Você está na página 1de 7

28 MEDICINSKI GLASNIK / str.

28-34

Đorđević Valentina*, Gvozdenov Maja*, Pruner Iva*, Tomić Branko*,


Kovač Mirjana** ***, Antonijević Nebojša** ****, Radojković Dragica*

UČESTALOST PAI-1 4G/5G GENSKE VARIJANTE U


SRPSKOJ POPULACIJI

Sažetak
Uvod: Inhibitor aktivatora plazminogena 1 (PAI-1) ima značajnu ulogu
u procesu inhibicije fibrinolize i normalne hemostaze.
Prisustvo PAI-1 4G/4G genotipa uzrokuje povećanje ekspresije PAI-1.
Povišen nivo PAI-1 u krvi povezan je sa brojnim bolestima kao što su
tromboza, moždani udar, infarkt miokarda, spontani pobačaji, preeklamp-
sija, insulinska rezistencija, dijabetes tipa 2, rak dojke i astma. U okviru
ove studije određivana je učestalost PAI-1 4G/5G genske varijante kod
zdravih ispitanika u srpskoj populaciji.
Metode: Studija je obuhvatala grupu od 210 zdravih ispitanika (105 žena
i 105 muškaraca). Prisustvo PAI-1 4G/5G genske varijante detektovano
je PCR-RFLP metodom.
Rezultati: Učestalost PAI-1 4G/4G genotipa iznosila je 34,76% i bila je
povećana u odnosu na PAI-1 5G/5G genotip (19,05%), dok je najzastup-
ljeniji genotip bio PAI-1 4G/5G (46,19%). Učestalost 4G alela bila je
viša (0,58) u odnosu na 5G alel (0,42).
Zaključci: Učestalost PAI-1 4G/5G genske varijante u srpskoj populaciji
slična je sa okolnim populacijama. Rezultati ove studije su značajni, jer preds-
tavljaju prve podatke za srpsku populaciju što će omogućiti dalja istraživanja
o ulozi PAI-1 4G/5G genske varijante u patogenezi brojnih bolesti.
Ključne reči: PAI-1 4G/5G, inhibitor aktivatora plazminogena

*
Đorđević Valentina, Laboratorija za molekularnu biologiju, Institut za molekularnu genetiku
i genetičko inženjerstvo, Srbija. Univerzitet u Beogradu. e-mail: pg20210a@gmail.com
**
Medicinski fakultet, Univerzitet u Beogradu, Srbija
***
Institut za transfuziju krvi, Centar za ispitivanje poremećaja hemostaze, Beograd, Srbija
****
Institut za kardiovaskularne bolesti, Klinički centar Srbije, Beograd, Srbija
UČESTALOST PAI-1 4G/5G GENSKE VARIJANTE U SRPSKOJ POPULACIJI 29

Abstract
Introduction: Plasminogen activator inhibitor 1 (PAI-1) has a major role
in inhibition of fibrinolysis and normal haemostasis.
The presence of the PAI-1 4G/4G genotype leads to increased expression
of PAI-1. High bllod level of PAI-1 is associated with many diseases
such as thrombosis, cerebral insult, myocardial infarction, pregnancy
loss, preeclampsia, insulin resistance, type 2 diabetes, breast cancer and
asthma. In this study, the prevalence of PAI-1 4G/5G gene variant was
determined in healthy subjects from Serbian population.
Methods: The study was carried out in a group of 210 healthy subjects
(105 women and 105 men). The presence of PAI-1 4G/5G gene variant
was detected by PCR-RFLP analysis.
Results: The prevalence of PAI-1 4G/4G genotype was 34.76% and it
was increased compared to PAI-1 5G/5G genotype (19.05%). The most
frequent was PAI-1 4G/5G genotype (46.19%). Allelic frequency for 4G
allele was higher (0.58) compared to 5G allele (0.42).
Conclusions: The prevalence of PAI-1 4G/5G gene variant in Serbian
population is similar to the neighboring populations. Results of this study
represent the first data for Serbian population. This study could be useful
for further research where the role of PAI-1 4G/5G gene variant will be
assessed in the pathogenesis of many diseases.
Key words: PAI-1 4G/5G, plasminogen activator inhibitor 1

