Você está na página 1de 223

1.

Resposta: D
Comentário: Analisando os termos utilizados:
- Metabolismo é o conjunto de reações químicas que ocorrem num organismo vivo, sendo representado por reações de síntese
(anabolismo, como a fotossíntese que produz glicose) e de degradação (catabolismo, como a respiração celular que degrada glicose
para liberar energia);
- Auto-replicação, relacionada aos processos reprodutivos, se dá pela duplicação do material genético, ou seja, do DNA, no caso das
células;
- Mutação é o processo de alteração no material genético, essencial à variabilidade que possibilita o processo evolutivo.

2.
Resposta: B
Comentário: O processo de reprodução mostrado na tirinha é a bipartição ou cissiparidade, um tipo de reprodução assexuada. Na
reprodução assexuada, os organismos criam cópias idênticas a si (clones), não havendo variabilidade genética. A vantagem desse
processo reprodutivo está no fato de os descendentes guardarem as mesmas qualidades dos genitores (matrizes), além de não
necessitar de parceiros para a reprodução e muitas vezes ser rápida e capaz de gerar grande quantidade de descendentes. Por outro
lado, a desvantagem desse processo está no fato de os descendentes guardarem também os mesmos defeitos dos genitores. Para
ambientes estáveis, a reprodução assexuada se mostra positiva, uma vez que as matrizes (e conseqüentemente seus descendentes) já
devem estar bem adaptadas ao meio. Para ambientes em mudança, a reprodução assexuada se mostra problemática, pois as matrizes (e
seus descendentes) provavelmente estavam bem adaptadas ao meio antes da mudança, mas não estarão tão bem adaptados ao ambiente
mudado. Assim, são características do processo representado rapidez, simplicidade e semelhança genética.

3.
Resposta: A
Comentário: Na reprodução assexuada, os organismos criam cópias idênticas a si (clones), não havendo variabilidade genética. A
vantagem desse processo reprodutivo está no fato de os descendentes guardarem as mesmas qualidades dos genitores (matrizes), além
de não necessitar de parceiros para a reprodução e muitas vezes ser rápida e capaz de gerar grande quantidade de descendentes. Por
outro lado, a desvantagem desse processo está no fato de os descendentes guardarem também as mesmas qualidades negativas dos
genitores. Para ambientes estáveis, a reprodução assexuada se mostra positiva, uma vez que as matrizes (e conseqüentemente seus
descendentes) já devem estar bem adaptadas ao meio. Para ambientes em mudança, a reprodução assexuada se mostra problemática,
pois as matrizes (e seus descendentes) provavelmente estavam bem adaptadas ao meio antes da mudança, mas não estarão tão bem
adaptados ao ambiente mudado. Na reprodução sexuada, os organismos criam geram descendentes com ligeiras diferenças em relação
ao organismo parental, havendo variabilidade genética. Esta variabilidade é a base para a adaptação dos seres a novos ambientes, uma
vez que a variabilidade pode gerar descendentes adaptados às novas características ambientais. Assim, as espécies que apresentam
gametogênese, possuindo reprodução sexuada, possuem maior chance de se adaptar ao meio ambiente.

4.
Resposta: C
Comentário: Na reprodução assexuada, os organismos criam cópias idênticas a si (clones), não havendo variabilidade genética.
Assim, processos de reprodução assexuada são mecanismos naturais de clonagem. Mecanismos de reprodução assexuada ocorrem em
organismos de todos os grupos de seres vivos, sendo exemplos:
- bipartição ou divisão binária (termo usado para uni ou pluricelulares) ou cissiparidade (termo usado para unicelulares somente) em
vários grupos;
- esporulação em vários grupos;
- brotamento em esponjas, corais, hidras e fungos;
- regeneração ou fragmentação na maioria dos invertebrados;
- laceração em planárias;
- estrobilização em cnidários;
- esquizogênese em anelídeos poliquetos;
- propagação vegetativa natural e produção artificial de mudas em vegetais (por processos como estaquia, mergulhia, alporquia ou
enxertia).
Conclui-se então que são processos de clonagem a divisão binária (I) e brotamento (II). Transformação, transdução e conjugação são
mecanismos de reprodução sexuada em bactérias, uma vez que envolvem variabilidade genética.

5.
Resposta: C
Comentário: Na reprodução assexuada, os organismos criam cópias idênticas a si (clones), não havendo variabilidade genética. A
vantagem desse processo reprodutivo está no fato de os descendentes guardarem as mesmas qualidades dos genitores (matrizes), além
de não necessitar de parceiros para a reprodução e muitas vezes ser rápida e capaz de gerar grande quantidade de descendentes. Por
outro lado, a desvantagem desse processo está no fato de os descendentes guardarem também as mesmas qualidades negativas dos
genitores. Para ambientes estáveis, a reprodução assexuada se mostra positiva, uma vez que as matrizes (e conseqüentemente seus
descendentes) já devem estar bem adaptadas ao meio. Para ambientes em mudança, a reprodução assexuada se mostra problemática,
pois as matrizes (e seus descendentes) provavelmente estavam bem adaptadas ao meio antes da mudança, mas não estarão tão bem
adaptados ao ambiente mudado.
Na reprodução sexuada, os organismos criam geram descendentes com ligeiras diferenças em relação ao organismo parental, havendo
variabilidade genética. Esta variabilidade é a base para a adaptação dos seres a novos ambientes, uma vez que a variabilidade pode
gerar descendentes adaptados às novas características ambientais. Assim:
Item I: Tanto a reprodução assexuada como a sexuada permitem a manutenção das espécies.
Item II: Somente a reprodução sexuada apresenta variabilidade genética.
Item III: A reprodução assexuada não envolve variabilidade genética, possibilitando a manutenção do patrimônio genético sem
alteração (sendo qualquer alteração devido a mutações).
Item IV: A variabilidade genética da reprodução sexuada possibilita uma maior probabilidade de sobrevivência quando o ambiente
sofre modificação desfavorável.

6.
Resposta: C
Comentário: Vírus são estruturas biológicas acelulares, dotadas da capacidade de replicação, mas somente quando dentro de uma
célula hospedeira, o que os caracteriza como parasitas intracelulares obrigatórios. Isso ocorre porque vírus não possuem uma
aparelhagem enzimática capaz de expressar sua informação genética, ou seja, não têm metabolismo próprio e dependem, por isso, do
metabolismo da célula hospedeira.

7.
Resposta: E
Comentário: O conjunto de reações químicas que ocorrem num ser vivo recebe o nome de metabolismo. A perda do metabolismo é o
principal evento que marca a transição do estado “vivo” para o estado “morto” num determinado organismo. O metabolismo engloba
reações de síntese de moléculas complexas a partir de moléculas simples, o que se chama anabolismo, e reações de quebra de
moléculas complexas em moléculas simples, o que se chama catabolismo.

8.
Resposta: D
Comentário: Analisando cada item:
Item A: verdadeiro. Apesar de a água ser o componente mais abundante da matéria viva, qualitativamente as moléculas orgânicas
são as mais importantes, sendo caracterizadas basicamente pela presença de carbono ligado covalentemente a outros átomos de
carbono e átomos de hidrogênio, oxigênio e nitrogênio.
Item B: verdadeiro. Muitas das moléculas orgânicas são polímeros, como as proteínas formadas de aminoácidos, os ácidos nucleicos
formados de nucleotídeos e os polissacarídeos (como amido e celulose) formados de monossacarídeos (como a glicose).
Item C: verdadeiro. A partir dos mesmos aminoácidos, cada organismo vivo pode produzir uma ampla variedade de proteínas, o
mesmo ocorrendo com nucleotídeos e ácidos nucleicos e com monossacarídeos e polissacarídeos.
Item D: verdadeiro. O DNA é constituído de 4 tipos diferentes de desoxirribonucleotídeos (de adenina, citosina, guanina e timina) e
o RNA por 4 tipos diferentes de ribonucleotídeos (de adenina, citosina, guanina e uracila).

9.
Resposta: B
Comentário: Homeostase é a capacidade que os seres vivos possuem de manter sua organização e composição química constante e
diferente do meio externo.

10.
Resposta: D
Comentário: Analisando cada item:
Item A: falso. Como são acelulares, vírus não possuem membrana plasmática.
Item B: falso. Vírus não são auto-suficientes porque não tem metabolismo próprio, dependendo da célula hospedeira para a síntese de
ácidos nucléicos e proteínas indispensáveis à sua reprodução.
Item C: falso. Vírus não têm metabolismo próprio, sendo parasitas intracelulares obrigatórios.
Item D: verdadeiro. Salvo raríssimas exceções, vírus possuem apenas um tipo de ácido nucléico que, dependendo do vírus, pode ser
o DNA ou o RNA.

11.
Resposta: A
Comentário: Mecanismos de reprodução assexuada ocorrem em organismos de todos os grupos de seres vivos, sendo exemplos:
- bipartição ou divisão binária (termo usado para uni ou pluricelulares) ou cissiparidade (termo usado para unicelulares somente) em
vários grupos;
- esporulação em vários grupos;
- brotamento em esponjas, corais, hidras e fungos;
- regeneração ou fragmentação na maioria dos invertebrados;
- laceração em planárias;
- estrobilização em cnidários;
- esquizogênese em anelídeos poliquetos;
- propagação vegetativa natural e produção artificial de mudas em vegetais (por processos como estaquia, mergulhia, alporquia ou
enxertia).
Assim, cissiparidade e gemulação (um tipo de brotamento em esponjas de água doce) são exemplos de reprodução assexuada.
Observação: Parassexualidade pode ser definido como a ocorrência de processos de sexualidade primitiva, sem fecundação
propriamente dita nem meiose, como ocorre em processos de conjugação bacteriana.

12.
Resposta: C
Comentário: Os vírus são acelulares, sendo formados por um capsídeo protéico que envolve um material genético, que pode ser RNA
ou DNA. Eles não possuem sistemas enzimáticos próprios, não possuindo, pois, um metabolismo próprio. Para sua reprodução, têm
que invadir células e utilizar os sistemas enzimáticos destas, sendo parasitas intracelulares obrigatórios. Fora das células, não
apresentam característica alguma de ser vivo, comportando-se como seres inanimados. Assim, vírus dependem da célula viva para se
reproduzir. É bom deixar claro que vírus não possuem metabolismo próprio nem dentro da célula hospedeira, uma vez que utiliza o
metabolismo da mesma.

13.
Resposta: C
Comentário: Analisando cada item:
Item A: falso. Não existe qualquer coisa semelhante a uma força vital nos seres vivos que os diferencie de corpos brutos.
Item B: falso. Vírus são seres acelulares.
Item C: verdadeiro. Homeostase é a capacidade que os seres vivos possuem de manter sua organização e composição química
constante e diferente do meio externo.
Item D: falso. Em células, o componente mais abundante é a água, sendo que, dentre os componentes orgânicos, o mais abundante
são as proteínas.

14.
Resposta: B
Comentário: Crescimento e desenvolvimento são processos pelos quais, por exemplo, uma única célula viva, o ovo fertilizado, se
torna um organismo adulto. O desenvolvimento é caracterizado por um aumento de complexidade e envolve processos de divisão e
diferenciação celular.

15.
Resposta: B
Comentário: As moléculas mais características dos seres vivos são as moléculas orgânicas, importantes como fatores estruturais
(proteínas), energéticos (carboidratos e lipídios) e catalíticos (proteínas enzimáticas). Os principais grupos de moléculas orgânicas são
polímeros formados a partir da junção de unidades menores (monômeros) por um processo de síntese por desidratação, como visto no
exemplo abaixo:
aminoácido X + aminoácido Y + aminoácido Z + ... → proteína + água

16.
Resposta: B
Comentário: Vírus são seres acelulares formados basicamente por um capsídeo proteico e material genético na forma de DNA ou
RNA, não apresentando metabolismo próprio e agindo como parasitas intracelulares obrigatórios. Viróides e virusóides são mais
simples que vírus, sendo formados apenas por RNA, sem capsídeo, e também se comportando como parasitas intracelulares
obrigatórios. A diferença é que viróides são transmitidos diretamente de uma célula a outra, afetando apenas vegetais, enquanto que
virusóides são obrigatoriamente transportados na cápsula de vírus (como o vírus da hepatite D, que na verdade é um virusóide
transportado na cápsula do vírus da hepatite B). Príons são proteínas infectantes não associadas a material genético algum, estando
relacionados com a origem da encefalopatia espongiforme bovina ou mal da vaca louca. Pela descrição do texto, a exocorte cítrica é
causada por um viróide: constituído apenas por RNA sem capsídeo e infectante de plantas. Assim, a opção correta é a de letra B.
Observação: O termo Liliopsida pode ser usado como sinônimo de angiospermas monocotiledôneas, e o termo Magnoliopsida pode
ser usado como sinônimo de angiospermas dicotiledôneas. Gyncófitas são um grupo de gimnospermas que inclui o Ginkgo biloba, e
Licopodíneas e Filicíneas são grupos de pteridófitas. A laranja é uma dicotiledônea. O principal hormônio de crescimento vegetal são
as giberelinas, e sua deficiência pode justificar o nanismo da planta na exocorte cítrica.

17.
Resposta: A
Comentário: Príons são proteínas componentes das membranas dos neurônios e não causam problema algum. Entretanto, ao reagir
com príons defeituosos surgidos por mutação ou adquiridos de um outro animal onde a mutação ocorreu, podem passar também a
apresentar defeitos, como um mecanismo de replicação. Os príons causam uma doença chamada de doença de Creutzfeldt-Jakob, mais
conhecida como Encefalopatia Espongiforme Bovina ou doença da vaca louca.

18.
Resposta: C
Comentário: Analisando os itens pela segunda coluna:
- A biosfera (XII) pode ser descrita como o conjunto de todas as regiões da Terra que abrigam vida ou como o conjunto de todos os
ecossistemas da Terra.
- Os ecossistemas (XI) são as unidades básicas no estudo da Ecologia, sendo formados pela interação entre a comunidade biótica
(conjunto de todos os seres vivos de uma região) e o biótopo (conjunto de fatores abióticos de uma região).
- Biocenose ou bioma ou fatores bióticos ou comunidade biótica (X) é o conjunto de todos os seres vivos de uma região, incluindo
todas as espécies.
- População (IX) é o conjunto de seres vivos de uma mesma espécie que habitam uma mesma região.
- Organismo (VIII) é o conjunto de estruturas anátomo-fisiológicas de um indivíduo, incluindo todos os sistemas, órgãos, tecidos,
etc...
- Sistemas (VII) são conjuntos de órgãos relacionados ao desempenho de uma função.
- Órgãos (VI) são conjuntos de tecidos organizados para o desempenho de uma função.
- Tecidos (V) são conjuntos de células especializadas organizadas para o desempenho de uma função.
- Células (IV) são a unidade básica morfofisiológica de todos os seres vivos; vírus, no entanto, são seres acelulares;
- Organelas (III) são componentes celulares especializados no desempenho de uma função.
- Moléculas (II) são estruturas constituídas de átomos e que compõem toda a matéria.
- Átomos (I) são as unidades básicas constituintes das moléculas e de toda a matéria.

19.
Resposta: E
Comentário: Os vírus são acelulares, sendo formados por um capsídeo proteico que envolve um material genético, que pode ser RNA
ou DNA. Eles não possuem sistemas enzimáticos próprios, não possuindo, pois, um metabolismo próprio. Para sua reprodução, têm
que invadir células e utilizar os sistemas enzimáticos destas, sendo parasitas intracelulares obrigatórios. Dentro das células
hospedeiras, apresentam a capacidade de reprodução, de hereditariedade e de adaptação ao meio por mutações. Fora das células, não
apresentam característica alguma de ser vivo, como metabolismo próprio, organização celular ou crescimento.

20.
Resposta: A
Comentário: São características dos seres vivos:
- Composição química diferenciada, com predomínio de moléculas orgânicas e água;
- Organização complexa com estrutura celular;
- Homeostase (capacidade de manter a organização constante);
- Metabolismo (conjunto de reações químicas);
- Irritabilidade (capacidade de reagir a estímulos ambientais);
- Movimento;
- Crescimento e desenvolvimento;
- Reprodução (sexuada, com variabilidade genética, e/ou assexuada, sem variabilidade genética);
- Adaptação ao meio por mutações e seleção natural.
Apesar de essas várias características estarem presentes, é consenso entre a maioria dos estudiosos que a capacidade de reprodução, e
a hereditariedade a ela associada, são as duas características que melhor definem um ser vivo. Por isso, mesmo sendo acelulares, os
vírus são muitas vezes caracterizados como vivos por possuírem reprodução e hereditariedade.

21.
Resposta: B
Comentário: São características dos seres vivos:
- Composição química diferenciada, com predomínio de moléculas orgânicas e água;
- Organização complexa com estrutura celular;
- Homeostase (capacidade de manter a organização constante);
- Metabolismo (conjunto de reações químicas);
- Irritabilidade (capacidade de reagir a estímulos ambientais);
- Movimento;
- Crescimento e desenvolvimento;
- Reprodução (sexuada, com variabilidade genética, e/ou assexuada, sem variabilidade genética);
- Adaptação ao meio por mutações e seleção natural.
Assim, não é característica dos seres vivos a constância genética, uma vez que a maioria dos seres vivos faz reprodução sexuada, e
mesmo aqueles que não fazem estão sujeitos a alterações genéticas proporcionadas por mutações.

22.
Resposta: E
Comentário: Os vírus, como o HIV, são seres acelulares, sendo formados por um capsídeo proteico que envolve um material
genético, que pode ser RNA ou DNA e não possuindo um metabolismo próprio, tendo que invadir células para se reproduzir, ou seja,
sendo parasitas intracelulares obrigatórios. Príons são proteínas componentes das membranas dos neurônios e não causam problema
algum. Entretanto, ao reagir com príons defeituosos surgidos por mutação ou adquiridos de um outro animal onde a mutação ocorreu,
podem passar também a apresentar defeitos, como um mecanismo de replicação. Os príons causam uma doença chamada de doença de
Creutzfeldt-Jakob, mais conhecida como Encefalopatia Espongiforme Bovina ou doença da vaca louca. Assim:
Item A: falso. Apenas os vírus possuem material genético, uma vez que os príons são compostos apenas de proteínas.
Item B: falso. Apenas alguns vírus possuem um envelope lipoproteico externo ao capsídeo.
Item C: falso. Os vírus possuem apenas replicação intracelular, e os príons defeituosos se replicam quando no meio extracelular eles
entram em contato com príons saudáveis na superfície da membrana das células.
Item D: falso. Apenas os príons são causadores de doenças degenerativas do sistema nervoso central, uma vez que o HIV ataca o
sistema imune, causando AIDS.
Item E: verdadeiro. Tanto o vírus HIV da AIDS como os príons do mal da vaca louca são agentes infecciosos transmissíveis.

23.
Resposta: B
Comentário: A reprodução assexuada não apresenta variabilidade genética, gerando uma descendência geneticamente idêntica aos
indivíduos parentais, com as mesmas qualidades, sendo vantajosa em ambientes estáveis. No entanto, se o ambiente mudar, uma
característica a princípio vantajosa pode se mostrar prejudicial, de modo que a reprodução assexuada não é favorável em ambientes
em mudança, pode não permitir a adaptação a mudanças. A reprodução sexuada apresenta variabilidade genética, permitindo à
descendência se adaptar a eventuais mudanças ambientais, sendo vantajosa em ambientes em mudança. Para a agricultura de
subsistência, a reprodução sexuada é mais vantajosa, uma vez algumas das sementes colhidas são normalmente usadas para o cultivo
da próxima safra, sendo as sementes sobreviventes as mais adaptadas àquelas condições (item I falso). Para a agricultura em escala
industrial, a alta produtividade é muito importante, sendo mais vantajoso o uso de mudas produzidas de modo assexuado a partir de
uma matriz de alta produtividade (item II verdadeiro); se necessário, a matriz da próxima safra pode ser outra, para garantir a
adaptação a novas condições, mas sempre utilizando uma matriz de máxima produtividade. Para a recuperação de uma área
degradada, a variabilidade genética é fundamental, de modo que a reprodução sexuada é mais vantajosa (item III falso).

24.
Resposta: C
Comentário: Analisando cada item:
I. Vírus são seres acelulares, ao contrário de bactérias, que são formadas por células.
II. Vírus e bactérias são dotados de material genético, sendo DNA ou RNA nos vírus e DNA nas bactérias; uma vez que o vírus utiliza
a aparelhagem enzimática da célula hospedeira, que obedece ao mesmo código genético universal de todos os seres vivos.
III. Vírus e bactérias podem se adaptar ao meio por mutações e seleção natural.
Assim, vírus preenchem os requisitos II e III, mas não o I, enquanto que bactérias preenchem os três requisitos.

25.
Resposta: C
Comentário: Os vírus são acelulares, sendo formados por um capsídeo protéico que envolve um material genético, que pode ser RNA
ou DNA. Eles não possuem sistemas enzimáticos próprios, não possuindo, pois, um metabolismo próprio. Para sua reprodução, têm
que invadir células e utilizar os sistemas enzimáticos destas, sendo parasitas intracelulares obrigatórios. Fora das células, não
apresentam característica alguma de ser vivo, comportando-se como seres inanimados. Os vírus utilizam o mesmo código genético
universal das células, o que os aproxima evolutivamente dos seres vivos em geral.

26.
Resposta: E
Comentário: A substância mais abundante na matéria viva é a água, sendo formada pelos elementos hidrogênio e oxigênio. Além da
água, substâncias orgânicas são abundantes na composição da matéria viva, sendo formadas basicamente por elementos como
carbono, hidrogênio e oxigênio, além de nitrogênio, fósforo e enxofre. Assim, os elementos que os animais devem ingerir em maior
quantidade são exatamente hidrogênio, oxigênio e carbono (obtidos na água e nas moléculas orgânicas consumidas).

27.
Resposta: B
Comentário: Os termos extraídos do texto se referem aos seguintes níveis de organização dos seres vivos:
- núcleo: organela celular que o abriga o material genético em células eucarióticas;
- melanina: molécula derivada do aminoácido tirosina que dá cor à pele humana;
- pele: órgão que reveste o corpo humano, sendo formando por dois tecidos, a epiderme mais externa e a derme mais interna;
- corpo: organismo, ou seja, o conjunto de todos os sistemas, e consequentemente de todos os órgãos do indivíduo.

28.
Resposta: A
Comentário: Os seres vivos são capazes de reagir a estímulos do meio ambiente através de processos como movimento, num
processo denominado irritabilidade, ou simplesmente reação.

29.
Resposta: A
Comentário: Analisando cada item:
Item I: falso. Não são os compostos orgânicos, e sim a água a substância química mais abundante dos seres vivos, sendo o hidrogênio
o elemento químico mais abundante no organismo.
Item II: verdadeiro. Um ecossistema é caracterizado pela interação entre os seres vivos (comunidade biótica) e o meio ambiente
físico (biótopo) onde vivem.
Item III: falso. Os gametas são formados por meiose, que origina células geneticamente distintas da original.

30.
Resposta: A
Comentário: Os seguintes trechos extraídos do texto se referem a algumas propriedades dos seres vivos:
- “a presença de uma variedade de reações químicas” se refere ao metabolismo, conjunto de todas as reações químicas que ocorrem
num ser vivo;
- “deslocar- se no ambiente, responder a estímulos provindos dele” se refere ao movimento e à reatividade (irritabilidade) do
organismo vivo;
- “aumentarem o tamanho dos seus corpos” se refere ao crescimento;
- “podem produzir outras idênticas ou muito similares a si próprias” se refere à reprodução.

31.
Resposta: D
Comentário: Na reprodução assexuada, os organismos criam cópias idênticas a si (clones), não havendo variabilidade genética. A
vantagem desse processo reprodutivo está no fato de os descendentes guardarem as mesmas qualidades dos genitores (matrizes), além
de não necessitar de parceiros para a reprodução e muitas vezes ser rápida e capaz de gerar grande quantidade de descendentes. Por
outro lado, a desvantagem desse processo está no fato de os descendentes guardarem também as mesmas qualidades negativas dos
genitores. Para ambientes estáveis, a reprodução assexuada se mostra positiva, uma vez que as matrizes (e consequentemente seus
descendentes) já devem estar bem adaptadas ao meio. Para ambientes em mudança, a reprodução assexuada se mostra problemática,
pois as matrizes (e seus descendentes) provavelmente estavam bem adaptadas ao meio antes da mudança, mas não estarão tão bem
adaptados ao ambiente mudado. Na reprodução sexuada, os organismos criam geram descendentes com ligeiras diferenças em relação
ao organismo parental, havendo variabilidade genética. Esta variabilidade é a base para a adaptação dos seres a novos ambientes, uma
vez que a variabilidade pode gerar descendentes adaptados às novas características ambientais. Assim, como no ambiente II, há
presença de insetos e a temperatura e a umidade são instáveis, a reprodução sexuada é mais interessante, pois esta gera sempre uma
variedade de indivíduos que podem se adaptar novas condições.

32.
Resposta: C
Comentário: As moléculas mais características dos seres vivos são as moléculas orgânicas, importantes como fatores estruturais
(proteínas), energéticos (carboidratos e lipídios), catalíticos (proteínas enzimáticas) e informacionais (ácidos nucléicos, que
correspondem ao material genético, e proteínas e lipídios, que podem ter ação hormonal).

33.
Resposta: B
Comentário: A entrada de peixes de outra procedência nos viveiros de cultivo permitiria um aumento da variabilidade genética da
população do viveiro por mecanismos de recombinação gênica relacionados à reprodução sexuada. O aumento da variabilidade
genética aumenta a resistência genética da população contra patógenos. Ao impedir essa entrada, o criador leva a uma diminuição na
variabilidade genética da população, com conseqüente diminuição na ocorrência de peixes resistentes no viveiro.

34.
Resposta: E
Comentário: No caso da matéria viva, apenas seis elementos químicos apenas correspondem a cerca de 99% de todos os átomos
presentes nos seres vivos (sendo eles carbono, hidrogênio, oxigênio, nitrogênio, fósforo e enxofre, o famosíssimo “CHONPS” da
química orgânica), de modo que o gráfico 2 representa essa situação. O gráfico 1 representa a composição da Terra, onde oxigênio,
silício e alumínio estão entre os principais componentes.
Os níveis de organização na natureza viva, em escala crescente, são: átomos – moléculas – células – tecidos – órgãos – sistemas –
organismos – populações – comunidades – ecossistemas – Biosfera.

35.
Resposta: FFFVF
Comentário:
1º item: falso. No experimento descrito, a vida foi observada com a reprodução celular, o que é consistente com a teoria vigente da
Biogênese, ou seja, um organismo vivo somente pode ser gerado a partir de outro.
2º item: falso. A “Teoria Celular” afirma que para ser considerado um ser vivo, este deve ser formado por, no mínimo, uma célula.
Assim, a bactéria artificial preenche este requisito.
3º item: falso. Apesar da célula recipiente do genoma sintético não ter sido construída artificialmente, as células descendentes se
originaram devido à informação genética artificial.
4º item: verdadeiro. As características descritas são típicas dos seres vivos e devem estar presentes na bactéria gerada artificialmente.
5º item: falso. O criacionismo atribui o surgimento da vida a causas sobrenaturais ou religiosas, o que não é o caso no experimento
descrito.

36.
Resposta:
A) Se possui uracila, é porque o material genético é RNA, e somente vírus possuem RNA como material genético.
B) São acelulares e não têm metabolismo próprio.
C) ATGGGCAATTTC.

37.
Resposta: Por produzir maior variabilidade de indivíduos, a reprodução sexuada leva a maiores chances de surgimento de novas
características resistentes ao parasitismo. Por produzir muitos indivíduos rapidamente, a reprodução assexuada é vantajosa em
condições sem parasitas, nas quais o número de indivíduos é mais importante do que a variabilidade.

38.
Resposta:
A)
1) diminuirá, uma vez que o número de indivíduos para trocar genes é pequeno (ou seja, há uma pequena amostragem de genes nas
populações inicialmente isoladas).
2) os de reprodução sexuada, uma vez que os de reprodução assexuada já não apresentavam variabilidade genética em sua reprodução.
B) sim, uma vez que nela ocorrem eventos como o crossing-over e a separação dos cromossomos homólogos.

39.
Resposta:
A) A população da área B, formada por clones de uma planta produtiva, apresentou uma população com indivíduos geneticamente
idênticos, todos produtivos, mas com pouca ou nenhuma capacidade de adaptação às adversidades.
B) O milho propagado sexuadamente (através de sementes) enfrentou melhor as alterações ambientais por apresentar uma maior
variabilidade genética na população da área A, embora nem todas as plantas fossem tão produtivas quanto a planta matriz.

40.
Resposta: Amostra 1, pois não é afetada pela radiação, demonstrando que não possui material genético para sofrer mutação, que é o
que ocorre com príons.
1.
Resposta: A
Comentário: Pela análise dos dados da tabela, nota-se que os norte-americanos apresentam maior porcentagem de respostas certas
(51,0 %) sobre a ação dos antibióticos do que brasileiros (41,8 %) e europeus (39,7%).

2.
Resposta: B
Comentário: Analisando as relações entre os órgãos:
- Se, removendo X, os órgãos Y e Z, deixam de funcionar, pode-se afirmar que Y e Z dependem de X.
- Se, removendo Y, e deixando X e Z intactos, Z deixa de funcionar, pode-se afirmar que Z depende de Y, mas X na depende de Y.
- Se, removendo Z, não são afetados X nem Y, pode-se afirmar que nem X nem Y dependem de Z.
Assim, pode-se afirmar que a relação é X estimula Y que estimula Z.

3.
Resposta: C
Comentário: Para um experimento ser válido dentro do método científico, deve obedecer aos seguintes requisitos:
1) O experimento deve ter reprodutibilidade, ou seja, ele deve poder ser repetido quantas vezes forem necessárias, sendo que seu
resultado deve ser sempre o mesmo.
2) O experimento deve ser controlado, isto é, ele deve analisar uma única variável de cada vez. Isto impede que explicações
alternativas sejam dadas a um fenômeno, garantindo uma única explicação plausível para o fenômeno. O experimento controlado deve
contar com um grupo-controle e um grupo-teste. O grupo-controle é aquele em que não se faz intervenção alguma, isto é, não se
realiza o experimento, servindo para comparação. O grupo-teste é aquele em que se realiza o experimento. Todos os aspectos devem
ser idênticos no grupo-teste e no grupo-controle, com exceção de um, que é exatamente a variável a ser estudada.
3) Em ocasiões em que não é possível isolar uma única variável, o experimento deve ter amostragem, isto é contar com o maior
número possível de repetições, para garantir que variações individuais ou momentâneas nos grupos utilizados na pesquisa não
influenciem nos resultados da mesma.
Assim, para testar a afirmativa do astrólogo de que certos signos têm mais chances de apresentar problemas no fígado do que outros,
deve-se realizar um experimento controlado. Como não é possível isolar uma única variável, uma vez que dentro de um signo há
vários indivíduos com diferentes características genéticas e modos de vida, deve-se ter uma grande amostragem, ou seja, verificar se
em grande número de pessoas há mais pessoas com problemas no fígado nos signos indicados do que nos outros.

4.
Resposta: E
Comentário: O método científico envolve uma sequência de etapas descritas a seguir:
1) Observação de um fato ou fenômeno, ou seja, verdade confirmada por simples observação;
2) Questionamento;
3) Elaboração de uma hipótese, ou seja, a proposição que se dispõe a provar;
4) Dedução, ou seja, previsão das conseqüências da hipótese.
5) Experimentação, ou seja, teste da hipótese;
6) Análise dos resultados.
Assim, os seguintes trechos do texto se referem aos termos descritos em seguida.
“(I) Curiosos sobre por que as moscas foram atraídas à urina, analisaram-na e observaram que esta apresentava excesso de açúcar.” se
refere a uma observação;
“(II) Açúcar na urina é um sinal comum de diabetes.” é um fato;
“(III) O fato de tal animal não ter pâncreas sugeriu a relação entre esse órgão e o diabetes.” é uma hipótese;
“(IV) Quando injetaram os extratos [secreção do pâncreas] nos cães tornados diabéticos pela remoção de seus pâncreas o nível de
açúcar no sangue desses cães voltava ao normal, e a urina não apresentava mais açúcar.” descreve um experimento (ou seja, teste da
hipótese).

5.
Resposta: D
Comentário: O método hipotético-dedutivo pode ser resumido nas seguintes etapas:
1) Observação de um fenômeno;
2) Questionamento;
3) Coleta de dados;
4) Elaboração de uma hipótese (proposição a ser testada);
5) Dedução (previsão das conseqüências da hipótese);
6) Teste da hipótese através de experimentação;
7) Análise dos resultados:
- Se a hipótese for falsa, deve-se elaborar uma nova hipótese;
- Se a hipótese for verdadeira, passa a ser verdade científica.
Hipótese é uma tentativa de explicação para um fenômeno isolado, devendo ser testada para a verificação de sua validade, enquanto
que teoria é um conjunto de conhecimentos mais amplos, que procuram explicar fenômenos abrangentes na natureza, sendo que a
teoria já foi testada e confirmada. Uma vez confirmada a hipótese, ela permite antecipar as consequências dos fenômenos por ela
descritos, como a relação entre duas ou mais variáveis.

6.
Resposta: B
Comentário: O método hipotético-dedutivo pode ser resumido nas seguintes etapas:
1) Observação de um fenômeno;
2) Questionamento;
3) Coleta de dados;
4) Elaboração de uma hipótese (proposição a ser testada);
5) Dedução (previsão das conseqüências da hipótese);
6) Teste da hipótese através de experimentação;
7) Análise dos resultados:
- Se a hipótese for falsa, deve-se elaborar uma nova hipótese;
- Se a hipótese for verdadeira, passa a ser verdade científica.
Hipótese é uma tentativa de explicação para um fenômeno isolado, devendo ser testada para a verificação de sua validade, enquanto
que teoria é um conjunto de conhecimentos mais amplos, que procuram explicar fenômenos abrangentes na natureza, sendo que a
teoria já foi testada e confirmada.
Assim:
Item A: verdadeiro. Uma hipótese confirmada passa a constituir uma teoria. Como a teoria implica numa explicação, pode ser
alterada ou aperfeiçoada, não constituindo uma verdade absoluta.
Item B: falso. Após a dedução (previsão das conseqüências da hipótese), experimentações são necessárias para verificar a validade da
hipótese.
Item C: verdadeiro. A ciência é dinâmica, com novos conhecimentos sendo constantemente incorporados, inclusive com abandono e
substituição de ideias aceitas anteriormente.
Item D: verdadeiro. Para a elaboração de uma hipótese, a coleta de dados prévia é essencial, assim como o posterior
desenvolvimento de deduções que orientam o teste da hipótese.

7.
Resposta: A
Comentário: O método hipotético-dedutivo pode ser resumido nas seguintes etapas:
1) Observação de um fenômeno;
2) Questionamento;
3) Coleta de dados;
4) Elaboração de uma hipótese (proposição a ser testada);
5) Dedução (previsão das conseqüências da hipótese);
6) Teste da hipótese através de experimentação;
7) Análise dos resultados:
- Se a hipótese for falsa, deve-se elaborar uma nova hipótese;
- Se a hipótese for verdadeira, passa a ser verdade científica.
O experimento deve ser controlado, isto é, ele deve analisar uma única variável de cada vez. Isto impede que explicações alternativas
sejam dadas a um fenômeno, garantindo uma única explicação plausível para o fenômeno. O experimento controlado deve contar com
um grupo-controle e um grupo-teste. O grupo-controle é aquele em que não se faz intervenção alguma, isto é, não se realiza o
experimento, servindo para comparação. O grupo-teste é aquele em que se realiza o experimento. Todos os aspectos devem ser
idênticos no grupo-teste e no grupo-controle, com exceção de um, que é exatamente a variável a ser estudada.
Fazendo a relação:
- IV representa o fato de que moscas costumam rodear frutos;
- I representa a hipótese de que as moscas, ao pousarem sobre os frutos, dão origem a larvas em seu interior;
- V representa a dedução de que, se as moscas não pousarem sobre os frutos, como devido à presença de um saco plástico, não
ocorrerão larvas em seu interior;
- II representa o experimento, em que alguns frutos são cobertos com sacos plásticos (grupo-teste) e outros não (grupo-controle);
- III representa a conclusão do experimento, onde os frutos cobertos com sacos plásticos não apresentaram larvas e os não cobertos
apresentaram as mesmas.

8.
Resposta: E
Comentário: Para que um experimento seja considerado válido dentro dos princípios do método científico, deve apresentar um grupo-
teste e um grupo-controle com uma única variável a ser comparada. Assim, para testar a hipótese de que a deficiência de sais de
magnésio leva à cor amarela das folhas, deve-se ter dois conjuntos de plantas mantidas em condições idênticas, sendo um dos
conjuntos (grupo-teste) privado de sais de magnésio. Se as folhas do grupo-teste ficarem amarelas, a hipótese será verdadeira.

9.
Resposta: D
Comentário: Hipótese é uma tentativa de explicação para um fenômeno isolado, devendo ser testada para a verificação de sua
validade, enquanto que teoria é um conjunto de conhecimentos mais amplos, que procuram explicar fenômenos abrangentes na
natureza, sendo que a teoria já foi testada e confirmada.
Item A: falso. A lei é uma generalização para um fenômeno. Já a teoria é o modo de explicar o fenômeno descrito pela lei.
Item B: falso. Apesar de ter embasamento científico, a hipótese é um "palpite", uma explicação a ser confirmada. Já a teoria é uma
explicação cuja validade já foi confirmada pelo método hipotético-dedutivo.
Item C: falso. A teoria tem embasamento científico, ao contrário do senso comum.
Item D: verdadeiro.
Item E: falso. Uma vez que a lei é um fenômeno, não pode ser mudada. Já a teoria é uma explicação, podendo ser mudada quando
novas descobertas são feitas, para melhor explicar o fenômeno. Uma lei é imutável. Já uma teoria é passível a mudanças.

10.
Resposta: D
Comentário: O método hipotético-dedutivo pode ser resumido nas seguintes etapas:
1) Observação de um fenômeno;
2) Questionamento;
3) Coleta de dados;
4) Elaboração de uma hipótese (proposição a ser testada);
5) Dedução (previsão das conseqüências da hipótese);
6) Teste da hipótese através de experimentação;
7) Análise dos resultados:
- Se a hipótese for falsa, deve-se elaborar uma nova hipótese;
- Se a hipótese for verdadeira, passa a ser verdade científica.
Hipótese é uma tentativa de explicação para um fenômeno isolado, devendo ser testada para a verificação de sua validade, enquanto
que teoria é um conjunto de conhecimentos mais amplos, que procuram explicar fenômenos abrangentes na natureza, sendo que a
teoria já foi testada e confirmada.
Lei é a verificação de que determinado fenômeno natural sempre ocorre, ou ainda, um fenômeno que sempre se repete em dadas
condições. A lei é uma generalização para um fenômeno. Já a teoria é o modo de explicar o fenômeno descrito pela lei. Uma lei é
imutável. Já uma teoria é passível a mudanças.
Toda e qualquer proposição científica dentro do método científico deve ser testada por experimentos para que seja admitida como
verdadeira.

11.
Resposta: D
Comentário: O método hipotético-dedutivo pode ser resumido nas seguintes etapas:
1) Observação de um fenômeno;
2) Questionamento;
3) Coleta de dados;
4) Elaboração de uma hipótese (proposição a ser testada);
5) Dedução (previsão das conseqüências da hipótese);
6) Teste da hipótese através de experimentação;
7) Análise dos resultados:
- Se a hipótese for falsa, deve-se elaborar uma nova hipótese;
- Se a hipótese for verdadeira, passa a ser verdade científica.
Hipótese é uma tentativa de explicação para um fenômeno isolado, devendo ser testada para a verificação de sua validade, enquanto
que teoria é um conjunto de conhecimentos mais amplos, que procuram explicar fenômenos abrangentes na natureza, sendo que a
teoria já foi testada e confirmada.
Lei é a verificação de que determinado fenômeno natural sempre ocorre, ou ainda, um fenômeno que sempre se repete em dadas
condições. A lei é uma generalização para um fenômeno. Já a teoria é o modo de explicar o fenômeno descrito pela lei. Uma lei é
imutável. Já uma teoria é passível a mudanças.
O método indutivo é aquele que parte de questões particulares até chegar a conclusões generalizadas. Este método está cada vez mais
sendo abandonado, por não permitir ao autor uma maior possibilidade de criar novas leis, novas teorias. Próprio das ciências naturais
também aparece na Matemática através da Estatística. Utilizando como exemplo a enumeração, trata-se de um raciocínio indutivo
baseado na contagem.
A proposição levantada no texto de que “todos os objetos cilíndricos queimam” deve passar por testes experimentais, se constituindo
em uma hipótese; como ela foi levantada partindo de uma situação particular (“galhos, cabos, mastros e lápis”) para uma situação
geral (“todos os objetos cilíndricos”), pode-se afirmar que a proposição se baseia no raciocínio indutivo.

12.
Resposta: D
Comentário: O método hipotético-dedutivo pode ser resumido nas seguintes etapas:
1) Observação de um fenômeno;
2) Questionamento;
3) Coleta de dados;
4) Elaboração de uma hipótese (proposição a ser testada);
5) Dedução (previsão das conseqüências da hipótese);
6) Teste da hipótese através de experimentação;
7) Análise dos resultados:
- Se a hipótese for falsa, deve-se elaborar uma nova hipótese;
- Se a hipótese for verdadeira, passa a ser verdade científica.
Hipótese é uma tentativa de explicação para um fenômeno isolado, devendo ser testada para a verificação de sua validade, enquanto
que teoria é um conjunto de conhecimentos mais amplos, que procuram explicar fenômenos abrangentes na natureza, sendo que a
teoria já foi testada e confirmada.
Lei é a verificação de que determinado fenômeno natural sempre ocorre, ou ainda, um fenômeno que sempre se repete em dadas
condições. A lei é uma generalização para um fenômeno. Já a teoria é o modo de explicar o fenômeno descrito pela lei. Uma lei é
imutável. Já uma teoria é passível a mudanças.
Modelo científico é uma idealização simplificada de um sistema que possui maior complexidade, mas que ainda assim supostamente
reproduz na sua essência o comportamento do sistema complexo que é o alvo de estudo e entendimento. Dessa forma, também pode
ser definido como o resultado do processo de produzir uma representação abstrata, conceitual, gráfica ou visual, de fenômenos,
sistemas ou processos com o propósito de analisar, descrever, explicar, simular - em geral, explorar, controlar e predizer estes
fenômenos ou processos. Considera-se que a criação de um modelo é uma parte essencial de qualquer atividade científica.
Uma vez que a tabela periódica de Mendeleiev representava elementos químicos, mas apresentava lacunas reservadas para elementos
químicos não descobertos, o químico Berlikov, com sua pergunta “Pode a natureza ter espaços em branco?” questionou a ausência de
observação experimental dos elementos químicos correspondentes às lacunas da tabela.

13.
Resposta: D
Comentário: O método hipotético-dedutivo pode ser resumido nas seguintes etapas:
1) Observação de um fenômeno;
2) Questionamento;
3) Coleta de dados;
4) Elaboração de uma hipótese (proposição a ser testada);
5) Dedução (previsão das conseqüências da hipótese);
6) Teste da hipótese através de experimentação;
7) Análise dos resultados:
- Se a hipótese for falsa, deve-se elaborar uma nova hipótese;
- Se a hipótese for verdadeira, passa a ser verdade científica.
O experimento deve ser controlado, isto é, ele deve analisar uma única variável de cada vez. Isto impede que explicações alternativas
sejam dadas a um fenômeno, garantindo uma única explicação plausível para o fenômeno. O experimento controlado deve contar com
um grupo-controle e um grupo-teste. O grupo-controle é aquele em que não se faz intervenção alguma, isto é, não se realiza o
experimento, servindo para comparação. O grupo-teste é aquele em que se realiza o experimento. Todos os aspectos devem ser
idênticos no grupo-teste e no grupo-controle, com exceção de um, que é exatamente a variável a ser estudada.
Hipótese é uma tentativa de explicação para um fenômeno isolado, devendo ser testada para a verificação de sua validade, enquanto
que teoria é um conjunto de conhecimentos mais amplos, que procuram explicar fenômenos abrangentes na natureza, sendo que a
teoria já foi testada e confirmada.
Lei é a verificação de que determinado fenômeno natural sempre ocorre, ou ainda, um fenômeno que sempre se repete em dadas
condições. A lei é uma generalização para um fenômeno. Já a teoria é o modo de explicar o fenômeno descrito pela lei. Uma lei é
imutável. Já uma teoria é passível a mudanças.
Modelo científico é uma idealização simplificada de um sistema que possui maior complexidade, mas que ainda assim supostamente
reproduz na sua essência o comportamento do sistema complexo que é o alvo de estudo e entendimento. Dessa forma, também pode
ser definido como o resultado do processo de produzir uma representação abstrata, conceitual, gráfica ou visual, de fenômenos,
sistemas ou processos com o propósito de analisar, descrever, explicar, simular - em geral, explorar, controlar e predizer estes
fenômenos ou processos. Considera-se que a criação de um modelo é uma parte essencial de qualquer atividade científica.
Como a afirmação de Galileu foi feita antes mesmo de realizar seu experimento, tratava-se de uma proposição a ser testada, ou seja,
uma hipótese.
14.
Resposta: D
Comentário: Hipótese é uma proposição que se propõe a provar. Uma hipótese é proposta com base em observações (item 1
verdadeiro) e testada por experimentos baseados na predição das consequências da hipótese (item 2 verdadeiro). O experimento de
Fleming levou à conclusão de que a hipótese de os fungos produzem substâncias que inibem o crescimento das bactérias é verdadeira,
mas não permitiu identificar o mecanismo de ação dessas substâncias (item 3 falso).

15.
Resposta: A
Comentário: O método hipotético-dedutivo pode ser resumido nas seguintes etapas:
1) Observação de um fenômeno;
2) Questionamento;
3) Coleta de dados;
4) Elaboração de uma hipótese (proposição a ser testada);
5) Dedução (previsão das conseqüências da hipótese);
6) Teste da hipótese através de experimentação;
7) Análise dos resultados:
- Se a hipótese for falsa, deve-se elaborar uma nova hipótese;
- Se a hipótese for verdadeira, passa a ser verdade científica.
Hipótese é uma tentativa de explicação para um fenômeno isolado, devendo ser testada para a verificação de sua validade, enquanto
que teoria é um conjunto de conhecimentos mais amplos, que procuram explicar fenômenos abrangentes na natureza, sendo que a
teoria já foi testada e confirmada.
Lei é a verificação de que determinado fenômeno natural sempre ocorre, ou ainda, um fenômeno que sempre se repete em dadas
condições. A lei é uma generalização para um fenômeno. Já a teoria é o modo de explicar o fenômeno descrito pela lei. Uma lei é
imutável. Já uma teoria é passível a mudanças.
Como a idéia de o arsênio poder substituir o fósforo ainda tem que ser confirmada, deve ser considerada uma hipótese.

16.
Resposta: FVVFV = 22
Comentário:
Item 1: falso. A Ciência não pode ser considerada aleatória (uma vez que exige comprovações experimentais para suas explicações)
nem estática (uma vez que novos conhecimentos podem levar à elaboração e explicações mais adequadas para um certo fenômeno).
Item 2: verdadeiro. A hipótese é a proposição que se deseja confirmar com a experimentação, e a deduções são previsões das
conseqüências da hipótese.
Item 4: verdadeiro. Para serem válidos dentro do método científico, experimentos devem analisar uma única variável, devendo ser
dotados de grupos-controle e teste.
Item 8: falso. A população em geral e seu conhecimento, conhecido como senso comum, não podem ter interferência nos resultados
dos experimentos, que são regidos apenas pela experimentação, não importando o que o senso comum afirme.
Item 16: verdadeiro. Os resultados dos experimentos devem ser analisados apenas pelas evidências científicas apresentadas.

17.
Resposta:
A) Nos aquários I e III as piranhas devoram as presas. No aquário II as presas não serão devoradas.
B) Nos aquários I e II as piranhas devoram as presas. No aquário III as presas não serão devoradas.
C) Conclui-se que o olfato é o principal sentido da piranha.

18.
Resposta:
A) sim, pois o experimento é reproduzível e controlado, uma vez que apresenta um grupo-controle (bactérias não irradiadas) e um
grupo-teste (bactérias irradiadas).
B) Se bactérias forem submetidas a radiação ultravioleta então elas irão morrer (ou qualquer coisa parecida que você queira escrever).

19.
Resposta: Os experimentos corroboram a hipótese testada. Podemos observar que as conclusões elaboradas a partir da hipótese
correspondem exatamente ao resultado dos experimentos. No resultado que as bactérias que cresciam no meio com nitrogênio
insuficiente para liberação de nitratos não crescem com tanta eficácia. Isso pode ser interpretado como a falta para as bactérias de
nutrientes fornecidos pela planta, uma vez que, sem o fornecimento de nitrogênio das bactérias para a planta, não há fornecimento de
nutrientes da planta para as bactérias.

20.
Resposta: O DDE diminui o número de receptores para testosterona, apesar de não alterar a produção de testosterona.
1.
Resposta: A
Comentário: A grande quantidade de sal na carne a torna hipertônica em relação às bactérias decompositoras, que desidratam por
osmose e morrem. Com a morte dessas bactérias, a carne não se decompõe e é conservada mesmo que não haja refrigeração.

2.
Resposta: B
Comentário: A água possui propriedades como
- participação em reações químicas, como síntese por desidratação intermolecular, hidrólise, respiração aeróbica e fotossíntese (itens
A e E);
- grande capacidade de dissolução, devido à grande adesão a substâncias polares, resultante de interações como pontes de hidrogênio e
interações dipolo-dipolo; assim, a maior parte dos componentes celulares encontra-se dissolvida na água, que possibilita o transporte
de substâncias (itens C e D);
- alta tensão superficial, resultante da grande coesão das moléculas de água, ou seja, atração entre moléculas idênticas (no caso, a
própria água);
- alto calor específico, que implica na capacidade de absorver muito calor e mudar pouco de temperatura, agindo então como
regulador térmico (item B).
Todos os itens descrevem adequadamente a importância da água para os seres vivos. O alto calor latente de vaporização na água
implica na necessidade de grande quantidade de energia para que passe do estado líquido para o gasoso, o que torna essa mudança de
estado físico difícil de ocorrer em condições ambientais normais. Desse modo, o alto calor latente de vaporização impede que a água
dos seres vivos mude de estado físico com pequenas variações de temperatura, de modo que ela contribui para a manutenção da
temperatura corporal nos seres vivos.

3.
Resposta: D
Comentário: Analisando cada item:
Item I: verdadeiro. A água é solvente universal para substâncias polares, agindo como meio para transporte de substâncias (como em
sangue e seiva) e para reações metabólicas (de modo que todo o metabolismo ocorre em meio aquoso).
Item II: verdadeiro. A diminuição no volume de solvente acarreta aumento na concentração de sais, o que, no meio extracelular,
torna o ambiente hipertônico em relação ao meio intracelular; assim, por osmose, ocorre deslocamento de água para o meio
extracelular, provocando redução do volume de água no meio intracelular.
Item III: falso. Macromoléculas como proteínas e polissacarídeos, devido à grande massa molecular, são insolúveis; pra manter o
balanço hídrico, deve-se ingerir uma quantidade de água igual à que se perde diariamente.
Item IV: verdadeiro. Excretas são eliminadas principalmente pela urina, através dos rins, dissolvidas em água. A eliminação de água
pela urina, a partir do sangue, leva a uma diminuição da pressão arterial.

4.
Resposta: B
Comentário: A glândula tireóide é a principal responsável pelo metabolismo do iodo no corpo humano. Esse elemento mineral se
associa ao aminoácido tirosina, formando os hormônios tireoidianos, como a tiroxina.

5.
Resposta: A
Comentário: O ferro em humanos é adquirido na dieta em fontes como fígado (que possui a proteína ferritina como reserva desse
mineral), carnes vermelhas (que possuem proteínas como mioglobina e hemoglobina, ambas apresentando ferro em sua composição),
gemas de ovos, leguminosas como o feijão e verduras como o espinafre.

6.
Resposta: E
Comentário: A clorofila é um lipídio carotenóide associado ao magnésio, elemento mineral que lhe dá cor verde e que é fundamental
na captação da energia luminosa do sol no mecanismo de fotossíntese.

7.
Resposta: D
Comentário: A grande quantidade de sal na carne a torna hipertônica em relação às bactérias decompositoras, que desidratam por
osmose e morrem. Com a morte dessas bactérias, a carne não se decompõe e é conservada mesmo que não haja refrigeração.

8.
Resposta: E
Comentário: O sal torna o sangue hipertônico em relação aos tecidos circundantes, atraindo água por osmose. Assim, os tecidos
desidratam, o que pode ser fatal em relação a regiões como o tecido nervoso. Também ocorre aumento da volemia, que leva a uma
elevação na pressão arterial. A morte do náufrago, se ocorrer, deve se dar pela desidratação, que ocorre antes que o aumento da
pressão arterial atinja níveis prejudiciais.

9.
Resposta: C
Comentário: A grande capacidade de dissolução da água se dá pela grande capacidade de adesão a substâncias polares, resultante de
interações como pontes de hidrogênio e interações dipolo-dipolo. As pontes de hidrogênio são interações moleculares de natureza
físico-química, fracas quando comparadas a ligações químicas. Estas pontes ligam um átomo de hidrogênio (mais positivo) ao
oxigênio (mais negativo) de uma outra molécula. Apesar de fracas e de curta duração, como elas se formam em quantidades enormes,
acabam sendo uma força de grande importância. As interações dipolo-dipolo implicam na atração do pólo positivo da molécula de
água (átomos de hidrogênio) por regiões negativas de moléculas ou íons, e na atração do pólo negativo da molécula de água (átomo de
oxigênio) por regiões positivas de moléculas ou íons.

10.
Resposta: C
Comentário: Tecidos de um mesmo organismo variam os teores de água de acordo com um menor ou maior metabolismo. Quanto
maior o metabolismo tecidual, maior o teor percentual de água, uma vez que a água é o meio para o metabolismo. Assim, em animais,
músculos têm maior atividade metabólica que ossos, possuindo maior teor de água, bem como, em plantas, folhas têm maior atividade
metabólica que sementes, possuindo então maior teor de água.

11.
Resposta: B
Comentário: Analisando cada item:
Item I: verdadeiro. A água apresenta uma alta tensão superficial, resultante da grande coesão das moléculas de água, ou seja, atração
entre moléculas idênticas (no caso, a própria água). Esta forte atração se dá por interações como pontes de hidrogênio e interações
dipolo-dipolo.
Item II: falso. A água tem um alto calor específico, o que também é justificado pela formação de pontes de hidrogênio. Assim, a água
tem capacidade de absorver muito calor e mudar pouco de temperatura, tem origem na dificuldade quebrar as pontes de hidrogênio
para que as moléculas de água aumentem de energia cinética e de temperatura.
Item III: verdadeiro. A água tem peso específico maior que o do ar.

12.
Resposta: D
Comentário: Os íons de cálcio são importantes cofatores enzimáticos em processos como coagulação sangüínea e contração
muscular.

13.
Resposta: B
Comentário: Os íons de cálcio são importantes cofatores enzimáticos em processos como coagulação sangüínea e contração
muscular.

14.
Resposta: E
Comentário: O fósforo, na forma de fosfato, é importante constituinte estrutural de ossos e dentes (na forma de fosfato de cálcio e de
magnésio), além de participar de membranas celulares na composição de fosfolipídios e da formação de nucleotídeos no DNA, RNA e
ATP (tipo de nucleotídeo que age em processos de transferência de energia). Assim, dos elementos citados, DNA e RNA possuem
fósforo na composição.

15.
Resposta: D
Comentário: A água possui propriedades como
- participação em reações químicas, como síntese por desidratação intermolecular, hidrólise, respiração aeróbica e fotossíntese (item B
correto);
- grande capacidade de dissolução, devido à grande adesão a substâncias polares, resultante de interações como pontes de hidrogênio e
interações dipolo-dipolo; assim, a maior parte dos componentes celulares encontra-se dissolvida na água, que possibilita o transporte
de substâncias (itens A e C corretos);
- alta tensão superficial, resultante da grande coesão das moléculas de água, ou seja, atração entre moléculas idênticas (no caso, a
própria água);
- alto calor específico, que implica na capacidade de absorver muito calor e mudar pouco de temperatura, agindo então como
regulador térmico.
Das propriedades citadas, a habilidade de catalisar reações químicas não é encontrada na água, que pode ser reagente ou produto. As
principais moléculas biológicas que agem como catalisadores são as proteínas do grupo das enzimas.

16.
Resposta: A
Comentário: Analisando a 2ª coluna:
(2) O sódio, juntamente com o potássio e o cloreto, regula o teor de água nos compartimentos biológicos através do fenômeno de
osmose. Particularmente nas células animais, o mecanismo da bomba de sódio e potássio torna esse mecanismo de regulação do
equilíbrio osmótico particularmente eficiente.
(3) Os íons de cálcio são cofatores necessários à coagulação sanguínea, agindo juntamente aos fatores de coagulação, que são as
proteínas responsáveis por promover a cascata de reações químicas que culmina com a formação do coágulo para interromper
sangramentos após lesões nas paredes dos vasos.
(4) O fósforo é um elemento químico que integra a molécula de ATP (adenosina-trifosfato), que corresponde à moeda energética
universal nos sistemas biológicos, proporcionando a transferência de energia entre as reações que liberam energia e as que consomem
energia.
(1) O ferro integra uma série de proteínas, como a hemoglobina das hemácias, a mioglobina dos músculos e os citocromos que agem
no transporte de elétrons tanto na respiração aeróbica como na fotossíntese.
(5) O potássio, juntamente com o sódio, está relacionado ao mecanismo da bomba de sódio e potássio, que além de agir na regulação
osmótica, gera o potencial de membrana que é a base para a condução do impulso nervoso nos neurônios e nas fibras musculares,
tendo, consequentemente, importante papel na contração muscular.

17.
Resposta: B
Comentário: Analisando cada item:
Item A: falso. A proporção de água nos seres vivos varia com a espécie, o metabolismo do tecido e a idade.
Item B: verdadeiro. Em reações como hidrólise e fotossíntese, a molécula de água age como reagente, sendo quebrada e permitindo
que os átomos de hidrogênio e oxigênio se adicionem a outras substâncias.
Item C: falso. A água é um dos constituintes fundamentais da célula, sendo solvente universal para substâncias polares. No entanto,
algumas moléculas, particularmente as apolares, não são solúveis em meio aquoso.
Item D: falso. O oxigênio presente na molécula de água não pode ser removido dela, a não ser por algumas reações químicas. O
oxigênio utilizado nos processos de respiração dos seres vivos é o gás O 2 , encontrado em abundância na atmosfera e praticamente
insolúvel em água, sendo encontrado nela em pequenas quantidades. Assim, é mais fácil respirar fora da água do que dentro dela, uma
vez que o teor de O 2 é menor dentro de ambientes aquáticos.
Item E: falso. A água age como solvente universal para substâncias polares por ser também polar, característica que depende tanto do
hidrogênio como do oxigênio presentes na molécula de água.

18.
Resposta: C
Comentário: A água apresenta uma alta tensão superficial, resultante da grande coesão das moléculas de água, ou seja, atração entre
moléculas idênticas (no caso, a própria água). Esta forte atração se dá por interações como pontes de hidrogênio e interações dipolo-
dipolo. A coesão é o que possibilita a alguns insetos caminharem sobre a água, como na figura da questão.

19.
Resposta: B
Comentário: O sal torna o sangue hipertônico em relação aos tecidos circundantes, atraindo água por osmose. Assim, o aumento da
volemia leva a uma elevação na pressão arterial (hipertensão).

20.
Resposta: C
Comentário: O fósforo, na forma de fosfato, é importante constituinte estrutural de ossos e dentes (na forma de fosfato de cálcio e de
magnésio), além de participar de membranas celulares na composição de fosfolipídios e da formação de nucleotídeos no DNA, RNA e
ATP (tipo de nucleotídeo que age em processos de transferência de energia).

21.
Resposta: A
Comentário: A água é o componente mais abundante da matéria viva, constituindo cerca de 75 a 85% da célula viva, em seu
citoplasma.
22.
Resposta: C
Comentário: O íon positivo mais abundante no meio extracelular, como o plasma sangüíneo, é o sódio (Na+), como indicado no
gráfico III, e o íon positivo mais abundante no meio intracelular é o potássio (K+), como indicado no gráfico I.

23.
Resposta: D
Comentário: Se a solução salina tem concentração superior à fisiológica dos peixes, esta estará hipertônica em relação a eles,
podendo desidratá-los por osmose.

24.
Resposta: A
Comentário: O excesso de sal na dieta deixa o sangue hipertônico em relação aos tecidos vizinhos, de modo a atrair água por osmose,
o que aumenta o volume de sangue circulante e, consequentemente, a pressão arterial. Uma dieta pobre em sal leva à redução na
concentração do mesmo no sangue, de modo a reduzir o volume sanguíneo, o que é facilitado pela eliminação de urina abundante e
diluída.

25.
Resposta: B
Comentário:
1. O cálcio é obtido em alimentos como ovos, laticínios e vegetais verdes e, além do papel estrutural em ossos, dentes e conchas, age
na forma iônica como cofator enzimático em processos como coagulação sangüínea e contração muscular.
2. O iodo é obtido em frutos do mar e no sal de cozinha iodado, sendo metabolizado na glândula tireóide, onde se associa ao
aminoácido tirosina, formando os hormônios tireoidianos, como a tiroxina.
3. O ferro é obtido em fontes como fígado (que possui a proteína ferritina como reserva desse mineral), carnes vermelhas, gemas de
ovos, leguminosas como o feijão e verduras como o espinafre, sendo importante componente de proteínas como hemoglobina do
sangue (para transporte de oxigênio), mioglobina dos músculos (para transferência de oxigênio do sangue para a mitocôndria) e
citocromos (para o transporte de elétrons na respiração aeróbica e na fotossíntese).
4. O cobalto é obtido em carnes e laticínios e entra na composição da cobalamina ou vitamina B12, única vitamina associada a um
elemento mineral.

26.
Resposta: E
Comentário: Analisando cada item:
1º item: falso. A substância mais abundante na matéria viva é a água, sendo formada pelos elementos hidrogênio e oxigênio. Além da
água, substâncias orgânicas são abundantes na composição da matéria viva, sendo formadas basicamente por elementos como
carbono, hidrogênio e oxigênio, além de nitrogênio, fósforo e enxofre. Assim, os elementos mais abundantes na matéria viva são
exatamente hidrogênio, oxigênio, carbono, nitrogênio, fósforo e enxofre. Sódio e potássio não estado presentes no grupo de elementos
químicos mais abundantes nos organismos da Terra.
2º item: verdadeiro. Como mencionado acima, fósforo e enxofre estão entre os elementos químicos mais abundantes nos organismos
da Terra.
3º item: verdadeiro. São alguns elementos-traço encontrados nos seres da Terra elementos como cobre, ferro, iodo, potássio e
magnésio.
4º item: falso. Apesar de o alumínio estar ausente nos organismos terrestres (sendo inclusive tóxico para várias formas de vida,
inclusive os humanos), o silício entra na composição de algumas estruturas em organismos terrestres (como elementos esqueléticos em
esponjas e componentes da parede celular em algas diatomáceas).

27.
Resposta: B
Comentário: Os íons de sódio (I) e potássio (II) agem juntos no mecanismo de bomba de sódio e potássio para originar a polaridade
de membrana plasmática que é base para a condução do impulso nervoso. Os íons cálcio (III) são importantes cofatores enzimáticos
em processos como a contração muscular e a coagulação sangüínea.

28.
Resposta: D
Comentário: O ferro em humanos é adquirido na dieta em fontes como fígado (que possui a proteína ferritina como reserva desse
mineral), carnes vermelhas (que possuem proteínas como mioglobina e hemoglobina, ambas apresentando ferro em sua composição),
gemas de ovos, leguminosas como o feijão e verduras como o espinafre.
Em populações carentes, onde não há acesso a tais grupos alimentares, a utilização de panelas de ferro no preparo dos alimentos se
torna útil para enriquecê-los com esse elemento mineral.
29.
Resposta: D
Comentário: Íons tampões atuam na manutenção do pH de um meio. É importante que o pH dos variados meios orgânicos permaneça
constante para evitar desnaturação de enzimas. São exemplos de tampões os conjuntos fosfato (PO 4 ---) / bifosfato (HPO 4 --) e carbonato
(CO 3 --) / bicarbonato (HCO 3 --).
PO 4 --- ↔ HPO 4 --
CO 3 -- ↔ HCO 3 -
As reações abaixo mostram como esses sistemas conseguem impedir o acúmulo de íons H+ (acidificação) ou OH- (alcalinização) nos
meios orgânicos:
PO 4 --- + H+ ↔ HPO 4 —
CO 3 -- + H+ ↔ HCO 3 -
ou
HPO 4 -- + OH- ↔ PO 4 --- + H 2 O
HCO 3 - + OH- ↔ CO 3 -- + H 2 O

30.
Resposta: C
Comentário: Tecidos de um mesmo organismo variam os teores de água de acordo com um menor ou maior metabolismo. Quanto
maior o metabolismo tecidual, maior o teor percentual de água, uma vez que a água é o meio para o metabolismo. Assim, o tecido
nervoso é o que apresenta maior teor de água por ter maior atividade metabólica. O tecido muscular é o que apresenta o segundo maior
teor de água por ter a segunda maior atividade metabólica. Por outro lado, tecidos como ósseo e adiposo possuem pequeno teor de
água por terem pequena atividade metabólica. Além disso, quanto mais jovem um indivíduo (ou tecido do mesmo), maior sua
atividade metabólica e maior seu teor de água. Assim, tecido nervoso de embrião, por exemplo, terá maior teor de água que tecido
nervoso de adulto.

31.
Resposta: FVFFF
Comentário:
1º item: falso. A água apresenta alto calor específico, que implica na capacidade de absorver muito calor e mudar pouco de
temperatura, agindo então como regulador térmico.
2º item: verdadeiro. A água apresenta grande capacidade de dissolução, devido à grande adesão a substâncias polares, resultante de
interações como pontes de hidrogênio e interações dipolo-dipolo; assim, a maior parte dos componentes celulares encontra-se
dissolvida na água, que possibilita o transporte de substâncias e permite que ela aja como meio para reações químicas.
3º item: falso. Como mencionado acima, a água é o meio para transporte de substâncias, mas a capilaridade só atua em pequenas
alturas, de modo que o transporte de água e solutos para as plantas mais altas envolve um outro processo denominado tensão-coesão
de Dixon. .
4º item: falso. A água possui uma alta tensão superficial, que envolve altas forças de coesão (atração entre moléculas de água entre si)
e adesão (atração das moléculas de água por outras moléculas polares ou hidrofílicas).
5º item: falso. A água é uma molécula angulada, com o oxigênio mais eletronegativo no vértice da molécula e os hidrogênio mais
eletropositivos nas extremidades da mesma; assim, a água é polar, como o oxigênio como pólo negativo e os hidrogênios como pólos
positivos.

32.
Resposta:
A) O ambiente com alta concentração de açúcar (hipertônico) retira água das bactérias e fungos, que devido a essa desidratação não
proliferam.
B) Outro método de conservação de alimentos que tem por base o mesmo princípio fisiológico consiste na utilização de sal. Exemplos:
bacalhau, carne-seca, etc.

33.
Resposta:
A) Proposta IV. O ferro é essencial para a produção de hemoglobina – pigmento vermelho presente nas hemácias – que realiza o
transporte de oxigênio dos pulmões aos tecidos do corpo.
B) O cálcio presente no leite e em seus derivados é fundamental para os processos de calcificação óssea, mineralização dos dentes e a
coagulação sanguínea.

34.
Resposta:
A) Forma reduzida (Fe2+). Pelo gráfico, percebe-se que o ferro da carne é mais fácil de absorver do que o das verduras e o do feijão, e
segundo a tabela, o nas carnes e vísceras, o ferro é encontrado na forma Fe2+.
B) Sim. Segundo a tabela, a vitamina C é capaz de reduzir o ferro da forma Fe3+ (mais comum nos vegetais, como o feijão, e mais
difícil de absorver) para a forma Fe2+, mais fácil de absorver no intestino.

35.
Resposta:
A) Resfriar a pele quando evapora. (O alto calor de vaporização da água exige o consumo de grandes quantidades de calor para que
evapore, e esse calor é removido da pele do indivíduo).
B) A alta umidade do ar na região da Floresta Amazônica leva a dificuldade de evaporação do suor, o que leva a não remoção do calor
corporal, e conseqüentemente ao não resfriamento da pele, que assume temperaturas mais elevadas, dando uma sensação de mais
intensa de calor. Na caatinga, o ar mais seco favorece a evaporação do suor, levando a um mais eficiente resfriamento da pele e
diminuindo a sensação de calor corporal.

36.
Resposta:
A) O ambiente com alta concentração de açúcar (hipertônico) retira água das bactérias e fungos, que devido a essa desidratação não
proliferam.
B) O frio reduz o metabolismo das bactérias, matando-as ou diminuindo sua velocidade de reprodução. O congelamento leva à
formação de cristais de gelo que, por serem muito afiados, rasgam as membranas celulares e matam as células bacterianas.

37.
Resposta: O manitol é osmoticamente ativo e, assim, a alta concentração local faz com que a luz do intestino se torne hipertônica com
relação ao sangue. Desse modo, a água corporal é transportada para a luz do intestino provocando, então, a diarreia.

38.
Resposta: O salgadão, sendo hipertônico, atrairá água dos tecidos circundantes por osmose, aumentando mais rapidamente o volume
normal de sangue e assim, restabelecendo a pressão arterial.
Observação: Por que não se pode permitir que indivíduos muito desidratados ingiram água? Depois de muito tempo sem ingerir água,
o corpo fica desidratado devido às perdas de água no suor e urina (o limite máximo de manutenção da vida sem ingerir líquidos é de
36 h). Com a perda de água, as células ficam extremamente hipertônicas. O resultado é que, ao ingerir água, esta entrará nas células
com uma grande intensidade, promovendo deplasmólise. No tecido nervoso, esse inchaço (edema) leva à compressão mútua dos
neurônios. Podendo mesmo causar lesões cerebrais irreversíveis. Para evitar que isso aconteça, o melhor é administrar soluções
isotônicas (exemplo: soro fisiológico, isto é, NaCl a 0,9%). Normalmente o paciente desidratado chega em choque (isto é, devido às
perdas de água, seu volume sanguíneo e pressão arterial estão reduzidos), estando desmaiado. Por isso, a reidratação é feita por via
endovenosa, gradativamente para evitar um aumento brusco de pressão com conseqüente lesão no vaso.

39.
Resposta:
A)
- Manutenção do volume circulante e da circulação sanguínea
- Essencial para a absorção da glicose
- Intervém no equilíbrio ácido-base
- Participa nas contrações musculares
- Modula a absorção de nutrientes pelas células
- Manutenção do equilíbrio entre os fluidos celulares e extracelulares
- Responsável pelo transporte de várias substâncias pelo intestino
- Mantém o volume e a osmolaridade ou equilíbrio osmótico,
- Atua na transmissão do impulso nervoso, através do mecanismo da bomba de sódio, favorecendo o funcionamento do cérebro e o
controle de nossas funções vitais (sistema cardiovascular aos agentes vasopressores).
B) Íons Na+ penetram na célula por difusão, mas são expulsos através da membrana. O fenômeno ocorre contra o gradiente de
concentração, isto é, no inverso da tendência da difusão e depende de energia fornecida pela célula. Transporte ativo ou bomba de
Na+.
C) Hipertensão. A hipertensão arterial é um aumento da pressão interna dos vasos sangüíneos podendo ocorrer a ruptura dos mesmos,
em especial de capilares. Cálculos renais. Depósito de sais nos rins.

40.
Resposta:
A) Porque são endotérmicos e conseguem produzir calor para compensar as baixas temperaturas.
B) Como a água tem um alto calor específico, a temperatura da água não é tão baixa como a de fora da água.
1.
Resposta: E
Comentário: Segundo o texto, em relação à produção de etanol, “quanto mais simples a molécula de glicídio, mais eficiente é o
processo”. Assim, a maior eficiência se dará com a cana-de-açúcar, cujos caules (conhecidos como colmos), apresentam alto teor de
sacarose, um dissacarídeo constituído pelos monossacarídeos glicose e frutose.
Observação: O amido do milho é um polissacarídeo, e, portanto, mais complexo que a sacarose. As raízes da mandioca, conhecidas
como raízes tuberosas, são dotadas de alto teor de amido, e não de celulose (polissacarídeo encontrado na parede celular das células
vegetais, abundante em folhas). Glicogênio e quitina são polissacarídeos tipicamente encontrados em animais, mas nunca em plantas,
sendo o glicogênio com função de reserva e a quitina com função estrutural.

2.
Resposta: C
Comentário: A lactose é um dissacarídeo encontrado no leite e formado pela união entre dois monossacarídeos que são a glicose e a
galactose. Assim, a enzima beta-galactosidase ou lactase leva à digestão da lactose em um monossacarídeo de glicose e
monossacarídeo de galactose.

3.
Resposta: E
Comentário: Algumas moléculas são tipicamente encontradas em organismos animais ou em organismos vegetais. Assim,
polissacarídeos como glicogênio e quitina são próprios de animais e fungos, enquanto celulose e lignina são próprias de vegetais.
Glicerídeos são uma categoria de lipídios que inclui as gorduras e os óleos, sendo encontrados tanto em animais como em vegetais.

4.
Resposta: C
Comentário: A glicose é a fonte primordial de energia para as células, sendo metabolizada por processos como respiração aeróbica ou
fermentação. Em ambos os casos, o processo se inicia com a glicólise, cuja primeira reação, catalisada pela enzima hexoquinase,
converte a glicose em um composto denominado glicose-6-fosfato ou G6P. A G6P então continua sendo degradada até ácido pirúvico,
o que caracteriza o final da glicólise (a partir daí pode-se ir para o ciclo de Krebs na respiração aeróbica ou para a fermentação em
condições anaeróbicas. O excesso de glicose pode ser armazenado em animais como glicogênio, um polímero de glicose. Para isso, a
enzima glicoquinase converte a glicose também em G6P, que é usado na síntese de glicogênio, que é armazenado principalmente em
células hepáticas e musculares, mas com uma diferença importante:
- O glicogênio hepático é metabolizado pela enzima fosforilase em G6P, que pode entrar diretamente na glicólise ou, através da
enzima glicose-6-fosfatase, ser convertido em glicose e passar para o sangue, regulando a glicemia (a G6P não pode atravessar a
membrana plasmática para sair da célula para o sangue, mas a glicose pode fazer isso).
- O glicogênio muscular também é convertido em G6P, mas como o músculo não possui a enzima glicose-6-fosfatase, não consegue
convertê-la em glicose. Como a G6P não pode atravessar a membrana plasmática para sair da célula para o sangue, o glicogênio
muscular não pode atuar na regulação da glicemia.

5.
Resposta: C
Comentário: Quitina é um polissacarídeo aminado formado por unidades de N-acetil-glicosamina, sendo uma substância encontrada
em estruturas como a parede celular de fungos (como o mofo) e o exoesqueleto de artrópodes (como a mosca), além de cerdas de
anelídeos, rádulas de moluscos e rostro (coroa de ganchos) em Taenia solium.

6.
Resposta: A
Comentário: Carboidratos são moléculas caracterizadas como poliidroxialdeídos ou poliidroxicetonas, ou seja, dotados de vários
grupos hidroxila e aldeídos (aldoses) ou cetonas (cetoses). Os carboidratos mais simples são os monossacarídeos, sendo classificados
pelo número de carbonos como hexoses, pentoses, etc. Assim, glicose e galactose são aldohexoses (monossacarídeos com grupo
aldeído e seis carbonos) e a frutose é uma cetohexose (monossacarídeo com grupo cetona e seis carbonos). O item A representa então
a glicose. Observe a figura abaixo.
aldeído

cetona

carboxila

éter

7.
Resposta: A
Comentário: Analisando cada item:
Item A: verdadeiro. A glicose ou dextrose, um monossacarídeo, é a unidade formadora das moléculas de amido, um polissacarídeo.
Assim, a hidrólise do amido, como no milho, é usada para a produção industrial de glicose.
Item B: falso. Todos os monossacarídeos, como a frutose e a glicose, são solúveis em água. Frutose e glicose são os principais
componentes do mel.
Item C: falso. A sacarose é um dissacarídeo formado pela união de frutose e glicose; em grande quantidade, promove desidratação de
bactérias por fenômenos osmóticos, evitando a decomposição e possibilitando a conservação em alimentos.
Item D: falso. A celulose é obtida em algodão para a produção de tecidos e troncos de árvores para a produção de papel, mas não é
um monossacarídeo, e sim um polissacarídeo formado por várias unidades de glicose.

8.
Resposta: C
Comentário: Polissacarídeos são moléculas formadas por mais de 10 monossacarídeos ligados por ligações glicosídicas. Moléculas
como amido (polímero de glicose), celulose (também polímero de glicose) e ácido hialurônico (polímero de glicose aminada).
Galactose, frutose e ribose são monossacarídeos; maltose, sacarose e lactose são dissacarídeos; glicogênio é polissacarídeo.

9.
Resposta: A
Comentário: Carboidratos são moléculas caracterizadas como poliidroxialdeídos ou poliidroxicetonas, ou seja, dotados de vários
grupos hidroxila e aldeídos (aldoses) ou cetonas (cetoses). A fórmula geral dos carboidratos é C x (H 2 O) y . Nos carboidratos mais
simples, os monossacarídeos, a fórmula pode ser descrita como C n (H 2 O) n , com n variando de 3 (nas trioses) até 7 (nas heptoses).

10.
Resposta: C
Comentário: Carboidratos são moléculas caracterizadas como poliidroxialdeídos ou poliidroxicetonas, ou seja, dotados de vários
grupos hidroxila e aldeídos (aldoses) ou cetonas (cetoses). Os carboidratos mais simples são os monossacarídeos ou oses, sendo
classificados pelo número de carbonos como hexoses, pentoses, etc. Assim:
I. Açúcares que se apresentam com a estrutura de polihidroxicetonas são chamados cetoses.
II. Açúcares que, ao serem submetidos à hidrólise, dão como produto, além de oses, compostos orgânicos ou inorgânicos não
glicídicos podem ser chamados de heterosídios; holosídios são açúcares que, ao serem submetidos à hidrólise, dão como produto,
somente oses.

11.
Resposta: D
Comentário: Identificando cada substância:
I. A celulose é um polissacarídeo estrutural formado por glicose e encontrado em grande quantidade na parede celular de células
vegetais.
II. O RNA é um polímero de ribonucleotídeos, constituídos, cada um deles, por uma base nitrogenada (que pode ser adenina, guanina,
citosina ou uracila), uma molécula de ribose e um ou mais grupos fosfato. É bom lembrar que o RNA pode ser encontrado no núcleo e
no citoplasma, ao contrário do DNA que só pode ser encontrado no núcleo (com exceção daquele encontrado nas mitocôndrias),
apresentando desoxirribose no lugar de ribose.
III. O glicogênio é o principal polissacarídeo de reserva animal, sendo formado por glicose e encontrado em grande quantidade em
fígado e músculos.
IV. Proteínas são polímeros de aminoácidos, sendo que um grupo de proteínas denominadas enzimas se caracterizam por seu alto
poder catalítico.

12.
Resposta: D
Comentário: Tanto a celulose como o amido e o glicogênio são polímeros de glicose unidos por ligações glicosídicas. Entretanto, na
celulose, as moléculas de glicose ligadas estão numa forma (β-glicose) diferente daquela do amido e do glicogênio (α-glicose), sendo
que o organismo humano não possui enzimas apropriadas (β-celulases) para quebrar as ligações da glicose na celulose. Assim, a
celulose é completamente eliminada nas fezes sem sofrer alterações, o que contribui para a eliminação de gorduras da dieta, as quais
não são absorvidas e contribuem para a diminuição da quantidade de calorias ingeridas. Animais herbívoros se associam a
microorganismos capazes de digerir a celulose para poderem utilizar a glicose da mesma como fonte de energia.

13.
Resposta: C
Comentário: O principal componente orgânico de uma banana verde é o amido (I e II), o qual vai sendo convertido em açúcares mais
simples como glicose (III) e sacarose (IV) na medida em que vai amadurecendo, o que torna o seu sabor adocicado.

14.
Resposta: B
Comentário: A celulose é um polissacarídeo formado por cerca de 10 mil resíduos de β-glicose, sendo o componente orgânico mais
abundante em vegetais, onde é encontrada nas paredes celulares de todas as suas células.

15.
Resposta: E
Comentário: Tanto a celulose como o amido e o glicogênio são polímeros de glicose unidos por ligações glicosídicas. Entretanto, na
celulose, as moléculas de glicose ligadas estão numa forma (β-glicose) diferente daquela do amido e do glicogênio (α-glicose), sendo
que o organismo humano não possui enzimas apropriadas (β-celulases) para quebrar as ligações da glicose na celulose. Assim, a
celulose é completamente eliminada nas fezes sem sofrer alterações. Animais herbívoros se associam a microorganismos capazes de
digerir a celulose para poderem utilizar a glicose da mesma como fonte de energia.

16.
Resposta: E
Comentário: A lactose é o açúcar do leite, sendo um dissacarídeo constituído da associação em glicose e galactose. O intestino de
mamíferos jovens apresenta uma enzima denominada lactase ou β-galactosidase, responsável pela digestão da lactose. Em alguns
indivíduos, ocorre deficiência na produção de lactase e impossibilidade de digestão da lactose, caracterizando o quadro de intolerância
à lactose. Nesses indivíduos intolerantes, a ingestão de lactose leva a um quadro de mal-estar e diarreias, uma vez que a lactose não
pode ser digerida, Assim, analisando cada item:
Item I: verdadeiro. O texto apresenta uma incorreção biológica, pois a lactose não é uma proteína, e sim um carboidrato.
Item II: verdadeiro. A mutação a qual o texto se refere implica na intolerância à lactose, ou seja, na impossibilidade de digerir a
lactose em glicose e galactose, passíveis de serem absorvidas pelo intestino.
Item III: falso. Mutações ocorrem espontaneamente, não podendo ser induzidas por fatores como a presença de leite na dieta.

17.
Resposta: D
Comentário: Se o glicogênio hepático se mantém elevado, mas ocorrem crises freqüentes de hipoglicemia, pode-se afirmar que a
glicogenólise não ocorre normalmente. Assim, deve apresentar atividade deficiente a glicogênio-fosforilase (6), que converte
glicogênio em glicose-1-fosfato. Além disso, deve apresentar atividade deficiente a glicose-6-fosfato fosfatase (2), que converte a
glicose-6-fosfato em glicose, de modo que não há produção de glicose para que seja lançada no sangue.

18.
Resposta: A
Comentário: Analisando cada item:
Item A: verdadeiro. Macromoléculas como polissacarídeos (formados por monossacarídeos como monômeros), proteínas (formadas
por aminoácidos como monômeros) e ácidos nucléicos (formados por nucleotídeos como monômeros) são encontradas em todos os
seres vivos.
Item B: falso. Polissacarídeos, proteínas, lipídios e ácidos nucléicos são compostos orgânicos e a água é um composto inorgânico.
Item C: falso. Independentemente da complexidade, todos os seres vivos são formados pelos mesmos compostos básicos, como água
e compostos orgânicos.
Item D: falso. Como mencionado acima, todos os seres vivos são formados pelos mesmos compostos básicos, como água e
compostos orgânicos.
Item E: falso. Cada grupo de macromoléculas é formado por um tipo de constituinte monomérico que lhe é típico, sendo que um
mesmo grupo é constituído sempre pelo mesmo tipo de monômero.

19.
Resposta: B
Comentário: Lactose é um dissacarídeo formado pela união de glicose e galactose e encontrado no leite. Ao ser digerida, a lactose
libera glicose, cuja ingestão deve ser moderada em diabéticos.

20.
Resposta: A
Comentário: O principal alimento energético corresponde ao grupo dos carboidratos, uma vez que a glicose é prontamente
metabolizada no processo de respiração celular. Alimentos como carne seca e toucinho são basicamente compostos por proteínas,
sendo a gordura também abundante no toucinho. Já a farinha de mandioca e o arroz são principalmente formados por carboidratos,
sendo então os mais indicados para fins de fornecimento de energia.

21.
Resposta: FFVV
Comentário:
1º item: falso. Caloria é uma unidade de medida que indica a quantidade de energia gerada pela queima do alimento.
2º item: falso. Sal light apresenta 50% de cloreto de sódio (NaCl) e 50% de cloreto de potássio (KCl). O sal light tem um menor
tempo de retenção no organismo, sendo eliminado mais rapidamente pelos rins, o que é benéfico para pessoas com pressão alta
(hipertensos), pois retém menos água por osmose. Entretanto, pelo sua composição contendo potássio, não é recomendado para
pacientes com insuficiência renal, os quais têm dificuldade de remover o potássio do sangue. Além disso, ele salga menos que o sal
comum, levando, muitas vezes, ao seu consumo excessivo.
3º item: verdadeiro. Um alimento sem fenilalanina pode ser classificado como diet para indivíduos com fenilcetonúria,
4º item: verdadeiro. Indivíduos diabéticos não podem ingerir glicose (como no amido) de modo descontrolado; assim, um produto
light com glicose ou amido terá menos carboidrato que o normal, mas ainda terá carboidrato.

22.
Resposta: Polissacarídeos são macromoléculas formadas pela união de mais de 10 moléculas de monossacarídeos, sendo que alguns
deles apresentam nitrogênio na composição, sendo caracterizados como mucopolissacarídeos ou glicosaminoglicanas. São exemplos a
quitina no exoesqueleto de artrópodes e ácido hialurônico que mantém unidas as células musculares.

23.
Resposta:
A)
Polissacarídeos de reserva animal: glicogênio
Polissacarídeo de reserva vegetal: amido
B) Glicogênio é armazenado nos músculos esqueléticos e no fígado. Amido pode ser armazenado na raiz (mandioca), no caule (batata-
inglesa), nas sementes (milho).

24.
Resposta:
A) A bile é produzida no fígado e reabsorvida no intestino delgado.
B) A bile se mistura às fibras, sendo então eliminada nas fezes, de modo que o organismo deve produzir mais bile. Remove-se
colesterol do sangue para produzir mais bile, o que leva à diminuição dos níveis de colesterol no organismo.

25.
Resposta:
A) Celulose.
B) Xilema, esclerênquima.
C) Produção de tecidos, corda, papel.

26.
Resposta:
A) Ausência de enzima lactase.
B) Retirar a lactose, diminuir a concentração de lactose, pré-digerir a lactose.
C)
Macronutriente: proteína, gordura, carboidratos.
Micronutriente: cálcio, potássio, manganês, sódio, cobre, zinco, fósforo, vitaminas.
D) Convergência evolutiva.

27.
Resposta: A dieta rica em gordura recompõe o glicogênio muscular mais lentamente; assim, há pouca quantidade desse glicogênio
mesmo transcorridos vários dias depois do exercício. Os atletas dependem do glicogênio muscular como fonte imediata de energia
para a contração muscular e estarão assim prejudicados com essa dieta.

28.
Resposta:
A) A adrenalina é liberada em situações de estresse: a ativação da fosforilase leva à liberação de glicose no sangue, o que disponibiliza
mais energia para lidar com a situação de estresse.
B) O armazenamento de glicose sob a forma de amido diminui a pressão osmótica dentro da célula, além de evitar a saída de glicose
da célula por difusão.

29.
Resposta:
1.
A) A substância orgânica preferencialmente utilizada para a produção de energia nos seres vivos é a glicose (carboidrato), uma vez
que todos os processos metabólicos para produção de energia derivam evolutivamente da glicólise. O alimento com menor teor de
carboidratos é o alimento 1.
B) O alimento 3 tem um valor calórico de 400Kcal por 100 gramas.Se as necessidades diárias calóricas são de 2000Kcal, temos que a
massa necessária de alimento 3 seria de 500 gramas (Deixa de ser preguiçoso e faz uma regra de três que você acha esse resultado).
2. Proteínas macromoléculas, e como tal elas não conseguem ser absorvidas pelo intestino, cujas células só conseguem absorver
moléculas muito pequenas. Assim, a proteína de peixe é ingerida (por hidrólise) em aminoácidos, e estes aminoácidos são absorvidos.
No corpo humano, esses aminoácidos são utilizados no mecanismo de síntese protéica para a produção de proteínas humanas(já que a
regulação da produção dessas proteínas é realizada pelo material genético humano).
3. Amido. O iodo marca o amido com uma cor marrom-arroxeada.
4. O Alimento 2 é pobre em fibras alimentares. Tais fibras são basicamente a celulose nos alimentos. Essa celulose não é digerível no
corpo humano (uma vez que nós não possuímos enzimas para digerir ligações beta na celulose), não sendo, pois absorvida, e sendo
eliminada na forma de fezes junto a bactérias da microflora.Com uma pequena ingestão de fibras, a produção de fezes é diminuída,
bem como não há o adequado estímulo ao peristaltismo, o que leva uma retenção dessas fezes, chamada de prisão de ventre. Assim, a
afirmação é verdadeira.
5.
- Sódio: age no equilíbrio hídrico/ osmótico/ salino e na origem do potencial de membrana, base para a condução do impulso nervoso.
- Fósforo: na forma de fosfato, tem a função na estrutura de ossos e dentes (fosfato de Ca e de Mg), na transferência de energia (a
forma de ATP), na constituição dos ácidos nucléicos (fazendo parte dos nucleotídeos ), na composição da membrana plasmática(na
forma de fosfolipídios) e no impedimento na variação de pH do meio( na forma de íons-tampões).
- Cálcio: na forma salina (fosfato de cálcio e calcário) entra na composição de ossos, dentes, conchas e carapaças; na forma iônica, age
no controle da permeabilidade das membranas celulares (junto ao magnésio), na regulação da contração muscular e nos processos de
coagulação do sangue e na sinapse nervosa.
6. Aditivos são substâncias como conservantes, corantes, flavorizantes, edulcorantes (= adoçantes), etc. A vantagem da sua utilização
está na melhoria do aspecto do alimento quanto à cor, sabor e textura, bem como na ação de impedir a proliferação de microorganismo
que levariam a deterioração do alimento. A desvantagem de sua utilização está na possibilidade do aparecimento de câncer
(substâncias como as nitrosamidas são potencialmente cancerígenas) no caso de uso excessivo.
7. O metabolismo total em relação à quantidade de calorias necessárias varia com aspectos como a massa muscular (quanto maior a
massa muscular, maior a necessidade calórica) e a intensidade da atividade física (quanto maior, maior a necessidade calórica). Assim
o lenhador tem uma maior necessidade calórica em relação à criança por ter massa muscular maior; já o pirralho jogando bola tem
uma maior necessidade calórica em relação o adulto digitando por estar desempenhando uma atividade física mais intensa.

