jmb

J. Microbiol. Biotechnol. (2014), 24(7), 879–887

http://dx.doi.org/10.4014/jmb.1401.01016 Research Article

Review

Successful Enrichment of Rarely Found Candidatus Anammoxoglobus

propionicus from Leachate Sludge
Shu-Chuan Hsu, Yen-Chun Lai, Ping-Heng Hsieh, Pun-Jen Cheng, Suen–Shin Wong, and
Chun-Hsiung Hung*
Department of Environmental Engineering, National Chung Hsing University, Taichung 402, Taiwan

Received: January 9, 2014

Revised: March 4, 2014
Accepted: April 3, 2014
First published online
April 7, 2014
*Corresponding author
Phone: +886-4-22840441;
Fax: +886-4-22862589;
E-mail: badger@nchu.edu.tw
pISSN 1017-7825, eISSN 1738-8872
Copyright © 2014 by
The Korean Society for Microbiology
and Biotechnology
Bacteria that mediate the anaerobic oxidation of ammonium (anammox) have been detected in
natural ecosystems, as well as various wastewater treatment systems. In this study, sludge
from a particular landfill leachate anaerobic treatment system was selected as the incubation
seed for anammox microorganism enrichment owing to its possible anammox activity.
Transmission electron microscopy observation, denaturing gradient gel electrophoresis
analysis, and cloning/sequencing techniques were applied to identify the diversity of
anammox microorganisms throughout the incubation. During the early stage of operation, the
diversity of anammox microorganisms was similar to the original complex microbes in the
seed sludge. However, as incubation time increased, the anammox microorganism diversity
within the system that was originally dominated by Candidatus (Ca.) Brocadia sp. was replaced
by Ca. Anammoxoglobus propionicus. The domination of Ca. Anammoxoglobus propionicus
produced a stable removal of ammonia (70 mg-N/l) and nitrite (90 mg-N/l), and the total
nitrogen removal efficiency was maintained at nearly 95%. The fluorescence in situ
hybridization results showed that Ca. Anammoxoglobus propionicus was successfully enriched
from 1.8 ± 0.6% initially to 65 ± 5% after 481 days of operation. Therefore, the present results
demonstrated the feasibility of enriching Ca. Anammoxoglobus propionicus from leachate
sludge, even though the original cell count was extremely low. Application of this seldom
found anammox organism could offer an alternative to current ammonia-nitrogen treatment.
Keywords: Anammox, Ca. Anammoxoglobus propionicus, PCR-DGGE, primer, TEM

Introduction Ca. Jettenia asiatica, Ca. Kuenenia stuttgartiensis, Ca. Scalindua

Anaerobic ammonium oxidation (anammox) was recently
developed as a biological wastewater treatment technology
and has also become a potential solution for the removal
of nitrogenous contaminants from wastewater [8, 15].
Microorganisms that catalyze this reaction have been
identified as anammox bacteria, which are chemolithoautotrophic
microorganisms that conserve energy by oxidizing ammonium
with nitrite as an electron acceptor under anaerobic
conditions. Anammox bacteria compose a distinct, deep
branching phylogenetic group in the order Planctomycetales;
five genera of anammox bacteria have already been described
and provisionally named Candidatus (Ca.) Anammoxoglobus
propionicus, Ca. Brocadia anammoxidans, Ca. Brocadia fulgisa,
wagneri, Ca. Scalindua sorokinii, and Ca. Scalindua brodae [2,
11, 20]. Anammox bacteria are characterized by their
extremely slow growth rate; the doubling time of anammox
bacteria ranges from 5 to 30 days [17, 25, 28]. Recent studies
have also revealed that some of these microorganisms can
use organic acids as electron donor and undergo anammox
[6, 11, 26].
Anammox bacteria can be found in many ecosystems,
including agricultural soils, contaminated porous aquifers,
freshwater and marine sediments, hot springs, lakes,
lakeshores, marshes, oxygen minimum zones, and wastewater
treatment plants [7, 9, 13, 14, 18, 23]. Yet, different
anammox species are rarely found in the same ecosystem,
and there are large phylogenetic distances between different

