Você está na página 1de 198

Biologia moderna: Amabis & Martho - 1� ano

Ensino M�dio
Jos� Mariano Amabis
Gilberto Rodrigues Martho
1� edi��o, S�o Paulo, 2016
Editora Moderna
PNLD 2018, 2019 e 2020
C�digo 0196P18113101IL

Livro Digitalizado para leitura em DOSVOX


P�ginas 01 a 240

CAP - Centro de Apoio Pedag�gico para Atendimento �s Pessoas


com Defici�ncia Visual de Cascavel.
Av. Brasil n.� 2040, Bairro S�o Crist�v�o, 85816-981.
Cascavel - PR
Fone: (45) 3333-2878 e (45) 3333-2879
cap.cascavel@nrecascavel.com
- 2019 -

Biologia moderna: Amabis & Martho


Jos� Mariano Amabis, Gilberto Rodrigues Martho
Moderna

P�gina 1

Jos� Mariano Amabis


Licenciado em Ci�ncias Biol�gicas pelo Instituto de Bioci�ncias - Faculdade de
Educa��o da Universidade de S�o Paulo. Doutor e Mestre em Ci�ncias, na �rea de
Biologia (Gen�tica) pelo Instituto de Bioci�ncias da Universidade de S�o Paulo.
Professor do Instituto de Bioci�ncias da Universidade de S�o Paulo (1972-2004).
Coordenador de Atividades Educacionais e de Difus�o do Centro de Estudos do Genoma
Humano da Universidade de S�o Paulo (2000-2004).
Gilberto Rodrigues Martho
Licenciado em Ci�ncias Biol�gicas pelo Instituto de Bioci�ncias - Faculdade de
Educa��o da Universidade de S�o Paulo. Lecionou Biologia em escolas de ensino m�dio
e cursos pr�-vestibulares.
Biologia moderna
Amabis & Martho
1
Ensino M�dio
Componente curricular: BIOLOGIA
1� edi��o
S�o Paulo, 2016
Moderna

P�gina 2

Coordena��o editorial: Rita Helena Br�ckelmann


Edi��o de texto: Marcia Maria Laguna de Carvalho (coord.), Fl�vio Gomes-Silva,
Roberta Aparecida Bueno Hiranaka, Dino Santesso Gabrielli, Edna Emiko Nomura,
Zanith Cook
Prepara��o de texto: Silvana Cobucci
Ger�ncia de design e produ��o gr�fica: Sandra Botelho de Carvalho Homma
Coordena��o de produ��o: Everson de Paula
Suporte administrativo editorial: Maria de Lourdes Rodrigues (coord.)
Coordena��o de design e projetos visuais: Marta Cerqueira Leite
Projeto gr�fico: Marta Cerqueira Leite, Douglas Rodrigues Jos�
Capa: Mariza de Souza Porto
Foto: Planta carn�vora end�mica (Drosera roraimae). Monte Roraima (RR), 2014.
(c) Fabio Colombini
Coordena��o de arte: Wilson Gazzoni Agostinho
Edi��o de arte: Ana Miadaira
Editora��o eletr�nica: Grapho Editora��o
Coordena��o de revis�o: Adriana Bairrada
Revis�o: Afonso N. Lopes, Cec�lia Setsuko Oku, Geuid Dib Jardim, Maristela S.
Carrasco
Coordena��o de pesquisa iconogr�fica: Luciano Baneza Gabarron
Pesquisa iconogr�fica: Fl�via Aline de Morais, Luciana Vieira
Coordena��o de bureau: Am�rico Jesus
Tratamento de imagens: Denise Feitoza Maciel, Marina M. Buzzinaro, Rubens M.
Rodrigues
Pr�-impress�o: Alexandre Petreca, Everton L. de Oliveira, H�lio P. de Souza Filho,
Marcio H. Kamoto, Vit�ria Sousa
Coordena��o de produ��o industrial: Viviane Pavani
Impress�o e acabamento:
Dados Internacionais de Cataloga��o na Publica��o (CIP)
(C�mara Brasileira do Livro, SP, Brasil)
Amabis, Jos� Mariano
Biologia moderna : Amabis & Martho. -
1. ed. - S�o Paulo : Moderna, 2016.
bra em 3v.
Componente curricular: Biologia
Bibliografia
1. Biologia (Ensino m�dio) I. Martho, Gilberto Rodrigues. II. T�tulo.
16-01478 CCDD-574.07

�ndices para cat�logo sistem�tico:


1. Biologia : Estudo e ensino 574.07
Reprodu��o proibida. Art. 184 do C�digo Penal e Lei 9.610 de 19 de fevereiro de
1998.
Todos os direitos reservados
EDITORA MODERNA LTDA.
Rua Padre Adelino, 758 - Belenzinho
S�o Paulo - SP - Brasil - CEP 03303-904
Vendas e Atendimento: Tel. (011) 2602-5510
Fax (011) 2790-1501
www.moderna.com.br
2016
Impresso no Brasil
1 3 5 7 9 10 8 6 4 2

P�gina 3

Apresenta��o

Prezado estudante,
A ci�ncia est� em todas as m�dias - TV, jornais e revistas, sem falar da internet -
quase diariamente. Os conhecimentos cient�ficos saem dos laborat�rios de pesquisa e
geram tecnologias cada vez mais surpreendentes. Hoje, todo cidad�o bem informado e
participante dos avan�os sociais de sua �poca precisa compreender os fundamentos do
pensamento cient�fico.
A Biologia � o ramo da ci�ncia dedicado ao estudo e ao entendimento do intrincado
fen�meno da vida, em seus mais diversos n�veis e manifesta��es. O que � vida? Quais
s�o suas caracter�sticas fundamentais? De que � feito um ser vivo? Como os seres
vivos surgiram e evolu�ram? Como a vida se mant�m no organismo e se perpetua no
tempo? Essas s�o algumas das perguntas que esta obra prop�e analisar e responder,
do ponto de vista da ci�ncia atual. Al�m disso, queremos integrar essas quest�es
centrais da Biologia com suas aplica��es em nosso contexto social.
Como encarar esta obra did�tica de Biologia? Acima de tudo, como uma aliada em sua
busca pelo conhecimento. Folheie o livro, familiarize-se com ele: percorra cada
p�gina, observe as imagens, procure nele temas que despertam sua curiosidade,
antecipe respostas. Temos certeza de que muitos dos assuntos aqui tratados s�o de
seu interesse. N�o deixe de ler a apresenta��o de cada cap�tulo, que proporciona
mais contexto ao seu estudo. Aceite os desafios das atividades. Proponha outras
maneiras de divulgar os resultados de suas pesquisas, a fim de propagar informa��es
e ideias. Participe das aulas fazendo sugest�es de como gostaria de estudar os
variados assuntos. Lembre-se de que voc� � protagonista do processo de ensino-
aprendizagem e percorra seu pr�prio caminho no conhecimento da Biologia; esta obra
quer acompanhar voc� nessa tarefa.
Al�m disso procure sempre ampliar seus horizontes. Estabele�a rela��es, mesmo que
ousadas e inusitadas, entre o que voc� aprende em Biologia e o conte�do de outras
�reas do conhecimento. Converse com seus professores; troque ideias com colegas.
Quanto mais voc� utilizar seus conhecimentos, em diferentes contextos, mais eles
ser�o proveitosos.
Desejamos que esta obra o ajude a compreender e a valorizar a ci�ncia, considerando
os limites e as possibilidades que ela oferece; que desperte seu interesse por
temas cient�ficos e, quem sabe, seja seu incentivo para participar dessa grande
aventura que � a constru��o do conhecimento.
Os autores

P�gina 4

Organiza��o deste livro


Cada volume da obra est� dividido em 3 ou 4 m�dulos tem�ticos; em cada um deles, os
assuntos s�o desenvolvidos em 2 a 5 cap�tulos, acompanhados de atividades que
refor�am a aprendizagem.
Conhe�a detalhadamente a organiza��o interna deste volume.
Abertura dos m�dulos
Na abertura de cada m�dulo, os textos e imagens trazem informa��es importantes
sobre os assuntos em pauta. Habitue-se a explorar essas p�ginas iniciais para se
inteirar dos temas que ser�o desenvolvidos em cada cap�tulo.

Apresenta��o dos cap�tulos


Qual a rela��o dos assuntos tratados no cap�tulo com nossa vida?
A Apresenta��o discute justamente as rela��es entre os conte�dos e quest�es
cotidianas, sociais e de cidadania. Confira os temas de cada cap�tulo no item A
import�ncia do assunto.

P�gina 5

Textos e imagens
O texto do cap�tulo � dividido em itens e subitens que organizam os assuntos
tratados. Os conceitos mais relevantes est�o destacados em verde e outros conceitos
importantes est�o destacados em preto. As imagens complementam e ilustram o texto.
Em seus estudos, explore o "di�logo" entre textos, imagens e legendas explicativas.

Amplie seus conhecimentos


Presente em alguns cap�tulos, o quadro Amplie seus conhecimentos aprofunda alguns
temas e apresenta detalhes e curiosidades relativos ao assunto em pauta.

Ci�ncia e cidadania
Outro quadro presente em v�rios cap�tulos da obra � o Ci�ncia e cidadania. Nele,
encontram#se assuntos diretamente ligados a quest�es cotidianas ou de cidadania,
destinados a complementar ou a ampliar temas discutidos na Apresenta��o do
cap�tulo. Os par�grafos do texto s�o numerados em sequ�ncia, e umGuia de leitura
ajuda a explorar o tema central de cada um deles. Habitue#se a responder por
escrito, em seu caderno, �s sugest�es do Guia.

P�gina 6

Revendo conceitos, fatos e processos


Esse elenco de atividades cont�m quest�es de m�ltipla escolha, nas quais s�o
revistos conceitos fundamentais do cap�tulo, relacionando-os a diferentes fatos e
situa��es que ampliam seu significado. N�o deixe de explorar essas atividades,
anotando as respostas em seu caderno.

Quest�es para exercitar o pensamento


O elenco de atividades denominado Quest�es para exercitar o pensamento traz
desafios e orienta��es para aplicar os conhecimentos aprendidos no cap�tulo a
situa��es-problema. As diversas sugest�es desse bloco demandam respostas que devem
ser escritas no caderno. Exercite seu pensamento e aceite os desafios propostos por
elas.
Fa�a voc� mesmo!
A maioria dos cap�tulos do livro traz uma ou mais sugest�es de atividade
intituladas Fa�a voc� mesmo!. Elas s�o um convite para realizar alguns "fazeres",
como experimentos, a produ��o de murais, de mat�rias jornal�sticas ilustradas ou de
infogr�ficos, entre outros. Muitas dessas atividades destinam-se ao trabalho em
grupo. Forme sua equipe.

A Biologia no vestibular e no Enem


Essas atividades trazem quest�es selecionadas de exames de ingresso em
universidades de diversos estados brasileiros, al�m de quest�es do Exame Nacional
do Ensino M�dio (Enem) relacionadas aos temas do cap�tulo.

P�gina 7

Sum�rio
M�DULO 1 A natureza da vida 10
Cap�tulo 1 Biologia: ci�ncia e vida 12
Humanidade e ci�ncia 12
A import�ncia do assunto 13
1.1 Fundamentos do pensamento cient�fico e surgimento da Biologia 13
1.2 Procedimentos em ci�ncia 14
O procedimento hipot�tico-dedutivo da ci�ncia, 14
A comunica��o em ci�ncia, 17
1.3 A Biologia como ci�ncia 18
A ci�ncia da vida: Biologia, 18
Caracter�sticas dos seres vivos, 19
O que � vida, 19
Composi��o qu�mica dos seres vivos, 19
Organiza��o celular, 20
Metabolismo, 20
Rea��o e movimento, 21
Crescimento e reprodu��o, 22
Hereditariedade, 22
Variabilidade gen�tica, sele��o natural e adapta��o, 23
N�veis de organiza��o biol�gica, 24
- Atividades 26
Cap�tulo 2 Origem da vida na Terra 30
� procura de nossas origens 30
A import�ncia do assunto 31
2.1 A origem do universo e do Sistema Solar 31
A teoria do big bang ou teoria da grande explos�o, 31
A origem do Sistema Solar, 32
A forma��o da Terra, 33
2.2 Como surgiu a vida na Terra? 34
A queda da teoria da gera��o espont�nea, 34
O experimento de Redi, 34
Needham versus Spallanzani, 35
Pasteur e a derrubada da abiog�nese, 36
Pesquisas sobre gera��o espont�nea levaram a novas tecnologias, 37
2.3 Ideias modernas sobre a origem da vida 37
A origem pr�-biol�gica dos precursores da vida, 37
Teoria da evolu��o molecular, 38
A origem das primeiras c�lulas vivas, 39
As hip�teses heterotr�fica e autotr�fica, 40
- Atividades 41
Cap�tulo 3 Bases moleculares da vida 44
A Qu�mica e a vida 44
A import�ncia do assunto 45
3.1 Componentes da mat�ria viva 45
3.2 �gua e sais minerais 47
Import�ncia da �gua para a vida, 47
A �gua como solvente, 47
A �gua nas rea��es qu�micas dos seres vivos, 47
A �gua como moderador de temperatura, 48
Import�ncia biol�gica da coes�o e da ades�o da �gua, 48
Sais minerais e sua import�ncia biol�gica, 49
3.3 Glic�dios e lip�dios 49
Caracter�sticas gerais dos glic�dios, 49
Classifica��o dos glic�dios, 50
Caracter�sticas gerais dos lip�dios, 50
Classifica��o dos lip�dios, 51
- Ci�ncia e cidadania: Colesterol e sa�de, 53
3.4 Prote�nas, vitaminas e �cidos nucleicos 54
O que s�o prote�nas?, 54
Liga��o pept�dica, 55
Em que diferem as prote�nas?, 55
Arquitetura das prote�nas, 55
Desnatura��o das prote�nas, 55
Fun��es das prote�nas, 56
Enzimas, 56
Cofatores e coenzimas, 57
Fatores que afetam a atividade das enzimas, 57
- Amplie seus conhecimentos: "Teste do pezinho", 58
O que s�o vitaminas?, 58
�cidos nucleicos, 60
Estrutura dos �cidos nucleicos, 61
- Atividades 62
M�DULO 2 Citologia 64
Cap�tulo 4 A descoberta das c�lulas 66
De que s�o feitos os seres vivos? 66
A import�ncia do assunto 67
4.1 A inven��o do microsc�pio 67
4.2 As partes fundamentais da c�lula 68
4.3 A teoria celular 69
4.4 O desenvolvimento da Citologia 69
A microscopia fot�nica (�ptica), 69
A qualidade dos microsc�pios, 70
Prepara��o de materiais para observa��o microsc�pica, 71
- Amplie seus conhecimentos: T�cnicas em Citologia, 72
A microscopia eletr�nica, 74
4.5 C�lulas procari�ticas e eucari�ticas 75
- Atividades 76
P�gina 8
Cap�tulo 5 Membrana celular e citoplasma 78
O mundo nanosc�pico 78
A import�ncia do assunto 79
5.1 Construindo o modelo atual de c�lula 79
A tridimensionalidade da c�lula viva, 80
5.2 Caracter�sticas das membranas biol�gicas (biomembranas) 81
Estrutura molecular das biomembranas, 81
Biomembranas e a permeabilidade celular, 82
Transporte passivo: difus�o e osmose, 83
Transporte ativo, 84
Transporte em bolsas membranosas, 85
5.3 Ret�culo endoplasm�tico 87
5.4 Complexo golgiense 88
5.5 Lisossomos e digest�o intracelular 89
- Ci�ncia e cidadania: Os pequenos lisossomos e seus grandes efeitos, 91
5.6 Sustenta��o celular: paredes e citoesqueleto 93
Parede celular, 93
Citoesqueleto, 93
5.7 Centr�olos, flagelos e c�lios 94
5.8 Mitoc�ndrias e plastos 95
Mitoc�ndrias: sede da respira��o aer�bica, 95
Cloroplasto: sede da fotoss�ntese, 96
- Atividades 97
Cap�tulo 6 N�cleo celular, mitose e s�ntese de prote�nas 102
Clones e a import�ncia do n�cleo celular 102
A import�ncia do assunto 103
6.1 Organiza��o do n�cleo interf�sico 103
Envelope nuclear (carioteca), 103
Cromatina e nucl�olo, 104
6.2 Caracter�sticas gerais dos cromossomos 104
A arquitetura do cromossomo, 105
Crom�tides-irm�s e centr�mero, 105
Cromossomos e genes, 106
Cromossomos hom�logos, 106
C�lulas diploides e c�lulas haploides, 107
Citogen�tica humana, 107
O cari�tipo humano, 108
- Ci�ncia e cidadania: Altera��es cromoss�micas na esp�cie humana, 109
6.3 Dividir para multiplicar: a divis�o celular 111
O ciclo celular, 111
Mitose, 112
Pr�fase, 112
Met�fase, 113
An�fase, 114
Tel�fase, 114
Citocinese, 115
- Ci�ncia e cidadania: O que � c�ncer?, 116
6.4 Cromossomos em a��o: duplica��o e transcri��o g�nicas 118
A estrutura molecular do DNA, 118
A duplica��o semiconservativa do DNA, 119
A s�ntese de RNA: transcri��o g�nica, 120
6.5 O mecanismo da s�ntese de prote�nas: tradu��o g�nica 121
Tipos de RNA e suas fun��es, 121
RNA mensageiro (RNAm), 122
RNA transportador (RNAt), 123
RNA riboss�mico (RNAr), 123
A s�ntese da cadeia polipept�dica, 124
In�cio da s�ntese da cadeia polipept�dica, 125
Crescimento da cadeia polipept�dica, 125
T�rmino da s�ntese da cadeia polipept�dica, 127
- Atividades 128
M�DULO 3 METABOLISMO ENERG�TICO 136
Cap�tulo 7 Fotoss�ntese e quimioss�ntese 138
Luzes sobre a fotoss�ntese 138
A import�ncia do assunto 139
7.1 Energia para a vida 139
ATP, a "moeda energ�tica" do mundo vivo, 140
7.2 O processo da fotoss�ntese 141
"Construindo" a equa��o da fotoss�ntese, 141
A s�ntese de ATP no cloroplasto: fotofosforila��o, 143
Fot�lise da �gua, 145
O ciclo das pentoses e a s�ntese de glic�dios, 145
Destino dos produtos da fotoss�ntese, 146
7.3 Quimioss�ntese 146
- Atividades 147
Cap�tulo 8 Fermenta��o e respira��o aer�bica 150
Respirar para qu�? 150
A import�ncia do assunto 151
8.1 Fermenta��o como forma de obter energia 151
Tipos de fermenta��o, 152
- Ci�ncia e cidadania: A import�ncia da fermenta��o para a humanidade, 153
8.2 A respira��o aer�bica 155
Rendimento e etapas da respira��o aer�bica, 155
Fase citoplasm�tica da respira��o: glic�lise, 155
Fase mitocondrial da respira��o aer�bica, 156
Ciclo de Krebs ou ciclo do �cido c�trico, 156
Fosforila��o oxidativa, 157
- Atividades 159

P�gina 9

M�DULO 4 REPRODU��O E DESENVOLVIMENTO 162


Cap�tulo 9 Tipos de reprodu��o, meiose e fecunda��o 164
Sexo e reprodu��o 164
A import�ncia do assunto 165
9.1 Tipos de reprodu��o 165
Processos assexuados de reprodu��o, 165
A import�ncia da reprodu��o sexuada, 166
9.2 Meiose e reprodu��o 167
Etapas da meiose, 168
Semelhan�as e diferen�as entre mitose e meiose, 168
Meiose I, 168
Meiose II, 170
- Ci�ncia e cidadania: Falhas na meiose e altera��es cromoss�micas, 172
9.3 Gametas e fecunda��o nos animais 173
Espermatog�nese em mam�feros, 173
Ovulog�nese em mam�feros, 173
A fecunda��o nos animais, 174
9.4 Meiose e ciclos de vida 176
Ciclo haplobionte diplonte, 176
Ciclo haplobionte haplonte, 176
Ciclo diplobionte, 177
- Atividades 178
Cap�tulo 10 Desenvolvimento embrion�rio animal 182
O empreendimento embrion�rio 182
A import�ncia do assunto 183
10.1 Segmenta��o e forma��o da bl�stula 183
Tipos de ovos e segmenta��o, 183
10.2 Gastrula��o 186
Forma��o dos folhetos germinativos, 186
10.3 Organog�nese 188
O est�gio de n�urula, 188
Tubo nervoso, 188
Notocorda, 189
Mesoderma e endoderma, 189
- Amplie seus conhecimentos: A embriologia do anfioxo como exemplo, 190
10.4 Anexos embrion�rios 193
Saco vitel�nico, 194
Alantoide, 194
�mnio, 194
C�rio, 194
Como se explica a presen�a de anexos embrion�rios em mam�feros?, 195
- Atividades 196
Cap�tulo 11 Reprodu��o humana 199
Beb�s de proveta e clonagem humana 199
A import�ncia do assunto 200
11.1 Sistema genital feminino 200
Pudendo feminino, 200
Vagina e �tero, 201
Tubas uterinas e ov�rios, 202
11.2 Sistema genital masculino 202
P�nis, escroto e test�culos, 202
Ductos deferentes e gl�ndulas acess�rias, 203
11.3 Horm�nios relacionados � reprodu��o 204
Gonadotrofinas: FSH e LH, 205
Estr�geno e progesterona, 205
Testosterona, 205
Controle hormonal do ciclo menstrual, 206
- Amplie seus conhecimentos: Homens e mulheres: compreender conceitos para vencer
preconceitos e estere�tipos, 208
11.4 Gravidez e parto 210
Fecunda��o e nida��o, 210
A placenta, 211
Fase fetal, 211
Parto, 213
- Amplie seus conhecimentos: Compartilhando o �tero materno: g�meos humanos, 214
- Ci�ncia e cidadania: O controle da reprodu��o humana, 217
- Atividades 220
Cap�tulo 12 A diversidade celular dos vertebrados 222
C�lulas-tronco e engenharia de tecidos 222
A import�ncia do assunto 223
12.1 A diversidade dos tecidos vivos 223
- Ci�ncia e cidadania: A import�ncia das c�lulas-tronco, 224
12.2 Tecido epitelial 225
Epit�lios de revestimento, 225
Epit�lios glandulares, 226
12.3 Tecido conjuntivo 226
Tecidos conjuntivos propriamente ditos, 227
Tecidos conjuntivos especiais, 228
Tecido adiposo, 228
Tecido cartilaginoso, 228
Tecido �sseo, 229
Tecido hematopoi�tico e sangue, 230
12.4 Tecido muscular 231
12.5 Tecido nervoso 232
- Atividades 234
Lista de siglas 237
Bibliografia 238
Sugest�es de livros, sites e v�deos 239

P�gina 10

M�dulo 1 A natureza da vida


Conhe�a os cap�tulos deste m�dulo
Compreender a natureza da ci�ncia, al�m de auxiliar na tomada de decis�es de
interesse p�blico em diversas �reas, leva a um melhor entendimento de como o
conhecimento cient�fico progride. Esse � um dos temas tratados no primeiro cap�tulo
deste m�dulo. Outros assuntos do cap�tulo 1 s�o as caracter�sticas que distinguem
os seres vivos dos materiais inanimados e os n�veis hier�rquicos da organiza��o
biol�gica, desde o n�vel submicrosc�pico at� o planet�rio. Nos dois cap�tulos
seguintes, discutimos como teria se originado a vida na Terra e quais s�o os
principais componentes qu�micos dos seres vivos.
Cap�tulo 1
O desenvolvimento das Ci�ncias Naturais levou a humanidade n�o apenas a melhorar a
compreens�o da natureza, mas tamb�m a interagir com ela em um n�vel nunca antes
imaginado. Compreender como o conhecimento cient�fico � constru�do e os alcances e
as limita��es da ci�ncia pode auxiliar os cidad�os a tomar decis�es de interesse
p�blico. Neste cap�tulo veremos, em linhas gerais, como o conhecimento cient�fico �
produzido e como a a��o conjunta da observa��o e da raz�o contribui para o
entendimento dos fatos da natureza. Apresentamos tamb�m um breve hist�rico das
origens da Biologia como ci�ncia e discutimos as dificuldades em definir "vida".
Cap�tulo 2
O cap�tulo apresenta resumidamente a vis�o cient�fica atual sobre as origens do
universo, da Terra e dos seres vivos. A maioria dos estudiosos acredita que as
subst�ncias precursoras da vida se formaram na Terra primitiva h� mais de 4 bilh�es
de anos, por um longo processo de evolu��o molecular. Como essas subst�ncias teriam
originado os primeiros seres vivos? Responder a essa quest�o ainda � um dos grandes
desafios da Biologia.
Cap�tulo 3
A aplica��o de conhecimentos advindos da Qu�mica permitiu reconhecer que a
organiza��o e a fisiologia dos seres vivos s�o determinadas pelos �tomos e
mol�culas que os constituem. A compreens�o da qu�mica da vida tem sido de
fundamental import�ncia para o avan�o da Biologia e para a melhoria da qualidade da
vida humana. Neste cap�tulo apresentamos a constitui��o molecular das principais
subst�ncias que comp�em a mat�ria viva.

CHRISTOPHE LEHENAFF/PHOTONONSTOP/DIOMEDIA
O desenvolvimento do conhecimento cient�fico deve-se muito a uma caracter�stica
inerente ao ser humano: a curiosidade. Quando nos questionamos sobre a ocorr�ncia
de determinado fen�meno e buscamos explica��es l�gicas para ele com base em fatos
da natureza, estamos procedendo cientificamente.

P�gina 11

Cap�tulo 1 Biologia: ci�ncia e vida


Itens principais:
- Fundamentos do pensamento cient�fico e surgimento da Biologia
- Procedimentos em ci�ncia
- A Biologia como ci�ncia

BABAK TAFRESHI/SCIENCE SOURCE/FOTOARENA


Cap�tulo 2 Origem da vida na Terra
Itens principais:
- A origem do universo e do Sistema Solar
- Como surgiu a vida na Terra?
- Ideias modernas sobre a origem da vida

NOAA GOES/NASA
Cap�tulo 3 Bases moleculares da vida
Itens principais:
- Componentes da mat�ria viva
- �gua e sais minerais
- Glic�dios e lip�dios
- Prote�nas, vitaminas e �cidos nucleicos

MARUO FERMARIELLO/SCIENCE PHOTO LIBRARY/LATINSTOCK

P�gina 12

Cap�tulo 1 Biologia: ci�ncia e vida

BABAK TAFRESHI/SCIENCE SOURCE/FOTOARENA


A ci�ncia procura explicar a natureza a partir da observa��o sistem�tica e
controlada dos fen�menos naturais, embasada no racioc�nio l�gico. O conhecimento
cient�fico do mundo tem possibilitado � humanidade compreender melhor as rela��es
entre os seres vivos e o ambiente, conectando-nos ao mundo que nos cerca.
Humanidade e ci�ncia
Antes de escrever a introdu��o deste livro, naveg�vamos pela internet, a rede
mundial de computadores, pesquisando o tema "humanidade e ci�ncia" em busca de uma
maneira de abordar a natureza da ci�ncia que pudesse motivar os estudantes. Em um
blog encontramos um di�logo curioso em que um dos interlocutores dizia mais ou
menos o seguinte:
"- Cad� a ci�ncia? Que benef�cios ela tem proporcionado � humanidade? Na �ltima
d�cada do s�culo XX dizia-se que, quando o DNA humano fosse totalmente sequenciado,
90% das doen�as deixariam de existir. Por�m, j� se passou mais de uma d�cada e nada
aconteceu. Por qu�? Como acreditar na ci�ncia depois disso? E mais: a ci�ncia dizia
que no s�culo XXI muita coisa seria diferente, mas tenho a impress�o de que tudo
piorou: s� se produziram mais armas e melhores. Basta lembrar que a ci�ncia criou a
bomba at�mica!"
O outro interlocutor retrucava:
"- Infelizmente estamos bem longe de concretizar nossos sonhos. Mas n�o seja t�o
injusto com a ci�ncia! N�o se esque�a de que devemos muito a ela, como a
possibilidade de nos comunicar com amigos ou parentes que est�o do outro lado do
planeta ou a preven��o de doen�as como o sarampo. Isso sem falar da erradica��o de
uma doen�a t�o perigosa como a var�ola. E outra: voc� sabe como ocorrem as
pesquisas cient�ficas? Por exemplo: antes de estar dispon�vel, um medicamento ou
tratamento precisa passar por 10 anos de pesquisas e mais 15 anos de testes
rigorosos. Com certeza voc� n�o sabia disso. Se soubesse, n�o teria dito tanta
bobagem. Voc� est� vendo apenas o lado negativo das coisas. Atualize-se! Ou voc�
gostaria de voltar � Idade M�dia?"
O que achou do di�logo? O primeiro interlocutor est� claramente desencantado com o
alardeado poder da ci�ncia em construir um mundo melhor. Ele, inclusive, se referiu
ao Projeto Genoma Humano e citou alguns n�meros para justificar sua argumenta��o.
Ser� que seus pressupostos est�o corretos? Qual � a sua opini�o a respeito?

P�gina 13

A import�ncia do assunto
Para entender e discutir a import�ncia da ci�ncia, precisamos conhecer as bases do
pensamento cient�fico e os m�todos que os cientistas utilizam em seu trabalho. Al�m
disso, tamb�m � preciso conhecer um pouco da hist�ria da ci�ncia e ter informa��es
sobre as atualidades cient�ficas mais relevantes para a humanidade.
Por exemplo, o Projeto Genoma Humano, mencionado no blog, tornou-se um dos �cones
da ci�ncia contempor�nea. Entretanto, ao considerar como certa a cura de doen�as
pelo simples fato de se elucidar o genoma humano, algumas pessoas se decepcionaram
com a aparente falta de resultados desses estudos. Outras, mais realistas, acham
que ainda � cedo para esse tipo de resultado. N�s, particularmente, concordamos com
estas �ltimas. O estudo sobre o genoma de seres humanos, de outros animais, de
plantas e de outros seres vivos j� trouxe diversos novos conhecimentos importantes,
muitos deles com aplica��es futuras na melhoria da sa�de e da qualidade de vida. E
certamente muitos outros resultados positivos surgir�o em breve.
Neste primeiro cap�tulo, o principal objetivo � tornar mais clara a natureza da
ci�ncia e compreender o papel da observa��o, da formula��o de hip�teses e da
experimenta��o na produ��o do conhecimento cient�fico.
Ao longo dos demais cap�tulos do livro, voc� poder� relembrar os conhecimentos aqui
expostos e ampli�-los. � medida que for estudando, ter� a oportunidade de aplicar
esses conhecimentos para compreender melhor a import�ncia social da ci�ncia.
Compreender a natureza do conhecimento cient�fico, bem como de seus alcances e
limita��es, ajuda-nos a pensar socialmente e a tomar decis�es de interesse pessoal
e p�blico.
1.1 Fundamentos do pensamento cient�fico e surgimento da Biologia
Voc� � dessas pessoas curiosas que observam o mundo atentamente, procurando
compreend�-lo? Leva sempre em conta o que j� se conhece sobre determinado assunto
antes de tirar suas conclus�es? Em caso afirmativo, voc� segue alguns dos
princ�pios do procedimento empregado pelos cientistas para fazer ci�ncia. Mas o que
� ci�ncia, afinal?
Em linhas gerais, pode-se definir ci�ncia como um m�todo rigoroso de investiga��o
da natureza cujo objetivo � fornecer explica��es para fen�menos naturais. Nessa
empreitada, o cientista utiliza determinados procedimentos que se assemelham aos
empregados pelos detetives em suas investiga��es. A ci�ncia procura explicar a
natureza a partir da observa��o sistem�tica e controlada dos fen�menos naturais,
embasada no racioc�nio l�gico. Al�m disso, o procedimento cient�fico assume que
toda explica��o para um fen�meno natural deve ser sempre submetida a testes e
cr�ticas.
Os cientistas observam cuidadosamente os fatos e tentam explic�-los dentro de
determinado contexto. Fato � um objeto ou um processo do mundo natural que podemos
perceber objetivamente com nossos sentidos ou com o aux�lio de instrumentos que os
expandem, como microsc�pios e telesc�pios. A partir da observa��o controlada de
determinados fatos, os cientistas procuram entender se h� rela��o entre eles e como
ou por que determinados fen�menos ocorrem. Pode-se dizer que o m�todo que os
cientistas utilizam na atividade cient�fica � uma extens�o sofisticada de
procedimentos l�gicos a que recorremos em nossa vida cotidiana para descobrir como
as coisas funcionam ou por que elas acontecem. Por exemplo, quando observamos
determinado acontecimento e temos um "palpite" do motivo pelo qual ele est�
ocorrendo, estamos elaborando o que os cientistas chamam de hip�tese.

P�gina 14

Voc� liga o aparelho de TV e ele n�o funciona. Seu primeiro palpite talvez seja que
a televis�o n�o est� ligada � tomada. Para testar essa hip�tese, basta verificar se
o cabo de alimenta��o de energia est� ligado � tomada; se estiver, voc� rejeitar�
essa hip�tese e formular� outra: por exemplo, falta energia el�trica. Para testar
essa nova hip�tese, voc� poderia, por exemplo, tentar acender uma l�mpada ou ligar
outro aparelho el�trico. Em nosso dia a dia, essas atitudes podem ajudar a tomar
decis�es. O procedimento cient�fico � uma ferramenta poderosa � nossa disposi��o e
pode nos ajudar a melhorar nossa compreens�o do mundo.
No cotidiano, o termo hip�tese � muitas vezes usado como sin�nimo de "teoria", mas
h� uma grande diferen�a entre eles. Hip�tese � uma tentativa de explica��o para um
determinado fen�meno isolado, enquanto teoria � uma ideia ampla, uma esp�cie de
modelo que explica coerentemente um conjunto de observa��es e fatos abrangentes da
natureza. Teorias s�o vis�es amplas de como o mundo funciona; elas d�o sentido ao
que vemos e � com base nelas que elaboramos hip�teses sobre fatos observados. A
teoria celular, por exemplo, procura explicar a vida com base em informa��es sobre
a estrutura e o funcionamento das c�lulas. A teoria da gravita��o universal de
Newton procurava explicar os movimentos dos corpos celestes com base na for�a de
atra��o gravitacional. (Fig. 1.1)

Wally McNamee/Corbis/Latinstock
Figura 1.1 O paleont�logo estadunidense Stephen J. Gould (1941-2002) foi
reconhecido internacionalmente como um dos maiores divulgadores de ci�ncia dos
�ltimos tempos. O humor refinado e a ironia de Gould transparecem no texto sobre
fatos e teorias, publicado em 1981: "[...] E fatos e teorias s�o coisas diferentes
e n�o degraus de uma hierarquia de certeza crescente. Os fatos s�o os dados do
mundo. As teorias s�o estruturas de ideias que explicam e interpretam os fatos. Os
fatos n�o se afastam enquanto os cientistas debatem teorias rivais. A teoria da
gravita��o de Einstein tomou o lugar da de Newton, mas as ma��s n�o ficaram
suspensas no ar, aguardando o resultado [...]"1.
1.2 Procedimentos em ci�ncia
O procedimento hipot�tico-dedutivo da ci�ncia
O conhecimento cient�fico em geral come�a com uma pergunta: "por que tal fen�meno
ocorre?" ou "que rela��o determinado fen�meno tem com outro?". Quando formulam
essas perguntas, os cientistas geralmente j� t�m uma hip�tese sobre elas, apoiando-
se nas informa��es existentes sobre o assunto e em teorias cient�ficas que, como
comentamos, s�o ideias e modelos de como o mundo funciona. Para formular uma
hip�tese, o cientista primeiramente analisa, interpreta e re�ne o maior n�mero
poss�vel de informa��es dispon�veis sobre o assunto em estudo.
Para ser v�lida, uma hip�tese cient�fica tem que ser test�vel, ou seja, tem que
possibilitar um teste l�gico ou experimental. O teste da hip�tese consiste em
imaginar uma situa��o em que determinados fatos e consequ�ncias somente ocorrer�o
se a hip�tese testada for verdadeira. Em outras palavras, a partir da hip�tese o
cientista faz dedu��es, prevendo o que ocorreria na situa��o imaginada caso a
hip�tese seja verdadeira. Essa metodologia, denominada hipot�tico-dedutiva, � a
base da maioria dos procedimentos cient�ficos.
Em certos casos, os cientistas elaboram situa��es especiais para testar suas
hip�teses, o que se denomina experimenta��o. As situa��es experimentais, ou
experimentos, permitem confirmar ou refutar as dedu��es elaboradas com base nas
hip�teses. Se os resultados de experimentos, de observa��es controladas e mesmo de
simula��es matem�ticas mostrarem que as dedu��es s�o incorretas, o cientista
retrocede um passo e modifica ou substitui a hip�tese inicial. Se as dedu��es se
confirmarem, a hip�tese ganha credibilidade e � aceita, enquanto n�o houver motivos
para duvidar dela.
1 Tradu��o dos autores. O texto pode ser lido na �ntegra em: GOULD, S. J., 1981.
Dispon�vel em: <http://www.stephenjaygould.org/library/gould_fact-and-theory.html>.
Acesso em: fev. 2016.

P�gina 15

De forma resumida e simplificada, o procedimento adotado pelos cientistas para


investigar a natureza geralmente segue estes passos l�gicos:
1. proposi��o de uma pergunta sobre determinado assunto;
2. formula��o de uma hip�tese;
3. levantamento de dedu��es com base na hip�tese;
4. teste das dedu��es por meio de novas observa��es ou de experimentos;
5. conclus�es sobre a validade ou n�o da hip�tese.
Um exemplo ilustrativo e, ao mesmo tempo, hist�rico de procedimento cient�fico
refere-se ao experimento realizado por Charles Darwin (1809-1882) e seu filho
Francis Darwin (1848-1925), h� mais de 100 anos. Eles investigaram um fato
corriqueiro que voc� pode j� ter notado, de as plantas curvarem-se em dire��o �
luz. (Fig. 1.2)

MARTIN SHIELDS/SCIENCE SOURCE/FOTOARENA


Figura 1.2 Vaso com feij�o (Phaseolus vulgaris) curvando-se para um dos lados. � um
fato facilmente observ�vel que as plantas percebem a fonte de luz e crescem em
dire��o a ela. O que aconteceria, ap�s alguns dias, se gir�ssemos o vaso da
fotografia em 180�?
Com base em suas observa��es, Charles e Francis Darwin formularam a hip�tese de que
a luz � percebida pela extremidade do caule das plantas. A partir dessa hip�tese,
eles fizeram a seguinte dedu��o: se � realmente a extremidade da planta que percebe
a luz, plantas que tivessem suas extremidades eliminadas ou cobertas com uma
prote��o � prova de luz deixariam de se curvar em dire��o � fonte luminosa. Para
testar essa hip�tese, os pesquisadores cortaram as extremidades de algumas plantas
jovens de alpiste e as colocaram perto de uma fonte de luz; ao lado, plantas
intactas serviam de compara��o. Alguns dias depois, os cientistas verificaram que
as plantas intactas haviam se curvado em dire��o � luz, enquanto as plantas
"decapitadas" continuavam eretas, sem se curvar.
Em outra experi�ncia, os dois cientistas cobriram as extremidades de plantas com
papel preto � prova de luz e compararam o comportamento delas com o de plantas que
tiveram o papel preto colocado sobre outras partes que n�o as extremidades. As
plantas com extremidades cobertas, assim como as decapitadas, mantiveram-se eretas,
enquanto as plantas com outras regi�es cobertas se curvaram em dire��o � fonte de
luz. Como o resultado das experi�ncias confirmou a previs�o, a hip�tese adquiriu
validade. (Fig. 1.3)

JURANDIR RIBEIRO
Figura 1.3 Representa��o esquem�tica dos experimentos de Charles e Francis Darwin:
o desenho 1 representa o ocorrido com o grupo de plantas que foram mantidas
intactas: elas curvaram-se em dire��o � fonte de luz. O desenho 2 representa as
plantas que tiveram as extremidades removidas e permaneceram eretas. O desenho 3
representa o grupo de plantas que tiveram suas extremidades cobertas por papel �
prova de luz e que tamb�m se mantiveram eretas, tal qual as plantas decapitadas. O
desenho 4 representa as plantas que tiveram outras partes do caule, que n�o a
extremidade, cobertas por papel � prova de luz e que se curvaram, como as plantas
do grupo 1. (Elementos fora de propor��o de tamanho entre si; cores-fantasia.)

P�gina 16

Quando uma hip�tese � testada por meio da experimenta��o, comparam-se os resultados


obtidos em grupos experimentais - aqueles em que se provoca a altera��o - com os
obtidos em grupos de controle, nos quais n�o h� interven��o. Nos experimentos de
Charles e Francis Darwin, por exemplo, os grupos experimentais eram as plantas
decapitadas e com a extremidade coberta com papel � prova de luz. As plantas
intactas e aquelas em que a cobertura de papel preto n�o estava nas extremidades
constitu�am os grupos de controle, que permitiram aos pesquisadores avaliar os
resultados da interven��o e validar ou n�o as hip�teses.
Diversas outras perguntas podem ter ocorrido a Francis e Charles Darwin durante o
experimento, por exemplo: "De que modo a planta percebe a luz?" ou "Que mecanismo
faz a planta se curvar?". Quest�es como essas ilustram algo que ocorre com
frequ�ncia em ci�ncia: os experimentos, al�m de testar hip�teses, acabam por
levantar novas quest�es, para as quais ser�o elaboradas outras hip�teses,
acompanhadas de novos experimentos para test�-las; � assim que o conhecimento
cient�fico progride.
Um exemplo corriqueiro de procedimento cient�fico pode ser encontrado na pr�tica de
proteger frutos em desenvolvimento com saquinhos para evitar a infesta��o por
"bichos". Acompanhe no infogr�fico a seguir as etapas do procedimento cient�fico
nessa atividade comum em fruticultura. (Fig. 1.4)

SIMONKA
Figura 1.4 Representa��o de um experimento para testar a hip�tese de que os bichos
de goiaba s�o, na verdade, larvas de moscas. (Elementos fora de propor��o de
tamanho entre si; cores-fantasia.)
P�gina 17

A comunica��o em ci�ncia
Uma das exig�ncias da ci�ncia � que as ideias e as conclus�es cient�ficas se tornem
p�blicas, de modo que possam ser criticadas por qualquer pessoa. Teorias, hip�teses
e leis s� passam a fazer parte integrante do corpo da ci�ncia se forem publicadas,
na forma de artigo, em uma revista especializada, credenciada pela comunidade
cient�fica. Esse tipo de publica��o � imprescind�vel, pois d� credibilidade �s
informa��es levantadas, permitindo consultas e cr�ticas.
As revistas cient�ficas s�o publica��es peri�dicas, geralmente vinculadas e
subvencionadas por sociedades cient�ficas ou institui��es de pesquisa. Os editores
de revistas cient�ficas s�o pesquisadores renomados em sua �rea de atua��o, cuja
fun��o � avaliar se os artigos preenchem os requisitos m�nimos para a publica��o.
Nesse trabalho, eles s�o auxiliados por outros cientistas que atuam como �rbitros,
em geral anonimamente, com a incumb�ncia de analisar os trabalhos cient�ficos
apresentados e recomendar sua aceita��o com eventuais corre��es, ou mesmo sugerir
sua rejei��o. Essa avalia��o pr�via dos artigos cient�ficos tem por objetivo
excluir banalidades e excentricidades e verificar o ineditismo, a relev�ncia, a
qualidade e a adequa��o da investiga��o apresentada. Esse procedimento, conhecido
como julgamento por pares, evita que a autoridade e a fama de um pesquisador sejam,
por si s�, suficientes para a aceita��o de uma ideia dentro da ci�ncia. Qualquer
pesquisador, seja ele um iniciante ou um cientista consagrado, passar� pelo mesmo
processo de julgamento sempre que quiser publicar seus trabalhos e ideias em uma
revista cient�fica conceituada. (Fig. 1.5)

REPRODU��O
REPRODU��O
Figura 1.5 Capas da revista estadunidense Science, publicada pela American
Association for the Advance of Science, e da revista brasileira Genetics and
Molecular Biology, publicada pela Sociedade Brasileira de Gen�tica. Science � uma
das mais conceituadas revistas cient�ficas do mundo e publica artigos em diversas
�reas das Ci�ncias Naturais; Genetics and Molecular Biology � especializada na
publica��o de artigos na �rea da Gen�tica.
Um artigo cient�fico geralmente apresenta a seguinte estrutura��o: introdu��o,
material e m�todos, resultados, discuss�o e refer�ncias bibliogr�ficas. A
introdu��o tem a finalidade de situar o tema em estudo, apresentando os objetivos
da investiga��o realizada, as hip�teses a serem testadas e estudos relacionados j�
publicados em revistas cient�ficas. O item relativo a material e m�todos descreve
em detalhes os procedimentos utilizados na investiga��o, de modo que, em uma
eventual repeti��o, possam ser obtidos os mesmos resultados. No item referente aos
resultados, relata-se minuciosamente o que foi observado durante os estudos. A
discuss�o visa analisar criticamente o trabalho realizado e as hip�teses testadas,
confrontando os resultados obtidos com o conhecimento vigente apresentado em outras
publica��es e avaliando a contribui��o do estudo em quest�o ao panorama cient�fico.
O t�pico de refer�ncias bibliogr�ficas relaciona todos os artigos e livros
consultados durante o trabalho, com indica��o dos respectivos autores, nome da
revista, volume, p�ginas e data de publica��o.
Conv�m destacar que artigos veiculados em jornais, em revistas de divulga��o
cient�fica ou em livros n�o s�o compar�veis aos publicados em revistas cient�ficas
especializadas, uma vez que n�o s�o submetidos ao julgamento por especialistas
credenciados pela comunidade cient�fica. Publica��es em jornais e revistas, assim
como programas de televis�o sobre ci�ncia, desempenham papel importante na
populariza��o do conhecimento cient�fico, mas n�o trazem novos conhecimentos �
ci�ncia. Essas publica��es s�o muitas vezes redigidas por jornalistas
especializados, que se empenham em interpretar artigos de revistas cient�ficas para
os leitores leigos. Livros did�ticos de Ci�ncias, como este, tamb�m n�o t�m por
objetivo agregar ideias originais ao conhecimento cient�fico. Seu papel �
apresentar, de forma organizada e coerente, as ideias centrais vigentes em
determinada �rea do conhecimento para ajudar os estudantes a compreender e a
integrar conceitos fundamentais que lhes permitir�o desenvolver uma vis�o
cient�fica do mundo.

P�gina 18

1.3 A Biologia como ci�ncia


A ci�ncia da vida: Biologia
At� o s�culo XVIII os cientistas ainda n�o tinham uma vis�o unificada dos seres
vivos e dos processos biol�gicos, classificando as entidades da natureza em tr�s
grandes reinos: animal, vegetal e mineral. Essa separa��o mostra que os vegetais
eram considerados t�o diferentes dos animais quanto estes s�o diferentes dos
minerais.
O grande avan�o do conhecimento sobre a natureza, ao longo do s�culo XVIII, mostrou
que animais e vegetais compartilham caracter�sticas que os distinguem completamente
dos minerais. Essas caracter�sticas s�o, principalmente, a organiza��o corporal
complexa e a capacidade de crescer, de se reproduzir e de morrer. Com base nesses
par�metros, o naturalista franc�s Lamarck prop�s, em 1778, a divis�o da natureza em
dois grandes grupos: o dos minerais, que ele chamou de seres inorg�nicos (sem
organiza��o), e o dos animais e vegetais, denominados seres org�nicos (com
organiza��o corporal). Assim surgia a Biologia como ci�ncia. (Fig. 1.6)

WELLCOME LIBRARY, LONDON


REPRODU��O - COLLECTION OF PORTRAITS/MUSEUM F�R NATURKUNDE, BERLIN
LORENZ OKEN - COLE��O PARTICULAR
Figura 1.6 A. Retrato de Jean-Baptiste de Lamarck (1744-1829). B. Retrato de
Gottfried Reinhold Treviranus (1776-1837). C. Retrato de Lorenz Oken (1779-1851).
Esses estudiosos, al�m de outros, utilizaram, de modo independente e quase
simultaneamente, o termo Biologia (do grego bios, vida, e logos, estudo) para
designar a nova ci�ncia que surgia na virada do s�culo XVIII para o XIX e que tinha
como objetivo o estudo dos seres vivos. Lamarck, em particular, tamb�m elaborou uma
teoria sobre a evolu��o dos seres vivos que influenciou o naturalista Charles
Darwin.
A partir do s�culo XIX, a Biologia tornou-se um campo de pesquisa reconhecido e
independente dentro das Ci�ncias Naturais, passando a empregar os procedimentos que
caracterizam a ci�ncia moderna. No s�culo XXI, a Biologia tem ocupado um papel de
destaque entre as ci�ncias na busca de solu��es para grandes desafios da
humanidade. O principal deles �, sem d�vida, a sustentabilidade, que � a capacidade
de manter a harmonia entre a nossa esp�cie e os outros seres e os recursos do
planeta, de modo a garantir a sobreviv�ncia e o bem-estar das gera��es futuras.
Conhecer a trama da vida � fundamental para que possamos atuar, como cidad�os
conscientes, na busca de solu��es para a preserva��o dos ambientes naturais da
Terra. Novos campos de pesquisa biol�gica, como a Biotecnologia e a Engenharia
Gen�tica, t�m proporcionado � humanidade certo poder de modificar a natureza. Hoje
� poss�vel, por exemplo, criar variedades de organismos antes inexistentes,
produzir c�pias id�nticas de um organismo adulto ou mesmo prever doen�as antes que
elas se manifestem. Cabe � sociedade decidir se esses conhecimentos devem ser
utilizados ou n�o, e esse � um dos motivos pelos quais voc�, como cidad�o, precisa
conhecer os fundamentos das Ci�ncias Biol�gicas. Al�m disso, ao estudar Biologia,
entramos em contato com o modo cient�fico de pensar e de proceder, o que poder�
trazer mudan�as positivas em nossa vida.

P�gina 19

Caracter�sticas dos seres vivos


O que � vida?
Este t�pico pode ser considerado um "aquecimento" para iniciar o curso de Biologia;
a discuss�o dos conceitos b�sicos apresentados pode ser �til para detectar
concep��es e conceitos imprecisos ou equivocados, assim como para diagnosticar
outras dificuldades dos estudantes.
Muitos bi�logos t�m se empenhado no desafio de definir "vida"; entretanto, nenhuma
das defini��es formuladas at� hoje � plenamente satisfat�ria. Entre as diversas
tentativas de caracterizar e definir vida, podemos citar algumas que consideramos
mais elucidativas. Por exemplo, em 1959, o geneticista estadunidense Norman
Horowitz (1915-2005) sugeriu que a vida "caracteriza-se por autorreplica��o,
mutabilidade e troca de mat�ria e energia com o meio ambiente". Em 1986, o bi�logo
evolucionista ingl�s John Maynard Smith (1920-2004) considerou que "[...] entidades
com propriedades de multiplica��o, varia��o e hereditariedade s�o vivas, e
entidades que n�o apresentam uma ou mais dessas propriedades n�o o s�o". O
bioqu�mico evolucionista Jeffrey S. Wicken (1942-2002), em 1987, definiu vida como
"uma hierarquia de unidades funcionais que, por meio da evolu��o, t�m adquirido a
habilidade de armazenar e processar a informa��o necess�ria para sua pr�pria
reprodu��o".
A dificuldade em definir "vida" de maneira sint�tica deve-se � pr�pria complexidade
do fen�meno vida, que se manifesta de muitas formas, na enorme diversidade de
esp�cies biol�gicas da natureza. Como a vida n�o tem um tra�o distintivo �nico, e
sim v�rios, em diferentes n�veis, isso acaba criando defini��es longas e complexas,
que tentam abranger todas, ou a maioria, das caracter�sticas fundamentais da vida.
H� cientistas eminentes que consideram imposs�vel definir claramente o fen�meno
vida. Entre estes �ltimos, destaca-se o zo�logo alem�o, naturalizado estadunidense,
Ernst Mayr (1904-2005), que, em 1982, escreveu: "Tentativas foram feitas
repetidamente para definir 'vida'. Esses esfor�os s�o um tanto f�teis, visto que
agora est� inteiramente claro que n�o h� uma subst�ncia, um objeto ou uma for�a
especial que possa ser identificada � vida". Apesar de n�o achar poss�vel definir
"vida", Ernst Mayr admite a possibilidade de definir o que ele chama de "processo
da vida". Diz ele: "O processo da vida, contudo, pode ser definido. N�o h� d�vida
de que os organismos vivos possuem certos atributos que n�o s�o encontrados [...]
em objetos inanimados". (Fig. 1.7)

BRUNI MEYA/AKG-IMAGES/NEWSCOM/FOTOARENA
Figura 1.7 Ernst Walter Mayr (1904-2005) foi um dos mais importantes bi�logos do
s�culo XX. Ornit�logo e historiador da ci�ncia, ele foi um dos art�fices de uma das
mais difundidas defini��es de esp�cie biol�gica e da importante revolu��o
conceitual que ficou conhecida como teoria sint�tica da evolu��o. Entre sua extensa
produ��o cient�fica, destacam-se in�meros livros que tratam de quest�es cruciais da
Biologia.
Entre os atributos mais t�picos dos seres vivos, destacam-se: composi��o qu�mica,
organiza��o celular, metabolismo, rea��o e movimento, crescimento e reprodu��o,
hereditariedade, variabilidade gen�tica, sele��o natural e adapta��o. A seguir,
vamos analisar cada um desses atributos da vida.
Composi��o qu�mica dos seres vivos
A mat�ria componente dos seres vivos � constitu�da de �tomos, assim como a mat�ria
que constitui as entidades n�o vivas. Isso significa que a mat�ria viva est�
sujeita �s mesmas leis naturais que regem o universo conhecido. Na mat�ria viva,
por�m, certos tipos de elemento qu�mico sempre est�o presentes. S�o eles: carbono
(C), hidrog�nio (H), oxig�nio (O) e nitrog�nio (N); em menor propor��o, f�sforo (P)
e enxofre (S).
Dezenas, centenas e mesmo milh�es de �tomos desses e de outros elementos qu�micos,
unidos por meio de liga��es qu�micas, formam as mol�culas constituintes dos seres
vivos, genericamente chamadas de mol�culas org�nicas. Essas mol�culas s�o
geralmente constitu�das por longas sequ�ncias de �tomos de carbono interligados,
aos quais est�o unidos �tomos de outros elementos componentes da mol�cula. Os
principais tipos de mol�culas org�nicas s�o as prote�nas, os glic�dios, os lip�dios
e os �cidos nucleicos.

P�gina 20

Organiza��o celular
Os seres vivos possivelmente s�o as entidades mais complexas do universo. Basta
dizer que, no espa�o microsc�pico de uma c�lula viva podem estar reunidos at� 35
elementos qu�micos dos 89 elementos que ocorrem na natureza. Tal concentra��o e
organiza��o de elementos qu�micos n�o ocorrem em objetos n�o vivos. Al�m disso, os
elementos qu�micos que comp�em os seres vivos est�o organizados em milhares de
subst�ncias org�nicas diferentes. Essas subst�ncias, distribu�das e combinadas de
forma tamb�m altamente organizada, constituem as c�lulas, consideradas as unidades
fundamentais da vida.
H� dois tipos b�sicos de c�lulas: procari�ticas e eucari�ticas. A c�lula
procari�tica � relativamente mais simples que a eucari�tica e em seu interior
geralmente n�o h� compartimentos membranosos. A c�lula eucari�tica apresenta
in�meros compartimentos e estruturas membranosas internas, que desempenham fun��es
espec�ficas como digest�o, transporte e armazenamento de subst�ncias. Al�m disso, a
c�lula eucari�tica tem um compartimento especial, o n�cleo, no qual se localiza o
material gen�tico que constitui os genes; nas c�lulas procari�ticas, por sua vez, o
material heredit�rio encontra-se livre no conte�do celular. Apenas bact�rias e
arqueas t�m c�lulas procari�ticas; todos os demais seres vivos - protozo�rios,
algas, fungos, plantas e animais - t�m c�lulas eucari�ticas.
A figura a seguir mostra cortes de uma bact�ria e de um leuc�cito humano (c�lula do
sangue tamb�m conhecida como gl�bulo branco) ao microsc�pio eletr�nico de
transmiss�o. Nas imagens � poss�vel notar a diferen�a entre a organiza��o interna
de c�lulas procari�ticas e eucari�ticas. Para obter fotografias como estas, os
pesquisadores mergulham as c�lulas em um l�quido especial, denominado fixador, que
as mata rapidamente preservando sua estrutura interna, como se fosse uma esp�cie de
mumifica��o. Em seguida, as c�lulas fixadas s�o embebidas em uma resina que, ao
endurecer, permite cort�-las em fatias fin�ssimas; para isso, � utilizado um
aparelho especial de corte denominado micr�tomo. As fatias do material biol�gico
s�o, ent�o, observadas e fotografadas no microsc�pio eletr�nico. Detalhes do
procedimento de prepara��o de c�lulas para observa��o microsc�pica, assim como do
funcionamento dos microsc�pios, s�o tratados no cap�tulo 4 deste livro. (Fig. 1.8)

DR. KARI LOUNATMAA/SCIENCE PHOTO LIBRARY/LATINSTOCK


STEVE GSCHMEISSNER/SCIENCE PHOTO LIBRARY/LATINSTOCK
Figura 1.8 A. Fotomicrografia de bact�ria Vibrio cholerae, uma c�lula procari�tica.
(Microsc�pio eletr�nico de transmiss�o; aumento ? 40.000�; cores artificiais.) B.
Fotomicrografia de linf�cito humano, uma c�lula eucari�tica. (Microsc�pio
eletr�nico de transmiss�o; aumento ? 9.000�; cores artificiais.) Note a grande
complexidade da c�lula eucari�tica, em que se destacam o n�cleo e outras estruturas
membranosas no interior celular; a c�lula procari�tica n�o apresenta estruturas
membranosas internas.
Metabolismo
A maioria das subst�ncias presentes nas c�lulas � constantemente degradada e
substitu�da por subst�ncias rec�m-fabricadas. Essa atividade intracelular de
montagem e desmontagem de subst�ncias requer energia, que a c�lula obt�m pela
degrada��o de certos tipos de mol�culas org�nicas, genericamente chamadas de
nutrientes energ�ticos. Al�m de fornecer a energia necess�ria � manuten��o da vida,
esses nutrientes fornecem mat�ria-prima para a c�lula produzir

P�gina 21

novas mol�culas. Todas essas atividades de transforma��o qu�mica que ocorrem no


interior de uma c�lula constituem o metabolismo, palavra de origem grega (metabole)
que significa mudan�a ou transforma��o. (Fig. 1.9)

OLIVEROMG/SHUTTERSTOCK
Figura 1.9 A manuten��o da vida de um ser vivo, assim como todas as atividades que
ele realiza - por exemplo, a pr�tica de esportes -, depende das transforma��es
qu�micas que ocorrem em suas c�lulas e que constituem o metabolismo.
Rea��o e movimento
Os animais s�o capazes de perceber o que se passa ao seu redor e de reagir a
diferentes tipos de est�mulo. A rea��o quase sempre envolve a realiza��o de
movimentos. Por exemplo, o cheiro de um le�o levado pelo vento � captado pelo
apurado olfato dos ant�lopes e provoca sua fuga imediata. A capacidade de se
movimentar r�pida e ativamente, correndo, voando ou nadando, permite � maioria dos
animais explorar o ambiente � procura de alimento, de abrigo e de condi��es
adequadas � sobreviv�ncia.
Plantas tamb�m reagem a est�mulos. Por�m, as rea��es vegetais s�o bem mais lentas
que as dos animais. Por exemplo, a maioria das plantas altera a posi��o das folhas
no decorrer do dia e, em certas esp�cies, as folhas chegam mesmo a acompanhar a
trajet�ria aparente do Sol, o que lhes possibilita aproveitar melhor a
luminosidade. Algumas poucas esp�cies de plantas apresentam rea��es relativamente
r�pidas, como ocorre na sensitiva (Mimosa pudica) e em certas plantas "carn�voras",
cujas folhas se fecham rapidamente ao serem tocadas. (Fig. 1.10)

FOTOS: DAVID SIEREN/VISUALS UNLIMITED, INC./GLOW IMAGES


Figura 1.10 A rea��o das folhas da planta sensitiva (Mimosa pudica) ao toque � um
exemplo extremo da resposta das plantas a est�mulos. As folhas (A), ao serem
tocadas (B), fecham-se em fra��o de segundo (C).

P�gina 22

Entre os seres microsc�picos, muitos s�o capazes de perceber as condi��es


ambientais, movimentando-se ativamente em resposta a determinados est�mulos. Certas
algas, protozo�rios e bact�rias apresentam filamentos m�veis (flagelos ou c�lios)
que atuam como nadadeiras microsc�picas e permitem deslocamento em meio l�quido.
Embora a rea��o a est�mulos e a movimenta��o ativa sejam caracter�sticas da maioria
dos seres vivos, sobretudo dos animais, h� formas de vida que n�o reagem a
est�mulos nem s�o capazes de se movimentar ativamente. � o caso de certos tipos de
bact�ria que somente se deslocam passivamente quando transportados pela �gua, pelo
ar ou por outros seres vivos.
Crescimento e reprodu��o
Todo ser vivo cresce. Alguns minerais tamb�m podem crescer, mas por processos
completamente diferentes dos que ocorrem nos seres vivos; certos cristais, por
exemplo, podem aumentar de tamanho pela simples agrega��o de mat�ria. O crescimento
de um ser vivo, por sua vez, ocorre sempre pela produ��o organizada de subst�ncias
por meio do metabolismo celular.
Seres vivos constitu�dos por uma �nica c�lula - bact�rias, protozo�rios, algumas
algas e uns poucos fungos -, chamados de unicelulares, crescem pelo aumento do
tamanho de sua �nica c�lula. Esta cresce at� atingir determinado tamanho, podendo
eventualmente se dividir em duas c�lulas menores, semelhantes � original. Nesse
caso, a divis�o da c�lula em duas corresponde ao pr�prio processo de reprodu��o.
Os seres vivos constitu�dos por mais de uma c�lula (desde poucas dezenas at�
bilh�es ou trilh�es), chamados de seres multicelulares ou pluricelulares, surgem a
partir de uma �nica c�lula que se multiplica ou a partir de um grupo de c�lulas que
se desprende do corpo de um indiv�duo preexistente, crescendo principalmente pelo
aumento do n�mero de c�lulas do corpo.
Os bi�logos costumam distinguir dois modos b�sicos de reprodu��o: assexuada e
sexuada. Reprodu��o assexuada � aquela em que um novo ser surge a partir de uma
c�lula ou de um grupo de c�lulas produzido por um �nico indiv�duo genitor. Nesse
caso, os organismos filhos recebem as mesmas instru��es gen�ticas presentes no
genitor e geralmente s�o id�nticos a ele. Reprodu��o sexuada � aquela em que um
novo ser surge a partir de uma �nica c�lula, o zigoto, originado pela uni�o de duas
c�lulas sexuais, os gametas, produzidas por um ou, mais comumente, por dois
organismos genitores. O processo de uni�o dos gametas � denominado fecunda��o. Se
os gametas s�o provenientes do mesmo genitor, fala-se em autofecunda��o. Quando os
gametas que se fundem se originam de dois indiv�duos genitores, fala-se em
fecunda��o cruzada.
A reprodu��o � uma das caracter�sticas mais essenciais da vida. � por meio da
reprodu��o que a vida vem se perpetuando ininterruptamente desde que surgiu, h�
mais de 3,5 bilh�es de anos.
Hereditariedade
A hereditariedade � outra caracter�stica essencial da vida, intimamente ligada �
reprodu��o. Um ser vivo, ao se reproduzir, transmite a seus descendentes um
conjunto de instru��es em c�digo, inscritas nas mol�culas de seu material gen�tico
(�cido nucleico), al�m de uma estrutura celular b�sica a partir da qual o novo ser
desenvolver� sua organiza��o t�pica. Herdamos de nossos pais todas as instru��es
gen�ticas e a organiza��o celular para desenvolver nosso corpo conforme os padr�es
t�picos de nossa esp�cie. Uma bact�ria, uma samambaia, um cachorro ou qualquer
outro ser vivo desenvolvem as caracter�sticas t�picas de sua esp�cie a partir das
instru��es gen�ticas e da base celular que receberam pela reprodu��o de seus
progenitores.
As instru��es gen�ticas est�o presentes em mol�culas de uma subst�ncia qu�mica
denominada �cido desoxirribonucleico ou DNA. Apenas uns poucos tipos de v�rus
apresentam RNA (�cido ribonucleico), e n�o DNA, como material gen�tico. O material
gen�tico controla o metabolismo celular e define as caracter�sticas t�picas de cada
c�lula e do conjunto de c�lulas que constituem o organismo multicelular. (Fig.
1.11)

P�gina 23

LILIYA KULIANIONAK/SHUTTERSTOCK
Figura 1.11 Cadela da ra�a dachshund com seus filhotes; o c�o adulto dessa ra�a
mede cerca de 20 cm de altura. A semelhan�a entre pais e filhos deve-se �
transmiss�o de instru��es gen�ticas inscritas em mol�culas de DNA.
Variabilidade gen�tica, sele��o natural e adapta��o
O material gen�tico varia ligeiramente entre os membros de uma mesma esp�cie, o que
se denomina variabilidade gen�tica. Gra�as a essa capacidade de varia��o, os
indiv�duos que nascem a cada gera��o s�o ligeiramente diferentes uns dos outros;
alguns deles podem ter mais chance de sobreviver e de se reproduzir e, assim,
transmitir suas caracter�sticas � descend�ncia. Essa ideia de que os indiv�duos de
uma popula��o t�m diferentes chances de sobreviver e de deixar descendentes foi
proposta em meados do s�culo XIX pelos naturalistas ingleses Charles Darwin e
Alfred Wallace (1823-1913) e denominada sele��o natural.
A sele��o natural � a base da teoria evolucionista, segundo a qual os seres vivos
se modificam ao longo do tempo, adaptando-se aos ambientes em que vivem. A
adapta��o � explicada pela teoria evolucionista da seguinte maneira: entre os
indiv�duos de uma gera��o de organismos vivos, gra�as � variabilidade gen�tica, h�
aqueles que se ajustam melhor ao meio em que vivem; esses t�m mais chance de
sobreviver e de se reproduzir, transmitindo aos descendentes suas caracter�sticas,
entre elas aquelas respons�veis pela adapta��o. Em decorr�ncia dessa sele��o
operada pela natureza, gera��o ap�s gera��o, as esp�cies vivas v�o se tornando cada
vez mais bem ajustadas ao meio, isto �, cada vez mais adaptadas. (Fig. 1.12)

FABIO COLOMBINI
Figura 1.12 O bico de um beija-flor � perfeitamente adaptado ao modo como esse
p�ssaro se alimenta, pois, gra�as a seu formato longo e afilado, pode ser
introduzido nas flores para sugar o n�ctar. Os bi�logos atribuem essa e outras
adapta��es ao processo evolutivo, caracter�stico da vida. Na fotografia, beija-flor
da esp�cie Phaethornis pretrei, que mede cerca de 15 cm de comprimento.
Segundo a teoria evolucionista, as diferentes formas de adapta��o levaram �
diversifica��o da vida e ao surgimento da grande variedade de esp�cies biol�gicas
hoje existentes, cada uma adaptada a um modo de vida particular.

P�gina 24

N�veis de organiza��o biol�gica


Ao estudar a vida, podemos distinguir diversos n�veis hier�rquicos de organiza��o
biol�gica, que v�o desde o n�vel submicrosc�pico at� o planet�rio. (Fig. 1.13)

ILUSTRA��ES: CEC�LIA IWASHITA


Figura 1.13 Representa��o esquem�tica de diferentes n�veis de organiza��o da vida,
do at�mico-molecular (� esquerda) ao planet�rio (� direita). (Elementos fora de
propor��o de tamanho entre si; cores-fantasia.)
Come�ando no n�vel submicrosc�pico, a mat�ria viva � constitu�da de �tomos, que se
re�nem quimicamente formando as mol�culas das diversas subst�ncias org�nicas.
Prote�nas, por exemplo, s�o mol�culas constitu�das por centenas, milhares ou mesmo
milh�es de �tomos, principalmente dos elementos carbono (C), hidrog�nio (H),
oxig�nio (O) e nitrog�nio (N).
Continuando a "subir" na hierarquia da organiza��o biol�gica, vemos que as
mol�culas org�nicas formam diversos tipos de organelas ou organoides celulares, que
se integram na constitui��o das c�lulas, as unidades b�sicas de todos os seres
vivos, com exce��o dos v�rus. Organelas s�o estruturas celulares encontradas em
c�lulas eucari�ticas, especializadas em diversas fun��es; por exemplo, as
mitoc�ndrias s�o organelas produtoras de energia para os processos metab�licos.
Do n�vel celular passamos ao n�vel seguinte, que ocorre em diversos grupos de
organismos multicelulares (animais e plantas). As c�lulas desses organismos se
especializam e se congregam, originando conjuntos celulares funcionais, os tecidos.
O tecido muscular, por exemplo, � formado por c�lulas especializadas em se contrair
e produzir movimentos.
Diversos tipos de tecido organizam-se formando os �rg�os, que s�o unidades
anat�micas e funcionais presentes em seres multicelulares complexos. Por exemplo, o
cora��o, cuja fun��o � bombear sangue pelo corpo, � um �rg�o constitu�do por
diversos tecidos, entre eles o tecido muscular.
Os �rg�os atuam de forma integrada para o desempenho de fun��es corporais
espec�ficas. Um conjunto de �rg�os integrados funcionalmente constitui um sistema
de �rg�os. Um exemplo de sistema corporal � o sistema digestivo, formado por
diversos �rg�os, como boca, es�fago, est�mago, intestino e diversas gl�ndulas que
atuam na digest�o. Os sistemas de �rg�os, em seu conjunto, comp�em o n�vel do
organismo. � nesse n�vel que estamos conversando por meio deste texto, de pessoa
(organismo) para pessoa.
A hierarquia da organiza��o biol�gica n�o para por a�; os indiv�duos geralmente n�o
vivem isolados, mas interagem entre si e com o ambiente. O conjunto de indiv�duos
de uma mesma esp�cie que habita determinada regi�o geogr�fica constitui uma
popula��o biol�gica. Exemplos s�o as popula��es humanas dos diversos pa�ses ou uma
popula��o de macacos.

P�gina 25

Membros de uma popula��o geralmente interagem com indiv�duos de popula��es de


outras esp�cies que habitam a mesma regi�o geogr�fica. Ao conjunto de popula��es di
ferentes que coexistem em determinada regi�o, interagindo direta ou indiretamente,
d�-se o nome de comunidade biol�gica(ou biocenose). Por exemplo, a comunidade da
qual faz parte uma popula��o de macacos inclui as popula��es de plantas e de
animais com as quais coabitam.
Os membros de uma comunidade biol�gica, al�m de interagir entre si, interagem com o
ambiente em que vivem, que os bi�logos denominam bi�topo. Aspectos do bi�topo s�o
temperatura, umidade, luminosidade e componentes qu�micos, entre outros. Por
exemplo, os organismos s�o influenciados pela composi��o qu�mica e pela temperatura
da �gua dos rios, pela umidade do ar e por diversos outros fatores clim�ticos. Os
seres vivos da comunidade tamb�m influenciam os fatores ambientais. As plantas de
uma comunidade biol�gica, por exemplo, criam um microclima mais �mido que o
proporcionado pelo clima regional. Com o decorrer do tempo, plantas e animais
modificam a composi��o qu�mica do solo, enriquecendo-o em mat�ria org�nica. Ao
grande conjunto formado pela intera��o da comunidade e do bi�topo d�-se o nome de
ecossistema.
A mais alta das hierarquias biol�gicas � a que re�ne todos os ecossistemas da
Terra: a biosfera. O termo foi introduzido em 1875 pelo ge�logo austr�aco Eduard
Suess (1831-1914), e seu emprego se generalizou a partir da d�cada de 1920, por
analogia a outros conceitos utilizados para designar partes do planeta, como
litosfera, a camada rochosa que constitui a superf�cie terrestre, e atmosfera, a
camada de ar que circunda o planeta. A biosfera � constitu�da pelos seres vivos da
Terra e pelos ambientes onde eles vivem, ou seja, � o conjunto de ecossistemas do
planeta.

P�gina 26

ATIVIDADES
Revendo conceitos, fatos e processos
Registre em seu caderno
Escreva, em seu caderno, o termo abaixo que substitui corretamente a tarja entre
par�nteses das frases de 1 a 4.
a) dedu��o
b) fato
c) observa��o
d) teoria cient�fica
1. (.....) � um fen�meno natural, que pode ser observado com ou sem o aux�lio de
instrumentos.
2. Uma explica��o abrangente sobre a natureza que engloba fatos e hip�teses e
constitui um modelo de como o mundo funciona � um(a) (.....).
3. A partir de uma hip�tese, os cientistas fazem uma previs�o do que ocorrer� em
determinada situa��o, se aquela hip�tese for verdadeira. Isso constitui um(a)
(.....).
4. Um dos primeiros passos do procedimento cient�fico �, em geral, o(a) (.....),
que consiste no exame acurado da natureza.
5. Com o objetivo de testar a efic�cia de uma nova vacina contra a doen�a chamada
febre aftosa, vacinou-se um lote de 20 vacas, deixando outras 20 sem vacinar. Ap�s
algum tempo, injetou-se em todas as vacas o v�rus causador da febre aftosa. O lote
n�o vacinado constitui
a) o grupo de controle.
b) o grupo experimental.
c) a hip�tese.
d) a observa��o.
6. O que garante a continuidade da vida em nosso planeta � a capacidade que os
seres vivos t�m de
a) crescimento.
b) metaboliza��o.
c) movimenta��o.
d) rea��o a est�mulos.
e) reprodu��o.
7. Venenos como o cianureto matam porque bloqueiam rea��es qu�micas intracelulares.
Pode-se dizer, assim, que o cianureto atua diretamente sobre o(a)
a) reprodu��o.
b) evolu��o.
c) metabolismo.
d) crescimento.
e) rea��o a est�mulos.
Escreva, em seu caderno, o termo abaixo que substitui corretamente a tarja entre
par�nteses das frases de 8 a 10.
a) comunidade biol�gica
b) ecossistema
c) organismo
d) popula��o biol�gica
8. Os micos-le�es-dourados que habitam a Reserva Biol�gica Po�o das Antas no Rio de
Janeiro constituem um(a) (.....).
9. Um lago com seus habitantes em intera��o com os fatores f�sicos e qu�micos
ambientais � um exemplo de (.....).
10. O conjunto de seres vivos que habita um lago constitui um(a) (.....).
Quest�es para exercitar o pensamento
Registre em seu caderno
11. Dois cientistas realizaram o seguinte experimento: alimentaram larvas de uma
esp�cie de mosca com dietas que diferiam quanto � presen�a de amino�cidos, que s�o
os componentes das prote�nas. Um grupo de larvas foi alimentado com uma dieta
completa, com todos os 20 tipos de amino�cidos naturais, al�m de �gua, sais
minerais, a��cares e vitaminas. Cinco outros grupos de larvas, semelhantes ao
primeiro, foram alimentados com dietas nas quais faltava somente um dos
amino�cidos. Os resultados obtidos est�o representados no gr�fico a seguir.

ADILSON SECCO
Com base nessas informa��es, responda:
a) Qual era a prov�vel hip�tese testada pelos cientistas?
b) Qual grupo de larvas representa o grupo de controle e qual � sua import�ncia
para o experimento?
c) Qual foi a vari�vel testada nos grupos experimentais?
d) Que conclus�es � poss�vel tirar com base nos resultados do experimento?

P�gina 27

Fa�a voc� mesmo!


Registre em seu caderno
12. Atividade pr�tica: Testando o papel dos cotil�dones no desenvolvimento de
plantas de feij�o
A semente � uma estrutura vegetal em que est�o contidos o embri�o da planta e as
reservas nutritivas para aliment�-lo no in�cio de seu desenvolvimento. Os embri�es
de algumas plantas, como o feijoeiro, possuem folhas especializadas, denominadas
cotil�dones, nas quais ficam armazenados os nutrientes.
Nesta atividade, al�m de acompanhar a germina��o e o desenvolvimento de um grupo de
sementes de feij�o, voc� poder� testar a hip�tese de que os cotil�dones armazenam
alimento necess�rio ao desenvolvimento inicial da planta. Com base nessa hip�tese,
pode-se fazer a seguinte dedu��o: se os cotil�dones forem removidos no in�cio do
desenvolvimento da planta, faltar� alimento e ela n�o se desenvolver�
adequadamente. O experimento consistir�, portanto, em remover periodicamente os
cotil�dones de algumas plantas de feij�o, comparando seu desenvolvimento a um grupo
de controle.
Antes de iniciar o experimento, familiarize-se com a anatomia de um gr�o de feij�o.
Coloque algumas sementes em um copo com �gua e deixe-as imersas por alguns minutos,
at� que a casca se enrugue e possa ser removida com facilidade. As metades do
feij�o correspondem aos cotil�dones. Separe-os com cuidado e note como eles se
ligam ao embri�o, que j� apresenta prim�rdios de folhas e da raiz bem evidentes. Se
poss�vel, utilize uma lente de aumento para observar essas estruturas. Fa�a um
desenho esquem�tico com legendas de suas observa��es.
Material
- 56 sementes de feij�o de tamanhos semelhantes e apar�ncia saud�vel;
- 7 bandejas de pl�stico ou de isopor com aproximadamente 15 cm � 15 cm, com
pequenos furos para drenar o excesso de �gua;
- areia fina para preencher cada bandeja com uma camada de cerca de 3 cm de
espessura;
- pulverizador de �gua para umedecer as bandejas;
- tesoura de ponta fina;
- r�gua milimetrada;
- etiquetas adesivas para identificar as bandejas;
- caderno para anota��o dos procedimentos e das observa��es;
- opcional: c�mera fotogr�fica (pode ser do celular) para fotografar as etapas do
experimento.
Procedimento
1. Coloque os feij�es de molho em �gua e deixe-os imersos por uma noite. Prepare as
bandejas de germina��o, colocando em cada uma delas uma camada de areia com cerca
de 3 cm de espessura.
2. Disponha 8 feij�es em cada bandeja, a espa�os regulares, enterrando-os mais ou
menos 1 cm e cobrindo-os com areia. Umede�a diariamente a areia das bandejas com o
pulverizador para que n�o resseque.
3. Observe diariamente as bandejas e fa�a anota��es sobre o aspecto geral das
plantas, sua colora��o e se houve alguma morte.
4. Ap�s a germina��o, quando for poss�vel visualizar os cotil�dones presos ao
caule, separe duas bandejas e identifique uma delas como "controle". Identifique a
outra bandeja como "grupo experimental 1" e cuidadosamente remova, com a tesoura,
os dois cotil�dones de cada uma das plantas dessa bandeja.
5. Com uma r�gua milimetrada, me�a a altura de cada planta do grupo de controle e
do grupo experimental 1. Anote os resultados em uma tabela no caderno. Anote tamb�m
a data da opera��o e considere-a o "dia zero" de seu experimento. Me�a tamb�m a
altura de cada uma das plantas das outras 5 bandejas, identificando cada uma delas:
grupo experimental 2 a grupo experimental 6. Continue a cuidar normalmente de todas
as bandejas.
6. No "dia 3" (tr�s dias ap�s o "dia zero"), pegue a bandeja identificada como
"grupo experimental 2" e remova cuidadosamente os cotil�dones de todas as suas
plantas, como fez com o grupo 1.
7. Me�a a altura de todas as plantas de cada uma das bandejas e anote a data e os
resultados em uma tabela no caderno.
8. No sexto dia, pegue a bandeja identificada como "grupo experimental 3" e repita
o procedimento de remo��o dos cotil�dones. Me�a novamente a altura de todas as
plantas e anote os resultados no caderno.
9. Repita o procedimento anterior nos dias 9 ("grupo experimental 4"), 12 ("grupo
experimental 5") e 15 ("grupo experimental 6") do experimento. Ao final, voc� ter�
seis grupos experimentais e um grupo de controle.
10. No d�cimo oitavo dia, me�a todas as plantas e d� por encerrado o experimento.
An�lise do experimento
Para facilitar a interpreta��o dos dados coletados no experimento, vamos utilizar
uma representa��o gr�fica. Para isso, calcule a m�dia das alturas

P�gina 28

das plantas de cada grupo em cada um dos dias em que voc� fez a medi��o. Com esses
valores, construa um gr�fico de linhas, expressando a altura das plantas na
ordenada e o tempo decorrido desde o in�cio do experimento na abscissa. Se
necess�rio, pe�a sugest�es ao professor. Analise o gr�fico obtido e reflita sobre
as seguintes quest�es:
a) Houve diferen�a significativa entre o crescimento das plantas do grupo de
controle e o das plantas dos grupos experimentais? Como esses resultados podem ser
interpretados com base no que se sabe sobre o papel dos cotil�dones na germina��o?
b) Houve diferen�a entre os grupos experimentais? Em caso afirmativo, quais foram
elas e como podem ser interpretadas?
c) Os resultados obtidos confirmam a hip�tese da import�ncia dos cotil�dones para o
desenvolvimento inicial das plantas de feij�o? Por qu�?
Redija um relat�rio do experimento nos moldes de uma comunica��o cient�fica. Para
isso, escreva uma introdu��o para o trabalho, com informa��es obtidas na literatura
sobre o papel dos cotil�dones. N�o se esque�a de mencionar as fontes consultadas e
de cit�-las no item "Refer�ncias bibliogr�ficas", ao final do relat�rio. �
importante incluir na introdu��o o objetivo da investiga��o, ou seja, a hip�tese
testada e a dedu��o feita a partir dela. Pense na hip�tese que foi testada no
experimento.
Ap�s a introdu��o, inclua um item intitulado "Material e m�todos", no qual devem
ser descritos o material utilizado e o procedimento realizado, de modo que outra
pessoa possa repetir o experimento e verificar os resultados.
No item do relat�rio intitulado "Resultados" � preciso descrever detalhadamente os
resultados obtidos, com inclus�o de ilustra��es e fotografias devidamente
identificadas, que exemplifiquem os resultados descritos, e tamb�m de tabelas e
gr�ficos que sintetizem os dados coletados.
Para finalizar, inclua em seu relat�rio uma "Discuss�o", na qual os resultados
obtidos devem ser relacionados ao que j� se sabe sobre o assunto (a partir de
livros de Biologia, revistas cient�ficas etc.). Discuta se os resultados confirmam
ou refutam a hip�tese testada. Conclua sua comunica��o com o item "Refer�ncias
bibliogr�ficas", em que s�o citadas as fontes nas quais foram obtidas as
informa��es utilizadas na reda��o do trabalho.
Envie, por e-mail, seu trabalho para a avalia��o e cr�tica de seus pares, isto �,
seus colegas e seu professor. Eles podem critic�-lo e sugerir novas t�cnicas
experimentais ou novos experimentos relacionados � sua hip�tese. Reformule o
trabalho em fun��o das cr�ticas recebidas e publique-o na internet, no jornal ou no
mural da escola.
A Biologia no vestibular e no Enem
Registre em seu caderno
Quest�es objetivas
1. (UGF-RJ) Ao criar uma hip�tese cient�fica, o cientista procura
a) levantar uma quest�o ou problema.
b) explicar um fato e prever outros.
c) testar variantes.
d) comprovar teorias estabelecidas.
e) confirmar observa��es.
2. (Uerj) At� o s�culo XVII, o papel dos espermatozoides na fertiliza��o do �vulo
n�o era reconhecido. O cientista italiano Lazzaro Spallanzani, em 1785, questionou
se seria o pr�prio s�men, ou simplesmente o vapor dele derivado, a causa do
desenvolvimento do ovo. Do relat�rio que escreveu a partir de seus estudos sobre a
fertiliza��o, foi retirado o seguinte trecho:
"[...] para decidir a quest�o, � importante empregar um meio conveniente que
permita separar o vapor da parte figurada do s�men e faz�-lo de tal modo que os
embri�es sejam mais ou menos envolvidos pelo vapor".
Entre as etapas que constituem o m�todo cient�fico, esse trecho do relat�rio � um
exemplo de
a) an�lise de dados.
b) coleta de material.
c) elabora��o da hip�tese.
d) planejamento do experimento.
3. (Fuvest-SP) Observando plantas de milho com folhas amareladas, um estudante de
Agronomia considerou que essa apar�ncia poderia ser devida � defici�ncia mineral do
solo. Sabendo que a clorofila cont�m magn�sio, ele formulou a seguinte hip�tese: as
folhas amareladas aparecem quando h� defici�ncia de sais de magn�sio no solo. Qual
das alternativas descreve um experimento correto para testar tal hip�tese?
a) Fornecimento de sais de magn�sio ao solo em que as plantas est�o crescendo e
observa��o dos resultados alguns dias depois.
b) Fornecimento de uma mistura de diversos sais minerais, inclusive sais de
magn�sio, ao solo em que as plantas est�o crescendo e observa��o dos resultados
dias depois.
c) Cultivo de um novo lote de plantas em solo suplementado com uma mistura completa
de sais minerais, incluindo sais de magn�sio.
d) Cultivo de novos lotes de plantas, fornecendo � metade deles mistura completa de
sais minerais, inclusive sais de magn�sio, e, � outra metade, apenas sais de
magn�sio.
e) Cultivo de novos lotes de plantas, fornecendo � metade deles mistura completa de
sais minerais, inclusive sais de magn�sio, e, � outra metade, uma mistura com os
mesmos sais, menos os de magn�sio.

P�gina 29

4. (UFRGS-RS) Numa experi�ncia controlada o grupo controle tem por objetivo


a) testar outras variantes do resultado previsto.
b) confirmar as conclus�es obtidas com o grupo experimental.
c) desmentir as conclus�es obtidas com o grupo experimental.
d) servir de refer�ncia padr�o em face dos resultados fornecidos pelo grupo
experimental.
e) testar a efici�ncia dos equipamentos usados na experi�ncia.
5. (UFMG) Um estudante decidiu testar os resultados da falta de determinada
vitamina na alimenta��o de um grupo de ratos. Colocou ent�o cinco ratos em uma
gaiola e retirou de sua dieta os alimentos ricos na vitamina em quest�o. Ap�s
alguns dias, os pelos dos ratos come�aram a cair. Concluiu ent�o que esta vitamina
desempenha algum papel no crescimento e manuten��o dos pelos. Sobre essa
experi�ncia podemos afirmar
a) A experi�ncia obedeceu aos princ�pios do m�todo cient�fico, mas a conclus�o do
estudante pode n�o ser verdadeira.
b) A experi�ncia foi correta e a conclus�o tamb�m. O estudante seguiu as normas do
m�todo cient�fico adequadamente.
c) A experi�ncia n�o foi realizada corretamente porque o estudante n�o usou um
grupo controle.
d) O estudante n�o fez a experi�ncia de forma correta, pois n�o utilizou
instrumentos especializados.
e) A experi�ncia n�o foi correta porque a hip�tese do estudante n�o era uma
hip�tese pass�vel de ser testada experimentalmente.
6. (Vunesp) A sequ�ncia indica os crescentes n�veis de organiza��o biol�gica:
c�lula ? I ? II ? III ? ? popula��o ? IV ? V ? biosfera
Os n�veis I, III e IV correspondem, respectivamente, a
a) �rg�o, organismo e comunidade.
b) tecido, organismo e comunidade.
c) �rg�o, tecido e ecossistema.
d) tecido, �rg�o e bioma.
e) tecido, comunidade e ecossistema.
7. (UFPB) Em nosso planeta, o que distingue a mat�ria viva da n�o viva � a presen�a
de elementos qu�micos (C, H, O, N) que, junto com outros, formam as subst�ncias
org�nicas. Os seres vivos s�o formados a partir de n�veis bem simples e espec�ficos
at� os mais complexos e gerais. Numa ordem crescente de complexidade, estes n�veis
t�m a seguinte sequ�ncia:
a) biosfera, ecossistema, comunidade, popula��o, organismo, sistema, �rg�o, tecido,
c�lula, mol�cula.
b) mol�cula, c�lula, tecido, organismo, �rg�o, popula��o, comunidade, ecossistema,
sistema, biosfera.
c) mol�cula, c�lula, tecido, �rg�o, organismo, popula��o, comunidade, sistema,
ecossistema, biosfera.
d) mol�cula, c�lula, tecido, �rg�o, sistema, organismo, popula��o, comunidade,
ecossistema, biosfera.
e) biosfera, comunidade, popula��o, ecossistema, sistema, �rg�o, organismo, tecido,
c�lula, mol�cula.
8. (UFSC) Ao examinar um fen�meno biol�gico, o cientista sugere uma explica��o para
o seu mecanismo, baseando-se na causa e no efeito observados. Esse procedimento
01) faz parte do m�todo cient�fico.
02) � denominado formula��o de hip�teses.
04) poder� ser seguido de uma experimenta��o.
08) deve ser precedido de uma conclus�o.
D� como resposta a soma dos n�meros associados �s alternativas corretas.
Quest�es discursivas
9. (Vunesp) Considere a afirma��o: "As popula��es daquele ambiente pertencem a
diferentes esp�cies de animais e vegetais". Que conceitos est�o impl�citos nessa
frase, se levarmos em considera��o
a) somente o conjunto de popula��es?
b) o conjunto de popula��es mais o ambiente abi�tico?
10. (Unicamp-SP) Sobre uma mesa h� dois ratinhos semelhantes, em tamanho, forma e
cor. Um deles goteja um pouco de l�quido, desloca-se em linha reta at� cair da mesa
e emite um ru�do como de engrenagens, que logo cessa. O outro ratinho percorre a
mesa em linha sinuosa, vai at� a borda e volta. Anda para l� e para c�, parecendo
indeciso, como � procura de algo. De repente, dirige-se para um punhado de gr�os,
dos quais alguns s�o mordiscados e ingeridos. Em seguida esse ratinho urina e
defeca e, depois disso, volta para junto de seus filhotes numa caixinha em cima da
mesa. Descreva pelo menos tr�s caracter�sticas, percebidas a partir da descri��o
acima, que permitam concluir que um dos ratinhos � um ser vivo.

