Você está na página 1de 22

11/05/2012

Evolução Molecular
Reconstruções Filogenéticas e
Sistemática

Professor Fabrício R Santos


fsantos@icb.ufmg.br
Departamento de Biologia Geral, UFMG
2012

Taxonomia e Classificação Hierárquica


Sistemática e Taxonomia
O sistema taxonômico desenvolvido inicialmente por
• Sistemática é o estudo dos relacionamentos entre Linnaeus tem duas características principais:
grupos de organismos e a classificação hierárquica i) a designação de um nome duplo (binômio) a cada
em diferentes táxons – é um antigo ramo da espécie, e
ii) um sistema de agrupamento destas espécies.
biologia clássica.
Um binômio (nome latino de duas partes) é designado unicamente para
 A Taxonomia é parte da Sistemática e se cada espécie, no qual o primeiro é o nome genérico, e os dois nomes são
refere à nomenclatura e identificação de ditos específicos.
espécies. Seus princípios foram Trichechus inunguis
inicialmente estabelecidos por Carolus Homo sapiens
Linnaeus (1707-1778). Arabidopsis thaliana
Escherichia coli
Chromobacterium violaceum

O sistema de classificação das espécies segue uma hierarquia A Sistemática Filogenética conecta a
de categorias crescentes que formalizam o agrupamento de
diversidade biológica à história evolutiva
organismos, o qual deve ser feito a partir do reconhecimento
da história de ancestralidade comum das espécies.
Filogenia = A história evolutiva de uma espécie ou grupo de espécies
A nomenclatura binomial da espécie é a primeira relacionadas.
etapa no agrupamento: espécies derivadas do
Filogenia é geralmente representada como árvores filogenéticas
mesmo ancestral comum imediato são geralmente
que traçam relacionamentos evolutivos inferidos, revelando a
agrupadas no mesmo gênero.
história de ancestralidade comum entre espécies.
As demais categorias são mais amplas, isto é,
agrupam táxons de acordo com ancestrais comuns Sistemática = O estudo e classificação da diversidade biológica em um
mais e mais antigos: contexto evolutivo.
• Gêneros são agrupados em uma Família, pois A diversidade biológica reflete episódios passados de especiação
compartilham um ancestral comum recente. e macroevolução.
• Famílias são agrupadas em Ordens, que se
Taxonomia = Identificação, nomeação e classificação de espécies; é um
agrupam em Classes, que são agrupadas em Filos,
que se agrupam em Reinos e um dos 3 Domínios.
componente da sistemática.

1
11/05/2012

Organismos podem ser


Que são árvores?
representados em um
diagrama (árvore) que
ilustra seus
relacionamentos
evolutivos.

Usando dados
morfológicos e
moleculares, podemos
estimar os ancestrais
comuns inferidos pelos
pontos de divergência
nas árvores Charles Darwin (1837)
filogenéticas. Anotações sobre padrões de especiação nos Tentilhões de Galápagos

Árvore Filogenética
n1 OTU 1 Topologias equivalentes
n2

OTU 2
n3

OTU 3

n4

OTU 4

n5
raiz OTU 5

OTU 6
No de diferenças
8 7 6 5 4 3 2 1

antiga recente
tempo
n nó interno - ~ ancestral comum inferido que existiu no passado
OTU unidade taxonômica operacional - espécies ou outros táxons (famílias, ordens etc)

Por que árvores? • Evolução é divergência/cladogênese – espécies se


modificam com o tempo - Transformacionismo
Por que representamos evolução como árvore e não outro tipo de gráfico?
Darwin: “Descendência com modificação”

A B C D A B C D
• Por várias razões, reticulação torna-se um
fenômeno raro com o tempo – provavelmente no
Pré-Cambriano eram muito mais comuns as
reticulações devido a transferências gênicas
D A horizontais, fusões de células, etc.

Ciclo, reticulação
C B • Reticulações são difíceis de se representar.

2
11/05/2012

Grou

Árvores reticuladas

Ex: espécies híbridas


de Paeonia sp.

Sang et al., 1997

Filogenia do grou Filogenia do grou


Grus sp japonensis
japonensis japonensis
americana leucogeranus antigone
americana americana
rubicanda
grus
grus grus
vipio
nigrocollis nigrocollis nigrocollis
paradisea
monachus monachus monachus
virgo
canadensis canadensis canadensis

bugeranus bugeranus japonensis bugeranus

virgo virgo Bugeranus virgo

paradisea paradisea paradisea


americana
leucogeranus canadensis leucogeranus
leucogeranus monachus grus
antigone nigricollis antigone
antigone
rubicanda rubicanda
rubicanda
vipio vipio
vipio

Cladograma Árvore UPGMA Árvore sem raiz Árvore UPGMA


Citocromo b Citocromo b

Árvore filogenética Conexão entre classificação e filogenia


para os tentilhões A natureza da ramificação de uma árvore evolutiva reflete o arranjo hierárquico de
de Galápagos táxons (taxa). Esta árvore sugere as afinidades genealógicas entre táxons
subordinados à ordem Carnivora, ou seja, o padrão de especiação para este grupo.
Estas 13 espécies
habitam as Ilhas
Galápagos. Esta
árvore é baseada
em estudos
comparativos de
estruturas do corpo,
especialmente forma
e tamanho dos bicos,
e nos estudos de
campo sobre
isolamento
reprodutivo e
comportamento
alimentar.

