Você está na página 1de 151

UNIVERSIDADE FEDERAL DO RIO DE JANEIRO

INSTITUTO DE MICROBIOLOGIA PROFESSOR PAULO DE GÓES


DEPARTAMENTO DE MICROBIOLOGIA MÉDICA

Tese de Doutorado

Staphylococcus aureus ISOLADOS DE PRÓTESES

ARTICULARES E OUTRAS INFECÇÕES: DIVERSIDADE

GENOTÍPICA E ASPECTOS RELACIONADOS À

RESISTÊNCIA E VIRULÊNCIA

Ricardo Pinto Schuenck

Rio de Janeiro
2009
Livros Grátis
http://www.livrosgratis.com.br
Milhares de livros grátis para download.
ii

Ricardo Pinto Schuenck

Staphylococcus aureus ISOLADOS DE PRÓTESES


ARTICULARES E OUTRAS INFECÇÕES: DIVERSIDADE
GENOTÍPICA E ASPECTOS RELACIONADOS À
RESISTÊNCIA E VIRULÊNCIA

Tese de Doutorado apresentada ao Programa


de Pós-graduação em Ciências (Microbiologia)
do Instituto de Microbiologia Prof. Paulo de
Góes, da Universidade Federal do Rio de
Janeiro, como parte dos requisitos necessários
à obtenção do título de Doutor em Ciências
(Microbiologia).

Orientadores: Kátia Regina Netto dos Santos

Marcia Giambiagi de Marval

UNIVERSIDADE FEDERAL DO RIO DE JANEIRO


INSTITUTO DE MICROBIOLOGIA PROFESSOR PAULO DE GÓES

RIO DE JANEIRO
FEVEREIRO DE 2009
iii

FICHA CATALOGRÁFICA

S385 SCHUENCK, Ricardo Pinto


Staphylococcus aureus isolados de próteses articulares e outras
infecções: diversidade genotípica e aspectos relacionados à
resistência e virulência, 2009.
xvi, 131p
Tese [Doutorado em Ciências (Microbiologia)]
Universidade Federal do Rio de Janeiro, Instituto de Microbiologia
Professor Paulo de Góes, 2009
Orientadores: Kátia Regina Netto dos Santos
Márcia Giambiagi de Marval
1. Staphylococcus aureus 2. SCCmec 3. resistência antimicrobiana
4. infecções em próteses 5. genes de virulência 6. diversidade
genotípica – Teses.
I. Santos, Kátia Regina Netto dos (Orientadora). II. Instituto de
Microbiologia Professor Paulo de Góes. III. Staphylococcus aureus
isolados de próteses articulares e outras infecções: diversidade
genotípica e aspectos relacionados à resistência e virulência
iv

Ricardo Pinto Schuenck

Staphylococcus aureus isolados de próteses articulares e outras


infecções: diversidade genotípica e aspectos relacionados
à resistência e virulência

Rio de Janeiro, 18 de Fevereiro de 2009

Orientadora (Profa. Kátia Regina Netto dos Santos, Doutora, UFRJ)

Membro (Prof. Sergio Eduardo Longo Fracalanzza, Doutor, UFRJ)

Membro (Prof. Antônio Carlos Campos Pignatari, Doutor, UNIFESP)

Membro (Prof. Raphael Hirata Jr., Doutor, UERJ)

Revisora (Profa. Marinella Silva Laport, Doutora, UFRJ)

Suplente (Profa. Simone Aranha Nouér, Doutora, UFRJ)

Suplente (Profa. Ana Paula Vieira Colombo, Doutora, UFRJ)


v

Trabalho realizado no Laboratório

de Infecções Hospitalares e no

Laboratório de Microbiologia Molecular

do Departamento de Microbiologia

Médica do Instituto de Microbiologia

Prof. Paulo de Góes, sob orientação das

Profas. Kátia Regina Netto dos Santos e

Marcia Giambiagi de Marval.


vi

AGRADECIMENTOS

Ao final de mais uma importante etapa, gostaria de agradecer as

pessoas que tanto me apoiaram:

À minha orientadora Kátia Regina Netto dos Santos, minha “mãe

científica”, pela orientação, no sentido amplo da palavra, paciência,

incentivo e carinho, que contribuíram, acima de tudo, para o meu

crescimento pessoal. Tive o privilégio, de durante esses quase 10 anos,

estar ao lado de uma pessoa dedicada, exigente e, que acima de tudo, ama

o que faz! Com certeza, não poderia ter escolhido orientadora melhor!

Obrigado por me agüentar todo esse tempo !

À minha co-orientadora Márcia Giambiagi de Marval, por toda sua

imensa ajuda, dedicação e pelas sempre oportunas considerações!

A todos os grandes amigos do Laboratório de Infecções Hospitalares:

Gustavo, Eliezer, Ariane, Natália, Carol, Fred, Milena, André, Aline,

Cristiane, Roberta e Fernanda pela ajuda no trabalho, pelos momentos de

descontração e pela amizade.

Um agradecimento especial a Fernandinha, cuja ajuda, foi

imprescindível para o término desse trabalho. Muito obrigado!

Ao pessoal do Laboratório de Microbiologia Molecular, em especial,

Naira e Elaine, pela ajuda e pelos muitos momentos de descontração.

A todos dos Laboratórios de Micobactérias, Cocos Patogênicos e

Anaeróbios, por toda ajuda durante o desenvolvimento da tese.

Aos amigos da Pós-Graduação: Ivi, Bia, Tati, Carla, Renata, Lili,

Naira, Fabíola, Elaine e Léo. Um agradecimento especial ao Felipe, Marcos


vii

Dornelas, Gustavo e Eliezer, pela importante ajuda e amizade durante

esse tempo.

Aos funcionários do Departamento de Microbiologia Médica,

especialmente, Marlei, Orlando, Joaquim, Marcos, Antônio e Helena, pela

ajuda e por tornarem agradável o dia-a-dia nesse departamento.

À Dra. Simone Nouér, membro da equipe da Comissão de Controle

de Infecção Hospitalar (CCIH) do Hospital Universitário Clementino Fraga

Filho, pela importante ajuda durante o desenvolvimento desse trabalho.

A todos do Laboratório de Microbiologia e da CCIH do Instituto

Nacional de Traumatologia e Ortopedia, em especial, as funcionárias

Francisca, Rita e Maria do Carmo.

À Dra. Thais C. B. S. Souto-Padrón, Coordenadora do Curso de Pós-

Graduação, e aos demais professores do IMPPG.

Aos professores Sérgio Fracalanzza, Walter, Regina e Marinella por

sempre estarem prontos a nos ajudar.

Ao Instituto de Microbiologia, na pessoa da diretora Agnes Marie Sá

Figueiredo.

À FAPERJ pela bolsa a mim concedida durante o desenvolvimento

desse trabalho.

Ao CNPq, FUJB, Pronex e FINEP pelo financiamento dos projetos de

pesquisa desenvolvidos nesse laboratório.

A todos meus verdadeiros amigos Cordeirenses, que mesmo não

entendendo absolutamente nada do que eu fazia, compreendiam a

importância disso para mim.


viii

Ao meu pai (in memorian) que é o responsável direto pelo que sou

hoje e por durante toda a sua vida ter colocado seus filhos acima de tudo

e me ensinado o verdadeiro significado da palavra amar. Amor eterno!

À minha mãe, por muitas vezes se preocupar com meus desejos em

detrimento aos seus e pelo amor incondicional. Se pudesse escolher uma

mãe, seria exatamente como você. Agradeço também por compreender

todos os dias de distância e por tê-la feito vir tantas vezes ao Rio de

Janeiro! Amo você!

Aos meus irmãos, por todo amor e por entenderem minha escolha,

que me mantém distante fisicamente.

Na monografia o agradecimento foi como namorada, no mestrado

como noiva e, agora, como esposa! Gostaria de agradecer a Gisele, que fez

parte de cada passo que dei durante todo esse tempo. Mais do que estar

ao meu lado, você é parte essencial de minha vida. Agradeço por todo seu

amor, ajuda, compreensão pelas muitas horas em que estive ausente e

impaciente, enfim, por ter se mostrado uma verdadeira companheira.


ix

DEDICATÓRIA

Ao meu pai (in memorian) que dedicou cada


dia da sua vida a me tornar uma pessoa
melhor.

À minha mãe, pelo amor incondicional e


por ter sido essencial para que eu chegasse
até aqui.

À minha esposa que me acompanhou em


cada passo dessa caminhada e foi acima de
tudo uma verdadeira companheira.
x

RESUMO
Staphylococcus aureus isolados de próteses articulares e outras infecções:
diversidade genotípica e aspectos relacionados à resistência e virulência.

Ricardo Pinto Schuenck

Orientadoras: Kátia Regina Netto dos Santos


Marcia Giambiagi de Marval

Resumo da Tese de Doutorado submetida ao Programa de Pós-Graduação em


Ciências (Microbiologia) do Instituto de Microbiologia Prof. Paulo de Góes da
Universidade Federal do Rio de Janeiro, como parte dos requisitos necessários à
obtenção do título de Doutor em Ciências (Microbiologia).

Neste trabalho foram realizados dois estudos com 93 amostras de Staphylococcus


aureus isoladas de dois hospitais da cidade do Rio de Janeiro. No primeiro, foi
realizada a caracterização molecular e determinação das CMIs de oxacilina e
vancomicina em 20 amostras de S. aureus resistentes à meticilina não
multirresistentes (nMRSA). Destas, 19 apresentaram SCCmecIV e uma SCCmecII.
Dezoito amostras apresentaram CMIs <32µg/mL para oxacilina e CMIs para
vancomicina entre 1 e 2µg/mL. Foram observados nove genótipos, incluindo o
USA300, e 3 STs principais: 1, 5 e 8. Dois novos STs foram descritos: 1203 e
1204. No segundo estudo, foram analisados a diversidade genotípica e os
aspectos relacionados à virulência e resistência em 73 amostras, sendo 32 de
infecções associadas (IAP) e 41 de não associadas a próteses (INAP). Destas, 45
(61,6%) foram de MSSA e 28 de MRSA. Entre as 28 MRSA, 16 (57%)
apresentaram SCCmecIV (8 de IAP e 8 de INAP) e 12 SCCmecIII (5 de IAP e 7 de
INAP). A análise por PFGE mostrou 15 genótipos, sendo que cinco (A´-E´), foram
responsáveis por 83,5% das infecções. Todas as 12 amostras do genótipo A´
foram relacionadas ao genótipo de MRSA prevalente no Brasil (ST 239-
SCCmecIII). Os genótipos B´ e C´ englobaram 20 e 17 amostras, respectivamente,
sendo os principais agentes de todas as infecções (IAP e INAP). Nesses dois
genótipos, foram encontradas amostras de MRSA SCCmecIV e MSSA. Os
genótipos B´ e C´ apresentaram ST 5 e ST 1, respectivamente. O ST 30 foi
encontrado nas amostras com o genótipo E´. Mais de 95% das amostras, tanto de
IAP quanto de INAP, foram produtoras de biofilme. Os genes de virulência, icaA,
fnbA, cna e ebpS estavam amplamente distribuídos, enquanto os genes fnbB, bbp
e da PVL foram encontrados associados a genótipos específicos. Não foram
observadas diferenças, em relação à virulência e aos genótipos, entre as
amostras de IAP e INAP. Neste estudo observamos a emergência de importantes
genótipos e demonstramos que as amostras causadoras de infecções em próteses
refletem a microbiota existente no hospital. Foram detectados STs, até o
momento, não descritos no país (ST 97 e ST 72). A similaridade genética entre
amostras de MRSA-SCCmecIV e MSSA de dois genótipos, incluídos no ST 1 e ST
5, nos fez sugerir que essas amostras estariam mais aptas a receberem o cassete
mec.

Palavras chaves: Staphylococcus aureus – SCCmec – resistência antimicrobiana –


infecções em próteses – genes de virulência – diversidade genotípica.
Rio de Janeiro
Fevereiro de 2009
xi

ABSTRACT

Staphylococcus aureus isolated from prosthesis and other infections: clonal


diversity and resistance and virulence aspects

Ricardo Pinto Schuenck

Orientadoras: Kátia Regina Netto dos Santos


Márcia Giambiagi de Marval

Abstract da Tese de Doutorado submetida ao Programa de Pós-Graduação em


Ciências (Microbiologia) do Instituto de Microbiologia Professor Paulo de Góes da
Universidade Federal do Rio de Janeiro, como parte dos requisitos necessários à
obtenção do título de Doutor em Ciências (Microbiologia). .

In the present work two studies with 93 Staphylococcus aureus isolates obtained
from two hospitals in Rio de Janeiro were carried out. In the first study, a
molecular characterization and MICs determination to oxacillin and vancomycin
in 20 isolates of nonmultirresistant methicillin-resistant Staphylococcus aureus
(nMRSA) were performed. Nineteen isolates presented SCCmecIV and one
SCCmecII. Eighteen showed MICs to oxacillin of <32µg/mL. MICs to vancomycin
ranged from 1 to 2µg/mL. Nine genotypes and three principal STs, 1, 5 and 8,
were found. Genotype USA300 was also found among these lineages. Moreover,
two new STs were described, STs 1203 e 1204. In the second study we analyzed
the clonal diversity, resistance and virulence factors of 73 isolates, 32 recovered
from prosthesis related infections (PRI) and 41 from prosthesis not related
infections (PNRI). Among 73 isolates, 45 (61,6%) were MSSA and 28 MRSA.
Among 28 MRSA, 16 (57%) presented SCCmecIV (8 of PRI and 8 of PNRI) and 12
SCCmecIII (5 of PRI and 7 of PNRI). PFGE clustered all isolates in 15 genotypes.
However, five prevalent genotypes (A´ to E´) caused 83.5% of the infections. All 12
isolates of genotype A´ were related to the MRSA prevalent in Brazil (ST 239-
SCCmecIII). Genotypes B´ and C´ included 20 and 17 isolates, respectively. These
two genotypes were found among MRSA SCCmecIV and MSSA isolates,
presenting ST 5 (genotype B´) and ST 1 (genotype C´). ST 30 was found among
isolates from genotype E´. At least 95% of isolates produced biofilm. Virulence
genes, icaA, fnbA, cna and ebpS were extensively distributed, and fnbB, bbp and
PVL genes were associated with specific genotypes. There was no difference
between PRI and PNRI regarding the prevalence of virulence genes and genotypes
found. Our results show the presence of important international lineages of
MRSA-SCCmecIV in our institutions and STs not described in Brazil (ST 97 e ST
72). The genetic similarity observed between MRSA SCCmecIV and MSSA isolates
that were included in genotypes B´ and C´ (STs 5 and 1, respectively) indicates
that some lineages are more adapted to receive cassette mec.

Key words: Staphylococcus aureus – SCCmec – microbial resistance - prosthesis


infection – virulence genes - genotypic diversity

Rio de Janeiro
Fevereiro de 2009
xii

ÍNDICE

1 Introdução

1.1 O Gênero Staphylococcus................................................................ 2


1.2 Staphylococcus aureus.................................................................... 3
1.3 Fatores de virulência ..................................................................... 4
1.4 Aspectos gerais das infecções associadas a próteses articulares
causadas por Staphylococus aureus.......................................................... 11
1.5 Resistência à meticilina em Staphylococcus aureus......................... 14
1.6 Epidemiologia das infecções por Staphylococcus aureus resistentes
à meticilina............................................................................................... 21
1.7 Justificativa do presente estudo...................................................... 29

2 Objetivos............................................................................................... 32

3 Material e Métodos
3.1 Locais de estudo............................................................................. 34
3.2 Amostras bacterianas..................................................................... 34
3.3 Amostras-controle.......................................................................... 35
3.4 Definições utilizadas neste estudo................................................... 36
3.5 Identificação bacteriana.................................................................. 36
3.5.1 Confirmação da identificação das amostras de Staphylococus
aureus...................................................................................................... 37
3.6 Determinação da susceptibilidade aos antimicrobianos................... 38
3.7 Tipagem do SCCmec por PCR-multiplex nas amostras de
Staphylococcus aureus resistentes à meticilina.......................................... 40
3.7.1 Liberação do DNA................................................................... 40
3.7.2 PCR-multiplex para detecção do tipo de SCCmec.................... 42
3.8 Análise do perfil de fragmentação do DNA cromossômico após
tratamento com enzima de restrição e separação por eletroforese em gel
de campo pulsado (PFGE)......................................................................... 45
3.9 Caracterização das amostras de Staphylococcus aureus através da
análise dos fragmentos de restrição de genes que codificam isenzimas
(MLFRT).................................................................................................... 47
3.10 Caracterização das amostras de Staphylococcus aureus através de
tipagem por seqüênciamento de multilócus enzimático (MLST).................. 49
3.11 Detecção de genes que codificam fatores de virulência bacteriana. 50
3.12 Método quantitativo de análise da produção de biofilme................ 52
xiii

3.13 Análise estatística......................................................................... 54

4 Resultados............................................................................................ 55

86
5 Discussão..............................................................................................

6 Conclusões............................................................................................ 110

7 Referências bibliográficas...................................................................... 112

8 Anexo.................................................................................................... 130
xiv

LISTA DE ABREVIATURAS

A – Adenina
ATCC – “American type culture collection”
C – Citosina
CA-MRSA – Staphylococcus aureus resistente à meticilina de origem comunitária
CC – Complexo clonal
CCIH – Comissão de controle de infecção hospitalar
CDC – Centro de Prevenção Controle de Doenças, Estados Unidos
CLSI – “Clinical and Laboratory Standards Institute”
CMI(s) – Concentração (ões) mínima (s) inibitória (s)
oC – Graus centígrados
DNA – Ácido desoxirribonucléico
dNTPS – Desoxirribonucleotídeos trifosfatados
D.O. – Densidade ótica
EDTA – Ácido etilenodiaminotetracético
G – Guanina
h – Horas
HA-MRSA - Staphylococcus aureus resistente à meticilina de origem hospitalar
HIV – Vírus da imunodeficiência humana
HUCFF – Hospital Universitário Clementino Fraga Filho
IAP – Infecções associadas a prótese
INAP - Infecções não associadas a prótese
INTO – Instituto Nacional de Traumatologia e Ortopedia
IS – Seqüência de inserção
kb – Quilobase (s)
M - Molar
µg – Micrograma (s)
mg – Miligrama (s)
min - Minutos
mL – Mililitro (s)
µL – Microlitro (s)
MLFRT – Polimorfismo dos fragmentos de restrição de genes que codificam
isoenzimas (“Multilocus fragment restriction type”)
MLST – Tipagem por seqüenciamento de multilocus enzimático (“Multilocus
sequence typing”)
xv

MRSA – Staphylococcus aureus resistente à meticilina


MSCRAMMs – Componentes da superfície microbiana que reconhecem moléculas
da matriz extracelular
MSSA - Staphylococcus aureus sensível à meticilina
mM - Milimolar
NNISS – “National nosocomial infection surveillance system”
nMRSA - Staphylococcus aureus resistente à meticilina não multirresistente
OSPC – Clone Oceania Pacífico Sul
pb – Par (es) de base (s)
PBP – Proteína ligadora de penicilina
PCR – Reação em cadeia da polimerase
PFGE – Eletroforese de campo elétrico pulsado
pH – Potencial de hidrogênio
PVL – Leucocidina de Panton-Valentine
p/v – Peso por volume
RFT – “Restriction fragment type”
SCCmec – Cassete cromossômico mec de Staphylococcus
SCN – Staphylococcus coagulase-negativo
s – Segundo (s)
ST – “Sequence type”
T – Timina
TBE – Tris – Borato – EDTA
TE – Tris – EDTA
Tn – Transpósons
TSA – Ágar tripcaseína de soja
TSB – Caldo tripcaseína de soja
UFC – Unidade formadora de colônia
UI – Unidade internacional
UTI – Unidade de terapia intensiva
UFRJ – Universidade Federal do Rio de Janeiro
V – Volts
v/v – Volume por volume
xvi

VISA – Staphylococcus aureus com resistência intermediária à vancomicina


VRSA – Staphylococcus aureus resistentes à vancomicina
X g – Força gravitacional
1

1 - Introdução
2

1.1 O Gênero Staphylococcus

Membros do gênero Staphylococcus apresentam-se como cocos

Gram-positivos, com 0,5 a 1,5µm de diâmetro, isoladamente, aos pares,

em tétrades, em pequenas cadeias (3 ou 4 células) ou irregulares, na

forma de cachos. Esses microrganismos são imóveis, resistentes à

bacitracina, não formam esporos, são anaeróbios facultativos,

normalmente, produzem a enzima catalase, são capazes de crescer em até

10% de NaCl e sua temperatura ótima de crescimento se encontra entre

30oC e 37oC. Pertencem à família Staphylococcaceae e em seu genoma

apresentam baixo conteúdo G-C (HOLT et al., 1994; BANNERMAN &

PEACOCK, 2007).

O gênero Staphylococcus é composto por 41 espécies e 24

subespécies (EUZEBY, 2008). Essas espécies estão amplamente

distribuídas na natureza e colonizam, principalmente, mucosas, pele e

glândulas da pele de mamíferos e aves (JARLOV,1999).

Baseado na capacidade de coagular o plasma, através da ação da

enzima coagulase, as espécies do gênero são classificadas em coagulase-

positivas e coagulase-negativas. A espécie S. aureus subespécie aureus

(referida apenas como S. aureus) é a principal representante do grupo das

espécies coagulase-positivas. Essa espécie é reconhecida desde 1883 como

agente de infecções, tendo sido responsável, nessa era pré-antibiótico, por

taxas de mortalidade em bacteriemias de até 82% (SMITH & JARVIS,

1999). Hoje, essa espécie continua sendo considerada como patogênica e

de maior importância entre os estafilococos em infecções humanas, tanto

de origem comunitária quanto de origem hospitalar.


3

Os Staphylococcus coagulase-negativos (SCN) constituem um grupo

onde é encontrada a maior parte das espécies do gênero Staphylococcus

(JARLOV et al., 1999). Até 1975, os SCN eram agrupados juntos e

distinguidos do S. aureus por sua inabilidade em coagular plasma

sanguíneo. Eles foram considerados, durante muito tempo,

microrganismos saprófitas, porém, sua importância como patógenos tem

sido reconhecida nas últimas décadas, principalmente, devido ao aumento

no uso de próteses, cateteres e dispositivos invasivos, associado ao

crescente número de pacientes imunocomprometidos (BANNERMAN &

PEACOCK, 2007). Esses fatores trouxeram os SCN para a vanguarda dos

patógenos hospitalares. Contudo, como essas bactérias são habitantes

normais da pele e mucosas, um dos principais desafios é distinguir as

amostras de SCN com significância clínica das amostras contaminantes

(VON EIFF, PETERS & HEILMANN, 2002). Entre as espécies de SCN,

aquelas que têm sido mais isoladas de infecções humanas, especialmente

de bacteriemias, infecções relacionadas aos dispositivos médicos e

infecções urinárias são: S. epidermidis, S. haemolyticus, S. hominis e S.

saprohyticus (ING, BADDOUR & BAYER, 1997).

1.2 Staphylococcus aureus

As infecções por S. aureus muitas vezes são precedidas por

colonização, principalmente nasal, que ocorre em cerca de 25% dos

indivíduos sadios (VANDENBERGH et al., 1999; SCANVIC et al., 2001). A

narina anterior funciona como reservatório primário de S. aureus em


4

humanos (CASEWEL & HILL, 1986). Esse microrganismo pode ser

encontrado colonizando outros sítios, como axilas e períneo, porém,

havendo eliminação do microrganismo das narinas, normalmente, há

eliminação também em outros sítios, indicando ser a narina o principal

sítio de colonização da espécie (KLUYTMANS et al., 1997). A partir desse

local, o microrganismo pode colonizar pele, mucosas e outras regiões

(REAGAN et al., 1991). Além disso, indivíduos que são portadores nasais

podem contaminar as mãos de profissionais de saúde e/ou outros

pacientes e contribuir para a dispersão do microrganismo no ambiente ao

seu redor (BOYCE, 1996).

1.3 Fatores de virulência

Devido à variedade de mecanismos de virulência conhecidos, S. aureus é

considerado um dos patógenos humanos mais versáteis (ARCHER, 1998). S.

aureus pode causar desde infecções cutâneas superficiais, como impetigo,

celulite e abscessos, até infecções invasivas decorrentes da invasão direta

dos tecidos, como bacteriemia, endocardite, pneumonia e meningite (SMITH

& JARVIS, 1999). Além disso, esse patógeno causa síndromes clínicas

relacionadas à produção de toxinas, incluindo intoxicação alimentar

associada à ingestão de enterotoxina estafilocócica pré-formada, síndrome da

pele escaldada e síndrome do choque tóxico estafilocócico (BANNERMAN &

PEACOCK, 2007).

Inúmeros fatores de virulência atuam na patogenia bacteriana.

Durante a etapa de colonização está envolvido um conjunto de adesinas


5

que são capazes de se ligar aos componentes da matriz extracelular do

hospedeiro (tabela 1), que são designadas pela sigla MSCRAMMs

(“Microbial Surface Components Recognizing Adhesive Matrix Molecules”)

e reconhecidas como importantes receptores para aderência estafilocócica

(PROJAN & NOVICK, 1997). A maioria dessas MSCRAMMs possui em

comum a característica de estarem ancoradas, covalentemente, à

peptideoglicana da parede celular bacteriana através de ligações de

transpeptidação. Essas proteínas, freqüentemente, apresentam um sinal

peptídico, C-terminal, do tipo LPXTG, o qual é reconhecido por uma

enzima denominada sortase. Essa enzima é responsável pelo ancoramento

de proteínas de superfície a peptídeoglicana. A sortase é uma proteína

localizada na membrana do S. aureus que cliva os peptídeos entre a

treonina e a glicina do domínio LPXTG e catalisa a formação de uma ponte

amida entre o radical carboxil da treonina e o grupamento amina da ponte

cruzada do peptideoglicana (TON-THAT et al., 1999). Entre as MSCRAMMs

de S. aureus estão proteínas que se ligam ao fibrinogênio, como o fator

clumping A e B (ClfA e ClfB), proteínas que se ligam à elastina (Ebp), ao

colágeno (Cna), ao ácido siálico ósseo (Bbp) e proteínas que se ligam à

fibronectina A e B (FnBPA e FnBPB), que são reconhecidas como

importantes invasinas capazes de promover a entrada do S. aureus em

vários tecidos (FOSTER & HOOK, 1998; FOWLER et al., 2000; TUNG et

al., 2000). Essas MSCRAMMs têm papel essencial no início das infecções

endovasculares, e daquelas relacionadas a dispositivos médicos, entre

outras. Diferentes amostras de S. aureus podem apresentar conjuntos

diversos de MSCRAMMs, o que pode explicar a capacidade apresentada


6

por algumas cepas em causar determinadas infecções (PATTI et al. 1994;

FOSTER & HOOK, 1998).

Tabela 1. Principais adesinas de ligação à matriz extracelular


do hospedeiro encontradas em Staphylococcus aureus.

Gene Função da proteína codificada Referência

Cna ligação ao colágeno PATTI et al., 1994

clfA/clfB fator clumping – ligação ao fibrinogênio PATTI et al., 1994

fnbA/fnbB ligação à fibronectina MENZIES, 2003

Ebp ligação à elastina FOSTER et al., 1998

Bbp ligação ao ácido siálico ósseo TUNG et al., 2000

Spa proteína A (adesina) e ligação a porção HARTLEIB et al., 2000


Fc do anticorpo

Uma vez aderido ao tecido, S. aureus é capaz de se estabelecer e

persistir, utilizando vários mecanismos. Esse microrganismo é capaz de

formar uma estrutura complexa denominada biofilme, tanto em

componentes biológicos quanto em superfícies inanimadas (CONSTERTON

et al, 1999). Costerton e colaboradores (1999) definiram biofilme como

uma comunidade estruturada de células bacterianas embebidas em uma

matriz polimérica, produzidas por estas bactérias, e aderidas em uma

superfície biótica ou abiótica.

O biofilme atua como barreira física à ação do sistema imunológico

do paciente e tem se tornado um grave problema na área de saúde, pois,

está intrinsecamente relacionado ao aumento da resistência dos

microrganismos aos antimicrobianos. Além disso, está associado a


7

infecções relacionadas a dispositivos médicos e a dificuldade de

tratamento dessas infecções, uma vez que as células embebidas no

biofilme (sésseis) encontram-se menos expostas aos antimicrobianos, e

adicionalmente, neste microambiente há maior concentração de

nutrientes, como carbono e nitrogênio (DONLAN, 2001). El-Azizi e

colaboradores (2005) ao compararem a susceptibilidade à vancomicina e

quinupristina/dalfopristina em amostras de S. aureus e S. epidermidis, no

biofilme e em condições planctônicas, observaram que todas as células

crescidas em condições planctônicas foram sensíveis aos antimicrobianos

testados, enquanto no biofilme, grande parte das células era resistente a

concentrações superiores a 1g/mL, de ambas as drogas.

A formação de biofilme em Staphylococcus é um processo

multifatorial e complexo que pode ser subdividido em duas fases distintas:

(1) uma fase de rápida aderência da bactéria à superfície biótica ou

abiótica e (2) uma fase mais prolongada de acúmulo de células, que

envolve proliferação, adesão entre células bacterianas e a produção de

uma matriz levando a formação do biofilme maduro (HEILMANN et al.,

1996). A aderência inicial a superfícies depende não apenas da natureza

do material do polímero, mas também das características da superfície

celular bacteriana (GÖTZ, 2002). Essa interação inicial envolve forças

físico-químicas não específicas, como força de van der Waal’s, interações

hidrofóbicas e polaridade (VON EIFF, PETERS & HEILMANN, 2002). S.

aureus também pode se ligar às superfícies via proteínas da matriz

extracelular do hospedeiro uma vez que após a implantação do dispositivo

médico, o polímero rapidamente torna-se recoberto por plasma e proteínas


8

da matriz extracelular, como fibronectina, fibrinogênio, vitronectina,

colágeno e outras (DICKINSON & BISNO, 1989).

Na fase de acúmulo, adesinas polissacarídicas têm papel importante

na interação entre as células bacterianas (GÖTZ, 2002). Vários

polissacarídeos têm sido estudados, porém, a maioria dos estudos tem

mostrado que o principal composto presente nessa fase de formação de

biofilme é a adesina intercelular polissacarídica, referida como PIA, sendo

sua biossíntese dependente de genes do operon icaADBC (ARCIOLA,

BALDASSARRI & MONTANARO, 2001). A estrutura desse principal

polissacarídeo é formada por uma glicosaminoglicana, com ligações β-1,6

com pelo menos 130 resíduos de 2-deoxi-2-amino-D-glicopiranosil, onde

80 a 85% são N-acetilados, sendo 15-20% desses resíduos deacetilados e

assim, carregados positivamente (MACK et al., 1996).

O operon ica é composto pelo gene icaR (regulatório) e pelos genes

ica ADBC (biossíntese de PIA). Esse operon foi, inicialmente, descrito em S.

epidermidis e mais tarde foi observada sua presença também em S. aureus

(CRAMTON et al., 1999). Apesar das funções das proteínas IcaA, B, C e D

não estarem completamente elucidadas, acredita-se que IcaA e D têm

atividade de glicosil transferase, atuando na síntese dos oligômeros e

utilizando como substrato UDP-N-acetilglicosamina, enquanto IcaC

estaria envolvida na externalização do polissacarídeo crescente e IcaB

seria responsável pela reação de deacetilação (GERKE et al., 1998). O gene

icaR que está localizado à montante do operon ica codifica o repressor

desse operon (HEILMANN et al., 1996).


9

Em S. aureus, outros fatores, além da PIA, parecem ter papel

importante na formação do biofilme. Alguns estudos demonstram que

amostras de S. aureus que sofreram deleção no lócus ica foram capazes de

continuar produzindo biofilme, revelando que há outros mecanismos

envolvidos nessa produção, independente do operon ica (CUCARELA et al.,

2001; FITZPATRICK et al., 2005; O´NEILL et al., 2008).