P�gina 30

Cap�tulo 2 Origem da vida na Terra

NOAA GOES/NASA
"A Terra � azul e eu n�o vi Deus!" Quem disse essa frase foi o cosmonauta russo
Yuri Gagarin (1934-1968), h� mais de 50 anos, o primeiro ser humano a ver nosso
planeta do espa�o. Em 20 de julho de 1969, o estadunidense Neil Armstrong (1930-
2012) pisou na Lua, de onde se descortina uma bela vis�o do nosso planeta azul.
Como a vida surgiu aqui? H� vida em outros planetas? (Na imagem, foto de sat�lite
do planeta Terra em 22 de abril de 2014.)
� procura de nossas origens
De onde viemos? Com certeza, a maioria de n�s j� fez essa pergunta em diferentes
idades e de diversas maneiras. Geralmente, primeiro queremos saber como surgem os
beb�s. Superada essa curiosidade, passamos a querer saber como surgiram nossa
esp�cie, os outros seres vivos, a Terra e o universo.
At� pouco mais de tr�s s�culos atr�s, as principais explica��es para nossa origem
eram de car�ter religioso, segundo as quais o universo teria sido criado por
divindades supremamente poderosas. Nas �ltimas d�cadas, o desenvolvimento da
ci�ncia tem trazido novos dados para essa antiga discuss�o. Os avan�os da
Cosmologia, ramo da ci�ncia que estuda os corpos celestes e o espa�o sideral,
levaram os cientistas a imaginar uma nova explica��o para a origem do universo, que
ficou conhecida como a teoria da grande explos�o ou do big bang. Segundo ela, tudo
o que existe, incluindo o tempo e o espa�o, teria surgido h� cerca de 13,8 bilh�es
de anos a partir da expans�o s�bita e violenta de uma desconhecida "semente"
c�smica. Desde essa explos�o primordial, o universo vem evoluindo, com a forma��o
de gal�xias, de estrelas e de muitos outros corpos celestes, entre eles a Terra.
Aqui, supostamente h� mais de 3,5 bilh�es de anos surgiu a vida, fen�meno ainda n�o
confirmado em nenhum local fora da Terra. Os cientistas acreditam que os primeiros
seres vivos deviam ser extremamente simples, constitu�dos por uma �nica c�lula
dotada de organiza��o rudimentar. Ao longo de mais de 3,5 bilh�es de anos de
evolu��o, os descendentes daqueles primeiros seres colonizaram todos os ambientes
do planeta, modificaram-se e originaram a imensa variedade de esp�cies atuais,
entre elas a esp�cie humana.

P�gina 31

Ao contr�rio das muitas religi�es que consideram a esp�cie humana objeto central da
cria��o, a ci�ncia situa o aparecimento de nossa esp�cie no grande panorama da
evolu��o c�smica. Para os cientistas, h� continuidade evolutiva desde o momento do
big bang at� os dias de hoje.
Neste cap�tulo apresentamos resumidamente as ideias cient�ficas atuais sobre a
forma��o do universo e da Terra, tendo como principal objetivo mostrar a vis�o
cient�fica da origem da vida em nosso planeta. Para os cientistas, esse assunto
ainda � objeto de intensos debates: alguns acreditam que a vida surgiu na Terra a
partir de uma lenta evolu��o qu�mica de gases atmosf�ricos, enquanto outros
defendem que a vida pode ter sido semeada na Terra por cometas e asteroides que
atingiram a superf�cie terrestre.
A todo momento novas descobertas e novas interpreta��es dos fatos podem modificar a
vis�o que temos hoje. Informe-se e mantenha-se atualizado nas discuss�es que v�m
sendo travadas, ao longo da hist�ria, sobre a origem da vida na Terra.
A import�ncia do assunto
Uma pergunta que alguns estudantes costumam fazer �: por que estudar a hist�ria da
Terra em Biologia? Esse n�o seria um assunto a ser estudado em Geografia ou
Geologia? A raz�o de tornar nosso estudo mais abrangente � que a vida est�
intimamente ligada �s caracter�sticas f�sicas, qu�micas e estruturais do planeta e
toda esp�cie de ser vivo est� adaptada �s condi��es do ambiente onde vive. Assim,
saber como a Terra surgiu e como mudou no decorrer do tempo � importante para
compreendermos a hist�ria da vida.
Entender a vida do ponto de vista de sua hist�ria permite compreender semelhan�as e
diferen�as entre as esp�cies biol�gicas, sua distribui��o geogr�fica e as
intera��es que mant�m entre si e com o ambiente; enfim, � a vis�o hist�rica e
evolucionista da vida que d� sentido aos fatos biol�gicos. Como disse o bi�logo
ucraniano, naturalizado estadunidense, Theodosius Dobzhansky (1900-1975):
"Interpretada � luz da evolu��o, a Biologia �, talvez, do ponto de vista
intelectual, a mais inspirada e satisfat�ria das ci�ncias. [...] Sem essa luz, a
Biologia torna-se uma miscel�nea de fatos - alguns deles interessantes ou curiosos
-, mas desprovidos de significado [...]".
2.1 A origem do universo e do Sistema Solar
A teoria do big bang ou teoria da grande explos�o
Os avan�os da Cosmologia e da F�sica, no in�cio do s�culo XX, levaram � formula��o
de uma nova explica��o cient�fica para a origem do universo: a teoria do big bang
ou, traduzindo a express�o em ingl�s, teoria da grande explos�o. Atualmente
bastante aceita pela comunidade cient�fica, essa teoria prop�e que o universo tenha
se originado de um ponto extremamente compacto, de densidade infinita, que, por
raz�es ainda desconhecidas, explodiu h� cerca de 13,8 bilh�es de anos e se expandiu
de modo violento. Segundo essa teoria, o universo continua em expans�o at� hoje.
Nessa "explos�o" primordial, denominada big bang, teriam surgido simultaneamente o
espa�o, o tempo, a energia e a mat�ria que comp�em o universo.
Tudo indica que, imediatamente ap�s o big bang, a temperatura era t�o elevada que
impossibilitava a exist�ncia da mat�ria como hoje a conhecemos. Entretanto, a
r�pida expans�o do universo fez a temperatura diminuir; ao fim do primeiro minuto,
teriam surgido n�cleos at�micos do elemento qu�mico mais simples, o hidrog�nio,
al�m de n�cleos de h�lio e pequenas quantidades de n�cleos de l�tio. �tomos
propriamente ditos s� se formariam mais tarde, quase 400 mil anos depois do big
bang.
Quando o universo completou algumas centenas de milh�es de anos, come�aram a surgir
as primeiras estrelas, corpos celestes de grandes dimens�es, formadas basicamente
por �tomos de hidrog�nio e de h�lio. Ao mesmo tempo a atra��o gravitacional levou �
forma��o de conjuntos de estrelas e de mat�ria c�smica, as primeiras gal�xias.

P�gina 32

A origem do Sistema Solar


Os cientistas estimam que o Sistema Solar, conjunto formado pelo Sol, planetas,
sat�lites, cometas e outros corpos celestes, surgiu h� cerca de 4,6 bilh�es de anos
a partir de uma nebulosa - aglomera��o de gases e de poeira interestelar - presente
na gal�xia denominada Via L�ctea. Acredita-se que os gases da nebulosa que originou
o Sistema Solar eram predominantemente g�s hidrog�nio (H2) e g�s h�lio (He). A
poeira interestelar era constitu�da principalmente por gr�nulos de carbono e de
silicatos.
A atra��o gravitacional entre as part�culas da nebulosa fez com que ela se tornasse
cada vez mais compacta. Ap�s alguns milh�es de anos de compacta��o devido �
gravidade, a temperatura no centro da nebulosa teria atingido cerca de 10 milh�es
de graus Celsius (10.000.000 �C), ocasionando rea��es de fus�o nuclear em cadeia,
com libera��o de muita energia e eleva��o da temperatura. Nesse ponto, a massa
central compactada da nebulosa passou a emitir luz, constituindo uma estrela
amarela - o Sol -, uma entre os mais de 100 milh�es de estrelas presentes na Via
L�ctea.
Os cientistas acreditam que, ao mesmo tempo que o Sol se formava no centro da
nebulosa, tamb�m ocorreram condensa��es em pontos perif�ricos do disco de mat�ria
que girava em torno do centro, originando planetas e outros corpos celestes do
Sistema Solar, como sat�lites, asteroides e cometas. (Fig. 2.1)

SIMONKA
Figura 2.1 Concep��o art�stica da forma��o do Sistema Solar. A. Nebulosa
primordial. B. Condensa��o da mat�ria no centro, originando o Sol, e forma��o do
disco de mat�ria girando ao seu redor. C. Condensa��es em pontos perif�ricos do
disco girat�rio, que resultaria nos demais astros do Sistema Solar. D.Parte mais
interna do Sistema Solar mostrando o Sol com os planetas mais pr�ximos, sat�lites,
asteroides e cometas que orbitam ao seu redor. (Elementos fora de propor��o de
tamanho entre si; cores-fantasia.)

P�gina 33

A forma��o da Terra
Evid�ncias cient�ficas sugerem que o planeta Terra formou-se entre 4,6 bilh�es e
4,5 bilh�es de anos atr�s, a partir da aglomera��o de minerais, poeira c�smica e
gases presentes no disco de mat�ria que orbitava o Sol. A agrega��o progressiva
desse material gerou grande press�o no interior da Terra em forma��o, com aumento
da temperatura e derretimento dos materiais rochosos mais internos, que escapavam
para a superf�cie terrestre na forma de lava incandescente. Al�m dessa intensa
atividade interna, a jovem Terra tamb�m era continuamente bombardeada por
asteroides vindos do espa�o, que se chocavam com a superf�cie terrestre em eventos
catastr�ficos, contribuindo para o aumento da temperatura e da massa planet�rias.
Admite-se que nenhum tipo de vida como a que conhecemos hoje poderia ter existido
em condi��es t�o adversas quanto as reinantes na Terra em seus primeiros 700
milh�es de anos de exist�ncia.
A Terra em forma��o estava envolta por uma atmosfera constitu�da principalmente de
g�s carb�nico (CO2), g�s metano (CH4), mon�xido de carbono (CO) e g�s nitrog�nio
(N2), al�m de vapor-d'�gua (H2O). A maioria dos cientistas concorda com essa
suposta composi��o da atmosfera da Terra primitiva, ainda que haja discord�ncia
sobre a origem desses gases. Uma corrente cient�fica defende a hip�tese de que a
�gua e os gases da atmosfera terrestre originaram-se no interior do pr�prio
planeta. Outros, com base em recentes descobertas na pesquisa espacial, defendem a
ideia de que a maior parte da �gua e dos gases atmosf�ricos teria chegado a bordo
de cometas e asteroides.
Independentemente da origem dos gases atmosf�ricos terrestres, com o passar do
tempo a superf�cie da Terra primitiva foi esfriando devido � cont�nua perda de
calor para o espa�o. O resfriamento possibilitou a forma��o de uma fina camada de
material rochoso s�lido em torno do planeta, a crosta terrestre. Entretanto, a
crosta ainda era quente demais para permitir que se acumulasse �gua no estado
l�quido sobre ela. Nas camadas superiores da atmosfera, mais frias, o vapor-d'�gua
se condensava, produzindo nuvens que se precipitavam em forma de chuva. Na
superf�cie, por causa das altas temperaturas, toda a �gua voltava a evaporar, e o
processo se repetia. Passou muito tempo at� que esse quadro mudasse. Acredita-se
que, na Terra de pouco mais de 500 milh�es de anos de idade, tempestades
torrenciais ca�ram sem intervalos durante milh�es de anos seguidos.
A partir de determinado momento, a superf�cie da Terra j� havia esfriado o
suficiente para que �gua l�quida pudesse se acumular em depress�es da crosta
terrestre, formando imensas �reas alagadas precursoras dos oceanos. Provavelmente
foi em um cen�rio como esse que surgiram os primeiros seres vivos, dos quais
descendem todas as formas de vida. (Fig. 2.2)

MARK GARLICK/SCIENCE PHOTO LIBRARY/AGB PHOTO


FOTOSEARCH/AGB PHOTO/KEYSTONE BRASIL
LYNETTE COOK/SCIENCE PHOTO LIBRARY/LATINSTOCK
Figura 2.2 Representa��es art�sticas das mudan�as que teriam ocorrido gradualmente
no ambiente da Terra primitiva. A. Resfriamento superficial suficiente para in�cio
da forma��o da crosta terrestre, intensa atividade vulc�nica e bombardeamento por
corpos celestes. B. O resfriamento da crosta progride, mas ainda n�o permite
ac�mulo de �gua l�quida. C. A crosta fica suficientemente fria, o que permite a
forma��o dos primeiros mares.

P�gina 34

2.2 Como surgiu a vida na Terra?


A queda da teoria da gera��o espont�nea
At� meados do s�culo XVII era muito difundida a cren�a de que os seres vivos haviam
sido criados por divindades, doutrina denominada criacionismo. Admitia-se tamb�m
que alguns tipos de seres vivos podiam ser gerados espontaneamente a partir da
mat�ria sem vida, ou mesmo pela transforma��o de outros seres vivos. Essa era a
base da teoria da gera��o espont�nea, tamb�m chamada de teoria da abiog�nese.
A teoria da abiog�nese, entretanto, n�o resistiu � expans�o do conhecimento
cient�fico e aos rigorosos testes realizados por cientistas criteriosos como Redi,
Spallanzani e Pasteur, entre outros. Esses pesquisadores forneceram as primeiras
evid�ncias cient�ficas de que os seres vivos surgem somente pela reprodu��o de
seres de sua pr�pria esp�cie, ideia que ficou conhecida como teoria da biog�nese.
O experimento de Redi
Um dos primeiros experimentos cient�ficos sobre a origem de seres vivos foi
realizado em meados do s�culo XVII pelo m�dico italiano Francesco Redi (1626-1697).
Na �poca, muitos acreditavam que os seres vermiformes sempre vistos em cad�veres de
pessoas e de animais surgiam por transforma��o espont�nea da carne em putrefa��o.
Redi n�o concordava com essa ideia e formulou a hip�tese de que esses "vermes" eram
est�gios imaturos, ou larvas, do ciclo de vida de moscas. Redi acreditava que as
larvas nasciam dos ovos colocados por moscas na carne, e n�o por gera��o
espont�nea.
Em seu livro intitulado Experimentos sobre a gera��o de insetos (em latim,
Experimenta circa generationem insectorum), Redi conta como teve a ideia de que os
seres vermiformes presentes nos cad�veres eram parte do ciclo de vida de moscas. Ao
ler o poema �pico Il�ada, datado do s�culo IX ou VIII a.C., cuja autoria �
atribu�da ao grego Homero, o m�dico italiano se perguntou por que, no canto XIX da
Il�ada, Aquiles teme que o corpo de P�trocles se torne presa das moscas. Por que,
questiona Redi, Aquiles pede a T�tis que proteja o corpo contra os insetos que
poderiam dar origem a vermes e corromper a carne do morto? Redi concluiu que os
antigos gregos j� sabiam que as larvas encontradas nos cad�veres se originavam de
moscas que pousavam sobre eles e ali depositavam seus ovos. (Fig. 2.3)

GIOVANNI ANTONIO PELLEGRINI - MUS�E MUNICIPAL, SOISSONS, FRANCE


Figura 2.3 Aquiles contemplando o corpo de P�trocles, pintura de Giovanni Antonio
Pellegrini, c. 1700. (�leo sobre tela, 152,5 cm � 195,5 cm. Museu Municipal de
Soissons, Fran�a.) A cena retrata uma passagem do poema Il�ada, atribu�do a Homero,
que serviu de inspira��o para Redi idealizar seu experimento.
Seguindo os procedimentos da ci�ncia moderna, Redi raciocinou que, se os seres
vermiformes realmente surgem a partir de ovos colocados por moscas - essa � a
hip�tese -, ent�o eles n�o aparecer�o se impedirmos que moscas pousem na carne -
essa � uma dedu��o a partir da hip�tese. Para testar sua hip�tese, Redi realizou o
seguinte experimento: distribuiu animais mortos em diversos frascos de boca larga,
vedando alguns deles com uma gaze muito fina e deixando outros abertos. Nestes
�ltimos, nos quais as moscas podiam entrar e sair livremente, logo surgiram seres
vermiformes. Nos frascos tapados com gaze, que impedia a entrada das moscas, n�o
apareceu nenhum "verme", mesmo passados muitos dias. Desse modo, a dedu��o a partir
da hip�tese foi confirmada e a hip�tese, aceita. (Fig. 2.4)

P�gina 35

JURANDIR RIBEIRO
Figura 2.4 Representa��o do experimento de Redi, que descartou a hip�tese da
gera��o espont�nea dos "vermes" (larvas) que surgem na carne em putrefa��o. No
frasco � esquerda, tapado com gaze, n�o surgiram larvas. No frasco � direita, no
qual as moscas puderam entrar, apareceram larvas, que se alimentavam da carne.
(Elementos fora de propor��o de tamanho entre si; cores-fantasia.)
Needham versus Spallanzani
A teoria da gera��o espont�nea perdeu credibilidade com os experimentos de Redi,
mas voltou a ser utilizada para explicar a origem dos seres microsc�picos, ou
microrganismos, descobertos em meados do s�culo XVII pelo holand�s Antonie van
Leeuwenhoek (1632-1723). (Fig. 2.5)

REPRODU��O - ANTONIE VAN LEEUWENHOEK


Figura 2.5 A. Desenhos de seres microsc�picos, popularmente chamados de micr�bios,
realizados por Leeuwenhoek em 1683.

ANTONIE VAN LEEUWENHOEK - MUSEUM BOERHAAVE, LEIDEN, NETHERLANDS


Figura 2.5 B. Retrato de Antonie van Leeuwenhoek, fil�sofo natural e zoologista, em
Delft, c. 1680, de Jan Verkolje. (�leo sobre tela, 56 � 47,5 cm. Museu Boerhaave,
Holanda.)
Essa teoria parecia realmente adequada para explicar a origem dos microrganismos,
pois era dif�cil imaginar que seres aparentemente t�o simples, presentes em quase
todos os lugares, pudessem surgir por meio da reprodu��o. Muitos estudiosos, por�m,
estavam convencidos de que a gera��o espont�nea n�o ocorria nem para seres grandes
nem para seres microsc�picos.
Em 1745, o ingl�s John Needham (1713-1781) realizou o seguinte experimento:
distribuiu caldo nutritivo em diversos frascos, que foram fervidos por 30 minutos e
imediatamente fechados com rolhas de corti�a. Depois de alguns dias, os caldos
estavam repletos de seres microsc�picos. Assumindo que a fervura eliminara todos os
seres eventualmente existentes no caldo original e que nenhum ser vivo poderia ter
penetrado atrav�s das rolhas, Needham argumentou que s� havia uma explica��o para a
presen�a de microrganismos nos frascos: eles haviam surgido por gera��o espont�nea.
O padre e pesquisador italiano Lazzaro Spallanzani (1729-1799) refez os
experimentos de Needham. Ele preparou oito frascos com caldos nutritivos
previamente fervidos: quatro deles foram fechados com rolhas de corti�a, como
fizera Needham, e os outros quatro tiveram os gargalos derretidos no fogo, de forma
a adquirirem uma veda��o herm�tica. Al�m disso, os frascos foram fervidos durante
longo tempo. Ap�s alguns dias, microrganismos haviam surgido nos frascos arrolhados
com corti�a, mas n�o nos frascos cujos gargalos tinham sido hermeticamente fechados
no fogo. Spallanzani concluiu que a veda��o ou o tempo curto de fervura utilizados
por Needham, ou ambos, haviam sido incapazes de impedir a contamina��o do caldo.

P�gina 36

Em resposta a Spallanzani, Needham alegou que, devido � fervura prolongada, o caldo


poderia ter perdido sua "for�a vital", um princ�pio imaterial que seria
indispens�vel ao surgimento de vida. Spallanzani, ent�o, quebrou os gargalos
fundidos de alguns frascos, que ainda se mantinham livres de microrganismos,
expondo seu conte�do ao ar. Em pouco tempo, eles ficaram repletos de
microrganismos, mostrando que a fervura prolongada n�o havia destru�do a "for�a
vital" do caldo. Needham contra-argumentou mais uma vez, sugerindo a hip�tese de
que o princ�pio ativo, embora deteriorado pelo longo tempo de fervura, se
restabelecera com a entrada de ar fresco, permitindo que os microrganismos
surgissem espontaneamente. Dessa vez, Spallanzani n�o conseguiu elaborar um
experimento para descartar o contra-argumento de Needham, e a controv�rsia n�o foi
resolvida.
Pasteur e a derrubada da abiog�nese
No in�cio da d�cada de 1860, a Academia Francesa de Ci�ncias ofereceu um pr�mio em
dinheiro para quem realizasse um experimento definitivo sobre a origem dos
microrganismos. Estimulado pelo desafio, o pesquisador franc�s Louis Pasteur (1822-
1895) come�ou a trabalhar no assunto.
Em um de seus muitos experimentos, Pasteur distribuiu caldo nutritivo em quatro
frascos de vidro, cujos gargalos foram amolecidos ao fogo, o que permitiu serem
esticados e curvados na forma de um pesco�o de cisne. Na sequ�ncia, o cientista
franc�s aqueceu o caldo at� que sa�sse vapor pelas extremidades dos gargalos
curvos, deixando depois que o caldo resfriasse lentamente. O objetivo de Pasteur,
ao curvar os gargalos dos frascos, era manter livre a entrada de ar, mas fazendo
com que as part�culas em suspens�o ficassem retidas nas paredes do gargalo curvo,
que assim funcionaria como um filtro.
Apesar de o caldo estar em contato direto com o ar, n�o surgiram microrganismos em
nenhum dos quatro frascos com "pesco�o de cisne" preparados por Pasteur em seu
experimento. Microrganismos presentes no ar ficavam retidos nas curvas do gargalo e
n�o conseguiam chegar ao l�quido do frasco.
Para confirmar essa hip�tese, Pasteur quebrou o gargalo de alguns frascos,
verificando que, em poucos dias, seus conte�dos ficaram repletos de microrganismos.
O experimento demonstrou que o surgimento de microrganismos em caldos nutritivos se
d� pela contamina��o por germes provenientes do ambiente externo, e n�o por gera��o
espont�nea. (Fig. 2.6)

ILUSTRA��ES: SIMONKA

BSIP/UIG VIA GETTY IMAGES


Figura 2.6 A. Etapas do experimento realizado por Pasteur, que sepultou
definitivamente a teoria da gera��o espont�nea. (Elementos fora de propor��o de
tamanho entre si; cores-fantasia.) B. Frascos usados por Pasteur em seus
experimentos s�o mantidos at� hoje no Museu do Instituto Pasteur, em Paris, Fran�a.

P�gina 37

Pesquisas sobre gera��o espont�nea levaram a novas tecnologias


� interessante pensar que os experimentos pioneiros de Spallanzani sobre gera��o
espont�nea abriram caminho para o desenvolvimento da ind�stria de alimentos
enlatados. Ao saber das pesquisas e das controv�rsias sobre a origem dos
microrganismos, o confeiteiro franc�s Nicholas Appert (1749-1841) suspeitou que
eles poderiam ser respons�veis pela deteriora��o dos alimentos, problema ent�o
enfrentado pelos fabricantes de produtos aliment�cios. Partindo do princ�pio de que
caldos nutritivos previamente fervidos podiam ser guardados sob veda��o herm�tica
sem estragar, como Spallanzani havia demonstrado, Appert desenvolveu uma tecnologia
para produzir alimentos em conserva, que podiam ser armazenados por longo tempo sem
sofrer deteriora��o.
A hist�ria da fermenta��o remonta � d�cada de 1850. Naquela �poca, Louis Pasteur,
j� famoso por seus estudos sobre os microrganismos, interessou-se por um problema
de deteriora��o do vinho que afetava a ind�stria vin�cola de Arbois (Fran�a), sua
terra natal. Em experimentos anteriores, ele pr�prio j� demonstrara que a
transforma��o do suco de uvas em vinho resulta da atividade de microrganismos
denominados leveduras ou fermentos. Sua hip�tese, agora, era que a deteriora��o do
vinho decorria da contamina��o por outro tipo de microrganismo.
Ao observar ao microsc�pio amostras de vinhos estragados, Pasteur encontrou outros
microrganismos al�m das leveduras, o que refor�ava sua hip�tese. A quest�o era:
como se livrar desses invasores indesej�veis sem alterar o sabor do vinho? Este n�o
podia ser fervido, pois perderia totalmente suas qualidades. Pasteur descobriu
ent�o que o aquecimento do vinho por apenas alguns minutos, a 57 �C, era suficiente
para eliminar os microrganismos indesej�veis sem alterar o sabor da bebida; com
isso, estava inventado o processo que, em sua homenagem, recebeu o nome de
pasteuriza��o.
A pasteuriza��o, tecnologia para a elimina��o seletiva de microrganismos pelo
aquecimento brando, � largamente empregada na ind�stria de alimentos nos dias
atuais. Em diversos pa�ses, incluindo o Brasil, � obrigat�rio pasteurizar o leite e
seus derivados antes de comercializ�-los. Nesse processo, o leite � mantido a 62 �C
por 30 minutos, o que elimina a bact�ria Mycobacterium tuberculosis, um
microrganismo frequentemente presente no gado bovino e que pode causar tuberculose
no ser humano. A pasteuriza��o elimina tamb�m outros microrganismos respons�veis
pela deteriora��o do leite, prolongando sua vida �til.
2.3 Ideias modernas sobre a origem da vida
A origem pr�-biol�gica dos precursores da vida
Com o descr�dito da teoria da gera��o espont�nea e consolida��o da teoria da
biog�nese, uma nova quest�o sobressaiu: se os seres vivos n�o prov�m da mat�ria
inanimada, mas apenas por reprodu��o de outros seres vivos, como eles surgiram na
Terra pela primeira vez? De onde teriam vindo as mol�culas org�nicas que originaram
os primeiros seres vivos?
Ainda n�o h� resposta definitiva para essa quest�o. Uma das possibilidades,
embasada em descobertas recentes, � que subst�ncias precursoras da vida tenham
vindo do espa�o sideral, trazidas por cometas e asteroides. H� experi�ncias, no
entanto, que demonstram que a combina��o qu�mica de subst�ncias inorg�nicas gasosas
presentes na Terra primitiva poderia ter originado mol�culas org�nicas.
A primeira experi�ncia nessa dire��o foi idealizada pelo qu�mico estadunidense
Stanley Lloyd Miller (1930-2007) e estabeleceu as bases experimentais da evolu��o
molecular na origem da vida. Em 1953, Stanley Miller, um jovem aluno do eminente
qu�mico Harold C. Urey (1893-1981), construiu um aparelho que simulava as condi��es
supostamente existentes na Terra primitiva. Nesse simulador, formado por tubos e
bal�es de vidro interligados, Miller colocou uma mistura de metano (CH4), am�nia
(NH3), hidrog�nio (H2) e vapor-d'�gua (H2O), gases que, se supunha na �poca,
constitu�am a atmosfera da primitiva Terra quando a vida surgiu.
A mistura gasosa foi submetida ao calor e a fortes descargas el�tricas por alguns
dias. Segundo Miller, essas deviam ser as condi��es atmosf�ricas no in�cio da
exist�ncia de nosso planeta. No simulador havia tamb�m um condensador, no qual a
mistura de gases era resfriada.

P�gina 38

O vapor-d'�gua presente na mistura se condensava e escorria para a parte inferior


do aparelho, onde se acumulava. Com isso, Miller simulava as chuvas e o ac�mulo de
�gua nos mares e lagos da Terra primitiva. Por fim, um aquecedor fazia ferver a
�gua acumulada, que voltava a se transformar em vapor, simulando a evapora��o da
�gua na superf�cie quent�ssima da jovem Terra. Ap�s deixar o simulador funcionando
por cerca de uma semana, Miller realizou testes qu�micos no l�quido avermelhado que
se acumulara na parte inferior do aparelho e encontrou v�rias subst�ncias ausentes
no in�cio do experimento, entre elas os amino�cidos alanina e glicina, al�m de
outras subst�ncias org�nicas mais simples. (Fig. 2.7)

ADILSON SECCO

ROGER RESSMEYER/CORBIS/LATINSTOCK
Figura 2.7 A. Representa��o esquem�tica do simulador utilizado por Miller em seu
experimento sobre a origem da vida. (Elementos fora de propor��o de tamanho entre
si; cores-fantasia.) B. Stanley Miller usando os equipamentos de seu laborat�rio
original para recriar seu experimento da d�cada de 1950. (Fotografia de 1983.)
Esse experimento tem hoje significado apenas hist�rico, pois novos dados sugerem
que a composi��o atmosf�rica da Terra primitiva era diferente da mistura de gases
empregada no simulador de Miller. Evid�ncias recentes indicam que a atmosfera
terrestre, entre 4 e 3,5 bilh�es de anos atr�s, era provavelmente constitu�da por
80% de g�s carb�nico (CO2), 10% de metano (CH4), 5% de mon�xido de carbono (CO) e
5% de g�s nitrog�nio (N2), al�m de vapor-d'�gua.
Seguindo os passos de Miller, diversos outros experimentos simularam as condi��es
supostamente existentes na Terra primitiva, com produ��o de diversas subst�ncias
org�nicas encontradas nos seres vivos. Isso d� sustenta��o � hip�tese de que, nas
condi��es reinantes nos prim�rdios do nosso planeta, a mat�ria precursora da vida
poderia ter surgido por um processo abiog�nico.
Teoria da evolu��o molecular
Uma quest�o que ainda desafia os cientistas �: como os ingredientes precursores
puderam originar complexos moleculares dotados de metabolismo e de reprodu��o, ou
seja, seres vivos?
Atualmente, a maioria dos cientistas defende a ideia de que a vida surgiu por um
longo processo de evolu��o molecular, em que, inicialmente, compostos inorg�nicos
presentes na Terra primitiva reagiram entre si, originando mol�culas org�nicas como
amino�cidos, pequenos a��cares, bases nitrogenadas, �cidos graxos etc. Na
sequ�ncia, ao encontrar condi��es adequadas, essas primeiras mol�culas org�nicas
teriam se recombinado de v�rias maneiras, produzindo mol�culas mais complexas, como
prote�nas, lip�dios e �cidos nucleicos. Finalmente, essas mol�culas org�nicas
teriam originado "estruturas" capazes de controlar suas pr�prias rea��es qu�micas e
de se autoduplicar. Tais atributos seriam os primeiros esbo�os do metabolismo e da
reprodu��o, duas caracter�sticas fundamentais dos seres vivos.

P�gina 39

H� cientistas, no entanto, que defendem a ideia de que a vida na Terra surgiu pela
coloniza��o do planeta por subst�ncias precursoras de vida (ou mesmo seres vivos)
provenientes de outros locais do cosmo. Essa � a base da hip�tese da panspermia,
que voltou a ganhar for�a nos �ltimos anos com a descoberta de subst�ncias
org�nicas em meteoritos, asteroides e cometas. (Fig. 2.8)

HENRY BORTMAN/NASA
Os estudos da origem da vida enfrentam uma grande dificuldade: a falta de vest�gios
dos primeiros seres vivos, quase totalmente destru�dos pelas dr�sticas
transforma��es ocorridas na crosta terrestre nos primeiros milh�es de anos de sua
exist�ncia. J� foram encontrados vest�gios de atividade biol�gica em rochas datadas
de 2,7 bilh�es de anos, provavelmente deixados por ancestrais de cianobact�rias.
Acredita-se, entretanto, que a vida na Terra teve in�cio muito antes, h�
aproximadamente 3,5 bilh�es de anos, embora n�o existam evid�ncias f�sseis disso.
Figura 2.8 Astrobi�loga coletando amostras no Lago Mono (Calif�rnia, EUA, 2010).
Nesse lago foram encontrados microrganismos vivendo em condi��es at� ent�o
consideradas impr�prias para a exist�ncia de vida. Essa descoberta sugere a
exist�ncia de vida em outros lugares do cosmo, apoiando a hip�tese da panspermia.
A origem das primeiras c�lulas vivas
Nos seres vivos atuais, os processos qu�micos que caracterizam a vida ocorrem no
interior de c�lulas, compartimentos isolados do ambiente externo por uma fin�ssima
pel�cula envolvente, a membrana plasm�tica. Esse envolt�rio permite a manuten��o de
um ambiente celular interno diferenciado e adequado aos processos e �s rea��es
qu�micas essenciais � vida. A ruptura da membrana leva � desorganiza��o da
estrutura celular e � morte da c�lula.
A import�ncia da membrana para a c�lula viva levou os cientistas a imaginar que uma
etapa fundamental na origem da vida foi o aparecimento de sistemas qu�micos
delimitados por membranas que os separavam do meio externo. Tais sistemas podem ter
se formado em charcos, lagos e oceanos primitivos, seja a partir de aglomerados de
mol�culas org�nicas originadas na pr�pria Terra, como acreditam os defensores da
hip�tese da evolu��o molecular, seja a partir de mol�culas vindas do espa�o em
corpos celestes que atingiram a Terra, como pensam os defensores da panspermia.
Experimentos de laborat�rio d�o pistas sobre o que pode ter ocorrido com as
mol�culas precursoras da vida acumuladas na Terra primitiva. Quando se adicionam
experimentalmente prote�nas em solu��es aquosas com certo grau de acidez e
salinidade, podem-se obter aglomerados proteicos microsc�picos, em alguns casos
relativamente est�veis, gra�as � forma��o de uma pel�cula de mol�culas de �gua ao
redor das prote�nas. Tamb�m se observou que, em certas condi��es especiais, as
pr�prias prote�nas podem se organizar formando pel�culas ao redor de aglomerados de
mol�culas org�nicas. Esses fatos levaram os cientistas a pensar que, nas condi��es
da Terra primitiva, mol�culas org�nicas podem ter se isolado e se organizado,
formando gl�bulos microsc�picos est�veis precursores da vida.
O salto definitivo rumo aos seres vivos teria ocorrido h� pelo menos 3,5 bilh�es de
anos, no momento em que esses gl�bulos microsc�picos adquiriram estabilidade e
capacidade de produzir seus pr�prios componentes, podendo crescer e se reproduzir.
Como teria se dado esse passo crucial na evolu��o da vida? Essa � uma pergunta para
a qual os pesquisadores ainda n�o t�m resposta. (Fig. 2.9)

PAULO MAN ZI
Figura 2.9 Representa��o esquem�tica da forma��o dos coacervados, como s�o chamados
os aglomerados microsc�picos de mol�culas org�nicas mantidas juntas pela forma��o
de pel�culas de �gua ao redor. (Elaborada com base em Campbell e cols., 1999.) O
processo de coacerva��o ganhou destaque ao ser proposto como um passo importante no
surgimento da vida pelos pesquisadores Alexander Oparin (1894-1980) e J. B. S.
Haldane (1892-1964), no final da d�cada de 1920. (Elementos fora de propor��o de
tamanho entre si; cores-fantasia.)

P�gina 40

As hip�teses heterotr�fica e autotr�fica


Embora n�o se saiba exatamente os caminhos pelos quais mol�culas org�nicas
originaram seres vivos, sup�e-se que as primeiras formas de vida eram microsc�picas
e delimitadas por uma membrana. No interior desses corp�sculos precursores da vida,
rea��es qu�micas ordenadas e controladas forneciam energia para transformar
mol�culas nutritivas em componentes do corp�sculo, possibilitando o crescimento e a
reprodu��o.
De que se alimentavam os primeiros seres vivos? Para tentar responder a essa
pergunta, vamos analisar a alimenta��o dos seres atuais. Nos dias de hoje, os seres
vivos t�m duas estrat�gias alimentares b�sicas: ou eles mesmos produzem seu
alimento ou o obt�m do meio onde vivem. No primeiro caso, fala-se em seres
autotr�ficos (do grego aut�s, pr�prio, e trophos, alimento), capazes de produzir
subst�ncias org�nicas a partir de g�s carb�nico (CO2) e de energia do ambiente. S�o
autotr�ficos alguns tipos de bact�rias, todas as algas e todas as plantas atuais,
com exce��o de algumas plantas parasitas.
No segundo caso, fala-se em seres heterotr�ficos (do grego heteros, diferente); por
serem incapazes de produzir o pr�prio alimento, esses seres t�m de obt�-lo do meio
externo na forma de mol�culas org�nicas. S�o heterotr�ficos os fungos, diversas
bact�rias, a quase totalidade dos protozo�rios e todos os animais.
Durante muito tempo predominou a ideia de que os primeiros seres vivos seriam
heterotr�ficos. Os defensores dessa ideia, conhecida como hip�tese heterotr�fica,
acreditavam que as mesmas subst�ncias que originaram os primeiros seres vivos
tamb�m podiam ter-lhes servido de alimento. A obten��o de energia a partir de
subst�ncias nutritivas ocorreria por um processo semelhante � fermenta��o realizada
por certos fungos e bact�rias que conhecemos hoje.
Atualmente, a hip�tese mais aceita sobre como se nutriam os primeiros seres vivos �
a hip�tese autotr�fica. Seus defensores argumentam que na Terra primitiva n�o havia
mol�culas org�nicas em quantidade suficiente para sustentar a multiplica��o dos
primeiros seres vivos. De acordo com os conhecimentos atuais, os primeiros
habitantes da Terra poderiam ter sido quimiolitoautotr�ficos (do grego lit�s,
rocha), ou seja, capazes de produzir suas pr�prias subst�ncias alimentares a partir
da energia liberada em rea��es entre componentes inorg�nicos.
A hip�tese autotr�fica vem se consolidando gra�as � descoberta de microrganismos
capazes de viver em ambientes in�spitos, como fontes de �gua quente e vulc�es
submarinos. Certos microrganismos quimiolitoautotr�ficos atuais podem viver ao
redor de fendas vulc�nicas submersas, onde h� libera��o de sulfeto de hidrog�nio
(H2S). A exist�ncia de organismos em condi��es t�o extremas como essas refor�a a
ideia de que a vida pode ter surgido nesses ambientes, supostamente abundantes na
Terra primitiva. (Fig. 2.10)

DR. KEN MACDONALD/SCIENCE PHOTO LIBRARY/LATINSTOCK


Figura 2.10 Fonte termal submarina. A descoberta, em meados da d�cada de 1970, de
comunidades biol�gicas vivendo em total escurid�o nas profundezas oce�nicas, a mais
de 2.500 m de profundidade, e alimentadas por bact�rias quimiolitoautotr�ficas d�
for�a � hip�tese de que seres como esses, que obtinham energia de rea��es qu�micas
inorg�nicas como as que ocorrem em fontes termais, podem ter sido as primeiras
formas de vida na Terra.
De acordo com a hip�tese autotr�fica, a partir dos primeiros seres
quimiolitoautotr�ficos teriam surgido os outros tipos de seres vivos: inicialmente
os que realizam fermenta��o, depois os fotossintetizantes e, por fim, os que
respiram g�s oxig�nio (aer�bicos).

P�gina 41

ATIVIDADES
Revendo conceitos, fatos e processos
Registre em seu caderno
Escreva, em seu caderno, o termo abaixo que substitui corretamente a tarja entre
par�nteses das frases de 1 a 6.
a) c�lula
b) hip�tese autotr�fica
c) hip�tese da panspermia
d) hip�tese heterotr�fica
e) quimiolitoautotr�fico
f) teoria da evolu��o molecular
1. A denomina��o (.....) aplica-se a organismos capazes de obter energia a partir
de rea��es qu�micas entre componentes minerais.
2. (.....) � considerada a unidade dos seres vivos, onde ocorrem as rea��es
qu�micas essenciais � vida.
3. A frase "A Terra foi colonizada por vida proveniente do espa�o" resume o(a)
(.....).
4. A descoberta de bact�rias, capazes de obter energia a partir de componentes
inorg�nicos da crosta terrestre refor�a o(a) (.....).
5. A ideia de que subst�ncias originalmente presentes na Terra primitiva formaram
subst�ncias precursoras da vida e os primeiros seres vivos resume o(a) (.....).
6. Os primeiros seres vivos obtinham alimento a partir de subst�ncias org�nicas
presentes no meio em que tinham surgido. Essa frase resume o(a) (.....).
7. A teoria do big bang, tamb�m chamada de teoria da grande explos�o, explica como
a) surgiu a vida na Terra.
b) se formam as estrelas.
c) surgiu o planeta Terra.
d) surgiu o universo.
8. Os cientistas acreditam que a vida na Terra surgiu aproximadamente h�
a) 10 mil anos.
b) 5 milh�es de anos.
c) 65 milh�es de anos.
d) 3,5 bilh�es de anos.
9. A import�ncia do trabalho de Miller foi ter demonstrado, pela primeira vez, que
a) os primeiros seres vivos vieram do espa�o.
b) a vida surgiu nos mares primitivos.
c) mol�culas org�nicas poderiam ter se formado a partir de gases da atmosfera
primitiva.
d) os primeiros seres vivos eram heterotr�ficos.
10. A descoberta de microrganismos quimiossintetizantes capazes de viver em locais
in�spitos, obtendo energia das rochas, constitui uma evid�ncia a favor da
a) hip�tese autotr�fica.
b) hip�tese da panspermia.
c) hip�tese heterotr�fica.
d) teoria da evolu��o molecular.
e) teoria do big bang.
Quest�es para exercitar o pensamento
Registre em seu caderno
11. Alimentos preparados adequadamente e guardados em frascos hermeticamente
fechados conservam-se inalterados por muito tempo. Um exemplo � o leite longa vida,
que se conserva fora da geladeira por v�rios meses. Na embalagem de algumas marcas
de leite podem ser lidos os seguintes avisos: "Ap�s a abertura da embalagem, deve
ser conservado sob refrigera��o"; "Tratado pelo processo UHT (ultra high
temperature) � temperatura de 150 �C por 2-4 segundos, tornando-se est�ril".
Responda:
a) O que significa dizer que o processo UHT torna o leite est�ril?
b) Qual � a raz�o da recomenda��o do fabricante para conservar o leite longa vida
sob refrigera��o depois de abrir a embalagem?
c) Neste cap�tulo, foram explicados os princ�pios da t�cnica de pasteuriza��o, que
tamb�m � utilizada para conservar o leite. Em que a pasteuriza��o difere do
processo UHT?
12. Desenhe uma "linha do tempo" na qual ser�o representados, em escala, alguns
eventos ocorridos desde o big bang at� os dias de hoje. Sugerimos que utilize uma
folha grande de papel quadriculado ou milimetrado, ou uma folha de cartolina na
qual ser�o medidas as divis�es do tempo com uma r�gua. Desenhe uma linha horizontal
e marque, na extremidade � esquerda, "15 bilh�es de anos atr�s". Na extremidade �
direita da linha, marque "zero", que corresponde ao tempo atual. Divida a linha em
15 partes, cada uma delas correspondendo a 1 bilh�o de anos. Pesquise, no cap�tulo,
a �poca aproximada em que ocorreram os seguintes eventos:
a) big bang (grande explos�o);
b) origem do elemento hidrog�nio;
c) origem das primeiras estrelas;
d) origem do Sistema Solar;
e) origem da Terra;
f) surgimento dos primeiros oceanos;
g) surgimento dos primeiros seres vivos.

P�gina 42

Marque cada um desses acontecimentos na sua linha do tempo. Lembre-se de que �


importante distribuir os eventos em escala, o que nos ajuda a concretizar as
diferen�as temporais entre eles. Utilize sua criatividade para ilustrar a linha do
tempo com imagens representativas, no estilo dos infogr�ficos usados em jornais e
revistas.
Fa�a voc� mesmo!
Registre em seu caderno
13. Divulga��o cient�fica: Criando uma resenha de uma not�cia de jornal
Nesta atividade, seu desafio � fazer uma resenha de um artigo de divulga��o
cient�fica publicado em um jornal. Selecionamos uma reportagem que se relaciona com
o conte�do do cap�tulo. Futuramente, voc� e seus colegas poder�o fazer o mesmo com
outras reportagens e divulgar suas resenhas no mural da escola, na internet ou em
um jornal cient�fico da classe. Veja nossas sugest�es para a atividade:
1. Leia atentamente cada par�grafo, resumindo cada um com frases curtas e diretas;
elas ser�o a base de sua resenha. Se achar que algum trecho pode ser reproduzido
tal como aparece, coloque-o entre aspas, como cita��o.
2. O texto apresenta alguns conceitos estudados na disciplina de Qu�mica ao
explorar, por exemplo, o motivo de a �gua n�o congelar, mesmo estando a -13 �C, e a
mudan�a de cor na �gua quando exposta ao ar. Na sua resenha, explore um pouco mais
esses aspectos, para garantir que o leitor os compreenda.
3. Organize seu texto e acrescente figuras, se julgar necess�rio. Lembre-se de que
a diagrama��o, isto �, a organiza��o visual, � importante para captar o interesse
dos leitores.
Estudo acha vida em salmoura isolada por 20 m de gelo na Ant�rtida
Poucos ambientes parecem menos promissores para a vida do que uma salmoura
resfriada a -13 graus Celsius, mas um ambiente desse tipo � lar de uma
diversificada comunidade de bact�rias no interior da Ant�rtida.
Mais intrigante ainda, esse ecossistema improv�vel parece estar isolado de fontes
externas de energia e nutrientes h� pelo menos 3.000 anos, afirmam os cientistas
americanos que o exploraram pela primeira vez em artigo na revista cient�fica PNAS.
Alison Murray e seus colegas do Centro de Pesquisas do Deserto em Reno (sudoeste
dos EUA) acharam as bact�rias depois de cuidadosas perfura��es no manto de pelo
menos 20 m que recobre o lago Vida.
N�o se sabe exatamente a profundidade do lago. Tamb�m n�o est� claro se, abaixo da
grossa camada de gelo, existiria algo parecido com uma lagoa l�quida.
O que d� para dizer � que, abaixo de certa profundidade, a placa s�lida de gelo
come�a a dar lugar a uma rede de canais por onde corre a salmoura onde vivem as
bact�rias do lago.
O l�quido n�o congela totalmente, mesmo com a temperatura bem abaixo de zero, por
causa da elevada quantidade de cloreto de s�dio (o popular sal de cozinha)
dissolvida nele. Por causa disso, essa �gua � seis vezes mais salgada que a do mar.
Levemente amarelo, o l�quido cont�m tanto ferro que fica laranja-escuro quando
exposto � atmosfera (dentro do lago, praticamente n�o existe oxig�nio). Tamb�m h�
elevadas quantidades de enxofre e nitrog�nio ali.
Mesmo assim, an�lises de DNA e observa��es de amostras da salmoura feitas com
microsc�pios revelaram a presen�a de exemplares de pelo menos oito filos
bacterianos (um filo � um agrupamento que re�ne grande diversidade de esp�cies; o
dos cordados, por exemplo, abrange todos os vertebrados, do homem aos peixes).
Tudo indica que v�rias dessas esp�cies nunca foram detectadas antes. H� sinais de
que elas est�o sobrevivendo em "marcha lenta" desde que ficaram isoladas ali - sem
uma explos�o populacional, mas mantendo seu metabolismo numa taxa baixa e
relativamente constante.
O mist�rio � como elas estariam fazendo isso. Uma possibilidade � que estejam se
aproveitando, por exemplo, do hidrog�nio produzido pelas rochas da regi�o, em
contato com o lago, para produzir alguma energia.
Vai ser preciso mais trabalho para entender o que est� ocorrendo no lago Vida, mas
a descoberta j� d� f�lego a uma busca bem mais ampla: a ca�ada por micr�bios dur�es
fora do nosso planeta.
� que as condi��es do lago ant�rtico n�o s�o t�o diferentes assim das que existem
em oceanos congelados de locais como Europa, uma das luas de J�piter.
Folha de S.Paulo, Ci�ncia, 27 nov. 2012. Dispon�vel em:
<http://www1.folha.uol.com.br/ciencia/2012/11/1191657-estudo-acha-vida-em-salmoura-
isolada-por-20-m-degelo-na-antartida.shtml>. Acesso em: mar. 2016.
A Biologia no vestibular e no Enem
Registre em seu caderno
Quest�es objetivas
1. (Unifal-MG) Do in�cio da vida na Terra at� o aparecimento dos seres vivos
atuais, aconteceram v�rios eventos, como, por exemplo:

P�gina 43

I. forma��o das primeiras c�lulas;


II. forma��o de mol�culas org�nicas complexas;
III. aparecimento de organismos capazes de produzir alimentos pela fotoss�ntese;
IV. surgimento dos primeiros organismos aer�bicos.
Determine a alternativa que indica a ordem mais aceita atualmente para o
acontecimento desses eventos.
a) I; II; IV; III.
b) II; III; IV; I.
c) I; IV; III; II.
d) II; I; III; IV.
2. (UFMG) Recentes pesquisas espaciais constataram a exist�ncia, na Via L�ctea, de
sistemas solares com planetas cuja atmosfera � semelhante � atmosfera primitiva da
Terra. Essa atmosfera primitiva caracteriza-se pela aus�ncia de
a) am�nia.
b) g�s carb�nico.
c) metano.
d) oxig�nio.
e) vapor-d'�gua.
3. (UFRGS-RS) A primeira coluna apresenta o nome de teorias sobre a evolu��o da
vida na Terra; a segunda, afirma��es relacionadas a tr�s dessas teorias.
1 - Abiog�nese
2 - Biog�nese
3 - Panspermia
4 - Evolu��o qu�mica
5 - Hip�tese autotr�fica
(.....) Os primeiros seres vivos utilizaram compostos inorg�nicos da crosta
terrestre para produzir suas subst�ncias alimentares.
(.....) A vida na Terra surgiu a partir de mat�ria proveniente do espa�o c�smico.
(.....) Um ser vivo s� se origina de outro ser vivo.
A sequ�ncia correta de preenchimento dos par�nteses, de cima para baixo, �
a) 4 - 2 - 1.
b) 4 - 3 - 2.
c) 1 - 2 - 4.
d) 5 - 1 - 3.
e) 5 - 3 - 2.
4. (UEL-PR) Charles Darwin, al�m de postular que os organismos vivos evolu�am pela
a��o da sele��o natural, tamb�m considerou a possibilidade de as primeiras formas
de vida terem surgido em algum lago t�pido do nosso planeta. Entretanto, existem
outras teorias que tentam explicar como e onde a vida surgiu. Uma delas, a
panspermia, sustenta que
a) as primeiras formas de vida podem ter surgido nas regi�es mais in�spitas da
Terra, como as fontes hidrotermais do fundo dos oceanos.
b) compostos org�nicos simples, como os amino�cidos, podem ter sido produzidos de
maneira abi�tica em v�rios pontos do planeta Terra.
c) bact�rias ancestrais podem ter surgido por toda a Terra, em fun��o dos
requisitos m�nimos necess�rios para a sua forma��o e subsist�ncia.
d) a capacidade de replica��o das primeiras mol�culas org�nicas foi o que permitiu
que elas se difundissem pelos oceanos primitivos da Terra.
e) a vida se originou fora do planeta Terra, tendo sido trazida por meteoritos,
cometas ou ent�o pela poeira espacial.
Quest�es discursivas
5. (Uerj) A procura de formas de vida em nosso Sistema Solar tem dirigido o
interesse de cientistas para Io, um dos sat�lites de J�piter, que � coberto por
grandes oceanos congelados. As condi��es na superf�cie s�o extremamente agressivas,
mas sup�e-se que, em grandes profundidades, a �gua esteja em estado l�quido e a
atividade vulc�nica submarina seja frequente. Considerando que tais condi��es s�o
similares �s do bioma abissal da Terra, aponte o tipo de bact�ria que poderia ter
se desenvolvido em Io e indique como esse tipo de bact�ria obt�m energia para a
s�ntese de mat�ria org�nica.
6. (Unicamp-SP) Em 1953, Miller e Urey realizaram experimentos simulando as
condi��es da Terra primitiva: supostamente altas temperaturas e atmosfera composta
pelos gases metano, am�nia, hidrog�nio e vapor-d'�gua, sujeita a descargas
el�tricas intensas. A figura a seguir representa o aparato utilizado por Miller e
Urey em seus experimentos.

PAULO MANZI
a) Qual a hip�tese testada por Miller e Urey nesse experimento?
b) Cite um produto obtido que confirmou a hip�tese.
c) Como se explica que o O2 tenha surgido posteriormente na atmosfera?

P�gina 44

Cap�tulo 3 Bases moleculares da vida


MARUO FERMARIELLO/SCIENCE PHOTO LIBRARY/LATINSTOCK
Mol�culas de DNA de diferentes amostras podem ser comparadas por meio da t�cnica de
eletroforese. Nesse processo, os DNAs s�o cortados com "tesouras" moleculares
(enzimas de restri��o), resultando em um padr�o de fragmentos para cada tipo de DNA
analisado. Fragmentos de diferentes tamanhos s�o ent�o separados em uma folha de
gelatina especial ao serem for�ados a migrar sob efeito de um campo el�trico,
formando faixas na gelatina. Na foto podem ser observadas diferentes colunas, cada
uma correspondendo a uma amostra de DNA com seu padr�o de faixas caracter�stico. O
pesquisador aponta para uma dessas faixas.
A Qu�mica e a vida
O desenvolvimento da Qu�mica Org�nica nos s�culos XIX e XX foi fundamental para o
progresso da Biologia. Sem a base proporcionada pela Qu�mica seria imposs�vel
penetrar no mundo submicrosc�pico e descobrir como funcionam as c�lulas e os
organismos vivos no n�vel molecular.
At� as primeiras d�cadas do s�culo XIX, o estudo experimental das subst�ncias
org�nicas, hoje definidas como aquelas que apresentam carbono (C) e hidrog�nio (H)
em sua composi��o, n�o progrediu muito principalmente porque se acreditava que
subst�ncias org�nicas somente poderiam ser fabricadas no interior de organismos
vivos. A teoria da for�a vital ou vitalismo defendia que, para a fabrica��o de
subst�ncias org�nicas, era necess�ria uma "ess�ncia" imaterial, a for�a vital,
presente apenas em seres vivos.

P�gina 45

As ideias vitalistas come�aram a perder for�a a partir de 1828, quando o qu�mico


alem�o Friedrich W�hler (1800-1882) conseguiu fabricar ureia, uma subst�ncia
org�nica, a partir de cianato de am�nia, uma subst�ncia tipicamente inorg�nica. A
experi�ncia de W�hler mostrou que as subst�ncias presentes nos seres vivos podiam
ser fabricadas em laborat�rio por m�todos semelhantes aos j� utilizados pelos
qu�micos experimentais na produ��o de subst�ncias inorg�nicas.
Desde ent�o, a aplica��o de princ�pios e m�todos da Qu�mica ao estudo das
subst�ncias org�nicas tem sido proveitosa tanto para qu�micos como para bi�logos.
Para os qu�micos, abriu-se um novo e vasto campo de estudo, a Qu�mica Org�nica;
para os bi�logos, desenvolveu-se um novo ramo das Ci�ncias Naturais, a Bioqu�mica,
que estuda a qu�mica da vida.
Com base nos conhecimentos e nas t�cnicas de an�lise da Qu�mica tornou-se poss�vel
"dissecar" em laborat�rio qualquer subst�ncia org�nica, identificando seus �tomos
componentes e a maneira como eles se organizam nas mol�culas. Tamb�m se tornou
poss�vel produzir em laborat�rio praticamente qualquer subst�ncia org�nica
conhecida (prote�nas, a��cares, gorduras, �cidos nucleicos etc.), sem falar na
possibilidade de criar subst�ncias antes inexistentes na natureza. Atualmente s�o
produzidas diversas subst�ncias org�nicas "sint�ticas", isto �, fabricadas em
laborat�rio, que servem de mat�ria-prima para a ind�stria de pl�sticos, fibras,
borrachas, solventes e in�meros outros compostos. Laborat�rios farmac�uticos
produzem vitaminas, nutrientes e v�rios tipos de medicamentos, que curam e previnem
doen�as. Isso nos d� uma ideia de como a Qu�mica � importante.
A import�ncia do assunto
O desenvolvimento da Bioqu�mica revelou que a mais simples das c�lulas vivas �
formada por uma grande variedade de subst�ncias org�nicas e que centenas de
transforma��es moleculares ocorrem ininterruptamente no interior celular. Uma �nica
c�lula bacteriana, por exemplo, fabrica mais de 3 mil tipos de prote�na no curso de
sua curta exist�ncia, que pode ser de apenas 20 minutos.
Se considerarmos a variedade de elementos e de subst�ncias reunidos no espa�o
microsc�pico de uma c�lula, concluiremos que os seres vivos s�o os entes mais
complexos do universo conhecido. E � exatamente essa complexidade que caracteriza a
vida. Conhecer as principais subst�ncias que constituem os seres vivos e seus
processos bioqu�micos essenciais �, portanto, fundamental para se compreender o
fen�meno vida.
3.1 Componentes da mat�ria viva
Um passo importante para o progresso tanto da Qu�mica quanto da Biologia foi o
desenvolvimento da teoria at�mica, segundo a qual a mat�ria � constitu�da por
part�culas invis�veis a olho nu denominadas �tomos. De acordo com a teoria at�mica,
todas as subst�ncias existentes na natureza, inclusive as que formam os seres
vivos, s�o resultantes de combina��es peculiares entre os �tomos dos 89 elementos
qu�micos existentes na natureza. Por exemplo, sempre que dois �tomos do elemento
hidrog�nio (H) se combinam com um �tomo do elemento oxig�nio (O), forma-se uma
mol�cula de �gua (H2O). A combina��o de dois �tomos de hidrog�nio com um �tomo de
enxofre (S) forma um g�s malcheiroso denominado g�s sulf�drico (H2S).
Na mat�ria que constitui os seres vivos predominam �tomos de certos elementos
qu�micos, como carbono (C), hidrog�nio (H), oxig�nio (O), nitrog�nio (N), f�sforo
(P) e enxofre (S). Outros elementos qu�micos tamb�m constituem a mat�ria dos
organismos vivos, mas em propor��es bem menores. Esses seis elementos predominantes
na mat�ria viva constituem cerca de 98% da massa corporal da maioria das esp�cies
biol�gicas. O carbono � o elemento qu�mico presente em todas as mol�culas
org�nicas. A versatilidade dos �tomos de carbono, que podem ligar-se entre si e com
�tomos de diversos outros elementos, torna poss�vel a grande variedade de mol�culas
org�nicas. Acompanhe no infogr�fico "�tomos e liga��es qu�micas" a seguir algumas
informa��es sobre a estrutura at�mica da mat�ria. (Fig. 3.1)

P�gina 46

�tomos e liga��es qu�micas


Um �tomo � t�o pequeno que, se 10 milh�es deles fossem colocados lado a lado,
mediriam apenas 1 mil�metro de comprimento. Apesar de suas dimens�es reduzidas, o
�tomo � constitu�do principalmente por espa�o vazio. O di�metro do n�cleo at�mico �
cerca de 10 mil vezes menor que o di�metro do �tomo, definido pela �ltima camada de
el�trons que se movimentam ao redor do n�cleo. Por compara��o, se um �tomo fosse
ampliado at� o tamanho do est�dio do Maracan�, seu n�cleo teria o tamanho da cabe�a
de um alfinete.

GRAMADO: TURGAY KOCA/SHUTTERSTOCK ALFINETE: BLACKSNAKE/SHUTTERSTOCK


DMITRY_ISLENTEV/SHUTTERSTOCK
Est�dio do Maracan� (RJ).
Todo �tomo apresenta um n�cleo ao redor do qual h� el�trons em movimento, que
constituem sua eletrosfera. O n�cleo at�mico � formado por dois tipos de
part�culas: pr�tons, que apresentam carga el�trica positiva, e n�utrons, que n�o
apresentam carga el�trica. Cada tipo de elemento qu�mico caracteriza-se pelo n�mero
de pr�tons presentes em seu n�cleo at�mico: � o chamado n�mero at�mico.

El�trons s�o part�culas de massa muito menor que a massa dos pr�tons e n�utrons
(cujas massas s�o aproximadamente iguais) e apresentam carga el�trica negativa. Um
�tomo apresenta sempre o mesmo n�mero de pr�tons e de el�trons, o que significa que
um �tomo � neutro em termos de carga el�trica total, j� que as cargas de pr�tons e
el�trons se equivalem.
Pelo modelo de Rutherford-Bohr, os el�trons se movem em n�veis (camadas
eletr�nicas). O n�mero de camadas eletr�nicas presentes na eletrosfera depende da
quantidade de el�trons do �tomo e cada n�vel eletr�nico pode conter um n�mero
m�ximo de el�trons.

ILUSTRA��ES: CAN�ADO
�tomos podem se unir por meio de liga��es qu�micas, que envolvem a participa��o de
el�trons presentes nas camadas eletr�nicas mais externas da eletrosfera. Por
exemplo, em sais como o cloreto de s�dio, o sal de cozinha, um �tomo de s�dio (Na)
fornece um el�tron para o cloro (Cl). Com isso, o elemento doador fica com um
el�tron a menos e adquire carga el�trica positiva, transformando-se no �on positivo
Na+. O cloro, receptor de el�trons, por sua vez, adquire carga negativa,
transformando-se no �on negativo Cl-. Os �ons Na+ e Cl- se atraem e formam uma
liga��o i�nica. Em compostos como a �gua, formada pela uni�o de dois �tomos de
hidrog�nio (H) com um �tomo de oxig�nio (O), os �tomos que se ligam n�o doam
el�trons como na liga��o i�nica, mas os compartilham, formando um tipo de liga��o
qu�mica chamado de liga��o covalente.
Figura 3.1 Infogr�fico que ilustra algumas rela��es existentes na estrutura at�mica
da mat�ria. (Elementos fora de propor��o de tamanho entre si; cores-fantasia.)

P�gina 47

3.2 �gua e sais minerais


A �gua � a subst�ncia mais abundante em um ser vivo, constituindo cerca de 75% a
85% de sua massa corporal. O restante distribui-se entre prote�nas (10% a 15%),
lip�dios (2% a 3%), glic�dios (1%) e �cidos nucleicos (1%), al�m de 1% de sais
minerais e de outras subst�ncias. Por exemplo, se desidrat�ssemos hipoteticamente
uma pessoa de 60 kg, ela ficaria reduzida a apenas 12 kg, sendo aproximadamente 8,5
kg de prote�nas, 1,8 kg de lip�dios, 0,5 kg de a��cares, 0,5 kg de �cidos nucleicos
e 0,5 kg de outras subst�ncias e minerais diversos.
A mol�cula de �gua, cuja f�rmula qu�mica � H2O, constitui-se de um �tomo de
oxig�nio (O) unido, por liga��es covalentes, a dois �tomos de hidrog�nio (H). Eles
formam entre si um �ngulo de 104,5� (cento e quatro graus e meio), o que torna a
mol�cula de �gua polarizada e explica muitas de suas propriedades. (Fig. 3.2)

ADILSON SECCO
Figura 3.2 A mol�cula de �gua � polarizada: a regi�o da mol�cula em que se localiza
o �tomo de oxig�nio tem carga el�trica parcialmente negativa, representada por ?-,
e a regi�o em que se localizam os �tomos de hidrog�nio tem carga el�trica
parcialmente positiva, simbolizada por ?+. (Elementos fora de propor��o de tamanho
entre si; cores-fantasia.)
Import�ncia da �gua para a vida
A �gua como solvente
Atividades essenciais � vida, como o transporte de determinadas subst�ncias e a
maioria das rea��es qu�micas enzim�ticas, necessitam que as mol�culas reagentes
estejam dissolvidas em um meio l�quido. A �gua desempenha papel fundamental nos
seres vivos por ser capaz de dissolver grande variedade de subst�ncias qu�micas,
tais como sais, gases, a��cares, amino�cidos, prote�nas e �cidos nucleicos; por
isso, costuma-se atribuir � �gua o t�tulo de "solvente universal".
Subst�ncias cujas mol�culas t�m afinidade por �gua, dissolvendo-se nela, s�o
chamadas de hidrof�licas (do grego hydro, �gua, e philos, amigo). A solubilidade
dessas subst�ncias deve-se ao fato de haver, nas mol�culas hidrof�licas, regi�es
eletricamente carregadas, por isso capazes de interagir com as mol�culas
polarizadas da �gua. Exemplos de subst�ncias org�nicas hidrof�licas s�o grande
parte dos glic�dios e muitas prote�nas.
Ao contr�rio, subst�ncias que n�o se dissolvem em �gua s�o chamadas de hidrof�bicas
(do grego hydro, �gua, e phobos, medo, avers�o). A insolubilidade dessas
subst�ncias decorre do fato de suas mol�culas n�o apresentarem cargas el�tricas,
isto �, serem apolares; por isso, elas n�o conseguem interagir com as mol�culas
polarizadas da �gua e agregam-se, sem se dissolver. Exemplos de subst�ncias
hidrof�bicas s�o os �leos e as gorduras.
A �gua nas rea��es qu�micas dos seres vivos
Nos seres vivos ocorrem ininterruptamente muitos tipos de rea��es qu�micas, por
meio das quais as c�lulas obt�m energia e produzem subst�ncias necess�rias � sua
vida; a �gua est� presente em muitos desses processos. H� determinadas rea��es
qu�micas em que ocorre uni�o (s�ntese) de certos tipos de mol�culas, com forma��o
de �gua como produto. Elas s�o denominadas rea��es de condensa��o ou s�nteses por
desidrata��o. Tamb�m h� rea��es em que ocorre quebra (an�lise) de mol�culas
org�nicas com participa��o da �gua como reagente; elas s�o denominadas rea��es de
hidr�lise (do grego, hydro, �gua e lise, quebra), que significa "quebra pela �gua".
(Fig. 3.3)

P�gina 48
Figura 3.3 � esquerda, rea��o de condensa��o entre dois amino�cidos, em que ocorre
uma s�ntese por desidrata��o. � direita, uma rea��o de hidr�lise, em que a �gua
participa como reagente na quebra molecular, no caso, a digest�o do a��car
sacarose, que resulta em glicose e frutose.
A �gua como moderador de temperatura
A maioria dos seres vivos s� consegue viver em uma certa faixa de temperatura, fora
da qual ocorre a morte ou o metabolismo cessa. Nesse aspecto, a �gua � importante
para ajudar a evitar varia��es bruscas na temperatura dos organismos, isso porque a
�gua apresenta alto calor espec�fico, sendo capaz de absorver ou ceder grandes
quantidades de calor com pequena altera��o de temperatura.
A �gua tamb�m apresenta elevado calor latente de vaporiza��o, ou seja, necessita
absorver grande quantidade de calor para passar do estado l�quido ao gasoso. A
evapora��o da �gua � importante para os seres vivos, pois, gra�as a ela, os
organismos que vivem em terra firme evitam o superaquecimento. As folhas das
plantas, por exemplo, n�o se aquecem demais durante um dia de sol intenso porque a
maior parte do calor que recebem � utilizado para evaporar a �gua nelas contida, no
processo de transpira��o foliar. A evapora��o do suor de nossa pele ajuda a
resfriar a superf�cie do corpo em um dia quente ou quando fazemos atividades
f�sicas que geram calor em excesso.
Import�ncia biol�gica da coes�o e da ades�o da �gua
Duas propriedades da �gua - a coes�o e a ades�o - s�o extremamente importantes para
a vida. Coes�o � o fen�meno em que as mol�culas de �gua se mant�m unidas umas �s
outras por meio de liga��es de hidrog�nio. (Fig. 3.4)

ADILSON SECCO
Figura 3.4 As regi�es eletricamente positivas de uma mol�cula de �gua atraem a
regi�o eletricamente negativa de outras, formando liga��es de hidrog�nio.
(Elementos fora de propor��o de tamanho entre si; cores-fantasia.)
Ades�o � o fato de as mol�culas de �gua, por serem polarizadas, aderirem a
superf�cies constitu�das por subst�ncias polares. Essa propriedade faz com que a
�gua "molhe", isto �, seja capaz de aderir a diversos materiais, como tecidos de
algod�o, papel etc. Al�m disso, a ades�o possibilita � �gua subir pelas paredes
internas de tubos muito finos, fen�meno denominado capilaridade. Nas plantas, as
propriedades de ades�o e coes�o da �gua permitem o deslocamento da seiva mineral,
desde as ra�zes, nas quais ela � absorvida do solo, at� as folhas no topo das
�rvores.

P�gina 49

Sais minerais e sua import�ncia biol�gica


Sais minerais s�o subst�ncias inorg�nicas formadas por �ons, muitos deles
fundamentais para o bom funcionamento dos seres vivos. A falta de certos minerais
pode afetar seriamente o metabolismo e at� mesmo causar a morte. Nos animais
vertebrados, por exemplo, os �ons de c�lcio (Ca2+) participam das rea��es de
coagula��o do sangue e da contra��o muscular, al�m de serem componentes
fundamentais dos ossos. Os �ons de magn�sio (Mg2+), de mangan�s (Mn2+) e de zinco
(Zn2+), entre outros, participam de rea��es qu�micas vitais �s c�lulas. Os �ons de
s�dio (Na+) e de pot�ssio (K+) s�o respons�veis, entre outras fun��es, pela atua��o
das c�lulas nervosas. �ons inorg�nicos, como os fosfatos (PO43-) e os carbonatos
(CO32-), s�o importantes para o controle da acidez do ambiente interno das c�lulas.
A acidez resulta da concentra��o relativa de �ons hidrog�nio (H+) no meio, que os
qu�micos denominam potencial hidrogeni�nico ou pH. Quanto maior a concentra��o de
H+ em um meio, maior a sua acidez e mais baixo o valor do pH (pH = -log [H+]). O pH
neutro � igual a 7. Muitas rea��es qu�micas essenciais � vida somente ocorrem se as
condi��es de acidez forem favor�veis, e sais como os fosfatos e os carbonatos s�o
capazes de neutralizar o excesso de �ons H+.
3.3 Glic�dios e lip�dios
Caracter�sticas gerais dos glic�dios
Glic�dios, tamb�m chamados de carboidratos ou hidratos de carbono, s�o mol�culas
org�nicas constitu�das fundamentalmente por �tomos de carbono, hidrog�nio e
oxig�nio.
Os glic�dios s�o a principal fonte de energia para os seres vivos e est�o presentes
em diversos tipos de alimento. Farinhas de trigo, de milho e de mandioca cont�m o
glic�dio amido; o a��car de cana, largamente utilizado no dia a dia, comp�e-se
basicamente do glic�dio sacarose; o leite cont�m o a��car lactose; frutos
adocicados cont�m frutose e glicose, entre outros tipos de glic�dio.
Al�m de seu papel energ�tico, os glic�dios tamb�m desempenham papel relevante na
estrutura corporal dos organismos. A celulose, por exemplo, forma a parede das
c�lulas vegetais e d� sustenta��o ao corpo das plantas, sendo um glic�dio com
fun��o estrutural. Outro exemplo de glic�dio estruturalmente importante � a
quitina, cuja mol�cula apresenta �tomos de nitrog�nio e constitui o mais importante
componente do exoesqueleto dos artr�podes (insetos, aranhas, camar�es etc.) e da
parede celular da maioria dos fungos. (Fig. 3.5)

DONNA BRUNET/KEYSTONE BRASIL


GERSON SOBREIRA/TERRASTOCK
Figura 3.5 A cana-de-a��car (Saccharum sp., na fotografia maior) produz grandes
quantidades do glic�dio sacarose, amplamente utilizado na alimenta��o humana. O
exoesqueleto que a cigarra do g�nero Magicicada est� abandonando (fotografia
menor), bem como o novo exoesqueleto formado, � constitu�do pelo polissacar�dio
nitrogenado denominado quitina, um tipo de glic�dio. Essa cigarra mede cerca de 2,5
cm de comprimento.
Os glic�dios tamb�m fazem parte da estrutura dos �cidos nucleicos (DNA e RNA), que
cont�m instru��es heredit�rias e controlam indiretamente a maior parte das
atividades celulares. O ATP (trifosfato de adenosina), a principal subst�ncia
envolvida nos processos energ�ticos biol�gicos, tamb�m apresenta um glic�dio - a
ribose - em sua composi��o.

P�gina 50

Classifica��o dos glic�dios


Os glic�dios podem ser classificados em tr�s grupos, de acordo com o tamanho e a
organiza��o de sua mol�cula: monossacar�dios, dissacar�dios e polissacar�dios.
Monossacar�dios s�o os glic�dios mais simples, que apresentam entre 3 e 7 �tomos de
carbono na mol�cula e f�rmula geral Cn (H2O)n. Monossacar�dios de tr�s carbonos s�o
denominados trioses, os de quatro carbonos s�o tetroses e assim por diante:
pentoses, hexoses e heptoses. Al�m desses nomes gen�ricos, os monossacar�dios t�m
nomes espec�ficos, de acordo com suas caracter�sticas qu�micas. Com certeza voc� j�
ouviu falar em glicose, frutose e galactose: elas s�o hexoses, isto �,
monossacar�dios com 6 carbonos na mol�cula. A ribose presente no RNA � um
monossacar�dio do tipo pentose. (Fig. 3.6)

Figura 3.6 F�rmulas dos monossacar�dios glicose, frutose, galactose, ribose e


desoxirribose. Nesses compostos, os �tomos de carbono unem-se formando an�is
pentagonais ou hexagonais. As f�rmulas est�o simplificadas e omitem os �tomos de
carbono localizados nos v�rtices dos an�is. Note que, nos exemplos, a desoxirribose
� o �nico dos cinco que n�o apresenta f�rmula geral Cn (H2O)n.
Dissacar�dios s�o glic�dios constitu�dos por dois monossacar�dios quimicamente
unidos. A sacarose, o principal a��car presente na cana-de-a��car, � um
dissacar�dio formado pela uni�o de glicose e frutose. Outro exemplo de dissacar�dio
� a lactose, o a��car do leite, constitu�do pela uni�o de glicose e galactose.
(Fig. 3.7)

Figura 3.7 F�rmulas dos dissacar�dios sacarose e lactose.


Polissacar�dios s�o mol�culas formadas pelo encadeamento de dezenas, centenas ou
milhares de monossacar�dios. Essas subst�ncias s�o o que os qu�micos denominam
pol�meros, nome gen�rico de mol�culas constitu�das pela uni�o de muitas unidades
id�nticas ou semelhantes. As unidades de um pol�mero s�o denominadas mon�meros,
neste caso, monossacar�dios. Exemplos de polis sacar�dios s�o o amido, o glicog�nio
e a celulose, pol�meros constitu�dos por mon�meros de glicose, e a quitina,
pol�mero cujo mon�mero � a N-acetilglucosamina.
Caracter�sticas gerais dos lip�dios
O termo lip�dio designa certos tipos de subst�ncias org�nicas como �leos, ceras e
gorduras, cuja principal caracter�stica � a insolubilidade em �gua e a solubilidade
em certos solventes org�nicos. Voc� provavelmente j� notou que �leos e gorduras s�o
insol�veis em �gua; a raz�o dessa insolubilidade � que as mol�culas dos lip�dios
s�o apolares e, assim, n�o t�m afinidade pelas mol�culas polares da �gua. (Fig.
3.8)

P�gina 51

FABIO COLOMBINI
Figura 3.8 A. Gotas de gordura sobre a �gua. �leos e gorduras n�o s�o sol�veis em
�gua, uma vez que suas mol�culas, sendo apolares, n�o t�m afinidade pelas mol�culas
polarizadas da �gua.

KACHALKIN OLEG/SHUTTERSTOCK
PASIEKA/SCIENCE PHOTO LIBRARY/LATINSTOCK
Figura 3.8 B. As aves aqu�ticas lubrificam as penas com subst�ncias oleosas
produzidas por uma gl�ndula especial localizada na cauda (a gl�ndula uropigiana).
Isso faz as penas repelirem a �gua, impedindo que a pele da ave se molhe (como
mostra a imagem no detalhe, com aumento aproximado de 10�). Na foto, pato do g�nero
Anas, que mede cerca de 60 cm de comprimento.
Classifica��o dos lip�dios
Os principais tipos de lip�dio s�o glicer�dios, esteroides, fosfolip�dios,
carotenoides e ceras.
Glicer�dios s�o constitu�dos por mol�culas do �lcool glicerol ligadas a uma, duas
ou tr�s mol�culas de �cidos graxos; neste �ltimo caso, os glicer�dios s�o
conhecidos como triglicer�dios ou triglic�rides. Os glicer�dios s�o os �leos e as
gorduras, subst�ncias que diferem quanto ao ponto de fus�o: os �leos s�o l�quidos �
temperatura ambiente, enquanto as gorduras s�o s�lidas.
O glicerol (C3H8O3) � um �lcool cujas mol�culas t�m tr�s �tomos de carbono, e a
cada um deles unem-se grupos hidroxila (-OH). �cidos graxos s�o formados por longas
cadeias de �tomos de carbono com um grupo terminal denominado carboxila (-COOH).
(Fig. 3.9)

Figura 3.9 F�rmula estrutural de um glicer�dio constitu�do por tr�s �cidos graxos
distintos. Note que dois dos �cidos graxos t�m cadeia carb�nica "reta"; eles s�o
quimicamente classificados como saturados por apresentarem apenas liga��es simples
entre os carbonos de sua cadeia. O �cido oleico, por sua vez, � classificado como
insaturado por apresentar uma dupla liga��o na cadeia carb�nica, o que a faz
apresentar uma "dobra". Por serem retas, mol�culas de �cidos graxos de cadeias
saturadas podem aproximar-se mais umas das outras, formando um empacotamento mais
denso; em consequ�ncia, o conjunto molecular � s�lido, como ocorre, por exemplo, na
margarina e na manteiga. Quando as cadeias carb�nicas dos �cidos graxos s�o
insaturadas, forma-se um empacotamento molecular mais frouxo, produzindo um
conjunto l�quido � temperatura ambiente, como ocorre no �leo vegetal. Em sua
opini�o, o lip�dio mostrado na f�rmula seria um �leo ou uma gordura? Por qu�?

DORLING KINDERSLEY/UI/KEYSTONE BRASIL

P�gina 52

Os seres vivos utilizam glicer�dios como subst�ncias de reserva de energia para


momentos de necessidade. Por exemplo, certas plantas armazenam grande quantidade de
�leo em suas sementes, cuja fun��o � alimentar o embri�o durante seu
desenvolvimento. A soja, o girassol e o milho, entre outras plantas, t�m sementes
oleaginosas, utilizadas pela humanidade na fabrica��o de �leo de cozinha. Aves e
mam�feros armazenam gordura em c�lulas especiais localizadas em uma camada sob a
pele. Al�m de servir de reserva energ�tica, a camada gordurosa subd�rmica atua como
isolante t�rmico, ajudando a manter constante a temperatura corporal.
A dieta humana saud�vel deve conter certa quantidade de gorduras e �leos, pois,
entre outras fun��es, eles s�o necess�rios para o organismo absorver as chamadas
vitaminas lipossol�veis (vitaminas A, D, E e K), que s� se dissolvem em lip�dios.
Al�m disso, tamb�m necessitamos de certos �cidos graxos que n�o conseguimos
produzir, os chamados lip�dios essenciais. Esses lip�dios, presentes em diversos
�leos vegetais e em peixes marinhos (por exemplo, no conhecido �leo de f�gado de
bacalhau), s�o importantes para a constru��o das membranas celulares e para a
s�ntese das prostaglandinas, subst�ncias que regulam diversos processos org�nicos,
como contra��o da musculatura lisa, agrega��o de plaquetas do sangue, processos
inflamat�rios etc.
Esteroides diferem marcadamente dos glicer�dios e das ceras (que ser�o estudadas a
seguir), constituindo uma categoria especial de lip�dios. As mol�culas de
esteroides s�o compostas por �tomos de carbono interligados, formando quatro an�is
carb�nicos aos quais est�o ligadas cadeias carb�nicas, grupos hidroxila ou �tomos
de oxig�nio. (Fig. 3.10)

Figura 3.10 F�rmulas de dois esteroides, o colesterol e a progesterona. Os


hex�gonos e os pent�gonos s�o representa��es simplificadas da f�rmula: em cada
v�rtice h� um �tomo de carbono ligado a �tomos de hidrog�nio, n�o mostrados. Note
que esses dois esteroides t�m o mesmo "esqueleto" b�sico, formado por quatro an�is
moleculares interligados.
O colesterol � um dos esteroides mais conhecidos principalmente por estar associado
ao infarto do cora��o e a doen�as do sistema cardiovascular. Sabe-se que a ingest�o
exagerada de colesterol, presente nas gorduras animais, pode trazer diversos
dist�rbios � sa�de. Entretanto, o colesterol � necess�rio ao organismo humano
porque � um importante componente das membranas das c�lulas animais, sendo tamb�m
precursor de horm�nios esteroides, como a progesterona e a testosterona.
Curiosamente, as membranas das c�lulas de plantas e de c�lulas bacterianas n�o
apresentam colesterol. Nos seres humanos, o colesterol � produzido principalmente
no f�gado ou obtido em alimentos de origem animal.
Fosfolip�dios s�o os principais componentes das biomembranas. Do ponto de vista
qu�mico, um fosfolip�dio � um glicer�dio combinado a um grupo fosfato. A mol�cula
de fosfolip�dio lembra um palito de f�sforo, com uma "cabe�a" eletricamente
carregada e uma haste sem carga el�trica, constitu�da por duas "caudas" de �cido
graxo. (Fig. 3.11)

ADILSON SECCO
Figura 3.11 Estrutura molecular da fosfatidilcolina (lecitina), fosfolip�dio
fundamental na composi��o das membranas das c�lulas vivas.

P�gina 53

Carotenoides s�o pigmentos de cor vermelha, laranja ou amarela, insol�veis em �gua


e sol�veis em �leos e solventes org�nicos. Est�o presentes nas c�lulas de todas as
plantas, nas quais desempenham papel no processo de fotoss�ntese. Os carotenoides
s�o importantes tamb�m para os animais. Por exemplo, a mol�cula de caroteno, um
carotenoide alaranjado presente na cenoura e em outros vegetais, � mat�ria-prima
para a produ��o da vitamina A, que auxilia na nossa vis�o, uma vez que � precursora
do retinal, uma subst�ncia sens�vel � luz presente na retina dos olhos dos
vertebrados.
Ceras s�o subst�ncias formadas por uma mol�cula de �lcool diferente do glicerol
unida a uma ou mais mol�culas de �cidos graxos. H� ceras constitu�das por mol�culas
de �lcool com at� 16 �tomos de carbono na cadeia. Por serem altamente insol�veis em
�gua, as ceras s�o �teis para diversos animais e plantas. As folhas de muitas
esp�cies vegetais t�m a superf�cie recoberta de cera, o que as torna bastante
imperme�veis, reduzindo a perda de �gua por transpira��o. As ceras est�o presentes
tamb�m no revestimento corporal de diversos insetos; certas esp�cies, como as
abelhas, utilizam cera na constru��o das colmeias.
Ci�ncia e cidadania
Colesterol e sa�de
1 Talvez voc� j� tenha ouvido falar em "colesterol bom" e "colesterol ruim". Essas
express�es n�o se referem � pr�pria mol�cula de colesterol, que � sempre a mesma,
mas a prote�nas sangu�neas encarregadas do transporte de colesterol e de diversos
outros lip�dios. Essas prote�nas associam-se a lip�dios formando lipoprote�nas,
conhecidas pelas siglas LDL (do ingl�s low density lipoprotein, lipoprote�na de
baixa densidade) e HDL (do ingl�s high density lipoprotein, lipoprote�na de alta
densidade).
2 As LDL s�o as principais transportadoras de colesterol, enquanto as HDL s�o as
principais transportadoras de fosfolip�dios. Ambas, entretanto, podem transportar
esses dois tipos de lip�dio.
3 O colesterol sintetizado no f�gado ou absorvido dos alimentos de origem animal
(alimentos de origem vegetal n�o possuem colesterol) � transportado pelo sangue na
forma de LDL. Nos tecidos do corpo, o complexo colesterol-prote�na � englobado
pelas c�lulas, e o colesterol � utilizado como mat�ria-prima para a s�ntese das
membranas celulares.
4 Concentra��es muito elevadas de colesterol no sangue diminuem o processo de
capta��o do complexo colesterol-LDL pelas c�lulas. Com isso, o complexo colesterol-
LDL em excesso no sangue oxida-se e pode se acumular na parede das art�rias,
formando placas ateroscler�ticas. O crescimento dessas placas pode levar ao
entupimento de uma art�ria e bloquear o fluxo de sangue. Quando isso ocorre em
art�rias do cora��o ou do c�rebro, o resultado � um infarto do mioc�rdio ou uma
isquemia cerebral, respectivamente. Por isso, o colesterol associado ao LDL �
chamado "colesterol ruim" e n�o deve estar em excesso no sangue.
5 As lipoprote�nas HDL capturam parte do excesso de colesterol do sangue,
transportando-o at� o f�gado, no qual ele � eliminado na bile. Portanto, HDL ajuda
a eliminar colesterol do sangue e, por isso, o complexo colesterol-HDL � chamado de
"colesterol bom". Acredita-se que a ingest�o de �leos vegetais insaturados, como os
presentes no azeite de oliva, contribua para manter os n�veis normais de colesterol
no sangue e para aumentar a produ��o de HDL. O azeite tamb�m aumenta a taxa de
secre��o de bile pelo f�gado, estimulando a digest�o e a absor��o das gorduras e
das vitaminas lipossol�veis.
6 Estudos populacionais t�m mostrado uma rela��o entre os n�veis de colesterol no
sangue e o risco de desenvolvimento de doen�as cardiovasculares. Segundo a
Associa��o Americana do Cora��o, a rela��o entre os n�veis de colesterol sangu�neo
total de uma pessoa em jejum e o risco para doen�as cardiovasculares � a seguinte:
N�vel de colesterol sangu�neo (mg/dL) Risco de doen�a cardiovascular< 200N�vel
desej�vel: menor risco de doen�a cardiovascular200-240Limiar de alto risco> 240
N�vel n�o desej�vel: alto risco7 Exames laboratoriais mais modernos permitem
estimar os n�veis de colesterol-HDL e de colesterol-LDL e tendem a substituir os
antigos exames em que se avaliava apenas o colesterol total. Nesse caso, de acordo
com a Sociedade Brasileira de Cardiologia, o desej�vel � que o n�vel de colesterol-
HDL ("bom") seja maior do que 60 mg/dL de sangue e que o de colesterol-LDL ("ruim")
seja menor do que 100 mg/dL de sangue para as pessoas em geral ou menor do que 70
mg/dL para pessoas que apresentam alto risco de doen�as cardiovasculares.

P�gina 54

Guia de leitura
Responda em seu caderno
1 Leia os dois par�grafos iniciais do quadro. Como voc� responderia a algu�m que
afirmasse: "h� dois tipos de mol�cula de colesterol: um bom e outro ruim para o
organismo"?
2 O terceiro par�grafo apresenta a fun��o normal do transporte de colesterol pelo
LDL sangu�neo. Certifique-se de ter compreendido por que o colesterol, em n�veis
normais, � necess�rio ao nosso organismo.
3 Leia o quarto par�grafo do quadro e responda resumidamente ou por meio de um
esquema: qual � a rela��o entre o excesso de colesterol sangu�neo e a forma��o de
placas ateroscler�ticas? Qual � a consequ�ncia disso para a sa�de?
4 Pela leitura do quarto e do quinto par�grafos podemos reunir informa��es para
definir o que � "colesterol ruim" e "colesterol bom". Certifique-se de ter
compreendido a diferen�a entre eles. Segundo o texto, que provid�ncias adotadas em
nossa dieta podem diminuir o "colesterol ruim" e aumentar o "colesterol bom"?
5 Os dois �ltimos par�grafos (6 e 7) do quadro relacionam o n�vel de colesterol
sangu�neo ao risco de doen�as cardiovasculares. Com base no que foi discutido no
texto, voc� acha que os exames individualizados dos n�veis de LDL e HDL forneceriam
mais ou menos informa��es sobre o metabolismo da pessoa que o exame do colesterol
total no sangue? Por qu�?
3.4 Prote�nas, vitaminas e �cidos nucleicos
O que s�o prote�nas?
Prote�nas s�o subst�ncias formadas por dezenas, centenas ou milhares de mol�culas
de amino�cido, ligadas em sequ�ncia como elos em uma corrente. Para aplicar um
conceito apresentado anteriormente no cap�tulo, prote�nas s�o pol�meros cujos
mon�meros s�o amino�cidos.
Um amino�cido � uma mol�cula org�nica formada por �tomos de carbono, hidrog�nio,
oxig�nio e nitrog�nio unidos entre si de maneira caracter�stica, como veremos a
seguir. Certos tipos de amino�cido podem ainda conter �tomos de enxofre.
Se compararmos as f�rmulas dos vinte amino�cidos que entram na composi��o das
prote�nas notaremos que todos apresentam um �tomo de carbono denominado carbono-
alfa, ao qual se ligam um grupo amina (-NH2), um grupo carboxila (-COOH), um �tomo
de hidrog�nio (-H) e um quarto grupo genericamente denominado -R (de radical), que
varia nos diferentes amino�cidos e caracteriza cada um deles. Por exemplo, na
glicina, o grupo -R � um �tomo de hidrog�nio (-H); na alanina, o radical � -CH3; na
ciste�na, � o grupamento -CH2SH. (Fig. 3.12)

Figura 3.12 A. F�rmula geral de um amino�cido. B. F�rmulas de tr�s amino�cidos,


mostrando que a diferen�a entre eles reside no grupo R, destacado em azul.

P�gina 55

Liga��o pept�dica
A liga��o entre dois amino�cidos vizinhos em uma mol�cula de prote�na � denominada
liga��o pept�dica e sempre se estabelece entre o grupo amina de um amino�cido e o
grupo carboxila do amino�cido vizinho. (Fig. 3.13)

Figura 3.13 Representa��o esquem�tica da forma��o de uma liga��o pept�dica entre


dois amino�cidos.
Mol�culas resultantes da condensa��o de amino�cidos s�o genericamente chamadas de
pept�dios. Dois amino�cidos unidos constituem um dipept�dio; tr�s amino�cidos
unidos formam um tripept�dio, quatro um tetrapept�dio e assim por diante. Os termos
oligopept�dio (do grego oligo, pouco) e polipept�dio (do grego poli, muito) s�o
tamb�m usados para denominar as mol�culas formadas, respectivamente, por poucos e
por muitos amino�cidos. Como as prote�nas s�o geralmente constitu�das por grande
n�mero de amino�cidos, elas s�o polipept�dios.
Em que diferem as prote�nas?
As prote�nas podem diferir umas das outras nos seguintes aspectos: a) pela
quantidade de amino�cidos presentes na cadeia polipept�dica; b) pelos tipos de
amino�cidos presentes na cadeia; c) pela sequ�ncia em que os amino�cidos est�o
unidos na cadeia. Assim, mesmo que duas prote�nas possuam exatamente o mesmo n�mero
e as mesmas propor��es de tipos de amino�cido, elas podem ser diferentes,
dependendo da sequ�ncia em que esses amino�cidos est�o unidos. Teoricamente, h� um
n�mero muito grande de combina��es poss�veis entre os vinte tipos de amino�cido nas
prote�nas. E, de fato, j� foram identificados milhares de tipos de prote�na nos
organismos vivos; calcula-se que no corpo de uma pessoa existam entre 100 mil e 200
mil tipos diferentes de prote�na.
Arquitetura das prote�nas
A sequ�ncia linear de amino�cidos de uma cadeia polipept�dica � denominada
estrutura prim�ria, determinando os enrolamentos e dobramentos que ocorrer�o na
cadeia. Em outras palavras, � a estrutura prim�ria do polipept�dio que determina
sua forma no espa�o, genericamente chamada deestrutura espacial. A maioria dos
polipept�dios apresenta um primeiro n�vel de enrolamento helicoidal, chamado de
estrutura secund�ria, compar�vel ao de um fio de telefone. A cadeia polipept�dica,
j� enrolada helicoidalmente em estrutura secund�ria, costuma dobrar-se sobre si
mesma formando o que os bioqu�micos chamam de estrutura terci�ria.
Certas prote�nas s�o constitu�das por apenas uma cadeia polipept�dica, enquanto
outras s�o compostas de duas ou mais cadeias polipept�dicas quimicamente unidas.
Assim, al�m da estrutura terci�ria apresentada pelas cadeias polipept�dicas
isoladas, h� mais um n�vel de organiza��o espacial, que os bioqu�micos denominam
estrutura quatern�ria. A hemoglobina do nosso sangue, por exemplo, � composta pela
associa��o de quatro cadeias polipept�dicas individuais, sendo duas delas chamadas
de cadeias ? (alfa) e as outras duas chamadas de cadeias ? (beta); essas quatro
cadeias est�o associadas a um grupamento qu�mico que cont�m ferro (o grupo heme).
Desnatura��o das prote�nas
A temperatura, o grau de acidez, a concentra��o de sais e a polaridade do meio
podem afetar a estrutura espacial das prote�nas, fazendo com que suas mol�culas se
desenrolem e modifiquem-se em rela��o � configura��o original. A altera��o causada
na estrutura espacial de uma prote�na � chamada desnatura��o.
O calor excessivo desnatura as prote�nas porque o aumento da agita��o molecular
provocado pela alta temperatura rompe determinadas liga��es respons�veis pela
manuten��o da forma das mol�culas. Por exemplo, em um ovo fresco cada mol�cula de
albumina � um pequeno gl�bulo em solu��o aquosa, o que determina a consist�ncia
semil�quida da clara.