30.
Resposta:
A) O açúcar A obedece a fórmula geral de monossacarídeos C n H 2n O n para n=7, sendo ele o monossacarídeo (uma heptose, pois).
B) O açúcar B, pois se adicionarmos a ele uma molécula de água (como se faz na hidrolise), fica C 6 H 12 O 6 e quebrando (como se faz
na hidrólise), origina-se 2C 3 H 6 O 3 que são os únicos 2 monossacarídeos que se dar para formar com 6C, já que eles têm de 3 a 7C.
1.
Resposta: C
Comentário: A grande disponibilidade de alimentos altamente calóricos nos dias de hoje tem levado uma parcela cada vez maior das
populações humanas quadros de obesidade, uma vez que a maior parte das reservas energéticas no corpo humano se dá na forma de
gorduras. A obesidade, no entanto, está relacionada ao aumento no risco de uma série de doenças, como doenças cardiovasculares e
diabetes tipo II.
Observação 1: A diabetes tipo I ou juvenil está relacionada à destruição das células beta do pâncreas, responsáveis pela produção de
insulina, com consequente diminuição na produção do referido hormônio; a diabetes tipo II ou tardia está relacionada à diminuição de
receptores para a insulina, estando fortemente relacionada à obesidade.
Observação 2: Anemia é a diminuição na quantidade de hemoglobina no sangue, estando normalmente relacionada à falta de ferro na
dieta (anemia ferropriva); beribéri é a condição resultante da hipovitaminose da vitamina B1; escorbuto é a condição resultante da
hipovitaminose da vitamina C; e fenilcetonúria é uma doença genética que resulta na impossibilidade de metabolizar o aminoácido
fenilalanina.

2.
Resposta: C
Comentário: Analisando cada item:
Item I: falso. É muito comum referir-se ao valor energético dos alimentos pela quantidade de calorias de energia (kcal) que ele pode
liberar. Assim, os carboidratos liberam 4,1 kcal por grama, os lipídios liberam 9,3 kcal por grama e as proteínas liberam 4,1 kcal por
grama. Apesar de os lipídios serem mais energéticos, os glicídios são os primeiros a serem consumidos pelo organismo, uma vez que a
principal reação metabólica para a liberação de energia a partir dos nutrientes é a respiração aeróbica, que começa com a glicólise, a
qual usa glicose como substrato primordial. Lipídios são usados em seguida, uma vez que são a principal substância de reserva
energética animal, devendo ser convertidos em derivados de açúcar para serem utilizados como fonte de energia. Proteínas, uma vez
que são de função estrutural, só são consumidas em caso de ausência dos demais compostos, devendo ser convertidos em derivados de
açúcar para serem utilizados como fonte de energia.
Item II: verdadeiro. Como mencionado acima, lipídios e proteína devem ser convertidos em derivados de carboidratos para que
sejam utilizados como fontes de energia, o que dá pelo processo de gliconeogênese, cujas principais vias metabólicas são mostradas
abaixo:
Glicose Lipídios Proteínas

Glicólise Digestão Digestão

Ácido pirúvico Ácidos graxos Aminoácidos

β-oxidação Desaminação

Acetil-coA

Ácidos orgânicos Amônia

Ciclo de Krebs Ciclo da


ornitina

Energia! Uréia

Assim, uma alimentação hiperproteica levará a uma desaminação elevada.


Item III: verdadeiro. Fibras de celulose provenientes da dieta não podem ser digeridas nem absorvidas pelo corpo humano, sendo
eliminadas nas fezes. São, no entanto, importantes na dieta, uma vez que estimulam o peristaltismo.
Item IV: falso. Alimentos de origem animal, como carne, leite, ovos e bacon, são ricos em colesterol e em gorduras conversíveis em
colesterol. O colesterol, apesar de sua relação com doenças cardiovasculares, é uma substância fundamental aos organismos animais,
sendo importante para a integridade da membrana celular, aumentando sua estabilidade e fluidez, participando da síntese dos
hormônios esteróides, como os hormônios sexuais (testosterona, estrógenos e progesterona) e os hormônios corticóides (como o
cortisol e a aldosterona), participando da síntese dos sais biliares da bile, chamados de colatos (derivados do acido cólico) e da
produção da vitamina D. Assim, apesar de o colesterol agir na produção de sais biliares para emulsificar triglicerídeos no intestino,
não se pode dizer que essa é sua principal função, a qual é, provavelmente, a de agir como componente estrutural das membranas
celulares.

3.
Resposta: B
Comentário: Existe uma hierarquia no consumo de nutrientes pelo organismo. Assim, glicídios são os primeiros a serem consumidos
pelo organismo, uma vez que a principal reação metabólica para a liberação de energia a partir dos nutrientes é a respiração aeróbica,
que começa com a glicólise, a qual usa glicose como substrato primordial. Lipídios são usados em seguida, uma vez que são a
principal substância de reserva energética animal, devendo ser convertidos em derivados de açúcar para serem utilizados como fonte
de energia. Proteínas, uma vez que são de função estrutural, só são consumidas em caso de ausência dos demais compostos, devendo
ser convertidos em derivados de açúcar para serem utilizados como fonte de energia. A questão, no entanto, aborda o assunto por um
outro ponto de vista. Carboidratos são polares (hidrossolúveis), assim, como a maioria das enzimas, incluindo aquelas da respiração
celular, facilitando a interação entre eles, ao contrário dos lipídios, que são apolares. Assim:
Item A: falso. O excesso de carboidratos é armazenado no corpo na forma de lipídios.
Item B: verdadeiro. Como mencionado anteriormente, os carboidratos a as enzimas são hidrossolúveis.
Item C: falso. Os lipídios são apolares, e, portanto, hidrofóbicos, enquanto as enzimas são polares, e, portanto, hidrofílicas.
Item D: falso. Muitas das enzimas que agem na via metabólica que degrada carboidratos agem na via metabólica que degrada lipídios.
Item E: falso. Carboidratos do grupo dos polissacarídeos podem ser formados por milhares de unidades de monossacarídeos, como o
amido, que é formado por 1400 unidades de glicose, enquanto os lipídios triglicerídeos, ou seja, óleos e gorduras, são formados apenas
por quatro unidades, no caso, três moléculas de ácidos graxos e uma de glicerol, sendo, então, mais simples.

4.
Resposta: A
Comentário: Baseado no gráfico, temos que:
X = glicídios, uma vez que são os primeiros a serem consumidos pelo organismo e, conseqüentemente, os primeiros a se esgotar;
Y = lipídios; e
Z = proteínas, uma vez que são de função estrutural, só sendo consumidas em caso de ausência dos demais compostos, sendo então os
últimos a se esgotar.

5.
Resposta: C
Comentário: Analisando cada item:
Item A: falso. A obesidade é uma doença crônica multifatorial na qual a reserva natural de gordura aumenta. As demais informações
do item estão corretas.
Item B: falso. Hábitos de dieta (rica em carboidratos e gorduras) e estilo de vida (relacionado à falta de exercícios), além de genética,
apresentam grande correlação com a obesidade.
Item C: verdadeiro. Uma das principais ferramentas epidemiológicas para análise de obesidade corresponde à medição do IMC (=
massa em quilos/ altura em metros2), permitindo a identificação de indivíduos abaixo ou acima do peso.
Item D: falso. A obesidade se refere ao fato de os indivíduos estarem acima, e não abaixo do peso.
Item E: falso. O tratamento da obesidade objetiva reduzir a massa corpórea, incluindo uma combinação de dieta, exercícios físicos,
mudança de comportamento e, algumas vezes, remédios para emagrecer.

6.
Resposta: B
Comentário: Analisando cada item:
Item A: falso. A nicotina do cigarro estimula a liberação de adrenalina pelo organismo, e esta tem um efeito vasoconstrictor,
contribuindo para o aumento da pressão arterial.
Item B: verdadeiro. Atividades físicas aumentam a angiogênese, formação de novos vasos sanguíneos, favorecendo a oxigenação dos
músculos como um todo, inclusive miocárdio do coração.
Item C: falso. A ingestão de alimentos pouco calóricos, ricos em fibras e aminoácidos, não contribui para a obstrução das artérias
coronárias ou a formação de placas de ateroma (colesterol); dietas ricas em lipídios e sal e pobres em fibras podem, entretanto, ter esse
efeito.
Item D: falso. O estresse contribui para liberação de catecolaminas como a adrenalina, que, por seu efeito vasoconstritor, tem efeito
hipertensor; insulina e glucagon não são catecolaminas e não têm relação com o estresse.
Item E: falso. O sal aumenta a pressão osmótica do sangue, o que aumenta a volemia, com efeito hipertensor; esse efeito de pressão
alta pode lesionar o endotélio arterial, favorecendo a formação de placas de ateroma (colesterol).

7.
Resposta: E
Comentário: O metabolismo dos lipídios na gliconeogênese, que ocorre em regiões do corpo como fígado e tecido adiposo, se inicia
com a quebra dos triglicerídeos, liberando ácidos graxos, que são oxidados em acetil-coA, utilizado na respiração aeróbica (no ciclo de
Krebs) para gerar energia. O ácido láctico é proveniente do metabolismo anaeróbico da glicose por fermentação láctica.

8.
Resposta: C
Comentário: Uma vez que lipídios são apolares, não são solúveis em água e não podem ser transportados no sangue. Assim, para que
haja o transporte dos mesmos, os lipídios são associados a proteínas, formando compostos denominados genericamente de
lipoproteínas.
- Quilomícrons são lipoproteínas formadas pela associação de triglicerídeos com proteínas, sendo produzidos nas células do intestino
delgado que absorvem os nutrientes da dieta (enterócitos) a partir dos ácidos graxos e glicerol gerados na digestão intestinal dos
lipídios;
- Lipoproteínas de colesterol são formadas pela associação do colesterol com proteínas, podendo ser HDL (lipoproteína de alta
densidade ou “colesterol bom”, que transporta colesterol para o fígado, removendo-o do sangue, para que seja metabolizado) e
LDL/VLDL (lipoproteínas de baixa/baixíssima densidade ou “colesterol ruim”, que transportam colesterol do fígado para as demais
células e que podem aderir à parede dos vasos sanguíneos formando placas de ateroma).
O item C está incorreto porque o VLDL não contém triglicerídeos, e sim colesterol em sua composição.

9.
Resposta: D
Comentário: Óleos e gorduras são lipídios do grupo dos triglicerídeos ou triacilgliceróis, quimicamente caracterizados por serem
ésteres de 3 ácidos graxos com glicerol.

10.
Resposta: B
Comentário: Analisando cada item:
Item A: falso. Radicais livres promovem danos às células por sua ação oxidante, de modo que seu combate deve se dar pela ingestão
de alimentos com substâncias antioxidantes.
Item B: verdadeiro. Óleos e gorduras são triglicerídeos, correspondendo a ésteres de 3 ácidos graxos com glicerol; nos óleos, que são
líquidos, esses ácidos graxos são insaturados; nas gorduras, que são sólidas, esses ácidos graxos são saturados.
Item C: falso. A gordura trans é produzida a partir da hidrogenação de óleos poliinsaturados de origem vegetal, sendo menos
insaturada e por isso mais consistente (menos líquida).
Item D: falso. O aquecimento de óleos promove a saturação de algumas de suas ligações; na reação representada, a molécula que
reage com a água é um aldeído, e não um óleo.

11.
Resposta: D
Comentário: Analisando cada item:
Item A: falso. Esteroides são lipídios derivados do colesterol, um álcool policíclico.
Item B: falso. A aterosclerose (formação de placas de colesterol conhecidas como ateromas na parede dos vasos sangüíneos) está
relacionada ao excesso de lipoproteínas de baixa densidade (LDL e VLDL), conhecidas como “colesterol ruim”; o HDL não está
relacionado com a aterosclerose e por isso é conhecido como “colesterol bom”.
Item C: falso. Estradiol, estriol e estronas são hormônios esteróides (derivados do colesterol) que originam caracteres sexuais
femininos, enquanto a testosterona é o hormônio esteróide que origina caracteres sexuais masculinos.
Item D: verdadeiro. A maior parte do colesterol do corpo é produzida em órgãos como fígado e intestino a partir dos óleos e gorduras
da dieta (“colesterol endógeno”); uma pequena parte é obtida diretamente na dieta a partir de fontes alimentares de origem animal
(“colesterol exógeno”).

12.
Resposta: A
Comentário: Moléculas como oses (também conhecidas como monossacarídeos) e osídeos (também conhecidos como
oligossacarídeos e polissacarídeos) são carboidratos; holosídios são carboidratos complexos formados apenas por moléculas de
carboidratos mais simples, enquanto que heterosídios são carboidratos complexos que possuem em sua estrutura outras unidades além
de carboidratos mais simples. Já glicerídeos, fosfatídios (fosfolipídios) e cerídeos são categorias de lipídios.

13.
Resposta: D
Comentário: Lipases são enzimas que digerem lipídios. No caso de triglicerídeos, os produtos da digestão são os ácidos graxos e o
glicerol; no caso dos cerídeos, os produtos da digestão são ácidos graxos e alcoóis de cadeia longa; no caso dos esteróides, não há
digestão, sendo colesterol absorvido com sua estrutura intacta. Aminoácidos são o produto da digestão de proteínas por enzimas
proteases e monossacarídeos (açúcares simples) são o produto da digestão de polissacarídeos (açúcares complexos) por enzimas
carboidratases.

14.
Resposta: C
Comentário: O colesterol é um lipídio esteroide que estabiliza e aumenta a fluidez da membrana plasmática de animais, não sendo
encontrado em bactérias, fungos, algas ou plantas. No corpo humano, é precursor na formação de sais biliares e hormônios esteroides,
como os hormônios sexuais. Analisando cada item:
Item A: falso. Os lipídios caracterizados por serem ésteres de um ácido graxo com um monoálcool de cadeia longa são os cerídeos,
como as ceras, enquanto que o ergosterol e o colesterol são alcoóis policíclicos, não apresentando a função éster. grupo superiores de
cadeia aberta.
Item B: falso. O ergosterol ou pró-vitamina D2 é um lipídio de natureza vegetal o qual, na pele, sob ação de raios ultravioleta, origina
a vitamina D2 ou ergocalciferol.
Item C: verdadeiro. Como mencionado, o colesterol estabiliza a membrana de células animais e origina hormônios sexuais como
testosterona, progesterona e estrógenos.
Item D: falso. Alimentos de origem animal são ricos em gorduras saturadas, as quais aumentam os níveis sanguíneos de LDL-
colesterol, aumentando o risco de aterosclerose e, consequentemente, de problemas cardiovasculares. Gorduras insaturadas, obtidas
tanto em óleos vegetais como em óleos de peixe levam à diminuição nos níveis de LDL-colesterol e, por isso, diminuem o risco de
aterosclerose.
Item E: falso. Os principais constituintes estruturais do corpo humano são as proteínas, obtidas em alimentos ditos plásticos ou
construtores.

15.
Resposta: C
Comentário: Analisando cada item:
Item A: falso. Proteínas são alimentos plásticos ou construtores, apresentando função estrutural, e podem ser eventualmente utilizadas
como fontes de energia na ausência de carboidratos e lipídios. O valor energético dos lipídios é de 9,3 kcal/g, enquanto o de
carboidratos e de proteínas é de 4,1 kcal/g.
Item B: falso. Lipídios são a principal forma de armazenamento de energia em animais. Apesar de os lipídios serem mais energéticos,
os glicídios são os primeiros a serem consumidos pelo organismo, uma vez que a principal reação metabólica para a liberação de
energia a partir dos nutrientes é a respiração aeróbica, que começa com a glicólise, a qual usa glicose como substrato primordial.
Item C: verdadeiro. Como mencionado anteriormente, os lipídios fornecem 9,3 kcal/g, mais do dobro da energia dos carboidratos,
que fornecem 4,1 kcal/g. Em excesso, lipídios aumentam o risco de obesidade e contribuem para o aumento nos níveis de colesterol no
sangue.
Item D: falso. Sais minerais são substâncias inorgânicas, não produzidas pelos seres vivos, e que agem como alimentos reguladores,
sendo principalmente utilizados como cofatores enzimáticos.
Item E: falso. A reserva de carboidrato no organismo humano, na forma de glicogênio em fígado e músculos, permite a sobrevivência
em jejum por cerca de um dia, enquanto a reservas de lipídios permite a sobrevivência em jejum durante semanas.

16.
Resposta: D
Comentário: Analisando cada item:
Item A: falso. O magnésio é um elemento mineral encontrado na clorofila, sendo essencial à fotossíntese, nos ribossomos, sendo
essencial à síntese proteica, e nos ossos e dentes. O elemento mineral necessário ao funcionamento da glândula tireoide é o iodo,
entrando na composição da tiroxina, principal hormônio tireoidiano.
Item B: falso. Gorduras saturadas, de origem animal, estão relacionadas ao aumento nos teores sanguíneos de LDL, ou seja, de
colesterol ruim, aumentando o risco aterosclerose e condições associadas, como hipertensão arterial, infartos e derrames.
Item C: falso. O sal aumenta a pressão osmótica sanguínea, atraindo água por osmose e aumentando o volume de sangue, o que leva
ao aumento da pressão arterial, com eventuais consequências nocivas como infartos e derrames.
Item D: verdadeiro. Gorduras insaturadas podem ser de dois tipos: as poliinsaturadas, encontradas em óleos vegetais e óleos de
peixes, e que diminuem os teores totais de colesterol, tanto de LDL (“colesterol ruim”) como de HDL (“colesterol bom”), a as
monoinsaturadas, encontradas em castanhas, como a macadâmia, e que diminuem o teor de LDL (“colesterol ruim”) e aumentam o
teor de HDL (“colesterol bom”).
Item E: falso. Como mencionado anteriormente, as castanhas como amêndoas, avelãs e nozes são ricas em gorduras monoinsaturadas,
sendo as gorduras saturadas encontradas em alimentos animais como carne, ovos e leite.

17.
Resposta: C
Comentário: A obesidade é caracterizada pela ocorrência de um grande percentual de gordura corporal, predispondo a várias
condições patológicas como diabetes tipo 2, aterosclerose e doenças cardiovasculares. Nos últimos anos, a ocorrência de obesidade
infantil tem sido relacionada ao aumento no risco de obesidade e doenças relacionadas no adulto, havendo vários fatores
predisponentes a essa situação. Analisando as condições citadas:
Item I: verdadeiro. Bebês que dormem pouco apresentam maior nível de hormônios do estresse, os quais predispõem ao ganho de
peso.
Item II: verdadeiro. Mães diabéticas apresentam alto teor de açúcar no sangue, disponibilizando mais açúcar para a criança, o que
favorece a produção de gordura.
Item III: falso. O leite materno oferece uma série de benefícios para a criança, como uma alimentação balanceada, o fornecimento de
anticorpos e a criação de vínculos afetivos com a mãe. Mesmo sem a amamentação, entretanto, é possível que a criança consiga uma
alimentação balanceada que impeça a ocorrência de obesidade.
Item IV: falso. Recém‐nascidos de grande tamanho não necessariamente se tornarão crianças obesas se alimentadas adequadamente.
Item V: falso. A presença de celulite na criança, mesmo em grande quantidade, não aumenta o risco de obesidade na mesma.
Item VI: verdadeiro. Devido à influência da genética e dos hábitos alimentares, genitores obesos aumentam o risco de a criança
desenvolver obesidade.

18.
Resposta: E
Comentário: Lipoproteínas de colesterol são formadas pela associação do colesterol com proteínas, podendo ser HDL (lipoproteína
de alta densidade ou “colesterol bom”, que transporta colesterol para o fígado, removendo-o do sangue, para que seja metabolizado) e
LDL/VLDL (lipoproteínas de baixa/baixíssima densidade ou “colesterol ruim”, que transportam colesterol do fígado para as demais
células e que podem aderir à parede dos vasos sanguíneos formando placas de ateroma). Óleos são triglicerídeos líquidos onde
predominam ácidos graxos insaturados. No caso dos ácidos graxos poliinsaturados, ocorre estímulo à diminuição da produção de
colesterol por parte do corpo. Os ácidos graxos monoinsaturados (encontrados em azeite e castanhas) agem diminuindo as taxas de
colesterol ruim e aumentando as taxas de colesterol bom, e os ácidos graxos saturados (encontrados em alimentos animais como carne,
leite e ovos) agem aumentando as taxas de colesterol ruim. Assim, analisando cada item:
Item I: falso. Uma alimentação rica em gorduras saturadas está relacionada ao aumento do colesterol LDL, o que pode comprometer a
saúde.
Item II: falso. O colesterol LDL está relacionado ao aumento no risco de doenças cardiovasculares, sendo conhecida como colesterol
ruim, conduzindo colesterol do fígado aos tecidos.
Item III: verdadeiro. Segundo o texto, o valor de referência para a glicose sanguínea em jejum é de 70 a 99, de modo que o valor de
86 está dentro de padrões aceitáveis.

19.
Resposta: D
Comentário: Lipídios simples são aqueles formados somente pelos elementos químicos C, H e O, sendo classificados em grupos
como glicerídeos (ésteres de ácidos graxos e glicerol), cerídeos (ésteres de ácidos graxos e monoálcoois de cadeia longa) e esteróides
(derivados de colesterol). Quando o lipídio possui também elementos como N, P e S, passa a ser chamado de lipídio complexo ou
conjugado (como os fosfolipídios dotados de grupos fosfato).

20.
Resposta: C
Comentário: Lipídios são compostos orgânicos apolares, insolúveis em água e solúveis em solventes orgânicos. São
predominantemente energéticos, consumidos pelo organismo após o esgotamento de carboidratos (que são os compostos energéticos
consumidos preferencialmente pelo organismo), mas também têm função estrutural (como nos fosfolipídios de membrana plasmática).
Os principais grupos de lipídios são glicerídeos (ésteres de ácidos graxos e glicerol), cerídeos (ésteres de ácidos graxos e monoálcoois
de cadeia longa) e esteróides (derivados de colesterol).

21.
Resposta: A
Comentário: Lactose e colesterol são substâncias encontradas em organismos animais, mas não em vegetais, de modo que podem ser
encontrados em alimentos de origem animal, mas não vegetal. Assim, analisando cada situação:
- Se a bebida da tabela 1 só apresenta carboidrato, não possuindo proteína ou gordura, corresponde ao suco néctar de pêssego;
- Se a bebida da tabela 2 apresenta colesterol, tem que ser de origem animal, não podendo ser suco néctar de pêssego nem bebida pura
de soja, sendo então o iogurte integral natural.
- Por eliminação, a bebida da tabela 3 é a bebida pura de soja.
Assim:
- Se o consumidor A tinha intolerância à lactose, não é recomendado que ele ingira iogurte natural, que contém lactose;
- Se o consumidor B era diabético, não é recomendado que ele ingira a bebida da tabela 1, que contém alto teor de carboidrato (21,3 g)
comparado com as outras (respectivamente com 1,9 g e 1,5 g);
- Se o consumidor C tinha altos níveis de colesterol, não é recomendado que ele ingira iogurte natural, única bebida que contém
colesterol.
Desse modo, analisando cada item:
Item A: verdadeiro. Suco néctar de pêssego é o da tabela 1, e o consumidor A pode ingeri-lo (devendo evitar apenas o iogurte
natural).
Item B: falso. Iogurte integral natural é o da tabela 2, mas o consumidor C não pode ingeri-lo, uma vez que contém colesterol.
Item C: falso. Iogurte integral natural é o da tabela 2, e não o da tabela 1.
Item D: falso. Bebida pura de soja é a da tabela 3, e não a da tabela 2.
Item E: falso. Suco néctar de pêssego é o da tabela 1, e não o da tabela 3.
22.
Resposta: B
Comentário: São moléculas tipicamente animais carboidratos como a lactose (encontrada apenas no leite, produzido somente por
mamíferos) e lipídios como o colesterol (ausente em vegetais, algas, fungos e bactérias).

23.
Resposta: A
Comentário: Lipídios simples são aqueles formados somente pelos elementos químicos C, H e O, sendo classificados em grupos
como glicerídeos (ésteres de ácidos graxos e glicerol), cerídeos (ésteres de ácidos graxos e monoálcoois de cadeia longa) e esteróides
(derivados de colesterol). Quando o lipídio possui também elementos como N, P e S, passa a ser chamado de lipídio complexo ou
conjugado (como os fosfolipídios dotados de grupos fosfato e a esfingomielina com enxofre).

24.
Resposta: B
Comentário: Existe uma seqüência de consumo de compostos energéticos no corpo humano, de modo que os glicídios são os
primeiros a serem consumidos, uma vez que seu metabolismo é mais fácil (os carboidratos são os substratos imediatos do processo de
respiração celular). Na falta desses, através de um processo denominado de gliconeogênese, ocorre consumo de lipídios e,
posteriormente, de proteínas, sendo estas as ultimas a serem consumidas, uma vez que são de função estrutural, só sendo consumidas
em caso de ausência dos demais compostos, sendo então os últimos a se esgotar. Na gliconeogênese, vias metabólicas irão produzir
derivados de carboidrato (particularmente acetil-coA) a partir dos lipídios ou proteínas consumidos.

25.
Resposta: B
Comentário: Uma vez em jejum, o organismo começa a mobilizar suas reservas nutritivas para fornecer energia às células. O fígado
armazena grandes quantidades de nutrientes na forma de glicogênio e gordura. Assim, no fígado,
- ocorre glicogenólise, ou seja, quebra de glicogênio em glicose, que é então disponibilizada para a corrente sanguínea (1 aumenta);
- diminui a glicólise, uma vez que a glicose não será utilizada pelo fígado, e sim disponibilizada para o sangue (2 diminui);
- ocorre desaminação, ou seja, remoção do grupo amina dos aminoácidos com liberação de ácidos orgânicos que podem ser
convertidos em acetil-coA e daí em glicose, que pode então ser disponibilizada para o sangue (3 aumenta);
- diminui a glicogenogênese, ou seja, síntese de glicogênio, uma vez que esta molécula estará sendo quebrada em glicose (4 diminui);
- ocorre β-oxidação dos lipídios, ou seja, degradação das gorduras a ácidos graxos e daí a acetil-coA, o qual pode ser convertido em
glicose, que pode então ser disponibilizada para o sangue (5 aumenta);
- ocorre gliconeogênese, ou seja, formação de glicose a partir de proteínas/aminoácidos (por desaminação) e lipídios/ácidos graxos
(por β-oxidação), sendo esta glicose disponibilizada para o sangue (6 aumenta).

26.
Resposta: D
Comentário: Se o indivíduo em questão tem 1,60 m de altura e “peso” de 89,6 kg, tem IMC = peso / (altura)2 = 89,6 / (1,60)2 = 35, o
que o classifica, segundo a tabela, como obeso nível II. Analisando cada item:
Item I: verdadeiro. Como a altura está no denominador da fórmula do IMC, caso a altura aumente e a massa se mantiver constante, o
valor do IMC vai diminuir.
Item II: falso. Como mencionado, esse indivíduo tem IMC = 35 e é obeso nível II.
Item III: verdadeiro. Se esse indivíduo engordar 18 kg, terá massa de 107,6 kg e IMC = 42, sendo considerado obeso nível III.
Item IV: verdadeiro. Se esse indivíduo emagrecer 30 kg, terá massa de 59,6 kg e IMC = 23,2, sendo considerado saudável.

27.
Resposta: E
Comentário: Analisando cada item:
Item A: falso. Diuréticos são substâncias que levam a um aumento na produção de urina, reduzindo a massa corporal por reduzir a
quantidade de água, mas não interferindo na quantidade de gordura do corpo.
Item B: falso. A redução do estômago reduz a massa corporal porque leva ao enchimento gástrico com menor quantidade de alimento,
levando à saciedade com pequena quantidade de alimento, o que reduz a ingestão calórica e leva ao consumo do estoque de gordura
do corpo, com consequente redução da massa corpora.
Item C: falso. A obesidade resulta da diferença positiva entre o que se come e o que se gasta, de modo que as sobras energéticas são
armazenadas como gordura.
Item D: falso. Músculos não acumulam gordura, a qual é armazenada em fígado e tecido adiposo.
Item E: verdadeiro. A sequência de consumo de nutrientes energéticos é, normalmente, primeiro carboidrato, em seguida gordura, e,
por último, proteína. Como os músculos não armazenam gordura, durante a atividade física, a sequência de consumo de nutrientes
muda, sendo primeiro carboidrato, em seguida proteína, removida do próprio músculo, e, por último, gordura, a qual é metabolizada a
partir de fígado e tecido adiposo.
28.
Resposta: E
Comentário: Apesar de sua relação com doenças cardiovasculares, o colesterol é uma substância fundamental aos organismos
animais.
Item I: verdadeiro. O colesterol é importante para a integridade da membrana celular, aumentando sua estabilidade e fluidez.
Item II: verdadeiro. O colesterol participa da síntese dos hormônios esteróides, como os hormônios sexuais (testosterona, estrógenos
e progesterona) e os hormônios corticóides (como o cortisol e a aldosterona).
Item III: verdadeiro. O colesterol, um álcool, participa da síntese dos sais biliares da bile, chamados de colatos (derivados do acido
cólico).
Além disso, o colesterol é precursor da vitamina D em animais.

29.
Resposta: A
Comentário: É muito comum referir-se ao valor energético dos alimentos pela quantidade de calorias de energia (kcal) que ele pode
liberar. Assim, os carboidratos liberam 4,1 kcal por grama, os lipídios liberam 9,3 kcal por grama e as proteínas liberam 4,1 kcal por
grama.

30.
Resposta: B
Comentário: Analisando cada item:
Item I: verdadeiro. Óleos são triglicerídeos com predomínio de ácidos graxos insaturados, que lhes dá consistência líquida; a
hidrogenação dos mesmos satura os ácidos graxos, transformando-os em gorduras saturadas de consistência sólida ou menos
insaturadas de consistência pastosa.
Item II: verdadeiro. A margarina é produzida a partir da hidrogenação (saturação de óleos vegetais).
Item III: verdadeiro. Como mencionado, óleos são triglicerídeos onde há predomínio de ácidos graxos de cadeia insaturada, sendo
líquidos à temperatura ambiente.
Item IV: falso. Os ácidos graxos poliinsaturados de origem animal, como os óleos de peixe de águas frias, como o salmão, diminuem
os níveis de colesterol total, mas em excesso podem levar à obesidade por serem muito calóricos.
Item V: verdadeiro. O ácido linoléico é um ácido graxo essencial da série ômega 6, sendo de origem vegetal e fundamental ao bom
funcionamento (resistência e permeabilidade) dos capilares sangüíneos.

31.
Resposta: B
Comentário: É muito comum referir-se ao valor energético dos alimentos pela quantidade de calorias de energia (kcal) que ele pode
liberar. Assim, os carboidratos liberam 4,1 kcal por grama, os lipídios liberam 9,3 kcal por grama e as proteínas liberam 4,1 kcal por
grama. Lipídios liberam mais energia por se apresentarem mais reduzidos, ou seja, têm mais elétrons a serem liberados para gerar
energia em processos oxidativos como a cadeia transportadora de elétrons da respiração aeróbica. De modo simplificado, pode-se
argumentar que os ácidos graxos, por serem compostos de acetil-coA, fornecem mais acetil-coA que a glicose. Com mais moléculas
de acetil-coA no ciclo de Krebs, mais elétrons são liberados para a produção de energia na cadeia respiratória. Assim os lipídios são a
reserva de energia em longo prazo para os animais, uma vez que acumulam mais energia por unidade de massa, sendo mais leves e
facilitando a locomoção.

32.
Resposta: B
Comentário: As gorduras são nutrientes de função energética que são metabolizadas no processo de gliconeogênese. Nesse processo,
elas são primeiros digeridas em ácidos graxos e glicerol, e posteriormente, os ácidos graxos passam pelo processo de β-oxidação em
organelas denominadas de peroxissomos, quando são então convertidos em acetil-coA. Esse composto entra na respiração aeróbica
diretamente no ciclo de Krebs e na cadeia respiratória, sendo então degradado para gerar energia química na forma de ATP. Como
subprodutos, assim, como se dá no consumo de carboidratos, têm-se gás carbônico e água.

33.
Resposta: VVFFF
Comentário:
1º item: verdadeiro. Diabetes, dieta inadequada (rica em gordura, colesterol e sal e pobre em fibras e vitaminas) e sedentarismo são
fatores que contribuem para o surgimento de hipertensão arterial e aterosclerose, que pro sua vez aumentam o risco do
desenvolvimento de doenças cardiovasculares.
2º item: verdadeiro. Pílulas anticoncepcionais, que são à base de hormônios sexuais femininos (estrógenos e progesterona),
fragilizam os vasos sangüíneos, aumentando o risco de ruptura dos mesmos e, conseqüentemente, do aparecimento de condições como
varizes e doenças cardiovasculares, sobretudo em indivíduos com história familiar de doenças circulatórias.
3º item: falso. A nicotina do cigarro promove a liberação de adrenalina, cujo efeito vasoconstrictor leva ao aumento da pressão
arterial, predispondo a doenças cardiovasculares como infartos, derrames e impotência.
4º item: falso. Gordura animal é a principal matéria-prima para a produção de colesterol; estresse promove a liberação de adrenalina,
cujo efeito vasoconstrictor leva ao aumento da pressão arterial; pressão alta danifica os vasos sangüíneos e favorece a instalação de
colesterol nos mesmos para a ocorrência de aterosclerose e arterioesclerose (onde o ateroma acumula cálcio, levando à perda de
elasticidade nos vasos); assim, todos os fatores predispõem à hipertensão arterial e aterosclerose; entretanto, os ateromas são de
colesterol e não de gordura (triglicerídeos).
5º item: falso. A obstrução brusca de uma artéria coronária (que irriga o coração) leva à morte das células musculares cardíacas por
falta de oxigenação, o que caracteriza o infarto do miocárdio; uma vez mortas, as células musculares cardíacas não podem ser
repostas, uma vez que o miocárdio não tem capacidade de regeneração; além disso, o sangue que passa pelos ventrículos não nutre o
miocárdio porque o endocárdio que reveste o coração por dentro (em contato com o sangue) é impermeável.

34.
Resposta:
A) Porque os altos níveis de colesterol aumentam o risco de doenças cardiovasculares. Pode-se diminuir o colesterol circulante
diminuindo a ingestão de gorduras animais e de alimentos ricos em colesterol.
B) Emulsificação dos lipídios, ou seja, fragmentação das gorduras em pequenas gotas, o que aumenta a superfície de contato com as
enzimas digestivas lipases e aumenta a eficiência da digestão.

35.
Resposta:
A) Carotenoides são lipídios derivados de hidrocarbonetos com pigmentação amarela, laranja ou vermelha, encontrados em vegetais
como batata-inglesa, cenoura e beterraba. Como por exemplo, a vitamina A. A vitamina A é encontrada na retina em associação com
proteínas específicas, sob a forma de pigmentos visuais, nos bastonetes. O retinol se oxida a retinal ou aldeído de vitamina A, que se
liga a uma proteína chamada opsina e forma rodopsina ou púrpura visual, que percebe luz fraca.
B) Controle hormonal. Testosterona, estrógenos e progesterona são exemplos.
C)
Animais: tecido conjuntivo adiposo subcutâneo.
Vegetais: sementes.

36.
Resposta:
A) O alimento 2, pois apresenta menor teor de nutrientes que podem agir como promotores do aumento da pressão arterial.
B)
- Sódio, que retém água por osmose no sangue, de modo a elevar a volemia e com isso a pressão arterial;
- Gorduras saturadas, que aumentam os teores sangüíneos de colesterol ruim e levam à formação de placas de ateromas, causando
aterosclerose, que predispõe à hipertensão arterial.

37.
Resposta:
A) 3 e 7.
B) STH da adenohipófise e cortisol do córtex adrenal.

38.
Resposta:
A)
- hormônios esteroides (hormônios sexuais e corticoides)
- participação nas membranas celulares animais
- acúmulo na forma de ateromas em vasos sanguíneos
- no fígado, o colesterol pode ser convertido em ácido cólico, e daí em sais biliares, enviados para a vesícula biliar e daí sendo
eliminado para a emulsificação de gorduras no intestino, sendo depois eliminado junto às fezes.
B)
- endógeno: 90% dele, produzido no fígado a partir das gorduras da dieta.
- exógeno: 10% dele, vindo diretamente da dieta a partir de fontes animais (pelamordedeus lembre-se que só há colesterol em
organismos animais).

39.
Resposta: Sem carboidratos, não há liberação de insulina que é estímulo para a mobilização dos excedentes nutricionais na forma de
acúmulo de lipídios no tecido adiposo.
40.
Resposta:
A)
1. sedentarismo – acúmulo de lipídios e falta de estímulo do sistema circulatório, facilitando o acúmulo de ateromas, o que causa
hipertensão
2. fumo (nicotina) – liberação de adrenalina que tem ação vasoconstrictora nas coronárias, o que causa hipertensão também.
3. sal – atrai água por osmose para o sangue, contribuindo para a retenção de líquido no sangue com consequente aumento da volemia
(volume sanguíneo circulante), o que causa hipertensão novamente.
4. estresse – reação exagerada do SNA com aumento dos níveis de adrenalina, o que acarreta arritmias cardíacas (taquicardia) e
hipertensão outra vez.
B) Contribui para a formação das placas de ateroma (depósitos de placas gordurosas na parede das artérias), diminuindo seu calibre,
reduzindo seu fluxo, propiciando a formação de coágulos, determinantes de tromboses e infartos.
1.
Resposta: D
Comentário: A ausência de alimentos de origem animal na dieta implica na ausência de proteínas integrais, as quais possuem todos
os aminoácidos essenciais, ou seja, aqueles que não podem ser produzidos pelo corpo. Assim, durante o período da promessa, a dieta
deve ser suplementada nesses aminoácidos essenciais.

2.
Resposta: D
Comentário: São reconhecidos três grupos de alimentos:
- Alimentos energéticos são aqueles usados como fonte de energia pelo corpo, correspondendo essencialmente a carboidratos e
lipídios, mas, eventualmente, a proteínas. Apesar de os lipídios serem mais energéticos, os glicídios são os primeiros a serem
consumidos pelo organismo, uma vez que a principal reação metabólica para a liberação de energia a partir dos nutrientes é a
respiração aeróbica, que começa com a glicólise, a qual usa glicose como substrato primordial. Lipídios são usados em seguida, uma
vez que são a principal substância de reserva energética animal, devendo ser convertidos em derivados de açúcar para serem utilizados
como fonte de energia. Proteínas, uma vez que são de função estrutural, só são consumidas em caso de ausência dos demais
compostos, devendo ser convertidos em derivados de açúcar para serem utilizados como fonte de energia.
- Alimentos plásticos ou construtores são aqueles de função estrutural, equivalendo às proteínas.
- Alimentos reguladores são aqueles que agem como cofatores na atividade de enzimas, como vitaminas e sais minerais.
Uma dieta bem balanceada para o humano adulto é aquela que contém cerca de 60% de carboidrato, 25% de lipídio e 15% de proteína.
Assim, analisando cada item:
Item A: falso. A base da pirâmide é composta por alimentos ricos em carboidratos (arroz, massas, pães, etc),os quais representam
uma maior fonte de energia para o organismo.
Item B: falso. Lipídios não devem ser consumidos sem restrição, uma vez que são muito calóricos e podem aumentar os níveis de
colesterol sanguíneo.
Item C: falso. Frutas são boas fontes de sais minerais e fibras, principalmente em suas cascas, mas não de lipídios.
Item D: verdadeiro. Carnes, ovos, plantas leguminosas (como soja e feijão), nozes e castanhas são excelentes fontes de proteínas,
sendo alimentos plásticos ou construtores.
Item E: falso. O leite e seus derivados são os maiores fornecedores de cálcio, mineral envolvido na formação dos ossos e dentes. O
ferro é normalmente obtido em fígado, carnes vermelhas, gema de ovos, verduras de cor verde escura e feijão, estando envolvidos na
formação de proteínas como a hemoglobina e a mioglobina.

3.
Resposta: D
Comentário: Proteínas são constituídas por moléculas de aminoácidos, nas quais ocorrem um grupo amina e um grupo ácido
simultaneamente ligados a um mesmo carbono, que também se liga a um átomo de hidrogênio e um grupo variável chamado radical
R.
NH2
|
R – C – COOH
|
H
Existem 20 tipos de aminoácidos diferentes nas proteínas, variando quanto ao radical R. Esse, por exemplo, pode conter até átomos de
enxofre, como no aminoácido cisteína. Aminoácidos se ligam por ligações peptídicas entre a hidroxila do grupo ácido de um deles e
um hidrogênio do grupo amina de outro, numa função química chamada de amida. Na formação da ligação peptídica, ocorre
desidratação intermolecular e liberação de água.

H H H
| O | O desidratação | O
R1 – C – C + R2 – C – C R1 – C – C H + H2O
| OH | OH intramolecular | | O
NH2 N NH2 N – C–C
H H | | OH
H R2

aminoácido 1 + aminoácido 2 dipeptídeo + H2O


Ao juntar vários aminoácidos por ligações peptídicas, temos a estrutura primária da proteína, que é linear. Alguns aminoácidos
próximos se ligam por pontes de hidrogênio, deixando a cadeia de aminoácidos em uma alfa-hélice, caracterizando a estrutura
secundária.

Alguns aminoácidos distantes interagem pelos seus radicais R, promovendo um dobramento tridimensional da cadeia, caracterizando a
estrutura terciária. Algumas interações que agem na formação dessa estrutura são as pontes dissulfeto, ligações covalentes entre
átomos de enxofre dos radicais R de cisteínas, mas também pode haver pontes de hidrogênio, interações hidrofóbicas e ligações sal.
Ligações
Sal

Interações
Hidrofóbicas

Em algumas proteínas, estruturas terciárias se juntam para formar a estrutura quaternária, como ocorre na hemoglobina, dotada de
quatro estruturas terciárias, duas chamadas cadeias alfa e duas chamadas cadeias beta.

A proteína alfa-queratina é o componente mais importante do fio de cabelo, bem como de pêlos e unhas, sendo alongada, com a cadeia
formando três alfa-hélices que dobram e ficam lado a lado, sendo unidas por pontes dissulfeto em uma super-hélice.
Várias moléculas de alfa-queratina se reúnem em feixes para formar o fio de cabelo.
Como o texto menciona, várias interações são quebradas quando o cabelo é exposto à água e ao calor, alterando a forma do fio
temporariamente. Entretanto, é possível alterar permanentemente a forma do fio de cabelo através de alterações químicas na proteína
alfa-queratina.
- As pontes dissulfeto são quebradas através de agentes redutores, formando radicais –SH, chamados tiol ou mercaptana;
- O fio de cabelo é mecanicamente deformado, de modo que os radicais – SH assumem novas posições;
- Finalmente, os radicais – SH são oxidados para formar novas pontes dissulfeto e consolidar a nova forma do fio.
Assim, analisando cada item:
Item A: falso. Pontes dissulfeto são ligações covalentes entre átomos de enxofre dos grupos – SH da cisteína.
Item B: falso. Pontes de hidrogênio não são ligações covalentes.
Item C: falso. A quebra das pontes dissulfeto por redução, a mudança na forma do fio, e o restabelecimento das pontes dissulfeto por
oxidação podem promover mudança permanente no fio.
Item D: verdadeiro. Como mencionado, a quebra das pontes dissulfeto pode promover a mudança permanente do foi.
Item E: falso. Redução implica em ganho de elétrons, e oxidação implica em perda de elétrons.

4.
Resposta: A
Comentário: Kwashiorkor é uma palavra de origem africana que significa "doença que afeta uma criança quando nasce outra (uma
irmã ou um irmão)". Isso ocorre porque, quando o irmão da criança nasce, ela é desmamada, perdendo assim a principal fonte de
proteínas de sua dieta, passando a assumir uma dieta basicamente vegetal, com farinha de trigo, milho ou mandioca, dependendo da
região. A doença caracteriza-se por retardo de crescimento (pela falta de proteínas, que são alimentos plásticos), cabelos e pele
descoloridos (pela falta do aminoácido tirosina, precursor da melanina, pigmento do corpo humano) e inchaço do corpo,
principalmente da barriga, devido ao acúmulo de líquido nos tecidos (com a falta de proteína, a albumina do plasma é consumida
como fonte de aminoácidos, diminuindo assim a pressão osmótica do sangue em relação aos tecidos, que passam então a atrair água
por osmose, o que por sua vez ocasiona os edemas). Quando submetidas a dietas adequadas, as crianças recuperam a albumina
sanguínea, de modo a corrigir o edema, aparentando perder peso inicialmente.

5.
Resposta: C
Comentário: A fenilcetonúria é uma doença genética caracterizada pela deficiência da enzima fenilalanina-hidroxilase, que converte
o aminoácido fenilalanina no aminoácido tirosina. Em indivíduos fenilcetonúricos, a ausência da referida enzima impede a conversão
de fenilalanina em tirosina, resultando em acúmulo de fenilalanina, o que leva a lesões neurológicas e grave retardo mental
(oligofrenia pirúvica), bem como na deficiência de tirosina, que, por ser precursor da melanina, resulta em deficiência de pigmentação.
O teste do pezinho detecta a fenilcetonúria, sendo que os indivíduos doentes devem evitar excessos de fenilalanina para evitar as
lesões neurológicas, sendo recomendada uma dieta pobre nesse aminoácido.
6.
Resposta: D
Comentário: Aminoácidos naturais são aqueles que podem ser produzidos no organismo, o que se dá no fígado pelo processo de
transaminação. Dos 20 aminoácidos que participam das proteínas, 12 deles são naturais para a espécie humana, correspondendo a
alanina, arginina, asparagina, cisteína, ácido glutâmico, glutamina, glicina, histidina, prolina, ácido aspártico, serina e tirosina.
Aminoácidos essenciais são aqueles que não podem ser produzidos no organismo. Dos 20 aminoácidos, 8 deles são essenciais para a
espécie humana, correspondendo a fenilalanina, isoleucina, leucina, lisina, metionina, treonina, triptofano e valina. Para alguns
autores, entretanto, histidina e arginina são considerados essenciais, a histidina por ser essencial para recém-nascidos, e a arginina por
ser produzida em quantidades insuficientes para as necessidades fisiológicas do organismo, sendo, por vezes, chamada de semi-
essencial.

7.
Resposta: A
Comentário: Analisando cada item:
1º item: verdadeiro. A substituição de um aminoácido em uma proteína altera sua estrutura primária e, conseqüentemente, todos os
demais níveis de estrutura protéica, que pode assim perder sua atividade; doenças genéticas originadas por mutações têm como
conseqüência a produção de proteínas deficientes por alteração de sua estrutura, sendo várias delas letais.
2º item: verdadeiro. Carotenoides são lipídios derivados de hidrocarbonetos, sendo caracteristicamente coloridos; a clorofila é um
carotenoide de cor verde associado ao magnésio, assim como o caroteno é um carotenoide de cor laranja; por serem lipídios, os
carotenoides são apolares, e, portanto, insolúveis em água e solúveis em óleos e solventes orgânicos.
3º item: verdadeiro. Esteróides são lipídios derivados do colesterol, sendo essa substância capaz de formar placas de ateroma que
levam à hipertensão arterial e consequente aumento no risco de doenças cardiovasculares.
4º item: falso. A principal substância de reserva dos vegetais é o polissacarídeo amido, enquanto fungos e animais armazenam o
polissacarídeo glicogênio; a celulose é um polissacarídeo vegetal de função estrutural, sendo encontrada na parede celular das células
vegetais.

8.
Resposta: D
Comentário: A desnaturação é a perda da estrutura espacial final (tridimensional) de uma proteína, o que leva à perda de sua
atividade. A desnaturação pelo calor se dá pela quebra das pontes de hidrogênio que mantêm sua estrutura secundária, destruindo
também suas estruturas terciária e quaternária, enquanto a desnaturação por mudança de pH (inativação) se dá pela quebra de ligações
iônicas que mantêm sua estrutura terciária, destruindo também sua estruturas quaternária. Assim, as ligações peptídicas que mantêm a
estrutura primária de uma proteína nunca são quebradas em processos de desnaturação, que sempre envolve a perda das suas estruturas
terciária e quaternária. Quando a desnaturação se dá pelo calor, quebra as pontes de hidrogênio na estrutura 2ª e é irreversível; quando
se dá por mudança de pH, quebra ligações iônicas na estrutura 3ª e é reversível. Se a proteína pode ser renaturada, é porque se trata de
desnaturação por mudança de pH, afetando a estrutura 3ª.

9.
Resposta: D
Comentário: O metabolismo dos aminoácidos no fígado se inicia com a reação de desaminação, onde há remoção do grupo amina do
mesmo, restando o grupo ácido carboxílico. Esse grupo ácido carboxílico entra no ciclo de Krebs da respiração aeróbica para ser
utilizado como fonte de energia pelo corpo, enquanto que a grupo amina, na forma de amônia, deve ser excretado por ser tóxico. No
humano, a amônia é convertida no fígado, através de um ciclo de reações conhecido como ciclo da ornitina, em uréia, um composto
menos tóxico que pode ser transportado no sangue de modo menos prejudicial ao organismo do fígado até os rins, onde é eliminado na
urina.

10.
Resposta: B
Comentário: Analisando cada item:
Item I: verdadeiro. A proteína hemoglobina promove o transporte de oxigênio no sangue; proteína ferritina e albumina promovem o
armazenamento de substâncias como ferro e aminoácidos, respectivamente; proteínas actina e miosina são as principais responsáveis
pelo movimento muscular; proteínas imunoglobulinas (anticorpos) são peça fundamental no funcionamento do sistema imune.
Item II: falso. Proteínas são macromoléculas constituídas de dezenas a milhares de aminoácidos polimerizados, atingindo pesos
moleculares que vão de milhares a milhões de Daltons.
Item III: verdadeiro. Aminoácidos formadores de proteínas têm em sua estrutura um grupo ácido carboxílico (-COOH), um grupo
amina (-NH 2 ) e um radical R que pode apresentar vários radicais orgânicos, alguns deles com enxofre.
Item IV: verdadeiro. Proteínas são os componentes orgânicos mais abundantes e versáteis das células animais, sendo que o
organismo humano apresenta cerca de 100 mil proteínas distintas.
Item V: falso. Proteínas são constituídas por 20 tipos de α-aminoácidos, variando em número, tipo e disposição de proteína para
proteína.
11.
Resposta: C
Comentário: Aminoácidos são as unidades formadoras das proteínas, contendo em sua estrutura um grupo ácido carboxílico (-
COOH), um grupo amina (-NH 2 ) e um radical R que pode apresentar vários radicais orgânicos, alguns deles com enxofre. Proteínas
são constituídas por 20 tipos de α-aminoácidos, nos quais o grupo ácido carboxílico e o grupo amina estão ligados a um mesmo
carbono (carbono α). Observe a figura abaixo:
NH2
|
R – C – COOH
|
H
Assim:
A)
aldeído

amina

B)
ácido

amida

C)
ácido
ligados a um mesmo
amina carbono: α-aminoácido

D)
amina
não ligados a um mesmo
carbono: não α-aminoácido
ácido

12.
Resposta: D
Comentário: Proteínas ingeridas na dieta são digeridas em aminoácidos, que são então absorvidos pelo corpo. O metabolismo dos
aminoácidos no fígado se inicia com a reação de desaminação, onde há remoção do grupo amina do mesmo, restando o grupo ácido
carboxílico. Esse grupo ácido carboxílico entra no ciclo de Krebs da respiração aeróbica para ser utilizado como fonte de energia pelo
corpo, enquanto que a grupo amina, na forma de amônia, deve ser excretado por ser tóxico. No humano, a amônia é convertida no
fígado, através de um ciclo de reações conhecido como ciclo da ornitina, em uréia, um composto menos tóxico que pode ser
transportado no sangue de modo menos prejudicial ao organismo do fígado até os rins, onde é eliminado na urina. Num último estágio,
a ureia pode ser convertida em ácido úrico, ainda menos tóxico, porem insolúvel. No organismo humano, a principal das excretas
nitrogenadas derivadas de proteínas/aminoácidos é a uréia.

13.
Resposta: E
Comentário: Analisando cada item:
Item A: verdadeiro. A glicose é um monossacarídeo que corresponde à principal fonte de energia para o organismo; o aumento
crônico da concentração de glicose no sangue, ou seja, da glicemia, é um indicativo de Diabetes melitus, relacionada à deficiência de
insulina (diabetes mellitus tipo 1) ou de receptores para insulina (diabetes mellitus tipo 2).
Item B: verdadeiro. O colesterol é um lipídio esteroide que pode ser obtido na dieta (cerca de 10% do colesterol corporal é exógeno)
ou produzido naturalmente pelo fígado, principalmente, e em menor grau pelo intestino (cerca de 90% do colesterol corporal é
endógeno). O colesterol é fundamental à vida animal por estabilizar as membranas celulares, por estar relacionado à síntese de
hormônios esteroides e à síntese de sais biliares.
Item C: verdadeiro. Os triglicerídeos são lipídios formados pela reação de esterificação entre o glicerol (um triálcool) e três ácidos
graxos, sendo representados por gorduras (saturadas e sólidas) e óleos (insaturados e líquidos).
Item D: verdadeiro. O ácido úrico é produzido a partir do metabolismo de aminoácidos e bases nitrogenadas. Em excesso, causa
gota, caracterizada por lesões hepáticas e articulares.
Item E: falso. A transaminação é o mecanismo pelo qual aminoácidos naturais são produzidos, o que se dá através da transformação
de outros aminoácidos. As enzimas transaminases realizam essas reações, as quais ocorrem no fígado, sendo seus exemplos a TGO
(transaminase glutâmico oxalacética) e a TGP (transaminase glutâmico pirúvica). O aumento nos teores das transaminases é indicativo
de lesões hepáticas, como ocorre nas hepatites virais.

14.
Resposta: E
Comentário: Analisando cada item:
Item A: falso. A fenilcetonúria é uma doença genética que não ocorre a metabolização do aminoácido fenilalanina, que em excesso
causa danos ao tecido nervoso. A fenilalanina é um aminoácido essencial, não podendo ser removido da dieta, de modo que os
fenilcetonúricos devem ter uma dieta reduzida, mas não ausente para esse aminoácido.
Item B: falso. Alimentos de origem animal possuem maior teor de proteína e proteínas de maior qualidade (com maior diversidade de
aminoácidos) do que alimentos de origem vegetal.
Item C: falso. As gorduras são lipídios de consistência sólida, compostos principalmente de ácidos graxos saturados, que estimulam a
produção de grandes quantidades de colesterol ruim, levando à aterosclerose (formação de placas de colesterol, que não é gordura) e
aumentando o risco de doenças cardiovasculares.
Item D: falso. O glicogênio é um polissacarídeo de reserva, sendo um polímero de glicose.
Item E: verdadeiro. Gorduras são lipídios do grupo dos triglicerídeos, sendo armazenados em animais principalmente em células do
tecido adiposo, um tipo de tecido conjuntivo frouxo que constitui fonte de reserva de energia e isolante térmico.

15.
Resposta: B
Comentário: A anemia falciforme ou siclemia é uma doença genética que se origina numa mutação no gene que codifica a cadeia β
da molécula de hemoglobina. Nessa hemoglobina alterada, ocorre substituição do 6º aminoácido da cadeia β de um ácido glutâmico
(hidrofílico) para uma valina (hidrofóbica), o que leva as várias moléculas de hemoglobina alteradas a se unirem por interações
hidrofóbicas em cadeias alongadas que tornam a hemácia alongada, em forma de foice, e facilmente hemolisável por fígado e baço.

16.
Resposta: C
Comentário: Aminoácidos são as unidades formadoras das proteínas, contendo em sua estrutura um grupo ácido carboxílico (-
COOH), um grupo amina (-NH 2 ) e um radical R que pode apresentar vários radicais orgânicos, alguns deles com enxofre. Assim, os
elementos químicos encontrados nos aminoácidos são basicamente C, H, O, N e S. Carboidratos como a celulose são
polihidroxialdeídos ou polihidroxicetonas, contendo em sua composição basicamente elementos como C, H e O. Pode-se afirmar
então que a ureia fornece nitrogênio para que as bactérias da microflora do gado produzam aminoácidos (proteínas) a partir de
carboidratos (celulose, glicose).

17.
Resposta: E
Comentário: Duas proteínas só são idênticas quando apresentam a mesma estrutura primária. Isto significa que elas devem ter o
mesmo número de aminoácidos, os mesmos tipos de aminoácidos nas mesmas quantidades de cada e a mesma seqüência de
aminoácidos. Caso alguma das condições não seja obedecida, as proteínas em análise são diferentes. Assim, apesar de as duas
proteínas terem os mesmos tipos de aminoácidos nas mesmas quantidades de cada, não se pode afirmar que são idênticas porque não
se tem informação sobre a disposição (seqüência) dos aminoácidos nas mesmas.

18.
Resposta: D
Comentário: Os aminoácidos aparecem inicialmente na natureza pela reação de produtos da fotossíntese, como o aldeído
fosfoglicérico, com a amônia (NH 3 ) proveniente do ciclo do nitrogênio. Assim, o primeiro aminoácido a se formar na natureza é o
acido glutâmico. Todos os demais são provenientes dele a partir de uma reação denominada de transaminação, que no corpo humano
ocorre no fígado.
COOH COOH COOH COOH
| | | |

| | enzima | |
R1 R2 transaminase R1 R2

aminoácido cetoácido novo novo


de radical de radical cetoácido aminoácido
R1 R2 de radical de radical
R1 R2
(aminoácido
natural)
Transaminação. Observe em negrito os grupos substituídos na reação.
COOH COOH
| |
COOH COOH
| | | |
H–C–H enzima H–C–H
| + | transaminase | + |
H–C–H H–C–H H–C–H H–C–H
| | | |
COOH H H COOH

Ácido Ácido Alanina Ácido


glutâmico pirúvico (novo α-cetoglutárico
(primeiro (cetoácido) aminoácido (novo
aminoácido formado) formado)
formado na
natureza)
Formação da alanina: um exemplo de transaminação. A reação é catalisada pelas enzimas transaminases. Observe em negrito os
grupos substituídos na reação.

19.
Resposta: A
Comentário: O metabolismo dos aminoácidos no fígado se inicia com a reação de desaminação, onde há remoção do grupo amina do
mesmo, restando o grupo ácido carboxílico. Esse grupo ácido carboxílico entra no ciclo de Krebs da respiração aeróbica para ser
utilizado como fonte de energia pelo corpo, enquanto que a grupo amina, na forma de amônia, deve ser excretado por ser tóxico. No
humano, a amônia é convertida no fígado, através de um ciclo de reações conhecido como ciclo da ornitina, em ureia, um composto
menos tóxico que pode ser transportado no sangue de modo menos prejudicial ao organismo do fígado até os rins, onde é eliminado na
urina. Segundo o texto, a alanina marcada radioativamente é desaminada em ácido pirúvico, que é então lançado na respiração celular,
podendo ser degradado em acetil-coA, que é lançado no ciclo de Krebs e utilizado como fonte de energia, ou podendo ser convertido
em glicose por gliconeogênese. Assim, a marcação radioativa será detectada em maior intensidade na glicose.

20.
Resposta: D
Comentário: Aminoácidos são as unidades formadoras das proteínas, contendo em sua estrutura um grupo ácido carboxílico (-
COOH), um grupo amina (-NH 2 ) e um radical R que pode apresentar vários radicais orgânicos, alguns deles com enxofre. Proteínas
são constituídas por 20 tipos de α-aminoácidos, nos quais o grupo ácido carboxílico e o grupo amina estão ligados a um mesmo
carbono (carbono α). Assim, tem-se o carbono α ligado a amina em 2 e o grupo carboxila em 6. A utilização de 1 ou 4 como radicais R
seria possível, de modo que possíveis combinações seriam 1, 2 e 6 ou 4, 2 e 6.

21.
Resposta: E
Comentário: Analisando cada item:
Item I: falso. Uma dieta balanceada, considerada ideal, deve fornecer a uma pessoa adulta quantidade de energia de que ela necessita
(aproximadamente 3 mil kcal/dia) distribuída em cerca de 50% a 60% de carboidratos, 25% a 35% de gorduras e cerca de 15% a 25%
de proteínas.
Item II: verdadeiro. Uma dieta protetora para uma pessoa adulta precisa fornecer, em média, cerca de 1300 kcal/dia. Menos que esta
quantidade a pessoa passará a apresentar sintomas de subnutrição.
Item III: verdadeiro. Uma dieta rica em lipídios favorece a concentração de colesterol na bile que pode tornar-se insolúvel,
favorecendo o desenvolvimento de cálculos vesiculares.
Item IV: verdadeiro. A dieta para portadores de diabetes melito deve evitar alimentos ricos em açúcares ou substituídos por similares
dietéticos somados a uma atividade física que tem papel fundamental na regulação da glicemia.

22.
Resposta: C
Comentário: Anticorpos ou imunoglobulinas são proteínas com função de defesa, e, como tal, devem ser descritas como moléculas.

23.
Resposta: C
Comentário: Uma dieta bem balanceada para o humano adulto é aquela que contém cerca de 60% de carboidrato, 25% de lipídio e
15% de proteína.
- Leite, queijo, iogurte, peixe, ovo e frango são constituídos principalmente de proteínas e lipídios, com apenas pequenos teores de
carboidratos.
- Frutas, feijão e pão são constituídos principalmente de carboidratos, com razoável teor de proteínas no feijão, mas com apenas
pequenos teores de lipídios.
- Manteiga é constituída principalmente de lipídios.
- Verduras contêm basicamente fibras.
Assim, uma dieta com leite, carne (esses dois com proteínas e lipídios), cereais, frutas (esses outros dois com carboidratos) e verduras
(esses últimos com fibras) está bem balanceada.

24.
Resposta: E
Comentário: As proteínas podem ser globulares ou fibrosas, conforme a disposição espacial final de suas estruturas.
- proteínas globulares apresentam-se como glóbulos, enoveladas. A forma destas proteínas facilita a interação com a água, de maneira
elas são solúveis em água.
- proteínas fibrosas são longas e desenroladas, apresentando-se como delgados filamentos, numa estrutura que dificulta interações com
a água, sendo as mesmas insolúveis. Como exemplos de proteínas globulares temos as histonas (que participam da constituição dos
cromos somos) e a hemoglobina, e como exemplo de proteínas fibrosas, temos a queratina dos cabelos, o colágeno dos tecidos, a
fibrina da coagulação e outras.

25.
Resposta: B
Comentário: Vacinas estimulam a produção de anticorpos, quimicamente caracterizadas como proteínas imunoglobulinas. Para a
síntese desses anticorpos, é necessária uma adequada ingestão de proteínas na dieta, uma vez que os aminoácidos obtidos nessas
proteínas serão utilizados na produção das proteínas corporais. Assim, um indivíduo vacinado, porém com uma dieta pobre em
proteínas, não terá aminoácidos para fabricar suas próprias proteínas como os anticorpos.

26.
Resposta: C
Comentário: O leite humano possui maior teor de lactose, menor teor de proteínas e maior teor de lipídios quando comparado com o
leite de macaco. Assim, a menor quantidade de proteína (de papel estrutural) implica numa deficiência de crescimento.

27.
Resposta: A
Comentário: Alimentos de origem vegetal apresentam proteínas caracterizadas do ponto de vista dietético como proteínas parciais, ou
seja, que não possuem todos os aminoácidos essenciais. Assim, a combinação de certos alimentos vegetais é interessante no sentido da
complementação de seus nutrientes, como a que ocorre no arroz com feijão. Por exemplo: o arroz é pobre no aminoácido Lisina, que é
encontrado em abundância no feijão, e o aminoácido Metionina é abundante no arroz e pouco encontrado no feijão. Assim, a
combinação dos dois fornece ao organismo todos os aminoácidos essenciais.

28.
Resposta: A
Comentário: A água é o componente mais abundante da matéria viva, tanto em animais como em plantas. Dentre os compostos
orgânicos, as proteínas são os componentes mais abundantes em células animais (Z) e os carboidratos (devido à celulose da parede
celular vegetal) são os componentes mais abundantes em células vegetais (Y).

29.
Resposta: D
Comentário:
- Ácidos nucléicos são polímeros compostos de quatro tipos de unidades monoméricas distintas, chamadas nucleotídeos (no DNA, os
nucleotídeos são de timina, adenina, citosina e guanina, e no RNA, os nucleotídeos são de uracila, adenina, citosina e guanina).
- Glicerídeos não são polímeros, sendo lipídios caracterizados como ésteres de 3 ácidos graxos com glicerol.
- Esteróides não são polímeros, sendo lipídios derivados do colesterol.
- Proteínas são polímeros compostos de vinte tipos de unidades monoméricas distintas, chamadas α-aminoácidos.
- Vitaminas não são polímeros, sendo moléculas orgânicas de composição bastante diversificada.

30.
Resposta: B
Comentário: As proteínas são polímeros de α-aminoácidos ligados entre si por ligações peptídicas (ligações covalentes do tipo amida
entre a amina de um aminoácido e a carboxila do outro aminoácido). Em cada aminoácido de um peptídio, o grupo amina e o grupo
carboxila estão envolvidos na ligação peptídica, com exceção do primeiro aminoácido de um peptídio, cuja amina está livre, sendo
chamada de amina-terminal, e do último aminoácido do peptídio, cuja carboxila está livre, sendo chamada carboxila-terminal. Assim,
se há 84 ligações peptídicas, há 85 aminoácidos ligados, 1 grupo amina-terminal (do primeiro aminoácido) e um grupo carboxila-
terminal (do ultimo aminoácido).

31.
Resposta: E
Comentário: As proteínas são polímeros de α-aminoácidos ligados entre si por ligações peptídicas (ligações covalentes do tipo amida
entre a amina de um aminoácido e a carboxila do outro aminoácido). Para cada ligação peptídica feita, ocorre a liberação de uma
molécula de água. Na quebra das proteínas em aminoácidos, a reação de hidrólise implica no consumo de uma molécula de água para
cada ligação quebrada. Assim, um tripeptídio (composto formado pela união de três aminoácidos) possui duas ligações peptídicas,
necessitando do consumo de duas moléculas de água em sua hidrólise.

32.
Resposta: E
Comentário: Proteínas ingeridas na dieta são digeridas em aminoácidos, que são então absorvidos pelo corpo. O metabolismo dos
aminoácidos no fígado se inicia com a reação de desaminação, onde há remoção do grupo amina do mesmo, restando o grupo ácido
carboxílico. Esse grupo ácido carboxílico entra no ciclo de Krebs da respiração aeróbica para ser utilizado como fonte de energia pelo
corpo, enquanto que a grupo amina, na forma de amônia, deve ser excretado por ser tóxico. No humano, a amônia é convertida no
fígado, através de um ciclo de reações conhecido como ciclo da ornitina, em uréia, um composto menos tóxico que pode ser
transportado no sangue de modo menos prejudicial ao organismo do fígado até os rins, onde é eliminado na urina. A amônia também
pode ser convertida na base nitrogenada guanina, que é então utilizada para produzir outras bases nitrogenadas, sendo seu excesso
convertido em ácido úrico, ainda menos tóxico, porem insolúvel e difícil de ser eliminado na urina, sendo reconvertido em amônia no
fígado. No organismo humano, a principal das excretas nitrogenadas derivadas de proteínas/aminoácidos é a uréia. Entretanto,
excessos de proteína podem aumentar a desaminação e a produção de acido úrico, resultando no surgimento de gota.

33.
Resposta:
A) III. É o alimento que contém a maior quantidade de carboidrato, fonte preferencial de energia para as células.
B) III. É o alimento que contém o maior teor de proteínas, natureza química dos anticorpos.
C) I. É o único que não contém colesterol, pois este é de origem animal.
D) I.

34.
Resposta:
A)
1. A glicina apresenta radical R apolar correspondendo ao hidrogênio (-H), sendo o único aminoácido sem carbono assimétrico e sem
enantiômeros:

2. A alanina apresenta radical R apolar correspondendo à metila (-CH 3 ):

3. A cisteína apresenta radical R contendo enxofre em um grupo mercaptana ou tiol (-SH):


B) Aminoácidos essenciais são aqueles que não podem ser produzidos pelo corpo, sendo obtidos na dieta; aminoácidos naturais são
aqueles que podem ser produzidos pelo corpo, sendo fabricados no figado pelo processo de transaminação.

35.
Resposta:
A) Com o nascimento do segundo filho, o primeiro é desmamado, perdendo a principal fonte de proteínas de sua dieta, que é o leite
materno. Isso leva à deficiência protéica do kwashiorkor.
B) Alimentos proteicos são plásticos ou construtores, sendo usados como fontes de aminoácidos para a produção de aminoácidos pelo
organismo.
C) A deficiência calórica exige do indivíduo o consumo de suas reservas lipídicas para fornecer energia para o metabolismo.

36.
Resposta:
A) A fenilalanina é um aminoácido essencial. Aminoácido essencial é aquele que não pode ser produzido pelo organismo, tendo de ser
obtido na dieta.
B) Porque em pessoas portadoras de fenilcetonúria, a fenilalanina não é metabolizada e se acumula, causando lesões nos neurônios e
retardo mental.

37.
Resposta:
A) A proteína albumina do sangue é consumida como fonte de aminoácidos, o que torna o sangue hipotônico em relação aos tecidos
vizinhos, que por sua vez passam a atrair água por osmose, levando a inchaços em abdome a cabeça (essa só incha na infância, uma
vez que os ossos do crânio não estão perfeitamente soldados, de modo que a maior pressão osmótica pode levar a um afastamento dos
ossos cranianos). A perda de massa muscular em pernas e braços aumenta a sensação de desproporção de abdome e cabeça.
B) Uma refeição matinal equilibrada deve conter cerca de 60% de carboidratos (pães, massas e biscoitos), 25% de lipídios (manteiga,
margarina, queijo e ovos) e 15% de proteínas (ovos, presunto, queijo e leite).

38.
Resposta:
A) Perda da atividade biológica como conseqüência da perda da estrutura espacial da proteína.
B) Nenhuma, já que a desnaturação não altera a composição em aminoácidos da proteína. A proteína estando desnaturada ou não, será
digerida do mesmo jeito, fornecendo os mesmo aminoácidos.

39.
Resposta: Os ratos do grupo II estão recebendo menos proteína que o necessário, tendo menos alimentos plásticos e apresentando,
pois, um comprimento menor, e estão recebendo menos carboidrato e mais fibra (que não tem valor calórico), tendo menos alimentos
energéticos e apresentando, pois, um peso menor. Os ratos do grupo III estão recebendo menos proteína que o necessário, tendo menos
alimentos plásticos e apresentando, pois, um comprimento menor, e estão recebendo mais carboidrato e mais gordura, tendo mais
alimentos energéticos e apresentando, pois, um peso maior.

40.
Resposta: O metabolismo dessas substâncias leva à produção de ureia, que precisa de bastante água para ser diluída a níveis não
tóxicos.
1.
Resposta: B
Comentário: Enzimas são proteínas catalíticas, aumentando a velocidade de uma reação química específica através da diminuição de
sua energia de ativação. Como as demais proteínas, são orgânicas e biodegradáveis, ou seja, capazes de serem destruídas pelo
metabolismo de algum organismo vivo.

2.
Resposta: A
Comentário: O principal mediador do processo inflamatório são substâncias denominadas prostaglandinas, produzidas a partir da
ação de enzimas ciclooxigenases (COX). Antiinflamatórios chamados esteroidais derivam do colesterol e agem bloqueando todo o
processo inflamatório, sendo muito fortes e dotados de intensos efeitos colaterais. Já os antiinflamatórios não esteroidais inibem a
COX, tendo ação e efeitos colaterais mais fracos. Os principais efeitos colaterais dos antiinflamatórios não esteroidais se dão por sua
ação na enzima COX-1, relacionada à produção de prostaglandinas de efeito protetor. Assim, as drogas que têm maior afinidade pela
enzima COX-1 inibem a produção de tais prostaglandinas protetoras, tendo efeitos colaterais mais intensos. Já aquelas drogas que têm
maior afinidade pela enzima COX-2 inibem a produção de prostaglandinas inflamatórias, tendo efeitos colaterais mais fracos e ação
antiinflamatória mais intensa. De acordo com a tabela:
Item A: verdadeiro. O piroxicam é o antiinflamatório que têm maior afinidade pela COX-1, sendo o que mais interfere na formação
de prostaglandinas protetoras.
Item B: falso. O rofecoxibe é o antiinflamatório que tem a maior afinidade pela enzima COX-2, de modo que tem o efeito
antiinflamatório mais intenso com menos efeitos colaterais.
Item C: falso. A aspirina tem maior afinidade pela enzima COX-1 do que pela enzima COX-2.
Item D: falso. O fato de o diclofenaco ocupar uma posição intermediária no esquema indica que tem afinidade igual pelas duas
enzimas (COX-1 e COX-2), tendo atividade antiinflamatória e efeitos colaterais de intensidade equivalente.
Item E: falso. O nimesulide tem maior grau de afinidade pela enzima COX-2 do que pela enzima COX-1.

3.
Resposta: C
Comentário: O sabor adocicado do milho verde é dado pela maltose, que no milho maduro é convertida em amido, de sabor neutro.
Ao mergulhar as espigas de milho verde em água fervente, as enzimas responsáveis pelo processo de conversão de glicose em amido
são desnaturadas pelo calor da fervura, impedindo a conversão da maltose em amido e preservando o sabor adocicado. O posterior
resfriamento impede a produção de mais enzimas e impede a renaturação das enzimas desnaturadas.

4.
Resposta: C
Comentário: A manutenção de alimentos em refrigeradores para evitar sua decomposição se baseia principalmente no efeito da baixa
temperatura sobre o metabolismo dos microorganismos decompositores, uma vez que, quanto mais baixa a temperatura de um sistema,
menor a velocidade das reações químicas, inclusive as reações metabólicas vitais mediadas por enzimas. Assim, em relação ao efeito
da preservação em refrigerador:
Item I: falso. O refrigerador não congela a água, mantendo a água líquida, de modo que os microorganismos decompositores
continuam dispondo de água líquida e sobrevivem no refrigerador; assim, não é a ausência de água líquida que justifica a conservação
do leite em geladeira, e sim o baixo metabolismo dos microorganismos decompositores devido à baixa temperatura.
Item II: verdadeiro. A temperatura do interior do refrigerador é inferior àquela necessária à reprodução dos microrganismos.
Item III: verdadeiro. A baixa temperatura do interior do refrigerador diminui a velocidade de transformações químicas como aquelas
relacionadas à decomposição e à rancificação.
Item IV: falso. Substâncias que acrescentadas ao alimento que dificultam a sobrevivência ou a multiplicação de microrganismos são
denominadas de conservantes, mas sua presença não tem relação alguma com o refrigerador.
Item V: verdadeiro. Além de o refrigerador diminuir a exposição do alimento ao ar onde há microrganismos, as baixas temperaturas,
como já dito, diminui a atividade metabólica dos microrganismos.

5.
Resposta: A
Comentário: Analisando cada item:
Item I: verdadeiro. Enzimas são proteínas de ação catalisadora, diminuindo a energia de ativação das reações e, com isso,
aumentando a velocidade das reações.
Item II: verdadeiro. Enzimas possuem um sítio ativo complementar aos substratos com os quais reagem, sendo específicos para esse
determinado substrato (modelo chave-fechadura).
Item III: falso. Catalisadores como as enzimas não são consumidos pela reação que catalisam, não alterando sua composição química
após a reação.
Item IV: falso. Como não são consumidas pela reação que catalisam, as enzimas podem participar várias vezes de uma mesma
reação.
6.
Resposta: A
Comentário: A velocidade de qualquer reação química duplica ou triplica a cada aumento de 10ºC da temperatura do meio. Isto
acontece porque, aumentando a temperatura, aumenta a energia das moléculas, aumentando o número de choques entre elas,
facilitando a reação e diminuindo a energia de ativação. Assim também é para as reações enzimáticas. O limite superior da tem-
peratura na qual a reação enzimática pode ocorrer é aquela temperatura que provoca a desnaturação da enzima. A partir desta
temperatura, a velocidade da reação deixa de aumentar e cai bruscamente, porque a enzima desnaturada perde sua conformação
espacial e sua atividade biológica. Para cada tipo de enzima existe uma temperatura ótima, na qual a velocidade da reação é máxima,
sem que haja desnaturação. Assim, uma vez que fotossíntese, respiração aeróbica e fermentação alcoólica são todas reações mediadas
por enzimas, todas são afetadas pela temperatura.

7.
Resposta: B
Comentário: Analisando cada item:
Item A: falso. Os catalisadores aumentam a velocidade das reações porque diminuem a energia de ativação das mesmas.
Item B: verdadeiro. Conservantes são aditivos que reduzem a velocidade das reações de deterioração dos alimentos, normalmente
por eliminar microorganismos decompositores.
Item C: falso. Segundo o texto, os venenos bloqueiam a catálise, ou seja, diminuem a eficiência do catalisador.
Item D: falso. Catalisadores como as enzimas não são consumidos pela reação que catalisam, não alterando sua composição química
após a reação.
Item E: falso. De modo geral, os catalisadores têm sua eficiência aumentada com a elevação da temperatura, mas as enzimas têm um
limite para isso, uma vez que desnaturam a partir de certa temperatura, diminuindo sua eficiência catalítica.

8.
Resposta: D
Comentário: Desnaturação é a perda da estrutura tridimensional, isto é, espacial de uma proteína, o que leva à perda de sua função
biológica. Os principais fatores que desencadeiam a desnaturação são o calor, que pode destruir pontes de hidrogênio relacionadas à
manutenção da estrutura secundária da proteína, sendo a desnaturação irreversível, e a mudança de pH, que pode destruir ligações
iônicas relacionadas à manutenção da estrutura terciária da proteína, sendo a desnaturação reversível. Assim, analisando cada item:
Item A: falso. A desnaturação da albumina pelo calor é um processo reversível.
Item B: falso. A desnaturação da proteína leva à perda de sua estrutura espacial, e consequentemente à perda da função biológica.
Item C: falso. Todas as enzimas são proteínas, sendo temperatura e pH interferem na sua atividade no organismo.
Item D: verdadeiro. Como mencionado, desnaturação da proteína leva à perda de sua estrutura espacial, o que leva à perda da sua
função.
Item E: falso. Febre alta desnatura enzima de modo irreversível, podendo levar à morte. O controle da febre impede que mais
moléculas de enzima sejam desnaturadas até o ponto em que o metabolismo cesse e o indivíduo morra.

9.
Resposta: C
Comentário: Analisando cada item:
Item A: falso. Enzimas possuem um sítio ativo complementar aos substratos com os quais reagem, sendo específicos para esse
determinado substrato (modelo chave-fechadura).
Item B: falso. Como não são consumidas pela reação que catalisam, as enzimas podem participar várias vezes de uma mesma reação.
Item C: verdadeiro. Enzimas são proteínas de ação catalisadora, diminuindo a energia de ativação das reações e, com isso,
aumentando a velocidade das reações.
Item D: falso. Enzimas diminuem a energia de ativação das reações biológicas.

10.
Resposta: C
Comentário: A velocidade de qualquer reação química duplica ou triplica a cada aumento de 10ºC da temperatura do meio. Isto
acontece porque, aumentando a temperatura, aumenta a energia das moléculas, aumentando o número de choques entre elas,
facilitando a reação e diminuindo a energia de ativação. Assim também é para as reações enzimáticas. O limite superior da tem-
peratura na qual a reação enzimática pode ocorrer é aquela temperatura que provoca a desnaturação da enzima. A partir desta
temperatura, a velocidade da reação deixa de aumentar e cai bruscamente, porque a enzima desnaturada perde sua conformação
espacial e sua atividade biológica. Para cada tipo de enzima existe uma temperatura ótima, na qual a velocidade da reação é máxima,
sem que haja desnaturação. A maioria das enzimas humanas têm sua temperatura ótima em torno de 35 a 40°C e (a temperatura do
corpo humano é em média de 37°C). Já em bactérias que vivem em fontes termais (de água quente), esta temperatura ótima das
enzimas pode ser de cerca de 70°C ou ainda mais. Assim, uma enzima que se mantém funcional (não desnatura) em temperaturas de
cerca de 90ºC deve ser de origem bacteriana.

11.
Resposta: A
Comentário: Mecanismos de retro-inibição ou feedback promovem a auto-regulação da concentração de certas substâncias. No caso
de reações enzimáticas, estão relacionados a enzimas alostéricas, dotadas, além de um sítio ativo para a ligação do substrato, de um
sítio alostérico para a ligação de substâncias moduladoras inibidoras ou ativadoras. No caso, a enzima 1 é alostérica, e a substância X
em altas concentrações age como um modulador negativo (inibidor). Assim:
- Se a quantidade de X aumentar, a enzima 1 é inibida, diminuindo a produção da substância A, e conseqüentemente da substância B,
e conseqüentemente de X;
- Se a quantidade de X diminuir, a enzima 1 volta a agir, aumentando a produção da substância A, e conseqüentemente da substância
B, e conseqüentemente de X
Pode-se então afirmar que a quantidade de X tende a ficar variando próximo a uma constante.
Item A: verdadeiro.
Item B: falso. Se o consumo de x for pequeno, este irá se acumular, aumentando em concentração e inibindo a enzima 1, que não
consumirá o substrato, que então se acumulará.
Item C: falso. Se a concentração de x diminuir, a enzima 1 estará funcional, consumindo o substrato, que não irá se acumular.
Item D: falso. Quando a concentração de x aumentar, a enzima 1 é inibida, diminuindo a produção da substância A , que não irá se
acumular.
Item E: falso. Quando o consumo de x for pequeno, este irá se acumular, aumentando em concentração e inibindo a enzima 1, que
não produzirá a substância A e conseqüentemente nem a substância B, que não irá se acumular.

12.
Resposta: B
Comentário: Enzimas são proteínas de ação catalisadora, diminuindo a energia de ativação das reações e, com isso, aumentando a
velocidade das reações. O aumento da concentração do substrato aumenta a velocidade de reação enzimática, pois leva à atividade de
maior número de moléculas de enzimas, mas só até determinado ponto (ponto de saturação), a partir do qual todas as moléculas de
enzimas do sistema estão em atividade, o que leva a velocidade de reação a atingir um valor máximo e constante. Por outro lado,
substâncias denominadas inibidores diminuem a afinidade entre enzima e substrato, diminuindo a velocidade das reações. Existem
dois tipos de inibidores:
- os inibidores competitivos competem com o substrato pelo sítio ativo da enzima; assim, em baixas concentrações de inibidores
competitivos e altas concentrações de substrato, os substratos ocupam o sítio ativo das enzimas e a atividade de inibição é baixa, e em
altas concentrações de inibidores competitivos e baixas concentrações de substrato, os inibidores ocupam o sítio ativo das enzimas e a
atividade de inibição é alta. Analise o gráfico abaixo, em forma sigmoidal (em S), que representa essa situação, com concentração fixa
do inibidor e da enzima, e concentração variável do substrato:

Velocidade
de reação

Concentração
de substrato
I II III
Na região I, com pequena concentração do substrato, a concentração do inibidor é proporcionalmente maior, de modo que a inibição é
mais intensa e a velocidade da reação é baixa; na região II, com grande concentração do substrato, a concentração do inibidor é
proporcionalmente menor, de modo que a inibição é menos intensa e a velocidade da reação é alta; na região III, com concentração
ainda maior do substrato, ocorre saturação e a velocidade da reação passa a ser constante. É importante notar o efeito do inibidor é
maior em pequenas concentrações de substrato e menor em altas concentrações de substrato.
- os inibidores não competitivos se ligam ao sítio ativo permanentemente, e diminuem igualmente a atividade enzimática em
concentrações de substrato altas ou baixas. Assim, comparando os gráficos abaixo na ausência do inibidor não competitivo (1) e na
presença do inibidor não competitivo (2):
Velocidade
de reação
1

Concentração
de substrato
Perceba que a velocidade da reação diminui como um todo com a presença do inibidor não competitivo. Desse modo, sabendo que a
curva I corresponde aos resultados obtidos na ausência de inibidores, a curva que representa a resposta obtida na presença de um
inibidor competitivo é a de número II (sendo que ela não representa a região do gráfico onde ocorre a saturação, só mostrando até o
trecho em que a concentração do substrato é alta, com consequente pequena atividade do inibidor e alta velocidade de reação) e na
presença de um não competitivo é a de número III.

13.
Resposta: B
Comentário: Enzimas são proteínas de ação catalisadora, diminuindo a energia de ativação das reações e, com isso, aumentando a
velocidade das reações. Fatores como temperatura, concentração do substrato e pH influenciam em sua atividade. O aumento na
temperatura aumenta a velocidade da reação enzimática, mas só até determinado ponto (ponto de desnaturação, de cerca de 40oC para
as enzimas humanas), a partir do qual ocorre desnaturação enzimática e a velocidade de reação passa a diminuir. O aumento da
concentração do substrato aumenta a velocidade de reação enzimática, pois leva à atividade de maior número de moléculas de
enzimas, mas só até determinado ponto (ponto de saturação), a partir do qual todas as moléculas de enzimas do sistema estão em
atividade, o que leva a velocidade de reação a atingir um valor máximo e constante. Cada enzima age num pH que lhe é ideal,
desnaturando fora dessa faixa de pH. Por exemplo, as enzimas que degradam dissacarídeos, como a maltase que degrada a maltose,
agem no intestino, em pH básico de 7,8 a 8,2, mas não no estômago, em pH ácido de 1,8 a 2,0. Assim:
- Fixando a concentração de substrato em X, a ação das enzimas aumenta até cerca de 40oC, quando desnaturam e diminuem de
atividade, como no experimento I (perceba que de 0oC a 40oC a velocidade aumenta de 0 para 25, mas de 40oC a 80oC a velocidade
diminui de 25 para 0);
- Enzimas humanas não agem em temperaturas acima de 40oC, de modo que não atuam em temperaturas de 80oC, como no
experimento II;
- Fixando a concentração de substrato em X, a ação das enzimas não aumenta continuamente até cerca de 80oC, como no experimento
III (perceba que de 40oC a 80oC a velocidade aumenta de 1 para 10), uma vez que ocorre desnaturação na casa dos 40oC;
- Fixando a temperatura em 40oC, a ação das enzimas aumenta com o aumento na concentração de substrato, como no experimento
IV (perceba que da concentração X para a 4X, a velocidade aumenta continuamente de 25 para 52).
Assim, os experimentos que podem corresponder à hidrólise enzimática ocorrida quando o dissacarídeo foi incubado com suco
intestinal são os de números I e IV.

14.
Resposta: C
Comentário: Enzimas são catalisadores biológicos de natureza proteica, aumentando a velocidade de reação por um fator que varia de
108 a 1011 vezes. As enzimas, por serem proteínas, agem em um pH ideal (que varia de enzima para enzima), apresentando eficiência
máxima nesse pH, mas diminuindo de atividade em pH maior ou menor devido ao fenômeno da desnaturação proteica. O
comportamento descrito para a enzima corresponde ao do gráfico IV, onde se observa que o pH ideal de ação da sacarase está entre 7
e 8 (atividade máxima da enzima). Catalisadores não proteicos como o HCl aumentam a velocidade de reação de modo menos intenso,
sendo que o HCl age em meio ácido. Assim, em baixo pH, sua ação catalítica é elevada, mas a mesma diminui com o aumento de pH,
praticamente não havendo mais ação já em pH por volta de 5, como no gráfico II.

15.
Resposta: A
Comentário: Enzimas são proteínas de ação catalisadora, diminuindo a energia de ativação das reações e, com isso, aumentando a
velocidade das reações. O aumento da concentração do substrato aumenta a velocidade de reação enzimática, pois leva à atividade de
maior número de moléculas de enzimas, mas só até determinado ponto (ponto de saturação), a partir do qual todas as moléculas de
enzimas do sistema estão em atividade, o que leva a velocidade de reação a atingir um valor máximo e constante. Segundo o gráfico,
na concentração E1 da enzima, para a concentração S1 de substrato S1, a velocidade de reação é igual a V1. Fixada a concentração do
substrato S1, ao diminuir a concentração da enzima para E2, a velocidade da reação se alterará proporcionalmente para V2. Assim,
fazendo uma regra de três:
E1 → V1
E2 → V2

V2 = V1 x E2 / E1
Desse modo, a nova velocidade, V2, seria igual ao resultado da multiplicação de V1 por E2/E1, como no item A.

16.
Resposta: C
Comentário: Uma vez que mudanças de pH promovem a desnaturação reversível (ou inativação) de proteínas e enzimas, cada enzima
age num faixa de pH que lhe é ideal. Assim:
- a pepsina (I) é a principal enzima do suco gástrico, agindo no estômago na digestão de proteínas em peptídeos e agindo em pH ideal
ácido de cerca de 1,8 a 2,0 (proporcionado pelo ácido clorídrico do suco gástrico);
- a ptialina ou amilase salivar (II) é a principal enzima da saliva, digerindo amido em maltose e agindo em pH ideal quase neutro;
- a tripsina (III) é a principal enzima do suco pancreático, agindo no duodeno na digestão de proteínas em peptídeos e agindo em pH
ideal básico de cerca de 7,8 a 8,2 (proporcionado pelo bicarbonato de sódio do suco pancreático).
Apesar do pH ideal de ação para a tripsina ser básico, sua atividade se inicia ainda em pH levemente ácido e vai até o alcalino.

17.
Resposta: E
Comentário: Enzimas são proteínas de ação catalisadora, diminuindo a energia de ativação das reações e, com isso, aumentando a
velocidade das reações. Assim:
- I é o estado energético inicial dos reagentes (substrato);
- II representa o estado de transição dos reagentes (complexo ativado ou complexo enzima-substrato), com máximo nível de energia;
- III representa a energia de ativação para desencadear a reação;
- IV representa a diferença de energia entre os estado inicial dos reagentes (substrato) e o estado final dos produtos;
- V representa o estado energético final dos produtos.
Assim, o item E está incorreto porque IV é a diferença entre a energia de reagente e produto, não tendo relação com a enzima.

18.
Resposta: E
Comentário: Enzimas são proteínas de ação catalisadora, diminuindo a energia de ativação das reações e, com isso, aumentando a
velocidade das reações. O aumento da concentração do substrato aumenta a velocidade de reação enzimática, pois leva à atividade de
maior número de moléculas de enzimas, mas só até determinado ponto (ponto de saturação), a partir do qual todas as moléculas de
enzimas do sistema estão em atividade, o que leva a velocidade de reação a atingir um valor máximo e constante. Assim:
Item I: verdadeiro. Enzimas possuem um sítio ativo complementar aos substratos com os quais reagem, sendo específicos para esse
determinado substrato (modelo chave-fechadura). Assim, se a enzima age nos substratos 1 e 3, pode-se afirmar que os mesmos são
iguais. Se a velocidade de reação é maior para o substrato 3, pode-se afirmar que concentração do substrato 3 é maior.
Item II: falso. Como mencionado acima, os substratos 1 e 3 são iguais.
Item III: falso. Como a enzima é específica e não age para o substrato 2, não adianta aumentar a concentração desse substrato que
não ocorrerá aumento na velocidade de reação.
Item IV: verdadeiro. Catalisadores como as enzimas não são consumidos pela reação que catalisam, não alterando sua composição
química após a reação; como não são consumidas pela reação que catalisam, as enzimas podem participar várias vezes de uma mesma
reação.

19.
Resposta: C
Comentário: O nome de uma enzima é dado pela adição do sufixo –ase ao nome do substrato. Como jacarés são carnívoros, a ave
estará se alimentando de restos de carne presos entre os dentes do mesmo. Assim, para digerir as proteínas (peptídios), principais
componentes orgânicos da carne, a ave necessitará de enzimas proteases (peptidases).

