Você está na página 1de 85

SUHAILA KARIM KHALIL JASER

Avaliação de polimorfismos no gene do Hormônio de


Crescimento (GH1) de duas variedades de Oreochromis niloticus
e sua associação com características de desempenho

Dissertação apresentada ao Programa de Pós-


Graduação Interunidades em Biotecnologia da
Universidade de São Paulo para obtenção do
título de Mestre em Biotecnologia.

São Paulo
2015
SUHAILA KARIM KHALIL JASER

Avaliação de polimorfismos no gene do Hormônio de Crescimento


(GH1) de duas variedades de Oreochromis niloticus e sua associação
com características de desempenho

Dissertação apresentada ao Programa de Pós-


Graduação Interunidades em Biotecnologia da
Universidade de São Paulo para obtenção do título de
Mestre em Biotecnologia.

Área de concentração: Biotecnologia

Orientador: Alexandre Wagner Silva Hilsdorf

Versão corrigida. A versão original eletrônica


encontra-se disponível tanto na Biblioteca do ICB
quanto na Biblioteca Digital de Teses e Dissertações
da USP (BDTD).

São Paulo
2015
Dedico este trabalho aos meus pais Anis Karim Khalil Jaser e Eucileide
Cândida de Morais Jaser e a meu irmão Eyas Anis Karim Jaser, aqueles a
quem devo todas as conquistas alcançadas.
AGRADECIMENTOS

A Deus por me conceder capacidade para alcançar meus objetivos.

Aos meus pais pela criação, carinho, apoio e por terem possibilitado meus estudos.

Ao meu orientador Prof. Dr. Alexandre Wagner Silva Hilsdorf por ter me integrado a seu
grupo de pesquisa e pelos projetos a mim confiados.

À Dra. Léia Cecília de Lima Fávaro, com quem tive o privilégio de trabalhar, por toda a
atenção e paciência e por ter me ensinado muitas das técnicas empregadas no
desenvolvimento deste trabalho.

Em especial, ao Dr. Marco Aurélio Dessimoni Dias, pelo auxílio no desenvolvimento de todo
o projeto, principalmente com as análises estatísticas, pelos conselhos e pela grande amizade
desenvolvida durante este período.

Á Prof. Dra. Regina Célia Mingroni Neto pela imensa atenção e pelo auxílio com implicações
teóricas envolvidas neste estudo.

Aos Profs. Drs. Rodrigo Marques Lima dos Santos e Maria José de Jesus Filho, integrantes da
banca de qualificação, pelas contribuições.

Aos colegas de laboratório Fernando e Caio por toda a ajuda com o manejo dos animais e por
muitas vezes terem sanado minhas dúvidas no laboratório.

À Prof. Dra. Silvia Arranz, do Instituto de Biologia Celular e Molecular de Rosário,


Argentina, por ter me recebido em seu laboratório para estágio, dando todo o suporte e auxílio
teórico que contribuíram imensamente para minha formação. E aos integrantes de seu grupo
de pesquisa Vanina Villanova, Juan Diaz e Ignacio Simó, que muito me ensinaram.

A todos os colegas do Laboratório de Genética de Organismos Aquáticos e Aquicultura


(LAGOAA) pela amizade, companhia e ajuda.
A Thais Prado, técnica do Núcleo Integrado de Biotecnologia, por todo o auxílio com as
tarefas laboratoriais, no pedido de novos primers, pelas conversas e pela sincera amizade.

Aos funcionários que trabalham na piscicultura da Empresa Brasileira do Peixe, fazendas Rio
das Pedras e Santa Ignês, que foram essenciais para a execução deste trabalho e, além de tudo,
sempre foram muito atenciosos e prestativos.

A todo o corpo docente do curso de Ciências Biológicas da UMC, por todos os


conhecimentos compartilhados e apoio durante o curso de graduação.

A todos os amigos que estiveram ao meu lado dando apoio e carinho.

Aos peixes estudados.

À Universidade de Mogi das Cruzes e à FAEP, por possibilitar o uso de suas instalações.

Ao Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) e à Fundação


de Amparo à Pesquisa do Estado de São Paulo (FAPESP) pelo auxílio financeiro.

Muito Obrigada!!!
“Quando o homem explorar intensamente o pequeno átomo e o imenso
espaço e disser que domina o mundo, quando conquistar as mais complexas
tecnologias e disser que sabe tudo, então ele terá tempo para se voltar para
dentro de si mesmo.”
“Descobrirá que se tornou um gigante na ciência, mas que é um frágil
menino que não sabe navegar nas águas da emoção e que desconhece os
segredos que tecem a colcha de retalhos da sua inteligência.”

Augusto Cury
RESUMO

JASER, S. K. K. Avaliação de polimorfismos no gene do Hormônio de Crescimento (GH1) de


duas variedades de Oreochromis niloticus e sua associação com características de desempenho.
2015. 85 f. Dissertação (Mestrado em Biotecnologia) - Instituto de Ciências Biomédicas, Universidade
de São Paulo, São Paulo, 2015.

Estudos que buscam identificar polimorfismos no gene do Hormônio do Crescimento (GH – Growth
Hormone) e os relacionar à taxa de crescimento de peixes economicamente importantes são
fundamentais para o desenvolvimento do setor aquícola, pois além de fornecerem novas e relevantes
informações a respeito da regulação de expressão desse gene, também podem ser usados em
programas de melhoramento genético. Assim, o objetivo deste estudo foi identificar polimorfismos de
base única (SNPs) na região promotora proximal e no intron I do gene GH (região alvo) e verificar
uma possível associação com os pesos de duas variedades (Red-Stirling e Chitralada) de tilápia do
Nilo - Oreochromis niloticus. Para isso, este estudo foi dividido em duas etapas: (1) prospecção de
SNPs, na qual indivíduos de quatro variedades (Red-Stirling, Chitralada, GIFT e UFLA) foram
avaliados para verificar a existência de SNPs na região alvo e (2) associação de possíveis SNPs com
peso das variedades Red-Stirling (n = 100) e Chitralada (n = 100). Para prospecção dos SNPs, a região
alvo foi amplificada por PCR, sequenciada e as sequências foram alinhadas para a verificação de
alterações de bases únicas. Tanto na etapa de prospecção quanto na de associação, as frequências
alélicas e genotípicas foram calculadas para cada SNP e foram estimados os blocos genotípicos
(conjunto de genótipo dos 10 SNPs) com suas respectivas frequências. O acompanhamento de
crescimento foi realizado nas instalações da Empresa Brasileira do Peixe Ltda. (EBP), no município de
Itupeva, SP. Para avaliar se os SNPs possuíam associação com o peso, foi utilizada uma metodologia
estatística baseada em análise univariada de modelo linear misto considerando-se efeitos fixos e
aleatórios em cada pesagem. No total, 10 SNPs foram prospectados, nove localizados no promotor
proximal (GHP1 a GHP9) e um localizado na região 5‟ UTR (GHP10), os quais formam 10 blocos
genotípicos (A a J). Entretanto, cinco destes blocos genotípicos (F a J) não apareceram na população
de associação e seis novos blocos foram identificados (K a P). Considerando todas as pesagens, os
blocos „B‟, „P‟, „K‟, „L‟ e „M‟ foram associados aos melhores pesos da população de associação e, os
SNPs GHP6, GHP7, GHP8, GHP9 e GHP10 demonstraram associação significativa (P < 0,05) como o
crescimento, ressaltando que os genótipos de maior valor aditivo para peso foram observados na
variedade Chitralada. Portanto, foi possível estimar um conjunto de genótipos com maior efeito
aditivo sobre o crescimento da população estuada, o qual poderia ser utilizado em futuros programas
de melhoramento genético de tilápia assistidos por marcadores moleculares.

Palavras-chave: Tilápia, Hormônio de Crescimento, SNP, Aquicultura.


ABSTRACT

JASER, S. K. K. Polymorphic variation in Growth Hormone (GH1) gene of two Oreochromis


niloticus strains and its association to growth performance. 2015. 85 p. Masters thesis
(Biotechnology) - Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo, 2015.

Polymorphisms in the Growth Hormone gene (GH) associated to growth rate of farmed fishes have
been the target of many studies of breeding programs. Assessment of Single Nucleotide
Polymorphisms (SNP) variations in GH of tilapia species and their association to tilapia performance
in farming system is still unknown. The present study aimed to identify SNPs in the proximal
promoter region and in the first intron of GH gene and to evaluate if there is association of SNPs
variation with the growth rate of two strains of Nile tilapia - Oreochromis niloticus (Red-Stirling and
Chitralada). Firstly, SNP searching in the two targeted regions was carried out in four strains of nile
tilapia (Red-Stirling, Chitralada, GIFT and UFLA). Then, two strains, Red-Stirling (n=100) and
Chitralada (n=100) were used in grow-out testing in cages. The two targeted regions were amplified
by PCR using primers designed for it, and then sequenced. The sequences were aligned to check the
presence of SNPs in the four Nile tilapia strains. The same approach was used to test the SNPs found
in the SNP´s prospection phase in the grow-out testing. Allele and genotype frequencies were
estimated for each SNP and genotype. Genotype blocks (set of SNPs genotypes) frequencies were also
estimated. Association between SNPs and growth rate were statistically estimated by univariate linear
mixed model taking into account fixed and random effects. A total of 10 SNPs were found; nine
located in the proximal promoter region and one located in the 5‟ UTR region, which formed 10
genotype blocks (A to J). Five of these genotype blocks (F to J) were not found in the grow-out
individuals. However, six new genotype blocks (K to P) were identified. In all four weighing
recording, genotype blocks „B‟, „P‟, „K‟, „L‟ and „M‟ were statistically associated to the best weights,
and the SNPs GHP6, GHP7, GHP8, GHP9 and GHP10 individually also showed significant
association (P < 0,05) with growth. Noting that genotypes with higher additive genetic values for
weight were observed in the Chitralada strain, which suggest possible impact of these additive effects
of GH SNP´s genotypes on the growth rate of Nile tilapia. These findings found herein may
potentially be used as Marked-Assisted Selection in tilapia breeding programs

Keywords: Tilapia, Growth Hormone, SNP, Aquaculture.


LISTA DE TABELAS

TABELA 1 – Produção pesqueira e aquícola mundial.............................................................22

TABELA 2 – Descrição dos primers utilizados para amplificação da região alvo e para
sequenciamento.........................................................................................................................39

TABELA 3 – Relação dos SNPs identificados e suas respectivas posições na sequência do


gene GH1 de Oreochromis niloticus.........................................................................................51

TABELA 4 – Frequências alélicas dos SNPs identificados na população de


prospecção.................................................................................................................................52

TABELA 5 – Frequências genotípicas dos SNPs identificados na população de


prospecção.................................................................................................................................53

TABELA 6 – Blocos Genotípicos Apresentados pela População de Prospecção....................54

TABELA 7 – Frequências dos Blocos Genotípicos da População de Prospecção...................54

TABELA 8 – Frequências alélicas da população de associação..............................................57

TABELA 9 – Frequências genotípicas da população de associação........................................58

TABELA 10 – Blocos genotípicos apresentados pela população de associação......................59

TABELA 11 – Frequências dos blocos genotípicos da população de associação....................59

TABELA 12 – Peso médio da população de associação por bloco genotípico........................63

TABELA 13 – Peso médio por SNP com associação significativa (P < 0,05) em cada
pesagem.....................................................................................................................................67

TABELA 14 – Conjunto de genótipos de maior efeito genético aditivo para o peso...............68


LISTA DE FIGURAS

FIGURA 1 – Comparação da organização exon/intron dos genes GH de diferentes grupos


taxonomicos. Quadrados representam os exons, linhas representam os introns e as setas
indicam a inserção do intron V. Fonte: Ma et al. (2012)..........................................................28

FIGURA 2 – Estrutura dos genes GH1 e GH2 de O. niloticus. Quadrados brancos


representam as regiões 5‟ e 3‟ UTR transcritas, quadrados pretos indicam a região
codificadora e as linhas entre os quadrados indicam os introns. „T‟ representa o TATA box.
„A‟ representa o sinal de poliadenilação. „J‟ representa a região de junção, depois da qual os
genes GH1 e GH2 diferem. Adaptado de: Ber; Daniel (1993).................................................29

FIGURA 3 – Variedades de Oreochromisniloticus utilizadas no estudo: GIFT (A), CHIT (B),


UFLA (C) e RED (D). Fonte: DIAS, 2014...............................................................................35

FIGURA 4 – Primers construídos para amplificação da região alvo: primer TnPr1F em


violeta e primer On_R1 em azul. Letras minúsculas: promotor e introns. Letras maiúsculas
em negrito: exons I e II. Sublinhado e em negrito: TATA box. Em verde: códon de início da
tradução.....................................................................................................................................38

FIGURA 5 – Primers construídos para sequenciamento da região alvo. Cinza: primer


On_Fsec1; Violeta: primer On_Fsec2; Azul: primer On_Rsec1 e Amarelo: primer On_Rsec2.
Verde: códon de início da tradução. Letras minúsculas: promotor e introns. Letras maiúsculas
em negrito: exons I e II. Sublinhado e em negrito: TATA box................................................39

FIGURA 6 – Esquema dos tanques-rede onde os animais estudados na fase de associação


foram mantidos durante o período de acompanhamento do crescimento. Os números de 1 a 4
se referem às diferentes classes de peso....................................................................................42

FIGURA 7– Eletroforese em gel de agarose 0,8%, referente à extração de DNA por método
baseado em precipitação por altas concentrações de sal. Canaletas 1 e 11: Marcador de peso
molecular λ Hind III (Fermentas).............................................................................................46
FIGURA 8 – Eletroforese em gel de agarose 2,0%, referente às reações de PCR realizadas
com o DNA genômico de 38 indivíduos. Canaletas 1 e 21: Marcador de peso molecular 100
pb (Life Thechnologies). Circuladas em vermelho: bandas inespecíficas de baixa
concentração..............................................................................................................................47

FIGURA 9 – Eletroforese em gel de agarose 2,0%. Produtos de PCR a serem purificados.


Canaletas 1 e 13: Marcador de peso molecular GeneRuler 100 bp (Thermo Scientific).
Circuladas em azul: bandas de interesse recortadas para purificação.......................................48

FIGURA 10 – Eletroforese em gel de agarose 2,0%. Amostras purificadas. Canaletas 1 e 18:


Marcador para peso molecular e concentração, Low DNA Mass (Life Technologies)..............48

FIGURA 11 – Cromatograma de sequenciamento observado no programa CodonCode


Aligner.......................................................................................................................................49

FIGURA 12 – Alinhamento das sequências-consenso dos indivíduos pertencentes à etapa de


prospecção de SNPs no programa MEGA 5.0. Em destaque estão alguns dos SNPs
identificados..............................................................................................................................50

FIGURA 13 – SNPs identificados na região alvo do gene GH1 de Oreochromis niloticus


(destacados em vermelho). Possível região promotora em letras minúsculas e exon I em letras
maiúsculas em negrito. Possíveis regiões de ligação de fatores de transcrição estão
sublinhadas e em negrito com suas respectivas identificações acima. Destacado em cinza está
o códon de início da tradução...................................................................................................51

FIGURA 14 – Curva de crescimento das médias de pesos de machos e fêmeas pertencentes à


variedade REDS........................................................................................................................55

FIGURA 15 – Curva de crescimento das médias de pesos de machos e fêmeas pertencentes à


variedade CHIT.........................................................................................................................56

FIGURA 16 – Análise descritiva das médias de pesos por bloco genotípico em cada pesagem.
Traços representam as médias de peso, colunas representam peso máximo e mínio e linhas
tracejadas representam o desvio padrão....................................................................................61
FIGURA 17 – Classificação dos blocos genotípicos de acordo com as médias de peso
centradas em zero......................................................................................................................63

FIGURA 18 – Classificação dos genótipos referentes aos SNPs com associação significativa
na 1ª pesagem............................................................................................................................65

FIGURA 19 – Classificação dos genótipos referentes aos SNPs com associação significativa
na 2ª pesagem............................................................................................................................65

FIGURA 20 – Classificação dos genótipos referentes aos SNPs com associação significativa
na 3ª pesagem............................................................................................................................66

FIGURA 21 – Classificação dos genótipos referentes aos SNPs com associação significativa
na 4ª pesagem............................................................................................................................66
LISTA DE ABREVIATURAS E SIGLAS