3
11/05/2012

Árvores filogenéticas baseadas em sistemática Antiga controvérsia sobre afinidades entre


Dois métodos, comparação de proteínas do sangue e hibridização DNA-DNA, foram
usados para construir esta árvore de espécies de ursos e procionídeos.
focas, leões marinhos e morsas

A relação filogenética entre


Phoecidae, Odobaenidae e
Otaridae já foi
extremamente discutida.
Hoje a família Pinnipedia é
considerada um grupo
monofilético, mas focas
foram previamente
consideradas grupo-irmão
de Lontras (Mustelidae)

Classificação: Reinos e Domínios


Árvores filogenéticas podem nos dar
informações sobre o passado remoto

Qual relação entre procariotos e eucariotos?

Qual a origem das mitocôndrias e dos cloroplastos?

Atualmente a sistemática filogenética reconhece 3 domínios

Origem dos 3 domínios da vida no Pré-Cambriano

4
11/05/2012

Archaea As mitocôndrias são relacionadas filogeneticamente às


Eucariotos a-proteobactérias e são grupo-irmão das Rickettsias

Riquétsias
Mitocôndrias
Rickettsia Mitocôndria
Parasita intracelular Organela intracelular
obrigatório eucariótica
de eucariotos
Nature, 1998
outras bactérias

Árvores nos informam sobre processos recentes Árvores filogenéticas e epidemiologia


de diversificação de populações e espécies

paciente G-y

paciente D-y
paciente G-x

paciente D-x
paciente A-y
paciente A-x
paciente B-y
paciente B-x

paciente C-y
paciente C-x
paciente E-y
paciente E-x

paciente F-y
paciente F-x
Dentista X
Dentista-y

LC02-y

LC03-y
LC02-x
LC03-x

HIVLI
LC09
LC35
Grupos irmãos de
ciclídeos do
Lago Tanganika na África
oriental

Dentista com HIV deu


origem a um surto
regional nos EUA
Freeman e Herron, 1998

Filogenias de agentes infecciosos permitem traçar surtos e pandemias, assim como


auxiliam nas estratégias de controle de epidemias como da gripe H1N1 ou para o
desenvolvimento de vacinas da gripe comum.
Árvore MP C0I (E. Michel, 1999)

Reconstruções filogenéticas e Filogenias dos peixes-bois (Trichechus sp)


Conservação da Biodiversidade
• Filogenética pode ser extremamente útil para estudos de marinho
biodiversidade (inventariamento e classificação) e
estabelecimento de prioridades conservacionistas.

• Medidas de diversidade que utilizam filogenias de africano


sequências de DNA estão agora sendo usadas para
implementar planos de conservação de espécies, priorizar
unidades de conservação, definir unidades de manejo etc.

• Ex: filogenias (e filogeografia) são usadas para identificar amazônico


ESUs (unidades evolutivamente significantes), as quais
representam populações importantes para manter a
dinâmica evolutiva de uma espécie.
10-20 milhões de anos

Vianna et al 2006 Mol Ecol

5
11/05/2012

Populações do clado III do

Filogeografia comparada
Filogenia Filogeografia peixe-boi marinho
(Trichechus manatus)
possuem uma distribuição
restrita às Guianas e ao
Brasil, portanto conformam
marinho
uma unidade evolutiva
independente (ESU) das
demais nesta espécie.

africano

Em estudos da biodiversidade, ambas as abordagens


tentam reconstruir o passado evolutivo das Árvore sem raiz (rede Median Joining)
espécies e de suas populações. amazônico da região controle do DNAmt
Vianna et al 2006 Mol Ecol

B0665
Árvore NJ COI em
99
B0663 D. ochropyga
B0655
99 B0653
B0654
B0656
D. ferruginea
Thamnophilidae
Termos filogenéticos
99 B0369
B0367 R. ardesiaca
B0368
99 B0609
D. squamata
B0317
B0647
• Homologia
99 B0329
B0326
P. leucoptera
B0335

99
B0658
B0644
B0657
M. loricata • Analogia
99 B0677
B0678 T. major
B0646

99
B0291
B0292
B0290
D. plumbeus
• Convergência, Reversão
99 B0680
B0643 F. serrana
B0660
99 B0281
B0285 D. mentalis • Plesiomorfia – estado ancestral – “0”
99 B1189
B1301
B1188
B1296
H. atricapillus
(Simplesiomorfia)
99
B1186 S. cristatus
B1303

90
99 B0525
B0524
99 B0515
T. doliatus • Apomorfia – estado derivado – “1”
B0511
T. caerulescens
(Autapomorfia - Sinapomorfia)
99
90 B0513
82 B0528
Análises filogenéticas 99 B0535
T. ambiguus
91 B0562
permitem o uso do DNA 99 B1148

como identificador de espécies


B1147
B1150
T. pelzelni
Vilaça et al. 2006

Analogia
Homologia:
um caráter (ancestral ou derivado) compartilhado
Espécies: 1 2 3 4
entre duas ou mais espécies, o qual estava presente
Estado do caráter:
no ancestral comum destas.