P�gina 56

Ao cozinharmos o ovo, o calor do cozimento faz com que as mol�culas de albumina


desnaturem, desenrolando-se e emaranhando-se umas �s outras; isso leva � forma��o
da massa compacta e s�lida da clara do ovo cozido ou frito. (Fig. 3.14)

NATTIKA/SHUTTERSTOCK
NIKOLA BILIC/SHUTTERSTOCK
Figura 3.14 O ovo � muito rico em prote�nas. Seu cozimento provoca uma altera��o na
forma espacial de suas mol�culas proteicas, que se aglomeram provocando o
endurecimento da clara e da gema.
Meios fortemente �cidos ou b�sicos tamb�m podem desnaturar prote�nas, desmantelando
as atra��es el�tricas respons�veis pela estrutura espacial das mol�culas proteicas.
Na fabrica��o dos queijos e iogurtes, o ac�mulo de �cido l�ctico liberado por
microrganismos fermentadores acidifica o leite e desnatura suas prote�nas, que se
emaranham e solidificam.
Fun��es das prote�nas
As prote�nas s�o subst�ncias de fundamental import�ncia na estrutura e no
funcionamento dos seres vivos. A forma das c�lulas, por exemplo, deve-se � presen�a
de um esqueleto interno constitu�do por filamentos proteicos, o citoesqueleto. Al�m
disso, as prote�nas fazem parte da estrutura de todas as membranas celulares e d�o
consist�ncia ao citoplasma. Al�m da fun��o estrutural, um grupo de prote�nas
denominadas enzimas participa de praticamente todas as rea��es qu�micas vitais.
Consequentemente, o metabolismo dos seres vivos depende da a��o de prote�nas
enzim�ticas, como veremos a seguir.
Enzimas
Enzimas s�o catalisadores biol�gicos, participando de processos biol�gicos, mas sem
se alterarem durante o processo. Enzimas s�o geralmente mol�culas de grande
tamanho, enroladas sobre si mesmas formando uma estrutura globular. Na superf�cie
das enzimas h� sali�ncias e reentr�ncias que permitem seu encaixe nas subst�ncias
sobre as quais elas atuam, genericamente chamadas de substratos enzim�ticos. Os
locais da enzima que propiciam o encaixe nos substratos s�o denominados centros
ativos enzim�ticos.
Enzimas t�m atua��es espec�ficas, ou seja, uma enzima atua somente em uma ou em
poucas rea��es biol�gicas. A especificidade de uma enzima � explicada pelo fato de
seus centros ativos se encaixarem corretamente apenas a substratos espec�ficos.
O encaixe com a enzima facilita a modifica��o dos substratos, originando os
produtos da rea��o. Uma vez formados os produtos, a enzima se liberta e pode se
ligar a novos substratos, voltando a atuar. (Fig. 3.15)

ILUSTRA��O: PAULO MANZI


Figura 3.15 Modelo de a��o enzim�tica, representado na ilustra��o pela enzima
sacarase ou invertase. Ao se ligar � mol�cula de sacarose, a enzima sacarase
facilita a quebra da liga��o entre os monossacar�dios que comp�em o dissacar�dio,
liberando glicose e frutose. Ao final da rea��o, a enzima sacarase pode se associar
novamente a outra mol�cula de sacarose. (Elementos fora de propor��o de tamanho
entre si; cores-fantasia.)

P�gina 57

A nomenclatura das enzimas costuma utilizar o nome do substrato enzim�tico sobre o


qual atua (prote�na, lip�dio etc.) acrescido do sufixo -ase. Para designar as
enzimas que digerem prote�nas, por exemplo, falamos em proteases; enzimas que
digerem lip�dios s�o lipases. O sufixo -ase tamb�m � utilizado em denomina��es mais
espec�ficas, como na enzima que quebra lactose em galactose e glicose, que �
denominada lactase.
Cofatores e coenzimas
Muitas enzimas s�o prote�nas simples, constitu�das apenas por cadeias
polipept�dicas. Outras, entretanto, s�o prote�nas conjugadas, constitu�das por uma
parte proteica (uma ou mais cadeias polipept�dicas), chamada de apoenzima,
combinada a uma parte n�o proteica, denominada cofator. Para algumas enzimas, os
cofatores s�o �ons met�licos; a maioria dos �ons que necessitamos ingerir na dieta,
entre eles os de cobre, de zinco e de mangan�s, atua como cofatores de enzimas. O
cofator enzim�tico tamb�m pode ser uma subst�ncia org�nica, nesse caso denominada
coenzima. A maioria das vitaminas de que necessitamos na dieta atua como coenzima
ou como precursor de coenzimas.
Fatores que afetam a atividade das enzimas
A temperatura � um fator importante na atividade das enzimas. Dentro de certos
limites, a velocidade de uma rea��o enzim�tica aumenta com a eleva��o da
temperatura. Isso ocorre porque o aumento da temperatura eleva a movimenta��o das
mol�culas, possibilitando maior n�mero de encontros entre elas e maiores chances de
reagirem entre si. Entretanto, se for ultrapassada certa temperatura limite, a
agita��o molecular torna-se t�o intensa que leva � desnatura��o da enzima, com
diminui��o ou perda da atividade enzim�tica.
Cada tipo de enzima atua melhor em uma faixa de temperatura caracter�stica
(temperatura �tima), na qual a velocidade da rea��o catalisada � m�xima, por�m sem
desnatura��o da enzima. A maioria das enzimas humanas tem sua temperatura �tima
situada entre 35 �C e 40 �C, que corresponde � faixa de temperatura normal de nosso
corpo. Bact�rias que vivem em fontes de �gua quente t�m enzimas cuja temperatura
�tima de atua��o situa-se ao redor de 70 �C ou mais. (Fig. 3.16A)
Outro fator que afeta a atividade das enzimas � o grau de acidez do meio ou pH
(potencial hidrogeni�nico), expresso em uma escala logar�tmica que vai de 0 a 14.
Esses valores de pH expressam a concentra��o relativa do �on de hidrog�nio (H+) em
determinado meio. Como mencionado neste cap�tulo, o valor 7 representa um meio
neutro, nem �cido nem b�sico; valores abaixo de 7 s�o progressivamente mais �cidos
e os acima de 7 s�o progressivamente mais b�sicos (alcalinos). Por exemplo, uma
solu��o de bicarbonato de s�dio (NaHCO3) tem pH em torno de 9, enquanto o vinagre
tem pH em torno de 4. Isso quer dizer que, no vinagre, a concentra��o de �ons H+ �
cerca de 100 mil vezes maior do que em uma solu��o de bicarbonato de s�dio.
Assim como em rela��o � temperatura, cada enzima tamb�m apresenta um pH �timo de
atua��o, no qual sua atividade � m�xima. Fora dessa faixa de pH, a enzima deixa de
funcionar adequadamente. O pH �timo para a maioria das enzimas celulares situa-se
ao redor de 7, pr�ximo ao neutro. A enzima pepsina que atua em nosso est�mago
funciona mais eficientemente em valores de pH fortemente �cidos, em torno de 2,
condi��o em que a maioria das outras enzimas deixa de funcionar. A tripsina, enzima
digestiva que atua no ambiente alcalino do intestino delgado, tem seu pH �timo em
torno de 8. (Fig. 3.16B)

ILUSTRA��ES: ADILSON SECCO


Figura 3.16 Curvas de atividade de diferentes enzimas em condi��es diversas de
temperatura (A) e de grau de acidez (pH) (B). Note que cada enzima tem uma
temperatura e um pH �timos, em que sua atividade � m�xima. (Elaboradas com base em
Campbell, N. A. e cols., 1999.)

P�gina 58

Amplie seus conhecimentos


"Teste do pezinho"
O conhecimento cient�fico sobre enzimas e genes tem permitido o desenvolvimento de
diagn�sticos precisos e, em alguns casos, o tratamento para doen�as de origem
gen�tica. Um exemplo refere-se � fenilceton�ria, uma doen�a decorrente da
incapacidade inata de uma pessoa produzir determinada enzima. Essa doen�a pode ser
controlada quando diagnosticada no rec�m-nascido. Para o diagn�stico, basta uma
gota de sangue obtida com uma leve pun��o no p� da crian�a, o chamado "teste do
pezinho".
A pessoa portadora da condi��o gen�tica respons�vel pela fenilceton�ria n�o produz
a enzima que transforma o amino�cido fenilalanina em tirosina. Nessa situa��o, a
fenilalanina tende a se acumular no corpo e pode causar danos �s c�lulas cerebrais,
principalmente na inf�ncia.
Os piores efeitos da fenilceton�ria s�o evitados se a doen�a � detectada
prematuramente e se o portador passa a receber uma dieta que forne�a apenas as
quantidades m�nimas de fenilalanina necess�rias ao desenvolvimento. Pessoas
fenilceton�ricas adultas devem evitar o excesso de prote�nas na alimenta��o e o uso
de ado�antes artificiais feitos � base de aspartame, que cont�m fenilalanina e
�cido asp�rtico.

SIMON FRASER/SCIENCE PHOTO LIBRARY/LATINSTOCK


A. Rea��o catalisada pela enzima fenilalanina-4-monoxigenase, cuja aus�ncia � a
principal causa da fenilceton�ria, que afeta 1 em cada 20 mil pessoas. B. Retirada
de sangue do p� de um rec�m-nascido para o teste de fenilceton�ria e de outras
doen�as ("teste do pezinho").
O que s�o vitaminas?
O termo vitamina n�o se refere a uma classe particular de subst�ncias, mas a
qualquer subst�ncia org�nica que o organismo n�o consegue produzir, geralmente
necess�ria em quantidades relativamente pequenas. A vitamina C, por exemplo,
essencial ao bom funcionamento do organismo humano e dos demais primatas (s�mios e
macacos), � o �cido asc�rbico. Outros animais tamb�m necessitam de �cido asc�rbico,
mas conseguem produzi-lo em suas c�lulas; assim, para eles, o �cido asc�rbico n�o �
considerado vitamina. Os cientistas descobriram que muitas vitaminas atuam como
cofatores em rea��es enzim�ticas. Nesse caso, a defici�ncia de dada vitamina
diminui a quantidade de enzima ativa, alterando negativamente o metabolismo
celular.

P�gina 59

A import�ncia da alimenta��o variada come�ou a ser reconhecida durante a �poca das


grandes navega��es a vela. A dieta da tripula��o dos navios era pobre, constitu�da
basicamente por biscoitos secos e carne salgada. Ap�s algumas semanas no mar, os
marinheiros tornavam-se fracos, desatentos, tinham fortes hemorragias nasais e
chegavam a morrer. Bastava, no entanto, que os doentes passassem alguns dias em
terra firme, alimentando-se de frutas e verduras frescas, para que os sintomas
rapidamente desaparecessem.
Os alimentos s�o as fontes naturais de vitaminas. Atualmente, as vitaminas tamb�m
podem ser encontradas no com�rcio na forma purificada, sendo prescritas pelos
m�dicos para eliminar defici�ncias vitam�nicas, geralmente causadas por uma dieta
pobre ou desbalanceada ou por algum tipo de disfun��o metab�lica. Para que os
alimentos n�o percam seu valor vitam�nico, s�o precisos certos cuidados, pois
algumas vitaminas s�o facilmente destru�das pelo calor ou pela exposi��o ao g�s
oxig�nio (O2) do ar. Uma regra geral para preservar o valor vitam�nico de verduras
e legumes � consumi-los crus ou apenas levemente cozidos em pequena quantidade de
�gua. Vegetais para saladas e frutas s� devem ser cortados no momento de ser
servidos, para evitar a oxida��o destrutiva de suas vitaminas pelo ar.
As vitaminas costumam ser classificadas em hidrossol�veis e lipossol�veis. A
import�ncia dessa classifica��o est� relacionada ao modo como elas devem ser
ingeridas e a seu armazenamento no organismo. Vitaminas hidrossol�veis, assim
chamadas por serem subst�ncias polares e dissolverem-se em �gua, s�o armazenadas em
quantidades pequenas no corpo e devem ser ingeridas diariamente. Vitaminas
lipossol�veis, assim chamadas por serem subst�ncias apolares e dissolverem-se em
lip�dios e em outros solventes org�nicos, s�o armazenadas no tecido adiposo e n�o
precisam ser ingeridas diariamente. As doen�as resultantes da falta de vitaminas
s�o denominadas avitaminoses. Veja as principais vitaminas, suas fun��es,
avitaminoses e seus sintomas na tabela a seguir. (Tab. 3.1)
TABELA 3.1 PRINCIPAIS VITAMINAS E SUAS FUN��ESVitaminas hidrossol�veisVitamina
Principal fun��o no corpoSintomas de defici�nciaPrincipais fontesB1 (tiamina)
Auxilia na oxida��o dos carboidratos. Estimula o apetite. Mant�m o t�nus muscular e
o bom funcionamento do sistema nervoso. Previne o berib�ri.Perda de apetite, fadiga
muscular, nervosismo, berib�ri.Cereais na forma integral e p�es, feij�o, f�gado,
carne de porco, ovos, fermento de padaria, vegetais de folha (couve, repolho,
espinafre etc.).B2 (riboflavina)Auxilia a oxida��o dos alimentos (respira��o
celular). Mant�m a tonalidade saud�vel da pele. Atua na coordena��o motora.Ruptura
da mucosa da boca, dos l�bios, da l�ngua e das bochechas.Vegetais de folha, carnes
magras, ovos, fermento de padaria, f�gado, leite.B3 (niacina ou �cido nicot�nico)
Mant�m o t�nus nervoso e muscular e o bom funcionamento do sistema digest�rio.
Previne a pelagra.In�rcia e falta de energia, nervosismo extremo, dist�rbios
digestivos, pelagra.Levedo de cerveja, carnes magras, ovos, f�gado, leite.B5 (�cido
pantot�nico)� componente da coenzima A, participante de processos energ�ticos
celulares.Anemia, fadiga e dorm�ncia dos membros.Carne, leite e seus derivados,
verduras e cereais integrais.B6 (piridoxina)Auxilia na oxida��o dos alimentos.
Mant�m a pele saud�vel.Doen�as da pele, dist�rbios nervosos, in�rcia e extrema
apatia.Levedo de cerveja, cereais integrais, f�gado, carnes magras, leite.B8
(biotina)Atua como coenzima em processos energ�ticos celulares, na s�ntese de
�cidos graxos e das bases nitro genadas p�ricas.Inflama��es na pele e dist�rbios
neuromusculares.Carnes, legumes, verduras e bact�rias da flora intestinal.

P�gina 60

Vitaminas hidrossol�veisVitaminaPrincipal fun��o no corpoSintomas de defici�ncia


Principais fontesB9 (�cido f�lico)Importante na s�ntese das bases nitrogenadas e,
portanto, na s�ntese de DNA e na multiplica��o celular.Anemia, esterilidade
masculina, durante a gravidez predisp�e a uma malforma��o do feto conhecida como
espinha b�fida.Vegetais verdes, frutas, cereais integrais e bact�rias da flora
intestinal.B12 (cianocobalamina)� essencial para a matura��o das hem�cias e para a
s�ntese de nucleot�dios.Anemia perniciosa e dist�rbios nervosos.Carne, ovos, leite
e seus derivados.C (�cido asc�rbico)Mant�m a integridade dos vasos sangu�neos e a
sa�de dos dentes. Previne infec��es e o escorbuto.In�rcia e fadiga em adultos,
ins�nia e nervosismo em crian�as, sangramento das gengivas, dores nas juntas,
dentes alterados, escorbuto.Frutas c�tricas (lim�o, lima, laranja), tomate, couve,
repolho, outros vegetais de folha, piment�o.Vitaminas lipossol�veisA (retinol)
Necess�ria para o crescimento normal e para o bom funcionamento dos olhos, do
nariz, da boca, dos ouvidos e dos pulm�es. Previne resfriados e v�rias infec��es.
Evita a "cegueira noturna"."Cegueira noturna" (xeroftalmia), "olhos secos" em
crian�as, cegueira total.Vegetais amarelos (cenoura, ab�bora, batata-doce, milho),
p�ssego, nectarina, abric�, gema de ovo, manteiga, f�gado.D* (calciferol)Atua no
metabolismo do c�lcio e do f�sforo. Mant�m os ossos e os dentes em bom estado.
Previne o raquitismo.Problemas nos dentes, ossos fracos, contribui para os sintomas
da artrite, raquitismo.�leo de f�gado de bacalhau, f�gado, gema de ovo.E
(tocoferol)Promove a fertilidade. Previne o aborto. Atua no sistema nervoso involun
t�rio, no sistema muscular e nos m�sculos involunt�rios.Esterilidade masculina,
aborto.�leo de germe de trigo, carnes magras, latic�nios, alface, �leo de amendoim.
K (filoquinona)Atua na coagula��o do sangue. Previne hemorragias.Hemorragias.
Vegetais verdes, tomate, castanha.* A vitamina D n�o � encontrada pronta na maioria
dos alimentos; estes cont�m, em geral, um precursor que se transforma em vitamina D
quando exposto aos raios ultravioleta da radia��o solar. (Adaptado de Campbell, N.
A. e cols., 1999.)
�cidos nucleicos
Os �cidos nucleicos s�o assim chamados por seu car�ter �cido e por terem sido
originalmente descobertos no n�cleo das c�lulas no s�culo XIX. A partir da d�cada
de 1940, os �cidos nucleicos passaram a ser detalhadamente estudados, pois
descobriu-se que eles constituem os genes, entidades respons�veis pela heran�a
biol�gica. Somos parecidos com nossos pais porque recebemos, nos gametas que nos
originaram, genes paternos e maternos, constitu�dos por �cido desoxirribonucleico.
H� dois tipos de �cido nucleico: o �cido desoxirribonucleico, conhecido pela sigla
DNA (do ingl�s, desoxirribonucleic acid), e o �cido ribonucleico, conhecido pela
sigla RNA (do ingl�s, ribonucleic acid). Esses nomes referem-se ao fato de o DNA e
o RNA apresentarem, respectivamente, os monossacar�dios desoxirribose e ribose em
suas mol�culas.

P�gina 61

Estrutura dos �cidos nucleicos


Os �cidos nucleicos s�o constitu�dos por tr�s tipos de componentes: glic�dios do
grupo das pentoses (desoxirribose no DNA e ribose no RNA), �cido fosf�rico e bases
nitrogenadas. Dos cinco tipos de base nitrogenada presentes nos �cidos nucleicos,
tr�s ocorrem tanto no DNA quanto no RNA; s�o elas a adenina (A), a citosina (C) e a
guanina (G). A base nitrogenada timina (T) ocorre exclusivamente no DNA, enquanto a
base uracila (U) est� presente apenas no RNA. As bases adenina e guanina s�o
constitu�das por dois an�is de carbono e nitrog�nio, sendo denominadas bases
p�ricas ou purinas. Citosina, timina e uracila apresentam apenas um anel de carbono
e nitrog�nio, sendo denominadas bases pirim�dicas ou pirimidinas.
Os componentes dos �cidos nucleicos organizam-se em um trio molecular denominado
nucleot�dio. Tanto o DNA como o RNA s�o constitu�dos por nucleot�dios ligados em
sequ�ncia em longas cadeias polinucleot�dicas. A uni�o entre os nucleot�dios d�-se
entre o a��car de um deles e o fosfato do outro, liga��o denominada fosfodi�ster.
As mol�culas de DNA s�o constitu�das por duas cadeias polinucleot�dicas orientadas
em sentido inverso uma em rela��o � outra (antiparalelas) e enroladas, lembrando
uma longa escada helicoidal. As duas cadeias mant�m-se unidas por pontes de
hidrog�nio estabelecidas entre pares de bases espec�ficas: a adenina emparelha-se
com a timina por meio de duas liga��es de hidrog�nio, enquanto a guanina emparelha-
se com a citosina por meio de tr�s liga��es de hidrog�nio. (Fig. 3.17)

Figura 3.17 Componentes dos �cidos nucleicos. O a��car desoxirribose e a base


nitrogenada timina ocorrem exclusivamente no DNA. O a��car ribose e a base uracila
s�o exclusivos do RNA. Os demais componentes s�o comuns ao DNA e ao RNA.
As mol�culas de DNA s�o geralmente muito longas, com milhares ou milh�es de
nucleot�dios unidos em sequ�ncia. No n�cleo de nossas c�lulas, constituindo nossos
cromossomos, h� mol�culas de DNA que chegam a atingir mais de 10 cent�metros de
comprimento, embora sejam fin�ssimas, com cerca de apenas 0,000002 mil�metros ou 2
nan�metros (nm) de di�metro.
As mol�culas de RNA s�o geralmente formadas por uma cadeia �nica, que pode se
enrolar sobre si mesma pelo emparelhamento entre bases complementares na mesma
cadeia polinucleot�dica. O estudo dos �cidos nucleicos ser� retomado com mais
detalhes no cap�tulo 6 deste volume.

P�gina 62

ATIVIDADES
Revendo conceitos, fatos e processos
Registre em seu caderno
1. As subst�ncias org�nicas de um ser vivo s�o, em ordem decrescente de abund�ncia,

a) �cidos nucleicos > prote�nas > glic�dios > lip�dios.


b) lip�dios > glic�dios > prote�nas > �cidos nucleicos.
c) prote�nas > glic�dios > �cidos nucleicos > lip�dios.
d) prote�nas > lip�dios > glic�dios > �cidos nucleicos.
2. Para degradarmos uma prote�na em seus amino�cidos constituintes, precisamos
quebrar
a) liga��es pept�dicas, o que consome �gua como reagente.
b) liga��es pept�dicas, o que consome g�s oxig�nio como reagente.
c) pontes de hidrog�nio, o que consome �gua como reagente.
d) pontes de hidrog�nio, o que n�o consome reagentes.
3. Nossa dieta deve conter, necessariamente, o amino�cido triptofano, pois o corpo
humano n�o consegue produzi-lo. O bolor do p�o, por sua vez, n�o precisa ter nenhum
amino�cido em sua dieta, pois � capaz de produzir todos os vinte tipos de
amino�cido de que necessita. O triptofano �, portanto, um amino�cido
a) essencial para a esp�cie humana, mas natural para o bolor do p�o.
b) natural para a esp�cie humana, mas essencial para o bolor do p�o.
c) essencial tanto para a esp�cie humana quanto para o bolor do p�o.
d) natural tanto para a esp�cie humana quanto para o bolor do p�o.
4. Quando uma prote�na se desnatura, ela
a) tem sua estrutura prim�ria modificada.
b) tem sua estrutura espacial modificada.
c) sofre hidr�lise.
d) tem suas liga��es pept�dicas quebradas.
5. "Quando separamos as quatro cadeias polipept�dicas que constituem uma mol�cula
de hemoglobina, por�m sem alterar a estrutura espacial de cada uma delas, estamos
modificando apenas a estrutura (.....) da prote�na." Qual das alternativas completa
corretamente a frase?
a) prim�ria
b) secund�ria
c) terci�ria
d) quatern�ria
Quest�es para exercitar o pensamento
Registre em seu caderno
6. � importante ter consci�ncia dos tipos de subst�ncia que comemos, suas
quantidades e seu valor cal�rico (quantidade de energia que fornecem),
principalmente quando se trata de produtos industrializados. Ultimamente, com o
lan�amento de muitos produtos diet�ticos, os fabricantes foram obrigados por lei a
informar, na embalagem, dados sobre a composi��o qu�mica do produto. Fa�a uma
pesquisa nos alimentos que porventura tenha em sua casa e descubra aqueles cujas
embalagens trazem dados sobre a composi��o qu�mica do conte�do. Se necess�rio, v� a
um supermercado e anote os dados dos r�tulos de diversos produtos. Compare os
resultados de sua pesquisa com os de seus colegas e classifique os produtos de
acordo com seu conte�do em prote�nas, em glic�dios e em lip�dios.
7. Observe a f�rmula do amino�cido valina, encontrado nas prote�nas dos seres
vivos. Note que h� partes da mol�cula destacadas e numeradas.
2
Sobre esses destaques, responda:
a) O que representam os n�meros 1, 2, 3 e 4?
b) Qual desses grupos destacados varia de acordo com o amino�cido?
8. A explica��o para a especificidade de uma enzima por seu substrato recebe a
denomina��o de modelo chave-fechadura. Redija um breve texto argumentando a favor
dessa denomina��o.
9. Os dados a seguir mostram os resultados de an�lises qu�micas a que foram
submetidas quatro amostras de �cidos nucleicos (I a IV). Determine, para cada
amostra, se o �cido nucleico � DNA ou RNA, justificando a resposta.
AmostraResultado da an�lise qu�micaIPresen�a de riboseIIPresen�a de timinaIII
Presen�a de uracilaIVPresen�a de desoxirribose

P�gina 63

10. Observe o gr�fico a seguir, que ilustra a a��o da enzima estomacal pepsina em
diferentes faixas de acidez (pH).

ADILSON SECCO
Com base nos dados apresentados no gr�fico, responda:
a) Qual � a faixa de pH mais favor�vel � a��o dessa enzima?
b) A partir de que valores de pH a pepsina para de atuar?
A Biologia no vestibular e no Enem
Registre em seu caderno
Quest�es objetivas
1. (PUC-RJ) Na prepara��o do meio de cultura para c�lulas animais, o t�cnico de um
determinado laborat�rio esqueceu-se de adicionar o suprimento de amino�cidos. Que
mol�culas ter�o sua forma��o imediatamente prejudicada?
a) lip�deos
b) glic�deos
c) nucleot�deos
d) prote�nas
e) �cidos nucleicos
2. (Fuvest-SP) Leia o texto a seguir, escrito por Jacob Berzelius em 1828. "Existem
raz�es para supor que, nos animais e nas plantas, ocorrem milhares de processos
catal�ticos nos l�quidos do corpo e nos tecidos. Tudo indica que, no futuro,
descobriremos que a capacidade de os organismos vivos produzirem os mais variados
tipos de compostos qu�micos reside no poder catal�tico de seus tecidos." A previs�o
de Berzelius estava correta, e hoje sabemos que o "poder catal�tico" mencionado no
texto deve-se
a) aos �cidos nucleicos.
b) aos carboidratos.
c) aos lip�dios.
d) �s prote�nas.
e) �s vitaminas.
3. (Uece) Sabe-se que o carboidrato � o principal fator a contribuir para a
obesidade, por entrar mais diretamente na via glicol�tica, desviando-se para a
produ��o de gordura, se ingerido em excesso. Uma refei��o composta de bolacha
(amido processado industrialmente) e vitamina de sapoti (sapoti, rico em frutose),
leite (rico em lactose) e a��car (sacarose processada industrialmente) pode
contribuir para o incremento da obesidade, por ser, conforme a descri��o acima,
visivelmente rica em
a) lip�dios.
b) prote�nas.
c) vitaminas.
d) glic�dios.
4. (UFMA) As enzimas biocatalisadoras da indu��o de rea��es qu�micas reconhecem
seus substratos atrav�s da
a) temperatura do meio.
b) forma tridimensional das mol�culas.
c) energia de ativa��o.
d) concentra��o de minerais.
e) reversibilidade da rea��o.
5. (Uece) Com rela��o � composi��o das mol�culas, o RNA e o DNA diferem entre si
quanto ao tipo de
a) a��car apenas.
b) base nitrogenada e de a��car apenas.
c) base nitrogenada e de fosfato apenas.
d) base nitrogenada, a��car e de fosfato.
6. (UFRN) Embora seja visto como um vil�o, o colesterol � muito importante para o
organismo humano porque ele �
a) precursor da s�ntese de testosterona e progesterona.
b) agente oxidante dos carboidratos.
c) respons�vel pela resist�ncia de cartilagens e tend�es.
d) cofator das rea��es biol�gicas.
Quest�es discursivas
7. (UEG-GO) Em 1747, o m�dico escoc�s James Lind publicou um tratado no qual
esclareceu a preven��o do escorbuto. Sobre esse tema, responda ao que se pede.
a) Que vitamina hidrossol�vel se encontra deficiente nas pessoas com escorbuto?
b) Qual a fun��o das vitaminas nas rea��es enzim�ticas?
8. (Unicamp-SP) Os lip�dios t�m papel importante na estocagem de energia, estrutura
de membranas celulares, vis�o, controle hormonal, entre outros. S�o exemplos de
lip�dios: fosfolip�dios, esteroides e carotenoides.
a) Como o organismo humano obt�m os carotenoides? Que rela��o t�m com a vis�o?
b) A quais das fun��es citadas no texto os esteroides est�o relacionados? Cite um
esteroide importante para uma dessas fun��es.
c) Cite um local de estocagem de lip�dios em animais e um em vegetais.

P�gina 64

M�dulo 2 Citologia
Conhe�a os cap�tulos deste m�dulo
Seres humanos, minhocas, cogumelos, alfaces e bact�rias: todos s�o constitu�dos
pelo mesmo "tijolo" biol�gico b�sico, a c�lula. Esse incr�vel grau de semelhan�a,
em um n�vel de organiza��o t�o fundamental, � considerado uma forte evid�ncia de
que todos os seres vivos partilham um ancestral comum. H� quase dois s�culos, o
m�dico alem�o Rudolf Virchow, um dos grandes divulgadores da teoria celular,
afirmou que, para se compreender plenamente o fen�meno vida, seria preciso conhecer
as c�lulas, e isso continua valendo atualmente.
Cap�tulo 4
Apresentamos aqui alguns microscopistas pioneiros e como ocorreu a descoberta da
c�lula. � medida que a qualidade dos microsc�pios melhorava e as t�cnicas
citol�gicas avan�avam, ficava cada vez mais evidente que muitos dos segredos da
vida s� poderiam ser desvendados no plano microsc�pico. Essa � a ess�ncia da teoria
celular, tratada neste cap�tulo: a c�lula � a unidade da vida.
Cap�tulo 5
Iniciamos, neste cap�tulo, uma viagem ao interior da c�lula eucari�tica, lembrando
que nosso corpo � constitu�do por trilh�es de c�lulas. O pensamento, a imagina��o e
as t�cnicas microsc�picas e bioqu�micas nos conduzir�o nessa viagem investigativa.
Como vamos lidar com elementos microsc�picos e nanosc�picos, � necess�rio que
fiquemos sempre atentos �s escalas de tamanho.
Cap�tulo 6
Aqui, nossa viagem ao interior da c�lula chega ao centro de controle das atividades
celulares: o n�cleo. Nele est� presente a cromatina, constitu�da pelo conjunto de
filamentos denominados cromossomos, os quais se duplicam e se separam na mitose,
processo de divis�o celular em que uma c�lula origina duas c�lulas-filhas,
transmitindo-lhes o conjunto de informa��es gen�ticas fundamentais para sua vida.
Veremos como os genes determinam a s�ntese das prote�nas e, por meio dela,
controlam o funcionamento da c�lula e, por extens�o, do organismo como um todo.

SCIENCE PHOTO LIBRARY/LATINSTOCK


Imagem de corte de c�lula muscular do cora��o humano. Gra�as �s t�cnicas modernas
de microscopia, podemos observar diversas estruturas que, antigamente, n�o eram
sequer imaginadas. (Microsc�pio eletr�nico de transmiss�o; aumento ?20.000�; cores
artificiais.)

P�gina 65

Cap�tulo 4 A descoberta das c�lulas


Itens principais:
- A inven��o do microsc�pio
- As partes fundamentais da c�lula
- A teoria celular
- O desenvolvimento da Citologia
- C�lulas procari�ticas e eucari�ticas

TETRA IMAGES/CORBIS/LATINSTOCK
Cap�tulo 5 Membrana celular e citoplasma
Itens principais:
- Construindo o modelo atual de c�lula
- Caracter�sticas das membranas biol�gicas (biomembranas)
- Ret�culo endoplasm�tico
- Complexo golgiense
- Lisossomos e digest�o intracelular
- Sustenta��o celular: paredes e citoesqueleto
- Centr�olos, flagelos e c�lios
- Mitoc�ndrias e plastos

EYE OF SCIENCE/SCIENCE PHOTO LIBRARY/LATINSTOCK


Cap�tulo 6 N�cleo celular, mitose e s�ntese de prote�nas
Itens principais:
- Organiza��o do n�cleo interf�sico
- Caracter�sticas gerais dos cromossomos
- Dividir para multiplicar: a divis�o celular
- Cromossomos em a��o: duplica��o e transcri��o g�nicas
- O mecanismo da s�ntese de prote�nas: tradu��o g�nica

JEREMY SUTTON-HIBBERT/ALAMY/GLOW IMAGES

P�gina 66

Cap�tulo 4 A descoberta das c�lulas

TETRA IMAGES/CORBIS/LATINSTOCK
Microsc�pio desenvolvido por Antonie van Leeuwenhoek. Esse estudioso foi o primeiro
a usar a microscopia para observar materiais biol�gicos. Desde ent�o, o mundo
microsc�pico vem sendo modelado cada vez com mais detalhes pelas descobertas dos
cientistas e pelo desenvolvimento de novos e mais potentes microsc�pios.
De que s�o feitos os seres vivos?
Pense r�pido numa resposta para a pergunta do t�tulo!
Diversas respostas podem ter lhe ocorrido. Por exemplo, os seres vivos s�o feitos
de �tomos. Embora um tanto gen�rica, essa � uma resposta correta; toda mat�ria,
inclusive a mat�ria viva, � constitu�da por �tomos, uma unidade que se repete (com
varia��es) em todos os materiais da natureza.
Outra resposta correta seria: os seres vivos s�o feitos de mol�culas. Essa resposta
� menos gen�rica, mas, ainda assim, correta: muitos componentes do universo s�o
constitu�dos por mol�culas, resultantes da uni�o qu�mica entre �tomos. A �gua, por
exemplo, comp�e-se de mol�culas de H2O. O g�s carb�nico, de mol�culas de CO2. A
mat�ria que constitui os seres vivos tamb�m se comp�e de milhares de tipos de
mol�culas diferentes, entre elas a pr�pria �gua. Entretanto, h� mol�culas
encontradas somente nos seres vivos, como as prote�nas e os �cidos nucleicos, j�
mencionados neste livro. Se voc� tivesse respondido que os seres vivos s�o feitos
"de mol�culas org�nicas", sua resposta, al�m de correta, levaria a uma boa
discuss�o, como veremos adiante.
A resposta considerada mais adequada pela maioria dos bi�logos seria: os seres
vivos s�o constitu�dos por c�lulas. Se essa foi a sua resposta, parab�ns!
Entretanto, h� um ponto pol�mico a considerar: os v�rus n�o s�o constitu�dos por
c�lulas, embora sejam feitos de dois tipos de mol�culas org�nicas caracter�sticas
de todos os seres vivos: prote�nas e �cidos nucleicos. Al�m disso, os v�rus somente
se reproduzem no interior de c�lulas vivas. E agora? V�rus s�o seres vivos? Ou n�o?
Relembre essas quest�es no cap�tulo 1.
S� mais uma pergunta: em sua opini�o, a c�lula foi "descoberta" em 1665, quando
Hooke visualizou pela primeira vez as cavidades da corti�a, ou quando Schleiden e
Schwann propuseram a teoria celular, em 1838-1839? Pense nisso quando estudar o
cap�tulo.

P�gina 67

A import�ncia do assunto
A inven��o do microsc�pio foi uma condi��o necess�ria � descoberta das c�lulas
vivas. O mundo microsc�pico intracelular foi desvendado, passo a passo, pelas
descobertas e contribui��es de muitos cientistas. Em 1665, Robert Hooke observou ao
microsc�pio que a corti�a era porosa e denominou "c�lula" cada orif�cio
microsc�pico do material. Logo essa denomina��o passou a ser empregada para
designar o conte�do fluido das cavidades constituintes das partes vivas das
plantas. As cavidades da corti�a s�o, na verdade, c�lulas que morreram e perderam o
conte�do, restando apenas a parede celular.
Passou-se cerca de um s�culo e meio at� que o conceito de c�lula fizesse sentido
para a Biologia: s� no in�cio do s�culo XIX � que foi reconhecido que as c�lulas
s�o os constituintes fundamentais dos seres vivos, surgindo, assim, a teoria
celular.
Muitos dos segredos da vida s� podem ser desvendados no plano microsc�pico e este
cap�tulo � a porta de entrada para o mundo invis�vel a olho nu. Voc� ver� que, para
descobrir essa realidade, os cientistas t�m recorrido a diversos instrumentos e
ferramentas. A mais importante de todas, certamente, � a imagina��o.
4.1 A inven��o do microsc�pio
A inven��o do microsc�pio, instrumento capaz de ampliar imagens, possibilitou a
descoberta das c�lulas, as unidades microsc�picas que constituem os seres vivos.
Acredita-se que o primeiro microsc�pio tenha sido constru�do por volta de 1591 por
Zacharias Janssen (1580-1638) e seu pai Hans, dois holandeses fabricantes de
�culos. Entretanto, os primeiros registros de observa��es microsc�picas de
materiais biol�gicos foram realizados pelo comerciante holand�s Antonie van
Leeuwenhoek (1632-1723).
Leeuwenhoek fabricou dezenas de microsc�pios dotados de uma s� lente, feita de
vidro e quase esf�rica, com os quais observou diversos materiais biol�gicos, como
embri�es de plantas, gl�bulos vermelhos do sangue e espermatozoides de animais.
Leeuwenhoek � considerado o descobridor dos "micr�bios", denomina��o antiga dos
seres microsc�picos, hoje conhecidos como microrganismos. (Fig. 4.1)

BETTMANN/CORBIS/LATINSTOCK

WELLCOME LIBRARY, LONDON


Figura 4.1 A. Os microsc�pios constru�dos por Leeuwenhoek consistiam em uma pequena
lente de vidro inserida em uma placa de metal, na qual estava preso um suporte para
o material observado, conectado a parafusos regul�veis. O observador mantinha a
lente pr�xima ao olho, de modo a examinar atrav�s dela objetos mantidos na ponta do
suporte. B. Retrato de Antonie van Leeuwenhoek, de 1686.
Influenciado pelas descobertas de Leeuwenhoek, o f�sico ingl�s Robert Hooke (1635-
1703) idealizou e construiu um microsc�pio com duas lentes de vidro ajustadas �s
extremidades de um tubo de metal. O observador olhava por uma lente, a ocular,
enquanto aproximava do objeto a outra lente - a objetiva - at� obter foco. Por
apresentar duas lentes, o microsc�pio idealizado por Hooke � denominado microsc�pio
composto, enquanto microsc�pios como aqueles feitos por Leeuwenhoek, dotados de uma
s� lente, s�o chamados de microsc�pios simples.

P�gina 68

Um dos materiais inicialmente observados por Hooke foi a corti�a, extra�da da casca
de certas �rvores e utilizada na fabrica��o de rolhas. Hooke verificou que esse
material tinha baixa densidade por apresentar in�meros poros microsc�picos, por
isso ele chamou de cell (do ingl�s, cela ou cavidade) cada buraquinho microsc�pico
da corti�a. Assim surgiu o termo c�lula, diminutivo de cela, hoje consagrado para
designar a unidade constituinte dos seres vivos. (Fig. 4.2)

DAVE KING/DORLING KINDERSLEY/GETTY IMAGES


REPRODU��O
ROBERT HOOKE - COLE��O PARTICULAR
Figura 4.2 A. R�plica do microsc�pio composto de Robert Hooke. B. Imagem da capa do
livro Micrographia (1667), no qual Hooke descreve suas observa��es microsc�picas.
Esse livro cont�m o desenho das fatias de corti�a (em C), cujas cavidades foram
denominadas c�lulas.
4.2 As partes fundamentais da c�lula
O interesse pelo mundo invis�vel levou muitos pesquisadores a investigar a
constitui��o microsc�pica de grande variedade de plantas e de animais. Descobriu-se
que partes internas e suculentas de plantas s�o formadas por cavidades semelhantes
�quelas descritas por Hooke na corti�a, mas preenchidas por um fluido gelatinoso
semitransparente. Logo se descobriu que os animais tamb�m s�o constitu�dos por
bolsas gelatinosas semelhantes �s das plantas, por�m, sem o envolt�rio espesso
caracter�stico das c�lulas vegetais.
A observa��o de c�lulas sob diversas condi��es levou os cientistas a concluir que
c�lulas animais e vegetais deviam ser delimitadas por uma fin�ssima pel�cula, a
membrana plasm�tica, invis�vel mesmo nos melhores microsc�pios �pticos. No caso das
c�lulas vegetais, h� ainda um envolt�rio externo mais espesso e bem vis�vel, a
parede celular.
Em 1833, o bot�nico escoc�s Robert Brown (1773-1858) verificou que a maioria das
c�lulas, tanto as de animais como as de vegetais, tem em seu interior um corpo
esf�rico ou ovoide, que ele denominou n�cleo. O restante do fluido celular passou a
ser chamado de citoplasma.
No s�culo XIX, al�m dessas tr�s partes fundamentais das c�lulas - membrana
plasm�tica, citoplasma e n�cleo -, descobriu-se que o citoplasma cont�m estruturas
presumivelmente equivalentes a pequenos "�rg�os" celulares, por isso denominadas
organelas (ou org�nulos) celulares. No interior do n�cleo das c�lulas foram
observadas estruturas filamentosas, os cromossomos, e estruturas globosas, os
nucl�olos. (Fig. 4.3)

ADILSON SECCO
Figura 4.3 Esquemas de c�lulas animal e vegetal, na concep��o dos citologistas do
s�culo XIX. Os vac�olos - bolsas contendo solu��o aquosa - s�o organelas t�picas de
c�lulas vegetais. (Elementos fora de propor��o de tamanho entre si; cores-
fantasia.)

P�gina 69

4.3 A teoria celular


Em 1838, reunindo estudos pr�prios e de diversos outros pesquisadores sobre a
estrutura celular dos vegetais, o bot�nico alem�o Mathias Schleiden (1804-1881)
lan�ou a ideia de que todas as plantas s�o constitu�das por c�lulas. Em 1839, o
zo�logo alem�o Theodor Schwann (1810-1882) chegou � mesma conclus�o para os
animais. Come�ava a se estruturar, assim, a teoria celular, segundo a qual as
c�lulas s�o as unidades constituintes de todos os seres vivos. (Fig. 4.4)

NATIONAL LIBRARY OF DENMARK AND COPENHAGEN UNIVERSITY LIBRARY


UNIVERSITY OF LEUVEN - B�LGICA
Figura 4.4 A. Retrato de Mathias Schleiden. B. Retrato de Theodor Schwann. Esses
dois cientistas alem�es propuseram a teoria celular.
As tr�s premissas fundamentais da teoria celular, que se consolidou ao longo do
s�culo XIX, s�o:
1. Todos os seres vivos s�o formados por c�lulas e por estruturas que elas
produzem; as c�lulas s�o, portanto, as unidades morfol�gicas dos seres vivos.
2. As atividades essenciais que caracterizam a vida ocorrem sempre no interior de
c�lulas; elas s�o, assim, as unidades funcionais ou fisiol�gicas dos seres vivos.
3. Novas c�lulas formam-se apenas por meio da reprodu��o de c�lulas preexistentes,
em um processo denominado divis�o celular.
A formula��o da teoria celular foi revolucion�ria para a Biologia. Pense um pouco:
n�o � not�vel que seres t�o distintos como uma ameba e uma pessoa sejam
constitu�dos pelo mesmo "tijolo" b�sico, a c�lula? A ameba � unicelular, isto �,
formada por uma �nica c�lula, enquanto os seres humanos s�o multicelulares (ou
pluricelulares), constitu�dos por muitas c�lulas; uma pessoa adulta tem nada menos
que 10 trilh�es (1013) de c�lulas!
A teoria celular � uma das mais importantes generaliza��es da Biologia. Ela prop�e
que os seres vivos, apesar das diferen�as que apresentam, t�m em comum o fato de
serem constitu�dos por c�lulas. Isso sugere que h� um parentesco evolutivo entre
todos os seres vivos. E � no n�vel microsc�pico e molecular que esse parentesco se
revela com toda a clareza. O m�dico alem�o Rudolph Virchow (1821-1902) j� apontava
para a necessidade de se conhecerem as c�lulas para compreender o fen�meno vida.
A descoberta da c�lula e o desenvolvimento da teoria celular abriram um novo campo
de estudo na �rea da Biologia: a Citologia (do grego kytos, c�lula, e logos,
estudo), que se dedica � compreens�o da estrutura e do funcionamento das c�lulas
vivas.
4.4 O desenvolvimento da Citologia
A microscopia fot�nica (�ptica)
O avan�o da microscopia resultou tanto do interesse em estudar as c�lulas quanto do
desenvolvimento paralelo da ind�stria �ptica. Entre os s�culos XIX e XX, o
microsc�pio �ptico, mais recentemente denominado microsc�pio fot�nico (do grego
photos, luz), chegava pr�ximo aos limites de amplia��o e de qualidade �ptica dos
microsc�pios da atualidade.
Os microsc�pios fot�nicos modernos apresentam tr�s conjuntos principais de lentes
fabricadas em vidro ou cristal. Um desses conjuntos � o condensador, cujas lentes
t�m a fun��o de concentrar os raios luminosos que v�o atravessar o objeto
observado. Outro conjunto comp�e as lentes objetivas, respons�veis pela forma��o da
imagem. O terceiro conjunto � o das lentes oculares, pelas quais o observador olha
o objeto.
A luz � concentrada pelas lentes condensadoras e transmitida atrav�s do objeto;
passa, ent�o, pelas lentes da objetiva e da ocular e chega ao olho do observador,
que v� a imagem ampliada do objeto. A partir da multiplica��o entre o aumento
fornecido pela objetiva e o aumento da ocular, calcula-se o valor final da
amplia��o. Se empregarmos, por exemplo, uma objetiva de 50 vezes e uma ocular de 10
vezes, o valor final da amplia��o ser� de 500 vezes.

P�gina 70

Os microsc�pios fot�nicos modernos apresentam aumentos m�dios entre 100 e 1.500


vezes. Dessa forma, um objeto de 0,01 mm de di�metro, invis�vel a olho nu, ao ter
sua imagem ampliada 1.000 vezes, pode ser visualizado como se tivesse 1 cm. (Fig.
4.5)

COMPASSIONATE EYE FOUNDATION/TOM GRILL/GETTY IMAGES

ADILSON SECCO
Figura 4.5 A. Cientista observando material em um microsc�pio fot�nico moderno. B.
Representa��o esquem�tica das partes fundamentais de um microsc�pio fot�nico,
mostrando o caminho percorrido pela luz (em vermelho) no interior do aparelho.
(Elementos fora de propor��o de tamanho entre si; cores-fantasia.)
A qualidade dos microsc�pios
Quando observamos fotos coloridas impressas com uma lente de aumento, percebemos
que as imagens s�o compostas de pequenos pontos de tr�s cores prim�rias (amarela,
azul e vermelha), al�m de pontinhos pretos. Como esses pontos s�o muito pequenos e
pr�ximos, a olho nu "misturamos" suas cores e temos a sensa��o visual das diversas
cores secund�rias das fotos.
Por exemplo, a �rea verde-escura de uma foto � formada predominantemente por
pontinhos azuis, amarelos e pretos quando observada com uma lente de aumento. A
lente "resolve" os pontos da imagem, o que nos permite v�-los como pontos
separados. O termo "resolver" vem do latim e significa "separar".
A olho nu conseguimos resolver, isto �, distinguir, pontos que estejam at� um
d�cimo de mil�metro (0,1 mm) de dist�ncia um do outro. Pontos mais pr�ximos que
essa dist�ncia limite s�o vistos sem distin��o. Portanto, o limite de resolu��o do
olho humano "desarmado" � da ordem de 0,1 mm. Essa � a menor dist�ncia entre dois
pontos em que eles ainda s�o percebidos como pontos separados a olho nu.
As lentes, no processo de forma��o da imagem, aumentam a capacidade do olho em
distinguir pontos muito pr�ximos. A qualidade de um microsc�pio fot�nico depende,
em grande parte, da qualidade �ptica das lentes, respons�vel por imagens n�tidas e
bem detalhadas, com alto poder de resolu��o e, consequentemente, limite de
resolu��o baixo. (Fig. 4.6)

OSNEI ROCHA
Figura 4.6 Reprodu��o de p�gina do livro infantil O mist�rio da f�brica de livros,
de Pedro Bandeira (S�o Paulo: Moderna, 2010). Um dos "mist�rios" revelados no livro
� a maneira pela qual s�o produzidas as cores das ilustra��es: � a incapacidade dos
nossos olhos de distinguir os pontos coloridos que causa a sensa��o de mistura de
cores.

P�gina 71

Microsc�pios fot�nicos de boa qualidade t�m limite de resolu��o em torno de 0,00025


mm, ou seja, permitem distinguir pontos separados por at� essa dist�ncia. Assim, o
limite de resolu��o desses microsc�pios � cerca de 400 vezes menor que o do olho nu
(0,1 mm � 0,00025 mm = 400). Isso significa que o microsc�pio fot�nico pode
aumentar o poder de resolu��o do olho humano cerca de 400 vezes.
Quando trabalhamos com dimens�es do mundo microsc�pico, utilizamos unidades de
medida menores que as normalmente presentes em nosso cotidiano. Uma delas � o
micr�metro (?m), correspondente � milion�sima parte do metro. Com essa unidade, as
grandezas mencionadas no par�grafo anterior seriam: 100 ?m � 0,25 ?m = 400. Para
dimens�es ainda menores, costuma-se usar o nan�metro (nm), que corresponde a um
mil�simo do micr�metro (10-3 ?m ou 10-6 mm ou 10-9 m). Os f�sicos e os qu�micos
tamb�m utilizam o angstrom (�), 10 vezes menor que o nan�metro e que corresponde a
10-10 m.
Prepara��o de materiais para observa��o microsc�pica
Paralelamente ao desenvolvimento dos microsc�pios, os citologistas criaram novas
metodologias para o preparo do material biol�gico, de modo a obter a m�xima
qualidade poss�vel nas observa��es microsc�picas.
Em primeiro lugar, � preciso cortar o material biol�gico em fatias fin�ssimas, pois
a forma��o de imagens nos microsc�pios fot�nicos demanda que a luz atravesse o
objeto observado.
Alguns tecidos vegetais permitem obter cortes manuais de espessura razo�vel, feitos
com navalhas ou l�minas de barbear. Entretanto, a maioria dos materiais vegetais e
animais tem de ser previamente tratada e endurecida antes de ser cortada em
aparelhos especiais - os micr�tomos -, que permitem a obten��o de fatias finas o
suficiente para a observa��o.
Os tratamentos dos materiais biol�gicos consistem, inicialmente, em imergi-los em
solu��es de certas subst�ncias, denominadas fixadores (�lcool, formalde�do, �cido
p�crico etc.), que matam rapidamente as c�lulas, mas conservam sua estrutura com
poucas altera��es.
O tecido fixado � ent�o colocado em um recipiente que cont�m parafina derretida
pelo calor. Depois que esfria e endurece, a parafina forma um bloco s�lido, que �
tirado do recipiente. No interior desse bloco de parafina encontra-se o material
biol�gico; por isso, o m�todo � chamado inclus�o em parafina. Em seguida, o bloco �
cortado em fatias bem finas pela l�mina de a�o do micr�tomo.
As finas fatias de tecidos fixados, chamadas cortes histol�gicos, precisam ainda
passar por outros tratamentos antes da observa��o. Em geral, as estruturas
celulares apresentam pouco contraste �ptico. Para aument�-lo, os citologistas
utilizam corantes, subst�ncias capazes de colorir diferencialmente as estruturas
celulares. Por exemplo, uma solu��o dilu�da de carmim, corante extra�do de um
inseto conhecido como cochonilha-do-carmim (Coccus cacti), colore intensamente o
n�cleo das c�lulas, mas n�o o citoplasma; a hematoxilina, corante extra�do do
tronco de uma �rvore, o campeche (Haematoxylon campechianum), tamb�m colore o
n�cleo celular. (Fig. 4.7)

STEVE GSCHMEISSNER/SCIENCE PHOTO LIBRARY/LATINSTOCK


Figura 4.7 Alguns corantes permitem observar partes espec�ficas das c�lulas devido
� sua afinidade por determinadas estruturas. Na imagem, fotomicrografia de c�lulas
de intestino delgado, com o epit�lio externo em azul mais escuro e c�lulas
secretoras de muco em azul-claro. Os n�cleos celulares est�o corados em marrom-
claro.
(Microsc�pio fot�nico; aumento ? 240�; cores artificiais.)
Na segunda metade do s�culo XIX, anilinas empregadas na ind�stria t�xtil mostraram-
se �teis para colorir partes espec�ficas das c�lulas. Uma delas, a eosina, revelou
grande afinidade por prote�nas citoplasm�ticas.
O emprego de corantes possibilitou a descoberta de diversas estruturas celulares.
Entretanto, as limita��es do microsc�pio fot�nico impediam que os citologistas
visualizassem detalhadamente o intrincado meio intracelular. Isso s� veio a ocorrer
com a inven��o dos microsc�pios eletr�nicos, como veremos na sequ�ncia.

P�gina 72

Amplie seus conhecimentos


T�cnicas em Citologia
A observa��o vital, o esfrega�o, o esmagamento e a radioautografia s�o algumas
t�cnicas em Citologia, al�m da inclus�o e do corte.
Observa��o vital
Uma t�cnica citol�gica relativamente simples � a observa��o vital, tamb�m conhecida
como exame a fresco. O material biol�gico vivo � colocado entre a l�mina e a
lam�nula e observado. Esse tipo de exame � utilizado, por exemplo, para observar
c�lulas vegetais vivas.
Nos exames a fresco tamb�m � poss�vel utilizar alguns corantes especiais, chamados
corantes vitais, que penetram na c�lula e evidenciam suas estruturas sem mat�-la.
Exemplos de corantes vitais s�o o azul de metileno e o verde janus; este �ltimo tem
grande especificidade pelas estruturas citoplasm�ticas denominadas mitoc�ndrias.
Esfrega�o
Se o material biol�gico � constitu�do por c�lulas isoladas ou pouco unidas entre
si, pode-se simplesmente espalh�-lo sobre a l�mina de vidro, processo conhecido por
esfrega�o. Por exemplo, para preparar l�minas de amostra de sangue, pinga-se uma
gota dele sobre a l�mina e espalha-se bem, de modo a formar uma camada fina. Isso
evita que as c�lulas fiquem sobrepostas e permite visualiz�-las isoladamente.
A t�cnica de esfrega�o pode tamb�m ser utilizada para observar c�lulas de
revestimentos mucosos, as quais se soltam com certa facilidade. Por exemplo, para
obter c�lulas do revestimento interno da boca, raspa-se levemente a superf�cie da
mucosa bucal com um instrumento adequado, espalhando as c�lulas coletadas sobre uma
l�mina de microscopia, de modo a obter o esfrega�o.

JASON EDWARDS/NATIONAL GEOGRAPHIC/GETTY IMAGES

ARQUIVO DO AUTOR

MICHAEL ABBEY/SCIENCE SOURCE/FOTOARENA


A. Macrofotografia de uma flor de trapoeraba-roxa (Tradescantia pallida), mostrando
os tricomas (pelos) estaminais (setas), estruturas utilizadas para an�lise de
c�lulas. A flor mede cerca de 4 cm de di�metro. B. Fotomicrografia de exame a
fresco de c�lulas do tricoma estaminal de Tradescantia pallida. (Microsc�pio
fot�nico; aumento ? 270�.) C. C�lulas da mucosa bucal humana preparadas pelo m�todo
de esfrega�o e coradas com hematoxilina e eosina. (Microsc�pio fot�nico; aumento ?
600�; cores artificiais.)

P�gina 73

Esmagamento
No caso de c�lulas frouxamente associadas, como as de partes moles de tecidos
animais ou vegetais, pode-se preparar o material por meio da t�cnica de
esmagamento. O material, geralmente j� fixado e corado, � colocado entre uma l�mina
e uma lam�nula de vidro e esmagado pela press�o suave do dedo polegar. Em alguns
casos, o material pode ser aquecido previamente para fazer com que suas c�lulas se
separem com mais facilidade.

ADILSON SECCO

M. I. WALKER/SCIENCE SOURCE/FOTOARENA
Representa��o esquem�tica das etapas da prepara��o de uma l�mina de raiz de cebola
pela t�cnica de esmagamento. As pontas das ra�zes s�o fervidas em um tubo com o
corante orce�na e transferidas para uma l�mina, na qual s�o picadas com dois
estiletes. Depois os fragmentos das ra�zes s�o esmagados entre l�mina e lam�nula.
(Elementos fora de propor��o de tamanho entre si; cores-fantasia.) No detalhe,
fotomicrografia de c�lulas de raiz de cebola. (Microsc�pio fot�nico, com uso de
filtro verde; aumento ? 440�.)
Radioautografia
Para determinar em que c�lulas de um tecido uma dada subst�ncia est� sendo
sintetizada, pode-se utilizar uma t�cnica conhecida como radioautografia. Por
exemplo, se desejarmos identificar em que c�lulas de um tecido est� sendo
sintetizado DNA, o tecido vivo � incubado em um meio de cultura contendo timina
radioativa, um precursor de DNA. Ap�s algum tempo, o tecido � fixado e preparado em
l�minas para observa��o microsc�pica. Em um quarto totalmente escuro, as l�minas
s�o recobertas com uma fina pel�cula fotogr�fica virgem e guardadas em caixas �
prova de luz.
As c�lulas que cont�m DNA radioativo - sintetizado durante a incuba��o na presen�a
de timina radioativa - emitem radia��o que impressiona a pel�cula fotogr�fica sobre
a l�mina. Ap�s alguns dias de exposi��o � radia��o, executa-se a revela��o
fotogr�fica da l�mina com o filme aderido. Se forem observados gr�os negros no
filme revelado, isso indicar� a presen�a de subst�ncias radioativas nas c�lulas
situadas imediatamente abaixo.

ADILSON SECCO
Representa��o esquem�tica da t�cnica de radioautografia. A presen�a de gr�os negros
sobre o n�cleo de determinadas c�lulas indica que neles ocorreu s�ntese de DNA
durante a incuba��o do tecido no meio de cultura com o precursor radioativo.
(Elementos fora de propor��o de tamanho entre si; cores-fantasia.)

P�gina 74

A microscopia eletr�nica
O primeiro microsc�pio eletr�nico foi constru�do no in�cio da d�cada de 1930, mas
seu emprego no estudo das c�lulas come�ou mais tarde, na d�cada de 1950. Nesse
meio-tempo, os citologistas desenvolveram diversas t�cnicas de fixa��o, de
colora��o e de corte apropriadas para o microsc�pio eletr�nico.
A microscopia eletr�nica revolucionou a Citologia porque possibilitou estudos
bastante detalhados da estrutura interna das c�lulas. Para se ter ideia, enquanto
microsc�pios fot�nicos fornecem aumentos m�ximos de 1.500 vezes, microsc�pios
eletr�nicos operam com aumentos entre 5 mil e 100 mil vezes ou mais.
Al�m disso, o fato de os microsc�pios eletr�nicos utilizarem feixes de el�trons, em
vez de luz, possibilita obter baixos limites de resolu��o, bem menores que os dos
microsc�pios fot�nicos; enquanto nestes �ltimos o limite de resolu��o � de 0,25 ?m,
nos microsc�pios eletr�nicos o limite � de 0,001 ?m (1 nm). Fazendo os c�lculos,
conclu�mos que o limite de resolu��o do microsc�pio eletr�nico � cerca de 250 vezes
menor que o do microsc�pio fot�nico; seu poder de resolu��o, portanto, � 250 vezes
maior. Em rela��o ao olho nu, o poder de resolu��o do microsc�pio eletr�nico �
cerca de 100 mil vezes maior (100 ?m � 0,001?m = 100.000). (Fig. 4.8)

MAURO FERMARIELLO/SCIENCE PHOTO LIBRARY/LATINSTOCK

STEVE GSCHMEISSNER/SCIENCE PHOTO LIBRARY/LATINSTOCK


Figura 4.8 A. Cientista manipulando um microsc�pio eletr�nico de transmiss�o. B.
Fotomicrografia de corte de um linf�cito. (Microsc�pio eletr�nico de transmiss�o;
aumento ? 4.500�; cores artificiais.)
A vis�o que temos da arquitetura celular foi basicamente elaborada a partir de
estudos em microsc�pios eletr�nicos de transmiss�o. Nesses aparelhos se observa o
material biol�gico cortado em fin�ssimas fatias entre 30 nm a 60 nm de espessura, o
que equivale a cortar uma c�lula em aproximadamente 200 fatias. A microscopia
eletr�nica produz imagens em branco e preto e bidimensionais (2-D). Assim, para
imaginar como s�o as c�lulas e as organelas em tr�s dimens�es (3-D), os
citologistas tiveram (e ainda t�m) de realizar um minucioso trabalho de
reconstru��o da tridimensionalidade celular a partir de cortes sequenciais em
diferentes planos.
O pensamento e a imagina��o, aliados �s t�cnicas microsc�picas e bioqu�micas de
investiga��o, s�o as principais ferramentas utilizadas nos estudos das c�lulas.
Eles nos permitem "viajar" ao mundo microsc�pico e compor os modelos
tridimensionais e funcionais da c�lula viva.
Os cen�rios celulares e eventos moleculares que estudaremos adiante n�o foram
visualizados diretamente, tais como est�o representados nos esquemas did�ticos.
Para construir os modelos de c�lulas os cientistas re�nem diversas evid�ncias,
imaginando cen�rios que n�o podem ser visualizados diretamente, mas que podem ser
testados e validados por meio de experimentos.

P�gina 75

� importante prestar aten��o �s escalas de tamanho de c�lulas, organelas e


mol�culas, principalmente ao observar representa��es e esquemas que modelam
estruturas e processos. Por exemplo, se uma c�lula c�bica de 30 ?m � 30 ?m � 30 ?m
fosse ampliada 100.000 vezes, ela teria aproximadamente o tamanho de um quarto de
uma casa (3 m � 3 m � 3 m). Qual seria, em escala, a espessura de sua membrana
plasm�tica?
Vamos calcular: a espessura real da membrana situa-se em torno de 5 nm; com uma
amplia��o de 100.000 vezes, ela passaria a ter aproximadamente 0,5 mm de espessura.
Pegue uma r�gua e visualize esse tamanho. Imagine agora aquele quarto de 27 metros
c�bicos delimitado por uma pel�cula pl�stica transparente e flex�vel de 0,5 mm de
espessura! Essa compara��o nos d� uma ideia de como a membrana plasm�tica � fina.
As cores utilizadas nas ilustra��es n�o correspondem � realidade, ou seja, s�o
cores-fantasia, empregadas com o prop�sito did�tico de distinguir melhor as partes
celulares. Em muitos casos, a pr�pria fotografia obtida ao microsc�pio eletr�nico �
colorizada artificialmente. Procure sempre, nas legendas de fotografias e
ilustra��es, indica��es sobre a escala e a colora��o para poder interpretar
corretamente as indica��es dos mundos microsc�pico e nanosc�pico.
4.5 C�lulas procari�ticas e eucari�ticas
O microsc�pio eletr�nico revelou a exist�ncia de dois tipos b�sicos de c�lula:
procari�ticas, t�picas de bact�rias e de arqueas, e eucari�ticas, presentes em
todos os demais seres vivos (protozo�rios, fungos, algas, plantas e animais).
Organismos constitu�dos por c�lulas procari�ticas s�o chamados procariontes e os
que apresentam c�lulas eucari�ticas, eucariontes.
C�lulas procari�ticas (do grego protos, primitivo, e karyon, n�cleo) s�o mais
simples que as eucari�ticas; seu citoplasma n�o tem estruturas membranosas nem
n�cleo; o "cromossomo" bacteriano concentra-se em uma regi�o da c�lula chamada
nucleoide.
C�lulas eucari�ticas (do grego eu, verdadeiro, e karyon, n�cleo) t�m o citoplasma
repleto de canais, bolsas e outras estruturas membranosas, sendo uma delas o
n�cleo, no qual se localizam os cromossomos.
A estrutura interna de c�lulas procari�ticas e eucari�ticas ser� estudada com mais
detalhes nos pr�ximos cap�tulos. (Fig. 4.9)

ILUSTRA��ES: CEC�LIA IWASHITA


Figura 4.9 Representa��es esquem�ticas de uma c�lula procari�tica de bact�ria (�
esquerda) e de uma c�lula eucari�tica animal (� direita). O tamanho da c�lula
procari�tica equivale ao de uma mitoc�ndria na c�lula animal. (Elementos fora de
propor��o de tamanho entre si; cores-fantasia.)

P�gina 76

ATIVIDADES
Revendo conceitos, fatos e processos
Registre em seu caderno
Escreva, em seu caderno, o termo abaixo que substitui corretamente a tarja entre
par�nteses das frases de 1 a 7.
a) colora��o
b) corte histol�gico
c) fixa��o
d) inclus�o
e) limite de resolu��o
f) micr�tomo
g) poder de resolu��o
1. O aparelho com o qual se obt�m cortes finos para observa��o microsc�pica chama-
se (.....).
2. O procedimento de matar as c�lulas rapidamente, de modo a causar pouca altera��o
estrutural e permitir sua observa��o ao microsc�pio, � conhecido como (.....).
3. A t�cnica de (.....) consiste em tingir diferencialmente as estruturas celulares
com determinadas subst�ncias qu�micas, o que real�a o contraste entre elas.
4. A t�cnica de (.....) consiste em retirar fatias muito finas do material
biol�gico para observa��o ao microsc�pio.
5. A t�cnica de impregnar uma pe�a de material biol�gico com subst�ncias que a
endurecem, como a parafina, permitindo a obten��o de fin�ssimas fatias, recebe o
nome de (.....).
6. (.....) � a capacidade de um microsc�pio fornecer imagens n�tidas e detalhadas
da estrutura de objetos.
7. A menor dist�ncia entre dois pontos em que ainda � poss�vel perceber a separa��o
entre eles � chamada (.....).
Copie as frases 8 e 9 substituindo a tarja por um dos termos a seguir.
a) procari�tica
b) eucari�tica
8. A c�lula (.....) apresenta o citoplasma repleto de canais, bolsas e outras
estruturas membranosas, uma das quais � o n�cleo.
9. Uma c�lula sem n�cleo e organelas membranosas no citoplasma, caracter�stica de
bact�rias e arqueas, � chamada (.....).
10. De acordo com a teoria celular, apesar das diferen�as no n�vel macrosc�pico,
todos os seres vivos s�o semelhantes em sua constitui��o fundamental, uma vez que
a) cont�m mol�culas org�nicas.
b) se originam de gametas.
c) s�o capazes de se reproduzir sexualmente.
d) s�o constitu�dos por c�lulas.
11. A membrana das c�lulas, pelo fato de ter cerca de 5 nm (0,000005 mm) de
espessura, pode ser observada:
a) ao microsc�pio fot�nico ou �ptico.
b) ao microsc�pio eletr�nico.
c) ao microsc�pio simples.
d) a olho nu
12. Em uma fotomicrografia obtida com um microsc�pio eletr�nico, o n�cleo de uma
c�lula mediu 5,5 cm de di�metro. Sabendo que a amplia��o da imagem foi de 11.000
vezes, qual � o di�metro real desse n�cleo?
a) 5 cm.
b) 5 mm.
c) 5 ?m ou 0,005 mm.
d) 5 nm ou 0,000005 mm.
13. "Um pesquisador estudou a c�lula de um organismo, verificando aus�ncia de
n�cleo e de compartimentos membranosos. Com base nessas observa��es, ele concluiu
que a c�lula � (1) e pertence a (2)." Qual � a alternativa que cont�m os termos que
substituem corretamente os n�meros na frase?
a) 1 =procari�tica; 2 = um fungo.
b) 1 = eucari�tica; 2 = um animal.
c) 1 = eucari�tica; 2 = uma planta.
d) 1 = procari�tica; 2 = uma bact�ria.
Quest�o para exercitar o pensamento
Registre em seu caderno
14. Suponhamos que voc� tenha recebido uma fotografia de uma c�lula ampliada.
Medidos com uma r�gua, os di�metros da imagem da c�lula e de seu n�cleo na
fotografia eram, respectivamente, 17,5 cm e 4,25 cm. A ocular e a objetiva usadas
no microsc�pio eram de, respectivamente, 10� e 40� de aumento. A amplia��o
fotogr�fica para o papel foi de 5�, al�m do que foi ampliado e registrado no
negativo do filme. Quanto medem, em micr�metro, a c�lula e seu n�cleo?
Fa�a voc� mesmo!
Registre em seu caderno
15. Atividade pr�tica: Poder de resolu��o
A qualidade da imagem fornecida por um instrumento �ptico depende, entre outros
fatores, de seu poder de resolu��o, isto �, de sua capacidade de diferenciar dois
pontos situados muito pr�ximos um do outro. Quanto menor � a dist�ncia entre dois
pontos que o instrumento distingue, maior ser� seu poder de detalhar a imagem.
Nesta atividade, vamos comparar o poder de resolu��o de alguns instrumentos
�pticos. Para isso, voc� precisar� de uma p�gina de jornal ou revista com um
retrato colorido de uma pessoa.

P�gina 77

Al�m disso, tente obter diferentes instrumentos �pticos para observar a fotografia,
como um par de �culos, desses usados para "vista cansada" (presbiopia), lupas de
diversos tamanhos e, se poss�vel, um microsc�pio.
Voc� vai testar o poder de resolu��o desses instrumentos utilizando-os para
observar os pontos que comp�em a fotografia. A impress�o comercial costuma empregar
tr�s cores b�sicas (magenta, ciano e amarela), al�m de preto, impressas
separadamente na forma de pequenos pontos. A olho nu, n�o distinguimos esses pontos
porque eles est�o muito pr�ximos uns dos outros, a uma dist�ncia inferior � do
limite de resolu��o do olho. Assim, nossa vista "mistura" as cores dos pontos, o
que cria diferentes tonalidades.
Ao observar a fotografia com os diferentes instrumentos �pticos, procure
identificar os pontos que comp�em a imagem e, se poss�vel, fa�a um registro
fotogr�fico dessas observa��es. Todos os instrumentos utilizados permitiram
distinguir os pontos da fotografia? Qual deles apresentou maior poder de resolu��o?
Compare suas observa��es com as de seus colegas e elabore um pequeno relat�rio
descrevendo o procedimento realizado e os resultados obtidos.
A Biologia no vestibular e no Enem
Registre em seu caderno
Quest�es objetivas
1. (UFPA) A descoberta da c�lula foi feita em 1665 por (.....). Em 1838 e 1839,
(.....) e (.....), atrav�s de observa��es de estruturas de muitas plantas e
animais, conclu�ram que os seres vivos s�o constitu�dos por c�lulas. Qual � a
alternativa que completa corretamente as frases?
a) Hooke, Weismann, Schwann
b) Virchow, Schleiden, Schwann
c) Schleiden, Hooke, Schwann
d) Hooke, Schleiden, Schwann
e) Virchow, Weismann, Hooke
2. (Unifor-CE) A teoria celular, proposta por Schleiden e Schwann, afirmava que
a) toda c�lula prov�m de uma c�lula preexistente.
b) todas as c�lulas vivas t�m n�cleo individualizado.
c) h� estreita rela��o entre a forma e a fun��o nas c�lulas.
d) c�lulas embrion�rias se multiplicam por mitose.
e) vegetais e animais s�o constitu�dos por c�lulas.
3. (Unifor-CE) Durante o processo de prepara��o de tecidos em cortes para estudo
microsc�pico, uma das fases em que o tecido � endurecido, a fim de que possa ser
cortado em fatias fin�ssimas, � denominada
a) fixa��o.
b) colora��o.
c) inclus�o.
d) montagem.
4. (UnB-DF) Quando se usa o microsc�pio, � importante saber de quanto o instrumento
ampliou a imagem do objeto. Se, por exemplo, na ocular estiver marcado 5� e na
objetiva 12�, a amplia��o � de
a) 17 di�metros (12� + 5�).
b) 7 di�metros (12� - 5�).
c) 60 di�metros (12� ? 5�).
d) 2,4 di�metros (12� ? 5�).
5. (Unigranrio-RJ) Os seres vivos, exceto um, s�o constitu�dos por unidades
biol�gicas identificadas como c�lulas. As exce��es s�o
a) as algas.
b) os v�rus, considerados seres vivos pela maioria dos cientistas modernos.
c) os vermes.
d) as bact�rias, ainda que consideradas seres vivos por uma minoria de
pesquisadores.
6. (Vunesp) Os procariontes diferenciam-se dos eucariontes porque os primeiros,
entre outras caracter�sticas,
a) n�o possuem material gen�tico.
b) possuem material gen�tico como os eucariontes, mas s�o anucleados.
c) possuem n�cleo, mas o material gen�tico encontra-se disperso no citoplasma.
d) possuem material gen�tico disperso no n�cleo, mas n�o em estruturas organizadas
denominadas cromossomos.
e) possuem n�cleo e material gen�tico organizado nos cromossomos.
7. (Fatec-SP) A inven��o do microsc�pio possibilitou v�rias descobertas e, gra�as
ao surgimento dos microsc�pios eletr�nicos, houve uma revolu��o no estudo das
c�lulas. Esses equipamentos permitiram separar os seres vivos em procari�ticos e
eucari�ticos, porque se descobriu que os primeiros, entre outras caracter�sticas,
a) possuem parede celular e cloroplastos.
b) possuem material gen�tico disperso pelo citoplasma.
c) possuem n�cleo organizado envolto por membrana nuclear.
d) n�o possuem n�cleo e n�o t�m material gen�tico.
e) n�o possuem clorofila e n�o se reproduzem.
Quest�o discursiva
8. (Fuvest-SP)
a) Quais as diferen�as existentes entre c�lulas procariontes e eucariontes quanto a
n�cleo e citoplasma?
b) Em que grupos de organismos s�o encontradas c�lulas procariontes?

P�gina 78

Cap�tulo 5 Membrana celular e citoplasma

EYE OF SCIENCE/SCIENCE PHOTO LIBRARY/LATINSTOCK


A ci�ncia conta com uma nova aliada: a nanotecnologia. O desenvolvimento de
nanomateriais e de nanopart�culas tem dado grande contribui��o para a Medicina e a
Ecologia, entre outras �reas do conhecimento. T�cnicas de nanotecnologia t�m sido
usadas no tratamento de doen�as e na preserva��o ambiental. Na imagem, fibras de
algod�o (estruturas alaranjadas) recobertas por nanopart�culas que as protegem de
�gua e sujeira. (Microsc�pio eletr�nico de varredura; aumento ? 15.600�; cores
artificiais.)
O mundo nanosc�pico
Em 1981, trabalhando em Zurique, na Su��a, os f�sicos Heinrich Rohrer (1933-2013) e
Gerd Binnig (1947-) desenvolveram os princ�pios de um novo e revolucion�rio
aparelho: o microsc�pio de tunelamento por varredura. Com esse microsc�pio, �
poss�vel detectar o tamanho e a apar�ncia tridimensional dos �tomos. Pela inven��o,
a dupla de cientistas recebeu o Pr�mio Nobel de F�sica em 1986.
Para ter uma ideia do poder de amplia��o do novo microsc�pio, seria como ampliar a
imagem de uma bolinha de pingue-pongue ao tamanho da Terra. Voc� consegue calcular
esse aumento? (Considere que o di�metro da Terra � de aproximadamente 12.000 km e
que o de uma bolinha de pingue-pongue � de 40 mm.)
Com a nova gera��o de microsc�pios, ultrapassamos os limites do mundo microsc�pico
e chegamos ao mundo "nanosc�pico", onde lidamos com objetos de poucos nan�metros de
tamanho. Lembre-se de que 1 nan�metro equivale � bilion�sima parte de 1 metro (1 nm
= 10-9 m).
Em uma memor�vel palestra proferida em 1959, o f�sico estadunidense Richard Feynman
(1918-1988), Pr�mio Nobel de F�sica em 1965, sugeriu que os cientistas dedicassem
mais esfor�os ao mundo nanosc�pico, realizando experimentos e interven��es no n�vel
dos �tomos e das mol�culas. Alguns anos mais tarde, surgiu a nanotecnologia, que
trabalha com a cria��o de aplica��es tecnol�gicas em uma escala que vai de 1 nm a
100 nm, em m�dia.
A nanotecnologia j� tem diversas aplica��es industriais e tamb�m parece promissora
nas �reas da Biologia e da Medicina. Por exemplo, em meados dos anos 1990, o
farmacologista estadunidense Volkmar Weissig descobriu que era poss�vel produzir
artificialmente pequenas bolsas membranosas de 50 nm de di�metro capazes de levar
DNA (e outras subst�ncias) diretamente �s mitoc�ndrias, as organelas respons�veis
pela produ��o de energia nas c�lulas vivas. Ele talvez tenha pensado: e da�? O que
algu�m poderia fazer com isso? Poucos anos depois, pesquisas come�aram a relacionar
diversas doen�as humanas a dist�rbios dessas organelas. Hoje, um dos desafios da
pesquisa farmacol�gica � levar drogas terap�uticas diretamente �s mitoc�ndrias
celulares.
P�gina 79

A import�ncia do assunto
Com a evolu��o da microscopia, aliada �s descobertas no campo da Bioqu�mica
Celular, os cientistas podem "visualizar" a c�lula viva em um novo patamar: o n�vel
nanosc�pico. Essa visualiza��o n�o � feita com os olhos, e sim com a mente. No
nanoambiente h� diversas estruturas - as organelas celulares - que criam condi��es
para as intera��es moleculares necess�rias � vida. Essas intera��es constituem o
metabolismo, como vimos anteriormente.
Gra�as � nossa capacidade imaginativa, podemos nos transportar - como
"nanobservadores" - para o interior da c�lula eucari�tica, um intrincado labirinto
de membranas no qual se deslocam part�culas, fibras, t�bulos, bolsas membranosas e
mol�culas de diversos tipos. Ao analisar a estrutura e a fun��o de cada componente
celular, compreendemos melhor por que o metabolismo � um conjunto de intera��es
moleculares que se passa no interior da c�lula. Neste cap�tulo e no pr�ximo, vamos
explorar esse universo nanosc�pico.
5.1 Construindo o modelo atual de c�lula
O conceito de c�lula como unidade b�sica da vida come�ou a ser constru�do a partir
da d�cada de 1840, quando foram aceitos os fundamentos da teoria celular.
A teoria celular parece-nos hoje t�o �bvia que, �s vezes, subestimamos sua
import�ncia para a Biologia. Pessoas, minhocas, cogumelos, alfaces e bact�rias, por
exemplo, s�o todos constitu�dos pelo mesmo "tijolo" biol�gico b�sico - a c�lula.
� verdade que h� diferen�as entre as c�lulas dos diversos organismos e tamb�m entre
c�lulas de um mesmo organismo. As maiores diferen�as s�o encontradas entre as
bact�rias, que apresentam c�lula procari�tica, destitu�da de n�cleo e de organelas
membranosas, e os demais seres vivos, que t�m c�lulas eucari�ticas. A presen�a de
plastos no citoplasma das c�lulas vegetais as diferencia das c�lulas animais. As
c�lulas vegetais tamb�m s�o dotadas de uma parede celular, ausente nas c�lulas
animais.
Apesar das diferen�as, uma an�lise dos aspectos celulares essenciais mostra que
todas as c�lulas eucari�ticas partilham a mesma estrutura b�sica e funcionam de
modo muito parecido. Neste e no pr�ximo cap�tulo estudaremos justamente esses
aspectos fundamentais da estrutura e do metabolismo dessas c�lulas. (Fig. 5.1)

JURANDIR RIBEIRO
Figura 5.1 Representa��o esquem�tica de alguns tipos de c�lula ou fragmentos de
c�lula, no caso das plaquetas sangu�neas. Um exame das caracter�sticas mais
evidentes das c�lulas, como tamanho, forma, padr�es de movimento etc., revela a
grande diversidade de tipos celulares existentes em um mesmo organismo. (Elementos
fora de propor��o de tamanho entre si; cores-fantasia.)

P�gina 80

A tridimensionalidade da c�lula viva


Quem j� teve a oportunidade de observar cortes de c�lulas ao microsc�pio fot�nico
pode ter ficado um pouco decepcionado. O que se v� na l�mina de microscopia est�
bem distante das belas ilustra��es coloridas e tridimensionais das c�lulas dos
livros did�ticos. Por qu�?
Em primeiro lugar, essa diferen�a ocorre por limita��es das t�cnicas e dos
aparelhos de observa��o microsc�pica. Como vimos no cap�tulo anterior, antes de
observar as c�lulas temos de mat�-las e fix�-las, tentando preservar ao m�ximo suas
estruturas. Em seguida, precisamos obter fatias celulares muito finas - os cortes
histol�gicos - que permitam a passagem da luz atrav�s delas, nos microsc�pios
fot�nicos, ou de feixes eletr�nicos, nos microsc�pios eletr�nicos de transmiss�o.
Em muitos casos, antes ou depois do corte, o material a ser observado passa por
tratamentos com subst�ncias corantes, que aumentam os contrastes entre as partes
celulares, permitindo distingui-las. Com tantos tratamentos e interven��es, n�o �
de admirar que a reconstitui��o da imagem do que seria a c�lula viva e funcionante
exija muita imagina��o. (Fig. 5.2)
ILUSTRA��ES: EDILSON BILAS
Figura 5.2 Representa��o esquem�tica de c�lula animal (A) e de c�lula vegetal (B)
parcialmente cortadas para mostrar seus diversos componentes. (Elementos fora de
propor��o de tamanho entre si; cores-fantasia.)

P�gina 81

5.2 Caracter�sticas das membranas biol�gicas (biomembranas)


Em fun��o do comportamento das c�lulas em diversas situa��es - inchar, murchar,
estourar -, os primeiros citologistas logo perceberam que elas eram delimitadas por
algum tipo de pel�cula muito fina, invis�vel at� nos mais poderosos microsc�pios
fot�nicos modernos; essa pel�cula hipot�tica foi denominada membrana plasm�tica.
Com o progresso da microscopia eletr�nica, a membrana plasm�tica foi finalmente
visualizada. Nos cortes transversais observados ao microsc�pio eletr�nico, ela
aparece como duas linhas escuras entremeadas por uma regi�o central mais clara, e
sua espessura situa-se em torno de 5 nm.
A microscopia eletr�nica e as an�lises bioqu�micas revelaram tamb�m que o
citoplasma de uma c�lula eucari�tica � repleto de membranas, com espessura e
composi��o qu�mica semelhantes �s da membrana plasm�tica. Esse sistema membranoso
citoplasm�tico forma um labirinto de tubos e bolsas, cercado por um fluido aquoso
no qual h� t�bulos e filamentos proteicos fin�ssimos, al�m de part�culas de
diversos formatos e tamanhos.
Atualmente, o termo biomembrana designa tanto a membrana plasm�tica como as
membranas que dividem o interior da c�lula em compartimentos. (Fig. 5.3)

STEVE GSCHMEISSNER/SCIENCE PHOTO LIBRARY/LATINSTOCK


Figura 5.3 Fotomicrografia de um corte de um linf�cito, mostrando o n�cleo, em
roxo, e a profus�o de estruturas membranosas citoplasm�ticas, em amarelo.
(Microsc�pio eletr�nico de transmiss�o; aumento ? 4.300�; cores artificiais.)
Estrutura molecular das biomembranas
An�lises bioqu�micas de membranas celulares mostraram que seus principais
componentes s�o fosfolip�dios. As biomembranas das c�lulas animais apresentam ainda
colesterol, um tipo de lip�dio ausente em c�lulas vegetais.
As mol�culas de fosfolip�dios apresentam uma "cabe�a" eletricamente carregada,
representada pelo grupo fosfato, e duas "caudas" apolares, representadas pelo
glicer�dio. As cabe�as eletricamente carregadas dos fosfolip�dios tendem a atrair
mol�culas de �gua (que, como vimos, tamb�m t�m cargas), sendo, por isso,
denominadas hidrof�licas (do grego hydro, �gua, e phylos, amigo). As caudas, sem
carga el�trica, tendem a repelir mol�culas de �gua, sendo, por isso, denominadas
hidrof�bicas (do grego hydro, �gua, e phobos, medo, avers�o). (Relembre a fig. 3.11
na p�gina 52.)
Em 1972, os pesquisadores estadunidenses Jonathan Singer (1924-) e Garth Nicolson
(1943-), com base na constitui��o qu�mica e no comportamento das biomembranas,
elaboraram um modelo molecular para explicar sua estrutura altamente din�mica.
No modelo de Singer e Nicolson, as biomembranas seriam constitu�das por uma camada
dupla de mol�culas de fosfolip�dios bem compactadas. As cabe�as dos fosfolip�dios,
eletricamente carregadas, estariam voltadas para as faces externas da membrana, em
contato com a �gua sempre presente nas solu��es internas e externas � c�lula. Com
isso, "esconderiam" as caudas sem carga el�trica da �gua circundante, voltando-as
para o interior da dupla camada molecular da membrana. Segundo o modelo, � essa
estrutura em dupla camada que confere �s membranas biol�gicas sua grande
estabilidade e dinamismo. Embora se desloquem continuamente no plano da membrana,
as mol�culas de fosfolip�dios nunca perdem o contato umas com as outras.
*
P�gina 82

O modelo de Singer e Nicolson tamb�m sup�e a presen�a de mol�culas globulares de


prote�nas, incrustadas na bicamada de fosfolip�dios, como se fossem pe�as de um
mosaico. Algumas dessas prote�nas encontram-se em posi��o superficial na dupla
camada lip�dica, enquanto outras a atravessam de lado a lado. A movimenta��o das
prote�nas na estrutura da biomembrana explica diversas fun��es importantes e levou
Singer e Nicolson a denominar sua proposta como modelo do mosaico fluido. (Fig.
5.4)

ADILSON SECCO
Figura 5.4 Representa��o esquem�tica da membrana plasm�tica de acordo com o modelo
do mosaico fluido. (Elementos fora de propor��o de tamanho entre si; cores-
fantasia.)
J� foram identificadas dezenas de tipos de prote�na nas membranas celulares.
Algumas delas, voltadas para o exterior, est�o ligadas a mol�culas de glic�dios,
que formam uma esp�cie de malha filamentosa em torno da c�lula, denominada
glicoc�lix. Outras formam poros, que permitem a passagem de mol�culas de �gua e
�ons. Outras, ainda, capturam subst�ncias fora ou dentro da c�lula, transportando-
as atrav�s da membrana e soltando-as do lado oposto. Al�m disso, determinadas
prote�nas presentes na membrana plasm�tica atuam no reconhecimento de fatores
f�sicos e qu�micos do meio, estimulando a rea��o celular.
Biomembranas e a permeabilidade celular
A c�lula � um compartimento aquoso mergulhado em ambientes tamb�m aquosos; a
separa��o entre os ambientes intracelular e extracelular � feita pela membrana
plasm�tica.
As c�lulas de nosso corpo, por exemplo, com exce��o daquelas presentes nas camadas
mais externas da pele (que s�o c�lulas mortas), s�o banhadas por l�quidos
provenientes do sangue. Nas plantas a situa��o � semelhante. O tronco de uma
�rvore, por exemplo, � revestido externamente por c�lulas mortas (a casca), mas nas
partes internas as c�lulas vivas est�o em contato com solu��es aquosas provenientes
da seiva absorvida pelas ra�zes.
As c�lulas s�o altamente dependentes de ambientes aquosos porque as biomembranas
somente conseguem manter sua organiza��o molecular em contato direto com a �gua,
como podemos deduzir do modelo de Singer e Nicolson.
A manuten��o da vida depende do cont�nuo interc�mbio de subst�ncias entre o meio
extracelular e o citoplasma atrav�s da membrana plasm�tica. A entrada e a sa�da de
subst�ncias nas c�lulas constituem a permeabilidade celular, tamb�m conhecida como
permeabilidade seletiva.

