Você está na página 1de 24

See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/292176812

Systematic review on Endolimax nana: A less well studied intestinal ameba

Article · January 2016


DOI: 10.4103/2229-5070.175077

CITATIONS READS

5 1,287

2 authors:

Casper Sahl Poulsen Christen Rune Stensvold


Technical University of Denmark Statens Serum Institut
6 PUBLICATIONS   44 CITATIONS    194 PUBLICATIONS   3,451 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Global Water Pathogen Project View project

Escherichia coli in Inflammatory Bowel Disease View project

All content following this page was uploaded by Christen Rune Stensvold on 29 March 2016.

The user has requested enhancement of the downloaded file.


Vol 6/ Issue 1/ January 2016
Tropical Parasitology • Volume 6 • Issue 1 • January-June 2016 • Pages 01-000
Review Article

Systematic review on Endolimax nana: A less well studied intestinal


ameba
Casper Sahl Poulsen, Christen Rune Stensvold
Department of Microbiology and Infection Control, Laboratory of Parasitology, Statens Serum Institut, Copenhagen, Denmark

KEY WORDS ABSTRACT


Diagnosis, epidemiology, Of the so-called nonpathogenic intestinal protozoa, Endolimax nana belongs to the
infectious diseases, protozoon, ones least well described. Most data on E. nana have emerged from general surveys of
public health intestinal parasites in selected cohorts and mostly in the absence of any particular focus
on Endolimax. Hence, the genus of Endolimax remains largely unexplored in terms of
morphology, taxonomy, genetic diversity, host specificity, and epidemiology. In this review,
we seek to provide an overview of the work that has been performed on the parasite since
the genus Endolimax was described by Kuenen and Swellengrebel in 1917 and suggest
activities that may pave the way for a better understanding of E. nana in a clinical and
public health context.

INTRODUCTION unavailable at present. A simple search for “Endolimax”


in PubMed and Web of Science on the 26th  of March
The genus Endolimax appears to consist of a large number
2015 identified 265 and 304 articles, respectively, with
of species based on its reported occurrence in a vast range
an overlap of 255. The vast majority of these articles
of mammals, and it has moreover been described in birds,
were general surveys/prevalence studies focusing
reptiles, and amphibians. Descriptions have been based
on intestinal parasites in general with no particular
on morphology and sometimes limited to identification
focus on Endolimax. Narrowing down the search to
of a cyst stage. Analyzed specimens have been recovered
“Endolimax (title),” the number of articles decreased to
from stool samples or directly from the intestinal lumen
19 and 25 (overlap, 19), respectively. In reality, much
if the animal was necropsied. Recently, an ameba closely
more work than this has been carried out on Endolimax,
related to Endolimax was also recovered from various
but most of the literature is relatively old and might not
tissues of a fish (Solea senegalensis).[1]
be indexed in the aforementioned search engines; this
could also be the reason why such articles are not cited
An overview of fundamental information such as
in the more recent literature. In this study, older articles
host specificity, pathogenicity, and epidemiology is
were identified mainly by backtracking using already
Address for correspondence
available articles, and it turned out that Endolimax
Dr. Christen Rune Stensvold, research has been carried out by many groups that have
Laboratory of Parasitology, Statens Serum Institut, Building 37/137, been debating issues that can be resolved with modern
Artillerivej 5, DK–2300 Copenhagen S, Denmark.
E-mail: run@ssi.dk
This is an open access article distributed under the terms of the Creative
Commons Attribution‑NonCommercial‑ShareAlike 3.0 License, which allows
Access this article online others to remix, tweak, and build upon the work non‑commercially, as long as the
author is credited and the new creations are licensed under the identical terms.
Quick Response Code:
Website:
For reprints contact: reprints@medknow.com
www.tropicalparasitology.org

How to cite this article: Poulsen CS, Stensvold CR. Systematic review
DOI: on Endolimax nana: A less well studied intestinal ameba. Trop Parasitol
2016;6:8-29.
10.4103/2229-5070.175077
DOA: 04-11-2015, DOP: 28-01-2016

8 © 2016 Tropical Parasitology | Published by Wolters Kluwer - Medknow


Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

day technologies. The goal of this review is therefore to which had been lasting for 17 years at the time of his last
provide an overview of some of the work that has been publication on Endolimax.[7]
performed on Endolimax nana since the genus Endolimax
was described by Kuenen and Swellengrebel[2] in 1917 TAXONOMY
and the species E. nana by Wenyon and O’Connor[3]
Silberman et al.[12] performed the first DNA-based study
in 1917 and Brug [4] in 1918. Central topics such as
on E. nana and were able to obtain a complete sequence
morphology, taxonomy, host specificity, epidemiology,
of the Endolimax SSU rRNA gene. It is noteworthy that
pathogenicity, diagnosis, and treatment are reviewed
this sequence is still the only available sequence of
and discussed. Where applicable, emphasis is given on
E. nana in the NCBI database, despite the fact that it
how previous discussions in the scientific community
has been 16  years since the sequence was deposited.
might be elucidated and resolved using state-of-the-art
Compared with other amoebozoa, the SSU rRNA gene
technology.
of Endolimax is relatively long (more than 2500 bases),
which is in part due to AT-rich expansion regions, with
MORPHOLOGY AND LIFE CYCLE
no evidence of introns.[12] In their phylogenetic analysis,
E. nana inhabits the colon and has also been found Silberman et al.[12] placed Endolimax as a sister taxon to
in the appendix.[5-7] Trophozoites (8–10  µm) move by the Entamoeba assemblage. Cavalier-Smith et al.[13] later
pseudopodia and may reach a size of up to 30 µm during performed phylogenetic analyses with more sequences,
locomotion. They feed exclusively on bacteria and including various Mastigamoeba sequences and placed
divide by binary fission. The nucleus is vesicular and Endolimax in the family Endolimacidae, which included
spherical, measuring 2.0–2.5  µm, with a polymorphic Endolimax and Endamoeba. Sequencing the SSU rRNA
karyosome. [6-9] Before excystation, the trophozoite gene of Iodamoeba, Stensvold et al. [14] found that it
divides without growing, producing stages that are grouped together with Endolimax, but failed to establish
smaller but with nuclei of the same size. At first, the monophyly for Iodamoeba. To clarify the phylogenetic
cyst contains one nucleus that divides twice by mitotic position of Endolimax, there was a clear need for further
division. When mature, cysts of Endolimax are oval and studies on intrageneric diversity.[14,15] Recently, and
very small (6–9  µm × 5–7  µm) compared with cysts mostly due to availability of more sequences from related
of other intestinal amebae. The cyst wall appears thin organisms, Zadrobílková et al.[16] were able to obtain
(80  nm), colorless, and smooth on the outside. In the monophyly for both Endolimax and Iodamoeba.
cytoplasm, no mitochondria, Golgi apparatus, rough
endoplasmic reticulum, centrioles, or microtubules are SSU rRNA gene sequences were recently obtained
present. Uniquely among intestinal amebae, E. nana has from a new species identified in a sole that was named
elongated tubular structures consisting of ribosome-like Endolimax piscium;[1] while these sequences did cluster
particles.[7,9,10] The cyst typically contains four nuclei, but specifically with E. nana, they were highly divergent.[16]
it is possible that Endolimax may produce supernucleate However, there is still a need for additional sequences
cysts where up to four of the four nuclei perform of both E. nana and Endolimax isolated from nonhuman
an additional division, producing cysts containing hosts to investigate intrageneric diversity and further
5–8 nuclei; this might, however, be a somewhat rare clarify the taxonomic status of the genus.
phenomenon.[7,9] Segal[11] argued that the nuclei in excess
of four were in fact chromatoid bodies that might be Meanwhile, it has proved challenging to obtain complete
the same as the elongated tubular structures mentioned SSU rRNA genes from Endolimax. This is mostly due
above. The nucleus has a thin nuclear membrane with to the fact that general eukaryotic primers are prone
chromatin deposits and no pores.[7,9,10] The cysts are to amplifying ribosomal genes that comprise fewer
excreted in feces and may survive for up to 2 weeks when bases than that of Endolimax; for instance, Blastocystis
incubated at room temperature and for up to 2 months has a SSU rRNA ribosomal gene of about 1800  bp,
at lower temperatures; this, however, is under optimal and since Blastocystis is very often present in stool
conditions, and survival times are lower under natural samples positive for Endolimax, general primers tend
settings such as in feces or water.[6,7] Trophozoites may to amplify Blastocystis preferentially over Endolimax
survive in stool for up to 1 day when feces is incubated when applied to genomic DNA extracted from stool.
at room temperature.[6] After ingestion, the ameba excysts Moreover, sequences derived from Endolimax-positive
by escaping through a pore in the cyst wall, divides polymerase chain reaction products often turn out to be
by successive cytoplasmic bipartition into uninucleate more or less unreadable, probably for the same reasons
amebae, and turn into the trophic stage. as for Iodamoeba.[14] It might therefore prove useful to
develop phylogenies based on other genes; preferably
Infection may last for many years exemplified by the genes such as actin that are also likely to be conserved
experimental infection that Dobell performed on himself, in Endolimax.

Tropical Parasitology 9 Jan 2016 | Volume 6 | Issue 1 |


Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

HOST SPECIFICITY provided an overview of the different Endolimax species


named to date [Table  1]. Arguments have been made
The host specificity of Endolimax has been debated in the
against some of these species names, including the
older literature.[6,17,18] Wenrich[19] stated that Endolimax
possibility that some were in fact Iodamoeba as in the case
species cannot be differentiated based on morphology
of E. kueneni.[6] Moreover, morphological descriptions
and pointed out the need for experimental infection
disqualify the species described as E. reynoldsi, which
studies to investigate the host specificity of Endolimax.
has cysts with only one nucleus,[19] and some species
Among such studies, Dobell[6] is the only person to
described as distinct may in fact be the same species, for
date to have performed experimental infections on
instance E. nana, Endolimax gildemeisteri, and Endolimax
humans, namely on himself. He had examined his
cynomolgi.[6]
own feces for many years and found it to be negative
for Endolimax before experimentally infecting himself
There might be a need to revise the taxonomy of
with Endolimax from what was called a Macacus sinicus.
Endolimax. We have recently observed extensive genetic
The infection established, he was later able to infect
variation in the SSU rRNA gene among human-derived
a so-called M. rhesus with his own Endolimax isolate.
Endolimax (unpublished data). The only complete SSU
Some believed in a limited host range and proposed
rRNA sequence of E. nana available in Genbank is from
new species names for the isolates of different animals
a monkey (Cercocebus albigena) isolate,[33] which clusters
[Table  1], whereas others[18] believed that E. nana was
with only some of our unpublished human-derived
able to infect a wide range of hosts. Dobell[6] was more
sequences, indicating that there may be different
cautious in drawing conclusions before having more
ribosomal lineages infecting humans and nonhuman
evidence. This confusion is also evident from the great
primates, as was already observed in the closely related
number of Endolimax species described. Constenla et al.[1]
genus of Iodamoeba.[14] The genetic diversity might also
explain the differences in host specificity observed
Table 1: Species of Endolimax reported to date (modified from
between research groups, as discussed above. Yarinsky
Constenla et al. 2014)
and Burrows[34] observed general differences in the size
Species Host References
of trophozoites between infected individuals suggesting
E. reynoldsi American swift (lizard) McFall[20] the existence of at least two lineages of Endolimax based
E. greganiformis/ Bird Tyzzer;[21] Hegner[22]
on this morphological characteristic. To investigate the
E. janisae
E. leptocoridis Boxelder bug Kay[23]
host specificity and classification of Endolimax spp., DNA
E. blattae Cockroach Lucas[24] sequence data should be obtained from animal isolates as
E. ranarum Frog Hegner[22] well as humans and analyzed by phylogenetic methods.
E. caviae Guinea pig Hegner[22]
E. nana/ Human Wenyon and EPIDEMIOLOGY
E. gildemeisteri O’Connor;[3] Brug;[4]
Momcilo[25] Endolimax is transmitted through fecal-oral contamination
E. kueneni/ Monkey Brug[26] of food or water.[35-37] Endolimax cysts have been observed
E. cynomolgi* in drinking water from deep wells,[38] on raw consumed
E. tayassusi/ Pig De Mello and Amaral;[27] vegetables, [39] and on banknotes, which have been
E. suis Simitch et al.[28] suggested to be potential fomites.[40]
E. ratti Rat Chiang[29]
E. piscium Sole Constenla et al.[1]
The scientific literature abounds with studies that have
E. termitis Termite Kirby[30]
surveyed the prevalence of Endolimax in human stools
E. clevelandi Turtle Gutierrez‑Ballesteros
and Wenrich[31] samples. This can be explained by its inclusion in studies
No species Cattle, horse, goat, Wenrich;[19] Stark et al.[32] that investigate the prevalence of intestinal parasites
name provided sheep, rock fish, in general, based on for instance microscopy of fecal
millipede, crane‑fly concentrates. Due to the overwhelming number of
larva, Japanese beetle
studies, an overview of the prevalence, study groups, and
larva, and leech
*E. kueneni was erroneously identified as Iodamoeba by Brug  (1920), who
methods have been included in Supplementary Table 1.
later described E. cynomolgi as being a “true Endolimax”. Since Endolimax We tried to estimate the global prevalence based on
from macaques can infect humans and vice versa, E. cynomolgi is most likely data from healthy individuals and including articles
E. nana, as discussed by Dobell (1933). The names E. kueneni and E. cynomolgi
are still used. E. reynoldsi: Endolimax reynoldsi, E. greganiformis: Endolimax that were only 20 years old or less. These studies were
greganiformis, E. janisae: Endolimax janisae, E. leptocoridis: Endolimax mainly performed on schoolchildren, minority groups, or
leptocoridis, E. blattae: Endolimax blattae, E. ranarum: Endolimax ranarum,
E. caviae: Endolimax caviae, E. nana: Endolimax nana, E. gildemeisteri: Endolimax controls. By calculating weighted averages, we estimated
gildemeisteri, E. kueneni: Endolimax kueneni, E. cynomolgi: Endolimax cynomolgi, the global prevalence in healthy individuals to be 13.4%,
E. tayassusi: Endolimax tayassusi, E. suis: Endolimax suis, E. ratti: Endolimax ratti,
E. piscium: Endolimax piscium, E. termitis: Endolimax termitis, E. clevelandi: Endolimax
yielding 950,000,000 possibly infected individuals. Based
termitis on patient samples or reports in articles older than