Analogia:
caráter “compartilhado”, mas não herdado do
ancestral comum (i.e., o caráter evolui duas vezes,
independentemente): evolução convergente (ou
paralela) e reversão ao estado ancestral. A este estado ancestral

caráter recorrente damos o nome de Homoplasia.


Nas spp. 1 e 3 há uma analogia (caráter análogo) ou homoplasia;
Origem independente – evolução paralela ou convergente .

6
11/05/2012

Homologia Ancestral (0) Homologia Derivada (1)


Espécies: 1 2 3 4 Espécies: 1 2 3 4
Estado do caráter: Estado do caráter:

estado ancestral estado ancestral

Nas spp. 1, 3 e 4 há uma homologia ancestral (simplesiomorfia); é ancestral porque Nas spp. 1 e 2 aparece um caráter homólogo derivado (sinapomorfia). Aconteceu uma
está presente na base da árvore, no ancestral comum de todas 4 spp atuais. transição do estado “basal” ou primitivo no ancestral imediato destas duas spp ou OTUs.

Origem das Homoplasias Evolução Convergente = Aquisição de características


similares em espécies de diferentes linhagens, devido
Convergência: origem independente do ao compartilhamento de nichos ecológicos similares (a
caráter (i.e., duas linhagens fixam seleção natural explica a existências destas adaptações
paralelamente um “fenótipo” similar). análogas ou homoplasias).
Exemplos:
asas de pássaros e morcegos
Reversão: origem e subsequente perda, ou bicos de aves e monotremados
mutação “de volta” ao caráter ancestral (i.e.,
reversão ao estado plesiomórfico). Evolução convergente também se dá no nível
molecular: sequências de DNA e proteínas podem
sofrer mudanças paralelas, reversões, etc

Evolução
Convergente e Um grupo monofilético:
Seleção Natural
é um grupo de táxons que inclui o
Similaridades aparentes entre
marsupiais australianos e
mamíferos placentários em outros
ancestral comum e todos seus
continentes.
Estas espécies ocupam nichos
descendentes
parecidos nos diferentes
continentes.
também podemos chamá-lo de clado

7
11/05/2012

Exemplo de grupo não monofilético: Répteis Famílias monofiléticas


Hyllobatidae Pongidae Hominidae

O ancestral comum mais recente


dos répteis viventes também
deu origem às aves.

Considerando a paleontologia que considera que


mamíferos descendem também de répteis, este
ancestral comum é ainda mais antigo. Filogenia dos grandes símios sem cauda

Famílias parafiléticas
Hyllobatidae Pongidae Hominidae
Abordagens filogenéticas

Fenética
(Taxonomia numérica)

Esta classificação equivocada


Cladística
não representa a história
evolutiva das espécies
(Sistemática Filogenética)

Filogenia dos grandes símios sem cauda

Fenética MÉTODOS FENÉTICOS


Análise de vários caracteres Matriz de Construção
• Abordagem Clássica (desde Linnaeus). dissimilaridade
(fenótipos, sítios polimórficos em base ao número de de árvore
de DNA, freq. alélicas, etc.) diferenças filogenética
• Agrupa espécies baseada na similaridade
fenotípica (ou genotípica). A B C A B C Fenograma
A
A 0
• Usa todas características distinguíveis.
B 3 0 B

• Ex: métodos baseados em distâncias C 7 6 0 C

(UPGMA) Relações de
similaridade

8
11/05/2012

Cladística Cladística
• Baseia-se no padrão de ancestralidade comum e
• A Teoria Evolutiva postula que grupos de
modificação das espécies e não em mera
organismos relacionados descendem de um
similaridade.
ancestral comum.
• Deve usar apenas caracteres derivados
• Sistemática Filogenética (Cladística) é um método
(apomórficos) compartilhados (sinapomórficos ou
de classificação taxonômica baseado na história
homólogos derivados).
evolutiva.
• Portanto, objetiva traçar a história evolutiva real, o
 Foi desenvolvido em 1950 por padrão de descendência com modificação.
Willi Hennig, um entomologista
• Ex: métodos baseados em caracteres (parcimônia).
alemão.