July 2014 ⎪ Vol. 24 ⎪ No. 7

880 Hsu et al.
species as members of Planctomycetales [11]. For example,
Ca. Brocadia anammoxidans and Ca. Kuenenia stuttgartiensis
were found to coexist in a leachate-treating rotating disk
contactor, and approximately 15% of the nitrite utilized
during autotrophic growth was converted to nitrate [5]. Xiao
et al. [34] also confirmed that Ca. Kuenenia stuttgartiensis
was an anammox microorganism thriving in a landfill
leachate treated in a sequencing batch biofilm reactor.
Yapsakli et al. [35] subsequently established that Ca.
Kuenenia stuttgartiensis is the major nitrogen converter in
leachate treatment plants. Daverey et al. [4] also demonstrated
the simultaneous occurrence of partial nitrification, anaerobic
ammonium oxidation, and denitrification in a landfill
leachate treated under a single partially aerated bioreactor,
and indicated that Ca. Kuenenia stuttgartiensis was one of
the dominant species in the reactor.
In our previous study, we monitored the composition of
biogas from a leachate treatment anaerobic tank located in
central Taiwan and found high concentrations of N2 in its
off-gas aside from methane. This rare phenomenon
prompted our interest to examine the possible existence of
anammox bacteria in that particular system. Initial results
confirmed the existence of anammox microorganisms, but
with low cell counts (data not shown). Accordingly, in the
present study, a laboratory-scale batch reactor designed to
operate in an autotrophic anammox mode was operated to
enrich the anammox microorganisms using this leachate
sludge as the initial seed. The anammox bacteria in this
enrichment were characterized, and their physiological
characteristics compared with those of previously reported
anammox bacteria. A regular water quality analysis,
denaturing gradient gel electrophoresis (DGGE), cloning,
and transmission electron microscopy (TEM) were also
applied to explore the microbial community composition.
Materials and Methods
Enrichment and Cultivation of Anammox Bacteria
A laboratory-scale batch-mode reactor (blood vase, 900 ml
culture volume, 100 ml headspace) was used to enrich and culture
Table 1. Summary of 16S rRNA gene-based PCR primers used to detect anammox bacteria in this study.
Primer Specificity group
PLA46F Planctomycetales
Amx368R All anammox bacteria
Amx368F All anammox bacteria
Amx820R Kuenenia stuttgartiensis/ Brocadia anammoxidans,
Brocadia fulgida
a
16S rRNA position according to Escherichia coli numbering.
J. Microbiol. Biotechnol.
the anammox bacteria. Sludge collected from a local landfill
leachate anaerobic treatment system (treating 500 mg-N/l NH4+–N)
was used as the seeding. This landfill is used for the disposal of
domestic wastes, yet unusually high concentrations of nitrogen
gas have been measured in its anaerobic tank off-gas, indicating
potential anammox activity. For each batch, the reactor was filled
with 900 ml of a mineral medium consisting of (NH4)2SO4 (0.778 g),
NaNO2 (0.739 g), KHCO3 (1.25 g), NaH2PO4 (0.06 g), MgSO4·7H2O
(0.2 g), CaCl2·2H2O (0.3 g), FeSO4 (0.00625 g), EDTA (0.00625 g),
HCl (1 M, 1 ml), and 1 ml of a trace element solution II [28] per
liter of demineralized water. Once the gas production for each
batch operation stopped completely, a fresh medium was added
to replace the used medium without wasting any biomass.
Overall, each batch lasted for an average of 20 days. The
headspace was backfilled at 25 ml/min with 95% Ar-5% CO2 for
10 min to maintain anoxic conditions. The pressure of the
headspace was maintained slightly higher than atmospheric
pressure. The reactor was then sealed with silicone stoppers. The
pH was set at 7 to 8 and then measured and adjusted with
hydrochloric acid. The temperature was not controlled and set at
room temperature (27°C to 30°C). The concentrations of NH4+–N,
NO2−–N, and NO3−–N were measured using colorimetric methods
according to standard procedures [3].
Fluorescence In Situ Hybridization (FISH)
For the FISH analysis, this study used a Cy3-labeled oligonucleotide
probe targeting Ca. Anammoxoglobus propionicus to investigate the
anammox bacteria. The hybridizations with fluorescent probes
were performed as described by Zilles et al. [36]. The total cell
counts were determined by DAPI staining, plus a probe S-*-Apr-
0820-a-A-21 targeting Ca. Anammoxoglobus propionicus and 40%
formamide concentration were used for the hybridization experiment
[11]. A total of ten FISH images were taken of the same hybridization
sample to determine the average ratio of anammox bacteria to
total bacteria.
DNA Extraction, Polymerase Chain Reaction (PCR), and DGGE
The total DNA was extracted from each enrichment culture
sample (approximately 1 ml) using an UltraClean Soil DNA Isolation
Kit (MOBIO, Solana Beach, USA), following the manufacturer’s
instructions. The 16S rRNA gene fragments from the extracted
total DNA were then amplified with Taq DNA polymerase
(GoTAq Green Master Mix; Promega, Madison, USA) using the
Sequence (5’-3’) Target sitea References
GGATTAGGCATGCAAGTC 46-63 [16]
CCTTTCGGGCATTGCGAA 368-385 [22]
TTCGCAATGCCCGAAAGG 368-385 [22]
AAAACCCCTCTACTTAGTGCCC 799-820 [20]
 Enrichment of Anammox Microorganism from Leachate 881

bacteria and all anammox bacteria specific primer set Pla46F-

Amx368R [16, 22], as shown in Table 1. The PCR products were
electrophoresed on a 1.5% (w/v) agarose gel. The DGGE was
conducted at 60°C in 1× TAE buffer at 80 V for 12 h on a Dcode
system (Bio-Rad Laboratories) with a 6% polyacrylamide gel and
20% to 80% denaturant gradient. The gels were stained for 10 min
with ethidium bromide and visualized with UV radiation. After
visualization under UV transillumination, specific gel bands were
excised using a sterilized scalpel. Upon confirmation of the excisions
as single bands via a secondary DGGE run, the bands were re-
amplified and then sequenced.

