TIPS 1446 No.

of Pages 23

Feature Review
An Overview of Novel
Adjuvants Designed for
Improving Vaccine Efficacy
Srinivasa Reddy Bonam,1,2 Charalambos D. Partidos,1,y
Sampath Kumar M. Halmuthur,2,* and Sylviane Muller1,3,*
Adjuvants incorporated in prophylactic and/or therapeutic vaccine formula-tions
Trends
impact vaccine efficacy by enhancing, modulating, and/or prolonging the New-generation adjuvants are crucially
immune response. In addition, they reduce antigen concentration and the awaited to create new vaccines or
number of immunizations required for protective efficacy, therefore contribut-ing improve the efficacy of existing ones.

to making vaccines more cost effective. Our better understanding of the Pattern recognition receptors are cen-
molecular mechanisms of immune recognition and protection has led research tral to the innate immune response and
efforts to develop new adjuvants that are currently at various stages of devel- are considered as key targets for pro-
ducing effective vaccine generation.
opment or clinical evaluation. In this review, we focus mainly on several of these
promising adjuvants, and summarize recent work conducted in various labo- Several smart novel adjuvants have
emerged recently that act as immuno-
ratories to develop novel lipid-containing adjuvants
modulators or potent delivery systems.

Introduction Synthetic or natural adjuvants, with or

Vaccine immunology remains a valuable legacy of the pioneering research of scientists without a delivery system, are pre-
pared to sensitize the immune system
such as Edward Jenner, William B. Coley, Louis Pasteur, Gaston Ramon, and Alexander against infectious agents and induce
T. Glenny. Many vaccines have been developed on the basis of trial and error and their long-lasting memory immune
immunological mechanisms of protection remain unknown. This lack of understanding responses.
results mainly from the shortage of predictive models that can be used to determine the
Novel adjuvants are also required as
outcome of interactions of various vaccine formulations with the host immune system. As components of vaccines generated
a result, vaccine testing has become time consuming and expensive, requiring in vivo from novel technologies, such as
testing to meet safety, immunoge-nicity, and efficacy requirements. reverse vaccinology, which starts with
the genome of pathogens and is used
for predicting pertinent epitopes.
Vaccines encompass ‘any preparation used as a preventive inoculation to confer immunity
against a specific disease, usually employing an innocuous form of the disease agent, as killed
or weakened bacteria or viruses (in the case of infection), to stimulate antibody production’ and
1CNRS, Immunopathology and
cellular immunity (see Glossary). Recent vaccines can also contain a protective antigen(s) of
therapeutic chemistry/Laboratory of
the pathogen (subunit vaccines), which can be expressed by an attenuated bacterial or virus
excellence Medalis, Institut de
vector (recombinant vaccines) or encoded by DNA or RNA (DNA or RNA vaccines) [1–3]. Biologie Moléculaire et Cellulaire,
Strasbourg, France
2Vaccine Immunology Laboratory,
Despite the rapid and successful development of antiviral drugs against some pathogenic viruses,
Natural Products Chemistry Division,
such as HIV and hepatitis C virus (HCV), there is still an alarming paucity of antiviral drugs for many CSIR-Indian Institute of Chemical
clinically important viral pathogens. In fact, there is a lack of effective drugs against most infectious Technology, Hyderabad, India
3University of Strasbourg Institute for
agents. To confront the ongoing emergence of new and previously known, but not yet controlled,
Advanced Study (USIAS), Strasbourg,
infectious pathogens, as well as the problem of drug-resistant variants, there is a need to develop France
novel vaccines and, therefore, potent adjuvants that improve their efficacy [4]. The introduction of yCurrent address: 4210 Bagley Pkwy,
Madison, WI, USA.
novel vaccines remains a challenge to public health systems worldwide.
*Correspondence:
Inactivated, subunit, or recombinant vaccines in general are poorly immunogenic. Adjuvants sampath@iict.res.in (S.K.M.
Halmuthur) and
have been used to augment and modulate the immunogenicity of vaccines without causing sylviane.muller@unistra.fr (S. Muller).

Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy http://dx.doi.org/10.1016/j.tips.2017.06.002 1

© 2017 Elsevier Ltd. All rights reserved.
 TIPS 1446 No. of Pages 23

adverse effects. Their discovery often emerges from studies dissecting the immunostimulatory Glossary
properties of bacterial components [5]. Vaccine adjuvants in current clinical use are listed in C-type lectin receptors (CLRs): include
Table 1 and their advantages are depicted in Figure 1. Adjuvants stimulate the innate immune DEC 205, macrophage mannose
receptor (MMR), dectin-1,2
system directly by acting on dendritic cells (DCs), macrophages, and neutrophils, leading to
macrophage-inducible C-type lectin
the activation of the adaptive immune system (Figure 2). (Mincle), dendritic cell natural killer
lectin group receptor-1 (DNGR-1), and
The innate immune system (Figure 2) has a critical role as a first line of defense that allows dendritic cell-specific intracellular
adhesion molecule 3-grabbing
primary responses against microbes to occur. It confers an immediate nonspecific mechanism
nonintegrin (DC-SIGN). CLRs are
conserved carbohydrate recognition
receptors with or without calcium
dependency and form part of the
Table 1. Examples of Vaccine Delivery Formulationsa,b
innate immune system with an
Adjuvant Composition Proposed mechanism of action Refs essential role in antifungal immunity.
MF59 Squalene, Span 85, Tween 80, and Upon injection, recruited CD11b+ [135,136] Co-stimulation: in addition to the first
cells and MHC-II+ cells and also antigen-specific signal involving the
citrate buffer
promoted systemic expression of IL- major histocompatibility complex
12 (p40) and IL5; further assisted the (MHC) peptide–T cell receptor (TCR)
sustained release of Ag at the interaction, a co-stimulatory signal (or
injection site and activated muscle ‘second signal’) is crucial for T cell
fibers followed by tissue-resident DCs activation. Co-stimulatory molecules
expressed on the membrane of
AS01 Liposomes containing MPLS and Activated Ag-loaded monocytes and [137] antigen-presenting cells (APCs) and T
QS21 MHC-IIhigh DCs cells act in a tandem ligand– receptor
AS02 O/W emulsion containing MPLA and Enhanced both cellular and humoral- [138] system that, upon completion of the full
QS21 mediated immune responses signal, initiates T cell maturation,
differentiation, and proliferation. Co-
AS03 a-tocopherol, squalene, polysorbate Promoted recruitment of monocytes [139] stimulatory molecules include CD28-
80, and PBS and granulocytes; also increased CD80/ CD86, or ICOS-ICOL
secretion of cytokines (CCL2, CCL3, complexes. B cell co-stimulatory
IL-6, CSF3, and CXCL1) from APCs, molecules include CD40-CD40L and
thereby enhancing Ag-specific complement-complement receptors.
adaptive immune responses Damage-associated molecular
AS04 Contains MPLA adsorbed onto a Directly activated APCs by inducing [121] patterns (DAMPs): host cellular
particulate form of aluminum salt NF-kB, cytokine production, and components released during tissue
antigen-specific T cell activation injury or death. DAMPs activate the
immune system through PRRs;
Virosomes Contain inactivated virus Virosomal-adjuvanted influenza [140]
nonspecific activation of APCs through
vaccine Inflexal1 V increased the DAMPs causes several autoimmune
geometric mean titers of antibodies
diseases, atherosclerosis, and
along with cell-mediated immunity
myocardial infarction.
CAF01 Cationic liposomal vehicle containing Induced cell-mediated immunity [98]
DDA with a glycolipid through release of IFN-g and IL-17
immunostimulator (TDB) from activated T cells Danger signal: the immune system is
well organized to recognize danger
CAF04 Cationic liposomal vehicle containing Induced higher IFN- g responses than [103]
elements by discriminating self and
DDA with monomycoloyl glycerol CAF01
non-self. Exogenous dangers, such as
analog (MMG)
PAMPs, DAMPs, or stress molecules
CAF05 Cationic liposomal vehicle containing Induced higher IFN-g response than [103] detected by the APCs, instantaneously
DDA with the immunostimulators TDB CAF01 and CAF04 release signals, such as heat shock
and poly(I:C) proteins, uric acid, reactive oxygen
species, neuromediators, matrix
Montanide ISATM 720 W/O emulsion containing non-mineral Formed a depot and induced cell- [127,141] proteins, and cytokines, including IFN-
oil with mannide mono-oleate family mediated immunity
g, IL-1b, and IL-6. Dangers signals are
emulsifier
a significant focus for therapeutic
Montanide ISATM 51 W/O emulsion containing mineral oil Formed a depot and induced strong [127] applications and diagnoses.
with mannide mono-oleate family cytotoxic T cell response Immunomodulators: any substance
emulsifier that activates, suppresses (weakens)
or changes (deviates) immune
aSelection based on hits in preclinical and clinical studies.
responses. Immunomodulators can
bAbbreviations: Ag, antigen; APC, antigen-presenting cells; AS, adjuvant system; CAF, cationic adjuvant
modulate cytokines and chemokines
formulations; CC/ CX, chemokine; CSF, colony-stimulating factor; DC, dendritic cell; DDA, dimethyl dioctadecyl-
secretion, thereby altering immune
ammonium; IFN, inter-feron; IL, interleukin; MHC, major histocompatibility complex; MPLA, 3-O-desacyl-40-
monophosphoryl lipid A; NF, nuclear factor; O/W, oil in water; PBS, phosphate-buffered saline; poly(I:C),
polyinosinic-polycytidylic acid; QS, Quillaja saponaria; TDB, trehalose 6,6-dibehenate; W/O, water in oil.

2 Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy

 TIPS 1446 No. of Pages 23

• Makes vaccine more cost effec ve (fewer system strategies; examples include
doses required) CpG oligodeoxynucleotides (CpG
ODNs), a-galactosylceramide
• Effec ve innate immune signals, including (a-GalCer), and liposomes.
danger signals Non-invasive vaccine delivery:
numerous vaccines have been
• Good immunomodulatory capacity committed for parenteral
administration with poor subject
acceptability. Novel delivery systems
• High specific an body produc on using non-invasive techniques offer a
Vaccine variety of benefits over traditional
adjuvant delivery using needles (e.g. painless,
• An gen-specific clonal expansion stability of the vaccine, and improved
protective systemic immunity via the
mucosa). For example, non-invasive
• Genera on of cytotoxic T cells vaccination against TB via the
intranasal or aerosol routes provided
protective immunity equivalent to that
• Long-las ng adap ve immune response
generated after intradermal delivery.
Nucleotide-binding
• Makes an gen more potent (less dose oligomerization domain, leucine-
required) rich repeat (NLRs): this family of
receptors comprises cytosolic
receptors, such as CARD, PYDs,
BIR, and AD, that are classified
Figure 1. Characteristic Properties of Vaccine Adjuvants. according to the sequence of their
N-terminal domain; there are 22
NLRs in humans. They are essential
of protection through pattern recognition receptors (PRRs), such as Toll-like receptors (TLRs), to the sensing of PAMPs and
nucleotide-binding, oligomerization domain (NOD)-like receptors (NLRs), and C-type lectin DAMPs. NLRs have been shown to
receptors (CLRs), or by the so-called ‘complement’ system. The interaction of PRRs with their have central role in chronic
inflammatory and autoimmune
corresponding ligands (e.g., bacterial components) controls and shapes the subsequent diseases. Among the NLR-CARD
adaptive immune response, which is specific to the invading pathogen [6]. The adaptive domains, CARD4 (NOD1) and
immune system (Figure 2) has the capacity for self and non-self-recognition and induction of CARD15 (NOD2) have been
extensively studied and implicated in
an immune response, which comprises effective lymphocytes, such as B cells, ab T helper and
adjuvant research through their
cytotoxic T cells, natural killer T (NKT), and gd]FID$T69[ T cells. These cells recognize recognition of peptidoglycan (PGN).
peptides or epitopes presented through classical and nonclassical major histocompatibility Muramyl dipeptide (MDP), a cell wall
complex (MHC)-I and MHC-II molecules. The interface interacts]FID$T769[ with many co- component of bacteria, is recognized
by NOD2. Modification of the MDP
stimulatory molecules, such as clusters of differentiation 40 (CD40)-CD40 ligand (L), CD28-
structures also results in antigen-
CD80/86, and inducible T cell co-stimulator (ICOS)-ICOSL complexes. The activation of this specific immune responses.
interface, often named the immune synapse, allows the amplification of cytokines and antigen- Pathogen-associated molecular
specific immune responses, which can kill or inactivate the pathogen. Such strong co- patterns (PAMPs): microbial
components or mimics of microbial
stimulation leads to the development of immunological memory [7].
components (synthesized) that are
recognized by specialized receptors
Over the past few decades, there has been significant progress in understanding the molecular of the innate immune system; they
mechanisms involved in antigen recognition and the induction of immune responses [8]. are potent immunostimulants.
Pathogen recognition receptors
Preclinical and clinical studies using TLR agonists alone or in combination with other adjuvants (PRRs): expressed mainly in
highlighted their potential use as adjuvants. For example, monophosphoryl lipid A (MPLA), a professional and nonprofessional
TLR4 agonist purified from Salmonella minnesota lipopolysaccharide (LPS), is currently used cells of the innate immune system.
They recognize two types of distinct
in human licensed vaccines for the prevention of human papillomavirus (HPV) and HBV
families of molecule, namely PAMPs
infections [9,10]. Several other adjuvants, including MF59, adjuvant system (AS) 01, AS03, and DAMPs. Membrane-bound
AS04, and virosomes, are now available in licensed vaccine products (Table 1) [11]. In other PRRs include TLRs and CLRs, while
cases, adjuvants were taken back to the bench for further evaluation due to their adverse cytoplasmic PRRs include NLRs and
RLRs.
effects, such as signs of arthritis and bowel disease [12,13]. This prompted efforts to design RIG-I-like receptors (RLRs): examples
new molecules with better safety profiles and potent adjuvanticity. Using focused libraries that include RIG-I, MDA5, and LGP2; these
comprise collections of compounds that are designed to interact with a particular protein target are antiviral receptors of the innate
or, more frequently, with a family of related bioactive targets, chemists were able to synthesize immune system and recognize viral
RNA. Activation of the
novel molecules that exhibit immunostimulatory properties with minimal adverse effects.

Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy 3

 TIPS 1446 No. of Pages 23

Notable examples include analogs, which belong to the families of MurNAc-L-Ala-D-isoGln, RLR signaling pathway leads to
also known as muramyl dipeptide (MDP), MPLA, TLR2 agonist N-palmitoyl-S-[2,3-bis(palmi- increased production of IFN-g, which
controls viral infection. Poly(I:C) and
toyloxy)-(2RS)-propyl-R]-cysteinyl-[S]-seryl-[S]-lysyl-[S]-lysyl-[S]-lysyl-[S]-lysine (Pam3CSK4; 5' triphosphate double-stranded
see below for more detail), imiquimod,]FID$T869[TLR9 ligand CpG oligodeoxynucleotides RNA are ligands of RIG-I and MDA5.
(ODNs; see below for more detail), QS-21, an acylated 3,28-bisdesmodic triterpene glycoside They have shown effective vaccine
adjuvanticity against viral infections.
(see below for more detail), and a-galactosylceramide (a-GalCer; see below for more detail). In
Toll-like receptors (TLRs): first
general, these molecules have been evaluated in vitro and in vivo for their immunostimulating discovered in Drosophila and later in
activity using model antigens, such as ovalbumin (OVA), and disease-specific antigens [14]. mammals. These receptors
Most of these molecules are pathogen-associated molecular patterns (PAMPs), which can recognize a variety of antigens; 11
induce immunity by interacting with receptors of the innate immune system, such as TLRs, TLRs have been characterized in
humans and 13 in mice. TLRs react
NOD-like receptors, and RIG-I (a family of cytoplasmic RNA helicases)-like receptors. The
with specific PAMPs and activate
latter are transmembrane or cytosolic receptors, which can indirectly activate the innate and signaling pathways, notably the NF-
adaptive immune systems through the specific ligands mentioned above, such as MDP, MPLA, kB signaling and MAPK pathways,
leading to secretion of
QS-21, Pam3CSK4, CpG, and a-GalCer [13].
proinflammatory cytokines and
activation of co-stimulatory
In this review, we focus on newly developed and patented vaccine adjuvants, describing molecules.
their mode of action and immunostimulatory properties. In addition, we summarize recent Vaccine adjuvant: the word
‘adjuvant’ originates from the Latin
work conducted in various laboratories on novel lipid-based adjuvants. For more detailed adiuvare, which means ‘to help’.
informa-tion, please see the relevant references cited throughout the article. Vaccine adjuvants are components in
vaccine formulations that potentiate
Patented Vaccine Adjuvants and New Developments the immune response. They can be
immunomodulators and/or delivery
Adjuvants are compounds that, when admixed with vaccine antigens, enhance, modulate, systems. They generally act by
and/or prolong their immunogenicity and protective efficacy. Vaccines typically comprise inducing a proinflammatory
an antigen [e.g., a defined target antigen, short epitope(s)-encompassing protein environment that favors the
recruitment and promotion of
fragments, or inactivated pathogen] and an adjuvant. These two components are
infiltrating phagocytic cells to the site
normally formulated for delivery as emulsions or particulate delivery systems, such as of administration.
liposomes, biodegradable polymers, virosomes, immune stimulating complexes Vaccine delivery systems:
(ISCOMs), virus-like particles (VLPs), and nanoparticles/nanotubes (Figure 3) [13,15,16]. formulations comprising
antigens, associated or not with
Each adjuvant has unique immunological properties and, therefore, their selection criteria
adjuvants, which protect
normally depends on the target pathogen and required immune responses for protection antigens from degradation and
(e.g., humoral versus cellular immunity or both) [17]. Conventional vaccine strategies enhance their presentation by
based on live attenuated pathogens do not require adjuvants since they have intrinsic targeting antigen delivery.

adjuvanticity (e.g., resulting from danger signals due to their nucleic acid content).

Detailed information on vaccine components contained in currently marketed licensed

vac-cines is provided in Table 1. Characteristics of a selected set of these patented
immunopo-tentiating compounds are described below.

Lipopeptides
Macrophage-activating lipopeptide-2 (MALP-2), derived from the N-terminal moiety of Myco-
plasma and Escherichia coli, shows immunostimulatory activity that results from the induction
of B cell proliferation and increased secretion of TNF-a from macrophages [18]. Modification
studies on MALP-2 resulted in two analogs, Pam2CSK4 and Pam3CSK4 (Figure 4A,B), that
have proinflammatory properties. The N-terminal cysteine was shown to be a key residue in
these compounds [19]. Similar to MALP-2, both analogs were shown to interact with specific
receptors, namely TLR2 that heterodimerizes with TLR6 for the former, and TLR2 that
heterodimerizes with TLR1 for the latter (Figure 4C) [20,21]. This heterodimerization occurs via
an amide bond with distinct extra lipid chains [22]. Upon activation with Pam3CSK4, the TLR2
receptor interacts with TLR1 and adopts a horse shoe-shape structure. The lipid portion of
Pam3CSK4 was found to fit into a narrow gap in the newly formed complex, while the cysteine
residue also inserted into the same gap. In the case of Pam 2CSK4, in which an extra amide
bond is absent compared with Pam3CSK4, the lipid chain interacts with TLR2 and the

4 Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy

 TIPS 1446 No. of Pages 23

Basophil γδ T cell
Monocyte Macrophage
Plasma cells

B cell

Cytokines/chemokines/ NKT cell

other signals Cytokines

Neutrophil Memory cells

TH cell

Eosinophil APC
Complement NK cell Lysed target cell
T cell CTL
(apoptosis)
Innate immunity Adap ve immunity

CD40 CD40L

CD80/86 CD28 TLRs

NLRs
MHC-II TCR
CLRs

ICOSL ICOS

Co-s mula on

Figure 2. Innate and Adaptive Immune Systems. The innate immune system constitutes a front line of defense and provides a nonspecific response against
invading pathogens. This response is mediated by various cells (granulocytes, monocytes, macrophages, dendritic cells, neutrophils, basophils, and natural killer cells,
and active molecules as proteins of the complement cascade) through recognition of PAMPs or DAMPs by PRRs. The innate immune response shapes adaptive
immunity resulting in the production of antigen-specific T and B lymphocytes. Abbreviations: APCs, antigen-presenting cells; CD, cluster of differentiation; CLRs, C-type
lectin receptors; CTL, cytotoxic lymphocytes; DAMPs, damage-associated molecular patterns; ICOS, inducible T cell costimulatory; MHC, major histocompatibility
complex; NKT, natural killer T cells; NLRs, nucleotide-binding, oligomerization domain (NOD)-like receptors; PAMPs, pathogen-associated molecular patterns; PRRs,
pathogen recognition receptors; TCR, T cell receptor; TLRs, Toll-like receptors.

peptide moiety interacts with TLR6, a molecular hot core of links that resembles the
CD1d– invariant NKT (iNKT) interaction (see below for more detail) [23]. TLR2 agonists
represent an effective family of adjuvants tested in vaccine formulations against different
infectious agents, including HIV [24], HBV, HPV [25], Leishmania [26], and Chlamydia
[27], and in certain cancers, such as melanoma [28].

Research has led to the development of novel Pam 3CSK4 analogs [14]. In particular, carbo-
hydrate di- and tri-lipidated cysteine-based 1,2,3-triazoles have been developed that exhibit
adjuvant properties in vaccine formulations against bacterial, viral, and protozoan infections,
and in cancer [29]. A construct was built in which the polycationic peptide entity was swapped

Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy 5

 TIPS 1446 No. of Pages 23

Receptor-specific
ngmulas
immune ac vators
virosomes,

[emulsions,

Vaccine DC
(ISCOMs)]
complexes
immune-
liposomes, and

Innate immunity
delivery systems

Adjuvant T and B cells

Adap ve
immunity

Memory cells
Immunos mulators
and nonreceptor-specific immune
ac vators

Figure 3. Interactions of Adjuvant with the Bioactive Actors of Innate and Adaptive Immunity. Novel
delivery systems (e.g., emulsions, liposomes, polymers, and nanocarriers) and immunostimulants activate the innate
immune system. Antigen fragments activate adaptive immunity in inducing (or not) immunological memory. Adjuvants and
immunostimulatory compounds enhance vaccine efficacy primarily by stimulating innate immunity. They also boost adaptive
immunity, thus providing a long-term memory response against pathogens and foreign antigens. Abbreviation: DCs,
dendritic cells (acting as antigen-presenting cells, APCs).

with a hydrophilic carbohydrate entity tethered to a triazolyl moiety. The aim of this new
design was to examine the possibility of generating a functional mimic of Pam 3CSK4. The
carbohy-drate entity imparts hydrophilicity, whereas the triazolyl moiety mimics the
cationic nature of the peptide portion.

Synthesis of triazole-tethered hybrid conjugates of Pam 3C involved two intermediates: azido

carbohydrate and propargylamido Pam 3C moieties. The peracylated glycosyl moiety was treated
with TMSN3 and SnCl4 followed by deacylation with NaOMe to obtain the respective anomeric azido
sugars. By contrast, the propargylated Pam 3C fragment was prepared starting from ]FID$T96[

cyclohexylidene mannitol subjected to diol cleavage using NaIO4 oxidation and subsequent
reduction to hydroxyl with a NaBH4 reagent. Hydroxyl was converted to iodo using I2/triphenyl-
phosphine and imidazole, which was further coupled with N-tert-butyloxycarbonyl (N-Boc) cysteine,
forming a protected cysteinyl glycerol unit. The]FID$079[ cysteinyl intermediate thus obtained was
further treated with acid to remove the N-Boc and cyclohexyl protecting groups to afford compound
with free amine and diol moieties. This was subjected to palmitoylation using N,N 0-
diisopropylcarbodiimide, which gave the required triacylated entity. The free carboxylic acid was
condensed with propargyl amine to give the second fragment. Various glycosyl azides and
propargylated Pam3C fragments were subjected to a click reaction using CuSO 4 and sodium
ascorbate to obtain the required novel 1,2,3 triazole tethered glycolated-P3C entities (Figure 4D,E).
All compounds were subjected to ex vivo immunological evaluation. It was found that the galactosyl
analog (compound 6h]FID$T49[) exhibited increased T helper (Th)1-type (IL-2, IL-12, and IFN-g)
immunostimulatory activity compared with the control Pam 3CSK4. Moreover, some of the analogs
bearing ribose (compound 6e) and maltose (compound 6h]FID$T49[)moieties were also shown to
elicit a Th1-type response. However, this response was not superior to that of the cognate
Pam3CSK4 molecule. When the adjuvant activity of 6h]FID$T49[, 6e, and Pam 3CSK4 was tested in
vivo using OVA as a model antigen, the anti-OVA IgG titers in the 6e molecule were higher
compared with those of alum, but not compared with Pam3CSK4 (Figure 4F). The 6e analog was
less active than the 6h]FID$T179[compound, alum, or Pam 3CSK4 (Figure 4F). Both 6h]FID$T49[and
6e analogs promoted a Th1 cytokine response (IL-2, IL-12, and IFN-g) in the serum and higher
expression of CD4 and CD8 surface markers. Interestingly, the hit molecules 6h]FID$T49[and 6e
were found to exert their activity via the TLR2 receptor, as does Pam 3CSK4 (Figure 4C). This was
confirmed by using the HEK-BlueTM-hTLR2 reporter gene assay [14].

