1322 Vol.
6, 1322–1327, April 2000
Colorectal Tumors Responding to 5-Fluorouracil Have Low Gene
Expression Levels of Dihydropyrimidine Dehydrogenase,
Thymidylate Synthase, and Thymidine Phosphorylase1
Dennis Salonga, Kathleen D. Danenberg,
Martin Johnson, Ralf Metzger, Susan Groshen,
Denice D. Tsao-Wei, Heinz-Josef Lenz,
C. Gail Leichman, Lawrence Leichman,
Robert B. Diasio, and Peter V. Danenberg2
University of Southern California/Norris Comprehensive Cancer
Center, University of Southern California School of Medicine, Los
Angeles, California 90033 [D. S., K. D. D., R. M., S. G., D. D. T-W.,
H-J. L., C. G. L., L. L., P. V. D.], and the Department of
Pharmacology and Toxicology, University of Alabama, Birmingham,
Alabama 35294 [M. J., R. B. D.]
ABSTRACT
We had previously shown that high gene expressions
(mRNA levels) of thymidylate synthase (TS; Leichman et al.,
J. Clin. Oncol., 15: 3223–3229, 1997) and thymidine phos-
phorylase (TP; Metzger et al., Clin. Cancer Res., 4: 2371–
2376, 1998) in pretreatment tumor biopsies could identify
tumors that would be nonresponsive to 5-fluorouracil (5-
FU)-based therapy. In this study, we investigated the asso-
ciation between intratumoral gene expression of the pyrim-
idine catabolism enzyme dihydropyrimidine dehydrogenase
(DPD) and the response of colorectal tumors to the same
5-FU-based protocol. DPD expressions were measured by
quantitative reverse transcription-PCR in 33 pretreatment
biopsies of colorectal tumors from patients who went on to
receive treatment with 5-FU and leucovorin (LV). The range
of DPD gene expression in those tumors that were nonre-
sponsive to 5-FU was much broader than that of the re-
sponding tumors. None of the tumors with basal-level DPD
expressions above a DPD:␤-actin ratio of 2.5 ⴛ 10ⴚ3 (14 of
33) were responders to 5-FU/LV therapy, whereas those
tumors with DPD gene expressions below DPD:␤-actin ratio
of 2.5 ⴛ 10ⴚ3 had a response rate of 50%. There was no
correlation among DPD, TS, and TP expression values in
this set of colorectal tumors, which indicated that these gene
expressions are independent variables. All of the tumors that
Received 7/21/99; revised 1/12/00; accepted 1/19/00.
The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked
advertisement in accordance with 18 U.S.C. Section 1734 solely to
indicate this fact.
1
Supported by USPHS Grants U01 CA 60108, RO1 CA 39629, RO1
CA60859, and P30 CA 14089. R. M. was supported by Dr. Mildred
Scheel Stiftung, Bonn, Germany.
2
To whom requests for reprints should be addressed, at University of
Southern California/Norris Comprehensive Cancer Center CRL-204,
1303 North Mission Road, Los Angeles, CA 90033. Phone: (213)
224-7788; Fax: (213) 224-7679; E-mail: pdanenbe@hsc.usc.edu.
Clinical Cancer Research
responded to 5-FU therapy (11 of 33) had expression values
of all three of the genes, TS, TP, and DPD, below their
respective nonresponse cutoff values, whereas, in each of the
nonresponding tumors, at least one of these gene expressions
was high. The patients with low expression of all three of the
genes had significantly longer survival than patients with a
high value of any one of the gene expressions. The results of
this study show that intratumoral gene expression level of
DPD is associated with tumor response to 5-FU and that the
use of more than one independent determinant of response
permits the identification of a high percentage of responding
patients.
INTRODUCTION
5-FU3 has been used for more than 40 years for the treat-
ment of various cancers and remains the standard first-line
treatment for colorectal cancer, although the response rate as a
single agent is usually less than 20% (1). Over the years, various
strategies have been attempted to increase the antitumor efficacy
of 5-FU by modulation of its intracellular metabolism and
biochemistry (2). We have been pursuing another approach for
improving therapy with 5-FU by identifying the biochemical
response determinants of this drug. If such determinants could
be measured in tumors before treatment, patients who are judged
unlikely to respond to 5-FU would then have the option to be
treated, instead, with another agent to which they might respond,
whereas those patients with favorable 5-FU response indices
could anticipate a higher than average probability of response.
