Você está na página 1de 45

1º Simulado 2007 - Estilo UFC

1º Simulado 2010 – Estilo ENEM 1


Prova de Conhecimentos Gerais

CIÊNCIAS DA NATUREZA E
SUAS TECNOLOGIAS
Questões de 1 a 45

Questão 01
Observe o seguinte anúncio:

A propaganda acima citada está relacionada à divulgação de um cosmético de grande aceitação no mercado e com benefícios
comprovados. As zonas quadriculadas preservam a marca do produto. A partir da análise acima, indique a afirmação verdadeira.
a) O pH da pele é ligeiramente básico, logo existe uma falha na divulgação quando se afirma que a composição natural da superfície da
pele é neutra.
b) O pH da pele é neutro, logo a divulgação está correta ao divulgar que a composição natural da superfície da pele é neutra.
c) O pH da pele é ligeiramente ácido, logo existe uma falha na divulgação quando se afirma que a composição natural da superfície da
pele é neutra.
d) O pH da pele é ligeiramente ácido, mas não existe falha na divulgação quando se afirma que a composição natural da superfície da
pele é neutra.
e) O pH da pele é ligeiramente ácido, mas não existe falha na divulgação pois esta não afirma que a composição natural da superfície da
pele é neutra.

RESPOSTA: E
Comentário:
O pH da pele é ligeiramente ácido (≅ 6,5) sendo este seu pH ótimo. Percebe-se pela leitura do enunciado que o anúncio em nenhum
momento afirma sobre o valor do pH da pele.

diferentes entre si. Portanto, as células podem se dividir por


Questão 02 mitose e/ou meiose.
A todo momento, os seres vivos pluricelulares perdem muitas
células do próprio corpo, como, por exemplo, quando ocorrem Com relação, ao exposto acima, assinale a alternativa correta.
ferimentos, quando os alimentos passam pelo trato digestório e a) Os processos de mitose e meiose ocorrem em todos os
ate mesmo quando há o envelhecimento celular, mas, graças a seres vivos.
um processo de divisão celular, a mitose, as células somáticas b) O numero cromossômico permanece igual após ambos os
são repostas diariamente. No entanto, para uma célula se dividir processos, contudo as células que realizam o segundo tipo
em duas novas células iguais, ela deve passar por um processo de divisão celular sofrem a permuta gênica, o que gera
anterior de multiplicação do seu conteúdo. Essa etapa e variabilidade genética.
conhecida como interfase. c) A transcrição de RNA ocorre principalmente na interfase.
Existe um segundo tipo de divisão celular, a meiose, que ocorre Durante os processos de divisões, a transcrição diminui,
somente nas células gaméticas. Esse processo permite que o chegando ate a inativação.
número cromossômico das espécies seja mantido após o evento d) Na fase de metáfase, os fusos mitóticos se ligam aos
da fecundação e que os indivíduos sejam geneticamente telômeros dos cromossomos.

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


2 1º Simulado 2010 – Estilo ENEM

e) Tanto na anáfase da mitose quanto nas anáfases I e II da viagem da semana passada, ao ser surpreendido por uma
meiose, as cromatides irmãs são separadas para os pólos chuva, decide reduzir a velocidade para 60 km/h, permanecendo
opostos. assim até a chuva parar, 20 min depois, quando retorna à sua
velocidade inicial. Essa redução temporária de velocidade fez
RESPOSTA: C com que o tempo da viagem do Raul aumente, com relação à
Comentário: estimativa inicial, em:
O mecanismo de transcrição consiste na transferência da a) 4 min
informação genética do DNA para o RNAm; Através da tradução b) 6 min
essa informação é expressa na produção de uma molécula c) 8 min
peptídica (proteína) específica. Esse processo ocorre d) 10 min
basicamente na intérfase, uma vez que iniciada a divisão celular e) 12 min
os filamentos cromossômicos condensam-se (espiralizam-se) e
tornam-se inativos. RESPOSTA: C
Comentário:
Sabemos que a distância percorrida por um móvel é numericamente
Questão 03 igual à área sob o gráfico V×t do movimento.
Os gráficos representam o crescimento de dois animais (A e B). As figuras a seguir mostram os gráficos V×t das viagens do Raul
de Fortaleza a Sobral em um dia “sem chuva” e em um dia “com
chuva”. A área total embaixo de cada um dos gráficos V×t deve
ser a mesma, já que corresponde à distância entre as duas
cidades.
V(km/h)
100

distancia
percorrida

t(min)
V(km/h)
100
A1
60
A2

t(min)
Baseado nos mesmos é correto afirmar que: 20 t
a) O animal A, quando adulto, terá um tamanho maior que B.
No gráfico que corresponde à viagem com chuva, a área A1 que
b) O animal B, quando adulto, terá um tamanho maior que A.
c) O animal A tem crescimento limitado. “foi recortada” no meio do gráfico foi compensada pelo
d) O animal B, em momento algum, apresenta o mesmo acréscimo da área A2 no final do gráfico. Essas áreas devem
ser iguais:
tamanho de A.
e) Os animais A e B, num dado momento, podem apresentar o A1 = A2 ⇒ 20 min × (100−60) km/h = ∆t ×100km/h
mesmo tamanho. ∆t = 8 min

RESPOSTA: E
Comentário: Questão 05
Basta passar retas entre os dois gráficos e observar que em O hidrogênio é o elemento químico mais abundante no universo.
certos momentos apresentam o mesmo tamanho. No planeta Terra, ele é o terceiro em ocorrência (após oxigênio e
silício). No entanto, como substância simples, ele representa
apenas 0,81% em volume da atmosfera.
Com base nas informações acima, assinale a alternativa correta.
a) O elemento químico hidrogênio pode formar apenas
compostos covalentes.
Questão 04 b) 11 X 12 Y e 13 Z , não são nuclídeos do elemento químico
O famoso professor Raul Brito viaja para Sobral toda semana hidrogênio.
para lecionar Matemática. Usualmente, ele desenvolve uma
velocidade média de 100 km/h durante todo o percurso. Na
Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br
1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 3
Prova de Conhecimentos Gerais
c) O nuclídeo 12 Y é o deutério, que com o oxigênio forma a
água dura.
d) 0,81% em volume significa que, em 1 L de ar atmosférico
existem 8,1 mL de gás hidrogênio.
e) O átomo de hidrogênio é isoeletrônico com o gás nobre
Hélio, e com o cátion bivalente do Lítio.

RESPOSTA: D
Comentário:
+ −
1 H → 1p : 1e ⎧não são por tan to
+ − ⎪
2 He → 2 p : 2e ⎨ isoeletrôni cos

3 Li
2+
→ 3 p + : 1e − ⎪⎩
O hidrogênio pode formar ligações iônicas, caso esteja ligado
com metais.
X, Y e Z mostrados acima representam isótopos do elemento Estime a freqüência f, em Hz, com que as ondas foram
hidrogênio. produzidas e assinale a opção corresponde à mesma.
O deutério com o oxigênio forma “água pesada”. Logo a a) 0,1 Hz
alternativa correta é a “d”. b) 0,2 Hz
c) 0,3 Hz
d) 0,4 Hz
Questão 06 e) 0,5 Hz
O professor "Django” é um empreendedor. Além de exercer o
magistério, é também horticultor. Querendo expandir suas fontes RESPOSTA: B
de renda, resolveu investir no cultivo de escargots. Adquiriu um Comentário:
exemplar da espécie Achatina fubica e colocou-o em sua horta. Do gráfico, nota-se que dois comprimentos de onda estão
Após algum tempo observou a destruição de sua horta pela ação associados ao tempo de 10s. Logo, o período é T = 5s. Como a
de um elevado número de escargots. Ficou “pasmo”, pois era freqüência é o inverso do período, vem:
impossível a invasão da horta pelos referidos animais. Com base 1 1
no texto e seus conhecimentos, é correto afirmar que: f = = = 0,2 Hz (opção “b”)
a) a espécie utilizada para iniciar o cultivo de escargots realiza T 5
reprodução assexuada.
b) o animal cultivado não pertence à classe gastropoda.
c) o número de animais aumentou como resultado de Questão 08
fecundação cruzada. Implante de eletrodos no cérebro traz
d) a espécie usada para iniciar a criação não é monóica.
paciente de volta à vida
e) a espécie citada é do gênero Achatina e do filo mollusca.
Agência FAPESP - 03/08/2007

RESPOSTA: E Um paciente, norte-americano de 38 anos, que, após ter sido


Comentário: vítima de agressão, estava no que se chama de estado de
Se só havia um animal não pode ter havido fecundação cruzada. consciência mínima. Sua única forma de comunicação,
Será do filo mollusca e do gênero Achalina. inconsistente, resumia-se a eventuais movimentos com os dedos
ou com os olhos. Após seis anos nesse estado, o paciente
deixou de precisar se alimentar por meio de tubos e recuperou a
Questão 07 capacidade de se expressar verbalmente.
A propagação de ondas na água é estudada em grandes
tanques, com detectores e softwares apropriados. Em uma das
extremidades de um tanque, de 200 m de comprimento, um
dispositivo D produz ondas na água, sendo que o perfil da
superfície da água, ao longo de toda a extensão do tanque, é
registrado por detectores em instantes subseqüentes. Um
conjunto de ondas, produzidas com freqüência constante, tem
seu deslocamento y, em função do tempo, representado ao lado,
tal como registrado por detectores fixos na posição x = 15 m.
Para esse mesmo conjunto de ondas, os resultados das
medidas de sua propagação ao longo do tanque são
apresentados na página de respostas. Esses resultados
correspondem aos deslocamentos y do nível da água em
relação ao nível de equilíbrio (y = 0 m), medidos no instante
t = 25 s para diversos valores de x. A partir desses resultados:
Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br
4 1º Simulado 2010 – Estilo ENEM

Implante de eletrodos Questão 09


A causa de tamanha e extremamente rara recuperação de uma Na cidade de Fortaleza, praças e avenidas são iluminadas com
lesão cerebral traumática se deve ao sucesso inédito - e que lâmpadas de vapor de sódio (luz amarela) e vapor de mercúrio
está sendo considerado revolucionário - de um procedimento (luz branca). Como sabemos a descarga elétrica através desses
conhecido como estimulação cerebral profunda (ECP). A cirurgia gases, promove a emissão de luz, como conseqüência dos
envolve o implante de eletrodos para promover impulsos saltos dos elétrons.
elétricos em determinadas regiões cerebrais. Os médicos Com relação a este fenômeno, marque a alternativa verdadeira.
responsáveis pelo procedimento, usaram a ECP para induzir a) A luz branca e a luz amarela possuem a mesma intensidade,
funções dentro das redes cerebrais residuais e ainda funcionais. sendo constituídas por fótons com diferentes energia.
Segundo os pesquisadores, se os resultados forem replicados b) Ao saltar de uma órbita para outra mais externa, o elétron
em outros casos, poderão mudar os padrões de cuidado desses emite energia radiante.
pacientes crônicos, que passarão a contar com a possibilidade c) Ondas eletromagnéticas são liberadas no instante em que o
de tratamentos e acompanhamentos clínicos reabilitativos. elétron passa do estado fundamental para o estado excitado.
d) No estado excitado o elétron acumula a energia absorvida
A figura mostra, em um certo instante, a situação de um paciente durante a descarga elétrica.
no qual eletrodos são aplicados em pontos A, B e C, separados e) A luz amarela e a luz branca são emitidas por ondas
pelas distâncias indicadas. De B para c o potencial elétrico eletromagnéticas de diferentes freqüências e mesmo
cresce de 1 mV e de A para C, de 2 mV. comprimento de onda.

RESPOSTA: D
Comentário:
O elétron acumula a energia e a emite durante seu regresso de
uma órbita mais externa para outra mais interna.

Questão 10
O jogo-da-velha é um jogo popular, originado na Inglaterra. O
nome “velha” surgiu do fato de esse jogo ser praticado, à época
em que foi criado, por senhoras idosas que tinham dificuldades
de visão e não conseguiam mais bordar. Esse jogo consiste na
disputa de dois adversários que, em um tabuleiro 3 X 3, devem
conseguir alinhar verticalmente, horizontalmente ou na diagonal,
3 peças de formato idêntico. Cada jogador, após escolher o
formato da peça com a qual irá jogar, coloca uma peça por vez,
em qualquer casa do tabuleiro, e passa a vez para o adversário.
Supondo, para fins de estimativa, que o campo elétrico E ao Vence o primeiro que alinhar 3 peças.
longo do segmento AB seja uniforme e tenha a direção de AB, Substituindo os tradicionais símbolos do “famoso” jogo-da-velha
então E: por artrópodes, sendo: • = Animais Díceros e X = Animais
a) Aponta de A para B e tem módulo 7,5.10-3 V/m Áceros. Analise o tabuleiro abaixo:
b) Aponta de B para A e tem módulo 2,5.10-3 V/m
c) Aponta de B para A e tem módulo 7,5.10-6 V/m
d) Aponta de A para B e tem módulo 2,5.10-3 V/m
e) Aponta de B para A e tem módulo 7,5.10-3 V/m

RESPOSTA: B
Comentário:
1) Note que para esta questão, é necessário conhecermos o
comportamento do campo elétrico uniforme em função da DDP
entre dois pontos. O campo elétrico ele sempre flui de um ponto
de maior potencial em direção ao um ponto de menor potencial
elétrico. E a expressão que mostra tal relação é U = E . d. Onde
na questão a ddp vale entre os ponto B e C vale 1mV e entre A e Obs.: Os números 1, 2, 3, 4 e 5 serão usados para a resolução
C vale 2 mV, então podemos concluir que a ddp entre A e B vale da questão.
1 mV. Como ele pede a intensidade do campo elétrico, para Neste momento é a vez do jogador que utiliza os círculos. Esse
acharmos a resposta precisamos fazer a razão entre 1 mV pela jogador ganhará o jogo se:
distância 0,4 m, onde isso implica em um valor de 2,4 .10-3 V/m. a) Se substituir o número 1 por carrapato.
Ficando então a resposta “B”!!!! b) Se substituir o número 2 por piolho.
c) Se substituir o número 5 por pulga.

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 5
Prova de Conhecimentos Gerais
d) Se substituir o número 3 por borboleta.
e) Se substituir o número 4 por aranha. Questão 12
Com a atual crise no fornecimento de energia elétrica, uma boa
RESPOSTA: D maneira de economizar energia é substituir as lâmpadas
Comentário: incandescentes, que têm um rendimento muito baixo, por
O jogador ganhará o jogo se colocar um animal dícero no lâmpadas fluorescentes. Estas lâmpadas contêm gás neon puro
número 1 ou no número 3. O carrapato é acero, portanto, a ou misturado com argônio a baixa pressão e uma pequena
resposta correta é “c”. Borboleta é animal dícero. quantidade de mercúrio líquido. Quando submetido a uma
tensão elétrica, o gás ioniza-se, baixando sua resistência elétrica
e estabelecendo uma corrente elétrica no seu interior. O
Questão 11 mercúrio, então, vaporiza-se e as sucessivas colisões entre seus
O trecho a seguir foi extraído do artigo "Desencontros sexuais", de átomos e o neon fazem com que eles emitam radiação visível e
Drauzio Varella, publicado na "Folha de S. Paulo", em 25 de ultravioleta. Esta última é absorvida pelo pó fluorescente da
agosto de 2005. camada interior do tubo, que o reemite na faixa da radiação
visível. Esse é o motivo do alto rendimento e baixo consumo de
"Nas mulheres, em obediência a uma ordem que parte de energia dessas lâmpadas.
uma área cerebral chamada hipotálamo, a hipófise libera o
hormônio FSH (hormônio folículo estimulante), que agirá sobre os Considere um feixe de radiação ultravioleta propagando-se no ar
folículos ovarianos, estimulando-os a produzir estrogênios, com uma velocidade de 3,0 x 108 m/s e freqüência de
encarregados de amadurecer um óvulo a cada mês. 1,0 x 1015 Hz. Qual o comprimento de onda, no ar, desta
FSH e estrogênios dominam os primeiros 15 dias do ciclo radiação?
menstrual com a finalidade de tornar a mulher fértil, isto é, de a) 3 x 10–7 m
preparar para a fecundação uma das 350 mil células germinativas b) 8 x 10–7 m
com as quais nasceu." c) 10 x 10–7 m
d) 15 x 10–7 m
O trecho faz referência a um grupo de células que a mulher e) 20 x 10–7 m
apresenta ao nascer. Essas células são
a) ovogônias em início de meiose, presentes no interior dos RESPOSTA: A
folículos ovarianos e apresentam 23 cromossomos. Comentário:
b) ovócitos em início de meiose, presentes no interior dos V = λ⋅f
folículos ovarianos e apresentam 46 cromossomos. → λ = 3 ⋅ 10−7 m
3 ⋅ 108 = λ ⋅ 1015 ⎯⎯
c) ovócitos em fase final de meiose, presentes no interior de
folículos ovarianos e apresentam 23 cromossomos.
d) óvulos originados por meiose, presentes na tuba uterina e
apresentam 23 cromossomos.
e) ovogônias em início de meiose, presentes na tuba uterina e
apresentam 46 cromossomos.

RESPOSTA: B
Comentário:
Ainda na vida intrauterina, a criança do sexo feminino conclui
duas das três etapas de sua gametogênese, a saber, a
multiplicação de ovogônias e seu crescimento, gerando ovócitos
I, células diplóides. A etapa de maturação, uma meiose, é
apenas iniciada, detendo-se na prófase da divisão reducional
(dictióteno). Concordemente, no interior dos folículos ovarianos
da criança, por ocasião de seu nascimento, há milhares de
ovócitos I em meiose iniciada e, portanto, ainda diplóides. Item B

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


6 1º Simulado 2010 – Estilo ENEM

Questão 13
Ao abastecer o veículo em um posto, o consumidor adquire a gasolina “C”, uma mistura de gasolina “A” (pura) com álcool anidro. A
proporção em volume de álcool anidro nessa mistura é determinada por resoluções federais, podendo variar entre 20% e 25%. O teor de
álcool na gasolina deve ser analisado, a fim de aferir a qualidade desse combustível, como ilustrado a seguir:

A partir dos dados da ilustração, é correto afirmar que, em volume, o teor de álcool presente nessa gasolina é de:
a) 32%
b) 68%
c) 66%
d) 20%
e) 24%

RESPOSTA: A
Comentário:

NO INÍCIO TEMOS COM O PASSAR DO TEMPO

100 mL

gasolina + álcool

50 mL

H2O

0 mL

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 7
Prova de Conhecimentos Gerais
Logo temos 16 mL de álcool em 50 mL de gasolina, o que equivale a:

50 mL ___________ 100%
16 mL ___________ X%

X = 32% de álcool na gasolina.

Questão 14
Galileu Galilei foi um físico, matemático, astrônomo e filósofo
italiano que teve um papel preponderante na chamada revolução
científica. Ele desenvolveu os primeiros estudos sistemáticos do
movimento uniformemente acelerado e do movimento do
pêndulo. Descobriu a lei dos corpos e enunciou o princípio da
inércia e o conceito de referencial inercial, idéias precursoras da
mecânica newtoniana.

Considere que uma rampa possua uma extensão de 64 m.


