERES INFECTADAS PELO HPV

Dissertação de mestrado apresentada ao


Programa de Pós-graduação em Ciências
Biológicas do Centro de Biociências, da
Universidade Federal do Rio Grande do
Norte, como parte dos requisitos para
obtenção do título de Mestre em Ciências
Biológicas.

Orientador: Professor Dr. José Veríssimo


Fernandes

NATAL/RN

2016
3
4

Universidade Federal do Rio Grande do Norte

PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS BIOLÓGICAS

ATA Nº 123

Aos 22 (vinte e dois) dias do mês de março de 2016 (dois mil e dezesseis), às
15:30 (quinze e trinta horas), no Anfiteatro das Aves do Centro de Biociências da
Universidade Federal do Rio Grande do Norte, reuniu-se em sessão pública a banca
examinadora responsável pela avaliação da dissertação de mestrado intitulada:
AVALIAÇÃO DO PERFIL DA RESPOSTA IMUNE PRESENTE NA MUCOSA DA
CÉRVICE UTERINA DE MULHERES INFECTADAS PELO HPV, da mestranda Jayra
Juliana Paiva Alves Abrantes. A banca examinadora foi composta pelos professores
doutores José Veríssimo Fernandes (presidente/orientador), Thales Allyrio Araújo de
Medeiros Fernandes (membro convidado externo à instituição), e Josélio Maria Galvão
de Araújo (membro convidado interno à instituição). Após a apresentação formal do
trabalho à banca examinadora e ao público presente, procedeu-se a arguição. Em
seguida, a banca examinadora reuniu-se em sessão secreta, decidindo que a candidata
foi considerada APROVADA. Nada mais havendo a tratar, foi lavrada a presente ata,
assinada pelos membros da banca examinadora e pela mestranda. Natal-RN, 22 de
março de 2016.

Dr. THALES ALLYRIO ARAUJO DE MEDEIROS FERNANDES, UERN

Examinador Externo à Instituição

Dr. JOSELIO MARIA GALVAO DE ARAUJO, UFRN

Examinador Externo ao Programa

Dr. JOSE VERISSIMO FERNANDES, UFRN

Presidente JAYRA JULIANA PAIVA ALVES

Mestrando
5

AGRADECIMENTOS

A Deus, por ter me guiado durante essa longa jornada e por mostrar uma
solução diante de todas as dificuldades;

Aos meus familiares, que sempre me apoiaram em todas as minhas decisões,


desejando sempre o melhor pra mim e me incentivando em todos os momentos; em
especial minha mãe, que apesar de estar distante fisicamente, esteve presente em
todos os momentos dessa caminhada, sempre orando pra Deus iluminar meus
caminhos;

Ao meu esposo e grande companheiro, Gerlailson Abrantes, por ter aturado


todos os meus estresses diários, me compreendendo e incentivando a buscar o melhor
de mim;

Ao meu Orientador, Prof. Dr José Veríssimo Fernandes, pelo excelente


profissional e dedicação prestada, por ter aceitado me orientar e acreditado na minha
capacidade para realizar esse trabalho. Muito obrigada!

Aos Professores, Paulo Marcos da Matta Guedes e Josélio Maria Galvão de


Araújo, que foram pessoas de suma importância para a concretização desse trabalho,
auxiliando em diversos aspectos e mesmo diante de inúmeros compromissos e falta de
tempo, estiveram sempre dispostos a ajudar e esclarecer eventuais dúvidas;

Ao Professor Thales Allyrio Medeiros de Araújo Fernandes, pela pessoa


maravilhosa, pela amizade e por sempre está disposto a me ajudar em todos os
momentos;

A equipe do LADIC (Laboratório de Doenças Infecciosas e do Câncer), alunos e


professores, que me acolheram e compartilharam comigo bons momentos. Em
especial, aos alunos que fizeram e fazem parte da nossa equipe de trabalho: Érika,
Daniel, Raíza, Camila Nobre, Kamila Araújo e Anne, responsáveis também pelo
sucesso desse trabalho. E a aluna, já mestre, Janete, (Laboratório), uma pessoa
incrível, que me auxiliou em diversos aspectos, sempre disposta a ajudar;

A secretaria de Pós Graduação em Ciências Biológicas, em especial a Louíse da


Matta, por resolver todos os problemas burocráticos de forma atenciosa e prestativa.

Aos colegas de Mestrado, por momentos ótimos vividos de estudos,


companheirismo e palavras de incentivo.
6

RESUMO

A infecção genital pelo vírus do papiloma humano (HPV) é uma das causas mais
frequentes de doenças sexualmente transmissíveis, em ambos os sexos, com maior
prevalência da infecção entre mulheres jovens, com vida sexualmente ativa,
constituindo-se em um grave problema de saúde pública. A infecção persistente por
HPVs de alto risco, em conjunto com eventos adicionais desencadeados pela
exposição a fatores físicos, químicos e ambientais, disfunção do sitema imune podem
favorecer o desenvolvimento de lesões pré-malignas e malignas da cérvice uterina. O
objetivo deste estudo foi estimar a prevalência do HPV e avaliar o perfil da resposta
imune em mulheres infectadas pelo HPV, por meio dos níveis de expressão de
citocinas, TLR9 e Myd88, e correlacioná-las com a presença ou não de lesões. Foram
incluídas no estudo, mulheres com idade entre 16 e 85 anos, média de 36,2 anos,
desvio padrão de 11.26. Do total de 225 mulheres, 126 foram recrutadas entre as
atendidas pelo programa de rastreio do câncer de colo do útero e 99 que foram
encaminhadas à Maternidade Januário Cicco com suspeita de lesão da cérvice uterina.
As pacientes que concordaram participar do estudo passaram por entrevista para
obtenção de dados sócio-demográficos, seguida de exame clínico e coletas de dois
espécimes de raspado cervical, um para análise citológica e outra para analise
molecular destinado a detecção do HPV. Nas mulheres com suspeita de lesão foi
realizada a colposcopia para detecção de possíveis alterações, e coletados dois
fragmentos de tecido por biópsia, um para análise histopatológica, e outro para
obtenção de ácidos nucleicos, destinado à detecção do HPV por PCR convencional e a
análise da expressão de citocinas, TLR9 e MyD88 por PCR em tempo real. A
prevalência global do HPV foi de 39,5%, sendo 18,8% em pacientes sem lesões, e
61,1% em mulheres com lesões na cérvice uterina. As mulheres com múltiplos
parceiros apresentaram maiores riscos de infecção pelo HPV, enquanto que as que
tiveram duas ou mais gestações tiveram um fator protetor. Observou-se correlação
entre alterações cervicais e a infecção pelo HPV. Os níveis de expressão de RNA-m
das citocinas pró-inflamatórias INF-γ, TNF-α, IL-17 e anti-inflamatória IL-10 de
pacientes infectados pelo HPV, tiveram seus níveis de expressão mais alto no grupo
com lesão em comparação ao sem lesão, em relação ao controle. É possível que, o
aumento na expressão das citocinas, principalmente IL-10 e IL-17, esteja associado a
um processo inflamatório de natureza crônica presente nas lesões e pode estar
relacionadas ao favorecimento da persistência viral e provável progressão para lesões
malignas.

Palavras chaves: HPV. Citocinas. Imunidade. Doença do colo do útero.


7

ABSTRACT

Genital human papillomavirus (HPV) infection is one of the most common causes of
sexually transmitted diseases in both genders, with a higher infection prevalence among
young women sexually active, consisting in a serious public health problem. The
persistent high-risk HPV infection with epigenetic events triggered by exposure to
physical, chemical, environmental, beyond the dysfunction of the immune system, can
favor the development of premalignant and malignant lesions of the uterine cervix. The
objective of this study was estimate the HPV prevalence and evaluate the profile of the
immune response in women, with and without cervical lesions associated with it; through
the expression levels of cytokines, TLR9 and Myd88 in the uterine mucosa, establishing
a correlation with the presence or absence of lesions and HPV. The study included
women aged between 16 and 85 years, with an average of 36,2 years and standard
deviation of 11.26. A total of 225 women participated of this study, 126 were recruited
among women attending the screening program for cervical cancer and the other 99
were sent to maternity Januário Cicco with a suspected uterine cervix injury. Patients
who agreed to participate, were submitted to an interview to obtain socio-demographic
data, followed by clinical examination and collection of two cervical scrape specimens,
one for cytological analysis and another for molecular analysis in order to detect HPV.
Colposcopy was performed in women who had suspected injury to detect these possible
changes. It was collected two fragments of tissue in each biopsy, one for
histopathological analysis and other to obtain nucleic acid, destined to detection of HPV
by conventional PCR and, analysis of receptors and cytokines expression involved in
the immune response by real-time PCR. The overall HPV prevalence was 39.5%, 61,1%
in patients with lesions and 18,8% % in patients without lesions. Women with multiple
partners, and those who had two or more pregnancies had higher risk of HPV infection.
There was a correlation between cervical changes and HPV infection. The RNA-m
expression levels of The pro-inflammatory cytokines INF-γ, TNF-α, IL-17 and the anti-
inflammatory IL-10 showed higher expression levels in the positive HPV injury group
compared to uninjured, compared to control. It is possible that the increased expression
of cytokines, especially IL-10 and IL-17 is associated with a chronic inflammatory
process present in the lesions and can be related to favor viral persistence and likely to
progress to malignant lesions.

Keywords: HPV, cytokines. Immunity. Uterine cervical disease.


8

LISTA DE FIGURAS

Páginas

Figura 1. Estrutura do HPV.............................................................................................21

Figura 2. Representação esquemática do genoma do HPV...........................................22

Figura 3. Mecanismos utilizados pelo HPV para evadir da resposta Imune...................37

Figura 4. Diferença na Expressão de RNAm de TLR-9 (A) e Myd88 (B) em amostras da


cérvice uterina de mulheres com e sem lesões infectadas pelo
HPV.................................................................................................................................56

Figura 5. Diferença na Expressão de RNAm de IFN-γ (A), TNF-α (B), IL-10 (C), IL-17
(D), em amostras da cérvice uterina de mulheres com e sem lesões infectadas pelo
HPV.................................................................................................................................58
9

LISTA DE TABELAS

Páginas

Tabela 1. Categorização dos grupos para análise da resposta imune...........................45

Tabela 2. Sequência dos primers utilizados no estudo...................................................47

Tabela 3. Perfil sócio demográfico das mulheres participantes do estudo.....................50

Tabela 4. Resultados dos exames citomorfológicos e histopatológico e a presença de


HPV.................................................................................................................................52

Tabela 5. Comparação das taxas de prevalência do HPV em alterações detectadas


pelos exames: citológico, colposcópico e histopatológico...............................................52

Tabela 6. Comparação entre a prevalência de infecção pelo HPV em amostras


coletadas por meio de células descamadas e biópsia de tecido da cérvice
uterina..............................................................................................................................53

Tabela 7. Prevalência da infecção genital pelo HPV de acordo com as características


sóciodemográficas e fatores de risco para doenças sexualmente
transmissíveis..................................................................................................................54
10

ABREVIATURAS, SIGLAS E SIMBOLOS

APC- Célula Apresentadora de antígeno

β-actina- beta actina (Proteína do citoesqueleto)

β-globina- beta globina (Proteína do citoesqueleto)

CD1d- membro da família do CD (Cluster de diferenciação)-1d

CDC- Centers for Disease Control and Prevention

CT- Limiar do ciclo ou Thresohld Cycle

CTL- Linfótico T citotóxico

CD- Célula dendrítica

CCU – Câncer do Colo do Útero

DNA – Ácido Desoxirribonucleico

DST - doenças sexualmente transmissíveis

cDNA- DNA complementar

E1- Proteína precoce E1 do HPV

E2- Proteína precoce E2 do HPV

E4- Proteína precoce E4 do HPV

E5- Proteína precoce E5 do HPV

E6- Proteína precoce E6 do HPV

E7- Proteína precoce E7 do HPV

HPV – Papilomavírus Humano

HSV-2- Herpes Vírus Simples tipo 2

HSIL - Lesões Intraepiteliais Escamosas de Alto Grau


11

Hu- Human

IC- Intervalo de Confiança

IFN- Interferon

IFN-α- Interferon alfa

IFN-β- Interferon beta

IFN- γ- Interferon gama

IFN-k- Interferon kappa

INCA- Instituto Nacional do Câncer

IgA- Imunoglobulina A

IgG- Imunoglobulina G

IL-10- Interleucina 10

IL-17- Interleucina 17

LC- Células de Langerhans

LCR - Região Longa de Controle do genoma do HPV

LSIL - Lesões Intraepiteliais Escamosas de Baixo Grau

L1- Proteína tardia L1 do HPV

L2- Proteína tardia L2 do HPV

MHC- Complexo Principal de histocompatibilidade

Min- Minutos

N- Número amostral

NIC – Neoplasia Intraepitelial Cervical


12

NK- Células ‘Natural Killers’

p- Nível de significância

pb- Pares de bases

PCR- Reação em Cadeia da Polimerase

pRb- Proteína supressora de tumor pRb

PRR- Receptores de Reconhecimento Padrão

P53- Proteína supressora de tumor P53

RC- Razão de chance

RN- Rio Grande do Norte

RNA- Ácido ribonucleico

RNA-m- RNA mensageiro

STIs - infecção sexualmente transmissíveis

START-1- Fator de transcrição membro da família START 1

START-3- Fator de transcrição membro da família START 3

TBE- Tris-borato de EDTA

TCD4+-Linfócitos T CD4+

TCD8+-Linfócitos T CD8+

Th1- Resposta imunológica do tipo Th1

Th2- Resposta imunológica do tipo Th2

Th17- Resposta imunológica do tipo Th17

TGF-β- Fator de transformação do crescimento


13

TLR- Receptores semelhantes a Toll

TLR-9- Receptores semelhantes a Toll-9

TNF-α- Fator de necrose tumoral alfa

Treg- Resposta imunológica do tipo T regulatória

Tyk2- Proteína Tirosina quinase sem receptor-2

URR- Região reguladora não codificante


14

SUMÁRIO
Páginas
1. INTRODUÇÃO .................................................................................................. 15
1.1. Propriedades biológicas do HPV .................................................................... 20
1.1.1. Estrutura da partícula viral ........................................................................... 20
1.2. Patogênese .................................................................................................... 25
1.2.1. Persistência viral e eliminação .................................................................... 25
1.3. Resposta imune ao HPV ................................................................................ 27
1.3.1. Mucosa da cérvice uterina e resposta imune Inata ..................................... 27
1.3.2. Imunidade específica................................................................................... 29
1.3.3. Evasão imune do HPV ................................................................................ 32
2. OBJETIVOS ...................................................................................................... 39
2.1. Objetivo Geral ................................................................................................ 39
2.2. Objetivos Específicos ..................................................................................... 39
3. DELINEAMENTOEXPERIMENTAL....................................................................40
4. METODOLOGIA.................................................................................. ..............41
4.1. Local do Estudo e obtenção das amostras..................................................... 41
4.2. Exames e procedimentos ............................................................................... 42
4.2.1.Papanicolaou ................................................................................................ 42
4.2.2.Colposcopia.................................................................................................. 42
4.2.3.Exame Histopatológico ................................................................................. 43
4.3. Processamento para extração de ácidos nucleicos ....................................... 43
4.3.1. Amostras obtidas por raspado cervical........................................................ 43
4.3.2. Fragmentos de tecidos obtidos por biópsia ................................................. 44
4.3.3. Reação em Cadeia da Polimerase – PCR .................................................. 44
4.4.Quantificação de citocinas e fatores transcricionais ........................................ 45
4.4.1.Análise da Expressão de Citocinas .............................................................. 45
4.5. Análise Estatística .......................................................................................... 48
5. RESULTADOS .................................................................................................. 49
6. DISCUSSÃO ..................................................................................................... 59
7. CONCLUSÕES ................................................................................................. 69
8. REFERÊNCIAS.... ............................................................................................. 70
9. ANEXO ..............................................................................................................80
15

1. INTRODUÇÃO

A cada ano, cerca de 19 milhões de novos casos de infecção sexualmente


transmissíveis (STIs) acometem jovens com idade entre 19-24 anos. O vírus do
papiloma humano (HPV), juntamente com a Chlamydya trachomatis e Trichomonas
vaginalis, destacam-se entre os principais agentes causadores dessas infecções, sendo
responsáveis por mais de 80% de todos os casos de STI em adolescentes e jovens
adultos, sendo a maioria deles, assintomáticos (WEINSTOCK; BERMAN; CATES, 2004;
MALHOTRA, 2008) A infecção genital pelo HPV é considerada uma das causas mais
frequentes de doenças sexualmente transmissíveis (DST) ao redor do mundo, podendo
eventualmente afetar ambos os sexos masculino e feminino (De SANJOSÉ et al.,
2007), ocorrendo especialmente entre as mulheres mais jovens (RAMA et al., 2008;
FERNANDES et al., 2009; PAESI et al. 2009), resultando em um grave problema de
saúde pública, principalmente nos países em desenvolvimento (VINODHINI;
SHANMUGHAPRIYA; NATARAJASEENIVASAN, 2012).
Estudos mostram que a prevalência mundial dessa infecção pode ocilar entre 2-
44% em mulhers assintomáticas dependendo da população estudada, da localização
geográfica, e das diferentes técnicas moleculares utilizadas para a detecção do DNA do
vírus (TROTTIER; FRANCO 2006). As maiores taxas de prevalência da infecção pelo
HPV ocorrem em mulheres jovens, com vida sexualmente ativa, especialmente aquelas
das regiões menos desenvolvidas, que estão constantemente expostos e podem
adquirir a infecção em alguma fase da sua vida por algum dos genotipos do vírus.
Entretanto, essa taxa de prevalência tende a diminuir com o aumento da idade,
provavelmente explicado pela redução da atividade sexual e pelo desenvolvimento de
uma resposta imune contra o vírus (FERNANDES et al., 2013; CASTLE, 2005; CHAN,
2010). Segundo BROOMALL ; REYNOLDS; JACOBSON, 2010, aproximadamente 80%
das mulheres sexualmente ativas serão contaminadas com algum tipo de HPV até os
50 anos de idade.
Recentemente, tem sido amplamente discutida a correlação direta entre
infecção, por certos patógenos, inflamação e câncer. A importância da inflamação no
processo de carcinogênese vem sendo evidenciado pela infiltração de células
inflamatórias nos tumores o que desencadeia uma complexa interação entre células do
16

sistema imune e células cancerosas, ativando mecanismos críticos nas diferentes fases
da formação dos tumores (FRANCESCONE et al., 2014; FERNANDES et al., 2015;
HATTORI; USHIJIMA; TOSHIKAZU, 20016).
De acordo com a última estimativa mundial feita através de um estudo de análise
sistemática global realizado por Ferlay et al., 2013, o câncer de colo do útero (CCU) é o
segundo mais frequente tipo de câncer que acomete as mulheres em todo o mundo,
excluindo-se o câncer de pele não melanoma. Estima-se que a incidência mundial
dessa neoplasia maligna seja de cerca de 500 mil novos casos por ano, a maioria deles
diagnosticada nos países em desenvolvimento (CASTELLSAGUÉ, 2008; FERLAY et
al., 2013). Com taxas de incidência que variam de 10 a 40 casos novos por 100 mil
mulheres a cada ano o CCU, representa a terceira causa de morte por câncer entre as
mulheres, apresentando taxa de sobrevida de cerca de 70%. (FERLAY et al., 2013;
TORRE et al., 2015).
No Brasil, estimativa do Instituto Nacional do Câncer (INCA) indica que no ano
de 2014 foram notificados cerca de 15.590 casos novos de CCU, o que representa uma
taxa de incidência estimada de 15,5 casos por 100 mil mulheres. Para a região
Nordeste a taxa de incidência estimada foi de 18,8 e para o Rio Grande do Norte de
15,8 por 100 mil mulheres. Em geral, a ocorrência do CCU tem início a partir dos 30
anos de idade, aumentando o seu risco rapidamente, até atingir o pico de incidência na
faixa etária dos 50 aos 60 anos. O tipo histológico mais comum é carcinoma de células
escamosas, representando de 85 a 90% dos casos da doença, seguido do
adenocarcinoma (INCA, 2014).
A história natural do CCU revela que, a despeito de sua alta incidência, esta
neoplasia se destaca entre aquelas com maior potencial de prevenção e cura. Isto se
deve a sua natureza infecciosa, o que permite tanto a prevenção primária através da
vacinação contra o HPV, como a secundária por meio dos programas de rastreio. Além
disso, a evolução lenta, passando por vários estágios de lesões intraepiteliais pré-
cancerosas, possibilita o diagnóstico e tratamento precoce, antes que estas lesões
progridam para a forma invasiva (STEENBERGEN et al., 2005; KYRGIOU et al., 2010).
Atualmente é inequivocamente estabelecido que a infecção persistente por
certos genotipos de HPV é causa necessária do câncer de colo do útero (CCU)
17