A manutenção da bactéria no biofilme requer mecanismos

adaptativos ao modo séssil de vida. Dentro do biofilme a bactéria

desenvolve uma organizada e complexa comunidade, onde os canais

servem como um rudimentar sistema circulatório (BOLES, THOENDEL &

SINGH, 2004). A liberação de moléculas sinalizadoras, que é finamente

regulada por um sistema “quorum sensing”, induz a bactéria a responder

às mudanças, alterando seu perfil de expressão gênica. Além disso, esse

microambiente fornece condições ótimas para transferência de genes

extra-cromossomiais (DUNNE et al., 2002). Beenken e colaboradores

(2004) analisando a expressão global dos genes de S. aureus em biofilme e

nas fases exponencial e pós-exponencial de culturas planctônicas, através

de “microarray”, identificaram 48 genes em que a taxa de expressão foi

aumentada pelo menos duas vezes mais no biofilme. Concomitantemente,

foi observado que 84 genes tiveram sua expressão diminuída pela metade

nas culturas planctônicas.

Os S. aureus também possuem outras características que o permitem

evadir do sistema imune do hospedeiro (FOSTER et al., 2005). Um dos

principais fatores é uma microcápsula, presente em mais de 90% das

amostras clínicas de S. aureus que atua como fator antifagocitário, sendo


10

os tipos CP5 e CP8, os mais encontrados (JOHN & BARG, 1996; LEE &

LEE, 2000).

Durante o processo infeccioso S. aureus é capaz de produzir várias

enzimas, como proteases e lipases que permitem que o patógeno invada e

destrua os tecidos, migrando para outros sítios (LOWY, 1998). Além disso,

essa espécie produz várias toxinas, como a da síndrome do choque tóxico

(TSST), esfoliatinas e enterotoxinas que causam síndromes severas

associadas a essas toxinas (DINGES et al., 2000).

A leucocidina de Panton Valentine (PVL) é uma toxina cuja importância

vem sendo destacada devido ao isolamento cada vez maior de amostras de S.

aureus que a produzem. A PVL tem se destacado como um importante fator

de virulência, devido a constante presença dessa proteína em amostras de S.

aureus resistentes à meticilina causadoras de infecções comunitárias e

também hospitalares (DAVIS et al., 2006; BARTELS et al., 2007). Essa

toxina, codificada pelos genes lukS-PV e lukF-PV, consiste em duas proteínas

secretadas separadamente, conhecidas como componentes S e F, que atuam

sinergicamente para lisar células polimorfonucleares, monócitos e

macrófagos (PREVÓST et al., 1995). Os genes que a codificam encontram-se

inseridos em bacteriófagos que possuem a capacidade de integrar-se no

cromossomo de S. aureus (KANECO & KAMIO, 2004). Amostras MRSA

produtoras de PVL estão fortemente associadas com infecções cutâneas e

pneumonias necrotisantes (GILLET et al., 2002; YAMASAKI et al., 2005).


11

1.4 Aspectos gerais das infecções associadas a próteses articulares

causadas por Staphylococcus aureus

Implantes de próteses articulares estão entre os principais avanços

da cirurgia e medicina nas últimas décadas (STECKELBERG & OSMON,

2000). Contudo, esses avanços vieram acompanhados de maior

susceptibilidade às infecções, apesar das taxas ainda serem relativamente

baixas. Segundo Steckelberg e Osmon (2000) a incidência de infecções em

artroplastias de joelho e quadril é de 5,9/1.000 pacientes-ano, nos dois

primeiros anos pós-operatório, e de 2,3/1000 pacientes-ano, entre 2 e 10

anos após a cirurgia. Na Inglaterra, o Serviço Nacional de Vigilância de

Infecções Hospitalares divulgou as taxas de infecções em próteses de

joelho e quadril, entre 1997 e 2005, tendo sido observados percentuais de

1% e 1,8%, respectivamente (http://www.hpa.org.uk/infections/topics_az/

surgical_site_infection/all_97_05_ssi.pdf). Essas infecções ocasionam alta

morbidade devido a dor, perda da prótese, necessidade de nova cirurgia, e

em muitos casos, pode levar a óbito. Além disso, o custo com o reimplante

é 3 a 4 vezes maior do que o implante original e há prolongado uso de

antimicrobianos (STECKELBERG & OSMON, 2000). Sculco e

colaboradores (1995) demonstraram que o custo com cada episódio de

infecção em próteses, nos Estados Unidos, excede os $50.000,00.

Em relação aos principais agentes causadores de infecções em

próteses articulares os Staphylococcus, sobretudo, as espécies S. aureus e

S. epidermidis, possuem um papel essencial, uma vez que, normalmente,

são encontrados em mais de 70% dessas infecções (EHLRICH et al., 2004;

MORAN et al., 2007). Moran e colaboradores (2007) analisando infecções


12

de próteses articulares, em 112 pacientes, demonstraram que S. aureus

estava presente em 52% e os SCN em 47% dessas infecções, sendo que em

algumas delas havia a presença de ambos os patógenos.

Microrganismos podem colonizar a prótese, diretamente no

momento da colocação do implante através da manipulação pela equipe

médica, através da via hematogência durante uma bacteriemia, ou por

contigüidade de sítios infectados (LIDWELL et al., 1983). Muitas vezes,

devido ao longo período existente entre a realização do implante e o

surgimento dos sintomas e/ou diagnóstico, torna-se difícil determinar a

causa da infecção (TSUKAYAMA, ESTRADA & GUSTILO, 1996). As

infecções que ocorrem em próteses são classificadas de acordo com o

período em que apareceram os sintomas, após a colocação do implante,

em: i) infecção rápida, aquela que ocorre até três meses após implante da

prótese, sendo, em geral, adquirida durante a colocação da prótese; ii)

infecção retardada, que ocorre entre três meses e dois anos após a

colocação do implante, podendo ser adquirida durante a colocação da

prótese, sendo causada por microrganismos menos virulentos, como S.

epidermidis; iii) infecção tardia, que ocorre após 24 meses de implantação

da prótese, sendo predominantemente adquirida por via hematogênica

(TRAMPUZ & ZIMMERLI, 2005). Vários trabalhos sugerem que a maioria

das infecções em próteses articulares é adquirida na sala de cirurgia, já

que diversos tipos de profilaxia pré-operatória, incluindo antimicrobianos

sistêmico e local, diminuem significativamente a incidência dessas

infecções (HILL et al., 1981; LIDWELL et al., 1982; STECKELBERG &

OSMON, 2000). Moram e colaboradores (2007) analisando infecções em


13

próteses articulares, entre 1998 e 2003, mostraram que 69% das

infecções ocorreram nos três primeiros meses após o implante.

Normalmente, são utilizados os seguintes critérios para caracterizar

os casos como infecção de próteses (pelo menos um devendo estar

presente): i) duas ou mais culturas do fragmento do tecido ou do aspirado

da prótese devem ser positivas para o mesmo microrganismo, ii) formação

de secreção observada no sítio cirúrgico, iii) inflamação aguda com

infecção observada em exame histopatológico (STECKELBERG & OSMON,

2000).

No Brasil, não há conhecimento do número preciso de implantes de

próteses que é realizado anualmente. Na Alemanha, 2,5 milhões de

dispositivos médicos, como, cateteres, próteses articulares e marcapassos

são utilizados por ano. Ainda assim, é esperado um aumento nesse

número devido ao crescimento da expectativa de vida da população, pela

realização de exercícios de alto impacto, obesidade, entre outros (MACK et

al., 2004). Nos Estados Unidos são feitos, aproximadamente, 250.000

implantes de próteses de joelho e 450.000 de quadril, anualmente e,

levando em conta que a taxa média de infecções nesses implantes seja de

1%, cerca de 7.000 artroplastias são infectadas anualmente (EHLRICH et

al., 2004; KURTZ et al., 2005).

O principal fator da patogênese bacteriana relacionado a próteses

articulares é a produção de biofilme. Como foi dito anteriormente, o

biofilme age protegendo a bactéria da ação antimicrobiana. Dois

mecanismos têm sido propostos para explicar como as bactérias tornam-

se resistentes na presença do biofilme: (i) os antibióticos não conseguiriam


14

alcançar bactérias presentes nas camadas mais profundas do biofilme,

devido a dificuldade destes em penetrarem na camada de polissacarídeo;

(ii) as bactérias das camadas mais profundas estariam com o metabolismo

sensivelmente alterado, o que as tornariam resistentes aos

antimicrobianos (CONSTERTON et al., 1999)

1.5 Resistência à meticilina em Staphylococcus aureus

Com a introdução das penicilinas semi-sintéticas, como meticilina e

oxacilina, em 1959, ocorreu um grande avanço no tratamento das

infecções estafilocócicas, causadas por amostras produtoras de

penicilinases, diminuindo, consideravelmente, os índices de mortalidade

por essas infecções (JOHN & BARG, 1996). Porém, já no início da década

de 60, surgiram as primeiras amostras de S. aureus resistentes a essas

drogas na Inglaterra (JEVONS, 1961 apud ITO et al., 2004). Na década

seguinte, amostras de S. aureus resistentes à meticilina emergiram como

principais causadoras de infecções hospitalares em várias partes do

mundo (BENNER & KAYSER, 1968; ZECHOVSKY, 1974).

O surgimento da resistência à meticilina em S. aureus deveu-se a

aquisição do gene mecA, cujo tamanho é de 2,1kb e é responsável pela

produção de uma proteína ligadora de penicilina (PBP) alterada, de 78

kDa, chamada PBP 2a (ITO et al., 2003). Essas PBPs são enzimas que

atuam como transpeptidases durante a biossíntese da parede celular

bacteriana. Em amostras de S. aureus sensíveis à meticilina (MSSA -

“methicillin-suceptible Staphylococcus aureus”) os antimicrobianos β-

lactâmicos ligam-se às PBPs nativas e impedem a síntese da camada de


15

peptideoglicana. Como esses antimicrobianos possuem baixa afinidade

pela PBP2a, a síntese da parede celular ocorre normalmente nas amostras

resistentes (MRSA - “methicillin-resistant Staphylococcus aureus”)

(CHAMBERS, 1993).

O gene mecA está inserido em um cassete cromossômico mec de

estafilococos (“staphylococcal cassete chromosome mec”, SCCmec), um

elemento que pode variar de 20,9 a 66,9kb de DNA. Até o momento foram

descritos sete tipos de elementos SCCmec, classificados de I a VII (tabela

2; figura 1) (ITO et al. 2001; DAUM et al., 2002; ITO et al, 2004; OLIVEIRA

et al., 2006; HIGUCHI et al. 2008). Normalmente, os tipos I, IV, V, VI e VII

determinam resistência apenas aos β-lactâmicos, enquanto os tipos II e III

determinam resistência a várias classes de antimicrobianos, devido aos

elementos genéticos adicionais integrados a esses cassetes, tais como:

plasmídeos (pUB110, pI258 e pT181) e transpósons (Tn554 e ΨTn554). O

plasmídeo pUB110 apresenta o gene ant(4´) que confere resistência a

vários aminoglicosídeos, enquanto o pI258 confere resistência às

penicilinas e aos metais pesados, e o pT181 resistência à tetraciclina. Os

elementos genéticos móveis atuam como potenciais regiões “hot spot” (alta

freqüência de recombinação), contribuindo para a variação na composição

do cassete. Além disso, esses elementos possuem seqüências de inserção

(IS) como, IS431 e IS1272 e os genes responsáveis pela regulação do gene

mecA: mecI e mecR1 (ITO et al., 2001; LECLERCQ, 2002; ITO et al., 2003;

OLIVEIRA et al., 2006). A proteína MecI atua na repressão dos genes mecA

e mecR1 enquanto a MecR1 é uma proteína transmembranar com

capacidade de reconhecer os β-lactâmicos. Na presença do


16

antimicrobiano, MecR1 sofre clivagem e o domínio metaloprotease

intracelular torna-se ativo. Esse domínio cliva a proteína MecI que está

ligada à região promotora do mecA, permitindo assim, a expressão do gene

mecA e, conseqüentemente, a síntese da PBP2a (BERGER-BACHI &

ROHER, 2002). As seqüências de inserção IS431 e IS1272 podem se

inserir na região do mecI e mecR1 e, como resultado, ocorre a indução do

gene mecA (KATAYAMA et al., 2001). Já foram descritas, até o momento,

cinco classes distintas de complexo do gene mec (A, B, C, D e E) em

Staphyloccoccus, das quais, três, foram descritas para S. aureus: classe A

(mecI-mecR1-mecA-IS431), classe B (IS1272-∆mecR1-mecA-IS431) e classe

C (IS431-mecA-∆mecR1-IS431) (ITO et. al., 2001, OLIVEIRA, MILHEIRIÇO

& DE LENCASTRE, 2006; DEURENBERG & STOBBERINGH, 2008).

O SCCmec também é caracterizado pela presença de genes que

codificam as recombinases, denominados ccr, que estão presentes em

todos os elementos SCCmec (tabela 2). Sua função é integrar e excisar o

SCCmec no genoma bacteriano em um sítio específico denominado sítio de

ligação do SCCmec (attBscc), que está localizado na região terminal 3´ de

uma seqüência de leitura aberta ou orf (“open reading frame”), cuja função

não é conhecida (ITO et al., 1999). São descritos quatro alotipos (1, 2, 3 e

4) para os genes ccrA e ccrB e três para o gene ccrC (1, 2 e 8). Os tipos de

SCCmec são determinados pela composição do complexo mec e dos genes

ccr (tabela 2). As regiões que não fazem parte desses sítios são

denominadas regiões J (do inglês junkiard). Cada SCCmec é dividido em

três regiões J que, baseado em sua posição, apresentam-se,


17

esquematicamente como: J3-mec-J2-ccr-J1 (SHORE et al., 2005;

CHONGTRAKOOL et al. 2006).

Tabela 2: Características do SCCmec encontrados em amostras de


Staphylococcus aureus

Tipo do Complexo genes / tipo de Tamanho


SCCmec mec complexo ccr (kb)

I B A1 e B1 /ccr1 34,3

II A A2 e B2 /ccr2 53

III A A3 e B3 /ccr3 67

IV B A2 e B2 /ccr2 20,9 – 24,3

V C C1 /ccr5 28

VI B A4 e B4 /ccr4 20,9

VII C C2 e C8 / - 35,9

Adaptada de: (ITO et al., 2001; MA et al., 2002; ITO et al., 2004;
OLIVEIRA, MILHEIRIÇO & DE LENCASTRE, 2006, HIGUCHI et al., 2008,
DEURENBERG & STOBBERINGH, 2008)

A origem do SCCmec ainda é desconhecida, apesar desse elemento

ser amplamente disseminado entre os estafilococos (HIRAMATSU et al.,

2001). Alguns estudos têm mostrado similaridade entre as seqüências de

aminoácidos das PBPs de Staphylococcus sciuri e de S. aureus, sugerindo

que o gene mecA possa ter se originado a partir dos SCN (WU et al., 1996),

porém, ainda não existe um consenso sobre esta origem.


IS431 ∆mecR1 ccrA1 e B1 18
orfX
pls SCCmecI
mecA
ΨIS1272
mecA ccrA2 e B2
orfX SCCmecII
pUB 110 Tn554 kdp

mecI/mecRI

ccrC mecA ccrA3 e B3


orfX
Tn554 pI258 pT181 Tn554 SCCmecIII
mecI/mecRI

mecA ∆mecR1 ccr2


orfX
SCCmecIV
ΨIS1272
∆mecR1 ccrC

orfX
SCCmecV
mecA
mecA ΨIS1272 ccr4
orfX SCCmecVI

IS 431
∆mecR1
ccrC2 mecA ccrC8

SCCmecVII

∆mecR1
Figura 1 – Figura esquemática simplificada da estrutura dos tipos de cassete cromossômico mec (SCCmec) encontrados em
amostras de Staphylococcus aureus (adaptado de DEUREMBERG & STOBBERINGH, 2008). Cores iguais representam os mesmos
fragmentos gênicos.

18
19

As taxas de resistência à meticilina em S. aureus têm sido bastante

variadas nos últimos anos. Em um estudo realizado por Tiermesma e

colaboradores (2004), onde foi analisada a resistência à meticilina em S.

aureus em diversos países da Europa, foram encontradas taxas menores

que 1%, em países como Holanda e Suécia, porém, em outras localidades,

como França (33,1%), Portugal (34,7%), Itália (40,9%), Inglaterra (41,5%) e

Grécia (44%) as taxas de resistência foram superiores a 30%. No Brasil,

um trabalho realizado por Sader e colaboradores (2004), em hospitais do

Rio de Janeiro, São Paulo, Porto Alegre, Brasília e Florianópolis,

envolvendo 1.516 amostras, coletadas de janeiro de 1997 a dezembro de

2001, mostrou uma taxa média de 38% de resistência à meticilina entre

as amostras de S. aureus. Vivoni e colaboradores (2006) analisando

amostras de S. aureus isoladas de infecções em pacientes do Hospital

Universitário Clementino Fraga Filho, no Rio de Janeiro, encontraram

uma taxa de 37% de resistência à meticilina nas amostras de S. aureus

analisadas.

A terapêutica utilizada em infecções causadas por amostras MRSA

ainda é bastante limitada. Algumas drogas começaram a ser utilizadas

nos últimos anos, tais como, linezolida, quinupristina/dalfopristina e

tigeciclina (AKSOY & UNAL, 2007). Contudo, a vancomicina continua

sendo o principal antimicrobiano de escolha para o tratamento dessas

infecções. Essa droga é administrada endovenosamente e pode induzir

efeitos colaterais devido a sua toxicidade (HIRAMATSU et al., 2001).


20

Apesar da existência de relatos esporádicos de amostras clínicas de

SCN resistentes à vancomicina, desde a década de 80, o interesse sobre a

possibilidade de aquisição de resistência à vancomicina em estafilococos

aumentou somente após o primeiro relato de amostras de S. aureus com

resistência intermediária a essa droga, em 1996, no Japão (HIRAMATSU

et al., 1997) e, em 1997, nos Estados Unidos (CDC, 1997). Desde então, o

isolamento de amostras clínicas conhecidas como VISA (“vancomycin

intermediate Staphylococus aureus”) tem sido relatado em vários países

(KANTZANOU et al., 1999; ROTUN et al., 1999; MARCHESE et al., 2000).

Em 2002, nos Estados Unidos, foi relatado o isolamento de uma amostra

de S. aureus com resistência plena à vancomicina (chamada VRSA -

“vancomycin resistant Staphylococcus aureus) com concentração mínima

inibitória de 32µg/mL. Além disso, foi detectado nessa amostra o gene

vanA, indicando que essa resistência tenha sido adquirida por

transferência a partir da amostra de Enterococcus faecalis, que foi isolada

do mesmo sítio do VRSA (CHANG et al., 2003). No Brasil, Oliveira e

colaboradores (2001) publicaram o primeiro relato de isolamento de

amostras VISA em São Paulo. Nesse estudo, foram isoladas cinco

amostras VISA entre 140 amostras MRSA, isoladas no período de um ano,

sendo quatro amostras provenientes de pacientes internados na unidade

de queimados, que tinham utilizado vancomicina por 30 dias, e a quinta

amostra isolada de um paciente da unidade de ortopedia com sete dias de

tratamento com a droga. Esse fato vem reforçar a preocupação com o uso

continuado de vancomicina e, conseqüentemente, com a questão da


21

emergência de amostras de Staphylococcus resistentes à vancomicina no

ambiente hospitalar.

1.6 Epidemologia das infecções por Staphylococcus aureus

resistentes à meticilina

A primeira amostra de MRSA (NTCT 10442) foi isolada na Inglaterra

em 1960 e apresentava o SCCmec tipo I (ITO et al., 2001). Esse clone,

agora denominado clone Arcaico, disseminou-se pelo mundo na década de

60. Em 1982, outra amostra de MRSA (N315) foi isolada no Japão e

apresentou o SCCmecII. Esse clone foi chamado de Nova Iorque/Japão e

também se disseminou para vários países, sendo inclusive, o genótipo

predominante nas infecções por MRSA nos Estados Unidos. Três anos

mais tarde, em 1985, foi isolada uma amostra de MRSA na Nova Zelândia

(85/2082) que apresentou o SCCmecIII (ITO et al., 2001). Já na década de

1990 e 2000 vários clones de MRSA, com SCCmec IV, também começaram

a se disseminar por vários países (OKUMA et al., 2002; HUANG et al.,

2007; AMORIN et al., 2008) e, em 2004, na Austrália, foi descrita uma

amostra de MRSA (WIS) com SCCmecV (ITO et al., 2004). O SCCmecVI foi

observado apenas em amostras de Portugal e o protótipo dessas amostras

é chamado HDE288 (OLIVEIRA et al., 2006) e o SCCmecVII foi,

recentemente, descrito na amostra TSG-17 em Taiwan (HIGUCHI et al.,

2008).

No início da década de 1990, vários estudos utilizando técnicas de

tipagem molecular, em grandes coleções de S. aureus, começaram a

elucidar aspectos da epidemiologia desse patógeno. Duas teorias sugerem


22

a evolução clonal das amostras MRSA. A primeira, chamada de teoria

clonal simples, sugere que todos os MRSA teriam um ancestral em comum

e que o SCCmec teria sido inserido somente uma vez nesse ancestral e ele

teria se disseminado (KREISWIRTH et al., 1993). A outra teoria, chamada

multiclonal, sugere que o SCCmec foi introduzido várias vezes, em

diferentes linhagens de S. aureus (ENRIGHT et al., 2002). Vários estudos

indicam que esta última é a teoria mais provável (MUSSER & KAPUR,

1992; FITZGERALD et al, 2001). Musser e Kapur (1992) publicaram

resultados da análise de 254 amostras de MRSA, isoladas entre 1961 e

1992, em nove países de quatro continentes. Foi observado que o gene

mecA estava inserido em amostras de diversas linhagens de S. aureus de

diferentes origens, tendo esses autores sugerido que a aquisição desse

gene seria um evento de transmissão horizontal entre membros da

espécie, que teria ocorrido repetidas vezes em amostras de MSSA,

originando diversas linhagens de MRSA (MUSSER & KAPUR, 1992). O

estudo foi baseado na avaliação do perfil eletroforético de isoenzimas

(“Multilocus Enzyme Electrophoresis”, MLEE), responsáveis pela

manutenção celular e que apresentam pouca variação entre os membros

de uma mesma espécie (BOERLIN, 1997).

O estudo da epidemiologia de infecções por S. aureus teve grande

avanço com a aplicação da técnica de análise dos perfis de fragmentação

do DNA cromossômico, após o tratamento com enzimas de restrição e de

separação por PFGE (“Pulsed Field Gel Electrophoesis”). Em 1995, a

publicação de uma proposta de padronização da interpretação dos

resultados, obtidos pelo emprego da técnica, veio facilitar a utilização da


23

mesma em estudos epidemiológicos envolvendo amostras isoladas de uma

mesma localidade, em períodos curtos de tempo (TENOVER et al., 1995). A

técnica de PFGE passou a ser muito utilizada em grupos de amostras de

S. aureus responsáveis por surtos hospitalares (CLANCY et al., 2005;

LARSSEN et al., 2005).

Clones epidêmicos de MRSA são conhecidos por sua facilidade de

transmissão, longa persistência, rápida disseminação intra e inter-

hospitalar e facilidade de cruzar barreiras geográficas (PAPAKYRIACOU et

al., 2000). A tabela 3 mostra os principais clones de MRSA disseminados

pelo mundo. O clone Ibérico foi primeiramente descrito na Espanha, em

1989 (DOMINGUEZ et al., 1994) e, desde então, tem sido isolado em

Portugal (SANCHES et al., 1995), na Itália e Reino Unido (MATO et al.,

1998), Alemanha (WITTE et al., 1994), Bélgica, Suíça e França (DEPLANO

et al., 2000) e Estados Unidos (EUA) (ROBERTS et al., 1998b) entre

outros. O clone Húngaro foi descrito como extensivamente disseminado

nos hospitais da Hungria (SANCHES et al., 1998), tendo sido também

encontrado na Tailândia (CRISOSTOMO et al., 2001). O clone Nova

Iorque/Japão foi identificado como sendo predominante em hospitais de

Nova Iorque (ROBERTS et al. 1998a), Nova Jérsei, Pensilvânia e

Connecticut (ROBERTS et al., 2000), além de ter sido descrito em um

hospital localizado em Tóquio (AIRES DE SOUZA et al., 2000). O clone

pediátrico foi, inicialmente, descrito em um hospital pediátrico de Portugal

em 1992 (SÁ-LEÃO et al., 1999). Sua ocorrência também foi relatada na

Polônia (LESKI et al., 1998), EUA (ROBERTS et al., 1998b), Argentina

(CORSO et al., 1998) e Colômbia (GOMES et al., 2001), entre outros


24

países. O clone brasileiro (CB) foi inicialmente descrito por Teixeira e

colaboradores (1995) e encontrado em vários hospitais do Brasil

(TEIXEIRA, LOURENÇO & FIGUEIREDO, 1996; SANTOS et al., 1999),

Argentina, Uruguai e Chile (AIRES et al., 2001) e Portugal (DE SOUZA et

al., 1998). Esse clone encontra-se disseminado em vários países do

mundo.

Apesar da técnica de PFGE ser utilizada em inúmeros estudos, a

mesma pode se mostrar inadequada para avaliação de amostras coletadas

em longos períodos, bem como, em estudos de epidemiologia em nível

nacional ou global. Além da limitação dos critérios de interpretação, com

relação ao período de tempo e localidade onde foram coletadas as

amostras, outro problema é a dificuldade de comparação dos resultados

obtidos pelos diferentes laboratórios (TENOVER et al., 1995).

No ano de 2000, Enright e colaboradores descreveram a aplicação da

técnica de tipagem por seqüenciamento de multilócus enzimáticos

(“multilocus sequence typing”, MLST) na caracterização de amostras

MSSA e MRSA. Através dessa técnica, sete genes (arcC, aroE, glpF, gmk,

tpi, yqiL e pta) que codificam enzimas de manutenção celular são

seqüenciados, após amplificação através da técnica de reação em cadeia

da polimerase (PCR). Cada nova seqüência caracteriza-se por um novo

alelo. Da mesma forma que na eletroforese de isoenzimas, a combinação

desses alelos forma o perfil alélico (“sequence type”, ST) de cada amostra

(ENRIGHT et al., 2000). Os resultados obtidos com o uso do MLST vêm

sendo utilizados para a construção de um banco de dados que permite a

comparação de amostras de S. aureus isoladas de várias partes do mundo.


25

Em 2003, Diep e colaboradores (2003) descreveram uma nova

metodologia para tipagem de amostras de S. aureus, baseada na técnica

de MLST, denominada polimorfismo dos fragmentos de restrição de genes

que codificam isoenzimas (“multilocus restriction fragment type”, MLRFT).

Nessa metodologia são analisados os mesmos sete genes de manutenção

celular avaliados no MLST, porém, como alternativa ao seqüenciamento, é

realizada a digestão enzimática dos produtos obtidos por PCR. Esses

produtos digeridos são, então, analisados em eletroforese e os diferentes

perfis, obtidos pela avaliação dos sete genes analisados, são considerados

como diferentes tipos de fragmentação (RFTs - “restriction fragment

types”).

A associação do MLST com tipagem do SCCmec determinou uma

nova proposta de nomenclatura para os clones epidêmicos de MRSA. As

amostras são classificadas de acordo com o ST, fenótipo de resistência à

oxacilina e tipo de SCCmec. Por exemplo, o clone brasileiro é representado

como ST 239-MRSAIIIA e o clone Nova Iorque/Japão é caracterizado como

ST 5-MRSAII (OLIVEIRA, TOMASZ & DE LENCASTRE, 2001).

Em 2002, Enright e colaboradores analisaram, por MLST, 359

amostras comunitárias e hospitalares de MRSA, isoladas de 20 países.

Essa análise revelou a prevalência de cinco complexos clonais (CC),

compostos pelo mesmo ST ou STs relacionados (5 ou mais loci

semelhantes entre as amostras), que foram: CC 8, CC 5, CC 30, CC 45 e

CC22.

Os STs e complexos clonais dos principais clones distribuídos pelo

mundo estão descritos na tabela 3.


26

Tabela 3. Características dos principais clones de Staphylococcus aureus


resistentes à meticilina disseminados pelo mundo.

Genótipo Sequence Complexo Tipo de Distribuição geográfica


type (ST) clonal (CC) SCCmec

Arcaico 250 8 I Austrália., Dinamarca, Alemanha., Suíça,


Uganda, Reino Unido, Estados Unidos
Ibérico 247 8 I Bélgica, Croácia, República Tcheca, Dinamarca,
Finlândia, França, Alemanha, Itália, Polônia,
Holanda, Portugal, Eslovênia, Espanha, Suécia,
Suíça, Reino Unido, Estados Unidos
Irlandês 1 8 8 II Austrália, Irlanda, Estados Unidos, Reino Unido

Nova Iorque 5 5 II Austrália., Bélgica, Canadá, Dinamarca,


/Japão Finlândia, França, Alemanha., Irlanda, Japão,
Coréia, México, Singapura, Suíça, Uruguai,
Reino Unido, Estados Unidos
EMRSA-16 36 36 II Austrália., Bélgica, Canadá, Dinamarca, Grécia,
Irlanda, México, Noruega, Espanha, Suíça,
Suécia, Reino Unido, Estados Unidos
Brasileiro/ 239 8 III Argélia, Austrália, Brasil, China, Chile,
Húngaro República Tcheca, Finlândia, Alemanha.,
Grécia, Índia, Coréia, Mongólia, Holanda,
Polônia, Portugal,Cingapura, Eslovênia,
Espanha, Sri-Lanka, Suécia, Tailândia,
Uruguai, Reino Unido, Vietnã
Berlim 45 45 IV Armênia, Austrália., Bélgica, Finlândia,
Alemanha, Hungria, Holanda, Noruega,
Espanha, Suécia, Suíça, Estados Unidos
Pediátrico 5 5 IV Argélia, Austrália, Brasil, Colômbia, Dinamarca,
França, Coréia, Noruega, Polônia, Portugal,
Espanha, Uruguai, Reino Unido, Estados
Unidos
E-MRSA - 2/6 8 8 IV Austrália, Bélgica, Finlândia, França,
Alemanha, Irlanda, Holanda, Noruega, Taiwan,
Reino Unido, Estados Unidos
E-MRSA- 15 22 22 IV Austrália, Bélgica, República Tcheca,
Dinamarca, Alemanha, Irlanda, Kwait, Nova
Zelândia, Noruega, Portugal, Singapura,
Espanha, Suíça, Reino Unido

Adaptado de DEURENBERG et al., 2007.

Em relação às amostras MSSA, apesar de sua importância como

agentes de infecções hospitalares e comunitárias, poucos são os estudos

envolvendo tipagem molecular. Contudo, o emprego da técnica de PFGE

na tipagem de MSSA tem mostrado uma grande variedade de perfis

eletroforéticos (ENRIGHT et al., 2000; NETTO DOS SANTOS et al., 2001).


27

A epidemiologia das infecções por MRSA vem sofrendo alterações

nos últimos anos, uma vez que está cada vez mais comum o isolamento de

amostras MRSA não multirresistentes (chamadas nMRSA – “non-

multirresistant oxacillin-resistant Staphylococcus aureus”) nos hospitais

(OKUMA et al., 2002; TRINDADE et al., 2005). Esse fato era observado

apenas em amostras MRSA isoladas de infecções de origem comunitária

(CA-MRSA – “community-acquired meticillin resistant Staphylococcus

aureus”). As primeiras amostras de CA-MRSA foram descritas na

população indígena na Austrália (UDO et al., 1993). Desde então, há

registro de infecções por CA-MRSA em diversas partes do mundo (OKUMA

et al., 2002; MA et al., 2005; RIBEIRO et al., 2005). Essas infecções

acometem, principalmente, população indígena, crianças em creches,

grupos militares e atletas (SHAHIN et al., 1999; GROOM et al., 2001; CDC,

2003). No Brasil, o primeiro relato de infecções causadas por CA-MRSA foi

realizado por Ribeiro e colaboradores (2005). Essas amostras

apresentavam o SCCmecIV, ST 30 e os genes da PVL. Além disso, três das

quatro amostras apresentavam o mesmo perfil pela técnica de PFGE.

Essas amostras comunitárias são diferentes das amostras

tradicionalmente encontradas nos hospitais, ou seja, freqüentemente,

apresentam resistência apenas aos β-lactâmicos, o SCCmecIV ou V e os

genes da PVL (GILLET et al., 2002; OKUMA et al., 2002; DIETRICH et al.,

2004).