Quando uma bola de sinuca é abandonada do repouso do ponto
mais alto dessa rampa, determine as sucessivas distâncias x1,
x2, x3 e x4 que serão percorridas por essa bola em intervalos de
tempos iguais:
a) 4, 12, 20, 28
b) 3, 9, 18, 34
Galileu melhorou significativamente o telescópio refrator e com
ele descobriu as manchas solares, as montanhas da Lua, as c) 4, 10, 20, 30
fases de Vênus, quatro dos satélites de Júpiter, os anéis de d) 6, 12, 18, 28
Saturno, as estrelas da Via Láctea. Estas descobertas e) 5, 12, 20, 27
contribuíram decisivamente na defesa do heliocentrismo.
Contudo a principal contribuição de Galileu foi para o método
científico, pois a ciência assentava numa metodologia
aristotélica.
Chegou a ser destinado à carreira religiosa, mas o seu pai RESPOSTA: A
queria que fosse médico e por isso inscreveu-o na Universidade Comentário:
de Pisa. No entanto desistiu de estudar medicina e decidiu Pelas proporções de Galileu, temos:
estudar matemática. Foi nessa época que inventou a balança 1X + 3X + 5X + 7X = 64
hidrostática, cujo mecanismo descreveu no breve tratado "La 16X = 64
bilancetta", publicado em 1644. Durante o curso de medicina X=4
descobriu o isocronismo do pêndulo, determinando que o seu Portanto: 3X = 12, 5X = 20, 7X = 28.
período não depende da massa, mas apenas do comprimento
do fio. Foi o primeiro a pensar que este fenômeno permitiria
fazer relógios muito mais precisos, e já no final da sua vida viria
a trabalhar no mecanismo de escapo que mais tarde originaria o
relógio de pêndulo.
Em Pisa realizou as suas famosas experiências de queda de Questão 15
corpos em planos inclinados. Nestas demonstra que a
velocidade de queda não depende do peso. Viagem na memória: o inferno de Auschwitz
Um dos princípios que Galileu estabeleceu foi que, quando um
corpo parte do repouso em MRUV, as distâncias percorridas por Em meados de 1944, em plena Segunda Guerra Mundial (1939-
ele em intervalos de tempo arbitrariamente iguais, são 1945), o jovem combatente da Resistência francesa Charles
diretamente proporcionais aos números ímpares 1, 3, 5, 7, 9, Gottlieb, então com 18 anos, foi detido e colocado em um trem
11.... etc. rumo a um destino desconhecido. Ao desembarcar em seu
paradeiro final, se viu diante de um portal que dava acesso a
Essa propriedade pode ser facilmente compreendida quando se
uma enorme área cercada de arame farpado, vigiada por
analisa as áreas sob o gráfico V x T para esse movimento.
guardas armados e povoada de farrapos humanos, a maioria
vestida com uniformes listrados. A primeira frase que ouviu
ressoa até hoje em sua memória: "Aqui você entra por esse

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


8 1º Simulado 2010 – Estilo ENEM

portão e sai por aquela chaminé", disse seu interlocutor, concentração de Auschwitz para testar o assassinato de
apontando para a fumaça que saía ao longe do topo de uma humanos com o veneno.
torre de tijolos. Quem lhe deu as boas-vindas foi um dos
prisioneiros do campo de Auschwitz-Birkenau, na Polônia. A Com relação ao exposto acima, marque a opção correta.
fumaça a que se referia provinha de um dos fornos crematórios a) Nas câmaras de gás, envenenava-se os prisioneiros por
do complexo, um dos instrumentos da "solução final", o ação do ácido cianídrico (HNC) utilizado na forma de
meticuloso plano de extermínio dos judeus arquitetado pelos vapores.
nazistas. b) O Zyklon B fundamenta-se na asfixia por interação do CO
com os íons ferrosos que gera asfixia por diminuir a ação
das hemoglobinas.
c) Da descarga dos caminhões era eliminado gás cianídrico,
que mata por asfixia.
d) A fumaça dos caminhões é capaz de envenenar uma pessoa
em ambiente fechado pela ação do CO que diminui o
transporte de oxigênio para os tecidos.
e) Não pode-se matar pessoas somente com a ação das
fumaças de caminhão, por isso utilizava-se HCN (ácido
cianídrico).

RESPOSTA: D
Comentário:
Prisioneiros em Auschwitz O monóxido de carbono (composto polar) se liga de forma
estável com o grupo heme da hemoglobina. Assim o oxigênio
não consegue ser transportado aos tecidos gerando asfixia.
Logo o item correto é “d”.

Questão 16
Notícia de um certo jornal de circulação nacional em meados de
abril de 2010: “Polícia Federal prende homem suspeito de ser
um dos maiores traficantes de ECSTASY da Europa para o
Câmaras de gás em Auschwitz Brasil.”
Apesar de ser uma boa notícia, o problema está longe de ser
resolvido. O consumo de drogas entre os jovens cresce a cada
O macabro campo hoje é uma extensa área deserta de ruidoso
dia, no mundo inteiro. No Brasil não é diferente o ECSTASY por
silêncio. Uma grama verde substitui o lodaçal de outrora. Das
exemplo é muito consumido nas “baladas” noturnas e a sua
câmeras de gás, onde os detentos eram asfixiados pelo vapores
combinação com bebidas alcoólicas pode causar conseqüências
do Zyklon B* em uma morte lenta de até 20 minutos, pensando
desastrosas ao usuário!!! O ECSTASY apresenta a estrutura
que se dirigiam para uma ducha, restam ruínas.
representada a seguir:
Duas a três vezes por semana, no meio da madrugada, diz ele,
os alemães fazerem uma inspeção nos dormitórios para
"controle de pulgas". "Era tudo invenção para exterminar mais O NH
CH3
pessoas. Eles escolhiam alguns que diziam estar infectados,
colocavam na parte traseira do caminhão, fechada, com o cano CH3
da descarga inserido no interior. Os prisioneiros morriam no O
caminho e os corpos era desovados diretamente nos fornos para
incineração". Com relação à molécula do ECSTASY assinale a alternativa
Fernando Eichenberg, jornalista correta.
www.terramagazine.terra.com.br a) Apresenta fórmula empírica C11H13O2N
b) Na sua estrutura, existem 4 pares de elétrons não ligantes.
* Zyklon B era a marca registrada de um pesticida a base de c) Não pode ser classificado bioquimicamente como
ácido cianídrico que foi utilizado pelos Nazistas como veneno no alucionógeno.
assassinato em massa por sufocamento em sessões de banho d) Trata-se de uma molécula que apresenta amina secundária,
coletivo nas câmaras de gás. éter cíclico e grupos alquila.
e) É uma molécula aromática com estrutura homocíclica.
O Zyklon B foi inicialmente usado nos campos de concentração
para desinfestar piolhos e evitar o tifo. Em setembro de 1941, as
primeiras experiências foram realizadas no campo de

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 9
Prova de Conhecimentos Gerais
RESPOSTA: D
Comentário: RESPOSTA: D
éter cíclico amina secundária Comentário:
O NH Os resultados fenotípicos resultantes dos cruzamentos na
CH3 alquila
espécie X e na espécie Y (resistrados nos gráficos), sugerem
CH3 que a altura das plantas na espécie X é um caso de dominância
O alquila completa, enquanto que na espécie Y, não há dominância para
éter esse caráter. Assim, todas as mudas de plantas altas da esp. Y
cíclico
são puras (homozigotas); Havendo cruzamentos entre essas
• Molécula aromática e heterocíclica plantas, de qualquer geração, os descendentes serão 100%
• Apresenta cinco pares de elétrons não ligantes altos.
• Fórmula molecular: C11H15O2N
• Fórmula mínima ou empírica: C11H15O2N
Questão 18
A FORÇA G − Nas transmissões de corridas de Fórmula 1 pela
TV, frequentemente é mostrado no canto da tela o medidor
Questão 17 virtual de força g indicando a intensidade da força g que o piloto
Com o enorme crescimento populacional, ha também uma está sentindo em tempo real.
necessidade crescente de alimentos, o que estimula a obtenção
de culturas vegetais com máxima produtividade. Muitas vezes
esse melhoramento lança mão do conhecimento da herança
genética de um determinado carácter como, por exemplo, a
altura. Supondo-se que duas espécies vegetais - X e Y -
poderiam apresentar mudas com alturas diferentes, realizou-se
cruzamento entre mudas altas e baixas das duas espécies (P1),
obtendo F1 que ao serem fenótipos resultantes dos cruzamentos
foram representados nos gráficos a seguir:

Mas afinal o que é a Força G ? É a força fictícia que você sente


para trás, quando acelera o carro bruscamente para frente; Ou
que você sente para frente quando seu carro é bruscamente
freado; Ou que você sente lhe puxando para fora da curva,
quando você faz uma curva fechada. Você sentirá essa força G
sempre que estiver acelerado, portanto, só estará livre dela caso
esteja parado ou em movimento retilíneo sem aceleração.
Por que ela é chamada de força G ? Ora, para fazer uma alusão
à força da gravidade (peso) que também age em você. Por
exemplo, se seu carro dá uma freada muito brusca com uma
Supondo que as plantas altas, tanto da espécie X quanto da aceleração retardatória a = 20 m/s2, essa aceleração equivale a
espécie Y, sejam mais produtivas, pode-se afirmar corretamente duas vezes a aceleração da gravidade (terrestre). Nessa freada
que se obtém na espécie: brusca, dizemos que seu corpo ficará sujeito a força g de
a) X e na espécie Y, 100% de mudas altas ao cruzar mudas
intensidade “2G” empurrando seu corpo para frente. À rigor,
altas em F2;
b) X, 50% de mudas altas ao cruzar as mudas altas em F1; isso significa que, durante essa freada, você se sentirá
c) Y, 100% de mudas altas ao cruzar as mudas médias em F2; empurrado para frente por uma força duas vezes maior do que o
d) Y, 100% de mudas altas ao cruzar mudas altas em P1 com seu próprio peso, ou seja, uma força “2P”.
mudas altas em F2;
e) Y, 100% de mudas altas ao cruzar mudas altas em P1 com
mudas médias em F2.

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


10 1º Simulado 2010 – Estilo ENEM

Freada brusca (a bolinha sai Acelerada forte para frente


do centro e vai para frente) (a bolinha sai do centro e vai
para trás)

A uma velocidade de 370 km/h, os pilotos demoram cerca de 6,5


segundos para percorrer a reta frontal e então enfrentam quase
5G de força nos 6,5 segundos seguintes, enquanto eles
Curva para a esquerda (a Curva para a direita (a contornam a curva. Em seguida, demoram somente cerca de 4
bolinha sai do centro e vai bolinha sai do centro e vai segundos para percorrer a reta oposta antes da próxima curva e
para a direita) para a esquerda) outros 6,5 segundos de quase 5G novamente. Se a corrida
planejada de 966 km tivesse prosseguido até o final, os pilotos
Da mesma forma, digamos que você faça uma curva fechada de
teriam sofrido uma variação de 5G (nas curvas) até quase
raio R com velocidade V no seu carro de Fórmula 1 ☺, com uma
zero G (nas retas) cerca de 800 vezes durante toda a prova
aceleração centrípeta actp = V2/R = 30 m/s2. Essa aceleração
(urra !).
equivale a três vezes a aceleração da gravidade g = 10 m/s2.
Nesse caso, você sentirá seu corpo sendo empurrado A musculatura do pescoço dos pilotos sofre bastante em provas
radialmente para fora da curva com uma força g de intensidade de corrida por causa dessa força G, requerendo grande preparo
“3G”. Em outras palavras, você sentirá uma força fictícia três físico e musculatura treinada para esse tipo de atividade. Que
vezes maior do que o seu peso lhe empurrando para a fora da todo bom piloto tem que ser bom de braço é fácil entender. Mas,
curva, ou seja, uma força “3P”. Nas curvas, essa força também é por este raciocínio, concluímos que todo bom piloto deve
chamada de força “centrífuga”. ser bom também de pescoço !
A força G, na verdade, é uma força fictícia. Quem está fora do
Imagine que você venha de carro na avenida Dom Luiz atrasado
carro, em pé fora no gramado assistindo ao piloto fazer à curva,
para sua aula no Simétrico e entre na rotatória da Praça
não enxerga nem sente essa força. Ela só é percebida, de fato,
Portugal. Quanto maior a sua velocidade na curva, maior será a
por quem está sob o efeito da aceleração.
força g que você sentirá na curva. Entretanto, a sua velocidade
na curva não pode ser grande demais devido ao risco de
Em 29 de abril de 2001, funcionários da CART (Champion Auto
derrapamento caso o atrito no chão seja insuficiente. Sendo o
Racing Teams) cancelaram uma corrida no Texas Motor
coeficiente de atrito estático entre os pneus do carro e o chão
Speedway porque os pilotos tiveram vertigens após apenas
10 voltas. A combinação de altas velocidades e curvas fechadas igual a µE = 1,5 e cinético µC = 1,2, o Prof. Renato Brito pede
do Texas Motor Speedway gera forças de quase 5G nas curvas. que você determine a máxima força g que você poderá sentir ao
A 5G, um piloto experimenta uma força igual a cinco vezes o seu fazer a curva na Praça Portugal:
peso. a) 0,8.G
Os pilotos sofrem um enorme castigo em uma pista como essa. b) 1,0.G
Esse nível de aceleração é maior do que a maioria das pessoas c) 1,2.G
já experimentou. Mesmo um ônibus espacial desenvolve d) 1,5.G
somente 3G na decolagem. O mais surpreendente é o tempo
que esses pilotos toleram esse tipo de força. e) 2,0.G
O autódromo do Texas Motor Speedway tem 2,4 km de
comprimento: a reta frontal tem 686 m de comprimento e a reta RESPOSTA: D
oposta tem 405 m de extensão. Comentário:
Qual a maior velocidade que um carro pode ter numa curva plana
horizontal para não derrapar (escorregar) ? Esse resultado é obtido
lembrando que, na curva, temos:

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 11
Prova de Conhecimentos Gerais
N = P = m.g (eq1) c) Considerando os metais Na, K, Cu, Ag, a prata é o metal que
possui a menor freqüência de corte.
m.V 2 d) Quando a freqüência da luz incidente é maior que a
Fat = (eq2)
R freqüência de corte, verifica-se a emissão de fotoelétrons,
Condição de iminênciade escorregar : independente da intensidade da luz.
Fat =µe .N (eq3) e) Duplicando-se a freqüência da luz incidente, duplica-se a
energia cinética dos fotoelétrons emitidos.
Substituindo eq1 e eq3 em eq2, vem:
m.V 2 V2
RESPOSTA: D
Fat = = µe .N = µe .m.g ⇒ = µe .m.g Comentário:
R R De acordo com a conservação da energia:
v = µ e .R.g ⇒ v max = µe .R.g (eq4) ⎧finc.→ frequência do fóton incidente
hfinc = hfo + EC ⎨
Agora que sabemos a máxima velocidade possível na curva, ⎩fo → frequência de corte
saberemos a aceleração centrípeta máxima que ele consegue Se finc > fo verifica-se emissão de elétrons por parte do metal.
sentir na curva.
2
v max ( µe .R.g)2 µe .R.g
actpmax = = = = µe .g Questão 20
R R R
Para saber quanto vale a força g agindo no motorista nessa situação,
devemos determinar quantas vezes a aceleração centrípeta do
ESTÁ NA INTERNET:
motorista supera a aceleração da gravidade. Para isso, façamos o
quociente entre elas:
Porque a Coca-Cola Zero, que contém Ciclamato, foi
actp µe .g 1,5.g proibida nos Estados Unidos?
n= = = = 1,5
g g g A Coca Cola LIGHT possui: Acesulfame K (16mg/%) e
Aspartame (24mg/%), num total de 40mg/100ml de bebida, de
Assim, a máxima força g que você consegue sentir, ao fazer a
edulcorantes. Já a Coca Cola ZERO tem em sua formulação
curva na Praça Portugal, vale 1,5.G.
Ciclamato de Sódio (27mg%), Acesulfame K (15mg%) e
Aspartame (12 mg%), tornando-a mais doce que a outra - um
total 54mg/100ml de bebida).
Tendo em conta que o edulcorante Ciclamato de Sódio
está terminantemente proibido pelo F.D.A (Federal Drugs
Questão 19 Administration) - Organismo máximo de controle de alimentos
As fotocélulas (ver esquema abaixo), utilizadas em circuitos e drogas dos EEUU da América por comprovados efeitos na
elétricos, são dispositivos que geram e permitem a passagem de gênese de tumores cancerígenos, e mais, que o Ciclamato é
corrente elétrica apenas quando recebem iluminação. muito mais barato que o Aspartame a razão de 10 dólares por
Funcionam, portanto, como interruptores de corrente elétrica quilo do Ciclamato contra 152 dólares/Kg do Aspartame, vem a
acionados pela luz, sendo usadas em máquinas fotográficas, pergunta: Que Coca-Cola você passará a tomar?
alarmes antifurto, torneiras automáticas e portas de http://www.stmt.com.br/cocacola_zero_proibida.html
supermercados.
No pólo negativo da fotocélula, existe uma camada metálica que
facilmente libera elétrons pela ação da luz.
INFORMAÇÃO DO MINISTÉRIO DA SAÚDE:

Esclarecimentos sobre o uso do edulcorante ciclamato em


alimentos
Em resposta a várias demandas recebidas pela Anvisa a
ε− respeito da segurança de uso do aditivo edulcorante ciclamato
em alimentos, em especial em bebidas não alcoólicas com
informação nutricional complementar (por exemplo, refrigerantes
“zero”, “sem açúcar”), informamos o que segue.
As dúvidas quanto à segurança de uso de ciclamato
iniciaram após a observação de que alguns indivíduos e certos
Com relação ao dispositivo citado, podemos afirmar animais eram capazes de metabolizar ciclamato a cicloexilamina
corretamente que: e de que a sua ingestão crônica aumentava a incidência de
a) O metal alcalino mais indicado para a construção da camada tumores de bexiga em ratos. Por esse motivo, o ciclamato foi
metálica, é o lítio. proibido nos EUA em setembro de 1970. Contudo, a FDA
b) Para cada metal, a emissão de fotoelétrons independe da recebeu petição do setor produtivo para revisar essa proibição, a
freqüência do fóton da luz incidente. qual está atualmente em análise.

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


12 1º Simulado 2010 – Estilo ENEM

A pedido da FDA, as informações disponíveis sobre grandes cidades – ao contrário da energia elétrica. Com a rápida
ciclamato foram reavaliadas em 1985 pela National Academy of urbanização assistida no Brasil desde então, esta solução foi
Sciences e pelo National Research Council Committee, os quais sendo a principal adotada, embora convivesse com outras
concluíram que à luz de evidências experimentais e formas de aquecimento da água. De concepção bastante
epidemiológicas, o ciclamato não era carcinogênico. Uma simples, o chuveiro elétrico era constituído de um elemento de
pesquisa feita pelo Instituto Nacional de Câncer dos EUA aquecimento, chamado de "resistência" no Brasil (não confundir
avaliou, durante 17 anos, a ingestão por macacos de com resistor), feito de um fio espiralado composto de metais com
quantidades diárias (cinco vezes por semana) de ciclamato alto ponto de fusão, como o níquel, o cromo ou uma liga dos
equivalentes àquelas constantes em 30 latas de refrigerante dois metais, que ao aquecer, esquenta imediatamente a água,
dietético Esse estudo revelou que nenhum dos animais contraiu um sistema dotado de uma alavanca que abre/fecha a água e
câncer de bexiga. liga/desliga a eletricidade, além do espalhador de água, sempre
Em 1999 o ciclamato foi classificado pela Agência parecido com os tradicionais chuveiros.
Internacional de Pesquisa sobre Câncer (Iarc) como pertencente
ao Grupo 3, isto é, não carcinogênico para humanos. Segundo a
Iarc, “há evidência inadequada em animais de laboratório e em
humanos para a carcinogenicidade de ciclamatos”.
As normas brasileiras que determinam os limites
máximos de aditivos alimentares são elaboradas com base em
referências internacionais, como o Codex Alimentarius (Norma
Geral de Aditivos Alimentares – GSFA), a União Européia e, de
forma complementar, a U. S. Food and Drug Administration
(FDA). Além disso, por acordo firmado no Mercosul, somente
aditivos que constam da Lista Geral Harmonizada – Resolução
GMC n. 11/2006 – podem ser autorizados pelos Estados Partes,
incluindo Brasil. O uso de ciclamato está previsto na GSFA,
considerada a principal referência, e em Diretiva da UE, bem
como na Lista Geral Harmonizada de Aditivos do Mercosul.
http://www.anvisa.gov.br/alimentos/informes/40_020609.htm

Um estudante que morava em no Ceará e estudava no curso


Com base na leitura acima julgue os itens a seguir e marque o Simétrico, na turma do Saúde 10, Passou em Medicina na
correto. Universidade Federal de Porto Alegre, e teve que se mudar, e
a) Pode se perceber que a informação do primeiro site é consigo levou seu chuveiro elétrico. Seu cuidado deveria ser
totalmente confiável tendo várias referências científicas. com a tensão elétrica da nova cidade, pois no Ceará a tensão
b) O site oficial do Ministério da Saúde ratifica as informações elétrica é de 220 V, e ele estava indo para uma região onde a
do www.stmt.com.br/cocacola_zero_proibida.html tensão é de 110 V. Modificações deverão ser feitas na
c) O site inicial afirma que existe 54mg/100mL de ciclamato de resistência do chuveiro para que a potência elétrica dele não
sódio na Coca-cola Zero. sofra modificações.
d) Não se pode confiar no site do Ministério da Saúde pois ele
autoriza o uso de ciclamato, sendo o Brasil e países sub- Com relação à nova resistência do chuveiro e a corrente elétrica
desenvolvidos os únicos a utilizar este edulcorante. que passará através dessa resistência, é correto afirmar que:
e) Segundo o site www.stmt.com.br, existe 54% de peso em a) tanto a resistência original quanto a corrente elétrica
volume de edulcorantes na Coca-cola Zero. quadruplicarão.
b) a resistência original será reduzida à metade e a corrente
RESPOSTA: E elétrica duplicará.
Comentário: c) tanto a resistência original como a corrente elétrica
Segundo o www.stmt.com.br existe um total de 54 mg/100 mL duplicarão.
de edulcorantes na bebida, isto corresponde a 54% de peso em d) a corrente elétrica permanecerá a mesma, não sendo, pois
volume. necessário modificar a resistência original.
e) a resistência original será reduzida à quarta parte e a
corrente elétrica duplicará.