Uvod

Hemostaza predstavlja jedan od najvažnijih mehanizama održavanja homeostaze


čitavog organizma. Njena uloga je da obezbedi tečno stanje krvi i njen nesmetani pro-
tok kroz cirkulaciju, a u slučaju oštećenja krvnog suda da omogući stvaranje krvnog
ugruška i zaustavljanje krvarenja. Radi se o veoma kompleksnoj i osetljivoj ravnoteži
u čijem održavanju učestvuje više faktora: endotel krvnih sudova, trombociti, faktori
koagulacije, inhibitori koagulacije i sistem fibrinolize (1).
Sistem fibrinolize omogućava razgradnju krvnog ugruška i uklanjanje fibrina
iz cirkulacije. Centralni enzim ovog sistema je plazmin koji nastaje aktivacijom
plazminogena. Aktivnost plazmina regulisana je kompleksnom mrežom aktivatora
i inhibitora fibrinolize. Najznačajniji inhibitori fibrinolize su: inhibitori aktivatora
plazminogena (PAI-1 i PAI-2) i α2-antiplazmin (2).
Inhibitor aktivatora plazminogena tipa 1 (PAI-1) je glikoprotein molekulske
mase 55 kD koji se sintetiše u endotelnim ćelijama, hepatocitima i megakariocitima
(3). PAI-1 deluje kao inhibitor endogene fibrinolitičke aktivnosti, zbog svoje sposob-
30 MEDICINSKI GLASNIK / str. 28-34

nosti da inhibira aktivnost tkivnog tipa aktivatora plazminogena (t-PA), i urokinaza


tipa aktivatora plazminogena (u-PA) (4-6). Gen za PAI-1 nalazi se na hromozomu 7
(7q21.3-q22.1) i sadrži 8 introna i 9 egzona (3). U promotoru PAI-1 gena na poziciji
-675 bp opisana je insercija/delecija jednog guanozina koja je označena kao 4G/5G
genska varijanta. Alelska varijanta sa 5 guanozina (5G) sadrži preklapajuća vezujuća
mesta za aktivator i represor transkripcije, što dovodi do normalnog nivoa ekspresije
PAI-1. Nasuprot tome, 4G alelska varijanta vezuje samo aktivator transkripcije, što
dovodi do povećanja nivoa PAI-1 u krvi (3).
Povećana ekspresija PAI-1 dovodi do smanjene fibrinolize, zbog čega može
predstavljati faktor rizika za niz kardiovaskularnih bolesti: infarkt miokarda
(7,8), moždani udar (9), tromboze dubokih vena (3). Studije su pokazale da
PAI-1 4G/5G genska varijanta može biti jedan od faktora rizika koji dovode do
spontanog pobačaja (10, 11) i preeklampsije (12). Takođe, povišena ekspresija
PAI-1 se povezuje sa insulinskom rezistencijom (13) i dijabetesom tipa 2 (14).
Značajna uloga ove genske varijante pokazana je u patogenezi raka dojke (15) i
astme (16).
Učestalost PAI-1 4G/5G genske varijante varira zavisno od etničke pripadnosti
(17-22). Frekvenca ove genske varijante određivana je za veliki broj populacija, ali
do sada nema objavljenih podataka za srpsku populaciju.
Cilj ove studije je da se odredi frekvenca PAI-1 4G/5G genske varijante u zdravoj
populaciji sa područja Srbije.

Materijal i metode

U ovu studiju uključeno je 210 zdravih subjekata (105 žena i 105 muškaraca;
starosti 39±11,25 godina) koji nisu imali nijedan trombotički događaj.
Za izolaciju DNK ispitanika korišćeni su limfociti periferne krvi i ćelije bukalne
sluzokože. Krv ispitanika uzimana je sa 3,8% Na-citratom kao antikoagulansom, a
uzorci bukalne sluzokože uzimani su sterilnim štapićem. Genomska DNK izolovana
je upotrebom QIAamp DNA blood mini kit (QIAGEN, Germany), prema standardnom
protokolu proizvođača.
Detekcija genske varijante PAI-1 4G/5G vršena je metodom PCR-RFLP. Reak-
cija lančanog umnožavanja DNK za analizu prisustva PAI-1 4G/5G genske varijante
odvijala se u smeši finalne zapremine 25μL, sledećeg sastava: 1x pufer A (Kapa
system, Boston, USA); 2,5mM MgCl2; 200μM dNTP; 10pmol svakog od odgovara-
jućih graničnika; 1U Taq polimeraze i 200 ng DNK. Uslovi umnožavanja i korišćeni
graničnici dati su u tabeli 1.
Produkti PCR reakcije proveravani su na 2% agaroznom gelu, a zatim su digerira-
ni BselI restrikcionim enzimom (Biolabs, New England). Produkti digestije analizirani
su vertikalnom elektroforezom na 10% poliakrilamidnom gelu. Na osnovu veličine
UČESTALOST PAI-1 4G/5G GENSKE VARIJANTE U SRPSKOJ POPULACIJI 31

restrikcionih fragmenata razdvajani su normalni (77 i 21 bp) i mutirani (98 bp) aleli.
Vizuelizacija DNK vršena je bojenjem gelova solima srebra (24).