Jan 2016 | Volume 6 | Issue 1 | 10 Tropical Parasitology


Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

20  years, the global prevalence is estimated to about performed postmortem examination of infected monkeys
3.4% [Table 2]. The relatively high estimate in healthy and failed to discover any amebic lesions of the intestine.
individuals is mainly attributable to two articles from Some authors have argued that Endolimax can cause
Africa where the prevalence of Endolimax was above irritation of the crypts of the intestinal mucosa, referring
80%.[41,42] The inclusion of countries in Central America to observations by Swerdlow and Burrows; [48] the
in the continent of North America probably leads to empirical data to support such a statement are limited,
overestimation of the prevalence in this continent, the however, since this report is on Dientamoeba fragilis and
opposite potentially being true by the inclusion of the only one case was co-infected with Endolimax.
Middle East in Asia. In general, apparently most carriers
of E. nana are found in Africa and South America, which It is common to find reports on associations between
comprise several developing countries. A relatively low diarrhea and Endolimax infections.[49-52] This association
prevalence is generally observed in studies from Asia, may at least in part be explained by Endolimax being
but the very low prevalence estimate in symptomatic an indicator of fecal contamination, which may often
patients compared with controls is mainly due to entail co-infection by other organisms capable of causing
the inclusion of a large study carried out in Israel.[43] diarrhea. In a couple of case studies, Endolimax was
It is challenging to develop a precise estimate of the associated with chronic diarrhea;[52-54] all cases responded
prevalence of Endolimax in Asia due to the limited well to treatment, and it was not possible to detect other
amount of data from India and China, the two most infections except in the study by Shah et al.[52] where
populous countries in the world. It is expected that the one case was co-infected with Blastocystis. It is possible
prevalence be overestimated from articles available that the cysts in the study published by Fitzgerald and
due to publication bias, since it is unlikely that E. nana O’Farrell[53] are not Endolimax cysts since they were
is mentioned unless observed and recorded. Likewise, described as having only one nucleus. Twelve cases were
there are no studies to these authors’ knowledge where described in the study by Sanchez[55] who concluded that
the prevalence of Endolimax is described as the primary E. nana is possibly pathogenic.
focus of the article. On the other, it is expected that
some studies have not included findings of Endolimax There are also case studies that associate E. nana with
because it was considered unimportant in relation to urticaria[56] and polyarthritis.[57] Alarcón-Segovia and
the study aim. In addition, investigators may lack the Abud-Mendoza[58] objected to the latter study, which
skills to identify this parasite, including differentiating it was followed by a reply from Liakos and Burnstein[59]
from other amebas, as reported by Angel Núñez et al.,[44] in the same journal issue. The objections included
leading to an underestimation of the prevalence of that no tests of reactive arthritis were performed, that
Endolimax is presumably noninvasive, and that the
E. nana.
treatment with metronidazole could eradicate other
disease-causing organisms; in addition, no efforts were
CLINICAL SIGNIFICANCE
made to investigate whether any such organisms were
Endolimax is considered a nonpathogenic commensal present. The reply stated that testing did not reveal any
protozoon parasitizing the human colon;[6,9] this or a other pathogenic organisms, but that such organisms
similar description is given in most textbooks.[37,45-47] could possibly be present. There is some evidence that
The evidence supporting Endolimax as nonpathogenic is Endolimax may give rise to an immunological response,
scarce, but in the study where Dobell[6] infected himself, including eosinophilia.[60,61] There are no known cases
the author did not experience any symptoms. Dobell[6] of Endolimax crossing the intestinal barrier in humans;

Table 2: Estimated prevalence of Endolimax nana by continent and globally


Continent Prevalence range in Prevalence range in healthy Population† Total number of infected individuals
nonhealthy individuals (%)* individuals (%) (weighted based on prevalence of healthy individuals
(weighted average [%], total average [%], total number of (patients/surveys older than 20 years)
number of individuals tested) individuals tested)
Africa 0.33-30.4 (3.3, 370,962) 16.2-83.8 (81.5, 8,805) 995,000,000 811,029,528 (32,460,171)
Asia 0.098-21.4 (1.6, 707,009) 0-16.4 (0.51, 71,589) 4,140,000,000 21,050,161 (66,690,042)
Australia 0.80-41.2 (17.7, 3123) NA‡ 36,000,000 183,045§ (6,386,167)
Europe 0-29.9 (5.4, 13,836) 1.5-2.1 (1.7, 2482) 739,000,000 12,505,238 (39,844,897)
North America 0.39-50.2 (4.4, 237,186) 0.30-23.9 (6.9, 2,120) 529,000,000 36,431,132 (23,318,278)
South America 0.47-50.5 (16.6, 76,906) 1.8-41.2 (18.2, 8,819) 386,000,000 70,380,769 (64,028,840)
Globally 0-50.5 (3.4, 1,409,022) 0-83.8 (13.9, 93,815) 6,825,000,000 951,579,874 (232,728,396)
*This group comprises samples obtained from patient groups and from all studies performed before 1995. This cut‑off was chosen based on the difficulty of getting
clear information on study group and to avoid including articles in calculations of the prevalence in healthy individuals that are biased by being outdated, †Population
statistics obtained from June 8th 2015: http://www.worldpopulationstatistics.com/continent‑population/, ‡No studies performed that met the criteria, §Calculated
using the weighted average prevalence of Asia

Tropical Parasitology 11 Jan 2016 | Volume 6 | Issue 1 |


Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

however, E. piscium was recently described in a sole in direct examination is performed on fresh stool samples
both intestinal and nonintestinal tissue.[1] [Figure 1d].

The authors of this review are of the opinion that the Based on the single SSU rRNA gene sequence in
sporadic articles on E. nana present too little evidence GenBank, in-house primers have been developed
in favor of the assertion that Endolimax should be [Table  3] that have proved partially effective for
considered pathogenic with the ability to cause diarrhea diagnosing E. nana in genomic DNA extracted from
or intestinal inflammation. The clinical picture may fresh stool. It was from sequences generated using these
be subtle, however, and it has been suggested that primers that the high variation in the SSU rRNA genes
symptoms may develop if a heavy infection is present[54] mentioned previously was observed. Meanwhile, DNA
or that the pathogenicity might be limited to particularly from microscopy-positive samples have sometimes failed
virulent strains.[59] to show amplification with these primers. Due to the
high variation in SSU rDNA (unpublished observations),
DIAGNOSIS AND TREATMENT designing genus-specific primers based on a single
sequence or only a few sequences is problematic. There
The diagnosis of Endolimax traditionally relies
is a need for more reference sequences to develop
on microscopy of cysts, which can be direct or
better diagnostic primers that also eliminates selection
coupled with a concentration procedure and different
for specific Endolimax strains. It is currently unknown
stains prior to analysis. Concentration can be
whether the primers included in Table 3 will also amplify
formalin-based [Figure 1a], and when the fecal concentrate
Endolimax from hosts other than humans.
is stained with iodine, cysts of E. nana appear gibbous[7]
[Figure  1b]. This gibbous appearance is however not
Endolimax appears to respond well to both metronidazole
always present and almost absent when cysts are
and diphetarsone treatment. Stauffer and Levine[54] were
concentrated using a sucrose gradient and stained with
able to treat two cases with metronidazole, although it
iodine [Figure 1c]. The cysts of Endolimax and E. hartmanni
appears that two courses of treatment were necessary in
both have four nuclei but can be differentiated by E. nana
one of the cases. The same treatment with metronidazole
having a larger punctuate karyosome and peripheral
was successful in a single case in the study by Burnstein
chromatin, both of which features however may be
and Liakos.[57] Based on these two studies, Graczyk et al.[51]
quite difficult to discern.[8,47] Endolimax stains with both
recommend metronidazole for Endolimax treatment,
Ziehl–Neelsen and trichrome. Cysts of E. nana are some
administered as 250  mg 3  times a day for 10  days. In
of the smallest among those of the amebas, which is
a study by Keystone et al.,[63] a 98% cure rate (n  =  44)
why it is recommended to use a microscope with at
was observed with diphetarsone 500 mg 3 times a day
least ×400 magnification to avoid missing them but also
for 10 days. In vitro studies have revealed little effect of
in order to be able to distinguish them from E. hartmanni.
streptomycin[64] and emetine[6] on Endolimax. Treatment
A large number of cysts may be excreted compared with
of concurrent pathogenic parasites revealed little effect
other amebae (Entamoeba coli, E. histolytica/E. dispar),
on Endolimax using emetine[6] or mebendazole.[35]
with an estimate of about 8000 cysts/g, but with a few
“heavy shedders.” It is possible that Endolimax is shed
CONCLUSIONS
periodically.[62] Trophozoites are rarely observed, unless
Based on available data, the global prevalence of E. nana
in healthy individuals is estimated to be 13.9% on
average, which, however, is probably an overestimation
as discussed above; still, hundreds of millions are most
likely infected. Very little research has been performed
on Endolimax since the 1920s, 30s, and 40s. With the
availability of DNA-based detection methods, resolving
a b
major issues such as host specificity, diversity, and
which Endolimax species that can infect humans should
be straightforward. In addition, the development of
diagnostic primers will allow Endolimax to be detected
with high sensitivity using fecal DNAs and distinguished
easily from other amebae. The clinical significance of
c d Endolimax is still an unresolved issue. Prior exposure
Figure 1: Cysts of Endolimax nana in direct smear (a), concentrated (immunity), parasite load, and genetic variability might
with formalin and ethyl acetate and stained with iodine showing the
characteristic gibbous appearance (b), and isolated on a sucrose
influence clinical presentation. Little evidence points
gradient and stained with iodine, respectively (c). Image (d) shows a toward Endolimax being pathogenic, but a few articles
Endolimax nana trophozoite provide data on Endolimax-based stimulation of the
Jan 2016 | Volume 6 | Issue 1 | 12 Tropical Parasitology
Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Table 3: In‑house primers for detecting and characterizing Endolimax


Forward primer Reverse primer
Name Sequence Name Sequence
Endoligenus F 5´‑GTGGAATGCTTTCGCTCTC‑3´ Endoligenus R 5´‑GAGATTGTGCTTGGATGGAC‑3´
Limax 1F 5´‑CGTGGAATGGAGAAGGATAAC‑3´ Limax 1R 5´‑GCTACTCTATCATGTCTTTGTCTTGC‑3´
Limax 2F 5´‑GGAGCAATTGGAATGAAAGCAAG‑3´ Limax 2R 5´‑CGTCGTAGTCTCAACCATAAACG‑3´

immune system; whether this is a harmful or beneficial Phylogeny of the genera Entamoeba and Endolimax as
modulatory effect remains unknown. Hopefully, the deduced from small-subunit ribosomal RNA sequences.
Mol Biol Evol 1999;16:1740-51.
present review will stimulate interest in Endolimax
13. Cavalier-Smith T, Chao E, Oates B. Molecular phylogeny
research, which may eventually render Endolimax a not of Amoebozoa and the evolutionary significance of the
so inconspicuous companion. unikont Phalansterium. Eur J Protistol 2004;40:21-48.
14. Stensvold CR, Lebbad M, Clark CG. Last of the human
Acknowledgement protists: The phylogeny and genetic diversity of
Dr. Marianne Lebbad, The Swedish Agency of Iodamoeba. Mol Biol Evol 2012;29:39-42.
Public Health, and Dr. Maria Midgely, Liverpool School 15. Ptácková E, Kostygov AY, Chistyakova LV, Falteisek L,
of Tropical Medicine and Hygiene, are both thanked for Frolov AO, Patterson DJ, et al. Evolution of archamoebae:
Morphological and molecular evidence for pelobionts
providing images. including Rhizomastix, Entamoeba, Iodamoeba, and
Endolimax. Protist 2013;164:380-410.
Financial support and sponsorship 16. Zadrobílková E, Walker G, Cepicka I. Morphological and
Nil. molecular evidence support a close relationship between
the free-living archamoebae Mastigella and Pelomyxa.
Protist 2015;166:14-41.
Conflicts of interest
17. Hegner R. Host-parasite Relations Between Man and His
There are no conflicts of interest. Intestinal Protozoa. New York: The Century Co.; 1927.
18. Kessel J. Host-parasite relationships of certain intestinal
REFERENCES protozoa important to medical zoology. JAMA
1. Constenla M, Padrós F, Palenzuela O. Endolimax piscium sp. 1928;90:1089-92.
nov. (Amoebozoa), causative agent of systemic granulomatous 19. Wenrich D. Host-parasite Relations Between Parasitic
disease of cultured sole, Solea senegalensis Kaup. J Fish Protozoa and Their Hosts. American Philosophical
Dis 2014;37:229-40. Society: Proceedings of the American Philosophical
2. Kuenen W, Swellengrebel N. Korte beschrijving van Society; 1935. p. 605-50.
enkelc minder bekendc protozoeo uit denmenschelijkcn 20. McFall CM. Endolimax reynoldsi nov. sp. from the
darm. Geneesk. Tijdschr v Nederl; 1917. p. 496. Intestine of the Common Swift, Sceloporus undulatus.
3. Wenyon C, O’Connor F. Human Intestinal Protozoa in the J Parasitol 1926;12:191-8.
Near East. London: J. Bale, Sons and Danielsson, Ltd.; 1917. 21. Tyzzer EE. Amoebae of the caeca of the common fowl
4. Brug S. Enkele opmerkingen over de nomenclatuur van and of the Turkey.– Entamoeba gallinarum, SP. N. and
cenige nieuwere parasieten uit den menschelyken darm. Pygolimax gregariniformis, Gen. et Spec. Nov. J Med Res
Batavia Geneesk: Tydsehr Ned Ind; 1918. p. 283-5. 1920;41:199-210.1.
5. Cerva L, Schrottenbaum M, Kliment V. Intestinal 22. Hegner RW. Endolimax caviae n. sp. from the Guinea-Pig
parasites: A study of human appendices. Folia Parasitol and Endolimax janisae n. sp. from the Domestic Fowl.
(Praha) 1991;38:5-9. The American Society of Parasitologists. J Parasitol
1926;12:146-7.
6. Dobell C. Researches on the intestinal protozoa of
monkeys and man. V. The endolimax of macaques. 23. Kay MW. Two new amoebae from the box elder bug,
Parasitology 1933;25:436-67. Leptocoris trivittatus Say. Am Midl Nat 1940;23:724-8.
7. Dobell C. Researches on the intestinal protozoa of 24. Lucas CL. Two New Species of Amoeba found in
monkeys and man. XI. The cytology and life-history of Cockroaches: With notes on the cysts of Nyctotherus
endolimax nana. Parasitology 1943;35:134-58. ovalis Leidy. Parasitology 1927;19:223-35.
8. Yarinsky A, Burrows R. Atypical nuclei of Endolimax 25. M o m c i l o I . B e i t r ä g e z u r k e n n t n i s d e r
nana in purged stool specimens. Am J Clin Pathol entwicklungsgeschichte einer im menschlichen
1966;46:490-3. enddarme lebenden Endolimax-amöbe (Endolimax
gildemeisteri spec. nov.). Zentralblatt für Bakteriologie,
9. Dobell C. The Amoebae Living in Man: A Zoological Parasitenkunde, Infektionskrankheiten und Hygiene;
Monograph. London: J. Bale and Danielsson; 1919. 1936. p. 377-98.
10. Zaman V, Howe J, Ng M, Goh TK. Ultrastructure of the 26. Brug S. Endolimax kueneni n.sp., Parasitic in the intestinal
Endolimax nana cyst. Parasitol Res 2000;86:54-6. tract of the monkey Macacus cynomolgus. Parasitology
11. Segal B. Budding and other variations in Endolimax nana, 1920;12:378-9.
a comparison with Councilmania tenuis Kofoid, 1928. 27. De Mello IF, Amaral AD. Note on an ameba of the genus
Am J Hyg 1932;15:741-52. Endolimax, intestinal parasite of the peccary Tayassus
12. Silberman JD, Clark CG, Diamond LS, Sogin ML. tajacu. An Inst Med Trop (Lisb) 1952;8:615-9.

