Volume 6, Issue 1, 2013

Prolonged inflammatory cytokine expression during the late phase of wound healing in the
diabetic K14/mIGF1 transgenic mice.

Maryna S. Shkumat, Junior Research Scientist, Pathophysiology and Immunology Laboratory,

D.F. Chebotarev State Institute of Gerontology, NAMS, Kyiv, Ukraine

Pavlo P. Klymenko, Senior Research Scientist, Morphology and Cytology Laboratory, D.F. Chebotarev State Institute
of Gerontology, NAMS, Kyiv, Ukraine

Yuri I. Leonov, Research Scientist, Pathophysiology and Immunology Laboratory, D.F. Chebotarev State Institute of
Gerontology, NAMS, Kyiv, Ukraine

Iryna N. Pishel, Lead Research Scientist, Pathophysiology and Immunology Laboratory, D.F. Chebotarev State
Institute of Gerontology, NAMS, Kyiv, Ukraine

Pavel V.Glukhovskiy, Associate Professor, National University, Los Angeles, USA, pglukhovskiy@nu.edu

Abstract

Diabetes impairs numerous components of wound healing, including inflammation, matrix deposition, and
angiogenesis. The locally acting isoform of IGF-1 (mIGF-1) was shown to enhance wound healing. In this study, we
tested the therapeutic potential of mIGF-1 in the skin regeneration of diabetic mice. To establish the mechanism of
mIGF-1 transgene action on the diabetic wound healing the effect of mIGF-1 transgene on angiogenesis and its
interrelation with the inflammatory process in the wound was verified. Also, the total IGF-1 gene expression damage
in the uninjured skin of diabetic mice, and elevated level in the skin of K14/mIGF-1 transgenic mice were established.

Introduction

Injury to the skin initiates a series of events, which finally leads to at least partial reconstruction of the wounded tissue
[1-2]. Wound healing is a complicated process and involves a few stages (the main stages: inflammation,
proliferation, and maturation) and the participation of many cell subtypes (platelets, neutrophils, macrophages,
keratinocytes, fibroblasts, endothelial cells, nerve cells, lymphocytes, et al) [3]. The manner by which a distinct cell
population modulates the function of another cell population and the roles of different hormones and growth factors in
this process has been of great interest.

One of the hormones, which is thought to influence the repair process, is growth hormone (GH). This hormone is
successfully used in the treatment of growth defects as an anti-aging strategy [4]. Many effects of GH are mediated
via the insulin-like growth factor (IGF) system [5]. IGF-I is a mitogen for keratinocytes [6], and it stimulates collagen,
glycosaminoglycan, and proteoglycan synthesis by dermal fibroblasts.

The major source of circulating IGF-1 in postnatal life is the liver but IGF-1 can also be produced by many other
tissues, where it is thought to act in a paracrine fashion. In the context of skin, IGF-I has been identified as the active
paracrine growth-promoting factor secreted by feeder fibroblasts and macrophages for keratinocyte culture in vitro [7]
and was observed to stimulate the nondirectional migration of keratinocytes [8]. Treatment of wounds with IGF-I has
also been shown to accelerate healing by the stimulation of fibroblast collagen synthesis in addition to its mitogenic
effect on keratinocytes and fibroblasts [2, 9]. In keratinocytes, IGF-1 is thought to stimulate proliferation [10] and to
contribute to hair follicle morphogenesis [11-13]. Mice with a targeted deletion of the IGF-1 receptor die shortly after
birth from respiratory failure and show an abnormally thin and translucent epidermis with a decreased number of hair
follicles [11]. Until now, no function and mechanism of action for IGF-1 in wound healing has been clearly
demonstrated; there is recent evidence, however, that levels of IGF-1 are decreased in non-healing skin wounds of
diabetic individuals and during aging [14].

Wound healing, including re-epithelization, is delayed in diabetes [14]. Diabetes impairs numerous components of
wound healing, including hemostasis and inflammation, matrix deposition, and angiogenesis. These impairments are
present in a wide variety of tissues including myocardium, skeletal muscle, nerve, and skin. Cutaneous wounds in
diabetics have been shown to have altered blood flow, impaired neutrophil anti-microbial activity, and a dysfunctional
inflammatory state associated with abnormal chemokine expression [15].

The resolution of the inflammatory response is necessary to proceed toward wound repair. At the molecular level,
mIGF-1 expression can significantly down-regulate proinflammatory cytokines, such as tumor necrosis factor (TNF)-
alpha and interleukin (IL)-1beta, and modulated the expression of CC chemokines involved in the recruitment of
monocytes/macrophages. The aim of this study was to examine the effect of local overexpression of IGF-1 in the skin
on the rate of wound healing in diabetes.

1
Material and Methods

Mice and experimental model of diabetes

FVB.Cg (wt) and K14/mIGF-1 (tg +/- ) male mice were received from European Molecular Biology Laboratory (EMBL)
and maintained in vivarium conditions for laboratory animals of D.F. Chebotarev Institute of Gerontology, NAMS,
Kyiv, Ukraine.