Statistička analiza

Za određivanje Hardi-Vajnbergove ravnoteže (Hardy-Weinberg equilibrium)


korišćen je softver Hardy-Weinberg equilibrium calculator (http://www.oege.org/
software/hardy-weinberg.html).

Rezultati

U ovu studiju uključeno je 210 zdravih subjekata sa područja Srbije. Genotipiza-


cija za PAI-1 4G/5G urađena je PCR-RFLP metodom (slika 1). Rezultati su pokazali
da je kod 40 (19,05%) ispitanika bio prisutan PAI-1 5G/5G genotip, 97 (46,19%)
su bili heterozigotni nosioci PAI-1 4G/5G genske varijante, dok je 73 (34,76%)
ispitanika bilo nosilac PAI-1 4G alela u homozigotnom stanju. Alelska frekvenca
za 4G alela iznosila je 0,58, a za 5G alel 0,42. Na osnovu dobijenih učestalosti 4G
i 5G alela utvrđeno je da je grupa ispitanika bila u Hardi-Vajnbergovoj ravnoteži
(χ2=0.59).

Diskusija

U okviru ove studije određena je učestalost PAI-1 4G/5G genske varijante u


zdravoj srpskoj populaciji. Rezultati su pokazali da učestalost 4G alela iznosi 0,58,
što je u saglasnosti sa rezultatima dobijenim za okolne populacije (17–19). Ista
učestalost za 4G alel utvrđena je u studiji Alfirevića i saradnika u hrvatskoj popu-
laciji (17) (tabela 2). Slične rezultate dobili su Spiroski i saradnici za makedonsku
populaciju u studiji koja je uključivala 82 zdrava ispitanika (40 žena i 42 muškarca;
starosti 40,7±11,3 godina) (18). Nossikoff i saradnici su ispitivali učestalost PAI-1
4G/5G genske varijante kod pacijenata koji su imali infarkt miokarda (54 pacijenta)
u poređenju sa zdravim ispitanicima (85 zdravih subjekata) u bugarskoj populaciji.
Oni su pokazali da je u zdravoj bugarskoj populaciji frekvenca 4G alela nešto sniže-
na (0,42) (19). U studiji koja je određivala učestalost PAI-1 4G/5G genske varijante
kod pacijenata sa infarktom miokarda mlađih od 35 godina i kontrolne grupe zdravih
ispitanika, pokazano je da je u zdravoj grčkoj populaciji učestalost 4G alela 0,52 (20).
Sa druge strane, u populacijama Španije (21) i Italije (22) učestalost 4G alela je nešto
niža (0,49; tj. 0,47).
Bez obzira na postojanje razlike u procentualnoj zastupljenosti, sve studije,
uključujući i našu, pokazuju visoku učestalost 4G alela u različitim populacijama (17,
32 MEDICINSKI GLASNIK / str. 28-34

18, 20). Velika učestalost 4G alela u zdravoj populaciji može da ukazuje na njegovu
potencijalnu protektivnu ulogu u nekim procesima.
Neke studije su pokazale da PAI-1 svojim protektivnim delovanjem može
da smanji rizik za pojavu brojnih bolesti (5, 7). Tokom inflamatornih procesa u
moždanom tkivu, prisustvo 4G alela može dovesti do povećanja nivoa PAI-1, što
posledično dovodi do smanjenja proteolize i stabilizacije plaka. Lokalni mehanizmi
unutar moždanog tkiva mogu biti uključeni u protektivno delovanje PAI-1 i time
doprineti smanjenju rizika za pojavu moždanog udara (5). U holandskoj studiji, koja
je obuhvatala osobe starosti od 65 do 84 godine, pokazano je da prisustvo PAI-1
4G/4G genotipa smanjuje rizik od moždanog udara, tranzijentnog ishemijskog
napada i smrtnosti usled pojave kardiovaskularne bolesti (5). Inhibitorni efekat
PAI-1 4G/4G genotipa na migraciju ćelija može da dovode do smanjenog rizika od
bolesti koronarnih arterija (7).
Naša studija pokazuje da je učestalost PAI-1 4G/5G genske varijante u zdravoj
srpskoj populaciji slična sa okolnim populacijama. Rezultati ove studije predstavljaju
značajne podatke za buduće studije u kojima će biti određivana frekvenca PAI-1 4G/5G
genske varijante kao potencijalnog faktora rizika povezanog sa brojnim bolestima.
Ovaj rad je finansiran od strane projekta broj 173008 Ministarstva za prosvetu,
nauku i tehnološki razvoj Republike Srbije.