Nos últimos anos, essas características apontadas anteriormente

para as amostras de CA-MRSA vêm sendo encontradas em amostras

isoladas de infecções hospitalares. Muitos estudos têm demonstrado a


28

emergência de amostras de nMRSA com SCCmec IV em hospitais de todo

mundo (TRINDADE et al., 2005; VAN DER MEE-MARQUET et al., 2006;

BARTELS et al., 2007; AMORIN et al., 2008). A grande preocupação em

relação a essas linhagens de amostras que emergem como MRSA não

multirresistentes e com SCCmec curtos é que elas parecem apresentar um

maior equilíbrio entre a resistência e virulência, demonstrando vantagens

adaptativas, tais como, tempo de geração menor, tendência de maior

facilidade de transmissão dos elementos de resistência e CMIs de oxacilina

próximas ao “ponto de corte”, o que pode acarretar em dificuldade na

detecção de sua resistência, facilitando a sua disseminação (GILLET et al.,

2002; OKUMA et al., 2002; ITO et al., 2004). Dados que ratificam a

preocupação com essas novas amostras podem ser verificados pela

substituição, em hospitais de diversos países, dos clones de MRSA

endêmicos por essas linhagens. Além disso, essas amostras estão sendo

responsáveis pelo aumento das infecções por MRSA em países cujas taxas

eram inferiores a 1%. Bartels e colaboradores (2008) relataram que na

Dinamarca, entre 1980 e 2002, as taxas de isolamento eram inferiores a

100 amostras de MRSA por ano. A partir de 2003 os números de infecções

por MRSA foram de 243 casos em 2003, 549 em 2004 e 864 em 2005.

Esse grupo caracterizou 143 amostras de MRSA isoladas de infecções

ocorridas em Copenhagen, entre 2003 e 2004, e observou que 71% dos

casos de infecções por MRSA foram caracterizadas como comunitárias.

Nesse estudo foram identificados 16 STs, sendo os prevalentes ST 8, ST

30 e ST 80. Além disso, 86% das amostras apresentavam SCCmecIV e

44% tinham os genes da PVL. Amorim e colaboradores (2007) analisando


29

280 amostras MRSA isoladas, entre 2003 e 2005, de um hospital de

Portugal, onde o clone ST 239-SCCmecIII era endêmico, verificaram que a

maioria das amostras era resistente apenas aos β-lactâmicos e que 80,3%

das amostras apresentaram ST 22 e SCCmecIV. Apenas 11,8% das

amostras apresentaram ST 239 e SCCmecIII, características do clone

prevalente até então, demonstrando claramente a substituição de um

clone pelo outro.

1.7 Justificativas do presente estudo

1 – Entre 2005 e 2006 houve uma alteração no perfil de resistência

aos antimicrobianos nas amostras de S. aureus resistentes à meticilina

isoladas no Hospital Universitário Clementino Fraga Filho, da UFRJ. Ao

longo desses dois anos, foram isoladas amostras de MRSA com grande

sensibilidade aos demais antimicrobianos. Nesse hospital, antes desse

período, era observada a prevalência do clone brasileiro (ST 239 e

SCCmecIII), cuja característica principal é a resistência a múltiplos

antimicrobianos. Outro aspecto relevante é o fato do Laboratório de

Microbiologia do hospital apresentar dificuldade na correta detecção da

resistência à oxacilina nessas amostras. Assim, para compreender essa

alteração na resistência e responder outras questões pertinentes,

realizamos um estudo epidemiológico e da resistência à oxacilina e à

vancomicina nas amostras em questão.


30

2 – A alta prevalência de S. aureus nas infecções associadas a

dispositivos médicos relatada em diversos estudos, torna cada vez mais

importante a caracterização molecular dessas amostras, bem como a

análise de aspectos genotípicos e fenotípicos relacionados a sua

virulência. Além disso, na literatura mundial e, sobretudo no Brasil, são

extremamente escassos trabalhos que apresentem dados moleculares de

amostras de MRSA causadores de infecções em próteses. Estudos de

epidemiologia molecular podem fornecer dados de crucial importância

para a identificação e caracterização de genótipos prevalentes, bem como

de aspectos relevantes relacionados a virulência nessas amostras. Esse

tipo de análise pode ser uma importante ferramenta para auxiliar na

compreensão desse tipo de infecção e direcionar futuras terapias com o

objetivo de diminuir a incidência de infecções associadas a próteses por

essa espécie bacteriana.


31

2 - OBJETIVOS
32

O objetivo geral desse estudo foi avaliar características relacionadas

a epidemiologia molecular, a resistência e a virulência em amostras de

Staphylococcus aureus isoladas de infecções associadas e não associadas

a próteses articulares em dois hospitais da cidade do Rio de Janeiro.

Os objetivos específicos foram:

a – Determinar a susceptibilidade aos antimicrobianos utilizados na

prática clínica e as concentrações mínimas inibitórias de oxacilina e

vancomicina.

b – Determinar o tipo de cassete cromossômico mec (SCCmec).

c – Avaliar a diversidade genotípica das amostras através da técnica de

eletroforese em campo pulsado (PFGE), “multilocus fragment restriction

type” (MLFRT) e “multilocus sequence typing” (MLST).

d – Detectar a presença de diferentes genes relacionados à virulênca

bacteriana nas amostras isoladas de próteses articulares e de outras

infecções e correlacionar com a clonalidade dessas amostras.

e – Verificar a formação de biofilme nas amostras isoladas de próteses

articulares e de outras infecções.


33

3 – MATERIAL E MÉTODOS
34

3.1 – Locais de obtenção das amostras

a) Hospital Universitário Clementino Fraga Filho (HUCFF). O HUCFF

é um hospital de ensino que está ligado a Universidade Federal do Rio de

Janeiro e possui 490 leitos, sendo 10 de terapia intensiva. Em geral, 1.200

pacientes são admitidos mensalmente nas diversas especialidades

médicas existentes.

b) Instituo Nacional de Traumatologia e Ortopedia (INTO). O INTO é

uma instituição especializada em atendimento cirúrgico, não presta

serviços de emergência e está localizado na cidade do Rio de Janeiro. Os

pacientes são encaminhados ao INTO por outras unidades de saúde. O

INTO possui 144 leitos, sendo 15 de terapia intensiva e oferece serviços

médicos em 13 especialidades ortopédicas.

3.2 Amostras bacterianas

No total, foram analisadas 93 amostras de S. aureus isoladas dos

dois hospitais citados anteriormente, sendo 20 amostras de MRSA não

multirresistentes, obtidas de infecções ocorridas em pacientes do HUCFF,

no período de Fevereiro de 2005 a Março de 2006. As outras 73 amostras

foram de S. aureus resistentes ou sensíveis à oxacilina, isoladas,

continuamente, de infecções em pacientes internados no INTO, sendo 32

de infecções associadas a próteses articulares (IAP) e 41 de infecções não

associadas a próteses (INAP), no período de Agosto de 2005 a Setembro de

2007.
35

3.3 Amostras-controle

Para os testes utilizados nesse estudo foram empregadas as

amostras-controle listadas na tabela 4.

Tabela 4. Amostras-controle utilizadas no presente estudo.

Espécie Amostra Descrição Referência

Staphylococcus aureus ATCC 25923 Padrão para antibiograma CLSI


Controle dos testes fenotípicos de identificação

S. aureus ATCC 29213 Padrão para teste de diluição em ágar CLSI

S. aureus ATCC 33591 Padrão para teste de triagem em ágar com CLSI
oxacilina

S. aureus 52a Amostra clínica resistente à oxacilina (gene SCHUENCK et


mecA+) al. (2006)

S. aureus 63a Amostra clínica com SCCmecIII / Clone VIVONI et al


Brasileiro (2006)

S. aureus Mu50 Amostra SCCmecII / Clone Nova Iorque-Japão HIRAMATSU et


al (1997)

S. aureus 522a Amostra clínica com SCCmecIV / Clone VIVONI et al


Pediátrico (2006)

S. aureus 523a Amostra clínica com os genes da PVL VIVONI et al


(2006)

S. aureus ATCC 12600 Amostra tipo - Controle de testes fenotípicos -


de identificação

Staphylococcus ATCC 14990 Amostra tipo - Controle de testes fenotípicos -


epidermidis de identificação

S. epidermidis ATCC 35984 Amostra produtora de biofilme (icaA +) ARCIOLA et al.,


2001

S.epidermidis ATCC 12228 Amostra não produtora de biofilme (icaA-) -

Enterococcus faecalis ATCC 29212 Controle de testes fenotípicos de identificação CLSI

Micrococcus luteus ATCC 10240 Amostra tipo - Controle de testes fenotípicos -


de identificação

ATCC - American Type Culture Collection; CLSI – “Clinical and Laboratory Standards Institute”
36

3.4 Definições utilizadas neste estudo

No presente estudo, infecção de prótese foi caracterizada quando

observados os seguintes critérios: (i) inflamação aguda no local de

implantação da prótese e (ii) quando duas ou três culturas do fragmento

do tecido adjacente a prótese eram positivas para o mesmo

microrganismo.

Para diferenciar infecções comunitárias (IC) de infecções

hospitalares (IH) por MRSA foi utilizada a definição recomendada pelo

CDC (BUCK et al., 2005). A classificação das IC foi baseada nos seguintes

critérios:

- diagnóstico em até 48h após a admissão hospitalar;

- ausência de histórico de infecção ou colonização por MRSA;

- não ter, no período de um ano, histórico de hospitalização,

admissão em “home-care”, diálise, cirurgia, implantes de cateteres ou

outros dispositivos médicos.

3.5 Identificação bacteriana

As amostras foram previamente identificadas pelos Laboratórios de

Bacteriologia do HUCFF e do INTO, através do sistema automatizado

Vitek® (Biomerieux, Paris, França) e Microscan – AutoScan®4 (Siemens,

Mϋnchen, Alemanha), respectivamente. A confirmação da identificação

das amostras de S. aureus foi realizada segundo metodologia descrita por

MacFaddin (1976) e Smibert & Krieg (1994), com modificações, conforme

descrito a seguir.
37

3.5.1 Confirmação da identificação das amostras de Staphylococcus

aureus

As amostras foram cultivadas em ágar-sangue (Plast Labor LTDA,

Rio de Janeiro) e incubadas a 35oC, por até 72 horas, para análise da

pureza, morfologia colonial e presença de hemólise. Posteriormente, foram

realizados os seguintes testes:

a) Produção da enzima catalase

A partir de cultura bacteriana em ágar TSA (“Trypticase Soy Agar”,

Difco Laboratories, Le Pont de Claix, França) foram transferidas 3 colônias

para uma lâmina de vidro que continha uma solução de peróxido de

hidrogênio a 3% (v/v). A produção de bolhas foi indicativa de reação

positiva. As amostras de S. aureus ATCC 12600 e Enterococcus faecalis

ATCC 29212 foram utilizadas como controles positivo e negativo,

respectivamente.

b) Susceptibilidade à bacitracina

Uma suspensão bacteriana com uma turbidez equivalente à 0,5 da

escala McFarland (~108 UFC/mL) foi preparada em salina 0,9% (p/v) e

semeada, confluentemente, com auxílio de um “swab” em agar Müeller-

Hinton (Difco Laboratories). Posteriormente, foi depositado sobre o meio,

um disco impregnado de bacitracina 0,04U (CECON, São Paulo, Brasil) e a

placa foi incubada a 35oC por 18h. Um halo menor ou igual a 10mm foi

indicativo de resistência à bacitracina. As amostras utilizadas como


38

controles do teste foram S. aureus ATCC 12600 (resistente) e Micrococcus

luteus ATCC 10240 (sensível).

c) Produção de fator “clumping”

A produção de “fator clumping” foi verificada utilizando-se o sistema

comercial “Slidex Staph Plus” (Biomerieux), conforme instruções do

fabricante. A amostra utilizada como controle-positivo foi S. aureus ATCC

12600 e a amostra de S. epidermidis ATCC 14990 como controle-negativo.

d) Produção da enzima coagulase

A partir do crescimento bacteriano em meio ágar-sangue 3 colônias

foram transferidas para um tubo contendo plasma de coelho (Biocampo,

Rio de Janeiro, Brasil), diluído a 1:2 (v/v) em solução salina 0,9% (p/v).

Foi realizada incubação a 37oC, por 4h, em banho de imersão. Em

seguida, foi verificada a produção ou não de coágulo. Nos testes que ainda

se apresentavam negativos, uma nova leitura foi realizada após 24h de

incubação. Amostras de S. aureus ATCC 12600 e S. epidermidis ATCC

14990 foram utilizadas como controles positivo e negativo,

respectivamente.

3.6 Determinação da susceptibilidade aos antimicrobianos

a) Teste de difusão a partir do disco (Clinical and Laboratory

Standards Institute [CLSI] 2006a)

O perfil de susceptibilidade das amostras foi determinado frente a

15 antimicrobianos. As amostras foram inicialmente semeadas em ágar


39

sangue, por 18-24h, a 35oC. O crescimento microbiano foi então diluído

em solução salina 0,9% (p/v) para obtenção do padrão de turvação 0,5 da

escala de McFarland (~108 UFC/mL), e inoculado em placa de ágar

Müeller-Hinton (Difco Laboratories), com auxílio de um “swab”, de forma a

obter um crescimento confluente. Os discos foram depositados sobre o

meio e a leitura dos halos de inibição foi feita após 18h de incubação a

35oC, exceto para oxacilina, cefoxitina e vancomicina, cujo período de

incubação foi de 24h.

As amostras foram testadas frente aos seguintes antimicrobianos:

ciprofloxacina (5µg), clindamicina (2µg), cloranfenicol (30µg), eritromicina

(15µg), gentamicina (10µg), penicilina G (10UI), rifampicina (5µg),

sulfametoxazol/trimetoprima (25µg), teicoplanina (30µg), tetraciclina

(30µg), vancomicina (30µg) (Cecon, Rio de Janeiro, Brasil), cefoxitina

(30µg), linezolida (30µg), mupirocina (5µg) e oxacilina (1µg) (Oxoid).

Concomitantemente ao teste de difusão a partir do disco foi

realizado o teste de indução de resistência à clindamicina por macrolídeos

(teste D), conforme determinação do CLSI (2006a). Os discos de

clindamicina e eritromicina foram colocados a 20mm de distância,

margem a margem, e a análise da indução da resistência à clindamicina

por macrolídeos foi verificada pelo surgimento de um “achatamento” no

halo de inibição da clindamicina, próximo ao disco de eritromicina.

A interpretação do teste foi realizada conforme o CLSI (2007) para os

antimicrobianos em geral e de acordo com Fuchs, Jones e Barry (1990)


40

para mupirocina. A amostra padrão S. aureus ATCC 25923 foi utilizada

como controle do teste.

b) Determinação da concentração mínima inibitória (CLSI, 2006b)

A determinação das concentrações mínimas inibitórias (CMIs) de

oxacilina (Sigma-Aldrich Company, St. Louis, EUA) e vancomicina (Sigma-

Aldrich Company) foi realizada pelo método de diluição em ágar, segundo

o CLSI (2006b). As amostras bacterianas foram inicialmente semeadas em

agar-sangue, por 18-24h, a 35oC. O crescimento microbiano foi então

diluído em salina 0,9% (p/v) para obtenção do padrão de turvação 0,5 da

escala de McFarland (~108 UFC/mL). Em seguida, foi realizada uma

diluição 1:10 (v/v) em salina 0,9% e as amostras foram transferidas para

o replicador de “Steers”. Posteriormente, as amostras (~104 UFCs/mL)

foram inoculadas nas placas contendo agar Mueller-Hinton (Difco

Laboratories), 2% de NaCl (Reagen, Rio de Janeiro, Brasil) e concentrações

crescentes do antimicrobiano, variando de 0,25 a 256µg/mL.

Posteriormente, as placas foram incubadas por 24h à 35oC. A leitura do

teste foi realizada de acordo com os valores do CLSI (2007). Foi utilizada a

amostra S. aureus ATCC 29213 como controle do teste.

c) Teste de triagem em ágar contendo 6µg/mL de oxacilina ou

4µg/mL de vancomicina (NCCLS – 2006b)

O crescimento microbiano em ágar sangue foi diluído em solução

salina 0,9% para obtenção do padrão de turvação 0,5 da escala de

McFarland (~108 UFC/mL) e inoculado em um quadrante da placa de ágar


41

Müeller-Hinton (Difco) com 6µg/mL de oxacilina e 4% de NaCl (Difco), com

auxílio de um “swab” de forma a obter um crescimento confluente. As

amostras foram incubadas por 24h a 35oC. A leitura do teste foi realizada

de acordo com o NCCLS (2007). Foram utilizadas as amostras S. aureus

ATCC 29213 (sensível) e ATCC 33591 (resistente) como controles do teste.

Para o teste de triagem em 4µg/mL de vancomicina, foram

realizados os mesmos procedimentos descritos anteriormente, porém, as

amostras foram inoculadas no meio BHI (“Brain Heart Infusion”, Difco)

com 4µg/mL de vancomicina. As amostras foram incubadas por 24h a

35oC. O crescimento de mais de uma colônia na superfície do meio foi

indicativo de resultado positivo, isto é, susceptibilidade reduzida à

vancomicina. A amostra S. aureus ATCC 25923 (amostra sensível à

vancomicina) e a amostra S. aureus Mu50 (resistência intermediária à

vancomicina) foram utilizadas como controles do teste.

3.7 Tipagem do SCCmec por PCR-multiplex nas amostras de S.

aureus resistentes à meticilina

3.7.1 Liberação do DNA

A liberação do DNA foi realizada de acordo com Pitcher, Sauders e

Owen (1989). Cinco colônias bacterianas, obtidas após crescimento em

ágar-sangue, foram inoculadas em 3mL de caldo TSB (Oxoid) e incubadas

por 18h, a 35oC. A seguir, 1mL dessa suspensão foi centrifugada

(centrífuga modelo 5417R, Eppendorf, Hamburgo, Alemanha) (5min, 8000


42

X g) e o sedimento suspenso em 1,5mL de tampão TE (Tris 10 mM, EDTA

1 mM, pH 7,8). A suspensão foi novamente centrifugada (5min, 8000 X g)

e ao precipitado foram adicionados 100µL de solução de lise (50mg/mL de

lisozima [Sigma-Aldrich Company] em tampão TE, pH 7,8 e 5% de BRIJ

0,5% [v/v] (Sigma-Aldrich Company). A essa solução foram adicionados

5µL de lisostafina (1mg/mL) comercial (Sigma-Aldrich Company) e após

rápida agitação esta solução foi incubada por 1h, a 37oC em banho de

imersão. Após esse período, foram adicionados 500µL de isotiocianato de

guanidina 5M (p/v) (Life Technologies, California, EUA). As suspensões

celulares foram agitadas manualmente e então incubadas a temperatura

ambiente, por 10 min. Posteriormente, os lisados foram resfriados no gelo,

por 10 min, e a seguir adicionados 250µL de acetato de amônio (Vetec, Rio

de Janeiro, Brasil) a 7,5M (p/v). Após agitação manual os tubos foram

mantidos por 10min no gelo. Após esse período uma solução de 500µL

composta de clorofórmio/álcool isoamílico (24:1 v/v – Vetec) foi adicionada

e a mistura agitada. Posteriormente, essa mistura foi centrifugada por

10min, a 13000 X g. A fase aquosa, foi então, transferida para um novo

tubo, onde foram adicionados 430µL de isopropranol (Vetec). Os tubos

foram invertidos repetidas vezes, por 1 min, para misturar as soluções.

Após centrifugação a 7000 X g, por 20 seg o DNA precipitado foi então

lavado 5 vezes com etanol gelado (Merck) a 70% (v/v). Por fim, o DNA foi

suspenso em 50 µL de tampão TE, incubado por 16h, a 37oC e então

estocado a -20ºC.
43

3.7.2 PCR-multiplex para detecção do tipo do SCCmec.

A determinação do tipo de SCCmec presente nas amostras

resistentes à oxacilina foi realizada de acordo com Oliveira e de Lencastre

(2002).

A técnica baseia-se na presença de diferentes fragmentos de DNA

específicos dos diferentes tipos de SCCmec. O conjunto de

oligonucleotídeos utilizados (IDT, Coralville, EUA), a especificidade dos

mesmos e o tamanho dos produtos amplificados estão descritos tabela 5.

Tabela 5 – Seqüência, tamanho do amplicon e especificidade dos


oligonucleotídeos utilizados na reação de PCR-multiplex para tipagem do
SCCmec em amostras de Staphylococcus resistentes à meticilina.

Oligonucleotídeo Seqüência (5’-3’) Amplicon Especificidade


(pb) (tipo de SCCmec)
CIF2 F2 TTGGAGTTGCTGATGAAGAAGG 495 I
CIF2 R2 ATTTACCACAAGGACTACCAGC

KDP F1 AATCATCTGCCATTGGTGATGC 284 II


KDP R1 CGAATGAAGTGAAAGAAAGTGG

MECI P2 ATCAGACTTGCATTCAGGC 209 II, III


MECI P3 GCGGTTTCAATTCACTTGTC

DCS F2 CATCCTATGATAGCTTGGTC 342 I, II, IV


DCS R1 CTAAATCATAGCCATGACCG

RIF4 F3 GTGATTGTTCGAGATATGTGG 243 III


RIF4 R9 CGCTTTATCTGTATCTATCGC

RIF5 F10 TTCTTAAGTACACGCTGAATCG 414 III


RIF5 R13 GTCACAGTAATTCCATCAATGC

IS431 P4 CAGGTCTCTTCAAGATCTACG 381 IA


pUB110 R1 GAGCCATAAACACCAATAGCC

IS431 P4 CAGGTCTCTTCAAGATCTACG 303 IIIA


pT181 R1 GAAGAATGGGGAAAGCTTCAC
44

Como controles internos da reação de PCR-multiplex foram

utilizados os oligonucleotídeos MRS1 e MRS2 (IDT) (DEL VECCHIO et al.,

1995) para amplificação de um fragmento do gene mecA de 154pb.

O volume de 50µL para realização da PCR-multiplex, foi composto

por: 1µL (~30ng) de DNA, tampão da enzima 1X (10mM de Tris-HCl,

25mM de KCl), 2 mM de MgCl2, 200µM de cada deoxinucleotídio

trifosfatado (dNTPS - dATP, dGTP, dCTP e dTTP) (Biotools, Madrid,

Espanha), 1,5U de Taq DNA polimerase (Biotools), 0,8µM dos

oligonucleotídeos CIF2 F2, CIF2 R2, MECI P2, MECI P3, RIF5 F10, RIF5

R13, pUB110 R1 e pT181 R1, 1,6µM dos oligonucleotídeos DCS F2, DCS

R1 e IS431 P4 e 0,4µM dos oligonucleotídeos KDP F1, KDP R1, RIF4 F3 e

RIF4 R9.

As condições da PCR-multiplex foram as seguintes: desnaturação

inicial a 94°C, por 4min, seguida de 30 ciclos de 94°C, por 30s, 53°C por

30s e 72°C, por 1min, e, em seguida, extensão final de 4min, a 72°C. Após

a realização do ciclo, os produtos amplificados foram analisados por

eletroforese em gel de agarose (Invitrogen, Carlsbad, Estados Unidos) a 2%

em TBE 1x (Tris 0,89M, ácido bórico 0,89M, EDTA 2,5mM, pH 8,2), a 100

V, por 1h e 20min. Posteriormente, o gel foi corado com solução de

brometo de etídio (0,5µg/mL) e a imagem capturada sob luz ultravioleta

em um fotodocumetador (Vilber Lourmat, Marne-la-Valleé, França). Como

padrão de DNA para a corrida eletroforética foi utilizado o marcador 100pb

DNA ladder (Biotools).


45

3.8 Análise do perfil de fragmentação do DNA cromossômico após

tratamento com enzima de restrição e separação por eletroforese em

gel de campo pulsado (PFGE).

A análise do perfil de fragmentação do DNA cromossômico das

amostras isoladas nesse estudo foi realizada após separação, por PFGE,

dos fragmentos gerados após tratamento com a enzima de restrição SmaI .

Foi utilizada a técnica descrita por Vivoni e colaboradores (2005). As

amostras, inicialmente, foram cultivadas em ágar-sangue a 35oC, por 48h.

Posteriormente, cinco colônias isoladas foram inoculadas em 5mL de caldo

TSB (Oxoid) e incubadas durante 4h, a 37oC em banho de imersão. A

seguir, 1mL desta suspensão foi centrifugado (7000 X g / 5min) e o

sedimento suspenso em 250µL de tampão PIV (NaCl 1M, Tris-HCl 10mM,

pH 7,6). A esta suspensão foi adicionado o mesmo volume de agarose de

baixo ponto de fusão (“Low Melting Point Agarose”, IBI Technical, New

Heaven, EUA) a 2%, dissolvida em tampão PIV e mantida a 58oC. Após

homogeneização, a agarose foi distribuída em moldes que foram mantidos

a 4oC por cerca de 10 min. Posteriormente, os blocos de agarose foram

colocados em 2mL de solução de lise EC (Tris-HCl 6mM, NaCl 1M, EDTA

100mM, 0,5% de Brij 58 e 0,5% lauril sarcosinato de sódio; pH final 7,5)

contendo 50.000U de lisozima (Sigma-Aldrich Company) e 50U de

lisostafina (Sigma-Aldrich Company) e incubados a 37oC, sob agitação

lenta, durante 18h. Após este período, os tubos foram resfriados a 4°C e a

solução foi substituída por 2mL de solução ESP (EDTA 0,4M pH 9,5, 1%

(p/v) de lauril sarcosinato de sódio) contendo 0,1mg/mL de proteinase K

(Sigma-Aldrich Company), sendo essa solução incubada a 50oC, em


46

banho de imersão, sob leve agitação, durante 18h. Ao final desta fase, os

blocos de agarose foram mantidos em nova solução ESP (sem proteinase)

a 4oC. A digestão do DNA cromossômico foi realizada a partir de um bloco

de agarose, lavado cinco vezes em tampão TE a 37oC, sendo as quatro

primeiras lavagens de 1h cada e a última de 18h. Após este processo, o

bloco de agarose foi transferido para uma solução contendo 250µL do

tampão específico da enzima de restrição SmaI (New England Biolabs,

Ipswich, Inglaterra) e incubado a 25oC, por 4h. Em seguida, o bloco de

agarose foi novamente transferido para um novo tampão da enzima de

restrição contendo 20U da enzima SmaI e incubado a 25oC, durante 18h.

Posteriormente, foi removida a solução contendo a enzima e o bloco de

agarose foi fundido a 70oC e aplicado no gel de agarose (Invitrogen) a 1%

em tampão TBE 0,5x. O gel foi submetido a eletroforese em campo

pulsado (CHEF DR III, Bio-Rad), utilizando um tempo de pulso crescente

de 1 a 35s, durante 23h, a 6V/cm, 13oC, com ângulo de 120o. O gel foi

corado com brometo de etídio (0,5µg/mL), por 40min e descorado por 1h

com água destilada. Posteriormente, a imagem foi capturada sob luz

ultravioleta em um fotodocumetador (Vilber Lourmat). Como padrão de

tamanho molecular de DNA foi utilizado o marcador 50-1.000Kb Lambda

Ladder PFGE Marker (New England BioLabs).

Os padrões de bandas foram analisados através da comparação

visual entre as amostras e foram classificados de acordo com os critérios

de Tenover e colaboradors (1995) e através da análise automatizada pelo

programa GelCompar II, versão 3,5 (Applied Maths, Bélgica), usando o

coeficiente Dice de similaridade e o método de “Unweitgthed Pair Group


47

Method using Arithmetic Averages” (UPGMA) para análise dos

agrupamentos.

3.9 Caracterização das amostras de S. aureus através da análise do

polimorfismo dos fragmentos de restrição de genes que codificam

isoenzimas (MLRFT) (DIEP et al., 2003).

Após o crescimento das amostras de S. aureus em ágar-sangue, a

liberação do DNA bacteriano foi realizada como descrito no item 3.7.1.

Inicialmente foram realizadas as reações de PCR para amplificação dos

sete genes “housekeeping”, que codificam enzimas metabólicas essenciais

(tabela 6). As reações foram realizadas em um volume final de 25µL

contendo: 1µL de DNA (~30ng), tampão da enzima 1X (10mM de Tris-HCl,

25mM de KCl), 5mM de MgCl2, 0,2µM de cada oligonucleotídeo, 200µM de

cada dNTP e 1U de Taq DNA polimerase (Biotools). As condições de

amplificação foram: um ciclo inicial de 94°C/2min, seguido de 30 ciclos de

94°C/1min, 55°C/1min, 72°/1min e um ciclo final de extensão de

72°/5min. Após a realização dos ciclos, os produtos amplificados foram

analisados por eletroforese em gel de agarose (Invitrogen) a 1% em TBE 1X

a 100V por 1h e 20min. Posteriormente, o gel foi corado com solução de

brometo de etídio (0,5µg/mL) e a imagem capturada sob luz ultravioleta

em um fotodocumetador (Vilber Lourmat). Como padrão de DNA para a

corrida eletroforética foi utilizado o marcador 100pb DNA ladder (Biotools).

Após a amplificação, os produtos foram submetidos à digestão

enzimática, nas condições apropriadas a cada enzima, segundo

determinações dos fabricantes (Promega, Madison, EUA e Biotools). Para


48

cada reação de digestão foram utilizadas 3,5U de cada enzima de restrição

e 3µL do produto de PCR. Após a etapa de restrição os fragmentos obtidos

foram separados através de eletroforese em gel de agarose (Invitrogen) a

4%, exceto para os produtos da fragmentação do gene glpF pela enzima

Tsp5091 que foram separados em gel de poliacrilamida. Os possíveis

alelos descritos para cada gene estão apresentados na tabela 6.

A eletroforese em gel de agarose (Invitrogen), feito em tampão TBE

1X, foi realizada a 50V durante 3h. O padrão de tamanho molecular

utilizado foi de 50pb (Biotools).

O gel de poliacrilamida foi preparado utilizando acrilamida

(Pharmacia Biotech, New Jersey, Estados Unidos) e bis-acrilamida (Biorad)

na proporção 29:1 (p/v) na concentração de 20%, TBE 1X, 0,7% (p/v) de

persulfato de amônio (Sigma-Aldrich Company) e 0,7% (v/v) de solução

TEMED (GE Healthcare). As amostras foram submetidas a eletroforeses

em cuba vertical a 150V, por 3h. O padrão de tamanho molecular

utilizado foi de 10pb (Biotools).

A visualização dos géis foi realizada através do emprego de

transiluminador de luz UV e a imagem, capturada por um fotocumentador

(Vilber Lourmat)
49

Tabela 6. Oligonucleotídeos, enzimas de restrição e alelos descritos


utilizados nas técnicas de MLST e MLFRT.

Lócus (gene) oligonucleotídeo (5´-3´)a Enzima de Alelos


restriçãob descritosb
Carbamato quinase TTGATTCACCAGCGCGTATTGTC HinfI A, B e C
(arcC)
AGGTATCTGCTTCAATCAGCG
Shiquimato
ATCGGAAATCCTATTTCACATTC AluI e CfoI A, B, C e D
desidrogenase (aroE)
GGTGTTGTATTAATAACGATATC
Glicerol quinase
CTAGGAACTGCAATCTTAATCC Tsp5091 A, B, C, D, E,
(glpF)
FeG
TGGTAAAATCGCATGTCCAATTC
Guanilato quinase
ATCGTTTTATCGGGACCATC CfoI A, B e C
(gmk)
TCATTAACTACAACGTAATCGTA
Fosfato acetil
GTTAAAATCGTATTACCTGAAGG RsaI A, B e C
transferase (pta)
GACCCTTTTGTTGAAAAGCTTAA
Triose fosfato
TCGTTCATTCTGAACGTCGTGAA BbuI e MboI A, B, C e D
isomerase (tpi)
TTTGCACCTTCTAACAATTGTAC
Acetil coenzima A
CAGCATACAGGACACCTATTGGC VspI e DdeI A, B e C
acetil transferase
(yqiL) CGTTGAGGAATCGATACTGGAAC

a – ENRIGHT et al., 2000; b – DIEP et al., 2003.

