Biosynthesis of Gold and Silver

Nanoparticles from the Symbiotic

Bacterium, Photorhabdus luminescens of
Entomopathogenic Nematode: Larvicidal
Properties Against Three Mosquitoes and
Galleria mellonella Larvae
D. Aiswarya, R. K. Raja, C. Kamaraj,
G. Balasubramani, P. Deepak, D. Arul,
V. Amutha, et al.
Journal of Cluster Science
Including Nanoclusters and
Nanoparticles

ISSN 1040-7278

J Clust Sci
DOI 10.1007/s10876-019-01564-1

1 23
Your article is protected by copyright and
all rights are held exclusively by Springer
Science+Business Media, LLC, part of
Springer Nature. This e-offprint is for personal
use only and shall not be self-archived in
electronic repositories. If you wish to self-
archive your article, please use the accepted
manuscript version for posting on your own
website. You may further deposit the accepted
manuscript version in any repository,
provided it is only made publicly available 12
months after official publication or later and
provided acknowledgement is given to the
original source of publication and a link is
inserted to the published article on Springer's
website. The link must be accompanied by
the following text: "The final publication is
available at link.springer.com”.

1 23
 Author's personal copy
Journal of Cluster Science
https://doi.org/10.1007/s10876-019-01564-1 (0123456789().,-volV)(0123456789().
,- volV)

ORIGINAL PAPER

Biosynthesis of Gold and Silver Nanoparticles from the Symbiotic

Bacterium, Photorhabdus luminescens of Entomopathogenic
Nematode: Larvicidal Properties Against Three Mosquitoes
and Galleria mellonella Larvae
D. Aiswarya1 • R. K. Raja1 • C. Kamaraj1 • G. Balasubramani1 • P. Deepak1 • D. Arul1 • V. Amutha1 •

C. Sankaranarayanan2 • S. Hazir3 • P. Perumal1

Received: 22 February 2019

 Springer Science+Business Media, LLC, part of Springer Nature 2019

Abstract
The present investigation focuses on the larvicidal property of gold and silver nanoparticles (AuNPs and AgNPs) that were
synthesized using the supernatant of Photorhabdus luminescens strain KPR-8B from nematode. The synthesized AuNPs
and AgNPs were characterized through UV–visible spectrophotometer, X-ray diffraction analysis, Fourier transform
infrared spectroscopy, dynamic light scattering and high-resolution transmission electron microscopic analyses. The
characterization studies confirmed the spherical shape and size (14–46 nm) of AuNPs and AgNPs. The synthesized AuNPs
and AgNPs were evaluated against 4th instar larvae of three mosquitoes, Aedes aegypti, Anopheles stephensi and Culex
quinquefasciatus. The highest larval mortality was observed after 24 h from the KPR-8B derived AuNPs against A. aegypti
with the LC50 and LC90 values of 5.04 and 12.65 lg/ml, respectively.

Keywords Photorhabdus luminsecens  Biosynthesis  Gold and silver nanoparticles  Bionanopesticides

Introduction more than 700,000 deaths annually. One sixth of the illness
and disability being suffered worldwide is due to vector-
Mosquito born-diseases are one of the most important borne diseases [2]. Aedes aegypti, a vector responsible for
health problems all over the world. The mosquitoes of the spreading several arboviral diseases, is widely distributed
genera; Aedes, Anopheles and Culex are considered as in the tropical and subtropical zones of India. The mos-
devastating vectors for the cause of various diseases, such quito, Anopheles stephensi is a malaria-causing vector,
as malaria, filariasis, yellow fever, dengue, Japanese which affects approximately 2–3 million people annually
encephalitis and hemorrhagic fever [1]. They are respon- and which also causes morbidity and mortality in India [3].
sible for over 17% of all infectious diseases, that cause The Culex quinquefasciatus, a vector of Wuchereria spe-
cies that cause lymphatic filariasis, is widely distributed in
tropical regions. In India, 553 million people are at risk of
& R. K. Raja infection and there are approximately 21 million people
sriramkarthik83@gmail.com
with symptomatic filariasis and 27 million microfilaria
& P. Perumal carriers [4].
perumalarticles@gmail.com
The Gram negative bacterium, Photorhabdus belonging
1
Department of Biotechnology, School of Biosciences, Periyar to the family Enterobacteriaceae have symbiotic relation-
University, Periyar Palkalai Nagar, Salem, ship with the entomopathogenic nematodes (EPNs) of the
Tamil Nadu 636 011, India genus, Heterorhabditis. The infective juvenile stages (IJs)
2
Department of Nematology, Sugarcane Breeding Institute of EPNs are in circulation within natural and agricultural
(ICAR), Coimbatore, Tamil Nadu 641 007, India soils and they are being successfully utilized for the insect
3
Department of Biology, Faculty of Arts and Science, Adnan pests control [5]. Photorhabdus are rod shaped and motile
Menderes University, 09010 Aydin, Turkey