Cloning and Phylogenetic Analysis

The amplified PCR products were cloned using a TA Cloning
Kit (Yeastern Biotech, Taiwan), following the manufacturer’s
instructions. Selected PCR products were then further distinguished
using DGGE analysis under previously described conditions to
obtain the operational taxonomic units (OTUs). All the PCR
products with different compositions were subjected to further
sequencing (Mission Biotech, Taiwan). The isolated anammox
bacterial cultures were identified by comparing their 16S rRNA
gene sequences with those in available databases using the BLAST
software on the NCBI website [1]. Phylogenetic trees were
constructed based on the neighbor-joining method using a Fig. 1. Variation of nitrogen compounds in the batch reactor.
molecular evolutionary genetics analysis package (MEGA ver. 4). Each set of points indicates initial and final concentrations for each
The robustness of the phylogeny was tested using a bootstrap batch test, ammonium (initial ( ■ ) and final ( □ )), nitrite (initial ( ▲ )
analysis with 1,000 iterations. The isolated and clone sequences and final ( △ )), and nitrate (initial ( ◆ ) and final ( ◇ )).
used in this study can be retrieved from the GenBank database
under accession number KC862502.
During the start-up period (1 to 60 days), the nitrogen removal
Transmission Electron Microscopy (TEM)
rates fluctuated between 11% and 30%. The removal rates
The samples from the reactor were fixed in a 2% glutaraldehyde
of ammonia and nitrite reached nearly 100% after 2 months
solution in a 0.1% phosphate buffer (pH 6.8 to 7.4) for 2 to 4 h at
of operation. An increase in the removal rates of ammonia
room temperature. Next, they were fixed with 1% osmium acid
for 2 to 4 h after cleaning with a phosphate buffer solution (0.1%,
and nitrite was accompanied with a significant amount of
pH 6.8 to 7.4). The samples were then dehydrated through a nitrogen gas production. The gas production increased
graded series of 50%, 70%, 85%, 95%, and 100% ethanol. Thereafter, from 70 to 100 ml and then to 200 ml per batch
the samples were treated with pure ethanol for 30 min, and then (approximately 20 days for one batch). The highest gas
treated with a mixture of a coating agent and ethanol [1:1 (v/v)] yield was 300 ml for one batch. Approximately 8 ± 1 to
overnight at 4°C. Afterward, the samples were infiltrated using a 13 ± 2 mg-N/l of nitrate was accumulated from day 88 to
pure coating agent and left overnight at 70°C. Ultrathin sections of day 286. Thereafter, the system became more stable and the
70 to 90 nm in size were obtained using a Reichert microtome. removal rates of ammonia and nitrite were maintained at
These sections were stained with a lead citrate solution and uranyl approximately 100%. The concentration of nitrate during
acetate in a 50% saturated ethanol solution for 15 min. Finally, the
the final period ranged from 12 ± 9 to 27 ± 9 mg-N/l. The
samples were observed under a transmission electron microscope
ratios of the average ammonium consumption to nitrite
(JEOL JEM-1400, Japan).
conversion to nitrate production ranged from 1:1.3:0.3 and
1:1.1:0.5 between day 88 to day 286 and day 286 to day 504,
Results and Discussion
respectively. The overall stoichiometric nitrate production,
nitrite utilization, and ammonium removal ratio also
Reactor Operation and Nitrogen Removal During Cultivation
agreed with the predicted ratio, 1:1.32:0.26, from a previous
The concentration profiles of ammonium, nitrite, and
study [25]. As shown in Fig. 1, the concentration of nitrate
nitrate from the batch reactor operation are shown in Fig. 1.
during the final period suddenly increased to 98 mg-N/l

