Você está na página 1de 151

______________________________________________________________________________________________________

UNIDADES
EDITORA BILBIOTECA
MAGISTERIAL
Y

SESIONES

____________________________________________________________________________________________________
V- DICIEMBRE 1
______________________________________________________________________________________________________

EDITORA BILBIOTECA
MAGISTERIAL

____________________________________________________________________________________________________
V- DICIEMBRE 2
______________________________________________________________________________________________________
UNIDAD DIDÁCTICA DEL MES DE DICIEMBRE
“EL AMOR FAMILIAR ES EL MEJOR REGALO QUE PODEMOS
RECIBIR EN NAVIDAD”
Trimestre III
CICLO V – Quinto grado de primaria

PROYECTO (2 semanas)
Situación de contexto:
 Leen el texto: “Carta de Jesús”:
Querido Amigo:
Hola, te amo mucho. Como sabrás, nos estamos acercando otra vez a la fecha en que festejan
mi nacimiento.
El año pasado hicieron una gran fiesta en mi honor y me da la impresión que este año ocurrirá lo
mismo. Ha transcurrido ya mucho tiempo cuando comprendían y agradecían de corazón lo
mucho que hice por toda la humanidad.

EDITORA BILBIOTECA
Pero hoy en día, da la impresión de que la mayoría de la gente apenas si sabe por qué motivo
se celebra mi cumpleaños.
Por otra parte, me gusta que la gente se reúna y lo pase bien y me alegra sobre todo que los
niños se diviertan tanto; pero aun así, creo que la mayor parte no sabe bien de qué se trata. ¿No

MAGISTERIAL
te parece?
Como lo que sucedió, por ejemplo, el año pasado: al llegar el día de mi cumpleaños, hicieron
una gran fiesta, pero ¿Puedes creer que ni siquiera me invitaron? ¡Imagínate! ¡Yo era el invitado
de honor! ¡Pues se olvidaron por completo de mí!
Resulta que habían estado preparándose para las fiestas durante dos meses y cuando llegó el
gran día me dejaron al margen. Ya me ha pasado tantísimas veces que lo cierto es que no me
sorprendió.
Aunque no me invitaron, se me ocurrió colarme sin hacer ruido. Entré y me quedé en mi rincón.
¿Te imaginas que nadie advirtió siquiera mi presencia, ni se dieron cuenta de que yo estaba
allí?
Estaban todos bebiendo, riendo y pasándolo en grande, cuando de pronto se presentó un
hombre gordo vestido de rojo y barba blanca postiza, gritando: "¡jo, jo, jo!".
Parecía que había bebido más de la cuenta, pero se las arregló para avanzar a tropezones entre
los presentes, mientras todos los felicitaban. Cuando se sentó en un gran sillón, todos los niños,
emocionadísimos, se le acercaron corriendo y diciendo: ¡Santa Clos! ¡Cómo si él hubiese sido el
homenajeado y toda la fiesta fuera en su honor!
Aguanté aquella "fiesta" hasta donde pude, pero al final tuve que irme. Caminando por la calle
me sentí solitario y triste. Lo que más me asombra de cómo celebra la mayoría de la gente el
día de mi cumpleaños es que en vez de hacer regalos a mí, ¡se obsequian cosas unos a otros! y
para colmo, ¡casi siempre son objetos que ni siquiera les hacen falta!
Te voy a hacer una pregunta: ¿A ti no te parecería extraño que al llegar tu cumpleaños todos tus
amigos decidieron celebrarlo haciéndose regalos unos a otros y no te dieran nada a ti? ¡Pues es
lo que me pasa a mí cada año!
Una vez alguien me dijo: "Es que tú no eres como los demás, a ti no se te ve nunca; ¿Cómo es
que te vamos a hacer regalos?". Ya te imaginarás lo que le respondí.
Le dije: "Escucha bien, todo lo que regales a tus semejantes para aliviar su necesidad, ¡Lo
contaré como si me lo hubieras dado a mí personalmente!" (Mateo 25,34-40).
Muchas personas en esta época en vez de pensar en regalar, hacen bazares o ventas de

____________________________________________________________________________________________________
V- DICIEMBRE 3
______________________________________________________________________________________________________
garaje, donde venden hasta lo que ni te imaginas con el fin de recaudar hasta el último centavo
para sus nuevas compras de Navidad.
Lamentablemente, cada año que pasa es peor. Llega mi cumpleaños y sólo piensan en las
compras, en las fiestas y en las vacaciones y yo no pinto para nada en todo esto.
Me agradaría muchísimo más nacer todos los días en el corazón de mis amigos y que me
permitieran morar ahí para ayudarles cada día en todas sus dificultades, para que puedan
palpar el gran amor que siento por todos.
Por eso lo que pido es que me dejes entrar en tu corazón. Llevo años tratando de entrar, pero
hasta hoy no me has dejado. "Mira yo estoy llamando a la puerta, si alguien oye mi voz y abre la
puerta, entraré en su casa y cenaremos juntos". Confía en mí, abandónate en mí. Este será el
mejor regalo que me puedas dar. Gracias
Tu amigo Jesús

 Responden las interrogantes:


- Y tú ¿Cómo te preparas para recibir la Navidad?
- ¿Qué opinas del texto leído anteriormente?

EDITORA BILBIOTECA
- ¿Crees que se da la preparación adecuada para la navidad? ¿Por qué?

MAGISTERIAL

____________________________________________________________________________________________________
V- DICIEMBRE 4
______________________________________________________________________________________________________
SEMANA Nº 1
“ESPERAMOS CON ENTUSIASMO Y RESPONSABILIDAD LA LLEGADA DE
JESÚS”
Día Nro. 1
“NOS PREPARAMOS PARA LA LLEGADA DE JESÚS”
NEGOCIACIÓN Y SENSIBILIZACIÓN DEL PROYECTO”
• PROPÓSITOS DE APRENDIZAJE
Evidencias de
Competencia / Campo
Área Desempeños aprendizaje /
Capacidad temático
Inst. de valoración
ER 2. Asume la experiencia Nacimiento - Relaciona el amor de Dios con - Reflexiona sobre el
del encuentro personal y de Jesús. sus experiencias de vida, para nacimiento de Jesús
comunitario con Dios en actuar con coherencia. para alcanzar una
su proyecto de vida en convivencia justa y
coherencia con su fraterna con los
creencia religiosa. demás.

EDITORA BILBIOTECA
2.1. Transforma su
entorno desde el
encuentro personal y
comunitario con Dios y
- Prueba escrita.

MAGISTERIAL
desde la fe que profesa.
C 2. Lee diversos tipos de Textos - Opina sobre el contenido del - Elabora
textos escritos en su literarios. texto, la organización textual, la sociogramas de
lengua materna. Sociograma intención de algunos recursos textos navideños
2.3. Reflexiona y evalúa textuales (negritas, esquemas) ordenando sus
la forma, el contenido y y el efecto del texto en los ideas de forma
contexto del texto lectores, a partir de su coherente y
experiencia y del contexto cohesionada.
sociocultural en que se - Lista de cotejos
desenvuelve.
3. Escribe diversos tipos - Escribe textos de forma
de textos en su lengua coherente y cohesionada.
materna. Ordena las ideas en torno a un
3.2. Organiza y desarrolla tema, las jerarquiza en
las ideas de forma subtemas de acuerdo a
coherente y cohesionada párrafos, y las desarrolla para
ampliar la información, sin
digresiones o vacíos.
Establece relaciones entre las
ideas, como causa- efecto,
consecuencia y contraste, a
través de algunos referentes y
conectores. Incorpora de forma
pertinente vocabulario que
incluye sinónimos y algunos
términos propios de los
campos del saber.

PS 5. Gestiona El - Representa de diversas - Plantea propuestas


responsablemente los consumismo maneras cómo influye la para ahorrar dinero
____________________________________________________________________________________________________
V- DICIEMBRE 5
______________________________________________________________________________________________________
Evidencias de
Competencia / Campo
Área Desempeños aprendizaje /
Capacidad temático
Inst. de valoración
recursos económicos. publicidad en sus decisiones en Navidad y dejar
5.2. Toma decisiones de consumo. de lado el
económicas y financieras consumismo.
- Escala de
valoración.

ÁREA: EDUCACIÓN RELIGIOSA


¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Preparar las imágenes de la parte inicial, Copia de - Reproductor de audio. Imágenes, biblia, cuadernos,
imagen para colorear, Copia de prueba escrita. papelógrafos, plumones, colores.
INICIO:
 Se les hace escuchar audios de canciones de navidad
 Se pregunta ¿Cómo se sintieron al cantar los villancicos? ¿Qué festividad cristiana se acerca? Se
escucha las respuesta de los estudiantes

EDITORA BILBIOTECA
 Presentamos una sopa de letras de los Personajes de Belén, en un minuto deberán encontrar a
los personajes de Belén

MAGISTERIAL

AGUADORA JOSE MOLINERO PESCADOR


ALFABERO LAVANDERA NIÑO POSADERO
ANGEL LEÑADOR PAJE REYES
CASTAÑERA MARIA PANADERO SEGADOR
HILANDERA PASTOR
 Luego, leen información sobre la Navidad:
La celebración de la Navidad se remonta a las fiestas paganas que celebraban el solsticio
de invierno y la llegada de la primavera. La Navidad no fue oficialmente reconocida hasta el
año 345, cuando por influencia de San Juan Crisóstomo y San Gregorio Nacianzeno se

____________________________________________________________________________________________________
V- DICIEMBRE 6
______________________________________________________________________________________________________
proclamó el 25 de diciembre como fecha de la Natividad.
La tradición de armar el nacimiento se le atribuye a San Francisco de Asís. En la Navidad de
1223, él tuvo la inspiración de reproducir en vivo el misterio del nacimiento de Jesús en la
gruta de Greccio. Construyó una casita de paja a modo de portal, puso un pesebre en su
interior, trajo un buey y un asno de los vecinos del lugar e invitó a un pequeño grupo de
gente a reproducir la escena de la adoración de los pastores. Dice la tradición que, de
manera milagrosa, aparecieron ángeles, el Niño Jesús, la Santísima Virgen y San José.
Desde entonces se extendió la costumbre de armar los nacimientos por todo el mundo.
Los villancicos son cantos populares que aluden al misterio de la Navidad y que se cantan
acompañados de instrumentos musicales. Los temas hacen referencia de los elementos que
Intervienen en la fiesta navideña. Su origen se remonta al siglo XIII.
 Rescatamos los saberes previos de los estudiantes: ¿Qué información te ha llamado más
la atención? ¿Por qué? ¿Qué es para ti la navidad? ¿Qué celebramos en navidad? ¿Qué
es lo que más te gusta de la fiesta de navidad? ¿Qué es lo más importante en la fiesta de
navidad? ¿Conoces la historia del nacimiento de Jesús?
 Se comunica el propósito de la sesión:

HOY REFLEXIONARAN SOBRE EL VERDADERO SIGNIFICADO DE LA NAVIDAD.

EDITORA BILBIOTECA
 Se acuerda las normas de convivencia:
- Respetar a los compañeros.
- Levantar la mano para intervenir.
DESARROLLO
Ver MAGISTERIAL
 De forma individual, describen en tarjetas cómo celebran la navidad con su familia.
NAVIDAD CON MI FAMILIA
Yo lo celebro de la siguiente manera:
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________

 Leen información acerca de la Navidad.


Navidad
La Navidad es una fiesta que se celebra en muchos países del mundo. Muchas personas aprovechan esta fecha
para reunirse con toda la familia, olvidar las diferencias que tengan con los demás y extender mensajes de paz,
esperanza y fraternidad por todo el mundo. El ambiente navideño despierta en las personas sentimientos de
buena voluntad que inundan las calles, escuelas y oficinas. Sin embargo, algunos han cambiado el sentido
auténtico de la Navidad, haciendo de ella una oportunidad para el consumismo; pareciera ser que cuanto más
costoso es el regalo que se da más grande es el amor que se tiene por el otro. Descubramos el verdadero
sentido de la Navidad, fiesta del amor y de la alegría verdadera.
Juzga
 Leen unas citas bíblicas (Lucas, mateo) acerca del Nacimiento de Jesús.

____________________________________________________________________________________________________
V- DICIEMBRE 7
______________________________________________________________________________________________________
Acogemos a nuestro salvador (Lucas, Mateo)
Por aquellos días salió un decreto del emperador Augusto, por el que se debía proceder a un censo en todo el
imperio. Todos, pues, empezaron a moverse para ser registrados cada uno en su ciudad natal. José también, que
estaba en Galilea, en la ciudad de Nazaret, subió a Judea, a la ciudad de David, llamada Belén, porque era
descendiente de David; allí se inscribió con María, su esposa, que estaba embarazada.
Mientras estaban en Belén, llegó para María el momento del parto y dio a luz a su hijo primogénito. Lo envolvió en
pañales y lo acostó en un pesebre, pues no había lugar para ellos en la sala principal de la casa.
En la región había pastores que vivían en el campo y que por la noche se turnaban para cuidar sus rebaños. Se
les apareció un ángel del Señor, y la gloria del Señor los rodeó de claridad. Y quedaron muy asustados.
Pero el ángel les dijo: "No tengan miedo, pues yo vengo a comunicarles una buena noticia, que será motivo de
mucha alegría para todo el pueblo: hoy, en la ciudad de David, ha nacido para ustedes un Salvador, que es el
Mesías y el Señor. Miren cómo lo reconocerán: hallarán a un niño recién nacido, envuelto en pañales y acostado
en un pesebre".
De pronto una multitud de seres celestiales aparecieron junto al ángel, y alababan a Dios con estas palabras:
"Gloria a Dios en lo más alto del cielo y en la tierra paz a los hombres esta es la hora de su gracia".
Después que los ángeles se volvieron al cielo, los pastores se dijeron unos a otros: "Vayamos, pues, hasta Belén
y veamos lo que ha sucedido y que el Señor nos ha dado a conocer". Fueron apresuradamente y hallaron a María
y a José con el recién nacido acostado en el pesebre.
(Lc 2,1.3-16)

EDITORA BILBIOTECA
Jesús había nacido en Belén de Judá durante el reinado de Herodes. Unos Magos que venían de Oriente llegaron
a Jerusalén preguntando: "¿Dónde está el rey de los judíos recién nacido? Porque hemos visto su estrella en el
Oriente y venimos a adorarlo".
(Mt 2,1-2)

MAGISTERIAL
 Reflexionan y expresan el significado de la navidad.
Para los cristianos
La Navidad significa uno de los grandes tiempos del año litúrgico. Celebramos uno de los profundos misterios de
nuestra fe: el que Dios se haya hecho hombre. También es una invitación a recordar que Dios nos ama tanto que
nos ha dado a su Hijo Unigénito. La Navidad es la fiesta de un Dios que se hace niño que entra en nuestro mundo
sin poder, ni riqueza, débil, frágil y pequeño. No es la fiesta de los regalos y las compras de banquetes y grandes
gastos. Por eso la celebración cristiana de Navidad que cada año recordamos ha de ser la fiesta de la solidaridad
del amor a los pequeños del compartir de confiar en un Dios que no olvida a su pueblo. La Navidad es sentir que
Jesús vuelve a nacer en nuestros corazones. Su presencia en nosotros nos invita a dar y compartir lo que tenemos
con los más desfavorecidos: los huérfanos, los ancianos, los que no tienen familia, los desvalidos; porque en ellos
está también Jesús.
La Iglesia celebra el tiempo de Navidad desde la tarde del 24 de diciembre hasta la fiesta de la Epifanía o
manifestación de Dios a los Reyes Magos que representan a toda la humanidad.
Actuar
 Realizan una actividad grupal: “El pesebre de Jesús” y comparten sus experiencias.
EL PESEBRE DE JESÚS
Jesús fue colocado en un pesebre al momento de nacer.
1. Arman el pesebre de Jesús en el aula con sus acciones:
• Redactan con tu grupo un listado de acciones solidarias en bien de los demás.
• Cortan veinte pedazos de lana de quince centímetros de largo del color que desees.
• Colocan dos lanitas en el pesebre por cada acción solidaria que realices.
• El último día de la clase acomoda al Niño Jesús en el pesebre de tu salón. Y mira si está bien
acolchonadito.
Escribe aquí las acciones con las que colaboraste a preparar el pesebre de Jesús.
a. __________________________________________________________________________
b.Pensaré
__________________________________________________________________________
en las necesidades de
2. Anota en los recuadros los presentes que darás al Niño _____________________
Jesús en esta Navidad. Utiliza los
los demás para poder
dones que te ha regalado Dios.
ayudarlos. _____________________

____________________________________________________________________________________________________
_____________________ _____________________
V- DICIEMBRE 8
_____________________ _____________________
La navidad celebra: La navidad no es tanto:
____________________ ____________________
______________________________________________________________________________________________________
____________________ ____________________

3. Realiza estas preguntas entre familiares y amigos; con los datos obtenidos,
a. ¿Con quiénes celebras la Navidad? Respuesta libre
b. ¿Cuál es para ti el mejor regalo de Navidad?

El mejor regalo de Navidad es ____________________________________________

 Felicitamos la labor realizada a lo largo de la sesión y se resalta el cumplimiento a las normas de


convivencia
CIERRE
 Se responden las preguntas: ¿Les gustó la actividad? ¿Les resultó difícil responder las
preguntas? ¿Por qué es importante conocer el verdadero significado de la Navidad?

EDITORA BILBIOTECA
 Como actividad de extensión resuelven la siguiente actividad:
ACTIVIDADES
1. Marca con una aspa ()
a. La navidad

MAGISTERIAL
___ Es uno de los grandes tiempos del año litúrgico cristiano.
___ Es importante porque se dan regalos.
___ Es la fiesta de la solidaridad, del amor y de la esperanza.

2. Anota en el siguiente esquema la información que se te pide.

3. Diseña una tarjeta de navidad para compartir con tus amigos y amigas su verdadero
significado. Anota en las líneas lo que escribirás en la tarjeta.

_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

4. Enumera de acuerdo al grado de importancia que tienen para ti lo siguiente.


a. Los regalos. e. Las calles luminosas y de color.
b. La familia unida. f. Los villancicos.
c. La cena de Noche Buena. g. La representación de nacimientos en vivo.
d. La decoración y arreglo de la casa.

 Se evalúa a través de una ficha de evaluación.


PRUEBA OBJETIVA
1. Narran la historia del Nacimiento de Jesús.
____________________________________________________________________________________________________
V- DICIEMBRE 9
______________________________________________________________________________________________________
_______________________________________________________________________________
_______________________________________________________________________________
_______________________________________________________________________________
_______________________________________________________________________________
_______________________________________________________________________________
_______________________________________________________________________________
_______________________________________________________________________________
_______________________________________________________________________________
_______________________________________________________________________________
_______________________________________________________________________________
___________________________________________________________________________
2. Completar en el espacio vacío:
a. “Aconteció en quellos días, que se promulgo un edicto de parte de Augusto Cesar, que todo el
mundo fuese ______________” (Lucas 2,1)
b. “Este primer censo se hizo siendo Cirenio gobernador de ______________” (Lucas 2,2)
c. “Y dio a luz a su hijo ____________, lo envolvió en ______________, y lo acostó en un
_________________, porque no había lugar para ellos en el mesón” (Lucas 2,7)
3. Subraya la respuesta correcta:
Y José subió… (Lucas 2,4)
a. De Galilea

EDITORA BILBIOTECA
b. De Nazaret
c. A Judea
d. A la ciudad de David
e. De Belén

MAGISTERIAL
5. Completa el siguiente crucigrama.
a. Fiesta que recuerda la manifestación de Jesús a toda la humanidad.
b. Lugar donde María acostó a Jesús envuelto en pañales.
c. Personas a quienes el ángel anunció el nacimiento de Jesús.
d. Guió a los Reyes Magos hasta Jesús.
e. Ciudad donde vivían María y José.
f. Rey a quien Dios prometió que su descendiente sería el Mesías.
g. Lugar de procedencia de los Reyes Magos.
F

A
G

____________________________________________________________________________________________________
V- DICIEMBRE 10
______________________________________________________________________________________________________
6. Traza las líneas con un color diferente y descubre el significado de los obsequios que los Reyes
Magos le regalaron al Niño Jesús.
b. El oro es el símbolo de los
reyes.

c. El incienso es símbolo de
adoración a Dios.

a. La mirra simboliza el
sufrimiento y el dolor humano.

REFLEXIONES SOBRE EL APRENDIZAJE


 ¿Lograron los estudiantes reconocer el verdadero significado de la Navidad?
 ¿Qué dificultades se observaron durante la práctica en clase?
 ¿Qué aprendizajes se deben reforzar?
 ¿Las estrategias, materiales y recursos resultaron de adecuados para la sesión?

EDITORA BILBIOTECA
ÁREA: COMUNICACIÓN
¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar

MAGISTERIAL
- Preparar imágenes de la Virgen María. José y el niño - Cinta adhesiva o limpiatipo. Lectura. Papelógrafo.
Jesús. Fotocopia el texto “Regalos de Navidad”. Hojas. Lista de cotejos.
Preparar los materiales necesarios para escribir sus
sociogramas.
INICIO:
 Se presenta en macrogrupo las imágenes de María, José y el Niño Jesús.

 Luego solicitamos que en tarjetas escriban los nombres de los personajes y la relación que los
une.

NIÑO JESÚS MARÍA JOSÉ

MADRE PADRE HIJO

 Se pregunta ¿Qué otras relación podemos establecer entre los personajes presentados? Si
tuviéramos que contar la historia del Nacimiento de Jesús ¿Qué escribirían en las tarjetas? Les
entregamos más tarjetas para que narren la Historia del Nacimiento de Jesús.
 Realizamos preguntas para rescatar los saberes previos: ¿Qué nombre recibe la técnica de
comprensión lectora utilizada?; ¿Qué es un sociograma? ¿Cuál es la función del sociograma?
¿En qué tipo de textos podemos utilizar el sociograma? ¿Podemos utilizar los sociogramas para
comprender textos literarios? ¿De qué manera?
 Se comunica el propósito de la sesión:

____________________________________________________________________________________________________
V- DICIEMBRE 11
______________________________________________________________________________________________________

ELABORAR SOCIOGRAMAS LITERARIOS Y PARTICIPAR EN LA PLANIFICACION


DEL PROYECTO
 Se acuerda las normas de convivencia:
- Cuidar el material de estudios.
- Pedir permiso a los compañeros para usar sus materiales.
DESARROLLO
 Se presenta en un papelógrafo un ejemplo de un sociograma literario.

EDITORA BILBIOTECA
MAGISTERIAL
 A partir de lo observado los estudiantes establecen ideas del concepto de Sociograma y su
estructura.
 Presentamos información sobre los sociogramas que serán cotejados con las ideas iniciales que
ellos tenían.
El Sociograma Literario es una estrategia de comprensión lectora que podemos utilizar cuando realizamos
lecturas colectivas en clase.
Se trata de escribir dentro de un círculo el nombre de cada personaje que interviene en la historia, y representar
mediante líneas las relaciones que se establecen entre ellos. Esta estrategia contribuye a entender mejor el
texto y a profundizar en la trama de relaciones entre los personajes, por lo que facilita una lectura más
profunda y meticulosa que clarifica la interacción de los mismos, y es otra forma de construir el significado de un
texto literario.
 Indicamos a los estudiantes que ellos elaboraran un sociograma a partir de un cuento navideño.
Planificación
 Se indica que antes de iniciar la textualización del sociograma debemos de planificar, para ello
entregamos un cuadro de planificación.
¿Qué vamos a escribir? ¿Para qué escribiremos ¿Quiénes leerán ¿Qué tipo de lenguaje
el sociograma? nuestro sociograma? utilizaremos?
Un sociograma literario Para entender mejor el La profesora y nuestros Lenguaje informal.
texto y profundizar en la compañeros.
trama de las relaciones de
los personajes.
 Una vez completado el cuadro de planificación se indica que ahora escribirán sus sociograma.
Textualización
 Entregamos hojas bond y una copia del cuento: “Regalos de Navidad”
____________________________________________________________________________________________________
V- DICIEMBRE 12
______________________________________________________________________________________________________
 Leen el cuento y luego elaboran su sociograma.
REGALOS DE NAVIDAD
La Conferencia de Regalos de Navidad de aquel año estaba llena hasta la bandera. A ella habían acudido
todos los jugueteros del mundo, y muchos otros que no eran jugueteros pero que últimamente
solían asistir, y los que no podían faltar nunca, los repartidores: Santa Claus y los Tres Reyes Magos.
Como todos los años, las discusiones tratarían sobre qué tipo de juguetes eran más educativos o
divertidos, cosa que mantenía durante horas discutiendo a unos jugueteros con otros, y sobre el tamaño
de los juguetes. Sí, sí, sobre el tamaño discutían siempre, porque los Reyes y Papá Noel se quejaban
de que cada año hacían juguetes más grandes y les daba verdaderos problemas transportar todo aquello...
Pero algo ocurrió que hizo aquella conferencia distinta de las anteriores: se coló un niño. Nunca jamás
había habido ningún niño durante aquellas reuniones, y para cuando quisieron darse cuenta, un niño
estaba sentado justo al lado de los reyes magos, sin que nadie fuera capaz de decir cuánto tiempo llevaba
allí, que seguro que era mucho. Y mientras Santa Claus discutía con un importante juguetero sobre el
tamaño de una muñeca muy de moda, y éste le gritaba acaloradamente "¡gordinflón, que si estuvieras más
delgado más cosas te cabrían en el trineo!", el niño se puso en pie y dijo:
- Está bien, no discutáis. Yo entregaré todo lo que no puedan llevar ni los Reyes ni papá Noel.
Los asistentes rieron a carcajadas durante un buen rato sin hacerle ningún caso. Mientras reían, el niño se
levantó, dejó escapar una lagrimita y se fue de allí cabizbajo...
Aquella Navidad fue como casi todas, pero algo más fría. En la calle todo el mundo continuaba con sus

EDITORA BILBIOTECA
vidas y no se oía hablar de todas las historias y cosas preciosas que ocurren en Navidad. Y cuando los
niños recibieron sus regalos, apenas les hizo ilusión, y parecía que ya a nadie le importase aquella
fiesta.
En la conferencia de regalos del año siguiente, todos estaban preocupados ante la creciente falta de ilusión

MAGISTERIAL
con se afrontaba aquella Navidad. Nuevamente comenzaron las discusiones de siempre, hasta que de
pronto apareció por la puerta el niño de quien tanto se habían reído el año anterior, triste y cabizbajo. Esta
vez iba acompañado de su madre, una hermosa mujer. Al verla, los tres Reyes dieron un brinco:
"¡María!", y corriendo fueron a abrazarla. Luego, la mujer se acercó al estrado, tomó la palabra y dijo:
- Todos los años, mi hijo celebraba su cumpleaños con una gran fiesta, la mayor del mundo, y lo
llenaba todo con sus mejores regalos para grandes y pequeños. Ahora dice que no quiere celebrarlo, que a
ninguno de ustedes en realidad le gusta su fiesta, que sólo quieren otras cosas... ¿se puede saber
qué le han hecho?
La mayoría de los presentes empezaron a darse cuenta de la que habían liado. Entonces, un anciano
juguetero, uno que nunca había hablado en aquellas reuniones, se acercó al niño, se puso de rodillas
y dijo:
- Perdón, mi Dios; yo no quiero ningún otro regalo que no sean los tuyos. Aunque no lo sabía, tú siempre
habías estado entregando aquello que no podían llevar ni los Reyes ni Santa Claus, ni nadie más:
el amor, la paz, y la alegría. Y el año pasado los eché tanto de menos...perdóname.
Uno tras otro, todos fueron pidiendo perdón al niño, reconociendo que eran suyos los mejores regalos
de la Navidad, esos que colman el corazón de las personas de buenos sentimientos, y hacen que cada
Navidad el mundo sea un poquito mejor...
 Terminada la lectura se indica que inicien con el desarrollo de sus sociogramas. Pueden utilizar el
siguiente esquema.

 Pueden utilizar el siguiente ejemplo.

____________________________________________________________________________________________________
V- DICIEMBRE 13
______________________________________________________________________________________________________

 Invitamos a los estudiantes a compartir sus sociogramas.


 Para finalizar se elabora un sociograma a nivel macrogrupo.
 Dialogamos a partir de lo trabajado, respondiendo las siguientes preguntas: ¿Fue necesaria la
planificación para la realización del sociograma? ¿Por qué? ¿Cuál es la función de la
planificación? ¿Consideran que debemos realizar planificar las actividades que se realizaran en

EDITORA BILBIOTECA
este proyecto? ¿De qué manera? ¿Qué actividades tomaremos en cuenta?
 Luego, se plantea que, por grupos, elaboren un planificador con todas las actividades que
necesitaremos para organizar el proyecto escolar de diciembre y nuestros grupos de trabajo,
durante el presente proyecto.

MAGISTERIAL
 Se coloca el papelote con la tabla para planificar lo que van a hacer en el proyecto.

¿Qué queremos
¿Cómo lo haremos?
¿Cuándo lo
¿Quiénes lo
haremos?
¿Quiénes nos
¿Qué
saber/ hacer? haremos? necesitamos?
ayudarán? ¿Cómo
nos organizamos?
- Reflexionar sobre- Investigando como - El presente - Los niños, las - Libros diversos,
el verdadero fue el Nacimiento de proyecto se niñas y su tiras de papel,
significado de la Jesús. realizará en maestra. cuadernos de
Navidad. - Participando con dos - Nos ayudarán trabajo y libros,
- Elaborando villancicos y la semanas. nuestras familias. papelotes o
trabajos elaboración de cartulina,
- Nos organizamos
navideños y manualidades periódicos,
en grupos y un
velups como navideñas. revistas, colores,
representante de
opción ante los cables, pilas, cinta
- Eligiendo un cada grupo.
pirotécnicos. masking tape,
municipio escolar.
láminas de
- Cantando - Investigando sobre navidad, etc.
villancicos que la luz, el calor y los
alegren nuestra pirotécnicos.
Navidad
- Hablando sobre el
consumismo.
- Resolviendo
ejercicios con
números enteros.
 Se coloca el papelote con lo planificado en un lugar visible para que los estudiantes en cada
sesión puedan establecer su agenda y monitorear su cumplimiento.
CIERRE

____________________________________________________________________________________________________
V- DICIEMBRE 14
______________________________________________________________________________________________________
 Reflexionan sobre sus aprendizajes a través de preguntas: ¿Qué aprendimos hoy?; ¿Participar
en el diálogo les ayudó a establecer las actividades del plan de trabajo para el proyecto?; ¿Por
qué es importante la planificación?, ¿Consideran importante reflexionar respecto al verdadero
significado de la Navidad? ¿Por qué?
 Como actividad de extensión: Los estudiantes completan sus sociogramas.
 Se evalúa a través de una lista de cotejos.
LISTA DE COTEJOS

Desempeños (criterios de evaluación) Sí No Observaciones


Opina sobre el contenido del texto, la organización textual, la intención
de algunos recursos textuales (negritas, esquemas) y el efecto del texto
en los lectores, a partir de su experiencia y del contexto sociocultural en
que se desenvuelve.
Escribe textos de forma coherente y cohesionada.
Ordena las ideas en torno a un tema, las jerarquiza en subtemas de
acuerdo a párrafos, y las desarrolla para ampliar la información, sin
digresiones o vacíos.
Establece relaciones entre las ideas, como causa- efecto, consecuencia

EDITORA BILBIOTECA
y contraste, a través de algunos referentes y conectores. Incorpora de
forma pertinente vocabulario que incluye sinónimos y algunos términos
propios de los campos del saber.

MAGISTERIAL
REFLEXIONES SOBRE EL APRENDIZAJE
 ¿Lograron los estudiantes realizar la planificación y textualización de los sociogramas?
 ¿Qué dificultades se observaron durante la textualización?
 ¿Los recursos y materiales fueron utilizados adecuadamente durante la sesión?
ÁREA: PERSONAL SOCIAL
¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Preparar la imagen inicial. Fotocopia los ficha de - Imágenes. Texto PS 5º. Diversas fuentes de
aplicación y prueba escrita en cantidad suficiente información disponibles sobre el tema.
para repartir a todos los estudiantes.
INICIO:
 Saludamos a los estudiantes y pedimos que observen y analicen la imagen presentada de un
señor preocupado por los regalos de Navidad.

 Dialogamos a partir de las siguientes preguntas: ¿Qué les da a entender la imagen? ¿Consideran
que los regalos de Navidad son lo más importante de esta fiesta?
 Se plantea a los estudiantes las siguientes preguntas: ¿Qué es el consumismo? ¿En qué épocas
del año se da más el consumismo? ¿Quiénes son los más beneficiados con el consumismo?
¿Qué alternativas se pueden tener en cuenta respecto al consumismo? ¿Cómo podemos
disminuir el consumismo en esta Navidad? Los estudiantes responderán voluntariamente.
 Se comunica el propósito de la sesión:

____________________________________________________________________________________________________
V- DICIEMBRE 15
______________________________________________________________________________________________________

HOY INDAGARÁN SOBRE EL CONSUMISMO Y PLANTEARAN ALTERNATIVAS.


 Se acuerda las normas de convivencia:
- Mantener el orden y limpieza en mi aula.
- Utilizo las palabras por favor y gracias.
DESARROLLO
Problematización
 Indicamos a los estudiantes que formen grupos de trabajo de cuatro integrantes y lean una
noticia sobre los gastos en Navidad.
RADIOGRAFIA DE LOS GASTOS DE NAVIDAD
La Navidad es una época importante para las familias peruanas. Es sinónimo de paz, alegría, pero también (por más
duro que suene) donde las personas compran más. Alimentos, ropa, accesorios son algunas de las cosas en las
que gastan su dinero. Económicamente, ¿cómo se perfilan estas fiestas decembrinas? ¿Cuánto es lo que se
gastará por persona? Revisemos algunos datos interesantes.
De acuerdo con información obtenida por el equipo de investigación de Informa BTL, el 30.21% de las personas
realizan sus compras entre el 16 y el 24 de diciembre; sin embargo, 15.21% aprovechan las rebajas para hacer sus
compras navideñas.
Otra de las cuestiones importantes es que en esta fecha, buena parte de los peruanos reciben su aguinaldo. El 32%

EDITORA BILBIOTECA
de las personas han expresado, de acuerdo con el equipo de investigación, que el pagarán sus deudas, mientras
que el 28% realizarán compras navideñas, en tanto que el 19% ahorrarán.
Acerca de los gastos propios de la época decembrina, de acuerdo con datos de Deloitte, 61% expresó que gastaría
menos con respecto al 2017. Respecto a las prioridades de gastos, 80% colocó las cenas de Navidad y de Fin de

MAGISTERIAL
año en primer lugar, mientras que un 68% expresó que la ropa sería la segunda prioridad.
Según la información, las principales razones por las que el 35% de las personas ha decidido comprar en línea en
esta época son, en primer lugar, el envío gratis; en segundo lugar, porque existen programas de lealtad y finalmente
porque consideran que hay un mayor poder de negociación.
 Responden: ¿Qué gastos se realizan en navidad según la lectura? ¿Qué aspectos influyen el
aumento del consumismo? ¿Qué acciones podemos realizar para disminuir estos gastos?
 Indicamos a los estudiantes que estas preguntas serán respondidas durante la sesión.
Análisis de la información.
 Los estudiantes organizados en sus equipos analizan información relacionada al consumismo.
¿Qué es el consumismo?
Consumismo puede referirse tanto a la acumulación, compra o consumo de bienes y servicios considerados no
esenciales, como al sistema político y económico que promueve la adquisición competitiva de riqueza como signo
de status y prestigio dentro de un grupo social. El consumo a gran escala en la sociedad contemporánea
compromete seriamente los recursos naturales y el equilibrio ecológico. El consumismo, entendido como
adquisición o compra desaforada, idealiza sus efectos y consecuencias asociando su práctica con la obtención de
la satisfacción personal e incluso de la felicidad personal.
Origen del consumismo
En la literatura actual se señala que el consumismo tal y como lo conocemos hoy día, surgió a finales de la
Primera Guerra Mundial, en esta época el mercado estadounidense sufrió una gran crisis económica, lo que
ocasionó altos niveles de desempleo y enfriamiento o estancamiento del mercado.
Si bien aumentó la producción, porque se sustituyó personal por avances tecnológicos, la demanda de los
productos se veían reducidas, por lo que se debía motivar de alguna manera.
Fue Edward Bernays, sobrino del reconocido psicoanalista Sigmund Freud, quien encontró la manera de motivar
el consumo valiéndose de los descubrimientos de su tío de que las personas tienen en lo más profundo de su ser
un estado animal que se caracteriza por sentimientos irracionales, pero el comportamiento de las personas a
veces se nutre de esos impulsos irracionales que nacen de lo más profundo de sus mentes.
A Bernays se le ocurrió relacionar estos impulsos irracionales con el mundo de la publicidad comercial; asociando
los distintos productos a deseos instintivos que tiene el ser humano en su inconsciente.
De esta manera es como el consumo de bienes primordialmente realizado para satisfacer necesidades, pasó a
____________________________________________________________________________________________________
V- DICIEMBRE 16
______________________________________________________________________________________________________
satisfacer deseos, lo que produce el consumo desenfrenado que hoy conocemos.
Hoy día, el consumismo no solo se basa en los impulsos inconscientes e irracionales que genera nuestro cerebro,
sino también en el contexto social donde nos desenvolvemos porque cuando tratamos de ser aceptados
socialmente nos vemos obligados a adquirir determinados bienes y servicios.
Causas del consumismo
El capitalismo
El consumo es el elemento central del capitalismo, porque carece de sentido que se produzcan cosas que no
serán consumidas.
Asociación de los bienes con el éxito
Existe la falsa creencia de que la acumulación de bienes es fuente de felicidad y sinónimo de éxito personal. En
muchos casos se aplican las frases “eres lo que tienes” o “vales lo que tienes”.
La presión de expresar el estatus y la identidad implica encontrar seguridad al sobresalir y al encajar en el grupo
social por medio de las posesiones y su exhibición.
La globalización
La globalización ha disuelto y expandido los límites territoriales de los modos de producción, distribución y
consumo de la actualidad.
La publicidad
El individuo de la sociedad actual se ve bombardeado por todo tipo de publicidad, la cual presenta los productos
como necesarios para la vida y forma en las personas falsas necesidades.

EDITORA BILBIOTECA
La publicidad es tan poderosa que tiene el poder de influir en las decisiones de compra de las personas, para esto
se muestra a los productos desde su mejor perspectiva, destacando solo lo aparentemente ventajoso que estos
son.
La publicidad apela a que el individuo consuma en exceso, y lo hace al generarle deseos o imponiéndole un grupo
de referencia que consume para ser feliz. Porejemplo, se presenta a un joven con rostro sonriente y aparente

MAGISTERIAL
éxito porque tiene el último teléfono inteligente que se promociona.
Productos de baja calidad
Actualmente los productos vienen con fecha de caducidad y una vez esta llega no queda otra opción que comprar
otro.
Las marcas y fabricantes se dieron cuenta que hacer productos duraderos es contraproducente para sus
ganancias, de ahí que se acorta la vida útil de los mismos.
Cada vez las bombillas, cartuchos de impresión o teléfonos móviles duran menos, obligando a su reemplazo.
No existe una cultura de reciclaje
La no existencia de una cultura de reciclaje y reutilización, en muchos países no se práctica ni promueve el
reciclaje, de ahí que las personas desechan frecuentemente objetos a los que se les puede dar un segundo uso o
que pueden ser remanufacturados.
Consecuencias del consumismo
 Tiene un impacto negativo en el ambiente, es fácil, mientras más se produzca más se afecta el ambiente, más
recursos se utilizan y más contaminación ambiental se genera.
 Se contribuye a la mala distribución de la riqueza. El comprador gasta dinero innecesario y el fabricante o
vendedor continúa enriqueciéndose.
 Se sobre utilizan servicios como el agua, energía eléctrica y combustible, aumentado la tarifa de pago de los
mismos y contribuyendo a que el sistema eléctrico o la distribución de los servicios básicos se pueda ver
afectado
 Preferencia de lo procesado antes de lo natural. Muchos productos industrializados han sustituido a los
realizados en casa o los productos naturales. En muchos países se consume por ejemplo sopa en lata, o se
prefiere comer hamburguesas procesadas que las hechas en casa.
 Transculturalización. El consumismo impone la cultura de otras regiones, donde se manejan otros valores y
otros niveles de consumo. Se promueve el deseo de consumir bienes de manera ilimitada en todas las
culturas menospreciando la cultura propia de cada lugar.
 Genera ansiedad en las personas. Cuando alguien quiere poseer un artículo y claramente este se escapa de
sus posibilidades económicas, se puede generar ansiedad al no poseerlo o al tener que trabajar de más para
poder comprarlo, es decir al tener que hacer algún esfuerzo extraordinario para poder hacerse con él.
 El consumismo no promueve el desarrollo sustentable lo cual trae consecuencias para las generaciones
____________________________________________________________________________________________________
V- DICIEMBRE 17
______________________________________________________________________________________________________
futuras y no solo para la actual.
No se puede negar que el consumo es una actividad necesaria sin la cual no hay desarrollo posible, pero exige
responsabilidad, tanto por parte de las industrias como de los usuarios de productos y servicios.
 A los equipos se les entrega papelógrafos y plumones para que elaboren mapas conceptuales
que sistematice la información proporcionada.
 Pegan sus papelógrafos en las paredes del aula y un representante de cada grupo explica sus
mapas conceptuales.
 Los estudiantes se sientan en círculo, se promueve el diálogo a partir de las preguntas
planteadas: ¿Cómo podemos disminuir nuestros gastos en Navidad?
 En grupo clase se consolidan las respuestas.
 Pegamos un papelógrafo y solicitamos voluntarios para que mencionen propuestas para ahorrar
dinero en Navidad. Por ejemplo:
 Replantéate tu ritmo de consumo.
 Sé más crítico con la publicidad que recibes.
 Procura agotar la vida útil de las cosas antes de comprar un nuevo producto que las sustituya.
 Piensa en la imagen que proyectas.
 La austeridad no tiene porqué ser una mortificación.
 Concédete un capricho, no es bueno vivir con un continuo sentimiento de privación.