A streptozotosin-based diabetes model was set up: 3 to 4-month-old wild type mice (wtD) and K14/mIGF-1 transgenic
mice (tgD) underwent the injection via intraperitoneal route with streptozotosin (Sigma, USA) dosage of 50 mg/kg for
5 consecutive days. Animals with a glucose level >15 mmol/L were taken for the experiment. Wounds were applied 3
weeks after the last injection.

Incisional injury model and wound processing

Local ethical committee approval was obtained for all studies. Male FVB mice (3 to 4-months-old) were anesthetized
by injection of ketamine (10mg/kg) 3 weeks after last injection with streptozotosin. The fur of the ventral and dorsal
skin was removed by shaving. Then, the skin was washed briefly with 70% ethanol, and four full-thickness dermal
punch wounds (5 mm in diameter) extending through the panniculus carnosus were produced on the dorsal skin of
each mouse. Mice were housed individually during the healing period. At specific times after injury, mice were again
anesthetized, and the wounds harvested for analysis. Individual wounds from each animal were processed
separately.

Wounds were excised and bisected at uninjured, days 5 and 8 after wounding, and one-half of the samples were
processed for histology. The remaining one-half of each wound was flash frozen and stored at -80°C before RNA
extraction. Skin and granuloma for the RNA extraction were stored and processed independently.

Semiquantitative Reverse Transcriptase Polymerase Chain Reaction (RT-PCR).

Total RNA was extracted from tissue by RNA extraction kit (AmpliSens, Moscow, Russia). cDNA was synthesized
with M-MuLV Reverse Transcriptase according to manufacturer’s instructions. The primer sequences used for PCR
amplification (from 5' to 3') are shown in Table 1.

Table 1. Primer sequences

GAPDH F GGTGAAGGTCGGTGTGAACGGA
R TGTTAGTGGGGTCTCGCTCCTG
TNF-α F GAAAGCATGATCCGCGACGTGGA
R TACGACGTGGGCTACAGGCTTG
IGF-1 (tg) F TACCAGCTCGGCCACAGCC
R CCGGATGGAACGAGCTGAC
IGF-1 (total) F TGCTCTTCAGTTCGTGTG
R ACATCTCCAGTCTCCTCAG
VEGF F TGAACTTTCTGCTCTCTTGG
R AACAAATGCTTTCTCCGCT
MIP-1α F GCCCTTGCTGTTCTTCTCTGT
R GGCAATCAGTTCCAGGTCAG
HIF-1 F TTGGGGATGAAAACATCTGC
R GGAGCTATCTCTCTAGACC
MCP-1 F TTTTGTCACCAAGCTCAAGAGAG
R TCACTGTCACACTGGTCACTCC
IL-1α F CTCTAGAGCACCATGCTACA
R TGGAATCCAGGGGAAACACTG

Primers were designed by Invitrogen (for IGF-1, both tg and total), Sigma (for VEGF, MIP-1α) and SibEnzyme Ltd
(Russia, for GAPDH, TNF-α, HIF-1, MCP-1, IL-1α). Samples containing mRNA for PCR analysis were treated with an
excess of RNase-free DNA (Sigma) before cDNA synthesis. PCR was carried out at Palm-Cycler (Corbett Research,
Australia) under the following conditions: denaturation at 94 °C, for 20 seconds; annealing at 55 °C, for 20 seconds;
extension at 72 °C, for 20 seconds. The number of amplification cycles was determined by preliminary experiments.
The cycles were as follows: GAPDH, 30; all other - 40. Then PCR products were electrophoresed in 1.5% agarose
gel and stained with 0.5 µg/ml ethidium bromide for 20 minutes. Photographs of the gel were taken with a camera
(Canon PowerShot A75), and the density of the band of negative image was analyzed by BioTestColor Image
software (Bio Test v.2.1, Amplisens, Russia). The expression level of mRNA was standardized by the expression of
GAPDH as an internal control.

2
Immunohistochemistry

Skin/wound biopsies were embedded in paraffin after formalin-fixed and 7 μm sections were obtained using a
microtome and later deparaffinized with xylene, rehydrated in ethanol. Sections were analyzed after Masson
trichrome staining (Sigma-Aldrich, USA).

For the immunohistochemistry study, sections were incubated in 3% H 2 O 2 to inactivate endogenous peroxides. The
sections were subsequently incubated with the following primary antibodies: (a) Cell proliferation marker Ki67 rabbit
IgG1K clone B56, BD Biosciences; (b) Cell proliferation marker for endothelial cells rabbit CD31, Abcam; (c) Marker
for granulocytes Gr1 Rat IgG2b/k, BD Biosciences; (d) Marker for macrophages CD11b/Mac1 Rat (DA) IgG2b/k, BD
Biosciences; e) Secondary antibodies: goat anti-rabbit-HRP and goat anti-rat-HRP (Vector Laboratories, Burlingame,
CA).

For color development the sections were incubated with DAB peroxidase substrate. Vector Fast red was used for
counterstaining. Both substrate and dye were obtained from Vector Laboratories (Burlingame, CA). Stained sections
were observed with a light microscope (Leica DC500) and images were obtained and processed using Abode
Photoshop software. “Image J” software was used for: morphometric quantitative analysis of area, thickness of
regenerating epithelia (thickened skin region); length of regenerating epithelia; length of open wound; total length of
regenerating epithelia and open wound.

