Você está na página 1de 190

UNIVERSIDADE FEDERAL DE MINAS GERAIS

ESCOLA DE VETERINÁRIA
PROGRAMA DE DOUTORADO EM CIÊNCIA ANIMAL

Isolamento, Identificação e Avaliação de


Características Probióticas de Bactérias Ácido-
Láticas isoladas de amostras de queijo de coalho
produzidas em Pernambuco – Brasil

Luiz Gonzaga Guedes Neto

BELO HORIZONTE
2008
LUIZ GONZAGA GUEDES NETO
Isolamento, Identificação e Avaliação de
Características Probióticas de Bactérias Ácido-
Láticas isoladas de amostras de queijo de coalho
produzidas em Pernambuco – Brasil

Tese apresentada a Universidade Federal de Minas Gerais,


como requisito parcial para obtenção do grau de Doutor
em Veterinária.
Área de concentração: Medicina Veterinária Preventiva

Orientador: Prof. Dr. Wagner Luiz Moreira dos Santos


Coorientadores: Profa. Dra. Mônica Maria de Oliveira
Pinho Cerqueira e Prof Dr. Jacques Robert Nicoli.

Belo Horizonte
200
Luiz Gonzaga Guedes Neto
Isolamento, Identificação e Avaliação de Características Probióticas de Bactérias
Ácido-Láticas isoladas de amostras de queijo de coalho produzidas em
Pernambuco – Brasil.

Tese apresentada ao Programa de Doutorado em Veterinária da Universidade Federal


de Minas Gerais

A defesa desta dissertação foi realizada no dia __ de _____ de 2008 e a nota obtida
foi de ________________ concedida pela seguinte banca de examinadores:

Dr. Wagner Luiz Moreira dos Santos

Prof. Dr. Wagner Luiz Moreira dos Santos (Orientador) – UFMG

NOME

NOME– UNIVERSIDADE

NOME

NOME. – UNIVERSIDADE

AGRADECIMENTOS
Agradeço a Deus.

Aos meus queridos pais, Carlos Alberto e Heloisa, por todo o apoio e amizade.

Aos meus irmãos, Carolina, Helena e Lucas, eternos companheiros.

A Ju pelo amor e carinho

Ao Francisco, Vilma e Vitor pelo apoio e amizade.

Ao Professor Wagner pela orientação e confiança.

Ao Professor e amigo Marcelo Resende de Souza pela dedicação, amizade e empenho durante a
realização deste trabalho.

As Professoras e amigas Mônica Maria Oliveira Pinho Cerqueira e Cláudia Freire de Andrade
Morais Penna, pela importante colaboração e incentivos dados desde a graduação.

A Professora e amiga Maria José de Sena, pela amizade, ajuda e inestimável colaboração à
realização deste trabalho.

Aos Professores Leorges Moraes da Fonseca e Mônica Oliveira Leite.

Ao DTIPOA, na pessoa do chefe do Departamento, professor Renaldo Travassos Martins.

Aos funcionários do DTIPOA.

Ao Professor Jacques Robert Nicoli e a todos do Laboratório de Ecologia e Fisiologia de


Microrganismos do ICB, pela acolhida e importante contribuição a realização deste trabalho.

A Professora Regina Maria Nardi Drummond, do Departamento de Microbiologia do ICB – UFMG,


pelo apoio e colaboração ao trabalho.

Ao Professor Álvaro Cantini Nunes, e a todos do Laboratório de Biologia Molecular de Parasitos


do ICB, pela confiança, dedicação e envolvimento.

Ao Doutor Luiz Simeão do Carmo, pela amizade e valiosa contribuição.

Ao Professor Ivan Barbosa Machado Sampaio.

Ao Professor Iran Borges.

Aos colegas de pós-graduação pelo incentivo e amizade, especialmente às amigas Ana Helena de
Mendonça e Jamaira Ferreira Veras.

Ao Colegiado de Pós–Graduação da Escola de Veterinária da UFMG.

A URFPE e aos proprietários dos laticínios e fazendas visitadas no estado de Pernambuco.

A todos que de alguma forma contribuíram para a realização deste trabalho, por confiarem e
acreditarem em mim.
"Por muito tempo eu pensei que a minha vida fosse se tornar uma vida de verdade.
Mas sempre havia um obstáculo no caminho, algo a ser ultrapassado antes de começar a viver, um
trabalho não terminado, uma conta a ser paga.
Aí sim, a vida de verdade começaria.
Por fim, cheguei a conclusão de que esses obstáculos eram a minha vida de verdade.
Essa perspectiva tem me ajudado a ver que não existe um caminho para a felicidade.
A felicidade é o caminho!”.

Henfil

SUMÁRIO

RESUMO 15

1. INTRODUÇÃO E JUSTIFICATIVA 16
2. REVISÃO DA LITERATURA 18
2.1. Queijo de coalho 18
2.1.1. Critérios oficias de identidade e qualidade de queijo de coalho 20
2.1.1.1. Critérios físico-químicos 20
2.1.1..2. Critérios microbiológicos 20
2.1.2. Qualidade de queijo de coalho 21
2.2. Doenças transmitidas por alimentos e microrganiasmos patogênicos de 22
importância em queijos
2.2.1. Coliformes termotolerantes e Escherichia coli 24
2.2.2. Salmonella sp. 26
2.2.3. Listeria monocytogenes 27
2.2.4. Staphylococus sp e suas enterotoxinas 28
2.3. Bactérias Ácido-Lácticas (BAL) 32
2.3.1. Bactérias Ácido-Lácticas em queijos 32
2.3.2. Efeitos antimicrobianos de Bactérias Ácido-Lácticas 34
2.3.3. O gênero Lactobacillus sp 38
2.3.3.1. Efeitos probióticos e terapeuticos de Lactobacillus sp. 39
2.3.4. Métodos de isolamento e identificação de BAL. 41
2.4. Probióticos 47
2.4.1. Definição 48
2.4.2. Características desejáveis 48
2.4.3. Mecanismos de ação 50
2.4.4. Produtos carreadores de bactérias probióticas e microrganismos 52
empregados em sua formulação
2.5. O modelo animal e a avaliação de microrganismos probióticos 54
3. MATERIAIS E MÉTODOS 56
3.1. Amostragem e produção de queijo de coalho estudados 57
3.2. Determinação de Características e Composição Físico-Químicas de Queijo 57
de Coalho produzido em Pernambuco.
3.2.1. Determinação da acidez titulável 57
3.2.2. Determinação do extrato seco total (EST) e umidade - método gravimétrico 57
3.3. Isolamento, Enumeração, Caracterização Fisiológica e Purificação de 58
Bactérias Ácido-Lácticas de Queijo de Coalho Artesanal e Industrial,
produzido no Estado de Pernambuco.
3.4. Isolamento, Enumeração, Purificação e Identificação de Microrganismos 58
Patógenos (Coliformes a 30ºC e 45ºC, Escherichia coli O157:H7,
Salmonella spp., Listeria spp.) presentes em Queijo de Coalho artesanal e
Industrial, produzido no Estado de Pernambuco.
3.4.1. Pesquisa de coliformes a 30ºC - tubos múltiplos (APHA, 2001). 59
3.4.2. Pesquisa de coliformes a 45ºC (APHA, 2001) 59
3.4.3. Pesquisa de Escherichia coli O157:H7 (FDA, 2001) 59
3.4.4. Pesquisa de Salmonella spp. (APHA, 2001) 59
3.4.5. Pesquisa de Listeria spp. (IDF 1995; SILVA, 1996). 59
3.5. Isolamento, Enumeração, Purificação e Identificação de Staphylococcus 60
spp. e suas Enterotoxinas (CARMO, 2001)
3.5.1. Isolamento e identificação do microrganismo 60
3.5.2. Caracterização bioquímica 60
3.5.3. Prova da coagulase 60
3.5.4. Prova da termonuclease 61
3.5.5. Prova da fermentação da maltose e manitol 61
3.5.6. Prova da hemólise em ágar sangue 61
3.5.7. Cultura estoque 61
3.5.8. Indução da produção de enterotoxinas 61
3.6. Identificação Molecular, ao nível de Espécies, de Bactérias Ácido-Láctico 62
Isoladas de Queijo de Coalho produzido no Estado de Pernambuco.
3.6.1. Extração de DNA total 62
3.6.1.1. Obtenção das células sem parede e sem membrana 62
3.6.1.2. Extração com fenol – clorofórmio 62
3.6.1.3. Eletroforese em gel de agarose 62
3.6.1.4. Reação de Polimerização em Cadeia (PCR) 63
3.6.1.5. Digestão dos produtos de PCR 16S-23S 63
3.6.1.6. Seqüenciamento dos produtos de PCR 63
3.7. Pesquisa de Antagonismo In Vitro de Bactérias Ácido-Lácticas frente a 64
Patógenos da Microbiota de Queijo de Coalho Artesanal e Industrial,
produzido em Pernambuco (TAGG et al., 1976).
3.7.1. Análise estatística 64
3.8. Susceptibilidade aos Antimicrobianos de Bactérias Ácido-Lácticas e 64
Staphylococcus spp Isolados de Queijo de Coalho Artesanal e Industrial,
produzido no Estado de Pernambuco (CHARTERIS et al., 1998; NCCLS,
2003).
3.9. Avaliação de Características Probióticas - Capacidade de Colonização do 65
Trato Gastrointestinal e do Efeito de Proteção Contra Salmonelose
Experimental em Camundongos Gnotobióticos e Convencionais por
Bactérias Ácido-Lácticas Isoladas de Queijos de Coalho, Produzidos no
Estado de Pernambuco.
3.9.1. Animais de experimentação 65
3.9.1.1. Animais isentos de germes 65
3.9.1.2. Animais convencionais 65
3.9.2. Manejo dos animais 65
3.9.3. Análises dos animais isentos de germes 65
3.9.3.1. Obtenção dos animais gnotobióticos 65
3.9.3.2. Tratamentos e desafios 65
3.9.3.3. Determinação da capacidade de espécies de BAL de colonizar o trato 65
digestivo de camundongos isentos de germes
3.9.3.4. Teste de antagonismo “in vivo” 66
3.9.3.5. Sobrevivência e sobrevida 66
3.9.4. Análises dos animais convencionais 66
3.9.4.1. Tratamentos e desafio 66
3.9.4.2. Ganho de peso, sobrevida e sobrevivência. 66
3.9.5. Análises histológicas 66
3.9.6. Análises estatísticas 67
4. RESULTADOS E DISCUSSÃO 67
4.1. Processamento dos queijos de coalho 67
4.1.1. Produção industrial de queijo de coalho 67
4.1.1.1. Laticínio BL 67
4.1.1.2. Laticínio LV 68
4.1.2. Produção artesanal de queijo de coalho 68
4.1.2.1. Fazenda AQ 68
4.1.2.2. Fazenda CM 68
4.1.3. Avaliação dos sistemas de produção de queijo de coalho 69
4.1.3.1. Fluxogramas de produção 69
4.1.3.2. Ingredientes 69
4.1.3.3. Utensílios 70
4.1.3.4. Prazo de validade 70
4.1.3.5. Condições higiênico-sanitárias 70
4.2. Determinação de características e composição físico-químicas 70
4.3. Isolamento, enumeração, purificação e caracterização fisiológica de 72
bactérias ácido-lácticas
4.3.1. Isolamento e enumeração 72
4.3.2. Caracterização fisiológica 73
4.3.2.1. Isolamento em ágar M17 73
4.3.2.2. Isolamento em ágar MRS 74
4.4. Identificação das bactérias ácido-lácticas isoladas, de acordo com técnicas 75
de Biologia Molecular.
4.4.1 Diversidade da microbiota dos queijos de coalho 76
4.5. Isolamento, Enumeração, Purificação e Identificação de Microrganismos 78
Patógenos (Coliformes a 30 °C e 45 °C, Escherichia coli O157:H7,
Salmonella spp., Listeria spp.) presentes em Queijo de Coalho artesanal e
Industrial, produzido no Estado de Pernambuco.
4.6. Isolamento, enumeração, purificação e identificação de Staphylococcus 80
spp. e suas enterotoxinas
4.7. Teste de antagonismo "in vitro" entre as cepas isoladas de queijo de coalho 82
e contra microrganismos indicadores
4.7.1. Atividade antagonista frente a BAL, isoladas de queijo de coalho. 82
4.7.2. Atividade antagonista frente a Staphylococcus spp. e Escherichia coli, 83
isolados de queijo de coalho
4.7.3. Atividade antagonista frente a cepas referência de patógenos relevantes em 83
saúde pública
4.8. Teste de sensibilidade das bactérias ácido-lácticas isoladas frente aos 84
antimicrobianos
4.9. Determinação da capacidade de espécies de Lactobacilus spp de colonizar o 87
trato digestivo de camundongos isentos de germes
4.9.1. Determinação dos níveis populacionais da levedura nas diversas porções do 88
trato gastrointestinal de camundongos gnotobióticos (GN)
4.10. Determinação do efeito da levedura na colonização intestinal por S. 89
Typhimurium em camundongos gnotoxênicos (GN)
4.10.1. Anatomopatologia 93
4.11. Determinação do efeito de Lactobacillus spp no desenvolvimento ponderal 97
e na mortalidade por S. Typhimurium em camundongos convencionais
(CV).
5. CONCLUSÕES 98
6. REFERÊNCIAS BIBLIOGRÁFICAS 99
7. ANEXOS 184
Anexo A Fluxogramas de produção de queijo de coalho artesanal e industrial 184
Fluxograma 1: Fluxograma de produção de queijo de coalho do laticínio 184
BL
Fluxograma 2: Fluxograma de produção de queijo de coalho do laticínio 185
LV
Fluxograma 3: Fluxograma de produção de queijo de coalho da fazenda AQ 186
Fluxograma 4: Fluxograma de produção de queijo de coalho da fazenda 187
CM.
Anexo B Gram de culturas isoladas de queijo de coalho artesanal (AB e CM). 188
Anexo C Resultados dos seqüenciamentos dos produtos de PCR16S-23S clonados 191
em vetor Topo.
Anexo D Perfil de digestão dos fragmentos amplificados por PCR do espaçador 16S- 198
23S rRNA de diferentes espécies de BAL
Anexo E Perfil bioquímico de cepas de Staphylococcus spp. isolados de queijo de 199
coalho artesanal e industrial.
Anexo F Identificação bioquímica de linhagens de Staphylococcus spp. isolados de 200
queijo de coalho artesanal e industrial.
Anexo G Antagonismo frente a Listeria monocytogenes e teste de sensibilidade aos 201
antimicrobianos de Lactobacillus casei.
Anexo H Diversidade da microbiota presente em queijo de coalho artesanal e 203
industrial, produzidos no estado de Pernambuco.
Anexo I Produção industrial e artesanal de queijo de coalho. 204
Anexo J Extração do DNA total 213
Anexo L Amplificação da região intergênica 16S-23S por PCR 215
Anexo M Digestão enzimática dos produtos de PCR 217
LISTA DE FIGURAS
Figura 1 Níveis populacionais de Lactobacillus spp. no conteúdo do estômago (I), 89
intestino delgado – porção dista (II), ceco (III) e cólon (IV) do trato
gastrointestinal de camundongos NIH gnotobióticos (A) monoassociados
com dose única de 108 L. casei AB2 (A); L. acidophilus LV3 (B); L.
rhamnosus AQ1 (C) e L. fermentum AB3 (D). N = 5.
Figura 2 Populações fecais de S. Typhimurium em camundongos NIH gnotobióticos, 90
monoassociados (●) ou não (♦) com uma dose de 108 células viáveis da
levedura L. rahmnosus AQ1 (■) dez dias antes do desafio com 103 células
da bactéria patogênica. N = 3.
Figura 3 Populações fecais de S. Typhimurium em camundongos NIH gnotobióticos, 91
monoassociados (●) ou não (♦) com uma dose de 108 células viáveis da
levedura L. casei AB2 (■) dez dias antes do desafio com 103 células da
bactéria patogênica. N = 3.
Figura 4: Populações fecais de S. Typhimurium em camundongos NIH gnotobióticos, 91
monoassociados (●) ou não (♦) com uma dose de 108 células viáveis da
levedura L. fermentum AB3 (■) dez dias antes do desafio com 103 células
da bactéria patogênica. N = 3.
Figura 5 Populações fecais de S. Typhimurium em camundongos NIH gnotobióticos, 92
monoassociados (●) ou não (♦) com uma dose de 108 células viáveis da
levedura L. acidophilus LV3 (■) dez dias antes do desafio com 103 células
da bactéria patogênica. N = 3.
Figura 6 Sobrevida dos camundongos monoassociados ou não (I), antes do desafio 93
com 103 de S Typhimurium, com dose única de 108 de L. casei AB2 (II); L.
fermentum AB3 (III); L. rhamnosus AQ1 (IV) e L. acidophilus LV3 (V). N
= 5.
Figura 7 Corte Histológico de fígado de camundongos isentos de germes infectados 94
com Salmonella typhimurium não tratados (A) e tratados com AQ1. Notar a
presença de focos inflamatórios no parênquima hepático de fígado
infectado não tratado (seta) Hematoxilina e Eosina. Barra = 100 µm.
Figura 8 Corte Histológico de ceco de camundongos isentos de germes infectados 95
com Salmonella Typhimurium não tratados (A) e tratados com
Lactobacillus spp.. Notar presença de infiltrado inflamatório (seta).
Hematoxilina e Eosina. Barra = 100 µm
Figura 9 Corte Histológico de ceco de camundongos isentos de germes infectados 96
com Salmonella Typhimurium não tratados (A) e tratados com
Lactobacillus spp.. Notar presença de neutrófilos na submucosa (seta).
Hematoxilina e Eosina. Barra = 25 µm
Figura 10 Gram de cultura isolada de queijo de coalho artesanal (AB), identificada 188
como Lactobacillus fermentum.
Figura 11 Gram de cultura isolada de queijo de coalho artesanal (AB), identificada 189
como Streptococcus thermophilus.
Figura 12 Gram de cultura isolada de queijo de coalho artesanal (CM), identificada 190
como Weissella confusa.
Figura 13 Antagonismo de Lactobacillus casei isolado de queijo de coalho artesanal 201
frente a Listeria monocytogenes.
Figura 14 Teste de sensibilidade de Lactobacillus casei isolado de queijo de coalho 202
artesanal frente à diversas drogas antimicrobianas
Figura 15 Silos de estocagem de leite 204
Figura 16 Detalhe de piso e parede da área de recepção do leite 204
Figura 17 Vista interna da sala de processamento de queijos 205
Figura 18 Detalhe da sala de processamento de queijos 205
Figura 19 Área de recepção do leite. 206
Figura 20 Tanque de fabricação de queijo de coalho 206
Figura 21 Processo de salga na massa do queijo de coalho 207
Figura 22 Enformagem do queijo de coalho 207
Figura 23 Sistema de ordenha mecânica da Fazenda onde está localizada a indústria 207
LV
Figura 24 Recepção do leite na sala de produção de queijo 208
Figura 25 Leite colocado no recipiente para coagulação 208
Figura 26 Utensílios utilizados para produção dos queijos 209
Figura 27 Mexedura e quebra do coágulo 209
Figura 28 Massa do queijo dessorando dentro de sacos de plástico 210
Figura 29 Enformagem dos queijos 210
Figura 30 Vista externa do local destinado à produção de queijos 211
Figura 31 Utensílios utilizados para fabricação dos queijos 211
Figura 32 Enformagem dos queijos 212
Figura 33 DNA total de amostras de microrganismos fermentadores de lactose, 213
isolados de queijo de coalho em ágar MRS (canaletas da esquerda para a
direita: 1-marcador de peso molecular; 2-AB1; 3-AB2; 4-AB3; 5-marcador
de peso molecular; 6-CM1; 7-CM2; 8-CM3; 9-CM4; 10-LV1; 11-LV2 e 12-
LV3).
Figura 34 DNA total de amostras de microrganismos fermentadores de lactose, 213
isolados de queijo de coalho em ágar M17 (canaletas da esquerda para a
direita: 1-AQ1; 2-AQ2; 3-AQ3; 4-AQ4; 5-CM1; 6-CM2; 7-CM3; 8-CM4;
9-SM1; 10-SM2; 11-SM3; 12-SM4).
Figura 35 DNA total de amostras de microrganismos fermentadores de lactose, 214
isolados de queijo de coalho em ágar M17 (canaletas da esquerda para a
direita: 1-marcador de peso molecular; 2-AB1; 3-AB2; 4-AB3; 5-AB4; 6-
marcador de peso molecular; 7-LV1; 8-LV2; 9-LV3; 10-LV4; 11-vazia; 12-
vazia).
Figura 36 DNA total de amostras de microrganismos fermentadores de lactose, 214
isolados de queijo de coalho em ágar MRS (canaletas da esquerda para a
direita:1-vazia; 2-SM1; 3-SM2; 4-BL1; 5-BL2; 6-AQ1; 7-AQ2) e M17
(amostras da esquerda para a direita: 8-BL1; 9-BL2; 10-BL3; 11-BL4 e 12-
marcador de peso molecular)
Figura 37 PCR 16S-23S de DNA de amostras de microrganismos fermentadores de 215
lactose, isolados de queijo de coalho, em ágar MRS (canaletas da esquerda
para a direita: 1-marcador de peso molecular; 2-AB1; 3-AB2; 4-AB3; 5-
CM1; 6-CM2; 7-CM3; 8-CM4; 9-LV1; 10-LV2; 11-LV3 e 12-marcador de
peso molecular)
Figura 38 PCR 16S-23S de DNA de amostras de microrganismos fermentadores de 215
lactose, isolados de queijo de coalho, em ágar MRS (canaletas da esquerda
para a direita: 1-marcador de peso molecular; 2-AQ1; 3-AQ2; 4-BL1; 5-
BL2; 6-SM1 e 7-SM2) e M17 (canaletas da esquerda para a direita: 8-BL1;
9-BL2; 10-BL3; 11-BL4 e 12-marcador de peso molecular).
Figura 39 PCR 16S-23S de DNA de amostras de microrganismos fermentadores de 216
lactose, isolados de queijo de coalho, em ágar M17 (canaletas da esquerda
para direita: 1-marcador de peso molecular; 2-AQ1; 3-AQ2; 4-AQ3; 5-
AQ4; 6-CM4; 7-CM3; 8-CM2; 9-SM1; 10-SM2; 11-SM3 e 12-SM4)
Figura 40 Digestão de produtos de PCR 16S-23S de cultura identificada como 217
Lactobacillus rhamnosus (canaletas/enzimas da esquerda para a direita: 1-
SphI, 2-NcoI, 3-NheI, 4-SspI, 5-SfuI, 6-EcoRV, 7-DraI, 8-VspI, 9-EcoRI,
10-HpaI, 11-HindIII e 12- marcador de peso molecular).
Figura 41 Digestão de produtos de PCR 16S-23S de culturas identificadas como 217
Lactobacillus casei e Lactobacillus fermentum (canaletas/enzimas da
esquerda para a direita: 1-marcador de peso molecular, 2-SphI, 3-NcoI, 4-
NheI, 5-SspI, 6-SfuI, 7-EcoRV, 8-DraI, 9-VspI, 10-EcoRI, 11-HpaI, 12-
HindIII).
Figura 42 Digestão de produtos de PCR 16S-23S de culturas identificadas como 218
Lactobacillus rhamnosus (canaletas/enzimas da esquerda para a direita: 1-
marcador de peso molecular, 2-SphI, 3-NcoI, 4-NheI, 5-SspI, 6-SfuI, 7-
EcoRV, 8-DraI, 9-VspI, 10-EcoRI, 11-HpaI, 12-HindIII).
Figura 43 Digestão de produto de PCR 16S-23S de cultura identificada como 218
Lactobacillus sp. do grupo acidófilo (canaletas/enzimas da esquerda para a
direita: 1-marcador de peso molecular, 2-SphI, 3-NcoI, 4-NheI, 5-SspI, 6-
SfuI, 7-EcoRV, 8-DraI, 9-VspI, 10-EcoRI, 11-HpaI, 12-HindIII)

LISTA DE QUADROS
Quadro 1 Requisitos microbiológicos para inspeção de queijos de alta umidade. 21
Quadro 2 Programa utilizado para obtenção dos produtos da PCR 63
Quadro 3 Principais diferenças relacionadas à produção de queijo de coalho. 69
Quadro 4 Microrganismos identificados por seqüenciamento de DNA isolados de 75
amostras de queijo de coalho artesanal e industrializado.
Quadro 5 Identificação bioquímica de linhagens de Staphylococcus spp. isolados de 200
queijo de coalho artesanal e industrial
Quadro 6 Diversidade da microbiota presente em queijo de coalho artesanal e 203
industrial, produzidos no estado de Pernambuco
LISTA DE TABELAS
Tabela 1 Resultados de análises físico-químicas de seis amostras de queijo de 71
coalho, produzido no Estado de Pernambuco.
Tabela 2 Resultados de determinação da acidez titulável de queijo de coalho 72
produzido no estado de Pernambuco.
Tabela 3 Enumeração (UFC/g) de microrganismos produtores de ácido láctico em 72
amostras de queijo de coalho artesanal e industrializado
Tabela 4 Resultados de análises microbiológicas de culturas isoladas em ágar M17 a 73
partir de queijo de coalho, produzido no estado de Pernambuco
Tabela 5 Resultados de análises microbiológicas de culturas isoladas em ágar MRS a 74
partir de queijo de coalho, produzido no estado de Pernambuco
Tabela 6 Resultados da contagem de coliformes a 30 °C e a 45 °C e da pesquisa de 78
E. coli O157:H7, Salmonella sp. e Listeria sp. em queijo de coalho
Tabela 7 Espécies de microrganismos do grupo coliforme e outros Gram negativo 79
identificados em amostras de queijo de coalho artesanal e industrial,
produzidos em Pernambuco
Tabela 8 Enumeração de E. coli (NMP/g) em amostras de queijo de coalho artesanal 80
e industrial produzidos em Pernambuco.
Tabela 9 Enumeração de Staphylococcus spp. em amostras de queijo de coalho 80
artesanal e industrializado.
Tabela 10 Atividade antagonista de culturas de BAL isoladas de queijo de coalho 82
frente às mesmas e a outras BAL (halo de inibição em mm)
Tabela 11 Atividade antagonista de culturas de BAL isoladas de queijo de coalho 83
frente a Staphylococcus spp. e Escherichia coli (halo de inibição em mm)
Tabela 12 Atividade antagonista de culturas de BAL isoladas de queijo de coalho 84
frente a patógenos de referência.
Tabela 13 Perfil de resistência de microrganismos isolados de queijo de coalho em 85
teste de difusão em ágar MRS com discos de antimicrobianos
Tabela 14 Perfil de resistência de microrganismos isolados de queijo de coalho em 86
teste de difusão em ágar Müller Hinton frente a diferentes antimicrobianos
Tabela 15 Contagem de Bactérias Ácido-Lácticas nas fezes de camundongos 88
monoassociados, durante 10 dias, após o inóculo inicial com 108 células.
Tabela 16 Sobrevivência, tempo médio de vida e peso médio dos camundongos CV 97
após o desafio com Salmonella Typhimurium
Tabela 17 Perfil de digestão dos fragmentos amplificados por PCR do espaçador 16S- 198
23S rRNA de diferentes espécies de BAL
Tabela 18 Perfil bioquímico de cepas de Staphylococcus spp. isolados de queijo de 199
coalho artesanal e industrial
RESUMO

O queijo de coalho apresenta grande importância histórica, social, econômica e cultural para pequenos produtores do
Nordeste do Brasil. Geralmente, produzido artesanalmente ou de forma industrializada por alguns laticínios, este
alimento é amplamente consumido. Este trabalho foi conduzido com os objetivos de conhecer os processos artesanais e
industriais em algumas unidades produtoras do estado de Pernambuco, isolar e identificar bactérias ácido-lácticas
(BAL) e Staphylococcus spp. a partir de quatro amostras artesanais e duas industriais, bem como avaliar as propriedades
antagonistas, a sensibilidade antimicrobiana destas BAL e as características físico-químicas das amostras analisadas.
Foram isolados e identificados dezenove microrganismos, sendo seis pertencentes ao gênero Lactobacillus, quatro de
Streptococcus, três de Enterococcus, dois de Lactococcus, um de Weissella, um de Escherichia e um de Erwinia. Um
total de 36 cepas de Staphylococcus spp. foram identificadas. Os níveis populacionais destas bactérias foram superiores
a 106 UFC/g tanto nas amostras de queijo artesanal, quanto nas amostras de queijo industrializado, incluindo cepas
coagulase positivo e negativo produtoras de enterotoxina estafilocócica B (SEB). As BAL isoladas apresentaram
atividade antagonista frente às mesmas, aos patógenos isolados dos mesmos queijos e também a cepas de referência,
havendo diferença estatística significativa (p<0,05), exceto quando as próprias BAL foram utilizadas como reveladoras.
Dentre as bactérias isoladas, Lactobacillus casei (AB2MRS) e Lactobacillus rhamnosus (AQ1MRS) apresentaram as
atividades antagonistas mais potentes frente aos patógenos utilizados como reveladores. Microrganismos presentes em
queijos de coalho artesanal e industrial demonstraram diferentes perfis de sensibilidade às drogas antimicrobianas,
incluindo a presença de Enterococcus faecalis multi-resistente e Lactobacillus acidophilus sensível a vancomicina.
Existem diferenças tecnológicas importantes entre as formas de produção de queijo de coalho artesanal e industrial, e
este alimento apresenta uma microbiota muito variada, apresentando, em sua constituição, BAL (principalmente
Lactobacillus spp. e Lactococcus spp.) com potencial probiótico para serem utilizadas visando a melhoria da qualidade
higiênico-sanitária-tecnológica deste queijo.

Palavras-chave: queijo de coalho, bactérias ácido-lácticas, Staphylococcus, atividade antagonista, sensibilidade aos
antimicrobianos, qualidade higiênico-sanitária-tecnológica; probióticos

ABSTRACT

“Queijo de coalho” is a typical cheese that shows historical, social, economical and cultural importance to the Brazilian
population. Usually, artisanaly produced in rural areas of the Northeastern region or by dairies, that food is widely
consumed throughout Brazil. The present study was carried out with the following aims: know the artisanal and
industrial processes in some production units of Pernambuco state, isolate and identify LAB and Staphylococcus spp.
from four samples of artisanal and two samples of industrial “queijo de coalho”, as well as evaluate the antagonistic
properties, the antimicrobial sensibility of those LAB and the physical-chemical characteristics of the analyzed samples.
There were isolated and identified nineteen microorganisms, as following: six Lactobacillus spp., four Streptococcus
spp., three Enterococcus spp., two Lactococcus spp., one Weissella sp. one Erwinia sp. and one Escherichia sp. A total
of 36 strains of Staphylococcus were also identified. Counts of that microorganism higher of 106 CFU/g were verified
either in artisanal or industrial cheeses, including coagulase positive and negative SEB producer’s strains. The isolated
LAB showed antagonistic activity against themselves, pathogens isolated from the same cheeses and reference strains,
presenting statistical significant difference (p<0.05), except for the first antagonism. Among the isolated LAB,
Lactobacillus casei (AB2MRS) and Lactobacillus rhamnosus (AQ1MRS) demonstrated the most potent antagonistic
activities against the pathogens. Microorganisms present in artisanal and industrial “queijo de coalho” show distinct
sensibility profile to the antimicrobials, including the presence of multi-resistant Enterococcus faecalis and vancomycin
susceptible Lactobacillus acidophilus. It is concluded that there are important technological differences among the
production of artisanal and industrial “queijo de coalho”. Furthermore, that food has a varied microbiota, including
LAB which show probiotic potential to be used in order to improve its technological, hygienic and sanitary quality.

Key-words: “queijo de coalho”, lactic acid bacteria, Staphylococcus, antagonistic activity, antimicrobials susceptibility,
technological, hygienic and sanitary quality, probiotics
1. INTRODUÇÃO & JUSTIVICATIVA podem ser ainda mais sérios. Desta forma, queijos
produzidos sob estas circunstâncias podem ser um
A preservação de alimentos e de bebidas por processos veículo de toxinfecções alimentares, representando
de fermentação tem sido utilizada pelo homem ao longo riscos à saúde pública. Nesta situação, microrganismos
da história. Assim, há vários séculos, os microrganismos patogênicos como Listeria monocytogenes, Escherichia
têm representado um papel importante na produção de coli:H7, Salmonellaspp. (Donnelly, 2001) podem
queijos, iogurte, manteiga, vinho, cerveja, pães, etc. contaminar os queijos, incluindo Staphylococcusspp. e
Inicialmente, os alimentos eram preservados por suas enterotoxinas, que são termoestáveis (Carmo et al,
fermentações que ocorriam naturalmente. Atualmente, 2002).
na produção moderna de alimentos e bebidas
fermentadas utilizam-se processos controlados de Alguns tipos de queijos são elaborados artesanalmente e
fermentação, sendo utilizados microrganismos caracterizam culturalmente a região geográfica e o
iniciadores selecionados, garantindo uniformidade e grupo étnico que os produz. Em muitas circunstâncias,
qualidade ao produto final. apesar da significativa produção e consumo destes
produtos, os mesmos apresentam deficiências em sua
Os queijos são alimentos fermentados, elaborados a fabricação. Estes problemas podem levar à perda do
partir do leite, possuindo grande importância nutricional produto ou até mesmo ameaçar a saúde dos
para os homens, destacando-se por sua rica composição consumidores. Este fato assume mais importância
em proteínas de alto valor biológico e cálcio. Além quando associado ao grande crescimento da população
disto, os queijos também possuem outros nutrientes humana observada nos últimos anos, sem um
como lipídeos, lactose e vitaminas lipossolúveis. Devido planejamento adequado da produção de alimentos. Com
ao seu processo de fermentação, estes produtos lácteos isto, algumas populações convivem com o problema da
apresentam uma microbiota bastante diversificada, falta de alimentos e com a fome.
podendo ser constituída de microrganismos desejáveis e
indesejáveis. As bactérias ácido-lácticas (BAL) Especialmente na região nordeste do Brasil tal situação
constituem importante exemplo de microrganismos assume proporções ainda mais significativas. Muitas
desejáveis presentes nos diferentes tipos de queijo. Elas pessoas desta região dependem economicamente da
desempenham importantes funções neste alimento como produção artesanal de alimentos, como é o caso do
a produção de ácidos orgânicos e de outros compostos queijo de coalho. Desta forma, a produção artesanal de
químicos responsáveis pelo "flavour" além da alimentos precisa ser mais bem estudada, caracterizada
elaboração de substâncias antagonistas aos e aprimorada a fim de que os mesmos possam ser
microrganismos indesejáveis, dentre outras. Desta preservados, mantendo seu importante papel social e
forma, a presença da microbiota desejável colabora para econômico em relação às populações envolvidas em sua
as características organolépticas e para a conservação e produção.
segurança higiênico-sanitária dos queijos.
O queijo de coalho vem sendo produzido há muitos
As BAL são capazes de produzir substâncias de anos no Nordeste do Brasil. Segundo a cultura local,
natureza protéica, conhecidas por bacteriocinas. Estes este alimento surgiu quando as pessoas utilizavam
compostos possuem diferentes atividades bactericidas e recipientes feitos com estômago de animais para
bacteriostáticas contra vários microrganismos (Ross et transportar leite. Depois de certo tempo em contato com
al. 2002; Riley e Wertz, 2003). Estas ações também o interior do utensílio, o leite transformava-se em uma
podem ocorrer no tratos gastrointestinal, respiratório massa coagulada, tendo sido submetido a ação das
superior e genito-urinário inferior humano e de outros enzimas digestivas, como a renina ou a quimosina.
animais. Desta forma, algumas BAL originárias de Assim, quando as pessoas abriam o recipiente não
queijos, principalmente Lactococcus e encontravam o leite fluído, mas um coágulo. Com o
Lactobacillus .podem, por diferentes mecanismos, decorrer do tempo, os homens passaram a apreciar o
contribuir para o equilíbrio da microbiota destes sítios, produto coagulado e a produção do queijo de coalho
exercendo efeito probiótico (Fuller, 1993, Sabikhi et al., começou a ser disseminada. Inicialmente, pedaços de
2001). estômago de pequenos animais, como mocó, preá,
cabritos, cordeiros e bezerros eram colocados dentro de
Os microrganismos indesejáveis podem ser um utensílio contendo leite cru (Aquino, 1983). Depois
deteriorantes e/ou patógenos, estando presentes nos de certo tempo, o leite coagulava-se, então era feito o
queijos em função de contaminações, resultantes de corte do coágulo, a mexedura da massa, a dessoragem e
higiene deficitária, relacionada a todo o processo de a enformagem, seguida de salga. Este costume sempre
produção, desde a obtenção da matéria-prima até o foi passado de geração para geração tornado-se, então,
consumo. Estes problemas incluem manipulação uma das principais características da cultura nordestina.
inadequada, utilização de ingredientes não selecionados
e de utensílios não higienizados e outros, Atualmente, a produção de queijo de coalho é feita por
comprometendo a qualidade dos produtos, tanto pequenos produtores, cuja quantidade média é de
artesanais quanto industrializados. No caso dos queijos aproximadamente 5 Kg por dia (Escobar et al., 2001).
artesanais, elaborados a partir de leite cru, estes riscos Em certas regiões, ainda se mantém a forma ancestral de
colocar pedaços de estômago de mamíferos no leite para desses produtos, especialmente em queijos.
a sua coagulação. Entretanto, hoje em dia, a maioria dos
produtores artesanais deste tipo de queijo e a totalidade Os probióticos podem suprimir a presença de
dos industriais utilizam coalho industrializado (líquido microrganismos indesejáveis nos queijos e alimentos
ou em pó) para a elaboração deste alimento. fermentados atuando pela exclusão competitiva
Infelizmente, há escassez com relação à disponibilidade (Alexandre et al, 2002; Caridi, 2003), pela produção de
de dados estatísticos sobre a produção de queijo de bacteriocinas (Riley e Wertz, 2002), por inibirem a ação
coalho nos estados e no país, como um todo. Porém, de toxinas e pela produção de metabólitos bactericidas,
certamente a produção artesanal de queijo de coalho é como ácido lático (Fuller, 1989).
bastante expressiva para o contexto da economia
regional de vários estados nordestinos. Cerca de 30% do As BAL podem apresentar importantes efeitos benéficos
leite produzido em Pernambuco é destinado para esta à saúde humana. Isto pode ser comprovado por um
finalidade, atingindo 40 a 50% em algumas número crescente de evidências que demostram estes
microregiões (Escobar et al., 2001). fatos positivos. Dentre eles, podem ser citados:
imunomodulação, proteção contra infecções causadas
As bactérias probióticas são encontradas, por bactérias e vírus patogênicos, redução de níveis
principalmente, em alimentos fermentados, tendo os plasmáticos de colesterol e de incidência de câncer,
produtos lácteos um importante papel na veiculação além de serem utilizadas no tratamento de úlceras
desses microrganismos. Esses alimentos estão bem pépticas e de vaginites (Naidu et al, 1999).
relacionados aos benefícios à saúde proporcionados
pelos microrganismos probióticos por diversas razões: Apesar da importância das BAL na microbiota dos
Geralmente os produtos lácteos têm uma imagem alimentos fermentados, não existem pesquisas
positiva relacionada à saúde; Os consumidores estão relacionadas à caracterização dos microrganismos
acostumados à idéia de produtos lácteos fermentados desejáveis em queijo de coalho, bem como seu potencial
conterem microrganismos vivos e esses microrganismos efeito probiótico. Neste sentido, o isolamento, a
podem ser usados como culturas iniciadoras no processo identificação e a seleção de BAL presentes em queijo de
de fermentação, combinando o papel de culturas coalho podem ser uma alternativa viável para a
iniciadoras e probióticas. elaboração de produtos com efeitos benéficos à saúde
dos consumidores, facilitando a sua conservação e
Os queijos são alimentos fermentados, elaborados a mantendo suas características sensoriais peculiares, sem
partir do leite, possuindo grande importância nutricional colocar em risco a saúde dos consumidores. A utilização
para os homens, destacando-se por sua rica composição destas culturas de BAL, associada à adoção das Boas
em proteínas de alto valor biológico e cálcio. Além Práticas de Fabricação (BPF) nas indústrias são
disto, os queijos também possuem outros nutrientes, fundamentais para que a produção deste queijo esteja
como: lipídeos, lactose e vitaminas lipossolúveis. adequada às modernas normas de inspeção.
Devido ao seu processo de fermentação, estes produtos
lácteos apresentam uma microbiota bastante diversa, Desta forma, ressalta-se a relevância de buscar soluções
podendo ser constituída de microrganismos desejáveis e para a melhoria da qualidade higiênico-sanitária-
indesejáveis. As bactérias ácido-lácticas (BAL) tecnológica deste queijo, para que o mesmo não possa
constituem importante exemplo de microrganismos oferecer risco a saúde dos consumidores e ser
desejáveis presentes nos diferentes tipos de queijo. Elas considerado seguro.
desempenham importantes funções neste alimento,
como: produção de ácidos orgânicos e outros compostos 2. REVISÃO DE LITERATURA
químicos responsáveis pelo "flavour" e elaboração de
substâncias antagonistas aos microrganismos 2.1. Queijo de coalho
indesejáveis, dentre outras. Desta forma, a presença da
microbiota desejável colabora para a conservação e Com o desenvolvimento tecnológico da produção de
segurança higiênico-sanitária dos queijos. queijo surgiram muitas variedades, sendo algumas de
expressão regional, como os queijos artesanais queijo de
Lactobacillus estão entre as principais BAL utilizadas “coalho” e queijo de “manteiga” produzidos no
como probióticos em alimentos e são reconhecidos Nordeste (Nassu et al., 2001) “serro, canastra, Minas,
como geralmente seguro ( “Generally Recognized As Araxá e Salitre” produzidos em Minas Gerais, no
Safe” - GRAS). Eles podem ser encontrados devido a Sudeste (Pinto, 2004; Araújo et al., 2004) e “colonial”
sua presença natural, como por exemplo, no leite cru e produzido, principalmente, em Santa Catarina e Rio
em seus derivados ou devido à sua adição intencional, Grande do Sul, no Sul (Ide e Benedet, 2001).
por razões tecnológicas ou para gerar um efeito benéfico
à saúde dos consumidores. Na maioria dos casos as O queijo de coalho vem sendo produzido há muitos
espécies de Lactobacillus adicionadas aos produtos anos no Nordeste do Brasil. Segundo a cultura local,
fermentados industriais são exógenas e têm seus efeitos este alimento surgiu quando as pessoas utilizavam
probióticos demosntrados. Contudo a falta de relação recipientes feitos com estômago de animais para
entre essas espécies e a microbiota normal transportar leite. Depois de certo tempo em contato com
originalmente encontrada nesses produtos não garante a o interior do utensílio, o leite transformava-se em uma
preservação dos aspectos organolépticos característicos
massa coagulada, tendo sido submetido a ação das temperatura ambiente em mercados, mercearias,
enzimas digestivas, como a renina ou a quimosina. padarias, feiras livres e outros estabelecimentos de
Assim, quando as pessoas abriam o recipiente não vendas de alimentos.
encontravam o leite fluído, mas um coágulo. Com o
decorrer do tempo, os homens passaram a apreciar o De acordo com o Regulamento Técnico de identidade e
produto coagulado e a produção do queijo de coalho Qualidade de Queijo de Coalho (Secretaria de Defesa
começou a ser disseminada. Inicialmente, pedaços de Agropecuária, 2001) o queijo de coalho industrializado
estômago de pequenos animais, como mocó, preá, deve ser fabricado a partir de leite pasteurizado, com ou
cabritos, cordeiros e bezerros eram colocados dentro de sem adição de culturas lácticas, e pode ser maturado ou
um utensílio contendo leite cru (Aquino, 1983). Depois não. Por produzido a partir de leite pasteurizado
de certo tempo, o leite coagulava-se, então era feito o apresenta maior segurança microbiológica e
corte do coágulo, a mexedura da massa, a dessoragem e padronização da qualidade. Geralmente, são
a enformagem, seguida de salga. Este costume sempre armazenados e comercializados sob temperatura de
foi passado de geração para geração tornado-se, então, refrigeração em supermercados, padarias e outros
uma das principais características da cultura nordestina. estabelecimentos especializados em venda de alimentos.
Além disso, sua fabricação não é realizada de forma
A produção de queijo de coalho é feita por pequenos exclusiva nas indústrias regulamentadas e fiscalizadas
produtores, cuja quantidade média é de por órgãos oficiais, nas quais também são
aproximadamente 5 Kg por dia (Escobar et al., 2001). manufaturados queijos padronizados como Minas
Em certas regiões, ainda se mantém a forma ancestral de frescal, prato e mussarela, cujo volume de produção
colocar pedaços de estômago de mamíferos no leite para supera a do queijo de coalho (Nassu et al., 2001).
a sua coagulação. Entretanto, hoje em dia, a maioria dos
produtores artesanais deste tipo de queijo e a totalidade Em relação à produção de queijo de coalho no Nordeste,
dos industriais utilizam coalho industrializado (líquido constata-se escassez de dados estatísticos confiáveis,
ou em pó) para a elaboração deste alimento. pelo fato da maior parte da sua produção ser artesanal e
a comercialização ocorrer na informalidade, não sendo,
Infelizmente, há escassez com relação à disponibilidade portanto, incluída em estatísticas oficiais. Em
de dados estatísticos sobre a produção de queijo de levantamento realizado no Estado do Ceará, sobre o
coalho nos estados e no país, como um todo. Porém, processamento do queijo de coalho em 57 unidades
certamente a produção artesanal de queijo de coalho é produtoras, constatou-se que 85% das unidades
bastante expressiva para o contexto da economia utilizavam leite cru e que apenas as quatro indústrias,
regional de vários estados nordestinos. Cerca de 30% do submetidas à inspeção (Federal -SIF, Estadual - SIE e
leite produzido em Pernambuco é destinado para esta Municipal), pasteurizavam o leite utilizado na
finalidade, atingindo 40 a 50% em algumas fabricação dos queijos (Nassu et al., 2001).
microregiões (Escobar et al., 2001).
O queijo de coalho é consumido diretamente, grelhado
A produção de produtos lácteos como queijo de em frigideira, chapa ou grelhado na brasa na forma de
manteiga, manteiga da terra e, em especial, o queijo de espetinho, principalmente nas praias, além de ser
coalho, na região Nordeste, representa uma atividade ingrediente em vários pratos típicos da Região, como
relevante para a economia regional, por ser considerada baião-de-dois, feijão de corda, tapioca, entre outros.
fonte de renda e de trabalho para parcela considerável
de pequenos e médios produtores rurais (Escobar et al., O queijo de coalho, devido a suas características de
2001; Cavalcante, Andrade e Silva, 2004). Além disso, consumo e sabor peculiar, vem a cada dia ganhando
desempenha importante papel no desenvolvimento da novos consumidores em outras regiões do país,
agricultura familiar, em pequenos municípios principalmente a Sudeste. Hoje, o queijo de coalho
localizados nas bacias leiteiras. Esses produtos são industrializado representa parte do mercado de queijos
fabricados em todos estados do Nordeste, mas a maior no Rio de Janeiro, São Paulo, Goiânia e Brasília
produção concentra-se nos estados do Pernambuco, (Cavalcante, 2005). No período de entressafra na
Ceará, Rio Grande do Norte e Paraíba. produção de leite no Nordeste, queijo de coalho
industrializado produzido em Minas Gerais tem sido
A indústria queijeira na região Nordeste divide-se, comercializado nos estados da Bahia e Pernambuco. Em
basicamente, em pequenas unidades artesanais, sem Campinas (SP) foi identificada à comercialização de
qualquer fiscalização, e em médias empresas, indústrias sete marcas de queijo de coalho industrializado
regulamentadas e inspecionadas pelo Ministério da produzidas em vários estados, sendo duas em Minas
Agricultura ou órgãos oficiais estaduais e municipais. Gerais, duas no Paraná, uma no Mato Grosso, uma em
Goiás e uma em Mato Grasso do Sul (Perez, 2005).
Tradicionalmente, a origem do queijo de coalho está
ligada à fabricação artesanal, fato que ainda persiste em A Secretaria de Defesa Agropecuária (SDA) do
numerosas unidades de produção caseira e de fazendas Ministério da Agricultura, com base no Regulamento
produtoras, as quais não contam com tecnologia Técnico de Identidade e Qualidade de Queijo de Coalho
apropriada de manufatura e elaboram o queijo a partir (Secretaria de Defesa Agropecuária, 2001), define
de leite cru (Nassu et al., 2001). Os queijos, em sua queijo de coalho como o produto obtido da coagulação
maioria, são armazenados e comercializados à do leite pasteurizado através do coalho ou outras
enzimas coagulantes apropriadas, complementada ou Abastecimento (MAPA) não reconhece a variedade de
não pela ação de bactérias lácteas selecionadas e queijo de coalho produzido a partir de leite cru. O
comercializado normalmente com até 10 dias de Regulamento Técnico de Identidade e Qualidade de
fabricação. É classificado como queijo de médio a alto Queijo de Coalho (Brasil, 2001) define este produto
teor de umidade, de massa cozida ou semicozida, como o queijo que se obtém por coagulação do leite por
apresentando um teor de gordura nos sólidos totais entre meio do coalho ou outras enzimas coagulantes
35 e 60%. Quanto aos aspectos sensoriais, apresenta apropriadas, complementada ou não pela ação de
consistência semidura e elástica com textura compacta e bactérias lácteas selecionadas e comercializado
macia. As principais características distintivas do normalmente com até 10 (dez) dias de fabricação.
processo de elaboração são: coagulação em torno de 40
minutos, corte e mexedura da massa, remoção parcial do O queijo de coalho industrializado é um queijo de média
soro, aquecimento da massa com água quente ou vapor a alta umidade, de massa semi-cozida ou cozida e
indireto até obtenção de massa semicozida (até 45ºC) ou apresentando um teor de gordura nos sólidos totais
cozida (entre 45 e 55ºC), adição de sal (cloreto de sódio) variável entre 35,0% e 60,0%. Os ingredientes
a massa, prensagem, secagem, embalagem e estocagem obrigatórios são leite integral ou padronizado a 3%
a 10-12ºC, normalmente até 10 dias. Este queijo, (m/m) em seu conteúdo de matéria gorda; coalho ou
também poderá ser elaborado a partir de massa crua, ou outras enzimas coagulantes apropriadas. Os ingredientes
seja, sem aquecimento. opcionais seriam: cloreto de cálcio, cultivo de bactérias
lácteas selecionadas, sólidos de origem láctea,
2.1.1. Critérios oficias de identidade e qualidade condimentos e especiarias e cloreto de sódio (Brasil,
de queijo de coalho 2001).

Tecnicamente, o queijo de coalho pode ser definido 2.1.1.1. Critérios físico-químicos


como o produto obtido por coagulação enzimática, cuja
coalhada pode ou não sofrer aquecimento, sendo Os requisitos físico-químicos do queijo de coalho
prensado manualmente ou em pequenas prensas e correspondem às características de composição e
salgado a seco, diretamente na massa ou na superfície qualidade dos queijos de média a alta umidade,
(Mangueira et al., 2001). conforme estabelecido pelo MAPA, no Regulamento
Técnico de Identidade e Qualidade de Queijos (Brasil,
O queijo de coalho produzido em estabelecimentos 1996) e com teor de gordura nos sólidos totais (GST)
artesanais em Pernambuco pode ser definido pela entre 35% e 60%.
legislação sobre Inspeção e Fiscalização Agropecuária
deste estado em dois tipos: 2.1.1..2. Critérios microbiológicos

Tipo A: queijo elaborado com leite integral ou O queijo de coalho deverá obedecer os critérios
desnatado pasteurizado, massa crua prensada, estabelecidos para queijo de médio a alto teor de
suficientemente dessorada, salgada e maturada; umidade no Regulamento Técnico Geral para Fixação
dos Requisitos Microbiológicos de Queijos – Portaria nº
Tipo B: queijo elaborado com leite cru integral ou 146/96 – MAPA (Brasil, 1996). Neste caso, recomenda-
desnatado, não pasteurizado, massa crua, prensada ou se a pesquisa de Staphylococcus coagulase positivo,
não, suficientemente dessorada, salgada e maturada. Salmonella spp., Listeria monocytogenes, coliformes a
30ºC e a 45ºC (de acordo com o quadro a seguir).
Entretanto, o Ministério da Agricultura Pecuária e

Quadro 1: Requisitos microbiológicos para inspeção de queijos de alta umidade.

Microrganismo Critério de aceitação Categoria (ICMSF) Método de ensaio


Coliformes/g (30ºC) n=5, c=2, m=5.000, M=10.000 5 FIL 73 A:1985
Coliformes/g (45ºC) n=5, c=2, m=1.000, M=5.000 5 APHA 1922 c. 24 (1)
Staphylococcus coagulase positivo n=5, c=2, m=100, M=1.000 5 FIL 145:1990
Salmonella spp./25g n=5, c=0, m=0 10 FIL 93 A:1985
Listeria monocytogenes/25g n=5, c=0, m=0 10 FIL 143:1990
Fonte: Brasil (1996)

As práticas de higiene para elaboração do produto alcalina residual negativa, nos termos da Portaria no
devem estar de acordo com o Regulamento Técnico 146/96 – MAPA, de acordo com metodologia analítica
sobre as Condições Higiênico-Sanitárias e de Boas oficial do MAPA, combinado ou não com outros
Práticas de Fabricação para Estabelecimentos processos físicos ou biológicos que garantam a
Elaboradores/Industrializadores de Alimentos (Brasil, inocuidade do produto (Brasil, 1996).
1997).
2.1.2. Qualidade de queijo de coalho
O leite a ser utilizado deverá ser higienizado por meios
mecânicos adequados e submetido à pasteurização ou Trabalhos científicos avaliando queijo de coalho têm
tratamento térmico equivalente, para assegurar fosfatase demostrado diversos problemas relacionados à sua
qualidade microbiológica. Poucas pesquisas também formato e do sabor. Além disto, existem cepas
relatam alterações microscópicas e físico-químicas deste patogênicas de Escherichia coli e a presença deste
produto lácteo. Vários destes fatores são causados pela microrganismo indica a probabilidade da existência de
produção inadequada, sem condições higiênico- outros patógenos Gram negativo, como Salmonella spp.
sanitárias apropriadas. e Shigella spp..