EDITORA BILBIOTECA
 Aprende a buscar cosas buenas y baratas.
Toma de decisiones
 Dialogamos a partir de las siguientes preguntas: ¿Qué papel juega la publicidad en el

MAGISTERIAL
consumismo? ¿Qué opciones de regalo podemos utilizar que ayuden a reducir gastos?
 A través de lluvia de ideas se consolidan las ideas y se redactan conclusiones.
 Para consolidar la información resuelven una ficha de aplicación.
FICHA DE APLICACIÓN
Lee el siguiente caso y luego responde las preguntas:
Un estudiante de Nivel Medio necesita leer una novela para realizar un trabajo de literatura, pero cuando estaba por
comprar el libro se acordó de la polera que vio el día pasado en una tienda, que todos sus compañeros usan y que
cuesta el mismo precio que la novela.
a) ¿Qué actitud tomaría si fuese un consumidor equilibrado?

b) ¿Y si se dejara llevar por la tentación del consumismo?

II. Si el consumismo se manifiesta en el deseo ilimitado de posesión y produce la falsa sensación de


felicidad, ¿cuál sería un ejemplo que afecta especialmente a los jóvenes?

III. Menciona un ejemplo de presión social que conduce al consumismo entre las mujeres.

IV. En un párrafo, resume las consecuencias del consumismo.

 Comentamos brevemente que en esta sesión hemos comprendido la importancia de buscar


alternativas ante el consumismo.
CIERRE
 Iniciamos la metacognición a través de estas preguntas: ¿Qué han aprendido el día de hoy?
¿Qué actividades han sido importantes para aprender? ¿Cuáles eran nuestros saberes respecto

____________________________________________________________________________________________________
V- DICIEMBRE 18
______________________________________________________________________________________________________
al tema? Además de lo que sabíamos, ¿qué sabemos ahora? ¿Para qué nos servirá lo
aprendido?
 Como actividad de extensión: Se pide a los estudiantes que investiguen sobre el ahorro.
 Se evalúa a través de una escala de valoración.
ESCALA DE VALORACIÓN
En
Sí No Observaciones
proceso
Gestiona responsablemente los recursos económicos
Representa de diversas maneras cómo influye la
publicidad en sus decisiones de consumo
PRUEBA ESCRITA
1. Marca la alternativa correcta:
Consumismo es:
a. Acumulación b. Compra necesaria c. Consumo de bienes
La publicidad apela a que el individuo consuma:
a. Lo necesario b. En exceso c. Limitadamente.
2. Menciona tres consecuencias del consumismo:

EDITORA BILBIOTECA
a. ______________________________________________________
b. ______________________________________________________
c. ______________________________________________________
3. Dibuja tres objetos que no son necesarios en Navidad.

MAGISTERIAL

REFLEXIONES SOBRE EL APRENDIZAJE


 ¿Lograron los estudiantes reconocer las causas del consumismo?
 ¿Qué dificultades se observaron durante el trabajo en equipo de los estudiantes?
 ¿Cómo se solucionaron los conflictos durante el trabajo en equipo?
 ¿Qué aprendizajes se deben reforzar?
 ¿Las estrategias, materiales y recursos resultaron adecuados para la sesión?

____________________________________________________________________________________________________
V- DICIEMBRE 19
______________________________________________________________________________________________________

SEMANA Nº 1
“ESPERAMOS CON ENTUSIASMO Y RESPONSABILIDAD LA LLEGADA DE
JESÚS”
Día Nro. 2
“RECIBIMOS A JESÚS CON ENTONANDO VILLANCICOS”
• PROPÓSITOS DE APRENDIZAJE
Evidencias de
Competencia / Campo
Área Desempeños aprendizaje /
Capacidad temático
Inst. de valoración
AyC 1. Aprecia de manera Creación - Genera hipótesis sobre el - Interpreta villancicos
crítica manifestaciones artística. significado y la intención de con entusiasmo y
artístico-culturales. una manifestación artístico- alegría para recibir
1.3. Reflexiona creativa y cultural e incorpora la opinión el Nacimiento de
críticamente sobre de los demás para reformular Jesús.
manifestaciones artístico- sus puntos de vista sobre ella. - Escala de
culturales valoración.

EDITORA BILBIOTECA
2. Crea proyectos desde Villancicos: - Genera ideas a partir de
los lenguajes artísticos. Cancionero. estímulos y fuentes diversas
2.2. Aplica procesos (tradicionales, locales y
creativos. globales) y planifica su trabajo

MAGISTERIAL
artístico tomando en cuenta la
información recogida.
Manipula una serie de
elementos, medios, técnicas,
herramientas y materiales
para desarrollar trabajos que
comunican ideas a una
audiencia específica.
CyT 2. Explica el mundo físico Calor y - Compara los datos cualitativos - Experimenta con el
basándose en temperatura. o cuantitativos para probar sus calor para
conocimientos sobre los hipótesis y las contrasta con diferenciarlo de la
seres vivos, materia y información científica. Elabora temperatura
energía, biodiversidad, sus conclusiones. compara datos, para
Tierra y universo. probar su hipótesis.
2.2. Evalúa las - Lista de cotejo
implicancias del saber y
del quehacer científico y
tecnológico.
M 1. Resuelve problemas Números - Establece relaciones entre - Resuelve ejercicios
de cantidad. enteros: datos y una o más acciones de representación
1.1. Traduce cantidades a Representa- de agregar, quitar, comparar, de números enteros
expresiones numéricas ción igualar, reiterar, agrupar y en fichas de
- repartir cantidades, para aplicación.
Comparación. transformarlas en expresiones - Prueba escrita.
numéricas (modelo) de
adición, sustracción,
multiplicación y división con
números naturales, y de
adición y sustracción con

____________________________________________________________________________________________________
V- DICIEMBRE 20
______________________________________________________________________________________________________
Evidencias de
Competencia / Campo
Área Desempeños aprendizaje /
Capacidad temático
Inst. de valoración
decimales.

ÁREA: ARTE Y CULTURA


¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Preparar materiales para la elaboración de carteles. - Cartulinas, hojas de colores, tijeras, pegamento,
- Prepara los carteles de candidatos políticos. escala de valoración.
INICIO:
 Leen el fragmento de un villancico y la entonan los estudiantes que la saben:
Navidad, navidad,
En la nieve y la arena.
Navidad, navidad
En la tierra y el mar.
 Se recoge los saberes previos de los niños y las niñas mediante lluvia de ideas; para ello se
pregunta lo siguiente: ¿Qué continua de la canción? ¿Qué tipo de canción es? ¿Qué es un

EDITORA BILBIOTECA
villancico? ¿Cuándo cantamos villancicos? ¿Qué expresamos al cantar un villancico? ¿Pueden
crear un villancico? ¿Pueden utilizar instrumentos musicales al entonar un villancico?
 Se comunica el propósito de la sesión:

MAGISTERIAL
HOY VAN ENTONAR VILLANCICOS CON ENTUSIASMO.
 Se acuerda las normas de convivencia:
- Levantar la mano al participar.
- Ayudar a los compañeros que lo necesiten.
DESARROLLO
 Por medio de lluvia de ideas mencionan el concepto de villancicos.
Un villancico es una canción popular breve con estribillo. Se trata de una composición musical (con su forma
poética asociada) que nació en forma de canción profana y que obtuvo mucha popularidad cuando la gente
comenzó a asociarla a la navidad. Poco a poco los villancicos comenzaron a ser cantados en templos e iglesias.
 Solicitamos que mencionen y escriban en tarjetas el nombre de diversos villancicos que ellos
conocen.

Navidad Noche de Paz Burrito Sabanero

Campana sobre campana Vamos pastores Los peces en el río

 Luego se indica que recuerde la letra y el sonido de un villancico


 Solicitamos que formen grupos y se preparan para entonar los villancicos elegidos en el aula.
Los peces en el río Burrito Sabanero
La virgen se está peinando Con mi burrito sabanero
entre cortina y cortina voy camino de Belén,
sus cabellos son de oro con mi burrito sabanero
y el peine de plata fina voy camino de Belén,

Pero mira como beben los peces en el rio si me ven, si me ven voy camino de Belén (Bis)
Pero mira como beben por ver al Dios El lucerito mañanero ilumina mi sendero (Bis)
nacido si me ven, si me ven voy camino de Belén (Bis)
____________________________________________________________________________________________________
V- DICIEMBRE 21
______________________________________________________________________________________________________
beben y beben y vuelven a beber
los peces en el rio En mi burrito voy cantando,
por ver a Dios nacer. (Bis) mi burrito va trotando. (Bis)

La virgen lava pañaaales si me ven, si me ven voy camino de Belén (Bis)


y los tiende en el romeeero
los pajarillos cantaaando duki duki duki duki,duki duki duki
Y el romero floreciendo. da apúrate mi burrito que ya vamos a llegar

Pero mira como beben duki duki duki duki,duki duki duki duu
los peces en el rio apúrate mi burrito vamos a ver a Jesús
Pero mira como beben
por ver a Dios nacido con mi burrito sabanero
beben y beben y vuelven a beber voy camino de Belén (Bis)
los peces en el rio
por ver a Dios nacer si me ven si me ven voy camino de Belén (Bis)
El lucerito mañanero ilumina mi sendero (Bis)
la virgen se está lavando si me ven, si me ven voy camino de Belén(Bis)
con un poco de jabón

EDITORA BILBIOTECA
Se le picaron las manos, En mi burrito voy cantando,
Manos de mi corazón. mi burrito va trotando (Bis)

Pero mira como beben si me ven, si me ven voy camino de Belén (Bis)
los peces en el rio

MAGISTERIAL
Pero mira como beben por
ver a d
Dios nacido
beben y beben y vuelven a beber
duki duki duki duki,duki duki duki da
apúrate mi burrito que ya vamos a llegar

duki duki duki duki duki duki duki duu


los peces en el rio apúrate mi burrito vamos a ver a Jesús.
por ver a dios nacer
con mi burrito sabanero
Pero mira como beben los peces en el rio voy camino de Belén (Bis)
Pero mira como beben
por ver a d si me ven, si me ven voy camino de Belén (Bis)
Dios nacido si me ven, si me ven voy camino de Belén (Bis)
beben y beben y vuelven a beber
los peces en el rio
por ver a dios nacer. (Bis)

Campana sobre campana VAMOS PASTORES, VAMOS


Campana sobre campana, Vamos pastores, vamos,
y sobre campana una, vamos a Belén
asómate a la ventana, a ver en ese niño
____________________________________________________________________________________________________
V- DICIEMBRE 22
______________________________________________________________________________________________________
verás el Niño en la cuna. la gloria del Edén,
a ver en ese niño
Belén, campanas de Belén, la gloria del Edén.
que los ángeles tocan
qué nueva me traéis? ¡Ese precioso niño!
Yo me muero por Él
Recogido tu rebaño sus ojitos me encantan,
a dónde vas pastorcillo? su boquita también,
Voy a llevar al portal el padre lo acaricia.
requesón, manteca y vino. La madre mira en Él
y los dos extasiados
Belén, campanas de Belén, contemplan aquel ser
que los ángeles tocan Contemplan aquel ser.
qué nuevas me traéis?
Un establo es una cuna,
Campana sobre campana, su casa es un portal
y sobre campana dos, y sobre duras pajas
asómate a esa ventana, por nuestro amor está.
porque está naciendo Dios. Allí duerme el niñito

EDITORA BILBIOTECA
junto a un mulo y un buey,
Belén, campanas de Belén, y bien cobijadito,
que los ángeles tocan con un blanco pañal.
qué nueva me traéis? Con un blanco pañal.

MAGISTERIAL
Campana sobre campana,
y sobre campana tres,
en una Cruz a esta hora,
el Niño va a padecer.
Es tan lindo el niñito,
que nunca podrá ser
que su belleza copie
el lápiz y el pincel;
pues el Eterno Padre
Belén, campanas de Belén, con inmenso poder
que los ángeles tocan hizo que el Hijo fuera
qué nueva me traéis? inmenso como Él.
Inmenso como Él.

Noche de paz Navidad


Noche de paz, Navidad, Navidad
noche de amor! Navidad, Navidad
Ha nacido el niño Dios Hoy es Navidad.
en un humilde portal de Belén Con campanas este día
sueña un futuro de amor y de fe Hay que festejar
viene a traernos la paz Navidad, Navidad
viene a traernos la paz... Porque ya nació
Desde el portal llega tu luz ayer noche, Nochebuena,
y nos reúne en torno a ti El niñito Dios.
ante una mesa de limpio mantel
o en el pesebre María y José
en esta noche de paz
____________________________________________________________________________________________________
V- DICIEMBRE 23
______________________________________________________________________________________________________
en esta noche de paz...
 Se indica a cada equipo de trabajo que creen villancicos, con sonidos musicales.
 Presentan sus villancicos al grupo clase.
 Comentan los sentimientos que les genera entonar los villancicos.
 Comparten anécdotas que se dieron en navidad al entonar villancicos en su familia.
CIERRE
 Realiza las siguientes preguntas sobre las actividades desarrolladas durante la sesión: ¿Qué han
aprendido hoy?, ¿Qué villancico me agrado más?, ¿Qué otros villancicos conocen?, ¿Consideran
que el cantar villancicos une a la familia?
 Finalmente, resaltamos el trabajo realizado por los equipos.
 Como actividad de extensión Prepara un villancico y acompáñalo de un instrumento musical.
CUMBIA DE NAVIDAD VALS NAVIDEÑO
Suena la cumbia de Navidad En mi tierra se oye un cantar
La noche es clara, que clara está. Son todos los canarios en su caminar
Suena la cumbia de Navidad. (bis) Con sus coplas nos van alegrar
El Niño duerme, soñando está, Y van anunciando que ya es Navidad.
Suena la cumbia de Navidad Venid pastorcillos, venid a adorad
Sueña que viene y nos va a salvar, Al niño chiquito que ha nacido ya

EDITORA BILBIOTECA
Suena la cumbia de Navidad. (bis) En ese pesebre que llorando está
Techo de paja que abrigo da Su madre en sus brazos lo acurrucará
Suena la cumbia de Navidad En mi tierra se oye un cantar
no es de una casa, es de un portal Son todos los canarios en su caminar

MAGISTERIAL
Suena la cumbia de Navidad (bis) Con sus coplas nos van alegrar
El Niño es pobre, llorando está, Y van anunciando que ya es Navidad.
Suena la cumbia de Navidad Venid todos juntos, venid a cantar
Viene llorando y nos va a salvar Venid con guitarras, venid a tocar
Suena la cumbia de Navidad (bis) El canto canario, hay que acompañar
Folias alegres, el niño oirá
En mi tierra se oye un cantar
Son todos los canarios en su caminar
Con sus coplas nos van alegrar
Y van anunciando que ya es Navidad.

HUACHITORITO LA VIRGEN Y SAN JOSÉ


A la Huachi Huachitorito La Virgen y San José
Niñito del portalito juntos pasaron el rio
Huachi- Huachi- Huachitorito y en una cuna de flores
Niño Dios. llevan al niño metido.
Vamos mejor a la puna Ya le llevan al recien nacido
que el agua ya está pasando mantilla pañales faja y fajetin,
con mi manta y con mi llilla porque vienen los frios de Enero
yo te llevaré tapando. y el Rey de los cielos esta pobretin.
Una estrella tan tamaña A Jesús mira la Virgen
guiando va el camino y a la Virgen San José
porque está noche en el cielo y Jesús mira a los dos
se descubrió la provincia. y se sonrien los tres.
Yo ya le estaba trayendo Ya le llevan al recien nacido
un barquito pintadito mantilla pañales faja y fajetin,
para que le hagáis cunita porque vienen los frios de Enero
al niñito Manuelito. y el Rey de los cielos esta pobretin.
En tanto rigor del aire La Virgen lo tiene en brazos
estas temblando de frío y unos ratos San José
____________________________________________________________________________________________________
V- DICIEMBRE 24
______________________________________________________________________________________________________
porque eres como la grana ¡quién pudiera Virgen mía,
en las espigas del trigo. ayudárnoslo a tener!.
El pastor de la provincia Ya le llevan al recien nacido
hoy te viene a festejar mantilla pañales faja y fajetin,
porque ha tenido noticias porque vienen los frios de Enero
que ha nacido en un portal. y el Rey de los cielos esta pobretín

 Evaluamos a lo largo de la sesión con una escala de valoración.


ESCALA DE VALORACIÓN
En
Desempeños Sí No Observaciones
proceso
Aprecia de manera crítica manifestaciones artístico-culturales
Genera hipótesis sobre el significado y la intención de una
manifestación artístico-cultural e incorpora la opinión de los
demás para reformular sus puntos de vista sobre ella.
Crea proyectos desde los lenguajes artísticos.
Genera ideas a partir de estímulos y fuentes diversas
(tradicionales, locales y globales) y planifica su trabajo
artístico tomando en cuenta la información recogida.

EDITORA BILBIOTECA
Manipula una serie de elementos, medios, técnicas,
herramientas y materiales para desarrollar trabajos que
comunican ideas a una audiencia específica.
REFLEXIONES SOBRE EL APRENDIZAJE

MAGISTERIAL
 ¿Qué lograron los estudiantes en esta sesión?
 ¿Qué dificultades se observaron durante el aprendizaje y la enseñanza?
 ¿Qué aprendizajes se deben reforzar?
 ¿Las estrategias, materiales y recursos resultaron de adecuados para la sesión?

ÁREA: CIENCIA Y TECNOLOGÍA


¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Fotocopiar los textos informativos sobre las plantas - Textos sobre plantas nativas del Perú. Papelotes.
nativas que serán entregados a cada grupo. Pedir a Plumones. Cinta adhesiva. Libro de Ciencia 5º
los estudiantes que traigan información sobre las
plantas nativas del Perú.
INICIO:
 Presentamos el villancico: Ven a Cantar
VEN A CANTAR Ven a cantar, ven a cantar,
Otro año que queda atrás, que ya llegó la Navidad.
mil momentos que recordar. Ven a cantar, ven a cantar,
Otro año, mil sueños más que ya está aquí la Navidad. (Bis)
hechos realidad.
Gira el mundo, gira el reloj,
Los problemas vienen y van, gira el viento, la mar y el sol.
y al final todo sigue igual. Dale vuelta a tu corazón
No hay montaña que pueda más, y llénalo de amor.
que la voluntad.
Navidad, feliz Navidad,
Alzo mi copa aquí, vuelve a casa, vuelve al hogar.
para brindar por ti, Navidad, dulce Navidad,
____________________________________________________________________________________________________
V- DICIEMBRE 25
______________________________________________________________________________________________________
y desearte lo mejor. es calor de hogar.

Navidad, feliz Navidad, Ven a cantar, ven a cantar,


vuelve a casa, vuelve al hogar. que ya llegó la Navidad.
Navidad, dulce Navidad, Ven a cantar, ven a cantar,
es calor de hogar. que ya está aquí la Navidad.
 Responden a preguntas: ¿De qué trata la canción? , ¿Qué quiere decir la frase: “Navidad, dulce
Navidad, es calor de hogar”?, ¿El calor al que hace referencia se relaciona con la temperatura del
ambiente?
 Rescatamos los saberes previos: ¿Qué saben del calor?, ¿Cuáles son sus fuentes? ¿De qué
manera el calor puede causar muertes?, ¿Cuáles son los efectos del calor?, ¿Cómo se mide la
temperatura? ¿Qué escalas se emplean? ¿Es lo mismo temperatura que calor?
 Se comunica el propósito de la sesión:

HOY EXPLICARAN LA DIFERENCIA ENTRE CALOR Y TEMPERATURA.


 Se acuerda las normas de convivencia:
- Cuidar el material propio y común.
- Mostrar amabilidad con todos.

EDITORA BILBIOTECA
DESARROLLO
Planteamiento del problema:
 Observan y leen la siguiente viñeta:

MAGISTERIAL
No está bien dicho
eso, en realidad
¡Uf! ¡Vaya
debes decir que la
calor hace!
temperatura es alta.

 Los estudiantes responden las siguientes interrogantes: ¿Por qué dice en la viñeta que está mal
dicha la expresión del calor? ¿Cuándo la temperatura es alta, el calor también? ¿Cuándo hay
demasiado calor, la temperatura también es alta?
 Planteamos la pregunta de indagación: ¿Qué relación hay entre el calor y la temperatura?; ¿Qué
los diferencia?
Planteamiento de la hipótesis.
 Explicamos que para responder las preguntas planteadas es importante saber diferenciar entre el
calor y la temperatura.
 Retomamos la pregunta inicial y solicitamos que escriban hipótesis que les ayuden a responder la
pregunta.
 La posible hipótesis puede ser: Calor y temperatura son dos conceptos considerados como
sinónimos, pero el calor se define como el movimiento e intercambio de energía entre cuerpos,
mientras que la temperatura se caracteriza por la agitación de las moléculas de un cuerpo.
Elaboración del plan de indagación
 Se recuerda la hipótesis planteada. Luego, se hace preguntas: ¿Qué hacer para confirmarla?
 Organizan la información y anotan tres actividades en el siguiente cuadro.
¿Cuál es el ¿Cuáles son las ¿Qué actividades o ¿Qué fuentes de ¿En qué fechas lo
problema a hipótesis tareas realizaron? información usarán? realizarán?
indagar? planteadas?
1. La diferencia 1. Conceptos 1. Realizamos 1. Libro de C yT 1.
entre calor y considerados experimentaciones 2. Páginas web 2.
temperatura. como sinónimos, 3. Libros de la 3.
____________________________________________________________________________________________________
V- DICIEMBRE 26
______________________________________________________________________________________________________
pero diferentes. biblioteca
 Se indica que anoten sus respuestas a las preguntas planteadas para el problema y así poder
confirmar la hipótesis planteada.
Recoja de datos y análisis de los resultados.
 Invitamos a los estudiantes a participar en la siguiente experiencia: Construcción de un
termómetro: Los gases se expanden al calentarlos.
Construcción de un termómetro: los gases se expanden al calentarlos
Materiales: Para cada grupo:
 Una botella de plástico rígida con tapón
 Plastilina o arcilla de modelar
 Una paja para beber transparente
 Tijeras
 Colorante alimentario (opcional)
 Agua del grifo
Procedimiento
1. Haz un agujero con las tijeras en el centro del tapón de la botella que sea suficiente para que
quepa la paja.
2. Llena la botella hasta la mitad con agua.
3. Añade unas gotas de colorante y mezcla bien.

EDITORA BILBIOTECA
4. Enrosca el tapón, introduce la paja hasta que se sumerja en el agua pero asegúrate de que no
toque el fondo de la botella.
5. Usa plastilina para sellar el orificio y fijar la paja al tapón. El sellado no debe permitir la entrada o salida de aire.
6. Coloca una mano en la parte superior de la botella, ¿Qué le sucede al líquido de la paja y por qué?
¿Qué ha sucedido?

MAGISTERIAL
El calor de tu mano calienta el aire del interior de la botella. El calor se expande y empuja al agua, haciendo que
suba el nivel en la paja.
 Preguntamos a los estudiantes: ¿El agua, ha subido por el calor o por la presión que has ejercido
con tus manos? ¿Cómo se puede comprobar experimentalmente?
 Respuestas: La botella es rígida y, suponiendo que no se ha deformado, el líquido sube por la
paja debido al calor, no a la presión. Comprueben poniendo las manos muy cerca de la botella,
sin llegar a tocarla y ver cómo sube el líquido por la paja.
 Se indica que, para corroborar la información que se obtuvo del experimento, leen información
sobre el calor y la temperatura.
CALOR
La conducción del calor
El calor es una forma de energía que puede pasar de un cuerpo a otro cuando están a diferentes temperaturas. Lo
puedes experimentar cuando tocas un objeto frío o caliente, al entrar en contacto con el fuego o al sentir los rayos
solares.
Todo cuerpo emite calor. Según la mayor o menor energía interna que tenga, se dice que un cuerpo está caliente o
frío. Una forma de aproximar la cantidad de energía interna promedio que tiene un cuerpo es midiendo su
temperatura. La temperatura en los seres humanos es de, aproximadamente, 37 °C.
Al poner en contacto dos cuerpos con distinta temperatura, el flujo de calor va del cuerpo de mayor temperatura al
de menor temperatura. El calor puede transmitirse de un cuerpo a otro en tres formas: conducción, convección y
radiación.
La conducción
Ocurre en los sólidos, cuyas partículas, al calentarse, se agitan más y transmiten calor a las partículas aledañas.
Pero no todos los sólidos conducen el calor de la misma manera. Según su conductividad térmica, los sólidos
pueden ser:
Conductores Aislantes
Transmiten bien el calor porque tienen alta Impiden la transmisión del calor porque tienen baja
conductividad térmica. Es el caso de los metales. Por conductividad térmica. Por ejemplo, el aire, la madera
ejemplo, al acercar una cuchara de metal al fuego, se y los plásticos.
calentará a tal punto que debes soltarla para no
____________________________________________________________________________________________________
V- DICIEMBRE 27
______________________________________________________________________________________________________
quemarte.

La convección
La convección es la forma como el calor se transfiere en los líquidos y los gases. En estos estados, las moléculas
están más separadas entre sí y pueden trasladarse de un lugar a otro.
A diferencia de la conducción, la transferencia de calor ocurre por el movimiento de algún fluido, ya sea gas o
líquido. Cuando se calienta agua en una olla, las partículas calientes, que están más cercanas a la fuente de calor,
se desplazan hacia las zonas frías. El espacio que queda es ocupado por las partículas más frías y que ahora se
calientan. Así se generan las corrientes de convección.
Los efectos de la convección se pueden observar en la naturaleza, en los vientos y en las corrientes marinas.

EDITORA BILBIOTECA
La radiación
MAGISTERIAL
La radiación es la única forma de transferencia de calor que puede ocurrir en el vacío, es decir, sin que haya
contacto físico o material entre los cuerpos. Gracias a la radiación, la energía se transfiere de un cuerpo a otro en
forma de ondas electromagnéticas. Por ejemplo, la radiación es el mecanismo mediante el cual la energía
proveniente del Sol llega hasta la Tierra.
TEMPERATURA
La temperatura es una magnitud escalar arbitraria tomada a fin de expresar el estado de calor o
frío en que se encuentra un cuerpo o una sustancia.
Termómetros
Son instrumentos que sirven para medir la temperatura de los cuerpos.
Los termómetros, en su construcción, se fundamentan en la dilatación de los
cuerpos por efecto del calor.
Partes de un termómetro
Los termómetros pueden funcionar en base a sólidos, líquidos y gases, siendo los más usados
los que emplean como sustancia termométrica un liquide, que puede ser el mercurio o el alcohol.
Estos termómetros tienen las siguientes partes: un bulbo o depósito de vidrio, un tubo capilar, y
una escala de temperaturas en la superficie del tubo capilar.
Termómetro clínico
Señala la temperatura del cuerpo humano. Es muy sensible, su escala está dividida en decimos
de grado y limitada entre las temperaturas de 38°C y 45°C, los 37°C están marcados en rojo
porque esa es la temperatura normal del cuerpo humano; una temperatura superior a este grado
indica que hay fiebre.
Presenta en la parte inferior del tubo capilar un ensanchamiento, para evitar que la columna de
mercurio baje. Por esta razón es que, antes de tomar la temperatura, debe sacudírsele.
Escalas y unidades de temperatura

____________________________________________________________________________________________________
V- DICIEMBRE 28
______________________________________________________________________________________________________
Las escalas termométricas más usadas son la centígrada o de
Celsius, la de Fahrenheit y la de Kelvin, en cada una de las cuales
se marcan dos temperaturas que son los puntos fijos de referencia:
ebullición y solidificación del agua.
Escala centígrado o Celsius ©
Se asigna arbitrariamente el valor de cero grados centígrados (0 °C)
al punto de fusión del hielo, y el de 100 grados centígrados (100 °C) al punto de ebullición del
agua. El intervalo entre los 0 °C y 100 °C está dividido en cien partes iguales, cada una de las
cuales es un grado centígrado.
Esta escala es usada en América y en la mayor parte de los países del mundo. Es también la
preferida para el uso científico.
Escala Fahrenheit (F)
Tiene como puntos fijos los 0 °F y 212 °F los 0 °F corresponden a la temperatura que se obtiene
de una mezcla en partes iguales de hielo machacado y sal de amonio; tos 212 °F corresponden
a la temperatura de los vapores del agua en ebullición a nivel del mar, mientras que los 32 °F
corresponden a la temperatura del hielo.
El espacio comprendido entre los puntos 32 °F y 212 °F se divide en 180 partes iguales, cada
una de las cuales corresponde a un grado Fahrenheit. Esta escala se usa en los países de habla
inglesa.

EDITORA BILBIOTECA
Escala Kelvin (k) o absoluta
Se asigna arbitrariamente el valor de 273,15 QK al punto de fusión del hielo, y el de 373,15 °K al
punto de ebullición del agua.

MAGISTERIAL
El grado Kelvin, tiene las mismas dimensiones que el grado centígrado; pero se diferencia en
que su escala comienza en el cero absoluto (-273 .16°C) que es la más baja temperatura
concebible.
 Realizan conversiones.
Por lo tanto, para convertir una temperatura expresada en °C a °K basta sumarle 273 a los
primeros. O sea:
T °K = T °C + 273
Se usa la letra “T” para designar la temperatura absoluta.
Esta escala se creó para evitar las lecturas negativas en la escala centígrada y facilitar los
estudios científicos.
Conversión de escalas termométricas
1. Convierte 60 grados centígrados a grados Fahrenheit.
Utilizando la regla de 3 simple:
Si 100 °C---------- 180 °F 60 x 180
X= = 108
60°C---------- x 100

A 108 se le suman algebraicamente 32, porque el 0 °C corresponde a 32 °F


108 + 32 = 140 °F
Utilizando la fórmula:
9 ºC +
ºF =
°F =108 + 32 32
°F = 140 5
9 ºC x 60 +32
ºF =
5
2. Convierte 50 grados Fahrenheit a grados centígrados.
Utilizando la regla de tres simple.

____________________________________________________________________________________________________
V- DICIEMBRE 29
______________________________________________________________________________________________________
Antes debe restarse 32 para igualar las escalas:
Utilizando la fórmula:
ºC = 5 (ºF – 32)
50- 32 = 18 °F 9
Si 180°F------------ 100°C
18°F---------------x ºC = 5 (50 – 32)
9
18 x 100
X= = 10
180 ºC ºC = 5 x 18
9

ºC = 10

 Participan en la realización de experimentos sobre el calor.


Propagación del calor
I. Propagación del calor por conducción
1er. paso.- En un desarmador haz gotear la cera de una vela encendida,
a intervalos regulares. Presiona la cabeza de varios clavos contra las
gotas aún blandas de la cera y deja luego que se endurezca. Debes
Propagación del calor

EDITORA BILBIOTECA
colocar los clavos como se indica en la figura.
por conducción (A) y por
2do. paso.-Calienta el extremo puntiagudo con un mechero. convección (B).
3er. paso.- Observa el proceso de conducción del calor y anota tus
descubrimientos.

MAGISTERIAL
¿Cómo podrías explicar la caída de los clavos uno a continuación del otro?
II. Propagación del calor por convección
1er. paso.- En un vaso que contenga agua, agrega aserrín o pequeñas
perlas de plástico.
2do. paso.-Aplica calor gradualmente hasta que el agua comience a hervir.
3er. paso.- Anota tus observaciones.
4to. paso.- Contesta las siguientes interrogantes:
¿Cómo explicas el movimiento de estas pequeñas perlas? Propagación del
¿Qué nombre le darías a ese movimiento continuo? calor por radiación
III. Propagación del calor por radiación
1er. paso.- Enciende tres velas y fíjalas sobre una lata de betún.
2do. paso.-Acerca tu mano a una distancia prudente de las llamas.
¿Qué sientes?
¿Cómo explicas la llegada del calor a tu mano?
3er. paso.- Quita dos velas y coloca nuevamente tu mano. Anota tus observaciones.
 Conversamos con ellos acerca de las recomendaciones sobre los objetos que conducen el calor
ya que pueden ser muy peligrosos.
Estructuración del saber construido como respuesta al problema
 Comentan sus impresiones después de la realización de sus experimentos y sistematizan lo
trabajado durante la sesión en sus cuadernos de trabajo
La temperatura es una propiedad general de la materia, que mide el grado de calor o frío en
que se encuentra un cuerpo.
El calor es una forma de energía interna, que puede ser recibida o cedida por un cuerpo.
La temperatura
Mide la cantidad de energía interna que posee un cuerpo. La energía interna es la suma de la
energía cinética de todas las partículas que componen un cuerpo.
____________________________________________________________________________________________________
V- DICIEMBRE 30
______________________________________________________________________________________________________
Medida
El instrumento que se utiliza para medir la temperatura es el termómetro. Existen tres escalas
termométricas;
Escala Celsius. Sus puntos de referencia son 0°C (punto de fusión del agua) y 100°C (punto de
ebullición del agua).
Escala Fahrenheit. Sus puntos de referencia son 32°F (punto de fusión de agua y 212°F (punto
de ebullición de agua)
Escala kelvin. Sus puntos de referencia son 273° K (punto de fusión del agua) y 373° K (punto
de ebullición del agua)
Evaluación y comunicación
 Con participación activa completan el mapa conceptual con las siguientes palabras y
expresiones: Condensación, temperatura, líquidos, radiación, cambios de estado, termómetro,
gases, conducción y fusión.
Calor

Se propaga produce
es
por

EDITORA BILBIOTECA
Energía térmica Convención Dilatación
en tránsito
Ocurre en Que son
Su medida es

MAGISTERIAL
la Solidos Vaporización

Solidificación
Se mide con
Sublimación Sublimación
regresiva
CIERRE
 Se plantea las siguientes interrogantes: ¿Qué dificultades han encontrado al elaborar el proyecto
de investigación?, ¿Cómo lograron superar esa dificultad?, ¿Tomaron apuntes de los cambios
producidos?, ¿Qué aprendieron?, ¿De qué forma lo aprendieron?
 Como actividades de extensión: Responden los siguientes casos
 Si tenemos prisa en calentar un objeto usando energía del sol, ¿Cuál de estos materiales
preferirías: papel aluminio, papel carbón o papel bono? ¿Por qué?
 Investigan ¿Cómo se adaptan los seres vivos a la temperatura?

___________________________________________
_________________________________________

___________________________________________
_________________________________________

 Se evalúa a través de una prueba escrita.


PRUEBA ESCRITA
1. Identifica, si son verdaderas (V) o falsas (F) las siguientes afirmaciones:
 El calor es una forma de energía que pasa de un cuerpo a otro. ( )
 Todos los materiales se dilatan de la misma forma ( )
 El agua hierve a 373°K ( )
____________________________________________________________________________________________________
V- DICIEMBRE 31
______________________________________________________________________________________________________
 Un material conductor es aquel que permite el paso de calor solo a cierta temperatura.( )
 Al calentar un objeto, las moléculas pierden energía cinética. ( )
 Las superficies oscuras reflejan el calor ( )
2. Reconoce a qué forma de transmisión del calor corresponden las siguientes
situaciones:
Al poner una cuchara de metal en la sopa caliente, el mango se calienta.
Si tomamos sol sin protección, sufrimos quemaduras.
Los ventiladores de techo refrescan el ambiente mejor que los que se apoyan en el suelo.
3. Convierte:
a) 15 °C a °F (Rpta. 59)
b) 40 °C a °F (Rpta. 104)
c) 50 °F a °C {Rpta. 10)
d) 105,8 °F a °C (Rpta. 41)
e) 50 °C a °F (Rpta. 122)
4. Completa el siguiente texto sobre la temperatura con las ideas de los recuadros
La _____________ es una magnitud que puede medirse a escala
_____________,Fahrenheit y Kelvin mediante unos instrumentos de medida

EDITORA BILBIOTECA
llamados ____________ teniendo los más comunes un funcionamiento basado
en la ______________ de distintas sustancias _____________ empleadas para
medir los _____________ de temperatura. Existen diferentes tipos de termómetros,

MAGISTERIAL
entre los que destacan el de mercurio y _____________;ambos constan de
un tubo de _____________ sellado en cuyo interior se encuentra el líquido, que
puede dilatarse _____________ con la temperatura.

termómetros cambios temperatura

Celsius uniformemente alcohol

dilatación líquidas vidrio


5. Indica si las siguientes afirmaciones son verdaderas o falsas.
SI NO
1. La energía térmica es la energía cinética media de un conjunto de partículas.
2. La temperatura no es energía.
3. El calor y la temperatura son dos magnitudes distintas.
4. La temperatura es energía en tránsito.
5. El calor es energía en tránsito.
6. Durante un cambio de estado se produce alteración de la temperatura.
7. El frío es una sensación que percibimos a través de la piel por la pérdida de
calor.
8. La unidad de medida del calor en el Sistema Internacional es el julio.
9. Los termómetros de mercurio están sustituyendo poco a poco a los
termómetros de alcohol.
10. La unidad de medida de la temperatura en el Sistema Internacional es el
grado Celsius.
11. La conducción es la forma de transmisión de calor en los sólidos.
REFLEXIONES SOBRE EL APRENDIZAJE
 Lograron los estudiantes reconocer la diferencia entre calor y temperatura?
____________________________________________________________________________________________________
V- DICIEMBRE 32
______________________________________________________________________________________________________
 ¿Qué dificultades se observaron durante la sistematización de la información?
 ¿Qué aprendizajes se deben reforzar?
 ¿Las estrategias, materiales y recursos resultaron adecuados para la sesión?
ÁREA: MATEMÁTICA
¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Tener listo el papelógrafo con el problema. Contar - Metro o cinta métrica. Modelos de los cuerpos
con material para elaborar los cuerpos redondos. redondos. Libro Matemática 5
INICIO:
 Leen y observan la siguiente información.
La NASA y la Agencia Meteorológica de Japón han determinado que el pasado julio ha sido el mes más caluroso
en la historia, superando el récord anterior establecido en julio del 2011. Asimismo, 2015 tiende a convertirse en
el año con las temperaturas más altas de los últimos tiempos.

EDITORA BILBIOTECA
MAGISTERIAL
 Dialogamos con los estudiantes a partir de las siguientes preguntas: ¿Según el mapa que zonas
son las más calientes? ¿Cómo nos afecta el aumento de la temperatura? ¿Cuál es el lugar más
frio y que temperatura tiene? ¿Por qué hay número que tienen el signo negativo? ¿Qué tipo de
números son los que tienen signo negativo?
 Rescatamos los saberes previos de los estudiantes a través de interrogantes: ¿Qué es un
número entero? ¿Qué características tienen los números enteros? ¿Cómo se representan los
números enteros? ¿Qué relación existe entre los números enteros y el valor absoluto?
 Se comunica el propósito de la sesión:

HOY VAN A REPRESENTAR Y COMPARAR NÚMEROS ENTEROS.