We had previously found that the intratumoral levels of expres-
sion of the mRNA for the 5-FU target enzyme TS (3) and the
catabolic enzyme TP (4) were predictors of the sensitivity of
colorectal tumors to 5-FU-based protocols. TS and TP expres-
sion values that were above a certain threshold identified a
subset of tumors not responding to 5-FU, whereas expression
values below the nonresponse cutoff value number predicted an
appreciably higher response rate but did not specifically identify
responding tumors. However, we also noted that tumors with
both low TS and low TP had a higher response rate than tumors
with only one or the other gene expression being low (4); that is,
by combining response determinants, it was possible to achieve
a considerably better response prediction than with just one
determinant. This observation suggested that, with yet a third
independent response determinant, it might be possible to iden-
tify a set of tumors that would have a very high, if not 100%,
response rate to 5-FU-based protocols.
3
The abbreviations used are: 5-FU, 5-fluorouracil; TS, thymidylate
synthase; DPD, dihydropyrimidine dehydrogenase; LV, leucovorin; RT,
reverse transcription; TP, thymidine phosphorylase.

In this study, we examined intratumoral DPD expression as
a possible additional determinant of the response of colorectal
tumors to 5-FU treatment. DPD reduces the 5,6 double bond of
uracil (as well as that of 5-FU) and is the rate-limiting enzyme
for 5-FU catabolism (5–7). DPD activity is highly variable in
normal tissues (8) and, thus, by sufficiently influencing the
bioavailability of 5-FU, could affect its pharmacokinetics, tox-
icity, and antitumor activity. DPD levels not only vary among
individuals but also within the same individual on a Circadian
rhythm basis (9). Patients with DPD levels within the normal
range rapidly eliminate over 80% of administered 5-FU as
2-fluoro-␤-alanine, whereas patients who are deficient in DPD
retain 5-FU over a much longer half-life and excrete mostly
unchanged 5-FU in the urine (10). In such patients, 5-FU can
cause profound toxicity (11). Because inactivation of 5-FU by
DPD seemed to be a mechanism of clinical resistance to 5-FU,
vigorous efforts have been made to design inhibitors of DPD.
The most successful of these, 5-ethynyluracil, markedly im-
proved the efficacy and therapeutic index of 5-FU in rats (12).
In addition to its role in normal tissue toxicity of 5-FU, DPD
expression specifically in tumors has been studied as a possible
determinant of tumor response to 5-FU. DPD expression is
variable among tumors also, and, in head-and-neck tumors,
DPD levels have been inversely associated with response to
5-FU (13).
The above-cited studies, along with previous studies show-
ing that DPD and TS levels both were significantly associated
with sensitivity to 5-FU (14), suggested to us that DPD expres-
sion could be a useful 5-FU response determinant in colorectal
tumors along with TS and TP expression provided that: (a)
intratumoral basal DPD level was associated with clinical effi-
cacy of FU; (b) TS, TP, and DPD expressions were independent
variables; and (c) there was sufficient variation among individ-
uals in the expression of this gene. Accordingly, we used quan-
titative RT-PCR to measure DPD expression (relative mRNA
levels) in a group of 33 colorectal tumors in which we had
already determined TS and TP expressions, and we correlated
these expressions with response to 5-FU-based therapy.
MATERIALS AND METHODS
Clinical Methods. Eligibility criteria for these trial-and-
tumor-response-evaluation parameters were described previ-
ously in detail (3). In brief, eligible patients had (a) a diagnosis
of disseminated or recurrent colorectal cancer with a measurable
lesion accessible for biopsy; (b) a Southwest Oncology Group
performance status of 0 to 2 with adequate hematological,
hepatic, and renal function; (c) no prior infusional 5-FU; and (d)
a lesion that was bidimensionally measurable either by physical
or radiological examination. After placement of an indwelling
venous access, patients were treated with 5-FU (200 mg/m2/day)
as a continuous infusion administered by ambulatory infusion
pump (Pharmacia Deltec Cadd pump, Minneapolis, MN) with
LV (20 mg/m2) by i.v. push weekly. The initial cycle was given
for 4 weeks, followed by a 1-week rest, with subsequent cycles
consisting of 3 weeks continuous therapy and a 1-week rest.