MÉTODOS CLADÍSTICOS Caracteres utilizados


Análise de vários caracteres
Construção de
com estados ancestrais (0) e árvore filogenética Analogias Homologias Homologias
derivados (1) Ancestrais Derivadas
Cladograma
1
A B C D E E
2 3
1
D
2
3
4
Fenética Sim Sim Sim
4 5 6
C
5
6 B
7
7 8
8 A

Relações de
Cladística Não Não Sim
ancestralidade comum

“Eventos Reais” Fenética Cladística

Cavalo Besouro Borboleta Cavalo Besouro Borboleta Cavalo Besouro Borboleta

Inferências filogenéticas

9
11/05/2012

“Eventos reais” Fenética Cladística

Lagarto Jacaré Ave Ave Lagarto Jacaré Lagarto Jacaré Ave

Inferências filogenéticas

O objetivo da inferência filogenética é resolver a ordem de


Análise Filogenética ramificação das linhagens nas árvores evolutivas:
Não-resolvida Filogenia Completamente resolvida,
Dado um conjunto de dados ou filogenia tipo “estrela” parcialmente resolvida filogenia bifurcada
(caracteres morfológicos, A A A
alinhamento de múltiplas
B C E
sequências de DNA e
proteína, etc), pode-se inferir C E C
Tempo

o relacionamento ancestral
dentre as espécies. D B B

E D D

Esp.1 Esp.2 Esp.3 Esp.4


Politomia ou multifurcação uma bifurcação

O número de árvores sem raiz aumenta


Há 3 possíveis árvores sem raiz para
exponencialmente com o número de táxons
4 táxons (A, B, C, D)
A B
# táxons # árvores sem raiz
árvore 1 árvore 2 árvore 3
C A C 3 1
A C A B A B 4 3
5 15
B D 6 105
7 945
C
B D C D D C A D 8 10.935
9 135.135
10 2.027.025
Métodos de reconstrução (ou inferência) filogenética objetivam descobrir qual das árvores é a B E . .
“mais provável". . .
Espera-se que esta seja a “verdadeira” árvore biológica — aquela que seguramente represente A C . .
D
a história evolutiva dos táxons analisados – mas esta é formalmente chamada de árvore . .
inferida a partir dos dados, cuja confiança pode ser testada por diferentes métodos. 30 3,58 x 10 36
B F E

10
11/05/2012

Inferir relacionamentos evolutivos entre os


O enraizamento em outra posição:
táxons requer enraizar a árvore
B
B C
C
raiz
Note que nesta árvore árvore sem raiz

Raiz D
D enraizada, o táxon A não
árvore sem raiz está mais estreitamente A
A
relacionado ao táxon B A
A B C D B
em relação a C ou D C D árvore enraizada
como sugerido acima. Note que nesta árvore
árvore enraizada
enraizada, táxon A é mais
Raiz
raiz
estreitamente relacionado ao
táxon B, enquanto o C é mais
relacionado ao D.

Uma árvore sem raiz de 4 táxons pode ser enraizada em cinco lugares
Cada árvore sem raiz pode teoricamente ser enraizada
distintos para produzir cinco árvores enraizadas diferentes em qualquer lugar ao longo de qualquer de seus ramos
2 4 A C
A C # táxons # árvores x # árvores
1 5 sem raiz # raízes = com raiz
árvore sem raiz:
B D 3 1 3 3
4 3 5 15
B 3 D C 5 15 7 105
A D 6 105 9 945
7 945 11 10.3 95
árvore c/raiz árvore c/raiz árvore c/raiz árvore c/raiz árvore c/raiz 8 10 .395 13 1 35.1 35
1 2 3 4 5 9 135 .135 15 2. 0 27.0 25
B A A C D B E . . . .
A B D C . . . .
B
A C
D . . . .
C C C A A . . 36
. . 38
30 ~3 , 58 x 10 57 ~2 , 04 x 10
D D D B B B F E
Estas árvores representam cinco histórias evolutivas diferentes entre os
táxons, dependendo de onde se coloca a raiz !

Há dois modos principais de enraizar árvores Todos estes rearranjos mostram o mesmo
relacionamento evolutivo entre táxons
Pelo grupo externo (outgroup ):
A A
Usa táxons de referência (o “outgroup”)
C D
que sabidamente se situam fora do grupo
de interesse (o “ingroup”). Requer D C
conhecimento a priori sobre árvore enraizada 1
relacionamentos entre os táxons. O B B
outgroup pode ser uma espécie (ex: aves B
para enraizar uma árvore de mamíferos) ou C D
cópias de genes duplicados (ex: a-globina outgroup A
para enraizar b-globinas). D C

Pelo ponto-médio ou distância: C A A


enraiza a árvore no ponto médio entre os A B B
d (A,D) = 10 + 3 + 5 = 18
dois táxons mais distantes na árvore, tal Ponto-médio = 18 / 2 = 9 D
como determinado pelo tamanho dos B B
10 C
ramos. Pressupõe que os táxons evoluem C D
3 2
coordenadamente (evolução constante
entre linhagens). Esta suposição está B 2 5 D D C
embutida em alguns métodos fenéticos de
A A
construção de árvores tal como o UPGMA.
Todas estas árvores são idênticas

11
11/05/2012

Árvores alternativas sobre relações evolutivas


entre os três “grandes símios” Tipos de árvores filogenéticas
• Cladogramas
– apresenta apenas a topologia da árvore, isto é, o padrão de
ancestralidade comum inferido,
H C G G C H C G H – devem ser enraizadas, geralmente com uso de um grupo externo;
• Árvores Aditivas (Filogramas)
– apresentam ramos proporcionais ao acúmulo de variação,
– nem sempre são enraizadas,
– importante na inferência da evolução do caráter após divergência;

• Árvores Ultramétricas (Dendrogramas)


– mostram ramos proporcionais ao tempo evolutivo entre os táxons,
isto é, assumem o relógio molecular,
A árvore do meio é considerada a “árvore verdadeira”, ou fato – devem ser enraizadas para que haja uma polaridade das
científico, para a história evolutiva destas três espécies. ramificações a partir do ancestral comum.