6 Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy

TIPS 1446 No. of Pages 23

(C) Triacyl lipopep de Diacyl lipopep de

TLR1 TLR2 TLR2 TLR6

(A) (B)

MyD88
TIRAP

IRAK

TRAF6

Nucleus

IKKγ
NF-κB IκB
NF-κB IKKα IKKβ

Proinflammatory cytokines

Pam3CSK4 Pam2CSK4

(D) (E)

6e 6h

(F) OVA-specific IgG

250 <0.001
<0.0001

200
Anbody ter (x 103)

150

100

50

alone OVA+6e OVA+6h

OVA+Alum
OVA+Pam3 CSK4

OVA

(See figure legend on the bottom of the next page.)

Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy 7

 TIPS 1446 No. of Pages 23

Synthetic CpG oligodeoxynucleotides

CpG oligodeoxynucleotides (CpG ODNs) comprise unmethylated CG motifs (cytosine phos-
phate guanidine). They activate B lymphocytes and plasmacytoid DCs (pDCs) through TLR9.
Based on their capacity to stimulate B cells and pDCs and induce IFN-g and IL-6 secretion,
three classes of stimulatory CpG ODNs have been identified and classified as class A (Type
D), class B (Type K), and class C CpG ODNs (Figure 5A) [30,31]. CpG ODNs enter cells via
the endosomal pathway. After internalization in endosomes, CpG ODNs are recognized by
endo-somal TLR9 (Figure 5), leading to the immediate recruitment of MyD88, which is followed
by the activation of downstream signaling molecules, such as IRAK1, IRF7, TRAF6, and
several protein kinases, including ERK, p38, JNK, as well as IkB complex. These activation
pathways activate transcription factors, such as nuclear factor-kB (NF-kB) and activating
protein 1 (AP1) (Figure 5B), and proinflammatory cytokine production. Cytokines released from
the activated DCs and B cells directly activate T helper, NK, and cytotoxic CD8+[965T$DIF]T
cells as well as macro-phages (Figure 5B).

There is abundant literature highlighting the adjuvanticity of CpG ODNs in preclinical and
clinical studies (Table 2) [32,33]. CpG ODNs conjugated with HBV surface antigen resulted in
a 1000-fold increase in the antibody response compared with antigen alone [34]. In contrast to
other TLR ligands, CpG ODNs have been shown to elicit superior CD8+ cell-mediated
immunity [35], due to the activation of Th1 cytokine production (Figure 5B) [36]. It has also
been shown that CpG ODN 1668 associated with carbon nanotubes and a Tat peptide of HIV
potentiated the immune response [37,38]. Vaccine formulations including CpG ODNs have
been shown to elicit strong humoral immune response against a variety of pathogens,
including anthrax, Leishmania, HBV, influenza, measles, orthopox, and tetanus toxoid [39–43].
In a Phase I trial, a malaria vaccine comprising CpG ODNs and the apical membrane antigen
resulted in fivefold higher antibody titers compared with antigen alone [44]. Moreover, CpG
ODNs showed significant adjuvant activity against Engerix B (a HBV vaccine for adults) by
increasing antibody titers and enhancing T cell proliferative responses in HIV-infected
immunocompromised subjects [45]. Improved antibody and CD8+ T cell responses were also
described when CpG ODNs were combined with Melanoma A, New York-oesophageal cancer
1, and anthrax vaccines [46–48]. Finally, the NuThraxTM vaccine candidate from Bioemergent
is based on BioThrax1 (Anthrax Vaccine Adsorbed) combined with the CpG ODN 7909 as an
adjuvant. A Phase III study is planned (first subject enrollment targeted for 2018). Millions of
doses of NuThrax are being stockpiled and the US FDA is close to licensing this product
(making it the first CpG-containing vaccine to achieve licensure). The FDA could authorize
NuThrax for emergency as early as 2018 [49]. CpG ODNs have also been combined with other
adjuvants or chemically linked to different nanoparticles or antigens to improve vaccine
immunogenicity [50–52].

Figure 4. Acylated Peptide-Induced Signaling Pathway. Pam2CSK4 (A) and Pam3CSK4 (B) acyl lipopeptides bind to the TLR2 present on the cytoplasmic
membrane (C), resulting in TLR2 heterodimerization with TLR6 and TLR1, respectively. As a consequence, these heterodimers interact with MyD88, leading to activation
of the IRAK-TRAF6 cascade, followed by activation of various kinases, which finally leads to the binding of NF-kB to its promoter region. This final step is responsible for
the production of proinflammatory cytokines. (D,E) Newly developed Pam3CSK4 derivatives (the structure of the hit molecules is shown). (F) OVA-specific IgG response
in BALB/c mice that were immunized subcutaneously with OVA alone, OVA + alum (Alhydrogel 1 adjuvant 2%), OVA + Pam3CSK4, OVA + 6e molecule, or OVA + 6h
molecule (100 mg/100 ml/mouse in each group; five mice per group). Mice received two injections at days 0 and 14 and were bled at day 28. Anti-OVA antibodies were
measured by indirect ELISA. Briefly, the plates were coated with OVA (1 mg/well) in carbonate buffer, pH 9.5, and then incubated at 4[945T$DIF]C overnight. After three
consecutive washings in PBS containing 0.05% v/v Tween-20 (PBS-T), and blocking nonspecific binding sites remaining on the plastic plates by adding 200 ml 1% (v/v)
bovine serum albumin at room temperature for 1 h followed by three other washings, standards and samples diluted in PBS-T were added to the plates and incubated at
37[946T$DIF] C for 2 h at room temperature. Plates were again washed three times with PBS-T, followed by addition of antimouse IgG-horseradish
peroxidase (IgG-HRP; Jackson ImmunoResearch diluted in PBS-T). After 30 min at room temperature, plates were again washed three times with PBS-T and
the HRP substrate (H2O2) and 3,3',5,5;-tetramethylbenzidine (TMB) chromogen were added. Plates were incubated at room temperature (4–30 min) for color
development. Color reaction was stopped by adding 50 ml HCl. Absorbance was measured at 450 nm [142]. The values are presented as mean titers SD. **P
<0.001, ***P <0.0001 (Mann–Whitney U[947T$DIF]test). Abbreviations: ELISA, enzyme-linked immunosorbent assay; IRAK, IL-1 receptor-activated kinase;
MyD88, adaptor protein myeloid differentiation gene 88; NF-kB, nuclear factor-kB; OVA, ovalbumin; TIRAP, Toll-interleukin 1 receptor domain containing
adaptor protein; TLR, Toll-like receptors; TRAF, tumor-necrosis factor receptor-associated factor.

8 Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy

 TIPS 1446 No. of Pages 23

(A)
G
C A
GGTGCATCGATGCAGGGGGG TCCATGGACGTTCCTGAGCGTT TCGTCGTTCGAACGACGTTGAT
D type (A type) K type (B type) C type T T
A G
C
C A G
G
Phosphodiester and Unstructured G
T
phosphorothioate backbone phosphorothioate backbone Composi on resembles G
with poly G tails; capable of of >12 bases; resistance to that of B-type ODNs G
G
forming a hairpin loop nuclease diges on G
containing the CpG mo f (half-life 30–60 min) G G

A type
Ac vate matura on of Ac vate pDCs to secrete Ac vate pDCs to produce
pDCs and their secre on TNF-α, and B cells to IFN-α, and
of IFN-α; no effect on B proliferate and secrete B cells to secrete IL-6 T
cells IgM G T
C C
G T
A C
Mainly remain in early Quickly transported Have intermediate G
endosomes and interact through early proper es of both A- and C
with adaptor proteins endosomes into late B-type ODNs T
(e.g., MYD88) to trigger endosomes for signal
the IFN-α signaling transduc on B type
cascade

CpGODN
(B)

Nucleus
Endosome

AP–1
MYD88
IRAK
NF-κB AP–1
TRAF6
CpG ODN
JNK

IκB
NF-κB

DC B cell

•Matura on
•Differen a on
•Prolifera on
Eosinophil Monocyte Macrophage TH1 cell CTL NK cell

Cytokines (IL-1, IL-6, IL-12,

MHC II
IL-18,TNF-α, and IFN-γ) Cytokines (IL-6 and IL-12)
MHC II
CD86 Plasma cells

CD86 DC CD80 B cell Fc An bodies

CD80
CD40
CD40
Chemokines (IP10, Mig, and I-TAC) Memory cells

Figure 5. Structure and Mode of Action of CpG Oligodeoxynucleotides (CpG ODNs). (A) The three different types of CpG ODN (A, B, and C), their
structures, and properties. (B) CpG ODNs modulate innate and adaptive immune responses in several ways. (A) The CpG ODN–TLR9 signaling pathway. TLR9 receptors
are present on the endosomal membrane. After internalization, CpG ODN activates elements of the MyD88/IRAK/TRAF6 pathway, leading to the simultaneously activation
of two kinase pathways (MAPK/c-JUN and NF-kB) and the AP-1 and NF-kB promoter genes. (B) CpG ODN activates directly DCs and B cells acting as APCs. Activated

(See figure legend on the bottom of the next page.)

Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy 9

 TIPS 1446 No. of Pages 23

QS-21
Saponins alter the membrane integrity of cells and induce danger signals that augment
immune responses [53]. Saponins acting as adjuvants were first reported as early as the 19th
century. Pioneering work on the immune stimulatory activity of saponins led to the
development of QS-21 [54]. In particular, testing crude extracts of the bark from the South
American tree, Quillaja saponaria Molina demonstrated potent vaccine adjuvant activity
[55,56]. QS-21 is the gold-standard vaccine adjuvant among the saponin family. As shown in
Figure 6A, it comprises branched tri-saccharides, triterpenes, linear tetra-saccharides, and an
acyl chain. The linear tetra-saccharides terminal domain has two isomeric units: QS-21-apiose
and QS-21-xylose [57,58]. QS-21 has been shown to exert adjuvant activity in vaccine
formulations against cancer [59,60], infections such as malaria [61,62], AIDS [63], hepatitis
[64,65], and TB [66], and also[973T$DIF] against Alzheimer’s disease [67].

The mechanism of action of QS-21 at the molecular level remains unclear. According to
current understanding, the free aldehyde side chains of QS-21 are the primary interacting
components that bind amino acid residues of proteins present on the surface of immune
cells. This leads to the formation of a Schiff base or imine [59]. This interaction, on T cells
and antigen-presenting cells (APCs), appears to contribute to the initial triggering signal
for downstream signaling (Figure 6B) [5,68].

A novel mechanism of action of saponins was recently proposed, based on inflammasome activation
that enhances antigen cross-presentation by forming unique intracellular lipid bodies. In this scheme,
lipid bodies escape from endosomes and translocate the antigens for cross-presentation [53].
Although natural QS-21 has good immunostimulatory properties, there are several important
limitations in terms of adverse effects, such as hemolysis at higher doses, an unfavorable
dose:efficacy ratio, and an ecological burden resulting from its extraction from Q. saponaria. In this
context, and with the aim of enhancing efficacy and reducing the hemolytic adverse effects, a
focused library was synthesized of novel glycolipid mimics encompassing a carbohydrate entity as
the hydrophilic head group and a triterpenoid/steroid-based lipid moiety tethered with a trizolyl
spacer. Three different sugars (glucose, galactose, and xylose) were converted to their respective
anomeric azide via TMSN3 and SnCl4 treatment. Cholesterol, betulin, and betulinic acid were
propargylated on their secondary hydroxyl group via spacers such as triethylene glycol or a
succinate unit. Both the sugar]FID$T479[ azide and acetylenic triterpenoid/ cholesterol fragments
were subjected to a Cu(I)-catalyzed click reaction to produce a]FID$T579[library of novel adjuvants
(Figure 6C). Carbohydrates have a vital role in immune functions and molecules containing
carbohydrate moieties display strong safety and tolerability properties [69]. More-over, vaccine
adjuvants obtained from natural and synthetic sources have carbohydrate moieties [69]. In a recent
study, a carbohydrate was linked with steroid/triterpenoid using a polyethylene glycol linker. Among
a series of analogs that were synthesized and evaluated, a lead compound was identified, called
15g]FID$T849[, that exhibited lower hemolytic activity in vitro and superior immunostimulatory
activity compared with many of the other analogs that were tested in parallel [70]. In particular,
15g]FID$T849[increased B cell-mediated proliferation ex vivo and increased levels of IL-2, TNF-a,
IL-12, and IFN-g measured in the cell supernatants. More interestingly, it exerted an adjuvant effect
in vivo when co-administered with OVA [70]. Anti-OVA IgG antibody responses were significantly
higher compared with those induced by alum-adjuvanted OVA (Figure 6D).