123
 Author's personal copy
via peritrichous flagella. These bacteria are being carried in
the intestines of IJs that invades into the hemocoel of an
insect host through the mouth, spiracles and anus, where-
upon, they are released into the hemolymph [6]. The EPN-
bacterial complex could destroy the immune response of
the larval insect host and could cause death within 24–48 h.
Consequently, the body of insect larval cadaver exhibit a
red or black color based on the EPN infected. The EPNs
develop through one to three generations in the host
cadaver by feeding on the bacteria and dead insect tissue.
Upon depletion of the food resources, the 3rd stage infec-
tive juveniles (IJs) emerge from the host cadaver to search
for a new host [7]. These bacteria could produce many
bioactive compounds that possess insecticidal, cytotoxic
and anti-microbial properties [8]. Symbiotically, the EPNs
may be benefited from the bacteria by eating the bacteria
and survived in the infected insects.
Nanotechnology has become one of the most promising
technologies with potential application in all areas of sci-
ence. Nanoparticles (NPs) are wide class of materials that
include particulate substances, which have one dimension
less than 100 nm and size-related physico-chemical prop-
erties differs significantly from larger matter [9, 10]. Bio-
logical method of the nanoparticles syntheses could be
achieved by the use of biological agents such as bacteria,
fungi, actinomycetes, yeasts and plants. These are extre-
mely good candidates in the synthesis of cadmium, gold
and silver nanoparticles [11]. The microbes-based biolog-
ical approach has been used to synthesize different metallic
NPs, which has advantages over other chemical methods
[12]. Biological agents secrete a great deal of enzymes that
bring about enzymatic reduction of metallic ions [13].
Many microorganisms can produce nanoparticles either by
intracellular or extracellular routes. Gold (Au) and silver
(Ag) NPs have been used for the treatment of certain illness
and the staining of glass and enamels. Nowadays, AuNPs
and AgNPs were found to be useful in many applications
such as biomedicine, water treatment, catalysis, biosensing,
electronic and magnetic devices [14]. Various species of
Gram positive and negative bacteria have been known to
adsorb and take up heavy metal ions [15]. Earlier, silver
and gold nanoparticles were synthesized from several
bacteria such as Pseudomonas stutzeri [16], Bacillus
megaterium [17], Pseudomonas aeruginosa, Cyanobacte-
ria, Brevibacterium casei, Rhodopseudomonas capsulate,
Escherichia coli DH5a, Bacillus subtilis and Steno-
trophomonas maltophilia [18]. The present investigation
was carried out to synthesize gold and silver nanoparticles
from the symbiotic bacterium, Photorhabdus luminescens
strain KPR-8B of entomopathogenic nematode and the
larvicidal effect of synthesized NPs against larvae of A.
aegypti, A. stephensi and C. quinquefasciatus.
123
D. Aiswarya et al.
Materials and Methods
Materials
Chloroauric acid (HAuCl43H2O) and silver nitrate
(AgNO3) were purchased from SD-fine chemicals, India.
Nutrient broth was purchased from Himedia Pvt. Ltd,
India.
Methods
Isolation of Symbiotic Bacterium from Entomopathogenic
Nematode
Symbiotic bacterial strain KPR-8B (P. luminescens) was
isolated from the EPN, Heterorhabditis indica KPR-8
strain. H. indica KPR-8 was infected on the last instar
larvae of Galleria mellonella, that was conducted in 9 cm
diameter petri dishes lined at the bottom with a sheet of
whatman filter paper. After 24 h, the infected cadaver
larvae were placed on 70% ethanol containing beaker for
surface sterilization under laminar airflow chamber. The
cadaver-larvae were dissected and placed a drop of hae-
molymph that was streaked onto a plates containing
Nutrient Bromothymol blue agar medium (NBTA). The
plates were incubated for 24 to 48 h at 24 C. The isolated
colony was sub cultured and the obtained pure culture was
used for synthesis of nanoparticles.
Molecular Identification of Symbiotic Bacterium
Molecular identification of the KPR-8B symbiotic bacterial
strain was carried out by 16S rDNA sequencing method.
Total genomic DNA was isolated from a KPR-8B bacterial
strain. The genomic DNA was used as template for PCR
amplification using 16S rDNA primers (27F-
50 AGAGTTTGATCMTGGCTCAG 30 and 1525R-
50 AAGGAGGTGATCCAGCCGCA 30 ). For polymerase
chain reaction (PCR), 1 ll of bacterial DNA and 2 ll of
each forward and reverse primers were mixed with 10 ll of
29 PCR Master Mix (GeNeiTM, Bangalore, India) con-
sisting of dNTPs, Taq DNA polymerase and PCR buffer.
The final volume was made up to 20 ll with sterile double
distilled water. PCR amplification was performed in a
thermal cycler (cyber cycler-P series PCR Peltier model
p96 ? the USA) with the following cycling conditions:
initial denaturation at 94 C for 4 min and 30 cycles at
94 C for 1 min, 62 C for 1 min, 72 C for 2 min with a
final extension for 7 min at 72 C. The amplified PCR
product was purified and subjected to sequencing at
Shrimpex Biotech Pvt. Ltd, Chennai. The partial gene
sequence of 16S rDNA of KPR-8B strain was used to
 Author's personal copy
Biosynthesis of Gold and Silver Nanoparticles from the Symbiotic Bacterium, Photorhabdus…
BLAST with the existing nucleotide sequences in NCBI
and the phylogenetic tree was constructed using neighbor-
joining method in MEGA 6.0 software [19].
Extracellular Synthesis of Gold and Silver Nanoparticles
(AuNPs and AgNPs) The KPR-8B bacterial strain was
inoculated in to 250 ml Erlenmeyer flask containing
100 ml sterile nutrient broth. The flask containing the
culture was incubated in a rotating shaker at 200 rpm for
48 h at 24 C. The culture was then centrifuged at
10,000 rpm for 15 min. The supernatant was collected and
used for the synthesis of gold and silver nanoparticles. The
supernatant was mixed with 2 mM HAuCl4 and 2 mM
AgNO3 solutions separately in a 250 ml Erlenmeyer flask,
respectively. The reaction mixtures were incubated on
rotating shaker (200 rpm) placed in a dark for 48 h. Visual
observation was made periodically to check the nanopar-
ticle formation.
Characterization of the Synthesized AuNPs and AgNPs
The formations of gold and silver nanoparticles were
confirmed through periodical analyses through UV–Vis
spectrophotometer (Cyber Lab UV-100) in the wavelength
range of 200–800 nm. Furthermore, nanoparticle solutions
were subjected to centrifugation at 10,000 rpm for 15 min
and the resultant pellets were air-dried and used for the
various characterization viz; X-ray diffraction (XRD)
(Bruker AXS D8 Advance) and Fourier transform infrared
spectroscopy (FTIR) (Thermo Nicolet, Avatar 370) analy-
ses. The size and morphology of the NPs were character-
ized through high resolution transmission electron
microscope (HRTEM) (JEOL/JEM 2100). XRD, FTIR and
HRTEM analyses that were carried out in the Sophisticated
Test and Instrumentation Centre (STIC), Cochin, Kerala,
India. The measurement of zeta potential and particle size
of KPR-8 synthesized AuNPs and AgNPs were carried out
by particle size analyzer system (Zeta-sizer, Malvern
Instruments Ltd, Worcestershire, UK).
Mosquito Culture The eggs and 1st instar larvae of A.