3.10 Caracterização das amostras de S. aureus através da tipagem

por seqüenciamento de multilócus enzimáticos (MLST) (ENRIGHT et

al., 2000)

As amostras de S. aureus foram selecionadas para realização do

MLST, segundo os resultados obtidos após as análises por PFGE e/ou

MLFRT. Nessa técnica foi realizada PCR para amplificação dos mesmos

genes e nas mesmas condições descritas no item anterior (3.8). Após a

amplificação dos fragmentos dos genes, esses produtos foram purificados

utilizando o sistema comercial “GTX PCR and band purification” (GE


50

Healthcare, Buckinghamshire, Inglaterra), de acordo com as

especificações do fabricante.

Os produtos purificados foram seqüenciados pelo Centro de Estudo

do Genoma Humano da Universidade de São Paulo utilizando sistema

MegaBACE 1000 com 96 capilares (GE Healthcare). As reações de

seqüenciamento foram realizadas utilizando o sistema comercial

“DYEnamic ET Dye Terminator (com Thermo Sequenase™ II DNA

Polimerase)”.

As seqüências obtidas foram analisadas no sítio

http://saureus.mlst.net/ pela comparação com o banco de dados para

determinação dos alelos e do ST (combinação dos sete alelos) de cada

amostra.

3.11 – Detecção de genes que codificam fatores de virulência

bacteriana

Foram pesquisados os seguintes genes relacionados a virulência

bacteriana em S. aureus: icaA (codifica o polissacarídeo de adesão

intercelular), cna (proteína ligadora de colágeno), bbp (proteína ligadora de

sialoproteína óssea), ebpS (proteína ligadora de elastina), fnbB (proteína B

ligadora de fibronectina), fnbA (proteína A ligadora de fibronectina) e os

genes lukS e lukF (leucocidina de Panton Valentine).

A liberação do DNA bacteriano foi realizada conforme descrito no

item 3.7.1. A amplificação foi realizada para cada gene separadamente.

Cada reação de PCR foi realizada em um total de 25µL compostos por:

1µL de DNA (~30ng), tampão da enzima 1X (10mM de Tris-HCl, 25mM de


51

KCl), 2 mM de MgCl2, 200µM de cada dNTP (dATP, dGTP, dCTP e dTTP)

(Biotools), 1U de Taq DNA polimerase (Biotools).

Os oligonucleotídeos e as concentrações utilizadas, os tamanhos dos

fragmentos amplificados e os ciclos de amplificação estão descritos na

tabela 7.

Após a realização dos ciclos, os produtos amplificados foram

analisados por eletroforese em gel de agarose (Invitrogen) a 1% em TBE 1X

a 100V por 1h e 20min. Posteriormente, o gel foi corado com solução de

brometo de etídio (0,5µg/mL) e a imagem capturada sob luz ultravioleta

em um fotodocumetador (Vilber Lourmat). Como padrão de DNA para a

corrida eletroforética foi utilizado o marcador 100pb DNA ladder (Biotools).


52

Tabela 7 – Oligonucleotídeos, tamanho dos fragmentos e ciclo de amplificação


utilizados para detecção de genes de virulência nas amostras de Staphylococcus
aureus analisadas.

oligonucleotídeo (5´-3´) / concentração na reação gene amplicon ciclo referência


(pb)
PEACOCK et
FNBA1 – GATTATTAACGCAGCAGTAG/ 0,4µM fnbA 1362 1
al., 2002
FNBA2 – GATAATTTAATGCCAGAGC / 0,4µM

ICAF - TCTCTTGCAGGAGCAATCAA/ 0,4µM icaA 188 2 ARCIOLA et


ICAR - TCAGGCACTAACATCCAGCA/ 0,4µM al., 2001

FNBB1 – GTAACAGCTAATGGTCGAATTGATACT/ 0,4µM fnbB 524 3 TRISTAN et


FNBB2 – CAAGTTCGATAGGAGTACTATGTTC/ 0,4µM al, 2003

BBP1 – AACTACATCTAGTACTCAACAACAG/ 0,8µM


bbp 575 3 TRISTAN et
BBP2 – ATGTGCTTGAATAACACCATCATCT/ 0,8µM al, 2003
EBP1 – CATCCAGAACCAATCGAAGAC/ 0,4µM
ebpS 186 3 TRISTAN et
EBP2 – CTTAACAGTTACATCATCATGTTTATCTTT/ 0,4µM
al, 2003

CNA1 – GTCAAGCAGTTATTACACCAGAC/ 0,8µM cna 423 3 TRISTAN et


CNA2 – AATCAGTAATTGCACTTTGTCCACT/ 0,8µM al, 2003

PVL1-ATCATTAGGTAAAATGTCTGGACATGATCCA/ 0,8µM luk-S e F 433 4 LINA et al.,


PVL2-GCATCAATGTATTGGATAGCAAAAGC/ 0,8µM 1999

ciclo 1 – 30 ciclos de 1min a 94°C / 1min a 50°C / 2min a 72°C


ciclo 2 – 5min a 94°C e 50 ciclos de 30s a 94°C / 30s a 55,5°C / 30s a 72°C e 1min 72°C
ciclo 3 – 5min a 94°C e 30 ciclos de 1min a 94°C / 1min a 55°C / 1min a 72°C e 10min 72°C
ciclo 4 – 30 ciclos de 30s a 94°C / 30s a 55°C / 30s a 72°C.

3.12 Método quantitativo de análise da produção de biofilme

Para a análise da formação de biofilme foi utilizado o método e

interpretação descritos por Stepanovic e colaboradores (2000).

As culturas bacterianas foram crescidas em TSB (Difco) a 35°C, por

18-24h. Em seguida, foi realizada uma diluição (1:100v/v) desse

crescimento em novo caldo TSB suplementado com 1% de glicose (Merck,

New Jersey, EUA). Posteriormente, foram distribuídos, em quadriplicata,

200µL da suspensão bacteriana em poços de uma placa de microtitulação

de 96 poços (modelo 92096 TPP – “Techno Plastic Products”, Trasadingen,


53

Suíça), e essa foi incubada a 35°C, por 24h, e em seguida, o meio foi

desprezado para retirada das células planctônicas. Os poços foram

lavados quatro vezes com 200µL de tampão PBS (“Phosphate Buffer

Saline” – pH 7,2). Em seguida, a placa permaneceu por 1h, a 60ºC, para

fixação das células aderidas. Em seguida, foram adicionados 200µL de

cristal violeta, a 0,1% (p/v), em cada poço e a placa foi mantida à

temperatura ambiente, por 45min. Após esse período foi realizada uma

lavagem em água corrente e a placa mantida, por 30 min, a 35°C, para

secagem. Em seguida, foram colocados 200µL etanol (Merck) a 70% em

cada poço da placa.

Para análise da produção de biofilme foi avaliada a absorbância das

células aderidas, utilizando-se um leitor de ELISA, modelo 680 (Bio-Rad)

em comprimento de onda de 570nm.

As amostras de S. epidermidis ATCC 35984 (produtora de biofilme) e

S. epidermidis ATCC 12228 (não produtora de biofilme) foram utilizadas

como controles do teste.

As amostras foram classificadas em quatro categorias: não

produtoras ou fracas, moderadas ou fortes produtoras de biofilme,

fundamentadas no valor da densidade ótica (DO), obtida a partir do

biofilme bacteriano formado. Para cada amostra analisada foi

determinado um valor (chamado de N), que correspondeu a média

aritmética dos valores encontrados nos quatro poços. O valor da

densidade ótica final (DOf) considerado para determinar se as

amostras produziam ou não biofilme foi obtido calculando-se a


54

média aritmética dos quatro poços da amostra controle-negativo (S.

epidermidis ATCC 12228) acrescida de três vezes o valor do desvio-

padrão encontrado para essa amostra, ou seja, DOf = P/4 + (3 x DP),

onde P é a soma algébrica dos valores das DOs nos 4 poços do

controle-negativo e DP é o desvio-padrão observado nesses 4 poços.

A tabela 8 mostra as quatro classificações possíveis.

Tabela 8 – Critérios e classificações utilizados na análise da produção de


biofilme nas amostras de Staphylococcus aureus.

Critérios Classificações

N < DOf Amostras não produtoras de biofilme

DOf < N ≤ 2DOf Amostras fracas produtoras de biofilme

2DOf < N < 4DOf Amostras moderadamente produtoras de biofilme

N > 4DOf Amostras fortes produtoras de biofilme

N= média aritmética dos quatro poços da amostra testada; DOf – média aritmética
dos quatro poços da amostra controle-negativo (S. epidermidis ATCC 12228)
acrescida de três vezes o valor do desvio-padrão encontrado para essa amostra.

3.13 – Análise estatística

Neste estudo foi utilizado o teste do Qui-quadrado para analisar se

houve diferença quanto a produção de biofilme, resistência aos

antimicrobianos e presença dos genes de virulência entre as amostras

isoladas de próteses e de outras infecções. Foi estabelecida significância

em valores de 5% (p<0,05).
55

4 - RESULTADOS
56

Os resultados obtidos no presente estudo foram divididos em duas

partes, sendo uma envolvendo a justificativa 1, referente a estudos

realizados em amostras MRSA não multirresistentes (nMRSA) isoladas de

infecções no HUCFF, e a outra relacionada com a justificativa 2, referente

a estudos realizados em amostras de S. aureus isoladas de infecções

associadas e não associadas a próteses, ocorridas no INTO.

Estudo I – Resultados do estudo envolvendo 20 amostras de nMRSA

isoladas no HUCFF.

4.1 – Amostras de nMRSA e aspectos relacionados aos pacientes do

HUCFF.

Nesse estudo foram avaliadas 20 amostras de MRSA, que foram

detectadas como sensíveis a pelo menos seis classes diferentes de

antimicrobianos pelo laboratório do HUCFF, tendo sido denominadas

nMRSA. Esse tipo de amostra começou a emergir no HUCFF, no início de

2005, e surpreendeu a equipe de CCIH e os profissionais do laboratório de

bacteriologia devido a grande sensibilidade frente aos antimicrobianos,

mesmo sendo resistentes a oxacilina. Esse tipo de perfil fenotípico era

diferente daquele encontrado nas amostras MRSA isoladas até então na

instituição. No período de 01/2005 a 03/2006, 30 amostras de nMRSA

foram isoladas de 27 pacientes no HUCFF. Desse total, 20 amostras de 17

pacientes foram recuperadas e analisadas.


57

As características relacionadas aos 17 pacientes de onde foram

isoladas as 20 amostras de nMRSA estão apresentadas na tabela 9.

A idade média dos pacientes, sendo 10 do sexo masculino e 7 do

sexo feminino, foi de 46 anos (variando de 15 a 79 anos). Em relação aos

tipos de infecção (hospitalar ou comunitária), quatro foram caracterizadas

como comunitárias e 16 como hospitalares. Dos quatro pacientes que

apresentaram infecções comunitárias (pacientes 4, 11, 16 e 17), três não

tinham quaisquer fatores de risco para aquisição de MRSA e um fazia uso

de antimicrobianos (paciente 17). Um desses pacientes era de origem

americana, que se encontrava no Brasil a turismo. Esse paciente (número

4) apresentou infecção cutânea e foi encaminhado ao HUCFF. As

principais infecções apresentadas pelos pacientes foram: bacteriemia (6

pacientes) e infecções cutâneas e de tecidos moles (4 pacientes, sendo em

três casos infecções causadas por CA-MRSA). Os principais fatores de

risco para aquisição de MRSA foram: uso de antimicrobianos, prévia

hospitalização e realização de procedimentos invasivos. Hipertensão

arterial e diabetes foram as principais comorbidades encontradas nos

pacientes analisados.

Dos 17 pacientes que apresentaram infecções por MRSA, oito (47%)

evoluíram para óbito, sendo que seis apresentaram bacteriemia e um

paciente apresentou pneumonia.


58

Tabela 9- Características gerais dos 17 pacientes que apresentaram infecções por


Staphylococcus aureus resistentes à meticilina não multirresistentes isoladas no Hospital
Universitário Clementino Fraga Filho.

Nº do Local Idade Fatores de Comorbidade 4 Origem do Tipo de Espécime Data de Evolução


paciente (andar)1 /sexo2 risco3 MRSA5 infecção6 clinico7 isolamento

1 9º 56/M proc. invasivo. hip. arterial HA bacteriemia sangue 02/2005 óbito


uso atb bacteremia sangue 04/2005
hemodiálise IPTM sec. ferida 04/2005
hosp. prev..
2 5º 55/M uso atb. OE HA bacteriemia sangue 04/2005 óbito
LH
3 10º 59/F proc. invasivo - HA bacteremia sangue 05/2005 alta
nut. Parenteral
4 5º 26/F - - CA IPTM sec. ferida 06/2005 alta

5 9º 51/F proc. invasivo. cancer retal HA pneumonia secreção 07/2005 óbito


uso atb quimioterapia traqueal
radioterapia
6 8º 42/F proc. invasivo. hip. arterial HA mediastinite sec. ferida 07/2005 óbito
uso atb cardiopatia sangue
diabetes 09/2005

7 7º 53/F proc. invasivo. hip. arterial HA bacteriemia sangue 08/2005 óbito


uso atb hepatite C
hosp. prev. DR
8 9º 37/F proc. invasivo. - HA bacteriemia sangue 10/2005 óbito
uso atb relacionada
hosp. prev. a cateter
9 9º 26/M proc. invasivo. - HA empiema líquido 11/2005 alta
uso atb pleural pleural
10 8º 51/M uso atb insuficiência HA ITU urina 01/2006 alta
hemodiálise vascular
11 5º 15/M - - CA IPTM sec. ferida 01/2006 alta
12 5º 62/M proc. invasivo hip. arterial HA bacteriemia sangue 01/2006 óbito
prev. Hosp diabetes
13 13º 53/M proc. invasivo. hip. arterial HA pneumonia secreção 01/2006 alta
uso atb DPOC traqueal
hosp. prev. diabetes
14 9º 51/M uso atb hiperplasia HA artrite sec. ferida. 01/2006 alta
hosp. prev. trombose séptica
15 7º 45/F Hemodiálise DR HA bacteriemia sangue 01/2006 óbito
diabetes
16 10º 79/M - diabetes CA otite sec. 03/2006 alta
auricular
17 5º 24/M uso atb HTLV CA IPTM sec. ferida 03/2006 alta
linfoma
cutâneo

1 – 5º andar – Dermatologia e Doenças infecciosas e Parasitárias (DIP); 7º andar – Nefrologia e Hemodiálise; 8º – Cirurgia Cardíaca e
Vascular; 9º andar – Medicina Interna; 10º andar - Centro Cirúrgico; 13º - Unidade de Terapia Intensiva (UTI); 2 – M= masculino; F =
feminino; 3 – proc. invasivo – procedimento invasivo; hosp prev.. – hospitalização prévia; uso atb – uso de antibiótico, 4 - hip. arterial
– hipertensão arterial; OE – otite externa, DR – doença renal; LH – linfoma de Hodkin; HTLV – infecção por vírus humano T linfotrópico;
DPOC - doença pulmonar obstrutiva crônica,; 5 – MRSA – Staphylococcus aureus resistente à meticilina, HA – hospitalar; CA –
comunitária; 6 - IPTM – infecção de pele e tecidos moles; ITU – infecção de trato urinário; 7 – sec. – secreção
59

4.2 – Testes de susceptibilidade, determinação dos tipos de SCCmec e

detecção do gene da PVL nas amostras nMRSA isoladas do HUCFF.

O perfil de resistência aos 15 antimicrobianos testados, os

resultados das concentrações mínimas inibitórias (CMIs) para oxacilina e

vancomicina, bem como a determinação dos tipos de SCCmec e da

presença dos genes da PVL estão apresentados na tabela 10.

Das 20 amostras analisadas, 12 (60%) foram resistentes à

eritromicina, 8 (40%) à ciprofloxacina, 6 (30%) ao cloranfenicol, 6 (30%) à

clindamicina, duas (10%) à gentamicina, uma (5%) a rifampicina e uma

outra a mupirocina. Todas as amostras foram sensíveis a vancomicina,

teicoplanina, linezolida, sulfametoxazol/trimetoprima e tetraciclina.

Em relação às CMIs de oxacilina, 18 (90%) amostras apresentaram

valores <32µg/mL, sendo que duas apresentaram CMI de 4µg/mL. Apenas

duas amostras apresentaram CMIs elevadas para oxacilina (128µg/mL).

Em relação a vancomicina, as CMIs variaram entre 1 e 2µg/mL, sendo que

16 (80%) amostras apresentaram CMI de 2µg/mL, como apresentado na

tabela 10.

No teste de triagem com oxacilina, somente as duas amostras com

CMIs de 4µg/mL apresentaram crescimento não confluente no meio.

Todas as amostras de nMRSA avaliadas não foram capazes de crescer no

ágar com 4µg/mL de vancomicina.

Em relação ao tipo de SCCmec, das 20 amostras analisadas, 19

apresentaram o tipo IV e apenas uma apresentou o tipo II (tabela 10).


60

A presença dos genes da PVL foi observada em três amostras, sendo

duas relacionadas a infecções comunitárias (amostras 526 e 601) e uma

relacionada a infecção hospitalar (551) (tabela 10).

4.3 – Caracterização molecular das amostras de nMRSA isoladas no

HUCFF.

A caracterização genotípica por análise da fragmentação do DNA

cromossômico (PFGE) revelou a presença de 14 pulsotipos em 9 genótipos

distintos (A até I), demonstrando uma grande variedade clonal entre as 20

amostras. Os pulsotipos prevalentes foram o A (5 amostras) e o D (3

amostras), como demonstrado na tabela 10 e figuras 2A e 2B. Em relação

ao MLFRT, todas as amostras foram agrupadas em 6 RFTs distintos. A

associação entre as técnicas de MLFRT e PFGE demonstrou que o RFT

AAAAAAA englobou todas as amostras do genótipo A, o RFT AAACCAC

agrupou as amostras do genótipo B, o RFT BBBBBAB as amostras do

genótipo C e o RFT AAACCAA incluiu quatro diferentes genótipos, D, E, F

e G. Os RFTs únicos CAAAABC e CAAACAC englobaram os genótipos H e

I, respectivamente.

Para a realização da técnica de MLST foram selecionadas 7 amostras

representativas, uma de cada RFT, sendo que para o RFT AAACCAA foram

analisadas duas amostras: uma que apresentou o SCCmecII e outra o

SCCmecIV. A análise por MLST demonstrou os seguintes resultados: a

amostra 633 (genótipo A e RFT AAAAAAA) apresentou o ST 1 (Complexo

Clonal 1 – CC 1); a amostra 517 (genótipo B e RFT AAACCAC) apresentou

o ST 72 (CC 8); a amostra 601 (genótipo C e RFT BBBBBAB) apresentou


61

perfil alélico 2-2-161-2-3-6-2, demonstrando a alteração de um

nucleotídeo na seqüência do gene gmk e foi incluída em um novo ST 1203,

que é um variante de um lócus (SLV) do ST 30, porém, a amostra foi

classificada em um complexo clonal único. As amostras 664 (SCCmecIV) e

603 (SCCmecII) apresentaram o mesmo RFT AAACCAA, porém, na

primeira foi observado o ST 5, enquanto a amostra 603 apresentou o perfil

alélico 1-4-1-4-144-1-10 (com alteração na seqüência nucleotídica no gene

pta), um SLV do ST 5, e foi classificada em um novo ST, o ST 1204 (CC 5).

A amostra 563 (genótipo H e RFT CAAAABC) foi classificada como ST 97

(CC 97), enquanto a amostra 526 (genótipo I e RFT CAAACAC) apresentou

o ST 8 (CC 8).
62

Tabela 10 – Características gerais das 20 amostras de MRSA não multirresistentes isoladas no Hospital Universitário
Clementino Fraga Filho
Nº da amostra Nº do paciente/ Perfil de resistência CMI (µg/mL) 3 Tipo de genes da Pulsotipo Clonalidade RFT 4 ST 5 CC 6
origem do além dos ß-lactâmicos 2 OXA VAN SCCmec PVL
MRSA 1
527 5 / HA CIP – CLI – CLO – ERI – GEN 16 2 IV - A1 USA400 AAAAAAA
530 3 / HA CIP – CLI – CLO – ERI – GEN 32 2 IV - A1 AAAAAAA
548 7 / HA CIP – CLI – CLO – ERI 32 2 IV - A1 AAAAAAA
608 10 / HA CIP – CLI – ERI 8 2 IV - A1 AAAAAAA
633 16 / CA CIP – CLI – CLO – ERI 128 1 IV - A2 AAAAAAA 1 1

517, 518, 519 1 / HA - 8 2 IV - B CA-MRSA AAACCAC 72 8

551 8 / HA - 4 2 IV + C1 CA-MRSA BBBBBAB


601 11 / CA - 4 1 IV + C2 BBBBBAB 1203 Único

646 12 / HA CLO 8 1 IV - D1 AAACCAA


664 17 / CA CIP – ERI –MUP 8 2 IV - D2 AAACCAA 5 5
598 15 / HA ERI 8 2 IV - D3 AAACCAA
603 13 / HA CIP – CLI – CLO – ERI 32 2 II - E1 AAACCAA 1204 5
604 14 / HA - 8 1 IV - E2 USA800 AAACCAA
528, 529 6 / HA ERI 32 2 IV - F AAACCAA
520 2 / HA CIP – ERI 8 2 IV - G AAACCAA

563 9 / HA RIF 128 2 IV - H relacionados a CAAAABC 97 97


MSSA
526 4 / CA ERI 16 2 IV + I USA300 CAAACAC 8 8

1 – MRSA – Staphylococcus aureus resistentes à meticilina, HA – hospitalar, CA – comunitária; 2 - CIP – ciprofloxacina; CLI – clindamicina; CLO – cloranfenicol; ERI –
eritromicina; GEN – gentamicina; MUP – mupirocina; RIF - rifampicina; 3 – concentração minima inibitória de oxacilina (OXA) e vancomicina (VAN); 4 - RFT restriction fragment
type obtido por MLFRT, ordem dos genes – arcC-aroE- glpF-gmk-pta-tpi-yqiL; 5–sequence type obtidos por MLST; 6 – CC – complexo clonal; - indica ausência; + indica presença.
63
a) Pulsotipo
.
Nº da amostra
kb

339,5

242,5
194
145,5

97

48,5

b)

A1
A1
A1
A1
A2
H
D1
D2
D3
I
C1
C2
B
B
B
E1
E2
F
F
G
Nº da Pulsotipo
amostra

Figura 2. A – Genótipos obtidos pela fragmentação do DNA cromossômico com a


enzima SmaI das 20 amostras de MRSA não multirresistentes analisadas nesse
estudo. B – Dendograma obtido por análise computadorizada dos genótipos
encontrados.
64

Estudo II – Resultados do estudo envolvendo 73 amostras de S. aureus

isoladas continuamente, no período de 08/2005 a 09/2007, de infecções

associadas e não associadas a próteses articulares.

4.4 – Amostras de S. aureus isoladas no INTO

Foram analisadas 73 amostras de S. aureus, sensíveis e resistentes à

oxacilina, sendo 32 isoladas de infecções associadas a próteses articulares

(IAP) de joelho e quadril e 41 de infecções não associadas a próteses (INAP).

As amostras isoladas de INAP foram obtidas a partir de infecção de sítio

cirúrgico (21 amostras), bacteriemia (10), osteomielite (7), infecção urinária

(2) e pneumonia (1). Apenas uma amostra de cada paciente foi analisada no

presente estudo.

4.5 – Resultados da susceptibilidade antimicrobiana nas amostras de S.

aureus isoladas de IAP e INAP no INTO

O percentual de resistência aos antimicrobianos nas 73 amostras de S.

aureus isoladas de IAP (32) e INAP (41) está apresentado na figura 3. Em

relação a oxacilina, 13 (40,6%) amostras de IAP e 15 (36,6%) de INAP foram

resistentes a esse antimicrobiano. Em relação aos outros antimicrobianos o

número de amostras resistentes isoladas de IAP e INAP foram os seguintes,

respectivamente: sulfametoxazol/trimetoprima, 6 (18,7%) e 8 (19,5%);

rifampicina, 3 (9,4%) e 8 (19,5%); cloranfenicol, 7 (21,9%) e 9 (21,9%);

gentamicina, 8 (25%) e 11 (26,8%); ciprofloxacina, 12 (37,5) e 11 (26,8%);

clindamicina, 13 (40,6%) e 12 (29,3%); tetraciclina, 9 (28,1%) e 12 (29,3%) e


65

eritromicina, 21 (65,6%) e 19 (46,3%). Todas as amostras de INAP foram

resistentes à penicilina, enquanto 28 (87,5%) amostras de IAP também

foram resistentes a essa droga. Todas as 73 amostras foram sensíveis à

vancomicina, teicoplanina e linezolida. Apenas duas (4,9%) amostras foram

resistentes à mupirocina, e ambas eram sensíveis à oxacilina e isoladas de

INAP. Para todos os antimicrobianos não houve diferença estatisticamente

significativa no perfil de resistência antimicrobiana observado entre as

amostras isoladas de IAP e INAP (p>0,05).

Não foi observada a indução de resistência à clindamicina por

macrolídeos entre as 73 amostras analisadas.

100
90

80
70
% de resistência

60

50

40 Amostras de IAP

30 Amostras de INAP

20

10

0
VAN TEIC LIN M UP SUT RIF CLO GEN CIP CLI TET OXA CEF ERI PEN
Antimicrobianos
Figura 3 – Perfil de resistência das amostras de S. aureus isoladas de infecções
associadas (IAP) e não associadas a próteses (INAP). VAN – vancomicina; TEIC –
teicoplanina; LIN – linezolida; MUP – mupirocina; SUT –
sulfametoxazol/trimetoprima; RIF – rifampicina; CLO – cloranfenicol; GEN –
gentamicina; CIP – ciprofloxacina; CLI – clindamicina; TET – tetraciclina; OXA –
oxacilina; CEF – cefoxitina; ERI – eritromicina; PEN – penicilina. Não houve
diferença estatisticamente significativa, pelo teste qui-quadrado (p>0,05), na
resistência aos antimicrobianos testados, entre as amostras isoladas de IAP e INAP.
66

4.6 – Determinação dos tipos de SCCmec nas amostras de MRSA

isoladas de IAP e INAP no INTO

A tipagem do SCCmec foi realizada nas 28 amostras que foram

resistentes à oxacilina, através do teste de difusão a partir do disco, sendo 13

amostras isoladas de IAP e 15 de INAP.

Nas 45 amostras que se apresentaram sensíveis à oxacilina no teste de

difusão a partir do disco foi realizada a confirmação da sensibilidade, através

da PCR, utilizando-se os oligonucleotídeos MRS1 e MRS2, utilizados para a

detecção do gene mecA. Esse gene não foi encontrado em nenhuma das 45

amostras sensíveis analisadas.

Entre as 28 amostras MRSA, 16 (57,1%) apresentaram o SCCmecIV

enquanto 12 (42,9%) apresentaram o SCCmecIII. Quando avaliadas em

relação ao tipo de infecção, verificamos que entre as 13 amostras isoladas de

IAP, 8 (61,5%) apresentaram o SCCmec tipo IV, enquanto 5 (38,5%)

apresentaram o tipo III. Nas 15 amostras isoladas de INAP, 8 (53,3%)

apresentaram o SCCmec tipo IV e 7 (46,7%) o tipo III (tabela 11; figura 4).

Tabela 11 – Tipos de SCCmec detectados nas amostras


MRSA isoladas de infecções associadas e não associadas
à próteses no INTO.

Nº ( % de amostras)
Tipos de SCCmec
(Nº/% de amostras) Amostras isoladas Amostras isoladas
de IAP de INAP
III (12/42,9) 5 (38,5) 7 (46,6)
IV (16/57,1) 8 (61,5) 8 (53,4)

Total (28/100) 13 (100) 15 (100)

IAP – infecções associadas a próteses; INAP – infecções não associadas a


próteses. III II IV IV III III IV Tipos de SCCmec
kb
67

500pb

300pb

100pb

1 2 3 4 5 6 7 8 9
Figura 4 - Eletroforese em gel de agarose dos tipos de
SCCmec detectados por PCR-multiplex em amostras
MRSA. Linha 1 - padrão de tamanho de DNA (100pb
ladder); Linhas 2 a 4 – amostras de S. aureus 63a, Mu50 e
522, controles dos tipos III, II e IV de SCCmec,
respectivamente; Linhas 5 e 8 – amostras clínicas com
SCCmec IV; linhas 6 e 7 - amostras clínicas com
SCCmecIII; linha 9 - S. aureus ATCC 29213 - controle
sensível à oxacilina.

4.7 – Associação entre a resistência antimicrobiana e os tipos de

SCCmec em 28 amostras MRSA isoladas no INTO.

Os perfis de susceptibilidade antimicrobiana, entre os grupos de

amostras MRSA com os tipos III e IV de SCCmec, foram comparados com o

objetivo de verificar se havia diferença no padrão de resistência entre eles, já

que a prevalência de amostras com esses dois tipos de cassetes foi

semelhante nas amostras de próteses e de outras infecções. Esta associação

está apresentada na figura 5.

Todas as amostras de ambos os grupos foram sensíveis à vancomicina,

teicoplanina, mupirocina e linezolida. As amostras com SCCmecIII também

foram resistentes à tetraciclina, sulfametoxazol/trimetoprima, gentamicina,

ciprofloxacina, clindamicina e eritromicina. Além disso, 9 (75%) amostras

foram resistentes à rifampicina e 7 (58,3%) ao cloranfenicol. Em relação às


68

amostras com SCCmecIV, todas foram sensíveis à tetraciclina,

sulfametoxazol/trimetoprima e rifampicina. Em relação aos outros

antimicrobianos foi observado que 6 (37,5%) amostras foram resistentes à

gentamicina, 6 (37,5%) ao cloranfenicol, 9 (56,2%) à ciprofloxacina, 9 (56,2%)

à clindamicina e 11 (68,7%) à eritromicina. Exceto para o cloranfenicol,

houve diferença significativa na taxa de resistência encontrada para todos os

antimicrobianos avaliados, quando os dois grupos de MRSA, com SCCmecIII

e IV, foram comparados.

100 * * * * * *
90
80 *
% de resistência

70
60
50
40
30
20
10
0
VAN TEIC LIN MUP TET SUT RIF GEN CIP CLI ERI CLO
Antimicrobianos

Amostras com SCCmecIII


Amostras SCCmecIII Amostras
Amostras com SCCmecIV
SCCmecIV
g g

Figura 5 – Associação entre resistência antimicrobiana e os tipos de SCCmec


detectados nas amostras de MRSA isoladas no INTO; * - diferença
significativa pelo teste qui-quadrado (p<0,05) na resistência a esses
antimicrobianos entre os dois grupos.
69

4.8 - Concentrações mínimas inibitórias (CMIs) de oxacilina e

vancomicina e associação com os tipos de SCCmec nas 28 amostras de

MRSA isoladas de IAP e INAP no INTO.

Como um dos principais problemas para os laboratórios clínicos na

detecção de amostras de MRSA é a existência de CMIs de oxacilina muito

próximas ao “ponto de corte”, realizamos a determinação das mesmas nas 28

amostras MRSA, com interesse principal nas amostras com SCCmecIV, que,

geralmente, são aquelas que apresentam essa característica. Outro

importante fator que também foi analisado refere-se à CMI de vancomicina,

uma vez que, vem sendo relatado o aumento de seus valores em muitos

hospitais, comprometendo a resposta clínica do paciente nas infecções por

MRSA.

As CMIs de oxacilina e vancomicina foram determinadas para as 12

amostras de MRSA, com SCCmecIII (5 de IAP e 7 de INAP) e para as 16

amostras com SCCmecIV (8 de IAP e 8 de INAP). Em relação à oxacilina todas

as amostras com SCCmecIII apresentaram CMIs >256µg/mL enquanto que

as amostras com SCCmecIV mostraram CMIs variando de 8 a 256µg/mL,

como apresentado na tabela 12. É importante destacar que, apesar do

número reduzido de amostras, entre aquelas com SCCmecIV, 5 (62,5%)

amostras isoladas de INAP apresentaram CMIs <32µg/mL, enquanto entre

aquelas amostras isoladas de IAP, 7 (87,5%) delas tiveram CMIs >64µg/mL.