RESPOSTA: E
Questão 21 Comentário:
Para que não haja alteração na potência elétrica do chuveiro
Chuveiro elétrico elétrico, temos:
P=P
i.U = i`.U`
Desenvolvido no Brasil, na década de 1940, o chuveiro elétrico
procurou substituir nesse país a fonte principal de calor – uma
vez que redes de gás eram praticamente inexistentes nas

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 13
Prova de Conhecimentos Gerais
A análise desse expressão, mostra que para a potência elétrica
se manter constante, se houve redução à metade do valor da Questão 23
ddp, a corrente elétrica deverá dobra. O consumo de cachaça, bebida destilada mais consumida no
E se analisarmos: Brasil, deve ser moderado devido ao seu alto teor de etanol
P=P (38% a 48% em volume). Na cachaça, são encontradas algumas
U2/R = U`2/R` substâncias prejudiciais à saúde, como metanol e aldeído
acético. O cobre (presente no material de alguns alambiques)
Se a ddp reduziu a metade, para a manutenção da potência também é um contaminante, cujo teor máximo permitido é 5
elétrica deverá reduzir a quarta parte. Por isso, item correto, “E”. mg/L. A tabela seguinte contém os pontos de ebulição, em
condições ambiente (1 atm e 25ºC), de alguns componentes da
cachaça.

Ponto de ebulição Massa Molar


Composto
(ºC) (g/mol)
Metanol 65,0 32
Questão 22 Etanol 78,5 46
Propan-1-al 97,4 60
JOGO DURO CONTRA O DOPING Etanal (aldeído
21,0 44
acético)
Fifa adota as normas rígidas da agência antidoping para Ácido etanóico
punir quem usar estimulantes na Copa 118,2 60
(ácido acético)
A atitude mais condenável do esporte, o doping, receberá Metanal – 21,0 30
marcação dura e sob pressão na Copa do Mundo (...) A Fifa (...)
considera doping qualquer iniciativa para melhorar a performance Com base nas informações acima, assinale a alternativa correta.
do jogador fora dos parâmetros de treinamento e preparação do a) O etanol tem ponto de ebulição superior ao do aldeído
esporte. As tentativas de alterar ou destruir amostras de urina (...) acético, devido à existência de interações intermoleculares
para exame são também consideradas atos de doping. Os testes do tipo dipolo instantâneo (também chamada ponte de
no futebol são feitos por amostragem. Depois das partidas, dois hidrogênio) no álcool.
jogadores de cada equipe são definidos por sorteio para colher a b) O ponto de ebulição do metanol é superior ao do metanal,
urina. porque no metanal existem ligações de hidrogênio
No maior escândalo de doping da história das Copas, intermoleculares.
Diego Maradona, flagrado após a vitória da Argentina sobre a c) O ácido acético é mais volátil que o etanol.
Nigéria por 2 a 1, no Mundial de 1994, usava esse componente. O d) A fórmula molecular do propan-1-al é C3H8O2
laudo da Fifa mostrou que o craque ingeriu, no dia do jogo, uma e) O ácido acético apresenta ponto de ebulição superior ao do
quantidade dez vezes maior de efedrina do que a média possível propan-1-al, devido à existência de ligações de hidrogênio
de ser encontrada se ele usasse a substância para desentupir o bastante fortes entre as moléculas do ácido, dando origem a
nariz. um dímero.
(Revista Isto é, edição Nº. 1909)
RESPOSTA: E
O(s) processo(s) envolvidos no exame citado no texto, permitindo Comentário:
detectar a efedrina e outras substâncias proibidas no organismo, • No etanol as interações intermoleculares mais intensas são
se denomina(m): as pontes de hidrogênio ou ligações de hidrogênio ou
a) filtração glomerular, apenas. interações de hidrogênio.
b) reabsorção tubular. • As moléculas do metanal não formal entre si pontes de
c) filtração glomerular e secreção tubular. hidrogênio.
d) secreção tubular, apenas. • O ácido acético tem maior PE que o etanol e portanto é
e) reabsorção e secreção tubulares. menos volátil.
• Propanal ou O
CH3 CH2 C (C3H6O)
RESPOSTA: C propan-1al: H
Comentário:
No processo de depuração do sangue pelo rim, as substâncias • propanol-1: CH3 CH2 CH2 OH (C3H8O)
filtradas pelo glomérulo ou secretadas pelos túbulos renais são • O ácido acético estabelece pontos de hidrogênio através de
lançadas ao filtrado (ou urina inicial), sendo detectadas na dímeros:
urina, desde que não sejam reabsorvidas de volta ao sangue. O HO
Assim, só filtração glomerular e secreção tubular contribuem
para eficácia do exame antidoping de urina. H3C C C CH3
OH O

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


14 1º Simulado 2010 – Estilo ENEM

opõe à força aplicada sobre a caixa, e que a esta se soma para


Questão 24 dar uma resultante nula de forças, o que é necessário para
Os meios de comunicação têm noticiado, freqüentemente, que o manter a caixa em repouso, é justamente a força de atrito
Brasil esta se tornando um país de obesos. Os órgãos estático que atua na caixa. A força de atrito estático é em
envolvidos com a saúde pública tem mostrado preocupação módulo igual ao da componente paralela à superfície da força
constante com a dieta do povo brasileiro, pois o tradicional prato aplicada pelo homem, até que o bloco se mova. Entretanto, há
de "feijão, arroz, bife e salada" esta sendo substituído por uma força limite que o homem pode aplicar na caixa sem que o
comidas industrializadas e com alto teor calórico. Estima-se que caixote se mova: a componente desta força paralela à superfície
o consumo de feijão e de arroz caiu em torno de 30% nos iguala-se à de atrito estático máxima, em módulo. Ao entrar em
últimos anos. movimento, a força que o homem exerce diminui bem se
Com base no texto acima e nos conhecimentos sobre a terra, comparada à necessária para colocar o caixote em movimento.
considere as afirmativas a seguir. Neste caso, a componente paralela da força que ele passa a
I. O prato tradicionalmente consumido pelo brasileiro exercer para manter o caixote se movendo iguala-se em módulo
apresenta elementos essenciais ao metabolismo, como à força de atrito dinâmico, e mostra-se relativamente
proteínas, carboidratos, gorduras, vitaminas e sais minerais. independente da velocidade do caixote (para baixas
II. A ingestão de proteínas e importante, pois elas serão velocidades), sendo esta consideravelmente menor do que a
degradadas em aminoácidos, usados como fonte na síntese força máxima aplicada.
das proteínas codificadas pelo organismo. Matematicamente a força de atrito dinâmico relaciona-se com a
III. Os carboidratos e lipídios da dieta são fonte importante de força normal mediante a seguinte equação:
energia para os organismos, pois essas moléculas Fatcin = µC.N
preservam, na forma de energia química, boa parte da
E a força de atrito estático máxima relaciona-se com a força
energia gasta para a sua síntese.
normal da seguinte forma:
IV. Os ácidos nucléicos ingeridos são incorporados ao DNA do
Fatmax = µe.N
organismo, razão pela qual questiona-se o consumo de
alimentos transgênicos. Considere que, numa situação inicial, uma caixa permanece em
repouso sobre uma rampa inclinada 45º devido à ação de uma
Estão corretas apenas as afirmativas: força de atrito de intensidade Fat = 42N. São dados µE = 1,2,
a) I e III. µC = 0,8, , 2 = 1,4 e g = 10 m/s2.
b) I e IV.
c) II e IV
d) I, II e III
e) II, III e IV.

RESPOSTA: D
Comentário:
As afirmativas I, II e III são Verdadeiras.
A afirmativa IV está incorreta porque os Ácidos Nucléicos (DNA 45o
e RNA) ingeridos na constituição de qualquer alimento de origem
animal ou vegetal, transgênico ou não, são desdobrados pelas
enzimas digestivas em nucleotídeos e seus componentes, que Caso a inclinação da rampa seja reduzida para 30º, a força de
serão posteriormente, assimilados. Portanto, não há atrito estático agindo sobre a caixa:
possibilidade do DNA presente em algum alimento ingerido ser
incorporado no DNA (genoma) do organismo.

30o

Questão 25 a) Permanecerá constante;


A Força de Atrito − Chama-se de força de atrito estático a força b) Diminuirá 12 N;
que se opõe ao início do movimento entre as superfícies, ou ao
atrito de rolamento de uma superfície sobre outra. Por exemplo, c) Diminuirá 15 N
pode-se citar o atrito entre o pneu de um carro quando este não d) Diminuirá 25 N
está escorregando sobre a superfície (o que não implica que o e) Diminuirá 30 N
pneu não possa estar rolando). Chama-se força de atrito estático
máximo à máxima força de atrito estático que pode existir entre
duas superfícies sem que estas, entretanto, deslizem uma sobre
RESPOSTA: B
a outra. Comentário:
Quando se tenta empurrar uma caixa em repouso em relação ao Na situação 1, temos: P.senα1 = Fat1 ⇒ P ⋅ sen45o = 42N
solo, nota-se que se pode gradualmente ir aumentado a força
sobre a caixa sem que esta entretanto se mova. A força que se Na situação 2, temos: P.senα 2 = Fat 2 ⇒ P ⋅ sen30o = Fat 2

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 15
Prova de Conhecimentos Gerais
P ⋅ sen45o 42N
Dividindo, membro a membro, vem: = A partir das informações fornecidas, assinale a alternativa
o Fat 2
P ⋅ sen30 verdadeira.
2 a) O que caracteriza um sabão ou um detergente é o fato de
serem estruturalmente constituídos de pequenos grupos
2 = 42N ⇒ Fat = 42 ≅ 42 ≅ 30N
1 2 hidrocarbônicos, que não têm afinidade com a água
Fat 2 2 1,4 (hidrofóbicos), e um ou mais grupos polares que têm
2 afinidade com a água (hidrofílicos).
Assim, vemos que o Fat diminui de 42 N para 30 N, ou seja, ele b) Sabões são ácidos carboxílicos de cadeia longa, resultantes
diminuiu 42 − 30 = 12 N. principalmente da saponificação de gorduras e óleos.
c) Para um detergente ser biodegradável é importante que a
cadeia hidrocarbônica seja linear como as que ocorrem nas
gorduras naturais e que são totalmente biodegradáveis.
d) A principal diferença entre sabões e detergentes, no uso
Questão 26 caseiro, é que em geral os sabões são sólidos e os
A refrigeração e o congelamento de alimentos são responsáveis detergentes são líquidos.
por uma parte significativa do consumo de energia elétrica numa e) Tanto os sabões como os detergentes, apresentam grande
residência típica. Para diminuir as perdas térmicas de uma parte polar (lipofídica) e pequena parte apolar (hidrofílica).
geladeira, podem ser tomados alguns cuidados operacionais:
I. Distribuir os alimentos nas prateleiras deixando espaços RESPOSTA: C
vazios entre eles, para que ocorra a circulação do ar frio Comentário:
para baixo e do quente para cima. As gorduras biodegradáveis apresentam cadeia carbônica linear.
II. Manter as paredes do congelador com camada bem espessa Os detergentes biodegradáveis, para possuírem tal
de gelo, para que o aumento da massa de gelo aumente a característica, apresentam cadeia carbônica linear.
troca de calor no congelador.
III. Limpar o radiador (“grade” na parte de trás) periodicamente,
para que a gordura e a poeira que nele se depositam não
reduzam a transferência de calor para o ambiente.
Questão 28
Para uma geladeira tradicional é correto indicar, apenas, No texto a seguir, reproduzido do livro "Descobertas Acidentais
a) a operação I. em Ciências" de Royston M. Roberts (Editora Papirus,
b) a operação II. Campinas, SP, 1993), algumas frases referentes a etapas
c) as operações I e II. importantes na construção do conhecimento cientifico foram
d) as operações I e III. colocadas em maiúsculo e identificadas por um numeral romano.
e) as operações II e III.
"Em 1889, em Estrasburgo, então Alemanha, enquanto
RESPOSTA: D estudavam a função do pâncreas na digestão, Joseph von
Comentário: Merling e Oscar Minkowski removeram o pâncreas de um cão.
I. (V) – os espaços vazios favorecem as correntes de ar da No dia seguinte, um assistente de laboratório chamou-lhes a
convecção. atenção sobre o grande numero de moscas voando ao redor da
II. (F) – o gelo é isolante térmico. urina daquele cão. (I) CURIOSOS SOBRE POR QUE AS
III. (V) – a energia poderá fluir diretamente para o ambiente, MOSCAS FORAM ATRAÍDAS A URINA, ANALISARAM-NA E
sem que seja absorvida. OBSERVARAM QUE ESTA APRESENTAVA EXCESSO DE
AÇÚCAR. (II) AÇÚCAR NA URINA E UM SINAL COMUM DE
DIABETES.
Von Mering e Minkowski perceberam que estavam vendo pela
Questão 27 primeira vez a evidencia da produção experimental de diabetes
Os sabões e detergentes compreendem uma variedade de em um animal. (III) O FATO DE TAL ANIMAL NAO TER
produtos que usamos no dia-a-dia com a finalidade de remover a PÂNCREAS SUGERIU A RELAÇÃO ENTRE ESSE ÓRGÃO E O
sujeira. Sobre esses produtos estão representadas a seguir, as DIABETES.
estruturas dos mesmos. (...) Muitas tentativas de isolar a secreção foram feitas, mas sem
sucesso ate 1921. Dois pesquisadores, Frederick G. Banting, um
SABÃO jovem médico canadense, e Charles H. Best, um estudante de
medicina, trabalhavam no assunto no laboratório do professor
John J. R. Mac-Leod, na Universidade de Toronto. Eles
extraíram a secreção do pâncreas de cães. (IV) QUANDO
INJETARAM OS EXTRATOS [SECREÇÃO DO PÃNCREAS]
DETERGENTE BIODEGRADÁVEL
NOS CÃES TORNADOS DIABÉTICOS PELA REMOÇÃO DE
SEU PÂNCREAS, O NÍVEL DE AÇÚCAR NO SANGUE
DESSES CÃES VOLTAVA AO NORMAL, E A URINA NÃO
APRESENTAVA MAIS AÇÚCAR."
Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br
16 1º Simulado 2010 – Estilo ENEM

A alternativa que identifica corretamente cada uma das frases


em destaque com cada uma das etapas de construção do Questão 30
conhecimento científico é: A água do mar é salgada devido ao grande número de sais
a) I - Hipótese; II - Teste da hipótese; III - Fato; IV - minerais dissolvidos, constituídos, em sua maior parte, por:
Observação. sódio, potássio, magnésio, cálcio e cloro. Considerando os
b) I - Fato; II - Teoria; III - Observação; IV - Teste da hipótese. elementos Mg, Na e Cl e algumas de suas propriedades
c) I - Observação; II - Hipótese; III - Fato; IV - Teste da periódicas, identifique a afirmativa correta:
hipótese. Dados:
d) I - Observação; II - Fato; III - Teoria; IV - Hipótese. Na (Z = 11)
e) I - Observação; II - Fato; III - Hipótese; IV - Teste da Mg (Z = 12)
hipótese. Cl (Z = 17)
Ca (Z = 20)
RESPOSTA: B Br (Z = 35)
Comentário: a) O número quântico magnético do elétron de valência de
Ao investigar um fenômeno qualquer com método científico, sódio é + 1.
deve-se obedecer às seguintes etapas: b) O cloro é um metal com sete elétrons de valência.
• Observação: o fenômeno é observado e desenvolve-se a c) O magnésio é um metal alcalino.
curiosidade em relação a ele. d) É possível, em algumas situações biológicas, substituir o
• Questionamento: elaboração de uma pergunta ou cálcio pelo magnésio, uma vez que ambos apresentam
identificação de um problema (fato) a ser resolvido. propriedades químicas semelhantes.
• Formulação da hipótese: possível explicação para uma e) O cloro, assim como o bromo, apresenta-se na temperatura
pergunta ou solução de um problema. ambiente no estado líquido.
• Predição: previsão baseada na hipótese, conseqüência
esperada se a hipótese estiver correta. RESPOSTA: D
• Experimentação: teste (experiência controlada) da predição. Comentário:
• Conclusão: etapa em que se aceita ou se rejeita a hipótese. Mg e Ca são da mesma família e portanto, apresentam
propriedades químicas semelhantes.

Questão 29
Segundo dados da OMS (Organização Mundial da Saúde), 2/3
dos pacientes com câncer utilizarão a radioterapia em alguma fase Questão 31
do tratamento da sua doença, quer de maneira exclusiva ou A questão abaixo se relaciona a situações vivenciadas por um
associada a outras modalidades de terapia oncológica. motorista que, dirigindo seu próprio carro, faz sozinho uma
A radioterapia é uma especialidade médica recente, pois o viagem de férias. Sempre que necessário utilize, em seus
emprego de radiação ionizante como recurso terapêutico tem cálculos, os seguintes dados:
apenas um século trata-se de uma terapia voltada quase que
exclusivamente aos pacientes com câncer, eventualmente pode
ser indicada em algumas patologias benignas. O agente
terapêutico empregado são as radiações ionizantes (comumente
os raios gama, X e elétrons).
Um homem em tratamento com radioterapia, para combater um
tumor no sistema nervoso, apresentava paralisia em um dos lados
do corpo (hemiplegia). Essa paralisia ocorreu porque o tumor
provavelmente havia afetado:
a) os nervos do sistema simpático.
b) um dos hemisférios cerebrais.
c) os nervos do sistema parassimpático.
d) a porção ventral da medula espinhal.
e) a base do tronco encefálico.

RESPOSTA: B
Comentário:
A fonte dos estímulos para a contração da musculatura
esquelética é o córtex motor cerebral, de onde partem tratos
nervosos descendentes que se cruzam no trajeto até as porções
inferiores do sistema nervoso central, de modo que o córtex do
hemisfério cerebral esquerdo controla os movimentos do lado
direito do corpo e vive-versa. Se um dos hemisférios sofrer
injúria, haverá paralisia no lado oposto do corpo, ou seja,
hemiplegia.