(BOSCH; MUNOZ, 2002). Contudo, a infecção por si só não é um motivo suficiente para
transformação neoplásica da célula infectada, a menos que seja acompanhada de
eventos adicionais, tais como deficiência da resposta imune, carências nutricionais e
características genéticas do hospedeiro, fatores físicos químicos e ambientais incluindo
as infeções por outros agentes infecciosos tais como Chlamydia trachomatis (CT) e
herpes simplex vírus tipo 2 (HSV-2), (TROTTIER, FRANCO, 2005; MANAV et al, 2008;
MUÑOZ et al., 2006; GRODZKI, et al., 2006; CASTELLSAGUÉ, 2008).
Uma grande parcela dos indivíduos que adquire a infecção pelo HPV já na
adolescência, logo após o início da atividade sexual (SCHIFFMAN et al., 2007; SMITH,
et al., 2008). Na maioria dos casos a infecção ocorre na forma assintomática, sem a
presença de lesão, ou apresenta lesões de baixo grau que, na maioria das vezes
evoluem para cura espontânea no período de até 24 meses (RICHARDSON et al.,
2003; CASTELLSAGUÉ, 2008; FERNANDES et al., 2013). Entretanto, em uma parcela
significativa das mulheres as lesões desaparecem, mas o vírus permanece latente nas
células da camada basal do epitélio da cérvice uterina, sem se replicar por tempo
indeterminado, o que caracteriza a infecção persistente. Em algum momento,
dependendo de fatores físico, químicos, genéticos, ambientais e do próprio hospedeiro,
especialmente o estado imune, o vírus pode ser reativado voltando à forma de infecção
produtiva, resultando no desenvolvimento de lesões que podem evoluir para o câncer
de colo do útero (MUÑOZ et al., 2006; FERNANDES et al., 2013).
De acordo com estudo de metanálise realizado por Burchell, 2006, a
prevalência global do HPV em mulheres com citologia normal foi em média e 10,41%,
apresentando considerável variação, dependendo da região estudada. E avaliando
cada região separadamente, a África apresentou prevalência de 22,12, América
12,95%, Europa com 8,08% e Ásia com 7,95%. A América do Sul apresentou uma
prevalência média de 13,2%, sendo que no Brasil a taxa de prevalência encontrada foi
de 14,1%. Em estudo realizado em Natal por Fernandes et al., 2009 foi encontrado uma
taxa de prevalência de 24,5% do HPV em mulheres com citologia normal. Essas
diferenças nas taxas prevalências encontradas em diferentes estudos podem ser
explicadas por fatores tais como método de detecção utilizado, características étnicas e
culturais, comportamento sexual, crença religiosa, e outros fatores que vaiam nas
18

diferentes regiões geográficas do mundo e até mesmo dentro de um mesmo país (De
SANJOSÉ et al., 2007; BALOCH et al., 2016). Entretanto, as taxas de prevalência são
maiores em mulheres com patologia cervical aumentando proporcionalmente com a
gravidade da lesão, atingindo cerca de 90% nas mulheres com lesões intraepiteliais de
alto grau e praticamente 100% naquelas com câncer invasivo (FORMAN et al., 2012).
Os HPVs abrange um grupo com mais de uma centena de genotipos de vírus
epiteliotrópicos com genoma de DNA de fita dupla circular, protegido por um capsídeo
com simetria icosaédrica, sem a presença de envelope. Com base em suas
características filogenéticas, patológicas e na sequência de nucleotídeo do gene L1, ele
são classificados na família Papillomaviridae que abrange cinco gêneros, designados
pelas letras do alfabeto grego alfa, beta, gama, Mu e Nu, os quais são subdivididos em
vários ramos ou grupo “espécies” (De VILLIERS et al., 2004; BERNARD et al., 2010).
Dos cerca de 150 genotipos de HPV que já foram catalogados aproximadamente 40,
infectam o trato genital e outras mucosas do corpo humano, sendo também
classificados em dois grupos, de acordo com o seu potencial oncogênico (MUÑOZ et
al., 2003). Entre os HPVs de baixo risco ou de baixo potencial oncogênico está os HPV
6, 7, 11, 13, 30, 32, 40, 42, 44, 54, 55 e 74 que causam lesões hiperproliferativas
benignas, conhecidas como verrugas anogenitais e, normalmente, não estão
associados com câncer. Os HPVs de alto risco ou de alto potencial oncogênico entre
estes: HPV 16, 18, 26, 30, 31, 33, 34, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 67, 68, 69,
70, 73, 82 que são associados com o câncer (SCHIFFMAN et al., 2010). Os HPVs de
alto risco são considerados causa necessária de virtualmente todos os casos de câncer
de colo do útero, e em menor proporção dos cânceres de outras áreas do trato
anogenital humano, tais como: vulva, vagina, ânus e pênis, além de cânceres em áreas
extragenitais, como cabeça, pescoço, cavidade oral e esôfago (SCHIFFMAN et al.,
2007; CASTELLSAGUÉ, 2008; STANLEY, 2010).
O gênero Alphapapillomavirus abrange três ramos principais, os quais todos
possuem potencial oncogênico e estão reunidos em um único grupo chamado de HPVs
de alto risco, composto por cinco grupos “espécie”: α-5, α-6, α-7, α-9 e α-11. Embora
esses cinco grupos “espécies” pertençam ao mesmo grupo, dos HPVs de alto risco,
existem diferenças entre eles em relação ao potencial oncogênico. Assim, o grupo
19

“espécie” α-9 destaca-se como o mais importante uma vez que nele se encontra o HPV
16 que é o genotipo com maior potencial oncogênico, além de incluir vários outros
genotipos de alto risco relacionados ao HPV 16, entre eles o HPV 58 (SCHIFFM et al.,
2010).
Atualmente existem hoje mais de 150 tipos diferentes de HPVs catalogados,
alguns deles estão associados à infecção do epitelio de revestimento da superfície
queratinizada da pele, por isso são classificados no grupo pele; outros infectam as
mucosas da boca, garganta, trato respiratório, e especialmente o do trato anogenital,
sendo classificados no grupo HPVs genitais ou da mucosa (MUÑOZ et al., 2003). A
infecção desses sítios anatômicos por HPVs de baixo potencial oncogênico ou de baixo
risco, causa proliferação das células epiteliais resultando na formação de verrugas
comuns, quando ocorre na supaerfície queratinizada da pele e em verrugas anogenitais
ou condiloma acuminado, quando ocorre trato anogenital. A maioria das infecções
causadas pelo HPV é de natureza transitória de maneira que, mesmo quando causadas
por genotipos considerados de alto risco, em grande parte dos indivíduos a infecção
regride espontaneamente para cura, com a eliminação do vírus do organismo sem
desenvolver qualquer manifestação clínica (BOSCH; DE SANJOSÉ; CASTELLSAGUÉ,
2008; MISTRY; WIBOM; EVANDER, 2008; FERNANDES, FERNANDES, 2012).
Estudos clínicos e epidemiológicos têm demonstrado que o principal fator de
risco para o CCU, é a infecção persistente por HPVs dos tipos oncogênicos, como os
HPV 16 e 18, considerados os mais comuns, sendo juntos, responsáveis por cerca de
70% de todos os casos da doença (BOSCH; DE SANJOSÉ; CASTELLSAGUÉ, 2008). A
integração do genoma viral aos cromossomos da célula hospedeira pode aumentar o
risco de transformação neoplásica, uma vez que pode provocar rearranjos genéticos,
inversões, translocações cromossômicas, deleções, conversão de protoncogene e
oncogene, gerar tipos de instabilidades genômicas, levando à perda de
heterozigosidade (ADEFUYE; SALES, 2012; AKAGI et al., 2014).
Segundo o CDC, 2004, Mulheres que apresentam testes positivos para DNA de
HPVs oncogênicos, têm quatro vezes mais chance de desenvolverem lesões
intraepiteliais escamosas de baixo grau (LSIL) e 13 vezes mais chances de
desenvolverem lesões intraepiteliais escamosas de alto grau (HSIL), que são
20

precursoras do CCU. Quando considerados apenas os três últimos testes para HPV (ao
longo de 3 anos), sendo todos positivos para tipos de alto risco, o risco de
desenvolverem CCU é 14 vezes maior quando comparadas às mulheres que
apresentam resultados negativos. Todavia, alguns dados mostram que, 60% das LSIL
regridem espontaneamente e raramente progridem ao câncer, enquanto o índice de
eliminação das HSIL diminui para 30% a 40%, e apenas cerca de 10% a 20%
progridem a carcinoma invasor.
Tanto a imunidade inata quanto à adaptativa têm importância na proteção contra
o HPV, sendo a expressão de receptores da resposta imune inata de reconhecimento a
patógenos, e a produção de citocinas e os mecanismos gerados por estímulos
específicos decorrente de infecção e inflamação na cérvice uterina (HASAN et al., 2007;
MACHADO et al., 2004). No entanto, após infectar a célula o HPV utiliza-se de uma
variedade de mecanismos para evitar a ativação da resposta imune do hospedeiro,
gerando dessa forma uma imunidade deficiente (DURAY et al., 2014; AMADOR-
MOLINA, et al., 2013).
Dessa forma, a infecção persistente e a integração do DNA viral no genoma do
hospedeiro são causas necessárias para o desenvolvimento do CCU. E essa infecção
persistente na maioria das vezes é assintomática e também implica tolerância
imunológica (LEPIQUE; RABACHINI; VILLA, 2009).

1.1. Propriedades biológicas do HPV


1.1.1. Estrutura da partícula viral

O Papilomavírus Humano é considerado um vírus de tamanho pequeno, com


diâmetro entre 50 a 60nm, constituído por genoma de DNA de dupla fita circular
associado a proteínas semelhantes a histonas, contendo cerca de 8.000 pb, contendo
oito sequências abertas de leitura, com todos os genes localizados na mesma fita de
DNA. O genoma é dividido em três regiões específicas de acordo com a sua
funcionalidade: a primeira é uma região conhecida como long control region (LCR) ou
upper regulatory region (URR), que é uma região regulatória, não codificadora, que
21

apresenta 400 a 1.000 pares de bases, situada entre os genes L1 e E6. A segunda
região precoce (E) do inglês early, onde estão localizados os genes E1, E2, E4, E5, E6
e E7 iniciadores da transcrição e regulação da replicação e persistência viral. E a ultima
é a região tardia L (late), que codifica as proteínas do capsídeo viral L1 e L2 (TYRING,
2000, FEHRMANN; LAIMINS, 2003; JO; KIM, 2005).
O genoma viral encontra-se envolvido por um capsídeo com simetria icosaédrica,
formado por duas proteínas estruturais L1 e L2. A proteína L1 é o constituinte principal
do capsídeo viral e é composta por cinco unidades monoméricas de 55 kDa que se
juntam para formar uma estrutura pentamérica, denominado capsômeros. Cada
capsídeo contem 72 unidades pentaméricas, associadas a um número varável da
proteína L2 que envolve e protege o genoma viral, formando uma partícula com cerca
de 55 nm (SAPP et al., 1995, ZUR HAUSEN, 2009).

Figura 1. Estrutura do HPV. Mostrando a forma como o DNA genômico e as histonas se agrupam
e a localização das proteínas do capsídeo L1 e L2.

Fonte: (Adaptado de Swiss Institute of Bioinformatics, Viral Zone – Disponível em


http://viralzone.expasy.org/all_by_species/5.html).

Os genes E1 e E2 têm a função na codificação de proteínas essenciais para a


replicação do DNA viral e no controle da transcrição gênica do vírus. Ambas atuam na
22

fase inicial da amplificação, E2 interage com E1 estimulando replicação do DNA viral,


mas durante a manutenção da replicação, quando o DNA está na forma epissomal,
pode ser considerada dispensável, quando ocorre estabilização do número de cópias
(KADAJA et al. 2009; FERNANDES; FERNANDES, 2012). Além disso, E1 é uma das
proteínas mais conservadas entre os diferentes tipos de HPV (DENG et al. 2004).
A proteína E4 regula a expressão dos genes tardios L1 e L2 e tem um papel
importante na alteração da matriz intracelular, maturação e liberação das novas
partículas virais, contribuindo junto com a proteína E5 no sucesso da amplificação do
genoma, na modificação do ambiente intracelular (FERNANDES; FERNANDES, 2012).
Adicionalmente, E5 está associada com a fusão de células gerando aneuploidia e com
redução da expressão do MHC de classe I. Além disso, aprimora a atividade de
transformante das proteínas E6 e E7, contribuindo desta forma para a atividade
carcinogênica dos HPVs de alto risco (MOODY; LAIMINS, 2010; FERNANDES;
FERNANDES, 2012).
As proteínas E6 e E7 são as mais importantes relacionadas com a amplificação
do genoma viral, interagindo com as proteínas celulares supressoras de tumor, p53 e
pRB, levando ao descontrole do ciclo celular com perda dos mecanismos de reparo ao
DNA, acúmulo de mutações e consequentemente instabilidade genômica. Além do
mais, inibem apoptose, induzem proliferação, imortalização celular e transformação
neoplásica de células infectadas com HPV de alto risco. E6 também interage com
proteínas da resposta imune inata e ativa a expressão contínua de telomerase
impedindo o envelhecimento das células, resultando em imortalização. E7 também
induz tolerância periférica dos linfócitos T citotóxicos e contribui para evasão de
resposta imune por regular negativamente a expressão de TLR9 e, consequentemente
a produção de interferons do tipo 1 (MÜNGER; PETER M; HOWLEY, 2002; JO; KIM,
2005; MOODY; LAIMINS, 2010; FERNANDES; FERNANDES, 2012) .
As regiões tardias L1 e L2 codificam as proteínas virais dos capsídeos durante
os últimos estágios da replicação dos vírus (MUÑOZ, 2006; SCHEURER;
TORTOLERO-LUNA; ADLER-STORTHZ, 2013).
23

Figura 2. Representação esquemática do genoma do HPV, mostrando o arranjo dos genes precoses E
ou genes não estruturais, dos genes do capsídeo (L1 e L2) e da região não codificante URR.

Fonte: (adaptado de MUÑOZ et al. 2006).

A expressão de genes virais ocorre a partir de uma única fita de DNA de fita
dupla, que servirá como fita molde e irá codificar um número de transcritos de mRNA
policistrônicos (STANLEY; PETT; COLEMAN, 2007). A regulação da expressão do
gene viral é considerada complexa e é controlada tanto por fatores de transcrição virais
quanto celulares. Na maioria das vezes ocorre dentro da região de LCR, que varia
substancialmente em composição de nucleotídeos entre os tipos de HPV individuais
(ZUR HAUSEN, 1996).
Existem três grupos gerais de genes virais que são reguladas durante a
diferenciação da célula hospedeira: O promotor precoce do vírus, o promotor tardio
dependente da diferenciação, e dois sinais de poliadenilação. Os genes E6 e E7 tem
importância na replicação, e os genes E1, E2, E4, E5, E8 estão envolvidos na
replicação do DNA viral além de atuam no controle transcricional, em adição a outras
funções tardias, enquanto as proteínas que formam o capsídeo L1 e L2, que são os
produtos de genes tardios, são responsáveis para a montagem de partículas virais
(BODILY; LAIMINS, 2011).
24

Dentre os fatores relevantes identificados na transcrição gênica, alguns fatores


quando apresentam disfunção em algum deles, podem desempenhar um papel
importante na carcinogênese do papilomavírus (THIERRY et al., 1992; HAMID;
BROWN; GASTON, 2009). Levando em consideração os tipos de HPVs anogenitais, as
LCRs variam em tamanho entre 800-900 pb, e considerando em outros vírus do
papiloma, sobretudo naqueles encontrados em EV-lesões, elas são um pouco mais
curtas. Dentro do LCR elementos cis-activa regular a transcrição dos genes E6 / E7,
que representam os genes de transformação para a imortalização e para a manutenção
do fenótipo maligno das células do CCU HPV-positivos (JIN; XU, 2015).
Nas infecções por HPVs genitais a regulação e expressão de genes tardios não
são bem compreendidas. No entanto, estudos têm mostrado que o segundo promotor,
ou promotor tardio, é iniciado de forma dependente de diferenciação celular. Ou seja,
Uma vez ativado, o promotor tardio dirige a transcrição para um conjunto heterogêneo
de locais de iniciação e a partir desse momento, servirá para produzir um conjunto de
transcritos que facilitam a tradução de proteínas L1 e L2 (SMITH et al., 2007;
CONWAY, MEYERS, 2009). Dessa forma, quando um promotor tardio é ativado,
acelera o processo de replicação viral e de divisão celular, ocorre aumento da
expressão de genes, que codifica as proteínas estruturais L1 e L2, que se juntam para
montar os capsídios e formar os vírus, consequentemente aumentando o número
células infectadas e o número de cópias do DNA viral por célula (STANLEY; PETT;
COLEMAN, 2007).
Quando o curso da infecção pelo HPV gera lesões do tipo benignas, a replicação
viral é do tipo extracromossomal, ou seja, os vírus infectam o epitélio celular e
permanecem na camada basal das células como estruturas denominadas
extracromossômicas, na qual, tem a capacidade de se replicar durante as etapas de
duplicação dos cromossomos. E o ciclo do vírus não provoca citólise, ou seja, à medida
que as partículas virais são geradas nas camadas mais externas e diferenciadas, o
vírus também são eliminados após morte da célula sem ocorrer o processo de
inflamação (LEPIQUE; RABACHINI; VILLA,, 2009). No entanto, não ocorre o mesmo
nas lesões malignas, em que o DNA viral é integrado aos cromossomos das células do
hospedeiro (RAMIREZ-SALAZAR et al., 2011), e essa inserção do genoma viral no
25

DNA do hospedeiro se dá através da linearização do DNA circular do vírus, na qual


ocorre perda do gene E2, e consequentemente, uma superexpressão dos genes virais,
de forma mais importante os genes E6 e E7, que são responsáveis por estimular a
proliferação e transformação celular (SILVA; AMARAL; CRUZ, 2002).

1.2. Patogênese
1.2.1. Persistência viral e eliminação

O Papilomavirus Humano pode desencadear uma enorme gama de doenças


uma vez que infectam diversos locais do corpo, dentre elas a conjuntiva, a cavidade
oral, superfície queratinizada da pele, e principalmente a mucosa anogenital. Em geral,
infecções epiteliais provocadas pelo HPV culminam em aspectos que variam desde o
aparecimento de pequenas verrugas na região anogenital, até o surgimento do
condiloma acuminado, neoplasias intraepiteliais e o câncer invasivo (PALEFSKY,
HOLLY, 1995). A compreensão da persistência viral, eliminação, e possível latência
causada pela infecção do HPV, ainda são pouco compreendidas (SCHIFFMAN, KJAER,
2003), uma vez que, a grande maioria dos casos de infecção anogenitais pelo vírus
presumivelmente resolve-se naturalmente, sendo os vírus eliminados pelo próprio
sistema imune através de uma resposta mediada por células num período curto de
tempo, que pode variar de 1 a 2 anos, não persistindo, portanto, tempo suficiente para
que a expressão gênica ocorra de forma desregulada e acumule erros genéticos
secundários. No entanto, em cerca de 10% da população essa eliminação não ocorre,
resultando em casos de infecção persistente que poderá levar ao desenvolvimento de
lesões pré-malignas, caracterizadas por alterações citológicas importantes e que podem
evoluir para casos de câncer cervical (STALEY, 2008; SCHIFFMAN; KJAER, 2003; HO
et al, 1998).
Na história natural da infecção pelo HPV, além dos casos de eliminação do vírus
e da persistência viral, que pode ser definida como o espaço longo de tempo em que a
infecção pelo mesmo tipo de HPV (variante) persiste, e pode ser detectado por métodos
sensíveis. Os casos de “eliminação viral” parecem desenvolver uma proteção humoral e
/ou celular de curto prazo, entretanto, apesar do DNA do vírus não ser mais detectado
26

no organismo por métodos sensíveis, a presença do vírus não poderá ser descartado,
uma vez que pequenos focos de células podem manter a infecção com baixo número
de cópias de DNA. Isso acontece devido o processo de eliminação ser precedida pela
ocorrência da latência viral, estado em que o vírus permanece latente no organismo
(DELIGEOROGLOU et al., 2013). A teoria da explicação para a existência de um
estado de latência se baseia através de estudos em pessoas imunossuprimidas,
entretanto não se tem muito conhecimento a respeito da frequência que ocorre a
latência em indivíduos imunocompetentes, quanto tempo pode durar, o motivo para a
ocorrência de um estado redetectável, e quais cânceres surgem após esse período de
latência, sendo considerado um estado comum e geralmente benigno, mesmo em
indivíduos imunossuprimidos (SCHIFFMAN, KJAER, 2003). Entretanto, comparando-se
as infecções pelo HPV em casos que ocorre a eliminação do vírus, com as que ocorrem
persistência, sabe-se que o risco de câncer pode aumentar consideravelmente nos
casos de persistência (JIN; XU, 2015).
Apesar de existirem definições diferentes para os estados do curso natural da
infecção pelo HPV, na prática é muito complicada a classificação e diferenciação entre
eliminação, persistência e Latência da infecção viral. O aumento da ocorrência de
lesões de alto grau e malignas provocadas pelos HPVs de alto risco oncogênico está
diretamente relacionado à instabilidade gerada pela perda da regulação do ciclo
produtivo do HPV e a integração do genoma do vírus ao da célula hospedeira e que são
evidenciados nas infecções persistentes (WENTZENSEN; VINOKUROVA; VON
KNEBEL DOEBERITZ, 2004; DOORBAR, 2005). No processo de infecção natural pelo
HPV acredita-se que ativação de células T seja ineficiente, uma vez que os antígenos
virais do HPV não são apresentados de forma eficaz ao sistema imune, nem podem ser
expressos em níveis detectáveis pelo sistema imunológico, resultando na ignorância
imunológica e / ou a tolerância às células viralmente infectadas (O’BRIEN, CAMPO,
2002)
A ruptura gene E2 durante o processo de integração do genoma viral resulta na
superexpressão dos genes E6 e E7 o que irá provocar uma interrupção do processo de
diferenciação celular e consequentemente não haverá amadurecimento das células
hospedeiras e produção de novas partículas virais (WENTZENSEN; VINOKUROVA;
27

VON KNEBEL DOEBERITZ, 2004; DOORBAR, 2005). Além disso, a capacidade de


interferir no controle do ciclo celular e apoptose por meio dos produtos de seus genes
E6 e E7 estão relacionadas ao potencial oncogênico dos HPVs, onde E6 se ligam à
p53, e irá marca-la para posterior degradação pelo proteassomo, comprometendo
dessa forma a integridade do DNA replicado, instabilidade genômica, imortalização e
proliferação anormal das células transformadas, favorecendo o desenvolvimento do
tumor. Além do mais, a proteína E6 também tem um papel importante na degradação
da proteína pró-apoptótica BAX em queratinócitos humanos, impedindo que haja
apoptose da célula infectada (SINGH; JOHNSON; CHELLAPPAN, 2010).