P�gina 83

Certas subst�ncias atravessam a membrana plasm�tica espontaneamente, sem gasto de


energia pela c�lula, o que se denomina transporte passivo. Outras subst�ncias, no
entanto, precisam ser "bombeadas" para dentro ou para fora da c�lula em processos
que consomem energia e, por isso, classificados como transporte ativo.
Transporte passivo: difus�o e osmose
Difus�o
Mol�culas de �gua, certos tipos de �ons e pequenas mol�culas hidrossol�veis passam
facilmente atrav�s de poros proteicos presentes na membrana celular sem que haja
nenhum gasto de energia pela c�lula. Esse processo espont�neo de passagem,
conhecido como difus�o, depende apenas da diferen�a de concentra��o de mol�culas ou
�ons difus�veis dentro e fora da c�lula.
Na difus�o, o deslocamento de uma subst�ncia ocorre sempre em maior fluxo da regi�o
em que suas mol�culas est�o mais concentradas para a regi�o em que a concentra��o �
menor. Assim, se uma subst�ncia capaz de se difundir est� mais concentrada fora da
c�lula do que dentro, ela tende a entrar em maior quantidade do que sai, e vice-
versa. (Fig. 5.5)

ILUSTRA��ES: CEC�LIA IWASHITA


Figura 5.5 Exemplo de difus�o: (A) ao ser colocada em uma x�cara de caf�, uma gota
de leite cont�m apenas part�culas de leite; (B) logo as part�culas de caf� passam a
invadir a gota de leite, enquanto part�culas de leite invadem o espa�o do caf�; (C)
ap�s algum tempo, n�o h� mais diferen�a entre as concentra��es de leite e de caf�
em nenhum ponto da x�cara. (Elementos fora de propor��o de tamanho entre si; cores-
fantasia.)
Osmose
O citoplasma � uma solu��o aquosa, ou seja, uma solu��o em que o solvente � a �gua.
Mol�culas sol�veis em �gua presentes no citosol e nas bolsas citoplasm�ticas
(glic�dios, prote�nas, sais etc.) s�o os solutos celulares.
Quando uma c�lula � mergulhada em �gua pura, a concentra��o externa desse solvente
� sempre maior que a encontrada no interior da c�lula, onde a �gua divide espa�o
com as mol�culas de soluto. Consequentemente, a �gua tende a se difundir em maior
quantidade para dentro da c�lula, fazendo-a inchar. As mol�culas de �gua s�o
capazes de atravessar a membrana com facilidade, o que n�o ocorre com a maioria dos
solutos.
E se uma c�lula � colocada em um meio concentrado em solutos? A tend�ncia � que
ocorra maior difus�o da �gua para fora da c�lula. Com isso, a c�lula murcha.

P�gina 84

Esse fen�meno, em que h� difus�o de �gua atrav�s de uma membrana semiperme�vel que
separa duas solu��es com diferentes concentra��es em solutos, � denominado osmose.
Membrana semiperme�vel � aquela que deixa passar apenas (ou predominantemente) as
mol�culas de solvente, mas n�o as de soluto.
Na terminologia qu�mica, quando se comparam duas solu��es quanto � concentra��o em
solutos, diz-se que a mais concentrada � hipert�nica (do grego hyper, superior) em
rela��o � outra; e esta � hipot�nica (do grego hypo, inferior) em rela��o �
primeira. Duas solu��es com concentra��es equivalentes em solutos s�o chamadas
isot�nicas (do grego iso, igual, semelhante). (Fig. 5.6)

ILUSTRA��ES: JURANDIR RIBEIRO


Figura 5.6 Comportamento de uma c�lula animal (em cima) e de uma c�lula vegetal
(embaixo) em solu��es de diferentes concentra��es. Em solu��o isot�nica (coluna
central), n�o ocorre altera��o de volume. Em solu��o hipert�nica (coluna da
direita), as c�lulas perdem �gua e murcham. Em c�lulas vegetais, o processo pode
levar ao descolamento da membrana plasm�tica, o que � chamado de plasm�lise. Em
solu��o hipot�nica (coluna da esquerda), as c�lulas absorvem �gua e incham, podendo
se romper se n�o houver a prote��o da parede celular. (Elementos fora de propor��o
de tamanho entre si; cores-fantasia.)
Transporte ativo
C�lulas humanas e de diversos organismos mant�m diferentes concentra��es internas
de �ons e de outras subst�ncias em rela��o ao meio extracelular. O �on de pot�ssio
(K+), por exemplo, mant�m-se em alta concentra��o dentro de nossas c�lulas,
enquanto a concentra��o intracelular do �on de s�dio (Na+) mant�m-se bem inferior
em rela��o ao meio extracelular.
A manuten��o de diferen�as i�nicas entre a c�lula e o meio externo gera um
potencial el�trico nas membranas celulares. � gra�as a esse potencial, por exemplo,
que as c�lulas nervosas conseguem transmitir os impulsos nervosos.
De que maneira as c�lulas conseguem manter diferenciadas as concentra��es i�nicas
em seu interior, se a tend�ncia da difus�o � igualar concentra��es de subst�ncias
difus�veis dentro e fora da c�lula? Isso se deve a mecanismos ativos de transporte
realizado por prote�nas da membrana plasm�tica, denominados genericamente bombas
i�nicas.
Uma bomba i�nica bem estudada � a que transporta �ons de Na+ e de K+, sendo, por
isso, chamada bomba de s�dio-pot�ssio. Nesse processo, prote�nas transportadoras
presentes na membrana plasm�tica capturam �ons de Na+ no citoplasma, transportando-
os para fora da c�lula. Na face externa da membrana, as prote�nas transportadoras
capturam �ons de K+ do meio extracelular, transportando-os para o citoplasma, e
assim sucessivamente, de forma ininterrupta, compensando a difus�o espont�nea
desses �ons e mantendo suas concentra��es diferenciadas dentro e fora da c�lula.
(Fig. 5.7)
P�gina 85

ILUSTRA��O: ADILSON SECCO


Figura 5.7 Representa��o esquem�tica do funcionamento da bomba de s�dio-pot�ssio,
um processo de transporte ativo. Um complexo proteico incrustado na membrana
plasm�tica transporta, em cada ciclo de atividade, tr�s �ons de s�dio (Na+) para
fora da c�lula e dois �ons de pot�ssio (K+) para o citoplasma. A energia para o
processo prov�m das mol�culas altamente energ�ticas do ATP, que transferem um
fosfato energ�tico (P) para o complexo proteico. (Elementos fora de propor��o de
tamanho entre si; cores-fantasia.) (Elaborada com base em Campbell, N. e cols.,
1999.)
Transporte em bolsas membranosas
Certas part�culas e subst�ncias podem entrar ou sair da c�lula por meio de bolsas
membranosas. Quando esse transporte ocorre para dentro da c�lula, fala-se em
endocitose (do grego endos, dentro, e kytos, c�lula); quando bolsas membranosas
citoplasm�ticas se fundem � membrana plasm�tica e eliminam seu conte�do para fora
da c�lula, fala-se em exocitose (do grego exos, fora, e kytos, c�lula).
Endocitose: pinocitose e fagocitose
Um dos tipos de endocitose � a pinocitose (do grego pinein, beber, e kytos,
c�lula), processo realizado por praticamente todos os tipos de c�lula e que permite
capturar l�quidos e pequenas part�culas do meio externo. � pela pinocitose, por
exemplo, que as c�lulas do revestimento interno do intestino capturam got�culas de
lip�dios do alimento digerido.
No processo de pinocitose, a membrana plasm�tica aprofunda-se no citoplasma e forma
um canal que se estrangula nas bordas, liberando pequenas bolsas membranosas para o
interior da c�lula. Essas bolsas membranosas que cont�m o material englobado por
pinocitose s�o os pinossomos (do grego pinein, beber, e soma, corpo).

P�gina 86

Outra forma de endocitose � a fagocitose (do grego phagein, comer, e kytos,


c�lula). Nesse processo, a c�lula emite expans�es citoplasm�ticas denominadas
pseud�podes, que envolvem part�culas do meio externo e as englobam totalmente em
uma bolsa membranosa. Essa bolsa se desprende da membrana e passa a circular
livremente no citoplasma, recebendo o nome de fagossomo (do grego phagein, comer, e
soma, corpo), termo que literalmente significa "corpo comido". Os protozo�rios,
organismos unicelulares, utilizam o processo de fagocitose em sua alimenta��o.
(Fig. 5.8)

ILUSTRA��ES: JURANDIR RIBEIRO


Figura 5.8 Representa��o esquem�tica de cortes na borda de uma c�lula, mostrando a
fagocitose e a pinocitose. As principais diferen�as entre os dois processos s�o o
modo de captura e o tamanho das part�culas capturadas. (Elementos fora de propor��o
de tamanho entre si; cores-fantasia.)
Em animais pluricelulares, certas c�lulas realizam fagocitose para combater a
invas�o do corpo por microrganismos. Por exemplo, quando bact�rias conseguem
penetrar em nosso corpo, as primeiras linhas de defesa s�o certas c�lulas do sangue
- os macr�fagos e os neutr�filos - capazes de se "espremer" entre as c�lulas da
parede dos capilares sangu�neos e sair da corrente sangu�nea, em um processo
chamado diapedese. Essas c�lulas se deslocam por meio de movimentos ameboides at� o
local da infec��o, onde passam a fagocitar ativamente os invasores, digerindo-os em
seu citoplasma, no interior de bolsas membranosas chamadas de vac�olos digestivos.
(Fig. 5.9)

ILUSTRA��O: CEC�LIA IWASHITA


Figura 5.9 Representa��o esquem�tica do papel da fagocitose na prote��o corporal.
Quando h� uma infec��o bacteriana em nosso corpo, certos tipos de c�lulas do sangue
saem dos capilares sangu�neos (diapedese) e se deslocam at� o local infectado, onde
fagocitam ativamente os agentes invasores. (Elementos fora de propor��o de tamanho
entre si; cores-fantasia.)
Exocitose
Certas subst�ncias citoplasm�ticas permanecem temporariamente armazenadas em bolsas
membranosas antes de serem eliminadas para o meio externo. Em determinado momento,
as bolsas aproximam-se da membrana plasm�tica e fundem-se a ela, eliminando seu
conte�do para fora da c�lula. Esse processo � denominado exocitose.
A exocitose � utilizada por certos tipos de c�lulas para eliminar restos da
digest�o intracelular. � tamb�m por esse processo que as c�lulas glandulares
secretam seus produtos.

P�gina 87

5.3 Ret�culo endoplasm�tico


Nas primeiras observa��es ao microsc�pio fot�nico, a c�lula parecia ser preenchida
por um fluido aparentemente homog�neo e viscoso, contido pela membrana plasm�tica.
� medida que a Citologia foi se desenvolvendo, os cientistas descobriram, no
interior das c�lulas, o n�cleo e as regi�es citoplasm�ticas diferenciadas.
Os citologistas notaram, por exemplo, que algumas regi�es citoplasm�ticas coravam-
se intensamente quando tratadas com certas subst�ncias, revelando que elas eram
diferentes do restante do citoplasma. Como essas regi�es eram particularmente
abundantes em c�lulas de gl�ndulas, os cientistas imaginaram que ali seria o local
de produ��o das secre��es.
A microscopia eletr�nica mostrou que certas estruturas identificadas no microsc�pio
fot�nico por suas afinidades por determinados corantes eram parte de um
desenvolvido sistema: o ret�culo endoplasm�tico.
O ret�culo endoplasm�tico, presente em todos os tipos de c�lulas eucari�ticas, �
uma rede membranosa de bolsas achatadas e de canais tubulares interligados,
cercados pelo citosol, a solu��o aquosa que preenche o citoplasma. Nas cavidades
internas do ret�culo, circulam diversos tipos de mol�culas.
H� dois tipos de ret�culo, um deles constitu�do por canais de membranas "lisas" - o
ret�culo endoplasm�tico n�o granuloso ou liso - e outro em que a face da membrana
voltada para o citosol tem aderidos gr�nulos chamados ribossomos, sendo, por isso,
denominado ret�culo endoplasm�tico granuloso ou rugoso. O grau de desenvolvimento
de cada tipo de ret�culo varia de acordo com as fun��es desempenhadas pela c�lula.
O ret�culo endoplasm�tico liso � respons�vel pela s�ntese de �cidos graxos, de
fosfolip�dios e de esteroides. A maioria das c�lulas apresenta pouco ret�culo
endoplasm�tico liso; entretanto, esse tipo de ret�culo � abundante nas c�lulas do
f�gado que atuam sobre toxinas, �lcool e outras drogas, inativando-as e facilitando
sua elimina��o.
O ret�culo endoplasm�tico rugoso tem por fun��o principal a s�ntese de prote�nas,
que ocorre nos ribossomos aderidos � sua superf�cie externa. (Fig. 5.10)

EDILSON BILAS

CORTESIA DO PROF. ALBERTO RIBEIRO/IBUSP


Figura 5.10 A. Representa��o tridimensional do ret�culo endoplasm�tico granuloso e
do ret�culo endoplasm�tico n�o granuloso. (Elementos fora de propor��o de tamanho
entre si; cores-fantasia.) B. Fotomicrografia de corte de c�lula animal mostrando
ret�culo endoplasm�tico granuloso (REG) e mitoc�ndrias (M). (Microsc�pio eletr�nico
de transmiss�o; aumento ? 51.000�.)
Ribossomos s�o gr�nulos constitu�dos por mol�culas de RNA associadas a prote�nas.
Os ribossomos medem cerca de 30 nm de di�metro. Em uma c�lula imagin�ria que fosse
ampliada 100 mil vezes, at� o tamanho de um quarto de 3 m � 3 m � 3 m, um ribossomo
teria a dimens�o de um gr�o de pimenta-do-reino.

P�gina 88

A s�ntese de qualquer prote�na na c�lula inicia-se em ribossomos livres no citosol.


Dependendo do tipo de prote�na produzida, o ribossomo adere ou n�o � membrana do
ret�culo endoplasm�tico. Ribossomos aderidos �s membranas produzem prote�nas para o
interior das bolsas do ret�culo endoplasm�tico; essas prote�nas s�o utilizadas na
constitui��o das membranas celulares ou exportadas da c�lula na forma de secre��es.
Ribossomos que permanecem livres no citosol produzem prote�nas utilizadas no
interior da pr�pria c�lula.
5.4 Complexo golgiense
Por volta de 1898, ao tratar cortes histol�gicos de tecido nervoso com corantes �
base de sais de prata ou de �smio, o m�dico italiano Camillo Golgi (1843-1926)
notou que a colora��o se concentrava em �reas celulares bem definidas e sugeriu a
exist�ncia de uma estrutura subjacente no citoplasma. Mais tarde, a microscopia
eletr�nica comprovou a presen�a da estrutura celular sugerida por Golgi, que passou
a ser chamada de aparelho de Golgi ou complexo de Golgi.
O complexo de Golgi, atualmente denominado complexo golgiense, � geralmente
constitu�do por 6 a 20 bolsas membranosas achatadas e empilhadas. No interior
dessas bolsas, prote�nas provenientes do ret�culo endoplasm�tico granuloso s�o
modificadas, selecionadas e "empacotadas" em bolsas membranosas. O destino dessas
bolsas pode ser o pr�prio citoplasma, quando elas cont�m prote�nas da membrana ou
enzimas para a digest�o intracelular, ou o meio externo, se a ves�cula contiver
prote�nas a serem secretadas. (Fig. 5.11)

EDILSON BILAS
Figura 5.11 Representa��o esquem�tica da estrutura do complexo golgiense
parcialmente cortado para mostrar sua organiza��o. Note a face cis, pela qual
prote�nas provenientes do ret�culo endoplasm�tico (RE) penetram no complexo
golgiense, e a face trans, pela qual as prote�nas modificadas e "empacotadas"
deixam o complexo. A ilustra��o mostra um instante congelado do processo; ves�culas
s�o continuamente liberadas pelo ret�culo e se fundem � face cis do complexo; as
bolsas do complexo golgiense, por sua vez, liberam continuamente mais ves�culas.
(Elementos fora de propor��o de tamanho entre si; cores-fantasia.) (Elaborada com
base em Lodish, H. e cols., 2005.)
Muitas das subst�ncias que passam pelo complexo golgiense saem da c�lula e atuam em
diferentes locais do organismo. � o que ocorre, por exemplo, com enzimas produzidas
e eliminadas pelas c�lulas do p�ncreas e que atuam na digest�o. Subst�ncias de
natureza proteica, como certos horm�nios e muco, tamb�m s�o "empacotadas" e
"despachadas" para o meio extracelular pelo complexo golgiense. Nessa fun��o, o
complexo golgiense elimina subst�ncias celulares �teis ao organismo, processo
denominado secre��o celular. (Fig. 5.12)

P�gina 89

PAULO MANZI
Figura 5.12 Representa��o esquem�tica da localiza��o e da estrutura de uma c�lula
secretora de enzimas digestivas do p�ncreas (c�lula acinosa). O p�ncreas cont�m
in�meras bolsas, denominadas �cinos pancre�ticos, cujas paredes s�o constitu�das
por c�lulas acinosas. (Elementos fora de propor��o de tamanho entre si; cores-
fantasia.)
O complexo golgiense tamb�m desempenha papel importante na forma��o dos
espermatozoides, dando origem ao acrossomo (do grego acros, topo, e somatos,
corpo), uma grande bolsa repleta de enzimas digestivas que ocupa o topo da cabe�a
do gameta masculino. As enzimas across�micas t�m por fun��o perfurar as membranas
que envolvem o gameta feminino, permitindo a penetra��o do espermatozoide no
momento da fecunda��o. (Fig. 5.13)

CAN�ADO
Figura 5.13 Representa��o esquem�tica da diferencia��o de um espermatozoide. �
medida que a esperm�tide se transforma em espermatozoide, as enzimas se acumulam
nas bolsas do complexo golgiense; estas se fundem e originam a ves�cula
across�mica, localizada na extremidade da cabe�a do gameta masculino. (Elementos
fora de propor��o de tamanho entre si; cores-fantasia.)
5.5 Lisossomos e digest�o intracelular
Al�m do "empacotamento" e da "remessa" corretos das secre��es celulares, outra
importante fun��o do complexo golgiense � a produ��o de lisossomos (do grego lise,
quebra, e somatos, corpo), bolsas membranosas intracelulares que cont�m enzimas
capazes de digerir grande variedade de subst�ncias org�nicas. As enzimas
lisoss�micas s�o sintetizadas no ret�culo endoplasm�tico granuloso, do qual migram
para o complexo golgiense. Neste, s�o "empacotadas" em bolsas membranosas, que s�o
liberadas para o citosol e passam a constituir os lisossomos prim�rios. Uma c�lula
animal pode conter dezenas ou centenas dessas organelas.
A fun��o dos lisossomos � promover a digest�o intracelular. A atividade lisoss�mica
� significativa em c�lulas que capturam part�culas ou subst�ncias do meio externo
por fagocitose ou pinocitose. Esse � o caso de protozo�rios como a ameba, que
capturam alimentos e os digerem dentro de grandes bolsas membranosas, compar�veis a
pequenos "est�magos" intracelulares.

P�gina 90

Outras c�lulas em que h� grande atividade lisoss�mica s�o os macr�fagos e certos


tipos de gl�bulo branco do sangue, que capturam bact�rias e outros agentes
invasores de nosso corpo, defendendo-o de infec��es.
As bolsas membranosas com o material ingerido, sejam fagossomos ou pinossomos,
fundem-se a lisossomos e originam bolsas maiores, em cujo interior ocorre a
digest�o intracelular. Essas bolsas s�o os vac�olos digestivos, tamb�m chamados
lisossomos secund�rios.
Subst�ncias �teis originadas da digest�o atravessam a membrana do vac�olo e passam
para o citosol, no qual podem ser utilizadas como fonte de energia ou como mat�ria-
prima para a produ��o de novos componentes celulares. Restos n�o aproveit�veis
permanecem no vac�olo digestivo, que passa a ser chamado de vac�olo residual. Ao se
fundir com a membrana plasm�tica, o vac�olo residual elimina os res�duos para o
meio extracelular, processo denominado clasmocitose ou defeca��o celular.
A atua��o dos lisossomos na digest�o de part�culas e subst�ncias vindas de fora da
c�lula � denominada fun��o heterof�gica (do grego, hetero, diferente, e fagos,
comer) dos lisossomos. (Fig. 5.14)

EDILSON BILAS

CORTESIA DO PROF. ALBERTO RIBEIRO/IBUSP


Figura 5.14 A. Representa��o esquem�tica das fun��es heterof�gica e autof�gica dos
lisossomos. (Elementos fora de propor��o de tamanho entre si; cores-fantasia.)
(Elaborada com base em Campbell, N. e cols., 1999.) B. Fotomicrografia de um corte
de c�lula animal em que se veem lisossomos secund�rios (Li), alguns deles digerindo
partes da pr�pria c�lula. (Microsc�pio eletr�nico de transmiss�o; aumento ?
10.500�.)
Os lisossomos tamb�m atuam na digest�o de partes da pr�pria c�lula em que se
encontram, o que � denominado fun��o autof�gica (do grego autos, pr�prio, e fagos,
comer). Por exemplo, quando um organismo � privado de alimento e suas reservas se
esgotam, as c�lulas podem realizar autofagia e digerir partes de si mesmas como
estrat�gia de sobreviv�ncia.
A estrutura celular que vai ser digerida � inicialmente cercada por membranas do
ret�culo endoplasm�tico, que formam em torno dela uma bolsa membranosa, o
autofagossomo. Este se funde a um ou mais lisossomos, originando um vac�olo
autof�gico. Este, como o vac�olo heterof�gico, tamb�m � um lisossomo secund�rio,
pois em seu interior ocorre a digest�o.
C�lulas eucari�ticas utilizam normalmente a autofagia para eliminar partes
desgastadas e reaproveitar alguns de seus componentes. C�lulas nervosas do c�rebro,
por exemplo, que se formam na fase embrion�ria e podem durar por toda a nossa vida,
t�m todos os seus componentes (exceto os genes) digeridos e reciclados a cada m�s.
Nesse contexto, a autofagia � um processo que permite �s c�lulas manter sua
"juventude".

P�gina 91

Ci�ncia e cidadania
Os pequenos lisossomos e seus grandes efeitos
1 O estudo aprofundado das c�lulas tem permitido entender os intrincados caminhos
que levam a determinadas doen�as humanas, possibilitando eventualmente sua cura,
tratamento e preven��o. Voc� sabia, por exemplo, que j� se conhecem mais de 25
doen�as resultantes de dist�rbios digestivos das c�lulas?
Doen�a de Tay-Sachs
2 A doen�a de Tay-Sachs (DTS) resulta de um defeito na enzima que atua em uma das
etapas da digest�o intracelular de um ganglios�dio, subst�ncia normalmente presente
nas membranas das c�lulas nervosas, mas que precisa ser continuamente reciclada por
meio da digest�o dos lisossomos. As aut�psias mostram que as c�lulas nervosas dos
doentes est�o aumentadas devido ao incha�o dos lisossomos, que ficam repletos de
ganglios�dios n�o digeridos. Os sintomas da DTS come�am a se manifestar no primeiro
ano de vida; por volta dos dois anos, a crian�a j� apresenta sinais de dem�ncia e
geralmente morre antes de completar tr�s anos de idade.
Silicose e asbestose
3 Duas outras doen�as relacionadas aos lisossomos s�o a silicose e a asbestose, que
afetam os pulm�es.
4 A silicose � comum em pessoas constantemente expostas a p� de s�lica, como os
trabalhadores de marmorarias e os ceramistas, entre outros. Os min�sculos cristais
dessa subst�ncia ficam em suspens�o no ar inalado e atingem os pulm�es, nos quais
s�o ingeridos por fagocitose pelos macr�fagos, c�lulas de defesa que "patrulham" os
alv�olos pulmonares. As part�culas de s�lica acumulam-se nos lisossomos dos
macr�fagos e acabam por perfur�-los, levando ao derrame de enzimas ativas e a
preju�zos �s c�lulas pulmonares.
5 A asbestose � uma doen�a relacionada � inala��o prolongada de poeira com alta
concentra��o de fibras de amianto. � semelhan�a do que ocorre com a s�lica, o
amianto inalado acumula-se nos lisossomos de c�lulas pulmonares e altera seu
funcionamento.
6 O amianto, ou asbesto, pertence ao grupo dos silicatos cristalinos hidratados.
Ambas as denomina��es referem-se ao fato de esse material ser incombust�vel, o que
difundiu seu emprego na produ��o de materiais antichamas. Al�m da
incombustibilidade, a estrutura fibrosa do amianto possui alta resist�ncia
mec�nica, durabilidade e flexibilidade. Por isso, esse material � empregado na
ind�stria, principalmente para a fabrica��o de telhas e caixas-d'�gua, de autope�as
de ve�culos, entre outras aplica��es. O amianto j� foi largamente utilizado como
isolante t�rmico e prote��o antichama nas d�cadas de 1940 e 1950.
7 O uso do amianto vem sendo proibido em v�rios pa�ses; embora ainda utilizado em
alguns estados brasileiros, sua proibi��o no Brasil todo � quest�o de tempo. De
acordo com dados da Organiza��o Mundial da Sa�de (OMS), um ter�o dos c�nceres
ocupacionais - ou seja, aqueles originados por agentes carcinog�nicos presentes no
ambiente de trabalho - � causado pela inala��o de fibras de amianto1.

STEVE ALLEN/SCIENCE PHOTO LIBRARY/LATINSTOCK


SIMON BELCHER/ALAMY/GLOW IMAGES
� esquerda, radiografia da caixa tor�cica de uma pessoa cujos pulm�es est�o
fibrosados em decorr�ncia da asbestose. � direita, radiografia mostrando pulm�es
sadios.
1 Mais informa��es em:
<http://www2.stf.jus.br/portalStfInternacional/cms/destaquesNewsletter.php?
sigla=newsletterPortalInternacionalDestaques&idConteudo=217549>. Acesso em: maio
2016.

P�gina 92
8 Embora para muitas pessoas essas precau��es pare�am exageradas, autoridades da
�rea da sa�de sugerem aos que t�m um telhado de amianto que procurem instalar um
forro ou alguma prote��o para evitar o contato com o farelo das telhas, que se
desprende principalmente com a umidade e o bolor. Recomendam-se tamb�m cuidados com
a caixa-d'�gua, evitando o uso de escova de a�o na limpeza e principalmente
produtos agressivos, como a �gua sanit�ria. O ideal, com o tempo, � substitu�-la.
Encefalopatias espongiformes transmiss�veis
9 Os lisossomos est�o implicados em uma s�rie de doen�as conhecidas como
encefalopatias espongiformes transmiss�veis ou TSE (do ingl�s, transmissible
spongiform encephalopathies). A mais conhecida delas � a doen�a da vaca louca ou
BSE (do ingl�s, bovinespongiform encephalopathy); sua correspondente humana � a
nova variante da doen�a de Creutzfeldt-Jakob, mais conhecida pela sigla nvCJD.
10 Essas doen�as caracterizam-se por uma degenera��o lenta do sistema nervoso
central decorrente do ac�mulo de uma prote�na fibrosa infectante conhecida como
pr�on, geralmente adquirida pela ingest�o de carne contaminada. O aspecto esponjoso
do c�rebro dos doentes deve-se ao ac�mulo de fibras dessa prote�na.
11 Os surtos da doen�a da vaca louca no gado bovino da Inglaterra e de alguns
outros pa�ses, nas d�cadas de 1980 e 1990, foram provavelmente causados pela
pr�tica de enriquecer a ra��o dos rebanhos com prote�na animal derivada de
carca�as. Animais eventualmente contaminados por pr�ons tiveram suas carca�as
reduzidas a p� e serviram de alimento a animais sadios, contaminando-os. Casos de
nvCJD, principalmente em pessoas na Inglaterra, foram relacionados � ingest�o de
carne proveniente de animais infectados por pr�ons. O Brasil est� aparentemente
livre da doen�a porque em nossa pecu�ria o gado � alimentado quase exclusivamente
com produtos de origem vegetal.
12 O kuru � uma doen�a neurol�gica causada por pr�on, end�mica entre nativos da
Nova Guin� e cuja transmiss�o est� ligada a rituais de canibalismo. Nessas
popula��es, costuma-se macerar o c�rebro do cad�ver e utiliz�-lo no preparo de uma
sopa, ingerida pelos familiares do morto. Se este era portador da encefalopatia
transmiss�vel, os familiares correm o risco de contrair a doen�a. Como os sintomas
levam anos para se manifestar, foi dif�cil estabelecer a rela��o entre os rituais e
a aquisi��o da enfermidade.
13 Sup�e-se que, quando uma pessoa ou um animal ingerem carne contaminada por
pr�ons, estes n�o s�o digeridos e penetram intactos na circula��o sangu�nea. Pelo
sangue, os pr�ons chegam aos nervos e aos corpos celulares dos neur�nios, nos quais
come�am a fazer com que prote�nas normais similares a eles se transformem em novos
pr�ons. Estes, sendo resistentes � digest�o, acumulam-se nos lisossomos e acabam
por causar a morte das c�lulas nervosas. A lenta destrui��o dos neur�nios afeta o
funcionamento do sistema nervoso, levando ao aparecimento dos sintomas t�picos da
doen�a: perda gradativa da mem�ria recente e de orienta��o espacial, incontin�ncia
urin�ria e dem�ncia.
Guia de leitura
Responda em seu caderno
1 Leia o primeiro par�grafo do quadro. Como voc� responderia a algu�m que n�o
considere importante conhecer os dist�rbios digestivos das c�lulas?
2 O segundo par�grafo apresenta a doen�a de Tay-Sachs. Qual � a rela��o dessa
doen�a com os lisossomos?
3 Leia os par�grafos 3, 4 e 5 do quadro, que descrevem duas outras doen�as: a
silicose e a asbestose. Qual � a rela��o de cada uma delas com os lisossomos?
4 Nos par�grafos 6, 7 e 8 fala-se do uso de materiais que cont�m amianto (caixas-
d'�gua, telhas etc.), das recomenda��es para o seu uso e da proibi��o desse produto
em alguns pa�ses. Voc� j� ouviu falar nesse assunto? Pesquise a situa��o do uso do
amianto no Brasil e informe-se sobre os riscos do uso desse material para a sa�de
das pessoas.
5 Com base na leitura do nono e do d�cimo par�grafos do quadro, responda: o que � a
"doen�a da vaca louca"?
6 Leia o par�grafo de n�mero 11, que comenta sobre a dissemina��o da "doen�a da
vaca louca" na Inglaterra. Por que, segundo o texto, o Brasil est� aparentemente
livre da doen�a?
7 No d�cimo segundo par�grafo, � apresentado o kuru, doen�a tamb�m causada por um
pr�on. De acordo com o texto, como se d� a dissemina��o dessa doen�a?
8 No �ltimo par�grafo do quadro (13�), � estabelecida a rela��o entre doen�as
causadas por pr�ons ("doen�a da vaca louca" e kuru) e os lisossomos. Qual � ela?

P�gina 93

5.6 Sustenta��o celular: paredes e citoesqueleto


Parede celular
As c�lulas de bact�rias, fungos, algas, plantas e alguns protozo�rios t�m parede
celular, um envolt�rio externo r�gido ao qual adere internamente a membrana
plasm�tica.
A estrutura e a composi��o qu�mica da parede celular variam muito. Nas c�lulas de
plantas e de algas, por exemplo, a parede � constitu�da basicamente por celulose e,
por isso, � chamada parede celul�sica. A espessura da parede celul�sica das plantas
tamb�m � bastante vari�vel; em c�lulas vegetais jovens, a parede celul�sica � fina
e el�stica, medindo entre 0,1 ?m e 0,2 ?m de espessura. Em c�lulas vegetais
maduras, ela pode ter entre 1 ?m e 10 ?m de espessura.
As mol�culas de celulose organizam-se em feixes resistentes - as microfibrilas -
que se mant�m unidos gra�as a uma matriz formada por glicoprote�nas (prote�nas
ligadas a a��cares) e polissacar�dios (hemicelulose e pectina). Em c�lulas vegetais
jovens, as microfibrilas de celulose da parede formam um arranjo cruzado, que alia
resist�ncia � elasticidade e possibilita o crescimento da c�lula. (Fig. 5.15)

JURANDIR RIBEIRO
Figura 5.15 Representa��o esquem�tica da estrutura molecular da parede celul�sica.
(Elementos fora de propor��o de tamanho entre si; cores-fantasia.) (Elaborada com
base em Alberts, B. e cols., 2004.)
Citoesqueleto
As c�lulas eucari�ticas apresentam um complexo estrutural de t�bulos e filamentos
proteicos mergulhados no citosol: o citoesqueleto. Este desempenha diversas
fun��es: a) define a forma da c�lula e organiza sua estrutura interna; b) permite a
ades�o de uma c�lula �s suas vizinhas e a superf�cies extracelulares; c) promove o
deslocamento de materiais no citoplasma. O citoesqueleto tamb�m participa de
movimentos celulares, da contra��o muscular, da movimenta��o dos cromossomos
durante as divis�es celulares e dos movimentos de c�lios e de flagelos.
Os fin�ssimos t�bulos proteicos do citoesqueleto, chamados microt�bulos, medem
cerca de 25 nm de di�metro e podem atingir at� alguns micr�metros de comprimento.
Suas paredes s�o constitu�das por mol�culas da prote�na tubulina. Em nossa c�lula
imagin�ria aumentada 100 mil vezes, um microt�bulo teria cerca de 2,5 mm de
espessura, compar�vel ao tubo de tinta de uma caneta esferogr�fica, com at� 50 cm
de comprimento.

P�gina 94

Outros componentes do citoesqueleto s�o os microfilamentos de actina, uma prote�na


abundante nos organismos eucari�ticos. Esses filamentos t�m cerca de 7 nm de
espessura e disp�em-se no citoplasma de duas maneiras principais: lado a lado,
formando feixes, ou entrela�ados, formando redes. (Fig. 5.16)

DR. TORSTEN WITTMANN/SCIENCE PHOTO LIBRARY/LATINSTOCK


Figura 5.16 A fotomicrografia mostra o citoesqueleto de dois fibroblastos cujos
componentes foram evidenciados em amarelo (tubulina) e azul (actina), por uma
t�cnica denominada imunofluoresc�ncia; o n�cleo est� evidenciado em verde.
(Microsc�pio fot�nico iluminado com luz ultravioleta; aumento ? 900�; cores
artificiais.)
O citoesqueleto � uma estrutura din�mica. Microt�bulos surgem e se desfazem
continuamente, pela respectiva organiza��o e desorganiza��o das prote�nas que os
comp�em. Os microfilamentos de actina aumentam e diminuem em comprimento e seus
feixes e redes modificam-se sempre. Filamentos da prote�na miosina deslizam sobre
filamentos de actina, levando a c�lula a mudar de forma, a criar pseud�podes e a
expulsar as secre��es, entre outros movimentos.
5.7 Centr�olos, flagelos e c�lios
A maioria das c�lulas eucari�ticas, com exce��o das de fungos e de plantas com
sementes (gimnospermas e angiospermas), apresenta pelo menos um par de centr�olos,
pequenos cilindros ocos, cada qual constitu�do por nove conjuntos de tr�s
microt�bulos unidos por prote�nas adesivas. O par de centr�olos localiza-se na
regi�o celular denominada centrossomo ou centro celular, local para onde convergem
os microt�bulos do citoesqueleto. (Fig. 5.17)

ILUSTRA��ES: ADILSON SECCO


Figura 5.17 Representa��o esquem�tica de um par de centr�olos e detalhe de um
peda�o de microt�bulo, mostrando as mol�culas de tubulina que o constituem.
(Elaborada com base em Lodish, H. e cols., 2005.)
Os centrossomos t�m papel importante no processo de divis�o celular. Como veremos
no pr�ximo cap�tulo, os microt�bulos que convergem para os centrossomos puxam os
cromossomos, separando-os corretamente para as c�lulas-filhas.
Certas c�lulas t�m estruturas filamentosas m�veis que se projetam da superf�cie
celular como pelos microsc�picos. Dependendo do tamanho e do tipo de movimenta��o,
esses filamentos s�o classificados em flagelos ou c�lios.
Os flagelos s�o geralmente mais longos que os c�lios e ocorrem em menor n�mero por
c�lula; o espermatozoide humano, por exemplo, cuja cabe�a mede 5 ?m de comprimento
por 3 ?m de largura, tem um �nico flagelo de aproximadamente 41 ?m de comprimento.
Os gametas de certas plantas possuem dois, quatro ou mais flagelos. Os movimentos
flagelares s�o ondula��es que se propagam da base para a extremidade livre do
filamento.
Os c�lios s�o mais curtos que os flagelos e ocorrem em n�mero relativamente maior
por c�lula, da ordem de dezenas ou centenas. Seus movimentos assemelham-se aos de
um chicote, com frequ�ncia de 10 a 40 batimentos por segundo.
As fun��es de flagelos e c�lios compreendem a movimenta��o da c�lula em meios
l�quidos, como ocorre com gametas e certos protozo�rios, ou a movimenta��o de
l�quidos em rela��o � c�lula, como ocorre com certos protozo�rios e animais, cujos
c�lios criam correntes que trazem part�culas alimentares. Nossa traqueia �
internamente revestida por c�lulas ciliadas, que "varrem" para fora o muco que
lubrifica as vias respirat�rias, livrando-nos assim de bact�rias e part�culas
inaladas com o ar.

P�gina 95

Tanto os flagelos quanto os c�lios originam-se a partir de centr�olos, que migram


para a periferia da c�lula e crescem pelo alongamento de seus microt�bulos. A
membrana plasm�tica acompanha esse crescimento e passa a envolv�-los, como se fosse
uma luva.
A estrutura interna de flagelos e c�lios � id�ntica: eles apresentam nove duplas de
microt�bulos perif�ricos, al�m de um par de microt�bulos centrais. (Fig. 5.18)

DR. GOPAL MURTI/SCIENCE PHOTO LIBRARY/LATINSTOCK


Figura 5.18 Fotomicrografia de c�lio cortado transversalmente. (Microsc�pio
eletr�nico de transmiss�o; aumento ? 170.000�.)
5.8 Mitoc�ndrias e plastos
Mitoc�ndrias: sede da respira��o aer�bica
Com exce��o de um pequeno grupo de protozo�rios, todos os organismos eucari�ticos
apresentam mitoc�ndrias, organelas membranosas em geral com cerca de 2 ?m de
comprimento por 0,5 ?m de di�metro. O n�mero de mitoc�ndrias em uma c�lula varia de
dezenas a centenas, dependendo do tipo de c�lula e do seu grau de atividade.
A mitoc�ndria � delimitada por duas membranas lipoproteicas; a membrana externa �
lisa e semelhante �s demais membranas celulares; a membrana interna apresenta
dobras e pregas, denominadas cristas mitocondriais, que se projetam para o interior
da organela. O espa�o interno da mitoc�ndria � preenchido por um fluido viscoso - a
matriz mitocondrial - que cont�m diversas enzimas, DNA, RNA e ribossomos
semelhantes aos das bact�rias. (Fig. 5.19)

PROFESSORS P. MOTTA & T. NAGURO/ SCIENCE PHOTO LIBRARY//LATINSTOCK


ILUSTRA��O: JURANDIR RIBEIRO
Figura 5.19 Representa��o esquem�tica de uma mitoc�ndria com uma parte removida
para visualizar seus componentes internos. (Elementos fora de propor��o de tamanho
entre si; cores-fantasia.). No detalhe, micrografia de uma mitoc�ndria cortada, em
vermelho, entre tubos e bolsas membranosos do citoplasma, em verde. (Microsc�pio
eletr�nico de transmiss�o; aumento ? 29.000�; cores artificiais.)
Mitoc�ndrias surgem exclusivamente por autoduplica��o de mitoc�ndrias
preexistentes. Quando a c�lula se divide por mitose e origina duas c�lulas-filhas,
cada uma recebe aproximadamente metade das mitoc�ndrias da c�lula-m�e. � medida que
as duas c�lulas crescem, suas mitoc�ndrias se autoduplicam, restabelecendo o n�mero
original.
A complexidade das mitoc�ndrias, sua capacidade de autoduplica��o e a semelhan�a
com certas bact�rias levaram os cientistas a imaginar que essas organelas tenham se
originado de seres procari�ticos primitivos que, no passado, se instalaram no
citoplasma de primitivas c�lulas eucari�ticas. Essa explica��o para a origem das
mitoc�ndrias, v�lida tamb�m para os plastos, � conhecida como hip�tese
endossimbi�tica ou simbiog�nese.

P�gina 96

Um fato interessante sobre as mitoc�ndrias � que, em animais com reprodu��o


sexuada, essas organelas t�m sempre origem materna. Apesar de os gametas masculinos
possu�rem mitoc�ndrias, elas degeneram logo ap�s a fecunda��o, de modo que todas as
mitoc�ndrias do zigoto e, consequentemente, as de todas as c�lulas do novo
indiv�duo descendem das que estavam presentes no gameta feminino.
Cloroplasto: sede da fotoss�ntese
Os cloroplastos est�o presentes apenas em c�lulas de algas e de plantas. Essas
organelas t�m geralmente forma alongada e achatada, com cerca de 4 ?m de
comprimento por 1 a 2 ?m de espessura. Uma �nica c�lula de uma folha pode conter
entre 40 e 50 cloroplastos.
Os cloroplastos das plantas s�o delimitados externamente por duas membranas
lipoproteicas; em seu interior, h� um complexo membranoso formado por bolsas
discoidais achatadas e empilhadas, os tilacoides, no qual se localizam as mol�culas
do pigmento clorofila (do grego chloros, verde). As mol�culas de clorofila disp�em-
se de modo muito bem organizado nas membranas do tilacoide, formando os chamados
complexos de antena, altamente eficientes na capta��o de energia luminosa para a
realiza��o da fotoss�ntese.
A membrana do tilacoide apresenta in�meras dobras, formando tubos e bolsas
achatadas, que geralmente se organizam em conjuntos de pilhas denominados grana
(plural do latim granum, gr�o). As cavidades internas dos grana est�o em
comunica��o direta, constituindo um compartimento �nico, o l�men do tilacoide. O
espa�o entre os tilacoides � preenchido por um fluido denominado estroma: uma
solu��o aquosa que cont�m DNA, RNA e ribossomos semelhantes aos das c�lulas
bacterianas, al�m de v�rios tipos de enzimas. (Fig. 5.20)

ILUSTRA��ES: JURANDIR RIBEIRO


Figura 5.20 Representa��o esquem�tica de um cloroplasto com uma parte removida e
amplia��es sucessivas de sua estrutura interna at� uma mol�cula de clorofila a.
(Elementos fora de propor��o de tamanho entre si; cores-fantasia.)

P�gina 97

ATIVIDADES
Revendo conceitos, fatos e processos
Registre em seu caderno
1. As duas principais subst�ncias org�nicas constituintes das biomembranas s�o
a) glic�dios e �cidos nucleicos.
b) lip�dios e prote�nas.
c) glic�dios (polissacar�dios) e prote�nas.
d) lip�dios e �cidos nucleicos.
Escreva, em seu caderno, o termo abaixo que substitui corretamente a tarja entre
par�nteses das frases de 2 a 5.
a) hipert�nica
b) hipot�nica
c) isot�nica
d) transporte ativo
e) transporte passivo
2. Quando uma subst�ncia passa atrav�s da membrana plasm�tica sem gasto de energia
por parte da c�lula, fala-se em (.....).
3. Processos de passagem de subst�ncias atrav�s da membrana plasm�tica que dependem
da energia celular s�o genericamente chamados (.....).
4. Quando comparamos duas solu��es, dizemos que a menos concentrada em solutos �
(.....) e que a mais concentrada em solutos � (.....).
5. Uma solu��o com a mesma concentra��o em solutos que outra � (.....) em rela��o a
ela.
6. O mecanismo de transporte ativo de �ons de Na+ e de K+ atrav�s da membrana
plasm�tica com gasto de energia � chamado
a) bomba i�nica.
b) difus�o facilitada.
c) fagocitose.
d) osmose.
Escreva, em seu caderno, o termo abaixo que substitui corretamente a tarja entre
par�nteses das frases de 7 a 12.
a) acrossomo
b) complexo golgiense
c) lisossomo
d) ret�culo endoplasm�tico n�o granuloso
e) ret�culo endoplasm�tico granuloso
f) ribossomo
7. O conjunto de bolsas membranosas com gr�nulos aderidos � face voltada para o
citosol, presente nas c�lulas eucari�ticas, � o (.....).
8. O (.....) � uma bolsa membranosa citoplasm�tica que cont�m enzimas capazes de
digerir diversos tipos de subst�ncias org�nicas.
9. O (.....) � constitu�do por um conjunto de bolsas membranosas achatadas e
empilhadas, cuja fun��o � "empacotar" e "despachar" subst�ncias produzidas pela
c�lula.
10. O (.....) � um gr�nulo constitu�do por prote�nas e RNA, cuja fun��o �
sintetizar prote�nas.
11. A bolsa repleta de enzimas digestivas que os espermatozoides apresentam na
"cabe�a" � chamada (.....) e tem origem no (.....).
12. O sistema formado por tubos e bolsas membranosos interligados e sem gr�nulos
aderidos, presente no interior das c�lulas eucari�ticas, � chamado (.....).
13. Durante o fen�meno de osmose, ocorre passagem de �gua preferencialmente da
solu��o menos concentrada em solutos para a solu��o
a) hipert�nica.
b) hipot�nica.
c) isot�nica.
d) osm�tica.
14. C�lulas mergulhadas em solu��o (I) incham; entretanto, c�lulas vegetais n�o
estouram devido � presen�a de (II). Qual alternativa cont�m os termos que
substituem corretamente os n�meros entre par�nteses?
a) (I) = hipot�nica; (II) = parede celul�sica.
b) (I) = hipot�nica; (II) = vac�olo.
c) (I) =hipert�nica; (II) = parede celul�sica.
d) (I) = hipert�nica; (II) = vac�olo.
Associe cada organela citoplasm�tica das alternativas a seguir com a respectiva
fun��o apresentada nos itens 15 a 18.
a) Complexo golgiense.
b) Lisossomo.
c) Ret�culo endoplasm�tico n�o granuloso.
d) Ret�culo endoplasm�tico granuloso.
15. Secre��o celular.
16. Digest�o intracelular.
17. S�ntese de prote�nas.
18. S�ntese de lip�dios.
19. Certas c�lulas presentes no revestimento interno de nossa traqueia produzem e
eliminam, por exocitose, subst�ncias mucosas que lubrificam e protegem a superf�cie
traqueal. Qual organela citoplasm�tica � diretamente respons�vel pelo
"empacotamento" e elimina��o do muco?
a) Acrossomo.
b) Complexo golgiense.
c) Ribossomo.
d) Vac�olo digestivo.
e) Vac�olo residual.

P�gina 98

Quest�es para exercitar o pensamento


Registre em seu caderno
20. Do terceiro par�grafo do item Biomembranas e a permeabilidade celular, consta o
trecho: "As c�lulas s�o altamente dependentes de ambientes aquosos porque as
biomembranas somente conseguem manter sua organiza��o molecular em contato direto
com a �gua, como podemos deduzir do modelo de Singer e Nicolson". Elabore um texto
que explique claramente essa rela��o.
21. Entre as diversas maneiras de verificar a difus�o, mencionamos a seguir uma que
pode ser realizada com materiais simples. Ponha �gua em um recipiente largo de
vidro transparente (uma placa de Petri ou um pirex, desses usados na cozinha) e
mantenha-o sobre uma superf�cie branca, em um local bem iluminado. Espere at� que a
�gua pare de se agitar e, ent�o, pingue uma gota de tinta nanquim preta (ou tinta �
base de l�tex) bem perto da superf�cie da �gua. Observe a difus�o das part�culas de
tinta pelo l�quido. Teste o efeito da temperatura da �gua sobre a velocidade com
que a difus�o ocorre, pingando a tinta em um recipiente com �gua bem gelada e em
outro com �gua quente. Em qual deles voc� espera que a difus�o ocorra mais
rapidamente? Por qu�?
22. Tr�s tubos de vidro t�m, na extremidade inferior, membranas semiperme�veis
(isto �, perme�veis � �gua, mas imperme�veis ao soluto) e foram mergulhados em um
recipiente contendo uma solu��o aquosa de sacarose de concentra��o C = 10 g/L. Os
tubos apresentavam, inicialmente, volumes iguais de solu��es de sacarose de
diferentes concentra��es: C1 = 20 g/L (tubo 1); C2 = 10 g/L (tubo 2); C3 = 5 g/L
(tubo 3). O que se espera que ocorra com o n�vel de l�quido em cada um dos tubos
ap�s algum tempo? Por qu�?

ADILSON SECCO
(Esquema simplificado.)
23. Um pesquisador verificou que a concentra��o de certa subst�ncia dentro da
c�lula era vinte vezes maior do que fora dela. Sabendo que a subst�ncia em quest�o
� capaz de se difundir facilmente atrav�s da membrana plasm�tica, como pode ser
explicado o fato de n�o ser atingido o equil�brio entre as concentra��es interna e
externa?
Fa�a voc� mesmo!
Registre em seu caderno
24. Atividade de laborat�rio: Osmose em ovos de codorna
Uma dificuldade em realizar experimentos sobre osmose � encontrar membranas
semiperme�veis que funcionem adequadamente, isto �, que permitam a passagem de
�gua, mas impe�am a passagem de solutos. Por�m, essa dificuldade t�cnica � superada
com o uso da membrana coquil�fera, encontrada sob a casca dos ovos das aves.
O objetivo desta atividade, que pode ser realizada facilmente no laborat�rio, na
sala de aula ou em casa, � demonstrar o processo de osmose. Como a membrana
coquil�fera � perme�vel a sais, utilizamos uma solu��o de a��car, e n�o uma solu��o
salina, para esta demonstra��o.
Material
- 4 ovos de codorna;
- 1 recipiente m�dio (tigela, prato fundo etc.);
- 2 copos de vidro;
- �gua filtrada;
- vinagre branco (de vinho, de arroz etc.);
- a��car de cana (sacarose);
- etiquetas de papel.
Procedimento
1. Para observar os efeitos da osmose nos ovos, � preciso antes remover a casca
calc�ria. Para isso, vamos dissolver o carbonato de c�lcio da casca usando o �cido
ac�tico presente no vinagre.
Coloque o vinagre no recipiente e mergulhe os ovos de modo a cobri-los
completamente. Deixe-os assim por cerca de 24 horas ou at� a total remo��o da casca
calc�ria. A seguir, lave-os cuidadosamente sob �gua corrente. Durante a rea��o de
dissolu��o, observa-se intenso desprendimento de bolhas de g�s carb�nico pr�ximo �
superf�cie do ovo. Essa rea��o est� esquematizada a seguir.
2 H3C - COOH + CaCO3 ? [Ca2+][H3COO-]2 + H2O + CO2
�cido ac�tico Carbonato Acetato de c�lcio
�gua
G�s
de c�lcio carb�nico

2. Coloque a �gua nos copos at� cerca de metade da capacidade. Em um deles,


dissolva aproximadamente 5 colheres de sopa de a��car, preparando uma solu��o
altamente concentrada. O outro copo ficar� apenas com �gua filtrada. Etiquete os
copos, identificando as solu��es contidas em cada um deles.
3. Coloque 2 ovos com a casca calc�ria removida em cada solu��o. Observe a forma e
a consist�ncia deles a cada 2 horas. Anote os resultados e tente explic�-los com
base em seus conhecimentos sobre osmose.

P�gina 99

4. Em seguida, transfira um dos ovos da solu��o de a��car para o copo de �gua


filtrada, e um dos ovos da �gua filtrada para a solu��o a�ucarada. Observe o
resultado ap�s algum tempo. Explique o que aconteceu com cada um dos ovos.
25. Constru��o de modelos: Modelos tridimensionais de c�lulas
Construa um modelo tridimensional de uma c�lula e suas organelas. Para isso, podem
ser usados massa de modelar, gelatina, gel para cabelo, filmes pl�sticos (para
representar as membranas), macarr�o e dezenas de outros materiais. Amendoins com
casca, por exemplo, representam muito bem as mitoc�ndrias; uma ameixa pode
representar adequadamente o n�cleo celular, em modelos de tamanho compat�vel. Seja
criativo e lembre-se de manter a rela��o de propor��o de tamanho entre os elementos
do seu modelo de c�lula. A confec��o dos modelos pode ser filmada ou suas etapas
podem ser fotografadas. Essas imagens, com um pequeno texto explicativo, podem ser
usadas para compor um v�deo e postadas no blog da escola, por exemplo.
26. Atividade pr�tica: Desenhar como forma de express�o e de aprendizagem
O desenho � uma ferramenta extremamente poderosa de express�o. Em Biologia,
particularmente, desenhos, esquemas e gr�ficos s�o fundamentais � transmiss�o do
conhecimento cient�fico. N�o � preciso ser artista nem ter habilidades especiais
para fazer bons desenhos e esquemas dos componentes das c�lulas vivas. Entretanto,
� preciso praticar bastante para melhorar o desempenho.
Proponha novos cortes e novos �ngulos de observa��o de partes da c�lula. O l�pis �
o instrumento b�sico para os esbo�os iniciais, pois permite corre��es e
aperfei�oamentos. L�pis de cor e canetas coloridas s�o excelentes para o acabamento
dos desenhos e para destacar as diferentes organelas. Organize com seus colegas um
mural com desenhos grandes e detalhados, feitos em folhas de cartolina. Atente para
a escala, que deve estar sempre representada nos desenhos, e tamb�m para as setas e
legendas explicativas.
27. Divulga��o cient�fica: "Clipando" uma not�cia de jornal
Nesta atividade, reproduzimos o artigo Exerc�cios autof�gicos, do Dr. Drauzio
Varella, publicado no jornal Folha de S.Paulo. Nele, o autor comenta um artigo
cient�fico publicado na revista cient�fica Autophagy.
A tarefa � semelhante �quela feita pelo autor: fazer um clipping, isto �, um
"recorte" do artigo de uma revista cient�fica, extraindo dele as informa��es que
interessam para sua pr�pria mat�ria.
Em nosso caso, ela seria publicada no jornal ou no blog da escola.
Veja a seguir nossas sugest�es para a atividade.
- Fa�a uma leitura do texto e numere todos os seus par�grafos.
- Localize os par�grafos 5 e 15, em que se comenta sobre duas organelas celulares
estudadas no cap�tulo: os lisossomos e as mitoc�ndrias. Note que o texto n�o cita
nominalmente os lisossomos, apenas comenta suas fun��es.
- Identifique outros par�grafos ou frases do artigo que julgar interessantes e que
possam ser utilizados como cita��es em seu texto. Al�m do t�tulo, sua mat�ria deve
ter apenas 5 par�grafos de, no m�ximo, 10 linhas cada um. Imagine que seu editor-
chefe tenha lhe pedido para desenvolver o seguinte argumento, relacionando-o aos
assuntos do texto do jornal: O que se aprende na escola pode melhorar nossa
qualidade de vida. Lembre-se de eleger um bom t�tulo para sua mat�ria e de usar o
primeiro par�grafo para motivar o leitor; o �ltimo par�grafo � geralmente reservado
para as conclus�es, de prefer�ncia com algum "impacto", como no artigo do Dr.
Drauzio Varella.
Exerc�cios autof�gicos
A lista dos benef�cios da atividade f�sica est� cada vez mais longa.
Praticar exerc�cios confere for�a muscular, ativa a circula��o do sangue, melhora a
oxigena��o do c�rebro e dos demais tecidos, al�m de combater a obesidade, proteger
contra complica��es cardiovasculares, diabetes, Alzheimer, doen�a de Parkinson e
diversos tipos de c�ncer, como demonstram os estudos populacionais.
Apesar dessas constata��es, explicar os mecanismos por meio dos quais a atividade
f�sica � capaz de aprimorar tal variedade de fun��es org�nicas tem sido dif�cil.
Em dezembro passado, um grupo italiano deu a primeira contribui��o para esclarecer
esse mist�rio. Em publica��o na revista Autophagy, eles demonstraram que o
exerc�cio induz autofagia.
Autofagia � um mecanismo fisiol�gico que acontece no interior das c�lulas, por meio
do qual restos de membranas, organelas e demais estruturas celulares envelhecidas
ou deterioradas s�o englobadas e cortadas em peda�os para que seus componentes
sejam reaproveitados, num processo silencioso de renova��o cont�nua.
Essa reciclagem est� presente em organismos que v�o dos fungos aos mam�feros. Ela �
fundamental para que as c�lulas possam obter a energia necess�ria para exercer suas
fun��es. Quando algum estresse aumenta a demanda de energia, a autofagia aumenta.

P�gina 100

Os pesquisadores italianos mostraram que o estresse causado pelo exerc�cio f�sico


estimula e potencializa a autofagia na musculatura de ratos atletas.
Em janeiro deste ano, Beth Levine, da Universidade do Texas, publicou na revista
Nature uma pesquisa que confirma e aprofunda essa rela��o de causa e efeito: de
fato, a autofagia est� por tr�s dos efeitos ben�ficos da atividade f�sica.
Numa primeira fase, Levine comprovou que camundongos mantidos naquelas rodas, em
que o animal anda sem sair do lugar, apresentavam n�veis mais elevados de autofagia
n�o apenas nos m�sculos, mas em diversos �rg�os.
Na segunda fase, comparou um grupo de camundongos normais com outro formado por
camundongos mutantes que tinham como caracter�stica a total incapacidade de
acelerar a autofagia em resposta ao estresse.
Nos camundongos normais, os m�sculos submetidos a exerc�cios extenuantes consumiram
cerca de 85% da glicose obtida na alimenta��o. Como consequ�ncia, os n�veis de
glicose e de insulina na circula��o diminu�ram.
Nos mutantes, incapazes de responder com aumento da autofagia, o estresse causado
pela mesma atividade f�sica n�o modificou os n�veis sangu�neos de glicose e
insulina. Conclus�o: a resposta da autofagia ao estresse � respons�vel pelos
benef�cios metab�licos imediatos da atividade f�sica.
Para analisar os efeitos tardios, Levine engordou os dois grupos de camundongos at�
desenvolverem diabetes, para depois obrig�-los a fazer exerc�cios di�rios numa
esteira rolante.
Passados dois meses, os ratos normais tinham ficado livres do diabetes e reduzido
os n�veis de colesterol e triglic�rides, enquanto os mutantes continuavam
diab�ticos. Conclus�o: o aumento da autofagia em resposta ao estresse tamb�m �
fundamental para os efeitos a longo prazo da atividade f�sica.
O exerc�cio f�sico regular provoca adapta��es duradouras na musculatura. A
principal delas ocorre nas mitoc�ndrias, organelas celulares que funcionam como
centrais de produ��o de energia e que se desgastam com o passar dos anos. Para
melhorar seu rendimento a fim de cobrir a demanda de energia solicitada pelo
aumento da atividade f�sica, as mitoc�ndrias entram num processo de renova��o que
retarda o envelhecimento.
Essas descobertas ainda n�o esclarecem os detalhes do papel da atividade f�sica na
redu��o dos casos de c�ncer e doen�as neurodegenerativas.
N�o explicam tamb�m porque aqueles que resolvem andar m�seros 40 minutos por dia
depois de receber o diagn�stico e o tratamento convencional de c�ncer de intestino
ou de mama aumentam de 30% a 50% suas chances de cura definitiva.
S�o tantos os benef�cios da atividade f�sica, leitor, que s� existe uma explica��o
para a vida sedent�ria que a maioria leva: praticar exerc�cios vai contra a
natureza humana. Nenhum animal adulto desperdi�a energia.
Voc� j� viu uma on�a no zool�gico dando um pique para perder a barriga?
VARELLA, Drauzio. Folha de S.Paulo, 11 ago. 2012. Dispon�vel em:
<www1.folha.uol.com.br/colunas/drauziovarella/1135203-exercicios-
autofagicos.shtml>. Acesso em: 28 mar. 2016.
A Biologia no vestibular e no Enem
Registre em seu caderno
Quest�es objetivas
1. (UFMS) Hem�cias humanas foram imersas em tr�s tubos de ensaio, denominados A, B
e C, contendo l�quidos diferentes. Foram observados: redu��o de volume das hem�cias
no tubo A; aumento do volume das hem�cias no tubo B; e nenhuma modifica��o de
volume nas hem�cias do tubo C. Determine a alternativa que indica a tonicidade das
solu��es A, B e C, respectivamente.
a) Isot�nica, hipert�nica e hipot�nica.
b) Hipert�nica, hipot�nica e isot�nica.
c) Hipot�nica, hipert�nica e isot�nica.
d) Hipert�nica, isot�nica e hipot�nica.
e) Hipot�nica, isot�nica e hipert�nica.
2. (UFPel-RS)
Aten��o na cozinha: n�o � aconselh�vel temperar, com sal e vinagre, uma salada de
verduras, ou um peda�o de carne, muito tempo antes de consumir. Provavelmente as
folhas da verdura ficar�o murchas, e a carne vai come�ar a liberar muito l�quido.
Baseado no texto e em seus conhecimentos, � correto afirmar que em ambos os casos
ocorrer�
a) a difus�o do solvente do meio hipert�nico para o hipot�nico, por isso a carne e
as verduras perder�o �gua.
b) a lise celular e por isso as c�lulas liberar�o �gua, pois foram submetidas a um
meio hipot�nico.
c) a deplasm�lise, processo em que h� perda de �gua para o ambiente e
consequentemente a diminui��o do volume celular.
d) um processo de osmose, em que as c�lulas perder�o �gua por serem submetidas a um
meio hipert�nico.
e) um processo de transporte ativo, em que as c�lulas secretar�o �gua para ocorrer
a entrada de sal nas pr�prias c�lulas.

P�gina 101

3. (Uerj) Em um experimento realizado em um laborat�rio escolar, duas tiras de


batata foram mergulhadas por 10 minutos, uma na solu��o A e a outra na solu��o B.
Os resultados, ap�s este tempo, est�o resumidos na tabela abaixo.
Solu��oCondi��o da tira de batataAAmolecidaBR�gidaEm rela��o � tonicidade do
citoplasma das c�lulas de batata, as solu��es A e B s�o, respectivamente,
classificadas como
a) hipot�nica e isot�nica.
b) isot�nica e hipert�nica.
c) hipert�nica e hipot�nica.
d) hipot�nica e hipert�nica.
4. (UFC-CE) Suponha que voc� esteja trabalhando com uma suspens�o de c�lulas
animais, a partir da qual voc� deseje isolar uma prote�na. Durante a prepara��o,
v�rios lisossomos sofrem ruptura. Como consequ�ncia disso, ocorreria
a) libera��o de �cidos nucleicos, que dificultariam o isolamento da macromol�cula
que voc� est� tentando obter.
b) libera��o de ATP, que facilitaria o processo de isolamento da macromol�cula de
seu interesse.
c) libera��o de enzimas, que poderiam digerir a macromol�cula que voc� est�
tentando isolar.
d) libera��o de macromol�culas proteicas rec�m-sintetizadas nos lisossomos, o que
aumentaria a quantidade da prote�na a ser obtida.
e) interrup��o da s�ntese de prote�nas enzim�ticas nos lisossomos, diminuindo a
quantidade da prote�na a ser obtida.
5. (Vunesp) No homem, o revestimento interno da traqueia apresenta c�lulas
secretoras de muco que a lubrificam e a umedecem. A informa��o sobre a natureza
secretora dessas c�lulas permite inferir que elas s�o especialmente ricas em
estruturas citoplasm�ticas do tipo
a) mitoc�ndrias e ret�culo endoplasm�tico liso.
b) ret�culo endoplasm�tico granular e aparelho de Golgi.
c) mitoc�ndrias e aparelho de Golgi.
d) lisossomos e aparelho de Golgi.
e) ret�culo endoplasm�tico granular e mitoc�ndrias.
6. (Unifap) Qual das afirmativas a seguir apresenta organelas citoplasm�ticas em
intensa atividade em uma c�lula glandular?
a) Lisossomas e complexo de Golgi.
b) Complexo de Golgi e mitoc�ndrias.
c) Ret�culo endoplasm�tico e mitoc�ndrias.
d) Ret�culo endoplasm�tico e complexo de Golgi.
e) Lisossomas e ret�culo endoplasm�tico.
7. (UFC-CE) C�lulas animais com fun��o secretora apresentam abund�ncia de ret�culo
endoplasm�tico granuloso (rugoso) e complexo golgiense, estruturas que se localizam
pr�ximas uma � outra e que trabalham em conjunto. Nesse trabalho em parceria, o
ret�culo endoplasm�tico granuloso
a) libera prote�nas digestivas em ves�culas denominadas lisossomos, que atuar�o em
conjunto com os tilacoides do complexo golgiense.
b) produz fosfolip�dios de membrana que ser�o processados no complexo golgiense e
liberados no citoplasma para forma��o de novos ribossomos.
c) sintetiza prote�nas e as transfere para o complexo golgiense, que as concentra e
as libera em ves�culas, que ter�o diferentes destinos na c�lula.
d) funde-se ao complexo golgiense para formar o acrossomo dos espermatozoides,
respons�vel pela digest�o da parede do �vulo e pela penetra��o nele.
e) acumula os polissacar�dios de parede celular, produzidos no complexo golgiense,
e os processa, antes de liberar as ves�culas que se fundir�o com a membrana
plasm�tica.
Quest�es discursivas
8. (Unifesp) O esquema representa parte da membrana plasm�tica de uma c�lula
eucari�tica.

OSVALDO SEQUETIN
a) A que correspondem X e Y?
b) Explique, usando o modelo do "mosaico fluido" para a membrana plasm�tica, como
se d� a secre��o de produtos do meio intracelular para o meio extracelular.
9. (UFU-MG) Explique como os lisossomos s�o formados na c�lula e descreva a sua
fun��o, relacionando-a com a fagocitose.

P�gina 102

Cap�tulo 6 N�cleo celular, mitose e s�ntese de prote�nas

JEREMY SUTTON-HIBBERT/ALAMY/GLOW IMAGES


A ovelha Dolly - o clone animal mais famoso do mundo - e o bi�logo Ian Wilmut,
l�der da equipe respons�vel pela clonagem (Esc�cia, 2003).
Clones e a import�ncia do n�cleo celular
Belinda era uma ovelha de 6 anos de idade da ra�a Finnish-Dorset, de cor clara e
uniforme. Em um experimento in�dito, ela foi a doadora do n�cleo de uma c�lula de
sua gl�ndula mam�ria. Fluffy, ovelha da ra�a Scottish Blackface (cara-preta), foi a
doadora de um �vulo cujo n�cleo foi eliminado e substitu�do pelo n�cleo da c�lula
da gl�ndula mam�ria de Belinda. Ap�s um pequeno choque el�trico, o n�cleo
transplantado incorporou-se ao citoplasma do �vulo de Fluffy e iniciou-se o
desenvolvimento embrion�rio. O embri�o assim produzido foi implantado no �tero de
uma terceira ovelha Scottish Blackface - Lassie - e nele se desenvolveu. Em 5 de
julho de 1996 nasceu Dolly, um clone (isto �, uma "c�pia") de Belinda. O nome,
dizem, foi uma duvidosa homenagem a uma exuberante cantora estadunidense, aludindo
ao fato de Dolly ter sido clonada a partir do n�cleo de uma c�lula de gl�ndula
mam�ria.
Esse incr�vel feito cient�fico foi realizado pela equipe liderada pelo bi�logo
escoc�s Ian Wilmut, do Instituto Rosling, na Esc�cia. Como era de esperar, a
experi�ncia suscitou grande pol�mica. Abriam-se as portas para a clonagem humana,
defendida por uns e criticada por outros.
Bastou um �nico n�cleo celular de Belinda, convenientemente instalado no citoplasma
do �vulo de Fluffy, para originar Dolly, uma r�plica de Belinda. A experi�ncia
confirmou o que se esperava: o n�cleo de uma c�lula som�tica cont�m todas as
informa��es necess�rias para originar um organismo completo, no caso, uma ovelha
Finnish-Dorset muito semelhante a Belinda.
Em m�dia, um n�cleo celular mede entre 5 e 15 ?m de di�metro, algo em torno de 0,01
mm. N�o � formid�vel pensar que um �nico n�cleo de uma c�lula qualquer de nosso
corpo, com seu tamanho microsc�pico, possui todas as informa��es necess�rias para
originar um organismo completo? E que os n�cleos de todas as nossas c�lulas t�m
informa��es id�nticas por serem a reprodu��o fiel do n�cleo da c�lula-ovo que nos
originou?

P�gina 103

A import�ncia do assunto
Nossa viagem ao interior das c�lulas chega, neste cap�tulo, a um ponto culminante:
o n�cleo celular. Como vimos no texto anterior, sobre a clonagem da ovelha Dolly, o
n�cleo cont�m todas as informa��es necess�rias para o desenvolvimento e o
metabolismo da c�lula.
Neste cap�tulo voc� aprender� diversos conceitos importantes sobre o n�cleo e seus
principais componentes, os cromossomos, nos quais se localizam os genes, que cont�m
as informa��es b�sicas para cada esp�cie ser o que ela �. Exercite sua imagina��o
para visualizar a transi��o da estrutura nanom�trica do cromossomo, constitu�do por
uma �nica mol�cula de DNA associada a mol�culas de prote�nas, at� o n�vel do
cromossomo condensado, vis�vel ao microsc�pio fot�nico.
O cap�tulo aborda tamb�m a natureza das informa��es gen�ticas e como elas se
multiplicam e se expressam por meio da transcri��o e da tradu��o g�nicas.
O estudo do papel dos cromossomos esclarece algumas das incr�veis adapta��es da
c�lula para se reproduzir e transmitir todos os genes nucleares �s c�lulas-filhas.
Ao conhecer e compreender a mitose, processo pelo qual uma c�lula origina duas
c�lulas id�nticas, podemos entender melhor a continuidade da vida.
6.1 Organiza��o do n�cleo interf�sico
O microscopista pioneiro Antonie van Leeuwenhoek (1632-1723), no s�culo XVII, fez a
ilustra��o de uma c�lula de salm�o com uma estrutura central identificada por
l�men, termo que significa cavidade. Essa � a mais antiga refer�ncia cient�fica ao
n�cleo celular, embora Leeuwenhoek n�o o identificasse como tal. No in�cio do
s�culo XIX, o microscopista e bot�nico austr�aco Franz Bauer (1758-1840) notou a
presen�a do n�cleo em c�lulas vegetais, mas foi apenas em 1831 que o bot�nico
escoc�s Robert Brown (1773-1858) o descreveu com mais detalhes, caracterizando-o
como uma estrutura t�pica das c�lulas.
O n�cleo celular � uma estrutura caracter�stica das c�lulas eucari�ticas; cada
c�lula quase sempre cont�m um n�cleo, cujo tamanho e forma variam, dependendo do
tipo celular. Entretanto, h� c�lulas com dois ou mais n�cleos: protozo�rios
ciliados, por exemplo, apresentam um n�cleo pequeno, o micron�cleo, e outro maior,
o macron�cleo. As fibras musculares estriadas de nosso corpo, resultantes da fus�o
de v�rias c�lulas precursoras, t�m dezenas ou centenas de n�cleos. Ao contr�rio, as
hem�cias (c�lulas vermelhas do sangue) dos mam�feros n�o apresentam n�cleo, pois
ele degenera no decorrer do amadurecimento celular.
Envelope nuclear (carioteca)
O n�cleo � delimitado pelo envelope nuclear ou carioteca, constitu�do por duas
membranas lipoproteicas muito bem ajustadas uma � outra. A face interna da
membrana, voltada para o interior do n�cleo, � refor�ada por uma camada de
filamentos proteicos que constitui a l�mina nuclear. Em diversos pontos do envelope
nuclear, as membranas externa e interna fundem-se em torno de um poro, atrav�s do
qual ocorre troca de subst�ncias entre o n�cleo e o citoplasma.
Os poros do envelope nuclear atuam como v�lvulas, abrindo-se para dar passagem a
determinados materiais e fechando-se em seguida. No poro h� uma estrutura conhecida
como complexo do poro, formada por dezenas de tipos diferentes de prote�nas. O
complexo do poro controla ativamente o tr�nsito de part�culas e de subst�ncias
entre o n�cleo e o citoplasma. (Fig. 6.1)

ILUSTRA��O: EDILSON BILAS


Figura 6.1 Modelo tridimensional, feito com base em estudos ao microsc�pio
eletr�nico, de um poro da carioteca em corte. (Elementos fora de propor��o de
tamanho entre si; cores-fantasia.) (Elaborado com base em Cooper, G., 2000.)

P�gina 104

Cromatina e nucl�olo
Ao tratar c�lulas com certos corantes, os primeiros citologistas descobriram que o
material contido no n�cleo celular tinha capacidade de se corar intensamente,
destacando-se das outras partes da c�lula. Por esse motivo, em meados do s�culo
XIX, passou a ser empregado o termo cromatina (do grego chromatos, cor) para
designar o material altamente cor�vel presente no n�cleo celular. Na �poca, dada a
baixa resolu��o dos microsc�pios, acreditava-se que a cromatina era uma massa de
material amorfo. Mais tarde verificou-se, por�m, que a cromatina era constitu�da
por um material filamentoso, os cromossomos. Em uma c�lula imagin�ria que fosse
ampliada 100 mil vezes, o n�cleo seria equivalente a uma esfera de 1 m de di�metro,
delimitada por uma dupla membrana transparente e porosa. Em seu interior, os
cromossomos seriam compar�veis a muitos metros de barbantes finos, longos e
emaranhados como um novelo.
No interior do n�cleo h� geralmente uma ou mais estruturas globulares densas
denominadas nucl�olos. Um nucl�olo � constitu�do pela aglomera��o de muitos
ribossomos em processo de forma��o e n�o apresenta nenhuma membrana envolvente. A
principal subst�ncia constituinte dos ribossomos e, portanto, dos nucl�olos � o RNA
riboss�mico, produzido em certas regi�es de determinados cromossomos.
O nucl�olo � uma estrutura din�mica. Ao mesmo tempo que o material riboss�mico sai
do n�cleo para o citoplasma, onde constitui os ribossomos, a regi�o cromoss�mica
que forma o nucl�olo produz mais material riboss�mico, que rep�e o que vai para o
citoplasma.
A cromatina se apresenta mais densamente condensada na periferia nuclear e mais
frouxa na regi�o central. Tanto a cromatina quanto os nucl�olos se encontram
mergulhados em uma solu��o aquosa que preenche o n�cleo, o nucleoplasma ou
cariolinfa, na qual circulam �ons e diversas subst�ncias, como mol�culas de ATP,
nucleot�dios e enzimas, apenas para citar as mais importantes. (Fig. 6.2)

PROF. ALBERTO RIBEIRO/IBUSP


Figura 6.2 Fotomicrografia de um corte de c�lula animal, mostrando os principais
constituintes do n�cleo. (Microsc�pio eletr�nico de transmiss�o; aumento ?
11.000�.)
6.2 Caracter�sticas gerais dos cromossomos
Praticamente todas as informa��es para o funcionamento das c�lulas eucari�ticas e,
consequentemente, do organismo est�o inscritas nos cromossomos, estruturas
filamentosas intranucleares constitu�das por uma longa mol�cula de DNA associada a
prote�nas. As informa��es a que nos referimos, codificadas no DNA cromoss�mico, s�o
os genes.
No n�cleo celular, h� geralmente v�rios cromossomos, que diferem quanto aos tipos
de genes que apresentam. O n�mero de cromossomos presentes no n�cleo celular varia
entre as esp�cies. Por exemplo, na esp�cie humana (Homo sapiens), as c�lulas
corporais, denominadas c�lulas som�ticas, t�m 46 cromossomos no n�cleo. As c�lulas
som�ticas do chimpanz� (Pan troglodytes) t�m 48 cromossomos, ao passo que as da
mosca dros�fila (Drosophila melanogaster) t�m 8 cromossomos. Ovelhas da esp�cie
Ovis aries, a que pertencia Dolly, t�m 54 cromossomos em suas c�lulas som�ticas.

P�gina 105

A arquitetura do cromossomo
Nas c�lulas eucari�ticas, o cromossomo � constitu�do por uma longa mol�cula de DNA
que, a espa�os regulares, d� duas voltas sobre um gr�nulo de prote�nas da classe
das histonas. Cada gr�nulo proteico com um segmento de DNA enrolado constitui uma
unidade estrutural - o nucleossomo -, que se repete ao longo do filamento
cromoss�mico.
A associa��o entre nucleossomos vizinhos faz o filamento cromoss�mico enrolar-se
como uma mola helicoidal compacta, originando um fio mais grosso, com cerca de 30
nm de espessura. Esse fio apresenta, ao longo do comprimento, outras prote�nas, que
fornecem sustenta��o esquel�tica ao cromossomo. A espessura do fio cromoss�mico
associado ao esqueleto proteico � da ordem de 300 nm. Quando a c�lula se divide
para originar duas c�lulas-filhas, o cromossomo enrola-se sobre si mesmo, assumindo
um estado ainda mais condensado, com cerca de 700 nm de espessura. (Fig. 6.3)

ILUSTRA��O: ADILSON SECCO


Figura 6.3 Representa��o esquem�tica dos n�veis de organiza��o do cromossomo em
seres eucari�ticos. (Elementos fora de propor��o de tamanho entre si; cores-
fantasia.) (Elaborada com base em Campbell, N. e cols., 1999.)
Crom�tides-irm�s e centr�mero
Uma c�lula que n�o est� se dividindo encontra-se no per�odo denominado interfase. �
nesse est�gio que ocorrem os preparativos para uma futura divis�o celular. Um dos
principais eventos que antecedem a divis�o da c�lula � a duplica��o dos
cromossomos, condi��o necess�ria para sua posterior distribui��o entre as c�lulas-
filhas.
Ao se duplicar, cada cromossomo produz outro cromossomo id�ntico; ambos permanecem
juntos, aderidos por prote�nas especiais e fundidos em um ponto denominado
centr�mero. Enquanto ainda est�o unidas, as c�pias de um cromossomo duplicado s�o
denominadas crom�tides-irm�s. A separa��o das crom�tides ocorre em uma fase
espec�fica da divis�o celular, durante a qual o centr�mero se divide.
Durante a divis�o celular, cada crom�tide condensa-se independentemente de sua
irm�, apesar de ambas continuarem unidas. Com a condensa��o, os cromossomos
encurtam e tornam-se mais grossos, assumindo o aspecto de bastonetes duplos. O
centr�mero associa-se a microt�bulos presentes no citoplasma e desempenha papel
fundamental na separa��o das crom�tides-irm�s durante a divis�o celular, como
veremos adiante. (Fig. 6.4A)
Os pesquisadores costumam classificar os cromossomos pela posi��o do centr�mero,
reconhecido pela presen�a de um estrangulamento que divide o cromossomo condensado
em dois "bra�os".

P�gina 106

POWER AND SYRED/SCIENCE PHOTO LIBRARY/LATINSTOCK

ILUSTRA��O: OSVALDO SEQUETIN


Figura 6.4 A. Fotomicrografia de cromossomos humanos condensados. (Microsc�pio
eletr�nico de varredura; aumento ? 4.500�; cores artificiais.) B. Tipos de
cromossomo de acordo com a posi��o do centr�mero. (Elementos fora de propor��o de
tamanho entre si; cores-fantasia.)
De acordo com esse crit�rio, os cromossomos s�o classificados em quatro tipos: a)
metac�ntrico, em que o centr�mero divide o cromossomo em dois bra�os
aproximadamente de mesmo tamanho; b) submetac�ntrico, em que o centr�mero �
deslocado da regi�o mediana, definindo dois bra�os de tamanho um tanto desigual; c)
acroc�ntrico, em que o centr�mero se localiza perto de uma das extremidades,
definindo um bra�o bem maior que o outro; e d) teloc�ntrico, em que o centr�mero se
localiza na extremidade do cromossomo, que tem apenas um bra�o. (Fig. 6.4B)
As extremidades de um cromossomo apresentam organiza��o peculiar e s�o denominadas
tel�meros. Para produzir as extremidades da mol�cula de DNA do tel�mero �
necess�ria uma enzima especial, a telomerase.
Cromossomos e genes
Em uma defini��o simplificada, trechos da mol�cula de DNA que cont�m informa��es
para a produ��o de prote�nas podem constituir genes. O conjunto total de mol�culas
de DNA de uma esp�cie, incluindo tanto os genes quanto trechos de DNA n�o
codificante, constitui o genoma.
Cromossomos hom�logos
Na esp�cie humana, h� 24 cromossomos diferentes: 22 deles s�o denominados
autossomos e identificados por n�meros de 1 a 22; os outros dois tipos, chamados de
cromossomos sexuais, s�o identificados pelas letras X e Y. Autossomos s�o os tipos
de cromossomos presentes em c�lulas de ambos os sexos. Cromossomos sexuais s�o os
que variam entre os sexos e diferenciam c�lulas masculinas das femininas.
Cada c�lula do corpo de uma pessoa, com exce��o dos gametas, apresenta um par de
cada tipo de autossomo e um par de cromossomos sexuais. Nas c�lulas femininas, o
par sexual � composto por dois cromossomos denominados X; nas c�lulas masculinas,
est�o presentes um cromossomo X e um cromossomo Y.
Os gametas femininos da esp�cie humana t�m 23 cromossomos, sendo 22 autossomos (um
de cada par) e um cromossomo X. Os espermatozoides humanos tamb�m t�m 23
cromossomos, sendo 22 autossomos e um cromossomo sexual, o qual pode ser tanto o
cromossomo X quanto o cromossomo Y. Cerca de metade dos espermatozoides produzidos
por um homem apresenta um cromossomo X e a outra metade apresenta um cromossomo Y.

P�gina 107

Quando um espermatozoide se une a um �vulo no momento da fecunda��o, os conjuntos


cromoss�micos dos gametas juntam-se na primeira c�lula do novo organismo, a qual �
denominada zigoto. Na esp�cie humana, o zigoto tem 23 cromossomos provenientes da
m�e e 23 provenientes do pai.
A determina��o do sexo de um novo indiv�duo ocorre no momento da fecunda��o: se um
espermatozoide portador de um cromossomo X fecundar um �vulo (sempre portador de um
X), o zigoto ser� do sexo feminino (XX); se o espermatozoide apresentar um
cromossomo Y, o zigoto ser� do sexo masculino (XY).
Pouco antes de se dividir, o zigoto duplica os cromossomos provenientes dos
gametas; ao final da primeira divis�o celular, cada c�lula-filha receber� r�plicas
exatas dos 46 cromossomos recebidos dos dois genitores.
Os representantes de cada tipo de cromossomo de uma c�lula originada do zigoto, um
herdado do pai e outro da m�e, s�o chamados cromossomos hom�logos (do grego
homoios, igual, semelhante). (Fig. 6.5)

ILUSTRA��ES: ADILSON SECCO


Figura 6.5 Cada pessoa herda dois conjuntos de 23 cromossomos, um proveniente da
m�e e outro proveniente do pai. (Elementos fora de propor��o de tamanho entre si;
cores-fantasia.)
C�lulas diploides e c�lulas haploides
O zigoto e as c�lulas som�ticas que dele descendem t�m pares de cromossomos
hom�logos e por esse motivo recebem o nome de c�lulas diploides (do grego diplos,
duplo), representadas por 2n. C�lulas que apresentam apenas um lote de cromossomos,
como os gametas humanos, s�o chamadas de c�lulas haploides (do grego haplos,
simples) e representadas por n.
Cromossomos de um par de hom�logos s�o morfologicamente indistingu�veis: t�m o
mesmo tamanho, a mesma forma e genes equivalentes, localizados nas mesmas posi��es
relativas no filamento cromoss�mico. Por exemplo, se em determinado local de um
cromossomo houver um gene com a informa��o para produzir determinada prote�na, em
seu hom�logo, no local correspondente, haver� um gene com uma informa��o id�ntica
ou muito parecida.
Citogen�tica humana
A Citogen�tica humana, ramo da Biologia que estuda os cromossomos humanos, � uma
especialidade relativamente nova. Para se ter ideia, apenas em 1956 ficou
definitivamente demonstrado que tanto homens quanto mulheres t�m 46 cromossomos nas
c�lulas. Atualmente, os cientistas t�m condi��es de identificar pessoas com
problemas cromoss�micos e prever o risco de seus filhos virem a ser afetados por
certas doen�as heredit�rias. Esses procedimentos fazem parte de um ramo da Gen�tica
denominado aconselhamento gen�tico.

P�gina 108

A t�cnica mais empregada para o estudo dos cromossomos humanos baseia-se no cultivo
de linf�citos em tubo de ensaio. O linf�cito � um dos tipos de gl�bulos brancos
presentes em nosso sangue. Linf�citos isolados do sangue s�o colocados em um frasco
com solu��o nutritiva, � qual se adiciona fitoemaglutinina, uma subst�ncia de
origem vegetal que induz os linf�citos a se dividirem.
Depois de alguns dias, junta-se ao frasco de cultivo colchicina, subst�ncia tamb�m
de origem vegetal que bloqueia a divis�o celular no est�gio em que os cromossomos
est�o mais condensados, facilitando sua observa��o. Algumas horas depois da adi��o
de colchicina, acrescenta-se ao frasco de cultivo uma solu��o hipot�nica (relembre
o conceito de osmose no cap�tulo 5), o que faz os linf�citos incharem.
Quando gotas da solu��o contendo linf�citos s�o pingadas a uma certa dist�ncia
sobre l�minas de vidro para microscopia, as c�lulas inchadas arrebentam e liberam
os cromossomos. Estes aderem � l�mina e podem, ent�o, ser corados e examinados ao
microsc�pio fot�nico.
Ao observar a l�mina ao microsc�pio, o pesquisador escolhe um conjunto completo de
cromossomos e o fotografa. Os cromossomos s�o separados na fotografia e organizados
por ordem decrescente de tamanho e de acordo com a posi��o dos centr�meros. Essa
montagem fotogr�fica � chamada de cariograma. (Fig. 6.6)
ILUSTRA��ES: ADILSON SECCO
Figura 6.6 Representa��o esquem�tica da t�cnica de prepara��o de um cariograma
humano. (Elementos fora de propor��o de tamanho entre si; cores-fantasia.)
O cari�tipo humano
O conjunto de cromossomos de uma c�lula constitui seu cari�tipo (do grego karyon,
n�cleo, e typos, forma). Na esp�cie humana, por exemplo, os cari�tipos de homens e
de mulheres diferem quanto ao par de cromossomos sexuais. Como vimos, nas mulheres
esse par � composto por dois cromossomos morfologicamente id�nticos, os cromossomos
X. Nos homens, o par de cromossomos sexuais � composto por um cromossomo X e um
cromossomo Y. Cari�tipos normais de homem e de mulher costumam ser escritos como se
v� a seguir:
Cari�tipo da mulher: 22AA + XX ou 46, XX
Cari�tipo do homem: 22AA + XY ou 46, XY

P�gina 109

Alguns cromossomos humanos s�o facilmente identificados pelo tamanho e pela forma;
outros, por�m, s�o muito parecidos entre si, sendo praticamente indistingu�veis
quanto � morfologia. Quando os cientistas submetem prepara��es citol�gicas de
cromossomos a certos tratamentos especiais, s�o produzidas faixas transversais
t�picas de cada tipo cromoss�mico. Assim, esses tratamentos permitem identificar,
pelo padr�o de faixas produzidas, cada um dos 23 pares de cromossomos do cari�tipo
humano. (Fig. 6.7)

PR. PHILIPPE VAGO, ISM/SCIENCE PHOTO LIBRARY/LATINSTOCK


Figura 6.7 Cariograma obtido de fotomicrografia de cari�tipo humano masculino
normal. (Microsc�pio fot�nico; aumento ? 1.500�; cores artificiais.) As faixas
transversais t�picas de cada cromossomo s�o obtidas por tratamento qu�mico
especial. O padr�o de faixas permite identificar os diferentes tipos cromoss�micos.
Ci�ncia e cidadania
Altera��es cromoss�micas na esp�cie humana
1 Em v�rias esp�cies, inclusive na nossa, podem nascer indiv�duos com altera��es
cromoss�micas em rela��o ao cari�tipo normal. Essas altera��es geralmente causam
transtornos no funcionamento celular, levando a doen�as graves ou mesmo � morte.
2 Certas altera��es afetam a estrutura de um ou mais cromossomos, sendo, por isso,
denominadas altera��es estruturais; se, por exemplo, um cromossomo perde um peda�o,
ocorre o que se denomina dele��o; se cromossomos n�o hom�logos trocam peda�os,
temos a chamada transloca��o. Altera��es decorrentes de erros no processo de
divis�o celular e que afetam o n�mero de cromossomos da c�lula s�o conhecidas como
altera��es num�ricas.
S�ndrome de Down
3 Uma das altera��es cromoss�micas num�ricas bem estudadas na esp�cie humana � a
trissomia do cromossomo 21, assim chamada porque as c�lulas da pessoa possuem n�o
apenas um par do cromossomo designado pelo n�mero 21, como seria normal, mas tr�s
exemplares desse cromossomo. Pessoas com essa altera��o cromoss�mica podem
apresentar uma s�rie de caracter�sticas t�picas - atraso no desenvolvimento mental,
hipotonia (fraqueza) muscular, baixa estatura, anomalias card�acas, olhos com
fendas palpebrais obl�quas, o que lhes confere um aspecto amendoado, prega �nica
nas palmas das m�os, entre outras. Esses tra�os cl�nicos caracterizam a s�ndrome de
Down.

PROF. ANGELA MORGANTE/IBUSP


Cariograma de pessoa do sexo masculino com s�ndrome de Down. O cromossomo 21
extranumer�rio est� destacado pelo c�rculo vermelho. (Microsc�pio fot�nico; aumento
? 1.100�.)

P�gina 110
4 Gra�as aos avan�os na compreens�o da s�ndrome, as pessoas com Down t�m sido cada
vez mais bem acolhidas na sociedade. Os pais de crian�as nascidas com a trissomia
do cromossomo 21 devem procurar ajuda especializada t�o logo a s�ndrome seja
diagnosticada; sabe-se que a estimula��o f�sica e mental precoce melhora o
desenvolvimento neuromuscular e a capacidade de comunica��o de crian�as com essa
s�ndrome.
S�ndrome de Turner e s�ndrome de Klinefelter
5 Outros exemplos de altera��o no n�mero de cromossomos na esp�cie humana s�o a
s�ndrome de Turner e a s�ndrome de Klinefelter.
6 A pessoa com s�ndrome de Turner tem apenas um cromossomo sexual (monossomia), o
cromossomo X, e � do sexo feminino. As principais caracter�sticas dessa s�ndrome
s�o baixa estatura, problemas no desenvolvimento dos �rg�os genitais, infertilidade
e, em alguns casos, atraso mental leve e desenvolvimento de pregas de pele nos
lados do pesco�o (pesco�o alado).
7 A pessoa com s�ndrome de Klinefelter tem tr�s cromossomos sexuais, sendo dois X e
um Y, e � do sexo masculino. As principais caracter�sticas dessa s�ndrome s�o
problemas no desenvolvimento dos �rg�os genitais, geralmente acompanhados de
infertilidade e retardo mental leve.

PROF. ANGELA MORGANTE/IBUSP


Cariograma de pessoa com s�ndrome de Turner, que � sempre do sexo feminino.
(Microsc�pio fot�nico; aumento ? 1.050�.)