20.
Resposta: C
Comentário: A pelagem do gato siamês é devido a uma enzima que produz pigmento preto. Nas regiões mais quentes do corpo, a
enzima está desnaturada, de modo que o pigmento preto não é produzido, resultando em pelagem branca nessas áreas. As
extremidades do corpo perdem calor para o meio ambiente com mais facilidade e costumam, portanto, apresentar uma temperatura
inferior à do restante do corpo. Assim, nessas regiões (orelhas, focinho, pés e cauda), a enzima é funcional, resultando em uma
pelagem preta.

21.
Resposta: FFVVF
Comentário:
1º item: falso. Como enzimas são proteínas, agem em pH específico, e a atividade enzimática pode não ocorrer caso haja variações de
pH que levem à desnaturação da enzima.
2º item: falso. O aumento da concentração do substrato aumenta a atividade enzimática até um ponto máximo conhecido como ponto
de saturação.
3º item: verdadeiro. A velocidade de qualquer reação química duplica ou triplica a cada aumento de 10ºC da temperatura do meio. O
limite superior da temperatura na qual a reação enzimática pode ocorrer é aquela temperatura que provoca a desnaturação da enzima.
A partir desta temperatura, a velocidade da reação deixa de aumentar e cai bruscamente, porque a enzima desnaturada perde sua
conformação espacial e sua atividade biológica.
4º item: verdadeiro. Como já dito, enzimas agem em pH específico.
5º item: falso. Na inibição competitiva, um inibidor de forma semelhante ao substrato compete com ele pelo sítio ativo da enzima, que
é inibida de modo reversível, uma vez que aumentos na concentração do substrato fazem com haja uma retomada da reação.

22.
Resposta: Para verificar o pH ideal de funcionamento da protease para digerir a proteína da clara de ovo basta colocar clara de ovo e
protease em vários recipientes com pH’s variados. Onde houver melhor digestão, lá será o pH adequado para a protease funcionar.
Mas, como saber que houve a digestão?
- Primeiro modo: Os tubos com proteína albumina intacta apresentarão mudança de coloração quando submetidos ao aquecimento,
uma vez que a albumina (clara do ovo) crua é semi-transparente e a desnaturada é branca; nos tubos com albumina digerida
completamente, não haverá proteína, mas aminoácidos, que não desnaturam (pois não tem estrutura quaternária, terciária e secundária
a serem perdidas) e não vão ficar esbranquiçados com a presença de calor.
- Segundo modo: Na proteína intacta, não há grupos amina ou carboxila livres (uma vez que estes estão envolvidos na ligação
peptídica, uma ligação amida). Na proteína digerida, como as ligações peptídicas estarão quebradas, os grupos amina ou carboxila
estarão livres, estando susceptíveis a reações químicas de identificação de base/amina ou carboxilas/ácidos.
- Terceiro modo: A pressão osmótica de uma solução é função de seu número de partículas. Nas proteínas intactas o número de
partículas será menor que na proteína digerida (que é quebrada em vários aminoácidos). Assim, a proteína digerida em aminoácidos
terá pressão osmótica maior que a proteína não digerida, o que é verificável por um osmômetro.
- Tente imaginar outro modo!

23.
Resposta:
A) Num experimento controlado, apenas um parâmetro pode variar; se o objetivo é verificar o efeito da temperatura, o pH deve ser
mantido constante em seu valor ideal, ou seja, 2,0. Veja a tabela na figura de resolução.
B) Ao analisar as três tabelas de resultados, pode-se notar que, na coluna B, a ação da enzima aumenta com o aumento de temperatura,
até ficar constante e na coluna C, a ação da enzima aumenta progressivamente com o aumento de temperatura. Nenhum desses dois
casos corresponde ao real efeito da temperatura sobre a ação da enzima, que é descrita na coluna A: a princípio, ação aumenta, até que
com a desnaturação, a ação diminui. Observe o gráfico abaixo da tabela II na figura de resolução.
C) A temperatura ótima para que a velocidade da reação enzimática seja máxima é 40°C. Abaixo ou acima do ótimo a velocidade da
reação diminui.

24.
Resposta:
A) E é uma enzima.
B) E acelera a reação e perde a ação em grandes temperaturas, o que indica que é desnaturada.

25.
Resposta:
A) Inibição competitiva. Na inibição enzimática do tipo competitivo, o inibidor, mantido em concentração constante, exerce seu efeito
com maior intensidade em concentrações baixas de substrato. Com o aumento da concentração do substrato, devido ao efeito
competitivo, a inibição tende a diminuir. Dessa forma, em excesso de substrato, a velocidade máxima de reação é a mesma na
ausência ou na presença do inibidor.
B) Uma dentre as substâncias e respectiva função:
- sais biliares – emulsificação de gorduras durante a digestão.
- vitamina D – metabolismo do cálcio e desenvolvimento do tecido ósseo.

26.
Resposta:
A) Os amaciantes naturais e industrializados contém proteases, enzimas relacionadas com a hidrólise das proteínas fibrosas que
"endurecem" a carne. No corpo humano, a digestão das proteínas da carne tem início na cavidade gástrica, por ação da enzima
pepsina. Prossegue no duodeno, onde atua a tripsina presente no suco pancreático e é finalizada pela atividade das peptidases
existentes no suco entérico.
OBS.: As enzimas são a papaína no mamão e a bromelina no abacaxi. Nesse caso, a papaína tem vantagem sobre a bromelina, pois
não deixa gosto de mamão na carne (a bromelina deixa gosto de abacaxi).
B) O cozimento causará a desnaturação das enzimas presentes nos amaciantes. Desta forma, a carne não sofrerá qualquer efeito, pois
as enzimas desnaturadas não poderão desempenhar seu papel como catalisadores biológicos.

27.
Resposta: Porque as enzimas responsáveis pelo processo de conversão de glicose em amido são desnaturadas pela fervura e o
congelamento impede sua renaturação.

28.
Resposta: As extremidades do corpo perdem calor para o meio ambiente com mais facilidade e costumam, portanto, apresentar uma
temperatura inferior à do restante do corpo. Como a enzima só é ativa abaixo de 34°C, a síntese do pigmento que confere cor negra só
ocorrerá nas extremidades do corpo.

29.
Resposta: A hexoquinase possui uma grande afinidade pela glicose, ou seja, ela atinge a velocidade máxima com uma concentração
muito pequena de glicose. A glicoquinase exibe uma afinidade bem menor, pois somente atinge sua velocidade máxima em
concentrações bem mais altas do substrato. Logo, a enzima que contribui para a formação de glicogênio hepático é a glicoquinase,
pois esta somente produz G6P com máxima eficiência quando há excesso de glicose no sangue.

30.
Resposta: A curva da enzima B. Em uma baixa concentração relativa do substrato essa enzima produz uma velocidade de reação
maior que a da enzima A.
1.
Resposta: A
Comentário: Agentes antioxidantes como as vitaminas C e E e o selênio agem na proteção do individuo contra radicais livres.
Radicais livres são agentes oxidantes, removendo elétrons de moléculas como DNA, promovendo mutações e induzindo cânceres, ou
proteínas, desencadeando morte celular e envelhecimento. Alguns compostos presentes em alimentos, no fumo e no álcool, bem como
a exposição à radiação, podem induzir a produção de radicais livres. No entanto, a maior parte desses compostos é produzida no
organismo como subprodutos de reações oxidativas como a respiração celular nas mitocôndrias e a β-oxidação dos lipídios nos
peroxissomos, sendo esses radicais livres conhecidos como espécies ativas de oxigênio ou EAO.

2.
Resposta: C
Comentário: Vitaminas lipossolúveis (A, D, E e K) são as mais facilmente armazenadas no organismos animal, principalmente ao
nível de fígado. Vitaminas hidrossolúveis (complexo B, C e P) são facilmente eliminadas na urina, uma vez que são amplamente
solúveis em água. Assim, as vitaminas lipossolúveis não necessitam de ingestão tão frequentemente como vitaminas hidrossolúveis,
que devem ser ingeridas mais frequentemente. De acordo com a regra da química de “semelhante dissolve semelhante”, compostos
polares se dissolvem facilmente em água, de modo que as vitaminas hidrossolúveis são dotadas de grande quantidade de radicais
polares, como os grupos hidroxila (-OH). Por outro lado, ligações covalentes entre carbono e hidrogênio são praticamente apolares.
Assim, a vitamina representada pelo número III, pela sua grande quantidade de radicais hidroxila polares corresponde a uma vitamina
hidrossolúvel, sendo necessária uma ingestão mais frequente da mesma.

3.
Resposta: E
Comentário: O remédio descrito no texto é o Xenical (Orlistat), usado no tratamento da obesidade. A droga descrita age como
inibidora de lipases, de modo a impedir a digestão e a absorção de lipídios. Como efeito colateral, o usuário deixa de absorver também
vitaminas lipossolúveis (A, D, E e K), que são absorvidas normalmente junto aos lipídios da dieta.

4.
Resposta: A
Comentário: Analisando cada item:
Item I: falso. Segundo o texto, mesmo com o uso de suplementos de vitamina D, para a prevenção contra doenças cardíacas, as
pessoas precisam continuar com cuidados como não fumar, praticar exercícios e se alimentar de forma correta
Item II: verdadeiro. Vitaminas são alimentos reguladores, agindo como coenzimas ou precursores de coenzimas, sendo necessários
em pequenas quantidades na dieta e, por isso, chamados micronutrientes.
Item III: falso. O texto não menciona o mecanismo pelo qual a vitamina D age na redução dos níveis de LDL no sangue.
Item IV: verdadeiro. Segundo o texto, a prática de hábitos saudáveis, junto com o uso de vitamina D, se somam na prevenção de
doenças cardíacas.

5.
Resposta: B
Comentário: Analisando cada item:
Item A: falso. A vitamina K está relacionada com a formação de fatores da coagulação do sangue, sendo fornecida principalmente
pela microflora bacteriana e tendo sua carência relacionada a uma maior incidência de hemorragias. A vitamina A está relacionada
com a formação de pigmentos visuais (rodopsina) para a percepção de luz fraca nos bastonetes da retina, sendo encontrada como
caroteno em cenoura, abóbora e gema de ovo e tendo sua carência relacionada a cegueira noturna ou hemeralopia.
Item B: verdadeiro. A vitamina D ou calciferol está relacionada com a absorção intestinal de cálcio e fosfato, necessários à formação
de ossos e dentes, sendo fornecida pela ingestão de fígado, gema de ovo e exposição ao sol e tendo sua carência relacionada a
problemas ósseos e dentais, sendo chamada raquitismo na criança e osteomalácia no adulto.
Item C: falsa. A vitamina B9 ou ácido fólico está relacionada com a produção de bases nitrogenadas e a divisão celular, sendo
encontrada em folhas verdes e tendo sua carência relacionada a anemia e má-formação fetal (anencefalia e espinha bífida). A vitamina
C ou ácido ascórbico está relacionada a formação de colágeno para o tecido conjuntivo e é um poderoso antioxidante, sendo
encontrada em frutas cítricas e tendo sua carência relacionada ao escorbuto, com hemorragias e queda de imunidade.
Item D: falso. Como mencionado acima, a carência de vitamina D ou calciferol está relacionada a problemas ósseos, e não a
hemorragias frequentes.
Item E: falso. Como mencionado acima, a carência de vitamina C ou ácido ascórbico está relacionada ao escorbuto.

6.
Resposta: D
Comentário: Analisando cada item:
Item A: falso. A vitamina C ou ácido ascórbico age na produção de colágeno e é uma das principais antioxidantes corporais,
protegendo contra radicais livres. Sua deficiência causa escorbuto, com degeneração do colágeno e, consequentemente, dos tecidos
conjuntivos.
Item B: falso. A vitamina K age na produção dos fatores da coagulação no fígado. Sua deficiência causa dificuldade de coagulação,
com tendências hemorrágicas.
Item C: falso. A vitamina A ou retinol age como antioxidante para os epitélios e na produção de rodopsina ou púrpura visual,
pigmento visual que percebe luz fraca nos bastonetes da retina. Sua deficiência causa dermatite (inflamação da pele), xerodermia
(ressecamento da pele), xerostomia (ressecamento da boca), xeroftalmia (ressecamento dos olhos) e hemeralopia (cegueira noturna).
Item D: verdadeiro. A vitamina B12 ou cianocobalamina age na produção e maturação de bases nitrogenadas, com consequente
influência na produção de DNA na divisão celular. Sua deficiência causa anemia perniciosa, devido à diminuição da produção de
hemácias pela medula óssea.
Item E: falso. A vitamina D age na absorção intestinal de cálcio. Sua deficiência causa raquitismo na infância e osteomalácia no
adulto. O beribéri é a deficiência de vitamina B1 ou tiamina.

7.
Resposta: A
Comentário: Vitaminas lipossolúveis (A, D, E e K) são encontrados em alimentos ricos em lipídios como óleos, gorduras e
carotenóides, sendo também absorvidos somente junto aos lipídios da dieta. Assim, a ingestão de leite desnatado sem gorduras pode
levar á deficiência das referidas vitaminas.

8.
Resposta: A
Comentário: A pró-vitamina D (7-deidrocolesterol) obtida na dieta é convertida em vitamina D ativa (7-deidrocolesterol ativado) na
pele, sob influência dos raios ultra-violeta do sol. A vitamina D age como um hormônio, sendo que para isso ela inicialmente
hidroxilada no fígado em 25-hidroxicolecalciferol e depois novamente hidroxilada no fígado em 1,25-diidroxicolecalciferol, hormônio
fundamental para a absorção intestinal do cálcio da dieta para a corrente sangüínea. A falta de pró-vitamina D na dieta e/ou a falta de
exposição ao sol pode levar à deficiência de vitamina D, com conseqüente falta de cálcio para o corpo, com efeitos principalmente
ósseos, numa condição chamada de osteomalácia em adultos e raquitismo em crianças.
Item I: falso. Uma vez que a vitamina D é precursora do 25-hidroxicolecalciferol, a ausência da mesma leva a uma queda no teor da
substância mencionada.
Item II: verdadeiro. O hormônio da paratireóide (paratormônio) é necessário para a ativação da vitamina D em sua forma hormonal
de 1,25-diidroxicolecalciferol, sendo então necessário à atividade da mesma.
Item III: verdadeiro. O aumento no teor de cálcio leva à inibição do paratormônio, diminuindo a ativação da vitamina D em sua
forma hormonal de 1,25-diidroxicolecalciferol.
Item IV: falso. Como já mencionado, o aumento no teor de cálcio leva à inibição do paratormônio.

9.
Resposta: C
Comentário: Sucos de frutas possuem principalmente em sua composição água, sendo que as vitaminas hidrossolúveis como as do
complexo B e a vitamina C podem facilmente se solubilizar neles. Azeite é composto de óleos monoinsaturados, sendo que as
vitamina lipossolúveis como A, D, E e K podem facilmente se solubilizar nele.

10.
Resposta: A
Comentário: Analisando cada item:
Item A: verdadeiro. Processos energéticos oxidativos como a respiração celular nas mitocôndrias e a oxidação dos lipídios nos
peroxissomos levam à produção de água oxigenada, importante formadora de espécies ativas de oxigênio, ou seja, radicais livres que
promovem oxidação de componentes celulares, e que por isso podem danificar as paredes das artérias e predispor à aterosclerose.
Item B: falso. Ao se ganhar peso, não ocorre hiperplasia de células adiposas (aumento no número), mas hipertrofia das mesmas
(aumento do tamanho, no caso pelo acúmulo de gorduras).
Item C: falso. A ingestão acentuada de vitaminas pode trazer prejuízos à saúde, mas não contribui para a obesidade.
Item D: falso. Um valor elevado de IMC implica em sobrepeso e aumenta o risco do desenvolvimento de doenças cardiovasculares,
Item E: falso. Apesar de o patrimônio genético contribuir para a obesidade, filhos de pais obesos não necessariamente serão obesos,
uma vez que fatores externos como a composição da dieta são fundamentais na determinação do sobrepeso.

11.
Resposta: A
Comentário: Fazendo a relação:
1. O Ferro é um elemento mineral encontrado na proteína hemoglobina das hemácias, a qual tem papel de transporte de oxigênio no
sangue (ii); entre suas principais fontes estão carne vermelha, gema de ovo, verduras escuras e fígado (c).
2. O Sódio é um elemento mineral que age no equilíbrio osmótico e na geração do impulso nervoso por sua ação na origem da
polaridade de membrana com a bomba de sódio e potássio (i); entre suas principais fontes, estão os frutos do mar (d).
3. A vitamina D age na absorção intestinal de cálcio, sendo, portanto, fundamental para a formação dos ossos (iv); entre suas
principais fontes estão os óleos vegetais e de peixe (a).
4. O Enxofre é um elemento que entra na formação de alguns aminoácidos como a cisteína, e, consequentemente, de proteínas (iii);
entre suas principais fontes estão vegetais como feijão e repolho (b).

12.
Resposta: D
Comentário: O ácido ascórbico ou vitamina C é uma vitamina hidrossolúvel essencial à síntese da proteína colágeno e que age como
a principal vitamina antioxidante no corpo humano. Sua ação antioxidante em ceder elétrons facilita a conversão de íons férricos
(Fe+++) em íons ferrosos (Fe++), mais fáceis de absorver no tubo digestivo, e, por isso, a vitamina C é fundamental à absorção desse
mineral essencial. A falta de vitamina C causa escorbuto, comum em indivíduos com pequena ingestão de frutas e verduras, e
caracterizada por perda de colágeno, com fraturas ósseas e rupturas de vasos sanguíneos, com consequentes hemorragias.
Observação: A vitamina K ou menaquinona está relacionada à produção de fatores da coagulação sanguínea no fígado, e a vitamina
B6 ou piridoxina está relacionada com atividades como desaminação e transaminação em aminoácidos.

13.
Resposta: A
Comentário: A vitamina C ou ácido ascórbico é uma importante vitamina antioxidante, além de agir como fator essencial na
produção do colágeno, proteína mais abundante do corpo humano. Ela é obtida principalmente em frutos cítricos (como acerola,
laranja e limão) e verduras (como brócolis). No conjunto, o item que descreve apenas alimentos ricos em vitamina C é o item A
(acerola, brócolis e mamão).

14.
Resposta: D
Comentário: Analisando cada item:
Item I: verdadeiro. A vitamina D (7-deidrocolesterol ativado) é fundamental para a absorção intestinal do cálcio da dieta para a
corrente sanguínea; a falta de pró-vitamina D na dieta e/ou a falta de exposição ao sol pode levar à deficiência de vitamina D, com
consequente falta de cálcio para o corpo, com efeitos principalmente ósseos, numa condição chamada de osteomalácia em adultos e
raquitismo em crianças.
Item II: falso. A vitamina B9 ou ácido fólico é uma substância que é fornecida ao corpo humano pela microflora e através da dieta
especialmente por vegetais folhosos (de onde vem o nome “fólico”), e que age na síntese e maturação de bases nitrogenadas e,
consequentemente, na atividade de divisão celular. Em mulheres grávidas, sua deficiência pode acarretar o não fechamento dorsal do
tubo neural do embrião, o que pode provocar, dependendo do nível em que ocorre o não fechamento, em anencefalia ou espinha
bífida, ambas condições muito graves. Note que as frutas cítricas representam a única fonte natural de ácido fólico.
Item III: falso. A vitamina A (axeroftol ou retinol) é um importante agente antioxidante protetor de epitélios em geral, sendo que em
sua deficiência ocorre degeneração do epitélio de glândulas sebáceas, com consequente ressecação da pele (xerodermia) e de
glândulas lacrimais, com consequente ressecação dos olhos (xeroftalmia); outro efeito importante de sua deficiência está na falta de
rodopsina ou púrpura visual, pigmento visual dos bastonetes responsável pela percepção de luz de baixa intensidade, o que leva à
cegueira noturna ou hemeralopia. As enterobactérias (bactérias intestinais) não estão relacionadas à síntese de vitamina A, mas
principalmente de vitamina K.

15.
Resposta: D
Comentário: Analisando cada item:
Item A: falso. A vitamina D se apresente principalmente como vitamina D2 ou ergocalciferol, de origem vegetal, e vitamina D3 ou 7-
deidrocolesterol ativado, de origem animal. Tocoferol é o nome químico da vitamina E.
Item B: falso. A vitamina D2 ou ergocalciferol é de origem vegetal e sua deficiência causa o raquitismo em crianças e a osteomalácia
em adultos. A anemia é a deficiência de hemoglobina no sangue e está relacionada normalmente à deficiência de ferro na dieta.
Item C: falso. A vitamina D3 ou 7-deidrocolesterol ativado é de origem animal e sua deficiência causa raquitismo e osteomalácia. Em
crianças, a deficiência de vitamina D diminui a absorção de cálcio e leva à má-formação dos ossos.
Item D: verdadeiro. As principais fontes de vitamina D3 de origem animal são laticínios e gema de ovo de vitamina D2 de origem
vegetal são óleos vegetais.
Item E: falso. O precursor da vitamina D2 (pró-vitamina D2) é o ergosterol vegetal e o precursor da vitamina D3 (pró-vitamina D3) é
o 7-deidrocolesterol vegetal. TSH é um hormônio produzido pela hipófise que estimula a produção de tiroxina pela tireoide.

16.
Resposta: C
Comentário: Analisando a relação:
- A vitamina D ou 7-deidrocolesterol age na absorção intestinal de cálcio, sendo fundamental para a adequada formação de ossos e
dentes; sua deficiência causa raquitismo na infância e osteomalácia na idade adulta (1).
- A vitamina K ou menaquinona age na produção dos fatores de coagulação sanguínea no fígado; sua deficiência causa falhas de
coagulação e aumento no risco de hemorragias (2).
- A vitamina B6 ou piridoxina está relacionada com atividades como desaminação e transaminação em aminoácidos; sua deficiência
está relacionada a dermatites e à acrodinia, neurite caracterizada por dores nas extremidades como as pontas dos dedos (3).
- A vitamina B1 (tiamina) é cofator enzimático na glicólise da respiração celular; sua deficiência está relacionada ao beribéri, uma
polineurite caracterizada, dentre outros sintomas, a intensa fraqueza muscular (4)
- A vitamina B12 ou cianocobalamina está relacionada à produção de bases nitrogenadas e, consequentemente, de DNA e RNA, sendo
particularmente importante na atividade de replicação do DNA anterior aos processos de divisão celular; sua deficiência causa falhas
na produção de hemácias na medula óssea, sendo caracterizada como anemia perniciosa (5).

17.
Resposta: C
Comentário: A vitamina C (ácido ascórbico) é uma importante vitamina antioxidante, além de facilitar a absorção do ferro e estar
relacionada à produção do colágeno, proteína mais abundante do corpo humano; sua deficiência resulta numa condição denominada
escorbuto. Os principais efeitos do escorbuto decorrem da deficiência de colágeno nos tecidos conjuntivos, como na parede dos vasos
sanguíneos, levando à sua ruptura e a hemorragias, principalmente gengivais.
Observação: A vitamina K é cofator enzimático para a produção de proteínas fatores da coagulação no fígado, sendo que sua
deficiência acarreta coagulação deficiente e riscos hemorrágicos, mas essas hemorragias não são restritas a uma certa região como as
gengivas, ocorrendo indiscriminadamente no corpo todo.

18.
Resposta: B
Comentário: A vitamina A (axeroftol ou retinol) é um importante agente antioxidante protetor de epitélios em geral, sendo que em
sua deficiência ocorre degeneração do epitélio de glândulas sebáceas, com consequente ressecação da pele (xerodermia) e de
glândulas lacrimais, com consequente ressecação dos olhos (xeroftalmia); outro efeito importante de sua deficiência está na falta de
rodopsina ou púrpura visual, pigmento visual dos bastonetes responsável pela percepção de luz de baixa intensidade, o que leva à
cegueira noturna ou hemeralopia.

19.
Resposta: B
Comentário: A pró-vitamina D2 ou 7-deidrocolesterol é de origem animal e deve ser convertida, na pele, sob ação da radiação
ultravioleta do Sol, em vitamina D2 ativa ou 7-deidrocolesterol ativado, o qual age na absorção de cálcio no intestino.

20.
Resposta: D
Comentário: A vitamina B9 ou ácido fólico é uma substância que é fornecida ao corpo humano pela microflora e através da dieta
especialmente por vegetais folhosos (de onde vem o nome “fólico”), e que age na síntese e maturação de bases nitrogenadas e,
conseqüentemente, na atividade de divisão celular. Em mulheres grávidas, sua deficiência pode acarretar o não fechamento dorsal do
tubo neural do embrião, o que pode provocar, dependendo do nível em que ocorre o não fechamento, em anencefalia ou espinha
bífida, ambas condições muito graves.

21.
Resposta: B
Comentário: A vitamina B2 ou ribloflavina é obtida em fontes como leite e ovos e age no corpo humano formando a coenzima FAD,
com ação de aceptor intermediário de elétrons na respiração aeróbica. Sua carência causa dermatite, especialmente no canto da boca
(queilite ou estomatite angular) e na língua (glossite).

22.
Resposta: A
Comentário: De acordo com o texto, as vitaminas A (retinol) e D (calciferol) apresentam a função álcool (hidroxila, -OH), a vitamina
E possui a função fenol e a vitamina K possui a função cetona. Assim, identificando as funções:
Cetona

Fenol

Hidroxila (álcool)

Hidroxila (álcool)

- I apresenta cetona, sendo a vitamina K;


- II apresenta fenol, sendo a vitamina E;
- III e IV apresenta hidroxila (álcool), sendo ou a vitamina A ou a D.
Para manutenção das propriedades de coagulação do sangue, a vitamina K é necessária na produção dos fatores da coagulação, ou
seja, a representada em I.

23.
Resposta: B
Comentário: Radicais livres são espécies químicas que removem elétrons de outras moléculas, provocando sua oxidação, o que no
DNA pode levar a mutações e câncer, e em proteínas pode levar a morte celular e envelhecimento. Algumas vitaminas, como a
vitamina C (ácido ascórbico) e a vitamina E (tocoferol), podem proteger contra a ação de radicais livres, tendo ação antioxidante, ou
seja, redutora.
Observação: A ação das vitaminas antioxidantes consiste em se oxidar, cedendo elétrons para reduzir os radicais livres, de modo que
eles não mais ataquem os constituintes orgânicos do corpo.

24.
Resposta: C
Comentário: A vitamina B1 (tiamina) é cofator enzimático na glicólise da respiração celular, sendo que em sua falta ocorre acúmulo
de metabólitos por interrupção da referida via metabólica, com efeitos nocivos ao sistema nervoso, numa condição conhecida como
beribéri (polineurite). Assim:
Item A: verdadeiro. No beribéri, ocorrem sintomas como distúrbios cardíacos e fadiga muscular, que são então evitados pela
vitamina B1.
Item B: verdadeiro. Como mencionado, a vitamina B1 é coenzima da glicólise da respiração celular.
Item C: falso. A vitamina B1 age na oxidação de carboidratos na respiração aeróbica, mas não age na gliconeogênese para a oxidação
de proteínas e ácidos graxos.
Item D: verdadeiro. No beribéri, ocorrem sintomas como fadiga muscular e deficiência de coordenação motora, de modo que a
vitamina B1 contribui com a manutenção do tônus muscular (estado normal de contração dos músculos em repouso).
Item E: verdadeiro. No beribéri, ocorrem sintomas como demência, de modo que a vitamina B1 previne a degeneração das células
nervosas.

25.
Resposta: A
Comentário: A vitamina C ou ácido ascórbico age na produção da proteína colágeno, proteína mais abundante do corpo humano,
particularmente presente nos tecidos conjuntivos.

26.
Resposta: B
Comentário: A vitamina B2 (riboflavina) age no organismo como FAD (flavina-adenina-dinucleotídeo), importante coenzima da
respiração aeróbica, aumentando o metabolismo aeróbico e diminuindo o metabolismo anaeróbico (fermentação láctica) que leva ao
acúmulo de ácido láctico.

27.
Resposta: B
Comentário: Como as vitaminas agem junto às enzimas, e as enzimas agem em quantidades mínimas, as vitaminas também agem em
pequenas concentrações, sendo, pois, consideradas micronutrientes, e correspondendo a menos de 1 % das necessidades dietéticas
diárias.

28.
Resposta: D
Comentário: Radicais livres são espécies químicas com elétrons faltando em sua estrutura, de modo a retirar elétrons de outras
moléculas, promovendo sua oxidação. No caso de moléculas como DNA ou proteínas, os podem desencadear mutações, cânceres e
morte celular (com conseqüente envelhecimento). A principal origem dos radicais livres no corpo humano está nos processos
oxidativos relacionados ao metabolismo energético, que produzem muitas vezes água oxigenada (peróxido de hidrogênio ou H 2 O 2 ),
responsável pela formação de uma classe de radicais livres conhecidas como espécies ativas de oxigênio (EAO). Assim, na respiração
aeróbica, muitas vezes, ocorre produção de água oxigenada na cadeia respiratória nas mitocôndrias, bem como, no processo de β-
oxidação dos lipídios, se dá a formação de água oxigenada nos peroxissomos. (Peroxissomos produzem a enzima catalase para
degradar parte dessa água oxigenada, gerando água e gás oxigênio, utilizado na oxidação de substâncias tóxicas, que são assim
destruídas no organismo, num processo de destoxificação.) Vitaminas anti-oxidantes são vitaminas que combatem os radicais livres,
se oxidando antes que as moléculas da célula o sejam. São vitaminas anti-oxidantes as do complexo B, C, P, A e E, e, acredita-se,
essas vitaminas diminuem os riscos de cânceres e retardam o envelhecimento, apesar de não haver comprovação experimental desse
efeito. Assim:
Item 1: falso. Radicais livres surgem quando a molécula de O 2 não recebe elétrons normalmente na cadeia respiratória, resultando na
formação de água oxigenada e não de água.
Item 2: verdadeiro. Altas concentrações de oxigênio podem aumentar a quantidade de água oxigenada e, conseqüentemente, de
radicais livres produzidos nas mitocôndrias.
Item 3: verdadeiro. Como já dito, radicais livres podem levar a mutações e cânceres, apesar de poderem ser usados no combate a
microorganismos (através da água oxigenada produzida em peroxissomos de leucócitos).
Item 4: falso. Os radicais livres são produzidos como subprodutos as atividade metabólica, mas não são produzidos diretamente por
controle genético.
Item 5: verdadeiro. Acredita-se que vitaminas anti-oxidantes, por sua proteção contra radicais livres, podem ter efeitos benéficos nas
situações de esforço físico, envelhecimento e câncer, apesar da ausência de evidências experimentais.

29.
Resposta: A
Comentário: Analisando cada item:
Item I: verdadeiro. Vitaminas não são normalmente produzidas por animais, mas por vegetais, fungos e bactérias.
Item II: falso. Vitaminas são alimentos reguladores, não podendo ser usadas como componentes estruturais ou fontes de energia.
Item III: verdadeiro. Vitaminas são micronutrientes, sendo necessárias em quantidades muito pequenas.
Item IV: verdadeiro. Vitaminas agem como coenzimas ou precursores de coenzimas.

30.
Resposta: E
Comentário: A vitamina E (tocoferol) é um importante agente antioxidante protetor de músculos e de epitélios dos órgãos sexuais, se
modo que, acredita-se, sua deficiência pode levar à esterilidade e aborto. Na margarina, devido a sua ação antioxidante, atua como
conservante ao impedir a oxidação dos lipídios.

31.
Resposta: VVFF
Comentário:
1º item: verdadeiro. Vitaminas lipossolúveis como A, D, E e K só podem ser absorvidas pelo tubo digestivo junto aos lipídios da
dieta.
2º item: verdadeiro. As fibras vegetais são constituídas basicamente do polissacarídeo celulose, não sendo digeríveis nem absorvíveis
por animais, e por isso não possuindo valor nutritivo. Entretanto, sua ingestão estimula o peristaltismo (evitando constipação e câncer
intestinal) e auxilia na redução do colesterol sangüíneo.
3º item: falso. Aminoácidos só podem ser obtidos na alimentação a partir das proteínas da dieta.
4º item: falso. Vitaminas são alimentos reguladores, agindo como coenzimas ou precursores de coenzimas e não podendo ser usados
como fontes de energia pelo organismo.
32.
Resposta: VVFV
Comentário: Radicais livres são espécies químicas com elétrons faltando em sua estrutura, de modo a retirar elétrons de outras
moléculas, promovendo sua oxidação. No caso de moléculas como DNA ou proteínas, os podem desencadear mutações, cânceres e
morte celular (com conseqüente envelhecimento). A principal origem dos radicais livres no corpo humano está nos processos
oxidativos relacionados ao metabolismo energético, que produzem muitas vezes água oxigenada (peróxido de hidrogênio ou H 2 O 2 ),
responsável pela formação de uma classe de radicais livres conhecidas como espécies ativas de oxigênio (EAO). Assim, na respiração
aeróbica, muitas vezes, ocorre produção de água oxigenada na cadeia respiratória nas mitocôndrias, bem como, no processo de β-
oxidação dos lipídios, se dá a formação de água oxigenada nos peroxissomos. (Peroxissomos produzem a enzima catalase para
degradar parte dessa água oxigenada, gerando água e gás oxigênio, utilizado na oxidação de substâncias tóxicas, que são assim
destruídas no organismo, num processo de destoxificação.) Vitaminas anti-oxidantes são vitaminas que combatem os radicais livres,
se oxidando antes que as moléculas da célula o sejam. São vitaminas anti-oxidantes as do complexo B, C, P, A e E, e, acredita-se,
essas vitaminas diminuem os riscos de cânceres e retardam o envelhecimento, apesar de não haver comprovação experimental desse
efeito. Assim:
1º item: verdadeiro. Ao degradar a água oxigenada, a catalase dos peroxissomos minimiza a produção de EAO.
2º item: verdadeiro. Como são radicais livres, as EAO podem degradar várias moléculas orgânicas na celular. Vitaminas como as do
complexo B, C, P, A e E, são importantes agentes antioxidantes que podem proteger contra radicais livres e, conseqüentemente, contra
as EAO.
3º item: falso. Segundo o texto, a produção das EAO é facilitada por alimentos com componentes como gordura e ferro, ambos
presentes em quantidades desprezíveis no arroz.
4º item: verdadeiro. A água oxigenada produzida como subproduto da β-oxidação dos lipídios nos peroxissomos é um importante
fator formador de EAO.

33.
Resposta: FFVVF = 4 + 8 = 12
Comentário:
Item 1: falso. Vitaminas hidrossolúveis tendem a ser eliminadas pela urina e não se acumular no corpo, de modo que dificilmente
atingem níveis tóxicos.
Item 2: falso. Vitaminas lipossolúveis não são eliminadas pela urina e tendem a se acumular em regiões como fígado e tecido
adiposo, podendo atingir níveis tóxicos se ingeridas em excesso.
Item 4: verdadeiro. São hidrossolúveis as vitaminas do complexo B, C e P, e são lipossolúveis as vitaminas A, D, E e K.
Item 8: verdadeiro. Uma alimentação balanceada tende a fornecer todas as vitaminas de que o indivíduo precisa, sem que haja
necessidade do uso de suplementos vitamínicos.
Item 16: falso. Vitaminas anti-oxidantes são vitaminas que combatem os radicais livres, se oxidando antes que as moléculas da célula
o sejam. São vitaminas anti-oxidantes as do complexo B, C, P, A e E, e, acredita-se, essas vitaminas diminuem os riscos de cânceres e
retardam o envelhecimento, apesar de não haver comprovação experimental desse efeito. As vitaminas D e K, entretanto, não têm
ação anti-oxidante.

34.
Resposta:
A)
Doença: Anemia Ferropriva.
Medida de saúde pública: Ensinar cozinhar o feijão em panela de ferro ou com uma barra de ferro. Adicionar pó de ferro à massa da
merenda escolar.
Doença: Bócio Endêmico.
Medida de saúde pública: iodação do sal de cozinha.
B)
I.
Fator 1: Vitamina D
Fator 2: Cálcio
II.
Raquitismo: ocorre na infância
Osteomalácia: ocorre no adulto
III.
Deficiência na mineralização da matriz óssea acompanhada de deformidades no esqueleto.
C)
Edema: Decorre da deficiência de proteínas plasmáticas, principalmente de Albumina.
Infecções frequentes: Baixa produção de Anticorpos por carência de aminoácidos.
Retardo do crescimento: Deficiência da síntese do hormônio do crescimento ou carências de proteínas estruturais.

35.
Resposta: Antibióticos por via oral podem levar à morte de bactérias da microflora, que normalmente forneceriam vitaminas como a
B9, B12 e K.

36.
Resposta:
A) A hipótese I é a verdadeira.
B) Vitamina C
C) O colágeno da gelatina não apresenta todos os aminoácidos essenciais.

37.
Resposta:
A) A enzima 2,3-epoxi-redutase da vitamina K atua promovendo a redução da vitamina K da forma inativa (vit. K-O) para forma ativa
(vit. K-H2), que, por sua vez, irá participar da carboxilação da molécula de protrombina em trombina, um fator de coagulação que irá
ativar a fibrina, dando início assim à formação de uma rede fibrosa (rede de fibrina), onde as células sanguíneas, como as plaquetas,
irão aderir formando o trombo que irá estancar o sangue.
B) A vitamina K tem de ter seu consumo reduzido na vigência de uso de derivados da cumarina, pois essa vitamina compete com
esses derivados pela enzima 2,3-epoxi-redutase da vitamina K. Assim, pela figura II, na presença de vitamina K, a quantidade de
derivados da cumarina tem de ser aumentada para exercer o mesmo bloqueio enzimático.

38.
Resposta:
A) Vitaminas C e E são anti-oxidantes, de modo que se desgastam continuamente, devendo ser renovadas.
B) As vitaminas A e E diminuem de concentração mais lentamente porque são lipossolúveis e por isso mais facilmente armazenadas
no organismo em tecidos como fígado e hipoderme; as vitaminas do complexo B são hidrossolúveis e por isso mais fáceis de perder
pela urina, não se armazenando de modo significativo.

39.
Resposta:
A) Vitamina D
B) Ergosterol ou pró-vitamina D2 (7-deidrocolesterol ou pró-vitamina D3 é o precursor de origem animal)
C) Má-formações ósseas como genuvaro, genuvalgo, escoliose, cifose, lordose e peito-de-pombo, devido à não absorção de cálcio no
intestino.

40.
Resposta:
A) radicais livres agem promovendo a oxidação de moléculas orgânicas no corpo humano, como DNA e proteínas, levando a
mutações, câncer, morte celular e envelhecimento.
B) radicais livres se formam através de mecanismos como a respiração celular nas mitocôndrias das células e metabolismo de lipídios
nos peroxissomos.
1.
Resposta: C
Comentário: A molécula de DNA é formada por uma dupla hélice de polinucleotídeos unidos por pontes de hidrogênio. Ao se
replicar, as pontes de hidrogênio são quebradas e as hélices se separam, havendo o pareamento de novos nucleotídeos seguindo a regra
de pareamento entre A e T e G e C. Como cada molécula filha apresenta uma fita parental e uma fita nova, pode-se dizer que a
replicação do DNA é semiconservativa.

2.
Resposta: D
Comentário: Analisando cada item:
Item A: falso. Moléculas como DNA, RNA, enzima e aminoácidos participam do processo de produção de proteínas.
Item B: falso. Na maioria dos organismos, o fluxo de informação genética é unidirecional, no sentido DNA – RNA – proteínas.
Entretanto, nos organismos conhecidos como retrovírus, como o HIV da AIDS, ocorre uma situação particular envolvendo a ação dos
ácidos nucléicos, uma vez que o RNA viral é inicialmente transcrito em DNA através de uma enzima presente no próprio vírus,
denominada transcriptase reversa. Essa enzima toma a molécula de RNA do vírus como molde e forma uma cadeia simples de DNA.
Depois, essa cadeia simples de DNA se separa do RNA, e outra enzima atua, completando a estrutura de dupla-hélice do DNA.
Item C: falso. O DNA possui segmentos denominados genes que se constituem nas fontes de informação para a produção das
proteínas.
Item D: verdadeiro. Em organismos eucariontes, o gene no DNA é inicialmente transcrito em um pré-RNA mensageiro, que pode
ser então editado em diferentes RNA mensageiros, cada qual capaz de gerar um diferente peptídeo. Em organismos procariontes, isso
não acontece, de modo que vários genes são transcritos em um único RNA mensageiro, cada qual codificando um peptídeo.
Item E: falso. A molécula de DNA é formada por uma dupla hélice de polinucleotídeos, sendo essa aberta em eucariontes e circular
em procariontes, enquanto RNA e proteínas são moléculas de fita simples, a primeira formada por nucleotídeos e a segunda por
aminoácidos. Em alguns vírus, somente, o DNA é de fita simples e o RNA é de fita dupla.

3.
Resposta: C
Comentário: Em organismos eucariontes, o gene no DNA é inicialmente transcrito em um pré-RNA mensageiro, que pode ser então
editado em diferentes RNA mensageiros, cada qual capaz de gerar um diferente peptídeo. Assim, um mesmo gene pode ser utilizado
como base para a produção de vários peptídios. Isso justifica o fato de o tamanho do genoma (e conseqüentemente o número de genes)
não ser um indicativo exato do número de proteínas produzidas por um organismo. Isso pode ser evidenciado na tabela pelo fato de o
homem possuir um genoma menor que o do arroz, mas ainda assim produzir mais proteínas, de modo que o tamanho do genoma não é
diretamente proporcional ao número de proteínas produzidas pelo organismo.

4.
Resposta: D
Comentário: O gene é o segmento de DNA com informação para produzir um RNA capaz de ser traduzido num peptídeo, sendo que
cada molécula de DNA inclui vários genes. O conjunto de todos os genes de um organismo é conhecido como genoma. Existem,
entretanto, trechos de DNA não-codificante no material genético, ou seja, trechos de DNA sem informação para a produção de RNA
que se expressa como proteínas. Esse DNA não-codificante é por vezes chamado DNA lixo, uma vez que sua função é obscura, apesar
da existência de evidências de que produza RNA de ação reguladora. Assim, o DNA não-codificante pode ser expresso em
informações que, apesar de não serem traduzidas em sequências de proteínas, interferem no fenótipo.

5.
Resposta: E
Comentário: Em organismos eucariontes, o gene no DNA é inicialmente transcrito em um pré-RNA mensageiro, que pode ser então
editado em diferentes RNA mensageiros, cada qual capaz de gerar um diferente peptídeo. Esse mecanismo é conhecido como splicing
alternativo. Assim, um mesmo gene pode ser utilizado como base para a produção de vários peptídios. Isso justifica o fato de o
tamanho do genoma (e conseqüentemente o número de genes) não ser um indicativo exato do número de proteínas produzidas por um
organismo. Isso pode ser evidenciado na tabela pelo fato de o homem possuir um genoma menor que o do arroz, mas ainda assim
produzir mais proteínas, de modo que o tamanho do genoma não é diretamente proporcional ao número de proteínas produzidas pelo
organismo. Assim, as complexidades morfológica e fisiológica de uma espécie estão relacionadas à quantidade de proteínas, que,
devido ao splicing alternativo, não tem relação direta com o tamanho do genoma e o número de genes. Do mesmo modo, a
complexidade de um organismo não tem relação direta com seu número de genes, mas com a maior habilidade em realizar o splicing
alternativo, ou seja, de sintetizar várias proteínas a partir de um único gene.

6.
Resposta: B
Comentário: A molécula de DNA é formada por uma dupla hélice de polinucleotídeos unidos por pontes de hidrogênio entre adenina
e timina e entre citosina e guanina. Devido a essa característica, em moléculas de DNA tem-se que a quantidade de adeninas é igual à
de timinas e a quantidade de citosinas é igual à de guaninas. Desse modo, se o conteúdo de citosinas e guaninas é de 48%, o conteúdo
de adeninas e timinas é de 52%. Como a quantidade de adeninas é igual à de timinas, tem-se que a quantidade de cada uma delas é de
52% ÷ 2 = 26%.

7.
Resposta: B
Comentário: Em eucariontes, existem trechos de DNA não-codificante dentro do gene, chamados de introns, para diferenciar dos
trechos de DNA codificante dentro do gene, chamados de exons. Nesses organismos, então, o gene no DNA é inicialmente transcrito
em um pré-RNA mensageiro, passa então por um processo de edição denominado splicing, através do qual ocorre remoção dos introns
não-codificantes e união dos exons codificantes para formar um RNAm que é efetivamente traduzido em peptídio. Assim, a receita do
bolo está representando a receita da proteína, ou seja, a informação codificante dos exons dentro das letras em disposição aleatória, ou
seja, a informação não-codificante dos introns.

8.
Resposta: A
Comentário: Na replicação do DNA, as pontes de hidrogênio entre as duas fitas são quebradas pela enzima DNA helicase, expondo
as bases nitrogenadas de ambas as fitas. No ponto de abertura da dupla-hélice, ela assume uma configuração em forma de Y conhecida
como “forquilha de replicação”. A partir daí, a enzima DNA polimerase adiciona novos nucleotídeos às bases expostas, seguindo a
regra de pareamento entre adenina e timina e entre guanina e citosina. Se as enzimas que agem na replicação do DNA iniciassem o
processo numa das extremidades da dupla-hélice e prosseguissem até a outra extremidade, o processo de replicação seria muito lento,
considerando o longo comprimento da molécula de DNA, dificultando os processos de divisão celular. Assim, para acelerar o
processo, a replicação ocorre com duas propriedades especiais:
- ocorrência de múltiplos locais de origem, ou seja, ocorrência de vários sítios de origem de replicação onde conjuntos de enzimas
agem simultaneamente para iniciar o processo de síntese;
- bidirecionalidade, ou seja, ocorrência de conjuntos de enzimas agindo nos dois sentidos a partir de cada sítio de origem de
replicação, formando “bolhas de replicação”.
Assim, na figura B, a existência de uma única forquilha de replicação indica a existência de um único local de origem com as enzimas
agindo de modo unidirecional, o que tornaria a replicação demasiadamente demorada. Já na figura A, a existência de várias bolhas de
replicação indica a existência de vários locais de origem com as enzimas agindo de modo bidirecional, o que tornaria a replicação
mais rápida e compatível com os processos vitais.

9.
Resposta: C
Comentário: A molécula de DNA é formada por uma dupla hélice de polinucleotídeos, enquanto o RNA é formado por uma fita
simples de polinucleotídeos. Em alguns vírus, somente, o DNA é de fita simples e o RNA é de fita dupla. Nas moléculas de dupla fita,
esta é mantida por pontes de hidrogênio que somente podem se formar entre guanina e citosina e entre adenina e timina (no DNA) ou
uracila (no RNA), de modo que nas moléculas bicatenárias, pode-se afirmar que os teores de G = C e A = T ou U. Nas moléculas de
fita simples, não ocorre esse pareamento por pontes de hidrogênio, de modo que não há G ≠ C e A ≠ T ou U. No caso em questão, se o
ácido nucleico contém timina é por que se trata de DNA, mas como G = 20% ≠ C = 40% e A = 30% ≠ T = 10%, trata-se de uma
molécula de fita simples, que apenas pode pertencer a um vírus.

10.
Resposta: E
Comentário: Cada molécula de DNA é formada por uma dupla cadeia de polinucleotídeos unidas por pontes de hidrogênio entre
adenina e timina e entre guanina e citosina. As duas cadeias se organizam de modo antiparalelo, ou seja, se uma das cadeias se inicia
com o grupo fosfato (extremidade 5’) do nucleotídeo e termina com a pentose (extremidade 3’) do nucleotídeo, a outra cadeia se inicia
com a pentose (extremidade 3’) do nucleotídeo e termina com o grupo fosfato (extremidade 5’) do nucleotídeo. Na replicação do
DNA, as pontes de hidrogênio entre as duas fitas são quebradas pela enzima DNA helicase, expondo as bases nitrogenadas de ambas
as fitas. No ponto de abertura da dupla-hélice, ela assume uma configuração em forma de Y conhecida como “forquilha de
replicação”. Em seguida, a enzima DNA primase adiciona um primer de RNA complementar em orientação antiparalela à cadeia
molde de DNA. Então, a enzima DNA polimerase adiciona novos nucleotídeos complementares à cadeia molde de DNA, sempre
ligando os novos nucleotídeos na cadeia em formação pelo grupo fosfato (extremidade 3’) do nucleotídeo e em orientação antiparalela
à cadeia molde de DNA. Se as enzimas que agem na replicação do DNA iniciassem o processo numa das extremidades da dupla-
hélice e prosseguissem até a outra extremidade, o processo de replicação seria muito lento, considerando o longo comprimento da
molécula de DNA, dificultando os processos de divisão celular. Assim, para acelerar o processo, a replicação ocorre com duas
propriedades especiais:
- ocorrência de múltiplos locais de origem, ou seja, ocorrência de vários sítios de origem de replicação onde conjuntos de enzimas
agem simultaneamente para iniciar o processo de síntese;
- bidirecionalidade, ou seja, ocorrência de conjuntos de enzimas agindo nos dois sentidos a partir de cada sítio de origem de
replicação, formando “bolhas de replicação”.
O gene é o segmento de DNA com informação para produzir um RNAm capaz de ser traduzido num peptídeo. A produção do RNAm,
denominada transcrição, envolve a enzima RNA polimerase, que adiciona novos nucleotídeos complementares ao gene no DNA,
sempre ligando os novos nucleotídeos na cadeia em formação pelo grupo fosfato (extremidade 3’) do nucleotídeo e em orientação
antiparalela à cadeia molde de DNA. Assim, analisando cada item:
Item I: verdadeiro. Tanto a replicação quanto a transcrição, em seu início, implicam na implicam na disponibilidade de um DNA
molde e de nucleotídeos de RNA (no caso da replicação do DNA porque ela se inicia pela produção da seqüência primer pela enzima
DNA primase, que é constituída de RNA).
Item II: verdadeiro. A replicação do DNA tem múltiplos locais de origem, ocorrendo simultaneamente, em vários trechos na
molécula-mãe do DNA, e a transcrição também pode ocorrer em vários genes simultaneamente, com uma enzima RNA polimerase
transcrevendo cada gene (constituído por apenas uma das fitas de DNA naquele trecho da dupla-hélice de DNA).
Item III: verdadeiro. O princípio do antiparalelismo na montagem das cadeias nucleotídicas é observado na replicação do DNA e na
transcrição, sempre com as cadeias em formação em orientação inversa à cadeia molde de DNA.
Item IV: verdadeiro. Tanto no início da replicação como no da transcrição, há a necessária participação de uma RNA polimerase,
uma vez que a replicação do DNA se inicia com a produção do primer de RNA pela enzima DNA primase, que pode ser considerada
um tipo de enzima RNA polimerase.
Item V: verdadeiro. Os sítios de ligação das enzimas DNA e RNA polimerases são chamados promotores, enquanto os sítios de
desligamento das enzimas citadas são chamados de seqüências de término.

11.
Resposta: B
Comentário: Analisando cada item:
Item A: falso. Todas as células somáticas de um organismo pluricelular apresentam o mesmo genoma, ou seja, o mesmo conjunto de
genes em seu DNA. A diferença entre as células, originada pela especialização celular, se dá pela ativação ou inativação de conjuntos
específicos de genes em cada célula, ou seja, ocorre pela diferença nos genes expressos. Entretanto, o DNA de todas as células de
todos os tecidos tem mesma composição e organização, incluindo mesmas sequências de nucleotídeos e mesmos genes, variando,
como já mencionado, o conjunto de genes expressos.
Item B: verdadeiro. O DNA lixo ou DNA não codificante corresponde a trechos de DNA cuja sequência de nucleotídeos não
codifica proteínas, mas, por vezes, produz moléculas de RNA de função reguladora. Como exemplo, temos os microRNAs, que
apresentam sequências de nucleotídeos complementares ao de certas moléculas de RNAm, de modo a ligar com os mesmos por pontes
de hidrogênio e formar moléculas de RNA de fita dupla, as quais, por sua vez, não podem ser traduzidas pelos ribossomos. Assim, os
microRNAs impedem a tradução de um certo RNAm e bloqueiam a síntese da proteína por ele codificada.
Item C: falso. O RNAm corresponde ao RNA que copia a informação do gene para que os ribossomos executem a síntese da proteína
codificada.
Item D: falso. RNA e DNA são constituídos por nucleotídeos, sendo cada nucleotídeo constituído por uma base nitrogenada (adenina,
citosina, guanina ou timina no DNA e adenina, citosina, guanina ou uracila no RNA), uma pentose (desoxirribose no DNA e ribose no
RNA) e um fosfato. O RNA apresenta uma cadeia de polinucleotídeos (fita simples) e o DNA apresenta duas cadeias de
polinucleotídeos unidas por pontes de hidrogênio (fita dupla).
Item E: falso.

12.
Resposta: B
Comentário: Em eucariontes, existem trechos de DNA não-codificante dentro do gene, chamados de introns, para diferenciar dos
trechos de DNA codificante dentro do gene, chamados de exons. Nesses organismos, então, o gene no DNA é inicialmente transcrito
em um pré-RNA mensageiro, passa então por um processo de edição denominado splicing, através do qual ocorre remoção dos introns
não-codificantes e união dos exons codificantes para formar um RNAm que é efetivamente traduzido em peptídio.

13.
Resposta: E
Comentário: Analisando cada item:
Item A: verdadeiro: Ribozimas são moléculas de RNA de ação catalítica. Segundo a Hipótese do Mundo do RNA, no início da vida
na Terra, moléculas de RNA com ação de ribozimas teriam sido o primeiro material genético na natureza, passando a partir de um
certo momento controlar a síntese de proteínas. Somente num segundo momento é que o DNA assumiu o papel de material genético
das células.
Item B: verdadeiro: Moléculas de RNA agem na transmissão da informação genética do DNA para as proteínas, através de sua ação
de RNAm, RNAr e RNAt. Em vírus com RNA como material genético, o RNA controla a reprodução através de sua capacidade
replicativa.
Item C: verdadeiro: Apesar de ser produzido no núcleo a partir do DNA, a ação do RNA como RNAm, RNAr e RNAt se dá
predominantemente no citoplasma.
Item D: verdadeiro: O RNA assume várias funções, como no RNAm que transfere a informação genética do gene para o ribossomo
sintetizar a proteína codificada, no RNAr que compõe o ribossomo e age como ribozima, e no RNAt que transporte aminoácidos para
o ribossomo sintetizar a proteína.
Item E: falso: As bases purinas são as mesmas em DNA e RNA, correspondendo a adenina e guanina; as bases pirimidinas são
diferentes em DNA e RNA, correspondendo a citosina e timina no DNA e citosina e uracila no RNA.
14.
Resposta: C
Comentário: Analisando cada item:
Item A: falso. O DNA possui segmentos denominados genes que se constituem nas fontes de informação para a produção das
proteínas. Nesse processo, o gene é transcrito em fitas simples de RNA mensageiro, que são posteriormente traduzidas pelos
ribossomos em cadeias peptídicas. A replicação do DNA é semiconservativa, ou seja, cada molécula filha contém uma fita conservada
da molécula parental e uma fita nova sintetizada a partir do molde da parental, sendo que a enzima DNA polimerase, responsável por
sintetizar a nova fita, sempre trabalha no sentido 5’3’, ou seja, adicionando novos nucleotídeos sempre na extremidade
3’(correspondente àquele com a hidroxila da pentose) da cadeia de polinucleotídeos em formação.
Item B: falso. Em eucariontes, existem trechos de DNA não-codificante dentro do gene, chamados de introns, para diferenciar dos
trechos de DNA codificante dentro do gene, chamados de exons. A maior parte do DNA corresponde a introns.
Item C: verdadeiro. Em células eucarióticas, ocorre DNA em três organelas, núcleo, mitocôndrias e cloroplastos, de modo que as três
são capazes de replicação, transcrição e tradução.
Item D: falso. Em todos os organismos celulares, a molécula de DNA é formada por uma dupla hélice de polinucleotídeos, enquanto
o RNA é formado por uma fita simples de polinucleotídeos. Em alguns vírus, somente, o DNA é de fita simples e o RNA é de fita
dupla.
Item E: falso. Em eucariontes, o DNA se associa a proteínas para formar cromossomos. Esses, durante a divisão celular, se encontram
numa forma condensada na qual é impossível o acesso da enzima RNA polimerase (responsável pela transcrição) aos genes, de modo
que não ocorre produção de RNA.

15.
Resposta: D
Comentário: Analisando cada item:
Item I: falso. O DNA é constituído por duas cadeias de polinucleotídeos (formados por nucleotídeos unidos por ligações fosfodiéster
3’5’, entre a hidroxila do carbono 3’ da pentose de um nucleotídeo e o fosfato do carbono 5’ da pentose do outro nucleotídeo). As
bases nitrogenadas dos nucleotídeos não participam da ligação fosfodiéster 3’5’, se mantendo para dentro da dupla fita e unindo a
mesma por pontes de hidrogênio entre adenina e timina e entre guanina e citosina.
Item II: verdadeiro. Como mencionado acima, no DNA, as bases nitrogenadas das duas fitas de DNA interagem através de pontes de
hidrogênio.
Item III: verdadeiro. As duas cadeias de DNA são antiparalelas, ou seja, em orientação inversa, de modo que uma delas vai do
carbono 5’ (correspondente àquele ligado ao fosfato) para o 3’ (correspondente àquele com a hidroxila da pentose) e a outra vai do
carbono 3’ para o 5’.
Item IV: falso. A dupla hélice de DNA executa um giro completo a cada cerca de 10 pares de bases.
Item V: falso. A dupla hélice de DNA possui giro para a direita, e em sua estrutura apresenta 2 sulcos ou depressões, de tamanhos
diferentes, que giram ao longo de todo o seu comprimento. O sulco menor resulta da depressão entre as duas cadeias complementares,
enquanto que o sulco maior resulta da depressão existente entre os giros adjacentes da hélice. Os sulcos são importantes porque
deixam livres superfícies para a interação entre o DNA e as proteínas.

Giro para direita

= 10
pares
de bases

Sulco menor = Sulco maior =


depressão entre depressão entre
as cadeias os giros
complementares adjacentes
16.
Resposta: A
Comentário: Em eucariontes, existem trechos de DNA não-codificante dentro do gene, chamados de introns, para diferenciar dos
trechos de DNA codificante dentro do gene, chamados de exons. Em organismos eucariontes, o gene no DNA é inicialmente transcrito
em um pré-RNA mensageiro, passa então por um processo de edição denominado splicing, através do qual ocorre remoção dos introns
não-codificantes e união dos exons codificantes para formar um RNAm que é efetivamente traduzido em peptídio. Assim, analisando
cada item:
Item I: verdadeiro. A enzima RNA polimerase é a responsável pela transcrição do gene, tanto exons como introns, em pré-RNAm.
Somente posteriormente é que ocorrerá o splicing do pré-RNAm para a remoção dos introns e formação do RNAm definitivo que será
traduzido.
Item II: verdadeiro. Como mencionado acima, o splicing é o processo que promove a remoção dos introns de uma molécula de RNA
pré-mensageiro.
Item III: verdadeiro. No splicing, um sistema denominado spliciossomo identifica, no pré-RNAm, o limite entre os introns e os dois
exons adjacentes. O spliciossomo então se liga a esse trecho, remove os introns e liga os dois exons adjacentes imediatamente entre si.
Item IV: falso. A unidade de transcrição corresponde ao segmento contínuo de DNA que é transcrito pela enzima RNA polimerase (e
não DNA polimerase). Como mencionado acima, em eucariontes, essa transcrição copia exons e introns, produzindo uma molécula
inicialmente de pré-RNAm (e não de RNAm, que só será gerado após o splicing).
Item V: falso. O splicing significa corte e colagem com a remoção dos introns de uma molécula de pré-RNAm.

17.
Resposta: C
Comentário: A replicação do DNA é semiconservativa, ou seja, cada molécula filha contém uma fita conservada da molécula
parental e uma fita nova sintetizada a partir do molde da parental. Na replicação do DNA, as pontes de hidrogênio entre as duas fitas
são quebradas pela enzima DNA helicase, expondo as bases nitrogenadas de ambas as fitas. No ponto de abertura da dupla-hélice, ela
assume uma configuração em forma de Y conhecida como “forquilha de replicação”. A partir daí, a enzima DNA polimerase adiciona
novos nucleotídeos às bases expostas, seguindo a regra de pareamento entre adenina e timina e entre guanina e citosina, sempre
trabalhando no sentido 5’3’, ou seja, adicionando novos nucleotídeos por ligações fosfodiéster 3’5’ sempre na extremidade
3’(correspondente àquele com a hidroxila da pentose) da cadeia de polinucleotídeos em formação. Se as enzimas que agem na
replicação do DNA iniciassem o processo numa das extremidades da dupla-hélice e prosseguissem até a outra extremidade, o processo
de replicação seria muito lento, considerando o longo comprimento da molécula de DNA, dificultando os processos de divisão celular.
Assim, para acelerar o processo, a replicação ocorre com duas propriedades especiais:
- ocorrência de múltiplos locais de origem, ou seja, ocorrência de vários sítios de origem de replicação onde conjuntos de enzimas
agem simultaneamente para iniciar o processo de síntese;
- bidirecionalidade, ou seja, ocorrência de conjuntos de enzimas agindo nos dois sentidos a partir de cada sítio de origem de
replicação, formando “bolhas de replicação”.
Assim, analisando cada item:
Item A: falso. Como mencionado acima, a replicação do DNA é semiconservativa e bidirecional.
Item B: falso. Como mencionado acima, a replicação do DNA se inicia em múltiplos locais de origem.
Item C: verdadeiro. Como a enzima DNA polimerase só promove o crescimento da nova fita em formação no sentido 5’3’ e as duas
fitas de DNA são antiparalelas (em orientação inversa), uma das novas fitas produzidas é contínua, sendo feita no sentido correto 5’3,
e a outra nova fita é descontínua, porque não pode ser feita no sentido 3’5’ e daí é feita em fragmentos de Okazaki, pequenos trechos
de DNA produzidos em sentido 5’3’ e então ligados entre si pela enzima DNA polimerase. Como a replicação se inicia com um
primer de RNA (sintetizado pela enzima DNA primase) a partir do qual a enzima DNA polimerase adiciona novos nucleotídeos, a
ocorrência da cadeia descontínua requer múltiplos primers de RNA, um para cada fragmento de Okazaki.
Item D: falso. Várias enzimas DNA polimerase e de outros tipos (como DNA helicase e DNA primase) são utilizadas no processo de
replicação.
Item E: falso. Devido ao comportamento da enzima DNA polimerase, os filamentos contínuo e descontínuo são sintetizados no
sentido 5’3’.

18.
Resposta: C
Comentário: O DNA é constituído por duas cadeias de polinucleotídeos (formados por nucleotídeos unidos por ligações fosfodiéster
3’5’, entre a hidroxila do carbono 3’ da pentose de um nucleotídeo e o fosfato do carbono 5’ da pentose do outro nucleotídeo). As duas
cadeias de DNA são antiparalelas, ou seja, em orientação inversa, de modo que uma delas vai do carbono 5’ (correspondente àquele
ligado ao fosfato) para o 3’ (correspondente àquele com a hidroxila da pentose) e a outra vai do carbono 3’ para o 5’. Além disso, as
duas fitas são unidas por pontes de hidrogênio entre adenina e timina e entre guanina e citosina. O princípio do antiparalelismo na
montagem das cadeias nucleotídicas é observado na replicação do DNA e na transcrição, sempre com as cadeias em formação em
orientação inversa à cadeia molde de DNA. Como a transcrição do DNA em RNA é feita de modo a parear adenina com uracila,
timina com adenina, guanina com citosina e citosina com guanina. Assim, a sequência 5’ – ACGGCTATTTAG – 3’, em um filamento
de DNA implica numa cadeia complementar de sequência 3’ – TGCCGATAAATC – 5’. Ao transcrever essa fita, o RNA apresentará
a sequência de 5’ – ACGGCUAUUUAG – 3’.

19.
Resposta: B
Comentário: Numa molécula de DNA, a quantidade de adeninas é igual à de timinas e a quantidade de guaninas é igual à de
citosinas. Assim, se na molécula em questão ocorre 24% de guanina, também ocorre 24% de citosina, num total de 48% para essas
duas bases. Desse modo, sobram 52% para dividir entre adenina e timina, ou seja, 26% para adenina e 26% para timina. Com um total
de 600 nucleotídeos, sendo 26% de timina, ocorrem 156 timinas.

20.
Resposta: A
Comentário: A molécula de DNA é constituída de nucleotídeos, sendo cada nucleotídeo constituído de um grupo fosfato (1), uma
pentose (ribose ou desoxirribose, 2) e uma base nitrogenada (adenina, citosina, guanina ou timina, 3).

21.
Resposta: C
Comentário: A molécula de ATP ou adenosina-trifosfato é quimicamente caracterizada como um nucleotídeo, apresentando em sua
estrutura uma base nitrogenada (adenina), uma pentose (ribose) e três grupos fosfatos ligados por ligações fosfoanidra de alta energia.
Assim, a figura representa o ATP, o qual é um nucleotídeo que, ao ter suas ligações fosfoanidras quebradas, libera energia para o as
reações químicas do metabolismo.

22.
Resposta: D
Comentário: O DNA é uma molécula que age armazenando informações que condicionam o aparecimento de cada característica
genética de um certo organismo, sendo que essa informação se expressa na forma de produção de proteínas. O gene é o segmento de
DNA com informação para produzir um RNA capaz de ser traduzido num peptídeo, sendo que cada molécula de DNA inclui vários
genes.

23.
Resposta: A
Comentário: O DNA é constituído por duas cadeias de polinucleotídeos (formados por nucleotídeos unidos por ligações fosfodiéster
3’5’, entre a hidroxila do carbono 3’ da pentose de um nucleotídeo e o fosfato do carbono 5’ da pentose do outro nucleotídeo). Assim,
as denominações C3’ e C5’ referem-se, na molécula, aos átomos de carbono da pentose.

24.
Resposta: D
Comentário: Analisando cada item:
Item A: falso. Nucleosídeos são moléculas constituídas pela união entre uma base nitrogenada e uma pentose, e nucleotídeos são
moléculas constituídas pela união entre uma base nitrogenada, uma pentose e um grupo fosfato. O DNA é constituído por duas cadeias
de polinucleotídeos (formados por nucleotídeos unidos por ligações fosfodiéster 3’5’, entre a hidroxila do carbono 3’ da pentose de
um nucleotídeo e o fosfato do carbono 5’ da pentose do outro nucleotídeo). As duas cadeias de DNA são antiparalelas, ou seja, em
orientação inversa, de modo que uma delas vai do carbono 5’ (correspondente àquele ligado ao fosfato) para o 3’ (correspondente
àquele com a hidroxila da pentose) e a outra vai do carbono 3’ para o 5’. Além disso, as duas fitas são unidas por pontes de hidrogênio
entre adenina e timina e entre guanina e citosina.
Item B: falso. A replicação do DNA é semiconservativa, ou seja, cada molécula filha contém uma fita conservada da molécula
parental e uma fita nova sintetizada a partir do molde da parental, sendo que a enzima DNA polimerase, responsável por sintetizar a
nova fita, sempre trabalha no sentido 5’3’, ou seja, adicionando novos nucleotídeos sempre na extremidade 3’(correspondente àquele
com a hidroxila da pentose) da cadeia de polinucleotídeos em formação.
Item C: falso. Como mencionado acima, nucleotídeos são compostos por grupos fosfato, uma pentose e uma base nitrogenada.
Item D: verdadeiro. Em eucariontes, existem trechos de DNA não-codificante dentro do gene, chamados de introns, para diferenciar
dos trechos de DNA codificante dentro do gene, chamados de exons. A maior parte do DNA corresponde a introns.
Item E: falso. O DNA possui segmentos denominados genes que se constituem nas fontes de informação para a produção das
proteínas. Nesse processo, o gene é transcrito em fitas simples de RNA mensageiro, que são posteriormente traduzidas pelos
ribossomos em cadeias peptídicas.

25.
Resposta: B
Comentário: O DNA é uma molécula que age armazenando informações que condicionam o aparecimento de cada característica
genética de um certo organismo, sendo que essa informação se expressa na forma de produção de proteínas. O gene é o segmento de
DNA com informação para produzir um RNA capaz de ser traduzido num peptídeo, sendo que cada molécula de DNA inclui vários
genes. O conjunto de todos os genes de um organismo é conhecido como genoma. Em organismos eucariontes, o gene no DNA é
inicialmente transcrito em um pré-RNA mensageiro, que pode ser então editado em diferentes RNA mensageiros, cada qual capaz de
gerar um diferente peptídeo. Esse mecanismo é conhecido como splicing alternativo. Assim, um mesmo gene pode ser utilizado como
base para a produção de vários peptídios. Isso justifica o fato de o tamanho do genoma (e consequentemente o número de genes) não
ser um indicativo exato do número de proteínas produzidas por um organismo. Isso pode ser evidenciado na tabela pelo fato de o
homem possuir um genoma menor que o do arroz, mas ainda assim produzir mais proteínas, de modo que o tamanho do genoma não é
diretamente proporcional ao número de proteínas produzidas pelo organismo. Assim, as complexidades morfológica e fisiológica de
uma espécie estão relacionadas à quantidade de proteínas, que, devido ao splicing alternativo, não tem relação direta com o tamanho
do genoma e o número de genes. Do mesmo modo, a complexidade de um organismo não tem relação direta com seu número de
genes, mas com a maior habilidade em realizar o splicing alternativo, ou seja, de sintetizar várias proteínas a partir de um único gene.

26.
Resposta: E
Comentário: O DNA é formado por unidades denominadas nucleotídeos, sendo cada um deles constituído de uma base nitrogenada
(adenina, citosina, timina ou guanina), uma desoxirribose (pentose, ou seja, açúcar de 5 átomos de carbono) e um grupo fosfato. Os
nucleotídeos se ligam por ligações fosfodiéster entre as pentoses e os fosfatos, formando polinucleotídeos. No DNA, ocorrem duas
cadeias de polinucleotídeos unidas por pontes de hidrogênio entre as bases nitrogenadas voltadas para dentro das cadeias,
obrigatoriamente entre adenina e timina e entre citosina e guanina. As duas cadeias de DNA se torcem no espaço, formando uma
dupla hélice. Essa estrutura do DNA foi descrita pelos pesquisadores Watson e Crick. Assim, analisando cada item:
Item A: falso. No modelo de Watson e Crick, os fosfatos ficam no esqueleto dos filamentos de polinucleotídeos e as bases se
localizam na parte interna da dupla hélice.
Item B: falso. No modelo de Watson e Crick, as bases são ligadas por pontes de hidrogênio, ligando as duas cadeias de
polinucleotídeos.
Item C: falso. Segundo a informação de Chargaff e Wyatt, “a razão entre as quantidades de adenina e timina e a razão entre guanina e
citosina são sempre muito próximas da unidade para o DNA”, ou seja, a razão entre adenina e timina é igual a 1, de modo que a
quantidade de adenina é igual a de timina, e a razão entre guanina e citosina é igual a 1, de modo que a quantidade de guanina é igual a
de citosina. Desse modo, analisando a dupla hélice de DNA, para cada base purina (adenina e guanina) haverá uma base pirimidina
(timina e citosina). Entretanto, dentro de uma das cadeias, a disposição de purinas e pirimidinas não segue padrão algum.
Item D: falso. O fato de Chargaff e Wyatt defenderem que a quantidade de adenina é igual a de timina e a que a quantidade de
guanina é igual a de citosina já sugere o emparelhamento específico dos nucleotídeos; os dados de Atsbury, Wilkins e Randal sobre
“helicoidização” permitiram que Watson e Crick desenvolvessem o modelo do DNA como dupla hélice.
Item E: verdadeiro. Na replicação semiconservativa de DNA, cada cadeia age como molde para a produção de uma cadeia
complementar, determinando sua sequência e garantindo a perfeita cópia do material genético.

27.
Resposta: A
Comentário: Em eucariontes, existem trechos de DNA não-codificante dentro do gene, chamados de introns, para diferenciar dos
trechos de DNA codificante dentro do gene, chamados de exons. Nesses organismos, então, Em organismos eucariontes, o gene no
DNA é inicialmente transcrito em um pré-RNA mensageiro, passa então por um processo de edição denominado splicing, através do
qual ocorre remoção dos introns não-codificantes e união dos exons codificantes para formar um RNAm que é efetivamente traduzido
em peptídio. No splicing, um sistema denominado spliciossomo, formado por pequenas molécula de RNA conhecidas como snRNA
(“pequenos RNA nucleares”) identifica, no pré-RNAm, o limite entre os introns e os dois exons adjacentes. O spliciossomo então se
liga a esse trecho, remove os introns e liga os dois exons adjacentes imediatamente entre si. Assim:
(1) A unidade de transcrição é segmento contínuo de DNA transcrito pela RNA polimerase;
(2) Na transcrição do gene com introns e exons, é formado inicialmente um pré-RNAm;
(3) Pequenas moléculas de RNA associadas a proteínas formam ribonucleoproteínas que formam...
(4) o spliciossomo responsável pelo processo de splicing...
(5) que remove os introns do pré-RNAm e forma...
(6) o RNAm somente com exons, que será finalmente traduzido.

28.
Resposta: D
Comentário: Em eucariontes, existem trechos de DNA não-codificante dentro do gene, chamados de introns, para diferenciar dos
trechos de DNA codificante dentro do gene, chamados de exons. Nesses organismos, então, o gene no DNA é inicialmente transcrito
pela enzima RNA polimerase em um pré-RNA mensageiro (1), que passa então por um processo de edição denominado splicing (2;
realizado no núcleo por um sistema denominado spliciossomo), através do qual ocorre remoção dos introns não-codificantes e união
dos exons codificantes para formar um RNAm que é efetivamente traduzido (3) em peptídio. Assim:
Item I: verdadeiro. A etapa 1 representa a transcrição, realizada pela enzima RNA polimerase, cujo sítio de ligação ao gene se chama
de região promotora.
Item II: verdadeiro. A etapa 2 representa o splicing, no qual há a retirada das regiões não codificantes (íntrons) do pré-RNAm para
formar o RNAm.
Item III: verdadeiro. A etapa 3 representa a tradução, realizada no citoplasma pelos ribossomos, onde o RNAm será traduzido em
polipeptídeo.
Item IV: falso. A diminuição do tamanho do pré-RNAm no splicing se dá pela retirada dos introns, e não dos éxons, o que é feito pelo
spliciossomo, sem relação alguma com o RNAr.

29.
Resposta: B
Comentário: O DNA é uma molécula que age armazenando informações que condicionam o aparecimento de cada característica
genética de um certo organismo, sendo que essa informação se expressa na forma de produção de proteínas. O gene é o segmento de
DNA com informação para produzir um RNA capaz de ser traduzido num peptídeo, sendo que cada molécula de DNA inclui vários
genes. O conjunto de todos os genes de um organismo é conhecido como genoma.
Em eucariontes, o DNA está associado a proteínas básicas denominadas histonas, formando estruturas denominadas cromossomos.
Segundo a Teoria Uninêmica, cada cromossomo equivale a uma única molécula de DNA, ou seja, uma única dupla-hélice de DNA.

30.
Resposta: B
Comentário: No processo de replicação (auto-duplicação) do DNA, as pontes de hidrogênio entre as duas fitas são quebradas pela
enzima DNA helicase, expondo as bases nitrogenadas de ambas as fitas. A partir daí, a enzima DNA polimerase adiciona novos
nucleotídeos às bases expostas, seguindo a regra de pareamento entre adenina e timina e entre guanina e citosina. Assim, a replicação
do DNA é semiconservativa, uma vez que cada molécula filha conserva uma cadeia do DNA parental e produz uma nova cadeia.
Desse modo, ao cultivar as bactérias em meio com timina radioativa, seu DNA se apresentará radioativo em suas duas fitas. Ao
transferir as bactérias para um meio com timina não radioativa e promover sua reprodução, o DNA das mesmas se replicará de modo
semi-conservativo, conservando a fita parental com timina radioativa e produzindo uma fita nova com nucleotídeos com timina não
radioativa, gerando moléculas híbridas (com uma fita radioativa e a outra fita não radioativa). A cada nova reprodução bacteriana,
ocorre nova replicação semi-conservativa, sempre conservando uma fita parental e produzindo uma nova fita com nucleotídeos com
timina não radioativa, como no esquema abaixo.

Geração inicial radioativa 100% com ambas as fitas


radioativas (r)
R-r
Na replicação, conserva-se as fitas parentais radioativas (r) e
Transferidas para o meio com
produz-se novas fitas com timina não radioativa (nr)
timina não radioativa

100% com uma das fitas


radioativa (r) e a outra não
radioativa (nr)
r-nr r-nr

Na replicação, conserva-se as fitas parentais e produz-se


novas fitas não radioativas

50% com uma das fitas radioativa


(r) e a outra não radioativa (nr) e
50% com ambas as fitas não
n-nr nr-nr r-nr radioativas (nr)

Na replicação, conserva-se as fitas parentais e produz-se


novas fitas não radioativas

25% com uma das fitas radioativa


(r) e a outra não radioativa (nr) e
75% com ambas as fitas não
r-nr nr-nr r-nr radioativas (nr)

Deve-se perceber que, a cada nova geração bacteriana no meio com timina não radioativa, a porcentagem de bactérias com moléculas
de DNA híbridas (com uma fita radioativa e outra fita não radioativa) se reduz à metade: de 100% na 1ª geração para 50% na 2ª
geração e 25% na 3ª geração. Assim, após a 3ª divisão, das 800 bactérias geradas, 25% delas, ou seja, 200 delas terão moléculas de
DNA híbridas com uma fita não radioativa e outra radioativa, e todas as demais terão DNA com ambas as fitas não radioativas. Como
o RNA é produzido no meio com timina não radioativa, não apresentará marcação radioativa, inclusive porque quem era radioativo no
meio original era a timina e o RNA não possui timina e sim uracila.

31.
Resposta: C
Comentário: A molécula de DNA é formada por uma dupla hélice de polinucleotídeos unidos por pontes de hidrogênio entre adenina
e timina e entre citosina e guanina. Devido a essa característica, em moléculas de DNA tem-se que a quantidade de adeninas é igual à
de timinas e a quantidade de citosinas é igual à de guaninas, ou seja:
A da fita molde = T da fita complementar;
G da fita molde = C da fita complementar;
T da fita molde = A da fita complementar;
C da fita molde = G da fita complementar;
Se em uma fita de DNA a relação (A + G)/(T + C) = 0,5, temos que (A molde + G molde )/(T molde + C molde ) = 0,5. Assim, substituindo as
bases para a fita complementar, temos que (T complementar + C complementar )/(A complementar + Gc omplementar ) = 0,5 = 1/2, ou, ao contrário,
(A complementar + Gc omplementar )/ (T complementar + C complementar ) = 2/1 = 2. Desse modo, as lacunas são preenchidas correta e respectivamente
por pontes de hidrogênio e 2,0.

32.
Resposta: C
Comentário: Os monômeros formadores dos ácidos nucléicos são estruturas denominadas nucleotídeos, compostos por:
- Uma molécula de açúcar do grupo das pentoses (monossacarídeo com cinco átomos de carbono), no caso, desoxirribose;
- Uma base nitrogenada purina (dotada de dois anéis carbônicos conjugados) ou pirimidina (dotada de um único anel carbônico); no
DNA, são purinas adenina e guanina e, pirimidinas timina e citosina;
- Ácido fosfórico, que inclusive confere o caráter ácido aos ácidos nucléicos.
Os ácidos nucléicos são formados por polinucleotídeos, polímeros de nucleotídeos. O "esqueleto" de um ácido nucléico é composto
por fosfatos e pentoses que se alternam. As bases nitrogenadas estão ligadas aos açúcares desse "esqueleto", ficando lateralmente à
cadeia de polinucleotídeos. No DNA, ocorrem duas fitas de polinucleotídeos, unidas por pontes de hidrogênio estabelecidas entre os
pares de bases. Os únicos pares possíveis são entre adenina (A) e timina (T), onde se formam 2 pontes de hidrogênio, e entre guanina
(G) e citosina (C), onde se formam 3 pontes de hidrogênio. Assim,
- como 1 tem dois anéis conjugados, é uma base purina, e como forma 3 pontes, trata-se da guanina;
- como 2 tem dois anéis conjugados, é uma base purina, e como forma 2 pontes, trata-se da adenina;
- como 3 tem um único anel, é uma base pirimidina, e como forma 2 pontes, trata-se da timina;
- como 4 faz parte do esqueleto do polinucleotídeo e está ligado ao fosfato, trata-se da desoxirribose.

33.
Resposta: D
Comentário: No processo de replicação (auto-duplicação) do DNA, as pontes de hidrogênio entre as duas fitas são quebradas pela
enzima DNA helicase, expondo as bases nitrogenadas de ambas as fitas. A partir daí, a enzima DNA polimerase adiciona novos
nucleotídeos às bases expostas, seguindo a regra de pareamento entre adenina e timina e entre guanina e citosina. Assim, a replicação
do DNA é semiconservativa, uma vez que cada molécula filha conserva uma cadeia do DNA parental e produz uma nova cadeia.
Desse modo, ao cultivar as bactérias em meio com N14, seu DNA apresentará esse isótopo em suas duas fitas. Ao transferir as
bactérias para um meio com N15 e promover sua reprodução, o DNA das mesmas se replicará de modo semi-conservativo,
conservando a fita parental com N14 e produzindo uma fita nova com nucleotídeos com N14, gerando moléculas híbridas (com uma
fita com N14 e outra com N15). A cada nova reprodução bacteriana, ocorre nova replicação semi-conservativa, sempre conservando
uma fita parental e produzindo uma nova fita com nucleotídeos com N15, como no esquema abaixo.
Geração inicial N14 100%com
100% com ambas
ambas as
as fitas
fitas
comN14
com N15
N14
N15-N15
N14-N14
Nareplicação,
Na replicação, conserva-se
conserva-se as fitas
as fitas parentais
parentais come
com N15
Transferidas para N14 eproduz-se
produz-se novas
novas fitasfitas
com com
N14 N15
meio com N15
100% com uma das fitas com
N15 e a outra com N14
N15-N14 N15-N14
Na Na
replicação,
replicação,conserva-se as fitas
conserva-se as fitasparentais
parentaise e
produz-se
produz-senovas
novas fitas comN14
fitas com N15

50% com uma das fitas com


50% com uma das fitas com
N15 e a outra com N14 e 50%
N15 e a outra com N15 e 50%
com ambas as fitas com N14
com ambas as fitas com N15
N15-N14 N15-N15
N14-N14 N15-N14

NaNa
replicação,
replicação,conserva-se asfitas
conserva-se as fitasparentais
parentaise e
produz-se
produz-se novas fitascom
novas fitas comN14 N15

25%com
25% com uma
uma das
das fitas
fitascom
com
N15ee aa outra
N15 outra com
com N15
N14ee 75%
75%
comambas
com ambas asas fitas
fitascom
com N15
N14
N15-N14 N15-N15
N14-N14 N15-N14

Deve-se perceber que, a cada nova geração bacteriana no meio com N15, a porcentagem de bactérias com moléculas de DNA híbridas
(com uma fita com N14 e outra com N15) se reduz à metade: de 100% na 1ª geração para 50% na 2ª geração e 25% na 3ª geração.
Resolução: Observe o gráfico correspondente ao resultado obtido na primeira etapa do experimento, na qual as células se
reproduziram em meio normal com N14, com 100% das moléculas de DNA com ambas as fitas com N14:

Densidade do Densidade do Densidade do


DNA com duas DNA híbrido DNA com duas
fitas com N14 N14/N15 fitas com N15
Observe o gráfico correspondente ao resultado obtido na 1ª geração desenvolvida em meio com N15, com 100% das moléculas de
DNA com uma fita com N14 e outra com N15:
Densidade do Densidade do Densidade do
DNA com duas DNA híbrido DNA com duas
fitas com N14 N14/N15 fitas com N15
Observe o gráfico correspondente ao resultado obtido na 2ª geração desenvolvida em meio com N15, com 50% das moléculas de
DNA com uma fita com N14 e outra com N15 e 50% das moléculas de DNA com ambas as fitas com N15:

Densidade do Densidade do Densidade do


DNA com duas DNA híbrido DNA com duas
fitas com N14 N14/N15 fitas com N15
Observe o gráfico correspondente ao resultado obtido na 3ª geração desenvolvida em meio com N15, com 25% das moléculas de
DNA com uma fita com N14 e outra com N15 e 75% das moléculas de DNA com ambas as fitas com N15:

Os gráficos que correspondem, respectivamente à primeira, à segunda e à terceira gerações em meio com N15 são Y, Z e X.
34.
Resposta: B
Comentário: O DNA é constituído por duas cadeias de polinucleotídeos (formados por nucleotídeos unidos por ligações fosfodiéster
3’5’, entre a hidroxila do carbono 3’ da pentose de um nucleotídeo e o fosfato do carbono 5’ da pentose do outro nucleotídeo). Assim,
ligação fosfodiéster 3’5’ tem esse nome porque a função resultante da reação entre hidroxila (da pentose) e ácido (fosfato do ácido
fosfórico) denomina-se éster.

35.
Resposta: C
Comentário: Os monômeros formadores dos ácidos nucléicos são estruturas denominadas nucleotídeos, compostos por:
- Uma molécula de açúcar do grupo das pentoses (monossacarídeo com cinco átomos de carbono);
- Uma base nitrogenada purina (dotada de dois anéis carbônicos conjugados) ou pirimidina (dotada de um único anel carbônico);
- Ácido fosfórico, que inclusive confere o caráter ácido aos ácidos nucléicos.
O termo nucleosídeo descreve a molécula formada por pentose e base nitrogenada, sem o fosfato. Os ácidos nucléicos são formados
por polinucleotídeos, polímeros de nucleotídeos. O "esqueleto" de um ácido nucléico é composto por fosfatos e pentoses que se
alternam. As bases nitrogenadas estão ligadas aos açúcares desse "esqueleto", ficando lateralmente à cadeia de polinucleotídeos. No
RNA, a pentose é a ribose, as pirimidinas são guanina e citosina e as purinas são adenina e guanina, sendo a molécula constituída de
uma única cadeia de polinucleotídeos. No DNA, a pentose é a desoxirribose, as pirimidinas são guanina e citosina e as purinas são
adenina e timina, sendo a molécula constituída de duas cadeias de polinucleotídeos. Essas são unidas por pontes de hidrogênio
estabelecidas entre os pares de bases. Os únicos pares possíveis são entre adenina (A) e timina (T), onde se formam 2 pontes de
hidrogênio, e entre guanina (G) e citosina (C), onde se formam 3 pontes de hidrogênio. Assim:
- I, II e III são grupos fosfato.
- IV é a hexose, no caso a ribose, mostrando que se trata de um ribonucleotídeo.
Observação: Como identificar que se trata de ribose? Os carbonos da pentose podem ser numerados de 1 a 5, sendo o carbono 1’
aquele que se liga à base nitrogenada e o carbono 5’ aquele que se liga ao fosfato; a contagem feita no sentido horário a partir de
então. Veja abaixo:

C5

C4 C1

C3 C2

Ribose e desoxirribose são monossacarídeos, açúcares simples com 5 carbonos, que obedecem à fórmula geral C 5 H 10 O 5 . A
desoxirribose, entretanto, foge à fórmula por ter um oxigênio a menos (“desoxi”), tendo fórmula molecular C 5 H 10 O 4 . A diferença está
no carbono 2’ da pentose, que, na ribose, tem um grupo hidroxila (- OH) e, na desoxirribose, apenas um hidrogênio (- H). Observe
que no carbono 2’ existe um grupo hidroxila, de modo que a pentose em questão é a ribose do RNA.
- V é a base nitrogenada, no caso a adenina.
Observação: Como identificar que se trata de adenina? Como 2 tem dois anéis conjugados, é uma base purina, ou seja, adenina ou
guanina, e como forma 2 pontes, não pode ser a guanina, sendo, pois, a adenina.
Ao observar a molécula como um todo, pode-se chegar à conclusão de que é a adenosina-trifosfato ou ATP, formada de adenina,
ribose e três grupos fosfato e responsável pela transferência de energia entre reações exotérmicas liberadoras de energia e
endotérmicas consumidoras de energia. Por fim, analisando cada item:
Item A: falso. A subunidade III é um fosfato, a subunidade IV é a ribose e a subunidade V é a adenina. Assim, a molécula em questão
é um nucleotídeo, e não um nucleosídeo, podendo ser chamada de adenina-nucleotídeo-monofosfato.
Item B: falso. As subunidades III (fosfato) e V (adenina) fazem parte da molécula de DNA, mas não a subunidade IV, que é a ribose.
Item C: verdadeiro. As reações endergônicas utilizam moléculas de ATP, como a indicada na figura.
Item D: falso. No “modelo de escada” para a dupla-hélice de DNA, o “esqueleto” de desoxirriboses e fosfatos representam o corrimão
e as bases nitrogenadas, como V, devidamente unidas por pontes de hidrogênio entre as cadeias, representam os degraus.

36.
Resposta: D
Comentário: A replicação do DNA é promovida por uma série de enzimas, como a DNA helicase, que promove a quebra das pontes
de hidrogênio e a abertura da dupla hélice, e a DNA polimerase, que produz uma nova cadeia de polinucleotídeos, sempre no sentido
5’ → 3’, obedecendo o princípio do antiparalelismo. Assim:
- a fita molde iniciando na extremidade 3’ produz uma fita complementar que cresce no sentido 5’ → 3’, sendo chamada cadeia líder e
produzida de modo contínuo;
- a fita molde iniciando na extremidade 5’ produz uma fita complementar que deveria crescer no sentido 3’ → 5’, o que não é possível,
de modo que ela é feita em fragmentos denominados de fragmentos de Okazaki, colocados no sentido 5’ → 3’ ao contrário do
deslocamento da DNA helicase, sendo ligados pela enzima DNA ligase e produzindo uma cadeia de modo descontínuo, chamada de
cadeia retardada.
A replicação do DNA é bidirecional, de modo que a partir de cada sítio de origem (onde se inicia a replicação), grupos de enzimas
agem nos dois sentidos. Assim, sendo “Ori” o sítio de origem, temos que:

A fita produzida será contínua em B e C e descontínua em A e D.

37.
Resposta: C
Comentário: Analisando cada item:
A) A determinação da estrutura do DNA foi possível porque os raios X são um tipo de radiação eletromagnética com comprimento de
onda (λ) de mesma ordem de grandeza que as distâncias que separam as cadeias de nucleotídeos.
B) As posições dos átomos em uma substância química cristalizada podem ser inferidas pelo padrão de difração de raios
X que a atravessam.
C) As ligações que ocorrem entre as bases nitrogenadas no interior da hélice do DNA são possíveis devido à diferença de
eletronegatividade entre os átomos de nitrogênio ligados a átomos de hidrogênio nas bases.
D) Os fosfatos representados apresentam um átomo de oxigênio unido por ligação covalente a um átomo de hidrogênio que possibilita
a interação da molécula de DNA com íons positivos no interior da célula.
E) Na estrutura do DNA as ligações de hidrogênio ocorrem entre pares de bases específicos: a adenina liga-se unicamente com a
timina e a citosina liga-se unicamente com a guanina.