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 17
Prova de Conhecimentos Gerais

Questão 32

O motorista abasteceu o carro às 7 horas da manhã, quando a


temperatura ambiente era de 150ºC, e o deixou estacionado por
5 horas, no próprio posto. O carro permaneceu completamente
fechado, com o motor desligado e com as duas lâmpadas
internas acesas. Ao final do período de estacionamento, a
• O que diz a lei que restringe o consumo de bebidas
temperatura ambiente era de 400ºC. Considere as temperaturas alcoólicas por motoristas?
A lei considera crime conduzir veículos com praticamente
no interior do carro e no tanque de gasolina sempre iguais à
qualquer teor alcoólico no organismo. Quem for pego sofrerá
temperatura ambiente. punições que variam da multa até a cadeia. O homicídio
praticado por um motorista alcoolizado será considerado doloso
Ao estacionar o carro, a gasolina ocupava uma certa fração f do
(com intenção de matar). A lei prevê também a proibição da
volume total do tanque de combustível, feito de aço. Qual o valor venda de bebidas alcoólicas nas das rodovias federais em zonas
rurais.
máximo de f para o qual a gasolina não transborde quando a
temperatura atinge os 40ºC? • Como foram estabelecidos os limites?
Na verdade, o limite de 0,2 g/L se refere à margem de erro do
a) 93,0 %
próprio bafômetro, explica o relator da lei, deputado Hugo Leal
b) 80,5 % (PSC-RJ). "Para que não haja conflito, estabeleceu-se uma
pequena margem de erro na questão da aferição do aparelho".
c) 97,8 %
Esse limite, porém, poderá ser revisto pelo governo, a partir de
d) 34,1% estudos que analisam a dosagem de álcool em itens como anti-
sépticos e até doces com licor.
e) 12,9%
• Quanto é permitido beber antes de dirigir?
A partir de agora, praticamente nada – limite de 0,2 grama de
RESPOSTA: C álcool por litro de sangue. Antes, somente motoristas cuja
dosagem de álcool no sangue superava 0,6 grama de álcool por
Comentário:
litro de sangue (duas latas de cerveja) eram punidos.
γ ap = γ gas − γ aço
• Após beber, quanto tempo é preciso esperar antes de dirigir?
γ ap = 8,9 ⋅ 10−4 ºC −1 De maneira geral, um copo de cerveja ou um cálice de vinho
∆Vap = Vo ⋅ γ ap ⋅ ∆θ → (1 − f ) ⋅ V = f ⋅ V ⋅ 8,9 ⋅ 10−4 ⋅ 25 demora cerca de seis horas para ser eliminado pelo organismo –
já uma dose de uísque leva mais tempo. Por isso,
f = 97,8% independentemente do volume ou tipo de bebida ingerida, é
mais prudente que o motorista só reassuma o volante 24 horas
depois de beber. Assim mesmo, passado esse intervalo, se
persistirem sintomas do álcool, o melhor a fazer é não dirigir. A
alternativa é tomar um táxi, transporte coletivo ou então entregar
a direção a quem não bebeu.
www.veja.com

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


18 1º Simulado 2010 – Estilo ENEM

No tocante ao exposto acima, marque a alternativa correta: Em relação aos hormônios mencionados nesses comentários,
a) De acordo com a leitura, atualmente o motorista pode assegura-se que, no organismo humano:
consumir duas latas de cerveja e dirigir sem ser punido. a) ambos são absorvidos sem alteração, mimetizando seus
b) O limite máximo permitido é de 200ppm de álcool no sangue efeitos;
(considerando densidade do sangue igual a da água) b) tanto os esteróides como o hormônio somatotrófico são
c) É aconselhado que após ingerir bebida alcoólica, o indivíduo totalmente digeridos e inativados;
só dirija seis horas depois. c) apenas os esteróides são digeridos e totalmente inativados;
d) O limite autorizado é baseado em dados que comprovam d) apenas os esteróides são absorvidos pelo trato intestinal sem
que com esse índice de álcool o condutor dirige com total sofrer grandes alterações em sua estrutura;
segurança, segundo a reportagem. e) apenas o somatotrófico não é digerido nem absorvido pelo
e) O álcool utilizado em bebidas é, normalmente o propanol, já trato gastrintestinal.
que o etanol é utilizado como combustível para veículos.
RESPOSTA: D
RESPOSTA: B Comentário:
Comentário: Através do epitélio gastrointestinal podem ser absorvidos íons e
O limite e de 0,2 g/L o que corresponde o 200 mg/L. Isto moléculas pequenas (água, monossacarídeos, aminoácidos etc.)
equivale a 200 ppm. O item correto é “b”. ou lipossolúveis (essas últimas se difundem através da
bicamada fosfolipídica das membranas celulares). Assim, das
duas substâncias citadas no enunciado, apenas a proteína - o
hormônio somatotrófico - precisa ser quebrada até aminoácidos
Questão 33 (NULA) para ser absorvida. O hormônio esteróide, sendo lipossolúvel,
não precisa.
Em um programa de rádio foram feitos os seguintes comentários:
OBS.:
– Não como carne bovina, pois, geralmente, o gado é tratado No simulado original a questão 6 foi repetida também como 33.
com certos hormônios esteróides que podem causar-me Logo, para efeito de gabarito ela esta nula. A questão acima
problemas. seria a correta.
– Não bebo leite de vaca, pois, o hormônio do crescimento
(somatotrófico) presente em sua composição pode alterar o
crescimento dos meus ossos.

Questão 34
A união de vários aminoácidos forma os peptídeos. Estes, após passarem por diferentes processamentos no Reticulo endoplasmático
rugoso e complexo de Golgi, formam as proteínas.
As proteínas exercem inúmeras funções no nosso organismo, como por exemplo as funções enzimáticas. Para descobrir se determinado
organismo produz determinada proteína, faz-se a construção de uma fita de RNA mensageiro a partir dela. Isso e possível graças a relação
existente entre os códons do RNA mensageiro (cada três nucleotídeos) e os aminoácidos presentes nas proteínas. Cada três nucleotídeos
correspondem a um aminoácido, portanto, a partir de uma sequencia de aminoácidos (peptídeo), é possível obter uma sequencia de
nucleotídeos (RNA mensageiros). O inverso também pode ocorrer. A correspondência entre os códons do RNA mensageiro e os
aminoácidos por ele determinados constitui o código genético, que esta representado na tabela a seguir:

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 19
Prova de Conhecimentos Gerais

Phe (fenilalanina), Leu (leucina), Ile (isoleucina), Met (metionina), Val (valina), Ser (serina), Pro (prolina), Thr (treonina), Ala (alanina), Tyr
(tirosina), His (histidina), Gln (glutanina), Asn (asparagina), Lys (lisina), Asp (ácido aspártico), Glu (ácido glutâmico), Cys (cisteína), Trp
(triptofano), Arg (arginina), Gly (glicina), pare (códon de parada).

Com base no texto e em seus conhecimentos, é correta a seguinte afirmação:


a) O peptídeo Gly-Gly-Gly-His-Arg-Leu-Ile-Gln pode ter sido originado a partir do seguinte RNA mensageiro:
GGCGGUGCGCACCGCCUUAUUCAA.
b) A partir da seqüência do RNA mensageiro UUUCAUAGUGCUGGGAGCCAC, e formado o seguinte peptídeo: Phe-His-Ser-Ala-Gly-Arg-
His.
c) A partir da seqüência do RNA mensageiro GUGGUUGUCGCUCGUCGGCGG, e formado o seguinte peptídeo: Val-Val-Val-Val-Arg-Arg-
Arg.
d) A partir da sequencia do RNA mensageiro UUAGGGGAGACUCGGCAGGAG, e formado o seguinte peptídeo Leu-Gly-Glu-Thr-Arg-Gln-
Glu.
e) O peptídeo Lys-Phe-Lys-Tyr-Tyr-Thr-Ile pode ter sido originado a partir do seguinte RNA mensageiro: AAAUUUAACUAUUACACAAUA.

RESPOSTA: D
Comentário:
Utilizando-se a tabela representativa do código genético (códons > aminoácidos), podemos obter por cada "trinca" do RNAm, o aminoácido
correspondente e assim determinar a seqüência da cadeia peptídica resultante.

Questão 35 a) Por serem gases sintéticos, conclui-se que os freons foram


Em um dia em que se registrava uma temperatura ambiente de obtidos por processos físicos.
27ºC, um balão de festa foi cheio com ar, cuja densidade era de b) Nos freons os átomos de cloro são isótopos dos átomos de
1,3kg/m3. Foi medida uma diferença de massa entre o balão flúor.
vazio e cheio de 7,8g. Considerando o ar como um gás ideal, c) Os elementos flúor e cloro pertencem a um mesmo período
qual seria o seu volume se, depois de cheio, ele fosse guardado da tabela periódica.
numa câmara fria a -23ºC, sem variar a pressão e o número de d) O átomo de flúor é menos eletronegativo do que os átomos
partículas em seu interior? de carbono e cloro.
a) 3L e) No estado fundamental, os átomos de carbono e flúor têm o
b) 4L mesmo número de níveis eletrônicos.
c) 5L
d) 6L RESPOSTA: E
e) 6,5L Comentário:
6 C → 1s 2s 2 p ⎪
2 2 2

RESPOSTA: C 5⎬
igual número de níveis energéti cos
9 F → 1s 2s 2 p ⎪
2 2

Comentário: ⎭
P1 ⋅ V1 P2 ⋅ V2 V V 5
= → 1 = 2 → V2 = ⋅ V1
⎯⎯
T1 T2 300
N 250
N 6
(27ºC) ( −23ºC)
No início, tem-se:
1m3 __________ 1,3 kg Questão 37
−3
V1 __________ 7,8 ⋅ 10 kg
Oásis marinhos em perigo
V1 = 6 ⋅ 10−3 m3 = 6A
5 Biólogos planejam o repovoamento dos recifes de corais,
Daí, V2 = ⋅ 6 A → V2 = 5 A um dos mais ricos ambientes do mundo, ameaçados pela pesca
6
excessiva.
Na etapa inicial desse projeto, os pesquisadores
trabalharão com as principais espécies responsáveis pela
formação dos recifes, como os corais-cérebro do gênero
Questão 36 Mussimilia, encontrados apenas no Brasil, o coral-estrelagrande
Os freons são gases sintéticos, isto é, inexistentes na natureza (Montastrea carvenosa) e o coral-cérebro-pequeno (Favia
antes de o homem inventá-los. São substâncias compostas grávida), um globo de cerca de 10 centímetros cuja aparência
constituídas de carbono cloro e flúor (clorofluorcarbonetos- lembra um cérebro humano. Tanto os corais-cérebro quanto o
CFCs), de amplo emprego industrial. Os freons são estrela-grande são de fecundação externa. Já o cérebro-
quimicamente inertes, pois não são inflamáveis, não oxidam pequeno é uma espécie com fecundação interna.
materiais, não são explosivos nematóxidos. Do exposto é correto Após a fecundação, os ovos desenvolvem-se em larvas
afirmar:
Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br
20 1º Simulado 2010 – Estilo ENEM

microscópicas - as plânulas - que nadam algum tempo antes de da luz. Então, em um tempo muito curto, todos os elétrons livres
se fixarem nas rochas do fundo do mar e originarem novas já estão em movimento, embora os elétrons que começaram a
colônias. mover-se nas proximidades do interruptor só alcancem o
Pesquisa FAPESP. Jan. 2004 (adapt.) filamento depois de um tempo muito longo. Portanto, os elétrons
que provocam o aquecimento do filamento a 2500ºC são
Com base no texto, foram feitas as seguintes afirmações: aqueles presentes no seu próprio tungstênio.
I. Os corais estrela-grande e cérebro-pequeno pertencem a LUZ, A. M.R.; ÁLVARES, B.A., Curso de Física, 5ª. ed. Eletricidade.
uma mesma classe. São Paulo: Scipione, p. 155.
II. A fecundação realizada pelo coral-cérebro-pequeno promove
maior capacidade adaptativa que a realizada pelo coral- A propósito do assunto tratado no texto, assinale a alternativa
cérebro. correta:
III. A capacidade dispersiva dos corais é resultante do a) O efeito joule consiste na transformação de energia térmica
desenvolvimento dos zigotos. em energia luminosa em um resistor percorrido por uma
IV. Os gêneros Monastrea, Favia e Aussilia são encontrados corrente elétrica.
apenas no Brasil. b) As lâmpadas incandescentes foram criadas por James Watt.
V. Os corais citados realizam reprodução assexuada. c) Os filamentos dessas lâmpadas são geralmente feitos de
tungstênio, que é um metal cujo ponto de fusão é baixo.
Estão corretas as afirmativas: d) Para um elétron percorrer um fio de 60 cm de comprimento
a) I e II, apenas. com velocidade constante de 0,1 mm/s seria necessário um
b) I, II e III, apenas. tempo de 100 minutos.
c) I, III e V, apenas. e) Em Fahrenheit, a temperatura do filamento pode chegar a
d) II, III e IV, apenas. 950º F.
e) II, III e V, apenas.
RESPOSTA: D
RESPOSTA: C Comentário:
Comentário: a) INCORRETA. No efeito Joule, calor é gerado a partir da
Todos os corais são antozoários. As larvas móveis possibilitam a energia elétrica.
dispersão e são resultantes do desenvolvimento do zigoto. As b) INCORRETA. A invenção da lâmpada incandescente é o
colônias resultam de reprodução assexuada. maior feito de Thomas Edison.
c) INCORRETA. Se o ponto de fusão fosse baixo, o filamento
não suportaria a alta temperatura necessária à
incandescência.
Questão 38 d) CORRETA. Sendo v = d/t, com v = 0,1 mm/s e d = 60 cm,
teremos t = 6000s = 100 min.
Os elétrons, em um circuito no qual há uma corrente elétrica
e) INCORRETA. Sendo C/5 = (F – 32)/9, com C = 2500,
contínua, movem-se com velocidade muito pequena (apenas
encontramos F = 4532.
0,1 mm/s, aproximadamente). Entretanto, quando ligamos o
interruptor do circuito, o campo elétrico que surge no condutor é
estabelecido quase instantaneamente em todo fio, pois a
velocidade de propagação desse campo é praticamente igual à

Questão 39
O Brasil atualmente defronta-se com a perspectiva de um significativo aumento na demanda por etanol combustível. Esta previsão
sustenta-se em certas realidades de mercado, como:
I. aumento do consumo interno de álcool hidratado devido ao sucesso dos automóveis flexi-fuel no mercado de veículos automotivos
leves.
II. expansão das exportações brasileiras de etanol em função do crescente interesse mundial pela mistura deste à gasolina, como forma
de diminuir as emissões de gases de efeito estufa (GEE).
Um caminho para solucionar o problema seria ampliar a produtividade de litros de álcool por hectare de cana plantada, aproveitado
integralmente a biomassa da planta para produzir etanol. Essa rota recebe o nome de etanol lignocelulósico ou de 2ª geração. Para
obtermos etanol lignocelulósico são necessários, basicamente, dois processos: a hidrólise dos polissacarídeos em açúcares simples e a
fermentação destes em etanol.
Disponível em: HTTP://www.bioetanol.ogr.br/interna/index.php?pq=MzM Acesso em: 16 ago. 2009.

Com base nas informações acima, assinale a afirmação correta.


a) Hidrólise significa reação química de quebra pelo hidrogênio.
b) A hidrólise da celulose pode ser representada por:

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 21
Prova de Conhecimentos Gerais

c) O aumento da produtividade de álcool por hectare pode ser conseguido pela fermentação da molécula de açúcar liberada pela
hidrólise da lignocelulose presente no bagaço da cana.
d) A fermentação da glicose para geração de etanol pode ser representada pela equação corretamente balanceada:
C4H12O2 → 2C2H5OH.
e) A molécula de etanol produzida pelo processo tradicional é diferente da molécula de etanol produzida pela fermentação do açúcar
proveniente da lignocelulose.

RESPOSTA: C
Comentário:
O último parágrafo do texto enunciado, qualifica como verdadeiro o item “c”.

Questão 40 RESPOSTA: B
Comentário:
O Sistema Vascular Sanguíneo Dica 1: estabeleça que r’ = 2r
Dica 2: calcule R’
O sistema vascular sanguíneo compõe-se de vasos com Dica 3: determine a porcentagem, comparando inicial e final.
diferentes calibres, que são as artérias, as veias e os capilares. Sendo R = C . L/r4, para r’ = 2r, temos R’ = 1/16 . C . L/r4
Esse sistema transporta o sangue do coração para os tecidos e R’ = 0,0625 . C . L/4 = 6,25%.
destes de volta para o coração e deve trabalhar de forma a
minimizar a energia despendida pelo coração no bombeamento
do sangue. Em particular, essa energia é reduzida quando a
resistência do sangue baixa. Tal situação foi experimentalmente
comprovada e resultou em uma das Leis de Poiseuille, que dá a Questão 41
resistência R do sangue como sendo “Desta vida você não leva nada. Mas você pode deixar. Doe
córneas. Doe novos horizontes para quem não pode ver” –
R = C(L/r2) Campanha do Ministério da Saúde, 2008
em que L é o comprimento do vaso sanguíneo, r é o raio, e C é No contexto de uma campanha e de acordo com seus
uma constante positiva determinada pela viscosidade do conhecimentos, considere as seguintes afirmações:
sangue. A relação entre pressão, resistência e fluxo médio nos I. Não sendo órgão vital, a córnea a ser transplantada é
vasos sanguíneos é análoga, de modo geral, à relação entre, removida de um doador vivo.
respectivamente, a diferença de potencial, a resistência e a II. O transplante de córnea é indicado para pacientes que sofrem
corrente elétrica num circuito elétrico, expressa pela Lei de Ohm. de catarata.
Se o raio do vaso sanguíneo é dobrado ao longo de toda a sua III. A rejeição da córnea é improvável por ela não ser
extensão, então a resistência do fluxo sanguíneo reduz-se a um vascularizada.
percentual do valor inicial igual a: IV. A córnea é comparável à lente móvel de uma câmera uma vez
a) 5,25% que é responsável pelo ajuste focal das imagens pelo olho.
b) 6,25%
c) 12,15% Assinale o item que contém a(s) afirmação(ões) correta(s):
d) 25% a) I, II, III e IV
e) 50% b) II e IV, apenas.
c) I e II, apenas.
d) II e III, apenas.
e) III, apenas.

RESPOSTA: E
Comentário:
a córnea é um tecido transplantável raramente acometido de
rejeição imunológica por parte do receptor, uma vez que se

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


22 1º Simulado 2010 – Estilo ENEM

encontra em uma porção normalmente não vascularizada do Questão 43


globo ocular (é a partir do sangue que chegam os elementos de Dengue é uma doença causada por vírus do gênero Flavivírus e
ataque imune a tecidos estranhos). O transplante é indicado em transmitida pelo mosquito Aedes Aegypti. Em geral, o acometido
lesões ou doenças da córnea (ceratopatias), sendo sempre feito de dengue apresenta necessidade de tomar antitérmicos,
a partir de doador morto, já que representaria uma lesão com cefaléia, fraqueza, dores nas articulações, anorexia, manchas
consequências danosas e irreversíveis para a visão do doador, vermelhas na pele e pequenos sangramentos. No dengue
caso estivesse vivo. Já a catarata acomete o cristalino (que se hemorrágico observa-se um aumento da permeabilidade dos
opacifica, bloqueando a passagem da luz), sendo recomendada capilares sanguíneos, o que pode levar à morte. Com base no
sua substituição por uma lente. O ajuste focal também cabe ao texto é incorreto afirmar:
cristalino, o qual tem raio de curvatura variável, sob controle a) o agente etiológico do dengue é acelular.
muscular, ao passo que a córnea tem raio fixo. b) a pessoa acometida de dengue apresenta dor de cabeça,
falta de apetite e febre.
c) o AAS não é indicado no tratamento, pois trata-se de um
vasodilatador.
Questão 42 d) o vetor do dengue pertence ao gênero Aedes.
Atualmente, muitos condomínios fazem a iluminação de e) o transmissor da referida virose é dícero e octópode.
determinadas áreas, como escadas e entradas de elevadores,
com sensores e temporizadores, para que as luzes permaneçam RESPOSTA: E
acesas apenas por pequenos intervalos de tempo, enquanto Comentário:
estão sendo utilizadas. A figura a seguir representa, O transmissor da virose é um inseto, sendo, portanto um animal
esquematicamente, duas possibilidades, A e B, de montagem de dícero e hexápode.
circuitos elétricos com essa finalidade. Na figura, S representa
um sensor. As lâmpadas são idênticas e possuem valores
nominais de 127V – 60W. A rede elétrica que alimenta cada
circuito fornece tensão elétrica U = 127 V.
Questão 44
Princípio de Arquimedes − Quando um corpo está totalmente
ou parcialmente imerso em um fluido em equilíbrio, ficará sob a
ação de uma força que dependerá da porção do corpo que está
imersa. Isto pode ser verificado se tentarmos submergir uma
cortiça ou bola cheia de ar em recipiente com água. Quanto mais
profundo estiver o corpo maior será a força que teremos de fazer
para mantê-lo naquela profundidade.
A melhor associação é: A força que faz a cortiça flutuar, parecendo que o corpo possui
a) em série, pois as lâmpadas possuem o maior brilho possível. um peso menor do que o peso real é denominado de empuxo do
b) em série, pois as lâmpadas deverão operar na sua potência fluido sobre o corpo. O princípio de Arquimedes quantifica o
nominal. valor desta força: Um corpo total ou parcialmente imerso em um
c) em paralelo, pois as lâmpadas deverão operar em suas fluido sofre um empuxo que é igual ao peso do volume do fluido
potências nominais apresentando um menor brilho. deslocado pelo corpo.
d) em paralelo, pois as lâmpadas deverão operar em suas
Contam os livros que o sábio grego Arquimedes o descobriu
potências nominais apresentando um maior brilho.
enquanto tomava banho, quando procurava responder a Hierão,
e) Em série e em paralelo simultaneamente.
rei de Siracusa, se sua coroa era realmente de ouro puro.
Conta Vitrúvio, que o rei mandou fazer uma coroa de ouro. Para
RESPOSTA: D isso, contratou um artesão, que consoante uma boa quantia de
Comentário: dinheiro e a entrega do ouro necessário, aceitou o trabalho.
No circuito B, as lâmpadas funcionam independentemente uma Na data prevista o artesão entregou a coroa executada na
da outra, pois estão associadas em paralelo. No circuito A, uma perfeição, porém, o rei estava desconfiado que o artesão
lâmpada funciona apenas se a outra estiver ligada. Outro motivo pudesse ter trocado o ouro por prata, pediu a Arquimedes que
é que no circuito B a ddp (127V) é a mesma nas duas investigasse o que se passava uma vez que este era muito
lâmpadas, cada uma funcionando com sua potência nominal. inteligente.
Imagem correta: Um dia, enquanto tomava uma caipirinha numa banheira, em
Iguatu com seu amigo Rabin Jucá, Arquimedes observou que, à
medida que seu corpo mergulhava na banheira, a água
transbordava. Concluiu, então, como poderia resolver o
problema da coroa e de tão contente que estava saiu da
banheira e foi para a rua gritando: "Eureka, Eureka!", que em
língua grega quer dizer descobri, achei, encontrei.