PROF. ANGELA MORGANTE/IBUSP


Cariograma de pessoa com s�ndrome de Klinefelter, que � sempre do sexo masculino.
No c�rculo vermelho, o cromossomo X extranumer�rio. (Microsc�pio fot�nico;
aumento ? 1.150�.)
Guia de leitura
Responda em seu caderno
1 Leia apenas o t�tulo do quadro. H� alguns anos, ele poderia ter sido "Aberra��es
cromoss�micas da esp�cie humana", uma vez que, no jarg�o da Gen�tica, altera��es do
cari�tipo s�o denominadas aberra��es. Entretanto, o termo tem conota��o
depreciativa e, por isso, conv�m n�o utiliz�-lo para se referir � esp�cie humana.
Escreva um coment�rio a respeito desse assunto.
2 Leia agora o primeiro e o segundo par�grafos do quadro. Certifique-se de ter
compreendido a distin��o entre altera��es cromoss�micas estruturais e altera��es
num�ricas.
3 Leia o terceiro par�grafo, referente � s�ndrome de Down, e responda: o que
caracteriza a s�ndrome do ponto de vista cromoss�mico? Observe o cari�tipo
correspondente e identifique o cromossomo 21 extranumer�rio. Informe-se, no
par�grafo, sobre as principais caracter�sticas f�sicas apresentadas por pessoas com
s�ndrome de Down.
4 Leia o quarto par�grafo do quadro, que aborda um importante aspecto de cidadania:
a inclus�o social de pessoas com caracter�sticas especiais, como as que estamos
estudando. Voc� j� teve algum contato com pessoas com s�ndrome de Down? Informe-se
sobre a inclus�o dos portadores da s�ndrome de Down nos diversos setores da
sociedade e escreva um texto opinativo sobre o assunto.
5 Nos par�grafos 5, 6 e 7 s�o apresentadas duas outras s�ndromes cromoss�micas
humanas: a de Turner e a de Klinefelter. O que caracteriza cada uma dessas
s�ndromes do ponto de vista cromoss�mico? Observe as figuras correspondentes e
localize os cromossomos em quest�o. Informe-se, nos par�grafos 6 e 7, sobre as
principais caracter�sticas f�sicas de pessoas com s�ndromes de Turner e
Klinefelter, respectivamente.

P�gina 111

6.3 Dividir para multiplicar: a divis�o celular


No momento em que voc� l� este texto, milh�es de c�lulas de seu corpo est�o se
reproduzindo. Na pele, c�lulas multiplicam-se continuamente, substituindo as
camadas celulares mais externas, que v�o morrendo e descamando. No interior de
certos ossos, h� c�lulas em cont�nua multiplica��o que originam gl�bulos brancos e
hem�cias do sangue. Cabelos e unhas crescem pela incessante multiplica��o de
c�lulas presentes no fol�culo piloso e na base ungueal, respectivamente.
A reprodu��o celular, apesar de corriqueira, � uma empreitada fant�stica, quando
analisada nos n�veis nanosc�pico e microsc�pico. Primeiramente, cada uma das longas
mol�culas de DNA que constituem os cromossomos precisa passar por uma rigorosa
duplica��o. Depois de duplicados, os cromossomos devem separar-se e distribuir-se
corretamente para as c�lulas-filhas. Imagine os desafios desse empreendimento: em
nossas c�lulas, os 46 cromossomos totalizam mais de 2 metros de fin�ssimos fios
emaranhados (relembre o conceito de cromatina). Eventuais erros na distribui��o dos
cromossomos costumam causar problemas no funcionamento do organismo, em decorr�ncia
da import�ncia dos genes para o metabolismo.
O ciclo celular
O per�odo que vai do surgimento de uma c�lula por divis�o at� que a pr�pria c�lula
se divida em duas � denominado ciclo celular. Esse ciclo costuma ser dividido em
duas etapas: a interfase e a divis�o celular. (Fig. 6.8)

ILUSTRA��O: ADILSON SECCO


Figura 6.8 Representa��o esquem�tica do ciclo celular. Note, no c�rculo central,
que as �reas de cada fase do ciclo celular n�o correspondem aos respectivos tempos
de dura��o mostrados entre par�nteses. Em um ciclo celular de 24 horas, a mitose
representa pouco mais de 30 minutos. (Elementos fora de propor��o de tamanho entre
si; cores-fantasia.)

P�gina 112

Interfase � o per�odo entre duas divis�es celulares consecutivas. A divis�o


celular, por sua vez, compreende dois processos: mitose (duplica��o do n�cleo) e
citocinese (divis�o do citoplasma). Em geral, a mitose e a citocinese duram menos
de 1 hora, o que corresponde a cerca de 5% da dura��o total do ciclo celular. Nos
outros 95% do tempo, a c�lula est� em interfase.
O per�odo de interfase � subdividido em tr�s fases: G1, S e G2. A sigla S deriva da
palavra inglesa synthesis, em refer�ncia � s�ntese de DNA, que ocorre durante a
fase S, quando a quantidade de DNA do n�cleo � duplicada. As siglas G1 e G2 derivam
da palavra inglesa gap (intervalo) e designam os momentos anterior (G1) e posterior
(G2) � duplica��o do DNA. (Fig. 6.9)

OSVALDO SEQUETIN
Figura 6.9 Acima, representa��o esquem�tica da rela��o entre DNA e cromossomos nas
diversas fases do ciclo celular. Em G1 cada cromossomo cont�m apenas uma mol�cula
de DNA; em S ocorre a duplica��o do DNA; em G2, o cromossomo est� constitu�do por
duas crom�tides-irm�s, cada uma contendo uma mol�cula de DNA; as crom�tides-irm�s
separam-se na mitose (M). (Elementos fora de propor��o de tamanho entre si; cores-
fantasia.) Embaixo, gr�fico da varia��o da quantidade de DNA em uma c�lula durante
o ciclo celular.
Mitose
Em um aparente paradoxo, na "matem�tica" celular dividir � igual a multiplicar. Por
qu�? Quando uma c�lula se divide, ela origina duas c�lulas-filhas geralmente com
metade do tamanho da c�lula genitora. Entretanto, cada nova c�lula tem potencial
para crescer e originar uma c�lula t�pica da linhagem a que pertence, uma vez que
recebeu um conjunto completo de genes. Isso � poss�vel porque os cromossomos e
genes duplicam-se antes de a c�lula se dividir.
Como vimos, a duplica��o dos cromossomos ocorre no per�odo S da interfase. Depois
que a duplica��o se completa, h� a fase G2 e em seguida a c�lula inicia a mitose.
O termo mitose deriva da palavra grega mitos, que significa "filamento", referindo-
se ao fato de os cromossomos, durante o processo, tornarem-se cada vez mais
espessos.
A mitose de uma c�lula humana costuma durar de 30 a 60 minutos, desde o in�cio da
condensa��o cromoss�mica at� a forma��o dos dois n�cleos-filhos. Ao longo da
mitose, ocorrem eventos marcantes, escolhidos pelos cientistas para dividir esse
processo em quatro fases: pr�fase, met�fase, an�fase e tel�fase.
Pr�fase
Durante a interfase, os cromossomos est�o descondensados e s�o t�o finos que n�o
podem ser visualizados individualmente, mesmo com os melhores microsc�pios
fot�nicos.
A pr�fase (do grego pro, antes, em frente) caracteriza-se pela condensa��o dos
cromossomos, que se tornam mais curtos e grossos, podendo ser visualizados
individualmente ao microsc�pio fot�nico. Ao se condensar, os cromossomos encurtam
e, desse modo, separam-se mais facilmente e podem se distribuir corretamente para
as c�lulas-filhas.

P�gina 113

O cromossomo condensado torna-se inativo, pois a compacta��o geralmente impede a


produ��o de mol�culas de RNA a partir do DNA. Isso explica por que os nucl�olos
desaparecem durante a pr�fase: ao se condensar, a regi�o cromoss�mica que organiza
o nucl�olo deixa de produzir RNA riboss�mico, seu principal componente.
Outro evento caracter�stico da pr�fase � a forma��o do fuso mit�tico ou fuso
acrom�tico, um conjunto de microt�bulos orientados de um polo a outro da c�lula e
cuja fun��o � capturar e distribuir os cromossomos para as c�lulas-filhas.
A forma��o do fuso mit�tico inicia-se com a separa��o dos centrossomos, duplicados
na fase S da interfase, para polos opostos da c�lula. Em sua migra��o, os
centrossomos v�o orientando a organiza��o de microt�bulos entre os dois polos
celulares, formando fibras. Nas c�lulas animais, os microt�bulos se organizam
tamb�m ao redor de cada centrossomo, originando uma estrutura denominada �ster,
ausente em c�lulas vegetais. (Fig. 6.10)

Figura 6.10 A. Representa��o esquem�tica de uma c�lula animal em in�cio de pr�fase,


com o fuso mit�tico em forma��o. B. Em maior aumento, organiza��o geral do fuso,
com fibras entre os centros celulares e fibras do �ster ao redor de cada um deles.
(Elementos fora de propor��o de tamanho entre si; cores-fantasia.)
Ao final da pr�fase, a carioteca se fragmenta em pequenas bolsas e os cromossomos,
j� em grau avan�ado de condensa��o, espalham-se pelo citoplasma.
Met�fase
A met�fase (do grego meta, meio) sucede a pr�fase e � marcada pelo posicionamento
dos cromossomos na regi�o equatorial do fuso acrom�tico. Microt�bulos provenientes
dos centrossomos crescem e "fisgam" os cromossomos, capturando-os pelo cinet�coro,
estrutura proteica presente na regi�o do centr�mero. Quando o cinet�coro de uma
crom�tide � capturado por microt�bulos ligados a um dos polos celulares, o
cinet�coro da crom�tide-irm� volta-se automaticamente para o polo oposto, sendo
capturado por microt�bulos provenientes desse polo. Assim, as crom�tides-irm�s de
cada cromossomo prendem-se a polos celulares opostos.
Os cromossomos presos �s fibras do fuso posicionam-se na regi�o mediana da c�lula,
constituindo a chamada placa metaf�sica ou placa equatorial. O termo met�fase
refere-se justamente ao fato de os cromossomos se alinharem na regi�o mediana da
c�lula. (Fig. 6.11)

ILUSTRA��ES: CAN�ADO
Figura 6.11 Representa��o esquem�tica do processo de uni�o dos cromossomos ao fuso
mit�tico, com forma��o da placa metaf�sica. A. Captura dos cromossomos por
microt�bulos de um dos polos. B. Liga��o de microt�bulos do outro polo ao
cinet�coro da crom�tide-irm�. C. Alinhamento dos cromossomos, formando a placa
metaf�sica. (Elementos fora de propor��o de tamanho entre si; cores-fantasia.)

P�gina 114

Alguns autores denominam promet�fase o per�odo que vai da ruptura da carioteca �


forma��o completa da placa metaf�sica. Nesse caso, a met�fase corresponderia apenas
ao per�odo que vai do alinhamento dos cromossomos no equador da c�lula at� o in�cio
de sua migra��o para polos opostos.
Certas drogas, como a colchicina e o colcemide, interferem na forma��o dos
microt�bulos ao se ligarem �s mol�culas da prote�na tubulina que os constituem. Em
situa��es experimentais em que essas drogas s�o adicionadas ao meio de cultura das
c�lulas ou injetadas em animais em estudo, a mitose prossegue normalmente at� a
met�fase, mas � interrompida porque os microt�bulos n�o conseguem se formar. Como
veremos a seguir, s�o eles que puxam as crom�tides para os polos opostos da c�lula.
Depois de algum tempo em contato com a droga, os cromossomos se descondensam e a
carioteca se recomp�e. O novo n�cleo assim formado tem o dobro do n�mero de
cromossomos originalmente presentes na c�lula, pois houve duplica��o cromoss�mica
da interfase, mas n�o ocorreu separa��o das crom�tides-irm�s para n�cleos-filhos.
An�fase
A pr�fase e a met�fase preparam a c�lula para um evento culminante da divis�o: a
separa��o das crom�tides-irm�s, puxadas para polos opostos pelo encurtamento dos
microt�bulos do fuso. Por isso, essa fase denomina-se an�fase (do grego ana,
separa��o).
O encurtamento dos microt�bulos ligados aos cromossomos ocorre por desagrega��o
controlada das mol�culas constituintes dos microt�bulos, junto � regi�o dos
cinet�coros. Progressivamente, cada cromossomo � arrastado pelo centr�mero em
dire��o ao polo ao qual est� ligado. A densidade do citoplasma celular pode ser
percebida pelo formato flexionado dos cromossomos na an�fase, quando s�o arrastados
pelos microt�bulos do fuso no citoplasma denso. Quando as crom�tides-irm�s,
chamadas de cromossomos-irm�os ap�s a separa��o, chegam aos polos da c�lula,
termina a an�fase. (Fig. 6.12)

CAN�ADO
Figura 6.12 Representa��o esquem�tica do encurtamento dos microt�bulos, que faz os
cromossomos serem puxados para os polos. Foi representado apenas um microt�bulo, em
amplia��o muito maior que a do cromossomo. (Elementos fora de propor��o de tamanho
entre si; cores-fantasia.)
Muito raramente, ambas as crom�tides de um cromossomo podem ligar-se por engano a
microt�bulos de um mesmo polo, migrando juntas. Esse fen�meno, conhecido como n�o
disjun��o cromoss�mica, leva a um erro na distribui��o dos cromossomos: uma das
c�lulas-filhas fica com um cromossomo a mais, e a outra, com um cromossomo a menos.
Quando a n�o disjun��o ocorre nas c�lulas germinativas que d�o origem aos gametas
ou no in�cio do desenvolvimento embrion�rio, podem surgir malforma��es em um
organismo.
Tel�fase
Quando os cromossomos chegam aos polos celulares tem in�cio a tel�fase (do grego
telos, fim), �ltima fase da mitose. Nela, os cromossomos se descondensam e novas
cariotecas reorganizam-se ao redor de cada conjunto cromoss�mico separado,
reconstituindo dois novos n�cleos.
� medida que os cromossomos se descondensam, eles s�o envolvidos pelas bolsas
membranosas resultantes da fragmenta��o da carioteca antiga, reconstituindo duas
novas cariotecas. Com a descondensa��o, os cromossomos voltam progressivamente �
atividade e retomam a produ��o de RNA riboss�mico; consequentemente, os nucl�olos
reaparecem.

P�gina 115

A divis�o por mitose origina n�cleos-filhos com o mesmo n�mero e os mesmos tipos de
cromossomos da c�lula-m�e. C�lulas diploides (2n) originam, por mitose, duas
c�lulas diploides. C�lulas haploides (n) originam, por mitose, duas c�lulas
haploides. (Fig. 6.13)

ILUSTRA��ES: CAN�ADO
Figura 6.13 De cima para baixo, representa��o esquem�tica da sequ�ncia de fases da
mitose. Os esquemas � direita representam fen�menos descobertos apenas com o
emprego da microscopia eletr�nica e de t�cnicas especiais de colora��o. � esquerda,
s�o reproduzidos os desenhos publicados em 1882 pelo citologista alem�o Walther
Flemming (1843-1905), considerado o descobridor da mitose. (Elementos fora de
propor��o de tamanho entre si; cores-fantasia.)
Citocinese
Durante a reorganiza��o dos n�cleos-filhos, os microt�bulos do fuso desagregam-se e
inicia-se a citocinese, processo de divis�o do citoplasma que leva � forma��o das
duas c�lulas-filhas.
Em c�lulas animais e de protozo�rios, a citocinese ocorre por estrangulamento na
regi�o equatorial, causado por um anel de filamentos contr�teis constitu�do pelas
prote�nas actina e miosina. Por se iniciar na periferia da c�lula e avan�ar para o
centro, esse tipo de divis�o citoplasm�tica � chamadocitocinese centr�peta.

P�gina 116

Nas c�lulas das plantas, ao final da tel�fase, bolsas membranosas que cont�m o
polissacar�dio pectina depositam-se na regi�o equatorial da c�lula. Essas bolsas
fundem-se umas �s outras originando o fragmoplasto, uma placa que cresce do centro
da c�lula para a periferia, at� encostar na parede celul�sica e separar as c�lulas-
filhas. Por ocorrer do centro para a periferia, a divis�o do citoplasma nas c�lulas
vegetais recebe o nome de citocinese centr�fuga. (Fig. 6.14)

ILUSTRA��ES: JURANDIR RIBEIRO


Figura 6.14 Representa��o esquem�tica em que se compara a divis�o de uma c�lula
animal com a de uma c�lula vegetal. Note a aus�ncia do �ster na c�lula vegetal e as
diferen�as no processo de citocinese. (Elementos fora de propor��o de tamanho entre
si; cores-fantasia.) (Elaborada com base em Lodish, H. e cols., 2005.)
Ci�ncia e cidadania
O que � c�ncer?
1 Durante a vida de um animal, as divis�es celulares s�o rigorosamente controladas
para garantir o bom funcionamento do organismo. Ao longo do desenvolvimento
embrion�rio e das fases jovens da vida, as divis�es celulares s�o intensas e os
diversos �rg�os se formam e crescem at� atingir seu tamanho definitivo. Na fase
adulta, o ritmo das divis�es celulares diminui e elas passam a ocorrer apenas
quando � necess�rio repor as c�lulas que morrem naturalmente ou em consequ�ncia de
acidentes.
2 Entretanto, certas altera��es gen�ticas podem danificar o sistema de controle da
divis�o celular, levando a c�lula a se multiplicar sem necessidade. Caso essa
tend�ncia de multiplica��o incontrolada seja transmitida �s c�lulas-filhas, surgir�
um clone de c�lulas com propens�o a se expandir indefinidamente: um tumor.
3 Um tumor pode ser constitu�do por c�lulas sem mobilidade, que ficam restritas ao
local onde surgiram.
Nesse caso, geralmente causa poucos problemas ao organismo e, por isso, �
denominado tumor benigno. No entanto, alguns tipos de tumor t�m c�lulas capazes de
migrar e invadir tecidos vizinhos sadios: s�o os tumores malignos ou c�nceres.
Pelas circula��es sangu�nea e linf�tica, as c�lulas cancer�genas atingem diversas
regi�es do corpo, onde podem originar novos tumores. O processo de dissemina��o de
um tumor � denominado met�stase. Tumores malignos geralmente s�o prejudiciais ao
organismo e, se n�o s�o tratados adequadamente, podem levar � morte.
4 Costuma-se classificar os tumores malignos em dois grupos: sarcomas e carcinomas.
Sarcomas s�o provenientes de c�lulas origin�rias do mesoderma embrion�rio, enquanto
carcinomas prov�m de c�lulas origin�rias do ectoderma ou do endoderma. A leucemia �
um tipo especial de sarcoma que atinge os gl�bulos brancos do sangue.

P�gina 117

5 Com exce��o da leucemia, em que as c�lulas tumorais est�o livres no sangue, os


tumores s�o estruturas s�lidas. Um tumor pode crescer at� atingir cerca de 1 milh�o
de c�lulas, produzindo uma estrutura mais ou menos esf�rica com cerca de 2
mil�metros de di�metro. Nesse ponto, as c�lulas mais internas do tumor come�am a
ter um problema de nutri��o, pois os nutrientes trazidos pelo sangue n�o chegam at�
elas. O esperado seria que essas c�lulas morressem e o tumor deixasse de crescer.
Entretanto, a maioria dos tumores tem a capacidade de induzir a angiog�nese, que �
a forma��o de novos vasos sangu�neos. A descoberta de subst�ncias que bloqueiam a
angiog�nese tem sido motivo de otimismo entre os m�dicos, pois pode levar ao
desenvolvimento de novos agentes terap�uticos para o combate ao c�ncer.
6 Muta��es g�nicas, perdas e duplica��es de cromossomos (inteiros ou peda�os) ou
quebras cromoss�micas, entre outros tipos de altera��o gen�tica, podem levar uma
c�lula normal a se transformar em uma c�lula cancerosa.
7 A teoria mais conservadora para a origem do c�ncer admite que, dependendo do tipo
de tumor, uma c�lula se torna maligna depois de 3 a 20 muta��es em uma sequ�ncia
definida. Essas altera��es ocorrem em duas classes principais de genes: genes
supressores de tumor e oncogenes. Os primeiros produzem prote�nas que impedem a
progress�o do

ADILSON SECCO
Gr�fico que mostra a incid�ncia de diversos tipos de c�ncer em homens em fun��o da
idade. Note que as taxas de incid�ncia, assim como as idades, est�o expressas em
escala logar�tmica; isso � necess�rio para representar o aumento dr�stico da
incid�ncia de c�ncer com o avan�o da idade; por exemplo, a taxa de incid�ncia do
c�ncer de pr�stata � 500 vezes maior em homens com 80 anos do que em homens com 45
anos de idade. (Elaborado com base em Volgelstein, B. e Kinzler, K., 1993.)
ciclo celular quando h� problemas. Os oncogenes estimulam as divis�es celulares.
Muta��es nos genes supressores de tumor podem permitir a reprodu��o de c�lulas
alteradas. Modifica��es nos oncogenes podem levar � divis�o descontrolada das
c�lulas.
8 Como exige diversas altera��es, a forma��o de tumores � mais frequente em pessoas
idosas. Uma pessoa de 70 anos de idade tem 100 vezes mais risco de ter um c�ncer
que uma pessoa de 19 anos. Algumas vezes, a pessoa herda dos pais certas altera��es
gen�ticas que a tornam mais propensa a desenvolver tumores. Nesse caso, a
manifesta��o da doen�a requer menos muta��es na pr�pria pessoa. Essa � uma das
raz�es de certas fam�lias apresentarem maior incid�ncia de alguns tipos de c�ncer.

ILUSTRA��ES: JURANDIR RIBEIRO


Representa��o esquem�tica do desenvolvimento de um tumor maligno no tecido
epitelial. O tumor estimula a angiog�nese e libera c�lulas invasivas na circula��o
sangu�nea. (Elementos fora de propor��o de tamanho entre si; cores-fantasia.)

P�gina 118

Guia de leitura
Responda em seu caderno
1 Leia o primeiro par�grafo e resuma sua ideia central.
2 Leia o segundo par�grafo e explique o que � um tumor.
3 Com base na leitura do terceiro par�grafo, diferencie tumor benigno de tumor
maligno e defina met�stase.
4 Leia o quarto par�grafo. Que crit�rio � utilizado para distinguir sarcoma de
carcinoma?
5 No quinto par�grafo � apresentada uma "estrat�gia" dos tumores que atingem
tamanho relativamente grande: a angiog�nese. Explique o que isso significa.
6 Leia os par�grafos 6 e 7, que comentam as origens do c�ncer. Quais s�o os
principais tipos de genes cujas muta��es podem causar c�ncer?
7 Leia o oitavo e �ltimo par�grafo. Analise o gr�fico que relaciona diversos tipos
de c�ncer � idade. Alguns oncologistas costumam dizer que, se outras doen�as fossem
curadas, todos morreriam de c�ncer. Como voc� analisa essa afirma��o baseando-se no
que leu e no gr�fico?
8 Estrat�gias bem-sucedidas na abordagem contra o c�ncer envolvem sua detec��o e
tratamento prematuros. Pesquise na internet campanhas preventivas contra o c�ncer
de mama ou de pr�stata. Informe-se e organize, em grupo, uma campanha de divulga��o
a respeito disso; lembre-se de que esses assuntos s�o de grande interesse para toda
a comunidade.
6.4 Cromossomos em a��o: duplica��o e transcri��o g�nicas
A estrutura molecular do DNA
Como vimos, o constituinte fundamental do cromossomo � o �cido desoxirribonucleico,
o DNA ou ADN, uma mol�cula longa e fina, com apenas 2 nm de espessura, mas que pode
atingir alguns cent�metros de comprimento. Ele � formado por dois filamentos
paralelos e muito pr�ximos, que se enrolam helicoidalmente no espa�o lembrando a
"espiral" de um caderno. Por apresentar dois filamentos paralelos em forma
helicoidal, costuma-se dizer que a mol�cula de DNA � uma dupla-h�lice.
Cada uma das cadeias do DNA � composta por milhares ou mesmo milh�es de unidades
moleculares - os desoxirribonucleot�dios - unidos em sequ�ncia. Cada filamento do
DNA �, portanto, o que os cientistas denominam cadeia polinucleot�dica.
Um nucleot�dio � constitu�do por tr�s componentes quimicamente unidos: uma base
nitrogenada, a pentose desoxirribose e um fosfato, �on negativo derivado de um
�cido fosf�rico. As bases nitrogenadas que comp�em os desoxirribonucleot�dios podem
ser de quatro tipos: adenina (A),guanina (G), citosina (C) e timina (T). Os
nucleot�dios do DNA est�o unidos entre si por liga��es covalentes, que se
estabelecem entre o grupo fosfato de um nucleot�dio e a desoxirribose de outro.
As duas cadeias polinucleot�dicas do DNA mant�m-se unidas por liga��es de
hidrog�nio (ou pontes de hidrog�nio), estabelecidas entre as bases nitrogenadas das
cadeias. As liga��es de hidrog�nio ocorrem apenas entre pares de bases espec�ficos,
de tal modo que a base adenina se liga apenas � timina (A ? T), enquanto a citosina
se liga apenas � guanina (C ? G). Assim, as duas cadeias da dupla-h�lice do DNA s�o
sempre complementares: se em uma delas houver um desoxirribonucleot�dio com
adenina, na posi��o correspondente da outra cadeia haver� um

P�gina 119

com timina, e vice-versa. Se em uma das cadeias houver um desoxirribonucleot�dio


com guanina, na outra cadeia haver� um com citosina, e vice-versa. Por exemplo, se
a sequ�ncia de bases em uma das cadeias do DNA for ATTGCATGCGCATTACG, a regi�o
correspondente da outra cadeia apresentar� a sequ�ncia complementar
TAACGTACGCGTAATGC. (Fig. 6.15)

ILUSTRA��ES: ADILSON SECCO


Figura 6.15 A. Representa��o esquem�tica da estrutura do DNA, formado por duas
cadeias dispostas helicoidalmente (dupla-h�lice). B. Representa��o das liga��es de
hidrog�nio entre as bases nitrogenadas que comp�em duas cadeias de DNA; note as
tr�s liga��es de hidrog�nio entre as bases C e G e as duas entre A e T; por isso,
costuma-se representar o par CG como C ? G e o par AT como A = T. (Elementos fora
de propor��o de tamanho entre si; cores-fantasia.)
A replica��o semiconservativa do DNA
O modelo para a mol�cula de DNA, proposto originalmente em 1953 pelos pesquisadores
James Watson (1928-) e Francis Crick (1916-2004), foi bem aceito porque, al�m de
ser coerente com as propriedades f�sicas e qu�micas da mol�cula, explicava como ela
se duplica, produzindo duas r�plicas exatamente iguais. De acordo com o modelo de
Watson e Crick, no momento da duplica��o, as duas cadeias de uma mol�cula de DNA
separam-se e cada uma delas orienta a forma��o de uma cadeia complementar. Essa
forma de duplicar, amplamente confirmada em in�meros experimentos, � conhecida como
replica��o semiconservativa do DNA; cada mol�cula resultante da duplica��o conserva
uma das cadeias originais da "mol�cula-m�e" e tem uma cadeia nova, complementar �
que serviu de molde.
O processo de duplica��o do DNA � catalisado por diversas enzimas. Entre elas,
destacam-se as helicases, que catalisam a quebra das liga��es de hidrog�nio entre
as duas cadeias, fazendo com que elas se separem, e as polimerases do DNA, que
orientam o emparelhamento de nucleot�dios livres � cadeia-molde, al�m de
catalisarem a uni�o entre eles (polimeriza��o).
� medida que as bases nitrogenadas de cada cadeia desemparelham-se de suas
complementares por a��o das helicases, a polimerase do DNA orienta o encaixe de
desoxirribonucleot�dios livres �s cadeias originais, respeitando a regra de
emparelhamento A ? T e C ? G. Os desoxirribonucleot�dios, uma vez corretamente
posicionados, v�o se unindo entre si, originando uma cadeia polinucleot�dica
complementar � que serve de molde. Ao final do processo de duplica��o, h� duas
mol�culas de DNA id�nticas, cada uma delas com uma cadeia da mol�cula original e
uma cadeia nova rec�m-sintetizada a partir da uni�o de desoxirribonucleot�dios
livres presentes na c�lula. (Fig. 6.16)

P�gina 120

ILUSTRA��ES: ADILSON SECCO


Figura 6.16 Representa��o esquem�tica da duplica��o do DNA.
A s�ntese de RNA: transcri��o g�nica
Como comentamos, sequ�ncias de bases nitrogenadas no DNA cont�m informa��es
codificadas que controlam praticamente todos os processos celulares. Essas
informa��es s�o rigorosamente duplicadas e transmitidas com precis�o de gera��o
para gera��o pela duplica��o semiconservativa do DNA. Resta, no entanto, responder
� pergunta: como as informa��es contidas no DNA se manifestam, ou seja, como elas
se transformam em a��es efetivas no metabolismo celular?
Lembre-se de que, nas c�lulas eucari�ticas, a maior parte do DNA permanece dentro
do n�cleo, onde faz parte dos cromossomos. Mas a produ��o de prote�nas e a maior
parte das atividades celulares ocorrem no citoplasma. Como o DNA pode "expressar"
suas informa��es codificadas sem sair do n�cleo? Isso ocorre por meio de mol�culas
de �cido ribonucleico, o RNA ou ARN, que agem como intermedi�rias e assessoras da
manifesta��o das informa��es contidas no DNA nuclear.
O RNA tamb�m � constitu�do por nucleot�dios unidos em sequ�ncia. Estes, contudo,
diferem dos nucleot�dios do DNA por apresentarem a pentose ribose em lugar da
desoxirribose; as unidades constituintes do RNA s�o, portanto, ribonucleot�dios.
Tr�s das quatro bases nitrogenadas presentes no RNA s�o id�nticas �s do DNA:
adenina (A), guanina (G) e citosina (C). O RNA, no entanto, n�o apresenta a base
timina; seu lugar � ocupado pela base uracila (U). Outra diferen�a em rela��o ao
DNA � que as mol�culas de RNA, com poucas exce��es, s�o constitu�das por apenas uma
cadeia polinucleot�dica.
O DNA expressa-se transcrevendo suas informa��es para mol�culas de RNA, que saem do
n�cleo e atuam em processos metab�licos citoplasm�ticos, basicamente na s�ntese de
prote�nas.
A transcri��o do RNA tem in�cio com a separa��o das duas cadeias de certo segmento
do DNA, processo catalisado pela enzima polimerase do RNA. � medida que separa as
cadeias do DNA, essa enzima tamb�m orienta o emparelhamento de ribonucleot�dios
livres em uma das cadeias, que serve assim de molde para a s�ntese de RNA; a outra
cadeia permanece inativa.
O emparelhamento dos ribonucleot�dios livres � cadeia-molde de DNA obedece �
seguinte regra: ribonucleot�dios com uracila emparelham-se �s adeninas da cadeia-
molde de DNA (U ? A); ribonucleot�dios com adenina emparelham-se �s timinas do DNA
(A ? T); ribonucleot�dios com citosina emparelham-se �s guaninas do DNA (C ? G); e
ribonucleot�dios com guanina emparelham-se �s citosinas do DNA (G ? C).
� medida que o emparelhamento ocorre, os ribonucleot�dios unem-se pela a��o da
polimerase, formando a cadeia de RNA. Ao final do processo, a mol�cula de RNA
sintetizada liberta-se do DNA que comandou sua s�ntese, cujas duas cadeias voltam a
se emparelhar, reconstituindo a dupla-h�lice. (Fig. 6.17)

P�gina 121

ILUSTRA��ES: ADILSON SECCO


Figura 6.17 Representa��o esquem�tica da s�ntese de RNA a partir do DNA.
A sequ�ncia de bases nitrogenadas do RNA reflete fielmente a sequ�ncia de bases da
cadeia de DNA que serviu de molde. Por exemplo, uma cadeia de DNA formada pela
sequ�ncia de bases TAGGCTAATGCTCGTA produz um RNA com sequ�ncia de bases
AUCCGAUUACGAGCAU. Portanto, uma mensagem codificada em um gene do DNA � transcrita
para o RNA. Por isso, a s�ntese de RNA � chamada de transcri��o g�nica.
6.5 O mecanismo da s�ntese de prote�nas: tradu��o g�nica
Tipos de RNA e suas fun��es
A fun��o primordial das mol�culas de RNA transcritas a partir do DNA � participar
da s�ntese de prote�nas. Lembre-se de que as prote�nas definem a estrutura e o
funcionamento das c�lulas e, portanto, do organismo como um todo.
Toda prote�na � formada por uma ou mais cadeias polipept�dicas ou polipept�dios.
Cada polipept�dio � uma longa cadeia filamentosa constitu�da por amino�cidos. Nos
seres vivos h� vinte tipos de amino�cidos, encadeados de diferentes maneiras nos
polipept�dios.
A sequ�ncia de amino�cidos de uma cadeia polipept�dica � denominada estrutura
prim�ria. Dependendo da estrutura prim�ria, a cadeia polipept�dica enrola-se,
dobra-se e, n�o raro, une-se a outras cadeias polipept�dicas (ou mesmo a outras
subst�ncias), originando a grande variedade de prote�nas que constituem os seres
vivos. Assim, a fun��o biol�gica de cada prote�na � determinada, em �ltima an�lise,
por sua estrutura prim�ria.
Como a estrutura e o funcionamento de qualquer ser vivo dependem da natureza de
suas prote�nas, pode-se afirmar que o metabolismo celular � controlado pelo DNA, no
qual se encontram as "receitas" para ordenar os amino�cidos, determinando assim a
estrutura prim�ria das prote�nas.
O processo de s�ntese de prote�nas � fundamentalmente semelhante em todos os seres
vivos, o que representa mais uma evid�ncia da evolu��o da vida e do parentesco
entre as esp�cies biol�gicas. Os "atores" principais desse processo s�o tr�s tipos
de RNA: o RNA mensageiro, o RNA transportador e o RNA riboss�mico.

P�gina 122

RNA mensageiro (RNAm)


O RNA mensageiro (RNAm) � o portador da instru��o para a estrutura prim�ria de uma
prote�na. A sequ�ncia de nucleot�dios do RNAm cont�m informa��o para o n�mero e a
sequ�ncia de amino�cidos da cadeia polipept�dica. Essa informa��o, como vimos, est�
primariamente codificada na sequ�ncia de nucleot�dios do DNA.
O sistema de codifica��o gen�tica dos seres vivos � denominado c�digo gen�tico.
Nele, uma trinca de nucleot�dios do RNA mensageiro transcrito, e consequentemente
do DNA, corresponde a um amino�cido no polipept�dio. Cada uma das trincas de bases
nitrogenadas do RNAm codificadoras da prote�na � denominada c�don.
Como vimos, os nucleot�dios do RNA podem ser de quatro tipos quanto �s bases
nitrogenadas, que s�o A, G, C e U. Combinando quatro tipos de nucleot�dios em
trincas, obt�m-se 64 c�dons diferentes. Fa�a as contas: um c�don cuja primeira base
� A pode ser de quatro tipos quanto � segunda base; cada combina��o, por sua vez,
pode ser de quatro tipos quanto � terceira base. Portanto, h� 16 tipos diferentes
de c�dons cuja primeira base � A. Como esse racioc�nio � v�lido para os c�dons
iniciados com cada uma das outras 3 bases, chega-se ao total de 64 c�dons
diferentes (4 � 16).
Esses 64 c�dons s�o mais do que suficientes para codificar os 20 tipos de
amino�cido que entram na composi��o das prote�nas. Tanto � assim que diferentes
c�dons correspondem a um mesmo amino�cido, ou seja, s�o "sin�nimos" (veja na tabela
a seguir). H� tamb�m tr�s trincas que n�o correspondem a nenhum amino�cido e sua
fun��o � a "pontua��o" da mensagem gen�tica: elas indicam o fim da instru��o
contida no RNA mensageiro para a codifica��o de um polipept�dio. (Tab. 6.1)

Tabela 6.1 As letras da coluna azul correspondem �s bases que ocupam a primeira
posi��o na trinca. As letras da linha superior, vermelha, correspondem �s bases que
ocupam a segunda posi��o na trinca. As letras da coluna verde correspondem �s bases
que ocupam a terceira posi��o na trinca.
Somente dois amino�cidos - metionina e triptofano - s�o codificados por apenas uma
trinca de bases; para todos os outros amino�cidos, h� c�dons sin�nimos, isto �,
mais de uma trinca codificadora. Por isso, os geneticistas costumam dizer que o
c�digo gen�tico � "degenerado". Tr�s trincas "sem sentido" (UAA, UAG e UGA),
chamadas c�dons "pare", sinalizam o fim da mensagem.
O c�digo gen�tico � universal, ou seja, � o mesmo em praticamente todos os seres
vivos do planeta. Essa � mais uma evid�ncia do parentesco evolutivo entre as
diversas esp�cies biol�gicas e uma forte indica��o de que o c�digo gen�tico atual
foi estabelecido antes da diversifica��o da vida na Terra, estando presente no
ancestral comum a todas as esp�cies hoje existentes. As exce��es conhecidas �
universalidade do c�digo gen�tico restringem-se ao significado de alguns c�dons em
mitoc�ndrias e em genes nucleares de umas poucas esp�cies. Lembre-se de que as
mitoc�ndrias e os cloroplastos s�o organelas com material gen�tico; nelas, o DNA
passa pelos mesmos processos que o DNA nuclear.

P�gina 123

RNA transportador (RNAt)


No in�cio da d�cada de 1960, os cientistas suspeitaram que amino�cidos n�o
conseguiriam "ler" diretamente os c�dons do RNAm. Aventou-se, ent�o, a
possibilidade de existirem mol�culas especiais, capazes de acoplar os amino�cidos a
seus respectivos c�dons no RNAm.
Logo se descobriu que havia mol�culas de RNA capazes de reconhecer e interagir
tanto com amino�cidos como com o RNAm. Elas foram chamadas RNA transportadores
(RNAt), em refer�ncia ao seu papel de "transportar" os amino�cidos at� seus
respectivos c�dons no RNA mensageiro.
Os RNA transportadores (RNAt) s�o mol�culas relativamente pequenas quando
comparadas a outros tipos de RNA, sendo constitu�das por cerca de 75 a 90
ribonucleot�dios. As mol�culas de RNAt dobram-se sobre si mesmas, adquirindo uma
forma t�pica que lembra a de uma letra "L". Em determinada regi�o da mol�cula,
correspondente a uma das extremidades do "L", h� uma trinca de bases nitrogenadas
capaz de se emparelhar, por liga��es de hidrog�nio, ao c�don complementar do RNAm;
por isso, essa trinca � denominada antic�don. A extremidade da mol�cula do RNAt no
outro bra�o do "L" � capaz de se ligar a um amino�cido espec�fico, correspondente
ao antic�don. (Fig. 6.18)

OSVALDO SEQUETIN
Figura 6.18 Representa��o esquem�tica da estrutura tridimensional de um RNAt. Uma
trinca de bases especial, o antic�don, permite que o RNAt se emparelhe ao c�don
complementar do RNAm durante a s�ntese da prote�na. (Elementos fora de propor��o de
tamanho entre si; cores-fantasia.) (Elaborada com base em Rawn, J., 1989.)
H� dezenas de tipos de RNAt, capazes de se ligar especificamente aos vinte tipos de
amino�cidos que constituem as prote�nas. Essa liga��o � mediada por enzimas, que
reconhecem tanto o RNAt com determinado antic�don quanto o amino�cido
correspondente �quele antic�don. Por exemplo, mol�culas de RNAt com antic�don AAA
ou AAG ligam-se sempre ao amino�cido fenilalanina; RNAt com antic�dons CCA, CCG,
CCU ou CCC ligam-se � glicina; e assim por diante.
RNA riboss�mico (RNAr)
As mol�culas de RNAt t�m a fun��o de capturar amino�cidos livres na c�lula e
orden�-los sobre mol�culas de RNAm de acordo com sua sequ�ncia de c�dons. Esse
processo de acoplamento entre o RNAm e os RNAt ocorre em uma estrutura celular
altamente especializada, o ribossomo.
Ribossomos s�o estruturas granulares citoplasm�ticas constitu�das por diversos
tipos de prote�na e por mol�culas de um tipo especial de RNA, o RNA riboss�mico
(RNAr). Cada ribossomo � composto de duas part�culas ou subunidades de diferentes
tamanhos.

P�gina 124

O RNAm associa-se � subunidade menor do ribossomo. Os RNAt, cada qual unido ao seu
respectivo amino�cido, unem-se � subunidade maior do ribossomo, a qual apresenta
dois locais espec�ficos conhecidos como s�tio A e s�tio P. Nessa subunidade maior,
localiza-se a enzima peptidiltransferase, cuja fun��o � catalisar a liga��o
pept�dica entre os amino�cidos que se acoplam ao RNAm depois que eles se posicionam
corretamente, de acordo com a sequ�ncia de c�dons. (Fig. 6.19)

ILUSTRA��ES: ADILSON SECCO


Figura 6.19 No lado esquerdo da ilustra��o, representa��o esquem�tica das etapas
que levam � forma��o de uma liga��o pept�dica. Os dois amino�cidos trazidos por
seus respectivos RNAt e posicionados sobre os c�dons do RNAm s�o unidos pela a��o
da enzima peptidiltransferase, presente no ribossomo. No lado direito, as f�rmulas
qu�micas dos amino�cidos que se unem. (Elementos fora de propor��o de tamanho entre
si; cores-fantasia.)
A s�ntese da cadeia polipept�dica
A s�ntese de uma cadeia polipept�dica consiste na uni�o de amino�cidos de acordo
com a sequ�ncia de c�dons do RNAm. Como essa sequ�ncia � determinada pela sequ�ncia
de bases do DNA transcrita para o RNAm, a s�ntese de prote�nas representa, em
�ltima inst�ncia, a "tradu��o" da informa��o gen�tica, sendo, por isso, chamada
tradu��o g�nica. (Fig. 6.20)

Figura 6.20 A sequ�ncia de bases de uma das cadeias do DNA � transcrita na forma de
uma mol�cula de RNAm, que, por sua vez, � traduzida em uma cadeia polipept�dica.
Cada trinca de bases no RNAm (c�don) corresponde a um amino�cido na prote�na. As
abreviaturas indicam os amino�cidos: triptofano (Trp), fenilalanina (Phe), glicina
(Gly) e serina (Ser). (Elementos fora de propor��o de tamanho entre si; cores-
fantasia.) (Elaborada com base em Campbell, N. e cols., 1999.)

P�gina 125

No processo de tradu��o g�nica participam, entre outros fatores, um ribossomo, um


RNAm, v�rios RNAt, amino�cidos e diversas enzimas. O ribossomo encaixa-se em uma
das extremidades do RNAm e se desloca percorrendo-o em dire��o � outra extremidade.
� medida que esse deslocamento ocorre, os RNAt v�o encaixando os amino�cidos na
sequ�ncia definida pela ordem dos c�dons do RNAm. Dessa forma, a informa��o
codificada pela sequ�ncia de bases do RNAm vai sendo traduzida na sequ�ncia de
amino�cidos da prote�na, isto �, em sua estrutura prim�ria. Acompanhe, com mais
detalhes, as principais etapas da tradu��o g�nica.
In�cio da s�ntese da cadeia polipept�dica
A s�ntese de um polipept�dio tem in�cio com a associa��o entre um ribossomo, um
RNAm e o RNAt que transporta o amino�cido metionina. O antic�don da metionina �
UAC, emparelhando-se ao c�don AUG localizado perto da extremidade inicial da
mol�cula de RNAm. Esse primeiro c�don (AUG) de um RNAm � chamado de c�don de in�cio
de tradu��o, uma vez que determina o in�cio da informa��o para a cadeia
polipept�dica.
Crescimento da cadeia polipept�dica
O local do ribossomo onde se encaixa o primeiro RNAt, correspondente ao c�don de
in�cio de tradu��o, � chamado de s�tio P; durante a s�ntese da prote�na, ele ser�
ocupado pelo RNAt que carrega a cadeia polipept�dica em forma��o. Junto ao s�tio P
do ribossomo, localiza-se o s�tio A, no qual se aloja o RNAt que traz o pr�ximo
amino�cido a ser incorporado na cadeia polipept�dica.
Com o primeiro RNAt encaixado ao s�tio P, o segundo RNAt aloja-se no s�tio A. O
antic�don desse segundo RNAt ser� complementar ao segundo c�don codificador do
RNAm, posicionado no s�tio A. Por exemplo, se o c�don do RNAm no s�tio A for UUU, o
RNAt que se encaixar� tem antic�don AAA e transporta o amino�cido fenilalanina
(Phe). (Fig. 6.21)

ADILSON SECCO
Figura 6.21 Representa��o esquem�tica do in�cio da s�ntese de uma prote�na. O
ribossomo associa-se ao RNAm; o primeiro RNAt, transportando o amino�cido
metionina, ocupa o s�tio P. O segundo RNAt, transportando fenilalanina, ocupa o
s�tio A; os dois amino�cidos unem-se pela liga��o pept�dica. O ribossomo desloca-se
uma trinca sobre o RNAm e o processo se repete. (Elementos fora de propor��o de
tamanho entre si; cores-fantasia.)
Assim que os dois primeiros RNAt se encaixam aos s�tios P e A do ribossomo, ocorre
a liga��o entre os amino�cidos e o desligamento do primeiro RNAt do amino�cido que
ele transportava. Com isso, o RNAt que transportava a metionina desprende-se do
RNAm e abandona o ribossomo. Simultaneamente, o ribossomo desloca-se sobre a
mol�cula de RNAm, dando um "passo" correspondente a uma trinca de bases. O RNAt que
ocupava o s�tio A passa a ocupar, ent�o, o s�tio P; esse RNAt transporta agora dois
amino�cidos unidos por liga��o pept�dica (dipept�dio).
Com o deslocamento do ribossomo, o s�tio A torna-se dispon�vel para a entrada do
pr�ximo RNAt, que se encaixa ao terceiro c�don da sequ�ncia codificadora do RNAm.

P�gina 126

Novamente, o ribossomo catalisa a separa��o do dipept�dio do RNAt que ocupava o


s�tio P e sua liga��o ao amino�cido rec�m-chegado, transportado pelo RNAt ocupante
do s�tio A. Mais uma vez, o ribossomo d� um "passo" correspondente a uma trinca de
bases; o RNAt desligado dos amino�cidos se solta e o s�tio P passa a ser ocupado
pelo RNAt que antes ocupava o s�tio A. Esse RNAt transporta agora um tripept�dio,
ou seja, uma cadeia de tr�s amino�cidos. O s�tio A, localizado sobre o quarto c�don
da sequ�ncia, torna-se dispon�vel para receber o pr�ximo RNAt, com seu respectivo
amino�cido. � medida que o ribossomo se desloca sobre o RNAm, a cadeia
polipept�dica cresce. (Fig. 6.22)

ILUSTRA��ES: ADILSON SECCO


Figura 6.22 A. De cima para baixo, representa��o dos est�gios sucessivos do
encadeamento dos amino�cidos para formar a prote�na. A sequ�ncia de c�dons do RNAm
determina a ordem em que os amino�cidos se unem. B. Vis�o geral do processo de
s�ntese de prote�nas que ocorre no ribossomo, desde o momento em que ele se une ao
RNAm (1) at� que suas subunidades se separam (5), liberando a prote�na
completamente formada. (Elementos fora de propor��o de tamanho entre si; cores-
fantasia.)

P�gina 127

T�rmino da s�ntese da cadeia polipept�dica


O �ltimo est�gio da s�ntese de um polipept�dio ocorre quando o ribossomo chega a um
c�don de parada, um dos tr�s para os quais n�o h� amino�cido correspondente. Quando
isso ocorre, o s�tio A do ribossomo � ocupado por uma prote�na denominada fator de
libera��o. Todos os participantes do processo se separam, liberando, ent�o, a
cadeia polipept�dica formada.
Ao percorrer a extens�o da mol�cula de RNAm, o ribossomo promove a s�ntese de uma
�nica cadeia polipept�dica. Entretanto, � medida que um ribossomo se desloca sobre
o RNAm, traduzindo-o, outro ribossomo pode se associar ao mesmo RNAm e iniciar a
s�ntese de outra cadeia polipept�dica. Esta ser� exatamente id�ntica � produzida
pelo outro ribossomo.
� comum encontrar entre dez e vinte ribossomos traduzindo simultaneamente um mesmo
RNAm. Cada um deles apresenta uma cadeia polipept�dica em forma��o, cujo tamanho
depende do trecho j� percorrido no RNAm. O conjunto formado por v�rios ribossomos
traduzindo simultaneamente um mesmo RNAm � denominado polirribossomo ou polissomo.
(Fig. 6.23)

ILUSTRA��ES: ADILSON SECCO


Figura 6.23 Representa��o esquem�tica de um polirribossomo. Uma mol�cula de RNAm �
percorrida simultaneamente por diversos ribossomos, todos eles sintetizando cadeias
polipept�dicas id�nticas. (Elementos fora de propor��o de tamanho entre si; cores-
fantasia.)
P�gina 128

ATIVIDADES
Revendo conceitos, fatos e processos
Registre em seu caderno
Escreva, em seu caderno, o termo abaixo que substitui corretamente a tarja entre
par�nteses das frases de 1 a 4.
a) c�lula diploide
b) c�lula haploide
c) gene
d) genoma
1. O conjunto total de mol�culas de DNA caracter�stico de uma esp�cie, incluindo os
trechos sem informa��o gen�tica, constitui o(a) (.....).
2. A presen�a de pares de cromossomos hom�logos caracteriza um(a) (.....).
3. O(A) (.....) apresenta apenas um representante de cada tipo cromoss�mico.
4. O segmento de DNA denominado (.....) cont�m informa��o para a s�ntese de uma
prote�na.
5. Cromossomos hom�logos s�o aqueles que
a) diferem entre os sexos.
b) est�o presentes tanto em machos quanto em f�meas.
c) apresentam genes equivalentes, localizados nas mesmas posi��es relativas.
d) distinguem c�lulas som�ticas de gametas.
6. O evento denominado fase S da interfase � definido pelo(a)
a) condensa��o dos cromossomos.
b) desaparecimento dos nucl�olos.
c) duplica��o do DNA cromoss�mico.
d) s�ntese de RNA riboss�mico.
Relacione cada uma das fases do ciclo celular, listadas a seguir, a um evento
caracter�stico, apresentado nas quest�es 7 a 13.
a) an�fase
b) fase S da interfase
c) met�fase
d) pr�fase
e) tel�fase
7. Um dos eventos t�picos da (.....) � a reconstitui��o das cariotecas, com
forma��o dos n�cleos-filhos.
8. A (.....) tem in�cio com a condensa��o dos cromossomos.
9. O evento que caracteriza a (.....) da mitose � a separa��o das crom�tides-irm�s
para polos celulares opostos.
10. O desaparecimento dos nucl�olos ocorre na (.....).
11. A placa equatorial, em que os cromossomos est�o alinhados na regi�o mediana da
c�lula, � caracter�stica da (.....).
12. O que caracteriza a (.....) � a duplica��o do DNA dos cromossomos.
13. Os nucl�olos, que desaparecem no in�cio da mitose, reaparecem na (.....).
14. O cari�tipo humano normal apresenta
a) 23 pares de autossomos e 1 par de cromossomos sexuais.
b) 22 pares de autossomos e 1 par de cromossomos sexuais.
c) 45 pares de autossomos e 1 par de cromossomos sexuais.
d) 44 pares de autossomos e 2 pares de cromossomos sexuais.
15. Quantas crom�tides se espera encontrar em cada n�cleo celular humano na pr�fase
e na tel�fase da mitose, respectivamente?
a) 46 crom�tides; 23 crom�tides.
b) 46 crom�tides; 46 crom�tides.
c) 92 crom�tides; 46 crom�tides.
d) 92 crom�tides; 92 crom�tides.
16. O que significa dizer que as duas cadeias de uma mol�cula de DNA s�o
complementares?
a) Elas t�m os mesmos tipos de bases nitrogenadas.
b) Uma delas � formada apenas pelas bases A/T, e a outra, por C/G.
c) Onde houver A em uma delas, haver� U na outra; onde houver C em uma delas,
haver� G na outra.
d) Onde houver A em uma delas, haver� T na outra; onde houver C em uma delas,
haver� G na outra.
17. Um pesquisador descobriu que a sequ�ncia de bases de um trecho de uma mol�cula
de DNA � ATTACGAGGTACATTCG. Qual ser� a sequ�ncia de bases na cadeia complementar
no mesmo trecho?
a) ATTACGAGGTACATTCG.
b) GCCGTAGAACGTGCCTA.
c) TAATGCTCCATGTAAGC.
d) N�o pode ser determinada.

P�gina 129

18. Ao final da s�ntese de um polipept�dio, o que o ribossomo encontra na mol�cula


de RNA mensageiro que est� sendo traduzida?
a) Um c�don AUG.
b) Um dos tr�s c�dons de parada, para os quais n�o h� RNAt correspondentes.
c) Uma regi�o promotora.
d) Uma sequ�ncia de t�rmino de transcri��o.
19. Onde � sintetizada uma cadeia polipept�dica?
a) Em apenas um ribossomo, que se desloca sobre o RNA mensageiro desde um c�don AUG
at� um c�don de parada.
b) Em apenas um ribossomo, que se desloca sobre o RNA mensageiro desde a regi�o
promotora at� um antic�don.
c) Em in�meros ribossomos, que se disp�em em sequ�ncia sobre o RNA mensageiro, cada
um deles associado a um c�don.
d) Em in�meros ribossomos, que se disp�em em sequ�ncia sobre o RNA mensageiro, cada
um deles associado a dois c�dons vizinhos.
Quest�es para exercitar o pensamento
Registre em seu caderno
20. Justifique ou conteste a seguinte afirma��o: "C�lulas procari�ticas n�o t�m
n�cleo; como as hem�cias humanas n�o t�m n�cleo, elas s�o, portanto, c�lulas
procari�ticas".
21. Releia a abertura do cap�tulo, que trata da clonagem da ovelha Dolly. �
poss�vel que voc� tenha notado que os pesquisadores do Instituto Rosling escolheram
ovelhas de caracter�sticas bem distintas como doadoras do n�cleo - Belinda =
Finnish-Dorset - e do citoplasma - Fluffy = Scottish Blackface. O que ser� que eles
pretendiam com isso? Troque ideias com os colegas e o professor a respeito e
registre suas conclus�es.
22. O gr�fico a seguir representa a varia��o do conte�do de DNA por n�cleo no
decorrer do ciclo celular de uma c�lula eucari�tica. Analise-o e identifique o
significado das siglas T1, T2, T3 e T4.

ADILSON SECCO
23. A sequ�ncia ACUGACAUGUUACUCACUAUUUGACAGGUAA representa uma mol�cula de RNA
mensageiro cuja tradu��o ocorre da esquerda para a direita.
Tendo como base a tabela de c�digo gen�tico apresentada neste cap�tulo, determine:
a) o c�don a partir do qual ser� iniciada a cadeia polipept�dica;
b) o �ltimo c�don com amino�cido correspondente na cadeia polipept�dica;
c) a sequ�ncia de amino�cidos da cadeia polipept�dica codificada por esse RNA.
24. Escreva a sequ�ncia de bases das duas cadeias do DNA a partir do qual foi
transcrito o RNA mencionado na quest�o anterior, indicando qual das cadeias foi
transcrita pela polimerase do RNA.
25. Quais seriam os efeitos no RNA mensageiro e no polipept�dio traduzido se o 16�
par de bases (T = A) do DNA da quest�o anterior fosse trocado pelo par C ? G?
(Utilize a tabela de c�digo gen�tico para responder a esta quest�o.)
26. Quais seriam os efeitos no RNA mensageiro e no polipept�dio se o 16� par de
nucleot�dios do DNA da quest�o 24 fosse eliminado da mol�cula? (Utilize a tabela de
c�digo gen�tico para responder a esta quest�o.)
Fa�a voc� mesmo!
Registre em seu caderno
27. Constru��o de modelos: Simulando os eventos da mitose
Nesta atividade, voc� e seus colegas representar�o os cromossomos usando modelos de
massa de modelar (ou de outro material); o objetivo � simular, passo a passo, o
processo de mitose, facilitando sua compreens�o. Sugerimos trabalhar em grupos de
tr�s ou quatro alunos, para que haja troca de ideias durante a elabora��o dos
modelos. Aproveite a atividade para refor�ar os conceitos de c�lula diploide,
cromossomos hom�logos, crom�tide e centr�mero.
Se poss�vel, fotografe as etapas da simula��o da divis�o celular e monte um painel
ou uma apresenta��o de slides com a sequ�ncia, identificando cada etapa.
Alternativamente, voc� pode utilizar fotografias ou v�deos desta atividade para
criar uma pequena anima��o sobre o processo de divis�o celular. Essa anima��o pode
ser exibida para a turma ou disponibilizada na internet.
Material
- massa de modelar (ou barbantes grossos) de pelo menos quatro cores diferentes;
- folhas grandes de papel de embrulho;
- gr�os de lentilha ou de feij�o pequeno;
- opcional: c�mera fotogr�fica.

P�gina 130

Procedimento
1. Forre a mesa de trabalho com uma folha de papel de embrulho e desenhe sobre ela
um c�rculo grande para representar os limites da c�lula.
2. Com a massa de modelar, represente um par de cromossomos metac�ntricos e um par
de cromossomos acroc�ntricos, usando uma cor para cada cromossomo. Uma c�lula com
apenas esses cromossomos teria n�mero diploide 2n = 4.
3. Os cromossomos metac�ntricos devem ser representados por dois rolinhos com
aproximadamente 10 cm de comprimento e 0,5 cm de di�metro.
4. Os outros dois rolinhos, um pouco mais curtos que os primeiros, representam o
par de cromossomos acroc�ntricos.
5. Utilize um gr�o de lentilha ou de feij�o para representar o centr�mero de cada
par de cromossomos.
6. Coloque os modelos de cromossomos sobre a folha de papel de embrulho e d� in�cio
� atividade. O primeiro passo consiste em representar a duplica��o dos cromossomos,
fazendo novos rolinhos, id�nticos aos anteriores, e unindo-os aos cromossomos
correspondentes pela regi�o do centr�mero.
7. Distribua os modelos de cromossomos duplicados sobre a folha de papel de
embrulho, simulando a met�fase.
8. Represente, em seguida, a separa��o das crom�tides-irm�s na an�fase. Para isso,
separe as crom�tides de cada cromossomo e use mais uma lentilha ou um feij�o para
recompor o centr�mero, que tamb�m se duplica.
9. Prossiga a simula��o, separando as crom�tides de cada cromossomo e carregando-as
para polos opostos da c�lula. Para isso, amarre uma linha �s regi�es centrom�ricas
dos cromossomos, de modo a pux�-los apenas pelos centr�meros. Isso permite notar
que a forma dobrada que os cromossomos assumem, durante sua migra��o para polos
opostos, resulta do fato de eles serem puxados apenas pela regi�o do centr�mero.
10. Finalize a simula��o representando a citocinese.
28. Atividade de laborat�rio: Extraindo DNA de cebola
Apresentamos aqui uma t�cnica simples de extra��o de DNA de bulbo de cebola. Apesar
de simplificados, os procedimentos empregados s�o equivalentes aos utilizados em
laborat�rios bioqu�micos.
Material
- uma cebola grande;
- faca de cozinha;
- 3 copos tipo americano;
- 1 colher de sopa e 1 colher de caf�;
- panela de �gua em banho-maria (cerca de 60 �C);
- �gua filtrada;
- sal de cozinha;
- detergente de lavar lou�a;
- �lcool et�lico a 95%, gelado (mantido por uma noite no congelador);
- bast�o fino de vidro ou de madeira;
- coador de caf� de papel;
- gelo mo�do.
Procedimento
1. Pique a cebola em peda�os bem pequenos, com menos de 0,5 cm2.
2. Coloque quatro colheres (de sopa) de detergente e uma colher (de caf�) de sal em
meio copo com �gua, mexendo at� os componentes se dissolverem completamente.
3. Coloque a cebola picada no copo com a solu��o de detergente e sal e leve ao
banho-maria por cerca de 15 minutos.
4. Retire a mistura do banho-maria e resfrie-a rapidamente, colocando o copo no
gelo durante cerca de 5 minutos.
5. Coe a mistura no coador de caf�, recolhendo o filtrado em um copo limpo.
6. Cuidadosamente, adicione ao filtrado cerca de meio copo de �lcool gelado.
Despeje o �lcool fazendo-o escorrer vagarosamente pela borda do copo. Voc� vai
notar que se formar�o duas fases, a superior, alco�lica, e a inferior, aquosa.
7. Mergulhe o bast�o no copo e, com movimentos circulares, misture as fases.
Formam-se fios esbranqui�ados que s�o aglomerados de mol�culas de DNA.
Quest�es
1. Qual � o papel do detergente nesse procedimento?
2. Qual � o papel do �lcool e do sal nesse procedimento? Fa�a uma pesquisa sobre
isso e resuma as informa��es encontradas.
29. Trabalhando com modelos: Simulando a s�ntese de prote�nas
Nesta atividade, vamos simular, passo a passo, os mecanismos que levam ao
encadeamento dos amino�cidos da prote�na sob o comando do RNA mensageiro e, em
�ltima an�lise, do DNA que os transcreveu. Realize esta atividade em grupo e, se
poss�vel, filme ou fotografe a simula��o para manter um registro dela. Esse
material pode ser utilizado para criar uma anima��o sobre a s�ntese de prote�nas,
que voc�s podem divulgar na internet por meio de blogs ou redes sociais.

P�gina 131

Material
- tesoura;
- cola (de prefer�ncia em bast�o);
- miniclipes;
- reprodu��o (escaneada ou xerocopiada) das p�ginas 134 e 135;
- tabela de codifica��o gen�tica (consulte a do livro na p�gina 122);
- painel de isopor ou de corti�a (opcional);
- alfinetes de mapa ou percevejos (opcional);
- l�pis de cor ou canetas hidrogr�ficas coloridas (opcional);
- c�mera filmadora ou fotogr�fica (opcional).
Procedimento inicial
Pegue a reprodu��o das p�ginas 134 e 135 e recorte os elementos nelas
representados: RNAm, ribossomo, amino�cidos, RNAt e fator de libera��o. Note que o
RNAm est� dividido em dois peda�os, que precisam ser unidos com cola. Se quiser,
voc� pode colorir as partes para torn�-las mais facilmente identific�veis.
Alternativamente, voc� poder� fazer seus pr�prios desenhos com base nos modelos.
A montagem do modelo pode ser feita sobre uma superf�cie plana ou fixando as pe�as
em um painel de isopor ou de corti�a com alfinetes de mapa ou percevejos.
Simula��o
- Sua primeira tarefa � encontrar o RNAt correspondente a cada amino�cido, unindo-
os com os miniclipes. Consulte a tabela de codifica��o gen�tica para estabelecer a
correspond�ncia, lembrando que ela se refere aos c�dons (trincas de bases no RNAm)
dos amino�cidos. Assim, ser� necess�rio "traduzir" os c�dons para os antic�dons do
RNAt. Por exemplo, se o c�don para a metionina � AUG, a trinca do RNAt
correspondente � UAC.
- Alinhe o RNAm na subunidade menor do ribossomo de maneira que o c�don de in�cio
fique exatamente abaixo do s�tio P, na subunidade maior do ribossomo. Encaixe o
RNAt da metionina no s�tio P do ribossomo de modo que seu antic�don se encaixe ao
c�don de in�cio. Esse encaixe marca o in�cio da s�ntese da prote�na.
- Encaixe o RNAt que corresponde ao c�don localizado sob o s�tio A. O amino�cido
transportado por esse RNAt ser� o segundo da cadeia polipept�dica. Solte a
metionina de seu RNAt e prenda com um miniclipe sua extremidade carboxila (cinza) �
extremidade amina (branca) do segundo amino�cido.
- Deslize com cuidado o ribossomo para a direita. Percorra uma dist�ncia
correspondente a tr�s bases, mantendo encaixados os c�dons e os antic�dons. O RNAt
da metionina fica fora do ribossomo e desliga-se do RNAm; o segundo RNAt, com os
dois amino�cidos unidos, passa a ocupar o s�tio P; o s�tio A fica vazio. Encaixe o
RNAt que corresponde ao c�don localizado sob o s�tio A. Solte a dupla de
amino�cidos (dipept�dio) do RNAt localizado no s�tio P e prenda a extremidade
carboxila livre � extremidade amina do terceiro amino�cido.
- Repita o procedimento anterior at� que o c�don de t�rmino passe a ocupar o s�tio
A do ribossomo. O encaixe do fator de libera��o determina o fim da mensagem
gen�tica para a prote�na, que se desliga do �ltimo RNAt. A ilustra��o a seguir
esquematiza simplificadamente todo o procedimento.

ILUSTRA��ES: ADILSON SECCO


Representa��o esquem�tica do procedimento.

P�gina 132

A Biologia no vestibular e no Enem


Registre em seu caderno
Quest�es objetivas
1. (Unir-RO) Qual das seguintes estruturas celulares � respons�vel pela forma��o
dos ribossomos?
a) Ret�culo endoplasm�tico.
b) Complexo de Golgi.
c) Centr�olo.
d) Nucl�olo.
e) Lisossomo.
2. (UFRGS-RS) O desenho abaixo representa um cromossomo da esp�cie humana.

OSVALDO SEQUETIN
Como se chama a regi�o indicada pela seta? De que subst�ncia ela � formada?
a) crom�tide - DNA.
b) centr�mero - RNA.
c) crom�tide - RNA.
d) cromossomos - RNA.
e) centr�mero - DNA.
3. (Fuvest-SP) No processo de divis�o celular por mitose, chamamos de c�lula-m�e
aquela que entra em divis�o e de c�lulas-filhas as que se formam como resultado do
processo. Ao final da mitose de uma c�lula, t�m-se
a) duas c�lulas, cada uma portadora de metade do material gen�tico que a c�lula-m�e
recebeu de sua genitora e a outra metade, rec�m-sintetizada.
b) duas c�lulas, uma delas com material gen�tico que a c�lula-m�e recebeu de sua
genitora e a outra c�lula com material gen�tico rec�m-sintetizado.
c) tr�s c�lulas, ou seja, a c�lula-m�e e duas c�lulas-filhas, estas �ltimas com
metade do material gen�tico que a c�lula-m�e recebeu de sua genitora e a outra
metade, rec�m-sintetizada.
d) tr�s c�lulas, ou seja, a c�lula-m�e e duas c�lulas-filhas, estas �ltimas
contendo material gen�tico rec�m-sintetizado.
e) quatro c�lulas, duas com material gen�tico rec�m-sintetizado e duas com material
gen�tico que a c�lula-m�e recebeu de sua genitora.
4. (UFPA) O per�odo que precede a mitose � denominado de interfase. Nessa fase
ocorre a duplica��o do DNA, evento que garante a transmiss�o das informa��es
existentes na c�lula original para cada uma das c�lulas-filhas. A duplica��o do DNA
origina a forma��o de pares de
a) crom�tides-irm�s presas uma � outra pelo centr�mero.
b) cromossomos hom�logos ligados pelos quiasmas.
c) nucl�olos portadores de genes alelos.
d) cromossomos duplos, cada um com uma crom�tide.
e) cromatinas diploides dispersas no nucl�olo.
5. (UFPA) Em 1953, Watson e Crick decifraram que a estrutura da mol�cula de DNA
(�cido desoxirribonucleico) � uma dupla-h�lice, respons�vel pelas caracter�sticas
dos organismos. Com os conhecimentos atuais, julgue as afirmativas sobre a mol�cula
de DNA.
I. Na autoduplica��o da mol�cula de DNA, cada filamento original serve de molde
para a s�ntese de um novo filamento (duplica��o semiconservativa).
II. A base nitrogenada adenina emparelha-se com a citosina, enquanto a timina
emparelha-se com a guanina.
III. As bases nitrogenadas dos dois filamentos est�o unidas por liga��es
denominadas pontes de hidrog�nio.
Est�(�o) correta(s) a(s) afirmativa(s)
a) I somente.
b) II somente.
c) I e II.
d) I e III.
e) II e III.
6. (Enem-MEC) Um fabricante afirma que um produto dispon�vel comercialmente possui
DNA vegetal, elemento que proporcionaria melhor hidrata��o dos cabelos.
Sobre as caracter�sticas qu�micas dessa mol�cula essencial � vida, � correto
afirmar que o DNA
a) de qualquer esp�cie serviria, j� que tem a mesma composi��o.
b) de origem vegetal � diferente quimicamente dos demais, pois possui clorofila.
c) das bact�rias poderia causar muta��es no couro cabeludo.
d) dos animais se encontra sempre enovelado e � de dif�cil absor��o.
e) de caracter�sticas b�sicas assegura sua efici�ncia hidratante.

ADILSON SECCO
7. (UFC-CE) Sobre os diferentes pap�is dos �cidos nucleicos na s�ntese de
prote�nas, podemos afirmar corretamente que
a) a sequ�ncia de bases no DNA determina a se qu�ncia de amino�cidos na cadeia
polipept�dica.
b) a posi��o dos amino�cidos na cadeia polipept�dica depende da sequ�ncia de bases
do RNAt.
c) o transporte de amino�cidos para o local da s�ntese � feito pelo RNAm.
d) a sequ�ncia de bases do RNAr � transcrita a partir do c�digo do RNAm.
e) a extremidade livre dos diversos RNAt tem sequ�ncias de bases diferentes.

P�gina 133

8. (UFSCar-SP) Um pesquisador, interessado em produzir em tubo de ensaio uma


prote�na nas mesmas condi��es em que essa s�ntese ocorre nas c�lulas, utilizou
ribossomos de c�lulas de rato, RNA mensageiro de c�lulas de macaco, RNA
transportador de c�lulas de coelho e amino�cidos ativos de c�lulas de sapo. A
prote�na produzida teria uma sequ�ncia de amino�cidos id�ntica � do
a) rato.
b) sapo.
c) coelho.
d) macaco.
e) macaco e do rato.
9. (Fuvest-SP) Quando afirmamos que o metabolismo da c�lula � controlado pelo
n�cleo celular, isso significa que
a) todas as rea��es metab�licas s�o catalisadas por mol�culas e componentes
nucleares.
b) o n�cleo produz mol�culas que, no citoplasma, promovem a s�ntese de enzimas
catalisadoras das rea��es metab�licas.
c) o n�cleo produz e envia, para todas as partes da c�lula, mol�culas que catalisam
as rea��es metab�licas.
d) dentro do n�cleo, mol�culas sintetizam enzimas catalisadoras das rea��es
metab�licas.
e) o conte�do do n�cleo passa para o citoplasma e atua diretamente nas fun��es
celulares, catalisando as rea��es metab�licas.
10. (Fuvest-SP) Existe um n�mero muito grande de subst�ncias com fun��es
antibi�ticas. Essas subst�ncias diferem quanto � maneira pela qual interferem no
metabolismo celular. Assim, a tetraciclina liga-se aos ribossomos e impede a
liga��o do RNA transportador; a mitomicina inibe a a��o da polimerase do DNA e a
estreptomicina causa erros na leitura dos c�dons do RNA mensageiro. Essas
informa��es permitem afirmar que
I. a tetraciclina impede a transcri��o e leva a c�lula bacteriana � morte por falta
de RNA mensageiro.
II. a mitomicina, por inibir a duplica��o do DNA, impede a multiplica��o da c�lula
bacteriana.
III. a estreptomicina interfere na tradu��o e leva a c�lula bacteriana a produzir
prote�nas defeituosas.
Das afirmativas acima
a) apenas I � correta.
b) apenas I e II s�o corretas.
c) apenas II e III s�o corretas.
d) apenas I e III s�o corretas.
e) I, II e III s�o corretas.
Quest�es discursivas
11. (UFRJ) Num laborat�rio, o n�cleo de uma c�lula da esp�cie A foi retirado e
implantado numa c�lula-ovo da esp�cie B, cujo n�cleo havia sido previamente
removido. Caso essa c�lula-ovo se desenvolvesse at� a forma��o de um novo
indiv�duo, ele teria as caracter�sticas da esp�cie A ou da esp�cie B? Justifique
sua resposta.
12. (Unicamp-SP) O esquema abaixo representa tr�s fases do ciclo celular de uma
c�lula som�tica de um organismo diploide.

CAN�ADO
Adaptado de Hernandes Faustino de Carvalho e Shirlei Maria Recco-Pimentel. A
c�lula. Manole, 2007. p. 380.
a) Qual � o n�mero de cromossomos em uma c�lula haploide do organismo em quest�o?
Justifique sua resposta.
b) Identifique se a c�lula representada � de um animal ou de uma planta. Aponte
duas caracter�sticas que permitam fazer sua identifica��o. Justifique.
13. (UFRJ) A soma das porcentagens de guanina e citosina em certa mol�cula de ADN �
igual a 58% do total de bases presentes.
a) Indique as porcentagens das quatro bases, adenina (A), citosina (C), guanina (G)
e timina (T), nessa mol�cula.
b) Explique por que � imposs�vel prever a propor��o de citosina presente no ARN
mensageiro codificado por esse trecho de ADN.
14. (Unicamp-SP) Em 25 de abril de 1953, um estudo de uma �nica p�gina na revista
inglesa Nature intitulado "A estrutura molecular dos �cidos nucleicos", quase
ignorado de in�cio, revolucionou para sempre todas as ci�ncias da vida, sejam elas
do homem, rato, planta ou bact�ria. James Watson e Francis Crick descobriram a
estrutura do DNA, que permitiu posteriormente decifrar o c�digo gen�tico
determinante para a s�ntese proteica.
a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada
retorcida. Explique a que correspondem os "corrim�os" e os "degraus" dessa escada.
b) Que rela��o existe entre DNA, RNA e s�ntese proteica?
c) Como podemos diferenciar duas prote�nas?
15. (Fuvest-SP) Uma altera��o no DNA pode modificar o funcionamento de uma c�lula?
Por qu�?
16. (Unicamp-SP) Ribossomos s�o formados por RNA e prote�nas, sintetizados pelos
processos de transcri��o e tradu��o, respectivamente.
a) Onde esses processos ocorrem na c�lula eucari�tica?
b) O que acontecer� com os processos de transcri��o e tradu��o se ocorrer uma
inativa��o na regi�o organizadora do nucl�olo? Justifique.

P�gina 134

Reproduzir esta p�gina para realiza��o da atividade 29 do Fa�a voc� mesmo!

ILUSTRA��ES: ADILSON SECCO


N�o recorte esta p�gina. Ela deve ser reproduzida (escaneada ou xerocopiada).

P�gina 135

Reproduzir esta p�gina para realiza��o da atividade 29 do Fa�a voc� mesmo!

ILUSTRA��ES: ADILSON SECCO

P�gina 136

M�dulo 3 Metabolismo energ�tico


Conhe�a os cap�tulos deste m�dulo
Neste m�dulo, abordamos um tema fundamental para a vida na Terra: energia. Os
sistemas biol�gicos demandam a inje��o cont�nua de energia, que � transformada e
dissipada como calor nos processos metab�licos. Trata-se de um assunto de alto
valor estrat�gico atualmente, em virtude da busca por fontes alternativas de
energia.
Cap�tulo 7
O Sol � a fonte de energia para quase todos os seres vivos da Terra. A energia
luminosa entra nos sistemas vivos pela fotoss�ntese, um processo altamente
eficiente de convers�o de energia luminosa em energia qu�mica, a qual fica
armazenada nas subst�ncias org�nicas. Veremos que todos os seres vivos compartilham
da mesma "moeda energ�tica", o ATP, subst�ncia org�nica especializada na
transfer�ncia de energia entre as rea��es qu�micas. A quimioss�ntese, realizada
apenas por certas bact�rias e arqueas, permite obter energia a partir de rea��es de
oxida��o de subst�ncias inorg�nicas. Esse pode ter sido o primeiro modo de obten��o
de energia na hist�ria da vida na Terra.
Cap�tulo 8
A maioria dos seres vivos produz o ATP de que necessita pela respira��o celular,
processo em que o g�s oxig�nio � o oxidante final das transforma��es de mol�culas
org�nicas em CO2 e H2O. A fermenta��o, por sua vez, � um processo de produ��o de
ATP sem utiliza��o de g�s oxig�nio, empregado principalmente por certos fungos e
bact�rias. Nossas c�lulas, em determinadas situa��es, realizam fermenta��o, se n�o
houver g�s oxig�nio suficiente para sustentar a atividade celular demandada pelo
corpo.

P�gina 137

DR. GEORGE CHAPMAN, VISUALS UNLIMITED/SCIENCE PHOTO LIBRARY/LATINSTOCK


Cloroplasto obtido de uma c�lula vegetal. (Microsc�pio eletr�nico de transmiss�o;
aumento ? 60.000�; cores artificiais.)
Cap�tulo 7 Fotoss�ntese e quimioss�ntese
Itens principais:
- Energia para a vida
- O processo da fotoss�ntese
- Quimioss�ntese

DEBRA FERGUSON/AGSTOCK IMAGES/ CORBIS/LATINSTOCK


Cap�tulo 8 Fermenta��o e respira��o aer�bica
Itens principais:
- Fermenta��o como forma de obter energia
- A respira��o aer�bica

DAVID BLAIR/ZUMA PRESS/CORBIS/LATINSTOCK

P�gina 138

Cap�tulo 7 Fotoss�ntese e quimioss�ntese

DEBRA FERGUSON/AGSTOCK IMAGES/CORBIS/LATINSTOCK


Sabe-se, atualmente, que as plantas (com exce��o das plantas parasitas) produzem
seu pr�prio alimento a partir de energia luminosa e de subst�ncias simples obtidas
no ambiente: g�s carb�nico e �gua. Essas subst�ncias originam mol�culas org�nicas
ricas em energia, que sustentam as atividades vitais das plantas e dos outros seres
vivos. Na imagem, planta��o de algod�o (Estados Unidos, 2014).
Luzes sobre a fotoss�ntese
- Pai, o que a planta come?
- Planta n�o come, filho!
- E como ela cresce? Voc� sempre diz que se eu n�o comer n�o cres�o...
- Bom, ela tira tudo o que precisa do solo.
O que voc� acha da resposta dada pelo pai � d�vida do filho? No s�culo XVII, Jan
Baptista van Helmont (1579-1644), m�dico e fisiologista holand�s, descobriu que as
plantas tiram do solo apenas quantidades m�nimas de subst�ncias minerais, que n�o
correspondem ao aumento de massa durante o desenvolvimento do vegetal. Naquela
ocasi�o, Van Helmont atribuiu o crescimento das plantas principalmente � �gua que
elas absorvem do ambiente.
Hoje sabemos que as plantas realmente extraem do solo n�o apenas �gua, mas tamb�m
pequen�ssimas quantidades de nutrientes minerais. O conhecimento cient�fico sobre
esse tema permitiu desenvolver um m�todo de cultivo que tem sido amplamente
empregado em todo o mundo: a hidroponia. � poss�vel cultivar plantas sem solo,
desde que as ra�zes estejam mergulhadas em uma solu��o com nutrientes minerais
essenciais.

P�gina 139

Na segunda metade do s�culo XVIII descobriu-se que, al�m da �gua, as plantas


utilizam g�s carb�nico atmosf�rico como mat�ria-prima para sintetizar as
subst�ncias org�nicas necess�rias ao seu desenvolvimento. A energia para isso vem
da luz solar. Assim, surgiu e se desenvolveu o conceito de fotoss�ntese, processo
pelo qual certas bact�rias, algas e a grande maioria das plantas (exce��o feita
apenas �s plantas parasitas) produzem subst�ncias org�nicas a partir de mol�culas
de �gua e de g�s carb�nico, liberando g�s oxig�nio como subproduto. Talvez voc� j�
conhe�a a equa��o geral que resume a fotoss�ntese:
ReagentesProdutos
6 CO2 + 6 H2O ?"PLANTAS" ????"LUZ" C6H12O6 + 6 O2
G�s
�gua
Glic�dio
G�s
carb�nicooxig�nio
A equa��o pode dar a falsa impress�o de que a fotoss�ntese consiste em juntar
diretamente g�s carb�nico e �gua, em presen�a de luz, para obter glicose e g�s
oxig�nio. Esse processo, por�m, n�o � t�o simples assim; como voc� aprender� neste
cap�tulo, ocorrem dezenas de rea��es intermedi�rias at� a forma��o de glic�dios
ricos em energia como produtos finais. Uma das etapas-chave da fotoss�ntese
consiste em aproveitar a energia da luz para movimentar geradores proteicos
nanosc�picos, localizados nas membranas internas dos cloroplastos e capazes de
produzir mol�culas ricas em energia.
A fotoss�ntese � um m�todo altamente eficiente de convers�o de energia luminosa em
energia qu�mica; esta, por sua vez, supre o metabolismo de praticamente todos os
seres vivos do planeta. Nestes tempos em que se buscam fontes alternativas de
energia, esse � um assunto de alto valor estrat�gico. Os maiores especialistas
nessa �rea continuam sendo os seres fotossintetizantes. Neste cap�tulo, vamos
aprender um pouco com eles.
A import�ncia do assunto
Todos os seres vivos compartilham a mesma "moeda energ�tica" - o ATP -, uma
subst�ncia org�nica especializada na transfer�ncia de energia entre as rea��es
qu�micas celulares.
Uma atividade corriqueira da maioria das plantas - a fotoss�ntese -, que come�a ao
nascer do Sol e pode continuar noite adentro, � um jogo molecular de transfer�ncias
de energia das quais depende a nossa vida.
Outro assunto do cap�tulo � a quimioss�ntese, processo pelo qual certas bact�rias e
arqueas obt�m energia a partir de rea��es de oxida��o de subst�ncias inorg�nicas.
Esse pode ter sido o primeiro modo de obten��o de energia na hist�ria da vida na
Terra.
A efici�ncia dos seres vivos em lidar com a energia surpreende os tecn�logos, que
alimentam a esperan�a de um dia poder construir m�quinas capazes de gerenciar a
energia com efici�ncia pr�xima � do sistema vivo.
Ao aprender mais sobre esses temas, voc� poder� responder corretamente � pergunta
da abertura: "o que a planta come?". Pense na resposta enquanto estuda o cap�tulo.
7.1 Energia para a vida
A fonte prim�ria de energia utilizada pela maioria dos seres vivos � a luz solar.
Os seres fotossintetizantes (certas bact�rias, algas e a maioria das plantas)
captam a energia luminosa do Sol e, a partir dela, produzem glic�dios, um grupo de
subst�ncias org�nicas capazes de armazenar grandes quantidades de energia potencial
qu�mica.
Em uma vis�o simplificada, � como se a energia luminosa empregada na s�ntese da
mol�cula de glic�dio permanecesse "armazenada" nas liga��es qu�micas dessa
subst�ncia. O rearranjo das liga��es, quando as c�lulas decomp�em os glic�dios em
subst�ncias mais simples, permite que a energia seja disponibilizada para as
atividades vitais. Como veremos a seguir, esses processos de transfer�ncia de
energia que ocorrem nas c�lulas vivas s�o intermediados por um importante composto
qu�mico conhecido pela sigla ATP.

P�gina 140

ATP, a "moeda energ�tica" do mundo vivo


Praticamente todos os processos celulares demandam energia, que as c�lulas obt�m a
partir de mol�culas org�nicas que lhes servem de alimento. Nesse contexto, podemos
perguntar: como as c�lulas conseguem captar a energia proveniente do alimento,
armazen�-la temporariamente e disponibiliz�-la prontamente para os processos
metab�licos? Para responder a essas quest�es, vamos nos transportar ao mundo
molecular.
A estrat�gia energ�tica dos seres vivos consiste em transferir a energia liberada
na quebra do alimento para mol�culas armazenadoras, capazes de circular livremente
pela c�lula fornecendo energia aos processos vitais. O principal respons�vel pelo
armazenamento tempor�rio de energia intracelular � o trifosfato de adenosina,
subst�ncia conhecida pela sigla ATP (do ingl�s, adenosine triphosphate). Alguns
cientistas comparam o ATP a uma "moeda energ�tica", que circula dentro da c�lula e
custeia os gastos metab�licos.
Uma mol�cula de ATP resulta da uni�o qu�mica de tr�s componentes: uma base
nitrogenada, a adenina, um glic�dio de cinco carbonos, a ribose, e tr�s grupamentos
fosfato. A mol�cula formada por uma base nitrogenada e um glic�dio unida a um ou
mais fosfatos constitui um nucleot�dio.
Os grupos fosfatos do ATP est�o unidos entre si por liga��es covalentes que liberam
grande quantidade de energia quando se desfazem; por esse motivo, essas liga��es
entre os fosfatos do ATP s�o denominadas liga��es de alta energia, sendo
representadas pelo s�mbolo ~.
Quando o grupo fosfato terminal se separa do ATP, este se transforma em ADP
(difosfato de adenosina), um nucleot�dio com dois fosfatos. Por sua vez, ao ter seu
grupo fosfato terminal separado, o ADP transforma-se em AMP (monofosfato de
adenosina). (Fig. 7.1)

Figura 7.1 F�rmula estrutural do ATP. A parte da mol�cula formada pela adenina e
pela ribose � chamada adenosina.
O ATP � o principal fornecedor de energia para a realiza��o de atividades
celulares, entre elas a s�ntese de subst�ncias org�nicas e v�rios outros tipos de
atividades metab�licas. Por exemplo, o ATP fornece energia para que as prote�nas
transportadoras da membrana realizem o transporte ativo (relembre no cap�tulo 5).
Nas c�lulas musculares, � o ATP que fornece energia para o deslizamento de
filamentos proteicos uns sobre os outros, determinando a contra��o muscular. O ATP
tamb�m transfere energia para c�lios e flagelos, possibilitando que essas
estruturas se movimentem.
Outra importante fun��o do ATP � fornecer energia para as rea��es que levam �
s�ntese dos milhares de subst�ncias presentes nos seres vivos. Essas rea��es s�o
comandadas por enzimas que removem um fosfato terminal do ATP, transformando-o em
ADP. A quebra da liga��o entre os fosfatos libera energia, que � transferida para a
rea��o qu�mica em quest�o.

P�gina 141

7.2 O processo da fotoss�ntese


Vamos relembrar a equa��o geral da fotoss�ntese apresentada anteriormente: de um
lado, g�s carb�nico (CO2) e �gua (H2O), os reagentes do processo; de outro,
glic�dios (C6H12O6) e g�s oxig�nio (O2), os produtos. Como fonte de energia, a luz.
Nas c�lulas vegetais, a fotoss�ntese ocorre no interior dos cloroplastos, organelas
citoplasm�ticas que cont�m clorofila e pigmentos acess�rios respons�veis pela
capta��o da energia da luz, al�m de todos os outros participantes do processo
fotossint�tico: enzimas, coenzimas, cofatores etc. (relembre a fig. 5.20 no
cap�tulo 5). Nas bact�rias fotossintetizantes, a clorofila e outros pigmentos
fotossintetizantes localizam-se em estruturas membranosas presentes no citoplasma.
"Construindo" a equa��o da fotoss�ntese
Conhecer um pouco de hist�ria da ci�ncia ajuda-nos a entender como o conhecimento
cient�fico � "constru�do" pouco a pouco, como empreendimento coletivo de in�meros
cientistas. A elabora��o da equa��o da fotoss�ntese � um bom exemplo disso.
Acompanhe, a seguir, um pouco da hist�ria do conhecimento sobre a fotoss�ntese.
O primeiro pesquisador que estudou cientificamente a fotoss�ntese foi o qu�mico
ingl�s Joseph Priestley (1733-1804). Em um artigo de 1772, ele escreveu: "Fiquei
muito feliz ao encontrar acidentalmente um m�todo de restaurar o ar viciado pela
queima das velas e descobrir pelo menos um dos restauradores que a natureza emprega
para essa finalidade: a vegeta��o".
Sabia-se, naquela �poca, que a queima de velas ou a respira��o de animais em um
ambiente fechado "esgotavam o ar", tornando-o irrespir�vel e incompat�vel com a
vida. Priestley foi o primeiro a observar que, se uma planta fosse introduzida em
um ambiente com o "ar esgotado", depois de algum tempo o ar era restaurado e
tornava-se novamente respir�vel.
Ar "esgotado" ?(??PLANTAS) Ar "puro"
(irrespir�vel)
(respir�vel)
Essa descoberta causou grande impacto no mundo cient�fico da �poca; o fato de a
vegeta��o "restaurar" o ar explicava por que a atmosfera permanecia respir�vel, sem
se deteriorar com a respira��o de pessoas e de animais e com os processos de
combust�o.
Outro passo importante na elucida��o do processo da fotoss�ntese foi dado em 1779,
quando o m�dico holand�s Jan Ingen-Housz (1730-1799) descobriu que, para
"restaurar" o ar, as plantas precisavam ser iluminadas. Assim, acrescentou-se �
descoberta de Priestley um novo fator: a luz.
Ar "esgotado" ?(?"PLANTAS" ????"LUZ") Ar "puro"
(irrespir�vel)(respir�vel)
Os qu�micos logo descobriram que o ar esgotado pela respira��o dos animais continha
menos g�s oxig�nio (O2) e mais g�s carb�nico (CO2) que o ar atmosf�rico. As
plantas, na presen�a de luz, invertiam essa situa��o. O fen�meno descoberto por
Priestley passou a ser expresso, ent�o, de uma forma mais elaborada:
Ar rico em g�s carb�nico ?"PLANTAS" ????"LUZ" Ar rico em g�s oxig�nio
(CO2)
(O2)
A equa��o anterior sugere que as plantas decomp�em CO2 e liberam oxig�nio na forma
de O2. Mas onde teriam ido parar os �tomos de carbono?
Em 1796, Ingen-Housz prop�s a hip�tese de que as plantas usavam o carbono do CO2
para elaborar suas pr�prias subst�ncias org�nicas; esse seria o principal papel da
fotoss�ntese, segundo o cientista. Em sua opini�o, a libera��o de g�s oxig�nio era
apenas um subproduto do processo.
G�s carb�nico ?"PLANTAS" ????"LUZ" Compostos org�nicos + G�s oxig�nio
(CO2) (contendo �tomos de C)
(O2)

P�gina 142

Em 1804, o cientista su��o Nicolas Theodore de Saussere (1767-1845) mostrou que a


�gua (H2O) tamb�m participa da fotoss�ntese, juntamente com o g�s carb�nico (CO2)
do ar. A equa��o do processo foi novamente ampliada:
CO2 + H2O ?"PLANTAS" ????"LUZ" Compostos org�nicos + O2
G�s
�gua
(contendo �tomos de
C) G�s
carb�nico
oxig�nio

Em 1893, o pesquisador ingl�s Charles Barnes (1858-1910) prop�s a denomina��o de


fotossintaxe ou fotoss�ntese para o processo de s�ntese de compostos org�nicos a
partir de g�s carb�nico, em presen�a de clorofila e de luz. Barnes, pessoalmente,
preferia a primeira denomina��o, mas foi o termo fotoss�ntese que prevaleceu e se
tornou consagrado pelo uso.
Os estudiosos da fotoss�ntese supunham que a subst�ncia org�nica produzida nesse
processo era a glicose, um glic�dio com seis �tomos de carbono e f�rmula molecular
C6H12O6. Essa suposi��o fundamentava-se no fato de a glicose ser o glic�dio mais
utilizado no metabolismo de plantas e animais. A equa��o do processo passou, ent�o,
a ser escrita, em f�rmulas qu�micas, da seguinte maneira:
ReagentesProdutos
6 CO2 + 6 H2O ?"PLANTAS" ????"LUZ" C6H12O6 + 6 O2
G�s
�gua
Glic�dio
G�s
carb�nicooxig�nio
A equa��o anterior leva a pensar que os �tomos de oxig�nio presentes nas mol�culas
de O2 prov�m diretamente das mol�culas de CO2 e que os �tomos de hidrog�nio e de
oxig�nio presentes nos glic�dios (C6H12O6) prov�m das mol�culas de H2O. Entretanto,
n�o � esse o rearranjo de �tomos que ocorre na rea��o de fotoss�ntese, como veremos
a seguir.
Qual dos reagentes - g�s carb�nico ou �gua - fornece os �tomos de oxig�nio
constituintes das mol�culas de O2 produzidas na fotoss�ntese? A resposta come�ou a
ser delineada pelo bioqu�mico holand�s Cornelis van Niel (1897-1985). Por volta de
1930, ele estudava a fotoss�ntese realizada por sulfobact�rias p�rpura, organismos
autotr�ficos que utilizam em sua fotoss�ntese mol�culas de sulfeto de hidrog�nio
(H2S) em vez de �gua (H2O) e liberam no processo enxofre elementar (S) em vez de
g�s oxig�nio (O2). A partir desses estudos, o pesquisador sugeriu a seguinte
equa��o para a fotoss�ntese das sulfobact�rias p�rpura:
6 CO2 + 12 H2S ?(??LUZ) C6H12O6 + 12 S + 6 H2O
G�s
G�s Glic�dio
Enxofre
�gua
carb�nico sulf�drico

Partindo do pressuposto de que a fotoss�ntese dessas bact�rias era semelhante �


realizada pelas plantas, diferindo apenas quanto ao doador de hidrog�nios - H2S nas
sulfobact�rias e H2O nas plantas -, Van Niel prop�s que todos os �tomos do g�s
oxig�nio produzido na fotoss�ntese das plantas seriam provenientes da �gua. Assim,
a maneira mais completa de escrever a equa��o da fotoss�ntese seria:
6 CO2 + 12 H2O ?"PLANTAS" ????"LUZ" C6H12O6 + 6 O2 + 6 H2O
G�s
�guaGlic�dio
G�s
�gua
carb�nicooxig�nio

Na d�cada de 1940, um experimento engenhoso confirmou a hip�tese de Van Niel.