38.
Resposta: D
Comentário: Os monômeros formadores dos ácidos nucléicos são estruturas denominadas nucleotídeos, compostos por:
- Uma molécula de açúcar do grupo das pentoses (monossacarídeo com cinco átomos de carbono): desoxirribose no DNA e ribose no
RNA;
- Uma base nitrogenada purina (dotada de dois anéis carbônicos conjugados) ou pirimidina (dotada de um único anel carbônico); são
purinas adenina e guanina e pirimidinas timina, citosina e uracila;
- Ácido fosfórico, que inclusive confere o caráter ácido aos ácidos nucléicos.
Os ácidos nucléicos são formados por polinucleotídeos, polímeros de nucleotídeos. O "esqueleto" de um ácido nucléico é composto
por fosfatos e pentoses que se alternam. As bases nitrogenadas estão ligadas aos açúcares desse "esqueleto", ficando lateralmente à
cadeia de polinucleotídeos. No DNA, ocorrem duas fitas de polinucleotídeos, unidas por pontes de hidrogênio estabelecidas entre os
pares de bases. Os únicos pares possíveis são entre adenina (A) e timina (T) e entre guanina (G) e citosina (C). No RNA, ocorre uma
única fita de polinucleotídeos. Uma vez que a figura apresenta ribose como nucleotídeo, trata-se de um nucleotídeo de RNA.
Observação: Como identificar que se trata de ribose? Os carbonos da pentose podem ser numerados de 1 a 5, sendo o carbono 1’
aquele que se liga à base nitrogenada e o carbono 5’ aquele que se liga ao fosfato; a contagem feita no sentido horário a partir de
então. Veja abaixo:
C5

C4 C1

C3 C2


Ribose e desoxirribose são monossacarídeos, açúcares simples com 5 carbonos, que obedecem à fórmula geral C 5 H 10 O 5 . A
desoxirribose, entretanto, foge à fórmula por ter um oxigênio a menos (“desoxi”), tendo fórmula molecular C 5 H 10 O 4 . A diferença está
no carbono 2’ da pentose, que, na ribose, tem um grupo hidroxila (- OH) e, na desoxirribose, apenas um hidrogênio (- H). Observe
que no carbono 2’ existe um grupo hidroxila, de modo que a pentose em questão é a ribose do RNA.

39.
Resposta: A
Comentário: O DNA é uma molécula que age armazenando informações que condicionam o aparecimento de cada característica
genética de um certo organismo, sendo que essa informação se expressa na forma de produção de proteínas. O gene é o segmento de
DNA com informação para produzir um RNA capaz de ser traduzido num peptídeo, sendo que cada molécula de DNA inclui vários
genes. O conjunto de todos os genes de um organismo é conhecido como genoma. Em eucariontes, o DNA está associado a proteínas
básicas denominadas histonas, formando estruturas denominadas cromossomos. Segundo a Teoria Uninêmica, cada cromossomo
equivale a uma única molécula de DNA, ou seja, uma única dupla-hélice de DNA.

40.
Resposta: C
Comentário: Analisando cada item:
Item A: verdadeiro. O gene é o segmento de DNA com informação para transcrever um RNA capaz de ser traduzido num peptídeo.
Item B: verdadeiro. Em eucariontes, existem trechos de DNA não-codificante dentro do gene, chamados de introns, para diferenciar
dos trechos de DNA codificante dentro do gene, chamados de exons. Nesses organismos, então, o gene no DNA é inicialmente
transcrito pela enzima RNA polimerase em um pré-RNA mensageiro, que passa então por um processo de edição denominado splicing
(realizado no núcleo por um sistema denominado spliciossomo), através do qual ocorre remoção dos introns não-codificantes e união
dos exons codificantes para formar um RNAm que é efetivamente traduzido em peptídio.
Item C: falso. Como descrito acima, o splicing remove os introns do pré-RNAm e une os exons para formar o RNAm.
Item D: verdadeiro. Em eucariontes, cada gene é separado dos outros no DNA por trechos de DNA não-codificante, de modo que
não há colinearidade de genes; em procariontes, ocorrem grupos de genes justapostos sem DNA não codificante entre eles, de modo
que há colinearidade de genes.
Item E: verdadeiro. Em organismos eucariontes, o gene no DNA é inicialmente transcrito em um pré-RNA mensageiro, que pode ser
então editado em diferentes RNA mensageiros, cada qual capaz de gerar um diferente peptídeo. Assim, um mesmo gene pode ser
utilizado como base para a produção de vários peptídios.

41.
Resposta: D
Comentário: No processo de replicação (auto-duplicação) do DNA, as pontes de hidrogênio entre as duas fitas são quebradas pela
enzima DNA helicase, expondo as bases nitrogenadas de ambas as fitas. A partir daí, a enzima DNA polimerase adiciona novos
nucleotídeos às bases expostas, seguindo a regra de pareamento entre adenina e timina e entre guanina e citosina. Assim, a replicação
do DNA é semiconservativa, uma vez que cada molécula filha conserva uma cadeia do DNA parental e produz uma nova cadeia.
Desse modo, ao cultivar as bactérias em meio com N15, seu DNA apresentará esse isótopo em suas duas fitas. Ao transferir as
bactérias para um meio com N14 e promover sua reprodução, o DNA das mesmas se replicará de modo semiconservativo,
conservando a fita parental com N15 e produzindo uma fita nova com nucleotídeos com N14, gerando moléculas híbridas (com uma
fita com N15 e outra com N14). A cada nova reprodução bacteriana, ocorre nova replicação semi-conservativa, sempre conservando
uma fita parental e produzindo uma nova fita com nucleotídeos com N14, como no esquema abaixo.
100% com ambas as fitas
com N15
N15-N15
Na replicação, conserva-se as fitas parentais com N15 e
produz-se novas fitas com N14

100% com uma das fitas com


N15 e a outra com N14
N15-N14 N15-N14
Na replicação, conserva-se as fitas parentais e
produz-se novas fitas com N14

50% com uma das fitas com


N15 e a outra com N14 e 50%
com ambas as fitas com N14
N15-N14 N14-N14 N15-N14

Na replicação, conserva-se as fitas parentais e


produz-se novas fitas com N14

25% com uma das fitas com


N15 e a outra com N14 e 75%
com ambas as fitas com N14
N15-N14 N14-N14 N15-N14

Deve-se perceber que, a cada nova geração bacteriana no meio com N14, a porcentagem de bactérias com moléculas de DNA híbridas
(com uma fita com N15 e outra com N14) se reduz à metade: de 100% na 1ª geração para 50% na 2ª geração e 25% na 3ª geração.
Observe que ao final da 2ª geração, cada molécula híbrida de DNA da 1ª geração formou duas moléculas filhas, sendo uma híbrida e
outra com as duas fitas N14.

42.
Resposta: A
Comentário: A molécula de DNA é formada por uma dupla hélice de polinucleotídeos, enquanto o RNA é formado por uma fita
simples de polinucleotídeos. Em alguns vírus, somente, o DNA é de fita simples e o RNA é de fita dupla. Nas moléculas de dupla fita,
esta é mantida por pontes de hidrogênio que somente podem se formar entre guanina e citosina e entre adenina e timina (no DNA) ou
uracila (no RNA), de modo que nas moléculas bicatenárias, pode-se afirmar que os teores de G = C e A = T ou U. Nas moléculas de
fita simples, não ocorre esse pareamento por pontes de hidrogênio, de modo que não há G ≠ C e A ≠ T ou U.
Assim, num RNA de fita dupla, U = A e G = C, de modo que U + C = A + G e (U + C)/(G + A) = 1.

43.
Resposta: D
Comentário: A molécula de DNA é formada por uma dupla hélice de polinucleotídeos, enquanto o RNA é formado por uma fita
simples de polinucleotídeos. Em alguns vírus, somente, o DNA é de fita simples e o RNA é de fita dupla. Nas moléculas de dupla fita,
esta é mantida por pontes de hidrogênio que somente podem se formar entre guanina e citosina e entre adenina e timina (no DNA) ou
uracila (no RNA), de modo que nas moléculas bicatenárias, pode-se afirmar que os teores de G = C e A = T ou U. Nas moléculas de
fita simples, não ocorre esse pareamento por pontes de hidrogênio, de modo que não há G ≠ C e A ≠ T ou U. Assim:
Item A: verdadeiro. A diferença de composição entre os ácidos nucléicos indica que as três amostras são provenientes de diferentes
espécies.
Item B: verdadeiro. De acordo com a tabela, a amostra 3 possui o mais alto conteúdo de pares de bases A (47,3%) e T (47,3%).
Item C: verdadeiro. Se a amostra 2 apresenta timina, é porque se trata de DNA, e se nela G = 24,0 ≠ C = 33,0 e A = 25,0 ≠ T = 18,0,
é porque se trata de um DNA de fita simples, que somente pode pertencer a um vírus.
Item D: falso. A grande diferença de composição dos DNA das amostras 1 e 3 não permitem afirmar que ocorre alta homologia
(semelhança) entre seus DNAs.

44.
Resposta: O gene que contém um único exon, pois não tendo introns, gera um pré-RNAm menor.
45.
Resposta: Se há 27% de adenina e 35% de guanina, a molécula não pode ser DNA fita dupla nem RNA fita dupla, pois neles, A = T
(ou U, no caso do RNA) e G = C, de modo que A = T (ou U) = 27% e G = C = 35%. Assim, A + T + G + C = 27% + 27% + 35% +
35% = 124%!!!! Dessa maneira, só se pode ter no vírus DNA fita simples ou RNA fita simples, equivalendo às famílias
Picornaviridae, Retroviridae, Rhabdoviridae e Parvoviridae, ou seja, respectivamente 2, 3, 4 e 5.

46.
Resposta:
A) Porque a duplicação do DNA é semiconservativa, tendo as bactérias mantido, para cada fita da dupla-hélice de DNA, uma cadeia
original com N15 e uma nova com N14.
B) X também, uma vez que a duplicação do DNA gera uma quantidade idêntica de DNA em relação à amostra anterior (que era X).

47.
Resposta:
A) O esquema II se refere aos eucariotos, os quais apresentam em seus genes trechos de DNA não codificante conhecidos como
introns, transcritos (processo 3) no pré-RNAm e removidos no splicing (processo 4) para gerar o RNAm madura que será traduzido
(processo 5) em um peptídeo. Como o esquema II corresponde um eucarioto, apresenta núcleo organizado pela presença de uma
carioteca, de modo que a etapa 3 (transcrição) ocorre no núcleo e a etapa 5 (tradução) ocorre no citoplasma.
Como o esquema I corresponde a um procarioto, não apresenta núcleo organizado, ou seja, não apresenta carioteca, de modo que as
etapas 1 (transcrição) e 2 (tradução) ocorrem no citoplasma.
B) A remoção dos introns do pré-RNAm, conhecida como splicing, corresponde à etapa 4 do esquema II. Através da remoção
diferencial de introns, um mesmo pré-RNAm pode ser editado em diferentes RNAm, num processo conhecido como splicing
alternativo, levando à produção de diferentes peptídeos.

48.
Resposta:
A) Os “corrimãos” correspondem a uma sucessão alternada de fosfato e desoxirribose (açúcar). Os “degraus” são constituídos por
pares de bases nitrogenadas, unidas por pontes de hidrogênio, onde adenina pareia com timina, e citosina com guanina.
B) O DNA realiza a transcrição, isto é, produz o RNA mensageiro, que conduz os códons para a síntese da proteína nos ribossomos.
C) As proteínas podem ser diferenciadas pelo número, tipos e sequências de seus aminoácidos.

49.
Resposta: Amostra 3. O pareamento entre as bases nitrogenadas G e C é feito por três pontes de hidrogênio, enquanto entre A e T é
feito por apenas duas. Quanto mais pontes de hidrogênio, mais energia será necessário aplicar para rompê-las. Desse modo, quanto
maior a relação (G + C)/(A + T), maior a temperatura de desnaturação da molécula de DNA.

50.
Resposta: O RNAm já passou pelo splicing, de modo que sua parte não codificante já foi removida.

51.
Resposta:
A) Os RNA mensageiros transcritos do gene normal e do gene inserido formam um RNA de dupla hélice ou híbrido. A disposição das
bases destes dois RNA mensageiros são exatamente complementares.
B) Havendo a interação entre os RNA mensageiros transcritos a partir destes dois genes, restarão menos mensageiros normais (fita
simples) capazes de serem traduzidos em enzima, ao nível ribossomal. Em conseqüência, a concentração da enzima diminuirá nas
células, o que retardará o processo de maturação.

52.
Resposta: Para responder como o DNA atende aos critérios de autocopiar-se precisamente e de ser estável, porém capaz de sofrer
modificação, basta descrever como a molécula de DNA se duplica e descrever sua estrutura química para nos mostrar sua estabilidade
e sua capacidade de sofrer modificação. Uma das mais importantes contribuições do modelo da dupla-hélice foi explicar a duplicação
do material hereditário. Segundo Watson e Crick, as pontes de hidrogênio entre as bases nitrogenadas se desfazem e as duas cadeias
complementares que formam a molécula de DNA se separam. Nucleotídeos livres encaixam-se nas cadeias desemparelhadas,
obedecendo à regra de emparelhamento entre as bases: adenina se emparelha com timina e citosina se emparelha com guanina. Assim,
os nucleotídeos vão se unindo e constituindo uma nova cadeia polinucleotídica, complementar à que lhe serve de molde. A molécula
de DNA é estável, devido apresentar arranjo energeticamente favorável por causa da estrutura em dupla-hélice com as bases no
interior da hélice e por causa das múltiplas pontes de hidrogênio e ligações fosfodiéster. É, no entanto, capaz de se modificar através
das mutações e através do crossing-over durante a meiose.

53.
Resposta:
- Bases purinas (A e G) são formadas por 2 anéis carbônicos conjugados e bases pirimidinas (T e C) são formadas por apenas 1 anel
carbônico.
- Entre G e C, três pontes de hidrogênio são formadas, e entre A e T apenas duas pontes de hidrogênio são formadas.
Assim:
A) guanina
B) percebe-se que a base 1 possui 2 anéis, o que a caracteriza como uma purina, e forma três pontes de hidrogênio, não podendo ser a
adenina, o que permite a confirmação de que é a guanina.
C) Se 30% é de base 2 (que está ligada à base 1, sendo pois a citosina), haverá 30% também de base 1 (guanina). Sobram 40% para
serem distribuídos entre 3 (timina) e 4 (adenina), sendo pois 20% de 3 e 20% de 4.

54.
Resposta: Se houvesse a transcrição simultânea das cadeias complementares dos genes, as moléculas de RNA sintetizadas também
teriam sequências complementares. Tal situação provocaria então a formação de moléculas de RNA de cadeia dupla, que não
poderiam ser traduzidas nos ribossomas.

55.
Resposta: No caso do sequenciamento direto do ADN, os resultados revelam tanto a sequência das regiões codificadoras (os genes)
quanto a das não codificadoras, que representam quase 90% do genoma. Com a segunda estratégia são sequenciados somente os
genes, isto é, regiões codificadoras. Ao mapear o material genético no Projeto Genoma, não há interesse em mapear o DNA lixo, uma
vez que, como já dito, não codifica proteínas, não tendo função aparente pois. Além disso, os genes ocupam apenas uma das fitas do
DNA, não as duas (lembre que é porque o RNA transcrito só tem uma cadeia). Assim, transcreve-se todos os genes de um
cromossomo, produzindo-se vários RNA’s mensageiros. Une-se todos esses RNA’s numa única molécula, e através de transcriptase
reversa, produz-se uma fita de DNA a ser mapeada. Ganha-se então tempo e poupa-se trabalho, uma vez que esse novo DNA terá
apenas os genes, não se mapeando o DNA lixo. Ao se realizar o processo acima descrito, remove-se os introns dos RNA’s antes de
uni-los para fabricar a fita de DNA a ser mapeada.

56.
Resposta: As regiões 2 e 4. Essas regiões formam alças justamente por não possuírem as sequências de nucleotídeos complementares,
que foram eliminadas após o processo de transcrição.

57.
Resposta: Várias moléculas de DNA polimerase iniciam a replicação do DNA, simultaneamente, em diversos sítios do genoma
denominados sítios de origem de replicação. Além disso, a síntese é bidirecional a partir de cada sítio de origem. Em eucariontes, o
ganho de velocidade é maior porque há mais sítios de origem.

58.
Resposta: Na cadeia 2 há maior quantidade de pares CG. Devido a este fato, é maior o número de pontes de hidrogênio (3 pontes
contra 2 pontes do par AT) a serem rompidas, o que justifica a necessidade de uma temperatura de desnaturação mais elevada.

59.
Resposta: Os genes que não codificam polipeptídeos transcrevem para produzir RNA ribossômico e RNA transportador.

60.
Resposta: Os círculos pretos representam o número de bactérias; os círculos brancos representam a concentração de glicose; os
triângulos pretos a concentração da enzima ß-galactosidase. Enquanto existe glicose no meio a ß-galactosidase está reprimida. Quando
a glicose se esgota a expressão dessa enzima é induzida.
1.
Resposta: A
Comentário: Cada 3 bases nitrogenadas no RNAm constituem uma unidade denominada códon, que uma vez traduzida, codifica um
certo aminoácido no peptídio. Assim, se a proteína em questão contém 112 aminoácidos, foi codificada por 1 RNAm com auxílio de
112 RNAt, um para cada aminoácido conduzido. Observação: Como são 112 aminoácidos, o RNAm em questão possui 112 códons,
ou seja, 112 x 3 bases nitrogenadas, correspondendo a 336 bases nitrogenadas no RNAm.

2.
Resposta: C
Comentário: Ribonucleases são enzimas que digerem moléculas de RNA, principais componentes de estruturas como ribossomos e
nucléolos.

3.
Resposta: E
Comentário: Analisando cada item:
Item A: A supressão das três primeiras bases nitrogenadas implica na supressão de um códon no RNAm transcrito, ou seja, na
supressão de um aminoácido no peptídio traduzido.
Item B: A substituição da 4ª base nitrogenada por outra implica na alteração do 2º códon no RNAm transcrito, ou seja, na alteração do
2º aminoácido no peptídio traduzido (talvez nenhum, se a mutação gerar um códon sinônimo), desde que a mutação não gere um
códon de terminação.
Item C: A inclusão de mais três bases nitrogenadas no final da molécula implica na inclusão de um códon no RNAm transcrito, ou
seja, na inclusão de um aminoácido no final do peptídio traduzido, desde que a mutação não gere um códon de terminação.
Item D: A substituição das três primeiras bases nitrogenadas por outras implica na alteração do 1º códon no RNAm transcrito, ou seja,
na alteração do 1º aminoácido no peptídio traduzido (talvez nenhum, se a mutação gerar um códon sinônimo), desde que a mutação
não gere um códon de terminação.
Item E: A supressão da 2ª base nitrogenada faz com que todos os códons a partir daí sejam lidos com uma base de defasagem, o que
altera todos os códons no RNAm da mutação em diante, e conseqüentemente todos os aminoácidos seguintes, excetuando-se
coincidências e surgimento de códons sinônimos ou de terminação.
Assim, a alteração mais drástica que esta molécula pode sofrer é a supressão da 2ª base nitrogenada.

4.
Resposta: B
Comentário: Analisando cada item:
Item I: verdadeiro. A maioria das mutações que alteram um nucleotídeo apenas (mutações pontuais) gera um códon que codifica um
aminoácido distinto daquele que é codificado originalmente (mutações de sentido trocado), sendo que são mais raras aquelas que
originam códons nonsense de terminação (mutações sem sentido, que geram um dos três códons de terminação, UGA, UAA ou UAG)
e que originam códons sinônimos (mutações silenciosas, que geram um códon sinônimo normalmente alterando somente a 3ª base do
códon).
Item II: verdadeiro. Como mencionado anteriormente, as mutações de sentido trocado originam um códon diferente do anterior não
sinônimo e não de terminação, enquanto as mutações sem sentido originam um dos três códons de terminação.
Item III: verdadeiro. Mutações sem sentido podem criar códons de terminação antes do momento adequado, antecipando o fim da
tradução e originando peptídios mais curtos pela ausência de um ou mais aminoácidos.
Item IV: falso. Mutações gênicas promovem alterações em genes que passam de dominantes em recessivos, sendo que os genes
recessivos que surgiram por mutações sem sentido originam proteínas defeituosas; em homozigotos, os dois genes defeituosos
implicam em produção somente de proteínas defeituosas, o que normalmente é letal, mas em heterozigotos, a existência de uma cópia
funcional do gene evita efeitos mais graves.

5.
Resposta: A
Comentário: Em eucariontes, existem trechos de DNA não-codificante dentro do gene, chamados de introns, para diferenciar dos
trechos de DNA codificante dentro do gene, chamados de exons. Nesses organismos, então, o gene no DNA é inicialmente transcrito
em um pré-RNA mensageiro, passa então por um processo de edição denominado splicing, através do qual ocorre remoção dos introns
não-codificantes e união dos exons codificantes para formar um RNAm que é efetivamente traduzido em peptídio. Cada 3 bases
nitrogenadas no RNAm constituem uma unidade denominada códon, que uma vez traduzida, codifica um certo aminoácido no
peptídio. Assim, se a proteína em questão tem 2026 aminoácidos, ela foi codificada por 2026 códons, ou seja, por 2026 x 3 = 6078
bases nitrogenadas. Desse modo, temos que a porcentagem de DNA codificadora é de 6078 bases dentro de 61200 bases, ou seja,
6078 ÷ 61200 = 0,0993 = 9,93%.

6.
Resposta: E
Comentário: No processo de síntese proteica, cada trinca de bases nitrogenadas que codificam um determinado aminoácido é
denominada códon. Assim, analisando cada item:
Item A: falso. Como o código genético é degenerado, ou seja, existem mais códons do que aminoácidos, cada códon determina um
único aminoácido, mas um mesmo aminoácido pode ser codificado por mais de um códon distinto. Assim, no peptídeo em questão,
um aminoácido como a asparagina pode ter sido codificado, segundo a tabela, pelo códon AAU ou AAC no RNAm, o que implica que
sua sequência de DNA complementar, do qual foi transcrito, pode ter sido TTA ou TTG, não sendo possível garantir qual essa
sequência. O mesmo vale para os outros aminoácidos codificados por mais de um códon, como cisteína, fenilalanina, ácido glutâmico
e tirosina, onde também não é possível garantir qual o RNAm e o DNA a partir do qual foram traduzidos.
Item B: falso. De modo geral, quanto maior a sequência de DNA codificadora da proteína, maior será a sequência de nucleotídeos e
maior será o número de códons no RNAm , sendo maior o número de aminoácidos que serão ligados durante a tradução.
Item C: falso. A síntese proteica depende diretamente da transcrição de RNAm, RNAr e RNAt a partir do DNA, o que ocorre no
núcleo da célula.
Item D: falso. Códons sinônimos são aqueles que codificam um mesmo aminoácido, e, na maioria dos casos, códons sinônimos para
um aminoácido só são diferentes na terceira base da trinca. Assim, a troca do terceiro nucleotídeo de uma trinca normalmente produz
um códon sinônimo e não altera a proteína a ser codificada, num tipo de mutação chamada de mutação silenciosa.
Item E: verdadeiro. O código genético é degenerado implica em haver mais de um códon para um mesmo aminoácido, fato que pode
ser comprovado observando os aminoácidos Fenilalanina, Tirosina, Cisteína, Ácido glutâmico e Asparagina na tabela, os quais são,
cada um, codificados por dois códons distintos.

7.
Resposta: A
Comentário: Cada 3 bases nitrogenadas no RNAm constituem uma unidade denominada códon, que uma vez traduzida, codifica um
certo aminoácido no peptídio. Assim, se o peptídeo tem peso molecular de 27000 daltons e o peso molecular médio de um aminoácido
é de 100 daltons, o peptídeo em questão possui 27000 ÷ 100 = 270 aminoácidos. Como cada aminoácido é codificado por um códon,
que corresponde a três nucleotídeos do RNAm, o RNAm em questão possui 270 x 3 = 810 nucleotídeos.

8.
Resposta: C
Comentário: Analisando cada item:
Item I: verdadeiro. Uma vez que há 64 códons para codificar os 20 aminoácidos, o código genético é degenerado, ou seja, há mais
códons que aminoácidos, de modo que cada códon define um único aminoácido, mas um mesmo aminoácido pode ser codificado por
mais de um códon (de 1 a até 6 códons, dependendo do aminoácido).
Item II: verdadeiro. O código genético degenerado permite que algumas mutações ocorram sem que causem alterações no peptídio
traduzido; essas mutações, ditas mutações silenciosas, originam códons sinônimos em relação ao original.
Item III: falso. Em eucariontes, existem trechos de DNA não-codificante dentro do gene, chamados de introns, para diferenciar dos
trechos de DNA codificante dentro do gene, chamados de exons. Nesses organismos, então, Em organismos eucariontes, o gene no
DNA é inicialmente transcrito em um pré-RNA mensageiro, passa então por um processo de edição denominado splicing, através do
qual ocorre remoção dos introns não-codificantes e união dos exons codificantes para formar um RNAm que é efetivamente traduzido
em peptídio.

9.
Resposta: C
Comentário: Dá-se o nome de códon a cada trinca de bases nitrogenadas no RNAm que codifica um determinado aminoácido no
peptídio traduzido. Como as moléculas representadas na figura possuem uracila, são RNA e não DNA. Assim, analisando os RNA
representados, observa-se que o número de aminoácidos codificados pela sequência de bases entre o sítio de início da tradução e a
mutação é igual ao número de códons, ou seja, o número de trincas de bases, ou seja, 8, como se observa abaixo:

1 2 3 4 5 6 7 8
10.
Resposta: C
Comentário: Analisando cada item:
Item I: falso. Uma vez que há 64 códons para codificar os 20 aminoácidos, o código genético é degenerado, ou seja, há mais códons
que aminoácidos, de modo que cada códon define um único aminoácido, mas um mesmo aminoácido pode ser codificado por mais de
um códon (de 1 a até 6 códons, dependendo do aminoácido).
Item II: verdadeiro. O RNA ribossômico é parte integrante estrutural do ribossomo, além de funcionar como ribozima, ou seja,
catalisador; por exemplo, quem catalisa a formação da ligação peptídica no ribossomo é um RNAr catalítico, ou seja, uma ribozima.
Item III: verdadeiro. No processo de síntese protéica, de início ocorre ligação da molécula de RNA transportador com o aminoácido
metionina (equivalente ao códon de iniciação AUG) à subunidade menor do ribossomo; num segundo momento, esse conjunto se liga
ao RNA mensageiro; num último momento, a subunidade maior é acrescentada ao sistema. Assim, a subunidade menor pode ser
descrita como o sítio de ligação do RNA transportador ao RNA mensageiro.

11.
Resposta: D
Comentário: Mutações gênicas são aquelas que alteram a sequência de bases nitrogenadas em um gene, de modo a alterá-lo. Algumas
mutações gênicas são:
- deleção: apaga uma ou mais bases nitrogenadas no gene;
- adição: adiciona uma ou mais bases nitrogenadas no gene;
- duplicação: adiciona uma ou mais bases nitrogenadas no gene de modo a repetir um trecho do gene;
- substituição: troca uma ou mais bases nitrogenadas no gene por outra (s); pode ser por transversão, quando troca uma base purina por
uma pirimidina ou vice-versa, ou por transição, quando troca uma base purina por outra base purina ou uma base pirimidina por outra
base pirimidina.
Assim, como a mutação no 6º códon troca de CTT por CAT, troca uma timina por uma adenina, trocando uma base pirimidina
(timina) por uma purina (guanina) e sendo caracterizada como uma transversão.

12.
Resposta: C
Comentário: Analisando cada item:
Item A: A deleção de dois nucleotídeos faz com que todos os códons a partir daí sejam lidos com duas bases de defasagem, o que
altera todos os códons no RNAm da mutação em diante, e consequentemente todos os aminoácidos seguintes, excetuando-se
coincidências e surgimento de códons sinônimos ou de terminação.
Item B: A inserção de um nucleotídeo faz com que todos os códons a partir daí sejam lidos com uma base de adiantamento, o que
altera todos os códons no RNAm da mutação em diante, e consequentemente todos os aminoácidos seguintes, excetuando-se
coincidências e surgimento de códons sinônimos ou de terminação.
Item C: A substituição de uma base nitrogenada por outra implica na alteração de um único códon no RNAm transcrito, ou seja, na
alteração de um aminoácido no peptídio traduzido (talvez nenhum, se a mutação gerar um códon sinônimo), desde que a mutação não
gere um códon de terminação.
Item D: A inserção de dois nucleotídeos vizinhos faz com que todos os códons a partir daí sejam lidos com duas bases de
adiantamento, o que altera todos os códons no RNAm da mutação em diante, e consequentemente todos os aminoácidos seguintes,
excetuando-se coincidências e surgimento de códons sinônimos ou de terminação.
Assim, a alteração menos drástica que esta molécula pode sofrer é a substituição de um nucleotídeo.

13.
Resposta: B
Comentário: Ribossomos são organelas citoplasmáticas responsáveis pela síntese protéica, apresentando um sítio A (aminoacil), por
onde entra o aminoácido que será acrescentado ao peptídio, e um sítio P (peptidil), por onde sai o peptídio em formação. O RNAt
transporta aminoácidos até os ribossomos para que sejam utilizados na síntese de proteínas. Os ribossomos só agem quando
associados a moléculas de RNA mensageiro, numa forma conhecida como polirribossomos. Durante a síntese proteica, o ribossomo
no polirribossomo desliza sobre o RNAm, sendo que o sítio A vai à frente para traduzir os códons, e é nesse sítio A que os RNAt
trazendo os aminoácidos vão se ligar.

14.
Resposta: A
Comentário: Analisando cada item:
Item A: verdadeiro. Em eucariontes, existem trechos de DNA não-codificante dentro do gene, chamados de introns, para diferenciar
dos trechos de DNA codificante dentro do gene, chamados de exons. A maior parte do DNA corresponde a introns. Assim, a chance
de que ocorram mutações significativas é rara, uma vez que a maior parte do DNA é composta de introns sem informação genética.
Além disso, ocorrem mecanismos de reparo do DNA durante a replicação do mesmo, os quais podem corrigir eventuais mutações.
Item B: falso. Radiações ionizantes como os raios ultravioleta podem promover mutações por promoverem o pareamento anormal
entre bases nitrogenadas, formando dímeros de pirimidinas (cerca de 50% das vezes, entre timinas, 40% das vezes entre timina e
citosina, e, cerca de 10% das vezes, entre citosinas). Essas mutações podem culminar em câncer de pele. Notem que as mutações
desencadeadas pelos raios UV não correspondem à deleção (apagamento) de pares de nucleotídeos.
Item C: falso. Como o código genético é degenerado, com mais códons do que aminoácidos, ocorrem mais de um códon para um
mesmo aminoácido, sendo chamados códons sinônimos. Mutações silenciosas são aquelas que geram códons sinônimos (normalmente
alterando apenas a 3ª base do códon), não alterando o peptídeo codificado, ou seja, não afetando a tradução da informação genética.
Item D: falso. Como mencionado acima, a luz ultravioleta induz um pareamento anormal entre nucleotídeos com pirimidinas (timina-
timina, timina-citosina ou citosina-citosina); observe que as ligações por pontes de hidrogênio entre citosina e guanina e entre adenina
e timina já são as que ocorrem normalmente.
Item E: falso. Câmaras de bronzeamento artificial utilizam lâmpadas emissoras de raios ultravioleta, de modo a poderem induzir
mutações e câncer e não serem seguras para a saúde.

15.
Resposta: C
Comentário: Ribossomos são organelas citoplasmáticas responsáveis pela síntese protéica, sendo que os ribossomos só agem quando
associados a moléculas de RNA mensageiro, numa forma conhecida como polirribossomos. Num polirribossomo, o RNAm é
simultaneamente traduzido por vários ribossomos, produzindo várias cópias do peptídio a ser gerado. Assim, analisando cada item:
Item 1: verdadeiro. Como, na figura, a tradução está ocorrendo da esquerda para a direita, o ribossomo (1) percorreu um menor
trecho do RNAm, tendo traduzido menos códons do mesmo, de modo que o polipeptídeo ainda está com poucos aminoácidos,
justificando estar mais curto.
Item 2: verdadeiro. Como o RNAm que está sendo traduzido é o mesmo, as proteínas produzidas em (2, 3, 4, 5 e 6) apresentam a
mesma sequência de aminoácidos.
Item 3: falso. O anticódon do RNAt identifica o aminoácido a ser transportado, sendo que esse anticódon é complementar ao códon
do RNAm; assim, o pareamento de um anticódon ACC, no RNA transportador, será dado por um códon UGG no RNA mensageiro.
(Lembre-se que não ocorre timina no RNA, mas sim uracila.)
Item 4: verdadeiro. O RNAt transporta aminoácidos até os polirribossomos para que sejam utilizados na síntese de proteínas.

16.
Resposta: A
Comentário: O código genético consiste na relação entre os nucleotídeos (bases nitrogenadas) no RNAm e os aminoácidos por eles
codificados no peptídio a ser traduzido pelo ribossomo. Cada 3 bases nitrogenadas no RNA mensageiro (RNAm) constituem uma
unidade denominada códon, que uma vez traduzida, codifica um certo aminoácido no peptídio. Esse código genético é universal, ou
seja, é o mesmo em praticamente todos os seres vivos conhecidos, de bactérias a animais, com algumas pouquíssimas exceções em
que há alguns poucos códons codificando aminoácidos diferentes.
Observação: O termo genoma descreve o conjunto de genes (e conseqüentemente de moléculas de DNA) de um organismo, sendo que
cada organismo tem um genoma próprio, idêntico em todas as suas células somáticas. (A exceção são as células germinativas, que
surgem por meiose e possuem variabilidade genética devido a mecanismos como crossing-over e segregação dos cromossomos
homólogos.) Apenas em clones é que se têm organismos distintos com genomas idênticos.

17.
Resposta: E
Comentário: O código genético consiste na relação entre os nucleotídeos (bases nitrogenadas) no RNAm e os aminoácidos por eles
codificados no peptídio a ser traduzido pelo ribossomo. Cada 3 bases nitrogenadas no RNA mensageiro (RNAm) constituem uma
unidade denominada códon, que uma vez traduzida, codifica um certo aminoácido no peptídio. Esse código genético é universal, ou
seja, é o mesmo em praticamente todos os seres vivos conhecidos, de bactérias a animais, com algumas pouquíssimas exceções em
que há alguns poucos códons codificando aminoácidos diferentes.
Observação: O termo genoma descreve o conjunto de genes (e conseqüentemente de moléculas de DNA) de um organismo, sendo que
cada organismo tem um genoma próprio, idêntico em todas as suas células somáticas. (A exceção são as células germinativas, que
surgem por meiose e possuem variabilidade genética devido a mecanismos como crossing-over e segregação dos cromossomos
homólogos.) Apenas em clones é que se têm organismos distintos com genomas idênticos.

18.
Resposta: B
Comentário: Cada 3 bases nitrogenadas no RNA mensageiro (RNAm) constituem uma unidade denominada códon, que uma vez
traduzida, codifica um certo aminoácido no peptídio. Existem, no entanto, códons nonsense ou sem sentido, que não codificam
aminoácidos e determinam o fim da tradução, de modo que nenhum novo aminoácido será acrescentado ao peptídio em formação. Se
o 50º códon do RNA mensageiro é um códon de parada da tradução, é correto afirmar que o peptídio resultante da tradução desse
RNA mensageiro foi codificado por 49 códons com sentido, possuindo 49 aminoácidos.

19.
Resposta: D
Comentário: O código genético consiste na relação entre os nucleotídeos (bases nitrogenadas) no RNAm e os aminoácidos por eles
codificados no peptídio a ser traduzido pelo ribossomo. Cada 3 bases nitrogenadas no RNA mensageiro (RNAm) constituem uma
unidade denominada códon, que uma vez traduzida, codifica um certo aminoácido no peptídio. Se as histonas H4 de boi e ervilha
diferem em dois aminoácidos, as seqüências de ácidos nucléicos que os traduzem diferem entre si em pelo menos dois códons,
podendo haver diferenças de 2 a 6 bases nitrogenadas nesses códons. Além disso, pode haver outras diferenças entre seus ácidos
nucléicos que levam à formação de códons sinônimos em seus RNA mensageiros, de modo que pode haver diferenças em vários
pontos de seus genes.

20.
Resposta: A
Comentário: O código genético consiste na relação entre os nucleotídeos (bases nitrogenadas) no RNAm e os aminoácidos por eles
codificados no peptídio a ser traduzido pelo ribossomo. Cada 3 bases nitrogenadas no RNA mensageiro (RNAm) constituem uma
unidade denominada códon, que uma vez traduzida, codifica um certo aminoácido no peptídio. Esse código genético é universal, ou
seja, é o mesmo em praticamente todos os seres vivos conhecidos, de bactérias a animais, com algumas pouquíssimas exceções em
que há alguns poucos códons codificando aminoácidos diferentes. O termo genoma descreve o conjunto de genes (e conseqüentemente
de moléculas de DNA) de um organismo, sendo que cada organismo tem um genoma próprio, idêntico em todas as suas células
somáticas. (A exceção são as células germinativas, que surgem por meiose e possuem variabilidade genética devido a mecanismos
como crossing-over e segregação dos cromossomos homólogos.) Apenas em clones é que se têm organismos distintos com genomas
idênticos. Assim, os textos empregam inadequadamente o termo código genético, uma vez que ambos estão se referindo, na verdade,
ao genoma.

21.
Resposta: C
Comentário: No que diz respeito ao material genético e à síntese de proteínas:
- Organismos procariotos possuem DNA circular e desnudo (não associado a histonas) e não possuem núcleo organizado por
carioteca, de modo que, neles, transcrição e tradução podem ocorrer de modo simultâneo, no mesmo compartimento celular que é o
citoplasma. Em organismos procariotos, não ocorrem introns, exons ou splicing.
- Organismos eucariotos possuem DNA aberto e associado a histonas e possuem núcleo organizado por carioteca, de modo que, neles,
a transcrição ocorre no núcleo, num primeiro momento, e a tradução ocorre no citoplasma, num segundo momento. Em organismos
eucariotos, ocorrem nos genes trechos de DNA não codificante, ou seja, introns, entre trechos de DNA codificante, ou seja, exons.
Quando o gene é transcrito, forma-se inicialmente um pré-RNAm com introns, os quais são removidos no núcleo pelo processo de
splicing, de modo a formar um RNAm maduro somente com exons, o qual será traduzido pelos ribossomos livres do citoplasma ou
pelos ribossomos do retículo endoplasmático rugoso.
Assim, analisando cada item:
Item I: Em procariotos, como DNA e ribossomos estão no citoplasma, a tradução pode ocorre simultaneamente à transcrição.
Item II: Em eucariotos, ocorrem introns e exons nos genes.
Item III: Em procariotos, não ocorre retículo endoplasmático rugoso, de modo que a tradução ocorre sempre em ribossomos livres
no citoplasma.
Item IV: Em procariotos, como o DNA é circular, o processo de replicação possui um único local de origem.

22.
Resposta: C
Comentário: Segundo o texto, a guanina oxidada (G*) pode passar a se emparelhar a timina (T) na replicação do DNA, passando a
ser substituído por adenina (A) na molécula replicada. Assim, nas células filhas resultantes da divisão celular, o trecho de DNA em
questão, G*CG* - CCC - TG*T - ACG* - ATA, passará a ser ACA - CCC - TAT - ACA - ATA, o que altera três trincas de
nucleotídeos, ou seja, três códons, alterando até três aminoácidos. Como dois dos códons trocados são idênticos, ACA, o número
máximo de aminoácidos diferentes que poderão ser substituídos na proteína sintetizada é 2 (um devido ao códon trocado ACA e um
devido ao códon trocado TAT).

23.
Resposta: C
Comentário: Cada 3 bases nitrogenadas no RNA mensageiro (RNAm) constituem uma unidade denominada códon, que uma vez
traduzida, codifica um certo aminoácido no peptídio. No caso em questão, se o RNAm possui sempre as mesmas duas bases repetidas
(C – A), temos que dois códons podem ser lidos, CAC ou ACA, dependendo do local onde os ribossomos iniciam a tradução do
código genético. Assim, o peptídeo traduzido terá apenas 2 aminoácidos (o aminoácido X para o códon CAC e o aminoácido Y para o
códon ACA) alternados e se repetindo.

24.
Resposta: B
Comentário: O DNA é uma molécula que age armazenando informações que condicionam o aparecimento de cada característica
genética de um certo organismo, sendo que essa informação se expressa na forma de produção de proteínas. O gene é o segmento de
DNA com informação para produzir um RNA capaz de ser traduzido num peptídeo. Como o DNA é uma molécula em dupla-hélice, e
o DNA do bacteriófago T2 tem um total de 3600 bases, cada fita possui 1800 bases. Como esse DNA compreende três genes
aproximadamente iguais, cada gene tem 3600 ÷ 3 = 1200 bases (lembre-se que genes estão em apenas uma das fitas do DNA).
Cada 3 bases nitrogenadas no RNAm constituem uma unidade denominada códon, que uma vez traduzida, codifica um certo
aminoácido no peptídio. Assim, 1200 bases por gene implicam em 1200 ÷ 3 = 400 códons, o que implica na ocorrência de 400
aminoácidos no peptídio gerado. Por fim, se cada aminoácido tem uma massa média de 120, cada peptídio terá uma massa aproximada
de 400 x 120 = 24 000.

25.
Resposta: A
Comentário: Analisando cada item:
Item A: verdadeiro. O DNA localizado no núcleo transcreve o RNA mensageiro que é enviado ao citoplasma, cujos ribossomos
traduzem o RNAm em peptídios.
Item B: falso. A posição dos aminoácidos na cadeia polipeptídica depende da seqüência de bases do RNA mensageiro (RNAm).
Item C: falso. O transporte de aminoácido para o local da síntese é feito pelo RNA transportador (RNAt).
Item D: falso. A seqüência de bases do RNA ribossômico (RNAr) é transcrita a partir de genes localizados na chamada zona SAT de
DNA, também conhecida como região organizadora do nucléolo.
Item E: falso. O RNAt possui uma estrutura tridimensional conhecida como “folha-de-trevo”, possuindo nela duas regiões especiais:
- uma seqüência de três bases variáveis, complementares ao códon, denominada de anticódon, que determinam qual dos 20
aminoácidos é transportado por aquele RNAt;
- uma seqüencia denominada alça aceptora ou extremidade livre, sempre CCA (citosina-citosina-adenina), na qual se liga o
aminoácido a ser transportado, o qual se liga ao RNAt pelo grupo amina, através de ligação covalente.

26.
Resposta: B
Comentário: Uma vez que o antibiótico A inibe a tradução (leitura do RNAm pelo ribossomo para a montagem da cadeia peptídica),
a interrupção na síntese protéica é imediata; como o antibiótico B inibe a transcrição (produção de RNAm a partir da codificação do
gene no DNA), os RNAm já sintetizados são traduzidos, de modo que a síntese protéica não é interrompida imediatamente, mas só
após a degeneração dos RNAm já existentes antes da adição do antibiótico ao meio.

27.
Resposta: C
Comentário: Ribossomos são organelas citoplasmáticas responsáveis pela síntese protéica, sendo que os ribossomos só agem quando
associados a moléculas de RNA mensageiro, numa forma conhecida como polirribossomos. Estes podem estar livres no citoplasma,
sendo responsáveis pela síntese de proteínas de uso interno pela célula (1º grupo), associados ao RER, sendo responsáveis pela síntese
de proteínas de exportação, que agem no espaço extracelular (2º grupo) e, no interior das mitocôndrias, sendo responsáveis pela
síntese de proteínas mitocondriais (3º grupo). Algumas proteínas mitocondriais são produzidas pelos polirribossomos livres (1º grupo).
Observação: As proteínas de membrana plasmática são produzidas parte nos polirribossomos livres (1º grupo) e parte no RER (2º
grupo).

28.
Resposta: VFVFV
Comentário: O ribossomo possui duas subunidades, menor e maior, sendo que a subunidade maior possui dois sítios de ligação. O
sítio A (aminoacil) recebe os novos RNAt com aminoácidos a serem adicionados ao peptídio em formação, que sai pelo sítio P
(peptidil); uma vez que há um aminoácido no sítio A e outro no sítio P, forma-se uma ligação peptídica entre eles, e o RNAt que trazia
o aminoácido é liberado no citoplasma. Assim:
- I representa o primeiro aminoácido do peptídio, ou seja, a metionina codificada pelo códon de iniciação AUG no RNAm (códon 1);
- II representa o anticódon UAC no RNAt que traz a metionina; esse anticódon reconhece o códon de iniciação AUG no RNAm;
- III representa o RNAt que traz o segundo aminoácido do peptídio, codificado pelo códon 2 no RNAm;
- IV representa o RNAt que trouxe o primeiro aminoácido do peptídio, ou seja, a metionina;
Assim:
1º item: verdadeiro.
2º item: falso. Os códons UAA, UAG e UGA são códons de terminação, não sendo reconhecidos por nenhum RNAt, e por isso sendo
responsáveis pelo encerramento do processo de tradução.
3º item: verdadeiro.
4º item: falso. Como mencionado acima, o final da tradução é marcado por um dos códons de terminação (UAA, UAG e UGA).
5º item: verdadeiro. Cada 3 bases nitrogenadas no RNAm constituem uma unidade denominada códon, que uma vez traduzida,
codifica um certo aminoácido no peptídio. Uma vez que há 64 códons para codificar os 20 aminoácidos, o código genético é
degenerado, ou seja, há mais códons que aminoácidos, de modo que cada códon define um único aminoácido, mas um mesmo
aminoácido pode ser codificado por mais de um códon (de 1 a até 6 códons, dependendo do aminoácido). Se os códons 5 e 6 trazem a
informação para um mesmo aminoácido, esses códons são iguais ou sinônimos; se para esse aminoácido existe apenas um códon,
trata-se da metionina ou do triptofano, que são os únicos aminoácidos codificados por apenas um códon.

29.
Resposta: VFVV
Comentário:
1º item: verdadeiro. Uma vez que a figura representa um polissoma com vários ribossomos traduzindo o mesmo RNAm, ao final da
síntese, todas as proteínas representadas no esquema serão iguais.
2º item: falso. Como os peptídios representados no alto do esquema são menores, estão no início da tradução, de modo que os
ribossomos estão se movendo da parte de cima para a de baixo do esquema.
3º item: verdadeiro. O RNA transportador é responsável pelo transporte de aminoácidos até os ribossomos, para que sejam usados na
tradução.
4º item: verdadeiro. Ribossomos são sempre encontrados em sua forma ativa em estruturas denominadas de polissomas, formados
por ribossomos e RNA mensageiro (RNAm), podendo os polissomas estarem livres no citoplasma (para produzir proteínas de uso
interno) ou associados ao RER (para produzir proteínas de exportação).
5º item: verdadeiro. Cada 3 bases nitrogenadas no RNAm constituem uma unidade denominada códon, que uma vez traduzida,
codifica um certo aminoácido no peptídio. Assim, de modo geral, quanto maior o RNAm, maior o número de códons e maior o
número de aminoácidos no peptídio.

30.
Resposta: FFFFVFV = 80
Comentário: Analisando cada item:
Item 1: falso. Se o peptídio em questão tem 7 aminoácidos, seu RNAm tem 7 códons; como cada códon tem 3 bases nitrogenadas, o
RNAm tem 7 x 3 bases = 21 bases.
Item 2: falso. Como o segundo aminoácido é o triptofano, de acordo com a tabela do código genético, é codificado pelo códon UGG.
Se esse códon passar a ser UGA, passará a ser um códon de término, de modo que a cadeia polipeptídica será interrompida logo após o
1º aminoácido, faltando seis aminoácidos no peptídio.
Item 4: falso. A metionina só pode ser codificada pelo códon AUG e o triptofano só pode ser codificado pelo códon UGG; a arginina
pode ser codificada por 6 códons, a lisina pode ser codificada por 2 códons, a cisteína pode ser codificada por 2 códons e a
fenilalanina pode ser codificada por 2 códons. Assim, o total de combinações de códons para os 7 aminoácidos é 1 para metionina, 1
para triptofano, 1 para metionina, 6 para arginina, 2 para lisina, 2 para cisteína e 2 para fenilalanina = 1 x 1 x 1 x 6 x 2 x 2 x 2 = 48
sequências possíveis de RNA mensageiro para formarem este polipeptídio.
Item 8: falso. O código genético é degenerado porque um mesmo aminoácido pode ser codificado por mais de um códon. Como os
dois primeiros aminoácidos, metionina e triptofano, são codificados cada qual por um códon apenas, eles não representam exemplos
da degeneração do código genético.
Item 16: verdadeiro. UAA, UAG e UGA são códons de terminação no RNA mensageiro, levando ao encerramento da síntese
proteica e à desmontagem da maquinaria de tradução.
Item 32: falso. Como mencionado, o aminoácido da 7ª posição, a fenilalanina, pode ser codificada por dois códons.
Item 64: verdadeiro. Mutações silenciosas geram códons sinônimos, de modo que não levam a modificações na sequência dos
aminoácidos deste polipeptídio.

31.
Resposta:
A) A ordem dos RNAs transportadores será 4-7-6-8-7-1-3-5.
B) A sequência de aminoácidos será: isoleucina – serina – serina- histidina – serina – fenilalanina – glutamina – treonina,

32.
Resposta:
A)
I. RNAm procariota - Em geral contém informação para a tradução de mais de uma cadeia polipeptídica ou é policistrônico.
II. RNAm eucariota - Contém a informação ou instrução para a tradução de uma única cadeia polipeptídica ou é monocistrônico.
B) Genes procariotas não possuem introns, portanto, não ocorrem: transcrição de pré-RNAm e splicing. O RNAm transcrito do gene
apresenta apenas exons.
C)
I. É uma mutação em que a substituição de um par de bases origina um outro códon que continua codificando o mesmo aminoácido.
II. A mutação silenciosa é conseqüência da redundância do código genético, ou porque o código genético é degenerado.
D)
I. A mutação ocorreu em uma trinca codificante do DNA, tornando-a uma trinca que será transcrita em um códon de parada.
II. A mutação ocorreu em uma trinca de DNA que é transcrita em um códon de parada, tornando-a codificante de aminoácido.
33.
Resposta:
A) São necessários pelo menos 84 nucleotídeos pois cada aminoácido de uma proteína é codificado por uma trinca de nucleotídeos.
Além disso, mais 6 nucleotídeos corresponderiam ao códon de iniciação e de terminação.
B) Não. Devido à degeneração do código genético, um aminoácido pode ser codificado por mais do que uma trinca de nucleotídeos.
C) Dentre outras, a mutação que originou a espécie 2 foi uma substituição por uma mutação pontual (nos aminoácidos 7 e 12). Uma
inversão (nos quatro últimos aminoácidos) produziu a alteração verificada na espécie 3 e uma deleção (nos aminoácidos de 7 a 12)
acarretou o surgimento da espécie 4.

34.
Resposta:
A) Se os códons fossem de duas letras, haveria apenas 16 combinações de códons (4X4=16), insuficientes para codificar 20
aminoácidos. Sendo de três letras, haverá 64 combinações (4X4X4=64), o que possibilita a codificação dos 20 aminoácidos.
B) Sim e não, respectivamente.

35.
Resposta:
A) Mutações.
B) Não. Genoma é o conjunto de genes, enquanto que código genético é a relação entre genes e proteínas (códons e aminoácidos).

36.
Resposta:
A) As proteínas obtidas possuíam apenas um tipo de aminoácido porque o DNA utilizado apresentava um único tipo de códon, uma
vez que são as mesmas três bases sempre repetidas.
B) O tipo de aminoácido utilizado na produção da proteína poderá variar dependendo do local onde os ribossomos iniciam a tradução
do código genético. O aminoácido utilizado é a serina quando a leitura começa no A, do códon AGC. O aminoácido é a alanina
quando a leitura começa no G, do códon GCA. O aminoácido utilizado é a glutamina, quando a leitura começa no C, do códon CAG.

37.
Resposta:
A) Em ribossomos isolados não há síntese de cadeias polipeptídicas. O RNA mensageiro é necessário pois transmite a mensagem
genética para a síntese dos polipeptídeos.
B) Polipeptídeos são formados a partir do encadeamento de aminoácidos. Polirribossomos são constituídos de ribossomos ligados ao
RNA mensageiro.

38.
Resposta:
A) As proteínas produzidas pelos extraterrestres em questão, poderiam ter, no máximo, 16 tipos diferentes de aminoácidos. Seu código
genético, formado por pares de bases, permite a formação de apenas 16 códons diferentes. Isso sem considerar a possibilidade da
existência de um, ou mais, códons de finalização. Neste caso, não seria possível a produção das proteínas B e C com, respectivamente,
16 e 19 aminoácidos.
B) A diversidade no planeta Terra seria maior, pois o código genético dos terráqueos é formado por 64 códons, sendo 3 códons de
finalização. Assim o número de tipos distintos de aminoácidos presentes nos polipeptídeos seria, obviamente, maior.
C) A proteína produzida pela bactéria terrestre não será idêntica ao polipeptídeo alienígena, uma vez que o equipamento ribossômico
da bactéria que incorporou o gene, está capacitado para traduzir códons constituídos por 3 bases nitrogenadas consecutivas.

39.
Resposta: Como o ARNm pode conter outros códons AUG, além do códon de iniciação, a iniciação da tradução poderia ocorrer em
qualquer região onde houvesse um outro códon AUG, o que geraria peptídeos truncados ou incompletos. A tradução só ocorre quando
a sequência de Shine-Dalgarno e o códon AUG estão presentes. Assim, a sequência de Shine-Dalgarno permite identificar que códon
AUG é o de iniciação e que códons AUG codificam a metionina.

40.
Resposta:
A) Arginina, pois é o único aminoácido que foi traduzido por códons diferentes. (AGA e AGG).
B) Não, pois o código genético é degenerado. Alguns aminoácidos podem ser codificados por diferentes códons e não seria possível
saber qual dos códons estava presente no mRNA que foi traduzido.
1.
Resposta: E
Comentário: A terapia genética consiste na introdução de genes capazes de corrigir defeitos genéticos num certo indivíduo, o que
é feito através de técnicas de engenharia genética pela introdução de um DNA recombinante com o gene adequado. Essa mesma
técnica pode ser usada em indivíduos saudáveis para melhorar o desempenho de atletas, no que se chama doping genético. No
caso em questão, como a miostatina inibe a reprodução das células-satélite do músculo, a injeção de um gene que codifica uma
proteína capaz de bloquear a ação da miostatina estimularia a reprodução das células-satélite do músculo, levando ao aumento do
volume de fibras musculares.

2.
Resposta: D
Comentário: A técnica descrita no texto permitiu aos pesquisadores produzirem uma célula bacteriana com um cromossomo
artificial com o DNA dotado de uma sequência de nucleotídeos inteiramente especificada por seus interesses, abrindo a
possibilidade de desenvolver microorganismos com DNA engenheirado para produzir substâncias úteis ao homem, como
medicamentos e vacinas.
Observação: Não se pode argumentar que a célula foi gerada artificialmente porque seus componentes, como membrana e
citoplasma, haviam sido produzidos a partir da informação do DNA da bactéria original, tendo apenas havido a substituição desse
pelo DNA artificial produzido pelos pesquisadores.

3.
Resposta: C
Comentário: Através da técnica do DNA recombinante, que emprega enzimas de restrição para cortar fragmentos específicos de
DNA, é possível transferir genes de interesse de um indivíduo para qualquer outro indivíduo. Organismos geneticamente
modificados (OGM) são aqueles que passaram por qualquer tipo de modificação por engenharia genética, sendo que nos seres
transgênicos essa modificação implica necessariamente na incorporação de genes de outra espécie. Uma das utilidades da técnica
do DNA recombinante está na produção de vegetais que possuem genes que aumentam sua resistência a herbicidas, o que permite
ao agricultor usar esse tipo de defensivo agrícola para eliminar ervas daninhas em sua lavoura sem afetar as plantas transgênicas
cultivadas. Nesse caso, um possível problema advindo do cultivo dessas plantas se dá pela transferência de genes da planta
transgênica cultivada para plantas selvagens na região, com possíveis impactos ambientais negativos pela disseminação da
resistência contra herbicidas nas populações vegetais naturais. No caso descrito no texto, o risco ambiental é baixo porque a soja
transgênica “não tem possibilidade de cruzamento com outras plantas e o perigo de polinização cruzada com outro tipo de soja é
de apenas 1%”, não havendo a possibilidade de a linhagem analisada cruzar com espécies selvagens.

4.
Resposta: D
Comentário: Através da técnica do DNA recombinante, que emprega enzimas de restrição para cortar fragmentos específicos de
DNA, é possível transferir genes de interesse de um indivíduo para qualquer outro indivíduo. No caso do porco transgênico em
questão, para que produza hemoglobina e órgãos humanos, recebeu genes humanos que codificam RNAm para determinar a
sequência de aminoácidos de proteínas humanas.

5.
Resposta: A
Comentário: A terapia gênica consiste no tratamento de doenças genéticas pela introdução de genes saudáveis para compensar a
existência de genes defeituosos no doente. Através da técnica do DNA recombinante, que emprega enzimas de restrição para
cortar fragmentos específicos de DNA, é possível transferir os genes utilizados no tratamento para um vetor, e esse é então
aplicado no indivíduo doente. No caso mais comum, utiliza-se um retrovírus modificado como vetor, através de uma técnica
conhecida como ex-vivo: remove-se células do paciente, aplica-se o retrovírus modificado com o gene de interesse nas células
fora do corpo, e só então se devolve as células já modificadas ao doente. A aplicação do retrovírus modificado fora do corpo
paciente minimiza o risco de reações do doente contra o mesmo.

6.
Resposta: D
Comentário: Através da técnica do DNA recombinante, que emprega enzimas de restrição para cortar fragmentos específicos de
DNA, é possível transferir genes de interesse de um indivíduo para qualquer outro indivíduo. Organismos geneticamente
modificados (OGM) são aqueles que passaram por qualquer tipo de modificação por engenharia genética, sendo que nos seres
transgênicos essa modificação implica necessariamente na incorporação de genes de outra espécie. Para que o gene de interesse se
expresse no indivíduo modificado, é necessário que ele seja encontrado em todas as células do indivíduo. Como é inviável
modificar todas as muitas células de um organismo pluricelular adulto, a modificação deve ser feita nos gametas dos genitores ou
no zigoto do indivíduo. Assim, o zigoto modificado, ao se dividir por mitose para originar as várias células do adulto, transfere o
gene para todas essas células, de modo que o gene se expressa no adulto.

7.
Resposta: B
Comentário: Organismos transgênicos possuem genes de outras espécies inseridos a partir de técnicas de engenharia genética.
Plantas transgênicas são produzidas de modo a oferecer vantagens em relação às plantas nativas de uma área, como resistência a
pragas ou maior valor nutritivo, mas podem oferecer riscos médicos devido à presença de substâncias que podem causar alergias e
riscos ecológicos por diminuírem a biodiversidade numa região. Essa diminuição da biodiversidade está relacionada com o uso
excessivo de herbicidas em culturas de plantas transgênicas resistentes a esses agrotóxicos, o que não as afeta, mas pode eliminar
plantas nativas de áreas próximas. Outra possibilidade é o fluxo gênico com plantas nativas, o que pode se dar por ação de vírus
transmitidos por insetos ou pelo cruzamento com plantas evolutivamente semelhantes.

8.
Resposta: C
Comentário: A terapia gênica consiste no tratamento de doenças genéticas pela introdução de genes saudáveis para compensar a
existência de genes defeituosos no doente. Através da técnica do DNA recombinante, que emprega enzimas de restrição para
cortar fragmentos específicos de DNA, é possível transferir os genes utilizados no tratamento para um vetor, e esse é então
aplicado no indivíduo doente. A mesma técnica pode ser utilizada para se promover doping genético, introduzindo em atletas
genes que levam a produção de substâncias que aumentem sua performance numa determinada atividade esportiva, como pelo
aumento da massa muscular. Assim, analisando cada item:
Item A: falso. Apesar de o doping genético ser bem semelhante a uma terapia gênica, não se pode afirmar que as vantagens que
ele oferece ao atleta são naturais.
Item B: falso. O doping genético não gera subprodutos que circulam no sangue e/ou são eliminados na urina, sendo difícil de
detectar.
Item C: verdadeiro. O doping genético usa técnicas de terapia genética para aumentar artificialmente parâmetros fisiológicos,
como a massa muscular de um indivíduo, com o objetivo de aumentar sua eficiência em determinado esporte.
Item D: falso. O doping genético não emprega células, mas genes que tenham a capacidade de aumentar o desempenho esportivo.
Item E: falso. A detecção do doping genético pela detecção de anticorpos contra o vírus utilizado como vetor, que não tem
relação com o vírus da gripe, sendo normalmente um retrovírus.

9.
Resposta: A
Comentário: Através da técnica do DNA recombinante, que emprega enzimas de restrição para cortar fragmentos específicos de
DNA, é possível transferir genes de interesse de um indivíduo para qualquer outro indivíduo. Organismos geneticamente
modificados (OGM) são aqueles que passaram por qualquer tipo de modificação por engenharia genética, sendo que nos seres
transgênicos essa modificação implica necessariamente na incorporação de genes de outra espécie, ou seja, possuem parte de sua
informação genética proveniente de outro ser vivo.

10.
Resposta: D
Comentário: A terapia gênica consiste no tratamento de doenças genéticas pela introdução de genes saudáveis para compensar a
existência de genes defeituosos no doente. Através da técnica do DNA recombinante, que emprega enzimas de restrição para
cortar fragmentos específicos de DNA, é possível transferir os genes utilizados no tratamento para um vetor, e esse é então
aplicado no indivíduo doente.

11.
Resposta: C
Comentário: A terapia gênica consiste no tratamento de doenças genéticas pela introdução de genes saudáveis para compensar a
existência de genes defeituosos no doente. Através da técnica do DNA recombinante, que emprega enzimas de restrição para
cortar fragmentos específicos de DNA, é possível transferir os genes utilizados no tratamento para um vetor, e esse é então
aplicado no indivíduo doente. No caso mais comum, utiliza-se um vírus modificado como vetor, ou seja, como veículo para a
introdução do gene terapêutico na célula receptora.

12.
Resposta: D
Comentário: A terapia gênica é uma técnica que usa princípios de engenharia genética para corrigir defeitos genéticos. No
procedimento mais comum, removem-se células do indivíduo a ser tratado, e adiciona-se a essas células vírus modificados com
um DNA recombinante com genes para corrigir o defeito em questão. A aplicação dos vírus recombinantes nas células fora do
corpo, o que se chama de técnica “ex vivo”, diminui o risco de reações imunes contra tais vírus. As células, já modificadas, são
então reintroduzidas no indivíduo a ser tratado. No caso descrito no texto, os genes BRCA, do termo em inglês BReast CAncer
(“câncer de mama”), são versões defeituosas de genes reguladores da divisão celular, aumentando o risco de câncer. Assim,
poderiam ser utilizados vírus recombinantes com versões adequadas dos referidos genes reguladores da divisão celular, evitando o
risco aumentado de câncer.

13.
Resposta: A
Comentário: Na técnica do DNA recombinante, as enzimas responsáveis por cortar fragmentos de DNA são denominadas
enzimas de restrição ou enzimas endonucleases de restrição.

14.
Resposta: B
Comentário: Através da técnica do DNA recombinante, que emprega enzimas de restrição para cortar fragmentos específicos de
DNA, é possível transferir genes de interesse de um indivíduo para qualquer outro indivíduo. A vacina de DNA consiste na
aplicação de um DNA recombinante contendo o gene para a produção do antígeno. Assim, o indivíduo vacinado passa a produzir
o antígeno em questão, e seu sistema imune reage produzindo anticorpos e células de memória contra o patógeno em questão.
Como o DNA é muito estável e terá atividade por toda a vida do indivíduo vacinado, a vacina de DNA mantém o estímulo ao
sistema imune para que produza anticorpos e células de memória de modo permanente, não havendo necessidade de doses extra
da vacina após um certo tempo. Desse modo, analisando cada item:
Item A: falso. Vacinas de DNA são constituídas por DNA microbiano enxertado em um vetor e adicionado a uma célula
receptora.
Item B: verdadeiro. Vacinas de DNA introduzem o DNA microbiano nas células do hospedeiro, sendo esse transcrito em RNAm
e traduzidos em proteínas microbianas.
Item C: falso. Vacinas de DNA levam à produção de proteínas microbianas, às quais induzem a formação de linfócitos B de
memória e anticorpos no hospedeiro.
Item D: falso. Para que se produzam vacinas de DNA contra vírus que possuem material genético de RNA, pode-se preparar a
vacina com DNA com uma sequência de nucleotídeos que é transcrita num RNAm que é traduzido em alguma proteína do vírus
em questão.
Item E: falso. Vacinas de DNA induziriam a produção de anticorpos permanentemente, por toda a vida do indivíduo receptor.

15.
Resposta: C
Comentário: Seres transgênicos são aqueles que receberam genes de outra espécie através da técnica do DNA recombinante em
Engenharia Genética. Assim, se os camundongos do texto receberam genes de celacanto, pode-se descrevê-los como transgênicos.
Assim, analisando cada item:
Item A: falso. Os celacantos do texto não são transgênicos, e sim os camundongos.
Item B: falso. Os camundongos são considerados transgênicos por terem recebidos os genes de celacanto por técnicas de
Engenharia Genética.
Item C: verdadeiro. Camundongos são mamíferos, os quais compartilham um ancestral comum com os peixes, como o
celacanto, o que justifica a atividade dos genes de celacanto nos camundongos.
Item D: falso. Os genes ativos relacionados ao desenvolvimento de membros do celacanto têm ação semelhante nos
camundongos transgênicos que receberam tais genes.
Item E: falso. O DNA dos camundongos transgênicos recebeu os nucleotídeos dos genes do celacanto e os incorporaram ao seu
genoma.

16.
Resposta: B
Comentário: Na técnica do DNA recombinante para a produção de organismos geneticamente modificados, utilizam-se enzimas
de restrição capazes de cortar trechos específicos de DNA. Essas enzimas, então, cortam o vetor (1), que é o DNA suporte para o
gene de interesse, o gene de interesse (2), que é o que se deseja transferir de um organismo a outro. O vetor pode ser o DNA de
um plasmídeo bacteriano ou de um vírus, e ao ser somado ao gene de interesse através da enzima DNA ligase, forma um DNA
recombinante (3). O DNA recombinante é introduzido em uma bactéria hospedeira, que passa a ser uma bactéria geneticamente
modificada (4), a qual se multiplica de modo assexuado por bipartição (cissiparidade) e origina várias cópias do DNA
recombinante (5), no que se chama de clonagem molecular. Várias espécies de bactérias podem ser utilizadas na técnica, como a
Escherichia coli, que pode então produzir a substância codificada pelo gene de interesse e virar uma biofábrica, ou a
Agrobacterium tumefaciens, que tem a habilidade de transferir um plasmídio recombinante para uma planta, tornando a mesma
geneticamente modificada.

17.
Resposta: E
Comentário: Através da técnica do DNA recombinante, que emprega enzimas de restrição para cortar fragmentos específicos de
DNA, é possível transferir genes de interesse de um indivíduo para qualquer outro indivíduo. Organismos geneticamente
modificados (OGM) são aqueles que passaram por qualquer tipo de modificação por engenharia genética, sendo que nos seres
transgênicos essa modificação implica necessariamente na incorporação de genes de outra espécie. Assim, a técnica pode
transferir genes de qualquer espécie para qualquer espécie, independentemente de sua classificação.

18.
Resposta: D
Comentário: Através da técnica do DNA recombinante, que emprega enzimas de restrição para cortar fragmentos específicos de
DNA, é possível transferir genes de interesse de um indivíduo para qualquer outro indivíduo. No caso em questão, para a
produção de bactérias modificadas com o gene para produção de hormônio do crescimento humano, utiliza-se o RNAm que
codifica esse hormônio como base para a produção do DNA com a informação a ser acrescentada na bactéria a ser modificada.
Para sintetizar DNA a partir de RNA, utiliza-se a enzima transcriptase reversa, encontrada em vírus conhecidos como retrovírus,
enzima essa capaz de sintetizar DNA a partir de um molde de RNA.

19.
Resposta: C
Comentário: Através da técnica do DNA recombinante, que emprega enzimas de restrição para cortar fragmentos específicos de
DNA, é possível transferir genes de interesse de um indivíduo para qualquer outro indivíduo. Assim, analisando cada item:
Item I: verdadeiro. Na técnica do DNA recombinante, a possibilidade de transferência de genes é ilimitada entre organismos de
diferentes espécies e até mesmo de diferentes domínios e filos.
Item II: verdadeiro. No cruzamento seletivo, a transferência de genes ocorre apenas dentro da mesma espécie, e apesar de os
criadores controlarem os cruzamentos para direcionar os genes que serão transmitidos à prole, essa transferência se dá ao acaso,
dependendo dos genótipos parentais.
Item III: falso. Como mencionado acima, na técnica do DNA recombinante, a possibilidade de transferência de genes é ilimitada
entre organismos de diferentes espécies e até mesmo de diferentes domínios e filos.
Item IV: verdadeiro. Dá-se o nome de vetor ao DNA ao qual o gene de interesse é adicionado, para que seja clonado e
transferido para a célula a ser modificada; o vetor pode ser um vírus modificado ou um plasmídio bacteriano.
Item V: falso. A possibilidade de criar “super-homens” geneticamente modificados para atuarem como soldados em guerras e
controle da sociedade em regimes totalitários não consiste num risco ambiental da engenharia genética. São riscos ambientais
associados à engenharia genética a produção de alimentos transgênicos, os quais podem transferir os transgenes para plantas
nativas, podendo alterá-las, e podem gerar plantas mais resistentes a agrotóxicos, que permitem aos produtores agrícolas usar
doses mais altas dessas substâncias, podendo afetar a vegetação nativa.

20.
Resposta: D
Comentário: Analisando cada item:
Item I: verdadeiro. Na biotecnologia aplicada, os organismos transgênicos, além de consistirem em bactérias, fungos, plantas ou
animais geneticamente melhorados pela introdução artificial de definidas características, podem funcionar como biorreatores para
a produção de proteínas valiosas ou para propósitos industriais.
Item II: verdadeiro. Organismo transgênico obtido deve ter como características principais: a capacidade de produzir a proteína
de interesse em grandes quantidades sem comprometer o funcionamento normal de suas células; a capacidade de passar esta
característica para a próxima geração e, no caso de ser um organismo multicelular como plantas e animais, a capacidade de
produzir a proteína exógena em um definido órgão.
Item III: falso. A engenharia genética clássica permite a transferência do material genético de um organismo para outro,
permitindo que as alterações no genoma do organismo sejam previsíveis, ao contrário do melhoramento genético clássico que
consiste na transferência de genes por meio de hibridação, misturando todo o conjunto de genes em combinações aleatórias.
Item IV: verdadeiro. A biotecnologia, processo também denominado como engenharia genética ou tecnologia do DNA
recombinante, contempla a manipulação direta do material genético das células (DNA), objetivando alterar pontualmente
características orgânicas ou introduzir novos caracteres genéticos nos seres vivos. Com a biotecnologia, virtualmente qualquer
gene de qualquer organismo pode ser isolado e transferido para o genoma de qualquer outro ser vivo, por mais divergente ou
distante que sejam na escala evolutiva. Sendo assim, é possível transferir para plantas, por exemplo, qualquer gene de fungos,
algas, animais, bactérias ou vírus.

21.
Resposta: B
Comentário: Através da técnica do DNA recombinante, que emprega enzimas de restrição para cortar fragmentos específicos de
DNA, é possível transferir genes de interesse de um indivíduo para qualquer outro indivíduo. Organismos geneticamente
modificados (OGM) são aqueles que passaram por qualquer tipo de modificação por engenharia genética, sendo que nos seres
transgênicos essa modificação implica necessariamente na incorporação de genes de outra espécie. As enzimas de restrição são
encontradas na natureza em bactérias, onde agem como proteção contra vírus bacteriófagos, ou seja, na remoção do DNA de vírus
bacteriófagos que tentem se incorporar ao genoma bacteriano. Cada uma das cerca de 30 enzimas de restrição conhecidas é obtida
em uma linhagem diferente de bactérias e corta um trecho diferente de DNA, específico para cada enzima.

22.
Resposta: C
Comentário: Através da técnica do DNA recombinante, que emprega enzimas de restrição para cortar fragmentos específicos de
DNA, é possível transferir genes de interesse de uma espécie para qualquer outra espécie. Indivíduos modificados por engenharia
genética para possuírem em seu genoma genes de outra espécie são conhecidos como seres transgênicos. Uma das principais
ferramentas a serem utilizadas na técnica mencionada são os plasmídeos, fragmentos circulares e desnudos (sem proteínas
histonas) de DNA extracromossomial bacteriano. A utilidade dos plasmídeos está em seu uso como vetores, suportes para o gene
de interesse que será transferido para o organismo a ser modificado.

23.
Resposta: C
Comentário: Evolução é o processo de mudanças nas frequências genéticas em uma população ao longo do tempo, sejam essas
mudanças benéficas ou prejudiciais (adaptativas ou não adaptativas), ou no sentido de aumentar ou diminuir a complexidade. A
atual diversidade de espécies vivas pode ser explicada pela evolução, ou seja, mudanças ocorridas nas várias formas de vida a
partir de um ancestral comum. Qualquer característica que tenha ocorrido no ancestral comum de todos os seres vivos deve estar
presente em todas as formas de vida atuais, como ocorre com a presença de membrana plasmática lipoproteica, material genético
obedecendo a um mesmo código genético universal, presença de ribossomos para a síntese protéica e moeda energética na forma
de ATP. A técnica do DNA recombinante, que permite a modificação genética pela introdução de genes de uma espécie em outra
para adicionar-lhe características de interesse, se baseia na existência de um código genético universal herdado de um ancestral
comum a todos os seres vivos.

24.
Resposta: D
Comentário: Através da técnica do DNA recombinante, que emprega enzimas de restrição para cortar fragmentos específicos de
DNA, é possível transferir genes de interesse de um indivíduo para qualquer outro indivíduo. Organismos geneticamente
modificados (OGM) são aqueles que passaram por qualquer tipo de modificação por engenharia genética, sendo que nos seres
transgênicos essa modificação implica necessariamente na incorporação de genes de outra espécie. Uma das utilidades da técnica
do DNA recombinante está na produção de vegetais que possuem genes que aumentam sua qualidade, como a resistência a certos
agrotóxicos. Nesse caso, um possível problema advindo do cultivo dessas plantas se dá pela transferência de genes da planta
transgênica cultivada para plantas não transgênicas na região. Como o principal mecanismo de transferência desses transgenes se
dá pelo cruzamento através da polinização, para impedir a transferência de transgenes da lavoura transgênica para a convencional,
deve-se impedir o contato do pólen da planta transgênica com a convencional.

25.
Resposta: B
Comentário: Através da técnica do DNA recombinante, que emprega enzimas de restrição para cortar fragmentos específicos de
DNA, é possível transferir genes de interesse de um indivíduo para qualquer outro indivíduo. Organismos geneticamente
modificados (OGM) são aqueles que passaram por qualquer tipo de modificação por engenharia genética, sendo que nos seres
transgênicos essa modificação implica necessariamente na incorporação de genes de outra espécie. As principais ferramentas
nessa técnica são as enzimas de restrição, que cortam o DNA em trechos específicos. Outras importantes ferramentas são os
vetores, como plasmídeos, que suportam o gene de interesse para clonagem e inserção no organismo a ser modificado e enzima
DNA ligase, que liga fragmentos de DNA distintos, formando o que se chama de DNA recombinante. Assim, para fabricar a
mangueira transgênica, primeiro há o corte do DNA de interesse (DNA a ser clonado) e do vetor (plasmídeo) por enzimas de
restrição, seguido da união dos mesmos por enzimas DNA ligase, formando então um plasmídio recombinante (inserção do gene
num vetor). Esse então é introduzido em uma bactéria (transfecção do gene) que, ao se reproduzir assexuadamente, cria várias
cópias do DNA recombinante (clonagem ou amplificação do gene). Posteriormente, esse DNA recombinante é transferido para a
mangueira que se deseja tornar transgênica.

26.
Resposta: C
Comentário: A terapia gênica consiste no tratamento de doenças genéticas pela introdução de genes saudáveis para compensar a
existência de genes defeituosos no doente. Através da técnica do DNA recombinante, que emprega enzimas de restrição para
cortar fragmentos específicos de DNA, é possível transferir os genes utilizados no tratamento para um vetor, e esse é então
aplicado no indivíduo doente. A mesma técnica pode ser utilizada para se promover doping genético, introduzindo em atletas
genes que levam a produção de substâncias que aumentem sua performance numa determinada atividade esportiva. Assim, a
injeção de novas cópias do gene do fator IGF-1 em células musculares estimularia o crescimento muscular e traria vantagens para
atletas em competições que envolvam necessidade de maior força física. Como o DNA é muito estável, o efeito proporcionado por
tais genes seria virtualmente permanente.
Observação:
- No item A: Apesar de novas cópias de RNAm para fator IGF-1 serem traduzidas nessa substância, o RNAm tem vida útil curta,
de modo que, quando sua atividade cessasse, a produção de fato IGF-1 também cessaria, e o ganho de crescimento muscular não
seria significativo;
- No item B: Anticorpos contra a proteína miostatina iriam bloquear seu efeito inibidor do crescimento, resultando em maior
crescimento da massa muscular; entretanto, anticorpos têm vida útil curta, de modo que sua ação não resultaria num ganho de
crescimento muscular seria significativo;
- No item D: Mesmo que a proteína miostatina mutada neutralizasse a ação na miostatina natural, proteínas não têm vida útil
muito longa, de modo que o efeito de ganho de crescimento muscular não seria significativo. - No item E: Anticorpos contra o
fator IGF-1 iriam impedir um ganho de crescimento muscular.

27.
Resposta: C
Comentário:
- A vacina clássica (I) consiste na aplicação de um antígeno, molécula orgânica estranha ao organismo humano, nesse caso
proveniente do patógeno causador da doença em questão. Assim, o indivíduo vacinado reage produzindo anticorpos e células de
memória contra o patógeno em questão, ficando imunizado. Infelizmente, as células de memória responsáveis pela imunização em
longo prazo têm uma vida útil limitada de cerca de 10 anos, havendo necessidade de uma nova dose da vacina após esse intervalo.
- a vacina de DNA (II) consiste na aplicação de um DNA recombinante contendo o gene para a produção do antígeno. Assim, o
indivíduo vacinado passa a produzir o antígeno em questão, e seu sistema imune reage produzindo anticorpos e células de
memória contra o patógeno em questão. Como o DNA é muito estável e terá atividade por toda a vida do indivíduo vacinado, a
vacina de DNA mantém o estímulo ao sistema imune para que produza anticorpos e células de memória de modo permanente, não
havendo necessidade de doses extra da vacina após um certo tempo.
Assim:
Item A: verdadeiro. Tanto na vacina clássica (I) como na vacina de DNA (II) há produção de anticorpos pelo sistema imune do
indivíduo vacinado.
Item B: verdadeiro. O código genético, ou seja, a relação entre códons no RNAm e aminoácido na proteína, é universal, ou seja,
idêntico em praticamente todas as formas de vida conhecidas, inclusive no patógeno e no camundongo.
Item C: falso. Na vacina clássica (I), o antígeno do patógeno é introduzido no indivíduo a ser vacinado, mas não produzido por
ele; na vacina de DNA (II), o gene do antígeno do patógeno é introduzido, de modo que o antígeno em si é produzido pelo
indivíduo vacinado.
Item D: verdadeiro. Na vacina de DNA (II), o mRNA do antígeno do patógeno é traduzido para a produção desse antígeno.

28.
Resposta: B
Comentário: Através da técnica do DNA recombinante, que emprega enzimas de restrição para cortar fragmentos específicos de
DNA, é possível transferir genes de interesse de um indivíduo para qualquer outro indivíduo. Organismos geneticamente
modificados (OGM) são aqueles que passaram por qualquer tipo de modificação por engenharia genética, sendo que nos seres
transgênicos essa modificação implica necessariamente na incorporação de genes de outra espécie. Assim:
Item A: verdadeiro. Antes do advento da técnica do DNA recombinante, a insulina para tratamento de diabéticos era obtida no
pâncreas de animais abatidos, num processo caro, demorado e que produzi uma insulina (suína) não idêntica à insulina humana.
Com a produção de seres transgênicos com genes para insulina humana, hoje a obtenção da insulina humana se dá através dessas
biofábricas.
Item B: falso. Seres transgênicos, por mais que possuem em seu genoma genes de outra espécie (como para a produção de
insulina humana), não são considerados pertencentes a novas espécies.
Item C: verdadeiro. Além de insulina humana, bactérias transgênicas podem ser produzidos para atuarem com biofábricas de
substâncias como hormônio do crescimento para o tratamento de nanismo e fator VIII para o tratamento de hemofilia A.
Item D: verdadeiro. Uma vez que a insulina produzida por bactérias transgênicas com genes para insulina humana é exatamente
idêntica à insulina humana, essa permite o tratamento para pacientes com intolerância à insulina suína.

29.
Resposta: VFVFV
Comentário:
1º item: verdadeiro. Após extraído das células, o DNA é multiplicado in vitro (clonado) com auxílio de uma DNA polimerase,
daí o nome dado a técnica de PCR.
2º item: falso. Enzimas de restrição cortam o DNA em um locus específico, em reação do tipo chave-fechadura.
3º item: verdadeiro. Plasmídios são elementos genéticos de origem bacteriana onde são armazenados os genes de interesse para
transferência entre organismos.
4º item: falso. Organismos transgênicos têm sua capacidade reprodutiva preservada.
5º item: verdadeiro. Genes de um vírus, por exemplo, que fossem inseridos na célula do hospedeiro seriam expressos de forma
independente do cromossomo celular, produzindo proteínas (antígenos) que induziriam a ativação de células B produtoras de
anticorpos.

30.
Resposta:
A) Incluindo-se no vírus modificado genes para produzir enzimas não produzidas devido a defeitos genéticos e aplicando-se o
vírus modificado no portador do defeito. Na imunodeficiência combinada severa ou doença da bolha, por exemplo, poderia ser
introduzido no vírus o gene para a produção da enzima ausente nos portadores, a ADA (adenosina-desaminase), permitindo que
seu sistema imune volte a funcionar.
B) No zigoto (se fosse possível), porque todas as células do indivíduo adulto são provenientes dele; com o defeito corrigido no
zigoto, todas as células do adulto serão normais.

31.
Resposta:
A)
I. Ativador Tecidual do Plasminogênio (TPA) / Estreptoquinase.
II.
Desvantagem: Não ocorrem as glicosilações inicial e sucessivas à fração protéica.
Justificativa: Procariotas não possuem Sistema de Endomembranas ou não possuem Retículo Endoplasmático Granular e Sistema
Golgiense.
III. A Universalidade do Código Genético.
B)
I. PCR / Reação em Cadeia da Polimerase.
II.
Finalidade 1: Impressão digital genética ou Identificação de pessoas.
Finalidade 2: Detecção de doenças hereditárias.
Finalidade 3: Construção de árvores filogenéticas.

32.
Resposta:
A) Sim, porque há a possibilidade de plasmídeos conterem genes cujos produtos de transcrição podem destruir substâncias tóxicas
às bactérias, como os antibióticos.
B) Os plasmídeos podem ser modificados geneticamente e serem usados como vetores para a implantação de genes em bactérias.
C) Insulina, Hormônio do crescimento.
D) universalidade do Código Genético.
E) Ferramenta: enzimas de restrição. Obtenção: bactérias.

33.
Resposta:
A) Através da técnica do DNA recombinante na engenharia genética, pode-se cortar um segmento de DNA humano com o gene
para a insulina humana através de enzimas de restrição, e posteriormente colar esse gene no DNA de uma bactéria previamente
cortado pela mesma enzima de restrição, sendo a colagem feita pela enzima DNA ligase.
B) Extração de insulina humana do pâncreas de cadáveres e extração de insulina suína a partir do pâncreas de porcos.

34.
Resposta:
A) planta transgênica é uma planta modificada por engenharia genética com genes de outra espécie; elas são de interesse
comercial porque são mais nutritivas, mais resistentes, etc...
B) o uso da planta autógama e sem parentes silvestres no Brasil é mais seguro por não haver riscos de transferir genes para as
plantas silvestres.

35.
Resposta:
A) A terapia gênica consiste na cura de defeitos genéticos pela introdução de genes normais em células de indivíduos doentes.
B) “... usaram um retrovírus para introduzir uma cópia correta do gene nestas células.”

36.
Resposta:
A) Célula germinativa ou célula meristemática. Esta célula é precursora de todas as demais células de uma planta. Logo, se ela
possuir o gene da petúnia que define a cor azul, a roseira que dela se originar também apresentará o gene para a produção do
pigmento azul.
B) Não há possibilidade. Para que a expressão da enzima seja contínua, essa informação deve estar contida em um segmento de
DNA, pois os RNA mensageiros transcritos a partir desse gene não se replicam, sendo degradados ao final de algum tempo.

37.
Resposta:
A) O melhoramento genético envolve a transferência de vários genes de uma vez através do cruzamento de indivíduos
selecionados com genes para as características desejadas; a transgenia permite a transferência de um único gene através de
técnicas de engenharia genética.
B) O cruzamento no melhoramento genético envolve a possibilidade de geração de várias categorias de descendentes, nem sempre
tendo todos eles as características desejadas; a transgenia permite a transferência precisa de todos os genes desejados para o
indivíduo que se deseja modificar.

38.
Resposta:
A) Nas células da medula óssea existem células precursoras dos eritrócitos. Após receberem a cópia do gene, que codifica a cadeia
peptídica da hemoglobina, essas células se diferenciarão em eritrócitos que produzirão a hemoglobina normal.
B) O retrovírus modificado mostrado no esquema IV. Essa partícula viral tem a capacidade de inserir a cópia do gene da cadeia ß
da hemoglobina no cromossomo das células hospedeiras, porque contém as enzimas transcriptase reversa e integrase. Além disso,
não tem a capacidade de produzir novas partículas virais que infectariam as outras células do paciente, pois o trecho X do ácido
nucleico do vírus original foi retirado.

39.
Resposta: As bactérias transferirão com certeza seus genes para os descendentes, o que não acontece com células eucarióticas,
uma vez que, por meiose, podem ou não transferir os transgenes para os gametas.

40.
Resposta:
A1) etapa II. A2) etapa I. A3) etapa III.
B) Organismos ou indivíduos em que genes de uma outra espécie são deliberadamente introduzidos por meio de engenharia
genética.
1.
Resposta: D
Comentário: O DNA mitocondrial tem origem exclusivamente materna, uma vez que o DNA do espermatozoide não permanece
no zigoto, uma vez que as mitocôndrias paternas se degeneram. Dessa forma, deverá haver coincidência entre o DNA
mitocondrial do rapaz e de sua linhagem materna, ou seja, mãe e avó materna.

2.
Resposta: C
Comentário: O exame de DNA fingerprint (“impressão digital de DNA”) para paternidade é feito pelo corte do DNA dos
indivíduos envolvidos (criança, supostas mães e supostos pais) através de enzimas de restrição específicas seguido pela separação
dos fragmentos de DNA através da técnica de eletroforese. Essa separação resulta num padrão de fragmentos de DNA (bandas)
que é único em cada pessoa, excetuando-se gêmeos univitelinos, e herdado metade do pai e metade da mãe. Os pais biológicos da
criança são aqueles em que ocorre coincidência de todas as bandas da criança com as do pai e as da mãe. Veja:

As três
faixas
marcadas
indicam
bandas do
bebê que só
aparecem
na mãe do
casal 3

A faixa
marcada
indica uma
banda do
bebê que só
aparece na
pai do casal
3

Assim, conclui-se que o casal 3 é o de pais da criança.

3.
Resposta: A
Comentário: Através das técnicas de exame de DNA, que emprega a eletroforese para separar fragmentos específicos de DNA
em um gel, com posterior marcação de fragmentos de DNA de interesse por marcações radioativas chamadas sondas, é possível
identificar um indivíduo pela comparação de sua região hipervariável de DNA com a região hipervariável de DNA de seus pais,
de quem o indivíduo herdou todo o seu material genético. O texto descreve a aplicação da técnica em identificar a identidade de
uma vítima de acidente pelo DNA de seus restos mortais, o que pode ser feito comparando seu DNA com de seus pais para
verificar se há compatibilidade ou não. Segundo o texto, “o número de cópias de um mesmo cromossomo por célula maximiza a
chance de se obter moléculas não degradadas pelo calor da explosão”, aumentando as chances de se obter DNA viável da vítima
para comparação com o DNA de seus pais. Entre as opções, os peritos necessitam escolher, entre cromossomos autossômicos (em
cada célula, duas cópias de DNA de cada par de autossomos), cromossomos sexuais (em cada célula, duas cópias de DNA de
cromossomo X em mulheres e uma cópia de cromossomo X e outra de cromossomo Y em homens) ou DNA mitocondrial (em
cada célula, milhares de cópias, uma vez que há milhares de mitocôndrias, cada qual com um DNA mitocondrial). Assim, como
há mais cópias de DNA mitocondrial por célula, a maior chance de obter DNA não degradado pela explosão é exatamente pela
análise desse DNA mitocondrial.

4.
Resposta: D
Comentário: Mosaico é o termo que descreve, em genética, um indivíduo que apresenta células de constituição genética distinta,
podendo surgir devido a várias situações, sendo a mais comum a ocorrência de mutações somáticas, ou seja, mutações em células
não sexuais, as quais não são hereditárias. Em exames de DNA, a ocorrência de mosaicos pode dificultar a análise de paternidade
e a identificação de criminosos, uma vez que a coleta de DNA das células diferentes do indivíduo em mosaico mostra um DNA
diferente da maioria das células do indivíduo. Assim, analisando cada item:
Item A: falso. O mosaicismo pode surgir a partir de mutações espontâneas, mas não necessariamente resultam em lesões
malignas, ou seja, cânceres.
Item B: falso. O mosaicismo pode ocorrer em poucas células de um indivíduo que, adulto, tem trilhões de células, sendo muitas
vezes difícil de ser identificado.
Item C: falso. Se o mosaicismo ocorrer no embrião antes da separação das células germinativas (que podem sofrer meiose para
originar os gametas) e das células somáticas (que não podem sofrer meiose e não têm relação direta com a reprodução). Se essa
mutação ocorrer nas células que originam as células germinativas, todos os gametas do indivíduo terão o gene mutante e,
consequentemente, 100% de seus descendentes terão o gene mutante; se essa mutação ocorrer nas células que originam somente
as células somáticas, nenhum dos gametas do indivíduo terá o gene mutante e, consequentemente, 100% de seus descendentes não
terão o gene mutante.
Item D: verdadeiro. A análise de várias células de um indivíduo através do exame de DNA pode indicar quais são aquelas
portadoras de mosaicismo pela sequência diferente de nucleotídeos em seu DNA mutante.
Item E: falso. No exame de DNA fingerprint (“impressão digital de DNA”) para a identificação de criminosos, compara-se o
DNA de uma amostra encontrada no local do crime com o DNA do suspeito, sendo confirmado que a amostra de DNA é
realmente do suspeito apenas se houver 100% de coincidência entre os DNA analisados. Assim, mesmo que uma outra pessoa
apresente uma mutação semelhante à do suspeito, é impossível que apresente 100% de coincidência em relação a sequência de
nucleotídeos, de modo a não haver risco de uma pessoa ser condenada injustamente pelo crime. Entretanto, o criminoso portador
de mosaicismo pode não ser identificado positivamente caso a amostra de DNA no local do crime seja comparada com uma célula
com DNA diferente daquele da amostra.