CHIT: Chitralada

cm2: Centímetros Quadrados

cm3: Centímetros Cúbicos

CRE: cAMP Response Element

DNA: Ácido Desoxirribonucleico

DNOCS: Departamento Nacional de Obras contra a Seca

DZO/UFLA: Departamento de Zootecnia da Universidade Federal de Lavras

dNTP: Desoxirribonucleotídeos Fosfatados

EBP: Empresa Brasileira do Peixe

g: Gramas

GH: Growth Hormone

GHRH: growth hormone realizing hormone

GIFT: Genetic Improvement of Farmed Tilapias

HNF: Hepatocyte Nuclear Factor

IGF: insulin-likegrowth factor

mg: Miligramas
mm: Milímetros

mM: Milimolar

mRNA: RNA Mensageiro

ng: Nanogramas

pb: Pares de Base

PCR: Polymerase Chain Reaction

Pit: Pituitary-Specific Transcription Factor

q.s.p: Quantidade Suficiente Para

REDS: Red-Stirling

RFLP: Restriction Fragment Length Polymorphism

SEAP-PR: Secretaria Especial de Aquicultura e Pesca

SNP: Single Nucleotide Polymorphism

TER: TPA Transcription Factor

U: Unidade

µL: Microlitros
SUMÁRIO

1 INTRODUÇÃO GERAL.....................................................................................................19
2 REVISÃO BIBLIOGRÁFICA............................................................................................22
2.1 Aquicultura..........................................................................................................................22
2.2 Tilápia: Breve Panorama.....................................................................................................24
2.3 Hormônio de Crescimento: Fisiologia e Estrutura Molecular............................................27
2.4 SNPs como Marcadores Moleculares.................................................................................31
3 OBJETIVOS.........................................................................................................................34
3.1 Objetivo Geral.....................................................................................................................34
3.2 Objetivos Específicos..........................................................................................................34
4 MATERIAL E MÉTODOS.................................................................................................35
4.1 Material Biológico e Procedência dos Animais..................................................................35
4.2 Extração de DNA Genômico..............................................................................................36
4.3 Amplificação e Sequenciamento da Região Alvo do Gene GH1.......................................38
4.4 Prospecção de SNPs............................................................................................................41
4.5 Associação de SNPs com Crescimento...............................................................................42
4.5.1 Acompanhamento do Crescimento...................................................................................42
4.5.2 Genotipagem da População de Associação.....................................................................44
4.5.3 Análises Estatísticas.........................................................................................................45
5 RESULTADOS....................................................................................................................46
5.1 Análises Moleculares..........................................................................................................46
5.1.1 Extração de DNA.............................................................................................................46
5.1.2 Amplificação da Região Algo..........................................................................................47
5.1.3 Purificação da Região Alvo.............................................................................................48
5.1.4 Sequenciamento...............................................................................................................49
5.2 Prospecção de SNPs............................................................................................................50
5.3 Associação de SNPs com Crescimento...............................................................................55
5.3.1 Acompanhamento do Crescimento...................................................................................55
5.3.2 Genotipagem da população de associação......................................................................57
5.3.3 Análises Estatísticas.........................................................................................................60
6 DISCUSSÕES.......................................................................................................................69
6.1 Identificação dos SNPs.......................................................................................................69
6.2 Acompanhamento de Crescimento.....................................................................................71
6.3 SNPs e sua Associação com Crescimento..........................................................................72
6.4 Possível Interferência Funcional dos SNPs na Expressão do Gene GH1...........................74
7 CONSIDERAÇÕES FINAIS..............................................................................................76
REFERÊNCIAS......................................................................................................................77
ANEXO....................................................................................................................................84
19

1 INTRODUÇÃO GERAL

A tilápia do Nilo ou Oreochromis niloticus (LINNAEUS, 1758) é a quarta espécie de


peixe mais produzida pela aquicultura mundial e ocupa primeira posição entre as mais
produzidas no Brasil (FOOD AND AGRICULTURE ORGANIZATION - FAO, 2014).
Dentre os motivos responsáveis pelo grande volume de produção desta espécie pela
aquicultura brasileira, os principais são sua adaptabilidade às condições climáticas do país e
suas características zootécnicas adequadas ao cultivo (POPMA; LOVSHIN, 1995), tais como:
fácil manejo, resistência a doenças, tolerância a baixos teores de oxigênio, hábito alimentar
variado, rápido crescimento e ausência de espinhas intramusculares em forma de Y no filé
(HILSDORF, 1995).
Com a domesticação desta espécie, diferentes variedades foram produzidas, a partir de
populações selvagens, sendo que algumas destas variedades foram inicialmente
desenvolvidas, com o objetivo de obter animais com maiores taxas de crescimento, por meio
de processos de cruzamentos e seleção genética. Neste contexto, algumas variedades que
muito se destacam são GIFT (EKNATH, 1998; WORDFISH CENTER, 2004) e Chitralada
(ZIMMERMANN, 2000).
Outros tipos de tilápia amplamente produzidos são as chamadas tilápias vermelhas,
assim denominadas devido à ausência de pigmentação preta na pele causada por mutação
genética. Animais deste tipo compõem algumas variedades da espécie O. niloticus, dentre as
quais está a variedade Red-Stirling, desenvolvida pela Universidade de Stirling na Escócia
(HILSDORF, 1995). Apesar da preferência do mercado consumidor pelas tilápias vermelhas
(CAMPO, 2001), estudos demonstraram que a variedade Red-Stirling possui menor
desempenho de crescimento quando comparada com Chitralada, que possui coloração escura.
Isso ocorre, pois Red-Stirling é uma variedade mutacional originada a partir de uma
população base restrita e, desenvolvida para produção de animais com total ausência de
manchas na pele, enquanto Chitralada possui um antigo histórico de seleção para maiores
taxas de crescimento (MOREIRA et al., 2005).
O crescimento nos vertebrados é uma característica regulada por um grande número de
vias fisiológicas, onde o papel mais importante é desempenhado pelo eixo somatotrófico.
Dentre os hormônios que constituem este eixo o GH (Growth Hormone ou Hormônio de
Crescimento) é um dos principais responsáveis pelo crescimento pós-natal, atuando nos ossos
e músculos (SELLIER, 2000). Nos peixes, além de atuar no crescimento somático, o GH está
20

envolvido em muitas funções metabólicas, como reprodução, osmorregulação (SAKAMOTO


et al., 1997), crescimento linear, digestão de alimentos e apetite (TRUDEAU, 1997;
ALMULY et al., 2005). Devido ao importante papel que desempenha no crescimento, o gene
responsável pela produção do GH (gene GH) teve sua sequência completa ou parcialmente
caracterizada em muitas espécies de peixes, entre as quais estão algumas das mais importantes
para a aquicultura: Cyprinus carpio - carpa comum (CHIOU et al., 1990),
Hypophthalmichthys molitrix - carpa prateada (HONG; SCHARTL, 1993), Salmo salar -
salmão do Atlântico (JOHANSEN et al., 1989), Oreochromis niloticus - tilápia do Nilo (BER;
DANIEL, 1993), entre outras.
É comprovado que ganhos significativos na taxa de crescimento podem ser atingidos
por meio do aumento nos níveis de GH e outros hormônios no organismo de peixes (DEVLIN
et al., 2004). Como prova disso, processos de transgenia, envolvendo a adição de genes GH
exógenos no genoma, já foram realizados com espécies de importância comercial como
salmão (DEVLIN et al., 2004; DU et al., 1992), bagre (DUNHAM et al., 1992), carpa (CHEN
et al., 1993) e tilápia (MARTINEZ et al., 1996). White et al. (1994) produziram indivíduos
transgênicos da espécie Oncorhynchus kisutch inserindo em seu genoma um gene GH
adicional e demonstraram que os mesmos cresceram, em média, 11 vezes mais que os animais
controle (não transgênicos) da mesma idade.
Outra opção muito eficiente para obtenção de animais com maior desempenho de
crescimento é o melhoramento genético que, ao longo dos anos, têm mostrado consideráveis
resultados na produção de peixes com fenótipos mais produtivos (HILSDORF; ORFÃO,
2011). Um exemplo disso é o Programa de Desenvolvimento de Reprodutores de Salmão do
Atlântico (Atlantic Salmon Broodstock Development Program - ASBD), desenvolvido no
Canadá, para produção de uma nova variedade da espécie Salmo salar que possua maiores
taxas de crescimento, utilizando métodos de seleção e reprodução (QUINTON et al., 2005).
Sabendo-se que a base de qualquer programa de melhoramento genético reside nas
diferenças de características herdáveis (HILSDORF; ORFÃO, 2011), variações genéticas, ou
polimorfismos, envolvidos com fenótipos economicamente importantes podem ser
diagnosticados por meio de marcadores moleculares (ALMEIDA et al., 2009). Polimorfismos
encontrados no gene GH têm sido associados a diversas características de desempenho como
crescimento, produção de ovos e resistência a doenças em aves (MARQUES, 2009;
KUHNLEIN et al.,1997), ganho de peso e produção de carne em bovinos (CURI et al., 2006;
PEREIRA et al., 2005) e, taxa de crescimento em peixes, como por exemplo, Danio rerio
21

(KURADOMI, 2009), Sparus aurata (SÁNCHEZ-RAMOS et al., 2006) e O. niloticus (DIAS,


2014). Atualmente, marcadores moleculares do tipo SNPs estão sendo cada vez mais
empregados em estudos de associação com características de desempenho, por representarem
o tipo de variação mais abundante nos genomas (WANG et al., 2008) e devido aos avanços
tecnológicos que vem trazendo metodologias de alto desempenho e acurácia, baixo custo e
menor tempo para prospecção e genotipagem dos SNPs (CAETANO, 2009).
Neste cenário, estudos envolvendo polimorfismos no gene GH de espécies
economicamente importantes são de fundamental importância para que mais avanços no setor
aquícola sejam alcançados. Portanto, estudos sobre correlação de SNPs no gene GH com
crescimento de O. niloticus são fundamentais para o desenvolvimento de futuros programas
de melhoramento genético por seleção assistida.
22

2 REVISÃO BIBLIOGRÁFICA

2.1 Aquicultura

O termo aquicultura se refere ao processo de criação de organismos aquáticos, tais


como: peixes, moluscos, crustáceos, plantas, répteis e anfíbios, utilizando-se técnicas a fim de
melhorar a produção do organismo em questão além de sua capacidade natural. Desde a
década de 90, este e é o setor de produção alimentícia que mais tem crescido no mundo,
atingindo nos dias atuais metade da demanda mundial por alimentos a base de peixe (FAO,
2013).
Dados da FAO mostram que em 2012 a produção aquícola mundial atingiu 66,6
milhões de toneladas de peixes, com uma taxa de crescimento anual de 6,2% desde 2000.
Enquanto a produção por captura foi de 91,3 milhões de toneladas, com um decréscimo de
2,6% em comparação com os anos anteriores (TABELA 1) (FAO, 2014).

TABELA 1 - Produção pesqueira e aquícola mundial.


2007 2008 2009 2010 2011 2012

(Milhões de toneladas)

PRODUÇÃO

Captura

Continental 10,1 10,3 10,5 11,3 11,1 11,6

Marinha 80,7 79,9 79,6 77,8 82,6 79,7


Total da Captura 90,8 90,1 90,1 89,1 93,7 91,3

Aquicultura

Continental 29,9 32,4 34,3 36,8 38,7 41,9


Marinha 20,0 20,5 21,4 22,3 23,3 24,7
Total da
49,9 52,9 55,7 59,0 62,0 66,6
Aquicultura
Total geral 140,7 143,1 145,8 148,1 155,7 158,0
Fonte: FAO (2014).

Segundo os últimos dados coletados pela FAO, 10 países contribuem com 88% da
produção aquícola mundial, estando a China em primeiro lugar, com 41,1 milhões de
toneladas produzidas em 2012, a Índia em segundo, com 4,2 milhões de toneladas, e Vietnã
23

em terceiro, com 3.1 milhões de toneladas, seguidos por Indonésia, Bangladesh, Noruega,
Tailândia, Chile, Egito e Birmânia. Dentre os organismos mais produzidos no setor aquícola
estão os peixes, correspondendo a 66,3% da produção total, os moluscos, com 22,8% e os
crustáceos com 9,7%. Dentre os peixes, a tilápia do Nilo representa 80% da produção
aquícola mundial, com 3 milhões e 100 mil toneladas produzidas em 2012 (FAO, 2014).
Assim como ocorre no cenário mundial, a produção aquícola brasileira vem mostrando
aumentos significativos nos últimos anos. No período entre 2008 e 2010 a produção nacional
obteve um ganho de 31,2%, passando de 365 mil toneladas em 2008 para 479 mil toneladas
em 2010. Quando se leva em consideração apenas a aquicultura continental, ou seja, o cultivo
de espécies de água doce, o incremento da produção foi de 40%, passando de 282 mil
toneladas produzidas em 2008 para 394 mil toneladas produzidas em 2010 (MINISTÉRIO
DA PESCA E AQUICULTURA - MPA, 2010). Tal crescimento pode ser associado ao
estabelecimento de políticas públicas no setor, as quais facilitaram o acesso a programas
governamentais que objetivam ampliar o desenvolvimento sustentável por meio de medidas
de estímulo à competitividade e ao empreendedorismo (MPA, 2014). O estado do Rio Grande
do Sul é atualmente o maior produtor aquícola do país, com 55 mil toneladas produzidas no
ano de 2010. O estado de São Paulo vem logo atrás, com 45 mil toneladas produzidas no
mesmo ano, sendo o segundo estado Brasileiro com maior produção no setor aquícola (MPA,
2010).
24

2.2 Tilápia: Breve Panorama

Tilápias são peixes africanos pertencentes à família dos ciclídeos e abrangem mais de
70 espécies. As espécies de tilápia mais importantes para a aquicultura pertencem ao gênero
Oreochromis, que inclui a tilápia do Nilo (O. niloticus), a tilápia de Moçambique, (O.
mossambicus), a tilápia azul (O. aureus) e O. urolepshornorum (KUBITZA, 1999;
MOREIRA et al., 2007). Este peixe foi amplamente disseminado por todo o mundo e,
atualmente, sua produção ocorre em mais de 100 países (FAO, 2014).
As primeiras tilápias foram introduzidas no Brasil no ano de 1953, no estado de São
Paulo, por meio de importação da espécie Tilapia rendalli do Congo. Após isso, exemplares
de tilápia do Nilo provenientes de Bouaké - Costa do Marfim foram introduzidos no estado do
Ceará em 1971 por um programa oficial implementado pelo Departamento Nacional de Obras
contra a Seca (DNOCS) para produção de alevinos e introdução em reservatórios públicos da
região nordeste, sendo esta a primeira introdução oficial de tilápia do Nilo no Brasil. No
mesmo período os estados de São Paulo e Minas Gerais, através de suas companhias
hidrelétricas, iniciaram a produção de alevinos da espécie para liberação em seus
reservatórios, venda e distribuição a produtores rurais (EMPRESA BRASILEIRA DE
PESQUISA AGROPECUÁRIA - EMBRAPA, 2007).
No ano de 1996, uma segunda importação, de 20.800 alevinos de tilápia do Nilo
provenientes da Tailândia, foi realizada para Londrina no estado do Paraná. Esta variedade foi
produzida por meio de domesticação iniciada na década de 40 no Japão, passando por um
programa de melhoramento genético realizado no Palácio Real de Chitralada - Tailândia. Daí
o nome de tilápia tailandesa, ou Chitralada (KUBITZA, 2006).
A variedade Chitralada apresenta crescimento superior ao das variedades de tilápia do
Nilo não selecionadas que se cultivava, no Brasil. Segundo Zimmermann (2000) a
substituição de variedades não selecionadas por Chitralada em sistemas de gaiolas flutuantes
de São Paulo e Minas Gerais, no ano de 1999, fez com que o período de cultivo diminuísse de
oito para quatro meses e a conversão alimentar fosse mais eficiente. Além disso, quando
desafiada a densidades de até 550 peixes/m3, a população Chitralada produziu animais com
até 500 gramas em quatro meses. Em cultivos menos intensivos os resultados de Chitralada
são igualmente impressionantes, onde se obteve animais com peso médio de 600 gramas, em
viveiros com densidade de 8 peixes/m2, num período de quatro meses (ZIMMERMANN,
2000).
25

Um projeto de pesquisa colaborativo chamado „Genetic Improvement of Farmed


Tilapia (GIFT), iniciado em 1988, foi o responsável pelo desenvolvimento da variedade
GIFT. Este projeto foi executado nas Filipinas pelo International Center for Living Aquatic
Resources Management - ICLARM em cooperação com vários outros centros de pesquisa e se
iniciou pela comparação das performances de crescimento e sobrevivência apresentadas por
quatro linhagens de cativeiro asiáticas e quatro linhagens selvagens africanas de tilápia do
Nilo. Posteriormente, estas oito linhagens foram cruzadas por um grande número de gerações
de acordo com programas bem estabelecidos de melhoramento animal que ainda continua
sendo realizados (BENTSEN et al., 1998). Após cinco gerações de seleção, o desempenho de
crescimento da variedade GIFT obteve um ganho total de 65,8% quando comparada com a
população base (ASIAN DEVELOPMENT BANK, 2005). A variedade GIFT (Genetic
Improvement of Farmed Tilapia) foi introduzida no Brasil em 2005 pelo Departamento de
Zootecnia da Universidade Estadual de Maringá - Paraná com apoio do Instituto de tecnologia
Agropecuária de Maringá e com financiamento da Secretaria Especial de Aquicultura e Pesca
(SEAP-PR) (MASSAGO et al., 2010).
A variedade UFLA (Universidade Federal de Lavras) se originou a partir de 2.000
alevinos de O. niloticus doados pela Faculdade de Agricultura e Ciências Veterinárias da
UNESP, campus Jaboticabal, em 11 de novembro de 1977, atendendo ao pedido do professor
Álvaro João L. Almeida do Departamento de Zootecnia da Universidade Federal de Lavras -
DZO/UFLA. Esta população foi a primeira a povoar a Estação de Piscicultura do DZO/UFLA
quando inaugurada em 1978. A partir de então, programas de melhoramento genético para
ganho de peso e forma do corpo, baseados em seleção massal, foram realizados com esta
população ao longo de 25 anos. Nesta variedade, as características que mais se destacam são a
textura do filé e seu contínuo consumo de ração em temperaturas abaixo de18ºC (DIAS,
2014).
Mais exemplos de variedades amplamente cultivadas no Brasil e no mundo são as
tilápias vermelhas. Descobertos em 1968 em Taiwan - China, alguns exemplares desprovidos
de pigmentação escura na pele foram levados para o Taiwan Fisheries Research Institute onde
se iniciaram os primeiros estudos com estes animais. A partir de então as novas variedades se
disseminaram e demonstraram ter um grande potencial de mercado (HILSDORF, 1995).
Atualmente, algumas das principais variedades de importância comercial que vêm sendo
cultivadas pelo mundo são: Tailandesa, Filipina, Flórida, Saint-Peter e O. niloticus da
variedades Red-Stirling (MCANDREW et al., 1988; NANDI, 1997).
26

Animais das variedades Tailandesa e Filipina são híbridos resultantes do cruzamento


entre O. mossambicus e O. niloticus, (GALMAN; AVTALION, 1983; LIAO; CHANG,
1983). A variedade Flórida foi desenvolvida a partir de mutantes de coloração branca
pertencentes à espécie O. mossambicus. Saint-Peter é um tetra-híbrido produzido pelo
cruzamento entre machos híbridos de O. niloticus com O. aureus e fêmeas híbridas de O.
mossambicus com O. hornorum e, sua introdução no Brasil ocorreu no início da década de
1990 com indivíduos provenientes de Israel (SOUZA et al., 2000).
A variedade Red-Stirling foi produzida e inicialmente cultivada no início da década de
90 em um programa de melhoramento genético realizado no Instituto de Aquicultura da
Universidade de Stirling - Escócia a partir de indivíduos com corpo de coloração avermelhada
conferida por uma mutação genética (HUSSAIN, 1994). Huang et al. (1988) demonstraram
que a coloração vermelha do corpo é herdada como um único gene que possui dominância
incompleta e esta característica, chamada de vermelha, na verdade é conferida devido á
ausência da pigmentação preta, pela qual os melanóforos são responsáveis. Desta forma, a
coloração branca da carne somada à irrigação sanguínea da derme conferem um aspecto de
róseo a avermelhado aos animais (HILSDORF, 1995). Segundo Hilsdorf, 2014 (comunicação
pessoal)1, larvas de Red-Stirling foram trazidas ao Brasil no ano 2000 pela Empresa Brasileira
do Peixe Ltda. onde é mantido um estoque de reprodutores para fins de produção e pesquisa.