July 2014 ⎪ Vol. 24 ⎪ No. 7

882 Hsu et al.
on day 312. This result can be attributed to cracking of the
reactor wall, which allowed oxygen to enter the reactor.
This disturbance was avoided after the reactor was fixed.
Thus, overall, anammox activity was successfully established
during the 500 days of operation when using leachate
sludge as the seed.
In biological nitrogen removal, nitrogen compounds can
be involved in five biological processes; namely, ammonium
oxidation, nitrite oxidation, denitrification, dissimilatory
nitrate reduction to ammonium (DNRA), and anammox. In
the batch reactor operated in this study, the enrichment
was maintained under anoxic conditions. Thus, nitrification
(including ammonium oxidation and nitrite oxidation) was
not involved. Therefore, when estimating the nitrogen
balance in the reactor, it was assumed that anammox,
denitrification, and DNRA were all involved in the
conversion of nitrogen. The quantity of nitrogen consumed
by anammox and denitrification was then modeled based
on the corresponding stoichiometric equations. The initial
feeding concentrations of ammonia, nitrite, and nitrate
were 59 ± 1, 78 ± 2, and 20 ± 1 mg-N/l, respectively. The
initial feeding of chemical oxygen demand (COD) was 28 ±
2 mg/l as O2. After the operation, the final concentrations
of ammonia, nitrite, and nitrate were 0.1, 0.1, and 21 ±
2 mg-N/l, respectively. The TN removal rate was maintained
at 86%, and approximately 120 ml of nitrogen gas was
produced. The final COD value was measured to be
20 ± 2 mg/l as O2.
Thus, the following stoichiometric relationships were
assumed for the various biological activities occurring in
the reactor: (i) the molar ratio of NH4+-N : NO2−-N
consumed in anammox is 1:1.32, which produces 0.26 mol
of NO3−-N, as shown in Eq. (1) [12, 27, 30]; (ii) theoretically,
denitrification can utilize 1.6 mol of NO3−-N per mole of
COD consumption, as shown in Eq. (2) [32]. The average
values from two batch tests were used for the following
modeling. The final concentration of NH4+-N and NO2−-N
was 0.1 mg-N/l after anammox, and 15 mg-N/l of NO3−-N
was produced. Therefore, TN changed from 157 mg-N/l to
35.2 mg-N/l (initial nitrate 20 mg-N/L plus 15 mg-N/l was
produced); that is, anammox removed approximately 77%
TN in the reactor and should produce 105 ml of nitrogen
gas. COD is used by heterotrophic bacteria as a carbon and
energy source during denitrification. Thus, since the
concentration of final COD was 20 mg/l as O2, it was
assumed that 8 mg/l as O2 of the COD was utilized by the
system for denitrification. Consequently, the process only
produced 3 ml of nitrogen gas when consuming 3 mg-N/l
of nitrate. In summary, if anammox and denitrification
J. Microbiol. Biotechnol.
were the only two reactions occurring in the system, 108 ml
of nitrogen gas would have been produced, and a final
nitrate concentration of 32 mg-N/l would have been
obtained. Therefore, the difference between the final
measured nitrate value of 21 mg-N/l and the calculated
nitrate value of 32 mg-N/l suggests the existence of a third
reaction in addition to anammox and denitrification. In
previous research, it was found that anammox microorganisms
could reduce nitrate to ammonium [10, 29]. Hence, the
11 mg-N/l gap between the final measured NO3−-N
concentration (21 mg-N/l) and the modeling results
(32 mg-N/l) could be attributed to the consumption of
NO3−-N through dissimilatory nitrite reduction by anammox.
If DNRA utilized 1 mol of NO3−-N per mole of NO2−-N or
NH4+-N [10], then an extra 10 ml of N2 gas should have
been obtained through anammox. In this study, approximately
120 ml of gas was actually produced, which agreed with
the calculated value of 118 ml [105 ml (anammox) + 3 ml
(denitrification) + 10 ml (DNRA)]. These stoichiometric
calculations of NH4+-N, NO2−-N, and the NO3−-N concentrations
matched well with the corresponding final measured batch
concentrations. Therefore, the results confirmed that the
main nitrogen removal mechanism in the reactor was
anammox.
NH4+ + 1.32 NO2− + 0.066 HCO3− + 0.13 H+ → 1.02 N2 +
0.26 NO3− + 0.066 CH2O0.5N0.15 + 2.03 H2O (1)
C1.6H3.3O1.1N0.02 + 1.6 NO3− → 0.8 N2 + 1.6 CO2 + 1.1 H2O +
0.02 NH3 + 1.6 OH− (2)
DGGE Analysis of Enrichment Microbial Community
16S rRNA-based PCR–DGGE technology was also used
to investigate the microbial succession of the bacterial
community during the long-term experimental period
using leachate sludge from a local landfill as the seed. The
existence of an anammox bacterial community was verified
from the PCR-DGGE profile using the primer set Pla46F/
Amx368R targeting members of Planctomycetales [16, 21].
In the seeding sludge, seven to eight PCR-amplified DNA
bands were detected (Fig. 2). This anammox bacterial
community in the original leachate sludge comprised Ca.
Brocadia sp. 40, Ca. Kuenenia sp., and some unidentified
anammox microorganisms. After 46 days of operation, most
of the Planctomycetales microorganisms were eliminated
from the reactor during the incubation. As shown in Fig. 2,
only one clear PCR-DGGE band existed after the first
month of operation. The PCR product of this particular
band was carefully removed from the gel and further