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 23
Prova de Conhecimentos Gerais

RESPOSTA: C
Comentário:
Na primeira situação temos: Empuxo E1 = peso P
Na segunda situação temos: Empuxo E2 = peso P
Como o peso é o mesmo, nas duas situações , concluímos que
os empuxos são iguais, nas duas situações, o que nos permite
concluir que o volume submerso nos dois casos é o mesmo.
Ora, mas se a marca d’água é sempre a mesma, isso significa
que o volume da porção do cone imersa é igual ao volume da
porção emersa do cone e que, portanto, é igual à metade do
volume total do cone.
Ora, então quer dizer que esse cone flutua com metade do seu
volume submerso !!!!!! Isso nos leva a crer que a densidade do
Assim, pegou um vasilhame com água e mergulhou um pedaço cone é igual à metade da densidade do liquido, veja por que:
de ouro, do mesmo peso da coroa, registrando o quanto a água E = Peso
tinha subido. Fez o mesmo com um pedaço de prata. Efetuou o dliq . Vsub. g = mcorpo.g
mesmo registro e comparou-o com o anterior concluindo que o dliq . Vsub. g = dcorpo. Vcorpo . g, mas Vsub = Vcorpo / 2
ouro não fez a água subir tanto como a prata. O nível da água dliq . (Vcorpo / 2). g = dcorpo. Vcorpo . g
subiu mais com a prata do que com o ouro. dliq / 2 = dcorpo
Por fim, inseriu a coroa na água. Esta elevou o nível da água
mais do que o ouro e menos do que a prata. Arquimedes De fato, a densidade do cone é igual à metade da densidade do
constatou, então, que a coroa havia sido feito com uma mistura liquido ! ☺
de ouro e prata. Pôde-se assim desvendar o mistério da coroa e
desmascarar o artesão.
Para compreender, lembre-se que tanto a coroa, quanto o
pedaço de ouro e quanto o pedaço de prata utilizados por
Arquimedes tinham todos o mesmo peso. Entretanto, como a Questão 45
densidade do ouro é maior do que a da prata, o pedaço de ouro “A composição dos produtos para a reidratação oral deve ter as
ocupa um volume menor que o pedaço de prata de mesmo seguintes especificações, de acordo com a norma internacional
peso. Se o pedaço de ouro possui menor volume, então o OMS/UNICEF:
mesmo deslocou um volume menor de água do que o pedaço de Composição por litro de água
prata. A coroa, sendo feita de uma mistura de ouro e prata, Sódio 90 mEq
possuía uma densidade média entre o ouro e a prata. Potássio 20-25 mEq
Considere que um cone maciço seja posto para boiar em um Cloreto 80 mEq
líquido. A marca circular deixada pelo líquido na superfície do Citrato (*) 30-25 mEq
corpo é denominada a “linha d’água”. Curiosamente no caso Glicose 111 mMol
desse líquido e desse corpo, a linha d’água é exatamente a (*) O citrato pode ser substituído por bicarbonato, lactato ou
mesma, tanto se o cone é posto a boiar de cabeça para cima ou acetato.
de cabeça para baixo nesse líquido.
Outros eletrólitos e outros componentes não aportam benefícios
adicionais nesta fase de reposição e devem ser evitados, a não
que surjam comprovações científicas que justifiquem sua
inclusão.
Linha Linha
d’água d’água Não se pode adicionar corantes e/ou sabores aos produtos para
reidratação oral.
Os produtos para reidratação podem ser apresentados como
soluções prontas para uso, soluções concentradas para serem
diluídas ou como pó ou grânulos para diluição em água, de
acordo com instruções de preparo que devem constar da
Isso nos permite concluir que: embalagem de forma clara como está descrito no item III desta
a) O empuxo que age no cone é igual à metade do peso do Norma, que trata de bula e rotulagem.
cone; II. A composição dos produtos para a prevenção da desidratação
b) O empuxo que age no cone é igual ao dobro do peso do e para a manutenção da hidratação deve ter as seguintes
cone; especificações:
c) A densidade do cone é a metade da densidade do líquido; - A concentração de Sódio poderá variar entre 40 e 60 mEq/L. A
d) A densidade do líquido é a metade da densidade do cone; concentração de potássio deverá ser 20 mEq/L. A concentração
e) A densidade do líquido é igual à densidade do cone milimolar de bicarbonato (ou base equivalente) deverá compor

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


24 1º Simulado 2010 – Estilo ENEM

1/5 a 1/3 dos ânions, sendo o restante cloreto. A concentração


de glicose deverá estar entre 110 e 140 mMol/L”.
PAULO ROBERTO MIELE http://e-legis.anvisa.gov.br

Analise as informações acima e indique o item verdadeiro.


a) A glicose pode ter uma concentração de 1,2 x 10-2 mol/L
para está dentro das especificações.
b) As soluções de reidratação só se tornam eletrolíticas, se
houver diluição de soluções concentradas.
c) O sódio contido na solução provem unicamente do cloreto de
sódio.
d) O ânion em maior concentração é o sódio.
e) A concentração milimolar máxima de bicarbonato deverá
compor 1/3 dos ânions.

RESPOSTA: E
Comentário:
Está citado no texto que a concentração do bicarbonato os variar
de 1/5 (mínimo) a 1/3 (máximo). Dos ânions do sistema. Logo o
item correto “e”.

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 25
Prova de Conhecimentos Gerais
CIÊNCIAS HUMANAS E
SUAS TECNOLOGIAS Questão 47
Questões de 46 a 90 A Revolução Industrial ocorrida no final do século XVIII
transformou as relações do homem com o trabalho. As
Questão 46 máquinas mudaram as formas de trabalhar, e as fábricas
concentraram-se em regiões próximas às matérias-primas e
grandes portos, originando vastas concentrações
humanas.Muitos dos operários vinham da área rural e cumpriam
jornadas de trabalho de 12 a 14 horas, na maioria das vezes em
condições adversas. A legislação trabalhista surgiu muito
lentamente ao longo do século XIX e a diminuição da jornada de
trabalho para oito horas diárias concretizou-se no início do
século XX.
Pode-se afirmar corretamente que as conquistas no início deste
século, decorrentes da legislação trabalhista, estão relacionadas
com:
a) A expansão do capitalismo e a consolidação dos regimes
monárquicos constitucionais.
b) A expressiva diminuição da oferta de mão-de-obra, devido à
De acordo com o imaginário da charge o contato do colonizador demanda por trabalhadores especializados.
com o nativo brasileiro se mostrou: c) A capacidade de mobilização dos trabalhadores em defesa
a) evidentemente pacífico e inofensivo aos seus costumes e dos seus interesses.
hábitos de liberdade. d) O crescimento do Estado ao mesmo tempo que diminuía a
b) contraditório, na medida em que apresenta o nativo representação operária nos parlamentos.
ameaçador e rebelde diante do colonizador recém chegado. e) A vitória dos partidos comunistas nas eleições das principais
c) promissor ao desenvolvimento nativo e superação do atraso capitais européias.
diante da civilização européia.
d) revelador de uma ameaça que assustava o índio, apesar da RESPOSTA: C
promessa de paz do colonizador. Comentário:
e) pacífico e pautado pela promessa de vida melhor aos nativos As mudanças advindas com a Revolução Industrial fez surgir o
isolados na terra virgem brasileira. operário, trabalhador das fábricas que, tendo que enfrentar
condições miseráveis de trabalho, passou a exigir melhores
RESPOSTA: D condições de trabalho, através de mobilizações e greve. Surgia
Comentário: assim, consequência da Revolução Industrial, o movimento
A interpretação da charge demonstra a contradição do aceno de operário.
paz feito por um símbolo de morte, fator revelado no choro da
criança indígena e na apreensão da família, sendo, portanto
correto o item “D”.

Questão 48
Tomando como base a interpretação abaixo do Gráfico e seus conhecimentos sobre a Globalização, analise as afirmativas a seguir:
I. a globalização é um processo ideal para garantir o acesso a
bens e serviços para toda a população.
II. a globalização é um fenômeno econômico e, ao mesmo tempo,
cultural.
III. a globalização favorece a manutenção da diversidade de
costumes.
IV. filmes, programas de TV e música são mercadorias como
quaisquer outras.
V. As ameaças globais ao meio ambiente, vindas de diferentes
setores, entre os quais o militar e o nuclear.

Destas afirmativas estão corretas:


a) I, II e IV, apenas.
b) II, IV e V, apenas.
c) II, III e IV, apenas.
d) I, III e IV, apenas.
e) III, IV e V, apenas.
Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br
26 1º Simulado 2010 – Estilo ENEM

RESPOSTA: B
Comentário:
Globalização é o termo utilizado para o processo de transformações econômicas e políticas que vêm acontecendo nas últimas décadas. A
principal característica é a integração dos mercados mundiais com a exploração de grandes empresas multinacionais. Junta-se a isso a
grande revolução tecnológica com o uso cada vez maior de telefones, computadores e televisão e a uniformidade das informações com o
surgimento e explosão da Internet e dos canais de televisão por assinatura. Com isso os países passam a interagir não só na economia e
na política, como também na cultura.

Questão 49
Leia os enunciados sobre domínios paisagísticos brasileiros e Questão 50
assinale a alternativa que corresponda corretamente a cada um
deles, respectivamente. “O monstrengo que está no fim do mar
Na noite do breu ergueu-se a voar
1. A região tem seu mecanismo regulador no ciclo anual que A roda da nau voou três vezes
alterna longas estiagens e grandes cheias, capazes de cobrir Voou três vezes a chiar
mais de dois terços de sua área. A redução de matas ciliares E disse: quem é que ousou entrar
e conseqüente assoreamento de rios, além do turismo Nas minhas cavernas que não desvendo
descontrolado ameaçam este domínio e suas espécies, Meus tetos negros no fim do mundo...”
como a arara-azul e a onça-pintada. (PESSOA, Fernando. Mensagens. Ática,
São Paulo, 1986, p.21)
2. Cortado por três das maiores bacias hidrográficas do
continente, possui grande variedade de formações vegetais, De acordo com o poema, marque a opção correta no que
desde campos abertos até formações florestais. Sobre concerne à mentalidade criada pelos navegadores e cronistas
terrenos predominantemente sedimentares, a monocultura, a em relação aos mares e terras desconhecidos.
mineração e a pecuária extensiva reduziram drasticamente a a) Enfrentar o mar significava ir ao encontro de perigos
cobertura original, intensificando os processos erosivos. desconhecidos e desafiar crenças: navegar em águas
Espécies como o lobo guará estão ameaçadas de extinção. habitadas por monstros e explorar terras onde viviam seres
sobrenaturais.
3. Trata-se do domínio brasileiro menos protegido e estudado, b) Os viajantes portugueses e espanhóis lançaram-se ao mar
cuja degradação já ocasionou a extinção de algumas para concretizar o “sonho dourado” do seu tempo: a
espécies, como a ararinha azul. É um domínio que expansão comercial. E não havia, por parte dos
apresenta grave situação social, o que leva à exploração navegadores, a crença em monstros fantásticos.
predatória dos delicados recursos ambientais por meio de c) Na época das grandes navegações, os europeus buscavam
agricultura e pecuária inadequadas e extrativismo primário. também o paraíso terrestre, repleto de riquezas e sem
sofrimentos.
a) Cerrado, Amazônia e Caatinga d) a crença em monstros marítimos fez navegadores e
b) Pantanal, Cerrado e Caatinga investidores desistir do projeto de conquistas marítimas.
c) Caatinga, Cerrados e Pampas gaúchos e) a igreja foi a maior responsável pela campanha contra as
d) Amazônia, Cerrados e Caatinga navegações marítimas, pois sua luta reforçava dogmas
e) Pantanal, Amazônia e Cerrados teocêntricos.

RESPOSTA: B RESPOSTA: C
Comentário: Comentário:
Complexo do Pantanal, ou simplesmente Pantanal, é um A poesia de Fernando Pessoa foi marca do esforço de
bioma constituído principalmente por uma savana estépica, interpretação realista da Expansão Marítima, um episódio
alagada em sua maior parte, com 250 mil km² de extensão, histórico que uniu coragem, aventura e ambição tanto material
altitude média de 100 metros,[1] situado no sul de Mato Grosso e quanto de conquista do paraíso, sendo, portanto correto o item
no noroeste de Mato Grosso do Sul, ambos Estados do Brasil, “C”.
além de também englobar o norte do Paraguai e leste da Bolívia
(que é chamado de chaco boliviano), considerado pela UNESCO
Patrimônio Natural Mundial e Reserva da Biosfera. Em que pese
o nome, há um reduzido número de áreas pantanosas na região
pantaneira

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 27
Prova de Conhecimentos Gerais
II. Tanto na República como no Império, a lei era o resultado de
Questão 51 discussões entre os representantes escolhidos pelo povo
romano.
III. A lei republicana definia que os direitos de um cidadão
acabavam quando começavam os direitos de outro cidadão.
IV. Existia, na época imperial, um poder acima da legislação
romana.

Estão corretas, apenas as afirmações:


a) I e II.
b) I e III.
c) II e III.
d) II e IV.
e) III e IV.

RESPOSTA: E
Comentário:
Os romanos criaram uma legislação bem elaborada, que
influenciou fortemente nosso sistema jurídico. Mesmo com o
advento da república em Roma, não havia democracia nos
moldes modernos, com votação direta para representantes do
governo. Já no período Imperial, o imperador estava acima das
leis, sendo considerado um representante dos deuses.

Questão 53
Na divisão de terras retratada acima, a parte que cabe aos
Em 1999, o Programa das Nações Unidas para o
nativos brasileiros pode ser entendida metaforicamente:
Desenvolvimento elaborou o “Relatório do Desenvolvimento
a) como prioritária tanto pra Espanha quanto pra Portugal.
Humano”, do qual foi extraído o trecho abaixo. Nos últimos anos
b) como pequena se comparada com a parte portuguesa e
da década de 90, o quinto da população mundial que vive nos
espanhola.
países de renda mais elevada tinha:
c) como grande, pois fruto do reconhecimento europeu de seu
autoctonismo. • 86% do PIB mundial, enquanto o quinto de menor renda,
d) como preferencial ao avanço do sistema colonizatório luso- apenas 1%;
espanhol. • 82% das exportações mundiais, enquanto o quinto de menor
e) como uma linha imaginária que representa a conquista de renda, apenas 1%;
suas terras. • 74% das linhas telefônicas mundiais, enquanto o quinto de
menor renda, apenas 1,5%;
• 93,3% das conexões com a Internet, enquanto o quinto de
RESPOSTA: E menor renda, apenas 0,2%.
Comentário:
A metáfora da charge revela a ironia, em tom de sarcasmo, A distância da renda do quinto da população mundial que vive
daqueles que conquistaram e buscaram dividir as terras nos países mais pobres – que era de 30 para 1, em 1960 –
americanas, em total desprezo pelos interesses nativos, no passou para 60 para 1, em 1990, e chegou a 74 para 1, em
caso, o Tratado de Tordesilhas assinado entre Portugal e 1997.
Espanha. O item correto é o “E”. De acordo com esse trecho do relatório, o cenário do
desenvolvimento humano mundial, nas últimas décadas, foi
caracterizado pela:
Questão 52 a) diminuição da disparidade entre as nações.
b) diminuição da marginalização de países pobres.
“Somos servos da lei para podermos ser livres.” c) inclusão progressiva de países no sistema produtivo.
Cícero d) crescente concentração de renda, recursos e riqueza.
“O que apraz ao príncipe tem força de lei.” e) distribuição eqüitativa dos resultados das inovações
Ulpiano tecnológicas.

As frases acima são de dois cidadãos da Roma Clássica que RESPOSTA: D


viveram praticamente no mesmo século, quando ocorreu a Comentário:
transição da República (Cícero) para o Império (Ulpiano). Os indicadores apontados no quadro mostram uma situação de
Tendo como base as sentenças acima, considere as afirmações: crescente concentração de renda, recursos e riquezas entre as
I. A diferença nos significados da lei é apenas aparente, uma décadas de 60 e 90.
vez que os romanos não levavam em consideração as
normas jurídicas.
Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br
28 1º Simulado 2010 – Estilo ENEM

Questão 54

Leia, com atenção, a descrição do espaço geográfico:

E por aqueles campos que ele agora via da janela do


trem em movimento na certa passara um dia o cap. Rodrigo
Cambará, montado em seu frete, de espada à cinta, violão a
tiracolo, chapéu de aba quebrada sobre a fronte altiva. De certo
modo ele simbolizava a tradição de hombridade do Rio Grande,
uma tradição – achava Rodrigo – que as gerações novas deviam
manter, embora dentro dum outro ambiente. Tinham-se acabado
as guerras com os castelhanos. As fronteiras estavam
definitivamente traçadas. Trilhos de estrada de ferro cortavam os
campos, e ao longo dessas paralelas de aço, através de
centenas de quilômetros, estavam plantados postes telegráficos.
Em algumas cidades havia já telefones e até luz elétrica. Os
inventos e descobrimentos da ciência, as maquinas que a
inteligência e o engenho humano inventavam e construíam para
melhorar e facilitar a vida, aos poucos iam entrando no Rio
Grande e um dia chegariam a Santa Fé.
Fonte: VERÍSSIMO, E. O tempo e o vento, Porto Alegre,
Globo, 1963.

Marque a alternativa que apresenta de modo correto o mapa


representativo da organização do espaço brasileiro, no período
descrito no texto.

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 29
Prova de Conhecimentos Gerais
que o mesmo já se encontra num período bem mais moderno
como observado pela legenda.

Questão 55

A FOME NO MUNDO
Não se deve confundir fome com subnutrição. A fome
ameaça não só a vida das pessoas, mas também a sua
dignidade. Uma carência grave e prolongada de alimentação
provoca o debilitamento do organismo, a apatia, a perda do
sentido social, a indiferença e, por vezes, a hostilidade em
relação aos mais frágeis: em particular as crianças e os idosos.
Assim, grupos inteiros são condenados a morrer na desgraça.
No decurso da história, esta tragédia repete-se infelizmente, mas
a consciência contemporânea compreende melhor que outrora
que a fome constitui um escândalo.
Até ao século XIX, as misérias que dizimavam
populações inteiras tinham, com muita frequência, uma origem
natural. Hoje elas são mais circunscritas mas, na maioria das
vezes, derivam da ação humana. Basta citarmos algumas
regiões ou países para nos convencermos disto: Etiópia,
Camboja, Uganda , Ruanda, Haiti...etc . Nesta época em que o
homem, mais que outrora, tem a possibilidade de fazer fae às
misérias, tais situações constituem uma verdadeira desonra para
a humanidade.
Fonte :
http://www.vatican.va/roman_curia/pontifical_councils/corunu.
acesso 2010.

Produto da necessidade moderna de relacionar natureza e


sociedade, a geografia por muito tempo ficou incomodada pelo
desconforto da discussão sobre seu objeto de estudo, o qual
sempre foi motivo de amplo debate. Com relação as mais
recentes propostas de abordagem da ciência geográfica,
relacionada a temática da fome, marque a opção correta.

RESPOSTA: D
Comentário:
Do ponto de vista da literatura a ação da narrativa se inicia em
outubro de 1828, quando o capitão Rodrigo, uma das
personagens mais marcantes e popularizadas pela obra de Érico
Veríssimo, chega à cidade de Santa Fé. Já do ponto de vista
geográfico perceba que o texto afirma que as fronteiras já estão
demarcadas e que os trilhos da estrada de ferro cortava o
campo. Observe que o mapa A , B e C nas opção não citam na
legada a presença da estrada de ferro portanto os Três são a) Á geografia crítica, suas escolas e subdivisões não cabe,
falsos. O texto ainda cita algumas inventos da ciência da época nem nunca coube, o tratamento de problemas dessa
, tais como telégrafos, telefones e luz em algumas cidades o que natureza (a fome.), uma vez a mesma tem como finalidade
descarta a possibilidade do mapa E como resposta, uma vez principal a simples descrição da paisagem.