DCs and B cells also activate other immune cells, such as neutrophils, monocytes, macrophages, Th1-type CD4+]FID$T49[T cells, CTL, and NK cells, which then mature,
differentiate, and proliferate. APCs construct a base by forming co-stimulatory signals and provide strong memory responses. Abbreviations: APCs, antigen-presenting
cells; Fc, fragment crystallizable region; IFN, interferon; IP10, IFN-g-inducible protein 10 (or CXCL1); I-TAC, interferon-inducible T cell alpha chemoattractant (or
CXCL11); JNK, c-Jun N-terminal kinase; MAPK, mitogen-activated protein kinase; MHC-II, class II major histocompatibility complex; Mig, monokine-induced by IFN-g (or
CXCL9); pDC, plasmacytoid dendritic cells. For definitions of other abbreviations, please see the main text and the legend to Figure 2.

10 Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy

 TIPS 1446 No. of Pages 23

Table 2. Live Vaccine Adjuvant Patents (2016)a,b[953T$DIF]

Patent number]FID$T459[ Assignee Title Year ]FID$T59[ Composition
(filed/
published)

US 5182109A National Institute of Health; Vaccine preparation comprising a 1993 Vaccine comprises different
The Kitasato Institute, both of Tokyo bacterial toxin adjuvant toxin antigens
(JP)

EP 0781 559 A2 Juridical Foundation, The Chemo- Oil adjuvant vaccine and method for 1996 W/O emulsion with different
Sero-Therapeutic Research Institute preparing same surfactant and polymer ratios
Kumamoto-ken (JP)

PCT/KR96/00053 LG Chemical Ltd., Seoul, (KR) Quillaja saponin adjuvant and vaccine 1998 Comprises saponin component from
formulation containing same the bark of Quillaja saponaria Molina
as an immune adjuvant

US 6,406,705 B1 University of Iowa Research Use of nucleic acids containing 2002 Unmethylated CpG ODN and
Foundation, Iowa City (USA); Coley unmethylated CpG dinucleotide as an non-nucleic acid adjuvant
Pharmaceutical GmbH, Langenfeld adjuvant
(DE); Ottawa Health Research Institute,
Ottawa (CA)

PCT/US98/08652 Protection Unlimited, Inc., Wilmington, Nerve growth factor as a vaccine 2003 Nerve growth factor acts as an adjuvant
DE (USA) adjuvant to enhance effectiveness of vaccine

US 2004/0101534 A1 Rothwell’ Figg’ Ernst & Manbeck, P.C. Adjuvant-free peptide vaccine 2004 Vaccine comprises fusion peptide
Washington (USA) synthetically derived from
cytomegalovirus with CpG ODN as
an adjuvant

US 6,881,561 B1 Cheil Jedang Corporation,]FID$T659[Seoul (KR) Endonuclease of immune cell, process 2005 Immune adjuvant
for producing the same, and immune comprising approximately
adjuvant using the same 10-bp single-stranded
oligonucleotide with a CpG motif;
produced by treatment of bacterial
DNA with endonuclease

PCT/EP00/01046 Eurocine AB, Stockholm,]FID$T759[Solna (SE) Vaccine composition 2005 TB vaccine that
comprises mycobacterial
US 2005/0158330 A1 NOF Corporation, Tokyo (JP); Juridical Oil adjuvant vaccine 2005 Vaccine comprises W/O/W-type
Foundation, Kurnarnoto-shi (JP) oil adjuvant
PCT/NL2004/000437 Bestewil]FID$T859[ Holding B.V., Amsterdam (NL) Functionally reconstituted viral 2009 Membrane protein from pathogens or
membranes containing adjuvant tumor cells with amphiphilic adjuvant

PCT/EP05/05786 SmithKlineBeecham Corporation Vaccine compositions comprising 2009 Vaccine comprises influenza
Corporate Intellectual Property,]FID$T95[ virosomes and a saponin adjuvant viral antigen, QS21, and sterol
Pennsylvania (USA)

PCT/KR2007/006889 SNU R&DB Foundation, Seoul (KR) a-GalCer derivatives, pharmaceutically 2010 a-GalCer-containing triazole moiety
acceptable salts thereof, preparation at the amide position
method, and pharmaceutical
composition for the immune adjuvant
containing the same as an active
ingredient

PCT/EP08/57998 GlaxoSmithKline Corporate Intellectual Vaccine comprising Streptococcus 2010 Vaccine comprises different
Property,]FID$T069[North Carolina (USA) pneumoniae capsular polysaccharide Streptococcus pneumoniae
conjugates capsular saccharide conjugates
PCT/FR08/51807 Air Liquide USA LLC, Intellectual Method for preparing a vaccine 2010 Composition comprises an adjuvant
Property, Houston,]FID$T169[Texas (USA) composition comprising at least one such as inverse latex or polymer
antigen and at least one adjuvant mixed into an antigenic medium
US 7,749,979 B2 National Pingtung University of Science CpG DNA adjuvant in avian vaccines 2010 CpG DNA
and Technology, Pingtung County (TW)

US 7,771,726 B2 New York University, New York (USA); Use of synthetic glycolipids as universal 2010 Synthetic a-C-GalCer
The Research Foundation of the City adjuvants for vaccines against cancer
University of New York, New York and infectious diseases

Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy 11

 TIPS 1446 No. of Pages 23

Table 2. (continued)
Patent number]FID$T459[ Assignee Title Year ]FID$T59[ Composition
(filed/
published)
(USA); Aaron Diamond Aids Research
Center, New York (USA)

PCT/EP10/51882 GlaxoSmithKline Biologicals S.A. Inactivated dengue virus vaccine with 2011 Inactivated dengue virus antigen in
Rixensart (BE) aluminium-free adjuvant combination with aluminum-free
adjuvant

PCT/EP2006/069979 GlaxoSmithKline Biologicals S.A., Vaccine comprising an O/W emulsion 2012 O/W emulsion comprises
Rixensart (BE) adjuvant metabolizable oil, tocol, emulsifying
agent with various antigens and
methods of preparation

EP 2 589 392 A2 Sanofi Pasteur, Lyon (FR) Process for stabilizing an adjuvant 2013 Process for stabilizing a vaccine
containing a vaccine composition composition with a stabilizer

PCT/US2004/005152 HasumiLlc (Dba Shukokai International) Human lymphocyte vaccine adjuvant 2013 Supernatant collected from stimulated
New York (USA) cultured human lymphocytes

US 8,540,955 B2 Wyeth LLC, Madison (USA) Process for producing aluminium 2013 Provides improved methods for
phosphate producing the aluminium adjuvant
AlPO4

PCT/U52008/057355 The Regents of the University of
Colorado, A Body Corporate, Denver
(USA)
Method of preparing an
immunologically active adjuvant-bound
dried vaccine composition
2013 Preparation of freeze-dried vaccine
comprising an aluminium salt adjuvant,
a recombinant Clostridium botulinum
neurotoxin protein, and a glass-forming
agent

US 8,624,004 B2 GlaxoSmithKline Biologicals S.A., Purification of HBV antigens for use in 2014 HBV antigen that includes cysteine
Rixensart (BE) vaccines

PCT/FR2011/050069 Société d’Exploitation de Produits pour Adjuvant for preparation of vaccine 2014 Short and long-chain hydrocarbons
les Industries Chimiques, Paris (FR) compositions intended for prevention with Coccidia
of coccidiosis

US 8,795,678 B2 Academia Sinica, Taipei (TW) TLR2 agonists and methods of use 2014 FMDV capsid proteins VP1 and VP3
thereof activate TLR2

US 8,889,616 B2 Oncothyreon Inc., Seattle (USA) MUC1-based glycolipopeptide vaccine 2014 Liposomal vaccine formulations
with adjuvant comprising an adjuvant and an
immunogen for immunotherapy

PCT/US2013/034372 Kansas State University Research Vaccine adjuvant 2015 Oil-based adjuvants comprise a plant-
Foundation, University of Tennessee derived surfactant, such as gum arabic,
Research Foundation,]FID$T269[Manhattan an aqueous component, and an oil
(USA)

US2016/0200758A1 Council of Scientific and Industrial
Research,]FID$T369[Delhi (India)
1,2,3-Tiazole-tethered carbohydrate
di- and tri-lapidated cysteine
conjugates useful as vaccine
adjuvants, and process for preparation
thereof
2016 Lipidated cysteine-based triazoles as
vaccine adjuvants covered both
therapeutic and prophylactic vaccines
against bacterial, viral, and protozoan
infections, and cancer

aThe mentioned patents are all in the field of vaccines and vaccine adjuvants.
b
Abbreviations: bp, base pairs; CpG ODN, CpG dinucleotide; FMDV, Foot-and-mouth disease virus; TLR, Toll-like receptor; VP, viral protein; W/O/W, water/oil/water.

a-GalCer
The synthesis of a-GalCer, popularly known as KRN7000 (Figure 7A), was based on structure–
activity relationship (SAR) studies pertaining to Agelasphine-9b. The latter was first isolated from the
Okinawan sea (Japan) sponge Agelas mauritianus. The curiosity-driven discovery of agelasphine-9b
was based on the bioactive cerebrosides that it contains. Glycosphingolipids are widely distributed in
living organisms [71] and a-GalCer is mostly known as an activator of type 1-murine and human
iNKT cells. As NK cells, NKT cells express an invariant ab T cell

12 Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy

 TIPS 1446 No. of Pages 23

(A)

Par ally
Oligosaccharide Oligosaccharide hydro- Pentose
philic lipid

(B)

Saponin
Ag CHO CH
Imine
NH2 N
2+
Ca
+
Na
K+ ERK2
Lipid body
MAPK
ER MHC-I TCR

Transcrip on
Pep de

Cell survival
Prolifera on
APC Migra on
+
CD8 T cells

(C) (D) OVA-specific IgG

<0.0001
40
bodyAn ter (x 10 3 )

<0.0001
30

20

10
15g
0
A m
OVA+Alu OVA+15g
OV

(See figure legend on the bottom of the next page.)

Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy 13

 TIPS 1446 No. of Pages 23

(A) (B)

B cells
Neutrophils IL-4

iNKT
IFN -γ

α-GalCer TCR
(C) Lipid an gen
CD1d
Monocytes
NK cells
APC

IL-12

α-C-GalCer
(D)

Macrophages
CD8+ T cells

(E)
CD4+ T cells

Figure 7. CD1d–a-GalCer–iNKT Ternary Complex Activation of Bystander Cells. (A) Pictorial

representation summarizing the formation of the binary complex of CD1d–a-GalCer that releases IL-12 from APCs and the
formation of the ternary complex CD1d–a-GalCer-iNKT that releases cytokines IL-4 and IFN-g from iNKT cells. The release
of large amounts of cytokines activates bystander cells to migrate, proliferate, and differentiate. (B) a-GalCer; (C) a-C-
GalCer analog; (D,E) novel benzyloxyalkyl-substituted 1,2,3-triazolyl a-GalCer analogs (T1204B]FID$T94[ and T1206B).
Abbreviations: iNKT, invariant natural killer T cells. For definitions of other abbreviations, please see the main text.

receptor (TCR) and also markers, such as NK1.1, DX5, and CD161 [72]. Unlike conventional
CD4+]FID$T279[and CD8+ T cells, NKT cells recognize exogenous or endogenous glycolipids
presented by the MHC-I-like molecule CD1d. Although there are minor variations among human and
mouse NKT cells, the latter are considered to be 100% CD1d restricted. Interactions between NKT
and a-GalCer or between analogs and CD1d and their immunomodulatory properties have been
extensively studied over the past two decades. Many exogenous (natural and synthetic) and
endogenous CD1d-restricted iNKT stimulators have been reported [73–76].

X-ray crystallography studies revealed that a-GalCer is primarily recognized by the

nonclassical MHC-I or CD1d molecules present on APCs. CD1d forms two pockets, A’
and F’, for binding two lipid chains in a-GalCer (the acyl and sphingosine chains) and
forms an a-GalCer/CD1d binary complex [77,78]. Furthermore, CD1d presents a-GalCer
to the TCR of iNKT cells and forms a NKT/a-GalCer/CD1d ternary complex. This ternary
complex is one of the largest ever recorded for any natural TCR ligands [79,80].