Pesquisadores da equipe do bioqu�mico estadunidense Melvin Calvin (1911-1997)
forneceram � alga verde Chlorella sp. mol�culas de �gua cujo oxig�nio era o is�topo
18O, chamado de oxig�nio "pesado" em virtude de sua massa at�mica ser maior que a
do is�topo "leve" (16O), mais comum na natureza. Como t�cnicas de laborat�rio
permitem diferenciar os dois is�topos, essa foi a maneira encontrada pelos
cientistas para "marcar" os �tomos de oxig�nio da �gua, de modo a poder distingui-
los dos �tomos de oxig�nio presentes no g�s carb�nico.

P�gina 143

Os pesquisadores verificaram que, quando a fotoss�ntese ocorria em um meio em que


todas as mol�culas de �gua continham 18O, somente o g�s oxig�nio (O2) formado
apresentava esse is�topo; n�o havia 18O nos glic�dios produzidos. A partir disso,
eles conclu�ram que todos os �tomos do g�s oxig�nio formado na fotoss�ntese prov�m
exclusivamente de mol�culas de �gua.
A s�ntese de ATP no cloroplasto: fotofosforila��o
As emiss�es solares que atingem a Terra constituem-se de uma ampla gama de
radia��es (ou ondas) eletromagn�ticas. As radia��es distinguem-se umas das outras
por uma caracter�stica vibrat�ria de suas ondas, o comprimento de onda. Radia��es
ultravioleta, por exemplo, t�m comprimentos de onda mais curtos que radia��es
infravermelhas. Entre a grande gama de radia��es, h� uma estreita faixa de
comprimentos de onda que nossos olhos conseguem captar, constituindo as radia��es
vis�veis que denominamos luz.
A clorofila presente nos cloroplastos de algas e de plantas � capaz de absorver
energia da luz, principalmente a das radia��es luminosas vermelha e violeta,
refletindo quase todo o verde, da� a cor apresentada pela clorofila. (Fig. 7.2)
Ao ser atingida pela luz, uma mol�cula de clorofila capta energia luminosa. Ocorre
ent�o o que os qu�micos denominam "excita��o eletr�nica": alguns el�trons absorvem
energia da luz e tornam-se "excitados", o que faz com que eles sejam expelidos da
mol�cula de clorofila.

ILUSTRA��ES: ADILSON SECCO


Figura 7.2 A. Representa��o da decomposi��o da luz branca que passa atrav�s de um
prisma de vidro (note que a luz vis�vel � uma estreita faixa entre os comprimentos
de onda que constituem as radia��es eletromagn�ticas). B. Espectro de absor��o pela
clorofila dos diversos comprimentos de onda da luz vis�vel.

P�gina 144

El�trons excitados s�o inst�veis, tendendo a eliminar a energia adicional e voltar


ao estado energ�tico original. Entretanto, ao redor das mol�culas de clorofila h�
subst�ncias especializadas em captar esses el�trons energizados antes que eles
liberem seu "excesso" energ�tico na forma de luz ou calor e retornem � clorofila.
Essas subst�ncias captadoras s�o chamadas aceptores de el�trons.
A excita��o eletr�nica da clorofila pela luz e a captura dos el�trons energizados
pelos aceptores marcam o momento da transforma��o da energia luminosa em energia
qu�mica.
A energia de parte dos el�trons excitados � liberada controladamente � medida que
eles s�o transferidos do primeiro aceptor para um segundo, para um terceiro, e
assim por diante, naquilo que os cientistas denominam cadeia transportadora de
el�trons. O termo cadeia, nesse caso, refere-se a uma sequ�ncia, como os elos de
uma corrente. No cloroplasto, os diversos aceptores intermedi�rios da cadeia
transportadora de el�trons disp�em-se organizadamente na membrana do tilacoide,
maximizando a efici�ncia das transfer�ncias eletr�nicas. O �ltimo aceptor da cadeia
� a subst�ncia conhecida por NADP (sigla do ingl�s nicotinamide adenine
dinucleotide phosphate: fosfato de dinucleot�dio de nicotinamida-adenina).
Ao receber os el�trons da cadeia transportadora da qual faz parte, a mol�cula de
NADP passa do estado oxidado (NADP+) em que se encontrava para um estado reduzido
(NADPH). Voltaremos a falar dessa subst�ncia mais adiante.
A energia liberada pelos el�trons nas cadeias transportadoras � utilizada para
for�ar pr�tons (�ons de hidrog�nio, representados por H+) a passar do estroma para
o espa�o interno dos tilacoides, onde se acumulam. Os �ons H+ acumulados tendem a
retornar ao estroma, mas a membrana do tilacoide � imperme�vel � sua sa�da. Por
isso, esses �ons s� podem voltar ao estroma atravessando a sintase do ATP, um
complexo proteico presente na membrana do tilacoide.
A constitui��o da sintase do ATP � compar�vel a um gerador molecular de dimens�es
nanosc�picas: ela possui um rotor interno que gira ao ser movido pela passagem dos
�ons H+. Nessa atividade, a energia da difus�o do H+ � utilizada para sintetizar
ATP pela uni�o de ADP e Pi.
A rea��o de adi��o de Pi ao ADP que leva � s�ntese de ATP � denominada
fosforila��o. Uma vez que a energia para essa rea��o prov�m originalmente da luz, o
processo todo � denominado fotofosforila��o. (Fig. 7.3)

ILUSTRA��ES: JURANDIR RIBEIRO


Figura 7.3 No alto, � direita, representa��o esquem�tica de um cloroplasto
parcialmente cortado para mostrar seu sistema interno de membranas. As bolsas
membranosas circulares e achatadas, que lembram moedas empilhadas, s�o os
tilacoides. Abaixo, em maior detalhe, organiza��o das cadeias transportadoras de
el�trons e da sintase do ATP na membrana de um tilacoide. Q e Fd s�o siglas das
subst�ncias quinona e ferredoxina, que, como a plastocianina (P), s�o prote�nas
carregadoras de el�trons. (Elaborada com base em Raven, P. e cols., 1999.)
(Elementos fora de propor��o de tamanho entre si; cores-fantasia.)

P�gina 145
Fot�lise da �gua
A clorofila recupera os el�trons que perdeu com a excita��o luminosa a partir de
mol�culas de �gua degradadas. Essa rea��o, denominada fot�lise da �gua (do grego
photos, luz, e lyse, quebra) ou rea��o de Hill, ocorre de forma acoplada �
fotofosforila��o. Cada mol�cula de �gua decomp�e-se em dois el�trons (e-), dois
pr�tons de hidrog�nio (�ons H+) e um �tomo de oxig�nio. Os �tomos de oxig�nio unem-
se imediatamente dois a dois, formando mol�culas de g�s oxig�nio (O2).
A fot�lise da �gua pode ser escrita, em termos qu�micos, da seguinte maneira:
2 H2O ?(??LUZ) O2 + 4 H+ + 4 e-
�gua
G�s
�ons de El�trons
oxig�nio hidrog�nio

Nessa rea��o s�o formados tr�s produtos:


a) g�s oxig�nio, que � liberado para o ambiente;
b) �ons H+, que ser�o capturados pelo NADP; como veremos adiante, esses hidrog�nios
ser�o disponibilizados para a fase seguinte da fotoss�ntese e passar�o a fazer
parte das mol�culas de glic�dio produzidas;
c) el�trons com baixa energia, que rep�em os que foram perdidos pela clorofila na
excita��o eletr�nica; ao recuperar seus el�trons, as mol�culas de clorofila est�o
prontas para passar por novos ciclos de excita��o eletr�nica.
O ciclo das pentoses e a s�ntese de glic�dios
O �ltimo conjunto de rea��es da fotoss�ntese, denominado ciclo das pentoses ou
ciclo de Calvin-Benson, resulta na forma��o de mol�culas de glic�dios com tr�s
�tomos de carbono - o 3-fosfato gliceralde�do ou PGAL (do ingl�s
phosphoglyceraldehyde). Nesse processo, mol�culas de CO2 reagem com �ons de
hidrog�nio liberados na fot�lise da �gua e com el�trons de alta energia liberados
pela clorofila excitada, produzindo o PGAL. O processo � mediado por mol�culas de
NADPH e demanda certa quantidade de energia adicional, fornecida pelo ATP produzido
na fotofosforila��o. Acompanhe as rea��es de forma��o de PGAL no esquema a seguir.
(Fig. 7.4)

ADILSON SECCO
Figura 7.4 Esquema do ciclo das pentoses. O processo tem in�cio com a incorpora��o
de 6 mol�culas de g�s carb�nico a 6 mol�culas de RuBP (do ingl�s ribulose 1,5-
bisphosphate; 1,5-bifosfato de ribulose), sob a coordena��o da enzima rubisco. A
cada volta completa, o ciclo das pentoses produz 2 mol�culas de glic�dio com 3
carbonos (3-fosfato gliceralde�do ou PGAL) e 6 mol�culas de RuBP, prontas para
incorporar novamente CO2 e iniciar outro ciclo. (Elaborado com base em Campbell, N.
e cols., 1999.)

P�gina 146

� costume representar o glic�dio formado na fotoss�ntese como a glicose (C6H12O6).


Entretanto, hoje se sabe que o produto direto do ciclo das pentoses n�o � glicose,
e sim o 3-fosfato gliceralde�do (PGAL).
Destino dos produtos da fotoss�ntese
O PGAL formado no ciclo das pentoses pode seguir dois caminhos. A maior parte dessa
subst�ncia sai do cloroplasto para o citosol, onde suas mol�culas se unem para
formar sacarose. As mol�culas de PGAL que permanecem no cloroplasto s�o convertidas
em amido, que � armazenado. � noite, o amido � transformado em sacarose e sai para
o citosol da c�lula fotossintetizante, de onde � exportado para as demais partes do
organismo fotossint�tico.
Parte dos glic�dios produzidos na fotoss�ntese � utilizada imediatamente nas
mitoc�ndrias da pr�pria c�lula vegetal no processo de respira��o celular,
fornecendo energia aos processos vitais. Parte dos glic�dios � transformada nas
diversas subst�ncias org�nicas de que a planta (ou o organismo fotossintetizante)
necessita, como amino�cidos, a��cares, gorduras, celulose etc. Outra parte, ainda,
� armazenada na forma de amido dentro de amiloplastos, organelas presentes em
c�lulas do caule e da raiz das plantas.
A fotoss�ntese garante �s algas, �s plantas e �s bact�rias fotossintetizantes total
independ�ncia em rela��o a outros organismos vivos no que se refere � obten��o de
nutrientes org�nicos. Pelo contr�rio, praticamente todos os seres heterotr�ficos da
Terra dependem dos seres fotossintetizantes para viver.
7.3 Quimioss�ntese
Certas esp�cies de bact�rias e de arqueas (estas �ltimas antigamente chamadas de
arqueobact�rias) s�o autotr�ficas e produzem subst�ncias org�nicas por meio da
quimioss�ntese, processo que utiliza energia liberada por rea��es oxidativas que
ocorrem em subst�ncias inorg�nicas simples. Arqueas metanog�nicas, por exemplo,
obt�m energia a partir da rea��o entre g�s hidrog�nio (H2) e g�s carb�nico (CO2),
com produ��o de g�s metano (CH4). Essas arqueas vivem em ambientes pobres em g�s
oxig�nio (anaer�bicos), tais como dep�sitos de lixo, fundos de p�ntanos e tubos
digestivos de animais. A equa��o que resume esse processo �:
CO2 + 4 H2 ? CH4 + 2 H2O + energia
Outros exemplos de bact�rias quimiossintetizantes s�o as dos g�neros Nitrosomonas e
Nitrobacter, que vivem no solo e t�m import�ncia fundamental na reciclagem do
elemento nitrog�nio na Terra. As nitrosomonas obt�m energia por meio da oxida��o da
am�nia (NH3) presente no solo, transformando-a em �on de nitrito (NO2-).
As nitrobact�rias, por sua vez, utilizam o �on de nitrito (NO3-), oxidando-o a �on
de nitrato (NO2-).
As bact�rias quimiossintetizantes conseguem viver em ambientes desprovidos de luz e
de mat�ria org�nica, obtendo a energia necess�ria ao seu desenvolvimento por
oxida��es inorg�nicas. Al�m de um agente oxidante, essas bact�rias necessitam
apenas de g�s carb�nico e �gua, que constituem as mat�rias-primas para a produ��o
de glic�dios. (Fig. 7.5)

KENNETH L. SMITH JR./GETTY IMAGES


Figura 7.5 O anel�deo Riftia pachyptila, que pode chegar a 2 m de comprimento, �
encontrado no assoalho oce�nico, em ambientes frios e sem luz. Em seu interior
vivem bact�rias quimiossintetizantes capazes de metabolizar compostos sulf�ricos e
produzir alimento para o anel�deo e para outros seres que habitam essa regi�o.

P�gina 147

ATIVIDADES
Revendo conceitos, fatos e processos
Registre em seu caderno
1. A subst�ncia qu�mica que fornece energia para praticamente todos os processos
celulares � o
a) trifosfato de adenosina (ATP).
b) �cido desoxirribonucleico (DNA).
c) fosfato inorg�nico (Pi).
d) fosfato de dinucleot�dio de nicotinamida-adenina (NADP).
Escreva, em seu caderno, o termo abaixo que substitui corretamente a tarja entre
par�nteses das frases de 2 a 4.
a) ciclo das pentoses
b) fotofosforila��o
c) fot�lise da �gua
2. O(A) (.....) � um conjunto de rea��es qu�micas que ocorrem no estroma do
cloroplasto, nas quais mol�culas de g�s carb�nico combinam-se a hidrog�nios
fornecidos pelo NADPH, produzindo PGAL (3-fosfato gliceralde�do).
3. A rea��o de quebra de mol�culas de �gua com produ��o de g�s oxig�nio, el�trons e
�ons H+ � chamada (.....).
4. O processo denominado (.....) utiliza energia dos el�trons liberados pela
clorofila excitada pela luz para a produ��o de ATP no cloroplasto.
5. Os �tomos de oxig�nio das mol�culas de g�s oxig�nio liberadas na fotoss�ntese
prov�m
a) da �gua, apenas.
b) da glicose, apenas.
c) da �gua e da glicose, apenas.
d) da �gua, da glicose e do ATP.
6. A mol�cula de clorofila, ao ser atingida pela luz, perde el�trons, repostos em
seguida pela
a) degrada��o de mol�culas de ATP.
b) fixa��o de mol�culas de g�s carb�nico.
c) quebra de mol�culas de �gua.
d) degrada��o de mol�culas de glicose.
Quest�es para exercitar o pensamento
Registre em seu caderno
7. Observe duas equa��es v�lidas para resumir a fotoss�ntese apresentadas a seguir:
- 6 CO2 (g�s carb�nico) + 6 H2O (�gua) ? C6H12O6 (glicose) + 6 O2 (g�s oxig�nio)
- 6 CO2 (g�s carb�nico) + 12 H2O (�gua) ? C6H12O6 (glicose) + 6 O2 (g�s oxig�nio) +
6 H2O (�gua)
Qual das equa��es permite mostrar que todo o g�s oxig�nio liberado no processo
prov�m da fot�lise da �gua? Por qu�?
8. Que argumentos voc� usaria para convencer uma amiga ou um amigo de que os seres
humanos dependem de luz solar para viver? Se preferir, fa�a um esquema que ilustre
essa ideia.
Fa�a voc� mesmo!
Registre em seu caderno
9. Atividade pr�tica: Libera��o de g�s oxig�nio na fotoss�ntese
A fotoss�ntese � um dos processos mais importantes da natureza. Al�m de transformar
energia luminosa em energia qu�mica, que fica armazenada na mat�ria org�nica que
constitui os seres vivos, o processo fotossint�tico gera, como subproduto, o g�s
oxig�nio que constitui cerca de 21% da atmosfera da Terra. A libera��o de g�s
oxig�nio na fotoss�ntese pode ser demonstrada em um experimento simples e f�cil de
ser realizado.
Material
- 2 recipientes incolores e transparentes (por exemplo, por��es inferiores de
garrafas PET de 2 litros ou aqu�rios de vidro pequenos);
- 2 funis grandes de vidro, que caibam nos recipientes pedidos;
- 2 tubos de ensaio (mais longos que o bico do funil);
- massa de modelar;
- bicarbonato de s�dio;
- ramos de el�dea (Elodea sp.);
- luz forte (l�mpada incandescente de, pelo menos, 100 W ou equivalente).
Procedimento
Dever�o ser montados dois conjuntos completos, como os descritos a seguir.
1. Prepare uma solu��o de bicarbonato de s�dio para encher os recipientes: para
cada litro de �gua, dissolva cerca de uma colher de sopa de bicarbonato de s�dio, o
que garantir� o suprimento de g�s carb�nico para a fotoss�ntese.
2. Coloque alguns ramos de el�dea no funil e mergulhe-o completamente, com o bico
para cima, na solu��o do recipiente.
3. Fixe o funil com massa de modelar de modo a mant�-lo suspenso a um ou dois
cent�metros do fundo do recipiente.
4. Se necess�rio, adicione mais solu��o de bicarbonato de s�dio at� cobrir
completamente o bico do funil.

P�gina 148

5. Encha um tubo de ensaio com �gua e inverta-o sobre o bico do funil, evitando a
entrada de ar em seu interior.

CAN�ADO
Montagem dos conjuntos. (Elementos fora de propor��o de tamanho entre si; cores-
fantasia.)
6. Mantenha um dos conjuntos iluminado e coloque o outro dentro de uma caixa ou de
um arm�rio no qual n�o entre luz.
7. Observe atentamente o conjunto iluminado, no qual aparecer�o bolhas de g�s
aderidas aos ramos de el�dea. As bolhas logo se desprender�o, e o g�s passar� a se
acumular no tubo de ensaio.
8. Quando um volume razo�vel de g�s tiver se acumulado no tubo de ensaio do frasco
iluminado, retire o conjunto que permaneceu no escuro e compare-o com o que
permaneceu no claro.
Quest�es
a) O que se pretende testar quando se utilizam dois conjuntos experimentais, um
iluminado e outro no escuro? Qual � a import�ncia desse segundo conjunto?
b) Como seria poss�vel demonstrar que o g�s acumulado no tubo do conjunto iluminado
� g�s oxig�nio? Pesquise sobre o assunto.
10. Atividade pr�tica: Testando a rela��o entre a luz e a presen�a de amido nas
folhas de plantas
O produto prim�rio da fotoss�ntese � um glic�dio com tr�s �tomos de carbono, que �
rapidamente transformado em sacarose e amido. Nas c�lulas das folhas, o amido �
armazenado nos cloroplastos at� que seja necess�rio ao metabolismo vegetal. Nesta
atividade, apresentamos um experimento simples para demonstrar que a presen�a de
amido nas folhas depende da luz e da fotoss�ntese.
Material
- sementes de feij�o;
- �lcool et�lico 95%;
- placa de aquecimento el�trica ou forno de micro-ondas para o aquecimento da �gua;
- solu��o de lugol forte (solu��o aquosa de 15% de iodeto de pot�ssio - KI - e 3%
de iodo - I2) ou de tintura de iodo;
- pin�a para manuseio das folhas;
- papel-alum�nio;
- pires ou recipientes de pl�stico;
- 2 vasos grandes com terra adubada.
Procedimento
1. Duas semanas antes de iniciar o experimento, prepare os dois vasos com terra
adubada e plante cerca de 6 sementes de feij�o em cada um. Regue sempre, molhando
bem a terra, mas sem encharc�-la.
2. Cerca de duas semanas ap�s o plantio, as plantas de feij�o j� dever�o estar com
folhas bem desenvolvidas. Escolha um vaso e, com cuidado, envolva totalmente uma
folha de cada planta com papel-alum�nio, deixando as demais descobertas. No outro
vaso, embrulhe duas folhas de cada planta pela metade. Mantenha os vasos expostos �
luz natural, em local bem iluminado, por dois dias.
3. Retire das plantas duas folhas que estavam descobertas e mergulhe-as em �gua
fervente por cerca de dois minutos; isso far� com que as c�lulas fiquem perme�veis
ao �lcool.
4. Com uma pin�a, retire as folhas da �gua quente e mergulhe-as no �lcool et�lico
at� que os pigmentos sejam totalmente extra�dos, tingindo o �lcool de verde (esse
processo leva cerca de 10 min).
5. Lave as folhas em �gua para retirar o excesso de �lcool e mergulhe-as na tintura
de iodo (ou lugol) por 10 min.
6. Retire as folhas da tintura de iodo (ou do lugol), e lave-as em �gua corrente;
mantenha-as imersas em �gua e identifique-as como "controle". O iodo penetra nas
c�lulas da folha e reage com os gr�os de amido nelas presentes, corando-os em
p�rpura-escuro. Se uma folha n�o tiver amido, adquirir� uma tonalidade amarelo-
clara.
7. Retire das plantas as folhas que foram mantidas totalmente cobertas com papel-
alum�nio, descubra-as e submeta-as ao mesmo procedimento realizado com as folhas de
controle. Identifique essas folhas como "totalmente cobertas".
8. Utilize o mesmo procedimento com as folhas parcialmente cobertas. Identifique-as
como "parcialmente cobertas".
Quest�es
a) Compare a colora��o das folhas de controle com a das folhas que ficaram cobertas
por dois dias. Qual � a diferen�a entre elas? Formule uma explica��o para a
diferen�a observada.
b) Observe as folhas que ficaram cobertas pela metade. Qual � a colora��o? Explique
o aspecto adquirido por elas.

P�gina 149

A Biologia no vestibular e no Enem


Registre em seu caderno
Quest�es objetivas
1. (Unesp) Sobre o processo de fotoss�ntese, � correto afirmar que
a) o CO2 � fonte de carbono para a s�ntese de mat�ria org�nica e fonte de O2 para a
atmosfera.
b) a �gua � fonte de H+ para a s�ntese de NADPH e de O2 para a atmosfera.
c) o NADPH � fonte de energia para a convers�o do CO2 em mat�ria org�nica.
d) o ATP � doador de energia para a quebra da mol�cula de �gua, que, por sua vez,
fornece O2 para a atmosfera.
e) a convers�o do CO2 em mat�ria org�nica produz energia que � acumulada pelo ATP.
2. (Udesc) A fotoss�ntese � um processo de transforma��o de energia luminosa em
energia qu�mica, realizada por organismos autotr�ficos. Sobre a fotoss�ntese, �
correto afirmar:
a) Ao final da fotoss�ntese, s�o produzidos 38 mols de ATP.
b) Os organismos autotr�ficos crescem mais sob a luz verde, porque a clorofila �
verde.
c) A fotoss�ntese � um processo dependente de luz e ocorre na aus�ncia da �gua.
d) Somente plantas vasculares s�o capazes de realizar a fotoss�ntese.
e) A unidade fotossint�tica da planta localiza-se nos tilacoides dos cloroplastos.
3. (Uespi) O cloroplasto � uma "f�brica" que produz um combust�vel valioso para as
c�lulas vivas, a partir de subst�ncias simples, aqui chamadas de "mat�rias-primas".
Determine a alternativa que indica corretamente as mat�rias-primas e as subst�ncias
produzidas no processo em considera��o, nessa ordem a) H2O, CO2, glicose e O2.
b) CO2, O2, glicose e prote�na.
c) H2O, O2, glicose e prote�na.
d) O2, CO2, prote�na e H2O.
e) prote�na, CO2, H2O e O2.
4. (Cesgranrio-RJ)

(Esquema simplificado.)
ILUSTRA��O: ADILSON SECCO
No experimento com el�dea num tubo iluminado, o que s�o as bolhas?
a) O2 resultante de fot�lise da �gua.
b) O2 resultante da quebra da mol�cula de CO2.
c) CO2 resultante do ciclo de Krebs.
d) CO2 proveniente do ciclo de Calvin.
e) O2 proveniente da fotofosforila��o.
5. (U. S�o Judas-SP) Com rela��o ao fen�meno da fotoss�ntese, sabe-se que a rea��o:

2 H2O + 2 NADP ?"Clorofila" ????"Luz" 2 NADPH2 + O2?


a) corresponde ao ciclo de Calvin.
b) corresponde � rea��o de Hill.
c) ocorre em estroma do cloroplasto.
d) � o resultado do ciclo de pentoses.
e) � o resultado do ciclo de Krebs.
Quest�o discursiva
6. (UFMG) Com o objetivo de estudar a a��o da luz na fotoss�ntese foi realizada a
seguinte experi�ncia:
Em um pequeno aqu�rio foi colocada uma �nica c�lula da alga verde Spirogyra; essa
c�lula tem um longo cloroplasto, em forma de fita espiralada, que ocupa todo o seu
comprimento; mol�culas de clorofila est�o aderidas sobre a membrana do cloroplasto.
Dentro do aqu�rio foram colocadas, tamb�m, bact�rias m�veis que s�o atra�das para
�reas onde existia oxig�nio em abund�ncia.
O aqu�rio foi, ent�o, iluminado por um feixe de luz branca que passava por um
prisma antes de chegar na c�lula de Spirogyra; a luz branca, ao passar pelo prisma,
decomp�e-se nas cores b�sicas, de modo que cada regi�o da c�lula foi iluminada por
uma cor diferente, como mostra a figura a seguir.

ILUSTRA��O: CAN�ADO
a) Explique por que as bact�rias se acumulam nas �reas indicadas na figura.
b) Se a Spirogyra fosse iluminada diretamente por um feixe de luz branca, o que
aconteceria com a distribui��o das bact�rias? Justifique sua resposta.

P�gina 150

Cap�tulo 8 Fermenta��o e respira��o aer�bica

DAVID BLAIR/ZUMA PRESS/CORBIS/LATINSTOCK


Prova dos 1.500 m no Campeonato Mundial de Atletismo em Pista Coberta de 2016, no
Oregon, EUA.
Respirar para qu�?
O que acontece quando respiramos? O que tem o ar atmosf�rico de fundamental � nossa
vida? Se voc� respondeu que precisamos do g�s oxig�nio presente no ar, acertou.
Entretanto, podemos aprofundar um pouco mais a pergunta: qual � o papel do g�s
oxig�nio em nosso organismo? Para responder a essa quest�o, � preciso entender
alguns detalhes sobre a respira��o.
Vamos come�ar com um pouco de hist�ria. Foi apenas a partir de 2,5 bilh�es de anos
atr�s que a concentra��o de g�s oxig�nio atmosf�rico, praticamente inexistente na
Terra at� ent�o, aumentou progressivamente at� atingir a porcentagem atual, em
torno de 21%. Os respons�veis pela produ��o de g�s oxig�nio foram os seres
fotossintetizantes, que ainda hoje s�o essenciais para a reposi��o desse g�s no
ambiente, de onde � continuamente consumido pela grande maioria dos seres vivos.
Os cientistas acreditam que, ao se acumular na atmosfera da Terra primitiva, o g�s
oxig�nio, devido ao seu alto poder oxidante, levou � destrui��o em massa de muitas
formas de vida. Nesse ambiente em transforma��o, sobreviveram, preferencialmente,
seres dotados de sistemas qu�micos antioxidantes, alguns dos quais evolu�ram de
modo a aproveitar o poder oxidante do g�s oxig�nio para quebrar mol�culas org�nicas
e produzir energia utiliz�vel pelo metabolismo. Surgia, assim, a respira��o
aer�bica, isto �, que utiliza g�s oxig�nio.
Quando nos referimos � respira��o, podemos pensar em dois n�veis distintos. O
primeiro � o n�vel do organismo: ao respirar, fazemos o ar entrar em nossos pulm�es
e, nesses �rg�os, o g�s oxig�nio � capturado pelas c�lulas vermelhas do sangue e
transportado para cada uma de nossas c�lulas. Nelas ocorre um segundo n�vel do
processo respirat�rio, denominado respira��o celular. Dentro das c�lulas, o g�s
oxig�nio penetra em organelas citoplasm�ticas denominadas mitoc�ndrias, nas quais
exerce seu papel oxidante, capaz de auxiliar na extra��o de energia de mol�culas
org�nicas originalmente provenientes do alimento.
Pela respira��o celular, a energia contida em subst�ncias alimentares � transferida
para mol�culas de ATP e nelas armazenada. Essas mol�culas s�o capazes de suprir
energeticamente diferentes processos celulares. Assim, em linhas gerais, o processo
respirat�rio permite aos seres vivos obter e mobilizar com grande efici�ncia a
energia originalmente presente nos alimentos, condi��o fundamental � vida.

P�gina 151

A import�ncia do assunto
Neste cap�tulo, estudaremos o segundo n�vel respirat�rio a que nos referimos
anteriormente: a respira��o celular aer�bica. O processo respirat�rio � um
intrincado jogo de transforma��es moleculares das quais participa o g�s oxig�nio.
Gra�as ao poder oxidante desse g�s, � poss�vel extrair com alta efici�ncia a
energia contida em subst�ncias org�nicas, transferindo-a, via ATP, para processos
metab�licos.
Veremos, tamb�m, as linhas gerais de um processo de obten��o de energia anaer�bico,
isto �, que n�o utiliza oxig�nio: a fermenta��o. O processo fermentativo, acredita-
se, desenvolveu-se h� bilh�es de anos, provavelmente antes da respira��o. Uma
evid�ncia disso � que as rea��es iniciais da respira��o s�o as mesmas que ocorrem
na fermenta��o.
A fermenta��o ainda � empregada por certos fungos e bact�rias como forma de obter
energia. Curiosamente, em certas situa��es, nossas c�lulas tamb�m utilizam-se da
fermenta��o. Quando nossas c�lulas musculares s�o intensamente exigidas, a ponto de
o sistema respirat�rio n�o conseguir supri -las totalmente com o g�s oxig�nio
necess�rio � respira��o, os m�sculos obt�m parte da energia por um tipo de
fermenta��o que forma, como produto final, �cido l�tico. � essa subst�ncia que, ao
se acumular ap�s exerc�cios f�sicos muito intensos, causa uma dor t�pica nos
m�sculos duramente exigidos. Aprenda um pouco sobre a natureza bioqu�mica da
respira��o aer�bica e da fermenta��o ao estudar este cap�tulo.
8.1 Fermenta��o como forma de obter energia
Certos fungos e bact�rias adaptados a ambientes pobres em g�s oxig�nio obt�m
energia pela fermenta��o, processo em que subst�ncias org�nicas s�o degradadas
parcialmente, originando mol�culas org�nicas menores.
O fungo Saccharomyces cerevisiae, uma levedura conhecida popularmente como fermento
de padaria ou levedo de cerveja, recorre � fermenta��o para obter energia quando o
g�s oxig�nio � escasso no ambiente. Nesse processo, o levedo produz �lcool et�lico
(etanol) e g�s carb�nico como subprodutos. Os lactobacilos, bact�rias que fermentam
o leite, utilizam a lactose do leite para obter energia e produzem �cido l�tico
como subproduto. Em c�lulas musculares tamb�m pode ocorrer fermenta��o l�tica; isso
acontece quando a demanda de energia � muito grande e n�o h� g�s oxig�nio
suficiente para sustentar a respira��o celular.
A fermenta��o geralmente tem como ponto de partida uma mol�cula de glicose, a qual
� formada por 6 carbonos encadeados. Ao fim de dez rea��es sequenciais, a glicose
origina duas mol�culas de uma subst�ncia constitu�da por 3 carbonos, o �cido
pir�vico. O conjunto de rea��es em que uma mol�cula de glicose � transformada em
duas mol�culas de �cido pir�vico comp�e a glic�lise (do grego glykys, doce, a��car,
e lysis, quebra).
Apesar de a mol�cula de glicose ser altamente energ�tica, ela � bastante est�vel e
n�o se degrada com facilidade. Por isso, as rea��es iniciais do processo de
glic�lise t�m por fun��o "ativar" a glicose, levando-a a reagir. A ativa��o ocorre
pela transfer�ncia de dois grupos fosfato de alta energia para a mol�cula de
glicose; esses fosfatos s�o provenientes de duas mol�culas de ATP. Assim, para
iniciar a glic�lise, a c�lula precisa "investir" o equivalente a 2 ATP por mol�cula
de glicose. (Fig. 8.1)

ADILSON SECCO
Figura 8.1 Esquema das etapas da glic�lise.

P�gina 152

Nas rea��es finais da glic�lise, a c�lula recupera "com juros" o investimento


energ�tico inicial, pois consegue sintetizar 4 mol�culas de ATP a partir da energia
liberada na degrada��o da glicose. Ao final do processo, o rendimento energ�tico
l�quido da glic�lise � de 2 mol�culas de ATP por mol�cula de glicose metabolizada.
Tipos de fermenta��o
Dependendo do tipo de organismo fermentador, o �cido pir�vico produzido na
glic�lise segue diferentes caminhos. Por exemplo, na fermenta��o alco�lica,
realizada por leveduras, o �cido pir�vico transforma-se em �lcool et�lico e g�s
carb�nico. Na fermenta��o l�tica realizada por bact�rias como os lactobacilos, o
�cido pir�vico transforma-se em �cido l�tico. Confira as equa��es gerais desses
dois tipos de fermenta��o:
Fermenta��o alco�lica
C6H12O6 ? 2 CH3 - CO - COOH + 4 H+ + 4 e- ? 2 CH3 - CH2OH + 2 CO2
Glicose
�cido pir�vico Etanol
G�s carb�nico
Fermenta��o l�tica
C6H12O6 ? 2 CH3 - CO - COOH + 4 H+ + 4 e- ? 2 CH3 - CHOH - COOH
Glicose
�cido pir�vico
�cido l�tico

Na glic�lise, al�m de �cido pir�vico, s�o liberados 4 �ons de hidrog�nio (4 H+) e 4


el�trons com alta energia (4 e-). Esses produtos s�o capturados por um aceptor de
hidrog�nio (ou de el�trons) que participa da fermenta��o: o NAD+ (do ingl�s,
nicotinamide adenine dinucleotide: dinucleot�dio de nicotinamida-adenina).
O NAD+ � um aceptor de el�trons semelhante aos aceptores estudados na fotoss�ntese:
sua fun��o � receber el�trons e �ons de hidrog�nio, transferindo-os posteriormente
para outras mol�culas que ser�o sintetizadas.
Em uma das etapas da glic�lise, duas mol�culas de NAD+ recebem el�trons e �ons H+,
transformando-se em NADH. Veja na equa��o a seguir.
2 H+ + 4 e- + 2 NAD+ ? 2 NADH
Na fase final da fermenta��o, os el�trons e os �ons de hidrog�nio capturados pelo
NAD+ s�o transferidos para o �cido pir�vico. Nessa rea��o, o �cido pir�vico
transforma-se em �lcool et�lico e g�s carb�nico (na fermenta��o alco�lica) ou em
�cido l�tico (na fermenta��o l�tica). (Fig. 8.2)

Figura 8.2 Esquema das principais etapas da fermenta��o l�tica e da fermenta��o


alco�lica.

P�gina 153

Ci�ncia e cidadania
A import�ncia da fermenta��o para a humanidade
1 A "domestica��o" e a utiliza��o de microrganismos fermentadores pela esp�cie
humana datam de milhares de anos. O p�o e o vinho, os mais tradicionais alimentos
da humanidade, s�o produtos da fermenta��o realizada por leveduras do g�nero
Saccharomyces. Diversas esp�cies de fungos e de bact�rias podem fermentar v�rios
tipos de substratos, gerando produtos finais que dependem tanto do organismo que
realiza o processo quanto das subst�ncias fermentadas.
2 Na panifica��o, a levedura Saccharomyces cerevisiae, misturada � farinha,
fermenta carboidratos produzindo etanol (�lcool et�lico) e g�s carb�nico. Esse g�s
� liberado na forma de min�sculas bolhas que se dilatam durante o cozimento,
tornando a massa macia e leve. Algumas receitas de p�es e bolos utilizam, em vez de
leveduras, bicarbonato de s�dio. Esse composto, conhecido como fermento qu�mico,
produz bolhas de g�s carb�nico que tamb�m tornam a massa macia e leve, mas sem o
valor nutricional conferido pelas leveduras.

STUDIO SCHIERMANN/STOCKFOOD/GLOW IMAGES


O fungo Saccharomyces cerevisiae constitui o fermento biol�gico, que produz g�s
carb�nico durante a fermenta��o; � esse g�s que faz a massa do p�o crescer.
3 As bebidas alco�licas resultam da fermenta��o dos a��cares de frutos ou de
sementes por leveduras, que liberam etanol e g�s carb�nico no processo. A produ��o
de cerveja, por exemplo, utiliza a fermenta��o de a��cares provenientes da
degrada��o do amido presente nas sementes de cevada ou de trigo. Os agentes
fermentadores, nesse caso, s�o leveduras das esp�cies Saccharomyces cerevisiae ou
Saccharomyces carlsbergensis. Na produ��o do vinho, o substrato � o suco de uvas e
o agente fermentador, a levedura Saccharomyces ellipsoideus, presente naturalmente
na superf�cie das uvas maduras. No M�xico, um tipo de cerveja conhecido como pulque
� produzido desde tempos pr�-colombianos pela fermenta��o de plantas do g�nero
Agave por leveduras e lactobacilos. O destilado resultante do produto dessa
fermenta��o � a popular tequila. O vinho de arroz dos japoneses, conhecido como
saqu�, resulta da a��o de leveduras sobre os a��cares gerados pela degrada��o do
amido de gr�os de arroz pelo fungo Aspergillus oryzae.
4 Produtos da fermenta��o do leite t�m hist�ria t�o antiga quanto a dos vinhos,
cervejas e p�o, uma vez que o leite � um excelente substrato para o desenvolvimento
de diversos tipos de microrganismos. A fermenta��o l�tica � largamente utilizada na
produ��o de latic�nios como queijos, coalhadas e iogurtes. Diversos tipos de queijo
s�o fabricados utilizando leite previamente coagulado pela enzima renina, obtida do
est�mago de mam�feros. Ap�s a drenagem do fluido (soro), a massa coagulada,
composta basicamente de case�na (a prote�na do leite), � inoculada com a linhagem
de bact�ria correspondente ao tipo de queijo que se deseja obter. Subst�ncias
produzidas e eliminadas pelas bact�rias fermentadoras s�o respons�veis pelo sabor e
aroma caracter�sticos de cada tipo de queijo. Por exemplo, na produ��o do queijo
su��o � empregada a bact�ria Propionibacterium freudenreichii, que libera, como
produto da fermenta��o da lactose do leite, �cido propi�nico e g�s carb�nico,
respons�veis pelo sabor caracter�stico e pelas cavidades t�picas desse tipo de
queijo.
5 Iogurtes comerciais s�o produzidos a partir de leite desnatado concentrado,
obtido por evapora��o a v�cuo. O leite � inoculado com uma mistura das bact�rias
Streptococcus thermophilus e Lactobacillus bulgaricus e incubado a 45 �C por v�rias
horas. Durante esse tempo, o estreptococo produz �cido l�tico a partir da
fermenta��o da lactose do leite; o lactobacilo produz a maior parte das subst�ncias
que conferem cremosidade, sabor e aroma caracter�sticos do iogurte. Um dos segredos
da fabrica��o de um bom iogurte � o equil�brio entre a multiplica��o dessas duas
esp�cies de bact�ria; em certos casos, leveduras tamb�m podem participar do
processo.

P�gina 154

6 O sabor caracter�stico da manteiga resulta da atividade de uma esp�cie de


estreptococo que libera uma subst�ncia chamada aceto�na, presente tamb�m em alguns
iogurtes. A produ��o de certos embutidos de carne, como o salame, demanda a a��o
fermentativa de bact�rias do g�nero Pediococcus, cuja produ��o de �cido l�tico
contribui para o sabor e para a elevada capacidade de conserva��o desses alimentos.
Vinagres s�o, em geral, produzidos por a��o de bact�rias fermentadoras,
principalmente dos g�neros Acetobacter eAcetomonas, que convertem etanol em �cido
ac�tico, processo conhecido como fermenta��o ac�tica.
7 A fermenta��o tamb�m est� envolvida na produ��o do chocolate. As sementes de
frutos do cacau rec�m-colhidos t�m seus carboidratos fermentados primeiro por
leveduras e, depois, por bact�rias l�ticas e ac�ticas. Em seguida, elas s�o secas,
torradas e processadas. A fermenta��o � necess�ria para que se formem as
subst�ncias que d�o o sabor t�pico do chocolate. O molho de soja, ingrediente
indispens�vel nas culin�rias chinesa e japonesa, � produto da fermenta��o de
a��cares e outros compostos de sementes de soja pelo fungoAspergillus oryzae.

OWEN FRANKEN/CORBIS/LATINSTOCK
A fermenta��o das sementes de frutos do cacau (Theobroma cacao) � um processo
necess�rio na produ��o do chocolate.
8 A aplica��o em larga escala de processos fermentativos ganha cada vez mais
destaque em decorr�ncia do desenvolvimento econ�mico e do aumento da demanda de
energia e de insumos qu�micos. O programa brasileiro de produ��o de etanol
combust�vel utiliza a fermenta��o do mela�o de cana por leveduras do g�nero
Saccharomyces.
Acetona e butanol, importantes solventes empregados nas ind�strias qu�mica e
farmac�utica, s�o produzidos na fermenta��o de mela�o de cana pela bact�ria
Clostridium acetobutylicum. O �cido c�trico, largamente empregado pela ind�stria de
refrigerantes, � produzido pela fermenta��o do mela�o de cana por bact�rias do
g�nero Aspergillus.
Guia de leitura
Responda em seu caderno
1 Leia o primeiro e o segundo par�grafos do quadro, que se referem � panifica��o, e
responda:
a) Qual � o agente fermentador?
b) Trata-se de um fungo ou de uma bact�ria?
c) Qual � o substrato fermentado?
d) Qual(is) �(s�o) o(s) produto(s) de interesse nesse caso?
2 Leia o terceiro par�grafo, que trata da fabrica��o de bebidas alco�licas. Utilize
os mesmos crit�rios da quest�o anterior, itens de a) a d), para fazer uma tabela
que relacione os seguintes produtos da fermenta��o tratados no texto: cerveja,
vinho, tequila, saqu�. Aten��o: voc� continuar� a completar essa tabela nos itens a
seguir; deixe espa�o para mais cinco linhas.
3 Leia o quarto e o quinto par�grafos do quadro, que se referem � fermenta��o na
produ��o de latic�nios, e responda:
a) Qual � a fun��o da enzima renina na fabrica��o de queijos?
b) Continue a completar a tabela que voc� fez na quest�o anterior, acrescentando os
seguintes produtos da fermenta��o: queijo su��o e iogurte.
4 Leia o sexto par�grafo e continue a completar a tabela, acrescentando mais um
produto: o vinagre.
5 No s�timo par�grafo, encontre mais informa��es para completar sua tabela com os
seguintes produtos da fermenta��o: chocolate e molho de soja.
6 Leia o oitavo e �ltimo par�grafo do quadro, que comentam a import�ncia da
fermenta��o na ind�stria de �lcool combust�vel e de outras subst�ncias produzidas
em larga escala. Voc� est� informado sobre a produ��o de etanol combust�vel no
Brasil? Considere esse tema para uma pesquisa.

P�gina 155

8.2 A respira��o aer�bica


A respira��o aer�bica � um processo em que mol�culas org�nicas provenientes do
alimento s�o degradadas com a participa��o de g�s oxig�nio (O2), levando � forma��o
de g�s carb�nico (CO2) e �gua (H2O); nesse processo, � liberada energia para a
s�ntese de mol�culas de ATP.
A equa��o geral da respira��o aer�bica �:
C6H12O6 + 6 O2 ? 6 CO2 + 6 H2O + energia no ATP
Glicose
G�s
G�s
�gua
oxig�nio
carb�nico

Note que essa equa��o corresponde, quanto a reagentes e produtos, ao inverso da


fotoss�ntese. Al�m disso, ela representa tamb�m a combust�o total da glicose, com a
diferen�a de que a energia liberada na combust�o ocorre na forma de calor e luz,
enquanto na respira��o aer�bica grande parte dessa energia � armazenada nas
mol�culas de ATP.
A equa��o geral apresenta um resumo muito simplificado da respira��o aer�bica. Na
verdade, esta se comp�e de diversas etapas enzimaticamente controladas, durante as
quais a energia potencial qu�mica da glicose � liberada aos poucos e armazenada nas
mol�culas de ATP.
Rendimento e etapas da respira��o aer�bica
A respira��o aer�bica tem rendimento cerca de 15 vezes maior que o da fermenta��o:
enquanto esta leva � produ��o de 2 mol�culas de ATP por mol�cula de glicose, na
respira��o aer�bica, uma �nica mol�cula de glicose libera energia suficiente para a
s�ntese de aproximadamente 30 mol�culas de ATP.
A que se pode atribuir essa diferen�a de rendimento energ�tico entre os dois
processos? A resposta est� no grau em que a glicose � degradada. Na fermenta��o,
ocorre degrada��o parcial e os produtos, como o �lcool et�lico ou o �cido l�tico,
ainda t�m muita energia acumulada. Na respira��o aer�bica, a cadeia carb�nica da
mol�cula de glicose � totalmente degradada a g�s carb�nico e �gua, subst�ncias
inorg�nicas com pouca energia potencial qu�mica para liberar.
O alto rendimento da respira��o aer�bica, associado � abund�ncia de g�s oxig�nio na
atmosfera terrestre, fez com que esse processo de obten��o de energia representasse
uma grande vantagem evolutiva, estando presente quase universalmente nos seres da
biosfera: algas, plantas, protozo�rios, animais e muitos fungos e bact�rias.
A respira��o aer�bica da glicose comp�e-se de tr�s etapas: glic�lise, ciclo de
Krebs e fosforila��o oxidativa. A glic�lise ocorre no citosol, fluido que comp�e o
citoplasma; em c�lulas eucari�ticas, o ciclo de Krebs e a fosforila��o oxidativa
ocorrem no interior das mitoc�ndrias (relembre a Fig. 5.19 no cap�tulo 5).
Fase citoplasm�tica da respira��o: glic�lise
A glic�lise � a fase preparat�ria da degrada��o da glicose, produzindo subst�ncias
que entrar�o na mitoc�ndria para as rea��es seguintes, que envolvem o g�s oxig�nio.
Como vimos, a glic�lise consiste na quebra da mol�cula de glicose em duas mol�culas
de �cido pir�vico1, com saldo l�quido de duas mol�culas de ATP. Na glic�lise,
formam-se tamb�m duas mol�culas de NADH, a partir do NAD+, e s�o liberados el�trons
e �ons H+.
A glic�lise n�o necessita de g�s oxig�nio para ocorrer. As etapas seguintes da
respira��o, por�m, s� ocorrem se houver disponibilidade de g�s oxig�nio. Na falta
dele, o �cido pir�vico � transformado, ainda no citosol, em �cido l�tico ou em
etanol e g�s carb�nico, dependendo do tipo de organismo.

P�gina 156

Fase mitocondrial da respira��o aer�bica


Se houver g�s oxig�nio dispon�vel na c�lula, o �cido pir�vico produzido na
glic�lise � transportado para dentro da mitoc�ndria, onde reage com uma subst�ncia
denominada coenzima A (CoA). Nessa rea��o, formam-se acetilcoenzima A (acetilCoA,
mol�cula constitu�da por dois �tomos de carbono) e g�s carb�nico (CO2). Participa
do processo uma mol�cula de NAD+, que se transforma em NADH ao capturar dois
el�trons de alta energia e um dos dois �ons H+ liberados na rea��o:
�cido pir�vico + CoA + NAD+ ? AcetilCoA + NADH + CO2 + H+
Ciclo de Krebs ou ciclo do �cido c�trico
A acetilCoA � o ponto de partida para um conjunto de rea��es que comp�em o ciclo de
Krebs, tamb�m conhecido como ciclo do �cido c�trico. A primeira denomina��o
homenageia seu descobridor, o bioqu�mico alem�o Hans Adolf Krebs (1900-1981); a
segunda refere-se � primeira subst�ncia formada no ciclo, o �cido c�trico.
Assim que se forma na mitoc�ndria, cada mol�cula de acetilCoA reage com uma
mol�cula de �cido oxalac�tico tamb�m presente na organela. Nessa rea��o, a coenzima
A � liberada e forma-se uma mol�cula de �cido c�trico, o primeiro reagente a
participar do ciclo. Ao longo de oito rea��es, s�o liberadas duas mol�culas de g�s
carb�nico, el�trons de alta energia e �ons H+. Ao final, forma-se novamente �cido
oxalac�tico, que pode se combinar a outra acetilCoA e reiniciar o ciclo.
Durante as rea��es do ciclo de Krebs, el�trons de alta energia e �ons H+ s�o
capturados por mol�culas de NAD+, que se transformam em NADH. Tamb�m participa do
ciclo de Krebs outro tipo de aceptor de el�trons, o FAD (do ingl�s flavine adenine
dinucleotide: dinucleot�dio de flavina-adenina), que se transforma em FADH2. Ao
longo do ciclo, s�o formados 3 NADH e 1 FADH2.
Em uma das etapas do ciclo, a energia liberada permite a forma��o direta de uma
mol�cula de trifosfato de guanosina, ou GTP (do ingl�s guanosine triphosphate), a
partir de GDP (difosfato de guanosina) e Pi. O GTP � muito semelhante ao ATP,
diferindo dele apenas por apresentar a base nitrogenada guanina em vez de adenina.
O GTP fornece energia para alguns processos celulares, como a s�ntese de prote�nas.
Tamb�m pode ser convertido em ATP pela transfer�ncia de seu fosfato energ�tico para
um ADP.
Em resumo, no ciclo de Krebs s�o formados 2 CO2 + 3 NADH + 1 FADH2 + 1 GTP
(equivalente a 1 ATP). (Fig. 8.3)
ADILSON SECCO
Figura 8.3 Esquema das transforma��es do �cido pir�vico. No interior da
mitoc�ndria, o �cido pir�vico origina acetilCoA, que participa da sequ�ncia de
rea��es qu�micas do ciclo de Krebs (ou ciclo do �cido c�trico).

P�gina 157

Fosforila��o oxidativa
A s�ntese da maior parte do ATP produzido na respira��o aer�bica ocorre na
transfer�ncia de el�trons e de �ons de hidrog�nio das mol�culas de NADH e FADH2
para �tomos provenientes do g�s oxig�nio; essa rea��o leva � forma��o de mol�culas
de �gua, como est� resumido nas equa��es a seguir:
2 NADH + 2H+ + O2 ? 2 NAD+ + 2 H2O
2 FADH2 + O2 ? 2 FAD + 2 H2O
A energia liberada pelos el�trons durante sua transfer�ncia at� o g�s oxig�nio �
utilizada para produzir ATP. A express�o fosforila��o oxidativa refere-se
exatamente � adi��o de fosfato ao ADP para formar ATP, uma rea��o de fosforila��o.
Ela � denominada oxidativa porque ocorre em diversas rea��es de oxida��o
sequenciais, sendo o g�s oxig�nio (O2) o �ltimo agente oxidante dessa cadeia de
rea��es.
O processo de transfer�ncia de el�trons e de �ons H+ do NADH (e do FADH2) para o
g�s oxig�nio � realizado por quatro grandes complexos de prote�na, que se disp�em
em sequ�ncia na membrana interna da mitoc�ndria. Entre os componentes dessas
prote�nas, destacam-se os citocromos, que t�m ferro em sua composi��o. Cada
conjunto sequencial de transferidores de el�trons � denominado cadeia
transportadora de el�trons, que, nesse caso, tamb�m recebe o nome de cadeia
respirat�ria.
Durante a passagem pela cadeia respirat�ria, os el�trons liberam gradativamente
energia, que � utilizada para bombear �ons H+ da matriz mitocondrial para o espa�o
entre as duas membranas da organela. Os �ons H+ acumulados "� for�a" no espa�o
entre as membranas mitocondriais tendem a se difundir de volta para a matriz
mitocondrial, mas s� podem fazer isso passando pela sintase do ATP, presente na
membrana interna da mitoc�ndria.
O mecanismo � o mesmo que ocorre nos tilacoides dos cloroplastos. Como vimos no
cap�tulo anterior, a sintase do ATP � compar�vel a um gerador molecular acionado
pela passagem dos �ons H+, quando produz mol�culas de ATP a partir de ADP e Pi.
Esse mecanismo de produ��o de ATP, comprovado em diversos experimentos, � conhecido
como teoria quimiosm�tica para a s�ntese de ATP. (Fig. 8.4)

JURANDIR RIBEIRO
Figura 8.4 Representa��o esquem�tica de detalhe dos conjuntos transportadores da
cadeia respirat�ria e da sintase do ATP. (Elementos fora de propor��o de tamanho
entre si; cores-fantasia.) (Elaborada com base em Campbell, N. e cols., 1999.)

P�gina 158

Ao retornar � matriz mitocondrial, os �ons H+ combinam-se a el�trons que foram


"desenergizados" ao longo da cadeia respirat�ria e a �tomos de oxig�nio
provenientes do O2, com forma��o de mol�culas de �gua (H2O). (Fig. 8.5)

JURANDIR RIBEIRO
Figura 8.5 Representa��o esquem�tica da enzima sintase do ATP, de acordo com a
teoria quimiosm�tica. A enzima utiliza o potencial de difus�o dos �ons H+ que
haviam sido for�ados a se acumular no espa�o entre as membranas mitocondriais,
durante a cadeia respirat�ria, para produzir ATP. (Elementos fora de propor��o de
tamanho entre si; cores-fantasia.) (Elaborada com base em Campbell, N. e cols.,
1999.)
A energia liberada pelos el�trons de alta energia em sua passagem pela cadeia
respirat�ria pode formar, teoricamente, 34 mol�culas de ATP; em condi��es normais,
no entanto, o rendimento � menor, formando at� um m�ximo de 26 mol�culas de ATP.
Somando essas 26 mol�culas aos 2 ATP formados na glic�lise e aos 2 formados no
ciclo de Krebs (um GTP para cada acetilCoA), chega-se a um rendimento m�ximo de 30
mol�culas de ATP por mol�cula de glicose, embora o rendimento te�rico seja de 38
ATP por mol�cula de glicose. (Fig. 8.6)

ADILSON SECCO
Figura 8.6 Representa��o esquem�tica das etapas do metabolismo aer�bico da glicose
com produ��o de ATP. A glic�lise ocorre no fluido citoplasm�tico, o citosol,
enquanto o ciclo de Krebs e a cadeia respirat�ria ocorrem no interior da
mitoc�ndria. Cada mol�cula de glicose metabolizada pode produzir at� 30 ATP.
(Elementos fora de propor��o de tamanho entre si; cores-fantasia.)
Outras subst�ncias capazes de fornecer energia por meio da respira��o aer�bica s�o
os lip�dios. Antes de serem utilizadas, as mol�culas de �cido graxo s�o
transportadas para o interior das mitoc�ndrias, onde se transformam em mol�culas de
acetilCoA, que entram no ciclo de Krebs.

P�gina 159

ATIVIDADES
Revendo conceitos, fatos e processos
Registre em seu caderno
Escreva, em seu caderno, o termo abaixo que substitui corretamente a tarja entre
par�nteses das frases de 1 a 7.
a) cadeia respirat�ria
b) ciclo de Krebs
c) fermenta��o
d) fosforila��o oxidativa
e) fotoss�ntese
f) glic�lise
g) respira��o aer�bica
1. (.....) � o processo de s�ntese de subst�ncias org�nicas a partir de �gua, g�s
carb�nico e energia luminosa.
2. (.....) � um processo de obten��o de energia em que as mol�culas org�nicas s�o
parcialmente degradadas, com rendimento energ�tico relativamente baixo.
3. (.....) � um conjunto de rea��es sequenciais que ocorrem nas mitoc�ndrias e cujo
primeiro participante � o �cido c�trico.
4. O processo de produ��o de ATP na mitoc�ndria, denominado (.....), utiliza
energia dos el�trons provenientes da degrada��o de mol�culas org�nicas.
5. (.....) corresponde a um conjunto de subst�ncias presentes na membrana interna
das mitoc�ndrias, por onde passam sequencialmente el�trons energizados provenientes
das mol�culas org�nicas degradadas.
6. Realizado(a) pela ampla maioria dos seres vivos, o(a) (.....) � um processo de
obten��o de energia em que mol�culas org�nicas ricas em energia s�o totalmente
degradadas em g�s carb�nico e �gua.
7. O(A) (.....) � um conjunto sequencial de rea��es que ocorrem no citosol, em que
uma mol�cula de glicose � degradada em duas mol�culas de �cido pir�vico.
8. Qual das alternativas indica corretamente os compartimentos celulares em que
ocorrem as diversas etapas da respira��o celular?
Ciclo de Krebs Glic�lise Fosforila��o oxidativaa)CitosolMitoc�ndria Citosolb)
Mitoc�ndriaMitoc�ndriaMitoc�ndriac)Mitoc�ndriaCitosol Citosold)Mitoc�ndria Citosol
Mitoc�ndria9. Qual conjunto de rea��es � respons�vel pela produ��o da maior parte
do CO2 liberado no metabolismo das c�lulas musculares em uma atividade leve e com
suprimento de O2 adequado?
a) Glic�lise.
b) Ciclo de Krebs.
c) Fermenta��o l�tica.
d) Fosforila��o oxidativa.
10. Qual etapa metab�lica ocorre tanto na respira��o aer�bica quanto na
fermenta��o?
a) Transforma��o do �cido pir�vico em �cido l�tico.
b) Produ��o de ATP por fosforila��o oxidativa.
c) Ciclo de Krebs.
d) Glic�lise.
11. Fisiologistas esportivos de um centro de treinamento ol�mpico desejam
determinar a partir de que ponto os m�sculos dos atletas deixam de receber a
quantidade necess�ria de g�s oxig�nio e come�am a suplementar a energia pela
fermenta��o. Eles podem fazer isso investigando, nos m�sculos, o aumento de qual
subst�ncia?
a) ATP.
b) ADP.
c) G�s carb�nico.
d) �cido l�tico.
Utilize as alternativas a seguir para responder �s quest�es de 12 a 14.
a) C6H12O6 (glicose) + 6 O2 (g�s oxig�nio) ? 6 CO2 (g�s carb�nico) + 6 H2O (�gua)
b) 6 CO2 (g�s carb�nico) + 12 H2O (�gua) ? C6H12O6 (glicose) + 6 O2 (g�s oxig�nio)
+ 6 H2O (�gua)
c) C6H12O6 (glicose) ? 2 H5C2OH (etanol) + 2 CO2 (g�s carb�nico)
12. Qual alternativa representa a equa��o da respira��o celular?
13. Qual alternativa representa a equa��o da fotoss�ntese realizada por algas e
plantas?
14. Qual alternativa cont�m a equa��o da fermenta��o realizada pelo fermento
biol�gico?
15. Imagine o ciclo de Krebs como um carrossel de subst�ncias qu�micas em
transforma��o. A subst�ncia que d� in�cio ao ciclo � o �cido c�trico (6 carbonos na
mol�cula), formado a partir da uni�o do �cido oxalac�tico (4 carbonos na mol�cula)
com uma subst�ncia proveniente da descarboxila��o do �cido pir�vico. Qual � ela?
a) 3-fosfato gliceralde�do (PGAL)
b) AcetilCoA
c) NADPH
d) NAD+

P�gina 160

16. A energia da passagem de �ons H+ atrav�s das sintetases leva � s�ntese de ATP.
Esse � o ponto central da
a) hip�tese autotr�fica.
b) hip�tese heterotr�fica.
c) teoria celular.
d) teoria quimiosm�tica.
Quest�o para exercitar o pensamento
Registre em seu caderno
17. Na d�cada de 1940, alguns m�dicos prescreveram doses baixas da droga
dinitrofenol (DNP) para ajudar pacientes a emagrecer, mas o tratamento foi
abandonado ap�s a morte de alguns deles. Hoje se sabe que o DNP torna a membrana
interna da mitoc�ndria perme�vel � passagem de �ons H+. Com base no que aprendeu
sobre a teoria quimiosm�tica de produ��o de ATP em mitoc�ndrias e cloroplastos,
explique as consequ�ncias metab�licas do DNP na respira��o celular.
Fa�a voc� mesmo!
Registre em seu caderno
18. Atividade pr�tica: Libera��o de g�s carb�nico na fermenta��o
Apresentamos nesta atividade um experimento simples que permite testar diversas
hip�teses sobre a fermenta��o, entre elas: 1. o processo depende de um substrato
org�nico, como um a��car; 2. o processo � influenciado pela temperatura; 3. o
processo depende da presen�a de leveduras.
Material
- fermento biol�gico (30 g de fermento fresco ou 10 g de fermento seco);
- 6 garrafas pl�sticas vazias de �gua ou refrigerante (500 mL), com tampa;
- bal�es de borracha (bexigas);
- tubos pl�sticos (como os utilizados em bombas de aqu�rio);
- a��car;
- montagem para banho-maria;
- gelo.
! Aten��o: A manipula��o do fogo ficar� a cargo do professor.
Procedimento
1. Dissolva o fermento biol�gico em 200 mL de �gua. Numere as garrafas de 1 a 4 e
distribua quantidades iguais da solu��o de fermento em cada uma delas. Nas garrafas
5 e 6, adicione apenas �gua.
2. Adicione uma colher de sopa de a��car em cada uma das garrafas, exceto nas de
n�meros 1 e 6. Adapte uma bexiga � boca de cada uma das garrafas. Deixe as garrafas
1, 2, 5 e 6 � temperatura ambiente; coloque a garrafa de n�mero 3 em um banho de
gelo; o professor colocar� a garrafa de n�mero 4 em banho-maria de temperatura
entre 35 �C e 40 �C. Observe e anote o que ocorre com as bexigas nas horas
seguintes. Responda �s quest�es a seguir.
a) Qual � o papel da garrafa de n�mero 6?
b) Quais garrafas permitem testar a hip�tese de que a presen�a das leveduras �
necess�ria para a produ��o de g�s carb�nico? Justifique.
c) Quais garrafas permitem testar a hip�tese de que a presen�a de a��car �
necess�ria para a produ��o de g�s carb�nico? Justifique.
d) Quais garrafas permitem testar a hip�tese de que a produ��o de g�s carb�nico �
afetada pela temperatura? Justifique.
A Biologia no vestibular e no Enem
Registre em seu caderno
Quest�es objetivas
1. (Ufac) A maioria dos seres vivos atuais obt�m energia por meio da respira��o
celular, tamb�m chamada respira��o aer�bia por utilizar o oxig�nio atmosf�rico.
Esse tipo de respira��o comp�e-se de tr�s etapas: glic�lise, ciclo de Krebs e
cadeia respirat�ria. Indique corretamente em quais compartimentos da c�lula ocorrem
as diferentes etapas da respira��o.
a) Citosol, mitoc�ndria, mitoc�ndria.
b) Citosol, citosol, mitoc�ndria.
c) Mitoc�ndria, mitoc�ndria, citosol.
d) Mitoc�ndria, citosol, mitoc�ndria.
e) Citosol, mitoc�ndria, citosol.
2. (UFRGS-RS) As c�lulas animais para a produ��o de energia necessitam de oxig�nio,
enzimas e substrato. Em rela��o ao processo de produ��o de energia, considere as
afirma��es abaixo.
I. A fosforila��o oxidativa ocorre nas mitoc�ndrias.
II. Na fase aer�bia, ocorre alta produ��o de ATP.
III. A glic�lise possui uma fase aer�bia e outra anaer�bia.
Quais est�o corretas?
a) Apenas I.
b) Apenas II.
c) Apenas I e II.
d) Apenas II e III.
e) I, II e III.
3. (Unifor-CE) A rea��o qu�mica a seguir esquematiza o processo da fermenta��o
alco�lica.
2 ADP ?(??(glicose ? �lcool et�lico + g�s carb�nico)) 2 ATP
[F�rmula adaptada]
A ind�stria utiliza esse processo na fabrica��o de
a) vinho.
b) iogurte.
c) coalhada.
d) vinagre.
e) picles.
P�gina 161

4. (UFPI) A atmosfera terrestre cont�m uma grande quantidade de oxig�nio e, na


presen�a do oxig�nio, a forma de carbono mais est�vel energeticamente � o CO2; o
mesmo ocorre com o hidrog�nio e com a �gua. Assim, a c�lula � capaz de obter
energia de a��cares e de outras mol�culas org�nicas pela combina��o dos �tomos de
carbono e de hidrog�nio com oxig�nio, para produzir CO2 e H2O, respectivamente, em
um processo chamado de
a) fotoss�ntese.
b) fotofosforila��o.
c) respira��o.
d) cat�lise.
e) fixa��o de carbono.
5. (Unifor-CE) O esquema seguinte mostra de modo simplificado um tipo de rea��o
celular metab�lica.

O processo representado �
a) respira��o anaer�bia.
b) respira��o aer�bia.
c) quimioss�ntese.
d) fotoss�ntese.
e) glic�lise.
6. (UPF-RS) As mitoc�ndrias s�o estruturas citoplasm�ticas respons�veis pela
respira��o celular. Analise a figura a seguir, que representa uma mitoc�ndria,
considerando que I = crista mitocondrial, II = matriz mitocondrial, III = membrana
interna e IV = membrana externa.

ADILSON SECCO
(Esquema simplificado.)
Nas estruturas indicadas pelos n�meros I e II, ocorrem, respectivamente,
a) o ciclo de Krebs e a cadeia transportadora de el�trons.
b) a glic�lise e o ciclo de Krebs.
c) a cadeia transportadora de el�trons e a glic�lise.
d) a cadeia transportadora de el�trons e o ciclo de Krebs.
e) a glic�lise e a cadeia transportadora de el�trons.
7. (Uece) Todos os seres vivos necessitam de energia para viver e para isso
realizam processos metab�licos variados. Enquanto organismos mais complexos
realizam respira��o aer�bica para obter energia, alguns microrganismos, como
bact�rias e fungos, utilizam a fermenta��o. Com rela��o aos processos existentes no
mundo vivo para a obten��o de energia, analise as afirmativas a seguir.
I. A glicose � o combust�vel inicial tanto da respira��o quanto da fermenta��o.
II. Os vegetais fazem fotoss�ntese durante o dia e respiram apenas � noite.
III. As leveduras fermentam a��cares para produzir �cido l�tico.
IV. Como os microrganismos precisam se multiplicar com rapidez, realizam
fermenta��o, processo mais eficiente com rela��o ao balan�o energ�tico do que a
respira��o aer�bia, pois � mais r�pido.
� correto o que se afirma em
a) I, II e IV.
b) I, apenas.
c) I, II e III.
d) III, apenas.
Quest�es discursivas
8. (Fuvest-SP) No processo de fabrica��o do p�o, um ingrediente indispens�vel � o
fermento, constitu�do por organismos anaer�bios facultativos.
a) Qual a diferen�a entre o metabolismo energ�tico das c�lulas que ficam na
superf�cie da massa e o metabolismo energ�tico das c�lulas que ficam no seu
interior?
b)Por que o fermento faz o p�o crescer?
9. (Unicamp-SP) O processo de fermenta��o foi inicialmente observado no fungo
Saccharomyces. Posteriormente, verificou-se que os mam�feros tamb�m podem fazer
fermenta��o.
a) Em que circunst�ncia esse processo ocorre nos mam�feros?
b) D� dois exemplos da import�ncia do processo de fermenta��o para a obten��o de
alimentos.
10. (UFMA) O esquema abaixo representa a primeira etapa da respira��o aer�bia
(glic�lise). Ap�s analis�-lo, responda:

a) Em que local da c�lula ela ocorre?


b) Qual � o gasto energ�tico dessa fase e qual � o saldo em ATP?
11. (Fuvest-SP) H� um s�culo, Louis Pasteur, investigando o metabolismo do levedo,
um organismo anaer�bio facultativo, observou que, em solu��o de �gua e a��car, esse
microrganismo se multiplicava. Observou tamb�m que a multiplica��o era maior quando
a solu��o era aerada.
a) Explique a import�ncia do a��car para o levedo.
b) Justifique a diferen�a do crescimento nas condi��es aer�bia e anaer�bia.

P�gina 162

M�dulo 4 Reprodu��o e desenvolvimento


Conhe�a os cap�tulos deste m�dulo
A "inven��o" do sexo pelos seres vivos possibilitou combinar caracter�sticas de
dois indiv�duos no descendente, com chances de as novas combina��es serem bem-
sucedidas na luta pela vida. Tudo come�a pelo encontro de um par de gametas.
Confira, nos cap�tulos deste m�dulo, como come�a uma nova vida nas esp�cies animais
e os tipos de tecidos que constituem o corpo de uma pessoa.
Cap�tulo 9
O zigoto, a c�lula formada pela uni�o dos gametas, tem dois conjuntos de
cromossomos, um materno e outro paterno. Uma vez que s�o originadas por mitoses do
zigoto, todas as c�lulas de nosso corpo tamb�m ter�o dois conjuntos de cromossomos
no n�cleo. Na maturidade, uma linhagem celular especial torna-se capaz de realizar
meiose e formar gametas, c�lulas portadoras de apenas um conjunto de cromossomos.
Conhecer o processo de meiose � essencial para compreender a reprodu��o sexuada,
como veremos mais adiante neste livro.
Cap�tulo 10
O desenvolvimento de um embri�o animal � um fant�stico empreendimento celular.
Trata-se da constru��o de um organismo altamente complexo a partir de uma �nica
c�lula, o zigoto. Um empreendimento como esse requer um elevado grau de organiza��o
e planos gen�ticos precisos, com uma rigorosa sucess�o de etapas no espa�o corporal
e no tempo. Como isso ocorre? Embora j� se conhe�a o passo a passo desse processo
celular, seus mecanismos de controle at� hoje desafiam a compreens�o dos
cientistas.
Cap�tulo 11
Abordamos aqui aspectos b�sicos da reprodu��o em nossa esp�cie. O conhecimento
cient�fico sobre o tema e sua recente populariza��o t�m levado cada vez mais
pessoas a compreender os fundamentos da reprodu��o humana. Trata#se de um exerc�cio
de cidadania n�o apenas por favorecer a liberdade de escolha de cada um, mas tamb�m
por possibilitar reflex�es mais aprofundadas sobre o crescimento populacional
humano em um mundo j� t�o intensamente povoado.
Cap�tulo 12
Animais e plantas s�o formados por diversos tecidos, que s�o conjuntos de c�lulas
especializados em executar fun��es definidas. No corpo humano h�, segundo alguns
especialistas, 216 tipos de tecidos, incluindo os que formam a placenta e os anexos
embrion�rios. O conhecimento detalhado da estrutura e do funcionamento dos
organismos, desde as mol�culas at� os tecidos, tem possibilitado um futuro otimista
para a humanidade, principalmente no tratamento e na cura de in�meras doen�as.
Neste cap�tulo estudaremos os principais tecidos do corpo humano.

MARJA VAN DER LAAN/MINDEN PICTURES/FOTOARENA


Casal de lib�lulas da esp�cie Enallagma cyathigerum em c�pula. O macho apresenta
colora��o azulada, enquanto a f�mea tem cor marrom-clara. Esses insetos t�m
aproximadamente 3 cm de comprimento.

P�gina 163

Cap�tulo 9 Tipos de reprodu��o, meiose e fecunda��o


Itens principais:
- Tipos de reprodu��o
- Meiose e reprodu��o
- Gametas e fecunda��o nos animais
- Meiose e ciclos de vida

WIM VAN EGMOND/GETTY IMAGES


Cap�tulo 10 Desenvolvimento embrion�rio animal
Itens principais:
- Segmenta��o e forma��o da bl�stula
- Gastrula��o
- Organog�nese
- Anexos embrion�rios

DR. YORGOS NIKAS/SCIENCE PHOTO LIBRARY/LATINSTOCK


Cap�tulo 11 Reprodu��o humana
Itens principais:
- Sistema genital feminino
- Sistema genital masculino
- Horm�nios relacionados � reprodu��o
- Gravidez e parto

ISM/SCIENCE PHOTO LIBRARY/LATINSTOCK


Cap�tulo 12 A diversidade celular dos vertebrados
Itens principais:
- A diversidade de tecidos vivos
- Tecido epitelial
- Tecido conjuntivo
- Tecido muscular
- Tecido nervoso

MAURO FERMARIELLO/SCIENCE PHOTO LIBRARY/LATINSTOCK

P�gina 164

Cap�tulo 9 Tipos de reprodu��o, meiose e fecunda��o

WIM VAN EGMOND/GETTY IMAGES


Fotomicrografia de pares de filamentos de alga do g�nero Spirogyra em processo de
conjuga��o. Note c�lulas j� vazias no par de filamentos inferior e a presen�a de
in�meros canais de conjuga��o para a transfer�ncia do conte�do de uma c�lula para
outra. (Microsc�pio fot�nico; aumento ? 175�.)
Sexo e reprodu��o
Por que a sexualidade ocupa espa�o t�o expressivo em todas as sociedades? Em alguns
pa�ses, sexo faz parte dos neg�cios, do show business. Em outros, � tratado como
assunto proibido, envolto em tabus e preconceitos. Ambas as vis�es revelam a mesma
coisa, que percebemos desde a inf�ncia: sexo � realmente importante!
� natural que voc� esteja pensando agora na import�ncia do sexo em sua vida:
prazer, emo��es, amor, talvez filhos. Entretanto, neste cap�tulo trataremos o
assunto de um ponto de vista mais abrangente: por que a reprodu��o por meio do sexo
� t�o disseminada no mundo vivo?
Com exce��o dos seres procari�ticos (bact�rias e arqueas), que n�o t�m reprodu��o
sexuada propriamente dita, h� pouqu�ssimos organismos eucari�ticos em que o sexo
n�o est� presente; algumas esp�cies de plantas cultivadas, como a banana, perderam
os processos sexuais e passaram a se reproduzir exclusivamente por brotamento. Em
certas esp�cies de animais, como alguns lagartos, os machos foram eliminados: os
�vulos das f�meas desenvolvem-se sem necessidade de fecunda��o por um processo
denominado partenog�nese.
A universalidade do sexo sugere que ele surgiu h� muito tempo na hist�ria evolutiva
da vida, possivelmente em antigos organismos unicelulares dos quais descendemos n�s
e todos os seres eucari�ticos atuais. Quais seriam as vantagens da reprodu��o
sexuada se h� organismos como as bact�rias, que se reproduzem assexuadamente com
grande sucesso h� mais de 3 bilh�es de anos? Acompanhe essa quest�o em seus
aspectos moleculares e cromoss�micos e descubra por que o sexo, como forma de
reprodu��o, faz tanto sucesso.

P�gina 165

A import�ncia do assunto
Os assuntos tratados neste cap�tulo s�o de grande import�ncia tanto para a Biologia
como para a compreens�o de nossa vida. Temas como a sexualidade, com suas
implica��es comportamentais e morais, adquirem maior consist�ncia se tamb�m forem
considerados os seus aspectos biol�gicos. A sexualidade � importante em nosso
cotidiano por estar diretamente relacionada � nossa sobreviv�ncia na Terra.
O ponto central do cap�tulo � a meiose, processo pelo qual os animais formam
gametas e as plantas formam esporos. O assunto � relativamente complexo, mas est�
longe de ser dif�cil ou mera "decoreba". Tendo em vista o papel da meiose para a
continuidade da vida, devem-se valorizar seus aspectos fundamentais e sua
import�ncia na reprodu��o; nesse contexto, os detalhes passam a ter fun��o mais
ilustrativa, exemplificando a nomenclatura utilizada pelos cientistas.
9.1 Tipos de reprodu��o
A reprodu��o - processo pelo qual os seres vivos originam descendentes - � a
maneira pela qual a vida tem se perpetuado em nosso planeta desde sua origem. Se
retroced�ssemos ao tempo de nossos ancestrais unicelulares mais antigos,
chegar�amos ao momento em que surgiu a primeira forma de reprodu��o: a capacidade
de se dividir em dois, de crescer e novamente se dividir, perpetuando nos
descendentes os processos vitais.
Processos assexuados de reprodu��o
Quando um �nico genitor d� origem a descendentes geneticamente id�nticos a si,
fala-se em reprodu��o assexuada. Como veremos a seguir, esse tipo de reprodu��o
pode ocorrer de diversas maneiras.
A maioria dos organismos unicelulares - bact�rias, protozo�rios e algas
unicelulares - reproduz-se por divis�o bin�ria, tamb�m conhecida como
cissiparidade, processo assexuado que consiste na divis�o do indiv�duo genitor em
dois novos indiv�duos.
Certas algas e fungos multicelulares formam c�lulas reprodutivas especiais
denominadas esporos; estes s�o liberados no ambiente e, se as condi��es forem
favor�veis, desenvolvem-se em novos indiv�duos. A reprodu��o por esporos �
denominada esporula��o. (Fig. 9.1)

CNRI/SCIENCE PHOTO LIBRARY/LATINSTOCK

ED RESCHIKE/GETTY IMAGES

ANTONSOV85/SHUTTERSTOCK

ANDR� VAZZIOS
Figura 9.1 A. Fotomicrografia da bact�ria Escherichia coli em divis�o bin�ria.
(Microsc�pio eletr�nico de transmiss�o; aumento ? 30.000�; cores artificiais.) B.
Fotomicrografia do protozo�rio param�cio (Paramecium sp.) em divis�o bin�ria.
(Microsc�pio eletr�nico de varredura; aumento ? 180�; cores artificiais.) C. Os
diferentes tipos de bolor que surgem no p�o prov�m, na maioria das vezes, de
esporos assexuais presentes no ar. D. Representa��o esquem�tica da esporula��o do
bolor negro do p�o, o fungoRhizopus sp. (Elementos fora de propor��o de tamanho
entre si; cores-fantasia.)

P�gina 166

Certas algas, plantas, fungos e alguns animais invertebrados reproduzem-se


assexuadamente por brotamento. Nesse processo, um indiv�duo forma expans�es
corporais, os brotos, que depois se separam do genitor e passam a ter vida
independente.
Algumas algas, plantas e animais invertebrados reproduzem-se assexuadamente por
fragmenta��o: partes que se destacam do corpo do genitor regeneram-se e originam
novos indiv�duos. (Fig. 9.2)

DAVID SCHARF/SCIENCE PHOTO LIBRARY/LATINSTOCK

VAVIT/STOCKPHOTO/GETTY IMAGES

ERIC GRAVE/SCIENCE PHOTO LIBRARY/LATINSTOCK


Figura 9.2 A. Fotomicrografia de levedura da esp�cie Saccharomyces cerevisiae
(fermento biol�gico); note um broto em forma��o. (Microsc�pio eletr�nico de
varredura; aumento ? 2.630�; cores artificiais.) B. No morangueiro (g�nero
Fragaria), o estol�o (um tipo de caule) origina assexuadamente novos indiv�duos. As
folhas t�m aproximadamente 4 cm de largura. C. Fotomicrografia de uma hidra (Hydra
sp.) com broto, pequeno animal que vive em lagos e rios e pode se reproduzir por
brotamento. (Microsc�pio fot�nico; aumento ? 40�.)
Certas plantas, certos animais invertebrados e algumas esp�cies de vertebrados
reproduzem-se por partenog�nese, processo em que o gameta feminino desenvolve-se
sem que tenha ocorrido fecunda��o. Em abelhas, por exemplo, ocorre partenog�nese:
machos originam-se pelo desenvolvimento de �vulos n�o fecundados. A rainha, �nica
f�mea f�rtil da colmeia, � capaz de controlar a fecunda��o: depois de copular com
diversos zang�es e armazenar o s�men deles, ela pode p�r ovos (fecundados) e �vulos
(n�o fecundados). Os ovos, diploides, originam f�meas, que poder�o ser rainhas ou
oper�rias, dependendo da alimenta��o. Os �vulos, haploides, desenvolvem-se por
partenog�nese, originando apenas machos, os zang�es. (Fig. 9.3)

ILUSTRA��O: JURANDIR RIBEIRO


Figura 9.3 Partenog�nese em abelhas do g�nero Apis. (Elementos fora de propor��o de
tamanho entre si; cores-fantasia.)
A import�ncia da reprodu��o sexuada
Um passo importante na hist�ria da vida em nosso planeta foi o aparecimento da
reprodu��o sexuada, em que duas c�lulas especializadas - os gametas - se fundem e
originam uma c�lula �nica, o zigoto, que re�ne material gen�tico dos dois gametas.
Os gametas que se unem pela fecunda��o s�o, na maioria dos casos, bem diferentes um
do outro, morfol�gica e funcionalmente. Em geral, um deles � relativamente muito
grande e n�o tem mobilidade pr�pria, enquanto o outro � pequeno e se move
ativamente. Por conven��o, o gameta im�vel � denominado feminino, e o gameta m�vel,
masculino.
Qual seria a vantagem de indiv�duos diferentes misturarem, em uma �nica c�lula,
suas informa��es heredit�rias? De acordo com o evolucionismo, a reprodu��o sexuada
� importante porque leva � forma��o de descendentes de v�rios tipos, em contraste
com a reprodu��o assexuada, em que toda a descend�ncia � geneticamente id�ntica.
Apresentar descend�ncia vari�vel, fen�meno que os cientistas denominam
variabilidade gen�tica, constitui uma vantagem evolutiva porque aumenta a chance de
surgirem indiv�duos capazes de sobreviver e de se adaptar a diferentes condi��es
ambientais.

P�gina 167
9.2 Meiose e reprodu��o
Seres humanos t�m 46 cromossomos nas c�lulas corporais e apenas 23 cromossomos nos
gametas. Pela fecunda��o, um par de gametas se une e forma o zigoto, com 46
cromossomos. O zigoto se multiplica por mitose, processo que conserva o n�mero de
cromossomos nas c�lulas-filhas, originando um ser humano com c�lulas
cromossomicamente id�nticas, isto �, com 46 cromossomos. Mas como se formam, ent�o,
as c�lulas com 23 cromossomos que originam os gametas?
No ciclo de vida de esp�cies como a nossa, cujas c�lulas corporais s�o diploides,
as c�lulas haploides se formam por um processo especial de divis�o celular, a
meiose, em que o n�mero de cromossomos das c�lulas-filhas � reduzido � metade. A
redu��o do n�mero de cromossomos na meiose contrabalan�a a soma dos cromossomos
maternos e paternos que ocorre na fecunda��o.
O termo meiose deriva da palavra grega meiosis, que significa diminui��o,
referindo-se ao fato de o n�mero de cromossomos ser reduzido � metade nas c�lulas-
filhas em rela��o � c�lula-m�e. A redu��o ocorre porque h� apenas uma duplica��o
cromoss�mica seguida de duas divis�es celulares consecutivas, a meiose I e a meiose
II. Formam-se, assim, quatro c�lulas-filhas, cada uma com metade do n�mero de
cromossomos originalmente presente na c�lula-m�e. (Fig. 9.4)

ADILSON SECCO
Figura 9.4 Representa��o esquem�tica da distribui��o de um par de cromossomos
hom�logos �s c�lulas-filhas na mitose e na meiose. A mitose � um processo
equacional de divis�o celular, pois o n�mero de cromossomos conserva-se igual nas
c�lulas-filhas. A meiose � um processo reducional de divis�o: ap�s duas divis�es
sucessivas, a meiose I e a meiose II, formam-se quatro c�lulas-filhas, cada uma com
metade do n�mero de cromossomos originalmente presente na c�lula-m�e. Embora
representados como bastonetes curtos por conveni�ncia did�tica, devemos lembrar
que, na interfase, os cromossomos s�o filamentos longos e finos. (Cores-fantasia.)

P�gina 168

Etapas da meiose
Na interfase que antecede a meiose, como tamb�m ocorre na interfase que antecede a
mitose, h� a duplica��o dos cromossomos, que passam a ser constitu�dos por duas
crom�tides. A c�lula passa, ent�o, pela primeira divis�o mei�tica (meiose I),
originando duas c�lulas-filhas que iniciam rapidamente a segunda divis�o (meiose
II), sem que haja nova duplica��o cromoss�mica. A "mec�nica" b�sica das duas
divis�es � semelhante � da mitose. Esse � um dos argumentos para a hip�tese de que
a meiose surgiu, evolutivamente, a partir da mitose.
As divis�es I e II da meiose compreendem quatro fases cada uma, com os mesmos nomes
das fases da mitose:
- meiose I: pr�fase I, met�fase I, an�fase I e tel�fase I;
- meiose II: pr�fase II, met�fase II, an�fase II e tel�fase II.
Entre as divis�es I e II, pode haver um curto intervalo denominado intercinese.
Semelhan�as e diferen�as entre mitose e meiose
Torna-se mais f�cil entender a meiose se nos prepararmos para o que vamos
encontrar. Estudantes desavisados podem trope�ar na nomenclatura e perder de vista
os aspectos essenciais do processo mei�tico, que s�o fundamentais para compreender
a Gen�tica. Por isso, acompanhe o passo a passo da divis�o celular.
Uma vez que os mecanismos b�sicos de divis�o celular s�o similares na mitose e na
meiose, basta dominar certas particularidades da mitose para compreender a meiose.
Relembraremos, na sequ�ncia, os destaques de cada fase da mitose.
a) Interfase: embora n�o fa�a parte da mitose nem da meiose, ela � imprescind�vel
para o processo de divis�o celular, pois � nessa fase que acontece a duplica��o dos
cromossomos.
b) Pr�fase: na mitose, forma-se o fuso de microt�bulos e os cromossomos se
condensam; o mesmo ocorre na meiose, por�m com algumas diferen�as. A mais marcante
entre a pr�fase da mitose e a pr�fase I da meiose � que, nesta �ltima, os
cromossomos hom�logos se aproximam e se emparelham intimamente, em geral trocando
peda�os entre suas crom�tides.
c) Met�fase: tanto na mitose quanto na meiose, a carioteca desintegra-se e os
microt�bulos do fuso ligam-se aos cromossomos. Aqui tamb�m h� uma diferen�a
marcante entre os dois processos: na met�fase I da meiose, cada cromossomo
duplicado liga-se a microt�bulos de apenas um polo do fuso; na met�fase da mitose,
cada cromossomo duplicado liga-se a fibras de polos celulares opostos.
d) An�fase: o encurtamento dos microt�bulos do fuso ocorre de maneira similar na
mitose e na meiose. A grande diferen�a, por�m, decorrente do tipo de liga��o ao
fuso que ocorreu na met�fase, � que na mitose s�o separadas crom�tides-irm�s de um
cromossomo duplicado, pelo fato de o cromossomo estar ligado �s fibras dos dois
polos celulares, enquanto na an�fase I da meiose se separam cromossomos hom�logos
duplicados, pois o cromossomo est� ligado �s fibras de um �nico polo celular,
embora alguns deles possam ter trocado peda�os de crom�tides.
e) Tel�fase: na mitose e na meiose, as cariotecas se organizam em torno dos
conjuntos cromoss�micos que chegaram aos polos e est�o se descondensando,
reconstituindo dois novos n�cleos. Naqueles formados na tel�fase I, j� ocorreu a
redu��o cromoss�mica. Embora cada cromossomo esteja duplicado, n�o h� pares de
hom�logos no mesmo n�cleo, pois eles se separaram na an�fase I. Ou seja, cada
c�lula formada na tel�fase I tem apenas um representante de cada tipo cromoss�mico,
embora duplicado.
Prepare-se agora para um estudo mais detalhado de cada fase da meiose. Retorne ao
texto acima quantas vezes forem necess�rias para compreender plenamente o fen�meno
mei�tico.
Meiose I
A meiose tem in�cio com a pr�fase I, uma fase mais longa e com muitos eventos
importantes, tendo sido, por isso, dividida em cinco subfases: lept�teno, zig�teno,
paqu�teno, dipl�teno e diacinese.
O lept�teno caracteriza-se pela condensa��o de certos pontos ao longo dos
cromossomos, formando os crom�meros (regi�es mais condensadas e que se coram mais
intensamente). Nessa fase, os cromossomos tornam-se vis�veis ao microsc�pio
fot�nico como fios longos e finos, pontilhados de crom�meros.