1
Informação fornecida por Hilsdorf no Laboratório de Genética de Organismos Aquáticos e
Aquicultura da Universidade de Mogi das Cruzes, em novembro de 2014.
27

2.3 Hormônio de Crescimento: Fisiologia e Estrutura Molecular

Nos vertebrados, o eixo somatrotófico é constituído pelo hormônio de crescimento


(growth hormone - GH), pelo hormônio liberador de hormônio de crescimento (growth
hormone realizing hormone - GHRH), pela somatostatina e por fatores de crescimento
semelhantes a insulina (insulin-likegrowth factors - IGFs) (SELLIER, 2000).
O processo de crescimento estimulado pelo GH se inicia com a produção desta
proteína, de aproximadamente 22 KDa de peso molecular, na proximal pars distails, região da
adenohipófise, e liberação na corrente sanguínea sob estímulo do hipotálamo. Sua liberação é
controlada por outros dois hormônios: a somatostatina, que atua como inibidor, e o GHRH
que atua como estimulante (BALDISSEROTTO, 2013). Então, O GH circulante se liga a
receptores específicos nos órgãos-alvo onde estimula a produção dos IGFs. O principal-órgão
alvo é o fígado, responsável pela produção de IGF-I e IGF-II, entretanto, o coração, os rins e
as gônadas também têm participação significativa na produção IGF-II em peixes (DAL-PAI et
al., 2014).
Os IGFs têm como função promover a mitogênese e a diferenciação celular e,
também, inibir a apoptose. Tem ação direta nas cartilagens e parece atuar também no
desenvolvimento do trato gastrointestinal. Em peixes adultos o IGF-I participa na manutenção
de neurônios e células da glia, já o IGF-II atua na diferenciação, manutenção e regeneração de
neurônios (BALDISSEROTTO, 2013).
Além de atuar diretamente no crescimento, o GH está envolvido em diversas funções
metabólicas dos vertebrados. Nos teleósteos, existem evidências de que o GH exerce
influência sobre o apetite e ingestão de alimento, síntese proteica e lipólise
(BALDISSEROTTO, 2013), interage com o sistema reprodutivo (TRUDEAU, 1997;
BENEDET et al., 2010) e atua na osmorregulação (SAKAMOTO et al., 1997).
GHs têm sido isolados de uma ampla variedade de vertebrados incluindo mamíferos,
aves, répteis, anfíbios e peixes. Embora haja uma diferença considerável na sequência de
aminoácidos quando se compara espécies de diferentes grupos taxonômicos, os GHs de todas
elas possuem aproximadamente 50-60% de estruturas em α-hélice e compartilham uma
estrutura tridimensional similar (CLACKSON et al., 1998). Entre os vertebrados, o gene GH
dos Agnatha é considerado como sendo o mais primitivo. Este, no curso da evolução, se
diversificou dando origem ao gene GH de vertebrados superiores e inferiores e aos genes da
28

prolactina e da somatostatina devido a eventos de duplicações gênicas (POEN;


PORNBANLUALAP, 2013).
A estrutura genômica do GH é caracterizada por possuir aproximadamente 2 Kb de
comprimento, com a região codificadora da proteína sendo formada por quatro a cinco exons,
o que representa menos de um terço do tamanho do gene (BART et al., 2010). A região
codificadora tende a ser altamente conservada entre os vertebrados, presumivelmente devido a
limitações funcionais na estrutura do hormônio, enquanto a região não-codificadora
demonstra ser polimórfica (MA et al., 2012).
Os genes GH dos tetrápodes (mamíferos, aves, répteis e anfíbios) e da maioria dos
teleósteos consistem de cinco exons e quatro introns (5:4) (POEN; PORNBANLUALAP,
2013). Entretanto, a organização exon-intron possui elevado grau de variabilidade nos peixes
(MA et al., 2012), sendo que membros das superordens Protacanthopterygii e
Acanthopterygii apresentam uma relação exon-intron 6:5 e os demais teleósteos se inserem no
grupo dos que apresentam a estrutura 5:4 (FIGURA 1) (POEN; PORNBANLUALAP, 2013).

FIGURA 1 – Comparação da organização exon/intron dos genes GH de diferentes grupos taxonomicos.


Quadrados representam os exons, linhas representam os introns e as setas indicam a inserção do intron V.
Fonte: Ma et al. (2012).

Tais informações levam a algumas implicações: (1) a inserção do intron V ao gene GH


de alguns peixes pode ter ocorrido depois que os peixes e os tetrápodes se diversificaram na
história evolutiva dos vertebrados (MA et al., 2012); (2) a presença de 6 exons no gene GH de
Perciformes e Salmoniformes, enquanto Cypriniformes e Siluriformes apresentam apenas 5,
implica na introdução do intron V ao gene GH de teleósteos após a divergência evolutiva das
ordens Perciformes e Salmoniformes (YOWE; EPPING, 1995).
O gene GH de O. niloticus, assim como de outros Perciformes, é constituído por 6
exons (exon I, 75 pb; exon II, 134 pb; exon III, 117 pb; exon IV, 144 pb; exon V, 147 pb; exon
29

VI, 259 pb) e 5 introns (intron I, 96 pb; intron II, 420 pb; intron III, 123 pb; intron IV, 72 pb;
intron V, 79 pb). Todos os introns se iniciam com um dinucleotídeo „GT‟ e terminam em um
„AG‟, de acordo com as sequências-consenso de sítios de splicing. Sua unidade transcricional
compreende uma região de 1.7 Kb, codificando um mRNA de 875 pb (BER; DANIEL,
1992). Nas tilápias (BER; DANIEL, 1992) e em outros teleósteos como salmonídeos e carpas,
o gene GH é representado por isoformas não alélicas duplicadas, designadas GH1 e GH2, as
quais divergiram, pelo menos 30 milhões de anos atrás, devido a um evento de duplicação
genômica. (SCHALBURG et al., 2008).
Ber e Daniel (1993) demonstraram que os genes GH1 e GH2 de O. niloticus são
altamente homólogos, com um arranjo de exons e introns muito similar (FIGURA 2) e
codificam polipeptídeos idênticos, o que explica a existência de apenas uma sequência
peptídica de GH caracterizada para a espécie. Esta baixa divergência existente entre as
sequências dos dois genes GH indica que o evento de duplicação genômica, responsável por
sua origem, é relativamente recente. A alta similaridade apresentada pelos GHs 1 e 2 se
estende até a base -628, upstream do ponto de início da transcrição, chamada de região de
junção, depois da qual as sequências dos dois genes não são altamente relacionadas entre si
(FIGURA 2). Por este motivo, os autores supõem que todos os elementos-cis regulatórios,
necessários para o controle da transcrição, encontram-se dentro dos -628 pb conservados para
os dois genes GH de O. niloticus (BER; DANIEL, 1993).

FIGURA 2 – Estrutura dos genes GH1 e GH2 de O. niloticus. Quadrados brancos representam as regiões 5‟
e 3‟ UTR transcritas, quadrados pretos indicam a região codificadora e as linhas entre os quadrados indicam
os introns. „T‟ representa o TATA box. „A‟ representa o sinal de poliadenilação. „J‟ representa a região de
junção, depois da qual os genes GH1 e GH2 diferem. Adaptado de: Ber; Daniel (1993).

Sabe-se que, em mamíferos, a expressão do gene GH é controlada pelo fator de


transcrição pituitária-específico Pit-1 (pituitary-specific transcription factor), o qual se liga a
elementos-cis ricos em AT, na região promotora (YOWE; EPPING, 1995). Ma et al. (2012)
30

identificaram no promotor do gene GH de Cynoglossus semilaevis, uma espécie de linguado,


sítios de ligação para os fatores de transcrição Pit-1/GHF-1, CRE, HNF-3β e TER. Moriyama
et al. (2006) também identificaram sequências de ligação para os fatores de transcrição Pit-
1/GHF-1, CRE e TER no promotor do gene GH de Petromyzon marinus, lampreia-marinha,
um dos representantes mais antigos dos vertebrados. Tais informações sugerem que o gene
GH de teleósteos é regulado por interações sinergéticas de um número de fatores de
transcrição com a região promotora, onde Pit-1/GHF-1, HNF-3β e TER são responsáveis,
especificamente, pela ativação do promotor (YAMADA et al., 1993). Com isto, pode-se
inferir que a região promotora é um importante alvo de estudo para melhor compreensão dos
mecanismos regulatórios do gene GH.
31

2.4 SNPs como Marcadores Moleculares

Marcadores moleculares são caráteres geneticamente determinados que resultam


diretamente de variações na sequência de DNA e que sofrem segregação segundo os padrões
de herança mendeliana entre as gerações (ANNE, 2006; FERREIRA; GRATTAPAGLIA,
1998). Assim, são considerados importantes ferramentas para quantificação da diversidade
genética e para a estimativa de parâmetros genéticos em animais de cultivo (VAN BERS et
al., 2012). Devido à evolução dos métodos de biologia molecular ao longo dos anos,
principalmente o advento da tecnologia do DNA recombinante, da técnica de PCR e do
sequenciamento automático de DNA, se tornou possível explorar novos marcadores
moleculares como os Minissatélites, Microssatélites e SNPs (FALEIRO, 2007;
SCHLÖTTERER, 2004).
Um marcador do tipo SNP (Single Nucleotide Polymorphism) se caracteriza pela
mudança de um único nucleotídeo em determinada sequência de DNA, mudança esta que
possui duas bases alternativas em um locus. Para que uma alteração nucleotídica seja
considerada SNP, o alelo menos frequente deve aparecer em uma frequência de 1% ou mais
na população de estudo (LI et al., 1981). Mesmo que, em princípio, qualquer uma das quatro
bases nitrogenadas possa aparecer em determinada posição da sequência de DNA, na prática,
os SNPs são bialélicos. Uma das razões para que isto ocorra é o fato de que as substituições
nucleotídicas que dão origem aos SNPs acontecem com baixíssima frequência. Outra razão é
devido a um enviesamento das mutações, levando à prevalência de SNPs que surgem devido a
mutações do tipo transição (LI et al., 1981; MARTINEZ-ARIAS et al., 2001).
Existem dois tipos de mecanismos que levam ao surgimento de mutações, sendo eles:
transições, que consistem nas trocas purina-purina (A↔G) ou pirimidina-pirimidina (C↔T);
e transversões, que consistem nas trocas purina-pirimidina (A↔C, A↔T, G↔C, G↔T) ou
pirimidina-purina (C↔A, C↔G, T↔A, T↔G). As transições são, em média, duas vezes mais
comuns que as transversões em diversas espécies. Uma possível explicação para isto é a alta
taxa de desaminação espontânea da 5-metil citosina (5mC) para timina nos sítios CpG,
levando à geração de altas taxas de SNPs do tipo C↔T (COOPER; KRALCZAK, 1989).
Alguns autores também consideram inserções ou deleções de uma base nitrogenada como
SNPs, mesmo que estes ocorram por meio de mecanismos totalmente diferentes daqueles que
causam trocas de bases nitrogenadas (VIGNAL et al., 2002).
32

SNPs constituem o tipo de polimorfismo mais abundante nos genomas, podendo


ocorrer tanto em regiões não gênicas quanto em regiões gênicas, sendo mais abundantes nas
não gênicas (LIU; CORDES, 2004). Por possuírem herança co-dominante e alta
adaptabilidade para genotipagens automáticas em larga escala, os SNPs vem sendo
frequentemente utilizados em estudos de associação a características de desempenho de
espécies importantes para os setores agropecuário e aquícola e servindo como base para
programas de melhoramento genético assistido por marcadores moleculares (WANG et al.,
2008).
Neste contexto, SNPs foram mapeados em genes candidatos para qualidade de carne
em bovinos (HAEGEMAN et al., 2003) e significativamente associados com peso, taxa
metabólica e consumo alimentar em gado de corte (LU et al., 2014). Marcadores deste tipo
também foram identificados nos genes da Leptina e do Neuropeptideo Y e demonstrou-se que
possuíam associação significativa com característica de crescimento, produção de leite e
fertilidade em vacas holandesas (CLEMPSON et al., 2011). Fontanesi et al. (2010)
identificaram SNPs nos genes do IGF-II e da Catepsina D e verificaram sua associação a
características de desempenho de porcos da raça Duroc, segundo os autores tais
polimorfismos podem ser usados para melhorar a eficiência de seleção em programas de
melhoramento genético assistidos por marcadores moleculares (FONTANESI et al., 2010).
No setor aquícola, seleções bem sucedidas para taxas de crescimento ideal ou peso
corporal são objetivos fundamentais. Para isto, estudos com SNPs vêm sendo realizados e
genes responsáveis pela produção dos hormônios que constituem o eixo somatrotófico se
tornaram importantes alvos para identificação destes marcadores e para estudos de associação
com características de desempenho (SALEM et al., 2012). Nadjar-Boger e Funkenstein
(2011) identificaram vários SNPs na região promotora do gene da Miostatina de S. aurata e
demonstraram que existe uma possível relação entre alguns diferentes alelos e a taxa de
crescimento dos peixes estudados (NADJAR-BOGER; FUNKENSTEIN, 2011).
Uma mutação pontual foi identificada no intron III do gene GH1 de salmão do
Atlântico e foi verificado que a distribuição das frequências haplotípicas e genotípicas não
eram homogêneas entre as diferentes classes de peso da população estudada, indicando a
existência de algum tipo de associação entre o polimorfismo do gene GH1 e o crescimento.
Os autores deste estudo ressaltam que polimorfismos localizados em introns não são,
necessariamente, mutações neutras por estarem localizadas em regiões não codificadoras do
33

gene, pois efeitos de ligação entre genes e regiões gênicas são possíveis (GROSS; NILSSON,
1999).
Em estudo de associação entre SNPs, localizados em genes do eixo somatrotófico, e
taxa de crescimento de Salvelinus alpinus, Tao e Boulding (2003) identificaram quatro SNPs
no gene GH1, um deles na região promotora, um no exon V e outros dois nos introns I e II.
Suas análises demonstraram que o SNP detectado no exon teve associação significativa com o
peso inicial dos animais estudados (TAO; BOULDING, 2003).
Estudos com O. niloticus envolvendo marcadores moleculares do tipo SNPs tem sido
publicados recentemente. Van Bers et al. (2012), identificaram 33569 SNPs no genoma da
variedade GIFT e desenvolveram um conjunto de 384 SNPs que permitiram a distinção entre
indivíduos de diferentes variedades e espécies de tilápia. Os autores demonstraram que estes
resultados são úteis para avaliar a diversidade genética de populações selvagens de O.
niloticus em áreas onde tilápias foram ou podem ser introduzidas e, além disso, podem ser
utilizados no setor aquícola, auxiliando programas de melhoramento genético da espécie
(VAN BERS et al., 2012). Xia et al. (2014) identificaram e mapearam um grande número de
SNPs no genoma de O. niloticus e, utilizando 101 destes SNPs, avaliaram a estruturação
populacional de diferentes variedades e espécies. Com isso, os autores afirmam que estes
SNPs serão utilizados para monitorar a diversidade genética e para o desenvolvimento de
programas de melhoramento genético da espécie (XIA et al., 2014).
O único estudo envolvendo SNPs, especificamente, no gene GH de tilápias do Nilo foi
realizado por Blanck et al. (2009), onde um polimorfismo foi identificado no intron I do gene
GH1 por meio da técnica de PCR-RFLP. O estudo, realizado com as variedades Chitralada e
GIFT da espécie O. niloticus, demonstrou que este SNP pode ter associação direta com
características corporais, pois maior porcentagem dos animais que apresentaram genótipo
heterozigoto mostrou melhor desempenho quanto às características de comprimento total,
comprimento padrão, altura e largura. Portanto, observa-se a necessidade de mais estudos para
identificação de SNPs no gene GH de peixes com importância comercial objetivando avanços
nos métodos de seleção para melhoramento genético (BLANCK et al., 2009).
34

3 OBJETIVOS

3.1 Objetivo Geral

Prospectar SNPs no promotor e no intron I do gene GH1 de variedades de O. niloticus


e verificar a associação destes SNPs com o crescimento de duas variedades comerciais da
espécie (Red-Stirling e Chitralada).