1.3. Resposta imune ao HPV


1.3.1. Mucosa da cérvice uterina e resposta imune Inata

Nas infecções sexualmente transmissíveis o epitélio de revestimento da vagina e


da cérvice uterina atuam como as primeiras linhas de defesa física e imunológica,
mediadas pela imunidade inata, que age em primeiro plano, mediadas por fagócitos,
proteínas solúveis como citocinas, sistema complemento, e barreiras epiteliais, e a
resposta imune específica ou adaptativa que atua contra os patógenos que causam tais
infecções, através da produção de anticorpos e células efetoras citotóxica (GAGE et al.,
2000; LIMA; ALVES, 2008; STANLEY, 2006). Nesse sentido a mucosa da cérvice
uterina atua como importante mecanismo de resposta imune local a microrganismos
invasores, uma vez que apresenta produção de padrões celulares e perfis de
expressões de citocinas específicos com níveis locais diferenciados dos níveis
sistêmicos. Apesar de estar em uma fração menor do que a local, a resposta imune
sistêmica também possui um importante valor na produção da resposta imune ao
patógeno (LIMBERGER.; OLIVEIRA; CORREA, 2012). Portanto, Em resposta a uma
determinada infecção, tanto a resposta imune inata quanto à adaptativa desenvolvem
um mecanismo de inflamação, para combater o agente agressor (TANG et al., 2013).
Este processo é bastante complexo e estar associado a eventos em cascatas com
participação de mediadores denominados citocinas e quimiocinas, que agem
28

coletivamente na ativação e regulação da resposta inflamatória (IWASAKI et al., 2010;


DELIGEOROGLOU et al.,2013).
As citocinas são moléculas proteicas intercelulares expressas na mucosa vaginal
que apresentam um importante papel nas fases efetoras da imunidade inata e
específica, pois, estão envolvidas na geração e manutenção de uma resposta imune.
Elas são induzidas por estímulos específicos e são responsáveis pela diferenciação dos
vários tipos celulares (MACHADO et al., 2004; ROCK et al., 2010). Tanto as Células
epiteliais, quanto as células dendríticas, os linfócitos, as células NK (natural killer), os
neutrófilos e macrófagos, estão presentes no trato genital, e secretam constitutivamente
e em resposta ao estímulo antigênico, aumentam a secreção de peptídeos
antimicrobianos, citocinas e quimiocinas (WIRA et al., 2005).
Na resposta inata as citocinas são na sua maior parte produzidas por fagócitos
mononucleares, e na imunidade específica, pelos linfócitos T ativados, os quais são
capazes de provocar reações inflamatórias ricas em neutrófilos que servem para conter
e, quando possível, erradicar as infecções microbianas (MACHADO et al., 2004), e as
células NK por sua vez, representam uma barreira importante e um componente-chave
do sistema imune inato, reconhecendo e matando células infectadas por vírus e as
células transformadas através de dois mecanismos: a citotoxicidade dependente de
grânulo; e a via de apoptose em células alvo (AMADOR-MOLINA et al. 2012).
O primeiro alvo para infecção do HPV é o epitélio estratificado escamoso da
mucosa cervical, chamados queratinócitos indiferenciados, que estão localizados nas
camadas basais (DOORBAR, 2006). A resposta inflamatória induzida por essa infecção
nos tecidos leva a infiltração de células do sistema imune como neutrófilos, macrófagos
e posteriormente na resposta imune adaptativa por linfócitos. As células da resposta
imune inata são inespecíficas e detectam e reconhecem a presença dessas moléculas
virais, por meio de estruturas virais, tais como o genoma do HPV (DNA de cadeia dupla)
ou proteínas do capsídeo como a L1e L2. O reconhecimento destas moléculas são
detectadas pelos receptores de reconhecimento padrão do tipo Toll expressos nos
queratinócitos (ROSALES; ROSALES, 2014), representado principalmente pelo Toll 9
(TLR9) que reconhece o DNA de dupla fita do HPV (HASAN et al., 2007). A ativação
direta de NFk-B provocada pela ligação a esse tipo de receptor de reconhecimento de
29

patógenos, resultam na superexpressão de citocinas pró-inflamatórias, e/ou ativação do


genes de resposta interferon tipo 1, incluindo fatores de transcrição que regulam a
produção de citocinas (ANDERSEN; AL-KHAIRY, D; INGALLS, 2006; LEBRE et al.,
2007).
Ao se ligar ao seu receptor, o IFN tipo I irá estimular a transdução de sinal que
aciona a formação do fator estimulada pelo gene de IFN (ISGF)-3 complexo de
transcrição, que vai se ligar ao elemento de resposta estimulada por IFN no núcleo,
resultando na iniciação da transcrição e ativação dos mecanismos pelos quais os IFN
tipo I atuam na destruição de células infectadas, que são baseados na indução genes
celulares que destroem ARNm e inibem a expressão de proteínas virais e algumas
proteínas do hospedeiras e irá aumentar a resistência. Na indução da expressão de
MHC de classe I em células não infectadas, aumentará sua resistência às células NK, e
a susceptibilidade das células infectadas à morte por CTL. E também por meio da
ativação das células NK, que têm o papel te lisar seletivamente as células infectadas
pelo vírus que reduzem a expressão de MHC de classe I (O’BRIEN, CAMPO, 2002).
Estudos têm mostrado que a cérvice uterina atua como um microambiente
imunológico, e sendo assim pode, portanto, ser modificado não só pelo processo
infeccioso causado por patógenos, mas outros fatores também podem alterá-los como:
os níveis de citocinas nos fluidos genitais, a idade, a gravidez, o uso de contraceptivos
orais, e também o uso de antissépticos vaginais infecção por outros patógenos
(STURM-RAMIREZ et al., 2000; PUDNEY; QUAYLE; ANDERSON 2005).

1.3.2. Imunidade específica

A resposta imune adaptativa ou específica ocorre tanto pela resposta humoral


quanto celular, que geram respostas efetoras específicas e células de memória para os
determinados antígenos dos patógenos (MESTECKY; FULTZ, 1999; ZHU et al., 2012;
MACHADO et al., 2004). A Imunidade humoral é mediada por anticorpos que atuam
neutralizando as partículas virais livre nos fluidos corporais, gerando anticorpos
específicos que reconhecem e tentam evitar assim os casos de reinfecção viral,
enquanto que as respostas imunes mediadas por células são essenciais para a
30

destruição de células infectadas com vírus e a geração de memória imunológica


(STANLEY, 2006).
A resposta imune adaptativa inicia logo após ativação da resposta imune inata,
quando as células apresentadoras de antígeno (APCs), tais como Langerhans e células
dendríticas (DC) absorvem os antígenos virais, os transformam em peptídeos e
apresentam para linfócitos juntamente com a molécula MHC na membrana da célula.
Esse complexo liga-se à receptores de células T antígeno-específico em células T
naíves auxiliares (CD4+) e citotóxicas (CD8+), aumentando assim a proliferação de
células T, produção de IL-2 e ativação desses linfócitos (ROSALES, ROSALES, 2014).
Portanto, o perfil da resposta imune adaptativa pode ser do tipo humoral ou celular,
sendo esta última representada pela produção e ativação dos linfócitos TCD4+ e
TCD8+.
Na resposta imune humoral deve-se em grande parte aos anticorpos produzidos
localmente presentes na mucosa cervical, representados principalmente por IgA e IgG,
e por uma pequena fração advindos de outros fluidos corporais, que são transportados
a partir do sangue para os tecidos uterinos com objetivo de fornecer a imunidade
humoral no canal vaginal. Os níveis e o isotipo dessas imunoglobulinas presentes na
mucosa podem variar circunstancialmente de acordo com o ciclo hormonal feminino. A
importância dos níveis locais dessas imunoglobulinas na mucosa vaginal na defesa
contra patógenos infecciosos pode ser evidenciada após cirurgia de histerectomia, onde
ocorre uma redução de grandes níveis dessas imunoglobulinas e deficiência na
resposta imune local (MESTECKY; FULT, 1999).
A resposta imune mediada por células (CD4+ CD8+) assim como a resposta
imune humoral, tem fundamental importância na defesa antiviral. O papel das células
TCD4+, além de estar ligado no auxilio na ativação dos linfócitos B durante a produção
de imunoglobulinas através da expressão específica de citocinas, essas células são
necessárias também durante a fase inicial de diferenciação dos linfócitos T efetores na
resposta de células TCD8+, para indução da morte celular programada (apoptose) na
célula alvo pela ação de perforinas e granzimas, e na geração de células T de memória
(NAKANISHI et al 2009).
31

A população de células T CD4+ (T auxiliares) é heterogênea e dependendo do


microambiente, do estímulo das APCs e da produção de citocinas, as células T
auxiliares CD4 + naíves ativadas (Th0) podem diferenciar-se em várias linhagens de
células auxiliares T (Th), incluindo Th1, Th2, Th17, e Treg, de acordo com seu padrão
de produção e função de citocinas (ZHU et al., 2012; MACHADO et al., 2004). Essa
diferenciação ocorre de acordo com estímulos diferenciados para cada antígeno
apresentados por células apresentadoras de antígeno para se tornarem competentes
efetoras e/ou memória de fenótipos de células especializadas . O perfil Th1 e o Th2 são
os mais comuns, o Th1 produz IL-2, IL-12, IL-15, IL-18, factor de necrose tumoral (TNF-
α), e IFN-γ, induzindo a proliferação e aumento da capacidade citotóxica dos LT CD8.
Th2 produzem IL-4, IL-5, IL-6, IL-10 e IL-13, favorecendo a produção de anticorpos
(ROSALES; ROSALES, 2014). Recentemente, um novo subtipo de LT efetores foi
elucidado, os LTh17 são responsáveis pela produção de citocinas como: IL-22, IL-26 e
citocinas da família IL-17, que estão envolvidas numa potente indução da resposta
inflamatória, indução da infiltração celular e produção de outras citocinas pró-
inflamatórias. A produção desregulada dessa citocina está associada a várias
condições autoimunes (CHEN et al., 2007; MESQUITA JR et al., 2010).
Os linfócitos do tipo TREG têm função imunorreguladora responsável pela
produção de citocinas imunossupressoras. Essa resposta pode ser por LT de
ocorrência natural (TREGS CD4+ CD25+) (SAKAGUCHI et al.,1995), os LTR1 que
produzem IL-10 e suprimem o desenvolvimento de algumas respostas de LT in vivo, e
os LTh3 (CD4+ e CD8+), e outra subpopulação (CD4- e CD8-) responsáveis pela
produção predominantemente INF-γ, TNF-α e TGF-β e são capazes de suprimir a
reposta imune alogênica e xenogênica mediada por LT CD4+ e CD8+, assim como a
resposta a antígenos próprios (STROBER et al, 1989; (MESQUITA JR et al., 2010).
O curso da infecção pelo HPV se dá pela indução de imunidade de forma fraca.
De acordo com estudos de DE JONG et al., 2004, foi verificado que na resposta imune
contra os antígenos do HPV, o perfil tipo Th1 foi visto em casos de mulheres
assintomáticas que apresentam DNA do HPV. Enquanto que em casos de pacientes
com câncer, ocorre diminuição desse padrão Th1 e elevação de citocinas produzidas
por linfícitos T regulatórios (Treg), em respostas a esse mesmo antígeno. Esse perfil T
32

regulatório tem sido evidenciado no envolvimento com tolerância a antígenos próprios,


onde essas células desempenham papel fundamental na limitação da imunopatogênese
das infecções virais crônicas de estimulação imune persistente (SAKAGUCHI, 2003).
Em pacientes infectados pelo HPV com casos de condilomas, foi visto que ocorre
um Infiltrado inflamatório composto de macrófagos e células T CD4+ que parecem
regredir de forma espontânea, mostrando uma forte associação à eliminação do HPV e
a resposta linfoproliferativa das células T CD4+ específica para o antígeno E2. Já a
resposta linfoproliferativa de células T CD8+ específicas para os antígenos E6 e E7 são
encontradas em pacientes que apresentam tumor cervical e grandes lesões. Nesses
casos de pacientes com lesão intraepitelial de alto grau é observada uma diminuição da
resposta tipo Th1, levando uma baixa produção de IL-2, IFN-γ e TNF-α (LEE et al.,
2004).
A resposta imune tem fundamental importância na defesa contra agentes
infecciosos, e atua principalmente impedindo a ocorrência de infecções disseminadas,
nas quais podem habitualmente estar associadas com alto índice de mortalidade.
Dessa forma, na maioria das vezes o organismo por si só, têm condições de destruir os
microrganismos e impedir a progressão da infecção e a ocorrência de casos de câncer
(JANEWAY, 2001). Exemplo disso é quando uma infecção prévia pelo HPV é resolvida
com sucesso, o sistema imune parece proteger o organismo contra infecções adicionais
e posteriores a esse mesmo tipo de vírus. Entretanto, a resposta imune humoral pela
infecção natural pelo HPV parece não ser o suficiente para desenvolver uma proteção
contra a reinfecção, uma vez que leva a baixos níveis de anticorpos e que pode ser
detectado apenas por um curto período de tempo, o que pode não se relacionar com a
presença do DNA do vírus. Dessa forma, a proteção contra a infecção pelo HPV por
meio da produção de anticorpos ocorre de forma incerta (LIMBERGER; OLIVEIRA;
CORREA, 2012).

1.3.3. Evasão imune do HPV

A infecção inicial pelo HPV é caracterizada por gerar através da ativação dos
mecanismos da resposta imune inata um microambiente pró-inflamatório mediado por
33

citocinas, por meio do recrutamento de células do sistema imune inato que tem como
objetivo promover a eliminação das células infectadas e iniciar uma resposta imune
adquirida efetiva (AMADOR-MOLINA, et al., 2013). Na maioria das infecções, as lesões
são eliminadas pelo sistema imune através de uma resposta celular bem sucedida
direcionada contra proteínas precoces do HPV (E). Essa reposta gera uma
soroconversão e anticorpo para a proteína de revestimento principal L1. No entanto, os
títulos dos anticorpos obtidos são concentrações baixas e nem todas as mulheres
desenvolvem a seroconversão (CARTER, 2000).
O vírus parece evadir do sistema imune com objetivo de gerar um mecanismo
necessário a uma infecção viral bem sucedida, exemplo disso é a alteração do
microambiente de lesões cervicais de baixo grau que é predominantemente pró-
inflamatório, e é modificada de uma forma que favorece a infecção pelo HPV (AZAR et
al., 2004). Portanto, apesar da resposta imune ter um importante papel na eliminação
desse tipo de infecção, o HPV exibe uma enorme gama de estratégias para escapar da
vigilância do sistema imune, gerando um microambiente anti-inflamatório, que em
alguns casos, pode não eliminar o patógeno e desenvolver uma infecção persistente
(AMADOR-MOLINA, et al., 2013).
Na infecção natural pelo HPV o ciclo de replicação do vírus ocorre
exclusivamente intraepitelial, o HPV infecta as células basais e a expressão dos genes
virais precoces são ativados nas camadas basais e suprabasais do epitélio. De forma
que, quando essas células se diferenciam, ocorre ativação da expressão dos genes
tardios na camada granular das proteínas da cápside estruturais L1 e L2, em conjunto
com a proteína E4 e montagem e liberação dos vírus infecciosos maduro nas camadas
escamosas (CAMPO et al., 1993; KIRNBAUER et al., 1996). Ou seja, as partículas do
vírus são eliminadas das superfícies das mucosas e não há viremia, nem necrose e
resposta inflamatória, ou esta ocorre de forma limitada.
Adicionalmente, a chegada das partículas virais ou das proteínas do capsídeo
aos gânglios linfáticos de drenagem ocorrem de forma limitada e as células
apresentadoras de antígenos (APC) são macrófagos e células de Langerhans, ambas
ineficazes no processo de geração da resposta inflamatória durante as infecções por
HPV, resultando em baixas respostas imunes adaptativas (STANLEY, 2006). Portanto,
34

o próprio ciclo de replicação do HPV é um mecanismo de escape do sistema imune,


pois a infecção e crescimento vegetativo do vírus dependem exclusivamente da
diferenciação dos queratinócitos, pois essas células se diferenciam terminalmente e
morrem por causas naturais. Dessa forma, mesmo a célula estando infectada não sofre
citólise ou necrose, quase não há inflamação e pouca ou nenhuma liberação local de
citocinas pró-inflamatórias, o que seria essencial para ativação dos sinais centrais para
lançar as respostas imunes no epitélio escamoso (PULENDRAM, AHRMED, 2006).
Apesar da ausência de citólise, viremia, e diminuição ou ausência de inflamação
e respostas ineficazes das APCs devido ao próprio mecanismo do ciclo de replicação
do vírus, ainda sim os queratinócitos infectados por HPV deverá ativar a produção de
interferon do tipo 1, IFN- α e IFN-β que têm importante papel na primeira linha de
defesa na infecção intracelular contra vírus, atuando como uma ponte entre a resposta
imune inata e a adaptativa por meio de mecanismos antivirais, anti-proliferativos e
imunoestimulatórios, além de estar relacionado na regressão das lesões provocadas
pelo HPV (Le BOM; TOUGH, 2002, AMADOR-MOLINA, et al., 2013). No entanto, a
ativação de proteínas expressas pelo HPV, modulam a expressão de citocinas e
quimiocinas para alteração da apresentação de antígenos, regulando negativamente as
vias de interferons do tipo 1 (IFN α e β) e moléculas de aderência (KANODIA; FAHEY;
KAST, 2007).
Os HPVs de alto risco, como HPV 16 e 18, utilizam-se de meios que promovem a
redução da secreção de IFN e também de MCP1 nos queratinócitos cervicais. A
expressão da oncoproteína E7 do HPV18 pode reduzir a expressão de IRF-1 nos
tecidos cervicais e a expressão de E6 pode está relacionada com a inibição da
fosforilação de moléculas envolvidas na sinalização de IFN como Tyk2 quinase,
START1 e START2 em câncer cervical (STANLEY, 2015).
Os HPVs oncogênicos têm a capacidade de regular a expressão do MHC de
classe I por meio da ação da proteína E7 que reprimem promotores de cadeia pesada e
também promotores que regula a expressão dos genes codificadores das proteínas
TAP-1 e LMP-2, que atuam no transporte do peptídeo / complexo MHC de classe I para
a superfície da célula, alterando o transporte do peptídeo / complexo MHC de classe I
para a superfície da célula, devido à dificuldade de interação entre o HPV e as
35

proteínas, o que irá resultar em baixa apresentação de antígenos virais pelas células
infectadas. Além da proteína E7, foi demostrada que a proteína E5 também induz a
regulação negativamente da expressão de superfície de MHC de classe I (O’BRIEN,
CAMPO, 2002).
As células Dendríticas (DCs) são células apresentadoras de antígenos
profissionais (APCs) que promovem uma resposta imune das células T através da
captura e apresentação de antígenos. As Células de Langerhans (LCs) são
consideradas as principais células dendríticas de humanos na pele (epiderme e derme)
encontradas em epitélios escamosos (AMADOR-MOLINA, et al., 2013). Os mecanismos
de migração e adesão para o local da região cervical durante o processo inicial de
infecção pelo HPV são fundamentais para o processo de resposta imune do hospedeiro
para eliminação desse patógeno, estando relacionada ao processo de cicatrização das
lesões induzidas pelo HPV e tem sido correlacionada com bom prognóstico clínico
(EIBEN; VELDERS; KAST, 2002). Entretanto, o HPV pode driblar essa resposta,
modulando a adesão e migração dessas APCs, regulando negativamente a expressão
E-caderina por meio de E6 e E7 interrompendo assim a adesão entre queratinócitos e
LCs. Além disso, a proteína L2 presente no capsídeo do HPV tem a capacidade de
suprimir a maturação, migração e secreção de citocinas pelas LCs (GHITTONI et al.,
2010, AMADOR-MOLINA, et al., 2013).
As LCs e os queratinócitos podem sofrer interferência dos efeitos da infecção
pelo HPV no estágio de desenvolvimento de lesões graves. A redução do número de
LC em neoplasias Intraepiteliais cervicais (NIC), induzida por HPV contribui para o
escape da vigilância imunológica e está associada com a gravidade da lesão. Além do
mais, nesses tipos lesão as LCs mostram pouca ou nenhuma expressão de moléculas
co-estimuladoras de adesão, sugerindo um ambiente pobre em células apresentadoras
de antígeno. Por outro lado, a expressão dessas moléculas aumenta nos queratinócitos
proporcionalmente com a gravidade da doença que juntamente com leucócitos ativados
em baixo da lesão desenvolve uma fraca resposta imune relacionada a NIC, uma vez
que TNF-α regulada negativamente e IL-10 tem sua expressão aumentada (MOTA et al,
1998). Exemplo disso é observado em pacientes HPV positivo, que apresentam LSIL, e
tem os níveis mais elevados de IL-10 em comparação com pacientes HPV-negativos
36