aegypti, A. stephensi and C. quinquefasciatus were
obtained from ICMR-Vector Control Research Laboratory,
Madurai, India. They were reared in plastic trays contain-
ing tap water and maintained in laboratory condition.
Biscuits were served as larval food. All the experiments
were carried out at 28 ± 2 C, 70–80% relative humidity
and photoperiod of 12 h in light and dark conditions,
respectively. A 4th instar larva was used for the larvicidal
activity.
Mosquito Larvicidal Bioassay The larvicidal efficacy of
KPR-8B synthesized AuNPs and AgNPs were tested as per
the procedure of World Health Organization [20]. Different
concentrations (0.625, 1.25, 2.50, 5 and 10 lg/ml) of KPR-
8B AuNPs and AgNPs were used to test the larvicidal
activity on the larvae of A. aegypti, A. stephensi and C.
quinquefasciatus mosquitoes and a control groups (tap
water) without NPs samples. Then, batches of 25 healthy
4th instar larvae were introduced into the glass beaker
containing 250 ml of tap water with different concentra-
tions of KPR-8B derived AuNPs and AgNPs for each larval
species. The number of dead larvae was counted after 24 h
of exposure and their mortality percentage was calculated.
Three replicates were performed and control was assigned
to each mosquito species. The mortality percentage was
calculated using Abbott’s formula [21], Mortality
(%) = X - Y/*100; where, X: survival in the untreated
control and Y: survival in the treated sample [22].
Pathogenicity Assay Against G. mellonella
The pathogenicity of the synthesized NPs were assessed in
24 well plates. 5th instar larvae of G. mellonella were
obtained from the Department of Biotechnology, Periyar
University, Salem (Tamil Nadu). For each treatment, 0.5 g
of sterilized sandy soil was filled and two different con-
centrations (2.5 and 5 lg/ml) of nanoparticles (KPR-8B
AuNPs and AgNPs) were added to respective wells in the
24 well plate. After 1 h acclimatization, one wax moth
larva was introduced to each well. 24 well plates contain-
ing only wax moth larvae with sandy loam soil and 60 ll of
water in each well were treated as control.
Statistical Analysis
The average larval mortality data were subjected to Probit
Analysis [23] for calculating LC50 and LC90 values at 95%
confidence limit with upper and lower confidence limit
(UCL and LCL). Also the Chi square values were calcu-
lated using the statistical package for the social sciences
(SPSS) 16.0 software (Armonk, NY). Data from larvicidal
experiments were analyzed using One-way analysis of
variance (ANOVA) followed by Tukey’s Honest Signifi-
cant Difference (HSD) test (p B 0.05).
Results
Isolation and Identification of Symbiotic
Bacterium
The symbiotic bacterial strain KPR-8B isolated from the
nematode infected cadaver haemolymph was identified.
For the primary level identification of symbiotic bacteria,
colonies were observed based on the absorption of
123
 Author's personal copy
bromothymol blue and triphenyl tetrazolium dyes from
NBTA plates. Depending upon pigmentations, the KPR-8B
bacterial strain produced greenish colored colonies
(Fig. 1). Based on the major phenotypic characters and
colony morphology, the isolated KPR-8B bacterial strain
was tentatively identified and that belonged to the genus,
Photorhabdus (KPR-8B) (Table 1).
Phylogenetic Analysis
The isolated bacterial KPR-8B strain was confirmed at
species level through 16S rRNA gene sequencing. The
bacterial genomic DNA was amplified by using PCR pri-
mers representing conserved 16S rRNA regions in bacterial
DNA. KPR-8B bacterial strain produced a single band of
755 bp in the agarose gel. The 16S rRNA sequence of
KPR-8B strain was determined and which showed 99%
similarity with P. luminescens. Based on the molecular
similarity, the KPR-8B bacterial strain was identified as P.
luminescens KPR-8B strain. The phylogenetic tree con-
structed using neighbor-joining method is being shown in
Fig. 2. The sequence was deposited in GenBank and its
accession number is KR024037.1.
Synthesis and Characterization of Gold and Silver
Nanoparticles Using P. luminescens
KPR-8B Strain
The extracellular synthesis of nanoparticles was confirmed
primarily by change in color of the reaction solution from
pale yellow to purple for AuNPs and yellow to brown for
AgNPs (Fig. 3). The reaction was completed after 48 h of
incubation. The bio-reduction had occurred with a strong
surface plasmon resonance at 560 nm and 440 nm, thus
indicating the formation of synthesized AuNPs and AgNPs
(Fig. 4). The XRD analysis of KPR-8B AuNPs showed the
2h values of 31.03, 43.83, 64.14, and 77.25 that
Fig. 1 KPR-8B bacterial strain showing greenish colonies on NBTA
agar plate (Color figure online)
123
D. Aiswarya et al.
Table 1 Phenotypic characteristics of isolated symbiotic bacterium
KPR-8B strain
Characteristics P. luminescens KPR-8
Colony color on NBTA agar Greenish
Bioluminescence ?
Insect pathogenicity ?
Growth on 28 C ?
Growth on 37 C W
Absorption of bromothymol blue ?
Catalase ?
(-) Negative; (?) positive; (w) weak positive
correspond to (1 1 1), (2 0 0), (2 2 0) and (3 1 1),
respectively (Fig. 5a). Likewise for the AgNPs, the 2h
values were; 31.74, 45.76, 57.03 and 76.35 corre-
sponding to (1 1 1), (2 0 0), (2 2 0) and (3 1 1), respec-
tively. Bragg’s reflections of face centered cubic nature of
metallic nanoparticles are shown in Fig. 5b. The FTIR
spectrum of KPR-8 supernatant (Fig. 6a) showed the fre-
quency bands at 3446.44, 2085.91 and 1637.60 cm-1. The
band at 3446.44 cm-1 could be assigned to the O–H
stretching vibration of alcohol groups. The band at
2085.91 cm-1 corresponds to the N=C stretching vibration
of miscellaneous groups. The bands at 1637.60 cm-1 cor-
responds to the C=O stretching vibration of amides group.
Whereas, the FTIR spectrum of synthesized AuNPs
showed the presence of bands at 3137.30, 2362.15,
1625.76, 1401.38, 1195.35, 677.23, and 573.20 cm-1
(Fig. 6b). The band at 3137.30 cm-1 could be assigned to
the C–H stretching vibration of alkanes groups. Similarly,
the band at 2362.15 cm-1 signals to the P–H stretching
vibration of miscellaneous groups. The band at
1625.76 cm-1 also represents the CH=CHR stretching
vibration of alkenes groups. The band at 1401.38 cm-1
could be assigned to the S=O stretching vibration of mis-
cellaneous groups. The band at 1195.35 cm-1 corresponds
to the C–F stretching vibration of alkyl halides. The band at
677.23 cm-1 represents the C–H stretching of alkynes
groups. Finally, the band at 573.20 cm-1 was of alkynes
with C–H stretching vibrations.
The FTIR spectrum of synthesized AgNPs showed fre-
quency bands at, 3398.50, 2960.04, 1641.39, 1540.52,
1387.38, 1230.45, 1077.11, and 607.03 cm-1 (Fig. 6c).
The band at 3398.50 cm-1 represents the RCO–OH to the
carboxylic acids. The band at 2960.04 cm-1 signals to the
RCH2CH3 stretching of alkanes groups. The band at
1641.39 cm-1 consigned to the RCONHR’6 vibration of
amides group. The band at 1540.52 cm-1 represents the N–
O stretching vibration of miscellaneous groups. The band
at 1387.38 cm-1 signals to the S=O stretching vibration of
 Author's personal copy
Biosynthesis of Gold and Silver Nanoparticles from the Symbiotic Bacterium, Photorhabdus…