Conclusões obtidas com dados morfológicos e moleculares nos anos


1990, corroborada atualmente por dados genômicos.

Tipos de árvores filogenéticas

• Cladogramas
A B C D Reconstruções

A B C D filogenéticas com dados


4 2
1
• Árvores Aditivas (Filogramas) 5
2

A B C D
moleculares
• Árvores Ultramétricas (Dendrogramas)
tempo

Variabilidade genética Freqüências alélicas


Fenotípica
Freqüência de um dos alelos em cinco locos
Morfológica bialélicos (A-E) em 3 populações (pop1, 2, 3)
Funcional
POP1 POP2 POP3
Protéica
A - 0,4 A - 0,6 A - 0,3
DNA B - 0,2 B - 0,5 B - 0,2
Macromutações C - 0,9 C - 0,8 C - 0,9
D - 0,1 D - 0,3 D - 0,2
SNP’s – mutações de ponto E - 0,2 E - 0,1 E - 0,4
Inserções de retroposons
Microssatélites Frequências alélicas servem apenas para comparações fenéticas
intra-específicas (estudos comparativos entre populações).

12
11/05/2012

Microssatélites SNPs ou mutações de ponto


AT
AT
AT são multi-alélicos
AT
Single Nucleotide Polymorphisms
AT

CA CA CA CA são geralmente bialélicos


CCG
CCG
CCG
CCG
alelo 0 ...AAGCGTTATAGC...
Alelo 3 CA CA CA
alelo 1 ...AAGTGTTATAGC...
Alelo 5 CA CA CA CA CA

Alelo 7 CA CA CA CA CA CA CA µ = 10-7 a 10-8 / locus / geração


µ= 10-4 a 10-3 / loco / geração

SNPs podem ser utilizados para comparações


Microssatélites servem geralmente apenas para comparações fenéticas intra-
específicas, testes de paternidade, identificação individual etc. cladísticas interespecíficas.

Analogia
SNPs em sequências de DNA
Espécies: 1 2 3 4
* * * ** * * * * * *
A aat tcg ctt cta gga atc tgc cta atc ctg Estado do caráter:
T C T C
B ... ..a ..g ... .a. ... ... t.. ... ..a
C ... ..a ..c ..g ... ..t ... ... ... t.a
D ... ..a ..a ..g ..g ..t ... t.g ..t t..

Cada diferença de nucleotídio é um SNP e considerado


como um caráter na reconstrução filogenética
C estado ancestral

Obs:
Pontos (.) se referem a posições de caracteres inalterados em relação
Nas spp. 1 e 3 há uma analogia (caráter análogo ou homoplasia);
T
Origem independente – evolução paralela ou convergente
à primeira sequência (A)
* Posições com caracteres variáveis entre estas sequências

Homologia Ancestral (0) Homologia Derivada (1)


Espécies: 1 2 3 4 Espécies: 1 2 3 4
Estado do caráter: C Estado do caráter:
T C C T T C C

C estado ancestral C estado ancestral

Nas spp. 1, 3 e 4 há uma homologia ancestral (simplesiomorfia); é ancestral porque C Nas spp. 1 e 2 possuem homólogos derivados (sinapomorfia) (i.e., aconteceu uma T
está presente na raiz da árvore (ancestral comum) como uma plesiomorfia. transição do estado “basal” ou primitivo, no ancestral comum imediato destas duas
spp ou OTUs).

13
11/05/2012

Similaridade vs. relacionamento evolutivo


Tipos de abordagens filogenéticas Similaridade e relacionamento evolutivo não são a mesma coisa, mesmo que
utilizando moléculas relacionamento evolutivo seja inferido de certos tipos de similaridade.

Similar: ser semelhante (uma observação, uma aparência)

Relacionado: genealogicamente conectado (um fato histórico)

Dois táxons podem ser mais similares sem ser mais relacionados:

Fenética Cladística 1
6
Táxon B
1 O táxon C é mais similar ao A (d = 3)
3 Táxon C
Similaridade geral Sistemática filogenética 1
do que ao B (d = 7), mas C e B são
Táxon A
mais estreitamente relacionados: C e
5 B compartilham um ancestral comum
Táxon D
mais recente do que os dois com A.

