Você está na página 1de 27

Núcleo Celular

 É o centro de controle
de todas as atividades
celulares.

 Não sintetiza
proteínas.

 Sua forma é variável e característica de cada tipo celular.

 Geralmente é uma estrutura arredondada ou alongada,


com 5 a 10 um
 Responsável pela
síntese e
processamento de
todos os tipos de
RNA:
 rRNA
 mRNA
 tRNA
 miRNA (pequenos RNAs não codificantes)

 Cada célula tem apenas 1 núcleo, localizado no seu centro,


mas há células multinucleadas.
 Membrana que separa o conteúdo intranuclear do citoplasma.

 É impermeável a íons e moléculas.

 Apresenta poros, e cada um é organizado por uma estrutura


denominada complexo do poro.

 Passagem de macromoléculas por difusão passiva.

 Complexo do poro
 Estrutura cilíndrica.
 Constituída por mais de 100 proteínas.
 Quantidade variada de acordo com o tipo celular e sua função.
 Do grego croma, cor.

 Material genético.

 Porção do núcleo que se cora e é visível ao microscópio,


com exceção dos nucléolos.

 Eucromatina
 Heterocromatina
 Unidade estrutural dos cromossomos.

 Formadas por um octâmero de proteínas histonas.

 Envolvidas por 166 pb de DNA.

 H1 (H5) é presa por 48 pb.


 Compactação da cromatina x cromossomos

 https://www.youtube.com/watch?v=ENJWh50sJRo
Centrômero Mediano

Centrômero submediano

Centrômero Subterminal

Levan, 1964 Centrômero Terminal


Citogenética

Citologia Genética

Ciência que
Ciência que
estuda a
estuda a célula
hereditariedade
 Esta área da ciência engloba
todo e qualquer estudo
relacionado com o
cromossomo, isolado ou em
conjunto, condensado ou
distendido, tanto no que diz
respeito à sua morfologia,
organização, função e
replicação, quanto à sua
variação e evolução.
 Coloração com Giemsa
 Coloração com Fluorocromos
Taxonomia

Filogenia Evolução

Citogenética

Melhoramento Medicina
Animal Clínica

Melhoramento
Vegetal
 Humano Aberrações Cromossômicas

Fonte: http://animais.culturamix.com/curiosidades/animais-vertebrados-e-invertebrados
Extração

PCR

Eletroforese
Região Forward Reverse Referência
Intergênic
a
Crozier and
16S 5’ CACCTGTTTATCAAAAACAT 3’ 5’ CGTCGATTTGAACTCAAAT 3’ Crozier ,1993
540 pb

Citocromo B 5' CG(A/T)TTAATTCATATAAATGG 5' TATCATTC(A/T)GGTTTAATATG Kaulianos et al.,


3' 3' 1999
580 pb
Extração

PCR

Eletroforese
 Exonuclease I Escherichia coli (EXOI)
 Fosfatase Alcalina de Camarão (SAP)
Purificação 37 ºC 60 m
80ºC 15 m

Sequenciamento
 Organelas esféricas intranucleares
não envolvidas por membrana.

 São as fábricas para a produção de


ribossomos.

 Constituídas por rRNA e proteínas.


 Lâmina Nuclear

 Estrutura fibrilar deixada pela extração bioquímica dos


componentes solúveis de núcleos isolados.

 Esqueleto para apoiar a cromatina interfásica.

 Constituída principalmente por RNA.


 Composição
 Água
 Íons
 Aminoácidos
 Metabólitos
 Enzimas
 RNA’s
 Dentre outros
 renan.nascimento@ufsb.edu.br
 renanmonteiro.bio@gmail.com

 http://lattes.cnpq.br/9523018821022568