(AZAR et al., 2004). A expressão de E6, após a infecção pelo HPV ter sido
estabelecida, leva a regulação positiva de IL-17, e pode constituir um passo importante
para o desenvolvimento e progressão tumoral (CHANG et al, 2010), promovendo a
angiogênese e o crescimento tumoral (NUMASAKI et al., 2003). Portanto, a indução de
uma resposta pró-inflamatória é de suma importância como forma de quebrar a
tolerância induzida pela infecção pelo HPV, constituindo uma etapa essencial na
modulação da resposta pró-inflamatória durante a carcinogênese, um processo que
inclui o estabelecimento da infecção, a persistência, progressão, metástase e
angiogênese (FRASER et al,2001).
Outro mecanismo de evasão imune utilizado pelo HPV é por meio de mutações
nas proteínas estruturais do capsídeo viral L1 acarretando em falha na montagem das
partículas e não ativação de Dcs, assim como na regulação negativa da expressão de
receptores do tipo TLR em queratinócitos devido o aumento da expressão de proteínas
E6 e E7, impedindo o reconhecimento do vírus pelos receptores padrões TLR
prejudicando assim a resposta inata dependente de MyD88, com tinha como objetivo
desenvolver uma resposta pró-inflamatória e consequentemente um resposta imune
adaptativa efetiva. Exemplo desse mecanismo é visto em casos de carcinogenese
cervical, na qual ocorre essa mutação do gene L1 de tal forma que já não ocorre a sinal
de ativação dependente de MyD88 de células dendríticas (YANG et al., 2005). Além do
mais, altos níveis de L1 de HPV16 não conseguem ativar as células de Langerhans
(FAUSCH et al, 2002).
Assim como os IFN tipo I as células NK é uma das primeiras linhas de defesa do
hospedeiro contra a infecção viral atuando na resposta mune inata e na ativação de
linfócitos efetores específicos contra o vírus, incluindo a produção de anticorpos e de
CTL (O’BRIEN, CAMPO, 2002). Embora o papel das células NK na história natural da
infecção pelo HPV não seja totalmente estabelecido, estudos sugerem que os níveis de
NKT circulantes está associada com a gravidade da infecção ou progressão para
câncer cervical (MOLLING et al,2007). Apesar disso, há indícios de mecanismos de
evasão imune desenvolvidos pelo HPV para evitar a atividade das células NKT. O HPV
utiliza algumas estratégias para evitar a ação dessas células, desregulando a
expressão de receptores que possuem ações inibitórias e ativadoras durante as
37

infecções de HPV e nos casos de câncer. Alguns destes mecanismos estão


relacionados com a diminuição da expressão CD1d, o pode representar uma estratégia
para as células infectadas pelo HPV para evadir-se da vigilância imunológica durante as
fases iniciais da infecção (MIURA et al, 2010). Além do mais, a ação benéfica dessas
células é vista na utilização de vacinas profiláticas contra HPV, na qual aumentam a
população de células NK após a imunização, e consequentemente ocorre o aumento na
expressão dos receptores das células NK: NKG2D, NKp30, NKp46 e ILT2, sugerindo a
contribuição de outras vias, para além do aumento propriamente das células
(COLMENARES et al., 2012, AMADOR-MOLINA et al, 2013).

Figura 3. Mecanismos utilizados pelo HPV para evadir da resposta Imune que podem facilitar a
progressão das lesões.

Fonte: (Adaptado de DURAY et al., 2014).


38

Nesse estudo, analisamos a relação entre o perfil da resposta imune em


mulheres infectadas pelo HPV, na presença e ausência de lesões na cérvice uterina,
como uma forma de compreender e elucidar melhor os processos infecciosos e
inflamatórios que ocorrem no epitélio da mucosa do trato genital e a relação entre a
imunidade, persistência e o desenvolvimento de carcinogêneses cervicais
desenvolvidos por esse vírus.
39

2. OBJETIVOS

2.1. Objetivo Geral

Analisar o perfil de resposta imune presentes na mucosa da cérvice uterina de


mulheres infectadas pelo HPV.

2.2. Objetivos Específicos

 Comparar a expressão de RNAm de TLR-9, Myd88 e Citocinas em


pacientes positivas para o HPV com e sem lesão da cérvice uterina;

 Avaliar a prevalência da infecção genital pelo HPV em mulheres não


grávidas com e sem lesão da cérvice uterina;

 Analisar a influência dos fatores de risco clássico para doenças


sexualmente transmissíveis na população estudada.
40

3. DELINEAMENTO EXPERIMENTAL

Março2014-Junho 2015 Entrevista com


Maternidade Escola Januário Cicco, questionário
Natal/RN padronizado
225 Pacientes

 Sociodemográfica
 Atividade sexual e
Biologia Molecular Coleta de espécimes da Cérvice uterina
reprodutiva
 Atitude comportamental

Extração de DNA Citologia

(KIT QIAGEN) Histopatologia

Extração de RNA Coloração de Papanicolaou

(KIT QIAGEN) PCR convencional β-globina

PCR convencional HPV Colposcopia

RNA em cDNA

(KIT HIGH CAPACITY cDNA


REVERSE TRANSCRIPTION)
Eletroforese em gel de agarose 1%

RT-PCR IFN-γ, TNF-α,


Teste do x2 simples
IL-10, IL17, TRL-9, MyD88
e β-actina Regressão logística RC e IC 95%

Winpepi

Grupos:
Teste de Mann-Whitney Bicaudal
 S/ Lesão e sem HPV
 S/ Lesão e com HPV Software GraphPad Prism 5.0 Significativos valores de P≤ 0,05
 C/ Lesão e com HPV
41

4. METODOLOGIA

4.1. Local do Estudo e obtenção das amostras

A pesquisa foi realizada durante o período de março de 2014 à junho de 2015,


na Maternidade Escola Januário Cicco (MEJC), em Natal/RN. O presente estudo foi
aprovado pelo Comitê de ética da UNP com CAAE 126.114, e analisou espécimes
cervicais de um total de 225 mulheres sexualmente ativas e não grávidas que
concordaram em participar voluntariamente da pesquisa. As participantes foram
divididas em dois grupos o primeiro composto por 126 mulheres recrutadas entre
aquelas que procuraram o programa de rastreio do câncer de colo do útero (CCU) da
MEJC para fazer o exame citológico de Papanicolaou. Antes da coleta as mulheres
passaram por uma entrevista por meio de um questionário padrão (Anexo) para a
obtenção de informações a respeito das características sócio-demográficas, atividade
sexual e reprodutiva. Em seguida, foram submetidas ao exame clínico com inspeção
visual da cérvice uterina e a coleta de dois espécimes contendo células descamadas da
ectocérvice e endocérvice uterina, meio da escova ginecológica e/ou espátula de Ayre.
Um desses espécimes foi utilizado para preparação de esfregaço em lâmina para
realização do exame citológico e o outro foi processado para extração de DNA e
analisado para a detecção do HPV por meio de PCR convencional.
O segundo grupo foi composto por 99 mulheres não grávidas, recrutadas entre
aquelas que foram encaminhados pelas unidades de saúde do Sistema Único de Saúde
(SUS) à Maternidade Escola Januário Cicco, com suspeita de terem lesões associadas
ao HPV, e que também aceitaram participar voluntariamente da pesquisa. Após
responderem ao questionário da entrevista as mulheres passaram por uma consulta ao
ginecologista do serviço durante a qual foi realizado o exame clínico e inspeção visual
da cérvice uterina por meio de colposcopia. Das mulheres que no exame colposcópio
apresentaram aspectos sugestivos de lesão da cérvice uterina, foram coletados dois
fragmentos de tecido por meio de biópsia, sendo um fixado em formol e encaminhado
ao laboratório de patologia para análise histopatológica e o outro acondicionado em
criotubo contendo Trizol (Invitrogen , Carlsbad, CA, EUA), e encaminhado ao laboratório
de biologia molecular de doenças infecciosas e do câncer, onde foram processadas
42

para extração de ácidos nucleicos para detecção do HPV e análise da expressão de


RNAm de TLR9, MyD88 e citocinas envolvidos na resposta imune presente na mucosa
da cérvice uterina.

4.2. EXAMES E PROCEDIMENTOS


4.2.1. Papanicolaou

O exame citológico de Papanicolaou foi realizado no laboratório da MEJC a partir


das lâminas contendo esfregaço de cada paciente. Para a preparação dos esfregaços
as células descamadas do epitélio da ectocérvice e endocérvice uterina foram
espalhadas de maneira uniforme na superfície de lâminas limpas e previamente
identificada e imediatamente fixado como álcool etílico 70 a 90%, ou aerosol contendo
álcool isopropílico e polietileno glicol (Carbowax), para evitar a dessecação e
deformação das células. Após a fixação, As mesmas foram coradas pelo método
descrito por Papanicolaou (1942), e em seguida analisadas ao microscópio óptico para
detecção de possíveis alterações celulares associadas à infecção pelo HPV, utilizando
os critérios de diagnósticos descritos no sistema Bethesde (2001) (SOLOMON et al.,
2002).

4.2.2. Colposcopia

A colposcopia foi realizada pelo médico ginecologista da Maternidade Escola


Januário Cicco colaborador da pesquisa. Todas as pacientes foram submetidas ao
exame, que tem como objetivo inspecionar todo o trato genital feminino, da vulva ao
canal endocervical na sua porção inicial, incluindo-se o períneo e região perianal
visando detectar possíveis alterações sugestivas de infecção.
A colposcopia é exame realizado por meio de um aparelho conhecido como
colposcópio, que permite visualizar o colo uterino sob luz brilhante, com aumento de 10
a 40 vezes, o que permite detectar a presença de lesões na cérvice uterina. Para
realização do exame é aplicada inicialmente uma solução de ácido acético a 5% sob o
colo do útero e em seguida visualizado no colposcópico. Em seguida, é retirado
43

excesso do ácido acético, aplicada uma solução de lugol e realizada uma nova
inspeção (FEBRASGO, 2010) e interpretado segundo as orientações do Comitê
Internacional de Colposcopia (STAFL; WILBANKS, 1991).

4.2.3.Exame Histopatológico

O exame histopatológico tem como objetivo estabelecer o diagnóstico de


certeza da presença ou não de lesões pré-malignas ou malignas a partir de uma
amostra de tecido, obtida por meio de biópsia dirigida, após a colposcopia, ou a partir
de peça cirúrgica. Os fragmentos de tecido foram fixados em formol a 10% e
encaminhado ao laboratório de patologia onde foram incluídos em blocos de parafina, e
cortados com auxilio de micrótomo em fatias de 4 nm de espessura as quais foram
fixadas em lâminas e coradas pela hematoxilina-eosina e analisadas ao microscópio
óptico. Na análise microscópica foi feita a identificação da natureza da lesão,
particularizando-se as lesões de caráter benigno e as de caráter pré-neoplásico ou
neoplásico. As lesões quando presentes foram identificados com neoplasia intraepitelial
cervical (NIC) e classificadas de acordo com a sua gravidade em NIC-I, NIC-II, NIC-III
ou câncer invasivo com base nos critérios estabelecidos por RICHERT, 1967, e
utilizando a nomenclatura proposta por RICHERT, 2001.

4.3. Processamento para extração de ácidos nucleicos


4.3.1. Amostras obtidas por raspado cervical

Os tubos contendo as amostras de células descamadas do epitélio da cérvice


uterina, obtidas por meio de raspado cervical foram submetidos à agitação vigorosa em
vórtex para resuspensão das células. Em seguida, o conteúdo dos tubos foram
transferidos para microtubos de 15mL onde a suspensão de célula foi tratada com o
tampão de lise e submetida ao processo de extração de DNA por meio do KIT
QIAGEN® (QIAquick Gel Extraction Kit DNA) pelo método da proteinase K, conforme
protocolo recomendado pelo fabricante. Ao fim do processo, as amostras de DNA
purificado foram estocadas em microtubos de 1,5mL em freezer; -20.
44

4.3.2. Fragmentos de tecidos obtidos por biópsia

Os fragmentos de tecido obtidos por biopsia mantidos em tubos em presença de


Trizol foram submetidos a um processo de maceração utilizando micropistilos para
friccionarem o tecido contra as paredes do tubo de forma a obter células em
suspensão. Em seguida, a suspensão de células obtida foi dividida em duas alíquotas
as quais foram transferidas para microtubos de 15mL. Uma dessas alíquotas foi tratada
com o tampão de lise e submetida ao processo de extração de DNA por meio do KIT
QIAGEN® pelo método da proteinase K, conforme protocolo recomendado pelo
fabricante. Ao fim do processo, as amostras de DNA purificado foram estocadas em
microtubos de 1,5mL em freezer, - 20ºC. A outra alíquota foi também tratada com o
tampão de lise e submetida ao processo de extração de RNA, utilizado Kit da QIAGEN
(Viral RNA Mini Kit Qiagen RNA Extraction) específico para extração de RNA total,
seguindo as recomendações do fabricante. Após a extração as amostras também foram
mantidas no freezer -80°C até o momento serem utilizadas para obtenção do cDNA. As
amostras de RNA foram então submetidas ao procedimento de síntese de cDNA,
utilizado o kit HIGT CAPACITY cDNA REVERSE TRANSCRIPTION, seguindo o
protocolo recomendado pelo fabricante. Os cDNA obtidos a partir de cada amostra
foram estocados –20°C até a realização das análise para quantificação da expressão
das citocinas e receptores pesquisado, por PCR em tempo real.

4.3.3. Reação em Cadeia da Polimerase – PCR

Para avaliar a qualidade do DNA extraído, foi realizado uma PCR convencional
para β- globina, com os primers PCO3+/ PCO4+ que amplifica um segmento do gene
da β- globina de 110 pb, segundo protocolo descrito por SAIKI et al., 1985. As
condições da reação foram: ciclo 1) 5 min a 95°C; ciclo 2 -37) 1 min a 95°C, 1 min a
58°C, 1 min a 72°C; ciclo 38) 10 min a 72°C e a temperatura de manutenção (Holding)
de 20ºC. O produto da PCR foi submento a uma eletroforese em gel de agarose a 1%
em TBE 1X, corado com gel Red e visualizado no transiluminador. As bandas foram
45

comparadas utilizando um padrão de peso molecular de 100pb e controle positivo com


o mesmo fragmento de 110pb.
As amostras que apresentaram positividade para β-globina foram submetidas a
PCR convencional para detecção do DNA HPV, utilizando os Primers: GP5+/GP6+, que
amplifica um segmento de 140pb do gene L1 do vírus (De RODA HUSMAN et. al.,
1995). As condições da reação foram as seguintes: ciclo 1) 5 min a 95°C; ciclo 2- 42) 1
min a 95°C, 2 min a 50°C, 1 min a 72°C e a temperatura de Holding de 20°C. Os
produtos amplificados nesta PCR foram submetidos a uma eletroforese em gel de
agarose a 1% em TBE 1X e visualizado no transiluminador. Para comparação do
tamanho dos fragmentos amplificados foi utilizado o mesmo Peso de tamanho
molecular de 100pb utilizado na PCR para β- globina, e também com um controle
positivo. (lista de primers abaixo na tabela 2).

4.4.Quantificação de citocinas e fatores transcricionais


4.4.1.Análise da Expressão de Citocinas

Para essa análise considerou-se como controle negativo as amostras que se


apresentaram sem qualquer alteração no exame citológico ou na colposcopia. As
pacientes que apresentaram algum tipo de alteração no exame citológico,
histopatológico ou na colposcopia, foram dívidas em dois grupos: um constituído por
pacientes com teste positivo para HPV, mas sem lesão e o outro composto por
mulheres positivas para HPV e com lesão, Tabela 1.
Tabela 1. Categorização dos grupos para análise da resposta imune

Grupos N= 69 Lesão/Inflamação Presença de HPV


1 (controle) 17 Sem alteração Sem HPV
2 09 Sem alteração Com HPV
3 43 Com alteração Com HPV

Foram analisadas as expressões quantitativa relativa do RNAm por RT-PCR em


tempo real das seguintes citocinas: IFN-γ, TNF-α, IL-10 e IL-17 , do receptor TLR-9, e
da molécula adaptadora MyD88, utilizando como controle positivo interno β-actina
46

(gene constitutivo) A lista de primers utilizado é apresentado na tabela abaixo. Utilizou-


se o Sistema Maxima SYBR Green qPCR Master Mix, realizado em aparelho Applied
Biosystems 7500 Fast Real-time PCR System ( Applied BIosystems, Warrington, Reino
Unido).
A RT-PCR em tempo real foi realizada nas seguintes condições de
termociclagens: 2 min a 95°C para ativação da enzima, 40 ciclo de 30s a 95°C, 30s a
60°C, 72 a 1min e um ciclo final de com temperatura de 72°C a 5min. Foi obtida uma
curva de dissociação dos produtos da reação, para análise da especificidade de
amplificação. Para cada primer utilizado na RT-PCR, as condições foram padronizadas
de acordo com a concentração, temperatura de anelamento, ausência de formação de
dímeros, eficiência de amplificação dos genes alvos e controle interno (gene
constitutivo). Tabela 2.
O método Delta-Delta CT (ΔΔ CT) foi utilizado para avaliar a expressão gênica
(LIVAK; SCHMITTGEN, 2001). Inicialmente, para cada amostra foi calculado o delta
CT, subtraindo os valores de CT do gene controle (β-actina) dos valores de CT do gene
alvo (citocinas e receptores). Quando obtido o valor do ΔCT da amostra, foi escolhido
um grupo controle (sem inflamação, sem HPV) com objetivo de atuar como agente
normalizador. Para o cálculo de ΔΔ CT foi utilizado a seguinte fórmula: [ΔCT (amostra)-
ΔCT (grupo controle)]. Após determinado o valor de ΔΔ CT, foi aplicado a fórmula 2-
ΔΔCT, que resultou no valor da expressão gênica relativa.
47

Tabela 2. Sequência de primers utilizados no estudo.