EU155132.1 Photorhabdus luminescens isolate IISc HiP1

EU155131.1 Photorhabdus luminescens HiP6.71 16S
JN053268.1 Photorhabdus luminescens strain BMC2
DQ518589.1 Photorhabdus luminescens strain BSB 46
HE805079.1 Photorhabdus luminescens strain NAIP2
MF950907.1 Photorhabdus luminescens strain SBIPLP1
Z77237.1 Phorhabdus luminescens strain HmHyper
KP224430.1 Photorhabdus luminescens strain KZ4H1
KP224439.1 Photorhabdus luminescens strain KZ6M1
KP224432.1 Photorhabdus luminescens strain KZ5B1
KR024037.1 Photorhabdus luminescens strain KPR-8B
JF923814.1 Photorhabdus luminescens strain NBAII 105

0.5 0.4 0.3 0.2 0.1 0.0

Fig. 2 Phylogenetic trees based on 16S rRNA gene sequences of Photorhabdus luminescens KPR-8B strain based on UPGMA tree

miscellaneous groups. The band at 1077.11 cm-1 corre-

Fig. 3 Synthesis of gold nanoparticles a Supernatant of P. lumi-
nescens, b synthesized gold nanoparticles, c silver nanoparticles of P.
luminescens KPR-8B strain (Color figure online)
sponds to the RNH2 vibration of amines group. Finally, the
band at 607.03 cm-1 represents the alkynes group with C–
H stretching vibrations. In addition, the FTIR peaks indi-
cated the presence of alcohols, alkynes, aromatics, car-
boxylic acids, alkenes, and alkyl halides.
The HRTEM micrographs of KPR-8B derived AuNPs
(Fig. 7a–c) and AgNPs (Fig. 8a–c) clearly indicated that
the particles were in spherical shapes with size range of
14–46 nm for AuNPs and 17–40 nm for AgNPs. The
selected area electron diffraction (SAED) pattern reveals
that the particles are single crystalline in nature (Figs. 7d,
8d). The zeta potential analysis of AuNPs and AgNPs
showed the negative value - 23.1 and - 23.4 mV

Fig. 4 UV–Vis absorption spectra of KPR-8B synthesized AuNPs (a) and AgNPs (b)

123
 Author's personal copy
D. Aiswarya et al.

Fig. 5 XRD pattern of synthesized KPR-8B AuNPs (a) and AgNPs Fig. 6 FTIR spectrum: supernatant, Synthesized KPR-8B AuNPs and
(b) AgNPs

(Figs. 9a, 10a). The particle size analysis exposed the

Z-average of AuNPs and AgNPs are 179.1 and 504.2
(d.nm) and PdI values are 0.383 and 0.910 (Figs. 9b, 10b).

Larvicidal Activity of Synthesized AuNPs and AgNPs

In our experiments, both the KPR-8B AuNPs and AgNPs

showed dose dependent larvicidal effect against all the
three tested mosquito species. Compared to the AgNPs,
AuNPs showed higher toxicity against A. aegypti, A. ste-
phensi, and C. quinquefasciatus with mortality % of 93.33,
83, and 90.67, respectively. Also, AgNPs showed mortality
% of 73.33, 61.33, and 70.67 that are represented in
Figs. 11 and 12. The obtained LC50 and LC90 values are
presented in Tables 2 and 3. The effective LC50 and LC90
values (lg/ml) of synthesized AuNPs were: 5.041 and
28.657 (A. aegypti) followed by 7.435 and 32.481 (A.
stephensi), and 6.312 and 31.453 (C. quinquefasciatus),
respectively. Whereas, the AgNPs showed the LC50 and Fig. 7 HRTEM images (a–c) and SAED pattern (d) of KPR-8B
AuNPs
LC90 values (lg/ml) of: 7.213 and 31.232 (A. aegypti),
10.102 and 45.357 (A. stephensi), and 9.872 and 42.715 (C.
quinquefasciatus), respectively. The control did not show
any mortality. v2 value was significant at p \ 0.05 level.