Figure 6. Mechanisms Involved in the Adjuvant Activity of Saponins. (A) Structural elements of QS-21. (B) Aldehyde-containing saponins (e.g., QS-21) act via two
different mechanisms. One is via the formation of a lipid body that participates in the presentation of MHC antigens by APCs. The second one is direct activation of T cells by interacting
with amino acid residues present in the TCRs. These interaction steps are followed by the activation of ERK2, MAPK, and transcription factors, leading to cytokine release, and cell
proliferation, migration, and differentiation. (C) Compound 15g]FID$T849[, a novel 1,2,3-triazolyl conjugate with a carbohydrate-steroid entity.
(D) OVA-specific IgG response in BALB/c mice that were immunized subcutaneously with OVA alone, OVA + alum, and OVA + 15g]FID$T849[(100 mg/mouse in each group; five mice
per group). Mice received two injections at days 0 and 14 and were bled at day 28. Anti-OVA antibodies were measured by indirect ELISA (please see the legend to
Figure 4 for technical details). The values are presented as mean SD. ***P <0.0001 (Mann–Whitney U]FID$T749[test). Abbreviations: Ag, antigen; ER, endoplasmic
reticulum; ERK2, extracellular signal-regulated kinases. For definitions of other abbreviations, please see the main text and the legends to Figures 2 and 3.

14 Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy

 TIPS 1446 No. of Pages 23

iNKT cells act as a bridge between the innate and adaptive immune systems. A distinct role of iNKT
cells is to produce copious amounts of Th1 (IFN-g) and Th2 (IL-4) cytokines in a short time [81].
However, activated iNKT cells also produce other cytokines, including IL-2, IL-5, IL-6, IL-9, IL-10, IL-
13, IL17, IL-21, TNF-a, TGFb, and granulocyte-macrophage colony-stimulating factor (GM-CSF),
along with numerous chemokines [82]. Independent studies have shown that iNKT cell-secreted
cytokines can activate bystander cells, such as NK cells, conventional CD4 +]FID$T679[and CD8+ T
cells, macrophages, B cells, and myeloid DCs (Figure 7B). a-GalCer and its analogs (e.g., a-C-
GalCer) showed potential therapeutic benefits against infectious diseases, autoimmune diseases,
and tumors (Figure 7C). The introduction of 1,2,3-triazole at the amide linkage of a-GalCer increased
its stability for hydrolysis and induced the formation of two hydrogen bonds with the Thr154 residue,
two elements that are likely to contribute to raise immune response. A focused library of novel a-
GalCer analogs encompassing a triazolyl moiety linked to a variable spacer with a terminal
benzyloxy group has been generated using a Cu(I)-catalyzed azide alkyne click chemistry approach.
The design was based on the immunogenicity of two distinct, previously published, structural
analogs of a-GalCer [83], one bearing a triazolyl linker on the acyl chain of GalCer framework
instead of an amide linkage and the other with a benzyloxy alkyl group at the acyl terminus. In the
structural modification of the most versatile a-GalCer, the triazole linker is known to favor Th2
responses, while an aromatic terminus of the acyl chain is known to favor Th1 responses. Based on
the immunogenicity of the individual glycolipid structures mentioned above, the authors inferred that
a combination of these two structural entities on a single molecular framework should provide better
immunostimulatory properties. The new design encompassed both structural elements (i.e., 1,2,3-
triazole and the benzyloxy lipid entity) in a single compound. To prepare the analogs, one end of
each consecutive diol (ethylene glycol to 1,12-dodecanediol) was benzylated, while the other
hydroxyl was propargylated. The acetylenes were modified by click chemistry with the azido a-
GalCer to provide the desired analogs in quantitative yields (e.g., Figure 7D,E). These analogs
comprised triazole with lipid chains of varying lengths containing a terminal benzyl group with some
intervening oxygen atoms. These structural modifications enhanced Th1 and Th2 responses and
iNKT cell activation, and their activity as vaccine adjuvants is currently being evaluated [84]. The
possible molecular basis of the adjuvant activity of a-GalCer and a-GalCer-derived molecules has
been critically examined elsewhere [85–89]. These molecules were shown to display good
adjuvanticity in vaccine formulations against a range of infectious diseases, including HIV infection,
TB, influenza, malaria, and dengue, as well as tumors [74,75,90–95].

Liposomes
Liposomes are lipid vesicles with phospholipid bilayers. They have the capacity to act both as
delivery systems for antigens and as immunomodulators [96–98]. They protect antigens from
degradation, deliver them to APCs, and can be used for mucosal delivery. The lipid membrane
comprises phosphatidylcholine, which is nonimmunomodulatory but shows fusogenic activity,
thus facilitating better uptake by APCs. Frequently, other compounds, such as TLR ligands,
need to be incorporated for optimal adjuvanticity [99]. It has taken many years of research to
design liposome-containing formulations that are clinically usable as safe vaccine delivery
systems. Liposomes and virosomes are present in vaccine suspensions against influenza virus
(Inflexal V), HAV (Epaxal), and Plasmodium falciparum for malaria (RTS,S/AS01/Mosquirix TM,
approved for use by European regulators in July 2015) [100]. In addition, some oral liposome
formulations with recombinant heat shock protein 60 were shown to be promising against
Helicobacter pylori infection in preclinical studies [101].

Cholesterol-containing liposomes have also been used to attenuate adjuvant toxicity. For
example, a liposome formulation was shown to reduce the toxic effects of QS-21
(hemolytic activity) and MPLA (endotoxic activity) [102]. Moreover, liposomes containing
cationic charges have demonstrated superior delivery properties and elicited significantly
higher protective response against Mycobacterium spp. (Table 1) [103].

Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy 15

 TIPS 1446 No. of Pages 23

Virus-Like Particles
In recent years, virus-like particle (VLP)-based vaccine strategies have been frequently used
for novel vaccine design. VLPs are empty noninfectious viral capsids that structurally mimic the
conformation of native virions. VLPs are known to be highly immunogenic and elicit higher titer
neutralizing antibody responses than subunit vaccines based on individual proteins [104]. Such
VLPs present viral spikes and other surface components that display liner or conformational
epitopes in a repetitive array that effectively results in recognition by B cells [105]. This
recognition leads to B cell signaling and MHC-II upregulation that facilitates the generation of
high titers of specific antibodies. VLPs from viruses, including HBV, HPV, and Chikungunya
virus, elicit high-titer neutralizing antibody responses that contribute to protective immunity in
preclinical animal models and in humans [104,106–108].

Immune-Stimulating Complexes
Immune-stimulating complexes (ISCOMs) are spherical open cage-like structures (typically 40
nm in diameter) that spontaneously form when cholesterol, phospholipids, and specific
saponins (mostly Quil A) are mixed at a specific ratio. The ISCOM matrix can directly associate
with antigens or be formed first and then added to the formulation at a later point. Given their
structure, ISCOMs can achieve efficient antigen delivery into DCs that results in the induction
of antigen-specific T cell responses, longlasting antibody responses, and balanced Th1/Th2
immunity [109–111]. To improve their efficacy, ISCOMs have also been used in combination
with immune-stimulating molecules, such as TLR ligands or cholera toxin A (CTA) [112,113].

State of the Art of Emulsion-Based Delivery Systems and Novel

Developments
There are different types of emulsion in current use; water-in-oil (W/O), oil-in-water (O/W), and
multiple emulsions, such as water-in-oil-in-water (W/O/W) and oil-in-water-in-oil (O/W/O).

Table 3. Examples of Patented Emulsions and Their Compositiona

Patent number Oil Surfactant/adjuvant]FID$T469[

WO2004087204 A2 Light mineral oil Lecithin, Tween 80, Span 80

US 5,961,970 Medium-chain triglyceride oil, Lecithin, Tween 80

vegetable oil

US 5,084,269 Mineral oil Lecithin

CA 2179779 A1 Metabolisable oil a-tocopherol, Tween 80,3 de-O-acylated

monophosphoryl lipid A, QS-21

CA2628206 A1 Animal (such as fish) or vegetable Tweens, Spans, Brijs, lecithin, triton X-100,
source copolymers of ethylene oxide, propylene oxide,
and/or butylene oxide; mixture of surfactants

US 5,376,369 Squalene or squalane PluronicTM L121, muramyldipeptide

US 5718904 A Squalene or squalane Glycerol, Tween 80

US 5690942 A Squalene, squalane, or mixture Lecithin, aluminum salt, polyoxyethylenesorbitan

ester, especially Tween 80

US 5885590 A Vegetable oil, animal oil, mineral oil, Polyoxyethylene polyoxy propylene block
isopropyl myristate, and copolymer, poloxamer 331, poloxamer 461,
polyoxypropylene poloxamer 520.5, sorbitan monooleate,
sorbitan tristearate, Arlacel 186, poloxamer
403, polyoxyethylene sorbitan monooleate,
poloxamer 188, and mixtures thereof

a
Selection based on the patented product (oil, surfactant, and adjuvant).

16 Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy

 TIPS 1446 No. of Pages 23

CD19+ CD86+

15 <0.0001
(A) Submicron size <0.0001

Low viscosity 10

% onpopula
High stability
5
Easily metabolizable in biological systems
0
g) g) g)
μ μ μ

MPLA OVA+ (10 E+OVA+MPLA (5 E+OVA+ A (10

MPLA M
PL
(B)
Oil OVA-specific IgG

400 000 <0.0001

Aqueousphase Surfactant
300 000 <0.001
OVA

ter
200 000

bodyAn
Emulsion
100 000

0
) ) )
g g g
μ μ μ
0 0
(5 1
L (1 PLA (
OVA PA E+OVA+M E+OVA+MPLA

+M

OVA-specific IgA

0.5 <0.0001

0.4
OD @ 630 nm

0.3

0.2
Immuniza on
0.1

0.0

OVA+MPLA OVA+MPLA+Emulsion

Figure 8. Emulsion-Based Vaccine Delivery Systems. (A) Prerequisites for emulsions to be used as adjuvants. (B) Efficacy of an oleic acid nanoemulsion for
vaccine delivery. An O/W emulsion comprising OVA as a model antigen and MPLA as an adjuvant was administered intranasally to C57/Bl6 mice (N = 5). Antigen-specific
IgA from nasal washes and IgG from the serum of immunized mice were revealed by indirect ELISA (please see the legend to Figure 4 for technical details).
Immunophenotyping for co-stimulator markers CD19+ and CD86+ was performed according to the method of Colovai et al. [143] with slight modifications. Briefly, 3 105 splenocytes (3
105cells/tube) were centrifuged at 2000 rpm for 15 min. BD Fc BlockTM(10]FID$T59[ ; 1 ml) was then added for 15–20 min at 4]FID$T549[C in the dark to block
nonspecific Fc receptor-mediated antibody binding. After two successive washings with 1% (v/v)-fetal calf serum-containing PBS, cells were centrifuged at 2000 rpm for 5
min. They were then labeled using 7 ml (determined according to previous titrations) of anti-CD19-PE and anti-CD86-allophycocyanin fluorochrome-conjugated antibodies
and 2 ml of fluorochrome-conjugated isotype control (all from BD Biosciences). Cells were then incubated on ice for 30 min in the dark, centrifuged with 1%
(v/v)[951T$DIF] fetal calf serum-containing PBS and analyzed using a BD FACSVerse flow cytometer. Compensation was established using BD Biosciences
compensation beads. Postacquisition flow cytometry analyses were performed using the FACS Suite software. Abbreviations: E, emulsion; ELISA, enzyme-linked
immunosorbent assay; Fc, fragment crystallizable region; MPLA, monophosphoryl lipid A; OVA, ovalbumin; PE, phycoerythrin.

Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy 17

 TIPS 1446 No. of Pages 23

Table 3 lists several novel, patented emulsions and their composition, while Figure 8A
details the prerequisites for vaccine adjuvant formulations.