Response rates and toxicity profiles for this regimen have been
published previously (15).
After two cycles (8 weeks) of treatment, measurable dis-
Clinical Cancer Research 1323
Fig. 1 DPD gene expressions in 33 colorectal tumors grouped accord-
ing to response (⬎50% tumor shrinkage) or nonresponse (⬍50% tumor
shrinkage).
ease was reassessed. Response criteria were the standard defi-
nitions used for national cooperative group trials (16). To be
classified as a responder, a tumor had to have a 50% reduction
in the sum of the products of the perpendicular diameters of the
indicator lesion without growth of other disease or the appear-
ance of new lesions. Those with responses or stable disease were
continued on protocol until progression was documented.
Liver metastases represented the most common site of
disease on which a biopsy was performed and assessed for
response, whereas, in some cases, nodal metastases or peritoneal
metastases were the disease sites evaluated. All of the specimens
were obtained by core-needle biopsy. This technique uses a
coaxial system in which fine-needle aspiration is used to con-
firm cytological evidence of cancer within moments of the
aspiration. The fine needle is withdrawn from a sheath and a
core needle is inserted through the sheath without losing posi-
tion. The core-needle material is used for gene expression anal-
ysis. Specimens were examined by pathologists and were not
used for analysis unless they were judged to consist of ⬎80%
tumor tissue.
Laboratory Methods. The procedure for RT-PCR quan-
titation of gene expression has been described in detail previ-
ously (17, 18). In brief, the method involves isolation of mRNA
from each tumor, preparation of cDNA using reverse tran-
scriptase and random hexamers and PCR amplification of the
specific cDNA of interest in a range of concentrations that gives
rise to a linear curve of the resulting PCR products. An internal
standard gene (for example, ␤-actin) from the same cDNA
solution is PCR-amplified separately. We found previously that
with ␤-actin as the reference gene, a good linearity is obtained
between gene expression values determined by RT-PCR and
protein content determined by immunohistochemistry (19).
Once the concentration ranges for linear amplification are es-
tablished for the cDNA of the target gene and the reference
gene, the ratio of the slopes generates an empirical number
proportional to the amount of mRNA of interest in the tissue
normalized to total RNA. Gene expression values are reported
only if the PCR of serial dilutions of the cDNA solution gen-
erates a set of distinct bands with intensities that are linear with
1324 Gene Expressions and Tumor Sensitivity to 5-FU

Table 1 Summary of response data for tumors with different expressions of DPD and TS genes
Gene expression status (values ⫻ 10⫺3) No. of responding patients No. of nonresponding patients P (Fisher’s two-tailed exact test)
DPD ⬍ 2.5 (n ⫽ 22) 11 11 0.005
DPD ⬎ 2.5 (n ⫽ 11) 0 11
DPD ⬍ 2.5, TS ⬍ 4.1 and TP ⬍ 18 (n ⫽ 11) 11 0 0.0001
DPD ⬎ 2.5 or TS ⬎ 4.1 or TP ⬎ 18 (n ⫽ 22) 0 22

the concentration of cDNA. Slopes of the lines are obtained

from at least three data points, so that each reported gene
expression value represents the average of a minimum of three
separate PCR reactions within the linear amplification range.
When the initially chosen cDNA concentrations for a particular
determination give PCR products clearly outside of the propor-
tional linearity region, the determination is repeated with ad-
justed cDNA concentrations until the data points are in the
linear range, and the correlation coefficient for linearity for a set
of at least three consecutive serial dilutions plus the zero point
is greater than 0.90. This method has been used by us (3, 19) as
well as by others (20) to quantitate various gene expressions in
tumor biopsy specimens. Gene expression values are expressed
as a ratio of PCR products of the gene of interest to that of the
internal reference gene ␤-actin.
For RT-PCR quantitation of DPD, the following primers were
designed based on the sequence of the DPD gene (GenBank
accession no. U20938): DPD-1740F, T7-GGTCTTGCTAGCG-
CAACTCC (“T7” designates the T7 RNA polymerase clamping
sequence TAATACGACTCACTATAGGGAGA attached to the
5⬘ end), and DPD-1989R, CCTTTAGTTCAGTGACACTTTGA.