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


30 1º Simulado 2010 – Estilo ENEM

b) Relacionar o problema da fome ao crescimento


populacional, como costuma fazer estudos de Geografia da Com base no exposto acima, é possível inferir corretamente que:
População pautados em teses malthusianas e a) o novo mapa do Chile foi resultante de interações humanas
neomalthusianistas, não elucida a problemática. Importante com o meio físico.
torna-se outros elementos significativos como: estrutura b) as alterações geofísicas do espaço geográfico são
agrária, distribuição de renda e divisão internacional do constantes e perceptíveis no tempo-espaço humano atual,
trabalho. por esse motivo não foi uma supressa tal deslocamento da
c) A chamada revolução científica-técnica tem um papel cidade de Concepción.
irrelevante na exploração dos recursos utilizados pelo c) o tremo no Chile (27/02/2010) e no Haiti (12/02/2010)
homem, visto que a mesma caracteriza apenas as modernas sinalizam para as possíveis catástrofes futuras decorrentes
espacialidades urbanas. do aquecimento global, resultantes da agressão das
d) A Geografia Crítica comunga com a idéia de que a fome atividades humanas no espaço geográfico.
resulta, unicamente, da relação que o homem mantém com d) apesar das interações da sociedade com o meio físico
o meio. A discussão remete-se, conforme ocorre na provocarem mudanças mais drásticas na paisagem, as
Geografia Tradicional, à questão relativa ao uso irracional ocorrências sísmicas podem modificar o espaço geográfico.
dos recursos naturais pelo homem, não devendo considerar- e) Por estar no centro de placas tectônicas a população chilena
se os aspectos políticos, econômicos e sociais. convive com os terremotos, apesar da supressa da
e) Em geografia agrária a análise do problema (a fome) deve intensidade do tremor do dia 27 de fevereiro de 2010
desconsiderar a estrutura fundiária, pois a concentração de
grandes extensões de terras, nas mãos de uma minoria, não RESPOSTA: D
contribui para agravar a fome do Terceiro Mundo. Comentário:
A questão aborda as diferentes formas de alteração do meio
físico, provocadas pela ação humana e pelas catástrofes
RESPOSTA: B naturais. A opção C é a correta, apesar das interações da
Comentário: sociedade com o meio físico provocarem mudanças mais
Geografia da Fome revela a associação harmoniosa da drásticas na paisagem, as ocorrências sísmicas podem modificar
capacidade de argumentar com a segurança científica, um novo o espaço geográfico.
modo de pensar e de agir frente à realidade alimentar e
nutricional e também uma abordagem pioneira no
dimensionamento da fome coletiva como um fenômeno
geograficamente universal. A Geografia Crítica comunga com a Questão 57
idéia de que a fome resulta de varias problemática sócio Um dos problemas ambientais mais graves que afligem grandes
econômica. Importante torna-se outros elementos significativos cidades brasileiras é o das enchentes. Sobre seus
como: estrutura agrária, distribuição de renda e divisão conhecimentos sobre o tema e as considerações abaixo ,
internacional do trabalho, desigualdades sócias, subordinanças responda a questão.
econômica etc. “Rio de Janeiro enfrenta uma grande quantidade de
chuvas, principalmente na capital que basta chover um
pouco mais forte que uma grande parte da cidade inundada.
A falta de investimentos é um dos maiores problemas para
Questão 56 as enchentes. A falta de Infra-estrutura gera todo a
polemica .
MAPA MODIFICADO Quando se chove a água simplesmente não tem para
Terremoto redesenha Chile onde ir e por isso as inundações são causadas.
Outro problema são as sujeiras que as pessoas
O terremoto que sacudiu o Chile em fevereiro jogam nas ruas sem nenhuma vergonha nos bueiros que
redesenhou os mapas da região, causando um deslocamento de ficam bloqueados e não conseguem escoar a água. Esses
até quatro metros nas zonas próximas ao epicentro, afirmaram, são os dois principais problemas que eu vejo na cidade. Se
ontem, cientistas chilenos. Mas dados preliminares indicam que a população contribuísse não teríamos tantos”
a cidade de Concepción, segunda maior do país, e também
bastante afetada, se deslocou três metros para sudeste.
Santiago, a capital, "andou" meio metro. A energia liberada pelo
sismo foi tão grande que, segundo a Nasa, deslocou em cerca
de 7,6 centímetros o eixo de rotação da Terra. O Chile está
situado diante da linha de contato entre as placas tectônicas de
Nazca, no Pacífico, e da América do Sul.

Disponível em:
http://diariodonordeste.globo.com/materia.asp?codigo=74855
6 Acesso em: 10/03/2010

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 31
Prova de Conhecimentos Gerais
Fonte : http://noticias.bol.uol.com.br/brasil/2010/04/06/chuva-
forte-provoca-tres-mortes-no-rio-de-janeiro.jhtm Questão 58
I. Uma das causas das enchentes relaciona-se com a
ocupação desordenada dessas cidades pois, nesse
processo, até as áreas de várzea dos rios que atravessam
seus sítios foram inteiramente ocupadas por avenidas
marginais e edificações. Uma forma de tentar minimizar esse
problema seria destruir – por decisão unilateral do Poder
Executivo municipal — as construções existentes nessas
várzeas.
II. Como a ocupação urbana dessas cidades foi realizada sem
planejamento, elas estão quase totalmente tomadas por
avenidas e edificações, o que impede a absorção da água
das chuvas pelo solo. Uma forma de tentar minimizar esse
problema seria construir, em áreas estratégicas, grandes
reservatórios de água, denominados popularmente
piscinões.
III. Uma das causas das enchentes nas grandes cidades está
relacionada com o intenso processo de assoreamento dos Sobre o contexto social e a literatura do período retratado no
rios que atravessam seus sítios, pois eles assim se tornam quadro acima, é correto afirmar que:
muito rasos e por isso transbordam rapidamente quando a) estão intimamente ligados à contra reforma, pois a arte
ocorre uma grande chuva. Uma forma de minimizar esse barroca procura comover o leitor, envolvendo-o
problema seria rebaixar mecanicamente as calhas desses emocionalmente na retomada dos valores cristãos.
cursos fluviais b) valorizavam as formas clássicas, procurando imitar os
IV. A culpa das enchentes é inteiramente das populações modelos greco-romanos, tais como: busca da perfeição
urbanas, que têm o hábito de jogar lixo nas ruas de forma formal, racionalismo e convencionalismo.
indiscriminada, contribuindo para que as galerias pluviais e c) nesse momento, ocorrem as primeiras lutas sociais contra o
os bueiros, construídos para escoarem a água das chuvas, capitalismo progressivamente dominador. Nas artes,
não consigam realizar essa tarefa, por estarem entupidos. destaca-se o retrato realista das dinâmicas sociais e a
Uma forma de minimizar esse problema seria, por decisão análise psicológica dos personagens.
do poder municipal, multar e prender quem jogasse lixo nas d) é marcado pelas vitórias políticas da burguesia, daí o
ruas. nacionalismo e a idealização dos elementos locais.
e) a literatura do período consiste em relatórios, documentos e
Sobre as considerações apresentadas, pode-se dizer de modo cartas que se empenhavam em levantar a fauna, a flora e os
correto, que apontam causas reais e soluções legalmente habitantes da nova terra, daí o fato de ser uma literatura
viáveis as de número: meramente descritiva.
a) I e II, apenas.
b) I e III, apenas. RESPOSTA: D
c) II e III, apenas. Comentário:
d) II e IV, apenas. A pintura de Victor Meirelles reflete uma combinação de
e) III e IV, apenas. nacionalismo e romantismo neoclássico do século XIX, estilo
que identifica a vitória burguesa sobre a barbárie nativa,
RESPOSTA: C idealizando seus elementos locais. O item que confirma tal
Comentário: contexto é o “D”.
Analisando as afirmações referentes às causas das enchentes,
que constituem uma grave situação-problema enfrentada por
grandes aglomerações urbanas, bem como as propostas de
intervenção para reduzir e controlar seus efeitos, assim pode-se Questão 59
concluir que apenas a opção B pode ser considerada correta. O primeiro testemunho sobre a antropofagia na América foi
Entre as causas mais importantes das enchentes em grandes registrado por Álvarez Chanca (...) em 1493. (...) Registrada a
cidades encontram-se a impermeabilização dos solos e o abominação antropofágica, os monarcas espanhóis autorizam
processo de assoreamento dos rios que as cortam. Quanto às em 1503 a escravidão de todos os caraíbas pelos colonos. No
medidas apresentadas para tentar minimizar seus efeitos, litoral brasileiro, os tupinambás, do grupo tupi, tinham o hábito
ambas são de implantação perfeitamente viável, tanto do ponto do canibalismo ritual (...). Prova de barbárie e, para alguns, da
de vista legal como do administrativo. natureza não-humana do ameríndio, a antropofagia condenava
as tribos que a praticavam a sofrer pelas armas portuguesas a
“guerra justa” e do ca tiveiro perpétuo em 1557, por terem
devorado no ano anterior vários náufragos portugueses, entre os
quais se encontrava o primeiro bispo do Brasil.
Luís Felipe de Alencastro, Folha de S. Paulo, 12 out. 1991.

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


32 1º Simulado 2010 – Estilo ENEM

d) a origem do governo como uma proteção à vida, aos bens e


A partir do fragmento é correto concluir que aos direitos.
a) as tribos tupiniquins, aliadas aos franceses, acreditavam na e) o poder dos governantes, colocando a liberdade individual
justiça e na importância da guerra justa como capaz de acima da propriedade.
permitir a supremacia contra tribos inimigas.
b) conforme determinava a legislação de Portugal e da RESPOSTA: D
Espanha até o início do século XIX, apenas os nativos da Comentário:
América que praticavam o canibalismo foram escravizados. O texto de John Locke destaca, entre outros aspectos, que
c) a escravização dos ameríndios foi legal e efetiva apenas até devem ser impostos limites à nossa sabedoria individual para
a entrada dos primeiros homens escravos africanos na que possamos viver em sociedade.
América, a partir da segunda metade do século XVII.
d) o estranhamento do colonizador europeu com a prática da
antropofagia por parte dos nativos da América serviu de
pretexto para a escravização desses nativos. Questão 61
e) portugueses e espanhóis, assim como a Igreja Católica, Analisando o texto, podemos concluir corretamente que se trata
associavam a desumanidade dos índios ao fato desses de um pensamento:
nativos insistirem na prática da guerra justa. a) do liberalismo.
b) do socialismo utópico.
RESPOSTA: D c) do absolutismo monárquico.
Comentário: d) do socialismo científico.
A leitura do fragmento remonta às manobras de colonizadores e) do anarquismo.
pra justificar a escravidão indígena utilizando para tanto, do
estranhamento diante da cultura antropofágica, interpretada RESPOSTA: A
como barbárie e natureza não humana do ameríndio. O item que Comentário:
confirma tal leitura é o “D”. O texto expressa os conteúdos do ideário liberal que propõe,
entre outros aspectos, formas representativas de governo e o
respeito à vida, à liberdade e à propriedade.
TEXTO REFERÊNCIA PARA AS QUESTÕES 60 e 61

O texto abaixo, de John Locke (1632-1704), revela algumas Questão 62


características de uma determinada corrente de pensamento.
“Se o homem no estado de natureza é tão livre, conforme
(...) Depois de longas investigações, convenci-me por fim de
dissemos, se é senhor absoluto da sua própria pessoa e
que o Sol é uma estrela fixa rodeada de planetas que giram em
posses, igual ao maior e a ninguém sujeito, por que abrirá
volta dela e de que ela é o centro e a chama. Que, além dos
ele mão dessa liberdade, por que abandonará o seu império
planetas principais, há outros de segunda ordem que circulam
e sujeitar-se-á ao domínio e controle de qualquer outro
primeiro como satélites em redor dos planetas principais e com
poder? Ao que é óbvio responder que, embora no estado de
estes em redor do Sol. (...) Não duvido de que os matemáticos
natureza tenha tal direito, a utilização do mesmo é muito
sejam da minha opinião, se quiserem dar-se ao trabalho de
incerta e está constantemente exposto à invasão de
tomar conhecimento, não superficialmente mas duma maneira
terceiros porque, sendo todos senhores tanto quanto ele,
aprofundada, das demonstrações que darei nesta obra. Se
todo homem igual a ele e, na maior parte, pouco
alguns homens ligeiros e ignorantes quiserem cometer contra
observadores da eqüidade e da justiça, o proveito da
mim o abuso de invocar alguns passos da Escritura (sagrada), a
propriedade que possui nesse estado é muito inseguro e
que torçam o sentido, desprezarei os seus ataques: as verdades
muito arriscado. Estas circunstâncias obrigam-no a
matemáticas não devem ser julgadas senão por matemáticos.
abandonar uma condição que, embora livre, está cheia de
(COPÉRNICO, N. De Revolutionibus orbium
temores e perigos constantes; e não é sem razão que
caelestium.)
procura de boa vontade juntar-se em sociedade com outros
que estão já unidos, ou pretendem unir-se, para a mútua
Aqueles que se entregam à prática sem ciência são como o
conservação da vida, da liberdade e dos bens a que chamo
navegador que embarca em um navio sem leme nem bússola.
de propriedade.”
Sempre a prática deve fundamentar-se em boa teoria. Antes de
(Os Pensadores. São Paulo: Nova Cultural, 1991)
fazer de um caso uma regra geral, experimente-o duas ou três
vezes e verifique se as experiências produzem os mesmos
efeitos. Nenhuma investigação humana pode se considerar
Questão 60 verdadeira ciência se não passa por demonstrações
Do ponto de vista político, podemos considerar o texto como matemáticas.
uma tentativa de justificar: (VINCI, Leonardo da. Carnets.)
a) a existência do governo como um poder oriundo da
natureza. O aspecto a ser ressaltado em ambos os textos para
b) a origem do governo como uma propriedade do rei. exemplificar o racionalismo moderno é:
c) o absolutismo monárquico como uma imposição da natureza a) a fé como guia das descobertas.
humana. b) o senso crítico para se chegar a Deus.
Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br
1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 33
Prova de Conhecimentos Gerais
c) a limitação da ciência pelos princípios bíblicos. RESPOSTA: A
d) a importância da experiência e da observação. Comentário:
e) o princípio da autoridade e da tradição. O apelo da charge funciona como crítica à postura ambígua do
humanitarismo cristão ao permitir castigos corporais aplicados
RESPOSTA: D aos negros, vistos como educativos, porém, condenando
Comentário: excessos no ato de punir. O item correto é o “A”.
A questão apresenta dois textos: um do astrônomo polonês
Nicolau Copérnico e outro do mestre (pintor, escultor, arquiteto,
músico, crítico de arte e cientista italiano) Leonardo da Vinci.
Tanto um quanto outro pertencem ao movimento cultural e Questão 64
científico conhecido como Renascimento. Nesse movimento, a Analise os mapas abaixo e as afirmativas relacionadas aos
verdade deixou de ser baseada unicamente na fé para se basear mesmos.
na observação e experimentação. Podemos perceber essas
características a partir da leitura atenta dos textos 1 e 2.
No texto 1, preste atenção nos trechos "Depois de longas
investigações" e "as verdades matemáticas não devem ser
julgadas senão por matemáticos", entre outros.
No texto 2, preste atenção nos trechos "Sempre a prática deve
se fundamentar em boa teoria" e "Nenhuma investigação
humana pode se considerar verdadeira ciência se não passar
por demonstrações matemáticas".
Após essas observações, fica fácil concluir que, em ambos os
textos, destaca-se "a importância da experiência e da

Questão 63

I. Atualmente, observam-se significativos graus de degradação


de ecossistemas marinhos e costeiros, sendo o mangue um
dos mais afetados, especialmente, em decorrência de sua
posição próxima às principais fontes de poluição.
Sobre o sistema escravista retratado na charge e o que ela II. Dentre as mais graves ameaças às regiões coralíferas do
sugere , podemos afirmar de modo verdadeiro que: planeta, estão os efluentes lançados por acidentes com
a) a igreja assumiu papel contraditório ao condenar abusos de embarcações, o aquecimento global, a exploração predatória
castigos corporais sem questionar a própria escravidão. e a poluição em zonas costeiras.
b) o discurso do poder institucional se colocou frontalmente III. Os mangues constituem-se em ecossistemas resistentes e
contra qualquer ato de tortura contra o escravo. adaptáveis a mudanças físicas, o que se comprova por sua
c) a afirmação do padre na charge reforça a postura distribuição independente de zonas térmicas.
incondicional de defesa da igreja católica do negro livre. IV. As regiões coralíferas, embora permanentemente
d) a igreja católica procurou o absoluto silêncio em relação aos ameaçadas de degradação, estão entre os ecossistemas
castigos corporais aplicados contra os negros. mais resistentes do planeta, tal como ocorre com os
e) o feitor orientado pelo padre procurava ser condescendente mangues.
no momento de chibatear o negro.

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


34 1º Simulado 2010 – Estilo ENEM

Está correto apenas o que se afirma em: projeto da usina. Ele diz que as comunidades locais não foram
a) I. ouvidas nos debates sobre a construção.
b) II.
c) I e II. Com base na charge, no texto e nos conhecimentos sobre o
d) II e III. tema, considere as afirmativas a seguir.
e) I, III e IV. I. A charge e o texto mostram a preocupação do Governo
brasileiro em desenvolver uma Política Indigenista que vise
RESPOSTA: B garantir os direitos territoriais dos povos indígenas.
Comentário: II. O texto e a charge remetem à importância da política
Os ecossistemas costeiros são diversos e ricos em indigenista brasileira nos últimos cinco anos e aos ganhos
biodiversidade pelo que várias actividades tem tido lugar tais sociais decorrentes da garantia dos direitos a essa
como agricultura, pesca, turismo, exploração mineira, população.
transportes entre outras. III. A partir da charge e do texto, é possível verificar que os
A maioria dos principais assentamentos humanos são povos indígenas estão alijados do apoio oficial necessário à
localizados ao longo da costa sendo por isso muito vulnerável a luta pela manutenção de suas terras e de seus recursos
impactos ambientais nomeadamente erosão e poluição costeira, naturais.
exploração excessiva de recursos naturais, desertificação e IV. A charge e o texto indicam que, em diversas instâncias,
mudanças climáticas ecoam ações e discursos contrários às reais necessidades
dos povos indígenas.

Estão corretas as afirmativas:


Questão 65 a) I e II, apenas.
Analise a charge e o texto a seguir. b) II e III, apenas.
c) III e IV, apenas.
d) I, II e IV, apenas.
e) I, III e IV, apenas.

RESPOSTA: C
Comentário:
Artigo 231 da Constituição:"São reconhecidos aos índios sua
organização social, costumes, línguas, crenças e tradições, e os
direitos originários sobre as terras que tradicionalmente ocupam,
competindo à União demarcá-las, proteger e fazer respeitar
todos os seus bens."

Pela charge e pelo texto o que existe de verdade no


tocante a política indigenista é que os seus direitos ficam ainda
Disponível em: <www.inesc.org.br.> Acesso em: 19 Jun. 2005. reduzido as promessas e leis não cumpridas , Pois mesmo
com a demarcação e homologação de suas terras cerca de 85%
TEXTO das áreas são alvo de invasão, segundo estimativa feita
pela Funai . Muitas dessas invasões acabam em violência.
O que é a Usina Hidrelétrica de Belo Monte? Existem vários motivos para tal. Deste a exploração
ilegal de madeira, o interesse por minérios , exploração
Com projeto para ser instalada na região conhecida imobiliária, disputa pela posse até o chamado “progresso” como
como Volta Grande do Rio Xingu, no Pará, a Usina de Belo construção de estradas , hidrelétricas , Barragens , ampliação da
Monte deve ser a terceira maior do mundo em capacidade agricultura moderna para exportação etc.
instalada, atrás apenas das usinas de Três Gargantas, na China, Assegurar plena efetividade ao texto constitucional é o desafio
e da binacional Itaipu, na fronteira do Brasil com o Paraguai. que está posto. Cabe aos índios, mas também às suas
Para a construção da hidrelétrica de Belo Monte, no Rio organizações, entidades de apoio, universidades, Ministério
Xingú, inundarão uma área no Pará onde se localizam 30 terras Público e outros mais. Sabe-se que se trata de um processo
indígenas e afetará um terço do município de Altamira. As lento, que está inclusive condicionado à tarefa de
principais tribos indígenas a serem afetadas são: aldeia conscientização da própria sociedade. O êxito dependerá
Paquiçamba, dos índios juruna, a tribo Arara, necessariamente do grau de comprometimento diário nessa
As lideranças indígenas da Volta Grande do rio Xingu, no direção por parte de todos e os que atuam na questão
Pará, prometem realizar uma ocupação da região em que será
construída a usina hidrelétrica de Belo Monte. Não há previsão
de quantas pessoas estarão envolvidas. Cerca de 150 índios da Questão 66
etnia Xikrin Kayapó devem chegar à área a partir de quarta-feira “No Brasil colonial, seguindo o costume português, desde o
(21). O cacique Luis Xipaya, presidente do Conselho Indígena despertar o cristão se via rodeado de lembranças do reino dos
de Altamira (PA), afirma que a ocupação das margens próximas céus. Na parede contígua à cama, havia sempre algum símbolo
à área da barragem principal é uma forma de protestar contra o visível da fé cristã: um quadrinho ou caixilho com gravura do
Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br
1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 35
Prova de Conhecimentos Gerais
anjo da guarda ou do santo; uma pequena concha com água d) preconceituosa, pois critica tanto índios quanto negros,
benta; o rosário dependurado na cabeceira da cama.” representando de modo positivo apenas o elemento
(MOTT, Luiz. Cotidiano e Vivência Religiosa: europeu, vindo com as caravelas.
entre a capela e o calundu. In. Laura de Mello e Souza e) negativa, pois retrata a formação do Brasil como incoerente
(org.). História da Vida Privada no Brasil.) e defeituosa, resultando em anarquia e falta de seriedade.