Oil-in-Water Emulsions
O/W emulsions are extremely safe compared with W/O formulations. The antigen is available in the
continuous phase and can easily diffuse into tissues. However, the addition of immuno-modulators,
such as MPLA, QS21, MDP, or imiquimod, was found to be necessary to achieve a strong immune
response. The oil phase in most emulsions comprises metabolizable oils, such as vegetable
(sunflower, soybean, corn, olive, and mustard) and animal based-oils, such as fish oils (cod liver oil,
shark liver oils, or whale oil) and squalene and squalane. These oils are biocompatible and
biodegradable [114,115]. O/W emulsions associated with immunomodu-lators with established
mechanisms of action, such as MF59, AS02, AS03, and AS04, showed efficacy in preclinical and
clinical studies against infectious diseases (Table 1). MF59 composi-tion contains squalene with
varying amounts of muramyl tripeptide phosphatidyl-ethanolamine (MTP-PE). Fluad1, seasonal
influenza vaccine with MF59 was shown to produce high antibody titers against influenza in older
patients [116,117]. An AS02 emulsion associated with 3-O-desacyl-40-MPLA (a TLR4 agonist) and
QS-21 has been associated with many antigenic vaccine preparations. For example, RTS,S/AS02
effectively elicited protective immune responses against P. falciparum [118]. Others, such as TB
vaccines, comprising Mtb72f (Mycobacterium tuberculosis fusion protein), Mtb41, or Ag85B-ESAT-6
(secreted antigenic proteins) with AS02; HBV vaccines, comprising HBV hyperimmunoglobulin
(HBIG) or SL* (small HBV envelope protein) with AS02; HIV vaccines, comprising gp120 (an
envelope glycoprotein) and AS02; and cancer vaccine, comprising melanoma-associated antigen 3
(MAGE-A3) and AS02 have elicited potent immune responses in preclinical and clinical studies
[119]. An AS03 emulsion composed of biodegradable oils (squalene and a-tocopherol) and a
surfactant (polysorbate 80) in phosphate-buffered saline (PBS) also showed some efficacy. Even
though this adjuvant system did not show encouraging results with malaria and HIV vaccines, it
demonstrated strong immunostimulatory activity and surrogate protection against H5N1 and H1N1
pandemic influenza in both children and adults [120].The AS04 emulsion contains MPLA with a
particulate form of aluminum salt. CervarixTM and FENDrixTM are two licensed vaccines containing
AS04 against HPV and HBV [121] and others, such as herpes simplex virus (HSV), respiratory
syncytial virus (RSV), and Epstein–Barr virus (EBV) are under clinical evalua-tion [119]. This system
is also exploited in other infectious diseases [122].

Water-in-Oil Emulsion
In W/O emulsions, the antigen is present in aqueous droplets entrapped in the continuous phase of
oil and, therefore, has a tendency to remain at the site of injection. This accumulation can induce
granulomas at the injection site and also causes sharp pain [123–125]. However, this type of
emulsion generates high immunogenicity especially due to the sustained release of antigen from the
oily phase. Nevertheless, W/O emulsion are of limited use in humans. However, many veterinary
vaccines are based on W/O emulsions and some are in clinical trials for the treatment of certain
cancers, such as melanoma [126]. Freund's adjuvant, a classical W/O emulsion system with
nonmetabolizable oils, produced high antibody responses against many antigens with a Th1-biased
cytokine response, although it is not authorized for human use. Other W/O emulsions that have
gained interest as adjuvant delivery systems include Montanide ISA TM 51 and Montanide ISATM
720. These emulsions comprise mineral oil (Drakeol1[97T$DIF]6VR) (Montanide ISATM 51) and
nonmineral oil (squalene) (Montanide ISATM 720) with a surfactant from the mannide monooleate
family (Table 1) [127]. Both formulations have been used in preclinical and clinical vaccine trials
against HIV infection, malaria, and breast cancer [117].

18 Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy

 TIPS 1446 No. of Pages 23

Multiple or Double Emulsions Outstanding Questions

In W/O/W emulsions, antigen may be entrapped in the inner aqueous phase, which is How can we formulate vaccines so
surrounded by large oil droplets dispersed in an outer aqueous phase, or can be dispersed in that their kinetics and biodistribution
ensure optimal immune responses
the outer aqueous phase. This type of emulsion is more acceptable compared with W /O and safety?
emulsions because it does not induce granulomas at the injection site. However, their physical
instability remains a limiting factor to their use in vaccine formulations. Miyahara and Can adjuvants deliver a sufficiently
colleagues licensed a W/O/W emulsion comprising polyethylene glycol as the outer aqueous pro-longed potent immune stimulus
as a rapid response in the face of a
phase [128]. This type of emulsion, which includes W/O/W-type delivery systems with or
pan-demic threat?
without antigens [e.g., Actinobacillus pleuropneumoniae NG-22 strain (serotype 2), Japanese
encephalitis virus (JEV), Newcastle disease virus, and bovine ephemeral fever (BEF) virus] Will currently available adjuvants be
demonstrated high adjuvant activity and stability with minimum adverse effects. Although suitable for use via non-invasive
promising, more work is needed to ascertain the efficacy and safety of this original preparation. routes of vaccine delivery?

Can novel adjuvants help design

Of all the emulsion types, mineral oil-based W/O emulsions show superior efficacy. However,
vac-cines that elicit long-term
O/W emulsions have a greater safety profile. Therefore, a novel emulsion type with good memory responses and exhibit a
adjuvanticity and safety profile is eagerly awaited [129]. Researchers have focused on formu- broad spec-trum of action against
lating a submicronized, highly stable, and relatively weakly viscous novel emulsion vaccine constantly mutating pathogens and
emerging infectious agents, such as
delivery system. This was designed to increase the sustainability of antigen release and to
HIV, influ-enza, hemorrhagic fevers,
efficiently activate the innate and adaptive immune systems. To this end, an oleic acid-based and dengue?
nanoemulsion (O/W) was developed for mucosal vaccine delivery (Figure 8B). Mice
immunized intranasally with this emulsion containing standard adjuvant (MPLA) and a model Can we design smart adjuvants that
antigen (i.e., OVA) produced significantly higher antibody levels (sixfold higher in terms of IgG contribute to the development of pro-
tective responses in hosts who are
titers) than control mice immunized with the same adjuvant without emulsion. The emulsion
immunocompromised as a result of, for
was also found to activate APCs, antigen uptake, and B cell proliferation [130]. These results example, HIV infection, cancer, and
clearly demon-strated that an antibody class switch (IgG and IgA) occurred and that high- organ and stem cell transplanta-tion, or
affinity antibodies were produced following mucosal immunization (Figure 8B). Interestingly, various diseases, such as asplenia,
congenital immune deficien-cies,
this delivery system could be used to significantly reduce the antigen and adjuvant doses chronic inflammatory/autoim-mune
required without impacting the induced cellular and humoral immunity [130]. conditions, or cerebrospinal fluid leaks?

Concluding Remarks and Future Directions

Protein subunit or inactivated vaccines are usually less immunogenic than traditional vaccines.
Therefore, to improve their immunogenicity, co-administration with an adjuvant is required.
Adjuvants act via activation of the innate immune system and provide key signals that
modulate the adaptive immune response. This results in the priming of antigen-specific Th
cells that exhibit signature cytokine profiles (Th1, Th2, and Th17) associated with protection.

Basic research on adjuvants has come a long way in identifying and or synthesizing novel
molecules that exhibit potent immunostimulatory properties with minimal adverse effects.
These included autoimmune diseases (rabies vaccine), disseminated encephalomyelitis
(small pox vaccine), and paralysis of children (polio vaccine). New vaccine adjuvants
currently in clinical use, such as MF59 and AS03, minimize the number of injections, and
exhibit fewer adverse effects and improved vaccine efficacy.

Many preclinical and clinical studies have demonstrated the use of purified TLR agonists
as adjuvants. Ligands of TLR4 are currently used in human licensed vaccines for the
prevention of HPV and HBV infections [9,10]. With the increased understanding of TLR4
receptor–ligand interactions, chemists have synthesized new compounds that exhibit
immunostimulatory properties with minimal adverse effects. Such work has led to the
development of novel Pam3CSK4 analogs [12], such as carbohydrate di- and tri-lipidated
cysteine-based 1,2,3-triazoles that exhibit adjuvant properties in vaccine formulations
against bacterial, viral, and protozoan infections, and against cancer [27].

Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy 19

 TIPS 1446 No. of Pages 23

By making changes to the carbohydrate and lipid scaffolds (e.g., with the introduction of a linker),
saponin mimics have been developed that enhance the immune response. However, despite
intensive research on a-GalCer components, which resulted in numerous analogs and mimics,
disappointing data have been reported in the literature. The new analogs that we have briefly
described in this review show potential because they elicit strong Th cell responses. However, at this
stage, more work is needed for further exploring the immunomodulatory responses of these novel
molecules in the context of various antigens, and notably against tumors.

Non-invasive vaccine delivery remains a primary focus of research that could impact mass
vaccination campaigns worldwide [131–133]. In this context, developing vaccine formulations
that are safe, effective, and available at low cost is a priority (see Outstanding Questions).
Stringent strategies should be followed for the development of vaccine formulations that
include adjuvants, that result in the desired immune responses, that have immunopotentiating
activity that result in]FID$T879[long-term immunity and protection. Extensive research has
already led to the development of several novel adjuvants that are currently being evaluated in
clinical trials or have been licensed. Along this line, research efforts have focused on
developing novel lipid-containing adjuvants that are safe and improve the efficacy of vaccine,
notably for non-invasive delivery. However, detailed information regarding the interactions
between cell surface recep-tors after stimulation by adjuvant molecules and the compatibility of
these novel adjuvants with existing or novel formulations is required. As our understanding of
the molecular mechanisms involved in immune protection improves, and with the advent of
new methods in synthetic chemistry, considerable breakthroughs in vaccine development,
along the lines of those summarized here, are anticipated in the near future. Novel
technologies, such as new glyco-conjugation methods, reverse vaccinology, and next-
generation sequencing techniques, should lead to novel vaccine strategies including, but not
limited to, HBV, pertussis toxin, Lyme borreliosis, and HPV. Such vaccines could be developed
with or without adjuvants [134]. Thus, the goal of the research community is to ensure a high
level of broad protection by building new concepts that are no longer based on structural
vaccinology (given the variability of target epitopes and the constant emergence of new
pathogens and tumor antigens), but on introducing new immunostimulants and novel delivery
systems that combine efficacy (with longlasting memory immune responsiveness) and safety.

Author Contributions
All the authors listed made substantial direct and intellectual contributions to this article and approved it for publication.

Acknowledgments
We thank Dennis Klinman for insightful comments. Some figures were made from the material provided by Servier Medical
Art (www.servier.fr) under the CC 3.0 FR license. Research in S.M.’s laboratory is funded by the French Centre National de
la Recherche Scientifique (CNRS), the Laboratory of Excellence Medalis (ANR-10-LABX-0034), and the EquipEx program
I2MC (ANR-11-EQPX-022), Initiative of Excellence (IdEx), Strasbourg University, France. Research in H.M.S.K.’s labora-
tory is funded by the Council of Scientific and Industrial Research (CSIR), Government of India for the founding of the 12th
five-year plan CSC0205 (Development of Novel Vaccine Adjuvant, DENOVA). S.R.B. thanks the Department of Science and
Technology (DST), Government of India, and the Centre Franco-Indien pour la Promotion de la Recherche Avancée
(CEFIPRA) for the award of a Raman-Charpak fellowship.

References
1. Kaushik, D. and Sehgal, D. (2008) Developing antibacterial
vaccines in genomics and proteomics era. Scand. J.
Immunol. 67, 544–552
2. Leclerc, C. and Ronco, J. (1998) New approaches in
vaccine development. Immunol. Today 19, 300–302
3. Nascimento, I. and Leite, L. (2012) Recombinant vaccines
and the development of new vaccine strategies. Braz. J.
Med. Biol. Res. 45, 1102–1111
4. Chan, Y.K. and Gack, M.U. (2016) Viral evasion of intracellular
DNA and RNA sensing. Nat. Rev. Microbiol. 14, 360–373
5. Marciani, D.J. (2003) Vaccine adjuvants: role and
mechanisms of action in vaccine immunogenicity. Drug
Discov. Today 8, 934–943
6. Akira, S. et al. (2006) Pathogen recognition and innate
immunity. Cell 124, 783–801
7. Hoebe, K. et al. (2004) The interface between innate and
adap-tive immunity. Nat. Immunol. 5, 971–974