Statistical analysis

Statistical significance between experimental groups was examined by the Fisher method of analysis using multiple
comparisons (value of p<0.05 was regarded as significant). For comparison between treatment groups, the null
hypothesis was tested by either a single-factor ANOVA for multiple groups or unpaired t-test for two groups.
Statistical significance was regarded as significant at p<0.05.

Results

The expression of IGF1 was detected during wound healing in diabetic mice. In all experiments transgenic mice that
express rat mIGF-1 ectopically under the control of a human K14 promoter were used. It was demonstrated that
fragment transgene expression was detected in the skin, but not in the liver or heart of K14mtg mice [19]. In situ
hybridization confirmed the expected K14 promoter-driven expression of the mIGF-1 transgene in the K14-positive
cells of the basal layer of the epidermis, and in the outer root sheath and the bulge compartment of the hair follicles
[19].

For the determination of the total IGF-1 gene expression the primer, which assessing the overall level (both tg IGF-1
and own IGF-1) of producing hormones (Figure 1) was used. It was found that total IGF-1 gene expression level
tends to decrease in the intact skin of wt diabetic mice and tends to increase in transgenic diabetic mice as compared
with intact animals (0 days). At days 5 and 8 after injury IGF-1 gene expression was significantly higher in skin wound
of diabetic wild-type mice compared with 0 days. In transgenic animals, IGF-1 expression levels were significantly
higher in the skin and granuloma in the 5th and 8th day after injury, compared with intact wild-type mice (Figure 1A,
B), as well as in granuloma on day 8, compared with diabetic wild-type mice (Figure 2B).

Figure 1. Total IGF-1 gene expression level in the skin (A), and in granulation tissue (B) at the different term of
wound healing (mean ± SE; * - P(t) < 0.05 vs the same tissue in wtD group; @ - P(U) < 0.05 vs the uninjured skin of
the same group; # - P(U) < 0.05 vs the same tissue in wt group).

Thus, it was found that IGF-1 gene expression in the wound skin increases significantly compared to uninjured tissue
on the 5th and 8th day in the mice with diabetes. In tgD group this increase was only incidental, but the IGF-1 mRNA
level was significantly higher in the skin of the tgD group compared to wt. On the 5th day in granuloma IGF-1 gene
expression was increased in both groups with diabetes, on the 8th day in this tissue mRNA level was significantly
3
higher only in tgD group. Thus, it is logical to assume that the maximum effect of the transgene can occur during this
period of healing.

IGF-1 transgene did not changed cutaneous wounds healing in diabetic K14/mIGF-1 mice.

It is well known that wounds heal poorly in patients with diabetes. In our study, the length of the open wound in mice
with diabetes was significantly higher in both wild-type and in transgenic diabetic animals compared to intact mice on
day 5 after injury. But the length of an open wound in tgD mice tended to decrease compare to wtD on the 8th day
after injury (Figure 2A).

In this study a significant difference in the growth area of regenerating epithelia between diabetic wild-type and
diabetic K14/mIGF-1 mice on day 8 after injury (Figure 2 C), was shown.

The area of the regenerating epithelium in transgenic animals was increased due to increase of its thickness. Also
differences in this parameter were found within tgD group between day 5 and day 8 (P < 0.05; Figure 2C).

A mm
1.0 * B
0.8 mm *
* 0.2
0.6
0.4
0.1
0.2
0.0 0
5 days 8 days 5 days 8 days
wt wtD tgD wt wtD tgD

C 2
*
mm *
0.6
0.4
0.2
0
5 days 8 days
wt wtD tgD

Figure 2. Morphometric parameters of wound healing. A: Length open wound (*p<0.05). B: Thickness of
regenerating epithelia (*p<0.05). C: Area of regenerating epithelia (*p<0.05).

Figure 3. The wounds of K14/ mIGF-1 mice with diabetes (A) and wtD mice (B) on day 5: large accumulation of
adipose connective tissues and the border edges of the wounds formed granuloma tissue. Formation of hair follicles
(→) (x100). C: The wound of K14/ mIGF-1 mice with diabetes on day 8. Pronounced growth of epithelial cells -
acanthous (x100). D: The regenerated skin of wt D mice on day 8. Hyperplasia and hypertrophy of epithelial basal
and prickle layers is not expressed (x100).

Morphological study of wounds after 5 days of injury, showed a large accumulation of an adipose connective tissues
and granuloma tissue, formed at the border edges of the wound in all groups. On a day 5 the formation of hair

4
 follicles near the wound was observed in all animals. Hair follicles were more accentuated in tgD mice than in wtD
mice (Figure 3 A-B).
On the day 8, after injury, a large formation of granuloma tissue with growth of more fibrous components was shown
in wounds of all groups. In regenerated skin of transgenic mice we observed occasionally stronger epithelial growth
(acanthous) than in wt (Figure 3. C-D).

The proliferation of the epithelial cells in wounds has shown in all groups at day 5 and 8. It was not significant
distinction at expression of Ki 67+ (Figure 4). The expression of Ki 67+ was mainly detected in basal cells and less in
prickle cells. Also high number of Ki67-positive cells was observed in hair follicles.