123
 Author's personal copy
Biosynthesis of Gold and Silver Nanoparticles from the Symbiotic Bacterium, Photorhabdus…
Fig. 8 HRTEM images (a–c) and SAED pattern (d) of KPR-8B
AgNPs
Insecticide Effect of Synthesized AuNPs and AgNPs
During the pathogenicity assessment of NPs against the
late instar larvae of G. mellonella larvae at 24 h treatment,
the AuNPs exerted 94.44% mortality, but the AgNPs
showed only 80.56% mortality at the final concentration of
5 lg/ml.
Discussion
Nanotechnology is a promising field of interdisciplinary
research as it opens up a wide array of opportunities in
different fields, including pharmacology, electronics, par-
asitology and pest management. Nanoparticles have
received considerable attention in recent years due to their
wide range of applications in the fields of diagnostics,
biomarkers, cell labeling, antimicrobial agents, drug
delivery, cancer therapy, medical and veterinary sciences,
as well as entomology [24, 25]. Mosquito-borne diseases
have been a major problem in almost all tropical and
subtropical countries, leads to loss of socio-economic
wealth in many countries due to the death of millions of
people every year [26, 27]. Chemical based pesticides or
insecticides have contaminated almost every part of our
environment, that have caused potential health risks and
environmental problems [28]. Biologically synthesized
pesticides, due to their biodegradability and eco-friendly
nature, to control the mosquitoes are an important strategy
for the prevention of widespread outbreak of infectious
diseases [29]. Microbial insecticides are being considered
as alternatives to chemical insecticides because of their
toxicity and decomposability in the ecosystem [30].
Therefore, the present focus was on the mosquitocidal
activity of AuNPs and AgNPs synthesized from ento-
mopathogenic bacterium Photorhabdus sp., as a bio-
insecticide.
EPNs are considered to be boon for the agriculture,
belong to the Families Steinernematidae (genus Stein-
ernema) and Heterorhabditidae (genus Heterorhabditis).
They are obligate insect parasitic organisms, and occur
naturally in the soil. The Gram negative symbiotic bacteria
belonging to Enterobacteriaceae family are mutulistic
associations with EPNs (Xenorhabdus spp. for Steinernema
spp. of EPN and Photorhabdus spp. for Heterorhabditis
spp. of EPN) [31]. In the present study, the ento-
mopathogenic bacterium P. luminescens strain KPR-8B
isolated from the hemolymph of G. mellonella infected
with EPN H. indica. The isolated Photorhabdus sp. strain
KPR-8B was identified by using morphological and
molecular characterization techniques. Similar to our
study, Mathur et al. [32] and Shawer et al. [33] isolated P.
luminescens sub sp. akhurstii from the hemolymph of G.
mellonella infected H. indica.
The P. luminescens strain KPR-8B synthesized
nanoparticles was confirmed through the colour changes
from the pale yellow to purple for AuNPs and brownish for
AgNPs after 24 h, similar to the earlier observation of
Chandrakasan et al. [34] dark brownish color was exhib-
ited for X. stockiae AgNPs, whereas XsAuNPs showed
pink color within 24 h of incubation. In the present study,
the surface plasmon resonance (SPR) peak in UV–Vis
spectroscopy for KPR-8B derived AuNPs and AgNPs were
recorded at 560 and 440 nm after 24 h of incubation.
Similar investigations on the biosynthesis of AuNPs and
AgNPs with an absorbance spectra at 560 and 430 nm
using symbiotic bacterium X. Stockiae have been reported
earlier [34]. The FTIR spectrum of synthesized NPs
showed variation in the stretches, which are mainly due to
the interaction of metal ions with bacterial proteins [35].
The functional groups of amines, alkynes and alkyl halides
were mainly contribute to the synthesis of AuNPs and
AgNPs from the P. luminescens KPR-8B strain were ana-
lyzed in the FTIR. The amide linkages between amino acid
residues in proteins give rise to well known signs in the
infrared region of electromagnetic spectrum. The bands
could be assigned to the stretching vibrations of primary
and secondary amines, respectively [34]. In our result,
FTIR spectrum between bacterial supernatant and synthe-
sized AuNPs and AgNPs, the major peaks were observed in
1540 to 573 cm-1 indicating major functional groups that
mainly contribute the synthesis of nanoparticles. XRD
pattern of AuNPs and AgNPs were interpreted and indexed
as (111) (200) and (220) of faced centered cubic (fcc)
lattice. Chandrakasan et al. [34] have also found that both
123
 Author's personal copy
Fig. 9 a Zeta potential values of KPR-8B AuNPs and b particle size distribution of KPR-8B AuNPs
the AgNPs and AuNPs were polydispersed in nature,
revealing fine configuration of spherical NPs with the size
range of 10–30 nm. Presently, the HRTEM micrographs
showed the sizes of nanoparticles from 14 to 46 nm for
AuNPs and 17 to 40 nm for AgNPs. Similarly, the bac-
terium Klebsiella pneumoniae produced the AgNPs that
ranged between 28.2 and 122 nm with an average size of
52.5 nm [36]. El-Shanshoury et al. [37] have also sup-
ported through R. capsulata derived AuNPs with spherical
123
D. Aiswarya et al.
morphology with the size range of 10–20 nm and they also
observed at similar lower metal ion concentration.
In agriculture, chemical pesticides and weedicides are
being widely used to control pests and weeds for increasing
crop yield. But, also they were damaging the soil health by
overexploitation. Nano-pesticide is an agrochemical com-
bination used to overcome the problems caused by con-
ventional pesticides [38]. Of late, several types of materials
viz., surfactants, organic polymers and minerals which fall
 Author's personal copy
Biosynthesis of Gold and Silver Nanoparticles from the Symbiotic Bacterium, Photorhabdus…