P�gina 169

� medida que se condensam, os cromossomos hom�logos duplicados disp�em-se lado a


lado, emparelhando-se perfeitamente ao longo de todo o seu comprimento, como se
fossem as duas partes de um z�per sendo fechado. O emparelhamento ocorre pela
forma��o de uma estrutura proteica entre os cromossomos hom�logos, denominada
complexo sinapton�mico. Essa etapa da pr�fase I � denominada zig�teno.
A etapa seguinte � o paqu�teno. Cada cromossomo do par de hom�logo, agora com suas
crom�tides j� bem condensadas, est� perfeitamente emparelhado ao seu parceiro
aparecendo ao microsc�pio como uma entidade �nica, denominada bivalente ou t�trade.
No dipl�teno, os cromossomos hom�logos que estavam muito bem emparelhados no
paqu�teno come�am a se separar. A separa��o evidencia, em certos casos, as
crom�tides de cromossomos hom�logos cruzadas em determinados pontos, formando
figuras na forma da letra X, denominadasquiasmas (do grego chiasma, cruzado, em
forma de X).
Os quiasmas surgem nos locais em que as crom�tides de cromossomos hom�logos se
romperam e se soldaram de maneira trocada durante o emparelhamento, fen�meno
denominado permuta��o ou crossing#over. A permuta��o cromoss�mica leva � reuni�o,
em um mesmo cromossomo, de genes provenientes da m�e, presentes em um dos
hom�logos, e genes provenientes do pai, presentes no outro hom�logo. (Fig. 9.5)

ILUSTRA��O: OSVALDO SEQUETIN


Figura 9.5 Representa��o esquem�tica da permuta��o entre cromossomos hom�logos.
Dois hom�logos emparelhados (A) sofrem quebras em suas crom�tides (B). Em seguida,
as quebras s�o reparadas, mas o fragmento da crom�tide de um cromossomo pode
soldar-se � crom�tide de seu hom�logo e vice-versa, originando quiasmas (C). Em D,
os cromossomos est�o representados lado a lado para mostrar o resultado das
permuta��es. (Cores-fantasia.)
Na diacinese, a �ltima etapa da pr�fase I, as for�as que levavam ao emparelhamento
cromoss�mico diminuem ainda mais e os cromossomos hom�logos permanecem unidos
apenas pelos quiasmas, que deslizam progressivamente para as extremidades
cromoss�micas, fen�meno conhecido comoterminaliza��o dos quiasmas. Nessa fase, que
marca o final da pr�fase I, a carioteca se desintegra e os pares de cromossomos
hom�logos espalham-se pelo citoplasma. (Fig. 9.6)

ILUSTRA��ES: JURANDIR RIBEIRO


Figura 9.6 Representa��o esquem�tica do comportamento de um par de cromossomos
hom�logos durante a pr�fase I. (Elementos fora de propor��o de tamanho entre si;
cores-fantasia.)

P�gina 170

Tem in�cio, ent�o, a met�fase I. Nessa fase, os cromossomos j� completamente


condensados ligam-se aos microt�bulos do fuso pela regi�o dos centr�meros. Aqui
reside um ponto-chave do processo mei�tico. Enquanto na meiose um hom�logo
duplicado prende-se a microt�bulos de um dos polos, seu parceiro, tamb�m duplicado,
prende-se a microt�bulos do polo oposto. Na met�fase da mitose, como vimos, cada
cromossomo prende-se a microt�bulos de ambos os polos, de modo que as crom�tides-
irm�s ficam unidas a polos opostos.
Como consequ�ncia dessa liga��o cromoss�mica peculiar que ocorre na met�fase I,
cada cromossomo de um par de hom�logos, constitu�do por duas crom�tides unidas pelo
centr�mero, � puxado para um dos polos da c�lula. A separa��o dos cromossomos
duplicados para polos opostos marca aan�fase I. (Fig. 9.7)

OSVALDO SEQUETIN
Figura 9.7 Representa��o esquem�tica da uni�o dos microt�bulos do fuso aos
cromossomos. Na an�fase I da meiose, h� separa��o de cromossomos hom�logos
duplicados. Na an�fase II da meiose e na an�fase da mitose, ocorre separa��o de
crom�tides-irm�s. (Elementos fora de propor��o de tamanho entre si; cores-
fantasia.)
Na tel�fase I, os lotes cromoss�micos em migra��o chegam aos polos da c�lula. O
fuso acrom�tico se desfaz, os cromossomos se descondensam, as cariotecas se
reorganizam e os nucl�olos reaparecem. Surgem, assim, dois n�cleos haploides, pois
h� apenas um representante de cada par de cromossomos hom�logos em cada n�cleo. No
entanto, cada cromossomo ainda est� constitu�do por duas crom�tides unidas pelo
centr�mero.
Geralmente, logo ap�s a primeira divis�o mei�tica, ocorre a citocinese I, que se
caracteriza pela separa��o das duas c�lulas-filhas, que logo iniciam a meiose II.
Meiose II
As duas c�lulas resultantes da meiose I entram em meiose II, processo praticamente
id�ntico a uma mitose.
Na pr�fase II, forma-se o fuso de microt�bulos, os cromossomos se condensam, os
nucl�olos desaparecem e a carioteca se desintegra.
Na met�fase II, cada cromossomo, constitu�do por duas crom�tides, associa-se a
microt�bulos de polos opostos do fuso e alinha-se no plano equatorial da c�lula. Os
centr�meros dividem-se e os microt�bulos come�am a puxar as crom�tides-irm�s para
polos opostos, marcando o in�cio da an�fase II.
Quando as crom�tides-irm�s, agora chamadas de cromossomos-irm�os, chegam aos polos
da c�lula, termina a an�fase e tem in�cio a tel�fase II. Nessa fase, os cromossomos
se descondensam, os nucl�olos reaparecem e as cariotecas se reorganizam. Em
seguida, o citoplasma se divide e s�o formadas duas c�lulas-filhas a partir de cada
c�lula que iniciou a segunda divis�o mei�tica.
No final da meiose, para cada c�lula diploide que iniciou o processo, formam-se
quatro c�lulas haploides. Acompanhe, no esquema a seguir, o processo completo da
meiose. As letras de A a N correspondem �s diferentes fases do processo; tente
identificar cada uma e confira com a legenda do esquema. (Fig. 9.8)

P�gina 171

ILUSTRA��ES: ADILSON SECCO


Figura 9.8 Representa��o esquem�tica das fases da meiose. A. interfase (G1). B.
interfase (G2). C. pr�fase I (lept�teno). D. pr�fase I (zig�teno). E. pr�fase I
(paqu�teno). F. pr�fase I (dipl�teno). G. pr�fase I (diacinese). H. met�fase I. I.
an�fase I. J. tel�fase I. K. pr�fase II. L. met�fase II. M. an�fase II. N. tel�fase
II. (Elementos fora de propor��o de tamanho entre si; cores-fantasia.)

P�gina 172

Ci�ncia e cidadania
Falhas na meiose e altera��es cromoss�micas
1 Na meiose, assim como na mitose, tamb�m pode ocorrer n�o disjun��o cromoss�mica,
isto �, cromossomos que deveriam separar-se migram juntos para o mesmo polo
celular. Se a n�o disjun��o ocorrer na meiose I, uma das c�lulas receber� os dois
cromossomos hom�logos que n�o se separaram. Se a n�o disjun��o ocorrer na meiose
II, uma das c�lulas receber� dois cromossomos-irm�os que n�o se separaram.
2 O resultado de n�o disjun��es na meiose � a produ��o de gametas com falta ou
excesso de cromossomos. Quando um gameta com um cromossomo a mais ou a menos se une
por fecunda��o a um gameta normal, o zigoto formado � portador de uma altera��o no
n�mero de cromossomos. Na esp�cie humana, a maior parte das altera��es num�ricas
causa a morte ainda na fase embrion�ria, mas, dependendo dos cromossomos afetados,
algumas altera��es cromoss�micas s�o compat�veis com a vida. Exemplos disso s�o as
s�ndromes de Down, de Turner e de Klinefelter.
3 Um aspecto importante a ser considerado � que a frequ�ncia de n�o disjun��es
cromoss�micas durante a meiose aumenta drasticamente em mulheres com mais de 35
anos de idade. Isso eleva o risco de serem geradas crian�as portadoras de
altera��es cromoss�micas. Mulheres com idade superior a 40 anos e que queiram
engravidar devem procurar aconselhamento gen�tico para se inteirarem dos riscos de
virem a ter crian�as portadoras de s�ndromes decorrentes de n�o disjun��es
cromoss�micas.

ADILSON SECCO
Gr�fico que mostra a rela��o entre a idade materna e a gera��o de crian�as com
s�ndrome de Down. As fra��es em cada ponto do gr�fico correspondem �s frequ�ncias
de nascimentos de portadores da s�ndrome. (Elaborado com base em Penrose, L. S. e
Smith, G. F., 1966.)
Guia de leitura
Responda em seu caderno
1 Leia o primeiro par�grafo. Certifique-se de ter compreendido o que � n�o
disjun��o cromoss�mica. Para operacionalizar esse conceito, represente
esquematicamente a divis�o mei�tica de uma c�lula com 2n = 4. Represente a c�lula
na met�fase I com dois pares de cromossomos emparelhados. Escolha um deles e
desenhe a fibra do fuso apenas de um dos polos; isso simular� a n�o disjun��o de um
par de hom�logos. Continue a representar a meiose normalmente, o que resultar� em
quatro c�lulas haploides: duas delas desprovidas de um dos tipos cromoss�micos e as
outras duas com esse cromossomo em dose dupla. Desenhe, a seguir, a divis�o
mei�tica com a n�o disjun��o cromoss�mica ocorrendo na meiose II.
2 O segundo par�grafo comenta os resultados das n�o disjun��es cromoss�micas que
ocorrem na meiose humana. Quais s�o eles?
3 Leia o terceiro e �ltimo par�grafo do quadro, que se refere ao aumento da
frequ�ncia de n�o disjun��es cromoss�micas � medida que aumenta a idade da mulher.
Uma das hip�teses para isso � que as c�lulas germinativas femininas iniciam
simultaneamente a meiose na fase embrion�ria de vida da mulher e permanecem
estacionadas em pr�fase I at� serem ativadas pelos horm�nios sexuais. A cada ciclo
menstrual, uma das c�lulas germinativas � ativada de forma a dar prosseguimento �
sua meiose. Em outras palavras, em uma gravidez tardia, a c�lula que originou o
�vulo estava h� muito tempo estacionada em pr�fase I da meiose, o que parece
aumentar a probabilidade de ocorr�ncia de n�o disjun��es cromoss�micas.
4 Analise o gr�fico apresentado neste quadro. Inicialmente, note a curva vermelha
que cresce acentuadamente. Confira o que indicam as ordenadas e as abscissas.
Interrompa agora a an�lise do gr�fico e leia a sua legenda. Retorne ao gr�fico �
medida que l�, complementando as informa��es. Calcule: quantas vezes o risco de uma
mulher com mais de 45 anos de idade ter uma crian�a portadora de s�n drome de Down
� maior que o de uma mulher de 20 anos?

P�gina 173

9.3 Gametas e fecunda��o nos animais


Agora que conhecemos o significado principal da meiose - reduzir o n�mero de
cromossomos e contrabalan�ar sua duplica��o pela fecunda��o -, podemos entender
melhor seu papel na forma��o dos gametas de animais, que estudaremos a seguir.
Nos animais, os gametas formam-se a partir de c�lulas especiais - as c�lulas
germinativas -, destinadas a passar por meiose desde as fases iniciais do
desenvolvimento embrion�rio. Nos machos, as c�lulas germinativas localizam-se nos
test�culos e s�o chamadas de espermatog�nias. Nas f�meas, elas se situam nos
ov�rios e s�o denominadas ovog�nias. Tanto as espermatog�nias como as ovog�nias s�o
c�lulas diploides (2n) e multiplicam-se por mitose.
Nos machos de mam�feros, a multiplica��o das espermatog�nias tem in�cio na vida
embrion�ria e se intensifica ap�s a maturidade sexual, continuando praticamente por
toda a vida, com decl�nio acentuado na velhice. Nas f�meas, o per�odo de
multiplica��o das ovog�nias geralmente se restringe � vida intrauterina, como
ocorre na esp�cie humana.
A forma��o de gametas a partir das c�lulas germinativas primordiais � genericamente
chamada de gametog�nese. A forma��o de �vulos � a ovulog�nese; e a forma��o de
espermatozoides � a espermatog�nese.
Espermatog�nese em mam�feros
Nos test�culos dos machos de mam�feros, h� sempre espermatog�nias multiplicando-se
por mitose, originando novas gera��es de espermatog�nias que tamb�m se dividem e
assim sucessivamente. Enquanto a multiplica��o ocorre, alguns grupos de
espermatog�nias crescem e diferenciam-se, passando a ser denominados espermat�citos
prim�rios (ou espermat�citos I). Esses espermat�citos duplicam os cromossomos no
per�odo S da interfase e iniciam a divis�o mei�tica.
Ao fim da meiose I, formam-se duas c�lulas-filhas de tamanhos equivalentes,
denominadas espermat�citos secund�rios (ou espermat�citos II). Cada uma delas
inicia a meiose II e origina duas c�lulas tamb�m de tamanhos equivalentes,
denominadas esperm�tides. Assim, ap�s as divis�es I e II, cada espermat�cito I,
diploide, que inicia a meiose produz quatro esperm�tides haploides.
Cada esperm�tide passa, ent�o, por um processo de especializa��o denominado
espermiog�nese, durante o qual se transforma em espermatozoide. Nesse processo, um
centr�olo transforma-se em um longo flagelo, a cauda do gameta masculino, e parte
do citoplasma � eliminada, o que torna o gameta masculino mais leve e �gil. Forma-
se tamb�m o acrossomo, bolsa que cont�m enzimas respons�veis pela digest�o dos
envolt�rios ovulares durante a fecunda��o (reveja a fig. 5.13, no cap�tulo 5).
Ovulog�nese em mam�feros
Nos ov�rios das f�meas de mam�feros, ainda na vida intrauterina, tem in�cio a
forma��o dos gametas femininos, a ovulog�nese (ou ovog�nese ou, ainda, oog�nese).
As c�lulas germinativas femininas, as ovog�nias, multiplicam-se rapidamente por
mitose, atingem determinado n�mero e as divis�es cessam. Em virtude do grande
ac�mulo de subst�ncias nutritivas no citoplasma - o vitelo -, as ovog�nias crescem
e se transformam em ov�citos prim�rios (ou ov�citos I), que iniciam a meiose, mas
estacionam na fase de dipl�teno da pr�fase I.
Na fase reprodutiva da f�mea, o ov�cito I retoma a meiose I, originando duas
c�lulas de tamanho bastante desigual: uma delas, o ov�cito secund�rio (ou ov�cito
II), recebe quase todo o citoplasma e o vitelo, enquanto a outra c�lula fica com
praticamente s� o n�cleo, constituindo um pequeno gl�bulo aderido a um dos polos do
ov�cito II, da� sua denomina��o gl�bulo (ou corp�sculo) polar I. Embora algumas
vezes continue a meiose, o gl�bulo polar n�o desempenha papel algum na reprodu��o e
se degenera.
O ov�cito II inicia, ent�o, a meiose II, estacionando em met�fase II. A meiose s�
se completa se houver fecunda��o, o que resulta novamente em duas c�lulas-filhas de
tamanho bastante desigual. A c�lula grande, que cont�m praticamente todo o
citoplasma e vitelo, � o �vulo. A c�lula pequena e desprovida de citoplasma � o
gl�bulo (ou corp�sculo) polar II, que logo degenera.

P�gina 174

A citocinese desigual na meiose das f�meas, como vimos, possibilita que o vitelo,
constitu�do por subst�ncias para nutrir o futuro embri�o, se concentre em uma �nica
c�lula. Assim, a partir de um ov�cito I, diploide, que inicia a meiose forma-se
apenas uma c�lula funcional haploide, o �vulo, que concentra todo o vitelo
acumulado na ovog�nia. (Fig. 9.9)

ILUSTRA��ES: JURANDIR RIBEIRO


Figura 9.9 Representa��o esquem�tica em que se comparam a espermatog�nese (�
esquerda) e a ovulog�nese (� direita) nos animais vertebrados. (Elementos fora de
propor��o de tamanho entre si; cores-fantasia.)
A fecunda��o nos animais
O processo de fus�o de dois gametas, com forma��o de um zigoto diploide, �
denominado fecunda��o (ou fertiliza��o). Quando os gametas que se unem prov�m de
dois indiv�duos distintos, fala-se em fecunda��o cruzada. Quando os gametas que se
unem foram produzidos pelo mesmo indiv�duo, fala-se em autofecunda��o. Nos animais,
o encontro dos gametas masculino e feminino pode ocorrer no ambiente externo ou
dentro do corpo da f�mea. No primeiro caso, fala-se em fecunda��o externa; no
segundo, em fecunda��o interna.
Experi�ncias com diversos animais mostram que os gametas femininos liberam
subst�ncias capazes de atrair os espermatozoides. Ao se aproximar do �vulo e tocar
nele, os espermatozoides s�o imediatamente estimulados a liberar as enzimas
contidas no acrossomo, que digerem os envolt�rios ovulares e permitem a penetra��o
de um deles no citoplasma ovular.
O primeiro espermatozoide a tocar a superf�cie exposta do �vulo, ap�s a digest�o
dos envolt�rios ovulares, provoca a forma��o de uma barreira f�sico-qu�mica em
torno do citoplasma ovular, a chamada membrana de fecunda��o. Esta impede a
penetra��o de outros espermatozoides e garante que a fecunda��o seja realizada pelo
�nico gameta masculino pioneiro.

P�gina 175

A membrana plasm�tica do ov�cito II funde-se, ent�o, � membrana do espermatozoide,


cujo n�cleo � praticamente "sugado" para o gameta feminino. No citoplasma ovular,
os corpos basais do flagelo do espermatozoide originam os centr�olos, que orientam
a forma��o do fuso de microt�bulos para a mitose do zigoto; restos da cauda e
mitoc�ndrias masculinas degeneram.
Nos mam�feros, a penetra��o do espermatozoide induz o gameta feminino, ent�o
estacionado em fase de ov�cito II, a completar a segunda divis�o mei�tica, formando
o segundo gl�bulo polar e o �vulo propriamente dito. Com isso, o cen�rio
intraovular est� preparado para o �pice dos acontecimentos da fecunda��o: a
cariogamia.
O n�cleo do �vulo, haploide e pronto para se encontrar com o n�cleo do
espermatozoide, � o pron�cleo feminino. O n�cleo tamb�m haploide do espermatozoide
fecundante aumenta de volume e passa a ser chamado de pron�cleo masculino.
Algumas horas ap�s a penetra��o do espermatozoide no �vulo, os pron�cleos masculino
e feminino aproximam-se; seus cromossomos duplicam-se e iniciam a condensa��o,
preparando-se para a primeira divis�o mit�tica do zigoto. Os pron�cleos feminino e
masculino geralmente n�o se fundem: eles permanecem pr�ximos e, em determinado
momento, seus envolt�rios degeneram, liberando os cromossomos maternos e paternos,
j� duplicados e condensados, no citoplasma ovular.
A uni�o do conte�do dos pron�cleos � a cariogamia (do grego karyon, n�cleo, e
gamos, casamento, uni�o) ou anfimixia (do grego anfi, dois, e mixos, misturar);
trata-se do ponto alto da fecunda��o, marcando a forma��o do zigoto, primeira
c�lula de um novo ser.
Os cromossomos maternos e paternos duplicados ligam-se �s fibras do fuso e inicia-
se a separa��o das crom�tides-irm�s para polos opostos, isto �, a an�fase da
primeira mitose do zigoto. Cada polo celular recebe um lote de cromossomos maternos
e um lote de cromossomos paternos. Formam-se, ent�o, dois novos n�cleos, e a
citocinese origina as duas primeiras c�lulas diploides do novo indiv�duo, gen�tica
e cromossomicamente id�nticas ao zigoto. (Fig. 9.10)

ILUSTRA��ES: EDILSON BILAS


Figura 9.10 Representa��o esquem�tica das etapas da forma��o de um zigoto humano e
de sua primeira mitose. A. Espermatozoide no interior do ov�cito secund�rio. B. Fim
da meiose do ov�cito, com forma��o do segundo gl�bulo polar e do pron�cleo
feminino. C. Os pron�cleos masculino e feminino disp�em-se pr�ximos ao fuso
mit�tico com os cromossomos j� bem condensados. D. As cariotecas dos dois
pron�cleos se desfazem e os cromossomos condensados espalham-se nas proximidades do
fuso, unindo-se �s fibras. E. Separa��o de crom�tides-irm�s para polos opostos do
fuso, nos quais se originam dois n�cleos-filhos, cada um com dois conjuntos de
cromossomos (um materno e outro paterno). F. Citocinese e forma��o das duas
primeiras c�lulas, ou blast�meros, do embri�o. (Elementos fora de propor��o de
tamanho entre si; cores-fantasia.) (Elaborada com base em Gilbert, S. F., 2006.)

P�gina 176

9.4 Meiose e ciclos de vida


A etapa do ciclo de vida em que a meiose ocorre varia nos diferentes organismos.
Nos animais, por exemplo, a meiose ocorre nas g�nadas para forma��o dos gametas. Em
algumas esp�cies de fungos, protozo�rios e algas, a meiose ocorre imediatamente
ap�s a forma��o do zigoto. Em certas algas e em todas as plantas, ocorre meiose em
indiv�duos diploides originando esporos haploides.
Em todos esses casos, a meiose � respons�vel pela manuten��o do n�mero de
cromossomos da esp�cie.
Ciclo haplobionte diplonte
Em nossa esp�cie, o ciclo de vida tem in�cio com a uni�o de um �vulo haploide
(produzido por nossa m�e) e um espermatozoide haploide (produzido por nosso pai),
originando um zigoto diploide, a primeira c�lula de nosso corpo. A multiplica��o do
zigoto e o desenvolvimento embrion�rio levam � forma��o de todas as c�lulas e
tecidos corporais. Na maturidade sexual, a pessoa forma gametas haploides que, ao
se unirem a gametas de parceiros do sexo oposto, originam zigotos diploides, dando
in�cio a outro ciclo.
Nesse tipo de ciclo de vida, que tamb�m ocorre na maioria dos animais, a meiose
leva � forma��o de gametas, sendo, por isso, denominada meiose gam�tica. Os
bi�logos denominam esse tipo de ciclo de vida como haplobionte diplonte.
Haplobionte (do grego hapl�s, simples, um, e bionte, ser vivo) porque no ciclo h�
apenas um tipo de indiv�duo, e diplonte porque a constitui��o dos indiv�duos do
ciclo � diploide. (Fig. 9.11)

ILUSTRA��ES: PAULO MANZI


Figura 9.11 Representa��o esquem�tica do ciclo de vida da esp�cie humana, em que a
meiose ocorre para a forma��o dos gametas. (Elementos fora de propor��o de tamanho
entre si; cores-fantasia.)
Ciclo haplobionte haplonte
Em alguns organismos, a meiose n�o leva � forma��o de gametas, como ocorre em nosso
ciclo de vida. Por exemplo, em algas unicelulares do g�nero Chlamydomonas
(clamidomonas), os indiv�duos maduros s�o haploides. Em certo momento, eles se
comportam como gametas, fundindo-se dois a dois e originando zigotos diploides. Em
geral, imediatamente ap�s essa fus�o ocorre meiose, que d� origem a quatro c�lulas
haploides. Estas se desenvolvem em indiv�duos haploides, que mais tarde podem se
comportar como gametas, dando in�cio a outro ciclo.
Uma vez que a meiose ocorre no zigoto, em geral logo ap�s sua forma��o, fala-se em
meiose zig�tica. O ciclo � denominado haplobionte haplonte. Haplobionte porque h�
apenas um tipo de indiv�duo no ciclo (no caso, as clamidomonas), e haplonte porque
elas s�o haploides. (Fig. 9.12)

P�gina 177

Figura 9.12 Representa��o esquem�tica do ciclo de vida do bolor de p�o, em que a


meiose ocorre ap�s a forma��o do zigoto. (Elementos fora de propor��o de tamanho
entre si; cores-fantasia.)
Ciclo diplobionte
Em certas esp�cies de algas e nas plantas, o indiv�duo gerado pelo encontro dos
gametas e pelo desenvolvimento do zigoto diploide n�o produz gametas. Quando
maduro, algumas de suas c�lulas executam meiose, originando c�lulas haploides
denominadas esporos. Cada esporo, ao se multiplicar mitoticamente, origina um
indiv�duo haploide. Na maturidade sexual, esses organismos haploides formam gametas
haploides sem ocorr�ncia de meiose, uma vez que suas c�lulas j� s�o haploides.
Pares de gametas unem-se e originam zigotos diploides, que se desenvolvem e
originam indiv�duos diploides, completando o ciclo.
Nas samambaias, por exemplo, o indiv�duo diploide originado do zigoto � a planta
com folhagem exuberante que utilizamos na ornamenta��o de casas. Essa planta n�o
produz gametas, e sim esporos. Os locais de forma��o de esporos, os espor�ngios,
s�o facilmente identificados como pontos ou linhas de cor marrom ou amarela sob as
folhas. � nesses locais que ocorre a meiose. Quando os esporos haploides se
libertam dos espor�ngios e caem em locais adequados, germinam e originam pequenas
plantas haploides com formato de cora��o, os pr�talos, que produzem gametas, cuja
uni�o gera novos indiv�duos diploides, fechando o ciclo.
Ciclos como esse s�o denominados diplobiontes (do grego diplos, duplo) ou
alternantes, porque ocorre altern�ncia entre organismos haploides produtores de
gametas - os gamet�fitos - e organismos diploides produtores de esporos - os
espor�fitos.
No ciclo diplobionte, a meiose que ocorre nos indiv�duos diploides origina esporos,
que, ao germinar, originam indiv�duos haploides; por isso, fala-se em meiose
esp�rica. (Fig. 9.13)

ILUSTRA��ES: PAULO MANZI


Figura 9.13 Representa��o esquem�tica do ciclo de vida de uma samambaia, em que a
meiose ocorre para a forma��o dos esporos. (Elementos fora de propor��o de tamanho
entre si; cores-fantasia.)

P�gina 178

ATIVIDADES
Revendo conceitos, fatos e processos
Registre em seu caderno
1. O que caracteriza a reprodu��o assexuada � a
a) autofecunda��o.
b) aus�ncia de permuta��o cromoss�mica.
c) descend�ncia variada.
d) aus�ncia de fecunda��o.
2. O processo celular de redu��o cromoss�mica associado aos ciclos de vida sexuados
� a
a) isogamia.
b) permuta��o.
c) meiose.
d) mitose.
3. A troca de peda�os entre crom�tides hom�logas que ocorre durante a pr�fase I da
meiose denomina-se
a) diacinese.
b) dipl�teno.
c) paqu�teno.
d) permuta��o.
e) quiasma.
Utilize as alternativas a seguir para responder �s quest�es de 4 a 8.
a) Os cromossomos est�o emparelhados dentro do n�cleo, com cruzamentos entre
crom�tides de cromossomos hom�logos.
b) Os cromossomos apresentam duas crom�tides migrando juntas para cada polo da
c�lula.
c) Os cromossomos s�o constitu�dos por um �nico fio, em separa��o, para polos
opostos da c�lula.
d) Os cromossomos hom�logos ainda est�o unidos por quiasmas, dispostos na regi�o
mediana do fuso acrom�tico.
4. Qual alternativa descreve um evento que ocorre na pr�fase I da meiose?
5. Qual alternativa descreve um evento que ocorre na met�fase I da meiose?
6. Qual alternativa descreve um evento que ocorre na an�fase I da meiose?
7. Qual alternativa descreve um evento que ocorre na an�fase II da meiose?
8. Qual alternativa traz a descri��o de um evento que ocorre tanto na meiose como
na mitose?
Escreva, em seu caderno, o termo abaixo que substitui corretamente a tarja entre
par�nteses das frases 9 e 10.
a) mitose, apenas.
b) meiose I, apenas.
c) meiose I e meiose II.
d) mitose e meiose II.
9. Os cromossomos hom�logos migram para polos opostos da c�lula na (.....).
10. As crom�tides-irm�s migram para polos opostos da c�lula na (.....).
Quest�es para exercitar o pensamento
Registre em seu caderno
11. Um pesquisador desenhou c�lulas de um animal em diversas fases do processo de
meiose. Com base nos desenhos mostrados a seguir, identifique o n�mero de
cromossomos presentes em c�lulas haploides e diploides (n e 2n) desse animal e a
fase em que se encontra cada uma das c�lulas esquematizadas. Explique suas
conclus�es.

OSVALDO SEQUETIN
(Elementos fora de propor��o de tamanho entre si.)
12. A educa��o sexual e o controle da natalidade s�o vistos atualmente pela nossa
sociedade de maneira bem distinta do que ocorria h� algumas d�cadas. Para
aprofundar seu conhecimento sobre esse assunto, forme um grupo com seus colegas e
entreviste pessoas mais velhas, como seus av�s, bisav�s, tios, pais etc.,
perguntando-lhes como era tratada a sexualidade humana na �poca em que elas eram
adolescentes. Sua primeira tarefa � elaborar uma lista de perguntas - o roteiro da
entrevista. A seguir, algumas sugest�es de perguntas:
- Qual era o n�vel de informa��o sobre sexo, reprodu��o e m�todos anticoncepcionais
que voc� tinha aos 15 anos de idade?
- Qual � a vis�o que voc� tem hoje sobre esses assuntos?
- Qual � sua opini�o sobre as mudan�as na maneira como a sociedade trata esses
assuntos?
Registre a idade, o sexo e o grau de escolaridade de cada pessoa entrevistada;
anote tamb�m os pontos principais das entrevistas. Ao final, produza um texto no
formato reportagem de revista, tra�ando um panorama cronol�gico de como os assuntos
relacionados � sexualidade humana eram tratados pela sociedade. Inclua tamb�m a
opini�o de colegas da sua idade.
P�gina 179

Fa�a voc� mesmo!


Registre em seu caderno
13. Constru��o de modelos: Simulando os eventos da meiose
Nesta atividade, vamos simular a meiose utilizando um modelo concreto para
facilitar a compreens�o desse processo.
Sugerimos trabalhar em grupos de tr�s ou quatro colegas, para que haja troca de
ideias durante a elabora��o dos modelos. Se poss�vel, fotografe cada uma das etapas
e monte um painel com a sequ�ncia obtida, identificando pelos respectivos nomes
cada uma das etapas. Alternativamente, voc� pode utilizar fotografias e v�deos para
produzir uma pequena anima��o da meiose.
Material
- massa de modelar (ou barbantes grossos) de pelo menos quatro cores diferentes;
- folhas grandes de papel de embrulho;
- linha ou barbante fino;
- opcional: c�mera fotogr�fica.
Procedimento
1. Forre a mesa de trabalho com uma folha de papel de embrulho e desenhe sobre ela
um c�rculo grande para representar os limites da c�lula.
2. Com a massa de modelar (ou os barbantes grossos), represente um par de
cromossomos metac�ntricos e um par de cromossomos acroc�ntricos, usando uma cor
para cada cromossomo. Uma c�lula com ape nas esses cromossomos teria n�mero
diploide 2n = 4. Fa�a cromossomos longos, pois vamos simular o fen�meno da
permuta��o.
3. Os cromossomos metac�ntricos devem ser representados por dois rolinhos de
aproximadamente 10 cm de comprimento e 0,5 cm de di�metro. Uma bolinha de massa de
cor diferente, grudada � regi�o mediana de cada cromossomo, representa o
centr�mero.
4. Os outros dois rolinhos podem ser mais curtos que os primeiros (apenas para
diferenci�-los melhor) e representam o par de cromossomos acroc�ntricos. Coloque a
bolinha de massa que representa o centr�mero bem perto de uma das extremidades.
5. Posicione os modelos de cromossomos sobre a folha de papel de embrulho e d�
in�cio � atividade. O primeiro passo � representar a duplica��o dos cromossomos,
fazendo novos rolinhos id�nticos aos anteriores e unindo-os aos cromossomos
correspondentes pela regi�o do centr�mero.
6. Distribua os modelos de cromossomos duplicados sobre a folha de papel de
embrulho e inicie a simula��o. O que ocorre na pr�fase I? Imagine que ocorra uma
permuta��o em cada cromossomo. Como represent�-la no modelo? Que tipo de separa��o
cromoss�mica ocorre na an�fase I? E na an�fase II?
7. Para simular a separa��o dos cromossomos, amarre uma linha �s regi�es
centrom�ricas e puxe cada cromossomo pelos polos opostos.
8. Uma vez visualizados os eventos gerais da segrega��o dos cromossomos na meiose e
da permuta��o, seu desafio � fazer modelos para cada subfase da pr�fase I e das
outras fases, mostrando a sequ�ncia completa em modelos tridimensionais.
14. Atividade pr�tica: Representando a meiose com os dedos
Nesta atividade, voc� vai representar as separa��es cromoss�micas da meiose com os
dedos de suas m�os. Apesar de simples, a atividade permite compreender a ess�ncia
do processo mei�tico e as leis b�sicas da Gen�tica.
Os desenhos de n�meros 1 e 2 servem de refer�ncia, apresentando a proposta da
atividade. Nos desenhos seguintes, o seu desafio � explicar o significado de cada
representa��o.

ILUSTRA��ES DOS AUTORES

P�gina 180

a) Os desenhos de n�meros 3 e 4 representam dois eventos que ocorrem,


respectivamente, na pr�fase I e na an�fase I da meiose. Que eventos s�o esses?

ILUSTRA��ES DOS AUTORES


b) O desenho de n�mero 5 representa um evento mei�tico equivalente, em termos da
separa��o cromoss�mica, ao que ocorre na mitose. Que evento � esse?

c) No desenho de n�mero 6 est� representado um determinado evento mei�tico. Qual �


ele? Identifique-o e discuta sua import�ncia para a meiose.

d) Seu desafio agora � representar a meiose com os dedos como um processo cont�nuo,
que se desenvolve � medida que voc� narra o que est� ocorrendo. Enfatize as
separa��es cromoss�micas da primeira e da segunda divis�o da meiose, discutindo os
conceitos de diploidia e de haploidia. Represente tamb�m a mitose com os dedos. Se
poss�vel, realize esse trabalho em grupo e filme as simula��es. Os v�deos podem ser
apresentados para a sala ou mesmo compartilhados na internet, em blogs ou redes
sociais.
A Biologia no vestibular e no Enem
Quest�es objetivas
Registre em seu caderno
1. (UFRRJ) Da fus�o dos gametas masculino e feminino, ambos haploides, surge a
c�lula-ovo ou zigoto, em que se restabelece o n�mero diploide. Comparando a
quantidade de DNA encontrada no n�cleo das c�lulas som�ticas de um camundongo,
podemos afirmar que � igual:
a) � quantidade de DNA encontrada no n�cleo dos espermatozoides desse animal.
b) a duas vezes a quantidade de DNA encontrada no n�cleo dos espermatozoides desse
animal.
c) � metade da quantidade de DNA encontrada no n�cleo dos espermatozoides desse
animal.
d) a quatro vezes a quantidade de DNA encontrada no n�cleo dos espermatozoides
desse animal.
e) � quarta parte da quantidade de DNA encontrada no n�cleo dos espermatozoides
desse animal.

P�gina 181

2. (UFSCar-SP) Um pesquisador verificou que o n�cleo celular dos �vulos de uma


certa esp�cie de formiga tem 4 cromossomos e uma quantidade x de DNA. Considerando
que os machos de formiga desenvolvem-se por partenog�nese e s�o haploides, que
quantidade de DNA e de cromossomos se espera encontrar no n�cleo dos
espermatozoides dessa esp�cie?
a) 2x de DNA e 8 cromossomos.
b) 2x de DNA e 4 cromossomos.
c) x de DNA e 4 cromossomos.
d) x de DNA e 2 cromossomos.
e) 1/2 x de DNA e 2 cromossomos.
3. (UFMA) Com rela��o � gametog�nese humana, � correto afirmar que:
a) cada ov�cito I produz 4 ov�citos II.
b) ovog�nias e ov�citos prim�rios s�o formados durante toda a vida da mulher.
c) espermatog�nias s�o formadas apenas durante a vida intrauterina.
d) cada espermat�cito I produz um espermatozoide.
e) a ovulog�nese s� � conclu�da se o ov�cito II for fecundado.
4. (UFSCar-SP) Sessenta c�lulas de um animal, com a constitui��o representada na
figura, sofrem meiose. S�o esperados, apresentando a constitui��o ABC:

ADILSON SECCO
a) 30 espermatozoides.
b) 60 espermatozoides.
c) 90 espermatozoides.
d) 120 espermatozoides.
e) 180 espermatozoides.
5. (Unir-RO) Comparando a ovulog�nese (I) com a espermatog�nese (II), todas as
alternativas abaixo est�o corretas, exceto:
a) Nos dois processos ocorre meiose.
b) Ambos s�o importantes para manter constante o n�mero de cromossomos t�picos de
cada esp�cie.
c) I ocorre nos ov�rios e II, nos test�culos.
d) H� maior produ��o de gametas em II do que em I.
e) Em I e II, as c�lulas formadas s�o diploides.
6. (UEL-PR) A seguir est�o esquematizados n�cleos de um gamet�cito de primeira
ordem, de um gamet�cito de segunda ordem e de uma tide (ov�tide ou esperm�tide), de
uma mesma esp�cie animal.
Durante a gametog�nese, as fases esquematizadas ocorrem na seguinte ordem:

OSVALDO SEQUETIN
a) A B C
b) A C B
c) B C A
d) B A C
e) C A B
Quest�es discursivas
7. (Fuvest-SP) Considere os processos de mitose e meiose.
a) Qual o n�mero de cromossomos das c�lulas originadas, respectivamente, pelos dois
processos na esp�cie humana?
b) Qual a import�ncia biol�gica da meiose?
8. (Unicamp-SP) Os esquemas A, B e C abaixo representam fases do ciclo de uma
c�lula que possui 2n = 4 cromossomos.

ADILSON SECCO
a) A que fases correspondem as figuras A, B e C? Justifique.
b) Qual � a fun��o da estrutura cromoss�mica indicada pela seta na figura D?
9. (Fuvest-SP) As algas apresentam os tr�s tipos b�sicos de ciclo de vida que
ocorrem na natureza. Esses ciclos diferem quanto ao momento em que ocorre a meiose
e quanto � ploidia dos indiv�duos adultos. No esquema abaixo est� representado um
desses ciclos.

ADILSON SECCO
a) Identifique as c�lulas tipo I, II e III.
b) Considerando que o n�mero haploide de cromossomos dessa alga � 12 (n = 12),
quantos cromossomos os indiv�duos X, Y e Z possuem em cada uma de suas c�lulas?

P�gina 182

Cap�tulo 10 Desenvolvimento embrion�rio animal

DR. YORGOS NIKAS/SCIENCE PHOTO LIBRARY/LATINSTOCK


A fecunda��o leva � forma��o do zigoto, primeira c�lula do novo ser; essa c�lula
primordial se multiplica continuamente e origina o embri�o. Na imagem,
fotomicrografia colorizada artificialmente de embri�o humano com apenas quatro dias
de desenvolvimento mostrando suas c�lulas, denominadas blast�meros. (Microsc�pio
eletr�nico de varredura; aumento ? 700�.)
O empreendimento embrion�rio
Nos primeiros anos de vida, uma crian�a passa de aproximadamente 3 kg ao nascer
para cerca de 30 kg aos sete anos de idade, um aumento de dez vezes em rela��o �
massa corp�rea inicial.
Achou muito? Pois saiba que um zigoto humano tem cerca de 3 milion�simos de grama
(0,000003 g) e, depois de cerca de 9 meses de desenvolvimento intrauterino, origina
um beb� que pode chegar a mais de 3 kg (3.000 g). Isso representa um aumento de
massa corp�rea da ordem de 1 bilh�o de vezes em menos de um ano e mostra o
fant�stico ritmo do crescimento embrion�rio.
No come�o do desenvolvimento embrion�rio, as divis�es celulares se sucedem com tal
rapidez que as c�lulas do embri�o n�o t�m tempo de crescer. � por isso que um
embri�o com 128 c�lulas � apenas um pouco maior que o zigoto que o originou.
Entretanto, depois de algum tempo, o ritmo das divis�es diminui e as c�lulas
crescem entre uma divis�o e outra. Os efeitos combinados da multiplica��o e do
crescimento celular explicam o formid�vel aumento de massa do embri�o durante seu
desenvolvimento intrauterino.
A partir do zigoto s�o originados os mais de 10 trilh�es de c�lulas que comp�em o
corpo de uma pessoa adulta. O que realmente impressiona � que h� centenas de tipos
de c�lulas, especializados nas mais diversas fun��es: revestimento, contra��o,
percep��o, secre��o, armazenamento e mais algumas centenas de especialidades. Todos
funcionando nos locais corretos do corpo.
Pense no desenvolvimento de um embri�o como um fant�stico empreendimento celular.
Trata-se nada menos do que "construir" um organismo altamente complexo a partir de
uma microsc�pica "pedra fundamental", o zigoto. Um empreendimento desse porte n�o
seria poss�vel sem um alto grau de organiza��o, com etapas se sucedendo
rigorosamente dentro do prazo. Como isso ocorre? Embora j� se conhe�a o passo a
passo celular desse empreendimento, seus mecanismos de controle ainda hoje desafiam
a compreens�o dos estudiosos.

P�gina 183

A import�ncia do assunto
Pense nisto: o encontro de um par de gametas conduz � maravilhosa organiza��o de um
ser humano. Essa organiza��o � rigorosamente "constru�da", c�lula por c�lula,
durante o desenvolvimento embrion�rio.
Neste cap�tulo, estudaremos as linhas gerais da embriog�nese, nome dado ao processo
de desenvolvimento dos embri�es. Vamos nos concentrar apenas nos seus aspectos
b�sicos, uma vez que esse processo varia muito nos diversos grupos animais.
N�o se desestimule com a nomenclatura e concentre-se na compreens�o das linhas
gerais do desenvolvimento embrion�rio. Al�m disso, n�o se surpreenda se o cap�tulo
trouxer muitas perguntas al�m das respostas: � assim que o conhecimento progride!
10.1 Segmenta��o e forma��o da bl�stula
Na reprodu��o sexuada dos animais multicelulares, a partir da fus�o dos gametas
forma-se a primeira c�lula do novo ser, o zigoto. Imediatamente ap�s a fecunda��o,
o zigoto inicia o desenvolvimento e origina o embri�o, um conjunto celular que se
transforma gradualmente em um novo organismo. O processo de desenvolvimento
embrion�rio � chamado embriog�nese (do grego genese, origem, cria��o). Embora o
tipo de desenvolvimento embrion�rio varie entre as esp�cies de animais, em todas
elas � poss�vel distinguir tr�s etapas principais: segmenta��o (ou clivagem),
gastrula��o e organog�nese.
Na etapa de segmenta��o, como o pr�prio nome sugere, o zigoto divide-se r�pida e
seguidamente por mitose, originando um aglomerado maci�o de c�lulas conhecidas como
blast�meros. Esse aglomerado de blast�meros, pouco maior que o zigoto, lembra uma
amora microsc�pica, sendo, por isso, chamado m�rula (do latim morula, amora).
� medida que o desenvolvimento prossegue, ocorre ac�mulo de l�quido entre as
c�lulas embrion�rias, o que leva ao aparecimento de uma cavidade central. Nesse
est�gio, o embri�o � chamado bl�stula e a cavidade cheia de l�quido � a blastocela
(do latim cella, pequeno quarto, cavidade).
Na fase inicial do desenvolvimento, que vai do zigoto at� a bl�stula plenamente
formada, as divis�es celulares sucedem-se com grande rapidez; na mosca dros�fila,
por exemplo, apenas 12 horas ap�s a primeira segmenta��o o embri�o tem mais de 50
mil c�lulas; um embri�o de r� com apenas 43 horas de vida � constitu�do por nada
menos que 37 mil c�lulas.
Tipos de ovos e segmenta��o
Durante o desenvolvimento, as c�lulas embrion�rias nutrem-se exclusivamente de
subst�ncias que se acumularam no citoplasma do gameta feminino enquanto ele se
desenvolvia no organismo materno. Por exemplo, nos ovos de galinha, a gema � uma
c�lula-ovo extremamente desenvolvida, repleta de material nutritivo que ser�
utilizado durante o desenvolvimento do futuro pintinho.
As subst�ncias nutritivas, constitu�das predominantemente por gorduras e prote�nas,
est�o armazenadas no citoplasma dos ovos na forma de gr�nulos de vitelo. Dependendo
da esp�cie, a quantidade e a distribui��o dos gr�os de vitelo no ovo variam. Quanto
a esses dois crit�rios, os ovos podem ser classificados em quatro tipos b�sicos:
oligol�citos, mesol�citos, megal�citos e centrol�citos. Os estudos embriol�gicos
mostram que h� uma n�tida rela��o entre o tipo de ovo e o que ocorre na
segmenta��o, como veremos adiante.
Ovos oligol�citos (do grego oligos, pouco), tamb�m chamados isol�citos (do grego
isos, igual), t�m quantidade relativamente pequena de vitelo, distribu�da de forma
mais ou menos homog�nea no citoplasma. Esse tipo de ovo est� presente em cordados,
equinodermos, moluscos, anel�deos, nemat�deos e platelmintos. Em muitos mam�feros,
entre eles a esp�cie humana, a quantidade de vitelo nos ovos � t�o pequena que eles
s�o chamados al�citos (do grego a, nega��o, isto �, sem vitelo).

P�gina 184

Ovos mesol�citos (do grego mesos, intermedi�rio), tamb�m chamados ovos


heterol�citos (do grego heteros, diferente, desigual), t�m quantidade relativamente
grande de vitelo, distribu�da de forma desigual no citoplasma. Um dos polos do ovo,
no qual se localiza o n�cleo, tem menos vitelo e � denominado polo animal. O polo
oposto tem maior quantidade de gr�os de vitelo e � denominado polo vegetativo. Esse
tipo de ovo � caracter�stico dos anf�bios.
Ovos megal�citos (do grego mega, grande), tamb�m chamados ovos telol�citos (do
grego telos, extremidade), t�m muito vitelo acumulado no citoplasma. O vitelo ocupa
quase toda a c�lula-ovo, que em algumas esp�cies chega a medir alguns cent�metros
de di�metro. Esse tipo de ovo est� presente em aves, r�pteis, certos peixes e nos
moluscos cefal�podes (polvos e lulas).
Ovos centrol�citos (do grego centro, meio, centro) t�m quantidade relativamente
grande de vitelo, concentrada na regi�o central. Esse tipo de ovo ocorre na maioria
dos artr�podes. (Fig. 10.1)

ILUSTRA��ES: ADILSON SECCO


Figura 10.1 Representa��o esquem�tica dos tipos de ovo em rela��o � distribui��o do
vitelo no citoplasma. (Elementos fora de propor��o de tamanho entre si; cores-
fantasia.)
Como mencionamos, h� rela��o entre a quantidade e a distribui��o de vitelo no ovo e
o que ocorre na segmenta��o, uma vez que a presen�a de vitelo interfere na
citocinese, isto �, na segmenta��o celular. Em geral, em ovos com pouco vitelo, as
duas primeiras segmenta��es "cortam" totalmente o citoplasma, enquanto ovos com
muito vitelo t�m segmenta��es incompletas, que n�o chegam a dividi-lo totalmente.
A segmenta��o dos ovos, portanto, pode ser de dois tipos: holobl�stica (ou total) e
merobl�stica (ou parcial). A segmenta��o holobl�stica (do grego holos, inteiro) ou
total ocorre quando os blast�meros se separam completamente; a segmenta��o
merobl�stica (do grego meros, parte) ou parcial ocorre quando as c�lulas-filhas se
separam de forma incompleta na citocinese.
Dependendo da distribui��o de vitelo no ovo, as segmenta��es podem resultar em
blast�meros aproximadamente do mesmo tamanho ou em blast�meros desiguais; os
blast�meros maiores t�m mais vitelo que os menores. Por exemplo, em ovos al�citos e
oligol�citos, que t�m pouco vitelo distribu�do homogeneamente no citoplasma, a
segmenta��o � holobl�stica e resulta em blast�meros de tamanho aproximado.
Ovos mesol�citos, apesar de sua quantidade razo�vel de vitelo, tamb�m t�m
segmenta��o holobl�stica. Entretanto, o vitelo acumulado no polo vegetativo
determina a segmenta��o desigual do ovo: os blast�meros do polo vegetativo s�o
maiores e mais ricos em vitelo que os formados no polo animal. Os blast�meros
maiores s�o denominados macr�meros e os menores, micr�meros.
Ovos megal�citos, por sua vez, t�m quantidade t�o grande de vitelo que as
estruturas citoplasm�ticas e o n�cleo limitam-se a uma pequena �rea do polo animal,
formando um disco superficial de 2 a 3 mil�metros de di�metro, o disco germinativo.
Nesse tipo de ovo, as segmenta��es ocorrem apenas na regi�o do disco germinativo,
enquanto a parte do ovo repleta de vitelo n�o se divide. Nesse caso, a segmenta��o
� merobl�stica discoidal.
Nos ovos centrol�citos, inicialmente apenas os n�cleos se dividem, sem forma��o de
c�lulas individualizadas. Ap�s certo n�mero de mitoses, os n�cleos migram para a
periferia do ovo e disp�em-se embaixo da membrana ovular. A seguir, formam#se
membranas entre os n�cleos, individualizando c�lulas, que se disp�em em uma camada
no embri�o. Nesse caso, a segmenta��o � denominada superficial. (Fig. 10.2)

P�gina 185

ILUSTRA��ES: ADILSON SECCO


Figura 10.2 Representa��o esquem�tica de alguns tipos de segmenta��o de ovos. A.
Segmenta��o holobl�stica e igual (anfioxo). B. Segmenta��o holobl�stica e desigual
(anf�bios). C. Segmenta��o merobl�stica e discoidal (r�pteis e aves). D.
Segmenta��o superficial (insetos). (Elementos fora de propor��o de tamanho entre
si; cores-fantasia.) (Elaborada com base em Gilbert, S., 2000.)
A bl�stula originada de ovos oligol�citos �, em geral, uma bola de c�lulas com uma
grande cavidade central cheia de l�quido. Na bl�stula proveniente de ovos
mesol�citos, a blastocela � relativamente pequena e restrita � regi�o do polo
animal. Por sua vez, a bl�stula que se origina de ovos megal�citos resume-se a uma
pequena calota de c�lulas, o blastodisco, composto de duas camadas celulares, o
epiblasto e o hipoblasto. A blastocela � um espa�o cheio de l�quido que surge entre
essas duas camadas celulares. (Fig. 10.3)

ILUSTRA��ES: ADILSON SECCO


Figura 10.3 Representa��o esquem�tica, em corte, de tipos de bl�stula. No anfioxo
(ovo oligol�cito e segmenta��o holobl�stica e igual), a bl�stula apresenta uma
blastocela grande e central. Nos anf�bios (ovo mesol�cito e segmenta��o
holobl�stica e desigual), a bl�stula � mais maci�a, com a blastocela deslocada para
o polo animal. Nas aves (ovo megal�cito), a segmenta��o � merobl�stica e discoidal,
e a blastocela surge entre o epiblasto e o hipoblasto. (Elementos fora de propor��o
de tamanho entre si; cores-fantasia.)

P�gina 186

10.2 Gastrula��o
O est�gio embrion�rio que se sucede � bl�stula � chamado g�strula e seu processo de
forma��o � denominado gastrula��o.
Durante essa etapa da embriog�nese, as c�lulas embrion�rias passam por grandes
altera��es, que definem o plano corporal b�sico do futuro animal.
Na gastrula��o, c�lulas que dar�o origem a m�sculos e �rg�os internos migram para o
interior do embri�o, enquanto c�lulas precursoras da pele e do sistema nervoso
disp�em#se na superf�cie.
A migra��o de c�lulas para dentro do embri�o faz com que a blastocela d� lugar a
uma nova cavidade, o arqu�ntero (do grego archeos, primitivo, e enteron, intestino)
ou gastrocela (do grego gastros, est�mago, e cela, cavidade). Esses nomes indicam
que a cavidade interna da g�strula � o "esbo�o" do tubo digestivo do futuro
organismo.
O arqu�ntero comunica-se com o meio externo atrav�s de uma abertura denominada
blast�poro.
Nos cordados (grupo ao qual pertencem os vertebrados) e nos equinodermos
(ouri�os#do#mar e estrelas-do-mar, por exemplo), o blast�poro origina o �nus do
futuro animal. A boca forma-se em momento posterior do desenvolvimento, no lado
oposto ao do arqu�ntero. Por isso, esses animais s�o chamados deuterost�mios (do
grego deuteros, segundo, e stoma, boca).
Em todos os outros grupos de animais que t�m tubo digestivo completo (nemat�deos,
moluscos, anel�deos e artr�podes), o blast�poro origina a boca e o �nus surge
posteriormente. Por isso, esses animais s�o chamados protost�mios (do grego protos,
primeiro, e stoma, boca).
Forma��o dos folhetos germinativos
Na maioria das esp�cies animais, durante o est�gio de g�strula originam-se tr�s
conjuntos de c�lulas dos quais derivam todos os tecidos corporais: os folhetos
germinativos.
O folheto germinativo mais externo, que reveste o embri�o, � denominado ectoderma
(do grego ecto, fora). Dele se originam a epiderme - a camada externa da pele - e
diversas estruturas associadas a ela, como pelos, unhas, garras, gl�ndulas seb�ceas
e gl�ndulas sudor�paras. Do ectoderma surge tamb�m o sistema nervoso, composto pelo
enc�falo, medula espinhal, nervos e g�nglios nervosos.
O folheto germinativo mais interno, que delimita a cavidade do arqu�ntero, � o
endoderma (do grego endo, dentro). Ele origina o revestimento interno do tubo
digestivo e forma as diversas estruturas glandulares associadas � digest�o, tais
como gl�ndulas salivares, gl�ndulas mucosas, p�ncreas, f�gado e gl�ndulas
estomacais. O endoderma tamb�m origina o sistema respirat�rio (br�nquias ou
pulm�es).
O folheto germinativo situado entre o ectoderma e o endoderma � o mesoderma (do
grego meso, meio). Ele origina m�sculos, ossos, sistema cardiovascular (cora��o,
vasos sangu�neos e sangue), sistema urin�rio (rins, bexiga e vias urin�rias) e
sistema genital. (Fig. 10.4)
No in�cio do desenvolvimento embrion�rio diferencia-se uma linhagem celular
especial, denominada linhagem germinativa, cujas c�lulas migram para os prim�rdios
das g�nadas (sistema genital) e originar�o os gametas nos animais adultos. Todas as
demais c�lulas do embri�o constituem a chamada linhagem som�tica. (Fig. 10.5)
Entre os animais, as esponjas s�o os �nicos que n�o apresentam folhetos
germinativos em seus embri�es.
Nos cnid�rios (�guas-vivas, an�monas e corais, por exemplo), os embri�es t�m apenas
dois folhetos germinativos, o ectoderma e o endoderma, e, por isso, eles s�o
chamados animais dibl�sticos.
Em todos os outros grupos de animais, os embri�es formam tr�s folhetos
germinativos, sendo denominados animais tribl�sticos.

P�gina 187

Figura 10.4 Representa��o esquem�tica em que se comparam os processos de


gastrula��o de anfioxos, anf�bios e aves. No anfioxo, as c�lulas de um polo da
bl�stula parecem ser empurradas para dentro da blastocela. Nos anf�bios, a
gastrula��o ocorre pela migra��o de c�lulas do l�bio dorsal do blast�poro para o
interior da blastocela e, tamb�m, pelo crescimento de c�lulas da camada externa,
que penetram pelo l�bio inferior. Nas aves, formam-se l�minas transversais de
c�lulas, que originam os tr�s tecidos embrion�rios b�sicos. (Elementos fora de
propor��o de tamanho entre si; cores-fantasia.)

ILUSTRA��ES: ADILSON SECCO


Figura 10.5 Os folhetos germinativos formam todos os tecidos corporais. A figura
mostra alguns tipos de c�lulas originadas de cada folheto. (Elementos fora de
propor��o de tamanho entre si; cores-fantasia.)

P�gina 188

10.3 Organog�nese
O est�gio de n�urula
Durante o desenvolvimento dos animais cordados, ao final do est�gio de g�strula,
c�lulas embrion�rias localizadas ao longo do dorso do embri�o come�am a se
diferenciar, originando uma estrutura tubular oca, o tubo nervoso ou tubo neural, e
um cord�o maci�o de c�lulas, a notocorda. Nesse est�gio de desenvolvimento
embrion�rio, o embri�o � denominado n�urula (do grego neuron, nervo), uma vez que
a� come�a a ser esbo�ado o sistema nervoso.
Tubo nervoso
A forma��o do tubo nervoso � induzida por subst�ncias liberadas por c�lulas do
mesoderma e da regi�o anterior do endoderma. A diferencia��o das c�lulas
ectod�rmicas dorsais leva � forma��o de uma placa achatada no dorso embrion�rio, a
placa neural.
A placa neural desenvolve-se a partir da regi�o anterior, diferenciando-se em
dire��o � extremidade posterior do embri�o. No decorrer de sua forma��o, a placa
neural se dobra e assume progressivamente o aspecto de uma calha (sulco ou goteira
neural) ao longo do dorso do embri�o.
O dobramento da placa neural prossegue at� que suas bordas laterais se fundem,
isolando um tubo de c�lulas ao longo do dorso do embri�o - o tubo nervoso. O
revestimento ectod�rmico dorsal regenera-se sobre esse tubo. (Fig. 10.6)

ILUSTRA��ES: ADILSON SECCO


Figura 10.6 Representa��o esquem�tica de embri�o de anf�bio em processo de
transi��o de g�strula para n�urula. Na parte de cima, g�strula avan�ada em que se
v� a placa neural, formada pela especializa��o do ectoderma dorsal, que d� origem
ao tubo nervoso. Na parte de baixo, representa��o de tr�s est�gios da forma��o do
tubo nervoso; simultaneamente, o mesoderma se diferencia, constituindo a notocorda
e dois blocos mesod�rmicos, um de cada lado do corpo. (Elementos fora de propor��o
de tamanho entre si; cores-fantasia.) (Elaborada com base em Gilbert, S., 2006.)

P�gina 189

A forma��o do tubo nervoso ocorre de maneira diferente nos diversos grupos de


animais. Nas aves, por exemplo, o fechamento do tubo nervoso progride da cabe�a em
dire��o � cauda. Nos mam�feros, o fechamento inicia-se em diversos pontos ao longo
da placa neural. Alguns tipos de malforma��o cong�nita neurol�gica devem-se
exatamente a falhas no fechamento de uma ou de outra parte do tubo nervoso que dar�
origem ao sistema nervoso central, composto pelo enc�falo e pela medula espinal.
Na esp�cie humana, uma falha do fechamento na regi�o anterior do tubo nervoso causa
a anencefalia, que leva � morte. Uma condi��o patol�gica conhecida como espinha
b�fida, cuja gravidade depende do local e do grau de comprometimento da medula
espinal, � decorrente de uma falha de fechamento na regi�o posterior do tubo
nervoso, em torno do 27� dia de vida do embri�o. Defeitos de forma��o do tubo
nervoso na esp�cie humana, considerados em conjunto, s�o relativamente frequentes,
da ordem de 1 caso para cada 500 nascimentos.
Notocorda
Ao mesmo tempo que o tubo nervoso se diferencia, um conjunto de c�lulas situado
embaixo dele se isola do mesoderma e forma um bast�o s�lido ao longo da regi�o
dorsal: a notocorda (do grego notos, dorso, costas), tamb�m chamada corda dorsal.
A notocorda � uma estrutura exclusiva de animais cordados. Embora presente no
desenvolvimento embrion�rio de todos eles, desaparece na fase adulta da maioria das
esp�cies. Hoje se sabe que, al�m de dar suporte estrutural ao tubo nervoso, a
notocorda libera subst�ncias que induzem a diferencia��o do tubo nervoso.
Mesoderma e endoderma
Enquanto o tubo nervoso se forma, o mesoderma desenvolve-se e passa a preencher os
espa�os entre o ectoderma e o endoderma embrion�rios.
O mesoderma situado ao longo do dorso do embri�o (mesoderma paraxial) divide-se em
blocos transversais denominados somitos. A partir deles formam-se a derme, a coluna
vertebral, as costelas e os m�sculos estriados esquel�ticos.
As regi�es laterais do mesoderma (mesoderma intermedi�rio) originam o sistema
urogenital, constitu�do pelos rins, a parte n�o germinativa das g�nadas e seus
respectivos canais (ductos).
A regi�o ventral do mesoderma separa-se em duas l�minas celulares, uma mais externa
e em contato com o ectoderma - a somatopleura ou mesoderma parietal - e outra mais
interna - a esplancnopleura ou mesoderma visceral -, em contato com o endoderma. O
espa�o entre essas duas camadas mesod�rmicas, preenchido por l�quido, � denominado
celoma. A partir dessas l�minas mesod�rmicas surgem o sistema cardiovascular
(cora��o e vasos sangu�neos), a musculatura lisa e o esqueleto dos membros, entre
outras estruturas corporais. (Fig. 10.7)

ILUSTRA��O: ADILSON SECCO


Figura 10.7 Representa��o esquem�tica de um embri�o de cordado em est�gio de
n�urula. Note o celoma, a cavidade mesod�rmica que surge nesse est�gio. (Elementos
fora de propor��o de tamanho entre si; cores-fantasia.) (Elaborada com base em
Gilbert, S., 2006.)
O endoderma origina o revestimento interno do tubo digestivo, al�m das estruturas
que se formam a partir dele: gl�ndulas salivares, p�ncreas, f�gado e ves�cula
biliar. O endoderma tamb�m origina o revestimento das br�nquias de peixes e
anf�bios jovens, e o revestimento dos condutos respirat�rios e dos pulm�es em
anf�bios, r�pteis, aves e mam�feros.

P�gina 190

Amplie seus conhecimentos


A embriologia do anfioxo como exemplo
O anfioxo lembra um peixinho de cerca de 5 cm de comprimento que n�o possui cabe�a
nem nadadeiras. Ele vive semienterrado em praias de areia no sublitoral raso,
abaixo da linha das mar�s, sendo muito abundante no sul da China, onde � utilizado
como alimento; tamb�m � encontrado em praias brasileiras. O anfioxo tem sido muito
utilizado como modelo por cientistas e professores de Biologia pelo fato de seu
corpo ser organizado de forma simples e "did�tica". A embriologia desse animal
ajuda a compreender os passos fundamentais do desenvolvimento embrion�rio que
resultam na organiza��o t�pica do corpo de um cordado.

CLEVELAND HICKMAN/ VISUALS UNLIMITED/GLOW IMAGES


ILUSTRA��ES: ADILSON SECCO
Em cima, fotografia do anfioxo, o Branchiostoma lanceolatum, que mede cerca de 5 cm
de comprimento; note as extremidades do corpo afiladas e semelhantes entre si, da�
a denomina��o "anfioxo" (do grego amphi, duas, e oxus, ponta, cauda). Ao lado da
fotografia, esquema de corte transversal da parte mediana do corpo desse animal;
abaixo, vista lateral mostrando alguns de seus �rg�os internos por transpar�ncia.
(Elementos fora de propor��o de tamanho entre si; cores-fantasia.) (Elaborado com
base em Sherman, I. e Sherman, V., 1970.)
No anfioxo, os sexos s�o separados e machos e f�meas eliminam gametas na �gua do
mar, na qual a fecunda��o ocorre (fecunda��o externa). O ovo � do tipo oligol�cito
e apresenta segmenta��o holobl�stica e praticamente igual. No est�gio de oito
blast�meros, h� no polo animal quatro micr�meros ligeiramente menores que os quatro
macr�meros do polo vegetativo. A partir da�, as clivagens se sucedem em planos
perpendicularmente alternados.
Na gastrula��o do anfioxo, as c�lulas da regi�o correspondente ao polo vegetativo
s�o empurradas para dentro, espremendo a blastocela. A g�strula ligeiramente
alongada tem inicialmente duas camadas celulares, uma mais externa, o ectoderma, e
outra mais interna, que alguns autores denominam mesentoderma, para ressaltar o
fato de que ela originar�, em seguida, o endoderma e o mesoderma. A cavidade
revestida pelo mesentoderma � o arqu�ntero, e o orif�cio que o comunica com o
exterior � o blast�poro.

P�gina 191

ILUSTRA��ES: ADILSON SECCO


Representa��o esquem�tica da sequ�ncia de est�gios iniciais do desenvolvimento
embrion�rio do anfioxo: m�rula, bl�stula e g�strula. (Elementos fora de propor��o
de tamanho entre si; cores-fantasia.) (Elaborada com base em Huettner, A., 1949.)
Na fase de n�urula, o ectoderma situado ao longo da regi�o dorsal forma o tubo
nervoso. O mesentoderma da regi�o dorsal do arqu�ntero origina a notocorda, bem
como os mesodermas paraxial (dividido em somitos), intermedi�rio e ventral, no qual
se forma a cavidade cel�mica. A epiderme do anfioxo adulto � proveniente do
ectoderma que revestia o embri�o e seu sistema nervoso deriva do tubo nervoso,
tamb�m de origem ectod�rmica. O intestino com suas gl�ndulas (f�gado, por exemplo)
e as br�nquias derivam do endoderma. Toda a musculatura e �rg�os internos prov�m do
mesoderma.

P�gina 192

ILUSTRA��ES: ADILSON SECCO


Representa��o esquem�tica dos est�gios de desenvolvimento que levam � forma��o da
n�urula no anfioxo. (Elementos fora de propor��o de tamanho entre si; cores-
fantasia.) (Elaborada com base em Huettner, A., 1949.)

P�gina 193

10.4 Anexos embrion�rios


As c�lulas de um embri�o t�m as mesmas necessidades b�sicas de qualquer c�lula:
precisam obter alimento e g�s oxig�nio para manter o metabolismo; t�m de eliminar
res�duos e subst�ncias de excre��o formados nas atividades metab�licas. De que
maneira as c�lulas embrion�rias conseguem suprir essas necessidades?
Como vimos, as subst�ncias nutritivas utilizadas por embri�es de muitas esp�cies
animais prov�m do vitelo. Um ovo mesol�cito de r�, por exemplo, tem vitelo
suficiente para nutrir o embri�o por alguns dias, at� a fase em que o girino come�a
a se alimentar; um ovo de galinha tem subst�ncias nutritivas suficientes para os 21
dias de desenvolvimento embrion�rio, at� a eclos�o do pintinho (fig. 10.8). Em
algumas esp�cies, incluindo a nossa, os ovos t�m pouqu�ssimo vitelo acumulado.
Surge, ent�o, uma quest�o a ser respondida mais adiante: como se alimentam as
c�lulas de um embri�o de mam�fero durante o per�odo de desenvolvimento embrion�rio,
que � geralmente longo?

GUSTOIMAGES/SCIENCE PHOTO LIBRARY/LATINSTOCK


Figura 10.8 Radiografias colorizadas artificialmente de ovo de galinha em
desenvolvimento (A, B e C) e fotografia de um pinto rec�m-nascido (D). A. Ovo com 6
dias de incuba��o. B. Ovo com 12 dias de incuba��o, mostrando o in�cio da forma��o
dos ossos. C. Ovo com 18 dias de incuba��o, faltando 3 dias para o nascimento.
Primeiramente, vamos analisar de que maneira os embri�es obt�m g�s oxig�nio para
respirar e como se livram do g�s carb�nico que surge como subproduto da respira��o.
O embri�o de r�, que completa seu desenvolvimento na �gua, utiliza-se da difus�o
para realizar todas as trocas gasosas necess�rias � sua vida. Um embri�o de ave,
que se desenvolve no ambiente seco em um ovo com casca, enfrenta uma si tua��o
diferente. Ser� que ocorre difus�o de gases do ar atrav�s da casca do ovo? E um
embri�o de mam�fero, cujo desenvolvimento ocorre no �tero materno, como respira?
Essas quest�es tamb�m ser�o respondidas mais adiante.
Um �ltimo ponto a considerar � o que fazer com as excre��es produzidas pelas
c�lulas embrion�rias. O embri�o de r�, para eliminar suas excre��es nitrogenadas,
n�o tem muitos problemas: as subst�ncias a serem excretadas saem das c�lulas
embrion�rias para a �gua circundante por difus�o. Mas o processo de excre��o � bem
diferente para um embri�o de ave ou de r�ptil, que completa o desenvolvimento
"lacrado" em um ovo com casca, que se desenvolve em terra firme. Como aves e
r�pteis mant�m as excre��es potencialmente t�xicas longe do embri�o, se ele se
encontra confinado no ovo? As respostas a todas essas quest�es envolvem os chamados
anexos embrion�rios.

P�gina 194

Em r�pteis, aves e mam�feros, paralelamente ao desenvolvimento dos tecidos e


�rg�os, formam-se estruturas externas ao embri�o denominadas anexos embrion�rios,
encarregadas de obter nutrientes, armazenar excre��es, manter um ambiente aquoso e
protegido para o embri�o e realizar trocas gasosas. Os anexos embrion�rios s�o o
saco vitel�nico, o alantoide, o �mnio e o c�rio. (Fig. 10.9)

ILUSTRA��O: ADILSON SECCO


Figura 10.9 Representa��o esquem�tica de um embri�o de galinha com 13 dias de
incuba��o (a 8 dias do nascimento), mostrando a localiza��o dos anexos
embrion�rios. (Elementos fora de propor��o de tamanho entre si; cores-fantasia.)
Finalmente, uma �ltima pergunta, entre tantas: por que os anexos embrion�rios est�o
presentes apenas em r�pteis, aves e mam�feros, essencialmente animais de terra
firme? A resposta est� no passado, quando ancestrais dos r�pteis estavam
conquistando os ambientes de terra firme, h� mais de 360 milh�es de anos. Antes
disso, n�o havia animais vertebrados nesses ambientes.
Entre as diversas adapta��es dos ancestrais dos r�pteis ao ambiente de terra firme,
uma das mais importantes foi o desenvolvimento de um ovo dotado de casca
imperme�vel � desseca��o. Entretanto, tal desenvolvimento exigiu novas adapta��es,
entre elas o surgimento e a evolu��o dos anexos embrion�rios.
Saco vitel�nico
O saco vitel�nico surge pelo crescimento conjunto do endoderma e da esplancnopleura
(mesoderma) sobre o vitelo. Trata-se de uma bolsa membranosa que envolve
completamente a massa vitel�nica. Assim, o embri�o passa a ter o saco de vitelo
estrategicamente ligado ao seu futuro intestino.
A parte mesod�rmica do saco vitel�nico desenvolve vasos sangu�neos e torna-se
ricamente vascularizada. Enzimas produzidas por c�lulas endod�rmicas digerem os
gr�os de vitelo, cujos nutrientes passam para os vasos sangu�neos e s�o
distribu�dos para todas as c�lulas do embri�o.
Alantoide
O alantoide � uma proje��o da parede do arqu�ntero, formada pelo crescimento
conjunto do endoderma e da esplancnopleura. Esse anexo embrion�rio tem, portanto, a
mesma constitui��o do saco vitel�nico. A principal fun��o do alantoide � armazenar
subst�ncias ricas em nitrog�nio excretadas pelos rins do embri�o, basicamente o
�cido �rico.
Excretar �cido �rico, uma subst�ncia pouco sol�vel em �gua, � uma adapta��o de aves
e de r�pteis. Como as excre��es acumuladas no alantoide n�o se difundem pelo ovo, o
embri�o n�o corre o risco de se intoxicar durante o desenvolvimento.
Outra fun��o do alantoide � participar da respira��o do embri�o, em parceria com
outro anexo embrion�rio, o c�rio, como veremos a seguir.
�mnio
O �mnio � formado pelo crescimento conjunto do ectoderma e da somatopleura
(mesoderma) ao redor do embri�o, constituindo uma bolsa membranosa que o envolve
totalmente: a bolsa amni�tica. Esta � repleta de l�quido e tem a fun��o de manter o
embri�o em um ambiente aquoso, prevenindo a desseca��o e amortecendo eventuais
choques mec�nicos.
C�rio
O c�rio � formado pelo crescimento conjunto da somatopleura e do ectoderma,
constituindo uma membrana que envolve todos os outros anexos embrion�rios,
incluindo a bolsa amni�tica que cont�m o embri�o.
Nos ovos de r�pteis e de aves, o c�rio se desenvolve bem embaixo da casca. O
alantoide tamb�m se desenvolve e sua face externa encosta-se no c�rio, junto �
casca. O conjunto formado pela associa��o entre o c�rio e o alantoide, denominado
alantoc�rio, ou corioalantoide, � ricamente vascularizado, o que permite uma
eficiente troca de gases entre os tecidos embrion�rios e o ar ao redor da casca.
(Fig. 10.10)

P�gina 195

ILUSTRA��ES: ADILSON SECCO


Figura 10.10 Representa��o esquem�tica do desenvolvimento dos anexos embrion�rios
em galinha. � esquerda, tr�s est�gios do desenvolvimento de um ovo em corte
longitudinal; o embri�o aparece cortado transversalmente. � direita, est�gios
correspondentes do ovo em corte transversal; o embri�o aparece cortado
longitudinalmente. Analise a figura acompanhando as explica��es no texto.
(Elementos fora de propor��o de tamanho entre si; cores-fantasia.) (Elaborada com
base em Houillon, C., 1972.)
Como se explica a presen�a de anexos embrion�rios em mam�feros?
Na maioria dos mam�feros, os embri�es se desenvolvem no interior do �tero materno.
Nesses animais, o embri�o e a m�e desenvolvem, em conjunto, uma estrutura
denominada placenta, pela qual estabelecem o interc�mbio de nutrientes, gases e
excre��es.
Entretanto, embri�es dos mam�feros placent�rios tamb�m apresentam os mesmos anexos
embrion�rios que r�pteis e aves - saco vitel�nico, alantoide, �mnio e c�rio -,
embora sua fun��o original tenha sido substitu�da pela placenta.
A presen�a dos anexos embrion�rios nos mam�feros placent�rios pode ser explicada
como um "resqu�cio" evolutivo do grupo: os mam�feros evolu�ram a partir de um grupo
antigo de r�pteis. Mesmo com a evolu��o da placenta, os anexos embrion�rios
persistiram como uma heran�a de nossa ancestralidade reptiliana.

P�gina 196

ATIVIDADES
Revendo conceitos, fatos e processos
Registre em seu caderno
1. O conjunto de transforma��es que v�o desde a fase de zigoto at� a forma��o de um
jovem animal � denominado
a) blastula��o.
b) embriog�nese.
c) gastrula��o.
d) neurula��o.
Escreva, em seu caderno, o termo abaixo que substitui corretamente a tarja entre
par�nteses das frases 2 e 3.
a) bl�stula
b) g�strula
c) m�rula
d) n�urula
2. O desenvolvimento embrion�rio inicia-se com uma s�rie de divis�es r�pidas do
zigoto, o que leva � forma��o de uma bola maci�a de c�lulas chamada (.....).
3. O est�gio do desenvolvimento embrion�rio dos vertebrados em que se formam os
somitos � a (.....).
4. Quais estruturas apresenta um embri�o de vertebrado em fase de n�urula, do dorso
para o ventre?
a) tubo nervoso, arqu�ntero e notocorda.
b) tubo nervoso, notocorda e arqu�ntero.
c) notocorda, tubo nervoso e arqu�ntero.
d) notocorda, arqu�ntero e tubo nervoso.
5. "Em determinado momento do desenvolvimento, ocorre remodela��o total do embri�o,
com intensa migra��o de c�lulas e forma��o dos tr�s folhetos germinativos."
O processo descreve qual est�gio de desenvolvimento embrion�rio?
a) Bl�stula.
b) G�strula.
c) M�rula.
d) N�urula.
Escreva, em seu caderno, o termo abaixo que substitui corretamente a tarja entre
par�nteses das frases de 6 a 10.
a) alantoc�rio
b) alantoide
c) �mnio
d) c�rio
e) saco vitel�nico
6. O anexo embrion�rio denominado (.....) � respons�vel pelo armazenamento de �cido
�rico em r�pteis e aves.
7. O (.....) mant�m um ambiente aquoso em torno do embri�o, protegendo-o da
desseca��o e de choques mec�nicos.
8. Formado pela justaposi��o de dois anexos embrion�rios, o (.....) � respons�vel
pelas trocas respirat�rias entre o embri�o e o ar circundante.
9. Um dos primeiros anexos embrion�rios a se formar, o (.....) tem a fun��o de
mobilizar as subst�ncias nutritivas do vitelo para o embri�o.
10. O (.....), al�m de envolver e proteger todos os anexos embrion�rios e o
embri�o, participa, com outro anexo, nos processos de trocas gasosas para a
respira��o.
Quest�es para exercitar o pensamento
Registre em seu caderno
11. As sequ�ncias de figuras abaixo representam est�gios do desenvolvimento inicial
de anfioxo (A) e de anf�bio (B).

OSVALDO SEQUETIN
(Esquemas simplificados.)
Em que diferem os processos que ocorrem em A e B? Como se explica a diferen�a?
12. Os esquemas a seguir representam dois momentos da embriog�nese do anfioxo (1 em
corte longitudinal e 2 em corte transversal).

OSVALDO SEQUETIN
(Elementos fora de propor��o de tamanho entre si.)
Com rela��o ao esquema 1, responda:
a) Em que fase de desenvolvimento se encontra o embri�o representado?
b) Qual � o nome das partes indicadas?

P�gina 197

Com rela��o ao esquema 2, responda:


a) Que est�gio de desenvolvimento est� se iniciando?
b) Qual � o nome das partes indicadas?
c) Esse esquema mostra um embri�o em que v�rios processos est�o se iniciando.
Utilizando o mesmo tipo de desenho, represente um corte transversal do embri�o em
um est�gio mais avan�ado, no qual os processos iniciados em 2 estejam finalizados.
Coloque legendas.
Fa�a voc� mesmo!
Registre em seu caderno
13. Constru��o de modelos: Trabalhando com modelos de embri�es
O uso de argila ou massa de modelar para representar est�gios do desenvolvimento
embrion�rio certamente ajuda muito na compreens�o desse complexo processo.
Desenhos, por melhores que sejam, s�o representa��es bidimensionais e n�o conseguem
transmitir todas as informa��es sobre a forma do embri�o, que � tridimensional.
Forme um grupo com quatro ou cinco colegas e escolha o organismo e as fases do
desenvolvimento embrion�rio que ser�o representados. Por exemplo, seu grupo poderia
modelar o desenvolvimento do anfioxo a partir do est�gio de zigoto at� o de m�rula.
Outro grupo modelaria o mesmo per�odo de desenvolvimento para um anf�bio; outro
grupo, para uma ave; e outro, para um mam�fero. Represente os embri�es tamb�m em
cortes transversais, de maneira a mostrar a organiza��o dos folhetos germinativos.
Para facilitar a visualiza��o, fa�a cada folheto de uma cor diferente. Se poss�vel,
registre em fotografias ou v�deo a realiza��o dos modelos. Depois de prontos,
organize uma exposi��o na escola com os modelos constru�dos. As fotografias e os
v�deos podem ser utilizados para enriquecer a exposi��o.
A Biologia no vestibular e no Enem
Registre em seu caderno
Quest�es objetivas
1. (Uerj) A partir de um ovo fertilizado de sapo, at� a forma��o do girino, ocorre
uma s�rie de divis�es celulares. A distribui��o percentual dos tipos de divis�o
celular, nessa situa��o, � a seguinte:
a) 100% mitose.
b) 100% meiose.
c) 50% meiose - 50% mitose.
d) 75% mitose - 25% meiose.
2. (Ufla-MG) Qual � a alternativa correta?
a) O arqu�ntero desenvolve-se em sistema respirat�rio.
b) O blast�poro d� origem � cavidade oral em mam�feros.
c) A forma��o do arqu�ntero caracteriza a fase de m�rula do desenvolvimento
embrion�rio.
d) O blast�poro � uma abertura que permite a comunica��o do arqu�ntero com o
ambiente externo.
3. (UFSCar-SP) Observe o corte de um embri�o a seguir esquematizado.

OSVALDO SEQUETIN
(Elementos fora de propor��o de tamanho entre si.)
Os algarismos 1, 2 e 3 representam, respectivamente,
a) o arqu�ntero, o celoma, o tubo neural.
b) o arqu�ntero, a m�rula, o tubo neural.
c) a m�rula, a bl�stula, a notocorda.
d) o arqu�ntero, o celoma, a notocorda.
e) o celoma, o arqu�ntero, a notocorda.
4. (UFRGS-RS) Os folhetos embrion�rios, atrav�s de processos de desenvolvimento e
diferencia��o, dar�o origem a diferentes estruturas nos indiv�duos adultos.
Considere as afirma��es abaixo relacionadas ao desenvolvimento embriol�gico.
I. A ectoderme origina a medula espinal.
II. A mesoderme origina o tecido muscular e �sseo.
III. A endoderme origina o tecido urogenital.
Quais est�o corretas?
a) Apenas I.
b) Apenas I e II.
c) Apenas I e III.
d) Apenas II e III.
e) I, II e III.
5. (Unifal-MG) Durante o desenvolvimento embrion�rio dos vertebrados, o conjunto de
c�lulas que se diferenciam dos blast�meros forma os folhetos germinativos e,
posteriormente, as diversas c�lulas do corpo. Com rela��o a esse processo, analise
as afirmativas a seguir.
I. O mesoderma origina as fibras musculares.
II. O ectoderma origina as c�lulas nervosas.
III. O endoderma origina as c�lulas do epit�lio intestinal.
� correto o que se afirma em
a) I e II apenas.
b) II e III apenas.
c) I e III apenas.
d) I apenas.
e) I, II, e III.

P�gina 198

6. (UFPR) Fase do desenvolvimento embrion�rio caracterizada pelo estabelecimento


dos tr�s folhetos germinativos (ectoderma, mesoderma e endoderma) e por intensos
movimentos morfogen�ticos:
a) Gastrula��o.
b) Clivagem.
c) Morfog�nese.
d) Fecunda��o.
e) Apoptose.
7. (UEMS) Nos vertebrados, ao longo do desenvolvimento embrion�rio, a notocorda �
substitu�da
a) pelo cord�o nervoso.
b) pela coluna vertebral.
c) pelo tubo neural.
d) pelo tubo digestivo.
e) pela placa dorsal.
8. (UEPB) Observe o esquema abaixo que representa um tipo de segmenta��o de ovos de
animais. A alternativa que cont�m as informa��es corretas quanto ao tipo de ovo,
tipo de segmenta��o e exemplo de ser vivo em que ocorre �:

ADILSON SECCO
(Elementos fora de propor��o de tamanho entre si.)
a) Ovo isol�cito, segmenta��o holobl�stica igual, ocorre em mam�feros.
b) Ovo telol�cito, segmenta��o merobl�stica discoidal, ocorre em anf�bios.
c) Ovo centrol�cito, segmenta��o merobl�stica superficial, ocorre em insetos.
d) Ovo centrol�cito, segmenta��o merobl�stica discoidal, ocorre em r�pteis e aves.
e) Ovo heterol�cito, segmenta��o holobl�stica desigual, ocorre em anf�bios.
9. (UFPI) Com rela��o aos aspectos da embriologia animal, as alternativas corretas
s�o:
a) A segmenta��o � uma fase do desenvolvimento embrion�rio que vai desde a primeira
divis�o do zigoto at� a forma��o de um aglomerado de c�lulas com uma cavidade
interna: a bl�stula.
b) Os ovos telol�citos, tamb�m chamados de oligol�citos, apresentam uma quantidade
relativamente pequena de vitelo, distribu�da de forma mais ou menos homog�nea no
citoplasma.
c) O endoderma d� origem ao revestimento interno do tubo digest�rio, al�m de
estruturas que se formam a partir dele, como gl�ndulas salivares, p�ncreas, f�gado
e ves�cula biliar.
d) Na fase embrion�ria da classe Mammalia, � medida que o desenvolvimento progride,
o embri�o � gradativamente envolvido pela bolsa amni�tica, que o mant�m hidratado e
protegido de eventuais choques mec�nicos.
Quest�es discursivas
10. (Unicamp-SP) As fases iniciais do desenvolvimento embrion�rio do anfioxo est�o
representadas nas figuras abaixo.

OSVALDO SEQUETIN
(Elementos fora de propor��o de tamanho entre si.)
a) Identifique essas fases.
b) Descreva as diferen�as de cada uma delas em rela��o � fase anterior.
11. (UFSCar-SP)
As mais vers�teis s�o as c�lulas-tronco embrion�rias (TE) isoladas pela primeira
vez em camundongos, h� mais de 20 anos. As c�lulas TE v�m da regi�o de um embri�o
muito jovem que, no desenvolvimento normal, forma as tr�s camadas germinativas
distintas de um embri�o mais maduro e, em �ltima an�lise, todos os diferentes
tecidos do corpo.
Scientific American Brasil, jul. 2004.
a) Quais s�o as tr�s camadas germinativas a que o texto se refere?
b) Ossos, enc�falo e pulm�o t�m, respectivamente, origem em quais dessas camadas
germinativas?
12. (Unicamp-SP) Os primeiros vertebrados a ocupar o ambiente terrestre foram os
anf�bios, que, por�m, ainda necessitam retornar � �gua para a reprodu��o. A
independ�ncia da �gua foi conseguida posteriormente atrav�s de novidades
evolutivas, como as relacionadas ao ovo.

OSVALDO SEQUETIN
(Elementos fora de propor��o de tamanho entre si.)
a) Indique as letras do esquema que correspondem �s estruturas que aparecem s� a
partir desse tipo de ovo. Identifique as estruturas indicadas.
b) Cite outra adapta��o reprodutiva para a vida animal em ambiente terrestre.
13. (Fuvest-SP)
a) Qual a fun��o desempenhada pelo �mnio no desenvolvimento embrion�rio?
b) Quais os grupos de vertebrados que apresentam essa estrutura?

P�gina 199

Cap�tulo 11 Reprodu��o humana

ISM/SCIENCE PHOTO LIBRARY/LATINSTOCK


Embri�o humano de aproximadamente 7 semanas de idade, medindo cerca de 2 cm de
comprimento.
Beb�s de proveta e clonagem humana
Londres, 25 de julho de 1978: nasce Louise Joy Brown, o primeiro beb� de proveta da
hist�ria da humanidade.
Leslie Brown, m�e de Louise, tinha as tubas uterinas obstru�das e n�o conseguia
engravidar. Em um procedimento at� ent�o in�dito, os ginecologistas Patrick Steptoe
(1913-1988) e Robert Edwards (1925-2013) aplicaram inje��es de horm�nios em Leslie,
o que induziu o amadurecimento de �vulos em seus ov�rios e preparou o �tero para a
gravidez. Em seguida, os m�dicos retiraram cirurgicamente alguns gametas dos
ov�rios de Leslie, passando-os para um frasco com meio nutritivo; a� eles foram
fecundados por espermatozoides do marido, John Brown, originando zigotos que
come�aram a se desenvolver em embri�es. Com seis dias de vida, alguns embri�es
foram implantados no �tero de Leslie Brown, onde um deles se desenvolveu e gerou
Louise.
O sucesso na concep��o de Louise levou milhares de mulheres com problemas de
infertilidade a implantar em seus �teros embri�es concebidos in vitro, isto �, em
frascos de laborat�rio.
Atualmente, a fertiliza��o in vitro � cada vez mais utilizada, por�m ainda desperta
pol�micas. Em cada tratamento, geralmente s�o fecundados entre 10 e 15 �vulos, a
maioria dos quais se desenvolve e origina embri�es. Alguns dias depois, at� quatro
embri�es selecionados s�o implantados no �tero da mulher, uma vez que a chance de
sucesso nessa etapa � da ordem de 25%. Os demais embri�es s�o congelados em
nitrog�nio l�quido, a uma temperatura de quase 196 �C negativos, podendo
eventualmente ser utilizados se a primeira implanta��o n�o for bem-sucedida ou se o
casal desejar outros filhos mais tarde.

P�gina 200

O que fazer com os embri�es congelados? Guard�-los indefinidamente? Descart�-los?


Esta �ltima hip�tese poderia ser considerada um aborto? Seria �tico doar ou vender
os embri�es para outras pessoas? Ou mesmo utiliz�-los em pesquisas cient�ficas que
visam � obten��o de c�lulas#tronco? Essas s�o apenas algumas das quest�es que
surgem quando o assunto � reprodu��o humana.
As pol�micas aumentaram ainda mais com o sucesso da clonagem da ovelha Dolly,
originada a partir de uma �nica c�lula de uma ovelha adulta. Abriu-se, assim, a
possibilidade de se fazer o mesmo com seres humanos. Teoricamente, uma pessoa
poderia contratar os servi�os de uma mulher que doasse �vulos, cujos n�cleos seriam
eliminados; um desses gametas anucleados receberia o n�cleo (e os genes) da pessoa
"contratante", formando-se o zigoto. O embri�o resultante desse zigoto, implantado
no �tero de uma "m�e de aluguel" ou da pr�pria doadora dos �vulos, originaria uma
crian�a geneticamente id�ntica � pessoa que doou o n�cleo - seu pr�prio clone.
A principal cr�tica � clonagem humana � que a pessoa clonada seria privada do
direito de possuir uma identidade gen�tica �nica e original, por ter seu genoma
deliberadamente escolhido por algu�m. Alguns temem tamb�m a possibilidade de clonar
um n�mero ilimitado de determinadas pessoas, criando assim "ex�rcitos" de
oper�rios, soldados, artistas, professores etc. Pensa-se, ainda, em usar a clonagem
para produzir tecidos e �rg�os humanos em laborat�rio, o que supriria a enorme
necessidade de �rg�os para transplantes.
A ci�ncia e a tecnologia abrem possibilidades pr�ticas antes inimagin�veis. Com
isso, � preciso repensar antigos valores �ticos e morais. E voc�, o que acha de
tudo isso? As discuss�es prosseguem e ningu�m pode ficar fora delas.
A import�ncia do assunto
Neste cap�tulo apresentamos os aspectos b�sicos da reprodu��o humana. O
conhecimento cient�fico sobre o tema tem levado as pessoas a ter mais consci�ncia
de sua pr�pria reprodu��o. Al�m do m�todo natural de controle, que requer apenas o
conhecimento do ciclo reprodutivo (e muita disciplina, � claro!), h� diversos
m�todos anticoncepcionais eficazes, como a p�lula, a camisinha, o diafragma, o DIU
(dispositivo intrauterino), entre outros. Em uma sociedade democr�tica, espera-se
que cada um possa escolher livremente a utiliza��o ou n�o de m�todos
anticoncepcionais, de acordo com seus valores e cren�as.
Gra�as aos conhecimentos sobre a reprodu��o humana, muitos casais tamb�m podem
solucionar dificuldades biol�gicas para ter filhos. Os tratamentos variam desde
inje��es de horm�nios e corre��o cir�rgica de �rg�os genitais at� a fertiliza��o in
vitro e a implanta��o dos embri�es no �tero materno.
O conhecimento dos fundamentos da reprodu��o humana � um exerc�cio de cidadania,
n�o apenas por possibilitar a cada pessoa o controle da pr�pria reprodu��o, mas
tamb�m por levar a reflex�es mais aprofundadas sobre o crescimento populacional
humano, em um mundo j� t�o intensamente povoado.
11.1 Sistema genital feminino
O sistema genital feminino comp�e-se de �rg�os situados externamente ao corpo da
mulher (pudendo feminino ou vulva) e de �rg�os localizados no interior do abdome
(vagina, �tero, um par de tubas uterinas e um par de ov�rios).
Pudendo feminino
O pudendo feminino, ou vulva, localiza-se na regi�o baixa do ventre, entre as
coxas, sendo constitu�do pelos l�bios maiores, l�bios menores, clit�ris e vest�bulo
vaginal.
Os l�bios maiores s�o duas sali�ncias que se estendem paralelamente da regi�o
inferior do p�bis at� as proximidades do �nus. Mais internamente, h� um par de
l�bios menores, que delimitam a entrada da vagina, regi�o denominada vest�bulo
vaginal.
Na regi�o vulvar anterior, perto da jun��o entre os l�bios menores, localiza-se o
clit�ris, �rg�o com cerca de 1 cm de comprimento dotado de grande sensibilidade
t�til. Ele � constitu�do por tecido er�til: durante a excita��o sexual, recebe
grande afluxo de sangue e fica intumescido.