Tropical Parasitology 13 Jan 2016 | Volume 6 | Issue 1 |


Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

28. Simitch T, Chibalitch D, Petrovitch Z, Heneberg N. 45. Roberts L, Schmidt G, Janovy J. Gerald D. Schmidt and
Contribution to the knowledge of the fauna of intestinal Larry S. Roberts’ Foundations of Parasitology. 8th ed.
protozoa of Yugoslavian pigs. Their experimental Boston: McGraw-Hill Higher Education; 2009.
identification. Arch Inst Pasteur Alger 1959;37:401-8. 46. Levine N. Protozoan Parasites of Domestic Animals and
29. Chiang SF. The rat as a possible carrier of the dysentery of Man. 1st ed. Minneapolis: Burgess Pub. Co.; 1961.
amoeba. Proc Natl Acad Sci USA 1925;11:239-46. 47. Ash LR, Orihel TC. Atlas of Human Parasitology. 5th ed.
30. Kirby H. Studies on some amoebae from the termite Chicago: ASCP Press; 2007.
Mirptermes with notes on some other Protozoa from the 48. Swerdlow MA, Burrows RB. Dientamoeba fragilis, an
Termitidae. Q J Microsc Sci 1927;71:189-223. intestinal pathogen. J Am Med Assoc 1955;158:176-8.
31. Gutierrez-Ballesteros E, Wenrich DH. Endolimax 49. Peters C, Kocka F, Chittom A, Sable R, Janda W. High
clevelandi, n. sp. from turtles. J Parasitol 1950;36:489-93. carriage of Endolimax-nana in diarrheal specimens from
32. Stark D, Phillips O, Peckett D, Munro U, Marriott D, homosexual men. Lett Appl Microbiol 1987;5:65-6.
Harkness J, et al. Gorillas are a host for Dientamoeba 50. Iqbal J, Hira PR, Al-Ali F, Philip R. Cryptosporidiosis
fragilis: An update on the life cycle and host distribution. in Kuwaiti children: Seasonality and endemicity. Clin
Vet Parasitol 2008;151:21-6. Microbiol Infect 2001;7:261-6.
33. Clark CG, Diamond LS. Intraspecific variation and 51. Graczyk TK, Shiff CK, Tamang L, Munsaka F, Beitin AM,
phylogenetic relationships in the genus Entamoeba Moss WJ. The association of Blastocystis hominis and
as revealed by riboprinting. J Eukaryot Microbiol Endolimax nana with diarrheal stools in Zambian
1997;44:142-54. school-age children. Parasitol Res 2005;98:38-43.
34. Yarinsky A, Burrows R. Increase in number of Endolimax 52. Shah M, Tan CB, Rajan D, Ahmed S, Subramani K, Rizvon K,
nana trophozoites with typical nuclei in serial et al. Blastocystis hominis and Endolimax nana co-infection
samples of purged stool specimens. Am J Clin Pathol resulting in chronic diarrhea in an immunocompetent
1966;46:494-5. male. Case Rep Gastroenterol 2012;6:358-64.
35. Hostetler LD. Microbiology problem. Am J Med Technol 53. Fitzgerald O, O’farrell TT. Chronic diarrhoea due to
1981;47:328-9. Endolimax nana infestation. Ir J Med Sci 1954;346:467-8.
36. Sard BG, Navarro RT, Esteban Sanchis JG. Non-pathogenic 54. Stauffer JQ, Levine WL. Chronic diarrhea related
intestinal amoebae: A clinical-analytical overview. to Endolimax nana: Response to treatment with
Enferm Infecc Microbiol Clin 2011;29 Suppl 3:20-8. metronidazole. Am J Dig Dis 1974;19:59-63.
37. Garcia L, Bruckner D. Diagnostic Medical Parasitology. 55. Salazar Sanchez A. Infestation with Endolimax nana;
2nd ed. Washington, DC: ASM Press; 1993. preliminary report. Rev Fac Med Univ Nac Colomb
38. Guillen A, Gonzalez M, Gallego L, Suarez B, Heredia H, 1957;25:214-8.
Hernandez T, et al. Presence of intestinal protozoans 56. Veraldi S, Schianchi-Veraldi R, Gasparini G. Urticaria
in water of consumption in “18 de Mayo Community”. probably caused by Endolimax nana. Int J Dermatol
Aragua State-Venezuela. 2011. Bol Malariol Salud 1991;30:376.
Ambient 2013;53:29-36.
57. Burnstein SL, Liakos S. Parasitic rheumatism presenting
39. Monge R, Chinchilla M, Reyes L. Seasonality of parasites as rheumatoid arthritis. J Rheumatol 1983;10:514-5.
and intestinal bacteria in vegetables that are consumed
raw in Costa Rica. Rev Biol Trop 1996;44:369-75. 58. Alarcón-Segovia D, Abud-Mendoza C. Parasitic
rheumatism by Endolimax nana. Objections. J Rheumatol
40. Moreno P, Perfetti D, Antequera I, Navas P, Acosta M. 1985;12:184-5.
Contamination of banknotes with enteric parasites
in Coro, Falcon state, Venezuela. Bol Malariol Salud 59. Liakos S, Burnstein S. Parasitic rheumatism by
Ambient 2014;54:38-46. Endolimax-nana – Reply. J Rheumatol 1985;12:184-5.
41. Raso G, Utzinger J, Silué KD, Ouattara M, Yapi A, Toty A, 60. Cerva L, Kliment V. Contribution to the problem of the
et al. Disparities in parasitic infections, perceived ill so-called nonpathogenic amoebae in the intestine of man.
health and access to health care among poorer and less Folia Parasitol (Praha) 1978;25:367-70.
poor schoolchildren of rural Côte d’Ivoire. Trop Med Int 61. Yamaguchi N, Takeuchi T, Kobayashi S, Tanabe M,
Health 2005;10:42-57. Miura S, Asami K, et al. Health status of Indochinese
42. Ouattara M, Silué KD, N’Guéssan AN, Yapi A, Barbara M, refugees in Japan: Statistical analyses on anemia,
Raso G, et al. Prevalence and polyparasitism of intestinal eosinophilia and serum alkaline phosphatase. Southeast
protozoa and spatial distribution of Entamoeba histolytica, Asian J Trop Med Public Health 1984;15:209-16.
E. dispar and Giardia intestinalis from pupils in the rural 62. Garrido-Gonzalez E, Zurabian R, Acuna-Soto R.
zone of Man in Côte d’Ivoire. Sante 2008;18:215-22. Cyst production and transmission of Entamoeba and
43. Ben-Shimol S, Sagi O, Greenberg D. Differences in Endolimax. Trans R Soc Trop Med Hyg 2002;96:119-23.
prevalence of parasites in stool samples between three 63. Keystone JS, Proctor E, Glenn C, McIntyre L. Safety and
distinct ethnic pediatric populations in Southern Israel, efficacy of diphetarsone in the treatment of amoebiasis,
2007-2011. Parasitol Int 2014;63:456-62. non-pathogenic amoebiasis and trichuriasis. Trans R Soc
44. Angel Núñez F, Ginorio DE, Finlay CM. External quality Trop Med Hyg 1983;77:84-6.
assessment in coproparasitology in Havana City Province, 64. Pfeiffer AV. Effect of streptomycin on Endolimax nana
Cuba. Cad Saude Publica 1997;13:67-72. in vitro. J Parasitol 1948;34:142-6.

Jan 2016 | Volume 6 | Issue 1 | 14 Tropical Parasitology


Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Supplementary Table 1: Summary of prevalence articles used to estimate the global prevalence
Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Europe. From Armengol et al.[1] Spain, Guadalquivir Valley, in the period 1.6 (1,917) Only specify coprological
articles with healthy 1994-1996, Children between 6 and analysis and Graham method
that are not older 10 years old without symptoms from
than 20 years 20 villages
Sagebiel et al.[2] Germany, Berlin, Kids in kindergarten, 1.5 (202) Microscopically examination
response rate 59 % of stools does not specify
concentration or staining methods
Schlosser et al.[3] France, two groups: Group one sewage 2.1 (363) from Two concentration techniques
workers and group two food-handlers group two merthiolate-iodine-formalin and
Bailenger’s method
Europe. From Cerva and Kliment[4] Czech republic, Prague hospital, 5.7 (10,418) Faust’s flotation-concentration
articles with symptomatic patients with suspected method and wet smears stained
patients that are intestinal parasitosis with ferric haematoxylin after
older than 20 years Heidenhain
Chin and Gerken[5] Great Britain, London, two groups: 21.7 (83) and 0 (43) Formol-ether concentration
Group one homosexual attending the from group one and
department of genitourinary medicine two, respectively
and group two controls medical students
and laboratory technicians
Jokipii et al.[6] Finland, two groups: Group one healthy 29.9 (190) and Fresh stools: Diluted in warm
homosexual volunteers and group 1.2 (172) from Locke’s solution and examined
two healthy students, employees of group one and two, to detect trophozoites, iodine
a government office and hospital or respectively staining and formalin ether
laboratory personel serving as controls concentration
Portus and Prats[7] Spain, Barcelona, Stool samples from 4.5 (650) Sapero and Lawless (MIFD) and
patients at hospital that was submitted with the biphasic concentration
for parasitic investigation method of Blagg et al. (MIFC)
Schlosser et al.[3] France, two groups: Group one sewage 5.1 (126) from Two concentration techniques
workers and group two food-handlers group one merthiolate-iodine-formalin and
Bailenger’s method
Soriano et al.[8] Saharawi children hosted in Spain 8.9 (270) Direct smear, Ritche
concentration, Kinyoun’s
modified staining and
trichrome staining
Sterba et al.[9] Czechoslovakia, South Bohemia, 0.8 (1750) NA
agricultural workers, from 1975 to 1982
Stürchler and Peter[10] Switzerland, Jura, schoolchildren 7 to 1.5 (134) MIF-stool-samples
16 years
Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
North America. Aimpun and Hsieh[11] Belize, Toledo district, 5 villages 0.30 (672) Formalin-ethyl-acetate
From articles with concentration
healthy that are not Faulkner et al.[12] Mexico, state of Tamaulipas, children 5.3 (438) Centrifugal flotation with
older than 20 years saturated zinc sulfate and
Sheathers sucrose solutions, fecal
smears stained with trichrome
Kurup and Hunjan[13] Saint Lucia, rural villages, school children 2.1 (554) Parasep concentration and
aged 0-19 years, response rate 100 % Kato-Katz
Mendoza et al.[14] Cuba, San Miguel del Padron 23.9 (456) Direct and Ritchie’s
municipality, from children in day-care concentration
centers, three fecal samples from each
North America. Acuna-Soto et al.[15] Mexico, state of Chiapas, in the village 50.2 (201) Formalin-ethyl acetate
From articles with of Navenchauc, random sample of sedimentation, lugol
patients that are 48 households
older than 20 years Barrett et al.[16] Jamaica, children with HIV/AIDS in 2.4 (42) NA
children’s homes, two fecal examined
from each child
Bruckner [17] USA, Los Angeles, patients, large part 13.0 (1,350) and 8.5 Formail-ether concentration,
had Spanish surnames, two groups: (493) from group one Gomori’s Trichrome
Group one from Olive view Medical and two, respectively
center and group two from Harbor
General hospital
Contd...
Tropical Parasitology 15 Jan 2016 | Volume 6 | Issue 1 |
Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Supplementary Table 1: Contd...


Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Church et al.[18] USA, Rocky Mountain region, patients 1.5 (2,604) ParaPak, Formalin vial
experiencing gastrointestinal discomfort processed by filtered
centrifugation stained with
Lugol’s iodine, confirmation
stool in Zn-PVA vials stained
with trichrome
Church et al.[19] Canada, Calgary, gay men with a 41 (58) Specified as standard methods
majority HIV positive, it is not clear if it
is the whole group that the prevalence is
specified from
Edouard et al.[20] Martinique, samples examined at Fort de 1.25 (4,684) NA
France University Hospital, patients, not
unique samples
Elliott et al.[21] USA, Texas Gulf Coast, samples send for 0.5 (1,626) Direct smear with saline
parasitological investigation and stained with D’Antoni’s
iodine, then by a smear from
a concentrate prepared by the
zinc-sulfate flotation method.
Some samples also concentrated
by formol-ether and ethyl-
acetate
Haddad and USA, New Orleans, foreign seamen with 5 (99) NA
Agrawal[22] adominal symptoms
Kabani et al.[23] Canada, Calgary, patients at childrens 0.39 (1,532) Formalin-ethyl acetate
hospital concentration, hematoxylin/
Kinyoun stain and unstained
Kappus et al.[24] USA, specimens examined for intestinal 4.2 (216,275) NA
parasites by the state diagnostic
laboratories in 1987
Peters et al.[25] USA, Chicago, 3 hospitals (1, 2 and 39 (61), 31.6 (418) Iodine stain direct and
3) Patients from hospital 1 and 2 was and 9 (418) attending after formalin ethyl acetate
primarily homosexual men. Symptomatic hospital 1, 2 and 3, concentration
respectively
Ramirez-Miranda Mexico, IBS patients 3.2 (62) NA
et al.[26]
Ribes et al.[27] USA, Kentucky, patients suffering from 0.95 (315) Formalin-ethyl acetate
diarrhea submitting samples for ova and concentration, Kinyoun
parasite examination modified acid-fast- and
trichrome stain
Robinson et al.[28] Jamaica, healthy food handlers, two 8.1 (99) and 8.8 (113) Ritchie formalin-ether
groups: Group one HTLV-1 positive and from group one and concentration
group two HTLV-1 negative two, respectively
Rojas et al.[29] Cuba 10.3 (5,850) Direct, Willis’ brine flotation and
Kato-Katz thick smear
Tsaihong et al.[30] USA, New York city, homosexual men 5.2 (77), 15.3 (111) Filtered and concentrated
with gastrointestinal illness, three and 13.9 (72) from by centrifugation, saline wet
groups: Group one AIDS patients, anti group one, two and mount, iodine wet mount and
HIV positive and anti HIV negative three, respectively trichrome stain
Ungar et al.[31] USA, Migrant farmworkers working on 6.8 (339) Formaldehyde-ether technique
the Delmarva Peninsula
Wilkins and USA Texas and Northern Mexico 9.5 (273) NA
Horner[32] Chihuahua, clinical patients
Yamamoto-Furusho Mexico, patients with ulcerative colitis 9 (215) Trichrome stain on polyvinyl
and Torijano- alcohol preserved samples
Carrera[33] other formalin-ethyl acetate
concentration examined no stain
described
Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Contd...