Nome do primer Sequência do Primer (5’ - 3’) Temp. de Referência


Anelamento

PCO3+ (SENSE) CTT CTG ACA CAA CTG TGT TCA CTA GC 58 SAIKI, R. l. K., et al, 1985.
PCO4+
(ANTISENSE) TCA CCG CAA CTT CAT CCA CGT TCA CC

GP5+ (SENSE) TTT GTT ACT GTG GTA GAT ACT AC 42 DE RODA HUSMAN et al.,
GP6+ 1995
(ANTISENSE) CTT TTT ATT TGA CAT TTA GTA TAA G

Hu B-actina
(SENSE) TGA CTC AGG ATT TAA AAA CTG GAA
Hu B-actina 56,5 DESENHADO
(ANTISENSE) GCC ACA TTG TGA ACT TTG GG
IFN-GAMA Hu
(SENSE) ATG CAG AGC CAA ATT GTC TCC
IFN-GAMAHu 60 DESENHADO
(ANTISENSE) GG CAG GAC AAC CAT TAC TGG

IL-10 Hu (SENSE) AGA TCT CCG AGA TGC CTT CA


IL-10 Hu 57 DESENHADO
(ANTISENSE) ATT CTT CAC CTG CTC CAC GG

IL-17 Hu (SENSE) CAA TGA CCT GGA AAT ACC AA


IL-17 Hu 55 DESENHADO
(ANTISENSE) TGA AGG CAT GTG AAA TCG AGA

TNF-a Hu (SENSE) TTC TGG CTC AAA AAG AGA ATT G


TNF-a Hu 55 DESENHADO
(ANTISENSE) TGG TGG TCT TGT TGC TTA AAG

TRL-9 Hu (SENSE) TGAAGACTTCAGGCCCAACTG


61 DESENHADO
TRL-9 Hu
(ANTISENSE) TGCACGGTCACCAGGTTGT
MYD88 Hu
(SENSE) CAA GTA CAA GGC AAT GAA GAA AG
MYD88 Hu 61 DESENHADO
(ANTISENSE) AAG GCG AGT CCA GAA CCA
48

4.5. Análise Estatística

As análises dos fatores de risco em função das características sócio


demográficos foram realizadas por meio de regressão logística univariada para o
cálculo de razão de chance (RC) e de seus respectivos intervalos de confiança (IC)
utilizando o programa Winpepi e teste do qui-quadrado simples para obtenção dos
valores p. Foram considerados valores estatísticos significantes quando p<0,05. Para
análise dos níveis de expressão das citocinas e receptores envolvidos na resposta
imune, obtidos a partir da quantificação do RNA-m utilizando o software GraphPad
Prism 6.0, utilizando o teste de Mann-Whitney bicaudal.
49

5. RESULTADOS

Com base na análise dos questionários individuais foi possível determinar o perfil
sócio-demográfico das pacientes que participaram do estudo. Ao todo foram incluídas
225 mulheres com tinham idade entre 16 e 85 anos, média de 36,2 anos e desvio
padrão de ±11,26 e mediana de 35 anos, sendo a grande maioria composta de
mulheres com idade entre 31-45 anos, de etnia não branca, com grau de escolaridade
menor ou igual ao ensino fundamental, casadas ou vivendo em relação estável com um
seu parceiro, teve o primeiro intercurso sexual com idade até 18 anos, teve múltiplos
parceiros sexuais ao longo de sua vida, não faziam uso de preservativo nas relações
sexuais, teve uma a duas gestações e não eram fumantes (Tabela 3).
Todas as pacientes foram submetidas aos exames citomorfológicos (Citologia e
Colposcopia), e uma parte delas (99) foi também submetida a um procedimento de
biopsia para retirada de um fragmento de tecido do colo do útero, destinado a
realização do exame histopatológico para confirmar a existência da lesão e classificá-
las de acordo com os critério estabelecidos. Das 225 pacientes incluídas no estudo, 95
(42,2%) apresentaram resultado do exame citológico dentro dos padrões de
normalidade, enquanto que 130 (57,8%) apresentaram algum tipo de alteração no
exame. O exame colpóscópico revelou que 143 pacientes (63,6%) apresentava algum
tipo de alteração, enquanto que 82 (36,4%) não apresentaram alterações visíveis
durante a inspeção visual do trato genital, sendo o resultado do exame considerado
dentro dos padrões de normalidade. A análise de fragmento de tecido por meio do
exame histopatológico foi realizada em 99 das quais 95 (96,0) apresentaram lesões
intraepiteliais de diferentes graus e em apenas 4 delas (4,0%) a presença de lesão não
foi confirmada.
50

Tabela 3: Perfil sociodemográfico das mulheres participantes do estudo

Variáveis Pacientes analisados (N= 225) %

Idade
≤30 74 32,9
31-45 108 48,0
≥45 43 19,1

Etnia
Branco 87 38,7
Não Branco 138 61,3

Escolaridade
≤ Fundamental 143 63,5
≥Médio 82 36,4

Estado civil
Casada/parceiro fixo 171 76
Solteira 54 24

Idade da 1ª relação sexual


≤18 166 73,8
≥19 56 24,9
Não lembra 3 1,3

Múltiplos parceiros
Não 74 32,9
Sim 151 67,1

Uso de preservativo
Não 183 81,3
Sim 42 18,7

Número de gestações
Nenhuma 26 11,6
Apenas uma 33 14,6
Duas ou mais 166 73,8

Hábito de fumar
Não 174 77,3
Sim 51 22,7
51

Todas as amostras de DNA obtidas tiveram o resultado positivo na PCR para a


amplificação do gene da beta-globina, confirmando a presença de DNA humano com
qualidade adequada para ser utilizados nos ensaios seguintes. Os resultados da
análise molecular por meio de PCR convencional, utilizando os primers GP5+ e GP6+,
revelaram uma taxa de prevalência global da infecção genital pelo HPV de 39,6%,
sendo 18,8% entre aquelas que não apresentaram alterações em nenhum dos exames
(48 pacientes).
Das 95 mulheres que apresentaram citologia normal 29(30%), se apresentaram
positiva para a presença do DNA do HPV. Das 130 pacientes que apresentaram algum
tipo de alteração no exame citológico, um número de 60 pacientes, o equivalente 46,1%
foi detectado a presença do DNA do HPV. Os resultados mostraram que houve uma
forte associação entre alteração citológica e a presença do DNA do HPV, p=0,018
(Tabela 4).
Na colposcopia, 18 das 82 pacientes que não apresentaram alterações visíveis
se mostraram positivas no teste para detecção do HPV, revelando uma taxa de
prevalência da infecção por esse vírus de 22,0%, enquanto que em 71 de um total de
143 pacientes que apresentaram alterações na coposcopia a presença do vírus foi
detectada revelando uma taxa de prevalência da infecção pelo HPV de 49,7%,
mostrando que a taxa de prevalência da infecção pelo HPV foi maior nas pacientes com
alterações detectadas pelo exame colposcópico em relação àquelas que não
apresentavam alterações no exame, p=0,0001 (Tabela 4).
Com relação aos resultados do exame histopatológico das 95 pacientes que
apresentaram algum tipo de lesão, em 58 (61,1%) delas foi detectada a presença do
DNA do HPV, o que representa uma taxa de prevalência da infecção de 61,1%. Estes
resultados mostram que a taxa de prevalência da infecção genital pelo HPV foi maior
nas pacientes com lesões da cérvice uterina, detectadas por meio do exame citológico,
quando comparadas aquelas sem lesão, p=0,083 (Tabela4). Considerando-se apenas
as pacientes que apresentaram alterações em pelo menos um, dos três tipos de
exames morfológicos realizados, constatou-se que as taxas de prevalência do HPV nas
pacientes alterações na citologia e na colposcopia foram muito semelhantes entre si.
Contudo, a taxa de prevalência da infecção genital pelo HPV foi maior nas pacientes
52

que apresentaram alterações detectadas por meio do exame histopatológico, p=0,027


(Tabela 5).

Tabela 4. Resultados dos exames morfológicos, distribuídos em função da presença ou


ausência de infecção pelo HPV.

Pacientes Resultado da PCR para HPV


Exame N= 225 % Negativo % Positivo % P
Citologia
Sem alteração 95 42,2 66 69,5 20 30,5 0,018
Com alteração 130 57,8 70 53,8 60 46,1

Colposcopia
Sem alteração 82 36,4 64 78,0 18 22,0 0,0001
Com alteração 143 63,6 72 50,3 71 49,7

Histopatologia
Sem alteração 2 2,1 2 100,0 0 0,0 0,083
Com alteração 95 97,9 37 39,0 58 61,1

Tabela 5. Prevalência do HPV em pacientes com alterações detectadas pelos exames


citológico, colposcópico e histopatológico.
Resultados considerando apenas as pacientes com alterações
HPV Citologia % Colposcopia % Histopatologia %

Positivo 60 46,2 71 49,7 58 61,0

Negativo 70 53,8 72 50,3 37 38,9

Total 130 100,0 143 100,0 95 100,0

*Valor de significativo (p=0,0027) quando comparou-se a citopatologia com histopatologia.

As taxas de prevalência de infecção genital pelo HPV foram comparadas em


função do tipo de espécime biológico utilizado para a análise. Constatou-se que em
células descamadas do epitélio da cérvice uterina, obtidas por meio de raspado cervical
a taxa de prevalência do vírus encontrada foi de 24,6%, enquanto que em amostras de
tecidos obtidas por biopsia o valor encontrado foi de 58,6%. Este resultado indica que a
53

análise realizada a partir de fragmentos de tecidos obtidos por biópsia aumenta


significativamente a chance de detecção do HPV, quando comparada ao raspado
cervical, p=0,001 (Tabela 6).

Tabela 6. Eficiência da detecção do DNA do HPV por PCR em função do tipo espécime
biológico utilizado

Pacientes Resultado da PCR para HPV


Espécime biológico N % Negativo % Positivo % P

Raspado cervical 126 56,0 95 75,4% 31 24,6% -

Tecido de biópsia 99 42,7 41 41,4% 58 58,6% 0,001

Total 225 100,0 136 60,4 89 39,6

A existência ou não de associação entre as taxas de prevalência da infecção


genital pelo HPV e as variantes sócio-demográficas estudadas foi analisada por meio
da regressão logística univariada, observando associação positiva com relacionamento
sexual com múltiplos parceiros ao longo da vida (RC:3,06;IC:1,56-6,03;p=0,001). Isso
significa que as mulheres que tiveram múltiplos parceiros ao longo da vida
apresentaram três vezes mais chance de ter infecção pelo HPV, tomando-se como
parâmetro, aquelas que tiveram apenas um parceiro sexual. Nas pacientes com idade
menor que 30 anos (RC: 2.12; IC: 0.91- 4.95; p=0,056), e etnia não branca (RC:1,67;IC:
0,92-3,05; p=0,073) os valores de p foram próximos da significância estatística.
Observou-se uma associação negativa entre o número de gestações e a taxa de
prevalência de infecção do trato genital por HPV (RC:031;IC:0,12-0,78;p=0,005),
indicando que nas mulheres deste estudo a gestação funcionou como fator de proteção
contra a infecção pelo HPV, uma vez que as mulheres que tiveram duas ou mais
gestações apresentaram menor chance de ter a infecção, quando comparadas aquelas
que nuca engravidaram. As demais variáveis analisadas não apresentaram qualquer
associação com a infecção genital pelo HPV nas mulheres deste estudo (Tabela 7).
54

Tabela 7. Associação entre variáveis sócio-demográficas e taxa de prevalência da


infecção do trato genital pelo HPV.

Prevalência de HPV Análise univariada


Variáveis Negativo Positivo % RC [IC:95%] P

Idade

≤30 39 35 47,3 2.12 [0.91- 4.95] 0.056


31-45 68 40 37,0 1.39 [0.63- 3.10] 0.384
≥45 33 14 32,6
Etnia

Branco 59 28 31,2
Não Branco 77 61 44,2 1.67 [0.92- 3.05] 0.073

Escolaridade

≤ Fundamental 89 54 37,8 0.81 [0.45- 1.47] 0.468


≥ Médio 47 35 42,7
Estado Civil
Casada/parceiro fixo 108 63 36,8
Solteira 28 26 48,1 1.59 [0.82- 3.09] 0.139
Idade 1ª relação sexual

≤18 100 66 39,7 1.10 [0.56- 2.15] 0.765


≥19 35 21 46,4 Ref. -
Não lembra 1 2 66,6 3.33 [0.22-99.42] 0.313
Múltiplos parceiros

Não 57 17 23,0 -
Sim 79 72 47,7 3.06 [1.56- 6.03] 0.001
Uso de preservativo

Não 109 74 40,4 1.22 [0.58- 2.60] 0.572


Sim 27 15 35,7 -
Número de gestações

Nenhuma 10 16 61,5 -
Apenas uma 15 18 54,5 0,75 [0.23-2.42] 0.589
Duas ou mais 111 55 33,1 0,31 [0.12-0,78] 0,005
Hábito de fumar

Não 100 74 42,5 -


Sim 36 15 29,4 0.56 [0.27- 1.16] 0.150
55

Para estudar os mecanismos imunológicos envolvidos na infecção e


imunopatogênese do HPV no desenvolvimento de lesões da cérvice uterina foram
realizados ensaios para avaliar a expressão de citocinas e de receptores envolvidos na
resposta imune destas pacientes. Para isso, as amostras de cDNA sintetizados a partir
do RNA total extraído de células da mucosa da cérvice uterina obtidas por raspado
cervical ou por biópsia, foram submetidas à amplificação RT-PCR em tempo real para
quantificação dos RNAs mensageiros específicos para esses mediadores da resposta
imune inata. Foram analisadas amostras de mulheres sem lesão e com teste negativo
para HPV, utilizadas como grupo controle, de pacientes com resultado positivo para
HPV, mas sem qualquer lesão e amostras de pacientes com lesão e com teste positivo
para HPV. Todas as amostras dos três grupos foram analisadas para a quantificação da
expressão dos genes das citocinas: IFN-γ, TNF-α, IL-10, IL-17 e para o receptor da
resposta imune inata, TLR-9, e a proteína adaptadora MYD88. A expressão do gene da
β-actina foi utilizada como agente normalizador considerado como valor de referência
para quantificar as expressões dos demais genes analisados.
Em relação aos níveis de expressão dos genes codificadores de TLR-9 e MYD88
os resultados obtidos mostraram que não houve aumento significativo dos níveis de
expressão desses dois receptores (p=0,5276 e p=0,5322) e nenhum dos grupos de
pacientes analisados, embora tenha sido observado um pequeno aumento dos níveis
de expressão dessas moléculas no grupo de pacientes, sem lesão, mas infectadas pelo
HPV e naquele com lesão e infectado pelo HPV, quando comparado ao grupo controle,
sem lesão e sem infecção pelo HPV, Figura 3 A e B.
56

Figura 4. Diferença na Expressão de RNAm de TLR-9 (A) e Myd88 (B) em amostras da cérvice uterina
de mulheres com e sem lesões infectadas pelo HPV.

Expressão de RNAm de TLR-9 e Myd88 , realizado por meio de PCR em tempo real, a partir de
amostras de raspado da cérvice uterina e por fragmento de biópsia de pacientes com infecção genital
pelo HPV com e sem lesões na cérvice uterina. CN: grupo controle sem infecção e sem lesão. (TLR9 p
=0,5276; MyD88 p=0,5322).

Os resultados obtidos mostraram que todas as citocinas analisadas apresentam


um aumento relativo de sua expressão, nas pacientes que tinham lesão, quando
comparada aquelas do grupo controle, sem lesão. Os maiores níveis de expressão dos
genes analisados foram observados no grupo de pacientes que apresentavam lesões
da cérvice uterina e eram positivas no teste para detecção do HPV, quando comparado
aos grupos, sem lesões e sem HPV, e sem lesão, mas com infecção pelo HPV. A
expressão relativa de IFN-γ teve um pequeno aumento no grupo de mulheres que não
apresentava lesão, mas eram positivas para o HPV, em comparação ao grupo controle
sem lesão e sem HPV. Observou-se um aumento altamente significativo (p=0,0001), da
expressão relativa de IFN-γ no grupo de pacientes que apresentavam lesão da cérvice
uterina e eram positivas para HPV, em comparação ao grupo controle, e ao grupo
positivo para HPV, mas que não tinha lesão na cérvice uterina Figura 4A.
Os valores de expressão do gene TNF-α também mostram uma produção maior
dessa citocina no grupo de pacientes com lesão e com HPV, uma vez que os níveis de
expressão do gene TNF-α foram significativamente maiores (p=<0,0001), neste grupo,
57

quando comparado tanto com o grupo controle quanto com o grupo que apresentam a
infecção pelo HPV, mas não apresentava lesão na cérvice uterina Figura 4B.
A análise da expressão do gene da citocina anti-inflamatória, IL-10 também
mostrou que houve um pequeno aumento dos níveis de expressão dessa citocina nas
pacientes infectadas pelo HPV, mas sem lesão da cérvice uterina, em relação ao grupo
controle. Observou-se, no entanto, uma diferença altamente significativa (p=<0,0001)
nos níveis de expressão da IL-10 no grupo de pacientes que apresentavam lesão da
cérvice uterina e que tinha teste positivo para a detecção do HPV, quando comparados
aos níveis de expressão encontrados nas mulheres do grupo controle, bem como
naquelas infectadas pelo HPV, porém sem lesão Figura 4C.
Os resultados obtidos em relação a avaliação dos níveis de expressão do gene
da citocina de perfil inflamatório IL-17, mostraram que a produção dessa citocina foi
também aumentada nas pacientes portadora de infecção pelo HPV e que apresentam
lesão da cérvice uterina. Os níveis de expressão do gene IL-17 foram semelhantes no
grupo controle e no grupo de pacientes infectadas pelo HPV, mas sem lesão.
Observou-se, no entanto, um aumento altamente significativo (p=<0,0001) nos níveis de
expressão da citocina IL-17, no grupo de pacientes com lesão e com teste positivo para
HPV, quando comparados tanto ao grupo controle, quanto ao grupo de pacientes sem
lesão, mas positivas para HPV Figura 4D.
58

Figura 5. Diferença na Expressão de RNAm de IFN-γ (A), TNF-α (B), IL-10 (C), IL-17 (D), em amostras da
cérvice uterina de mulheres com e sem lesões infectadas pelo HPV.

Expressão de RNAm de IFN-γ (A), TNF-α (B), IL-10 (C), IL-17 (D), realizado por meio de PCR em tempo
real, a partir de amostras de raspado da cérvice uterina e por fragmento de biópsia de pacientes com
infecção genital pelo HPV com e sem lesões na cérvice uterina. CN: grupo controle sem infecção e sem
lesão. [As diferenças estatísticas são marcadas por asterístico (*), onde *=p≤ 0,05].
59