These primers were designed to give an amplicon of 250 bp,
spanning positions 1740 to 1989 of the genomic sequence. ␤-actin
primers BA67 and BA68 were described previously (17). The PCR
reaction was performed as described previously (17, 18), except
that cycling conditions were modified to be optimal for the DPD
primers. The cycling conditions for DPD amplification were 15 s at
96°C, 30 s at 65°C, and 30 s at 72°C for 31 cycles.
Statistical Methods. To evaluate the association of DPD
with response and with survival, DPD was categorized into a
low and a high value. To determine this cutoff value, the
maximally selected ␹2 method of Miller and Halpern (21, 22)
was adapted. For each observed DPD value, patients were
classified as falling below or equal to that value, or above that
value. The Pearson ␹2 test statistic was used to compare the
response rates of the two resulting groups of patients (below or
equal to the value versus above the value). The DPD value that
yielded the largest ␹2 test statistic (the maximal ␹2 statistic) was
selected as the optimal cut-point. To determine the P-value
associated with the maximal ␹2 statistic, we performed 2000
bootstrap-like simulations. For each simulation, a randomly
selected DPD value was drawn (with replacement) from the set
of observed DPD values and assigned to each of the observed
responses; the maximal ␹2 test statistic was calculated based on
this set of randomly matched DPD values and responses. The
corrected P-value was calculated as the proportion of the 2000
simulated maximal statistics that was larger than the original
maximal ␹2 test statistic; the calculated corrected value was
0.033, compared with the uncorrected P of 0.0041. This analysis
was repeated using the log-rank test to compare survival. For
Fig. 2 DPD expressions plotted against TS expressions in the same set
of 33 colorectal tumors. The values for TS expression were obtained
from a previously published study (3). The dotted lines indicate the
nonresponse cutoff values for each gene expression.
this analysis, the calculated corrected value was 0.03, compared
with the uncorrected P of 0.0015. These corrected Ps account
for the fact that all of the possible DPD values were examined
before selecting the optimal cut-point. In both analyses, the
optimal DPD cut-point was 2.5. The rest of the analysis was
descriptive, and P-values were calculated to reflect the magni-
tude of associations rather than to perform formal testing. The
cutoff values for TS and TP expressions were based on the
highest level in the group of responders (therefore, no patient
with a TS ⱖ 4.1 or a TP ⱖ 18 was a responder). To examine the
joint association of TS, TP, and DPD with either response or
survival, the 2⫻2⫻2 ⫽ 8 groups of patients were examined.
The group of patients with TS ⱕ 4, TP ⱕ 18, and DPD ⱕ 2.5,
was the largest (n ⫽ 11 patients) and also identified a subset
with a longer survival; the outcome of this subset was compared
with the others. To evaluate the association with response, the
two-sided Fisher’s exact test was used; the Spearman correlation
was used to evaluate the association between DPD and TS; the
log-rank test was used to measure the association between TS,
TP, and DPD, and survival. The Ansari-Bradley test was used to
compare the responders and nonresponders in terms of the
variability of DPD gene expression (23).
RESULTS
Relative DPD mRNA content was determined by quanti-
tative RT-PCR (17, 18) in biopsy specimens from 33 colorectal
cancer patients analyzed previously for TS expression levels (3).
Tumors were categorized as either responding or not responding

Fig. 3 DPD, TS, and TP expressions in tumors grouped according to response or no response to 5-FU treatment. The gene expression values shown
on the ordinate were normalized with respect to the highest value on each group. The numbers on the X-axis are identification numbers for each of
the tumor specimens.
to a regimen of 5-FU and LV (see “Materials and Methods” for
definition of clinical response criteria). Fig. 1 shows the distri-
butions of DPD:␤-actin PCR product ratios (henceforth termed
“expressions” for convenience) for the two groups. The range of
DPD expressions among the responding tumors was relatively
narrow (0.60 ⫻ 10⫺3 to 2.5 ⫻ 10⫺3, 4.2-fold) compared with
that of the nonresponders (0.2 ⫻ 10⫺3 to 16 ⫻ 10⫺3, 80-fold).