5.
Resposta: C
Comentário: Eritrócitos ou hemácias ou glóbulos vermelhas são células anucleadas do sangue, não possuindo núcleo e,
consequentemente, não possuindo DNA que possa ser utilizado na realização de exames de DNA.

6.
Resposta: B
Comentário: Genoma é o conjunto de todos os genes de um indivíduo (ou espécie). “Projetos Genoma” têm o objetivo de
sequenciar os genes de um indivíduo (ou espécie), ou seja, determinar a sequência de bases nitrogenadas no DNA de cada gene.
Identificando a sequência de cada gene, pode-se deduzir a sequência de bases de seus respectivos RNAm e, através do código
genético (relação entre códons e aminoácidos), deduzir a sequência de aminoácidos no peptídio codificado, para então determinar
a função de cada gene.

7.
Resposta: B
Comentário: Analisando cada item:
Item I: falso. A compreensão das funções de cada gene pode elucidar os mecanismos por trás de várias doenças e auxiliar no seu
tratamento, mas não se pode afirmar que todas as doenças passarão a ter cura.
Item II: verdadeiro. A identificação de genes relacionados a doenças e sua detecção em indivíduos através de técnicas de exame
de DNA proporcionarão um diagnóstico precoce de doenças genéticas e de fundo genético.
Item III: verdadeiro. A identificação da função de cada gene vai permitir a associação de determinado gene a alguma condição
patológica em particular.
Item IV: falso. Não há métodos preventivos contra doenças hereditárias. Entretanto, a identificação de genes relacionados a
doenças nos genitores pode permitir, através de aconselhamento genético, que casais com alto risco de terem filhos doentes optem
por não ter crianças, bem como a identificação de embriões com genes para doenças em técnicas de fertilização in vitro permitirão
a seleção de embriões saudáveis para a gravidez.

8.
Resposta: D
Comentário: A técnica de PCR (Reação em Cadeia de Polimerase) emprega uma enzima denominada TAQ polimerase, extraída
de bactérias Thermus aquaticus, para produzir várias cópias de uma molécula de DNA, num processo denominado clonagem ou
amplificação de DNA, útil em técnicas como a técnica do DNA recombinante (para criar cópias do DNA recombinante a ser
introduzido no organismo a ser modificado) e do exame de DNA (para criar cópias de uma amostra de DNA até que se obtenha
DNA suficiente para a eletroforese). A alta temperatura a que se submete o DNA tem objetivo de desnaturar as fitas de DNA, ou
seja, quebrar as pontes de hidrogênio para separar as fitas e expor suas bases nitrogenadas para que se promova a replicação do
mesmo.

9.
Resposta: C
Comentário: A técnica de PCR (Reação em Cadeia de Polimerase) emprega uma enzima denominada TAQ polimerase, extraída
de bactérias Thermus aquaticus, para produzir várias cópias de uma molécula de DNA, num processo denominado clonagem ou
amplificação de DNA, útil em técnicas como a técnica do DNA recombinante (para criar cópias do DNA recombinante a ser
introduzido no organismo a ser modificado) e do exame de DNA (para criar cópias de uma amostra de DNA até que se obtenha
DNA suficiente para a eletroforese).

10.
Resposta: A
Comentário: O exame de DNA permite a identificação de indivíduos pelo seu DNA, podendo ser usado em análises de casos em
criminalística. Nesse caso, o DNA do suspeito de um crime é comparado com o de alguma prova no local do crime, como gotas de
sangue, fios de cabelo ou esperma. No teste, o DNA do indivíduo e da prova são fragmentado por meio de enzimas de restrição.
Os fragmentos são separados pela técnica de eletroforese, que separa as moléculas de DNA pelo tamanho, de modo que cada
molécula de DNA aparece no diagrama de eletroforese como uma banda. Fragmentos idênticos de amostras distintas assumem a
mesma posição no diagrama de eletroforese. São utilizadas, então, sondas radioativas complementares ao DNA não codificante
(“DNA lixo”), para marcá-lo. Uma vez que este é hipervariável, varia enormemente de um indivíduo para outro, de modo que
cada indivíduo (excetuando-se gêmeos univitelinos) tem um padrão único de bandas marcadas com as referidas sondas. Assim, a
coincidência da posição de bandas de amostras distintas no diagrama de eletroforese indica igualdade entre elas, permitindo a
confirmação de que o DNA na amostra do suspeito é idêntico àquele da amostra obtida na prova no local do crime, confirmando
que a amostra é do suspeito. Assim, no caso em questão, deve-se comparar no diagrama fornecido o DNA do réu (2) com o da
amostra masculina obtida na vagina da vítima (4). Observe:

Discordante
entre o
suspeito e a
amostra

Coincidente
entre o
suspeito e a
amostra

Conclui-se então, que a amostra na fração masculina do esfregaço vaginal não possui DNA correspondente ao do réu (como o
DNA deve ser idêntico, todas as bandas deveriam ser coincidentes entre o DNA do réu e da amostra).

11.
Resposta: C
Comentário: Através das técnicas de exame de DNA, que emprega a eletroforese para separar fragmentos específicos de DNA
em um gel, com posterior marcação de fragmentos de DNA de interesse por marcações radioativas chamadas sondas, é possível
identificar um indivíduo pela comparação de sua região hipervariável de DNA com a região hipervariável de DNA de seus pais,
de quem o indivíduo herdou todo o seu material genético. O texto descreve a aplicação da técnica em identificar a paternidade de
um indivíduo pela comparação de seu DNA com o de seu suposto pai verificar se há compatibilidade ou não.
- Na dúvida entre dois irmãos gêmeos dizigóticos (bivitelinos) em relação à paternidade de uma criança, o exame de DNA pode
indicar corretamente o pai, uma vez que o material genético dos gêmeos dizigóticos não é igual (1ª situação, com Alfredo).
- Na dúvida entre dois irmãos gêmeos monozigóticos (univitelinos) em relação à paternidade de uma criança, o exame de DNA
não tem serventia alguma, uma vez que gêmeos monozigóticos possuem DNA exatamente idêntico, de modo que ambos terão o
DNA igualmente compatível com o da criança em questão (2ª situação, com Renato).

12.
Resposta: B
Comentário: Analisando as afirmações de cada estudante:
- Ao afirmar que a identidade genética individual pode ser estabelecida pela técnica DNA fingerprint, ou impressão digital
genética, EDUARDO está correto, mas como esta técnica compara trechos de DNA não codificante (“DNA lixo”), sua afirmação
como um todo está incorreta.
- Ao afirmar que enzimas de restrição podem cortar o DNA em pontos determinados, MARIANA está correta.
- Ao afirmar que plasmídeos são vetores na técnica do DNA recombinante, LAURA está correta (dá-se o nome de vetor ao DNA
ao qual o gene de interesse é adicionado, para que seja clonado e transferido para a célula a ser modificada; o vetor pode ser um
vírus modificado ou um plasmídio bacteriano).
- Genoma é o conjunto de genes de um indivíduo ou espécie, sendo o proteoma o conjunto de proteínas expressas pelo genoma, de
modo que a afirmação de RAFAEL está correta.
- A vacina de DNA consiste na aplicação de um DNA recombinante contendo o gene para a produção do antígeno. Assim, o
indivíduo vacinado passa a produzir o antígeno em questão, e seu sistema imune reage produzindo anticorpos e células de
memória contra o patógeno em questão. Desse modo, a afirmação de JOANA está incorreta, uma vez que as vacinas genéticas não
inoculam microrganismos, mas seu material genético.
13.
Resposta: A
Comentário: O exame de DNA permite a identificação de indivíduos pelo seu DNA, podendo ser usado em casos de
determinação de paternidade ou da identidade de indivíduos envolvidos em crimes. Assim, analisando cada item:
Item A: verdadeiro. Segundo o texto, o uso de versões simplificadas do exame de DNA, bem como trocas de exames e erros de
interpretação podem levar a resultados equivocados, de modo que a regulamentação e a fiscalização dos laboratórios pode reduzir
a ocorrência de erros.
Item B: falso. A análise dos grupos sanguíneos, como no sistema ABO, não permite a confirmação da paternidade, mas no
máximo a exclusão da mesma, e ainda assim com a possibilidade de erros devido a fenômenos como o fenótipo Bombaim ou falso
O.
Item C: falso. O exame de DNA pode ter aplicações criminais através da comparação do DNA de suspeitos com o DNA de
amostras de encontradas em locais onde ocorreram crimes.
Item D: falso. Na dúvida entre dois irmãos gêmeos monozigóticos (univitelinos) em relação à paternidade de uma criança, o
exame de DNA não tem serventia alguma, uma vez que gêmeos monozigóticos possuem DNA exatamente idêntico, de modo que
ambos terão o DNA igualmente compatível com o da criança em questão.
Item E: falso. O exame de DNA pode ser feito com quaisquer amostras de DNA, como aquelas encontradas em fios de cabelo ou
em qualquer célula nucleada. É importante lembrar que hemácias de mamíferos são anucleadas, e trombócitos (ou plaquetas) são
fragmentos anucleados de células, não possuindo DNA, e não podendo ser utilizados nos exames de DNA.

14.
Resposta: E
Comentário: Os exames de DNA permitem a comparação de DNA entre amostras distintas para fins diversos como determinação
de paternidade, identificação de cadáveres e identificação de criminosos. Analisando cada item:
Item A: falso. O DNA pode ser destruído em situações extremas, como ocorre em temperaturas elevadas que ocorrem em
incêndios e explosões. No entanto, pode ser encontrada alguma amostra intacta de DNA nos tecidos carbonizados, a qual, mesma
em pequenas quantidades, pode ser usada em exames de DNA.
Item B: falso. A quantidade de DNA nuclear na célula é bem maior que a de DNA mitocondrial. No caso da identificação de
corpos carbonizados, o DNA mitocondrial é muito útil por apresentar-se em várias cópias com sequências idênticas de
nucleotídeos, o que possibilita uma maior chance de que parte desse DNA mitocondrial esteja intacto para a comparação com o
DNA de parentes próximos.
Item C: falso. A tipagem sanguínea não é 100% confiável para a determinação de paternidade.
Item D: falso. O DNA mitocondrial é inteiramente herdado da mãe, uma vez que as mitocôndrias dos espermatozoides
degeneram após a fecundação.
Item E: verdadeiro. Como o DNA mitocondrial é de origem materna, não pode ser usado na determinação da paternidade.

15.
Resposta: D
Comentário: O termo Eugenia designa o estudo dos agentes sob o controle social que podem melhorar ou empobrecer as
qualidades raciais das futuras gerações seja física ou mentalmente. Na prática, a Eugenia visa a eliminação de defeitos genéticos
de uma população, semdo um tema muito controverso e sujeito a questionamentos éticos. Ao longo da história da humanidade,
especialmente nos regimes totalitários da primeira metade do século XX, práticas eugenistas incluíram a segregação, a castração e
até a eliminação de indivíduos doentes ou de “raças” consideradas inferiores pelos grupos dominantes. Com os resultados obtidos
com o Projeto Genoma Humano e a identificação de genes relacionados a doenças ou ao risco de doenças, existe um sério receio
de que esses dados venham a ser usadas em práticas eugenistas, com discriminação genética e seleção de embriões. Como o termo
diz respeito a humanos, o melhoramento genético das raças de rebanhos bovinos não é considerado uma prática de Eugenia.

16.
Resposta: C
Comentário: O exame de DNA consiste basicamente na fragmentação do DNA dos indivíduos analisados através de enzimas de
restrição e posterior separação dos fragmentos de DNA (“bandas”) pela técnica de eletroforese. Variações na sequência de
nucleotídeos do DNA (“polimorfismos”) podem ser detectadas através da marcação de bandas com sondas radioativas, trechos de
nucleotídeos modificados com isótopos radioativos e complementares a um DNA de interesse (“marcador”), como um gene ou um
trecho de DNA não codificante (“DNA lixo”). O padrão de bandas dos indivíduos é então comparado. Apenas indivíduos
geneticamente idênticos, como clones e irmãos gêmeos univitelinos apresentam padrão de bandas idêntico, sendo esse padrão de
bandas normalmente único para cada indivíduo de cada espécie. Dentro de cada espécie, entretanto, alguns padrões de bandas de
DNA se mostram comuns a todos os indivíduos daquela espécie, permitindo a identificação de uma espécie em particular de seres
vivos. Assim:
Item A: falso. Na técnica do exame de DNA, utiliza-se enzimas de restrição que cortam sequências específicas de DNA,
ocorrendo invariavelmente o corte do DNA em vários trechos e gerando várias bandas. A ocorrência de polimorfismos pode gerar
cortes em regiões diferentes, produzindo fragmentos maiores ou menores que o normal, e/ou marcáveis ou não marcáveis por uma
sonda específica, o que faz com que o padrão geral de bandas, inclusive aquelas marcadas por sondas, se mostre diferente.
Item B: falso. Apesar de todos os indivíduos de uma mesma espécie possuírem alguns padrões em comum de bandas de DNA, o
padrão geral de cada indivíduo é único, como já mencionado, excetuando-se clones e irmãos gêmeos univitelinos.
Item C: verdadeiro. Os polimorfismos de DNA podem ser analisados pela quebra do DNA do genoma uma enzima de restrição
apropriada, seguida pela identificação de bandas específicas através, por exemplo, de sondas radioativas. A identificação de uma
banda dentro dos fragmentos de DNA resultantes do corte com as enzimas de restrição se dá por eletroforese, que separa esses
fragmentos de DNA pelo tamanho. Polimorfismos, como, por exemplo, genes alelos de um mesmo locus, resultam em bandas de
tamanhos diferentes.
Item D: falso. Combinando técnicas de genética clássica e de genética molecular, é possível estimar a localização de um
determinado marcador genético no cromossomo.
Item E: falso. Existem algumas poucas enzimas de restrição conhecidas, sendo que cada uma delas corta o DNA em uma
sequência específica de nucleotídeos. Em relação aos alelos, ocorrem apenas poucos alelos para um gene, normalmente apenas
dois, sendo o dominante e o recessivo, ocorrendo em alguns poucos casos múltiplos alelos para um gene, como no caso do sistema
ABO de grupos sanguíneos. Um alelo recessivo surge por mutação do alelo dominante, sendo que essa mutação pode ocorrer em
vários pontos do DNA, de modo que cada alelo pode ser caracterizado por vários polimorfismos. Entretanto, vários polimorfismos
não necessariamente caracterizam vários alelos, pois podem ocorrer em genes diferentes (não alelos) ou mesmo em segmentos de
DNA não codificante (“DNA lixo”).

17.
Resposta: B
Comentário: A técnica de PCR (Reação em Cadeia de Polimerase) emprega uma enzima denominada TAQ polimerase, extraída
de bactérias Thermus aquaticus, para produzir várias cópias de uma molécula de DNA, num processo denominado clonagem ou
amplificação de DNA, útil em técnicas como o exame de DNA para criar cópias de uma amostra de DNA de interesse até que se
obtenha DNA suficiente para a eletroforese. Esse DNA de interesse pode ser um gene em particular, no caso do diagnóstico
genético de doenças, ou DNA lixo (hipervariável), como as VNTR (trechos de DNA lixo com número variável de repetições de
seqüências curtas de bases nitrogenadas) no DNA fingerprint para identificação de pessoas em criminalística ou análise de
parentesco. Assim:
Item I: verdadeiro. Antes da PCR, para que se pudesse visualizar as bandas de eletroforese, havia a necessidade de se ter grande
quantidade de DNA de interesse.
Item II: falso. A PCR apenas copia trechos do DNA in vitro, ou seja, fora de organismos vivos, usando DNA polimerases de
bactérias.
Item III: verdadeiro. A técnica da PCR permitiu a obtenção de grandes quantidades de DNA de interesse através de ciclo de
replicação (amplificação).
Item IV: falso. O DNA a ser amplificado é submetido a temperaturas altas, acima de 40°C para desnaturar as fitas de DNA, ou
seja, quebrar as pontes de hidrogênio para separar as fitas e expor suas bases nitrogenadas para que se promova a replicação do
mesmo; ao baixar a temperatura, o DNA renatura, uma vez que apenas pontes de hidrogênio entre adenina e timina e entre
guanina e citosina podem ocorrer.

18.
Resposta: A
Comentário: Genoma é o conjunto de todos os genes de um indivíduo (ou espécie). “Projetos Genoma” têm o objetivo de
seqüenciar os genes de um indivíduo (ou espécie), ou seja, determinar a seqüência de bases nitrogenadas no DNA de cada gene.
Identificando a seqüência de cada gene, pode-se deduzir a seqüência de bases de seus respectivos RNAm e, através do código
genético (relação entre códons e aminoácidos), deduzir a seqüência de aminoácidos no peptídio codificado, para então determinar
a função de cada gene.

19.
Resposta: C
Comentário: Genoma é o conjunto de todos os genes de um indivíduo (ou espécie). “Projetos Genoma” têm o objetivo de
seqüenciar os genes de um indivíduo (ou espécie), ou seja, determinar a seqüência de bases nitrogenadas no DNA de cada gene.
Identificando a seqüência de cada gene, pode-se deduzir a seqüência de bases de seus respectivos RNAm e, através do Código
Genético (relação entre códons e aminoácidos), deduzir a seqüência de aminoácidos no peptídio codificado, para então determinar
a função de cada gene. O Código Genético é conhecido desde o início da década de 1960, e sabe-se que ele é universal, ou seja,
essencialmente o mesmo para todas as formas de vida.

20.
Resposta: A
Comentário: Os fragmentos de diferentes tamanhos, gerados pelo corte de um DNA com determinada endonuclease de restrição,
podem ser separados uns dos outros por meio de uma técnica denominada eletroforese. O processo de eletroforese é realizado em
uma placa de gelatina especial (gel); a solução contendo os fragmentos de DNA é colocada em fendas em uma das extremidades
do gel, à qual é conectado o pólo negativo de uma fonte geradora de corrente elétrica; ao pólo oposto do gel é ligado o pólo
positivo da fonte. A aplicação de uma diferença de potencial na placa de gel faz os fragmentos de DNA se deslocarem em direção
ao pólo positivo, uma vez que eles possuem carga elétrica negativa. Quanto menor o tamanho dos fragmentos, maior a velocidade
com que eles se deslocam. Quando o campo elétrico é desligado, fragmentos de mesmo tamanho estacionam juntos em determina-
da posição na placa de gelatina, formando uma faixa, ou banda. Pela medida da distância relativa de migração das bandas, é
possível calcular o peso molecular, e conseqüentemente o tamanho, dos fragmentos de DNA que as constituem. Assim, o
fragmento F1 possui o maior peso molecular (2 × 109), de modo a apresentar a menor velocidade de migração, o fragmento F3
possui o segundo maior peso molecular (1 × 107), de modo a apresentar a segunda menor velocidade de migração, e o fragmento
F2 possui o terceiro maior peso molecular (1 × 106), ou seja, o menor peso molecular, a apresentando a terceira menor velocidade
de migração, ou seja, a maior velocidade de migração.
21.
Resposta: A
Comentário: Os fragmentos de diferentes tamanhos, gerados pelo corte de um DNA com determinada endonuclease de restrição,
podem ser separados uns dos outros por meio de uma técnica denominada eletroforese. O processo de eletroforese é realizado em
uma placa de gelatina especial (gel); a solução contendo os fragmentos de DNA é colocada em fendas em uma das extremidades
do gel, à qual é conectado o pólo negativo de uma fonte geradora de corrente elétrica; ao pólo oposto do gel é ligado o pólo
positivo da fonte. A aplicação de uma diferença de potencial na placa de gel faz os fragmentos de DNA se deslocarem em direção
ao pólo positivo, uma vez que eles possuem carga elétrica negativa. Quanto menor o tamanho dos fragmentos, maior a velocidade
com que eles se deslocam. Quando o campo elétrico é desligado, fragmentos de mesmo tamanho estacionam juntos em determina-
da posição na placa de gelatina, formando uma faixa, ou banda. Pela medida da distância relativa de migração das bandas, é
possível calcular o peso molecular, e consequentemente o tamanho, dos fragmentos de DNA que as constituem. A técnica de
eletroforese é possível porque a molécula de DNA possui carga elétrica negativa proporcionada pela abundância de grupos fosfato
(PO 4 ---), um dos componentes dos desoxirribonucleotídeos.

22.
Resposta: A
Comentário: A técnica de sequenciamento de bases nitrogenadas de uma cadeia de DNA baseia-se na construção de cadeias
complementares ao DNA a ser sequenciado, utilizando nucleotídeos normais de DNA (desoxirribonucleotídeos) e nucleotídeos
especiais (didesoxirribonucleotídeos), com um hidrogênio no carbono 3’, ao invés da hidroxila que normalmente ocorre; esses não
permitem a adição de novos nucleotídeos para o crescimento da cadeia, uma vez que não possuem a hidroxila do carbono 3’ para
fazer uma ligação fosfodiéster 3’5’. Assim, uma vez que uma nova cadeia de DNA produzida incorpora um nucleotídeo especial,
não pode mais receber nucleotídeos, e seu crescimento é interrompido.

Várias cópias da cadeia de DNA a ser sequenciada são feitas, com nucleotídeos normais e nucleotídeos especiais, gerando cópias
do DNA com comprimentos diversos, desde aquelas que possuem todos os nucleotídeos a serem sequenciados, como aquelas que
possuem um nucleotídeo a menos (por terem incorporado como penúltimo nucleotídeo um didesoxirribonucleotídeo que
interrompe o crescimento da cadeia impedindo a adição do último nucleotídeo), como aquelas que possuem dois nucleotídeos a
menos (por terem incorporado como antepenúltimo nucleotídeo um didesoxirribonucleotídeo que interrompe o crescimento da
cadeia impedindo a adição dos dois últimos nucleotídeos), e daí por diante. Essas várias cadeias de comprimentos diversos são
então separadas por eletroforese, gerando uma gradação de cadeias de DNA no diagrama de eletroforese, da maior (com todos os
nucleotídeos a serem sequenciados) para a menor (com apenas um nucleotídeo a ser sequenciado, uma vez que a cadeia iniciou
sua formação já pelo didesoxirribonucleotídeo que interrompe o crescimento da cadeia). Assim, basta analisar o último
nucleotídeo de cada banda do diagrama de eletroforese que se tem o sequenciamento das bases nitrogenadas, de cima para baixo
no diagrama, do último para o primeiro nucleotídeo no DNA. Para identificar a base nitrogenada do último nucleotídeo contido na
banda (didesoxirribonucleotídeo), este é marcado com material radioativo. Observe que o sequenciamento é feito na verdade com
a cadeia complementar à original, uma vez que se sequencia a cadeia filha gerada na replicação. Assim, se a sequência em análise
é GTACTCGA, serão produzidas na replicação do DNA cadeias complementares ACTGAGCT (com 8 nucleotídeos), ACTGAGC
(com 7 nucleotídeos), ACTGAG (com 6 nucleotídeos), etc, já organizadas abaixo no diagrama de eletroforese (com o nucleotídeo
sublinhado sendo o didesoxirribonucleotídeo que interrompe a replicação):
ACTGAGCT 8ª base
Pólo negativo
(fragmentos
maiores)

ACTGAGC 7ª base
Sentido de
migração dos
ACTGAG 6ª base
fragmentos de
DNA (lembre-se
que o DNA tem
ACTGA 5ª base
carga elétrica
negativa devido a
seus grupos
ACTG 4ª base
fosfato)
ACT 3ª base
AC 2ª base
Pólo positivo
(fragmentos
menores)
A 1ª base
Ou, lendo no diagrama de eletroforese do texto:

Pólo negativo
(fragmentos
maiores)

8ª base

7ª base

6ª base

5ª base

4ª base

3ª base

2ª base
Pólo positivo
(fragmentos
1ª base
menores)

23.
Resposta: D
Comentário: Os fragmentos de diferentes tamanhos, gerados pelo corte de um DNA com determinada endonuclease de restrição,
podem ser separados uns dos outros por meio de uma técnica denominada eletroforese. O processo de eletroforese é realizado em
uma placa de gelatina especial (gel); a solução contendo os fragmentos de DNA é colocada em fendas em uma das extremidades
do gel, à qual é conectado o pólo negativo de uma fonte geradora de corrente elétrica; ao pólo oposto do gel é ligado o pólo
positivo da fonte. A aplicação de uma diferença de potencial na placa de gel faz os fragmentos de DNA se deslocarem em direção
ao pólo positivo, uma vez que eles possuem carga elétrica negativa. Quanto menor o tamanho dos fragmentos, maior a velocidade
com que eles se deslocam. Quando o campo elétrico é desligado, fragmentos de mesmo tamanho estacionam juntos em determina-
da posição na placa de gelatina, formando uma faixa, ou banda. Pela medida da distância relativa de migração das bandas, é
possível calcular o peso molecular, e consequentemente o tamanho, dos fragmentos de DNA que as constituem. Após a
fragmentação da molécula de DNA representada, nos pontos de corte indicados, a eletroforese separa os fragmentos, do polo
negativo para o polo positivo, do maior para o menor. Assim, a leitura do pólo positivo para o pólo negativo será do menor
fragmento para o maior (no caso da questão, o tamanho dos fragmentos é determinado visualmente, por aproximação): C (menor)
– G – F – D – E – A – B (maior).

24.
Resposta: D
Comentário: Analisando cada item:
Item I: verdadeiro. Na técnica do DNA recombinante, o vetor é o suporte para um gene de interesse a ser introduzido no
organismo que se deseja modificar. O vetor mais comumente usado são plasmídeos bacterianos, que correspondem a fragmentos
circulares e desnudos de DNA extracromossomial em bactérias.
Item II: verdadeiro. O corte do DNA na técnica do DNA recombinante é feito por intermédio de enzimas de restrição, as quais
fragmentam o DNA em trechos com sequências nucleotídicas específicas.
Item III: falso. Se duas diferentes moléculas de DNA forem cortadas por uma mesma enzima de restrição, serão produzidos
diferentes conjuntos de fragmentos, uma vez que as sequências nucleotídicas que são sítio para ação das enzimas de restrição
estarão em regiões diferentes das moléculas de DNA distintas.
Item IV: verdadeiro. A tecnologia do DNA recombinante é a principal técnica de engenharia genética, sendo que para a
produção de transgênicos, consiste na fusão de segmentos de DNA de organismos de diferentes espécies para a construção de um
DNA híbrido ou recombinante.

25.
Resposta: B
Comentário: Os microssatélites descritos no enunciado correspondem aos trechos de DNA não codificante conhecidos como
VNTR e que são usados para comparação nos exames de DNA. VNTR são sequências curtas de nucleotídeos que se repetem,
variando em número de repetições de um indivíduo para outro. Humanos são diploides e têm cromossomos organizados em pares
de homólogos, sendo que em cada cromossomo ocorrem locos (regiões cromossômicas) para um certo VNTR. Como cada
cromossomo de um par de homólogos do indivíduo é herdado de um dos pais, em cada loco, um dos VNTR tem origem paterna e
outro tem origem materna. A separação eletroforética dos fragmentos de DNA obtidos com o corte do DNA dos indivíduos
envolvidos (nesse caso criança, mãe e suposto pai) permite a comparação da posição dos trechos de VNTR, os quais estão
representados na tabela por valores numéricos. Na criança, em cada loco, um microssatélite deve vir do pai e outro da mãe, e, o
microssatélite que não vier da mãe, obrigatoriamente tem origem paterna. Por exemplo, para o loco 1, se os microssatélites da
criança são 13 e 14 e na mãe são 12 e 13, pode-se afirmar que o 13 da criança veio da mãe, de modo que o 14 tem que ter vindo
do pai, o que é viável porque o suposto pai tem os microssatélites 9 e 14. Assim, analisando cada item:
Item A: falso. Para o loco 6, o suposto pai e a criança têm ambos 15 repetições no microssatélite em cada cromossomo do par de
homólogos, sendo homozigotos (15; 15) para esse loco.
Item B: verdadeiro. No loco 2, a criança é 35; 35, tendo que ter herdado um microssatélite de 35 repetições de cada genitor, o
que é possível na mãe, que é 32; 35, mas não no suposto pai, que é 29; 32 e não possui microssatélite de 35 repetições. No loco 4,
a criança é 7; 7, tendo que ter herdado um microssatélite de 7 repetições de cada genitor, o que é possível na mãe, que é 7; 9, mas
não no suposto pai, que é 6; 9 e não possui microssatélite de 7 repetições. No loco 7, a criança é 21; 22, tendo que ter herdado um
microssatélite de 21 repetições de um genitor e um microssatélite de 22 repetições do outro genitor, o que é possível na mãe, que é
18; 22, tendo passado microssatélite de 22 repetições, de modo que o microssatélite de 21 repetições tem que ter vindo do pai, o
que não é possível para o suposto pai, que é 18; 19 e não possui microssatélite de 21 repetições.
Item C: falso. O filho é homozigoto para os locos 2, 3, 4 e 6, e heterozigoto para os locos 1, 5 e 7.
Item D: falso. Em todos os locos analisados pode-se observa a coincidência de um dos microssatélites da criança com a da mãe,
mostrando que a maternidade é viável.
Item E: falso. No loco 1, a criança é 13; 14, tendo que ter herdado um microssatélite de 13 repetições de um genitor e um
microssatélite de 14 repetições do outro genitor, o que é possível na mãe, que é 12; 13, tendo passado microssatélite de 13
repetições, de modo que o microssatélite de 14 repetições tem que ter vindo do pai, o que é possível para o suposto pai, que é 9;
14 e possui microssatélite de 14 repetições. No loco 3, a criança é 10; 10, tendo que ter herdado um microssatélite de 10 repetições
de cada genitor, o que é possível na mãe, que é 8; 10, e no suposto pai, que é 10; 12.

26.
Resposta: D
Comentário: Através das técnicas de exame de DNA, que emprega a eletroforese para separar fragmentos específicos de DNA
em um gel, com posterior marcação de fragmentos de DNA de interesse por marcações radioativas chamadas sondas, é possível:
Item I: verdadeiro. É possível identificar um indivíduo pela comparação de sua região hipervariável de DNA com a região
hipervariável de DNA de seus pais, de quem o indivíduo herdou todo o seu material genético.
Item II: falso. A Síndrome de Down não é caracterizada por nenhuma seqüência em particular de DNA, uma vez que não é
condicionada por gene algum, não se constituindo em um doença genética, e por isso não podendo ser diagnosticada pela
eletroforese. A Síndrome de Down é uma doença cromossômica onde o indivíduo possui 3 cromossomos do par 21 ao invés de
apenas 2, que é o normal, podendo ser diagnosticada por exames como o de cariotipagem, que permite a contagem do número de
cromossomos.
Item III: verdadeiro. A eritroblastose fetal é uma condição que afeta a partir do 2º filho Rh+ de mãe Rh-, sendo a tipagem
sangüínea pelo fator Rh uma característica genética, ou seja, determinada por uma certa seqüência de DNA (gene) que pode ser
identificada na eletroforese. Assim, uma mulher Rh- que já tenha um filho Rh+ pode obter DNA de seu filho antes mesmo que
nasça, através de técnicas como amniocentese, e através do exame de DNA verificar se possui o gene que condiciona sangue Rh+,
podendo então prever a ocorrência de eritroblastose fetal.

27.
Resposta: D
Comentário: O exame de DNA permite a identificação de indivíduos pelo seu DNA, podendo ser usado em análises de casos em
criminalística. Nesse caso, o DNA do suspeito de um crime é comparado com o de alguma prova no local do crime, como gotas de
sangue, fios de cabelo ou esperma. No teste, o DNA do indivíduo e da prova são fragmentado por meio de enzimas de restrição.
Os fragmentos são separados pela técnica de eletroforese, que separa as moléculas de DNA pelo tamanho, de modo que cada
molécula de DNA aparece no diagrama de eletroforese como uma banda. Fragmentos idênticos de amostras distintas assumem a
mesma posição no diagrama de eletroforese. São utilizadas, então, sondas radioativas complementares ao DNA não codificante
(“DNA lixo”), para marcá-lo. Uma vez que este é hipervariável, varia enormemente de um indivíduo para outro, de modo que
cada indivíduo (excetuando-se gêmeos univitelinos) tem um padrão único de bandas marcadas com as referidas sondas. Assim, a
coincidência da posição de bandas de amostras distintas no diagrama de eletroforese indica igualdade entre elas, permitindo a
confirmação de que o DNA na amostra do suspeito é idêntico àquele da amostra obtida na prova no local do crime, confirmando
que a amostra é do suspeito. Assim, no caso em questão, deve-se comparar no diagrama fornecido o DNA dos suspeitos, da vítima
e da amostra. As bandas encontradas na amostra, mas não na vítima, só podem ser do autor do crime. Observe:

Assim, conclui-se que o suspeito 3 é o culpado do crime.

28.
Resposta: D
Comentário: O exame de DNA permite a identificação de indivíduos pelo seu DNA, podendo ser usado em casos de
determinação de paternidade. Nesse caso, o DNA dos envolvidos, ou seja, do indivíduo, da mãe e do(s) provável(is) pai(s), é
comparado no exame. De início, o DNA dos envolvidos é fragmentado por meio de enzimas de restrição e separado pela técnica
de eletroforese (que separa as moléculas de DNA pelo tamanho), de modo que cada molécula de DNA aparece no diagrama de
eletroforese como uma banda. Fragmentos idênticos de amostras distintas assumem a mesma posição no diagrama de eletroforese.
São utilizadas, então, sondas radioativas complementares ao DNA não codificante (“DNA lixo”), para marcá-lo. Uma vez que este
é hipervariável, varia enormemente de um indivíduo para outro, de modo que cada indivíduo (excetuando-se gêmeos univitelinos)
tem um padrão único de bandas marcadas com as referidas sondas. Entretanto, como metade do DNA do indivíduo é herdada de
cada um dos pais, metade das bandas marcadas do indivíduo devem ser iguais às de sua mãe e metade devem ser iguais às de seu
pai. Assim, a coincidência da posição de bandas de amostras distintas no diagrama de eletroforese indica igualdade entre elas,
permitindo a confirmação de que metade do DNA do indivíduo é idêntico ao de seu pai, confirmando a paternidade. Na questão,
as bandas coincidentes foram substituídas por conjuntos de símbolos idênticos, de modo que as bandas do latifundiário estão
indicadas por círculos brancos “○” e as bandas da mulher estão indicadas por letras “x”. Assim,
- O filho 1 tem bandas “x” da mulher e bandas “♣” ausentes no latifundiário, de modo que devem ter sido herdadas do 1º esposo
da mulher;
- O filho 2 tem bandas “x” da mulher e bandas “○” do latifundiário, sendo filho dos dois;
- O filho 3 tem bandas “○” do latifundiário e bandas “∆” ausentes na mulher, de modo que devem ter sido herdadas da 1ª esposa
do latifundiário.
Conclui-se então que os filhos 2 e 3 são filhos biológicos do latifundiário, sendo que o filho 2 é do segundo casamento e o filho 3,
do primeiro.

29.
Resposta: VVFVF
Comentário:
1º item: verdadeiro. Seres procariotos, menores em dimensão celular, possuem alta taxa metabólica em comparação aos
eucariotos, que repercute na rápida absorção de nutrientes que são transformados no interior da célula e utilizados na realização de
trabalho, como a replicação do DNA.
2º item: verdadeiro. A replicação do DNA é semiconservativa, e, portanto, cada fita mãe do DNA é pareada a uma nova fita.
2º item: falso. As fitas do DNA são antiparalelas; na replicação a fita contínua é produzida no mesmo sentido do movimento da
forquilha de replicação.
4º item: verdadeiro. Na PCR, a alta temperatura quebra temporariamente as ligações de hidrogênio entre as fitas de DNA,
permitindo a união de oligonucleotídeos (primers) pelo DNA polimerase, que irão compor a nova cadeia da dupla fita.
5º item: verdadeiro. Geralmente são comparadas unidades repetidas de pares de bases (microssatélites) em cerca de apenas 13
locos polimórficos dos cromossomos.

30.
Resposta: FFVFFFF = 4
Comentário: Na eletroforese, trechos de DNA cortado por enzimas de restrição são separados baseando-se na diferença de
tamanho dos fragmentos. Como o DNA tem carga elétrica negativa pelo grupo fosfato, os fragmentos depositados no polo
negativo do sistema são atraídos para o polo positivo, sendo que os fragmentos maiores são mais pesados e se deslocam menos e
os fragmentos menores são mais leves e se deslocam mais. Como humanos são diploides, têm cromossomos organizados em pares
de homólogos, sendo que em cada cromossomo ocorrem locos (regiões cromossômicas) onde se encontram trechos de DNA
específicos. Assim, como o alelo A é quebrado em dois fragmentos e o alelo a não é quebrado, correspondendo a apenas um
fragmento, tem-se que:
- o indivíduo 1 só tem um fragmento, só possuindo o alelo a e sendo homozigoto para ele, ou seja, aa; conclui-se que o alelo a
corresponde ao fragmento de cerca de 700 pb;
- o indivíduo 2 tem dois fragmentos, e não possui o fragmento de 700 pb, de modo que possui somente o alelo A e é homozigoto
para ele, ou seja, AA; conclui-se que o alelo A corresponde aos fragmentos de 400 pb e 300 pb;
- o indivíduo 3 tem o fragmento de 700 pb, ou seja, possui o alelo a, e possui os fragmentos de 400 pb e 300 pb, ou seja, possui o
alelo A, sendo, pois, heterozigoto, ou seja, Aa.
Analisando cada item:
Item 1: falso. Como mencionado, o indivíduo 1 é homozigoto aa.
Item 2: falso. Como mencionado, o indivíduo 2 é homozigoto AA.
Item 4: verdadeiro. Como mencionado, o indivíduo 3 é heterozigoto Aa.
Item 8: falso. Como mencionado, o indivíduo 2 é homozigoto AA.
Item 16: falso. Como mencionado, o alelo A, quando clivado origina 2 fragmentos com cerca de 400 pb e 300 pb.
Item 32: falso. Como mencionado, o alelo a possui um tamanho de aproximadamente 700 pb.
Item 64: falso. Como mencionado, os fragmentos maiores ficam mais próximos do polo negativo.

31.
Resposta:
A) O resultado mostrou que o Filho 1 é filho biológico do outro homem porque apresenta duas bandas (segmentos de DNA)
também encontradas nesse homem, enquanto as outras duas se referem a segmentos de DNA herdados da mãe. O Filho 2 é filho
do marido, já que as bandas referentes a esse filho são encontradas tanto no resultado referente à mãe quanto naquele
correspondente ao marido.
B) Não, porque o DNA mitocondrial tem informações só do genoma materno, proveniente das mitocôndrias do gameta materno
(óvulo). Não seria possível, portanto, detectar os fragmentos de DNA mitocondrial de origem paterna.

32.
Resposta: Para começar apenas a presença de duas bandas (A e B) é indicativo positivo para o indivíduo apresentar a disfunção
muscular. Interpretando cada banda como um gene, chamaremos a banda A de A, a banda B e B, e a ausência delas de 0 (observe
que as bandas são genes alelos porque ocupam o mesmo loco). Assim, o indivíduo I será AB, o II será A0, o III será 00 e o IV será
B0.
A) II, III e IV, porque não têm os dois marcadores.
B) O único possível cruzamento que pode oferecer os genótipos AB, A0, B0 e 00 é entre indivíduos A0 e B0, ou seja, II e IV.
C) 0.

33.
Resposta: Como o mRNA apresentou o mesmo padrão eletroforético, significa que não houve nenhum problema na transcrição
gênica para a produção do mRNA. Assim, a diferença entre os dois padrões de proteínas pode ter sido causada por uma mutação
no DNA ou por alguma alteração no processo de tradução do mRNA. Isso resultou na tradução de uma proteína com menor
tamanho (padrão B) em relação ao padrão A (selvagem), ou seja, menor massa molecular.

34.
Resposta:
A) Dada à grande variedade das seqüências de nucleotídeos no DNA na espécie humana em praticamente infinitas possibilidades
de combinação, é praticamente impossível que dois indivíduos possuam seus DNA idênticos, exceto nos casos dos clones naturais,
isto é, os gêmeos univitelinos.
B) Da mesma maneira que o material genético do filho é proveniente do material do pai, havendo profundas semelhanças entre
estes materiais genéticos (aliás, a diferença existente entre os cromossomos do filho e do pai e mãe diz respeito apenas ao
crossing-over), o material genético do filho é proveniente do material do avô ou avó. Desta maneira, a análise do DNA destes
parentes (ou mesmo de tios, cujo material genético em um cromossomo é bastante semelhante ao do pai) pode fornecer um
esclarecimento sobre a paternidade da criança.

35.
Resposta:
I. O exame de DNA pode ser feito com qualquer célula nucleada ou fragmentos de núcleos de células, como em fios de cabelo.
II. A semelhança genética entre pai e filho é bem superior à semelhança entre tio e sobrinho, o que pode ser percebido no exame
de DNA.
III. O cadáver pode ser exumado e dele extraído DNA viável para a realização do exame.

36.
Resposta: Por que B é heterozigoto.

37.
Resposta: Como o projeto visava determinar a sequência completa de todos os cromossomos humanos, era importante incluir
nesse conjunto o cromossomo Y. Como o cromossomo Y só existe nos indivíduos do sexo masculino, assim o doador teria que ser
um indivíduo desse sexo.

38.
Resposta:
A) Se ocorrer a comparação do DNA das células recebidas na transfusão com as da criança, a paternidade será negada, mesmo
que o cidadão safado seja o pai da criança.
B) Tomar várias amostradas de célula do cidadão vagabundo e comparar com as da criança; caso o DNA de nenhuma delas seja
compatível, a paternidade estará excluída; caso o DNA seja compatível em alguma, a paternidade estará confirmada. Pode-se
também remover DNA de outras partes do corpo que não o sangue.

39.
Resposta:
A) Inclusão. A porcentagem de bandas coincidentes de 50% é compatível com a porcentagem de 50% de DNA da criança que é
herdada de cada um dos genitores, pai e mãe.
B) A reação de cadeia de polimerase cria várias cópias de uma molécula de DNA sem a necessidade de um vetor biológico. Essa
técnica se baseia na capacidade de replicação (auto-duplicação) do DNA.

40.
Resposta:
A) 3’AAGCTTTCCACTGGGGACCTGGAAATCT5’.
B) 5’TTCGAAAGGTGACCCCTGGACCTTTAGA3’.
C)
3’AAGCTTTCCACTGGGGACCTGGAAATCT5’
5’TTCGAAAGGTGACCCCTGGACCTTTAGA3’.
1.
Resposta: B
Comentário: Bactérias são seres constituídos de células procarióticas, de modo a não apresentarem núcleo delimitado por carioteca,
mas sim um nucleoide, onde o material genético está disperso no citoplasma e é constituído de um único cromossomo formado por
DNA circular e desnudo (não associado a proteínas histonas). Células bacterianas em geral se reproduzem de modo assexuado, com
uma divisão celular denominada amitose, caracterizando o processo de bipartição ou cissiparidade. A simplicidade do material
genético e a habilidade de gerar clones na reprodução assexuada são aspectos que justificam o uso de bactérias em engenharia
genética, como na técnica do DNA recombinante para a produção de seres transgênicos.

2.
Resposta: E
Comentário: As células possuem uma região chamada núcleo cuja função é abrigar o material genético dos organismos. Em algumas
células, este núcleo é delimitado por uma membrana chamada membrana nuclear ou carioteca. Algumas células, porém, não possuem
uma carioteca, sendo que o material genético está diretamente em contato com o citoplasma. Nestes casos, o núcleo não está
organizado e é preferencialmente chamado de nucleóide. Procariontes não possuem carioteca, possuindo um nucleóide. Não há
organelas membranosas em células procarióticas. Pode-se então dizer que elas não possuem compartimentalização. Assim, o chamado
sistema de endomembranas (composto por R.E., complexo de Golgi, mitocôndrias, etc) está ausente. A única organela encontrada em
organismos procariontes são os ribossomos.

3.
Resposta: E
Comentário: A descoberta da célula é creditada às pesquisas do pesquisador inglês Robert Hooke, em 1655, ao analisar uma fatia de
cortiça (tecido suberoso, que é formado de células mortas) ao microscópio, a presença de uma série de cavidades, correspondendo aos
arcabouços correspondentes às paredes celulares das células mortas. O termo célula diz respeito a uma cavidade ou espaço vazio, que
foi exatamente o que Hooke observou. Em 1838, o botânico alemão Mathias Jakob Schleiden postulou que "todos os vegetais são
formados por células", No ano seguinte, em 1839, o zoólogo alemão Theodor Schwann estendeu esta afirmação ao postular que "todos
os animais são formados por células". Juntas, estas duas afirmações correspondiam a "todos os seres vivos são formados por células".
Esta é a premissa básica da chamada Teoria Celular. A moderna Teoria Celular afirma:
1) As células constituem as unidades básicas morfofisiológicas de todos os organismos vivos, ou seja, todos os seres vivos são
formados por células, de modo que os itens I e II são verdadeiros.
2) As propriedades de determinado organismo dependem das propriedades de suas células isoladas, ou seja, todas as características
morfológicas (forma) e fisiológicas (funcionais) podem ser explicadas como derivadas de suas características celulares, bem como
alterações nestas áreas podem ser vistas como alterações ao nível também celular.
3) As células se originam unicamente de outras células e sua continuidade é mantida através de seu material genético, de modo que o
item III é verdadeiro.
4) A menor unidade da vida é a célula, ou seja, partículas subcelulares como organelas, por exemplo, não podem ser consideradas
vivas. Em níveis de organização, estruturas como átomos, moléculas ou organelas não são consideradas estruturas vivas. Só podem ser
consideradas vivas estruturas de células em diante, do ponto de vista de níveis de organização: células, tecidos, órgãos, sistemas, etc.

4.
Resposta: C
Comentário: Para preparar estruturas a serem visualizadas no microscópio óptico, várias técnicas podem ser utilizadas. Em tecidos
organizados em blocos mais espessos, utiliza-se principalmente uma técnica conhecida como inclusão, que só possibilita a
visualização de tecidos já mortos:
1. Fixação: Coloca-se o material biológico num fixador (como o formol), o que se chama fixação, para impedir a ação de bactérias
decompositoras sobre o material;
2. Inclusão: Coloca-se o material em parafina ou resinas plásticas, o que se chama inclusão, para endurecê-lo e cortá-lo em finas fatias
(através de um aparelho chamado micrótomo), a fim de que a luz possa atravessar o material e a visualização seja possível.
3. Coloração: Utilizam-se corantes para permitir a visualização de estruturas celulares como no método HE (a hematoxilina cora
estruturas ácidas como o núcleo em azul e a eosina cora estruturas básicas como o citoplasma em cor de rosa).

5.
Resposta: D
Comentário: Apesar de não possuírem mitocôndrias, os procariontes podem fazer respiração celular aeróbica. Nesse caso, as etapas
da respiração que ocorreriam na matriz mitocondrial (ciclo de Krebs) e cristas mitocondriais (cadeia respiratória) de células
eucarióticas ocorrem, respectivamente, no citoplasma e na membrana plasmática de células procarióticas. A cadeia respiratória ocorre
principalmente numa área da membrana denominada mesossomo, que é uma invaginação da mesma.

6.
Resposta: C
Comentário: A estrutura que se quer observar, multiplicado pelo aumento do microscópio, tem que ser igual, no mínimo, ao limite de
resolução do olho humano para ser visível. Assim, podemos escrever:
estrutura X aumento = limite de resolução do olho
No caso em questão, sabendo que o aumento total máximo do microscópio óptico está em torno de 1000 vezes:
menor estrutura visível ao MO X aumento máximo do MO = limite de resolução do olho humano

menor estrutura visível ao MO X 1000 = 200 μm

menor estrutura visível ao MO = 200 μm / 1000 = 0,2 μm

Como não há a opção, vamos substituir a unidade de μm para nm, lembrando que 1 μm = 103 nm

menor estrutura visível ao MO = 0,2 μm X 103 nm = 200 nm

7.
Resposta: A
Comentário: Analisando cada item:
Item A: verdadeiro. De acordo com a Lei de Spencer, quanto menor a célula, maior a relação superfície/volume da mesma, e
consequentemente melhor sua nutrição. Como as células procarióticas são pequenas, apresentam grande relação superfície/volume,
não precisando de compartimentalização, ou seja, de sistema de endomembranas; em células eucarióticas, de maiores dimensões, a
menor relação superfície/volume que haveria é compensada pelo aumento de superfície proporcionado compartimentalização, ou seja,
de sistema de endomembranas.
Item B: falso. De acordo com a Lei de Hertwig, a relação entre o núcleo e o citoplasma é mais ou menos constante para a maioria das
células (relação núcleo-plasmática ou RNP) em torno de 1/3 ou 1/4.
Item C: falso. O mesossomo é uma dobra de membrana plasmática em células procarióticas relacionada a atividades de respiração
aeróbica e divisão celular, mas não é considerada uma organela. Além disso, células procarióticas não apresentam nucléolo, sendo os
ribossomos produzidos sem essa estrutura. (Nucleóide é o nome que se dá ao cromossomo bacteriano diretamente mergulhado no
citoplasma da célula procariótica, que não possui núcleo.)
Item D: falso. A compartimentalização das células eucarióticas promove aumento das suas superfícies internas, aumentando sua
relação superfície/volume.

8.
Resposta: B
Comentário: Num cubo, onde “a” é a aresta, a superfície (S) é calculada como S = 6a2 e o volume (V) é calculado como V = a3.
Numa célula cúbica de aresta 1, a superfície é de S = 6x12 = 6 e o volume é de V = 13 = 1, com relação entre superfície e volume S/V
= 6/1 = 6. Já numa célula cúbica de aresta 2, a superfície é de S = 6x22 = 6x4 = 24 e o volume é de V = 23 = 8, com relação entre
superfície e volume S/V = 24/8 = 3. Desse modo, quando a aresta aumenta de 1 para 2, a relação S/V diminui de 6/1 para 3/1. Assim,
segundo a Lei de Spencer, quanto maior a célula, menor sua relação superfície/volume e melhor sua capacidade de absorção de
nutrientes.

9.
Resposta: C
Comentário: Todas as células apresentam:
- membrana plasmática lipoproteica para manter a homeostase,
- material genético na forma de DNA para controlar metabolismo, reprodução e hereditariedade;
- ribossomos para sintetizar proteínas;
- capacidade de produzir energia.
Células procarióticas, como as encontradas em bactérias, não possuem núcleo organizado, uma vez que não possuem carioteca,
apresentando seu material genético disperso no citoplasma na forma de um nucleoide. Nessas células, o DNA é circular e desnudo
(não associado a histonas), e organizado num único cromossomo, com fragmentos de DNA extracromossomial na forma de
plasmídeos. Além disso, a célula procariótica não é compartimentada, não apresentando organelas membranosas como retículo
endoplasmático, complexo de Golgi, mitocôndrias e cloroplastos, de modo que sua única organela é o ribossomo. A maioria das
células procarióticas apresenta uma parede celular externa à membrana plasmática, excetuando-se o grupo de bactérias conhecidas
como Mycoplasma. Assim, bactérias possuem parede celular, membrana plasmática, DNA e ribossomos, mas não carioteca,
mitocôndrias e cloroplastos (6 + 10 + 12 = 28).

10.
Resposta: D
Comentário: Como as bactérias se reproduzem assexuadamente em grande velocidade quando supridas de nutrientes adequados no
meio, o uso das mesmas é muito comum em Engenharia Genética para clonar segmentos de DNA recombinante ou mesmo para
produzir substâncias de interesse médico ou comercial codificadas por transgenes.
11.
Resposta: B
Comentário: Dá-se o nome de transcrição ao processo pelo qual o DNA é copiado em RNA, e dá-se o nome de tradução ao processo
pelo qual o RNA orienta a síntese de proteínas nos ribossomos. Em células eucarióticas, ocorre núcleo organizado por carioteca, de
modo que, nelas, a transcrição ocorre no núcleo, num primeiro momento, e a tradução ocorre no citoplasma, num segundo momento.
Em células procarióticas, não ocorre núcleo organizado por carioteca, estando o material genético diretamente disperso no citoplasma,
de modo que, nelas, transcrição e tradução podem ocorrer de modo simultâneo, no mesmo compartimento celular que é o citoplasma,
conforme evidenciado na figura. Assim, o diagrama mostra a transcrição e tradução do código genético em procariontes.

12.
Resposta: B
Comentário: O olho humano desarmado tem limite de resolução na casa de 0,1 a 0,2 mm, sendo a maioria das células menores do que
esse tamanho. O microscópio óptico possibilita um aumento na casa de 1.000 x, possuindo um limite de resolução de cerca de 100 a
200 nm, o que permite visualizar várias estruturas celulares. Algumas delas, no entanto, só são visíveis ao microscópio eletrônico, que
possibilita um aumento de 300.000x, possuindo um limite de resolução de cerca de 0,3 nm, o que permite visualizar estruturas que o
microscópio óptico não visualiza. Estruturas como parede celular, núcleo, cloroplastos e vacúolos são visíveis tanto ao microscópio
óptico quanto ao eletrônico. Usando corantes específicos, estruturas como cromossomos, nucléolos e mitocôndrias são visíveis tanto
ao microscópio óptico quanto ao eletrônico. Estruturas como membrana plasmática, complexo de Golgi, lisossomos e ribossomos são
visíveis apenas ao microscópio eletrônico, mas não ao microscópio óptico. Assim, podem ser observados em células vivas, não
coradas, examinadas ao microscópio óptico, cloroplastos, vacúolos e núcleo.

13.
Resposta: E
Comentário: Como a maioria das células é menor que o limite de resolução do olho humano, somente com o advento do microscópio
é que a Biologia pôde avançar até seu estado atual. O microscópio óptico utiliza feixes de luz e lentes para ampliar a imagem, sendo
que o microscópio óptico simples apresenta apenas uma lente e o microscópio óptico composto apresenta duas lentes. A lente mais
próxima do olho do observado é denominada ocular (A) e a lente mais próxima do objeto de estudo é denominada objetiva (C).
Observação: Comparando a figura abaixo com a da questão, temos que:

A: lente ocular;
B: filtro de luz;
C: lente objetiva;
D: condensador (para concentrar a luz sobre o objeto de estudo);
E: controle do ajuste do foco;
F: platina (suporte para o objeto de estudo);
G: corpo do microscópio;
H: base do microscópio.

14.
Resposta: D
Comentário: De acordo com a Lei de Driesch ou do volume constante, células do mesmo tipo em indivíduos da mesma espécie
possuem o mesmo volume. Assim, as células de uma criança têm o mesmo tamanho das células de um adulto, sendo a diferença de
tamanho proporcionada pela diferença no número de células.

15.
Resposta: E
Comentário: Em microscopia, utilizam-se corantes para permitir a visualização de estruturas celulares, como no método HE, onde o
corante hematoxilina cora estruturas ácidas (como os ácidos nucléicos do núcleo) em roxo e o corante eosina cora estruturas básicas
(como as proteínas básicas do citoplasma) em cor de rosa. Em células com intensa atividade de síntese protéica, o citoplasma
apresentará grande quantidade de ribossomos, formados principalmente por RNAr (ácido ribonucléico), o que tornará o citoplasma
ácido e corado pela hematoxilina.

16.
Resposta: D
Comentário: Nos procariontes, o DNA não se encontra associado a histonas, mas a outras proteínas, sendo chamado o cromossomo
de desnudo; além disso, o cromossomo é circular e único, disperso no citoplasma com o nome de nucleóide. Pode haver no
procarionte a presença de DNA extracromossomial, imerso no citoplasma, sendo denominado plasmídeo, utilizado na troca de genes
num processo chamado de conjugação bacteriana. Nos eucariontes, o DNA se encontra associado a proteínas básicas, as histonas, é de
cadeia aberta e normalmente encontra-se aos pares (pares de homólogos). Assim, completando a frase: Nas bactérias, o material
genético está organizado em uma fita contínua de DNA que fica localizado em uma área chamada de nucleóide A reprodução das
bactérias se dá principalmente por fissão binária que produz duas células-filhas idênticas.

17.
Resposta: C
Comentário: Nos procariontes, o DNA não se encontra associado a histonas, mas a outras proteínas, sendo chamado o cromossomo
de desnudo; além disso, o cromossomo é circular e único, disperso no citoplasma com o nome de nucleóide. Pode haver no
procarionte a presença de DNA extracromossomial, imerso no citoplasma, sendo denominado plasmídeo, utilizado na troca de genes
num processo chamado de conjugação bacteriana. Nos eucariontes, o DNA se encontra associado a proteínas básicas, as histonas, é de
cadeia aberta e normalmente encontra-se aos pares (pares de homólogos). Assim, os dois componentes celulares bacterianos que
contêm DNA são plasmídio e nucleóide.

18.
Resposta: C
Comentário: O microscópio eletrônico ou microscópio de elétrons (ME) foi desenvolvido na década de 1930 para fins militares e usa
feixes de elétrons e campos magnéticos gerados por bobinas (“lentes magnéticas”) para promover aumentos muito maiores, de até 300
mil vezes. A partir de 1950, foram desenvolvidas técnicas que possibilitam o uso biológico do mesmo, através da preparação de
lâminas semelhante à inclusão, uma vez que o material a ser observado deve ser cortado em fatias extremamente finas e corado com
corantes elétron-densas a base de chumbo ou ósmio, na técnica de transmissão (SEM), ou coberto em sua superfície com uma camada
de substâncias elétron-densas como ouro, na técnica de varredura (TEM). Assim, como a figura da questão representa a estrutura
interna da célula, pode-se afirmar que representa célula vista ao microscópio eletrônico de transmissão, com as técnicas disponíveis
desde 1950.

19.
Resposta: D
Comentário: A descoberta da célula é creditada às pesquisas do pesquisador inglês Robert Hooke, em 1655, ao analisar uma fatia de
cortiça (tecido suberoso, que é formado de células mortas) ao microscópio, a presença de uma série de cavidades, correspondendo aos
arcabouços correspondentes às paredes celulares das células mortas. O termo célula diz respeito a uma cavidade ou espaço vazio, que
foi exatamente o que Hooke observou. Em 1838, o botânico alemão Mathias Jakob Schleiden postulou que "todos os vegetais são
formados por células", No ano seguinte, em 1839, o zoólogo alemão Theodor Schwann estendeu esta afirmação ao postular que "todos
os animais são formados por células". Juntas, estas duas afirmações correspondiam a "todos os seres vivos são formados por células".
Esta é a premissa básica da chamada Teoria Celular. Assim, analisando cada item:
Item A: falso. No mesmo XVII, em 1674, o holandês Anton von Leeuwenhöek descobriu células livres, isoladas, sendo estas de
organismos eucariontes. Somente com o advento da microscopia eletrônica, em meados do século XX, é que se pôde evidenciar a
diferença entre dois tipos celulares básicos, as células procarióticas e as células eucarióticas.
Item B: falso. As células de cortiça observadas por Hooke quando da descoberta das mesmas eram mortas, apresentando na verdade
somente o arcabouço da parede celular e um espaço vazio deixado pelo citoplasma após a morte celular.
Item C: falso. Quando Schleiden e Schwann elaboraram a Teoria Celular, não havia ocorrido ainda o desenvolvimento do
microscópio eletrônico que permitiu a descoberta da maioria dos constituintes celulares (apesar do núcleo ter sido descoberto ainda no
século XIX, em 1831, por Robert Brown.
Item D: verdadeiro. Uma das premissas da Teoria Celular é a de que toda célula vem de uma célula preexistente, o que se deu por
Rudolf Virchow em 1855. A observação de fenômenos da divisão mitótica feitas por Walther Fleming, por volta de 1878, reforçou
essa idéia,
Item E: falso. Como mencionado antes, a Teoria Celular foi desenvolvida antes do advento da microscopia eletrônica.

20.
Resposta: D
Comentário: De acordo com a Lei de Spencer, quanto menor a célula, maior a relação superfície/volume da mesma, e
consequentemente melhor sua nutrição. Assim, células não podem atingir grandes dimensões, caso contrário apresentariam pequena
relação superfície/volume, e, consequentemente, nutrição muito deficiente.

21.
Resposta: C
Comentário: Com o poder de resolução do microscópio óptico pode-se observar estruturas como tecidos, células eucarióticas (mas
não células procarióticas ou vírus), núcleos de células, cromossomos e parede celulósica, enquanto com o microscópio eletrônico
pode-se observar células procarióticas, vírus, todas as organelas, membrana plasmática e todas as estruturas observadas pelo
microscópio óptico. Assim, analisando cada item:
Item A: falso. Vírus só são visíveis pelo microscópio eletrônico.
Item B: falso. Mitocôndrias só são visíveis pelo microscópio, seja ele óptico ou eletrônico.
Item C: verdadeiro. Óvulos animais, em geral, são grandes o suficiente para serem visíveis pela vista desarmada, especialmente em
grupos como as aves, cuja gema do ovo corresponde exatamente ao óvulo.
Item D: falso. Moléculas não são visíveis com nenhum tipo de microscópio, salvo no caso de algumas macromoléculas como algumas
proteínas, visíveis ao microscópio eletrônico.
Item E: falso. Estrias das células musculares esqueléticas só são visíveis pelo microscópio, seja ele óptico ou eletrônico.

22.
Resposta: A
Comentário: Com o poder de resolução do microscópio óptico, na casa de 1000 x, pode-se observar estruturas como tecidos, células
eucarióticas (mas não células procarióticas ou vírus), núcleos de células, cromossomos e parede celulósica, enquanto que com o poder
de resolução do microscópio eletrônico, na casa de 300000 x, pode-se observar células procarióticas, vírus, todas as organelas,
membrana plasmática e todas as estruturas observadas pelo microscópio óptico. Assim, um aumento de 40 x proporcionado pela lupa
já possibilitaria o exame das peças bucais de uma barata, que também podem ser vista a olho nu.

23.
Resposta: D
Comentário: De acordo com a Lei de Spencer, quanto menor a célula, maior a relação superfície/volume da mesma, e
conseqüentemente melhor sua nutrição. Assim, células não podem atingir grandes dimensões, caso contrário apresentariam pequena
relação superfície/volume, e, conseqüentemente, nutrição muito deficiente. Assim, ao se dividirem e gerarem células menores, as
células da zona de crescimento da raiz mantêm uma grande relação superfície/volume, facilitando o rápido intercâmbio de substâncias
nutrientes e de material de excreção.

24.
Resposta: D
Comentário: A descoberta da célula é creditada às pesquisas do pesquisador inglês Robert Hooke, em 1655, ao analisar uma fatia de
cortiça (tecido suberoso, que é formado de células mortas) ao microscópio, a presença de uma série de cavidades, correspondendo aos
arcabouços correspondentes às paredes celulares das células mortas. O termo célula diz respeito a uma cavidade ou espaço vazio, que
foi exatamente o que Hooke observou. Em 1838, o botânico alemão Mathias Jakob Schleiden postulou que "todos os vegetais são
formados por células", No ano seguinte, em 1839, o zoólogo alemão Theodor Schwann estendeu esta afirmação ao postular que "todos
os animais são formados por células". Juntas, estas duas afirmações correspondiam a "todos os seres vivos são formados por células".
Esta é a premissa básica da chamada Teoria Celular.

25.
Resposta: C
Comentário: O aumento proporcionado pelo microscópio óptico composto é dado pelo produto do aumento da lente objetiva pelo
aumento da lente ocular, ou seja, 5 x 12 = 60 diâmetros.

26.
Resposta:
A) A Chlamydia trachomatis é uma bactéria, pois, como mostra a tabela, não apresenta núcleo celular organizado, porém possui
DNA, RNA, membrana plasmática e ribossomos. Herpes simplex é um vírus. Este organismo não possui estrutura celular típica, fato
evidenciado pela ausência de membrana plasmática, núcleo e ribossomos.
B) Não. O gráfico indica o crescimento populacional de bactérias que se multiplicam através de divisões binárias, segundo uma
progressão geométrica de razão 2. Os vírus não apresentam um padrão de crescimento representado pelo gráfico pois, dependendo
de células hospedeiras para se multiplicar, podem produzir múltiplas cópias em determinado intervalo de tempo.

27.
Resposta:
A) síntese proteica.
B) citoplasma.
C) I = DNA, II = RNA e III = proteína.
D em células de procariontes, a transcrição e a tradução são simultâneas, ambas ocorrendo no citoplasma, enquanto que em
eucariontes, a transcrição ocorre no núcleo e a tradução ocorre no citoplasma.

28.
Resposta: Hematoxilina: núcleo, porque possui DNA (ácido). Eosina: citoplasma, porque tem a maioria de suas proteínas básicas.
Observação: Em células com alta intensidade de síntese protéica, a abundância de ribossomos, que são compostos de RNAr (ácido
ribonucléico), torna o citoplasma corável também por hematoxilina.

29.
Resposta: Os microrganismos (procariotos ou eucariotos) possuem tamanho maior que o dos poros, ficando retidos no filtro de
cerâmica. A água passa livremente pelos poros do filtro de 200 nm, ficando filtrada e livre dos microrganismos. Portanto, estes filtros,
por reter os microrganismos e filtrar a água, são considerados esterilizantes.

30.
Resposta: Pode-se generalizar a seguinte fórmula:
aumento total X tamanho da estrutura analisada = poder de resolução do olho humano
Assim temos que:
Aumento total X 8 µm = 100 µm → aumento total = 12,5 X.
Como o aumento mínimo é o de 80 X (10 X de ocular e 8 X de objetiva), esta é a resposta.
1.
Resposta: E
Comentário: De acordo com o modelo do mosaico fluido, a membrana celular é formada por uma bicamada de fosfolipídios na qual
ocorrem proteínas integral ou parcialmente mergulhadas. Os fosfolipídios são formados pela reação entre o álcool glicerol
(propanotriol) e 2 ácidos graxos mais 1 ácido fosfórico, através de três ligações éster. Os fosfolipídios são moléculas anfipáticas ou
anfifílicas. A parte apolar (conhecida como cauda hidrofóbica da molécula) corresponde às cadeias derivadas dos ácidos graxos e a
parte polar (conhecida como cabeça hidrofílica da molécula) corresponde ao fosfato ligado a compostos como colina ou inositol.

Os fosfolipídios em água se organizam como uma bicamada devido a sua natureza anfipática ou anfifílica, de modo que as cabeças
polares dos fosfolipídios se voltem para fora, interagindo com a água polar, e as caudas apolares dos fosfolipídios se voltem para
dentro, interagindo entre si.

2.
Resposta: E
Comentário: De acordo com o modelo do mosaico fluido, a membrana celular é formada por uma bicamada de fosfolipídios na qual
ocorrem proteínas integral ou parcialmente mergulhadas. Os fosfolipídios são formados pela reação entre o álcool glicerol
(propanotriol) e 2 ácidos graxos mais 1 ácido fosfórico, através de três ligações éster. Os fosfolipídios são moléculas anfipáticas ou
anfifílicas. A parte apolar (conhecida como cauda hidrofóbica da molécula) corresponde às cadeias derivadas dos ácidos graxos e a
parte polar (conhecida como cabeça hidrofílica da molécula) corresponde ao fosfato ligado a compostos como colina ou inositol.

A bicamada lipídica se organiza de modo que as cabeças polares dos fosfolipídios se voltem para fora, interagindo com a água polar, e
as caudas apolares dos fosfolipídios se voltem para dentro, interagindo entre si. Uma vez que detergentes também são anfipáticos ou
anfifílicos, eles agem de modo que sua região polar interage com a cabeça hidrofílica do fosfolipídio e sua região apolar interage com
a cauda hidrofóbica do fosfolipídio, desorganizando a bicamada lipídica da membrana celular (e do envelope nuclear ou carioteca) e
promovendo a liberação do DNA para extração.

3.
Resposta: C
Comentário: Segundo o modelo do mosaico fluido, a membrana plasmática é constituída de uma bicamada lipídica com proteínas
encaixadas na bicamada. Os principais lipídios de membrana são os fosfolipídios e o colesterol (em células animais). Fosfolipídios são
derivados de triglicerídeos, sendo ésteres de um glicerol (álcool de cadeia curta) com dois ácidos graxos e um ácido fosfórico. Esses
fosfolipídios, quando se apresentam apenas com ácidos graxos saturados, são sólidos (como as gorduras), e quando se apresentam
ácidos graxos insaturados, são líquidos (como os óleos). A bicamada lipídica é fluida porque apresenta um predomínio de fosfolipídios
insaturados, os quais, em sua ligação dupla, possuem um ângulo de ligação de 120º, deixando a cadeia aberta em relação àquelas que
são saturadas, onde as ligações simples possuem um ângulo de ligação de 109º, sendo mais fechadas. A cadeia mais aberta na
insaturação dificulta a agregação dos fosfolipídios insaturados, que se mantêm em estado líquido. O colesterol se insere entre as
cadeias de ácidos graxos da bicamada lipídica, estabilizando a mesma graças a seu sistema plano de anéis que conectam as porções
apolares dos fosfolipídios. Veja a estrutura do colesterol abaixo:

Assim, analisando cada item:


Item A: falso. Os fosfolipídios de membrana são formados por ácidos graxos de cadeias saturadas e ácidos graxos de cadeias
insaturadas, os quais predominam e justificam a fluidez da bicamada lipídica.
Item B: falso. O colesterol se insere entre as cadeias de ácidos graxos, dificultando sua aproximação e contribuindo para a fluidez; no
entanto, a flexibilidade da membrana não tem relação com a fluidez.
Item C: verdadeiro. Como mencionado, o colesterol se insere entre as cadeias apolares de ácidos graxos e estabiliza a membrana.
Item D: falso. Como mencionado, o colesterol dificulta a aproximação das cadeias de ácidos graxos, contribuindo para a fluidez.
Item E: falso. Os fosfolipídios insaturados dificultam a aproximação das cadeias de ácidos graxos, contribuindo para a fluidez.

4.
Resposta: A
Comentário: Segundo o modelo do mosaico fluido, a membrana plasmática é constituída de uma bicamada de fosfolipídios com
proteínas mergulhadas totalmente (proteínas integrais ou intrínsecas, que atravessam a bicamada) ou parcialmente (proteínas
periféricas ou extrínsecas, que não atravessam a bicamada). A bicamada lipídica possui predomínio de fosfolipídios de cadeia
insaturada, sendo fluida à temperatura corporal. Na face externa da bicamada lipídica da membrana de células animais, ocorrem oligo
e polissacarídeos associados a lipídios (glicolipídios) ou a proteínas (glicoproteínas), constituindo o glicocálix.
A figura abaixo representa a membrana segundo o modelo do mosaico fluido:
Percebe-se que 1 e 2 são, respectivamente, fosfolipídeo e proteína.

5.
Resposta: B
Comentário: A parede celular vegetal é constituída essencialmente de celulose e está localizada externamente à membrana celular,
sendo espessa, rígida, resistente e permeável. Em alguns tecidos vegetais, ela pode ser impregnada de substâncias impermeabilizantes
como suberina (no súber) e lignina (no esclerênquima e no xilema).

6.
Resposta: D
Comentário: O modelo do mosaico fluido que descreve a estrutura microscópica da membrana plasmática. Segundo esse modelo, a
membrana é constituída de uma bicamada de fosfolipídios atravessada por moléculas de colesterol (em células animais) e proteínas
mergulhadas total ou parcialmente. Os fosfolipídios são constituídos de uma cabeça hidrofílica polar, voltada para fora da bicamada, e
uma cauda hidrofóbica apolar, voltada para dentro da bicamada e com predomínio de cadeias insaturadas de ácidos graxos, que dão a
consistência líquida à mesma. Na face externa da bicamada (em células animais), ocorrem oligossacarídeos associados aos lipídios e
às proteínas, constituindo o glicocálix. Assim, a membrana plasmática é constituída de uma dupla camada de fosfolipídios onde suas
extremidades hidrofóbicas (apolares) estão voltadas para dentro e suas extremidades hidrofílicas (polares) estão voltadas para fora,
composta por proteínas (integrais, que atravessam integralmente a bicamada, ou periféricas, que não atravessam a bicamada), além do
glicocálix constituído de glicoproteínas e glicolipídios.
Observação: No item D, o termo “esféricas” colocado na prova originalmente deveria ter sido colocado como “periféricas”.

7.
Resposta: D
Comentário: Na face externa da bicamada lipídica da membrana de células animais, ocorrem oligo e polissacarídeos associados a
lipídios (glicolipídios) ou a proteínas (glicoproteínas), constituindo o glicocálix. Este age em atividades como reconhecimento celular,
adesão intercelular e proteção da célula.

8.
Resposta: B
Comentário: Plasmalema ou membrana plasmática é a estrutura que envolve e limita a célula viva, controlando a passagem de
substâncias e regulando a composição da mesma. Analisando cada item:
Item A: falso. Colesterol é um lipídio que estabiliza e aumenta a fluidez da membrana em células animais, mas não ocorre em plantas,
algas, fungos ou bactérias.
Item B: falso. Algumas células apresentam, externamente à membrana plasmática, um envoltório rígido denominado parede celular,
cuja composição básica é de celulose em células vegetais, quitina em células fúngicas e peptoglicanas em células bacterianas, estando
a parede celular ausente em células animais. (Bactérias do grupo das Mycoplasma não possuem parede celular.)
Item C: falso. Em células vegetais, a citocinese (divisão do citoplasma após a divisão celular) é centrífuga, partindo do centro para a
periferia, através da formação da parede celular, enquanto em células animais, a citocinese é centrípeta, por estrangulamento.
Item D: falso. Segundo o modelo do mosaico fluido, a membrana plasmática é constituída de uma bicamada de fosfolipídios com
proteínas mergulhadas totalmente (proteínas integrais ou intrínsecas, que atravessam a bicamada) ou parcialmente (proteínas
periféricas ou extrínsecas, que não atravessam a bicamada). A bicamada lipídica possui predomínio de fosfolipídios de cadeia
insaturada, sendo fluida à temperatura corporal.
9.
Resposta: D
Comentário: A formação da parede celular após a divisão celular envolve primeiramente a formação de vesículas liberadas pelo
complexo de Golgi, denominadas fragmoplastos, que se alinham no plano equatorial da célula depois de dividido o núcleo celular.
Esta placa celular vai constituir a lamela média da parede celular madura, sendo formada por amilopectina. Em cima desta lamela
média vão sendo depositadas as demais microfibrilas para formação da parede, deixando espaços que futuramente corresponderão aos
plasmodesmos.

10.
Resposta: C
Comentário: Em células vegetais, existe externamente à membrana celular uma estrutura denominada parede celular, que constitui
uma espécie de exoesqueleto para tais células. Esta parede celular apresenta se totalmente permeável, com uma alta resistência, e ao
mesmo tempo uma certa flexibilidade e tem funções de suporte mecânico da célula, proteção mecânica e proteção osmótica. A parede
celular é formada por microfibrilas compostas principalmente do polissacarídeo celulose (formado por repetidas unidades de glicose),
e por outros açúcares em menores concentrações, como amilopectina, hemicelulose, celobiose e lignina (este último é o principal
componente da madeira e confere a ela sua resistência e rigidez). Assim, a parede celular vegetal serve de proteção à célula e é
permeável à passagem de substâncias.

11.
Resposta: C
Comentário: Analisando cada item:
1º item: verdadeiro. De acordo com o modelo do mosaico fluido, a membrana plasmática é constituída de uma bicamada de
fosfolipídios com proteínas encaixadas total ou parcialmente, além de, em células animais, um glicocálix na face externa da bicamada
e constituído de glicolipídios e glicoproteínas. Apesar dessa constituição comum a todas as membranas, a proporção de cada
componente varia muito de um tipo de célula para outro.
2º item: verdadeiro. As células eucarióticas são compartimentadas, apresentando compartimentos citoplasmáticos conhecidos como
organelas membranosas, tais como retículo endoplasmático e complexo de Golgi, as quais têm a mesma composição e organização em
mosaico fluido da membrana plasmática. Porções das membranas das organelas e da membrana plasmática podem se deslocar no
citoplasma e serem transferidas de uma estrutura para a outra, de modo que se pode argumentar todas as membranas da célula são a
mesma, ou seja, ocorre continuidade entre a membrana plasmática e o sistema de endomembranas.
3º item: falso. Os glicolipídios e as glicoproteínas do glicocálix da membrana funcionam, dentre outras funções, como elementos de
proteção química, dificultando a fixação de toxinas bacterianas.
4º item: falso. Proteínas de membrana têm papéis variados, como transporte e reconhecimento celular, sendo algumas delas receptores
para substâncias como hormônios ou neurotransmissores para a captação de estímulos extracelulares, mas não nucleares ou
citoplasmáticos.

12.
Resposta: C
Comentário: A maioria das células vegetais apresenta pontes de cito plasma que atravessam as paredes celulares e estabelecem
comunicações entre células adjacentes. Estas pontes são chamadas plasmodesmos e muitas vezes possuem túbulos do retículo
endoplasmático liso que permitem a livre circulação de líquido e outras substâncias, mantendo a isotonicidade entre as células
vizinhas.

13.
Resposta: B
Comentário: Na face externa da bicamada lipídica da membrana plasmática de células animais, ocorre uma camada de
oligossacarídeos associados a proteínas (como glicoproteínas) e a lipídios (como glicolipídios), sendo essa camada denominada de
glicocálix. O glicocálix age como proteção mecânica da célula, como agente de adesão entre células vizinhas e no reconhecimento
celular, uma vez que o padrão de glicoproteínas e glicolipídios varia de indivíduo para indivíduo, funcionando como uma “impressão
digital” celular.

14.
Resposta: B
Comentário: As membranas celulares são constituídas de uma bicamada lipídica com proteínas mergulhadas total ou parcialmente,
além de, somente em células animais, uma camada externa de glicoproteínas e glicolipídios denominada de glicocálix. Algumas
dessas proteínas e glicoproteínas têm papel de reconhecimento celular, agindo em processos imunológicos, ou de receptores para
hormônios, neurotransmissores ou mesmo vírus.

15.
Resposta: C
Comentário: Na face externa da bicamada lipídica da membrana de células animais, ocorrem oligo e polissacarídeos associados a
lipídios (glicolipídios) ou a proteínas (glicoproteínas), constituindo o glicocálix. Uma das funções do glicocálix é possibilitar o
reconhecimento celular, uma vez que seu padrão de moléculas é único para um determinado tipo celular de um organismo. Um
exemplo de corno o glicocálix está relacionado ao reconhecimento diz respeito aos grupos sangüíneos do sistema ABO. A substância
(ou antígeno ou aglutinogênio) A corresponde a um oligossacarídeo particular da membrana da hemácia que termina em galactose, e a
substância (ou antígeno ou aglutinogênio) B difere desta por possuir galactosamina no lugar da galactose. Através da análise destas
substâncias, o organismo analisa quais hemácias pertencem a ele.

16.
Resposta: D
Comentário: O modelo do mosaico fluido que descreve a estrutura microscópica da membrana plasmática. Segundo esse modelo, a
membrana é constituída de uma bicamada de fosfolipídios atravessada por moléculas de colesterol (em células animais) e proteínas
mergulhadas total ou parcialmente. Os fosfolipídios são constituídos de uma cabeça hidrofílica polar, voltada para fora da bicamada, e
uma cauda hidrofóbica apolar, voltada para dentro da bicamada e com predomínio de cadeias insaturadas de ácidos graxos, que dão a
consistência líquida à mesma. Na face externa da bicamada (em células animais), ocorrem oligossacarídeos associados aos lipídios e
às proteínas, constituindo o glicocálix. Assim, analisando cada item:
Item A: falso. Pela bicamada de fosfolipídios, ocorre apenas a passagem de substâncias apolares pequenas (como O 2 , CO 2 , N 2 e
lipídios) e de substâncias polares muito pequenas sem carga elétrica (como H 2 O, NH 3 e etanol), não havendo a passagem de
substâncias grandes de qualquer natureza (como proteínas e polissacarídeos) ou de substâncias polares em geral (como aminoácidos e
glicose).
Item B: falso. Pelas proteínas de membrana, ocorre a passagem de substâncias polares pequenas, não havendo a passagem de
substâncias grandes de qualquer natureza ou de substâncias apolares em geral.
Item C: falso. O glicocálix é formado por oligossacarídeos ligados a proteínas ou lipídios, estando localizado apenas na face externa
da bicamada lipídica de células animais. Entre suas funções estão a adesão e o reconhecimento celular.
Item D: verdadeiro. Nos fosfolipídios, ocorre uma cabeça polar (hidrofílica) voltada para periferia da membrana, e uma causa apolar
(hidrofóbica) voltada para a região central da mesma.
Item E: falso. O colesterol é encontrado somente nas membranas plasmáticas de células animais, aumentando a estabilidade da
bicamada de fosfolipídios.

17.
Resposta: B
Comentário: Analisando cada item:
Item A: falso. Na face externa da bicamada lipídica da membrana de células animais e protistas como a ameba, ocorrem oligo e
polissacarídeos associados a lipídios (glicolipídios) ou a proteínas (glicoproteínas), constituindo o glicocálix, que não ocorre em
células vegetais.
Item B: verdadeiro. A parede celular em bactérias é constituída essencialmente de peptideoglicanos, podendo apresentar outros
componentes como lipopolissacarídeos, e podendo estar ausente, como em bactérias do gênero Mycoplasma.
Item C: falso. A parede celular em células vegetais é constituída principalmente de celulose, mas não contém quitina, que é o
principal componente da parede celular de células fúngicas.
Item D: falso. Segundo o modelo do mosaico fluido, a membrana plasmática é constituída de uma bicamada de fosfolipídios com
proteínas mergulhadas totalmente (proteínas integrais ou intrínsecas, que atravessam a bicamada) ou parcialmente (proteínas
periféricas ou extrínsecas, que não atravessam a bicamada). A bicamada lipídica possui predomínio de fosfolipídios de cadeia
insaturada, sendo fluida à temperatura corporal. Os fosfolipídios são lipídios formados pela associação de glicerol, dois ácidos graxos
e um ácido fosfórico.
Item E: falso. O colesterol é um lipídio esteróide composto por átomos de carbono interligados, formando quatro anéis carbônicos
ligados a outros átomos, como hidrogênio e oxigênio, estabilizando e regulando a fluidez da membrana de células animais, estando
ausente em células vegetais.

18.
Resposta: E
Comentário: Segundo o modelo do mosaico fluido, a membrana plasmática é constituída de uma bicamada de fosfolipídios com
proteínas mergulhadas totalmente (proteínas integrais ou intrínsecas, que atravessam a bicamada) ou parcialmente (proteínas
periféricas ou extrínsecas, que não atravessam a bicamada). A bicamada lipídica possui predomínio de fosfolipídios de cadeia
insaturada, sendo fluida à temperatura corporal. Na face externa da bicamada lipídica da membrana de células animais, ocorrem oligo
e polissacarídeos associados a lipídios (glicolipídios) ou a proteínas (glicoproteínas), constituindo o glicocálix. Em células vegetais,
existe externamente à membrana celular uma estrutura denominada parede celular, que constitui uma espécie de exoesqueleto para tais
células. A parede celular vegetal é formada por microfibrilas compostas principalmente do polissacarídeo celulose e por outros
açúcares em menores concentrações, como amilopectina, hemicelulose, celobiose e lignina. Assim, para a célula animal (1), que só
possui membrana plasmática em sua estrutura, deve-se adicionar L (para digerir lipídios de membrana) e P (para digerir proteínas de
membrana), e para a célula vegetal (2), que possui membrana plasmática e parede celular, deve-se adicionar L (para digerir lipídios de
membrana), P (para digerir proteínas de membrana) e C (para digerir a celulose da parede celular).

19.
Resposta: D
Comentário: Analisando cada item:
Item A: falso. Os oligossacarídeos do glicocálix estão fixados à superfície de proteínas e/ou lipídios; o colesterol age regulando a
fluidez da membrana, de acordo com sua composição de ácidos graxos nos fosfolipídios.
Item B: falso. A bicamada lipídica é constituída de uma dupla lâmina de fosfolipídios, e não de colesterol; as proteínas
transportadoras são obrigatoriamente intrínsecas, estando representadas em 3.
Item C: falso. As proteínas integrais têm regiões polares em sua região externa à bicamada lipídica e regiões apolares que penetram
na bicamada lipídica em contato com as caudas apolares dos fosfolipídios; as proteínas periféricas não encaixadas na bicamada
apresentam apenas regiões polares em sua superfície; o colesterol age regulando a fluidez da membrana, de acordo com sua
composição de ácidos graxos nos fosfolipídios.
Item D: verdadeiro. A bicamada lipídica, por ser fluida, confere dinamismo às membranas biológicas, permitindo o deslocamento de
suas proteínas; as proteínas integrais têm regiões polares (hidrofílicas) em sua região externa à bicamada lipídica e regiões apolares
(hidrofóbicas) que penetram na bicamada lipídica em contato com as caudas apolares dos fosfolipídios; as proteínas periféricas não
encaixadas na bicamada apresentam apenas regiões polares (hidrofílicas) em sua superfície.
Item E: falso. As proteínas periféricas não atravessam a membrana e não permitem o transporte através da membrana; o colesterol
age regulando a fluidez da membrana, de acordo com sua composição de ácidos graxos nos fosfolipídios.

20.
Resposta: D
Comentário: Analisando cada item:
1º item: verdadeiro. Os fosfolipídios da membrana plasmática são anfipáticos, possuindo têm uma cabeça polar hidrofílica
(correspondente ao grupo fosfato) e uma cauda apolar hidrofóbica (correspondente às longas cadeias hidrocarbonadas dos dois ácidos
graxos).
2º item: falso. Na face externa da bicamada lipídica da membrana de células animais, ocorrem oligo e polissacarídeos associados a
lipídios (glicolipídios) ou a proteínas (glicoproteínas), constituindo o glicocálix.
3º item: verdadeiro. Como mencionado acima, células animais podem apresentar glicocálix.
4º item: verdadeiro. A parede celular primária é formada principalmente por amilopectina (presente na lamela média, agora interna à
parede), hemicelulose e microfibrilas frouxas de celulose. Ela é fina e elástica, de modo a possibilitar que a célula jovem possa se
dividir e crescer mais facilmente. Quando a parede aumenta de volume e chega a sua espessura definitiva, sendo agora bem mais
resistente, temos a parede celular secundária, que contém principalmente celulose, hemicelulose, lignina e suberina.
5º item: falso. A parede celular primária é externa à membrana plasmática; quando a parede celular secundária é produzida, vai sendo
depositada entre a membrana plasmática e a parede celular primária.

21.
Resposta: D
Comentário: Segundo o modelo do mosaico fluido, a membrana plasmática é constituída de uma bicamada de fosfolipídios com
proteínas mergulhadas totalmente (proteínas integrais ou intrínsecas, que atravessam a bicamada) ou parcialmente (proteínas
periféricas ou extrínsecas, que não atravessam a bicamada). A bicamada lipídica possui predomínio de fosfolipídios de cadeia
insaturada, sendo fluida à temperatura corporal. Na face externa da bicamada lipídica da membrana de células animais, ocorrem oligo
e polissacarídeos associados a lipídios (glicolipídios) ou a proteínas (glicoproteínas), constituindo o glicocálix. As proteínas integrais
ou intrínsecas atravessam completamente a bicamada lipídica da membrana, podendo ter ação de transporte através da membrana, seja
ele a favor de um gradiente de concentração e sem gasto de energia, sendo chamado de difusão (exemplo I, relacionado à entrada de
glicose nas células), ou contra um gradiente de concentração e com gasto de energia, sendo chamado de transporte ativo (exemplo 2,
relacionado ao bombeamento de íons cloro). Em ambos os exemplos, os componentes da membrana relacionados são as proteínas.

22.
Resposta: A
Comentário: Assim, analisando cada item:
Item A: falso. O transporte de substâncias através da membrana é mediado por proteínas integrais com ação de canal, mas não pelas
glicoproteínas do glicocálix, com funções como adesão e reconhecimento intercelular.
Item B: verdadeiro. Além dos fosfolipídios (formados pela associação de glicerol, dois ácidos graxos e um ácido fosfórico), também
ocorre na membrana colesterol, lipídio que estabiliza e aumenta a fluidez da membrana em células animais, mas não ocorre em
plantas, algas, fungos ou bactérias.
Item C: verdadeiro. As proteínas integrais ou intrínsecas atravessam completamente a bicamada lipídica da membrana.
Item D: verdadeiro. Os fosfolipídios da membrana plasmática são anfipáticos, possuindo têm uma cabeça polar hidrofílica
(correspondente ao grupo fosfato) e uma cauda apolar hidrofóbica (correspondente às longas cadeias hidrocarbonadas dos dois ácidos
graxos).
Item E: verdadeiro. As proteínas integrais ou intrínsecas da membrana plasmática podem ter ação de transporte através da
membrana.

23.
Resposta: C
Comentário: Segundo o modelo do mosaico fluido, a membrana plasmática é constituída de uma bicamada de fosfolipídios com
proteínas mergulhadas totalmente (proteínas integrais ou intrínsecas, que atravessam a bicamada) ou parcialmente (proteínas
periféricas ou extrínsecas, que não atravessam a bicamada). A bicamada lipídica possui predomínio de fosfolipídios de cadeia
insaturada, sendo fluida à temperatura corporal. A bicamada lipídica, por ser fluida, confere dinamismo às membranas biológicas,
permitindo o deslocamento de suas proteínas.

24.
Resposta: E
Comentário: Analisando cada item:
Item A: verdadeiro. Segundo o modelo do mosaico fluido, a membrana plasmática é constituída de uma bicamada de fosfolipídios
com proteínas mergulhadas totalmente (proteínas integrais ou intrínsecas, que atravessam a bicamada) ou parcialmente (proteínas
periféricas ou extrínsecas, que não atravessam a bicamada). A bicamada lipídica possui predomínio de fosfolipídios de cadeia
insaturada, sendo fluida à temperatura corporal. Na face externa da bicamada lipídica da membrana de células animais, ocorrem oligo
e polissacarídeos associados a lipídios (glicolipídios) ou a proteínas (glicoproteínas), constituindo o glicocálix.
Item B: verdadeiro. Como mencionado acima, as proteínas integrais são aquelas que atravessam completamente a bicamada lipídica
da membrana plasmática.
Item C: verdadeiro. A bicamada lipídica possui predomínio de fosfolipídios de cadeia insaturada, sendo fluida à temperatura
corporal, permitindo o deslocamento de suas proteínas.
Item D: verdadeiro. A formação da parede celular envolve primeiramente a formação de uma placa celular a partir de vesículas
liberadas pelo complexo de Golgi, denominada lamela média, sobre a qual vão sendo depositadas as demais microfibrilas para
formação da parede celular. A parede celular primária é formada principalmente por amilopectina (presente na lamela média, agora
interna à parede), hemicelulose e microfibrilas frouxas de celulose, sendo fina e elástica, de modo a possibilitar que a célula jovem
possa se dividir e crescer mais facilmente. Quando a parede aumenta de volume e chega à sua espessura definitiva, sendo agora bem
mais resistente, temos a parede celular secundária, que contém principalmente celulose, hemicelulose e lignina.
Item E: falso. A parede celular não tem função cimentante entre as células vegetais.