The significant alteration of Ki67+ epithelial cells number between all studied groups was not detected at 5 and 8
days after injury (Figure 4 G).

The CD31-positive endothelial cells in blood capillaries, venules and arteriole was detected in adipose connective
tissues of wounds on 5 and 8 days after injury in all 3 studied groups of mice (Figure 5 A) and in net layers of the skin
near the wound Also СD31-positive endothelial cells were detected in blood capillaries that grow in granuloma
(Figure 5 B). But the mean number of capillaries per unit area did not differ in wild and transgenic diabetic mice.

To estimate the intensity of the angiogenesis process, the relative levels of VEGF and HIF-1 gene expression in the
wound was assessed. It was shown that the greatest level of VEGF mRNA in wound granuloma of tg diabetic mice
was significantly higher than in wt (both intact and diabetic) at the 8 th day after injury (Figure 5 C), and greatest level
of HIF-1 mRNA in wound granuloma of diabetic mice (both wt and tg) compared with intact wt in this period (Figure 5
D).

A B C

D E F

Figure 4.
G Ki 67+ cells in regenerated wound of wt group (A),
3.5 wtD group (B) and tgD group (C), 5 day after injury.
In hair follicle were observed a high number of
3 Ki67+ cells on day 5 after injury in wt mice (D), wtD
2.5 mice (E) and in K14/mIGF-1 transgenic mice with
diabete (F) (x200). Number Ki67+ epithelial cells in
2
mice (Kaplow coefficient) (G).
1.5
1
0.5
0
5 days 8 days

wt wtD tgD

5
 Figure 5. A: Adipose connective tissues on day
5 wound healing in K14/mIGF-1 mice with
diabetes. CD31+ cells in arterioles (→) and
venules (*) (х200). VEGF (B) and HIF-1 (C) gene
expression is higher in 8 day’s granulation tissue of
tgD (# - p<0.05 vs the same tissue in wt group, ♣
p<0.05 vs the same tissue in wtD group; M ± m).

These results indicate that, at the 8 th day after injury in the wound of tgD mice the level of IGF-1 gene expression
was increased. However, its elevated levels have only a minor effect on the rate of diabetic wound healing in contrast
to the results obtained by Semenova et al. [19] in experiments on intact (not diabetic) mice. It is established that the
wound healing in tgD mice is accompanied by an accelerated re-epithelialization by a greater thickness and area of
regenerating epithelia, which corresponds to data in [19]. The differences in the number of Ki-67 positive cells and
СD-31 positive endothelial cells between tg and wt mice with diabetes were not found. But it was shown the
increased level of VEGF gene expression in wound granuloma of tg compared with wt diabetic mice. This fact may
suggest that despite the absence of differences in the number CD31-positive cells, intensity of angiogenesis in tgD
mice granuloma wounds may be higher and may serve as a one of disincentive closure of the wound. But big effect
on all these processes can be affected by inflammation processes in the wound.

Inflammatory response during wound healing in K14/mIGF-1 diabetic mice

Accelerated re-epithelialization in mIGF-1 transgenic mice might result from a direct effect of mIGF-1 on keratinocytes
or from an indirect effect that is mediated via the stroma. In the early phase of the repair process, inflammatory cells
are particularly important regulators of keratinocyte migration and proliferation [20]. Semenova et al. [19]
demonstrated that the inflammatory infiltrate in the wounds at a later stage of healing (5-day wounds) content
neutrophils and macrophages as infiltrating cells, but their number revealed no significant differences between mIGF-
1 and wild-type animals. Authors also did not observe significant differences in the expression of various chemokines,
cytokines, and growth factors that are known to be associated with the inflammatory response in the wound [19].

In this experimental model in diabetic mice there were no any significant differences in infiltrating neutrophils and
macrophages between mIGF-1 and wild-type diabetic animals observed. However, significant higher numbers of
monocyte/macrophage (Mac-1 positive) cells (Figure 6 A) and granulocytes (Gr-1+) have been observed (Figure 6 B)
in the wound granuloma of wtD mice on 8 day after injury, and tendency to decrease its number (not significant) in
K14/mIGF-1 diabetic group. Significantly higher number of macrophages/monocytes and granulocytes in the wound
of wt mice with diabetes is accompanied by higher intensity of infiltration of these cells across of capillary’s wall
during wound healing (Figure 6 C-H). Significantly higher number of macrophages/monocytes and granulocytes in
the wound of mice with diabetes are evidencing the amplification of inflammation processes in the wound of mice with
streptozotocin-induced diabetes. Also, mIGF-1 transgene had no significant effect on the magnitude of this process.