20 Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy

 TIPS 1446 No. of Pages 23
8. Thompson, A.G. and Thomas, R. (2002) Induction of
immune tolerance by dendritic cells: implications for
preventative and therapeutic immunotherapy of autoimmune
disease. Immunol. Cell Biol. 80, 509–519
9. Giannini, S.L. et al. (2006) Enhanced humoral and memory
B cellular immunity using HPV16/18 L1 VLP vaccine
formulated with the MPL/aluminium salt combination (AS04)
compared to aluminium salt only. Vaccine 24, 5937–5949
10. Tong, N.K.C. et al. (2005) Immunogenicity and safety of an
adjuvanted hepatitis B vaccine in pre-hemodialysis and
hemo-dialysis patients. Kidney Int. 68, 2298–2303
11. Leroux-Roels, G. (2010) Unmet needs in modern
vaccinology: adjuvants to improve the immune response.
Vaccine 28, C25–C36
12. Allison, A.C. and Byars, N.E. (1991) Immunological
adjuvants: desirable properties and side-effects. Mol.
Immunol. 28, 279–284
13. Petrovsky, N. and Aguilar, J.C. (2004) Vaccine adjuvants: cur-rent
state and future trends. Immunol. Cell Biol. 82, 488–496
14. Nalla, N. et al. (2015) Design, synthesis and immunological
evaluation of 1, 2, 3-triazole-tethered carbohydrate-Pam 3
Cys conjugates as TLR2 agonists. Bioorg. Med. Chem. 23,
5846–5855
15. Kumar, S. et al. (2017) Carbon nanotubes: a novel material
for multifaceted applications in human healthcare. Chem.
Soc. Rev. 46, 158–196
16. Klinman, D.M. et al. (2015) Use of nanoparticles to deliver
immunomodulatory oligonucleotides. Wiley Interdiscip. Rev.
Nanomed. Nanobiotechnol. 8, 631–637
17. Knudsen, N.P.H. et al. (2016) Different human vaccine adjuvants
promote distinct antigen-independent immunological signa-tures
tailored to different pathogens. Sci. Rep. 6, 19570
18. Buwitt-Beckmann, U. et al. (2005) Toll-like receptor 6-
indepen-dent signaling by diacylated lipopeptides. Eur. J.
Immunol. 35, 282–289
19. Bessler, W.G. et al. (1985) Synthetic lipopeptide analogs of
bacterial lipoprotein are potent polyclonal activators for
murine B lymphocytes. J. Immunol. 135, 1900–1905
20. Takeuchi, O. et al. (2001) Discrimination of bacterial lipoproteins
by Toll-like receptor 6. Int. Immunol. 13, 933–940
21. Takeuchi, O. et al. (2002) Cutting edge: role of Toll-like
receptor 1 in mediating immune response to microbial
lipoproteins. J. Immunol. 169, 10–14
22. Kang, J.Y. et al. (2009) Recognition of lipopeptide patterns
by Toll-like receptor 2-Toll-like receptor 6 heterodimer.
Immunity 31, 873–884
23. Jin, M.S. et al. (2007) Crystal structure of the TLR1-TLR2
het-erodimer induced by binding of a tri-acylated lipopeptide.
Cell 130, 1071–1082
24. Borsutzky, S. et al. (2006) Efficient systemic and mucosal
responses against the HIV-1 Tat protein by prime/boost
vacci-nation using the lipopeptide MALP-2 as adjuvant.
Vaccine 24, 2049–2056
25. Steinhagen, F. et al. (2011) TLR-based immune adjuvants.
Vaccine 29, 3341–3355
26. Halliday, A. et al. (2016) The TLR2/6 ligand PAM2CSK4 is a
Th2 polarizing adjuvant in Leishmania major and Brugia
malayi murine vaccine models. Parasit. Vectors 9, 96
27. Cheng, C. et al. (2011) A TLR2 agonist is a more effective
adjuvant for a Chlamydia major outer membrane protein
vaccine than ligands to other TLR and NOD receptors.
Vaccine 29, 6641–6649
28. Zom, G.G. et al. (2014) Efficient induction of antitumor
immunity by synthetic toll-like receptor ligand–peptide
conjugates. Can-cer Immunol. Res. 2, 756–764
29. Sampathkumar, H.M. et al. Council of Scientific and Industrial
Research. 1,2,3-triazole-tethered carbohydrate-di and tri lipi-dated
cysteine conjugates useful as vaccine adjuvants and process for
preparation thereof, 20160200758
30. Bayik, D. et al. (2016) Structure, mechanism and therapeutic
utility of immunosuppressive oligonucleotides. Pharmacol.
Res. 105, 216–225
31. Klinman, D.M. (2004) Immunotherapeutic uses of CpG
oligo-deoxynucleotides. Nat. Rev. Immunol. 4, 249–259
32. Bode, C. et al. (2011) CpG DNA as a vaccine adjuvant.
Expert Rev. Vaccines 10, 499–511
33. Shirota, H. et al. (2015) CpG oligonucleotides as cancer
vaccine adjuvants. Vaccines 3, 390–407
34. Davis, H.L. et al. (1998) CpG DNA is a potent enhancer of
specific immunity in mice immunized with recombinant
hepatitis B surface antigen. J. Immunol. 160, 870–876
35. Muraoka, D. et al. (2010) Peptide vaccine induces enhanced
tumor growth associated with apoptosis induction in CD8+ T
cells. J. Immunol. 185, 3768–3776
36. Stern, B.V. et al. (2002) Vaccination with tumor peptide in
CpG adjuvant protects via IFN-g-dependent CD4 cell
immunity. J. Immunol. 168, 6099–6105
37. Bianco, A. et al. (2005) Cationic carbon nanotubes bind to CpG
oligodeoxynucleotides and enhance their immunostimulatory
properties. J. Am. Chem. Soc. 127, 58–59
38. Partidos, C.D. et al. (2009) Immunomodulatory consequences of
ODN CpG-polycation complexes. Methods 49, 328–333
39. Fogg, C.N. et al. (2007) Adjuvant-enhanced antibody responses
to recombinant proteins correlates with protection of mice and
monkeys to orthopoxvirus challenges. Vaccine 25, 2787–2799
40. Sun, S. et al. (1998) Type I interferon-mediated stimulation
of T cells by CpG DNA. J. Exp. Med. 188, 2335–2342
41. McCluskie, M.J. and Davis, H.L. (1998) Cutting edge: CpG DNA
is a potent enhancer of systemic and mucosal immune responses
against hepatitis B surface antigen with intranasal administration
to mice. J. Immunol. 161, 4463–4466
42. Chu, R.S. et al. (1997) CpG oligodeoxynucleotides act as
adju-vants that switch on T helper 1 (Th1) immunity. J. Exp.
Med. 186, 1623–1631
43. Beignon, A.S. et al. (2002) Immunization onto bare skin with
synthetic peptides: immunomodulation with a CpG-containing
oligodeoxynucleotide and effective priming of influenza virus-
specific CD4+ T cells. Immunology 105, 204–212
44. Mullen, G.E. et al. (2008) Phase 1 trial of AMA1-C1/Alhydrogel
plus CPG 7909: an asexual blood-stage vaccine for Plasmo-dium
falciparum malaria. PLoS One 3, e2940
45. Cooper, C.L. et al. (2005) CPG 7909 adjuvant improves
hepatitis B virus vaccine seroprotection in antiretroviral-
treated HIV-infected adults. AIDS 19, 1473–1479
46. Speiser, D.E. et al. (2005) Rapid and strong human CD8+ T
cell responses to vaccination with peptide, IFA, and CpG
oligodeox-ynucleotide 7909. J. Clin. Invest. 115, 739–746
47. Valmori, D. et al. (2007) Vaccination with NY-ESO-1 protein
and CpG in Montanide induces integrated antibody/Th1
responses and CD8 T cells through cross-priming.
Proc. Natl. Acad. Sci. U. S. A. 104, 8947–8952
48. Tross, D. and Klinman, D.M. (2008) Effect of CpG
oligonucleo-tides on vaccine-induced B cell memory. J.
Immunol. 181, 5785–5790
49. Minang, J.T. et al. (2014) Enhanced early innate and T cell-
mediated responses in subjects immunized with Anthrax
Vac-cine Adsorbed Plus CPG 7909 (AV7909). Vaccine 32,
6847–6854
50. Lin, A.Y. et al. (2013) Gold nanoparticle delivery of modified
CpG stimulates macrophages and inhibits tumor growth for
enhanced immunotherapy. PLoS One 8, e63550
51. De Titta, A. et al. (2013) Nanoparticle conjugation of CpG
enhances adjuvancy for cellular immunity and memory recall at
low dose. Proc. Natl. Acad. Sci. U. S. A. 110, 19902–19907
52. Cho, H.J. et al. (2000) Immunostimulatory DNA-based
vaccines induce cytotoxic lymphocyte activity by a T-helper
cell-indepen-dent mechanism. Nat. Biotechnol. 18, 509–514
53. Den Brok, M.H. et al. (2016) Saponin-based adjuvants
induce cross-presentation in dendritic cells by intracellular
lipid body formation. Nat. Commun. 7, 13324
54. Richou, R. et al. (1964) Research on saponin, an adjuvant
substance which stimulates immunity: I. Rev Immunol Ther
Antimicrob 28, 49–62 (in French)
Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy 21
 TIPS 1446 No. of Pages 23
55. Bomford, R. (1982) Studies on the cellular site of action of
the adjuvant activity of saponin for sheep erythrocytes. Int.
Arch. Allergy Appl. Immunol. 67, 127–131
56. Dalsgaard, K. (1974) Saponin adjuvants. Archiv fuer die
gesamte Virusforschung 44, 243–254
57. Soltysik, S. et al. (1993) Adjuvant activity of QS-21
Isomers. Ann. N. Y. Acad. Sci. 690, 392–395
58. Jacobsen, N.E. et al. (1996) Structure of the saponin
adjuvant QS-21 and its base-catalyzed isomerization
product by 1H and natural abundance 13C NMR
spectroscopy. Carbohydr. Res. 280, 1–14
59. Ragupathi, G. et al. (2011) Natural and synthetic saponin
adju-vant QS-21 for vaccines against cancer. Expert Rev.
Vaccines 10, 463–470
60. Eggermont, A.M. et al. (2013) Adjuvant ganglioside GM2-
KLH/ QS-21 vaccination versus observation after resection
of primary tumor> 1.5 mm in patients with stage II
melanoma: results of the EORTC 18961 randomized phase
III trial. J. Clin. Oncol. 31, 3831–3837
61. Mahmoudi, S. and Keshavarz, H. (2017) Efficacy of phase 3 trial
of RTS, S/AS 01 malaria vaccine in infants: a systematic review
and meta-analysis. Hum. Vaccin. Immunother. Published online
January 6, 2017. http://dx.doi.org/10.1080/
21645515.2016.1271686
62. Rts, S. et al. (2012) A phase 3 trial of RTS, S/AS01 malaria
vaccine in African infants. N. Engl. J. Med. 367, 2284–2295
63. Kennedy, J.S. et al. (2008) The safety and tolerability of an
HIV-1 DNA prime–protein boost vaccine (DP6-001) in
healthy adult volunteers. Vaccine 26, 4420–4424
64. Vandepapelière, P. et al. (2008) Vaccine adjuvant systems
con-taining monophosphoryl lipid A and QS21 induce strong
and persistent humoral and T cell responses against
hepatitis B surface antigen in healthy adult volunteers.
Vaccine 26, 1375–1386
65. Leroux-Roels, G. et al. (2015) Vaccine Adjuvant Systems
con-taining monophosphoryl lipid A and QS-21 induce
strong humoral and cellular immune responses against
hepatitis B surface antigen which persist for at least 4 years
after vaccina-tion. Vaccine 33, 1084–1091
66. Von Eschen, K. et al. (2009) The candidate tuberculosis
vaccine Mtb72F/AS02A: tolerability and immunogenicity in
humans. Hum. Vaccin. 5, 475–482
67. Vellas, B. et al. (1792) 2009) Long-term follow-up of patients
immunized with AN: reduced functional decline in antibody
responders. Curr. Alzheimer Res. 6, 144–151
68. Fernández-Tejada, A. et al. (2014) Development of a
minimal saponin vaccine adjuvant based on QS-21. Nat.
Chem. 6, 635–643
69. Slovin, S.F. et al. (2005) Carbohydrate vaccines as
immunother-apy for cancer. Immunol. Cell Biol. 83, 418–428
70. Bhunia, D. et al. (2015) Design, synthesis, and evaluation of
novel 1, 2, 3-triazole-tethered glycolipids as vaccine
adjuvants. Archiv der Pharmazie 348, 689–703
71. Murphy, N. et al. (2010) R-Galactosylceramides and analogues
Important immunomodulators for use as vaccine
adjuvants. Carbohydr. Chem. 36, 64–100
72. Fowlkes, B. et al. (1987) A novel population of T-cell
receptor ab-bearing thymocytes which predominantly
expresses a single Vb gene family. Nature 329, 251–254
73. Bonifaz, L.C. et al. (2004) In vivo targeting of antigens to
matur-ing dendritic cells via the DEC-205 receptor improves
T cell vaccination. J. Exp. Med. 199, 815–824
74. Silk, J.D. et al. (2004) Utilizing the adjuvant properties of CD1d-
dependent NK T cells in T cell–mediated immunotherapy.
J. Clin. Invest. 114, 1800–1811
75. Kim, S. et al. (2008) Glycolipid ligands of invariant natural killer T
cells as vaccine adjuvants. Expert Rev. Vaccines 7, 1519–1532
76. Laurent, X. et al. (2014) Switching invariant natural killer T