Em relação à vancomicina, 20 amostras apresentaram CMI de 1µg/mL

(9 amostras com SCCmecIII e 11 com SCCmecIV), 4 amostras apresentaram

CMI de 2µg/mL (2 amostras SCCmecIII e 2 com SCCmecIV) e 4 apresentaram


70

CMI <0,5µg/mL (1 amostra com SCCmecIII e 3 com SCCmecIV). Não houve

diferença significativa em relação a resistência à vancomicina entre as

amostras com SCCmec tipo III e IV (p>0,05).

Tabela 12 – Associação entre os tipos de SCCmec e concentrações mínimas


inibitórias de oxacilina e vancomicina nas 28 amostras de MRSA associadas e
não associadas a próteses.

SCCmec / Tipo de infecção CMI de oxacilina CMI de vancomicina


Nº de (Nº de amostras) (µg/mL) (µg/mL)
amostras
4 8 16 32 64 128 256 >256 >0,5 1 2 4 8 16
Tipo III (12) IAP (5) - - - - - - - 5 1 4 - - - -
INAP (7) - - - - - - - 7
- 5 2 - - -

Tipo IV (16) IAP (8) - - 1 - 3 2 2 - 3 4 1 - - -


INAP (8) - 1 - 4 1 2 - - - 7 1 - - -

IAP – infecções associadas a próteses; INAP - infecções não associadas a próteses; CMI –
concentração mínima inibitória.

4.9 – Presença de genes de virulência e análise da produção de biofilme

nas 73 amostras de S. aureus isoladas de IAP e INAP no INTO

A presença de genes de virulência e a formação de biofilme foram

comparadas entre as amostras isoladas de IAP e INAP. Todas as 73 amostras,

independente da origem, apresentaram o gene icaA. Em relação às amostras

isoladas de IAP, 31 (96,9%) apresentaram o gene fnbA, 24 (75%) o gene ebpS,

21 (65,6%) o gene cna, 5 (15,6%) o gene fnbB, 1 (3,1%) o gene bbp e 1 (3,1%)

o gene da PVL. Nas amostras isoladas de INAP, 33 (80,5%) apresentaram o

gene fnbA, 29 (70,7%) o gene ebpS, 28(68,3%) o gene cna, 7 (17,1%) o gene

fnbB, 6 (14,6%) o gene bbp e 6 (14,6%) o gene da PVL. Não houve diferença
71

estatisticamente significativa, em relação à presença dos genes de virulência,

entre os dois tipos de infecções (IAP e INAP). Os resultados da detecção dos

genes de virulência estão apresentados nas figuras 6 e 7

0
10
0
0

,9
10
10

96
100 ,7
,5 87
80
90
,6

,7
80 75 72 ,1
70

,3
67

68
,6
% de amostras

70

65
60
50
40
30 ,4
16

17 6
,1

,6
,

,6
15

14
20 6 6

14
9, 9,

1
1
10

3,
3,
0
icaA fnbA ebpS cna fnbB bbp pvl
genes de virulência

Amostras de IAP (n=32) Amostras de INAP (n=41) total (n=73)


Figura 6 – Percentual de positividade para diferentes genes de virulência nas 73
amostras de S. aureus isoladas de infecções associadas (IAP) e não associadas a
próteses (INAP) no INTO. Não houve diferença estatisticamente significativa, pelo
teste qui-qudrado (p>0,05), em relação à presença dos genes de virulência entre as
amostras isoladas de IAP e INAP.
72

fnbA fnbB bbp ebpS PVL cna icaA Genes de virulência

kb
1kb
600pb

300pb

100pb

1 2 3 4 5 6 7 8
Figura 7 – Eletroforese em gel de agarose dos genes de virulência pesquisados neste
estudo. Linha 1 - padrão de tamanho de DNA (100pb ladder); Linhas 2 a 8 –
Diferentes amostras clínicas de S. aureus que apresentaram os genes fnbA (1362
pb), fnbB (524 pb), bbp (575 pb) ebpS (186), da PVL (433 pb), cna (423 pb) e icaA
(188pb).

Em relação à produção de biofilme, utilizando a metodologia descrita

por Stepanovic e colaboradores (2000), os seguintes valores aproximados de

DO foram considerados para classificação das amostras: valor de DO menor

ou igual a 0,6, para amostras não produtoras de biofilme; DO entre 0,6 e

<1,2, para amostras fracas produtoras; DO entre 1,2 e <2,4, para moderadas

produtoras e acima de 2,4 para amostras fortes produtoras de biofilme.

Entre as 32 amostras isoladas de IAP, 31 (96,9%) produziram biofilme,

sendo 5 fortes, 23 moderadas e 3 fracas produtoras. Nas 41 amostras

isoladas de INAP, 39 (95,1%) produziram biofilme, sendo 3 fortes, 30

moderadas e 6 fracas produtoras. O resultado geral da produção de biofilme


73

nas 73 amostras de IAP e INAP, isoladas do INTO, está demonstrado na

figura 8.

11% 4,1%
12,3%

72,6%
Total de amostras (N=73)

3,1% 4,9%
15,6% 9,4% 7,3%
14,6%

71,9% 73,2%

Amostras de IAP (N=32) Amostras de INAP (N=41)

Não produtoras produção fraca produção moderada produção forte

Figura 8. Avaliação da capacidade de produção de biofilme nas 73 amostras


de S. aureus isoladas de infecções associadas (IAP) e não associadas a
próteses (INAP) no INTO.
74

4.10 – Caracterização molecular das 73 amostras de S. aureus isoladas

de IAP e INAP no INTO.

Com o objetivo de determinar a diversidade genotípica das amostras de

S. aureus causadoras de IAP e de INAP, no INTO, e verificar se havia

prevalência e/ou diferença de genótipos nesses dois grupos, foram realizados

os testes de PFGE e MLST.

A caracterização genotípica através da análise da fragmentação do DNA

cromossômico (PFGE) revelou 15 genótipos distintos (A´ a P´) entre as

amostras de MRSA e MSSA avaliadas. Nas tabelas 13 e 14 estão descritas as

características gerais das amostras, incluindo os genótipos encontrados.

Apenas 5 genótipos (A´ a E´) englobaram 61 (83,5%) das 73 amostras de S.

aureus isoladas.

A tabela 13 mostra as características gerais das 28 amostras MRSA

isoladas de IAP e INAP. Todas as 12 amostras MRSA, com SCCmecIII,

isoladas nesse estudo estão representadas pelo genótipo A´ (figura 9) e foram

geneticamente relacionadas ao clone multirresistente, prevalente no Brasil.

As 12 amostras desse genótipo foram incluídas em 11 pulsotipos distintos,

demonstrando que apesar de serem relacionados, não existiu a disseminação

de um pulsotipo específico no hospital. A amostra desse grupo (número 530)

selecionada para análise por MLST apresentou o ST 239, similar ao descrito

para o clone brasileiro multirresistente.

O genótipo B´ foi prevalente nas amostras de infecções no INTO e

apresentou 14 pulsotipos distintos (B´1 a B´14). Esse genótipo (figura 10) foi

encontrado em 20 (27,4%) amostras, sendo seis MRSA que apresentaram o


75

SCCmecIV (tabela 13), e 14 amostras de MSSA (tabela 14). Entre as amostras

resistentes foram observados cinco pulsotipos, sendo dois em amostras

isoladas de IAP (pulsotipos B´3 e B´4) e quatro de INAP (pulsotipos B´3, B´10,

B´13 e B´14). Um mesmo pulsotipo (B´3) foi observado nos dois tipos de

amostras, isoladas de IAP e INAP. As amostras selecionadas para realização

do MLST foram: 4948 (MRSA SCCmecIV; pulsotipo B´3) e 2807 (MSSA;

pulsotipo B´6), ambas isoladas de IAP, e as amostras 2638 (MRSA SCCmecIV;

pulsotipo B´10), 2520 (MRSA SCCmecIV; pulsotipo B´13), e 3210 (MSSA;

pulsotipo B´1), que foram isoladas de INAP. Essas amostras foram escolhidas

como representativas do genótipo B´ e pela diferença na susceptibilidade à

oxacilina. Todas apresentaram perfil alélico 1-4-1-4-12-1-10 e foram

alocadas no ST 5 (CC 5).

Dentro do genótipo C´ (figura 11) foram incluídas 17 amostras (23,3%),

distribuídas em nove pulsotipos distintos (C´1 a C´9). Entre elas, nove eram

de MRSA com SCCmecIV, sendo seis isoladas de IAP e três de INAP, e foram

incluídas em cinco pulsotipos. As amostras do pulsotipo C´1 foram isoladas

de IAP (três amostras) e INAP (uma amostra). Entre as oito amostras de

MSSA, quatro foram isoladas de IAP e outras quatro de INAP, e foram

incluídas em cinco pulsotipos. Assim como, entre as amostras de MRSA,

também foi observado, entre as de MSSA pulsotipos iguais em amostras de

IAP (pulsotipo C´4 - duas amostras) e de INAP (pulsotipo C´3 – duas

amostras), além do pulsotipo C´5, que foi encontrado nos dois grupos de

infecção. As amostras do genótipo C´ selecionadas para realização do MLST

foram: 3216 (MRSA SCCmecIV; pulsotipo C´1), 5398 (MSSA; pulsotipo C´4 e)
76

e 2879 (MRSA SCC mecIV; pulsotipo C´7), que foram isoladas de IAP e a

amostra 5917 (MRSA SCCmecIV; pulsotipo C´2), que foi isolada de INAP.

Todas as amostras foram incluídas no ST 1 (perfil alélico 1-1-1-1-1-1-1),

integrando o CC 1.

Em conjunto, os genótipos B´ e C´ foram responsáveis por 59,4% das

amostras de IAP e 44% das INAP .

Oito amostras foram incluídas no genótipo D´, sendo três isoladas de

IAP e cinco de INAP, e foram incluídas em seis pulsotipos. Todas as amostras

desse genótipo foram sensíveis à oxacilina e quatro amostras (3210-C, 3474,

4511 e 4855) de dois pulsotipos (D´1 e D´4), apresentaram os genes da PVL.

Três amostras isoladas de INAP apresentaram o mesmo pulsotipo D´1. Foi

realizado o MLST em duas amostras, 4511 (pulsotipo D´1) e 3210-C

(pulsotipo D´4), que representaram os dois pulsotipos de amostras positivas

para os genes da PVL. Nas duas amostras foi observado o perfil alélico 3-1-1-

4-1-1-1, o qual não apresentou correspondência com nenhum outro descrito

no banco de dados. A similaridade encontrada foi com o ST 188, cujo perfil

alélico é 3-1-1-8-1-1-1-1, sendo, então, um variante em um lócus (gene gmk)

do ST 188 (SLV 188).

O genótipo E´ englobou quatro amostras e todas elas eram de amostras

isoladas de INAP. Dessas quatro amostras, três eram MSSA e uma MRSA

com SCCmecIV. Das quatro amostras, três apresentaram os genes da PVL,

sendo duas amostras de MSSA (amostra 3651, pulsotipo E´1 e amostra 324,

pulsotipo E´2) e uma MRSA (amostra 1970, pulsotipo E´3). Foi realizado o
77

MLST dessas três amostras e todas apresentaram perfil alélico 2-2-2-2-6-3-2,

sendo representantes do ST 30 (CC 30).

Na figura 12 estão apresentados os pulsotipos de todas as sete

amostras que apresentaram os genes da PVL. Dessas sete amostras, quatro

apresentaram o genótipo D´ e três o genótipo E´.

Todos as outras 12 amostras apresentaram 10 genótipos distintos (F´ a

P´) e todas elas eram MSSA, como mostrado nas tabelas 13 e14.
78

Tabela 13 – Características gerais das 28 amostras MRSA isoladas de infecções


associadas e não associadas a próteses no INTO.
Tipo de Nº da Data de CMI (µg/mL)2 Tipo de Pulsotipo ST3 CC4
infecção / Nº amostra isolamento OXA VAN SCCmec (PFGE)
de amostras1
IAP (13) 178 01/2006 >256 1 III A´1
530 02/2006 >256 0,5 III A´2 239 8
590 02/2006 >256 1 III A´3
499 02/2006 >256 1 III A´4
6452 12/2006 >256 1 III A´5

4948 12/2005 128 2 IV B´3 5 5


6769 08/2007 16 1 IV B´4

3671 09/2005 256 0,5 IV C´6


3216 08/2005 128 0,5 IV C´1 1 1
445 01/2006 256 0,5 IV C´1
468 02/2006 64 1 IV C´8
2879 06/2006 64 1 IV C´7 1 1
510 01/2007 64 0,5 IV C´1

INAP (15) 3679-3 09/2005 >256 1 III A´7


3478 09/2005 >256 1 III A´11
4144 10/2005 >256 2 III A´6
4122 10/2005 >256 2 III A´8
5238 12/2005 >256 1 III A´10
1140 03/2006 >256 1 III A´7
3200 07/2006 >256 1 III A´9

2520 05/2006 32 1 IV B´13 5 5


2638 06/2006 32 1 IV B´10 5 5
1509 03/2007 32 1 IV B´3
3211 04/2007 32 1 IV B´14

4435 11/2005 64 2 IV C´1


5917 11/2006 128 1 IV C´2 1 1
795 02/2007 128 1 IV C´2

1970 05/2006 8 1 IV E´3 30 30

1 – IAP – infecções associadas a próteses, INAP – infecções não associadas a próteses; 2 – CMI- concentração
mínima inibitória, OXA – oxacilina, VAN – vancomicina; 3 – ST – sequence type; 4 – CC – complexo clonal
79

Tabela 14 – Características gerais das 45 amostras de S. aureus


sensíveis à oxacilina isoladas de infecções associadas e não
associadas a próteses no INTO.
Tipo de infecção / Nº da Data de Pulsotipo ST2 CC3
Nº de amostras1 amostra isolamento (PFGE)

IAP (19) 4341 10/2005 B´1


4840 12/2005 B´1
791 02/2006 B´5
2195 05/2006 B´2
2807 06/2006 B´6 5 5
710 02/2007 B´2
7856 09/2007 B´7

1183 03/2006 C´9


2733 06/2006 C´4
5398 10/2006 C´4 1 1
6562 08/2007 C´5

4233 10/2005 D´5


2405 05/2006 D´6
3210-C 04/2007 D´4 SLV 188 1

6436 08/2007 F´1

4608 11/2006 H´

3676-2 09/2005 I´

3473 07/2006 J´

4700 11/2005 L´

INAP (26) 727 02/2006 B´12


490 02/2006 B´5

1572 04/2006 B´8


3460 07/2006 B´1
3210 07/2006 B´1 5 5
4412 09/2006 B´9
1496 03/2007 B´11

4715 11/2005 C´10


3346-1 08/2005 C´3
024 01/2006 C´5
1215 03/2006 C´3
80

continuação da tabela 14.


3630 09/2005 D´2
3884 10/2005 D´3
3474 07/2006 D´1
4511 09/2006 D´1 SLV 188 1
4855 09/2006 D´1

3651 08/2006 E´1 30 30


5218 10/2006 E´4
324 01/2007 E´2 30 30

5210 10/2006 F´2

2389 05/2006 G´1


4976 10/2006 G´2

4318 10/2005 M´

4104 08/2006 N´

2032 05/2006 O´

3670-2 09/2005 P´

1 – IAP – infecções associadas a próteses, INAP – infecções não associadas a próteses; 2 –


ST – sequence type; 3 – CC – complexo clonal.
81

M M M
kb

339,5

145,5

97

48,5

Figura 9 – Pulsotipos do genótipo A´ obtidos por PFGE após


fragmentação do DNA genômico com a enzima SmaI. Amostras de MRSA
com SCCmecIII. Amostra 63a - representante do genótipo do clone
brasileiro.M – marcador molecular.
82

M M M

kb

339,5

242,2
145,5

97

48,5

Figura 10 – Pulsotipos representativos do genótipo B´, obtidos por PFGE


após fragmentação do DNA genômico com a enzima SmaI. Amostras de
MRSA com SCCmecIV: 6769, 4948, 3211, 2638 e 2520; amostras de
MSSA: 791, 7856, 2195, 2807, 3210, 3460, 490, 1572 e 4412. M –
marcador molecular.

M M M
kb

339,5

242,2
145,5

97

48,5

Figura 11 - Pulsotipos representativos do genótipo C´ obtidos por PFGE


após fragmentação do DNA genômico com enzima a SmaI. Amostras de
MRSA com SCCmecIV: 445, 3216, 510, 2879, 468, 3671, 4435, 795 e
5917; amostras de MSSA: 5398, 2733, 6562, 1215, 3346-1, 024 e
4715.M – marcador molecular.
83

M M
kb

339,5

242,2

145,5

97

48,5

Figura 12 – Pulsotipos do genótipo D´ e E´, obtidos por PFGE após


fragmentação do DNA genômico com enzima a SmaI, de amostras que
apresentaram os genes da PVL. Quatro amostras foram do genótipo D´
(3210-C, 3474, e 4855 e 4511) e três do genótipo E´ (3651, 324, 1970). A
exceção da amostra 1970 (MRSA SCCmecIV), todas foram sensíveis à
oxacilina.M – marcador molecular.
84

4.11 – Relação entre os principais perfis genotípicos encontrados e

a presença de genes de virulência

A tabela 15 mostra a associação entre os genótipos prevalentes e a

presença de genes de virulência nas 73 amostras de S. aureus isoladas de

IAP e INAP, no INTO. À exceção do genótipo D´, todos os outros genótipos e

seus pulsotipos apresentaram, no máximo, duas combinações (perfis) de

genes de virulência. As 12 amostras do genótipo A´ (SCCmecIII) apresentaram

os genes cna, fnbA, fnbB e ica e não apresentaram os genes bbp, ebpS e da

PVL. Apenas no genótipo A´ foi encontrado o gene fnbB. Em relação ao

genótipo B´, em 19 amostras que apresentaram SCCmecIV, das 20

analisadas, só foram detectados os genes fnbA, ebpS e ica, exceto a amostra

de MSSA que, além destes genes, também apresentou o gene cna. No

genótipo C´, onde se encontrou a maior parte das amostras de MRSA com

SCCmecIV, das 17 amostras, 16 apresentaram os genes cna, fnbA, ebpS e ica

e apenas uma de MSSA não apresentou o gene cna. No genótipo D´ foi

observada a maior variação de combinação dos genes. Entre as oito

amostras, seis combinações distintas de genes de virulência foram

detectadas. Quatro amostras tinham os genes da PVL. Em relação ao

genótipo E´, todas as quatro amostras apresentaram os genes cna, fnbA, bbp,

ebpS e ica e três apresentaram o gene da PVL (1970, 3651 e 324). Somente

amostras desse genótipo apresentaram o gene bbp. O perfil 3 de virulência foi

observado entre amostras dos genótipos B’, C’ e D’. Em geral, os genes ica

(100%), fnbA (87,7%), cna (72,6%) e ebpS (75,3%) estavam presentes em

grande parte das amostras.


85

Tabela 15 – Associação entre genótipos prevalentes e a presença dos genes de


virulência nas 73 amostras de Staphylococcus aureus isoladas de infecções
associadas e não associadas a próteses no INTO.

Genótipo / Perfil / Nº de Genes de virulência


STs descritos amostras
cna fnbA fnbB bbp ebpS ica pvl

A´/239 1 (12) + + + - - + -
B´/5 2 (19) - + - - + + -
3 (1)2 + + - - + + -

C´/1 3 (16) + + - - + + -
2 (1)2 - + - - + + -
D´/SLV1881 4 (3) + - - - - + +
5 (1) + - - - - + -
6 (1) + - - - + + -
3 (1) + + - - + + -
7 (1) + + - - - + +
8 (1) + + - - - + -

E´/30 9 (3) + + - + + + +
10 (1)2 + + - + + + -
1 – Todas as amostras do genótipo D’ foram de Staphylococus aureus sensíveis à meticilina
(MSSA); 2 – amostras que apresentaram perfis dos genes de virulência distintos do restante do
genótipo foram de MSSA; + indica presença; - indica ausência
86

5 - DISCUSSÃO
87

A espécie S. aureus está entre aquelas de maior prevalência em

infecções, tanto de origem hospitalar quanto comunitária. A presença de uma

grande variedade de fatores de virulência, bem como sua capacidade de

desenvolver ou adquirir mecanismos de resistência a diversas classes de

antimicrobianos, torna desafiadora e extremamente relevante a realização de

estudos que permitam a compreensão desses mecanismos.

Grande parte das amostras de S. aureus, isoladas de diversas partes do

mundo, é resistente à oxacilina (DIEKEMA et al., 2001). Em hospitais, a

multirresistência é comum entre as amostras, assim como, um limitado

número de genótipos é responsável pela maioria das infecções (SANTOS et al,

1999; OLIVEIRA et al., 2002; TIEMERSMA et al., 2004). No Brasil, um

genótipo de MRSA, com SCCmecIII e incluído no ST 239, tem sido o principal

agente de infecções hospitalares, sendo a multirresistência sua principal

característica (OLIVEIRA et al., 2001, VIVONI et al., 2006). A prevalência de

amostras de MRSA, apresentando resistência múltipla aos antimicrobianos,

tem sido demonstrada em estudos anteriores de nosso grupo, inclusive entre

amostras isoladas no HUCFF (SANTOS et al., 1996; SCHUENCK et al., 2004,

VIVONI et al., 2006). Contudo, entre fevereiro de 2005 e março de 2006, foi

observada a emergência de amostras MRSA não multirresistentes (nMRSA)

nesse hospital. Dados da CCIH revelaram que esse tipo de amostra foi

responsável por 14% das infecções por MRSA no ano de 2004, mas que esse

percentual tinha aumentado quatro vezes mais (56%) em 2005. Para

compreender melhor essa alteração na epidemiologia das infecções por

amostras MRSA, isoladas no HUCFF, avaliamos 20 amostras de nMRSA,


88

obtidas entre fevereiro de 2005 e março de 2006, através de PFGE, MLRFT e

MLST. Além disso, determinamos o tipo de SCCmec, as concentrações

mínimas inibitórias de oxacilina e vancomicina e verificamos a presença dos

genes da PVL nessas amostras de nMRSA.

Amostras MRSA de origem comunitária (CA-MRSA), geralmente,

possuem SCCmecIV, e podem apresentar heterorresistência à oxacilina.

Outra característica importante é que essas amostras possuem um tempo de

geração menor do que outras que apresentam cassetes mec maiores e, além

disso, possuem CMIs para oxacilina próximas ao “ponto de corte” (OKUMA

et al. 2002). Entre as 20 amostras analisadas em nosso estudo, 19

apresentaram SCCmecIV e, em 18 destas, as CMIs obtidas variaram de 4 a

32µg/mL, características similares às encontradas em CA-MRSA.

Quanto ao tipo de SCCmec, amostras hospitalares, geralmente,

apresentam os tipos I, II ou III, diferentes daquelas de origem comunitária,

que apresentam, normalmente, os tipos IV ou V (DIETRICH et al., 2004,

KILLIC et al., 2006, UDO et al., 2008). Esse quadro vem sendo alterado na

última década, sendo cada vez mais comum o isolamento de amostras com

SCCmecIV, no ambiente hospitalar (WANNET et al., 2005; FOSSUM &

BUKHOLM, 2006; UDO et al., 2008). Em São Paulo, Trindade e

colaboradores (2005) avaliando amostras isoladas de infecções de corrente

sanguínea, demonstraram a presença de amostras com o SCCmecIV entre

elas. Uma característica importante dessas amostras emergentes é a

presença de um tipo SCCmec de tamanho reduzido e, uma presença mais

freqüente de genes de virulência, como o da PVL. Essas características


89

poderiam conferir uma vantagem adaptativa a esses clones e ajudar a

disseminá-los (OKUMA et al., 2002).

Outro aspecto relevante, é a dificuldade de detecção da resistência à

oxacilina em algumas dessas amostras de nMRSA. Vandenesch e

colaboradores (2003) analisando 81 amostras de CA-MRSA com SCCmecIV,

observaram que as CMIs variavam de 4 a 64µg/mL, semelhante ao observado

no presente estudo. Esse fato representa um grande problema para os

laboratórios clínicos, uma vez que esses valores de CMIs se aproximam aos

de sensibilidade. Adicionalmente, o ágar triagem com 6µg/mL também pode

fornecer resultados de falsa sensibilidade. Os resultados obtidos com a

utilização de ágar com oxacilina confirmam essa dificuldade, uma vez que

duas amostras com CMI de 4µg/mL apresentaram crescimento de apenas 2 a

5 UFCs no meio, característico de heterorresistência à oxacilina, um dos

principais motivos para a detecção errônea de MRSA (VELASCO et al., 2005).

No presente estudo, a resistência à eritromicina foi freqüente entre as

amostras (12/20), seguida por ciprofloxacina (8/20), clindamicina (6/20) e

cloranfenicol (6/20). Esses fatos vem sendo observados em amostras MRSA

carreando o SCCmecIV (BARTELS et al., 2007). Em relação a vancomicina

80% das amostras apresentaram CMIs de 2µg/mL. Já foi observada a

ocorrência de falha terapêutica no tratamento de infecções de corrente

sanguínea por MRSA, em amostras com CMI aumentada (1 e 2µg/mL), em

comparação com amostras com CMIs reduzidas (<0,5) (SAKOULAS et al,

2004). Contudo, mesmo com o desenvolvimento de novas drogas como

tigeciclina e daptomicina, a vancomicina continua a ser a droga mais


90

utilizada no tratamento de infecções por amostras MRSA. Logo, a diminuição

de sua atividade pode tornar o tratamento dessas infecções ainda mais difícil.

A técnica de PFGE agrupou as 20 amostras de nMRSA isoladas no

HUCFF, em 9 pulsotipos diferentes (A até I), demonstrando uma ampla

variedade clonal entre elas. Essa diversidade de perfis genotípicos entre

amostras com SCCmecIV foi também descrita por vários outros autores

(DIETRICH et al., 2004; NIMMO et al., 2006; BARTELS et al., 2007). Dados

similares aos nossos foram encontrados por Bartels e colaboradores (2007),

que também observaram uma emergência de amostras nMRSA, com

SCCmecIV e geneticamente distintas, entre 2003 e 2004, em um hospital na

Dinamarca. De acordo com Robinson e Enright (2003) esta elevada

diversidade pode ser devido não apenas a disseminação de determinados

genótipos, mas também a transmissão do SCCmecIV para amostras de MSSA

apresentando diferentes genótipos. Trindade e colaboradores (2005)

observaram a emergência de amostras nMRSA SCCmecIV, em infecções de

corrente sanguínea, em um hospital em São Paulo, porém, os autores

verificaram a prevalência de um genótipo causando estas infecções.

No presente estudo, cinco das 20 amostras nMRSA avaliadas

apresentaram o genótipo A, considerado prevalente no estudo. Essas

amostras foram isoladas de cinco pacientes e apresentaram resistência a um

maior número de drogas, entre todas as outras amostras avaliadas. Todas

foram resistentes à eritromicina, clindamicina e ciprofloxacina. A prevalência

desse genótipo no hospital pode ter favorecido a aquisição de outros genes de

resistência. Todas as amostras do genótipo A apresentaram o RFT AAAAAAA,


91

e uma dessas amostras (633) foi selecionada e analisada por MLST, sendo

incluída no ST 1 (CC 1). Esse ST é similar ao do genótipo denominado WA-1,

que foi inicialmente descrito em amostras de CA-MRSA na Austrália (UDO et

al., 1993). A similaridade também foi observada em relação ao genótipo

USA400, associado a infecções comunitárias nos Estados Unidos

(MCDOUGAL et al., 2003). Entre 1999 e 2000, amostras apresentando

características semelhantes também foram encontradas causando infecção

no HUCFF (VIVONI et al, 2006). Porém, essas amostras carreavam os genes

da PVL e eram sensíveis à oxacilina. Ribeiro e colaboradores, em 2007,

analisando amostras isoladas de dois hospitais nacionais também

encontraram amostras que apresentaram ST 1 e eram semelhantes aos

genótipos WA-1/USA400. Em nosso estudo, as amostras de nMRSA

relacionadas ao WA-1/USA400 não apresentaram os genes da PVL e foram

resistentes à meticilna. Como esse genótipo já havia sido detectado em

amostras de MSSA isoladas no HUCFF (VIVONI et al., 2006), anteriormente,

uma hipótese seria que estas amostras tenham incorporado o SCCmecIV e

perdido os genes da PVL.

O RFT AAACCAA foi aquele mais freqüente (7/20) entre as amostras

nMRSA avaliadas, tendo sido associado a 4 genótipos: D, E, F e G. Uma

amostra representativa desse RFT (664 - genótipo D) foi analisada por MLST

e apresentou perfil alélico 1-4-1-4-12-1-10, sendo incluído no ST 5 (CC 5).

Amostras de S. aureus apresentando SCCmecIV, com genótipo similar por

PFGE, e mesmo RFT, já tinham sido descritas anteriormente no HUCFF

(VIVONI et al, 2006). Contudo, a maioria dessas amostras (9/11) não


92

apresentava o cassete de resistência. Esse fato pode indicar uma tendência a

aquisição de SCCmec por essas linhagens. Uma outra amostra (604), com o

mesmo RFT e do genótipo E, apresentou um perfil por PFGE idêntico ao do

USA800 (COCKFIELD et al, 2007), um MRSA de origem hospitalar descrito

como clone pediátrico (SÁ-LEÃO et al., 1999). Miranda e colaboradores

(2007) também encontraram amostras de MRSA com esse genótipo em um

estudo envolvendo dois hospitais brasileiros, indicando a emergência desse

perfil genômico também entre amostras MRSA isoladas no Brasil.

O complexo clonal 5 (CC 5) tem agrupado amostras de diferentes

SCCmec, como os tipos I, II e IV (ENRIGHT et al., 2002). As amostras de

nMRSA 664 e 603, isoladas no presente estudo, apresentaram os tipos IV e II

de SCCmec, respectivamente, porém o mesmo RFT AAACCAA foi detectado,

o que indicou que havia uma relação entre elas. O MLST classificou a

amostra 664 no ST 5 e a amostra 603 em um ST que variou em um lócus

(gene pta) em relação ao ST 5, recebendo uma nova denominação de ST

1204, sendo portanto, um SLV (do inglês, “single lócus variant”) do ST 5.

As amostras nMRSA de números 517, 518 e 519, que foram isoladas

de infecções hospitalares em diferentes sítios do mesmo paciente,

apresentaram o RFT-AAACCAC e o ST 72 (CC 8). Não encontramos descrição

desse ST no Brasil, porém, amostras com ST 72 e SCCmecIV têm sido

associadas a infecções comunitárias na Coréia (KIM et al., 2007) e Suécia

(FANG et al., 2008). Outro ST descrito entre as amostras analisadas foi o ST

97 (CC 97), relacionado à amostra 563. No banco de dados do MLST existe

pouca informação a respeito da distribuição desse ST no mundo e os que


93

estão descritos são referentes a amostras de MSSA. A causa da emergência

desses novos genótipos em nossa instituição não está clara, porém, pode

estar relacionada ao fato das amostras de nMRSA possuírem vantagens

adaptativas em comparação com as amostras multirresistentes (LAURENT et

al., 2001).

Geralmente associadas apenas a infecções hospitalares, no final da

década de 90, amostras de MRSA foram também isoladas de infecções

comunitárias (CA-MRSA), na Austrália (HEROLD et al., 1998) e Estados

Unidos (GROOM et al., 2001). A partir de então, houve relatos em diversos

locais pelo mundo (MA et al., 2005; DIETRICH et al, 2007). No Brasil, o

primeiro relato de CA-MRSA foi realizado por Ribeiro e colaboradores (2005).

Essas amostras foram isoladas de abscessos cutâneos e artrite séptica, em

um hospital de Porto Alegre, Rio Grande do Sul, apresentavam o SCCmecIV

e estavam relacionadas ao genótipo do sudoeste do pacífico, denominado,

OSPC (do inglês, “Oceania Southwest Pacific clone”) (NIMMO et al, 2000). Em

nosso trabalho, foram observadas quatro amostras MRSA isoladas de

infecções de origem comunitária, sendo uma delas (amostra 526) isolada de

uma turista americana de 26 anos, que se encontrava no Rio de Janeiro.

Essa amostra foi geneticamente idêntica ao genótipo USA300, relacionado,

principalmente com casos, de infecções comunitárias nos Estados Unidos e

mais recentemente, isoladas também de infecções hospitalares (HUANG et

al., 2006; PATEL et al., 2007). Essa amostra apresentou o RFT CAAACAC e

foi incluída no ST 8, e também apresentou os genes da PVL, características


94

comuns no genótipo USA300. Esse é o primeiro relato da presença de

amostra USA300, carreando o gene da PVL em hospital do Rio de Janeiro.