Fig. 2. DGGE profiles of PCR-amplified DNA fragment (~320 bp)
using primers Pla46F/Amx368R.
purified. The purified PCR product was sequenced and
identified to have 98% similarity to Ca. Brocadia sp. 40
(AM285341.1). This significant change in the Planctomycetales
diversity may have been due to the selection effect of the
artificial medium or that the initial cell count of Ca. Brocadia
sp. was the highest in the seeding sludge. The incubation
was continued without changing any operational factor; as
a result, another clear PCR-DGGE band appeared after 2
months of operation and gradually became the only
Planctomycetales member throughout the operation (more
than 500 days). The PCR product sequence of this
particular DGGE band was identified to have 100%
similarity to Ca. Anammoxoglobus propionicus (DQ317601.1).
As a further investigation of the anammox microorganism
diversity shift, another PCR primer set, Amx368F/Amx820R
[20, 21], was used to target the 16S rRNA fragment of Ca.
Brocadia sp. and Ca. Kuenenia sp. that are often found in
leachate sludge samples. Although this primer set was
designed for detecting Ca. Brocadia sp. and Ca. Kuenenia sp.,
the results from this study showed that it could also
amplify some seldom found anammox microorganisms,
such as Ca. Anammoxoglobus propionicus in this case. Fig. 3
shows the PCR-DGGE profile using the second primer set
of Amx368F/Amx820R with the same sludge samples
collected during the 500-day operation. A similar diversity
shift was also found when using the second primer set.
During the startup stage, Ca. Brocadia sp. 40 was the major
anammox microorganism in the system, with a slight
signal of Ca. Brocadia caroliniensis. Ca. Anammoxoglobus
propionicus appeared in the system on day 74 and then
Enrichment of Anammox Microorganism from Leachate 883
Fig. 3. DGGE profiles of PCR-amplified DNA fragment (~450 bp)
using primers Amx368F/Amx820R.
slowly became one of the dominant anammox microorganisms
throughout the 500-day operation. Ca. Brocadia sp. 40 and
Ca. Anammoxoglobus propionicus coexisted from day 74 to
day 312. After this period, the only anammox microorganism
existing in the reactor was Ca. Anammoxoglobus propionicus.
These results agreed with the results from the previous
PCR-DGGE experiments using a more general Planctomycetales
primer set.
The anammox microorganisms in the reactor were also
explored using different molecular methods. The nitrogen
removal rate significantly increased when the bacterial
community diversity shifted from the initial frequently
found anammox bacteria, Ca. Brocadia sp. 40, Ca. Kuenenia
sp., and some unidentified anammox microorganisms, to a
seldom identified Ca. Anammoxoglobus propionicus. Thus,
after Ca. Anammoxoglobus propionicus became the dominant
anammox microorganism, stable nitrogen removal was
achieved, and the total nitrogen (TN) removal efficiency
was maintained at 95%. Moreover, the removal rates of
ammonia and nitrite increased from 16% to 92% and from
22% to 99.9%, respectively. The reason for this anammox
community shift is unclear. Ca. Anammoxoglobus propionicus
possibly existed in the original leachate sludge, yet its
viable cell number was too low to be detected. Once the
artificial medium was added and the reactor was operated
in a well-controlled environment, Ca. Anammoxoglobus
propionicus prevailed over other frequently found anammox
July 2014 ⎪ Vol. 24 ⎪ No. 7
884 Hsu et al.
microorganisms and became the dominant one. The rarely
found anammox microorganism Ca. Anammoxoglobus
propionicus is among the five representative anammox
species that have been reported. This bacterium was
originally found in a laboratory-scale bioreactor in the
presence of ammonium and propionate [11]. Interestingly,
since Ca. Anammoxoglobus propionicus can reduce nitrate
and/or nitrite to ammonium, this trait could provide Ca.
Anammoxoglobus propionicus a competitive advantage in
ammonium-limited natural ecosystems [11]. Kartal et al.
[10] also reported that Ca. Anammoxoglobus propionicus can
dominate over other anammox bacteria and heterotrophic
denitrifiers, acquiring most propionate as a supplementary
electron donor in the presence of ammonium. To date, only
a few studies have reported on Ca. Anammoxoglobus
propionicus being enriched from sludge from wastewater
treatment plants [11, 33]. Therefore, this study is the first to
report the successful enrichment of Ca. Anammoxoglobus
propionicus from leachate with no addition of propionate.
Quantification of Ca. Anammoxoglobus propionicus Using
FISH
During the incubation, Ca. Anammoxoglobus propionicus
slowly became the predominant anammox microorganism.
Until now, this microorganism has never been detected
from leachate sludge. To understand its contribution to
nitrogen removal, Ca. Anammoxoglobus propionicus was
quantified using hybridization targeting 16S rRNA. The
Fig. 4. FISH analysis of anammox bacteria.
All bacteria were monitored using DAPI (A, C, and E); Ca. Anammoxoglobus propionicus was hybridized with Cy3-labeled probe Apr820 (B, D, and
F). Samples A and B were cultured for 46 days, samples C and D for 88 days, and samples E and F for 481 days. Bar, 20 µm.
J. Microbiol. Biotechnol.
probe selection was based on a previous study by Kartal
et al. [11], which suggested that Ca. Anammoxoglobus
propionicus could be hybridized using the probe S-*-Apr-
0820-a-A-21. The anammox enrichment culture was examined
using FISH after 16 months. The results showed that 65% of
the bacterial population was hybridized with the Ca.
Anammoxoglobus propionicus Cy3-labeled probe S-*-Apr-
0820-a-A-21. Ca. Anammoxoglobus propionicus was enriched
from 1.8 ± 0.6% (day 46) to 15 ± 3% (day 88) and then to
65 ± 5% (day 481) (Fig. 4). The definite presence and likely
dominance of Ca. Anammoxoglobus propionicus were identified
in this study.
Phylogenetic Diversity of Anammox Microorganisms Using
Cloning
Thirty PCR product clones obtained by applying the
primer set Amx368F/1492R were randomly selected to
construct a 16S rDNA clone library of the anammox
bacterial community using sludge collected on day 481.
The obtained sequences could be grouped into three OTUs
based on more than 99% sequence similarity. The nearly
complete 16S rDNA sequence of a representative clone
from each OTU was analyzed and utilized for the
phylogenetic analysis. The three OTUs were found to be
affiliated with one phylum. The sequences of AR01 (28 out
of 30 clones), AR02 (1 out of 30 clones), and AR03 (1 out of
30 clones) demonstrated 99% similarity to Ca. Anammoxoglobus
propionicus (Fig. 5). The sequence similarity among the 28
 Enrichment of Anammox Microorganism from Leachate 885