Tipos de Similaridade Reconstruções filogenéticas alternativas


Similaridade observada entre duas OTUs pode ser por:
Dados morfológicos e Dados morfológicos e
relacionamento evolutivo : análises fenéticas
caracteres ancestrais compartilhados (‘simplesiomorfias’) C DNA com cladística

caracteres derivados compartilhados (‘’sinapomorfias’) C


G
Homoplasia (evolução independente do mesmo estado de caráter):
G
Eventos Convergentes (em OTUs relacionadas ou não), Eventos Paralelos (em
OTUs relacionadas), Reversões (em OTUs relacionadas ou não)

G C C
C G G
T G G
G C C
Convergentes Paralelos Reversões
Métodos baseados em caracteres podem teoricamente discriminar
os tipos de similaridade e encontrar a “verdadeira” árvore
evolutiva .

Tipos de dados usados em inferência filogenética


Métodos gerais de reconstrução filogenética Métodos baseados em caracteres : Usam diretamente os caracteres
alinhados, tais como sequências de DNA ou proteína
Seleciona a árvore que explica os táxons caracteres
espécie A ATGGCTATTCTTATAGTACG
Parcimônia dados com o menor número de espécie B ATCGCTAGTCTTATATTACA
substituições (eventos mutacionais fixados). espécie C TTCACTAGACCTGTGGTCCA
espécie D TTGACCAGACCTGTGGTCCG
espécie E TTGACCAGTTCTCTAGTTCG
Seleciona a árvore que tem a
Verossimilhança maior probabilidade de reproduzir Métodos baseados em distâncias: Transformam os dados em distâncias
(dissimilaridades) par-a-par, e usam a matriz durante inferência da árvore.
os dados observados.
A B C D E
M espécie A ---- 0,20 0,50 0,45 0,40
Desenha a árvore que melhor A espécie B 0,23 ---- 0,40 0,55 0,50
Exemplo 1:
Distância “p”
T
Distância representa as distâncias R espécie C 0,87 0,59 ---- 0,15 0,40 (= percentagem
observada de
I espécie D 0,73 1,12 0,17 ---- 0,25
observadas entre os pares. Z espécie E 0,59 0,89 0,61 0,31 ----
sequências
diferentes)

Exemplo 2: distância Kimura 2-parâmetros


(estimativa do número real de substituições entre táxons)

14
11/05/2012

Algoritmos baseados em distâncias


Estima-se primeiro qual árvore sem raiz seria (agrupamento)
a mais “correta”
A C Usam distâncias para calcular árvores filogenéticas. Estas são
baseadas somente no número relativo de similaridades e
diferenças entre um grupo de seqüências.

B D – Começa com uma matriz de distâncias par-a-par


– Estes métodos constróem uma árvore ligando os pares de
táxons menos distantes, sucessivamente ligando táxons
Alguns métodos fenéticos produzem a árvore já com a raiz (UPGMA). mais distantes.
Os métodos cladísticos podem fornecer árvores com raiz se os dados – Ex: UPGMA (típico método fenético) e
possuem informação suficiente (Parcimônia, Verossimilhança), mas
geralmente utilizam ou necessitam obrigatoriamente de um grupo Neighbor joining (NJ) que considera diferentes taxas
externo para produzir uma árvore com raiz (Parcimônia, evolutivas entre linhagens.
Verossimilhança, Bayesiano, Neighbor Joining)

Distâncias entre DNA UPGMA


• distâncias entre pares de seqüências de DNA são relativamente • O mais simples dos métodos de distância é o UPGMA (Unweighted
Pair Group Method using Arithmetic averages) e apenas reconstrói
simples de computar como a soma de diferenças de bases entre as
fenogramas que representam meras relações de similaridade geral.
duas seqüências.
• Assume taxas evolutivas idênticas para todas as OTUs.
– Este tipo de algoritmo somente funciona para pares de • Agrupa as distâncias menores e recalcula novas distâncias através
sequências similares o bastante para serem alinhadas de médias aritméticas para novo agrupamento.
• Geralmente todas alterações de bases são consideradas iguais • Os programas do pacote PHYLIP DNADIST and PROTDIST calculam
distâncias genéticas entre grupos de seqüências criando uma
• Inserções/deleções geralmente possuem um peso maior do que matriz de dissimilaridades (distâncias).
substituições nucleotídicas (gap penalties). • Então o programa NEIGHBOR (que também constrói árvores NJ) do
• É também possível corrigir múltiplas substituições em um único sítio, PHYLIP constrói a árvore UPGMA a partir da matriz.
que é comum em relacionamentos filogenéticos distantes e para
• Esta árvore é visualizada em um programa apropriado (Ex:
TREEVIEW ou PTP).
sítios de rápida evolução.