Com relação aos aspectos microscópicos, Lima et al. Sena et al. (1998) isolaram Staphylococcus aureus de
(2002) avaliaram 51 amostras de queijo de coalho e amostras de queijo de coalho e verificaram que 35% das
verificaram que todas elas continham materiais mesmas eram produtoras da toxina da Síndrome do
estranhos (fibras, insetos e partículas de vidro e de Choque Tóxico (TSST-1). Esta doença caracteriza-se
metal), portanto, não sendo consideradas adequadas ao por febre, hipotensão, congestão de vasos e choque
consumo humano. letal. A associação de TSST-1 com a produção de uma
ou mais enterotoxinas estafilocócicas, detectadas a
Os constituintes físico-químicos (teores de umidade, partir de cepas envolvidas em casos de mastite foi
gordura e gordura no estrato seco total) e pH de 70 relatada por Cardoso (1999).
amostras de queijo de coalho, comercializado em Recife
(Pernambuco), foram analisados por Sena et al. (2000). Sena (2000), ao analisar 107 amostras de queijo coalho,
Os resultados demostraram leves oscilações nos provenientes de Recife (Pernambuco), constatou que
resultados dos parâmetros pesquisados, as quais foram 105 (98,1%) apresentavam-se contaminadas com
atribuídas às diferentes formas de processamento deste Staphylococcus. As contagens variaram de 103 a 107
queijo. UFC/g, sendo a média igual a 106 UFC/g. Neste
trabalho, 637 cepas de Staphylococcus spp. foram
Os conteúdos de umidade, gordura, sal, amido e isoladas e submetidas a testes bioquímicos para
proteína e acidez de queijo de coalho apresentaram identificação das espécies, sendo que 218 (58%) foram
ampla variação de resultados, demonstrando falta de de Staphylococcus aureus; 96 (25%) foram de
padronização do produto, de acordo com pesquisa Staphylococcus coagulase-negativo; 41 (11%) foram de
realizada por Araújo et al. (2002), analisando amostras Staphylococcus hyicus e 22 (6%) de Staphylococcus
deste queijo nos estados do Rio Grande do Norte e do intermedius. A produção de enterotoxinas deste
Ceará. microrganismo também foi investigada. Neste caso,
tanto cepas coagulase positivo quanto negativo
A qualidade microbiológica dos queijo de coalho apresentaram este fenótipo. Ressalta-se que, a legislação
também pode ser considerada deficiente, de acordo com oficial para a inspeção de queijos no Brasil ainda não
relatos descritos na literatura científica. Florentino e leva este importante fato em consideração (Brasil,
Martins (1999) estudaram aspectos microbiológicos de 1996). Os autores citaram este fato como o principal
40 amostras de queijo de coalho, coletadas em vários problema microbiológico deste queijo, principalmente
municípios do sertão da Paraíba. Foram detectadas porque as enterotoxinas estafilocócicas são
elevadas contagens de bolores e leveduras, termoestáveis e potenciais causadoras de surtos de
Staphylococcus aureus, coliformes totais e fecais, assim intoxicação alimentar.
como a presença de Salmonella spp. em 30% das
amostras. Estes resultados demostraram as inadequadas Rapini et al. (2002) avaliaram a presença de patógenos
condições higiênicas de produção artesanal deste queijo. em dez amostras de queijo de coalho comercializado em
praias de Salvador (Bahia) e Maceió (Alagoas).
Mendes et al. (1999) avaliaram a qualidade Staphylococcus aureus foi detectado em todas as
bacteriológica de 105 amostras de queijo de coalho, amostras, em contagens variando de 104 a 107UFC/g,
comercializado em Recife, Pernambuco, oriundas de 15 sendo detectada a presença de suas enterotoxinas (SEB
municípios deste estado. Os resultados demostraram que e SEC). Os autores concluíram que este queijo
a maioria das amostras analisadas foram consideradas apresentava-se impróprio para o consumo humano, com
impróprias para o consumo humano, devido à presença grande potencial de causar intoxicação alimentar.
de Staphylococcus aureus, Salmonella spp. e coliformes
fecais em valores superiores àqueles estabelecidos pela Salmonella sp. foi detectada em 8,7 % de 23 amostras
legislação. de queijo de coalho pesquisadas por Escobar et al.
(2001). Leite-Júnior et al. (2000) detectaram que 50%
Altos índices de contaminação com coliformes totais e das amostras (9/18) de queijo de coalho comercializadas
fecais foram verificados em amostras de queijo de em Campina Grande (Paraíba), apresentavam-se
coalho, produzido e comercializado no Nordeste (Leite- contaminadas com Salmonella e coliformes fecais.
Júnior et al., 2000; Bastos et al., 2001; Escobar et al.,
2001; Nascimento et al., 2001). Estes resultados No Ceará, Borges et al (2003) avaliaram 43 amostras de
demonstram problemas higiênico-sanitários ocorridos queijo de coalho, produzidos em 11 municípios
durante a produção deste queijo, bem como a utilização pertencentes a cinco microrregiões produtoras de leite e
de leite cru e a falta de tratamento de água nas unidades verificaram que 74% das amostras estavam
produtoras. Adicionalmente, os coliformes podem contaminadas por coliformes fecais e &. coli em níveis
causar defeitos nos produtos levando à deterioração do superiores ao estabelecido na legislação.
alimento, como o estufamento precoce, alteração do
Bruno et al (2005) verificaram que 100% (8) das
amostras de queijo de coalho analisadas apresentavam Borges et al (2003) avaliaram 43 amostras de queijo de
níveis de coliformes fecais e &. coli em desacordo com coalho, produzido em 11 municípios, pertencentes a
os padrões microbiológicos vigentes. cinco microrregiões produtoras de leite, e verificaram
que 91% (39) das amostras estavam contaminadas por
No Rio Grande do Norte, Feitosa et al (2003) Staphylococcus coagulase positiva em níveis superiores
detectaram coliformes fecais acima dos limites legais ao estabelecido pela legislação (103UFC/g).
em 36% (4/11) das amostras de queijo de coalho,
produzido em diferentes microrregiões do Estado. Os dados acima demonstram a baixa qualidade
microbiológica do produto, sendo causada não somente
Paiva e Cardonha (1999) constataram que 60% (18/30) pela utilização de leite cru em sua produção, mas
das amostras de queijo coalho artesanal, também pela deficiência de boas práticas de fabricação,
comercializadas no Estado também apresentavam níveis tanto artesanais quanto industrializados.
de coliformes fecais em desacordo com a legislação.
2.2. Doenças transmitidas por alimentos e
A ocorrência de L. monocytogenes foi detectada, tanto microrganiasmos patogênicos de importância
para queijos artesanais como para industrializados, A em queijos
maior taxa (50%) de ocorrência do patógeno foi
observada em queijo artesanal comercializado em João As doenças transmitidas por alimentos (DTA) são
Pessoa (Sousa, 1999). Catão e Ceballos (2001) responsáveis, atualmente, pela maior parte dos surtos de
constataram alta incidência (51,5%) de L. diarréia em quase todos países do mundo. O
monocytogenes em leite cru procedente de três desenvolvimento econômico e a globalização da
municípios do estado da Paraíba. comercialização de alimentos e as mudanças nos hábitos
alimentares, aliados ao crescente consumo de alimentos
No Ceará, a ocorrência de L. monocytogenes (19%) foi industrializados preparados fora de casa, alteram o perfil
constatada em queijo de coalho industrializado, epidemiológico dessas doenças.
armazenado sob refrigeração (Branco et al., 2003). Já,
em queijo artesanal elaborado a partir de leite cru a As DTA são associadas, principalmente, ao consumo de
prevalência desta bactéria foi baixa (zero a 2,3%) produtos de origem animal, em especial os produtos
(Borges et al., 2003; Branco et al., 2003; Bruno et al., lácteos. Em surtos e casos esporádicos de DTA, as
2005). bactérias patogênicas têm sido identificadas apenas em
Cunha Neto et al (2002) isolaram Staphylococcus 30%, mas respondem por 60% dos casos de
enterotoxigênicos em vários alimentos, incluindo queijo hospitalização e 70% dos casos fatais (Mead et al.,
de coalho e leite em pó integral, comercializados em 1999). A incidência global de DTA é reconhecidamente
Recife – PE. As contagens de Staphylococcus coagulase subnotificada, tornando-se impossível avaliar seu real
positiva variaram de 102 a 1,5 x 104UFC/g para estes impacto na saúde das populações e na economia dos
dois produtos e 100% das cepas isoladas de queijo de países, mesmo os desenvolvidos (Flint et al., 2005). O
coalho foram positivas para enterotoxinas impacto das DTA nos países em desenvolvimento é
estafilocócicas clássicas. difícil de calcular, mas estima-se que nestes países
ocorrem anualmente 2,1 milhões de mortes,
Lima (2005) avaliou a incidência de Staphylococcus principalmente crianças com até cinco anos de idade,
coagulase positiva em 80 amostras de queijo de coalho devido à diarréia, veiculada, na maioria das vezes, pela
industrial e artesanal comercializado em Fortaleza – CE água e pelos alimentos. Nos países industrializados, a
e constatou que 54% (43) dos queijos estavam mortalidade é limitada, mas a incidência de surtos
contaminados com esta bactéria, cujas contagens (30%) permanece alta (World Health Organization,
oscilaram entre 4,4 x 104 a 1,7 x 107 UFC/g. A presença 2002).
de enterotoxinas estafilocócicas não foi observada nas
amostras analisadas. Apenas 8,3% (1/12) dos pools de Nos países da União Européia, estima-se que ocorram,
cepas de Staphylococcus produtores de coagulase foram anualmente, 45,4 milhões de casos esporádicos e surtos
positivos para enterotoxinas estafilocócicas clássicas. de DTA (Cashell, 2004). A salmonelose tem sido a
doença relatada com maior freqüência, seguida da
A ocorrência de altos níveis de Staphylococcus campilobacteriose (Food Administration Organization/
coagulase positiva e S. aureus, em queijo de coalho World Health Organization, 2002). Casos de listeriose
produzido em vários estados do Nordeste (Algoas, são relatados por poucos países, mas a incidência é alta
Bahia, Ceará, Paraíba, Pernambuco e Rio Grande do em países em que a notificação é obrigatória (Food
Norte) tem sido relatada em muitos estudos (Florentino Administration Organization/ World Health
e Martins, 1999; Mendes et al., 1999; Paiva e Cardonha, Organization, 2002; Haeghebaert et al., 2003). No
1999; Rapini et al., 2002; Feitosa et al., 2003; Borges et período de 1993 a 1998, foram investigados mais de
al., 2003). Na maioria destes estudos, os queijos foram 30.000 surtos, com acometimento de 391.383 pessoas,
classificados como impróprios para o consumo humano, em 42 países participantes do Programa de Vigilância da
dada a constatação de níveis de contaminação World Health Organization (WHO) para Controle de
superiores aos permitidos pela legislação de 103UFC/g DTA na Europa. Salmonella spp. foi identificada em
(Agência Nacional de Vigilância Sanitária, 2001).
77,1% dos casos, com predominância de S. Enteritidis incluindo fatores invasivos e de colonização que causam
(35%), Staphylococcus aureus em 4%, entre outros doenças diarreicas.
patógenos. Leite e produtos lácteos representaram 8%
dos alimentos envolvidos (Food Administration O grupo dos coliformes termotolerantes é encontrado na
Organization/ World Health Organization, 2002). água, no solo, nas plantas e nos alimentos,
principalmente nos produtos de origem animal e nos
Nos Estados Unidos, a incidência de DTA permanece manipulados por pessoas. Uma vez que suas células são
alta, apesar do substancial declínio observado na sensíveis a altas temperaturas, sua presença em produtos
incidência de alguns patógenos específicos (Escherichia pasteurizados, como o leite, ou cozidos representa
coli O157:H7, Listeria monocytogenes) no período contaminação após o tratamento térmico. A
entre 1996 a 2004 (Centers for Disease Control and sobrevivência destes microrganismos em baixas
Prevention, 2003a; Centers for Disease Control and temperaturas depende da espécie e do substrato
Prevention, 2004). A rede de vigilância de alimentos (International Commission on Microbiological
(FoodNet) diagnosticou, em 2004, 15.806 casos de Specifications for Foods, 1998).
doenças atribuídas ao consumo de alimentos. Entre os
10 patógenos rastreados, constatou-se a prevalência de Os coliformes são responsáveis pelo desenvolvimento
Salmonella em 41% dos casos, Campylobacter em 36%, de estufamento precoce em queijos, caracterizado pela
Shigella em 14%, &. coli STEC O157 em 2,5% e produção de gás H2 em 1 a 2 dias após a sua fabricação.
Listeria em 0,8% (Centers for Disease Control and Estes microrganismos podem ser inibidos pelo aumento
Prevention, 2004). Embora, L. monocytogenes e &. coli na concentração de sal, dentre outros fatores (Fox et al.,
O157:H7 tenham apresentado redução em sua 2000). De acordo com os resultados de Gabutti et al.
incidência, a porcentagem de pessoas hospitalizadas foi (2000), os coliformes fecais são os microrganismos
muito alta, 91% para Listeria e 39% para &. coli O157 mais sensíveis ao sal.
(Centers for Disease Control and Prevention, 2003a).
O grupo coliforme fecal consiste principalmente de
No Brasil, no período de 1999 a 2004, foram notificados espécies de &. coli pertencente ao gênero Escherichia,
3.064 surtos, com o acometimento de 57.353 pessoas e membro da família Enterobacteriaceae (Garrity, Bell e
registro de 37 mortes. As Secretarias Estaduais de Saúde Lilburn, 2004). &.coli é a espécie predominante entre as
dos estados das regiões Sudeste e Sul foram as que mais diversas bactérias Gram-negativo, anaeróbias
contribuíram com notificação de surtos, em função do facultativas, que fazem parte da microbiota do trato
nível mais avançado de implantação do sistema de intestinal do homem e dos animais de sangue quente.
Vigilância Epidemiológica das DTA nas Secretarias de Esta bactéria ainda é encontrada na água, no solo, nos
Vigilância em Saúde nestas regiões. Alimentos vegetais e alimentos, principalmente nos de origem
preparados com ovos e maionese predominaram, com animal como o leite e produtos lácteos. Com base nos
22,2% dos casos, seguidos por alimentos com fatores de virulência, distintos sorotipos O:H,
preparações mistas (21,5%); carnes vermelhas (13,8%); mecanismos de patogenicidade (interação com a mucosa
sobremesas (12,1%) e água (7,2%). Houve identificação intestinal), manifestações clínicas e epidemiologia as
etiológica em 1.882 surtos e a Salmonella foi cepas patogênicas de &. coli são divididas em seis
identificada em 41% (772/1882) dos surtos, seguida grupos: &. coli enteropatogênica (EPEC), &. coli
pelo Staphylococcus aureus (18,1%) e outros agentes enteroinvasiva (EIEC), &. coli enterotoxigênica
(Carmo et al., 2005). (ETEC), &. coli enterohemorrágica (EHEC), &. coli
enteroagregativa (EAggEC) e &. coli difusamente
2.2.1. Coliformes termotolerantes e Escherichia adesiva (diffusely adherent &. coli) (Nataro e Kaper,
coli 1998; Meng et al., 2001; Bopp et al., 2003; Clarke et al.,
2003). Basicamente, apenas os quatros primeiros grupos
Os coliformes termotolerantes ou fecais são membros de &. coli têm sido relacionados com surtos de DTA,
da família Enterobacteriaceae e incluem os bastonetes sendo &. coli enteropatogênica (EPEC), o principal
curtos aeróbios e anaeróbios facultativos, Gram- agente etiológico nas diarréias infantis.
negativos, catalase positiva e oxidase negativa que
fermentam lactose a 45° C. O grupo dos coliformes A evolução da &. coli como um patógeno
termotolerantes é composto principalmente pela gastrointestinal é comparativamente recente (Pupo et al.,
Escherichia coli, mas algumas espécies de Enterobacter 1997). Embora a &. coli seja encontrada no ambiente e
e Klebsiella podem produzir ácido e gás a partir da como comensal no intestino de mamíferos, a
lactose e outros carboidratos sem produzir H2S transferência horizontal de genes permite a transição de
(International Commission on Microbiological algumas linhagens de &. coli da forma comensal para a
Specifications for Foods, 1998; Holt et al., 2000). forma patogênica (Baumler, 1997), normalmente pela
aquisição de ilhas de patogenicidade (Lee, 1996). O que
Estes microrganismos fazem parte da flora normal do diferencia as diversas linhagens de &. coli patogênicas é
intestino de animais de sangue quente e, portanto, a sua o mecanismo de virulência de cada uma.
presença nos alimentos constitui um indicador de
contaminação fecal (Peresi et al., 2001). A &. coli A EPEC é uma linhagem moderadamente invasiva, que
produz enterotoxinas e/ ou outros fatores de virulência, produz uma adesina não fimbrial (Nataro e Kaper,
1998). É a principal causa de diarréia infecciosa em
todo o mundo. Seu principal mecanismo de virulência é com freqüência em vários tipos de queijos. Carvalho
devido à adesão, seguida de lesões, destruição das (2003) também constatou contagens de coliformes
microvilosidades e aplainamento das membranas dos fecais acima do limite permitido pela legislação em
enterócitos resultantes das lesões A/& (attaching and 34,4% (93) das amostras de queijo Minas frescal
effacing) (Clarke, 2001). analisadas. Em outro estudo, Reibnitz e García (1998)
constataram a presença de coliformes fecais e &. coli
As EIEC são importantes causas de diarréias, sendo em 70% (20) das amostras de queijo colonial artesanal,
responsáveis por uma doença semelhante à disenteria comercializados em Blumenau – SC.
bacilar, o que torna a &. coli enteroinvasiva uma doença
com sintomas indistinguíveis daqueles da disenteria Em queijo de coalho, a ocorrência de coliformes fecais
causada pela Shigella spp., embora nenhum caso de em níveis superiores aos permitidos pela legislação
síndrome urêmica hemolítica tenha sido observada em também tem sido relatada em vários estudos. No Ceará,
pacientes com disenteria causada por EIEC (Hart et al., Borges et al (2003) avaliaram 43 amostras de queijo de
1993). As linhagens de EIEC invadem as células do coalho, produzidos em 11 municípios pertencentes a
cólon, os enterócitos, por endocitose e se espalham cinco microrregiões produtoras de leite e verificaram
lateralmente para as células adjacentes. Estes passos de que 74% das amostras estavam contaminadas por
invasão e difusão célula a célula parecem ser coliformes fecais e &. coli em níveis superiores ao
virtualmente idênticos aos da Shigella spp. Mas, ao estabelecido na legislação. Em outro estudo, Bruno et al
contrário das linhagens de Shigella, as linhagens de (2005) verificaram que 100% (8) das amostras de queijo
EIEC não produzem a Shiga-toxina o que poderia de coalho analisadas apresentavam níveis de coliformes
explicar a ausência da síndrome urêmica hemolítica na fecais e &. coli em desacordo com os padrões
disenteria por EIEC. A habilidade da EIEC de invadir, microbiológicos vigentes.
sobreviver e multiplicar dentro dos enterócitos é
dependente da presença de um plasmídeo de 120-140 2.2.2. Salmonella sp.
MDa, que codifica todos os genes necessários para a
virulência (Hart et al., 1993), incluindo as proteínas da O gênero Salmonella pertencente à família
membrana externa que são requeridas para a invasão Enterobactereaceae, é extremamente heterogêneo,
(Levine, 1987). A infecção pela EIEC resulta em uma compreendendo quase 2000 sorotipos, dos quais
diarréia caracterizada pela presença de sangue e muco. somente poucos são patogênicos ao homem. Ele é
Como a Shigella, a EIEC não fermenta a lactose ou o composto por bactérias Gram-negativos, com forma de
faz tardiamente e é não móvel. Um número de bastonete curto, geralmente móveis, intracelulares
diferentes sorogrupos está associado com a EIEC, mas facultativas, anaeróbias facultativas, não esporuladas,
três sorogrupos predominam e estes não são vistos entre que fermentam glicose, mas não lactose e sacarose,
as linhagens de &. coli enterotoxigênica (ETEC), &. geralmente produzindo ácido, gás e H2S. São oxidase
coli enteropatogênica (EPEC) e &. coli negativa, catalase e lisina descaboxilase positivas, sendo
enterohemorrágica (EHEC) (Salyers; Whitt, 1994). que não hidrolisam a uréia. A temperatura considerada
ótima para o crescimento destes microrganismos é de
A EHEC também é uma linhagem moderadamente 37° C (Food and Drugs Administration, 1998; Holt et
invasiva que produz a verotoxina, que é uma toxina que al., 2000; Kaufmann et al., 2001; Bopp et al., 2003).
simula a shiga-toxina, além de outros fatores de
virulência como a produção de adesinas (Clarke, 2001). Esta bactéria é comumente encontrada no trato intestinal
Causa uma diarréia infantil hemorrágica copiosa que, de animais, especialmente em aves e suínos. As fontes
em casos mais graves, leva a uma uremia hemolítica ambientais deste microrganismo incluem a água, o solo,
(Coia, 1998). os insetos, as superfícies de cozinhas e indústrias, as
fezes animais e as carnes, aves e frutos do mar crus.
A ETEC é linhagem não invasiva e é a maior causa de Outros alimentos associados à Salmonella são ovos,
diarréia do viajante em todo o mundo (Hart et al., 1993). leite e seus derivados, coco, molhos, saladas, misturas
Produz uma toxina termo-lábil, que é muito semelhante para bolo, sobremesas recheadas com creme, gelatina
à toxina do cólera, e/ou uma toxina termo-estável em pó, manteiga de amendoim e chocolate (Food and
(Nataro e Kaper, 1998). Como a EIEC, a ETEC está Drug Administration, 1998; Holt et al., 2000).
mais associada a baixas condições de saneamento e
higiene (Clarke, 2001). Atualmente, o novo sistema de nomenclatura do gênero
Salmonella inclui as espécies Salmonella bongori e
As &. coli que causam diarréia são uma importante Salmonella enterica, sendo que a espécie S. enterica,
causa de doenças em todo o mundo. Embora se tenha subdivide-se em seis subespécies (De Vos, Trüper e
aprendido muito a respeito destas linhagens bacterianas, Tindall, 2002; Tindall et al., 2005). Até 2002, haviam
vários mecanismos ainda precisam ser elucidados. Para sido descritos 2.541 sorovares de Salmonella spp.,
o desenvolvimento de vacinas é preciso identificar sendo 60% destes referentes à S. enterica subsp.
possíveis alvos, o que é difícil, uma vez que as Enterica (Centers for Disease Control and Prevention,
linhagens patogênicas e as não-patogênicas 2005).
compartilham várias propriedades (Clarke, 2001)
Com relação à patogenicidade em humanos, as espécies
No Brasil, coliformes fecais e &. coli são detectados
de Salmonella são divididas, de acordo com Kaufmann linfonodos que drenam a região, chegando ao fígado e
et al. (2001) em: causadoras de septicemia e produtoras ao baço (Carter e Collins, 1974; Nardi et al., 1991). Em
da febre tifóide (S. typhi e espécies correlatas), camundongos, a Salmonella cresce em macrófagos
causadoras de gastroenterites (a maioria das espécies de residentes do fígado e do baço.
Salmonella, como S. typhimurium, S. enteritidis) e
causadoras de uma doença invasiva (S. choleraesuis). O estudo de salmoneloses em camundongos utilizando a
S. Typhimurium é um excelente modelo, pois os
O mecanismo de patogenicidade se desenvolve pela sintomas provocados por esta bactéria e pela S.
penetração e passagem da Salmonella do lúmem choleraesuis são muito semelhantes aos sintomas da
intestinal para dentro do epitélio que reveste a parede febre tifóide causada pela S. Typhi em seres humanos
intestinal, onde ocorre inflamação. O tempo de (Salyers e Whitt, 1994). Os resultados obtidos,
incubação é de 6-48 horas, seguido pelo início dos geralmente, têm sido extrapolados para a compreensão
sintomas agudos, como náusea, vômito, cãibra de vários aspectos da infecção causada pela S. Typhi.
abdominal, diarréia, febre e dor de cabeça. Algumas Em condições experimentais normais, este sorotipo não
conseqüências crônicas, como sintomas de artrite, é virulento para o camundongo, sendo incapaz de
podem persistir por 3-4 semanas após o início dos induzir uma doença progressiva neste animal (Carter e
sintomas agudos (International Commission on Collins, 1974).
Microbiological Specifications for Foods, 1998).
Embora a análise microbiológica de queijos
A infecção inicia-se quando a Salmonella spp invade as industrializados raramente resulte no isolamento de
células M, na superfície epitelial do intestino delgado Salmonella, este microrganismo pode crescer durante a
(Takeuchi, 1967). As bactérias, aderidas à superfície das fabricação e sobreviver em vários queijos por mais que
células epiteliais, induzem degeneração nas 60 dias (International Commission on Microbiological
microvilosidades do enterócito. Posteriormente, Specificatios for Foods, 2000).
projeções citoplasmáticas das células do hospedeiro
circundam as bactérias até que elas fiquem contidas em No Brasil, há vários relatos sobre a ocorrência de
vacúolos envoltos por membrana. Ocorre, então, a Salmonella spp. em queijos, principalmente em queijo
reconstituição da borda em escova dos enterócitos. A S. de coalho artesanal (Nassu et al., 2001; Rapini et al.,
Typhimurium induz rearranjos na membrana celular 2002; Araújo et al., 2004; Escobar et al., 2001).
como parte do processo de internalização (Finlay e
Falkow, 1990; Finlay et al., 1992; Francis et al., 1992). No Ceará, Borges et al (2003) detectaram a presença de
Salmonella spp. em 34,9% (43) das amostras de queijo
A salmonelose, geralmente, é causada pelo consumo de de coalho analisadas. Em outro estudo, Bruno et al
alimentos de origem animal contaminados por (2005) verificaram que esta bactéria estava presente em
Salmonella, como aves, ovos carnes, e leite e seus 12,5% (8) dos queijos industrializados. No Rio Grande
derivados, embora muitos outros alimentos, incluindo do Norte, Feitosa et al (2003) relataram a presença de
vegetais contaminados, têm sido implicados na Salmonella em 9% (11) dos queijos analisados, de
transmissão da doença. Este patógeno ocorre desde a diferentes microrregiões do Estado. Florentino e
cadeia de produção primária de alimentos até o Martins (1999) observaram a presença do patógeno em
ambiente doméstico ou estabelecimentos e instituições 30% das amostras de queijo artesanal produzido em
de serviços de alimentação. S. Enteritidis e S. várias regiões do Estado da Paraíba. Em Recife, Mendes
Typhimurium são os sorotipos de maior importância na et al (1999) avaliaram 105 amostras de queijo de
transmissão de salmonelose humana (D’Aoust, Maurer coalho, procedentes de 15 municípios de Pernambuco, e
e Bailey, 2001). verificaram a presença de Salmonella em 73,3% dos
queijos, enquanto Duarte et al (2005) isolaram este
Em camundongos inoculados intragastricamente, patógeno em apenas 5,5% dos queijos comercializados
observou-se que o sítio primário de colonização por S. em 21 municípios do Estado.
enteritidis é o íleo terminal (Carter e Collins, 1974).
Também foi observado que a Salmonella interagia, 2.2.3. Listeria monocytogenes
preferencialmente, com as células das placas de Peyer
(tecido linfóide associado ao intestino), como é o caso Segundo o Taxonomic outline of the prokaryotes,
da S. Typhimurium que, seguindo a rota oral de Bergey´s Manual of Systematic Bacteriology (Garrity,
colonização, associa-se rapidamente com o tecido das Bell e Lilburn, 2004), o gênero Listeria encontra-se
placas de Peyer (Hohmann et al., 1978). A bactéria entra classificado na classe Bacilli, Ordem I Bacillales e
seletivamente pelas células M (“microfold”) – que são família IV Listeriaceae e apresenta seis espécies: L.
células epiteliais especializadas, localizadas no epitélio monocytogenes, L. innocua, L. weishimeri, L. seeligeri,
folicular associado, que estão sobre o tecido linfóide – L. ivanovii e L. grayi.
do epitélio associado aos folículos linfóides (Jones et
al., 1994). A entrada bacteriana é seguia pela morte As espécies do gênero são pequenos bastonetes Gram
destas células M e, após a eliminação destas células, os positivos, não formam esporos, não formam cápsula,
microrganismos movem-se lateralmente ao longo da anaeróbios facultativos, móveis devido a flagelos
lâmina própria ou invadem os folículos onde se peritríquios e em meio-sólido, a 20-25°C, apresentam
multiplicam. Com o tempo, a infecção progride para os
motilidade típica de guarda-chuva (Bille e Rocourt, Danielsson-Tham, 2002; Kabuki et al., 2004).
2003). Crescem numa faixa de temperatura entre –0,4 a
50°C (Lou e Yousef, 1999), com crescimento ótimo a Em queijo de coalho, a incidência de L. monocytogenes
30-37°C (Bille e Rocourt, 2003). A faixa de pH para também apresenta ampla variação (zero a 50%), tanto
crescimento situa-se entre 5,6 a 9,6 (Swaminathan, para queijos artesanais como para industrializados. A
2001), mas o crescimento de L. monocytogenes já foi maior taxa (50%) de ocorrência do patógeno foi
constatado em pH abaixo de 4,0 (Lou e Yousef, 1999; observada em queijo artesanal comercializado em João
Donelly, 2001). A atividade de água ótima é >0,97, Pessoa (Sousa, 1999). Cabe ressaltar que, em outro
porém, a mínima varia entre 0,90-0,93 (Lou e Yousef, estudo, Catão e Ceballos (2001) constataram alta
1999) e toleram altas concentrações de cloreto de sódio incidência (51,5%) de L. monocytogenes em leite cru
(10-12%), sobrevivendo a 25,5% de NaCl (Donelly, procedente de três municípios do estado da Paraíba. No
2001). Ceará, a maior ocorrência de L. monocytogenes (19%)
foi constatada em queijo de coalho industrializado,
A listeriose é uma doença causada pela ingestão de armazenado sob refrigeração (Branco et al., 2003). Já,
alimentos contaminados por L. monocytogenes. São em queijo artesanal elaborado a partir de leite cru a
descritas duas formas de manifestação clínica da prevalência desta bactéria foi baixa (zero a 2,3%)
doença, a listeriose invasiva e a listeriose gastrintestinal (Borges et al., 2003; Branco et al., 2003; Bruno et al.,
(não invasiva). A listeriose invasiva é uma doença 2005).
severa, pois a taxa de mortalidade é alta (20 a 30%),
principalmente para pessoas susceptíveis a adquirir a 2.2.4. Staphylococus sp e suas enterotoxinas
infecção, como gestantes, recém nascidos, idosos,
pacientes submetidos a hemodiálise e a terapias O gênero Staphylococcus é composto de 30 espécies e
prolongadas, indivíduos com sistema imunológico 20 subespécies (Garrity, Bell e Lilburn, 2004). Os
deprimido (Swaminathan, 2001), enquanto a listeriose membros deste gênero são cocos Gram positivos,
não invasiva pode causar infecções suaves semelhantes quando visualizados ao microscópio ocorrem sozinhos,
a uma gripe, em indivíduos saudáveis, até surtos de aos pares, tétrades, cadeias curtas (três ou quatro
gastrenterite febril, mas normalmente não evolui para células) ou apresentam formação semelhante a um
óbito (Carrique-mas et al., 2003; Gahan e Hill, 2005). cacho de uva. As espécies são anaeróbias facultativas,
exceto S. saccharolyticus e S. aureus subsp. anaerobius.
Listeria monocytogenes é um patógeno intracelular com São tipicamente encapsuladas ou com formação de
habilidade de penetrar, multiplicar-se dentro do cápsula limitada, usualmente catalase positiva, não
citoplasma da célula do hospedeiro (macrófagos, apresentam motilidade e nem produzem esporos
fibroblasto, eritrócitos) e invadir células adjacentes, (Bannerman, 2003).
além de se proteger do sistema imunológico do
hospedeiro (Vazquez-Boland et al., 2001). Staphylococcus são amplamente distribuídos na
Inicialmente, o processo infeccioso parece ser uma natureza, sendo o homem e os animais os principais
associação com a membrana plasmática das células reservatórios. Geralmente, são encontrados nos pêlos,
epiteliais das microvilosidades do trato intestinal do na pele, boca, narinas, glândulas mamárias, trato
hospedeiro. Então, a célula bacteriana é internalizada respiratório e intestinal destes hospedeiros (Bannerman,
pela célula por fagocitose, permanece no vacúolo por 2003). Em geral, as espécies deste gênero têm uma
curto período de tempo e quando ocorre a lise da relação benigna ou simbiótica com o hospedeiro, porém,
membrana fagossomal é liberada no citoplasma da por serem bactérias oportunistas, certas espécies são
célula do hospedeiro, onde se multiplica rapidamente e freqüentemente agentes etiológicos de várias infecções
induz a polimerização de filamentos de actina da célula no homem e nos animais. A espécie S. aureus é a que
do hospedeiro, formando longas caudas em uma das está associada mais freqüentemente a doenças
extremidades da célula bacteriana. Os filamentos de estafilocócicas, quer sejam de origem alimentar ou não.
actina favorecem o deslocamento da bactéria no Estima-se que entre 30 a 50 % da população humana
citoplasma, permitindo a invasão das células adjacentes seja portadora desta bactéria (Le Loir, Baron e Gautier,
dando início a um novo ciclo da infecção 2003). A cavidade nasal é o principal habitat de
(Swaminathan, 2001; Vazquez-Boland et al., 2001; Staphylococcus no homem e, a partir deste foco atingem
Schmidt e Hensel, 2004). tanto a epiderme e como ferimentos, água, ar, solo,
esgoto, plantas de processamento de alimentos, leite, e
A ocorrência de L. monocytogenes em leite e produtos alimentos diversos.
lácteos tem sido relatada em muitos estudos (Silva,
Hoffer e Tibana, 1998; Catão e Ceballos, 2001; Kabuki A espécie mais importante deste gênero, ligada aos
et al., 2004). Entre os produtos lácteos, os queijos são os alimentos, é a S. aureus, distinguida das demais espécies
mais comumente contaminados por esta bactéria, através dos testes de coagulase (coagulação do plasma
principalmente os de alta e média umidade. A sangüíneo) e termonuclease (estabilidade térmica da
contaminação de queijos por L. monocytogenes está nuclease). Nenhum destes testes, entretanto, é
relacionada com a contaminação do leite cru, o que absolutamente específico para o S. aureus. O S. hyicus é
pode ocorrer durante o processo de ordenha, estocagem, freqüentemente coagulase positiva e pode ser facilmente
transporte até a indústria e a partir do ambiente do confundido com o primeiro, no isolamento. A
processamento (Tompkin, 2002; Waak, Tham e
diferenciação entre ambos é realizada através de testes parecem localizar-se no intestino. O estímulo é
bioquímicos adicionais (International Commission on transferido através do nervo vago ao centro do vômito e
Microbiological Specifications for Foods, 1998). O S. induz a retroperistalsia do estômago e do intestino
aureus é uma bactéria mesófila, mas cresce em ampla delgado provocando vômitos intensivos (Balaban e
faixa de temperatura (10-45ºC) e de pH (4,2-9,3), tolera Rasooly, 2000; Dinges; e Orwin; Schlievert, 2000). A
elevadas concentrações de cloreto de sódio (até 23%) e ação diarréica é o segundo sintoma mais comum na
baixa atividade de água (0,83 a 0,86). No entanto, intoxicação. Embora seu mecanismo de ação ainda não
concentrações entre 12 a 13 % de NaCl e 0,87 a 0,93 de seja bem conhecido, causa inflamação e irritação da
atividade de água parecem ser limitantes para produção mucosa do estômago e intestino delgado (Dinges;
de enterotoxinas (Martin, Myers e Landolo, 2001; Orwin; Schlievert, 2000).
Bannerman, 2003).O S. aureus é muito resistente a
temperaturas de congelamento, sobrevivendo em A intoxicação estafilocócica, por ser uma doença de
alimentos estocados até –20° C. Ele não resiste a curso rápido (24-48 horas), e os indivíduos afetados,
temperaturas e pasteurização, porém é capaz de produzir geralmente, não necessitarem de atendimento médico, a
toxinas altamente estáveis ao aquecimento maioria dos casos não é notificada aos órgãos de
(International Commission on Microbiological Vigilância Sanitária, o que leva à subnotificação da
Specifications for Foods, 1998). doença no Brasil, bem como em outros países.

A intoxicação estafilocócica é causada pela ingestão de A contaminação dos alimentos por espécies de
alimentos contendo enterotoxinas produzida por Staphylococcus enterotoxigênicos representa um risco
Staphylococcus enterotoxigênicos, como S. aureus (com potencial para a saúde pública, uma vez que algumas
maior prevalência), S. hyicus, S. intermedius, entre espécies, incluindo coagulase positiva e negativa,
outras espécies. Esta intoxicação é um dos tipos mais quando presente nos alimentos pode produzir uma ou
comuns de DTA (Le Loir, Baron e Gautier, 2003). mais enterotoxinas estafilocócicas (SE) nos mesmos, os
quais, depois de ingeridos, causam intoxicação
A intoxicação alimentar causada por S. aureus se estafilocócica aos consumidores.
manifesta logo após a ingestão do alimento
contaminado com enterotoxinas pré-formadas. A Entre as espécies coagulase positiva, S. aureus é a mais
quantidade de enterotoxina necessária para causar a relacionada a casos e surtos de intoxicação alimentar,
doença ainda não está bem estabelecida, mas sabe-se devido à habilidade de muitas de suas cepas produzirem
que depende da susceptibilidade do individuo, peso exotoxinas superantigênicas (PTSAg), como as
corporal e, especialmente, do estado de saúde da pessoa enterotoxinas (Dinges, Orwin e Schlievert, 2000).
acometida (Jablonski e Bohach, 2001). Para a formação Outras espécies produtoras de coagulase, como S.
de enterotoxinas, em quantidade suficiente para intermedius (Becker et al., 2001) e S. hyicus (Adesiyun,
provocar intoxicação, são necessárias 105 a 106 células Tatini e Hoover, 1984), também produzem enterotoxinas
de S. aureus por grama de alimento (Jablonski e e têm sido envolvidas em alguns surtos (Khambaty,
Bohach, 2001). Além disso, o crescimento de S. aureus Bennet e Shah, 1994; Bennet, 1996).
e a produção de enterotoxinas são afetados por
parâmetros físicos e químicos, como temperatura, pH, A produção de enterotoxinas por Staphylococcus não
atividade de água (Aa), concentração de sal (NaCl) e produtores de coagulase, tais como, S. capitis, S.
disponibilidade de oxigênio. conhnii subsp cohnii, S. epidermidis, S. haemolyticus,
S. hominis, S. saprofphyticus, S. schleiferi, S. warneri,
A intoxicação estafilocócica é, geralmente, de início S. xylosus e S. chromogenes têm sido relatada em
repentino e severo, com náusea, vômitos e cólicas, vários estudos, sendo a maioria sob condições de
prostração, hipotensão e hipotermia (Dinges, Orwin e laboratório (Vernozy-Rozand et al., 1996a; Cheng-
Schlievert, 2000; Balaban e Rasooly, 2000; Le Loir, Chun; Lifen, 1997; Pereira et al., 2001). Os resultados
Baron e Gautier, 2003). Entretanto, a intensidade dos de alguns destes estudos sugerem que Staphylococcus
sintomas pode variar de acordo com o grau de não produtores de coagulase (Rodriguez et al., 1996;
suscetibilidade do indivíduo, com a concentração da Vernozy-Rozand et al., 1996b; Udo et al., 1999) podem
enterotoxina presente no alimento e a quantidade de ser potenciais, causadores de intoxicação alimentar. Já
alimento ingerida. A recuperação ocorre em torno de foram relatados surtos de intoxicação estafilocócica
dois dias, porém, alguns casos podem levar mais tempo associados a espécies coagulase negativa (Omori e
ou exigir hospitalização (Jablonski e Bohach, 2001). O Kato, 1959; Breckinridge e Bergdoll, 1971; Carmo et al,
período de incubação oscila de 30 minutos a 8 horas, 2002b; Veras et al., 2003).
porém, na maioria dos casos, os sintomas aparecem
entre 2 e 4 horas após a ingestão do alimento As enterotoxinas estafilocócicas (SE) são um grupo de
contaminado (Bannerman, 2003). proteínas extracelulares de cadeia simples, com baixo
peso molecular (26 a 30 kDa) e ponto isoelétrico de 7,0
Em uma intoxicação estafilocócica, as enterotoxinas a 8,6. São hidrossolúveis e resistentes à ação de enzimas
apresentam algumas ações no trato gastrintestinal, entre proteolíticas do sistema digestivo, permanecendo ativas
as quais incluem-se a emética e a diarréica. A ação após a ingestão (Le Loir, Baron e Gautier, 2003). São
emética é o sintoma observado com maior freqüência produzidas durante toda fase do crescimento bacteriano,
em uma intoxicação estafilocócica. Os sítios desta ação mas principalmente durante a fase exponencial (Soriano
et al., 2002). Outra característica importante é sua coleções bacterianas (Jarraud et al., 1999; Abe et al.,
termoestabilidade, sendo capazes de resistir a 2000; Jarraud et al., 2001; Omoe et al., 2002). Pouco se
tratamentos térmicos como a pasteurização e a tem relatado sobre a detecção das novas enterotoxinas
ultrapasteurização. em cepas de Staphylococcus, principalmente S. aureus,
isolados de alimentos (Mclauchlin et al., 2000;
As enterotoxinas estafilocócicas são nomeadas com as Akineden et al., 2001; Rosec e Gigaud, 2002; Blaiotta et
letras do alfabeto de acordo com a ordem cronológica al., 2004; Jørgensen et al., 2005). Por outro lado, os
de suas descobertas. Até o momento, já foram descritos relatos sobre a ocorrência das enterotoxinas clássicas
18 tipos de enterotoxinas distintas (Tabela 6), mas com (SEA, SEB, SEC1, 2, 3, SED e SEE) em alimentos são
similaridade na estrutura e seqüência (Balaban w numerosos (De Luca, Zanetti e Stampi, 1997; Rosec et
Rasooly, 2000). Atualmente, com base nas al., 1997; Meyrand et al., 1999; Mclauchlin et al., 2000;
características antigênicas, são reconhecidos oito tipos Akineden et al., 2001; Rosec e Gigaud, 2002; Chapaval,
sorológicos de enterotoxinas: SEA, SEB, SEC, SED 2003).
SEE (Dinges, Orwin e Schlievert, 2000) e as descritas
recentemente SEH (Ren et al. 1994; Su; Wong, 1995; A presença de Staphylococcus enterotoxigênicos e suas
Omoe et al. 2002), SEG e SEI (Omoe et al. 2002; enterotoxinas têm sido constatada com freqüência em
Jørgensen et al. 2005). Outras 12 enterotoxinas foram produtos lácteos, principalmente em leite cru e queijos
identificadas e caracterizadas nos últimos anos (Omoe (Rosec e Gigaud, 2002; Sena, 2000; Lamaita et al.,
et al. 2005). 2005; Le Loir, Baron e Gautier, 2003). O leite cru
obtido de animais com infecção estafilocócica nas
As cadeias polipeptídicas das enterotoxinas são ricas em glândulas mamárias (mastite) é a principal fonte de
aminoácidos lisina, ácido aspártico e ácido glutâmico e, cepas S. aureus enterotoxigênicos.
caracterizadas por conter somente dois resíduos de
cisteína e um ou dois resíduos de triptofano. A No Brasil têm sido realizadas muitas pesquisas para
composição de aminoácidos das enterotoxinas SEA, avaliar o potencial enterotoxigênico e a produção de
SED e SEE é similar, o mesmo ocorrendo entre a SEB e enterotoxinas por Staphylococcus sp. isoladas de
a SEC (Marrack; Kappler, 1990). alimentos, principalmente queijo Minas frescal
(Sabioni, Hirooka e Souza, 1988; Araújo et al., 2004) e
O seqüenciamento parcial dos aminoácidos das queijo de coalho (Florentino e Martins, 1999; Borges et
enterotoxinas SEA, SEB e SEC evidenciou a existência al., 2003; Feitosa et al., 2003).
de uma região homóloga nas três moléculas, o que
sugere ser esta região o sítio ativo da molécula de Cunha Neto et al (2002) isolaram Staphylococcus
enterotoxina (Dinges, Orwin e Schlievert, 2000; enterotoxigênicos em vários alimentos, incluindo queijo
Jablonski e Bohach, 2001). Embora as enterotoxinas de coalho e leite em pó integral, comercializados em
sejam similares em sua composição e atividade Recife – PE. As contagens de Staphylococcus coagulase
biológica, são identificadas separadamente em função positiva variaram de <102 a 1,5 x 104 UFC/g para estes
de suas diferenças antigênicas. Várias enterotoxinas dois produtos e 100% das cepas isoladas de queijo de
sorologicamente distintas têm sido reconhecidas e coalho foram positivas para enterotoxinas
classificadas de SEA até SEU e, seus genes, de sea até estafilocócicas clássicas. Em outro estudo, Sena (2000)
seu. Inicialmente, a toxina da Síndrome do Choque analisou 90 amostras de queijo de coalho
Tóxico foi equivocadamente identificada como SEF e comercializadas em Recife – PE e isolou 377 cepas de
por isso não existe a enterotoxina sorotipo F. Pequenas Staphylococcus, assim distribuídas: 218 (57,8%) de S.
variações antigênicas da (SEC1, 2, 3) têm sido descritas aureus; 96 (25.5%) de S. epidermidis; 41 (10,9%) de S.
(Bergdoll, 1967; Reiser et al., 1984; Becker;, Roht e hyicus; e 22 (5,8%) de S. intermedius. Pools de cepas
Peters, 1998) assim como duas SEH distintas (Omoe et foram testados quanto ao potencial de produção de
al., 2002). Normalmente, isto ocorre em cepas que enterotoxinas por indução sob condições laboratoriais e
secreta mais de um tipo de enterotoxinas (OmoE et al., observou-se que dos 78 pools de cepas de S. aureus, 48
2005). (61,5%) produziram SEB; 10 (12,5%) SEC e 2 (2,5%)
SED. Dos 11 pools de Sintermedius, 7 (63,6%)
As enterotoxinas estafilocócicas são codificadas por produziram SEB e os pools de S. epidermidis e de S.
bacteriófago (SEA e SEE), plasmídios como a SED hyicus não produziram enterotoxinas. Lima (2005)
(Iandolo, 1989), cromossomo como a SEH e SEP (Su e avaliou a incidência de Staphylococcus coagulase
Wong, 1995; Omoe et al., 2002) ou ilhas de positiva em 80 amostras de queijo de coalho industrial e
patogenicidade cromossomal a exemplo das artesanal comercializado em Fortaleza (CE) e constatou
enterotoxinas SEB, SEG, SEGv, SEI, SEIv, SEM, (Su e que 54% (43) dos queijos estavam contaminados com
Wong, 1995; Jarraud et al., 2001; Munson et al., 1998; esta bactéria, cujas contagens oscilaram entre 4,4 x 104 a
Blaiotta et al., 2004), entre outras. 1,7 x 107UFC/g. A presença de enterotoxinas
estafilocócicas não foi observada nas amostras
A relação entre as novas enterotoxinas e a intoxicação analisadas. Apenas 8,3% (1/12) dos pools de cepas de
estafilocócica, ainda não está completamente elucidada. Staphylococcus produtores de coagulase foram
Há poucos relatos na literatura sobre a ocorrência dos positivos para enterotoxinas estafilocócicas clássicas.
genes que codificam estas novas enterotoxinas, os quais Em uma avaliação de queijo de coalho comercializado
consideram principalmente amostras clínicas ou de nas praias de Salvador e Maceió, Rapini e outros (2002)
observaram que 100% das amostras estavam intermédio de reação de polimerização em cadeia
contaminadas por Staphylococcus sp. e por (“PCR”) (Batool et al., 2002;). Também são empregadas
enterotoxinas SEB e SEC. metodologias relacionadas ao polimorfismo de genes
2.3. Bactérias Ácido-Lácticas (BAL) (“RFLP”) e quantificação de proteínas de superfícies
(Gattim et al., 2001).
As bactérias lácticas são bastante difundidas na natureza
e capazes de se desenvolverem sob diferentes condições BAL podem apresentar importantes efeitos benéficos à
ambientais. São associadas a ambientes ricos em saúde humana. Isto pode ser comprovado por um
nutrientes, sendo freqüentemente encontradas em número crescente de evidências que demostram estes
alimentos fermentados, como leite, carnes, vegetais, fatos positivos. Dentre eles, podem ser citados:
grãos, frutas e bebidas. Algumas delas também fazem imunomodulação, proteção contra infecções causadas
parte da microbiota natural dos tratos respiratório por bactérias e vírus patogênicos, redução de níveis
eintestinal e de cavidades naturais de humanos e plasmáticos de colesterol e de incidência de câncer,
animais (Axelsson 1993; Pot et al., 1994). São além de serem utilizadas no tratamento de úlceras
amplamente utilizadas como fermentos lácticos devido a pépticas e de vaginites (Robinson, 1991; Fuller, 1993;
sua propriedade de conservar os alimentos e de fornecer Gonzalez-Martinez e Gomez-Trevino, 2001; Ouwehand
uma proteção eficaz ao homem e animais contra et al., 2003).
infecções intestinais (Dellaglio et al., 1994).
2.3.1. Bactérias Ácido-Lácticas em queijos
O grupo das BAL compreende onze gêneros de
bactérias Gram-positivo (Mogensen et al., 2003). São As BAL podem ser isoladas a partir de vários alimentos,
eles: Carnobacterium, Enterococcus, Lactococcus, incluindo produtos de origem vegetal (como forragens,
Lactobacillus, Lactosphaera, Leuconostoc, frutas e sucos), e de origem animal (como leite e
Oenococcus, Pediococcus, Streptococcus Vagococcus e derivados e carne e derivados). No caso dos queijos
Weissella. artesanais, sua presença está relacionada à sua origem
no leite, plantas e/ou água (Hammes; Vogel, 1995). No
As BAL são encontradas em inúmeros ambientes na caso dos queijos industrializados, as BAL estão
natureza, particularmente no leite. Elas são também presentes em decorrência da utilização de culturas
habitantes dos tratos digestivo, respiratório superior e lácticas utilizadas nos processos de fermentação deste
urogenital inferior dos animais (Hove et al. 1999). O alimento e, eventualmente, por cepas termodúricas.
grupo inclui tanto bastonetes quanto cocos não
esporulados, podendo ser aeróbios, microaerófilos ou No Brasil, a literatura apresenta alguns trabalhos que
anaeróbios facultativos. A maioria delas é inativada a foram realizados com objetivo de isolar BAL a partir de
temperaturas superiores a 70 °C. Bactérias lácticas produtos de origem animal. Oliveira e Garcia (1986)
utilizam preferencialmente a lactose como fonte de isolaram e caracterizaram BAL oriundas de leite cru e
carbono. A fermentação pode ser do tipo pasteurizado e de queijos provenientes de pequenos
homofermentativa, quando produz uma intensa produtores, que não utilizavam fermentos lácticos na
quantidade acido láctico, ou heterofermentativa, quando sua fabricação. Foram obtidos 400 isolados, sendo que
outras substâncias, além do ácido láctico, como os destes, 21 foram identificados como estreptococos
ácidos acéticos, dióxido de carbono e etanol, são mesofílicos, 26 como lactobacilos e 10 como
também produzidas durante a fermentação da lactose estreptococos termodúricos.
(Salminen e Von Wright, 1993).
Furtado (1990) isolou BAL de leite e de soro de queijo
A capacidade de fermentação varia de acordo com as da região do Serro, Minas Gerais. Trabalhando com o
espécies. A maioria das BAL produz entre 0,5% e 1,5% mesmo tipo de queijo, Leite et al. (1997) isolaram 1.244
de ácido láctico, mas existem bactérias capazes de colônias de microrganismos, das quais 105 foram
produzir mais de 3% de ácido láctico. Estas bactérias caracterizadas como Gram positivo e catalase negativo.
precisam de compostos nitrogenados orgânicos para se A maior partes destes (34) foi classificada no gênero
desenvolver. Assim, elas utilizam a caseína do leite Lactococcus, sendo o restante Enterococcus e
como fonte destes compostos. Porém, a habilidade Streptococcus. Adicionalmente, Alexandre et al. (2002)
enzimática de quebrar a caseína é variável de uma isolaram 192 cepas de BAL, do mesmo alimento.
espécie para outra (Robinson, 1991).
Na África, pesquisando queijos regionais da Argélia,
Apesar da identificação das BAL isoladas a partir de Boubekri e Otha (1996) isolaram 54 cepas de BAL, das
alimentos poder ser realizada por intermédio de provas quais a maioria delas (61,2%) pertenciam ao gênero
bioquímicas, novos procedimentos têm sido utilizados Enterococcus. O restante foi classificado como:
(Klaenhammer et al., 2002). Dentre estes, aqueles Pediococcus, Lactobacillus, Streptococcus e
baseados em técnicas de biologia molecular apresentam- Leuconostoc.
se como os mais promissores, principalmente por sua
precisão e confiabilidade (Tannock et al., 1999). Estas A maioria das pesquisas de BAL em queijos tem sido
análises baseiam-se na extração de DNA microbiano, feita na Europa, sendo encontradas e identificadas
seguida por amplificação de genes específicos por principalmente bactérias dos gêneros Lactococcus e
Lactobacillus. Leuconostoc mesenteroides ssp. cremoris, Pediococcus
pentosaceus e Lactobacillus paracasei ssp. paracasei
Potes e Marinho (1998) estudaram a variação foram identificados e selecionados como culturas
microbiana em dez amostras de queijo de Évora, iniciadoras para a produção deste queijo. A maturação
Portugal. Os resultados demostraram haver variações na do queijo foi significativamente influenciada pela
microbiota de acordo com a época do ano. Entretanto, atividade bioquímica resultante do metabolismo de
as BAL sempre foram os microrganismos Weissella paramesenteroides, Lactobacillus
predominantes. bifermentans e Lactobacillus brevis.