Tabela 1. Temperaturni profil i graničnici PCR reakcije

Graničnik Pa (23) 5’ CACAGAGAGAGTTCTGGCCACGT 3’


Graničnik Pb (23) 5’ CCAACAGAGGACTCTTGGTCT 3’

94 ◦C/5 min
Temperaturni profil PCR reakcije (94 ◦C/30 sec, 61 ◦C/30 sec, 72 ◦C/30 sec) 33 ciklusa
72 ◦C/10 min

Tabela 2. Genotipske i alelske učestalosti PAI-1 4G/5G genske varijante u različitim populacijama

Genotip Srbija Italija Makedonija Hrvatska Bugarska Grčka Španija


4G/4G (%) 34,76 24,36 24,4 32 18 20,3 21
4G/5G (%) 46,19 50,26 62,2 52 49 63,3 52
5G/5G (%) 19,05 25,38 13,4 16 33 16,4 27
Alelska frekvenca Srbija Italija Makedonija Hrvatska Bugarska Grčka Španija
4G alel 0,58 0,49 0,55 0,58 0,42 0,52 0,47
5G alel 0,42 0,51 0,45 0,42 0,58 0,48 0,53

Slika 1. Analiza genske varijante PAI-1 4G/5G PCR/RFLP metodom


UČESTALOST PAI-1 4G/5G GENSKE VARIJANTE U SRPSKOJ POPULACIJI 33

M – Marker dužine (100bp)


1 – PAI-1 5G/5G genotip
2 – PAI-1 4G/5G genotip
3 – PAI-1 4G/4G genotip

Literatura

Colman RW, Clowes AW, George JN, Goldhaber SZ, Marder VJ. Overview of hemostasis.
In: Colman RW, Marder VJ, Clowes AW, George JN, Goldhaber SZ. Haemostasis and
Thrombosis: basic principles and clinical practice. 5th ed. Philadelphia: Lippencott
Wiliams & Wilkins, 2006: 2-15.
Degen JL. Genetic interactions between the coagulation and fibrinolytic systems. Thromb
Haemost 2001; 86(1):130-7.
Akhter MS, Biswas A, Ranjan R, et al. Plasminogen activator inhibitor-1 (PAI-1) gene 4G/5G
promoter polymorphism is seen in higher frequency in the Indian patients with deep vein
thrombosis. Clin Appl Thromb Hemost. 2010 Apr; 16(2):184-8.
Shammaa DM, Sabbagh AS, Taher AT, Zaatari GS, Mahfouz RA. Plasminogen Activator In-
hibitor-1 (PAI-1) gene 4G/5G alleles frequency distribution in the Lebanese population.
Mol Biol Rep. 2008 Sep; 35(3): 453-7.
Hoekstra T, Geleijnse JM, Kluft C, Giltay EJ, Kok FJ, Schouten EG. 4G/4G genotype of
PAI-1 gene is associated with reduced risk of stroke in elderly. Stroke. 2003 Dec; 34(12):
2822-8.
Ringelstein M, Jung A, Berger K, et al. Promotor polymorphisms of plasminogen activator
inhibitor-1 and other thrombophilic genotypes in cerebral venous thrombosis: a case-
control study in adults. J Neurol. 2012 Nov; 259 (11): 2287-92.
Onalan O, Balta G, Oto A, Kabakci G, Tokgozoglu L, Aytemir K, Altay C, Gurgey A, Nazli
N (2008). Plasminogen activator inhibitor-1 4G4G genotype is associated with myo-
cardial infarction but not with stable coronary artery disease. J Thromb Thrombolysis
26: 211–217.
Gong LL, Peng JH, Han FF, et al. Association of tissue plasminogen activator and plasminogen
activator inhibitor polymorphism with myocardial infarction: a meta-analysis. Thromb
Res. 2012 Sep;130 (3): e43-51.
Wiklund PG, Nilsson L, Ardnor SN, et al. Plasminogenactivator inhibitor-1 4G/5G polymor-
phism and risk ofstroke: replicated findings in two nested case-control studiesbased on
independent cohorts. Stroke. 2005 Aug; 36(8):1661-5.
34 MEDICINSKI GLASNIK / str. 28-34