 Se acuerda las normas de convivencia:
- Participar en orden y en los tiempos adecuados.
- Respetar las opiniones de los demás.
DESARROLLO
Situación problemática
 Se presenta a continuación el siguiente problema en un papelote.
“Los estudiantes de quinto grado de primaria tienen que ubicar en la recta numérica los siguientes valores:
En Piura se registra una temperatura En Cerro de Pasco se registra una El submarino se encuentra a 150
de 39 grados Celsius sobre 0 temperatura de 5 grados bajo 0 - metros bajo el nivel del mar -
+39°c 5°c 150m

____________________________________________________________________________________________________
V- DICIEMBRE 33
______________________________________________________________________________________________________
¿Cómo podemos representar los números enteros en la recta numérica?
Comprensión del problema
 Para ello se realiza las siguientes preguntas: ¿De qué trata el problema?, ¿Qué datos nos
brinda?, ¿Qué nos pide?, ¿Qué tienen en común los datos proporcionados?, ¿Cómo los pueden
organizar?, ¿En qué nos ayudaría la recta numérica?
Búsqueda de estrategias
 Organizamos a los estudiantes en equipos de cuatro integrantes y se entrega los materiales.
 Responden a las siguientes preguntas: ¿Cómo podrían representar los datos que se indican en el
problema?, ¿Creen que es necesario considerar todos los datos?; ¿Cómo pueden distinguir a un
número natural de un número entero?; ¿Cómo es eso posible?; ¿Han resuelto un problema
parecido?, ¿Cómo lo hicieron? Se escucha sus respuestas
 Algunos estudiantes pueden realizar alguno(s) de los siguientes procedimientos:
Representación en la recta numérica
 Observa cómo representamos los números enteros.
 Trazamos una recta y fijamos un punto 0 que se llama origen y que corresponde al número
entero cero.
0 Origen

EDITORA BILBIOTECA 0

MAGISTERIAL
 A la derecha del origen, ubicamos los números positivos, y a la izquierda los números negativos,
a igual distancia unos de otros.
Números enteros negativos Números enteros positivos

-6 -5 -4 -3 -2 -1 0 +1 +2 +3 +4 +5 +6

 Observan como el valor de los números crece en la recta numérica de izquierda a derecha. Por
eso.
Por eso -9 < -7 +2 < +3 -2 < +6
De dos números positivos es mayor el más alejado del punto 0
+6 > +2
De nos números negativos es mayor el más próximo al punto 0
-3 > -7
Cualquier punto ´positivo es mayor que otro negativo
+1 > -3
El 0 es menor que cualquier numero positivo y mayor que los negativos.
+3 > 0 0 > -3
 Se formaliza lo aprendido con la participación de los estudiantes; Pregunta: ¿qué estrategias y
procedimientos han empleado para multiplicar decimales? Consolida tu explicación con lo
siguiente:
NÚMEROS ENTEROS
Los números positivos y negativos forman el conjunto de los números enteros. Este conjunto se
simboliza por Z y se representa en la recta numérica. El conjunto Z está formado por:
Números enteros positivos: Z+= {+1;+2;+3; + 4;+5;+6...} Z = Z U {0} U Z+
Números enteros negativos: Z- = {...; -6; -5; -4; -3; -2; -1}
El número cero: {0}
____________________________________________________________________________________________________
V- DICIEMBRE 34
______________________________________________________________________________________________________
COMPARACIÓN DE NÚMEROS ENTEROS
Entre dos números de distinto signo, siempre será mayor el positivo.
Entre dos números negativos, será mayor el que está más cerca del cero en la recta numérica.

VALOR ABSOLUTO DE UN NÚMERO ENTERO


Adrián ubica en la recta numérica los números -7 y +7.
¿Cómo son las distancias de -7 a 0 y de +7 a 0?
Representamos ambas distancias en la recta numérica.

7 unidades 7 unidades

-7 -6 -5 -4 -3 -2 -1 0 +1 +2 +3 +4 +5 +6 +7

La distancias de -7 y +7 a cero son iguales.


La distancia que hay entre un número entero y 0 ó se denomina valor absoluto.
El valor absoluto de -8 es 8. Se escribe l-8I = 8
El valor absoluto de +4 es 4. Se escribe l+4I = 4
 Luego se reflexiona con los estudiantes respecto a los procesos y las estrategias que siguieron

EDITORA BILBIOTECA
para resolver el problema, respondiendo: ¿Fue útil el uso de la recta numérica?, ¿Por qué?;
¿Qué conocimiento matemático hemos aprendido con el uso de la recta numérica?; ¿Qué
procedimientos hemos aplicado para comparar números enteros?, ¿En qué otros problemas será
útil lo aprendido?; ¿Crees que es posible resolver este problema con algún otro procedimiento

MAGISTERIAL
distinto a los que hemos aprendido?
 Plantear otros ejercicios:

____________________________________________________________________________________________________
V- DICIEMBRE 35
______________________________________________________________________________________________________
FICHA DE APLICACIÓN
1. Observa el dibujo y completa la tabla

UBICACIÓN
Buzo
Paracaidista
Gaviota
Lancha
2. Representa la temperatura de cada ciudad.

EDITORA BILBIOTECA
En Puno estamos a 10 En Tumbes estamos a 30 En Cusco estamos a 5
grados bajo 0. grados sobre 0. grados bajo cero.

MAGISTERIAL
3. Escribe el número entero que representa cada una de las siguientes situaciones
La cultura Paracas se desarrolló 1 000 años antes de Cristo. ___________________________
La cultura Mochica se desarrolló 200 años después de Cristo.___________________________
La imprenta se inventó 1 450 años después de Cristo._________________________________
La cultura China se desarrolló 5 000 años antes de Cristo.______________________________

Los años antes de Cristo son


números negativos, y los
años después de Cristo son
números positivos.

4. Ubica y dibuja.

Un flotador en el nivel del mar.


Un buzo que esté a 5 m bajo el nivel del mar.
Un pez que se encuentre a -3 m.
____________________________________________________________________________________________________
V- DICIEMBRE 36
______________________________________________________________________________________________________
Un pelícano que esté a 8 m sobre el buzo.
Un caballito de mar que esté a 4 m bajo el pelícano.
Un delfín que esté a 5 m bajo el caballito de mar.
5. Marca en los termómetros las temperaturas indicadas. Luego, escríbelas
Estábamos a 3o C y la temperatura bajó 4oC.

Estábamos a 2 grados bajo cero y la temperatura subió 5 o C.

6. Escribe los números que continúan en cada sucesión numérica.

EDITORA BILBIOTECA
MAGISTERIAL
7. Observan la recta numérica y compara cada par de números enteros.

-10 -9 -8 -7 -6 -5 -4 -3 -2 -1 0 +1 +2 +3 +4 +5 +6 +7 +8 +9 +10

a) +6 __+10 b) +10 __ +5 c) -5 __+4 d) +6 __ -8 e) 0 __ -7


f) +8 __ -3 g) +7 __ -9 h) -10 __ -9 i) -6 __ -5 j) -7 __ -8

. Escribe el antecesor y el sucesor de cada número entero. Observa los ejemplos.


- 12 < -11 < -10 -131 < -130 < -129
a) __-1__ b) __ -24__ c) __-36__

d) __-89__ e) ___-99___ f) ___-136___

9. Ordena de mayor a menor cada grupo de números.

a) +12 -18 b) -1 -7
+14 -13 0 -9

____________________________ ______________________________

c) -2 +1 d) -6 -8
-14 -12
0 -1

____________________________ ______________________________
10. Determina el valor absoluto.
a) l+49l = b) I-62I = c) I-45I =
____________________________________________________________________________________________________
V- DICIEMBRE 37
______________________________________________________________________________________________________

d) I-138I = e) I+312I = f) I-526I =


11. Compara temperaturas en grados Celsius.
La siguiente tabla registra las temperaturas en distintas ciudades del Perú.
Ciudad Pimentel
Santa Mazocruz Camaná Bagua Yauri
Cruz
Temperatura 24 oC -8 OC -18 OC 18 OC 21 OC -16 OC
 ¿En qué ciudad se registró la mayor temperatura? ¿Y la menor?
 ¿Cuántos grados de diferencia hay entre las dos ciudades con mayor temperatura?
 ¿Cuántos grados de diferencia hay entre las dos ciudades con menor temperatura?
 Ubica la mayor y menor temperatura en una recta numérica. ¿Cómo hallarías la diferencia
entre ambas?
CIERRE
 Para comprobar el aprendizaje de los estudiantes, se formula las siguientes preguntas: ¿Qué han
aprendido hoy?, ¿Fue sencillo?, ¿Qué dificultades se presentaron?, ¿Pudieron superarlas en
forma individual o grupal?, ¿En qué situaciones de tu vida cotidiana usan la comparación de
números enteros?
 Se felicita por el trabajo realizado y los logros obtenidos.
 Como actividad de extensión se pide a los estudiantes resuelvan ejercicios sobre números

EDITORA BILBIOTECA
enteros.
ACTIVIDADES
1. Representa las siguientes situaciones con números enteros.

MAGISTERIAL
Fernando obtuvo en su negocio una ganancia de S/ 800. ____________________ .
En Ticlio se registró una temperatura de 8 grados bajo cero. _________________ .
Un submarino desciende 100 metros bajo el nivel del mar. ___________________ .
La cultura Cara se desarrolló 5 000 años antes de Cristo. _____________________ .
2. Compara y escribe los signos , < o =, según corresponda.
a) -14 _____+12 b) +25____- 80
c) +35 _____-18 d) -55 ____ +1
e) -27 ____ -13 f) -42 _____ -24
g) -58 ____ -57 h) -7 _____ -15
3. Ordena de menor a mayor cada grupo de números.
a) +4; -9;-3;+0; +13; -10; -6; +2
__________________________________
b) -8; +8; -5; -7; +6; 0; -9; -3; +4
__________________________________
c) -16; -18;+4; -7; +2; -12; +7; -5
_________________________________
4. Escribe los números enteros que se indican.
a) Mayores que -7 y menores que +2.
____________________________________________

b) Mayores que -14 y menores que -8


____________________________________________

c) Mayores que -5 y menores que +6


____________________________________________

____________________________________________________________________________________________________
V- DICIEMBRE 38
______________________________________________________________________________________________________
5. Escribe el valor absoluto de los siguientes números:
a) I+12I = a) I- 17I =
b) I+21I = b) I+37I =
c) I- 48I = c) I- 72 I=
d) I+78I = d) I-124I =
e) I-145I = e) I+256I =
6. Escribe V si es verdadero o F si es falso.
a) -8; -12 y -84 pertenecen a Z. ____
b) -9 y +9 están a igual distancia de 0. ____
c) -8 es mayor que -3. ____
d) El valor absoluto de -15 es 15. ____
7. Efectúa.
a) I-12I + I-27I – I+34I + I-18I
b) I+124I – I-68I + I-45I – I+58I + I-23I

 Se evalúa a través de una ficha de evaluación.


PRUEBA ESCRITA
1) Representa la temperatura de cada ciudad.

La temperatura en La temperatura en La temperatura en

EDITORA BILBIOTECA
Huancavelica es 2
grados bajo cero.
Chiclayo es 28 grados. Cerro de Pasco es 8
grados bajo cero.

MAGISTERIAL
_____________________ _________________

Obtuve una
_____________________
2) Representa con números enteros las cantidades que mencionan estas personas.

Tengo una
ganancia de pérdida
S/ 250 de S/. 170.

Estoy a 5 000
metros sobre
el nivel del Estoy a 400
mar. metros bajo
el nivel del
mar.

3) Escribe los números que corresponden a las letras A, B, C, D, E, y F.


A= B= C= D= E= F=

-7 -6 C -4 F A -1 0 +1 D +3 +4 B +6 E

4) Indica las temperaturas que marcan los termómetros en cada ciudad.


____________________________________________________________________________________________________
V- DICIEMBRE 39
______________________________________________________________________________________________________

5) Escribe la letra que corresponde a cada número entero.

F J B G D 0 A H C T E

-9 +4
+2 +6
-4 -8
+8 -2
-6 +9

EDITORA BILBIOTECA
6. Completa las tablas
Anterior Número
-3
-10
Posterior

MAGISTERIAL
23

Anterior Número Posterior


-16
-28
-100

7. Escribe <, > o = según corresponda.


a. -15 ______ -3 d. +5 ____ +3
b. +8 _____ -1 e. -10 ____ -13
c. 15 ______ +15 f. -12 _____ 12

8. Ordena de mayor a menor los números de cada grupo

a.
-4 +3 -5
b.
-2 -1 0
c.
+6 -3 -5
d.
0 +1 -1

9. Ordena las temperaturas de menor a mayor

En Iquitos están a 35°C sobre 0 En Lima están a 14°C sobre 0


____________________________________________________________________________________________________
V- DICIEMBRE 40
______________________________________________________________________________________________________

En Huancavelica están a 2°C bajo 0 En Cerro de Pasco están a 5°C bajo 0

_____________<_________<____________<__________________________
10. Expresa cada conjunto por extensión y clasifícalo según sea: unitario, finito, vacío o
infinito.
a. A = { x/x  Z, -5 < x < 1} D = { x/x  Z, -4 < x < -2}
_____________________ _____________________

b. B = { x/x  Z, -3 < x < -1} E = { x/x  Z, -3 < x }


_____________________ _____________________

c. C = { x/x  Z, -9 < x < -8} F = { x/x  Z, -7 < x < -3}

_____________________ _____________________

EDITORA BILBIOTECA
REFLEXIONES SOBRE EL APRENDIZAJE
 ¿Lograron los estudiantes reconocer representar los números enteros?
 ¿Qué dificultades se observaron durante la resolución de los ejercicios?

MAGISTERIAL
 ¿Qué aprendizajes se deben reforzar?
 ¿Las estrategias, materiales y recursos resultaron de adecuados para la sesión?

____________________________________________________________________________________________________
V- DICIEMBRE 41
______________________________________________________________________________________________________
SEMANA Nº 1
“ESPERAMOS CON ENTUSIASMO Y RESPONSABILIDAD LA LLEGADA DE
JESÚS”
Día Nro. 3
“ESCRIBIMOS CORRECTAMENTE FELICITACIONES DE NAVIDAD”
• PROPÓSITOS DE APRENDIZAJE
Evidencias de
Competencia / Campo
Área Desempeños aprendizaje /
Capacidad temático
Inst. de valoración
C 3. Escribe diversos tipos Ortografía - Utiliza recursos gramaticales y - Utiliza los usos de la
de textos en su lengua de la H ortográficos (por ejemplo, H en la escritura de
materna. ortografía de la H) que oraciones
3.3. Utiliza convenciones contribuyen a dar sentido a su resolviendo fichas
del lenguaje escrito de texto, e incorpora algunos de aplicación.
forma pertinente. recursos textuales para - Prueba escrita.
reforzar dicho sentido. Emplea
algunas figuras retóricas, para

EDITORA BILBIOTECA caracterizar personas,


personajes y escenarios, o
para elaborar patrones rítmicos
o versos libres, con el fin de

M
MAGISTERIAL
1. Resuelve problemas
de cantidad.
Adición y
sustracción
expresar sus experiencias y
emociones.
- Establece relaciones entre
datos y una o más acciones de
- Establecen
relaciones entre los
1.1. Traduce cantidades a de números agregar, quitar, comparar, datos para la
expresiones numéricas enteros. igualar, reiterar, agrupar y resolución de
repartir cantidades, para adiciones y
transformarlas en expresiones sustracciones de
numéricas (modelo) de adición, números enteros.
sustracción, multiplicación y - Prueba escrita.
división con números
naturales, y de adición y
sustracción con decimales.

ÁREA: COMUNICACIÓN
¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Copias de las fichas y evaluaciones de los - Plumones. Papelotes. Libro Comunicación 5. Tarjetas
estudiantes. Texto de 5to grado. de cartulina para los carteles.
INICIO:
 Presentamos una sopa de letras sobre elementos de la Navidad.

____________________________________________________________________________________________________
V- DICIEMBRE 42
______________________________________________________________________________________________________

 Luego presentamos un conjunto de imágenes que se buscaran en la sopa de letras.

EDITORA BILBIOTECA
MAGISTERIAL
Solución
SOPA DE LETRAS – SOLUCION

 Los estudiantes leen el texto: Cuento de la letra H.

____________________________________________________________________________________________________
V- DICIEMBRE 43
______________________________________________________________________________________________________
Cuento de la letra H
Horacio, el payaso, está durmiendo la siesta en una
cómoda hamaca, a la sombra de un árbol que hay en la
huerta.
De pronto, aparece Hugo y le despierta diciendo:
-¿Te apetece comer un higo, Horacio?
-No, muchas gracias -le responde, y vuelve a cerrar los
ojos.
Al cabo de un rato, Henar se le acerca y le pregunta:
-¿Quieres un helado? ¡Están riquísimos!
-¿Qué? ¡No, gracias! -contesta Horacio algo molesto, deseando dormirse de
nuevo.
A los cinco minutos, Ainhoa le ofrece:
-¿Te traigo un café con hielo?
-¡No! ¡No me apetecen ni higos, ni helados, ni café con hieloooooo! -grita muy
enfadado nuestro amigo el payaso.
Los chicos al oírle se alejan a toda velocidad.
¡Por fin, Horacio consigue dormirse de nuevo! Se le oye roncar. Y...
¡ ¡ tacatacatacatacatacatá!!

EDITORA BILBIOTECA
-¿Qué? ¿Qué sucede? ¿Un terremoto? -pregunta asustado Horacio al oír ese
estruendo.
-¡Nooo! -responden a coro Hugo, Henar y Ainhoa-
¡No es un terremoto! ¡Es un helicóptero! Mira, ¡qué bajito vuela!
¡Salúdale, Horacio! ¡Buen viaje helicóptero! ¡Ja, ja, ja, ja, ja!

MAGISTERIAL
ANA SERNA VARA
 Después de leer el texto, rescatamos sus saberes: ¿Qué palabras con la letra H se menciona en
el cuento? Menciónalas ¿Qué reglas se deben de seguir para usar la letra “H”? ¿Es necesario
utilizar la “H” aún si es muda? ¿Cómo podemos mejorar la escritura de nuestros textos?
 Se comunica el propósito de la sesión:

HOY ESCRIBIREMOS UN TEXTO DE NAVIDAD DONDE RESALTAREMOS LA


ESCRITURA CORRECTA DE PALABRAS CON “H”
 Se acuerda las normas de convivencia:
- Escuchar las ideas que proponen los compañeros y compañeros, al hacer y responder preguntas.
- Demostrar respeto por los demás al momento de participar y exponer sus ideas.
DESARROLLO
 Presentamos una sopa de letras y solicitamos a los estudiantes que ubiquen palabras con H:

 Respuestas: Humo-Hielo- Hueso- Huir- Hiato- Hubieran- Hago- Hablamos- Deshacer- Herradura-
 Hidrocefalia- hemisferio

____________________________________________________________________________________________________
V- DICIEMBRE 44
______________________________________________________________________________________________________
 Responden: ¿Qué tienen en común las palabras encontradas? ¿En qué situaciones se utilizan la
letra H? Escribimos las respuestas en la pizarra.
 A partir de las respuestas de los estudiantes, presentamos información sobre el uso de la H.

EDITORA BILBIOTECA
MAGISTERIAL
 Escriben un texto de navidad usando las siguientes palabras
HIELO HUELLAS
HIERVA HENO
 Forman parejas de trabajo y resuelven una ficha de aplicación.
FICHA DE APLICACIÓN
Escribe el presente de indicativo y el presente de subjuntivo del verbo oler, fíjate en el ejemplo:
Presente del Indicativo Presente del Subjuntivo
yo huelo yo huela
tú tú
él él
nosotros nosotros
vosotros vosotros
ellos ellos
2. Fíjate cómo empiezan las siguientes palabras, rodea sus tres primeras letras y después
escríbelas en la columna correspondiente:
huesudo, huevo, hierbabuena, huerta, hierba, huella, hiena, hielo, huésped, hiel, hierro, hueco,
huevería, hiedra, huérfano, hierva, huelga, hierbajo, huele.
hie hue
3. Une cada sílaba de la primera columna con otra de la segunda columna y forma palabras:
PALABRAS FORMADAS
hie mo
hue cer
hu rro
ha jo
hi co
ho rror
____________________________________________________________________________________________________
V- DICIEMBRE 45
______________________________________________________________________________________________________
hon lo
hie so
hi ra
hue mor
hu ta
huer go
4. En el siguiente texto rodea con rojo las palabras que tengan h:
Las aves son animales ovíparos, es decir, que ponen huevos. Algunas aves hacen sus nidos
con hierbecillas, pajitas y plumas; otras los construyen con barro y los suspenden en los
aleros de los tejados; y otras incluso utilizan los huecos de troncos y peñascos para anidar.
5. De las palabras que has señalado en el ejercicio anterior, ¿Cuáles cumplen aluna regla que
conoces? ¿Qué regla?
6. en la siguiente sopa de letras localiza: hielo, huella, hiena, hueso, hierro, huerto, hierba, huevo.

EDITORA BILBIOTECA
7. completa las siguientes oraciones con estas palabras: hielo, huellas, huerto, hiena, hierba,
hueso, hierro, huevos, hierro.

MAGISTERIAL
 La ____________________ es un animal feroz.
 El perro está comiendo un ________________.
 Ese martillo esta hecho de _______________.
 La policía estudia las _____________ del ladrón.
 El ______________________ se derrite con el sol.
 Corto la _____________ del _________________.
 La gallina pone _____________________.
 El león está en la jaula de _____________________.
8. Completa el siguiente texto con las palabras del recuadro: huerto, huellas, hueco, hueso, huele
 El detective Humberto salió de la casa y vio unas misteriosas que iban hacia el
 Esto me ____________a chamusquina - dijo.
 Escarbó en la tierra y encontró ¡Un ___________ que había escondido el perro!
 Al fin, en el tronco _____________ de un árbol halló el mensaje en clave.
9. Completa las siguientes oraciones con palabras que empiecen por hle o hue:
 La vaca come ____________ por eso es un animal herbívoro.
 Recogí estos tomates en el _________________.
 La gallina puso un ___________________.
 En el congelador hay cubitos de __________________.
10. Completa con hum-, hie-, hue-:
Como hacía muy buen tiempo, Humberto fue a su ______rto a trabajar un rato. Allí podó la
______dra y quitó las malas ______rbas con una azada de_____rro. Después regó muy bien
hasta dejar la tierra bien ______eda y entró en el corral para recoger unos _________vos.
11. Agrupa estas palabras por familias:
Humano, humo, humilde, humor, humareda, humildad, humorista, humanidad, humorístico,
inhumano, humeante, humildemente.

____________________________________________________________________________________________________
V- DICIEMBRE 46
______________________________________________________________________________________________________
 Comparten sus respuestas y las justifican.
 Felicitamos por el trabajo realizado durante la sesión y por el respeto a las normas de
convivencia.
CIERRE
 Se propicia en los niños la reflexión sobre lo que han aprendido: ¿Qué aprendimos hoy? ¿Para
qué nos sirve lo aprendido hoy? ¿Espere mi turno para hablar, y mostré respeto y consideración?
 Como actividad de extensión resuelven los siguientes ejercicios.
ACTIVIDADES
1. Encuentra las siguientes palabras en la sopa de letras que te aparece.
• Si una palabra lleva “h”, las palabras derivadas de ella también lo llevan. Escribe una palabra
derivada de cada una de las siguientes. Utiliza los prefijos:
a- des- en- in- pre- re-

1. Horca: ahorcar 8. Humo: …………………………………


2. Hoja: ………………………………… 9. Hielo: …………………………………
3. Huir: ………………………………… 10. Honrar: …………………………………

EDITORA BILBIOTECA
4. Heredar: …………………………………
5. Historia: …………………………………
6. Hora: …………………………………
11. Hacer: …………………………………
12. Hondo: …………………………………
13. Habitar: …………………………………

MAGISTERIAL
7. Hinchar: ………………………………… 14. Humano: …………………………………
2. Añade la “h” a las palabras que lo necesiten:
1. No a venido __oy porque a ido a hacer unas pruebas al __ospital.
2. En aquella __abitación __abía mucha __umedad.
3. Se puso __istérico al darse cuenta de la situación en la que se aliaba.
4. Se __ospeda en el __ostal que __ay en la plaza.
5. Está muy orgulloso de la __ortalizas que cultiva en su __uerto.
6. Los muros son de __ierro y __ormigón.

3. Excepto cuatro, las palabras siguientes deben llevar “h”.


1. ovalado 11.ornona
2. uida 12. amburguesa
3. ebreo 13. iena
4. orchata 14. ebra
5. alerta 15. ipopótamo
6. ernia 16. echizar
7. oróscopo 17. eructar
8. ermita 18. ondo
9. ipoteca 19. úngaro
10. Idrógeno 20. ereditario
4. Escribe el sustantivo correspondiente a cada uno de estos verbos:
1. Hallar: …………………… 4. Hinchar: …………………… 7. Herir: ……………………
2. Haraganear: ………………… 5. Halagar: …………………… 8. Hartar: ……………………
3. Hender: …………………… 6. Hastiar: …………………… 9. Hostilizar: ……………………

____________________________________________________________________________________________________
V- DICIEMBRE 47
______________________________________________________________________________________________________
5. Escribe el sustantivo correspondiente a cada adjetivo:
1. Honrado: …………………… 4. Histérico: …………………… 7. Hermoso: ……………………
2. Mohoso: …………………… 5. Honesto: …………………… 8. Hondo: ……………………
3. Hábil: …………………… 6. Coherente: ………………… 9. Humeante: …………………
6. Escribe el adjetivo correspondiente a cada uno de estos sustantivos:
1. Héroe: …………………… 6. Humedad: …………………… 11. Hogar: ……………………
2. Harapo: …………………… 7. Hipótesis: …………………… 12. Humor: ……………………
3. Hambre: …………………… 8. Hostilidad: ………………… 13. Horror: ……………………
4. Herencia: …………………… 9. Hábito: …………………… 14. Higiene: ……………………
5. Humildad: …………………… 10. Herejía: …………………… 15. Herrumbre: …………………
7. Escribe la palabra de la que se ha formado cada una de las siguientes:
1. Hospitalizar: ………………… 6. Herbívoro: ………………… 11. Orfanato: …………………
2. Herrero: …………………… 7. Hilera: …………………… 12. Hombrera: …………………
3. Heladería: …………………… 8. Horario: …………………… 13. Hermanastro: ………………
4. Hortelano: …………………… 9. Oquedad: …………………… 15. Ahijado: ……………………
5. Higuera: …………………… 10. Óseo: …………………… 15. Osario: ……………………

EDITORA BILBIOTECA
8. Escribe las “h” que faltan en estas frases:
1. El elicóptero tenía una avería en la élice.
2. Lleva una orquilla en el pelo.

MAGISTERIAL
3. La oz es una erramienta en desuso.
4. Se an encontrado abundantes uellas de animales preistóricos.
5. De repente me a entrado ipo.
6. Tiene un ematoma en el ombro.
7. En este libro se narran las azañas de algunos de los éroes antiguos.
8. Iba acia la orilla del arroyo cuando la encontré.
9. Algunos de los problemas ortográficos con la “h” se deben a la confusión entre palabras distintas
que suenan igual: a/ha, echo/hecho, ...
1. No ________ venido todavía. Voy _______clase. (a/ha)
2. ¿ _________ estado en casa? En el ajedrez es un __________ (as/has)
3. Subió _________ el tejado. El _____________ de la bandera. (asta / hasta)
4. ¿ __________ alguien ahí? ¡ _____________ qué dolor! (ay/hay)
5. ¡Ojalá _________ venido! El ___________es un árbol.
El ___________cuidaba de los niños. (aya / haya)
6. La cama está _________. Siempre _________ lo que no le gusta.
Ahí vienen los _________ industriales (desecho, desecha/deshecho, deshecha)
7. Lo ___________ a la papelera. Lo tengo ______________
Se __________ cada tarde en el sofá. ¿Está ___________ la comida? (echo, echa/hecho, hecha)
8. La piscina es muy____________. La __________ del sonido, de la luz, del pelo. (onda/honda)
10. Escribe “h” intercalada en las palabras que lo necesiten.

____________________________________________________________________________________________________
V- DICIEMBRE 48
______________________________________________________________________________________________________
Caca__uete 11. Co__ibido 21. Des__alojar
Ex__ibir 12. Re__én 22. Bú__o
Bo__emio 13. Va__o 23. Al__elí
Ex__austo 14. Mal__umorado 24. Al__aja
Co__ete 15. A__orro 25. To__alla
Ca__oba 16. Mal__echor 26. Mo__oso
Ve__ículo 17. A__uyentar 27. Que__acer
Ad__esivo 18. Ba__ía 28. A__umar
A__ogar 19. Ca__ótico 29. An__elar
Ex__austivo 20. Bu__ardilla 30. Mal__erido
 Se evalúa a través de una ficha de evaluación.
PRUEBA ESCRITA
1. Escribe las oraciones colocando las palabras del recuadro en su lugar correspondiente.
Los grandes monumentos son patrimonio de la _________________.
Es muy _______________ ayudar a los necesitados.
A lo lejos se divisaba una inmensa _________________.
No dejaban de _____________________. los restos de la _________________.

EDITORA BILBIOTECA
El ______________ es un ______________ del cuerpo ____________________.
No es noble ____________________ al vencido.
Nunca debemos perder el buen _________________.
Los ________________ entretienen al público con sus _____________________.

humanidad
MAGISTERIAL
humanitario
hoguera
humoradas
humear
humareda
humano
humor
húmero
humillar
hueso
humoristas

2. Redactamos oraciones con las siguientes palabras.


hospitalizaron hipo hospedería hemisferio hidrosfera
hipopótamos hospedaje hospital hidrografía heridos
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
3. Escribimos el significado de estas palabras
Hexaedro: ___________________________________________________________________
Hectolitro: ___________________________________________________________________
Hectómetros: ________________________________________________________________
Hexágono: __________________________________________________________________
Hidrógeno: __________________________________________________________________
Homologar: _________________________________________________________________
Hidrocarburos: ______________________________________________________________
Helio: ______________________________________________________________________
Homófonas: _________________________________________________________________

4. Completamos las oraciones con los verbos del recuadro


Primero ______________ de revisar lo que ______________________
Procuraré _____________ las faltas que __________________ cometido.
Todo lo que _____________________ es hablar por _________________.
__________________ las reses marcándolas con un _________________.

____________________________________________________________________________________________________
V- DICIEMBRE 49
______________________________________________________________________________________________________
Se _______________ de ______________ el libro pero no ______________ lo que buscaba.
Estaban _____________ de _____________ agua para lavar _______________.
Nos ______________ en el lodo y se nos _________________ los pies.

hecho has he hablar hablado habléis hallar herraron hojear hayas hinchaban hundíamos hartos
hervir heridas halló hartó hierro
REFLEXIONES SOBRE EL APRENDIZAJE
 ¿Lograron los estudiantes reconocer los usos de la H?
 ¿Qué dificultades se observaron durante el desarrollo de la ficha de aplicación?
 ¿Qué estrategias podemos aplicar para mejorar el aprendizaje de mis estudiantes?
 ¿Los recursos y materiales fueron relevantes para el desarrollo de la sesión?
ÁREA: MATEMÁTICA
¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Tener preparado con anticipación los datos - Papelógrafo. Hojas de colores. Plumones. Reglas.
navideños. Preparar el papelógrafo con el problema. Cuaderno de trabajo 5.
Copias de la ficha de aplicación y prueba escrita
según la cantidad de estudiantes.
INICIO:
EDITORA BILBIOTECA
 Se invita a los estudiantes a jugar con los dados navideños por grupos:

MAGISTERIAL

 Se indica a los estudiantes que deberán de lanzar los cuatro dados a la vez y según las figuras
mostradas mencionar oraciones relacionadas a la navidad en memos de 10 segundos. Si logran
ganaran 30 puntos y si no lo logran en el tiempo establecido se le quita 50 puntos.
 Los resultados serán a notados en la pizarra.
 Responden las interrogantes: ¿Qué grupo obtuvo mayor puntaje? ¿Hubo resultados negativos?
¿Qué operaciones utilizaron para hallar el resultado?
 Rescatamos los saberes previos de los estudiantes a través preguntas: ¿Cómo se resuelve la
adición y sustracción de números enteros? ¿Se puede resolver una adición de un número entero
con un número natural? ¿De qué manera? ¿En qué se parecen y diferencian la adición y
sustracción de números naturales y números enteros? ¿De qué manera intervienen los signos en
la adición y sustracción de números enteros?
 Se comunica el propósito de la sesión:

HOY RESOLVERAN ADICIONES Y SUSTRACCIONES CON NÚMEROS ENTEROS.


 Se acuerda las normas de convivencia:

____________________________________________________________________________________________________
V- DICIEMBRE 50
______________________________________________________________________________________________________
- Participar en orden y en los tiempos adecuados.
- Respetar las opiniones de los demás.
DESARROLLO
Planteamiento del problema
 Se presenta el papelote con el siguiente problema
Luz y Juan han inaugurado un local comercial por Navidad cada uno. Ellos hacen un balance
de las ventas de los dos primeros días. La tabla muestra los resultados.
Día 1 Día 2 Balance Expresión numérica
Luz Ganó Ganó Ganó
S/. 50 S/. 40 S/. 90
Juan Perdió Perdió Perdió
S/. 15 S/. 20 S/. 35

Comprensión el problema.
 Se realiza las siguientes preguntas: ¿Qué tienen que hallar? ¿Qué operación utilizarán? ¿Cómo
sumamos números enteros? ¿Se puede sumar números enteros en la recta numérica? ¿La
adición de números enteros tiene propiedades? ¿De qué trata el problema?, ¿Qué datos nos

EDITORA BILBIOTECA
brinda?, ¿Qué nos pide el problema? Se solicita que algunos expliquen el problema con sus
propias palabras.
Búsqueda de estrategias

MAGISTERIAL
 Organizamos a los estudiantes en equipos de cuatro integrantes y entregamos los materiales:
reglas, papelotes, plumones.
 Los estudiantes conversan en equipo, proponen de qué forma resolverán el problema; asimismo,
que ejecuten la estrategia o el procedimiento acordado en equipo.
 Analizan la siguiente resolución del problema planteado.
Observamos en la tabla que la suma de números positivos es otro número positivo, y la suma de números
negativos es otro número negativo.
Expresión numérica
Luz (+50) + (+40) = +90
Juan (-15) + (-20) = -35
También podemos sumar los valores absolutos de losI-15I + I-20I y a dicho resultado
sumandos
anteponerle el mismo signo: I+50I + I+40I I-15I + I-20I
I+50I + I+40I 15 + 20
50 + 40 -35
+90
 Formaliza con la participación de los estudiantes.
Adición en Z
La operación que hace corresponder a dos números enteros, llamados sumandos, un tercero
llamado suma, es la adición.
La adición de números enteros cumple las mismas propiedades de la adición de números
naturales. Además, en Z existe el elemento opuesto.
Propiedad Expresión matemática
Clausura a  , b  , a + b = c, entonces c  
Conmutativa a+b=b+a
Asociativa (a + b) + c = a + (b + c)
Elemento neutro a+0=0+a=a
Elemento opuesto A  , existe –a   (+ a) + (- a) = 0
Al sumar dos números enteros se presentan dos casos:
____________________________________________________________________________________________________
V- DICIEMBRE 51
______________________________________________________________________________________________________
Si los sumandos son… Ejemplo
Del mismo signo: Se suman sus valores absolutos y se (+4) + (+5) = + (4 + 5) = +9
coloca el mismo signo. (-7) + (-11) = - (7 + 11) = - 18
De signos diferentes: Se restan sus valores absolutos y (+ 1) + (- 8) = - (8 - 1) = - 7
se coloca el signo del sumando con mayor valor absoluto. (+ 5) + (- 3) = + (-5 - 3) = + 2

Analizan una adición de números enteros con signos diferentes.


Observamos que la suma de números enteros de distintos signos se obtiene restando los valores
de los sumandos sin considerar su signo (valor absoluto de los sumandos). El signo de la suma lo
determina el sumando con mayor valor absoluto:
I+10I + I-15I I+12I + I+20I
Propiedad conmutativa Propiedad conmutativa
I-15I + I+10I I+20I + I-12I
15 - 10 20 - 12
-5 +8

Representan adiciones de números enteros en la recta numérica.


(+2) + (+3) (-1) + (-4)
Avanzamos 2 unidades a la derecha de Avanzamos 1 unidad a la izquierda de

EDITORA BILBIOTECA
cero y, luego, 3 unidades más.

+2 +3
cero y, luego, 4 unidades más.

-4 -1

MAGISTERIAL
0 +2 +5
-5

Luego: (-1) + (-4) = - 5


-1 0

Luego: (+2) + (+3) = + 5

Representamos la adición de números enteros en la recta numérica.

(+3) +(-5) (-2) + (+6)


Avanzamos 3 unidades a la derecha de Avanzamos 2 unidades a la izquierda de
cero y, luego, avanzamos 5 unidades a la cero y, luego, avanzamos 6 unidades a la
izquierda. derecho.
+6
-5
+3 -2

-2 0 +3 -2 0 +4

Luego: (+3) + (-5) = - 2 Luego: (-2) + (+6) = + 4

Sustracción en Z
La diferencia de dos números enteros a y b se obtiene al sumar al minuendo el opuesto del sustraendo. Por
ejemplo:
(+42) - (+6) = (+42) + (-6) = + (42 - 6) = +36
(+11)-(-13) = (+1 1) + (+13) = +24
 Reflexionar con los estudiantes respecto a los procesos y estrategias que siguieron para resolver
el problema propuesto, a través de las siguientes preguntas: ¿Las estrategias que utilizaron
fueron útiles?, ¿Cuál les pareció mejor, ¿Por qué?, ¿Qué estrategia les resultó mejor?, ¿Por

____________________________________________________________________________________________________
V- DICIEMBRE 52
______________________________________________________________________________________________________
qué?, ¿Qué conceptos hemos construido?, ¿En qué otros problemas podemos aplicar lo que
hemos construido?
 Plantea otros ejercicios:
PRÁCTICA DE CLASE
1. Con ayuda de la recta numérica, halla cada una de las sumas.

a) (-3) + (-2) = ________

-10 -9 -8 -7 -6 -5 -4 -3 -2 -1 0 +1 +2 +3 +4 +5 +6 +7 +8 +9 +10

b) (+1) + (+6) = ________

-10 -9 -8 -7 -6 -5 -4 -3 -2 -1 0 +1 +2 +3 +4 +5 +6 +7 +8 +9 +10

c) (- 5) + (- 1) = _______

EDITORA BILBIOTECA
-10 -9 -8 -7 -6

d) (+ 3) + (+5) = ________
-5 -4 -3 -2 -1 0 +1 +2 +3 +4 +5 +6 +7 +8 +9 +10

MAGISTERIAL
-10 -9 -8 -7 -6 -5 -4 -3 -2 -1 0 +1 +2 +3 +4 +5 +6 +7 +8 +9 +10

2.- Realizan las operaciones y colorea los espacios en los que aparezcan los resultados obtenidos.
a) (+7) + (+3) = __________
b) (-5) + (- 9) = __________
c) (+2) + (+3) + (+1) =__________
d) (- 1) + (-2) + (- 3) = __________
e) (17) + (+5) + (15) = __________
f) (-20) + (-12) + (-18) = __________
g) (+11) + (19) + (+20) = __________
h) (-6) + (-4) + (-2) + (-8) = __________
i) (+100) + (+5) + (+10) + (15) = __________
j) (-20) + (-3) + (-7) + (-13) = __________

3.- Escribe los números que faltan en las sucesiones.