6. DISCUSSÃO

O perfil sócio demográfico da população estudada foi composto principalmente


por mulheres jovens adultas, sexualmente ativas, casadas ou vivendo com parceiro fixo,
de etnia não branca, com baixa escolaridade e que tiveram vários filhos, caracterizando
uma população tipicamente carente levando em consideração a situação
socioeconômica.
Neste estudou observou-se que a obtenção de amostra por meio de biópsia
melhora a detecção do DNA do HPV, quando comparado a análise de células
descamadas da mucosa obtidas por meio de raspado cervical. Isso pode ser justificado
pela melhor sensibilidade do método histopatológico para detecção das lesões
provocadas pelo HPV na cérvice uterina, uma vez que a coleta da biópsia é direcionada
para as áreas que apresentam características sugestivas de infecção pelo HPV vistas
na colposcopia. Em razão disso, o exame histopatológico é mais indicada para a
confirmação de lesão, enquanto que a citologia e a colposcopia, são mais indicadas
como métodos de rastreio de lesões precursoras do câncer do colo do útero (MASSAD
et al., 2009). Por outro lado, o processo de extração, de ácidos nucleicos desse material
necessita de um método mais abrasivo para promover ruptura do tecido para obtenção
de células em suspensão o que pode dificultar um pouco a obtenção DNA do vírus.
Os resultados obtidos por meio da citologia, colposcopia e Histopatologia
mostraram haver uma forte associação entre a presença de alterações morfológicas da
cérvice uterina detectadas por estes métodos e a presença do DNA do HPV. No
entanto, neste estudo foi visto que nas amostras obtidas de mulheres sem alterações
na citologia e na colposcopia foi encontrada uma elevada taxa de prevalência de
infecção pelo HPV (18,8%). Isto se deve a presença de infecção latente pelo HPV, na
qual não existe replicação do vírus e nem qualquer sinal de lesão, embora o genoma
viral esteja presente em algumas células da cérvice uterina em um número muito baixo
de cópias.
Os valores das taxas de prevalência global da infecção genital pelo HPV nessa
população foram de 39,5%, com prevalência de 30,5% apenas para mulheres com
citologia normal, valor maior ao encontrado em uma pesquisa realizada por Fernandes
60

et al., 2011, no qual a taxa de prevalência foi de 24,5% em mulheres de Natal. E uma
taxa de prevalência de 61,1%, em mulheres com lesões da cérvice uterina
comprovadas pela histopatologia, que apesar de não ter sido classificado o grau da
lesão, foi menor que a taxa de prevalência encontrada por Fernandes et al., 2009 em
pacientes com lesões pré-malignas e malignas, que foi de 82.4%. Essa diferenças de
prevalência de infecção encontrada no nosso estudo em comparação ao de Fernandes
et al, 2011 e em 2009, poderia ser explicado pela diferença na obtenção e
processamento das amostras.
A associação entre a infecção genital pelo HPV e o relato de relacionamento com
múltiplos parceiros sexuais ao longo da vida observada neste estudo já era esperado
uma vez que representa um dos principais fatores de risco para infecção pelo HPV,
bem como para lesões da cérvice uterina, incluindo o câncer de colo do útero.
Resultados semelhantes são reportados por Nonnemmacher et al., 2002, em estudo
realizado no Rio Grande do Sul e por Fernandes et al., 2008 em estudo realizado em
Natal.
No que se refere à condição étnica, observou-se no presente estudo que as
mulheres de etnia não branca, apresentaram maior risco de contrair infecção pelo HPV,
quando comparada as de etnia branca. Resultados semelhantes tem sido relatado em
outros estudos, de Fernandes et al., 2009, em Natal RN, assim como HO et al., 1998
nos Estados Unidos. Este fenômeno pode ser atribuído mais à condição
socioeconômica do que propriamente a característica étnica, uma vez que geralmente,
existe uma promoção maior de pessoas de etnia não branca entre as populações
menos favorecidas que são mais vulneráveis às infecções por muitos patógenos,
incluindo o HPV.
No presente estudo foi observado que gravidez se apresentou como um fator
de proteção contra a infecção pelo HPV, uma vez que as mulheres que tiveram duas ou
mais gestações apresentaram as menores taxas de prevalência da infecção por esse
patógeno. Em estudos realizados por HERREIRO et al., 2005 em mulheres da Costa
Rica e por LIU et al., 2011, em mulheres do Sul da China, o número de gestação não
apresentou associação com o aumento de risco de infecção pelo HPV. Por outro lado,
Nonnemmacher et al., 2002 relatam ter encontrado associação positiva entre o número
61

de gestações e o risco de adquirir infecção genital pelo HPV. Nenhum sinal de


associação foi encontrado neste estudo em relação às variáveis idade cronológica,
estado civil, idade da primeira relação sexual, uso de preservativo nas relações sexuais
e hábito de fumar. Estes resultados são opostos aos relatados por Dunne et al., 2007,
em estudo realizado nos Estados Unidos, onde foi encontrada associação ente essas
variáveis e a presença de infecção pelo HPV.
O uso do preservativo é considerado uma medida importe para a prevenção de
doenças sexualmente transmissíveis. Entretanto, no presente estudo não apresentou
qualquer indicação de ação protetora conta a infecção pelo HPV. Esses resultados são
concordantes com aquelas obtidos em um estudo de méta-análise realizado por
Manhart e Koutsky em 2002, que também não encontraram relação entre o uso do
preservativo e a redução da incidência de infecção pelo HPV. Entretanto, apesar de não
oferecer proteção conta a infecção pelo HPV, o uso do preservativo nas relações
sexuais é recomendado porque reduz a incidência de verrugas genitais, displasia
cervical e câncer de colo do útero, uma vez que tem sido associado o contato do sêmen
com a mucosa do trata genital feminino, e uma resposta inflamatória pós-coital,
marcada pela presença deTGF-β que parece exercer um importante papel na indução
de baixa reatividade imune local. (ROBERTSON et al., 2001).
A condição gerada pela infecção persistente causada pelo HPV leva a produção
de mediadores químicos que desencadeiam uma resposta inflamatória de natureza
crônica, criando um ambiente que favorece ao desenvolvimento de lesões pré-malignas
e malignas da cérvice uterina por meio de mecanismos mediados por citocinas e
quimiocinas liberadas na mucosa do trato genital (FERNANDES et al., 2015). Os
receptores do tipo Toll-like- 9 (TLR-9) são expressos em células epiteliais na
endocérvice, ectocérvice e vagina, e reconhecem o HPV, por meio do DNA de dupla
fita, sendo ativados para desenvolver uma resposta mediante a produção de diferentes
citocinas que conduzem de uma resposta imune adaptativa contra esse patógeno
(NASU; NARAHARA, 2010). De forma interligada, MyD88 atua como uma proteína
adaptadora geral que está envolvida na sinalização dos TLRs, ativando fatores de
transcrição, tais como NF-KB, conduzindo uma resposta imune inata e adaptativa assim
como nos mecanismos de inflamação (SIN, 2011).
62

Os resultados das análises dos níveis de expressão de RNA-m de TLR-9 e


MYD88 mostraram que a expressão destes componentes se apresentou aumentados,
porém sem diferença estatística, tanto nos pacientes que apresentavam a infecção pelo
HPV sem lesão, quanto naquelas com lesão, em comparação ao grupo controle. Os
maiores valores foram observados no grupo que apresentaram algum tipo de lesão.
Entretanto, as diferenças não foram significativas. Em estudo similar, Cannella et al,
2014, encontraram aumento dos níveis de expressão de TLR-9 em pacientes com
histórico de infecção por HPV de alto risco, com mais de um ano, quando comparadas
aquelas com infecção recente. Isso sugere que a infecção persistente por HPV de alto
risco ativa a expressão desses receptores e contribui para o aumento da inflamação e
consequentemente para o risco de neoplasia cervical. Em estudo recente, foi observado
que a expressão de receptores do tipo Toll-like em células neoplásicas também
acontece (KACZANOWSKA; JOSEPH; DAVILA, 2013), impedindo a infiltração de
células do sistema imune e alterando o tipo de inflamação, e dessa forma, facilitando o
desenvolvimento de neoplasias (RENGA et al., 2013) .
Apesar dos resultados de MYD88 se mostrarem semelhantes aqueles
encontrados para o TLR-9, a sinalização mediada por MYD88 pode ocorrer por ativação
de qualquer um dos receptores do tipo Toll-like, não estando especificamente
relacionado a ação do receptor TLR-9. Entretanto, sabe-se que o microambiente da
cérvice uterina encontra-se constantemente exposto a microrganismos principalmente
aqueles transmitidos sexualmente, que podem, portanto, ativar as vias de sinalização
de MYD88 (LIMA; ALVES, 2008).
Os receptores Toll-like (TLRs) foram identificados como componentes
fundamentais no processo de reconhecimento do patógeno nas respostas inflamatórias
e imune para evitar doenças infecciosas (CHUANG et al., 2000-). O receptor TLR9
parece funcionar como uma proteína padrão de reconhecimento imune inato uma vez
que reconhece motivos não metilado ricos em CpG presentes no DNA bacteriano e
viral, agindo através de sinalização dependente da resposta primária de diferenciação
mielóide (MyD88) (MEDZHITOV; JANEWAY, 2000). A função de TLR9 envolve o fator
nuclear kappa B) (NF-kB), que ativa a transcrição de genes envolvidos na produção e
citocina pró-inflamatória (HE; QIAO; CERUTTI, 2010). Foi mostrado que TLR9 é capaz
63

de reconhecer motivos CpG presente no HPV16. Contudo as oncoproteínas E6 e E7 do


HPV16 pode atuar inibindo a transcrição TLR9 em linfócitos B e em cells câncer cervical
(HASAN et al., 2007).
Tem sido proposto que o HPV16 é capaz de desregular a expressão do TLR9
por meio da ação de sua oncoproteína E7 que promove a formação de um complexo de
inibição transcricional. A proteína E7 produzida pelo vírus ativa quinase IkB que por sua
vez NF-kB, bem como o receptor de estrógeno 1-α (ER α). Este complexo trascricional
criado por E7 também recruta histona-desacetilase 1 (HDAC1) e desmetilase específica
5B-lisina (JarID1B) para uma região específica do promotor de TLR9, resultando numa
diminuição da metilação e acetilação de histonas do sítio de iniciação transcricional
(HASAN, 2007). Também tem sido relatado que Oncoproteínas E6 e E7 dos HPV de
alto risco promovem modificação da expressão de vários componentes da via de
sinalização de NF-kB em queratinócitos cervicais, (HUSSEINZADEH, DAVENPORT,
2014). Além disso, em um estudo realizado por LAI; PAN; SONG, 2013, em mulheres
chinesas foi demonstrado que um polimorfismo 2848 G/A no gene do TLR9 esta
associado com aumento de risco para câncer de colo do útero.
A detecção de alta expressão dos genes que codificam esses receptores em
mulhers com lesões intraepiteliais associadas ao HPV, sugere que existe algum
mecanismo impedido a função de reconhecimento do vírus por essas moléculas e,
consequentemente supressão da resposta imune inata ao nível da mucosa da cérvice
uterina. Isso poderia ser devido a ação das proteínas viais E6 e E7, por meio de alguns
dos mecanismos referidos acima, ou alternativamente por outro mecanismo ainda não
conhecido.
Os mecanismos imunorregulatórios das citocinas produzidas na cérvice uterina no
combate à infecção pelo HPV são essenciais para determinar o tipo de perfil imune que
o hospedeiro irá desenvolver, ativando ou suprimindo a resposta imune. Determinadas
citocinas são capazes de gerar uma resposta, seja celular ou humoral, de eliminação do
patógeno ou levar uma infecção persistente que pode progredir para lesões
intraepiteliais cervicais e ao câncer (SPELLBERG, EDWARDS, 2001). Apesar de ser
bastante controverso o papel de cada citocina na infecção pelo HPV, acredita-se que o
perfil Th1 esteja associado com a imunidade mediada por células e eliminação da
64

infecção e regressão das lesões. Já o perfil Th2 atua suprimindo a imunidade celular,
associando-se às infecções persistentes pelo HPV (SONG et al., 2008). Sabe-se que o
IFN-γ atua como uma citocina pro- inflamatória, secretada por células da resposta Th1 e
desempenha uma função importante nos mecanismos considerados eficazes na
eliminação de vírus, incluindo o HPV. Assim, em pacientes infectadas pelo HPV, baixos
níveis de IFN-γ estaria relacionado a persistência da infecção e desenvolvimento de
lesões pré-malignas e malignas (WELTERS et al 2003).
Estudos mostram que em pacientes infectadas pelo HPV, níveis elevados de
IFN-γ sem aumento de IL-4,IL-6 e IL-10 sugere tendência de cura da infecção,
enquanto que baixos níveis de IFN-γ e TNF-α na presença de níveis elevados de IL-
4,IL-6 e IL-10, pode subverter a resposta imune para o HPV, favorecendo a persistência
da infecção o que pode resultar no desenvolvimento de lesões pré-malignas e
progressão para a forma maligna (MOTA et al., 1999; M EL‐SHERIF et al., 2001).
O TNF-α também é uma citocina pró-inflamatória, secretada por macrófagos
ativados e promove a migração e maturação de células apresentadoras de antígeno,
aumentando a eficiência de reconhecimento de antígenos (WANG; SAUDER, 1999).
Portanto, TNF-α possui atividade multifuncional na resposta do hospedeiro contra
infecções virais (JIN, 2015). Esta citocina age regulando a regressão de tumores
benignos e no controle das lesões de baixo grau causadas por HPVs de alto risco
(BACHMANN et al., 2002). Contudo autos níveis de expressão de TNF-α está
fortemente associado com lesão de alto grau e câncer induzidos pelo HPV. Isso se
deve ao fato de que nesses tipos de lesão o DNA do vírus encontra-se integrado ao
genoma da célula infectada, o que resulta na alta expressão dos genes virais E6 e E7,
cujos produtos neutralizam a ação do TNF-α na indução de apoptose e inibição da
proliferação de células cancerosas (FILIPPOVA et al., 2002; AHMED et al., 2001).
Alternativamente TNF-α poderia atuar como promotor de células epiteliais, como tem
sido demonstrado na carcinogênese de pele, no modelo camundongo (SUGAMURA et
al.,1999; ARNOTT et al., 2002). Assim, níveis elevados de TNF-α nos casos de lesão
de alto grau e câncer associado ao HPV, indica resposta imune do hospedeiro inválida
o que resulta em proliferação mais rápida de algumas células cancerosas, em virtude
da superação dos efeitos dessa citocina sobre a indução de apoptose e inibição do
65

crescimento celular (AZAR et al., 2004). Em estudo de polimorfismo do gene TNF-α a


associação de risco para câncer de colo do útero foi constatado com a elevação dos
níveis dessa citocina e aumento do risco da doença. Esta citocina estaria envolvida no
processo da carcinogênese por meio da indução da proliferação, promoção invasão do
tumor (BADANO et al., 2012; LIU et al. 2012). Além do mais, sabe-se que a inflamação
crônica e a liberação de citocinas pró-inflamatórias podem proporcionar o crescimento
anormal de células cervicais e a progressão para câncer (WOODWORTH et al., 1995,
JIN, 2014).
Por outro lado, nas infecções pelo HPV, parece que a IL-10 além de inibir as
funções de TNF-α, regula positivamente a expressão de genes do vírus e protege as
células infectadas da ação da resposta imune (ARANY et al., 2002). Assim, níveis
elevados de TNF-α e baixos de IL-10 indica que pode haver cura das lesões de baixo
grau, enquanto que níveis elevado de IL-10 na presença de baixos níveis de TNF-α
está relacionado com progressão das lesões associadas ao HPV (AZAR et al., 2004)
IL-17 é uma citocina produzida por Th17 e outros linfócitos com diversas funções
desenpenhando papeis reguladores chaves na defesa do hospedeiro, bem como em
mecanismos patológicos tais como de distúrbios auto-imunes, doenças inflamatórias
crônicas e câncro (GOSMANN et al., 2014). IL-17 desempenha uma gama de
atividades biológicas por meio da ligação direta entre a imunidade inata e adaptativa
com ativação das células T e inflamatórias respostas (FENG et al., 2012; XIE et al.,
2010).
No presente estudo foi encontrado um aumento significativo dos níveis de
expressão do genes de IFN-γ, TNF-α, IL-10 e IL-17, na mucosa da cérvice uterina de
mulheres com lesões e com teste positivo para HPV quando comparadas com lesão e
sem HPV e ao grupo controle sem lesão e sem HPV. Em um estudo recente, realizado
por GUMARÃES et al., 2015 relatam resultados semelhantes com relação aos níveis
de expressão IFN-γ, TNF-α e IL-17 encontrados na mucosal da cérvice uterina de
pacientes com lesões intraepiteliais escamosas de altop grau (HSIL) e sugerem que a
elevação dessas citocinas poderiam ser usados como biomarcadores selectivos para
lesão de alto grau.
66

Com relação ao aumento aos níveis de IFN-γ nas mulheres com lesão e que
estavam infectadas pelo HPV, o resultado é concordante com aqueles encontrados em
estudo realizado por FERNANDES et al., 2005 e outro por SONG et al., 2008, que
detectaram um elevado nível de IFN-γ em amostras de biópsia cervical de pacientes
com lesões intraepiteliais e infectadas pelo HPV16. Em outro estudo realizado por
PARDO-GOVEA et al., 2005, avaliando a expressão de citocinas do perfil pró-
inflamatório constataram que o níveis de expressão do IFN-γ aumentou gradativamente
com o grau da lesão em comparação ao grupo controle. No presente estudo o aumento
dos níveis de IFN-γ foi também acompanhado pelo aumento de IL-10 que regula
positivamente a expressão dos oncogenes do HPV criando algum mecanismo de
evasão, o que poderia explicar a presença de lesão, mesmo num ambiente com níveis
elevado de IFN-γ. Os resultados no presente estudo onde se observou um aumento
significativo de IFN-γ nas pacientes positiva para HPV e com lesão, suportam a ideia de
que o aumento de IL-10 em lesões cervicais na presença de HPV16 pode facilitar a
transformação neoplásica, que tem sido considerada um importante agente dotado de
um elevado potencial oncogênico, mas o mecanismo como isto ocorre não está claro.
Em estudo recente, realizado por TANESE et al., 2015, foi constatado que
produção aumentada de IFN-γ em pacientes com melanoma estava associada com
aumento da agressividade e progressão de tumor. Foi demonstrado que as células do
tumor produzem o fator inibidor da migração de macrófagos (MIF), que reverte o papel
do IFN-γ na vigilância imunológica contra os tumores. Isso ocorre porque do IFN-γ
aumenta a expressão do receptor de MIF, CD74 que ao interagir com seu ligante
sinaliza para a ativação da via P13K / AKT e promove a sobrevivência das células
tumorais. IFN-γ promove a fosforilação de AKT Ser473, resultando em aumento da
expressão fatores pró-tumorigênicos tais como IL-6, IL-8 e BCL2. Foi também
demonstrado que a inibição da interação de MIF com seu receptor CD74 suprimiu
significativamente o crescimento do tumor em presença de IFN-γ no modelo
camundongo. Poderia estar ocorrendo algo semelhante em relação ao câncer de colo
do útero? Essa possibilidade deveria ser investigada.
Com relação ao elevado nível de expressão do TNF-α, observado na mucosa
das pacientes positivas para HPV e com lesão, este se mostra coerente com os
67

resultados relatos por (AZAR et al., 2004) que indicam que uma forte associação entre
níveis elevados de TNF-α e HSIL. Isto se deve ao fato de que nesse tipo de lesão
ocorre alta expressão dos genes virais E6 e E7, e seus produtos neutraliza as funções
de TNF-α na indução de apoptose e inibição do crescimento de células tumorais de
maneira que as células tumorais ficam protegidas da apoptose e proliferam mais
rapidamente (AZAR, et al., 2004). Nossos resultados no que se refere ao TNF-α são
também concordantes com os relatados PARDO-GOVEA et al.,.2005, em estudo
realizado na Venezuela no qual os níveis dessa citocina se mostrou mais elevado nas
pacientes infectadas pelo HPV e com lesão em relação ao controle, sem lesão, embora
tenha se mantido em níveis semelhantes para os diferentes graus de lesões. Estudos
de polimorfismos de genes envolvidos na inflamação apontam evidências que sugerem
a provável participação dos produtos destes genes no processo de progressão de
lesões pré-malignas associadas ao HPV para câncer cervical invasivo, incluindo TNF-α,
IL-10, Caspase-7 e genes de reparo de DNA (ROSZAK et al., 2015; BAJPAI et al.,
2015).
Com relação a IL-17, os resultados obtidos neste estudo mostram níveis
elevados de expressão nas pacientes positivas para HPV com lesão da cérvice uterina.
Resultado semelhante foi encontrado por GUIMARÃES et al., 2015 em um estudo
realizado no Estado do Amazonas. Alguns estudos apontam para uma correlação entre
produção elevada de IL-17 com lesões da cérvice uterina associadas com HPV-16 ou
HPV-18 e o aumento do risco de progressão para câncer (LV et al., 2015). Também
foram observadas proporções mais elevadas de IL-17 produzidas por células-T CD4+
presentes no sangue periférico de mulheres neoplasia intraepitelial cervical (ZHANG et
al., 2011).
Portanto, os resultados da expressão das citocinas aqui analisadas sugerem que
pacientes com lesões na cérvice uterina podem apresentaram um perfil
imunossupressor, voltadas mais para um fenótipo Th17 e Treg que provavelmente
resulta em tolerância imunológica, infecção persistente, lesões pré-cancerigenas e
possível doença invasiva. Esses resultados podem ser explicados pelo papel das
células Th17 na inflamação tecidual precoce nas doenças inflamatórias crônicas,
produzindo citocinas pro-inflamatórias e quimiocinas responsáveis pelo recrutamento de
68

células Th1 aos sítios inflamatórios, e apesar das células T reguladoras (TREGs)
também estarem acumuladas nesses locais, a presença de altos níveis de citocinas
inflamatórias torna as células-alvo menos susceptíveis à imunorregulação, diminuindo,
portanto, o poder imunossupressor das TREGs (ADURTHI et al., 2008).
69

7. CONCLUSÕES

 O estudo mostrou uma taxa de prevalência global de infecção genital pelo HPV
de 39,5%, sendo 18,8% em pacientes sem lesões, com citologia e colposcopia
normais, e 61,1% em mulheres com lesões na cérvice uterina comprovada por
meio da histopatologia;

 As variáveis analisadas como, a relação com múltiplos parceiros sexuais e etnia


se apresentaram como fatores de risco para infecção pelo HPV, enquanto que a
gravidez se mostrou como fator protetor contra a infecção por esse patógeno;

 Os três métodos de diagnóstico utilizados foram capazes de detectar sinais da


presença do HPV e mostram haver correlação entre a presença de alteração
nesses exames, com a presença do DNA viral;

 Pacientes infectados pelo HPV apresentaram elevada expressão de citocinas


inflamatórias e anti-inflamatórias na cérvice uterina, provavelmente relacionados
à evolução das lesões intraepiteliais.
70

8. REFERÊNCIAS

ADEFUYE, A.; SALES, K. Regulation of inflammatory pathways in cancer and infectious


disease of the cervix. Scientifica, v. 2012, 2012.

ADURTHI, S.; et al. Regulatory T Cells in a Spectrum of HPV-Induced Cervical Lesions:


Cervicitis, Cervical Intraepithelial Neoplasia and Squamous Cell CarcinomaAmerican.
Journal of Reproductive Immunology, 60, 55–65. 2008.