3.2 Objetivos Específicos

 Prospectar SNPs no promotor e no intron I do gene GH1 de quatro variedades


comerciais de O. niloticus (Red-Stirling, Chitralada, GIFT e UFLA);
 Avaliar o desempenho de crescimento de indivíduos pertencentes às variedades Red-
Stirling e Chitralada, pertencentes a um plantel comercial;
 Verificar se existe associação dos SNPs identificados com o crescimento das duas
variedades citadas acima.
35

4 MATERIAL E MÉTODOS

4.1 Material Biológico e Procedência dos Animais

Na etapa de prospecção de SNPs foram utilizados 100 animais, pertencentes a quatro


variedades de O. niloticus (FIGURA 3): Genetic Improvement of Farmed Tilapias – GIFT (n
= 25), Universidade Federal de Lavras - UFLA (n = 25), ambas pertencentes ao plantel da
Universidade Federal de Lavras; Chitralada – CHIT (n = 25) e Red-Stirling – REDS (n = 25),
pertencentes ao plantel comercial da Empresa Brasileira do Peixe Ltda. (EBP) em Itupeva –
SP.
Para a etapa de associação de SNPs com crescimento, foram utilizados 200 animais
pertencentes às variedades RED (n=100) e CHIT (n=100), também fornecidos pela EBP.
Após coleta das amostras, os animais pertencentes a esta fase do estudo foram acondicionados
em tanques-rede, nas próprias instalações da EBP, onde permaneceram acondicionados até o
final do estudo.

FIGURA 3 – Variedades de Oreochromisniloticus utilizadas no estudo: GIFT (A), CHIT (B), UFLA (C)
e RED (D). Fonte: DIAS, 2014.
36

4.2 Extração de DNA Genômico

Uma porção de aproximadamente 25 mg foi retirada da nadadeira caudal de cada


indivíduo, a qual foi armazenada em Etanol 95% e posteriormente utilizada para a extração do
DNA genômico por método baseado em precipitação por altas concentrações de sal, descrito
por Aljanabi e Martinez (1997), com adaptações.
No momento da extração de DNA os tecidos foram colocados em microtubos
individuais de 1,5 mL, onde foi realizada reidratação com 500 µL de tampão Tris-EDTA 1X
(TE), por aproximadamente 15 minutos. O TE foi retirado do tubo e adicionou-se 500 µL de
Tampão de Lise contendo: 50 mM de Tris HCl; 50 mM de EDTA pH 8; SDS 1% e 50 mM de
NaCl. Acrescentou-se a cada amostra 10 µL de Proteinase K (10 mg/mL), as quais foram
incubadas a 55 ºC por aproximadamente 2 horas, ou até total digestão do tecido. Após a
incubação, foram adicionados 5 µL de RNase A (10 mg/mL) e realizada uma segunda
incubação de 37 ºC por 30 minutos.
As amostras foram centrifugadas na velocidade de 20.800 rcf por 15 minutos e 500 µL
do sobrenadante foram transferidos para novos microtubos, devidamente identificados para
cada amostra. Após a transferência, foi acrescentado ao sobrenadante 300 µL de NaCL (5 M),
foi feita uma breve homogeneização com auxílio de um agitador automático e uma nova
centrifugação de 15 minutos na velocidade de 20.800 rcf. Então, 600 µL de sobrenadante
foram transferidos para novos microtubos, aos quais foram adicionou-se 600 µL de
isopropanol absoluto a -20 ºC com posterior homogeneização manual. As amostras foram
incubadas em freezer a -20 ºC durante uma noite.
No segundo dia as amostras foram retiradas do freezer e levadas diretamente para a
centrifuga, onde foram centrifugadas por 15 minutos em velocidade de 20.800 rcf na
temperatura de 4 ºC. Após centrifugação todo o líquido sobrenadante foi descartado dos
microtubos, onde restaram apenas sedimentos de DNA. Foi realizada lavagem com 750 µL de
Etanol (70%), com cuidado para não desintegrar os sedimentos aderidos ao fundo dos tubos.
O Etanol foi descartado e os tubos foram deixados com a abertura voltada para baixo sobre
papel toalha até completa secagem. Por fim, as amostras foram ressuspendidas em 100 µL de
H2O deionizada esterilizada e armazenadas em freezer a -20 ºC.
A eficiência do procedimento de extração foi avaliada por meio de eletroforese
horizontal em gel de agarose (0,8%), nos quais foram aplicados 3 µL de solução de DNA
genômico, corados com GelRed Nucleic Acid Gel Stain (Biotium Uniscience). O marcador de
37

peso molecular λ Hind III (Fermentas) foi utilizado como referência. Os géis foram revelados
e fotografados em fotodocumentador ImageQuant 300 (GE Healthcare Life Sciences). As
amostras de DNA genômico foram armazenadas em freezer a temperatura de -20 ºC.
38

4.3 Amplificação e Sequenciamento da Região Alvo do Gene GH1

Neste estudo foi denominada „região alvo‟ a sequência que compreende desde 800 pb
upstream à base +1 até o último nucleotídeo do intron I do gene GH1, ou seja, um fragmento
com aproximadamente 1.000 pb (FIGURA 4).
Para amplificar esta região foram utilizados dois primers: TnPr1F e On_R1 (FIGURA
4 e TABELA 2). O primeiro é um primer foward, complementar à região promotora do gene
GH1 e desenvolvido por Dias (2014). O segundo é um primer reverse, complementar às
porções final do exon II e inicial do intron II, desenvolvido com auxílio dos programas
Primer3 v. 0.4.0 e OligoAnalyzer (IDT), com base na sequência referência do gene GH1 de
tilápia do Nilo (BER; DANIEL, 1993), disponível no GenBank (número de acesso:
M97766.1).

FIGURA 4 – Primers construídos para amplificação da região alvo: primer TnPr1F em violeta e primer
On_R1 em azul. Letras minúsculas: promotor e introns. Letras maiúsculas em negrito: exons I e II.
Sublinhado e em negrito: TATA box. Em verde: códon de início da tradução.

As reações de PCR foram preparadas para um volume final de 25 µL contendo: Taq


Buffer 1X; 1,5 mM de MgCl2; 0,2 mM de dNTP; 0,2 mM de cada primer; 1 U de Taq DNA
polimerase; 0,5 µL de DNA genômico; H2O deionizada q.s.p. 25 µL. A amplificação foi
executada em termociclador Veriti® (Applied Biosystems) utilizando o seguinte programa: 1
ciclo de 94 °C por quatro minutos para desnaturação inicial; 35 ciclos de 94 °C por 1 minuto
para desnaturação, 67 °C por 1 minuto para anelamento dos primers e 72 °C por 1 minuto e
30 segundos para extensão; 1 ciclo de 72 °C por 10 minutos para extensão final.
39

A eficiência da amplificação foi verificada por eletroforese horizontal em gel de


agarose (2%) onde foram aplicados 2 µL dos produtos de PCR, corados com GelRed Nucleic
Acid Gel Staim (Biotium Uniscience), usando como referência o marcador de peso molecular
100 pb (Life Thechnologies). Os géis foram revelados e fotografados em fotodocumentador
ImageQuant 300 (GE Healthcare Life Sciences).
Para sequenciar a região alvo foram construídos quatro novos primers (On_Fsec1,
On_Fsec2, On_Rsec1 e On_Rsec2) (TABELA 2) usando a mesma sequência referência citada
acima. Portanto, os primers utilizados na amplificação não foram os mesmos utilizados no
sequenciamento, sendo estes mais internos (FIGURA 5), permitindo melhor anelamento na
região que se deseja sequenciar.

FIGURA 5 – Primers construídos para sequenciamento da região alvo. Cinza: primer On_Fsec1; Violeta:
primer On_Fsec2; Azul: primer On_Rsec1 e Amarelo: primer On_Rsec2. Verde: códon de início da tradução.
Letras minúsculas: promotor e introns. Letras maiúsculas em negrito: exons I e II. Sublinhado e em negrito:
TATA box.

TABELA 2 - Descrição dos primers utilizados para amplificação da região alvo e para
sequenciamento.
Primer Sequência do Primer (5’-3’) Região do Gene GH Autor
TnPr1F CCAGCATGTTTGCACTGAGTA Promotor DIAS, 2014
Desenvolvido
On_R1 TGCTGCAGGCTTACAAAGTC Exon II e Intron II
neste estudo
Desenvolvido
On_Fsec1 GCACTGAGTAGGAGATGCTCTG Promotor
neste estudo
Desenvolvido
On_Fsec2 GTCAAACTGTCGGTGTGAACAT Promotor
neste estudo
Desenvolvido
On_Rsec1 CTGGTGACTAAAGTGCTCTGAC Promotor
neste estudo
Desenvolvido
On_Rsec2 GTGACTCTGTTGACTGCAATGG Exon II
neste estudo
40

As amostras que obtiveram sucesso na amplificação tiveram seu volume total (23 µL)
corado com GelRed Nucleic Acid Gel Stain (Biotium Uniscience) e aplicado em novos géis de
agarose com canaletas de 84 mm3. Após eletroforese, as bandas foram observadas sob luz
ultravioleta em fotodocumentador Image Quant 300 (GE Healthcare Life Sciences),
recortadas com auxílio de um bisturi e colocadas em microtubos novos de 1,5 mL. A
purificação foi feita com KIT illustraGFX Gel Band Purification da GE Healthcare Life
Sciences.
Neste trabalho optou-se pela purificação a partir do recorte das bandas do gel de
agarose, pois este método permite obtenção de um produto mais puro, livre de qualquer banda
inespecífica que possa ter sido amplificada durante o processo de PCR e que não pôde ser
visualizada no gel por apresentar baixa concentração. Os produtos purificados tiveram sua
concentração ajustada para 50 ng/µL, foram organizadas em placas de 96 poços e, enviados
pra o DNA Sequencing Service da empresa Macrogen na Coreia (de acordo com as
especificações da empresa).
41

4.4 Prospecção de SNPs

As sequências obtidas tiveram sua qualidade avaliada por meio da observação dos
cromatogramas no programa CodonCode Aligner, o qual também foi utilizado para montagem
das sequências-consenso (contigs) de cada indivíduo.
Os contigs referentes aos 100 indivíduos foram exportados em formato FASTA e
alinhados, com auxílio da ferramenta ClustalW do programa MEGA 5.0 para identificação de
SNPs.
Segundo Vignal et al. (2002), para que um locus com sequências alternativas seja
considerado SNP, o alelo menos frequente deve aparecer com frequência de 1%, ou mais, na
população. Levando em conta que na população de prospecção deste estudo 1% equivale a um
indivíduo, elevamos a frequência mínima para 2%, para que os resultados fossem mais
confiáveis.
Para cada SNP identificado as frequências alélicas e genotípicas foram calculadas e,
além disso, foi realizada inferência dos blocos genotípicos presentes na população assim
como cálculo de suas respectivas frequências. Considerou-se como bloco genotípico o
conjunto de genótipos pertencentes a um determinado indivíduo, ou seja, os genótipos
referentes a todos os SNPs identificados.
42

4.5 Associação de SNPs com Crescimento

4.5.1 Acompanhamento do Crescimento

Toda a etapa de acompanhamento de crescimento foi conduzida nas Fazendas Santa


Ignês e Rio das Pedras, propriedades da Empresa Brasileira do Peixe Ltda. (EBP), localizadas
às margens da Rodovia Dom Gabriel Bueno Paulino Couto, km 73,5 Serra do Japi, Itupeva,
SP.
Com 90 dias de cultivo, os juvenis foram identificados por microchips eletrônicos e
uma amostra de tecido caudal de aproximadamente 2 cm foi retirada de cada indivíduo. Após
isso, os animais foram separados por sexo e pesados para serem divididos em quatro classes
de peso. Portanto, havia oito tanques-rede no total, quatro para machos e quatro para fêmeas,
sendo que nos tanques-rede com o número „1‟ estavam os peixes de menor peso e nos
tanques-rede com o número „4‟, os de maior peso (FIGURA 6). Cada tanque-rede possuía 4
m3 e malha de 20 mm entrenós, com berçários de 2m3 de volume útil e malha multifilamento
de 5 mm entrenós
Os animais foram divididos desta forma com a finalidade de evitar efeito de ambiente
comum sobre o crescimento para explorar o máximo desempenho e diminuir a dominância,
possibilitando uma melhor comparação entre as variedades, ressaltando que a identificação de
cada indivíduo era possível devido à leitura dos microchips.

FIGURA 6 – Esquema dos tanques-rede onde os animais estudados na fase de associação foram mantidos
durante o período de acompanhamento do crescimento. Os números de 1 a 4 se referem às diferentes classes
de peso.
43

A única característica de desempenho avaliada ao longo do experimento foi peso e,


para acompanhar o crescimento dos animais foram realizadas quatro pesagens no período de
janeiro a março de 2014, com intervalo de 21 dias entre uma pesagem e outra. No momento
das pesagens, os animais eram alocados em baldes contendo água proveniente do mesmo
tanque onde se encontravam. Os animais foram anestesiado com benzocaína numa
concentração de 135 mg/L (COSTA, 2011) para tornar possível seu manuseio e pesagem em
balança analítica com precisão de duas casas após a vírgula,
44

4.5.2 Genotipagem da População de Associação

Os 200 indivíduos referente à população de associação foram genotipados seguindo as


mesmas análises moleculares que foram utilizadas para a prospecção de SNPs e,
posteriormente, as frequências alélicas e genotípicas de cada SNP foram calculadas. Além
disso, foram inferidos os blocos genotípicos e suas respectivas frequências.
45

4.5.3 Análises Estatísticas

Uma análise descritiva dos pesos observados em cada bloco genotípico foi realizada
para as quatro mensurações, utilizando a função summary ( ) do pacote lme4 do programa R
(BATES et al., 2014).
Para avaliara a associação dos SNPs com o peso, um modelo linear misto univariado
foi utilizado para cada pesagem, considerando-se como efeitos fixos: grupo de
contemporâneos de idade, tanque-rede (classe de peso inicial) e sexo do animal; e aleatórios:
grupamento genético e SNPs.
Na forma matricial, o modelo correspondente é:
y  X  Z1 g gg  Z 2 g GHP1  Z 3 g GHP 2  ...  Z11g GHP10  e

Sendo que:
y é o vetor de observações de pesos dos animais;

 é o vetor de efeitos fixos somados à média;


g gg é o efeito aleatório de grupamento genético com distribuição ~ N (0, I 1 ) e

 1   e /  gg ;

g GHP. são os efeitos aleatórios de cada SNP com distribuição ~ N (0, I  ) e .

 .   e /  GHP. ;
e é o vetor de erros com distribuição ~ N (0, I e ) ;

X , Z1 , Z 2 , ..., Z11 representam as matrizes de incidência para os referidos efeitos,

respectivamente.
As funções lmer( ) e ranef ( )do pacote lme4 do programa R (BATES et al., 2014)
foram utilizadas para estimação e predição dos efeitos aleatórios do modelo linear misto em
duas etapas: por bloco genotípico e por SNP, com nível de significância (P) de 5%.
46

5 RESULTADOS

5.1 Análises Moleculares

5.1.1 Extração de DNA

Neste tópico serão apresentados os resultados referentes às amostras dos 300


indivíduos utilizados neste estudo, ou seja, se referem tanto à etapa de prospecção quanto à de
associação. As imagens dos géis de agarose mostram apenas algumas das amostras para fins
de exemplificação.
Com as imagens dos géis de agarose (FIGURA 7) foi possível verificar a integridade
do material genético extraído amostras. A concentração não foi aferida, pois pela intensidade
das bandas era possível saber que havia concentração suficiente para preparação das reações
de PCR, portanto as soluções de DNA foram utilizadas sem diluição.

FIGURA 7 – Eletroforese em gel de agarose 0,8%, referente à extração de DNA por método baseado
em precipitação por altas concentrações de sal. Canaletas 1 e 11: Marcador de peso molecular λ Hind III
(Fermentas).
47

5.1.2 Amplificação da Região Algo

Foram verificadas bandas nítidas, de alta concentração e com peso molecular de


aproximadamente 1000 pb (FIGURA 8). O peso molecular das bandas mostra que os primers
TnPr1F e On_R1 anelaram-se às regiões corretas, pois os mesmos foram construídos com
1.107 pb de distância.
Em todas as amostras observou-se uma banda inespecífica de baixíssima concentração
(FIGURA 8) e, ajustes nas condições de amplificação não foram eficientes para eliminá-las.
Por este motivo, optamos por purificar as bandas de interesse utilizando método de
purificação a partir de seu recorte do gel de agarose.

FIGURA 8 – Eletroforese em gel de agarose 2,0%, referente às reações de PCR realizadas com o DNA
genômico de 38 indivíduos. Canaletas 1 e 21: Marcador de peso molecular 100 pb (Life Thechnologies).
Circuladas em vermelho: bandas inespecíficas de baixa concentração.
48

5.1.3 Purificação da Região Alvo

As amostras recortadas (FIGURA 9) foram purificadas e novamente analisadas em gel


de agarose, onde as mesmas foram quantificadas por meio da comparação com as bandas do
marcador. Foi verificada ausência total de bandas inespecíficas e as concentrações variaram
entre 50 ng e 100 ng (FIGURA 10).

FIGURA 9 – Eletroforese em gel de agarose 2,0%. Produtos de PCR a serem purificados. Canaletas 1 e 13:
Marcador de peso molecular GeneRuler 100 bp (Thermo Scientific). Circuladas em azul: bandas de interesse
recortadas para purificação.

FIGURA 10 – Eletroforese em gel de agarose 2,0%. Amostras purificadas. Canaletas 1 e 18: Marcador
para peso molecular e concentração, Low DNA Mass (Life Technologies).
49

5.1.4 Sequenciamento

As sequências geradas tiveram seus cromatogramas analisados, sendo consideradas de


boa qualidade aquelas que apresentaram picos bem definidos e sem sobreposições (FIGURA
11). As amostras com cromatogramas de baixa definição foram descartadas e os dados dos
indivíduos correspondentes não foram utilizados nas análises de prospecção e de associação.