To investigate possible differences for the inflammatory phase of wound healing in tgD compared with wtD a cytokine
gene expression in the regenerating skin and granuloma at the 5th and 8th day after injury were determined.
Significant differences in proinflammatory cytokine and chemokine mRNA level between skin and granuloma tissue at
5th day after injury – a higher level MIP-1α, and MCP-1, and lower level of TNF-α in granuloma compared with skin
were observed. In diabetic wtD mice these changes were not significant. An increased TNF-α gene expression in
granuloma of wtD mice compared with non-diabetic group (Table 2) has been seen. Similar changes were found for
IGF-1 gene expression level (Figure 1B). This fact may indicate a possible linkage between the level of IGF-1 and the
6
level of proinflammatory cytokines such as TNF-α in the wound healing in diabetic mice. Differences in mRNA levels
between the skin and granuloma are not so pronounced. But in the granuloma in this period IGF-1gene expression
level, as well as the cytokine expression levels (for genes IL-1α, TNF-α and MCP-1) in comparison with wtD group at
the 8th day after injury (Table 2). The obtained data suggest the presence of a longer phase of inflammation in
wound healing in transgenic animals with diabetes.

* A B
3.5
3.0 *
* 3.5
2.5 3.0 *
2.0 2.5
1.5
2.0
1.5
1.0
1.0
0.5 0.5
0.0 0.0
5 days 8 days 5 days 8 days
wt wtD tgD
wt wtD tgD

C D E

F G H

Figure 6. A: Mac1+-cells (Kaplow coefficient) in wound in different groups (*p<0.05). B: of Gr-1+-cells in wound of
different groups (*p< 0.05). Day 8 infiltration of monocytes/macrophages through blood capillaries absent of a wild
type mice (C) and K14/mIGF-1 transgenic mice with diabetes (E) (x200) and can be observed in wild type diabetic
mice (D) (→) (x400). Day 8, granulocytes in a wound of wild type mice (F) and activity infiltration of granulocytes can
be observed through the blood capillary walls in wtD (G) (→) (x400) and K14/mIGF-1 transgenic mice with diabetes
a few quantity of granulocyte in wound, absent of a infiltration granulocytes (→) (x200) (H).

7
 Table 2. Relative level of cytokine genes expression in the skin and granuloma at different terms after injury, (M ± m)

Groups wt wtD wtD

Type of Intact Skin, Granu- Skin, Granu- Intact Skin, Granu- Skin, Granu- Intact Skin, Granu- Skin, Granu-
tissue/ skin 5 day lema, 8 day lema, skin 5 day lema, 8 day lema, skin 5 day lema, 8 day lema,
cytokines 5 day 8 day 5 day 8 day 5 day 8 day

IL-1a 2.32 ± 2.59 ± 1.40 ± 3.29 ± 0.92 ± 0.90 ± 0.96 ± 2.44 ± 2.35 ± 0.40 ± 1.49 ± 2.68 ± 1.49 ± 1.77 ± 1.19 ±
0.44 0.64 0.19 1.03 0.37 0.33▲ 0.04▲ 0.67* 0.55 0.07*# 0.51 0.60 0.24 0.69 0.23 ♣

TNFα 1.21 ± 1.86 ± 0.86 ± 1.06 ± 0.34 ± 0.95 ± 1.24 ± 2.31 ± 1.73 ± 0.49 ± 1.25 ± 2.20 ± 1.39 ± 1.49 ± 1.24 ±
0.28 0.21 0.09 0.19 # 0.25 0.45 0.35 0.32 ▲ 0.37 0.17 * # 0.26 0.46 0.12 ▲♣ 0.22 0.15 ▲♣

MIP-1α 0.14 ± 0.22 ± 1.38 ± 2.68 ± 1.61 ± 0.26 ± 1.09 ± 2.63 ± 1.03 ± 1.33 ± 0.09 ± 1.31 ± 1.42 ± 1.34 ± 2.45 ±
0.12 0.15 0.16 * 1.01 ♦# 0.32 0.26 0.43 ♦ 0.71 0.35 0.53 0.09 0.56 ♦ 0.14 0.25 ♦ 0.45 #

MCP-1 0.82 ± 1.00 ± 2.01 ± 2.32 ± 1.79 ± 0.48 ± 1.17 ± 2.96 ± 0.99 ± 1.16 ± 0.46 ± 2.24 ± 2.13 ± 2.27 ± 2.37 ±
0.16 0.20 0.21* 0.80 ♦ 0.55 0.28 0.23 0.80 0.32 0.42 # 0.16 0.33 ▲♦ 0.59 1.02 ♦ 0.28 ♠

n 6 4 5 4 5 6 4 5 4 6 6 6 7 4 6
* - p(U) < 0.05 granuloma vs skin in the same day
# - p(U) < 0.05 vs the same tissue on day 5
♦ - p (U) <0.05 vs intact skin
▲ p(U) < 0.05 vs the same tissue in wt group
♣ p(U) <0.05 vs the same tissue in wtD group
♠ - p (t) < 0.05 vs the same tissue in wtD group

8
Discussion

It is known that wounds of diabetic rats exhibit a delay in IGF-I and IGF-II expression [21]. A human study by Blakytny
et al. [14] revealed that IGF-I is reduced or absent in the epidermis and dermal fibroblasts of diabetic skin and
recalcitrant wounds. Under culture conditions IGF-I is essential for keratinocyte proliferation and also stimulates
keratinocyte migration [22,23]. The derivation of IGFs in wound fluid may include migrating keratinocytes, epithelial
cells of adjacent hair follicles, granulation tissue fibroblasts, inflammatory cells, and serum [21, 24]. Retarded wound
healing may be partially due to alterations in the IGF system.