(iNKT) cell response from anticancerous to anti-
inflammatory effect: molecular bases: miniperspective. J.
Med. Chem. 57, 5489– 5508
22 Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy
77. Koch, M. et al. (2005) The crystal structure of human CD1d with
and without a-galactosylceramide. Nat. Immunol. 6, 819–826
78. Zajonc, D.M. et al. (2005) Structure and function of a potent
agonist for the semi-invariant natural killer T cell receptor.
Nat. Immunol. 6, 810–818
79. Banchet-Cadeddu, A. et al. (2011) The stimulating
adventure of KRN 7000. Org. Biomol. Chem. 9, 3080–3104
80. Borg, N.A. et al. (2007) CD1d–lipid-antigen recognition by
the semi-invariant NKT T-cell receptor. Nature 448, 44–49
81. Yoshimoto, T. and Paul, W.E. (1994) CD4pos, NK1.1pos T
cells promptly produce interleukin 4 in response to in vivo
challenge with anti-CD3. J. Exp. Med. 179, 1285–1295
82. Carnaud, C. et al. (1999) Cutting edge: cross-talk between cells
of the innate immune system: NKT cells rapidly activate NK cells.
J. Immunol. 163, 4647–4650
83. Li, X. et al. (2017) Co-localization of a CD1d-binding
glycolipid with an adenovirus-based malaria vaccine for a
potent adjuvant effect. Vaccine 5, 3171–3177
84. Verma, Y.K. et al. (2015) Design, synthesis, and immunological
evaluation of benzyloxyalkyl-substituted 1, 2, 3-triazolyl a-GalCer
analogues. ACS Med. Chem. Lett. 7, 172–176
85. Hammond, K. and Godfrey, D. (2002) NKT cells: potential
tar-gets for autoimmune disease therapy? Tissue Antigens
59, 353–363
86. Kobashi, K. et al. (2000) Down-regulation of IL-18 receptor
in cancer patients: its clinical significance. Anticancer Res.
21, 3285–3293
87. Smyth, M.J. et al. (2000) Differential tumor surveillance by natu-
ral killer (NK) and NKT cells. J. Exp. Med. 191, 661–668
88. Biron, C.A. and Brossay, L. (2001) NK cells and NKT cells in
innate defense against viral infections. Curr. Opin. Immunol.
13, 458–464
89. Miyamoto, K. et al. (2001) A synthetic glycolipid prevents auto-
immune encephalomyelitis by inducing TH2 bias of natural killer
T cells. Nature 413, 531–534
90. Fujii, S.I. et al. (2003) Activation of natural killer T cells by a-
galactosylceramide rapidly induces the full maturation of den-dritic
cells in vivo and thereby acts as an adjuvant for combined CD4
and CD8 T cell immunity to a coadministered protein.
J. Exp. Med. 198, 267–279
91. Kopecky-Bromberg, S.A. et al. (2009) Alpha-C-
galactosylcer-amide as an adjuvant for a live attenuated
influenza virus vac-cine. Vaccine 27, 3766–3774
92. Gonzalez-Aseguinolaza, G. et al. (2002) Natural killer T cell
ligand a-galactosylceramide enhances protective immunity
induced by malaria vaccines. J. Exp. Med. 195, 617–624
93. Huang, Y. et al. (2008) Enhancement of HIV DNA vaccine
immunogenicity by the NKT cell ligand, a-
galactosylceramide. Vaccine 26, 1807–1816
94. Ko, S.-Y. et al. (2005) a-Galactosylceramide can act as a nasal
vaccine adjuvant inducing protective immune responses against
viral infection and tumor. J. Immunol. 175, 3309–3317
95. Artiaga, B.L. et al. (2016) a-Galactosylceramide protects
swine against influenza infection when administered as a
vaccine adjuvant. Sci. Rep. 6, 23593
96. Guichard, G. et al. (1994) Antigenic mimicry of natural L-pep-tides
with retro-inverso-peptidomimetics. Proc. Natl. Acad. Sci.
U. S. A. 91, 9765–9769
97. Boeckler, C. et al. (1996) Immunogenicity of new heterobifunc-
tional cross-linking reagents used in the conjugation of synthetic
peptides to liposomes. J. Immunol. Methods 191, 1–10
98. Tandrup Schmidt, S. et al. (2016) Liposome-based adjuvants for
subunit vaccines: formulation strategies for subunit antigens and
immunostimulators. Pharmaceutics 8, 7
99. Milicic, A. et al. (2012) Small cationic DDA: TDB liposomes as
protein vaccine adjuvants obviate the need for TLR agonists in
inducing cellular and humoral responses. PLoS One 7, e34255
100. Reed, S.G. et al. (2013) Key roles of adjuvants in modern
vaccines. Nat. Med. 19, 1597–1608
101. Saroja, C. et al. (2011) Recent trends in vaccine delivery
sys-tems: a review. Int. J. Pharm. Investig. 1, 64
 TIPS 1446 No. of Pages 23
102. Beck, Z. et al. (2015) Detection of liposomal cholesterol and
monophosphoryl lipid A by QS-21 saponin and Limulus poly-
phemus amebocyte lysate. Biochim. Biophys. Acta 1848,
775–780
103. Billeskov, R. et al. (2016) Testing the H56 vaccine delivered
in 4 different adjuvants as a BCG-booster in a non-human
primate model of tuberculosis. PLoS One 11, e0161217
104. Yan, D. et al. (2015) The application of virus-like particles as
vaccines and biological vehicles. Appl. Microbiol. Biotechnol.
99, 10415–10432
105. Wang, J.W. and Roden, R.B. (2013) Virus-like particles for
the prevention of human papillomavirus-associated
malignancies. Expert Rev. Vaccines 12, 129–141
106. Metz, S.W. et al. (2013) Chikungunya virus-like particles are more
immunogenic in a lethal AG129 mouse model compared to
glycoprotein E1 or E2 subunits. Vaccine 31, 6092–6096
107. Akahata, W. et al. (2010) A virus-like particle vaccine for epi-
demic Chikungunya virus protects nonhuman primates
against infection. Nat. Med. 16, 334–338
108. Spohn, G. et al. (2010) A VLP-based vaccine targeting
domain III of the West Nile virus E protein protects from
lethal infection in mice. Virol. J. 7, 146
109. Schnurr, M. et al. (2009) ISCOMATRIX adjuvant induces
efficient cross-presentation of tumor antigen by dendritic
cells via rapid cytosolic antigen delivery and processing via
tripeptidyl pepti-dase II. J. Immunol. 182, 1253–1259
110. Drane, D. et al. (2009) Priming of CD4+ and CD8+ T cell
TM
responses using a HCV core ISCOMATRIX vaccine: A phase I
study in healthy volunteers. Hum. Vaccin. 5, 151–157
111. Lövgren Bengtsson, K. et al. (2011) ISCOM technology-
based Matrix MTM adjuvant: success in future vaccines
relies on for-mulation. Expert Rev. Vaccines 10, 401–403
112. Jacobs, C. et al. (2011) An ISCOM vaccine combined with a
TLR9 agonist breaks immune evasion mediated by
regulatory T cells in an orthotopic model of pancreatic
carcinoma. Int. J. Cancer 128, 897–907
113. Lycke, N. (2004) From toxin to adjuvant: the rational design
of a vaccine adjuvant vector, CTA1-DD/ISCOM. Cell
Microbiol. 6, 23–32
114. Fox, C.B. et al. (2013) Technology transfer of oil-in-water
emul-sion adjuvant manufacturing for pandemic influenza
vaccine production in Romania. Vaccine 31, 1633–1640
115. Stavaru, C. et al. (2016) Technology transfer of oil-in-water
emulsion adjuvant manufacturing for pandemic influenza
vac-cine production in Romania: preclinical evaluation of
split virion inactivated H5N1 vaccine with adjuvant. Hum.
Vaccin. Immun-other. 12, 1009–1026
116. Banzhoff, A. et al. (2008) MF591-adjuvanted vaccines for
sea-sonal and pandemic influenza prophylaxis. Influenza
Other Respir. Viruses 2, 243–249
117. Mohan, T. et al. (2013) Novel adjuvants & delivery vehicles for vaccines
development: a road ahead. Indian J. Med. Res. 138, 779
118. Bojang, K.A. et al. (2001) Efficacy of RTS, S/AS02 malaria
vaccine against Plasmodium falciparum infection in semi-
immune adult men in The Gambia: a randomised trial.
Lancet 358, 1927–1934
119. Garçon, N. et al. (2007) GlaxoSmithKline Adjuvant Systems
in vaccines: concepts, achievements and perspectives.
Expert Rev. Vaccines 6, 723–739
120. Garçon, N. et al. (2012) Development and evaluation of AS03, an
Adjuvant System containing a-tocopherol and squalene in an oil-
in-water emulsion. Expert Rev. Vaccines 11, 349–366
121. Didierlaurent, A.M. et al. (2009) AS04, an aluminum salt-and
TLR4 agonist-based adjuvant system, induces a transient
local-ized innate immune response leading to enhanced
adaptive immunity. J. Immunol. 183, 6186–6197
122. Baldwin, S.L. et al. (2012) The importance of adjuvant
formula-tion in the development of a tuberculosis vaccine. J.
Immunol. 188, 2189–2197
123. Gregoriadis, G. et al. (2012) Vaccines: New Generation Immu-
nological Adjuvants, Springer Science & Business Media
124. Sivakumar, S. et al. (2011) Vaccine adjuvants–current
status and prospects on controlled release adjuvancity.
Saudi Pharm. J. 19, 197–206
125. Petrovsky, N. (2015) Comparative safety of vaccine
adjuvants: a summary of current evidence and future needs.
Drug Saf. 38, 1059–1074
126. Slingluff, Jr et al. (2003) Clinical and immunologic results of
a randomized phase II trial of vaccination using four
melanoma peptides either administered in granulocyte-
macrophage col-ony-stimulating factor in adjuvant or pulsed
on dendritic cells. J. Clin. Oncol. 21, 4016–4026
127. Aucouturier, J. et al. (2002) Montanide ISA 720 and 51: a
new generation of water in oil emulsions as adjuvants for
human vaccines. Expert Rev. Vaccines 1, 111–118
128. Miyahara, T. et al. Juridical Foundation, The Chemo-Sero-
Ther-apeutic Research Institute. Oil adjuvant vaccine and
method for preparing same, EP 0781559 A2
129. Pérez, O. et al. (2012) Human prophylactic vaccine
adjuvants and their determinant role in new vaccine
formulations. Braz. J. Med. Biol. Res. 45, 681–692
130. Sravanthi, V. et al. (2015) Oleic acid nanoemulsion for nasal
vaccination: Impact on adjuvanticity based immune
response. J. Drug Deliv. Sci. Technol. 28, 56–63
131. Holmgren, J. and Czerkinsky, C. (2005) Mucosal immunity
and vaccines. Nat. Med. 11, S45–S53
132. Vajdy, M. et al. (2004) Mucosal adjuvants and delivery
systems for protein-, DNA-and RNA-based vaccines.
Immunol. Cell Biol. 82, 617–627
133. Azegami, T. et al. (2014) Challenges in mucosal vaccines for the
control of infectious diseases. Int. Immunol. 26, 517–528
134. Rappuoli, R. et al. (2011) Vaccine discovery and translation
of new vaccine technology. Lancet 378, 360–368
135. Calabro, S. et al. (2013) The adjuvant effect of MF59 is due
to the oil-in-water emulsion formulation, none of the
individual com-ponents induce a comparable adjuvant
effect. Vaccine 31, 3363–3369
136. Mosca, F. et al. (2008) Molecular and cellular signatures of
human vaccine adjuvants. Proc. Natl. Acad. Sci. U. S. A.
105, 10501–10506
137. Didierlaurent, A.M. et al. (2014) Enhancement of adaptive
immu-nity by the human vaccine adjuvant AS01 depends on
activated dendritic cells. J. Immunol. 193, 1920–1930
138. Garçon, N. and Van Mechelen, M. (2011) Recent clinical
expe-rience with vaccines using MPL-and QS-21-containing
adjuvant systems. Expert Rev. Vaccines 10, 471–486
139. Morel, S. et al. (2011) Adjuvant System AS03 containing a-
tocopherol modulates innate immune response and leads to
improved adaptive immunity. Vaccine 29, 2461–2473
140. Künzi, V. et al. (2009) Immunogenicity and safety of low
dose virosomal adjuvanted influenza vaccine administered
intrader-mally compared to intramuscular full dose
administration. Vac-cine 27, 3561–3567
141. Miles, A.P. et al. (2005) Montanide1 ISA 720 vaccines:
quality control of emulsions, stability of formulated antigens,
and com-parative immunogenicity of vaccine formulations.
Vaccine 23, 2530–2539
142. Sidiq, T. et al. (2011) A novel sarsasapogenin glycoside
from Asparagus racemosus elicits protective immune
responses against HBsAg. Immunol. Lett. 135, 129–135
143. Colovai, A.I. et al. (2004) Flow cytometric analysis of normal
and reactive spleen. Mod. Pathol. 17, 918–927
Trends in Pharmacological Sciences, Month Year, Vol. xx, No. yy 23