This difference in the range of gene expression between the
responding and nonresponding groups was significant (P ⫽
0.019, Ansari-Bradley rank test), as was the lack of responding
tumors with DPD expressions ⬎2.5 ⫻ 10⫺3 (Table 1). A total
of 22 tumors had DPD expressions ⬍ 2.5 ⫻ 10⫺3 with a
corresponding response rate of 50% (11 of 22).
For tumor response prediction, it was of interest to deter-
mine the relationship between these gene expressions. For ex-
ample, if TS and DPD were coregulated, there would be little or
no additional benefit for response prediction from measuring
two gene expressions, whereas if the genes were independently
regulated, some portion of the low-TS patients might be identi-
fied as nonresponders by their high DPD expression. A plot of
DPD against TS expressions (Fig. 2) showed no correlation
between the expressions of these genes (r2, 0.01), with a number
of low-DPD tumors having high TS and high-TS tumors having
low DPD expressions. As Fig. 3 further shows, only 1 of 12
tumors falling within the area designated by the nonresponse
cutoff values of TS and DPD (i.e., having both low TS and low
DPD) was a nonresponder to 5-FU/LV, but this one tumor (Fig.
3, tumor 152) had a TP expression value above its cutoff. Thus,
all of the responding tumors could be identified by low expres-
sion values of DPD, TS, and TP (Fig. 3). The response data are
summarized in Table 1.
Longer periods of survival have been observed for colo-
Clinical Cancer Research 1325
rectal cancer patients whose tumors respond to chemotherapy
(24). In the present study also, survival for those patients with
DPD values below the nonresponse threshold of DPD ⬍ 2.5 ⫻
10⫺3 was significantly longer than for those patients with DPD
above this value (Fig. 4, upper panel). The greatest increase in
survival was observed for the group of patients with all of the
three genes, DPD, TS, and TP below the respective nonresponse
cutoff values (Fig. 4, lower panel).
DISCUSSION
In this study, we have shown a significant correlation
between DPD expression levels in colorectal tumors, response
to 5-FU, and patient survival. The pattern of DPD expressions
as a function of response or nonresponse resembled that of TS
and TP expressions determined previously (3, 4) in that: (a) the
range of gene expressions among the nonresponders was con-
siderably broader than among the responders; and (b) there was
a cutoff value of DPD expression (DPD:␤-actin, 2.5 ⫻ 10⫺3)
above which there were no 5-FU-responsive tumors, whereas
the set of tumors with expressions below the cutoff value
comprised both responders and nonresponders. Thus, low DPD
expressions do not uniformly identify responding tumors but do
predict a high response rate of 50%. However, because TS and
DPD gene expressions are independently regulated (as indicated
by the lack of correlation between them in Fig. 2), 10 of these
low-DPD tumors could be positively identified as nonre-
sponders by TS expression values ⬎4.1 ⫻ 10⫺3 (the nonre-
sponse cutoff value for TS expression). Thus, tumors having
both TS ⬍ 4.1 ⫻ 10⫺3 and DPD ⬍ 2.5 ⫻ 10⫺2 in this group of
patients had a 92% response rate. Adding TP expression as a
third determinant allowed all of the responders in this group of
1326 Gene Expressions and Tumor Sensitivity to 5-FU
Fig. 4 Survival (Kaplan-Meier) plots indicating probability of survival
for patients with DPD expressions above or below the nonresponse
cutoff [DPD:␤-actin ⫽ 2.5 ⫻ 10⫺3 (upper panel)]; and for patients with
DPD, TS, and TP expressions either above or below their respective
nonresponse cutoff values (DPD:␤-actin ⫽ 2.5 ⫻ 10⫺3; TS:␤-actin ⫽
4.1 ⫻ 10⫺3; and TP:␤-actin ⫽ 18 ⫻ 10⫺3 (lower panel)].
tumors to be identified by low expression of all of the three
genes (Fig. 3). These data show how combining more than one
independent response determinant can increase predictive power
for clinical outcome.
It is striking to see in Fig. 3 that the patterns of expression
of TS, DPD, and TP vary over a wide range and are different in
every one of the nonresponding tumors. This almost chaotic
variation of gene expressions among the individual tumors of
the nonresponding group compared with the responding group,
suggests that the transition from a drug-sensitive tumor to one
that is insensitive is accompanied or preceded by a substantial
degradation of the ability of the tumor cells to regulate their
gene expressions.