In the presented work the IGF-1 gene expression was impaired in the uninjured skin of diabetic mice, and increased
in the skin of K14/mIGF-1 transgenic mice. After 5 days of injury, high levels of IGF-1 gene expression in the skin and
granuloma were observed in both lines of diabetic mice. But after 8 days of injury its level was increased in the
granuloma of tgD mice compared with wtD. Morphological changes of diabetic wound in wtD and tgD mice evidenced
faster division of epithelial cells of tgD mice. This epithelial cell division can lead to thickening of epithelial cell layers
and to development of acanthosis, which corresponds to data Semenova et al [19]. But increased epithelial cell
division does not lead to significant acceleration of wound healing in tgD mice with diabetes. IGF-1 has been
identified as the active paracrine growth-promoting factor secreted by feeder fibroblasts for keratinocyte culture in
vitro [7], it can also stimulate the nondirectional migration of keratinocytes [25]. Treatment of wounds with IGF-1 has
been shown to accelerate healing by stimulation of fibroblast collagen synthesis in addition to its mitogenic effect on
keratinocytes and fibroblasts. Clinical application of IGF-I to the wound site results in an increase in reepithelialization
[26], angiogenesis [27], dermal collagen deposition [28], and improved wound-healing rates. Local IGF-I treatment
can also ameliorate impaired wound healing associated with diabetes [29].

In the proposed model mIGF-1 transgene is expressed in keratinocytes in skin dermis [19]. It is known that the
dermis is richly supplied by blood vessels. Blood vessels are critical to the viability of the skin. When blood vessels
are insufficient, abnormal, or damaged (as occurs in burns, severe trauma, or chronic conditions like diabetes), tissue
viability is at risk, leading to poor wound healing and chronic skin ulcers. Therefore, it is suggested that the direct
action of mIGF-1 transgene may be affected via keratinocyte migration or angiogenesis in the wound.

Angiogenesis occurs during normal wound healing and is regulated by many growth factors, including IGF-1. IGF-1
stimulates vascular EC migration and tube formation [30] and promotes rat aortic angiogenesis in vitro [31]. IGF-1
might be a potential mediator of vascular growth responses in insulin-deficient diabetes and in hyperinsulinemic
states [32]. The process of angiogenesis is closely related to the formation of granulation tissue. It depends on the
concerted action of multiple factors produced by a variety of cells. These include macrophages and keratinocytes,
which produce angiogenic factors such as vascular endothelial growth factor [33, 34]. Therefore, different wound
tissue (skin and granulation) were used for the analysis.

A large number of CD31+ positive endothelial cells in wound capillaries, arterioles and venules in both groups of
th th
diabetic mice on the 5 day and 8 day after injury were found. This fact may suggest the high proliferation activity of
endothelial cells and the stronger vascular genesis in a wound. But the mean number of capillaries per unit area did
not differ in wild and transgenic diabetic mice in these experiments.

Vascular endothelial growth factor (VEGF), a member of a family of growth factors with essential roles in vascular
and lymphatic growth and patterning, has been shown to be deficient in experimental and clinical diabetic wounds
[35]. In the wound skin of wt diabetic mice there was no any changes in the VEGF gene expression, but in granuloma
high VEGF mRNA levels as compared with wt control mice were observed. In tgD diabetic mice this parameter was
higher at the 8th day of wound healing in comparison with wtD mice. This result may suggest the prolonged and more
effective angiogenesis in the transgenic mice with diabetes.

This more effective angiogenesis may have direct influence on diabetic wound healing because the VEGF-treated
wounds demonstrated increased epithelialization, increased matrix deposition, and enhanced cellular proliferation
[36]. It also showed that the effects of chronically infused VEGF is caused by the monocyte attractant effect of VEGF
that binds to the VEGF receptor 1, which is exclusively present on monocytes .

In our experiment, a significantly higher numbers of monocyte/macrophage (Mac-1 positive) cells (Figure 6 A) and
granulocytes (Gr-1+) (Figure 6 B) in the wound granuloma of wtD mice on the 8th day after injury were seen, but in
tgD mice we did not observe significant differences in infiltrating neutrophils and macrophages between mIGF-1 and
wildtype diabetic animals. We concluded that a significantly higher number of macrophages/monocytes and
granulocytes in the wounds of mice with diabetes show evidence of amplification of the inflammation process in the
wound of mice with streptozotocin-induced diabetes. mIGF-1 transgene had no significant effect on the magnitude of
this inflammation process.

The recruitment of monocytes/macrophages is tightly regulated by CC chemokines, such as MCP-1, MIP-1α, and
other. The monocyte/macrophage chemoattractant activities of these chemokines are evident in that treatment with
their neutralizing antibodies causes a decrease in the number of macrophages at the wound site, suggesting a direct
involvement of these chemokines in the infiltration of monocytes/macrophages [37]. Therefore, the increased MCP-1
level in tgD mice might explain the infiltration of monocytes/ macrophages, which can in turn, produce TNFα
endogenously. Accordingly, a prolonged MCP-1, IL-1α and TNF-α gene expression level in tgD mice was obtained.
This fact suggests that mIGF-1 may affect wound healing via the prolongation of the inflammatory response. In tgD

9
animals there is an effect of IGF-1 on epithelial growth, but prolonged chemokine and proinflammatory cytokine
production, did not accelerate the wound healing in diabetic mice.