Sobre a influência da religião na vida do Brasil colonial que o RESPOSTA: A


texto aborda, podemos afirmar corretamente que: Comentário:
a) não possui qualquer vínculo com a tradição metropolitana O viés humorístico de Oswald de Andrade remonta à
portuguesa. ambigüidade da formação brasileira, diversa e rica pelo seu
b) faz parte de um culto exclusivo nas famílias de posses, visto caráter desconjuntado de um índio bravo, de um branco
que o povo preferia a religião africana. inquisidor e do negro festivo, reforçando a interpretação correta
c) durante a ocupação holandesa, os rituais católicos foram do item “C”.
completamente abolidos, pois a religião dos novos donos do
Brasil era protestante.
d) os símbolos e signos religiosos, presentes em cada canto da
casa, refletia a combinação de beleza, fé e dominação na
sociedade dividida em senhores e escravos. Questão 68
e) o cristianismo aplicado a realidade colonial brasileira, foi
subvertido e corrompido pelos vícios culturais africanos e
indígenas.

RESPOSTA: D
Comentário:
A religiosidade brasileira, traço de nossa cultura miscigenada, é
composta de símbolos e signos de fé, domínio e beleza que dão
identidade ao povo e seus senhores na fase colonial quando de
uma sociedade bipolar, reflexo da tradição sincrética católica nos
trópicos. O item correto é o “D”.

Questão 67 O artesanato traz as marcas de cada cultura e, desse modo,


atesta a ligação do homem com o meio social em que vive. Os
Brasil artefatos são produzidos manualmente e costumam revelar uma
O Zé Pereira chegou de caravela integração entre o homem e o meio ambiente, identificável no
E preguntou pro guarani da mata virgem tipo de matéria-prima utilizada.
― Sois cristão? Pela matéria-prima (o barro) utilizada e pelos tipos humanos
― Não. Sou bravo, sou forte, sou filho da Morte representados, em qual região do Brasil o artefato acima foi
Teterê tetê Quizá Quizá Quecê! produzido?
Lá longe a onça resmungava Uu! ua! uu! a) Sul.
O negro zonzo saído da fornalha b) Norte.
Tomou a palavra e respondeu c) Nordeste.
― Sim pela graça de Deus d) Centro-Oeste.
Canhem Babá Canhem Babá Cum Cum! e) Sudeste
E fizeram o Carnaval
(Oswald de Andrade) RESPOSTA: C
Comentário:
Este texto apresenta uma versão humorística da formação do
A questão reflete a identidade de cada região com sua cultura,
Brasil, mostrando-a como uma junção de elementos diferentes.
reflexo da relação homem-meio social, no caso, o artesanato
Considerando-se esse aspecto, é correto afirmar que a visão
nordestino. O item correto é o “C”.
apresentada pelo texto é:
a) ambígua, pois tanto aponta o caráter desconjuntado da
formação nacional, quanto parece sugerir que esse
processo, apesar de tudo, acaba bem.
b) inovadora, pois mostra que as três raças formadoras –
portugueses, negros e índios – pouco contribuíram para a
formação da identidade brasileira.
c) moralizante, na medida em que aponta a precariedade da
formação cristã do Brasil como causa da predominância de
elementos primitivos e pagãos.
Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br
36 1º Simulado 2010 – Estilo ENEM

d) O fenômeno mostrado no gráfico 2 apresenta uma estreita


Questão 69 relação de causa ou de efeito com os fenômenos mostrados
Observe os gráficos para responder à questão que se segue: nos gráficos 1 e 3.
e) O fenômeno mostrado no gráfico 3 não apresenta qualquer
tipo de relação de causa ou de efeito com o fenômeno
mostrado no gráfico 1.

RESPOSTA: D
Comentário:
O fenômeno mostrado no gráfico 1 — o aumento da emissão de
dióxido de carbono na atmosfera — é um dos responsáveis pelo
agravamento do “efeito estufa” e,conseqüentemente, pelo
aquecimento global da Terra. Esse aquecimento tem provocado,
entre outros aspectos, o fenômeno destacado no gráfico 2: o
aumento do nível de degelo das calotas polares. Este, por sua
vez, tem provocado, entre outros aspectos, a elevação das
águas oceânicas, referida no gráfico 3. Isso significa, portanto,
que existe uma relação de causa e efeito entre os fenômenos
mostrados nos três gráficos.

Questão 70
O franciscano Roger Bacon foi condenado, entre 1277 e 1279,
por dirigir ataques aos teólogos, por uma suposta crença na
alquimia, na astrologia e no método experimental, e também por
introduzir, no ensino, as idéias de Aristóteles. Em 1260, Roger
Bacon escreveu:

“Pode ser que se fabriquem máquinas graças às quais os


maiores navios, dirigidos por um único homem, se desloquem
mais depressa do que se fossem cheios de remadores; que se
construam carros que avancem a uma velocidade incrível sem a
ajuda de animais; que se fabriquem máquinas voadoras nas
quais um homem (...) bata o ar com asas como um pássaro. (...)
Máquinas que permitam ir ao fundo dos mares e dos rios”
(apud. BRAUDEL, Fernand. Civilização
material,economia e capitalismo: séculos XV-
XVIII,São Paulo: Martins Fontes, 1996, vol. 3.).

Considerando a dinâmica do processo histórico, pode-se afirmar


de modo verdadeiro que as idéias de Roger Bacon
a) inseriam-se plenamente no espírito da Idade Média ao
privilegiarem a crença em Deus como o principal meio para
antecipar as descobertas da humanidade.
b) estavam em atraso com relação ao seu tempo ao
desconsiderarem os instrumentos intelectuais oferecidos
pela Igreja para o avanço científico da humanidade.
Considerando os três gráficos, assinale a alternativa que faz c) opunham-se ao desencadeamento da Primeira Revolução
considerações corretas sobre as relações existentes entre os Industrial, ao rejeitarem a aplicação da matemática e do
fenômenos neles mostrados. método experimental nas invenções industriais.
a) O fenômeno mostrado no gráfico 1 não apresenta nenhum d) eram fundamentalmente voltadas para o passado, pois não
tipo de relação de causa ou de efeito com o fenômeno apenas seguiam Aristóteles, como também baseavam-se na
mostrado no gráfico 3. tradição e na teologia.
b) O fenômeno mostrado no gráfico 3 não apresenta nenhum e) inseriam-se num movimento que convergiria mais tarde para
tipo de relação de causa ou de efeito com o fenômeno o Renascimento, ao contemplarem a possibilidade de o ser
mostrado no gráfico 2. humano controlar a natureza por meio das invenções.
c) Os fenômenos mostrados, embora estejam ocorrendo no
planeta, não apresentam entre si nenhum tipo de relação de
causa ou de efeito.

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 37
Prova de Conhecimentos Gerais
RESPOSTA: E RESPOSTA: D
Comentário: Comentário:
Roger Bacon viveu no período medieval e antecipou-se, sob É provável que a OTAN justificasse suas intervenções militares
muitos aspectos, às transformações culturais que se utilizando a argumentação contida no texto II, ou seja, que "a
desencadearam a partir da época do Renascimento na Europa guerra nem sempre é um desvalor".
Ocidental nos séculos XV e XVI.

Questão 73
Questão 71 A Geologia trabalha com longas escalas de tempo, analisando
Leia os texto I e II. os fatores endógenos e exógenos que transformam a litosfera ao
I. Para o filósofo inglês Thomas Hobbes (1588-1679), o estado longo de milhões de anos, contribuindo para a criação de novos
de natureza é um estado de guerra universal e perpétua. espaços geográficos. O texto a seguir trata de um agente
Contraposto ao estado de natureza, entendido como estado transformador que até pouco tempo atrás quase não era levado
de guerra, o estado de paz é a sociedade civilizada. Dentre em conta. Leia-o com atenção:
outras tendências que dialogam com as idéias de Hobbes,
destaca-se a definida pelo texto abaixo. A ação humana sobre a superfície terrestre é dez vezes mais
II. Nem todas as guerras são injustas e correlativamente, nem poderosa do que todos os rios e geleiras. Estima- -se que o
toda paz é justa, razão pela qual a guerra nem sempre é um homem tenha transportado, ao longo de sua história, cerca de
desvalor, e a paz nem sempre um valor. 16 mil km3 de solo e rochas. Parece que nada na natureza é tão
rápido e tão perigoso para o meio ambiente quanto a atividade
BOBBIO, N. MATTEUCCI, N PASQUINO, G. humana. Atualmente a humanidade movimenta cerca de
Dicionário de Política, 5ª ed. Brasília: Universidade de 140km3 de solos e rochas por ano, o que equivale a desgastar
Brasília; São Paulo: Imprensa Oficial do Estado, 2000. 325 metros da superfície continental a cada milhão de anos.
Compare-se esse dado com o que se sabe sobre as forças
Comparando as idéias de Hobbes (texto I) com a tendência naturais de erosão nos últimos 540 milhões de anos: estas
citada no texto II, pode-se afirmar corretamente que: desgastaram a superfície terrestre em cerca de 30 metros a
a) em ambos, a guerra é entendida como inevitável e injusta. cada milhão de anos.
b) para Hobbes, a paz é inerente à civilização e, segundo o Esse processo se acelerou desde a Revolução Agrícola, graças
texto II, ela não é um valor absoluto. à ampliação das áreas de cultivo, mas foi a Revolução Industrial,
c) de acordo com Hobbes, a guerra é um valor absoluto e, com ampliação das cidades, mineração, industrialização e
segundo o texto II, a paz é sempre melhor que a guerra. transporte, que mais mudou a superfície terrestre.
d) em ambos, a guerra ou a paz são boas quando o fim é justo. A erosão per capita mundial, em nossos dias, é de cerca de 6
e) para Hobbes, a paz liga-se à natureza e, de acordo com o toneladas ao ano, variando segundo o grau de desenvolvimento
texto II, à civilização. do país. Nos Estados Unidos a média é de 30 toneladas per
capita.
RESPOSTA: B (Traduzido e adaptado de Bruce H. Wilkinson, Humans
Comentário: as geologic agents: a deep-time perspective. Geology. Vol. 33,
De acordo com o texto I, no estado de natureza existe um abril 2005.)
permanente estado de guerra, enquanto a paz caracteriza a
sociedade civilizada. Com base no texto e nos seus conhecimentos sobre as
O texto II, por sua vez, relativiza tanto a paz como a guerra, transformações do espaço natural e geográfico, aponte a
portanto ambas não podem ser consideradas valores absolutos. afirmação correta:
a) A ação humana se situa em uma escala de tempo
relativamente curta, contada em milhares de anos, mas sua
dinâmica tem sobrepujado as forças da natureza, que agem
Questão 72 em escalas mais longas.
Tropas da Aliança do Tratado do Atlântico Norte (OTAN) b) A ação humana teve início na era Terciária e, graças ao
invadiram o Iraque em 1991 e atacaram a Sérvia em 1999. Para acelerado crescimento humano na fase inicial das migrações
responder aos críticos dessas ações, a OTAN usaria, intercontinentais, causou grandes transformações à
possivelmente, argumentos baseados: superfície terrestre.
a) na teoria da guerra perpétua de Hobbes. c) O desgaste da superfície continental não é relevante, já que
b) tanto na teoria de Hobbes como na tendência expressa no os continentes estão sofrendo um contínuo processo de
texto II. soerguimento.
c) no fato de que as regiões atacadas não possuíam d) O volume de solos destruído pela ação humana é realmente
sociedades civilizadas. elevado, mas o volume de rochas movimentado pela ação
d) na teoria de que a guerra pode ser justa quando o fim é das geleiras e rios é bem superior.
justo. e) Nos países pobres a erosão per capita é muito menor que
e) na necessidade de pôr fim à guerra entre os dois países nos países ricos devido ao pequeno uso que suas
citados. populações fazem da natureza e à sua maior preocupação
com o meio ambiente.

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


38 1º Simulado 2010 – Estilo ENEM

RESPOSTA: A relevo, etc., favorece a diversificação de inúmeras espécies


Comentário: que podem ocupar diferentes nichos ecológicos.
A ação humana é analisada em uma escala de tempo III. Madagascar, Indonésia e Filipinas apresentam, além de
usualmente limitada aos últimos 10 mil anos. Os agentes da grande biodiversidade, um elevado número de espécies que
natureza agem em escalas de milhões de anos. No entanto, o ocorrem apenas nesses locais; sendo ilhas, constituem
crescimento acelerado da população e a ampliação da sua ambientes propícios para a evolução de espécies exclusivas,
capacidade de transformação do espaço natural, estão levando pois estão isoladas geograficamente dos continentes.
a crer que a humanidade é o mais importante agente IV. À medida que certos ambientes — tais como o solo, as
transformador da superfície terrestre. A humanidade não existia copas das grandes árvores de florestas tropicais e o fundo
na era Terciária e, desde que surgiu, seu crescimento foi lento, do mar — venham a ser mais estudados, muitas novas
só se acelerando a partir do século XIX. O texto mostra que o espécies poderão ser descobertas.
desgaste provocado na superfície terrestre pela ação humana é V. A biodiversidade constitui hoje um enorme potencial para
relevante, o que se comprova por ser ele quase 11 vezes que a biotecnologia desenvolva, com propósito alimentício e
superior ao que resulta da ação das forças da natureza. A industrial, novas espécies, mais resistentes às pragas,
humanidade movimenta mais solos e rochas que as forças da doenças e adversidades ambientais.
natureza. Nos países pobres, as populações fazem muito uso da
natureza e os cuidados com o meio ambiente são em geral Estão corretos os itens:
pequenos, sobretudo em razão da falta de recursos financeiros. a) I, II, III e V, somente.
b) II, III, IV e V, somente.
c) I, III e IV, somente.
Questão 74 d) II, IV e V, somente.
“Diversidade biológica, ou biodiversidade, refere-se à variedade e) I, II, III, IV e V.
da vida no planeta Terra, incluindo: a variedade genética dentro
das populações e espécies; a variedade de espécies da flora, da RESPOSTA: E
fauna e de microrganismos; a variedade de funções ecológicas Comentário:
desempenhadas pelos organismos nos ecossistemas; e a Todos os itens apresentados trazem informações corretas
variedade de comunidades, habitats e ecossistemas formados acerca da biodiversidade no planeta Terra.
pelos organismos.” (DIAS, B. F. S. Biodiversidade: perspectivas
e oportunidades tecnológicas.)
No mapa a seguir estão assinalados os países em cujos
territórios se encontram 70% das espécies vegetais e animais Questão 75
existentes sobre a Terra. A maioria dos países que apresenta O texto abaixo reproduz parte de um diálogo entre dois
megadiversidade está localizada nas regiões onde ocorrem personagens de um romance.
florestas pluviais tropicais. – Quer dizer que a Idade Média durou dez horas? –
Perguntou Sofia.
– Se cada hora valer cem anos, então sua conta está
certa. Podemos imaginar que Jesus nasceu à meia-noite, que
Paulo saiu em peregrinação missionária pouco antes da meia-
noite e meia e morreu quinze minutos depois, em Roma. Até as
três da manhã a fé cristã foi mais ou menos proibida. (...) Até as
dez horas as escolas dos mosteiros detiveram o monopólio da
educação.
Entre dez e onze horas são fundadas as primeiras
universidades.
Adaptado de GAARDER, Jostein. O Mundo de Sofia,
Romance da História da Filosofia. São Paulo: Cia das Letras,
1997.

No que diz respeito a biodiversidade, julgue os itens a seguir. O ano de 476 d.C., época da queda do Império Romano do
I. A biodiversidade é produto de processos evolutivos Ocidente, tem sido usado como marco para o início da Idade
mediados por mecanismos de seleção natural. Média. De acordo com a escala de tempo apresentada no texto,
II. Nas florestas tropicais, a grande diversidade de condições que considera como ponto de partida o início da Era Cristã,
abióticas, tais como temperatura, umidade, luminosidade, pode-se afirmar corretamente que:

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 39
Prova de Conhecimentos Gerais
a) as Grandes Navegações tiveram início por volta das quinze
horas. Questão 77
b) a Idade Moderna teve início um pouco antes das dez horas.
c) o Cristianismo começou a ser propagado na Europa no início
da Idade Média.
d) as peregrinações do apóstolo Paulo ocorreram após os
primeiros 150 anos da Era Cristã.
e) os mosteiros perderam o monopólio da educação no final da
Idade Média.

RESPOSTA: A
Comentário:
A questão propõe localizar eventos históricos em rara escala
hipotética de tempo, medida em horas, em que a meia-noite (0
h) corresponde ao início da Era Cristã (ano 1 d.C.) e em que
cada hora vale cem anos.
A figura acima representa no universo dos engenhos coloniais
Assim, as Grandes Navegações, que tiveram início no século
do Brasil:
XV, estariam localizadas, na escala proposta, por volta das 15 h.
a) a especialização da produção açucareira que prioriza
experiência e tecnologia trazidas pelos africanos.
b) a participação dos escravos na moagem da cana,
consolidando a frase de Antonil: “os escravos são as mãos e
Questão 76 os pés do senhor”.
c) o predomínio do trabalhador livre e assalariado na moagem
da cana e feitura do açúcar.
d) uma das fases iniciais da empresa açucareira, logo após a
colheita, onde predominava o trabalhador livre e especialista.
e) a moagem da cana feita por escravos destacados
exclusivamente pra essa função, já que no escravismo
brasileiro escravo da lavoura não exerce qualquer outra
função na fazenda.

RESPOSTA: B
Comentário:
O artista e sua obra, dada circunstâncias específicas,
reproduzem a realidade social e colaboram com o desvendar de
relações homem – meio/homem – produção, caso da pintura de
Debret, Escravos no Engenho, que confirma a participação de
escravos na geração de riqueza no Brasil colonial. O item
correto é o “C”.

A charge acima sugere que Tiradentes ao longo da história: Questão 78


a) foi desprezado como líder idealista defensor da liberdade e O texto foi extraído da peça Tróilo e Créssida de William
da democracia. Shakespeare, escrita, provavelmente, em 1601.
b) ficou marcado como traidor da metrópole portuguesa e da
colônia brasileira. “Os próprios céus, os planetas, e este centro
c) tornou-se exemplo de criminalidade e subversão da ordem reconhecem graus, prioridade, classe,
pública. constância, marcha, distância, estação, forma,
d) conquistou status de libertário e defensor da democracia no função e regularidade, sempre iguais;
Brasil. eis porque o glorioso astro Sol
e) ficou preso e esquecido no passado dos livros de história. está em nobre eminência entronizado
e centralizado no meio dos outros,
RESPOSTA: D e o seu olhar benfazejo corrige
Comentário: os maus aspectos dos planetas malfazejos,
A sugestão da charge é utilizar símbolos do passado, caso de e, qual rei que comanda, ordena
Tiradentes, pra repensar um referencial ético da política atual sem entraves aos bons e aos maus.”
carente de vergonha e moral no trato com o povo e a coisa (personagem Ulysses, Ato I, cena III).
pública. O item que reflete tal imaginário é o “D”. SHAKESPEARE, W. Tróilo e Créssida. Porto: Lello &
Irmão, 1948.
Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br
40 1º Simulado 2010 – Estilo ENEM

a) X ⇒ 1; Y ⇒ 2; Z ⇒ 3
A descrição feita pelo dramaturgo renascentista inglês se b) X ⇒ 2; Y ⇒ 1; Z ⇒ 3
aproxima da teoria c) X ⇒ 3; Y ⇒ 1; Z ⇒ 2
a) geocêntrica do grego Claudius Ptolomeu. d) X ⇒ 2; Y ⇒ 3; Z ⇒ 1
b) da reflexão da luz do árabe Alhazen. e) X ⇒ 1; Y ⇒ 3; Z ⇒ 2.
c) heliocêntrica do polonês Nicolau Copérnico.
d) da rotação terrestre do italiano Galileu Galilei.
e) da gravitação universal do inglês Isaac Newton. RESPOSTA: A
Comentário:
X área mais úmida prevalecendo um solo mais profundo pela
RESPOSTA: C ação do intemperismo químico. Ao passo que a área Y tem
Comentário: características mais áridas associada ao solos rasos , já o setor
De acordo com o texto "... o glorioso astro Sol está em nobre 3 caracteriza uma região mais úmida equatorial daí também
eminência entronizado e centralizado no meio dos outros..."; solos mais espessos.
portanto, aproxima-se da teoria heliocêntrica de Nicolau
Copérnico.