López-Dias et al. (2000) isolaram aproximadamente 500 Manolopoulou et al. (2003) estudaram a microbiota de
cepas de microrganismos aeróbios, mesófílicos e queijo Feta tradicional, na região de Peloponessa (sul da
produtores de ácido láctico, a partir de queijo Valderón. Grécia). Lactobacillus pentosus e Lactobacillus
Este produto lácteo é um queijo azul artesanal típico, paraplantarum foram os principais microrganismos
elaborado a partir de leite de cabra, na Espanha. Os isolados durante o período de maturação deste queijo e
gêneros das bactérias predominantes, de acordo com identificados por testes bioquímicos e morfológicos.
resultados de provas bioquímicas, foram Lactococcus Streptococcus thermophilus, Lactobacillus delbrueckii
(42,2%) e Enterococcus (40,4%), sendo também ssp. bulgaricus e Enterococcus faecium também foram
encontrados Leuconostoc (5,0%) e Lactobacillus isolados. Microrganismos indesejáveis foram
(4,1%). A espécie de BAL dominante foi Lactococcus pesquisados, sendo isolados coliformes, incluindo
lactis ssp. lactis (31,1%). Outras espécies isoladas Escherichia coli.
foram Lactococcus raffinolactis, Lactobacillus
plantarum, Lactobacillus casei, Leuconostoc Callon et al (2004) descreveram a diversidade de BAL
mesenteroides ssp. dextranicum, Leuconostoc encontrada em queijo Salers, feito a partir de leite cru.
mesenteroides ssp. mesenteroides e Leuonostoc Foram caracterizadas 381 cepas isoladas durante o
paramesenteroides. processo de maturação que foram identificadas usando
técnicas fisiológicas e de biologia molecular :
Héberta et al. (2000) estudaram cinco cepas de amplificação específica por rep-PCR para identificação
lactobacilos homofermentativos, isolados de queijos do gêneros e espécies seguida da análise do
duros, naturalmente fermentados (queijo argentino e seqüenciamento do 16s rDNA para identificação
queijo Grana italiano). De acordo com testes taxonômica e tipificação das amostras isoladas.
bioquímicos, fisiológicos e seqüenciamento da região
variável do DNA ribossomal 16S, foram identificados Ouadghiri et al (2005) estudaram a diversidade
Lactobacillus delbrueckii ssp. lactis e Lactobacillus microbiana encontrada em queijo macios produzidos em
helveticus. oito diferentes regiões do Marrocos. Um total 164
amostras de BAL foram isoladas, purificadas e
Fortina et al. (2003) estudaram a população bacteriana identificadas através da caracterização de proteínas
natural de queijo Piemontês, na Itália. Foram analisados celulares e do padrão genômico obtido por rep-PCR. As
seis queijos, com 30 a 40 dias de maturação, maiorias das amostras pertenciam aos gêneros
provenientes de diferentes regiões da área queijeira de Lactobacillus, Lactococcus, Leuconostoc and
Toma, a qual produz artesanalmente queijos que Enterococcus.
recebem a inscrição de "origem de denominação
protegida". Foram isolados 116 cocos e 11 lactobacilos BAL de queijo Pecorino fabricado na região central da
mesofílicos. Utilizando-se análise do espaçador 16S - Itália foram identificadas e tipificadas para sua
23S e seqüenciamento de 16S rDNA, foram utilização como culturas iniciadoras ou adjuvantes na
identificados os seguintes microrganismos: Lactococcus fabricação de queijos artesanais, em um estudo
lactis, Lactococcus garviae, Streptococcus realizado por Aquilanti etal (2007). A caracterização
macedonicus, Streptococcus thermophilus e preliminar realizada por provas bioquímicas e
Enterococcus. A incidência de Lactobacillus foi baixa, morfológicas revelou 112 amostras Gram-positivo e
sendo isolado apenas Lactobacillus paracasei. catalase negativo. A identificação das amostras foi
obtida através da análise de restrição do gene 16s rRNA
Caridi (2003) identificou e caracterizou BAL isoladas amplificado e do seqüenciamento de amplicons de 360-
de nove queijos Pecorino del Poro, artesanal, elaborado 380 pares de base.
a partir de leite de ovelhas, na Itália. Lactobacillus
paracaei ssp. paracasei e Lactobacillus cruvatus foram Veljovic et al (2007) caracterizaram e identificaram
isolados e identificados. BAL isoladas durante o processo de maturação de
queijo Zlatar para seleção de amostras com boas
Gerasi et al. (2003) realizaram um estudo características tecnológicas. A caracterização das
microbiológico do queijo Manura. Este é considerado amostras isoladas foi realizada através de provas
como queijo duro, sendo elaborado com leite de ovelha morfológicas, fisiologicas e bioquimicas assim como
na ilha grega de Sifnos. Os isolados foram identificados pela determinação da atividade proteolítica. A
por intermédio de provas bioquímicas e houve identificação das amostras foi feita através da
predominância de BAL na microbiota deste queijo. Isto amplificação do DNA por rep-PCR e da análise do
foi observado durante todo o período de maturação. seqüenciamento do 16s rDNA. As principais espécies
encontradas foram Lactobacillus paracasei subsp. celular tornam o dióxido de carbono um potente sistema
paracasei, Lactobacillus plantarum, Lactobacillus inibitório contra um vasto numero de microorganismos;
brevis, Lactococcus lactis subsp. lactis, Enterococcus (4) A produção de diacetil e acetaldeído. O diacetil é o
faecium e Enterococcus faecalis. produto final do metabolismo do piruvato pelas
bactérias láticas fermentadoras de citratos. O diacetil é
Kongo et al (2007) identificaram por métodos mais eficiente contra bactérias Gram-negativo, mofos e
fenotípicos e genotípicos as espécies de BAL leveduras do que contra microorganismos Gram-
dominantes presente no queijo São Jorge, um queijo positivo. O diacetil interfere na utilização de arginina
típico português. Os resultados indicaram que por reagir com a proteína ligadora de arginina das
Lactobacillus seguidos pelos Enterococus foram os bactérias Gram-negativo. O acetaldeido é formado
gêneros dominantes. As species mais frequentes foram durante o metabolismo de carboidratos e é reduzido a
Lactobacillus paracasei, Lactobacillus rhamnosus, etanol pela reoxidaçao de nucleotídeos, catalisados por
Enterococcus faecalis e Enterococcus faecium. um álcool desidrogenase NAD dependente, e seu efeito
antimicrobiano tem sido relatado contra &. coli,
Doci et al (2008) avaliaram a dinâmica da microbiota Salmonella typhimurium e S. Aureus; (5) A produção de
dominante durante o processo de fabricação e substâncias antimicrobianas, e proteínas bactericidas,
maturação do queijo Castelmagno (Denominação chamadas bacteriocinas. As bacteriocinas variam quanto
Protegida na Origem). Foram analisadas amostras de à atividade, modo de ação, peso molecular, origem
leite, da massa e do queijo em diferentes estágios de genética e propriedades bioquímicas, e podem ser
fabricação. A identificação das espécies foi feita através produzidas espontaneamente ou induzidas (Naidu et al
da análise de PCR-DGGE da região V1 do 16S rRNA. 1999).
Lactococcus lactis subsp lactis foi a espécie mais
frequentemente encontrada durante o processo de A determinante genética da maioria das bacteriocinas
fabricação, enquanto Lactobacillus plantarum e está localizada nos plasmídios, com poucas exceções,
Lactobacillus paracasei foram isolados com maior nas quais a codificação esta no cromossomo. Estes
freqüência nos queijos maturados. agentes antimicrobianos são espécie-especificos e
exercem sua atividade letal através da adsorção de
2.3.2. Efeitos antimicrobianos de Bactérias receptores específicos localizados sob a superfície
Ácido-Lácticas. externa de bactérias sensíveis, seguidos por alterações
metabólicas, biológicas e morfológicas, que resulta na
Muitos estudos têm demonstrado que as BAL exercem morte de tais bactérias (Naidu et al 1999).
efeitos antimicrobianos e atividade antagonista contra
patógenos intestinais e transmissíveis pelo alimento. As As bacteriocinas foram inicialmente descobertas em
BAL são capazes de previnir a aderência, o Escherichia coli, quando foram denominadas colicinas
estabelecimento, a replicação e/ou a ação patogênica de e, posteriormente, em bactérias Gram positivo (Tagg et
microrganismos específicos (Saavedra, 1995). al., 1976). Muito do que se sabe sobre as bacteriocinas
foi baseado em estudos feitos sobre as colicinas (Jack et
O efeito antimicrobiano das BAL pode ser atribuído a al., 1995).
vários fatores. Entre esses fatores podem-se citar: (1) A
produção de ácido lático e ácidos voláteis decorrentes A ação antagonista de espécies de BAL contra
da fermentação e o acúmulo de ácidos orgânicos. O microrganismos indesejáveis em alimentos tem sido
ácido lático é obtido como produto final do descrita em vários relatos científicos. Estes trabalhos
metabolismo de carboidratos, gerados do piruvato pela demonstram uma importante perspectiva tecnológica de
ácido lático desidrogenase. O acúmulo de ácido lático e utilização destes microrganismos para a preservação de
a conseqüente queda do pH do meio resulta na inibição alimentos, bem como controle de patógenos.
da atividade de bactérias Gram-positivo e Gram-
negativo; (2) A produção de peróxido de hidrogênio A inibição de Listeria monocytogenes por Lactobacillus
produzidos pelos lactobacilos, na presença de oxigênio, bavaricus MN em produtos cárneos sob refrigeração foi
através do transporte enzimático de elétrons. Na demostrada por Winkowski et al. (1993). A habilidade
presença do peróxido de hidrogênio, ânions superóxido do Lactobacillus bavaricus, isolado de carne, para inibir
formam um radical hidróxido destrutivo. Este processo o crescimento de três cepas de Listeria monocytogenes
pode levar a peroxidação das membranas lipídicas, e foi examinada em três sistemas: carne em cubos, carne
aumentar a permeabilidade da membrana. O efeito em cubos no molho e carne em cubos no molho com
bactericida resultante desse metabolismo do oxigênio adição de glicose. O patógeno foi inibido pelo
tem sido atribuído ao seu forte poder de oxidação nas Lactobacillus bavaricus MN, sendo que a 4ºC foi
células bacterianas, bem como a destruição de ácidos inibido ou morto, dependendo do nível inicial do
nucléicos e proteínas celulares; (3) A produção de inoculo de Lactobacillus bavaricus. A 10ºC houve uma
dióxido de carbono. O dióxido de carbono é o principal redução de pelo menos 10 vezes da ocorrência do
produto final da fermentação de hexoses e seu papel é patógeno, exceto na carne sem molho. Foi detectada
criar um ambiente anaeróbio pela substituição às bacteriocina nas amostras e a inibição não pôde ser
moléculas de oxigênio do meio, diminuir o pH intra e atribuída a acidificação. Baixas temperaturas de
extracelular. Seus efeitos destrutivos sob a membrana refrigeração acentuaram significativamente a inibição
da Listeria monocytogenes.
cepa que apresentou melhor efeito inibitório.
Vaughan et al. (1994) avaliaram o efeito inibitório de Lactobacillus plantarum e Lactobacillus fermentum
BAL isoladas de alimentos de origem animal e de também apresentaram atividade antagonista frente
vegetais. Os microrganismos isolados de queijo Helicobacter pylori (G88016), porém, menos intensa.
elaborado com leite cru e de carnes não processadas
apresentaram os mais potentes efeitos contra Caridi (2003) verificou importante e potente efeito
Staphylococcus aureus (PRMM1), Listeria innocua antagonista de Lactobacillus paracasei ssp. paracasei e
(BL86/26) e Pseudomonas fragi (NCIMB 8987), Lactobacillus curvatus, isolados de queijo Pecorino
isolado de manteiga estocada sob refrigeração. artesanal, frente à Escherichia coli.

O antagonismo de Lactobacillus e outras BAL frente a Fayol-Messaoudi et al (2005) observaram que amostras
Staphylococcus aureus e Escherichia coli foi avaliado de Lactobacillus johnsonii, Lactobacillus rhamnosus,
por Fang et al. (1998). Todas os microrganismos Lactobacillus casei, L. casei 001, and L. rhamnosus
acidificantes foram repressivos contra Staphylococcus induciram uma forte redução na viabilidade Salmonella
aureus e Escherichia coli no ágar. Contudo, a sua enterica serovar Typhimurium SL1344 devido
atividade supressiva foi reduzida significativamente principalmente a uma substância tipo bacteriocina
quando o meio ágar foi tamponado a pH 7,2. No leite responsável pela atividade bactericida.
normal, cepas A e B de Lactobacillus acidophilus,
Streptococcus thermophilus e suas combinações com Alvarado et al (2006) avaliaram a atividade antagonista
Lactobacillus acidophilus A e Lactobacillus bulgaricus de 94 isolados de BAL a paritr de produtos fermentados
6032 foram inibitórias para Staphylococcus aureus, artesanais do México. 25 amostras de BAL
enquanto em leite de vacas com mamite, apenas o demonstraram capacidade inibitória frente a pelo menos
Streptococcus thermophilus e suas combinações 1 microrganismo indicador (& coli EPEC, S aureus, L
mostraram inibição. Lactobacillus acidophilus A e monocytogenes, & faecium). A maioria da atividade
Lactobacillus bulgaricus 34104 foram repressivos ao inibitória das BAL foi atribuída a redução do pH pelos
crescimento de Escherichia coli em leite. Streptococcus ácidos orgânicos.
thermophilus e suas combinações foram inibitórias para
Escherichia coli em leite de vacas com mamite ou não. O efeito de BAL sobre o crescimento de &. coli
Esses resultados indicaram que a atividade antagonista O157:H7, Salmonella sorotipo Typhimurium,
das BAL sobre bactérias patogênicas variou com o tipo Staphylococcus aureus, Listeria innocua, Enterococcus
de meio nos quais os testes foram realizados, e que o faecium e Enterococcus faecalis foi avaliado por 48
teste de antagonismo in vitro no leite seria mais horas a 37 °C. Na presença de BAL foi observado um
informativo do que em meios de cultura. aumento do tempo de geração de todas as bactérias
Gram-positivo avaliadas. S aureus foi a amostra mais
Um efeito inibitório bastante interessante foi sensível, aumentando seu tempo de geração em 210%.
demostrado por Brashears; Durre (1999) ao verificarem Entretanto para bactérias Gram-negativo, nenhuma
que Lactobacillus lactis apresentava efeito antagonista inibição ocorreu após 8 horas de fermentação. A fração
frente Salmonella spp. e Escherichia coli O157:H7, sobrenadante do leite fermentado por L acidophilus e L
durante o armazenamento de produtos lácteos sob casei foi recuperada e sua atividade antimicrobiana foi
refrigeração. Em todos os experimentos a 37ºC, o testada. A cepas mais sensiveis foram L innocua e S
Lactococcus lactis inibiu os patógenos, produzindo aureus. Após a neutralização do sobrenadante para
números não detectáveis após 24h de incubação. Houve eliminar a possivel ação de acidos organicos as cepas
aumentos significativos (P > 0,05) nos números de mais sensiveis foram L innocua e & coli O157:H7.
patógenos nas amostras controle, que não continham Finalmente o sobrenadante foi neutralizado e irradiado
Lactococcus lactis. Observou-se um aumento para eliminar a ação dos acidos organicos e substancias
significativo do declínio no pH das amostras inoculadas tipo bacteriocinas. Enterococcus faecalis, & coli
com Lactococcus lactis. O número de Salmonella spp. O157:H7 e S aureus foram as amostras mais afetadas.
incubadas a 6ºC não declinou significativamente quando Os resultados obtidos nesse estudo demonstram que a
comparado com aquele das amostras controle ou ação antimicrobiana pode ser devida aos acidos
inoculadas, o que sugeriu que esta cepa de Lactococcus organicos e substancias tipo bacteriocinas (Millet,
lactis não inibe Salmonella spp. sob temperaturas de Luquet e Lacroix, 2007).
refrigeração. Adicionalmente, não existiram mudanças
significantivas no pH ou nos números de Lactococcus No Brasil, algumas pesquisas também foram conduzidas
lactis durante a refrigeração. com o objetivo de avaliar atividade antagonista de BAL
isoladas de produtos de origem animal, frente à
Uraz et al. (2001) verificaram efeitos inibitórios de diferentes microrganismos indicadores.
Lactobacillus casei e Lactobacillus helveticus contra
espécies de Bacillus isolados de leite cru em diversas De seis amostras de pernil desossado curado e três
concentrações de sal. amostras de salame tipo italiano artesanal foram
isoladas 288 cepas de bactérias lácticas. Pelo teste de
Yoon e Won (2002) estudaram a atividade antagonista inibição direta59 delas foram capazes de inibir in vitro o
de 30 cepas de lactobacilos contra Helicobacter pylori. desenvolvimento de cepas de Listeriamonocytogenes e
Lactobacillus helveticus CU631 foi selecionado como a de Staphylococcus aureus, o que demonstra que
produzem compostos inibitórios (Dabés; Santos; líticos em nenhum dos isolados de L. acidophilus
Pereira, 2000). avaliados.

Amostras de bactérias lácticas recuperadas de 336 Chioda et al (2007) realizaram-se ensaios “in vitro” para
colônias isoladas e selecionadas foram submetidas ao avaliar o grau de atividade antagonista de cinco cepas
teste de atividade antimicrobiana direta, que identificou de Lactobacillus acidophilus, com capacidade
as produtoras de substâncias antimicrobianas capazes de probiótica sobre Escherichia coli BIA 26 (STEC)
inibir in vitro o desenvolvimento de duas cepas isolada de queijo "Minas Frescal". Para tanto, foi
indicadoras de Listeria monocytogenes. As 108 cepas utilizado o teste de inibição através do método de dupla
que inibiram diretamente pelo menos uma das cepas camada em triplicata para avaliar zonas de inibição de
indicadoras receberam a denominação DTEI e foram crescimento. Todas as cepas de Lactobacillus
selecionadas para o teste de atividade antimicrobiana mostraram-se capazes de inibir &. coli com zonas de
indireta contra as mesmas cepas de L. monocytogenes, inibição variando de 12 a 15mm de diâmetro, sendo que
assim como frente a outras cepas de bactérias lácticas de a maioria apresentou 14mm de diâmetro, consideradas
origens diversas. Essa atividade inibidora indireta foi como fortes halos de inibição.
avaliada por meio de sobrenadantes isentos de células,
esterilizados por meio de microfiltração, eliminando-se A atividade antimicrobiana de uma cultura probiótica
os principais compostos responsáveis por ela, como por comercial, o Lactobacillus acidophilus La5, frente ao
exemplo, os ácidos orgânicos e o peróxido de crescimento de dois microrganismos patogênicos
hidrogênio, mediante o ajuste do pH e a liofilização dos veiculados por alimentos, Escherichia coli e
sobrenadantes. Oito cepas de bactérias lácticas Staphylococcus aureus, foi avaliada. O antagonismo da
apresentaram atividade antimicrobiana indireta frente a cultura probiótica in vitro foi avaliado utilizando tanto a
pelo menos um dos microrganismos indicadores Metodologia de Multicamadas quanto a de Difusão em
utilizados, sugerindo terem produzido substâncias Ágar. Os resultados demonstraram que a substância
semelhantes a bacteriocinas. Três destas cepas foram inibidora presente no sobrenadante é extracelular e
caracterizadas e identificadas como pertencentes ao difusível. O período de incubação da bactéria lática em
gênero Lactobacillus sp (Prado et al, 2000). caldo MRS, a 37ºC em condições de aerobiose, onde se
Alexandre et al. (2002) verificaram atividade obteve a maior produção de ácido lático (1,08 g/%) foi
antagonista de BAL, isoladas de queijo artesanal, frente 72 horas, o qual demonstrou o menor valor de pH do
Staphylococcus aureus, Listeria monocytogenes, sobrenadante (3,90), e os melhores resultados de
Salmonella enteritidis var. Typhimurium, inibição pelo método de difusão em ágar, com halos de
Staphylococcus aureus, Listeria monocytogenes e inibição de 14,75mm e 15,0mm de diâmetro para &.
Listeria innocua. Entretanto, nenhum dos isolados foi coli e S. aureus, respectivamente. O composto inibidor
capaz de inibir Escherichia coli. não foi sensível à ação de enzimas proteolíticas e ao
congelamento, mas foi totalmente inativado quando o
Garcia et al (2006) avaliaram a actividade inibitória "in sobrenadante foi neutralizado com solução de NaOH
vitro" de nove isolados de Lactobacillus acidophilus és 1N. Os resultados obtidos sugerem que atividade
da produção de bacteriocinas, ácidos orgânicos ou de inibidora observada foi decorrente da concentração de
peróxido de hidrogénio sobre bactérias patogénicas, tais ácido lático e do baixo pH do meio de cultivo do
como: Escherichia coli, Salmonella enterica. Enterica. microrganismo probiótico (Pereira e Goméz, 2007).
Enteritidis e Clostridium perfringens. Para o teste de
inibição foi utilizado o método de dupla camada para 2.3.3. O gênero Lactobacillus sp
seleccionar os isolados com capacidade inibitória e
efectuar posteriormente os testes de antagonismo "spot- Os lactobacilos foram isolados pela primeira vez por
on-the-lawn", exclusão de bacteriófagos líticos e Moro em 1900, a partir das fezes de lactentes
sensibilidade da substância antagonística a proteases, amamentados ao peito materno; este pesquisador
visando caracterizar o tipo de efeito inibitório. No teste atribuiulhes o nome de Bacillus acidophilus, designação
de inibição observaram-se halos variando entre 0 a 15 genérica dos lactobacilos intestinais. São largamente
mm, sendo em sua maioria, classificadas como inibições utilizados na preparação de uma variedade de alimentos
fortes, apresentando halos de 10 mm de diâmetro ou como culturas “starter” em queijos e outros laticínios
superiores, excepto para o isolado C13 frente a S. (Bottazzi 1988). O gênero contém o maior número de
Enteritidis a qual não foi capaz de inibir. Os isolados C1 espécies de bactérias ácido lácticas; é também o mais
e C2 apresentaram efeito inibitório sobre &. coli e C. heterogêneo compreendendo espécies com uma grande
perfringens, da mesma forma que os isolados C13 e C14 variedade de propriedades bioquímicas e fisiológicas. A
apresentaram efeito inibitório somente sobre C. heterogeneidade se reflete pela extensão do teor de mol
Perfringens, caracterizando a provável produção de % de Guanina mais Citosina das espécies incluídas no
bacteriocinas. Observou-se também que as bacteriocinas gênero que é de 32-53%.
produzidas por quatro isolados de L. acidophilus
mostraram-se sensíveis à protease utilizada, permitindo O gênero Lactobacillus apresenta morfologia variada.
o crescimento das culturas indicadoras. Os halos de Em 1919, Orla-Jensen definiu três grupos de
inibição permaneceram inalterados nos testes controles Lactobacillus que consideraram importantes, de acordo
preparados com água destilada. Demonstrou-se que a com a morfologia. Posteriormente, estudos baseados em
inibição não ocorreu pela presença de bacteriófagos
microscopia eletrônica têm permitido uma classificação (Robinson, 1991), redução da ocorrência de infecções
mais apropriada destes microrganismos (Bottazzi, do trato urinário inferior (Hilton et al., 1992), aumento
1988). da absorção de lactose em pessoas intolerantes
(Mustapha et al., 1997), tratamento de infecções e
As espécies de bactérias compreendidas pelo gênero diarréias causadas por leveduras (Rani e Khetarpaul,
Lactobacillus possuem características morfológicas, 1998), imunomodulação em pessoas com deficiência do
metabólicas e fisiológicas em comum. Elas são sistema imunológico (Donnet-Hughes, 1999) e possível
bastonetes Gram-positivo, catalase negativa, não auxílio ao tratamento de AIDS (Tihole, 1988).
móveis, não formadoras de esporos, sem citocromo,
anaeróbias facultativas, aerotolerantes, nutricionalmente Para que um Lactobacillus spp exerça o seu efeito
exigentes, tolerantes à acidez, com metabolismo benéfico desejado em humanos, além de permanecer
estritamente fermentativo, sendo o ácido láctico o viável durante sua passagem pelo sistema
principal produto do seu metabolismo de carboidratos gastrointestinal, o seu nível populacional deve ser igual
(Robinson, 1991; Jay, 1996). ou maior do que 10 milhões de células por grama de
conteúdo fecal. Para isso, deve ser ingerido diariamente,
A diferenciação entre as espécies de Lactobacillus tem para manter seus níveis artificialmente elevados no
sido feita baseando-se na determinação dos tipos de ecossistema digestivo. À exceção dos Lactobacillus
peptideoglicanos dos componentes celulares, na rhamnosus GG e Lcr35, não se conhecem probióticos
mobilidade eletroforética de algumas enzimas, análises capazes de persistirem por um longo período no trato
imunológicas de enzimas homólogas a lactato digestivo do adulto (Alander et al., 1999; De Champs et
desidrogenase, definição de grupos antigênicos, al., 2003). Entretanto vários estudos vêm demonstrando
determinação de isômeros de ácido láctico obtidos, os potenciais efeitos benéficos desses microrganismos.
fermentação de carboidratos e análise molecular de seu As propriedades de adesão e colonização de três
genoma (Botazzi, 1998; Tannock, 2003). linhagens probióticas (Lactobacillus rhamosus DR20,
Lactobacillus. Acidophilus HN017, e Bifidobacterium
Em relação ao metabolismo, podem ser classificados lactis DR10) foram determinadas in vitro usando células
como (1) homofermentativos obrigatórios: convertem diferenciadas de intestino humano (HT-29, Caco-2,
hexoses em ácido láctico via Embden-Meyerhof Parnas, HT29-MTX) e comparadas com as propriedades L.
sendo incapazes de utilizar as pentoses; (2) Acidophilus LA-1 e L. Rhamanosus GG, duas linhagens
heterofermentativos facultativos: fermentam hexoses em probióticas comerciais. Todas as três linhagens
ácido láctico, e no caso de algumas espécies e sob certas mostraram forte adesão com as células intestinais
circunstâncias, em ácidos láctico, acético e fórmico e humanas in vitro. Os índices de adesão do L.
etanol; sendo capazes de fermentar pentoses em ácidos Acidophilus LA-1 e L. Rhamnosus GG foram
láctico e acético; (3) heterofermentativos obrigatórios: comparáveis ao das outras três linhagens probióticas.
utilizam hexoses para obter ácidos láctico e acético, Também foi investigado o efeito inibitório na aderência
etanol e dióxido de carbono; e pentoses para obter das linhagens contra monocamada de células intestinais
ácidos láctico e acético (Jay, 1996; Salminem, 1999). colonizadas por uma cepa enterohemorrágica conhecida
de &. Coli (linhagem O157:H7). O pré-tratamento da
Os lactobacilos são naturalmente encontrados em &. Coli O157:H7 com um sobrenadante de células
habitats ricos, como vegetais, grãos e na microbiota do livres concentrado duas vezes e meia, de L. Acidophilus
TGI, trato respiratório superior e urogenital inferior de HN017, L. Rhamnosus DR20, e B. Lactis DR10 reduziu
espécies animais diferentes (Klender e Weiss, 1986; numero de &. Coli cultiváveis em placas TSB e também
Salminem, 1998). Também são parte da microbiota de reduziu a invasividade e a associação celular
muitos alimentos fermentados, como queijo, iogurte, característica dessa linhagem tóxica. As moléculas
kefir, salame, polvilho, azeitonas, pickles, molhos inibitórias secretadas dentro do meio utilizado por estas
ácidos, etc (Jay, 1996). linhagens foram parcialmente afetadas pelos
tratamentos com lactato desidrogenase, tripsina e
2.3.3.1. Efeitos probióticos e terapeuticos de proteinase K sugerindo que a inibição total pode se
Lactobacillus sp. dever à ação sinérgica do ácido lático e substâncias
proteinaceas (GopaL et al., 2001).
Atualmente, existem várias possibilidades de utilização
terapêutica de Lactobacillus, e comprovação de seus Interações entre linhagens probióticas de Lactobacillus
efeitos benéficos como reposição de microbiota foram investigadas in vitro. Os resultados mostraram
intestinal desejável após longa exposição a uma que a presença de Lactobacillus casei NY1301, aumenta
antibioticoterapia, auxilio na digestão e no tratamento significativamente a adesão de Lactobacillus
de doenças imunossupressoras (Donnet-Hughes, 1999), gasseriNY0509 à cultura de células Caco-2 de intestino
atuação contra Helycobacter pylori no tratamento de humano. Em contraste o L. gasseriNY0509 não afeta a
úlceras gástricas em humanos (Michetti, et al., 1999), adesão de L. caseiNY1301 (Azuma e Sato, 2001).
redução dos níveis plasmáticos de colesterol e da
ocorrência de doenças cardíacas coronarianas, Um modelo de mucosa intestinal humana foi usado para
biodegradação de nitrosaminas carcinogênicas no comparar as propriedades de adesão de quatro linhagens
intestino e auxílio ao tratamento de câncer de intestino de Lactobacillus potencialmente probióticas (L. brevi,
L. reuteri, L. rhamnosus &-800 e L. rhamnosus) com
uma linhagem probiótica extensamente investigada de O grupo que recebeu lactobacilos sofreu menos de
L. rhamnosus variedade GG. Também foi investigada a diarréia do que o grupo placebo, os episódios de diarréia
influência sobre a adesão das cinco linhagens ao modelo foram mais curtos, e eles adoeceram menos no período
de mucosa em presença de ácido e de pepsina (para de 12 meses. O estudo mostrou que a suplementação de
simular o ambiente estomacal) e para diferentes leites crianças com L. sporogenescomo uma base profilática
(desnatado, 1,5% de gordura e 1,6 – 1,9% de gordura, tem um impacto significativo de prevenção na
para simular as condições de processamento e incidência e duração da diarréia.
crescimento sobre os diferentes meios). Os efeitos
inibitórios das linhagens contra Salmonela Estudo, realizado com pacientes voluntários no Gamelli
typhimuriume &. coliforam investigados. Os resultados Hospital (Hospital Escola da Universidade Católica de
mostraram que L. brevisPEL1 e L. rhamnosusLC-705 Roma), mostra que a administração de Lactobaciluss
exibiram intermediaria e fraca adesão, respectivamente, teve um impacto positivo sobre o os efeitos colaterais
ao modelo de mucosa, enquanto as três linhagens relacionados ao tratamento contra Helicobacter pylori.
restantes mostraram significantes propriedades de Houve diminuição da diarréia, náuseas e distúrbios de
adesão. Com exceção do L. rhamnosus , todas as paladar (95%, 95% e 98% de intervalo de confiança
linhagens tiveram redução na adesão depois de expostas respectivamente), melhorando a tolerância ao
ao ácido, pepsina e leite. Nenhuma das linhagens tratamento por parte dos pacientes (Armuzzi et al.,
testadas resultou em uma exclusão competitiva de S. 2001).
Typhimuriume &. coli. Os resultados sugerem que o
meio de crescimento e a fonte da alimentação afetam A administração de Lactobacillus associado a
significativamente a adesão das linhagens (Ouwehand et Bifidobacterium e Enterococcus melhorou os sintomas
al., 2001). da Sindrome do Intestino Irritavel em 85 pacientes
Mukai et al. (2002) examinaram a competição de estudados. Essa melhora pode ser associada as
ligação do Lactobacillus reuterie Helicobacter alterações benéficas da microbiota gastrintestinal (Fan
pyloripela gangliotetrasilceramida (asialo–GM1) e et al, 2006)
sulfatide, os quais são supostamente moléculas
glicolípides receptoras de H. pylori, e identificaram uma O consumo regular de uma bebida probiótica contendo
possível proteína de ligação com o sulfatide em L. casei, L. bulgaricus e S. tthermophilus foi capaz de
linhagens de L. reuteri.Entre nove linhagens de L. reduzir a incidência de diarreia associada a
reuteri, duas (JCM1081 e TM105) mostraram ter antibioticoterapia e diarreia causada por C difficile,
ligação para a asilo-GM1 e sulfatide, e para inibir a alem de demonstrar o potencial de reducir a morbidade,
ligação do H. pyloripara ambos glicolípides. O extrato os custos com internações e a mortalidade em pacientes
de células bacteriano de linhagens TM105 tratadas com com mais de 50 anos (Hickson et al 2007).
diversos detergentes reteve a ligação para ambos
glicolípides e também inibiu a ligação com o H. pylori, Cleusix et al (2007) estudaram a atividade da reuterina,
indicando que a inibição da ligação está associada à uma substância antibacteriana producida pelo L reuteri
superfície celular. Essas observações sugeriram que a frente a um grupo representativo de bacterias intestinais.
inibição pelas linhagens selecionadas de L. Os resultados mostraram que a maioria das bactérias
reuteripodem ajudar na prevenção de infecções num intestinais testadas forma sensíveis a ação inibitória da
estágio inicial de colonização do H. pylorie propôs que reuterina.
linhagens de L. reuteri, que partilham glicolipides
específicos com o H. pylorisejam utilizadas como
probióticos. 2.3.4. Métodos de isolamento e identificação de
BAL
Estudos em crianças têm mostrado que Lactobacillus
administrados oralmente podem ter propriedades Apesar dos vários benefícios à saúde das BAL serem
antidiarréicas. O ponto central das estimativas, reconhecidos mundialmente (Bottazzi et al., 1985;
realizadas por Niel et al. (2002), indicaram uma redução Nakazawa e Hosono 1992; Wood 1992; Roissart e
na duração da diarréia de 0,7 dia (95% de intervalo de Luquet 1994; Cogan e Accolas 1996; Bottazzi 1997;
confiança: 0,3 – 1,2 dia) e redução na freqüência de Mustapha et al., 1997; Kailasapathy e Rybka 1997) e
diarréia no segundo dia de tratamento (95% de intervalo níveis desses micorganismos serem sugeridos nos
de confiança: 0,7 – 2,6 menos fezes) nos participantes produtos fermentados do leite por vários autores
que receberam lactobacilos comparados com os que (Arroyo et al., 1994; Medina et al., 1995; Shah et al.,
receberam placebo. O trabalho concluiu que 1995; Rybka e Kailasapathy, 1995), existem poucas
lactobacilos são seguros e efetivos no tratamento de recomendações metodológicas para a acurada
crianças com infecções agudas com diarréia. enumeração desses microrganismos, dessa forma
dificultam o controle de qualidade (Rybka e
Em estudo feito por Chandra (2002), 112 neonatos Kailasapathy, 1996) e não permitem o estabelecimento
saudáveis de vilas da Nova Índia foram aleatoriamente de níveis oficiais, ou metodologias oficiais para a
distribuídos para receber placebo ou 100 milhões de enumeração destes microrganismos nos produtos
Lactobacillus sporogenes diariamente por 12 meses, fermentados.
com levantamentos semanais de morbidade. Infecções
por Rotavirus causaram diarréia em 84% dos neonatos.
Monitorar o número de células viáveis de BAL ácidos acético, succínico e fórmico podem ser
probióticas nos alimentos em que os mesmos são detectados em menores quantidades em algumas
incorporados é um parâmetro fundamental para espécies (Kandler e Weiss 1986). A determinação dos
assegurar a qualidade do produto que é comercializado isolados de lactobacilos nas categorias homo e
com apelo terapêutico, entretanto, muitas vezes essa heterofermentativos (por simples observação, por
necessidade tem sido negligenciada em função da falta medida de tubo de Durham ou gás produzido à partir da
de padronização de métodos. glicose) são usuais testes fenotípicos.

Para detectar BAL em produtos lácteos, diversos Vários meios têm sido avaliados por diferentes
métodos podem ser empregados, tais como contagem pesquisadores para a enumeração de Bifidobacterium,
em placa, técnicas moleculares (baseados em DNA ou Lactobacillus e Streptococcus tanto em culturas puras
rRNA), fluorescentes ou imunológicas, bem como os quanto em culturas mistas nos produtos lácteos (Ongoo
métodos enzimáticos (Hartemink et al., 1996; Scardovi e Fleet 1993; Dave e Shah 1996; Stefano et al., 2000),
1986). Tanto para controle de qualidade de produtos contudo, é crescente o consenso de que alguns meios
lácteos como para grande maioria dos estudos da que contêm bile e antibióticos podem também restringir
microbiota fecal, o método de contagem em placa ainda o crescimento destas culturas, o que torna a contagem
é o mais utilizado, portanto, o meio de cultura utilizado total obtida nestas condições, nem sempre
deve promover o crescimento seletivo da bactéria em representativa do número verdadeiro de células viáveis
estudo, enquanto outros microrganismos devem ser presentes no produto (Dave e Shah 1996).
suprimidos. A enumeração diferencial de bactérias
probióticas é difícil devido a presença de Muitos meios seletivos para a enumeração de L.
microrganismos similares nos produtos. Como regra no acidophilus e Bifidobacterium sp. tem sido propostos
entanto, para se determinar a viabilidade e (Hunger 1986; Hull e Roberts 1984; Laroia e Martin
sobrevivência das bactérias probióticas, é muito 1991b; Dave e Shah 1996; Lankaputhra e Shah 1996;
importante a existência de trabalhos direcionados a WIjsman et al., 1989; Shah 1997a, 2000). Similarmente,
métodos para a enumeração seletiva destas bactérias muitos meios são propostos para a enumeração seletiva
(Tharmaraj e Shah, 2003). de culturas do iogurte (Onggo e Fleet 1993; Samona e
Robinson 1994), no entanto poucos trabalhos descrevem
Para se isolar Lactobacillus sp que são organismos a enumeração seletiva de L. casei na presença de outras
extremamente fastidiosos e adaptados a complexos bactérias probióticas e bactérias do iogurte (Champagne
substratos orgânicos, que requerem não somente et al., 1997; Ravula e Shah 1998). Vinderola e
carboidratos como fonte de energia e fonte de carbono, Reinheimer (1999), citam que muitos meios para a
mas também nucleotídeos, aminoácidos e vitaminas, os enumeração de L. acidophilus e Bifidobacterium sp.,
meios de cultura devem possuir pH ácido e a carne deve tanto em cultura pura quanto em produtos comerciais
ser um nutriente essencial quando o meio contém não fornecem bons resultados quando se deseja uma
carboidratos fermentáveis, peptona, extrato de levedura enumeração seletiva ou diferencial de L. acidophilus e
e extrato de carne. A suplementação dos meios com B. bifidum na presença de S. thermophilus e L.
suco de tomate, manganês, acetato e ésteres de ácido delbruekii subsp. bulgaricus (Dave; Shah, 1996).
oléico, especialmente Tween 80 é estimulante ou até
essencial para muitas espécies. Estes compostos estão Segundo Lim et al. 1995, é importante que os meios
incluídos no meio extensamente utilizado para propostos para a enumeração (diferencial ou seletiva)
crescimento e isolamento, formulado por Man, Rogosa dos microrganismos não sejam complexos ou requeiram
e Sharp (1960), o meio MRS, sendo também utilizados muito tempo para o preparo, e que ofereçam uma boa
nas formulações dos meios APT (Evans e Niven 1951) recuperação celular dos microrganismos, neste sentido,
considerado similar ao MRS, o HHD e LA utilizados muitos meios não atendem este requisito de acordo com
neste projeto. Lankaputhra e Shah 1996 devido a falta de recuperação
de uma ou mais espécies, ou por falta de seletividade
De acordo com Rasic (1990), o ágar LA (Modified (Lim et al., 1995; Pacher e Kneifel, 1996), ou
Bifidus Blood Agar), foi desenvolvido principalmente diferenciação entre colônias (Kneifel e Pacher, 1993;
para a enumeração de B. bifidum e L. acidophilus em Ghoddusi e Robinson 1996; Nighswonger et al., 1996).
cultura starter e produtos fermentados. O ágar HHD A grande demanda de trabalho, tempo e material
(Homofermentative Heterofermentative Differential existente nos procedimentos convencionais para a
Medium) foi desenvolvido para a enumeração seleção e triagem de microrganismos, dificulta a
diferencial de bactérias ácido láctica hetero e manipulação de grandes volumes de isolados. Sob esta
homofermentativas (Lapierre 1990; McDonald et al., ótica, ao longo das últimas décadas, um novo enfoque
1987). Embora muitas culturas de Lactobacillus sp vem contínua e crescentemente orientando os
usadas em laticínios possam ser cultivadas em procedimentos de rotina em laboratórios de
microaerofilia, ou em condições aeróbicas, os isolados microbiologia no intuito de simplificá-los com técnicas
intestinais proliferam-se melhor em condições mais rápidas, práticas e automatizadas.
anaeróbias. A confirmação dos isolados pertencentes ao
gênero podem ser feitos por teste de ausência de As características fenotípicas mais utilizadas na
atividade da catalase e presença de ácido lático como identificação de lactobacilos são: forma, coloração de
maior ácido produzido pela fermentação da glicose. Os Gram, arranjo, motilidade, catalase, temperatura
máxima e mínima de crescimento e fermentação de Johansson et al. (1993).
carboidratos (33 diferentes tipos) (Kandler e Weiss
1986). Algumas espécies são estreitamente relacionadas De acordo com Kneifel e Pacher (1993), que utilizaram
e só podem ser distinguidas pelo perfil eletroforético de uma metodologia fenotípica (API ZYM teste para
proteínas (lactato desidrogenase e/ou proteínas totais) atividade da #-e #-D-glucosidase), todas as culturas de
ou por métodos moleculares. Vários métodos tem sido L. acidophilus testadas apresentaram fraco a elevada
usados para a identificação de lactobacilos, incluindo-se atividade, enquanto que para as culturas L. delbrueckii
a fermentação de carboidratos pelo sistema API 50 subsp. bulgaricus e S. salivarius subsp. thermophilus o
CHL, no entanto, Schillinger (1999), em estudo de teste foi negativo. Foi observado ainda que
isolamento e identificação de lactobacilos de novos bifidobacterias de diferentes espécies e outros
produtos probióticos e iogurtes (mild), o padrão de lactobacilos tiveram diferentes reações colorimétricas
fermentação de açúcares não permitiu a diferenciação para ambas enzimas. Os autores comentam que apesar
entre L. acidophilus de espécies fenotipicamente muito do perfil obtido pelo API não ser positivo para todas as
similares como o L. johnsonii, L. crispatus, L. gasseri, culturas de L. acidophilus testadas, estas bactérias
L. amylovorus e L. gallinarum. Em seu estudo, oito mostraram colônias azuis quando foram re-examinadas
culturas capazes de crescer a 15ºC e produzir isômeros no ágar XGLU. Este efeito foi atribuído a sensibilidade
do ácido láctico DL ou L-enantiomeros foram do teste. Em contraste, todas as culturas de L.
identificadas como membros do grupo L. casei, que delbrueckii subsp. bulgaricus testadas apresentaram
compreende as espécies L. paracasei, L. casei e L. colônias brancas neste meio, sendo que nenhuma cultura
rhamnosus. Um outro aspecto ressaltado foi que de S. salivarius subsp. thermophilus produziu reação
algumas culturas designadas como L. acidophilus, no colorimétrica nos ágares que contiam X-GLU. Na
entanto, foram encontradas sendo das espécies L. conclusão do trabalho os autores mencionam que
johnsonii ou L. crispatus. quando se pretende caracterizar completamente a
microflora total dos produtos fermentados, há a
Tannock et al. (1999), identificando lactobacilos de necessidade de se ter meios de cultura seletivos válidos
diferentes origens, mencionam que os métodos para a contagem de bifidobactéria.
fenotípicos de identificação são difíceis porque
requerem, em muitos casos, determinação das A classificação dos microrganismos com base em
propriedades da bactéria além dos testes comuns de informações genéticas tem como vantagem a unificação
fermentação (por exemplo, análise da parede celular e do conceito de espécie, a estabilidade da classificação
mobilidade eletroforética da lactato desidrogenase) (que não fica dependente de modificações causadas por
(Kandler e Weiss, 1986). Em geral, em torno de 17 poucas mutações) e a obtenção de bons esquemas de
testes fenotípicos são requeridos para a identificação de identificação (Hagler e Hagler, 1991). Além do estudo
isolados de lactobacilos acuradamente em nível de dos ácidos nucléicos, outros critérios têm demonstrado
espécie (Hammes e Vogel, 1995). A necessidades de interesse taxonômico, sendo os mais importantes, a
métodos simples e rápidos de identificação são, portanto comparação entre proteínas celulares, a composição da
requeridos quando grande número de culturas obtidas parede celular, a composição de lipídios e as
durante os estudos de ecologia microbiana do trato características topográficas da ultra-estrutura celular
intestinal, silage e produtos alimentares são requeridos. visualizadas ao microscópio eletrônico (Goodfellow e
Minnikin 1985).
Reque et al. (2000), estudando Lactobacillus fermentum
para uso como probióticos em frangos, utilizou para a Informações sobre parentesco ou similaridade genética
seleção das culturas além de aspectos de biossegurança, possuem aplicações importantes em diferentes áreas da
a bacterioscopia (morfologia por microscopia), o teste ciência, permitindo identificar linhagens ou populações
de Gram, iabilidade durante a estocagem a 4ºC e que devem ser mantidas para preservar a máxima
atividade antimicrobiana (Giraud et al., 1991; Reque diversidade genética (Thormann e Osborn 1992). Os
1999). A identificação das culturas foi baseada nas procedimentos clássicos de caracterização de linhagens
características dos lactobacilos como descrito no bacterianas, que são baseados nas características
Bergey’s Manual of Determinate Bacteriology bioquímicas ou nutricionais, análise de proteínas totais
(Buchanan e Gibbsons 1974) e fermentação de ou a composição das proteínas de membrana, reações
diferentes fontes de carbono pelo API 50 CHL. Em imunológicas e do conteúdo plasmático não permitem,
publicação com seleção de culturas de Lactobacillus em geral, distinguir linhagens aparentemente da mesma
potencialmente probióticos Chang et al (2001), espécie (Le Borgeois et al., 1993). A classificação e
utilizaram para a identificação das culturas as identificação das bactérias ácido lácticas utilizando-se
características bioquímicas obtidos através dos Kits API métodos clássicos tem sido tema de muitas revisões
50CH e 32A(Bio-Merieux). Jacobsen et al. (1999), (Hammes e Vogel, 1995; Pot et al., 1994; Sgorbati et al.,
também utilizaram nos seus estudos o sistema API 1995; Apajalahti et al., 2003). Em geral, métodos
50CHL para a seleção de 47 culturas de Lactobacillus fenotípicos não são reproduzíveis e a diversidade de
sp, entretanto algumas bactérias não foram confirmadas culturas (biotipos) destas espécies são reconhecidas
pelos métodos moleculares (ITS-PCR). A caracterização (Ballongue, 1993; Hammes e Vogel, 1995; Sgorbati et
fenotípica pelo API 50CHL mostrou ser usado al., 1995). Ácidos nucléicos são universais em biologia
principalmente para selecionar as culturas para uma celular, e a seqüência de bases de nucleotídeos das
posterior caracterização, como também relatado por moléculas não são influenciadas pelas condições de
cultivo. Análises dos ácidos nucléicos deste modo, 20 anos, o uso de sondas moleculares baseadas em
provem a base dos métodos de identificação e possuem seqüências de rDNA para a identificação das bactérias
a vantagem da reprodutibilidade. Métodos genéticos são isoladas de seus meios naturais tem sido reportadas
mais promissores para uma rápida e acurada (Tannock, 1988). “Primers” (iniciadores) espécie-
identificação dos lactobacilos e bifidobacteria (Tannock, específicos para PCR que marcam os sítios das regiões
1999). A diferenciação de lactobacilos termófilos, por espaçadoras 16S-23S rRNA são disponíveis para um
exemplo, pode ser realizada por meio de perfil de limitado número de espécies de Lactobacillus. Métodos
enzimas da parede celular em gel de proteína SDS- moleculares para a identificação de espécies de
PAGE (Lortal et al., 1992), porem, diferenças entre Bifidobacterium ainda não são disponíveis. Somente a
subespécies como lactis e bulgaricus não são possíveis reassociação DNA-DNA provem reais medidas para a
de serem estabelecidas utilizando-se esta técnica identificação das espécies deste gênero. As
eletroforética. bifidobacteria podem ser diferenciadas de bactérias
similares morfologicamente pelo uso de primers para
Os métodos que permitem medir a diversidade entre PCR gênero-específicos ou por sondas de
linhagens aparentadas podem ser baseados na oligonucleotídeos (Tannock, 1999).
comparação da seqüência dos seus genomas ou da
seqüência do rRNA ribossomal 16S e a medida da Marcantes mudanças têm ocorrido na classificação
homologia DNA/DNA. Dois métodos são bacteriana desde a aplicação das tecnologias
suficientemente rápidos para analisar as numerosas moleculares. A observação das seqüências do RNA
linhagens e podem revelar as diferenças entre linhagens ribossomal 16S pode ser usada como parâmetro
de uma mesma espécie: a eletroforese de grandes evolutivo (Woese, 1987). Algumas regiões da molécula
fragmentos de DNA em campos pulsados (PFGE) e o do rRNA 16S são conservadas inteiramente em todas as
Randomly Amplified Polymorphic DNA-RAPD (Welsh espécies bacterianas enquanto outras regiões não
e McClelland, 1990; Willians et al., 1990; Tailliez et al., apresentam este padrão o que permite comparar as
1996). següências de bases dos nucleotídeos entre muitas
espécies (Collins et al., 1991; Stackebrandt e Rainey,
A filogenia de muitas bactérias são baseadas na 1995; Vandamme et al., 1996). Do ponto de vista
comparação de molécula altamente conservadas que prático, as seqüências do gene 16S rRNA (rDNA)
estão presentes em todos os microrganismos. No podem ser usados em identificações de muitas espécies
entanto, genes que codificam o RNA ribossômico bacterianas através de técnicas que utilizam sondas de
(rRNA), compreendendo regiões conservadas e variadas oligonucleotídeos específicas ou reação em cadeia da
nesta molécula, são a escolha para os estudos polimerase (PCR) (Langendijk et al., 1995; Vandamme
filogenéticos. A comparação das seqüências do rRNA é et al., 1996; WANG et al., 1996). Outras regiões do
considerada a mais poderosa e a mais acurada técnica genoma também podem ser alvos para os procedimentos
para determinação do grau de relação filogenético dos de identificação (Gurtler e Stanisich, 1996). Estas
microrganismos (Woese, 1987). Inicialmente, a informações moleculares permitem identificar
hibridização DNArRNA ou métodos seqüenciando o seguramente espécies de Lactobacillus (Tannock, 1999).
rRNA foram usados para este propósito (Axelsson,
1998; Pot et al., 1997). Técnicas de biologia molecular A comparação das seqüências do gene 16S rDNA dos
permitiram o sequenciamento de longas fitas de rRNA, lactobacilos mostra que as regiões V1, V2 e V3 contêm
primeiro pelo uso da transcriptase reversa e segundo informações espécie específicas. No entanto, para uma
pela reação da polimerase em cadeia (PCR) identificação precisa, amplificações pelo PCR e
sequenciando as moléculas 16S ou 23S rDNA, as quais sequenciamento de genes menores (menos de 750 bp)
resultaram em grandes bancos de base das seqüências. podem ser suficientes, mas o sequenciamento genômico
Com base nas informações obtidas nas seqüências total, são melhores para o estabelecimento das relações
16S/23S rRNA, árvores filogenéticas ou dendogramas filogenéticas. Os genes rRNA 16S, 23S e 5S são
foram criados. Dados do sequenciamento do 16S rRNA arranjados dentro do operon do cromossomo bacteriano.
mostram que identificações utilizando-se somente Informações da seqüência de bases nucleotídicas tem
propriedades fenotípicas como morfologia celular e tipo sido determinadas para as regiões entre os genes 16S e
de fermentação, não correspondem com o conhecimento 23S chamada de região espaçadora 16S-23S. Muitas
filogenético. Como conseqüência, certas espécies de bactérias possuem cópias múltiplas do operon rRNA por
bactérias ácido lácticas foram reclassificadas. genoma e a região espaçadora pode variar de tamanho
dentro dos diferentes operons. Isto relata o número e
O desafio para os taxonomistas é a descoberta de tipo dos genes tRNA (tRNAglu, tRNAile, tRNAala)
determinados caracteres que correlatem com o localizados em algumas regiões espaçadoras. Primers
agrupamento baseado filogeneticamente. Este tem sido para PCR que anelam-se a região conservada dos genes
extremamente importante para a nomenclatura de 16S e 23S permitem a amplificação da região
espécies sua tipagem e a caracterização de novas espaçadora (Gurtler; Stanisich 1996). Muitas vezes,
culturas probióticas. Devido a grande maioria das genes ausentes de tRNA e genes com presença de um ou
bactérias ácido lácticas serem similares em seus dois tRNA nas regiões espaçadoras são detectados, e
requerimentos nutricionais e de crescimento, sua estes podem ser purificados em géis de agarose para
identificação usando-se métodos microbiológicos subsequente sequenciamento. A seqüência de
clássicos é geralmente impossível. Durante os últimos nucleotídeos da região espaçadora de muitas espécies de
Lactobacillus tem sido determinadas. Estas seqüências crescimento, fase de crescimento e mutações
mostram que a região espaçadora é hipervariável, e espontâneas. Os métodos genotípicos são aqueles que
espécie específica. Primers de PCR, baseados nestas são baseados na análise da estrutura genética do
regiões, tem sido derivados para a identificação dos organismo e incluem o polimorfismo do DNA baseado
lactobacilos de interesse em indústria alimentar em padrões de restrição que clivam o cromossomo por
(Berthier e Ehrlich, 1998; Tilsala-Timisjarvi e enzimas que cortam o DNA em muitos fragmentos
Alatossava, 1997). Sondas de oligonucleotídeos (mais de 100) – corte freqüente, ou em 10 a 30
baseadas nas análises de domínio hipervariáveis nas fragmentos cortes infreqüentes, e a presença ou ausência
moléculas de ácidos nucléicos têm sido derivadas para o de DNA extracromossomal. Métodos genotípicos são
propósito de identificação (Schleifer et al., 1995), no menos sujeitos a variações naturais, apesar disto eles
entanto, resultados específicos e consistentes são muitas podem ser afetados por inserções ou deleções do DNA
vezes difíceis de serem estabelecidos com estas sondas, dentro do cromossomo, e ganhar ou perder DNA
como o controle da temperatura e força iônica da extracromossomal, ou mutações ao acaso que podem
solução de lavagem são críticos para obtenção dos criar ou eliminar sítios endonucleases de restrição
resultados. (Tenover et al.,1997).

