Cell Module Review Questions

Cell
Reviewer 01

1. Method in Histotechnique in which a tissue is exposed to a graded concentration of
alcohol
a. Clearing
b. Dehydration
c. Fixation
d. Infiltration

2. T/F Glucose is present in the cell membrane

3. This is where storage and packaging of secretory products occur
a. SER
b. RER
c. Golgi complex
d. Nucleus

4. Which of the following is not membrane bound
a. SER
b. RER
c. Inclusions
d. Ribosomes
e. None of the above

5. Carbohydrate which have the same atomic composition but differ in the position of
hydrogens and double bonds.
a. Tautomers
b. Diasteriomers
c. Isomers
d. Enantiomers

6. Formed by the elimination of water between anomeric hydroxyl of a cyclic
monosaccharide and the hydroxyl group of another compound.
a. Phosphorylated derivatives
b. Glycosides
c. Amino sugars
d. Sugar acids

7. Carbohydrates, which are found in the ABO blood group
a. Monosaccharide
b. Disaccharide
c. Polysaccharide
d. Oligosaccharide

8. T/F Boat form is the most stable configuration of a carbohydrate

9. Amino acids in vivo are usually in what form?
a. L isomers
b. D isomers
c. Both L and D
d. None of the above

10. This structural arrangement of protein is based on the amino acid sequence of the
polypeptide
a. Primary structure
b. Secondary structure
c. Tertiary structure
d. Quaternary structure

11. Linking 2 or more strands by H-‐bonding forms
a. Alpha helices
b. Beta turns
c. Beta sheets

12. Which of the following will most probably not cause protein denaturation
a. pH
b. Temperature
c. Mechanical stress
d. Oxidizing agents

13. Which of the following type of protein is water soluble?
a. Fibrous
b. Globular
c. Membrane proteins

14. This protein’s configuration is composed of a triple helix
a. Alpha Keratin
b. Beta Keratin
c. Collagen
d. Membrane proteins
15. Gel filtration relies upon what property of protein?
a. Charge
b. Specific Binding affinity
c. Solubility
d. Size

16. Preferred method for isolating transcription factors
a. Salting out
b. Affinity Chromatography
c. Dialysis
d. Column chromatography

17. A process which makes use of the antibody-‐antigen binding principle
a. Immunoblot
b. SDS page
c. ELISA
d. Affinity Chromatography

18. Which of the following methods can be used to determine the exact size of a
protein?
a. Gel filtration
b. SDS page
c. Ultracentrifugation
d. Mass Spectrometry

19. Which of the following has the highest melting point?
a. Saturated FA-‐15 C
b. Unsaturated FA-‐ 15 C
c. Unsaturated FA with two double bonds-‐15 C
d. All have the same melting points

20. Serves as a secondary messenger
a. 1,2 diacyl glycerol
b. Cardiolipin
c. Phosphatidyl inositol
d. Plasmalogens

21. It is a reservoir of arachidonic acid
a. Phosphatidyl glycerol
b. Phosphatidyl inositol
c. Phosphatidic acid
d. Phosphatidyl choline

22. The only sphingolipid that contains phosphorus
a. Ceramide
b. Glycosphingolipid
c. Shpingomyelin

23. Majoerglycosphingolipid of the brain and other nervous tissue
a. Ceramide
b. Globoside
c. Glycoceramide
d. Galactocerebroside

24. Densest among the lipoproteins
a. VLDL
b. LDL
c. HDL
d. Chylomicron

25. According to the fluid mosaic model of the membrane:
a. proteins are always completely embedded in the membrane
b. transverse movement of a protein (flip-‐flop) is thermodynamically favored
c. transmembrane protein has largely hydrophobic amino acids
d. proteins are distributed symmetrically in the membrane
e. a mechanism for translocating the solute from one side of the membrane to
the other

26. Characteristics of a mediated transport system include
a. nonspecific binding of solute to transporter
b. release of the transporter from the membrane following transport
c. a rate of transport directly proportional to the concentration of solute
d. release of the solute only if the concentration on the new side is lower than
that on the original side
e. a mechanism for translocating a solute from one side of the membrane to the
other

27. Which of the following can transport a solute against its concentration gradient
a. activated mediated transport
b. passive mediated transport
c. both of the above systems
d. neither of the above systems