25.
Resposta: C
Comentário: Em células vegetais, existe externamente à membrana celular, mas não aderida à ela, uma estrutura denominada parede
celular, que constitui uma espécie de exoesqueleto para tais células. Esta parede celular apresenta se totalmente permeável, com uma
alta resistência, e ao mesmo tempo uma certa flexibilidade e tem funções de suporte mecânico da célula, proteção mecânica e proteção
osmótica. Assim, a parede celular é rígida, celulósica e não aderida à membrana plasmática.

26.
Resposta: VFVVV
Comentário:
1º item: verdadeiro. A imagem representa o modelo de membrana celular conhecido como mosaico- fluido, no qual uma bicamada
de lipídios está associada às proteínas.
2º item: falso. O item 1, na figura, representa a parte hidrofílica do lipídio de membrana, que fica voltada para a parte externa da
membrana.
3º item: verdadeiro. O item 2 está indicando a região hidrofóbica dos lipídio, que fica voltada para a região interna da membrana.
4º item: verdadeiro. O modelo de mosaico-fluido prevê a presença de proteínas associadas, que na figura estão representadas no item
3.
5º item: verdadeiro. Por ser baseada em lipídios, substâncias lipossolúveis atravessam a membrana por difusão simples.

27.
Resposta: VFVF
Comentário: Segundo o modelo do mosaico fluido, a membrana plasmática é constituída de uma bicamada de fosfolipídios com
proteínas mergulhadas totalmente (proteínas integrais ou intrínsecas, que atravessam a bicamada) ou parcialmente (proteínas
periféricas ou extrínsecas, que não atravessam a bicamada). A bicamada lipídica possui predomínio de fosfolipídios de cadeia
insaturada, sendo fluida à temperatura corporal. Na face externa da bicamada lipídica da membrana de células animais, ocorrem oligo
e polissacarídeos associados a lipídios (glicolipídios) ou a proteínas (glicoproteínas), constituindo o glicocálix. Analisando cada item:
1º item: verdadeiro. Proteínas integrais, que atravessam completamente a bicamada, podendo agir como transportadores.
2º item: falso. A adesão entre células vizinhas em organismos animais se dá através de estruturas de membrana como glicoproteínas
do glicocálix e proteínas de membrana.
3º item: verdadeiro. Proteínas, tanto integrais como periféricas, podem agir como receptores, podendo se ligar a sinais químicos,
como hormônios.
4º item: falso. Antígenos são substâncias orgânicas estranhas ao organismo, como ocorre com proteínas, carboidratos ou lipídios de
vírus ou bactérias.

28.
Resposta:
A) fosfolipídios, proteína, açúcares (glicocálix)
B) 1
C) o modelo do mosaico fluido apresenta proteínas móveis na bicamada que podem se deslocar de acordo com as necessidades da
membrana (ou seja, de acordo com a direção das substâncias que serão transportadas).

29.
Resposta:
A) X – lipídios; Y – proteína.
B) A bicamada lipídica se fusiona às vesículas citoplasmáticas contendo as secreções, o que permite sua eliminação no meio
extracelular.

30.
Resposta:
A) A membrana plasmática da célula intacta deve ser formada por duas camadas de lipídios (uma bicamada).
B) Na de que os lipídios dispersos na água ocuparam o dobro da superfície em relação à superfície das hemácias. Unida ao fato de que
as hemácias possuem somente a membrana plasmática, a melhor explicação é que os lipídios estejam acomodados em duas camadas
na membrana intacta.
1.
Resposta: E
Comentário: No processo de osmose, a água se desloca de um meio hipotônico (menos concentrado) para um meio hipertônico
(mais concentrado). Como a membrana plasmática não permite a difusão livre de NaCl, a diferença de concentração de sal levará
ao deslocamento de água por osmose. No exemplo descrito, se a hemácia, com concentração de 0,15 mol/L de NaCl, é colocada
em uma solução 0,20 mol/L de NaCl, pode-se afirmar que ela é colocada num meio hipertônico, perdendo água por osmose para a
solução.

2.
Resposta: B
Comentário: Células vegetais são dotadas de uma parede celular permeável, flexível e altamente resistente. Apesar disso, não há
ligação entre a parede celular e a membrana plasmática, de modo que elas não estão ''coladas'' uma na outra. Ao se colocar células
vegetais em meio hipertônico, elas perdem água por osmose e murcham, sofrendo plasmólise. Nela, a água perdida é proveniente
do vacúolo de suco celular que ocupa praticamente todo volume do citoplasma, de modo que o citoplasma se retrai (diminui de
volume) e a membrana celular separa da parede celular, mas o arcabouço celular representado pela parede celular não se altera,
sendo que o volume da célula não se altera de modo significativo. Esse fenômeno ocorre porque a membrana plasmática é
semipermeável e seletivamente permeável e a parede celular é completamente permeável.

3.
Resposta: B
Comentário: Mecanismos de transporte em bloco envolvem a passagem pela membrana de partículas muito grandes para
atravessá-la. Esses mecanismos podem envolver a fusão de vesículas derivadas de organelas citoplasmáticas (como o complexo de
Golgi) com a membrana plasmática para eliminar seu conteúdo no meio extracelular, num mecanismo chamado de exocitose,
relacionado a processos de secreção.

4.
Resposta: E
Comentário: O transporte de substâncias lipossolúveis (apolares) através da membrana plasmática se dá por difusão simples ou
diálise, que é o transporte de solutos através da bicamada lipídica. Assim, substâncias apolares atravessa a membrana mais
facilmente do que substâncias polares.

5.
Resposta: C
Comentário: Em condições normais, a concentração de sódio no meio extracelular (155 mmol/L) é maior que a concentração de
sódio no meio intracelular (19 mmol/L), de modo que ocorre difusão de sódio para o interior da célula, o que poderia causar
desequilíbrios iônicos e osmóticos na célula. Ainda em condições normais, a concentração de potássio no meio intracelular (136
mmol/L) é maior que a concentração de potássio no meio extracelular (5 mmol/L), de modo que ocorre difusão de potássio para o
exterior da célula, o que poderia causar déficit de potássio no meio celular e prejudicar processos como síntese e proteica e
respiração aeróbica, dos quais o potássio é cofator enzimático. Para evitar os problemas descritos, a bomba de sódio e potássio,
por transporte ativo, mantém continuamente o transporte de sódio para fora da célula e o transporte de potássio para dentro da
célula, devolvendo aos meios de origem os íons que se deslocam por difusão. Assim, nas hemácias do grupo 1, mantidas em
condições normais, o fluxo de potássio para o meio intracelular é constante devido à ação da bomba de sódio e potássio, como
mostrado no gráfico abaixo:

No grupo 2, as hemácias tratadas com um inibidor de metabolismo não podem produzir energia para manter a bomba de sódio e
potássio, de modo que cessa o fluxo de potássio para o meio intracelular, como no gráfico abaixo:

6.
Resposta: E
Comentário: Analisando cada item:
Item I: verdadeiro. Mecanismos de transporte passivo ocorrem a favor de um gradiente de concentração (do meio mais
concentrado para o menos concentrado), de modo espontâneo e exotérmico (com liberação de energia). Esses podem ser difusão
simples (transporte de solutos através da bicamada lipídica), difusão facilitada (transporte de solutos através das proteínas de
membrana, como proteínas-canais e proteínas carreadoras), e osmose (transporte de água através da bicamada e de proteínas
aquaporinas).
Item II: verdadeiro. Mecanismos de transporte ativo ocorrem contra de um gradiente de concentração (do meio menos
concentrado para o mais concentrado), de modo não espontâneo e endotérmico (com consumo de energia), sempre através de
proteínas de membrana. No transporte ativo 1º, utiliza-se a energia do ATP, mas no transporte ativo 2º, utiliza-se a energia liberada
na difusão (que é exotérmica) de uma molécula co-transportada. Um exemplo é o co-transporte sódio-glicose no intestino, onde a
bomba de sódio e potássio mantém uma baixa concentração de sódio no meio intracelular, forçando o sódio a entrar por difusão e,
com isso, liberar energia para o transporte de glicose, mesmo contra o gradiente, uma vez que a proteína transportadora responsável
pelo processo só permite a passagem do sódio junto à glicose e simultaneamente.
Item III: verdadeiro. A bomba de sódio e potássio tem ações como a de manter o equilíbrio osmótico das células animais, o que
não é necessário em células vegetais, fungos e bactérias, uma vez que possuem parede celular, capaz de impedir sua plasmoptise.
Apesar disso, ocorrem mecanismos de co-transporte envolvendo processos de transporte ativo 2º.

7.
Resposta: D
Comentário: Mecanismos de transporte ativo ocorrem contra de um gradiente de concentração (do meio menos concentrado para
o mais concentrado), de modo não espontâneo e endotérmico (com consumo de energia), sempre através de proteínas de
membrana. Mecanismos de transporte passivo ocorrem a favor de um gradiente de concentração (do meio mais concentrado para
o menos concentrado), de modo espontâneo e exotérmico (com liberação de energia). Esses podem ser difusão simples (transporte
de solutos através da bicamada lipídica), difusão facilitada (transporte de solutos através das proteínas de membrana, como
proteínas-canais e proteínas carreadoras), e osmose (transporte de água através da bicamada e de proteínas aquaporinas). Assim, o
processo de transporte passivo inclui todos os outros processos descritos.

8.
Resposta: C
Comentário: Osmose é o transporte passivo de água através da membrana plasmática, do meio hipotônico (meio menos
concentrado em soluto e mais concentrado em solvente) para o meio hipertônico (meio mais concentrado em soluto e menos
concentrado em solvente).
Hemácias apresentam uma concentração de 0,9% de NaCl. Ao serem colocadas em meio de concentração 2% de NaCl, esse meio
será hipertônico, e elas perdem água por osmose e murcham, sofrendo plasmólise. Se o volume de água na célula diminui, a
concentração de solutos na mesma aumenta, como representado no gráfico do item C.

9.
Resposta: C
Comentário: Osmose é o transporte passivo de água através da membrana plasmática, do meio hipotônico (meio menos
concentrado em soluto e mais concentrado em solvente) para o meio hipertônico (meio mais concentrado em soluto e menos
concentrado em solvente).
Se a concentração de solutos em uma célula aumenta, como representado no gráfico, a mesma está perdendo água por osmose, o
que significa que está num meio hipertônico. Essa perda de água, na qual a célula murcha, caracteriza o fenômeno de plasmólise.

10.
Resposta: B
Comentário: Células vegetais são envolvidas por uma membrana plasmática semipermeável (de modo que passa solvente, mas
não solutos) e uma parede celular permeável (de modo que passam solvente e solutos). Em células vegetais colocadas em meio
hipertônico, ocorre perda de água e plasmólise, e a membrana plasmática retrai, se separando da parede celular. Nessas mesmas
células vegetais em meio hipotônico, ocorre ganho de água e deplasmólise, com inchaço da célula, sendo que, quando em meio
muito hipotônico, ocorre ganho de grandes quantidades de água e turgência, com a célula inchando até seu volume máximo e
entrando em equilíbrio, com o excesso de água sendo eliminado devido à resistência da parede celular. Assim, a célula torna-se
plasmolisada quando colocada em meio hipertônico, com a solução ocupando o espaço entre a parede celular e a membrana
plasmática, de modo que parede celular e membrana plasmática se separam e o vacúolo de suco celular se contrai pela redução na
quantidade de água.

11.
Resposta: A
Comentário: Analisando cada item:
Item I: verdadeiro. O transporte ativo ocorre contra o gradiente de concentração, com gasto de energia e através de proteínas de
membrana, sendo que:
- aminoácidos e monossacarídeos são transportados ativamente da luz do intestino para as células intestinais, no processo de
absorção de alimentos, e da luz dos túbulos renais para os capilares sanguíneos, no processo de reabsorção de solutos nos rins;
- sódio e potássio são transportados ativamente na bomba de sódio e potássio em todas as células animais;
- íons de hidrogênio são transportados ativamente em áreas como o estômago, na formação do HCl do suco gástrico.
Item II: falso. O transporte de substâncias de um meio mais concentrado para um meio menos concentrado ocorre sem gasto de
energia, por transporte passivo.
Item III: verdadeiro. O mecanismo básico envolvido no transporte ativo envolve bombas, que são proteínas transportadores que
agem como enzimas para quebrar ATP e fornecer energia para o processo de transporte contra o gradiente de concentração.

12.
Resposta: E
Comentário: Osmose é a passagem de água de um meio menos concentrado, hipotônico, para um meio mais concentrado,
hipertônico. Hemácias são células anucleadas, apresentando um formado bicôncavo, como representado na figura 3. Na figura 1,
com as hemácias plasmolisadas ou crenadas (murchas), pode-se afirmar que a célula perdeu água, de modo que o meio está
hipertônico em relação a ela. Na figura 2, com as hemácias deplasmolisadas (inchadas), pode-se afirmar que a célula ganhou água,
de modo que o meio está hipotônico em relação a ela. Na figura 3, com as hemácias normais, pode-se afirmar que a célula está em
equilíbrio com o meio, que está isotônico em relação a ela.

13.
Resposta: A
Comentário: O transporte em bloco é o processo de transporte de partículas muito grandes que não conseguem atravessar a
membrana plasmática, sendo chamado de endocitose, quando se dá de fora para dentro da célula (fagocitose para partículas
sólidas e pinocitose para partículas líquidas), ou de exocitose quando se dá de dentro para fora da célula, como na secreção de
proteínas como a insulina.

14.
Resposta: A
Comentário: Osmose é a passagem de água de um meio hipotônico para um meio hipertônico. Células animais em meio
hipertônico (I) perdem água e murcham, sofrendo plasmólise (crenação em hemácias), em meio isotônico II se mantém
inalteradas, e em meio hipotônico (III) ganham água e rompem, sofrendo plasmoptise (hemólise em hemácias). Células vegetais,
devido à parede celular resistente, em meio hipertônico (I) perdem água e murcham, sofrendo plasmólise (de modo que a
membrana descola da parede celular), em meio isotônico II se mantém inalteradas; em meio hipotônico (III) ganham água, mas
não rompem, atingindo um equilíbrio sem isotonicidade, de modo que a quantidade de água que entra por osmose iguala à
quantidade de água que sai devido à resistência da parede celular, caracterizando a turgência. Assim, analisando cada item:
Item I: verdadeiro. Como mencionado, em I a solução é hipertônica, em II a solução é isotônica e, em III a solução é hipotônica.
Item II: verdadeiro. Em I, meio hipertônico, as células ficam plasmolisadas; em II, meio isotônico, as células mantêm seu
formato normal; em III, meio hipotônico, as células animais sofrem plasmoptise e as vegetais sofrem turgência.
Item III: falso. A passagem de água se dá por osmose, e não por difusão facilitada.
Item IV: verdadeiro. Como mencionado, as células em I estão plasmolisadas, em II elas estão em volume inalterado, e em III
elas estão, as animais plasmolisadas e as vegetais túrgidas.

15.
Resposta: C
Comentário: Analisando cada item:
Item I: verdadeiro. Segundo o modelo do mosaico fluido, a membrana plasmática é constituída de uma bicamada de fosfolipídios
com proteínas mergulhadas totalmente (proteínas integrais ou intrínsecas, que atravessam a bicamada) ou parcialmente (proteínas
periféricas ou extrínsecas, que não atravessam a bicamada). As proteínas podem ter agir como proteínas canais ou poros (que não
se alteram durante a passagem da substância transportada), proteínas carreadoras ou permeases (que se alteram durante a passagem
da substância transportada), proteínas receptoras (para hormônios, neurotransmissores, etc) e proteínas de reconhecimento (como
aquelas encontradas no glicocálix, associadas a açúcares).
Item II: falso. As células bacterianas apresentam membrana plasmática e, externa à ela, uma parede celular constituída
principalmente de peptidioglicanas e ausente nas bactérias do gênero Mycoplasma. Bactérias não possuem glicocálix, que
corresponde a oligo e polissacarídeos associados a lipídios (glicolipídios) ou a proteínas (glicoproteínas) na face externa da
bicamada lipídica da membrana de células animais.
Item III: falso. A bomba de sódio e potássio é o processo de transporte ativo de sódio e potássio através da proteína de membrana
com atividade enzimática de quebra de ATP denominada Na+K+ATPase (ou ATPase dependente de sódio e potássio).
Item IV: verdadeiro. A concentração de K+ é maior dentro da célula do que fora dela, a tendência é que saia K+ da célula por
difusão através da membrana. E como a concentração de Na+ é maior fora do que dentro da célula, a tendência é que entre Na+ na
célula por difusão. Para reposicionar os íons que se movimentaram por difusão em seus meios de origem, restaurando as
concentrações originais de cada um, a bomba reposiciona os íons que se moveram por difusão. Como existe mais Na+que K+,
proporcionalmente entra mais sódio do que sai potássio, o que faz com que a bomba trabalhe de maneira as simétrica: para cada
molécula de ATP utilizada, dois íons K+ entram na célula e três íons Na+saem da mesma. Como saem três cargas positivas
(equivalentes aos três Na+) para cada duas cargas positivas que entram (equivalentes aos dois K+), isto significa que, todo o tempo,
está saindo uma carga positiva. Assim, o meio externo fica positivo em relação ao interno, que fica então negativo, num fenômeno
que é conhecido como polaridade de membrana, a base para a transmissão do impulso nervoso.
Item V: verdadeiro. A fagocitose é o englobamento de partículas sólidas pela célula. Este englobamento ocorre devido a
projeções citoplasmáticas (evaginações da membrana), denominadas pseudópodes, que envolvem a partícula, formando uma
vesícula de membrana, e posteriormente o conteúdo desta vesícula, isto é, a partícula englobada, é digerida intracelularmente.
Leucócitos utilizam esse processo no combate a infecções e no processo de involução uterina pós-parto.
16.
Resposta: D
Comentário: Células vegetais são dotadas de uma parede celular permeável, flexível e altamente resistente. Apesar disso, não há
ligação entre a parede celular e a membrana plasmática, de modo que elas não estão ''coladas'' uma na outra. Ao se colocar células
vegetais em meio hipertônico, elas perdem água por osmose e murcham, sofrendo plasmólise. Nela, a água perdida é proveniente
do vacúolo de suco celular que ocupa praticamente todo volume do citoplasma, de modo que o citoplasma se retrai (diminui de
volume) e a membrana celular separa da parede celular, mas o arcabouço celular representado pela parede celular não se altera,
sendo que o volume da célula não se altera de modo significativo. Ao se colocar células vegetais em meios hipotônicos, elas
ganham água por osmose e incham, sofrendo deplasmólise. Se a entrada de água é muito intensa, não há plasmoptise na célula
vegetal porque a parede celular oferece resistência à entrada de água, de modo a ocorrer turgência. Nesse processo, há um
equilíbrio dinâmico quando a célula vegetal chega em seu volume máximo: a quantidade de água que entra por osmose é igual à
água que sai devido à resistência da parede celular. Assim, se a célula incha na solução I, o meio é hipotônico (situação 2), se a
célula permanece inalterada na solução 2, o meio é isotônico, e se a célula murcha na solução III, o meio é hipertônico (situação 1).
As situações 1 e 2 correspondem, então, às figuras III e I, respectivamente.

17.
Resposta: A
Comentário: O transporte passivo de substâncias por difusão simples tem velocidade do transporte diretamente proporcional à
diferença de concentração da molécula transportada. O transporte passivo de substâncias por difusão facilitada é mediado por um
carreador, aumentando de velocidade com o aumento da concentração da substância a ser transportada; no entanto, a velocidade
de transporte se aproxima de um valor máximo quando a proteína carreadora está saturada, com todos os carreadores ocupados, de
modo que a velocidade passa a ser constante. Como a velocidade de transporte de A é proporcional à concentração extracelular,
trata-se de difusão simples. Como a velocidade de transporte de B assume um valor constante em altas concentrações, conclui-se
que ocorreu saturação, de modo que se trata de difusão facilitada.

18.
Resposta: E
Comentário: Células vegetais são dotadas de uma parede celular permeável, flexível e altamente resistente. Apesar disso, não há
ligação entre a parede celular e a membrana plasmática, de modo que elas não estão ''coladas'' uma na outra. Ao se colocar células
vegetais em meio hipertônico, elas perdem água por osmose e murcham, sofrendo plasmólise. Nela, a água perdida é proveniente
do vacúolo de suco celular que ocupa praticamente todo volume do citoplasma, de modo que o citoplasma se retrai (diminui de
volume) e a membrana celular separa da parede celular, mas o arcabouço celular representado pela parede celular não se altera,
sendo que o volume da célula não se altera de modo significativo. Ao se colocar células vegetais em meios hipotônicos, elas
ganham água por osmose e incham, sofrendo deplasmólise. Se a entrada de água é muito intensa, não há plasmoptise na célula
vegetal porque a parede celular oferece resistência à entrada de água, de modo a ocorrer turgência. Nesse processo, há um
equilíbrio dinâmico quando a célula vegetal chega em seu volume máximo: a quantidade de água que entra por osmose é igual à
água que sai devido à resistência da parede celular. Assim, analisando cada item:
Item A: falso. Em meio hipotônico, a célula ganha água por osmose e incha, aumentando a resistência da parede celular à entrada
de água (ou seja, M aumenta).
Item B: falso. Em meio isotônico, a célula atinge um equilíbrio, e a célula se mantém com volume constante, de modo a não
murchar nem inchar.
Item C: falso. Em meio hipertônico, a célula perde água por osmose e plasmolisa, separando a parede celular da membrana
plasmática e diminuindo a resistência da parede celular à entrada de água (ou seja, M diminui).
Item D: falso. Quando a célula está túrgida, ocorre equilíbrio dinâmico, de tal modo que a quantidade de água que entra por
osmose se iguala à quantidade de água que sai pela resistência da parede celular, ou seja, Si = M e Sc = 0.
Item E: verdadeiro. Como discutido acima, com a célula túrgida, M = Si, e o volume da célula fica constante.

19.
Resposta: A
Comentário: Transporte passivo é aquele que ocorre a favor de um gradiente de concentração, ou seja, do meio mais concentrado
(hipertônico) para o menos concentrado (hipotônico). No caso da glicose, ocorre difusão facilitada, com o transporte passivo se
dando por proteínas carreadoras específicas. Quanto maior a concentração de glicose a ser transportada, mais proteínas
carreadoras são acionadas, aumentando a velocidade de transporte. Quando todas as proteínas carreadoras estão em ação, diz-se
que estão saturadas e a velocidade de transporte é máxima e constante. Assim, se no início do experimento ocorre no meio de
cultivo uma concentração de glicose que mantém o carreador saturado, a velocidade inicial de transporte é máxima e constante.
Com três minutos, o bloqueio do metabolismo da glicose já absorvida leva ao acúmulo de glicose dentro da célula, de modo que o
aumenta a concentração de glicose dentro da célula, dificultando sua entrada por difusão facilitada, que então diminui de
velocidade.

20.
Resposta: A
Comentário: Em condições normais, a concentração de íons potássio dentro das células é maior do que fora delas. Assim, existe
uma tendência à saída de potássio das células por difusão, que nesse caso é difusão facilitada, uma vez que ocorre por canais
proteicos de membrana. A bomba de sódio e potássio, através de transporte ativo e, consequentemente, com consumo de ATP,
devolve os íons potássio que saíram por difusão de volta para o interior da célula. Se a substância mencionada no texto promove a
diminuição da concentração intracelular do íon potássio, pode atuar de três maneiras:
- diminuindo a atividade da bomba de sódio e potássio, o que impede o transporte ativo do mesmo para dentro da célula;
- aumentando a difusão de potássio para fora da célula;
- diminuindo a produção de ATP, o que impede a ação da bomba de sódio e potássio.
As três situações descritas estão representadas no gráfico I.

21.
Resposta: B
Comentário: O transporte ativo é aquele que ocorre contra um gradiente de concentração, com gasto de energia, sendo mediado
por um carreador proteico com ação ATPásica, ou seja, que quebra ATP para fornecer energia para o transporte. No caso em
questão, quanto maior a concentração de soluto no meio de origem, menor a diferença de concentração em relação ao meio de
destino, de modo que o transporte ativo pode ser mais rápido. Considerando que a concentração do soluto no meio de origem não
se iguale ou ultrapasse a do meio de destino, continuando o transporte a ocorrer contra o gradiente de concentração, ou seja, por
transporte ativo, a partir de certa concentração de soluto, todas as proteínas carreadoras estão em ação, estando saturadas e com
velocidade de transporte máxima e constante, o que está representado no gráfico 2 (situação I). Se for inibida a produção de ATP,
não ocorrerá transporte passivo e a velocidade inicial do mesmo será, consequentemente, nula, como está representado no gráfico
2 (situação II). O transporte passivo é aquele que ocorre a favor de um gradiente de concentração, sem gasto de energia, sendo que
a difusão facilitada é um tipo transporte passivo mediado por um carreador proteico. Quanto maior a concentração de soluto a ser
transportado, mais proteínas carreadoras são acionadas, aumentando a velocidade de transporte. Quando todas as proteínas
carreadoras estão em ação, diz-se que estão saturadas e a velocidade de transporte é máxima e constante. Tanto na ausência
(situação III) como na presença de um inibidor de ATP (situação IV), que não afeta o transporte passivo, uma vez que não
depende de consumo de energia, o gráfico que representa o transporte passivo é o 2.

22.
Resposta: A
Comentário: Mecanismos de transporte ativo através da membrana celular ocorrem contra um gradiente de concentração, ou seja,
do meio menos concentrado (hipotônico) para o meio mais concentrado (hipertônico). Esse processo se dá de modo não
espontâneo e endotérmico, sendo realizado por proteínas transportadoras chamadas bombas, que utilizam a energia da quebra do
ATP no processo. O principal exemplo de transporte ativo em células animais se dá com a bomba de sódio e potássio, que
constantemente bombeia sódio para fora e potássio para dentro da célula, de modo que o teor de sódio no meio extracelular é
maior que o teor de sódio no meio intracelular e o teor de potássio no meio intracelular é maior que o teor de potássio no meio
extracelular. Essa diferença de concentração iônica, e consequentemente de polaridade elétrica, é chamada de potencial de
membrana e é a base para a condução do impulso nervoso. Assim, pode-se afirmar que a opção correta é a de letra A.

23.
Resposta: A
Comentário: O processo de difusão simples ocorre de modo passivo através da bicamada lipídica, sendo mais veloz quanto maior
for a diferença de concentração entre os dois meios envolvidos. Os processos de difusão facilitada e transporte ativo ocorrem
através de proteínas de transporte que, quando em grandes concentrações do substrato a ser carreado, saturam e passam a assumir
uma velocidade máxima e constante de transporte. Assim, os gráficos que representam adequadamente as situações analisadas são
os da opção A.

24.
Resposta: B
Comentário: Analisando cada item:
Item I: falso. As membranas celulares são constituídas por uma dupla camada de fosfolipídios, os quais são anfipáticos, com
porções apolares (hidrofóbicas) voltadas para o interior da membrana e porções polares (hidrofílicas) voltadas para as superfícies
da membrana.
Item II: verdadeiro. Como a bicamada lipídica é apolar e, de acordo com a regra do “semelhante dissolve semelhante”,
moléculas apolares atravessam a bicamada mais facilmente. Assim, quanto menor a molécula e quanto mais apolar ela for, maior a
velocidade de transporte através da bicamada.
Item III: verdadeiro. Moléculas apolares pequenas como oxigênio molecular (O 2 ) e o dióxido de carbono (CO 2 ) atravessam
rapidamente a bicamada lipídica das membranas por difusão.
Item IV: falso. Moléculas polares não carregadas, desde que muito pequenas, como água e etanol, também atravessam a
bicamada lipídica, mas moléculas polares de tamanho pouco maior, como a glicose, só podem passar pelas proteínas de
membrana.

25.
Resposta: E
Comentário: Osmose é o transporte passivo de água através da membrana plasmática, do meio hipotônico (meio menos
concentrado em soluto e mais concentrado em solvente) para o meio hipertônico (meio mais concentrado em soluto e menos
concentrado em solvente).
Se a concentração de solutos em uma célula diminui, como representado no gráfico, a mesma está ganhando água por osmose, o
que significa que está num meio hipotônico. Como a concentração inicial é de 10 unidades por mil, a única das opções em que a
concentração é menor do que essa (hipotônica) é a do item E, ou seja, de 5 unidade por mil.

26.
Resposta: B
Comentário: O celofane funciona como uma membrana semipermeável, de modo que o amido não consegue atravessá-la por
difusão, e assim não atinge o meio circundante com iodo. Desse modo, o iodo mantém a cor marrom, não assumindo a cor azul por
não reagir com o amido, uma vez que não atravessa a membrana de celofane.

27.
Resposta: B
Comentário: Mecanismos de transporte passivo ocorrem a favor de um gradiente de concentração (do meio mais concentrado para
o menos concentrado), de modo espontâneo e exotérmico (com liberação de energia). Esses podem ser de três tipos:
- difusão simples ou diálise, que é o transporte de solutos através da bicamada lipídica; esse processo transporta substâncias
apolares pequenas (como O 2 , CO 2 e lipídios) e substâncias polares muito pequenas sem carga (como NH 3 ).
- difusão facilitada, que é o transporte de solutos através das proteínas de membrana; esse processo transporta substâncias polares
pequenas sem carga (como aminoácidos e monossacarídeos) ou com carga (como íons).
- osmose, que é o transporte de solvente (água) através da bicamada e de proteínas denominadas aquaporinas; ela ocorre do meio
hipotônico (meio menos concentrado em soluto e mais concentrado em solvente) para o meio hipertônico (meio mais concentrado
em soluto e menos concentrado em solvente).
Mecanismos de transporte ativo ocorrem contra de um gradiente de concentração (do meio menos concentrado para o mais
concentrado), de modo não espontâneo e endotérmico (com consumo de energia), sempre através de proteínas de membrana.
Assim, A é difusão simples, B é difusão facilitada e C é transporte ativo.

28.
Resposta: A
Comentário: O transporte de substâncias lipossolúveis (apolares) através da membrana plasmática se dá por difusão simples ou
diálise, que é o transporte de solutos através da bicamada lipídica.

29.
Resposta: FVFVV.
Comentário: A palytoxina e a ouabaína são substâncias químicas que causam alterações no funcionamento normal das células de
mamíferos. O efeito da ouabaína é bastante conhecido, sendo um inibidor da enzima sódio e potássio ATPase, o que impede o
funcionamento normal da bomba de sódio e potássio e, conseqüentemente, altera a regulação osmótica celular, ocasionando
comprometimento das funções de manutenção normal de íons, como o Na+ e o K+, dentro e fora da célula. Já a palytoxina atua
causando a hemólise celular, com danos diretos à membrana celular. A palytoxina, a ouabaína e o potássio competem pelo mesmo
sítio específico de ligação, que corresponde a uma das subunidades da enzima sódio e potássio ATPase. A pré-incubação de
hemácias em meio de cultura de células contendo ouabaína faria com que todos esses receptores ficassem ocupados, não
permitindo a ligação da palytoxina posteriormente adicionada no experimento e, consequentemente, não desencadeando a hemólise
nas células sanguíneas usadas no experimento. Já a incubação de hemácias normais em meio contendo palytoxina causaria a
hemólise celular, independentemente da adição posterior de ouabaína ao meio. As células de animais geneticamente modificados,
de modo que a enzima sódio e potássio ATPase passasse a apresentar as subunidades receptoras defeituosas, não poderiam se ligar
à ouabaína nem à palytoxina, impedindo seu efeito nas células; entretanto, essas células perderão a capacidade de regulação
osmótica, pois a subunidade receptora defeituosa também não poderá se ligar ao potássio, íon importante nesse processo de
regulação osmótica. Células de animais geneticamente modificados e normais submetidos ao contado com ouabaína se
comportariam da mesma maneira no que diz respeito à regulação osmótica, pois o grupo A não sofrerá os efeitos da ouabaína,
entretanto terá, de qualquer maneira, a sua regulação osmótica alterada, e o grupo B sofrerá os efeitos da ouabaína, tendo também
seu processo regulatório danificado.

30.
Resposta: Na desidratação severa, a hidratação com água contendo sal e açúcar tem a finalidade de repor o sódio (Na+) perdido, já
que o sódio só pode ser absorvido junto com a glicose pela proteína transportadora, por co-transporte do tipo simporte.

31.
Resposta:
A) 1B ou C; 2A; 3B; A é difusão simples, transporte de solutos apolares a favor do gradiente pela bicamada lipídica; B é difusão
facilitada, transporte de solutos polares a favor do gradiente por proteínas carreadoras; C é transporte ativo, transporte de solutos
contra o gradiente por proteínas carreadoras com atividade ATPásica.
B) A alface perdeu água por osmose por ter sido exposta a um meio hipertônico.

32.
Resposta:
A) Transporte ativo secundário. A princípio, o houve passagem a favor do gradiente, e depois a passagem continuou contra o
gradiente. Assim, a concentração intracelular de X, inicialmente menor que a extracelular, aumentou após a incubação, tornando-
se maior do que a extracelular e caracterizando um tipo de transporte contra gradiente de concentração, dependente de gasto
energético.
B) Devido à bomba de sódio e potássio, o meio extracelular terá mais sódio que o meio intracelular, como ocorre no quadrante A.

33.
Resposta:
A) O salgamento desidrata as bactérias decompositoras por osmose.
B) Sim, uma vez que a parede celular impede a plasmoptise.
C) A bomba de sódio e potássio mantém a baixa concentração intracelular de sódio, o que força sua entrada por difusão. Como o
sódio entra em co-transporte com a glicose, a difusão de sódio fornece energia para carregar.

34.
Resposta: A questão cobre o tema de Biologia Celular, enfocando os efeitos da tonicidade do meio sobre o volume celular. Ao
tratar as folhas de Elodea com a solução A, o técnico de laboratório observou, sob microscopia óptica, que as células apresentaram
o mesmo aspecto daquelas imersas na solução isotônica de NaCl, então, pôde concluir que a solução A era isotônica com as
células. Com a solução B, observou que as células de Elodea ficaram mais túrgidas, portanto, esta solução era hipotônica em
relação às células e, assim, menos concentrada que a solução A (isotônica). Ao gotejar as células com a solução C, verificou que as
células ficaram mais murchas que aquelas da Elodea submetidas à solução A, o que deu para concluir que a solução C era
hipertônica em relação às células, pois o fato de terem murchado significa que o meio era mais concentrado que as células. Ao
visualizar as células após gotejar a solução D verificou que as mesmas ficaram mais murchas que aquelas da solução A, porém
menos murchas que as da solução C. Assim, pôde concluir que as concentrações das soluções seguiam a seguinte ordem
decrescente [C] > [D] > [A] > [B]. Assim, pôde inferir que [C] = 0,8M; [D] =0,6M; [A] = 0,4M e [B] = 0,2M. Quanto ao item II da
questão, as células de Elodea não estouraram quando gotejadas com a solução B (hipotônica em relação às células) porque, como
as de todos os vegetais, possuem parede celular, que é uma estrutura rígida e externa à membrana plasmática, proporcionando
resistência contra o rompimento da membrana com o aumento do volume celular.

35.
Resposta:
A) Tanto em diarreias como na sudorese excessiva, a perda de água é acompanhada de perda de íons como sódio e potássio. Assim,
a reposição de água deve ser acompanhada da reposição desses íons. No caso da reposição por via oral, para que ocorra absorção
de sódio pelo epitélio do intestino, se faz necessária a adição de glicose, uma vez que a entrada de sódio e glicose se dá por um
mecanismo de cotransporte, onde só pode haver a entrada das duas substâncias simultaneamente.
B) A massa molecular da sacarose é bem maior que a do cloreto de sódio, de modo que, apesar de a quantidade de moléculas (ou
de mol) ser a mesma, a massa de açúcar é maior do que a de sal.

36.
Resposta: A quantidade de aquaporinas deverá ser maior no paciente. A elevada concentração de solutos indica desidratação
causada pela diarreia e, portanto, a necessidade de reabsorver água, reduzindo sua perda na urina.

37.
Resposta:
A) As soluções eram hipertônicas, pois foram capazes de reduzir o volume celular por perda de água devida à osmose.
B) O soluto A foi capaz de atravessar a membrana pois, após algum tempo, o volume celular foi restaurado, indicando que as
concentrações intracelulares e extracelulares se igualaram.

38.
Resposta:
A)
(x) O transporte da substância S2 é mediado por carreador.
(x) A substância S1 é transportada por difusão simples.
B) O transporte da substância S1 é feito por difusão simples, enquanto que a substância S2 é transportada por carreador. Na difusão
simples, a velocidade do transporte é diretamente proporcional à concentração da molécula transportada. Já no transporte mediado
por carreador, a velocidade de transporte se aproxima de um valor máximo quando a proteína carreadora está saturada (todos os
sítios ligantes estão ocupados), pois este transporte depende da ligação da molécula a ser transportada à proteína carreadora.

39.
Resposta:
A)
(X) por difusão simples, através da bicamada lipídica da membrana citoplasmática.
B) Sendo um lipídio esteroide de peso molecular intermediário (não é macromolécula), o colesterol atravessa a membrana por
difusão simples via bicamada lipídica, e não por proteínas ou endocitose.
40.
Resposta: Se no meio A, hipertônico, não houve alteração de volume, é porque as concentrações se tornaram iguais por difusão do
soluto, e se o soluto pode passar pela membrana, é porque as partículas são bastante pequenas. Se no meio B, também hipertônico,
houve plasmólise, é porque houve perda de água, ou seja, o solvente se deslocou porque o soluto é muito grande para atravessar a
membrana. Uma ressalva: na verdade, se há difusão, também tem que haver osmose, de modo que, na verdade, em A, a água deve
ter se deslocado por osmose junto com a ocorrência da difusão, mas uma vez que o soluto atravessa a membrana, a água o
acompanha por osmose, retornando o volume da célula ao original. Assim, a célula altera seu volume a princípio, mas retoma seu
volume original, enquanto que em B, a célula altera seu volume, mas não retoma seu volume original.
1.
Resposta: B
Comentário: Polímeros são moléculas formadas pela repetição de unidade menores denominadas monômeros. Os três principais
polímeros biológicos são as proteínas, formadas por aminoácidos, os polissacarídeos, formados por monossacarídeos como a glicose, e
os ácidos nucleicos, como o DNA e o RNA, formados por nucleotídeos. Polímeros comestíveis secretados por algas podem ser
proteínas, produzidas por ribossomos, e, no caso das proteínas de exportação, destinadas à secreção, particularmente pelos ribossomos
do retículo endoplasmático rugoso. Entretanto, os principais polímeros comestíveis secretados por algas são polissacarídeos,
produzidos no complexo de Golgi. Tanto proteínas como polissacarídeos são secretados por vesículas derivadas do complexo de
Golgi, de modo que a opção A, onde ocorre maior proporção dessa organela, é a resposta mais adequada.

2.
Resposta: A
Comentário: Pela medição de radioatividade, pode-se notar que, de início, ela é maior no retículo endoplasmático rugoso (tempo
inicial, onde o retículo endoplasmático rugoso realiza a síntese das proteínas para exportação). Em seguida, a radioatividade é maior
no complexo golgiense (tempo médio, onde o complexo golgiense promove o envolvimento das proteínas de secreção por suas
membranas). Por fim, a radioatividade é maior nas vesículas de secreção (tempo final, onde as vesículas de secreção fusionam com a
membrana plasmática, liberando as proteínas para fora da célula por exocitose).

3.
Resposta: B
Comentário: Apesar de controvérsias, o fenômeno de apoptose ou morte celular programada, atualmente, é considerado diferente do
mecanismo de autólise, ocorrendo não por lisossomos e autólise, e sim através de estruturas denominadas apoptossomos, os quais são
formados a partir das mitocôndrias. Assim, sabe-se que a autólise por lisossomos ocorre em situações como as doenças de depósito,
exemplificadas por silicose e asbestose, mas a regressão da cauda do girino na metamorfose é promovida por apoptose.

4.
Resposta: B
Comentário: A figura representa uma célula animal (não possui parede celular, vacúolo de suco celular ou cloroplastos) como
visualizada ao microscópio eletrônico de transmissão. Nela, as estruturas evidenciadas são:
1. Vesículas de secreção ou grânulos de zimogênio, que são derivadas do complexo de Golgi e têm função de conduzir substâncias de
secreção até a membrana plasmática, onde são eliminadas por exocitose.
2. Complexo de Golgi, que é formado por um conjunto de vesículas membranosas achatadas denominadas dictiossomas ou
golgiossomas, com funções como a síntese de polissacarídeos, a síntese de glicoproteínas e glicolipídios, a formação do acrossomo de
espermatozóides, a formação da lamela média de células vegetais, a formação de lisossomas e a secreção celular pela formação de
vesículas secretoras para exocitose.
3. Retículo endoplasmático rugoso ou granular, que consiste em uma rede (“retículo”) canalículos e vesículas derivados de
invaginações da membrana plasmática, com ribossomos aderidos para promover a síntese de proteínas de exportação como a lisozima.
4. Mitocôndrias, que são organelas ovaladas, formadas por duas membranas, com um espaço intermembrana entre elas, sendo que a
membrana interna sofre uma série de invaginações, formando projeções denominadas cristas mitocondriais. Na face interna dessas, há
partículas esféricas pediculadas chamadas oxissomos, que são enzimas responsáveis pela síntese de ATP na mitocôndria. A membrana
interna também delimita um espaço contendo uma massa amorfa denominada matriz mitocondrial. As mitocôndrias são responsáveis
por duas das três etapas da respiração aeróbica, o ciclo de Krebs (na matriz mitocondrial) e a cadeia respiratória (nas cristas
mitocondriais); a glicólise ocorre no citoplasma.
Assim, como o paciente tem células com retículo endoplasmático rugoso normal, mas complexo de Golgi deficiente, pode-se afirmar
que o paciente produz a lisozima, mas não a secreta eficientemente.

5.
Resposta: B
Comentário: Doenças de depósito são causadas pelo acúmulo de substâncias em lisossomos, levando à sua ruptura e consequente
autólise, com liberação das enzimas lisossômicas e morte da célula. Poeira de sílica pode levar à autólise, numa condição denominada
silicose.

6.
Resposta: A
Comentário: Analisando a figura:
- 1 é o nucléolo, estrutura nuclear formada de RNAr e responsável pela produção de ribossomos;
- 2 é o núcleo, delimitado pela carioteca e responsável por abrigar o material genético;
- 3 é um ribossomo, formado por RNAr e proteínas e responsável pela síntese proteica;
- 4, 10 e 12, representadas como vesículas citoplasmáticas esféricas, podem ser lisossomos, com enzimas digestivas, para a digestão
intracelular, ou peroxissomos, com enzimas oxidativas, para a β-oxidação dos lipídios e para a destruição de substâncias tóxicas;
- 5 é o retículo endoplasmático rugoso, associado a ribossomos para produzir proteínas de exportação;
- 6 é o complexo golgiense, que prepara vesículas para a secreção de proteínas a partir do retículo endoplasmático rugoso, bem como
produz polissacarídeos, adiciona açúcares a lipídios e proteínas, forma o acrossomo do espermatozoide e a lamela média que origina a
parede celular vegetal;
- 7 é a membrana plasmática, formada por fosfolipídios e proteínas e que delimita a célula;
- 8 é o retículo endoplasmático liso, que produz lipídios esteroides e destrói substâncias tóxicas;
- 9 são mitocôndrias, relacionadas com a respiração aeróbica;
- 11 é o hialoplasma ou citoplasma fundamental;
- 13 é o diplossoma, par de centríolos, formados por microtúbulos e responsável pela produção de cílios, flagelos e áster (da divisão
celular).
Assim, analisando cada item:
Item A: verdadeiro. A organela 8 é o retículo endoplasmático liso, relacionado à desintoxicação celular.
Item B: falso. A degradação do peróxido de hidrogênio é realizada pela enzima catalase dos peroxissomos, que estão representados
por 4, 10 ou 12.
Item C: falso. Vacúolos residuais são formados após a digestão intracelular nos lisossomos, abrigando restos não digeríveis que são
eliminados da célula por clasmocitose, estando os mesmos representados por 4, 10 ou 12.
Item D: falso. Os centríolos (13) são responsáveis pela formação de cílios e flagelos em células eucarióticas, mas estão ausentes em
células procarióticas, que por vezes têm flagelos constituídos de uma proteína denominada flagelina.
Item E: falso. O nucléolo (1) não possui membrana nem DNA.

7.
Resposta: D
Comentário: Analisando cada item:
Item A: falso. O retículo endoplasmático rugoso ou granular (RER) consiste em uma rede (“retículo”) canalículos e vesículas
derivados de invaginações da membrana plasmática, com ribossomos aderidos para promover a síntese de proteínas de exportação,
estando bem desenvolvido nesta célula, pois a mesma deve sintetizar muitas proteínas.
Item B: falso. As mitocôndrias (M) são organelas ovaladas, formadas por duas membranas, com um espaço intermembrana entre elas,
sendo que a membrana interna sofre uma série de invaginações, formando projeções denominadas cristas mitocondriais. Na face
interna dessas, há partículas esféricas pediculadas chamadas oxissomos, que são enzimas responsáveis pela síntese de ATP na
mitocôndria. A membrana interna também delimita um espaço contendo uma massa amorfa denominada matriz mitocondrial. As
mitocôndrias são responsáveis por duas das três etapas da respiração aeróbica, o ciclo de Krebs (na matriz mitocondrial) e a cadeia
respiratória (nas cristas mitocondriais); a glicólise ocorre no citoplasma. A grande quantidade de mitocôndrias na célula indica a
grande atividade metabólica da célula.
Item C: falso. O nucléolo é responsável pela síntese e organização das subunidades ribossômicas, estando ausente em células em
divisão. Como a célula representada tem nucléolo, não está em mitose.
Item D: verdadeiro. Retículo endoplasmático liso ou agranular consiste em uma rede (“retículo”) canalículos e vesículas derivados
de invaginações da membrana plasmática, sem ribossomos aderidos à sua estrutura, com papéis como a síntese de lipídios esteróides e
a destoxificação, ou seja, a destruição de substâncias tóxicas. Quanto mais freqüente a exposição a uma certa substância tóxica, maior
o tamanho do retículo endoplasmático liso, uma vez que está relacionado à atividade de destoxificação na célula.
Item E: falso. Lisossomas são bolsas membranosas esféricas contendo em seu interior enzimas líticas, denominadas hidrolases
lisossômicas, com função de digestão intracelular, sem relação com a atividade da destoxificação. O catabolismo (destruição) do
álcool é realizado por organelas como o retículo endoplasmático liso e os peroxissomos.

8.
Resposta: C
Comentário: O colágeno é uma proteína fibrosa formada por uma cadeia peptídica que se dobra sobre si mesma em uma tripla-hélice,
a qual é mantida por ligações covalentes entre resíduos de lisina, as quais são chamadas de covalentes cross-linking. Como é uma
proteína que age no meio extracelular, ou seja, de exportação, o colágeno é produzido nos ribossomos do retículo endoplasmático
rugoso, sendo produzido inicialmente como pró-colágeno, o qual é convertido em colágeno por ação de uma enzima associada à
vitamina C, a qual converte o aminoácido prolina do pró-colágeno em 4-hidroxi-prolina do colágeno. Analisando cada item:
Item A: falso. O colágeno é formado por uma cadeia peptídica sintetizada pelos ribossomos do retículo endoplasmático rugoso.
Item B: falso. O procolágeno deve primeiro ser convertido em colágeno antes de ser enviado ao complexo de Golgi, onde é embalado
e secretado por exocitose.
Item C: verdadeiro. As fibrilas dentro da tripla-hélice de uma molécula de colágeno são ligadas pelas ligações covalentes cross-
linking.
Item D: falso. O escorbuto é causado pela deficiência de vitamina C e impede a formação dos resíduos de 4-hidroxi-prolina que
convertem o pró-colágeno em colágeno, de modo que ocorre degeneração do tecido conjuntivo, resultando em hemorragias, perda dos
dentes, fraturas ósseas e retardo de cicatrização.

9.
Resposta: A
Comentário: As inclusões citoplasmáticas correspondem a acúmulos de sais minerais em vegetais, conhecidos como drusas, ráfides e
cistólitos. Drusas e ráfides são acúmulos de oxalato de cálcio, enquanto que cistólitos são acúmulos de carbonato de cálcio. Estas
inclusões estão armazenadas em estruturas citoplasmáticas denominadas vacúolos.

10.
Resposta: B
Comentário: Analisando cada item:
Item A: verdadeiro. Os ribossomos possuem uma subunidade maior e uma menor.
Item B: falso. Os ribossomos são constituídos por proteínas associadas ao RNA ribossômico, não possuindo lipídios em sua
composição.
Item C: verdadeiro. Ribossomos ativos se apresentam como polissomos ou polirribossomos, formados por vários ribossomos
associados a uma molécula de RNAm.
Item D: verdadeiro. Polissomos livres produzem proteínas de uso interno pela célula, enquanto que polissomos aderidos ao retículo
endoplasmático rugoso produzem proteínas de exportação.

11.
Resposta: C
Comentário: Analisando cada item:
Item I: verdadeiro. O retículo endoplasmático consiste em uma rede (“retículo”) canalículos e vesículas derivados de invaginações
da membrana plasmática. O retículo granular ou rugoso possui ribossomos aderidos para promover a síntese de proteínas de
exportação, enquanto retículo agranular ou liso promove a síntese de lipídios esteróides e a destoxificação, ou seja, a destruição de
substâncias tóxicas.
Item II: falso. A eliminação de substâncias tóxicas é facilitada pelo retículo endoplasmático liso pela adição de radicais acetila a tais
substâncias, tornando-as mais polares e consequentemente mais solúveis em água e mais fáceis de eliminar na urina, a partir dos rins.
Item III: verdadeiro. A citocinese após a mitose vegetal é feita pela formação de uma parede no citoplasma entre os dois núcleos
formados, o que se chama de lamela média. Ela é formada por vesículas, os fragmoplastos, liberadas a partir do complexo de Golgi.
Essas vesículas contêm o polissacarídeo pectina e se localizam na região média da célula. Sobre elas será depositada celulose que
formará a parede celular entre as duas células-filhas.

12.
Resposta: B
Comentário: O movimento ameboide está associado, além da locomoção, ao processo de fagocitose e é observado principalmente em
certos protozoários como a ameba e células animais de defesa (leucócitos, também conhecidos como glóbulos brancos). Nesta forma
de movimento, a célula emite prolongamentos citoplasmáticos, denominados pseudópodes, o que é conseguido através de
transformações controladas gel-sol e sol-gel. Normalmente, a região mais externa do citoplasma é bastante viscosa, sendo denominada
ectoplasma e apresentando uma maior concentração protéica, se apresentando como um gel coloidal. Já a região mais interna,
denominada endoplasma, apresenta uma menor concentração protéica, sendo mais fluida e apresentado-se como um sol coloidal.

13.
Resposta: E
Comentário: O Retículo Endoplasmático Rugoso possui ribossomos aderidos a suas membranas, sendo responsável pela produção de
proteínas de exportação, que serão secretadas por intermédio do complexo de Golgi, pela produção de enzimas de organelas como
lisossomos e peroxissomos, as quais são formadas a partir do complexo de Golgi, e pela produção de proteínas de membrana, que são
introduzidas na membrana por intermédio de vesículas derivadas do complexo de Golgi.

14.
Resposta: D
Comentário: Lisossomos são vesículas esféricas, encontradas em algumas células eucarióticas, contendo enzimas digestivas. Em
algumas situações, a membrana do lisossomo se rompe, liberando suas enzimas digestivas e íons hidrogênio, o que leva à digestão e
morte da célula, num fenômeno chamado de autólise.
Observação: Atualmente, o fenômeno de apoptose ou morte celular programada é diferenciado da autólise por ocorrer não por
lisossomos e autólise, mas através de corpos denominados apoptossomos, derivados das mitocôndrias. Assim, a autólise por
lisossomos ocorre em situações patológicas, como nas chamadas doenças de depósito, exemplificadas por silicose e asbestose, e a
apoptose estaria relacionada a situações fisiológicas como a regressão da cauda do girino na metamorfose.

15.
Resposta: C
Comentário: Ribossomos são organelas constituídas de RNAr e proteínas e responsáveis pela polimerização de aminoácidos para a
síntese de proteínas. Algumas organelas são dotadas de ribossomos, possuindo a capacidade de produzir proteínas, como ocorre com
mitocôndrias, cloroplastos e retículo endoplasmático rugoso. Assim, os aminoácidos radioativos serão utilizados na síntese de
proteínas em organelas como ribossomos, mitocôndrias, cloroplastos e retículo endoplasmático rugoso.

16.
Resposta: B
Comentário: Cílios são estruturas celulares alongadas e constituídas de microtúbulos, sendo derivados dos centríolos e estando
relacionados à locomoção em organismos unicelulares como o protozoário Paramecium e com a movimentação de partículas, como
espermatozóides do ducto deferente à uretra, óvulos, zigotos ou embriões da tuba uterina ao útero, e muco e partículas a ele aderidas
das vias aéreas inferiores, como laringe, traquéia, brônquios e bronquíolos, até a faringe, para que sejam deglutidos ou eliminados fora
do corpo.

17.
Resposta: D
Comentário: O citoesqueleto é composto de três componentes proteicos:
- microtúbulos, formados de proteína tubulina e relacionados a sustentação, transporte de substâncias, movimentos celulares (como
emissão de pseudópodes, ciclose e movimentos ciliar e flagelar) e formação de centríolos, cílios, flagelos, fibras do fuso e fibras do
áster;
- microfilamentos, formados de proteína actina e relacionados a contração muscular e citocinese (divisão do citoplasma após a divisão
do núcleo na mitose e na meiose);
- filamentos intermediários, formados de proteína queratina e relacionados a adesão celular.
Assim, analisando cada item:
Item A: falso. A condensação e descondensação dos cromossomos na divisão celular está relacionada a proteínas nucleares
denominadas condensinas.
Item B: falso. O citoesqueleto está ausente em células procarióticas, como as células bacterianas.
Item C: falso. A oxidação de substâncias orgânicas no interior da célula, relacionada à produção de energia na respiração aeróbica,
está relacionada às mitocôndrias.
Item D: verdadeiro. Os filamentos intermediários de queratina do citoesqueleto estão relacionados à adesão da célula a células
vizinhas e a superfícies extracelulares.
Item E: falso. A digestão intracelular está relacionada aos lisossomos.

18.
Resposta: B
Comentário: O retículo endoplasmático liso é a principal organela responsável pela destoxificação, ou seja, pela conversão de
substâncias tóxicas em substâncias menos tóxicas e/ou mais fáceis de eliminar. Por exemplo, muitas drogas passam pelo processo de
acetilação no retículo endoplasmático liso do fígado, o que as torna mais solúveis em água e mais fáceis de eliminar na urina. Quanto
mais frequente o uso de uma droga, maior o retículo endoplasmático liso para eliminar a droga de modo mais eficaz. Assim, ao usar
uma droga, o retículo endoplasmático liso aumenta (dias de tratamento, de 1 a 5 no gráfico), e ao interromper o uso da mesma, o
retículo endoplasmático liso diminui (dias após o tratamento, de 6 a 12 no gráfico), de modo que a opção correta é a de letra B.

19.
Resposta: C
Comentário: Analisando cada item:
Item A: verdadeiro. Em células vegetais, o complexo de Golgi produz polissacarídeos como pectina e hemicelulose, formando
vesículas denominadas fragmoplastos, as quais constituem a lamela média que forma a parede celular.
Item B: verdadeiro. O complexo de Golgi adiciona carboidratos a proteínas e lipídios produzidos no retículo endoplasmático
formando glicolipídios e glicoproteínas, num processo denominado glicosilação.
Item C: falso. Lisossomos e peroxissomos as vesículas membranosas esféricas derivadas do complexo de Golgi, sendo que
lisossomos acumulam enzimas digestivas (hidrolíticas) e os peroxissomos acumula enzimas oxidativas.
Item D: verdadeiro. Na formação do espermatozoide, o complexo de Golgi origina o acrossomo que auxilia na penetração no óvulo
pela degradação da corona radiata e da zona pelúcida.
Item E: verdadeiro. O Complexo de Golgi é polarizado e apresenta uma face cis ou formadora, que recebe vesículas provenientes do
retículo endoplasmático, e uma face trans ou maturadora da qual se desprendem vesículas contendo as proteínas a modificadas a serem
secretadas.

20.
Resposta: A
Comentário: Segundo alguns autores, a regressão da cauda do girino na metamorfose se dá por autólise, ou seja, por ruptura dos
lisossomos e liberação de suas enzimas digestivas. As enzimas do lisossomo são produzidas pelos ribossomos do retículo
endoplasmático rugoso.
Observação: Atualmente, a maioria dos autores descreve o fenômeno da regressão da cauda do girino não por autólise mediada por
lisossomos, e sim por apoptose mediada pelos apoptossomos derivados da mitocôndria, os quais desmontam a célula sem inflamação e
com gasto de energia.

21.
Resposta: A
Comentário: A síndrome de Zellweger ou síndrome cerebrohepatorenal é uma doença genética relacionada aos peroxissomos.
Peroxissomos são vesículas citoplasmáticas contendo enzimas oxidativas relacionadas à β-oxidação dos lipídios, os quais são
degradados em acetil-coA, que por sua vez é degradado como fonte de energia no ciclo de Krebs da respiração aeróbica. Nesse
processo de β-oxidação, ocorre produção de água oxigenada, utilizada na eliminação de microorganismos invasores e na destruição de
substâncias toxicas. Os excessos de água oxigenada são eliminados pela enzima catalase.

22.
Resposta: D
Comentário: Os peroxissomas são bolsas membranosas esféricas, presentes em todos os eucariontes, contendo enzimas relacionadas
à oxidação de lipídios e à destruição de substâncias tóxicas ao organismo As principais substâncias destruídas pela ação das enzimas
dos peroxissomos são os radicais livres derivados de oxigênio, também conhecidas como espécies ativas de oxigênio, derivados de
peróxido de hidrogênio, como é o caso do ânion superóxido. Assim, os peroxissomos possuem a enzima catalase, que quebra o
peróxido de hidrogênio (água oxigenada) em água e oxigênio, usado na eliminação de microorganismos nos leucócitos. Ao se usar
água oxigenada como antisséptico em ferimentos, é o oxigênio que elimina os microorganismos. Desse modo, analisando cada item:
Item 1: verdadeiro. A formação de bolhas, em ferimentos, após o uso da água oxigenada, se deve à liberação de oxigênio como
produto da reação de quebra do peróxido de hidrogênio pela catalase.
Item 2: falso. A reação de quebra do peróxido de hidrogênio pela catalase é catabólica e exotérmica.
Item 3: verdadeiro. Enzimas não são consumidas na reação que catalisam , de modo que a catalase pode promover a reação
continuamente, tantas vazes quanto houver a adição de água oxigenada sobre o ferimento.

23.
Resposta: A
Comentário: Analisando cada item:
Item A: falso. O complexo golgiense é um conjunto de vesículas membranosas achatadas que agem na formação de vesículas para
secreção de proteínas sintetizadas no retículo endoplasmático rugoso; a produção de lipídios de membrana plasmática e de esteroides
se dá no retículo endoplasmático liso.
Item B: verdadeiro. O glicocálix é uma camada de oligossacarídeos associados a lipídios e proteínas na face externa da membrana
plasmática de células animais, agindo na adesão celular, no reconhecimento celular e na retenção de nutrientes e enzimas ao redor da
célula.
Item C: verdadeiro. Os peroxissomas ou microcorpos são vesículas contendo enzimas oxidativas presentes em células eucariontes,
sendo que em células vegetais ocorrem peroxissomas especiais chamados de glioxissomas, os quais convertem os lipídios das
sementes em glicídios, os quais são usados como fonte de energia para a germinação.
Item D: verdadeiro. O retículo endoplasmático rugoso produz proteínas de exportação, ou seja, que são secretadas pelas células,
como ocorre com hormônios proteicos e enzimas digestivas.

24.
Resposta: B
Comentário: A digestão intracelular é proporcionada por enzimas digestivas presentes nos lisossomos (II), estruturas derivadas do
complexo de Golgi (III).
- Na digestão intracelular heterofágica, ocorre digestão de material englobado a partir do meio externo da célula através de
mecanismos de endocitose (I), ou seja, fagocitose (de partículas sólidas) ou pinocitose (de partículas líquidas). Após a endocitose (I), o
material englobado é abrigado em uma vesícula denominada endossomo (fagossomo ou pinossomo, dependendo do caso). O
lisossoma (II) se aproximam do endossomo e se funde a ele, formando um vacúolo digestivo heterofágico ou lisossomo secundário,
onde ocorre a digestão e a absorção do material digerido. Algumas substâncias não digeríveis permanecem na vesícula sem que
possam ser absorvidas, e a vesícula agora assume o nome de vacúolo residual (V), que se funde à membrana plasmática e elimina seu
conteúdo por exocitose, num processo denominado clasmocitose ou defecação celular (VI).
- Na digestão intracelular autofágica, ocorre digestão de material englobado dentro da própria célula, como organelas que necessitam
de reciclagem. O retículo endoplasmático emite vesículas que englobam a organela a ser reciclada, sendo a vesícula denominada
vacúolo autofágico (IV). O lisossoma (II) se aproximam do vacúolo autofágico e se funde a ele, formando um vacúolo digestivo
autofágico ou lisossomo secundário, onde ocorre a digestão e a absorção do material digerido. De modo idêntico ao que ocorre na
digestão intracelular heterofágica, algumas substâncias não digeríveis permanecem na vesícula sem que possam ser absorvidas, e a
vesícula agora assume o nome de vacúolo residual (V), que se funde à membrana plasmática e elimina seu conteúdo por exocitose,
num processo denominado clasmocitose ou defecação celular (VI).
Assim, a opção correta é a de letra B (devendo-se perceber que a fagocitose é uma modalidade de endocitose).
25.
Resposta: C
Comentário: Os peroxissomas são bolsas membranosas esféricas, presentes em todos os eucariontes, contendo enzimas relacionadas à
oxidação de lipídios (beta-oxidação de ácidos graxos, com formação de acetil-coA e H 2 O 2 ) e à destruição de substâncias tóxicas ao
organismo (o peróxido de hidrogênio produzido na beta-oxidação é usado na detoxificação de agentes nocivos como o etanol e na
eliminação de certos microorganismos). As principais substâncias destruídas pela ação das enzimas dos peroxissomos são os radicais
livres derivados de oxigênio, também conhecidas como espécies ativas de oxigênio, derivados do peróxido de hidrogênio, como é o
caso do ânion superóxido. Além de produzida na beta-oxidação, a água oxigenada também é freqüentemente produzida como
subprodutos da ação respiratória. (Perceba que os peroxissomos formam e destroem água oxigenada.) A principal destas enzimas é a
catalase ou peroxidase. Ela converte o excesso de água oxigenada (peróxido de hidrogênio), altamente tóxica por oxidar componentes
celulares, em água e oxigênio.

26.
Resposta: E
Comentário: O citoesqueleto compreende um conjunto de estruturas protéicas no citoplasma, visíveis apenas ao microscópio
eletrônico sendo responsáveis pela sustentação da célula e definição da sua forma.
- Os microtúbulos são formados por uma proteína globular denominada tubulina, polimerizada em hélice e formando tubos
relacionados à formação de centríolos, cílios, flagelos, fibras do fuso e fibras do áster, ao transporte de substâncias e à sustentação e
proteção mecânica da célula, além de promoverem movimentos celulares como a emissão de pseudópodes, a ciclose e os movimentos
ciliar e flagelar.
- Os microfilamentos são formados por uma proteína denominada actina, que se associam à proteína miosina para desempenharem
juntos a função de contração celular.
- Os filamentos intermediários são formados por uma proteína denominada queratina, de alta resistência mecânica e que aumentam a
adesão entre células vizinhas, principalmente associadas a especializações de membrana denominadas desmossomos.
Assim:
Item A: falso. Microfilamentos são constituídos por actina, e não por tubulina.
Item B: falso. Filamentos intermediários de queratina são os componentes de maior resistência e durabilidade no citoesqueleto.
Item C: falso. De novo, microfilamentos são constituídos por actina, e não por tubulina.
Item D: falso. Microtúbulos são constituídos por tubulina, e não por actina.
Item E: verdadeiro. Nas células musculares, os microfilamentos de actina associam-se a filamentos mais grossos e também contráteis
de miosina. Isso ocorre em músculos estriados (com os filamentos organizados em sarcômeros) e em músculos lisos (com os
filamentos não organizados em sarcômeros). Os músculos lisos proporcionam o peristaltismo no tubo digestivo, o que possibilita o
deslocamento do bolo alimentar nele contido.

27.
Resposta: D
Comentário: Duas organelas agem no processo de desintoxicação, como no caso do metabolismo do etanol, apresentando enzimas
que convertem etanol em acetaldeído, num primeiro momento, e daí então acetaldeído em ácido acético, o qual pode ser utilizado
como fonte de energia na respiração aeróbica ou convertido em gorduras. Essas organelas são o retículo endoplasmático liso e os
peroxissomos.

28.
Resposta: B
Comentário: A figura I representa uma célula vegetal, uma vez que é dotada de parede celular, cloroplasto e vacúolo de suco celular,
que é delimitado por uma membrana denominada tonoplasto. A figura II representa uma célula animal, uma vez que é dotada de
centríolos e não apresenta celular e cloroplasto. O erro mencionado se refere ao fato de que 6 representa o núcleo celular, e não o
vacúolo de suco celular, o qual é encontrado somente em células vegetais, sendo delimitado pelo tonoplasto (1).

29.
Resposta: A
Comentário: De acordo com a tabela:
- A célula A é rica em filamentos de actina, com papel de contração, em retículo endoplasmático liso, que nas células musculares se
chama retículo sarcoplasmático e que armazena íons de cálcio que funcionam como o gatilho para a contração, em mitocôndrias, que
fornecem energia para a contração, e em núcleos, sendo a célula muscular estriada esquelético multinucleada, o que nos permite
concluir que sua função é a de contração.
- A célula B é rica em retículo endoplasmático rugoso e complexo de Golgi, principais organelas envolvidas no processo de secreção
celular, o que nos permite concluir que sua função é a de secreção.

30.
Resposta: E
Comentário: Em água pura, as células estarão hipertônicas e passarão a ganhar água por osmose. Assim:
- Como células vegetais têm parede celular, que limita a entrada de água, não aumentam muito de volume, passando a um volume
constante quando ficam túrgidas, de modo que a quantidade de água que entra por osmose se iguala à quantidade de água que sai pela
resistência da parede celular, de acordo com o esquema A.
- Protozoários não possuem parede celular, mas muitos deles possuem vacúolo pulsátil, de modo que, ao ganharem água por osmose,
eliminam o excesso de água pela contração dessa organela. Assim, o volume da célula do protozoário, bem como a entrada de água,
ficam oscilando, de acordo com o esquema B.
- Células animais não possuem parede celular ou vacúolo pulsátil, de modo que o volume celular e a entrada de água aumentam até
que a membrana se rompa no fenômeno de plasmoptise.

31.
Resposta: E
Comentário: Analisando cada item:
Item I: falso. Segundo o gráfico, a atividade das enzimas envolvidas no processo é máxima no final da regressão da cauda dos
girinos.
Item II: verdadeiro. A regressão da cauda dos girinos se dá por ação dos lisossomos, os quais possuem enzimas digestivas,
conhecidas como hidrolases ácidas.
Item III: verdadeiro. Apesar de as enzimas que atuam na digestão da cauda dos girinos estarem localizadas nos lisossomos, as
mesmas são sintetizadas no interior do retículo endoplasmático rugoso.
Item IV: verdadeiro. A ausência de lisossomos nas células da cauda dos girinos impediria sua regressão.

32.
Resposta: E
Comentário: O retículo endoplasmático consiste em uma rede (“retículo”) canalículos e vesículas derivados de invaginações da
membrana plasmática. O retículo granular ou rugoso possui ribossomos aderidos para promover a síntese de proteínas de exportação,
enquanto retículo agranular ou liso promove a síntese de lipídios esteróides e a destoxificação, ou seja, a destruição de substâncias
tóxicas. Assim, analisando cada item:
Item I: verdadeiro. A maioria das organelas citoplasmáticas é menor que o limite de resolução do Microscópio Óptico (de até
1.000x), havendo a necessidade do Microscópio Eletrônico (com limite de resolução de até 300.000x) para sua visualização; isso
ocorre com ribossomos, retículo endoplasmático, complexo de Golgi, lisossomos e outras.
Item II: falso. Quanto mais freqüente a exposição a uma certa substância tóxica, maior o tamanho do retículo endoplasmático liso,
uma vez que está relacionado à atividade de destoxificação na célula.
Item III: verdadeiro. O fígado é o principal órgão animal com papel de destoxificação do organismo, possuindo, por isso, retículo
endoplasmático liso bem desenvolvido.

33.
Resposta: C
Comentário: Os lisossomas são bolsas membranosas esféricas contendo em seu interior enzimas líticas, denominadas hidrolases
lisossômicas. A função dos lisossomas é a digestão intracelular, podendo ser heterofágica (de material proveniente do meio externo
da célula através de mecanismos de fagocitose e pinocitose, como proteínas ou mesmo microorganismos, para defesa ou nutrição),
autofágica (de organelas da própria célula, para reciclagem) e por autólise (quando a membrana do lisossoma se rompe e suas enzimas
se espalham pelo citoplasma, digerindo e matando a célula inteira, para promover efeitos como a remodelação corporal. No caso da
heterofagia, que ocorre após mecanismos como fagocitose ou pinocitose, a digestão tem fins de defesa e nutrição (em protozoários e
animais simples, como poríferos, cnidários, platelmintos, nematodas e alguns moluscos, que possuem pelo menos um componente de
sua digestão sendo intracelular; em moluscos cefalópodes, anelídeos, artrópodes, equinodermos e cordados, a digestão é inteiramente
extracelular, sendo que os lisossomas não têm função nutritiva). Assim:
Item I: falso. A fagocitose só tem papel na alimentação de algumas células.
Item II: falso. Na maior parte dos grupos de animais, a digestão é inteiramente extracelular, se completando nas cavidades digestivas
e não tendo participação dos lisossomos.
Item III: verdadeiro. O retículo endoplasmático é caracterizado como um conjunto de canais membranosos no citoplasma, tendo,
dentre outras, a função de transporte de substâncias no interior da célula.

34.
Resposta: E
Comentário: Os vacúolos de suco celular são vesículas delimitadas por uma membrana denominada tonoplasto, ocorrendo em células
vegetais apenas. Na célula vegetal adulta, preenche quase todo o citoplasma, com funções como o controle osmótico da célula,
recebendo ou perdendo água por osmose, o armazenamento de substâncias, como íons, carboidratos, aminoácidos e proteínas, e a
autofagocitose para utilização de reservas nutritivas na planta. Analisando cada item:
Item I: verdadeiro.
Item II: falso. A célula jovem possui vários pequenos vacúolos que se fundem para formar o vacúolo de suco celular na célula adulta.
Não ocorrem lisossomos em células vegetais.
Item III: verdadeiro.
Item IV: verdadeiro. As inclusões citoplasmáticas correspondem a acúmulos de sais minerais em vegetais, conhecidos como drusas,
ráfides e cistólitos. Drusas e ráfides são acúmulos de oxalato de cálcio, enquanto que cistólitos são acúmulos de carbonato de cálcio.
Estas inclusões estão armazenadas em estruturas citoplasmáticas denominadas vacúolos.

35.
Resposta: A
Comentário: O citoesqueleto compreende um conjunto de estruturas protéicas no citoplasma, visíveis apenas ao microscópio
eletrônico sendo responsáveis pela sustentação da célula e definição da sua forma.
- Os microtúbulos são formados por uma proteína globular denominada tubulina, polimerizada em hélice e formando tubos
relacionados à formação de centríolos, cílios, flagelos, fibras do fuso e fibras do áster, ao transporte de substâncias e à sustentação e
proteção mecânica da célula, além de promoverem movimentos celulares como a emissão de pseudópodes, a ciclose e os movimentos
ciliar e flagelar.
- Os microfilamentos são formados por uma proteína denominada actina, que se associam à proteína miosina para desempenharem
juntos a função de contração celular.
- Os filamentos intermediários são formados por uma proteína denominada queratina, de alta resistência mecânica e que aumentam a
adesão entre células vizinhas, principalmente associadas a especializações de membrana denominadas desmossomos.
Assim, a emissão de pseudópodes e a ciclose estão relacionados essencialmente aos microtúbulos.

36.
Resposta: B
Comentário: Doenças de depósito ocorrem quando o acúmulo de substâncias não digeríveis nos lisossomas leva à sua ruptura, com
conseqüente autólise. Na silicose, quando se aspira cristais de sílica, estes são fagocitados por leucócitos nos pulmões, chamados de
macrófagos alveolares. O lisossoma forma o vacúolo digestivo, mas não consegue digerir a sílica, que lá fica acumulada. Quando há
muito matéria no vacúolo digestivo, o que pode levar vários anos, sua membrana se rompe e as enzimas são liberadas (autólise),
eliminando as células dos alvéolos pulmonares. Extensas áreas de pulmão são destruídas, ocasionando enfisema pulmonar, e o
indivíduo passa a ter insuficiência respiratória. Assim:
Item I: falso. Não existem enzimas capazes de digerir sílica.
Item II: verdadeiro. A silicose é caracterizada pela autólise dos macrófagos alveolares desencadeada pelo acúmulo de sílica.
Item III: verdadeiro. A sílica ou dióxido de silício (SiO 2 ) é um composto natural formado pelos dois elementos químicos mais
abundantes na crosta terrestre: o oxigênio e o silício, podendo contaminar indivíduos expostos à sua poeira em minas, poços escavados
e pedreiras.
Item IV: verdadeiro. Com a destruição dos alvéolos pela autólise dos macrófagos alveolares, ocorre cicatrização do parênquima
pulmonar, com conseqüente fibrose pulmonar.

37.
Resposta: C
Comentário: O retículo endoplasmático consiste em uma rede (“retículo”) canalículos e vesículas derivados de invaginações da
membrana plasmática. O retículo granular ou rugoso possui ribossomos aderidos para promover a síntese de proteínas de exportação,
enquanto retículo agranular ou liso promove a síntese de lipídios esteróides e a destoxificação, ou seja, a destruição de substâncias
tóxicas. A eletromicrografia I representa o retículo endoplasmático liso, de modo que a célula a que pertence deve produzir lipídios
esteróides como colesterol e derivados (hormônios sexuais como testosterona, estrogênios e progesterona e hormônios corticóides
como aldosterona e cortisol). A eletromicrografia II representa o retículo endoplasmático rugoso, de modo que a célula a que pertence
deve produzir proteínas de exportação como enzimas digestivas (ptialina, pepsina e tripsina), hormônios protéicos (insulina, glucagon
e somatotrofina), colágeno e outras.

38.
Resposta: A
Comentário: Ciclose é uma forma de movimento típico de células vegetais. Nestas células, existe um vacúolo de suco celular que
preenche quase a totalidade do conteúdo celular, estando o citoplasma restrito a uma estreita faixa na periferia da célula. Na porção
endoplasma do mesmo, se pode observar um fluxo interno no citosol, que arrasta as organelas ao redor do vacúolo central. Esta
corrente citoplasmática no endoplasma (que é a região mais fluida do hialoplasma) é conhecida como ciclose e o movimento se deve a
proteínas contráteis presentes no próprio hialoplasma. A ciclose pode ser facilmente evidenciável em células vegetais como as da
planta aquática Elodea. Sua função é permitir uma distribuição constante das organelas na célula através do movimento
citoplasmático. O fenômeno se torna menos intenso com a diminuição da temperatura e a falta de oxigênio.
Assim, o item incorreto é o item A, uma vez que o exame a fresco de células vivas possibilita sua visualização.

39.
Resposta: D
Comentário: A função dos lisossomas é a digestão intracelular, podendo ser heterofágica (de material proveniente do meio externo da
célula através de mecanismos de fagocitose e pinocitose, como proteínas ou mesmo microorganismos, para defesa ou nutrição),
autofágica (de organelas da própria célula, para reciclagem) e por autólise (quando a membrana do lisossoma se rompe e suas enzimas
se espalham pelo citoplasma, digerindo e matando a célula inteira, para promover efeitos como a remodelação corporal). A autólise é
fisiológica em algumas situações, ocorrendo de acordo com o programa genético da célula. Nestes casos, as células sofrem autólise
promover remodelação corporal no indivíduo, como no caso da metamorfose dos girinos, onde há regressão da cauda devido à autólise
de suas células, na regressão do útero pós-parto e na regressão das membranas interdigitais do embrião humano. Analisando cada
item:
Item A: verdadeiro. A regressão da cauda do girino na metamorfose a sapo é mediada por enzimas digestivas dos lisossomos.
Item B: verdadeiro. A não regressão das membranas interdigitais durante o desenvolvimento embrionário humano pode resultar no
nascimento de crianças com defeitos na flexão dos dedos.
Item C: verdadeiro. Apesar dos lisossomos não serem hereditários, os genes responsáveis pela síntese de suas enzimas são, de modo
que alterações nos mesmos podem ser transmitidas aos descendentes.
Item D: falso. A apoptose ocorre naturalmente, sem a ocorrência de processos inflamatórios, o que ocorre em casos de morte celular
conhecidos como necrose.

40.
Resposta: VFVVF
Comentário: Os peroxissomas são bolsas membranosas esféricas derivadas do complexo de Golgi, presentes em todos os eucariontes,
contendo enzimas relacionadas à oxidação de lipídios (beta-oxidação de ácidos graxos, com formação de acetil-coA e H 2 O 2 ) e à
destruição de substâncias tóxicas ao organismo (o peróxido de hidrogênio produzido na beta-oxidação é usado na detoxificação de
agentes nocivos como o etanol e na eliminação de certos microorganismos). As principais substâncias destruídas pela ação das
enzimas dos peroxissomos são os radicais livres derivados de oxigênio, também conhecidas como espécies ativas de oxigênio,
derivados de peróxido de hidrogênio, como é o caso do ânion superóxido. Além de produzida na beta-oxidação, a água oxigenada
também é freqüentemente produzida como subprodutos da ação respiratória. (Perceba que os peroxissomos formam e destroem água
oxigenada.) A principal destas enzimas é a catalase ou peroxidase. Ela converte o excesso de água oxigenada (peróxido de
hidrogênio), altamente tóxica por oxidar componentes celulares, em água e oxigênio.
1º item: verdadeiro.
2º item: falso. Peroxissomos são muito abundantes em células do fígado para promover a destruição de substâncias tóxicas, mas não
em células dos rins, relacionadas não à destruição, mas à eliminação (excreção) de subprodutos do metabolismo.
3º item: verdadeiro.
4º item: verdadeiro. Glioxissomas são peroxissomas que degradam lipídios por uma via diferente da beta-oxidação, que é a via do
glioxalato (daí o nome glioxissomas), ocorrendo em plantas e fungos para degradar reservas energéticas, principalmente em sementes.
5º item: verdadeiro. Peroxissomas, através da catalase, degradam o peróxido de hidrogênio em água e gás oxigênio.

41.
Resposta: VFVF
Comentário:
Os lisossomas são bolsas membranosas esféricas contendo em seu interior enzimas líticas, denominadas hidrolases lisossômicas. A
função dos lisossomas é a digestão intracelular, podendo ser heterofágica (de material proveniente do meio externo da célula através
de mecanismos de fagocitose e pinocitose, como proteínas ou mesmo microorganismos, para defesa ou nutrição), autofágica (de
organelas da própria célula, para reciclagem) e por autólise (quando a membrana do lisossoma se rompe e suas enzimas se espalham
pelo citoplasma, digerindo e matando a célula inteira, para promover efeitos como a remodelação corporal.
Na heterofagia, primeiro ocorre o englobamento do material por pinocitose (1) de partículas líquidas por invaginações da membrana
plasmática (4) ou fagocitose (2) de partículas sólidas (9) por evaginação da membrana plasmática (4), havendo formação,
respectivamente, de formação de pinossomos (5 e 6) ou fagossomos (10), respectivamente. Os lisossomas (7 e 11) se aproximam dos
fagossomos ou pinossomos e se fundem a eles, formando um vacúolo digestivo ou lisossomo secundário (8). Nesse momento as
enzimas do lisossoma digerem o material na vesícula de englobamento. Ocorre então a absorção do material digerido. Algumas
substâncias não digeríveis permanecem na vesícula sem que possam ser absorvidas; a vesícula agora assume o nome de vacúolo
residual. O vacúolo residual se funde à membrana plasmática e elimina seu conteúdo por exocitose, num processo denominado
clasmocitose ou defecação celular.
Na autofagia (3), vesículas derivadas do retículo endoplasmático (12) englobam organelas a serem recicladas (como mitocôndrias
antigas, 13), formando vacúolos autofágicos, que se fusionam a lisossomas (14) para a formação de um vacúolo digestivo (8).
Assim, analisando cada item:
1º item: verdadeiro.
2º item: falso. Na fagocitose, os lisossomos (11), e não os peroxissomos são responsáveis pela digestão.
3º item: verdadeiro.
4º item: falso. Na autofagia, são vesículas derivadas do retículo endoplasmático, e não da membrana plasmática englobam organelas
defeituosas, como mitocôndrias antigas.

42.
Resposta: FVFF
Comentário: Células animais e células vegetais podem ser diferenciadas ao microscópio por uma série de estruturas exclusivas de
cada tipo. Assim, são estruturas exclusivamente encontradas em
- células animais: centríolos, cílios e flagelos (encontrados apenas em algumas células vegetais, como os gametas anterozóides
flagelados em briófitas e pteridófitas) e lisossomos.
- células vegetais: parede celular, vacúolo de suco celular, glioxissomas e plastos.
Analisando cada item:
1º item: falso. Ribossomos são a única organela encontrada em todas as células existentes, tanto procarióticas (bactérias) como
eucarióticas.
2º item: verdadeiro.
3º item: falso. Membrana plasmática é encontrada em todas as células existentes, tanto procarióticas (bactérias) como eucarióticas, e
mitocôndrias são encontradas em todas as células eucarióticas, tanto animais como vegetais.
4º item: falso. Complexo de Golgi é encontrado em todas as células eucarióticas, tanto animais como vegetais, e lisossomos são
encontrados em células eucarióticas animais, mas não em vegetais.

43.
Resposta:
A) Reagindo com a catalase, liberando oxigênio que inibe as bactérias anaeróbias.
B) Violeta nos tubos I e III. No tubo II, inicialmente violeta e, depois de algum tempo, amarelo.
C) Porque a amilase digeriu o amido.
D) Porque o calor desnaturou a enzima e a degradação do amido não ocorre.

44.
Resposta:
A) protozoários de água doce são hipertônicos em relação ao meio, ganhando água por osmose; protozoários de água salgada são
isotônicos.
B) BUM! (plasmoptise...)

45.
Resposta:
A) Lisossomos são vesículas membranosas esféricas contendo enzimas digestivas (hidrolases ácidas) em seu interior. Eles são
responsáveis pela atividade de digestão intracelular (é nada!).
B) Os genes para a deficiência na produção das enzimas lisossômicas é que são hereditários.

46.
Resposta:
A)
A – Retículo endoplasmático rugoso: síntese de proteínas de exportação.
B – Mitocôndria: fase aeróbica da respiração celular.
C – Complexo de Golgi: síntese de glicolipídios, glicoproteínas e mucopolissacarídeos, acondicionamento de substâncias em vesículas
de secreção, formação de acrossomo (em espermatozóides) e lamela média (após a mitose vegetal).
D – Vesículas de secreção ou grânulos de zimogênio: eliminação de substâncias por exocitose.
E – Nucleoplasma, carioplasma ou cariolinfa: guarda do material genético.
F – Nucléolo: síntese de ribossomos.
B) A – C – D.

47.
Resposta: Os problemas respiratórios serão causados pela impossibilidade dos cílios no epitélio de revestimento interno da traqueia
removerem o excesso de muco e a esterilidade será causada pela impossibilidade dos flagelos dos espermatozoides se moverem.

48.
Resposta:
A)
- tubo I: Núcleo (observe que há DNA e RNA, sendo que apenas três estruturas celulares apresentam tais substâncias: mitocôndrias,
cloroplastos e núcleo; entretanto, há proteínas histônicas, o que não existe em mitocôndrias e cloroplastos, que possuem DNA desnudo
como seus prováveis ancestrais bacterianos);
- tubo II: R.E.Rugoso (fosfolipídios e proteínas de membrana indicam a existência de estruturas membranosas, e o RNAr e as
proteínas ribossômicas indicam a presença de ribossomos);
- tubo III: Cloroplasto (presença de clorofila)
B) Como já citado, cloroplastos ainda possuem DNA e RNA, além de RNAr e proteínas de ribossomos.
C)
- se houvesse fosfolipídios e proteína de membrana apenas: R.E.Liso, Complexo de Golgi ou Vacúolo de suco celular
- se houvesse fosfolipídios, proteínas de membrana e enzimas digestivas: lisossomas
- se houvesse fosfolipídios, proteínas de membrana e catalase: peroxissomas
- se houvesse tubulina apenas: centríolos, cílios e flagelos
(Se bem que se a célula tem cloroplasto, ela é vegetal, e então não tem lisossomas, centríolos, cílios e flagelos...)

49.
Resposta:
A) O núcleo contém DNA que comanda a produção das proteínas através da síntese de RNA.
B) Proteínas e Glicoproteínas porque os ribossomos produzem as proteínas que são associadas aos açúcares no Complexo de Golgi.

50.
Resposta:
A) Filamentos tubulares formados pela proteína tubulina.
B) Formação do fuso de divisão celular onde se prendem os cromossomos duplicados antes da disjunção.
C) Muda de cor para confundir-se com o ambiente e (ou) atrair indivíduos do sexo oposto.

51.
Resposta:
A) Osmorregulação.
B) Tende a sofrer plasmoptise, pois a água penetra pela membrana plasmática por osmose.
C) O meio deve estar isotônico ou hipertônico em relação ao citoplasma das amebas.

52.
Resposta:
A) Os polissacarídeos são produzidos durante a fotossíntese, a qual ocorre nos cloroplastos. Os açúcares são transportados pelo retículo
até o Complexo de Golgi onde serão armazenados e modificados.
B) O Complexo de Golgi elimina os açúcares em grânulos de secreção, os quais se fundem à membrana plasmática e depositam os
polissacarídeos na parede celular.

53.
Resposta: Retículo endoplasmático granular (REG), complexo golgiense (CG) e vesículas de secreção (VS). REG: síntese das
proteínas; CG: envolvimento das proteínas por suas membranas; VS: fusão com a membrana plasmática, liberando as proteínas para
fora da célula.

54.
Resposta:
A) Filamento intermediário. A célula também se rompe e diminui a adesão entre as células vizinhas.
B) Localizam-se no sarcômero. Atuam na contração muscular.

55.
Resposta:
A) São estruturas celulares formadas por microtúbulos: citoesqueleto, fuso acromático, cílios e flagelos. O taxol, impedindo a
polimerização dos microtúbulos, determina a interrupção das divisões celulares. A mitose nas células tumorais seria bloqueada durante
a metáfase, uma vez que é nesta etapa que os cromossomos prendem-se aos microtúbulos do fuso acromático.
B) Células desprovidas do complexo de Golgi não mais poderiam produzir os lisossomos que atuam no processo de digestão
intracelular. Os espermatozóides não apresentariam o acrossomo, vesícula derivada do complexo de Golgi. Esta estrutura libera as
enzimas necessárias para a penetração do gameta masculino no óvulo. Neste caso, os gametas seriam incapazes de realizar a
fertilização.

56.
Resposta:
A) hidrolases ácidas.
B) Essas enzimas, se chegarem ao citoplasma/citosol por algum motivo (como o rompimento da membrana lisossomal), não seriam
ativas, pois o pH citosólico é 7,2 (neutro).

57.
Resposta: A membrana nuclear e a mitocôndria possuem duas membranas. O lisossomo e o peroxissomo possuem uma membrana
cada, e os ribossomos não possuem membrana. Desta forma, os valores corretos do item A seriam: a.1. = 4, a.2. = 2 e a.3. = zero (não
teria membrana para atravessar). Na respiração aeróbica, o oxigênio é o último aceptor da cadeia transportadora de elétrons. Essa
cadeia ocorre nas membranas internas das mitocôndrias e é necessária para a formação do ATP. Na fase clara da fotossíntese, o O 2 é
liberado na fotólise da água (H 2 O), reação que ocorre nas membranas dos tilacóides dos cloroplastos. Portanto, os processos seriam:
respiração aeróbica, fotossíntese e oxidação de substâncias orgânicas (item B).

58.
Resposta: A organela indicada por A é o Núcleo. O núcleo contém a maioria do material genético da célula (DNA). Ele determina a
expressão desse material, em razão do funcionamento celular, ou seja, controla as funções celulares e a sua duplicação quando a célula
se divide. A organela indicada por B é o Vacúolo. Quando a célula aumenta, o incremento do volume celular é devido à absorção de
água que é destinada principalmente ao vacúolo, que auxilia na expansão celular, aumentando a pressão de turgor dentro da célula.
Além disso, o vacúolo tem função de acúmulo de substâncias, tais como, íons, taninos, cristais, pigmentos etc. O vacúolo também
pode assumir a função de digestão celular e de controle osmótico. A estrutura indicada pelas setas é a parede celular. Um aspecto
característico das células vegetais é que elas são delimitadas por uma parede celulósica.

59.
Resposta:
A) Concentrações: X = 100mg/mL, Y= 25mg/mL e Z= 50mg/mL. A concentração de 25mg/mL da substância não exigiu o aumento da
área do retículo endoplasmático liso para sua metabolização, como observado na coluna Y, enquanto que, na concentração de 50mg/Ml
observou-se o aumento da área do retículo endoplasmático liso até 51 m2m/célula (coluna Z). A concentração mais alta (100mg/mL)
exigiu que o retículo endoplasmático liso aumentasse acentuadamente a sua área para tentar metabolizar a substância (coluna X).
B) 4o dia, pois neste dia observa-se o início do aumento da área do retículo nas colunas X e Y, devido a exposição das células ao
tratamento com a substância.
C) Retículo endoplasmático liso, pois esta organela é a responsável pela detoxificação celular.
D) A função principal do retículo endoplasmático liso nas células da musculatura esquelética é controlar a concentração de cálcio
citoplasmático.

60.
Resposta:
A) I e III.
B) Quando as células hepáticas foram mantidas em presença de Benzopireno ocorreu aumento da superfície do retículo endoplasmático
liso, pois, esta é a organela responsável pela metabolização de drogas. Com a metabolização, a droga carcinogênica, que era inativa,
torna-se ativa, podendo alterar o controle da divisão celular em células presentes no meio de cultura.
1.
Resposta: B
Comentário: A quebra da molécula de glicose no processo respiratório envolve a oxidação da mesma, ou seja, a perda de elétrons
por parte da glicose. Esses elétrons são recolhidos por moléculas conhecidas como aceptores de elétrons, responsáveis pelo
armazenamento dos mesmos. Assim, à medida, em que a glicose é oxidada, os aceptores de elétrons são reduzidos no processo.
- A respiração aeróbica envolve a quebra completa da glicose utilizando oxigênio como aceptor final de elétrons e produzindo gás
carbônico e água .

- A desnitrificação envolve a quebra completa da glicose na ausência de oxigênio, utilizando o nitrato como aceptor final de
elétrons, e gerando como subprodutos água, gás carbônico e gás nitrogênio, sendo uma importante etapa do ciclo do nitrogênio,
realizada por bactérias do gênero Pseudomonas.