P�gina 201

O clit�ris origina-se da mesma estrutura embrion�ria que o p�nis (s�o �rg�os


hom�logos), mas, diferentemente deste, o clit�ris n�o � percorrido pela uretra; a
uretra feminina abre-se em uma pequena fenda no vest�bulo vaginal, entre o clit�ris
e a abertura da vagina.
No vest�bulo vaginal desembocam condutos provenientes de um par de gl�ndulas
vestibulares maiores (ou gl�ndulas de Bartholin), produtoras de uma secre��o
lubrificante que facilita a penetra��o do p�nis durante o ato sexual. Na maioria
das mulheres virgens, a entrada da vagina � parcialmente recoberta por uma membrana
denominada h�men, que geralmente se rompe no primeiro ato sexual. (Fig. 11.1)

ILUSTRA��ES: JURANDIR RIBEIRO


Figura 11.1 Representa��o do sistema genital feminino humano. A. Pudendo feminino
(ou vulva). B. Vista lateral e em corte da regi�o p�lvica mostrando o sistema
genital feminino. C. Vista frontal e em corte dos �rg�os genitais internos e do
pudendo feminino. A tuba direita (� esquerda na ilustra��o) est� representada fora
de sua posi��o normal para melhor visualiza��o. A bexiga urin�ria, o reto e o �nus,
apesar de indicados nas figuras, n�o fazem parte do sistema genital. (Elementos
fora de propor��o de tamanho entre si; cores-fantasia.)
Vagina e �tero
A vagina � um tubo de paredes fibromusculares, com cerca de 10 cm de comprimento,
que vai do vest�bulo vaginal � base do �tero, com o qual se comunica. Durante a
excita��o sexual, as paredes da vagina se dilatam e as gl�ndulas vestibulares
secretam subst�ncias lubrificantes que facilitam a penetra��o do p�nis.
O �tero � um �rg�o muscular oco, de tamanho e forma parecidos com os de uma pera.
Em mulheres que nunca engravidaram, ele mede cerca de 7,5 cm de comprimento por 5
cm de largura. A por��o superior do �tero, mais arredondada, conecta-se �s tubas
uterinas. A por��o inferior, mais afilada, denominada colo uterino, projeta-se para
o interior da vagina, comunicando-se com ela por meio de uma pequena abertura com
menos de 0,5 mm de di�metro. Durante o parto, essa abertura se alarga, permitindo a
sa�da do beb�.
A parede do �tero, com cerca de 2,5 cm de espessura, � constitu�da por m�sculos e
capaz de grande dilata��o durante a gravidez. Internamente, o �tero � revestido
pelo endom�trio, um tecido rico em gl�ndulas, vasos sangu�neos e vasos linf�ticos.

P�gina 202

Tubas uterinas e ov�rios


As tubas uterinas, ou ovidutos, s�o dois tubos curvos, com cerca de 10 cm de
comprimento, ligados � parte superior do �tero. A extremidade livre de cada tuba
uterina � alargada e franjada e situa-se pr�ximo de um dos ov�rios. O interior das
tubas � revestido por c�lulas dotadas de c�lios, cujos batimentos contribuem para o
deslocamento do gameta liberado pelo ov�rio em dire��o ao �tero.
Os ov�rios s�o duas estruturas ovoides com cerca de 3 cm de comprimento,
localizados na cavidade abdominal, na regi�o da virilha. Na por��o ovariana mais
externa, chamada c�rtex ovariano, localizam-se as c�lulas que originam os gametas
femininos.
O processo de forma��o dos gametas femininos - a ovulog�nese - inicia-se antes do
nascimento da mulher, em torno do terceiro m�s de sua vida intrauterina. As c�lulas
diploides precursoras dos �vulos, as ovog�nias, param de se multiplicar, crescem e
iniciam a meiose, passando a ser chamadas ov�citos prim�rios (ou ov�citos I). A
meiose � interrompida ainda na pr�fase I. Os ov�citos prim�rios permanecem
estacionados nessa fase da meiose at� serem ati vados por um horm�nio produzido
pela parte anterior da gl�ndula hip�fise (adenoip�fise), o FSH (em portugu�s,
horm�nio estimulante do fol�culo).
Cada ov�cito prim�rio est� envolto por algumas camadas de c�lulas especializadas
(c�lulas foliculares), constituindo um fol�culo ovariano. Ao nascer, a mulher tem
cerca de 500 mil fol�culos em cada ov�rio; mais da metade, por�m, degenera antes da
adolesc�ncia.
A partir da puberdade, aproximadamente a cada 28 dias, a adenoip�fise aumenta a
libera��o do horm�nio FSH, o que estimula o desenvolvimento de alguns fol�culos. No
entanto, geralmente apenas um deles amadurece. O fol�culo em amadurecimento acumula
l�quido e cresce, formando uma sali�ncia na superf�cie do ov�rio. O ov�cito
prim�rio conclui a primeira divis�o da meiose e origina um ov�cito secund�rio (ou
ov�cito II) e um gl�bulo polar (primeiro gl�bulo polar ou gl�bulo polar I),
praticamente sem citoplasma, que logo degenera (relembre no cap�tulo 9).
O ov�cito secund�rio prossegue a segunda divis�o mei�tica at� a met�fase II, quando
o fol�culo se rompe e libera o ov�cito, fen�meno denominado ovula��o. A c�lula
sexual feminina liberada na ovula��o humana, assim como nos demais mam�feros, � um
ov�cito secund�rio estacionado em met�fase II da meiose e que somente completar� a
divis�o se houver fecunda��o. Essa c�lula � considerada o �vulo dos mam�feros,
apesar de a meiose ainda n�o haver se completado; caso seja fecundada por um
espermatozoide, forma-se o segundo gl�bulo polar e, em seguida, surge o zigoto. Se
a fecunda��o n�o ocorre dentro de aproximadamente 24 horas ap�s a ovula��o, o �vulo
degenera sem terminar a meiose.
No ov�rio, as c�lulas do fol�culo rompido na ovula��o desenvolvem-se, originando o
corpo-amarelo ou corpol�teo, uma "cicatriz" amarelada no ov�rio devido ao ac�mulo
de carotenoides pelas c�lulas foliculares.
11.2 Sistema genital masculino
O sistema genital masculino comp�e-se de �rg�os externos, o p�nis e a bolsa
escrotal ou escroto, na qual ficam alojados os test�culos, e de �rg�os internos,
entre os quais se destacam os ductos deferentes, as gl�ndulas seminais e a
pr�stata.
P�nis, escroto e test�culos
O p�nis � o �rg�o copulador masculino. Ao longo de seu comprimento, h� tr�s massas
de tecido er�til, sendo dois corpos cavernosos laterais e um corpo esponjoso ao
redor da uretra. Esses tecidos recebem grande afluxo de sangue durante a excita��o
sexual, intumescendo-se e levando � ere��o do p�nis, o que possibilita o ato
sexual. Perto da extremidade do p�nis, o corpo esponjoso expande-se e forma a
glande, que apresenta grande sensibilidade t�til, sendo protegida por uma dobra de
pele chamada prep�cio.
O p�nis � percorrido longitudinalmente pela uretra, um canal que pertence tanto ao
sistema urin�rio quanto ao sistema genital masculino, pelo qual s�o eliminados a
urina e o esperma.

P�gina 203

O escroto, ou bolsa escrotal, � uma bolsa musculocut�nea situada entre as coxas, na


base do p�nis; em seu interior, alojam-se dois test�culos, as g�nadas masculinas.
Cada test�culo � constitu�do por milhares de tubos finos e enovelados, os t�bulos
semin�feros, e envolto por diversas camadas de tecido conjuntivo. Nos t�bulos
semin�feros s�o produzidos os espermatozoides, os gametas masculinos. Entre os
t�bulos semin�feros, situam-se as c�lulas intersticiais, respons�veis pela produ��o
de testosterona, o horm�nio sexual masculino. (Fig. 11.2)

ILUSTRA��ES:JURANDIR RIBEIRO
Figura 11.2 Representa��o do sistema genital masculino humano. A. Vista externa. B.
Vista lateral e em corte mostrando �rg�os internos. A bexiga urin�ria, o reto e o
�nus, apesar de indicados na figura, n�o fazem parte do sistema genital. (Elementos
fora de propor��o de tamanho entre si; cores-fantasia.)
O processo de forma��o dos gametas masculinos - a espermatog�nese - inicia-se ainda
na vida embrion�ria, mas se acentua e se completa a partir da puberdade. As c�lulas
diploides precursoras dos espermatozoides, as espermatog�nias, localizam-se nas
paredes dos t�bulos semin�feros e multiplicam-se durante praticamente toda a vida
do homem, declinando apenas na velhice.
Enquanto a maioria das espermatog�nias continua a se multiplicar por mitose,
algumas crescem e iniciam a meiose, passando a ser chamadas espermat�citos
prim�rios. Ao fim da primeira divis�o mei�tica, as duas c�lulas que surgem s�o
denominadas espermat�citos secund�rios. Ambos executam a segunda divis�o mei�tica,
produzindo quatro esperm�tides haploides. Cada esperm�tide diferencia-se em um
espermatozoide (relembre no cap�tulo 9).
Os espermatozoides rec�m-formados s�o transportados para o epid�dimo, um tubo
enovelado com cerca de 6 cm de comprimento, localizado sobre o test�culo. A�, eles
completam seu amadurecimento e ficam armazenados at� ser eliminados na ejacula��o.
Ductos deferentes e gl�ndulas acess�rias
Dos epid�dimos, os espermatozoides passam por dois tubos finos, com cerca de 45 cm
de comprimento, os ductos deferentes. Estes sobem pelo abdome, contornam a bexiga
urin�ria e unem-se no ducto ejaculat�rio, que desemboca na uretra.

P�gina 204

Gl�ndulas localizadas atr�s da bexiga urin�ria, as gl�ndulas seminais ou ves�culas


seminais produzem e eliminam sua secre��o no ducto ejaculat�rio, no cl�max da
excita��o sexual, o orgasmo. Essa secre��o constitui a maior parte do volume do
esperma ou s�men, como � chamado o fluido formado por espermatozoides e l�quidos
nutritivos.
A pr�stata, localizada embaixo da bexiga urin�ria, � uma gl�ndula com cerca de 4 cm
de di�metro que envolve a por��o inicial da uretra. A secre��o prost�tica � lan�ada
na uretra e no ducto ejaculat�rio por meio de diversos canais.
Embaixo da pr�stata, desembocando na uretra, h� um par de gl�ndulas bulbouretrais.
Durante a excita��o sexual, essas gl�ndulas liberam um l�quido que contribui para a
limpeza do canal da uretra, antes da passagem do esperma.
No cl�max da excita��o sexual masculina, quase sempre ocorre ejacula��o, processo
de elimina��o do esperma atrav�s da uretra. O volume de esperma eliminado em cada
ejacula��o � de aproximadamente 5 mL e cont�m cerca de 350 milh�es de
espermatozoides. (Fig. 11.3)

ILUSTRA��ES: CAN�ADO
Figura 11.3 A. Representa��o esquem�tica de um test�culo humano em corte, mostrando
um t�bulo semin�fero em detalhe. B. Parte da parede do t�bulo semin�fero em corte
transversal, mostrando os diversos est�gios de forma��o dos espermatozoides.
(Elementos fora de propor��o de tamanho entre si; cores-fantasia.)
11.3 Horm�nios relacionados � reprodu��o
A puberdade humana � marcada por grandes transforma��es no corpo e na mente dos
adolescentes. O desenvolvimento f�sico e mental acelera-se e come�am a se definir
as caracter�sticas sexuais secund�rias, t�picas de f�meas e machos de nossa
esp�cie. Nas meninas, os seios desenvolvem-se, as curvas corporais se acentuam e
surgem pelos axilares e pubianos. Nos meninos, al�m dos pelos axilares e pubianos,
desenvolve-se barba, a voz engrossa e a musculatura torna-se mais densa. Isso para
citar apenas algumas das muitas transforma��es que ocorrem nessa fase da vida
humana.
As transforma��es exteriorizadas da adolesc�ncia sinalizam importantes mudan�as
internas; o organismo torna-se capaz de cumprir, caso deseje, uma das poss�veis
tarefas de todo ser vivo: reproduzir-se.
Como veremos a seguir, todas essas mudan�as s�o desencadeadas pelos horm�nios
sexuais. Essas subst�ncias s�o lan�adas no sangue em pequenas quantidades por
certas gl�ndulas end�crinas. Ainda durante o desenvolvimento embrion�rio, os
horm�nios influenciam a forma��o dos �rg�os genitais; a partir da puberdade, eles
acentuam as diferen�as entre machos e f� meas, induzem a forma��o dos gametas e
promovem o impulso sexual, al�m de serem os principais respons�veis pelas
modifica��es do organismo feminino durante a gravidez e a amamenta��o do beb�.

P�gina 205

Gonadotrofinas: FSH e LH
As mudan�as fisiol�gicas que ocorrem aproximadamente entre 11 e 14 anos de idade,
caracterizando a puberdade, s�o controladas por dois horm�nios produzidos pela
adenoip�fise: o horm�nio estimulante do fol�culo (FSH) e o horm�nio luteinizante
(LH). Esses horm�nios s�o chamadosgonadotrofinas (do grego trophos, nutri��o,
desenvolvimento), pois atuam sobre as g�nadas.
Nos meninos, o FSH e o LH agem sobre os test�culos, estimulando a produ��o da
testosterona. Nas meninas, o FSH atua sobre os ov�rios, promovendo o
desenvolvimento dos fol�culos ovarianos, enquanto o LH � respons�vel pelo
rompimento do fol�culo maduro e pela libera��o do �vulo. O LH tamb�m atua sobre o
fol�culo rompido, estimulando sua transforma��o em corpo-amarelo ou corpo-l�teo,
que produz o horm�nio progesterona, como veremos a seguir.
Estr�geno e progesterona
O estr�geno � produzido principalmente pelas c�lulas do fol�culo ovariano em
desenvolvimento e determina o aparecimento das caracter�sticas sexuais secund�rias
da mulher, tais como o desenvolvimento das mamas, o alargamento dos quadris e o
ac�mulo de gordura em determinados locais do corpo, caracter�sticas das formas
femininas. O estr�geno tamb�m induz o amadurecimento dos �rg�os genitais e promove
o impulso sexual.
A progesterona, produzida principalmente pelo corpo-amarelo ovariano, tem
import�ncia fundamental no processo reprodutivo, pois, juntamente com o estr�geno,
atua na prepara��o da parede uterina para receber o embri�o. (Tab. 11.1)
Tabela 11.1 Principais horm�nios reprodutivos e sua a��o no organismo feminino
Gl�ndula Horm�nio �rg�o-alvo Principais a��esHip�fise FSH Ov�rioEstimula o
desenvolvimento do fol�culo, a secre��o de estr�geno e a ovula��o.LH Ov�rio
Estimula a ovula��o e o desenvolvimento do corpo-amarelo.ProlactinaMamasEstimula a
produ��o de leite (ap�s estimula��o pr�via das gl�ndulas mam�rias por estr�geno e
progesterona).Ov�rioEstr�geno DiversosAtua no crescimento do corpo e dos �rg�os
genitais; estimula o desenvolvimento das caracter�sticas sexuais secund�rias.
Sistema genitalEstimula a matura��o dos �rg�os genitais e a prepara��o do �tero
para a gravidez.Progesterona�teroCompleta a prepara��o da mucosa uterina, mantendo-
a pronta para a gravidez.MamasEstimula o desenvolvimento das gl�ndulas
mam�rias.Testosterona
A testosterona � um horm�nio produzido pelas c�lulas intersticiais dos test�culos,
sendo respons�vel pelo aparecimento das caracter�sticas sexuais secund�rias
masculinas, tais como barba, espessamento das pregas vocais, que torna a voz mais
grave, e maior desenvolvimento da musculatura corporal em rela��o �s mulheres. Esse
horm�nio induz o amadurecimento dos �rg�os genitais, promove o impulso sexual e,
com o FSH e o LH, estimula a produ��o de espermatozoides.
A testosterona come�a a ser produzida ainda na fase embrion�ria; � sua presen�a no
embri�o que determina o desenvolvimento dos �rg�os genitais masculinos. A aus�ncia
de testosterona ou a falta de receptores para esse horm�nio nas c�lulas do embri�o
fazem com que ele desenvolva o sexo feminino. (Fig. 11.4)

P�gina 206

ILUSTRA��O: SIMONKA
Figura 11.4 Representa��o da diferencia��o dos �rg�os genitais humanos. At� a
s�tima semana de vida intrauterina, a estrutura genital humana externa ainda �
indiferenciada; os �rg�os genitais internos e externos de uma pessoa ainda n�o se
diferenciaram em feminino ou masculino. A produ��o de testosterona pelos test�culos
embrion�rios induz a diferencia��o do sistema genital em masculino (esquerda); sem
a a��o desse horm�nio, o sistema genital desenvolve-se no sexo feminino (direita).
Note a correspond�ncia de origem entre os l�bios vaginais e o escroto, bem como
entre o clit�ris e o p�nis. (Elementos fora de propor��o de tamanho entre si;
cores-fantasia.)
Controle hormonal do ciclo menstrual
A partir da puberdade, a mulher entra na fase reprodutiva, que vai,
aproximadamente, at� os 50 anos de idade. Nesse per�odo, a cada 28 dias, em m�dia,
o organismo feminino prepara-se para uma poss�vel gravidez, produzindo �vulos e
desenvolvendo o revestimento da parede uterina, o endom�trio, para a eventualidade
de receber um embri�o.
Se a fecunda��o n�o ocorre, o revestimento da parede uterina sofre uma descama��o e
� eliminado pela vagina, fen�meno denominado menstrua��o. O per�odo menstrual dura
entre 3 e 7 dias e ocorre todo m�s, a cada 28 dias, em m�dia, dependendo da mulher
e de suas condi��es fisiol�gicas. O intervalo entre o in�cio de uma menstrua��o e o
in�cio da seguinte � chamado ciclo menstrual.
Durante o ciclo menstrual, as taxas dos horm�nios sexuais sofrem varia��es
expressivas. A menstrua��o ocorre, precisamente, quando as taxas de todos esses
horm�nios se tornam muito baixas no sangue da mulher.
Durante o per�odo de menstrua��o, a adenoip�fise come�a gradativamente a aumentar a
produ��o do horm�nio FSH, cuja taxa eleva-se no sangue. O FSH promove o
desenvolvimento de alguns fol�culos ovarianos, que passam a produzir o horm�nio
estr�geno. A eleva��o da taxa de estr�geno na circula��o sangu�nea induz o
espessamento do endom�trio, que se torna rico em vasos sangu�neos e em gl�ndulas.
Quando a taxa de estr�geno no sangue atinge determinado n�vel, a adenoip�fise �
estimulada a liberar LH. A a��o desses horm�nios induz a ovula��o, que ocorre
geralmente por volta do d�cimo quarto dia a partir do in�cio do ciclo menstrual.
O LH, presente em taxas elevadas a partir da ovula��o, induz as c�lulas do fol�culo
ovariano rompido a formar o corpo-amarelo, que produz pequena quantidade de
estr�geno e grande quantidade de progesterona. O corpo-amarelo atinge seu
desenvolvimento m�ximo cerca de 8 a 10 dias ap�s a ovula��o. Caso n�o ocorra
fecunda��o, o corpo-amarelo regride.

P�gina 207
O estr�geno e a progesterona atuam em conjunto no �tero, que continua a se preparar
para uma eventual gravidez. A taxa elevada desses horm�nios passa a exercer um
efeito inibidor sobre a adenoip�fise, que diminui a produ��o de FSH e LH.
A queda na taxa de LH tem como consequ�ncia direta a regress�o do corpo-amarelo,
que deixa de produzir estr�geno e progesterona. A redu��o brusca nas taxas desses
dois horm�nios ovarianos leva ao desprendimento da mucosa uterina, que � eliminada
na menstrua��o. Caso haja fecunda��o, o corpo-amarelo mant�m-se em atividade por
a��o do horm�nio gonadotrofina cori�nica, como veremos no pr�ximo item.
Por sua vez, a queda nas taxas de estr�geno e de progesterona faz com que a
adenoip�fise volte a produzir FSH, iniciando-se, assim, um novo ciclo menstrual.
(Fig. 11.5)

ILUSTRA��ES: JURANDIR RIBEIRO


Figura 11.5 Gr�ficos que mostram a varia��o das taxas dos horm�nios hipofis�rios
FSH e LH e dos horm�nios sexuais estr�geno e progesterona durante o ciclo
menstrual. A varia��o desses horm�nios est� relacionada com as altera��es do
fol�culo ovariano e do endom�trio. Analise a figura acompanhando as explica��es no
texto. (Elementos fora de propor��o de tamanho entre si; cores-fantasia.)
(Elaborados com base em Campbell, N. A. e cols., 1999.)
A produ��o dos horm�nios sexuais femininos declina acentuadamente a partir dos 50
anos de idade da mulher, em m�dia. Os ciclos menstruais tornam-se irregulares, at�
cessarem por completo. Essa fase, que marca o fim da fase reprodutiva feminina, �
chamada climat�rio. Embora o termo menopausa seja popularmente empregado para
denominar esse per�odo, menopausa � o nome dado � �ltima menstrua��o na vida da
mulher.

P�gina 208

Amplie seus conhecimentos


Homens e mulheres: compreender conceitos para vencer preconceitos e estere�tipos
Determina��o do sexo biol�gico na esp�cie humana
Nos seres humanos, como em muitas outras esp�cies, h� diferen�as marcantes entre
indiv�duos do sexo masculino e do sexo feminino. O conjunto dessas diferen�as �
chamado de dimorfismo sexual. O sexo biol�gico pode ser diferenciado pelo tipo de
genit�lia, pelos tipos de cromossomos no n�cleo das c�lulas e pelos horm�nios no
sangue do indiv�duo.
Ao nascer, a diferen�a externa mais not�vel que distingue crian�as do sexo
masculino e do sexo feminino � o tipo de genit�lia externa - presen�a de p�nis e
bolsa escrotal nos meninos, e de pudendo feminino (ou vulva) nas meninas.
Internamente, meninos t�m como g�nadas - �rg�os produtores de gametas - os
test�culos, localizados na bolsa escrotal, al�m de outros �rg�os genitais internos
como epid�dimos, ductos deferentes, pr�stata etc., enquanto meninas t�m como
g�nadas os ov�rios, al�m de outros �rg�os genitais internos como os ovidutos, o
�tero e a vagina (reexamine os esquemas dos sistemas genitais apresentados no
cap�tulo).
Ao longo do desenvolvimento e principalmente ap�s a puberdade, as diferen�as
f�sicas entre os sexos se acentuam e surgem as chamadas caracter�sticas sexuais
secund�rias. Entre elas podem-se destacar a distribui��o da gordura corporal, que
torna os corpos femininos geralmente mais arredondados que os masculinos, a
quantidade da massa muscular e �ssea, geralmente maior nos homens, a presen�a de
mamas desenvolvidas nas mulheres, a quantidade e a distribui��o dos pelos
corporais, sem falar no timbre da voz, geralmente mais grave nas pessoas do sexo
masculino.
Em nossa esp�cie, o sexo biol�gico �, primariamente, determinado no momento da
fecunda��o, quando ocorre a uni�o de um espermatozoide, que cont�m os cromossomos e
genes paternos, e um �vulo, que cont�m cromossomos e genes maternos. A fecunda��o
de um �vulo por um espermatozoide portador de cromossomo X originar� um indiv�duo
com caracter�sticas t�picas do sexo feminino, que apresenta em suas c�lulas um par
de cromossomos sexuais do tipo X, al�m de 22 pares de cromossomos equivalentes aos
do sexo masculino (autossomos). Por isso, costuma-se representar a f�rmula
cromoss�mica feminina como 44A + XX. Por outro lado, a fecunda��o de um �vulo por
um espermatozoide portador de cromossomo Y originar� um indiv�duo do sexo
masculino. Nos homens, al�m dos 22 pares de autossomos, h� um cromossomo do tipo X
equivalente ao feminino e um cromossomo Y. Assim, a f�rmula cromoss�mica masculina
� 44A + XY.
A determina��o do sexo na esp�cie humana, como em outros mam�feros, deve-se �
presen�a de um gene localizado no bra�o curto do cromossomo Y, denominado SRY (do
ingl�s, sex regulation on the Y). O produto desse gene, atuando sobre as c�lulas da
g�nada ainda indiferenciada do embri�o, faz com que ela se desenvolva em test�culo.
A aus�ncia do produto desse gene, como ocorre em embri�es XX, faz com que a g�nada
embrion�ria se diferencie em ov�rio. S�o conhecidos casos de cromossomos Y em que o
gene SRY, devido a uma muta��o, foi perdido ou se tornou n�o funcional. Nesse caso,
a g�nada indiferenciada do embri�o XY desenvolve-se em ov�rio e a pessoa manifesta
o sexo feminino, apesar de ser cromossomicamente XY. Resumindo, a presen�a do gene
SRY normal leva � condi��o masculina, enquanto sua aus�ncia ou falhas em seu
funcionamento levam � condi��o feminina.
De que maneira a diferencia��o das g�nadas em test�culos resulta em uma pessoa do
sexo masculino? Na g�nada masculina em desenvolvimento por a��o do gene SRY, s�o
ativados os genes respons�veis pela s�ntese da testosterona, horm�nio que leva ao
desenvolvimento das caracter�sticas sexuais secund�rias masculinas.
A testosterona produzida nos test�culos � liberada na corrente sangu�nea do
embri�o, atuando sobre determinadas c�lulas corporais, genericamente denominadas
c�lulas-alvo do horm�nio. Em adolescentes, as c�lulas-alvo da testosterona s�o
desde c�lulas cerebrais at� c�lulas musculares, cartilaginosas, epid�rmicas etc.,
respons�veis pelas caracter�sticas sexuais secund�rias masculinas.
No citoplasma das c�lulas-alvo, a testosterona une-se a uma prote�na denominada AR
(do ingl�s, androgen receptor, receptor de andr�geno), a qual � produzida por um
gene localizado no cromossomo X (gene AR). O complexo formado pela prote�na AR
unida � testosterona penetra no n�cleo das c�lulas-alvo e ativa genes
masculinizantes.
A prote�na AR �, portanto, crucial na determina��o do sexo masculino. Se o gene que
codifica essa prote�na for perdido ou sofrer uma muta��o que o inative, a
testosterona n�o atuar� e n�o haver� efeito masculinizante no corpo do indiv�duo.
Uma muta��o rara ligada ao cromossomo X, que ocorre em 1 a cada 65 mil nascimentos
de pessoas XY, � respons�vel pela chamada "s�ndrome da insensibilidade a
andr�genos". As pessoas afetadas por essa s�ndrome, apesar de terem cari�tipo 44A +
XY, desenvolvem-se como mulheres,

P�gina 209

apresentando genit�lia externa tipicamente feminina e vagina, mas n�o t�m �tero nem
ov�rios; os test�culos alojam-se nos l�bios vaginais ou no abdome. Apesar do
fen�tipo feminino e de poderem ser sexualmente ativas, essas pessoas s�o est�reis,
condi��o que n�o pode ser revertida por tratamento hormonal.
Diferen�as al�m do sexo biol�gico
Al�m das diferen�as entre homens e mulheres quanto �s caracter�sticas sexuais
prim�rias (genit�lia) e secund�rias, h� tamb�m diferen �as quanto a aspectos
cognitivos e emocionais. Embora diversas pesquisas venham apontando diferen�as
cerebrais e comportamentais entre os sexos, uma das grandes dificuldades nesse
campo do conhecimento reside na influ�ncia que a educa��o e os aspectos sociais
exercem sobre as pessoas.
Nos dias atuais, em que h� maior liberdade de express�o e maior aceita��o de
minorias sociais, discute-se a possibilidade de identificar as pessoas, em vez de
pelo sexo biol�gico, pelo g�nero, definido como a identidade de uma pessoa n�o
apenas em fun��o de seus �rg�os genitais, mas tamb�m de sua estrutura psicol�gica,
de seu comportamento na sociedade e de seu autorreconhecimento.
Usualmente os principais g�neros s�o o masculino e o feminino; por�m, h� casos em
que o sexo biol�gico determinado geneticamente n�o corresponde � identidade de
g�nero que o indiv�duo tem de si mesmo (transg�neros).
Al�m do sexo biol�gico e da identidade de g�nero, tamb�m h� a orienta��o sexual do
indiv�duo, que envolve a atratividade sexual-afetiva. Por exemplo, quando essa
atra��o ocorre entre pessoas de sexos diferentes, ela � chamada de
heterossexualidade ou, mais amplamente, heteroafetividade; quando ocorre entre
pessoas de mesmo sexo, � denominada homossexualidade ou homoafetividade.
Ainda hoje, em diversas situa��es, as diferen�as inerentes entre homens e mulheres
t�m sido utilizadas em detrimento do sexo feminino, levando a diversos tipos de
preconceito de g�nero. Por exemplo, o fato de homens serem, em m�dia, fisicamente
mais fortes que as mulheres tem levado � constru��o do estere�tipo da mulher como o
"sexo fr�gil", o que � estendido a muitas esferas da vida social. Em algumas
sociedades, essas diferen�as s�o ainda mais marcantes; nelas, as mulheres n�o podem
votar, mostrar o rosto e dirigir autom�veis, entre tantos outros aspectos
discriminat�rios. Pesquisas mostram que praticamente no mundo todo ainda h�
discrimina��o de g�nero na �rea do trabalho. � comum que as mulheres recebam
sal�rios menores que os dos homens, mesmo ocupando cargos semelhantes aos deles.
A tend�ncia � que as diferen�as entre homens e mulheres sejam vistas n�o como
superiores ou inferiores, mas como complementares. � importante que as eventuais
diferen�as possam se somar no exerc�cio da cidadania. Independentemente do sexo
biol�gico, do g�nero e da orienta��o sexual, cada pessoa faz parte da sociedade e a
participa��o de todos � fundamental para a constru��o de uma realidade mais justa,
equilibrada e sem preconceitos.

ILUSTRA��ES: CAN�ADO
Representa��o esquem�tica da intera��o entre genes que determinam o sexo masculino
em seres humanos. A sequ�ncia de a��o dos genes est� numerada, iniciando-se com a
s�ntese da prote�na SRY na g�nada indiferenciada do embri�o (1). O produto do gene
SRY ativa genes que determinam a diferencia��o da g�nada em test�culo (2). O
produto desses genes, por sua vez, ativa os genes respons�veis pela s�ntese do
horm�nio testosterona (3). Esse horm�nio � liberado na corrente sangu�nea, pela
qual atinge as c�lulas corporais (c�lulas som�ticas) alvos da testosterona (4). No
citoplasma dessas c�lulas, o horm�nio se une � prote�na receptora AR, codificada
por um gene localizado no cromossomo X (5). O complexo testosterona-prote�na AR
penetra no n�cleo das c�lulas-alvo e ativa genes respons�veis pelas caracter�sticas
sexuais secund�rias masculinas (6). (Elementos fora de propor��o de tamanho entre
si; cores-fantasia.) (Elaborada com base em Griffiths e cols., 2005.)

P�gina 210

11.4 Gravidez e parto


Fecunda��o e nida��o
A fecunda��o ocorre no ter�o inicial da tuba uterina e, em geral, nas primeiras 24
horas ap�s a ovula��o. Ao se deslocar pelo oviduto em dire��o ao �tero, o zigoto
passa pelas primeiras clivagens, originando a m�rula, que chega ao �tero cerca de 3
dias ap�s a fecunda��o.
O embri�o continua a se desenvolver e, por volta do 7� dia ap�s a fecunda��o,
encontra-se no est�gio de bl�stula, que nos mam�feros � denominada blastocisto.
Este se implanta na mucosa uterina, fen�meno que recebe o nome de nida��o. Com
isso, inicia-se a gravidez ou gesta��o, que se encerra com o parto, cerca de nove
meses mais tarde.
Na fase de blastocisto, o embri�o � uma esfera de blast�meros, com um pequeno
aglomerado celular em um dos polos e uma cavidade cheia de l�quido. As c�lulas que
formam a parede do blastocisto constituem o trofoblasto; a cavidade interna � a
blastocela e o aglomerado de c�lulas constitui o embrioblasto.
As c�lulas do trofoblasto aderem � parede uterina e secretam enzimas que digerem
por��es do endom�trio, no qual o embri�o se infiltra e cresce. O trofoblasto se
ramifica e ocupa as cavidades abertas e, como rea��o � infiltra��o do trofoblasto,
a parede uterina sofre altera��es celulares e vasculares, com grande
desenvolvimento de vasos sangu�neos na regi�o, originando uma estrutura altamente
vascularizada. (Fig. 11.6)

ILUSTRA��O: ADILSON SECCO


Figura 11.6 Representa��o esquem�tica de parte do sistema genital feminino,
mostrando a sequ�ncia de desenvolvimento desde a ovula��o at� a nida��o do embri�o.
(Elementos fora de propor��o de tamanho entre si; cores-fantasia.)
As enzimas secretadas pelo trofoblasto digerem as paredes dos vasos sangu�neos,
formando ao seu redor lacunas de sangue, pelas quais passa a circular sangue
materno. As proje��es do trofoblasto que se ramificam dentro da parede uterina s�o
as vilosidades cori�nicas.
As vilosidades cori�nicas do embri�o rec�m-implantado na parede uterina secretam um
horm�nio denominado gonadotrofina cori�nica. Esse horm�nio sinaliza a presen�a do
embri�o e estimula a atividade do corpo-amarelo, mantendo as taxas de estr�geno e
de progesterona elevadas no sangue da mulher. Consequentemente, a menstrua��o n�o
ocorre, o que constitui um dos primeiros sinais de gravidez.
No in�cio da gesta��o, a concentra��o de gonadotrofina cori�nica � t�o elevada no
sangue da mulher que seu excesso � eliminado na urina. Diversos testes de gravidez
dispon�veis em farm�cias detectam a presen�a de gonadotrofina cori�nica na urina da
mulher, o que indica a gravidez.
A partir do quarto m�s de gesta��o, o corpo-amarelo come�a a regredir. A mucosa
uterina, mantida at� ent�o pelos horm�nios do corpo-amarelo, continua a se
desenvolver gra�as � produ��o de estr�geno e progesterona pela placenta.

P�gina 211

A placenta
A placenta � um �rg�o formado pelo desenvolvimento conjunto da parede uterina e das
vilosidades cori�nicas do embri�o. � por meio da placenta que ocorrem trocas de
subst�ncias entre m�e e filho durante a gravidez. Alimento e g�s oxig�nio passam do
sangue da m�e para o do filho, enquanto excre��es e g�s carb�nico fazem o caminho
inverso. O sangue da m�e e o do embri�o n�o se misturam na placenta. As trocas
ocorrem atrav�s das paredes dos vasos sangu�neos que separam as circula��es
embrion�ria e materna.
A placenta comunica-se com o embri�o pelo cord�o umbilical, uma estrutura tubular
originada a partir do mesoderma e do ectoderma extraembrion�rios. O cord�o
umbilical tem em seu interior duas art�rias e uma veia, por meio das quais o sangue
do embri�o vai e volta da placenta. (Fig. 11.7)

Figura 11.7 Representa��o esquem�tica da circula��o sangu�nea na placenta, um �rg�o


compartilhado entre m�e e embri�o. As setas indicam o sentido da circula��o do
sangue. (Elementos fora de propor��o de tamanho entre si; cores-fantasia.)
(Elaborada com base em Campbell, N. e cols., 1999.)
Fase fetal
Cerca de cinco semanas ap�s a fecunda��o, os bra�os e as pernas do embri�o humano
tornam-se bem definidos e come�am a apresentar contra��es musculares. Na nona
semana de vida (final do segundo m�s), o embri�o tem cerca de 2,5 cm de comprimento
e apar�ncia tipicamente humana. Nessa �poca tamb�m se inicia a forma��o dos ossos,
e o embri�o passa a ser chamado feto. (Fig. 11.8)

ILUSTRA��ES: JURANDIR RIBEIRO


Figura 11.8 A. Representa��o esquem�tica de corte de um embri�o humano com cerca de
27 dias e seus anexos embrion�rios. B. Representa��o esquem�tica de corte de um
embri�o de 45 dias, com a placenta e o cord�o umbilical formados. C. Representa��o
esquem�tica em que se compara o tamanho relativo de embri�es humanos de diferentes
idades. (Elementos fora de propor��o de tamanho entre si; cores-fantasia.)

P�gina 212

Aos cinco meses, o feto humano tem cerca de 20 cm de comprimento e pesa


aproximadamente meio quilograma. Aos sete meses, ele j� apresenta boas chances de
sobreviv�ncia, se porventura ocorrer seu nascimento prematuro. (Fig. 11.9 e Tab.
11.2)

RALPH HUTCHINGS/VISUALS UNLIMITED, INC./GLOW IMAGES


Figura 11.9 Feto humano com 16 semanas de gesta��o, com cerca de 11 cm de
comprimento. Ele j� pode ouvir e se movimentar em resposta a alguns sons.
Tabela 11.2 Ocorr�ncias marcantes no desenvolvimento embrion�rio humanoIdade do
embri�oEvento24 horas Primeira divis�o do zigoto, com forma��o de duas c�lulas. 3
dias Chegada do embri�o � cavidade uterina. 7 dias Implanta��o do embri�o no �tero.
2,5 semanasOrganog�nese em curso. In�cio da forma��o da notocorda e do m�sculo
card�aco; forma��o das primeiras c�lulas sangu�neas, do saco vitel�nico e do c�rio.
3,5 semanasForma��o do tubo nervoso. Prim�rdios de olhos e orelhas j� s�o vis�veis;
diferencia��o do tubo digestivo, com forma��o das fendas na faringe e in�cio do
desenvolvimento do f�gado e do sistema respirat�rio; o cora��o come�a a bater.4
semanasAparecimento de brotos dos bra�os e das pernas; forma��o das tr�s partes
b�sicas do enc�falo.2 mesesIn�cio dos movimentos. J� � poss�vel identificar a
presen�a de test�culos ou ov�rios; tem in�cio a ossifica��o; os principais vasos
sangu�neos assumem sua posi��o definitiva. 3 mesesO sexo j� pode ser identificado
externamente; a notocorda degenera. 4 mesesA face do embri�o assume apar�ncia
humana. 3� trimestreOs neur�nios tornam-se mielinizados; ocorre grande crescimento
do corpo. 266� diaNascimento.

P�gina 213

Parto
O parto natural consiste na expuls�o do feto por contra��es r�tmicas da musculatura
uterina; em geral, isso ocorre ao fim do nono m�s de gravidez, aproximadamente 266
dias ap�s a fecunda��o. Nessa �poca, o feto humano mede aproximadamente 50 cm de
comprimento e pesa, em m�dia, entre 3 e 3,5 kg.
No momento do parto, o colo do �tero se dilata e a musculatura uterina se contrai
ritmicamente induzida pelo horm�nio oxitocina, liberado pela por��o posterior da
hip�fise (neuroip�fise). A bolsa amni�tica se rompe e o l�quido nela contido
extravasa pela vagina. O feto � gradualmente empurrado para fora do �tero por
contra��es vigorosas da musculatura uterina. A vagina se dilata e permite a sa�da
do beb�.
A placenta desprende-se da parede uterina e � expulsa pela vagina juntamente com
sangue proveniente dos vasos sangu�neos maternos rompidos. Nesse momento, no parto
assistido, o cord�o umbilical que liga o feto � placenta � cortado e amarrado.
(Fig. 11.10)

ILUSTRA��ES: JURANDIR RIBEIRO


Figura 11.10 A. Representa��o esquem�tica de etapas do parto natural. B. Expuls�o
da placenta ap�s o parto natural. (Elementos fora de propor��o de tamanho entre si;
cores-fantasia.)
Com o desprendimento da placenta, g�s carb�nico come�a a se acumular no sangue do
rec�m-nascido, estimulando os centros cerebrais respirat�rios e desencadeando o
funcionamento dos pulm�es.
O parto natural pode ser desaconselhado pelos m�dicos em certos casos, como a falta
de contra��es uterinas ou o fato de o beb� ser muito grande para passar pela pelve
da m�e. Nesses casos, recorre#se a uma interven��o cir�rgica conhecida como
cesariana, na qual � feita uma incis�o na parte baixa do abdome da gestante, de
modo a expor o �tero; este � cortado e a crian�a � retirada, juntamente com o
cord�o umbilical e a placenta.

P�gina 214

Amplie seus conhecimentos


Compartilhando o �tero materno: g�meos humanos
Quando nascem duas ou mais crian�as em uma gesta��o, fala-se em g�meos. Eles podem
ser t�o diferentes quanto dois irm�os quaisquer (g�meos dizig�ticos ou fraternos)
ou ser do mesmo sexo e extremamente parecidos fisicamente (monozig�ticos).

ESTUDI M6/SHUTTERSTOCK
JESSICA HOLDEN PHOTOGRAPHY/ GETTY IMAGES
A. G�meas monozig�ticas, portanto, originadas do mesmo zigoto; apesar de
apresentarem genes id�nticos em suas c�lulas, essas g�meas podem exibir diferen�as
em raz�o da intera��o entre os genes e os fatores ambientais ao longo do
desenvolvimento. B. G�meos dizig�ticos, formados de dois zigotos distintos e,
portanto, de diferentes pares de gametas.
A gravidez de g�meos � um evento de relativa raridade na popula��o em geral, menos
de 1% dos nascimentos. Apesar dessa baixa porcentagem, estudos realizados em
Campinas, S�o Paulo, mostraram que, entre os g�meos, o n�mero de complica��es e
morte ap�s o nascimento praticamente dobra em rela��o aos nascimentos de parto
�nico. Estudos realizados na Finl�ndia mostraram que a fecunda��o in vitro (FIV)
eleva significativamente a chance de gesta��es m�ltiplas (g�meos e trig�meos); ela
foi da ordem de 36% no grupo FIV e 2,2% no grupo utilizado como controle.
G�meos dizig�ticos (ou g�meos fraternos)
Normalmente a mulher libera apenas um ov�cito ("�vulo") a cada ciclo menstrual.
Eventualmente, por�m, pode liberar dois ov�citos (ou mais) e, se ambos forem
fecundados, formam-se dois zigotos; se ambos se desenvolverem, nascer�o duas
crian�as na mesma gravidez, portanto g�meas. Nesse caso, as crian�as podem ser t�o
diferentes quanto quaisquer irm�os, podendo ter sexos diferentes. G�meos desse tipo
s�o, na verdade, irm�os de mesma idade que compartilharam o �tero materno, sendo,
por isso, chamados g�meos dizig�ticos ou g�meos fraternos. O termo dizig�tico
enfatiza a origem dos g�meos, formados a partir de dois zigotos diferentes.

P�gina 215

G�meos dizig�ticos podem se implantar no �tero em locais distantes um do outro,


originando cada um sua pr�pria placenta. Em certos casos, por�m, a implanta��o dos
dois blastocistos ocorre em �reas uterinas pr�ximas e eles parecem apresentar
apenas uma placenta. O exame microsc�pico revela, por�m, que a placenta tem dois
c�rios distintos, entre os quais h� trofoblasto e vilosidades cori�nicas
atrofiadas, resultado do desenvolvimento de uma placenta junto da outra. Cada
embri�o desenvolve seu pr�prio �mnio e seu pr�prio cord�o umbilical.
G�meos monozig�ticos
Na esp�cie humana, um �nico zigoto pode eventualmente originar dois ou mais
indiv�duos, id�nticos do ponto de vista gen�tico; consequentemente, t�m o mesmo
sexo e costumam ser muito parecidos fisicamente. Esses s�o os g�meos monozig�ticos,
bem menos frequentes que os dizig�ticos: de cada quatro pares de g�meos nascidos,
apenas um � monozig�tico.
Em aproximadamente 30% dos casos, os g�meos monozig�ticos formam se at� o terceiro
dia ap�s a fecunda��o, quando o embri�o ainda se encontra no est�gio de m�rula.
Nesses casos, a m�rula divide se em dois grupos de blast�meros, que prosseguem o
desenvolvimento independentemente um do outro, originando dois blastocistos com o
mesmo patrim�nio gen�tico, uma vez que s�o provenientes do mesmo zigoto. Cada um
desses embri�es desenvolve sua pr�pria placenta, �mnio e cord�o umbilical; se as
implanta��es forem muito pr�ximas, pode ocorrer uma aparente fus�o das placentas,
como foi mencionado no caso de g�meos dizig�ticos.
Em 70% dos casos, a forma��o dos g�meos monozig�ticos ocorre entre o quarto e o
d�cimo quarto dias de vida embrion�ria. Nesses casos, a divis�o do embrioblasto
ocorre de tal maneira que os g�meos, apesar de desenvolverem �mnios e cord�es
umbilicais pr�prios, compartilham um �nico c�rio e uma �nica placenta.
Mais raramente, os g�meos monozig�ticos surgem quando o disco embrion�rio j� est�
presente, ou seja, quando o hipoblasto e o epiblasto j� se formaram. A divis�o do
disco embrion�rio origina dois embri�es, cada um com seu cord�o umbilical, mas que
compartilham a mesma bolsa amni�tica, o mesmo c�rio e a mesma placenta.
ILUSTRA��ES: ADILSON SECCO
Representa��o esquem�tica da forma��o de g�meos dizig�ticos. A. Os g�meos
implantam-se em regi�es afastadas no �tero, desenvolvendo c�rio, placenta, �mnio e
cord�o umbilical separados. B. Os g�meos implantam-se muito pr�ximos um do outro no
�tero e suas placentas aparentemente se fundem; entretanto, a an�lise microsc�pica
revela que elas est�o separadas. (Elementos fora de propor��o de tamanho entre si;
cores-fantasia.)

P�gina 216

ILUSTRA��ES: ADILSON SECCO


Representa��o esquem�tica das diferentes maneiras de forma��o de g�meos
monozig�ticos. A. G�meos formados precocemente pela divis�o da m�rula em dois
blastocistos distintos; eles podem se implantar em regi�es distantes do �tero ou
compartilhar a mesma regi�o uterina da placenta. B. G�meos formados pela divis�o do
embrioblasto t�m �mnio e cord�o umbilical separados, compartilhando o c�rio e a
placenta. C. G�meos formados tardiamente a partir da divis�o do embrioblasto
compartilham o c�rio, o �mnio e a placenta; apenas seus cord�es umbilicais s�o
separados. (Elementos fora de propor��o de tamanho entre si; cores-fantasia.)
G�meos unidos
Em raros casos, g�meos monozig�ticos podem nascer ligados por uma parte do corpo.
Uma denomina��o para esse tipo de g�meo - terat�pago - carrega uma conota��o
negativa. O termo vem do grego teras, monstro, e pagos, unido; preferimos utilizar
o termo "g�meos unidos". Os mais famosos g�meos unidos foram os irm�os Chang e Eng,
nascidos em 1811 no ent�o Si�o (hoje Tail�ndia), que eram ligados pela regi�o
tor�cica. Eles ficaram conhecidos como "irm�os siameses" e ganharam a vida exibindo
se para plateias nos Estados Unidos, onde moraram e se casaram com duas irm�s. Ao
morrerem, em 1874, a aut�psia revelou haver liga��o entre seus f�gados.
H� diversos graus de compartilhamento de tecidos e �rg�os entre os g�meos unidos.
Em alguns casos, a separa��o cir�rgica � poss�vel, permitindo a sobreviv�ncia dos
dois g� meos. Em outros casos, a cirurgia leva necessariamente ao sacrif�cio de um
deles; em outros, ainda, a separa��o � imposs�vel, pois levaria ambos � morte. Essa
quest�o tem sido motivo de grande debate entre m�dicos e religiosos em virtude das
quest�es �ticas e morais envolvidas.

P�gina 217

Ci�ncia e cidadania
O controle da reprodu��o humana
1 A sexualidade e a reprodu��o da esp�cie humana s�o temas apaixonantes e
pol�micos. A partir da adolesc�ncia, a taxa dos horm�nios sexuais aumenta no sangue
das pessoas, fazendo com que corpo e mente se modifiquem e a sexualidade passe a
desempenhar um papel muito importante na vida.
2 O conhecimento cient�fico sobre a reprodu��o humana vem garantindo �s pessoas a
possibilidade de controlar conscientemente sua reprodu��o. Al�m do m�todo natural
de controle, baseado apenas no conhecimento do ciclo reprodutivo, h� tamb�m v�rios
m�todos anticoncepcionais eficazes, como a p�lula, a camisinha, o diafragma, o DIU
(dispositivo intrauterino), entre outros. Em uma sociedade democr�tica, espera-se
que a utiliza��o ou n�o de m�todos anticoncepcionais seja uma livre escolha de cada
um, de acordo com seus valores e cren�as.
3 Conhecer os fundamentos da reprodu��o humana � importante para o exerc�cio da
cidadania, n�o apenas por permitir � pessoa maior controle sobre a pr�pria
reprodu��o, mas tamb�m por possibilitar reflex�es mais aprofundadas sobre o
crescimento populacional humano, em um mundo j� t�o intensamente povoa do e com
tantas quest�es por resolver.
M�todos contraceptivos
4 Contracep��o � a preven��o deliberada da gravidez. A maneira mais �bvia e mais
segura de prevenir a gravidez � a abstin�ncia de rela��es sexuais, pelo menos
durante o per�odo f�rtil da mulher, em que existe a possibilidade de haver
ovula��o.
5 Ao longo da hist�ria, a humanidade tem desenvolvido diversos m�todos para evitar
a gravidez, genericamente denominados m�todos contraceptivos ou m�todos
anticoncepcionais.
6 Os m�todos contraceptivos podem atuar em diferentes etapas do processo
reprodutivo. Alguns impedem que os gametas masculinos e femininos se encontrem;
outros impedem que a mulher produza gametas; outros, ainda, impedem a implanta��o
do embri�o rec�m-formado na mucosa uterina.
Coito interrompido
7 Um m�todo para evitar a gravidez � o coito interrompido, que consiste em retirar
o p�nis da vagina antes que a ejacula��o ocorra. Esse m�todo � pouco eficiente,
pois as secre��es masculinas eliminadas antes da ejacula��o podem conter
espermatozoides.
Outro motivo para o grande �ndice de falhas do m�todo � a demora na retirada do
p�nis, que pode resultar na ejacula��o parcial ou total ainda dentro da vagina.
M�todo do ritmo ovulat�rio ou da tabelinha
8 Pode-se evitar a gravidez abstendo-se de rela��es sexuais apenas durante o
per�odo f�rtil do ciclo menstrual. Esse m�todo, conhecido como m�todo do ritmo
ovulat�rio ou da tabelinha, baseia-se no fato de que o gameta feminino estar�
presente nos ovidutos, em condi��o de ser fecundado, apenas durante um curto
per�odo do ciclo menstrual, chamado per�odo f�rtil. A mulher normalmente produz, a
cada 28 dias, um �nico �vulo que sobrevive durante, no m�ximo, dois dias nos
ovidutos, at� degenerar e ser eliminado.
9 O principal problema � justamente determinar qual � o per�odo f�rtil da pessoa. O
dia em que ocorre a ovula��o pode variar, dependendo da dura��o do ciclo e de
outros fatores.
10 Pode-se estimar o dia prov�vel da ovula��o, com algum grau de acerto, a partir
da an�lise do gr�fico de temperatura corporal. Na maioria das mulheres, a
temperatura do corpo eleva-se cerca de 0,5 �C logo ap�s a ovula��o. O
acompanhamento criterioso da temperatura corporal di�ria pode fornecer evid�ncias
de que a ovula��o ocorreu. As estat�sticas mostram que mulheres que determinam a
�poca da ovula��o por meio da tabela, com o aux�lio da constru��o de gr�ficos de
temperatura di�ria, t�m porcentagem de aceit�vel sucesso em evitar uma gravidez
indesejada, desde que sigam rigorosamente os princ�pios do m�todo.
Camisinha
11 Entre as pr�ticas anticoncepcionais mais difundidas, destaca-se o uso de
barreiras mec�nicas, que evitam o encontro dos gametas masculinos com o gameta
feminino. O preservativo, popularmente chamado de camisinha, � um protetor de l�tex
ou de outros materiais utilizado para reter o esperma ejaculado, evitando que ele
seja depositado na vagina. Tanto o preservativo masculino, que envolve o p�nis,
como o preservativo feminino, que a mulher introduz na vagina antes da rela��o
sexual, t�m a mesma finalidade. Al�m de atuar como anticoncepcional, a camisinha �
tamb�m eficiente na preven��o da aids e de outras doen�as sexualmente
transmiss�veis (DSTs).

P�gina 218

Diafragma
12 O diafragma � um dispositivo de borracha que deve ser colocado no fundo da
vagina de modo a fechar o colo do �tero e impedir a entrada de espermatozoides. �
comum aplicar no diafragma uma geleia contendo subst�ncias espermicidas, que matam
os espermatozoides e aumentam o �ndice de seguran�a do m�todo.

Representa��o esquem�tica da coloca��o correta do diafragma na vagina de modo a


cobrir totalmente o colo uterino. (Elementos fora de propor��o de tamanho entre si;
cores-fantasia.)
P�lula anticoncepcional
13 A p�lula anticoncepcional, um dos m�todos contraceptivos mais utilizados no
mundo, consiste geralmente em uma mistura de horm�nios sint�ticos (progesterona e
estr�geno) que, dependendo da p�lula, a mulher deve ingerir todos os dias, a partir
do 5� dia ap�s a menstrua��o. Depois de 21 dias, suspende-se a p�lula por uma
semana e come�a-se um novo lote de 21 p�lulas. A menstrua��o costuma ocorrer cerca
de tr�s dias ap�s a suspens�o da ingest�o das p�lulas.
14 Os dois horm�nios presentes na p�lula anticoncepcional inibem a secre��o de FSH
e de LH pela adenoip�fise. Na falta desses dois horm�nios, n�o ocorre ovula��o. A
manuten��o de n�veis altos de estr�geno e de progesterona no sangue induz o
crescimento da mucosa uterina, a qual se descama quando o n�vel desses horm�nios se
reduz, no per�odo de uma semana em que a p�lula deixa de ser ingerida.
15 A chamada p�lula do dia seguinte, tamb�m conhecida como m�todo contraceptivo de
emerg�ncia, � um composto hormonal utilizado para prevenir uma gravidez indesejada
dentro de 72 horas ap�s uma rela��o desprotegida ou acidental.
16 Os horm�nios constituintes dessa p�lula atuam basicamente de duas formas:
impedem a ovula��o (se ainda n�o ocorreu) e n�o permitem que o embri�o se implante
na parede uterina, entre cinco e seis dias depois da fertiliza��o.
17 Pesquisas cient�ficas t�m procurado avaliar se a ingest�o continuada de
horm�nios pode ser responsabilizada por problemas � sa�de, tais como altera��es na
coagula��o sangu�nea, arteriosclerose e infartos. Um estudo verificou que mulheres
fumantes e usu�rias de p�lulas anticoncepcionais apresentavam risco 10 vezes maior
de morte por problemas cardiorrespirat�rios. � importante que os contraceptivos
orais sejam utilizados sob rigoroso acompanhamento m�dico, a fim de evitar efeitos
colaterais prejudiciais decorrentes da ingest�o de horm�nios. Particularmente, a
utiliza��o da p�lula do dia seguinte exige cuidados especiais.
Dispositivo intrauterino: DIU
18 DIU � a sigla de dispositivo intrauterino, nome pelo qual s�o conhecidos os
dispositivos de pl�stico ou metal introduzidos no �tero com o objetivo de evitar a
concep��o. O DIU deve ser implantado por um m�dico especialista e, a menos que
cause problemas colaterais evidentes, pode permanecer no �tero at� que a mulher
deseje engravidar.
19 O modo de a��o do DIU ainda n�o � totalmente compreendido. Acredita-se que sua
presen�a no �tero cause uma pequena inflama��o, atraindo macr�fagos que destroem os
embri�es que tentam se implantar na mucosa uterina. Por isso, alguns consideram a
utiliza��o do DIU um m�todo abortivo, uma vez que, indiretamente, causa a morte do
embri�o, por impedir que ele se fixe no �tero.

ILUSTRA��ES: JURANDIR RIBEIRO


Representa��o esquem�tica do DIU na cavidade uterina (mostrado por transpar�ncia).
(Elementos fora de propor��o de tamanho entre si; cores-fantasia.)

P�gina 219

Vasectomia
20 Esteriliza��o � qualquer processo que impede definitivamente a concep��o. No
caso do homem, o processo utilizado na esteriliza��o � a vasectomia, que consiste
no secionamento dos ductos deferentes de modo que os espermatozoides n�o possam
chegar � uretra.
21 Como n�o afeta a produ��o de testosterona pelos test�culos, a vasectomia n�o tem
nenhum efeito negativo sobre a atividade sexual do homem. O homem vasectomizado
atinge o orgasmo e ejacula normalmente, com a diferen�a de que seu esperma n�o
cont�m espermatozoides, sendo constitu�do apenas pelas secre��es das gl�ndulas
sexuais acess�rias.

ILUSTRA��ES: JURANDIR RIBEIRO


Representa��o esquem�tica da vasectomia, cirurgia em que os ductos deferentes s�o
seccionados. Embora a cirurgia possa ser revertida, nem sempre h� sucesso em
recuperar a fertilidade. Entretanto, homens vasectomizados que querem ter filhos
podem coletar espermatozoides diretamente do test�culo e utiliz�-los na fecunda��o
in vitro. (Elementos fora de propor��o de tamanho entre si; cores-fantasia.)
Laqueadura tub�ria
22 A esteriliza��o feminina � denominada laqueadura tub�ria e consiste no
seccionamento das tubas uterinas. Assim, os espermatozoides s�o impedidos de chegar
at� os gametas femininos.

Representa��o esquem�tica da laqueadura tub�ria, uma cirurgia abdominal em que se


seccionam as tubas uterinas. Em geral, essa cirurgia � feita em mulheres que j�
tiveram filhos. (Elementos fora de propor��o de tamanho entre si; cores-fantasia.)
Guia de leitura
Responda em seu caderno
1 Leia os tr�s par�grafos iniciais do quadro, que argumentam a favor da import�ncia
dos conhecimentos sobre reprodu��o humana para o exerc�cio pleno da cidadania.
Escreva um texto concordando com as ideias desses tr�s par�grafos ou discordando
delas.
2 Leia o quarto, o quinto e o sexto par�grafos, no item M�todos contraceptivos.
Responda: a) O que � contracep��o? b) Em que etapas da reprodu��o podem atuar os
m�todos contraceptivos?
3 O s�timo par�grafo refere#se ao coito interrompido. Qual � o princ�pio desse
m�todo? Em que ele pode falhar?
4 Leia os par�grafos 8, 9 e 10, que apresentam o m�todo do ritmo ovulat�rio,
conhecido popularmente por tabelinha. a) Qual � o princ�pio desse m�todo? b) Em que
ele pode falhar? c) O que pode ser feito para melhorar sua efic�cia?
5 Leia o 11� par�grafo, que se refere aos preservativos de l�tex, feminino e
masculino. A camisinha � certamente o mais popular de todos os m�todos
anticoncepcionais.a) Qual � o princ�pio desse m�todo? b) Qual � o outro aspecto
importante da utiliza��o da camisinha al�m do anticoncepcional?
6 No 12� par�grafo � apresentado o diafragma. Acompanhe a leitura do texto com a
observa��o do esquema da coloca��o correta do diafragma na vagina. a) Qual � o
princ�pio desse m�todo? b) O que pode ser feito para melhorar sua efic�cia?
7 Os par�grafos de 13 a 17 referem se � p�lula anticoncepcional. a) Qual � o
princ�pio desse m�todo? b) Quais s�o os poss�veis efeitos colaterais decorrentes do
uso continuado dos horm�nios contraceptivos? c) O que � a chamada p�lula do dia
seguinte?
8 Nos par�grafos 18 e 19 � apresentado o DIU (dispositivo intrauterino). Acompanhe
a leitura do texto com a observa��o do esquema do DIU na cavidade uterina. a) Qual
� o princ�pio desse m�todo? b) Por que alguns criticam a utiliza��o desse m�todo
contraceptivo?
9 Leia o 20� e o 21� par�grafos, referentes � vasectomia. Acompanhe o texto com a
observa��o do esquema e a leitura atenta da legenda. a) Qual � o princ�pio desse
m�todo? b) A legenda acrescentou alguma informa��o sobre a vasectomia? Se sim,
qual?
10 Leia o 22� e �ltimo par�grafo, sobre a laqueadura tub�ria. Acompanhe com a
observa��o do esquema e a leitura atenta da legenda. a) Qual � o princ�pio desse
m�todo? b) A legenda acrescentou alguma informa��o sobre a laqueadura? Se sim,
qual?

P�gina 220

ATIVIDADES
Revendo conceitos, fatos e processos
Registre em seu caderno
1. O conjunto de transforma��es c�clicas do organismo feminino, em sua prepara��o
para uma poss�vel gravidez, constitui
a) a menstrua��o.
b) a ovula��o.
c) o ciclo de vida.
d) o ciclo menstrual.
2. A menstrua��o consiste:
a) na ruptura do fol�culo ovariano.
b) no desenvolvimento do corpo-amarelo.
c) no desprendimento e elimina��o de parte do endom�trio.
d) no per�odo f�rtil da mulher.
Escreva, em seu caderno, o termo abaixo que substitui corretamente a tarja entre
par�nteses das frases de 3 a 6.
a) endom�trio
b) fol�culo ovariano
c) ov�cito I
d) ov�cito II
e) primeiro gl�bulo polar
3. A ovulog�nese ocorre no interior do (.....).
4. O (.....) inicia a primeira divis�o da meiose e origina duas c�lulas de tamanho
desigual.
5. O revestimento interno do �tero, denominado (.....), apresenta grande
desenvolvimento durante o ciclo menstrual, preparando se para receber um eventual
embri�o.
6. Os produtos da divis�o I da meiose de um ov�cito s�o uma c�lula grande, o
(.....), e uma c�lula muito pequena, o (.....).
7. "Ao ser eliminado do fol�culo ovariano, o �vulo encontra se estacionado na (1)
da meiose e somente prossegue a divis�o se ocorrer (2)." Qual � a alternativa que
substitui corretamente os n�meros 1 e 2 entre par�nteses?
a) 1 = pr�fase I; 2 = ovula��o.
b) 1 = met�fase II; 2 = ovula��o.
c) 1 = pr�fase I; 2 =fecunda��o.
d) 1 = met�fase II; 2 = fecunda��o.
Escreva, em seu caderno, o termo abaixo que substitui corretamente a tarja entre
par�nteses das frases de 8 a 10.
a) epid�dimo
b) gl�ndula seminal
c) pr�stata
d) t�bulo semin�fero
e) uretra
8. O processo de espermatog�nese ocorre no(a) (.....).
9. O canal comum ao sistema urin�rio e ao sistema genital do homem, pelo qual o
s�men � eliminado na ejacula��o, � o(a) (.....).
10. Antes de passarem para os ductos deferentes, os espermatozoides permanecem
no(a) (.....), no(a) qual terminam de amadurecer.
Escreva, em seu caderno, o termo abaixo que substitui corretamente a tarja entre
par�nteses das frases de 11 a 13.
a) estr�geno
b) FSH (horm�nio estimulante do fol�culo)
c) LH (horm�nio luteinizante)
d) progesterona
e) testosterona
11. A forma��o do corpo-amarelo tem como consequ�ncia a eleva��o significativa da
taxa de (.....) no sangue, o que inibe a produ��o das gonadotrofinas hipofis�rias.
12. A ovula��o e a forma��o do corpo-amarelo s�o induzidas pelo horm�nio (.....).
13. O impulso sexual e o desenvolvimento das caracter�sticas sexuais secund�rias
s�o promovidos, na mulher, pelo(a) (.....) e, no homem, pelo(a) (.....).
14. O sangue do feto n�o se mistura com o sangue materno, mas eles circulam muito
pr�ximos nas lacunas de um �rg�o em que ocorrem trocas de subst�ncias entre m�e e
filho. Qual � esse �rg�o?
a) Bolsa amni�tica.
b) Placenta.
c) Ov�rio.
d) �tero.
15. Assim que se fixa no �tero, o embri�o desenvolve vilosidades cori�nicas, que
penetram no endom�trio e passam a secretar um horm�nio que impede a menstrua��o.
Qual � o horm�nio liberado?
a) Estr�geno.
b) Horm�nio estimulante do fol�culo.
c) Gonadotrofina cori�nica.
d) Progesterona.
16. Qual � a fun��o da p�lula anticoncepcional composta por horm�nios sint�ticos?
a) Impedir a forma��o do endom�trio.
b) Induzir a menstrua��o.
c) Reduzir o impulso sexual.
d) Suprimir a ovula��o.
17. Entre os m�todos anticoncepcionais a seguir, qual tamb�m previne doen�as
sexualmente transmiss�veis (aids, s�filis, gonorreia etc.)?
a) Camisinha.
b) Diafragma.
c) DIU (dispositivo intrauterino).
d) P�lula anticoncepcional.

P�gina 221

Quest�es para exercitar o pensamento


Registre em seu caderno
18. A sexualidade humana � um assunto pol�mico, que envolve tabus e regras de
conduta diversas. Lembre-se de que, na �rea do comportamento sexual, h� grande
diversidade de pr�ticas e de opini�es. Nossa sugest�o � que voc� organize com seus
colegas um grupo de pesquisa para verificar a opini�o das pessoas sobre a seguinte
quest�o: o sexo deve sempre ter finalidade reprodutiva? Entreviste diversas
pessoas, de diferentes idades e graus de instru��o. Anote ou grave suas
entrevistas. Discuta o assunto com seus pais, colegas e professores.
19. Observe o esquema e responda aos itens a seguir.

ILUSTRA��O: JURANDIR RIBEIRO


(Elementos fora de propor��o de tamanho entre si; cores-fantasia.)
a) Tendo por base as informa��es do esquema, identifique os horm�nios denominados
H1, H2, A e B.
b) Que efeitos produz o horm�nio H1?
c) Que efeitos produz o horm�nio H2?
d) Al�m de inibir a produ��o de H1, que outros efeitos o horm�nio A tem sobre o
organismo feminino?
e) Qual � o efeito do aumento da taxa do chamado horm�nio B sobre a produ��o
hormonal da adenoip�fise?
f) Qual � o dia aproximado do ciclo menstrual em que est� mais elevada a
concentra��o do horm�nio H2 no sangue?
A Biologia no vestibular e no Enem
Registre em seu caderno
Quest�es objetivas
1. (Ufam) Na ovula��o, o primeiro caminho natural do �vulo, ap�s ser liberado pelo
ov�rio para ser fecundado, �
a) o colo uterino.
b) a vagina.
c) a tuba uterina.
d) o fol�culo ovariano.
e) a uretra.
2. (UFRGS-RS) Durante o processo de forma��o do embri�o dos mam�feros, formam-se
tamb�m v�rios anexos que, embora n�o fazendo parte do corpo do embri�o, s�o
importantes para o desenvolvimento dele. O anexo respons�vel pelas trocas gasosas e
metab�licas na rela��o fetomaternal �
a) a bolsa amni�tica.
b) a placenta.
c) o c�rio.
d) a ves�cula vitel�nica.
e) o cord�o umbilical.
3. (UEL-PR) O esquema a seguir representa etapas do processo de gametog�nese no
homem.

ILUSTRA��O: LUIZ RUBIO


(Esquema simplificado.)
Sobre esse processo, a alternativa correta �:
a) A c�lula A � diploide, e as c�lulas B, C e D s�o haploides.
b) A separa��o dos hom�logos ocorre durante a etapa 2.
c) As c�lulas A e B s�o diploides, e as c�lulas C e D s�o haploides.
d) A redu��o no n�mero de cromossomos ocorre durante a etapa 3.
e) A separa��o das crom�tides irm�s ocorre durante a etapa 1.
4. (Unir-RO) Comparando-se a ovulog�nese (I) com a espermatog�nese (II), todas as
alternativas abaixo est�o corretas, exceto:
a) Nos dois processos ocorre meiose.
b) Ambos s�o importantes para manter constante o n�mero de cromossomos t�picos de
cada esp�cie.
c) I ocorre nos ov�rios e II, nos test�culos.
d) H� maior produ��o de gametas em II do que em I.
e) Em I e II, as c�lulas formadas s�o diploides.
Quest�o discursiva
5. (Fuvest-SP) Durante o desenvolvimento embrion�rio das aves, o embri�o � nutrido
gra�as � grande quantidade de vitelo presente no ovo. J� nos mam�feros o ovo �
pobre em vitelo. Como a grande maioria dos embri�es de mam�feros consegue obter os
nutrientes necess�rios para seu desenvolvimento?

P�gina 222

Cap�tulo 12 A diversidade celular dos vertebrados

MAURO FERMARIELLO/SCIENCE PHOTO LIBRARY/LATINSTOCK


No Instituto de Dermatologia (IDI), em Pomezia, na It�lia, o pesquisador Michele de
Luca realiza pesquisa que visa � produ��o de pel�culas epid�rmicas a partir do
cultivo de c�lulas epiteliais humanas em condi��es apropriadas. Um dos objetivos da
pesquisa � utilizar as pel�culas epid�rmicas no tratamento de doen�as de pele. Na
fotografia, o pesquisador segura uma pel�cula de tecido epitelial crescida em meio
de cultura.
C�lulas-tronco e engenharia de tecidos
"Imagine que a pessoa perdeu um p�. Com o desenvolvimento da engenharia de tecidos,
vai ser poss�vel que ela v� a uma cl�nica e escolha um p� para um implante, ou
poderemos escanear o outro p�, desenvolver uma estrutura de pele, m�sculos, ossos e
tend�es, semear c�lulas retiradas do paciente, desenvolver esses tecidos e fazer a
cirurgia para implantar um p� igual ao que ela tinha." Essa � a expectativa do
engenheiro Dr. Lu�s Alberto dos Santos, presidente da Sociedade Latino Americana de
Biomateriais e �rg�os Artificiais (Slabo), na mat�ria publicada pelo jornal Gazeta
do Povo, em 13 de mar�o de 2012.
"A esperan�a � que in�meras doen�as, entre elas as neuromusculares, o diabetes, o
mal de Parkinson e as les�es de medula, possam ser tratadas pela substitui��o ou
corre��o de c�lulas ou tecidos defeituosos. [...] Se as pesquisas derem os
resultados esperados, no futuro ser� poss�vel fabricar tecidos e �rg�os em
quantidade suficiente para suprir toda a demanda e acabar com as longas filas para
o transplante de �rg�os. Do mesmo modo que trocamos pe�as do nosso carro, poderemos
substituir �rg�os com defeito ou corrigir sua fun��o. Mas, para chegar l�, ainda
temos que pesquisar e estudar muito."

P�gina 223

Esse trecho faz parte de um artigo publicado no site do Dr. Drauzio Varella e
assinado pela geneticista Dra. Mayana Zatz, coordenadora do Centro de Estudos do
Genoma Humano, ligado ao Departamento de Gen�tica e Biologia Evolutiva da
Universidade de S�o Paulo.
O que achou dessas duas afirma��es? Em ambos os casos, pode-se perceber o grande
otimismo dos pesquisadores quanto a futuros tratamentos para problemas de sa�de
antes incur�veis.
A Dra. Mayana Zatz, conhecida nacionalmente por sua defesa da utiliza��o tera
p�utica de c�lulas-tronco embrion�rias, � cautelosa; observe que ela diz: "Se as
pesquisas derem os resultados esperados..." e "para chegar l�, ainda temos que
pesquisar e estudar muito".
De fato, a Dra. Mayana tem raz�o. Temos que estudar muito para entender os sistemas
biol�gicos a ponto de interferir positivamente neles, melhorando a qualidade da
vida humana. Nessa grande empreitada, cada um tem de fazer a sua parte; e �
exatamente o que vamos fazer juntos neste cap�tulo.
A import�ncia do assunto
Neste cap�tulo vamos estudar os principais tecidos constituintes do corpo dos
animais, com destaque para a esp�cie humana. Voc� sabia que, incluindo os tecidos
da placenta e dos anexos embrion�rios, h� nada menos que 216 tecidos diferentes em
nosso corpo?
O conhecimento detalhado da estrutura e do funcionamento dos organismos, desde as
mol�culas at� os tecidos, tem possibilitado visualizar um futuro otimista para a
humanidade, principalmente no tratamento e na cura de in�meras doen�as. Por
enquanto, nosso objetivo � entender como surge a grande variedade de tecidos
corporais e conhecer algumas de suas caracter�sticas b�sicas. Esse � o primeiro
passo para compreender melhor o funcionamento do corpo humano.
12.1 A diversidade dos tecidos vivos
Animais e plantas s�o organismos multicelulares, ou seja, constitu�dos por muitas
c�lulas, cujo n�mero varia de dezenas a trilh�es, dependendo da esp�cie. Os
bi�logos consideram a passagem da estrat�gia unicelular para a multicelular um
passo muito importante na hist�ria evolutiva da vida. Na estrat�gia multicelular,
c�lulas resultantes da multiplica��o do zigoto permanecem juntas e especializam-se,
passando a dividir as tarefas vitais.
Durante o desenvolvimento embrion�rio de um ser multicelular, as c�lulas
desenvolvem caracter�sticas particulares e diferenciam-se umas das outras, de
acordo com a posi��o que ocupam no embri�o. Esse processo, denominado diferencia��o
celular, � respons�vel pela forma��o dos mais de duzentos tipos de tecido
constituintes do corpo humano.
Tecidos s�o conjuntos de c�lulas que atuam de modo integrado no organismo
multicelular, constituindo �rg�os corporais. Um �rg�o � geralmente formado por
diferentes tecidos. Por exemplo, o est�mago, �rg�o que faz parte do sistema
digest�rio, apresenta-se constitu�do pelos tecidos epitelial, muscular, glandular e
conjuntivo. Um osso, parte do sistema esquel�tico, comp�e-se principalmente de
tecido �sseo e de tecido conjuntivo de revestimento, entre outros.
H� algumas d�cadas, descobriu-se a exist�ncia, em animais e em seres humanos, das
c�lulas-tronco, capazes de se multiplicar e de se diferenciar em qualquer tipo de
c�lula do organismo. Elas desempenham papel nos processos de regenera��o corporal e
sua descoberta abre novas possibilidades terap�uticas, como foi comentado na
apresenta��o do cap�tulo.
Apesar da grande variedade de tecidos dos animais vertebrados, os bi�logos costumam
agrup�-los em apenas quatro grandes categorias: tecido epitelial, tecido
conjuntivo, tecido muscular e tecido nervoso.

P�gina 224

Ci�ncia e cidadania
A import�ncia das c�lulas-tronco
1 Em 1908, o histologista russo Alexander Maksimov (1874-1928) formulou a hip�tese
de que todas as c�lulas do sangue surgiam por diferencia��o de c�lulas precursoras,
que ele denominou c�lulas-tronco hematopoi�ticas (do grego hematos, sangue, e
poiesis, cria��o, forma��o). O termo "c�lula-tronco" foi utilizado por Maksimov
para enfatizar a suposta capacidade dessas c�lulas de gerar v�rios tipos celulares,
assim como um tronco de uma �rvore gera diversos ramos.
2 Em 1963, os pesquisadores canadenses James Till (1931-) e Ernest McCulloch (1926-
2011) demonstraram pioneiramente a exist�ncia de c�lulas-tronco hematopoi�ticas na
medula �ssea de camundongos. Desde ent�o, in�meras descobertas sugerem que as
c�lulas-tronco, por sua capacidade de gerar diferentes tipos de c�lulas do corpo,
podem ter grande potencial terap�utico na recupera��o de �rg�os e de partes
corporais doentes.
3 O que s�o c�lulas-tronco e como elas surgem em nosso organismo? Para responder a
essas quest�es, vamos voltar ao sexto dia de nossa vida embrion�ria, quando nos
encontr�vamos no est�gio de blastocisto, fase em que o embri�o humano se implanta
na parede uterina. O blastocisto cont�m um conjunto de c�lulas - o embrioblasto -
que origina todas as c�lulas do futuro organismo. As c�lulas do embrioblasto s�o
hoje reconhecidas como as verdadeiras c�lulas-tronco embrion�rias. Elas s�o
totipotentes, pois t�m capacidade de se diferenciar em qualquer tipo de c�lula do
organismo.
4 � medida que o embri�o se desenvolve, as c�lulas-tronco embrion�rias diferenciam-
se nos diferentes tipos de c�lulas, que originam tecidos e �rg�os do animal adulto.
Entretanto, em certos locais do corpo, algumas linhagens de c�lulas continuam a
manter caracter�sticas "embrion�rias", sendo capazes de se multiplicar e se
diferenciar em c�lulas de diferentes tipos. Essas s�o as c�lulas-tronco adultas,
cuja fun��o � a regenera��o do organismo, originando novas c�lulas e reconstituindo
tecidos eventualmente danificados.
5 As pesquisas t�m revelado que h� diferentes tipos de c�lulas-tronco adultas. No
cord�o umbilical, por exemplo, h� linhagens de c�lulas-tronco capazes de originar
muitos tipos celulares, o que levou os cientistas a denomin�-las de c�lulas-tronco
pluripotentes.
6 A maioria das c�lulas-tronco encontradas no organismo adulto pertence a linhagens
capazes de originar um ou poucos tipos celulares, sendo, por isso, denominadas
c�lulas-tronco multipotentes.
7 O tratamento bem-sucedido de alguns tipos de leucemia pelo transplante de medula
�ssea tem estimulado os cientistas a pesquisar novas possibilidades terap�uticas
das c�lulas-tronco - a medula �ssea sadia transplantada coloniza o organismo doente
com c�lulas-tronco hematopoi�ticas.
8 Alguns pesquisadores defendem que as c�lulas-tronco embrion�rias de embri�es
descartados da fertiliza��o in vitro sejam utilizadas em experimentos e em
tratamentos m�dicos. Essa quest�o ainda desperta muitas pol�micas e esbarra em
quest�es �ticas e morais.
Guia de leitura
Responda em seu caderno
1 Leia os dois par�grafos iniciais do quadro e responda: por que as c�lulas-tronco
receberam esse nome? Explique o que significa o potencial terap�utico das c�lulas-
tronco.
2 O terceiro par�grafo aborda as c�lulas-tronco embrion�rias. Por que essas c�lulas
s�o consideradas totipotentes?
3 O quarto par�grafo trata das c�lulas-tronco adultas. Como elas surgem em nosso
corpo e qual � sua fun��o?
4 Leia os par�grafos 5 e 6 do quadro e responda: qual � a diferen�a entre c�lulas-
tronco pluripotentes e multipotentes?
5 O par�grafo 7 refere-se ao tratamento da leucemia pelo transplante de medula
�ssea. Pesquise sobre esse tipo de tratamento e escreva resumidamente a respeito.
6 No oitavo e �ltimo par�grafo do quadro, comenta-se o uso de embri�es descartados
em procedimentos de fertiliza��o in vitro em pesquisas cient�ficas. O que voc�
conhece sobre o assunto? Qual � sua opini�o a respeito?

P�gina 225

12.2 Tecido epitelial


Epit�lios de revestimento
O corpo dos vertebrados mant�m-se isolado do meio externo por um tecido
especializado em revestir, o tecido epitelial de revestimento ou epit�lio de
revestimento. A principal caracter�stica desse tecido � ser formado por c�lulas
firmemente unidas entre si, bem ajustadas (ou c�lulas justapostas, como dizem os
histologistas). Nos tecidos epiteliais, n�o h� vasos sangu�neos e as c�lulas
recebem g�s oxig�nio e nutrientes por difus�o a partir de tecidos conjuntivos
pr�ximos. Os epit�lios de revestimento est�o presentes na superf�cie externa do
corpo, nas superf�cies externa e interna de �rg�os e em diversas cavidades
corporais. A uni�o firme e �ntima das c�lulas epiteliais, que n�o deixa espa�os
entre si, faz dos epit�lios barreiras eficientes contra agentes invasores e impedem
a perda de l�quidos corporais.
Os tecidos epiteliais podem apresentar c�lulas de diversos formatos (prism�ticas,
achatadas etc.) e uma ou mais camadas celulares, caracter�sticas usadas pelos
cientistas como crit�rio para sua classifica��o. (Tab. 12.1 e Fig. 12.1)
Tabela 12.1 Classifica��o dos epit�lios de revestimentoCrit�riosNomeCaracter�sticas
N�mero e apar�ncia das camadas celularesSimples ou uniestratificadoUma �nica camada
de c�lulasEstratificadoMais de uma camada de c�lulasPseudoestratificadoUma �nica
camada de c�lulas, com n�cleos em diferentes alturasForma das c�lulasPavimentoso
C�lulas achatadasC�bico C�lulas c�bicasPrism�ticoC�lulas prism�ticas alongadasDe
transi��oC�lulas arredondadas que se tornam achatadas quando submetidas a
estiramentosILUSTRA��ES: CAN�ADO
Figura 12.1 Representa��o esquem�tica da estrutura de alguns tipos de epit�lio de
revestimento do corpo humano. (Elementos fora de propor��o de tamanho entre si;
cores-fantasia.) (Elaborada com base em Campbell, N. e cols., 1999.)

P�gina 226

Epit�lios glandulares
O epit�lio glandular constitui as gl�ndulas, cujas c�lulas s�o especializadas na
secre��o celular, que � a elimina��o, pela c�lula, de subst�ncias �teis ao
organismo em diversos aspectos.
Quanto � forma de secretar, as gl�ndulas s�o classificadas em dois tipos b�sicos:
ex�crinas e end�crinas.
Gl�ndulas ex�crinas (do grego exos, fora, e krinos, secretar) apresentam ductos, ou
seja, canais pelos quais eliminam as secre��es para fora do corpo ou para cavidades
de �rg�os. Exemplos de gl�ndulas ex�crinas s�o as gl�ndulas sudor�paras, que
eliminam o suor na superf�cie da pele, e as gl�ndulas salivares, que eliminam a
saliva na cavidade bucal. (Fig. 12.2)

ILUSTRA��ES: JURANDIR RIBEIRO


Figura 12.2 Representa��o esquem�tica de tr�s tipos de gl�ndulas ex�crinas. Se a
por��o secretora tem forma de tubo, a gl�ndula � chamada de tubulosa; se a por��o
secretora � arredondada, a gl�ndula � chamada de acinosa. (Elementos fora de
propor��o de tamanho entre si; cores-fantasia.)
Gl�ndulas end�crinas (do grego endos, dentro) n�o apresentam ductos, eliminando
suas secre��es, denominadas horm�nios, diretamente no sangue. A gl�ndula tire�idea,
por exemplo, localizada na regi�o do pesco�o, produz e libera no sangue os
horm�nios tiroxina e tri-iodotironina. A gl�ndula hip�fise, situada embaixo do
enc�falo, secreta no sangue diversos horm�nios, entre eles o horm�nio de
crescimento e os que regulam o ciclo menstrual.
12.3 Tecido conjuntivo
H� tecidos cuja fun��o � unir e sustentar outros tecidos, dando "conjunto" ao
corpo, da� sua denomina��o de tecidos conjuntivos. Neles, as c�lulas n�o est�o
justapostas como no tecido epitelial, mas distribuem-se em um material de
consist�ncia gelatinosa e rico em fibras - a matriz intercelular- secretado pelas
pr�prias c�lulas do tecido conjuntivo.
O principal componente das fibras da matriz intercelular � a prote�na denominada
col�geno, que constitui cerca de 30% das prote�nas presentes no corpo humano. Os
tipos de c�lulas e a composi��o da matriz intercelular caracterizam os diversos
tipos de tecido conjuntivo.
Ao contr�rio dos epit�lios, os tecidos conjuntivos s�o quase sempre vascularizados,
isto �, cont�m vasos sangu�neos. O sangue que circula nesses vasos fornece
nutrientes e g�s oxig�nio �s c�lulas do tecido conjuntivo e �s c�lulas epiteliais
vizinhas. O �nico tecido conjuntivo sem vasculariza��o interna � o cartilaginoso,
como veremos a seguir.
Os tecidos conjuntivos costumam ser classificados em dois grandes grupos: tecidos
conjuntivos propriamente ditos e tecidos conjuntivos especiais. (Tab. 12.2 e Fig.
12.3)
Tabela 12.2 Classifica��o dos tecidos conjuntivosTecido conjuntivo propriamente
dito FrouxoDensoDenso modelado (ou tendinoso)Denso n�o modelado (ou fibroso)Tecidos
conjuntivos especiaisAdiposoCartilaginoso �sseo Hematopoi�tico (ou hemocitopo�tico)

P�gina 227

ILUSTRA��ES: JURANDIR RIBEIRO


Figura 12.3 Representa��o esquem�tica de um corte longitudinal da regi�o do joelho
humano, mostrando a localiza��o de diversos tipos de tecido conjuntivo. (Elementos
fora de propor��o de tamanho entre si; cores-fantasia.) (Elaborada com base em
Campbell, N. e cols., 1999.)
Tecidos conjuntivos propriamente ditos
Os tecidos conjuntivos propriamente ditos apresentam-se amplamente distribu�dos no
corpo humano. Suas principais c�lulas s�o os fibroblastos, respons�veis pela
produ��o de fibras e subst�ncias intercelulares, e os macr�fagos, c�lulas grandes e
m�veis que se deslocam continuamente pela matriz intercelular, fagocitando
bact�rias e res�duos (relembre a fagocitose no cap�tulo 5).
Esses tecidos costumam ser divididos em dois tipos: frouxo e denso; este �ltimo �
subdividido em n�o modelado e modelado.
O tecido conjuntivo frouxo, presente em v�rias partes do corpo, caracteriza-se por
apresentar fibras frouxamente entrela�adas. Sua fun��o � sustentar tecidos
epiteliais vizinhos e preencher espa�os entre tecidos e �rg�os. Um exemplo desse
tecido � a camada papilar da derme, localizada imediatamente sob a epiderme da
pele.
O tecido conjuntivo denso n�o modelado, tamb�m chamado de tecido conjuntivo denso
fibroso, tem grande quantidade de fibras proteicas entrela�adas, que lhe d�o
resist�ncia e elasticidade. Ele est� presente na camada reticular da derme e em
c�psulas envolt�rias de diversos �rg�os internos, como os rins, o ba�o, o f�gado e
os test�culos, entre outros.

P�gina 228

O tecido conjuntivo denso modelado, tamb�m denominado tecido conjuntivo denso


tendinoso, tem grande quantidade de fibras col�genas orientadas paralelamente, o
que o torna muito resistente e pouco el�stico. Esse tecido constitui os tend�es,
que ligam os m�sculos aos ossos, e osligamentos, que ligam ossos entre si. (Fig.
12.4)

DR. KEITH WHEELER/SCIENCE PHOTO LIBRARY/LATINSTOCK

JURANDIR RIBEIRO
RALPH HUTCHINGS/VISUALS UNLIMITED, INC./GLOW IMAGES
Figura 12.4 A. Fotomicrografia da pele humana. (Microsc�pio fot�nico; aumento ?
10�; cores artificiais.) A epiderme, parte epitelial da pele, � a camada fina e de
colora��o mais escura na imagem; sob ela, situa-se um tecido conjuntivo n�o
modelado, que constitui a derme. B. Representa��o esquem�tica do tend�o calc�neo,
constitu�do por tecido conjuntivo denso modelado (tendinoso). (Elementos fora de
propor��o de tamanho entre si; cores-fantasia.) No c�rculo, fotomicrografia do
tecido tendinoso; note as fibras altamente compactadas. (Microsc�pio fot�nico;
aumento ? 195�; cores artificiais.)
Tecidos conjuntivos especiais
Alguns tecidos conjuntivos desempenham fun��es altamente especializadas, sendo, por
isso, chamados de tecidos conjuntivos especiais. Exemplos s�o o tecido adiposo, que
armazena gordura, o tecido cartilaginoso, que constitui as cartilagens, o tecido
�sseo, que constitui os ossos, e o tecido hematopoi�tico, que origina as c�lulas do
sangue. O pr�prio sangue � considerado um tecido conjuntivo, cujas c�lulas est�o
imersas em uma matriz intercelular l�quida, o plasma sangu�neo.
Tecido adiposo
O tecido adiposo � um tipo especial de tecido conjuntivo cujas c�lulas, os
adip�citos, especializam-se no armazenamento de gordura. Ele se localiza
principalmente sob a pele, constituindo a tela subcut�nea ou hipoderme.
A principal fun��o do tecido adiposo � reservar energia para momentos de
necessidade. Se faltar alimento, as reservas de gordura das c�lulas adiposas ser�o
metabolizadas no interior das mitoc�ndrias, produzindo energia para os processos
vitais. Nos mam�feros, principalmente nos que vivem em regi�es frias, a camada
adiposa constitui um eficiente isolante t�rmico corporal, que diminui a perda de
calor para o ambiente.
Tecido cartilaginoso
O tecido cartilaginoso caracteriza-se pela resist�ncia aliada � flexibilidade.
Essas caracter�sticas se devem � matriz intercelular rica em fibras col�genas e em
materiais consistentes, produzidos e secretados por c�lulas denominadas
condroblastos (do grego chondros, cartilagem, e blastos, com sentido de c�lula
jovem).
Nas cartilagens completamente formadas, os condroblastos amadurecem e diminuem de
tamanho, passando a ser chamados de condr�citos. Cada condr�cito est� confinado a
uma lacuna ligeiramente maior que ele, modelada durante a forma��o da matriz
intercelular.
Como o tecido cartilaginoso � avascular, isto �, sem vasos sangu�neos em seu
interior, os condroblastos e os condr�citos recebem nutrientes e g�s oxig�nio de
vasos sangu�neos localizados no tecido conjuntivo que envolve a cartilagem, o
chamado peric�ndrio (do grego peri, ao redor).

P�gina 229

No peric�ndrio tamb�m h� c�lulas-tronco cartilaginosas, que podem se transformar em


condroblastos e permitir o crescimento e a regenera��o do tecido cartilaginoso.
O esqueleto de ca��es, de tubar�es e de arraias � constitu�do basicamente por
tecido cartilaginoso; por isso, esses