Resultados apresentados por Zavaglia et al. (2000), Muitas técnicas de tipagem molecular podem ser
demonstraram que espécies identificadas como B. breve aplicadas para as BAL como instrumento para a
por fermentação de açúcares, quando analisadas por identificação de espécies ou diferenciação das culturas.
técnicas moleculares de PCR, apresentaram-se como B. As maiores vantagens dos métodos de tipagem
infantis ou B. bifidum. Portanto, para confirmação da molecular são em decorrência de seu poder
identidade desses isolados, é importante que análises discriminatório (Klein et al., 1998) e sua aplicabilidade
moleculares como homologia de DNA ou Polymerase universal. Culturas finamente relacionadas com aspectos
Chain Reaction – Random Amplified Polymorphic DNA fenotípicos similares podem ser atualmente
(PCR-RAPD) ou Restriction Fragment Length discriminadas por estas técnicas. Métodos de tipagem
Polymorphism (RFLP) sejam realizadas. moleculares aplicadas às bactérias ácido lácticas
probióticas incluem o perfil plasmidial, análises de
As técnicas moleculares são as mais indicadas para restrição enzimática (REA), eletroforese em gel em
discriminação entre espécies e estirpes diferentes dentro campo pulsante (PFGE), polimorfismo amplificado ao
de um gênero bacteriano. A técnica de eletroforese em acaso (RAPD) e a ribotipagem.
gel em campo pulsado (PFGE) tem sido utilizada para
diferenciar estirpes, embora não apresente o mesmo A tipagem molecular é uma caracterização mais
poder discriminatório ao nível de espécies. Isolados que detalhada do microrganismo, que utiliza técnicas de
apresentam o mesmo número de fragmentos de DNA biologia molecular para evidenciar uma possível relação
total, podem ser considerados geneticamente genética entre culturas de uma mesma espécie. Esta área
indistinguíveis, sugerindo que esses isolados adquiriu muita importância nos últimos anos, pois os
correspondem a uma mesma estirpe. Isolados que resultados obtidos pelas técnicas de tipagem molecular
apresentam o mesmo número total de fragmentos, mas são de grande valia para a identificação dos
de tamanhos diferentes, podem ser considerados estirpes microrganismos empregados como probióticos.
relacionadas. Embora PFGE seja uma técnica genética
laboriosa, apresenta alta sensibilidade e pode ser Inicialmente as técnicas de tipagem se constituíam de
utilizada na taxonomia polifásica de bactérias, onde são métodos que avaliavam as características fenotípicas.
combinados métodos fenotípicos e genotípicos para Nos últimos anos, com as facilidades da manipulação do
diferenciação de espécies fenotipicamente muito DNA, técnicas de tipagem molecular estão sendo
similares, mas, genotipicamente diferentes (Klein et al., utilizadas, as quais permitem produzir perfis
1998). Além disso, o perfil genético ou “fingerprint” de genotípicos. Como estes métodos examinam o DNA
bactérias probióticas obtido por PFGE constitui uma bacteriano, eles se tornaram mais reprodutíveis e
ferramenta no estudo da modulação da microbiota por discriminatórios que métodos baseados na análise de
probióticos, uma vez que esta técnica pode diferenciar características fenotípicas (Olive; Bean 1999; Pfaller et
os organismos endógenos da microbiota de organismos al., 2001).
exógenos administrados.
Várias técnicas que determinam o padrão genotípico de
Os métodos de tipagem são baseados em duas grandes diversos microrganismos estão sendo utilizadas e todas
categorias: Métodos fenotípicos e genotípicos. Os elas caracterizam-se por produzirem fragmentos de
métodos fenotípicos são aqueles que caracterizam os DNA os quais, quando submetidos a algum processo
produtos da expressão gênica para a diferenciação das eletroforético, produz um padrão (perfil) migratório
culturas. Propriedades como o perfil bioquímico, tipos característico de uma determinada cultura. Este perfil
de bacteriófagos, presença de antigenos na superfície migratório do DNA bacteriano poderá ser visualizado
celular, e perfil de susceptibilidade antimicrobiana são após o gel da eletroforese ser corado com brometo de
exemplos de propriedades fenotípicas que podem ser etídio, ou uando o gel é submetido à técnicas de
determinados em laboratório. Em decorrência deles hibridização.
envolverem a expressão do gene, estas propriedades
podem variar, baseado em mudanças das condições de O perfil migratório (análise cromossomal) pode ser feito
pela restrição (clivagem) do DNA por endonucleases de entanto, pouco satisfatória uma vez que a palavra
restrição, que são enzimas que clivam o DNA em ‘substância’ poderia incluir suplementos tais como os
seqüências específicas. A ação das endonucleases antibióticos, cuja função é virtualmente oposta.
origina fragmentos de DNA, os quais são separados por Entretanto, Fuller em 1989, (Fuller, 1989) definiu os
eletroforese. A distância migratória destes fragmentos probióticos como suplemento alimentar microbiano
mostra o polimorfismo do DNA (“Restriction Fragment vivo o qual afeta beneficamente o hospedeiro animal
Lenght Polymorphism - RFLP”), que pode ser pela melhora de seu balanço intestinal.
específico para cada cultura. O perfil migratório
também pode ser produzido pela amplificação de O conceito “probiótico” não é novo, a origem de
determinados sítios do DNA bacteriano, utilizando-se a culturas de produtos do leite foram relatadas no início
técnica da reação em cadeia da polimerase (PCR) com da civilização e menções do termo são encontradas na
“primers” (iniciadores) não-específicos (aleatórios). Bíblia e nos livros sagrados dos Hindus (Hosono, 1992).
No século 20, Elie Metcnikoff, propôs cientificamente
Os RFLPs são expressos por um perfil de bandas em gel os benefícios das bactérias do iogurte, postulando, que
de agarose ou em membranas e são comparados de as bactérias dos produtos fermentados com L.
acordo com a sua similaridade. RFLPs idênticos ou bulgaricus e S. thermophilus suprimiam fermentações
muito similares indicam culturas com mesmo conteúdo do tipo putrefativas, mantiam um equilíbrio entre
genético, ou seja, culturas idênticas (Pfaller et al., 1992; bactérias patogênicas e não patogênicas na flora
Sader et al., 1993; Denton et al., 1998; Pfaller et al., intestinal e o consumo destes iogurtes tinham um papel
2001). na manutenção da saúde e na longevidade de certos
grupos étnicos. Esta teoria conhecida como “O
Para a confirmação da identidade e classificação são Prolongamento da Vida” (The Prolongation of Life.
recomendados métodos capazes de estabelecer relações Optimistic Studies), foi atribuída aos Búlgaros que
filogenéticas, particularmente a hibridização DNA- ingeriam continuadamente estes iogurtes. Em 1905, Elie
DNA, o sequenciamento do gene que codifica o rRNA Metcnikoff identificou o L. bulgaricus e com ele
16S e o sequenciamento da região espaçadora ITS desenvolveu um fermento, que passou a ser largamente
(internal transcribed spacer) entre os genes do operon adicionado a produtos lácteos nos anos que se seguiram.
que codifica o rRNA. Essas técnicas são utilizadas hoje
por vários laboratórios, porém, exigem uma infra- Em decorrência de vários benefícios à saúde, muitos
estrutura não disponível e mesmo desnecessária em microrganismos têm sido estudados para serem
laboratórios que não trabalham diretamente com a utilizados como adjuntos dietários, para melhorarem a
manutenção de coleções de culturas microbianas. Nesse qualidade nutricional e terapêutica dos alimentos. No
caso há várias opções de técnicas de geração de entanto, alguns requerimentos são necessários para se
“fingerprints”, com diferentes graus de sofisticação e alcançar tal propósito. Na tecnologia industrial, por
capacidade discriminatória. Muitas técnicas de tipagem exemplo, durante a fermentação dos produtos, alguns
podem ser aplicadas para as bactérias ácido lácticas fatores devem ser observados, como o aparecimento de
como instrumento para a identificação de espécie ou alguns metabólitos, incluindo-se os ácidos acético e
diferenciação de culturas. As maiores vantagens dos láctico, os quais ocasionam redução do pH e podem
métodos de tipagem são em decorrência de seu poder afetar a estabilidade e as propriedades funcionais das
discriminatório (Klein et al., 1998) e sua aplicabilidade bactérias probióticas. Algumas interferências, no
universal. Culturas finamente relacionadas com aspectos entanto, podem ser controladas pois são relativas a
fenotípicos similares podem ser atualmente fisiologia da cultura, mas em decorrência do longo
discriminadas por estas técnicas. Métodos de tipagem tempo de duração do processamento e das condições de
moleculares aplicadas as bactérias lácticas probióticas estocagem dos produtos, estas alterações podem
incluem: Análises de Restrição Enzimática (REA), provocar mudanças nas propriedades probióticas das
Restriction Fragment Lenght Polymorphism Analysis culturas. Desta forma, em adição as propriedades
(RFLP), Eletroforese em gel de campo pulsado (PFGE), tecnológicas, as propriedades funcionais também devem
Polimerase Chain Reaction (PCR), Random Amplified ser consideradas para as medidas de controle de
Polymorphic DNA (RAPD), e Ribotipagem (Botelho, qualidade dos produtos (Tuomola et al., 2001). Com
2005). relação aos microrganismos, vários requerimentos
devem ser observados. Os produtos de mercado que
2.4. Probióticos mais comumente contém bactérias probióticas são os
produtos lácteos fermentados, embora boa parte das
O termo ‘probiótico’ de origem grega significa ‘para a espécies probióticas cresça pobremente em leite
vida’, e tem recebido diferentes definições ao longo dos fermentado. Assim, é usual a prática de incorporar
últimos anos. Tal termo foi inicialmente proposto por fermentos tradicionais nos produtos, como
Lilly e Stilwell em 1965 (Lilly e Stilwell 1965) como Streptococcus thermophilus e Lactobacillus delbrueckii
descritivo de compostos ou extratos de tecidos capazes subsp bulcaricus (Dave e Shah, 1996).
de estimular o crescimento microbiano; posteriormente,
Parker em 1974, (Parker, 1974) definiu probiótico como As evidências acumuladas até o momento parecem
relativo a organismos e substâncias que contribuem para indicar que essas espécies são raramente isoladas em
o equilíbrio microbiano intestinal. Esta definição era, no fezes humanas e não sobrevive bem no trato intestinal
(Gilliland, 1978; Goldin et al., 1992; Hoover, 1993). No
entanto, várias pesquisas têm demonstrado seu efeito WHO e Organização de Agricultura e Alimentos (FAO1)
benéfico sobre a saúde e bem estar do organismo é a seguinte: “microrganismos vivos, que quando
(Bogdanov et al.,1975; Shahani,1976; Bogdanov, 1977; administrados em quantidades adequadas, conferem
Shackelford, 1983; Bodana, 1990; Beshkova, 1998; benefício à saúde do hospedeiro” (Food and Agriculture
Tejada-SImon et al., 1999; Lin, 1999; Friedrich, 2000, Organization/ World Health Organization, 2002).
Terahara et al., 2000), havendo ainda controvérsias
sobre considerar ou não como probióticos os produtos 2.4.2. Características desejáveis
lácteos fermentados exclusivamente com L. delbrueckii
subsp. bulgaricus e S. thermophilus. Estes Para que um microrganismo seja selecionado e utilizado
microrganismos não são habitantes do trato intestinal de na preparação de produtos probióticos para humanos e
humanos e animais mas são normalmente isolados de animais ele precisa possuir características importantes.
materiais de plantas verdes e leite, respectivamente. Estas propriedades incluem: serem produzidos em
Estas bactérias não são altamente resistentes ao ácido e ampla escala; permanecerem estáveis e viáveis durante
bile. Somente em torno de 15% sobrevivem a passagem a estocagem; serem capazes de resistir às condições
através do estômago e em torno de 1% reage no adversas do TGI (acidez gástrica e sais biliares) e nele
intestino grosso (Pochart et al., 1989) mas não pode sobreviver, preferencialmente aderindo-se à mucosa;
colonizá-lo (Rasic, 1987). De acordo Gilliland e Speck produzir efeito benéfico ao hospedeiro (atividade
(1977a), bactérias de origem não intestinal como o L. antimicrobiana contra patógenos; reduzir a adesão de
delbrueckii ssp. bulgaricus e Lactococcus lactis são patógenos; atividade hidrolítica sobre sais biliares e
muito sensíveis a bile: concentrações menores que contribuição nutricional), modulação da atividade
0,05% são inibitórias. Por outro lado, bactérias imunológica e não ser patogênico (Fuller, 1989; Food
probióticas são resistentes a 0,15-0,3% de oxgall and Agriculture Organization / World Health
(Goldin e Gorbach 1992). Entretanto, Garvie et al. Organization, 2003).
(1984) e Kanbe (1992), em estudos com cobaias
alimentadas com iogurtes, relataram alterações na flora De acordo com Food and Agriculture Organization/
intestinal destes animais com o crescimento de World Health Organization, os microrganismos
lactobacilos e bifidobactérias, os quais afetam o tempo utilizados como probióticos apresentam relação espécie-
de trânsito intestinal e oferecem um significante específica com o hospedeiro; devem ser identificados
impacto na absorção de nutrientes. Assim, apesar das genotípica e fenotipicamente, e precisa ter seus efeitos
desvantagens referentes a sua sobrevivência, as sobre a saúde investigados, a fim de se constatar a
bactérias do iogurte podem exercer efeito benéficos in segurança do microrganismo (Food and Agriculture
vivo devido as enzimas intracelulares, aos receptores Organization / World Health Organization, 2002).
antigênicos na superfície celular ou a produção de
metabólitos durante a fermentação. Outros fatores que O interesse no uso de agentes microbianos vivos
têm sido citados para as bactérias do iogurte e outras objetivando a manutenção da saúde e a prevenção da
bactérias ácido lácticas é a inibição de bactérias doença ou seu tratamento, explodiu nos últimos anos.
patogênicas in vitro pela produção de ácidos orgânicos e Muitos destes microrganismos estão sendo propostos
substâncias equivalentes a antibióticos, entretanto, estas como verdadeiros remédios para um amplo número de
interações não tem sido claramente demonstradas in condições gastrointestinais e sistêmicas, desde a doença
vivo. diarréica à alergia e à preenção do câncer.
Recentemente, diversos livros e revisões foram
2.4.1. Definição dedicados a esse tópico (Elmer et al., 1996; Naidu,
1999; Saavedra, 2000).
A partir do conhecimento de microrganismos favoráveis
a saúde humana, em 1960, Richard Parker utilizou pela Resistência ao pH baixo do estômago e tolerância aos
primeira vez o termo probiótico, com o significado de sais biliares foram observadas em sete culturas
“a favor da vida”, de acordo com a origem grega do Lactobacillus spp. de várias origens (humana, leite e
termo. Lilley e Stillwell (1965) utilizaram este termo produtos lácteos e culturas lácteas). Lactobacillus
para descreverem substâncias secretadas por um plantarum LHI10, de origem humana, apresentou
microrganismo que estimula o crescimento de outro. melhores resultados. As amostras apresentaram variado
Posteriormente, Fuller (1989) modificou este conceito, grau de produção e sensibilidade a bacteriocinas
introduzindo nova definição para probióticos, que seria (Plockova et al., 1996).
“suplemento alimentar constituído de microrganismos
vivos capazes de beneficiar o hospedeiro através do Para resistir às condições do trato gastrointestinal
equilíbrio da microbiota intestinal”. culturas probióticas devem apresentar tolerância à bile e
atividade de hidrólise de sais biliares, além de resistir a
Salminem (1999) definiu probióticos como preparados condições ácidas e ricas de proteases no estômago.
de microrganismos, ou seus constituintes que têm efeito Adicionalmente, devem ser capazes de competir com a
benéfico sobre a saúde e o bem estar do hospedeiro. microbiota normal e resistir aos metabólitos produzidos
por membros dessa microbiota, incluindo bacteriocinas,
Atualmente, a definição de probióticos utilizada pela
1
Food and Agriculture Organization (FAO) cuja tradução para o
português é Organização para Agricultura e Alimentação (FAO).
ácidos orgânicos e outros agentes antimicrobianos os probióticos sobreviverem no alimento (Lee e
(Klaenhammer e Kullen, 1999). Bactérias probióticas Salminen, 1995). O veículo alimentar dominante para os
variam consideravelmente em seus níveis de tolerância probióticos são os iogurtes e leites fermentados, ambos
a bile. O mecanismo da tolerância e o nível mínimo apresentam relativamente baixos valores de pH no meio
aceitos para os candidatos a probiótico permanecem os quais a bactéria deve sobreviver. Conseqüentemente,
desconhecidos segundo Klaenhammer e Kullen (1999). a tolerância ao ácido é a primeira propriedade que deve
A maioria das bactérias é destruída quando passam pelo ser analisada para a seleção de culturas probióticas.
estômago humano em função da presença do suco Simples testes in vitro podem ser usados para se
gástrico que é um dos nossos melhores mecanismos de determinar esta tolerância para bactérias ácido lácticas e
defesa contra microrganismos patogênicos. culturas de bifidobactérias propostas como probióticas
nas indústrias de alimentos. Desta forma os resultados
A motilidade intestinal e o efeito inibitório dos sais obtidos nestes testes podem predizer a habilidade da
biliares dificultam a colonização no intestino delgado cultura em sobreviver em produtos ácidos.
(Naidu et al., 1999). Os microganismos ingeridos são
expostos durante o trânsito intestinal a sucessivos A validação in vivo da sobrevivência através do
fatores de stress que influenciam na sua sobrevivência estômago humano é mais difícil de ser obtida.
(Marteau et al., 1993a; Simon e Gorbach, 1987). Determinações in vitro examinando o efeito inibitório
dos ácidos biliares no crescimento de culturas
Os papéis do pH gátrico e peristaltismo gastrointestinal probióticas são também relativamente simples de
na prevenção da colonização bacteriana no intestino execução, embora novamente a extrapolação
delgado são bem estabelecidos (Heatley; Sobola 1993; quantitativa da performance in vivo seja difícil.
Simon; Gorbach 1987), entretanto, o papel da bile ainda Variações intraespécies da habilidade de crescimento em
é tópico de debate, primeiro por que a concentração de presença de bile são freqüentemente observadas entre
sais biliares no intestino não é estática, mas muda com o culturas potencialmente probióticas e testes in vitro
tempo e em diferentes partes do intestino delgado, e podem ser usados para a seleção das melhores culturas
após a refeição, a concentração deste sal nitidamente (Tuomola et al., 2001).
aumenta no duodeno (15mmol/L) e progressivamente
decresce (5mmol/L). No jejuno, a concentração é de A adesão às células do hospedeiro pode ser uma
10mmol/L e, no íleo é menor que 4mmol/L devido a característica desejável dos candidatos a probióticos,
ativa absorção ileal (Northfied e McColl, 1973). Em uma vez que possuindo esta habilidade, seus efeitos
segundo evido a formação de micelas com os podem ser mantidos por longo período de tempo, sem a
fosfolipídeos (encontrados na bile total) e, portanto, tem necessidade da contínua administração dos
alta atividade antibacteriana em relação a soluções microrganismos, como acontece com aqueles que não
artificiais do sal biliar puro (Sung et al., 1993). & permanecem no hospedeiro. A hidrofobicidade da
finalmente, in vivo, o sucessivo stress pelo ácido superfície da célula microbiana é uma característica que
gástrico e bile pode ser presumido para exercer um alto indica seu potencial de adesão às mucosas, sendo que
efeito antimicrobiano do que cada um destes parâmetros elevados valores indicam maior habilidade de adesão.
sozinhos. Esta capacidade foi alta para Lactobacillus fermentum
ssp. cellobiosus e menor para Lactobacillus animalis
A sobrevivência de microrganismos tem sido (Gusils et al., 1999).
escassamente quantificada in vivo, exceto para algumas
espécies de bactérias ácido lácticas (Berrada et al., A habilidade do Lactobacilus spp em sobreviver e reter
1991; Marteau et al., 1992; Pettersson et al., 1985; sua viabilidade através do trato é uma das principais
Pochart et al., 1992; Robins-Browne et al., 1981) devido características desejadas para a atividade probiótica
a dificuldade na amostragem do estômago humano (Kos et al. 2000). A resistência ao trânsito gástrico
(geralmente biopsias da mucosa intestinal, pois as humano tem sido demonstrada in vivo para bactérias
análises de fezes refletem somente parte da flora do ácido lácticas probióticas e constitui-se um importante
intestino grosso e são pobres indicadores da flora do critério de seleção in vitro para as bactérias probióticas,
trato gastrointestinal (Savage, 1977; Sharpe, 1981) e contudo métodos satisfatórios in vitro que simulam
devido a restrição ética, deste modo alternativas devem finamente o trânsito gástrico in vivo, não tem sido
ser adotadas in vitro para se simular tais condições e que definidos. Neste propósito a água destilada acidificada
estas possam ser utilizadas para a verificação dos com HCl, caldo e tampão tem sido usados como
critérios de seleção relatados. substituto do suco gástrico humano fresco (Suskovic et
al., 1997; Conway et al., 1987). Conway et al. (1987),
De acordo com Marteau et al. (1997), modelos de demonstraram que a bactéria sobrevive melhor em suco
validação “in vitro” permitem um rápido “screening” gástrico humano do que em tampão com pH equivalente
das bactérias probióticas. Muitos estudos investigaram a indicando que os estudos usando tampões
sobrevivência de L. acidophilus e/ou Bifidobacterium provavelmente subestimam a sobrevivência potencial in
spp. na presença de ácido e sais biliares (Conway et al., vivo.
1987; Berrada et al., 1991; Holcomb et al., 1991; Clark
et al., 1993; Clark e Martin, 1994; Lankaputhra e Shah,
1995; Marteau et al., 1997; Chou e Weimer, 1999), neste 2.4.3. Mecanismos de ação
aspecto, a tolerância ao ácido é também importante para
IgA, e células T, colaboradoras das placas de Peyer,
Os probióticos utilizados para humanos ou animais têm favorecendo o desenvolvimento de uma imunidade geral
diferentes aplicações terapêuticas ou profiláticas, como: e inespecífica. Pelo estímulo imunológico da mucosa,
tratamento de diversas disfunções gastrintestinais ocorre produção de anticorpos do tipo IgA, que
(intolerância a lactose, constipação, hipersensibilidade bloqueiam os receptores e reduzem o número de
alimentar, gastrenterite), alergias, dermatites atópicas, bactérias patogênicas na luz intestinal. Além disto,
infecções do sistema gênito-urinário inferior ou ocorre ativação de macrófagos e proliferação de células
respiratório superior (Salminem, 1998). T (Silva, 2000; Macari e Furlam, 2005).

Os probióticos podem suprimir a presença de Um aspecto de grande interesse em relação ao estudo


microrganismos indesejáveis no trato digestivo de aves dos probióticos refere-se aos seus efeitos na
atuando pela exclusão competitiva (Nurmi e Rantala, translocação (passagem de microrganismos através de
1973), por modular a atividade imunológica (Hoyos, mucosas) de patógenos e no sistema imune de
1997), por inibirem a ação de toxinas (Fuller, 1975), e hospedeiros, os quais ainda não são completamente
diminuírem a produção de aminas tóxicas e aumentarem conhecidos. Alguns probióticos poderiam afetar a
a disponibilidade de aminoácidos nos locais de absorção translocação bacteriana a partir do intestino, o que seria
(Kozasa, 1989), por economia de energia e aumento da de grande importância para evitar as infecções de
disponibilidade de vitaminas e enzimas (Fuller e Cole, origem entérica, dentre as quais a salmonelose assume
1988) e pela produção de metabólitos bactericidas, destaque na atualidade (Gil de Los Santos e Gil-Turnes,
como ácido lático (Fuller, 1975 e Bonilla, 1992). 2005).

A competição por nutrientes e espaço e a inibição de um Ewing e Cole (1994) descreveram que os lactobacilos
grupo de microrganismos por produtos de metabolismo são capazes de influenciar a atividade das enzimas dos
de outro grupo, a predação e o peristaltismo contribuem microvilos intestinais, as quais estão envolvidas no
para a regulação das populações no TGI. Como todos processo de absorção de nutrientes e, desta forma,
estes habitats são preenchidos por uma determinada beneficiam o hospedeiro.
população bacteriana que interage entre si, torna-se
extremamente difícil para microrganismos alóctones As substâncias produzidas durante o processo
(formados em outro lugar), acidentalmente ou fermentativo das bactérias lácticas contribuem não
intencionalmente introduzirem-se neste ecossistema e se somente para a conservação, como também para o
estabelecerem. Este fenômeno é definido como exclusão desenvolvimento das características sensoriais e
competitiva (Alexander, 1971). A exclusão de bactérias reológicas dos produtos (Caplice; Fitzgerald, 1999).
patogênicas pode ocorrer devido a competição por sítios Além dos ácidos orgânicos (ácido láctico e ácido
de adesão às células do epitélio do intestino delgado acético), dependendo das condições de crescimento,
(Zuanon, 1995). estas bactérias produzem outras substâncias, como o
peróxido de hidrogênio, diacetil, etanol, dióxido de
Para que um microrganismo possa exercer a sua ação carbono, aldeído e as bacteriocinas, que promovem o
probiótica em um determinado habitat, é necessário que fenômeno da antibiose, inibindo o desenvolvimento de
o mesmo se encontre em nível populacional adequado. bactérias deteriorantes e/ou patogênicas em alimentos
Muitos microbiologistas consideram que para que tais (Lindgren e Dodrogosz, 1990; De Vuyst e Vandamme,
efeitos ocorram, deve haver pelo menos 107 ufc/grama 1994a).
de conteúdo intestinal, no caso do TGI (Nicoli, 1995;
Guillot, 2001). Bacteriocinas são polipeptídeos (simples ou complexos)
antimicrobianos (Rattanachaikunsopon e
A composição da microbiota de determinada espécie Phumkhachom, 2000) sintetizados no ribossomo e
animal pode ser avaliada por exames dos secretados pela célula bacteriana (Chin et al., 2001). Seu
microrganismos existentes em suas fezes, o que mecanismo de ação é através da formação de poros na
normalmente é bastante estável (Tannock, 2003). membrana citoplasmática, o que leva a alteração de seu
Lactobacillus rhamnosus DR20 foi administrado via equilíbrio osmótico, resultando em morte celular
leite para humanos diariamente durante seis meses (Cleveland et al., 2001). Apresentam espectro de
(Tannock et al., 2000). Logo após o término do atividade amplo ou restrito contra bactérias Gram-
fornecimento do probiótico, cessou sua excreção nas positivo (De Vuyst e Vandamme 1994b), incluindo-se
fezes dos voluntários. Os níveis do probióticos foram microrganismos patogênicos importantes, como por
relativamente baixos (105a 106 ufc/g de fezes) e somente exemplo, Listeria monocytogenes, Clostridium spp.
foram irregularmente detectados nas fezes de 40% dos (incluindo C. botulinum), Staphylococcus aureus e
voluntários que já tinham populações estáveis previas Bacillus cereus. Contudo, não apresentam atividade
de Lactobacillus. contra microrganismos Gram-negativos (Hugas, 1998)
nem contra bolores e leveduras (Coventry et al., 1995).
Os probióticos podem estimular acúmulos de sistema
linfático ao longo do TGI das aves, representados pelas Além disso, essas substâncias não são consideradas
placas de Peyer, tonsilas cecais e Bursa de Fabricius. tóxicas para seres humanos, uma vez que são
Estes tecidos captam antígenos disponibilizados no trato produzidas por bactérias naturalmente presentes em
digestório, que estimulam as células B, produtoras de alimentos e são degradadas no trato digestivo por
enzimas de origem pancreática e gástrica (De Vuyst e lácteos de terceira geração, incluem os leites
Vandamme 1994c). Apresentam estabilidade ao fermentados (Tamine e Robinson, 1988; Mital e Carg,
tratamento térmico, sendo que algumas delas 1992), iogurtes (Reuter, 1990), iogurtes frescos
permanecem ativas mesmo após serem expostas às (gelados) (Holcomb et al., 1991; Modler e Villa-Garcia,
temperaturas de esterilização (Schillinger, 1990). 1993; Richardson, 1996; Laroia e Martin, 1991a), queijo
Geralmente são estáveis a pH ácido e neutro, indicando cheddar (Dinakar e Mistry, 1994; Roy et al., 1995),
que essas substâncias são bem adaptadas ao ambiente de queijo cottage (Blanchette et al., 1995), sorvetes
produção (Desmazeaud e Roissart, 1997), não afetam a (Modler et al., 1990b; Hekmat e McMahon, 1992), leite
qualidade sensorial do produto e são efetivas em baixa de soja fermentado (Valdez eGiori 1987, 1993), leite de
concentração, por exemplo, 10mg/kg (Rodgers, 2001). soja (Murti et al., 1992), entre outros.

Embora muitas bacteriocinas tenham sido isoladas e A contribuição das bactérias do iogurte na melhora da
caracterizadas nesta última década, somente um número microbiota intestinal tem sido vastamente reconhecida.
limitado tem revelado potencial comercial para efetiva A incorporação de L. acidophilus e B. bifidum nos
aplicação como bio-conservante, sendo a nisina iogurtes geram produtos de excelente valor terapêutico
produzida por Lactococcus lactis subsp. lactis a única (Tamine; Robinson, 1985). Um consumo regular de
bacteriocina purificada e aprovada para alimentos em iogurte (400 – 500g/semana) contêm 1,0 x 106 UFC/g de
diversos países, inclusive no Brasil. Ela apresenta Bifidobacterium sp. e L. acidophilus, estes por sua vez
atividade antimicrobiana contra uma grande faixa de deverão sobreviver à passagem pelo trato intestinal para
microrganismos Gram-positivos, incluindo as bactérias que possam oferecer seus efeitos terapêuticos benéficos
esporogênicas dos gêneros Bacillus e Clostridium (Tamine et al., 1995)
(Hurst, 1983).
As espécies mais freqüentemente empregadas na
Outras bacteriocinas têm sido extensivamente avaliadas produção dos produtos probióticos do leite são de
e exploradas comercialmente, como é o caso da origem intestinal humana, pois geralmente são mais
pediocina PA-1, disponível, na forma de um produto facilmente toleradas e mais adaptadas as necessidades
fermentado (AltaTM), e usada como um conservante fisiológicas do hospedeiro e podem mais facilmente
para aumentar a vida útil de produtos cárneos prontos colonizar o intestino do que culturas originárias do
para consumo e inibir o desenvolvimento de bactérias cólon de outros animais. As culturas natas incluem B.
patogênicas, principalmente L. monocytogenes. Já a adolescentis, B. bifidum, B. breve, B. infantis, B.
lacticina 3147, que é uma bacteriocina que apresenta longum, L. acidophilus, L. casei subsp. rhamnosus e
atividade em uma maior faixa de pH do que a nisina tem Enterococcus faecium (Kurmann, 1998; Hoier, 1992a).
expectativa para aplicação em alimentos não ácidos Resultados recentes com culturas de B. longum como
(Chen e Hoover, 2003; Guerra e Castro, 2002). adjunto dietético de produtos de leite com B.
Adolescentis, B. infantis tem sido considerados uma
2.4.4. Produtos carreadores de bactérias alternativa adequada (Martin, 1996; Silva et al 2004).
probióticas e microrganismos empregados em
sua formulação Muitos produtos recentemente desenvolvidos em todo o
mundo contêm uma mistura de culturas de
O consumo de leites fermentados remonta à história bifidobactérias e bactérias acidoláticas. Estas culturas
escrita, tendo sido inclusive, citado na Bíblia como mistas são formadas pelos microrganismos
alimento usado para oferecimento de Abraão a Deus ou Bifidobacterium bifidum, L. acidophilus e Streptococcus
a visitas ilustres. No entanto, somente após a II Guerra thermophilus, ou uma combinação de L. acidophilus e
Mundial é que os leites fermentados, principalmente o B. bifidum. Outras combinações encontradas apresentam
iogurte, passaram a ser produzidos em escala industrial, B. infantis e B. longum. As culturas mistas que
conquistando grande parte da população mundial. Por apresentam L. acidophilus e B. bifidum são as mais
outro lado, entretanto, desde o início de 1907, o utilizadas, pois uma simbiose entre estes
microbiologista Elie Metchnikoff (Metchinikoff, 1908), microrganismos permite uma maior velocidade de
propôs uma teoria que o consumo diário de grandes crescimento e um melhor aroma do produto terminado
quantidades de leites fermentados prolongaria a vida, (Manzanares, 1997).
muitos pesquisadores têm se empenhado no estudo dos
microrganismos empregados na elaboração de produtos Os iogurtes com culturas de L. acidophilus (incluindo-se
lácteos e no efeito destes sobre os homens e animais. espécies relacionadas como L. crispatus e L. johnsonii),
L. casei, L. paracasei e Bifidobacterium sp são
A manipulação da microbiota endógena do trato predominantes (Holtzapfel et al., 1998). Propriedades
gastrointestinal vem sendo correntemente empregada funcionais e de segurança das culturas L. casei, L.
como uma medida de introdução de novos rhamnosus, L. acidophilus e L. johnsonii tem sido
microrganismos ao trato (Driessen; e Deboer, 1989; extensivamente estudadas e documentadas na literatura
Hitchins e McDonough, 1989), para isto os bioprodutos (Salminen et al., 1998b).
alimentares tem sido empregados e são usados como
veículos carreadores destes microrganismos probióticos. Na Europa e Austrália, iogurtes contendo L. acidophilus
Esses bioprodutos também chamados de produtos e Bifidobacterium sp. são referidos como iogurtes “AB”
e a incorporação de L. casei ao produto é denominado
iogurtes “ABC”. Tradicionalmente, iogurtes fabricados
com S. thermophilus e L. delbrueckii subsp. bulgaricus Em qualquer um dos gêneros (Lactobacillus e
(culturas startes), apesar de oferecerem benefícios à Bifidobacterium), as espécies correntemente utilizadas
saúde, não são de origem natural do intestino, deste ao nível tecnológico não são consideradas patogênicas,
modo, para que o produto possa ser considerado gozando do status de Generally Recognised As Safe
probiótico, culturas de L. acidophilus e bifidobacteria (e (GRAS). O isolamento destes microrganismos de
L. casei ou ambas) devem ser incorporados como infecções tem sido reportados com baixa incidência, e
adjuntos dietéticos (Shah, 2000). Diferentes espécies e associados com pacientes imunocomprometidos (Brook
culturas são correntemente usadas nos produtos 1996; Saxelin et al. 1996).
europeus (Salminen et al., 1997; Tamine e Marshall,
1997; Anon, 1997; Obermann; e Libudzisz, 1988; Apesar da veemente comercialização dos produtos
Knorr, 1998) incluindo L. acidophilus, L. casei, L. probióticos no Brasil e no mundo, a sobrevivência das
johnsonii, L. rhamnosus, L. reuteri, L. delbrueckii culturas deixa dúvidas e gera muitas controvérsias, uma
subsp. bulgaricus, L. lactis subsp. cremoris, L. lactis vez que algumas culturas desses microrganismos são
biovar diacetylactis, B. bifidum, B. longum, B. brevis, B. extremamente sensíveis a uma série de fatores como
infantis, B. animalis, S. thermophilus os quais acidez, presença de oxigênio e outras culturas. Um outro
apresentam benefícios funcionais (Salminen et al., problema é a dificuldade e ausência de padronização de
1998c). Na Alemanha os produtos contendo L. métodos para identificação e contagem dessas culturas.
acidophilus e B. bifidum são conhecidos como iogurtes A indústria de produtos funcionais é peculiar, e a
“mild” ou bio-iogurtes. A maioria dos novos produtos colocação desses produtos no mercado, devidamente
probióticos contém culturas de L. acidophilus ou rotulados, implica não só em domínio de tecnologia,
espécies finamente relacionadas (chamadas de grupo L. mas de ciência. A comprovação dos benefícios desses
acidophilus). Culturas chamadas de grupo L. casei produtos deve ser documentada, e essas informações
compreendem as espécies L. casei, L. paracasei subsp. devem estar disponíveis para as organizações
paracasei e subsp. tolerans e L. rhamnosus têm sido governamentais, para a indústria e para os
utilizados na fabricação de iogurtes. consumidores. De acordo com Short (1999a), em geral,
o conhecimento dos consumidores para os alimentos
Os probióticos são comercializados na forma de potencialmente benéficos contendo bactérias
preparações contendo um único ou uma combinação de viáveis/probióticas é pobre. Existem muitas barreiras de
microrganismos, onde deve-se apresentar viável na comunicação sobre probióticos e o papel da dieta na
preparação e manter essa viabilidade no ecossistema modulação da flora intestinal. Entretanto, em países
digestivo, condição indispensável para a sua atuação com programas educacionais bem planejados entre
(Penna et al., 2000). Podem ainda ser comercializado na consumidores e profissionais de saúde o grau de
forma de preparações farmacêuticas em cápsulas ou qualidade tem-se elevado. No futuro, as alegações de
saches, pós, tabletes, suspensões líquidas e secas (Fooks saúde podem ajudar a informar os consumidores dos
et al., 1999). Em produtos liofilizados a manutenção da potenciais benéficos, mas é crucial que uma
viabilidade durante longo período de armazenamento normatização apropriada da comunicação, como a
em temperatura ambiente são obtidos, o que não é desenvolvida na União Européia, pela Confereration of
possível para os produtos fermentados do leite, onde a the Food Industries of the European Union – CIAA,
refrigeração é indispensável, e o tempo de vida dos sejam adicionadas e que todas as alegações sejam
microrganismos é reduzido (Fuller ,1992). cientificamente substanciais (Confereration of the Food
Industries of the European Union, 1999).
Além dos benefícios em termos de nutrição e de saúde
que proporcionam, os microrganismos probióticos 2.5. O modelo animal e a avaliação de
podem também contribuir para melhorar o sabor do microrganismos probióticos
produto final, possuindo a vantagem de promover uma
acidificação reduzida durante a armazenagem pós- Uma importante estratégia experimental para estudar as
processamento (Gomes e Malcata, 1998d). relações que ocorrem entre os microrganismos e seus
hospedeiros é a utilização de um modelo animal isento
Atualmente no mercado mundial estão disponíveis mais de germes. Neste caso, deve-se, primeiro, definir as
de 100 produtos diferentes contendo bactérias bífidas, e funções celulares na ausência de microrganismos e
cerca de 50 indústrias de laticínios estão depois avaliar os efeitos da adição de um único
comercializando produtos bífido-acidophilus, os quais microrganismo ou de uma população definida de
são produzidos essencialmente no Japão e Europa microrganismos. A criação de animais sob condições
(Gomes e Malcata, 1998c; Ferreira, 2003). Nos isentas de germes tem desenvolvido um campo
mercados japonês e europeu, a tendência é utilizar científico para este propósito, a gnotobiologia. O termo
novas estirpes probióticas e misturas mais complexas. gnotobiótico foi proposto para designar o campo de
Em outros mercados, como nos EUA e Brasil, a maioria investigação interessado na criação de animais e plantas
dos produtos probióticos contêm estirpes de L. que estão livres de todos os microrganismos ou
acidophilus e de Bifidobacterium sp. Tem-se observado, associados somente a espécies conhecidas (Trexler,
no entanto, o crescimento de produtos com outras 1978). A palavra gnotobiologia é derivada do grego
estirpes probióticas das espécies L. casei e L. onde, “gnotos” e “biota” significam, respectivamente,
rhamnosus.
flora ou fauna e conhecida (Gustafsson, 1948). Os
animais isentos de germes são, de um certo modo, uma O experimento gnotobiótico oferece considerável
extensão do conceito de cultura pura, permitindo o potencial como uma ferramenta no estudo das relações
estudo das interações do hospedeiro com os hospedeiro-microrganismo porque: retrata o hospedeiro
microrganismos sem a interferência dos organismos quando livre de germes, ou quando modificado por
associados (Gordon e Pesti, 1971; Trexler, 1978). microrganismos conhecidos ou outras associações;
permite o estudo da relação inter-microbiana dentro do
A tecnologia da gnotobiologia depende da habilidade de organismo do hospedeiro; pode ser usado no estudo de
controlar a composição do ambiente no qual o algum fator exógeno ou endógeno onde as ações
organismo se desenvolve e funciona. O uso combinado isoladas de tais fatores, afetadas ou não pela microbiota
de organismos geneticamente manipulados e associada no hospedeiro, é de interesse (Gordon e Pesti,
gnotobióticos têm o potencial de fornecer novas e 1971). Esses modelos são necessários, pois o estudo das
importantes informações sobre como uma bactéria afeta interações entre linhagens bacterianas in vitro não pode
o desenvolvimento normal, o estabelecimento e a ser sempre extrapolado ao que realmente ocorre in vivo
manutenção do sistema imune associado à mucosa e as no tubo digestivo de animais gnotoxênicos (Ducluzeau,
funções célula-epitélio. Além do mais, a gnotobiologia 1989). Esses animais também são uma excelente
pode ajudar no estudo sobre as etiologias de doenças ferramenta para avaliar quais são as mudanças
infecciosas, condições inflamatórias agudas e crônicas anatômicas, fisiológicas e imunológicas induzidas pela
(Fedorak, 1995; Sartor, 1995) e, possivelmente, em microbiota autóctone e alóctone na mucosa intestinal
tumorigênese (Gorbach e Goldin, 1990). (Nicoli, 1995).

Desde a década de 1950, quando a produção de ratos e Inúmeras tentativas vêm sendo feitas para sistematizar a
camundongos isentos de germes foi estabelecida, o uso terminologia usada em gnotobiologia, mas nenhum
desse modelo animal nas ciências biomédicas vem se sistema é universalmente aceito. A nomenclatura usada
expandindo. Entretanto, o estado isento de germes dá é limitada a termos que, por uso geral, é familiar e
origem a uma variedade de aspectos fisiológicos, compreendida pela maioria dos pesquisadores da área.
morfológicos e imunológicos diferentes daqueles Animal isento de germe (IG) ou axênico é um animal
encontrados na presença da microbiota normal. Esses livre de toda forma demonstrável de vida, sendo criado
animais possuem um grande aumento do ceco devido, e mantido continuamente em isoladores. O animal
em grande parte, ao acúmulo de muco que não é gnotobiótico (GN) ou gnotoxênico é aquele inicialmente
degradado (Gustafsson et al., 1970). As vilosidades do axênico mantido em isoladores em associação
intestino delgado são maiores e as criptas são mais intencional com um ou mais tipos microbianos
curtas e contem menos células (Alam et al., 1994). As conhecidos. Animal heteroxênico é um animal
diferenças entre os animais convencionais e os animais inicialmente isento de germes, mantido em isoladores
isentos de germe são maiores nas regiões do trato em associação com uma microbiota complexa
digestivo onde as densidades microbianas são conhecida ou não e que não é da própria espécie. O
normalmente maiores (Falk et al., 1998). animal holoxênico ou convencional (CV) apresenta uma
microbiota complexa e desconhecida na sua totalidade e
Além das diferenças na arquitetura geral do trato é criado sem precauções especiais desde o nascimento.
digestivo, os animais isentos de germes apresentam O animal convencionalizado é o animal ex-isento de
diferenças na motilidade intestinal, na diferenciação germes que foi associado com uma microbiota normal
epitelial e na imunologia. A distribuição espacial e de animais convencionais (Andremont et al., 1985;
temporal dos complexos motores que migram no Gordon e Pesti, 1971; Gustafsson, 1984).
intestino delgado desses animais é mais restrita e mais
lenta que em animais convencionais (Strandberg et al., Os equipamentos e procedimentos correntemente em
1966). Estudos em camundongos isentos de germes uso que permitem a manutenção do “status”
mostraram que a morfogênese de unidades de gnotobiótico em animais experimentais incluem, em
vilosidades da cripta pode ser completada na ausência essência, equipamentos para transferência do feto
de microrganismos. Entretanto, comparações entre esses maduro do útero para o interior de isoladores de
animais e os convencionais revelaram que componentes plástico, estéreis, supridos com filtros de ar e luvas de
da microbiota podem diferenciar linhagens intestinais borracha. Procedimentos de rotina incluem criação e
epiteliais durante a morfogênese (Falk et al., 1998). manutenção de animais gnotobióticos em isoladores,
esterilização de dietas, água, cama e outros utensílios,
Os camundongos isentos de germe representam um por autoclavação, irradiação ou filtração, quando
sistema experimental para simplificar o fenômeno de aplicável (Ducluzeau, 1989).
resistência à colonização e os mecanismos envolvidos
nesse fenômeno e também para testar a capacidade de Como os animais gnotobióticos permitem o estudo e
uma terapia à base de probióticos para prevenir ou reprodução de mecanismos de interação entre
impedir a colonização por patógenos. Muitos estudos microrganismos e hospedeiro, que não observados por
mostram que os animais isentos de germes, quando meio de experimentos in vitro (Gordon e Pesti, 1971),
infectados por patógenos podem, em alguns casos, se eles constituem um excelente modelo na avaliação do
mostrarem mais resistentes e, em outros, mais potencial probiótico de certos microrganismos (Filho-
susceptíveis (Vieira et al., 1998). Lima et al., 2000; Maia et al., 2001; Nardi et al., 1991;
Neumann et al., 1998; Nicoli e Raibaud, 1990; Peret (cepa BBSC 01), protegendo o hospedeiro da invasão à
Filho et al., 1998; Rodrigues et al., 1996; Rodrigues et mucosa intestinal das fêmeas grávidas do parasito.
al., 2000; Silva et al., 1999). Foram utilizados dez camundongos BALB/c,
distribuídos ao acaso em dois grupos: Grupo C ou grupo
A capacidade de Lactobacillus acidophilus UFV-H2B20 controle e Grupo T ou grupo tratados com L. casei. Ao
de antagonizar Salmonella enterica subsp. enterica ser. alimento do grupo C, foram inclusos 5 mL de solução
Typhimurium, e de reduzir as conseqüências patológicas fisiológica durante sete dias antes da infestação com
para o hospedeiro foram determinadas em animais larvas de T. spiralis. O Grupo T recebeu alimentação
convencionais e gnotobióticos. Camundongos NIH normal, diariamente, acrescida de 5mL de suspensão em
convencionais receberam diariamente, por via oral, 0,1 solução fisiológica de L. casei durante sete dias, com
8 larvas infestantes de T. spiralis. Ao oitavo dia, ambos os
ml de uma suspensão contendo em torno de 10 ufc de
grupos (C e T) foram inoculados via oral com larvas
L. acidophilus UFV-H2B20 e os animais sem germes
infestantes de T. spiralis. Aos cinco dias após infestação,
receberam uma única dose de 0,1 ml. Os grupos
os animais foram sacrificados para determinação da
gnotobióticos e convencionais foram desafiados
2 carga parasitaria presente no intestino e na mucosa
oralmente com, respectivamente, 10 e 105 ufc de S. intestinal (fêmeas). O número médio de parasitos
Typhimurium 7 dias após o início do tratamento. Os adultos de T. spiralis recuperados do conteúdo intestinal
grupos controles foram tratados com salina estéril em no grupo controle foi de 147, enquanto que no grupo
vez do Lactobacillus. Dados de sobrevida mostraram tratados foi de 189, apresentando diferenças
um efeito protetor contra a bactéria patogênica em significativas para p<0,05 entre ambos os grupos
ambos os grupos convencional e gnotobiótico tratados analisados. O valor promédio de fêmeas recuperadas no
com o Lactobacillus. L. acidophilus UFV-H2B20 Grupo C foi de 81 enquanto no grupo T foi de 12
colonizou o trato digestivo dos camundongos fêmeas, apresentando diferenças altamente
gnotobióticos e o número de células víaveis flutuou significativas para p<0,05. Os resultados obtidos
entre 109 e 1010 ufc/g de fezes. Em ambos os grupos indicam que o L. casei administrado pela via oral
experimental e controle, S. Typhimurium se estabeleceu produz um efeito antagônico sobre a penetração do
rapidamente numa faixa de 108 a 1010 ufc/g de fezes e se parasito na mucosa intestinal.
manteve em níveis elevados até os animais morreram ou
serem sacrificados. Em conclusão, o tratamento prévio Os efeitos de S. cerevisiae 905 na translocação de Salm.
de camundongos com L. acidophilus UFV-H2B20 Typhimurium assim como no sistema imune foram
protege os animais contra a infecção experimental com avaliados em camundongos gnotobióticos e/ou
S. Typhimurium, mas essa proteção não se deve à uma convencionais. O tratamento com a levedura reduziu
redução das populações patogênicas nos intestinos significativamente a translocação de Salm.
(Moura et al, 2001) Typhimurium para o fígado em animais gnotobioticos e
em todos os orgãos testados em camundongos
A produção de substâncias antagonistas por convencionais. O número de células Küpffer por 100
Lactobacillus murinus contra bactérias hepatocitos no fígado foi significativamente mais alto (P
enteropatogênicas foi avaliada in vivo assim como um <0.05) em camundongos mono-associados com
possível efeito protetor contra um desafio oral com levedura (52.9±15.7) do que nos animais controles
Salmonella Typhimurium utilizando um modelo animal isentos de germes (38.1±9.0). Provavelmente como
gnotobiótico. Um maior tempo médio de sobrevida (P < consequencia, o “clearance” de &. coli B41 da
0,05) foi observado nos animais associados com L. circulação sangüínea foi mais eficiente em animais
murinus (7,89 ± 3,83 dias) quando comparado com os mono-associados de levedura quando em comparação
controles (4,44 ± 0,73 dias). Lactobacillus murinus com animais isentos germe. Os mais altos níveis (P
exerceu um potente efeito antagonista in vivo contra S. <0.05) de IgA no conteúdo intestinal e de IgA e IgM no
sonnei e com menos intensidade contra S. Typhimurium soro foram observados em ratos mono-associados com
como revelado pelos halos de inibição ao redor das levedura quando em comparação com o grupo isento de
fezes dos animais associados com L. murinus. Os germe. A proteção contra bactérias patogenéticas
diâmetros dos halos de inibição ao redor dos conteúdos observadas foi provavelmente devido a uma modulação
intestinais aumentaram ao longo do trato digestivo, tanto da imunidade local como de sistêmica de
seguindo proporcionalmente os níveis populacionais de camundongos tratados com S. Cerevisiae 905 (Martins
L. murinus nas respectivas porções intestinais. et al, 2007).
Concluindo, o presente estudo mostra que a associação
com L. murinus em camundongos gnotobióticos retarda 3. MATERIAIS E MÉTODOS
a morte após um desafio oral com S. Typhimurium e
que compostos inibitórios difusíveis obtidos em ensaios
in vitro foram também produzidos in vivo e podem ser 3.1. Amostragem e produção de queijo de
responsáveis por este efeito (Vasconcelos, Nicoli e coalho estudados
Nardi, 2003).
Foram realizadas visitas aos locais de produção dos
Randazzo e Costamagna (2005) avaliaram se a ingestão queijos de coalho com a finalidade de acompanhar os
oral de Lactobacillus casei exerce uma ação antagônica processamentos artesanais e industriais e caracterizar os
na infestação de camundongos com larvas de T. spiralis
seus fluxogramas de fabricação (Anexo A). Foram A acidez titulável, em acido láctico percentual será
colhidas e analisadas seis amostras de queijo de coalho calculada de acordo com a seguinte fórmula: AT = V x f
produzido no estado de Pernambuco, compreendendo x 0,90
diferentes municípios e marcas e levando-se em M
consideração o prazo de validade. Duas amostras de
queijo de coalho artesanal e duas do produto Onde:
industrializado serão colhidas nas respectivas fazendas e V= volume da solução de NaOH gasto na titulação;
indústrias onde são processadas, logo após a produção, F= fator de correção da solução de hidróxido de sódio
enquanto que as outras duas amostras de queijos 0,1 N;
artesanais, de marcas diferentes, serão colhidas no M= massa da alíquota, em gramas
mercado varejista de Recife. Em seguida, as amostras
serão acondicionadas em caixas isotérmicas e mantidas 3.2.2. Determinação do extrato seco total (EST)
sob refrigeração com gelo, para serem transportadas, via e umidade - método gravimétrico
aérea, para Belo Horizonte (Minas Gerais).
Imediatamente após a recepção das amostras, as Cápsulas serão colocadas em estufa a 105 + 2 ºC
mesmas serão avaliadas quanto à preservação de sua durante 1 hora. Em seguida, serão resfriadas em
integridade e temperatura na qual foram conservadas. dessecador e pesadas. Cinco gramas de cada sub-
Cada amostra de queijo será assepticamente dividida em amostra serão preparadas e homogeneizadas e levadas à
cinco partes equivalentes. Logo após, uma sub-amostra estufa a 105+ 2 ºC durante 3 horas. Logo após, será
de cada amostra de queijo de coalho será encaminhada esfriada em dessecador e pesada. Esta etapa será
para os seguintes laboratórios: Laboratório de repetida até peso constante. As operações de pesagem
Microbiologia e Físico-Química do Departamento de devem ser feitas o mais rápido possível e a secagem
Tecnologia e Inspeção de Produtos de Origem Animal deve ser conduzida sem que haja escurecimento da
(DTIPOA) da Escola de Veterinária da Universidade amostra.
Federal de Minas Gerais (UFMG); Laboratório de
Ecologia e Fisiologia de Microrganismos do Determinação de lipídeos de acordo com butirômetro
Departamento de Microbiologia, do Instituto de para queijos.
Ciências Biológicas (ICB) da UFMG; Laboratório de
Biologia Molecular de Parasitos do Departamento de Serão pesados exatamente 3 g de cada sub-amostra,
Bioquímica e Imunologia, do ICB - UFMG; Laboratório sendo homogeneizadas diretamente no copo do
de Microbiologia de Alimentos da Fundação Ezequiel butirômetro, acoplando o copo do butirômetro à parte
Dias e Laboratório de Enterotoxinas Estafilocócicas da inferior de forma a ficar bem vedado. Em seguida serão
Fundação Ezequiel Dias, onde serão submetidas às adicionados cerca de 5 mL de água, 10 mL de ácido
análises laboratoriais descritas posteriormente. Uma sulfúrico e 1 mL de álcool isoamílico. Os butirômetros
sub-amostra será mantida congelada a -18ºC, como serão transferidos para banho-maria a 65 ºC para
medida de segurança para qualquer análise a ser auxiliar na dissolução da amostra. Os butirômetro serão
substituída e/ou incluída durante a realização do tampados e agitados até que se dissolva toda a amostra.
experimento. Realizar esta agitação cuidadosamente, envolvendo o
butirômetro em uma toalha de mão para evitar
3.2. Determinação de Características e acidentes. Quando as amostras apresentarem-se
Composição Físico-Químicas de Queijo de dissolvidas, as tampas superiores dos butirômetros serão
Coalho produzido em Pernambuco retiradas e adicionara-se água até a última marcação
destes. As bordas dos butirômetros serão secas com
Sub-amostras dos seis queijos serão encaminhadas para papel absorvente e recolocaram-se as tampa. Em
o laboratório de físico-química do DTIPOA - EV - seguida, os butirômetros serão centrifugados por 5
UFMG, onde serão submetidas às análises físico- minutos e assim, serão feitas as leituras da porcentagem
químicas, descritas a seguir (Brasil, 2003). de gordura diretamente na escala do butirômetro.

3.2.1. Determinação da acidez titulável 3.3. Isolamento, Enumeração, Caracterização


Fisiológica e Purificação de Bactérias Ácido-
Serão transferidos 10 gramas de cada sub-amostra para Lácticas de Queijo de Coalho Artesanal e
bécker de 150 mL, onde serão acrescentados 50 mL de Industrial, produzido no Estado de Pernambuco
água deionizada morna (40ºC), isenta de gás carbônico,
sendo agitado até a máxima dissolução possível. O Sub-amostras de cada queijo serão encaminhadas para a
volume será quantitativamente transferido para balão pesquisa de bactérias ácido-lácticas (MAC FADDIN,
volumétrico de 100 mL, resfriado em água corrente e 1980; IDF, 1983), a ser realizada no laboratório de
completado o volume com água deionizada. Uma Ecologia e Fisiologia de Microrganismos do ICB -
alíquota de 50 mL será transferida para bécker de 150 UFMG. Vinte e cinco gramas de cada sub - amostra
mL, acrescentadas 10 gotas de solução de fenolftaleína serão pesadas, trituradas e diluídas em 225 mL de salina
a 1% e titulada com solução de NaOH 0,1 N, até leve tamponada (0,85%), correspondendo à diluição 10-1.
coloração rósea. Em seguida, serão preparadas diluições decimais até
10-8, utilizando-se o mesmo diluente descrito
anteriormente. Industrial, produzido no Estado de Pernambuco
A partir de cada uma das diluições realizadas, uma
alíquota de 0,1 mL será semeada na superfície de placas Seis sub-amostras, sendo uma de cada queijo de coalho,
de Petri contendo os meios de cultura ágar MRS serão encaminhadas, sob refrigeração, para a pesquisa
(Merck) e ágar M17 (Difco), suplementado com solução de bactérias patogênicas, a ser realizada no laboratório
de lactose (Oxoid) a 10%. Em seguida, os inóculos de Microbiologia de Alimentos da Fundação Ezequiel
serão espalhados com auxílio de uma alça de Drigalski. Dias.