28. A mediated transport system would be expected to:
a. show a continuously increasing initial rate of transport with increasing
substrate concentration
b. exhibit structural and/ or steroespecificity for the substance transported
c. be slower than that of the simple diffusion system
d. establish a concentration gradient across the membrane
e. exist only in plasma membranes

29. Membrane channels
a. have a large aqueous area in the protein structure so are not very selective
commonly contain amphipathic a-‐helices
b. are opened or closed only as a result of a change in the transmembrane
potential
c. are the same as gap junctions
d. allow substrates to flow only from the outside to inside of the cell

30. Cell membranes typically
a. are about 90% phospholipid
b. have both integral and peripheral proteins
c. containcholesteryl esters
d. contain free carbohydrate such as glucose
e. contain large amounts of triacylglycerols

31. The group translocation type of transport system
a. does not require metabolic energy
b. involves the transport of two different solute molecules simultaneously
c. has been demonstrated for fatty acids
d. results in the alteration of the substrate molecule during the transport
process
e. uses ATP to maintain a concentration gradient

32. All of the following are correct about an ionophore except it:
a. requires the input of metabolic energy for mediated transport of an ion
b. may diffuse back and forth across a membrane
c. may form a channel across a membrane through which an ion may diffuse
d. may catalyze electrogenic mediated transport of an ion
e. will have specificity for the ion it moves

33. The transport system that maintains the Na and K gradients across the plasma
membrane of cells:
a. involves an enzyme that is an ATPase
b. is a symport system
c. moves Na either into or out of the cell
d. is an electrically neutral system
e. in the membrane, hydrolyzes ATP independently of the movement of Na and
K

34. Ion which corresponds to facilitation of action potential
a. Na
b. K
c. Ca
d. Cl

35. This is the area of highest integration in IPSP
a. Terminal button
b. Axon hillock
c. Near Dendrites

36. This type of transport makes use of the protein KINESIN
a. Fast Anterograde transport
b. Slow Anterograde transport
c. Retrograde
d. Both A and B

37. Neurotransmitter which can both be inhibitory and excitatory based on it location in
the body
a. Glycine
b. GABA
c. Dopamine
d. Glutamate

38. Main inhibitory neurotransmitter in the brain
a. Glycine
b. GABA
c. Dopamine
d. Glutamate

39. Neurophysiologic counterpart of the ankle reflex
a. F reflex
b. H reflex
c. Endplate activity
d. none of the above

40. Series of potentials recorded 10 msec after auditory stimulus represent sequential
activation of structures in subcortical auditory pathways
a. BAER
b. Somatosensory evoked potential
c. EMG NCV
d. none of the above

41. Measures how many axons are stimulated
a. Amplitude
b. Latency
c. F wave
d. H reflex

42. Represents spontaneous action activity of motor units
a. fibrillation
b. fasciculation
c. latency
d. amplitude

43. Makes use of submaximal stimulus
a. Amplitude
b. Latency
c. F wave
d. H reflex

44. True of DNA
a. composed of monodeoxyribonucleotides covalently linked by a 3’-‐5’
phosphodiester bonds
b. composed of hydrophobic deoxyribose phosphate backbone
c. consists of a double helix with chains paired in an anti-‐parallel manner
d. Both a and c
e. All of the above

45. The process by which complimentary DNA strands form double helix
a. denaturation
b. reannealing
c. dna packaging
d. both b and c

46. Makes up the majority of total RNA in the cell
a. Ribosomal RNA
b. Transfer RNA
c. Messenger RNA
d. Mitochondrial RNA

47. True of properties that differentiate collagen from elastin except
a. Double Helix structure
b. Presence of Hydroxylisine
c. Gly-‐X-‐Y in repeat
d. Carbohydrate containing

48. Secreted in the extracellular matrix of fibroblasts
a. Elastin
b. Collagen
c. Fibrilin
d. Fibronectin

49. This actin is formed in the presence of ATP, Mg and K
a. G actin
b. F actin
c. B actin

50. This is used in the rapid transport of organelles
a. Dynein
b. Intermediate Filaments
c. Actin
d. Kinesin

51. True of Anaphase except
a. Alignment of sister chromatids in the center
b. Sister chromatids separate
c. Movement of sister chromatids towards the spindle pole
d. Kinetochore microtubules shorten