AHMED, M.I.; et al. The human papillomavirus infection among Egyptian females with
cervical carcinoma: Relationship to spontaneous apoptosis and TNF-α. J Biochem. 34,
491-498, 2001.

AKAGI, K.; LI, J.; BROUTIAN, T. R.; PADILLA-NASH, H. Genome-wide analysis of HPV
integration in human cancers reveals recurrent, focal genomic instability. Genome
research, v. 24, n. 2, p. 185-199, 2014.

AMADOR-MOLINA, A.; et al. Role of Innate Immunity against Human Papillomavirus


(HPV) Infections and Effect of Adjuvants in Promoting Specific Immune
Response. Viruses , 5:2624–2642, 2013.

ANDERSEN, J. M.; AL-KHAIRY, D.; INGALLS, R. R. Innate Immunity at the Mucosal


Surface: Role of Toll-Like Receptor 3 and Toll-Like Receptor 9 in Cervical Epithelial Cell
Responses to Microbial Pathogens. Biology of Reproduction. 74, 824–831, 2006.

ARANY, I.; GRATTENDICK K, G.; TRYNG, S.K. Interleukin-10 induces transcription of


the early promoter of human papillomavirus tyoe 16 (HPV16) throught the 5’-segment of
the upstream regulatory region (URR). Antiviral Res. 55, 331-339, 2002.

ARNOTT, C. H.; et al. Tumour necrosis factor-alpha mediates tumour promotion via a
PKC alpha-and AP-1-dependent pathway. Oncogene, 21(31), 4728-4738, 2002.

AZAR, K.K.; et al. Increased secretion patterns of interleukin-10 and tumor necrosis
factor-alpha in cervical squamous intraepithelial lesions. Hum. Pathol. Vol. 35, p.1376–
1384, 2004.

BACHMANN, A.; et al. RÖSL, F. Disturbance of tumor necrosis factor alpha-mediated


beta interferon signaling in cervical carcinoma cells. Journal of virology, 76(1), 280-291,
2002.

BADANO, I.; et al. Analysis of TNFalpha promoter SNPs and the risk of cervical cancer
in urban populations of Posadas (Misiones, Argentina). Journal of Clinical Virology, p.53,
v.1, 2012.

BAJPAI, D.; et al. Single nucleotide polymorphisms in the DNA repair genes in HPV-
positive cervical cancer. Eur J Cancer Prev. 2015.
71

BALOCH, Z.; et al. Ethnic and geographic variations in HPV prevalence and genotype
distribution in north‐western Yunnan, China.Journal of medical virology, v. 88, n. 3, p.
532-540, 2016.

BERNARD, H. U.; et al . Classification of papillomaviruses (PVs) based on 189 PV types


and proposal of taxonomic amendments. Virology, v. 401, n. 1, p. 70-79, 2010.

BODILY, J.; LAIMINS, L. A. Persistence of human papillomavirus infection: keys to


malignant progression. Trends in microbiology, v. 19, n. 1, p. 33-39, 2011.

BOSCH, F.X.; DE SANJOSÉ, S.; CASTELLSAGUÉ, X. Chapter 4 HPV and genital


cancer: the essential epidemiology. Vaccines for the Prevention of Cervical Cancer, 1:
chapter-4, 2008.

BOSCH, F.X.; MUNOZ, N. The viral etiology of cervical cancer . Virus Research;89:
183-90, 2002.

BROOMALL, E. M.; REYNOLDS, S. M., JACOBSON, R. M. Epidemiology, clinical


manifestations, and recent advances in vaccination against human papillomavirus.
Postgraduate Medicine, Berwyn, v. 122, n. 2, p. 121-129, 2010.

BURCHELL, A. N.; et al. Epidemiology and transmission dynamics of genital HPV


infection. Vaccine,24, S52-S61, 2006.

CAMPO, M. S.; et al. Prophylactic and therapeutic vaccination against a mucosal


papillomavirus. Journal of General Virology, 74(6), 945-953, 1993.

CANNELLA, F.; et al., TLR9 is expressed in human papillomavirus-positive cervical cells


and is overexpressed in persistent infections, Immunobiology 220 363–368, 2015.

CARTER, J.J.; et al. Comparison of human papillomavirus types 16, 18, and 6 capsid
antibody responses following incident infection. J Infect Dis. vol. 181,1911–9, 2000.

CASTELLSAGUÉ, X. Natural history and epidemiology of HPV infection and cervical


cancer. Gynecologic Oncology, v. 110, n. 3, p. S4-S7, 2008.

CASTLE, P.E.; et al. A prospective study of age trends in cervical human papillomavirus
acquisition and persistence in Guanacaste, Costa Rica. J Infect Dis. Vol.191, n.6),
p.1808–1816, 2005.

CHAN P. K.; et al. Age distribution of human papillomavirus infection and cervical
neoplasia reflects caveats of cervical screening policies. Int J Cancer. Vol.126, n.1,
p.297–301, 2010.

CHANG, Y.H.; et al. Up-regulation of interleukin-17 expression by human papillomavirus


type 16 E6 in nonsmall cell lung cancer. Cancer, vol.116, p. 4800–4809., 2010.
72

CHEN, Z.; et al. Distinct Regulation of Interleukin-17 in Human T Helper Lymphocytes.


Arthritis & Rheumatism; 56(9):2936-46, 2007.

COLMENARES, V.; et al. Human papillomavirus immunization is associated with


increased xpression of diferente inatte immune regulatory receptors. Clin Vaccine
Immunol. 19,1005-1011, 2012.

CONWAY, M. J.; MEYERS, C. Replication and assembly of human


papillomaviruses. Journal of dental research, v. 88, n. 4, p. 307-317, 2009.

DE JONG, A.; et al. Human papillomavirus type 16-positive cervical cancer is associated
with impaired CD4+ T-cell immunity against early antigens E2 and E6. Cancer
Research, Baltimore, v. 64, p. 5449-5455, 2004.

DELIGEOROGLOU, E.; et al. HPV infection: immunological aspects and their utility in
future therapy. Infectious diseases in obstetrics and gynecology, 2013.

DE RODA HUSMAN, A. M.; et al. The use of general primers GP5 and GP6 elongated
at their 3′ ends with adjacent highly conserved sequences improves human
papillomavirus detection by PCR. Journal of General Virology. 76.4: 1057-1062, 1995.

DE SANJOSÉ, S.; et al. Worldwide prevalence and genotype distribution of cervical


human papillomavirus DNA in women with normal cytology: a meta-analysis. Lancet
Infec Dis. Vol.7, n.7, p.453–459, 2007.

DE VILLIERS, E.M.; et al. Classification of papillomaviruses. Virology. Vol. 324, p.17-27,


1992.

DELIGEOROGLOU, E.; et al., HPV Infection: Immunological Aspects and Their Utility in
Future Therapy Efthimios Deligeoroglou. Infectious Diseases in Obstetrics and
Gynecology. 540850, 9 pages, 2013.

DENG, S. J.; et al. Identification of peptides that inhibit the DNA binding, trans-activator,
and DNA replication functions of the human papillomavirus type 11 E2 protein. Journal
of Virology, Vol. 78, No. 5, p. 2637-2641, Mar 2004.

DOORBAR, J. The papillomavirus life cycle. J Clin Virol. Vol. 32S, p.S7–S15, 2005.

DUNNE, E. F.; et al. Prevalence of HPV Infection Among Females in the United States.
JAMA, 297(8), 813-819, 2007.

DURAY, A.; et al. Prognosis of HPV-positive head and neck cancers: implication of
smoking and immunosuppression. Advances in Cellular and Molecular
Otolaryngology, 2, 2014.
73

EIBEN, G. L.; VELDERS, M. P.; KAST, W. M.The cell-mediated immune response to


human papillomavirus-induced cervical cancer: implications for
immunotherapy. Advances in cancer research, 86, 113-148, 2002.

FAUSCH, S. C.; et al. Human papillomavirus virus-like particles do not activate


Langerhans cells: a possible immune escape mechanism used by human
papillomaviruses. J. Immunol. Vol. 169, p.3242–3249, 2002.

FEBRASGO (Federação Brasileira das Associações de Ginecologia e Obstetrícia).


Manual de Orientação: Trato Genital Inferior. pp 9-27, 2010.

FEHRMANN, F.; LAIMINS, L. A. Human papillomaviruses: targeting differentiating


epithelial cells for malignant transformation.Oncogene, v. 22, n. 33, p. 5201-5207, 2003.

FENG, Q.; et al. Th2 type inflammation promotes the gradual progression of HPV-
infected cervical cells to cervical carcinoma. Gynecol Oncol. v.127, p .412-9, 2012.

FERLAY J.; et al. Cancer Incidence and Mortality Worldwide: IARC CancerBase No. 11.
GLOBOCAN. v1. 0 2013.

FERNANDES, J. V.; et al. Prevalence of HPV infection by cervical cytologic status in


Brazil. Int J Gynecology and Obstetrics, 105, 21-24, 2009.

FERNANDES, J. V.; DE ARAÚJO, J. M. G.; FERNANDES, T. A. A.; DE M. Biology and


natural history of human papillomavirus infection, dovepress, 16 de junho, 2013.

FERNADES, J. V.; et al. Human papillomavirus prevalence in women with normal


cytology and with cervical câncer in Natal, Brazil. Moleculae Medicine Reports, 4: 1321-
1326, 2011.

FERNANDES, J. V.; FERNANDES T. A. A. DE M. Human Papillomavirus: Biology and


Pathogenesis, Human Papillomavirus and Related Diseases - From Bench to Bedside -
A Clinical Perspective, Dr. Davy Vanden Broeck (Ed.), ISBN: 978-953-307-860-1, 2012.

FERNANDES, J. V.; et al. Link between chronic inflammation and human


papillomavirus-induced carcinogenesis (Review), Oncol. Lett. 9, 1015–1026, 2015.

FILIPPOVA, M.; et al. The human papillomavirus 16 E6 protein binds to tumour necrose
factor (TNF-α) R1 and protects cells from TNF-induced apoptosis. J Biol Chem. 277,
21730-21739, 2002.

FORMAN, D.; DE MARTEL, C.; LACEY, C. J.; SOERJOMATARAM, I.; et al. Global
burden of human papillomavirus and related diseases. Vaccine, v. 30, p. F12-23, 2012.

FRANCESCONE, R.; et al. Tumor-derived mural-like cells coordinate with endothelial


cells: role of YKL-40 in mural cell-mediated angiogenesis.Oncogene, v. 33, n. 16, p.
2110, 2014.
74

FRAZER, I. H.; et al. Tolerance or immunity to a tumor antigen expressed in somatic


cells can be determined by systemic proinflammatory signals at the time of first antigen
exposure. J. Immunol. Vol. 167,p. 6180–6187, 2001.

GAGE, J.R.; et al. Effects of human papillomavirus -associated cells on human


immunodeficiency virus gene expression. Obstet Gynecol. Vol. 96, p. 879-885, 2000.

GHITTONI, R.; et al. The biological properties of E6 and E7 oncoproteins from human
papillomaviruses. Virus Genes, Vol. 40, No. 1, p. 1-13, 2010.

GOSMANN, C.; et al. A. IL-17 suppresses immune effector functions in human


papillomavirus-associated epithelial hyperplasia. The Journal of Immunology, 193(5),
2248-2257, 2014.

GRAHAM, C.S.; et al: Antigen-specific immune responses and liver histology in HIV and
hepatitis C coinfection. AIDS . vol.19, p. 767-773, 2005.

GRODZKI, M.; et al. Increased risk for cervical disease progression of French women
infected with the human papillomavirus type 16 E6-350G variant. Cancer Epidemiology
Biomarkers & Prevention, v. 15, n. 4, p. 820-822, 2006.

GUIMARÃES, A. G.; et al.. CD11c+CD123Low dendritic cell subset and the triad TNF-
α/IL-17A/IFN-γ integrate mucosal and peripheral cellular responses in HIV patients with
high-grade anal intraepithelial neoplasia: a systems biology approach. J Acquir Immune
Defic Syndr. 1;68(2):112-22, 2015.

HAMID, N. A.; BROWN, C.; GASTON, K. The regulation of cell proliferation by the
papillomavirus early proteins. Cellular and molecular life sciences, 66(10), 1700-1717,
2009.

HASAN, U.A.; et al. TLR9 expression and function is abolished by the cervical cancer-
associated human Papillomavirus type 16. J Immunol. 178, 3186-3197, 2007.

HATTORI, N.; USHIJIMA, TOSHIKAZU. Epigenetic impact of infection on


carcinogenesis: mechanisms and applications. Genome medicine, v. 8, n. 1, p. 1, 2016.

HE, B.; QIAO, X.; CERUTTI, A. CpG DNA induces IgG class switch DNA recombination
by activating human B cells through an innate pathway that requires TLR9 and
cooperates with IL-10. The Journal of Immunology, 173(7), 4479-4491, 2004.

HERRERO, R.; et al. Epidemiologic profile of type-specific human papillomavirus


infection and cervical neoplasia in Guanacaste,Costa Rica. J Infect Dis. Vol.191, n.11,
p.1796–807, 2005.

HO, G.Y.; et al. Natural history of cervicovaginal papillomavirus infection in young


women. N Engl J Med. Vol.8, p.338:423, 1998.
75

HUSSEINZADEH, N.; DAVENPORT, S.M. Role of toll-like receptors in cervical,


endometrial and ovarian cancers: a review, Gynecol. Oncol. 135 359–363, 2014.

INSTITUTO NACIONAL DE CANCER JOSÉ ALENCAR GOMES DA SILVA. Estimativa


da Incidência e Mortalidade por Câncer no Brasil, Rio de Janeiro: INCA, 2014.
Disponível em: <http://www.inca.gov.br/rbc/n_60/v01/pdf/11-resenha-estimativa-2014-
incidencia-de-cancer-no-brasil.pdf. Acesso em: 6 ago. 2015.

IWASAKI, A. Antiviral immune responses in the genital tract: clues for vaccines. Natures
Reviews Immunology, Vol 10, pp. 699-711, 2010.

JANEWAY, C.A JR. How the immune system protects the host from infection. Microbes
Infect. Vol.3. p.1167-7, 2001.

JIN, XU. Recent advances in the study of HPV-associated carcinogenesis.


VIROLOGICA SINICA, 30 (2): 101-106, 2015.

JIN. Association of Single Nucleotide Polymorphisms in Tumor Necrosis Factor-Alpha


with Cervical Cancer Susceptibility. Cell Biochem Biophys. 71:77–84, 2015.

JO, H.; KIM, J. W. Implications of HPV infection in uterine cervical cancer. Cancer
Therapy, Vol. 3, p 419-434, July 2005.

KACZANOWSKA, S., JOSEPH, A.M., DAVILA, E. TLR agonists: our best frenemy in
cancer immunotherapy, J. Leukoc. Biol. 93, 847–863, 2013.

KADAJA, M.; et al. Papillomavirus DNA replication frominitiation to genomic instability.


Virology, Vol. 384, No. 2, p. 360-368, 2009.

KANODIA, S.; FAHEY, L.M.; KAST, W. M. Mechanisms used by human


papillomaviruses to scape the host imune response. Curr. Cancer Drug Targed,. Vol. 7,
p. 79-89, 2007.

KIRNBAUER, R.; et al. Virus-like particles of bovine papillomavirus type 4 in prophylactic


and therapeutic immunization. Virology,219 (1), 37-44, 1996.

KYRGIOU M.; et al. Clinical management of HPV-related disease of the lower genital
tract. Annals of the New York Academy of Sciences, v. 1205, n. 1, p. 57-68, 2010.

LAI, Z. Z.; PAN, X. L.; SONG, L. Toll-like receptor 9 (TLR9) gene polymorphisms
associated with increased susceptibility of human papillomavirus-16 infection in patients
with cervical cancer. Journal of International Medical Research, 41(4), 1027-1036, 2013.

LE BON, A.; TOUGH, D.F. Links between innate and adaptative immunity via type I
interferon. Corrent Opinion in Immunology, vol. 14, n 4, p. 432-436, 2002.
76

LEBRE, M. C.; et al. Human Keratinocytes Express Functional Toll-Like Receptor 3, 4,


5, and 9. Journal of Investigative Dermatology.127, 331–341, 2007.

LEE, B. N.; et al. Depressed type 1 cytokine synthesis by superantigen-activated CD4+


T cells of women with human papillomavirus-related high-grade squamous intraepithelial
lesions. Clinical and Diagnostic Laboratory Immunology, Washington, v. 11, p. 239-244,
2004.

LEPIQUE, A. P.; RABACHINI, T.; VILLA, L. L. HPV vaccination: the beginning of the end
of cervical cancer? A Review. Memórias do Instituto Oswaldo Cruz, Rio de Janeiro, v.
104, p. 1-10, 2009.

LIMA, Y.A.R, ALVES, M.F.C. O sistema imune da mucosa do trato genital feminino e o
impacto das doenças sexualmente transmissíveis. Rev Patol Trop. Vol. 37, p. 295-309,
2008.

LIMBERGER,A.; et al. Aspectos imunológicos da infecção pelo vírus do papiloma


humano (HPV). Semina: Ciências Biológicas e da Saúde, Londrina, v. 33, n. 1, p. 111-
122, jan./jun. 2012.

LIU, S. S.; et al. Prevalence and Risk Factors of Human Papillomavirus (HPV) Infection
in Southern Chinese Women – A Population-Based Study. PLoS ONE 6(5): e19244,
2011.

LV, Q.; et al. Association between six genetic variants of IL-17A and IL-17F and cervical
cancer risk: a case–control study. International Society of Oncology and BioMarkers
(ISOBM), 2015.

LIVAK, K. J.; SCHMITTGEN, T. D. Analysis of relative gene expression data using real-
time quantitative PCR and the 2− ΔΔCT method. methods,25(4), 402-408, 2001.

MACHADO, P.R.L.; et al. Mecanismos de resposta imune às infecções. An Bras


Dermatol. Vol. 79, p. 647-664, 2004.

MALHORTA, S. Impact of the sexual revolution: consequences of risky sexual


behaviors. J Am Physi Surge 13 (3): 88 – 90, 2008.

MANAVI, M.; et al. Human papillomavirus DNA integration and messenger RNA
transcription in cervical low- and high-risk squamous intraepithelial lesions in Austrian
women. Int J Gynecol Cancer. Vol.18, n.2, p.285-94, 2008.

MANHART, L. E.; KOUTSKY, L. A. Do condoms prevent genital HPV infection, external


genital warts, or cervical neoplasia?: A meta-analysis.Sexually transmitted
diseases, 29(11), 725-735, 2002.
77

MASSAD, L. S.; JERONIMO, J., KATKI, H. A.; SCHIFFMAN, M. The accuracy of


colposcopic grading for detection of high grade cervical intraepithelial neoplasia. Journal
of lower genital tract disease, 13(3), 137, 2009.

M EL‐SHERIF, A.; et al. Quantitative analysis of IL-10 and IFN-gamma mRNA levels in
normal cervix and human papillomavirus type 16 associated cervical. precancer. J
Pathol. 195, 179-185, 1999.

MEDZHITOV, R.; JANEWAY, C Jr. The Toll like receptors family and microbial
recognition. Trends Microbiol. 8, 452-456, 2000.

MESTECKY, J.; FULTZ, P. N. Mucosal immune system of the human genital tract. J
Infect Dis. Vol. 179 Suppl3, p.470-474, 1999.

MESQUITA JÚNIOR, D.; et al. Sistema Imunitário – Parte II Fundamentos da resposta


imunológica mediada por linfócitos T e B. Rev Bras Reumato; 50(5):552-80, 2010.

MISTRY, N.; WIBOM, C.; EVANDER, M. Cutaneous and mucosal human


papillomaviruses differ in net surface charge, potential impact on tropism. Virol J. vol.5,
n.1, p.118–123, 2008.

MIURA, S.; et al. CD1d, a sentinel molecule brindging innate and adaptative immunity, is
downregulated by the human papillomavirus (HPV) E5 protein: A possible mechanism
for immune evasion by HPV. J. Virol, 202, 1507-1516, 2010.

MOLLING, J. W.; et al. CD4(+) CD25hi regulatory T-cell frequency correlates with
persistence of human papillomavirus type 16 and T helper cell responses in patients
with cervical intraepithelial neoplasia. International Journal of cancer. 121(8), 1749-
1755, 2007.

MOODY, C. A.; LAIMINS, L. A. Human papillomavirus oncoproteins: pathways to


transformation. Nature Reviews Cancer, Vol. 10, No. 8, p. 550-560, 2010.

MOTA, F.; et al. The antigen-presenting environment in normal and human


papillomavirus (HPV)-related premalignant cervical epithelium. Clin Exp Immunol 116,
33-40, 1999.

MOTA, F.F.; et al. Differential regulation of HLA-DQ expression by keratinocytes and


Langerhans cells in normal and premalignant cervical epithelium. Tissue Antigens. Vol.
52, p.286–293, 1998.