Em nosso estudo, as quatro amostras de CA-MRSA foram isoladas de

quatro pacientes (4, 11, 16 e 17). Em três deles não havia a presença de

fatores de risco para aquisição de MRSA e nem alguma comorbidade

associada, o que está de acordo com os critérios observados para pacientes

com CA-MRSA (MILLAR et al., 2007). O paciente 17, contudo, estava fazendo

uso de antimicrobiano e apresentava infecção viral. De fato, tanto as

amostras MRSA de origem comunitária quanto de origem hospitalar

apresentaram características em comuns, tais como: SCCmecIV e o fenótipo

de não multirresistência. Além disso, os mesmos STs, como o ST 1 e 5 foram

identificados para os dois tipos de amostras. Em adição, a apresentação

clínica foi a mesma para ambos os pacientes, com infecção por HA e CA-

MRSA. Portanto, amostras com características de CA-MRSA devem ser

consideradas como potencial causa de infecções hospitalares.

Dos quatro pacientes com infecção por CA-MRSA três apresentaram

infecções cutâneas, sendo em dois deles, por amostras com genes da PVL. A

outra amostra do estudo que também apresentava esses genes foi isolada de

sangue, em paciente com bacteriemia relacionada a cateter. Esses dados

confirmam estudos anteriores que demonstram serem mais freqüentes

amostras PVL positivas em infecções comunitárias do que hospitalares (LINA

et al, 1999; RIBEIRO et al, 2005; FANG et al, 2008).

Além da amostra 526, isolada de uma turista americana, uma outra

amostra de CA-MRSA (601) também carreava os genes da PVL. Essa amostra


95

apresentou o genótipo C, RFT BBBBBAB, e foi incluída no novo ST 1203

(SLV 30, CC não definido). Vivoni e colaboradores (2006) observaram em

estudo anterior, no HUCFF, a presença de amostras MSSA com genes da PVL

causando infecções. Essas amostras também eram do mesmo RFT

mencionado anteriormente e do ST 30. As outras duas amostras de CA-

MRSA (633 e 664) não apresentaram os genes da PVL e foram incluídas nos

genótipos A (ST 1) e D (ST 5), similares aos genótipos USA400 e USA800,

importantes agentes de infecções comunitárias e hospitalares,

respectivamente (SÁ-LEÃO et al., 1999; MCDOUGAL et al., 2002; RIBEIRO et

al, 2007).

Na segunda parte deste estudo, caracterizamos aspectos relacionados à

resistência e virulência em amostras de S. aureus, isoladas de infecções

associadas a próteses e outras infecções no INTO. S. aureus e S. epidermidis

são responsáveis por mais de 70% das infecções relacionadas a próteses

(EHLRICH et al., 2004; MORAN et al., 2007). Contudo, no Brasil são muito

escassos dados ou informações sobre estudos realizados com amostras

isoladas de próteses articulares (ERCOLLE & CHIANCA, 2002).

No período de 08/2005 a 10/2007 foram isoladas 73 amostras de S.

aureus no INTO, sendo 32 amostras isoladas de próteses articulares e 41 de

outras infecções. Diferente do estudo realizado no HUCFF, as amostras

isoladas no INTO foram obtidas consecutivamente de infecções por S. aureus

durante o período relatado.

Das 73 amostras avaliadas, 28 foram identificadas como MRSA (sendo

13 de próteses e 15 de outras infecções). Dezesseis (57,1%) carreavam o


96

SCCmecIV e 12 (42,9%) o SCCmecIII. Foi observado que houve prevalência de

amostras com SCCmecIV, tanto nas amostras de MRSA isoladas de IAP

quanto nas isoladaas de INAP. Essas amostras foram não multirresistentes

(nMRSA), ao contrário do observado para amostras com SCCmecIII.

Informações obtidas junto a CCIH do INTO demostraram que esse tipo de

amostra, nMRSA, não havia sido isolada no hospital até então.

Assim como entre as amostras isoladas no HUCFF, aquelas de MRSA

com SCCmecIV isoladas no INTO, apresentaram altas taxas de resistência à

eritromicina, ciprofloxacina e clindamicina. Outros trabalhos têm mostrado,

nos últimos anos, um aumento nas taxas de resistência aos antimicrobianos

não β-lactâmicos, sobretudo à eritromicina e à clindamicina, entre amostras

de MRSA com SCCmecIV (TRINDADE et al., 2005; KILIC et al., 2006; PARK et

al., 2007). Em nosso estudo, particularmente em relação as quinolonas,

mais de 50% das amostras com SCCmecIV foram resistentes. Kilic e

colaboradores (2006) analisando a resistência antimicrobiana em 423

amostras de MRSA com SCCmecIV, isoladas de variadas infecções em

adultos, observaram taxas de resistência à eritromicina, clindamicina e

levofloxacina de 90,1%, 13,2% e 16,8%, respectivamente. Esses autores

fazem uma associação desses resultados com o rápido aumento na

resistência a quinolonas ocorrido, em amostras com SCCmecII no passado, e

sugerem que o mesmo pode acontecer com as amostras MRSA que carreiam

o SCCmecIV.

Em nosso estudo, as taxas de resistência à gentamicina observadas

entre as amostras com SCCmecIV foi de 37,5%. Esses dados são conflitantes
97

com os de outros trabalhos que demonstraram serem essas amostras, em

geral, sensíveis a essa droga (LAURENT et al., 2001; KILIC et al., 2006;

MIRANDA et al., 2007). Inclusive, Laurent e colaboradores (2001) sugerem

que a gentamicina serviria como marcador para amostras com SCCmecIV. É

importante destacar, contudo, que, em nosso estudo, as amostras SCCmecIV

se agruparam em apenas dois genótipos, o que pode ter contribuído para

influenciar as elevadas taxas de resistência detectadas. Ainda assim, a

presença de resistência, sobretudo a antimicrobianos que não estão

associados com a resistência em amostras MRSA com SCCmecIV, como a

ciprofloxacina e gentamicina, pode retratar uma tendência nessas linhagens,

caracterizadas como ST 1 e ST 5. Provavelmente, esse fato está associado a

maior exposição aos antimicrobianos, e a presença, cada vez maior, dessas

amostras no ambiente hospitalar, o que facilitaria a aquisição de novos

elementos de resistência.

Em relação às CMIs de oxacilina em amostras SCCmecIV, mais de 60%

apresentaram valores entre 8 e 64µg/mL, confirmando que essas amostras

apresentam CMIs próximas aos “ponto de corte”. Como foi dito

anteriormente, esses valores dificultam a detecção, in vitro, dessas amostras

de MRSA, o que pode levar a resultados falso-negativos. Analisando as CMIs

das 16 amostras de MRSA com SCCmecIV, isoladas de IAP e INAP,

observamos que sete (87,5%), das oito amostras isoladas de IAP

apresentaram CMIs >64µg/mL, enquanto entre as oito amostras de INAP,

cinco (62,5%) apresentaram CMIs <32µg/mL. Apesar do pequeno número de

amostras, essas CMIs mais elevadas entre amostras isoladas de IAP, podem
98

refletir a exposição a concentrações subinibitórias da droga, provavelmente,

devido ao biofilme formado sobre o material implantado.

Quanto a vancomicina, 85,7% das amostras MRSA apresentaram CMIs

de 1 ou 2µg/mL. Esses resultados também foram observados para as

amostras do HUCFF, demonstrando que está havendo uma tendência de

aumento nas CMIs para vancomicina, entre as amostras MRSA (SAKOULAS

et al, 2004), o que pode reduzir as possibilidades terapêuticas no tratamento

de infecções por esse patógeno.

Todas as amostras de MRSA com SCCmecIII, analisadas no presente

estudo, foram relacionadas ao genótipo prevalente no Brasil e, como era

esperado, todas as amostras apresentaram multirresistência antimicrobiana.

Todas as CMIs nessas amostras foram >256µg/mL para oxacilina,

confirmando dados anteriores (SCHUENCK et al., 2004; VIVONI et al., 2006)

Nesse estudo, 100% (73) das amostras analisadas apresentaram o gene

icaA e mais de 95% das amostras, tanto de IAP quanto de INAP, produziram

biofilme em placas de poliestireno. Muitos estudos demonstraram que a

maioria das amostras clínicas de S. aureus apresenta o operon ica (PEACOCK

et al., 2002; FRANK et al., 2004; ROHDE et al., 2007; O´DONNEL et al.,

2008). Rohde e colaboradores (2007), analisando 18 amostras de S. aureus,

isoladas de próteses de joelho e quadril, mostraram que todas as amostras

carreavam o gene icaA e também produziam biofilme. O´Donnel e

colaboradores (2008) também detectaram o operon ica em 100% das

amostras isoladas de portadores nasais (n=20) e naquelas isoladas de

infecções (n=26). Diferente dos estudos citados, alguns autores têm


99

comentado que, apesar das altas taxas de detecção do operon ica, muitas

vezes as amostras não formam biofilme, in vitro (FOWLER et al., 2001;

KNOBLOCH et al., 2002). Esse fato pode estar relacionado com as distintas

metodologias empregadas, incluindo diferentes concentrações de

suplementos, como, glicose e/ou sacarose. Contudo, é possível que a

expressão, em agumas amostras, ocorra, preferencialmente, in vivo, sobre

condições mais apropriadas. Enfim, os autores, em geral, concordam que a

presença do operon ica e a produção de biofilme parecem ser fatores

essenciais para o estabelecimento das infecções em próteses articulares.

Logo, a presença do operon ica, na maioria das amostras clínicas de S.

aureus avaliadas, é de relevância e, medidas que evitem ou dificultem a

chegada do patógeno ao local do implante e sua ligação ao dispositivo médico

devem ser consideradas.

S. aureus é um microrganismo altamente versátil com grande

capacidade de colonizar e estabelecer infecções em várias partes do

organismo. O primeiro passo para o estabelecimento dessas infecções é a

adesão ao tecido do hospedeiro. No presente estudo, investigamos a presença

de genes relacionados a adesão, e verificamos que os genes fnbA, ebpS e cna

foram encontrados em mais de 65% das amostras, tanto nas isoladas de IAP

quanto nas de INAP, enquanto os genes fnbB e bbp foram associados a

genótipos específicos, sendo detectados em menos de 20% das amostras

avaliadas.

Já foi demonstrado que a fibronectina é um importante mediador da

adesão de S. aureus a diversos materiais utilizados em próteses ortopédicas,


100

como, titânio e alumínio (DELMI et al., 1994). As proteínas FnBPA e FnBPB,

codificadas pelos genes fnbA e fnbB, respectivamente, não apenas

apresentam capacidade de se ligar à fibronectina, como também tem

capacidade de se ligar ao fibrinogênio (WANN et al., 2000), o que demonstra a

importância dessas proteínas na adesão bacteriana. Peacock e colaboradores

(2000) analisando a presença dos genes fnbA e fnbB em 163 amostras de S.

aureus, isoladas de implantes ortopédicos, endocardite, artrite séptica,

osteomielite e narina anterior, demonstraram que 162 (99,4%) apresentavam

o gene fnbA e 127 (77,9%) o gene fnbB. Analisando, in vitro, a ligação à

fibronectina por essas amostras, os autores observaram que um número

maior de amostras isoladas de implantes ortopédicos se ligava a essa

proteína quando comparado a amostras isoladas de outros sítios. Arciola e

colaboradores (2005) analisando a prevalência dos genes fnbA e fnbB em 191

amostras de S. aureus isoladas de infecções ortopédicas, demonstraram a

presença desses genes em mais de 98% das amostras. Em nosso estudo,

96% das amostras de IAP e 80,5% das amostras de INAP apresentaram o

gene fnbA Ao contrário do observado nos estudos anteriormente citados, o

gene fnbB, foi detectado em apenas 12 (16,4%) amostras, todas de MRSA

com SCCmecIII e todas similares ao genótipo prevalente nos hospitais

brasileiros. Amaral e colaboradores (2005), em estudos desenvolvidos, in

vitro, verificaram que amostras desse genótipo apresentavam maior

habilidade para se ligar, persistir e invadir células epiteliais. Segundo Gordon

e Lowy (2008) a presença de domínios de ligação a fibronectina mais

acessíveis parece ser necessária para um alto nível de invasão dessas


101

amostras. Booth e colaboradores (2001) encontraram resultados similares

aos nossos quando analisaram a presença de diversos genes de virulência em

405 amostras de S. aureus, isoladas de diversas infecções em vários hospitais

dos Estados Unidos e, em um da Alemanha, observaram a prevalência (65%)

de cinco genótipos entre essas amostras. O gene fnbA estava amplamente

disseminado, sendo encontrado em mais de 91% das amostras. Porém, o

gene fnbB foi encontrado em 20,1% das amostras e todas pertenciam a um

genótipo específico. Contudo, diferente dos nossos resultados, todas as

amostras eram de MSSA, isoladas de infecções de corrente sanguínea.

Devemos ressaltar que na literatura não foram encontrados estudos

relacionando o gene fnbB com tipos de SCCmec ou complexos clonais.

Em relação ao gene cna, Booth e colaboradores (2001) também

observaram que sua prevalência estava relacionada a genótipos específicos,

pois, em três dos cinco genótipos, esse gene foi encontrado em mais de 90%

das amostras, enquanto que em um outro genótipo esse gene não foi

detectado. Outros estudos têm demonstrado taxas variadas em relação à

presença desse gene (TRISTAN et al. 2003; ROHDE et al., 2007; BABA-

MOUSSA et al., 2008). Rohde e colaboradores (2007) relataram a presença do

gene cna em 22% das amostras de S. aureus isoladas de próteses de joelho e

quadril, enquanto Arciola e colaboradores (2005) ao analisarem 191

amostras de S. aureus, isoladas de infecções ortopédicas, observaram taxas

de 98% para esse gene. Em nosso estudo esses genes estavam presentes em

67,1% das 73 amostras. Entre os cinco principais genótipos observados,

apenas entre amostras do genótipo B´ esse gene não foi encontrado.


102

Excetuando o genótipo B´, em geral, todas as outras amostras dos genótipos

prevalentes (A´, C´, D´ e E´) apresentaram esse gene, não sendo possível

associá-lo a genótipos específicos.

Outra importante proteína de matriz que atua na ligação do S. aureus

aos tecidos é a elastina. Essa proteína apresenta a função de manter a

integridade estrutural de tecidos que requerem elasticidade, como pulmões e

vasos sanguíneos (DOWNER et al., 2002). Nesse estudo, o gene ebpS foi

encontrado em 75% das amostras isoladas de IAP e 70,7% das amostras de

INAP. Taxas semelhantes em relação à presença do gene ebpS foram

encontradas por outros autores. Rohde e colaboradores (2007), relataram a

presença desse gene em 71% das amostras de S. aureus isoladas de próteses

de joelho e quadril. Tristan e colaboradores (2003) comparando amostras

isoladas de endocardite, osteomielite/artrite séptica e colonização nasal

encontraram taxas de 61%, 62% e 55%, respectivamente. Da mesma forma

que o gene fnbA, o gene ebpS parece estar amplamente distribuído entre

amostras clínicas de S. aureus. Contudo, sua ausência foi observada

especificamente entre amostras do genótipo A´, onde foram incluídas as

amostras relacionadas ao genótipo de MRSA prevalente no Brasil, que

apresenta SCCmecIII e pertence ao CC 8.

Em nosso estudo, o gene bbp, que codifica uma proteína ligadora de

sialoproteína óssea, foi encontrado em apenas sete amostras (9,6%). Esse

gene estava presente em todas as quatro amostras do genótipo E´, o qual foi

associado apenas a amostras de INAP. As outras três amostras que

apresentaram esse gene foram dos genótipos G´ e H´, associados a amostras


103

de IAP e INAP, respectivamente. Tristan e colaboradores (2003) observaram

que o gene bbp estava mais associado com amostras isoladas de osteomielite

e artrite séptica, quando comparado com amostras de colonização nasal e

endocardite. Essa relação encontrada se deve a capacidade da proteína Bbp

ligar-se à sialoproteína óssea (TUNG et al., 2000). Baba-Moussa e

colaboradores (2008) ao analisar a presença de genes de virulência, em 100

amostras de S. aureus, isoladas de infecções do trato urinário, não

encontraram o gene bbp. Por outro lado, Rohde e colaboradores (2007)

detectaram 27% de amostras de S. aureus carreando esse gene, entre 18

amostras isoladas de próteses de quadril e joelho. Em nosso estudo, das sete

amostras isoladas de osteomielite, apenas uma apresentou esse gene. Como

infecções associadas a próteses têm relação direta com a estrutura óssea, era

esperada uma presença significativa entre as amostras de IAP, porém, não foi

o observado no presente estudo.

A análise da diversidade clonal das 73 amostras de S. aureus isoladas

no INTO mostrou que apenas cinco genótipos eram prevalentes e foram

responsáveis por 83,5% das infecções.

As amostras do genótipo A´ foram relacionadas ao genótipo de MRSA

prevalente no Brasil. A amostra representativa desse grupo, selecionada para

o MLST, apresentou ST 239, confirmando essa relação. Esse genótipo é

amplamente disseminado em hospitais nacionais, como demonstrado em

vários estudos (TEIXEIRA et al., 1995; SANTOS et al., 1999; VIVONI et al.,

2005). As principais características associadas a esse genótipo são a

multirresistência antimicrobiana e a diversidade de fatores de virulência,


104

incluindo a produção de biofilme, o que pode ter permitido que essas

amostras se disseminassem por diversos países (AMARAL et al., 2005;

DEURENBERG et al., 2006). Em nosso estudo, das oito amostras fortes

produtoras de biofilme, quatro eram desse genótipo, confirmando os relatos

anteriores.

Os dois principais genótipos detectados (B´ e C´) e que foram

prevalentes, tanto em infecções de prótese quanto em outras infecções,

englobaram amostras MRSA com SCCmecIV e amostras MSSA. O genótipo B´

apresentou uma grande quantidade de pulsotipos (14) demonstrando uma

variedade de eventos genéticos envolvendo essa estirpe. Ainda assim, o perfil

encontrado para a presença dos genes de virulência foi idêntico em 19 das 20

amostras avaliadas (6 MRSA e 14 MSSA). Em todas as cinco amostras em

que foi realizado o MLST, foi encontrado o ST 5 (CC 5). Algumas amostras,

isoladas no HUCFF, e avaliadas na primeira parte do estudo, também

pertenciam ao mesmo CC 5. A comparação entre as amostras mostrou

grande similaridade entre elas, sendo o pulsotipo B´7, isolado no INTO,

idêntico ao pulsotipo D3, isolado do HUCFF. Essas amostras são

relacionadas ao genótipo USA800 (clone pediátrico), amplamente

disseminado em vários hospitais dos Estados Unidos e Europa

(DEURENBERG et al., 2006, MCDOUGAL et al., 2003). Sola e colaboradores

(2006), analisando amostras de MRSA isoladas em Córdoba, Argentina,

demonstraram que as amostras relacionadas ao USA800 (SCCmecIV; ST 5)

estavam substituindo o genótipo predominante naquela região (SCCmecIII;


105

ST 239). Nosso estudo mostrou a emergência de amostras relacionadas ao

genótipo USA800 nas duas instituições de saúde avaliadas.

No genótipo C´ foi incluída a maior parte das amostras SCCmecIV,

isoladas tanto de IAP quanto de INAP. Nesse genótipo foram observadas nove

amostras de MRSA e 8 de MSSA. Em relação à presença de genes de

virulência, da mesma forma que no genótipo B´, todas, exceto uma,

apresentaram o mesmo perfil. As quatro amostras desse genótipo que foram

submetidas ao MLST apresentaram o ST 1. Esse mesmo ST foi associado ao

genótipo A, prevalente nas amostras de nMRSA isoladas no HUCFF. Os

pulsotipos C´1 e C´7 das amostras do INTO foram idênticas aos pulsotipos A1

e A2, respectivamente, encontrados nas amostras do HUCFF. Esses

genótipos são similares ao WA-1/USA400 que, como foi discutido

anteriormente, é um importante agente de infecções comunitárias na

Austrália (UDO et al., 1993) e Estados Unidos (McDOUGAL et al., 2003) e

foram descritos no Brasil.

A presença, em dois hospitais distintos, desses genótipos de MRSA

SCCmecIV, com ST 1 e 5, demonstra uma nova realidade nas infecções por

esse patógeno, uma vez que genótipo de MRSA prevalente no Brasil, vêm

sendo substituído ou co-existindo com essas novas estirpes. Quando

introduzidas nos hospitais, as amostras com tipos de SCCmec de tamanhos

mais reduzidos, podem apresentar algumas vantagens em relação àqueles

genótipos de MRSA tipicamente hospitalares, uma vez que já foi observado

que tais amostras apresentam menor tempo de geração e presença de fatores


106

de virulência adicionais, em especial os genes da Leucocidina de Panton

Valentine (BABA et al., 2002; MIRANDA et al., 2007).

Nos genótipos D´ e E´ foram incluídas todas as sete amostras que

apresentaram os genes da PVL. Apenas uma amostra (número 1970) era

MRSA com SCCmecIV, enquanto outras duas do mesmo genótipo E´ eram

MSSA. O MLST demonstrou que elas pertenciam ao ST 30, enquanto as

amostras do genótipo D´ foram classificadas em um SLV do ST 188. Vivoni e

colaboradores (2006) analisando amostras de S. aureus, isoladas do HUCFF,

entre 1999 e 2000, também encontraram, em amostras de MSSA carreando

os genes da PVL, o ST 188 e o ST 432, um SLV do 188. Os mesmos autores

encontraram, entre 11 amostras de um mesmo genótipo, oito que carreavam

os genes da PVL. Dentre essas amostras o MLST foi realizado em duas delas,

e os STs encontrados foram, ST 30 e ST 642, um SLV do ST 30. E assim,

como em nosso estudo, dentre as amostras que apresentaram o ST 30 havia

uma de MRSA, porém, o SCCmec não foi tipável. Ribeiro e colaboradores

(2007) relataram a presença de amostras de CA-MRSA, com ST 30 e genes da

PVL, em amostras isoladas no Rio de Janeiro e Porto Alegre. O ST 30 está

amplamente relacionado com amostras que possuem os genes da PVL,

sobretudo em amostras de CA-MRSA. Vandenesh e colaboradores (2003), em

um estudo envolvendo 117 amostras de CA-MRSA, isoladas da Europa,

Estados Unidos e Oceania demonstraram que das 17 amostras isoladas da

Oceania, 13 apresentavam o ST 30 e eram representantes do chamado

genótipo do Sudoeste do Pacífico (OSPC). Além disso, todas as 13 amostras

apresentaram os genes da PVL. Nossos dados se enquadram no modelo


107

evolutivo proposto para as linhagens do CC 30, descritas por Robinson e

colaboradores (2005) e Diep e colaboradores (2006). Esses autores propõem

um modelo baseado no SCCmec, genes da PVL e genes de virulência. De

acordo com esse modelo, haveria um ancestral comum, de MSSA - ST 30 que

teria recebido os genes da PVL, e mais recentemente, o SCCmecIV. Assim, as

amostras de S. aureus com ST 30, genes da PVL e o SCCmecIV, serviriam

como reservatórios para a transferência, tanto do SCCmec, quanto dos genes

da PVL. Este fato torna ainda mais importante a caracterização das

amostras envolvidas em infecção nas instituições de saúde, para controlar,

não apenas a disseminação dessas amostras, mas a transmissão desses

fatores a outras linhagens.

A associação entre os genes de virulência e os STs encontrados

demonstra que as amostras com o ST 30 apresentaram o perfil com maior

número de genes de virulência (perfil 10- presença dos genes icaA, cna, fnbA,

fnbB, bbp, ebpS e da PVL). Além disso, somente amostras do ST 30

apresentaram o gene bbp.

Assim como Arciola e colaboradores (2005) demonstraram que as

condições geradas por implantes não alteram a população de S. aureus no

ambiente, em nosso estudo, não foram observadas características específicas

entre os dois grupos de amostras, de infecções associadas (IAP) e não

associadas a próteses (INAP).

Apesar do principal genótipo de MRSA isolado de hospitais, estar

relacionado com amostras multirresistentes com SCCmecIII e ST 239, nesse

estudo, ficou claramente demonstrada a entrada de novos genótipos de


108

MRSA não multirresistentes, nos dois hospitais analisados. O aumento das

infecções por amostras MRSA observado em todo o mundo pode ter relação

com dois fatores: a disseminação de linhagens já existentes e/ou a bem

sucedida conversão de determinadas linhagens de MSSA em amostras de

MRSA, pela aquisição do SCCmec (NOTO et al., 2008). Noto e colaboradores

(2008) em um estudo que analisou a região de inserção do SCCmec (chamada

attB) no cromossomo de diferentes linhagens de MSSA demonstraram que

alguns grupos de amostras possuem maior capacidade de adquirir o

SCCmec, pela presença de seqüências de DNA similares às encontradas

nesse cassete, o que facilitaria uma possível recombinação e inserção no

cromossomo. Em nosso estudo, as amostras de MRSA com SCCmecIV e de

MSSA incluídas nos mesmos genótipos e STs foram encontradas em

infecções ocorridas no INTO. Analisando os pulsotipos desses dois grupos,

verificamos que, em algumas amostras, a diferença era inferior a três

bandas. Essa similaridade pode ser indicativa de uma pré-disposição desses

genótipos em receberem o cassete mec. Futuros estudos devem ser realizados

para melhor avaliação dessas amostras, em especial a região attB.

Os resultados desse estudo mostram que é cada vez mais importante a

realização de uma vigilância ativa nos hospitais nacionais, visando à

detecção e caracterização de amostras MRSA, não somente quanto aos tipos

de SCCmec, como também em relação aos genótipos, já que vem ocorrendo

uma mudança mundial na epidemiologia das infecções por S. aureus. É

importante ressaltar ainda a necessidade de informar aos profissionais de

saúde sobre a emergência dessas novas linhagens, para que medidas de


109

controle apropriadas para prevenção de sua transmissão, dentro das

instituições de saúde, sejam adotadas.


110

6 – CONCLUSÕES
111

Entre as principais conclusões observadas nesse estudo, podemos citar:

• Os altos valores de CMI para vancomicina (1 e 2µg/mL), observados

nas amostras de MRSA, tanto no HUCFF (100%), quanto no INTO

(85,7%), podem refletir a sua ampla utilização em infecções por MRSA,

aumentando a possibilidade de ocorrência de falha terapêutica com o

uso desse antimirobiano.

• A análise das amostras de MRSA, isoladas nos dois hospitais

estudados, mostrou que o genótipo de MRSA multirresistente

(SCCmecIII; ST 239), predominante nos hospitais nacionais, vem sendo

substituído por linhagens de MRSA não multirresistentes. Pudemos

observar a emergência de três linhagens de MRSA com SCCmecIV, ST

1, ST 5 e ST 30, em ambos os hospitais do Rio de Janeiro.

• A similaridade genética detectada entre amostras MRSA-SCCmecIV

(comunitárias e hospitalares) e MSSA, no INTO, com a inclusão da

maioria delas em duas grandes linhagens, ST 1 e ST 5, indica que as

mesmas podem ter migrado dos hospitais para comunidade ou vice-

versa.
112

• Neste estudo detectamos STs, não descritos no país até o momento,

tais como: ST 97 e ST 72, entre amostras de MRSA com SCCmecIV,

isoladas do HUCFF, assim como, descrevemos dois novos STs (ST 1203

e ST 1204).

• Detectamos uma amostra do genótipo USA300 (PVL + e resistente à

eritromicina) em um hospital no Rio de Janeiro. Esse fato é relevante,

pois, esse genótipo mostrou rápida capacidade de disseminação na

comunidade e hospitais americanos.

• A presença do gene icaA em todas as amostras de S. aureus isoladas

no INTO demonstra seu grande potencial para a produção de biofilme,

como demonstrado, in vitro, em mais de 90% das amostras avaliadas.

Os genes de virulência, icaA (100%), fnbA (87,7%), ebpS (70,7%) e cna

(67,1%) estavam amplamente distribuídos entre as amostras, enquanto

os genes fnbB (16,4%), bbp (9,6%) e da PVL (9,6%) foram encontrados

associados a genótipos específicos.


113

7 – REFERÊNCIAS BIBLIOGRÁFICAS
114

AIRES DE SOUZA, M., MIRAGAIA, M., SANCHES, I. S., AVILA, S., ADAMNSON, I.,
CASAGRANDE, S. T., BRANDILEONE, M. C., PALACIO, R., DELL´ACQUA, L., HORTAL, M.,
CAMOU, M., ROSSI, A., VELAZQUEZ-MEZA, M. E., ECHANIZ-AVILES, G., SOLORZANO-
SANTOS, F., HEITMANN, I. & de LENCASTRE, H. Three-year assessment of methicillin-
resistant Staphylococus aureus clones in Latin America from 1996 to 1998. J. Clin.
Microbiol., 39, 2197-2205, 2001.

AIRES DE SOUZA, M., de LENCASTRE, H., SANTOS, S., KIKUCHI, I., TOTSUKA, K. &
TOMASZ, A. Similarity o antibiotic resistance patterns and molecular typing properties
of methicillin-resistant Staphylococcus aureus isolates widely spread in hospitals in
New York City and in a hospital in Tokio, Japan. Microbiol. Drug Resist. 6, 253-258,
2000.

AKSOY, D.Y. & UNAL, S. New antimicrobial agents for the treatment of Gram-positive
bacterial infections. Clin. Microbiol. Infect. 14, 411-420, 2008.

AMARAL, M.M., COELHO, L.R., FLORES, R.P., SOUZA, R.R., SILVA-CARVALHO, M.C.,
TEIXEIRA, L.A., FERREIRA-CARVALHO, B.T., FIGUEIREDO, A.M. The predominant
variant of the Brazilian epidemic clonal complexo of methicillin-resistant
Staphylococcus aureus has an enhanced ability to produce biofilm and to adhere to
and invade airway epithelial cells. J. Infect. Dis. 192, 801-810, 2005.

AMORIM, M.L., FARIA, N.A., OLIVEIRA, D.C., VASCONCELOS, C., CABEDA, J.C., MENDES,
A.C., CALADO, E., CASTRO, A.P., RAMOS, M.H., AMORIM, J.M. & DE LENCASTRE, H.
Changes in the clonal nature and antibiotic resistance profiles of methicillin-resistant
Staphylococcus aureus isolated associated with spread of the EMRSA-15 clone in a
tertiary care portuguese hospital. J. Clin. Microbiol. 45, 2881-2888, 2007.

ARCHER, G.L. Staphylococcus aureus: a well-armed pathogen. Clin. Infect. Dis. 26,
1179-1181, 1998.

ARCIOLA, C.R.; BALDASSARI, L. & MONTANARO, L. Presence of icaA and icaD genes and
slime production in a collection of staphylococcal strains from catheter-associated
infections. J. Clin. Microbiol. 39: 2151-2156, 2001

ARCIOLA, C.R., CAMPOCCIA, D., GAMBERINI, S., BALDASSARRI, L., MONTANARO, L.


Prevalence of cna, fnbA and fnbB adhesin genes among Staphylococcus aureus
isolates from orthopedic infections associated to different types of implant. FEMS
Microbiol. 246, 81-86, 2005.

ARCIOLA, C. R., COLLAMATI, S., DONATI, E. & MONTANARO, L. A rapid PCR method for
the detection of slime-producing strains of Staphylococcus epidermidis and S. aureus
in periprosthesis infections. Diagn. Mol. Pathol. 10, 130-137, 2001.

BABA-MOUSSA, L., ANANI, L., SCHEFTEL, J.M., COUTURIER, M., RIEGEL, P., HAIKOU, N.,
HOUNSOU, F., MONTEIL, H., SANNI, A. & PRÉVOST, G. Virulence factors produced by
strains of Staphylococcus aureus isolated from urinary tract infections. J. Hosp. Infect.
68, 32-38, 2008.

BANNERMAN, T. L.A & PEACOCK, S. J.Staphylococcus, Micrococcus and other catalase-


positive cocci. In. Manual of Clinical Microbiology, Murray, P. R.; Baron, E. J.; Jorgensen, J.
H., Landry, M. L. & Pfaller, M. A. (eds), 9th ed, ASM Press. Washington, D.C. p. 390-411.
2007.