- Na decomposição anaeróbica de compostos orgânicos sulfurados, o enxofre é usado como aceptor final de elétrons e produzindo
gás sulfídrico (H 2 S) relacionado ao cheiro de ovo podre do esgoto.
Assim, podem ter função de aceptor final de elétrons na respiração celular, assim como o O 2 , compostos como o S e o NO 3 -
.

2.
Resposta: B
Comentário: A fermentação alcoólica promove a quebra de glicose em etanol e gás carbônico, sendo um processo anaeróbico. O
processo ocorre em organismos como as leveduras, fungos unicelulares anaeróbicos facultativos que agem na produção de etanol
em bebidas alcoólicas e combustíveis e como fermento biológico na produção de pães e bolos, pela produção de gás carbônico.
Assim, no caso descrito, é o gás carbônico produzido na fermentação que leva a bolinha de massa a flutuar. Analisando cada item:
Item I: falso. A fermentação dos carboidratos da massa de pão ocorre por ação das leveduras
Item II: verdadeiro. Leveduras agem como fermento biológico na produção de pães e bolos, pela produção de gás carbônico.
Item III: falso. A bola de massa sobe pelo acúmulo de gás carbônico; além disso, se a bola de massa subisse devido ao álcool,
não poderia ser porque tem maior densidade do que a água.

3.
Resposta: A
Comentário: A produção de energia a partir de moléculas orgânicas, como a glicose, se inicia com a glicólise, reação que degrada
glicose em ácido pirúvico, com saldo de 2 ATP e conversão de 2 NAD+ em 2 NADH. Em anaerobiose, o NADH deve ser
reconvertido em NAD+ para que a glicólise possa ocorrer novamente, o que ocorre através da fermentação. Nos músculos
esqueléticos em anaerobiose, a fermentação láctica reage o NADH com o ácido pirúvico, formando ácido láctico e NAD+. Assim,
analisando cada item:
Item A: verdadeiro. A fermentação láctica em células musculares com o objetivo de converter o NADH em NAD+, o que
envolve perda de elétrons, ou seja, oxidação do NADH.
Item B: falso. Na fermentação láctica, que ocorre sem oxigênio, o aceptor final de elétrons (que recebe os elétrons do NADH) é o
ácido pirúvico, sendo o oxigênio o aceptor final de elétrons na respiração aeróbica.
Item C: falso. O saldo de 2 ATP por glicose é garantido na glicólise, que converte glicose em ácido pirúvico (piruvato). A
fermentação de ácido pirúvico (piruvato) em ácido láctico (lactato) não libera energia.
Item D: falso. A fermentação envolve a degradação parcial de glicose em produtos orgânicos, apresentando baixo saldo
energético quando comparado com a respiração aeróbica, que envolve a degradação total da molécula de glicose até CO 2 e H 2 O.
Item E: falso. O ácido láctico (lactato) é o produto final da fermentação láctica. Na respiração aeróbica, o ácido pirúvico é
convertido em acetil-CoA, que entra no ciclo de Krebs com objetivo de liberar energia, e não em ácido láctico.

4.
Resposta: D
Comentário: Existem vários mecanismos de produção de energia para a atividade muscular. De maneira geral, na seqüência em
que são utilizados pode-se citar:
- Primeiro utiliza-se o ATP já armazenado na musculatura. Este ATP está em quantidades muito pequenas, uma vez que o ATP é
muito pesado para ser armazenado em grandes quantidades. Assim, este ATP manterá a atividade muscular por períodos muito
curtos, de 3 a 4 segundos de duração.
- Em segundo, se utiliza o sistema creatina-fosfato. A creatina-fosfato armazena ligações fosfato de alta energia que serão
transferidas para o ADP, regenerando o ATP muscular:
creatina ~ P + ADP → creatina + ATP
A creatina ou creatinina é tóxica, sendo parte dela reconvertida em creatina pelo fígado e parte eliminada pelo organismo na urina,
como uma excreta nitrogenada. Em excesso, pode causar lesões hepáticas.
Este ATP produzido pelo sistema creatina-fosfato se esgota em cerca de 8 a 10 segundos de atividade muscular.
- Em terceiro, se utiliza fermentação láctica. Apesar de ser um processo de baixo rendimento energético quando comparada à
respiração aeróbica, a fermentação é utilizada porque nos momentos iniciais da atividade, ainda não um suprimento adequado de
oxigênio ao músculo para que mantenha sua atividade aeróbica. À medida que o ritmo respiratório, o ritmo cardíaco e o fluxo
sangüíneo para a musculatura se tornam adequados, passa-se a utilizar a respiração aeróbica. Ainda assim, nos cerca de 40
segundos iniciais de uma atividade, utiliza-se a fermentação láctica para o processo de fornecimento de energia.
- Posteriormente, se utiliza a respiração aeróbica. Quando o suprimento de oxigênio volta a ser insuficiente (devido ao tempo e à
intensidade da atividade, pode ser que o volume de oxigênio fornecido à musculatura não seja adequado), a atividade de
fermentação láctica voltará a ser mantida, o que por sua vez levará ao acúmulo de ácido láctico e conseqüente fadiga muscular.
Assim, a regeneração da fosfocreatina no fígado utiliza a energia da glicose, proveniente do glicogênio por glicogenólise e do
ácido láctico por gliconeogênese.

5.
Resposta: E
Comentário: A fermentação láctica envolve a quebra anaeróbica da molécula de glicose em ácido láctico, ocorrendo, por
exemplo, em músculos esqueléticos com suprimento deficiente de oxigênio. Nos músculos, o acúmulo de ácido láctico leva à
fadiga e dor muscular. Após algum tempo, esse ácido láctico é removido pela circulação sangüínea e enviado ao fígado, onde é
reconvertido em glicose pela gliconeogênese. Assim, analisando cada item:
Item I: verdadeiro. O ácido láctico (lactato em sua forma dissociada) pode ser proveniente da atividade de um músculo em
anaerobiose, o que se dá por fermentação láctica.
Item II: verdadeiro. O fígado, na gliconeogênese, promove atividades como a desaminação, onde aminoácidos como a alanina
são degradados como fonte de energia, com liberação de amônia como subproduto; através do ciclo da ornitina, a amônia é
convertida em ureia para ser eliminada na urina.
Item III: verdadeiro. Por demonstrar que houve conversão de ácido láctico em glicose, a experiência comprovou que há
gliconeogênese no fígado.

6.
Resposta: C
Comentário: A glicólise é um processo metabólico que envolve a degradação parcial da glicose, na ausência de oxigênio, até a
formação de ácido pirúvico. Esse processo ocorre no hialoplasma e apresenta um saldo energético de 2 ATP por glicose e a
conversão de 2 NAD em 2 NADH 2 .

A fermentação consiste em liberar os hidrogênios do NADH 2 , reconvertendo-o em NAD para que a glicólise possa continuar
ocorrendo. Sem isso, o esgotamento do NAD impossibilita a realização de glicólise novamente.
- Na fermentação alcoólica, o ácido pirúvico é convertido em acetaldeído (etanal) e gás carbônico, sendo que o acetaldeído recebe
os hidrogênios do NADH 2 , agindo como aceptor final de elétrons, e forma álcool etílico (etanol).

O processo ocorre em organismos como as leveduras, fungos unicelulares anaeróbicos facultativos que agem como fermento
biológico na produção de pães e bolos, pela produção de gás carbônico, e agem na produção de etanol em bebidas alcoólicas e
combustíveis.
- Na fermentação láctica, o ácido pirúvico recebe os hidrogênios do NADH 2 , agindo como aceptor final de elétrons, e forma ácido
láctico.

O processo ocorre em organismos como as bactérias lactobacilos anaeróbicas facultativas, que agem na produção de laticínios
como iogurtes e queijos, e na musculatura estriada de vertebrados quando o suprimento de oxigênio não é adequado.
Assim, analisando cada item:
Item A: falso. Leveduras utilizam fermentação alcoólica no seu metabolismo energético anaeróbico, produzindo álcool, mas não
ácido lático.
Item B: falso. Enzimas são específicas para a reação que executam, de modo que, necessariamente, deve haver enzimas distintas
para promover a fermentação alcoólica e a fermentação láctica.
Item C: verdadeiro. Sem a presença do NAD em ambas as células, o metabolismo seria interrompido pela impossibilidade de
realizar a glicólise.
Item D: falso. O saldo energético da fermentação alcoólica realizada por leveduras é idêntico ao da fermentação láctica realizada
pelas bactérias lactobacilos; ao realizarem respiração aeróbica, o saldo energético também é idêntico em leveduras e bactérias
lactobacilos.
Item E: falso. Se fornecermos O 2 às células de levedura e bactérias, ocorrerá respiração aeróbica, e não fermentação, de modo
que não haverá produção de álcool ou ácido lático; o rendimento energético da respiração aeróbica é maior que da fermentação.

7.
Resposta: B
Comentário: A fermentação láctica envolve a quebra anaeróbica da molécula de glicose em ácido láctico, ocorrendo, por
exemplo, em músculos esqueléticos com suprimento deficiente de oxigênio. Nos músculos, o acúmulo de ácido láctico leva à
fadiga e dor muscular. Após algum tempo, esse ácido láctico é removido pela circulação sangüínea e enviado ao fígado, onde é
reconvertido em glicose pela gliconeogênese.

8.
Resposta: B
Comentário: A glicólise é um processo respiratório que envolve a degradação parcial da glicose, na ausência de oxigênio, até a
formação de ácido pirúvico. Esse processo ocorre no hialoplasma e apresenta um saldo energético de 2 ATP por glicose e a
conversão de 2 NAD em 2 NADH 2 .

A fermentação consiste em liberar os hidrogênios do NADH 2 , reconvertendo-o em NAD para que a glicólise possa continuar
ocorrendo. Na fermentação alcoólica, o ácido pirúvico é convertido em acetaldeído (etanal) e gás carbônico, sendo que o
acetaldeído recebe os hidrogênios do NADH 2 , agindo como aceptor final de elétrons, e forma álcool etílico (etanol).

Assim, se o mol da glicose é de 180 gramas, temos que 360 gramas de glicose equivalem a 2 mol de glicose. Como, para cada mol
de glicose ocorre a produção de 2 mol de álcool etílico, com 2 mol de glicose ocorre a produção de 4 mol de álcool etílico. Como,
para cada mol de álcool etílico, ocorre a produção de 1 mol de gás carbônico, com 4 mol de álcool etílico ocorre a produção de 4
mol de gás carbônico.

9.
Resposta: A
Comentário: A glicólise é um processo respiratório que envolve a degradação parcial da glicose, na ausência de oxigênio, até a
formação de ácido pirúvico. Esse processo ocorre no hialoplasma e apresenta um saldo energético de 2 ATP por glicose, uma vez
que há consumo inicial de 2 ATP (para ativação da glicose) e produção de 4 ATP, e a conversão de 2 NAD em 2 NADH 2 .

A fermentação consiste em liberar os hidrogênios do NADH 2 , reconvertendo-o em NAD para que a glicólise possa continuar
ocorrendo. No caso, se X representa o consumo de ATP, sendo igual a 2, e Y representa a produção de ATP, sendo igual a 4.

10.
Resposta: C
Comentário: Analisando cada item:
Item A: falso. A fermentação láctica resultado do catabolismo anaeróbico de carboidratos, envolvendo a regeneração do NAD a
partir do NADH gerado na glicólise.
Item B: falso. A fermentação láctica produz duas moléculas de ácido lático por molécula de glicose, mas não produz gás
carbônico.
Item C: verdadeiro. A fermentação láctica realizada por bactérias lactobacilos no leite provoca a coagulação de da caseína,
principal proteína do leite, dando consistência pastosa ao leite fermentado usado na produção de iogurtes.
Item D: falso. A fermentação láctica é um processo anaeróbico e possui saldo energético inferior ao da respiração aeróbica que
ocorre quando há oxigênio disponível na célula.
Item E: falso. O saldo energético da fermentação láctica é gerado na glicólise pela conversão de glicose em ácido pirúvico e é de
2 ATP, não ocorrendo geração de ATP na conversão de ácido pirúvico em ácido láctico.
11.
Resposta: C
Comentário: A respiração aeróbica utiliza oxigênio e envolve a completa oxidação da glicose a gás carbônico e água, o que
resulta em alto saldo energético. A fermentação é um tipo de respiração anaeróbica que envolve a oxidação parcial da glicose em
subprodutos orgânicos, o que resulta em saldo energético bem mais baixo. Como o ambiente intestinal é anaeróbio, as bactérias só
fazem respiração anaeróbica, com baixo saldo energético, mas a quantidade de nutrientes disponíveis é tão elevada que compensa
esse baixo saldo e possibilita uma grande proliferação desses microorganismos.

12.
Resposta: C
Comentário: As fibras musculares estriadas esqueléticas podem ser rápidas ou lentas. As fibras rápidas, também denominadas
claras, possuem grande espessura, produzindo muita força, mas pequena quantidade de capilares, mitocôndrias e mioglobina, não
conseguindo manter a produção de energia por respiração aeróbica de modo prolongado. Assim, esse tipo de fibras se presta a
atividades de explosão, as quais envolvem muita força por curtos períodos de tempo, trabalhando apenas com processos
anaeróbicos, como a ação da fosfocreatina e da fermentação láctica, como ocorre com corridas de velocidade (I), levantamento de
peso (IV), saltos (V), etc. As fibras lentas, também denominadas escuras ou vermelhas, são dotadas de grande quantidade de
capilares sanguíneos, de mitocôndrias e da proteína mioglobina, de cor vermelha e que transfere O 2 da hemoglobina das hemácias
para a cadeia respiratória. Assim, esse tipo de fibras se presta a atividades de resistência, as quais envolvem períodos prolongados
e grande produção de energia por vias aeróbicas, como ocorre com corridas de longa distância (maratona, II) e natação (III).

13.
Resposta: A
Comentário: A produção do vinho está relacionada à fermentação alcoólica realizada por fungos unicelulares denominados
leveduras. A fermentação alcoólica é um processo anaeróbico que quebra a glicose em etanol, gás carbônico e energia. Como as
leveduras são anaeróbicos facultativos, podem realizar respiração aeróbica na presença de oxigênio, ou seja, quando os tanques
estão abertos, produzindo gás carbônico e água. Somente com o fechamento dos tanques e a falta de oxigênio é que ocorre a
fermentação alcoólica e consequente produção de álcool para o vinho.

14.
Resposta: B
Comentário: Os fungos possuem digestão extracorpórea, de modo que a célula de lêvedo elimina enzimas digestivas para o meio
para digerir a sacarose em glicose e frutose, que são absorvidas para o uso da glicose em processos como fermentação alcoólica e
respiração aeróbica.

15.
Resposta: C
Comentário: Fibras musculares estriadas esqueléticas podem ser classificadas em dois subtipos, as fibras lentas ou escuras e as
fibras claras ou rápidas. As fibras lentas ou escuras possuem grande quantidade da proteína mioglobina, de cor vermelha, que
transfere oxigênio da hemoglobina do sangue para a respiração aeróbica, e de mitocôndrias, estando adaptadas a atividade
contínua de baixa intensidade, ou seja, de resistência, que é essencialmente aeróbica. Como a coxa do peru é usada na atividade de
ciscar, a qual é contínua, essa região do corpo possui predomínio de fibras lentas. As fibras rápidas ou claras possuem pequena
quantidade da proteína mioglobina e de mitocôndrias, mas grande volume, estando adaptadas a atividades de muita força por
curtos períodos de tempo, ou seja, de explosão, que é essencialmente anaeróbica. Como a musculatura peitoral do peru é usada no
movimento das asas, a qual é pouco utilizada pela ausência de voo, essa região do corpo possui predomínio de fibras rápidas.
Assim:
Item A: falso. A musculatura do peito é formada por fibras musculares rápidas.
Item B: falso. A musculatura do peito é formada por fibras musculares rápidas, ricas em mitocôndrias e em mioglobina, e
eficientes na realização de esforço de baixa intensidade e longa duração.
Item C: verdadeiro. A musculatura da coxa é formada por fibras musculares lentas.
Item D: falso. A musculatura da coxa é formada por fibras musculares lentas.
Item E: falso. A musculatura do peito é formada por fibras musculares rápidas.

16.
Resposta: B
Comentário: Microorganismos decompositores podem ser aeróbicos ou anaeróbicos. Em ambos os casos, seus processos
metabólicos de geração de energia, ou seja, respiração aeróbica e respiração anaeróbica como a fermentação, respectivamente,
envolvem a liberação de subprodutos, sendo o CO 2 um dos mais comuns. Por ser um gás, o CO 2 tende a se expandir. Assim, em
um alimento enlatado contaminado, microorganismos decompositores obtêm energia pelo consumo de glicídios por respiração
anaeróbica (1ª hipótese correta), sendo que o gás carbônico liberado promoverá o estufamento da lata (2ª hipótese correta). Assim,
as duas hipóteses estão corretas e a segunda delas é consequência da primeira.

17.
Resposta: E
Comentário: O fermento biológico corresponde a leveduras, fungos unicelulares anaeróbicos facultativos que realizam
fermentação alcoólica, quebrando a glicose em etanol e gás carbônico. Ele age na produção de pães e bolos pela produção de gás
carbônico, que promove inchaço na massa. Já o fermento químico é um produto químico que consiste da mistura de um ácido não
tóxico (como o cítrico ou o tartárico) e um carbonato ou bicarbonato para levar uma massa, conferindo-lhe esponjosidade. O ácido
reage com o bicarbonato produzindo borbulhas de CO 2 , e dando volume à massa. A elevação de temperatura no meio acelera a
reação química e a torna efetiva no inchaço da massa. Assim, analisando cada “receita”:
- A receita de Juliana não resultará num bolo porque o fermento químico deveria ser misturado à massa, e não ao leite;
- A receita de Guilherme não resultará num bolo porque o fermento biológico deveria ser misturado à massa, e não ao leite;
- A receita de Mariana não resultará num bolo porque, apesar de o fermento biológico ter sido misturado à massa, ao ser colocada
imediatamente no forno aquecido, a alta temperatura levará à desnaturação das enzimas do fermento biológico que levariam ao
inchaço da massa; o procedimento correto seria deixar a massa “descansar”, ou seja, deixar o fermento biológico começar a agir
antes de a massa ser colocada no forno.
- A receita de Roberto não resultará num bolo porque, assim como Mariana, ele não deixou a massa “descansar” para o fermento
biológico agir antes do aquecimento, nesse caso no forno de micro-ondas.
- A receita de Rafael resultará num bolo (finalmente!), porque, com o fermento químico, não se precisa deixar a massa
“descansar” antes de ser aquecida, uma vez que não há enzimas a serem desnaturadas.

18.
Resposta: A
Comentário: No início da atividade muscular, a energia para contração é obtida pelo músculo a partir de fontes anaeróbicas,
como o ATP já existente no músculo, a fosfocreatina para a produção de ATP e a fermentação láctica. Assim, atividades feitas em
alta intensidade por curtos períodos de tempo são anaeróbicas e conhecidas como atividades de explosão, como nas corridas de
velocidade. Com o aumento do ritmo respiratório, o aumento do ritmo cardíaco e a vasodilatação muscular que ocorrem no
exercício, aumenta a disponibilidade de oxigênio, e o músculo passa a obter energia por respiração aeróbica, o que se dá em
atividades de maior duração, que são aeróbicas e conhecidas como atividades de resistência, como nas corridas de longas
distâncias. O esquema representa alguns dos processos utilizados pelo músculo, sendo:
1. glicólise;
2. β-oxidação dos lipídios;
3. fermentação láctica;
4. oxidação do ácido pirúvico (piruvato);
5. entrada do ácido pirúvico (piruvato) no ciclo de Krebs.
Numa corrida de 400m, que é uma atividade de explosão, 70% da energia vem de fontes anaeróbicas, segundo a tabela. No
esquema, são anaeróbicos a glicólise (1) e a fermentação láctica (3), sendo os demais processos aeróbicos.

19.
Resposta: B
Comentário: O processo de fermentação se inicia com o processo de glicólise, que consiste na quebra da molécula de glicose
(C 6 H 12 O 6 ) em duas moléculas de ácido pirúvico (C 3 H 4 O 3 ). Essa etapa é comum ao processo de fermentação e respiração.
Inicialmente, a molécula de glicose é ativada pelo consumo de 2 moléculas de ATP. Isso é necessário pois, apesar de possuir
muita energia, a glicose é estável. A quebra do ATP fornece energia para a glicose que acaba se tornando mais reativa para
promover a liberação de sua energia. Ao final do processo, 4 moléculas de ATP (a partir de ADP e Pi) e duas moléculas de
NADH 2 (a partir de NAD) são formadas. Uma vez que o NADH 2 é produzido, para que o processo de glicólise seja reiniciado, é
necessária a liberação dos hidrogênios de sua molécula para formação de NAD. Se isso não ocorresse, em determinado momento
não haveria mais NAD disponível na célula, e nesse caso, a glicólise não seria mais possível. A glicólise oxida a molécula de
glicose (com liberação de elétrons recolhidos pelo NAD formando NADH 2 ). A fermentação reduz o ácido pirúvico (introduzindo
nele elétrons provenientes do NADH 2 , com conseqüente regeneração do NAD). Assim, o processo representado implica na
conversão de NADH 2 em NAD na fermentação alcoólica (observe a conversao de acetaldeído em etanol na última etapa da
reação); como o NADH 2 perde hidrogênios, pode-se argumentar que está sendo oxidado; como a fermentação ocorre sem
oxigênio, pode-se argumentar que o processo está ocorrendo em anaerobiose.

20.
Resposta: C
Comentário: Tanto a fermentação quanto a respiração aeróbica, que ocorrem no músculo em atividade, o início do processo se dá
com a glicólise, que consiste na degradação de glicose em ácido pirúvico em anaerobiose. Se substrato inicial da glicólise é a
glicose e o produto é o ácido pirúvico, pode-se concluir que o gliceraldeído é um intermediário metabólico do processo. A glicose
é uma hexose, carboidrato com 6 átomos de carbono, de fórmula C 6 H 12 O 6 , correspondendo a X. O radical –COOH em Y
demonstra ser ele um ácido carboxílico, correspondendo então ao ácido pirúvico (que é um cetoácido). O radical –CHO em Z
demonstra ser ele um aldeído, correspondendo então ao gliceraldeído. Como a sequência de moléculas na glicólise é glicose –
gliceraldeído – ácido pirúvico, temos que ela pode ser descrito como X – Z – Y.

21.
Resposta: C
Comentário: Existem vários mecanismos de produção de energia para a atividade muscular. De maneira geral, na seqüência em
que são utilizados pode-se citar:
- Primeiro utiliza-se o ATP já armazenado na musculatura, que está em quantidades muito pequenas e mantém a atividade
muscular por períodos muito curtos.
- Em segundo, se utiliza o sistema creatina-fosfato. A creatina-fosfato armazena ligações fosfato de alta energia que serão
transferidas para o ADP, regenerando o ATP muscular:
creatina ~ P + ADP → creatina + ATP
A creatina ou creatinina é tóxica, sendo parte dela reconvertida em creatina pelo fígado e parte eliminada pelo organismo na urina,
como uma excreta nitrogenada.
- Em terceiro, se utiliza fermentação láctica, porque nos momentos iniciais da atividade, ainda não um suprimento adequado de
oxigênio ao músculo para que mantenha sua atividade aeróbica. À medida que o ritmo respiratório, o ritmo cardíaco e o fluxo
sangüíneo para a musculatura se tornam adequados, passa-se a utilizar a respiração aeróbica.
- Posteriormente, se utiliza a respiração aeróbica.
- Quando o suprimento de oxigênio volta a ser insuficiente (devido ao tempo e à intensidade da atividade, pode ser que o volume
de oxigênio fornecido à musculatura não seja adequado), a atividade de fermentação láctica voltará a ser mantida, o que por sua
vez levará ao acúmulo de ácido láctico e conseqüente fadiga muscular.
Assim, a conversão rápida de ADP em ATP para uso no músculo se dá a partir da fosfocreatina ou creatina-fosfato.

22.
Resposta: D
Comentário: A molécula de glicose consumida na reação de fermentação ou respiração contém um teor energético muito alto. Se
liberada de uma só vez, esta energia toda pode destruir a célula. Além disso, não existe processo celular que utilize toda essa
energia sozinho. Por esse motivo, as reações de oxidação para a produção de energia liberam a energia em partes, armazenadas em
moléculas de ATP. O ATP é um nucleotídeo, formado por adenina, ribose e três grupos fosfato (adenosina trifosfato). Ele
armazena uma quantidade tal de energia que pode ser utilizada em vários processos, sendo extremamente versátil. Sua energia está
presente na forma de ligações de alta energia envolvendo os grupos fosfato, representada por um (~) e denominada ligação
fosfoanidra. Quando ele quebra uma dessas ligações, passa a ADP (adenosina difosfato) e Pi (fosfato inorgânico) e libera cerca de
7,3 Kcal de energia por mol degradado.

Assim, analisando cada item:


Item A: verdadeiro. Os radicais fosfato são presos ao restante da molécula de ATP por ligações fosfoanidra de alta energia,
representadas por um til (~).
Item B: verdadeiro. A partir da degradação de uma molécula de glicose, são formadas grandes quantidades ATP.
Item C: verdadeiro. A energia do ATP pode ser utilizada nas várias atividades celulares, como a síntese de novos compostos
químicos e a realização de trabalho mecânico pela célula.
Item D: falso. O ATP é muito pesado, não sendo armazenado em grandes quantidades na célula, daí sua constante reciclagem; o
pouco ATP armazenado na célula está localizado tanto no citoplasma como no núcleo, onde é utilizado nas várias atividades
celulares.
Item E: verdadeiro. A energia utilizada para a síntese de ATP deriva de moléculas orgânicas degradadas por processos como
fermentação e respiração.

23.
Resposta: E
Comentário: Mecanismos de transporte ativo ocorrem contra de um gradiente de concentração (do meio menos concentrado para o
mais concentrado), de modo não espontâneo e endotérmico (com consumo de energia), sempre através de proteínas de membrana
com atividade ATPásica, capazes de quebrar ATP para fornecer energia para o processo. Pelo que se percebe nas situações I e II,
ocorre grande diferença de concentração de cálcio entre meio extracelular e meio intracelular, o que tem que ser mantido por
transporte ativo. Entretanto, para a manutenção dessa diferença de concentração, não há necessidade de oxigênio, como
demonstrado no item II. Entretanto, na situação III, a utilização de um inibidor da glicólise mostra que a diferença de concentração
de cálcio entre meio extracelular e meio intracelular se desfaz, o que indica o transporte de Ca++ pela membrana do eritrócito
normal é ativo e dependente de energia derivada da glicólise.

24.
Resposta: C
Comentário: Seres anaeróbicos restritos são aqueles que só realizam respiração anaeróbica, de modo que, para eles, o O 2 é
venenoso pelo seu grande poder oxidante e pela inabilidade desses organismos em degradá-lo. Isso ocorre em seres como as
bactérias Clostridium tetani (causadora do tétano) e a Clostridium botulinum (causadora do botulismo). Ambas têm por hábito se
alojar em ambientes pobres em oxigênio, como objetos enferrujados, no caso do bacilo do tétano, e alimentos em conserva, no
caso do bacilo do botulismo. Alimentos enlatados cuja lata esteja estufada não devem ser consumidos, uma vez que o estufamento
da lata indica a presença de microorganismos anaeróbicos. Esses, através de seus processos de respiração anaeróbica, liberam
gases como o gás carbônico, cuja expansão promove o referido estufamento. Os microorganismos em questão podem ser
microorganismos decompositores, o que indica que o alimento não é apropriado para o consumo, ou mesmo a bactéria causadora
do botulismo, cuja toxina, se ingerida, pode levar à paralisia muscular. Assim, analisando cada item:
Item A: verdadeiro. O estufamento da lata deve ter ocorrido pela liberação de gases respiratórios por bactérias, algumas delas
capazes de produzir toxinas.
Item B: verdadeiro. As bactérias em questão podem ser de ação decompositora sobre o alimento.
Item C: falso. O principal gás liberado no processo respiratório dos microorganismos é o gás carbônico, que não possui ação
tóxica.
Item D: verdadeiro. A falta de higiene durante o processo de embalagem pode ter permitido a instalação de microorganismos.

25.
Resposta: VFFVVF = 25
Comentário: Para que haja a produção de gás carbônico na fermentação alcoólica, deve-se ter a ação de leveduras (no fermento
biológico) sobre um carboidrato como substrato (como o amido da farinha de trigo ou a sacarose do açúcar), com temperaturas
compatíveis com a ação enzimática (uma vez que em temperaturas acima de 40ºC, as enzimas desnaturam). Assim, haverá
fermentação alcoólica nos tubos 1 e 2, resultando na liberação de gás carbônico na garrafa e enchimento do balão. Analisando
cada item:
Item 1: verdadeiro. Como mencionado, nas garrafas 1 e 2 há a produção de gás carbônico e os balões inflam.
Item 2: falso. Como mencionado, há a produção de gás carbônico na garrafa 2.
Item 4: falso. Como mencionado, o fermento biológico é composto de leveduras e a produção de gás carbônico é resultado da
fermentação alcoólica, um processo de respiração anaeróbica.
Item 8: verdadeiro. Como mencionado, o gás liberado após a reação de fermentação alcoólica é o CO 2 ; a reação envolve a
quebra de glicose em etanol e gás carbônico, com saldo de 2 ATP por glicose degradada.
Item 16: verdadeiro. Na garrafa 1 existe sacarose, um dissacarídeo capaz de ser facilmente degradado pela levedura em glicose e
frutose, facilitando a reação de fermentação alcoólica, com maior produção de gás carbônico do que na garrafa 2, onde ocorre
amido, mais difícil de ser degradado pela pelas leveduras, e, consequentemente, mais difícil de ser degradado na fermentação
alcoólica para a liberação de gás carbônico.
Item 32: falso. Temperaturas muito altas impedem a reação de fermentação por desnaturarem as enzimas envolvidas no processo
de fermentação alcoólica.

26.
Resposta:
- A contração muscular demanda energia, obtida pela degradação do ATP.
- No esforço muscular prolongado, as reservas de ATP das células musculares se esgotam e a taxa de respiração celular aumenta,
para suprir a demanda de ATP e permiti a continuidade do esforço.
- O aumento da taxa de respiração celular determina um aumento na taxa de CO 2 no sangue. Há estímulo para o aumento dos
batimentos cardíacos e do ritmo respiratório, para eliminar eficazmente o CO 2 presente no sangue e aumentar a quantidade de O 2 .

27.
Resposta:
- Leveduras (fungos unicelulares): utilizadas na produção de bebidas alcoólicas e como fermento na produção de pães e bolos, o
que se dá através da fermentação alcoólica.
- Acetobactérias: utilizadas na produção de vinagre, o que se dá através da fermentação acética.
- Bactérias lactobacilos: utilizadas na produção de laticínios como iogurtes e queijos, o que se dá através da fermentação láctica.
- Bactérias em geral: utilizadas na produção de organismos geneticamente modificados pelo fornecimento de enzimas de restrição
capazes de cortar trechos de DNA para a produção de DNA recombinante.

28.
Resposta:
A) Como são anaeróbicas facultativas, na presença de oxigênio realizam respiração aeróbica e na ausência de oxigênio realizam
fermentação (no caso, fermentação alcoólica).
B) O rendimento energético da respiração aeróbica é superior ao da fermentação alcoólica, permitindo uma maior atividade
metabólica no primeiro caso. Quando se utiliza fermento biológico (que corresponde à levedura Saccharomyces cerevisiae) em
massas, a região mais externa da massa trabalha com respiração aeróbica, pois terá oxigênio disponível para si, enquanto que a
região mais interna da massa trabalha com fermentação alcoólica, pois não estará em contato com oxigênio. O interessante, é que
a região central da massa consumirá glicose mais rapidamente, uma vez que, como o rendimento energético da fermentação é
menor que o da respiração aeróbica, haverá necessidade de se consumir mais glicose para se obter o mesma quantidade de ATP
gerado pela atividade aeróbica.

29.
Resposta:
A) na superfície, as células realizam a respiração aeróbica; no interior da massa, na ausência de oxigênio ocorre a fermentação
alcoólica.
B) a fermentação alcoólica produz CO 2 que estufa a massa.

30.
Resposta: Na ausência de oxigênio ocorre apenas a fermentação, processo que tem rendimento energético menor que o da
respiração, havendo necessidade de um maior consumo de glicose para compensar tal situação.

31.
Resposta: Caldo, uma vez que possui sacarose, que pode ser utilizado diretamente pelas leveduras. (O bagaço tem celulose que
teria que ser quebrado por enzimas em glicose para que as leveduras o pudessem utilizar; essas enzimas teriam que ser
adicionadas pelos interessados na produção do etanol, uma vez que as leveduras não as produzem.)

32.
Resposta:
A) maratonistas: C, porque corridas de longa distância são aeróbicas, havendo maior ação das fibras lentas; velocistas: A, porque
corridas de velocidade são anaeróbicas, havendo maior ação das fibras rápidas.
B) acúmulo de ácido láctico devido ao suprimento inadequado de oxigênio para o músculo.

33.
Resposta:
A) A receita B produziu iogurte saboroso. O iogurte natural foi utilizado por ser fonte de bactérias responsáveis pela fermentação
láctica (Lactobacillus), processo bioquímico que resulta no iogurte.
B) A fervura matou os lactobacilos. Com isso, não houve a formação de iogurte. A adição de geleia de morango adocicada e a
temperatura ambiente fornecem excelente meio para a multiplicação de bactérias decompositoras do meio, que são responsáveis
pelo resultado final, o leite estragado.

34.
Resposta:
A) Fermentação alcoólica com liberação de gás carbônico. Depois que a massa cresce pelo acúmulo de gás carbônico, sua
densidade se reduz, de modo que ela vem à tona.
B) Além de a quantidade de álcool produzida na fabricação do pão ser pequena, o calor do assamento faz com o álcool evapore.

35.
Resposta:
A) II, uma vez que, se produz menos gás carbônico, produz menos álcool, e as cervejas brasileiras têm menor teor alcoólico.
B) Sim, porque respirando por respiração aeróbica, a produção de CO 2 por molécula de glicose (6) é maior que na fermentação
alcoólica (2).

36.
Resposta: Como a produção de ATP via metabolismo aeróbio é insuficiente pelas limitações no aporte de oxigênio durante o
exercício, a célula muscular passa a usar, principalmente, a fermentação láctica, que gera ATP de modo mais rápido. Essa
fermentação é o mecanismo pelo qual a célula muscular reoxida o NADH + H+, permitindo o funcionamento contínuo da glicólise
em condições anaeróbias.

37.
Resposta: Charque: a adição de sal à carne torna o meio hipertônico em relação aos microrganismos, que perdem água por
osmose e morrem. Vinagre: o pH baixo da solução (meio ácido) compromete o metabolismo dos microrganismos, especialmente
por desnaturar proteínas. Compota: a adição de grande quantidade de açúcar torna o meio hipertônico em relação aos
microrganismos, que perdem água por osmose e morrem.

38.
Resposta: Ao contrário da glicose, o NAD é uma coenzima do processo, participando das reações de acepção e doação de elétrons
sendo, portanto, reciclado e não degradado.

39.
Resposta:
- aumento na quantidade de vasos sangüíneos nos músculos para aumentar o aporte de sangue e oxigênio
- aumento na quantidade de mitocôndrias nas fibras musculares para aumentar a produção de energia a partir de processos
aeróbicos
- aumento na quantidade de mioglobina nas fibras musculares para aumentar o aproveitamento de oxigênio pelos músculos
- aumento na capacidade respiratória para aumentar o aporte de oxigênio para os pulmões durante a atividade
- aumento na capacidade cardíaca para aumentar o aporte de sangue e oxigênio para os músculos.

40.
Resposta: Curva 1, CO 2 ; curva 2, O 2 ; curva 3, lactato. Durante o mergulho, não ocorreram trocas gasosas com o ambiente. Logo,
a curva 2, a única que mostra consumo, representa o oxigênio. De forma análoga, a curva 1, que aumenta durante o mergulho,
representa o CO 2 . O exercício em anaerobiose aumenta a produção de lactato, que é posteriormente metabolizado, o que é
mostrado pela curva 3.
1.
Resposta: D
Comentário: Segundo a Hipótese da Simbiose, mitocôndrias e cloroplastos são originários de seres procariontes que estabeleceram
relações de mutualismo com uma célula eucariótica ancestral. A principal evidência que sustenta essa teoria é a semelhança entre
bactérias, mitocôndrias e cloroplastos, como a presença de ribossomos 70S e DNA circular e desnudo (não associado a histonas).

2.
Resposta: B
Comentário: A técnica do DNA recombinante implica na introdução de um DNA exógeno em um certo organismo, que passa a ser
geneticamente modificado. Quando esse DNA exógeno tem origem em uma espécie distinta, esse organismo é caracterizado como
transgênico. Como o DNA exógeno tem que ser adicionado ao DNA da célula receptora, pode ser adicionado em organelas como
núcleo, mitocôndrias e cloroplastos (ausentes em leveduras), todas contendo DNA próprio.

3.
Resposta: A
Comentário: Segundo o texto, sabe-se que as soluções onde as células 1 e 2 estavam mergulhadas inicialmente no experimento A
(baixa concentração de oxigênio) tinham concentrações idênticas. Analisando as concentrações finais de glicose, tem-se que:
- A solução que banha as células 2 tem concentração de glicose menor que a inicial, de modo que a glicose foi transportada do meio
para a célula (a glicose entrou na célula 2);
- A solução que banha as células 1 tem concentração de glicose maior que a que banha as células 2, de modo que a glicose foi
transportada da célula para o meio (a glicose saiu da célula 1).
Segundo o texto, sabe-se que as soluções onde as células 1 e 2 estavam mergulhadas inicialmente no experimento B (alta concentração
de oxigênio) tinham concentrações idênticas. Analisando as concentrações finais de glicose, tem-se que:
- A solução que banha as células 2 tem concentração de glicose menor que a inicial, de modo que a glicose foi transportada do meio
para a célula (a glicose entrou na célula 2);
- A solução que banha as células 1 tem concentração de glicose menor que a inicial, de modo que a glicose foi transportada do meio
para a célula (a glicose entrou na célula 1).
Pode-se perceber que, nas células 2, a glicose entra na célula tanto com baixa (experimento A) como com alta (experimento B)
concentração de oxigênio, mas nas células 1, a glicose sei da célula com baixa concentração de oxigênio (experimento A) e entra na
célula com alta concentração de oxigênio (experimento B).
Pode-se então concluir que:
- As células 1 só executam metabolismo aeróbio, de modo que, no experimento B, com pouco oxigênio, as células não produzem
energia e não conseguem absorver glicose do meio por transporte ativo, perdendo glicose por difusão (de modo que a solução
apresentará maior teor de glicose). No experimento A, com muito oxigênio, as células produzem energia e conseguem absorver
glicose do meio por transporte ativo (de modo que a solução apresentará menor teor de glicose).
- As células 2 executam metabolismo aeróbico e anaeróbico, de modo que, tanto no experimento B, com pouco oxigênio, como no
experimento A, com muito oxigênio, as células produzem energia e conseguem absorver glicose do meio por transporte ativo (de
modo que a solução apresentará menor teor de glicose).

4.
Resposta: D
Comentário: Segundo o texto, a molécula “Alda Um” ativa a enzima aldeído desidrogenase-2, que degrada aldeídos tóxicos que
podem ser produzidos no metabolismo do álcool e em reações inflamatórias com geração de dor. Assim, analisando cada item:
Item A: falso. Se a molécula “Alda Um” ativa a enzima aldeído desidrogenase-2, pode-se afirmar que ela é um modulador positivo da
atividade da enzima.
Item B: falso. Se a enzima aldeído desidrogenase-2 degrada aldeídos, não agirá sobre o etano, que é um álcool. No metabolismo do
etanol, primeiramente o etanol é degradado em acetaldeído pela ação da enzima álcool desidrogenase, e o acetaldeído é degradado em
ácido acético (acetato) pela ação da enzima aldeído desidrogenase-2.
Item C: falso. Como mencionado acima, a enzima álcool desidrogenase catalisa a degradação do etanol em acetaldeído, e não dos
“metabólitos obtidos na quebra do acetaldeído”.
Item D: verdadeiro. A ativação da enzima aldeído desidrogenase-2 pela “Alda Um” favorece a depleção (diminuição) dos aldeídos
dentro da célula.
Item E: falso. Segundo o texto, a molécula “Alda Um” ativa a enzima que degrada aldeídos, mas não degrada aldeídos diretamente.

5.
Resposta: C
Comentário: A carnitina (ou L-carnitina) é uma substância derivada do aminoácido lisina e é encontrada nas mitocôndrias por todo o
corpo, sendo um dos responsáveis pela oxidação dos lipídios e, por isso, tendo efeito emagrecedor. A ação da carnitina consiste em
estimular a atividade da enzima carnitina-palmitoil-transferase, que promove o transporte de ácidos graxos de cadeia longa através da
membrana mitocondrial do hialoplasma para a matriz mitocondrial, para que possam ser oxidados como fonte de energia. Assim, a
carnitina age principalmente nos músculos sobre os ácidos graxos derivados dos triglicerídeos (óleos e gorduras) e dos corpos
cetônicos do sangue. Suplementação de carnitina pode agir na degradação mais eficiente de gorduras, o que explica seu efeito
emagrecedor.
Observação: A degradação dos ácidos graxos como fonte de energia é denominada de β-oxidação. Os ácidos graxos de cadeia muito
longa, com 24 átomos de carbono ou mais, são inicialmente degradados no interior dos peroxissomos, e quando a cadeia de ácidos
graxos é reduzida a 22 átomos de carbono, há transferência para as mitocôndrias para que o processo continue.

6.
Resposta: B
Comentário: O tecido adiposo multilocular apresenta várias gotas de lipídio por adipócito. Isso favorece a quebra desse lipídio, uma
vez que já está parcialmente quebrado, e sua utilização para a produção de energia como calor. Possui mitocôndrias em abundância, o
que confere a ele uma coloração amarronzada, e por isso é dito também tecido adiposo marrom. As mitocôndrias são usadas para a
produção de calor. Estas mitocôndrias apresentam uma proteína especial denominada termogenina que é uma desacopladora: ela
transporta prótons de hidrogênio de espaço intermembrana para a matriz sem passar pelos oxissomos, sendo a energia então liberada
como calor. Este tecido é encontrado em animais polares e em recém-nascidos humanos (próximo à nuca; nestes últimos esse tecido é
importante porque não possuem um controle térmico adequado). Assim, o mecanismo de regulação da temperatura realizado pela
gordura marrom está associado à presença de termogenina, uma proteína desacopladora.

7.
Resposta: D
Comentário: Na falta de oxigênio, a cadeia respiratória e a produção de ATP na mesma não ocorrem. Como conseqüência, tem-se o
impedimento da entrada do ácido pirúvico na mitocôndria, não ocorrendo o ciclo de Krebs. A produção de ATP estará restrita à
glicólise anaeróbica, com acúmulo de ácido láctico devido ao mecanismo de fermentação. A pequena quantidade de ATP gerada não
permite a atividade metabólica normal do organismo, ocorrendo morte pela falência múltipla de órgãos. Assim, analisando cada item:
Item I: verdadeiro. Sem oxigênio, não haverá cadeia respiratória e o ATP gerado será apenas aquele da glicólise, em pequena
quantidade.
Item II: falso. Sem oxigênio, não haverá cadeia respiratória, de modo que não haverá conversão de NADH 2 em NAD. Assim, o
NADH 2 tende a se acumular, e o NAD tende a diminuir de concentração, de modo que a relação NADH 2 /NAD irá aumentar, e não
diminuir.
Item III: verdadeiro. Sem oxigênio, ocorrerá glicólise e fermentação láctica, com consequente acúmulo de ácido láctico.
Item IV: verdadeiro. Como a produção de ATP por molécula de glicose é menor na fermentação láctica, o consumo de glicose
deverá ser maior para que haja uma geração razoável de energia; esse maior consumo de glicose levará à diminuição na quantidade de
glicogênio, que é um polímero de glicose com papel de armazenamento da mesma.

8.
Resposta: B
Comentário: Segundo a Hipótese Quimiosmótica de Mitchell, a energia liberada pelo fluxo de elétrons na cadeia respiratória é
utilizada para transportar íons H+ da matriz mitocondrial para o espaço intermembrana através da membrana mitocondrial interna.
Uma vez no espaço intermembrana, os íons H+ não podem retornar à matriz mitocondrial, se acumulando e gerando um gradiente de
prótons H+. Quando os prótons H+ retornam do espaço intermembrana para a matriz mitocondrial, eles o fazem por meio de proteínas
da membrana mitocondrial interna denominadas oxissomos (FoF1ATPase), que utilizam a energia liberada pelos prótons na passagem
a favor do gradiente (processos de transporte passivo são exotérmicos) para a síntese de ATP. Existem moléculas denominadas
desacopladores da fosforilação oxidativa, como o 2,4-dinitrofenol (2,4-DNP), que transportam prótons de hidrogênio do espaço
intermembrana para a matriz mitocondrial sem passar pelos oxissomos. Dessa maneira, quando os prótons voltam à matriz, liberam
energia como calor, não como ATP, uma vez que não passam pelos oxissomos (FoF1ATPase). Essas substâncias eram usadas como
emagrecedoras: ao invés de produzir ATP, o indivíduo gerava calos tendo que consumir muito mais matéria orgânica para garantir
uma produção razoável de ATP. Entretanto, pela geração excessiva de calor, elas deixaram de ser usadas. Assim, desacopladores
permitem a passagem de íons H+ devido ao gradiente de prótons gerado pelo transporte de elétrons da cadeia respiratória ocorra do
espaço intermembrana para a matriz mitocondrial sem passar pelos oxissomos, gerando calor ao invés de ATP.

9.
Resposta: D
Comentário: Na falta de oxigênio, a cadeia respiratória e a produção de ATP na mesma não ocorrem. Como conseqüência, tem-se o
impedimento da entrada do ácido pirúvico na mitocôndria, não ocorrendo o ciclo de Krebs. A produção de ATP estará restrita à
glicólise anaeróbica, com acúmulo de ácido láctico devido ao mecanismo de fermentação. A pequena quantidade de ATP gerada não
permite a atividade metabólica normal do organismo, ocorrendo morte pela falência múltipla de órgãos. Um veneno que interrompa a
passagem de elétrons pelos citocromos (como o cianeto) terá efeitos equivalentes ao da ausência de oxigênio, com bloqueio da cadeia
respiratória. Assim, ocorrerá fermentação láctica, com produção de ácido láctico, acúmulo de íons H+ e diminuição do pH celular.
Sem a cadeia respiratória, diminui a conversão de NADH 2 em NAD e de FADH 2 em FAD, com queda da taxa de NAD e FAD livres,
diminuindo consequentemente a produção de ATP. Ainda, sem a cadeia respiratória, o oxigênio não recebe elétrons e não reage com
os íons H+, não ocorrendo formação de água.
10.
Resposta: C
Comentário: Analisando cada item:
Item A: verdadeiro. A conversão de glicose em CO 2 e H 2 O envolve um aumento da entropia e uma variação negativa da entalpia,
correspondendo o processo a uma reação exotérmica.
Item B: verdadeiro. A maior parte da energia liberada pelas oxidações ocorridas no ciclo de Krebs é conservada na forma de elétrons
em moléculas de NAD e FAD reduzidas, ou seja, NADH 2 e FADH 2 .
Item C: falso. Apesar de o ciclo de Krebs produzir apenas 2 ATP por molécula de glicose (na verdade 2 GTP, guanosina-trifosfato,
que transfere sua energia para 2formar 2 ATP, adenosina-trifosfato), é um processo altamente energético porque gera grandes
quantidades de NADH 2 e FADH 2 a serem usados na cadeia respiratória para a geração de mais ATP.
Item D: verdadeiro. NAD e FAD reduzidos, ou seja, NADH 2 e FADH 2 , liberam seus elétrons na cadeia respiratória, de modo a se
oxidarem.
Item E: verdadeiro. Os elétrons conduzidos ao longo da cadeia respiratória liberam energia que será utilizada para a síntese de ATP
por fosforilação oxidativa.

11.
Resposta: D
Comentário: Analisando cada item:
Item A: falso. A glicólise consiste na degradação parcial da molécula de glicose.
Item B: falso. A formação de ATP na glicólise ocorre no citoplasma, enquanto que a formação de ATP no ciclo de Krebs e na cadeia
respiratória ocorrem dentro da mitocôndria.
Item C: falso. No ciclo de Krebs, o acetil-coA derivado da glicólise é inteiramente degradado em gás carbônico.
Item D: verdadeiro. Por receber os elétrons de NADH 2 e FADH 2 , o O 2 é o aceptor final de elétrons na respiração aeróbia.

12.
Resposta: D
Comentário: Apesar de não possuírem mitocôndrias, os procariontes podem fazer respiração celular aeróbica. Nesse caso, as etapas
da respiração que ocorreriam na matriz mitocondrial (ciclo de Krebs) e cristas mitocondriais (cadeia respiratória) de células
eucarióticas ocorrem, respectivamente, no citoplasma e na membrana plasmática de células procarióticas. A cadeia respiratória ocorre
principalmente numa área da membrana denominada mesossomo, que é uma invaginação da mesma. Assim, as estruturas celulares
que substituem as mitocôndrias são mesossomos que possuem as enzimas da cadeia respiratória.

13.
Resposta: D
Comentário: O oxigênio só participa diretamente da cadeia respiratória nas cristas mitocondriais, de modo que, em sua ausência, essa
etapa é a primeira a ser interrompida (apenas com a interrupção na cadeia respiratória é que ocorre o impedimento da entrada de ácido
pirúvico na mitocôndria, de modo que apenas a partir daí é que o ciclo de Krebs é também interrompido).

14.
Resposta: C
Comentário: Para cada NADH 2 que entra na cadeia respiratória, 3 ATP são gerados, e para cada FADH 2 , 2 ATP são gerados. Assim,
contabilizando os NADH 2 e FADH 2 produzidos:
- glicólise: 2 NADH 2 X 3 ATP = 6 ATP
- formação de acetil-coA: 2 NADH 2 X 3 ATP = 6 ATP
- ciclo de Krebs:
6 NADH 2 X 3 ATP = 18 ATP
2 FADH 2 X 2 ATP = 4 ATP
Desse modo, há um total de 34 ATP gerados na cadeia respiratória por molécula de glicose.

15.
Resposta: A
Comentário: Em seres eucariontes, dotados de mitocôndrias, a respiração aeróbica ocorre parte no hialoplasma (citoplasma
fundamental) e parte na mitocôndria. Assim:
- A glicólise, que converte glicose em ácido pirúvico, ocorre no hialoplasma;
- A oxidação do ácido pirúvico em acetil-coA e gás carbônico ocorre na matriz mitocondrial;
- O ciclo de Krebs, que degrada o acetil-coA em gás carbônico, ocorre na matriz mitocondrial;
- A cadeia respiratória, que utiliza a energia dos elétrons de NADH 2 e FADH 2 para gerar ATP, ocorre nas cristas mitocondriais.

16.
Resposta: A
Comentário: Ligações de alta energia são aquelas que liberam grandes quantidades de energia livre quando quebradas, como as
ligações fosfoanidra na molécula de ATP. O ATP (adenosina trifosfato) é um nucleotídeo, formado por adenina, ribose e três grupos
fosfato, sendo as ligações fosfoanidra aquelas que ocorrem entre os grupos fosfato e representadas por um til (~). Quando quebrada
uma dessas ligações, o ATP passa a ADP (adenosina difosfato) e Pi (fosfato inorgânico) e libera cerca de 7,3 Kcal de energia por mol
degradado. Ocorrem duas ligações dessas no ATP e um no ADP. Observe:

Apesar de a glicose ser a fonte primária de energia para os seres vivos, não possui ligações de alta energia, que são encontradas no
ATP, no ADP e em coenzimas associadas a nucleotídeos, como a coenzima A, o NAD e o FAD.

17.
Resposta: E
Comentário: A respiração aeróbica ocorre em três etapas, sendo elas glicólise, ciclo de Krebs e cadeia respiratória. A glicose entra
diretamente na glicólise, mas compostos como lipídios e proteínas são convertidos em acetil-coA para entrar no ciclo de Krebs. Veja
abaixo.
Glicose Lipídios Proteínas

Glicólise Digestão Digestão

Ácido pirúvico Ácidos graxos Aminoácidos

β-oxidação Desaminação

Acetil-coA

Ácidos orgânicos Amônia

Ciclo de Krebs Ciclo da


ornitina

Energia! Uréia

Como a maior parte do ATP gerado na respiração aeróbica é produzida na cadeia respiratória a partir de NADH 2 e FADH 2
provenientes principalmente do ciclo de Krebs, moléculas de lipídios produzem mais energia por unidade de massa, uma vez que
geram mais moléculas de acetil-coA, NADH 2 e FADH 2 por unidade de massa. Assim, açúcares e proteínas fornecem 4,1 kcal/g, mas
lipídios fornecem 9,3 kcal/g. Analisando cada item:
Item A: falso. Os triglicerídeos, lipídios como óleos e gorduras, produzem maior quantidade de energia por grama do que proteínas e
polissacarídeos.
Item B: falso. A utilização de lipídios e proteínas depende do ciclo de Krebs sendo, obrigatoriamente, aeróbica.
Item C: falso. A degradação de acetil-coA no ciclo de Krebs libera CO 2 como produto, sendo o oxigênio consumindo no processo por
se tratar de um processo aeróbico.
Item D: falso. Como mencionado, os lipídios são as mais ricas fontes energéticas da célula.
Item E: verdadeiro. Proteínas, para que sejam usadas como fontes de energia, são quebradas em aminoácidos, os quais são
desaminados, liberando amônia, uma das substâncias responsáveis pelo odor fétido de restos orgânicos em putrefação.

18.
Resposta: E
Comentário: Analisando cada item:
Item A: falso. NAD e FAD são aceptores intermediários de elétrons, ou seja, recolhem elétrons liberados na oxidação da glicose na
glicólise, na oxidação do ácido pirúvico e no ciclo de Krebs e os cedem à cadeia respiratória, que usa a energia desses elétrons na
produção de ATP. O oxigênio é o aceptor final de elétrons na respiração aeróbica, uma vez que recebem os elétrons no final da cadeia
respiratória, formando água como subproduto.
Item B: falso. A glicólise converte glicose em ácido pirúvico, que é oxidado a acetil-coA, que por sua vez entra no ciclo de Krebs,
liberando gás carbônico.
Item C: falso. Em células eucarióticas, a glicólise ocorre no hialoplasma, o ciclo de Krebs ocorre na matriz mitocondrial e a cadeia
respiratória ocorre nas cristas mitocondriais.
Item D: falso. Como mencionado, o oxigênio é o aceptor final de elétrons na respiração aeróbica, gerando água como produto.
Item E: verdadeiro. Na glicólise, ocorre consumo inicial de 2 ATP para a ativação da glicose, sendo produzidos 4 ATP, o que dá um
saldo de 2 ATP por glicose, sendo esse o saldo da fermentação, láctica ou alcoólica.

19.
Resposta: A
Comentário: A hipótese quimiosmótica de Mitchell descreve o mecanismo de produção de ATP por fosforilação oxidativa. Na cadeia
respiratória, ocorre oxirredução de NADH 2 e FADH 2 , com liberação de elétrons que, ao passar pelas proteínas citocromos, cedem
energia para bombear prótons de H+ da matriz mitocondrial para o espaço entre as membranas mitocondriais. Esta bomba de prótons
cria um gradiente eletroquímico entre o espaço intermembrana hipertônico e a matriz mitocondrial hipotônica em H+. Através de
proteínas denominadas oxissomos ou FoF1ATPases ou ATP sintases, os íons H+ se deslocam por difusão do espaço intermembrana
para a matriz mitocondrial, liberando energia para a fosforilação do ADP em ATP. Assim, resumidamente, o fluxo de elétrons da
cadeia respiratória libera energia para o bombeamento de íons H+ para o espaço intermembrana, os quais liberam energia como ATP
quando retornam pelas ATP sintases.

20.
Resposta: E
Comentário: Como o oxigênio é o aceptor final de elétrons da respiração aeróbica, reage com os elétrons e os íons H+ da cadeia
respiratória e forma água, de modo que, se o gás oxigênio é constituído pelo isótopo 18O, deve-se detectar a presença de isótopo 18O
primeiramente na molécula de água.

21.
Resposta: D
Comentário: O cianeto é um veneno que se liga ao ferro dos citocromos, bloqueando a cadeia respiratória da respiração aeróbica e
impedindo a utilização do oxigênio. O monóxido de carbono se liga ao ferro da hemoglobina formando carboxiemoglobina e
bloqueando o transporte de oxigênio no sangue. Em ambos os casos, a impossibilidade da utilização ou do aporte de oxigênio para as
células impede a respiração aeróbica, levando à asfixia, e consequentemente a uma grande diminuição na geração de ATP, afetando
diretamente o metabolismo energético e podendo levar à morte por falência múltipla dos órgãos.

22.
Resposta: A
Comentário: A Hipótese da Simbiose de Lynn Margulis defende a origem de mitocôndrias a partir de bactérias aeróbicas
endomutualísticas e a origem de cloroplastos a partir de cianobactérias endomutualísticas. Uma das evidências que sustentam essa
idéia é o fato de que a síntese protéica nos ribossomos bacterianos 70S é inibida pelos mesmos antibióticos que inibem a síntese
protéica nos ribossomos 70S de mitocôndrias e cloroplastos, como ocorre com o cloranfenicol, que não inibe a síntese protéica nos
ribossomos 80S do citoplasma de eucariontes. Assim, nas células das plantas, as organelas que apresentam o mecanismo de síntese
protéica igual ao dos procariotos correspondem às mitocôndrias (1) e aos cloroplastos (4).

23.
Resposta: D
Comentário: Mitocôndrias são organelas encontradas em células eucarióticas e que apresentam duas membranas, uma membrana
mitocondrial externa (3) e uma membrana mitocondrial interna (4), separadas por um espaço intermembrana (2). A membrana
mitocondrial interna apresenta dobras denominadas cristas mitocondriais, as quais estão associadas a proteínas denominadas
citocromos e a partículas denominadas oxissomos ou FoF1ATPases ou ATP sintases, que são as enzimas que geram ATP na
fosforilação oxidativa. O espaço interno da mitocôndria é ocupado por uma matriz mitocondrial (1), onde existem DNA, ribossomos e
enzimas. Na respiração aeróbica, a glicólise ocorre fora da mitocôndria, no hialoplasma, mas a oxidação do ácido pirúvico a acetil-
coA ocorre na matriz mitocondrial (1), o ciclo de Krebs ocorre na matriz mitocondrial (1), a cadeia respiratória ocorre nos citocromos
das cristas mitocondriais (4) e a ATP sintase da fosforilação oxidativa ocorre nas cristas mitocondriais (4).

24.
Resposta: A
Comentário: Segundo a Hipótese Quimiosmótica de Mitchell, a energia liberada pelo fluxo de elétrons na cadeia respiratória é
utilizada para transportar íons H+ da matriz mitocondrial para o espaço intermembrana através da membrana mitocondrial interna.
Uma vez no espaço intermembrana, os íons H+ não podem retornar à matriz mitocondrial, se acumulando e gerando um gradiente de
prótons H+. Quando os prótons H+ retornam do espaço intermembrana para a matriz mitocondrial, eles o fazem por meio de proteínas
da membrana mitocondrial interna denominadas oxissomos (FoF1ATPase), que utilizam a energia liberada pelos prótons na passagem
a favor do gradiente (processos de transporte passivo são exotérmicos) para a síntese de ATP. Existem moléculas denominadas
desacopladores da fosforilação oxidativa, como o 2,4-dinitrofenol (2,4-DNP), que transportam prótons de hidrogênio do espaço
intermembrana para a matriz mitocondrial sem passar pelos oxissomos. Dessa maneira, quando os prótons voltam à matriz, liberam
energia como calor, não como ATP, uma vez que não passam pelos oxissomos (FoF1ATPase). Essas substâncias eram usadas como
emagrecedoras: ao invés de produzir ATP, o indivíduo gerava calos tendo que consumir muito mais matéria orgânica para garantir
uma produção razoável de ATP. Entretanto, pela geração excessiva de calor, elas deixaram de ser usadas. Assim, um inibidor da
cadeia respiratória como o cianeto impede a utilização do oxigênio, de modo que seu consumo estará diminuído na célula, como no
gráfico 1. Um desacoplador diminui a produção de ATP na cadeia respiratória, desviando a energia para a geração de calor, de modo
que o organismo deve consumir mais glicose na respiração para compensar a diminuição na produção de ATP e manter sua produção
em níveis adequados; para isso, a célula irá consumir mais oxigênio, como no gráfico 4.

25.
Resposta: B
Comentário: O transporte de glicose nas vilosidades intestinais da luz para as células intestinais se dá pelo mecanismo de transporte
ativo 2º com cotransporte sódio-glicose. Assim, a bomba de sódio e potássio, por transporte ativo, mantém baixas concentrações de
sódio dentro das células do epitélio intestinal, forçando a passagem de sódio por difusão da luz para as células intestinais. Como o
transportador de sódio opera em cotransporte com a glicose, só permitindo a passagem de ambos, a energia liberada na difusão de
sódio libera energia que é usada para transportar a glicose da luz para as células intestinais mesmo contra seu gradiente de
concentração. Na situação descrita, produziu-se um saco com o intestino virado ao avesso, de modo que a mucosa (epitélio intestinal)
ficou voltada para o lado externo em contato com uma solução com sal (sódio) e com glicose, e a serosa (revestimento externo do
intestino) ficou voltada para o lado interno com uma solução com sal e sem glicose. Em condições normais, a glicose da solução
externa ao saco de intestino é absorvida pela mucosa por transporte ativo 2º, junto ao sódio, de modo que o teor de glicose diminui na
solução que envolve o saco de intestino, como ocorre nos gráficos 2 e 4. Com a adição de cianeto, ocorre bloqueio da cadeia
respiratória e, consequentemente, diminuição da produção de ATP, cessando a bomba de sódio e potássio nas células do epitélio
intestinal, o que faz com que o teor de sódio dentro das células desse epitélio não mais se mantenha baixo e o sódio não entre mais por
difusão, não liberando energia para o transporte ativo 2º de glicose, que não é absorvida, passando a ficar constante na solução que
envolve o saco de intestino, como ocorre no gráfico 2.

26.
Resposta: C
Comentário: Os pulmões são órgãos respiratórios formados internamente por pequenas bolsas denominadas alvéolos pulmonares. A
hematose é a troca de gases respiratórios no nível dos alvéolos pulmonares. Nesse processo, o gás carbônico abandona o sangue,
atravessa a membrana respiratória e passa ao alvéolo, e o oxigênio segue caminho inverso. O processo de hematose é realizado devido
às diferenças de pressões parciais dos diversos gases entre o ar alveolar e o sangue. A frase está incorreta porque o gás oxigênio é
utilizado pela cadeia transportadora de elétrons formando água como subproduto de modo que todo oxigênio que entra na respiração é
liberado como água. O gás carbônico liberado na respiração é proveniente da degradação da glicose na glicólise e no ciclo de Krebs.

27.
Resposta: C
Comentário: O cianeto se liga ao ferro dos citocromos, bloqueando a cadeia respiratória e reduzindo a produção de ATP, o que pode
levar à morte por asfixia.

28.
Resposta: A
Comentário: O etanol das bebidas alcoólicas é metabolizado nos peroxissomos em duas etapas, com a enzima álcool desidrogenase
convertendo etanol em etanal (aldeído acético ou acetaldeído), e a enzima aldeído desidrogenase convertendo etanal em ácido acético,
o qual pode ser convertido em acetil-coA para ser convertido em gordura ou ser metabolizado no ciclo de Krebs para fornecimento de
energia. O metanol é metabolizado pelas mesmas enzimas que metabolizam o etanol, sendo que a enzima álcool desidrogenase
converte metanol em metanal (ou formaldeído ou formol), extremamente tóxico, e a enzima aldeído desidrogenase converte metanal
em ácido metanóico. Quando ocorre ingestão de metanol, o fornecimento de bebidas alcoólicas faz com que a enzima álcool
desidrogenase metabolize preferencialmente o etanol, não convertendo o metanol em formol e, com isso, evitando o efeito tóxico.
Assim, pode-se argumentar o etanol compete com o metanol pela enzima álcool desidrogenase.

29.
Resposta: A
Comentário: A cadeia respiratória ocorre pela transferência de elétrons entre moléculas como os citocromos, que são proteínas
contendo ferro em sua estrutura. O estado normal de oxidação do ferro nos citocromos é Fe2+ (reduzido, ferroso), mas quando o
oxigênio molecular (O 2 ) entra em ação na cadeia respiratória, o ferro se oxida, passando ao estado de Fe3+ (oxidado, férrico). Segundo
o esquema, os elétrons vão do NADH para o complexo 1, daí para a ubiquinona, daí para o complexo 3, daí para o citocromo c, daí
para o complexo 4, e daí para o oxigênio. Se o citocromo c for inibido (o que pode ocorrer por substâncias como o cianeto), o oxigênio
removerá elétrons do complexo 4, que ficará oxidado (na forma de Fe3+, férrico), mas o complexo 4 não removerá elétrons do
citocromo c, que permanecerá reduzido (na forma de Fe2+, ferroso). De modo semelhante, o citocromo c não removerá elétrons do
complexo 3 (que permanecerá reduzido na forma de Fe2+, ferroso), que não removerá elétrons da ubiquinona (que permanecerá
reduzida), que não removerá elétrons do complexo 1 (que permanecerá reduzido na forma de Fe2+, ferroso). Assim, o complexo 1
ficará reduzido, a ubiquinona permanecerá reduzida, o complexo 3 permanecerá reduzido e o complexo 4 ficará oxidado.

30.
Resposta: D
Comentário: Analisando cada item:
Item A: falso. As dobras da membrana mitocondrial interna são denominadas cristas mitocondriais, delimitando um espaço
preenchido pela matriz mitocondrial.
Item B: falso. Condrioma é o termo que designa o conjunto de mitocôndrias de uma célula.
Item C: falso. A membrana mitocondrial interna apresenta em sua estrutura enzimas e outras substâncias responsáveis pela respiração
celular, como os oxissomos responsáveis pela síntese de ATP.
Item D: verdadeiro. Pelo fato de apresentarem DNA, e esse ser capaz de se replicar, as mitocôndrias são capazes de autoduplicar e
transferir às mitocôndrias resultantes seu material genético.
Item E: falso. As mitocôndrias possuem ribossomos, o que indica que são capazes de produzir suas próprias proteínas, e DNA, cujos
genes controlam a síntese de proteínas mitocondriais.

31.
Resposta: C
Comentário: A organela em destaque é uma mitocôndria. Analisando cada item:
Item I: verdadeiro. As mitocôndrias em humanos são herdadas sempre do gameta feminino.
Item II: falso. Os espermatozóides apresentam grande quantidade de mitocôndrias para lhes fornecer energia no processo de
deslocamento até o óvulo; entretanto, essas mitocôndrias se degeneram após a fecundação.
Item III: verdadeiro. Mitocôndrias apresentam DNA próprio, sendo capazes de se auto-reproduzir.

32.
Resposta: E
Comentário: Analisando cada item:
Item A: falso. Microorganismos como os Lactobacillus utilizam fermentação láctica para a produção de energia em anaerobiose, com
o ácido lático como produto do processo, mas microorganismos como as leveduras utilizam fermentação alcoólica para a produção de
energia em anaerobiose, com a produção de etanol e gás carbônico.
Item B: falso. Quando ocorre atividade muscular intensa e o suprimento de oxigênio é insuficiente, as células musculares utilizam
fermentação láctica para a produção de energia em anaerobiose, com o ácido lático como produto do processo.
Item C: falso. Em condições anaeróbicas, o ácido lático é o produto final da fermentação, não sendo convertido em acetil-coA e não
havendo ciclo de Krebs; em condições aeróbicas, o ácido pirúvico da glicólise entra na mitocôndria e é transformado diretamente em
acetil-coA, para só então o processo aeróbico prosseguir com a ocorrência do ciclo de Krebs.
Item D: falso. A maior parte do ATP produzido na respiração vem da cadeia respiratória, a partir dos elétrons armazenados nas
moléculas de NADH 2 e FADH 2 produzidas no ciclo de Krebs e na glicólise.
Item E: verdadeiro. Em condições aeróbicas, ácidos graxos, aminoácidos e glicídios são metabolizados em acetil-coA ou outros
intermediários metabólicos do ciclo de Krebs para que sejam completamente oxidados.

33.
Resposta: D
Comentário: No processo respiratório, a glicose é degradada em gás carbônico na glicólise e no ciclo de Krebs, e o oxigênio é usado
na cadeia respiratória para a produção de água. Isso pode ser percebido na experiência porque, quando o rato utiliza como alimento a
glicose marcada com 14C, fabrica gás carbônico marcado com 14C, que por sua vez reage com a água de cal, Ca(OH) 2 e forma
carbonato de cálcio, CaCO 3 , também marcado com 14C. Assim, conclui-se que o carbono do CO 2 eliminado pelos ratos é proveniente
da glicose.

34.
Resposta: VVVFF
Comentário:
1º item: verdadeiro. Segundo a Hipótese Quimiosmótica, a síntese de ATP na fosforilação oxidativa se dá a partir da energia
resultante de um gradiente de prótons, liberada durante as reações da cadeia respiratória.
2º item: verdadeiro. Quanto maior a atividade metabólica de uma célula, maior a quantidade de mitocôndrias e maior a síntese de
ATP, como nas células da musculatura cardíaca e nos espermatozóides.
3º item: verdadeiro. O ATP é uma substância química que permite a transferência de energia entre os processos que liberam energia
(exotérmicos, como a respiração celular) e os processos que consomem energia (endotérmicos, como a síntese protéica e o transporte
ativo).
4º item: falso. Quanto maior a atividade metabólica de uma célula, maior a quantidade de cristas mitocondriais em suas mitocôndrias,
possibilitando maior produção de energia na cadeia respiratória.
5º item: falso. O cianeto se liga aos citocromos da cadeia respiratória e impede o fluxo de elétrons para o oxigênio; sem a cadeia
respiratória, a quantidade de ATP gerada diminui, podendo levar à morte por falência múltipla dos órgãos.

35.
Resposta: VFVVV
Comentário:
1º item: verdadeiro. As enzimas aumentam a velocidade das reações químicas nos sistemas biológicos, diminuindo a energia de
ativação necessária à transformação dos compostos metabolizados.
2º item: falso. A fermentação gera um produto final de alta energia a partir do ácido pirúvico, como o etanol ou o ácido lático.
3º item: verdadeiro. A equação química que resume a reação é dada por: C 6 H 12 O 6 + 2 ADP +Pi → 2 C 3 H 4 O 3 + 2 ATP + 2 NADH +
2H+.
4º item: verdadeiro. As coenzimas NAD e FAD se tornam reduzidas em NADH e FADH 2 . Tais íons hidrogênios são carreados por
essas coenzimas para as cristas mitocondriais e participam da cadeia de transporte de elétrons (CTE).
5º item: verdadeiro. A enzima ATP sintetase adiciona fosfatos inorgânicos às moléculas de ADP, gerando ATP, à medida que os
prótons hidrogênios a atravessam. A reação de hidrogênios com o oxigênio (último aceptor da CTE) produz água no interior celular.

36.
Resposta: 1 – Glicólise. 2 – Ciclo de Krebs. 3 – Cadeia Respiratória. 4 – NADH. 5 – ATP.

37.
Resposta:
A) Não está ocorrendo feedback negativo da tiroxina sobre o TSH, o que justifica a alta concentração dos dois.
B) Como desacopladores da fosforilação oxidativa, a energia liberada na passagem dos elétrons da cadeia respiratória do espaço
intermembrana para a matriz mitocondrial não é liberara como ATP, e sim como calor, o que aumenta a temperatura corporal e a
sudoreses, numa tentativa de moderar a temperatura.

38.
Resposta:
A) Como o retículo endoplasmático liso está relacionado com a destoxificação, a célula A está relacionada a essa função. Como o
retículo endoplasmático rugoso está relacionado à produção de proteínas para exportação e o complexo de Golgi está relacionado à
secreção celular, a célula B está relacionada à atividade de secreção.
B) Como a célula B possui maior extensão de membranas mitocondriais internas, relacionadas à cadeia respiratória e à fosforilação
oxidativa, produz mais energia e possui maior atividade metabólica.

39.
Resposta:
A) Protozoários, algas, fungos, plantas e animais.
B) Na fermentação e na respiração aeróbica, o substrato oxidado é uma molécula orgânica, a glicose. O aceptor final de elétrons na
fermentação é um composto orgânico (ácido pirúvico na fermentação láctica e etanal na fermentação alcoólica), uma vez que nela
ocorre oxidação somente parcial da glicose, e o aceptor final de elétrons na respiração aeróbica é um composto inorgânico, o oxigênio,
formando água como produto, uma vez que nela ocorre oxidação total da glicose.

40.
Resposta: Um dos monossacarídeos: glicose, frutose. Substâncias: ácidos graxos e glicerol. Precursor: ácido pirúvico.
41.
Resposta: Desacoplamento da fosforilação oxidativa. Hormônios tireoidianos, à exceção da calcitonina.

42.
Resposta: Curva Z. Na mitocôndria intacta, íons H+ são bombeados a partir da matriz e se acumulam no espaço intermembranas. Na
mitocôndria sem membrana externa, os íons H+ se difundem para o meio nutritivo. Como conseqüência, há diminuição do pH do
meio.

43.
Resposta: Gráfico I; o DNF, desfazendo o gradiente de prótons, inibe a síntese de ATP, mas não atua na cadeia respiratória.
Consequentemente, o quociente entre a taxa de síntese de ATP e a taxa de consumo de O 2 deverá ser menor, após a adição do DNF.

44.
Resposta: O monóxido de carbono, por ter maior afinidade com o Fe++, impede a ligação do grupamento heme da hemoglobina com o
oxigênio, diminuindo o aporte desse gás aos tecidos. Já sua ligação ao heme da citocromo C oxidase paralisa a cadeia respiratória
mitocondrial, impedindo a síntese de ATP.

45.
Resposta:
A) Gráfico 5 – sob iluminação; gráfico 3 – na obscuridade.
O desacoplador diminui a síntese de ATP na mitocôndria e acelera a cadeia respiratória, provocando um decréscimo da taxa de
produção de ATP mitocondrial e um acréscimo no consumo de O 2 pela cadeia respiratória. O gráfico 5 é o que apresenta a síntese de
ATP no cloroplasto similar ao controle. O gráfico 3, apresentando uma baixa produção de ATP no cloroplasto, indica, portanto, o
experimento realizado na obscuridade.
B) A taxa de produção de CO‚ deverá diminuir.
Devido à inibição da cadeia respiratória mitocondrial, a síntese de ATP e o consumo de O 2 na mitocôndria estão diminuídos em
relação ao controle. Em conseqüência do acúmulo de coenzimas de oxirredução sob a forma reduzida, as oxidações do ciclo dos
ácidos tricarboxílicos e a produção de CO 2 estão diminuídas.

46.
Resposta:
A) I – Membrana externa. II – Espaço intermembranas ou espaço intermembranoso. III – Membrana Interna. IV – Matriz
Mitocondrial.
B) III – Cadeia respiratória ou Cadeia transportadora de elétrons ou fosforilação oxidativa. IV – Ciclo de Krebs ou Ciclo do Ácido
Cítrico ou descarboxilação oxidativa.
C) Citoesqueleto ou sarcômero ou miosina ou microfilamentos; o qual teve seu funcionamento afetado por ter menos ATP disponível
ou redução da energia disponível ou redução da respiração.

47.
Resposta:
A) segundo a Hipótese Quimiosmótica, o fluxo de elétrons na cadeia respiratória libera energia que bombeia prótons para o espaço
intermembrana da mitocôndria, gerando um gradiente eletroquímico; quando os prótons retornam para a matriz pelos oxissomos,
liberam energia utilizada na síntese de ATP.
B) fosforilação porque a síntese de ATP se faz pela adição de fosfato ao ADP, e oxidativa porque envolve a liberação de elétrons a
partir dos aceptores ativados, NADH e FADH 2 .
C) acúmulo de ácido láctico.

48.
Resposta:
A) O maçarico, uma vez que possui maior concentração de enzimas relacionadas ao metabolismo aeróbico, relacionado a atividades
prolongadas, como a citrato sintase e a lipase triacilglicerol.
B) Músculo peitoral vermelho implica em maior concentração da proteína mioglobina, que transfere oxigênio da hemoglobina para a
respiração aeróbica, estando relacionado a uma produção de energia mais prolongada por vias aeróbicas a partir de gordura e
glicogênio.

49.
Resposta: Observe que o álcool etílico será degradado em acetil-coA. Lembre-se que o ácido graxo sempre tem um número par de
carbonos exatamente porque é formado a partir da junção de moléculas de acetil-coA, que têm 2 carbonos em seu radical . Assim, o
acetil-coA é consumido pelo ciclo de Krebs, porém, em excesso, seu metabolismo é desviado para a formação de ácidos graxos, e daí
então de triglicerídeos (gorduras). No hepatócito, o acúmulo de gordura dificultará as atividades hepáticas, o que caracteriza a
princípio um quadro de esteatose (ou fígado gorduroso ou pré-cirrose), o que culmina com a morte do hepatócito sem possibilidade de
regeneração, de modo que o fígado cicatriza, o que caracteriza uma cirrose alcoólica.
CUIDADO COM O ÁLCOOL, MAIS CUIDADO AINDA COM ALDEÍDO ACÉTICO!!!
Percebam que o álcool é degradado em aldeído acético e daí então e ácido acético e acetil-coA. Em quantidades moderadas, a maior
parte do aldeído acético será então degradada em ácido acético e acetil-coA. Porém, em excesso, o aldeído acético permanece livre
(não há como degradá-lo integralmente em quantidades excessivas), sendo tóxico aos neurônios, promovendo efeitos como dilatação
dos vasos sangüíneos e queda de pressão arterial, taquicardia, tonturas, vermelhidão (pela vasodilatação), dor de cabeça, aumento de
temperatura corporal, alterações no sistema digestivo (náuseas e vômitos) e, em altas doses, coma. Além disso, ele inibe a liberação de
ADH, o que aumenta a produção de urina, mas disso todo mundo sabe, né...

50.
Resposta: Note que as mitocôndrias estão isoladas, não havendo pois citoplasma. Se não há citoplasma, não pode haver glicólise, ou
seja, quebra de glicose. O mecanismo respiratório começará no acetil-coA ligando-se ao oxalacetato para formar o citrato no ciclo de
Krebs. Na situação I, com a glicose, nada ocorrerá (e não haverá consumo de O 2 ). Na situação II, com o citrato, ocorrerá o ciclo de
Krebs na matriz mitocondrial e serão gerados NADH e FADH 2 que serão usados pela cadeia respiratória nas cristas mitocondriais (e
haverá consumo de O 2 ).
1.
Resposta: E
Comentário: A capacidade de realizar fotossíntese é devida à clorofila, que transfere a energia da luz para compostos orgânicos,
como o ATP, e posteriormente a glicose.

2.
Resposta: D
Comentário: A fotossíntese envolve uma fase clara, que utiliza luz, clorofila e água para produzir ATP, NADPH 2 e O 2 , e uma fase
escura, que utiliza ATP, NADPH 2 e CO 2 para produzir glicose. A fase escura ocorre dentro de uma reação denominada de ciclo de
Calvin ou das pentoses, que se inicia com a ligação do CO 2 com uma molécula de uma pentose denominada Ribulose-1,5-bifosfato ou
RuDP, o que se dá através de uma enzima denominada Ribulose-1,5-bifosfato-Carboxilase-Oxidase, ou, simplesmente, Rubisco.

3.
Resposta: B
Comentário: Analisando cada item:
Item I: verdadeiro. A etapa fotoquímica ou luminosa ocorre na membrana interna do cloroplasto (lamelas e tilacóides/grana) e a
etapa química ou escura ocorre no estroma dos cloroplastos.
Item II: falso. A utilização do CO 2 na produção de carboidrato ocorre no ciclo de Calvin durante a etapa química ou escura.
Item III: verdadeiro. A fotólise da água ou reação de Hill envolve a quebra da molécula de H 2 O sob ação da luz na fase fotoquímica
ou luminosa.
Item IV: verdadeiro. A etapa química ou escura ocorre sem necessidade direta da luz, apesar de depender do ATP e do NADPH 2
produzidos na fase fotoquímica ou luminosa, na qual há participação direta da luz.

4.
Resposta: E
Comentário: Plantas II mantêm alta atividade fotossintética mesmo em baixas intensidades luminosas, sendo umbrófilas, ou seja,
adaptadas a sombra (baixa luminosidade); plantas I são heliófilas, ou seja, adaptadas ao sol (alta luminosidade). Observe abaixo:

2
1 – Atividade fotossintética da
planta II em baixa intensidade
Baixa luminosa
intensidade
luminosa 2 – Atividade fotossintética da
planta I em baixa intensidade
luminosa

5.
Resposta: C
Comentário: Paramécios são protozoários, organismos eucariontes unicelulares heterótrofos, realizando apenas respiração aeróbica,
enquanto algas são organismos eucariontes uni ou pluricelulares autótrofos fotossintetizantes. Assim:
- considerando que a respiração aeróbica consome O 2 e libera CO 2 , tem-se que o tubo fechado (acumulando os gases em concentração
acima da atmosférica) com paramécios apenas (onde só ocorre respiração aeróbica) deve possuir mais CO 2 (tubo II);
- considerando que a fotossíntese consome CO 2 e libera O 2 , tem-se que o tubo fechado (acumulando os gases em concentração acima
da atmosférica) com algas apenas (onde ocorre fotossíntese e respiração aeróbica, mas menos respiração aeróbica do que nos tubos
com paramécios) deve possuir mais O 2 (tubo VI).

6.
Resposta: D
Comentário: O processo da fotossíntese inicia-se com a excitação de elétrons da clorofila pela luz, com o objetivo de produzir
energia química na forma de ATP, que será utilizada na síntese de moléculas orgânicas.

7.
Resposta: C
Comentário: A planta realiza fotossíntese somente na presença de luz, e realiza respiração aeróbica continuamente, na presença e na
ausência de luz. Comparando os dois processos:

Ponto de saturação luminosa

Fotossíntese
2
3 Respiração aeróbica
1

Intensidade luminosa
Na região 1 do gráfico, devido à pequena intensidade luminosa, a atividade respiratória é maior que a fotossintética; assim, a planta
retira oxigênio da atmosfera e libera gás carbônico para a atmosfera. Na região 2 do gráfico, devido à grande intensidade luminosa, a
atividade fotossintética é maior que a respiratória; assim, a planta retira gás carbônico da atmosfera e libera oxigênio para a atmosfera.
O ponto 3 é denominado ponto de compensação fótica. Nesse ponto, respiração e fotossíntese se equivalem, e a planta não retira nem
libera oxigênio ou gás carbônico da atmosfera. Assim, o oxigênio liberado pela fotossíntese é consumido na respiração e o gás
carbônico liberado na respiração é consumido na fotossíntese. Do mesmo modo, a matéria orgânica produzida na fotossíntese é
consumida na respiração, de modo que a planta não pode acumular reservas e crescer. Assim:
- O ponto de compensação fótica caracteriza uma intensidade luminosa tal que a fotossíntese e a respiração se igualam, de modo que
toda matéria orgânica produzida na fotossíntese é consumida na respiração aeróbica, não havendo acúmulo de matéria orgânica, de
modo que o amido armazenado é zero (ponto X).
- O ponto de saturação luminosa caracteriza uma intensidade luminosa a partir da qual a fotossíntese é constante mesmo aumento essa
intensidade, de modo que a produção, e conseqüentemente o acúmulo de matéria orgânica (amido) é máximo e constante (ponto Y).

8.
Resposta: B
Comentário: A planta realiza fotossíntese somente na presença de luz, e realiza respiração aeróbica continuamente, na presença e na
ausência de luz. Comparando os dois processos:

Ponto de saturação luminosa

Fotossíntese
2
3 Respiração aeróbica
1

Intensidade luminosa
Na região 1 do gráfico, devido à pequena intensidade luminosa, a atividade respiratória é maior que a fotossintética; assim, a planta
retira oxigênio da atmosfera e libera gás carbônico para a atmosfera. Na região 2 do gráfico, devido à grande intensidade luminosa, a
atividade fotossintética é maior que a respiratória; assim, a planta retira gás carbônico da atmosfera e libera oxigênio para a atmosfera.
O ponto 3 é denominado ponto de compensação fótica. Nesse ponto, respiração e fotossíntese se equivalem, e a planta não retira nem
libera oxigênio ou gás carbônico da atmosfera. Assim, o oxigênio liberado pela fotossíntese é consumido na respiração e o gás
carbônico liberado na respiração é consumido na fotossíntese. Do mesmo modo, a matéria orgânica produzida na fotossíntese é
consumida na respiração, de modo que a planta não pode acumular reservas e crescer. Assim, interpretando o gráfico:
- A região A representa a área onde há predomínio da atividade de respiração aeróbica (abaixo do ponto de compensação fótica), ou
seja, correspondendo àquela com menor intensidade luminosa; nela, ocorre acúmulo de gás carbônico liberado na respiração aeróbica,
deixando o meio ácido, pela reação do gás carbônico com a água, formando ácido carbônico, e, portanto, de cor amarela (tubo 3)
- A região B representa a área onde as atividades de fotossíntese e respiração aeróbica se igualam (igual à do ponto de compensação
fótica), ou seja, correspondendo àquela com intensidade luminosa intermediária; nela, ocorre equilíbrio entre gás carbônico e oxigênio
liberados e consumidos, resultando num meio neutro, e, portanto, de cor verde (tubo 2).
- A região C representa a área onde há predomínio da atividade de fotossíntese (acima do ponto de compensação fótica), ou seja,
correspondendo àquela com maior intensidade luminosa; nela, ocorre acúmulo de oxigênio e consumo de gás carbônico na
fotossíntese (com diminuição na quantidade de ácido carbônico), resultando num meio básico, e, portanto, de cor azul (tubo 1).
Analisando cada item:
Item A: falso. A letra A do gráfico representa a planta que estava no tubo 3.
Item B: verdadeiro. A letra B do gráfico representa a planta que estava no tubo 2.
Item C: falso. Plantas mantidas no ponto de compensação estão representadas, no gráfico, pela letra B.
Item D: falso. Plantas mantidas no ponto de saturação estão representadas, no gráfico, pela letra C.
Item E: falso. Os tubos 1, 2 e 3 correspondem respectivamente, no gráfico, às letras C, B e A.

9.
Resposta: B
Comentário: A fotossíntese é o mecanismo de produção de matéria orgânica, como a glicose, a partir de gás carbônico, água e
energia luminosa. Assim, analisando cada item:
Item A: falso. Na fase clara da fotossíntese, a qual depende de luz, ocorrem processos de fotofosforilação que produzem ATP e a
fotólise da água que degrada H 2 O em H+, O 2 e elétrons. O H+ reage com moléculas de NADP reduzidas (NADP-) para gerar
NADPH 2 . Na fase escura, utiliza-se o ATP como fonte de energia, o NADPH 2 como fonte de hidrogênios e o CO 2 como fonte de
carbono para a síntese de glicose e outras moléculas orgânicas.
Item B: verdadeiro. Como mencionado no item anterior, a fotólise da água é fonte de H+ para a síntese de NADPH 2 e de O 2 para a
atmosfera.
Item C: falso. O NADPH 2 é fonte de carbono e o ATP é fonte de energia para a conversão do CO 2 em matéria orgânica.
Item D: falso. A luz é fonte de energia para a fotólise ou quebra da água, que, por sua vez, fornece O 2 para a atmosfera.
Item E: falso. A conversão de CO 2 em matéria orgânica consome energia do ATP produzido na fase clara.

10.
Resposta: B
Comentário: As duas fases da fotossíntese são:
(1) Fase clara ou fotoquímica, que ocorre na membrana interna do cloroplasto (e suas dobras, ou seja, lamelas e tilacóides/grana), e
utiliza luz captada pela clorofila, NADP, ADP e água, e produz NADPH 2 , ATP e gás oxigênio. Essa fase engloba três processos:
- Fotofosforilação cíclica, que utiliza o fotossistema I e produz apenas ATP;
- Fotofosforilação acíclica, que utiliza os fotossistemas I e II e produz ATP e NADP- (reduzido);
- Fotólise da água (reação de Hill), que utiliza o fotossistema II e quebra a molécula de água em H+ (que se soma ao NADP- para
formar NADPH 2 ), elétrons (que reduzem a clorofila que perdeu os elétrons por ação da luz) e gás oxigênio.
(2) Fase escura ou química, que ocorre no estroma do cloroplasto, e utiliza NADPH 2 e ATP, provenientes da fase clara, e gás
carbônico, através do ciclo de Calvin, para produzir glicose.
Assim, a redução de NADP+ em NADP- ocorre na fotofosforilação acíclica, que utiliza os dois fotossistemas, ou seja, precisa da
cooperação entre os dois fotossistemas.

11.
Resposta: C
Comentário: A fotossíntese consiste na síntese de compostos orgânicos a partir de compostos inorgânicos (como gás carbônico e
água) e energia luminosa. Assim, analisando cada item:
Item A: falso. A referência a processos passivos e ativos se faz a mecanismos de transporte através da membrana celular, sendo os
passivos a favor de um gradiente de concentração e com liberação de energia (sem gasto de energia, portanto) e os ativos contra um
gradiente de concentração e com consumo de energia. Ainda assim, pode-se argumentar que a fotossíntese consome energia luminosa.
Item B: falso. A fotossíntese é completamente dependente da luz solar, não podendo ocorrer sem a mesma na natureza. A fase clara
da fotossíntese utiliza a luz de modo direto para produzir ATP que será utilizado na fase escura, que não utiliza a luz de modo direto,
mas indireto, porque depende do ATP da fase clara.
Item C: verdadeiro. A fase escura da fotossíntese ocorre com uma reação denominada ciclo de Calvin ou das pentoses, na qual o gás
carbônico reage inicialmente com um composto denominado ribulose-1,5-difosfato através da enzima Rubisco ou Ribulose-Oxidase-
Carboxilase.
Item D: falso. Como mencionado, o ciclo de produção de glicose, nesse processo, é denominado Ciclo de Calvin. O ciclo de Krebs se
relaciona com a oxidação da glicose na respiração aeróbica.
12.
Resposta: A
Comentário: As duas fases da fotossíntese são:
(1) Fase clara ou fotoquímica, que ocorre na membrana interna do cloroplasto (e suas dobras, ou seja, lamelas e tilacóides/grana), e
utiliza luz captada pela clorofila, NADP, ADP e água, e produz NADPH 2 , ATP e gás oxigênio. Essa fase engloba três processos:
- Fotofosforilação cíclica, que produz apenas ATP;
- Fotofosforilação acíclica, que produz ATP e NADP- (reduzido);
- Fotólise da água (reação de Hill), que quebra a molécula de água em H+ (que se soma ao NADP- para formar NADPH 2 ), elétrons
(que reduzem a clorofila que perdeu os elétrons por ação da luz) e gás oxigênio.
(2) Fase escura ou química, que ocorre no estroma do cloroplasto, e utiliza NADPH 2 e ATP, provenientes da fase clara, e gás
carbônico, através do ciclo de Calvin, para produzir glicose.
Assim, durante a etapa fotoquímica da fotossíntese ocorre liberação de oxigênio (a partir da fotólise de água), redução do NADP a
NADP- (na fotofosforilação acíclica), que é posteriormente convertido em NADPH 2 e fotofosforilação do ADP em ATP. A fixação do
carbono em glicose ocorre apenas na fase escura.