O meio de cultura MRS (Merck) será incubado a 37ºC, 3.4.1. Pesquisa de coliformes a 30ºC - tubos
durante 48 horas, em anaerobiose, dentro da câmara múltiplos (APHA, 2001)
anaeróbia (Forma Scientific, Marietta, USA: Atmosfera
85% N2, 10% H2 e 5% CO2), enquanto que o meio de Vinte e cinco gramas de cada amostra serão pesadas e
cultura M17 (Difco) será incubado a 37ºC, durante 48 diluídas em 225 mL de água peptonada tamponada. Em
horas, em aerobiose, dentro da estufa bacteriológica. seguida, serão feitas diluições decimais e inoculado 1
mL de cada uma em tubos contendo caldo lactosado bile
Após a incubação, será realizada a enumeração dos verde brilhante (Difco). Os mesmos serão incubados a
microrganismos por unidades formadoras de colônias 30ºC, durante 48 horas. A presença de gás nos tubos de
(UFC), sendo consideradas placas contendo de 20 a 200 Duhram invertidos sugere a presença de coliformes.
UFC. Em seguida, será realizado o cálculo de UFC/mL,
multiplicando-se o número de colônias formadas por 10 A seguir, amostras do caldo anterior, onde houver
e pelo inverso da diluição. produção de gás, serão repicadas em ágar EMB-
LEVINE (Biobrás), sendo incubadas a 30ºC, durante 48
A partir de colônias apresentando aspectos morfológicos horas, para a confirmação do resultado anterior. O
diferentes, de cada meio de cultura, serão feitos crescimento de colônias de microrganismos confirma o
esfregaços em lâminas para coloração pelo método teste.
Gram.
A determinação do Número Mais Provável (NMP) de
Além disto, a partir dessas mesmas colônias serão feitos coliformes a 30ºC será realizada utilizando-se a tabela
testes de catalase, sendo colocada uma gota de H2O2 de Hoskins (APHA, 2001).
(30%) peróxido de hidrogênio (PA) sobre a superfície
de uma lâmina. Em seguida, será colocada, sobre a gota, A identificação das espécies que crescerem no ágar
uma alíquota de cada colônia a ser testada. A produção EMB-LEVINE (Biobrás), será feita por intermédio de
de gás, sob a forma de bolhas, indica que o provas bioquímicas, utilizando-se o meio IAL (Rugai
microrganismo é produtor da enzima catalase, que, atua modificado) (Merck).
sobre o peróxido de hidrogênio, convertendo-o à água e
oxigênio.
3.4.2. Pesquisa de coliformes a 45ºC (APHA,
As colônias que apresentaram tipos morfológicos
2001)
diferentes serão repicadas em triplicata para placas de
Petri contendo ágar MRS (Merck) e ágar M17 (Difco) Alíquotas de caldo lactosado bile verde brilhante
(Difco) dos tubos contendo microrganismos produtores
(suplementado com lactose a 10%). As placas serão
incubadas a 37 ºC por 48 horas, sob tres condições de de gás, serão semeadas em tubos contendo caldo EC
(Merck). Os mesmos serão incubados a 45ºC, durante
cultivo: aerobiose, microaerofilia e anaerobiose.
48 horas. A presença de gás nos tubos de Duhram
invertidos, indicará a presença de coliformes a 45ºC.
Os microrganismos que cresceram nos meios de cultura
iniciais serão inoculados em 5 mL de Caldo MRS A determinação do Número Mais Provável (NMP) de
(Merck), sendo em seguida incubados em anaerobiose coliformes a 45ºC será realizada utilizando-se a tabela
(oriundos do ágar MRS) e aerobiose (oriundos do ágar de Hoskins (APHA, 2001).
M17), à 37ºC durante 48 horas. Após o crescimento,
uma alíquota de 500 µ L de cada tubo será transferida A identificação das espécies que crescerem no caldo EC
para tubo eppendorf e adicionada de glicerol (Merck) e produzirem gás será feita por intermédio de
esterilizado (50 µ L), sendo em seguida congelados a – provas bioquímicas, utilizando-se o meio IAL (Rugae
70ºC, para posterior utilização, quando necessário. O modificado) (Merck).
restante dos cultivos será destinado à biologia
molecular, com a finalidade de identificação das 3.4.3. Pesquisa de Escherichia coli O157:H7
espécies isoladas. (Food and Drugs Administration, 2001)
3.4. Isolamento, Enumeração, Purificação e Vinte e cinco gramas de cada sub-amostra serão pesadas
Identificação de Microrganismos Patógenos e diluídas em 225 mL de caldo TSB (caldo soja
(Coliformes a 30ºC e 45ºC, Escherichia coli tryptcase, suplementado com novobiocina) (Merck). Em
O157:H7, Salmonella spp., Listeria spp.) seguida, os mesmos serão incubados a 37ºC, durante 24
presentes em Queijo de Coalho artesanal e horas. De cada caldo incubado anteriormente, 0,1 mL
será espalhado sobre a superfície de placas de Petri,
contendo ágar MacConkey (Merck), adicionado de 3.5. Isolamento, Enumeração, Purificação e
sorbitol. As placas serão incubadas a 37ºC, durante 24 Identificação de Staphylococcus spp. e suas
horas. As colônias típicas que crescerem (transparentes) Enterotoxinas (Carmo, 2001)
serão submetidas à identificação por provas
bioquímicas, utilizando-se o cartão Vitek. Seis sub-amostras, sendo uma de cada queijo de coalho,
serão encaminhadas, sob refrigeração, para a pesquisa
3.4.4. Pesquisa de Salmonella spp. (APHA, de Staphylococcus spp. e suas enterotoxinas, a serem
2001) realizadas no laboratório de Enterotoxinas
Estafilocócicas da Fundação Ezequiel Dias.
Vinte e cinco gramas de cada sub-amostra serão pesadas
e diluídas em 225 ml de caldo nutriente (Difco), que 3.5.1. Isolamento e identificação do
será incubado a 37ºC, durante 24 horas. De cada caldo microrganismo
anterior, 1 mL será inoculado em 10 mL de caldo
selenito cistina (Merck) e 0,1 mL em 10 mL de caldo
Rappaport (Difco), que serão incubados a 37ºC, durante Sobre a superfície do ágar Baird Parker (Oxoid)
24 horas. Amostras destes caldos serão semeadas na contido nas placas de Petri, será espalhado 0,1
superfície de placas de Petri, contendo ágar Hecktoen mL de cada diluição preparada em série, para
(Merck), ágar Ramback (Oxoid) e ágar XLD (Synth) e cada sub-amostra de queijo, e espalhadas, até
ágar SS (Salmonella - Shigella) (Oxoid), que serão completa absorção, com auxílio de alça de
incubados a 37ºC, durante 24 - 48 horas As colônias que Drigalski, esterilizada ou previamente imersa em
crescerem nestes meios de cultura serão repicadas para álcool e flambada. As placas serão mantidas em
ágar LIA (ágar lisina ferro) (Merck), TSI (ágar tríplice posição normal por alguns minutos para assegurar
açúcar ferro) (Merck) e IAL (Rugae modificado) a absorção do inóculo, sendo então, incubadas a
(Merck), sendo incubadas a 37ºC, durante 24 - 48 horas. 35-37°C durante 48 horas.
A identificação das espécies será feita por intermédio do
cartão Vitek.
Colônias típicas e atípicas serão selecionadas para
confirmação, através da confecção de esfregaços
3.4.5. Pesquisa de Listeria spp. (IDF 1995;
corados pelo método de Gram, da presença de cocos
SILVA, 1996). Gram positivo. Serão selecionadas, de preferência, as
placas que apresentaram contagens entre 25 e 250
Vinte e cinco gramas de cada sub-amostra serão pesadas
colônias suspeitas de Staphylococcus e confirmadas pela
e diluídas em 225 mL de caldo de enriquecimento
prova do Gram. As colônias que apresentarem coloração
primário para Listeria LEB 1 (“Listeria Enrichment
negra brilhante, forma arredondada, convexa, com
Broth”) (Difco), sendo então, incubados a 30ºC, durante
bordos regulares, puntiformes, circundados por um halo
48 horas. Em seguida, alíquotas do cultivo anterior
branco de lipase e um outro externo, maior,
serão semeadas, por estria, na superfície de ágar Oxford
transparente, devido a ação da lecitinase, serão
(Oxoid) e ágar Palcam (Oxoid).
selecionadas como colônias típicas. As colônias que se
apresentarem sem halo, ou com apenas um, negras ou
A partir dos meios Oxford (Oxoid) e Palcam (Oxoid),
cinza, mucosas com ou sem brilho serão selecionadas
cinco a oito colônias que apresentarem crescimento
como atípicas. Após contagem das placas selecionadas,
típico (colônias pequenas, cinza e ou negras, convexas e
serão anotados separadamente os resultados obtidos
de contornos regulares) serão repicadas para ágar TSA
para colônias típicas e atípicas. O resultado será
(ágar tríplice açúcar) (Merck), adicionado de 0,6% de
multiplicado pelo inverso da diluição e por 10,
extrato de levedura e incubadas a 37ºC por 24 horas,
resultando em UFC de Staphylococcus spp. por mililitro
para purificação. Após crescimento, colônias típicas
do produto (Lachica et al.; 1969; Lancette e Tatini,
(pequenas, regulares, com aparência azulada) serão
1992).
submetidas aos testes bioquímicos para confirmação de
Listeria spp.
3.5.2. Caracterização bioquímica
Os testes para identificação de Listeria spp. e das
Diferente número de colônias, de preferência de
diferentes espécies do gênero Listeria baseiam-se na
diluições mais altas e representativas de cada amostra
reação de hemólise em ágar sangue de carneiro,
analisada, será pescado das placas contendo ágar Baird
motilidade (característica em ágar semi-sólido),
Parker (Oxoid) após a confecção do teste de Gram, e
utilização da esculina, hidrólise da uréia,
transferidas com auxílio de alça de platina previamente
comportamento em ágar TSI (ágar tríplice açúcar ferro)
flambada, para tubos de hemólise contendo 1,0 mL de
(Merck), teste da catalase, redução de nitrato a nitrito,
Caldo Infuso Cérebro Coração (BHI) (Merck) e
reação de Voges-Proskauer, reação de vermelho de
incubados a 37°C por 24 horas. A partir de cada
metila, fermentação de carboidratos (xilose, glicose,
subcultivo, após a divisão deste em 0,5 mL em
maltose, ramnose e manitol). Adicionalmente, será
diferentes tubos de hemólise, as cepas serão submetidas
realizada a identificação das espécies de Listeria por
às provas da coagulase livre, prova da termonuclease,
intermédio do cartão Vitek.
prova de fermentação da maltose, fermentação do
manitol e hemólise em ágar sangue de carneiro. A partir tipo de colônia (cultura estoque).
dos resultados das provas de fermentação da maltose e
fermentação do manitol, será realizada a prova da 3.5.8. Indução da produção de enterotoxinas
catalase, segundo metodologia proposta por Kloos
(1990). As toxinas utilizadas como padrão neste estudo, bem
como os anti-soros específicos, serão gentilmente
3.5.3. Prova da coagulase cedidos pelo Dr. Luiz Simeão do Carmo, do Laboratório
de Enterotoxinas Estafilocócicas da Fundação Ezequiel
A enzima pesquisada no presente estudo será a Dias.
coagulase livre uma vez que esta é produzida durante o
cultivo do microrganismo em caldo. A verificação da Após finalizar a identificação das espécies de
ação da enzima será realizada após 4 horas de incubação Staphylococcus pelas provas bioquímicas, uma porção
e depois deste tempo, a cada 2 horas durante período de das cepas oriundas da mesma amostra e que
24 horas. Os tubos contendo subcultivos das cepas apresentarem perfil bioquímico idêntico será transferida,
apresentando reações características, por formação de com auxílio de alça de platina ou níquel-cromo, para um
coágulo firme e organizado, serão considerados tubo contendo 5 mL de caldo BHI e incubada a 37°C
positivos para a prova. por 24 horas, fazendo-se um “pool” das culturas. As
soluções-tampão utilizadas serão cuidadosamente
3.5.4. Prova da termonuclease preparadas. Placas serão preparadas com 20 mL de ágar
BHI simples, acrescidas de 1% de extrato de levedura e
As lâminas preparadas com os subcultivos a serem fosfato de potássio, recobertas com disco de celofane,
testados e utilizadas na prova serão incubadas a 37°C com diâmetro idêntico ao da placa, esterilizado. Com
em câmara úmida (placa de Petri contendo papel filtro auxílio de alça de Drigalski flambada, após a
ou algodão embebido em água destilada). A leitura será acomodação cuidadosa do celofane sobre o ágar, 0,5 mL
feita após 4 horas de incubação, sendo a leitura refeita do pool das culturas preparado será espalhado e as
ao final de 24 horas de incubação. A prova será placas serão incubadas a 37°C por 24 horas. Será
considerada positiva quando houver formação de um utilizado 2,5 mL de tampão PBS (0,02 M e pH 7,4) para
halo róseo contendo frações de nucleotídeos solúveis, lavar o cultivo obtido em duas etapas, usando 1,5 mL e
procedentes da degradação do DNA, estendendo-se por 1,0 mL do tampão, respectivamente. O líquido
pelo menos 1 (um) milímetro além do diâmetro da resultante será transferido com auxílio de Pipeta Pasteur
cavidade preparada no ágar. para tubo de centrífuga de 10 mL e centrifugado sob
refrigeração a 4°C por 10.000 g por 10 minutos. Aos
3.5.5. Prova da fermentação da maltose e sobrenadantes, serão adicionadas 2 gotas de Timerosal
manitol (1:10.000) como conservante e, estes serão analisados
para a presença de enterotoxinas e TSST-1 pelo método
Os meios utilizados para a realização destas provas de OSP (“Optimum Sensitivity Plate”) (Robbins et al.,
(acrescidos dos açúcares manitol e maltose a 10%), 1974).
apresentarão pH alcalino e terão como indicador de
coloração, o púrpura de bromocresol. Algumas espécies Segundo Robbins et al. (1974), no método de OSP, 3
de estafilococos podem utilizar tais açúcares como fonte mL do ágar Nobre fundido serão adicionados a placas
de carboidrato com conseqüente produção de ácido de Petri estéreis plásticas de 50 x 12 mm, com tampas
láctico, tornando o meio para a cor amarela, bem ajustadas. Após solidificação do ágar, este será
caracterizando o resultado positivo para as provas. perfurado de modo a apresentar sete orifícios ou
“wells”. O modelo para a perfuração do ágar será
confeccionado pelo "Food Research Institute"
3.5.6. Prova da hemólise em ágar sangue
(Madison, Wisconsin, EUA). O anti-soro específico na
diluição (1:16) é colocado no orifício central, as toxinas
O meio utilizado nesta prova não é seletivo para o
crescimento de microrganismos. Dependendo do tipo de padrão (4 µ g/mL) são colocadas nos dois orifícios
hemolisina produzida, o ágar apresenta-se com reações menores e o fluido sobrenadante das culturas é colocado
de hemólise, parcial, total ou dupla hemólise, em quatro orifícios maiores nas posições laterais. As
caracterizadas pela formação de halos ao redor da estria placas serão colocadas em câmara úmida fechada e
realizada no ágar à partir de subcultivos de 24 horas de incubadas por 24 horas a 37°C. Reações positivas são
incubação do microrganismo em caldo BHI, ou sem determinadas pela formação de linhas de precipitina
reação de hemólise. entre os orifícios contendo os fluidos sobrenadantes das
culturas e o orifício central contendo o anti-soro. Pode-
se melhorar a visibilidade das linhas de precipitação
3.5.7. Cultura estoque
pela adição de ácido fosfórico (H2PO4) por poucos
segundos.
Após o isolamento e caracterização das cepas, com
auxílio de alça de platina ou níquel-cromo, cada inóculo
das cepas originárias do crescimento em ágar sangue 3.6. Identificação Molecular, ao nível de
será transferido para tubos de ensaio contendo TSA Espécies, de Bactérias Ácido-Láctico Isoladas de
(Merck) inclinado e identificados segundo a diluição e o Queijo de Coalho produzido no Estado de
Pernambuco. (25:24:1), sendo agitados à temperatura ambiente,
durante 5 minutos. Em seguida, os mesmos serão
A extração do DNA total dos microrganismos isolados centrifugados a 14.000 rpm, à 20ºC, durante 5 minutos.
nos meios de cultura ágar MRS e ágar M17 serão Os sobrenadantes serão transferidos para tubos contendo
realizadas a partir do cultivo recente em caldo MRS, 600 µ L de clorofórmio:álcool isoamílico (24:1), sendo
incubado sob anaerobiose ou aerobiose, a 37ºC, durante agitados à temperatura ambiente, durante 5 minutos. Em
24 horas, como descrito anteriormente. seguida, os mesmos serão centrifugados a 14.000 rpm, à
20ºC, durante 5 minutos. Os sobrenadantes serão
3.6.1.Extração de DNA total transferidos para tubos contendo 600 µ L de
isopropanol, sendo centrifugados a 14.000 rpm, durante
3.6.1.1. Obtenção das células sem parede e sem 30 minutos, para precipitação do DNA. Os
membrana sobrenadantes serão retirados e os pelletes serão lavados
com 500 µ L de etanol (70%), sendo centrifugados a
De cada cultivo dos microrganismos que crescerem em 14.000 rpm, durante 10 minutos, a 20ºC. O álcool será
caldo MRS, 10 mL serão centrifugados a 3.500 rpm, retirado e o pellet será ressuspenso em 50 µ L de TE
durante 30 minutos, à temperatura de 4ºC, para sem RNAse.
obtenção dos pellets. Os sobrenadantes serão
descartados. Os pellets serão ressuspensos em 1 mL de 3.6.1.3. Eletroforese em gel de agarose
cloreto de lítio (5 M), transferidos para tubos eppendorf
e incubados sob agitação à temperatura ambiente, por Com o objetivo de visualizar a quantidade de DNA total
uma hora, com finalidade de extrair proteínas associadas extraído na etapa anterior, as amostras serão submetidas
à parede bacteriana. Em seguida, os tubos serão à eletroforese em gel de agarose. Cinco µ L de cada
centrifugados a 14.000 rpm, durante 5 minutos, amostra de DNA total extraído serão misturados a 1 µ L
descartando-se os sobrenadantes. Os pellets serão de tampão (glicerol adicionado de azul de bromofenol).
ressuspensos e lavados com 1 mL de água deionizada, Em seguida, será realizada a eletroforese em gel de
autoclavada, para retirar o excesso de sal. Os tubos agarose (1%), adicionado de 3 L de brometo
serão centrifugados a 14.000 rpm, durante 5 minutos e Paralelamente, no mesmo gel será utilizado também o
os sobrenadantes descartados. Os pellets serão marcador de peso molecular. de 1 Kb. Ao término da
ressuspensos em 1 mL de tampão para protoplastos corrida, os géis serão fotografados de áeletídeo,
(50mM Tris HCl pH 8,0; 10 mM EDTA; 10 mg de utilizando 100V, durante 40 minutos
lisozima mL-1) sendo 200 µ L de enzima e 800 µ L de
tampão com RNAse, e incubados por uma hora, sob 3.6.1.4. Reação de Polimerização em Cadeia
agitação a 37ºC. Os tubos serão centrifugados a 14.000 (PCR)
rpm, durante 5 minutos e os sobrenadantes serão
descartados. Em seguida, os pellets serão lisados com a Posteriormente, as amostras de DNA total serão
adição de 2% de dodecil sulfato de sódio (SDS) em submetidas à reação de PCR, visando amplificar a
tampão TE com RNAse (para cada tubo, será utilizado região intergênica espaçadora entre as sub-unidades
500 µ L de TE e 100 µ L de SDS a 10%). ribossomais (16S – 23S) de BAL, de acordo com
metodologia proposta por Tissala-Timisjarvi ;
3.6.1.2. Extração com fenol – clorofórmio Alatossava (1997). Esta região do DNA é bastante
variável entre as espécies de microrganismos, porém,
Em cada tubo, serão acrescentados 600 µ L de fenol, bastante conservada em microrganismos da mesma
sendo agitados à temperatura ambiente, durante 5 espécie, sendo então, utilizada em pesquisas de
minutos. Em seguida, os mesmos serão centrifugados a identificação microbiana, ao nível molecular.
14.000 rpm, à 20ºC, durante 10 minutos. Os
sobrenadantes serão transferidos para tubos contendo Em seguida, os tubos eppendorf, contendo as amostras,
600 µ L de fenol:clorofórmio:álcool isoamílico serão colocados dentro da máquina Termocicladora “MJ
Research”, sendo utilizado o seguinte programa:

Quadro 2: Programa utilizado para obtenção dos produtos da PCR

Desnaturação 95º C 2 minutos e 30 segundos


94º C 30 segundos
Anelamento 55º C 1 minuto
Extensão 72º C 1 minuto
Extensão final 72º C 10 minutos
4º C Tempo indefinido
Posteriormente, 5 µ L de cada produto de PCR serão "primers" específicos, para realização da reação de
misturados com 1 µ L do tampão glicerol com azul de seqüenciamento, em máquina “MegaBACE DNA
bromofenol, e então, serão submetidos à nova Analysis Systems – Amersham Biosciences - EUA”, em
eletroforese em gel de agarose (1,4%), adicionado de 3 combinação com o sistema de sequenciamento
µ L de brometo de etídeo, utilizando 100V, durante 45 automatizado “MegaBACE 100”. Os resultados desta
minutos. Ao final da corrida, os géis serão fotografados, análise (seqüência de pares de base dos DNA’s) serão
para visualização das regiões amplificadas. comparados com as seqüências existentes no banco de
dados de DNA, utilizando o algorítmo BLAST
3.6.1.5. Digestão dos produtos de PCR 16S-23S (Altschul et al., 1990), para confirmação das espécies de
BAL, isoladas dos queijos de coalho.
Após a obtenção dos produtos de PCR, os mesmos serão
digeridos com enzimas de restrição, de acordo com 3.7. Pesquisa de Antagonismo In Vitro de
compilação de seqüências de nucleotídeos disponíveis Bactérias Ácido-Lácticas frente a Patógenos da
no “GenKank”para a identificação das espécies de BAL. Microbiota de Queijo de Coalho Artesanal e
As enzimas a serem utilizadas serão: Sph I, Nco I, Nhe I Industrial, produzido em Pernambuco (Tagg et
(que cortam o DNA dentro do gene 16S), Ssp I, Sfu I, al., 1976)
Dra I, Vsp I, Eco RI (que cortam o DNA na região
espaçadora), Hinc II ou Hpa I e Hind III (que cortam o Para a realização dos testes de antagonismos, as
DNA dentro do gene 23S). Também será utilizada a bactérias isoladas dos queijos de coalho serão
enzima Eco RV, que corta o DNA de Lactobacillus do previamente cultivadas em seus respectivos meios de
grupo casei na região intergênica 16S-23S e dentro do cultura. Para as BAL será utilizado caldo MRS (Merck),
gene 23S no grupo acidófilo. Como algumas destas incubando-se a 37ºC, durante 24 horas, sob anaerobiose.
enzimas necessitam de BSA (albumina sérica bovina) Para os Staphylococcus, será utilizado caldo BHI
para sua melhor atividade, serão preparadas duas (Merck), incubando-se a 37ºC, durante 24 horas, sob
misturas diferentes (com e sem BSA). aerobiose. Após duas ativações, 5 µ L de cada cultivo
Após o preparo dos tubos, os mesmo serão mantidos à de microrganismo serão colocados sobre a superfície de
37ºC, durante uma a seis horas, para haver a reação de uma placa de Petri, contendo ágar MRS (Oxoid), que
digestão enzimática. Em seguida, 5 µ L de cada será incubado, sob anaerobiose, a 37ºC, durante 48
produto de digestão serão misturados com 1 µ L do horas. Após este período, as placas serão retiradas da
tampão glicerol com azul de bromofenol, e então câmara de anaerobiose e será colocado clorofórmio nas
submetidos à eletroforese em gel de agarose (1,4%), tampas, deixando-se agir por 30 minutos. Com isto,
adicionado de 3 µ L de brometo de etídeo, utilizando espera eliminar os microrganismos que cresceram e
100V, durante 45 minutos. Os resultados serão possibilitar apenas a presença das supostas substâncias
fotografados e o perfil de digestão de cada produto de inibidoras. A seguir, serão colocados 3,5 mL de ágar
PCR será comparado com o perfil de digestão semi-sólido, contendo as bactérias reveladoras: BAL
característico de cada espécie de BAL. isoladas anteriormente, Staphylococcus spp. isolados
anteriormente e cepas de patógenos referência (Bacillus
3.6.1.6. Seqüenciamento dos produtos de PCR cereus; Staphylococcus aureus ATCC29213;
Salmonella enterica var Typhimurium ATCC12228;
Para melhor identificação dos microrganismos isolados, Yersinia enterocolitica ATCC; Listeria monocytogenes
será feito também o seqüenciamento de seus DNA’s ATCC15313; Salmonella enterica var Typhi
(Tannock et al., 1999), principalmente para aqueles que ATCC14028; Shigella flexneri; Pseudomonas
não forem identificados pelo perfil de digestão. Esta aeruginosa e Escherichia coli ATCC25723), recém-
análise será realizada no Núcleo de Análise de Genoma cultivadas em caldo MRS (Merck) e caldo BHI
e Expressão Gênica (NAGE) no ICB – UFMG. (Merck). Para todos os microrganismos reveladores
serão feitas duas ativações. Após crescimento dos
Para obtenção do DNA purificado, as bandas dos géis de microrganismos incubados nos caldos anteriores, 10
agarose, após a reação de PCR, serão cortadas, e será µ L dos mesmos serão transferidos para o ágar semi-
utilizado um kit específico (Concert Gel Extraction Kit sólido, que será então vertido sobre as placas de ágar
– Gibco BRL, Life Technologies - EUA). O DNA MRS (Oxoid), após os 30 minutos de ação do
purificado será clonado em vetor Escherichia coli XL1 clorofórmio. As placas serão incubadas a 37ºC, durante
"blue" competente. As células transformadas serão 24 horas, sob aerobiose ou anaerobiose, dependendo da
cultivadas em meio LB, suplementado com ampicilina. característica de cultivo da amostra reveladora. Então, a
De cada placa, algumas colônias serão escolhidas e leitura dos possíveis halos de inibição será feita (Tagg et
transferidas para tubos contendo caldo LB, al., 1976).
suplementado com ampicilina. Os mesmos serão
incubados à 37ºC, sob agitação (200 rpm) “overnight”, 3.7.1. Análise estatística
para preparo do “miniprep”. Os plasmídeos serão
extraídos pelo “miniprep” e submetidos à digestão com Os resultados obtidos serão submetidos à análise
Eco RI, para verificação das clonagens. Os clones que estatística não paramétrica, sendo que a comparação
receberam corretamente o inserto (produto de PCR 16S entre as médias dos diferentes tratamentos realizados
- 23S dos DNA’s das BAL) serão adicionados dos será feita de acordo como teste de Kruskal-Wallis,
utilizando o programa SAEG 7.0 (Sampaio, 1998). biotério do Departamento de Microbiologia, ICB-
UFMG. Os animais receberão ração sólida (Nuvilab
3.8. Susceptibilidade aos Antimicrobianos de Nuvital, Curitiba, PR, Brasil) autoclavada e água
Bactérias Ácido-Lácticas e Staphylococcus spp esterelizada por calor umido, ad libitum.
Isolados de Queijo de Coalho Artesanal e
Industrial, produzido no Estado de Pernambuco 3.9.1.2. Animais convencionais
(Charteris et al., 1998; NCCLS, 2003) Serão utilizados camundongos convencionais, suíços
(NIH), com 21-24 dias de idade, de ambos os sexos,
O antibiograma será realizado de acordo com a técnica provinientes do biotério do ICB/UFMG. Estes
de susceptibilidade antimicrobiana, baseando-se na camundongos serão derivados de matrizes isentas de
difusão da droga, utilizando-se discos contendo germes inoculadas com diluição fecal filtrada (3μm) de
antimicrobianos e medindo-se o diâmetro dos halos de animais convencionais sadios, sendo usados somente os
inibição. camundongos a partir da segunda geração após a
convencionalização. Os animais serão alimentados com
As amostras de microrganismos isolados e selecionados ração convencional para roedores (Nuvilab Nutival,
dos queijos, serão cultivadas em ágar MRS (Oxoid) e Curitiba, PR, Brasil) e água filtrada ad libitum e
ágar BHI (Merck), sendo posteriormente transferidas mantidos em biotério aberto do Departamento de
tubos contendo 3,5 mL de salina 0,85%, para obter-se Microbiologia, ICB-UFMG.
concentração correspondente à 0,5 na escala Mc Farland
(108 UFC/mL). Em seguida, serão feitos inóculos, 3.9.2. Manejo dos animais
utilizando zaragatoa, sobre a superfície de placas (14 cm
de diâmetro), contendo ágar MRS (Oxoid) e ágar A manutenção, assim como o uso dos animais nos
Müller-Hinton (Oxoid). Logo após, serão distribuídos os experimentos serão conduzidos respeitando o “Guide to
discos (Oxoid) contendo os antimicrobianos. As placas the care and use of experimental animal”, Canadian
serão incubadas em aerobiose ou anaerobiose, durante Council on Animal Care, vol. 1, 1993.
48 horas a 37ºC. Serão utilizadas drogas pertencentes
aos seguintes grupos químicos: (1) inibidores de síntese 3.9.3. Análises dos animais isentos de germes
de parede celular - penicilinas e cefalosporinas; (2)
inibidores de síntese de proteínas - aminoglicosídeos, 3.9.3.1. Obtenção dos animais gnotobióticos
tetraciclinas, cloranfenicol e macrolídeos e (3)
inibidores da síntese de ácidos nucleicos - quinolonas. A associação com os animais isentos de germes (IG)
para a obtenção do modelo gnotobiótico (GN) será feita
Após a incubação, com auxílio do paquímetro digital, a partir da utilização de espécies de BAL isoladas dos
serão feitas as leituras dos diâmetros dos halos de queijos de coalho a serem selecionadas.
inibição.
3.9.3.2. Tratamentos e desafios
3.9. Avaliação de Características Probióticas -
Capacidade de Colonização do Trato Os animais de cada grupo experimental receberão um
Gastrointestinal e do Efeito de Proteção Contra único inoculo intragástrico de 0,1 ml de solução salina
Salmonelose Experimental em Camundongos contendo aproximadamente 109 ufc/ml das espécies de
BAL, isoladas de queijo de coalho, selecionadas para
Gnotobióticos e Convencionais por Bactérias
essse experimento. Os animais do grupo controle
Ácido-Lácticas Isoladas de Queijos de Coalho, receberão solução salina tamponada estéril. Após 10
Produzidos no Estado de Pernambuco dias, todos os animais dos grupos receberão 0,1 ml de
solução salina tamponada contendo aproximadamente
3.9.1. Animais de experimentação 103 ufc/ml de Salmonella enterica sorov. Typhimurium
por inoculação intrgástrica.
3.9.1.1. Animais isentos de germes
3.9.3.3. Determinação da capacidade de espécies
Serão utilizados camundongos isentos de germes da de BAL de colonizar o trato digestivo de
linhagem NIH (Taconic, Germantowen, USA), de 21-24 camundongos isentos de germes
dias de idade e de ambos os sexos. Os animais serão
propagados no biotério de Gnotobiologia do A determinação dos níveis populacionais das BAL a
Departamento de Bioquímica e Imunologia, Instituto de serem testadas irá mostrar a sua capacidade de
Ciências Biológicas (ICB) da UFMG, e mantidos em sobrevivência e tolerância às condições adversas do
isoladores flexíveis do tipo Trexler (Standart Safety trato digestivo e sua capacidade de colonizar o trato
Equipment Company, Pallatine, IL, USA), de acordo gastrointestinal em modelo animal, avaliando assim as
com as normas tecnicas estabelecidas por Pleasants características probióticas dessas BAL isoladas de
(1974), adaptadas as nossas condições (Silva, 1986). queijo de coalho.
Para os experimentos os animais serão retirados dos
isoladores e mantidos em microisoladores (UNO As BAL a serem testadas serão crescidas em meio MRS
Roestvaststaal B. V., Zevenaar, The Netherlands) no (Oxoid) a 37ºC por 24-48 horas, centrifugadas a 3.000
rotações por minuto (rpm) por 10 minutos para 105 ufc\ml de Salmonella Typhimurium.
formação de um pellet bacteriano, desprezado o
sobrenadante (meio MRS), o pellet será ressuspenso em 3.9.4.2. Ganho de peso, sobrevida e
solução salina estéril e inoculado nos animais. Cada sobrevivência
animal irá receber um inóculo único por inoculação
intragástrica e a colonização será avaliada, durante 10 Durante o experimento, os camundongos convencionais
dias, pela contagem do número de bactérias presentes serão pesados em dias alternados. Também serão
nas fezes dos animais. Nos dias 1, 2, 4, 7 e 10, após o registradas as mortes decorrentes da infecção
inóculo, as fezes dos animais serão colhidas por experimental para posterior comparação das taxas de
estimulação anal. As fezes recentemente colhidas serão sobrevida e sobrevivência dos animais do grupo
homogeneizadas em solução salina estéril tamponada controle e do(s) grupo(s) experimental (is).
numa diluição 10-2 (Rodrigues et al., 1996). Diluições
decimais serão feitas no mesmo diluente. Uma alíquota 3.9.5. Análises histológicas
de 0,1 ml, das diluições decimais, serão plaqueadas
sobre ágar MRS (Oxoid) e incubadas a 37ºC por 48 Todos os animais isentos de germes e convencionais que
horas, sob anaerobiose (Forma Scientific, Marietta, sobreviverem à infecção experimental por Salmonella
USA: Atmosfera 85% N2, 10% H2 e 5% CO2) para Typhimurium serão sacrificados por deslocamento
posterior contagem do número de colônias crescidas em cervical ao final do experimento. Após o sacrifício,
cada placa. A quantidade de bactérias presentes nas serão retiradas amostras de intestino delgado e grosso,
fezes será determinada pelo número de colônias baço e figado desses animais pertencentes a cada um
desenvolvidas nas placas (UFC/ml) multiplicadas pelo dos grupos (controle e experimental). As amostras serão
fator de diluição. fixadas em formaldído 4% tamponado e processadas
para inclusão e microtomia em parafina. Serão
3.9.3.4. Teste de antagonismo “in vivo” excecutados corte de 3 a 5 μm de espessura e os
fragmentos obtidos serão corados pela hematoxilina-
Para a avaliação da colonização do trato gastrointestinal, eosina (HE). As amostras serão analisadas em
pelas BAL e pela Salmonella Typhimurium e para microscopia ótica convencional. A morfometria das
avaliar as possíveis relações de antagonismo no trato amostras será realizada utilizando um programa de
gastrintestinal de camundongos gnotoxênicos serão análise de imagens (KS 300-ZEISS) acoplado a um
realizadas análises microbiológicas quantitativas nas computador (Puglisi et al., 1995).
fezes frescas dos camundongos gnotobióticos, obtidas
por estimulação anal, que serão diluídas em salina 3.9.6. Análises estatísticas
esterilizada tamponada. As fezes serão coletadas no 1°,
2°, 4°, 7° e 10° dia após o desafio. Para contagem da Serão utilizados os seguintes métodos para o tratamento
cultura patogênica, alíquotas de 0,1 ml das diluições estatístico dos dados: Teste Log-Rank, para avaliação da
decimais adequadas serão plaquadas sobre ágar sobrevida e comparação das curvas de sobrevivência (p
MacConkey (DIFICO) e incubadas a 37 °C por 24 ≤ 0,05); Análise de variância, para comparação dos
horas, sob aerobiose. Para a contagem da cultura de níveis populacionais das bactérias nos experimentos dos
BAL, as mesmas diluições, serão plaqueadas sobre agar animais gnotobióticos e dados ponderais dos animais
MRS (Oxoid) a 37 °C por 48 horas em câmara de convencionais, utilizando-se do processo de diferença
anaerobiose. mínima significativa (dms) para comparação das médias
3.9.3.5. Sobrevivência e sobrevida (p ≤ 0,05).

Durante o experimento, os camundongos gnotobióticos 4. RESULTADOS E DISCUSSÃO


terão registradas as mortes decorrentes da infecção
experimental por Salmonella Typhimurium para 4.1. Processamento dos queijos de coalho
posterior comparação das taxas de sobrevida e
sobrevivência dos animais do grupo controle e do(s) Durante as visitas realizadas aos laticínios e fazendas
grupo(s) experimental(is). produtores de queijo de coalho industrial e artesanal,
respectivamente, o processamento deste alimento nestas
3.9.4. Análises dos animais convencionais localidades foi documentado. Os fluxogramas de
fabricação foram detalhados e são apresentados no
3.9.4.1. Tratamentos e desafio Anexo A. Foram observadas as condições de
processamento dos queijos, desde a obtenção do leite
Os animais do(s) grupo(s) experimental(is) receberão nas fazendas e recepção nos laticínios até a fase de
diariamente por via intragástrica 0,1 ml de solução expedição.
salina contendo aproximadamente 109 ufc\ml de
espécies de BAL a serem selecionadas. Os 4.1.1. Produção industrial de queijo de coalho
camundongos do grupo controle receberão diariamente
0,1 ml de solução salina tamponada. Após 10 dias todos A produção industrial de queijo de coalho foi
os grupos receberão por via intragástrica 0,1 ml de documentada em dois laticínios do estado de
solução salina tamponada contendo aproximadamente Pernambuco, localizados na regiões do Agreste (São
Bento do Una) e da Zona da Mata (Água Preta). 4.1.1.2. Laticínio LV

4.1.1.1. Laticínio BL Neste laticínio, a coleta do leite de cinco fornecedores


era granelizada, havendo também a utilização do leite
Neste laticínio, a coleta do leite era granelizada (70%) da fazenda, onde está localizada a indústria. Este leite
ou em latões (30%), sendo que estes eram recebidos até era canalizado diretamente da ordenha em circuito
às 10:30 da manhã. O volume diário de leite recebido fechado, realizada por processo mecânico, anexa à
era de 60 a 70 mil litros. O teste do alizarol a 70% era unidade industrial. O volume diário de leite recebido era
realizado para avaliar a estabilidade térmica da matéria- de 14 mil litros. Os testes do alizarol a 75% e de acidez
prima. Existiam 100 fornecedores de leite, sendo que o titulável (considerado apropriado até 17ºD) eram
pagamento era realizado por volume e qualidade, realizados para avaliar a estabilidade térmica da
avaliada somente pelo índice crioscópico. Além da matéria-prima. O pagamento do leite aos fornecedores
fabricação de queijo de coalho, principal produto deste era realizado apenas por volume. O rendimento
laticínio, também eram processados leite pasteurizado industrial estimado da produção de queijo de coalho era
tipo “C”, queijo Prato, bebida láctea e coalhada. de 8,5 litros por quilo de queijo. Além da fabricação de
queijo de coalho, principal produto deste laticínio, eram
Periodicamente, o controle de qualidade da matéria- também processados leites pasteurizados tipos “B” e
prima era feito incluindo as seguintes análises: redutase, “C”, manteiga e bebida láctea.
crioscopia e teor de gordura. Entretanto, não eram
realizados importantes testes que são fundamentais para Periodicamente, era realizado o controle de qualidade da
a indústria queijeira, como: pesquisa de resíduos de matéria-prima, incluindo as seguintes análises:
inibidores, contagem de células somáticas e crioscopia, teor de gordura, densidade a 15ºC, pesquisa
determinação do teor de proteínas. Estes índices de inibidores e contagem de células somáticas. O queijo
estariam relacionados com a viabilidade de utilização do de coalho apresentava 30 dias de validade, sendo
leite cru para a produção de queijos, bem como comercializado na região de Água Preta e em Recife, e
auxiliaria na previsão do rendimento industrial e na analisado quanto às pesquisas de bolores e leveduras,
remuneração mais apropriada dos fornecedores. Os coliformes e Staphylococcus aureus. Os resultados
produtos fabricados apresentavam 21 dias de validade, dessas análises não foram mostrados durante as visitas.
sendo comercializados na região de Garanhuns e em
Recife, e, eram periodicamente analisados quanto às Este laticínio informou estar em fase de implantação do
pesquisas de bolores e leveduras, coliformes e programa de Boas Práticas de Fabricação, porém
Staphylococcus aureus não sendo informado nenhum algumas observações foram feitas, como a intensa
resultado dessas análises. manipulação da massa durante os processos de salga e
enformagem, sem que os funcionários utilizassem luvas.
De acordo com o que foi observado neste laticínio, Medidas de controle de ambiente foram registradas:
pode-se verificar durante visita ao local, a adoção de pédilúvio com cloro, pias com detergente e pedal, lava
algumas medidas importantes do Programa de Boas botas, cortinas e exaustores de ar.
Práticas de Fabricação para a elaboração de queijo de
coalho. Entretanto, mais cuidados com o ambiente de O sistema de limpeza e desinfecção dos equipamentos
fabricação dos queijos deveriam ser observados. O era realizado com a utilização de detergente alcalino
acúmulo de resíduos e sujeiras na recepção e o (soda), detergente ácido (peracético) e sanitizante
vazamento de leite neste local, conforme foi observado (cloro). O sistema “clean in place” CIP era somente
no local deveriam ser evitados, pois podem adotado para limpeza do pasteurizador. A água utilizada
comprometer a qualidade microbiológica do ambiente, pelo laticínio não era dura, segundo informações dos
servindo como focos de contaminação. técnicos.

O sistema de limpeza e desinfecção dos equipamentos 4.1.2. Produção artesanal de queijo de coalho
era realizado com a utilização de detergente alcalino
(soda), detergente ácido (peracético ou nítrico) e A produção artesanal de queijo de coalho foi
sanitizante (cloro). Somente utilizava-se o sistema documentada em duas fazendas do estado de
“clean in place” (CIP) no pasteurizador. A água Pernambuco, localizadas nas regiões do Agreste (São
industrial poderia apresentar dureza elevada, como Bento do Una) e da Zona da Mata (Água Preta).
característica daquela região de solo árido e calcário,
sendo apenas clorada. Este fato poderia comprometer a 4.1.2.1. Fazenda AQ
ação do detergente alcalino, pois o cálcio e o magnésio
presentes neste tipo de água podem se associar ao sódio A fazenda AQ, localizada no município de São Bento do
do produto de limpeza, afetando conseqüentemente, a Una (PE), foi visitada. O leite utilizado para a
eficiência deste processo. Foram observadas elaboração dos queijos de coalho era oriundo
incrustações nas caldeiras, que devem ter se formado exclusivamente da fazenda, sendo obtido de 31 vacas,
com o decorrer do tempo (Andrade e Macedo, 1996). por intermédio de ordenhadeira mecânica do tipo latão
Contudo a dureza da água não foi avaliada. ao pé, totalizando cerca de 450 litros por dia. Os
animais recebiam dieta baseada em farelos de algodão,
soja, milho e arroz, além de palma. A propriedade era todos localizados na Zona da Mata pernambucana. O
assistida por uma veterinária, realizando rendimento era de aproximadamente 7,1 litros de leite
periodicamente, no rebanho, exames de brucelose, por quilo de queijo, possuindo prazo de validade de 14
tuberculose e mastite. dias. As embalagens dos queijos possuíam rótulo e a
produção estava sob fiscalização do Serviço de Inspeção
A produção era familiar e não era realizado nenhum tipo Estadual.
de análise do leite destinado à elaboração dos queijos,
nem dos produtos acabados. O rendimento estimado era 4.1.3. Avaliação dos sistemas de produção de
de 7 litros de leite por quilo de queijo. A produção era queijo de coalho
subordinada à inspeção estadual, porém, provisória. O
soro dos queijos era destinado à pocilga. A distribuição 4.1.3.1. Fluxogramas de produção
dos queijos era feita pelo próprio produtor, em veículo
particular, utilizando isopor sem gelo. Os queijos eram As fotos das visitas aos laticínios e fazendas onde eram
vendidos em feiras na cidade de Caruaru (PE) e fabricados os queijos (Anexo I) e a descrição dos
apresentavam validade de 30 dias. respectivos fluxogramas (Anexo A) demonstraram
variações quanto ao processamento, incluindo
4.1.2.2. Fazenda CM diferenças com relação às etapas, utensílios e
instalações. As diferenças não se restringiam entre
Na fazenda CM, localizada no município de Água Preta produção artesanal e industrial. Como foi possível
(PE), foi observado que o leite utilizado para a observar, pelos resultados apresentados, essas variações
elaboração dos queijos de coalho era oriundo também ocorriam entre as formas de produção de queijo
exclusivamente da fazenda, sendo obtido de 70 vacas, artesanal, e entre as formas de produção de queijo
por intermédio de ordenha mecânica do tipo latão ao pé, industrial, ou seja, cada estabelecimento (industrial ou
totalizando cerca de 500 litros por dia. Os animais não) estabelece um fluxograma próprio e individual,
recebiam dieta baseada em cevada e pasto de com variações quanto à tecnologia e cuidados higiênico-
Brachiaria. sanitários, podendo resultar em produtos que vão
apresentar características sensoriais, físico-químicas e
A produção, embora artesanal, não era familiar, microbiológicas distintas. Desta forma, pode ser
diferente da outra propriedade visitada, sendo observada falta de padronização na fabricação deste
encarregada a funcionários da fazenda. Não era alimento.
realizado nenhum tipo de análise do leite destinado à
elaboração dos queijos, nem dos produtos acabados. O De acordo com as descrições dos fluxogramas dos
queijo era produzido duas vezes por dia, após as queijos de coalho, as principais diferenças relacionadas
ordenhas. A distribuição destes era terceirizada, sendo à produção deste alimento são apresentadas na Quadro
feita duas vezes por semana, utilizando isopor sem gelo, 3:
nos municípios de Água Preta, Ribeirão e Palmares

Quadro 3: Principais diferenças relacionadas à produção de queijo de coalho.

Fazenda Industria
Padronização teor de gordura Não é realizada Realizada
Pasteurização Não é realizada Realizada
Mexedura 5 minutos 1 hora
Salga Superfície Na massa
Enformagem Forma de madeira Forma de alumínio
Prensagem (tempo) 5 minutos 30 minutos
Embalagem\Estocagem Manual\Freezer Vácuo\ Câmara fria
Comercialização Feiras Estabelecimento comercial
4.1.3.2. Ingredientes O Regulamento Técnico de Identidade e Qualidade de
Queijo de Coalho (Brasil, 2001) define este produto
Tecnicamente, o queijo de coalho pode ser definido como o queijo que se obtém por coagulação do leite por
como o produto obtido por coagulação enzimática, cuja meio do coalho ou outras enzimas coagulantes
coalhada pode ou não sofrer aquecimento, sendo apropriadas, complementada ou não pela ação de
prensado manualmente ou em pequenas prensas e bactérias lácteas selecionadas e comercializado
salgado a seco, diretamente na massa ou na superfície normalmente com até 10 (dez) dias de fabricação.
(Mangueira et al., 2001). Porém, ao observar-se os Entretanto, foi observado que a comercialização dos
fluxogramas de produção (Anexo A) dos produtos ocorria em um prazo superior a 10 dias após a
estabelecimentos visitados, pode-se perceber que em fabricação. Esta prática pode comprometer a qualidade
alguns casos essa definição não seria empregada, uma microbiológica destes queijos, principalmente, quando
vez que ocorre a adição de ingredientes como se leva em consideração as inadequadas condições de
bicarbonato de sódio. estocagem e comercialização, sendo feitas também sob
temperaturas impróprias.
O cloreto de cálcio é utilizado pelos laticínios
4.1.3.5. Condições higiênico-sanitárias
para proporcionar adequada coagulação do leite após a As práticas de higiene para elaboração do produto
pasteurização, pois neste processo ocorre a devem atender o Regulamento Técnico sobre as
insolubilização de parte do cálcio livre, Condições Higiênico-Sanitárias e de Boas Práticas de
Fabricação para Estabelecimentos Elaboradores/
o que poderia comprometer a firmeza do coágulo e o Industrializadores de Alimentos (Portaria nº 368/97 –
rendimento industrial. Como nas fazendas o leite não é MAPA, Brasil, 1997). Porém, apenas um dos laticínios
pasteurizado, não é necessária a adição de cloreto de informou ter as BPF’s implantadas, enquanto que o
cálcio. outro está em fase de implantação. A situação é ainda
pior nos estabelecimentos de produção artesanal, onde
O queijo de coalho industrializado é um queijo de média muitas vezes cuidados mínimos de higiene são
a alta umidade, de massa semi-cozida ou cozida e negligenciados, como a intensa manipulação do leite e
apresentando um teor de gordura nos sólidos totais da massa, a utilização de água não tratada, a
variável entre 35,0% e 60,0%. Os ingredientes higienização deficiente dos utensílios e a falta de
obrigatórios são leite integral ou padronizado a 3% cuidados com relação ao ambiente de produção de
(m/m) em seu conteúdo de matéria gorda; coalho ou queijo e com a higiene pessoal e das vestimentas das
outras enzimas coagulantes apropriadas. Os ingredientes pessoas envolvidas neste trabalho, comprometendo a
opcionais seriam cloreto de cálcio, cultivo de bactérias qualidade microbiológica do produto.
lácteas selecionadas, sólidos de origem láctea,
condimentos e especiarias e cloreto de sódio (Brasil, Associado ao fato anterior, percebe-se um cuidado
2001). Observou-se a não padronização do teor de maior das práticas de higiene e desinfecção dos
gordura do leite destinado à produção de queijo de equipamentos industriais, em relação aos utensílios
coalho artesanal e a padronização deste constituinte do utilizados durante a fabricação artesanal dos queijos.
leite a 3,0 ou 3,2 % na elaboração de queijo de coalho Porém, apesar da implantação das BPF’s, em alguns
industrial. Estes fatos podem produzir variações físico- casos, problemas higiênico-sanitários relacionados a
químicas que podem interferir na identidade e questões culturais podem interferir com a qualidade
padronização dos produtos. microbiológica destes queijos. Isto pôde ser verificado
pela intensa manipulação da massa nos processos de
4.1.3.3. Utensílios salga e enformagem dos queijos industriais. Desta
forma, estas etapas podem ser caracterizadas como
Outra importante observação diz respeito aos utensílios pontos críticos, associados a riscos microbiológicos,
utilizados para a fabricação do queijo de coalho, durante a fabricação do queijo de coalho industrial.
especialmente naqueles produzidos de forma artesanal.
O queijo de coalho artesanal ainda é feito com a Altos índices de contaminação com coliformes totais e
utilização de utensílios de madeira, o que pode fecais foram verificados em amostras de queijo de
comprometer a qualidade microbiológica do produto. coalho, produzido e comercializado no Nordeste (Leite-
Por isso a legislação estadual prevê apenas a permissão Júnior et al., 2000; Bastos et al., 2001; Escobar et al.,
para se fazer uso de utensílios de aço inox. Contudo, a 2001; Nascimento et al., 2001). Estes resultados
utilização de utensílios de madeira é uma prática demonstram problemas higiênico-sanitários ocorridos
tradicional na produção artesanal de queijos, estando durante a produção deste queijo, bem como a utilização
ligada a fatores culturais difíceis de serem modificados. de leite cru e a falta de tratamento de água nas unidades
Este fato esta também associado à questão econômica, produtoras, condições essas também observadas nos
pois o custo das formas de aço inox é elevado para estes estabelecimento visitados no presente experimento,
produtores. como descrito anteriormente.

4.1.3.4. Prazo de validade


4.2. Determinação de características e Para uma avaliação mais completa dos queijos, os
composição físico-químicas mesmos foram submetidos às análises físico-químicas.
Os resultados destas avaliações estão demonstrados na
tabela 1.

Tabela 1: Resultados de análises físico-químicas de seis amostras de queijo de coalho, produzido no Estado de
Pernambuco.
Amostra Gordura Gordura no EST EST Umidade
(%) (%) (%) (%)
BL 15,50 32,56 47,60 52,40
LV 21,5 42,07 51,10 48,90
AB 23,0 49,41 46,55 53,45
AQ 19,0 44,76 42,45 57,55
CM 27,0 57,45 47,00 53,00
SM 24,0 48,44 49,55 50,45
ou na superfície e forma e eficiência de prensagem
Os resultados obtidos (Tabela 11) demonstraram podem justificar as diferenças dos resultados dos
grandes variações com relação ao percentual de gordura parâmetros físico-químicos pesquisados. Esta falta de
das amostras estudadas, sendo o menor percentual de padronização destas características também foi relatada
15,50% e o maior de 27%. É interessante observar que o por Sena et al. (2000) e Araújo et al. (2002).
menor percentual foi visto para uma amostra de queijo
de coalho industrial, que realiza a padronização do teor Quanto ao percentual de gordura no EST, as amostras de
de gordura do leite, enquanto que o maior percentual de queijo de coalho puderam ser classificados como sendo
gordura observado foi de uma amostra de queijo de semi-gordo a gordo, o que estaria de acordo com os
coalho artesanal, que é feita com leite cru integral. critérios estabelecidos pelos Regulamentos Técnicos de
Portanto, estas variações dos teores de gordura podem Identidade e Qualidade de Queijo de Coalho (Brasil,
ser, em parte, causadas pela adoção da padronização 2001).
deste constituinte lácteo nas indústrias, enquanto que
nas fazendas esta operação não é realizada. De acordo com os dados demonstrados na Tabela 12,
Adicionalmente, outros fatores podem justificar a pode-se perceber que também existe grande variação
oscilação dos teores de gordura entre amostras de queijo dos valores de acidez titulável dos queijos de coalho
de coalho, dentre eles podem ser citados: alimentação pesquisados. A oscilação foi bastante significativa,
dos animais leiteiros, composição genética do rebanho, variando de 59,4 a 175,5 ºD. Este fato pode estar
estágio de lactação, ordem de parição, estação do ano, relacionado à microbiota específica de cada amostra,
etc. (Harding, 1995). As variações do teor de gordura que apresentaria diferentes níveis de fermentação da
também influenciaram as oscilações dos outros lactose. Somado à isto, outros fatores tornam-se também
parâmetros físico-químicos avaliados (EST, umidade e relevantes, como as diferenças tecnológicas de
gordura no EST), pois estes índices dependem do teor fabricação, variações das embalagem (à vácuo ou não),
de gordura dos queijos. tempo e temperatura de estocagem dos queijos, tipo de
comercialização e manutenção da cadeia do frio.
Quanto ao teor de umidade, de acordo com os padrões
oficiais de inspeção (Brasil, 1996), as amostras de As variações de acidez titulável nos queijos analisados
queijo de coalho puderam ser classificadas como sendo podem determinar alterações na composição de suas
de alta umidade, o que seria o exigido pela legislação microbiotas, limitando a viabilidade de bactérias mais
oficial de queijo sensíveis a ambientes de pH baixo, nos queijos com
maior acidez titulável. A capacidade de fermentação
de coalho (Brasil, 2001), excetuando-se apenas a varia de acordo com as espécies. A maioria das BAL
amostra AQ, que foi classificada como queijo de muito produz entre 0,5% e 1,5% de ácido láctico, mas existem
alta umidade. As variações do teor de umidade e de EST bactérias capazes de produzir mais de 3% de ácido
dos queijos podem ser explicadas pelas diferenças láctico (Robinson, 1991). Dentro deste raciocínio,
observadas quanto às bactérias indesejáveis como as do grupo coliforme
poderiam ser afetadas, porém igualmente seria
tecnologias de produção, descritas nos fluxogramas de prejudicada a sobrevivência de microrganismos
produção (Anexo A). As variações observadas durante a desejáveis como Lactococcus spp. em pH inferior a 4,5
fabricação destes queijos relacionadas à padronização (Jay, 1996). Este fato pode explicar parcialmente a
do teor de menor incidência de bactérias deste gênero nos queijos
analisados e uma maior predominância de identificação
gordura do leite, ao tamanho do grão após o corte, de Lactobacillus spp. que são mais tolerantes ao menor
tempo e tipo de mexedura e dessoragem, salga na massa pH do meio.

Tabela 2: Resultados de determinação da acidez titulável de queijo de coalho produzido no estado de Pernambuco.
Queijo Acidez titulável (º D)
BL 90,0
LV 81,2
AB 63,0
AQ 164,7
CM 59,4
SM 175,5

Adicionalmente, queijos com elevada acidez titulável consumidores um produto mais uniforme.
podem apresentar defeitos de aparência e textura, que
seriam visualizados como trincas, corpo ressecado e 4.3. Isolamento, enumeração, purificação e
friável (Furtado, 1990). Estes aspectos associados ao caracterização fisiológica de bactérias ácido-
sabor mais ácido destes produtos poderiam causar uma lácticas
rejeição maior pelos consumidores.
4.3.1. Isolamento e enumeração
De acordo com a análise dos dados de composição e
constituição físico-química dos queijos de coalho,
O isolamento dos microrganismos produtores de ácido
associando-os com as observações relacionadas aos
láctico em amostras de queijo de coalho artesanal e
processos de produção artesanal e industrial descritos
industrial foi realizado em ágar MRS, incubado sob
anteriormente, ressalta-se a necessidade de melhor
anaerobiose e em ágar M17, incubado sob aerobiose. Os
padronização dos processamentos deste alimento, a fim
resultados da enumeração destes microrganismos estão
de que se possa oferecer aos
apresentados na tabela 3:

Tabela 3: Enumeração (UFC/g) de microrganismos produtores de ácido láctico em amostras de queijo de coalho
artesanal e industrializado

QUEIJO ÁGAR MRS ÁGAR M17


(UFC/g) (UFC/g)
LV 5,1 x 106 7,5 x 107
BL 5,0 x 107 5,1 x 107
AQ 4,5 x 107 8,0 x 107
CM 3,3 x 107 1,3 x 108
AB 4,3 x 107 2,0 x 108
SM 9,0 x 107 3,3, x 108
A contagem total de microrganismos produtores de (AQ, CM, AB e SM), independentemente do meio de
ácido láctico nos meios MRS e M17 apresentou-se cultivo, apresentando microbiota mais rica e
ligeiramente diferente. Números discretamente mais diversificada. Provavelmente, este fato deve estar
elevados de bactérias foram verificados quando o relacionado, mais uma vez, às condições observadas no
isolamento foi realizado com o ágar M17, exceto para as processamento artesanal deste tipo de queijo, e à não
amostras BL e AQ, de queijo de coalho industrial e pasteurização da matéria-prima utilizada na fabricação
artesanal, respectivamente, que apresentaram deste produto. Outro ponto a ser considerado, é que,
populações semelhantes nos dois meios de cultura devido à falta da pasteurização, há provavelmente uma
utilizados (tabela 3). Uma provável explicação para este maior ocorrência de espécies de BAL e,
fato seria a atmosfera de incubação e a composição do conseqüentemente, uma maior contagem inicial desses
ágar MRS, que é mais específico para o isolamento de microrganismos no produto artesanal. Não submeter o
Lactobacillus spp., apresentando pH inferior ao do ágar leite ao tratamento térmico adequado não implica
M17, o que dificulta o crescimento de microrganismos apenas em um maior número de microrganismos
menos tolerantes à acidez e as condições de produtores de ácido láctico desejáveis, mas também de
anaerobiose. bactérias deteriorantes e/ou patogênicas, fazendo com
que o queijo artesanal, feito a partir de leite cru, se torne
Outra importante observação que pode ser feita a partir uma fonte de infecções aos humanos e, portanto, um
dos resultados demonstrados na tabela 3 é que as risco à saúde pública.
maiores contagens de microrganismos foram observadas
na amostra SM, queijo de coalho artesanal, coletado no 4.3.2. Caracterização fisiológica
mercado varejista da cidade de Recife (PE). Isso
ocorreu tanto quando o isolamento foi feito a partir do A caracterização fisiológica dos microrganismos
meio M17 quanto do meio MRS. Por outro lado, as isolados das amostras de queijo de coalho foi realizada
menores contagens de microrganismos foram por intermédio da realização de teste respiratório,
observadas em duas amostras de queijo de coalho coloração de Gram e teste de catalase.
industrial, coletadas nas indústrias LV, em ágar MRS, e
BL, em ágar M17, respectivamente. Isto, 4.3.2.1. Isolamento em ágar M17
provavelmente, ocorreu devido às más condições de
produção e estocagem sob temperaturas inadequadas da O teste respiratório das culturas isoladas em ágar M17
amostra SM, possibilitando o desenvolvimento indicou que, apesar do isolamento primário das mesmas
microbiano, principalmente, quando comparadas às ter sido feito em condições de aerobiose, estes
condições de produção e armazenamento observadas microrganismos comportaram-se, no geral, como
para as amostras de queijo industrializado (LV e BL). microaerófilos. Este fato pode ser comprovado pelo
crescimento dos mesmos em diferentes condições de
É possível ainda observar que as contagens foram ambiente: anaerobiose, microaerofilia e aerobiose
geralmente maiores para as amostras de queijo artesanal (Tabela 4)

Tabela 4: Resultados de análises microbiológicas de culturas isoladas em ágar M17 a partir de queijo de coalho,
produzido no estado de Pernambuco

Queijo/ Teste Respiratório Morfologia e Gram Catalase


Morfotipo
Aerobiose Microaerofilia Anaerobiose

BL1 +++ +++ +++ Bastonetes G + Pos


BL2 +++ +++ +++ Cocos G + Neg
BL3 +++ +++ ++ Cocos G + Neg
BL4 +++ +++ +++ Bastonetes G - Pos
LV1 +++ +++ +++ Cocos G - Pos
LV2 +++ +++ +++ Bastonetes G - Neg
LV3 +++ +++ +++ Cocos G - Pos
LV4 +++ +++ ++ Cocos G + Neg
AQ1 +++ +++ +++ Cocos G + Pos
AQ2 +++ +++ +++ Cocos G + Neg
AQ3 +++ +++ +++ Cocos G + Neg
AQ4 +++ +++ ++ Cocos G + Neg
CM1 +++ +++ +++ Cocos G + Pos
CM2 +++ +++ +++ Cocos G + Pos
CM3 +++ +++ +++ Bastonete G- Pos
CM4 +++ +++ +++ Cocos G + Neg
AB1 +++ +++ +++ Cocos G + Pos
AB2 +++ +++ +++ Cocos G + Neg
AB3 +++ +++ ++ Cocos G + Neg
AB4 +++ +++ +++ Cocos G + Pos
SM1 +++ +++ +++ Cocos G + Pos
SM2 +++ +++ ++ Cocos G+ Neg
SM3 +++ +++ +++ Cocos G + Pos
SM4 +++ +++ +++ Cocos G + Neg

A coloração de Gram destes microrganismos indicou 2000). Porém, também foram caracterizados
predominância de cocos Gram positivo, sendo um microrganismos cocos Gram positivo, catalase negativo,
resultado esperado e desejável. Isto, porque a o que seria sugestivo de bactérias dos gêneros
microbiota aeróbia predominante em queijos deveria ser Lactococcus, Streptococcus e Enterococcus (Tagg et al.,
constituída de BAL, como Lactococcus spp. Outros 1976).
pesquisadores encontraram predominância de cocos em
microbiota de queijos industrializados e artesanais 4.3.2.2. Isolamento em ágar MRS
(Oliveira; Garcia, 1986; Leite et al., 1997).
O teste respiratório das culturas isoladas em ágar MRS
Houve predominância de culturas caracterizadas como indicou maiores restrições com relação às condições de
cocos Gram positivo, catalase positivo, sugerindo a cultivo ideais para estes microrganismos. Foram
presença de bactérias contaminantes importantes neste detectadas culturas anaeróbias estritas (CM4MRS),
queijo, como é o caso de Staphylococcus spp. (Sena, microaerófilas e anaeróbias facultativas (Tabela 5).

Tabela 5: Resultados de análises microbiológicas de culturas isoladas em ágar MRS a partir de queijo de coalho,
produzido no estado de Pernambuco

Queijo/ Teste Respiratório Coloração de Gram Catalase


Morfotipo
Aerobiose Microaerofilia Anaerobiose

BL1 - ++ + Cocos G + Neg


BL2 + + ++ Cocos G + Neg
LV1 + ++ ++ Cocos G + Neg
LV2 - ++ ++ Bast. G + Neg
LV3 + ++ +++ Bast. G + Neg
AQ1 ++ +++ +++ Bast. G + Neg
AQ2 ++ - + Cocos G + Neg
CM1 + +++ +++ Bast. G + Neg
CM2 ++ +++ +++ Bast. G + Neg
CM3 ++ + ++ Bast. G + Neg
CM4 - - + Cocos G + Neg
AB1 + + + Cocos G + Neg
AB2 +++ ++ +++ Bast. G + Neg
AB3 ++ ++ ++ Bast. G + Neg
SM1 - ++ + Cocos G + Neg
SM2 - ++ ++ Cocos G + Neg
Os resultados da coloração de Gram demonstraram não favorece o isolamento de bactérias do gênero
haver predominância de um tipo morfológico, porém Lactococcus, que possuem comportamento respiratório
todos os microrganismos foram caracterizados como diferente dos Lactobacillus, que são microrganismos
Gram positivo, catalase negativo. aeróbios. Além disto, no meio M17 podem se
desenvolver outras espécies de microrganismos
Estes achados indicam a possibilidade do isolamento de fermentadores de lactose, como Streptococcus e
bactérias fermentadoras da lactose, como BAL não Enterococcus. Portanto, as diferenças observadas entre
apenas do gênero Lactobacillus, mas também dos os dados contidos nas tabelas 4 e 5 devem-se, em parte,
gêneros Lactococcus, Streptococcus e Enterococcus que ao meio de cultivo e também pelas características
são Gram positivo, catalase negativo. fisiológicas de cada grupo de microrganismo.