In this work it was shown that in K14m/IGF1 diabetic mice a significant increase of IGF-1 and VEGF gene expression
were observed in wound granuloma at 8 days after injury compared with wild type diabetic mice. This period of
wound healing is characterized by a significant increase in area and thickness of regenerating epithelia, and by the
absence of any differences in wound healing (length of open wound). Wound healing in diabetic mice was
accompanied by an increase in the number of Mac-1 positive cells in the wound, and by the high expression of the
proinflammatory cytokine and chemokine genes (IL-1α, TNFα and MCP-1) in wound granuloma of K14m/IGF1 mice
at the 8th day after injury. Obtained results suggest that the absence of the enhancing effect of tgIGF-1 in the wound
healing process may be due to an inflammatory response prolongation in the wound.

Acknowledgements

Dr. Ekaterina Semenova (St. John's Institute of Dermatology, Division of Genetics and Molecular Medicine, London,
UK) and Prof. Nadia Rosenthal (EMBL, Monterotondo, Italy) are highly acknowledged for their assistance in planning
of the experiments, providing with the different lines of mice and valuable discussion of the results.

Financial support was provided by EMBL (Monterotondo, Italy): grant ASTF №:234-08

List of references

1.auf dem Keller U, Kümin A, Braun S, Werner S. Reactive oxygen species and their detoxification in healing skin
wounds / Journal of Investigative Dermatology Symposium Proceedings. 2006, 11: 106–111.

2. Martin P. Wound Healing - Aiming for Perfect Skin Regeneration. / Science. 1997, 276(5309): 75-81.

3.Grazul-Bilska A, Johnson M, Bilski J, Redmer D, Reynolds L, Abdullah A, Abdullah K. Wound healing: The role of
growth factors. / Drugs Today. 2003, 39(10): 787-795.

4. Cummings D, Merriam G. Growth Hormone Therapy in Adults / Annual Review of Medicine. 2003 Nov, 54: 513-
533.

5. Green H, Morikawa M, Nixon T. A dual effector theory of growth-hormone action. / Differentiation. 1985, 29(3):195-
198.

6. Eming S, Snow R, Yarmush M, Morgan J. Targeted expression of insulin-like growth factor to human
keratinocytes: modification of the autocrine control of keratinocyte proliferation. / Journal of Investigative
Dermatology. 1996, 107: 113–120.

7.Barreca A, De Luca M, Del Monte P, Bondanza S, Damonte G, Cariola G, Di Marco E, Giordano G, Cancedda R,
Minuto F. In vitro paracrine regulation of human keratinocyte growth by fibroblast-derived insulin-like growth factors. /
J Cell Physiol. 1992, 151:262–268

8. Blenis, J. Signal transduction via the MAP kinases: proceed at your own risk. Proc. Natl. Acad. Sci. USA, 1993,
90(13): 5889-5892.

9.Guler H, Zapf J, Scheiwiller E, Froesch E. Recombinant human insulin-like growth factor I stimulates growth and
has distinct effects on organ size in hypophysectomized rats. Proc. Natl. Acad. Sci. USA, 1988, 85(13): 4889-4893.

10. Tavakkol A, Elder J, Griffiths C, et al. Expression of Growth Hormone Receptor, Insulin- Like Growth Factor 1
(IGF-1) and IGF-1 Receptor mRNA and Proteins in Human Skin / Journal of Investigative Dermatology, 1992, 99(3):
343-349.

11.Johansson, Olle; Peng Yue Liu, Olle. Ymelanocyte stimulating hormone (γ-MSH)- like immunoreactivity is present
in certain normal human keratinoytes / Experimental Dermatology, 1993, 2(5): 204-208.

12.Philpott M, Sanders D, Kealey T. Effects of insulin and insulin-like growth factors on cultured human hair follicles:
IGF-I at physiologic concentrations is an important regulator of hair follicle growth in vitro / Journal of Investigative
Dermatology, 1994, 102(6): 857-861.

13. Rudman, S, Philpott, M, Thomas, G, Kealey, T. The Role of IGF-I in Human Skin and its Appendages:
Morphogen as Well as Mitogen? / Journal of Investigative Dermatology, 1997, 109 ( 6): 770-777.

14.Blakytny R, Jude EB, Martin Gibson J, Boulton AJ, Ferguson MW Lack of insulin-like growth factor 1 (IGF1) in the
basal keratinocyte layer of diabetic skin and diabetic foot ulcers. / J Pathol. 2000, 589–594.

10
15.Wetzler C, Kampfer H, Stallmeyer B, Pfeilschifter J, Frank S. Large and sustained induction of chemokines during
impaired wound healing in the genetically diabetic mouse: prolonged persistence of neutrophils and macrophages
during the late phase of repair. / J Invest Dermatol. 2000, 115:245-253.