This study also shows that, because response of colorectal
tumors to chemotherapy is associated with a significant survival
benefit (24), measuring these gene expressions not only can
predict response to 5-FU but also can identify patients with a
better survival prognosis. If these results can be confirmed in a
clinical trial with a larger set of patients, data on TS, DPD, and
TP expressions in tumors would permit more rational decisions
on whether or not to proceed with 5-FU-based therapy as
first-line treatment. If the 5-FU response indices seem unfavor-
able, the alternative drug CPT-11 is now available for treatment
of colorectal cancer patients. Preliminary results show that tu-
mors with TS expression levels that would put them into the
group not expected to respond to 5-FU, or indeed have already
been treated and have failed 5-FU, do respond to CPT-11 (25).
If patients destined for 5-FU failure can be identified before the
start of treatment, benefits will of course be gained by avoiding
the toxicity associated with the drug, but, moreover, it is pos-
sible that patients will be more likely to respond to CPT-11
when it is given as primary therapy, compared with its use after
5-FU failure. Thus, the assignment of patients for either 5-FU or
CPT-11 treatment by taking into consideration their TS, DPD, or
TP levels may provide a way of achieving a substantial increase
in the overall response rate to chemotherapy using currently
available agents.
REFERENCES
1. Moertel, C. G. Chemotherapy for colorectal cancer. N. Engl. J. Med.,
330: 1136 –1142, 1994.
2. Soros, G. A., Grogan, L. M., and Allegra, C. J. Preclinical and
clinical aspects of biomodulation of 5-fluorouracil. Cancer Treat. Rev.,
20: 11– 49, 1994.
3. Leichman, C. G., Lenz, H-J., Leichman, L., Danenberg, K., Baranda,
J., Groshen, S., Boswell, W., Metzger, R., Tan, M., and Danenberg,
P. V. Quantitation of intratumoral thymidylate synthase expression
predicts for disseminated colorectal cancer response and resistance to
protracted infusion 5-fluorouracil and weekly leucovorin. J. Clin. On-
col., 15: 3223–3229, 1997.
4. Metzger, R., Danenberg, K. D., Leichman, C. G., Salonga, D.,
Schwartz, E. L., Wadler, S. Lenz, H-J., Groshen, S., Leichman, L., and
Danenberg, P. V. High basal level gene expression of thymidine phos-
phorylase (platelet-derived endothelial cell growth factor) in colorectal
tumors is associated with non-response to 5-fluorouracil. Clin. Cancer
Res., 4: 2371–2376, 1998.
5. Naguib, F. N. M., El Kouni, A. M., and Cha, S. Enzymes of uracil
catabolism in normal and neoplastic human tissues. Cancer Res., 45:
5405–5412, 1985.
6. Lu, Z., Zhang, R., and Diasio, R. B. Purification and characterization
of dihydropyrimidine dehydrogenase from human liver. J. Biol. Chem.,
267: 17102–17109, 1992.
7. Johnson, M. R., Wang, K., Tillmanns, S., Albin, N., and Diasio, R. B.
Structural organization of the human dihydropyrimidine dehydrogenase
gene. Cancer Res., 57: 1660 –1663, 1997.
8. Heggie, D., Sommadossi, J. P., Cross, D. S., Huster, W. J., and
Diasio, R. B. Clinical pharmacokinetics of 5-fluorouracil and its metab-
olites in plasma, urine, and bile. Cancer Res., 47: 2203–2206, 1987.
9. Grem, J. L., Yee, L. K., Venzon, D. J., Takimoto, C. H., and Allegra,
C. J. Inter- and intra-individual variation in dihydropyrimidine dehy-
drogenase activity in peripheral blood mononuclear cells. Cancer Che-
mother. Pharmacol., 40: 117–125, 1997.
10. Harris, B. E., Song, R., He, Y. J., Soong, S. J., and Diasio, R. B.
Relationship between dihydropyrimidine dehydrogenase activity and
plasma drug levels in cancer patients receiving 5-fluorouracil by pro-
tracted continuous infusion. Cancer Res., 50: 197–201, 1990.