Fig. 10 a Zeta potential values of KPR-8B AgNPs and b particle size distribution of KPR-8B AgNPs

in the nanometer size have been utilized for nano-pesti-
cides formulation [39]. The new generation nanopesticides
are field and target specific one in action against insects and
which could not produce any harm to other agriculturally
important insects in the soil [40, 41]. Aedes aegypti, A.
stephensi and C. quinquefasciatus are the major urban
vectors of malaria, dengue and lymphatic filariasis,
respectively. These diseases damage the Indian economy
every year [42, 43]. In larval stage, mosquitoes have less

123
 Author's personal copy
D. Aiswarya et al.

A. aegypti bacterium, P. luminescens TTO DSM15139 [47] and

100 A. stephensi Xenorhabdus nematophilus ATCC 19061 [48] suspensions
C. quinquefasciatus were found to be highly toxic to the 3rd instar larvae of A.
80
aegypti. Also, Vani and Lalithambika [49] have recorded a
% of mortality

60 maximum mortality (93.32%) against 3rd instar larvae of

A. gambiae when exposed to protein isolated from
40 Xenorhabdus strains. The earlier studies reported that the
protein toxins isolated from X. nematophilus strain A24
20 showed high toxic effect, when injected to G. mellonella
and Helicoverpa armigera [50, 51]. Similar findings were
0
0.625 1.25 2.50 5 10 earlier reported, Yooyangket et al. [52] have evaluated the
Concentration of KPR-8B AuNPs (µg/ml)
toxicity of Xenorhabdus and Photorhabdus isolates against
A. aegypti and A. albopictus larvae. They found the highest
Fig. 11 Percentage mortality of A. aegypti, A. stephensi, and C. larval mortality of A. aegypti (99%) and A. albopictus
quinquefasciatus using KPR-8B AuNPs (98%) after 96 h of exposure with X. stockiae and P.
luminescens, respectively. Therefore, the present larvicidal
100 potential from the EPN’s symbiotic P. luminescens sup-
A. aegypti
A. stephensi ports strongly as a bio-controlling agent with their active
80
C. quinquefasciatus extracellular protein or enzymes.
% of mortality

60 Nanoparticles have wide applications in medicine, drug

40
20
0
0.625 1.25 2.50 5 10
Concentration of KPR-8B AgNPs ( µg/ml)
Fig. 12 Percentage mortality of A. aegypti, A. stephensi, and C.
quinquefasciatus using KPR-8B AgNPs
mobility in breeding habitat, so formulating the control
measures at this stage is comparatively easy [44].
The presently selected ecofriendly symbiotic bacterium,
KPR-8B derived materials was attempted against the vec-
tors, Aedes, Anopheles and Culex species. In such a way,
the present P. luminescens was subjected to explore its
larvicidal potentiality against the three different vectors.
Presently, the larvicidal effect of KPR-8B synthesized
AuNPs and AgNPs was evaluated on the 4th instar larvae
of A. aegypti, A. stephensi and C. quinquefasciatus. Gen-
erally, the 4th instar larvae are considered to be more
immune-competency than the younger larvae [45]. From
the larvicidal bioassays, KPR-8B derived AgNPs showed
maximum larvicidal effect with the lethal concentrations
(LC) at the LC50 values of (lg/ml): 7.213 and LC90 values
of (lg/ml): 31.232, against A. aegypti. The recorded inhi-
bitory concentrations of KPR-8B derived AuNPs resulted
the significant lethal concentrations (lg/ml) LC50; 5.041
and LC90; 28.657 against A. aegypti, respectively. Already,
Silva et al. [46] have reported that the entomopathogenic
delivery and most importantly, it can be used as a pesticide
against various pests [53]. In earlier report of Barik et al.
[54] recommended the utilization of nano-silica as a
nanopesticide. Likewise, Rouhani et al. [55] have deter-
mined the efficacy of silica (LC50-0.68 g kg-1) and silver
nanoparticles (LC50-2.06 g kg-1) on larvae of Callosor-
bruchus maculates in the seeds of cowpea. Interestingly,
Goswami et al. [56] have also investigated the applications
of different kind of nanoparticles viz., silver, aluminium,
zinc oxide and titanium dioxide against the rice weevil
Sitophilus oryzae. Chakravarthy et al. [57] have evaluated
the efficacy of the DNA-tagged gold nanoparticles on the
Spodoptera litura and which caused 50% mortality at the
concentration of 500 ppm. Euphorbia prostrate mediated
silver nanoparticles were used against the adults of S.
oryzae, which resulted no fresh infestation in the
nanoparticles stored rice [58]. Kamaraj et al. [59] have
evidenced the growth reduction and development of H.
armigera and Spodoptera litura larvae when fed exclu-
sively on neem gum nano formulations (NGNF) treated
castor leaves. Likewise, the presently synthesized KPR-8B
AuNPs and AgNPs showed high mortality on G.
mellonella.
Conclusions
To conclude, during the present study, the gold and silver
nanoparticles (AuNPs and AgNPs) were successfully syn-
thesized using the supernatant of the symbiotic bacterium,
P. luminescens KPR-8B strain of entomopathogenic
nematode, H. indica. The presently utilized sources are cost
effective, biocompatible, eco-friendly and is useful for an

123
 Author's personal copy
Biosynthesis of Gold and Silver Nanoparticles from the Symbiotic Bacterium, Photorhabdus…

Table 2 Larvicidal activities of AuNPs KPR-8B against fourth instar larvae of A. aegypti, A. stephensi, and C. quinquefasciatus at 24 h
observation
Mosquito larvae Concentration AuNPs KPR- Mortality (%) ± SD LC50 lg/ml (LCL– LC90 lg/ml (LCL– v2
8B UCL) UCL) (df = 4)*