52. During the interphase, non-‐proliferating cells exit to
a. G0 phase
b. G1 phase
c. S1 phase
d. S2 phase

53. Major points for control system in the cells except for
a. G1/S checkpoint
b. G2/S checkpoint
c. G2/M checkpoint
d. Metaphase to anaphase checkpoint

54. T/F Cyclin B is prominent during metaphase

55. Catalyzes the movement of a group or a double bond within the same molecule
a. Ligases
b. Transferases
c. Lyases
d. Isomerases

56. These are small metal ions that are required for enzyme reactions
a. Cofactors
b. Cosubstrates
c. Coenzymes

57. Type of inhibition wherein Vmax is not altered
a. Competitive Inhibition
b. Noncompetitive Inhibition
c. Uncompetitive Inhibition
d. Enzyme Inhibition

58. T/F All enzymes are proteins

59. Which is true of DNA replication
a. A new strand is paired with an old strand
b. The sequence of old strand cannot necessary give a prediction for the
sequence of new strand
c. Conservative type of replication
d. Results to 2 DNA composed of paired parental strands and paired newly
synthesized strands

60. Removes the coils in DNA helix
a. helicase
b. topoisomerases
c. ligase
d. SSB

61. Major enzyme for replication
a. Polymerase 3
b. Polymerase 1
c. Helicase
d. Ligases

62. Proteins associated with newly synthesized daughter DNA
a. Single Stranded Binding Proteins
b. Helicases
c. Histones

63. Recognizes thymine-‐thymine dimers for repair
a. Benzo-‐pyrine endonucleases
b. Glycolases
c. UV specific endonucleases
d. AP endonucleases

64. Which of the following has a higher error rate?
a. DNA polymerase
b. RNA polymerase
c. They have the same error rates
d. They have repair mechanisms so there is technically no error.

65. Which of the following is/are true?
a. Both RNA and DNA polymerases need primers to start transcription.
b. RNA polymerase can bind to different regions of DNA template but prefers to
bind in ATTA-‐rich regions.
c. An RNA holoenzyme is made up of a β transcription factor and the RNA
polymerase.
d. The first step in RNA transcription is initiation, which involves a
conformational change in the holoenzyme and the DNA.
e. All of the above
f. None of the above.

66. T/F The direction of elongation of the newly transcribed RNA chain is from 5’-‐3’.

67. Following transcription elongation, what is the first step in the maturation of
eukaryotic RNA?

a. Splicing
b. Polyadenylation
c. Capping
d. Initiation

68. What type of RNA has a 5’-‐methyl cap which differentiates it from other RNAs?
a. Messenger RNA
b. Transfer RNA
c. Ribosomal RNA
d. Small Nuclear RNA

69. After splicing, the final mRNA contains:
a. Introns
b. Exons
c. Both a and b
d. Neither a nor b

70. Which of the following is/are true regarding RNA splicing?
a. The first step of RNA splicing involves a specific adenine nucleotide from the
exon sequence attacking the 5’ splice site.
b. Splice site mutations are associated with 15% of genetic mutations.
c. The released intron sequence is recycled and incorporated into other mRNA
sequences.
d. Both a and b.
e. All of the above

71. This leads to formation of different mRNA sequences from a single pre-‐mRNA.
a. Aberrant splicing
b. Post-‐transcription regulation
c. Alternative splicing
d. Post-‐translation modification

72. All of the following are true regarding termination EXCEPT:
a. Terminator sequences are close to the end of the coding sequence.
b. Chain elongation continues until the polymerase encounters a stop codon.
c. Termination signals are typically encoded in the DNA sequence.
d. Both B and C.
e. None. All of the statements are true.

73. Which of the following would lead to higher gene expression?
a. Greater activity of DNA methyltransferases
b. Methyl guanosine capping
c. Addition of longer poly-‐A tail
d. Addition of acetyl groups to chromatin structure

74. Which transcriptional control makes use of a repressor protein?
a. Inhibition
b. Positive regulation
c. Facilitation
d. Negative regulation

75. With an increase in lac repressor activity, which of the following is/are true:
a. Lac operon activity is repressed.
b. There is probably an absence of lactose.
c. There is probably an excess of lactose.
d. Both a and b are correct.
e. Both a and c are correct.