MÜNGER, K.; PETER M.; HOWLEY, P. M. Human papillomavirus immortalization and


transformation functions. Virus Research, Vol. 89, No. 2, p. 213-228, 2002.

MUNÕZ, N.; et al. Epidemilogic classification of human papillomavirus types associated


with cervical cancer. The New England Journal Medicine, Vol. 348, No 6, pp. 518-527,
Feb 2003.
78

MUÑOZ, N.; et al. Chapter 1: HPV in the etiology of human cancer. Vaccine. Vol.24,
Suppl 3, p.1–10, 2006.

NAKANISHI, Y.; et al. CD8+ T lymphocyte mobilization to virus-infected tissue requires


CD4+ T-cell help. Nature vol. 462, p. 510-513, 2009.

NASU, K.; NARAHARA, H. Pattern recognition via the toll-like receptor system in the
human female genital tract. Mediat Inflamm. 2010, 2010.

NONNENMACHER, B.; et al. Genital human papillomavirus infection identification by


molecular biology among asymptomatic women. Revista de Saúde Pública, v. 36, n. 1,
p. 95-100, 2002.

NUMASAKI, M.; et al. Interleukin-17 promotes angiogenesis and tumor growth. Blood,
vol. 101, p. 2620–2627, 2003.

O'BRIEN, P.M.; CAMPOS, M.S. Evasion of host immunity directed by papillomavirus-


encoded proteins. Virus Research, Vol. 88, No. 2, pp.103-117, 2002.

PAESI, S.; et al. High prevalence of human papillomavirus type 58 in patients with
cervical pre-malignant lesions in southern Brazil. J Med Virology. 81: 1270-1275, 2009.

PALEFSKY, HOLLY. Molecular virology and epidemiology and human papillomavirus


and cervical cancer. Cancer epidemiology, Biomarkers and prevention. 4, 415-428,
1995.

PAPANICOLAOU, G. N. A New Procedure for Staining Vaginal Smear. Science, n.95,


pp. 438-439, 1942.

PARDO GOVEA, T.; et al. Expressión de interleferon gamma (IFN-γ), fator de necrosis
tumoral alfa (TNF-α) e interleucinas 2,4 y 6 (IL-2, IL-4, IL-6) em células de neoplasias
intrepiteliais de cuello uterino: Reporte preliminar. Invest clin 46, 1, 5-13, 2005.

PUDNEY, J.; QUAYLE, A. J.; ANDERSON, D. J. Immunological microenvironments in


the human vagina and cervix: mediators of cellular immunity are concentrated in the
cervical transformation zone. Biology of reproduction, 73(6), 1253-1263, 2005.

PULENDRAM, B.; AHRMED, R. Translating innate immunity into immunological


memory: implications for vaccine development. Cell; vol.124:,p. 849–63, 2006.

RAMA, C.; et al. Previous screening for cervical cancer among women with cytological
and histological abnormalities. Revista de Saúde Pública, v. 42, n. 3, p. 411-419, 2008.

RAMIREZ-SALAZAR, E. R.; et al. HPV16 E2 could act as down-regulator in cellular


genes implicated in apoptosis, proliferation and cell differentiation. Virology Journal,
London, v. 8, p. 247, 2011.
79

RENGA, B.; et al., The bile acid sensor FXR is required for immune-regulatory activities
of TLR-9 in intestinal inflammation, PLoS One, 8(1), e54472, 2013.

RICHARDSON H.;et al. The Natural History of Type-specific Human Papillomavirus


Infections in Female University Students. Cancer Epidemiology Biomarkers &
Prevention, v. 12, n. 6, p. 485-490, June 2003.

RICHART R. M. Natural history of cervical intraepithelial neoplasia. Clin Obstet Gynec;


5:748-794, 1968.

RICHART, R. M. Natural history of low-grade CIN. 19o International papillomavirus


Conference. Florianópolis-SC, Brasil, 2001.

ROBERTSON, S. A.; et al. Semen elicits immunological changes in the human cervix. J
Soc Gynecol Invest, 9(Abstract 502), 228A, 2001.

ROCK, K. L.; et al. The sterile inflammatory response. Annual review of immunology, 28,
321, 2010.

ROSALES, R.; ROSALES, C.; Immune therapy for human papillomaviruses-related


cancers. World J Clin Oncol, 10; 5(5): 1002-1019, 2014.

ROSZAK, A.; et al. TNF-α-308 G/A as a risk marker of cervical cancer progression in the
Polish population. Mol Diagn Ther. v.19, p.53-7, 2015.

SAIKI, R. K.; et al. Enzymatic amplification of beta-globin genomic sequences and


restriction site analysis for diagnosis of sickle cell anemia. Science, 230 (4732), 1350-
1354, 1985.

SAKAGUCHI, S. Regulatory T cells: mediating compromises between host and parasite.


Nature Immunology, New York, v. 4, n. 1, p. 10-11, 2003.

SAPP, M.; et al. Organization of the major and minor capsid proteins in human
papillomavirus type 33 virus-like particles. Journal of General Virology, Vol. 76, No. 9, p.
2407-2412, 1995.

SASAGAWA, T.; TAKAGI, H.; MAKINODA, S. Immune responses against human


papillomavirus (HPV) infection and evasion of host defense in cervical cancer. J Infect
Chemother. Published online: DOI 10.1007/s10156-012-0485-5, 2012.

SCHEURER, M. E.; TORTOLERO-LUNA, G.; ADLER-STORTHZ, K. Human


papillomavirusinfection: biology, epidemiology and prevention. Int J Gynecol Cancer, vol
15, pp. 727-46, 2005.
80

SCHIFFMAN M.; et al. A Population-Based Prospective Study of Carcinogenic Human


Papillomavirus Variant Lineages, Viral Persistence, and Cervical Neoplasia. Cancer
Research, v. 70, n. 8, p. 3159 – 3169, Abril 2010.

SCHIFFMAN, M.; et al. Human papillomavirus and cervical cancer. The Lancet, v. 370,
n. 9590, p. 890-907, 2007.

SCHIFFMAN, M.; KJAER, S. K. Natural history of anogenital human papillomavirus


infection and neoplasia. J Natl Cancer Inst Monogr, 31, 14-19, 2003.

SILVA, A. M. T. C.; AMARAL, M. V. T.; CRUZ, A. D. C. HPV e câncer: o papel do


Papiloma vírus humano na carcinogênese. Biotecnologia Ciência e Desenvolvimento,
Brasília, v. 29, p. 48-54, 2002.

SIN, J.I. MyD88 signal is required for more efficient induction of Ag-specific adaptive
immune responses and antitumor resistance in a human papillomavirus E7 DNA vaccine
model. Vaccine 29, 4125–413, 2011.

SINGH, S.; JOHNSON, J.; CHELLAPPAN, S. Small molecule regulators of Rb-E2F


pathway as modulators of transcription. Biochim Biophys Acta. Vol. 1799(10-12): p. 788-
94, 2010.

SMITH, J. S.; et al. Human papillomavirus type distribution in invasive cervical cancer
and high‐grade cervical lesions: A meta‐analysis update. International journal of
cancer, v. 121, n. 3, p. 621-632, Agosto 2007.

SMITH, J. S.; et al. Age-specific prevalence of infection with human papillomavirus in


females: a global review. Journal of Adolescent Health, v. 43, n. 4, p. S5-e1, 2008.

SOLOMON, D.; et al. The 2001 Bethesda System: terminology for reporting results of
cervical cytology. Jama, 287(16), 2114-2119, 2002.

SONG, S. H.; et al. Interferon-γ (IFN-γ): A possible prognostic marker for clearance of
high-risk human papillomavirus (HPV). Gynecologic Oncology 108, 543–548, 2008.

SPELLBERG B, EDWARDS Jr J.E. Type 1/Type 2 immunity in infectious diseases. Clin


Infect Dis;32(1):76–102, 2001.

STAFL A, WILBANKS GD. An international terminology of colposcopy: report of the


Nomenclature Committee of the International Federation of Cervical Pathology and
Colposcopy. Obstet Gynecol. 77:313, 1991.

STANLEY, Immunology of HPV Infection. Curr Obstet Gynecol Rep 4:195–200, 2015.

STANLEY, M. Immune responses to human papillomavirus. Vaccine, vol. 24(Suppl 1),


p.16–22, 2006.
81

STANLEY, M.; PETT, M.; COLEMAN, N. HPV: from infection to cancer. Biochem Soc
Trans. Vol.53, n.6, p.1456–1460, 2007.

STANLEY, M. Pathology and epidemiology of HPV infection in females. Gynecologic


Oncology, v. 117, n. 2, p. S5-S10, Maio 2010.

STEENBERGEN, R. D.; et al. HPV-mediated transformation of the anogenital


tract. Journal of Clinical Virology, v. 32, p. 25-33, 2005.

STTROBER, S.; et al. Cloned natural supressor cell lines express CD3+ CD4- CD8-
surface phenotype and the alpha, beta heterodimer of the T cell antigen receptor. J
Immunol; 143:1118-22, 1989.

STURM-RAMIREZ, K.; et al. High levels of tumor necrosis factor-alpha and interleukin-
1beta in bacterial vaginosis may increase susceptibility to human immunodeficiency
virus. J Infect Dis. Vol. 182:, p. 467-473, 2000.

SUGAMURA, M.; et al. Essential role of tumor necrosis fator α (TNF- α) in tumor
promotion revealed by TNF- α deficient mice. Cancer Res, 59, 4516-4518, 1999.

TANG, T.; et al. MicroRNA-182 plays an onco-miRNA role in cervical cancer. Gynecol
Oncol. Vol. 129:,p. 199-208, 2013.

TANESE, K., et al. E. A Cell Surface CD74–MIF Interactions Drive Melanoma Survival
in Response to Interferon-γ. Journal of Investigative Dermatology, (2015).

THIERRY, F.; SPYROU, G.; YANIV, M.; HOWLEY, P. Two AP1 sites binding JunB are
essential for human papillomavirus type 18 transcription in keratinocytes. Journal of
Virology, Vol. 66, No. 6, p. 3740-3748, 1992.

TORRE, L. A.; et al. Global Cancer Statistics, 2012. CA: a cancer journal for clinicians,
v. 65, n. 2, p. 87, 2015.

TROTTIER, H.,; FRANCO, E. L. The epidemiology of genital human papillomavirus


infection. Vaccine. Vol. 24S1 , p. S1/4–S1/15, 2006.

TYRING, S.K. Human papillomavirus infections: epidemiology, pathogenesis, and host


immune response. J Am Acad Dermatol. Vol. 43, p. 518-526, 2000.

VINODHINI, K.; et al. Prevalence and risk factors of HPV infection among women from
various provinces of the world. Archives of gynecology and obstetrics, v. 285, n. 3, p.
771-777, 2012.

WANG, B.P.A.; SAUDER, D.P. Role cytokines in epidermal Langerhans cell migration. J
Leukoc Biol 66, 33-39, 1999.
82

WEINSTOCK, H.; BERMAN, S.; CATES, W. JR. Sexually transmitted diseases among
American youth: incidence and prevalence estimates. Perspect Sex Reprod
Health;36:6-10, 2004.

WELTERS, M. J.; et al. Frequent display of human papillomavirus type 16 E6-specific


memory t-Helper cells in the healthy population as witness of previous viral encounter.
Cancer Res.63(3):636–41, 2003.

WENTZENSEN, N.; VINOKUROVA, S.; VON KNEBEL DOEBERITZ, M. Systematic


review of genomic integration sites of human papillomavirus genomes in epithelial
dysplasia and invasive cancer of the female lower genital tract. Cancer research, v. 64,
n. 11, p. 3878-3884, 2004.

WIRA, C.R.; et al. Innate and adaptive immunity in female genital tract: cellular
responses and interactions. Immunol Rev. vol. 206, p. 306-335, 2005.

WOODWORTH, C. D.; et al. Interleukin la and tumor necrosis factor a stimulate


autocrine amphiregulin expression and proliferation of human papillomavirus-
immortalized and carcinoma-derived cervical epithelial cells. Cell Bio ogy, Vol. 92, pp.
2840-2844, 1995.

XIE, J. J.; et al. The Th17/Treg functional imbalance during atherogenesis in ApoE(−/−)
mice. Cytokine. p.49:185, v.93, 2010.

YANG, R.; et al. Papillomavirus capsid mutation to escape dendritic cell-dependent


innate immunity in cervical cancer. Journal of virology, 79(11), 6741-6750, 2005.

ZHANG, Y.; et al. The imbalance of Th17/Treg in patients with uterine cervical cancer.
Clin Chim Acta. 412:894–900, 2011.

ZUR HAUSEN, H. Papillomavirus infections - a major cause of human cancers.


Biochimica et Biophysica Acta. 1288,F55-F78, 1996.

ZUR HAUSEN, H. Papillomaviruses in the causation of human cancers - a brief


historical account. Virology, Vol. 384, No. 2, p. 260-265, 2009. ISSN 0042-6822, 2009.

ZHU, J.; et al. The transcription factor T-bet is induced by multiple pathways and
prevents an endogenous Th2 cell program during Th1 cell responses. Immunity, 37(4),
660-673, 2012.
83

9. ANEXO
9.1. Parecer do CEP
84

9.2. Questionário

MINISTÉRIO DA EDUCAÇÃO
UNIVERSIDADE FEDERAL DO RIO GRANDE DO NORTE
CENTRO DE BIOCIÊNCIAS
DEPARTAMENTO DE MICROBIOLOGIA E PARASITOLOGIA

1. Identificação (Iniciais do nome):


2. Data / / (dia/mês/ano)
DADOS GERAIS
3. Data de nascimento: / / (dia/mês/ano) Idade: Anos
4. Estado Civil: ( ) solteira ( ) casada ( ) viúva ( ) separada/divorciada ( ) estável
4.1 Estado conjugal : ( ) vive sem parceiro fixo ( ) vive com parceiro fixo
5. Escolaridade: ( ) analfabeto ( ) fundamental incompleto ( ) fundamental completo ( )
médio incompleto ( ) médio completo ( ) superior incompleto ( ) superior completo
6. Cor: ( ) branca ( ) não branca

HISTÓRIA MÉDICA
7. Idade à primeira relação sexual: anos de vida
8. Quantas vezes ficou grávida? Gravidezes.
9. Com quantos homens já teve relação? ( Incluindo atual parceiro ) Homens.
10. Com que freqüência você usa preservativo nas relações sexuais:
( ) Nunca ( ) Raramente ( ) A maioria das vezes ( ) Sempre
11. Você já teve ao menos uma destas doenças sexualmente transmissíveis
(Trichomonas,gonorréia, HPV, sífilis): ( ) Não ( ) Sim ( ) Ignorado
12. Você já realizou tratamento para HPV, verruga genital, NIC? ( ) Não ( ) Sim
( ) Ignorado
13. Algum parceiro seu teve ou tem HPV, ou outra doença sexualmente transmissível? (
) Não ( ) Sim ( ) Não sabe

FATORES DE RISCO
85

14. Já fez Citologia (Preventivo)? ( ) Sim ( ) nunca


Quando foi o último? Meses Anos ( ) Não lembra
15. A senhora fuma? ( ) Não ( ) Sim
16. Quantos cigarros por dia? ( ) Até 5 ( ) 5-10 ( ) 10-15 ( ) 15-20 ( ) Mais que 2

EXAME FÍSICO E RESULTADOS DOS EXAMES:

1.Inspeção da genitália:

a) Vulva: ( ) sem lesões ( ) com lesões TIPO?


b) Vagina: ( ) sem lesões ( ) com lesões CORRIMENTO?

2.Colo (COLPOSCOPIA) visualização da JEC?

( ) sem lesões ( ) inflamatória ( ) EAB ( ) MOSAICO ( ) PONTILHADO


( ) VASOS ATÍPICOS

3.Resultado da citologia:

( ) Normal ( ) Inflamatória ( ) ASCUS/ LSIL ( ) ASCUS/HSIL ( ) ASC-H

( ) LSIL ( ) HSIL ( ) CARCINOMA ESCAMOSO ( ) ADENOCARCINOMA

( ) Insatisfatória, por?

5.Resultado da biópsia:

( ) Normal, ( ) METAPLASIA/CERVICITE, ( ) LSIL,

( ) HSIL, ( ) CARCINOMA ESCAMOSO,( ) ADENOCARCINOMA.


86

9.3. Termo de Consentimento Livre e Esclarecido

Você está sendo convidada a participar da pesquisa: “Caracterização dos biomarcadores e


do perfil imunológico de mulheres infectadas pelo HPV segundo o local e a gravidade da
lesão”.

ESCLARECIMENTO

O câncer de colo do útero é uma causa importante de doença e mortalidade em mulheres. Esta doença
se relaciona a infecção pelo vírus do papiloma humano (HPV), porém não se sabe exatamente como o
vírus age no sistema imunológico determinando que algumas mulheres eliminem o vírus e outras tenham
câncer, quando não tratadas. O motivo que nos leva a este estudo é aumentar o conhecimento sobre a
infecção causada pelo vírus e sobre como nosso organismo se defende contra eles.
Para realizarmos o presente estudo iremos colher material da boca, do ânus e do colo do útero de
mulheres que apresentaram lesões por HPV no preventivo. Este material servirá para confirmar a
presença do vírus e determinar o tipo de HPV. Além disso, você realizará um exame de colposcopia para
localização da lesão que veio descrita no seu preventivo. Se houver lesão nós faremos uma biópsia para
retirar um pedaço do colo que está alterado e para saber se é portadora do HPV e doença causada por
ele. Desta forma poderemos ter certeza do diagnóstico e também fazer a avaliação do seu sistema imune
em relação ao HPV.
Coletaremos também sangue para pesquisar outras doenças transmitidas por relação sexual, como HIV e
Hepatites B e C. O sangue coletado para o exame de HIV também poderá ser utilizado para completar
essa avaliação do seu sistema imunológico. As informações obtidas serão analisadas em conjunto com
as de outros voluntários, não sendo divulgada a identificação de nenhum paciente. Você terá o direito de
receber os resultados de todos os exames coletados, de desistir de participar da pesquisa se não desejar
coletar os exames e de ser mantida atualizada sobre os resultados parciais das pesquisas, quando em
estudos abertos, ou de resultados que sejam do conhecimento dos pesquisadores.A sua participação
neste estudo poderá gerar algum desconforto na região genital, e poderemos ter o risco de sangramento
e infecção após a biópsia, porém o benefício do diagnóstico correto do HPV e do adequado tratamento é
superior ao risco e indispensável para que se tiver o vírus não desenvolva câncer. Além disso, poderá
gerar algum constrangimento por se tratar de pesquisa sobre doença sexualmente transmissível e que
exige exame de vagina, útero e ânus. Para minimizar os riscos de complicações na genitália e de
constrangimento, a coleta das informações pessoais e do material de pesquisa será feita por
pesquisadores capacitados em ambiente reservado, garantindo total privacidade. Em caso de dano
pessoal, diretamente causado pelos procedimentos ou tratamentos propostos neste estudo (nexo causal
comprovado), você terá direito a tratamento médico na Instituição, bem como às indenizações legalmente
estabelecidas.
O médico-pesquisador responsável pela sua consulta fará o seu tratamento ou encaminhamento, quando
for necessário, garantindo o seu completo atendimento na rede de saúde, no que tange as lesões por
HPV. Não há despesas pessoais para o participante em qualquer fase do estudo, incluindo exames e
consultas. Também não há compensação financeira relacionada à sua participação. Se existir qualquer
despesa adicional, ela será absorvida pelo orçamento da pesquisa. Existe compromisso do pesquisador
de utilizar os dados e o material coletado somente para esta pesquisa e de divulgar seus resultados em
revista científica.Você poderá esclarecer qualquer dúvida sobre a pesquisa sempre que quiser, com a
pesquisadora responsável, DRA. MARIA DA CONCEIÇÃO CORNETTA pelo telefone (84) 32062116,
email- mcornetta@hotmail.com, ou com os pesquisadores responsáveis pela coleta de material, DR.
RICARDO NEY COBUCCI pelo telefone (84) 32229741, email- rncobucci@hotmail.com e DRA.ELVIRA
BARBALHO, email- elvirabarbalho@hotmail.com. Você tem a liberdade da retirada de consentimento a
qualquer momento e pode deixar de participar do estudo quando quiser sem qualquer prejuízo à
87

continuidade de seu tratamento na Instituição, bastando comunicar a decisão aos pesquisadores, ou aos
comitês de ética em pesquisa relacionados abaixo.

1) Comitê de Ética em Pesquisa do Hospital Universitário Onofre Lopes- CEP/HUOL

Av. Nilo Peçanha, 620-Petrópolis- CEP 59012-300- Natal-RN

Telefone: (84) 33425003

2) Comitê de Ética em Pesquisa da Universidade Potiguar

Av.Senador Salgado Filho, 1610 – Lagoa Nova – Natal-RN

Telefone: (84) 32151219.