+2 +3 +5 -2
-3
+4 +9 +5

a)

____________________________________________________________________________________________________

-1 -3 V- DICIEMBRE 53
-5
-3 -1 -6
-4 -9
-6 -5
______________________________________________________________________________________________________

b)

c)

4.- Resuelve los siguientes problemas.


a) Laura dice que ha representado en la recta numérica el número -5, y para representar el
número -7 avanzó dos lugares a la derecha. ¿Está bien lo que hizo?
__________________________________________________________________
b) A las nueve de la noche, un termómetro marcaba 8 0C bajo cero. Si dos horas después la
temperatura descendió 3 0C, ¿qué temperatura marcaba el termómetro a las once de la
noche?
___________________________________________________________________
c) Un tiburón estaba a 6 metros bajo el nivel del mar. Si descendió 4 metros, ¿en qué
ubicación se encuentra ahora?
____________________________________________________________________

EDITORA BILBIOTECA
5.- Resuelve las sustracciones. Observa los ejemplos.
(+23)- -15) = (+23) + (+15) = +38
(-44) - (+26) = (-44) + (-26) = -70

MAGISTERIAL
a) (+18) - (+24) =
b) (+34) - (-21) =
c) (-31) - (+19) =
d) (+26) - (+12) =
e) (-42) - (-62) =
f) (+22) - (+52) =
6.- Representa en la recta numérica las siguiente sustracciones. Observa el ejemplo.
(+2) – (+8)
Escribimos la operación equivalente: (+2) – (+8) = (+2) + (-8)
Representamos en la recta.

-6 0 +2

a) (+4) – (+6) b) (+2) - (+5)


c) (+8) - (+5) d) (+6) - (+2)
e) (-2) - (-7) f) (-3) - (-5)
g) (+4) - (-3) h) (+5) - (-1)

____________________________________________________________________________________________________
V- DICIEMBRE 54
______________________________________________________________________________________________________
7.- Escribe la sustracción que se representa en cada recta.
+9

-3

-3 0 +6
-10
+2

-8 0 +2

+10
-7

-7 0 +3

EDITORA BILBIOTECA
8.- Halla los valores de a, b, y c en las siguientes igualdades:
1) a – (-5) = +10 2) b + (+10) = +20
3) c – (-12) = + 30 4) a + (-26) = +20
5) b – (-150) = + 100 6) c- (-63) = +150

MAGISTERIAL
7) a - (-26) = +40 8) b- (-64) = +100
9) c- (-17) = + 10 10) a + (-7) = -44
9.- Resuelve los siguientes problemas:
 En la ciudad de Chimbote, se registró una temperatura de 14 0C, y en la ciudad de Juliaca,
una temperatura de -8 0C. ¿Cuál es la diferencia de temperaturas entre ambas ciudades?
 Eduardo y José están buceando. Si Eduardo se encuentra a -36 m, y José, a -54 m, ¿Qué
distancia los separa?
 Se induce a los niños y niñas a que apliquen la estrategia más adecuada para resolver los
ejercicios propuestos.
CIERRE
 Realiza las siguientes preguntas sobre las actividades desarrolladas durante la sesión: ¿Qué han
aprendido hoy?, ¿Les pareció fácil?, ¿Dónde encontraron dificultad?, ¿Por qué?, ¿Trabajar en
equipo los ayudó a superar las dificultades?, ¿Por qué?, ¿Cómo se han sentido?, ¿Les gustó?,
¿Qué debemos hacer para mejorar?, ¿Cómo complementarían este aprendizaje?
 Como actividad de extensión resuelven los siguientes ejercicios:
ACTIVIDADES
1) Con ayuda de la recta numérica, halla cada una de las sumas.
a) (+4) + (-3) = _______

-10 -9 -8 -7 -6 -5 -4 -3 -2 -1 0 +1 +2 +3 +4 +5 +6 +7 +8 +9 +10

b) (- 8) + (+ 1) = ________

-10 -9 -8 -7 -6 -5 -4 -3 -2 -1 0 +1 +2 +3 +4 +5 +6 +7 +8 +9 +10

____________________________________________________________________________________________________
V- DICIEMBRE 55
______________________________________________________________________________________________________
c) (+3) + (-7) = ________

-10 -9 -8 -7 -6 -5 -4 -3 -2 -1 0 +1 +2 +3 +4 +5 +6 +7 +8 +9 +10

2.- Completa los cuadros y responde.


a b a+b b+a
-5 +3
-8 +2
+9 -7
+4 -9

a b a+b b+a
-50 -3
+19 -2
-36 +7
+40 +9
 ¿Se cumple la propiedad conmutativa en la adición de números enteros? ___________
3.- Resuelve los siguientes problemas.

EDITORA BILBIOTECA
a) A las ocho de la mañana, un termómetro marcaba 3 0C bajo cero; cuatro horas después, la
temperatura aumento 10 0C. ¿Qué temperatura marcaba el termómetro a las doce del día?
b) El congelador de un frigorífico tuvo una temperatura de 12 0C bajo cero y después subió 4
0
C. ¿Qué temperatura tiene ahora?

MAGISTERIAL
c) La suma de dos números es -12. Si uno de ellos es +7. ¿Cuál es el otro número?
d) La suma de dos números es +25. Si uno de ellos es -8. ¿Cuál es el otro número?
4.- Observa el ejemplo y calcula el resultado de cada operación.
a) Calcula el resultado de (+2) + (+3) + (-4) + (-8) + (+5).
Resolvemos de tres formas:
1ra FORMA 2da FORMA 3ra FORMA

Agrupamos de dos en dos los Agrupamos los sumandos Sumamos en el orden en que
sumandos. positivos y los negativos. aparecen los sumandos.

(+2) + (+3) + (-4) + (-8) + (+5) (+2) + (+3) + (-4) + (-8) + (+5) (+2) + (+3) + (-4) + (-8) + (+5)

(+5) + (-12) + (+5) (+2) + (+3) + (+5) + (-4) + (-8) (+5) + (-4) + (-8) + (+5)

(-7) + (+5) (+ 10) + (- 12) (+ 1) + (-8) + (+5)

-2 (-7) + (+5)

a) (+ 9) + (+ 2) + (- 3) + (- 6) + (- 10)

b) (- 13) + (+ 5) + (+ 11) + (- 8) + (+ 7)

c) (- 4) + (- 6) + (- 9) + (+ 5) + (- 8) + (+ 1)

d) (- 40) + (- 35) + (-12) + (+ 100) + (- 9)

____________________________________________________________________________________________________
V- DICIEMBRE 56
______________________________________________________________________________________________________
5.- Completa.
Número entero -13 -10 +15 +71
Opuesto +21 -17 -50
El opuesto de un número entero positivo es un número entero______________.
El opuesto de un número entero negativo es un número entero ______________ .
6.- Calcula las diferencias.
a) (-12) - (+25) =
b) (-57) - (-72) =
c) (+24) - (-32) =
d) (-36) - (+34) =
e) (-25) - (-68) =
f) (+86) - (-19) =
7. Realiza lo que se pide.
a) Calcula y completa la tabla.
- -15 +45 -123 + 250
-7
-12
+25
+76
8. Escribe el número que completa cada igualdad.

EDITORA BILBIOTECA
a) (-9) - _____ = +5
c) (+7) - _____ = -10
e) (- 10) - ____ = -16
g) (+18) - ____ = -20
b) ______ - (-2) = +9
d) ______ - (+ 9) = +7
f) ______ - (-12) = -8
h) ______ - (+26) = -30

MAGISTERIAL
9. Resuelve los siguientes problemas:
a. El punto más alto del mundo es la cima del monte Everest, a 8 848 metros sobre el nivel del
mar. Por otro lado, el punto de mayor profundidad se registra en la fosa de las islas Marianas, a
11 034 metros bajo el nivel del mar. ¿Cuál es la diferencia en metros entre estos dos puntos
extremos?
b. Tales de Mileto es considerado uno de os siete sabios de Grecia. Gran filósofo y matemático,
sobresalió especialmente en el área de la geometría. Murió en el año 547 a.C., a la edad de 77
años. ¿En qué año nació?
 Resuelven una ficha de evaluación.
PRUEBA ESCRITA
1. Calcula las sumas y represéntalas en la recta.

a.- (+18) + (+24) d.- (+27) + (+17)

b.- (-25) + (-14) e.- (-54) + (-36)

c.- (+68) + (+39) f.- (-36) + (-47)

2. Resuelve el siguiente problema:


a) Kevin jugó canicas con Luis y ganó 6. Luego, jugó con José y ganó 7 ¿Cuántas canicas ganó
en total? ¿Cuántas tendrá que ganar para acumular 19 canicas en total?
3. Escribe el número que corresponda.

a. (-1) + (-8) = d. +(+15) = +25 g. (+29) + = -2

b. (+24) + (+12) = e. (-12)+ = -20 h. +(-15) = -15

c. (-19) + (+8) = f. (-80) + = - 83 i. (+27) + = -27

____________________________________________________________________________________________________
V- DICIEMBRE 57
______________________________________________________________________________________________________
4.- Completa los cuadros.

Operación Propiedad Operación Propiedad


(-15) + (-42) = -57 Clausura (-37) + = -57 Clausura

(-5) + 0 = -5 = (-12) + (-43) Conmutativa

(+9) + (-4) = (-4) + (+9) (-6) + (+5) + (-14) = Asociativa

(-7) + (+7) = 0 (-10) + = -10 E. neutro

(+8) + (-4) + (-2) = (+8) + (-4) + (-2) (+2) + =0 E. opuesto

5.- Determina el valor de X en cada caso. Anota la propiedad aplicada en cada paso.

EDITORA BILBIOTECA
a. (+8) + (-8) + x = (-17) + (-5)
0 + x = -(17 + 5)
x = -22
b. (-16) + [x + (+16)] =-24

MAGISTERIAL
c. x = (-15) + (-13) + (+ 15)

d. [(-9) + x] + (+9) = [(-25) + (+6)] + (-6)

6.- Resuelve las operaciones en tu cuaderno siguiendo los pasos indicados en el cuadro.
Pasos para sumar números Ejemplos
enteros en la recta numérica.
Representa el primer sumando, a (+1) + (+3) (-3) + (+5)
-3
partir del cero, con una flecha hacia la +1
derecha si es positivo o hacia la
izquierda si es negativo. -4 -3 -2 -1 0 +1 +2 +3 +4
-4 -3 -2 -1 0 +1 +2 +3 +4

Representa el segundo sumando y +1 +3


-3 +2
une con una flecha la parte posterior
del primero con la punta del último.
-4 -3 -2 -1 0 +1 +2 +3 +4
-4 -3 -2 -1 0 +1 +2 +3 +4
+4
+5

a) (+6) + (- 10) =

b) (- 4) + (+ 5) =

c) (- 6) + (- 1) =

d) (+ 5) + (- 6) =

e) (+ 12) + (-7) =

f) (+ 4) + (- 4) =
____________________________________________________________________________________________________
V- DICIEMBRE 58
______________________________________________________________________________________________________
8.- Calcula las siguientes diferencias.
a) (-7) – (-5) = e) (+3) – (-3) = i) (-15) – (+8) =
b) (+6) – (-2) = f) (-8) – (-51) = j) (0) – (-43) =
c) (+6) – (+2) = g) (+3) – (-72) = k) (-65) – (0) =
d) (-11) – (+6) = h) (+1) – (+85) = l) (-37) – (+37) =

Resuelve las siguientes operaciones siguiendo los pasos indicados en el cuadro.


Pasos para restar números Ejemplos
enteros en la recta numérica
Representa el sustraendo, a partir (+2) – (+5)
+2 (-3) – (-7)
del cero, con una flecha hacia la -3
derecha si es positivo y hacia la -4 -3 -2 -1 0 +1 +2 +3 +4
izquierda si es negativo. -4 -3 -2 -1 0 +1 +2 +3 +4

Representa al opuesto del -5 +7


minuendo y une con una flecha la
+2 -3
parte posterior del sustraendo con
la punta del minuendo. -4 -3 -2 -1 0 +1 +2 +3 +4 -4 -3 -2 -1 0 +1 +2 +3 +4
-3 +4

EDITORA BILBIOTECA
a. (-3) - (-5) =
b. (+9) – (-2) =
c. (+5) – (-7) =
d. (+7) – (+1) =
e. (-11) – (+4) =
f. (+8) – (+9) =
9.- Completa las tablas escribiendo el número correspondiente a cada casillero.

+
+ 15
-1 1
MAGISTERIAL
-5 +8 -9 -7 -3 -15 -
+
15
-1 1
-5 +8 -9 -7 -3 -15

-9 -9

10.- Completa las igualdades.


a (+17) - ____ = +19
b. (-11)- ______=+5
c. (-1)-_____ = +6
d. _____- (-8) = +12
e. ______ -(+7) = +18
f. (+4)-_____ = -15
g. _____- (+9) = +9
h. (-17) - ______= 0
i. _____ - (-14) = +14

REFLEXIONES SOBRE EL APRENDIZAJE


 ¿Lograron los estudiantes resolver las adiciones y sustracciones con números enteros?
 ¿Qué dificultades se observaron durante la resolución de los ejercicios?
 ¿Qué aprendizajes se deben reforzar?
 ¿Las estrategias, materiales y recursos resultaron de adecuados para la sesión?

____________________________________________________________________________________________________
V- DICIEMBRE 59
______________________________________________________________________________________________________
SEMANA Nº 1
“ESPERAMOS CON ENTUSIASMO Y RESPONSABILIDAD LA
LLEGADA DE JESÚS”
Día Nro. 4
“AHORREMOS EN ESTA NAVIDAD”
• PROPÓSITOS DE APRENDIZAJE
Evidencias de
Competencia / Campo
Área Desempeños aprendizaje /
Capacidad temático
Inst. de valoración
PS 5. Gestiona Planes de - Argumenta la importancia del - Dialoga sobre los
responsablemente los ahorro. ahorro y de la inversión de gastos en Navidad
recursos económicos recursos, así como de la plantea acciones de
5.1. Comprende las cultura de pago de las deudas ahorro para su
relaciones entre los contraídas. familia.
elementos del sistema - Escala de
económico y financiero valoración.

EDITORA BILBIOTECA
5.2. Toma decisiones - Elabora un plan de ahorro y
económicas y financieras explica cómo el uso del dinero
afecta positiva o
negativamente a las personas

MAGISTERIAL
y a las familias.
M 2. Resuelve problemas Series alfa - Establece relaciones entre los - Resuelve series alfa
de regularidad, numérica. datos de una regularidad y los numéricas y explica
equivalencia y cambio. transforma en un patrón de el patrón de
2.1. Traduce datos y repetición (que combine un regularidad de la
condiciones a criterio geométrico de simetría serie.
expresiones algebraicas y o traslación y un criterio - Prueba escrita.
gráficas perceptual) o en un patrón
aditivo de segundo orden (por
ejemplo: 13 - 15 - 18 - 22 - 27
-...)

ÁREA: PERSONAL SOCIAL


¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Preparar con anticipación el villancico. Tener a la - Hojas bond. Plumones. Cinta adhesiva. Infografía.
mano la infografía de gastos. Papelógrafo. Villancico.
INICIO:
 Presentamos un papelografo con la letra del villancico: Ven a mi casa esta navidad.

VEN A MI CASA ESTA NAVIDAD No vayas solo por esas calles,


Tú que estás lejos de tus amigos, queriéndote aturdir,
de tu tierra y de tu hogar, ven con nosotros y a nuestro lado
y tienes pena, pena en el alma, intenta sonreír.
porque no dejas de pensar. Por eso y muchas cosas más,
ven a mi casa esta Navidad.
Tú que esta noche no puedes
dejar de recordar, Tú que has vivido, siempre de espaldas,
quiero que sepas, que aquí en mi mesa, sin perdonar ningún error,
____________________________________________________________________________________________________
V- DICIEMBRE 60
______________________________________________________________________________________________________
para ti tengo un lugar. ahora es momento de reencontrarnos,
ven a mi casa, por favor.
Por eso y muchas cosas más,
ven a mi casa esta Navidad. (Bis) Ahora ya es tiempo, de que charlemos,
pues nada se perdió,
Tú que recuerdas quizá a tu madre en estos días, todo se olvida,
o a un hijo que no está, y nada sucedió.
quiero que sepas, que en esta noche,
él te acompañará. Por eso y muchas cosas más,
ven a mi casa esta Navidad. (3 veces)

 Preguntamos: ¿Qué mensaje nos da el villancico? ¿Qué es más importante pasar el tiempo en
familia o comprar regalos? ¿Por qué se dice que en navidad los gastos se incrementan?
 Se recoge los saberes previos mediante esta pregunta: ¿Qué significa ahorrar? ¿Cuáles son los
beneficios del ahorro? ¿Qué acciones podemos realizar con el ahorro familiar en la fiesta de
Navidad?
 Se comunica el propósito de la sesión:

HOY VAN A ESTABLECER BASES PARA EL AHORRO FAMILIAR.

EDITORA BILBIOTECA
 Se acuerda las normas de convivencia:
- Mantener el orden y limpieza en mi aula.
- Utilizo las palabras por favor y gracias.

MAGISTERIAL
DESARROLLO
 Se presenta una infografía sobre los gastos que se realizan en Navidad:

____________________________________________________________________________________________________
V- DICIEMBRE 61
______________________________________________________________________________________________________
 Planteamos preguntas respecto a la infografía: Después de observar la información ¿Cuál de los
gastos realizados consideran innecesario? ¿Por qué los gastos se incrementan al pasar los
años? ¿Qué gastos se pueden dejar de lado para ahorrar? ¿Por qué es importante el ahorro?
 Comentamos que estas preguntas se irán resolviendo juntos, durante el desarrollo de la sesión.
Análisis de la información.
 Formamos grupos de trabajo y solicitamos a cada grupo que elaboren una lista de los gastos que
se realizan en las fiestas de Navidad.
Regalos Cena Fiestas Decoración

 Pedimos que los estudiantes presenten sus listas de gastos al pleno. Luego, presentamos un
palelógrafo con información sobre los tipos de necesidades de las personas.
Necesidades primarias: son aquellas cuya satisfacción permite la supervivencia (vida). Ejemplos:
alimentarse o comer, dormir, beber agua, respirar, abrigarse.
Necesidades secundarias: son aquellas cuya satisfacción aumenta el bienestar del individuo, y varía de una
sociedad a otra o de una época a otra. Ejemplos: tener bicicleta, comunicarse con un celular, ver la televisión,

EDITORA BILBIOTECA
escuchar música, adquirir un dulce.
Necesidades suntuarias o superfluas: son aquellas que están de más o sirven para motivar la vanidad, la
distinción económica. Por ejemplo, las joyas, los perfumes, etc.
 Pedimos a los estudiantes que busquen el concepto de ahorro y lo compartan con el aula.

MAGISTERIAL
Se entiende como ahorro a la parte del ingreso que no se destina al gasto y que se reserva para
necesidades futuras a través de algún sistema provisto por una institución autorizada por la ley para captar
dinero del público tal como una cuenta o tarjeta de ahorros un depósito a plazo o una cuenta de ahorro
previsional voluntario en caso de quienes trabajen.
 Se dibuja en la pizarra el siguiente cuadro e indica a los estudiantes que lo copien y completen
con la información de las listas elaboradas:
Consumo Tipo de necesidad Costo

 Concluido el proceso de llenar el cuadro, pedimos que calculen el costo de los consumos.
 Pedimos que observen su listado, reflexionen, y sobre esa base respondan las siguientes
preguntas en su cuaderno: ¿De qué manera nuestras decisiones de consumo nos afectan a
nosotros y a nuestra familia?, ¿Cómo?, ¿Por qué?
 Se señala además a los estudiantes que no consumir algunos productos significaría un ahorro.
Indicamos que calculen a grosso modo cuánto ahorrarían en un mes o al año sin adquirir
determinado producto.
 Organizamos en círculo al grupo clase, y se promueve la reflexión y el diálogo sobre la base de lo
trabajado individualmente y de las siguientes preguntas:
 ¿Antes de realizar compras pensamos acerca de lo que implica este consumo?
 ¿Priorizamos?, ¿Qué criterios tenemos en cuenta para priorizar nuestras compras?
 ¿De qué manera nuestras decisiones de consumo nos afectan a nosotros y a nuestra
familia?, ¿Cómo?, ¿Por qué?
 Se recoge lo reflexionado y dialogado en el grupo clase, y se finaliza este momento comentando
que nuestras decisiones de consumo nos pueden afectar a nosotros y a nuestra familia cuando
no priorizamos nuestros gastos, cuando consumimos por consumir, sin tener en cuenta que

____________________________________________________________________________________________________
V- DICIEMBRE 62
______________________________________________________________________________________________________
debemos priorizar nuestra salud, nuestros estudios y aquello que nos permita desarrollarnos
como personas.
 Presentamos una lista de acciones que les pueden ayudar a su familia a ahorrar dinero en esta
Navidad.
1. Elaborar su propia decoración: pueden dar un toque imaginativo y original si necesidad de hacer un
gran gasto. Usando flores secas, piñas, jugar con las posibilidades que ofrecen velas blancas, etc.
2. Pensar con tiempo los menús: elaborar menús baratos y aprovechar de posibles descuentos en días
anteriores a las fechas más señaladas. Muchos productos de alimentación se encarecen hasta un 40% con
la llegada de los días más señalados.
3. Anticipar los regalos: aprovecha de precios promocionales.
4. Reservar cuanto antes si van a comer o cenar fuera: no dejar para el último momento para evitar
sustos e improvisaciones.
5. Elaborar un presupuesto: Marca un límite máximo e intentar organizarse en función a él. Si necesitan
financiación, compra, calcula y no olvides la letra pequeña.
6. Guardar los tickets y comprobar cuál es plazo de devolución de los regalos: De esta manera se
podrá reclamar los derechos que tienes como consumidor. Muchas empresas aumentan los plazos de las
devoluciones en estas fechas.
Toma de decisiones

EDITORA BILBIOTECA
 Luego de compartir las acciones para ahorrar dinero, animamos a los estudiantes a reconocer la
necesidad de cambiar algunos patrones de consumo que ayudarían a mejorar la economía
familiar.
 Asume compromiso para ahorrar y gastar lo necesario.

MAGISTERIAL
 Para reforzar lo trabajado en la sesión los estudiantes resuelven una ficha de aplicación.
FICHA DE APLICACIÓN
1. Dibuja un ejemplo de cada tipo de necesidad.

PRIMARIAS SECUNDARIAS SUNTUARIAS


2. Participan en la actividad de Plan de ahorro.
¿Fabricamos un plan de ahorro?
En la columna apunta las cosas que te gustaría hacer. Averigua cuánto cuesta y apuntalo en
otra columna al lado (recuerda que una misma cosa puede tener un costo diferente según la
tienda, época del año,…). En la columna siguiente pondrás el dinero que vas a ahorrando
cada mes (que es el resultado de los que obtienes menos lo que gastas). Así podrás saber
cuándo tendrás suficiente dinero para comprar lo que quieres.

COSAS QUE ME GUSTARIA PRECIO DINERO


____________________________________________________________________________________________________
V- DICIEMBRE 63
______________________________________________________________________________________________________
TENER: AHORRADO

CIERRE
 Orienta la metacognición y preguntamos a los estudiantes lo siguiente: ¿Qué han aprendido

EDITORA BILBIOTECA
hoy?; a partir de hoy, ¿Qué tendrás en cuenta antes de consumir algún producto?; ¿Lo aprendido
hoy será importante en nuestra vida personal y familiar?, ¿Por qué?
 Escuchamos sus respuestas, y felicitamos sus aportes y logros.
 Como actividad de extensión: se solicita a los estudiantes que revisen el recibo de luz de su

MAGISTERIAL
domicilio y escriban una reflexión corta acerca del costo del consumo de energía en su casa
durante estas fechas.
 Se evalúa por medio de una escala de valoración.
ESCALA DE VALORACION

En
DESEMPEÑO Sí No Observaciones
proceso
Gestiona responsablemente los recursos económicos.
Argumenta la importancia del ahorro y de la inversión de
recursos, así como de la cultura de pago de las deudas
contraídas.
Elabora un plan de ahorro y explica cómo el uso del dinero
afecta positiva o negativamente a las personas y a las
familias.
PRUEBA ESCRITA
1. ¿Qué es ahorrar?
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
2. Marca la alternativa correcta:
Son aquellas cuya satisfacción aumenta el bienestar del individuo, y varía de una sociedad a
otra o de una época a otra.
a. Necesidades primarias b. Necesidades secundarias c. Necesidades suntuarias
Son aquellas que están de más o sirven para motivar la vanidad, la distinción económica.
a. Necesidades primarias b. Necesidades secundarias c. Necesidades suntuarias
Son aquellas cuya satisfacción permite la supervivencia (vida).
a. Necesidades primarias b. Necesidades secundarias c. Necesidades suntuarias.

____________________________________________________________________________________________________
V- DICIEMBRE 64
______________________________________________________________________________________________________
3. Menciona tres acciones que puede realizar tu familia para ahorrar dinero.
a. ____________________________________________________________________
b. ____________________________________________________________________
c. ____________________________________________________________________

REFLEXIONES SOBRE EL APRENDIZAJE


 ¿Lograron los estudiantes reconocer los gastos innecesarios y las acciones de ahorro familiar?
 ¿Qué dificultades se observaron durante el análisis de gastos?
 ¿Qué aprendizajes se deben reforzar?

ÁREA: MATEMÁTICA
¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Tener listo el papelógrafo con el problema. Fotocopia - Plumones y colores. Papelotes. Libro Matemática 5°.
las fichas de aplicación y la prueba escrita. Cuaderno de trabajo
INICIO:
 Se les entrega una ficha con serie numérica y se pide encontrar la palabra escondida.

EDITORA BILBIOTECA
Encuentra el único insecto que no se ha comido el camaleón. Para ello completa
cada serie numérica y el último número d la serie le indicara una letra en las
claves.
Escribe esa letra dentro del cuerpo de los dibujos de los insectos que se ha comido

MAGISTERIAL
y cuando las tengas todas descubrirás el que se le ha escapado.

 Preguntamos: ¿Qué operaciones matemáticas tuviste que utilizar para resolver la ficha?
 Recoge los saberes previos mediante esta pregunta: ¿Qué es una serie numéricas?, ¿Qué tipo
de series existen?, ¿Qué es una serie alfanumérica?, ¿Cómo se resuelven las series
alfanuméricas? ¿Qué habilidades matemáticas se desarrollan con las series alfanuméricas?
____________________________________________________________________________________________________
V- DICIEMBRE 65
______________________________________________________________________________________________________
 Se comunica el propósito de la sesión:

HOY VAN A RESOLVER SERIES ALFANUMÉRICAS.


 Se acuerda las normas de convivencia:
- Trabajar con el material concreto de manera ordenada.
- Comunicar y compartir la información importante.
DESARROLLO
Problematización
 Se presenta el papelote con una serie alfanumérica y se solicita que completen los espacios en
blanco:
A 3 H 10
1 D G M
Comprensión del problema
 Para ello, se realiza las siguientes preguntas: ¿Cuál es el patrón de resolución?, ¿Lograron
identificar los números faltantes? ¿Cómo podemos descubrir las letras faltantes? ¿Qué
operaciones matemáticas utilizaste? ¿Les fue difícil encontrar la serie alfanumérica?

EDITORA BILBIOTECA
Búsqueda de estrategias
 Propicia situaciones a través de estas preguntas: ¿Alguna vez utilizaron una situación como
esta?, ¿Qué acciones o procedimientos podríamos realizar?, ¿Alguna estrategia de cálculo
aprendida en las clases anteriores nos será útil?

MAGISTERIAL
 Entregamos a los estudiantes materiales necesarios para la resolución de la situación
problemática.
Representación
 Los estudiantes aplican la estrategia acordada en grupo y explican el proceso de resolución al
pleno.
 La posible solución es la siguiente:
Solución:
A BC H IJKL NÑOPQ R
EFG
D M

+2 +3 +5
3 10
+4
1 G 15
Rpta:
R
15
 Formalizar el aprendizaje matemático, con la participación de los estudiantes, a través de esta
pregunta: ¿Qué operación realizamos para hallar las respuestas?, ¿Con qué clase de números
operamos?, ¿Cómo lo hicimos?

¿QUÉ ES UNA SERIE ALFANUMÉRICA?


Una serie alfanumérica es una secuencia de números y letras ordenados, llamados términos, entre
los cuales hay una relación que hay que descubrir, para completar la serie.
Ejemplo
Que terminos continuan: 3; A; 5; E; 8; I; …
____________________________________________________________________________________________________
V- DICIEMBRE 66
______________________________________________________________________________________________________
Resolucion:
Consideramos que esta formada por dos secuencias alternadas:
BCD FGH JKL

3;A;5;E;8;I;…;…

+2 +3 +4

De donde se deduce que lo que sigue es:


8 + 4 = 12 y la metra M
Entonces, los dos siguientes términos será: 12 y M
 Reflexiona con los estudiantes respecto a los procesos y estrategias que siguieron para resolver
series numéricas. Formula las siguientes preguntas: ¿Qué estrategias aprendimos para identificar
completar la serie alfanumérica?
 Presentan nuevos ejercicios y resuelven una ficha de aplicación.
FICHA DE APLICACIÓN
1. Acompaña al caballito de mar por el camino siguiendo los números de 7en 7 ordenadamente.

EDITORA BILBIOTECA
MAGISTERIAL
2. Encontrar el número que sigue en cada una de las siguientes series.
a) 7; 10; 15; 22; … g) 64; 32; 16; …
b) 3; 9; 5; 15; 11; … h) 2; 4; 8; 14; …
c) 2; 2; 4; 12; … i) 2; 3; 4; 7; 8; 11; …
d) 5; 3; 6; 4; 8; 6; 16; … j) 18; 16; 12; 6; …
e) 1; 1; 2; 6; … k) 10; 12; 6; 8; 4; …
f) 2; 3; 4; 5; 8; 7; 16; … l) 3; 4; 8; 5; 9; 45; …

3. Encontrar la letra que sigue en cada una de las siguientes series.


a) A; D; G; J; … d) B; C; F; G; N; …
b) B; D; G; I; L; … e) A; B; D; D; G; F; J; …
c) A; D; I; O; … f) B; C; E; H; L; …

4. ¿Qué letra o número continúa la serie?


1- A , 10 , B , 9 , C , ... ,
a) 7 b) B c)8 d) D

2- F , G , 7 , H , I , 9 , ... ,
a) 11 b) J c) 10 d) K
____________________________________________________________________________________________________
V- DICIEMBRE 67
______________________________________________________________________________________________________

3- 12 , 13 , A , 14 , 15 , Z , ... ,
a) 16 b) B c) 15 d)Y

4- 3 , 3 , 3 , 3 , A , 4 , 4 , 4 , E , 5 , 5 , ... ,
a) 6 b) 5 c)M d) I

5- A , B , 10 , A , C , 5 , A , ... ,
a) D b) 0 c) 1 d)Z

6- 7 , A , 49 , Z , 5 , B , ... ,
a) Y b) 25 c) 3 d) C

5. ¿Qué dos elementos (números o letras) continúan la serie?


7- H , J , 5 , 7 , K , ... , ... ,
a) 12 y L b) L y 12 c) M y 9 d) 9 y M

EDITORA BILBIOTECA
8- 12 , A , 14 , C , 17 , F , ... , ... ,
a) 20 y I b) 21 y K c) 21 y L d ) 19 y J

MAGISTERIAL
9- 15 , 5 , 75 , A , B , 20 , 5 , ... , ... ,
a) 100 y C b) 8 y C c) 9 y J d) C y 100

6. Completa la secuencia:

7. Completa la secuencia:
A 5 E 25 I 125 M 625 ? ?

8. Completa

9. Competa la secuencia

 Se solicita que un representante de cada equipo comunique sus resultados.


CIERRE
____________________________________________________________________________________________________
V- DICIEMBRE 68
______________________________________________________________________________________________________
 Realiza las siguientes preguntas sobre las actividades desarrolladas durante la sesión: ¿Qué
aprendieron hoy?, ¿Fue sencillo?, ¿Qué dificultades tuvieron?, ¿Pudieron superarlas de forma
individual o de forma grupal?; ¿Qué debemos tener en cuenta para resolver series
alfanuméricas?, ¿Qué estrategias de cálculo podemos utilizar? ¿Por qué?
 Finalmente, resalta el trabajo realizado por los equipos y felicítalos por su escucha activa.
 Como actividad de extensión resuelven los siguientes ejercicios:
ACTIVIDADES
1. Hallar el número que sigue en cada una de las siguientes sucesiones.
1) 2; 5; 10; 13; 18; …
2) 2; 3; 6; 13; 18; 23; …
3) 26; 18; 11; 5; …
4) 4; 8; 5; 10; 7; 14; …
5) 5; 6; 12; 9; 10; 20; …
2. Hallarla letra que sigue en cada uno de los siguientes arreglos literales.
1) A; C; B; D; C; E; …
2) W; L; F; …
3) C; D; G; L; …

EDITORA BILBIOTECA
4) A; A; B; D; G; K; …
5) A; B; D; H; …

3. ¿Qué letra o número ocuparía el primer lugar en esta serie?

MAGISTERIAL
1- , ... , 15 , Z , Z , 14 , 14 , Y ,
a) 15 b) Y c ) 13 d) W

2- , ... , 2 , 3 , Z , Y , X ,
a) 4 b)1 c)2 d)5

3- , ... , 5 , Z , 7 , 4 , Y , 8 ,
a) 3 b) X c) 6 d) 2

4. ¿Qué letra o número no debería estar en esta serie?


4- , 2 , 22 , A , 3 , 33 , B , 4 , 5 ,
a) B b)4 c)5 d) 22

5- , 0 , 1 , 2 , A , A , A , 3 , 4 , 5 , 6 ,
a) 0 b) 3 c)4 d) 6

6- , 8 , 6 , R , S , T , 4 , 2 , 3 , U , V , X ,
a) X b) T c)V d) 3

 Resuelven una ficha de evaluación:


PRUEBA ESCRITA
1. Instrucción: Encuentra el número que continúa en cada serie:
1. 7a, 10d, 13g, 16j, … , … 5. B2, E5, H8, K11; ………….
2. A; 3; E; 6; I; 10; M; 15, … … 6. A5; F10; L16; R23: …. ; ….

____________________________________________________________________________________________________
V- DICIEMBRE 69
______________________________________________________________________________________________________
3. 3; A; 6; B; 12; C; 24; D; ?; ? 7. 1; C; 2; E; 4; I; 7; Ñ
4. 96; P; 48; M; 24; I; 12; E; … ; … 8. Z7; W14; T16; Q32; …; ….

2. Completa la secuencia y resuelve:


Hallar el valor de R – S
4 20 36 52 R
68 57 46 35 S
3. Hallar el valor de (M X N)
2
4802 686 68 14 M
768 192 48 12 N
4. Completa la secuencia.
2 4 6 8 10
B D E H ?
5. Completa la secuencia:

EDITORA BILBIOTECA
2 3 5 G
B C E 7
5.

MAGISTERIAL

REFLEXIONES SOBRE EL APRENDIZAJE


 ¿Lograron los estudiantes resolver los problemas con unidades de volumen y capacidad?
 ¿Qué dificultades se observaron durante la resolución de los ejercicios?
 ¿Se cumplió el propósito de la sesión?

____________________________________________________________________________________________________
V- DICIEMBRE 70
______________________________________________________________________________________________________
SEMANA Nº 1
“ESPERAMOS CON ENTUSIASMO Y RESPONSABILIDAD LA LLEGADA DE
JESÚS”
Día Nro. 5
“ILUMINEMOS NUESTRA NAVIDAD”
• PROPÓSITOS DE APRENDIZAJE
Evidencias de
Competencia / Campo
Área Desempeños aprendizaje /
Capacidad temático
Inst. de valoración
CyT 2. Explica el mundo físico Propagación - Justifica que el quehacer - Participa en
basándose en de la luz tecnológico progresa con el experimentos sobre
conocimientos sobre los paso del tiempo como la propagación de la
seres vivos, materia y resultado del avance científico luz y justifica los
energía, biodiversidad, para resolver problemas. usos que se dan a
Tierra y universo. la luz.
2.2. Evalúa las - Prueba escrita.

EDITORA BILBIOTECA
implicancias del saber y
del quehacer científico y
tecnológico.
EF 1. Se desenvuelve de Juegos - Explora y regula su cuerpo - Participa en juegos
manera autónoma a tradicionales para dar respuesta a las tradicionales de su

MAGISTERIAL
través de su motricidad.
1.1. Comprende su
cuerpo.
situaciones motrices en
contextos lúdicos y
predeportivos; así, pone en
práctica las habilidades
localidad poniendo
en práctica sus
habilidades
motrices.
motrices relacionadas con la - Lista de cotejos.
carrera, el salto y los
lanzamientos.
2. Asume una vida - Realiza actividades de
saludable. activación corporal, psicológica
2.2. Incorpora prácticas y de recuperación antes,
que mejoran su calidad durante y después de la
de vida. práctica de actividad física; de
esta manera, aplica los
beneficios relacionados con la
salud y planifica dietas
saludables adaptadas a su
edad y sus recursos.

ÁREA: CIENCIA Y TECNOLOGÍA


¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Preparar los materiales para los experimentos, - Papelotes, plumones, lápiz, colores y cinta adhesiva.
prepara algunas imágenes. Fotocopia los anexos en Un frasco de tamaño regular, de forma cilíndrica, agua
cantidad suficiente para distribuir entre tus mineral, papel negro y varias lombrices o cochinillas
estudiantes. Leer previamente el texto Ciencia y .Texto Ciencia y Ambiente 5.
Ambiente 5.
INICIO:
 Saludamos a los estudiantes. Luego presentamos imágenes de decoraciones navideñas con
luces.
____________________________________________________________________________________________________
V- DICIEMBRE 71
______________________________________________________________________________________________________

 Preguntamos: ¿Por qué todas las navidades se utilizan luces? ¿Las luces de colores es la única
forma de adornar? ¿Qué fuentes de luz conocen? Anotamos las intervenciones de los
estudiantes en la pizarra.
 Recogemos saberes previos de los estudiantes, preguntando: ¿Qué es la luz?, ¿Qué tipos de luz
conocen?, ¿Cómo se propaga la luz? ¿Qué experiencias podemos realizar con la luz?
Escuchamos atentamente sus respuestas.
 Se comunica el propósito de la sesión:

HOY VAN A IDENTIFICAR LAS CARACTERISTICAS DE LA LUZ Y SU


PROPAGACIÓN.

EDITORA BILBIOTECA
 Se acuerda las normas de convivencia:
- Cuidar el material propio y común.
- Mostrar amabilidad con todos.
DESARROLLO
MAGISTERIAL
Planteamiento del problema:
 Organizamos a los estudiantes en parejas de trabajo leen el siguiente texto.
LUZ SOLAR
Sin su luz y su calor, no existiría ninguna forma de vida en nuestro planeta.
EL SOL, FUENTE DE CALOR. Sin el calor que le proporciona el Sol, nuestro planeta sería un planeta muerto.
Los hielos invadirían toda la Tierra y desaparecerían por completo todas las manifestaciones de vida. ¿Has
observado que, donde más calor hace, más ricas son la flora y la fauna? Esto se debe a que la naturaleza
alcanza su clímax o desarrollo máximo pues la energía radiante del Sol calienta la tierra y el agua produciendo,
por lo tanto, la evaporación de ríos, mares y arroyos; y determina el ciclo del agua que volverá a la tierra en
forma de lluvia, nieve o granizo. Las distintas temperaturas que produce, originan diferencias de presión que
dan nacimiento a los vientos.
EL SOL, FUENTE DE LUZ. El Sol se encuentra a unos 150 millones de km de la Tierra y, como todas las
estrellas, emite luz. Si sabemos que la luz se propaga a una velocidad de 300 000 km/s ¿Cuánto tiempo tarda
un rayo de luz para llegar a la Tierra?
LA LUZ Y LA VIDA. La importancia de la luz solar para las diferentes formas de vida de nuestro planeta es
fundamental. Gracias a la energía lumínica, las plantas verdes (con clorofila) pueden realizar el proceso de
fotosíntesis, que les permite transformar minerales en sustancias orgánicas; estas plantas (productoras) son el
primer eslabón de las cadenas alimentarias. Además, los rayos ultravioletas que integran la luz del Sol, permiten
la producción de vitamina D en nuestro organismo a partir de pro-vitaminas (elementos de que se componen las
vitaminas).
 Iniciamos el dialogo comentando que así como a todos los seres humanos, les gustan la luz y los
colores, pero... ¿Les gusta la luz a todos los seres vivos? Mencionan animales que vivan a la luz,
por ejemplo: jirafa, avestruz, perro. ¿Conocen alguno que prefiera la oscuridad? Quizás el
murciélago, la lombriz de tierra, el topo. Y las plantas ¿Prefieren la luz o la oscuridad? ¿Cómo
influye la luz en el desarrollo de los seres vivos?
Planteamiento de la hipótesis.
____________________________________________________________________________________________________
V- DICIEMBRE 72
______________________________________________________________________________________________________
 Discuten y escriben una posible respuesta o hipótesis al problema de indagación.
 Comparten sus hipótesis y se anotan en la pizarra.
Elaboración del plan de indagación
 Leen la hipótesis planteada. Luego, se pregunta: ¿Qué hacer para confirmarla?
 Organizan la información y anotan tres actividades en el siguiente cuadro. Anexo 2
ANEXO 2
¿Cuál es el ¿Cuáles son las ¿Qué actividades ¿Qué fuentes de ¿En qué fechas lo
problema a hipótesis o tareas información realizarán?
indagar? planteadas? realizadas? usarán?
1. Como influye la 1. La luz permite que 1. Buscar 1. Libro de CyT 5° 1.
luz en el desarrollo los seres vivos información. 2. Libros de la
de los seres vivos. puedan crecer, tener 2. Analizar la biblioteca.
comida, etc. información. 3. Paginas web.
 Se indica que anoten sus respuestas a las preguntas planteadas para el problema y así poder
confirmar la hipótesis planteada.
Recojo de datos
 Organizados en equipos de trabajo los estudiantes realizan los siguientes experimentos.