BARTELS, M.D., BOYE, K., LARSEN, A.R., SKOV, R. & WESTH, H. Rapid increase of
genetically diverse methicillin-resistant Staphylococcus aureus, Copenhagen,
Denmark. Emerg. Infect. Dis. 13, 1533-1540, 2007.
115

BEENKEN, K. E., DUNMAN, P. M., McALEESE, F., MACAPAGAL, D., MURPHY, E., PROJAN,
S. J., BLEVINS, J. S. & SMELTZER, M. S. Global gene expression in Staphylococcus
aureus biofilm. J. Bacteriol. 186, 4665-4684, 2004.

BENNER, E. J. & KAYSER, F. H. Growing clinical significance of methcillin-resistant


Staphylococcus aureus. Lancet 2:741-744

BERGER-BACHI, B. & ROHRER, S. Factors influencing methicillin resistance in


staphylococci. Arch. Microbiol. 178:165-171, 2002

BOERLIN, P. Applications of multilocus enzyme electrophoresis in medical


microbiology. J. Med. Methods. 28, 221-231, 1997.

BOLES, B. R., THOENDEL, M. & SINGH, P. K. Self-generated diversity produces


"insurance effects" in biofilm communities. Proc. Natl. Acad. Sci. 101, 6630-16635,
2004.

BOOTH, M.C., PENCE L.M., MAHASRESHTI, P., CALLEGAN, M.C. & GILMORE, M.S. Clonal
Associations among Staphylococcus aureus Isolates from Various Sites of Infection.
Infect. Immun. 69, 345-352, 2001.

BOYCE, J.M. 1996. Coagulase-negative staphylococci. In: Mayhall, C.G. (ed.). Hospital
Epidemiology and Infection Control. Willians & Wilkins Company, Baltimore, USA. p. 306-
334.

BUCK, J. M., K. COMO-SABETTI, K. H. HARRIMAN, R. N. DANILA, D. J. BOXRUD, A.


GLENNEN, & D R. LYNFIELD. Community-associated methicillin-resistant
Staphylococcus aureus, Minnesota, 2000-2003. Emerg. Infect. Dis. 11,1532-1538, 2005.

CASEWELL, M. W. & HILL, R. L. R. Elimination of nasal carriage of Staphylococcus


aureus with mupirocin (“pseudomonic acid”) - a controlled trial. J. Antimicrob.
Chemother. 17, 365-372, 1986.

CENTER FOR DISEASE CONTROL AND HOSPITAL EPIDEMIOLOGY (CDC). Staphylococcus


aureus with reduced susceptibility to vancomycin – United States. Morb. Mortal. Wkly.
Rep. 46, 765-766, 1997.

CENTERS FOR DISEASE CONTROL AND PREVENTION (CDC). Public Health Dispatch:
Outbreaks of community-associated methicillin-resistant Staphylococcus aureus skin
infections - Los Angeles County, California, 2002-2003. Morb. Mortal. Wkly. Rep. 52, 88,
2003.

CHAMBERS, H. F. Detection of methicillin-resistant staphylococci. Infect Dis. Clin.


North. Am. 7, 425-433, 1993.

CHANG, S., SIEVERT, D. M., HAGEMAN, J. C., BOULTON, M. L., TENOVER F.C.,
DOWNES, F. P., SHAH, S., RUDRIK, J. T., PUPP, G. R.., BROWN W. J., CARDO, D.,
FRIDKIN, S. K. & THE VANCOMYCIN-RESISTANT Staphylococcus aureus INVESTIGATIVE
TEAM. Infection with vancomycin-resistant Staphylococcus aureus containing the
vanA resistance gene. N. Engl. J. Med. 348, 1342-1347, 2003.

CHONGTRAKOOL, P., ITO, T., MA, X.X., KONDO, Y., TRAKULSOMBOON, S.,
TIENSASITORN, C., JAMKLANG, M., CHAVALIT, T., SONG, J.H. & HIRAMATSU, K.
Staphylococcal cassette chromosome mec (SCCmec) typing of methicillin-resistant
Staphylococcus aureus strains isolated in 11 Asian countries: a proposal for a new
116

nomenclature for SCCmec elements. Antimicrob. Agents Chemother. 50,1001–1012,


2006.

CLINICAL AND LABORATORY STANDARDS INSTITUTE - CLSI 2006a Performance


standards for antimicrobial disk susceptibility test – eighth ed. Approved standards-
nine edition: M2-A9 . Wayne, Pensylvania, USA.

CLINICAL AND LABORATORY STANDARDS INSTITUTE - CLSI 2006b. Methods for dilution
antimicrobial susceptibility tests for bacteria that grow aerobically – sixth ed.
Approved standards – seventh edition: M7-A7. Wayne, Pensylvania, USA

CLINICAL AND LABORATORY STANDARDS INSTITUTE - CLSI 2007. Performance


standards for antimicrobial susceptibility testing – eightheenth information
supplement. M100-S18. Wayne, Pensylvania, USA.

COCKFIELD, J. D., S. PATHAK, J. EDGEWORTH, & J. A. LINDSAY. Rapid determination


of hospital-acquired methicillin-resistant Staphylococcus aureus lineages. J. Med.
Microbiol. 56, 614-619,2007.

COSTERTON, J. W., STWART, P. S. & GREENBERG, E.P. Bacterial biofilms: a common


cause of persistent infection. Science. 284,1318-1322, 1999.

CRAMTON, S.E., GERKE, C., SCHNELL, N.F., NICHOLS, W.W. & GÖTZ, F. The intercellular
adhesion (ica) locus is present in Staphylococcus aureus and is required for biofilm
formation. Infect Immun. 67, 5427-5433, 1999.

CRISOSTOMO, M. I., WESTH, H., TOMASZ A., CHUNG, M., OLIVEIRA, D. C. & de
LENCASTRE H. The evolution of methicillin resistance in Staphylococcus aureus:
similarity of genetics backgrounds in historically early methicillin-susceptible and –
resistant isolates and contemporary epidemic clones. Proc. Natl. Acad. Sci. 98, 9865-
9870, 2001.

CUCARELLA, C., TORMO, M. A., ÚBEDA, C., TROTONDA, M. P.MÓNZON, M., PERIS, C.,
AMOREMA, B. LASA, I. & PENADÉS, J. R. Role of biofilm-associated protein bap in the
pathogenesis of bovine Staphylococcus aureus. Infect. Immun. 72, 2177-2185, 2001.

DAUM, R.S., ITO, T., HIRAMATSU, K., HUSSAIN, F., MONGKOLRATTANOTHAI, K.,
JAMKLANG, M. & BOYLEVAVRA, S. A novel methicillinresistance cassette in
communityacquired methicillinresistant Staphylococcus aureus isolates of diverse
genetic backgrounds. J. Infec. Dis., 186, 1344-1347, 2002.

DAVIS, S.L., RYBAK, M.J., AMJAD, M., KAATZ, G.W. & MCKINNON, P.S. Characteristics of
patients with healthcare-associated infection due to SCCmec type IV methicillin-
resistant Staphylococcus aureus. Infect. Control. Hosp. Epidemiol. 27, 1025-1031, 2006.

DE SOUZA, M.A.; SANCHES, I.S.; FERRO, M.L.; VAZ, M.J.; SARAIVA, Z.; TENDEIRO, T.;
SERRA, J. & DE LENCASTRE, H. Intercontinental spread of a multidrug-resistant
methicillin resistant Staphylococcus aureus clone. J. Clin. Microbiol., 36: 2590-2596,
1998.

DELMI, M., VAUDAUX, P., LEW, D.P., & VASEY, H. Role of fibronectin on staphylococcal
adhesion to metallic surfaces used as models of orthopaedic devices. J. Orthop. Res. 12,
432-438, 1994.

DEPLANO, A., WITTE, W., VAN LEEUWEN, W. J., BRUN, Y. & STRUELENS, M. J. Clonal
dissemination of epidemic methicillin-resistant Staphylococus aureus in Belgium and
neighboring countries. Clin. Microbiol. Infect. 6, 239-245, 2000.
117

DEURENBERG, R.H. & STOBBERINGH, E.E. The evolution of Staphylococcus aureus.


Infection, Genetics and Evolution.8, 747-763, 2008.

DEURENBERG, R.H., VINK, C., KALENIC, S., FRIEDRICH, A.W., BRUGGEMAN, C.A. &
STOBBERINGH, E.E. The molecular evolution of methicillin-resistant Staphylococcus
aureus. Clin. Microbiol. Infect. 13, 222-235, 2007.

DICKINSON, G. M. & BISNO, A. L. Infections associated with indwelling devices:


concepts of pathogenesis; infections associated with intravascular devices. Antimicrob.
Agents Chemother. 33, 597-601, 1989.

DIEKEMA, D.J., PFALLER, M.A., SCMITZ, F.J., SMAYEVSKY, J., BELL, J., JONES, R.N.,
BEACH, M. & SENTRY GROUP. Survey of infections due to Staphylococcus species:
frequency of occurrence and antimicrobial susceptibility of isolates collected in the
United States, Canada, Latin America, Europe, and the Western Pacific Region for the
SENTRY antimicrobial surveillance program, 1997-1999. Clin. Infect. Dis. 32, S114-
132, 2001.

DIEP, B.A., CARLETON, H.A., CHANG, R.F., SENSABAUGH G.F. & PERDREAU-REMINGTON
F. Roles of 34 Virulence Genes in the Evolution of Hospital – and Community-
Associated Strains of Methicilin-Resistant Staphylococcus aureus. J. Infect. Dis. 193,
1495-1503, 2006.

DIEP, B.A., PERDREAU-REMINGTON, F. & SENSABAUGH, G.F. Clonal characterization of


Staphylococcus aureus by multilocus restriction fragment typing, a rapid screening
approach for molecular epidemiology. J. Clin. Microbiol. 41, 4559-4564, 2003.

DIETRICH, D.W, AULD, D. B. & MERMEL, L. A.. Community-acquired methicillin-


resistant Staphylococcus aureus in southern New England children. Pediatrics. 113,
347-352, 2004.

DINGES, M.M., ORWIN, P.M. & SCHILIEVERT, P.M. Exotoxins of Staphylococcus aureus.
Clin. Microbiol. Review. 13, 16-34, 2OOO.

DOMINGUEZ, M. A., de LENCASTRE, H., LINARES, J. & TOMAZS, A. Spread and


maintenence of a dominant methicillin-resistant Staphylococcus aureus (MRSA) clone
during an outbreak of MRSA disease in a Spanish hospital. J. Clin. Microbiol. 32, 2081-
2087, 1994.

DONLAN, R.M. Biofilm formation: a clinically relevant microbiological process. Clin.


Infect. Dis. 33, 1387-1392, 2001.

DOWNER, R., ROCHE, F., PARK, P.W., MECHAM, R.P. & FOSTER, T.J. The Elastin-binding
Protein of Staphylococcus aureus (EbpS) Is Expressed at the Cell Surface as an
Integral Membrane Protein and Not as a Cell Wall-associated Protein. J. Biol. Chem.
277, 243-250, 2002.

DUNNE, W.M. Bacterial adhesion: seen any good biofilms lately? Clin. Microbiol. Rev. 15,
155-166, 2002.

EHRLICH, G. D., HU, F. Z., LIN, QIAO, L., CONSTERTON, J. W. & POST, J. C. Intelligent
implants to battle biofilms. ASM News. 70, 127-133, 2004.

EL-AZIZI, M., RAO, S., KANCHANAPOOM, T. & KHARDORI, N. In vitro activity of


vancomycin, quinupristin/dalfopritin, and linezolid against intact and disrupted
biofilms of staphylococci. Ann. Clin. Microbiol. Antimicrob. 4, 2, 2005.
118

ENRIGHT, M.C., DAY, N.P.J., DAVIES, C.E., PEACOCK, S.J & SPRATT, B.G. Multilocus
sequence typing for characterization of methicillin-resistant and methicillin-
susceptible clones of Staphylococcus aureus. J. Clin Microbiol. 38, 1008-1015, 2000.

ENRIGHT, M.C., ROBINSON, D.A., RANDLE, G., FEIL, E.J., GRUNDMANN, H. & SPRATT,
B.G. The evolutionary history of methicilin-resistant Staphylococcus aureus (MRSA).
Proc. Natl. Acad. Sci. 99, 7687-7692, 2002.

ERCOLE, F.F. & CHIANCA, T.C.M. Infecção de sítio cirúrgico em pacientes submetidos a
artroplastias de quadril. Rev. Latino-am Enfermagem. 10, 157-165, 2002.

EUZÉBY, J.P. List of Prokaryotic names with Standing in Nomenclature - Genus


Staphylococcus. http://www.bacterio.cict.fr/s/staphylococcus.html 20/12/2008.

FANG, H., G. HEDIN, G. LI, AND C. E. NORD. Genetic diversity of community-associated


methicillin-resistant Staphylococcus aureus in southern Stockholm, 2000-2005. Clin.
Microbiol. Infect. 14, 370-376, 2008.

FITZGERALD, J.R., STURDEVANT, D.E., MACKIE, S.M., GILL, S.R. & MUSSER, J.M.
Evolutionary genomics of Staphylococcus aureus: insights into the origin of
methicillin-resistant strains and the toxic shock syndrome epidemic. Proc. Natl.
Acad.Sci. U.S.A. 98, 8821–8826. 2001.

FITZPATRICK, F., HUMPHREYS, H. & O'GARA, J.P. Evidence for icaADBC-independent


biofilm development mechanism in methicillin-resistant Staphylococcus aureus
clinical isolates. J. Clin. Microbiol., 43, 1973-1976, 2005.

FOSSUM, A. E., & G. BUKHOLM. Increased incidence of methicillin-resistant


Staphylococcus aureus ST80, novel ST125 and SCCmecIV in the south-eastern part of
Norway during a 12-year period. Clin. Microbiol. Infect. 12, 627-633, 2006.

FOSTER, T.J. Immune evasion by Staphylococci. Nature. 3, 948-958, 2005.

FOSTER, T.J. & HÖÖK, M. Surface protein adhesins of Staphylococcus aureus. Trends
Microbiol., 6, 484-488, 1998.

FOWLER, V.G.Jr, FEY, P.D., RELLER, L.B., CHAMIS, A.L., COREY, G.R. & RUPP, M.E. The
intercellular adhesion locus ica is present in clinical isolates of Staphylococcus aureus
from bacteremic patients with infected and uninfected prosthetic joints. Med.
Microbiol. Immunol. 189, 127-131, 2001.

FRANK, K.L., HANSSEN, A.D. & PATEL, R. icaA is not a useful diagnostic marker for
prosthetic joint infection. J. Clin. Microbiol. 42, 4846-4849, 2004.

FUCHS, P. C., JONES, R. N. & BARRY, A. Interpretative criteria for disk diffusion
susceptibility testing of mupirocin, a topical antibiotic. J. Clin. Microbiol. 28, 608-609,
1990.

GERKE C., KRAFT, A., SUSSMUTH R., SCHWEITZER O. & GÖTZ, F. Characterization of
the N-acetylglucosaminyltransferase activity involved in the biosynthesis of the
Staphylococcus epidermidis polysaccharide intercellular adhesin. J. Biol. Chem. 17,
18586-18593, 1998.

GILLASPY, A.F., PATTI, J.M., PRATT, F.L.Jr., IANDOLO, J.J. & SMELTZER, M.S. The
Staphylococcus aureus collagen adhesin-encoding gene (cna) is within a discrete
genetic element. Gene. 196, 239-248, 1997.
119

GILLET, Y., ISSARTEL, B., VANHEMS, P., FOURNET, J.C., LINA, G., BES, M.,
VANDENESCH, F., PIÉMONT, Y., BROUSSE, N., FLORET, D. & ETIENNE, J. Association
between Staphylococcus aureus strains carrying gene for Panton-Valentine leukocidin
and highly lethal necrotising pneumonia in young immunocompetent patients. Lancet.
359, 753-779, 2002.

GOMES, A. R., SANCHES, I. S.,AIRES, D. S., CASTANEDA, E. & DE LECANSTRE, H.


Molecular epidemiology of methicillin-resistant Staphylococcus aureus in Colombian
hospitals: dominance of a single unique multidrug resistant clone. Microb. Drug Resist.
7, 23-32, 2001.

GORDON, R.J. & LOWY, F.D. Pathogenesis of methicillin-resistant Staphylococcus


aureus infection. Clin. Infect. Dis. 46, S350-S359, 2008.

GÖTZ, F. Staphylococcus and biofilms. Mol. Microbiol. 43, 1367-1378, 2002.

GROOM, A.V., WOLSEY, D.H., NAIMI, T.S., SMITH, K., JOHNSON, S., BOXRUD, D.,
MOORE, K.A. & CHEEK, J.E. Community-acquired methicillin-resistant Staphylococcus
aureus in a rural American Indian community. JAMA. 286, 1201–1205, 2001.

GRUNDMANN, H., AIRES-DE-SOUZA, M., BOYCE, J., TIEMERSMA, E. Emergence and


resurgence of meticillin-resistant Staphylococcus aureus as a public-health threat.
Lancet. 368, 874-885, 2006.

HARTLEIB, J., KOHLER, N., DICKINSON, R.B., CHHATWAL, G.S., SIXMA, J.J., FOSTER,
T.J., PETERS, G., KEHREL, B.E. & HERMANN, M. Protein A is the von Willebrand factor
binding protein on Staphylococcus aureus. Blood. 96, 2149-2156, 2000.

HEILMANN, C., SCHWEITZER, O., GERKE, C., VANITTANAKOM, N., MACK, D., GÖTZ, E.
Molecular basis of intercellular adhesion in the biofilm-forming Staphylococcus
epidermidis. Mol. Microbiol. 20, 1083-1091,1996.

HEROLD, B.C., IMMERGLUCK, L.C., MARANAN, M.C., LAUDERDALE, D.S., GASKIN, R.E.,
BOYLE-VAVRA, S., LEITCH, C.D. & DAUM, R.S. Community-acquired methicillin-
resistant Staphylococcus aureus in children with no identified predisposing risk.
JAMA. 279, 593-598, 1998.

HIGUCHI, W., TAKANO, T., TENG, L., YAMAMOTO, T. Structure and especific detection of
staphylococcal cassette chromosome mec type VII. Biochemical and Biophysical
Research Communications. 377, 752-756, 2008.

HILL, C.R., FLAMANT, R., MAZAS, F. & EVRARD, J. Prophylatic cefazolin versus placebo
in total hip replacement. Report of multicentre double-mind randomised trial. Lancet.
I, 795-796, 1981.

HIRAMATSU, K., CHUI, L., KURODA, M. & ITO, T. The emergence and evolution of
methicillin-resistant Staphylococcus aureus. Trends Microbiol. 9, 486-493, 2001.

HIRAMATSU, K., HANAKI, H., INO, T., YABUTA, K., OGURI, T. & TENOVER, F.C.
Methicillin-resistant Staphylococcus aureus clinical strain with reduced vancomycin
susceptibility. J. Antimicrob. Chemother. 40, 135-136, 1997.

HOLT, G.H., KRIEG, N.R., SNEATH, P.H.A., STALEY, J.T. & WILLIANS, S.T. 1994. Gram-
positive cocci. In: Bergey’s Manual of Determinative Bacteriology - 9th ed. Willians &
Wilkins, Baltimore, USA p.532-558.
120

HUANG, H., FLYNN, N. M., KING, J. H., MONCHAUD, C., MORITA, M. & COHEN, S. H.
Comparisons of community-associated methicillin-resistant Staphylococcus aureus
(MRSA) and hospital-associated MSRA infections in Sacramento, California. J. Clin.
Microbiol. 44, 2423-2427, 2006.

HUANG, Y. H., TSENG, S.P., HU, J.M., TSAI, J.C., HSUEH P.R. &. TENG, L.J. Clonal spread
of SCCmec type IV methicillin-resistant Staphylococcus aureus between community
and hospital. Clin. Microbiol. Infect. 13, 717-724, 2007.

HUDSON, M. C., RAMP, W. K. & FRANKENBURG, K. P. Staphylococcus aureus adhesion


to bone matrix and bone-associated biomaterials. FEMS Microbiol. 173, 279-284, 1999.

HUEBNER, J. & GOLDMANN, D.A. Coagulase-negative staphylococci: role as pathogens.


Annu. Rev. Med. 50, 223-236, 1999.

ING, H.B., BADDOUR, L.M. & BAYER, A.S. 1997. Bacteremia and infective endocarditis:
pathogenesis, diagnosis, and complications. In: The Staphylococci in Human Disease,
Crossley, K.B. & Archer, G.L. (eds), Churchill Livingstone, New York, USA. p.331-355.

ITO, T., KATAYAMA, Y., ASADA, K., MORI, N., TSUTSUMIMOTO, K. TIENSATORN, C. &
HIRAMATSU, K. Structural comparison of three types of staphylococcal cassette
chromosome mec integrated in the chromosome in methicillin- resistant
Staphylocccus aureus. Antimicrob. Agents Chemother. 45, 1323-1336, 2001.

ITO, T., KATAYAMA, Y. & HIRAMATSU, K. Cloning and nucleotide sequence


determination of the entire mec DNA of pre-methicillin resistant Staphylococcus
aureus N315. Antimicrob. Agents Chemother. 43, 1449-1458, 1999.

ITO, T., MA, X. X., TAKEUCHI, F., OKUMA, K., YUZAWA, H. & HIRAMATSU, K. Novel type V
staphylococcal cassete chromosome mec driven by a novel cassete chromosome
recombinase, ccrC. Antimicrob. Agents Chemother. 48, 2637-2651, 2004.

ITO, T., OKUMA, K., MA, X.X., YUZAMA, H. & HIRAMATSU, K. Insights on antibiotic
resistance of Staphylococcus aureus from its whole genome: genomic island SCC. Drug
Resist. Updat. 6, 41-52, 2003.

JARLOV, J.O. Phenotypic characteristics of coagulase-negative staphylococci: typing


and antibiotic susceptibility. APMIS. 107, 1S-42S, 1999.

JEVONS, M.P. Celbenin-resistant Staphylococci. BMJ. 1, 124–125, 1961.

JOHN, J. F. & BARG N. L. 1996.Staphylococcus aureus. In: Hospital Epidemiology and


Infection Control. Mayhall, C. G. (ed.) 1st ed. Williams & Wilkins Company, Baltimore,
USA p. 271-289.

KANECO, J. & KAMIO, Y. Bacterial two-component and hetero-heptameric pore-forming


cytolytic toxins: structures, pore-forming mechanism and organization of the genes.
Biosci. Biotechnol. Biochem. 68, 981-1003, 2004.

KANTZANOU, M., TASSIOS, P.T., TSELINI-KOTSOVILI, A., LEGAKIS, N.J. & VATAPOULOS,
A. Reduced susceptibility to vancomycin of nosocomial isolates of methicillin-
resistant Staphylococcus aureus. J. Antimicrob. Chemother. 43, 729-731, 1999.

KATAYAMA, Y., ITO, T. & HIRAMATSU K. Genetic organization of the chromosome region
surrounding mecA in clinical staphylococcal strains: role of IS431-mediated mecI
121

deletion in expression of resistance in mecA-carrying, low-level methicillin-resistant


Staphylococcus haemolyticus. Antimicrob. Agents. Chemother. 45:1955-1963

KATAYAMA, Y., ITO, T. & HIRAMATSU, K. A new class of genetic element, staphylococcus
cassette chromosome mec, encodes methicillin resistance in Staphylococcus aureus.
Antimicrob. Agents. Chemother. 44, 1549-1555, 2000.

KILIC, A., LI, H., STRATTON, C.W. & TANG, Y-W. Antimicrobial susceptibility patterns
and staphylococcal cassette chromosome mec types of, as well as panton-valentine
leukocidin occurrence among, methicillin-resistant Staphylococcus aureus isolates
from children and adults in middle Tennessee. J. Clin. Microbiol. 44, 4436-4440, 2006.

KIM, E.S., SONG, J.S., LEE, H.J. , CHOE, P.G., PARK, K.H., CHO, J.H., PARK, W.B., KIM,
S.H., BANG, J.H., KIM, D.M., PARK, K.U., SHIN, S., LEE, M.S., CHOI, H.J., KIM, E.C., OH,
M.D., KIM, H.B. & CHOE, K.W. A survey of community-associated methicillin-resistant
Staphylococcus aureus in Korea. J. Antimicrob. Chemother. 60, 1108-1114, 2007.

KLUYTMANS, J., VAN BELKUM, A. & VERBRUGH, H. Nasal carriage of Staphylococcus


aureus: epidemiology, underlying mechanisms, and associated risks. Clin. Microbiol.
Rev. 10, 505-520, 1997.

KNOBLOCH, J.K., HORSTKOTTE, M.A., ROHDE, H. & MACK, D. Evaluation of different


detection methods of biofilm formation in Staphylococcus aureus. Med. Microbiol.
Immunol., 191, 101-106, 2002.

KONDO, Y., ITO, T., MA, X.X., WATANABE, S., KREISWIRTH, B.N., ETIENNE, J. &
HIRAMATSU, K. Combination of multiplex PCRs for staphylococcal cassette
chromosome mec type assignment: rapid identification system for mec, ccr, and major
differences in junkyards regions. Antimicrob. Agents Chemother. 51, 264-274, 2007.

KREISWIRTH, B., KORNBLUM, J., ARBEIT, R.D., EISNER, W., MASLOW, J.N., MCGEER, A.,
LOW, D.E. & NOVICK, R.P., Evidence for a clonal origin of methicillin resistance in
Staphylococcus aureus. Science. 259, 227–230, 1993.

KURTZ, S., MOWAT, F., ONG., K., CHAN, N., LAU, E. & HALPEM, M. Prevalence of primary
and revision total hip and knee arthroplasty in the United States from 1990 through
2002. J. Bone Joint Surg (Am). 87, 1487-1497, 2005.

LARSSEN, K.W., JACOBSEN, T., BERGH, K., TVETE, P., KVELLO, E. & SCHEEL, O.
Outbreak of methicillin-resistant Staphylococcus aureus in two nursing homes in
Central Norway. J. Hosp. Infect. 60, 312-316, 2005.

LAURENT, F., LELIÈVRE, H., CORNU, M., VANDENESCH, F., CARRET, G. ETIENNE, J. &
FLANDROIS, J.P. Fitness and competitive growth advantage of new gentamicin-
susceptible MRSA clones spreading in French hospitals. J. Antimicrob. Chemother. 47,
277-283, 2001.

LECLERCQ, R. Mechanisms of resistance to macrolides and lincosamides: nature of the


resistance elements and their clinical implications. Clin. Infect. Dis. 34, 482–492, 2002.

LEE, C. Y. & LEE, J. C. 2000. Staphylococcal capsule. In: Gram-Positive Pathogens.


Fischetti, V.A.; Novick, R.P.; Ferretti, J.J.; Portnoy, D.A. & Rood, J.I. (eds), 1st edition. ASM
Press, Washington, D.C., USA. p 361-366.

LIDWELL, O. M., LOWBURY, E. J. L., WHYTE, W., BLOWERS, R., STANLEY, S. J & LOWE.
Airbone contamination of wounds in joint replacement operations: the relationship to
sepsis rates. J. Hosp. Infect. 4, 111-113, 1983.
122

LIDWELL, O. M., LOWBURY, E. J. L., WHYTE, W., BLOWERS, R., STANLEY, S. J & LOWE.
Effect of ultraclean air in operating roons on deep sepsis in the joint after total hip or
knee replacement: a randomized study. Br. Med J. 250, 99-102, 1982.

LINA, G., PIÉMONT, Y., GODALL-GAMOT, F., BES, M. PETER, M.O., GAUDUCHON, V.,
VANDENESH, F. & ETIENNE J. Involvement of Panton-Valentine leukocidin-producing
Staphylococcus aureus in primary skin infections and pneumoniae. Clin. Infect. Dis.
29, 1128-1132, 1999.

LODISE, T.P., MILLER, C.D. , GRAVES, J., EVANS, A., GRAFFUNDER, E., HELMECKE M. &
STELLRECHT K. Predictors of high vancomycin MIC values among patients with
methicillin-resistant Staphylococcus aureus bacteraemia. J. Antimicrob. Chemother. 62,
1138-1141, 2008.

LOWY, F.D. Medical Progress: Staphylococcus aureus infections. N. Engl. J. Med. 339,
520-532, 1998.

MA, X.X., GALIANA, A., PEDREIRA, W., MOWSZOWICZ, M., CHRISTOPHERSEN, I.,
bhnMACHIAVELLO, S., LOPE, L., BENADERET, S., BUELA, F., VICENTINO, W., ALBINI, M.,
BERTAUX, O., CONSTENLA, I., BAGNULO, H., LIOSA, L., ITO, T. & HIRAMATSU, K.
Community-acquired methicillin-resistant Staphylococcus aureus, Uruguay. Emerg.
Infect. Dis., 11, 973-976, 2005.

MAC FADDIN, J.F. Biochemical tests for identification of medical bacteria. Baltimore:
Williams & Wilkins, 312p, 1976.

MACK, D., BECKER, P., CHATTERJJE, I., DOBINSKY, S., KNOBLOCH, J.K.M., PETERS, G.,
HOLDE, H. & HERRMANN, M. Mechanism of biofilm formation in Staphylococcus
epidermidis and Staphylococus aureus: functional molecules, regulatory circuits, and
adaptative responses. Intern. J. Med. Microbiol. 294, 203-212, 2004.

MACK, D., HAEDER, M., SIEMSSEN, N. & LAUFS, R. Association of biofilm production of
coagulase negative staphylococci with expression of a specific polysaccharide
intercellular adhesin. J. Infect. Dis. 174, 881-884, 1996.

MARCHESE, A., BALISTRERI, G., TONOLI, E., DEBBIA, E.A. & SCHITO, G.C.
Heterogeneous vancomycin resistance in methicillin-resistant Staphylococcus aureus
strains in a large Italian hospital. J. Clin. Microbiol. 38, 866-869, 2000.

MATO, R., SANTOS, S., VENDITII, M., PLATT, D. J., CHUNG, M. & DE LENCASTRE, H.
Spread of the multiresistant Iberian clone of methicillin-resistant Staphylococcus
aureus (MRSA) to Italy and Scotland. Microbial. Drug Resist. 4, 107-112, 1998.

MCDOUGAL, L.K., STEWARD, C.D., KILLGORE, G.E., CHAITRAM, J.M., MCALLISTER, S.K.
& TENOVER, F.C. Pulsed-field gel electrophoresis typing of oxacillin-resistant
Staphylococcus aureus isolates from the United States: establishing a national
database. J. Clin. Microbiol. 41, 5113-5120, 2003.

MENZIES, B.E. The role of fibronectin binding proteins in the pathogenesis of


Staphylococcus aureus infections. Curr. Opin. Infect. Dis. 16, 225-229, 2003.

MILLAR, B.C., LOUGHREY, A., ELBORN, J.S. & MOORE, J.E. Proposed definitions of
community-associated meticillin-resistant Staphylococcus aureus (CA-MRSA). J. Hosp.
Infect. 67, 109-113, 2007.
123

MIRANDA, O.P., SILVA-CARVALHO, M.C. , RIBEIRO, A., PORTELA, F., CORDEIRO, R.P. ,
CAETANO, N., VIDAL, C.F. & FIGUEIREDO A.M.S. Emergence in Brazil of methicillin-
resistant Staphylococcus aureus isolates carrying SCCmecIV that are related
genetically to the USA800 clone. Clin. Microbiol. Infect. 13, 1165-1172, 2007.

MONTANARO, L., CAMPOCCIA, D. & ARCIOLA, C.R. Advancements in molecular


epidemiology of implant infections and future perspectives. Biomaterials. 28, 5155-
5168, 2007.

MORAN, E., MASTERS, S., BERENDT, A.R., MCLARDY-SMITH, P., BYREN, I. & ATKINS, B.L.
Guiding empirical antibiotic therapy in orthopaedics: the microbiology of prosthetic
joint infection managed by debridement, irrigation and prosthesis retention. J. Infect.
55, 1-7, 2007.

MUSSER, J.M. & KAPUR, V. Clonal analysis of methicillin-resistant Staphylococcus


aureus from intercontinental sources: association of the mec gene with divergent
phylogenetic lineages implies dessemination by horizontal transfer and recombination.
J. Clin. Microbiol. 30, 2058-2063, 1992.