11. Lyss, A. P., Lilenbaum, R. C., Harris, B. E., and Diasio, R. B.
Severe 5-fluorouracil toxicity in a patient with decreased dihydropy-
rimidine dehydrogenase activity. Cancer Investig., 11: 239 –240, 1993.
12. Cao, S., Rustum, Y. M., and Spector, T. 5-Ethynyluracil modulation
of the efficacy and therapeutic index in rats bearing advanced colorectal
carcinoma. Cancer Res., 54: 1507–1510, 1994.
13. Etienne, M. C., Cheradame, S., Fischel, J. L., Formento, P., Das-
sonville, O., Renee, N., Schneider, M., Thyss, A., Demard, F, and
Milano, G. Response to fluorouracil therapy in cancer patients: the role
of intratumoral dihydropyrimidine dehydrogenase activity. J. Clin. On-
col., 13: 1663–1670, 1995.
14. Beck, A., Etienne, M. C., Cheradame, S., Fischel, J. L., Formento,
P., Renee, N., and Milano, G. A role for dihydropyrimidine dehy-

drogenase and thymidylate synthase in tumor sensitivity to 5-fluorou-
racil. Eur. J. Cancer, 30: 1517–1522, 1994.
15. Leichman, C. G., Leichman, L., Spears, C. P., Rosen, P. J., Jeffers,
S., and Groshen, S. Prolonged continuous infusion of fluorouracil with
weekly bolus leucovorin: a Phase II study in patients with disseminated
gastrointestinal cancers. J. Natl. Cancer Inst., 85: 41– 44, 1993.
16. Green, S., and Weiss, G. R. Southwest Oncology Group standard
response criteria, endpoint definitions, and toxicity criteria. Investig.
New Drugs, 10: 239 –253, 1992.
17. Horikoshi, T., Danenberg, K. D., Stadlbauer, T. H. W., Volkenandt,
M., Shea, L. L. C., Aigner, K., Gustavsson, B., Leichman, L., Frösing,
R., Ray, M., Gibson, N. W., Spears, C. P., and Danenberg, P. V.
Quantitation of thymidylate synthase, dihydrofolate reductase, and DT-
diaphorase gene expression in human tumors using the polymerase
chain reaction. Cancer Res., 52: 108 –116, 1992.
18. Lenz, H-J., Hill, C., Danenberg, K. D., Leichman, L. L., Priest,
D. G., and Danenberg, P. V. Rapid quantitative PCR for determination
of relative gene expressions in tissue specimens. PCR Methods Appl., 4:
305–309, 1995.
19. Johnston, P. G., Lenz, H-J., Leichman, C. G., Danenberg, K. D.,
Allegra, C. J., Danenberg, P. V., and Leichman, L. Thymidylate syn-
Clinical Cancer Research 1327
thase gene and protein expression correlate and are associated with
response to 5-fluorouracil in human colorectal and gastric tumors.
Cancer Res., 55: 1407–1412, 1995.
20. Kuo, D. Y-S., Mallick, S., Shen, H-J., DeVictoria, C., Jones, J.,
Fields, A. L., Goldberg, G. L., Runowicz, C. D., and Horwitz, S. B. Clin.
Cancer Res., 2: 1981–1992, 1996.
21. Miller, R., and Siegmund, D. Maximally selected ␹2 statistics.
Biometrics, 38: 1011–1016, 1982.
22. Halpern, J. Maximally selected ␹2 statistics for small samples.
Biometrics, 38: 1017–1023, 1982.
23. Hoolander, M., and Wolfe, N. A. Statistical Methods. New York:
John Wiley & Sons, 1973.
24. Graf, W., Pählman, L., Bergström, R., and Glimelius, B. The
relationship between an objective response to chemotherapy and
survival in advanced colorectal cancer. Br. J. Cancer, 70: 559 –563,
1994.
25. Saltz, L., Danenberg, K., Paty, P., Kelsen, D., Kemeny, N., Salonga,
D., Park, J. M., and Danenberg, P. High thymidylate synthase activity
does not preclude activity of CPT-11 in colorectal cancer (CRC). Proc.
Am. Soc. Clin. Oncol., 17: 1080, 1998.