Os resultados encontrados foram coerentes com a 4.4. Identificação das bactérias ácido-lácticas
literatura pesquisada. Furtado (1990) isolou BAL de isoladas, de acordo com técnicas de Biologia
leite e de soro de queijo da região do Serro, Minas
Molecular.
Gerais, os microrganismos foram caracterizados
fisiologicamente como Gram positivo, catalase
Alguns microrganismos possuem apenas uma cópia da
negativo, preferencialmente microaerófilos. Leite et al.
região intergênica 16S – 23S em seu DNA
(1997) isolaram 1.244 colônias de microrganismos de
(amplificação de apenas uma banda), como AB1MRS,
queijo do Serro, das quais 105 foram caracterizadas
BL1MRS, BL2MRS, SM1MRS, SM2MRS, BL3M17 e
como Gram positivo e catalase negativo. Entretanto,
BL4M17. Os outros isolados apresentam mais de uma
neste trabalho, a maior partes destes (34) foi classificada
cópia desta região em seus DNA’s. Este fato pode
no gênero Lactococcus, sendo o restante Enterococcus e
caracterizar diferentes espécies, como Lactobacillus
Streptococcus.
spp. que apresentam a amplificação típica de três
bandas. Estes genes são copiados mais de uma vez no
Pode-se observar maior seletividade do meio MRS em
genoma destas bactérias por codificarem estruturas
comparação ao meio M17 (Tabelas 4 e 5), havendo
vitais para os microrganismos, subunidades ribossomais
crescimento de menor número de microrganismos no
para síntese protéica. Entretanto, como este fato é
ágar MRS (Tabela 3). Confrontando os dados
comum entre as bactérias e esta região genômica é
demonstrados das tabelas 5 e quadro 4 percebe-se ainda
extremamente variável entre os microrganismos de
que o cultivo em meio MRS permitiu maior definição
espécies diferentes, porém bem conservada na mesma
dos microrganismos com relação ao perfil respiratório e
espécie, torna-se necessário à utilização de outras
menor variedade dos resultados de Gram e catalase. Isto
técnicas complementares para a identificação dos
ocorre em função das características específicas de cada
microrganismos isolados ao nível molecular.
meio, que irá determinar qual ou quais microrganismos
irão se desenvolver. O meio MRS é indicado para
Os resultados dos seqüenciamento confirmaram a
isolamento de espécies do gênero Lactobacillus, que são
presença de diferentes espécies de microrganismos nas
bactérias microaerófilas, em sua grande maioria. O meio
amostras de queijo de coalho (Quadro 4).
M17 (suplementado com lactose) é um meio que

Quadro 4: Microrganismos identificados por seqüenciamento de DNA isolados de amostras de queijo de coalho
artesanal e industrializado.

Amostra Microrganismo
AB1MRS Streptococcus thermophilus
AB2MRS Lactobacillus casei
AB3MRS Lactobacillus fermentum
AQ1MRS Lactobacillus rhamnosus
AQ2MRS Enterococcus faecalis
BL1MRS Streptococcus thermophilus
CM3MRS Weissella confusa
CM4MRS Enterococcus faecalis
LV1MRS Enterococcus faecalis
LV3MRS Lactobacillus acidophilus
AQ4M17 Lactococcus raffinolactis
BL2M17 Streptococcus thermophilus
CM2<M17 Lactococcus lactis
CM2>M17 Escherichia coli
CM3M17 Erwinia amylovora
SM4M17 Streptococcus thermophilus

Também foram identificadas duas culturas (CM1MRS E digestão confirmada pelo seqüenciamento (Tabela 5). A
CM2MRS) como Lactobacillus rhamnosus, de acordo cultura LV2MRS apresentou perfil de digestão
com o perfil de digestão idêntico ao daquele de sugestivo de Lactobacillus sp. do grupo acidófilo,
AQ1MRS, que teve a identificação baseada no perfil de porém o seqüenciamento não foi conclusivo, a respeito
da identificação desta espécie que se caracterizou como As espécies de Lactobacillus isoladas (L. acidophilus,
bastonete Gram positivo, catalase negativo, crescendo L. casei, L. fermentum e L. rhamnosus) representam
apenas em microaerofilia e anaerobiose, de acordo com exemplos de microrganismos desejáveis à fabricação de
os resultados descritos anteriormente (Tabela 3). queijos pelas características sensoriais e por serem
microrganismos com importante papel probiótico
Foram identificados dezenove microrganismos, sendo (Robinson, 1991). Espécies semelhantes de
seis pertencentes ao gênero Lactobacillus, quatro de Lactobacillus também foram isoladas de queijo
Streptococcus, três de Enterococcus, dois de artesanal por López Diaz (2000) e Gatto et al. (2002).
Lactococcus, um de Weissella, um de Escherichia e um Em outros trabalhos citados anteriormente, diversos
de Erwinia. Estes dois últimos microrganismos, apesar pesquisadores encontraram Lactobacillus spp. neste tipo
de não pertencerem ao grupo das BAL, sendo de alimento, porém, nas amostras de queijo de coalho
considerados enterobactérias, conseguiram se estudadas, foi identificada maior variedade de espécies
desenvolver no meio M17, reforçando a menor deste microrganismo.
seletividade do mesmo e a capacidade destas bactérias
de fermentar lactose, adaptando-se neste ambiente. A Weissella spp. eram anteriormente classificadas como
presença de Escherichia coli foi observada na cultura Lactobacillus., porém, com o desenvolvimento das
CM2M17, mesma cultura na qual foi identificada a cepa técnicas de identificação de microrganismos e a
de Lactococcus lactis, sendo detectada a ocorrência aplicação da biologia molecular, estas bactérias foram
destas duas cepas em um mesmo isolado apenas após o alocadas dentro deste novo gênero. No Brasil, a
seqüenciamento. Isto justifica o resultado encontrado na literatura consultada não relatou trabalhos sobre a
tabela 4 para a cultura CM2 no meio M17 (Cocos Gram ocorrência deste microrganismo em queijos. A presença
positivo, catalase positivo). de Weissella spp. em queijos também pode ser
relacionada aos mesmos fatores que justificam a
4.4.1. Diversidade da microbiota dos queijos de presença de Lactobacillus spp., como descrito
coalho anteriormente.

Os resultados mostram uma grande diversidade de Como no presente trabalho, pesquisas realizadas no
microrganismos identificados a partir das amostras de continente Europeu relatando a presença de Weissella
queijo de coalho produzido no estado de Pernambuco spp. em queijos também foram publicadas. Estes
(Anexo H). Essa diversidade pode ser explicada, em trabalhos foram conduzidos na Alemanha (Roushdy et
parte, no caso das amostras de queijos artesanais por al., 1998), Itália (Morea et al., 1998; Baruzzi et al.,
serem elaborados a partir de leite cru, que apresentaria 2002), França (Amiel et al., 2000), Reino Unido
uma microbiota mais variada em relação àquela do leite (Williams e Banks, 1997; Williams et al., 2000),
pasteurizado. Além disto, a microbiota dos queijos Espanha (Mas et al., 2002) e Grécia (Gerasi et al.,
industriais seria definida pela adição de culturas lácteas 2003). Diferente da espécie de Weissella isolada em
ao leite pasteurizado. Entretanto, a manipulação da queijo de coalho artesanal (W. confusa), os trabalhos
massa durante a fabricação do queijo, a qualidade da europeus descrevem a identificação de Weissella
água utilizada durante o processamento e a não paramesenteroides e Weissella helenica.
implantação correta das BPF’s pelas indústrias pode Microrganismos deste gênero estariam envolvidos em
levar a contaminação do leite, após a pasteurização. reações de proteólise, sendo importantes para o
Deve-se considerar ainda a existência de cepas de BAL desenvolvimento de “flavour” característico em queijos
termodúricas (Hammes e Vogel, 1995). maturados.

A presença de BAL em queijos artesanais foi descrita Normalmente, são encontradas bactérias como
por Bouberikri e Otha (1996), Héberta et al. (2000), Lactococcus lactis em queijos, decorrentes de sua
López-Dias (2000), Caridi (2003), Gerasi et al. (2003), presença no leite cru, em superfícies e equipamentos de
Fortina et al. (2003) e Manolopoulou et al. (2003) em laticínios ou da utilização de culturas lácticas (Chaves et
diferentes países do mundo. Entretanto, no Brasil, os al., 1995, Perez et al., 1998, Blaiotta et al., 2002, Gatto
dados da literatura pesquisada são escassos com relação et al., 2002 e Fortina et al., 2003). No presente trabalho,
à este tipo de estudo. Oliveira e Garcia (1986), Furtado além desta espécie, também foi isolada e identificada
(1990) e Leite et al. (1997) isolaram de BAL de queijo cultura de Lactococcus raffinolactis. Perez et al. (1998)
artesanal, incluindo principalmente, Lactococcus spp., e Blaiotta et al. (2002) também isolaram Lactococcus
Lactobacillus spp. e Streptococcus spp. raffinolactis a partir de amostras de queijo Idiazabal (da
Espanha) e no ambiente de laticínios da Itália,
A presença de BAL em queijos pode ser explicada pela respectivamente.
presença destes microrganismos no leite cru,
ocasionalmente na água e em vegetais que poderiam Outro gênero de microrganismo bastante comum de ser
contaminar o leite. No caso dos queijos industriais, estas isolado em queijos é o Streptococcus (Amiel et al.,
bactérias podem estar presentes por constituir as 2000, Baruzzi et al., 2002; Gatto et al., 2002). Nos
culturas lácticas utilizadas, como seriam os casos de queijos de coalho pesquisados, detectou-se a presença
Lactobacillus spp., Lactococcus spp. e Streptococcus de Streptococcus thermophilus em amostras artesanais
thermophilus. Este fato era esperado e desejável. (AB1MRS e SM4M17) e industriais (BL1MRS e
BL2M17). Em ambos tipos de queijo, sua presença pode
estar relacionada à microbiota original do leite cru, pois espécie de bactéria pertence à família
algumas linhagens de Streptococcus thermophilus são Enterobacteriaceae sendo relacionada a problemas em
termodúricas, podendo estar presente também na cultivos de vegetais, causando uma doença denominada
microbiota de leite pasteurizado. Adicionalmente, no “Fire Blight of Pear”, que acomete frutas, como pêras e
caso de queijos industrializados, a presença deste maçãs (Pusey, 1999). Outras espécies deste gênero
microrganismo pode ser traçada à sua utilização na foram isoladas de queijos artesanais europeus: Erwinia
composição das culturas lácticas utilizadas na spp. em queijo Serra da Estrela de Portugal (Tavaria e
elaboração deste alimento, como seriam os casos de Malcata, 2000) e Erwinia nitrifluens em queijo
BL1MRS e BL2MRS. Valdeteja da Espanha (Alonso et al., 2002). Este
resultado, bem como a presença de outras
A presença de Enterococcus spp. pode ser relacionada Enterobactérias (Escherichia coli – CM2>M17),
ao processamento de alimentos produzidos sem demonstra prováveis problemas associados à
tratamento térmico, particularmente em queijos manipulação e falta de higiene durante a elaboração dos
elaborados a partir de leite cru. Estes microrganismos queijos, podendo causar defeitos como estufamento
podem contribuir nos processos de maturação de precoce (FURTADO 1990). Isto pode ser comprovado
queijos, proporcionando “flavour” característico. por aspectos da produção dos queijos no item 7.1.
Entretanto, determinadas linhagens de Enterococcus
podem atuar como probióticos ou como patógenos, 4.5. Isolamento, Enumeração, Purificação e
tornando sua presença neste alimento um fator de risco Identificação de Microrganismos Patógenos
à saúde pública (Flair-Flow-Europe, 2003). (Coliformes a 30 °C e 45 °C, Escherichia coli
O157:H7, Salmonella spp., Listeria spp.)
Diferentes espécies de Enterococcus foram isoladas e
presentes em Queijo de Coalho artesanal e
identificadas por técnicas de biologia molecular, a partir
de amostras de queijo Ragusano, típico da Sicília, Itália.
Industrial, produzido no Estado de
As principais espécies isoladas foram: E. durans, E. Pernambuco.
faecium e E. faecalis (GATTO et al., 2002).
Os resultados da contagem de coliformes totais,
Um resultado bastante inesperado foi a identificação de coliformes fecais e da pesquisa de E. coli O157;H7,
uma cultura de Erwinia amylovora (CM3M17). Esta Lsteria sp. e Salmonella sp. nos queijos estão
apresentados na tabela 6:

Tabela 6: Resultados da contagem de coliformes a 30 °C e a 45 °C e da pesquisa de E. coli O157:H7, Salmonella sp. e


Listeria sp. em queijo de coalho

Amostra Coliformes (NMP/g) Pesquisa

30 °C 45 °C E. Coli O157:H7 Salmonella sp. Listeria sp.


LV > 1100 > 1100 ND ND Listeria spp
CM > 1100 > 1100 ND ND
AB > 1100 > 1100 ND ND Listeria spp
AQ > 1100 > 1100 ND ND
BL > 1100 > 1100 ND ND L. monocytogenes
SM > 1100 > 1100 ND ND
ND = Não Detectado

Os queijos analisados apresentaram elevada população 45°C) detectado nas amostras estava fora do limite
de bactérias do grupo coliforme 30 e 45 °C, estabelecido pela legislação (Agência Nacional de
evidenciando contaminação do produto. A presença de Vigilância Sanitária, 2001).
coliformes fecais geralmente é atribuída a deficiências
nas condições higiênico-sanitárias, durante o processo A ocorrência de coliformes em queijo de coalho,
de obtenção do produto e, indica contaminação de principalmente os artesanais, em níveis superiores aos
origem fecal. Além disso, estes queijos representam um permitidos pela legislação, também tem sido observada
risco para a saúde da população pela possibilidade de em muitos trabalhos (Florentino e Martins, 1999; Paiva
veicular cepas patogênicas de E. coli, pertencentes aos e Cardonha, 1999, Bruno et al., 2005). No Rio Grande
grupos EPEC, EIEC, ETEC e EHEC. Embora E.coli do Norte, Feitosa e outros (2003) observaram que 36%
O157:H7 não tenha sido isolada, outras linhagens (4/11) das amostras de queijo de coalho produzido no
patogênicas de ETEC, VTEC e NTEC podem estar Estado apresentavam coliformes fecais em valores
presentes. Os coliformes podem causar defeitos como o superiores ao estabelecido pela legislação. Borges e
estufamento precoce, alteração do formato e do sabor outros (2003) constataram que 74,4% (32/43) das
nos produtos lácteos e causar à deterioração do alimento amostras de queijo de coalho artesanal e industrial,
(Franco e Landgraf, 1996). O nível de coliformes (30 e produzidos em 11 municípios do Ceará, continham
níveis de coliformes fecais e E. coli superiores ao (2005) quando pesquisaram esta bactéria em queijo de
padrão microbiológico. coalho artesanal e industrial comercializados em
Fortaleza (CE).
Neste trabalho Salmonella spp. não foram detectadas Em pesquisa semelhante realizada por Rocha (2004) em
nas amostras analisadas (Tabela 3). A presença de uma linha de produção de queijo Minas frescal, a
Salmonella spp. também não foi constatada em outros presença de L. monocytogenes também não foi
estudos.. Ávila e Gallo (1996) não isolaram esta bactéria constatada na linha de produção, mesmo tendo sido
em 57 (100%) amostras de produtos lácteos (leite cru, observada alta prevalência de outras quatro espécies de
leite tipo C e queijo Minas frescal) comercializados no Listeria em superfícies de equipamentos e de ambientes.
município de Piracicaba – SP. Em outro estudo, Pereira Nero e outros (2004) não isolaram L. monocytogenes
et. al (1999) avaliaram 168 amostras de queijos (Minas em leite cru, proveniente de 210 propriedades leiteiras
Padrão, Minas Frescal e Canastra) e constataram localizadas nos estados de Minas Gerais, Rio Grande do
ausência do patógeno em 100% dos queijos. Em uma Sul, Paraná e São Paulo. Nos Estados Unidos, Canadá e
pesquisa conduzida por Cotton e White (1992), em seis Europa, apenas 3-4% do leite cru apresentou
indústrias beneficiadoras de leite e quatro produtoras de contaminação por Listeria spp. (Kozak et al., 1996). L.
sorvete, Salmonella spp. estavam presentes em apenas monocytogenes não foi detectada em 100% das
1,2% (4/353) das amostras ambientais. amostras de leite (13) e queijo Minas frescal (25)
estudadas por Rocha (2004). Em outro estudo,
Das amostras analisadas, Listeria spp. foi isolada em Cassarotti, Gallo e Camargo (1994) não detectaram L.
três delas, incluindo as duas amostras (BL e LV) de monocytogenes em 100% (57) das amostras de leite cru,
queijo de coalho feito a partir de leite pasteurizado. leite pasteurizado tipo C e queijos Minas frescal. Em
Listeria monocytogenes foi a espécie identificada na queijo mussarela de leite de búfala pasteurizado,
amostra BL. Entre os microrganismos patogênicos Listeria spp. não foi isolado nas 72 amostras analisadas
encontrados, Listeria monocytogenes pode ser (Olivieri, 2004).
considerada um dos mais sérios com relação à saúde
pública, devido a gravidade da doença por ela causada e A partir do método utilizado para a pesquisa de
pela alta taxa de letalidade (Centers for Disease Control coliformes, foi possível identificar a presença de E. coli,
and Prevention, 2002). Klebsiela sp., Enterobacter sp., Citrobacter sp..
Adicionalmente, outras bactérias Gram-negativo, não
A presença de Listeria spp. em queijos também foi pertencentes ao grupo dos coliformes, foram isoladas e
relatada por Silva et al. (2003) que realizaram um identificadas: Pseudomonas sp. e Proteus sp. (Quadro
estudo sobre a ocorrência desta bactéria em pontos 2).
críticos de controle do ambiente do processamento de
queijo Minas frescal. Foram colhidas 218 amostras ao A presença desses microrganismos demonstra as
longo da linha de produção e do ambiente, sendo que, condições inadequadas de processamento, manipulação
destas, 30 foram positivas para este microrganismo. As e estocagem das amostras analisadas indicando a
espécies identificadas foram: Listeria innocua, Listeria contaminação microbiana de origem fecal e a possível
grayi e Listeria monocytogenes. presença de linhagens de E. coli patogênicas para o
homem e animais (Franco; Landgraf, 1996). Os
Feitosa e outros (2003) avaliaram a qualidade coliformes podem causar defeitos nos produtos lácteos
microbiológica de queijo de coalho artesanal produzido levando à deterioração do alimento, como o estufamento
no Rio Grande do Norte e não constataram a presença precoce, alteração do formato e do sabor. Além disto,
de L. monocytogenes, embora 9% das amostras de indicam a probabilidade da existência de outros
queijos estivessem contaminadas por Listeria sp. patógenos Gram negativo
Resultado similar foi observado por Bruno e outros
.

Tabela 7: Espécies de microrganismos do grupo coliforme e outros Gram negativo identificados em amostras de queijo
de coalho artesanal e industrial, produzidos em Pernambuco

Amostra Klebsiela sp. Enterobacter sp. Citrobacter sp. E. coli Proteus sp. Pseudomonas sp.
CM + + ND + ND +
AB + ND ND + ND +
AQ ND + + + ND +
BL ND ND + + ND +
SM ND + ND ND + ND
LV + ND ND ND ND ND
ND = Não Detectado

A presença de Pseudomonas sp. em quatro das seis bactéria pode causar infecção intestinal (enterite e
amostras analisadas, incluindo uma amostra de queijo enterocolite), levando a diarréia de evolução
de coalho industrial, é preocupante devido a prolongada, que pode terminar em caquexia; ou diarréia
possibilidade de Pseudomonas aeruginosa ser a espécie aguda com comprometimento do equilíbrio hídrico e
envolvida, pois é a mais patogênica para o homem. Esta eletrolítico. Também podem ocorrer infecções auditivas,
respiratórias, urinárias, nervosas, oculares, cutâneas e coliformes a 45º indicam a presença de outras bactérias
até septicemia. Gram negativo termotolerantes, como Klebsiella sp..
Este resultado demostra problemas higiênico-sanitários
A enumeração de E. coli por Simplate esta apresentada ocorridos durante a produção dos queijos. A presença
no quadro 3. A enumeração confirmou os dados da dessas bactérias sugere a possibilidade da presença de
pesquisa de coliformes a 45ºC (pela técnica dos túbos patógenos como Proteus sp. e Shigella sp.. Entretanto,
múltiplos), sendo que nas amostras CM e AQ, contagens Salmonella sp não foi detectada.
menores de E. coli em relação aos maiores NMP de

Tabela 8: Enumeração de E. coli (NMP/g) em amostras de queijo de coalho artesanal e industrial produzidos em
Pernambuco

Amostras Escherichia coli (NMP/g)


LV 190
CM 28
AB 470
AQ 6
BL > 738
SM 440
4.6. Isolamento, enumeração, purificação e para produzirem casos de
identificação de Staphylococcus spp. e suas toxinfecção (Carmo et al., 1996). Este fato compromete
enterotoxinas a segurança alimentar deste produto, mesmo se
consumido após receber algum tipo de tratamento
Verificaram-se elevadas contagens deste microrganismo, térmico, pois as enterotoxinas estafilocócicas são
tanto nas amostras de queijo artesanal quanto nas termoestáveis, podendo, desta forma, ocasionar surtos
amostras de queijo industrializado. Os níveis (Carmo et al, 2002). Adicionalmente, as condições de
populacionais encontrados foram superiores a 106 transporte e comercialização destes queijos, realizadas
UFC/g (Tabela 9), sendo estes valores de grande de forma inadequada, sob temperaturas superiores às de
preocupação do ponto de vista de saúde pública, pois refrigeração proporcionam condições para o
indicam quantidades suficientes deste patógeno para a microrganismo crescer e produzir estas enterotoxinas
produção de enterotoxinas em quantidades suficientes (BergdolL, 1989).

Tabela 9: Enumeração de Staphylococcus spp. em amostras de queijo de coalho artesanal e industrializado

QUEIJO Staphylococcus spp.


(UFC/g)
LV 1,8 x 107
BL 6,7 x 106
AQ 1,1 x 106
CM 2,0 x 107
AB 2,0 x 107
SM 2,7 x 107

Os resultados demonstrados na Tabela 9 reforçam os deste patógeno em queijos. Este resultado reforça as
achados na literatura que apontam o Staphylococcus conclusões de Carmo (2001), indicando que
como o principal patógeno envolvido em casos de Staphylococcus spp. e suas enterotoxinas são um dos
toxinfecção alimentar relacionadas ao consumo de principais microrganismos de preocupação em
queijo (Cerqueira et al., 1994, Carmo et al., 1996, alimentos pasteurizados.
Carmo et al, 2002), em especial o queijo de coalho
(Sena, 2000). Estes resultados são bastante A presença de Staphylococcus spp. nestes queijos
significativos, pois, considerando-se apenas também está relacionada à manipulação inadequada do
Staphylococcus spp. verificaram-se contagens produto. Tal fato pode ocorrer durante as várias etapas
semelhantes àquelas de BAL (Tabela 3), demonstrando de produção dos queijos, incluindo a salga e a
poder não haver relação entre as populações de BAL e enformagem, como pôde ser documentada na produção
de Staphylococcus sp. A presença de Staphylococcus artesanal e até mesmo industrial. Apesar do laticínio LV
aureus produtores de enterotoxinas em queijo de coalho ter implantado BPF´s, a salga e a enformagem
foi também descrita por Florentino e Martins (1999), tornaram-se pontos críticos pela excessiva manipulação.
Mendes et al. (1999), Leite-Júnior et al. (2000); Sena A presença deste microrganismo em queijos
(2000); Bastos et al. (2001), Escobar et al. (2001) e industrializados também está associada à falta de
Rapini et al. (2002). cuidados higiênico-sanitários durante o processamento
dos mesmos. Ressalta-se que o homem é a principal
Pode-se perceber contagens semelhantes de fonte de contaminação de Staphylococcus spp. em
Staphylococcus spp. em queijos artesanais e industriais produtos submetidos à pasteurização, pois 30 a 50% das
(Tabela 9), demonstrando que a pasteurização do leite pessoas sadias são portadores deste microrganismo. O
não deve ser a única medida de controle da presença mesmo pode ser encontrado nas fossas nasais, nos leitos
sub-ungueais, nas mãos e na garganta dos portadores,
além de furúnculos e feridas supurativas da pele Não foram detectadas cepas produtoras de TSST-1,
(Moutinho, 2001). Além disto, água, utensílios e sendo este resultado diferente daquele obtido por Sena
equipamentos mal higienizados dentro dos laticínios et al. (1998) que isolaram cepas de Staphylococcus spp.
também podem ser fonte de contaminação deste produtoras desta toxina.
microrganismo.
A identificação das espécies de Staphylococcus foi 4.7. Teste de antagonismo "in vitro" entre as
realizada por intermédio de provas bioquímicas citadas cepas isoladas de queijo de coalho e contra
anteriormente. Trinta e dois isolados foram identificados
microrganismos indicadores
como Staphylococcus aureus, três como Staphylococcus
cohnii e um como Staphylococcus intermedius.
Para realização dos testes de antagonismo “in vitro”, as
Resultados semelhantes foram descritos por Sena
amostras de BAL, isoladas dos queijo de coalho, foram
(2000), ao pesquisar a presença destes microrganismos
testadas frente às mesmas, frente a três cepas de
em queijo de coalho, comercializado em Recife (PE).
Staphylococcus (S. aureus, S. cohnii e S. intermedius) e
uma de Escherichia coli isoladas destes queijos, e
De acordo com a caracterização bioquímica destas
também frente à microrganismos de referência.
cepas (Anexo E), pode-se perceber a predominância de
Staphylococcus spp. coagulase positivo, o que seria
refletido em contagens destes microrganismos acima
4.7.1. Atividade antagonista frente a BAL,
dos padrões oficiais estabelecidos para a inspeção de isoladas de queijo de coalho
queijos de média e alta umidade (Brasil, 1996; Brasil,
2001) em todas as amostras de queijo de coalho Pode-se observar, quando são comparadas as atividades
pesquisadas. antagonistas das espécies de BAL testadas frente às
mesmas e à outras BAL também isoladas das mesmas
A pesquisa de enterotoxinas, realizada pela técnica de amostras de queijo de coalho (Tabela 10), que houve
OSP, revelou a produção de SEB em dois “pools”, grande variação com relação aos valores dos diâmetros
contendo Staphylococcus aureus isolados do queijo AQ, dos halos de inibição. Além disto, percebe-se que nem
e também da cultura de Staphylococcus cohnii, sempre uma mesma cultura foi inibida por todas as
coagulase negativo, isolado do queijo LV, testada culturas potencialmente antagonistas utilizadas.
isoladamente. Detectou-se a presença de cepas Entretanto, verificou-se que as culturas reveladoras
potencialmente produtoras de enterotoxina em queijo Lactobacillus fermentum, (AB3MRS), Streptococcus
artesanal e industrializado, demonstrando mais uma vez thermophilus (BL1MRS) e Lactobacillus acidophilus
a necessidade de melhoria das condições de (LV3MRS) não foram inibidas por nenhuma cultura
processamento destes alimentos. Sena (2000) e Rapini produtora de substância(s) antagonista(s). Esta
et al. (2002) também detectaram a presença de característica seria desejável para a sobrevivência destes
Staphylococcus spp. produtores de SEB em amostras de microrganismos em ambientes que apresentam uma
queijo de coalho, adquiridas no comércio varejista do microbiota diversificada e complexa, como é o caso dos
Nordeste. queijos.

Como no presente trabalho, Sena (1998), Sena (2000), A análise estatística não paramétrica destes resultados
Carmo (2001) e Carmo et al. (2002) demonstraram a (Tabela 10) demonstrou que não houve diferença
presença de cepas de Staphylococcus spp. coagulase significativa (p>0,05) entre as atividades antagonistas
negativo produtoras de enterotoxinas. Isto ressalta a das culturas produtoras frente às BAL reveladoras.
necessidade de se rever a legislação em vigor (Brasil, Portanto, apesar das culturas de Lactobacillus spp.
2001), que determina a pesquisa de Staphylococcus terem inibido um maior número de culturas reveladoras
apenas coagulase positivo em queijo de coalho. em relação aos Lactococcus spp. testados
estatisticamente, esta diferença não foi verificada
.

Tabela 10: Atividade antagonista de culturas de BAL isoladas de queijo de coalho frente às mesmas e a outras BAL
(halo de inibição em mm)

Reveladora AB2MRS AB3MRS AQ1MRS LV3MRS CM2<M17 AQ4M17


AB1MRS 30,75 33,73 51,70 16,65 19,72 0
AB2MRS - 0 19,14 0 0 0
AB3MRS 0 - 0 0 0 0
AQ1MRS 22,58 17,07 - 0 0 0
AQ2MRS 9,77 0 13,95 53,72 0 0
BL1MRS 0 0 0 0 0 0
CM3MRS 24,05 0 33,22 0 0 0
CM4MRS 41,92 33,00 37,17 27,87 21,00 0
LV1MRS 33,08 38,62 39,07 17,78 17,49 27,98
LV3MRS 0 0 0 - 0 0
AQ4M17 25,10 23,20 22,27 28,50 18,72 0
CM2<M17 0 0 0 21,40 - 23,31
Média 15,60a 12,13a 18,04a 13,82a 6,41a 5,03a
a
Letras minúsculas sobrescritas distintas indicam valores das médias estatisticamente diferentes (p<0,05)
AB2MRS = L. casei; AB3MRS = L. fermentum; AQ1MRS = L. rhamnosus; AQ2MRS = E. faecalis; BL1MRS = S. thermophilus; CM3MRS = W.
confusa; CM4MRS = E. faecalis; LV1MRS = E. faecalis; LV3MRS = L. acidophilus; AQ4M17 = L. raffinolactis; CM2<M17 = L. lactis.

Estes resultados demonstram o potencial de e Escherichia coli isoladas das mesmas amostras de
antagonismo in vitro, mas não necessariamente este queijo de coalho. Houve grande variação dos valores
antagonismo ocorra in vivo. Isto porque as cepas de dos diâmetros dos halos de inibição, principalmente,
BAL AB1MRS, AB2MRS e AB3MRS demonstraram porque a cultura AQ4M17 (Lactococcus raffinolactis)
atividade antagonista entre elas no teste in vitro e, no não apresentou nenhum tipo de antagonismo frente à
entanto estão presentes no mesmo queijo (AB). estes indicadores.

Para a seleção de BAL isoladas de queijo de coalho com Portanto, verificou-se que os Lactobacillus spp.
a finalidade de compor culturas que poderiam melhorar apresentaram melhor potencial de inibição em relação
a qualidade sanitária deste alimento, o ideal seria que aos Lactococcus spp., quando testados frente à estes
estas não interferissem com a atividade de outras BAL patógenos. Isto foi confirmado pela avaliação estatística
desejáveis. Desta forma, de acordo com os resultados dos dados, demonstrando que as atividades antagonistas
estatísticos demonstrados acima, qualquer uma das de Lactobacillus casei (AB2MRS) e Lactobacillus
culturas isoladas de Lactobacillus spp. e Lactococcus rhamnosus (AQ1MRS) foram superiores (p<0,05) às de
spp. poderia ser utilizada com a finalidade anterior, Lactococcus lactis (CM2<M17) e Lactococcus
mantendo as propriedades sensoriais típicas deste raffinolactis (AQ4M17). Estes resultados mostram um
alimento. melhor potencial de utilização destes Lactobacillus spp.
para a melhoria da qualidade do queijo de coalho, em
4.7.2. Atividade antagonista frente a relação ao controle do desenvolvimento de bactérias
Staphylococcus spp. e Escherichia coli, isolados indesejáveis, isoladas neste mesmo tipo de queijo. Este
de queijo de coalho fato é relevante, pois Staphylococcus spp. é o principal
patógeno encontrado neste alimento (SENA, 2000) e
De acordo com os dados demonstrados na Tabela 11, Escherichia coli também está freqüentemente presente
percebe-se que todos os Lactobacillus spp. testados neste queijo, quando elaborado sem adoção de medidas
foram capazes de inibir as cepas de Staphylococcus spp. higiênico-sanitárias (Leite-Júnior et al., 2000; Bastos et
al., 2001; Escobar et al., 2001; Nascimento et al., 2001).

Tabela 11: Atividade antagonista de culturas de BAL isoladas de queijo de coalho frente a Staphylococcus spp. e
Escherichia coli (halo de inibição em mm)

Reveladora AB2MRS AB3MRS AQ1MRS LV3MRS CM2<M17 AQ4M17


CM2>M17 36,62 29,27 34,70 27,23 0 0
LVAT5 33,82 27,14 40,31 28,90 0 0
AQAT1 43,38 29,07 37,41 30,11 19,41 0
SMTP2 46,64 43,51 45,99 31,86 23,42 0
Média 40,11a 32,24abc 39,60a 43,55abd 10,70 bcd 0 bcd
a
Letras minúsculas sobrescritas distintas indicam valores das médias estatisticamente diferentes (p<0,05) AB2MRS = L. casei; AB3MRS = L.
fermentum; AQ1MRS = L. rhamnosus; LV3MRS = L. acidophilus; AQ4M17 = L. raffinolactis; CM2<M17 = L. lactis; CM2>M17 = E. coli; LVAT5 =
S. cohnii; AQAT1 = S. intermedius; SMTP2 = S. aureus

4.7.3. Atividade antagonista frente a cepas


referência de patógenos relevantes em saúde Avaliando estes resultados à luz da estatística, percebe-
pública se que houve diferenças significativas (P<0,05) entre as
atividades antagonistas pesquisadas. Lactobacillus casei
Como observado nos outros testes de antagonismo, os (AB2MRS), Lactobacillus fermentum (AB3MRS) e
resultados das inibições de patógenos de referência Lactobacillus rhamnosus (AQ1MRS) foram os
pelos microrganismos testados (Tabela 12) microrganismos que apresentaram halos de inibição
demonstraram grande variação com relação aos valores significativamente maiores (p<0,05) contra as bactérias
dos diâmetros dos halos de inibição. A única cultura que de referência testadas. Mais uma vez, os Lactobacillus
deixou de inibir algum tipo de bactéria reveladora, spp. tiveram maior potencial antagonista em relação aos
como ocorreu nos outros testes, foi Lactococcus Lactococcus spp., realçando ainda mais efeitos
raffinolactis (AQ4M17), não atuando frente a inibitórios benéficos dos primeiros, tanto contra
Salmonella Enteritidis typhimurium, Listeria patógenos de relevância nos queijos de coalho, quanto
monocytogenes e Escherichia coli. contra patógenos de referência.
Tabela 12: Atividade antagonista de culturas de BAL isoladas de queijo de coalho frente a patógenos de referência

Reveladora AB2MRS AB3MRS AQ1MRS LV3MRS CM2<M17 AQ4M17


BC 87,25 90,00 90,00 71,64 36,84 32,54
AS 51,88 49,54 52,61 33,17 20,16 16,61
SE 45,30 43,40 47,24 30,88 22,93 0
YE 35,33 37,39 46,50 33,73 25,09 43,28
LM 35,03 47,07 44,80 39,14 22,81 0
ST 44,98 41,89 39,87 32,61 26,07 24,09
SF 79,20 84,18 86,22 90,00 63,60 53,62
PA 89,12 81,92 86,12 34,65 74,60 41,79
EC 54,62 41,17 69,77 28,04 54,87 0
a a a ab ab
Média 58,07 57,39 62,57 43,76 38,55 23,54 b
a
Letras minúsculas sobrescritas distintas indicam valores das médias estatisticamente diferentes (P < 0,05)
AB2MRS = L. casei; AB3MRS = L. fermentum; AQ1MRS = L. rhamnosus; LV3MRS = L. acidophilus; AQ4M17 = L. raffinolactis; CM2<M17 = L.
lactis; BC = B. cereus (ATCC); AS = S. aureus (ATCC29213); SE = S. enteritidis Typhimurium (ATCC12228); YE = Y. enterocolitica (ATCC); LM =
L. monocytogenes (ATCC15313); ST = S. typhi (ATCC14028); SF = S. flexneri; PA = P. aeruginosa; EC = E. coli (ATCC25723)

Adicionalmente, analisando os resultados dos relatada por outros pesquisadores. Fang et al. (1998)
antagonismos, considerando todos os tipos de inibição verificaram atuação contra Staphylococcus aureus e
pesquisados (contra bactérias desejáveis e indesejáveis), Escherichia coli, Brearhers e Durre (1999) observaram
a análise estatística de Kruskal-Wallis revelou que a ação antagonista contra Salmonella spp. e Escherichia
cultura Lactobacillus rhamnosus (AQ1MRS) foi aquela coli O157:H7 e Uraz et al. (2001) detectaram inibição
que apresentou maior média de halos de inibição, frente à Bacillus cereus.
enquanto que a cultura Lactococcus raffinolactis
(AQ4M17) demonstrou ser aquela com menor média de Todas as atividades inibitórias verificadas nos itens
halos de inibição. Entre a s espécies de Lactobacillus a anteriores relacionadas ao antagonismo de
amostra L acidophilus (LV3) foi a que apresentou microrganismos indicadores desejáveis ou não podem
menores halos de inibição frente aos patógenos de ser justificadas pela produção de substâncias inibidoras
referência. que teriam se difundido pelo ágar e impedido o
crescimento das culturas reveladoras. Dentre estas,
Resultados semelhantes aos deste trabalho foram podem ser citados: ácidos orgânicos (como ácido
encontrados por outros autores que também láctico), peróxido de hidrogênio, dióxido de carbono,
demonstraram atividade antagonista de Lactobacillus diacetil, acetaldeido e substâncias antimicrobianas de
spp. isolados de queijos artesanais frente à patógenos, natureza protéica, denominadas bacteriocinas (Naidu et
como podem ser citados: Vaughan et al. (1994), por al., 1999). Como as BAL isoladas e testadas
exemplo, verificaram inibição de Staphylococcus apresentaram comportamento respiratório diversificado,
aureus, Listeria innocua e Pseudomonas fragi; Lactobacillus spp. e Lactococcus spp. testados no
Alexandre et al. (2002) detectaram atividade antagonista antagonismo e se comportaram como microaerófilos nos
contra Staphylococcus aureus, Listeria monocytogenes, testes respiratórios (Tabelas 4 e 5), qualquer um destes
Listeria innocua, Salmonella Enteritidis thyphimurium. mecanismos poderia estar envolvido na inibição das
Caridi et al. (2003) observaram antagonismo frente à culturas reveladoras.
Escherichia coli. Estas observações indicam uma
interessante perspectiva tecnológica de utilização destas
culturas de BAL para o controle de patógenos em
queijos artesanais, principalmente. Entretanto, é
necessário se avaliar a viabilidade de utilização destes
microrganismos com relação às características ligadas 4.8. Teste de sensibilidade das bactérias ácido-
ao sabor e as outras propriedades organolépticas lácticas isoladas frente aos antimicrobianos
desejáveis do produto.
A sensibilidade dos microrganismos (BAL, Escherichia
Adicionalmente, atividade antagonista de BAL isolada coli e Staphylococcus spp.) isolados de queijo de coalho
de leite frente a bactérias indesejáveis também foi aos principais grupos de drogas antimicrobianas foi
testada, utilizando-se técnica de difusão em ágar MRS e antimicrobianas revelou um perfil de resistência
Müller-Hinton. indesejável da maioria destes microrganismos aos
diferentes grupos de antimicrobianos testados (Tabelas
O teste de sensibilidade de BAL, isoladas de queijo de 13 e 14).
coalho artesanal, frente a diversas drogas

Tabela 13: Perfil de resistência de microrganismos isolados de queijo de coalho em teste de difusão em ágar MRS com
discos de antimicrobianos
Cultura AK KF CIP SXT CTX C E CN OX P TE VA
AB2MRS R S MS R S S S R R S S R
AB3MRS R S R R S S S R R S S R
AQ1MRS R S S R S S S S R S S R
BL1MRS R S R MS S S S R MS S S R
CM2>M17 R S MS R R S S R R MS S S
CM3MRS R S R R S S S S R S S R
S = sensível; MS = moderadamente sensível; R = resistente
AK=AMIKACINA; KF=CEFALOTINA; CIP=CIPROFLOXACIN; SXT=SULFA-TRIMETROPRIM; CTX=CEFOTAXIME;
C=CLORANFENICOL; E=ERITROMICINA; CN=GENTAMICINA; OX=OXACILINA; P=PENICILINA; TE=TETRACICLINA;
VA=VANCOMICINA
AB2MRS = L. casei; AB3MRS = L. fermentum; AQ1MRS = L. rhamnosus; BL1MRS = S. thermophilus; CM2>M17 = E. coli; CM3MRS =
Weissella confusa;

A maioria dos microrganismos testados mostrou-se animais de produção é proibida (Brasil, 2003b). Tal fato
resistente a amikacina e a oxacilina, sendo observada se deve aos riscos da presença de seus resíduos em
também menor sensibilidade dos mesmos à associação alimentos de origem animal, pois estes podem induzir o
sulfa-trimetroprim e a vancomicina. A resistência de aparecimento de cepas de microrganismos resistentes ao
Lactobacillus spp. a vancomicina é uma característica cloranfenicol e causar efeitos hematotóxicos no homem,
comum, sendo associada a este gênero (Christensen; incluindo reticulocitopenia, anemia e, em alguns casos,
Wind, 2003), porém neste trabalho, verificou-se que a leucopenia (granulocitopenia) e trombocitopenia (Food
cultura Lactobacillus acidophilus (LV3MRS) and Agriculture Organization / World Health
apresentou-se sensível a esta droga antimicrobiana, o Organization 1988; Yunis e Bloomberg, 1994).
que pode ser interessante, inclusive do ponto de vista
comercial, uma vez que não é interessante se usar Observou-se também maior sensibilidade dos
culturas com propriedades de resistência aos microrganismos isolados frente a cefalotina, sendo
antimicrobianos na elaboração de produtos destinados resistente apenas o Lactococcus raffinolactis (AQ4M17)
ao consumo humano e animal, afim de se previnir a e moderadamente sensível, duas cepas de Enterococcus
transferência destes fatores de resistência a outros faecalis (AQ2MRS e CM4MRS).
microrganismos, principalmente patogênicos.
O microrganismo, dentre aqueles isolados de queijo de
Verificou-se um menor número de microrganismos coalho artesanal, que demonstrou maior resistência a um
isolados de queijo de coalho artesanal, sensíveis à ação maior número de drogas foi o Enterococcus faecalis
do cloranfenicol. Apenas uma cepa de Enterococcus (CM4MRS). Esta cultura apresentou-se resistente à oito
faecalis (CM4MRS) foi resistente à ação deste das doze drogas testadas, e moderadamente sensível a
antimicrobiano. A sensibilidade à esta droga seria uma destas drogas.
desejável, pois a utilização deste produto químico em
Tabela 14: Perfil de resistência de microrganismos isolados de queijo de coalho em teste de difusão em ágar Müller
Hinton frente a diferentes antimicrobianos

Cultura AK KF CIP SXT CTX C E CN OX P TE VA


AB1MRS S S MS S S S S S MS S S S
AQ2MRS R MS S S R S R R S R R S
AQ4M17 R R S S R S R R S R R S
BL2M17 R S S S R R R S R MS R S
CM1MRS S S S S S S S S R S S R
CM4MRS R MS S S R R R R R R R S
LV1MRS MS R S S R S S S R R S S
LV2MRS R R S S R S S S R R S S
LV3MRS S S S S S S R S MS S R S
AQAT1 S S S S R R S S S MS R S
LVAT5 S S S S S S S S S S S S
SMTP2 S S S S S S S S S S S S
S = sensível; MS = moderadamente sensível; R = resistente
AK=AMIKACINA; KF=CEFALOTINA; CIP=CIPROFLOXACIN; SXT=SULFA-TRIMETROPRIM; CTX=CEFOTAXIME;
C=CLORANFENICOL; E=ERITROMICINA; CN=GENTAMICINA; OX=OXACILINA; P=PENICILINA; TE=TETRACICLINA;
VA=VANCOMICINA
AB1MRS = S. thermophilus; AQ2MRS = E. faecalis; BL1MRS = S. thermophilus; CM4MRS = E. faecalis; LV1MRS = E. faecalis; LV2MRS = ;
LV3MRS = L. acidophilus; AQ4M17 = L. raffinolactis; LVAT5 = S. cohnii; AQAT1 = S. intermedius; SMTP2 = S. aureus; BC = B. cereus (ATCC);
AS = S. aureus (ATCC29213); SE = S. enteritidis typhimurium (ATCC12228); YE = Y. enterocolitica (ATCC); LM = L. monocytogenes
(ATCC15313); ST = S. typhi (ATCC14028); SF = S. flexneri; PA = P. aeruginosa; EC = E. coli (ATCC25723).

Enterococcus spp. estão amplamente distribuídos na Este resultado é ainda mais preocupante, quando se
natureza, sendo que os tratos gastro intestinais de observa que este queijo foi elaborado com adição de
humanos e animais são seus habitat naturais. Eles cultura láctica comercial, teoricamente composta por
podem contaminar alimentos crus e diversos gêneros bactérias selecionadas. Desta forma, não seria desejável
alimentícios através da água e inadequadas condições encontrar Streptococcus thermophilus multi-resistentes
higiênicas de produção e manipulação dos mesmos. aos antimicrobianos em sua constituição.
Estes microrganismos são conhecidos por terem
resistência à maioria dos antimicrobianos utilizados na Um importante fato a ser destacado, refere-se à
clínica humana e veterinária. Enterococcus spp. multi- possibilidade de transmissão entre microrganismos de
resistentes e resistentes à vancomicina são comumente fatores relacionados à resistência aos antimicrobianos
isolados de humanos, animais, habitat aquáticos e (Danielsen e Wind, 2003). Observando as tabelas 13 e
resíduos agropecuários, demonstrando a probabilidade 14, vrifica-se que alguns microrganismos presentes em
de estarem presentes na cadeia alimentar humana mesmas amostras de queijo de coalho (AB e AQ)
(Lukasova E Sustackova, 2003). Os Enterococcus spp. apresentam perfis de resistência às drogas testadas
resistentes à vancomicina são considerados uma ameaça praticamente idênticos. Estas bactérias seriam
à saúde pública em todo o mundo. Entretanto, no (AB3MRS) Lactobacillus casei e AB3MRS
presente trabalho, apesar de terem sido identificados (Lactobacillus fermentum) no queijo AB e AQ2MRS
Enterococcus faecalis multi-resistente, não foi (Enterococcus faecalis) e AQ4M17 (Lactococcus
verificada a resistência à vancomicina. raffinolactis) no queijo AQ. Tal resultado pode levantar
a hipótese de que uma cultura transmitiu estes fatores de
Chingwaru et al. (2003) isolaram Enterococcus faecalis resistência à outra, principalmente por se tratarem de
multi-resistentes à antimicrobianos em leite, carne espécies de microrganismos semelhantes, do ponto de
bovina e carne de frango. A presença de Enterococcus vista filogenético.
spp. multi-resistentes que podem ser transmitidos ao
homem por alimentos contaminados também tem sido A possibilidade de transmissão de fatores relacionados à
relacionada à problemas na medicina humana, como em resistência aos antimicrobianos pode ser observada
pacientes internados em centro de terapia intensiva também entre os microrganismos isolados de queijo de
(CTI) (Johnson et al., 2003). coalho industrial (Tabela 14). Na amostra LV duas cepas
de microrganismos LV1MRS (Enterococcus faecalis) e
Streptococcus thermophilus (AB1MRS), isolado de LV2MRS (sugestivo de Lactobacillus sp. do grupo
queijo artesanal, foi a cultura que demonstrou ser acidófilo) demonstraram perfis de sensibilidade frente
sensível a um maior número de antimicrobianos, sendo aos antimicrobianos testados praticamente iguais.
moderadamente sensível a apenas duas (oxacilina e
ciprofloxacina) das doze drogas testadas. Com relação ao resultado de perfil de sensibilidade
Contrariamente, a cepa Streptococcus thermophilus frente aos antimicrobianos testados, das cepas de
(BL2M17), isolada de queijo industrial, foi a que Staphylococcus spp. isoladas de queijo de coalho
apresentou resistência a um maior número de artesanal e industrial, apenas Staphylococcus
antimicrobianos testados, inclusive ao cloranfenicol. intermedius (AQAT), isolada de queijo de coalho
artesanal, apresentou resistência a alguns dos contagem de Lactobacillus spp nas fezes de
antimicrobianos utilizados, entre eles o cloranfenicol. A camundongos monoassociados, durante 10 dez dias,
resistência observada frente ao cloranfenicol reforça a após inóculo único de 108 células das linhagens de
possibilidade da utilização indevida desta droga nas Lactobacillus spp. Todas as amostras conseguiram
propriedades produtoras de leite. colonizar os animais em níveis que variavam desde 8,15
± 0,29 log UFC/g de fezes (L. fermentum AB3) até 9,53
A presença de bactérias resistente à ação de ± 0,45 log UFC/g de fezes (L. acidophilus LV3) 24
antimicrobianos em queijos pode ser indicativa de que o horas após a inoculação. Esses níveis populacionais
uso indiscriminado de antimicrobianos na produção variaram ao longo de 10 dias e a linhagem L.
leiteira cria uma pressão seletiva sobre os acidophilus LV3 foi a que apresentou contagem
microrganismos, levando à expressão de fenótipos de populacional estatisticamente superior, entretanto a
resistência frente a determinados grupos de drogas colonização foi muito semelhante entre a maioria das
antimicrobianas. Associado a este fato pode ocorrer leveduras ao final de 10 dias.
também à transmissão de fatores ligados à resistência
entre microrganismos, fazendo com que aqueles que Este primeiro experimento in vivo mostrou que todas as
antes apresentavam sensibilidade frente a determinado linhagens conseguiram se estabelecer e persistir no trato
antimicrobiano, passe a ser resistente a esta droga. Isto digestivo de animais isentos de germes por pelo menos
pode ter reflexos indesejáveis, tanto na medicina 10 dias (período em que a colonização foi
veterinária, quanto humana (Danielsen; Wind, 2003) acompanhada). Os níveis populacionais das 4 especies
nos animais monoassociados variaram de 108 a 109.
4.9. Determinação da capacidade de espécies de
Lactobacilus spp de colonizar o trato digestivo Todas as amostras foram capazes de colonizar o trato
de camundongos isentos de germes digestivo de animais isentos de germes e de se
manterem em níveis elevados. No animal convencional,
Para ser utilizado como probiótico, primeiramente um seriam necessárias ingestões diárias para que estes
microrganismo deve ser resistente às condições adversas mesmos níveis fossem mantidos, pois à exceção dos
do trato gastrointestinal e chegar ao seu local de ação e Lactobacillus rhamnosus GG e Lcr35, não se conhecem
permanecer em números elevados para que possa probióticos capazes de persistirem por um longo
exercer seu efeito benéfico. A tabela 3 mostra a período no trato digestivo do adulto (Alander et al.,
1999; De Champs et al., 2003).

Tabela 15: Contagem de Bactérias Ácido-Lácticas nas fezes de camundongos monoassociados, durante 10 dias, após o
inóculo inicial com 108 células.

Linhagem Tempo (dias)


Dia 1 Dia 2 Dia 5 Dia 10 Total
L. acidophilus LV3 9,53 ± 0,45 9,13 ± 0,05 9,15 ± 0,14 9,14 ± 0,06 9,24 ± 0,27 a
L. casei AB2 8,20 ± 0,17 8,03 ± 0,13 8,19 ± 0,25 8,78 ± 0,16 8,30 ± 0,34 b
L. fermentum AB3 8,15 ± 0,29 7,65 ± 0,57 8,24 ± 0,08 8,52 ± 0,24 8,14 ± 0,44 b
L. ramnhosus AQ1 8,58 ± 0,17 8,26 ± 0,46 8,50 ± 0,46 8,29 ± 0,06 8,41 ± 0,32 b
Os resultados estão expressos em log10 UFC/g de fezes. N = 5
a
Letras minúsculas sobrescritas distintas indicam valores das médias estatisticamente diferentes (P < 0,05)

4.9.1. Determinação dos níveis populacionais da digestivo onde agem os enteropatógenos.


levedura nas diversas porções do trato
gastrointestinal de camundongos gnotobióticos Um perfil de níveis populacionais semelhante foi
(GN) encontrado por Vasconcelos et al. (2003) com a espécie
L. murinus. Entretanto, nossos resultados divergem um
A Figura 1 apresenta os níveis populacionais de pouco uma vez que encontramos níveis populacionais
Lactobacillus spp no conteúdo do estomago, intestino mais elevados em animais convencionais e não em
delgado – porção distal –, ceco e cólon do trato animais monoassociados. Apesar dos níveis
gastrointestinal de camundongos NIH gnotobióticos populacionais diferentes observados nas linhagens
monoassociados com dose única de 108 células de L. estudadas o perfil geral entre elas é semelhante, sendo
casei AB2 (A), L. fermentum AB3 (B), L. acidophilus que estes níveis são consideravelmente altos no
LV3 e L. rhamnosus AQ1 (D). Os resultados mostram estômago, decrescem ligeiramente na porção proximal
que os níveis populacionais da linhagens de do intestino delgado e, a partir daí, aumentam e atingem
Lactobacillus spp foram maiores na porção distal do níveis máximos nas regiões onde o trânsito intestinal é
intestino delgado. Estes resultados mostram que as menor, como no ceco e no cólon.
linhagens atingiram níveis populacionais
potencialmente funcionais nas porções do trato O estômago de camundongos convencionais é
colonizado por espécies de Lactobacillus sp e leveduras
(Savage, 1977). Este fato pode explicar porque neste mais baixo e a provável falta de receptores de adesão,
modelo os níveis populacionais deste órgão alcançaram quando comparado com roedores, deve levar a
um número tão elevado. No estômago humano, o pH resultados diferentes.

A B
L . c a s e i A B 2 L . a c i d o p h il u s L V 3

1 2 1 2

1 0 1 0

8 8
L o g 1 0 U F C /g

L o g1 0 U F C /g
6 6

4 4

2 2

0 0
I I I I I I I V I I I I I I I V
P o r ç ã o d o t r a t o g a s t r o i n t e s t i n a l P o r ç ã o d o t r a t o g a s t r o i n t e s t i n a l

C D
L . r h a m n o s u s A Q 1 L . f e r m e n t u m A B 3

1 2 1 2

1 0 1 0

8 8
L o g 1 0 U F C /g
L o g 1 0 U F C /g

6 6

4 4

2 2

0 0
I I I I I I I V I I I I I I I V
P o r ç ã o d o t r a t o g a s t r o i n t e s t i n a l P o r ç ã o d o t r a t o g a s t r o i n t e s t i n a l

Figura 1. Níveis populacionais de Lactobacillus spp. no conteúdo do estômago (I), intestino delgado – porção dista (II),
ceco (III) e cólon (IV) do trato gastrointestinal de camundongos NIH gnotobióticos (A) monoassociados com dose
única de 108 L. casei AB2 (A); L. acidophilus LV3 (B); L. rhamnosus AQ1 (C) e L. fermentum AB3 (D). N = 5.

