Você está na página 1de 6

27/03/2015

Replicação do material genético Relação entre DNA, RNA e proteína


nas células

Atividade celular
Replicação do DNA
Célula eucariótica Célula procariótica

Experimeto de Meselson e Stahl (1958)


Experimento de Meselson e Stahl (1958)

Purificação do
DNA, seguido de
centrifugação em
gradiente de
CsCl

geneticavirtual.webnode.com.br

1
27/03/2015

Resultado esperado para cada possibilidade: Replicação


do DNA

O mecanismo de
replicação está
baseado no
pareamento das
bases da dupla
hélice do DNA.

A estrutura do
DNA contém a
informação
necessária para
perpetuar sua
seqüência de
bases
www.visionlearning.com

A replicação do cromossomo circular Replicação em E. coli

Fita nova

Apenas um
replicon

Replicação em “cromossomo” bacteriano circular - E. coli

Demonstração da bidirecionalidade no DNA viral SV40


Micrografia, bolha de replicação

Forquilhas de replicação

2
27/03/2015

DNA polimerase
DNA polimerases: enzimas
*Necessita de dNTPs que sintetizam DNA
* É ativa na presença de Mg2+
Exigências da
*Extremidade 3’ OH livre (primer) DNA-polimerase
*Filamento molde de DNA
A síntese de DNA ocorre pela
adição de nucleotídeos a
3’ACTTGACGGATCTTACGATAACGATGCAGCTAAGC 5’ extremidade 3´OH da cadeia em
crescimento. O precursor da
síntese é o desoxirribonucleotídeo
5´trifosfato
UGAACUGCC
5’ 3’
Sentido da síntese sempre é
DNA polimerase 5’  3’

Em E. coli são encontradas 3 DNAs polimerases bem


descritas (mais duas já foram encontradas, a IV e V)

DNA polimerase I – Atividade de polimerase 5’ 3’


Ligações fosfodiéster (reparo do DNA) Atividade de exonuclease 5’ 3’
unem os nucleotídeos Atividade de exonuclease 3’ 5’
nas cadeias poliméricas
do DNA e RNA DNA polimerase II – Reparo do DNA (polimerase 5’ 3’ )
Atividade de exonuclease 3’ 5’

DNA polimerase III - Atividade de polimerase 5’ 3’


Atividade de exonuclease 3’ 5’

DNA-polimerase III holoenzima (forma completa): enzima


Visão geral da replicação
multimérica com pelo menos 20 polipeptídeos.

,  e  -
cerne catalítico
da DNA
polimerase
 - revisão

Duas
subunidades  Auto-radiografia e M.E. – DNA está sendo replicado na
mesma direção

3
27/03/2015

As duas fitas são sintetizadas de maneiras diferentes Fragmentos de


Okasaki ocorrem
A síntese de DNA requer um iniciador (primer) de RNA na fita
descontínua
Síntese da Fita descontínua
A DNA
anterior Fragmento Último fragmento Fita simples exposta DNA parental polimerase III é
responsável pela
síntese da maior
parte do DNA
Fita descontínua A DNA
Fita contínua
polimerase I
remove o primer
de RNA e
preenche as
Síntese da Fita Contínua lacunas
Nucleotídeos adicionados continuamente na extremidade 3’ A DNA ligase
sela as quebras

Síntese dos fragmentos de Okazaki Replicação nas duas forquilhas da


mesma bolha

http://biochemhelp.com/dna-replication-in-prokaryotes.html http://apphsbio.blogspot.com.br/2013/12/homework.html

Início da replicação em O complexo de replicação


E.coli
Uma única origem de replicação A proteína DNA B
em E.coli (OriC, 245 pb) (helicase) é responsável
pelo movimento para frente
da forquilha

Primossomo = Cada core catalítico da


helicase (DnaB) + primase DNA Polimerase III
sintetiza uma das fitas-
filhas
SSB = Single Strand Binding
proteins (proteinas ligadoras em Proteínas SSB mantém
fita simples) as fitas parentais separadas

4
27/03/2015

Replicação causa supertorção da fita TOPOISOMERASES (DNA girase)


de DNA
 Topoisômerases → enzimas que, quando presentes, promovem
a quebra transitória nas pontes fosfodiéster adicionando ou
removendo superenrolamentos.
• A enzima permanece ligada covalentemente ao DNA e permite
que as fitas passem umas sobre as outras.
• Estas enzimas mostram-se presentes tanto em células
procarióticas como eucarióticas.

Aspectos específicos da replicação em O genoma eucariótico apresenta várias origens de replicação


Eucariotos

Ciclo celular

G0

A replicação ocorre de maneira bidimensional


A velocidade da forquilha de replicação eucariótica é 2000pb/min. (Em E. coli
atinge a velocidade de ~ 30.000/min).

Replicação do DNA resultará em replicação DNAs polimerases em eucariotos


cromossômica (pelo menos 15)

DNA polimerase /primase – inicia a síntese em


ambas as fitas
DNA polimerase  - (fita contínua)
DNA polimerase  - (fita descontínua)
Replicação do DNA é o
processo de auto-
DNA polimerase - replicação do DNA mitocondrial
duplicação do material
genético mantendo (Outras: reparo, meiose, substituição de bases, etc.)
asssim o padrão de
herança ao longo das
gerações.

5
27/03/2015

Telômeros Síntese dos telômeros

Por hoje é só!


Envelhecimento precoce

Progéria