NATIONAL NOSOCOMIAL INFECTIONS SURVEILLANCE SYSTEM (NNISS) REPORT. 2001.


Data summary from January 1992-June 2001, issued August 2001. Centers for Disease
Control and Prevention. Atlanta, Georgia, USA.

NATIONAL NOSOCOMIAL INFECTIONS SURVEILLANCE SYSTEM (NNIS) REPORT. 1996.


Data summary from October 1986-April 1996, issued May 1996. Centers for Disease
Control and Prevention. Atlanta, Georgia, USA.

NETTO-DOS-SANTOS, K.R., DE SOUZA, F.L., TEIXEIRA, L.M. & GONTIJO FILHO, P.P.
Typing of Staphylococcus aureus from surgical site infections: comparison of pulsed
field electrophoresis (PFGE) and PCR technique using extragenic palindromic (rep) and
Tn916-shine-Dalgarno (tnSD) target sequences. Int. J. Med. Microbiol. 291, 231-236,
2001.

NIMMO, G.R., COOMBS, G.W., PEARSON, J.C., O'BRIEN, F.G., CHRISTIANSEN, K.J.,
TURNIDGE, J.D, GOSBELL, I.B., COLLIGNON, P. & MCLAWS, M.L. Methicillin-resistant
Staphylococcus aureus in the Australian community: an evolving epidemic. Med. J.
Aust. 184, 384-388, 2006.

NOSOCOMIAL INFECTION NATIONAL SURVEILLANCE SERVICE. Surveillance of surgical


site infection in England, October 1997-September 2005.
http://www.hpa.org.uk/infections/topics_az/surgical_site_infection/all_97_05_SSI.pdf
. Acesso em Novembro 2008.

NOTO, M. J., KREISWIRTH, B.N., MONK, A.B. & ARCHER, G.L. Gene Acquisition at the
Insertion Site for SCCmec, the Genomic Island Conferring Methicillin Resistance in
Staphylococcus aureus. J. Bacteriol. 190, 1276-1283, 2008.

O’DONNELL, S., HUMPHREYS, H. & HUGHES D. Distribution of virulence genes among


colonizing and invasive isolates of methicillin-resistant Staphylococcus aureus. Clin.
Microbiol. Infect. 14, 625-626, 2008.

OKUMA, K., IWAKAWA, K., TURNIDGE, J.D. , GRUBB, W.B. , BELL, J.M., O'BRIEN, F.G.,
COOMBS, G.W., PEARMAN, J.W. , TENOVER, F.C. , KAPI, M. , TIENSASITORN, C., ITO, T. &
HIRAMATSU, K. Dissemination of new methicillin-resistant Staphylococcus aureus
clones in the community. J. Clin. Microbiol. 40, 4289-4294, 2002.
124

OLIVEIRA, D.C. & DE LENCASTRE, H. Multiplex PCR strategy for rapid identification of
structural types and variants of the mec element in methicillin-resistant
Staphylococcus aureus. Antimicrob. Agents Chemother.46, 2155-2161, 2002.

OLIVEIRA, G.A., DELL`AQUILA, A.M., MASIERO, R.L., LEVY, C.E., GOMES, M.S., CU, L.,
HIRAMATSU, K. & MAMIZUKA, E.M. Isolation in Brazil of nosocomial Staphylococcus
aureus with reduced susceptibility to vancomycin. Infect. Control. Hosp. Epidemiol. 22,
443-448, 2001.

OLIVEIRA, D.C., MILHEIRIÇO, C. & DE LENCASTRE, H. Redefining a structural variant of


staphylococcal cassette chromosome mec, SCCmec type VI. Antimicrob. Agents
Chemother. 50, 3457-3459, 2006.

OLIVEIRA, D. C., TOMASZ, A. & DE LENCASTRE, H. Secrets of success of a human


pathogen: molecular evolution of pandemic clones of methicillin-resistant
Staphylococcus aureus. Lancet Infect. Dis. 2, 180:189, 2002.

OLIVEIRA, D.C., TOMASZ, A. & DE LENCASTRE, H. The evolution of pandemic clones of


methicillin-resistant Staphylococcus aureus: identification of two ancestral genetic
backgrounds and the associated mec elements. Microb. Drug. Resist. 7, 349-361, 2001.

O’NEILL, E., POZZI, C., HOUSTON, P., SMYTH, D., HUMPHREYS, H., ROBINSON, D.A. &
O’GARA, J.P. Association between methicillin susceptibility and biofilm regulation in
Staphylococcus aureus isolated from device-related infections. J. Clin. Microbiol. 45,
1379-1388, 2007.

PALAZZO, I. C. V., ARAÚJO, M. L. C. & DARINE, A. L. C. First report of vancomycin-


resistant staphylococci isolated from healthy carriers in Brazil. J. Clin. Microbiol. 43,
179-185, 2005.

PAPAKYRIACOU, H., VAZ, D., SIMOR, A., LOUIE, M. & MCGAVIN, M.J. Molecular analysis
of the acessory gene regulator (agr) locus and balance of virulence factor expression in
epidemic methicillin-resistant Staphylococcus aureus. J. Infect. Dis. 181, 990-1000,
2000.

PARK, J.Y., JIN, J.S., KANG, H.Y., JEONG, E.H., LEE, J.C., LEE, Y.C., SEOL, S.Y., CHO,
D.T. & KIM, J. A comparison of adult and pediatric methicillin-resistant
Staphylococcus aureus isolates collected from patients at a University Hospital in
Korea. J. Microbiol. 45, 447-452, 2007.

PARK, P.W., ROSENBLOOM, J., ABRAMS, W.R., ROSENBLOOM, J. & MECHAM, R.P.
Molecular cloning and expression of the gene for elastin-binding protein (ebpS) in
Staphylococcus aureus. J. Biol. Chem., 271, 15803-15809, 1996.

PATEL, M., KUMAR, R.A., STAMM, A.M., HOESLEY, C.J., MOSER, S.A. & WAITES, K.B.
USA300 genotype community-associated methicillin-resistant Staphylococcus aureus
as a cause of surgical site infections. J. Clin. Microbiol. 45, 3431-3433, 2007.

PEACOCK S.J., DAY N.P.J., THOMAS M.G., BERENDT, A.R., & FOSTER, T.J. Clinical
Isolates of Staphylococcus aureus Exihibit Diversity in fnb Genes and Adhesion to
Human Fibronectin. Jornual of Infection. 41, 23-31, 2000.

PEACOCK, S.J., MOORE, C.E., JUSTICE, A., KANTZANOU, M., STORY, L., MACKIE, K.,
O’NEILL, G. & DAY, N.P.J. Virulent Combinations of Adhesin and Toxin Genes in Natural
Populations of Staphylococcus aureus. Infect. Immun. 70, 4987-4996, 2002.
125

PETER, G., LOCCI, R. & PULVERER. Microbial colonization of prosthetic devices II.
Scaning electron microscopy of naturally infect intravenous catheters. Zentralbl.
Baketeriol. Mikrobiol. Hyg. B. 173, 293-299, 1981.

PITCHER, D.G., SAUDERS, N.A. & OWEN, R.J. Rapid extraction of bacterial genomic
DNA with guanidium thiocyanate. Lett. Appl. Microbiol. 8, 151-156, 1989.

PREVOST, G., COUPPIE, P., PREVOST, P., GAYET, S., PETIAU, P., CRIBIER, B., MONTEIL,
H. & PIEMONT, Y. Epidemiological data on Staphylococcus aureus strains producing
synergohymenotropic toxins. J. Med. Microbiol. 42, 237–245, 1995.

PROJAN, S.J. & NOVICK, R.P. The molecular basis of pathogenicity. In: The Staphylococci
in human disease. Crossley, K.B. & Archer, G.L. (ed). Churchill Livingstone, New York, USA,
p. 55-81. 1997.

REAGAN, D.R., DOEBBELING, B.N., PFALLER, M.A., SHEETZ, C.T., HOUSTON, A.J.,
HOLLIS R.J. & WENZEL, R.P. Elimination of coincident Staphylococcus aureus nasal
and carriage with intranasal application of mupirocin calcium ointment, Ann. Inten.
Med. 114, 101-106, 1991.

RIBEIRO, A., CORONADO, A.Z. , SILVA-CARVALHO, M.C., FERREIRA-CARVALHO, B.T.,


DIAS, C., ROZENBAUM, R., DEL PELOSO, P.F., LEITE, C.C.F., TEIXEIRA, L.A. &
FIGUEIREDO A.M.S. Detection and characterization of international community-
acquired infections by methicillin-resistant Staphylococcus aureus clones in Rio de
Janeiro and Porto Alegre cities causing both community- and hospital-associated
diseases. Diagn. Microbiol. Infect. Dis. 59, 339-345, 2007.

RIBEIRO, A., DIAS, C., SILVA-CARVALHO, M.C., BERQUÓ, L. FERREIRA, F.A., SANTOS,
K.R.N., FERREIRA-CARVALHO, B.T. & FIGUEIREDO A.M. First report of infection with
community-acquired methicillin-resistant Staphylococcus aureus in South America. J.
Clin. Microbiol. 43, 1985-1988, 2005.

ROBERTS, R.B., CHUNG, M., DE LENCASTRE, A., HARGRAVE, J., TOMASZ, A., NICOLAU,
D.P., JOHN, J.F.Jr. & KORZENIOWSKI, O. Distribuition of methicillin-resistant
Staphylococcus aureus clones among health care facilities in Connecticut, New
Jersey, and Pennsylvania. Microbial. Drug Resist. 6, 245-251, 2000.

ROBERTS, R.B., DE LENCASTRE, A., EISNER, W., SEVERINA, E.P., SHOPSIN, B.,
KREISWIRTH, B.N. & TOMASZ, A. Molecular epidemiology of methicillin-resistant
Staphylococcus aureus in 12 New York hospitals. J. Hosp. Infect. 178, 164-171, 1998a.

ROBERTS, R.B., TENNENBERG, A.M., EISNER, W., HARGRAVE, J., DRUSIN, L.M., YURT, R.
& KREISWIRTH, B.N. Outbreak in a New York teaching hospital burn center caused by
Iberian epidemic clone of MRSA. Microbial. Drug Resist. 4, 175-183, 1998b.

ROBINSON, D. A. & ENRIGHT, M. C. Evolutionary models of the emergence of


methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 47, 3926-
3934, 2003.

ROBINSON, D.A, KEARNS, A.M, HOLMES, A., MORRISON, D., GRUNDMANN, H.,
EDWARDS, G., O'BRIEN, F.G., TENOVER, F.C., MCDOUGAL, L.K., MONK, A.B., ENRIGHT,
M.C. Re-emergence of early pandemic Staphylococcus aureus as a community-acquired
meticillin-resistant clone. Lancet. 365, 1256-1258, 2005.

ROCHE, F.M., MASSEY, R., PEACOCK, S.J., DAY, N.P.J., VISAI, L., SPEZIALE, P., LAM, A.,
PALLEN, M. & FOSTER T.J. Characterization of novel LPXTG-containing proteins of
126

Staphylococcus aureus identified from genome sequences. Microbiology. 149, 643-654,


2003.

ROHDE, H., BURANDT, E.C., SIEMSSEN, N., FROMMELT, L., BURDELSKI, C., WURSTER,
S., SCHERPE, S., DAVIES, A.P., HARRIS, L.G., HORSTKOTTE, M.A., KNOBLOCH, J.K.-M.,
RAGUNATH, C., KAPLAN, J.B., MACK, D. Polysaccharide intercellular adhesin or protein
factors in biofilm accumulation of Staphylococcus epidermidis and Staphylococcus
aureus isolated from prothetic hip and knee joint infections. Biomaterials., 28, 1711-
1720, 2007.

ROTUN, S.S., MCMATH, V., SCHOONMAKER, D.J., MAUPIN, P.S., TENOVER, F.C., HILL,
B.C. & ACKMAN, D. M. Staphylococcus aureus with reduced susceptibility to
vancomycin isolated from a patient with fatal bacteremia. Emerg. Infect. Dis. 5: 147-
149, 1999.

SADER, H.S., GALES, A.C., PFALLER, M.A., MENDES, R.E., ZOCCOLI, C., BARTH, A.,
JONES, R.N. & THE SENTRY PARTICIPANTS GROUP. Pathogen frequency and resistance
patterns in brazilian hospitals: summary of results from three years of th SENTRY
antimicrobial surveillance program. Braz. J. Infect. Dis. 5, 200-214, 2001.

SADER, H.S., JONES, R.N., GALES A.C., SILVA J.B., PIGNATARI A.C. & THE SENTRY
PARTICIPANTS GROUP (LATIN AMERICA). SENTRY antimicrobial surveillance program
report: Latin American and Brazilian results for 1997 through 2001. Braz. J. Infect.
Dis. 8, 25-79, 2004.

SAKOULAS, G., MOISE-BRODER, P.A., SCHENTAG, J., FORREST, A., MOELLERING Jr,
R.C. & ELIOPOULOS, G.M. Relationship of MIC and bactericidal activity to efficacy of
vancomycin for treatment of methicillin-resistant Staphylococcus aureus bacteremia.
J. Clin. Microbiol. 42, 2398-2402, 2004.

SA-LEAO, R., SANTOS, S.I., DIAS, D., PERES, I., BARROS, R.M. & DE LENCASTRE, H.
Detection of na archaic clone of Staphylococcus aureus with low-level resistance to
methicillin in a pediatric hospital in Portugal and in international samples: relics of a
formely widely disseminated strain? J. Clin. Microbiol.37, 1913-1920, 1999.

SANCHES, I.S., AIRES DE SOUZA, M., SOBRAL, L., CALHEIROS, I., FELICIO, L., PEDRA, I.
& DE LENCASTRE, H. Multidrug-resistant iberian epidemic clone of methicillin-
resistant Staphylococcus aureus endemic in a hospital in northern Portugal. Microb.
Drug. Resist. 1, 299-306, 1995

SANCHES, I.S., SARAIVA, Z.C., TENDEIRO, T.C., SERRA, J.M., DIAS, D.C. & DE
LENCASTRE, H. Extensive intra-hospital spread of a methicillin-resistant
staphylococcal clone. Int. J. Infect. Dis. 3, 26-31, 1998.

SANTOS, K.R.N., TEIXEIRA, L.M., LEAL, G.S., FONSECA, L.S. & GONTIJO FILHO, P.P. DNA
typing of methicillin-resistant Staphylococcus aureus: isolates and factors associated
with nosocomial acquisition in two Brazilian university hospitals. J. Med. Microbiol.
48, 17-23, 1999.

SCANVIC, A., DENIC, F., GAILLON, S., GIRY, P., ANDREMONT, A. & LUCET, J. Duration of
colonization by methicillin-resistant Staphylococcus aureus after hospital discharge
and risk factors for prolonged carriage. Clin. Infect. Dis. 32, 1393-1398, 2001.

SCHUENCK, R.P., DADALTI, P., SILVA, M.G., FONSECA, L.S. & SANTOS, K.R.N. Oxacilin-
and mupirocin-resistant Staphylococcus aureus : in vitro activity of silver
sulphadiazine and cerium nitrate in hospital strains. J. Chemother. 16, 453-458, 2004.
127

SCHUENCK, R.P., LOURENÇO, M.C., IÓRIO, N.L., FERREIRA, A.L., NOUÉR, S.A. &
SANTOS, K.R. Improved and rapid detection of methicillin-resistant Staphylococcus
aureus nasal carriage using selective broth and multiplex PCR. Res. Microbiol. 157,
971-975, 2006.

SCULCO, T.P. The economic impacto f infected joint arthroplasty. Orthopedics. 18, 871-
873, 1995.

SHAHIN, R., JOHNSON, I. L., JAMIESON, F., MCGEER, A., TOLKIN, J, FORD-JONES, E. L.
Methicillin-resistant Staphylococcus aureus carriage in a child care center following a
case of disease. Toronto Child Care Center Study Group. Arch. Pediatr. Adolesc. Méd.
153:864-868.

SHORE, A., ROSSNEY, A.S., KEANE, C.T., ENRIGHT, M.C. & COLEMAN, D.C. Seven novel
variants of the staphylococcal chromosomal cassette mec in methicillin-resistant
Staphylococcus aureus isolates from Ireland. Antimicrob. Agents Chemother.49, 2070–
2083, 2005.

SMELTZER, M.S., GILLASPY, A.F., PRATT, F.L. & THAMES, M.D. Comparative evaluation
of use of can, fnbA, fnbB, and hlb for genomic fingerprinting in the epidemiological
typing of Staphylococcus aureus. J. Clin. Microbiol. 35, 2444-2449, 1997.

SMIBERT, R. & KRIEG, N.R. Methods for general and molecular bacteriology. In:
Phenotypic characterization. Gerhardt, P.; Murray, R.G. E.; Wood, W. A. & Krieg, N. R. (eds.)
ASM Press. Washington, D.C., USA, p. 611-651. 1994

SMITH, T. & JARVIS, W. Antimicrobial resistance in Staphylococcus aureus. Microb.


Infect. 1, 795-805, 1999.

SOLA, C., CORTES, P., SAKA, H.A., CORDOBA MRSA COLLABORATIVE STUDY GROUP,
VINDEL, A. & BOCCO, J.L. Evolution and molecular characterization of methicillin-
resistant Staphylococcus aureus epidemic and sporadic clones in Cordoba, Argentina.
J. Clin. Microbiol. 44, 192-200, 2006.

STECKELBERG, J. M. & OSMON, R. D. Prosthetic joint infection. In: Waldvogel, F. A. and


Bisno, A. L.(eds). Infections associated with indwelling medical devices. 3th edition. ASM
Press. Washington D. C. p. 173-210. 2000

STEPANOVIC, S., VUKOVIC, D., DAKIC, I., SAVIC, B. & SVABIC-VLAHOVIC, M. A modified
microtiter-plate for quantification of staphylococcal biofilm formation. J. Microbiol.
Methods., 40, 175-179, 2000.

TEIXEIRA, L.A., LOURENÇO, M. & FIGUEIREDO, A. Emergence of a methicillin-resistant


Staphylococcus aureus clone related to the Brazilian epidemic clone III:B:A causing
invasive disease among AIDS patients in a Brazilian hospital. Microb. Drug Resist.
2,393-399, 1996.

TEIXEIRA, L. A., RESENDE, C. A., ORMONDE, L. R., ROSENBAUM, R., FIGUEIREDO, A.M.,
DE LENCASTRE, H. & TOMAZS, A. Geographic spread od epidemic multiresistant
Staphylococcus aureus clone in Brazil. J. Clin. Microbiol. 33, 2400-2404, 1995.

TENOVER, F.C., ARBEIT, R.D., GOERING, R.V., MICKELSEN, P.A., MURRAY, B.E.,
PERSING, D.H. & SWAMINATHAN, B. Interpreting chromosomal DNA restriction
patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain
typing. J. Clin. Microbiol. 33, 2233-2239, 1995.
128

TENOVER, F.C. & GAYNES, R.P. The epidemiology of Staphylococcus infections. In:
Gram-Positive Pathogens. Fischetti, V.A.; Novick, R.P.; Ferretti, J.J.; Portnoy, D.A. & Rood,
J.I. (eds), 1st edition. ASM Press, Washington, D.C., USA. p 414-421. 2000.

TIERMESMA, E.W., BRONZWARR, S.L.A.M., LYYTIKAINEN, O., DEGENER, J.E.,


SCHRIJNEMAKERS, P., BRUNISMA, N., MONEN, J., WITTE, W., GRUNDMAMN, H. &
EUROPEAN ANTIMICROBIAL RESISTANCE SURVEILLANCE SYSTEM PARTICIPANTS.
Methicilli-resistant Staphylococcus aureus in Europe, 1999-2002. Emerg. Infect. Dis.
10, 1627-1634, 2004.

TON-THAT, H., LIU, G., MAZMANIAN, S.K., FAULL, K.F. & SCHNEEWIND, O. Purification
and characterization of sortase; the transpeptidase that cleaves surface proteins of
Staphylococcus aureus at the lpxtg motif. Proc. Natl. Acad. Sci. 96,12424-12429, 1999.

TRAMPUZ, A. & ZIMMERLI, W. Prosthetic joint infections: update in diagnosis and


treatment. Swiss. Med. Wkly. 135, 243-251, 2005.

TRINDADE, P.A., PACHECO, P.L., COSTA, S.F., ROSSI, F., BARONE, A.A., MAMIZUKA, E.M.
& LEVIN, A.S. Prevalence of SCCmec type IV in nosocomial bloodstream isolates of
methicillin-resistant Staphylococus aureus. J. Clin. Microbiol. 43, 3435-3437, 2005.

TRISTAN, A., YING, L., BES, M., ETIENNE, J., VANDENESCH, F. & LINA, G. Use of
multiplex PCR to identify S. aureus adhesions involved in human haematogenous
infections. J. Clin. Microbiol. 41, 4465-4467, 2003.

TSUKAYAMA, D. T., ESTRADA, R. & GUSTILO, R. B. Infection after total hip


arthroplasty. A study of the treatment of one hundred and six infections.
J. Bone Joint Surg. Am. 78, 512-23, 1996.

TUNG, H., GUSS, B., HELLMAN, U., PERSSON, L., RUBIN, K. & RYDÉN, C. A bone
sialoprotein-binding protein from Staphylococcus aureus: a member of the
staphylococcal Sdr family. Biochem. J. 345, 611-619, 2000.

UDO, E.E., PANIGRAHI, D. & JAMSHEER, A.E. Molecular typing of methicillin-resistant


Staphylococcus aureus isolated in a Bahrain hospital. Med. Princ. Pract. 17, 308-314,
2008.

UDO, E.E., PEARMAN, J.W. & GRUBB, W.B. Genetic analysis of community isolates of
methicillin-resistant Staphylococcus aureus in Western Australia. J. Hosp. Infect. 25,
97-108, 1993.

VANDENBERGH, M.F.Q., YZERMAN, E.P.F., BELKUM, A., BOELENS, H.A.M., SIJMONS, M.


& VERBRUGH, H.A. Follow-up of Staphylococcus aureus nasal carriage after 8 years:
redefining the persistent carrier state. J. Clin. Microbiol. 37, 3133-3140, 1999.

VANDENESCH, F., NAIMI, T., ENRIGHT, M.C., LINA, G. NIMMO, G.R., HEFFERNAN, H.,
LIASSINE, N., BES, M., GREENLAND, T., REVERDY, M.E. & ETIENNE, J. Community-
acquired methicillin-resistant Staphylococcus aureus carrying panton-valentine
leukocidin genes: worldwide emergence. Emerg. Infect. Dis. 9, 978-984, 2003.

VAN DER MEE-MARQUET, N., EPINETTE, C., LOYAU, J., ARNAULT, L., DOMELIER, A.,
LOSFELT, B., GIRARD, N., QUENTIN, R. & THE BLOODSTREAM INFECTION STUDY
GROUP OF THE RELAIS D’HYGIÉNE DU CENTRE. Staphylococcus aureus strains
isolated from bloodstream infections changed significantly in 2006. J. Clin. Microbiol.
45, 851-857, 2007.
129

VELASCO, D., DEL MAR TOMAS, M., CARTELLE, M., BECEIRO, A,, PEREZ, A., MOLINA, F.,
MOURE, R. & VILLANUEVA R, BOU G. Evaluation of different methods for detecting
methicillin (oxacillin) resistance in Staphylococcus aureus. J Antimicrob Chemother.
55:379-382. 2005

VIVONI, A.M., DIEP, B.A., MAGALHÃES, A.C.G., SANTOS, K.R.N., RILEY, L.W.,
SENSABAUGH, G.F. & MOREIRA B.M. Clonal composition of Staphylococcus aureus
isolates at a Brazilian university hospital: identification of international circulating
lineages. J. Clin. Microbiol. 44, 1686-1691, 2006.

VIVONI, A.M., NETTO-DOS-SANTOS, K.R., DE-OLIVEIRA, M.P., GIAMBIAGI-DEMARVAL, M.,


FERREIRA, A.L.P., RILEY, L.W. & MOREIRA, B.M. Mupirocin for controlling methicillin-
resistant Staphylococcus aureus: lessons from a decade of use at a university
hospital. Infect. Control. Hosp. Epidemiol. 26, 662-667, 2005.

VON EIFF, C. PETERS, G. & HEILMANN, C. Pathogenesis of infection due to coagulase-


negative staphylococci. Lancet Infect. Dis. 2, 677-685, 2002.

WANN, E.R., GURUSIDDAPPA S. & HOOK M. The Fibronectin-binding MSCRAMM FnbpA


of Staphylococcus aureus Is a Bifunctional Protein That Also Binds to Fibrinogen. J.
Biol. Chem. 275, 13863-13871, 2000.

WANNET, W.J.B., SPALBURG, E., HECK, M.E.O.C., PLUISTER, G.N., TIEMERSMA, E.,
WILLEMS, R.J.L., HUIJSDENS, X.W., NEELING, A.J. DE & ETIENNE, J. Emergence of
virulent methicillin-resistant Staphylococcus aureus strains carrying panton-valentine
leucocidin genes in the Netherlands. J. Clin. Microbiol. 43, 3341-3345, 2005.

WITTE, W., CUNY, C., BRAULKE, C. & HEUCK, D. Clonal dissemination of two MRSA
strains in Germany. Epidemiol. Infect. 113, 67-73, 1994.

WU, S., PISCITELLI, C., DE LENCASTRE, H. & TOMASZ, A. Tracking the evolutionary
origin of the methicillin resistance gene: cloning and sequencing of a homologue of
mecA from a methicillin susceptible strain of Staphylococcus sciuri. Microb. Drug
Resist. 2, 435-441,. 1996.

YAMASAKI, O., KANEKO, J., MORIZANE, S., AKIYAMA, H., ARATA, J., NARITA, S., CHIBA,
J., KAMIO, Y. & IWATSUKI, K. The association between Staphylococcus aureus strains
carrying panton-valentine leukocidin genes and the development of deep-seated
follicular infection. Clin. Infect. Dis. 40, 381-385, 2005.

ZAMAM, R. & DIBB, W.L. Methicillin resistant Staphylococcus aureus isolated in Saudi
Arabia: epidemiology and antimicrobial resistance patterns. J. Hosp. Infect. 26, 297-300,
1994.

ZHANG, Y.L., WANG, N.P., LAI, F.C., LI, Q. & LI, Z.Q. Survey on drug resistance of
Staphylococcus aureus to commonly used antibiotics. Chemother. 4, 251-253, 2003.

ZIMMERLI, W. & OCHSNER, P.E. Management of infection associated with prosthetic


joints. Infection. 31, 99-107, 2003.

ZIMMERLI, W., TRAMPUZ, A. & OCHSNER, P.E. Prosthetic-joint infections. N. Engl. J.


Med. 351, 1645-1654, 2004.
130

ANEXO

Artigos submetidos e em preparação relacionados a


presente tese:

Artigo 1 - Schuenck, R. P.; Nouér, S. A.; Winter, C. O.; Cavalcante, F. S.;

Scotti , T. D.; Ferreira, A. L. P.; Giambiagi deMarval, M. & Santos, K. R. N.

Polyclonal Presence of Nonmultiresistant Methicillin–Resistant

Staphylococcus aureus Isolates Carrying SCCmec IV in Healthcare-

Associated Infections in a Hospital in Rio de Janeiro, Brazil. (Artigo

submetido ao Diagnostic Microbiology and Infectious Disease)

Artigo 2 - Schuenck, R. P.; Cavalcante, F. S., Emery, E.; Giambiagi deMarval,


M. & Santos, K. R.N. Prevalence of fnbA, fnbB, cna, bbp, ebpS and PVL
genes among Staphylococcus aureus isolates from orthopedic and other
infections in a Brazilina hospital. (Manuscrito em preparação).

Artigo 3 - Schuenck, R. P.; Cavalcante, F. S., Emery, E.; Giambiagi deMarval,


M. & Santos, K. R.N. Emergence of lineages ST 1, 5 and 30 among
Staphylococcus aureus isolates from orthopedical Hospital in Rio de
Janeiro. (Manuscrito em preparação).
131

Polyclonal Presence of Nonmultiresistant Methicillin–Resistant

Staphylococcus aureus Isolates Carrying SCCmec IV in

Healthcare-Associated Infections in a Hospital in Rio de Janeiro, Brazil

Ricardo Pinto Schuenck 1; Simone Aranha Nouér 2, 3; Carolina de Oliveira Winter 1;

Fernanda Sampaio Cavalcante 1; Tatiana Dantas Scotti 3; Adriana Lúcia Pires

Ferreira 3; Márcia Giambiagi-de Marval 1; Kátia Regina Netto dos Santos 1*

Departamento de Microbiologia Médica, Instituto de Microbiologia Prof. Paulo de

Góes 1 and Faculdade de Medicina 2 and Hospital Universitário Clementino Fraga

Filho 3, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil

Running title: nMRSA SCCmec IV in healthcare-associated infections

*Corresponding author. Mailing address: Laboratório de Infecções Hospitalares,

Departamento de Microbiologia Médica, Instituto de Microbiologia Prof. Paulo de

Góes, CCS, Bloco I, UFRJ, Cidade Universitária, Rio de Janeiro, RJ, Brazil, CEP:

21941-590. Phone: 55-21-2560-8344, Fax: 55-21-2560-8028. E-mail:

santoskrn@micro.ufrj.br.
132

Abstract

Changing in epidemiology of methicillin-resistant S. aureus (MRSA) was

observed due to the emergence of infections by nonmultiresistant MRSA (nMRSA) in

our hospital in Rio de Janeiro, Brazil. Clinical characterization and molecular

analysis of 20 nMRSA isolates recovered from 17 patients, between February 2005

and March 2006 was performed. The analysis included SCCmec (staphylococcal

cassette chromosome mec), pulsed field gel electrophoresis, multilocus restriction

fragment, and multilocus sequence typing. Minimum inhibitory concentrations

(MICs) for oxacillin and vancomycin, and presence of PVL genes were also

investigated. All but one of the 20 isolates presented SCCmec type IV. PFGE

clustered all isolates into nine genotypes. MIC <16µg/ml to oxacillin was found for

65% of the isolates, while 80% exhibited MIC of 2µg/ml for vancomycin. PVL

encoding genes were observed in three isolates. Polyclonal presence of nMRSA

SCCmec IV was observed in our institution, including community and healthcare-

associated isolates, belonged to the sequence types (STs) 1 (Clonal Complex-CC1),

ST5 (CC5), ST8 and ST72 (CC8), ST97 (CC97) and 2 STs singletons (SLV5 and

SLV30).

Key words: methicillin-resistant Staphylococcus aureus, SCCmec IV, PFGE, MLRFT,

MLST
Livros Grátis
( http://www.livrosgratis.com.br )

Milhares de Livros para Download:

Baixar livros de Administração


Baixar livros de Agronomia
Baixar livros de Arquitetura
Baixar livros de Artes
Baixar livros de Astronomia
Baixar livros de Biologia Geral
Baixar livros de Ciência da Computação
Baixar livros de Ciência da Informação
Baixar livros de Ciência Política
Baixar livros de Ciências da Saúde
Baixar livros de Comunicação
Baixar livros do Conselho Nacional de Educação - CNE
Baixar livros de Defesa civil
Baixar livros de Direito
Baixar livros de Direitos humanos
Baixar livros de Economia
Baixar livros de Economia Doméstica
Baixar livros de Educação
Baixar livros de Educação - Trânsito
Baixar livros de Educação Física
Baixar livros de Engenharia Aeroespacial
Baixar livros de Farmácia
Baixar livros de Filosofia
Baixar livros de Física
Baixar livros de Geociências
Baixar livros de Geografia
Baixar livros de História
Baixar livros de Línguas
Baixar livros de Literatura
Baixar livros de Literatura de Cordel
Baixar livros de Literatura Infantil
Baixar livros de Matemática
Baixar livros de Medicina
Baixar livros de Medicina Veterinária
Baixar livros de Meio Ambiente
Baixar livros de Meteorologia
Baixar Monografias e TCC
Baixar livros Multidisciplinar
Baixar livros de Música
Baixar livros de Psicologia
Baixar livros de Química
Baixar livros de Saúde Coletiva
Baixar livros de Serviço Social
Baixar livros de Sociologia
Baixar livros de Teologia
Baixar livros de Trabalho
Baixar livros de Turismo