Jan 2016 | Volume 6 | Issue 1 | 16 Tropical Parasitology


Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Supplementary Table 1: Contd...


Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
South America. Acurero et al.[34] Venezuela, State of Zulia, school 19 (133) Direct examination, formol-ether
From articles with children, one fecal sample from each concentration and lugol
healthy that are not Alves et al.[35] Brazil, Southeast Piaui state 13.6 (265) Spontaneous sedimentation
older than 20 years Assis et al.[36] Brazil, Maxakali indigenous villages in 10.3 (1497) Formalin ethyl-acetate based
Minas Gerais, three stools collected on concentration (TF-test® kit)
alternate days
Berbert-Ferreira and Brazil, State of Minas Gerais, Sucling 1.76 (56) Hoffman, Pons and Janer’s
Costa-Cruz [37] babies (4-12 months), at nursery, 6 slides method, lugol stain
for each sample
Bermudez et al.[38] Colombia, Cali, children, at least two 60 (63) Direct and after concentration
samples examined does not specify which, Kato-
Katz and Ziehl-Neelsen
Biscegli et al.[39] Brazil, Catanduva, children from day 2.3 (133) NA
care center 7 – 78 months
Bracciaforte et al.[40] Argentina, Cordoba, children 6 months 7.3 (150) Direct and after Willis and
to 21 years old Ritchie concentration methods
Castro et al.[41] Brazil, Sao Paolo, Children from 2 (50) from group Hoffman-Pons-Janer centrifugal
a daycare center, two groups: Group one two flotation in zinc sulfate and
exhibiting diarrhea and group two non Baermann-Moraes
diarrheal
Damazio et al.[42] Brazil, northern Espirito Santo, 4.9 (82) Spontaneous sedimentation,
quilombola community stained with Lugol and
examined in triplicates
Flores et al.[43] Peru, communities located along the 39.6 (91) Direct examination, Kato
banks of Lake Titicaca, adults and technique, spontaneous
children sedimentation, Lumbreras rapid
sedimentation
Franke et al.[44] Peru, Lima, children, two groups: Group 18.5 (189) from Direct smear and spontaneous
one diagnosed with Tuberculosis and group two sedimentation methods
group two healthy
Freites et al.[45] Venezuela, State of Zulia, food handlers 41.2 (119) Wet mount, Ritchie
concentration, Modified Ziehl-
Neelsen staining
Ibanez et al.[46] Peru, Alto Maranon area in the amazon 23.9 (1049) Direct microscopy and lugol
jungle, schoolchildren 6-15 years old stain, Teleman’s and Kinnyouns
technique
Kobayashii et al.[47] Brazil, Sao Paulo, inhabitants of five 2.3 (222) Formalin-ether concentration,
farms Lugol stain
Korkes et al.[48] Brazil, Sao Paulo, children 20.8 (120) Direct exam, Kato-Katz,
Lutz-Hoffman spontaneous
sedimentation, Rugai, Mattos
and Brisola, thermal migration
and Zinc sulfate flotation
Laugart et al.[49] Venezuela, Barinas state, children 38.9 (262) Direct wet mount, Ritchie
younger than 15 years old (formalin-ether) concentration
and Kato Katz thick smear
Machado et al.[50] Brazil, Minas Gerais, children, Three 2.5 (160) Modified Baermann, Lutz,
fecal samples collected from each lugols iodine stain of six slides
for each sample and read by two
investigators
Mercado et al.[51] Chile, Calbuco county, rural county, one 16.4 (256) NA
sample per individual
Milano et al.[52] Argentina, children 1.8 (113) Modified Teleman, lugol
staining
Mora et al.[53] Venezuela, Sucre state, inhabitants of 17.8 (426) Direct, physiological saline
cities neighboring different rivers that solution and modified Ritchie
was also investigated for the presence of concentration, stained with lugol,
parasites modified Kinyoun and trichrome
Moura et al.[54] Brazil, Sao Paulo, first grade school 4.8 (146) NA
children
Contd...

Tropical Parasitology 17 Jan 2016 | Volume 6 | Issue 1 |


Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Supplementary Table 1: Contd...


Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Munoz-Antoli et al.[55] Nicaragua, children 34.8 (382) Formalin-ether concentration
and examination using iodine
wet mount and modified Ziehl-
Neelsen
Nascimento and Brazil, Pitanga city 33.7 (128) Direct wet mount, zinc sulphate
Moitinho[56] flotation, tube sedimentation,
formalin-ether, stained by
Kinyoun and iron hematoxylin
Rios et al.[57] Brazil, state of Amazonas, Lauarete district 10.3 (895) NA
Rivero-Rodriguez Venezuela, Maracaibo, schoolchildren 22.9 (349) Fresh test and after formol-ether
et al.[58] concentration
Saldiva et al.[59] Brazil, Sao Paolo, children 1-12 years 43 (520) NA
from rural areas, Three fecal samples
collected from each
Santos and Merlini[60] Brazil, Parana state 6.5 (431) Spontaneous sedimentation and
centrifugal fecal flotation
Silva et al.[61] Brazil, Minas Gerais, horticulturists, 13 (30) NA
three stool samples
Tabares and Columbia, Antioquia, Sabaneta, children 8.2 (97) NA
Gonzalez 2008[62] under 12 years, examined up to three
stool samples or less if positive
Takizawa et al.[63] Brazil, food handlers, 3 fecal samples 25.9 (343) Lutz, modified Ritchie and
collected over a 7 day period in same modified Ziehl-Neelsen staining
flask
Tashimi et al.[64] Brazil, children 3.0 (101) Faust concentration
RAPD agarose gel image
analyzer
South America. Amancio et al.[65] Brazil, Botucatu, HIV/AIDS patients, 1.9 (105) Formalin ethyl-acetate based
From articles with three fecal samples collected on alternate concentration (TF-test® kit) and
patients or that are days stained with Lugol’s solution
older than 20 years Bouree et al.[66] Peru, 4 native villages from the tribe 46 (165) NA
Cashibo in Amazonia
Cancrini et al.[67] Bolivia, Camiri, Gutierrez and Boyuibe 2.1 (381) NA
areas, healthy individuals
Carvalho-Costa Brazil, Rio de Janeiro, children with acute 0.5 (213) Not all methods performed on
et al.[68] diarrhea all samples but included, Direct
examination and examination
after Ritchie and safranin-
methylene blue staining
Castro et al.[41] Brazil, Sao Paolo, Children from a 6 (50) from group Hoffman-Pons-Janer centrifugal
daycare center, two groups: Group one one flotation in zinc sulfate and
exhibiting diarrhea and group two non Baermann-Moraes
diarrheal
Cho et al.[69] Ecuador, Guayas province, Palmar, 5.5 (325) Direct smear stained with lugol
mestizo population, collected from patients
Cimerman et al.[70] Brazil, AIDS patients 3.5 (200) Processed according to
Hoffman, Faust and Rugai
Franke et al.[44] Peru, Lima, children, two groups: Group 21.2 (189) from Direct smear and spontaneous
one diagnosed with Tuberculosis and group one sedimentation methods
group two healthy
Garibaldi et al.[71] Chile, Putaendo chronic patients from 50.5 (229) NA
the psychiatric hospital
Goldin et al.[72] Chile, Santiago nursery and primary 43 (722) Formol-ether concentration
school children
Guignard et al.[73] Argentina, orphaned and homeless 34.6 (396) Concentrated with Teleman
children living in substitute homes method, stained with Kinyoun’s
stain, Lugol and trichomic.
Kulik et al.[74] Brazil, two groups: Group one 16.3 (86) and 1.4 (146) Faust, Lutz and Rugai methods
hemodialysis patients and group two from group one and
attenders of local public health center two, respectively
Contd...

Jan 2016 | Volume 6 | Issue 1 | 18 Tropical Parasitology


Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Supplementary Table 1: Contd...


Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Maia et al.[75] Brazil, Amazonas state, children 17.9 (451) NA
0-10 years presenting at outpatient
clinics in Manaus
Merlano et al.[76] Columbia, Atlantico, patients 20.3 (423) NaCl parasite-concentration
compared with wet mount
Moura et al.[77] Brazil, Rio de Janeiro, aids patients 18.2 (95) Four methods: Faust, Kato-Katz,
Baermann-Moraes and Baxby
Navarrete and Chile, province of Valdivia, coastal area, 34.4 (219) NA
Torres[78] primary school children
Rivero-Rodriguez Venezuela, patients with HIV/AIDS 3.9 (56) Direct, formol-ether, Kinyoun-
et al.[79] and fast Gram-Chrornotrope
stain
Silva et al.[80] Brazil, Sao Paulo, neoplastic patients 3.3 (30) Lutz, and Rugai, in triplicate
Torres et al.[81] Chile, Valdivia River Basin 19.7 (970) NA
Urbina et al.[82] Columbia, Cartagena and Sincelejo, 3.2 (253) Direct wet mount
children and infants with acute diarrhea
Valles et al.[83] Venezuela, patients 9.1 (3060) Direct examination with
saline and lugol and Kato’s
concentration technique
Vidal et al.[84] Chile, Talca, preschool and school 26.3 (10,205), 19.7 NA
children, 6 periods divided into 1980-84, (12,010), 18.0
1985-89, 1990-94, 1995-99, 2000-04 and (11,680), 16.7
2005-07 (11,810), 8.6 (12,050)
and 10.1 (10,387)
Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Asia. From articles Abdel-Dayem et al.[85] Jordan, food handlers working at 0.11 (901) Wet mount preparations with
with healthy that luxurious hotels in the dead sea area physiological saline and iodine.
are not older than Formalin-ether concentration
20 years Akdemir and Turkey, older than 15 years 0.44 (675) Native and formalin-ethyl
Helvaci[86] acetate sedimentation
Amin[87] Saudi Arabia, Jeddah, healthy food 0,4 (250) NA
handlers
Azian et al.[88] Malaysia, Pahang, aborigine community 10.8 (130) Samples fixed in polyvinyl
alcohol, Trichrome staining
Ben-Shimol et al.[89] Israel, Southern Israel, children, samples 0.0065 (45,978) Sedimentation based
collected over 5 year period, not unique concentration. Stained with and
samples, but did not include samples without lugol
collected within 30 days of last sample
Börekci and Uzel[90] Turkey, Mersin, Children living in social 2.8 (106) Formol-ether-acetate, native
service child care centre lugol, Kinyoun’s acid fast
staining
Cengiz et al.[91] Turkey, Van, Children attending primary 0.3 (395) Native-lugol, flotation and
school trichrome staining
Cengiz et al.[92] Turkey, Van, Children attending primary 1.8 (2,975) Native-lugol, flotation and
school trichrome staining
Danchaivijitr Thailand, food handlers working at 4.1 (121) and 1.6 Identified by microscopy (does
et al.[93] included hospital, examined twice: 1st time in 2002 (129) from 1st and not specify how)
1st examination in and 2nd time in 2004 after education on 2nd examination,
calculations hand hygiene and treatment of positive respectively
cases
Daryani et al.[94] Iran, Sari, schoolchildren 1.5 (1,100) added Direct and after formalin-ether
both mono- and concentration staining with
polyparasitism Ziehl-Neelsen and trichrome
where E. nana is
included
Degerli Turkey, Alahaci village primary school 1st examination NA
et al.[95] included children in Sivas, examined twice at six 4.2 (189) and 2nd
1st examination in months intervals examination 0 (175)
calculations
Contd...

Tropical Parasitology 19 Jan 2016 | Volume 6 | Issue 1 |


Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Supplementary Table 1: Contd...


Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Guducuoglu et al.[96] Turkey, Van province, 1st and 2nd grade 0.5 (195) NA
students
Hamamci et al.[97] Turkey, Kayseri-Hacilar region, Children 1.8 (328) Native-lugol
attending primary school
Kia et al.[98] Iran, Mazandaran province, rural 0.7 (855) Formalin-ethyl-acetate
inhabitants, collected randomly concentration
Kitvatanachai and Thailand, Lak Hok subdistrict, 7.9 (202) Direct examination and after
Rhongbutsri[99] government schools aged 7-12 years, modified formalin-ether
fecal samples requested from 1253 concentration technique
students received 202
Koshak and Zakai[100] Saudi-Arabia, pre-employment workers 16.4 (292) Formalin ether, iodine stain
and their families
Kurtoglu et al.[101] Turkey, Van region, food sector workers 0.27 (739) NA
Lee et al.[102] Philippines, Legaspi city, children and 9.4 (64) Formalin-ether sedimentation
adolescents
Lu and Sung[103] Immigrant population in northeastern 0.7 (144), 1.4 (276), Merthiolate-iodine-
Taiwan tested for residence approval, 0.9 (114) and formaldehyde concentration and
from four countries: China, Indonesia, 1.3 (396) from the direct wet-mount
Vietnam and The Philippines different countries,
respectively
Ngrenngarmlert Thailand, Nakhon Prathom province, 1.0 (1,920) Formalin-ethyl acetate
et al.[104] school children 7-12 years
Oyofo et al.[105] Indonesia, Jakarta, two groups: Group 0 (51) from group Melvin and Brookes method
one patients with diarrhea and group two
two controls not having diarrhea
Prownebon et al.[106] Thailand, Pathum Thani province, 2.2 (137) and 0.7 (145) Simple smear and formalin-
children 1-6 years old, two groups: from group one and ether concentration
Group one children at orphanage and two. respectively
group two hill-tribe children
Sagnuankiat et al.[107] Thailand, Samut Sakhon province, 3.5 (372) Direct smear with normal saline
immigrant children at daycare centers 1 % iodine solution
Saksirisampant Thailand, Pathum Thani province, 3.7 (106) Simple smear preparation and
et al.[108] children in an orphanage (0-7 years) formalin-ether concentration
Saksirisampant Thailand, Chiang Mai Province, school 4.8 (542) Formalin-ether concentration
et al.[109] children 3-19 from the Karen Hill-Tribe
Saksirisampant Thailand, central region, children 0.48 (1,037) Formalin-ether concentration
et al.[110] attending primary school 3-12 years
Tungtrongchitr Thailand, two groups: group one 0 (25) from group Direct smear with saline
et al.[111] IBS patients and group two controls two solution and iodine, trichrome,
without IBS modified trichrome and acid-
fast staining
Tungtrongchitr Thailand, Ubon Ratchathani Province, 0.2 (479) Direct smear and modified Kato
et al.[112] rural communities thick smear
Waikagul et al.[113] Thailand, Nan-province, children from 2.5 (1,010) Formalin-ether sedimentation
primary schools
Warunee et al.[114] Thailand, Nakhon Prathom province, 1.0 (1,920) Formalin-ethyl acetate
schoolchildren 7-12 years old concentration
Wilairatana et al.[115] Thailand, laborers going abroad for 2.5 (362) Formalin-ether concentration
work, asymptomatic
Wongjindanon Thailand, two groups: group one 0 (3,358) and 0.76 Group one simple smear and
et al.[116] volunteers any age from Surin (656) from group one group two saline sedimentation,
province (rural) and group two healthy and two, respectively stained with iodine, all samples
schoolchildren between 5-7 years old were examined in duplicates
from Samut Sakhon province (sub-urban)
Yaicharoen et al.[117] Thailand, Bangkok, asymptomatic 0.27 (1,147) and Direct smear
participants, two groups: Group one 0.65 (1,083) from
participants examined in 1999 and group group one and two,
two participants examined in 2004 respectively
Contd...

Jan 2016 | Volume 6 | Issue 1 | 20 Tropical Parasitology


Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Supplementary Table 1: Contd...


Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Yaicharoen et al.[118] Thailand, Nakhon Pathom province, 2.2 (814) Cultured in Jones
children attending public schools medium (48 h), formalin ethyl
acetate concentration
Asia. From articles Akao et al.[119] Japan, Ishikawa, foreign workers from 5.6 (198) NA
with patients or Indonesia and the Philippines
that are older than Akhlaghi et al.[120] Iran, patients referred to three hospitals 3.2 (1,000) Direct smear, formol-ethyl
20 years in Tehran during, random selection of acetate, Ziehl-Neelsen
1000 samples
Arslan et al.[121] Turkey, 2-6 years old children with 4.3 (138) Centrifugal formalin ether, zinc-
gastrointestinal symptoms sulphate flotation and modified
acid fast techniques, Lugols stain
Azami et al.[122] Iran, renal transplant recipients 8.7 (150) Direct smear, formalin-ether
sedimentation, Sheather’s
flotation and modified Ziehl-
Neelsen staining
Carney et al.[123] Indonesia, Central and South Sulawesi, 1 (1,156) NA
remote areas
Carney et al.[124] Philippines, North Bohol, rural areas, 7.1 (1,694) Direct and after formalin-ether
volunteers concentration
Carney et al.[125] Philippines, Bukidnon province, 3.9 (831) Direct and after formalin-ether
volunteers concentration
Carney et al.[126] Philippines, Oriental Mindoro, 4.1 (1,058) Direct and after formalin-ether
volunteers concentration
Chiu et al.[127] Taiwan, Nantou county, Village 2.6 (417) Direct smear and formalin-ether
suspected of Taenia solium outbreak sedimentation
Choi et al.[128] Korea, clinical samples 0.26 (782) Formalin-ether concentration
Kim et al.[129] South Korea, inhabitants in the upper 0.3 (743) Formalin-ether concentration
stream of Taechong Dam, located on the
Kumgang river
Cross et al.[130] Borneo, West Kalimantan, 8 villages, 6 (2,101) NA
based on number of stool samples
examined
Cross et al.[131] Indonesia, North Sumatra, 5 villages, 8 (2,066) NA
based on number of stool samples
examined
Cross et al.[132] Phillippines, North Samar Province, 6 (1,394) NA
persons living in 8 barrios, based on
number of stool samples examined
Cross et al.[133] Indonesia, Irian Jaya (West Irian), based 8 (114) NA
on number of stool samples examined
Dogan et al.[134] Turkey, children with diarrhea 2.2 (225) Formalin-ether sedimentation
Goo et al.[135] Korea, Yondo, remote island, single stool 0.8 (1,011) Formalin-ether centrifugal
samples sedimentation
Hong et al.[136] Korea, Jeonlanam Do province, 4 urban 2.5 (4,116) Formalin-ether sedimentation,
and 7 rural areas Lugol’s iodine stain
Hong[137] Korea, soldiers, from 1983-1985 1.7 (2,643) Formalin-ether concentration
Iqbal et al.[138] Kuwait, patients in two groups: group 15 (3,549) and A single fecal sample
one with gastrointestinal symptoms and 0.2 (500) from concentrated with
group two with complaints other than group one and two, formalin based method
gastrointestinal symptoms respectively (EPC concentrator). Wet
examinations with physiological
saline and with iodine
Kim et al.[139] Korea and Vietnam, single specimens 0.14 (717), 6.1 (1,933), Iodine stain, different
examined twice, four groups: Group one 3.9 (433) and 1.8 concentration techniques
Vietnamese, group two US armed forces, (114) from group
group three Korean troops in South one, two, three and
Vietnam and group four Korean home four, respectively
patients at 1st army hospital in Korea
Kim et al.[140] Korea 10.0 (2250) Direct, zinc sulfate flotation and
formalin-ether sedimentation
Kim et al.[141] Korea, Gyeong-gi Do and Jeonra Bug Do 2.7 (2735) Formalin-ether sedimentation
Contd...
Tropical Parasitology 21 Jan 2016 | Volume 6 | Issue 1 |
Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Supplementary Table 1: Contd...


Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Kim et al.[142] Korea, patients attending Samsung 1.2 (12,163), 1.2 NA
medical center, 7 years 2000-2006 (14,194), 1.8 (12,377),
2.0 (9,945), 2.2
(9,685), 1.7 (10,110)
and 2.1 (9,599) from
the consecutive
years, respectively
Kim et al.[143] Korea, all samples submitted to Samsung 2.6 (26,452), 2.1 Formalin-ether sedimentation
medical center for parasitological (43,603), 1.4 (44,514),
investigation, 10 years 2003 - 2012 1.5 (43,347), 1.4
(43,921), 1.5 (56,849),
1.5 (57,607), 1.0
(56,301), 1.0 (57,272)
and 0.97 (56,946)
from the consecutive
years, respectively
Lee et al.[144] Southeast asia, aircrew personal, 2.6 (557) NA
mainly males
Lee et al.[145] Korea, Seoul Paik hospital, 9 years 1984 0.8 (5,353), 0.5 Formalin-ether sedimentation
- 1992 (4,919), 0.4 (4,795), and/or direct smear
0.6 (5,458), 0.9
(5,795), 0.7 (6,895),
0.6 (6,615), 0.7 (7,200)
and 1.7 (5,522) from
the consecutive
years, respectively
Lee et al.[146] Korea, handicapped at an institution 21.4 (112) Formalin-ether sedimentation
Mangali et al.[147] Indonesia, south Sulawesi, Campalagian 12.5 (380) Formalin ether concentration
district, 3 coastal and 2 inland villages
Nasiri et al.[148] Iran, Karaj, refugees 0.05 (13,915) Formalin-ethyl acetate
sedimentation and trichrome
stain
Niyyati et al.[149] Iran, Tehran, people referred to Kashani 0.97 (205) Direct examination and
hospital formalin-ether concentration
Oyofo et al.[105] Indonesia, Jakarta, two groups: Group 0.5 (389) from group Melvin and Brookes method
one patients with diarrhea and group one
two controls not having diarrhea
Purnomo et al.[150] Indonesia, West Flores, Karakuak 1 (198) NA
Sahin et al.[151] Turkey, wrestlers of the national team at 11.1 (18) NA
training camp in Kayseri, majority had
gastrointestinal complaints
Sharif et al.[152] Iran, Mazandaran province, children 3.9 (362) Direct wet mount, formol-ether
who are intellectually disabled, Three concentration, Ziehl-Neelsen
fecal samples collected and trichrome staining
Shokri et al.[153] Iran, mentally retarded 2.3 (133) Direct smear, formalin-ether
concentration and stained with
Trichrome and Ziehl-Neelsen
Stafford and Indonesia, Sumatra, Aceh province, 7 (348) Direct and formalin-ether
Joesoef [154] Bireuen and Takengon, volunteers concentration
Stafford et al.[155] Indonesia, Gorontalo North Sulawesi, 5 (156) Direct and formalin-ether
indigenous mountain people primarily concentration
moslems
Stafford et al.[156] Indonesia, Bali 7 (270) Direct and formalin-ether
concentration
Subbannayya et al.[157] India, Karnataka, south Kanara district, 0.10 (1,020) Direct smear with saline and
apparently healthy people D’Antoni’s iodine, Zinc sulfate
concentration and culture in
modified Boek and Drbolhav
medium
Supanaranond Thailand, Volunteers in cholera vaccine 3.5 (171) NA
et al.[158] trial
Contd...

Jan 2016 | Volume 6 | Issue 1 | 22 Tropical Parasitology


Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Supplementary Table 1: Contd...


Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Tanyuksel et al.[159] Turkey, patients with symptomatic 2.3 (380) Fresh, lugol and trichrome stain
diarrhea/dysentery
Tungtrongchitr Thailand, two groups: group one IBS 5.1 (59) from group Direct smear with saline solution
et al.[111] patients and group two controls without one and iodine, trichrome, modified
IBS trichrome and acid-fast staining
Yaman et al.[160] Turkey, samples send to parasitological 1.26 (28911) Flotation/sedimentation
laboratory at Erciyes University between methods, native-Lugol stain
2005-2008
Yazar et al.[161] Turkey, samples send to parasitological 1.4 (34883) Flotation/sedimentation
laboratory at Erciyes University between methods, native-Lugol stain
2000-2004
Yosefi et al.[162] Iran, Ahvaz, AIDS patients 5 (100) Merthiolate-iodine-
formaldehyde, trichrome and
Ziehl-Neelsen staining
Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Africa. From articles Graczyk et al.[163] Zambia, school-age children, half of the 64.3 (93) Direct wet smear, Sheather’s
with healthy that stools diarrheic sugar flotation and stained with
are not older than Lugols iodine
20 years Ikeh et al.[164] Nigeria, single stool specimens, Two 16.2 (111) and Formol-ether and modified
groups: one volunteers in rural village 18.3 (93) from Ziehl-Neelsen technique
and two randomly selected urban group one and two,
dwellers. Study groups unique in being respectively
adults where samples are not sent to
diagnostic facilities due to diarrhea
Ouattara et al.[165] Western Cote d’Ivoire, rural area, pupils 83.8 (4,466) Formol-ether concentration
6-16 years at 57 different schools
Raso et al.[166] Cote d’Ivoire, schoolchildren 82.6 (4,042) Formol-ether concentration
Africa. From articles Chunge et al.[167], Kenya, Kiambu District, Nderu, rural 30.4 (1,129), Direct smear in saline and iodine
with patients or includes only 1st community, 4 cross-sectional surveys, 21.4 (388), 28.9 (401) and a modified formol ether
that are older than study in calculations 2nd, 3rd and 4th based on selected group and 31.1 (363) from concentration method, examined
20 years from the 1st study. Endolimax was more study one, two, three at 10X and 400X magnification
commonly encountered in formed stools and four, respectively
El Shazly et al.[168] Egypt, patients 6.9 (3,180) Direct wet smear, formol-
ether concentration, modified
Sheather’s sugar flotation,
Potassium hydroxide
concentration. Gomori’s
Trichrome stain, and modified
Kinyoun’s acid-fast stain
Goldsmid et al.[169] Rhodesia (Zambia and Zimbabwe), 12.8 (180) Water centrifugation (strained
institution with cases of amoebic stool emulsified in tap water)
dysentery had been recorded and formol-ether concentration
Hunter et al.[170] Zambia, two groups, one patients with 11 (90) and 19 (105) Formol-ether concentration
AIDS and two controls adults recruited from group one and
from a township near Lusaka (only 1 two, respectively
complaining of diarrhea)
Kasssem et al.[171] Libya, Sirt, children and neonates 13.7 (350) NA
admitted to Ibn-Sina hospital, examined
2001-2002
Ogunba[172] Nigeria, Ibadan, two groups: one patients 3.1 (360,000) and Saline and iodine preparation
at University College Hospital in Ibadan 4.6 (4,021) from from fresh stool samples, later
collected from 1967-1977 and two healthy group one and two, formalin-ether concentration
Nigerians in the indigenous areas of respectively
Ibadan mainly children also teachers,
food sellers and parents of the children
Okafor and Nigeria, villagers from rural areas 0.3 (300) Formal-ether centrifugation
Azubike[173] reporting at the parasitological laboratory
Pampiglione et al.[174] Tanzania, Pemba island, collected from 4.3 (392) Modified Ritchie technique
healthy population chosen at random

Contd...

Tropical Parasitology 23 Jan 2016 | Volume 6 | Issue 1 |


Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

Supplementary Table 1: Contd...


Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Pampiglione et al.[175] Sao Tome and Principe, collected from 7.0 (1,050) Modified Ritchie technique
healthy population chosen at random
Prinz et al.[176] Northeast Zaire, Azande 1.3 (165) NA
Characteristics Reference Country, region and study group % prevalence (no. of Methods
samples examined)
Australia. From Ashford and Papua New Guinea, Asaro Valley, sing- 41 (995) Wet mount and iodine stained,
articles with Atkinson[177] out sampling, points at sampling bias gomori trichrome and saffranin
patients or that are associated with this method and methylene blue
older than 20 years Sawangjaroen et al.[178] Australia, Brisbane, non-hospital patients 1.2 (260) Unknown if found in routine
with diarrhoea microscopy or when culturing
D. fragilis
Stark et al.[179] Australia, Sydney, Three groups all 10 (618), 12 (628) and One fecal sample from
patients with diarrhea: one homosexual 0.8 (622) from group each, formalin-ethyl acetate
men with HIV, two homosexual men one, two and three, concentration, iron-hematoxylin
without HIV and three heterosexual men respectively stain

SUPPLEMENTARY REFERENCES 14. Mendoza D, Núñez FA, Escobedo A, Pelayo L, Fernández M,


Torres D, et al. [Intestinal parasitic infections in 4 child day-
1. Pérez Armengol C, Ariza Astolfi C, Ubeda Ontiveros  JM, care centers located in San Miguel del Padrón municipality,
Guevara Benítez DC, de Rojas Alvarez M, Lozano Havana City, 1998]. Rev Cubana Med Trop 2001;53:189-93.
Serrano C. [Epidemiology of children's intestinal
parasitism in the Guadalquivir Valley, Spain]. Rev Esp 15. Acuna-Soto R, Samuelson J, De Girolami P, Zarate L,
Salud Publica 1997;71:547-52. Millan-Velasco F, Schoolnick G, et al. Application of
the polymerase chain reaction to the epidemiology of
2. Sagebiel D, Weitzel T, Stark K, Leitmeyer K. Giardiasis pathogenic and nonpathogenic Entamoeba histolytica.
in kindergartens: Prevalence study in Berlin, Germany, Am J Trop Med Hyg 1993;48:58-70.
2006. Parasitol Res 2009;105:681-7.
16. Barrett DM, Steel-Duncan J, Christie CD, Eldemire-
3. Schlosser O, Grall D, Laurenceau MN. Intestinal parasite Shearer D, Lindo JF. Absence of opportunistic parasitic
carriage in workers exposed to sewage. Eur J Epidemiol infestations in children living with HIV/AIDS in
1999;15:261-5. children's homes in Jamaica: pilot investigations. West
4. Cerva L, Kliment V. Contribution to the problem of the Indian Med J 2008;57:253-6.
so-called nonpathogenic amoebae in the intestine of man. 17. Bruckner DA, Garcia LS, Voge M. Intestinal parasites in Los
Folia Parasitol (Praha) 1978;25:367-70. Angeles, California. Am J Med Technol 1979;45:1020-2.
5. Chin AT, Gerken A. Carriage of intestinal protozoal cysts 18. Church C, Neill A, Schotthoefer AM. Intestinal infections
in homosexuals. Br J Vener Dis 1984;60:193-5. in humans in the Rocky Mountain region, United States.
6. Jokipii L, Sargeaunt PG, Jokipii AM. Coincidence of J Parasitol 2010;96:194-6.
deficient delayed hypersensitivity and intestinal protozoa 19. Church DL, Sutherland LR, Gill MJ, Visser ND, Kelly JK.
in homosexual men. Scand J Infect Dis 1989;21:563-71. Absence of an association between enteric parasites in
7. Portús M, Prats G. [Contribution to the knowledge the manifestations and pathogenesis of HIV enteropathy
of intestinal protozoa infestation in the hospital in gay men. The GI/HIV Study Group. Scand J Infect Dis
population of Barcelona (author's transl)]. Med Clin (Barc) 1992;24:567-75.
1981;76:203-5. 20. Edouard A, Edouard S, Desbois N, Plumelle Y, Rat C,
8. Soriano JM, Domènech G, Martínez MC, Mañes J, Soriano F. Calès-Quist D, et al. [Evolution in the prevalence of
Intestinal parasitic infections in hosted Saharawi children. intestinal parasitosis in the Fort de France University
Trop Biomed. 2011;28:557-62. Hospital (Martinique)]. Presse Med 2004;33:707-9.
9. Stĕrba J, Ditrich O, Prokopic J, Kadlcík K. Gastrointestinal 21. Elliott S, Long EG, Truant AL, Smith JH. Parasitic
parasitoses discovered in agricultural workers in South infections encountered on the Texas Gulf Coast. Tex Med
Bohemia, Czechoslovakia. Folia Parasitol (Praha) 1981;77:45-6.
1988;35:169-73. 22. Haddad CG, Agrawal N. Gastrointestinal parasitic
10. Stürchler D, Peter R. [Parasitic disease in schoolchildren in infection: an overlooked entity. South Med J 1982;75:778-9.
a village in Swiss Jura]. Soz Praventivmed 1981;26:317-9. PubMed PMID: 7089641.
11. Aimpun P, Hshieh P. Survey for intestinal parasites in 23. Kabani A, Cadrain G, Trevenen C, Jadavji T, Church DL.
Belize, Central America. Southeast Asian J Trop Med Practice guidelines for ordering stool ova and parasite
Public Health 2004;35:506-11. testing in a pediatric population. The Alberta Children's
12. Faulkner CT, Garcia BB, Logan MH, New JC, Patton S. Hospital. Am J Clin Pathol 1995;104:272-8.
Prevalence of endoparasitic infection in children and its 24. Kappus KK, Juranek DD, Roberts JM. Results of testing for
relation with cholera prevention efforts in Mexico. Rev intestinal parasites by state diagnostic laboratories, United
Panam Salud Publica 2003;14:31-41. States, 1987. MMWR CDC Surveill Summ 1991;40:25-45.
13. Kurup R, Hunjan GS. Epidemiology and control of 25. Peters C, Kocka F, Chittom A, Sable R, Janda W. High
Schistosomiasis and other intestinal parasitic infections Carriage of Endolimax-Nana In Diarrheal Specimens
among school children in three rural villages of south From Homosexual Men. Letters in Applied Microbiology
Saint Lucia. J Vector Borne Dis 2010;47:228-34. 1987;5:65-6.

Jan 2016 | Volume 6 | Issue 1 | 24 Tropical Parasitology


Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

26. Ramírez-Miranda ME, Jiménez-González DE, Rodríguez- and parasite research. Rev Inst Med Trop Sao Paulo.
Campa ME, González-Angulo A, Hernández-Castellanos R, 2015;57:27-32.
Sara Arroyo-Escalante A, et al. [Irritable bowel syndrome: 42. Damazio SM, Lima MeS, Soares AR, Souza MA. Intestinal
frequency and phylogenetic relationship of Blastocystis parasites in a quilombola community of the Northern
sp. from Mexican patients]. Rev Gastroenterol Mex State of Espírito Santo, Brazil. Rev Inst Med Trop Sao
2011;76:309-15. Paulo 2013;55.
27. Ribes JA, Seabolt JP, Overman SB. Point prevalence of 43. Maco Flores V, Marcos Raymundo LA, Terashima
Cryptosporidium, Cyclospora, and Isospora infections in Iwashita A, Samalvides Cuba F, Gotuzzo Herencia E.
patients being evaluated for diarrhea. Am J Clin Pathol [Distribution of entero-parasitic infections in the Peruvian
2004;122:28-32. Highland: Study carried out in six rural communities of
28. Robinson RD, Murphy EL, Wilks RJ, Neva FA, Terry SI, the department of Puno, Peru]. Rev Gastroenterol Peru
Hanchard B, et al. Gastrointestinal parasitic infection 2002;22:304-9.
in healthy Jamaican carriers of HTLV-I. J Trop Med Hyg 44. Franke MF, Del Castillo H, Pereda Y, Lecca L, Fuertes J,
1991;94:411-5. Cárdenas L, et al. Parasite infection and tuberculosis
29. Rojas CL, Angel Núñez CF, Aguiar PH, Silva Ayçaguer CL, disease among children: A case-control study. Am J Trop
Alvarez D, Martínez R, et al. [Second national survey of Med Hyg 2014;90:279-82.
intestinal parasitic infections in Cuba, 2009]. Rev Cubana 45. Freites A, Colmenares D, Pérez M, García M, Díaz de
Med Trop 2012;64:15-21. Suárez O. [Cryptosporidium sp infections and other
30. Tsaihong JC, Liou MY, Ma PC. Enteric parasites and intestinal parasites in food handlers from Zulia state,
antibodies to human immunodeficiency virus in Venezuela]. Invest Clin 2009;50:13-21.
homosexual men with diarrhea. Gaoxiong Yi Xue Ke Xue 46. Ibanez H, Jara C, Guerra M, Diaz L. Prevalencia del
Za Zhi 1993;9:567-71. enteroparasitismo en escolares de comunidades nativas
31. Ungar BL, Iscoe E, Cutler J, Bartlett JG. Intestinal parasites del alto Maranon, Amazonas, Peru Rev Peru MEd Exp
in a migrant farmworker population. Arch Intern Med Salud Publica; 2004. p. 126-33.
1986;146:513-5. 47. Kobayashi J, Hasegawa H, Forli AA, Nishimura NF,
32. Wilkins R, Horner N. Human Intestinal Parasitosis In Yamanaka A, Shimabukuro T, et al. Prevalence of
Northern Chihuahua, Mexico. Texas Journal of Science intestinal parasitic infection in five farms in Holambra,
1991;43:81-9. São Paulo, Brazil. Rev Inst Med Trop Sao Paulo.
33. Yamamoto-Furusho JK, Torijano-Carrera E. Intestinal 1995;37:13-8.
protozoa infections among patients with ulcerative 48. Korkes F, Kumagai FU, Belfort RN, Szejnfeld D, Abud TG,
colitis: Prevalence and impact on clinical disease course. Kleinman A, et al. Relationship between intestinal
Digestion 2010;82:18-23. parasitic infection in children and soil contamination
34. Acurero E, Avila A, Rangel L, Calchi M, Grimaldos R, in an urban slum. J Trop Pediatr 2009;55:42-5.
Cotiz M. Intestinal Protozoa in School Children at Public 49. Laugart E, Garcia F, Nunez C, Pena M, Fundora I,
and Private Institutions in the Maracaibo Municipality, Medina R. Aspects on children epidemiology of intestinal
State of Zulia. Kasmera 2013;41:50-8. parasites in Vegon Nutrias, Venezuela. Revista Cubana
35. Alves JR, Macedo HW, Ramos AN, Ferreira LF, de Higiene y Epidemiologia; 2012. p. 330-9.
Gonçalves ML, Araújo A. [Intestinal parasite infections in 50. Machado E, Santos D, Costa-Cruz J. Enteroparasites
a semiarid area of Northeast Brazil: Preliminary findings and commensals among children in four peripheral
differ from expected prevalence rates]. Cad Saude Publica districts of Uberlandia, State of Minas Gerais. Revista Da
2003;19:667-70. Sociedade Brasileira De Medicina Tropical 2008;41:581-5.
36. Assis EM, Olivieria RC, Moreira LE, Pena JL, Rodrigues LC, 51. Mercado R, Otto JP, Musleh M, Pérez M. [Human infection
Machado-Coelho GL. [Prevalence of intestinal parasites by intestinal protozoa and helminths in Calbuco County,
in the Maxakali indigenous community in Minas Gerais, X Region, Chile, 1997]. Bol Chil Parasitol 1997;52:36-8.
Brazil, 2009]. Cad Saude Publica 2013;29:681-90. 52. Milano AM, Oscherov EB, Palladino AC, Bar AR.
37. Berbert-Ferreira M, Costa-Cruz JM. [Intestinal parasites [Children enteroparasitosis in north east Argentine urban
in children aged 4-12 months attending day-care centers area]. Medicina (B Aires) 2007;67:238-42.
of Federal University-Uberlândia-MG]. J Pediatr (Rio J) 53. Mora L, Martínez I, Figuera L, Segura M, Del Valle G.
1995;71:219-22. [Protozoans in superficial waters and faecal samples
38. Bermúdez A, Flórez O, Bolaños MV, Medina JJ, of individuals of rural populations of the Montes
Salcedo-Cifuentes M. [Enteroparasitism, hygiene municipality, Sucre state, Venezuela]. Invest Clin
and environmental sanitation in under-aged from six 2010;51:457-66.
indigenous communities. Cali-Colombia]. Rev Salud 54. Moura EC, Bragazza LM, Coelho MF, Aun SM. [Prevalence
Publica (Bogota) 2013;15:1-11. of intestinal parasitosis in schoolchildren]. J Pediatr
39. Biscegli T, Romera J, Candido A, Santos J, Candido E, (Rio J) 1997;73:406-10.
Binotto A. Nutritional status and enteroparasitosis 55. Munoz-Antoli C, Pavon A, Marcilla A, Toledo R,
prevalence among children enrolled in a day care center. Esteban J. Prevalence and risk factors related to
Rev Paul Pediatr; 2009. p. 289-95. intestinal parasites among children in Department
40. Bracciaforte R, Diaz M, Pivetta V, Burstein V, Varengo H, of Rio San Juan, Nicaragua. Transactions of the
Orsilles M. Enteroparasites in children and adolescents Royal Society of Tropical Medicine and Hygiene
of a periurban community in the province of Cordoba. 2014;108:774-82.
Acta Bioquimica Clinica Latinoamericana 2010;44:353-8. 56. Nascimento SA, Moitinho MaL. Blastocystis hominis
41. Castro ED, Germini MC, Mascarenhas JD, Gabbay YB, and other intestinal parasites in a community of Pitanga
de Lima IC, Lobo PoS, et al. Enteropathogens detected City, Paraná State, Brazil. Rev Inst Med Trop Sao Paulo
in a daycare center, Southeastern Brazil: bacteria, virus, 2005;47:213-7.