Métodos de Distância Métodos de Distância

dij a b c d d
ij a b c d d a b c
a 0
a ACGA a 0 b 0,5 0
c 0,75 0,25 0
b ATGC b 0,5 0 d 0,5 1,0 0,75 0

c GTGC c 0,75 0,25 0


d GCAA d 0,5 1,0 0,75 0 Matriz Árvore UPGMA
(mera similaridade)

15
11/05/2012

Métodos de Distância Máxima parcimônia


• Parcimônia é o método mais popular de
d
ij a b c d d c reconstrução cladística dos relacionamentos por
a 0 b ancestralidade comum.
b 0,5 0 a
c 0,75 0,25 0
• Parcimônia permite o uso de toda informação
d 0,5 1,0 0,75 0
evolutiva conhecida para a construção da árvore.
– em contraste, métodos de distância resumem todas
diferenças entre pares de seqüências em um único
Matriz Árvore Neighbor-Joining
(similaridade e número, a percentagem de diferença ou distância
taxas evolutivas diferenciais) genética.

Exemplo de Parcimônia Exemplo de Parcimônia


a c 1 2 3 4
• Considere 4 táxons com as seqüências: a (ACGA),
a A C G A
b (ATGC), c (GTGC), d (GCAA).
árvore 1
b d b A T G C
• A parcimônia deve decidir qual das 3 possíveis árvores
a b c G T G C
sem raiz (4 táxons), é a mais “correta” (parcimoniosa).
d G C A A
• Posteriormente, se houver informações suficientes, deve-
árvore 2
c d
se colocar a raiz, a qual polariza o padrão de ramificações
a b
sequenciais na árvore filogenética.

d árvore 3 c

Exemplo de Parcimônia Exemplo de Parcimônia


Aa c G 1 2 3 4 C a * cT 1 2 3 4
*
a A C G A * a A C G A
árvore 1 árvore 1
Ab d G b A T G C Tb d C b A T G C

c G T G C c G T G C
* = 1 etapa de mutação d G C A A * = 2 etapas de mutação d G C A A
total total
árvore 1 1 árvore 1 1 2
árvore 2 árvore 2
árvore 3 árvore 3

16
11/05/2012

Exemplo de Parcimônia Exemplo de Parcimônia


Ga cG 1 2 3 4 Aa * cC 1 2 3 4
* a A C G A * a A C G A
árvore 1 árvore 1
Gb dA b A T G C Cb dA b A T G C

c G T G C c G T G C
* = 1 etapa de mutação d G C A A * = 2 etapas de mutação d G C A A
total total
árvore 1 1 2 1 árvore 1 1 2 1 2 6
árvore 2 árvore 2
árvore 3 árvore 3

Exemplo de Parcimônia Exemplo de Parcimônia


a c 1 2 3 4 a b
a A C G A Árvore sem raiz
escolhida pela análise
árvore 1
b d b A T G C de parcimônia
árvore 3
d c
a b c G T G C Neste caso temos informações adicionais de que táxon com a sequência
d possa funcionar como um grupo externo (outgroup), portanto a raiz
d G C A A estará entre d e os outros ( ).
árvore 2 total
c d d a b c
a b árvore 1 1 2 1 2 6 Árvore com raiz
árvore 2 2 2 1 2 7 escolhida usando d como
outgroup
árvore 3 árvore 3 2 1 1 1 5
d c

A análise de parcimônia
Exemplo de Parcimônia pode discriminar alguns tipos de
eventos paralelos.
1 2 3 4 Na figura ao lado, 4 sequências
d a b c a A C G A homólogas alinhadas (a) de
1 (A) 1 (A) distintos organismos foram
b A T G C utilizadas para construir uma
4 (C) 2 (T) árvore de parcimônia (b).
c G T G C Na árvore b estão dispostos os
eventos de mutações
3 (G)
d G C A A (apomorfias), numerados de 1 a
8. No evento 2, o estado alélico
derivado (nucleotídio A)
A evolução dos caracteres apomórficos pode ser inferida a partir do Cladograma. demonstrou ser um evento
Assim, eventos paralelos (recorrentes) de mutação podem ser identificados, os paralelo, aparecendo
quais correspondem às homoplasias. independentemente na
seqüência do homem e do
milho.

17
11/05/2012

Máxima verossimilhança
Verossimilhança (L) é a probabilidade dos dados, dado o modelo de
Jukes-Cantor
substituições nucleotídicas e uma hipótese de topologia filogenética (1 parâmetro)

L = P (dados/árvore)

Modelo evolutivo de substituições


Diferentes padrões de substituição nucleotídica específicos de cada
conjunto homólogo de sequências de DNA.

Transição
A G

Transversão
A frequência dos nucleotídios não é considerada
C T Todas substituições têm a mesma taxa

Kimura 2P GTR (General Time Reversible)


(2 parâmetros) (6 parâmetros)
a
f
d e c

b
A frequência dos nucleotídios não é considerada A frequência dos nucleotídios é considerada
Transições e transversões têm diferentes taxas Transições e transversões têm diferentes taxas,
assim como os tipos de mudanças nucleotídicas

Modeltest

O modelo inapropriado de
substituições nucleotídicas
pode levar a uma reconstrução
filogenética incorreta.