FIGURA 11 – Cromatograma de sequenciamento observado no programa CodonCode Aligner.


50

5.2 Prospecção de SNPs

Dos 100 indivíduos amostrados para esta etapa do estudo, as sequências de 5 deles
foram descartadas das análises, pois apresentaram cromatogramas de baixa qualidade que
poderiam prejudicar a identificação de mutações pontuais.
A identificação de polimorfismos de nucleotídeo único foi realizada por meio do
alinhamento (FIGURA 12) das sequências-consenso obtidas a partir dos 95 indivíduos
restantes, sendo: 20 CHIT, 25 REDS, 25 GIFT e 25 UFLA.

FIGURA 12 – Alinhamento das sequências-consenso dos indivíduos pertencentes à etapa de prospecção


de SNPs no programa MEGA 5.0. Em destaque estão alguns dos SNPs identificados.

Nove SNPs foram identificados na região promotora e um na região 5‟ UTR do gene


GH (FIGURA 13). Os SNPs foram nomeados de acordo com a ordem (5‟→3‟) com que se
dispõem na sequência, sete deles são caracterizados por mutações do tipo transição e três, por
mutações do tipo transversão (TABELA 3).
Nenhum dos SNPs está posicionado dentro de uma possível região de ligação de
fatores de transcrição, entretanto, alguns estão muito próximos aos mesmos (FIGURA 13). Os
sítios de ligação de fatores de transcrição foram marcados segundo Almuly et al. (2005),
estudo no qual a região promotora proximal de Sparus aurata é comparada com a sequência
de outras espécies, incluindo O. niloticus.
51

TABELA 3 - Relação dos SNPs identificados e suas respectivas posições na


sequência do gene GH1 de Oreochromis niloticus.
Localização na
SNP (locus) Substituição Tipo de Mutação
Sequência
GHP1 C-G -672 Transversão

GHP2 G-A -648 Transição


GHP3 T-G -623 Transversão
GHP4 G-A -220 Transição
GHP5 C-G -199 Transversão
GHP6 T-C -177 Transição
GHP7 G-A -165 Transição
GHP8 G-A -131 Transição

GHP9 A-G -16 Transição


GHP10 C-T 37 Transição

FIGURA 13 – SNPs identificados na região alvo do gene GH1 de Oreochromis niloticus (destacados em
vermelho). Possível região promotora em letras minúsculas e exon I em letras maiúsculas em negrito.
Possíveis regiões de ligação de fatores de transcrição estão sublinhadas e em negrito com suas respectivas
identificações acima. Destacado em cinza está o códon de início da tradução.

As frequências alélicas de cada SNP foram estimadas considerando as variedades


individualmente, e o total da população de prospecção (TABELA 4). A menor frequência
alélica total foi de 1,58%, referente aos alelos alternativos (alelo de menor frequência total)
dos loci GHP4, GHP5 e GHP10.
52

No geral, as frequências apresentadas pelos alelos alternativos foram muito baixas,


com exceção, dos loci GHP8 e GHP9 nas variedades CHIT e REDS. Apenas na variedade
REDS os alelos alternativos destes dois loci aparecem em maior frequência que os alelos
originais (72% e 68%, respectivamente) (TABELA 4).

TABELA 4 - Frequências alélicas dos SNPs identificados na população de prospecção.


SNP Alelo F. Total (%) F. CHIT (%) F. REDS (%) F. GIFT (%) F. UFLA (%)
GHP1 C 97,89 95 100 100 96
G 2,11 5 0 0 4
GHP2 G 97,89 95 100 100 96
A 2,11 5,00 0 0 4
GHP3 T 90 97,50 100 76 88
G 10 2,50 0 24 12
GHP4 G 98,42 95 100 100 98
A 1,58 5 0 0 2
GHP5 C 98,42 95 100 100 98
G 1,58 5 0 0 2
GHP6 T 82,11 87,50 100 66 76
C 17,89 12,50 0 34 24
GHP7 G 82,11 87,50 100 66 76
A 17,89 12,50 0 34 24
GHP8 G 77,37 82,50 28 100 100
A 22,63 17,50 72* 0 0
GHP9 A 78,42 82,50 32 100 100
G 21,58 17,50 68* 0 0
GHP10 C 98,42 95 100 100 98
T 1,58 5 0 0 2
* Alelos alternativos com maior frequência que alelos originais.

Na TABELA 5 são apresentadas as frequências genotípicas estimadas para cada SNP,


considerando as variedades separadamente, e a população de prospecção como um todo. Os
loci GHP6, GHP7, GHP8 e GHP9 foram mais variáveis que os demais e alguns SNPs
apresentaram genótipos exclusivos em determinadas variedades. A variedade CHIT
apresentou quatro genótipos exclusivos: „TG‟ do locus GHP3, AA do locus GHP4, „GG‟ do
locus GHP5 e „TT‟ do locus GHP10. A variedade UFLA apresentou três genótipos
exclusivos: „GA‟ do locus GHP4, „CG‟ do locus GHP5 e „CT‟ do locus GHP10. Genótipos
exclusivos não foram identificados nas variedades REDS e GIFT.
53

TABELA 5 - Frequências genotípicas dos SNPs identificados na população de prospecção.


Genótipo F. Total (%) F. CHIT (%) F. REDS (%) F. GIFT (%) F. UFLA (%)
GHP1 CC 97,89 95 100 100 96
GG 2,11 5 0 0 4
CG 0 0 0 0 0
GHP2 GG 97,89 95 100 100 96
AA 2,11 5 0 0 4
GA 0 0 0 0 0
GHP3 TT 89,47 95 100 76 88
GG 9,47 0 0 24 12
TG 1,05 5* 0 0 0
GHP4 GG 97,89 95 100 100 96
AA 1,05 5* 0 0 0
GA 1,05 0 0 0 4*
GHP5 CC 97,89 95 100 100 96
GG 1,05 5* 0 0 0
CG 1,05 0 0 0 4*
GHP6 TT 73,68 75 100 56 64
CC 9,47 0 0 24 12
TC 16,84 25 0 20 24
GHP7 GG 73,68 75 100 56 64
AA 9,47 0 0 24 12
GA 16,84 25 0 20 24
GHP8 GG 73,68 80 16 100 100
AA 18,95 15 60 0 0
GA 7,37 5 24 0 0
GHP9 AA 74,74 80 20 100 100
GG 17,89 15 56 0 0
AG 7,37 5 24 0 0
GHP10 CC 97,89 95 100 100 96
TT 1,05 5* 0 0 0
CT 1,05 0 0 0 4*
*Genótipos exclusivos para a variedade.

Foram identificados 10 blocos genotípicos diferentes na população de prospecção,


(nomeados de A a J) (TABELA 6), dos quais, „A‟ e „F‟ foram exclusivos para a variedade
CHIT, „G‟ e „H‟ exclusivos para a variedade REDS e “J” exclusivo para a variedade UFLA.
Os blocos genotípicos „A‟, „F‟, „G‟, „H‟ e „J‟ foram os que apresentaram menor frequência
total (1,05%), o que equivale a apenas um indivíduo, já o bloco genotípico “E” foi o mais
frequente em todas as variedades, apresentando uma frequência total de 45,26% (TABELA
7).
54

TABELA 6 - Blocos Genotípicos Apresentados pela População de Prospecção.


Bloco Genotípico GHP1 GHP2 GHP3 GHP4 GHP5 GHP6 GHP7 GHP8 GHP9 GHP10
A CC GG TG GG CC TC GA GG AA CC
B CC GG TT GG CC TC GA GG AA CC
C CC GG TT GG CC TT GG AA GG CC
D CC GG TT GG CC TT GG AG AG CC
E CC GG TT GG CC TT GG GG AA CC
F GG AA TT AA GG TT GG GG AA TT
G CC GG TT GG CC TT GG AA GA CC
H CC GG TT GG CC TT GG AG AA CC
I CC GG GG GG CC CC AA GG AA CC
J GG AA TT AG CG TT GG GG AA TC

TABELA 7 - Frequências dos Blocos Genotípicos da População de Prospecção.


FREQ. FREQ. FREQ. FREQ.
Bloco Genotípico F. TOTAL (%)
CHIT (%) REDS (%) GIFT (%) UFLA (%)
A 1,05 5* 0 0 0
B 15,79 20 0 20 24
C 17,89 15 56 0 0
D 6,32 5 20 0 0
E 45,26 50 16 56 60
F 1,05 5* 0 0 0
G 1,05 0 4* 0 0
H 1,05 0 4* 0 0
I 9,47 0 0 24 12
J 1,05 0 0 0 4*
*Blocos genotípicos exclusivos para a variedade.

A presença de genótipos e blocos genotípicos exclusivos para determinadas variedades


demonstra que foi possível aumentar a variabilidade genética amostrada por meio da inclusão
de diferentes variedades genéticas na população de prospecção, compensando o baixo número
amostral utilizado nesta etapa do estudo.

5.3 Associação de SNPs com Crescimento


55

5.3.1 Acompanhamento do Crescimento

As médias dos pesos de fêmeas e machos de REDS e CHIT foram calculadas


separadamente e, com estes dados, estimaram-se suas curvas de crescimento (FIGURAS 14 e
15). Assim, verificou-se que a variedade CHIT atingiu maior peso médio total (97 gramas)
que a variedade REDS (65 gramas) durante o mesmo período e em iguais condições de
cultivo. Além disso, machos apresentaram maior crescimento que fêmeas em ambas as
variedades. O peso médio em CHIT foi de 111 gramas para machos e 80 gramas para fêmeas,
enquanto em REDS o peso médio foi de 66,5 gramas para machos e 63,5 gramas para fêmeas.
As curvas de crescimento não atingiram o ponto de inflexão, revelando que os animais
ainda estavam na fase exponencial do crescimento (FIGURAS 14 e 15). Pesagens
subsequentes não foram realizadas devido à chegada do outono, período no qual as
temperaturas começam a diminuir e o manejo dos peixes deve ser interrompido para evitar
altos índices de mortalidade.

FIGURA 14 – Curva de crescimento das médias de pesos de machos e fêmeas pertencentes à


variedade REDS.
56

FIGURA 15 – Curva de crescimento das médias de pesos de machos e fêmeas pertencentes à


variedade CHIT.
57

5.3.2 Genotipagem da população de associação

Dos 200 indivíduos que constituíam a população de associação, nove da variedade


REDS e 17 da variedade CHIT foram excluídos das análises por terem apresentado
sequências de baixa qualidade, impossibilitando sua genotipagem.
Na TABELA 8 as frequências alélicas da população de associação são apresentadas.
Para a maioria dos SNPs, a frequência total do alelo alternativo foi inferior a 2%, sendo que a
menor frequência (0,87%) foi verificada para o alelo „A‟ do locus GHP4. Na variedade REDS
os únicos alelos alternativos, pertencentes aos loci GHP8 e GHP9, apareceram com
frequência de 10,56%, mostrando que a variedade CHIT foi responsável por maior parte da
variabilidade presente na população de associação.
A inferência das frequências genotípicas (TABELA 9) demonstrou que a variedade
REDS possui baixa variabilidade genética, apresentando genótipos alternativos apenas nos
loci GHP8 e GHP9. Os genótipos heterozigotos dos loci GHP1 e GHP2, o genótipo „GG‟ do
locus GHP3 e „AA‟ do locus GHP4 foram ausentes em ambas as variedades.

TABELA 8 - Frequências alélicas da população de associação.


SNP Alelo F. Total (%) F. CHIT (%) F. REDS (%)
GHP1 C 98,27 96,39 100
G 1,73 3,61 0
GHP2 G 98,27 96,39 100
A 1,73 3,61 0
GHP3 T 98,84 97,59 100
G 1,16 2,41 0
GHP4 G 99,13 98,19 100
A 0,87* 1,81 0
GHP5 C 98,55 96,99 100
G 1,45 3,01 0
GHP6 T 89,60 78,31 100
C 10,40 21,69 0
GHP7 G 90,75 80,72 100
A 9,25 19,28 0
GHP8 G 93,35 97,59 89,44
A 6,65 2,41 10,56
GHP9 A 93,35 97,59 89,44
G 6,65 2,41 10,56
GHP10 C 98,84 97,59 100
T 1,16 2,41 0
*Menor frequência alélica total.
58

TABELA 9 - Frequências genotípicas da população de associação.


Genótipo F. Total (%) F. CHIT (%) F. REDS (%)
GHP1 CC 98,25 96,34 100
GG 1,75 3,66 0
CG 0 0 0
GHP2 GG 98,25 96,34 100
AA 1,75 3,66 0
GA 0 0 0
GHP3 TT 97,66 95,12 100
GG 0 0 0
TG 2,34 4,88 0
GHP4 GG 98,25 96,34 100
AA 0 0 0
GA 1,75 3,66 0
GHP5 CC 98,25 96,34 100
GG 1,17 2,44 0
CG 0,58 1,22 0
GHP6 TT 82,46 63,41 100
CC 2,92 6,10 0
TC 14,62 30,49 0
GHP7 GG 84,80 68,29 100
AA 2,92 6,10 0
GA 12,28 25,61 0
GHP8 GG 88,30 95,12 82,02
AA 1,75 0 3,37
GA 9,94 4,88 14,61
GHP9 AA 88,30 95,12 82,02
GG 1,75 0 3,37
AG 9,94 4,88 14,61
GHP10 CC 98,25 96,34 100
TT 0,58 1,22 0
CT 1,17 2,44 0

Apenas quatro dos blocos genotípicos presentes na população de prospecção também


foram observados na população de associação, na qual seis novos blocos foram identificados
(de K a P) (TABELA 10). Os novos blocos genotípicos aparecem em baixas frequências e
apenas na variedade CHIT. Na variedade REDS apenas „B‟, „D‟, „E‟ e „C‟ estavam presentes,
onde „E‟ apareceu em maior frequência (90,91%). Na variedade CHIT apenas o bloco
genotípico „C‟ não foi identificado e, o bloco „E‟ também foi o mais frequente (53,1%). „A‟,
59

„N‟, „O‟ e „P‟ foram os menos frequentes na população de associação, todos com frequência
de 0,68% (TABELA 11).

TABELA 10 - Blocos genotípicos apresentados pela população de associação.


Bloco
GHP1 GHP2 GHP3 GHP4 GHP5 GHP6 GHP7 GHP8 GHP9 GHP10
Genotípico
K CC GG TG GG CC CC AA GG AA CC
A CC GG TG GG CC TC GA GG AA CC
L CC GG TT GG CC CC AA GG AA CC
B CC GG TT GG CC TC GA GG AA CC
M CC GG TT GG CC TC GG GG AA CC
D CC GG TT GG CC TT GG AG AG CC
E CC GG TT GG CC TT GG GG AA CC
N GG AA TT AG GC TC GA GG AA TC
O GG AA TT AG GG TT GG GG AA TC
P GG AA TT AG GG TT GG GG AA TT
C CC GG TT GG CC TT GG AA GG CC

TABELA 11 - Frequências dos blocos genotípicos da população de


associação.
Bloco Genotípico F. Total (%) CHIT (%) REDS (%)
K 2,03 3,61 0
A 0,68 1,20 0
L 1,35 2,41 0
B 12,16 20,48 1,30
M 3,38 6,02 0
D 9,46 9,64 5,19
E 67,57 53,01* 90,91*
N 0,68 1,20 0
O 0,68 1,20 0
P 0,68 1,20 0
C 1,35 0 2,60
*Bloco genotípico de maior frequência nas variedades.
60

5.3.3 Análises Estatísticas

Alguns animais foram excluídos das análises, pois não puderam ser genotipados
devido à má qualidade de algumas sequencias, impossibilitando a identificação de
determinados alelos. Desta forma, os resultados apresentados a partir desta etapa são
referentes a 148 indivíduos restantes.
Os gráficos boxplot, gerados pelas análises descritivas (FIGURA 16), demonstraram
que o maior peso foi atingido por um animal possuindo o bloco genotípico „P‟ nas pesagens
um e dois. Devido à morte deste animal, o bloco „P‟ não está presente nas pesagens seguintes.
Desta forma, as informações obtidas para este bloco genotípico não podem ser conclusivas.
Pelo mesmo motivo o bloco genotípico „O‟ também não aparece nas pesagens três e quatro.
Desconsiderando os blocos genotípicos representados por indivíduos únicos, os
animais que demonstraram melhor desempenho compõem os blocos „B‟ e „K‟, atingindo peso
médio de 200,87 gramas e 212,66 gramas na quarta pesagem. Além de apresentarem um bom
desempenho, os indivíduos que constituem o bloco „K‟ foram os que, na quarta pesagem,
apresentaram pesos mais próximos à média (FIGURA 16).
61

FIGURA 16 – Análise descritiva das médias de pesos por bloco genotípico em cada pesagem. Traços
representam as médias de peso, colunas representam peso máximo e mínio e linhas tracejadas representam o
desvio padrão.