0.625 33.33±1.53 5.041 (2.78–20.31) 28.657 (4.92–60.34) 5.0

1.25 57.33±2.08
A. aegypti 2.50 74.67±0.58
5 85.33±1.53
10 93.33±0.58
0.625 30.67±1.53 7.435 (3.17–44.96) 32.481 (11.99–86.09) 4.8
1.25 44±1
A. stephensi 2.50 61.33±0.58
5 72.33±1.53
10 83±1.73
0.625 26.67±1.53 6.312 (4.23–37.80) 31.453 (7.09–79.69) 4.8
1.25 49.33±2.08
C. 2.50 64±1
quinquefasciatus
5 77.33±1.53
10 90.67±0.58
No mortality was observed in the control
LC50 = lethal concentration that kills 50% of the exposed organisms, LC90 = lethal concentration that kills 90% of the exposed organisms, LCL=
lower confidence limit, UCL = upper confidence limit, v2 = Chi square value df = degrees of freedom
*Significant at P \ 0.05 level

Table 3 Larvicidal activities of AgNPs KPR-8B against fourth instar larvae of A. aegypti, A. stephensi, and C. quinquefasciatus at 24 h
observation
Mosquito larvae Concentration AgNPs KPR- Mortality (%) ± SD LC50 lg/ml (LCL– LC90 lg/ml (LCL– v2
8B UCL) UCL) (df = 4)*

0.625 22.67±1.55 5.04 (2.78–10.31) 12.65 (4.92–20.34) 4.8

1.25 38.67±2.52
A. aegypti 2.50 40±2
5 56±1
10 73.33±1.53
0.625 16±1 12.55 (3.17–14.96) 23.61 (11.99–46.09) 5.0
1.25 30.67±1.15
A. stephensi 2.50 38.67±1.53
5 46.67±0.58
10 61.33±1.53
0.625 20±1.73 7.46 (4.23–17.80) 15.00 (7.09–26.69) 4.8
1.25 32±1
C. 2.50 37.33±1.53
quinquefasciatus
5 54.67±1.53
10 70.67±2.08
No mortality was observed in the control
*Significant at P \ 0.05 level
LC50 = lethal concentration that kills 50% of the exposed organisms, LC90 = lethal concentration that kills 90% of the exposed organisms,
LCL =lower confidence limit, UCL = upper confidence limit, v2 = Chi square value df = degrees of freedom