Fig. 5. Phylogenetic tree representing the affiliation of 16S rRNA clone sequences of anammox bacteria with sludge in the reactor.
The tree was generated with approximately 1,000 bp of the 16S rRNA gene through the neighbor-joining method. Scale bars = 5% sequence
divergence. The values at the nodes are bootstrap values (1,000 times resampling analysis). The NCBI accession numbers are also indicated.

clones in OTU AR01 exceeded 99%, indicating that the only
anammox bacterial type present in the reactor was likely to
be a strain of Ca. Anammoxoglobus propionicus. The 16S
rDNA sequences of AR01 were compared with those of Ca.
Anammoxoglobus propionicus (NCBI Accession No. DQ317601.1)
using MEGA4 software. AR01 exhibited an approximately
0.78% mismatch with Ca. Anammoxoglobus propionicus in
the database. The AR01 sequences used in this study can be
retrieved from the GenBank database under Accession No.
KC862502.
TEM Observation of Anammox Bacteria
All previously reported anammox organisms have a
membrane-bound intracytoplasmic compartment, known
as an anammoxosome [24]. TEM was performed on thin
sections prepared from the biomass (collected from the
batch reactor on day 481) containing the anammox organisms.
The anammox species in the leachate seeding system
displayed the typical features of anammox bacteria. The
species had a single membrane-bound anammoxosome
and an anammoxosome membrane-attached nucleoid and
riboplasm with ribosome-like particles separated from the
paryphoplasm at the cell rim by an intracytoplasmic
membrane (Fig. 6). Previous results also indicated that the
only anammox bacterium in this system is Ca. Anammoxoglobus
propionicus (481 days). The TEM images could be good

Fig. 6. Transmission electron micrograph of thin-sectioned C. Anammoxoglobus propionicus organism.

The cells contained the conventional anammox cell components: anammoxosome (A), riboplasm (R) containing a nucleoid (N) opposed to an
anammoxosome membrane (M), paryphoplasm (P) separated from the riboplasm by an intracytoplasmic membrane (ICM), and cytoplasmic
membrane (CM).