Para a análise de associação, o efeito aleatório de grupamento genético foi retirado do


modelo, pois os altos valores de variância deste parâmetro consomem toda a explicação de
diferença de pesos, ou seja, o efeito de grupo genético encobre o efeito dos genótipos sobre as
características fenotípicas.
Os blocos genotípicos e os genótipos pertencentes a cada SNP, individualmente, foram
classificados em função do valor de efeito genético aditivo sobre a característica estudada.
Efeito genético aditivo se refere à contribuição de cada alelo ou genótipo para determinada
característica fenotípica, sendo que tal característica é controlada por diversos fatores
genéticos (RAMALHO et al., 1989).
62

A FIGURA 17 apresenta o ordenamento dos blocos genotípicos em gráficos dotplot,


com média centrada em zero. O ordenamento é feito de acordo com o grau de associação de
cada bloco com o fenótipo, ou seja, os que aparecem em posições superiores têm maior valor
genético aditivo para o peso e, consequentemente, nas posições inferiores estão aqueles com
menor valor genético aditivo.
Nas pesagens um e dois, os blocos „B‟ e „P‟ foram associados aos maiores pesos
médios apresentados pela população (TABELA 12). Já nas pesagens três e quatro o bloco „B‟
vem em primeira posição no ordenamento, mesmo apresentando peso médio menor que o
bloco „K‟, que vem em segunda posição. Isso ocorreu, pois o ordenamento é feito de acordo
com o valor informativo dos blocos, ou seja, mesmo o bloco „K‟ apresentando maior peso
médio, este não foi mais significativamente associado ao fenótipo que o bloco „B‟. Com
relação ao bloco „P‟, este foi excluído das análises devido à morte de seu único representante
após a primeira pesagem. Os blocos genotípicos „C‟, „D‟ e „E‟ foram associados aos piores
desempenhos em todas as pesagens (FIGURA 17).
Mesmo com o efeito de grupamento genético excluído das análises de associação,
observou-se que os blocos genotípicos de maior valor genético aditivo aparecem com maior
frequência na variedade CHIT, enquanto os de menor valor genético aditivo aparecem com
mais frequência em REDS. Os blocos „L‟ e „M‟, por exemplo, são exclusivos de CHIT e o
bloco „B‟ tem frequência de 20,48% em CHIT e apenas 1,30% em REDS. O bloco „E‟,
associado ao pior desempenho, apresentou frequência de 90,91% em REDS e 53,01% em
CHIT. O fato de os blocos genotípicos de melhor efeito genético aditivo terem aparecido com
maior frequência em CHIT e os de menor efeito genético aditivo terem aparecido em REDS
pode ter relação com seu histórico de domesticação. As seleções focadas em diferentes
características zootécnicas de interesse (coloração para REDS e tamanho para CHIT)
(MOREIRA et al., 2005) podem ter sido refletidas nos genótipos das diferentes variedades.
63

FIGURA 17 – Classificação dos blocos genotípicos de acordo com as médias de peso


centradas em zero.

TABELA 12 - Peso médio da população de associação por bloco genotípico.


Peso Médio
Bloco Genotípico 1ª Pesagem 2ª Pesagem 3ª Pesagem 4ª Pesagem
A (n = 1) 35 ± 0 57 ± 0 89 ± 0 139 ± 0
B (n = 18) 47 ± 9,11 69,5 ± 10,61 122,25 ± 22,56 200,87 ± 40,23
C (n = 2) 36 ± 4 49 ± 3 89 ± 0 167 ± 0
D (n = 14) 43,5 ± 11,57 59,57 ± 13 106,58 ± 32,68 182,5 ± 58,25
E (n = 100) 41,88 ± 7,93 58,4 ± 12,67 98,95 ± 30,14 165,14 ± 55,35
K (n = 3) 47 ± 8 72 ± 9,33* 129,66 ± 7,55* 212,66 ± 11,11*
L (n = 2) 42,5 ± 2,5 61 ± 4 111 ± 0 175 ± 0
M (n = 5) 45,2 ± 8,64* 68 ± 8,8 116,4 ± 18,88 194,6 ± 34,32
N (n = 1) 35 ± 0 48 ± 0 79 ± 0 128 ± 0
O (n = 1) 30 ± 0 47 ± 0 - -
P (n = 1) 66 ± 0 93 ± 0 - -
*Maior peso médio de cada pesagem.
64

Nas análises realizadas para cada SNPs, apenas GHP6, GHP7, GHP8, GHP9 e GHP10
demonstraram associação significativa (P < 0,05) como o peso. As FIGURAS 18, 19 20 e 21
apresentam gráficos dotpot, com média centrada em zero, referentes aos SNPs com associação
significativa em cada pesagem. Os genótipos de cada SNPs são classificados em função do
ordenamento do valor aditivo para o modelo proposto, assim, os genótipos com maior valor
genético aditivo ocupam as posições superiores dos gráficos.
O SNP GHP6 foi o único que demonstrou associação significativa com o fenótipo em
todas as pesagens, entretanto, seu genótipo de maior valor aditivo não se manteve o mesmo. O
genótipo heterozigoto „TC‟ do SNP GHP6 foi o que apresentou maior valor aditivo nas
pesagens um, três e quatro, com peso médio de 45,68; 117,65 e 193,65 gramas,
respectivamente (FIGURAS 18, 20 e 21 e TABELA 13). Já na segunda pesagem „CC‟ foi o
genótipo com maior valor aditivo (0,772) e, peso médio de 67,84 gramas (FIGURA 19 e
TABELA 13).
Com relação ao locus GHP10, que demonstrou estar significativamente associado ao
peso nas pesagens um, dois e quatro, o genótipo „TT‟, representado por apenas um indivíduo,
apresentou maior valor aditivo nas pesagens um e dois (0,130 e 3,484). Devido à morte deste
animal após a terceira pesagem, o genótipo „CC‟ passou ao topo da classificação,
apresentando peso médio de 174,24 gramas (FIGURA 21).
65

FIGURA 18 – Classificação dos genótipos referentes aos SNPs com associação significativa na 1ª pesagem.

FIGURA 19 – Classificação dos genótipos referentes aos SNPs com associação significativa na 2ª pesagem.
66

FIGURA 20 – Classificação dos genótipos referentes aos SNPs com associação significativa na 3ª pesagem.

FIGURA 21 – Classificação dos genótipos referentes aos SNPs com associação significativa na 4ª pesagem.
67

TABELA 13 - Peso médio por SNP com associação significativa (P < 0,05)
em cada pesagem.
SNP Genótipo Peso Médio
CC 45,2 ± 5,52
GHP6 TC 45,68 ± 9,18
TT 42,07 ± 8,49
1º Pesagem
TT 66 ± 0
GHP10 CT 32,5 ± 2,5
CC 42,77 ± 8,45
CC 67,6 ± 7,36
GHP6 TC 67,84 ± 10,46
TT 58,58 ± 12,85
AA 49 ± 3
GHP8 GA 59,57 ± 13
GG 60,76 ± 12,58
2ª Pesagem
AA 60,76 ± 12,58
GHP9 AG 59,57 ± 13
GG 49 ± 3
TT 93 ± 0
GHP10 CT 47,5 ± 0,5
CC 60,44 ± 12,47
CC 125 ± 8
GHP6 TC 117,65 ± 22,65
TT 99,81 ± 30,43
3ª Pesagem
AA 125 ± 8
GHP7 GA 118,47 ± 22,91
GG 100,38 ± 30,10
CC 203,25 ± 17,75
GHP6 TC 193,65 ± 40,33
TT 167,47 ± 55,24
AA 203,25 ± 17,75
4ª Pesagem GHP7 GA 194,36 ± 40,80
GG 168,44 ± 54,74
TT -
GHP10 CT 128 ± 0
CC 174,24 ± 52,66

Cruzando os resultados obtidos por meios das análises de associação do fenótipo com
blocos genotípicos e associação do fenótipo com cada SNP foi possível inferir qual é o
conjunto de genótipos com maior efeito aditivo sobre o peso dos animais (TABELA 14).
Como os SNPs GHP1 a GHP5 não tiveram associação significativa com a característica
estudada, é possível afirmar que os mesmos não interferem no ganho de peso, e por isso, não
foram considerados neste conjunto.
68

TABELA 14 - Conjunto de genótipos de maior efeito genético aditivo para o


peso.
GHP6 GHP7 GHP8 GHP9 GHP10

Genótipos CC ou TC GA ou AA GG AA CC ou TT

Em uma seleção hipotética de animais com o conjunto de genótipos apresentado na


TABELA 13, seriam selecionados aqueles que possuem os blocos genotípicos, „B‟, „K‟, „L‟ e
„A‟, os quais apresentaram bom efeito aditivo para o fenótipo. Isso mostra que os resultados
gerados pela análise de associação por SNPs corroboram os resultados gerados pela análise
com blocos genotípicos. Além disso, a análise por SNPs demonstrou quais loci não tem
associação com o fenótipo, possibilitando simplificar o processo de genotipagem dos animais
num futuro processo de seleção.
69

6 DISCUSSÕES

6.1 Identificação dos SNPs

Inúmeras evidências a respeito do papel fundamental desempenhado pelo GH no


crescimento somático dos vertebrados estão registradas na literatura (SELLIER, 2000).
Assim, o gene produtor deste hormônio se tornou um importante alvo para pesquisas no setor
de melhoramento animal, inclusive na aquicultura, setor no qual um dos principais objetivos é
maior ganho de peso em menor tempo (HILSDORF; ORFÃO, 2011; MARTIN-SMITH et al.,
2004).
Neste contexto, Almuly et al. (2005) identificaram mini e microssatélites polimórficos
nos introns I e III do gene GH de Sparus aurata, sendo este o primeiro relato de níveis tão
altos de polimorfismos no primeiro intron do gene GH de um vertebrado. Ao caracterizar a
região promotora do gene GH desta espécie, mais dois microssatélites foram identificados e
ao analisar um deles, localizado mais próximo à região codificadora do mRNA, verificaram
polimorfismo entre indivíduos pertencentes a uma população de cultivo. Os autores afirmam
que devido à sua alta taxa de variabilidade e por estar localizado na região promotora
proximal, este microssatélite pode ter influencia na expressão do gene e, consequentemente,
na taxa de crescimento (ALMULY et al., 2005). Microssatélites também foram identificados
no gene GH de Oreochromis niloticus, um na região promotora e outro no intron I. Ambos
mostraram ser polimórficos em quatro variedades diferentes e foram associados
significativamente com características de desempenho como peso, comprimento e largura do
corpo (DIAS, 2014).
Além dos marcadores microssatélites, muitos trabalhos têm relatado a presença de
SNPs em regiões do gene GH e outros genes associados ao crescimento de vertebrados, como
por exemplo, o gene IGF-II (insulin-like growth fator) de suínos (FONTANESI et al., 2010),
GH1 de salmão do Atlântico (GROSS; NILSON, 1999), cinco genes de Salvelinus alpinus,
associados ao crescimento (TAO; BOULDING, 2003), e GH1 de tilápia do Nilo (BLANCK
et al., 2009). Nestes casos a identificação de polimorfismos foi realizada por meio de PCRs
seguidas de digestões enzimáticas (PCR-FRLP), por meio do qual o SNP é detectado somente
quando existe uma mutação no sítio de restrição da enzima. Entretanto, no presente estudo,
SNPs foram descobertos no gene GH de O. nilóticus por meio de uma abordagem
70

metodológica diferente, ou seja, a região alvo foi sequenciada após sua amplificação e as
sequências de todos os indivíduos foram comparadas entre si por meio de alinhamentos.
Utilizando a mesma abordagem metodológica, baseada em sequenciamento e
alinhamento das sequências, HORAN et al. (2003) avaliou amostras de 154 homens de
origem caucasiana, recrutas das forças armadas britânicas e identificaram quatro SNPs na
região codificadora e 12 na região promotora proximal do gene GH1. Da mesma forma,
Nadjar-Boger e Funkenstein (2011) identificaram vários SNPs na região promotora e no
intron I do gene da Miostatina (saMSTN-2) de Sparus aurata e, Tsai et al. (2014)
identificaram três SNPs no gene IGF-I de salmão do Atlântico, os quais se localizavam no
promotor, intron I e intron III, respectivamente.
Outra espécie de peixe ósseo que também teve o gene GH avaliado para identificação
de SNPs é Tinca tinca. Para isso, 17 indivíduos, pertencentes a 12 populações diferentes,
tiveram seu gene GH completamente sequenciado e, por meio do alinhamento das sequências,
sete SNPs em introns e dois em exons foram detectados, sendo que os dois SNPs localizados
em exons são caracterizados por mutações sinônimas e, por isso, não tiveram efeito sobre a
composição de aminoácidos (KOCOUR; KOHLMANN, 2011). Até o presente momento
polimorfismos não foram relatados para exons do gene GH de O. niloticus, isso porque as
regiões codificadoras do gene GH são altamente conservadas, enquanto as regiões não
codificadoras tendem a ser polimórficas (MA et al., 2012).
É importante ressaltar que o SNP descrito por Blanck et al. (2009) no intron I do gene
GH de O. niloticus não foi encontrado no presente estudo, o que pode ser explicado porque
este pode ser um SNP de baixa frequência em certas populações.
71

6.2 Acompanhamento de Crescimento

Neste trabalho, o crescimento das variedades Chitralada e Red-Stirling foi


acompanhado por meio de pesagens periódicas durante um período de três meses. A análise
dos pesos obtidos mostrou que a variedade Chitralada apresentou maior peso médio que Red-
Stirling.
Muitos estudos a respeito do desempenho de Oreochromis niloticus já foram
realizados por ser uma espécie amplamente cultivada no mundo, principalmente quando se
trata do fator crescimento. Moreira et al. (2005) compararam a taxa de crescimento de ambas
as variedades, todas sob iguais condições de cultivo, em piscicultura comercial. Para isso, os
animais foram monitorados durante um período de nove meses (de maio de 2002 a janeiro de
2003) e, ao final do experimento verificou-se que Chitralada obteve desempenho superior em
relação a Red-Stirling, com maiores ganhos de peso diários e maior peso médio total. Dentre
os fatores envolvidos nestes resultados está o fato de que enquanto Red-Stirling possui um
histporico de seleção para o fator coloração, onde se deseja obter animais sem manchas
escuras na pele, o histórico de domesticação de Chitralada envolve seleção para maior ganho
de peso em sistemas de cultivo, ao que se deve seu alto desempenho de crescimento
(MOREIRA et al., 2005).
Também verificamos que, em ambas as variedades, machos atingiram maior peso
médio que fêmeas. Estudos já demonstraram que em O. niloticus os machos iniciam seu
crescimento mais rápido que as fêmeas, muito antes da maturidade sexual. Toguyéni et al.
(2002), conduziram dois experimentos para comparar o crescimento entre os dois sexos de O.
niloticus. No primeiro, a influência genotípica sobre a taxa de crescimento foi analisada e
verificou-se que existe grande possibilidade de que as maiores taxas de crescimento dos
machos estejam relacionadas a genes ligados ao sexo, mas não necessariamente envolvidos
com reprodução funcional. No segundo experimento a influencia da interação social entre
ambos os sexos em diferentes proporções foi avaliada e verificaram que o comportamento
social também possui forte influência no crescimento de machos e fêmeas (TOGUYÉNI et al.,
2002). Considerando que no presente trabalho machos e fêmeas foram mantidos separados, a
diferença verificada na taxa de crescimento pode ser explicada pelos fatores genotípicos,
envolvidos no primeiro experimento de Toguyéni et al. (2002).
72

6.3 SNPs e sua Associação com Crescimento

Dos 10 SNPs detectados neste estudo, cinco (GHP6, GHP7, GHP8, GHP9 e GHP10)
demonstraram possuir associação significativa com os pesos atingidos pela população de
associação. Além disso, alguns genótipos pertencentes aos SNPs acima citados demonstraram
que são superiores devido a seu valor genético aditivo sobre a característica avaliada (Figuras
18 a 21).
Horan et al. (2003) identificaram 16 SNPs no gene GH humano, os quais se
manifestam em 36 haplótipos diferentes. Destes, 12 se localizam na região promotora
proximal e quatro na região 5‟UTR. Análises funcionais mostraram que alguns haplótipos
possuem associação com níveis significativamente reduzidos de expressão do gene, enquanto
outros estão associados a níveis significativamente elevados. A associação dos níveis de
expressão com SNPs individuais demonstrou que os mesmos são altamente interdependentes
e identificou seis SNPs como os principais determinantes para os níveis de expressão do gene
GH (HORAN et al., 2003). Com base nisso e nos resultados obtidos no presente estudo,
mostrando que alguns genótipos estão associados a melhores desempenos de crescimento, é
possível inferir que os SNPs GHP6, GHP7, GHP8, GHP9 e GHP10 também sejam
interdependentes.
Estudos envolvendo associação de SNPs com crescimento também tem sido realizados
para teleósteos. Nadjar-Boger e Funkenstein (2011) identificaram vários SNPs na região
promotora do gene da Miostatina de S. aurata (saMSTN-2). Para verificar a existência de uma
possível associação entre a distribuição de alelos e o crescimento em uma população de
cultivo, as frequências alélicas e genotípicas foram analisadas em dois grupos de tamanho
(fenótipo “grande” e fenótipo “pequeno”). Os resultados obtidos mostraram variação na
frequência de alguns alelos em diferentes grupos de tamanho e, com isso, os autores afirmam
existir uma possível relação entre alguns diferentes alelos e a taxa de crescimento, o que faz o
gene MSTN-2 um importante candidato para seleção de características desejáveis no setor
aquícola (NADJAR-BOGER; FUNKENSTEIN, 2011).
Li et al. (2009) relataram, pela primeira vez, associação entre polimorfismos no gene
IGF-I e a taxa de crescimento de um teleósteo. Os polimorfismos foram identificados na
região 5‟ proximal do gene IGF-I de Micropterus salmoides, caracterizados por uma deleção
seguida de duas substituições de base única, o que gerou dois haplótipos diferentes. Os dois
haplótipos (A e B) foram avaliados quanto a sua associação com o crescimento de 91
73

indivíduos pertencentes a uma população de cultivo. Os resultados obtidos neste estudo


mostraram que os polimorfismos têm efeitos significativos sobre o peso e a largura corporal
dos animais (P < 0,05). Além disso, análises semiquantitativas por meio de RT-PCR
revelaram que os genótipos referentes aos polimorfismos na região 5‟ proximal do gene IGF-I
foram significativamente associados (P = 0,001) aos níveis de mRNA de IGF-I nas brânquias
dos indivíduos estudados. Segundo os autores, tais descobertas são de fundamental
importância para melhor entender as funções e regulações do gene no crescimento de peixes.
Além disso, podem auxiliar programas de seleção para melhoramento genético de M.
salmoides (LI et al., 2009).
Tsai et al. (2014), identificou três SNPs no gene IGF-I de salmão do Atlântico, ao
avaliarem 4.800 indivíduos provenientes de uma população de cultivo. Um dos SNPs se
localiza no promotor (SNP1) e os outros dois, nos introns I e III, respectivamente (SNP2 e
SNP3). Em um modelo misto, análises de associação dos SNPs individuais demonstraram que
os SNPs 1 e 3 foram significativamente associados com algumas variantes de peso, além
disso, o SNP1 mostrou associação significativa (P < 0,05) ou sugestiva (P < 0,1) com todas as
variantes de peso mensuradas (peso na coleta, eviscerado, sem cabeça e peso do filé) e os
indivíduos com o alelo „TT‟ no SNP1 tiveram maiores pesos médios que peixes de outras
categorias genotípicas. Estes dados mostram que tais polimorfismos possuem um grande
potencial para serem utilizados em programas de melhoramento genético assistidos por
marcadores moleculares (TSAI et al., 2014).
Para tilápias do Nilo apenas um SNP já foi identificado no gene GH1, localizado no
intron I. O estudo, realizado com as variedades Chitralada e GIFT, demonstrou que maior
porcentagem dos animais que apresentaram genótipo heterozigoto possuía melhor
desempenho quanto às características de comprimento total, comprimento padrão, altura e
largura. Assim, os autores puderam inferir que o SNP encontrado pode ter associação direta
com características corporais (BLANCK et al., 2009).
74