76. This is/are (a) protein complex(es) that splices off the introns in RNA.
a. Ribozyme
b. Spliceosome
c. Operon
d. Both a and b
e. All of the above

77. Which of the following regulation of gene expression pairs is correct?
a. Post-‐transciptional control: micro-‐RNA
b. Post-‐translational control: proteosomes
c. Translational control: polyadenylation
d. Transcriptional control: splicing

78. The following statements outline the difference between prokaryotes and
eukaryotes with regards translation and transcription except:
a. Both prokaryotes and eukaryotes have mechanisms for post-‐translational
RNA modification.
b. In prokaryotes, the primary transcript is used immediately as template for
protein synthesis while eukaryotes make mRNA precursors first.
c. The tRNA’s for recognizing the initiator codon are methionine and formyl
methionine for eukaryotes and prokaryotes, respectively.
d. None, all of the statements are correct.

79. What polypeptide sequence will be encoded from this mRNA sequence:
AUGGAUCACGCUGGUUAAGUA
a. Met-‐Asn-‐Gly-‐Ser-‐His
b. Met-‐Asn-‐ Trp-‐Ser-‐His
c. Met-‐Asn-‐His-‐Ser-‐Trp
d. Met-‐Asp-‐His-‐Ala-‐Gly

80. What polypeptide sequence will be encoded from this anticodon sequence:
AUGGAUCACGCUGGUUAAGUA

a. Met-‐Asn-‐Gly-‐Ser-‐His
b. Met-‐Asn-‐ Trp-‐Ser-‐His
c. Met-‐Asn-‐His-‐Ser-‐Trp
d. Met-‐Asp-‐His-‐Ala-‐Gly

81. Which part of the ribosome is the catalytic unit?
a. Protein component
b. RNA component
c. Both a and b
d. Depends if eukaryote or prokaryote

82. What is the main quality control step in translation?
a. tRNA binding
b. amino acid activation
c. ATP hydrolysis
d. aminoacyl-‐tRNA synthesis

83. What is the action of aminoacyl-‐tRNA synthetase?
a. Matches correct tRNA with the correct mRNA sequence
b. Synthesizes tRNA using its amino acid substituent
c. Links amino acids to tRNA

84. Arrange the following steps according to how it occurs during protein synthesis
initiation:
1 – initiating charged tRNA enters P site of ribosome
2 – 40S subunit binds to the methionine codon with the help of initiation
factors
3 – 60S ribosome unit joins the 43S complex forming the initiation complex
4 – formation of 43S complex

a. 1-‐2-‐4-‐3
b. 2-‐1-‐4-‐3
c. 4-‐1-‐2-‐3
d. 1-‐4-‐3-‐4

85. Enzyme that catalyzes peptide bond formation:
a. Peptide ligase
b. Peptidyl synthetase
c. Peptidyl transferase
d. Amino synthethase

86. The enzyme that catalyzes peptide bond formation can be found:
a. In the 40S ribosome unit
b. In the 43S ribosome unit
c. In the 60S ribosome unit
d. Extrinsically, isolated from the ribosome complex

87. The ratchet-‐like motion of the tRNA already dissociated from its amino acid as its
leaves the P site and enters the _______ allowing for the entry of new amino acyl-‐tRNA
is called ________.
a. A site; elongation
b. E site; elongation
c. A site; translocation
d. E site; translocation

88. In the final step of elongation, deacylated tRNA leaves the ribosome and empties
the:
a. A site
b. E site
c. P site

89. What is needed to stop further elongation and release polypeptide from the last
tRNA?
a. Stop codons (UAA, UAG, UGA)
b. Termination factor
c. Release factor
d. A and B only
e. A and C only
f. All of the above

90. All of the following are common features of protein secretion and targeting except:
a. Proteins are made as preproteins with sequences which serve as sorting
signals.
b. Membranes involved in protein translocation have specific receptors.
c. Translocases catalyze the movement of proteins via active transport.
d. Chaperons are attached to the preproteins making them tightly bound and
inactive.