Tropical Parasitology 25 Jan 2016 | Volume 6 | Issue 1 |


Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

57. Rios L, Cutolo S, Giatti L, Castro M, Rocha A, Toledo R, ELISA for the detection of fecal Giardia antigens. Am J
et al. Prevalence of intestinal parasites and social- Trop Med Hyg 1990;42:538-45.
environmental aspects in an indigenous community 73. Guignard S, Arienti H, Freyre L, Lujan H, Rubinstein H.
in the lauarete district, municipality of Sao Gabriel Prevalence of enteroparasites in a residence for children
da Cachoeira (AM), Brasil. Saude Soc Sao Paulo; in the Córdoba Province, Argentina. Eur J Epidemiol
2007. p. 76-86. 2000;16:287-93.
58. Rivero-Rodríguez Z, Chourio-Lozano G, Diaz I, Cheng R, 74. Kulik RA, Falavigna DL, Nishi L, Araujo SM. Blastocystis
Rucsón G. [Intestinal parasites in school children at a sp. and other intestinal parasites in hemodialysis
public institution in Maracaibo municipality, Venezuela]. patients. Braz J Infect Dis 2008;12:338-41.
Invest Clin 2000;41:37-57.
75. Maia MM, Fausto MA, Vieira EL, Benetton ML,
59. Saldiva SR, Silveira AS, Philippi ST, Torres DM, Carneiro M. Intestinal parasitic infection and associated
Mangini AC, Dias RM, et al. Ascaris-Trichuris association risk factors, among children presenting at outpatient
and malnutrition in Brazilian children. Paediatr Perinat clinics in Manaus, Amazonas state, Brazil. Ann Trop
Epidemiol 1999;13:89-98. Med Parasitol 2009;103:583-91.
60. Santos SA, Merlini LS. [Prevalence of enteroparasitosis 76. Merlano N, Falconar A, Solano H, Vivas C. Clinical
in the population of Maria Helena, Paraná State]. Cien manifestations and risk factors associated with
Saude Colet 2010;15:899-905. Cryptosporidium spp. infections in patients from
61. Silva L, da Silva E, da Silva R. Parasitological diagnosis Barranquilla and three "municipios" of Atlantico
of horticulturist in monitoring parasitic contamination in (Columbia). Salud Uninorte Barranquilla; 2007. p. 19-31.
rural environments. Bioscience Journal 2010;26:648-52. 77. Moura H, Fernandes O, Viola JP, Silva SP, Passos RH,
62. Tabares L, Gonzalez L. Prevalence of intestinal parasites Lima DB. Enteric parasites and HIV infection: occurrence
in children under 12 years of age, hygienic habits, in AIDS patients in Rio de Janeiro, Brazil. Mem Inst
characteristics of the houses and presence of bacteria in Oswaldo Cruz. 1989;84:527-33.
the drinking water of a locality of Sabaneta, Columbia. 78. Navarrete N, Torres P. [Prevalence of infection by
Iatreia 2008;21:253-9. intestinal helminths and protozoa in school children from
63. Takizawa M, Falavigna DL, Gomes ML. Enteroparasitosis a coastal locality in the province of Valdivia, Chile]. Bol
and their ethnographic relationship to food handlers in a Chil Parasitol 1994;49:79-80.
tourist and economic center in Paraná, Southern Brazil. 79. Rivero-Rodríguez Z, Hernández A, Bracho Á, Salazar S,
Rev Inst Med Trop Sao Paulo 2009;51:31-5. Villalobos R. [Prevalence of intestinal microsporidia and
64. Tashimi N, Simoes M, Leite C, Fluminhan A, Nogueira M, other intestinal parasites in hiv positive patients from
Malaspina A. Classic and molecular study of Giardia Maracaibo, Venezuela]. Biomedica 2013;33:538-45.
doudenalis in children from a daycare center in the region 80. Silva L, da Silva R, Fernandes N, de Oliveira J.
of presidente prudente, Sao Paulo, Brazil Rev Inst Med Parasitic And Intestinal Commensals In The Neoplastic
trop S Paulo; 2009. p. 19-24. Patients Undergoing Chemotherapy. Bioscience Journal
65. Amancio F, Pascotto V, Souza L, Calvi S, Pereira P. 2011;27:170-7.
Intestinal parasitic infections in HIV/AIDS patients: 81. Torres P, Miranda JC, Flores L, Riquelme J, Franjola R,
Epidemiological, nutritional and immunological aspects. Pérez J, et al. [Blastocystosis and other intestinal
Journal of Venomous Animals and Toxins Including protozoan infections in human riverside communities of
Tropical Diseases 2012;18:225-35. the Valdivia River basin, Chile]. Rev Inst Med Trop Sao
66. Bourée P, David P, Basset D, Coco O, Beauvais B, Paulo 1992;34:557-64.
David-Julien MC, et al. [Epidemiologic survey of intestinal 82. Urbina D, Arzuza O, Young G, Parra E, Castro R, Puello M.
parasitoses in Peruvian Amazonia]. Bull Soc Pathol Exot Rotavirus type A and other enteric pathogens in stool
Filiales 1984;77:690-8. samples from children with acute diarrhea on the
67. Cancrini G, Bartoloni A, Nuñez L, Paradisi F. Intestinal Colombian northern coast. Int Microbiol 2003;6:27-32.
parasites in the Camiri, Gutierrez and Boyuibe areas, Santa 83. Valles L, Mieses M, Agobian G. Predominance of
Cruz Department, Bolivia. Parassitologia 1988;30:263-9. Blastocystis hominis over other enteroparasites in
68. Carvalho-Costa FA, Gonçalves AQ, Lassance SL, patients from Palavecino municipality, State of Lara,
de Albuquerque CP, Leite JP, Bóia MN. Detection of Venezuela; Rev Cubana Med Trop; 2006. p. 14-8.
Cryptosporidium spp and other intestinal parasites in 84. Vidal S, Toloza L, Cancino B. [Evolution of the prevalence
children with acute diarrhea and severe dehydration in the enteroparasitoses in Talca-Chile]. Rev Chilena Infectol
Rio de Janeiro Rev Soc Bras Med Trop 2007;40:346-8. 2010;27:336-40.
69. Cho SY, Kim JH, Park SH. Status of intestinal parasite 85. Abdel-Dayem M, Al Zou'bi R, Hani RB, Amr ZS.
infections in inhabitants of Palmar, Guayas Province, Microbiological and parasitological investigation among
Ecuador. Kisaengchunghak Chapchi 1990;28:109-13. food handlers in hotels in the Dead Sea area, Jordan;
70. Cimerman S, Cimerman B, Lewi DS. Prevalence of J Microbiol Immunol Infect 2014;47:377-80.
intestinal parasitic infections in patients with acquired 86. Akdemir C, Helvaci R. [Evaluation of parasitological
immunodeficiency syndrome in Brazil. Int J Infect Dis laboratory results of a group of people older than 15 years
1999;3:203-6. of age in Kutahya]. Turkiye Parazitol Derg 2007;31:37-40.
71. Garibaldi R, Muñoz N, Neira P, Subercaseaux B, Villalón L. 87. Amin AM. Blastocystis hominis among apparently
[Intestinal parasites and ectoparasites in the V region, healthy food handlers in Jeddah, Saudi Arabia. J Egypt
Chile: study in the Psychiatric Hospital of Putaendo]. Bol Soc Parasitol 1997;27:817-23.
Chil Parasitol. 1990;45(3-4):83-5. PubMed PMID: 2152365. 88. Azian M, San Y, Gan C, Yusri M, Nurulsyamzawaty Y,
72. Goldin AJ, Apt W, Aguilera X, Zulantay I, Warhurst DC, Zuhaizarn A, et al. Prevalence of intestinal protozoa in
Miles MA. Efficient diagnosis of giardiasis among nursery an aborigine community in Pahang, Malaysia; Tropical
and primary school children in Santiago, Chile by capture Biomedicine 2007;24:55-62.

Jan 2016 | Volume 6 | Issue 1 | 26 Tropical Parasitology


Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

89. Ben-Shimol S, Sagi O, Greenberg D. Differences in 105. Oyofo BA, Subekti D, Tjaniadi P, Machpud N, Komalarini S,
prevalence of parasites in stool samples between three Setiawan B, et al. Enteropathogens associated with
distinct ethnic pediatric populations in southern Israel, acute diarrhea in community and hospital patients
2007-2011. Parasitol Int 2014;63:456-62. in Jakarta, Indonesia; FEMS Immunol Med Microbiol
90. Börekçi G, Uzel A. [The determination of intestinal 2002;34:139-46.
parasites, physical growth and hygiene behaviors of 106. Prownebon J, Charupoonphol P, Saksirisampant P,
children in the Mersin City Social Service Child Care Limvorapitak T, Seepongpun U, Saksirisampant W.
Centre]. Turkiye Parazitol Derg 2009;33:63-72. Intestinal parasitic infections: high prevalence of Giardia
91. Taş Cengiz Z, Ciçek M, Akbayram S, Yilmaz H. [Intestinal intestinalis in children living in an orphanage compared
parasites detected in Süphan Primary schoolchildren in with hill-tribe children as detected by microscopy and
Van]. Turkiye Parazitol Derg 2009;33:294-7. ELISA. Asian Biomedicine 2013;7:855-63.
92. Taş Cengiz Z, Akbayram S, Ciçek M, Yilmaz H. [Intestinal 107. Sagnuankiat S, Wanichsuwan M, Bhunnachet E,
parasitoses detected in primary schoolchildren in the Van Jungarat N, Panraksa K, Komalamisra C, et al. Health
province]. Turkiye Parazitol Derg 2009;33:289-93. Status of Immigrant Children and Environmental Survey
of Child Daycare Centers in Samut Sakhon Province,
93. Danchaivijitr S, Rongrungruang Y, Kachintorn U, Thailand; J Immigr Minor Health 2014.
Techasathit V, Pakaworavuthi S, Kachintorn K. Prevalence
and effectiveness of an education program on intestinal 108. Saksirisampant W, Nuchprayoon S, Wiwanitkit V,
pathogens in food handlers. J Med Assoc Thai 2005;88 Yenthakam S, Ampavasiri A. Intestinal parasitic infestations
Suppl 10:S31-5. among children in an orphanage in Pathum Thani province.
J Med Assoc Thai 2003;86 Suppl 2:S263-70.
94. Daryani A, Sharif M, Nasrolahei M, Khalilian A,
Mohammadi A, Barzegar G. Epidemiological survey of the 109. Saksirisampant W, Prownebon J, Kanmarnee P, Thaisom S,
prevalence of intestinal parasites among schoolchildren Yenthakam S, Nuchprayoon S. Prevalence of parasitism
in Sari, northern Iran. Trans R Soc Trop Med Hyg among students of the Karen hill-tribe in Mae Chame
2012;106:455-9. district, Chiang Mai province, Thailand; J Med Assoc
Thai 2004;87 Suppl 2:S278-83.
95. Değerli S, Celiksöz A, Aslan A, Aciöz M, Ozçelik S.
[Comparison of the results of examination of fecal 110. Saksirisampant W, Prownebon J, Kulkumthorn M,
samples from students at six months intervals in the Yenthakam S, Janpla S, Nuchprayoon S. Prevalence of
intestinal parasitic infections among school children
Alahaci village primary school in Sivas]. Turkiye Parazitol
in the central region of Thailand; J Med Assoc Thai
Derg. 2006;30:305-7.
2006;89:1928-33.
96. Güdücüoğlu H, Parlak M, Cıçek M, Yaman G, Oztürk O,
111. Tungtrongchitr A, Manatsathit S, Kositchaiwat C,
Cikman A, et al. [Investigation of intestinal parasites
Ongrotchanakun J, Munkong N, Chinabutr P, et al.
in students of Mustafa Cengiz primary school in Van].
Blastocystis hominis infection in irritable bowel
Turkiye Parazitol Derg 2010;34:172-5.
syndrome patients. Southeast Asian J Trop Med Public
97. Hamamcı B, Cetinkaya U, Delice S, Erçal BD, Gücüyetmez Health 2004;35:705-10.
S, Yazar S. [Investigation of intestinal parasites among
112. Tungtrongchitr A, Chiworaporn C, Praewanich R,
primary school students in Kayseri-Hacılar]. Turkiye
Radomyos P, Boitano JJ. The potential usefulness of the
Parazitol Derg 2011;35:96-9.
modified Kato thick smear technique in the detection of
98. Kia E, Hosseini M, Nilforoushan M, Meamar A, intestinal sarcocystosis during field surveys. Southeast
Rezaeian M. Study of intestinal protozoan parasites in Asian J Trop Med Public Health 2007;38:232-8.
rural inhabitants of Mazandaran Province, northern Iran. 113. Waikagul J, Krudsood S, Radomyos P, Radomyos B,
Iranian Journal of Parasitology 2008;3:21-5. Chalemrut K, Jonsuksuntigul P, et al. A cross-sectional study
99. Kitvatanachai S, Rhongbutsri P. Intestinal parasitic of intestinal parasitic infections among schoolchildren in
infections in suburban government schools, Lak Hok Nan Province, Northern Thailand. Southeast Asian J Trop
subdistrict, Muang Pathum Thani, Thailand. Asian Pac Med Public Health. 2002;33:218-23.
J Trop Med 2013;6:699-702. 114. Warunee N, Choomanee L, Sataporn P, Rapeeporn Y,
100. Koshak EA, Zakai HA. A spectrum of pathogenic and Nuttapong W, Sompong S, et al. Intestinal parasitic
non-pathogenic intestinal parasites in pre-employment infections among school children in Thailand Trop
medical check-up for workers and their families. J Family Biomed 2007;24:83-8.
Community Med 2003;10:47-53. 115. Wilairatana P, Radomyos P, Radomyos B, Phraevanich R,
101. Kurtoğlu MG, Körkoca H, Ciçek M, Cengiz ZT. [Prevalence Plooksawasdi W, Chanthavanich P, et al. Intestinal
of intestinal parasites among workers in food sector in sarcocystosis in Thai laborers; Southeast Asian J Trop
Van region]. Turkiye Parazitol Derg 2007;31:309-12. Med Public Health 1996;27:43-6.
102. Lee KJ, Ahn YK, Yong TS. A small-scale survey of 116. Wongjindanon N, Suksrichavalit T, Subsutti W,
intestinal parasite infections among children and Sarachart T, Worapisuttiwong U, Norramatha P. Current
adolescents in Legaspi city, the Philippines. Korean J infection rate of Giardia lamblia in two provinces of
Parasitol 2000;38:183-5. Thailand; Southeast Asian J Trop Med Public Health
103. Lu CT, Sung YJ. Epidemiology of Blastocystis hominis 2005;36 Suppl 4:21-5.
and other intestinal parasites among the immigrant 117. Yaicharoen R, Sripochang S, Sermsart B, Pidetcha P.
population in northeastern Taiwan by routine physical Prevalence of Blastocystis hominis infection in
examination for residence approval. J Microbiol Immunol asymptomatic individuals from Bangkok, Thailand.
Infect 2009;42:505-9. Southeast Asian J Trop Med Public Health 2005;36 Suppl
104. Ngrenngarmlert W, Lamom C, Pasuralertsakul S, 4:17-20.
Yaicharoen R, Wongjindanon N, Sripochang S, et al. 118. Yaicharoen R, Ngrenngarmlert W, Wongjindanon N,
Intestinal parasitic infections among school children in Sripochang S, Kiatfuengfoo R. Infection of Blastocystis
Thailand. Tropical Biomedicine 2007;24:83-8. hominis in primary schoolchildren from Nakhon Pathom

Tropical Parasitology 27 Jan 2016 | Volume 6 | Issue 1 |


Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

province, Thailand; Trop Biomed 2006;23:117-22. Yondo, Jeonranam-do: Province. Kisaengchunghak