Jeddi-Tehrani M, Torabi R, Zarnani AH, et al. Analysis of plasminogen activator inhibitor-1, integrin
beta3, beta fibrinogen, and methylenetetrahydrofolate reductase polymorphisms in Iranian
women with recurrent pregnancy loss. Am J Reprod Immunol. 2011 Aug; 66(2):149-56.
Vora S, Shetty S, Khare M, Ghosh K. Placental histomorphology in unexplained foetal loss
with thrombophilia. Indian J Med Res. 2009 Feb; 129(2): 144-9.
Yamada N, Arinami T, Yamakawa-Kobayashi K, et al. The 4G/5G polymorphism of the
plasminogen activator inhibitor-1 gene is associated with severe preeclampsia. J Hum
Genet. 2000; 45(3):138-41.
Mansfield MW, Stickland MH, Grant PJ. Environmental and genetic factors in relation to ele-
vated circulating levels of plasminogen activator inhibitor-1 in Caucasian patients with
non-insulin-dependent diabetes mellitus. Thromb Haemost. 1995 Sep; 74(3): 842-7.
Zhang T, Pang C, Li N, Zhou E, Zhao K. Plasminogen activator inhibitor-1 4G/5G polymorphism
and retinopathy risk in type 2 diabetes: a meta-analysis. BMC Med. 2013 Jan 2;11:1.
Lee JH, Kim Y, Choi JW, Kim YS. Clinicopathological significance of plasminogen activator
inhibitor-1 promoter 4G/5G polymorphism in breast cancer: a meta-analysis. Arch Med
Res. 2013 Jan; 44(1): 39-45.
Nie W, Li B, Xiu QY. The -675 4G/5G polymorphism in plasminogen activator inhibitor-1 gene
is associated with risk of asthma: a meta-analysis. PLoS One. 2012; 7(3): e34385.
Alfirevic Z, Simundic AM, Nikolac N, et al. Frequency of factor II G20210A, factor V Leiden,
MTHFR C677T and PAI-1 5G/4G polymorphism in patients with venous thromboem-
bolism: Croatian case control study. Biochemia Medica. 2010; 20(2): 229-35.
Spiroski I, Kedev S, Antov S, et al. Investigation of SERPINE1 genetic polymorphism in
Macedonian patients with occlusive artery disease and deep vein thrombosis. Kardiol
Pol. 2009 Oct; 67(10): 1088-94.
Nossikoff A, Vikentieva E, Savov A, et al. 4G/5G polymorphism in the promoter region of
the PAI-1 gene in patients with myocardial infraction in Bulgaria- a pilot case-control
study. abstr. Balkan journal of medical genetics. 2006; 9(3&4).
Rallidis LS, Gialeraki A, Merkouri E, et al. Reduced carriership of 4G allele of plasminogen
activatorinhibitor-1 4G/5G polymorphism in very young survivors of myocardial infarc-
tionJ Thromb Thrombolysis. 2010 May; 29(4): 497-502.
Tàssies D, Espinosa G, Muñoz-Rodríguez FJ, et al. The 4G/5G polymorphism of the type 1
plasminogen activator inhibitorgene and thrombosis in patients with antiphospholipid
syndrome. Arthritis Rheum. 2000 Oct; 43(10): 2349-58.
Margaglione M, Cappucci G, Colaizzo D, et al. The PAI-1 Gene Locus 4G/5G Polymorphism
IsAssociated With a Family History ofCoronary Artery Disease. Arterioscler Thromb
Vasc Biol. 1998 Feb;18(2): 152-6.
Brown NJ, Murphey LJ, Srikuma N, Koschachuhanan N, Williams GH, Vaughan DE. Inte-
ractive effect of PAI-1 4G/5G genotype and salt intake on PAI-1 antigen. Arterioscler
Thromb Vasc Biol. 2001 Jun; 21(6): 1071-7.
Radojkovic D, Kusic J. Silver staining of denaturing gradient gel electrophoresis gels. Clin
Chem. 2000 Jun; 46(6): 883-4.