O software permite selecionar o modelo de substituição mais plausível para


determinado conjunto de sequências, assim como outros parâmetros
necessários para a reconstrução filogenética.
Posada e Krandal

18
11/05/2012

Dados reais:
mudanças observadas e esperadas Máxima verossimilhança
• Comparação de sequências de chimpanzé e homem no Método baseado na avaliação probabilística de modelos evolutivos
DNAmt (307/1333 sítios são diferentes) que melhor explicam um conjunto de dados de forma que este reflita
• Modelos com mais parâmetros se aproximam mais do a história evolutiva mais próxima da realidade
padrão observado LT = L (1) x L (2) x L (3) x L (4) x..x L (N) =  L (i)
C A A A
1 2 3 4 5 6 7 L(5) = Prob x
C G
Táxon a A A G A C T T C A
A C
Táxon b A G C C C T T
Prob x
C G
Táxon c A G A T A T C
C C T A
Táxon d A G A G G T C Prob x
C G
a c a b a c Prob ... x
C N N A
Modelo que mais b d c d d b Prob
se aproxima ao C G
observado

Problemas e cuidados na
reconstrução filogenética
Taxas de mutação/evolução

• As taxas evolutivas são diferentes para cada gene ou


segmento anônimo de DNA, e também em diferentes
escalas de tempo.
• As homoplasias levam à saturação dos dados, isto é,
aumentam os erros de reconstrução filogenética.
• As estimativas temporais estão sujeitas a calibrações
do relógio molecular e podem ter erros associados.
• Árvores filogenéticas contam a história do caráter, do
gene, mas não necessariamente da espécie, pois é
uma associação (inferência) histórica.

Saturação em sequências de DNA Relação entre a taxa de mutação espontânea


e a taxa de evolutiva (de substituição)
Existem pontos-quentes de mutação.
Algumas regiões estão mais sujeitas ao
acúmulo de substituições, portanto
também apresentam mais homoplasias
(alelos recorrentes) que atrapalham a
reconstrução filogenética.

Um problema decorrente
da saturação é o que
chamamos de “atração de
ramos longos”, nos quais
grupos divergentes ficam
parecendo mais próximos
do que realmente são.
A taxa estimada de acúmulo de novos variantes é maior em tempos recentes, pois
em longo prazo há o aumento da homoplasia (saturação) e outros processos que
113 mascaram o reconhecimento dos eventos de mutação.

19
11/05/2012

Calibração do relógio molecular Estimando taxas evolutivas


A B A B
A B
Separação recente
Separações antigas taxas rápidas
taxas lentas

As calibrações destas taxas podem ser feitas por análises diversas utilizando:

Registro fóssil Biogeografia Reamostragens Genealogias

116

Taxas evolutivas moleculares Erros de calibração com fósseis

6 M.A.

6 M.A.

Exemplo
taxa = 0,06 diferenças / 6 M.A. em um determinado gene Muitas vezes o fóssil usado para calibrar o “relógio” é mais
taxa = 0,01 / M.A. ou 1% por milhão de anos neste gene.
recente que a divergência genética, portanto as datas
estimadas com estas taxas podem ser subestimativas.

O processo do coalescente Erro de calibração do Coalescente


Presente

Isolamento
reprodutivo

Passado
Divergência
genética

Divergência genética precede o isolamento reprodutivo


119

20
11/05/2012

Exemplo de escalas Exemplo de


temporais em escalas temporais
em filogenias
filogenias
Correlação entre
divergência,
especiação, mudanças
climáticas e
especialização de
A evolução da hábitats em Tiranídeos.
eussocialidade em
abelhas halictídeas está Floresta húmida

associada a um período F. húmida dossel


geológico de
temperaturas amenas. Semi-aberto

Hábitat aberto

Brady et al. 2006. PRSB Ohlson et al. 2008 Zool.Sc.

Árvores de genes e de espécies


• A história evolutiva dos genes reflete aquela Esta é uma árvore
que representa só a
das espécies que os carregam, exceto história dos genes e
quando: não dos táxons.

– Transferência horizontal = transferência gênica entre Primatas


espécies (ex. entre bactérias, mitocôndrias em híbridos)
– Duplicação gênica : ortologia/ paralogia Mamíferos

Incongruência entre
árvores de genes e de
espécies

Associações históricas Eventos entre gene (associado)


e a espécie (organismo)

Transferência
Horizontal

Evento
de triagem

Associado
Codivergência

Espécie Duplicação

Page e Charleston, 1998 Page e Charleston, 1998

21
11/05/2012

Reconstrução da filogenia de espécies:


artefatos devido à paralogia

especiação GNS1 GNS2


duplicação

GNS1 GNS1 GNS1 GNS2 GNS2 GNS2 GNS GNS GNS


Hamster Rat Mouse Rat Mouse Hamster Hamster Mouse Rat

Árvore obtida com amostragem


Árvore verdadeira parcial de genes parálogos

Perda de genes pode acontecer durante a Evolução: mesmo sequências


com genomas completos pode ser difícil detectar paralogia (duplicação).
Algumas linhagens gênicas podem ter sido perdidas (eventos de triagem).

22

Você também pode gostar