4.10. Determinação do efeito de Lactobacillus spp, os níveis populacionais se mantiveram entre 10 8 e


spp na colonização intestinal por S. 1010 UFC/g de fezes. Após o desafio os grupos
Typhimurium em camundongos gnotoxênicos monoassociados a L acidophilus e L. casei apresentaram
(GN) contagens dessas bactérias superiores às de S
Typhimurium. Nos demais grupos as contagens de
As Figuras 2 a 5 mostram as populações fecais de S. Lactobacillus spp e S Typhimurium foram equivalentes.
Typhimurium em camundongos NIH gnotobióticos, Pode-se observar também a maior sobrevivência dos
monoassociados ou não com uma dose de 108 células animais monoassociados a Lactobacillus spp em ralação
viáveis das amostras de Lactobacillus acidophlus LV3; aos não associados. Neste experimento, os animais
L. rhamnosus AQ1; L. casei AB2 e L. fermentum AB3, previamente monoassiciados aos Lactobacillus spp
respectivamente, dez dias antes do desafio com a tiveram menores contagens de bactérias patogênicas
bactéria patogênica. A cinética de instalação das quando comparado ao grupo isento de germes
bactérias também, é mostrada nestas figuras. Nos monoassociado a S. Typhimurium.
camundongos GN monoassociados com Lactobacillus
A produção de substâncias antagonistas por
Lactobacillus murinus contra bactérias número de células víaveis flutuou entre 109 e 1010 ufc/g
enteropatogênicas foi avaliada in vivo assim como um de fezes, número semelhante ao encontrado no nesse
possível efeito protetor contra um desafio oral com experimento. Assim como no atual experimento em
Salmonella Typhimurium utilizando um modelo animal ambos os grupos, experimental e controle, S.
gnotobiótico. Um maior tempo médio de sobrevida (P < Typhimurium se estabeleceu rapidamente numa faixa de
0,05) foi observado nos animais associados com L. 108 a 1010 ufc/g de fezes e se manteve em níveis
murinus (7,89 ± 3,83 dias) quando comparado com os elevados até os animais morreram ou serem
controles (4,44 ± 0,73 dias) (Vasconcelos; Nicoli; sacrificados. Em conclusão, o tratamento prévio de
Nardi, 2003). camundongos com Lactobacillus sspp estudados em
ambos os experimentos protegeu os animais contra a
Outro experimento semelhante foi conduzido por Moura infecção experimental com S. Typhimurium mas essa
et al 2001. A capacidade de Lactobacillus acidophilus proteção não se deve à uma redução das populações
UFV-H2B20 de antagonizar Salmonella enterica subsp. patogênicas nos intestinos.
enterica ser. Typhimurium, e de reduzir as
conseqüências patológicas para o hospedeiro foram L casei AB2 foi aquela amostra que demonstrou maior
determinadas em animais convencionais e capacidade de reduzir os níveis populacionais de S.
gnotobióticos. L. acidophilus UFV-H2B20 colonizou o Typhimurium no trato digestivo dos camundongos (P <
trato digestivo dos camundongos gnotobióticos e o 0,037).

12

10
Log 10 UFC/g fezes

0
1 2 5 6 7 9 12 15 19
Tempo (dias)
Figura 2: Populações fecais de S. Typhimurium em camundongos NIH gnotobióticos, monoassociados (●) ou não (♦)
com uma dose de 108 células viáveis da levedura L. rahmnosus AQ1 (■) dez dias antes do desafio com 103 células da
bactéria patogênica. N = 3.
12

10
Log 10 UFC/g fezes

0
1 2 5 6 7 9 12 15
Tempo (dias)
Figura 3: Populações fecais de S. Typhimurium em camundongos NIH gnotobióticos, monoassociados (●) ou não (♦)
com uma dose de 108 células viáveis da levedura L. casei AB2 (■) dez dias antes do desafio com 103 células da bactéria
patogênica. N = 3.

12

10
Log 10 Ufc/g fezes

0
1 2 5 6 7 9 12 15 19
Tempo (dias)

Figura 4: Populações fecais de S. Typhimurium em camundongos NIH gnotobióticos, monoassociados (●) ou não (♦)
com uma dose de 108 células viáveis da levedura L. fermentum AB3 (■) dez dias antes do desafio com 103 células da
bactéria patogênica. N = 3.
12

10
Log 10 UFC/g fezes

0
1 2 5 6 7 9 12 15
Tempo (dias)

Figura 5: Populações fecais de S. Typhimurium em camundongos NIH gnotobióticos, monoassociados (●) ou não (♦)
com uma dose de 108 células viáveis da levedura L. acidophilus LV3 (■) dez dias antes do desafio com 103 células da
bactéria patogênica. N = 3.

A sobrevida dos camundongos de cada grupo foi medida sobrevida estatisticamente maior em relação aos demais
ao longo do experimento. O grupo monoassociado ao L. grupos (P < 0,001). A figura 6 mostra o resultado de
fermentum AB3, previamente ao desafio com S. sobrevida para todos os grupos.
Typhimurium foi aquele que apresentou tempo de

2 5

2 0
T e m p o (d ia s )

1 5

1 0

0
I I I I I I I V V

Figura 6. Sobrevida dos camundongos monoassociados ou não (I), antes do desafio com 103 de S Typhimurium, com
dose única de 108 de L. casei AB2 (II); L. fermentum AB3 (III); L. rhamnosus AQ1 (IV) e L. acidophilus LV3 (V). N =
5.
Nenhuma das amostras de Lactobacillus spp estudadas AB3 ou L acidophilus LV3. O grupo controle recebeu
demonstraram resultados estatisticamente inferior ao do apenas o desafio com S Typhimurium. Apenas para os
grupo de camundongos isentos de germes (controle) animais tratados com L. rahmnosus AQ1 houve
após o desafio intragástrico com solução salina alterações relevantes no figado em comparação ao
contendo 103 de S. Typhimurium. grupo controle.

L rahmnosus AQ1 (13,1 ± 6,1 dias), L. casei AB2 (10 ± Houve alterações não relevantes no baço, colon e íleo de
3 dias) e L. fermentum AB3 (14,3 ± 4,8 dias) se todos os grupos, não havendo diferenças significativas
mostraram capazes de aumentar a sobrevida dos entre eles.
camundongos, enquanto a amostra L. acidophilus LV3
(6,4 ± 1,9 dias) não demonstrou essa capacidade em No ceco, houve a presença difusa de células
relação ao grupo controle (7,3 ± 1,7 dias). inflamatórias (Figura 8) na região da submucosa, com
Camundongos associados a L. fermentum AB3 predomínio de macrófagos e, principalmente,
previamente ao desafio com S. Typhimurium foi o grupo neutrófilos (Figura 9). Não há diferença entre os
com maior sobrevida (P< 0,001). infectados não tratados ou tratados com Lactobacillus
spp.
4.10.1. Anatomopatologia No fígado, o infiltrado inflamatório se organizou de
forma focal, também com predomínio de macrófagos e
Foram analisadas lâminas histológicas dos seguintes neutrófilos. Não houve diferença marcante entre o
órgãos: fígado, íleo, colon, ceco e baço, de número e tamanho de focos inflamatórios no
camundongos isentos de germes infectados com parênquima hepático de animais não tratados e tratados
Salmonella Typhimurium, previamente monoassociados com AB2, AB3 ou LV3. Animais tratados com AQ1
com L rahmnosus AQ1, L casei AB2, L. fermentum mostram um número bem reduzido de células
inflamatórias (Figura 7).

A
B

Figura 7 - Corte Histológico de fígado de camundongos isentos de germes infectados com


Salmonella typhimurium não tratados (A) e tratados com AQ1 (B). Notar a presença de focos
inflamatórios no parênquima hepático de fígado infectado não tratado (seta) Hematoxilina e
Eosina. Barra = 100 µm.

A
Figura 8- Corte Histológico de ceco de camundongos isentos de germes infectados com Salmonella
Typhimurium não tratados (A) e tratados com Lactobacillus spp (B).. Notar presença de infiltrado
inflamatório (seta). Hematoxilina e Eosina. Barra = 100 µm

A
B

Figura 9- Corte Histológico de ceco de camundongos isentos de germes infectados com Salmonella
Typhimurium não tratados (A) e tratados com Lactobacillus spp.. Notar presença de neutrófilos na
submucosa (seta). Hematoxilina e Eosina. Barra = 25 µm

A análise histológica demonstrou que a monoasociação usados somente os camundongos a partir da segunda
com a L. rahmnosus AQ1 reduziu o número de focos geração após a convencionalização.
inflamatórios no figado desses animais. Porém nenhuma
alteração morfológica positiva pode ser vista nos demais Os animais dos grupos experimentais (N = 30)
órgãos analisados (intestino e baço). As lesões receberam diariamente por via intragástrica 0,1 mL de
produzidas na mucosa intestinal, principalmente no ceco solução salina contendo aproximadamente 109 ufc/mL
e no cólon, do grupo GN desafiado com a S. de espécies de Lactobacillus spp. (AB2, AB3, AQ1 e
Typhimurium foram caracterizadas por edema, exudato LV3). Os camundongos do grupo controle (N = 10)
de células inflamatórias, mono e polimorfonucleares, na receberam diariamente 0,1 mL de solução salina
lâmina própria, por vezes com destruição avançada das tamponada. Após 10 dias todos os grupos receberam por
vilosidades e criptas intestinais, que foram substituídos via intragástrica 0,1 mL de solução salina tamponada
por tecidos granulomatosos ou apresentaram-se erodidas contendo aproximadamente 105 ufc/mL de S.
ou fundidas. Houve alargamento da lâmina própria e das Typhimurium. Durante os experimentos, os
vilosidades intestinais. Sinais de congestão e camundongos convencionais foram pesados em dias
hemorragia focais na lâmina própria e serosa do órgão. alternados. Também foram registradas as mortes
O grau de lesão entre os grupos controle e experimental decorrentes da infecção experimental, por um período
foi muito semelhante, não havendo evidências de de 28 dias após a infecção experimental, para posterior
proteção no grupo tratado com a levedura. comparação das taxas de sobrevida e sobrevivência dos
animais do grupo controle e dos grupos experimentais.
4.11. Determinação do efeito de Lactobacillus Observou-se diferença no desempenho ponderal e na
spp no desenvolvimento ponderal e na mortalidade nos grupos tratados com os Lactobacillus, o
mortalidade por S. Typhimurium em que sugere um potencial probiótico dessas linhagens de
camundongos convencionais (CV) lactobacilos.

Para realização deste experimento, foram utilizadas as A tabela 16 mostra a taxa de sobrevivência, tempo
amostras Lactobacillus (L. casei AB2, L. fermentum médio de sobrevida e peso médio ao fim dos
AB3, L.acidophilus LV3 e L. rahmonosus AQ1) experimentos dos animais tratados ou não com
isoladas dos queijo de coalho. Foram utilizados Lactobacillus spp após o desafio com a S.
camundongos convencionais suíços, derivados de Typhimurium. Assim como foi observado em animais
matrizes isentas de germes inoculadas com diluição gnotobióticos (GN), também houve proteção contra a
fecal filtrada de animais convencionais sadios, sendo infecção neste modelo (animal CV).
Tabela 16: Sobrevivência, tempo médio de vida e peso médio dos camundongos CV após o desafio com Salmonella
Typhimurium

Controle Grupo AB2 Grupo AB3 Grupo AQ1 Grupo LV3


b ac bc bc
Taxa de sobrevivência (%) 20% 60% 50% 30% 20%b
Tempo médio de vida 14,6 ± 5,5bc 18,1 ± 4,1ac 16,7 ± 5,6bc 15,5 ± 4,7bc 13,7 ± 4,5b
(dias)
Peso médio (g) 14,18 ± 4,77a 15,12 ± 5,33a 14,45 ± 3,62a 13,73 ± 3,55a 13,33 ± 4,18a
a
Letras minúsculas sobrescritas distintas indicam valores das médias estatisticamente diferentes (P < 0,05).

Para a análise estatística da sobrevivência nos grupos foi seres humanos; 5) evidências de efeitos benéficos em
utilizado o método de análise de sobrevivência de modelos animais e mecanismos de ação; 6) estudos
Kaplan-Meier (Log Rank). A comparação dos grupos foi clínicos duplo-cego, aleatório, placebo-controlado (fase
feita pelo método de Holm-Sidak (P < 0,05). Os 2 de estudos em seres humanos); 7) segundo estudo
resultados mostram que o grupo AB2 (L. casei) foi clínico duplo-cego, aleatório, placebo-controlado
aquele com sobrevivência estatisticamente superior ao independente, para confirmação dos resultados; 8)
grupo controle, demonstrando efeito protetor frente a ensaios efetivos para comparar o tratamento com o
infecção experimental por S Typhimurium nos probiótico com outros tratamentos disponíveis (fase 3
camundogos testados. de estudos em seres humanos) e 9) comercialização em
escala industrial contendo a linhagem presente no
A comparação dos tempos médios de sobrevida entre os produto, número de células viáveis mínimo ao final da
grupos foi realizada através de uma análise de variância validade, condições de estocagem e indicações (fase 4
não paramétrica (Kruskal-Wallis), mesma metodologia de estudos em seres humanos).
empregada para a análise dos dados de peso. No caso do
tempo médio de sobrevida o teste utilizado para No presente estudo, as amostras de Lactobacillus spp. já
comparação das médias foi o teste de Tukey. Os passaram por alguns destes testes (1 e 3) e parcialmente
resultados confirmaram o observado para a por outros (4 e 5). É conhecido o potencial probiótico
sobrevivência, sendo o grupo tratado com L casei AB2 destes microrganismos que estão sendo demonstrados
aquele com maior tempo de sobrevida. A análise do devido à proteção conferida contra a infecção pelo S
desenvolvimento ponderal mostrou não haver diferença Typhimurium. Entretanto, ainda existem vários
estatisticamente significativa entre os grupos estudados. experimentos a serem executados antes de partirmos
para experimentos em seres humanos.
As espécies de Salmonella são descritas como parasitas
intracelulares facultativas que se multiplicam em Uma vez evidenciada a proteção conferida pelas
macrófagos residentes do baço e do fígado (Salyers e amostras de Lactobacillus spp. testadas, é necessário
Whitt, 1994) e que apresentam como sítio inicial de prosseguir com os estudos, verificando os mecanismos
infecção o íleo terminal do intestino delgado (Carter e pelos quais os microorganismos exerceram seu efeito
Collins, 1974). A linhagem de Salmonella utilizada nos benéfico e comparar os resultados com aqueles já
experimentos causa uma doença extremamente invasora descritos para a Lactobacillus spp. e tentar esclarecer os
nos camundongos GN e CV, sendo mais grave nos mecanismos para os efeitos protetores das bactérias
primeiros, devido à ausência da microbiota. A presença estudadas contra a ação de alguns patógenos.
da microbiota pode ter agido em sinergismo com a
Lactobacillus spp para a proteção contra o desafio com 5. CONCLUSÕES
a S. Typhimurium, conforme evidenciado pela
diminuição na mortalidade dos animais CV previamente Existem importantes diferenças entre os fluxogramas de
tratados com L casei AB2, do aumento da sobrevida nos produção dos queijos de coalho industrial e artesanal
animais GN tratados com L fermentum AB3 e pelos pesquisados, sendo estas relacionadas à tecnologia e
dados histológicos do fígado dos animais GN tratados cuidados higiênico-sanitários, podendo influenciar a
com L rahmnosus AQ1 (Figura 2), sugerindo uma composição e as características físico-químicas e
diminuição na translocação do patógeno. microbiológicas dos produtos finais.

Segundo a FAO/ WHO em sua norma de procedimentos O ágar M17 apresentou maior variedade de espécies de
para probióticos, um microrganismo, para ser microrganismos isolados, incluindo BAL e
classificado com probiótico, precisa passar pelos enterobactérias, enquanto que o ágar MRS demonstrou
seguintes testes: 1) identificação até espécie ou, em maior seletividade quanto ao isolamento de BAL.
alguns casos, até linhagem, uma vez que se sabe que
muitos efeitos benéficos são linhagem-específicos; 2) Queijos de coalho artesanais e industriais podem estar
deposição da linhagem em uma coleção de cultura contaminados com Staphylococcus spp., e
internacional; 3) caracterização funcional através de microrganismos patogênicos como Listeria
testes in vitro, 4) avaliação da segurança através de monocytogenes não sendo a pasteurização do leite a
testes em animais e fase 1 (teste de segurança e ausência única medida a ser adotada para o controle destes
de patogenicidade do microrganismo) de estudos em patógenos na produção deste tipo de alimento.
antimicrobianos semelhantes, indicando provável troca
Staphylococcus spp. coagulase negativo produtores de de resistência por mecanismos genéticos.
enterotoxinas podem ser encontrados em queijos de
coalho, sugerindo que seja revista a legislação que Existe grande variação dos resultados de parâmetros
estabelece critérios microbiológicos para a inspeção físico-químicos (principalmente acidez titulável) entre
sanitária deste alimento, que determina a pesquisa de as amostras de queijo de coalho analisadas, sendo que as
Staphylococcus coagulase positivo. mesmas classificam-se como semi-gordas a gordas e de
alta ou muito alta umidade.
A atividade antagonista in vitro de Lactobacillus spp foi
estatisticamente (P < 0,05) superior ao de Lactococcus Lactobacillus spp isolados de queijo de coalho,
spp frente a microrganismos patogênicos de referência. avaliados nesse estudo apresentaram potencial
probiótico, uma vez que foram capazes de apresentar
Microrganismos presentes em queijos de coalho atividade antagonista in vitro frente a diversos
artesanal e industrial apresentam diferentes perfis de patógenos de interesse em saúde pública, apresentaram
sensibilidade às drogas antimicrobianas, incluindo a capacidade de sobrevivência às condições do trato
presença de Enterococcus faecalis multi-resistente e gastrointestinal e capacidade de colonização e foram
Lactobacillus acidophilus sensível à vancomicina. capazes de promover ação protetora em camundongos
gnotobióticos e convencionais frente a infecção
Microrganismos presentes em um mesmo queijo de experimental por Salmonella Typhimurium.
coalho podem apresentar perfis de sensibilidade aos
6. REFERÊNCIAS BIBLIOGRÁFICAS

ABE, J.; ITO, Y.; ONIMARU, M.; et al. Characterization and distribution of a new enterotoxin-related superantigen
produced by Staphylococcus aureus. Microbiology and Immunology, Tokyo, v. 44, nº. 2, p. 79-88, feb., 2000.

ABREU, M.T.; VORA, P., FAURE, E.;et al. Decreased expression of toil-like receptor-4 and MD-2 correlates with
intestinal epithelial cell protection against dyregulated proinflammatory gene expression in response to bacterial
lipopolysaccharide. Journal of Immunology, v. 167, p. 1609-16, 2000.

ADESIYUN, A. A.; TATINI, S. R.; HOOVER, D. G. Productions of enterotoxins by Staphylococcus hyicus. Veterinary
Microbiology, Shannon, v. 9, nº. 5, p. 487-495, sept., 1984.

ADLERBERTH, I.; CARLSSON, B.; DE MAN, P.; et al.. Intestinal colonization of enterobacteriaceae in Pakistani and
Swedish hospital delivered children. Acta. Pediatr. Scan., v. 80, p. 602-610, 1991.

ADWAN, G.; ABU-SHANAB, B.; ADWAN, K. Enterotoxigenic Staphylococcus aureus in raw milk in the North of
Palestine. Turkish Journal of Biology, v. 29, nº. 4, p. 229-232, out./dec., 2005.

AGÊNCIA NACIONAL DE VIGILÂNCIA SANITÁRIA (ANVISA). Aprova regulamento técnico sobre os padrões
microbiológicos para alimentos. Resolução RDC no 12, de 02 de janeiro de 2001. Diário Oficial da União. Brasília, DF,
10 jan. 2001b.

AGÊNCIA NACIONAL DE VIGILÂNCIA SANITÁRIA (ANVISA). Aprova regulamento técnico sobre os padrões
microbiológicos para alimentos. Resolução RDC no 12, de 02 de janeiro de 2001. Diário Oficial da União. Brasília, DF,
10 jan. 2001b. Disponível em: <http://www.anvisa.gov.br/legis/resol/12-01rda.htm>. Acesso em: 07 fev. 2006.

AGÊNCIA NACIONAL DE VIGILÂNCIA SANITÁRIA (ANVISA) Resolução nº 02 de 07 de janeiro de 2002.

AGÊNCIA NACIONAL DE VIGILÂNCIA SANITÁRIA (ANVISA). Aprova regulamento técnico sobre os padrões
microbiológicos para alimentos. Resolução RDC nº 12, de 02 de janeiro de 2001. Diário Oficial da União. Brasília, DF,
10 jan. 2001b. Disponível em: <http://www.anvisa.gov.br/legis/resol/12-01rda.htm>. Acesso em: 07 fev. 2006.

AGÊNCIA NACIONAL DE VIGILÂNCIA SANITÁRIA (ANVISA) . Padrões Referenciais de Qualidade do Ar


Interior, em ambientes climatizados artificialmente de uso público e coletivo. Resolução RE no 9, de 16 de janeiro de
2003. Disponível em: <http://e-legis.bvs.br/leisref/public/showct.php?id=>. Acesso em: 29 mar. 2006.

AHRNÉ, S.; MOLIN, G. Restriction endonuclease analysis of total chromosomal DNA of Lactobacillus. Microecol.
Ther., v. 26, p. 27-30, 1997.

AIBA, Y.; SUZUKI, N.; KABIR, A.M.; et al. Lactic acid-mediated suppression of Helicobacter pylori by the oral
administration of Lactobacillus salivarius as a probiotic in a gnotobiotic murine model. Am. J. Gastroenterol., v. 93, p.
2097-2101, 1998.

AKINEDEN, , Ö.; ANNEMÜLLER, C.; HASSAN, A. A.; LÄMMLER, C.; WOLTER, W.; ZSCHÖCK, M. Toxin genes
and their characteristics of Staphylococcus aureus isolated from milk of cows with mastitis. Clinical and Diagnostic
Laboratory Immunology, v. 8, nº. 5, p. 959-964,sept., 2001.

ALAM, M.; MIDTVEDT, T.; URIBE, A. Differential cell kinetics in the ileum and colon of germ-free rats. Scand. J.
Gastroenterol., v. 29, p. 445-451, 1994.

ALANDER, M.; SATOKARI, R.; KORPELA, R.; et al. Persistence of colonization of human colonic mucosa by a
probiotic strain, Lactobacillus rhamnosus GG, after oral consuption. Appl. Environ. Microbiol., v. 65, nº. 1, p. 351-354,
1999.

ALANDER, M.; DE SMET, I.; NOLLET, L.; et al. The effect of probiotic strains on the microbiota of the simulator of
the human intestinal microbial ecosystem. Int. J. Food Microbiol., v. 46, p. 71-79, 1999.

ALEXANDRE, D.P. Atividade antimicrobiana de bactérias lácticas isoladas de queijo-de-minas artesanal do Serro
(MG) frente a microrganismos indicadores. 2001. 47f. Dissertação (Mestrado em Medicina Veterinária) – Escola de
Veterinária, Universidade Federal de Minas Gerais, Belo Horizonte.
ALEXANDRE, D.P. et al. Atividade antimicrobiana de bactérias lácticas isoladas de queijo-de-minas artesanal do Serro
(MG) frente a microrganismos indicadores. Arquivo Brasileiro de Medicina Veterinária e Zootecnia, v. 54, nº. 4, p. 424-
428, 2002

ALI, D.; LACROIX, C.; THUAULD, D.; et al.. Characterization of diacetin b, a bacteriocin from Lactococcus lactis
subsp. lactis bv. diacetylactis UL720. Can. J. Microbiol., v.41, p.832-841, 1995.

ALMEIDA FILHO, E.S.; NADER FILHO, A. Ocorrência de Staphylococcus aureus em queijo tipo "frescal". Revista
de Saúde Pública, v. 34, nº. 6, p. 578-580, 2000.

ALMEIDA, P. F.; ALMEIDA, R. C. C. A PCR. Protocol using inl gene as a target specific detection of Listeria
monocytogenes. Food Control, Oxford, v. 11, nº. 1, p. 97-101, jan., 2000.

ALONSO, C.C. et al. Changes in the Enterobacteriaceae populations throughout manufacturing and ripening of
Valdeteja cheese. Milchwissenschaft, v. 57, nº. 9-10, p. 522-525, 2002.

ALONSO, R.; PELAEZ, T.; GONZALEZ-ABAD, M.J.; et al. In vitro activity of new quinolones against Clostridium
difficile. J. Antimicrob. Chemother., v. 47, p. 195-197, 2001.

ALTEKRUSE, S. F.; TIMBO, B. B.; MOWBRAY, J.C.; et al. Cheese-associated outbreaks of human illness in the
United States, 1973 to 1992: sanitary manufacturing practices protect consumers. Journal of Food Protection,, v. 61, nº.
7, p. 709-725, july, 1998.

ALTMEYER, R.M.; MCNERM, J.K.; BOSSIO, J.C.; et al. Cloning and molecular characterization of a gene involved
in Salmonella adherence and invasion of cultured epithelial cells. Mol. Microbiol., v. 7, p. 89-98, 1993.

ALTSCHUL, S.F.; GISH, W.; MILLER, W.; et al. Basic local aligment search tool. Journal of Molecular Biology, v.
215, p. 403-410, 1990.

AMIEL, C. et al. Potentiality of Fourier infrared spectroscopy (FTIR) for discrimination and identification of dairy
lactic acid bacteria. Lait, v. 80, nº. 4, p. 445-459, 2000.

ANAND, S.K.; SRINIRASAN, R.A.; RAO, L.K. Antibacterial activity associated with Bifidobacterium longum. Cult.
Dairy Prod. J., v.19, p.6-8, 1984.

ANDRADE, N.J.; MACEDO, J.A.B. Higienização na indústria de alimentos. São Paulo: Varela, 1996,182p..

ANDRADE, N. J.; SILVA, R. M. M. da; BRABES, K. C. S. Avaliação das condições microbiológicas em unidades de
alimentação e nutrição. Ciências Agrotecnicas, v. 27, nº. 3, p. 590-595, maio/jun., 2003.

ANDREMONT, A.; RAIBAUD, P.; TANCRÉDE, C.; et al. The use of germ-free mice associated with human fecal
flora as an animal model to study enteric bacterial interactions. Bact. Diarrh. Dis., v. 22, p. 219-228, 1985.

ANDREWS, W. H.; HAMMACK, T. S. Salmonella. In: UNITED STATES FOOD DRUG ADMINISTRATION (Ed.).
Bacteriological analytical manual online. 8ª ed. Rockville: FDA, 2006. Chap. 5. p. 1-29. Disponível em:
<http://www.cfsan.fda.gov/~ebam/bam-5.html>. Acesso em: 22 Jun. 06.

ANON, Healthy eating bio yoghurts: potted health. health Which?, p.9295, jun. 1997.

ANONYMOUS. Yoghurt and probiotics. Choice, v. 11, p. 32-35, 1992.

APAJALAHTI, J.H.A.; KETTUNEN, A.; NURMINEN, P.H.; et al. Selective plating underestimates abundance and
shows differential recovery of bifidobacterial species from human feces. Applied and Environmental Microbiology, v.
69, nº. 9, p. 5731-5735, 2003.

AQUINO, F.T.M. Produção de queijo de coalho no Estado da Paraíba: acompanhamento das características físico-
químicas do processamento. 1983. 81f. Dissertação (Mestrado em Medicina Veterinária) Escola de Veterinária,
Universidade Federal da Paraíba, João Pessoa.

ARAÚJO, R.S.; NASSU, R.T.; ARAÚJO, S.R. Caracterização físico-química de queijo de manteiga, queijo de coalho e
manteiga da terra produzidos nos estados do Rio Grande do Norte e Ceará. Higiene Alimentar, v. 16, nº. 97, p. 70-75,
2002.
ARAÚJO, V. S.; PAGLIARES, V. A.; QUEIROZ, M. L. P.; et al. Occurrence of Staphylococcus aureus and
enteropathogens in soft cheese commercialized in the city of Rio the Janeiro, Brazil. Journal of Applied Microbiology,
v. 92, nº. 06, p. 1172-1177, may, 2002.

ARAÚJO, V.S. et al. Occurrence of Staphylococcus and enteropathogens in soft cheese commercialized
in the city of Rio de Janeiro, Brazil. Journal of Applied Microbiology, v. 92, nº. 6, p. 1172-1177, 2002.

ARAÚJO, R. A. B. M.; MARTINS, J. M.; PINTO, M. S.; et al. Avaliação microbiológica do queijo artesanal da região
de Araxá – MG. Revista do Instituto de Laticínios Cândido Tostes, v. 59, n.º 339, p. 93-96, jul./ago., 2004.

ARCURI, E. F.; OLIVEIRA, R. C.; BRITO, J. R. F.; et al. A. Avaliação do potencial enterotoxigênico de
Staphylococcus aureus isolados de leite cru refrigerado pela detecção dos genes sea, seb, sec, e sed através da PCR. In:
CONGRESSO BRASILEIRO DE QUALIDADE DO LEITE, 1, 2004, Passo Fundo. Anais. Passo Fundo: Universidade
Federal de Passo Fundo, 2004. p. 1-3.

ARMUZZI, A.; CREMONINI, F.; OJETTI, V.; et al. Effect of Lactobacillus GG supplementation on antibiotic-
associated gastrointestinal side effects during Helicobacter pylori erradication therapy: a pilot study. Digestion, v. 63, p.
1-7, 2001.

ARROYO, L., COTTON, L.N.; MARTIN, J.H. Evaluation of media for enumeration of Bifidobacterium adolescentis.
B.infantis and B.longum from pure culture. Cult.Dairy Prod.J.,v. 29, nº.5, p.20-24, 1994.

ARVOLA, T.; MOILANEN, E.; VUENTO, R.; et al. Weaning to hypoallergenic formula improves gut barrier function
in breast-fed infants with atopic eczema. J. Pediatr. Gastroenterol. Nutr., v. 38, p. 92-96, 2004.

ASAHARA, T.; NOMOTO, K.; WATANUKI, M.; et al. Antimicrobial activity of intraurethrally administered probiotic
Lactobacillus casei in a murine model of Escherichia coli urinary tract infection. Antimicrob. Agents Chemother., v. 45,
p. 1751-1760, 2001.

ASAO, T; KUMEDA, Y.; SHIBATA, T.; et al. An extensive outbreak of staphylococcal food poisoning due to low-fat
milk in Japan: estimation of enterotoxin A in the incriminated milk powdered skim milk. Epidemiology and Infection,v.
130, n.º 1, p. 33-40, jan., 2003.

ASSOCIATION OF OFFICIAL ANALYTICAL CHEMISTS (AOAC). Official Methods of analysis of AOAC


International, 16ª ed., Gaithersburg: Association of Official Analytical Chemists, 1997. cap. 33, v.2.

ASSUMPÇÃO, E G.; PICCOLI-VALLE, R. H.; HIRSCH, D.; et al. Fontes de contaminação por Staphylococcus aureus
na linha de processamento de queijo prato. Arquivo Brasileiro de Medicina Veterinária e Zootecnia, v. 55, nº. 3, p. 366-
370, jun., 2003.

AVENA, R. M.; BERGDOLL, M. S. Purification and some physicochemical properties of enterotoxin C,


Staphylococcus aureus strain 361. Biochemistry, v. 6, nº. 6, p. 1474-1480, june, 1967.

ÁVILA, C. R. de; GALLO, C. R. Pesquisa de Salmonella spp em leite cru, leite pasteurizado tipo C e queijo Minas
Frescal comercializados no município de Piracicaba – SP. Scientia Agricola, v. 53, nº. 1, p.159-163, jan.-abr., 1996.
Disponível em <http://www.scielo.br>. Acesso em: XX de mês ANO

ÁVILA, C. R.; GALLO, C. R. Pesquisa de Salmonella spp. em leite cru, leite pasteurizado tipo C e queijo "Minas
frescal" comercializados no município de Piracicaba - SP. Scientia Agricola, v. 53, nº.1, p.159-163, jan./abr., 1996.

AYGUN, O.; PEHLIVANLAR, S. Listeria spp. in the raw milk and dairy products in Antakya, Turkey, Oxford, v. 17, nº.
8, p. 676-679, ago., 2006.

AXELSSON, L.T. Lactic acid bacteria: classification and physiology. In: SALMINEN, S., WRIGHT, A., (eds.). Lactic
acid bacteria. New York: Marcel Dekker, 1993. cap.1, p.1-63.

AZNAR, R.; ALARÓN, B. PCR detection of Listeria monocytogenes: a study of multiple factors affecting sensitivity.
Journal of Applied Microbiology, Oxford, v. 95, nº. 5, p. 958-966, nov., 2003.

BABA, T.; TAKEUCHI, F.; KURODA, M.; et al. Genome and virulence determinants of high virulence community-
acquired MRSA. The Lancet, v. 359, nº. 9320, p. 1819-1827, mai. 2002.
BACH, S.J.; MCALLISTER, T.A.; VIEIRA, D.M.; et al. Effects of a Saccharomyces boulardii feed supplement on
Escherichia coli O157:H7 in ruminal fluid in vitro. Anim. Feed Sci. Technol., v. 104, p. 179-189, 2003.

BAEK, S.-Y.; LIM, S. Y.; LEE, D. H.; et al. Incidence and characterization of Listeria monocytogenes from domestic
and imported foods in Korea. Journal of Food Protection, v. 63, nº. 2, p. 186-189, fev. 2000.

BAHAKA, D.; NEUT, C.; KHATTABI, A.; et al. Phenotypic and genomic analysis of human strains belonging or
related to Bifidobacterium longum. Bifidobacterium infantis, and Bifidobacterium breve. Int. Journal Syst. Bacteriol., v.
43, p. 565-573, 1993.

BALABAN, N.; RASOOLY, A. Staphylococal enterotoxins. International Journal of Food Microbiology, v. 61, nº. 1, p.
1-10, out., 2000.

BALLONGUE, J. Bifidobacteria and probiotic action. In: SALMINEN, S.;VON WRIGHT, A. (eds.). Lactic Acid
Bacteria. New York: Marcel Dekker, 1993, p.357-428.

BALMER, S.E.; WHARTON, B.A. Diet and faecal flora in the newborn: breast milk and infant formula. Arch. Dis.
Child., v. 64, p. 1672-1677, 1989.

BANNERMAN, T. L. Staphylococcus, Micrococcus, and other catalase positive Coci that grow aerobically. In:
MURRAY, P.R.; BARON, E. J.; JORGENSEN, J. H.; et al (ed.). Manual of clinical microbiology. 8ª ed. Washington:
ASM, 2003. v. 1, chap. 28, p. 384-404.

BARRETT, J. N. Communicable disease associated with milk and dairy products in England and Wals: 1983-1984. The
Journal Infectious, v. 12, nº. 3, p. 265-272, mai, 1986.

BAUTISTA, L.; GAYA, P.; MEDINA, M.; et al. A quantitative study of enterotoxin production by sheep milk
Staphylococci. Applied and Environmental Microbiology, v. 54, nº. 2, p. 566-569, fev., 1988.

BAYLES, K. W.; IANDOLO, J. Genetic and molecular analyses of the gene encoding staphylococcal enterotoxin D.
Journal of Bacteriology, v. 171, v. 9, p. 4799-4806, set., 1989.

BANWART, G. J. Basic food microbiology. 2 ed. New YorK: Chapman & Hall, 1989. 773p.

BARNETT, J.A.; PAYNE, R.W.; YARROW, D. Yeast: characteristics and rd identification. 3 ed. Cambridge University
Press, Cambridge, 2000.

BARRE, P. Taxonomie numérique de lactobacilles isolés du vin. Archives fur Mikrobiologie, v. 68, p. 74-86, 1969.

BARRETO, G.P.M., SILVA, N., SILVA, E.N. et al.,. Monitoramento da viabilidade de lactobacilos e bifidobactérias em
alimentos probióticos disponíveis no mercado brasileiro. Brasilian Journal of Food Technology, 2002.

BARROS LOPES, M.; SODEN, A.; HENSCHKE, P.A.; LANGRIDGE, P. PCR differentiation of commercial yeast
strains using intron splice site primers. Appl. Environ. Microbiol., v. 62, p. 4514-4520, 1996.

BARTLETT, J.G. Antibiotic-associated diarrhea. Clin. Infect. Dis., v. 15, p. 573-581, 1992.

BARUZZI, F. et al. Microbial community dynamics during the Scamorza Altamurana cheese natural fermentation.
Journal of Dairy Science, v. 85, nº. 6, p. 1390-1397, 2002.

BASSETTI, S.; FREI, R.; ZIMMERLI, W. Fungemia with Saccharomyces cerevisiae after treatment with
Saccharomyces boulardii. Am. J. Med., v. 105, p. 71-72, 1998.

BASTOS, M.S.R. et al. Inspeção em uma indústria produtora de queijo tipo coalho, no estado do Ceará, visando a
implantação das boas práticas de fabricação. Revista do Instituto de Laticínios Cândido Tostes, v. 56, nº. 321, p. 130-
136, 2001.

BATOOL, S; MASUD, T.; SOOMRO, A.H. Genetic engineering for the improvement of dairy starter culture: a review.
Journal of Animal and Veterinary Advances, v. 1, nº. 1, p. 37-39, 2002.

BAUMLER, A.J. The record of horizontal gene transfer in Salmonella. Trends Microbiol., v. 5, p. 318-322, 1997.

BAUTISTA-GARFIAS, C.R.; IXTA, O.; ORDUNA, M.; et al. Enhancement of resistance in mice treated with
Lactobacillus casei: effect on Trichinella spiralis infection. Vet. Parasitol., v. 80, p. 251-260, 1999.

BAYONA GONZALES, A.; LOPEZ CAMARA, V.; GOMEZ CASTELLANOS, A. Prevención de caries por
lactobacilos (resultados finales de un ensayo clínico sobre caries dental con lactobacilos muertos [estreptococos y
lactobacilos] por via oral). (Prevention of caries with lactobacillus (final results of a clinical trial on dental caries with
killed lactobacillus [streptococcus and lactobacillus] given orally). Pract. Odontol., v. 11, p. 37-39, 1990.

BEATON, N. C. Ultrafiltration and reverse osmosis in the dairy industry – an introduction to sanitary considerations.
Journal of Food Protection, v. 42, nº. 7, p. 584-590, jul., 1979.

BECKER, K.; ROTH, R.; PETERS, G. Rapid and specific detection of toxigenic Staphylococcus aureus: use of two
Multiplex PCR enzyme immunoassays for amplification and hybridization of staphylococcal enterotoxin genes, and
Toxic Shock Syndrome toxin 1 gene. Journal of Clinical Microbiology, v. 36, nº. 9, p. 2548-2553, set., 1998.

BECKER, K.; KELLER, B.; Von EIFF, C.; et al. Enterotoxigenic potential of Staphylococcus intermedius. Applied and
Environmental Microbiology, v. 67, n°. 12, p. 5551-5557, dez., 2001.

BEENA, A.; PRASAD, V. Effect of yogurt and bifidus yogurt fortified with skim milk powder, condensed whey and
lactose-hydrolyzed condensed whey on serum cholesterol and triacylglycerol concentration in rats. J. Dairy Res., v. 64,
p. 453-457, 1997.

BENEVIDES, S. D.; TELLES, F. J. S. Características microbiológicas, de armazenamento e de embalagem de queijos


tipo “coalho” comercializados na cidade de Fortaleza, CE. Revista Higiene Alimentar, v. 16, nº. 95, p. 44-47, abr., 2001.

BENGMARK, S. Ecological control of the gastrointestinal tract. The role of probiotic flora. Gut, v. 42, p. 2-7, 1998.

BEIJERINK, M.W. Sur les ferments de lactique de l’industrie (Lactic acid bacteria of the industry.) Arc Néerland des
Sciences Extractes et Naturelles. v. 6, p. 212-43, 1901.

BENNET, R.W. Atypical toxigenic Staphylococcus and non-Staphylococcus aureus species on the horizon? An update.
Journal of Food Protection, v. 59, nº. 10, p. 1123-1126, out., 1996.

BENNET, R.; ERIKSSON, M.; NORD, C.E.; et al. Fecal bacterial microflora of newborn infants during intensive care
management and treatment with five antibiotic regimens. Pediatr. Infect. Dis., v. 5, p. 533-539, 1986.

BENNETT, R.W.; LANCETTE, G.A. Staphylococcus aureus. In: Food Drug Administration (Ed.). Bacteriological
analytical manual online. 8ª ed. Gaithersburg: Association of Official Analytical Chemists 2001. cap. 12. p. 12.1-12.5.
Disponível em: <http://www.cfsan.fda.gov/~ebam/bam-12.html>. Acesso em: 27 Ago. 2005.

BENNETT, R. W. ; LANCETTE, G. A. Staphylococcus aureus In: FOOD AND DRUG ADMINISTRATION.


Bacteriological Analytical Manual., 8ª ed., Rockville: Food and Drug Administration. 1998. cap. 12. Disponível em:
http://www.cfsan.fda.gov/~ebam/bam-12.html. Acesso em: 05 set. 2001.

BENNO, Y.; HE, F.; HOSODA, M.; HASHIMOTO, H.; et al. Effects of Lactobacillus GG yogurt on human intestinal
microecology in Japanese subjects. Nutrition Today, v. 31, p. 9S-11S, 1996.

BENSON, T. E.; PRINCE, D. B.; MUTCHLER, V. T.; et al. X-ray crystal structure of Staphylococcus aureus FemA.
Structure, v. 10, nº. 8, p. 11071115, ago., 2002.
BERKHIN, P. Survey of clustering data mining techniques. Relatório técnico, Accrue Software,2002.

BERG, R.; BERNASCONI, P.; FOWLER, D.; et al. Inhibition of Candida albicans translocation from the
gastrointestinal tract of mice by oral administration of Saccharomyces boulardii. J. Infect. Dis., v. 168, p. 1314-1318,
1993.

BERG, R.D. The indigenous gastrointestinal microflora. Trends Microbiol., v. 4, p. 430-435, 1996.

BERGDOLL, M.S. Staphylococcus aureus. In: DOYLE, Micheal P. (ed.) Foodborne Bacterial Pathogens. New York:
Marcel Dekker, Inc., p. 463-523, 1989.

BERGDOLL, M. S.; BORJA, C. R.; AVENA, R. M. Identification of a new enterotoxin as enterotoxin C. Journal of
Bacteriology, v. 90, nº. 5, p. 1481-1485, nov., 1965.

BERGDOLL, M. S.; BORJA, C. R.; ROBBINS, R.; et al. Identification enterotoxin E. Infection and Immunity, v. 4, nº.
5, p. 593-593, Nov., 1971.

BERGDOLL, M. S.; SURGALA, J.; DACK, G. M. Staphylococcal enterotoxin. Identification of a specific precipitating
antibody with enterotoxin-neutralizing property. The Journal of Immunology, v. 83, nº. 3, p. 334-338, mar., 1959.

BERGEY’S. Manual of Determinative Bacteriology. Baltimore: Williams & Wilkins, 1984. v. 1

BERGEY’S. Manual of Systematic Bacteriology. Baltimore: Williams and Wilkins, v.1

BERNARDEAU, M.; VERNOUX, J.P.; GUEGUEN, M. Probiotic properties of two Lactobacillus strains in vitro.
Milchwissenschaft, v. 56, nº. 12, p. 663-667, 2001.

BERNER, L.A.; O’DORNELL, J.A. Functional foods and health claims legislation: applications to dairy foods.
International Dairy Journal, v. 8, p. 355-362, 1998.

BERNET, M-F.; BRASSART, D.; NESSER, J-R.; et al. Adhesion of human bifidobacterial strains to cultured human
intestinal epithelial cells and inhibition of enteropathogen-cell interactions. Appl. Environ. Microbiol., v. 59, nº. 12, p.
4121-4128, 1993.

BERNET, M.F.; BRASSART, D.; NEESER, J.R.; et al. Lactobacillus acidophilus LA1 binds to cultured human
intestinal cells lines and inhibits cell-attachment and cell-invasion by enterovirulent bacteria. Gut, v. 35, p. 483-489,
1994.

BERRADA, N.; LEMELAND, J.F.; LAROCHE, G.; et al. Bifidobacterium from fermented milks: survival during
gastric transit. J. Dairy Sci., v. 74, nº. 2, p. 409-413, 1991.

BERTHIER, F.; EHRLICH, S.D. Rapid species identification within two groups of closely related lactobacilli using
PCR primers that the 16S/23S rRNA spacer region. FEMS Microbiol. Lett., v. 161, p. 97-106, 1998.

BETLEY, M. J.; BORST, D. W.; REGASSA, L. B. Staphylococcal enterotoxin, Toxic Shock Syndrome and
staphylococcal pyrogenic enterotoxins: a comparative study of their molecular biology. Chemical and Immunology, v.
55, nº.1, p. 1-35, jan., 1992.

BETLEY, M. J.; BORST, D. W.; REGASSA, L. B. Staphylococcal enterotoxin, toxic shock syndrome and
staphylococcal pyrogenic enterotoxins: a comparative study of their molecular biology. Chemical and Immunology, v.
55, nº.1, p. 1-35, jan., 1992.

BETLEY, M. J.; MEKALANOS, J. J. Nucleotide sequence of the type A staphylococcal enterotoxin gene. Journal of
Bacteriology, v. 170, nº. 1, p. 34--41, jan., 1988.

BETLEY, M. J.; MEKALANOS, J. J. Staphylococcal enterotoxin A is encoded by phage. Science, v. 229, nº. 4729, p.
185-187, jun., 1985.

BETZL, D.; LUDWIG, W.; SCHLEIFER, K-H. Identification of lactococci and enterococci by colony hibridisation
with 23S rRNA-targeted oligonucleotide probes. Appl. Environ. Microbiol., v. 56, p. 2927-2929, 1990.

BESHKOVA, D. Production of amino acid by yogurt bacteria. Biotechnology Progress, v. 14, nº. 6, p. 963-995, 1998.

BIAVATI, B.; SCARDOVI, V.; MOORE, W.E.C. Electrophoretic patterns of protein in the genus Bifidobacterium and
proposal of four new species. International Journal of Systematic Bacteriology, v. 32, p. 358-373, 1982.

BIAVATI, B.; SCORBATI, B.; SCARDOVI, V. Genus Bifidobacterium. In:, BALOWS, A.; TRIPER, H.G.;
DOWIKAN, M.; et al (eds). The Procaryotes. London: Springer, 1992., pp. 814-829.

BILLE, J.; ROCOURT, J. Listeria and Erysipelothrix. In: MURRAY, P. R.; BARON, E. J.; JORGENSEN,J. H.; et al.
(ed.). Manual of clinical microbiology. 8ªed. Washington: ASM, 2003. v. 1, cap.. 33, p. 461-471.

BINGEN,E.H.; DENAMUR,E.; ELION,J. Use of ribotyping in epidemiological surveillance of nosocomial outbreaks.


Clin. Microbiol. Rev., v.7, p. 311-327, 1994.

BIRREN,B.;LAI,E. Pulsed-field gel electrophoresis: a practical guide. San Diego:Academic Press, 1993. 253pp.

BJÖRKROTH, J.;KORKEALA, H. rRNA gene restriction patterns as a characterisation tool for Lactobacillus sake
producing ropy slime. Int. J. Food Microbiol., v. 30, p. 293-302, 1996.

BLANCHETTE, L.; ROY, D.; GAUTHIER, S.F. Production of cultured cottage cheese dressing by bifidobacteria. J.
Dairy Sci., v. 78, p. 1421-1429, 1995.

BLAIOTTA, G. et al. 16S-23S rDNA intergenic spacer region polymorphism of Lactococcus garviae, Lactococcus
raffinolactis and Lactococcus lactis as revelated by PCR and nucleotid sequence analysis. Systematic and Applied
Microbiology, v. 25, nº. 4, p. 520-527, 2002.

BLAIOTTA, G.; ERCOLINE, D.; PENNACCHIA, C.; et al. PCR detection of staphylococcal enterotoxin genes in
Staphylococcus spp. Strains isolated from meat and dairy products. Evidence for new variants of seG and seL in S.
aureus AB-8802. Journal of Applied Microbiology, v. 97, n°. 5, p. 719-730, May, 2004.

BLÉHAUT, H.; MASSOT, J.; ELMER, G.W.; et al. Disposition kinetics of Saccharomyces boulardii in man and rat.
Biopharm. Drug. Disp., v. 10, p. 353-364, 1989.

BLEICHNER, G.; BLEHAUT, H.; MENTEC, H.; et al. Saccharomyces boulardii prevents diarrhea in critically ill tube-
fed patients. A multicenter, randomized, double-blind placebo-controlled trial. Intensive Care Med., v. 23, p. 517-523,
1997.

BODANA, A. Antimutagenic activity of milk fermented by Streptococcus thermophilus and Lactobacillus bulgaricus.
Journal of Dairy Science, v. 73, nº.12. p. 3379-3384, 1990.

BODDY, A.V.; ELMER, G.W.; MCFARLAND, L.V.; et al. Influence of antibiotics on the recovery and kinetics of
Saccharomyces boulardii in rats. Pharm. Res., v. 8, p. 796-800, 1991.

BOGDANOV, I.G. Antitumor action of glycopeptides from the cell wall of Lactobacillus bulgaricus. Nol Biologll
Meditsiny, v. 84, nº. 12, p. 709-712, 1977.

BOGDANOV, I.G.; DALEV, P.G.; GUREVICH, A.I. et al. Antitumour glycopeptides from Lactobacillus bulgaricus cell
wail. Federation of European Biochemical Societies Letters, v. 57, nº.3, p. 259-261, 1975.

BOHACH, G. A.; SCHIEVERT, P. M. Nucleotide sequence of the staphylococcal enterotoxin C1 gene and relatedness
to other pyrogenic toxins. Molecular Genetics and Genomics, v. 209, nº. 1, p. 15-20, ago.1987.

BONAPARTE, C. Selective isolation and taxonomic position of bifidobacteria isolated from commercial fermented
dairy products in central Europe. 1997. Dissertação (Mestrado em CCVVD) Technische Universität, Berlin.

BONAPARTE, C.; REUTER, G. Bifidobacteria in commercial dairy products: Which species are used? In: Prodeedings
of the Symposium Probiotics in Man and Animal, ,1996, Berlin, Deutsche Veterinärmedizinische Gesellschaft. Berlin,
p. 33.

BOPP, A. C.; BRENNER, F. W.; FIELDS, P. I.; et al. Escherichia coli, Shigella, and Salmonella. In: MURRAY, P. R.;
BARON, E. J.; JORGENSEN, J. H.;et al. (ed.). Manual of clinical microbiology. 8ª ed. Washington: ASM, 2003. v. 1,
cap. 42, p. 654-671.

BORDER, P. M.; HOWARD, J. J.; PLASTOW, G. S.; et al. Detection of Listeria monocytogenes using polymerase
chain reaction. Letters in Applied Microbiology, v. 11, n.º 7, p. 158-162, jun. 1990.

BORELLI, B.M. Quantificação dos indicadores higiênicos sanitários e da diversidade de leveduras durante a fabricação
do queijo minas curado produzido na Serra da Canastra, MG. 2002. Dissertação (Mestrado em FSFDF) Instituto de
Ciências Biológicas, Universidade Federal de Mins Gerais, Belo Horizonte.

BORGES, M. F.; FEITOSA, T.; NASSU, R. T.; et al. Microrganismos patogênicos e em queijo de coalho produzido no
Ceará, Brasil. Boletim do Centro de Pesquisa e Processamento de Alimentos, v. 21, nº. 1, p. 31-40, jan./jun., 2003.

BORJA, C. R.; BERGDOLL, M. S. Purification and partial characterization of enterotoxin C produced by


Staphylococcus aureus strain 137. Biochemistry, Columbus, v. 6, nº. 5, p. 1467-1473,mai. 1967.

BORN, P.; LERSCH, C.; ZIMMERHACKL, B.; et al. The Saccharomyces boulardii therapy of HIV-associated diarrhea
(letter). Dtsch. Med. Wochenschr., v. 118, p. 765, 1993.

BORUCKI, M. K.; KIM, S. H.; CALL, D. R.; SMOLE, S. C.; PAGOTTO, F. Selective discrimination of Listeria
monocytogenes epidemic strains by a mixed-genome DNA microarray compared to discrimination by pulsed-field gel
electrophoresis, ribotyping, and multilocos sequence typing. Journal of Clinical Microbiology, Washington, v. 42, n. 11,
p. 5270-5276, Nov., 2004.

BOTTAZZI, V. An introduction to rod-shaped lactic-acid bacteria. Biochimie, v. 70, p. 303-315, 1988.

BOTTAZZI, V. Yoghurt, latte-fermentati, probiotici e funzionali. L’industria del latte, v. 33, p. 3-13, 1997.

BOTTAZZI, V.; ZACCONI, C.; SARRA, P.G. (eds.) Probiotica con Batteri Lattoci. Milano: Futurgraf, 1985, p. 37-86.

BOUBEKRI, K.; OHTA, Y. Identification of lactic acid bacteria from Algerian traditional cheese, El-Klila. Journal of
Science Food Agriculture, nº. 70, p. 501-505, 1996.

BOURLIOUX, P.; KOLETZKO, B.; GUARNER, F.; et al. The intestine and its microflora are partners for the
protection of the host: report on the Danone Symposium "The Intelligent Intestine," held in Paris, June 14, 2002. Am. J.
Clin. Nutr., v. 78, p. 675-683, 2003.

BRABES, K C. S.; ANDRADE, N. J.; MENDONÇA, R. C. S.; et al. Identificação e classificação de enterotoxinas
produzidas por Staphylococcus spp. isolados de ar de ambiente, manipuladores e de superfícies em uma indústria de
laticínios. Revista do Instituto de Laticínios Cândido Tostes, v. 58, nº. 333, p. 33-38, jul./ago. 2003.

BRACKETT, R. E. Presence and persistence of Listeria monocytogenes in food and water. Food Technology, v. 42, n. 3,
p. 163-164, apr. 1988.

BRANCO, M. A. A. C.; FIGUEIREDO, E. A. T.; BORGES, M. F.; et al. Incidência de Listeria monocytogenes em
queijo de coalho refrigerado produzido industrialmente. Boletim do Centro de Pesquisa e Processamento de Alimentos,
v. 21, nº. 2, p. 393-408, jun./dez., 2003.

BRANDÃO, R.L.; CASTRO, I.M.; BAMBIRRA, E.A.; et al.. Intracellular signal triggered by cholera toxin in
Saccharomyces boulardii and Saccharomyces cerevisiae. Appl. Environ. Microbiol., v. 64, p. 564-568, 1998.

BRASIL. Resolução n° 16, de 24 de abril de 1978. Comissão Nacional de Normas e Padrões para Alimentos – CNNP,
conceitua os produtos perecíveis e recomenda procedimento adequado de conservação. Ministério da Saúde. In: FOOD
STAFF (Comp.). Food Base: legislação sobre alimentos. São Paulo: ABIA, 1999. CDROM. produzido por Vox Editora.

BRASIL. Portaria n° 01, de 28 de janeiro de 1987. Aprova padrões microbiológicos para alimentos. Ministério da
Saúde. Divisão Nacional de Vigilância Sanitária de Alimentos. Diário Oficial da União, Seção 1. Brasília, DF, p.2197-
2200, 25 fev.1987.

BRASIL. Portaria n° 146, de 07 de março de 1996. Aprova regulamentos técnicos de identidade e qualidade dos
produtos lácteos. Ministério da Agricultura, do Abastecimento e da Reforma Agrária. Brasília, 50p.

BRASIL. Portaria no 451 de 19 de setembro de 1997. Aprova o regulamento técnico de princípios gerais para o
estabelecimento de critérios microbiológicos para alimentos. Ministério da Saúde Secretaria de Vigilância Sanitária de
Alimentos. Diário Oficial da União, Brasília, 22 set. 1997a.

BRASIL. Portaria n° 352, de 04 de setembro de 1997b. Regulamento técnico para fixação de identidade e qualidade de
queijo Minas Frescal. Ministério da Agricultura e do Abastecimento. In: FOOD STAFF (Comp.). Food Base: legislação
sobre alimentos. São Paulo: ABIA, 1999. CD-ROM. produzido por Vox Editora.

BRASIL. Resolução RDC no 12, de 02 de janeiro de 2001. Aprova regulamento técnico sobre os padrões
microbiológicos para alimentos. Ministério da Saúde. Agência Nacional de Vigilância Sanitária Disponível em:
http://www.anvisa.gov.br/legis/resol/12-01rda.htm. Acesso em 27 ago. 2001.

BRASHEARS, M.M.; DURRE, W.A. Antagonistic action of Lactobacillus lactis toward Salmonella spp. and
Escherichia coli O157:H7 during growth and refrigerated storage. Jouranl of Food Protection, v. 62, nº. 11, p. 1336-
1340, 1999.

BRECKINRIDGE, J. C.; BERGDOLL, M. S. Outbreak of food-borne gastroenteritis due to a coagulase-negative


enterotoxin producing Staphylococcus. New England Journal of Medicine,v. 284, nº. 10, p. 541-543, out., 1971.

BROOK, I. Isolation of non-sporing anaerobic rods from infections in children. Journal of Medical Microbiology, v. 45,
p. 21-26, 1996.
BRUCE,J.L. -Automated system rapidly identifies and characterizes microorganisms in food. Food Technology, v. 50,
p.77-81, 1996.

BORGES, M. F.; FEITOSA, T.; NASSU, R. T.; et al. Microrganismos patogênicos e em queijo de coalho produzido no
Ceará, Brasil. Boletim do Centro de Pesquisa e Processamento de Alimentos, v. 21, n° 1, p. 31-40, jan./jun., 2003.

BOHACH, G. A.; SCHIEVERT, P. M. Nucleotide sequence of the staphylococcal enterotoxin C1 gene and relatedness
to other pyrogenic toxins. Molecular Genetics and Genomics,v. 209, n°. 1, p. 15-20, ago., 1987.

BRANCO, M. A. A. C.; FIGUEIREDO, E. A. T.; BORGES, M. F.; et al. Incidência de Listeria monocytogenes em
queijo de coalho refrigerado produzido industrialmente. Boletim do Centro de Pesquisa e Processamento de Alimentos,
v. 21, nº. 2, p. 393-408, jun./dez., 2003.