EDITORA BILBIOTECA
Experimento 1
Objetivo: Comprobar si las lombrices, bichos bolita o cochinillas, prefieren la luz o la oscuridad.
Materiales: Un frasco de tamaño regular, de forma cilíndrica, agua mineral, papel negro y varias lombrices o
cochinillas.

MAGISTERIAL
Procedimiento:
Vierte un poco de agua en la botella, colócala de forma horizontal e introduce los animalitos que hayas conseguido;
forra la mitad de la botella con papel negro y una tela con perforaciones pequeñas en la boca del frasco, ponla cerca
de una ventana en la misma posición durante media hora.
Observaciones: ¿Hacia dónde se colocan los animalitos, a la luz o a la sombra?
LOS ANIMALES Y LA LUZ. De acuerdo con el experimento 1, a modo de conclusión podemos decir que hay
animales inferiores que huyen de la luz. A esta reacción la llamamos fototaxismo y, en este caso particular en la que
estos animales huyen de ella, es negativo. En el caso de la lombriz, está adaptada para vivir en la oscuridad, ya que
su cuerpo se resecaría a la luz y moriría. Otro caso es el de las cucarachas, que se alejan de la luz pues de este
modo, no son vistas por otros animales y no corren el riesgo de ser atrapadas por ellos.
Sin embargo otros animales buscan la luz: Ciertos insectos voladores presentan fototaxismo positivo. Nosotros, los
seres humanos, también necesitamos de la luz que ilumina a los objetos, los que por medio de los ojos, pueden ser
vistos.
Otros animales están adaptados para vivir en la oscuridad, algunos gracias a sus grandes ojos, como la lechuza; o
por medio de ojos muy sensibles, como los del gato. Otros, como el topo, son casi ciegos.
Experimento 2
Objetivo: comprobar si las plantas prefieren la luz o la oscuridad.
Materiales: Una maceta con una plantita tierna y una caja de cartón colocada en forma vertical.
Procedimiento:
Corta una ventana en un costado de la caja. Pon la maceta dentro y ciérrala bien, déjala varios días con la ventana
mirando hacia la luz, en la habitación más soleada de tu casa.
Observaciones: Toma nota ¿Qué ocurrió con las hojas de la planta?
-Exponen los sus resultados y en macro-grupo escriben las conclusiones a las que han llegado.
Conclusiones: ¿A las plantas, les gusta o no la luz? ¿Cuál es tu respuesta?
LOS VEGETALES Y LA LUZ. Una vez realizado el experimento 2 podemos establecer que:
Las plantas tienen sus hojas de color verde debido a una sustancia llamada clorofila, que sólo producen en
presencia de la luz y les sirve para elaborar sus propios alimentos (fotosíntesis). De esto se desprende que la
energía lumínica del Sol, es imprescindible para los vegetales.
Si se les priva de la luz, las hojas pierden el color verde, se amarillentan, debilitándose y muriendo.

____________________________________________________________________________________________________
V- DICIEMBRE 73
______________________________________________________________________________________________________
La luz, entonces, es vital para las plantas. Por eso es que orientan sus tallos y hojas hacia la luz. Esta reacción se
denomina fototropismo positivo.
 Comentan como salió el experimento y registran los resultados en el cuaderno de trabajo.
 Leen información sobre la luz.
LA LUZ
La reflexión de la luz
Cuando la luz llega a la superficie de un cuerpo, se refleja y cambia de dirección y sentido. A este fenómeno, se le
llama reflexión de la luz
• Los cuerpos lisos y claros, como los espejos, reflejan la mayor cantidad de luz. Debido a la superficie pulida, los
rayos de luz se reflejan ordenadamente y se forma la imagen de los objetos.
• Los cuerpos opacos no dejan pasar toda la luz y reflejan solo una porción.
• Los cuerpos rugosos y oscuros reflejan una mínima cantidad de luz.
Los espejos
Los espejos son superficies bien pulidas que forman imágenes a través de la reflexión de la luz. Al cuerpo ubicado
frente al espejo se le llama objeto, y lo que se proyecta en él es la Imagen. Los espejos pueden ser:
Espejos planos. Tienen superficie plana y forman Espejos esféricos. Tienen superficie curva, de modo
imágenes virtuales derechas y del mismo tamaño del que las imágenes no son del mismo tamaño que el
objeto real reflejado. objeto. Pueden ser:
Cóncavos Convexos

EDITORA BILBIOTECA
Pueden formar una Forman una imagen
imagen derecha o derecha y achatada,
invertida y alargada.

MAGISTERIAL
La refracción de la luz
Cuando la luz pasa de un medio a otro, se produce un cambio de velocidad y dirección en sus rayos. A esto se le
llama refracción de la luz.
La refracción hace que los objetos se vean de un tamaño diferente al real. Por ejemplo, las letras se ven más
grandes a través de una lupa. También se pueden ver los objetos de-formados, más lejos o más cerca, por ejemplo,
los objetos sumergidos en agua se ven más cerca o como si estuvieran quebrados porque la luz se refracta o
cambia de dirección al ingresar al agua.
Las lentes
Las lentes son objetos transparentes (vidrio o agua) en los que al menos una de sus superficies es curva. Cuando
un rayo de luz toca una lente, se refracta una vez al entrar y otra vez al salir de ella.
Las lentes pueden ser convergentes o divergentes.
Lentes convergentes Lentes divergentes
Pueden formar imágenes más grandes y por eso se Forman imágenes más pequeñas y se usan, por
usan en las lupas, microscopios y cámaras ejemplo, para corregir deficiencias de la visión,
fotográficas. como la miopía.

 Sistematizan la información en un organizador visual.


En todas las direcciones
Propagación En línea recta

La energía Se puede A 200 000 km/s Energía térmica


____________________________________________________________________________________________________
luminosa transformar en:V- DICIEMBRE 74
Energía eléctrica
______________________________________________________________________________________________________

Transparente
Material
iluminado Opaco

Translúcido

La reflexión de la luz produce El color de los objetos


Propiedades de
la luz La refracción de la luz provoca La distorsión de las
imágenes
La dispersión forma El arco iris

EDITORA BILBIOTECA
Análisis de resultados y comparación de hipótesis
 Responden: ¿Cuáles fueron las respuestas planteadas (hipótesis) al inicio?

MAGISTERIAL
 Comparten sus respuestas iniciales (hipótesis) con las respuestas planteadas después de
realizar las actividades. Luego, completen el cuadro:
Respuestas iniciales (hipótesis) Respuestas después de realizadas las
actividades

 Responden: Si sus respuestas no fueron las correctas, ¿Qué podrían hacer para corregirlas?
Evaluación y comunicación
 Escriben dos conclusiones a las que llegaron después de realizar las actividades.
 Forman grupos de tres o cuatro estudiantes resuelven la siguiente ficha de trabajo.
I. Responde:
1. ¿Qué entiendes por cuerpos opacos?
_______________________________________________________________________________
_______________________________________________________________________________
_______________________________________________________________________________
2. Completa escribiendo una de las dos opciones;_____________________________
en todas las direcciones
a) La luz viaja....................................... en una sola dirección

en línea recta
b) La luz se mueve………………………. en líneas curvas

refleja una parte de la luz


c) Un espejo…………………………. refleja toda la luz

no refleja la luz
____________________________________________________________________________________________________
V- DICIEMBRE 75
______________________________________________________________________________________________________
d) Una mesa de madera………………... refleja una parte de la luz
e) Cuando puedes ver fácilmente las cosas que hay detrás de un objeto, este objeto
es..........................
opaco
transparente
Soy transparente
f ) ¿Cómo eres tú?.......................... Soy opaco/a

 Responden: ¿Qué es los que sabía antes de la indagación? ¿Qué es lo que saben ahora?
¿Cómo darían a conocer a otras personas lo que sabes sobre el tema?
CIERRE
 Responden las siguientes preguntas sobre las actividades desarrolladas durante la sesión: :
¿Creen que es importante aprender sobre la luz? , ¿Por qué?, ¿Organizaron bien el tiempo para
realizar las actividades? ¿Qué recursos y estrategias han empleado?
 Como actividades de extensión: Explican cómo se produce un arcoíris.
 Se evalúa a través de una prueba escrita.

EDITORA BILBIOTECA
PRUEBA ESCRITA
1. Completa el organizador con las palabras del recuadro.
Refracción transparentes traslúcidos
opacos fuentes luminosas absorción reflexión

MAGISTERIAL LA LUZ

Es una forma de energía


emitida por

Ante ella los Cuando llega a


cuerpos son los cuerpos se
produce

REFLEXIONES SOBRE EL APRENDIZAJE


 ¿Lograron los estudiantes identificar las características de la luz?
 ¿Qué dificultades se observaron durante la sesión?
 ¿Qué aprendizajes se deben reforzar?
 ¿Las estrategias, materiales y recursos resultaron de adecuados para la sesión?
ÁREA: EDUCACIÓN FÍSICA
¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar

____________________________________________________________________________________________________
V- DICIEMBRE 76
______________________________________________________________________________________________________
- Preparar el material de educación física. Lista de - Espacio amplio, cronómetro, útiles de aseo,
cotejos. colchonetas.
INICIO:
 Participan en la actividad propuesta: “Carrera de sacos”, se forman dos grupos de 10, los grupos
se ubican a un lado del campo deportivo y se les entrega un saco. El juego consiste en meterse
dentro del saco e ir brincando de un lado del campo deportivo hacia el otro. Gana el equipo que
logra hacer el recorrido de todos sus integrantes en el menor tiempo posible.
 Dialogamos: ¿Les agrado la actividad realizada? ¿Qué otros juegos parecidos conocen? ¿Qué
juegos son propios del Perú?
 Se explica que existen juegos populares que son originarios de nuestro país y son conocidos
como juegos tradicionales del Perú.
 Rescatamos los saberes previos: ¿Qué significa tradicional? ¿Qué juegos tradicionales se
practican en su localidad? ¿Por qué la mayor parte de niños han dejado de lado este tipo de
juegos?
 Se comunica el propósito de la sesión:

HOY PARTICIPAN EN JUEGOS TRADICIONALES.


 Se acuerda las normas de convivencia:

EDITORA BILBIOTECA
- Cuidar el material propio y común.
- Mostrar amabilidad con todos.
DESARROLLO

MAGISTERIAL
 Se organizan en el campo deportivo de su institución.
 En el calentamiento los estudiantes irán a trote por todo el espacio y cuando se de la señal deben
saltar y chocar las manos en el aire con algún compañero, después se deberán chocar las manos
por debajo, por entre las piernas, y por último cuando suene de nuevo la señal los/as niños/as
deben chocar su cadera con algún compañero.
 Se explica sobre los juegos tradicionales.
Son los juegos infantiles clásicos o tradicionales, que se realizan sin ayuda de juguetes tecnológicamente
complejos, sino con el propio cuerpo o con recursos fácilmente disponibles en la naturaleza (arena, piedrecitas,
ciertos huesos como las tabas, hojas, flores, ramas, etc.) o entre objetos caseros (cuerdas, papeles, tablas,
telas, hilos, botones, dedales, instrumentos reciclados procedentes de la cocina o de algún taller, especialmente
de la costura).
 Se propone participar juegos tradicionales de su región.
 Proponemos alguno de los juegos populares del Perú y que pueden ser conocidos con otros
nombres.
1. LA RAYUELA: En un lugar se dibuja la rayuela. Los jugadores se organizan en turnos. El
primero tira la piedra en el primer cuadro salta a “la pata coja” todos los demás cuadros sin
pisar en el que está la piedra. En los cuadros 4 y 5 se apoyan los dos pies, al igual que los
cuadros 7 y 8, donde se gira dando un salto para retroceder hasta el cuadro número uno,
donde se recoge la piedra antes de salir. Luego se tira la piedra en el cuadro número 2, se
hace lo mismo que en el cuadro 1 y así sucesivamente. Gana el que acaba todo la rayuela.
Normas:
Si al lanzar la piedra, toca una raya, se volverá a lanzar con los ojos cerrados.
Si un jugador pisa una raya pierde e turno.
Si un jugador al lanzar no mete la piedra al cuadro respectivo, perderá su turno a no ser que caiga en la raya.
2. EL JUEGO DE LAS LIGAS: La persona que juega tiene que saltar entre las
dos líneas formadas por una cuerda a medida que el juego avanza, los de los
extremos irán subiendo la cuerda de los tobillos, a las rodillas, cintura, etc. Cuando

____________________________________________________________________________________________________
V- DICIEMBRE 77
______________________________________________________________________________________________________
está por la cintura ya no saltan sino levantarán la pierna como quien marcha en un desfile para pasar por las líneas
y cuando llega a los brazos saltan con las manos arriba y se gana el juego.
3. LA CARRERA DE SACOS. Es un juego muy popular entre los niños
de todo el mundo. Para su desarrollo tan solo son necesarios unos cuantos
sacos de tela (los de papel no sirven) y terreno suficiente para saltar.
Para ejecutar la carrera los niños se introducen dentro de los sacos y éstos
se atan al pecho o bien se agarran con las manos. Los niños deben
desplazarse saltando sin salirse de los sacos ni caerse. Gana el que
primero llega a la meta.
Modalidades de carreras de sacos:
De velocidad. Metidos los niños en los sacos, se trazan dos líneas paralelas a cierta distancia, por ejemplo, diez
metros. En una se colocan los corredores y la otra sirve de meta. Vence el que antes llegue a la línea de meta
cualquiera que sea el número de caídas sufridas.
De firmeza. Similar al anterior, pero el ganador es el que salve la distancia entre las dos rayas con el menor número
de caídas.
De resistencia. El vencedor será el que llegue más lejos de la línea de partida de entre los que queden en pie. A
medida que se vayan tropezando y cayendo los corredores quedarán eliminados de la prueba. El vencedor será el
último jugador que quede en pie.
4. MATA GENTE: Se forma un grupo de 7 a 11 personas, dos personas una de

EDITORA BILBIOTECA
cada extremo; con un balón tratarán de que el balón les choque a los que están en
medio y ellos tendrán que esquivar el balón, el estudiante que quede al final sin
que el balón lo haya tocado será el ganador.
Reglas:
1) Este juego se jugará dentro de un lugar corto.

MAGISTERIAL
2) Como máximo debe haber 16 personas.
3) A quien lo toque el balón queda descalificado.
5. TIRA Y AFLOJA
La soga es marcada con una línea central y dos marcas a
cuatro metros de cada lado del centro de la línea. El equipo
comienza con la línea central directamente sobre a línea
marcada en la tierra, y una vez comienza el juego, los equipos
deben de jalar al otro equipo hasta que la marca más cercana
cruce la línea central, o cuando cometan una falta (cuando un
miembro del equipo cae o se sienta).
 Realizan ejercicios de relajamiento: Ejercicios de respiración (inspirar- espirar) y relajación.
CIERRE
 Practican higiene personal.
 Los estudiantes se hidratan después de la actividad realizada.
 Como actividad de extensión: Investigan otros juegos populares de su región que se presentarán
en la siguiente sesión.
 Se evalúa con una lista de cotejos.

____________________________________________________________________________________________________
V- DICIEMBRE 78
______________________________________________________________________________________________________
LISTA DE COTEJOS

Desempeños Sí No Observaciones
- Explora y regula su cuerpo para dar respuesta a las
situaciones motrices en contextos lúdicos y
predeportivos; así, pone en práctica las habilidades
motrices relacionadas con la carrera, el salto y los
lanzamientos.
- Realiza actividades de activación corporal,
psicológica y de recuperación antes, durante y
después de la práctica de actividad física; de esta
manera, aplica los beneficios relacionados con la
salud y planifica dietas saludables adaptadas a su
edad y sus recursos.

REFLEXIONES SOBRE EL APRENDIZAJE


 ¿Lograron los estudiantes participar de manera respetuosa los juegos tradicionales ?
 ¿Qué dificultades se observaron durante las actividades propuestas?

EDITORA BILBIOTECA
 ¿Están satisfechos con el trabajo realizado?

MAGISTERIAL

____________________________________________________________________________________________________
V- DICIEMBRE 79
______________________________________________________________________________________________________
SEMANA Nº 2
“FESTEJEMOS EL NACIMIENTO DE JESÚS”
Día Nro. 6
“CONOCEMOS COMO ES LA NAVIDAD EN EL PERÚ”
• PROPÓSITOS DE APRENDIZAJE
Evidencias de
Competencia / Campo
Área Desempeños aprendizaje /
Capacidad temático
Inst. de valoración
ER 2. Asume la experiencia Navidad en - Participa proactivamente en - Expresa las
del encuentro personal y el Perú acciones de cambio a imagen tradiciones
comunitario con Dios en de Jesucristo, para alcanzar religiosas que se
su proyecto de vida en una convivencia justa y practican y
coherencia con su fraterna con los demás. reflexiona que es
creencia religiosa. una forma de creer
2.2. Actúa en Dios al
coherentemente en razón compartirlo con sus

EDITORA BILBIOTECA
de su fe según los compañeros.
principios de su - Lista de cotejo.
conciencia moral en
situaciones concretas de
la vida.
C
MAGISTERIAL
1. Se comunica
oralmente en su lengua
materna.
1.1. Obtiene información
Narración
con
diálogos.
- Recupera información explícita
de textos orales que escucha
seleccionando datos
específicos. Integra esta
- Localiza información
explicita en textos
con diálogos y
distingue su
del texto oral. información cuando es dicha propósito.
en distintos momentos en - Lista de cotejos.
textos que incluyen
expresiones con sentido
figurado, y vocabulario que
incluye sinónimos y términos
propios de los campos del
saber.
1.2. Infiere e interpreta - Explica el tema y el propósito
información del texto oral. comunicativo del texto oral.
Distingue lo relevante de lo
complementario clasificando y
sintetizando la información.
Establece conclusiones sobre
lo comprendido; para ello,
vincula el texto con su
experiencia y el contexto
sociocultural en que se
desenvuelve.
PS 4. Gestiona Población: - Describe las relaciones que se - Elabora
responsablemente el migración. establecen entre los elementos organizadores
espacio el ambiente. naturales y sociales de un visuales sobre las
4.1. Comprende las determinado espacio migraciones en el
relaciones entre los geográfico de su localidad o Perú.
elementos naturales y región, o de un área natural
____________________________________________________________________________________________________
V- DICIEMBRE 80
______________________________________________________________________________________________________
Evidencias de
Competencia / Campo
Área Desempeños aprendizaje /
Capacidad temático
Inst. de valoración
sociales protegida, así como las - Escala de
características de la población valoración.
que lo habita y las actividades
económicas que esta realiza.

ÁREA: EDUCACIÓN RELIGIOSA


¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Prepara la canción en papelógrafo, Copia de la ficha - Cañón multimedia. Imágenes, biblia, cuadernos,
de aplicación, Copia de prueba escrita. papelógrafos, plumones, colores.
INICIO:
 Presentamos un villancico peruano: Cholito Jesús. https://www.youtube.com/watch?
v=pmb3mSxVjWA
Cholito Jesús Todos le gritarán:
(Los Toribianitos - Lima, Perú) (¡Cholito!)
¿De dónde llegaste tú?

EDITORA BILBIOTECA
Al niño Dios le llevamos (¡Cholito!)
un ponchito de color (bis) Todos le creerán
un chullito muy serrano, (¡Cholito!)
zapatitos de algodón (bis) que naciste en el Perú

MAGISTERIAL Todos le gritarán:


¡Cholito!
¿De dónde llegaste tú?
Los indiecitos pastores
trigo y quinua llevarán (bis)
José y la Virgen María
(¡Cholito!) buena chicha tomarán
Todos le creerán
(¡Cholito!) Todos le gritarán:
que naciste en el Perú (¡Cholito!)
¿De dónde llegaste tú?
A la Virgen le llevamos (¡Cholito!)
un mantón abrigador (bis) Todos le creerán
A San José una quena (¡Cholito!)
un charango y un tambor (bis) que naciste en el Perú.
 Responden: ¿De qué trata el villancico? ¿Qué país menciona en el villancico? ¿Cómo es la
Navidad en el Perú? Anotamos las respuestas de los estudiantes en la pizarra.
 Preguntamos para rescatar los saberes previos: ¿Qué tradiciones se realizan en Navidad?;
¿Consideran que estas tradiciones navideñas unen a la familia?; ¿Cómo se celebra la navidad en
la selva? Así se tengan distintas tradiciones ¿La Navidad tiene el mismo significado?
 Se comunica el propósito de la sesión:

HOY VAN A REFLEXIONAR SOBRE COMO SE CELEBRA NAVIDAD EN DISTINTOS


LUGARES DEL PERÚ.
 Se acuerda las normas de convivencia:
- Respetar a los compañeros.
- Levanta la mano para intervenir.
DESARROLLO
Ver
 Presentamos imágenes de Nacimientos de distintas regiones del Perú.
____________________________________________________________________________________________________
V- DICIEMBRE 81
______________________________________________________________________________________________________

 Responden oralmente las siguientes preguntas: ¿Creen que la Navidad se determina por el lugar
donde se celebra? ¿Consideran que hay tradiciones que se dan en todo el Perú? ¿Qué
tradiciones se realizan en tu localidad? ¿Si no se practican estas tradiciones no hay Navidad?
 Presentamos un papelógrafo información de cómo se celebra la Navidad en Perú.
¿Cómo se celebra la Navidad en Perú?
Como en la mayoría de países, en Perú se comienza con los preparativos de Navidad semanas antes. La
anticipación es necesaria ya que hay un gran trabajo por delante decorando las casas tanto por el interior como
por el exterior y, además, se deben ir escogiendo los regalos para toda la familia.
La Navidad al estilo peruano trae consigo numerosas celebraciones en plazas y parques donde amigos y
familia se reúnen para escuchar a los coros de niños y adultos entonando villancicos.
En cualquier ciudad de Perú, los centros comerciales se vuelven caóticos. Durante el mes de diciembre, los

EDITORA BILBIOTECA
peruanos recorren las calles para ver tiendas y sentir el espíritu navideño que se respira en cada rincón
decorado.
Nochebuena, el 24 de diciembre, es una celebración muy familiar y elegante. Por lo general, la mayoría de las
familias aprovechan esta ocasión para vestir sus mejores ropas y, por supuesto, para cantar al ritmo de
villancicos de gran tradición en Perú.

MAGISTERIAL
A medianoche es costumbre felicitar la navidad entre besos y abrazos. Normalmente, es tarea del más
pequeño de la familia colocar la figurita del niño Jesús en el pesebre. Por todas las ciudades, desde los más
pequeños a los más grandes, salen a las calles jugando con pequeños fuegos de artificio que resuenan con
una fuerte explosión por las calles de los diferentes barrios.
La misma noche del 24 de diciembre, después de las 12 de la noche, los niños que se portaron bien durante el
año abren los regalos de Papá Noel colocó bajo el árbol de Navidad. Por supuesto, asistir a la Misa del Gallo
esa noche es esencial para los peruanos. Pese a todo, los que no pueden asistir a ella trasladan su visita a la
iglesia para el día 25 de diciembre que es festivo en todo el país.
El día de Navidad los peruanos pasan el día visitando a sus familiares y descansando. La mayoría deciden
disfrutar de los regalos que recibió la noche anterior antes de volver a las obligaciones diarias.
 Los estudiantes comentan sobre lo leído.
Juzgar
 Planteamos la siguiente pregunta: ¿Qué tradiciones se practican en tu localidad? Anotamos las
respuestas de los estudiantes en la pizarra.
 Presentamos información sobre las Tradiciones Navideñas en el Perú.
1. La Navidad Negra del sur y sus bailes folclóricos
Al sur del Perú cerca al departamento de Ica, se encuentra
la provincia de Cañete.
Entre danzas y cantos sus habitantes se unen para dar la
bienvenida al niño Jesús. Los más pequeños inician un
zapateo como promesa a sus antepasados de conmemorar
este nacimiento. La alegría de los niños, los aplausos de
los adultos y los instrumentos musicales como la quijada de
burro y el cajón, hacen parte de esta gran festividad criolla-
afroperuana.
2. Santurantikuy y la Plaza de Armas en Cusco
Si una de las cosas que más disfrutas al visitar un nuevo lugar, es su arquitectura, entonces esta
hermosa ciudad Inca te va a encantar. Artesanos de las regiones se reúnen en la Plaza de Armas
____________________________________________________________________________________________________
V- DICIEMBRE 82
______________________________________________________________________________________________________
para exhibir sus creaciones llenas de color en el
Santurantikuy que significa “la venta de los santos”, el
mercado artesanal que se abre el 24 de diciembre.

El “niño Manuelito” es una de las artesanías


más representativas que se comercializan en
esta feria como representación del niño
Jesús. Allí se dice que son las campanas de la
catedral de Cusco las que anuncian su nacimiento y
no las de Belén de Oriente.
No dejes de visitar esta hermosa feria y antójate de
sus artesanías.
3. La tradicional Misa de Gallo

EDITORA BILBIOTECA
El 24 de diciembre en la noche, antes de la cena de
Navidad, las familias van a la iglesia para celebrar
esta misa que conmemora el nacimiento de Jesús,
narrado a través del evangelio de la Biblia y las

MAGISTERIAL
lecturas.
En esta ceremonia las personas llevan sus propias
imágenes del niño para ubicarlas en el pesebre o
nacimiento principal del templo. La Misa de Gallo se
celebra en diversas regiones del Perú al igual que en
otros países latinoamericanos pero en estos se le
conoce con diferentes nombres.
4. Navidad familiar en Lima
En la capital, esta festividad se celebra con luces,
enormes árboles navideños y una gran oferta en
comercio. Las familias se reúnen en la noche del 24
de diciembre y preparan una cena con pavo,
chocolate caliente con clavos y canela, panetón, puré de manzana y por supuesto el tradicional y
delicioso Pisco Sour. Nacimientos en piedra y retablos con imágenes religiosas son importantes
para los habitantes de la región andina Perú los cuales utilizan para adornar sus casas o también
para regalar a sus seres queridos.
5. Nacimientos en Puno
Pasada la media noche del 24 de diciembre, algunas
familias suelen leer las hojas de coca como presagio
de hechos que están por acontecer en el año nuevo.
De igual forma la “Feria de Niños” ofrece una cantidad
inimaginable de nacimientos decorados, hechos en
diferentes técnicas por artesanos de la región.
El canto de los villancicos, es apenas una de las
muestras de fusión cultural que tiene el Perú. Las
tradiciones españolas e incas convergen en esta gran
celebración decembrina que cada año evoca lo mejor
de la cultura andina. Su gastronomía, arquitectura,
historia y artesanías hacen parte de esta gran riqueza

____________________________________________________________________________________________________
V- DICIEMBRE 83
______________________________________________________________________________________________________
que no te puedes perder.
 Se les entrega una hoja a cada estudiante y se les solicita que dibujen la tradición que se practica
en su hogar.
 Luego de realizados los dibujos pedimos voluntarios para que compartan sus dibujos y expliquen
en que consiste la tradición que practican.
 Forman parejas y resuelven una ficha de aplicación sobre la Navidad.
FICHA DE APLICACIÓN
Relaciona ambas columnas sobre las tradiciones navideñas del Perú.
( ) El 24 de diciembre en la noche, antes de la cena
a. Navidad Negra del sur. de Navidad, las familias van a la iglesia.
b. La tradicional Misa de Gallo. ( ) Algunas familias suelen leer las hojas de coca
como presagio de hechos que están por acontecer.
c. Nacimiento en Puno.
( ) Entre danzas y cantos sus habitantes se unen para
d. Santurantikuy
darla bienvenida al niño Jesús.
( ) Significa “la venta de los santos”, el mercado
artesanal que se abre el 24 de diciembre.

EDITORA BILBIOTECA
Aquí está oculto el significado de la palabra “Navidad”. Para descubrirlo, escribe la letra
inicial de cada dibujo en el casillero correspondiente.

MAGISTERIAL

Respuesta
La palabra “Navidad viene del latín “Ntivitate”, que significa:
Nati = nacimiento
Vita = de la vida
Te = para ti
“nacimiento de la vida para ti”

____________________________________________________________________________________________________
V- DICIEMBRE 84
______________________________________________________________________________________________________
Dibuja la tradición que realiza tu familia en Navidad.

 Comparten sus respuestas.


Actuar
 Se organiza a los estudiantes en grupos pequeños y se les solicita que elaboren sus propios

EDITORA BILBIOTECA
nacimientos, se les entrega las fichas necesarias.

MAGISTERIAL

____________________________________________________________________________________________________
V- DICIEMBRE 85
______________________________________________________________________________________________________

 Presentan sus nacimientos y felicitamos la labor realizada.


 Concluimos la sesión con una oración.

Oración de navidad
Señor en esta navidad cambia todos los corazones
que están en tinieblas y déjalos ver tu luz, haz que
el amor, la paz, y la fe estén siempre en nuestros
corazones para luego poder colaborar contigo en la
salvación del mundo. Todo esto te lo pedimos en
nombre de tu hijo amado Jesús que vive y reina por

EDITORA BILBIOTECA
los siglos de los siglos. Amen.
CIERRE
 Responden las preguntas: ¿Les gustó la actividad? ¿Les resultó difícil responder las preguntas?
¿Acepto la importancia de reflexionar en navidad? ¿Cómo podemos aplicar lo aprendido en

MAGISTERIAL
nuestra vida?
 Como actividad de extensión los estudiantes realizan una lista de acciones que pueden realizar
con su familia en esta Navidad.
 Se evalúa a través de una lista de cotejos.
LISTA DE COTEJOS
Desempeños Sí No Observaciones
- Participa proactivamente en acciones de cambio a
imagen de Jesucristo, para alcanzar una
convivencia justa y fraterna con los demás.

REFLEXIONES SOBRE EL APRENDIZAJE


 ¿Lograron los estudiantes reconocer el verdadero significado de la Navidad?
 ¿Qué dificultades se observaron durante la práctica en clase?
 ¿Qué aprendizajes se deben reforzar?
 ¿Las estrategias, materiales y recursos resultaron adecuados para la sesión?
ÁREA: COMUNICACIÓN
¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Preparar el reproductor multimedia. Fotocopia el texto - Video. Cañón multimedia. Cinta adhesiva o limpiatipo.
“Un nacimiento especial”. Fotocopia de la Lectura. Papelógrafo. Hojas. Lista de cotejos.
comprensión de lectura.
INICIO:
 Se invita a los estudiantes que observen el cuento del Nacimiento de Jesús.
https://www.guiainfantil.com/navidad/Cuentos/nacimiento.htm

____________________________________________________________________________________________________
V- DICIEMBRE 86
______________________________________________________________________________________________________
 Se pregunta: ¿Comprendieron la historia? ¿Lograron identificar a todos los personajes? ¿Qué
mensaje nos da la historia? ¿Consideran que se podría reflexionar a partir de una narración con
diálogos? ¿De qué manera?
 Realizamos preguntas para rescatar los saberes previos: ¿Qué es una narración con diálogos?;
¿Qué temas se pueden trabajar con narraciones con diálogos? ¿se puede realizar comprensión
lectora de las narraciones con diálogos?
 Se comunica el propósito de la sesión:

LEE Y OPINA SOBRE EL CONTENIDO DE LAS NARRACIONES CON DIALOGOS.


 Se acuerda las normas de convivencia:
- Cuidar el material de estudios.
- Pedir permiso a los compañeros para usar sus materiales.
DESARROLLO
Antes de la narración con diálogos
 Presentamos en una tira de cartulina el título de la obra literaria “UN NACIMIENTO ESPECIAL” y
pedimos hacer sus comentarios, guiados de las siguientes preguntas: ¿qué tipo de texto será?,
¿de qué tratará el texto? ¿Qué nos dirá el autor? ¿Para qué creen que se ha escrito este texto?
 Indican las hipótesis que tengan relación en el contenido y el tipo de texto y se dejan escritas

EDITORA BILBIOTECA
en la pizarra, indicando que les permitirá contrastarlas durante la lectura que hagan de manera
individual.
Durante la narración con diálogos
 Se pide que cada uno haga una lectura silenciosa general del texto y compruebe si las hipótesis

MAGISTERIAL
que expresó se relacionan con lo que va leyendo en el texto.
UN NACIMIENTO ESPECIAL
Decorado
El escenario representa un nacimiento sin figuras. Puede haber un fondo de montañas pintadas,
y un portal realizado con cartones pintados. A los lados deben aparecer simuladas dos cajas de
donde saldrán las figuras y los juguetes.
Personajes
Lorena Paje Gaspar San José
Jimena Paje Baltasar Ángel
Mónica Pastora China
Melchor Rapero India
Gaspar Bacalao Marroquí
Baltasar Rockero
Paje Melchor Virgen
Representación
Primera Parte
LORENA: ¡Hola! ¿Cómo estás? Me llamo Lorena y, como ven soy una muñeca.
JIMENA: Y yo soy Jimena, y también soy una muñeca. Nuestra dueña se llama Mónica y tiene 8
Años. La queremos mucho. Somos sus muñecas preferidas... Bueno, no sólo nosotras, porque
como pronto verán, a Mónica le gustan mucho las muñecas.
LORENA: Pero se preguntarán qué hacemos aquí. Vamos a contarles una historia de Navidad.
Aunque un poco extraña, o mejor dicho, un poco fantástica, o un poco milagrosa. Verán.
JIMENA: Unos días antes de Navidad, Mónica quiso poner su nacimiento. Colocó las montañas,
las casitas, el río y el portal. Mónica fue sacando de la caja las figuritas del Portal y las fue
colocando.
De la caja van saliendo las figuras del Portal que Mónica va colocando.

____________________________________________________________________________________________________
V- DICIEMBRE 87
______________________________________________________________________________________________________
MÓNICA: Primero la Virgen y San José. Luego el Ángel y el niño... Después todas las demás
figuras.
LORENA: Pero, ¡qué fatalidad! Sólo quedaba una pastorcilla. Es que el Año pasado se le cayó la
caja y se le rompieron las demás figuras.
MONICA: ¿Y qué hago ahora?
JIMENA: Mónica no sabía qué hacer. De repente tuvo una idea muy extraña. Se dirigió a la caja
donde guardaba todas sus muñecas, y fue colocándolas en el nacimiento.
De la caja del lado opuesto, Mónica va sacando muñecos.
JIMENA: Primero, las muñecas que sus padres le habían traído de todas las partes del mundo.
LORENA: Una muñequita de la China.
JIMENA: Una pequeña muñeca india.
LORENA: una elegante muñeca egipcia.
JIMENA: Una preciosa muñequita marroquí...
LORENA: Pero también sacó de la caja tres marchosos personajes: un rockero, un fan de la
música bacalao y un rapero.
JIMENA: Mónica estaba contenta con aquel original nacimiento. Lo miró con cariño y como
estaba muy cansada se fue a la cama.

EDITORA BILBIOTECA
Segunda Parte
MELCHOR: ¡Qué oscuro está esto! Nos hemos perdido. ¿Dónde estará el portal?
Aparecen por el fondo del teatro y avanzan entre los espectadores.
PAJE MELCHOR: No sé, majestad. Quizás es mejor que vayamos a recoger los camellos y

MAGISTERIAL
volvamos a Oriente.
GASPAR: Ni hablar, Melchor. No hemos hecho un viaje tan largo para rendirnos ante las
dificultades.
PAJE GASPAR: ¡Majestad! ¡Allí! Iluminado por esa gran estrella. BALTASAR: ¡Si, si, ya la veo!
¡Vamos, vamos deprisa!
MELCHOR: Pero, ¿qué es esto?
PAJE MELCHOR: Majestad, nos hemos equivocado de siglo.
GASPAR: ¿Puede decirme alguien qué es todo esto?
LORENA: Es un nacimiento, Majestad. Pero con figuras de todos los tiempos. ¿O es que nuestra
majestad no sabe que Jesús ha nacido para todos?
PAJE GASPAR: ¡Me gusta esto! ¿Quiénes son ustedes?
JIMENA: Muñecas. Somos muñecas que formamos parte del nacimiento. ¿No les gusta la idea?
BALTASAR: Mmm... A mí me gusta. Es cierto que para Dios todos somos iguales.
LORENA: Pero suban, suban, majestades...Estarán muy cansados... Siéntense, siéntense aquí.
PAJE BALTASAR: Pero, ¿no hay ni una sola figura de verdad?
JIMENA: Si majestad, hay una. Es una pastora. ¡Pastora, pastora! Ven aquí que sus majestades
quieren verte.
PASTORA: Aquí estoy majestad.
LORENA: Majestades, ¿les gustaría oír villancicos? Es el canto típico de Navidad.
MELCHOR: Si, si... Pero, tú sola.
RAPERO: Déjenme a mí. Van a ver lo que es ritmo.
Se oye música rap y el rapero se pone a bailar.
PAJE MELCHOR: Pero esto no es un villancico de los de toda la vida.
JIMENA: Tiene razón. Pastora, ven a cantar.
GASPAR: ¡Ah! ¡No hay nada como los villancicos de toda la vida!
BACALAO: Pues ahora me toca a mí. Prepárense a oír villancicos modernos.
____________________________________________________________________________________________________
V- DICIEMBRE 88
______________________________________________________________________________________________________
Se oye música bacalao y baila al ritmo de la música.
LORENA: ¡Qué horror! Esto no es un villancico. Pastora, ahora te toca a ti.
ROCKERO: No, no. El rock es el mejor ritmo para un villancico. ¡A bailar!
Se oye un rock y baila a su ritmo.
Tercera Parte
VIRGEN: (sale del portal y se acerca a la parte exterior del escenario). ¿Qué escándalo es éste?
Me van a despertar al niño.
CHINA: tiene razón María ¡Nos han despertado a todos!, ¿verdad compañeras? Venga todas
para acá.
Se acercan las muñecas del mundo.
PAJE GASPAR: Perdonen. Estábamos discutiendo sobre música.
SAN JOSÉ: Pero, ¿qué pasa aquí? ¿Quiénes son todos ustedes?
INDIA: Somos personas de todo el mundo que hemos venido a ver al niño Jesús.
ANGEL: Pero... aquí ocurren cosas muy extrañas.
EGIPCIA: No, Ángel, no es extraño: es más natural. Aquí estamos todas las razas y todos los
siglos y todas las edades.
VIRGEN: Es cierto. Pensándolo bien, éste es el nacimiento verdadero y no el que han puesto

EDITORA BILBIOTECA
otros Años.
MARROQUÍ: Claro, Jesús nace para todos los siglos, y para todas las razas y para todas las
edades.
SAN JOSÉ: Muchachas, ¡esto me gusta!, Deberían conseguir que en todas partes se pusieran

MAGISTERIAL
nacimientos como éste.
CHINA: Yo estoy muy orgullosa de poder estar aquí representando todas las razas.
INDIA: ¡Y todos los colores!
EGIPCIA: ¡Y todas las culturas!
MARROQUÍ: ¡Y todas las naciones!
LORENA: Y así acabó aquella maravillosa noche. En aquel nacimiento se reunieron todas las
razas, edades y gustos, porque Jesús ha nacido para todos.
JIMENA: ¡Jesús ha nacido para todos! Y cada Navidad debemos hacer que este nacimiento se
haga realidad en nuestras vidas. ¿Qué les parece si nos unimos para cantar un villancico?
Buscar un villancico popular para que canten todos los participantes y animen al público a
hacerlo con ellos.
Fin
 Indicamos que vuelvan a leer, pero que en esta segunda lectura vayan subrayando las
características de cada personaje, para justificar lo que dice en relación al tema que está
presentando.
Después de la narración con diálogos
 Preguntamos: En el texto que hemos leído ¿Qué tema plantea el autor?, ¿Qué reflexión hace
sobre la navidad? ¿Cuáles son las características que se mencionan de la Navidad?
 Se pide completar actividades de comprensión lectora:
Comprensión lectora
1. Marca la alternativa correcta:
¿Quién armo el nacimiento?
a. Lorena b. Jimena c. Mónica
¿Cuántas muñecas puso en el nacimiento?
a. 4 b. 5 c. 3

¿Por qué se molesta la Virgen María?


a. Porque habían otros personajes en el nacimiento
____________________________________________________________________________________________________
V- DICIEMBRE 89
______________________________________________________________________________________________________
b. Por el canto de los villancicos.
c. Por las canciones del rapero y del rockero.
¿Por qué la Virgen dice que El Nacimiento es el verdadero?
a. Porque hay muchas muñecas.
b. Porque Jesús nace para todos y en todos los lugares.
c. Porque todos están juntos.
2. Dibuja el personaje que más te gusto:

3. Dibuja el nacimiento con los personajes que tú estimes.

EDITORA BILBIOTECA
 Motivamos a los estudiantes a compartir sus respuestas con sus compañeros.
 Dividimos el aula en cuatro grupos y solicitamos a los estudiantes a representa la historia de

MAGISTERIAL
navidad de la lectura.
 Se organizan los estudiantes y damos un tiempo prudente para la presentación de la narración
con diálogos.
 Felicitamos a los estudiantes por la realización de las actividades durante la sesión.
CIERRE
 Reflexionan sobre sus aprendizajes a través de preguntas: ¿Qué aprendimos hoy?; ¿Leer la
narración con diálogos les agradó?; ¿Consideran importante leer este tipo de textos? ¿Por qué?
 Como actividad de extensión: Resuelven actividades de narraciones con diálogos sobre la
Navidad.
ACTIVIDADES
Lee la narración y marca las respuestas correctas:

LOS JUGUETES ENCUENTRAN UN AMIGO


La Navidad había llegado y la ciudad estaba cubierta de una blanca capa de nieve. ¡Qué frío
hacía!
En sus casas, todos los niños y niñas jugaban ya con los regalos que habían recibido.
Sin embargo, en la juguetería quedaban aún dos muñecos de peluche, tristes y solitarios, que
ningún niño se había querido llevar, porque pensaban que eran feos y aburridos: el oso Pepón,
al que le faltaba un ojo, y el gatito Mino, que no tenía color.
Pepón y Mino se sentían abandonados y pensaron que, si salían de la juguetería, quizás
encontrarían algún niño que quisiera jugar con ellos.
- ¡Vamos, Mino! -dijo el oso Pepón.- ¡Seguro que alguien nos recogerá y nos llevará a su casa!
Pero en la calle, la nieve helaba sus patitas de peluche y pensaron que morirían de frío.
Caminando entre la nieve, Pepón y Mino consiguieron llegar hasta el portal de una casa y,
abrazados y temblorosos, se quedaron quietos, muy quietos...
De pronto, vieron que alguien se acercaba. Se asustaron un poco, pero enseguida comprobaron
que era una niña, que les miraba sorprendida:
- ¿Qué hacéis aquí? -les preguntó.- ¿No tenéis una casa y unos dueños que jueguen con
vosotros?
- No, nos hemos quedado solos en la juguetería, porque ningún niño nos quiere, y hemos
____________________________________________________________________________________________________
V- DICIEMBRE 90
______________________________________________________________________________________________________
decidido escapar, pero no tenemos adónde ir...
La niña los miró pensativa. Ella no había recibido ningún regalo; sólo le habían dado unas
cuantas monedas para poder comprar el pan. Y aquel oso, al que le faltaba un ojo, y aquel
gatito, al que le faltaba el color... ¡le parecían los juguetes más bonitos que había visto nunca!
- Venid a mi casa -les dijo.- ¡Yo sí quiero jugar con vosotros!
En casa de María, que así se llamaba la niña, Pepón y Mino entraron en calor junto al radiador.
¡Qué bien se estaba!
Allí descubrieron por primera vez lo que es la Navidad: un árbol, unos adornos, un lugar seguro
donde poder pasar la noche y, sobre todo, amor, mucho amor...
Como habréis imaginado, pepón y Mino nunca regresaron a la juguetería.
Desde aquel día, vivieron felices para siempre con María.
Aunque a uno le falte un ojo y aunque al otro le falte el color, jamás podréis encontrar un oso y
un gatito más queridos que ellos dos.