123
 Author's personal copy
alternative type of eco-friendly insect pest management
programme.
Acknowledgements The first author, D. Aiswarya, is grateful to the
Department of Science and Technology (DST-INSPIRE), Govern-
ment of India, New Delhi for providing financial support for this
study (IF150082). We would like to thank ICMR-Vector Control
Research Laboratory, Madurai, India, for providing mosquito larvae.
The authors are grateful to Sophisticated Test and Instrumentation
Centre (STIC), Cochin University of Science and Technology,
Cochin, India for providing XRD, FTIR and HRTEM analyses.
References
1. N. E. H. Djeghader, L. Aı̈ssaoui, K. Amira, and H. Boudjelida
(2018). Int. J. Mosq. Res. 5, 1.
2. World Health Organization A Global Brief on Vector-Borne
Diseases (WHO, Geneva, 2014).
3. R. B. Salunkhe, S. V. Patil, C. D. Patil, and B. K. Salunke (2011).
Parasitol. Res. 109, 823.
4. N. G. Das, M. Bhuyan, and S. C. Das (2008). Indian J. Malariol.
37, 88.
5. W. M. Hominick in R. Gaugler (ed.), Entomopathogenuc
Nematology (CABI Publishing, New York, 2002), p. 115.
6. Y. Wang and R. Gaugler (1998). J. Invertebr. Pathol. 72, 313.
7. P. Muangpat, T. Yooyangket, C. Fukruksa, M. Suwannaroj, T.
Yimthin, S. Sitthisak, N. Chantratita, A. Vitta, N. J. Tobias, H.
B. Bode, and A. Thanwisai (2017). Front Microbiol. 8, 1142.
8. H. B. Bode (2009). Curr. Opin. Chem. Biol. 13, 224.
9. S. Laurent, J. L. Bridot, L. V. Elst, and R. N. Muller (2010).
Future Med. Chem. 2, 427.
10. Y. Ju-Nam and J. R. Lead (2008). Sci. Total Environ. 400, 396.
11. P. Jeevan, K. Ramya, and A. E. Rena (2012). Indian J Biotechnol.
11, 72.
12. G. Sharma, N. D. Jasuja, M. Kumar, and M. I. Ali (2015). J.
Nanotechnol. https://doi.org/10.1155/2015/132675.
13. S. Honary, H. Barabadi, E. Gharaei-Fathabad, and F. Naghibi
(2012). Dig. J. Nanomater. Biostruct. 7, 999.
14. P. P. Gan and S. F. Li (2012). Rev. Environ. Sci. Biol. 11, 169.
15. K. Kalishwaralal, S. BarathManiKanth, S. R. Pandian, V. Dee-
pak, and S. Gurunathan (2010). Colloids Surf. B 79, 340.
16. T. Klaus, R. Joerger, E. Olsson, and C. G. Granqvist (1999).
Proc. Natl. Acad. Sci. 96, 13611.
17. M. Saravanan, A. K. Vemu, and S. K. Barik (2011). Colloids
Surf. B 88, 325.
18. S. Rajeshkumar, C. Malarkodi, M. Vanaja, and G. Annadurai
(2016). J. Mol. Struct. 1116, 165.
19. K. Tamura, G. Stecher, D. Peterson, A. Filipski, and S. Kumar
(2013). Mol. Biol. Evol. 30, 2725.
20. World Health Organization Guidelines for Laboratory and Field
Testing of Mosquito Larvicides (WHO, Geneva, 2005).
21. W. S. Abbott (1925). J. Econ. Entomol. 18, 265.
22. M. Gnanadesigan, M. Anand, S. Ravikumar, M. Maruthupandy,
V. Vijayakumar, S. Selvam, M. Dhineshkumar, and A. K. Ku-
maraguru (2011). Asian Pac. J. Trop. Med. 4, 799.
23. D. J. Finney Probit Analysis, vol. 60 (Cambridge University
Press, Cambridge, 1971), p. 1432.
24. M. Yosri, M. M. Abdel-Aziz, and R. M. Sayed (2018). J. Radiat.
Res. Appl. Sci. 11, 328.
25. G. Benelli, F. Maggi, R. Pavela, K. Murugan, M. Govindarajan,
B. Vaseeharan, R. Petrelli, L. Cappellacci, S. Kumar, A. Hofer,
and M. R. Youssefi (2017). Environ. Sci. Pollut. Res. https://doi.
org/10.1007/s11356-017-9752-4.
123
D. Aiswarya et al.
26. R. Kumar and J. S. Hwang (2006). Zool. Stud. 45, 447.
27. G. Benelli and M. F. Duggan (2018). Acta Trop. 182, 80.
28. W. Aktar, D. Sengupta, and A. Chowdhury (2009). Interdiscip.
Toxicol. 2, 1.
29. J. C. Beier, J. Keating, J. I. Githure, M. B. Macdonald, D.
E. Impoinvil, and R. J. Novak (2008). Malar. J. 7, S4. https://doi.
org/10.1186/1475-2875-7-S1-S4.
30. M. Govindarajan, A. Jebanesan, and D. Reetha (2005). Trop.
Biomed. 22, 3.
31. B. Gulcu, H. Cimen, R. K. Raja, and S. Hazir (2017). Biopestic.
Int. 13, 79.
32. C. Mathur, J. Kushwah, V. S. Somvanshi, and T. K. Dutta (2018).
Toxicon 154, 69.
33. R. Shawer, I. Donati, A. Cellini, F. Spinelli, and N. Mori (2018).
Insects 9, 148.
34. G. Chandrakasan, P. Seetharaman, S. Gnanasekar, M. Kadark-
arai, and S. Sivaperumal (2017). Artif. Cell. Nanomed. B 45,
1675.
35. V. Vignesh, G. Sathiyanarayanan, G. Sathishkumar, K. Parthiban,
K. Sathish-Kumar, and R. Thirumurugan (2015). RSC Adv. 5,
27794.
36. R. C. Murdock, L. Braydich-Stolle, A. M. Schrand, J. J. Schlager,
and S. M. Hussain (2008). Toxicol. Sci. 101, 239.
37. A. E. El-Shanshoury, S. E. ElSilk, and M. E. Ebeid (2011). ISRN
Nanotechnol. https://doi.org/10.5402/2011/385480.
38. Y. Sasson, G. Levy-Ruso, O. Toledano, and I. Ishaaya Insecti-
cides Design Using Advanced Technologies (Springer, Berlin,
2007), pp. 1–39.
39. H. A. El-Sadawy, A. H. El Namaky, E. E. Hafez, B. A. Baiome,
A. M. Ahmed, H. M. Ashry, and T. H. Ayaad (2018). Trop.
Biomed. 35, 392.
40. M. Kah, S. Beulke, K. Tiede, and T. Hofmann (2013). Crit. Rev.
Environ. Sci. Technol. 43, 1823.
41. M. Tripathi, S. Kumar, A. Kumar, P. Tripathi, and S. Kumar
(2018). Int. J. Curr. Microbiol. Appl. Sci. 7, (special issue), 196.
42. M. Govindarajan, M. Rajeswary, U. Muthukumaran, S. L. Hoti,
H. F. Khater, and G. Benelli (2016). J. Photochem. Photobiol.
B Biol. 161, 482.
43. M. Govindarajan, M. Rajeswary, and G. Benelli (2016). Eco-
toxicol. Environ. Saf. 129, 85.
44. M. Govindarajan, S. L. Hoti, M. Rajeswary, and G. Benelli
(2016). Parasitol. Res. 115, 2685.
45. P. Deepak, R. Sowmiya, R. Ramkumar, G. Balasubramani, D.
Aiswarya, and P. Perumal (2017). Artif. Cell Nanomed.
Biotechnol. 45, 990.
46. O. S. da Silva, G. R. Prado, J. L. da Silva, C. E. Silva, M. da
Costa, and R. Heermann (2013). Parasitol. Res. 112, 2891.
47. M. Fischer-Le Saux, V. Viallard, B. Brunel, P. Normand, and N.
E. Boemare (1999). Int. J. Syst. Evol. Microbiol. 49, 1645.
48. G. M. Thomas and G. O. Poinar (1979). Int. J. Syst. Evol.
Microbiol. 29, 352.
49. C. Vani and B. Lalithambika (2014). Int. J. Pharm. Biol. Sci. 5,
1072.
50. P. Khandelwal and N. Banerjee-Bhatnagar (2003). Appl. Environ.
Microbiol. 69, 2032.
51. H. Hawlena, F. Bashey, and C. M. Lively (2010). Evol. Int.
J. Organ. Evol. 64, 3198.
52. T. Yooyangket, P. Muangpat, R. Polseela, S. Tandhavanant, A.
Thanwisai, and A. Vitta (2018). PLoS ONE 13, e0195681.
53. D. Chauhan and N. S. Mishra Insect Pest Management Emerging
Trends in Agri-nanotechnology: Fundamental and Applied
Aspects, vol. 282 (CABI, Wallington, 2018).
54. T. K. Barik, B. Sahu, and V. Swain (2018). Parasitol. Res. 103,
253.
55. M. Rouhani, M. A. Samih, and S. Kalantari (2012). J. Entomol.
Res. 4, 297.
 Author's personal copy
Biosynthesis of Gold and Silver Nanoparticles from the Symbiotic Bacterium, Photorhabdus…

56. N. Goswami and D. K. Sharma (2010). Physica E 42, 1675. Publisher’s Note Springer Nature remains neutral with regard to
57. A. K. Chakravarthy, S. B. Kandakoor, B. Atanu, K. Dhanabala, jurisdictional claims in published maps and institutional affiliations.
K. Gurunatha, and P. Ramesh (2012). Curr. Biotica 6, 271.
58. A. A. Zahir and A. A. Rahuman (2012). Vet. Parasitol. 187, 511.
59. C. Kamaraj, P. R. Gandhi, G. Elango, S. Karthi, I. M. Chung, and
G. Rajakumar (2018). Int. J. Biol. Macromol. 107, 59.

123