91. After production of the immature protein, which of the following are true:
a. Protein can fold on its own.
b. Proteins fold with the aid of chaperones which prevent their aggregation
prior to folding.
c. Unfolded proteins with hydrophobic amino acids tend to be globular.
d. Only A and B
e. Only B and C
f. All of the above.

92. Endogenous proteins are targeted for degradation via the presence of which signal:
a. Chaperonin
b. Hsp70
c. Ubiquitin
d. mRNA signal

93. The following are true regarding proteolysis of exogenous proteins except:
a. It is slow and non-‐selective.
b. Usually through endocytosis and phagocytosis
c. Proteases for exogenous proteins have high pH to facilitate its degradation.
d. None, all of the statements are true.

94. What are enzymes which differ in amino acid sequences but catalyze the same
reaction?
a. Holoenzyme
b. Proteosome
c. Isozyme
d. Pro-‐enzyme

95. Which of the following shows the correct protein degradation regulation match?
a. Irreversible activation via proteolytic cleavage: KRAS
b. Reversible regulation: phosphatases and kinases
c. Multimodal regulation: chymotrypsinogen

96. Which of the following has been associated with breast cancer?
a. JAK kinases
b. Wild type KRAS
c. Caspases
d. Her-‐2/Neu gene

97. Which cell signaling mode uses gap junctions?
a. Endocrine
b. Paracrine
c. Neuronal
d. Contact-‐dependent

98. Molecule signaling which makes use of G-‐protein coupled cascades uses:
a. Cell-‐surface receptors
b. Intracellular receptors
c. Both

99. Which of the following is/are true regarding signals as carbon dioxide?
a. They most likely facilitate G-‐protein coupled reactions.
b. They may bind to receptors in the cell membrane.
c. They may bind to intracellular receptors.
d. Both A and B are true.
e. All of the above.

100. Which of the following may change their concentration intracellularly as a response
to environmental signals?
a. Potassium ion
b. Inositol 1,2,5-‐bisphosphate
c. Diacylglycerol
d. All of the above

101. What is the general term for the molecules referred to in the previous item?
a. Chaperones
b. Cascade pathways
c. Second messengers
d. G-‐proteins

102. Which of the following may act as both neurotransmitter and second messenger?
a. Dopamine
b. Endothelium-‐derived relaxing factor
c. Diacylglycerol
d. Cyclic AMP

103. What is the most common means of information transfer (i.e. how do environmental
signals usually translate to changes inside the cell?)
a. Protein cleavage
b. Changes in cellular concentrations
c. Phosporylation
d. Increased gene expression

104. Upon activation by tyrosine kinase, phospolipase C activates 2 signal molecules:
diacylglycerol and ________. The reaction involved is _________.
a. cAMP; phosporylation
b. cAMP; hydrolysis
c. IP3; phosporylation
d. IP3; hydrolysis

105. Changes in calcium concentration may activate ________; thus, stimulating different
enzymes and transporters.
a. Calcitonin
b. Calbindin
c. Calmodulin
d. Calcitriol

106. G-‐protein coupled pathways may involve the use of cAMP. This makes use of
_________ to convert ATP to cAMP; on the other hand, cAMP is degraded by _________.
a. Adenylyl cyclase; lysosomes
b. Adenylyl synthase; ubiquitin
c. Adenylyl cyclase; cAMP kinase
d. Adenylyl cyclase; cAMP phospodiesterase

107. Cyclic AMP stimulates phosporylation of target proteins by activating:
a. Protein kinase A
b. Phospolipase A
c. Protein kinase C
d. Phospolipase C

108. Defects in signaling pathways can lead to diseases. For instance, cholera can be
explained by:
a. Always active G-‐protein
b. Always inactive G protein
c. Decreased phosporylation
d. Insensitive receptors

Cell Module Review Questions

Enviado por

Dados do documento

Direitos autorais

Formatos disponíveis

Compartilhar este documento

Compartilhar ou incorporar documento

Opções de compartilhamento

Você considera este documento útil?

Este conteúdo é inapropriado?

Direitos autorais:

Formatos disponíveis

Cell Module Review Questions

Enviado por

Direitos autorais:

Formatos disponíveis

Cell

Você também pode gostar