119. Akao N, Ohyama T, Ohkawa T, Kondo K, Hirokawa Y, Chapchi 1988;26:275-84.
Ito S, et al. [A survey of intestinal parasites of the 136. Hong SJ, Hong ST, Chai JY, Lee SH, Seo BS, Cho SH, et al.
foreign laborers (Indonesians and Filipinos) in Ishikawa [A Survey On The Prevalence Of Intestinal Protozoan
Prefecture]. Kansenshogaku Zasshi. 1992;66:1256-61. Cysts In Jeonlanam Do, Korea]. Kisaengchunghak
120. Akhlaghi L, Shamseddin J, Meamar A, Razmjou E, Chapchi 1982;20:43-8.
Oormazdi H. Frequency of Intestinal Parasites in Tehran. 137. Hong ST. [A survey on intestinal parasites of soldiers in
Iranian Journal of Parasitology. 2009;4:44-7. Korea]. Kisaengchunghak Chapchi 1986;24:213-5.
121. Arslan MO, Sari B, Kulu B, Mor N. [The prevalence 138. Iqbal J, Hira PR, Al-Ali F, Philip R. Cryptosporidiosis
of intestinal parasites in children brought to the Kars in Kuwaiti children: Seasonality and endemicity. Clin
Maternal and Children's Hospital with complaints of Microbiol Infect 2001;7:261-6.
gastrointestinal symptoms]. Turkiye Parazitol Derg 139. Kim JH, Yoon JJ, Lee SH, Seo BS. Parasitologial Studies
2008;32:253-6. Of Korean Forces In South Vietnam: II. A Comparative
122. Azami M, Sharifi M, Hejazi SH, Tazhibi M. Intestinal Study On The Incidences Of Intestinal Parasites.
parasitic infections in renal transplant recipients. Braz J Kisaengchunghak Chapchi 1970;8:30-5.
Infect Dis 2010;14:15-8. 140. Kim CH, Park CH, Kim HJ, Chun HB, Min HK, Koh TY,
123. Carney WP, Van Peenen PF, See R, Hagelstein E, Lima B. et al. [Prevalence Of Intestinal Parasites In Korea].
Parasites of man in remote areas of Central and South Kisaengchunghak Chapchi 1971;9:25-38.
Sulawesi, Indonesia; Southeast Asian J Trop Med Public 141. Kim SC, Kim JJ, Lee KT. [Epidemiological Studies On
Health 1977;8:380-9. Protozoan Infection In Gyeong-Gi Do And Jeonra Bug
124. Carney WP, Banzon T, De Veyra V, Daña E, Cross Do]. Kisaengchunghak Chapchi. 1984;22:116-26.
JH. Intestinal parasites of man in Northern Bohol, 142. Kim H, Lee J, Choi Y, Kim J, Son H, Rhee P, et al.
Philippines, with emphasis on schistosomiasis. Southeast Examination for helminth eggs and protozoan cysts in
Asian J Trop Med Public Health 1980;11:473-9. fecal samples from healthy Korean adults, 2000~2006.
125. Carney WP, de Veyra VU, Cala EM, Cross JH. Intestinal The Korean Journal of Medicine 2009. p. 741-9.
parasites of man in Bukidnon, Philippines, with emphasis 143. Kim Y, Huh H, Hwang Y, Lee N. A survey of intestinal
on schistosomiasis. Southeast Asian J Trop Med Public parasite infection during a 10-year period (2003-2012).
Health 1981;12:24-9. Ann Clin Microbiol; 2013. p. 134-9.
126. Carney WP, Banzon T, de Veyra V, Papasin MC, Cross JH. 144. Lee R, Cross JH, Irving GS, Lane C, Watten RH. Surveillance
Intestinal parasites of man in Oriental Mindoro, Philippines, of some infectious diseases among aircrew personnel in
with emphasis on schistosomiasis. Southeast Asian J Trop Southeast Asia. Aviat Space Environ Med 1975;46:1152-4.
Med Public Health 1981;12:12-8. 145. Lee SK, Shin BM, Chung NS, Chai JY, Lee SH. [Second
127. Chiu JK, Chiu PC, Tseng PT. Prevalence of intestinal report on intestinal parasites among the patients of Seoul
parasitic infections among inhabitants of Tan-nan village, Paik Hospital (1984-1992)]. Korean J Parasitol 1994;32:27-33.
Nantou County, Taiwan. Zhonghua Min Guo Wei Sheng 146. Lee J, Park GM, Lee DH, Park SJ, Yong TS. Intestinal
Wu Xue Za Zhi 1979;12:155-9. parasite infections at an institution for the handicapped
128. Choi SC, Lee SY, Song HO, Ryu JS, Ahn MH. Parasitic in Korea. Korean J Parasitol 2000;38:179-81.
infections based on 320 clinical samples submitted to 147. Mangali A, Sasabone P, Syafruddin, Abadi K, Hasegawa H,
Hanyang University, Korea (2004-2011). Korean J Parasitol Toma T, et al. Intestinal parasitic infections in Campalagian
2014;52:215-20. district, south Sulawesi, Indonesia. Southeast Asian J Trop
129. Kim CH, Na YE, Kim NM, Shin DW, Chang DY. [Intestinal Med Public Health 1993;24:313-20.
parasite and Clonorchis sinensis infection among the 148. Nasiri V, Esmailnia K, Karim G, Nasir M, Akhavan O.
inhabitants in the upper stream of Taechong Dam, Intestinal parasitic infections among inhabitants of
Kumgang (River)]. Korean J Parasitol 1994;32:207-14. Karaj City, Tehran province, Iran in 2006-2008. Korean J
130. Cross JH, Clarke MD, Cole WC, Lien JC, Partono F, Parasitol 2009;47:265-8.
Djakaria, et al. Parasitic infections in humans in West 149. Niyyati M, Rezaeian M, Zahabion F, Hajarzadeh R, Kia E.
Kalimantan (Borneo), Indonesia; Trop Geogr Med A Survey On Intestinal Parasitic Infections In Patients
1976;28:121-30. Referred To A Hospital In Tehran. Pakistan Journal of
131. Cross JH, Clarke MD, Cole WC, Lien JC, Partono F, Medical Sciences 2009;25:87-90.
Joesoef A, et al. Parasitology survey in northern Sumatra, 150. Purnomo, Partono F, Soewarta A. Human intestinal
Indonesia. J Trop Med Hyg 1976;79:123-31. parasites in Karakuak, West Flores, Indonesia and the
132. Cross JH, Banzon T, Wheeling CH, Cometa H, Lien JC, effect of treatment with mebendazole and pyrantel
Clarke R, et al. Biomedical survey in North Samar pamoate. Southeast Asian J Trop Med Public Health.
Province, Philippine Islands. Southeast Asian J Trop Med 1980;11:324-31.
Public Health 1977;8:464-75. 151. Sahin I, Kiliç H, Ozcan M, Orhan R. [A copro-
133. Cross JH, Irving GS, Anderson KE, Gunawan S, Saroso JS. parasitological study on the wrestlers of the national
Biomedical survey in Irian Jaya (West Irian), Indonesia. team]. Mikrobiyol Bul 1984;18:114-8.
Southeast Asian J Trop Med Public Health 1977;8:532-6. 152. Sharif M, Daryani A, Asgarian F, Nasrolahei M. Intestinal
134. Doğan N, Oz Y, Koçman NU, Nursal AF. [Comparison parasitic infections among intellectual disability children
of individual differences in the direct microscopic in rehabilitation centers of northern Iran. Res Dev Disabil
examination in the diagnosis of intestinal parasites]. 2010;31:924-8.
Turkiye Parazitol Derg 2012;36:211-4. 153. Shokri A, Sarasiabi KS, Teshnizi SH, Mahmoodi H.
135. Goo GS, Min DY, Ahn MH, Kim KM, Leem MH, Yoon HS. Prevalence of Strongyloides stercoralis and other
Status of intestinal parasitic infections in a remote island, intestinal parasitic infections among mentally retarded

Jan 2016 | Volume 6 | Issue 1 | 28 Tropical Parasitology


Poulsen and Stensvold: Endolimax nana: An inconspicuous companion

residents in central institution of southern Iran. Asian health and access to health care among poorer and less
Pac J Trop Biomed 2012;2:88-91. poor schoolchildren of rural Côte d'Ivoire. Trop Med Int
154. Stafford EE, Joesoef A. Intestinal and blood parasites of Health 2005;10:42-57.
man in Bireuen and Takengon, Aceh Province, Sumatra, 167. Chunge RN, Karumba PN, Nagelkerke N, Kaleli N,
Indonesia. Southeast Asian J Trop Med Public Health. Wamwea M, Mutiso N, et al. Intestinal parasites in a
1976;7:518-22. rural community in Kenya: cross-sectional surveys with
155. Stafford EE, Masri S, Sorensen K. Parasitological survey emphasis on prevalence, incidence, duration of infection,
in Gorontalo North Sulawesi, Indonesia. Southeast Asian and polyparasitism. East Afr Med J 1991;68:112-23.
J Trop Med Public Health 1976;7:405-10. 168. El Shazly AM, Awad SE, Sultan DM, Sadek GS, Khalil HH,
156. Stafford EE, Sudomo M, Masri S, Brown RJ. Human Morsy TA. Intestinal parasites in Dakahlia governorate,
parasitoses in Bali, Indonesia. Southeast Asian J Trop with different techniques in diagnosing protozoa. J Egypt
Med Public Health 1980;11:319-23. Soc Parasitol 2006;36:1023-34.
157. Subbannayya K, Babu MH, Kumar A, Rao TS, Shivananda 169. Goldsmid JM, Rogers S, Mahomed K. Observations on
PG. Entamoeba histolytica and other parasitic infections the intestinal protozoa infecting man in Rhodesia. S Afr
in south Kanara district, Karnataka; J Commun Dis. Med J 1976;50:1547-50.
1989;21:207-13. 170. Hunter G, Bagshawe AF, Baboo KS, Luke R, Prociv P.
158. Supanaranond W, Migasena S, Pitisuttitham P, Intestinal parasites in Zambian patients with AIDS. Trans
Suntharasamai P. Health status of Thai volunteers in a R Soc Trop Med Hyg 1992;86:543-5.
cholera vaccine trial. J Med Assoc Thai 1990;73:548-51. 171. Kasssem HH, Zaed HA, Sadaga GA. Intestinal parasitic
159. Tanyuksel M, Yilmaz H, Ulukanligil M, Araz E, Cicek M, infection among children and neonatus admitted to
Koru O, et al. Comparison of two methods (microscopy Ibn-Sina Hospital, Sirt, Libya; J Egypt Soc Parasitol
and enzyme-linked immunosorbent assay) for the 2007;37:371-80.
diagnosis of amebiasis. Exp Parasitol 2005;110:322-6. 172. Ogunba EO. The prevalence of human intestinal protozoa
160. Yaman O, Yazar S, Ozcan H, Cetinkaya U, Gözkenç N, in Ibadan, Nigeria. J Trop Med Hyg. 1977;80:187-91.
Ateş  S, et al. [Distribution of intestinal parasites in
173. Okafor CN, Azubike CN. Studies in intestinal parasitic
patients presenting at the parasitology laboratory of the
disease agents in stools of people in a rural area of Nigeria.
medical school of Erciyes University between the years
West Afr J Med 1992;11:106-11.
of 2005 and 2008]. Turkiye Parazitol Derg 2008;32:266-70.
161. Yazar S, Yaman O, Gözkenç N, Sahın I. [Distribution of 174. Pampiglione S, Visconti S, Stefanini A. [Human intestinal
intestinal parasites among patients who presented at parasites in Subsaharan Africa. III. Pemba Island
the Department of Parasitology of the Erciyes University (Zanzibar-Tanzania)]. Parassitologia 1987;29:27-35.
Medical School.]. Turkiye Parazitol Derg 2005;29:261-3. 175. Pampiglione S, Visconti S, Pezzino G. [Human intestinal
162. Yosefi F, Randar M, Alavi S, Samany A. A study on parasites in Subsaharan Africa. II. Sao Tomé and
Prevalence of Gastrointestinal Parasitic Infections in HIV Principe]. Parassitologia 1987;29:15-25.
(+) Patients Referred to Ahvaz Razi Hospital in 2008- 176. Prinz A, Hinrainer-Wilfing C, Renoldner K. [Parasitological
2009. Jundishapur Journal of Microbiology 2012;5:424-6. results of a medico-anthropological research-work at the
163. Graczyk TK, Shiff CK, Tamang L, Munsaka F, Beitin AM, Azande in northeast-Zaire (author's transl)]. Wien Med
Moss WJ. The association of Blastocystis hominis and Wochenschr 1979;129:674-8.
Endolimax nana with diarrheal stools in Zambian school- 177. Ashford RW, Atkinson EA. Epidemiology of Blastocystis
age children. Parasitol Res 2005;98:38-43. hominis infection in Papua New Guinea: Age-prevalence
164. Ikeh EI, Obadofin MO, Brindeiro B, Baugherb C, Frost F, and associations with other parasites. Ann Trop Med
Vanderjagt D, et al. Intestinal parasitism in Magama Parasitol 1992;86:129-36.
Gumau rural village and Jos township in north central 178. Sawangjaroen N, Luke R, Prociv P. Diagnosis by faecal
Nigeria. Niger Postgrad Med J 2007;14:290-5. culture of Dientamoeba fragilis infections in Australian
165. Ouattara M, Silué KD, N'Guéssan AN, Yapi A, Barbara M, patients with diarrhoea. Trans R Soc Trop Med Hyg
Raso G, et al. [Prevalence and polyparasitism of intestinal 1993;87:163-5.
protozoa and spatial distribution of Entamoeba histolytica, 179. Stark D, Fotedar R, van Hal S, Beebe N, Marriott D,
E. dispar and Giardia intestinalis from pupils in the rural Ellis JT, et al. Prevalence of enteric protozoa in human
zone of Man in Côte d'Ivoire]. Sante 2008;18:215-22. immunodeficiency virus (HIV)-positive and HIV-negative
166. Raso G, Utzinger J, Silué KD, Ouattara M, Yapi A, Toty A, men who have sex with men from Sydney, Australia. Am
et al. Disparities in parasitic infections, perceived ill J Trop Med Hyg 2007;76:549-52.

“Quick Response Code” link for full text articles

The journal issue has a unique new feature for reaching to the journal’s website without typing a single letter. Each article on its first page has
a “Quick Response Code”. Using any mobile or other hand-held device with camera and GPRS/other internet source, one can reach to the full
text of that particular article on the journal’s website. Start a QR-code reading software (see list of free applications from http://tinyurl.com/
yzlh2tc) and point the camera to the QR-code printed in the journal. It will automatically take you to the HTML full text of that article. One can
also use a desktop or laptop with web camera for similar functionality. See http://tinyurl.com/2bw7fn3 or http://tinyurl.com/3ysr3me for the free
applications.

Tropical Parasitology 29 Jan 2016 | Volume 6 | Issue 1 |

View publication stats