13.
Resposta: B
Comentário: A Hipótese da Simbiose de Lynn Margulis defende a origem de mitocôndrias a partir de bactérias aeróbicas
endomutualísticas e a origem de cloroplastos a partir de cianobactérias endomutualísticas. Uma das evidências que sustentam essa
idéia é o fato de que a síntese protéica nos ribossomos bacterianos 70S é inibida pelos mesmos antibióticos que inibem a síntese
protéica nos ribossomos 70S de mitocôndrias e cloroplastos, como ocorre com o cloranfenicol, que não inibe a síntese protéica nos
ribossomos 80S do citoplasma de eucariontes. Outra evidência importante é o DNA circular e desnudo dessas organelas, como ocorre
com células bacterianas. Assim, analisando cada item:
Item A: verdadeiro. Tanto mitocôndrias como cloroplastos possuem DNA circular e desnudo semelhante aos de seres procariontes.
Item B: falso. Somente cloroplastos apresentam tilacóides empilhados em grana.
Item C: verdadeiro. Tanto mitocôndrias como cloroplastos possuem dupla membrana.
Item D: verdadeiro. Tanto mitocôndrias como cloroplastos produzem energia para a célula.

14.
Resposta: B
Comentário: As duas fases da fotossíntese são:
(1) Fase clara ou fotoquímica, que ocorre na membrana interna do cloroplasto (e suas dobras, ou seja, lamelas e tilacóides/grana), e
utiliza luz captada pela clorofila, NADP, ADP e água, e produz NADPH 2 , ATP e gás oxigênio. Essa fase engloba três processos:
- Fotofosforilação cíclica, que produz apenas ATP;
- Fotofosforilação acíclica, que produz ATP e NADP- (reduzido);
- Fotólise da água (reação de Hill), que quebra a molécula de água em H+ (que se soma ao NADP- para formar NADPH 2 ), elétrons
(que reduzem a clorofila que perdeu os elétrons por ação da luz) e gás oxigênio.
(2) Fase escura ou química, que ocorre no estroma do cloroplasto, e utiliza NADPH 2 e ATP, provenientes da fase clara, e gás
carbônico, através do ciclo de Calvin, para produzir glicose.
Assim, fazendo a correta associação:
- A utilização de ATP e NADPH 2 produzidos na fase clara ocorre no ciclo de Calvin (IV), onde ocorre a fixação do gás carbônico em
glicose;
- A produção de ATP e NADP- ocorre na fotofosforilação acíclica (II), sendo NADP- esse convertido em NADPH 2 por ação da
fotólise da água;
- A produção somente de ATP ocorre na fotofosforilação cíclica (III);
- A quebra da molécula d’água ocorre na fotólise da água, também chamada de reação de Hill (I).

15.
Resposta: D
Comentário: A equação representa a fotólise da água, processo que ocorre em organismos fotossintetizantes que utilizam a molécula
de água como doadora de elétrons para reduzir o gás carbônico em moléculas orgânicas, como ocorre com cianobactérias (nas
membranas dos cromatóforos) e plantas e algas (nos tilacóides dos cloroplastos).

16.
Resposta: A
Comentário: Analisando os processos de fotossíntese e respiração, observa-se que eles têm em comum a utilização de citocromos
como transportadores de elétrons liberando energia para a geração de ATP. Na fotossíntese, esses elétrons são provenientes da água e
da clorofila e excitados a partir da energia luminosa, produzindo ATP na fotofosforilação da fase clara; na respiração aeróbica, esses
elétrons são provenientes de moléculas orgânicas ricas em energia, como a glicose, e utilizados na síntese de ATP ao nível da cadeia
respiratória.
17.
Resposta: B
Comentário: Analisando cada item:
Item I: verdadeiro. Cloroplastos são as organelas responsáveis pela fotossíntese, tendo origem endossimbiótica a partir de
cloroplastos, e por isso possuem DNA próprio, o qual codifica enzimas que produzem a clorofila, presente na membrana interna, em
lamelas e tilacoides. Mutações no DNA dos cloroplastos podem levar à incapacidade de acumular a clorofila, o que inviabiliza o
processo fotossintético.
Item II: falso. Como plastos têm DNA próprio, possuem capacidade de autoduplicação, se originando a partir de outros plastos. De
modo geral, um plasto se divide em novos plastos, chamados protoplastos, os quais podem ser leucoplastos para reserva ou
cromoplastos para fotossíntese. Mesmo plenamente formado, um plasto pode se transformar em outro pelo acúmulo de nutrientes e/ou
síntese de pigmentos fotossintetizantes.
Item III: falso. O cloroplasto apresenta duas membranas lipoproteicas, sendo que a membrana interna apresenta invaginações
denominadas lamelas, que por sua vez formam bolsas chamadas tilacoides, que se organizam em pilhas chamadas grana (singular:
granum). Na bicamada lipídica da membrana interna (incluindo lamelas e tilacoides), encontra-se a clorofila. No interior das bolsas e
por dentro da membrana interna, ocorre uma massa protoplasmática denominada estroma, com DNA, RNA e ribossomos. Em folhas
brancas devido a mutações, ocorrem ribossomos normalmente, mas não há produção de clorofila.
Item IV: verdadeiro. Nas regiões brancas das folhas não há clorofila, não ocorrendo a etapa fotoquímica da fotossíntese, que
compreende fotofosforilação cíclica, fotofosforilação acíclica e fotólise da água. A ação da clorofila pode ser resumida na conversão
de luz em energia química: a luz excita elétrons do átomo de magnésio da clorofila, os quais abandonam a clorofila e percorrem uma
cadeia transportadora de elétrons liberando energia para produzir ATP.

18.
Resposta: A
Comentário: O principal pigmento fotossintetizante é a clorofila, que, por ser verde, não aproveita esse comprimento de onda na
fotossíntese. Existem, no entanto, pigmentos acessórios capazes de aproveitar o comprimento de onda da luz equivalente ao verde,
como é o caso de xantofilas amarelas e do caroteno laranja. Assim, analisando cada item:
Item I: verdadeiro. Como mencionado, a clorofila é verde e o caroteno é laranja.
Item II: verdadeiro. Os melhores comprimentos de onda da luz para a clorofila são o vermelho e o violeta, sendo o pior deles o
verde, que é refletido.
Item III: falso. Como mencionado, o caroteno é laranja e as xantofilas são amarelas.
Item IV: falso. Por ser verde, a clorofila reflete o verde, que não é aproveitado por ela na fotossíntese, e por ser laranja, o caroteno
reflete o laranja, que não é aproveitado por ele na na fotossíntese.

19.
Resposta: C
Comentário: Analisando cada item:
Item A: falso. A absorção de luz na fotossíntese se dá pelas moléculas de clorofila encontradas na membrana interna do cloroplasto, a
qual origina estruturas como lamelas, tilacoides e grana responsável pela fase clara do processo fotossintético; a membrana interna do
cloroplasto delimita um espaço interno denominado estroma, onde ocorrem as enzimas da fase escura da fotossíntese, relacionadas à
produção de glicose.
Item B: falso. Quando a luz incide na clorofila, excita elétrons do átomo de magnésio presente em sua estrutura. Esses elétrons
abandonam a clorofila e percorrem uma sequência de aceptores de elétrons, liberando energia para gerar ATP. No processo conhecido
como fotofosforilação cíclica, após percorrerem os aceptores, os elétrons retornam à clorofila de onde saíram; no processo conhecido
como fotofosforilação acíclica, após percorrerem os aceptores, os elétrons não retornam à clorofila de onde saíram, passando para a
molécula de NADP, o qual é reduzido e forma NADPH (NADPH 2 ), que por sua vez é a fonte de hidrogênios para a produção de
glicose a partir do gás carbônico.
Item C: verdadeiro. Fotossistemas são conjuntos de pigmentos fotossintetizantes e aceptores de elétrons relacionados com a captação
da luz e a geração de ATP, sendo que a fotofosforilação cíclica utiliza somente o fotossistema I, dotado de clorofila a P700 e
produzindo somente ATP, e a fotofosforilação acíclica utiliza o fotossistema I, dotado de clorofila a P700, e o fotossistema II, dotado
de clorofila a P680, ambos agindo em conjunto para a produção de ATP e a formação de NADPH (NADPH 2 ).
Item D: falso. Como mencionado, o NADPH (NADPH 2 ) produzido na etapa luminosa (fotoquímica) da fotossíntese cede hidrogênios
para a produção de glicose a partir do gás carbônico na fase escura.
Item E: falso. A fixação do carbono é o mecanismo que converte o gás carbônico em matéria orgânica e ocorre através do ciclo de
Calvin na fase escura.

20.
Resposta: C
Comentário: Os cloroplastos são organelas responsáveis pela fotossíntese, sendo formadas por duas membranas, com um espaço
intermembrana entre elas. A membrana interna apresenta clorofila em sua estrutura, sendo capaz de captar luz para a fotossíntese, e
sofre uma série de invaginações, formando projeções denominadas lamelas, que formam pequenos sacos achatados denominados
tilacóides e agrupados em pilhas denominadas grana (singular: granum). A membrana interna também delimita um espaço contendo
uma massa amorfa denominada estroma, contendo água, sais minerais, várias enzimas, DNA circular e desnudo (sem histonas
associadas), RNA e ribossomos 70S, sendo responsável pela fixação do gás carbônico em glicose, o que é feito com a energia química
produzida a partir da luz. Analisando a figura, temos que:
- 1 é a membrana externa;
- 2 é a membrana interna;
- 3 é o estroma;
- 4 é um granum.

21.
Resposta: B
Comentário: Equinócio é o dia do ano em que a duração do dia (período iluminado) é igual à da noite (período escuro). Solstício de
verão é o dia do ano em que a duração do dia é a maior possível no ano (com a noite mais curta do ano) e solstício de inverno é o dia
do ano em que a duração do dia é a menor possível no ano (com a noite mais longa do ano), sendo que, quando é solstício de verão no
hemisfério norte, é solstício de inverno no hemisfério sul e vice-versa. Assim, analisando cada item:
Item A: falso. Como a planta faz respiração de dia e de noite, e fotossíntese só durante o dia, nunca a planta passará mais horas
fazendo fotossíntese que respirando. No solstício de verão, com a maior duração do dia, tem-se o dia do ano onde a planta passará
mais tempo fazendo fotossíntese, mas ainda assim a respiração ocorrerá por mais tempo.
Item B: verdadeiro. Se a planta do hemisfério sul está em solstício de verão, a planta no hemisfério norte está em solstício de
inverno, de modo que a planta do hemisfério sul recebe mais tempo de luz e passará mais passará mais horas fazendo fotossíntese do
que a planta do hemisfério norte.
Item C: falso. Nos equinócios de primavera e verão, a duração dos dias (12 horas) é igual à duração das noites (12 horas), de modo
que a duração dos dias é idêntica, a as plantas passarão igual número de horas fazendo fotossíntese.
Item D: falso. Nos equinócios, as plantas não passarão 24 horas fazendo fotossíntese, uma vez que nos períodos de noite não há
fotossíntese. Em qualquer época do ano as plantas passarão mais horas respirando que em atividade fotossintética, uma vez que a
respiração ocorre de dia e de noite e a fotossíntese só ocorre de dia.
Item E: falso. Nos equinócios, as passarão 12 horas fazendo fotossíntese (só de dia) e 24 horas respirando (de dia e de noite).

22.
Resposta: A
Comentário: A fotossíntese emprega a clorofila para captar energia luminosa e convertê-la em energia química, a qual será
armazenada em moléculas orgânicas como a glicose. A clorofila é um pigmento verde, e por isso incapaz de absorver luz nesse
comprimento de onda, que é refletido. A fotossíntese só não é nula com a luz verde porque existem outros pigmentos
fotossintetizantes, chamados acessórios, que captam a luz verde, como as xantofilas. Apesar delas, a fotossíntese com luz verde é de
intensidade bastante reduzida. No experimento descrito, a planta foi iluminada com luz verde no período I, sendo a luz refletida, de
modo que as folhas ficam verdes e a fotossíntese é mínima (só ocorrendo devido aos pigmentos acessórios). No período II, a planta foi
iluminada com luz laranja-avermelhada, que é absorvida pela clorofila, de modo que as folhas ficam escuras (negras) e a fotossíntese é
mais eficiente.

23.
Resposta: C
Comentário: Os plastos ou plastídeos são organelas formadas por duas membranas, com um espaço intermembrana entre elas, sendo
que a membrana interna delimita um espaço contendo uma massa amorfa denominada estroma, contendo água, sais minerais, várias
enzimas, DNA circular e desnudo (sem histonas associadas), RNA e ribossomos 70S. Quando um plasto se auto-duplica, origina um
pró-plasto ou pró-plastídeo, que pode originar leucoplastos ou cromoplastos.
- Os leucoplastos não possuem pigmentos fotossintetizantes e têm função de armazenamento, podendo ser oleoplastos (com óleo),
amiloplastos (com amido) ou proteoplastos (com proteínas).
- Os cromoplastos possuem pigmentos fotossintetizantes e realizam a fotossíntese, sendo os principais os cloroplastos, contendo o
pigmento clorofila, de cor verde, e ocorrendo em algas clorofíceas e vegetais.
Assim, o amido é armazenado, em nível celular, no interior (estroma) de leucoplastos denominados amiloplastos, formandos pela
modificação de cloroplastos.

24.
Resposta: B
Comentário: O tubo no qual a cor da solução se modifica mais rapidamente de vermelha para roxa é aquele com menor concentração
de gás carbônico, ou seja, onde ocorre maior consumo de gás carbônico, o que por sua vez implica naquele com maior taxa de
fotossíntese. O tubo III contém apenas caramujos, os quais não fazem fotossíntese, de modo a liberar gás carbônico na respiração e,
com isso, tornar maior a concentração de gás carbônico. O tubo IV tem algas e caramujos, de modo que o gás carbônico consumido na
fotossíntese das algas é liberado pela respiração das algas e dos caramujos. Os tubos I e II possuem somente algas, que fazem
fotossíntese e respiração, sendo a fotossíntese mais intensa, de modo a ocorrer consumo de gás carbônico e menor concentração desse
gás. Como o tubo I é iluminado por luz amarela, que segundo o gráfico proporciona uma pequena intensidade de fotossíntese, e o tubo
II é iluminado por luz azul, que segundo o gráfico proporciona uma grande intensidade de fotossíntese, o maior consumo de gás
carbônico, com menor teor desse gás e maior tendência a tornar o meio roxo é o do tubo II.

25.
Resposta: D
Comentário: Observe que, ao fixar a concentração (C) e alterar a intensidade luminosa (I), pode-se observar o efeito da intensidade
luminosa na intensidade da fotossíntese (T). Na concentração C2, tanto com a intensidade I1 como com a intensidade I2, a intensidade
da fotossíntese de mantém constante em T2, mostrando que, com a intensidade I1, já ocorre saturação da fotossíntese, pois mesmo
com o aumento da intensidade luminosa para I2, a intensidade da fotossíntese não aumenta. Observe que, ao fixar a intensidade
luminosa (I) a alterar a concentração de CO 2 (C), pode-se observar o efeito da concentração de CO 2 na intensidade da fotossíntese (T).
Como a intensidade I1 já satura para a luminosidade, qualquer aumento de intensidade da fotossíntese a partir de I1 é provocada pelo
aumento da concentração de CO 2 , podendo ser percebido que a partir da concentração C3, a intensidade da fotossíntese estabiliza em
T3 (mesmo aumentando a concentração para C4), caracterizando o ponto de saturação.

26.
Resposta: B
Comentário: A fotossíntese produz matéria orgânica a partir de matéria inorgânica utilizando a luz como fonte de energia. A
quimiossíntese, no entanto, produz matéria orgânica a partir de matéria inorgânica utilizando a energia proveniente da oxidação de
compostos inorgânicos. Em ecossistemas oceânicos de grandes profundidades, não ocorre luz para a fotossíntese, de modo que a
formação de matéria orgânica só pode se dar por quimiossíntese, processo que ocorre exclusivamente em algumas bactérias
autotróficas.

27.
Resposta: B
Comentário: O processo de respiração aeróbica consome matéria orgânica e oxigênio para produzir gás carbônico, água e energia. A
respiração não é afetada pela luminosidade. O processo de fotossíntese consome gás carbônico e água para produzir matéria orgânica e
oxigênio, sendo a luz a fonte de energia. Quanto maior a intensidade luminosa, maior a atividade fotossintética, sendo maior o
consumo de gás carbônico e a produção de oxigênio. No início do teste, há uma determinada quantidade de oxigênio na água, o qual
vai diminuindo, indicando consumo de oxigênio, o que ocorre na respiração, e indicando que não há fotossíntese (se não o oxigênio
estaria sendo produzido e aumentaria). Assim, se no início do teste há respiração, mas não fotossíntese, não ocorre luz, de modo que
deve ser meia noite. Por volta de 6 horas da manhã, com o nascer do sol, a fotossíntese começa a ocorrer, de modo que o oxigênio
passa a ser produzido e aumenta de teor até meio dia, quando a luminosidade é máxima, e é máxima a liberação de oxigênio.
Observação: Se a escala de tempo da experiência fosse de 24 horas, e não de 12 horas, faria sentido a experiência ter iniciado meio
dia. Com o teor de gás carbônico mais baixo (indicando alto consumo desse gás) e o teor de oxigênio mais elevado (indicando alta
produção desse gás), poderia se afirmar que a atividade fotossintética estava a mais intensa possível, ou seja, a intensidade luminosa
era a mais elevada possível, o que ocorre, ao longo do dia, ao meio-dia. Aí, à meia-noite, sem luz, o teor de oxigênio seria mínimo
porque, sem luz, haveria somente respiração que consome o oxigênio, e ao meio-dia seguinte (24 horas após o início do experimento),
a fotossíntese seria novamente máxima e o teor de oxigênio seria novamente máximo. Como a escala de tempo é de 12 horas, não
faria sentido pensar desse jeito porque, com o experimento iniciando meio dia, terminaria 12 horas depois, ou seja, meia-noite, e não
faria sentido o oxigênio ter aumentado à meia-noite porque não há luz ou fotossíntese.

28.
Resposta: B
Comentário: Como a fotofosforilação cíclica produz apenas ATP, e não produz NADPH, pode-se concluir que o processo
esquematizado é a fotofosforilação acíclica, que produz ATP e NADPH.
- A torre maior representa o fotossistema I, cuja clorofila a P700 cede elétrons para o NADP+, que é reduzido em NADP- para formar
NADPH 2 .
- A torre menor representa o fotossistema II, cuja clorofila a P680 cede elétrons para repor os elétrons da clorofila a P700 oxidada no
fotossistema I.
- A roleta representa a cadeia transportadora de elétrons, constituída de citocromos, que utiliza a energia dos elétrons para a síntese de
ATP.
- O operário no solo representa a fotólise da água, na qual a molécula de água é quebrada, liberando elétrons para repor os elétrons da
clorofila a P680 oxidada no fotossistema II.
Analisando cada item:
Item A: verdadeiro. Os operários no topo das torres podem estar representando os aceptores primários de elétrons, do fotossistema II
na torre menor e do fotossistema I na torre maior.
Item B: falso. A torre menor corresponde ao fotossistema II e a torre maior ao fotossistema II.
Item C: verdadeiro. A torre maior, que representa o fotossistema I, recebe elétrons de baixa energia para recompor os elétrons
energizados pela luz que foram transferidos para reduzir o NADP+, que é reduzido em NADP-.
Item D: verdadeiro. A roleta corresponde à cadeia transportadora de elétrons que utiliza a energia dos elétrons para a síntese de ATP.
Item E: verdadeiro. O operário no solo representa a fotólise da água, que quebra a molécula de água, liberando elétrons.
29.
Resposta: B
Comentário: Na fotofosforilação acíclica, os elétrons liberados pela fotólise da água são transferidos para a clorofila a P680 oxidada
do fotossistema II, e daí para a clorofila a P700 oxidada do fotossistema I, e daí para o NADP+, que forma NADPH 2 , que é utilizado
no ciclo de Calvin para a síntese de glicose.

30.
Resposta: E
Comentário: A fotossíntese pode ser representada pela equação geral abaixo:
CO 2 + H 2 O → C 6 H 12 O 12 + O 2
Assim, a fotossíntese consome água em sua reação. Desse modo, em alta taxa de fotossíntese, uma grande quantidade de água é
consumida, e uma baixa percentagem de papéis de cobalto mudam de azul para a rosa indicando hidratação, o que corresponde às
folhas I, II e IV. Já em baixas taxas de fotossíntese, uma pequena quantidade de água é consumida, acumulando água devido à
atividade respiratória que produz água, e uma alta percentagem de papeis de cobalto mudam de azul para a rosa indicando hidratação,
o que corresponde às folhas III e V.

31.
Resposta: B
Comentário: Todo gás oxigênio liberado na fotossíntese é proveniente da fotólise da água. Assim, ao marcar a molécula de água com
o isótopo pesado de 18 O, observa-se que todo o gás oxigênio liberado apresentará esse isótopo, de modo que a reação II está correta,
confirmando que o O 2 é proveniente da H 2 O.

32.
Resposta: E
Comentário: Para uma dada temperatura, quanto maior a luminosidade, maior a atividade fotossintética, o que ocorre até o ponto de
saturação luminosa, a partir do qual a taxa de fotossíntese passa a ser constante. Para uma dada luminosidade, quanto maior a
temperatura, maior a atividade fotossintética, o que ocorre até o ponto de desnaturação, a partir do qual a taxa de fotossíntese passa a
diminuir pela desnaturação das enzimas. Assim, analisando cada item:
Item I: verdadeiro. Plantas heliófilas (“de sol”) são adaptadas a altas luminosidades e plantas umbrófilas (“de sombra”) são
adaptadas a baixas luminosidades. Como o mogno tem alta taxa fotossintética nas intensidades luminosas testadas, deve ser uma
planta heliófila.
Item II: verdadeiro. Pelos gráficos, a acariquara atinge o ponto de saturação luminosa numa intensidade luminosa menor que a do
mogno.
Item III: verdadeiro. Em altas temperaturas, a taxa fotossintética diminui devido à desnaturação das enzimas.
Item IV: verdadeiro. Como a acariquara tem taxas fotossintéticas menores que a do mogno em todos os parâmetros, pode ser
considerada umbrófila.

33.
Resposta: A
Comentário: Todo gás oxigênio liberado na fotossíntese é proveniente da fotólise da água, que se dá na fase clara. Assim, quanto
maior a intensidade da fotólise da água/fase clara da fotossíntese, maior será sua liberação de gás oxigênio. No experimento de
Engelmann, as bactérias aeróbicas se agrupam nas regiões da alga que mais fazem fotossíntese e, conseqüentemente, mais liberam gás
oxigênio, equivalentes às cores azul e vermelho.

34.
Resposta: B
Comentário: A captação da energia da luz do sol é possível através de pigmentos fotossintetizantes, sendo o principal deles a
clorofila, substância lipídica associada ao magnésio e de cor verde. A luz excita elétrons do magnésio da clorofila, que abandonam a
molécula e percorrem uma cadeia de citocromos, liberando energia a ser utilizada na síntese de ATP. Esse ATP é então utilizado na
síntese de moléculas orgânicas, como a glicose. Durante o processo de fotossíntese, a ação da luz sobre a clorofila libera elétrons que
são capturados por uma cadeia transportadora, onde há transferência dos elétrons entre moléculas organizadas em ordem decrescente
de energia, de modo a liberar energia para a síntese de ATP.

35.
Resposta: D
Comentário: Os plastos ou plastídeos são organelas formadas por duas membranas, com um espaço intermembrana entre elas, sendo
que a membrana interna delimita um espaço contendo uma massa amorfa denominada estroma, contendo água, sais minerais, várias
enzimas, DNA circular e desnudo (sem histonas associadas), RNA e ribossomos 70S. Quando um plasto se auto-duplica, origina um
pró-plasto ou pró-plastídeo, que pode originar leucoplastos ou cromoplastos.
- Os leucoplastos não possuem pigmentos fotossintetizantes e têm função de armazenamento, podendo ser oleoplastos (com óleo),
amiloplastos (com amido) ou proteoplastos (com proteínas).
- Os cromoplastos possuem pigmentos fotossintetizantes e realizam a fotossíntese, sendo os principais os cloroplastos, contendo o
pigmento clorofila, de cor verde, e ocorrendo em algas clorofíceas e vegetais.
Assim, leucoplastos têm papel de armazenamento de substâncias de reserva energética, como o amido nos amiloplastos.

36.
Resposta: VFVFV
Comentário: Analisando cada item:
1º item: verdadeiro. Fotossistemas são constituídos de um complexo de antena, constituído clorofilas e pigmentos acessórios, por um
centro de reação, constituído de clorofila a, e pelos aceptores de elétrons e citocromos.
2º item: falso. O centro de reação do fotossistema I é a clorofila a P700, que age na fotofosforilação cíclica e na acíclica, e o centro de
reação do fotossistema II é a clorofila a P680, que age na fotofosforilação acíclica e na fotólise da água.
3º item: verdadeiro. A fotólise da água se dá no fotossistema II e a redução do NADP+ em NADP- se dá no fotossistema I.
4º item: falso. Apesar de a fase escura, onde ocorre a fixação do carbono, não precisar de luz para ocorrer, ela pode ocorrer na
presença de luz.
5º item: verdadeiro. A clorofila a é o centro de reação do fotossistema, sendo responsável por ceder elétrons para a produção de
energia química na forma de ATP.

37.
Resposta: FFVFV
Comentário: A fase A representa a fase clara da fotossíntese, onde ocorre a utilização de luz, enquanto que a fase B representa a fase
escura da fotossíntese, onde ocorre o ciclo de Calvin. Analisando cada item:
1º item: falso. A fotólise da água e a geração de ATP e NADPH ocorrem na fase clara da fotossíntese (fase A).
2º item: falso. A fixação do carbono em glicose ocorre no ciclo de Calvin, que ocorre na fase escura da fotossíntese (fase B).
3º item: verdadeiro. A fase clara da fotossíntese ocorre em regiões como os tilacóides (grana), onde ocorre a fotólise da água, que
quebra a molécula de água, gerando oxigênio como subproduto.
4º item: falso. A fase clara da fotossíntese produz moléculas ricas em energia, como ATP e NADPH, que são utilizadas na fase
escura, no ciclo de Calvin ou das pentoses, que ocorre no estroma, para converter gás carbônico em moléculas de glicose. A liberação
de oxigênio ocorre como subproduto da fase clara da fotossíntese, que ocorre em regiões como os tilacóides (grana).
5º item: verdadeiro. Na fotofosforilação acíclica, que ocorre na fase clara da fotossíntese, os elétrons perdidos pela molécula de
clorofila, são repostos pelos elétrons liberados na fotólise da água.

38.
Resposta: FVFVV
Comentário: Analisando cada item:
1º item: falso. O ciclo de Calvin ou das pentoses se dá na fase escura da fotossíntese, que ocorre no estroma dos cloroplastos, se dá
com a incorporação de 6 moléculas de gás carbônico, as quais reagem com 6 moléculas de ribulose-1,5-difosfato, formando 12
moléculas de PGA (ácido fosfoglicérico). Cada molécula de gás carbônico entra de cada vez no ciclo, que se inicia então pela reação
de 1 molécula de gás carbônico com 1 molécula de ribulose-1,5-difosfato.
2º item: verdadeiro. O NADPH 2 proveniente da fase clara da fotossíntese age como agente redutor do gás carbônico, fornecendo
elétrons em átomos de hidrogênio para a formação da glicose.
3º item: falso. No ciclo de Calvin, a conversão de PGA (ácido fosfoglicérico) em PGAL (gliceraldeído-3-fosfato ou aldeído
fosfoglicérico) envolve a incorporação de elétrons em átomos de hidrogênio provenientes do NADPH 2 , sendo um processo de
redução, e não de oxidação.
4º item: verdadeiro. No ciclo de Calvin, 6 moléculas de gás carbônico reagem com 6 moléculas de ribulose-1,5-difosfato, formando
12 moléculas de PGA (ácido fosfoglicérico), que formam 12 moléculas de PGAL (gliceraldeído-3-fosfato ou aldeído fosfoglicérico);
dessas 12 moléculas de PGAL, 2 delas (equivalentes a 6 átomos de carbono, pois se trata de uma triose) forma uma hexose (frutose, e
depois glicose), e as 10 restantes (equivalentes a 30 átomos de carbono, pois se trata de uma triose) formarão 6 moléculas de ribulose-
1,5-difosfato (equivalentes a 30 átomos de carbono, pois se trata de uma pentose) e reiniciam o ciclo. Desse modo, se 10 moléculas de
PGAL reconstituem 6 moléculas de ribulose-1,5-difosfato, pode-se afirmar proporcionalmente que 5 moléculas de PGAL
reconstituem 3 moléculas de ribulose-1,5-difosfato.
5º item: verdadeiro. Como descrito acima, em cada ciclo de Calvin, é produzido uma triose, denominada PGAL (gliceraldeído-3-
fosfato ou aldeído fosfoglicérico), que age como precursor utilizado pela célula na produção de glicose.

39.
Resposta:
A) O principal pigmento fotossintetizante é a clorofila, que, por ser verde, não aproveita esse comprimento de onda na fotossíntese.
Existem, no entanto, pigmentos acessórios capazes de aproveitar o comprimento de onda da luz equivalente ao verde, como é o caso
de xantofilas amarelas e do caroteno laranja. Assim, no vaso 1, com a luz branca, todos os comprimentos de onda são aproveitados, e,
consequentemente, a atividade fotossintética e o crescimento das plantas é maior que no vaso 2, com luz verde, que é pouco
aproveitada pela fotossíntese por ser refletida pela clorofila, promovendo uma pequena eficiência de fotossíntese e um menor
crescimento.
B) A clorofila é o pigmento mais abundante na folha, sendo incapaz de absorver o comprimento de onda correspondente ao verde
quando iluminado com luz branca, sendo esse verde refletido.

40.
Resposta:
A) Ponto de compensação fótico (PCF) é um ponto de luminosidade tal em que fotossíntese e respiração se igualam, de modo que
todo O 2 produzido na fotossíntese é consumido na respiração, e todo CO 2 produzido na respiração é consumido na fotossíntese.
Assim:
A1) Abaixo do PCF, a respiração é mais intensa do que a fotossíntese, de modo que a planta estará consumindo O 2 e liberando CO 2 , o
qual será coletado no equipamento.
A2) Acima do PCF, a fotossíntese é mais intensa do que a respiração, de modo que a planta estará consumindo CO 2 e liberando O 2 , o
qual será coletado no equipamento.
B) Três fatores principais influenciam a fotossíntese, sendo eles a intensidade luminosa, a temperatura e a concentração de gás
carbônico. Como as condições de temperatura e de exposição à luz são idênticas, o fator que deve ter variado deve ter sido a
disponibilidade de gás carbônico.
Observação: Como houve fotossíntese, o gás cujo teor aumentou na experiência do item B é o gás oxigênio, que é produzido na
fotossíntese em quantidades progressivamente maiores com o aumento da mesma.

41.
Resposta:
A) Enquanto o aquário é iluminado (amostra 1), a atividade de fotossíntese das algas consome o gás carbônico, tornando o meio
menos ácido (mais básico), com maior pH e coloração azul; quando o aquário é mantido no escuro (amostra 2), não ocorre
fotossíntese, e a atividade de respiração de algas e peixes libera gás carbônico, tornando o meio mais ácido, com menor pH e
coloração amarela.
B) Considerando que a atividade de decomposição (amostra 3) envolve mecanismos de respiração aeróbica por parte dos
decompositores, o gás carbônico liberado tornará o meio ácido, com menor pH e coloração amarela.

42.
Resposta:
A) No ciclo vital de uma angiosperma as fases heterotróficas são representadas pelos gametófitos (tubo polínico e saco embrionário)
dependentes do esporófito verde e autótrofo e pelo embrião no interior da semente. Este é nutrido pelo endosperma ou albúmen.
B) Durante a germinação, o consumo de alimento através da respiração supera a fotossíntese. Nesta fase o vegetal jovem consome as
reservas acumuladas na semente. Durante o crescimento, e na fase adulta, a produção de matéria orgânica pela fotossíntese é maior do
que o consumo pela respiração. Desta forma o vegetal pode acumular matéria e crescer.

43.
Resposta:
A) Observe o gráfico adiante:

B) O valor provável para o ponto de compensação fótico é, aproximadamente, 5 unidades de intensidade luminosa.

44.
Resposta:
A) a, pois em intensidade luminosa mais baixa já atinge seu ponto de compensação fótica.
B) PCF: igualam o O 2 produzido com o consumido e o CO 2 produzido com o consumido, uma vez que a fotossíntese iguala à
respiração. PSL: atingem a produção máxima de O 2 e o consumo máximo de CO 2 , uma vez que a fotossíntese atinge sua intensidade
máxima.

45.
Resposta: O intermediário é o 3-fosfoglicerato. Ele é a única substância que deixa de ser degradada, aumentando de concentração
enquanto houver ribulose-1,5-difosfato.

46.
Resposta: Em alta intensidade de luz, devido ao risco de a clorofila ser destruída (lembre-se que o excesso de luz destrói a clorofila),
os cloroplastos se empilham em posição paralela a luz para diminuir a superfície de exposição à mesma e assim minimizar a
destruição das moléculas de clorofila. Em baixa intensidade de luz, os cloroplastos se organizam numa monocamada perpendicular à
luz para aumentar a superfície de exposição a ela, e assim melhor captar a luz de baixa intensidade.

47.
Resposta:
A) 3: clorofila; 7: complexo antena
B) centro de reação: clorofila a P700; aceptor: ferredoxina
C) 4: oxidação; 5: redução.

48.
Resposta:
A) A fotossíntese, e consequentemente a produção de O 2, é mais intensa com luz vermelha e azul e menos intensa com luz verde.
B) A: O 2 com O18 e glicose com O16
B: O 2 com O16 e glicose com O18
C) Falta de água; água é um dos substratos para a fotossíntese.

49.
Resposta:
Primeiro: A fotossíntese produz glicose, que é usada para a produção de ATP a partir da respiração. (É importante lembrar que a
energia da fotossíntese não pode ser armazenada diretamente como ATP, uma vez que este é muito pesado: assim, a glicose armazena
mais energia em menos peso; além disso, a membrana do plasto não é permeável ao ATP, que não pode sair do plasto para ser
distribuído pela planta.).
Segundo: Não há fotossíntese de noite, uma vez que não há luz. Assim, nos períodos de escuro, a respiração é a única fonte de energia.
Terceiro: Nem todas as partes da planta são iluminadas. Assim, essas partes recebem a glicose das áreas iluminadas fotossintetizantes
e fazem respiração para a produção de energia.

50.
Resposta:

51.
Resposta: Ô figura ridícula!!!
A)
I – célula animal (ausência de parede celular, cloroplastos e vacúolo de suco celular)
II – célula vegetal (presença de parede celular, cloroplastos e vacúolo de suco celular)
III – célula procariótica/bacteriana (presença de parede celular e ausência de carioteca; perceba que o material genético está disperso
diretamente no citoplasma,a o que caracteriza um nucleóide)
B) A célula animal respiradora aeróbica precisa de oxigênio liberado pela fotossíntese realizada pela célula vegetal.
C) Bactérias e células vegetais têm parede celular em suas células.
D) Vírus são parasitas intracelulares obrigatórios, não possuindo metabolismo próprio e conseqüentemente precisando do
metabolismo da célula hospedeira para se reproduzir.

52.
Resposta: Não há fluorescência porque os elétrons excitados são transferidos para a cadeia de transportadores de elétrons, não
retornando diretamente para a clorofila.

53.
Resposta: Pensou um bocado, né? Espero que tenha conseguido achar a resposta correta. Lá vai: a clorofila não é o único pigmento
fotossintetizante capaz de absorver energia luminosa. Apesar de nos pontos marcados a absorção de luz pela clorofila ser baixa a
atividade fotossintética é alta porque outros pigmentos devem ser adequados à absorção desses comprimentos de onda. (Aliás, é para
isso que servem os pigmentos acessórios, para absorver comprimentos de onda de luz os quais a clorofila não capta bem).

54.
Resposta: A equação apresentada poderia representar a fotossíntese das plantas, bastando para tal substituir o átomo de enxofre pelo
átomo de oxigênio. Então, por analogia o oxigênio (O 2 ) gerado pelas plantas seria cedido pela água.

55.
Resposta: Na 1ª etapa, apenas foi executada a fase luminosa da fotossíntese, quando são produzidos ATP e NADPH‚ necessários à
fixação do CO 2 em glicose. Não tendo havido fixação do CO 2 (ausente), o ATP e o NADPH‚ acumularam-se e foram utilizados no
início da 2ª etapa, após a adição de 14-CO 2 (aumento na velocidade de incorporação do 14-CO 2 em glicose). Como o ATP e o
NADPH‚ não são sintetizados pelo cloroplasto, na ausência de luz, observou-se posterior decréscimo na velocidade de fixação do 14-
CO 2.

56.
Resposta:
A)
No intervalo de tempo entre T1 e T3, a razão (O 2 consumido)/( O 2 produzido) é maior do que 1 e a razão (CO 2 consumido)/(CO 2
produzido) é menor do que 1.
No instante T3, a razão (O 2 consumido)/(O 2 produzido) é, aproximadamente, igual a 1, o mesmo ocorrendo com a razão (CO 2
consumido)/(CO 2 produzido).
B) Durante a fase iluminada, as folhas acumularam carboidratos pelo fato de o processo de fotossíntese (O 2 produzido e CO 2
consumido) predominar sobre o de respiração (O 2 consumido e CO 2 produzido). A queda da concentração de carboidratos entre T1 e
T3 é uma indicação de que o processo de respiração predomina sobre o de fotossíntese. No tempo T3, ocorre o ponto de compensação
e, após este tempo, o processo de fotossíntese predomina sobre o de respiração, aumentando, portanto, a concentração de carboidratos
nas folhas.

57.
Resposta: A espécie B, pois o pigmento ficoeritrina absorve melhor a luz azul-esverdeada que penetra em águas profundas.

58.
Resposta:
59.
Resposta:
A) clorofila, pois se trata de uma clorofícea (alga verde).
B) Porphyra, pois aproveita melhor os comprimentos de onda correspondentes ao azul e ao verde, que são os que penetram mais
profundamente.

60.
Resposta:
A) armazenamento.
B) amarelo e vermelho, respectivamente.
C) sem pigmentos, a planta não faz fotossíntese e não obtém nutrientes.
1.
Resposta: E
Comentário: Todas as células somáticas de um organismo têm o mesmo material genético, uma vez que se formam por mitose (sem
variabilidade genética) do zigoto, mas a diferenciação celular as deixa com formas e funções específicas devido à expressão de genes
diferentes. A especialização ou diferenciação celular é resultado da ativação ou inativação de genes por, respectivamente,
desespiralização ou espiralização do DNA. Assim, genes ativos são encontrados em áreas de eucromatina e genes inativos em áreas de
heterocromatina. Devido à especialização celular, em cada um dos tipos celulares distintos de um organismo, os genes são os mesmos,
mas os genes que se expressam são diferentes, ou seja, são transcritos diferentemente de acordo com cada necessidade.

2.
Resposta: C
Comentário: Todas as células somáticas de um organismo têm o mesmo material genético, uma vez que se formam por mitose (sem
variabilidade genética) do zigoto, mas a diferenciação celular as deixa com formas e funções específicas devido à expressão de genes
diferentes. A especialização ou diferenciação celular é resultado da ativação ou inativação de genes por, respectivamente,
desespiralização ou espiralização do DNA. Assim, genes ativos são encontrados em áreas de eucromatina e genes inativos em áreas de
heterocromatina.
Desse modo, analisando cada item:
Item I: verdadeiro. Cada célula apresenta um conjunto de genes ativos na forma de eucromatina e um conjunto de genes inativos na
forma de heterocromatina, originando a especialização celular.
Item II: verdadeiro. Apesar de todas as células somáticas de um indivíduo possuírem os mesmos genes, elas apresentam diferentes
conjuntos de genes ativos e inativos, expressando genes diferentes.
Item III: falso. Como as células somáticas de um indivíduo adulto são formadas por mitoses (sem variabilidade genética) a partir do
zigoto, todas elas possuem os mesmos genes entre si e em relação ao zigoto.

3.
Resposta: C
Comentário: A punção das vilosidades coriônicas consiste na coleta de células do feto na placenta em formação para a montagem de
seu cariótipo, exame que analisa quantitativa e qualitativamente os cromossomos de um indivíduo. Como é um exame muito invasivo,
não é feito nos exames pré-natal de rotina, mas somente em situações peculiares, como no caso de um ou ambos os pais e/ou um irmão
da criança apresentarem distúrbios genéticos, ou de a mãe apresentar idade avançada, quando aumenta o risco de produção de óvulos
defeituosos. Assim, analisando cada item:
Item A: falso. Espinha bífida pode ocorrer como consequência de defeitos genéticos, como ocorre com a síndrome de Patau
(trissomia do cromossomo 13), mas pode ocorrer por outros motivos, como a deficiência de vitamina B9 (ácido fólico) na mãe durante
a gestação.
Item B: falso. A punção das vilosidades coriônicas é feita por volta da 9ª semana de gestação. A amniocentese é um outro exame que
pode ser feito para montar o cariótipo do feto antes mesmo do nascimento, o que se dá pela obtenção de células do feto por punção do
líquido amniótico a partir da 16ª a 18ª semana de gestação.
Item C: verdadeiro. A translocação é a troca de segmentos entre cromossomos não homólogos. Além da trissomia do cromossomo
21, a síndrome de Down pode se dar pela translocação entre o cromossomo 14 ou 15 e o cromossomo 21, podendo essa condição ser
passada à descendência pelo pai portador.
Item D: falso. A rubéola na mãe durante a sua gestação pode levar a criança a nascer cega, sendo essa cegueira congênita, e não
genética, de modo a não interferir no risco de um outro filho dessa mulher vir a nascer cega .
Item E: falso. A síndrome de Down é uma doença cromossômica, e não genética, de modo que o fato de um casal já ter um filho com
síndrome de Down não necessariamente aumenta o risco de um outro filho desse casal apresentar a mesma condição.

4.
Resposta: D
Comentário: Amniocentese e amostragem vilo-coriônica são técnicas usadas para coletar células do embrião em desenvolvimento
para realizar a cariotipagem pré-natal e diagnosticar aberrações cromossômicas. Essas técnicas são indicadas em casos como:
Item A: verdadeiro. Quando mais avançada a idade da mãe, maior a probabilidade de erros na meiose que podem levar à ocorrência
de aneuploidias na criança.
Item B: verdadeiro. Drogas quimioterápicas interferem na divisão celular, podendo levar à ocorrência de aneuploidias na criança.
Item C: verdadeiro. Raios X têm ação mutagênica, de modo que podem levar à ocorrência de doenças genéticas na criança.
Item D: falso. Apesar de a cariotipagem pré-natal possibilitar a identificação do sexo da criança, os riscos para a criança e mãe não
justificam sua utilização para esse objetivo; procedimentos não invasivos como a ultrassonografia permitem a identificação do sexo da
criança sem trazer esses riscos.
Item E: verdadeiro. Como doenças genéticas apresentam recorrência familiar, o fato de a criança ter um irmão afetado por doença
genética aumenta a possibilidade de que a mesma também apresenta a referida doença.

5.
Resposta: C
Comentário: Em mulheres, um dos cromossomos X está inativado na forma de heterocromatina, formando uma estrutura denominada
cromatina sexual ou corpúsculo de Barr. A hipótese mais aceita para justificar essa inativação é a Hipótese de Lyon ou do Mecanismo
de Compensação de Dose, segundo a qual um dos cromossomos X da mulher é inativado para evitar a produção excessiva de
substâncias codificadas por genes do cromossomo X, o que seria prejudicial de alguma forma. Como só pode haver um cromossomo
X funcional, o número de cromatinas sexuais na célula de um indivíduo qualquer é igual ao número de cromossomos X menos um.
Uma das maneiras de se diagnosticarem aneuploidias sexuais é a análise do número de cromatinas sexuais. Deste modo, o número de
cromatinas sexuais é:
- em indivíduos normais do sexo feminino XX = 1
- em indivíduos superfêmea XXX = 2
- em indivíduos Turner X0 = 0
- em indivíduos normais do sexo masculino XY = 0
- em indivíduos supermacho XYY = 0
- em indivíduos Klinefelter XXY = 1
Assim, são esperados dois corpúsculos de Barr nas pessoas portadoras de síndrome da superfêmea XXX.

6.
Resposta: C
Comentário: Aneuploidias são aberrações cromossômicas numéricas caracterizadas pelo aumento no número de cromossomos, mas
não de genomas. Trissomias são aneuploidias em que ocorre um cromossomo a mais, de modo que o par de cromossomos afetado
apresentará três cromossomos ao invés de dois, como ocorre com a síndrome de Edwards (trissomia do par 18), a síndrome de
Klinefelter (trissomia XXY dos cromossomos sexuais), a síndrome de Patau (trissomia do par 13) e síndrome de Down (trissomia do
par 21). Monossomias são aneuploidias em que ocorre um cromossomo a menos, de modo que o par de cromossomos afetado
apresentará um cromossomo ao invés de dois, como ocorre com a síndrome de Turner (monossomia X0 dos cromossomos sexuais).

7.
Resposta: B
Comentário: A síndrome de Patau é causada pela trissomia do cromossomo 13, sendo uma aberração cromossômica numérica, ou
seja, uma mutação cromossômica numérica do tipo aneuploidia, que altera o número de cromossomos, mas não altera o número de
genomas.

8.
Resposta: C
Comentário: Pode-se observar que o indivíduo cujo cariótipo foi apresentado possui síndrome de Down, resultante da trissomia do
par 21 de cromossomos, como pode ser verificado abaixo:

Indivíduos com síndrome de Down possuem microcefalia (cabeça pequena), macroglossia (língua grande), baixo quociente intelectual
(baixo QI), obesidade, face em lua cheia, pregas palpebrais, defeitos na flexão dos dedos, flacidez muscular e distúrbios cardíacos,
digestivos, genitais e urinários, mas não possuem testículos pequenos, ausência de espermatozoides, mamas evidentes em homens,
baixa estatura ou ovários não-funcionais em mulheres.

9.
Resposta: B
Comentário: A trissomia do cromossomo 18 leva a uma série de problemas, como microftalmia, defeitos de flexão dos dedos,
defeitos cardíacos, defeitos renais e hérnia umbilical, apresentando baixa expectativa de vida. Essa condição é denominada de
síndrome de Edwards.

10.
Resposta: A
Comentário: A trissomia XXY dos cromossomos sexuais faz com que o indivíduo do sexo masculino apresente um corpúsculo de
Barr (cromatina sexual positiva) e gera efeitos como estatura acima da média da população, atrofia de pênis (micropênis), atrofia dos
testículos, ausência de espermatozóides (azoospermia) e esterilidade, desenvolvimento dos seios (ginecomastia), pequena quantidade
de pelos corporais e faciais e QI abaixo da média. Essa condição é denominada de síndrome de Klinefelter.

11.
Resposta: D
Comentário: Dá-se o nome de coesinas às proteínas que ligam as cromátides irmãs no centrômero de um cromossomo duplicado.

12.
Resposta: A
Comentário: Na espécie humana, a presença do cromossomo X determina o sexo masculino e a ausência do cromossomo Y
determina o sexo feminino. Mulheres XX são normais. Mulheres X0 são portadoras de síndrome de Turner, com estatura abaixo da
média, ovários atrofiados, esterilidade, dismenorréia (ausência de menstruação), útero atrofiado e mamas atrofiadas. Mulheres XXX,
apesar do número alterado de cromossomos, são fenotipicamente normais.
Observação: Indivíduos com trissomia do cromossomo18, como aqueles com cariótipo 47, XX + 18, são portadores de síndrome de
Edwards, apresentando microftalmia, defeitos de flexão dos dedos, defeitos cardíacos, defeitos renais, hérnia umbilical e baixa
expectativa de vida.

13.
Resposta: A
Comentário: Os cromossomos politênicos de larvas de moscas e mosquitos começam a se formar no final do desenvolvimento
embrionário. Por razões ainda desconhecidas, nas células de diversos órgãos das larvas, os cromossomos homólogos se emparelham e
começam a se multiplicar, sem que as cromátides irmãs de separem e sem que haja divisão do núcleo. Por conter um número cada vez
maior de filamentos cromossômicos, o núcleo cresce e o citoplasma também aumenta de volume. As células portadoras de
cromossomos politênicos são gigantes, chegando a ser 10 mil vezes maiores do que as células diplóides de um mesmo organismo. Os
cromossomos politênicos chegam a ser mais mil vezes maiores do que os de uma célula comum, o que justifica a denominação de
cromossomos gigantes. Esse cromossomo apresenta faixas transversais escuras, intercaladas com interfaixas mais claras, cujo padrão é
característico de cada cromossomo e é usado em sua identificação. As faixas dos cromossomos politênicos correspondem aos
cromômeros (constricções, heterocromatina superespiralizada) dos milhares de DNA colocados lado a lado, enquanto as interfaixas
correspondem às áreas intercromoméricas (eucromatina espiralizada). No cromossomo politênico, nos locais em que os genes entram
em atividade, os cromômeros desespiralizam e o fio cromossômico se expande. Com isso, a faixa correspondente desaparece, e no seu
lugar aparece um inchaço chamado pufe. Assim, cromossomos politênicos são encontrados nas células de glândulas salivares de
alguns insetos, como Drosophila, onde os cromossomos homólogos se pareiam e se replicam muitas vezes sem segregação
cromossômica, formando muitas cromátides.

14.
Resposta: D
Comentário: Analisando cada item:
Item A: falso. O cromonema resulta da ligação do DNA em dupla hélice a proteínas histonas, não relacionadas aos microtúbulos do
citoesqueleto.
Item B: falso. O maior nível de compactação do material genético é alcançado durante a formação do cromossomo, constituído por
duas cromátides unidas por um centrômero.
Item C: falso. As proteínas histonas que se ligam ao DNA são básicas, e não ácidas.
Item D: verdadeiro. Os nucleossomos são formados a partir da ligação do DNA a conjuntos de moléculas de histonas organizadas em
cubos (octâmeros).

15.
Resposta: D
Comentário: Os nucléolos são estruturas nucleares não membranosas constituídas de RNAr e proteínas e responsáveis pela formação
dos ribossomos. O RNAr que compõe nucléolos e ribossomos é transcrito a partir de genes localizados nas zonas SAT de DNA ou
regiões organizadoras dos nucléolos. Assim, analisando cada item:
Item A: falso. Os nucléolos formam os ribossomos, e não são formados por eles. Além disso, nucléolos não são delimitados por
membranas e não ocorrem aos pares (característica dos centríolos), sendo realmente visíveis ao microscópio óptico ou ao eletrônico.
Item B: falso. Com a espiralização cromossômica, o DNA fica inativo e cessa a transcrição de RNAr, de modo que os nucléolos
desaparecem, o que ocorre durante a divisão celular. Assim, a melhor fase do ciclo celular para se observarem nucléolos é a interfase,
não sendo possível sua visualização durante a maior parte de mitose e meiose.
Item C: falso. Os telômeros correspondem à extremidade dos cromossomos, não possuindo genes, mas apenas sequências de DNA
lixo. Como dito, os nucléolos são produzidos a partir das zonas SAT de DNA.
Item D: verdadeiro. Os genes que são transcritos em RNAr são intensamente transcritos nas zonas SAT de DNA ou regiões
organizadoras de nucléolos dos cromossomos, sendo o RNAr visualizado pelo corante nitrato de prata.
Item E: falso. Os RNAt são produzidos a partir de um conjunto específico de genes não relacionados aos nucléolos ou às zonas SAT.

16.
Resposta: A
Comentário: Os cromossomos podem se apresentar sob três formas de acordo com a posição do centrômero e tamanho dos braços:
- metacêntrico, com centrômero no centro e braços de tamanhos iguais;
- submetacêntrico, com centrômero quase no centro e braços de tamanho quase igual;
- acrocêntrico, com centrômero bem deslocado, havendo braços curtos e longos;
- telocêntrico, com centrômero em uma das extremidades do cromossomo, sendo que cada cromátide só tem um braço. Não existem
cromossomos telocêntricos na espécie humana.
Na figura, a letra "C" indica o centrômero e a letra "B", o braço cromossômico.

Assim, conclui-se que I é submetacêntrico, II é telocêntrico, III é acrocêntrico e IV é metacêntrico.

17.
Resposta: E
Comentário: Indivíduos da espécie humana possuem células diploides apresentando 46 cromossomos, sendo seu cariótipo
representado por 44 A, XX ou XY, ou seja, 44 autossomos (ou cromossomos somáticos, não relacionados à determinação do sexo) e 2
alossomos (cromossomos sexuais), sendo eles XX em mulheres e XY em homens. A meiose divide o número de cromossomos ao
meio, de modo que, em mulheres, os óvulos têm cariótipo 22 A, X, e nos homens, os espermatozoides têm cariótipo 22 A, X ou 22, A,
Y. Assim:
Item I: falso. O cariótipo do indivíduo 3, que é 44 A, XY, é compatível com homens normais; o cariótipo do indivíduo 5, que é 45 A,
XY, é compatível com homens com trissomia dos cromossomos somáticos, ou seja, com um cromossomo a mais em um par de
cromossomos somáticos, como ocorre na síndrome de Down com o par 21 de cromossomos; O cariótipo do indivíduo 6, que é 44 A,
XXY, é compatível com homens com uma trissomia dos cromossomos sexuais caracterizada como síndrome de Klinefelter, .
Item II: verdadeiro. Se o indivíduo 1 tem cariótipo 40 A, XY, produz por meiose gametas 20 A, X ou 20 A, Y, como ocorre com a
célula do indivíduo 2.
Item III: verdadeiro. Num homem normal, de cariótipo 44 A, XY, a meiose pode gerar gametas 22 A, X ou 22, A, Y, e numa mulher
normal, de cariótipo 44 A, XX, a meiose gera gametas 22 A, X, de modo que a célula do indivíduo 4 pode ser um gameta de um
indivíduo do sexo masculino ou do sexo feminino.

18.
Resposta: E
Comentário: No núcleo de células eucarióticas, o DNA se encontra associado a proteínas básicas denominadas histonas, de modo a
formar filamentos denominados cromonemas durante a intérfase e cromossomos durante a divisão celular. O conjunto de cromonemas
durante a intérfase é denominado cromatina. A cromatina se encontra predominantemente desespiralizada, estando acessível à enzima
RNA polimerase responsável pela transcrição, e conseqüentemente estando ativa para a síntese de RNAm e a tradução deste em
proteína. Estas partes desespiralizadas, ou seja, ativas da cromatina, são ditas eucromatina.
Parte da cromatina se encontra espiralizada, estando inacessível à enzima RNA polimerase, não havendo transcrição (síntese de
RNAm) e tradução (síntese de proteína). Estas partes espiralizadas, ou seja, inativas da cromatina, são ditas heterocromatina. Todas as
células somáticas de um organismo têm o mesmo material genético, uma vez que se formam por mitose (sem variabilidade genética)
do zigoto, mas a diferenciação celular as deixa com formas e funções específicas devido à expressão de genes diferentes. A
especialização ou diferenciação celular é resultado da ativação ou inativação de genes por, respectivamente, desespiralização ou
espiralização do DNA. Assim, genes ativos são encontrados em áreas de eucromatina e genes inativos em áreas de heterocromatina.
Assim, devido à especialização celular, em cada um dos tipos celulares distintos de um organismo, os genes são os mesmos, mas os
genes que se expressam são diferentes. Assim, ao compararmos células somáticas de diferentes tecidos do corpo de uma pessoa,
encontraremos conjuntos de cromossomos idênticos, conjuntos de moléculas de DNA idênticos e conjuntos de genes em atividade
diferentes.

19.
Resposta: A
Comentário: O material genético em células eucarióticas se encontra na forma de cromatina ou cromossomos, constituídos
principalmente de DNA e histona (proteína). Uma vez que o DNA é ácido, a histona que se associa a ele deve ser básica. Como o
DNA tem carga negativa, a histona básica que se associa a ele deve ter carga positiva. A única proteína que, em pH básico (maior que
7,0) tem carga elétrica positiva é a proteína W.

20.
Resposta: A
Comentário: Algas Acetabularia são unicelulares, mas visíveis a olho nu, tendo uma morfologia muito peculiar, com um pé contendo
o núcleo, uma longa haste, e um chapéu cuja morfologia varia de acordo com a espécie. Experimentos de merotomia (corte parcial de
uma célula) e enxertia (união entre partes de diferentes células) em Acetabularia auxiliaram a compreensão do papel do núcleo
celular. No experimento descrito, ao se cortarem os chapéus e trocarem os núcleos, pode-se observar que os novos chapéus gerados
correspondem ao determinado pelo núcleo, uma vez que este contém o DNA, cujos determinam as características da célula através de
sua produção de proteínas. Assim:
Item A: falso. Mutações correspondem a alterações no DNA, sendo eventos raros e espontâneos, não estando relacionados ao
transplante de núcleo.
Item B: verdadeiro. Ao mudar os núcleos, a expressão dos genes do DNA contido no núcleo transplantado resulta em diferentes
proteínas que justificam a alteração da forma do chapéu.
Item C: verdadeiro. Como afirmado acima, a produção de proteínas diferentes após o transplante nuclear, codificadas pelos genes do
DNA do núcleo transplantado justifica a alteração da forma do chapéu.
Item D: verdadeiro. A presença de genes diferentes no DNA do núcleo transplantado, em relação ao núcleo original, implica na
transcrição de diferentes tipos de RNAm após o transplante nuclear.

21.
Resposta: A
Comentário: Analisando a figura:
- 1 é uma constricção secundária;
- 2 é um braço;
- 3 é a constricção primária ou centrômero;
- 4 é uma constricção secundária.
Assim:
Item A: verdadeiro. Como mencionado acima, o número 1 indica uma constrição secundária.
Item B: falso. Como possui um braço maior e um outro braço menor, ele é do tipo submetacêntrico.

Braço maior

Braço menor

Item C: falso. O número 2 indica um braço.


Item D: falso. O telômero se encontra na extremidade do cromossomo; o número 3 indica o centrômero.
Item E: falso. O número 1 indica uma constrição secundária.

22.
Resposta: A
Comentário: A diferenciação celular se dá devido a ativação ou inativação de genes através, respectivamente, da desespiralização ou
espiralização da cromatina, o que é controlado por fatores intrínsecos e extrínsecos que interagem. Assim, analisando cada item:
Item A: verdadeiro. Como mencionado, a diferenciação depende de fatores intrínsecos inerentes ao material genético que podem ser
influenciados por fatores extrínsecos inerentes ao meio.
Item B: falso. O micro-ambiente em que a célula está localizada apresenta substâncias e condições físico-químicas que podem induzir
a ativação ou inativação de um trecho de cromatina, influenciando na especialização celular.
Item C: falso. Mesmo células que não interajam com outras células podem ser induzidas a se diferenciar se submetidas a condições
apropriadas.
Item D: falso. A diferenciação celular implica na alteração do padrão morfológico e funcional de uma célula ou tecido.
Item E: falso. Como mencionado, não é obrigatoriamente necessária a influência de uma célula para a diferenciação de uma outra
célula.

23.
Resposta: A
Comentário: Analisando cada item:
Item I: verdadeiro. Segundo a Teoria Uninêmica, cada cromossomo possui uma única molécula de DNA.
Item II: falso. Histonas são proteínas básicas que se ligam ao DNA para formar cromonemas/cromossomos.
Item III: falso. Os nucléolos atuam na produção das subunidades ribossômicas, que posteriormente migram do núcleo para o
citoplasma através dos poros nucleares.

24.
Resposta: B
Comentário: Células anucleadas não possuem núcleo, e, conseqüentemente, não possuem material genético. Estas células têm vida
curta pela incapacidade de produzir proteínas para regenerar danos que ocorrem naturalmente com o envelhecimento celular. São
exemplos:
- hemácias de mamíferos, com tempo de vida de cerca de 120 dias, apenas; hemácias de peixes, anfíbios, répteis e aves são nucleadas,
com tempo de vida bem mais longo;
- elementos de tubos crivados do floema, que apresentam vida longa por se comunicarem, através de plasmodesmos, com uma célula
companheira nucleada, que lhes fornece as substâncias de que necessitam para se manter.

25.
Resposta: C
Comentário: Segundo a Teoria Uninêmica, cada cromonema ou cromossomo é composto de uma única molécula de DNA em dupla-
hélice. Assim, o DNA em células eucarióticas está compactado em nucleossomas (1), formados imediatamente após a replicação
(duplicação do DNA, 2); cada nucleossoma é formado por um núcleo com oito proteínas histonas (3), com DNA enrolado em torno
deste núcleo, formando um fio cromossômico helicoidal chamado solenóide ou fibra cromossômica (4).

26.
Resposta: D
Comentário: As estruturas indicadas na figura representativa do núcleo são indicadas a seguir:
1 – Poros nucleares ou annuli (singular: annulus), responsáveis pela passagem de RNAm e ribossomos do núcleo, onde são
produzidos, para o citoplasma, onde atuam, e pela passagem de proteínas nucleares do citoplasma, onde são produzidas, para o núcleo.
2 – Carioteca ou envelope nuclear, formada por uma dupla bicamada fosfolipoprotéica com um espaço interno denominado espaço
perinuclear;
3 – Nucléolo, formado por RNAr e responsável pela montagem dos ribossomos que promoverão a síntese protéica;
4 – Cromatina, conjunto de cromonemas, cada qual formado pela associação entre DNA e proteínas básicas denominadas histonas; e
5 – Nucleoplasma, carioplasma ou cariolinfa, formada por uma solução coloidal de proteínas em água, e na qual estão mergulhadas as
demais estruturas.
O RNA ribossômico é transcrito a partir de genes localizados na zona SAT de DNA, também conhecida como região organizadora do
nucléolo, e equivalente ao número 4. Pelamordedeus, o RNAr forma o nucléolo, e não é formado por ele, beleza?

27.
Resposta: D
Comentário: Em mulheres, um dos cromossomos X está inativado na forma de heterocromatina, formando uma estrutura denominada
cromatina sexual ou corpúsculo de Barr. A hipótese mais aceita para justificar essa inativação é a Hipótese de Lyon ou do Mecanismo
de Compensação de Dose, segundo a qual um dos cromossomos X da mulher é inativado para evitar a produção excessiva de
substâncias codificadas por genes do cromossomo X, o que seria prejudicial de alguma forma. Como só pode haver um cromossomo
X funcional, o número de cromatinas sexuais na célula de um indivíduo qualquer é igual ao número de cromossomos X menos um.
Assim, em indivíduos normais do sexo feminino (XX), ocorre uma cromatina sexual por célula, e em indivíduos normais do sexo
masculino (XY), não ocorre cromatina sexual. Desse modo, devido à inativação de um dos cromossomos X na mulher, homens e
mulheres apresentam a mesma quantidade de cromossomos X funcionais, produzindo a mesma quantidade de proteína.

28.
Resposta: A
Comentário: Os telômeros são trechos de DNA não codificante localizados na extremidade dos cromossomos, com papel de proteger
essas extremidades de serem confundidos com pedaços partidos de DNA, que de outra forma seriam consertadas pelo mecanismo de
reparo celular. Como o genoma da bactéria consiste de uma molécula de DNA circular, não apresenta extremidade, de modo que não
possui telômero.

29.
Resposta: VVFVF
Comentário:
1º item: verdadeiro. O envoltório nuclear comunica-se com o retículo endoplasmático rugoso, podendo ser considerado parte dele.
2º item: verdadeiro. Se o nucléolo for experimentalmente removido ou impedido de funcionar, não ocorrerá formação de
ribossomos, o que impedirá a síntese protéica.
3º item: falso. Os poros nucleares permitem a passagem de RNAm e ribossomos do núcleo para o citoplasma, mas a cromatina, pelas
sua grandes dimensões, é incapaz de fazer essa passagem.
4º item: verdadeiro. A cromatina (conjunto de cromonemas na intérfase) é constituída por moléculas de DNA associadas a proteínas
básicas histonas.
5º item: falso. Os poros nucleares permitem a saída das subunidades dos ribossomos do núcleo para o citoplasma.

30.
Resposta:
A) Corresponde a um dos cromossomos sexuais X que se encontra condensado mesmo na interfase.
B) Nas primeiras semanas da vida embrionárias ou entre o décimo ao décimo quinto dia.
C) Significado: Compensação de dose. Justificativa: O cromossomo X é maior (contém maior quantidades de genes), a inativação
equilibra quantitativamente o produto gênico entre machos e fêmeas, ou como fêmeas possuem dois cromossomos X e machos apenas
um cromossomo X, elas produziriam o dobro de produtos gênicos codificados por genes do X em relação aos machos, caso não
ocorresse a inativação.
D) Porque a inativação do cromossomo X é incompleta.

31.
Resposta:
A) Não, devido ao princípio de constância genômica, pelo qual todas as células somáticas de um organismo pluricelular normal têm os
mesmos genes.
B) Sim, porque a especialização celular envolve a inativação de genes na forma de heterocromatina, de modo que cada célula
expressaria um conjunto diferente de genes produzindo um grupo diferente de RNAm.

32.
Resposta: O experimento com a Acetabularia é denominado de merotomia (do grego meros, ‘parcial’ e tomos, ‘corte’).
A) a alga em questão é unicelular, e está sendo fragmentada em porções de seu citoplasma. A parte da alga que conserva o núcleo é
capaz de regenerar pois conserva seu DNA, e com isso, sua capacidade de controlar a síntese de novas proteínas para a regeneração da
parte removida e a manutenção de suas funções normais. Os demais segmentos, sem núcleo, sobrevivem somente enquanto durarem
suas reservas nutritivas citoplasmáticas, uma vez que não têm DNA para manter sua atividade de síntese proteica e consequentemente
seu metabolismo normal.
B) A planária é um organismo pluricelular (metazoário). Cada um dos segmentos é pluricelular também: assim, haverá o controle
exercido pelo material genético contido nos núcleos das células sobre o metabolismo e sobre a multiplicação celular. Esses fatores
orientam a regeneração do verme.

33.
Resposta: Para haver grande atividade se síntese protéica, é necessária uma grande quantidade de ribossomos, que são produzidos a
partir dos nucléolos.

34.
Resposta:
A) vírus e bactérias.
B) nucleossoma e histona.
C) V e metáfase da divisão celular.

35.
Resposta:
A) espermatozoide < adipócito < neurônio
B) Células que apresentam menor metabolismo de síntese (RNAs e proteínas) possuem uma menor quantidade de complexos de poro.

36.
Resposta: Por serem células sexuais, os espermatozoides sofreram divisão meiótica, tendo, portanto, dezoito cromossomos apenas, o
que corresponde ao número haploide, presente neste tipo de célula. Proteínas e ácidos nucleicos são as principais substâncias
formadoras dos cromossomos. O número de cromátides pode ser calculado como segue: número diploide x 2 (cromátides). Ou seja, 36
x 2 = 72 cromátides. As células em metáfase mitótica apresentam cada cromossomo com duas cromátides. Como a célula é diploide,
teremos 18 pares de cromossomos, correspondendo a 36 cromossomos. Se cada cromossomo tem duas cromátides, o total será 72
cromátides em cada célula da pele deste animal, no período da metáfase mitótica. O número mínimo de cromossomos que contém um
representante de cada par homólogo é 18, ou seja, só será possível identificar todos os genes desse organismo se a sequência de pelo
menos um dos homólogos de cada par for identificada.
Observação: Pode-se argumentar no item D que o número de cromossomos necessários para decifrar o genoma da espécie é 19. Para
analisar o genoma, precisa-se de uma cópia de cada gene. Como cada um dos cromossomos de uma par de homólogos têm uma cópia
de um determinado gene, com 17 cromossomos (um de cada par de homólogos de autossomos), mais o cromossomo X e o
cromossomo Y, tem-se uma cópia de cada gene do genoma.

37.
Resposta: Sabe-se que além do grau de parentesco entre os pais (consanguinidade) que podem gerar filhos com problemas cerebrais
graves, outro fator de extrema importância que está associado à ocorrência de bebês com anomalias cromossômicas é a idade da mãe.
Mães com mais de 40 anos têm bastante aumentada a probabilidade de gerar crianças com defeitos congênitos, quando comparadas a
mães jovens. É muito provável que as trissomias estejam associadas ao avanço da idade materna. A cariotipagem pré-natal é a
apresentação ordenada de fotomicrografias de cromossomos das células provenientes do líquido amniótico, utilizada para fins de
diagnóstico. O exame pode ser realizado a partir da 16ª semana de gestação (quatro meses) e fornece à gestante uma informação, com
100% de acerto, se o bebê nascerá sadio ou não. A síndrome de Down (trissomia no 21 ou mongolismo) é a aberração cromossômica
mais comum, podendo ocorrer, também, outros defeitos graves como anencefalia (ausência de cérebro), micro e macrocefalia,
síndrome de Turner (X0), síndrome de Klinefelter (XXY), síndrome de Edwards (trissomia no 18), síndrome de Patau (trissomia no
13), etc. Desenvolvido mais recentemente, o exame do vilo-corial, que também coleta células para a cariotipagem, possibilita a
realização do exame já a partir da 9ª semana de gravidez, com o feto medindo 5 cm.

38.
Resposta:
A) Na 1ª etapa, o chapéu regenerado foi correspondente à haste devido à presença de RNAm já presente anteriormente, que se esgota;
na 2ª etapa, o chapéu regenerado foi correspondente ao pé devido à presença de RNAm fabricado agora pelo núcleo no pé.
B) O núcleo, uma vez que abriga o DNA e então produz o RNAm que irá levar à produção das proteínas que determinam as
características.

39.
Resposta:
A) Glóbulo branco ou leucócito envolvido na defesa orgânica.
B) Corpúsculo de Barr ou cromatina sexual observada em células somáticas de mulheres. De acordo com a Hipótese de Lyon ou
Mecanismo de Compensação de Dose, corresponde a um dos cromossomos X que permanece inativado na mulher, como
heterocromatina, com o objetivo de evitar a produção excessiva de substâncias codificadas por genes desse cromossomos, o que seria
prejudicial.
C) Normal: Mulher 2A + XX; Anormal: Homem 2A + XXY (Síndrome de Klinefelter).
D) Síndrome de Turner (Mulher 2A + X0).

40.
Resposta:
A) Acrocêntrico, pois apresenta centrômero terminal.
B) Metáfase.
C) A – satélite e B – braço do cromossomo.
D) Incapacidade de se prender às fibras do fuso de divisão, resultando em células com números anormais de cromossomos
1.
Resposta: D
Comentário: Células-tronco são células indiferenciadas, sendo capazes de originar outras células, o que permite o tratamento de
algumas doenças. No caso das células-tronco obtidas no sangue do cordão umbilical, a diferenciação pode gerar células de sangue,
uma vez que são multipotentes hematopoiéticas.

2.
Resposta: E
Comentário: Todas as células somáticas no corpo de um indivíduo pluricelular possuem os mesmos genes, variando somente em
conjuntos de genes que se expressam e que não se expressam. Através de técnicas de Engenharia Genética, pode-se atualmente
converter uma célula adulta diferenciada em uma célula tronco pluripotente induzida (iPS), ou seja, indiferenciada e capaz de
originar qualquer outro tipo de célula no adulto. A vantagem da produção de iPS em relação à obtenção de células-tronco
pluripotentes embrionárias é que não envolve discussões éticas, como as que ocorrem quando se remove células-tronco de
embriões, os quais morrem no processo. As iPS podem ser diferenciadas em qualquer célula do adulto, incluindo neurônios, desde
que se propicie um meio adequado contendo substâncias que estimulem essa diferenciação, o que, no caso dos neurônios, consiste
de um meio que imite o cérebro (como mencionado na marcação 3 da figura apresentada).

3.
Resposta: C
Comentário: Células-tronco são células indiferenciadas capazes de se diferenciar em novos tipos de células, tecidos ou órgãos.
Nem todas elas são capazes de sofrer diferenciação se transformando em todos os tipos celulares. Somente as células-tronco
embrionárias (CTE, blastômeros), ou seja, obtidas no embrião até a blástula, são toti/pluripotentes, ou seja, capazes de se
diferenciar em qualquer tipo de célula do organismo. Quaisquer células-tronco obtidas após o nascimento podem ser
caracterizadas como células-tronco adultas ou maduras, que não são toti/pluripotentes. São exemplos desse caso as células-tronco
obtidas de placenta, de cordão umbilical e de medula óssea (hematopoiéticas), podendo se diferenciar apenas em células
sanguíneas. Células-tronco obtidas no mesmo indivíduo que irá recebê-las (autólogas ou auto-transplantadas) apresentam o
mesmo material genético que as demais células do próprio indivíduo, não apresentando, consequentemente, risco de rejeição por
parte do sistema imune.

4.
Resposta: D
Comentário: Clones são organismos geneticamente idênticos a um indivíduo matriz, não apresentando variabilidade genética
alguma em relação a este.
A técnica de clonagem por transferência nuclear pode ser resumida da seguinte maneira:
(1) Remove-se um núcleo de célula somática de um indivíduo que se quer clonar; por ser somática, a célula apresentará todo um
conjunto cromossômico diploide para originar um indivíduo idêntico ao doador.
(2) Remove-se o núcleo de um óvulo da mesma espécie, obtendo-se um óvulo anucleado (ou seja, obtendo-se o citoplasma isolado
do óvulo).
(3) Insere-se o núcleo somático (2n) no óvulo anucleado; através de choques elétricos, estimula-se a fusão das duas estruturas e
formação de uma nova célula, basicamente o óvulo com o núcleo somático; este prontamente começa a se dividir mitoticamente,
como um zigoto.
(4) Ao atingir a fase de blastocisto, implanta-se o embrião numa barriga de aluguel. Este embrião é um clone do doador da célula
somática.
Considerando que as mitocôndrias apresentam DNA próprio, e que as mesmas são provenientes do óvulo, pode-se argumentar que
o clone gerado dessa maneira não é uma cópia genética perfeita do doador do núcleo da célula somática, uma vez que possui DNA
mitocondrial da doadora do óvulo.
No caso em questão, a vaca Z é a doadora do óvulo, contribuindo com o DNA mitocondrial do clone, a vaca W foi a doadora do
núcleo da célula somática, contribuindo com o DNA nuclear do clone, e a vaca Y é a mãe de aluguel, não contribuindo com o
DNA do clone. Assim, o animal resultante da clonagem tem as características genéticas das vacas Z e W, apenas.

5.
Resposta: A
Comentário: Somente células-tronco embrionárias (CTE, blastômeros), ou seja, obtidas no embrião até a blástula, são
toti/pluripotentes, ou seja, capazes de se diferenciar em qualquer tipo de célula do organismo. Quaisquer células-tronco obtidas
após o nascimento podem ser caracterizadas como células-tronco adultas ou maduras, que não são toti/pluripotentes. São
exemplos desse caso as células-tronco obtidas de placenta, de cordão umbilical e de medula óssea (hematopoiéticas), podendo se
diferenciar apenas em células sangüíneas.

6.
Resposta: C
Comentário: Clones são organismos geneticamente idênticos a um indivíduo matriz, não apresentando variabilidade genética
alguma em relação a este.
A técnica de clonagem por transferência nuclear pode ser resumida da seguinte maneira:
(1) Remove-se um núcleo de célula somática de um indivíduo que se quer clonar; por ser somática, a célula apresentará todo um
conjunto cromossômico diploide para originar um indivíduo idêntico ao doador.
(2) Remove-se o núcleo de um óvulo da mesma espécie, obtendo-se um óvulo anucleado (ou seja, obtendo-se o citoplasma isolado
do óvulo).
(3) Insere-se o núcleo somático (2n) no óvulo anucleado; através de choques elétricos, estimula-se a fusão das duas estruturas e
formação de uma nova célula, basicamente o óvulo com o núcleo somático; este prontamente começa a se dividir mitoticamente,
como um zigoto.
(4) Ao atingir a fase de blastocisto, implanta-se o embrião numa barriga de aluguel. Este embrião é um clone do doador da célula
somática.
Assim, analisando cada item:
Item I: verdadeiro. A substituição do núcleo de um óvulo pelo núcleo de uma célula diploide do mesmo animal e a implantação
desse zigoto no útero do animal para que se desenvolva consiste na técnica de clonagem por transferência nuclear.
Item II: verdadeiro. A produção de mudas de plantas por processos como estaquia não envolve variabilidade genética,
consistindo num processo de clonagem.
Item III: falso. A produção de sementes envolve processos de fusão de gametas para a formação de um zigoto por mecanismos de
reprodução sexuada, com variabilidade genética, de modo a não caracterizar um processo de clonagem.

7.
Resposta: A
Comentário: Células-tronco são células indiferenciadas capazes de se diferenciar em novos tipos de células, tecidos ou órgãos.
Nem todas elas são capazes de sofrer diferenciação se transformando em todos os tipos celulares. Somente as células-tronco
embrionárias (CTE, blastômeros), ou seja, obtidas no embrião até a blástula, são toti/pluripotentes, ou seja, capazes de se
diferenciar em qualquer tipo de célula do organismo. Quaisquer células-tronco obtidas após o nascimento podem ser
caracterizadas como células-tronco adultas ou maduras, que não são toti/pluripotentes. São exemplos desse caso as células-tronco
obtidas de placenta, de cordão umbilical e de medula óssea (hematopoiéticas), podendo se diferenciar apenas em células
sanguíneas. Assim, analisando cada item:
Item A: verdadeiro. Como as células-tronco embrionárias são pluri/totipotentes, podem originar qualquer tipo de célula, podem
ser usadas para ajudar a prevenir ou tratar várias doenças.
Item B: falso. Células-tronco são uma classe de células indiferenciadas, e não diferenciadas.
Item C: falso. Células-tronco adultas não são pluri/totipotentes, não podendo originar qualquer tipo de célula, o que é
prerrogativa apenas das células-tronco embrionárias.
Item D: falso. Células-tronco embrionárias são as de maior plasticidade, podendo originar qualquer tipo de célula do corpo.
Item E: falso. Células-tronco embrionárias são pluri/totipotentes.

8.
Resposta: C
Comentário: Clones são organismos geneticamente idênticos a um indivíduo matriz, não apresentando variabilidade genética
alguma em relação a este.
A técnica de clonagem por transferência nuclear pode ser resumida da seguinte maneira:
(1) Remove-se um núcleo de célula somática de um indivíduo que se quer clonar; por ser somática, a célula apresentará todo um
conjunto cromossômico diploide para originar um indivíduo idêntico ao doador.
(2) Remove-se o núcleo de um óvulo da mesma espécie, obtendo-se um óvulo anucleado (ou seja, obtendo-se o citoplasma isolado
do óvulo).
(3) Insere-se o núcleo somático (2n) no óvulo anucleado; através de choques elétricos, estimula-se a fusão das duas estruturas e
formação de uma nova célula, basicamente o óvulo com o núcleo somático; este prontamente começa a se dividir mitoticamente,
como um zigoto.
(4) Ao atingir a fase de blastocisto, implanta-se o embrião numa barriga de aluguel. Este embrião é um clone do doador da célula
somática.
Assim, A clonagem artificial por transferência nuclear envolve retirar e descartar o núcleo do óvulo de uma fêmea de determinada
espécie e injetar, neste óvulo anucleado, o núcleo de uma célula somática de um indivíduo da mesma espécie.

9.
Resposta: D
Comentário: Somente células-tronco embrionárias (CTE, blastômeros), ou seja, obtidas no embrião até a blástula são
toti/pluripotentes, ou seja, capazes de se diferenciar em qualquer tipo de célula do organismo. Quaisquer células-tronco obtidas
após o nascimento podem ser caracterizadas como células-tronco adultas ou maduras, que não são toti/pluripotentes. São
exemplos desse caso as células-tronco obtidas de placenta, de cordão umbilical e de medula óssea (hematopoiéticas), podendo se
diferenciar apenas em células sanguíneas.

10.
Resposta: A
Comentário: Clones são organismos geneticamente idênticos a um indivíduo matriz, não apresentando variabilidade genética
alguma em relação a este. A técnica de clonagem por transferência nuclear pode ser resumida da seguinte maneira:
(1) Remove-se um núcleo de célula somática de um indivíduo que se quer clonar; por ser somática, a célula apresentará todo um
conjunto cromossômico diploide para originar um indivíduo idêntico ao doador.
(2) Remove-se o núcleo de um óvulo da mesma espécie, obtendo-se um óvulo anucleado (ou seja, obtendo-se o citoplasma isolado
do óvulo).
(3) Insere-se o núcleo somático (2n) no óvulo anucleado; através de choques elétricos, estimula-se a fusão das duas estruturas e
formação de uma nova célula, basicamente o óvulo com o núcleo somático; este prontamente começa a se dividir mitoticamente,
como um zigoto.
(4) Ao atingir a fase de blastocisto, implanta-se o embrião numa barriga de aluguel. Este embrião é um clone do doador da célula
somática.
Qualquer célula somática pode ser utilizada como doadora do núcleo, uma vez que todas as células somáticas de um organismo
têm o mesmo material genético. Isso ocorre por que elas se formam por mitose (sem variabilidade genética) do zigoto, mas a
diferenciação celular as deixa com formas e funções específicas devido à expressão de genes diferentes. A especialização ou
diferenciação celular é resultado da ativação ou inativação de genes por, respectivamente, desespiralização ou espiralização do
DNA. Assim, genes ativos são encontrados em áreas de eucromatina e genes inativos em áreas de heterocromatina. Desse modo, a
obtenção de clones pela técnica de transferência nuclear a partir de uma célula somática qualquer consagra o princípio da
constância do genoma em todas as células somáticas de um mesmo indivíduo.

11.
Resposta: A
Comentário: De modo geral, quanto maior o grau de diferenciação de uma célula, maior seu tempo de vida e menor sua
capacidade de divisão celular. As células mais diferenciadas do corpo humano, de mais longo tempo de vida e manor capacaidade
de divisão celular são os neurônios.

12.
Resposta: E
Comentário: Imediatamente após a formação do zigoto, inicia-se o desenvolvimento do embrião com a fase de segmentação,
caracterizada pelas primeiras divisões mitóticas, chamadas clivagens, originando células denominadas blastômeros ou células-
tronco embrionárias. Essas células são indiferenciadas e pluri/totipotentes, sendo capazes de se diferenciar em todos os tipos de
célula, o que ocorre até a segmentação, passando pela mórula e até a blástula. Assim, analisando cada item:
Item A: falso. Como o embrião é produzido por mitoses a partir do zigoto diploide, as células embrionárias são todas igualmente
diploides, só havendo meiose para a produção de células haploides, ou seja, gametas, em estágios mais avançados do
desenvolvimento.
Item B: falso. Células-tronco oligopotentes são aquelas capazes de se diferenciar em alguns poucos tipos de células, e células-
tronco unipotentes são aquelas capazes de se diferenciar em apenas um único tipo de célula. As células-tronco que originam os
espermatozoides na gametogênese só podem gerar espermatozoides, sendo, pois, unipotentes.
Item C: falso. Segundo o texto, as “células-tronco foram removidas dos embriões masculinos com poucos dias de vida”,
correspondendo provavelmente ao desenvolvimento em sua fase inicial de segmentação, que vai até o 6º dia de desenvolvimento,
seguindo-se a gastrulação e a organogênese, na qual ocorre a nêurula, em que se forma o tubo nervoso, onde as células já estão
mais diferenciadas e não mais são células-tronco embrionárias pluri/totipotentes.
Item D: falso. Células-tronco extraídas de embriões até a fase de blástula são pluri/totipotentes e, portanto, completamente
indiferenciadas, não sendo altamente especializadas.
Item E: verdadeiro. Até a fase de blástula, as células do embrião são indiferenciadas, sendo células-tronco embrionárias
pluri/totipotentes capazes de se diferenciarem em qualquer tipo de tecido.

13.
Resposta: C
Comentário: Analisando cada item:
1º item: verdadeiro. Células-tronco são células indiferenciadas, capazes de se diferenciar em outras células.
2º item: falso. Células-tronco embrionárias (blastômeros) são obtidas no embrião até a fase de blástula e são as únicas
pluri/totipotentes, ou seja, capazes de originar qualquer outro tipo de célula do corpo. Células-tronco multipotentes podem
originar várias células, mas não todas, como ocorre com células-tronco obtidas em sangue de placenta/cordão umbilical, que
podem originar as várias células encontradas no sangue, mas não outros tipos celulares.
3º item: falso. Como mencionado, somente células-tronco embrionárias são pluri/totipotentes, ou seja, capazes de originar
qualquer outro tipo de célula do corpo.
4º item: verdadeiro. Células-tronco hematopoiéticas são aquelas que originam células sanguíneas, podendo ser linfoides,
originando somente leucócitos linfócitos, ou mieloides, originando as demais células sanguíneas, como as hemácias. Todas as
células do corpo vêm de células-tronco embrionárias pluri/totipotentes.
5º item: verdadeiro. Como mencionado, células-tronco embrionárias são capazes de originar qualquer outro tipo de célula do
corpo.

14.
Resposta: C
Comentário: A bipartição de embriões é uma técnica de clonagem no qual um embrião até a fase de mórula é fragmentado, sendo
que cada fragmento origina um novo embrião, cada embrião geneticamente igual ao original e aos demais embriões gerados no
processo. A técnica é equivalente ao que ocorre na natureza para produzir gêmeos monozigóticos ou univitelinos, que são clones
naturais.

15.
Resposta: D
Comentário: Células-tronco são células indiferenciadas, capazes de se diferenciar em outras células. Algumas células-tronco
podem se diferenciar em todos os tipos de célula, sendo chamadas de pluri/totipotentes, e correspondendo somente às células-
tronco embrionárias ou blastômeros, encontradas somente no embrião até a fase de blástula. Todas as células-tronco obtidas após
o nascimento são caracterizadas como células-tronco adultas e não possuem capacidade de se diferenciar em todos os tipos de
célula, não sendo pluri/totipotentes. São exemplos de regiões do corpo com grande quantidade de células-tronco adultas placenta,
cordão umbilical e medula óssea, todas particularmente ricas em células-tronco hematopoiéticas, ou seja, formadoras de células de
sangue.

16.
Resposta: C
Comentário: Clonagem é o mecanismo de produção de indivíduos geneticamente idênticos a um individuo matriz. A clonagem
reprodutiva produz clones para a produção de novo indivíduos que se desenvolverão até a idade adulta. A clonagem terapêutica,
como descrita na questão, produz embriões de clones que serão desmontados para a obtenção de células-tronco. No caso, a
clonagem descrita envolve a desdiferenciação, por técnicas de engenharia genética, de células adultas em células-tronco
pluripotentes (totipotentes) induzidas ou iPS, que podem então ser diferenciadas em todas as células de um individuo adulto.

17.
Resposta: E
Comentário: Analisando cada item:
Item I: falso. Não ocorre a entrada de dois espermatozóides num mesmo óvulo, uma vez que, após a entrada de um primeiro
espermatozóide, a zona pelúcida do óvulo forma uma membrana de fecundação que impede a entrada de um segundo
espermatozóide; gêmeos monozigóticos se formam quando um óvulo é fecundado por um espermatozóide, formando um embrião
que se fragmenta em dois novos embriões.
Item II: verdadeiro. O DNA mitocondrial de um clone produzido na técnica descrita é proveniente da doadora do óvulo.
Item III: verdadeiro. A clonagem é feita de modo que o núcleo de uma célula diplóide do indivíduo a ser clonado é introduzido
num óvulo anucleado, formando um zigoto, que origina um embrião a ser implantado numa barriga de aluguel para que se
desenvolva.
Item IV: falso. A barriga de aluguel não contribui com DNA ou células para o embrião em desenvolvimento, a não ser que ela
tenha sido também doadora do óvulo, contribuindo com o DNA mitocondrial. Ainda assim, nenhuma célula do embrião será
proveniente da barriga de aluguel, mesmo que tenha sido também doadora do óvulo.
Item V: verdadeiro. O mesmo padrão genético herdado do pai por um indivíduo será também encontrado num clone desse
indivíduo.

18.
Resposta: B
Comentário: Fazendo as relações:
1. A clonagem gênica consiste na cópia de um segmento de DNA, como ocorre com as moléculas de DNA recombinante
utilizadas em técnicas de engenharia genética na produção de transgênicos. Essa pode ser feita “in vitro”, através de um
procedimento denominado PCR (reação de cadeia de polimerase), realizado a partir de enzimas sem a participação direta de seres
vivos, ou seja, em tubos de ensaio, ou “in vitro”, pela introdução do DNA em seres vivos como células bacterianas, que, ao se
reproduzirem, copiam também o DNA de interesse (B).
2. A clonagem reprodutiva ocorre naturalmente na espécie humana na produção de gêmeos univitelinos a partir da fecundação de
um óvulo com um espermatozoide, formando um zigoto que se divide em dois, originando dois seres (D).
3. A clonagem reprodutiva e artificial pode ser realizada em vegetais de várias maneiras, a fim de se obter mudas, como através da
coleta de células diploides isoladas de uma planta-mãe e cultivadas em soluções nutritivas submetidas a determinados hormônios
vegetais, numa técnica chamada de cultura de tecidos (A).
4. A clonagem terapêutica tem o objetivo de fabricar embriões clonados cujas células-tronco embrionárias são removidas e
induzidas a se diferenciarem em tipos específicos de células, tais como células musculares (C).

19.
Resposta: C
Comentário: A primeira etapa do desenvolvimento embrionário é a segmentação, que é caracterizada pelas primeiras divisões
mitóticas do embrião, chamadas clivagens, originado células denominadas blastômeros ou células-tronco embrionárias, as quais
são indiferenciadas e pluri/totipotentes, ou seja, capazes de se diferenciar em qualquer célula do adulto. Durante toda a
segmentação, os blastômeros ou células-tronco embrionárias são pluri/totipotentes, o que vai até a blástula, passando pela mórula.
Em humanos, no entanto, a blástula é chamada de blastocisto e se apresenta com duas regiões, o trofoblasto, massa periférica de
células que origina a placenta, e o embrioblasto, massa interna de células que origina o embrião. As células do embrioblasto da
blástula e da mórula são igualmente pluri/totipotentes, havendo mais células dessa qualidade no embrioblasto da blástula do que
na mórula. Como a blástula tem células que não são pluri/totipotentes, no trofoblasto, e células que são pluri/totipotentes, no
embrioblasto, pode-se afirmar que a mórula apresenta somente células pluri/totipotentes.
Observação: No caso de pesquisas que utilizam células-tronco embrionárias, a blástula é uma fonte melhor que a mórula por
apresentar maior quantidade de células desse tipo.

20.
Resposta: C
Comentário: Células-tronco são células indiferenciadas capazes de se diferenciar em novos tipos de células, tecidos ou órgãos.
Nem todas elas são capazes de sofrer diferenciação se