¿De qué festividad se habla en el cuento?


A. Magüestu
B. Navidad
C. Carnaval
D. Hallowen
¿En qué estación del año se desarrolla el cuento?

EDITORA BILBIOTECA
A. Primavera
B. Invierno
C. Otoño
D. Verano

MAGISTERIAL
¿Cuántos muñecos quedaron sin vender en la juguetería?
A. 3
B. 2
C. 5
D. 0
¿Qué juguetes quedaron sin vender?
A. Gatito
B. Perro
C. Oso
D. Ratón
¿Qué nombre tiene el oso?
A. Pepito
B. Pepón
C. Pepe
D. Pepote
¿Cómo se llama el gatito?
A. Mininé
B. Minino
C. Minu
D. Mino
¿Qué defectos tienen los juguetes?
A. Le falta un ojo.
B. Tiene un tamaño enorme.
C. Le falta una oreja.
D. No tiene color.

¿Con quién se encontraron cuando salieron de la juguetería?


A. Con un abuelo.
B. Con un niño.
C. Con una niña.
D. Con un señor.
____________________________________________________________________________________________________
V- DICIEMBRE 91
______________________________________________________________________________________________________
¿Qué hizo la niña con los juguetes?
A. Se los llevó a su casa.
B. Los dejó solos.
C. Los regaló a otro niño.
D. Los llevó de nuevo a la juguetería.
¿Qué descubrieron los juguetes en casa de María?
A. Amor, mucho amor...
B. Lo que es el Carnaval.
C. Lo que es la Navidad.
D. Un árbol, los adornos, una cama
 Se evalúa a través de una lista de cotejos.
LISTA DE COTEJOS
Desempeños (criterios de evaluación) Sí No Observaciones
Recupera información explícita de textos orales que escucha seleccionando
datos específicos.
Integra esta información cuando es dicha en distintos momentos en textos que
incluyen expresiones con sentido figurado, y vocabulario que incluye sinónimos
y términos propios de los campos del saber.
Explica el tema y el propósito comunicativo del texto oral.

EDITORA BILBIOTECA
Distingue lo relevante de lo complementario clasificando y sintetizando la
información.
Establece conclusiones sobre lo comprendido; para ello, vincula el texto con su
experiencia y el contexto sociocultural en que se desenvuelve.

MAGISTERIAL
REFLEXIONES SOBRE EL APRENDIZAJE
 ¿Lograron los estudiantes reconocer las el mensaje de la narración con diálogos?
 ¿Qué dificultades se observaron durante la comprensión lectora?
 ¿Los recursos y materiales fueron utilizados adecuadamente durante la sesión?

ÁREA: PERSONAL SOCIAL


¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Preparar las letras de las palabras desordenadas. - Imágenes. Texto escolar de Ciencia y Ambiente 5.
Fotocopia los Anexos en cantidad suficiente para Diversas fuentes de información disponibles sobre el
repartir a todos tus estudiantes. tema.
INICIO:
 Saludamos a los estudiantes y los invitamos a participar en el Bingo de Navidad.
 En el juego de bingo, a cada estudiante se le entrega un cartón. Cuando se anuncia una imagen,
el propietario del cartón lo revisa para ver si aparece enlistado. Si aparece, él o ella lo marcarán.
Si sus cartones contienen el patrón ganador el estudiante será el ganador.

____________________________________________________________________________________________________
V- DICIEMBRE 92
______________________________________________________________________________________________________

ABETO ACEBO ADORNO ANGEL ARBOL

BALTAZAR BELEN BOLAS CORONA ESTRELLA

EDITORA BILBIOTECA
FELICITACION GASPAR GORRO GUIRNALDA IGLESIA

MAGISTERIAL
JOSE VILLANCICOS LAVANDERA LOR REYES LUCES

MARIA MELCHOR NIÑO NOCHEBUENA PAPANOEL

PASTOR ROSCON TRINEO


 Solicitamos a los estudiantes mencionar las palabras del bingo que no son de su localidad.
 Dialogan: ¿De dónde provienen esos objetos? ¿Qué otros objetos o tradiciones hemos adoptado
de otros lugares? ¿Qué nombre recibe la acción de trasladarse de un lugar a otro?
 Responden preguntas para rescatar los saberes previos de los estudiantes: ¿Qué es la
migración? ¿Qué relación existe entre la migración y la población? ¿Qué ventajas y desventajas
presenta la migración? ¿Qué tipo de migración se viene realizando estos últimos años?
 Se comunica el propósito de la sesión:
____________________________________________________________________________________________________
V- DICIEMBRE 93
______________________________________________________________________________________________________

HOY RECONOCERAN LAS TIPOS DE MIGRACIONES QUE SE DAN EN EL PERÚ.


 Se acuerda las normas de convivencia:
- Mantener el orden y limpieza en mi aula.
- Utilizo las palabras por favor y gracias.
DESARROLLO
Problematización
 Invitamos a los estudiantes que lean una noticia sobre la Migración de los venezolanos al Perú.
Venezolanos en Perú: cifras actualizadas de la migración venezolana
Hasta la fecha, han ingresado al Perú más de 456 mil ciudadanos venezolanos, informó el superintendente de
Migraciones, Eduardo Sevilla. Esta cifra representa un incremento de más de 24 mil migrantes procedentes
de Venezuela en comparación con los datos de los primeros días del mes, cuando se contaba con 431.966.
Por otro lado, detalló que la exigencia del pasaporte como requisito para entrar a Perú, que empezó a regir el 25 de
agosto, redujo de 3.500 a 1.300 los ingresos diarios de venezolanos a Perú por la frontera con Tumbes.
Respecto al número de migrantes venezolanos que cuentan con el Permiso Temporal de Permanencia (PTP),
actualmente 106 mil ya tienen este documento y 114 mil iniciaron el trámite. A inicios de mes, 93
mil venezolanos tenían el PTP y 70 mil estaban en gestiones para obtenerlo. Diariamente, se registran 2.700 citas
en línea de venezolanos para sacar el permiso.

EDITORA BILBIOTECA
Respecto al Hábeas Corpus interpuesto por la Coordinadora Nacional de Derechos Humanos (CNDDHH) para que
los ciudadanos venezolanos puedan ingresar al Perú sin pasaporte, admitido a trámite por el Poder Judicial los
primeros días de setiembre, Sevilla dijo a Tv Perú que son respetuosos de los fallos judiciales, pero que confía en
el criterio de los jueces que verán en los próximos días

MAGISTERIAL
este procedimiento jurídico.
Para regularizar su situación, el gobierno peruano
modificó los plazos de tiempo que rigen para otorgar el
PTP a los ciudadanos venezolanos (decreto
supremo N° 007-2018-IN). El documento alcanza a
todo aquel venezolano que ingrese al territorio
peruano hasta el 31 de octubre de 2018.
El plazo para presentar la solicitud del PTP vencerá el
31 de diciembre de 2018. En un primer momento era
hasta el 30 de junio del próximo año.
 Responden preguntas: ¿Según la lectura se puede decir que los venezolanos están migrando al
Perú? ¿Qué tipo de migración se presenta? ¿Qué ventajas presenta este tipo de migración?
¿Qué otras formas de migraciones hay?
 Mencionamos a los estudiantes que se irán resolviendo estas preguntas a lo largo de la sesión.
Análisis de la información.
 Cada equipo resuelven las preguntas planteadas, intercambian opiniones entre los integrantes.
 Luego, cada equipo expone sus respuestas.
 Los estudiantes organizados en sus equipos analizan información relacionada a las Migraciones.

Los movimientos migratorios son los desplazamientos de población desde un territorio a otro implicado cambio de
residencia temporal o permanente.
COMPONENTES
____________________________________________________________________________________________________
V- DICIEMBRE 94
______________________________________________________________________________________________________

TIPOS DE MOVILIDAD

EDITORA BILBIOTECA
MAGISTERIAL

CAUSAS
Familiares
Cuando una persona decide mudarse a una residencia más cercana a su familia, debido a que
estos viven en lugares muy lejanos, así como también cuando un familiar ya ha emigrado
anteriormente y luego de conseguir la estabilidad en el mismo, les ofrece la posibilidad de
hacerlo a los familiares que permanecieron en su tierra.
Políticas
Es uno de los casos más presenciados en la actualidad, o por lo menos en países como
Venezuela que presentan una situación de régimen totalitario, donde existen personas que
incluso han tenido que abandonar el país por exponer su vida en este, gracias a persecuciones
políticas, abuso policial entre otros.
La mayoría de los migrantes que se van de un territorio por estas causas no suelen volver,
debido a que probablemente tengan que abandonar por obligación, debido a que se les practico
exilio, o llegan a otros países como refugiados políticos.
Socioeconómicas
Una de las principales causas de migración, debido a que todas las personas andan en busca de
estabilidad tanto social como económica, y existen algunos países que no poseen ciertas
características que apoyan el éxito en ambos sentidos, cohibiendo a las personas que lo habitan.

____________________________________________________________________________________________________
V- DICIEMBRE 95
______________________________________________________________________________________________________
Los migrantes de este tipo suelen estudiar con detalle las opciones para migrar, debido a que lo
que estos buscan es mejorar su vida en estos aspectos, siendo la mayoría de países del tercer
mundo, y tratando de llegar a países del primer mundo, que ofrecen mayores oportunidades
claro está.
Conflictos internacionales y guerras
Son muchos los ejemplos de países que se encuentran en estos contextos, los cuales afectan de
manera directa a todos los habitantes de ellos, exponiendo su vida a diario por la intensa batalla
que se puede o pudo haber desarrollado.
A nivel de historia este ha sido un factor muy relevante con respecto a las migraciones, ya que
gracias a la naturaleza humana de buscar protección de su familia y de su propia vida, estos
huyen a lugares que les ofrezcan más seguridad.
Culturales
Estas no suelen ser de carácter dañino, a veces las personas simplemente deciden que quieren
aprender nuevas culturas, y se mudan para conocer un poco más el mundo, o porque
simplemente les gusta el modo de vivir de otras regiones
Aunque en algunas ocasiones los factores como la religión pueden ser determinantes a la hora
de elegir esta decisión, ya que esta puede incluso provocar grandes conflictos a nivel social y
político.
Catástrofes
Tales como los terremotos, las inundaciones, las enfermedades, los tsunamis, la erupción de

EDITORA BILBIOTECA
volcanes, la explosión de bombas, y todos las catástrofes que puedan afectar un territorio son
suficiente motivo para que se tome la decisión de migrar, debido a que todos estos atentan
contra la vida de la humanidad, y como ya se mencionó, la naturaleza del mismo, es de
protegerse.

MAGISTERIAL
 A los equipos se les entrega papelógrafos y plumones para que elaboren mapas conceptuales
que sistematice la información proporcionada.
 Pegan sus papelógrafos en las paredes del aula y un representante de cada grupo explica sus
organizadores visuales.
 Luego, se promueve el diálogo a partir de las preguntas planteadas: ¿Creen que las migraciones
perjudican o benefician? ¿Por qué? ¿Están de acuerdo con la norma de un tiempo limitado para
el ingreso de las personas venezolanas? ¿Por qué? ¿Creen que las autoridades deben de
ayudar a las personas migrantes sobre todo en fiestas de navidad? ¿Por qué? ¿De qué manera
podrían colaborar con ellos?
 En grupo clase se consolidan las respuestas.
Toma de decisiones
 Reflexionan acerca de la migración venezolana que está ocurriendo en el país y comentan
también que estas personas merecen buen trato.
 Los estudiantes se comprometen a respetar y tratar con cordialidad a personas que hayan
migrado a su localidad.
 Entregamos la ficha de aplicación y retroalimenta la sesión.

____________________________________________________________________________________________________
V- DICIEMBRE 96
______________________________________________________________________________________________________
FICHA DE APLICACIÓN
1. ¿Qué es la migración?
____________________________________________________________________________
____________________________________________________________________________
2. ¿Cuáles son los tipos de migración?
____________________________________________________________________________
____________________________________________________________________________
3. Relaciona las causas de las migraciones:
( ) Se mudan para conocer un poco más el mundo.
a. Familiares ( ) Las personas andan en busca de estabilidad tanto social
b. Políticas como económica.
c. Socioeconómicas ( ) Tales como los terremotos, las inundaciones, las
enfermedades, etc.
d. Conflictos
( ) Cuando una persona decide mudarse a una residencia más
e. Catástrofes
cercana a su familia.
( ) Presentan una situación de régimen totalitario.
Resuelve el siguiente crucigrama.

EDITORA BILBIOTECA
MAGISTERIAL

Según los planteamientos 1, 2, 3 y 5 relaciona las causas por las que se dieron las migraciones.

 Comentamos brevemente que para que se dé un clima de paz y armonía en esta Navidad
debemos de ayudar a las personas que más lo necesitan, sean migrantes o no.
 Los estudiantes se comprometen a realizar acciones de solidaridad en las fiestas de Navidad.
CIERRE
____________________________________________________________________________________________________
V- DICIEMBRE 97
______________________________________________________________________________________________________
 Iniciamos la metacognición a través de estas preguntas: ¿Qué han aprendido el día de hoy?
¿Qué actividades han sido importantes para aprender? ¿Cuáles eran nuestros saberes respecto
del tema? Además de lo que sabíamos, ¿qué sabemos ahora? ¿Para qué nos servirá lo
aprendido?
 Como actividad de extensión: Se pide a los estudiantes que investiguen sobre las causas que
motivaron a personas venezolanas a migrar al Perú.
Políticas
Económicas
Sociales
Familiares
 Se evalúa a través de una escala de valoración.
ESCALA DE VALORACIÓN

DESEMPEÑOS En
Sí No Observaciones
proceso
Gestiona responsablemente el espacio el ambiente
Describe las relaciones que se establecen entre los
elementos naturales y sociales de un determinado

EDITORA BILBIOTECA
espacio geográfico de su localidad o región, o de un
área natural protegida, así como las características de
la población que lo habita y las actividades
económicas que esta realiza.

MAGISTERIAL
REFLEXIONES SOBRE EL APRENDIZAJE
 ¿Lograron los estudiantes reconocer los tipos de migraciones?
 ¿Qué dificultades se observaron durante el trabajo en equipo de los estudiantes?
 ¿Cómo se solucionaron los conflictos durante el trabajo en equipo?
 ¿Qué aprendizajes se deben reforzar?
 ¿Las estrategias, materiales y recursos resultaron adecuados para la sesión?

____________________________________________________________________________________________________
V- DICIEMBRE 98
______________________________________________________________________________________________________
SEMANA Nº 2
“FESTEJEMOS EL NACIMIENTO DE JESÚS”
Día Nro. 7
“ELABORAMOS MANUALIDADES NAVIDEÑAS”
• PROPÓSITOS DE APRENDIZAJE
Evidencias de
Competencia / Campo
Área Desempeños aprendizaje /
Capacidad temático
Inst. de valoración
AyC 1. Aprecia de manera Composición - Genera hipótesis sobre el - Utiliza materiales
crítica manifestaciones de significado y la intención de una reciclados para la
artístico-culturales. materiales. manifestación artístico-cultural e elaboración de
1.3. Reflexiona creativa y incorpora la opinión de los manualidades
críticamente sobre demás para reformular sus navideñas.
manifestaciones artístico- puntos de vista sobre ella. - Escala de
culturales. valoración.
2. Crea proyectos desde Manualidade - Registra sus ideas y las

EDITORA BILBIOTECA
los lenguajes artísticos. s navideñas influencias de sus creaciones y
2.3 Evalúa y comunica las presenta de diversas
sus procesos y proyectos. maneras. Asume roles en las
diferentes fases del proyecto

MAGISTERIAL
artístico y evalúa el impacto de
sus acciones en el resultado de
sus creaciones o
presentaciones.
CyT 1. Indaga mediantes Pirotécnicos. - Formula preguntas acerca de - Expone los
métodos científicos para las variables que influyen en un peligros que
construir conocimientos. hecho, fenómeno u objeto puede provocar el
1.1. Problematiza natural o tecnológico. Plantea uso de
situaciones para hacer hipótesis que expresan la pirotécnicos y
indagación. relación causa-efecto y participa en
determina las variables actividades de
involucradas. protección en el
1.5. Evalúa y comunica el - Comunica sus conclusiones y lo uso de
proceso y resultados de que aprendió usando pirotécnicos.
su indagación. conocimientos científicos. - Rúbrica.
Evalúa si los procedimientos
seguidos en su indagación
ayudaron a comprobar sus
hipótesis. Menciona las
dificultades que tuvo y propone
mejoras. Da a conocer su
indagación en forma oral o
escrita.
M 1. Resuelve problemas Multiplicación - Establece relaciones entre - Establece
de cantidad. de números datos y una o más acciones de relaciones entre
1.1. Traduce cantidades a enteros. agregar, quitar, comparar, los datos para
expresiones numéricas. igualar, reiterar, agrupar y resolver
repartir cantidades, para multiplicaciones
transformarlas en expresiones con números

____________________________________________________________________________________________________
V- DICIEMBRE 99
______________________________________________________________________________________________________
Evidencias de
Competencia / Campo
Área Desempeños aprendizaje /
Capacidad temático
Inst. de valoración
numéricas (modelo) de adición, enteros en ficha
sustracción, multiplicación y de aplicación.
división con números naturales, - Prueba escrita.
y de adición y sustracción con
decimales.

ÁREA: ARTE Y CULTURA


¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Preparar imágenes con trabajos navideños. Tener - Botellas descartables, pegamento, tijeras, cintas,
preparadas los materiales para los trabajos rollos de papel higiénico, CD’s, papeles reciclables,
navideños. plumones, colores, escala de valoración.
INICIO:
 Observan imágenes de trabajos navideños:

EDITORA BILBIOTECA
MAGISTERIAL
 Rescatamos los saberes previos de los estudiantes: ¿Qué imágenes observan? ¿De qué
materiales están hechos? ¿Les gustaría elaborar sus propios adornos navideños? ¿A quiénes
regalarían sus adornos? ¿Qué materiales necesitarán? ¿Dar un adorno navideño es una manera
de expresar el sentimiento de la navidad?
 Se comunica el propósito de la sesión:

HOY VAN A ELABORAR TRABAJOS NAVIDEÑOS CON MATERIALES RECICLABLES.


 Se acuerda las normas de convivencia:
- Levantar la mano al participar.
- Ayudar a los compañeros que lo necesiten.
DESARROLLO
 Observan nuevamente las imágenes y mencionan los materiales que pueden utilizar.
 Reúnen los materiales para el trabajo.
 Forman grupos de trabajo para compartir materiales y herramientas comunes.
 Preparan sus lugares de trabajo, pueden forrar sus carpetas con periódicos o plásticos.
 Siguen las instrucciones dadas.
TRABAJO N°1
ADORNOS DE NAVIDAD CON BOTELLAS DESCARTABLES
Materiales.
1. 1 botella de plástico para cada adorno.
2. Tijera.
3. Pegamento.
4. Sal gruesa.
5. Muñecos navideños.
6. Cintas.
7. Hilo, cuerda o alambre.

____________________________________________________________________________________________________
V- DICIEMBRE 100
______________________________________________________________________________________________________
8. Accesorios para su decoración.
Instrucciones para la elaboración.
1. Corta la parte superior de la botella y luego la inferior, lo que buscamos en este paso es
descartar el área del centro de la botella para poder acortarla.
2. Coloca una buena cantidad de sal gruesa en la parte inferior de la botella, la cual simulará la
típica nieve que hay en la temporada navideña.
3. Ahora acomoda los muñecos de navidad sobre esa superficie, asegúrate que queden bien
firmes para que no se caigan.
4. Coloca pegamento en la parte superior de la botella y acomódala encima de la parte inferior.
5. Luego que se seque el pegamento agrega un moño realizado con un trozo de cinta de tela.
6. Y continua decorando el adorno como más te agrade, puedes realizar detalles con pintura,
colocarle boas navideñas, añadirle gibre sobre la superficie etc.
7. Si quieres colgar este adorno solo añade sobre la tapa de la botella un trozo de hilo o de
alambre fino doblado a la mitad.
TRABAJO N° 2
CORONA DE NAVIDAD CON TUBOS DE CARTÓN RECICLADO
Materiales:
 Rollos o tubos de cartón
 Tijeras
 Pegamento

EDITORA BILBIOTECA
 Pintura verde
 Bolillas de madera color rojas
Paso a paso:
1. Lo primero que debemos hacer es pintar los rollos de cartón de color

MAGISTERIAL
verde, por completo y luego dejarlos secar al aire libre hasta que la
pintura esté completamente seca.
2. Lo segundo que haremos será aplanar los rollos de cartón y realizar cortes sobre el mismo de
manera que consigamos muchos trozos del mismo grosor, tal como podemos apreciar en la
imagen. Al tenerlos cortados debemos proceder a unir los mismos de a cinco, para formar una
flor.
3. Con las flores formadas, debemos proceder a colorear las mismas también por el lado de
adentro, de esa manera conseguiremos un resultado mucho más estético, que tal como
podemos apreciar luce mucho mejor a la vista. Nuevamente debemos dejar que la pintura se
seque por completo para poder seguir trabajando el material cómodamente.
4. Para terminar, nos resta darle forma a la corona. Para ello pegaremos las flores entre sí,
formando un gran círculo, debemos aplicar bastante pegamento para asegurarnos de que quede
bien fijado todo. Al terminar, solo restará agregar algunas cuántas bolillas de madera de color
rojo las cuales le darán a la guirnalda un aspecto más real, llamativo y característico de
la Navidad.
TRABAJO N° 3
BOLAS NAVIDEÑAS – CORONA PARA LA PUERTA
Materiales:
 Pelotas de plumavit
 Témperas
 Pegamento
 Ganchos (como de colgar cuadros)
 CD's
 Pino aromático para coche
Paso a paso:
Bolas navideñas: Pinta las pelotas de plumavit con témperas
(colores alegres, verde, rojo...).Rompe algunos CD's y pega los pedacitos a la pelota. Ponles un
gancho para colgarlas.

____________________________________________________________________________________________________
V- DICIEMBRE 101
______________________________________________________________________________________________________
Corona para la puerta: Cogemos CD's y los pegamos haciendo un círculo. Ponemos cola fría
después y brillantina de colores (purpurina). Dejamos secar. Recortamos otro CD siguiendo el
modelo del pino aromático (puesto detrás). Lo forramos con papel higiénico y cola. Dejamos
secar y pintamos de rojo, por ejemplo. Lo colgamos del medio de la corona.
TRABAJO N° 4
ADORNOS NAVIDEÑOS DE PAPEL DE PERIÓDICO
Materiales:
 Papel reciclado (periódico, revistas, folletos de publicidad, fotocopias, libros que estén en
mal estado…).
 Regla.
 Lápiz.
 Tijeras.
 Pegamento de barra.
 Cinta para colgar adornos de Navidad.
 Botones, figura de goma eva, adorno… (para tapar el centro).
Cómo hacer adornos navideños de papel reciclado paso a
paso:
 Corta 20 trozos de papel de 30 x 10 cm . Esta medida es
aproximada, pueden ser un poco más grandes o pequeños
dependiendo del tamaño del papel que quiera reciclar. Si

EDITORA BILBIOTECA
usas papel de periódico pueden ser mucho más grandes por el tamaño de las hojas.
 Dobla los papeles por la mitad y pega a los lados para formar un sobre parecido a un bolsillo de
papel.
 Pega todos los sobres de papel, uno sobre otro, poniendo pegamento en forma de T , en el

MAGISTERIAL
centro y la parte de abajo, formando dos montones de 10 sobres cada uno.
 Corta con forma de pico para que tenga forma de estrella de papel . Marca arriba en el centro y a
6 cm en los lados para cortar con las tijeras y que tenga forma de punta.
 Pega los dos montones de papel entre sí con otra T de pegamento.
 Cuando esté totalmente seco (deja un tiempo prudencial, si no está seco el pegamento el
adorno navideño se desarmará) pon otra T de pegamento en uno de los lados , abre el rosetón
de papel y pega el principio con el final.
 Haz un agujero en una de las puntas de la estrella y pasa un cordón para colgar como adorno en
el árbol de Navidad, ventanas, paredes, puertas… o donde más te guste.
 Si haces estos rosetones de papel grandes pueden servir como corona navideña para decorar
la puerta.
TRABAJO N° 5
ADORNOS NAVIDEÑOS CON CHAPAS
Materiales para hacer adornos navideños con chapas
 Chapas de botellas (intenta que no estén dobladas)
 Pinceles (uno muy fino)
 Pintura acrílica blanca, negra y naranja ( si quieres puedes optar por
usar rotuladores naranjas y negros)
 Pistola de silicona o pegamento permanente
 Tijeras
 Un poco de cordón y celo.
 Si quieres darle un toque más real, como los muñecos de la imagen,
puedes coger una cinta o un lazo y un botón, para simular una
bufanda.
Adornos navideños con chapas paso a paso
 Coge tres chapas y píntalas de blanco por ambas caras. Puedes darlas una o dos capas, lo
más importante es que sea uniforme.
 Una vez estén secas, en una de ellas y con un pincel muy pequeño has los ojos (en negro) y
la nariz (en naranja). Como ya hemos dicho, en vez de con pintura, puedes optar por
hacerlos con rotuladores.
 En otra chapa, haz tres puntitos que serán los botones de tu muñeco de nieve.
____________________________________________________________________________________________________
V- DICIEMBRE 102
______________________________________________________________________________________________________
 Une las tres chapas con silicona. Si no tienes, puedes usar cola o pegamento permanente
pero quedarán mucho mejor unidas si optas por la silicona. Haz un poco de presión y ya
estarán unidos
 Ya tienes el cuerpo de tu muñeco. Si quieres ponerle la bufunda, como se ve en el vídeo,
corta un trozo de cinta y colócala entre la primera y segunda chapa. Puedes pegarla con
silicona.
 Finalmente, necesitas añadir en la parte posterior un pequeño trozo de cuerda desde el que
puedas colgar. Puedes unirlo al cuerpo de tu muñeco con silicona o con un poco de celo.
 Presentan sus trabajos.
 Se guía al grupo clase en la elaboración de conclusiones sobre los beneficios de elaborar sus
propios adornos navideños en vez de comprarlos.
 Se piden voluntarios para que compartan sus experiencias sobre lo trabajado durante la sesión.
CIERRE
 Orientamos la metacognición: ¿Qué hemos hecho hoy? ¿Qué aprendieron? Deberán conversar
en grupos y cada grupo presenta solo una idea acerca de lo que siente que aprendió. ¿De qué
nos sirve lo aprendido?
 Como actividad de extensión elaboran otros adornos con materiales reciclados y los presentan en
la siguiente sesión.

EDITORA BILBIOTECA
 Evaluamos a lo largo de la sesión con una escala de valoración.
ESCALA DE VALORACIÓN
En
DESEMPEÑOS Sí No Observaciones
proceso

MAGISTERIAL
Aprecia de manera crítica manifestaciones artístico-culturales
Genera hipótesis sobre el significado y la intención de una
manifestación artístico-cultural e incorpora la opinión de los
demás para reformular sus puntos de vista sobre ella.
Crea proyectos desde los lenguajes artísticos.
Registra sus ideas y las influencias de sus creaciones y las
presenta de diversas maneras. Asume roles en las diferentes
fases del proyecto artístico y evalúa el impacto de sus acciones
en el resultado de sus creaciones o presentaciones.

REFLEXIONES SOBRE EL APRENDIZAJE


 ¿Qué lograron los estudiantes en esta sesión?
 ¿Qué dificultades se observaron durante el aprendizaje y la enseñanza?
 ¿Qué aprendizajes se deben reforzar?
 ¿Las estrategias, materiales y recursos resultaron de adecuados para la sesión?
ÁREA: CIENCIA Y TECNOLOGÍA
¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Preparar los tableros y dados del juego inicial. - Botellas vacías de medio litro con tapa, una tela negra
Preparar los materiales para los experimentos. y otra blanca (la tela debe alcanzar para cubrir las
Copias de la información sobre la energía. botellas), tijeras y un termómetro (opcional). Cuaderno
de experiencias. Libro de Ciencia 5º
INICIO:
 Se invita a los estudiantes a observan un video sobe los pirotécnicos.
 https://www.youtube.com/watch?v=8SXFp5MnZr4
 Los estudiantes comentan sus impresiones sobre los pirotécnicos. Anotamos las ideas comunes
en la pizarra.
____________________________________________________________________________________________________
V- DICIEMBRE 103
______________________________________________________________________________________________________
 Rescatamos los saberes previos de los estudiantes en torno a las siguientes preguntas: ¿Qué
son los pirotécnicos?, ¿Por qué las personas utilizan pirotécnicos? ¿Consideran que es peligrosa
la elaboración de los pirotécnicos? ¿Por qué se debe de tener cuidado al momento de manipular
los pirotécnicos?
 Se comunica el propósito de la sesión:

HOY INDAGARÁN SOBRE EL PELIGRO DE LOS PIROTECNICOS.


 Se acuerda las normas de convivencia:
- Cuidar el material propio y común.
- Mostrar amabilidad con todos.
DESARROLLO
Planteamiento del problema:
 Presentamos una lectura sobre los pirotécnicos:
EL PELIGRO DE MANIPULAR JUEGOS PIROTÉCNICOS
Año tras año, pese a las advertencias, muchas personas manipulan juegos pirotécnicos en fiestas y celebraciones
sin pensar que la manipulación de estos artefactos implica un gran peligro para su
integridad física y la de quienes los rodean.
Una muestra del peligro que representa la manipulación de juegos pirotécnicos es la gran

EDITORA BILBIOTECA
cantidad de accidentes que se producen. Por ejemplo, el año pasado, durante las fiestas de
fin de año, se registraron más de trescientos casos de niños que, ante la imprudencia o el
desconocimiento de sus familiares, resultaron heridos o con quemaduras múltiples por
manipular juegos pirotécnicos. Debido a este suceso, las unidades de quemados de los

MAGISTERIAL
diversos hospitales tuvieron que incrementar sus turnos de trabajo para atender la mayor
cantidad de emergencias posibles.
Sin embargo, las quemaduras no son el único tipo de consecuencias que pueden
ocasionar. Los juegos pirotécnicos detonantes, como la rata blanca, los cohetecillos, el
cohetón, entre otros, pueden ocasionar, además de quemaduras, otros daños severos e irreversibles, como
pérdidas de partes del cuerpo y ceguera.
Algunas personas creen que solo este tipo de juegos pirotécnicos pueden ocasionar algún tipo de daño, pero esto
no es cierto. Los juegos pirotécnicos luminosos, como las luces de bengala y las abejitas, que algunos creen
inofensivos, también pueden ocasionar quemaduras e incendios en las casas. En declaraciones a la prensa, un
grupo de pediatras del Hospital Central, que atendió a niños con quemaduras producidas por la manipulación de
juegos pirotécnicos, advirtió que ningún juego pirotécnico es inofensivo, ya que todos ocasionan quemaduras y
ninguno es fácil de manipular.
Otra consecuencia que pueden ocasionar los juegos pirotécnicos es la pérdida de la audición. Las explosiones de
algunos juegos pirotécnicos llegan a ser tan fuertes que pueden dañar los oídos seriamente. Muchas veces, este
efecto no es notado inmediatamente, sino algún tiempo después al observarse las dificultades para escuchar.
Según lo expuesto, en nuestra opinión, los juegos pirotécnicos implican un gran peligro debido a los daños que
pueden ocasionar, por lo que se hace necesario que todos estemos informados y concientizados para así poder
evitar este tipo de accidentes.
Texto Ministerio de Educación del Perú
 Responden: ¿Por qué peligros ocasionan los pirotécnicos? ¿Quiénes son los principales
afectados por los pirotécnicos? ¿Qué tipo de lesiones se producen con los pirotécnicos? ¿Qué
recomendaciones podemos dar a nuestros compañeros para que no usen pirotécnicos?
 Preguntamos: ¿Cuál es el problema de indagación? Eligen y subrayan una alternativa:
a) ¿Qué efectos ocasiona el inadecuado uso de los pirotécnicos?
b) ¿Los pirotécnicos pueden ocasionar graves desastres?
c) ¿Los niños pueden sufrir lesiones al manipular los pirotécnicos?
Planteamiento de la hipótesis.
 Se invita a que se organicen en cuatro grupos y que, en cada grupo, ensayen algunas posibles
soluciones a esta pregunta. Luego, que las registren en su cuaderno de experiencias.
____________________________________________________________________________________________________
V- DICIEMBRE 104
______________________________________________________________________________________________________
 Planteamos la necesidad de formular preguntas más concretas que puedan ayudarnos a
responder la pregunta que nos hemos planteado; estas nos permitirán realizar indagaciones
sencillas que nos servirán de sustento, basado en evidencias, para nuestras respuestas. Algunas
de estas interrogantes son: ¿Cómo podemos saber las consecuencias del incorrecto uso de los
pirotécnicos? ¿Cómo podemos informar a otros estudiantes sobre las consecuencias del uso de
los pirotécnicos?
Elaboración del plan de indagación
 Recordar la hipótesis planteada. Luego, se hace preguntas: ¿Qué hacer para confirmarla?
 Organizan la información y anotan tres actividades en el siguiente cuadro.
¿Cuál es el ¿Cuáles son las ¿Qué actividades ¿Qué fuentes de
¿En qué fechas
problema a hipótesis o tareas información
lo realizarán?
indagar? planteadas? realizadas? usarán?
1. Los efectos del 1. La mala 1. Realizamos 1. Libro de CyT 1.
uso incorrecto de manipulación de investigaciones. 2. Páginas web 2.
los pirotécnicos. los pirotécnicos 2. Procesaremos 3. Libros de la 3.
pueden ocasionar información. biblioteca
en las personas
lesiones graves e
incluso la muerte.

EDITORA BILBIOTECA
 Se indica que anoten sus respuestas a las preguntas planteadas para el problema y así poder
confirmar la hipótesis.
 Presentamos imágenes de algunos accidentes producidos por los pirotécnicos.

MAGISTERIAL
 Luego organizados en grupos pequeños se les entrega papelógrafos y se les solicita que
mencionen recomendaciones sobre el uso de los pirotécnicos y sus efectos.
 Terminado el análisis de las imágenes y el planteamiento de recomendaciones solicitamos
voluntarios para que socialicen sus respuestas.
 Para corroborar su análisis presentamos afiches relacionados al tema.
CONSEJOS DE SEGURIDAD AL USAR FUEGOS ARTIFICIALES
No permita que los niños manipulen No use ropa sintética. No guarde los No detone fuegos pirotécnicos en el
los fuegos artificiales. fuegos artificiales en los bolsillos de interior de su casa.
su ropa.

No almacene grandes cantidades de En caso de mal funcionamiento de Los sobrantes no detonados no


cohetes. No queme muchos los artefactos, no insista en deben tirarse a la basura. Pueden
productos al mismo tiempo. prenderlos. provocar incendios.

Tener a la mano un extinguidor y Nunca encienda los productos en la Lávese bien las manos con agua y
____________________________________________________________________________________________________
V- DICIEMBRE 105
______________________________________________________________________________________________________
botiquín en caso de accidentes. mano. jabón después usar los fuegos
artificiales.

Análisis de resultados y comparación de la hipótesis


 Se pide a un representante de cada grupo que describa sus observaciones y los resultados
obtenidos.
 Responden: ¿Cuáles fueron las respuestas planteadas (hipótesis) al inicio?
 Comparten sus respuestas iniciales (hipótesis) con las respuestas planteadas después de
realizar las actividades. Luego, completen el cuadro:
Respuestas iniciales (hipótesis) Respuestas después de realizadas las actividades

 Responden: Si sus respuestas no fueron las correctas, ¿Qué podrían hacer para corregirlas?
Estructuración del saber construido como respuesta al problema
 Se pregunta: ¿Por qué es importante tener cuidado al momento de manipular un pirotécnico?

EDITORA BILBIOTECA
¿Qué acciones de prevención debemos de tener?
 Comentamos que para comprender mejor esta información leerán información del uso de los
pirotécnicos de manera responsable.