6.4 Possível Interferência Funcional dos SNPs na Expressão do Gene GH1

Ao comparar o promotor proximal do gene GH1 de O. niloticus (258 pb) com a


sequência de outras espécies de teleósteos verificamos que se trata de uma região conservada
em peixes da ordem Perciformes, onde existe uma concentração de potenciais sítios de
ligação de fatores de transcrição, dos quais os SNPs GHP 6 a GHP 9 estão bem próximos
(FIGURA 1 do anexo). Com base nos trabalhos de Yowe e Epping (1995), Sekkali et al.
(1999) e de Almuly et al. (2005), foi possível localizar, na região promotora do gene
estudado, um TATA box (-29 pb), três possíveis sítios de ligação para o fator de transcrição
Pit-1 (-55 pb, -105 pb e -192 pb) e dois sítios para fatores de transcrição não específicos da
hipófise, HNF-3 e N-Oct-3 (-81 pb e -122 pb, respectivamente).
Yowe e Epping (1995) compararam o promotor do gene GH de seis espécies de
mamíferos com quatro espécies de Osteichthyes e verificaram a existência de regiões
altamente conservadas para todos os vertebrados. Almuly et al. (2005), também alinharam os
promotores do gene GH de cinco espécies de Perciformes, incluindo S. aurata e O. niloticus
e, com isso, verificaram se tratar de uma região conservada para o grupo, onde identificaram
dois possíveis sítios de ligação para Pit-1, um para HNF-3 e um para N-Oct-3.
O gene GH de teleósteos é regulado por interações sinergéticas de um número de
fatores regulatórios (Pit-1, CRE, TRE, GRE e ERE) com o promotor (MORIYAMA et al.,
2006; ZHANG et al., 2009). Pit-1 (pituitary-specific transcription factor) é um fator de
transcrição específico da glândula hipófise. Yamada et al. (1993), ao isolar a proteína Pit-1 de
truta arco-íris e caracterizar seu cDNA, identificou, pelo menos, quatro sítios de ligação
específicos no promotor do gene GH da mesma espécie e, cinco sítios de ligação no promotor
do gene da prolactina de salmão. Com isso, os autores demonstraram que o fator Pit-1 é uma
importante ferramenta para o estudo dos mecanismos regulatórios que governam a transcrição
de vários genes expressos na glândula hipófise (YAMADA et al., 1993).
O fato de que a expressão do gene GH não é restrita à glândula hipófise e pode ocorrer
em vários outros tecidos é bem conhecido atualmente (HARVEY et al., 2000). A expressão
extrapituitária do gene GH já foi relatada em vários tecidos dos peixes, como intestino,
cérebro, brânquias, coração e algumas células sanguíneas (MORI; DEVLIN, 1999; YADA et
al., 2002; YANG et al., 1999). Entretanto, o mecanismo regulatório envolvido na expressão
do GH extrapituitário é diferente do que ocorre na hipófise e não depende da presença do
fator Pit-1. Como o promotor do gene GH não é alterado nos tecidos extrapituitários, é
75

possível inferir que fatores de transcrição não específicos da hipófise podem se ligar ao
promotor e induzir a expressão de GH extrapituitário (ALMULY et al., 2005).
O conhecimento a respeito da importância dos fatores de transcrição para o
funcionamento de um gene e dos mecanismos básicos pelos quais alguns deles atuam
possibilita a formulação de uma hipótese, sendo ela a seguinte: a proximidade de
determinados polimorfismos, presentes na região promotora, a sítios de ligação de fatores de
transcrição pode alterar os padrões de interação proteína-DNA, o que consequentemente,
levaria a alterações na ativação do gene.
Com base nesta hipótese, Horan et al. (2003) avaliaram a significância funcional de
SNPs presentes no gene GH humano pelo método EMSA (Eletrophoretic Mobility Shift
Assay) e verificaram que seis sítios polimórficos (cinco no promotor proximal e um na região
5‟ UTR) interferem no padrão de ligação de proteínas aos ácidos nucleicos, ressaltando que
três destes SNPs não se posicionam dentro de um sítio de ligação de fator de transcrição, mas
sim flanqueando os mesmos (HORAN et al., 2003). Além disso, segundo Tsai et al. (2014),
SNPs localizados em promotores e introns podem, simplesmente, estar atuando como
marcadores em desequilíbrio de ligação com variações causais presentes em algum outro local
do gene em questão, ou então, em outros genes ou regiões regulatórias associadas.
76

7 CONSIDERAÇÕES FINAIS

 Associar polimorfismos presentes no gene GH a características de desempenho de


interesse para o setor aquícola gera informações fundamentais para auxiliar programas
de melhoramento genético assistido por marcadores moleculares.
 Neste contexto, o presente estudo foi o primeiro a identificar nove SNPs na região
promotora proximal e um SNP na região 5‟ UTR do gene GH1 de O. niloticus, dentre
os quais, cinco (GHP6, GHP7, GHP8, GHP9 e GHP10) apresentaram associação
significativa com o peso das variedades Chitralada e Red-Stirling.
 Estes resultados são de fundamental importância para estudos futuros que busquem
compreender os mecanismos regulatórios do gene GH em teleósteos. Para isso, os
SNPs que apresentaram associação significativa com o crescimento das populações
avaliadas neste estudo podem ser testados quanto à sua associação com as taxas de GH
expresso em indivíduos com diferentes genótipos, o que pode ser realizado por meio
da técnica de RT-PCR a partir de RNA extraído de amostras de hipófise (PCR em
tempo real).
 Além disso, os SNPs aqui identificados se caracterizam como novas ferramentas para
programas de melhoramento genético de tilápias do Nilo, utilizando técnicas de
seleção assistida por marcadores moleculares.
 Portanto, o presente trabalho foi capaz de comprovar a associação de marcadores
moleculares presentes no promotor proximal e região 5‟ UTR gene GH da espécie O.
niloticus com crescimento das variedades Red-Stirling e Chitralada. Além de abrir
novos horizontes para pesquisas que busquem melhor compreender os mecanismos
envolvidos na regulação deste gene, gerou informações que podem ser utilizadas em
futuros programas de melhoramento genético para esta espécie.
77

REFERÊNCIAS*

ALJANABI, S. M.; MARTINEZ, I. Universal and rapid salt-extraction of high quality genomic DNA for PCR-
based techniques. Nucleic Acids Research, v. 25, n. 22, p. 4692-4693, 1997.

ALMEIDA, D. B.; MOREIRA, H. L. M.; COSTA, M. A. P.; VAZ, B. S.; MOREIRA, C. G. A.; OLIVEIRA, P.
A.; SILVA, J. C.; TAVARES, R. A.; BASSINI, L. N. Loci de Caracteres Quantitativos (QTL) em peixes.
Arquivo de Ciências Veterinárias e Zoologia da UNIPAR, v. 12, n. 2, p. 175-186, 2009.

ALMULY, R.; POLEG-DANIN, Y.; GORSHKOV, S.; GORSHKOVA G.; RAPOPORT, B.; SOLLER, M.;
KASHI, Y.; FUNKENSTEIN, B. Characterization of 5‟ flanking region of the growth hormone gene of the
marine teleost, gilthead sea bream Sparusaurata: analysis of a polymorphic microsatellite in the proximal
promoter. Fisheries Science, v. 71, p. 479-490, 2005.

ANNE, C. Choosing the right molecular genetic marker for studying biodiversity: from molecular evolution to
practical aspects. Genetica, v. 127, n. 1-3, p. 101-120, 2006.

ASIAN DEVELOPMENT BANK. An impact evaluation of the development of Genetically Improved


Farmed Tilapia: and their dissemination in selected countries. Mandaluyong, AsianDevelopment Bank,
2005. 13-14 p.

BALDISSEROTTO, Bernardo. Endocrinologia. In: - Fisiologia de Peixes Aplicada à Piscicultura. 3. ed. Santa
Maria: UFSM, 2013. cap. 7. p. 157-179.

BART, H. L.; RENEAU, P. C.; DOOSEY, M. H.; BELL, C. D. Evolutionary Divergence of Duplicate Copies of
the Growth Hormone Gene in Suckers (Actinopterygii: Catostomidae). International Journal of Molecular
Sciences, v. 11, p. 1090-1102, 2010.

BATES, D.; MACHLER, M.; BOLKER, B.M.; WALKER, S.C. Fitting linear mixed-effect models using
lme4.R package version 1.10-5. Disponível em: http://CRAN.R-project.org\package=lme4. Acessoem: 15 jun.
2014.

BENEDET, S.; ANDERSSON, E.; MITTELHOLZER, C.; TARANGER, G. L.; BJÖRNSSON, B. T. Pituitary
and plasma growth hormone dynamics during sexual maturation of female Atlantic salmon. General and
Comaparative Endocrinology, Sweden, v. 167, p. 77-85, 2010.

BENTSEN, H. B.; EKNATH, A. E.; VERA, M. S. P.; DANTING, J. C.; BOLIVAR, H. L.; REYES, R. A.;
DIONISIO, E. E.; LONGALONG, F. M.; CIRCA, A. V.; TAYAMEN, M. M.; GJERD, B. Genetic improvement
of farmed tilapias: growth performance in a complete diallel cross experiment with eight strains of Oreochromis
niloticus. Aquaculture, v. 160, n. 1-2, p. 145-173, 1998.

BER, R.; DANIEL, V. Structure and sequence of the growth hormone-encoding gene from Tilapia nilotica.
Gene, v. 113, p. 245-250,1992.

BER, R.; DANIEL, V. Sequence analusis suggests a recent duplication of the growth hormone encoding gene in
Tilapia nilotica. Gene, v. 125, p. 143-150, 1993.

BLANCK, D. V.; GASPARINO, E.; RIBEIRO, R. P.; MARQUES, D. S. Polimorfismo no gene GH1-PstI
associado a características corporais de variedades de tilápia-do-nilo. Pesquisa Agropecuária Brasileira, v. 44,
n. 6, p. 599-604, 2009.

* De acordo com:
ASSOCIAÇÃO BRASILEIRA DE NORMAS TÉCNICAS. NBR 6023: informação e documentação:
referências: elaboração. Rio de Janeiro, 2002.
78

CAETANO, A. R. Marcadores SNP: conceitos básicos, aplicações no manejo e no melhoramento animal e


perspectivas para o futuro. Revista Brasileira de Zootecnia, v. 38, p. 64-71, 2009.

CAMPO, L. F. C. Tilápia Roja 200: Una evolución de 20 anos, de laincertidumbre aléxito doce años
despues. Cali, Valle: 2001.

CHEN, T. T.; KIGHT, K.; LIN, C. M.; POWERS, D. A.; HAYAT, M.; CHATAKONDI, N.; RAMBOUX, A.
C.; DUNCAN, P. L.; DUNHAM, R. A. Expression and inheritance of RSVLTR-rtGH1 complementary DNA in
the transgenic common carp, Cyprinuscarpio. Molecular Marine Biology and Biotechnology, v. 2, p. 88–95,
1993.

CHIOU, C. S.; CHEN, H. T.; CHANG, W. C.The complete nucleotide sequence of the growth-hormone gene
from the common carp. Biochimica et Biophysica Acta, v. 1087, p. 91-94, 1990.

CLACKSON, T.; ULTSCH, M. H.; WELLS, J. A.; VOS, A. M. Structural and Funtional Analysis of the 1:1
Growth Hormone: Receptor Complex Reveals the Molecular Basis for Receptor Affinity. Journal of Molecular
Biology, v. 277, p. 1111-1128, 1998.

CLEMPSON, A. M.; POLLOT, G. E.; BRICKELL, J. S.; BOURNE, N. E.; MUNCE, N.; WATHERS, D. C.
Evidence that leptin genotype is associated with fertility, growth, and milk production. Journal of Dairy
Science, v. 94, n. 7, p. 3618-3628, 2011.

COOPER, D. N.; KRALCZAK, M. Cytosine methylation and the fate of CpG dinucleotides in vertebrate
genomes. Human Genetics, v. 83, p. 181-188, 1989.

COSTA, L. S. Avaliação de óleo de cravo e benzocaína como anestésicos para juvenis de tilápia nilótica.
2011. 54 f. Dissertação (Mestrado em Zootecnia) - Universidade Federal de Lavras, Lavras, Minas Gerais, 2011.

CURI, R. A.; PALMIERI, D. A.; SUGUISAWA, L.; OLIVEIRA, H. N.; SILVEIRA, A. C.; LOPES, C. R.
Growth and carcass traits associated with GH1/Alu I and POU1F1/Hinf I gene polymorphisms in Zebu and
crossbred beef cattle. Genetics and Molecular Biology, v. 29, n. 1, p. 56-61, 2006.

DAL-PAI, M.; ALMEIDA, F. L. A.; CARANI, F. R. Morfologia, desenvolvimento e Crescimento Muscular. In:
BALDISSEROTO, B.; CYRINO, J. E. P.; URBINATI, E. C. Biologia e Fisiologia de Peixes Neotropicais de
Água Doce. 1. ed. Jaboticabal: FUNEP, 2014. cap. 8. p. 157-176.

DEVLIN, R. H.; BIAGI, C. A.; YESAKI, T. Y. Growth, viability and genetic characteristics of GH transgenic
coho salmon strains. Aquaculture, v. 236, p. 607-632, 2004.

DIAS, M. A. D. Caracterização genética do gene do hormônio de crescimento em variedades de tilápia


utilizando marcadores microssatélite. 2014. 137 f. Tese (Doutorado em Zootecnia) – Universidade Federal de
Lavras, Lavras, Minas Gerais, 2014.

DU, S. J.; GONG, Z.; FLETCHER, G. L.; SHEARS, M. A.; KING, M. J.; IDLER, D. R.; HEW, C. L. Growth
enhancement in transgenic Atlantic salmon by use of an „„all fish‟‟ chimeric growth hormone gene construct.
Biotechnology, v. 10, p. 176-181, 1992.

DUNHAM, R. A.; RAMBOUX, A. C.; DUNCAN, P. L.; HAYAT, M.; CHEN, T. T.; LIN, C. M.; KIGHT, K.;
GONZALEZ-VILLASENOR, I.; POWERS, D. A. Transfer, expression, and inheritance of salmonid growth
hormone genes in channel catfish, Ictalurus punctatus, and effects on performance traits. Molecular Marine
Biology and Biotechnology, v. 1, p. 380-389, 1992.
79

EKNATH, A. E.; ACOSTA, B. O. Genetic Improvement of Farmed Tilápias. Final Report. International
Center for Living Aquatic Resources Management, 1998.

EMBRAPA. Circular técnico do Ministério da Agricultura, Pecuária e Abastecimento. Produção de tilapia:


Mercado, espécie, biologia e recria. Teresina, Piauí, 2007.

FALEIRO, Fábio Gelape. 102 p. Marcadores genético-moleculares aplicados a programas de conservação e


uso de recursos genéticos. Embrapa Cerrados, Planaltina, Distrito Federal, 2007.

FAO. Report of the twenty-four sessions of the coordinating working party on fishery statistics. FAO
Fisheries and Aquaculture Report, n. 1077, Rome, 2013.

FAO. The State of World Fisheries and Aquaculture: Opportunities and challenges. Food and Aquacultures
Organization, Rome, 2014.

FERREIRA, M.E.; GRATTAPALIA, D. Introdução ao uso de marcadores moleculares em análise genética.


3ed. Brasília: EMBRAPA-CENARGEN, 1998, 220 p.

FONTANESI, L.; SPERONI, C.; BUTTAZZONI, L.; SCOTTI, E.; DALL‟OLIO, S.; COSTA, L. N.; DAVOLI,
R.; RUSO, V. The insulin-like growth fator 2 (IGF2) gene intron3-g.3072G>A polymorphism is not the only
Susscrofachomossome 2p mutation affecting meat production and carcass traits in pigs: Evidence from the effect
of a cathepsin D (CTSD) gene polymorphism. American Society of Animal Science, v. 88, p. 2235-2245, 2010.

GALMAN, O. R.; AVTALION, R. R. A Preliminary Investigation of the characteristics of Red Tilapias


from the Philippines and Taiwan. In: International Simposium on Tilapia in Aquaculture, Tel Aviv, Israel, p.
291-301, 1983.