16. Mann, H.B., Whitney, D. R. On a Test of Whether one of Two Random Variables is Stochastically Larger than the
Other. // Annals of Mathematical Statistics, 1947, 18(1): 50– 60.
17. Wilcoxon, F., Individual comparisons by ranking methods // Biometrics Bulletin, 1945, 1(6): 80-83.

18. Kaplow L.S. A histochemical procedure for localising an evacuating leucocyte alcaline phasphatase activity in
Smears of blood marrow. // Blood. 1955, 10:1023-1029.

19. Semenova E, Koegel H, Hasse S, Klatte JE, Slonimsky E, Bilbao D, Paus R, Werner S, Rosenthal N.
Overexpression of mIGF-1 in keratinocytes improves wound healing and accelerates hair follicle formation and
cycling in mice. / The American J. Pathology. 2008, 173(5):1295-1310.

20. Werner S, Grose R: Regulation of wound healing by growth factors and cytokines // Physiol Rev 2003(83):835–
870.

21. Brown DL, Kane CD, Chernausek SD, Greenhalgh DG. Differential expression and localization of insulin-like
growth factors I and II in cutaneous wounds of diabetic and nondiabetic mice. / Am J Pathol. 1997, 151:715–724.

22. Telasky C, Tredget EE, Shen Q, Khorramizadeh MR, Iwashina T, Scott PG, Ghahary A. IFN-а2b suppresses the
fibrogenic effectsof insulin-like growth factor-1 in dermal fibroblasts. / J Interferon Cytokine Res. 1998, 18:571–577.

23. Neely EK, Morhenn VB, Hintz RH, Wilson DM, Rosenfeld RG. Insulin-like growth factors are mitogenic for human
keratin-ocytes and a squamous cell carcinoma. / J Invest Dermatol. 1991, 96:104–110.

24. Gartner MH, Benson JD, Caldwell MD. Insulin-like growth factors I and II expression in the healing wound./ J
Surg Res. 1992, 52:389–394.

25. Ando Y, Jensen PJ. Epidermal growth factor and insulin-like growth factor I enhance keratinocyte migration / J
Invest Dermatol. 1993, 100: 633–639.

26. Bhora FY, Dunkin BJ, Batzri S, Aly HM, Bass BL, Sidawy AN, Harmon JW. Effect of growth factors on cell
proliferation and epithelialization in human skin. / J Surg Res. 1995, 59:236–244.

27. Roesel JF, Nanney LB. Assessment of differential cytokine effects on angiogenesis using an in vivomodel of
cutaneous wound repair. / J Surg Res. 1995, 58:449–459.

28. Ghahary A, Tredget EE, Shen Q. Insulin-like growth factor-II/mannose 6 phosphate receptors facilitate the matrix
effects of latent transforming growth factor-beta1 released from genetically modified keratinocytes in a
fibroblast/keratinocyte co-culture system. / J Cell Physiol. 1999, 180:61–70.

29. Bitar MS, Pilcher CW, Khan I, Waldbillig RJ. Diabetes-induced suppression of IGF-1 and its receptor mRNA
levels in rat superior cervical ganglia. / Diabetes Res Clin Pract. 1997, 38:73–80.

30. Nakao-Hayashi J, Ito H, Kanayasu T, Morita I, Murota S. Stimulatory effects of insulin and insulin-like growth
factor I on migration and tube formation by vascular endothelial cells. / Atherosclerosis. 1992, 92:141–149.

31. Nicosia RF, Nicosia SV, Smith M. Vascular endothelial growth factor, platelet-derived growth factor, and insulin-
like growth factor-1 promote rat aortic angiogenesis in vitro. / Am J Pathol. 1994, 145:1023–1029.

32. Frystyk J, Ledet T, Moller N, Flyvbjerg A, Orskov H. Cardiovascular disease and insulin-like growth factor I. /
Circulation. 2002, 106:893–895.

33. Sunderkotter C, Steinbrink K, Goebeler M, Bhardwaj R, Sorg C. Macrophages and angiogenesis. / J. Leukoc.
Biol. 1994, 55: 410–422.
34. Dvorak HF, Brown LF, Detmar M, Dvorak AM. Vascular permeability factor/vascular endothelial growth factor,
microvascular hyperpermeability, and angiogenesis. / Am. J. Pathol. 1995, 146, 1029–1039.

35. Frank S, Hubner G, Breier G, Longaker MT, Greenhalgh DG, Werner S. Regulation of vascular endothelial
growth factor expression in cultured keratinocytes. Implications for normal and impaired wound healing. / J Biol
Chem. 1995, 270:12607-12613.

36. Galiano R, Michaels J, Dobryansky, M, Levine, J, Gurtner, G. Quantitative and reproducible murine model of
excisional wound healing. / Wound Repair & Regeneration, 2004, 12, 4: 485-492.

11
 37. Yoshida S, Yoshida A, Ishibashi T, Elner SG, Elner VM. Role of MCP-1 and MIP-1alpha in retinal
neovascularization during postischemic inflammation in a mouse model of retinal neovascularization./ J Leukoc Biol.
2003 Jan;73(1):137-44.

12