MAGISTERIAL

Evaluación y comunicación
 Retomamos la pregunta: ¿Cómo podemos dar a conocer las recomendaciones a nuestros
compañeros? Los estudiantes elaboran una conclusión general que escribirán en un papelote
para dejarlo expuesto en un lugar visible del salón.
 Forman parejas de trabajo y resuelven una ficha de aplicación.
FICHA DE APLICACIÓN
1. Escribe las consecuencias del uso de los pirotécnicos.

____________________________________________________________________________________________________
V- DICIEMBRE 106
______________________________________________________________________________________________________

2. Según cada imagen menciona las recomendaciones que se debe de tener al usar un
pirotécnicos.

EDITORA BILBIOTECA
MAGISTERIAL
CIERRE
 Responden preguntas de metacognición: ¿Qué actividades les gustó más? ¿Qué dificultades
tuvieron? ¿Qué pueden hacer para superar las dificultades en las actividades?
 Como actividad de extensión: Investigan sobre los velups o lámparas de papel voladoras.
 Se evalúa a través de una rúbrica.
RÚBRICA
Competencia: Indaga mediantes métodos científicos para construir conocimientos .
Capacidades En inicio En proceso Esperado Destacado
Problematiza Formula algunas Formula algunas Formula preguntas Formula preguntas
situaciones para preguntas acerca de preguntas acerca de acerca de las acerca de las
hacer indagación las variables que las variables que variables que variables que
influyen en un influyen en un influyen en un influyen en un
hecho. hecho. Plantea una hecho. Plantea hecho, fenómeno u
hipótesis. algunas hipótesis objeto natural o
que expresan la tecnológico. Plantea
relación causa- hipótesis que
efecto y determina expresan la relación
algunas variables. causa-efecto y
determina las
variables
involucradas.
Evalúa y comunica Comunica una parte Comunica parte de Comunica lo que Comunica sus
el proceso y de lo que aprendió. lo que aprendió aprendió usando conclusiones y lo
____________________________________________________________________________________________________
V- DICIEMBRE 107
______________________________________________________________________________________________________
resultados de su Menciona las usando conocimientos que aprendió usando
indagación dificultades que tuvo. conocimientos científicos. Evalúa si conocimientos
científicos. Evalúa los procedimientos científicos. Evalúa si
algunos seguidos ayudaron a los procedimientos
procedimientos comprobar sus seguidos en su
seguidos ayudaron a hipótesis. Menciona indagación ayudaron
comprobar sus algunas dificultades a comprobar sus
hipótesis. Menciona que tuvo y propone hipótesis. Menciona
algunas dificultades mejoras. las dificultades que
que tuvo. tuvo y propone
mejoras. Da a
conocer su
indagación en forma
oral o escrita.
PRUEBA ESCRITA
1. ¿Qué es un pirotécnico?
______________________________________________________________________________________
______________________________________________________________________________________
______________________________________________________________________________________

EDITORA BILBIOTECA
2. Según la imagen menciona las consecuencias negativas de los pirotécnicos.

MAGISTERIAL
REFLEXIONES SOBRE EL APRENDIZAJE
 ¿Lograron los estudiantes reconocer las consecuencias del uso de los pirotécnicos?
 ¿Qué dificultades se observaron durante la propuesta de recomendaciones?
 ¿Qué aprendizajes se deben reforzar?
 ¿Las estrategias, materiales y recursos resultaron adecuados para la sesión?
ÁREA: MATEMÁTICA
¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Tener listo el papelógrafo con el problema. Fotocopia - Plumones y colores. Papelotes. Lista de cotejo. Libro
las fichas de aplicación y la prueba escrita según la Matemática 5. Cuaderno de trabajo
cantidad de estudiantes.
INICIO:
 Observan un cuadro de la cantidad de toneladas de pirotecnia decomisada y el porcentaje de la
reducción de víctimas.
AÑO TONELADAS PORCENTAJE DE
DECOMISADAS REDUCCION DE
VICTIMAS (NIÑAS)
2005 7,6 0,00 %
2006 8,7 8,16 %
2007 9,2 24,48 %
2008 10,6 6,12 %
2009 8,5 46,93 %
____________________________________________________________________________________________________
V- DICIEMBRE 108
______________________________________________________________________________________________________
2010 8,2 59,18 %
2011 7,7 75,51 %
2012 6,2 81,63 %
 Responden: ¿Qué año se decomisó más cantidad de los pirotécnicos? ¿Qué año se redujo más
la cantidad de víctimas por pirotecnia? ¿Se pueden utilizar las cifras del cuadro para realizar
operaciones matemáticas? ¿Cuáles? Guiamos las respuestas para que mencionen la
multiplicación de números enteros.
 Rescatamos los saberes previos de los estudiantes a través de interrogantes: ¿Qué deben tener
en cuenta al multiplicar números enteros? ¿Qué propiedades tiene la multiplicación de números
enteros? ¿Qué sucede si multiplicas números enteros de signos diferentes? ¿El signo cambia el
resultado de una multiplicación?
 Se comunica el propósito de la sesión:

HOY VAN A RESOLVER EJERCICIOS CON MULTIPLICACIÓN DE NÚMEROS


ENTEROS.
 Se acuerda las normas de convivencia:
- Trabajar con el material concreto de manera ordenada.
- Comunicar y compartir la información importante.

EDITORA BILBIOTECA
DESARROLLO
Situación problemática
 Se Presenta a continuación los problema y sus respuestas en un papelote que tendrán que

MAGISTERIAL
relacionar.

(+8) x (+2) (+8) x (- 2) (-8) x (+ 2) (- 8) x (- 2)

-16 16 -16 16

(-14) x (-3) (-14) x (+3) (+14) x (+3) (+14) x (- 3)

42 -42 42 -42

Comprensión del problema


 Para ello se realiza las siguientes preguntas: ¿Lograron relacionar las respuestas? ¿Les fue
difícil? ¿Qué papel cumplieron los signos de cada cifra?
Búsqueda de estrategias
 Los estudiantes conversen en equipo, proponen las estrategias que utilizaran para la resolución
del problema planteado.
 Se orienta a los estudiantes a la aplicación de sus estrategias de resolución. Para ello se
pregunta: ¿Qué datos nos proporciona los ejercicios?, ¿Han resuelto problemas parecidos a
estos?, ¿Cómo los resolvieron?
Representación
 Incentivamos a los estudiantes a aplicar sus estrategias, analizando la ley de los signos.
Ley de signos
(+) . (+) = +
(+) . (-) = -
(-) . (+) = -
(-) . (-) = +
____________________________________________________________________________________________________
V- DICIEMBRE 109
______________________________________________________________________________________________________

 Observan la posible solución a los problemas planteados:


(+8) x (+2)= (+8) x (-2)=
8 x 2 = +16 8 x 2 = -16
(-8) x (+2)= (-8) x (-2)=
8 x 2 = -16 8 x 2 = +16
(-14) x (-3)= (-14) x (+3)=
14 x 3 = 42 14 x 3 = -42
(+14) x (+3)= (+14) x (-3)=
14 x 3 = 42 14 x 3 = -42
 Se formaliza lo aprendido con la participación de los estudiantes.
MULTIPLICACIÓN DE NÚMEROS ENTEROS
La operación que hace corresponder a dos números enteros llamados factores un tercero
llamado producto es la multiplicación.
a x b = c Donde: a Z, bZ, cZ Factores Producto

Factores Producto
La multiplicación de números enteros cumple las mismas propiedades que en los números naturales.

EDITORA BILBIOTECA
Propiedad Expresión matemática
Clausura a  Z, b Z y a X b = c, entonces c  Z
Conmutativa axb=bxa
Asociativa (a x b) x c = a x (b x c)

MAGISTERIAL
Elemento neutro a X (+1) = (+1) X a = a
Elemento absorbente aX0=0Xa=0
Distributiva a X (b + c) = a X b + a X c
a X (b - c) = a X b –a X c
Al multiplicar dos números enteros se procede de la siguiente manera:
Ejemplos: Factores de signos
Pasos Iguales Diferentes
Si los factores son:
• Del mismo signo, el producto tendrá signo positivo. + x + = + + x - = -
• De signos diferentes, el producto tendrá signo negativo.
(+3) x (+4) = +12 (+2) x (-8) = -16
Se multiplica los valores absolutos de los factores.
3 x 4 = 12 2 x 8 = 16
- x - = + - x + = -
(-5) x (-2) = + 10 (-7) x (+3) = - 21
5 x 2 = 10 7 x 3 = 21
 Se reflexiona con los niños y las niñas respecto a los procesos y estrategias que siguieron para
resolver el problema propuesto. Formula las siguientes preguntas: ¿Cómo lo hicimos?; ¿Qué
pasos siguieron para representar resolver el problema planteado?; ¿Qué debemos tener en
cuenta para resolver potenciación de números decimales?
 Plantear otros ejercicios:
FICHA DE APLICACIÓN
1.- Resuelve cada operación.
(+4) . (-3) (+4) . (+3) (+4) . (-3) (-4) . (+3)

(+2) . (-7) (-5) . (-4) (-4) . (-6) (-7) . (+3)

____________________________________________________________________________________________________
V- DICIEMBRE 110
______________________________________________________________________________________________________

(-2) . (-8) (+4) . (+9) (-9) . (+3) (-2) . (-18)

2.- Resuelve las multiplicaciones.

a. (+5)(+4) = e. (+8) (+4) = i. (-5) (+4) = m. (-4) (+4) =


b. (-5) (-4) = f. (- 9) (- 8) = j. (+2) (-7) = n. (-5) (+7) =
c. (+3) (+7) = g. (+5) (+6) = k. (-5) (+5) = ñ. (+9) (-7) =
d- (-9) (-6) = h. (-7) (-7) = l. (+3) (-8) = o. (+5) (-15) =
3.- Completa los datos de la tabla.

X (-5) (-2) (-10) (-4) (-7) X (-7) (-10) (-8) 0 (+4)


(-20) 0

EDITORA BILBIOTECA
(-5) + 50 (+9)
(-12) (--7)
(-1) (+2) 0
0 (-5)

MAGISTERIAL
(-3) + 21 (+3)
(-9) (-4)
4.- Completa el factor que falta en las multiplicaciones.

a) ( ) (- 3) = + 18 ( +e)36) ( ) = - 72 i)( ) (- 2) = - 12

b) ( + 5) ( ) = - 20 ( f) ) (- 8) = + 24 j)( ) (- 2) = + 2

c) ( + 9) ( ) = + 72 (g)
- 11 ) ( ) = - 99 k)
(- 11) ( ) = + 66

d) (-4)( ) = + 16 h) ( ) (- 10) = - 30 l) ( ) (- 4) = + 12

CIERRE
 Realizamos las siguientes preguntas sobre las actividades desarrolladas durante la sesión: ¿Qué
aprendieron hoy?, ¿Fue sencillo?, ¿Qué dificultades tuvieron?, ¿Pudieron superarlas de forma
individual o de forma grupal?; ¿Qué debemos tener en cuenta para resolver ejercicios con
potenciación de números decimales?; ¿En qué situaciones de la vida cotidiana hemos utilizado
potenciación de números decimales?
 Como actividad de extensión se pide a los estudiantes resuelvan los siguientes ejercicios.
ACTIVIDADES
1.- Efectúa los siguientes productos.
a) (+4) x (+5) =
b) (-5) x (-7) =
c) (-3) x (+5) =

____________________________________________________________________________________________________
V- DICIEMBRE 111
______________________________________________________________________________________________________
d) (+5) x (- 8) =
e) (-9) x (-5) =
f) (-1) x (-2) x (-7) =
g) (-3) x (-3) x (-3) =
2.- Calcula las siguientes operaciones:
a) (-5) x (-6) x (-8) x (-1)
b) (-8) x (-1) + (-3) x (+6) - (-3)
c) (-4 + 8 -1) x (-3) - (-6) (-2 + 9)
d) 18 x -3 + (-5) – (-9) + (5) x (-4)]

 Se evalúa a través de una ficha de evaluación.


PRUEBA ESCRITA
1.- Escribe en el recuadro el número correspondiente.
a. -4 x -8 = d. (+3) (-3) = g. ________ x -8 = - 24

b. +5 x +2 = e. (-2) (+6) = h. _______x -1 = -5

c. -7 x +8 = f. -21 x ___ = +42 i. – 12 x ______ = + 12

EDITORA BILBIOTECA
2.- Completa los cuadros.
Operación Propiedad Operación Propiedad

MAGISTERIAL
(-3 x +4) x +6 = -3 x (+4 x +6) -12 X ____ = 0 E. absorbente

(-12)(+18) = (+18)(-12) (-14)(+9) = -126 Clausura

-6 x +1 = -6 +3 x [(-8) - (+6)] = Distributiva

+28 X 0 = 0 (-8 X +2) x -7 = -8 X (+2 X Asociativa


-7)

-4 x [(-2) + (+5)] = (-4)(-2) + (-4)(+5) __________= (-4)(-19) Conmutativa

- 7 x -6 = +42 +9 x _____= +9 E neutro

3.- Aplica la propiedad distributiva para resolver las siguientes operaciones.


Operación Descomposición de Propiedad distributiva Respuesta
factores

(+ 18)(-99) + 1 8 [(-1 00) + (+1)] (+18)(-100) + (+18)(+1) -1 782

(+6)(-9) +6 x [(-10) + (+1)]

(+8)(+9)

(+101)(-5)

(-27)(-1 001)

4.- Resuelve las siguientes operaciones.

a. (-2)(-3)(+4)(-2)(-1)(+3)(-5) = -720
5 factores negativos => Producto negativo
____________________________________________________________________________________________________
V- DICIEMBRE 112
______________________________________________________________________________________________________
b. (+5)(-2)(-7)(+3)(-1)(-4) = 840
4 factores negativos => Producto positivo

c. (-6)(+8)(-2)(-1)(-5) =

d. (+7)(-2)(+3)(-4)(+2)(+3) =

e. (-2)(+2)(-2)(+2)(-2)(-2)(-2) =

f. (-3)(+2)(-1)(-2)(+3)(-1)(-4)(+4) =

REFLEXIONES SOBRE EL APRENDIZAJE


 ¿Lograron los estudiantes resolver las multiplicaciones con números enteros?
 ¿Qué dificultades se observaron durante la resolución de los ejercicios?
 ¿Se cumplió el propósito de la sesión?

EDITORA BILBIOTECA
MAGISTERIAL

____________________________________________________________________________________________________
V- DICIEMBRE 113
______________________________________________________________________________________________________
SEMANA Nº 2
“FESTEJEMOS EN NACIMIENTO DE JESÚS”
Día Nro. 8
“INTERPRETAMOS REFRANES”
• PROPÓSITOS DE APRENDIZAJE
Evidencias de
Competencia / Campo
Área Desempeños aprendizaje /
Capacidad temático
Inst. de valoración
C 1. Se comunica Refranes y - Explica el tema y el propósito - Interpreta el
oralmente en su lengua sentencias. comunicativo del texto oral. significado de los
materna. Distingue lo relevante de lo refranes planteados.
1.2. Infiere e interpreta complementario clasificando y - Lista de cotejos
información del texto oral. sintetizando la información.
Establece conclusiones sobre
lo comprendido; para ello,
vincula el texto con su

EDITORA BILBIOTECA
experiencia y el contexto
sociocultural en que se
desenvuelve.
M 1. Resuelve problemas División de - Establece relaciones entre - Establece

MAGISTERIAL
de cantidad. números datos y una o más acciones de relaciones entre los
1.1. Traduce cantidades a enteros agregar, quitar, comparar, datos para resolver
expresiones numéricas. igualar, reiterar, agrupar y divisiones con
repartir cantidades, para números enteros.
transformarlas en expresiones - Prueba escrita.
numéricas (modelo) de adición,
sustracción, multiplicación y
división con números
naturales, y de adición y
sustracción con decimales.

ÁREA: COMUNICACIÓN
¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Tener lista la imagen inicial. Tener copias de las - Carteles. Cuadernos, libros de comunicación 5°. Ficha
fichas de aplicación según la cantidad de estudiantes. de evaluación. Diccionario.
INICIO:
 Presentamos carteles con refranes y mencionan su significado:

No dejes para mañana


lo que puedas hacer Nadie aprende por Se cosecha lo que se
hoy cabeza ajena siembra

 Anotamos en la pizarra las respuestas de los estudiantes.

____________________________________________________________________________________________________
V- DICIEMBRE 114
______________________________________________________________________________________________________
 Rescatamos saberes previos: ¿Qué tipo de texto es el presentado? ¿Qué es un refrán? ¿Cuándo
se utilizan los refranes? ¿Quiénes utilizan los refranes? ¿Qué tipo de información nos
proporcionan los refranes?
 Se comunica el propósito de la sesión:

HOY INTERPRETARÁN REFRANES.


 Se acuerda las normas de convivencia:
- Levantar la mano para opinar.
- Guardar silencio cuando otra persona habla.
DESARROLLO
Antes de la interpretación de los refranes
 Por medio de intervenciones se pide que mencionen el concepto de mensaje. Pueden utilizar el
diccionario para dicha actividad.
Un mensaje es un recado que una persona envía a otra. El concepto también se utiliza para
nombrar al conjunto de los signos símbolos o señales que son objeto de una comunicación. El
mensaje por lo tanto es el contenido de la comunicación.
 Se explica que existen mensajes explícitos e implícitos que envían distinta información.

EDITORA BILBIOTECA
La palabra explícito significa que expresa claramente una cosa; lo que leemos es lo que
significa no hay nada oculto. En cambio la palabra implícito significa que lo que leemos puede
tener un significado alterno algo que no se expresa claramente.
 Hacemos del conocimiento de los estudiantes que los refranes poseen significado explicito e

MAGISTERIAL
implícito incluido.
Significado explícito del refrán.
El significado explícito es el menos importante a la hora de hablar de refranes. Se refiere al
significado literal, lo que decimos o leemos es lo que significa tal cual. Por ejemplo, cuando
decimos el refrán "camarón que se duerme, se lo lleva la corriente", el significado explícito es, que
cuando un camarón está despierto, este se sujeta bien al fondo del río, pero cuando se descuida o
se duerme, entonces, la corriente lo arrastra. El significado explícito es el primer pensamiento que
dibujamos en nuestra mente al escuchar el refrán.
Significado implícito del refrán.
El significado implícito es el más importante a la hora de hablar de refranes. Se refiere al
significado alterno, u oculto, que encierra la oración. El significado implícito viene después del
explícito, una vez que ya hemos imaginado la escena, viene entonces la reflexión para comprender
la enseñanza o moraleja que acompaña a ese refrán. En el mismo ejemplo de "camarón que se
duerme, se lo lleva la corriente", el significado implícito es, que si una persona se descuida (se
"duerme"), puede verse de repente, envuelto en un problema o en un imprevisto ("arrastrado por la
corriente").
 Proporcionamos información sobre el tema de los refranes:
El refrán es una frase, u oración de uso popular que contiene algún consejo, reflexión o
moraleja sobre asuntos cotidianos de la vida diaria de las personas.
Los refranes se transmiten de forma hablada, de persona a persona, y de generación en
generación, y su propósito es dar enseñanzas y consejos acerca del comportamiento de los
seres humanos.
Su uso en las conversaciones diarias es muy frecuente, debido a sus características: son
oraciones cortas, que hablan de algo cotidiano, muchas veces dichas de forma jocosa, y que
tienen rima; y todo esto hace que sean expresiones fáciles de recordar.
CARACTERÍSTICAS DEL REFRÁN:
 Su propósito es transmitir una enseñanza o una reflexión.
 Son frases u oraciones cortas.
 Su origen es a partir de la experiencia colectiva a lo largo del tiempo.
____________________________________________________________________________________________________
V- DICIEMBRE 115
______________________________________________________________________________________________________
 Por lo general, son observaciones de autor desconocido, es decir, son anónimos.
 Su uso más común es en las conversaciones cotidianas.
 Suele tratar temas cotidianos, del modo de vida del ser humano y sus valores. Para esto
hace comparaciones fáciles de imaginar, que van desde simples observaciones en la
naturaleza, pasando por oficios como la agricultura o la herrería, hasta cuestiones más
filosóficas o espirituales.
 Se han transmitido oralmente, de persona a persona y de generación a generación.
 Por lo general, en su estructura encontramos una relación de "causa y efecto", o "causa y
consecuencia".
 La estructura del refrán suele emplear algunos recursos literarios como la metáfora, la
analogía, la rima, y los juegos de palabras.

Durante la interpretación de los refranes


 Observan ejemplos de refranes.
 A las diez, en la cama estés: Los niños tiene que acostarse pronto para ir al colegio
descansados.
 En boca cerrada no entran moscas: En determinados momentos es mejor estar callado
antes de meter la pata.
 Zapatero a tus zapatos: No hay que meterse donde no te llaman.
 Barriga vacía, no tiene alegría: Comiendo bien se ven las cosas de distinto modo.

EDITORA BILBIOTECA
 Abril, aguas mil: Abril es un mes con muchas lluvias.
 Tras la leche, nada eches: Después de tomar leche es mejor no beber nada más para
evitar que se corte.
 El que tiene boca se equivoca: No hay que tener miedo a decir algo equivocadamente.

MAGISTERIAL
 El que se pica ajos come: La persona que se enfada tienes dos opciones: o desenfadarse
o seguir enfadado.
 De tal palo tal astilla: Los hijos suelen parecerse a sus padres.
 A quien madruga Dios le ayuda: Todo esfuerzo tiene su recompensa.
 Quien tiene un amigo tiene un tesoro: La amistad es muy importante y debemos
aprender a cuidarla y valorarla.
 Perro ladrador, poco mordedor: Las personas con mucho pronto suelen ser las más
inofensivas.
 A caballo regalado no le mires el dentado: Lo importante de los regalos es su valor
sentimental.
 El que calla otorga: A veces el que calla es porque esconde algo.
 Preguntando se llega a Roma: Cuando no se sabe algo lo mejor es preguntar.
 A mal tiempo, buena cara: Siempre hay que ser positivo ante las adversidades.
 Quien mucho abarca, poco aprieta: No hay que ser avaricioso. Es mejor cuidar y
mantener lo que uno tiene.
 Más vale maña que fuerza: En la vida es más importante ser astuto que fuerte.
 No dejes para mañana lo que puedas hacer hoy: La pereza no es la mejor compañía en
la vida.
Después de la interpretación de refranes
 Forman parejas de trabajo y resuelven las siguientes actividades.

____________________________________________________________________________________________________
V- DICIEMBRE 116
______________________________________________________________________________________________________
FICHA DE APLICACIÓN
1. Relaciona ambas columnas.
No por mucho madrugar → ■-mal acaba.
La avaricia → ■-sin saber una cosa más.
La buena lectura → ■-amanece más temprano
Lo que mal empieza → ■-rompe el saco.
Perro ladrador → ■-oídos sordos.
A palabras necias → ■-distrae, enseña y cura.
A la cama no te irás → ■-poco mordedor.
2. Relaciona las columnas y escribe correctamente el refrán.
Marzo, marzuelo no hay nada escrito

A mal tiempo algo le cuesta

En abril se queda con la mejor parte

Agua que no has de beber no le mires el diente

EDITORA BILBIOTECA
A caballo regalado se adquiere la ciencia

Cada oveja déjala correr

Con el tiempo y la paciencia aguas mil

Sobre gustos
MAGISTERIAL
El que algo quiere buena cara

hace un día malo y otro bueno.

El que parte y reparte con su pareja

 Se pide voluntarios para comunicar sus respuestas. Corrigen si fuese necesario.


 Luego se presentan algunos refranes para que los estudiantes mencionen los el significado de
cada uno.
 Por ejemplo:
A quien madruga, Dios lo ayuda
Quien pone una idea o una actividad a funcionar adelantándose a otros, lleva ya una gran ventaja.
Cuando tengas una nueva y buena idea, revísala bien, y no tardes en ponerla en funcionamiento.
Al mal tiempo buena cara
Cuando las circunstancias parecieran estar en contra de uno, no hay que rendirse, sino poner
optimismo, tomar las debidas precauciones, y avanzar hacia adelante.
Nunca te dejes abatir por momentos de preocupación. Afróntalos con esfuerzo, esperanza y dignidad.
El hábito no hace al monje
Por más que uno se esfuerce en dar la apariencia de algo que no se es, nunca se llegará a serlo
realmente.
Siempre aparenta ser únicamente lo que verdaderamente eres, no lo que no eres.
Hacer de tripas corazón
Es cuando se llena una necesidad contando con pocos recursos. No todo lo que parece inservible lo
es en realidad. Un ejemplo es el reciclaje de lo que se ha usado una o más veces.
No dejes para mañana lo que puedes hacer hoy
No es conveniente dejar para otro día lo que bien podemos empezar a hacer hoy. Para mañana no
sabemos que nos depara el día.
Si tienes un deber entre manos, y tienes el tiempo y las condiciones para iniciarlo hoy mismo,
energiza tu voluntad y manos a la obra.
Nunca digas: "De esta agua no he de beber"
Muchas veces por creer que lo tenemos todo, despreciamos cosas que en algún momento podrían
____________________________________________________________________________________________________
V- DICIEMBRE 117
______________________________________________________________________________________________________
sernos indispensables.
Nunca menosprecies lo que te parece insignificante, no vaya a ser que un día lo necesites
imperiosamente.
Tener la sartén por el mango
Muchas veces por creer que lo tenemos todo, despreciamos cosas que en algún momento podrían
sernos indispensables.
Nunca menosprecies lo que te parece insignificante, no vaya a ser que un día lo necesites
imperiosamente.
Yerba mala nunca muere
Cuando una persona ha adquirido malos hábitos, le es muy difícil abandonarlos.
Nunca tengas amistad con personas de malos hábitos, pues de seguro te contagiarán. Pide siempre
el buen consejo de tus padres.
Zapatero a tus zapatos
Se dice de cuando una persona trata de opinar o inmiscuirse en algo que le es totalmente
desconocido.
Siempre cuídate de estar debidamente preparado en lo que vayas a opinar o actuar.
Cuando hay hambre no hay pan duro
Cuando se está necesitado de algo, la más sencilla ayuda debe ser siempre bienvenida.
Acepta con cariño y humildad cualquier buena ayuda que te brinden cuando estés en alguna
necesidad.
CIERRE

EDITORA BILBIOTECA
 Reflexionan sobre sus aprendizajes a través de preguntas: ¿Qué aprendimos hoy?; ¿Leer los
ejemplos de carta y solicitud les ayudó en la planificación de sus textos?; ¿Por qué es importante
la planificación? ¿Por qué?
 Como actividad de extensión: Los estudiantes resuelven algunas actividades relacionadas a los

MAGISTERIAL
refranes.
ACTIVIDADES
1. Ordena las frases:
1. Cuando se habla o murmura de algo siempre hay algún fundamento. Suena río el agua Cuando
lleva.

2. Cuando alguien tiene mucha hambre no es muy exigente a la hora de comer. duro, hambre A
no pan buen hay

3. No es aconsejable posponer cosas. para mañana No puedas lo dejes que hoy hacer

4. El que quiere hacer demasiadas cosas, finalmente no las puede acabar todas. Quien aprieta,
abarca poco mucho

5. Nadie puede asegurar que no cometerá el error que otros han cometido. beberé no No digas
esta agua de

2. En la siguiente tabla hay escondido 6 refranes, empezando por la casilla coloreada y


moviéndote como si fueras un caballo de ajedrez, descubre y colorea cuales son los
refranes que hemos escondido.

Dame no A palo En

____________________________________________________________________________________________________
V- DICIEMBRE 118
______________________________________________________________________________________________________
madera bollo boca cien caballo

cerrada pan entran rey perro


casa santo vivo regalado árbol
diego muerto y moscas ladrador
calma diré vestir juntan no
donde dime mordedor te si
de gato se le leña
tonto mal y careces ellos

tempestad que y clavos mires


tiempo presume palo Martín astilla
s
ahoga cría calle el san
que tal cerdo tal aprieta

EDITORA BILBIOTECA los

De
años

diablo
de

Dios
mosquito diente

león Dime

MAGISTERIAL
 Se evalúa a través de una prueba escrita.
PRUEBA ESCRITA
1. Relaciona los siguientes refranes y escríbelos correctamente.
a. Ojos que no ven… 1. …que por bien no venga
b. Muerto el perro… 2. …corazón que no siente.
c. Más vale pájaro en mano… 3. …se acabó la rabia.
d. Ante se coge al mentiroso… 4. …que ciento volando
e. No hay mal… 5. …que al cojo.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
2. En cada uno de los siguientes refranes hay algún fallo, descúbrelo y corrígelo.
Quién fue a Sevilla perdió su vida.
______________________________________________________________________________
No hay cal que cien años dure.
______________________________________________________________________________
Quién mucho aparca, poco aprieta.
______________________________________________________________________________
Donde las dan, las tocan
______________________________________________________________________________
Cría cuernos y te sacaran los ojos.
______________________________________________________________________________
Dios los cría y ellos se untan
______________________________________________________________________________

____________________________________________________________________________________________________
V- DICIEMBRE 119
______________________________________________________________________________________________________
Agua que no has de beber, déjala cocer
______________________________________________________________________________

REFLEXIONES SOBRE EL APRENDIZAJE


 ¿Lograron los estudiantes interpretar los refranes?
 ¿Qué dificultades se observaron durante la resolución de la ficha de aplicación?
 ¿Qué estrategias podemos aplicar para mejorar el aprendizaje de mis estudiantes?
 ¿Los recursos y materiales fueron relevantes para el desarrollo de la sesión?

ÁREA: MATEMÁTICA
¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Preparar el juego a utilizar - Plumones y colores. Papelotes. Lista de cotejo. Libro
- ener listo el papelógrafo con el problema. Fotocopia Matemática 5. Cuaderno de trabajo

EDITORA BILBIOTECA
las fichas de aplicación y la prueba escrita según la
cantidad de estudiantes.
INICIO:

MAGISTERIAL
 Formamos grupos de tres estudiantes y los invitamos a participar en el juego matemático: 16
embarcaciones.
JUEGO: 16 EMBARCACIONES
En este ejercicio deberás relacionar los números:
-2 3 -4

Forma grupos de tres compañeros. Este juego consiste en reunir una flota de barcos lo más grande
posible. Para obtener un barco, deberás usar los números -2, 3 y -4; las 4 operaciones matemáticas; y
poner paréntesis, con el fin de obtener los resultados expresados en cada barco. A medida que se alcancen
los resultados, estos no se pueden repetir nuevamente. Cada alumno tiene una oportunidad en cada turno
para ganar un barco. El juego termina cuando se haya alcanzado todos los resultados. Gana el que al final
del juego, obtiene más barcos en su flota.
Ejemplo: (-2)  (3) + (-4) = -6 – 4 = -10 (Se ha ganado el barco que tiene el N° 10).

-6
20
-5 1 -9

____________________________________________________________________________________________________
V- DICIEMBRE 120
- 19 + 19
______________________________________________________________________________________________________

24
-4
-3 -1

11

-10
2
-14

EDITORA BILBIOTECA
5
9

MAGISTERIAL 6

 Responden: ¿Qué operaciones matemáticas realizaron en el juego? ¿Lograron obtener los


resultados que querían? ¿Podemos utilizar la división como parte de este juego? ¿Por qué?
 Rescatamos los saberes previos de los estudiantes a través de interrogantes: ¿Cómo es la
división de números enteros? ¿Qué debemos tener en cuenta al dividir números enteros?
¿Cuáles son los pasos para dividir números enteros? ¿El signo cambia el resultado de una
división?
 Se comunica el propósito de la sesión:

HOY VAN A RESOLVER EJERCICIOS CON DIVISIÓN DE NÚMEROS ENTEROS.


 Se acuerda las normas de convivencia:
- Trabajar con el material concreto de manera ordenada.
- Comunicar y compartir la información importante.
DESARROLLO
Situación problemática
 Se Presenta a continuación los problemas y sus respuestas en un papelote que tendrán que
relacionar.

(+ 12)  (+ 3) (- 38)  (+ 2)

+4 -4

(+ 18)  ( + 2) ( - 27)  (- 3)
____________________________________________________________________________________________________
+9 -9 V- DICIEMBRE 121
______________________________________________________________________________________________________

-9 +9
Comprensión del problema
 Para ello realiza las siguientes preguntas: ¿Lograron relacionar las respuestas? ¿Les fue difícil?
¿Qué papel cumplieron los signos de cada cifra?
Búsqueda de estrategias
 Permite que los estudiantes conversen en equipo, se organicen y propongan de acuerdo en las
estrategias que utilizaran para la resolución del problema.
 Se orienta a los estudiantes la aplicación de sus estrategias de resolución. Para ello pregunta:
¿Qué datos nos proporciona los ejercicios?, ¿Han resuelto problemas parecidos a estos?,
¿Cómo los resolvieron?
Representación
 Incentivamos a los estudiantes a aplicar sus estrategias, analizando la ley de los signos.
Ley de signos
(+) . (+) = +
(+) . (-) = -
(-) . (+) = -

EDITORA BILBIOTECA
(-) . (-) = +
 Observan la posible solución a los problemas planteados:
(+ 12)  (+ 3) = (- 38)  (+ 2) =
12  3 = +4 38  2 = -19

MAGISTERIAL
(+ 18)  ( + 2) =
18  2 = +9
 Se formaliza lo aprendido con la participación de los estudiantes.
( - 27)  (- 3) =
27 x 3 = +9

DIVISIÓN DE NUMEROS ENTEROS


Es la operación que hace corresponder a dos números enteros llamados dividendo (D) y divisor
(d) un tercero llamado cociente (q).
Dd=q Cociente Donde: D  Z, d  Z, q  Z con d = 0
Divisor Además, se cumple que: D = q X d
Dividendo
•Cuando la división es inexacta presenta un residuo (r 0), con el cual se cumple que: D = q X d + r
• Al dividir dos números enteros se procede de la siguiente manera:
Ejemplos: dividendo y divisor de signos
Pasos
Iguales Diferentes
Si el dividendo y el divisor son: +  + = + +  - = -
• Del mismo signo, el cociente es • + 12  +3 = + 4 • + 8 -2=-4
positivo. 12  3 = 4 8  +=4
• De signos diferentes, el cociente es
-  - = + -  + = -
negativo.
Divide los valores absolutos de los • -40  -8 = +5 • (-15)  (+3) = - 5
términos. 40  8 = 5 15  3 =5
 Se reflexiona con los niños y las niñas respecto a los procesos y estrategias que siguieron para
resolver el problema propuesto. Formula las siguientes preguntas: ¿Cómo lo hicimos?; ¿Qué
pasos siguieron para representar resolver el problema planteado?; ¿Qué debemos tener en
cuenta para resolver división de números enteros?
 Se plantea otros ejercicios:
FICHA DE APLICACIÓN
____________________________________________________________________________________________________
V- DICIEMBRE 122
______________________________________________________________________________________________________
1.- Resuelve las siguientes divisiones
a. (+ 120)  (+4) = f. (-32)  (-8) =
b. (-42)  (+7) = g. (-50)  (+25) =
c. (+27)  (-9) = h. (+300) (-10) =
d. (-81)  (-4) = i. (+240)  (+60) =
e. (+ 100)  (-4) = j. (+ 580)  (+ 4) =
2.- Completa la tabla.
 (- 10) (- 4) (- 1) (- 8) (8 2)
( - 40)
(- 80) + 80
(- 120)
(- 160)
(- 200)
(- 240)
(- 320)

EDITORA BILBIOTECA
3.- Efectúa las siguientes divisiones:
a) (-12)  (-6) = e) (- 36)  (+ 9) =
b) (- 24)  (-6) = f) (- 50)  (- 10) =

MAGISTERIAL
c) (-28)  (+ 7) = g) (+ 55)  (-11) =
d) (+ 55)  (- 11) = h) (- 60)  (+ 12) =
4.- Calcula las siguientes operaciones.
a) (+ 28)  (-4) - (5) x (-2) c) (81)  (- 9) x 4 -(- 5) x (- 1) + (10)
b) (- 45)  (- 9) + (12) x (- 5) + (61) d) (- 244)  (-4) + (- 3) x (12)

5.- Completa el siguiente diagrama.

7 x-
 X
8
3

-16

-2
Resuelve las siguientes situaciones.
a. De acuerdo con la figura, calcula la altura a la que vuela el avión y la profundidad en la que
avanza el submarino.

____________________________________________________________________________________________________
V- DICIEMBRE 123
______________________________________________________________________________________________________

b. Para formar una empresa, cinco socios aportan S/. 35 000 cada uno. Si deben compartir los
ingresos y los gastos; y en un año los ingresos fueron de S/. 14 000 y los gastos de S/. 5 500,
¿cuál es la parte de los ingresos y la parte de los gastos que le corresponde a cada uno? ¿Con
qué cantidad de dinero cuenta ahora cada uno?
c. Ana tiene 80 min para hacer llamadas telefónicas. Los domingos cada llamada de 10 min cuesta S/. 2; de lunes a viernes el
minuto cuesta S/. 1; y los sábados paga por cada 5 min que habla, S/. 3. Además, por cada 10 min que habla por teléfono
le descuentan S/. 2 y a los 14 días se terminan los minutos (según el registro en la tabla mostrada). ¿Cuánto deberá pagar
en total?
Días L M M J V S D L M M J V S D
Min 3 3 4 4 5 10 10 3 4 4 7 10 10

CIERRE

EDITORA BILBIOTECA
 Realizamos las siguientes preguntas sobre las actividades desarrolladas durante la sesión: ¿Qué
aprendieron hoy?, ¿Fue sencillo?, ¿Qué dificultades tuvieron?, ¿Pudieron superarlas de forma
individual o de forma grupal?; ¿Qué debemos tener en cuenta para resolver ejercicios con
división de números enteros?; ¿En qué situaciones de la vida cotidiana hemos utilizado división

MAGISTERIAL
de números enteros?
 Felicítalos por el trabajo realizado y los logros obtenidos.
 Como actividad de extensión se pide a los estudiantes resuelvan los siguientes ejercicios.
ACTIVIDADES
1. Resuelve las siguientes divisiones exactas de números enteros:
a) (-40)  (-4)
b) (-15)  (-3)
c) (-32)  (-4)
d) (-21)  (-3)
e) (-60)  (-12)
f) (-18)  (+6)
g) (+15)  (+3)
h) (-48)  (+12)
i) (-75)  (+5)
2. En cada caso, halla el valor de X
(-10) · x = +20 x = +20 = -2
-10
(-12) · x = - 48 x=
x · (+8) = -72 x=
x · (-9) = -81 x=
x · (-13) = -39 x=

3 Observa el ejemplo resuelto y calcula de este modo los restantes.


(-3) · (-8) = +24 = -12 (+8) · (-9) =
(-2) -2 (-3)
____________________________________________________________________________________________________
V- DICIEMBRE 124
______________________________________________________________________________________________________

(+4) · (-5) = (+12) · (-4) =


(+2) (+3)

(-8) · (-5) = (-15) · (-6) =


(-4) (-5)

(+6) · (-9) = (-14) · (-3) =


(-3) (-7)

(-10) · (-5) = (+16) · (-2) =


(-2) (+8)
4. Observa el ejemplo resuelto y calcula de este modo los restantes.
[(-2) · (-4)] + [(-3) · (-6)] = (+8) + (+18) = +26 = -2
(-13) (-13) -13

EDITORA BILBIOTECA
[(-3) · (+8)] + [(-5) · (+3)] =
(-13)

[(+4) · (-5)] + [(-6) · (-3)] =

MAGISTERIAL
(+19)

[(-8) · (-4)] + [(+8) · (-6)] =


(-10)

[(-9) · (-3)] + [(-9) · (-8)] =


(+11)

[(+3) · (-8)] + [(-4) · (-10)] =


(-8)

[(-4) · (+9)] + [(-11) · (+2)] =


(-2)
 Se evalúa a través de una ficha de evaluación.
PRUEBA ESCRITA
1.- Efectúa cada división, luego indica qué alteración sufre el cociente en cada caso, si:
• La división es exacta:
a. En la división (-240)  (+4), se divide el dividendo entre 2. ________________________
b. En la división (-450)  (+5), el divisor se multiplica por 3. _________________________
c. En la división (-840)  (+3), el dividendo y el divisor se multiplican por 4.
_________________
• La división es inexacta:
a. En la división (+438)  (-7), se multiplica por 3 al dividendo y al divisor.
__________________
b. En la división (+ 140)  (+ l 2), se divide por 2 al dividendo y al divisor. __________________

____________________________________________________________________________________________________
V- DICIEMBRE 125
______________________________________________________________________________________________________
c. En la división (-1 674)  (+37), se multiplica por 5 al divisor. ______________________
2.- Escribe las expresiones y calcula el resultado.
Expresión literal Expresión Resultado
matemática
El triple de -15
El séxtuplo de 12, disminuido en 50
(-40) + (+5)
La mitad de -8, más -12
Dos veces el opuesto de +17, menos -16
2 (+5) - (-8)
3.- Completa los espacios para que se cumpla la igualdad.
a. (-12)  (-6) = e. (-36)  (+1) = i. ______ (-7) = -3
b. (-3)  (+1) = f. (-21)  (-7) = j. (-45)  _____= -5
c. (+28)  (-2) = g. (+81) (-27) = k. ____  (+6) = + 6
d. (+48)  (+8) = h. (-30)  (+6) = l. (-60)  _______ = -12
4.- Escribe los signos >, < o = según corresponda

EDITORA BILBIOTECA
a. (-44)  (+4)_____(+2)(-5)
b. (-90)  (+3)_____ (-26) + (-4)
c. (+28)  (-2)____ (- 112)  (-8)

MAGISTERIAL
d. (+48)  (+8) _____ (-2) (+77)  (- 11)
e. (-36)  (+1)_____ -4 x [(-5) + (-4)]
f. (-21)  (-7) ____ -224  (-7)(-32)
g. (+81)  (-27)____(-483)  (+161)
h. (+120)  (+5) ____ (+1 2)[(-5) + (+3)]
5.- Completa la tabla.
Operación Dividendo Divisor Cociente Residuo D=qXd+r
(+123) (+12)
(+165)  (-10)
(-99)  (-7)
(-24)  (-8)

REFLEXIONES SOBRE EL APRENDIZAJE


 ¿Lograron los estudiantes resolver las divisiones con números enteros?
 ¿Qué dificultades se observaron durante la resolución de los ejercicios?
 ¿Se cumplió el propósito de la sesión?