July 2014 ⎪ Vol. 24 ⎪ No. 7

886 Hsu et al.
representatives of the Ca. Anammoxoglobus propionicus
found in the leachate. In this study, the average diameter of
Ca. Anammoxoglobus propionicus ranged from 1 to 2 µm,
which agrees with a previous study where the anammox
bacterium with the largest diameter (1.1 µm) was Ca.
Anammoxoglobus propionicus [19, 31]. The cells of Ca.
Kuenenia stuttgartiensis and Ca. Brocadia fulgida have an
average diameter of 800 nm; the cells of Ca. Scalindua are
slightly larger, with an average cell diameter of 950 nm
[31]. Thus, since the TEM results showed the features of Ca.
Anammoxoglobus propionicus, the anammox bacterium in the
present study was likely a strain of Ca. Anammoxoglobus
propionicus.
In conclusion, based on an anammox community study
and TEM observation, a seldom found anammox microorganism
phylogenetically related to Ca. Anammoxoglobus propionicus
was enriched using leachate sludge as the seeding. Once
this Ca. Anammoxoglobus propionicus became the dominant
anammox microorganism in the reactor, the overall
nitrogen removal rate increased and remained stable for
nearly 500 days. A persistent and stable anammox process
was achieved in the system when maintaining the TN feed
concentration at 80 to 150 mg-N/l. The average stoichiometric
ratio of ammonium consumption to nitrite conversion to
nitrate production was 1:1.3:0.3. This study proved that the
seldom found anammox microorganism Ca. Anammoxoglobus
propionicus could be enriched from the environment
without adding propionate. The potential application of
this particular anammox microorganism in nitrogen
removal is worthy of further study.
Acknowledgments
The authors would like to thank the National Science
Council of the Republic of China, Taiwan, for financially
supporting this research under Contract Nos. NSC 99-2622-
E-005-012-CC3 and 100-2622-E-005-004-CC3.
References
1. Altschul SF, Gish W, Miller W, Meyers EW, Lipman DJ.
1990. Basic local alignment search tool. J. Mol. Biol. 215: 403-
410.
2. Amano T, Yoshinaga I, Okada K, Yamagishi T, Ueda S,
Obuchi A, et al. 2007. Detection of anammox activity and
diversity of anammox bacteria-related 16S rRNA genes in
coastal marine sediment in Japan. Microb. Environ. 22: 232-
242.
3. APHA. 1995. Standard Methods for the Examination of Water and
Wastewater. American Public Health Association, Washington,
J. Microbiol. Biotechnol.
DC, USA.
4. Daverey A, Su S-H, Huang Y-T, Lin J-G. 2012. Nitrogen
removal from opto-electronic wastewater using the simultaneous
partial nitrification, anaerobic ammonium oxidation and
denitrification (SNAD) process in sequencing batch reactor.
Bioresour. Technol. 113: 225-231.
5. Egli K, Fanger U, Alvarez PJJ, Siegrist H, van der Meer JR,
Zehnder AJB. 2001. Enrichment and characterization of an
anammox bacterium from a rotating biological contactor
treating ammonium-rich leachate. Arch. Microbiol. 175: 198-
207.
6. Güven D, Dapena A, Kartal B, Schmid MC, Maas B, van de
Pas-Schoonen K, et al. 2005. Propionate oxidation by and
methanol inhibition of anaerobic ammonium-oxidizing bacteria.
Appl. Environ. Microbiol. 71: 1066-1071.
7. Humbert S, Tarnawski S, Fromin N, Mallet M-P, Aragno M,
Zopfi J. 2010. Molecular detection of anammox bacteria in
terrestrial ecosystems: distribution and diversity. Int. Soc.
Microb. Ecol. J. 4: 450-454.
8. Innerebner G, Insam H, Franke-Whittle IH, Wett B. 2007.
Identification of anammox bacteria in a full-scale
deammonification plant making use of anaerobic ammonia
oxidation. Syst. Appl. Microbiol. 30: 408-412.
9. Jaeschke A, Op den Camp HJM, Harhangi H, Klimiuk A,
Hopmans EC, Jetten MSM, et al. 2009. 16S rRNA gene and
lipid biomarker evidence for anaerobic ammonium-oxidizing
bacteria (anammox) in California and Nevada hot springs.
FEMS Microbiol. Ecol. 67: 343-350.
10. Kartal B, Kuypers MMM, Lavik G, Schalk J, Op den Camp
HJM, Jetten MSM, Strous M. 2007. Anammox bacteria
disguised as denitrifiers: nitrate reduction to dinitrogen gas
via nitrite and ammonium. Environ. Microbiol. 9: 635-642.
11. Kartal B, Rattray J, van Niftrik L, van de Vossenberg J,
Schmid MC, Webb RI, et al. 2007. Candidatus “Anammoxoglobus
propionicus” a new propionate oxidizing species of anaerobic
ammonium oxidizing bacteria. Syst. Appl. Microbiol. 30: 39-
49.
12. Kuai L, Verstraete W. 1998. Ammonium removal by the
oxygen-limited autotrophic nitrification-denitrification system.
Appl. Environ. Microbiol. 64: 4500-4506.
13. Kuypers MMM, Lavik G, Woebken D, Schmid M, Fuchs
BM, Amann R, et al. 2005. Massive nitrogen loss from the
Benguela upwelling system through anaerobic ammonium
oxidation. Proc. Natl. Acad. Sci. USA 102: 6478-6483.
14. Long A, Heitman J, Tobias C, Philips R, Song B. 2013. Co-
occurring anammox, denitrification, and codenitrification in
agricultural soils. Appl. Environ. Microbiol. 79: 168-176.
15. Mulder JW, Van Loosdrecht MCM, Hellinga C, Van Kempen
R. 2001. Full-scale application of the SHARON process for
treatment of rejection water of digested sludge dewatering.
Water Sci. Technol. 43: 127-134.
16. Neef A, Amann R, Schlesner H, Schleifer K-H. 1998.
Monitoring a widespread bacterial group: in situ detection of