Questão 80
Analise as representações cartográficas.
Questão 79
Observe o mapa e as figuras a seguir.

(M. E. Simielli, Geoatlas, 2007)

Estas representações são anamorfoses geográficas. Uma


anamorfose geográfica representa a superfície dos países em
áreas proporcionais a uma determinada quantidade.
As anamorfoses acima representam, respectivamente:
a) Número de turistas recebidos e Produto Nacional Bruto.
b) Produto Nacional Bruto e População.
c) População e Número de turistas recebidos.
d) População ativa na agricultura e Produto Nacional Bruto.
e) População e População ativa na agricultura

Correlacionando-se os elementos que atuam na formação dos


solos, assinale a alternativa que CORRETAMENTE associa o
perfil de solo à sua respectiva localização no mapa.
Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br
1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 41
Prova de Conhecimentos Gerais

RESPOSTA: B Questão 82
Comentário: Nas favelas, o tráfico supera as instituições; nessas
Anamorfose: é um mapa no qual a superfícies reais sofrem uma comunidades, a influência do poder público torna as relações de
distorção para se tornarem proporcionais à variável que está poder, primitivas, até bélicas. Leia o que afirma uma moradora
sendo representada. de favela no Rio de Janeiro:

“a vantagem de viver aqui, é não pagar aluguel e morar na zona


sul. A desvantagem é pagar o IPTU mais caro do Rio, muito caro
Questão 81 mesmo: a violência.”
“... todos os brasileiros, e, sobretudo os brancos, não percebem (O Globo, abril de 2001)
suficientemente que é tempo de se fechar a porta aos debates
políticos (...). Se continua a falar dos direitos dos homens, da A relação sociedade/poder descrita acima, caracteriza-se pela:
igualdade, terminar-se-á por pronunciar a palavra fatal: a) ausência do poder público, fruto de uma mera deficiência da
liberdade, palavra terrível e que tem muito mais força num País administração estatal.
de escravos que em qualquer outra parte”. b) presença do poder público nesta comunidade quando
(MOTA, Carlos Guilherme (org.). “1822: dimensões”. São solicitada.
Paulo: Perspectiva, 1972. p. 482.) c) deficiência do poder público nestas comunidades tidas como
pouco relevantes socialmente.
O texto acima, escrito provavelmente por volta de 1823/1824, é d) adesão da própria comunidade ao comando alternativo que
parte de uma carta sobre a independência do Brasil, enviada por afasta o poder público.
um observador europeu a D. João VI. Leia com atenção o texto e) estrutura de poder democrático organizada pelas
e, a seguir, assinale a alternativa que expressa a configuração associações de moradores da comunidade.
social do processo brasileiro de independência.
a) A democracia racial, decorrente de uma intensa RESPOSTA: C
miscigenação durante o período colonial, contribuiu para Comentário:
conciliar, logo nos primeiros anos do Império, os interesses A relação Poder – Sociedade no capitalismo está ligada à
dos distintos grupos sociais. (pouca) importância de comunidades ditas irrelevantes, porém,
b) A “solução monárquica”, através da qual a jovem nação merecedoras de atenção no que diz respeito ao conceito de
optava por afastar-se de seus vizinhos americanos e adotar ordem social e bem-estar das elites econômicas. O item que
modelos políticos europeus, foi historicamente necessária corrobora tal interpretação é o “C”.
como instrumento de conciliação das raças no Brasil.
c) O “haitianismo”, temor da elite branca brasileira de que se
repetisse no Brasil uma revolução negra, tal qual ocorrera no Questão 83
Haiti, limitou as bases sociais da independência e justificou "A palavra tatuagem é relativamente recente. Toda a gente sabe
manifestações como essa da carta transcrita. que foi o navegador Cook que a introduziu no Ocidente, e esse
d) Em razão de temores como aquele expresso na carta citada, escrevia tattou, termo da Polinésia de tatou ou tu tahou,
a independência fez-se acompanhar de um processo 'desenho'.
crescente de enfraquecimento da escravidão. Os mesmos (...) Desde os mais remotos tempos, vemo-la a transformarse:
grupos que lideraram o processo de independência distintivo honorífico entre uns homens, ferrete de ignomínia entre
liderariam, anos depois, a abolição da escravatura. outros, meio de assustar o adversário para os bretões, marca de
e) O temor expresso na carta é infundado, pois além de contar uma classe de selvagens das ilhas marquesas (...) sinal de
com um número pequeno de escravos à época da amor, de desprezo, de ódio (...). Há três casos de tatuagem no
independência, as relações entre os escravos e seus Rio, completamente diversos na sua significação moral: os
senhores, no Brasil, sempre foram cordiais, decorrendo negros,os turcos com o fundo religioso e o bando de meretrizes,
justamente disso a noção de “democracia racial”. dos rufiões e dos humildes, que se marcam por crime ou por
ociosidade".
RESPOSTA: C RIO, João do. Os Tatuadores. Revista Kosmos. 1904, apud: A
Comentário: alma encantadora das ruas, SP: Cia das Letras, 1999.
A transcrição da carta reflete temor de que direitos humanos e
igualdade, num país escravista abram caminho pra revolução e Com base no texto são feitas as seguintes afirmações:
inversão da ordem tradicional que na história do Brasil tem I. João do Rio revela como a tatuagem já estava presente na
justificado exploração, desigualdade social e desrespeito à cidade do Rio de Janeiro, pelo menos desde o início do
diversidade sócio-cultural, confirmando como correto o item “C”. século XX, e era mais utilizada por alguns setores da
população.
II. A tatuagem, de origem polinésia, difundiu-se no ocidente
com a característica que permanece até hoje: utilização
entre os jovens com função estritamente estética.
III. O texto mostra como a tatuagem é uma prática que se
transforma no tempo e que alcança inúmeros sentidos nos

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


42 1º Simulado 2010 – Estilo ENEM

diversos setores das sociedades e para as diferentes obra nacional e transformadora das estruturas sociais, sendo,
culturas. para tanto, correto o item “C”.

Está correto o que se afirma apenas em


a) I
b) II Questão 85
c) III Um jornalista publicou um texto do qual estão transcritos trechos
d) I e II do primeiro e do último parágrafos:
e) I e III
" 'Mamãezinha, minhas mãozinhas vão crescer de novo?'
RESPOSTA: E Jamais esquecerei a cena que vi, na TV francesa, de uma
Comentário: menina da Costa do Marfim falando com a enfermeira que
Questão de nível fácil. Constata-se o seguinte: a tatuagem já
trocava os curativos de seus dois cotos de braços. (...)"
existia no Brasil no início do século XX (o texto é de 1904 e parte
dele se refere ao Rio do Janeiro) e era utilizada em diferentes
setores da sociedade. A afirmação de que as tatuagens "Como manter a paz num planeta onde boa parte da
possuem apenas finalidade estética entre os jovens elimina a humanidade não tem acesso às necessidade básicas mais
segunda alternativa. Já a última alternativa confirma as elementares? (...) Como reduzir o abismo entre o camponês
transformações das fun ções da tatuagem ao longo do tempo afegão, a criança faminta do Sudão, o Severino da cesta
nas mais diversas sociedades e culturas. básica e o corretor de Wall Street? Como explicar ao menino
de Bagdá que morre por falta de remédios, bloqueados pelo
Ocidente, que o mal se abateu sobre Manhattan? Como
Questão 84 dizer aos chechenos que o que aconteceu nos Estados
Unidos é um absurdo? Vejam Grozny, a capital da
Chechênia, arrasada pelos russos. Alguém se incomodou
com os sofrimentos e as milhares de vítimas civis, inocentes,
desse massacre? Ou como explicar à menina da Costa do
Marfim o sentido da palavra ' civilização' quando ela
descobrir que suas mãos não crescerão jamais?".
UTZERI, Fritz. Jornal do Brasil, 17/09/2001.

Apresentam-se, abaixo, algumas afirmações também retiradas


do mesmo texto. Aquela que explicita uma resposta do autor
para as perguntas feitas no trecho citado é:
a) "tristeza e indignação são grandes porque os atentados
ocorreram em Nova Iorque".
b) "ao longo da história, o homem civilizado globalizou todas as
A charge sugere que a independência, em 1822, pode ser suas mazelas".
descrita da seguinte forma: c) "a Europa nos explorou vergonhosamente".
a) O país passou da dependência econômica em relação a
d) "o neoliberalismo institui o deus mercado que tudo resolve".
Portugal à subordinação em relação aos EUA e sofreu
profundas mudanças na estrutura social. e) "os negócios das indústrias de armas continuam de vento
b) O país manteve a dependência econômica em relação a em popa".
Portugal, adquirindo liberdade política e social.
c) O país passou da dependência econômica em relação a RESPOSTA: B
Portugal à subordinação em relação à Inglaterra, não Comentário:
alterando sua estrutura social colonial.
Atualmente, vivemos um processo de globalização de
d) O país passou da dependência econômica em relação a
Portugal à subordinação em relação à França, alterando sua informações em que os acontecimentos, independentemente de
estrutura social colonial. sua natureza, chegam rapidamente a diversos pontos do planeta
e) O país manteve a dependência econômica em relação a devido à tecnologia dos meios de comunicação. Essa condição
Portugal e não modificou sua estrutura social colonial. permite fazer com que povos de diferentes localidades partilhem
o sofrimento de um fato trágico em um local distante apesar dos
RESPOSTA: C enormes tormentos de sua própria realidade.
Comentário: A partir da leitura atenta do enunciado e dos textos, a única
A sugestão da charge é uma crítica à independência do Brasil, alternativa correta é a B.
visto pelo autor mais como produto inglês do que resultante da

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 43
Prova de Conhecimentos Gerais
que as mesmas permanecessem no Brasil e posteriormente
Questão 86 premiou as tropas, tornando-as sua guarda pessoal.
Por que labutar no campo, na cidade? A máquina o fará III. Instalou-se um clima de guerra com toda tropa de linha e
por nós. miliciana do país. A estes se juntaram cidadãos de todas as
As relações campo-cidade têm passado por grandes classes: roceiros, agregados, negros forros, escravos
transformações no Brasil. Com relação a esse processo, é dispostos a enfrentar a divisão portuguesa.
correto afirmar que:
a) A crescente modernização das atividades agropecuárias tem São corretas:
liberado grandes contingentes de trabalhadores rurais que, a) I, II e III.
ao se dirigirem para as cidades, criam núcleos “caipiras” nas b) apenas I e III.
áreas urbanas. c) apenas I e II.
b) foi, principalmente, a partir da segunda metade do século XX d) apenas II e III.
que a economia rural tornou-se fornecedora de matérias- e) apenas I.
primas para as indústrias urbanas e consumidora de
mercadorias e serviços urbanos. RESPOSTA: B
c) à medida que o processo de mecanização da agricultura é Comentário:
concentrado nas áreas de cultivos de exportação, tornam-se A questão remonta ao episódio do “fico” visto como desfecho
mais evidentes o tradicionalismo do campo e o dinamismo das disputas entre portugueses e brasileiros na primeira metade
da cidade. do século XIX, enquanto caminho para a aliança entre D. Pedro
d) as diferenças socioculturais entre o mundo rural e o urbano e políticos brasileiros em nome da ruptura Brasil-Portugal. O
têm se acentuado à medida que avança a revolução técnico- item correto é o “B”.
científica e informacional nas cidades, principalmente do
Sudeste.
e) as estreitas ligações entre o mundo rural e o urbano, Questão 88
características da primeira metade do século XX, perderam Os efeitos abomináveis das armas nucleares já foram sentidos
força quando a modernização da agricultura reduziu a pelos japoneses há mais de 50 anos (1945). Vários países têm,
subordinação técnica do campo em relação à cidade. isoladamente, capacidade nuclear para comprometer a vida na
Terra. Montar o seu sistema de defesa é um direito de todas as
RESPOSTA: B nações, mas um ato irresponsável ou um descuido pode
Comentário: desestruturar, pelo medo ou uso, a vida civilizada em vastas
Com a Revolução Industrial brasileira ocorreu um forte processo regiões. A não-proliferação de armas nucleares é importante.
de urbanização, tornando o complexo urbano-industrial o No 1º domingo de junho de 98, Índia e Paquistão rejeitaram a
principal consumidor da produção rural. Ao mesmo tempo, o condenação da ONU, decorrente da explosão de bombas
campo se tornou dependente dos produtos e serviços das atômicas pelos dois países, a título de teste nuclear e
cidades (máquinas, insumos, sistema financeiro etc.). comemoradas com festa, especialmente no Paquistão. O
governo paquistanês (país que possui maioria da população
muçulmana) considerou que a condenação não levou em conta
Questão 87 o motivo da disputa: o território de CAXEMIRA, pelo qual já
"...diz Oliveira Lima que um oficial português jurou a um oficial travaram 3 guerras desde sua independência (em 1947, do
brasileiro que o Brasil continuaria escravo de Portugal e que o Império Britânico, que tinha o Subcontinente Indiano como
príncipe embarcaria, mesmo que para isto, tivesse sua espada colônia). Dois terços da região, de maioria muçulmana,
de servir-lhe de prancha". pertencem à Índia e 1/3 ao Paquistão.
Fonte: LUSTOSA, Isabel. "Perfis Brasileiros: D. Pedro I". São
Paulo: Companhia das Letras, 2006. P. 132/133. Sobre o tempo e os argumentos podemos dizer de modo
verdadeiro que:
O episódio acima narrado refere-se ao famoso "Dia do Fico". Em a) a bomba atômica não existia no mundo antes de o Paquistão
relação aos desdobramentos dele decorrentes, considere as existir como país.
seguintes afirmativas: b) a força não tem sido usada para tentar resolver os
I. A oficialidade portuguesa não se conformou com a decisão problemas entre Paquistão e Índia.
de D. Pedro I de permanecer no Brasil. As tropas armadas c) Caxemira tornou-se um país independente em 1947.
portuguesas saíram dos quartéis, armados de cassetetes, d) os governos da Índia e Paquistão encontram-se numa
insultando transeuntes e praticando desacatos. perigosa escalada de solução de problemas pela força.
II. Medidas para conter os desagravos das tropas portuguesas e) diferentemente do século anterior, no início do século XX, o
não foram tomadas e contraditoriamente, D. Pedro I exigiu Império Britânico não tinha mais expressão mundial.

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


44 1º Simulado 2010 – Estilo ENEM

RESPOSTA: D RESPOSTA: B
Comentário: Comentário:
O texto apresenta, com veemência, os conflitos entre Paquistão O século XVI é um momento marcante da história européia por
e Índia pelo domínio da região da Caxemira. Note que já se diversos motivos: ao mesmo tempo que o europeu expandiu
travaram três guerras desde 1947, e é fácil perceber a forte seus territórios e sua cultura, ele sofreu em seu interior com as
investida armada nesses conflitos, principalmente pelos testes guerras religiosas, que eram fruto da Reforma Protestante.
nucleares realizados pelos dois países em 1998. A posição Nesse momento, também chegaram à Europa relatos sobre os
dessas nações em rela ção a esses testes, em contraposição à costumes do Novo Mundo, como a prática da antropofagia
sua condenação pela ONU, demonstra que o processo de observada na América em várias sociedades ind ígenas.
conquista daquela região se dá, sobretudo, pelo uso da força. Ela foi considerada pelos europeus como um hábito bárbaro,
Assim, a alternativa correta é a D. incivilizado e cruel. Montaigne, um escritor francês,
contemporâneo das guerras religiosas, observando a crítica feita
pelos europeus ao costume indígena da antropofagia, censura
Questão 89 sua própria sociedade que, nesse momento, cometia toda a
Michel Eyquem de Montaigne (1533-1592) compara, nos sorte de barbaridades em nome da religião. Com base na leitura
trechos, as guerras das sociedades Tupinambá com as do texto, percebemos que, mesmo considerando-se civilizado, o
chamadas "guerras de religião" dos franceses que, na segunda europeu praticava atos tão bárbaros quanto os cometidos no
metade do século XVI, opunham católicos e protestantes. ritual antropofágico.
Com base no texto de Montaigne, chega-se à conclusão de que
" (...) não vejo nada de bárbaro ou selvagem no que dizem o ato bárbaro não caracteriza uma sociedade específica. A
daqueles povos; e, na verdade, cada qual considera bárbaro o diferença de costumes não constituiu um critério válido para
que não se pratica em sua terra. (...) Não me parece excessivo julgar as diferentes sociedades.
julgar bárbaros tais atos de crueldade [o canibalismo] , mas que
o fato de condenar tais defeitos não nos leve à cegueira acerca
dos nossos. Estimo que é mais bárbaro comer um homem vivo Questão 90
do que o comer depois de morto; e é pior esquartejar um homem Nos países subdesenvolvidos a migração campo-cidade
entre suplícios e tormentos e o queimar aos poucos, ou entregá- apresenta determinadas causas e conseqüências como mostra o
lo a cães e porcos, a pretexto de devoção e fé, como não quadro a seguir.
somente o lemos mas vimos ocorrer entre vizinhos nossos
conterrâneos; e isso em verdade é bem mais grave do que assar
e comer um homem previamente executado. (...) Podemos
portanto qualificar esses povos como bárbaros em dando
apenas ouvidos à inteligência, mas nunca se compararmos a
nós mesmos, que os excedemos em toda sorte de
barbaridades."
MONTAIGNE, Michel Eyquem de, Ensaios, São Paulo:
Nova Cultural, 1984.
Países desenvolvidos
Causas de expulsão:
De acordo com o texto, pode-se afirmar corretamente que, para
- Liberação de mão-de-obra pela mecanização
Montaigne,
Causas de atração:
a) a idéia de relativismo cultural baseia-se na hipótese da
- Oferta de empregos urbanos
origem única do gênero humano e da sua religião.
Conseqüências:
b) a diferença de costumes não constitui um critério válido para
- Urbanização integrada; aumento de população
julgar as diferentes sociedades.
secundária e terciária
c) os indígenas são mais bárbaros do que os europeus, pois
não conhecem a virtude cristã da piedade.
Países subdesenvolvidos
d) a barbárie é um comportamento social que pressupõe a
Causas de expulsão:
ausência de uma cultura civilizada e racional.
- Pressão demográfica no campo
e) a ingenuidade dos indígenas equivale à racionalidade dos
Causas de atração:
europeus, o que explica que os seus costumes são
- Fascínio urbano
similares.
Conseqüências:
(?)

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br


1º Simulado 2007 - Estilo UFC
1º Simulado 2010 – Estilo ENEM 45
Prova de Conhecimentos Gerais
Com base no texto anterior, assinale a alternativa que descreve
corretamente as "conseqüências" para os países
subdesenvolvidos:
a) Urbanização anômala, cinturão marginal, subemprego no
setor terciário.
b) Urbanização integrada provocando um cinturão marginal
mesmo com o crescimento dos empregos na indústria e nos
serviços.
c) Urbanização anômala, depois integrada, devido às políticas
econômicas adotadas revertendo a situação de fascínio
urbano.
d) Crescimento lento da população urbana devido ao processo
de industrialização recente.
e) Absorção do excedente populacional do campo pelo
moderno e crescente setor terciário.

RESPOSTA: A
Comentário:
O êxodo rural provoca, na maioria das vezes, problemas sociais.
Cidades que recebem grande quantidade de migrantes, muitas
vezes, não estão preparadas para tal fenômeno. Os empregos
não são suficientes e muitos migrantes partem para o mercado
de trabalho informal e passam a residir em habitações sem boas
condições (favelas, cortiços, etc). Além do desemprego, o êxodo
rural descontrolado causa outros problemas nas grandes
cidades. Ele aumenta em grandes proporções a população nos
bairros de periferia das grandes cidades. Como são bairros
carentes em hospitais e escolas, a população destes locais
acabam sofrendo com o atendimento destes serviços. Escolas
com excesso de alunos por sala de aula e hospitais superlotados
alem de outros problema de ordem sócio- econômicos.

Simétrico Pré-Universitário – 1º Simulado Estilo ENEM 2010 – www.simetrico.com.br