____________________________________________________________________________________________________
V- DICIEMBRE 126
______________________________________________________________________________________________________
SEMANA Nº 2
“FESTEJEMOS EL NACIMIENTO DE JESÚS”
Día Nro. 9
“PRACTICAMOS VALORES COMO LA SOLIDARIDAD”
• PROPÓSITOS DE APRENDIZAJE
Evidencias de
Competencia / Campo
Área Desempeños aprendizaje /
Capacidad temático
Inst. de valoración
PS 2. Convive y participa Valores - Muestra un trato respetuoso e - Explica la diferencia
democráticamente en la morales inclusivo con sus compañeros entre un valor y un
búsqueda del bien de aula y propone acciones antivalor y propone
común. para mejorar la convivencia a acciones de
2.1. Interactúa con todas partir de la reflexión sobre solidaridad.
las personas. conductas propias o de otros. - Prueba escrita.
Evalúa el cumplimiento de sus
deberes.

EDITORA BILBIOTECA
M 2. Resuelve problemas Analogías - Expresa, con lenguaje - Resuelve ejercicios
de regularidad, gráficas algebraico y diversas de analogías
equivalencia y cambio. representaciones, su gráficas y justifica el
2.2. Comunica su comprensión de la regla de proceso de su

MAGISTERIAL
comprensión sobre las formación de un patrón de resolución.
relaciones algebraicas. segundo orden, así como de - Prueba escrita.
los símbolos o letras en la
ecuación y de la
proporcionalidad como un
cambio constante.

ÁREA: PERSONAL SOCIAL


¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Tener las impresiones y copias de las lecturas - Papelotes y plumones. Impresiones y copias de las
escogidas. Tener fotocopia los anexos según la lecturas escogidas.
cantidad de estudiantes.
INICIO:
 Presentamos una imagen que menciona los valores y se pide a los estudiantes que mencionen
los valores que ellos practican.

 Se felicita por las intervenciones y se inicia el dialogo a partir de la siguiente pregunta: ¿Se puede
vivir sin valores?
 Se anotan las respuestas de los estudiantes en la pizarra.
____________________________________________________________________________________________________
V- DICIEMBRE 127
______________________________________________________________________________________________________
 Rescatamos los saberes previos de los estudiantes a través de las siguientes preguntas: ¿Qué
es un valor? ¿Cuáles son los tipos de valores? Si la paz es un valor ¿La violencia que es?
¿Cómo podemos llegar a convivir en completa paz? ¿Las personas que carecen de valores
podrán convivir con otras personas? ¿Por qué?
 Se comunica el propósito de la sesión:

HOY VAN A ESTABLECER LA DIFERENCIA ENTRE VALOR Y ANTIVALOR.


 Se acuerda las normas de convivencia:
- Mantener el orden y limpieza en mi aula.
- Utilizo las palabras por favor y gracias.
DESARROLLO
Problematización
 Presentamos el siguiente video: Un mundo sin valores (https://www.youtube.com/watch?
v=6yDvQ0LWyzQ)
 A través de lluvia de ideas mencionan los antivalores que observaron en el video y los escriben
en tarjetas de cartulina en grupo y lo ubican en la pizarra.
 Se plantea la pregunta a analizar: ¿Qué acciones demuestran antivalores? ¿Por qué existen los

EDITORA BILBIOTECA
antivalores?
Análisis de la información.
 De los antivalores anotados en la pizarra completaran el valor que correspondería.

MAGISTERIAL
 Para poder completar la actividad anterior observan el esquema de valores y antivalores.

 Después de observar y analizar el esquema presentado y con la ayuda del diccionario mencionan
los conceptos de valor y antivalor.
 Cotejan sus respuestas con la información proporcionada sobre los valores y antivalores. Se
realizará la lectura grupal, deteniéndose después de leer cada valor y antivalor para mencionar
ejemplos.
VALORES
Son principios que nos permiten orientar nuestro comportamiento en función a realizarnos como
personas. Algunos valores son:
Libertad: La palabra libertad designa la facultad del ser humano que le permite decidir llevar a
cabo o no una determinada acción.
Felicidad: La felicidad es un estado psicológico que pasa en un estado anímico
Honestidad: La honestidad es una cualidad humana consistente en comportarse y expresarse
con coherencia y sinceridad, y de acuerdo con los valores de verdad y justicia.

____________________________________________________________________________________________________
V- DICIEMBRE 128
______________________________________________________________________________________________________
Amor: el amor es considerado como el conjunto de sentimientos que se manifiestan entre seres
capaces de desarrollar inteligencia emocional.
Paz: La paz es generalmente definida como un estado de tranquilidad o quietud.
Respeto: Es el reconocimiento del valor inherente y los derechos innatos de los individuos y de
la sociedad
Amistad: La Amistad es una de las relaciones humanas más frecuentes. La amistad incluye
entendimiento mutuo, afecto, respeto.
Caridad: Una de las virtudes teologales, la caridad, consistente en el amor desinteresado hacia
los demás; derivados de este sentido, caridad es la práctica organizada de la prestación de
auxilio a los más necesitados.
Fidelidad: Una persona fiel o leal es aquella que se mantiene constante en sus afectos o en el
cumplimento de sus obligaciones o en la fe que uno debe a otro.
Trabajo: El trabajo es una de las principales actividades humanas y sociales.
Limpieza: Acción y efecto de limpiar.

ANTI VALORES
Son aquellos que hacen referencia al grupo de valores o actitudes que pueden ser consideradas
peligrosas o dañinas para la comunidad.
Algunos Anti valores:
Esclavitud: La esclavitud es una forma de sometimiento del hombre por el hombre que se

EDITORA BILBIOTECA
practicó desde la antigüedad del hombre.
Angustia: La angustia es un estado afectivo de carácter penoso que se caracteriza por aparecer
como reacción ante un peligro desconocido.
Arrogancia: La Arrogancia es el estado de estar convencido del derecho a situarse por encima

MAGISTERIAL
de los otros.
Odio: El odio es un sentimiento negativo, disgusto, enemistad hacia una persona, cosa.
Soberbia: La soberbia u orgullo consiste en una estima exagerada de sí mismo, o amor propio
indebido, que busca la atención y el honor.
Intolerancia: Es aquella donde el individuo quiere que solo su opinión sea escuchada y no
acepta las ideas de los demás.
Enemistad: La enemistad es la relación contraria a la amistad. Consiste en una aversión, no
necesariamente mutua, aunque sí frecuentemente, entre varias personas.
Envidia: La envidia es un sentimiento experimentado por aquel que desea intensamente algo
poseído por otro.
Ignorancia: La ignorancia es la ausencia de conocimiento. Se refiere a un "estado de
permanecer ignorante" o desinformado.
Pereza: Pereza, es la reticencia o el olvido en realizar acciones, movimientos o trabajos.
Suciedad: Acción y efecto de abandonar o abandonarse. Manchas, impurezas y falta de aseo.
 Entregamos una ficha de calificación de valores que los estudiantes deberán de completar.
SOY PERSONA
5 4 3 2 1 0 1 2 3 4 5
Servicial Egoísta
Positiva Pesimista
Sincera Hipócrita
Flexible Rígida
Relajada Tensa
Cariñosa Fría
Agradable Desagradable
Divertida Aburrida
Autoritaria Democrática
____________________________________________________________________________________________________
V- DICIEMBRE 129
______________________________________________________________________________________________________
Concentrada Distraída
Comprometida Indiferente
Respetuosa Agresiva
Responsable Irresponsable
Comprensiva Estricta
Profunda Superficial
Segura Insegura
Valiente Miedosa
Decidida Indecisa
Tolerante Intolerante
Importante Insignificante
Activa Pasiva
Conforme Inconforme

EDITORA BILBIOTECA
Constante Inconstante
Humilde Orgullosa
Prudente Imprudente

MAGISTERIAL
Creativa Rutinaria
Alegre Triste
Extrovertida Introvertida
Nota: En la escala de 0.a 5, entiéndase como máximo valor el No. 5 y mínimo el no. 0
 Pedimos voluntarios que deseen compartir sus fichas y se felicita la participación de los
voluntarios.
Toma de decisiones
 Lee una historieta sobre los valores. Sí, todos somos
iguales y por lo
Comprensión y respeto, eso es lo tanto debemos se
importante para convivir con los respetuosos.
demás y sobretodo ¿sabes qué? No
creer que uno es mejor que nadie.

 Comentan si están de acuerdo con las afirmaciones de la historieta y responden la siguiente


pregunta: ¿Por qué es importante el consenso en las decisiones del aula?
 Los estudiantes se comprometen a practicar valores en la escuela y en sus hogares.
CIERRE
 Finalizado el trabajo se realiza y completa las conclusiones con la participación de los
estudiantes.
 Se orienta la metacognición con las siguientes preguntas ¿Qué aprendimos? ¿Para qué nos es
útil lo aprendido? ¿Por qué debemos de fortalecer la práctica delos valores?
 Para finalizar escriben las conclusiones en sus cuadernos.

____________________________________________________________________________________________________
V- DICIEMBRE 130
______________________________________________________________________________________________________
 Como actividad de extensión escriben ejemplos del valor de la fraternidad que pueden practicar
en la Navidad.
 Se evalúa por medio de una prueba escrita.
PRUEBA ESCRITA
1. Completa el siguiente cuadro:
VALOR ANTIVALOR
CONCEPTO

EJEMPLO

2. Relaciona ambas columnas.


Honestidad Soberbia
Valentía Deshonestidad
Perdón Egoísmo
Humildad Cobardía
Altruismo Sabiduría

EDITORA BILBIOTECA
Sabiduría Venganza
3. Dibuja ejemplos del valor del respeto

MAGISTERIAL
REFLEXIONES SOBRE EL APRENDIZAJE
 ¿Lograron los estudiantes distinguir un valor de un antivalor?
 ¿Qué dificultades se observaron durante el trabajo en equipo de los estudiantes?
 ¿Cómo se solucionaron los conflictos durante el trabajo en equipo?
 ¿Qué aprendizajes se deben reforzar?

ÁREA: MATEMÁTICA
¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Tener listo el papelógrafo con el problema. Fotocopia - Plumones y colores. Papelotes. Lista de cotejo. Libro
las fichas de aplicación y la prueba escrita según la Matemática 5. Cuaderno de trabajo
cantidad de estudiantes.
INICIO:
 Observan y leen un afiche sobre la solidaridad en la Navidad:
" Cuando nace un niño... es el
acontecimiento más maravilloso para la
familia Entonces, Dios se manifiesta con el
milagro del amor, dándole VIDA a él y
BENDICIONES a los que lo reciben"
FE AMOR VIDA ESPERANZA
____________________________________________________________________________________________________
V- DICIEMBRE 131
______________________________________________________________________________________________________
COMPARTIR VALORES
UN GESTO DE AMOR SOLIDARIO CADA
DÍA, MEJORA NUESTRA CALIDAD DE
VIDA.
RECIBAMOS LA NAVIDAD
i Compartiendo con los niños que
menos recursos tienen!
 Preguntamos: ¿Qué referencia nos dan las imágenes del afiche?, ¿Por qué es importante
practicar la solidaridad en Navidad? ¿Qué tipo de información nos pueden proporcionar las
imágenes?
 Recoger los saberes previos mediante estas preguntas: En matemática ¿Qué son las analogías
graficas? ¿Para qué nos sirve las analogías graficas? ¿En qué momentos se hace uso de las
analogías? ¿Qué habilidades matemáticas se fortalecen con las analogías graficas?
 Se comunica el propósito de la sesión:

HOY RESUELVEN ANALOGÍAS GRÁFICAS.


 Se acuerda las normas de convivencia:
- Trabajar con el material concreto de manera ordenada.

EDITORA BILBIOTECA
- Comunicar y compartir la información importante.
DESARROLLO
Problematización

MAGISTERIAL
 Presentar el papelógrafo con el siguiente situación problemática.
Determina la figura que falta, en:

Comprensión del problema


 Responden las preguntas: ¿De qué trata la situación problemática?, ¿Qué datos nos brinda?,
¿Qué opciones nos dan?, ¿Cómo se pueden ubicar la figura que sigue?, ¿Consideran importante
seguir la secuencia?
 Organizamos a los estudiantes en grupos de tres integrantes y entrega a un papelote y 2
plumones gruesos de diferente color.
Búsqueda de estrategias
 Se promueve la solución formulando estas preguntas: ¿Han resuelto ejercicios como este?, ¿Qué
procedimiento realizarías para resolverlo?, ¿Podrías describir el ejercicio de otra forma?, ¿Cómo
lo resolverías? Se pide que ejecuten la estrategia o el procedimiento acordado en equipo.
____________________________________________________________________________________________________
V- DICIEMBRE 132
______________________________________________________________________________________________________
Representación
 Permitimos que los estudiantes conversen en equipo, se organicen y propongan de qué forma
solucionarán el ejercicio usando los materiales entregados. Se acompaña en sus construcciones
y discusiones matemáticas, que cada equipo aplique la estrategia que mejor lo ayude a
solucionar el problema.
 Orientamos a los estudiantes para que representen y presenten sus respuestas.
El procedimiento es el siguiente:
Resolvemos:
Notamos que cada figura representa un rostro, donde se combinan:
Tres tipos de “ojos”:
Tres tipos de “nariz”:
Tre tipos de “boca”:
Luego, la figura que falta esta en d.
 Se formaliza a través de la participación de los estudiantes a partir de sus ideas. Consolida las
siguientes ideas fuerza:
ANALOGÍAS DE FIGURAS
En este tipo de problemas se presentan dos figuras que guardan cierta relación entre ellas. Para solucionar estos

EDITORA BILBIOTECA
ejercicios debemos, primero, encontrar dicha relación, luego aplicamos la misma a una tercera figura, para encontrar
la cuarta.
Veamos algunos ejemplos:
Completa la siguiente analogía:

MAGISTERIAL
Observamos cómo se genera la segunda figura a partir de la primera.
Se observa que la segunda figura es la mitad de la primera y además el interior se ha sombreado.
Luego, la figura que completa la analogía es:

 Resuelven ejercicios propuestos:


FICHA DE APLICACIÓN
1. Marca la alternativa correcta.

____________________________________________________________________________________________________
V- DICIEMBRE 133
______________________________________________________________________________________________________

EDITORA BILBIOTECA
MAGISTERIAL

7. La figura I es a la figura II, como la figura III es a la figura:


____________________________________________________________________________________________________
V- DICIEMBRE 134
______________________________________________________________________________________________________

Si la figura I es a la figura II, la figura III es a la figura:

EDITORA BILBIOTECA
MAGISTERIAL

____________________________________________________________________________________________________
V- DICIEMBRE 135
______________________________________________________________________________________________________

EDITORA BILBIOTECA
MAGISTERIAL
 Se indica que mencionen las conclusiones a las que llegan respecto a cómo resolver los
ejercicios propuestos.
CIERRE
 Conversar con los estudiantes sobre lo siguiente: ¿Qué han aprendido hoy?, ¿Les gustó la
sesión?, ¿Cómo se han sentido?, ¿Trabajar en equipo los ayudó a superar dificultades?, ¿Por
qué?, ¿Para qué te sirve lo aprendido?, ¿En qué situaciones crees que podrías aplicar este
aprendizaje?, ¿Cómo lo complementarías?
 Felicitar a todos por el trabajo realizado y los logros obtenidos.
 Como actividades de extensión resuelven ejercicios con analogías graficas:
ACTIVIDADES
Determina la figura que continua en cada caso:

____________________________________________________________________________________________________
V- DICIEMBRE 136
______________________________________________________________________________________________________

3)

EDITORA BILBIOTECA
MAGISTERIAL
a) b) c) d) e)
4)

a) b) c) d) e)
5)

a) b) c) d) e)
6)

____________________________________________________________________________________________________
V- DICIEMBRE 137
______________________________________________________________________________________________________

a) b) c) d) e)

7)

@
EDITORA BILBIOTECA
MAGISTERIAL
a) b) c) d) e)

 Se evalúa a través de una prueba escrita.


PRUEBA ESCRITA
1. Encuentra la figura que continua, en:

a) b) c)

d) e)

2. Determina la figura que continua, en:

____________________________________________________________________________________________________
V- DICIEMBRE 138
______________________________________________________________________________________________________

3. Indica la figura que falta, en:

EDITORA BILBIOTECA
4. Determina la figura que continua, en:

MAGISTERIAL

5. Indica la figura que continua, en:

6. Encuentra la figura que sigue, en:

____________________________________________________________________________________________________
V- DICIEMBRE 139
______________________________________________________________________________________________________

7. Determina la figura que continua, en:

a) b) c)

d)
EDITORA BILBIOTECA
e)

MAGISTERIAL
8. ¿Cuál es la figura que falta?

9. Indica la figura que falla, en:

10. Encuentra la figura que continua:

____________________________________________________________________________________________________
V- DICIEMBRE 140
______________________________________________________________________________________________________

11. Determina la figura que continua, en:

EDITORA BILBIOTECA
MAGISTERIAL
12. ¿Cuál es la figura que continua?

REFLEXIONES SOBRE EL APRENDIZAJE


 ¿Lograron los estudiantes resolver las analogías graficas?
 ¿Qué dificultades se observaron durante la resolución de los ejercicios?
 ¿Se cumplió el propósito de la sesión?

____________________________________________________________________________________________________
V- DICIEMBRE 141
______________________________________________________________________________________________________
SEMANA Nº 2
“FESTEJEMOS EL NACIMIENTO DE JESÚS”
Día Nro. 10
“CELEBRAMOS DE MANERA RESPONSABLE”
• PROPÓSITOS DE APRENDIZAJE
Evidencias de
Competencia / Campo
Área Desempeños aprendizaje /
Capacidad temático
Inst. de valoración
CyT 3. Diseña y construye Fuegos - Determina el problema - Elaboran velups
soluciones tecnológicas artificiales tecnológico, las causas que lo como alternativa
para resolver problemas silenciosos: generan y su alternativa de tecnológicas para el
de su entorno. Los velups. solución, con base en uso de pirotécnicos
3.1. Determina una conocimientos científicos o poniendo en
alternativa de solución prácticas locales; asimismo, los práctica las medidas
tecnológica. requerimientos que debe de seguridad y
cumplir y los recursos ecoeficiencia

EDITORA BILBIOTECA
disponibles para construirla. necesarias.
3.2. Diseña la alternativa - Representa su alternativa de - Prueba escrita.
de solución tecnológica solución tecnológica con
dibujos y textos; describe sus

MAGISTERIAL
partes o etapas, la secuencia
de pasos, características de
forma, estructura y función.
Selecciona herramientas,
instrumentos y materiales
según sus propiedades físicas.
Considera el tiempo para
desarrollarla y las medidas de
seguridad necesarias, así
como medidas de
ecoeficiencia.
EF 1. Se desenvuelve de Juegos - Explora y regula su cuerpo - Participa en juegos
manera autónoma a cooperativos para dar respuesta a las cooperativos
través de su motricidad. situaciones motrices en poniendo en
1.1. Comprende su contextos lúdicos y práctica sus
cuerpo. predeportivos; así, pone en habilidades
práctica las habilidades motrices.
motrices relacionadas con la - Lista de cotejos.
carrera, el salto y los
lanzamientos.

____________________________________________________________________________________________________
V- DICIEMBRE 142
______________________________________________________________________________________________________
Evidencias de
Competencia / Campo
Área Desempeños aprendizaje /
Capacidad temático
Inst. de valoración
2. Asume una vida - Realiza actividades de
saludable. activación corporal, psicológica
2.2. Incorpora prácticas y de recuperación antes,
que mejoran su calidad durante y después de la
de vida práctica de actividad física; de
esta manera, aplica los
beneficios relacionados con la
salud y planifica dietas
saludables adaptadas a su
edad y sus recursos.

ÁREA: CIENCIA Y TECNOLOGIA


¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Preparar los materiales para cada grupo - Papel cedita, madera de bambu, goma , alambre,
- Elaborar velups de muestra vela, tijeras

EDITORA BILBIOTECA
- Prueba escrita
INICIO:
 Se presenta un cartel con la palabra: fuegos artificiales. Entregamos tarjetas para que los
estudiantes escriban palabras o frases relacionadas al cartel.

MAGISTERIAL
 Dialogamos a partir de las siguientes preguntas: ¿qué sensaciones les producen los fuegos
artificiales? ¿qué es lo que más les agrada? ¿las luces? ¿el color? ¿el sonido? ¿Si se les
presentara una opción parecida pero menos contaminante la utilizarían?
 Se rescata los saberes previos de los estudiantes: ¿Qué son los velups? ¿Qué materiales se
utilizan para su construcción? ¿los velups son amigables con el ambiente? ¿podemos utilizarlos
como opción de los fuegos artificiales?
 Se comunica el propósito de la sesión:

HOY VAN A ELABORAR VELUPS COMO OPCIÓN ANTE LOS FUEGOS


ARTIFICIALES.
 Se acuerda las normas de convivencia:
- Cuida sus materiales y la de los demás.
- Sigue las instrucciones dadas por el docente.
DESARROLLO
PLANTEAMIENTO DEL PROBLEMA
 Se presenta una noticia sobre la contaminación que genera el uso de los fuegos artificiales.
La quema de artículos pirotécnicos eleva índices de contaminación
A través de RPP Noticias, La Dirección General de Salud Ambiental (Digesa) hizo un llamado a la ciudadanía a fin
de evitar la quema de muñecos y artículos pirotécnicos en las fiestas de fin de año, para no elevar más los índices
de contaminación atmosférica.
En el marco de la campaña "Aire Limpio, Más Vida", el ingeniero Francisco Fuentes Paredes, Coordinador de la
Dirección de Ecología y Protección del Medio Ambiente de Digesa, afirmó que durante los festejos de fin de año se
incrementa la contaminación, llegando en algunos casos y lugares donde la atmósfera se encuentra saturada
con partículas pm10.
____________________________________________________________________________________________________
V- DICIEMBRE 143
______________________________________________________________________________________________________
A esto se suma, la gran cantidad de residuos sólidos que quedan en las calles,
muchos de ellos plásticos y otros materiales de difícil eliminación en el medio
ambiente y que dados en un día feriado son muy difíciles de ser recogidos por las
autoridades municipales.
Fuentes Paredes alertó que esta situación resulta perjudicial, principalmente en
personas que sufren de enfermedades respiratorias; es por ello que invitó a la
ciudadanía a conservar una buena calidad del aire absteniéndose, en lo posible, de
realizar estas prácticas que al final ponen en riesgo la salud.
Riesgos
Al quemarse llantas y plásticos, podrían generarse materiales altamente dañinos como las Dioxinas y Furanos,
incrementando la concentración de material particulado en el aire y dado su alto grado de combustibilidad podrían
originar incendios difíciles de controlar.
Por otro lado, los fuegos artificiales, cohetes y demás artículos de pirotecnia, además de generar contaminación
ambiental por material particulado, gases de combustión y pólvora, son un peligro al ser inadecuadamente
utilizados, ya que el riesgo de accidentes, especialmente, aquellos que comprometen a niños son elevados en esta
temporada.
 Responden a interrogantes: Según la noticia ¿Cuánto contamina los fuegos artificiales al medio
ambiente? ¿Es beneficioso o perjudicial? ¿Qué opciones podemos proponer para disminuir esta
acción?

EDITORA BILBIOTECA
Planteamiento de soluciones
 Entregamos tarjetas a los estudiantes y solicitamos que escriban los pasos que deberían se
seguís para resolver al problema tecnológico planteado.
 Con las tarjetas de los estudiantes completan el cuadro de planificación:

MAGISTERIAL
Actividades Responsables Fechas probables
Buscar información
Reunir los materiales
Diseñar el prototipo
Elabora el prototipo
Validar el prototipo
Comunicar nuestro resultados

 Invitamos a los estudiantes a buscar información sobre los velups.


VELUPS
Es la alternativa ecológica a los fuegos artificiales porque los Velups son lámparas de papel elaboradas con
papel de arroz reciclado, cera y bambú y no contienen pólvora. Son 100% biodegradable.
¿CÓMO FUNCIONAN? las instrucciones son muy básicas y detalladas. Tan sólo se enciende una vela que
está en el centro y se suelta hacia arriba…. El espectáculo es hipnotizador regalándo a los allí presentes
sensaciones inolvidables de belleza única.
Pero ¿dónde nace esta alternativa mágica?
Tienen su origen en Asia donde se utilizan desde hace cientos de años en las fechas señaladas como las
Navidades.
Según el folklore popular, eran elementos que alejaban los malos espíritus y traían la fortuna y la buena
suerte y ahora en la actualidad, en nuestro país, podemos acceder a este espectáculo hipnotizador en
algunos festivales y otros eventos.
Diseño y construcción del prototipo
 Se forman grupos de trabajo y se les entrega cada grupo un velups para que lo observen,
manipulen y analicen.
 Responden a las interrogantes: ¿De qué materiales están elaborados? ¿Cuál es su estructura?
¿Qué pasos deberían seguir para su construcción?
 Presentamos un cuadro resumen que ayude a sistematizar las preguntas planteadas.
Materiales Estructura Pasos a seguir
____________________________________________________________________________________________________
V- DICIEMBRE 144
______________________________________________________________________________________________________

 Solicitamos algunos voluntarios para que compartan sus respuestas.


 Luego de la socialización se presenta un papelografo con los materiales y pasos a seguir para la
construcción de los velups.
Materiales
4 hojas de papel de seda blanco
4 hojas de papel de seda azul
Spray ignifugo para rociar el papel
Barillas de bambú (4 de unos 30 cm)
Papel de calco
Lápiz
Tijeras
Pegamento blanco
Alambre de floristería (el de color verde)
Pasos a seguir para la construcción de los velups
1 – Colgar el papel azul que estará en la parte más cercana a la llama con pinzas en un tendedero rociar
con el spray ignifugo. Dejar secar. No rociar las esquinas.

EDITORA BILBIOTECA
2- Hacer el patrón para lo que será la linterna. Con el papel de calco puedes dibujarlo el patrón debe ser de
101 cm de largo por 30.48 cm en la base
3- Pegar cada hoja de papel de seda azul con una hoja de papel de seda banco a lo largo de los bordes.
Dejar secar

MAGISTERIAL
4- Cortar un panel de la linterna del papel que hemos pegado anteriormente (haremos 4) y luego se van
uniendo entre si con pegamento.
5- Se pegan los papeles entre si a los lados, nos aseguramos que la parte superior está sellado en los
extremos y que dejaremos la parte de abajo abierta como una especie de bolsa. Dejamos que se seque.
6- Hacer con el alambre una especie de aro de unos 25
cm. Sobre este aro irán las varillas de bambú en forma
de X. Se introduce por la parte inferior y se fija el aro
con pegamento.
7- Se cortan dos trozos de alambre más largos que el
diámetro que la parte inferior se ponen en entre las
varillas que hemos formado con bambú.
8- Ahora en lugar de vela ponemos una bola de algodón
bien húmeda de alcohol y la fijamos bien al centro de la
cruceta con los alambres. Se enciende y ya está listo
para volar.
 Se entregan los materiales y se indica a los estudiantes que inicien la construcción de sus velups.
Validación del prototipo
1. Dialoguen con su profesor o profesora sobre el impacto que tuvo su prototipo.
a. ¿El prototipo elaborado tuvo el resultado deseado? ¿Por qué?
b. ¿Qué dificultades se presentaron al elaborar el prototipo?
c. ¿Hay otras formas de comprobar sus hipótesis? ¿Cuáles?
2. Dibujen los pasos que siguieron para elaborar su prototipo.

____________________________________________________________________________________________________
V- DICIEMBRE 145
______________________________________________________________________________________________________

 Estructuración del saber construido como respuesta al problema


 Se solicita voluntarios para que mencionen que medidas de seguridad y beneficios deben de
tener al momento de utilizar sus velups.
Precauciones de uso
A pesar de su enorme belleza, estos velups pueden suponer algunos problemas para el medioambiente.
El principal riesgo al utilizar estas lámparas chinas es el riesgo de incendio. Si bien el diseño de
las linternas chinas está pensado para evitar este tipo de situaciones, ráfagas inesperadas de viendo o
fallos en la construcción pueden ocasionar que estas lámparas comiencen a arder en el cielo, existiendo
un notable riesgo de que se propague un incendio cuando estas velas voladores alcancen el suelo.
Además, los materiales de construcción de algunos farolillos voladores son de muy mala calidad y no son
biodegradables, por lo que es posible que acabemos contaminando nuestra tierra o nuestros mares.
Por ello es necesario seguir las siguientes recomendaciones:
- Utilizar materiales biodegradables.
- Utilizar velas pequeñas o velas misioneras.
1. Describan como usarían su prototipo

EDITORA BILBIOTECA
a) en beneficio de la comunidad educativa
b) en beneficio de una institución educativa.
2. Elaboren un informe explicando cómo construyeron su prototipo. Incluyan gráficos y esquemas.

MAGISTERIAL
Respondan
a) ¿Cuáles son las conclusiones a las conclusiones a las que han llegado al finalizar la indagación?
b) ¿Qué ventajas y desventajas identificaron en el diseño y la estructura de los velups?
 Para consolidar lo trabajado durante la sesión completan una ficha de aplicación.
FICHA DE APLICACIÓN
1. Dibuja los pasos que seguiste para la construcción de tu prototipo:

2. Colorea los beneficios de elaborar los velups.


Son contaminantes

Los velups son amigables con el ambiente.

Los materiales son difíciles de conseguir.

No hacen ruido.

Los animales no tienen problemas auditivos por su uso.


3. Explica porque los velups son amigables con el medio ambiente.

____________________________________________________________________________________________________
V- DICIEMBRE 146
______________________________________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
CIERRE
 Responde preguntas de metacognicion: ¿Qué aprendí hoy? ¿tuve dificultades al construir mi
prototipo? ¿Cómo las resolví? ¿para qué me sirve este nuevo conocimiento que aprendí?
¿Cómo lo puedo aplicar en mi vida diaria?
 Como actividad de extensión los estudiantes decoran los velups realizados durante la sesión
 Se evalúa con una lista de cotejos.
LISTA DE COTEJOS

Desempeños (criterios de evaluación) Sí No Observaciones


- Determina el problema tecnológico, las causas que lo generan
y su alternativa de solución, con base en conocimientos
científicos o prácticas locales; asimismo, los requerimientos
que debe cumplir y los recursos disponibles para construirla.

EDITORA BILBIOTECA
- Representa su alternativa de solución tecnológica con dibujos
y textos; describe sus partes o etapas, la secuencia de pasos,
características de forma, estructura y función. Selecciona
herramientas, instrumentos y materiales según sus

MAGISTERIAL
propiedades físicas. Considera el tiempo para desarrollarla y
las medidas de seguridad necesarias, así como medidas de
ecoeficiencia.
PRUEBA ESCRITA
1. ¿Qué es un velups?
______________________________________________________________________________________
____________________________________________________________________________________
2. Dibuja cuatro materiales utilizados en la construcción de los velups:

3. Explica en tres pasos sencillos como se construye un velups:


a. ___________________________________________________________________________________
_________________________________________________________________________________
b. ___________________________________________________________________________________
_________________________________________________________________________________
c. ___________________________________________________________________________________
_________________________________________________________________________________

REFLEXIONES SOBRE EL APRENDIZAJE


 ¿Lograron los estudiantes hacer funcionar sus velups?
 ¿Qué dificultades se observaron durante las actividades propuestas?
 ¿Están satisfechos con el trabajo realizado?

____________________________________________________________________________________________________
V- DICIEMBRE 147
______________________________________________________________________________________________________

EDITORA BILBIOTECA
MAGISTERIAL

____________________________________________________________________________________________________
V- DICIEMBRE 148
______________________________________________________________________________________________________

ÁREA: EDUCACIÓN FÍSICA


¿Qué necesitamos hacer antes de la sesión? Materiales o recursos a utilizar
- Preparar el material de educación física. Lista de - Espacio amplio, cronómetro, pelotas, bancas, latas
cotejos. vacías. Lista de cotejos.
INICIO:
 Participan en la actividad propuesta: “La cadena”. Uno de los estudiantes se la queda solo y corre
a atrapar a algún compañero, se dan la mano y continúan. Cuando vuelvan a atrapar a otro, los
tres van de la mano. Así sucesivamente hasta que estén todos atrapados. Los alumnos que
forman la cadena, tienen que cooperar para poder trabajar en equipo y atrapar al resto de
compañeros.
 Dialogamos: ¿Les agrado la actividad realizada? ¿Qué otros juegos parecidos conocen?
¿Consideran importante haber trabajo en equipo para completar la cadena?
 Rescatamos los saberes previos: ¿Qué nombre reciben los juegos donde todos trabajan en
común? ¿Los juegos deben de promover la integración? ¿Qué otros juegos pueden promover la
integración de todos los compañeros? ¿Pueden mencionar juegos que promueva la socialización
de los estudiantes? ¿Un niño puede jugar siempre solo?
 Se comunica el propósito de la sesión:

EDITORA BILBIOTECA
HOY PARTICIPAN EN JUEGOS DE COOPERACIÓN E INTEGRACIÓN.
 Se acuerda las normas de convivencia:
- Cuidar el material propio y común.

DESARROLLO MAGISTERIAL
- Mostrar amabilidad con todos.

 Se organiza a los estudiantes en el campo deportivo de su institución.


 Realizan ejercicios de calentamiento: Extensiones, flexiones, etc.
Series de ejercicios de calentamiento

 Explicamos información sobre la importancia de la cooperación e integración de los niños:


La cooperación es sinónimo de colaboración y ayuda. Las personas no actuamos de forma aislada lo hacemos
mediante interacciones (relaciones sociales) y, a mayor cooperación mayor rendimiento. El valor de la cooperación
no viene dado de una forma innata sino que se aprende y se adquiere durante la evolución de la persona.
LA COLABORACIÓN DEL NIÑO
Cuando los niños juegan y conviven, aprenden a colaborar entre ellos. La cooperación de los niños con los adultos
también pueden ser animada y estimulada por los padres como si fuera un reto o un juego, pero principalmente es
con el ejemplo que el adulto le ponga al niño, como aprenderá a colaborar con los demás. Cuando un adulto les
pide colaboración a los niños, les hace sentir que su participación es valiosa, muy bien recibida y aprendida. La
colaboración dentro de la familia y la comunidad es necesaria para que la sociedad se desarrolle. En la sociedad
así niño crecerá en un ambiente seguro, sociable y cálido.
La cooperación implica enfrentar problemas y soluciones. En el hogar, el cuidado de los niños se facilita cuando la
pareja colabora en todas las tareas y olvida que hay cosas que deben hacer “solo el hombre” o “solo la mujer”. Si
____________________________________________________________________________________________________
V- DICIEMBRE 149
______________________________________________________________________________________________________
los padres entenderemos que la colaboración depende el desarrollo pleno del niño, entonces estaremos más
dispuestos a colaborar tanto en la familia como en la comunidad, pues la colaboración es un valor que el niño
aprenderá si lo observa a su alrededor.

 Participan en los juegos de cooperación e integración propuestos. Se dan las instrucciones.


Cruzar el Lago. Se forman grupos de 3 o 4 alumnos. Se les cuenta que están delante de un
lago lleno de pirañas, cocodrilos y miles de bichos que se los comerán si pisan el suelo. Deben
cruzar el lago de una orilla a otra con la única ayuda de 5 piedras (ladrillos) que pueden pisar y
mover pero no desplazarse dentro de ellas. En el momento en que una persona toca con los dos
pies en el lago todo el grupo debe comenzar en la primera orilla.
Torre de Ladrillos. Toda la clase ayuda para construir la Torre más alta posible con latas de
leche vacías, intentando que no se caiga
Cruzar el Puente. Se coloca una fila de bancos suecos. Los alumnos formas sendas filas a los
extremos de los bancos. El primero de cada fila camina por los bancos hacia el extremo contrario
y coopera con el compañero para pasar a la vez al otro lado sin que ninguno de ellos caiga.
Que no caiga el Balón. Entre toda la clase, golpean un balón de playa hacia arriba tratando de
evitar que este toque el suelo. Se cuenta en número de veces que le dan cada vez.
Siameses del Balón. Por parejas, cooperan para trasladar una pelota de un sitio a otro, con

EDITORA BILBIOTECA
distintas partes del cuerpo.
 Por medio de lluvia de ideas los estudiantes mencionan los beneficios de los juegos de
cooperación.

MAGISTERIAL
IMPORTANCIA DE LOS JUEGOS COOPERATIVOS
 La diversión es para todos los que participen.
 La victoria es un sentimiento común, de todos.
 Se mezclan los grupos, se juega junto y se genera un alto nivel de aceptación mutua.
 Se aprende a compartir y confiar en los demás.
 Se genera y aprende el sentido de unidad y compartir.
 Hay una mezcla de personas en grupos heterogéneos que juegan juntos creando un
elevado nivel de aceptación mutua.
 Todos juntos inician y dan por finalizada la actividad, lo que no provoca el abandono de los
jugadores.
 Se gana y mejora la autoconfianza, ya que no se rechaza y se acepta a todos.
 La habilidad de perseverar ante las dificultades se fortifica por el apoyo del resto de
miembros.
 Realizan ejercicios de relajamiento: Ejercicios de respiración (inspirar- espirar) y relajación:
tendido supino (boca arriba) y las piernas flexionadas para evitar la tensión sobre el abdomen.
Luego, sitúan la mano sobre el abdomen, para ayudar a localizar el movimiento de la respiración.
Cierran los ojos para poder sentir los movimientos.
CIERRE
 Practican su higiene personal.
 Los estudiantes se hidratan después de la actividad realizada.
 Como actividad de extensión investigan sobre un juego de cooperación o integración y lo
presentan en la siguiente sesión.
 Se evalúa con una lista de cotejos.

____________________________________________________________________________________________________
V- DICIEMBRE 150
______________________________________________________________________________________________________
LISTA DE COTEJOS

Desempeños (criterios de evaluación) Sí No Observaciones


Explora y regula su cuerpo para dar respuesta a las situaciones
motrices en contextos lúdicos y predeportivos; así, pone en
práctica las habilidades motrices relacionadas con la carrera, el
salto y los lanzamientos.
Realiza actividades de activación corporal, psicológica y de
recuperación antes, durante y después de la práctica de
actividad física; de esta manera, aplica los beneficios
relacionados con la salud y planifica dietas saludables adaptadas
a su edad y sus recursos.

REFLEXIONES SOBRE EL APRENDIZAJE


 ¿Lograron los estudiantes participar en los juegos cooperativos?
 ¿Qué dificultades se observaron durante las actividades propuestas?
 ¿Están satisfechos con el trabajo realizado?

EDITORA BILBIOTECA
MAGISTERIAL

____________________________________________________________________________________________________
V- DICIEMBRE 151