planctomycetes with 16S rRNA-targeted probes. Microbiology
144: 3257-3266.
17. Park H, Rosenthal A, Ramalingam K, Fillos J, Chandran K.
2010. Linking community profiles, gene expression and N-
removal in anammox bioreactors treating municipal anaerobic
digestion reject water. Environ. Sci. Technol. 44: 6110-6116.
18. Penton CR, Devol AH, Tiedje JM. 2006. Molecular evidence
for the broad distribution of anaerobic ammonium-oxidizing
bacteria in freshwater and marine sediments. Appl. Environ.
Microbiol. 72: 6829-6832.
19. Rattray J, van de Vossenberg J, Hopmans E, Kartal B, van
Niftrik L, Rijpstra W, et al. 2008. Ladderane lipid distribution
in four genera of anammox bacteria. Arch. Microbiol. 190: 51-
66.
20. Schmid M, Twachtmann U, Klein M, Strous M, Juretschko
S, Jetten M, et al. 2000. Molecular evidence for genus level
diversity of bacteria capable of catalyzing anaerobic ammonium
oxidation. Syst. Appl. Microbiol. 23: 93-106
21. Schmid M, Walsh K, Webb R, Rijpstra WI, van de Pas-
Schoonen K, Verbruggen MJ, et al. 2003. Candidatus
"Scalindua brodae", sp. nov., Candidatus "Scalindua wagneri",
sp. nov., two new species of anaerobic ammonium oxidizing
bacteria. Syst. Appl. Microbiol. 26: 529-538.
22. Schmid MC, Maas B, Dapena A, van de Pas-Schoonen K,
van de Vossenberg J, Kartal B, et al. 2005. Biomarkers for in
situ detection of anaerobic ammonium-oxidizing (anammox)
bacteria. Appl. Environ. Microbiol. 71: 1677-1684.
23. Schmid MC, Risgaard-Petersen N, Van De Vossenberg J,
Kuypers MMM, Lavik G, Petersen J, et al. 2007. Anaerobic
ammonium-oxidizing bacteria in marine environments:
widespread occurrence but low diversity. Environ. Microbiol.
9: 1476-1484.
24. Sinninghe Damsté JS, Rijpstra WIC, Geenevasen JAJ, Strous
M, Jetten MSM. 2005. Structural identification of ladderane
and other membrane lipids of planctomycetes capable of
anaerobic ammonium oxidation (anammox). FEBS J. 272:
4270-4283.
25. Strous M, Heijnen JJ, Kuenen JG, Jetten MSM. 1998. The
sequencing batch reactor as a powerful tool for the study of
slowly growing anaerobic ammonium-oxidizing microorganisms.
Appl. Microbiol. Biotechnol. 50: 589-596.
26. Strous M, Pelletier E, Mangenot S, Rattei T, Lehner A,
Taylor MW, et al. 2006. Deciphering the evolution and
metabolism of an anammox bacterium from a community
Enrichment of Anammox Microorganism from Leachate 887
genome. Nature 440: 790-794.
27. Third KA, Paxman J, Schmid M, Strous M, Jetten MSM, and
Cord-Ruwisch R. 2005. Enrichment of anammox from
activated sludge and its application in the CANON process.
Microb. Ecol. 49: 236-244.
28. Van de Graaf AA, de Bruijn P, Robertson LA, Jetten MSM,
Kuenen JG. 1996. Autotrophic growth of anaerobic
ammonium-oxidizing microorganisms in a fluidized bed
reactor. Microbiology 142: 2187-2196.
29. Van De Vossenberg J, Rattray JE, Geerts W, Kartal B, Van
Niftrik L, Van Donselaar EG, et al. 2008. Enrichment and
characterization of marine anammox bacteria associated
with global nitrogen gas production. Environ. Microbiol. 10:
3120-3129.
30. Van Dongen U, Jetten MSM, Van Loosdrecht MCM. 2001.
The SHARON-anammox process for treatment of ammonium
rich wastewater. Water Sci. Technol. 44: 153-160.
31. van Niftrik L, Geerts WJC, van Donselaar EG, Humbel BM,
Webb RI, Fuerst JA, et al. 2008. Linking ultrastructure and
function in four genera of anaerobic ammonium-oxidizing
bacteria: cell plan, glycogen storage, and localization of
cytochrome C proteins. J. Bacteriol. 190: 708-717.
32. Wang C-C, Lee P-H, Kumar M, Huang Y-T, Sung S, Lin J-G.
2010. Simultaneous partial nitrification, anaerobic ammonium
oxidation and denitrification (SNAD) in a full-scale landfill-
leachate treatment plant. J. Hazard. Mater. 175: 622-628.
33. Winkler MKH, Yang J, Kleerebezem R, Plaza E, Trela J,
Hultman B, van Loosdrecht MCM. 2012. Nitrate reduction
by organotrophic anammox bacteria in a nitritation/anammox
granular sludge and a moving bed biofilm reactor. Bioresour.
Technol. 114: 217-223.
34. Xiao Y, Zeng G, Yang Z, Liu YS, Ma Y, Yang L, et al. 2009.
Coexistence of nitrifiers, denitrifiers and anammox bacteria
in a sequencing batch biofilm reactor as revealed by PCR-
DGGE. J. Appl. Microbiol. 106: 496-505.
35. Yapsakli K, Aliyazicioglu C, Mertoglu B. 2011. Identification
and quantitative evaluation of nitrogen-converting organisms
in a full-scale leachate treatment plant. J. Environ. Manag.
92: 714-723.
36. Zilles JL, Peccia J, Kim M-W, Hung C-H, Noguera DR. 2002.
Involvement of Rhodocyclus-related organisms in phosphorus
removal in full-scale wastewater treatment plants. Appl.
Environ. Microbiol. 68: 2763-2769.
July 2014 ⎪ Vol. 24 ⎪ No. 7