GROSS, R; NILSSON, J. Restriction fragment length polymorphism at the growth hormone 1 gene in Atlantic
salmon (Salmosalar L.) and its association with weight among the offspring of a hatchery stock. Aquaculture, v.
173, p. 73-80, 1999.

HAEGEMAN, A.; WILLIAMS, J. L.; LAW, A.; VAN ZEVEREN, A.; PEELMAN, L. J. Mapping and SNP
analysis of bovine candidate genes for meat and carcass quality. International Society of Animal Genetics,
Animal Genetics, v. 34, p. 349-353, 2003.

HARVEY, S.; AZUMAYA, Y.; HULL, K. L. Pituitary and extrapituitary growth hormone: Pit-1 dependence?
Canadian Journal of Physiology and Pharmacology, v. 78, p. 1013-1028, 2000.

HILSDORF, A. W. S. Genética e Cultivo de Tilápias Vermelhas – Uma Revisão. Boletim Instituto de Pesca,
São Paulo, v. 22, p. 73-84, 1995.

HILSDORF, A. W. S.; ORFÃO, L.H. Aspectos gerais do melhoramento genético em peixes no Brasil.
RevistaBrasileria de Zootecnia, v. 40, 2011.

HONG, Y.; SCHARTL, M. Sequence of the growth hormone (GH) gene from the silver carp
(Hypophthalmichthysmolithix) and evolution of GH genes in vertebrates. Biochimica et Biophysisca Acta, v.
1174, p. 285-288, 1993.

HORAN, M.; MILLAR, D. S.; HEDDERICH, J.; LEWIS, G.; NEWSWAY, V.; MO, N.; FRYKLUND, L.;
PROCTER, A. M.; KRAWCZAK, M.; COOPER, D. N. Human Growth Hormone 1 (GH1) Gene Expression:
Complex Haplotype-Dependent Influence of Polymorphic Variation in the Proximal Promoter and Locus
Control Region. Human Mutation, v. 21, p. 408-423, 2003.
80

HUANG, C. M.; CHANG, S. L.; CHENG, H. J.; LIAO, I. C. Single Gene Inheritance of Red Body Coloration in
Taiwanese Red Tilapia. Aquaculture, v. 74, p. 3-4, 1988.

HUSSAIN, M.G. Genetics of body color inheritance in Thai and Egyptian red tilapia strains. Asian Fisheries
Science, v.7, p.215- 224, 1994.

JOHANSEN, B.; JOHNSEN, C.; VALLA, S.The complete nucleotide sequence of the growth-hormone gene
from Atlantic salmon (Salmo salar).Gene, v. 77, p. 317-324, 1989.

KOCOUR, M.; KOHLMANN, K. Growth hormone gene polymorphisms in tench, Tinca tinca L. Aquaculture,
v. 310, p. 298-304, 2011.

KUBITZA, F. Nutrição e Alimentação de Tilápias - Parte 1. Panorama da Aquicultura, 1999.

KUBITZA, F. Questões frequentes dos produtores sobre a qualidade dos alevinos de tilápia. Panorama da
Aquicultura. v. 16, n. 97, p. 14-23, 2006.

KUHNLEIN, U.; NI, L.; GAVORA, J. S.; FAIRFULL, W.; ZADWARNY, D. DNA polymorphism in the
chicken growth hormone gene: response to selection for disease resistance and association with egg production.
Animal Genetics, v. 28, n. 2, p. 116-123, 1997.

KURADOMI, R. Y. Morfometria do crescimento, estrutura muscular e expressão de fatores miogênicos


em um modelo de peixe transgênico (Danio rerio) para o Hormônio de crescimento (GH). 2009. 81 f.
Dissertação (Mestrado em Aquicultura) – Universidade Federal do Rio Grande, Rio Grande, Rio Grande do Sul,
2009.

LI, X. H.; BAI, J. J; YE, X.; HU, Y. C.; LI, S. J.; YU, L.Y. Polymorphisms in the 5‟ flanking region of the
insulin-like growth factor I gene are associated with growth traits in largemouth bass Micropterus salmoides.
Fishery Sciences, v. 75, p. 351-358, 2009.

LI, W. H.; GOJOBORI, T.; NEI, M. Pseudogenes as a paradigma of neutral evolution. Nature, v. 292, n. 5820,
p. 237-239, 1981.

LIAO, I. C.; CHANG, S. Status and prospectcs of tilapia culture in Taiwan.In: FISHELSON, L.; YARON, Z.
Proceedings of the Internacional Symposium on Tilapia in Aquaculture, Nazareth-Israel, p. 588-598, 1983.

LIU, Z. J.; CORDES, J. F. DNA marker Technologies and their applications in aquaculture genetics.
Aquaculture, v. 238, p. 1-37, 2004.

LU, D.; MILLER, S.; SARGOLZAEI, M.; KELLY, M.; VOORT, G. V.; CALDWELL, T.; WANG, Z.;
PLASTOW, G.; MOORE, S. Genome-wide association analyses for growth and feed efficiency traits in beef
cattle. American Society of Animal Science, v. 91, p. 3612-3633, 2014.

MA, Q.; LIU, S.; ZHUANG, Z.; LIN, L.; SUN, Z.; LIU, C.; MA, H.; SU, Y.; TANG, Q. Genomic structure,
polymorphism and expression analysis of the growth hormone (GH) gene in female and male Half-smooth tong
sole (Cynoglossus semilaevis). Gene, v. 493, p. 92-104, 2012.

MARTINEZ-ARIAS, R.; CALAFELL, F.; MATEU, E.; COMAS, D.; ANDRES, A.; BERTRANPETIT, J.
Sequence variability of a human pseudogene. Genome Research, v. 11, p. 1071-1085, 2001.
81

MARTINEZ, R.; ESTRADA, M. P.; BERLANGA, J.; GUILLEN, I.; HERNANDEZ, O.; PIMENTEL, R.;
MORALES, R.; HERRERA, F.; FUENTE, J. Growth enhancement in transgenic tilápia by ectopic expression of
tilápia growth hormone. Molecular Marine Biology and Biotechnology, v. 5, p. 62-70, 1996.

MARTIN-SMITH, K. M.; ARMSTRONG, J. D.; JOHNSSON, J. I.. BJORSSON, B. T. Growth hormone


increases growth and dominance of wild juvenile Atlantic salmon without affecting space use. Journal of Fish
Biology, v. 65, p. 156-172, 2004.

MASSAGO, H.; CASTANNOLLI, N.; MALHEIROS, E. B.; RIBEIRO, T. C.; KOBERSTEIN, D.; SANTOS,
M. A.; RIBEIRO, R. P. Crescimento de quatro linhagens de tilápia Oreochromis niloticus. Revista Acadêmica
Ciências Agrárias e Ambientais, v. 8, n. 4, p. 379-403, 2010.

MCANDREW, B. J.; ROUBAL, F. R.; ROBERTS, R. J.; BULLOCK, A. M.; McEWEN, I. M. The Genetics and
History of Red, Blond and Associated Color Variants in Oreochromis niloticus. Genetics, v. 76, p. 127-137,
1988.

MOREIRA, A. A.; MOREIRA, H. L. M.; HILSDORF, A. W. S. Comparative growth performance of two Nile
tilápia (Chitralada and Red-Stirling), their crosses and the Israeli tetra hybrid ND-56. Aquaculture Research, v.
36, n. 11, p. 1049-1055, 2005.

MOREIRA, A. A.;HILSDORF, A. W. S.; SILVA, J. V.; SOUZA, V. R. Genetic variability of two Nile tilápia
strains by microsatellites markers. Pesquisa Agropecuaria Brasileira, v. 42, n. 4, p. 521-526, 2007.

MORI, T.; DEVLIN, R. H. Transgene and host growth hormone gene expression in pituitary and nonpituitary
tissues of normal and growth hormone transgenic salmon. Molecular and Cellular Endocrinology, v. 149, n. 1-
2, p. 129-139, 1999.

MORIYAMA, S.; ODA, M.; TAKAHASHI, A.; SOWER, S. S.; KAWAUCHI, H. Genomic structure of the sea
lamprey growth hormone-encoding gene. General and Comparative Endocrinology, v. 148, p. 33-40, 2006.

MPA, M. D. P. E. A. Boletim Estatístico da Pesca e Aquicultura - Brasil 2008-2009. Brasília 2010.

MPA. Plano Safra da Pesca e Aquicultura 2012/2013/2014, 2014. Disponível em:


http://www.mpa.gov.br/index.php/infraestrutura-e-fomento/138-plano-safra-da-pesca-e-aquicultura-2012-2013-
2014. Acesso em: 30 de outubro de 2014.

MARQUES, D. S. Polimorfismos no gene do Hormônio do Crescimento em linhagens de codorna


(Couturnix japonica) e sua associação com características de desempenho. 2009. 73 f. Dissertação
(Mestrado em Zootecnia) - Universidade Estadual de Maringá, Maringá, Paraná, 2009.

NADJAR-BOGER, E.; FUNKEINSTEIN, B. Myostatin-2 gene structure and polymorphism of the promoter and
first íntron in the marine fish Sparusaurata: evidence for DNA duplication and/or translocation. BMC Genetics,
v. 12, n. 22, 2011.

NANDI, S. Genetics of red melanophores and their role in skin coloration in the Nile tilapia. 1997. 62 f.
Tese (Doutorado em Aquicultura) – Universidade de Stirling, Stirling, Escócia, 1997.

PEREIRA, A. P.; ALENCAR, M. M.; OLIVEIRA, H. N.; REGITANO, L. C. A.Association of GH and IGF-1
polymorphisms with growth traits in a synthetic beef cattle breed. Genetics and Molecular Biology, v. 28, n. 2,
p. 230-236, 2005.
82

POEN, S.; PORNBANLUALAP, S. Growth hormone from striped catfish (Pangasianodon hypophthalmus):
Genomic organization, recombinant expression and biological activity. Gene, v. 518, p. 316-324, 2013.

POPMA, T. J., LOVSHIN, L. L. World-wide prospects for commercial production of tilápia. International
Center for Aquaculture, Alburn University.1995. 41 p.

QUINTON, C. D.; MCMILLAN, I.; GLEBE, B. D. Dvelopment of an Atlantic salmon (Salmo salar) genetic
improvement program: Genetic parameter of harvest body weight and carcass qualiy traits estimated with animal
models. Aquaculture, v. 247, n. 1, p. 211-217, 2005.

RAMALHO, M.; SANTOS, J. B.; PINTO, C. B. Genética Quantitativa. In: - Genética na Agropecuária. 1. ed.
Lavras, Minas Gerais, 1989. cap. 11. p. 199-229.

SAKAMOTO, T.; SHEPHERD, B.S.; MADSEN, S. S.; NISHIOKA, R. S.; SIHARATH, K.; RICHMAN, N. H.;
GRAU, E. G. Osmoregulatory actions of growth hormone and prolactin in an advanced teleost. General and
Comparative Endocrinology, v. 106, p. 95-101, 1997.

SALEM, M.; VALLEJO, R. L.; LEEDS, T. D.; PALTI, Y.; LIU, S.; SABBAGH, A.; REXROAD III, C. E.;
YAO, J. RNA-Sec Identifies SNP Markers for Growth Traits in Rainbow Trout. Plos One, v. 7, p. 1-13, 2012.

SÁNCHEZ-RAMOS, I.; BARRIOS, M.; CROSS, I.; REBORDINOS, L. Identificacíon de RFLP em genes
relacionados com elcrecimiento em doradaSparusaurata L., 1758. Boletín Instituto Español de Oceanografía,
v. 21, n. 14, p. 253-259, 2006.

SCHALBURG, K. R.; YAZAWA, R.; BOER, J.; LUBIENIECKI, K. P.; GOH, B.; STRAUB, C. A.; BEETZ-
SARGENT, M. R.; ROBB, A.; DAVDSON, W. S.; DEVLIN, R. H.; KOOP, B. Isolation, characterization and
comparison of Atlantic and Chinook salmon growth hormone 1 and 2. BMC Genomics, v. 9, n. 522, p. 1-12,
2008.

SCHLÖTTERER, C. The evolution of molecular markers - just a matter of fashion? Nature Reviews: Genetics,
v. 5, p. 63-69, 2004.

SEKKALI, B.; BRIM, H.; MULLER, M.; ARGENTON, F.; BORTOLUSSI, M.; COLOMBO, L.; BELAYEW,
A.; MARTIAL, J.A. Structure and Functional Analysis of Tilapia (Oreochromis mossambicus) Growth Hormone
Gene: Activation and Repression by Pituitary Transcription Factor Pit-1. DNA and Cell Biology, v. 18, n. 6, p.
489-502, 1999.

SELLIER, P. Genetically caused retardede Growth in animals. Domestic Animal Endrocrinology, France, v.
19, p. 105-119, 2000.

SOUZA, V. L.; SILVA, P. C.; PÁDUA, D. M. C.; DALACORTE, P. C. Comparison of productive


performance of sex reversed male Nile tilápia, Oreochromisniloticus (Thai strain) and tetra hybrid red
tilapia (Israeli strain). In: Fifth International Symposium on Tilapia in Aquaculture, Rio de Janeiro, Brasil, p.
83-87, 2000.

TAO, W. J.; BOULDING, E. G. Association between single nucleotide polymorphism in candidate genes ang
growth rate in Arctic char (Salvelinusalpinus L.). Heredity, v. 91, p. 60-69, 2003.

TOGUYÉNI, A.; FAUCONNEAU, B.; FOSTIER, A.; ABUCAY, J.; MAIR, G.; BAROILLER, J. F. Influence
of sexual phenotype and genotype, and sex ratio on growth performance in tilapia, Oreochromis niloticus.
Aquaculture, v. 207, p. 249-261, 2002.
83

TRUDEAU, V. L. Neuroendocrine regulation of gonadotropin II release and gonadal growth in the goldfish
Carassiusauratus. Reviews of Reproduction, v.2, n. 1, p. 55-68, 1997.

TSAI, H. Y.; HAMILTON, A.; GUY, D. R.; HOUSTON, R. D. Single nucleotide polymorphisms in the insulin-
like growth factor 1 (IGF1) gene are associated with growth-related traits in farmed Atlantic salmon. Animal
Genetics, v.45, p. 709-715, 2014.

VAN BERS, N. E. M.; CROOIJMANS, R. P. M. A.; GROENEN, M. A. M.; DIBBITS, B. W.; KOMEN, J. SNP
marker detection genotyping in tilapia. Molecular Ecology Resources, v. 12, p. 932- 941, 2012.

VIGNAL, A.; MILAN, D.; SANCRISTOBAL, M.; EGGEN, A. A review on SNP and other types of molecular
markers and their use in animal genetics. Genetics Selection Evolution, v. 34, p. 275-305, 2002.

WANG, S.; SHA, Z.; SONSTEGARD, T. S.; LIU, H.; XU, P.; SOMRIDHIVEJ, B.; PEATMAN, E.;
KUCUKTAS, H.; LIU, Z. Quality assessment parameters for EST-derives SNPs from catfish. BMC Genomics,
v. 9, p.1-11, 2008.

WHITE, T. W.; BRUZZONE, R.; GOODENOUGH, D. A. Extraordinary salmon growth. Nature, v. 371, p.
209-210, 1994.

WORDFISH CENTER. GIFT Technology Manual: An aid to Tilapia selective breeding. Worldfish Center,
Penang, Malaysia, 2004. 56 p.

XIA, J. H.; WAN, Z. Y.; LONG NG, Z.; WANG, L.; FU, G. H.; LIN, G.; LIU, F.; YUE, G. H. Genome-wide
discovery and in silico mapping of gene-associated SNPs in Nile tilapia. Aquaculture, v. 432, p. 67-73, 2014.

YADA, T.; UCHIDA, K.; KAJIMURA, S.; AZUMA, T.; HIRANO, T.; GRAU, E.G. Immunomodulatory effects
of prolactin and growth hormone in the tilapia, Oreochromis mossambicus. Journal of Endocrinology, v. 173,
p. 483-492, 2002.

YAMADA, S.; HATA, J. I.; YAMASHITA, S. Molecular cloning of fish Pit-1 cDNA and its functional binding
to promoter of gene expressed in the pituitary. Journal of Biological Chemistry, v. 268, n. 15, p. 24361-24366,
1993.

YANG, B. Y.; GREENE, M.; CHEN, T. T. Early embryonic expression of the growth hormone family protein
genes in the developing rainbow trout, Oncorhynchus mykiss. Molecular Reproduction and Development, v.
53, n. 2, 1999.

YOWE, D. L.; EPPING, R. J. Cloning of the barramundi growth hormone-encoding gene: a comparative
analysis of higher and lower vertebrate GH genes. Gene, v. 162, p. 255-259, 1995.

ZHANG, D.; SHAO, Y.; JIANG, S.; LI, J.; XU, X. Nibea coibor growth hormone gene: its phylogenetic
significance, microsatellite variation and expression analysis. General and Comparative Endocrinology, v.
163, n. 13, p. 233–241, 2009.

ZIMMERMANN, S. Incubação artificial, Técnica permite a produção de Tilápias do Nilo Geneticamente


superiores. Panorama da Aquicultura, Rio de Janeiro, v. 9, n. 54, p. 15-21, 2000.
84

ANEXO

FIGURA 1: Alinhamento múltiplo do promotor proximal do gene GH de quatro espécies da ordem Perciformes. Sequência contendo 204 pb da região
promotora e 75 pb do exon I do gene GH de Oreochomis niloticus (On), Sparus aurata (Sa), Nibea coibor (Nc) e Lates calcarifer (Lc). Sob números
de acesso do GeneBank: M97766, AY138985, FJ375311 e U16816, respectivamente. Blocos negros: regiões onde as sequencias das espécies se
alinham completamente. Caixas vermelhas: SNPs. Caixas Amarelas: sítios de ligação de fatores de transcrição. Caixa azul: Base de início da
transcrição (+1). Caixa verde: Códon de início da tradução (ATG).