BRECKINRIDGE, J. C.; BERGDOLL, M. S. Outbreak of food-borne gastroenteritis due to a coagulase-negative


enterotoxin producing Staphylococcus. New England Journal of Medicine, v. 284, nº. 10, p. 541-543, out. 1971.

BRETT, M. M. Kits for detection of some bacterial food poisoning toxins: problems, pitfalls and benefits. Journal of
Applied Microbiology Symposium Supplement, v. 84, nº. S1, p. 110S-118S, jul.1998.

BRUGIER, S.; PATTE, F. Antagonisme in vitro entre l'ultra-levure et différent germes bactériens. Med. Paris, v. 45, p.
3-8, 1975.

BRUM, J. V. F.; GONÇALVES, N. B.; MASSON, M. L. Condições higiênicas de mãos de manipuladores de laticínios.
Revisto do Instituto de Laticínios Cândido Tostes, v. 59, nº. 339, p. 179-182, jul./ago., 2004.

BRUNO, L. M.; FEITOSA, T.; NASSU, R. T.; et al.. Avaliação microbiológica de queijo de coalho artesanais e
industrializados comercializados em Fortaleza, CE. Revista do Instituto de Laticínios Cândido Tostes, v. 60, nº. 345, p.
217-220, jul./ago, 2005.

BUCHANAN, R.E.; GIBBSONS, N.E. Bergey’s Manual of Determinative Bacteriology, 8 ª ed.. Baltimore: The
Williams & Wilkins Co, 1974.

BÜLA, C. J.; BILLE, J.; GLAUSER, M. P. An epidemic of food-borne listeriosis in Western Switzerland: decryption of
57 cases involving adults. Clinical Infectious Deseases, v. 20, nº. 1 , p. 66-72, jan., 1995.

BULLEN, C.L.P.; TEARLE, P.V.; WILLIS, A.T. Bifidobacteria in the intestinal tract of infants: an in vivo study. J.
Med. Microbiol., v. 9, p. 325-333, 1976.

BRYNESTAD, S.; GRANUM, P.E. Clostridium perfringens and foodborne infections. Int. J. Food Microbiol., v. 74, p.
195-202, 2002.

BUSANI, L.; CIGLIANO, A.; TAIOLI, E.; et al. Prevalence of Salmonella enterica and Listeria monocytogenes
contamination in food of animal origin in Italy. Journal of Food Protection, v. 68, nº. 8, p. 1729-1733, ago. 2005.

BUSSCHER, H.J.; MULDER, A.F.; VAN DER MEI, H.C. In vitro adhesion to enamel and in vivo colonization of tooth
surfaces by Lactobacilli from a bio-yoghurt. Caries Res., v. 33, p. 403-404, 1999.

BUTS, J.P.; BERNASCONI, P.; VAN CRAYNEST, M.P.; et al. Response of human and rat small intestinal mucosa to
oral administration of Saccharomyces boulardii. Pediat. Res., v. 20, p. 192-196, 1986.

BUTS, J.P.; BERNASCONI, P.; VAERMAN, J.P.; et al.. Stimulation of secretory IgA and secretory component of
immunoglobulins in small intestine of rats treated with Saccharomyces boulardii. Dig. Dis. Sci., v. 35, p. 251-256, 1990.

CAETANO, J.A.M.; PARAMÉS, M.T.; BABO, M.J.; et al. Immunopharmacological effects of Saccharomyces
boulardii in healthy volunteers. Int. J. Immunopharmacol., v. 8, p. 245-259, 1986.

CAETANO, V. C.; SALTINI, D. A. S.; PASTERNAK, J. Surto de salmonelose por Salmonella enterica em profissionais
de saúde, causado por alimentos consumidos em uma festa de ano novo realizada dentro da Unidade de Terapia
Intensiva. Einstein, São Paulo, v. 2, nº. 1, p. 33-35, jan., 2004. Disponível em:
<http://www.einstein.br/biblioteca/artigos/Vol2Num1/Case%20Report%20=%20Surto %20de%20salmonelose.pdf>.
Acesso em: 13 abr. 2006.
CAMARA, S.A.V. et al. Avaliação microbiológica de queijos tipo minas frescal artesanal, comercializados no
município de Campo Grande, Mato Grosso do Sul. Higiene Alimentar, v. 16, nº. 101, p. 32-36, 2002.

CAMPOS, J. E.; ORLANDO, J. C.; PAPE, G.; et al. Estudo da fabricação de queijos não curados usando ácido lático
em lugar de culturas láticas selecionadas (fermentos láticos). Revista do Instituto de Laticínios Cândido Tostes, v. 158
nº. 9, p. 1-7, 1971.

CAMPOS, A. C. Efeito do uso combinado de ácido lático com diferentes proporções de fermento lático mesofílico no
rendimento, proteólise, qualidade microbiológica e propriedades mecânicas do queijo Minas Frescal. 2000. 80f.
Dissertação (Mestrado em Tecnologia de Alimentos) Faculdade de Engenharia de Alimentos, Universidade Federal de
Campinas, Campinas.

CÂNDIDO, L.M.B; CAMPOS, A.M. Alimentos funcionais: uma revisão. Boletim da Revista Brasileira de Ciência e
Tecnologia de Alimentos, v.29, nº.2, p.193-203, 1995.

CANGANELLA, F.; PAGANINI, S.; OVIDI, M.; et al microbiological investigator on probiotic pharmaceutical
products used for human health. Microb. Res., v. 152, p. 171-179, 1997.

CAPLICE, E.; FITZGERALD, G.F. Food fermentations: role of microrganisms in food production and preservation.
Int. J. Food Microbiol., v.50, p.131-149, 1999.

CARDINALI, G.; MARTINI, A. Electrophoretic karyotypes of authentic strains of the sensu stricto group of the genus
Saccharomyces. Int. J. Syst. Bacteriol., v. 44, p. 791-797, 1994.

CARDOSO, H.F.T. Identificação de fatores de virulência e susceptibilidade a antimicrobianos de Staphylococcus


aureus isolados de amostras de leite bovino em Minas Gerais. 1999.88f. Dissertação (Mestrado em GDSGDG) Nome
da Escola, Universidade Federal de Minas, Belo Horizonte.

CARELI, R. T.; DIAS, A. S.; ANDRADE, N. J.; et al. Qualidade de água e condições higiênicas de manipuladores,
equipamentos e utensílios em micro-indústrias de laticínios. Revista do Instituto de Laticínios Cândido Tostes, v. 58, nº.
333, p. 85-88, jul./ago. 2003.

CARELI, R. T.; DIAS, A. S.; ANDRADE, N. J.; et al. Qualidade de água e condições higiênicas de manipuladores,
equipamentos e utensílios em micro-indústrias de laticínios. Revista do Instituto de Laticínios Cândido Tostes, v. 58, nº.
333, p. 85-88, jul./ago. 2003a.

CARELI, R. T.; DIAS, A. S.; ANDRADE, N. J.; et al. Proposição, implantação e avaliação de procedimentos de
higienização para micro-indústrias de laticínios. Revista do Instituto de Laticínios Cândido Tostes, v. 58, nº. 333, p. 89-
91, jul./ago. 2003b.

CARIDI, A. Ripening and seasonal changes in microbial groups and in physicochemical properties of the ewes' cheese
Pecorino del Poro. International Dairy Journal, v. 13, nº. 2-3, p. 191-200, 2003.

CARMO, G. M. I.; OLIVEIRA, A. A.; DIMECH, C. P.; et al.Vigilância epidemiológica das doenças transmitidas por
alimentos no Brasil, 1999-2004. Boletim Eletrônico Epidemiológico, ano 5, n.º 6, p. 1-7, dez., 2005. Disponível em:
http://portal.saude.gov.br/portal/arquivos/pdf/bol_epi_6_2005_corrigido.pdf>. Acesso em: 19 jul. 2006.

CARMO, L. S.; DIAS, R. S.; ANUNCIAÇÃO, L. L. C.; BERGDOLL, M. S. Staphylococcal food poisoning in Minas
Gerais State (Brazil). Arquivos Brasileiros de Medicina Veterinária, v. 47, nº. 2, p. 113-122, jan./mar., 1995.

CARMO, L.S. et al. Staphylococcus aureus and Salmonella enteritidis present in food implicated in food poisoning
isolated from goat´s milk. Revista de Microbiologia, v. 27, p. 122-125, 1996.

CARMO, L.S. Produção e purificação em grande escala das enterotoxinas estafilocócicas SEA, SEB, SEC2, SED e
TSST-1 para uso em ensaios imuno-enzimáticos. 2001. 254f. Tese (Doutorado em FDFSDF). Nome da Escola,
Universidade Federal de Minas Gerais, Belo Horizonte.

CARMO, L. S. Intoxicação alimentar. Revista Minas faz Ciências, nº. 11, p. 1-2, jun./ago, 2002a. Disponível em:
<http://revista.fapemig.br/11/index.htlm>. Acesso em: 27 abr. 2006.

CARMO, L. S.; DIAS, R. S.; LINARDI, V. R.; et al. Food poisoning due to enterotoxigenic strains of Staphylococcus
present in Minas cheese and raw milk in Brazil. Food Microbiology, v.19, nº. 1, p. 9-14, jan./fev. 2002b.
CANGEMI DE GUTIERREZ, R.C.; SANTOS DE ARAOZ, V.S.; NADER-MACIAS, M.E. Effect of intranasal
administration of Lactobacillus fermentum on the respiratory tract of mice. Biol. Pharm. Bull., v. 23, p. 973-978, 2000.

CARRIQUE-MAS, J. J.; HÖKEBERG, I.; ANDERSON, Y.; et al. J. Febrile gastroenteritis after eating onfarm
manufactured fresh cheese – an outbreak of listeriosis? Epidemiology and Infection, v. 130, nº.1, p. 79-86, fev. 2003.

CARTER, P.B.; COLLINS, F.M. The route of enteric infection in normal mice. J. Exp. Med., v. 139, p. 1189-1203,
1974.

CATO, E.P.; MOORE, W.E.C.; JOHNSON, J.L. Synonymy od strains of Lactobacillus acidophilus group A2 (Johnson
et al. 1980) with the type strain od Lactobacillus crispatus (Brygoo and Aladame 1953) Moore and Holdeman 1970. Int.
J. Syst. Bacteriol., v.33, p. 426-428, 1983.

CARVALHO, J. D. G. Avaliação da qualidade de queijos tipo Minas Frescal elaborados por diferentes
processos tecnológicos e comercializados em Campinas. 2003. 107p. Dissertação (Mestre em Tecnologia de Alimentos)
– Faculdade de Engenharia de Alimentos, Universidade Estadual de Campinas, Campinas.

CASAS, I.A. & DOBROGOSZ, W.J. Lactobacillus reuteri: an effective animal probiotic. In: PROCEEDINGS OF
SYMPOSIUM PROBIOTICS IN MAN AND ANIMAL, 1996, Berlim, Dados da publicação, p.20-22, 1996.

CASHELL, M. Food poisoning outbreaks: the environmental health experience. Dublin. In: INTERNATIONAL EU-
RAIN CONFERENCE FOOD PATHOGEN EPIDEMIOLOGY: MICROBES, MALADIES AND METHODS, 1, 2004,
Pádua. Dublin: The National Food Center (Teagasc), part I. p. 27-33. 2004

CASMAN, E. P. Further serological studies of staphylococcal enterotoxin. Journal of Bacteriology, v. 79, nº. 6, p. 849-
856, jun.1960.

CASMAN, E. P.; BENNETT, R. W.; DORSEY, A. E.; et al. Identification of a fourth staphylococcal enterotoxin,
enterotoxin D. Journal of Bacteriology, v. 94, nº. 6, p. 1875-1882, dez., 1967.

CASSAROTTI, V. T.; GALLO, C. R.; CAMARGO, R. Ocorrência de Listeria monocytogenes em leite cru, leite
pasteurizado tipo C e queijo Minas Frescal comercializados em Piracicaba – SP. Archivos Latinoamericanos de
Nutrición, Caracas, v.44, nº. 3, p. 158-163, set.1994.

CASSONE, M.; SERRA, P.; MONDELLO, F.; et al. Outbreak of Saccharomyces cerevisiae subtype boulardii fungemia
in patients neighboring those treated with a probiotic preparation of the organism. J. Clin. Microbiol., v. 41, p. 5340-
5343, 2003.

CASTAGLIUOLO, I.; LAMONT, J.T.; NIKULASSON, S.T.; et al. Saccharomyces boulardii protease inhibits
Clostridium difficile toxin A effects in the rat ileum. Infect. Immun., v. 64, p. 5225-5232, 1996.

CASTAGLIUOLO, I.; RIEGLER, M.F.; VALENICK, L.; et al. Saccharomyces boulardii protease inhibits the
effects of Clostridium difficile toxins A and B in human colonic mucosa. Infect. Immun., v. 67, p. 302-307, 1999.

CASTEX, F.; CORTHIER, G.; JOUVERT, S.; et al. Prevention of Clostridium difficile-induced experimental
pseudomembranous colitis by Saccharomyces boulardii: a scanning electron microscopic and microbiological study. J.
Gen. Microbiol., v. 136, p. 1085-1089, 1990.

CATÃO, R. M. R.; CEBALLOS, B. S. O. Listeria spp., Coliformes totais e fecais e E. coli no leite cru e pasteurizado de
uma indústria de laticínios, no Estado da Paraíba (Brasil). Ciência e Tecnologia de Alimentos, v. 21, nº. 3, p. 281-287,
set/dez. 2001.

CAVALCANTE, J. F. M. Sistema de apoio á decisão na produção de leite e queijo coalho com segurança alimentar.
2005. 158p. Tese (Doutorado em Ciência e Tecnologia de Alimentos). Departamento de Tecnologia de Alimentos,
Universidade Federal de Viçosa, Viçosa.

CAVALCANTE, J. F. M.; ANDRADE, N. J.; SILVA, R. F. N. Valorização do queijo de artesanal brasileiro: caso do
queijo de coalho. Revista do Instituto de Laticínios Cândido Tostes, v. 59, nº. 339, p. 215-218, jul./ago. 2004.

CEARÁ. Secretaria da Saúde do Estado do Ceará. Núcleo de Epidemiologia. Célula de Vigilância Epidemiológica.
Informe anual de surtos das doenças transmitidas por alimentos. Fortaleza, 2004. 4p.

CEARÁ (Estado). Secretaria da Saúde do Estado do Ceará. Núcleo de Epidemiologia. Célula de Vigilância
Epidemiológica. Informe anual de surtos das doenças transmitidas por alimentos. Fortaleza, 2004. 4p.

CENCI-GOGA, B. T.; KARAMA, M.; ROSSITTO, P. V.; et al. Research Note Enterotoxin Production by
Staphylococcus aureus Isolated from Mastitic Cows. Journal of Food Protection, v. 66, nº. 9, p. 1693–1696, Sept.,
2003.

CENCI-GOGA, B. T.; KARAMA, M.; ROSSITTO, P. V.; MORGANTE, R. A.; CULLOR, J. S. Research Note
Enterotoxin Production by Staphylococcus aureus Isolated from mastitic cows. Journal of Food Protection,, v. 66, nº. 9,
p. 1693–1696, set., 2003.

CENTERS FOR DISEASE CONTROL AND PREVENTION (CDC). Final FoodNet SurveillanceReport. Atlanta:
Department of Health and Human Services / CDC, 2003a. 29p.

CENTERS FOR DISEASE CONTROL AND PREVENTION (CDC). Multistate outbreak of Salmonella serotype
Typhimurium infections associated with drinking unpasteurized milk - Illinois, Indiana, Ohio, and Tennessee, 2002-
2003. Morbidity and Mortality Weekly Report, Atlanta, v. 52, n. 26, p. 613-615, July, 2003b.

CENTERS FOR DISEASE CONTROL AND PREVENTION (CDC). Salmonella surveillance: Annual Summary, 2004.
Atlanta: United States Department of Health and Human Services/CDC, 2005. 15p. Disponível em:
<http://www.cdc.gov/ncidod/dbmd/phlisdata/salmtab/2004/Salmonellaintrodu ction2004.pdf>. Acesso em: 08 Mar.
2006.

CENTERS FOR DISEASE CONTROL AND PREVENTION (CDC). Preliminary FoodNet data on the incidence of
infection with pathogens transmitted commonly through food - - - 10 sites, United States, 2004. Morbidity and
Mortality Weekly Report, Atlanta, v. 54, n. 14, p. 352-356, Apr., 2004.

CENTERS FOR DISEASE CONTROL AND PREVENTION (CDC). Salmonella surveillance: Annual Summary, 2004.
Atlanta: United States Department of Health and Human Services, CDC, 2005. 15p.

CERQUEIRA, M.M.O.P. et al. Surto epidêmico de toxinfecção alimentar envolvendo queijo tipo Minas Frescal em
Pará de Minas. Arquivo Brasileiro de Medicina Veterinária e Zootecnia, v. 46, n.º 6, p. 723-728, 1994.

CERQUEIRA, M. M. O. P.; LEITE, M. O.; FONSECA, L. M.; et al. Freqüência de Listeria sp e Staphylococcus aureus
em queijo Minas produzido artesanalmente. In: CONGRESSO NACIONAL DE LATICÍNIOS, XIII., 1995, Juiz de
Fora. Anais. Juiz de Fora: EPAMIG/ELCT, 1995. p. 95-7.

CESARO, S.; CHINELLO, P.; ROSSI, L.; et al. L. Saccharomyces cerevisiae fungemia in a neutropenic patient treated
with Saccharomyces boulardii. Support. Care Cancer, v. 8, p. 504-505, 2000.

CHAMPAGNE, C.P.; ROY, D.; LAFOND, A. Selective enumeration of Lactobacillus casei in yoghurt-type fermented
milks based on a 15ºC incubation temperature. Biotechnol. Tech., v. 11, p. 567-569, 1997.

CHANDAN, R.C. Enhancing market value of milk by adding cultures. J. Dairy Sci., v. 82, p. 2245-2256, 1999. Apud
GIBSON, S.A.W., ed. Human Health, the Contribution of Microorganisms. Springer-Verlag, New York, NY, 1994.

CHANG, Y-H.; KIM, J-K.; KIM, H-J.; KIM, W-Y.; et al. Selection of potential probiotic Lactobacillus strain and
subsequent in vivo studies. Antonie van Leeuwenhoek, v. 80, p. 193-1999, 2001.

CHAPAVAL, L. Detecção de enterotoxinas estafilocócicas produzidas por Staphylococcus aureus no leite bovino por
eletroforese capilar e identificação dos isolados enterotoxigênicos via PCR.2003.140p. Tese (Doutorado em Ciências) –
Centro de Energia Nuclear na Agricultura, Universidade de São Paulo, Piracicaba.

CHARTERIS, A. et al. Antibiotic susceptibility of potencially probiotic Lactobacillus species. Journal of Food
Protection, v. 61, nº. 12, p. 1636-1643, 1998.

CHARTERIS, W.P.; KELLY, P.M.; MORELLI, L.; et al. Selective detection, enumeration and identification of potential
probiotic Lactobacillus and Bifidobacterium species in mixed bacterial populations. Int. J. Food Microbiol., v. 35, nº. 1,
p. 1-27, 1997.

CHARTERIS, W.P.; KELLY, P.M.; MORELLI, L.; et al. Development and application of an in vitro methodology to
determine the transit tolerance of potentially probiotic Lactobacillus and Bifidobacterium species in the upper human
gastrointestinal tract. J. Appl. Microbiol., v. 84, p. 759-768, 1998.
CHARTERIS, W.; KELLY, P.; MORELLI, L.; et al. Ingredient selection for probiotic microorganisms in functional
dairy foods. International Journal of Dairy Technology. ,v. 51, p. 123-136, 1998.

CHARTERIS, W.P.; KELLY, P.M.; MORELLI, L.; et al. Quality control Lactobacillus strains for use with the API
50CH and API ZYM systems at 37ºC. J. Basic Microbiol., v.41, nº. 5, p. 241-51, 2001.

CHAVES, A.H. et al. Isolamento, caracterização e identificação de Lactococcus lactis ssp. lactis var. diacetylactis.
Revista do Instituto de Laticínios Cândido Tostes, v. 50, nº. 295, p. 30-35, 1995.

CHAVES, A.H., SILVA, J.F.C., PINHEIRO, A.J.R., et al. Seleção de Lactobacillus acidophilus para probiótico em
bezerros. Anais da XXXIV Reunião da SBZ. 1997.

CHEN H.; HOOVER, D.G. Bacteriocins and their food applications. Comprehensive Reviews in Food Science and
Food Safety. v.2, p. 82-100, 2003

CHENG-CHUN, C.; LI-FEN, C. Enterotoxin production by Staphylococcus warneri CCRC 12929, a coagulase-
negative strain. Journal of Food Protection, v. 60, nº. 8, p. 923–927, ago., 1997.

CHEVALIER, P.; ROY, D.; SAVOIE, L. X-#-Gal-based medium for simultaneous enumeration of bifidobacteria and
lactic acid bacteria in milk. Journal of Microbiological Methods, v. 13, p. 75-83, 1991.

CHEVALIER, P.; ROY, D.;WARD, P. Detection of Bifidobacterium species by enzymatic methods. Journal of Applied
Bacteriology, v. 68, p. 619-624, 1990.

CHIA, J.K.S.; CHAN, S.M.; GOLDSTEIN, H. Baker's yeast as adjunctive therapy for relapses of Clostridium difficile
diarrhea. Clin. Infec. Dis., v. 20, p. 1581, 1995.

CHIN, H.S.; SHIM, J.S.; KIM, J.M.; et al. Detection and antibacterial activity of a bacteriocin produced by
Lactobacillus plantarum. Food Science and Biotechnol., v.10, nº.4, p.335-341, 2001.

CHINGWARU, W.; MPUCHANE S.F.; GASHE B.A. Enterococcus faecalis and Enterococcus faecium
isolates from milk, beef, and chicken and their antibiotic resistance. Journal of Food Protection, v. 66, nº. 6, p. 931-936,
2003.

CHOU, L.S.; WEIMER, B. Isolation and characterization of acid and bile tolerant isolates from strains of Lactobacillus
acidophilus. Journal of Dairy Science, v. 82, nº. 1, p. 23-31, 1999.

CHURCHILL, R. L. T.; LEE, H.; HALL, J. C. Detection of Listeria monocytogenes and the toxin listeriolysin O in
food. Journal of Microbiological Methods, v. 64, nº. 1, p. 141-170, Jan., 2006.

CIAA, Code of Practice on the Use of Health Claims. Bélgica:CIAA,, 1999

CLARK, P.A., MARTIN, J.H. Selection of bifidobacteria for use as dietary adjuncts in cultured dairy foods: III –
tolerance to simulated bile concentrations of human small intestines. Cult. Dairy Prod. J., v.29, p.18-21, 1994.

CLARK, P.A.; COTTON, L.N.; MARTIN, J.H. Selection of Bifidobacterium spp. for use as dietary adjuncts in cultured
dairy foods: II tolerance to simulated pH of human stomachs. Cult. Dairy Prod. J., v. 28 , n. 4, p. 11-14, 1993.

CLARKE, S.C. Diarrhoeagenic Escherichia coli – an emerging problem? Diagn. Microbiol. Infect. Dis., v. 41, p. 93-98,
2001.

CLARKE, S. C.; HAIGH, R. D.; FREESTONE, P. P. E.; et al. Virulence o fenteropathogenic Escherichia coli, a global
pathogen. Clinical Microbiology Review, v. 16, nº. 3, p. 365-378, jun. 2003.

CLEVELAND, J. et al. Bacteriocins: safe, natural antimicrobials for food preservation. Int. J. Food Microbiol., v.71,
p.1-20, 2001.

COCONNIER, M.H.; LIEVIN, V.; HEMERY, E.; et al. Antagonistic activity against Helicobacter infection in vitro and
in vivo by the human Lactobacillus acidophilus strain LB. Appl. Environ. Microbiol., v. 54, p. 4573-4580, 1998.

CODEX ALIMENTARIUS COMMISSION. (1993-2000). Reports of the Twenty-Second through Twenty-Eighth


sessions of the Codex Committee on Food Labeling (ALINORM 93/22-01/22). Rome, Italy: FAO/WHO.
CODY, S. H.; ABBOTT, S. L.; MARFIN, A. A.; et al. Two Outbreaks of Multidrug-Resistant Salmonella Serotype
Typhimurium DT104 Infections Linked to Raw-Milk Cheese in Northern California. The Journal of the American
Medical Association,, v. 281, n. 19, p. 1805-1810, mai.1999.

COGAN, T.M.; ACCOLAS, J.P. (eds.) Dairy starter cultures. Estados Unidos: VCH Publishers Inc, 1996, cap. 9,
pp.233-248.

COIA, J.E. Clinical, microbiological and epidemiological aspects of Escherichia coli O157 infections. FEMS Immunol.
Med. Microbiol., v. 20, p. 1-9, 1998.

COLAK, H.; HAMPIKYAN, H.; BINGOL, E. B.; ULUSOY, B. Prevalence of Listeria monocytogenes and Salmonella
spp. in Tulum cheese. Food Control, Oxford, In Press.

COLLINS, J.K.; THORTON, G.; SULLIVAN, G.O. Selection of probiotic strains for human application. International
Dairy Journal, v. 8, p. 487-490, 1998.

COLLINS, M.D.; PHILLIPS, B.A.; ZANONI, P. Deoxyribonucleic acid homology studies of Lactobacillus casei,
Lactobacillus paracasei sp. nov., subsp. paracasei and subsp. tolerans, and Lactobacillus rhamnosus sp. nov., comb. nov.
Intenational Journal of Systematic Bacteriology, v. 39, p. 105-108, 1989.

COLLINS, M.D.; RODRIGUES, U.; ASH, C.; et al. Phylogenetic analysis of the genus Lactobacillus and related lactic
acid bacteria as determined by reverse transcriptase sequencing of 16S rRNA. FEMS Microbiol. Lett., v. 77, p. 5-12,
1991.

CONWAY, P.L.; GORBACH, S.L.; GOLDEN, B.R. Survival of lactic acid bacteria in the human stomach and adhesion
to intestinal cells. J. Dairy Sci., v. 70, p. 1-12, 1987.

CORDANO, A. M.; ROCOURT, J. Occurrence of Listeria monocytogenes in food in Chile. International Journal of
Food Microbiology,, v. 70, n. 1/2, p. 175-178, out. 2001.

CORTHIER, G.; DUBOS, F.; DUCLUZEAU, R. Prevention of Clostridium difficile induced mortality in gnotobiotic
mice by Saccharomyces boulardii. Can. J. Microbiol., v. 32, p. 894-896, 1986.

CORTHIER, G.; LUCAS, F.; JOUVERT, S.; et al. Effect of oral Saccharomyces boulardii treatment on the activity of
Clostridium difficile toxins in mouse digestive tract. Toxicon, v. 30, p. 1583-1589, 1992.

COSTALOS, C.; SKOUTERI, V.; GOUNARIS, A.; et al. Enteral feeding of premature infants with Saccharomyces
boulardii. Early Hum. Dev., v. 74, p. 89-96, 2003.

COSTALUNGA, S.; TONDO, E. C. Salmonellosis in Rio Grande do Sul, Brazil, 1997 to 1999. Brazilian Journal of
Microbiology, v. 33, nº. 4, p. 342346, out./dez., 2002.

COSTELLO, M. Probiotic Foods. The Food Industry Conference Proceedings, Food Pro 93, International Food
Processing Machinery and Technology Exhibition and Conference. Sydney, Australia, 12-14 July, p. 10-16, 1993.

COTTON, L. N.; WHITE, C. H. Listeria monocytogenes, Yersinia enterocolitica, and Salmonella in dairy plant
environments. Journal of Dairy Science, 75, nº. 1, p. 51-57, jan. 1992.

COUCH, J. L.; SOLTIS, M. T.; BETLEY, M. J. Cloning and nucleotide sequence of the type E staphylococcal
enterotoxin gene. Journal of Bacteriology, v. 170, nº. 7, p. 2954–2960, jul. 1988.

COUCH, SOLTIS, M. T.; BETLEY, M. J. Cloning and nucleotide sequence of the type E staphylococcal enterotoxin
gene. Journal of Bacteriology, v. 170, nº. 7, p. 2954-2960, jul. 1988.

COVENTRY, M. J., MUIRHEAD, K., HICKEY, M. W. Partial characterization of pediocin PO2 and comparison with
nisin for biopreservation of meat products. Int. J. Food Microbiol., v.26, p.133-145, 1995.

CROCIANI, F.; ALESSANDRINI, A.; MUCCI, M.M.; et al. Degradation of complex carbohydrates by
Bifidobacterium spp. International Journal of Food Microbiology, v. 24, p. 199-210, 1994.

CUMMINGS, J.H.; MACFARLANE, G.T. The control and consequences of bacterial fermentation in the human colon.
J. Applied Bacteriol., v.70, p.443-459, 1991.
CUNHA NETO, A.; SILVA, C. G. M.; STANFORD, T. L. M. Staphylococcus enterotoxigênicos em alimentos in natura
e processados no estado de Pernambuco, Brasil. Ciência e Tecnologia de Alimentos, v. 22, nº. 3, p. 263-271, set./dez.,
2002.

CZERUCKA, D.; NANO, J.L.; BERNASCONI, P.; et al. Effect of Saccharomyces boulardii on cholera toxin-induced
cAMP levels in rat epithelial intestinal cell lines. Gastroenterol. Clin. Biol., v. 3, p. 383-384, 1989a.

CZERUCKA, D.; NANO, J.L.; BERNASCONI, P.; et al. Response to cholera toxin of 2 epithelial intestinal cell lines.
Effect of Saccharomyces boulardii. Gastroenterol. Clin. Biol., v. 13, p. 383-387, 1989b.

CZERUCKA, D.; NANO, J.L.; BERNASCONI, P.; et al., P. Response of the IRD intestinal epithelial cell line to
Clostridium difficile toxins A and B in rats. Effect of Saccharomyces boulardii. Gastroenterol. Clin. Biol., v. 15, p. 22-
27, 1991.

CZERUCKA, D.; ROUX, I.; RAMPAL, P. Saccharomyces boulardii inhibits secretagogue-mediated adenosine 3’,5’-
cyclic monophosphate induction in intestinal cells. Gastroenterology, v. 106, p. 65-72, 1994.

CZERUCKA, D.; RAMPAL, P. Effect of Saccharomyces boulardii on cAMP - and 2+-Ca - dependent Cl secretion in
T84 cells. Dig. Dis. Sci., v. 44, p. 2359-2368, 1999.

CZERUCKA, D.; DAHAN, S.; MOGRABI, B.; et al.. Saccharomyces boulardii preserves the barrier function and
modulates the transduction pathway induced in enteropathogenic Escherichia coli-infected T84 cells. Infect. Immun., v.
68, p. 5998-6004, 2000.

CZERUCKA, D.; RAMPAL, P. Experimental effects of Saccharomyces boulardii on diarrheal pathogens. Microbes
Infect., v. 4, p. 733-739, 2002.

D'AGATA,E.M.; GERRITS,M.M.; TANG,Y.W.; et al.-Comparison of pulsed-field gel electrophoresis and amplified


fragment-length polymorphism for epidemiological investigations of common nosocomial pathogens. Infect. Control
Hosp. Epidemiol.,v. 22, p. 550-554, 2001.

D’AOUST, J. Y.; MAURER, J.; BAILEY, J. S. Salmonella species. In: DOYLE, M. P.; BEUCHAT, L.
R.;MONTVILLE, T. J. (ed.) Food microbiology, fundamentals and frontiers. 2ª ed., Washington: ASM, 2001. cap. 18, p.
383-409.

DAHAN, S.; DALMASSO, G.; IMBERT, V.; et al. Saccharomyces boulardii interferes with enterohemorrhagic
Escherichia coli-induced signaling pathways in T84 cells. Infect. Immun., v. 71, p. 766-773, 2003.

DALTON, C. B.; AUSTIN, C. C.; SOBEL, J.; et al. An outbreak of gastroenteritis and fever due to Listeria
monocytogenes in milk. New England Journal of Medicine, v. 336, nº. 2, p. 100-105, jan., 1997.

DALTON, C. B.; GREGORY, J.; KIRK, M. D.; et al.. Foodborne disease outbreaks in Australia, 1995 to 2000.
Communicable Diseases Intelligence,, v. 28, nº, 2, p, 211-224, fev. 2004.

DANIELSEN, N.; WIND, A. Susceptibility of Lactobacillus spp. to antimicrobial agents. International Journal of
Food Microbiology, v. 82, nº. 1, p. 1-11, 2003.

DASH, M.; LIU, H. Efficient hierarchical clustering algorithms using partially overlapping partitions. Lecture Notes in
Computer Science, v. 2035, p. 495-506, 2001.

DATAMARK CONSULTORES, Brazil Pack’ 93. A indústria brasileira de embalagens incorporando o mercado
brasileiro de produtos ao consumidor. Parte II Os mercados de uso final. 8 ed. São Paulo: Datamark, 1993. p.73-219.
Apud: VAN DENDER, A. G. F. Contribuição ao estudo do uso da ultrafiltração de leite na fabricação de queijo Minas
Frescal. 1995. 176f. Tese (Doutorado em Tecnologia de Alimentos) - Faculdade de Engenharia de Alimentos,
Universidade Estatual de Campinas, Campinas.

DAUD, K.A.K.; NEILIAN, B.A.; HENRIKSSON, A.; et al. Identification and phylogenetic analysis of Lactobacillus
using multiplex RAPD-PCR. FEMS Microbiol. Lett., v. 153, p. 191-197, 1997.

DAVE, R.I.; SHAH, N.P. Effectiveness of ascorbic acid as an oxygen scavenger in improving viability of probiotic
bacteria in yoghurts made with commercial starter cultures. Int. Dairy Journal, v. 7, p. 435-443, 1997a.
DAVE, R.I.; SHAH, N.P. Effect of cysteine on the viability of yoghurt and probiotic bacteria in yoghurt made with
commercial starter cultures. Int. Dairy J., v. 7, p. 537-545, 1997.

DAVE, R.I.; SHAH, N.P. Evaluation of media for selective enumeration of Streptococcus thermophilus, Lactobacillus
delbrueckii spp. bulgaricus, Lactobacillus acidophilus, and bifidobacteria. J. Dairy Sci., v. 79, p. 1529-1536, 1996.

DE BUYSER, M. L. D.; DUFOUR, B.; MAIRE, M.; et al. V. Implication of milk and milk products in food-borne
diseases in France and in different industrialized countries. International Journal of Food Microbiology, v. 67, nº. 1, p.
1-17, Jan., 2001.

DE CHAMPS, C.; MARONCLE, N.; BALESTRINO, et al.. Persistence of colonization of intestinal mucosa by a
probiotic strain, Lactobacillus casei subsp. rhamnosus Lcr35, after oral consumption. J. Clin. Microbiol., v. 41, p. 1270-
1273, 2003.

DE LUCA, G.; ZANETTI, F.; STAMPI, S. Staphylococcus aureus in dairy products in the Bologna area. International
Journal of Food Microbiology,, v. 35, n. 3, p. 267-270, abr. 1997.

DE MAN, J.C.; ROGOSA, M.; SHARPE, M.E. A medium for cultivation of lactobacilli. J. Appl. Bacteriol., v. 23, p.
130-135, 1960.

DE RÉU, K.; DEBEUCKELAERE, W.; BOTTELDOORN, N.; et al.. Hygienic parameters, toxins and pathogen
occurrence in raw milk cheeses. Journal Food Safety, v. 22, nº. 3, p. 183-196, set.., 2002.

DE VOS, P.; TRÜPER, H. G.; TINDALL, B. J. Judicial Commission of the International Committee on Systematics of
Prokaryotes Xth International (IUMS) Congress of Bacteriology and Applied Microbiology. Minutes of the meetings,
28, 29 and 31 July and 1 August 2002, Paris, France. International Journal Systematic Evolutionary Microbiology,
Reading, v. 55, n. 1, p. 525-532, Jan., 2005

DE VUYST, L.; VANDAMME, E.J. Antimicrobial potential of lactic acid bacteria. In: ________(eds.), Bacteriocins of
lactic acid bacteria: microbiology, genetics and applications. Londres: Blackie Academic and Professional, 1994a.
p.91-142.

DE VUYST, L.; VANDAMME, E.J. Bacteriocins of lactic acid bacteria: microbiology, genetics and applications.
Londres: Blackie Academic and Professional, 1994b.. 536 p.

DE VUYST, L.; VANDAMME, E.J. Lactic acid bacteria and bacteriocins: their practical importance. In: _______.
(eds). Bacteriocins of lactic acid bacteria: microbiology, genetics and applications. New York: Chapman & Hall,
1994c. p. 1-12,

DEETH, H.C. & TAMINE, A.Y. Yoghurt: nutritive and therapeutic aspects. Journal of Food Protection, v.44, p.78-86,
1981.

DELLAGLIO, F.; DICKS, L.M.T.; DU TOIT, M.; et al. Designation of ATCC 334 in place of ATCC 393 (NCDO 161)
as the neotype strain of Lactobacillus casei subsp. casei and rejection of the name Lactobacillus paracasei (Collins et al.
1989). Request for an opinion. Int. J. Syst. Bacteriol., v. 41, p. 340342, 1991.

DELLAGLIO, H., ROISSART, H., TORRIANI, S., et al. Caractéristiques générales des bactéries lactiques. In:
ROISSART, H., LUQUET, F.M. (eds). Bactéries lactiques. aspects fondamentaux et technologiques. Paris: Lorica,
1994. v.1, p.25-139.

DENTON,M.; TODD,N.J.; KERR,K.G.; et al. Molecular epidemiology of Stenotrophomonas maltophilia isolated from
clinical specimens from patients with cystic fibrosis and associated environmental samples. J. Clin. Microbiol., v. 36, p.
1953-1958, 1998.

DESENCLOS, J. C.; BOUVET, F.; BENZ-LEMOINE, E.; et al. Large outbreak of Salmonella enterica serotype
paratyphi B infection caused by a goats' milk cheese, France, 1993: a case finding and epidemiological study. British
Medical Journal, 312, nº. 1, p. 91-94, jan., 1996.

DESMAZEAUD, M.J.;ROISSART, H. de. Métabolisme general des bacteries lactiques. In: ROISSART, H.
de;LUQUET F.M. (eds). Bactérie Lactique. Paris: Lorica, 1997. p. 169-204.

DESTRO, M. T.; SERRANO, A. De M.; KABUKI, D. Y. Isolation of Listeria species from some brazilian meat and
dairy products. Food Control, v.2, nº. 2, p. 110-112, abr. 1991.
DI PIETRO, S.; HARITCHABALET, K.; CANTONI, G.;et al. Surveillance of foodborne diseases in the province of
Rio Negro, Argentina, 1993-2001. Medicina, v. 64, nº. 2, p. 120-124, mar./abr., 2004.

DIAS, R.S.; BAMBIRRA, E.A.; SILVA, M.E.; et al. Protective effect of Saccharomyces boulardii against the cholera
toxin in rats. Braz. J. Med. Biol. Res., v. 28, p. 323-325, 1995.

DIAS, R. S.; SILVA, S. L.; SOUZA, J. M.; et al. Surtos de toxinfecção alimentar provocados por queijos
comercializados em Minas Gerais, no período de 1992 a 1994. In: CONGRESSO NACIONAL DE LATICÍNIOS, XIII.,
1995, Juiz de Fora. Anais. Juiz de Fora: EPAMIG/ELCT, 1995. p. 143-144.

DICKS, L.M.T.; DU PLESSIS, E.M.; DELLAGLIO, F.; et al. Reclassification of Lactobacillus casei subsp. casei ATCC
393 and Lactobacillus rhamnosus ATCC 15820 as Lactobacillus zeae nom. rev., designation of ATCC 334 as the
neotype of L. casei subsp. casei, and rejection of the names Lactobacillus paracasei. Int. J. Syst. Bacteriol., v. 46, nº. 1,
p. 337-340, 1996.

DINAKAR, P.; MISTRY, V.V. Growth and viability of Bifidobacterium bifidum in cheddar cheese. J. Dairy Sci., v. 77,
p. 2854-2864, 1994.

DINGES, M. M.; ORWIN, P. M.; SCHLIEVERT, P. M. Exotoxins of Staphylococcus aureus. Clinical Microbiology
Reviews, v. 13, nº.1, p. 16-34, jan., 2000.

DOBROGOSZ, W.J. & CASAS, I.A. Lactobacillus reuteri: na effective human probiotic. In.: Procedings of the
Symposium Probiotics in Man and Animal, June, 20-22, 1996.

DODD, C. E. R.; SHARMA, N. K.; REES, C. E. D. Development of a singlereaction multiplex PCR toxin typing assay
for Staphylococcus strains. Applied and Environmental Microbiology, v. 66, nº. 4, p. 1347-1353, Apr., 2000.

DONELLY, C. W. Listeria monocytogenes. In: HUI, Y.H.; PIERSON, M.D.; GORHAM, J.R. (ed.). Foodborne disease
handbook. 2ª ed. New York: Marcel Dekker, 2001. v. 1. cap. 10, p. 213-246.

DONG, X.; YUHUA, X.; JIAN, W.Y.; et al. Bifidobacterium thermacidophilum sp. nov., isolated from na anaerobic
digestor. Int. J. Syst. Evol. Microbiol., v. 50, p. 119-125, 2000.

DONNELLY, M. Factors associated with hygienic control and quality of cheeses prepared from raw milk: a review.
Bulletin of the International Dairy Federation, n. 369, p. 16-27, 2001.

DONOHUE, D.C.; SALMINEN, S. Safety of probiotic bacteria. Asia Pacific J. Clin. Nutr., v. 5, p. 25-28, 1996.

DORNELLAS, J. R. Efeito do tipo de coagulante e acidificante no rendimento, proteólise, e “shelf life” do queijo
Minas Frescal. Campinas, 1997. 96f. Dissertação (Mestrado em Tecnologia de Alimentos) - Faculdade de Engenharia de
Alimentos, Universidade Estadual de Campinas, Campinas.

DRIESSEN, F.M.; DE BOER, R. Fermented milks with selected intestinal bacteria: a healthy trend in new products.
Neth. Milk Dairy J., v. 43, p. 367-382, 1989.

DU PLESSIS, E.M.; DICKS, L.M.T. Evaluation of random amplified polymorphic DNA (RAPD)-PCR as a method to
differentiate Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus amylovorus, Lactobacillus gallinarum,
Lactobacillus gasseri, and Lactobacillus johnsonii. Curr. Microbiol., v. 31, p. 114118, 1995.

DUARTE, D. A. M.; SCHUCH, D. M. T.; SANTOS, S. B.;et al. Pesquisa de Listeria monocytogenes e microrganismos
indicadores higiênico-sanitários em queijo de coalho produzido e comercializado no estado do Pernambuco. Arquivos
do Instituto Biológico, v. 72, nº. 3, p. 297-302, jul./set. 2005.

DUCLUZEAU, R.; BENSAADA, M. Comparative effect of a single or continuous administration of Saccharomyces


boulardii on the establishment of various strains of Candida in the digestive tract of gnotobiotic mice. Ann. Microbiol.,
v. 133, p. 491-501, 1982.

DUCLUZEAU, R. Role of experimental microbial ecology in gastroenterology. In BERGOGNE-BEREZIN, E. (eds.).


Microbial Ecology and Intestinal Infections. Paris: Springer-Verlag, 1989. p. 7-29,

DUNNE, C.; O’MAHONY, L.; MURPHY, L.;et al. In vitro selection criteria for probiotic bacteria of human origin:
correation with in vivo findings. Am. J. Clin. Nutr., v. 73(suppl): p.386S-392S, 2001.
DUPONT, H.L.; LEVINE, M.M.; HORNICK, R.B.; et al. Inoculum size in shigellosis and implications for expected
mode of transmission. J. Infect. Dis., v. 159, p. 1126-1128, 1989.

D. C.: American Public Health Association, 2001. Chap. 3. p. 25-35. FEITOSA, T.; BORGES, M. F de; NASSU, R. T;
AZEVEDO, E. H. F.; MUNIZ, C. R. Pesquisa de Salmonella sp., Listeria sp. e microrganismos indicadores higiênico-
sanitários em queijos produzidos no estado do Rio Grande do Norte. Ciência e Tecnologia de Alimentos, Campinas, v.
23, n. 3, set./dez., 2003.

EL GAZZAR, F. E.; MARTH, E. H. Ultrafiltration and reverse osmosis in dairy technology: A review. Journal of Food
Protection, , v. 54, nº. 10, p. 801-809, out. 1991.

EL GAZZAR; F.; MARTH, E. H. Salmonellae, salmonellosis, and dairy foods: a review. Journal of Dairy Science, v.
75, n. 9, p. 2327-2343, set. 1992.

ELLIS, A.; PRESTON, M.; BORCZYK, A.; et al . A community outbreak of Salmonella Berta associated with a soft
cheese product. Epidemiology and Infection, v. 120, nº. 1, p. 29-35, jan. 1998.

ELMER, G.W.; CORTHIER, G. Modulation of Clostridium difficile induced mortality as a function of the dose and the
viability of the Saccharomyces boulardii used as a preventative agent in gnotobiotic mice. Can. J. Microbiol., v. 37, p.
315-317, 1991.

ELMER, G.W.; SURAWICZ, C.M.; MCFARLAND, L.V. Biotherapeutic agents. A neglected modality for the treatment
and prevention of selected intestinal and vaginal infections. J. Am. Med. Assoc., v. 275, p. 870-876, 1996.

ELMER, G.W.; MCFARLAND, L.V.; SURAWICZ, C.M.; et al. Behaviour of Saccharomyces boulardii in recurrent
Clostridium difficile disease patients. Aliment. Pharmacol. Ther., v. 13, p. 1663-1668, 1999.

ELMER, G.W.; MCFARLAND, L.V. Biotherapeutic agents in the treatment of infectious diarrhea. Gastroenterol. Clin.
North Am., v. 30, p. 837-854, 2001.

ENGESSER, D.M.; HAMMES, W.P. Non-heme catalase activity of lactic acid bacteria. Syst. Appl. Microbiol., v. 19, p.
763-776, 1994.

ERKMEN, O. Inativation kinetics of Listeria monocytogenes in Turkish white cheese during the ripening period.
Journal of Food Engineering, v. 46, nº. 2, p. 127-131, nov. 2000.

ESCOBAR, C.A.M. et al. Avaliação dos pontos críticos na produção de queijo de coalho em Pernambuco. Revista do
Instituto de Laticínios Cândido Tostes, v. 56, nº. 321, p. 248–256, 2001.

ESCOBAR, C. A. M.; LEUTHIER, S.; ANTUNES, G.; et al. Avaliação dos pontos críticos na produção de queijo de
coalho em Pernambuco. Revista do Instituto de Laticínios Cândido Tostes, v. 56, nº. 321, p. 248-256, jul./ago., 2001.

ESPER, L. M. R. Diagnóstico da qualidade de ricotas comercializadas no município de Campinas – SP. 2006. 114p.
Dissertação (Mestre em Tecnologia de Alimentos) – Departamento de Tecnologia de Alimentos, Universidade Estadual
de Campinas, Campinas.

ESPINOZA, A. M.; TORRE, M. D. L.; SALINAS, M. F.; et al. Determinación de Listeria monocytogenes e quesos
frescos de producción artesanal que se expanden en los mercados del distrito de Ica, enero-marzo 2003. Revista
Peruana de Medicina Experimental y Salud Publica, , v. 21, nº. 2, p. 71-75, jan. 2004.

EVANCHO, G. M.; SVEUM, W. HL. J.; FRANK, J. F. Microbiological monitoring of the food processing environment.
In: DOWNES, F.P.; ITO, H. (ed.). Compendium of methods for the microbiological examination of foods. 4ª ed.
Washington: editora, ano. número de páginas

EVANS, J.B. & NIVEN, C.F.J. Nutrition of the heterofermentative lactobacilli that cause greening of cured meat
products. J. Bacteriol., v. 62, n.5, p.599-603, nov. 1951.

EVERSON, M. L.; HINDS, M. W; BERNSTEIN, R. S.; et al.. Estimation of human dose staphylococcal enterotoxin A
from a large outbreak of staphylococcal food poisoning involving chocolate milk. International Journal of Food
Microbiology, , v. 7, nº. 4, p. 311-316, dez. 1988.

EYSSEN, H. Role of the gut microflora in metabolism of lipids and sterols. Proc. Nutr. Soc., v. 32, p. 59-63, 1973.
FALK, P.G.; HOOPER, L.V.; MIDTVEDT, T.; et al. Creating and maintaining the gastrointestinal ecosystem: what we
know and need to know from gnotobiology. Microbiol. Mol. Biol. Rev., v. 62, p. 1157-1170, 1998.

FANEDL, L., NEKREP, F.V. & AVGUSTIN, G., Random amplified polymorphic DNA analysis and demonstration of
genetic variability among bifidobacteria isolated from rats fed with raw kidney beans. Can.J. Microbiol., v. 44, p.
10941001, 1998.

FANG, W., et al. Antagonistic action of Lactobacillus lactis toward Salmonella spp. and Escherichia coli O157:H7
during growth and refrigerated storage. Veterinary Research, v. 27, nº.1, p. 3-12, 1998.

FARAH,S.B. -DNA no diagnóstico das doenças infecciosas. In: FARAH,S.B. DNA: segredos e mistérios. 3ª ed. São
Paulo: Sarvier, 1997. p.103-140.

FARBER, J. M.; JOHNSTON, M. A.; PURVIS, U.; et al. Surveillance of soft and semi-soft cheeses for the presence of
Listeria spp. International Journal of Food Microbiology, v. 5, nº.2 , p. 157-163, nov. 1987.

FARBER, J. M.; SANDERS, G. M.; JOHNSTON, M. A. A survey of various foods for the presence of Listeria species.
Journal of Food Protection, , v. 52, nº. 7, p. 456-458, jul. 1989.

FARBER, J. M.; PETERKIN, P. I. Listeria monocytogenes, a food-borne pathogen. Microbiological Reviews, v. 55, nº.
3, p. 476-511, sep. 1991.

FARBER, J. M. ; GENDEL, S. M.;TYLER, K. D.; et al.Molecular typing and differentiation. In: DOWNES, F.P.; ITO,
H. (Ed.). Compendium of methods for the microbiological examination of foods. 4ª ed. Washington: American Public
Health Association, 2001. chap. 11, p. 127-156.

FARUQUE, S.M.; ALBERT, M.J.; MEKALANOS, J.J. Epidemiology, genetics and ecology of toxigenic Vibrio
cholerae. Microbiol. Mol. Biol. Rev., v. 62, p. 1301-1314, 1998.

FEDORAK, R.N. Naturally occurring and experimental models of inflammatory bowel disease. In: KIRSTNER, J.B.;
SHORTER, R.G. (ed.). Inflammatory Bowel Disease, 4ª ed.. Baltimore:The Williams & Wilkins Co., 1995, p. 71-95.

FEITOSA, T.; BORGES, M. F.; NASSU, R. T; et al. Pesquisa de Salmonella sp., Listeria sp. e microrganismos
indicadores higiênico- sanitários em queijos produzidos no estado do Rio Grande do Norte. Ciência e Tecnologia de
Alimentos, Campinas, v. 23, n. 3 (suplemento), p. 162-165, set./dez., 2003.

FENIMAN, C. M.; PASINI, G.; MUCELIN, C. A. Avaliação microbiológica do leite tipo C comercializado no
município de Medianeira – PR. In: Congresso Brasileiro de Ciência e Tecnologia de Alimentos, 18., 2002, Porto Alegre.
Anais. Porto Alegre: Sociedade Brasileira de Ciência e Tecnologia de Alimentos – SBCTA. (ISBN: 85-8912301-4). CD-
ROM.

FENG, P.; WEAGANT, S. D. Enumeration of Escherichia coli and the coliform bacteria. In: UNITED STATES FOOD
DRUG ADMINISTRATION (Ed.). Bacteriological analytical manual online. 8th ed. Rockville: FDA, 2002. Chap. 4. p.
4.1-14. Disponível em: <http://www.cfsan.fda.gov/~ebam/bam-4.html>Acesso em: 12 Jan. 06.

FERNÁNDEZ GARAYZÁBAL, J. F.; DOMÍNGUEZ RODRÍGUEZ, L.; VÁSQUES BOLAND, J. A.; et al. Listeria
monocytogenes dans le lait pasteurizé. Canadian Journal of Microbiology, v. 32, nº. 2, p. 149-150, feb. 1986.

FERREIRA, C.L.L.F. Produtos lácteos de terceira geração: importância de produtos contendo bactérias bífidas. Leite &
Derivados, v.29, p.22-28, 1996.

FERREIRA, F.A.B.; KUSSAKAWA, K.C.K. Uso de probióticos nag alimentação de frangos de corte. Biotecnologia, v.
8, p. 40-43, 1999.

FERREIRA, C.L.L.F. Grupo de bactérias láticas-caracterização tecnológica e aplicação de bactérias probióticas. In:
______. (ed) Prebióticos e Probióticos: atualização e prospecção. Viçosa: nome da editora, 2003. cap. 1, p.7-33.

FERRERO, M.; CESENA, C.; MORELLI, L.; et al. Molecular characterisation of Lb. casei strains. FEMS
Microbiology Letters, v. 140, p. 215-219, 1996.

FIGUEIREDO, E. A. T. Ocorrência do gênero Listeria e avaliação da diversidade genética de Listeria monocytogenes


através do rondam amplified polymorphic DNA (RAPD) e sua distribuição em uma linha de processamento de leite
pasteurizado tipo C. 2000. 100p. Tese (Doutorado em Microbiologia). Instituto de Ciências Biomédicas, Universidade
de São Paulo, São Paulo.

FIGUEIREDO, P.P.; VIEIRA, E.C.; NICOLI, J.R.; et al. Influence of oral inoculation with plasmid-free human
Escherichia coli on the frequency of diarrhea during the first year of life in human newborns. J. Pediatr. Gastroenterol.
Nutr., v. 33, p. 70-74, 2001.

FILHO-LIMA, J.V.; VIEIRA, E.C.; NICOLI, J.R. Antagonistic effect of Lactobacillus acidophilus, Saccharomyces
boulardii and Escherichia coli combinations against experimental infections with Shigella flexneri and Salmonella
enteritidis subsp. typhimurium in gnotobiotic mice. J. Appl. Microbiol., v. 88, p. 365-370, 2000.

FINLAY, B.B.; FALKOW, S. Salmonella interactions with polarized human intestinal Caco-2 epithelial cells. J. Infect.
Dis., v. 162, p. 1096-1104, 1990.

FINLAY, B.B.; LEUNG, K.Y.; ROSENSHINE, I.; et al. Salmonella interactions with the epithelial cells. ASM News, v.
58, p. 486-490, 1992.

FIORENTINO, E.R.; MARTINS, R.S. Características microbiológicas de "queijo de coalho" produzido no estado da
Paraíba. Higiene Alimentar, v. 13, nº. 59, p. 43-48, 1999.

FITZGERALD, J. R.; MONDAY, S. R.; FOSTER, T. J.; et al. Characterization of a putative pathogenicity island from
bovine Staphylococcus aureus encoding multiple superantigens. Journal of Bacteriology, , v. 183, nº. 1, p. 63-70, jan.,
2001.

FLAIR-FLOW EUROPE Enterococci in foods. Flair-Flow Reports, v. 593, nº. 3, p.71, 2003.

FLEMING, D. W.; COCHI, S. L.; MACDONALD, K. L.; et al.. Pasteurized milk as a vehicle of infection in an
outbreak of listeriosis. New England Journal of Medicine, , v. 312, nº. 7, p. 404-407, jan., 1985.

FLINT, J. A.; VAN DUYNHOVEN, T. Y.; ANGULO, F. J.; et al. Estimating the burden of acute gastroenteritis,
foodborne disease, and pathogens commonly transmitted by food: an international review. Clinical Infectious
Diseases,v. 41, n.º 1, p. 698704, set., 2005.

FURRER, B.; CANDRIAN, U.; HOEFELEIN, C.; et al. Detection and identification of Listeria monocytogenes in
cooked sausage products and in milk by in vitro amplification of hamolysin gene fragments. The Journal of Applied
Bacteriology,, v. 70, nº. 5, p. 372-379, mai.1991.

FLORENTINO, E. S.; MARTINS, R. S. Características microbiológicas do "queijo de coalho" produzido no Estado da


Paraíba. Revista Higiene Alimentar, v. 13, nº. 59, p. 43-48, jan./fev. 1999. .

FOOKS, L.J.; FULLER, R.; GIBSON, G.R. Int. Dairy J., v.9, p. 53-61, 1999.

FOOD AND DRUG ADMINISTRATION – FDA. Center for Food Safety & Applied Nutrition. Foodborn pathogenic
microorganisms and natural toxins handbook. The ”Bad Bug Book”. 1998

FOOD AND AGRICULTURAL ORGANIZATION (FAO)/WORLD HEALTH ORGANIZATION (WHO).. Guidelines


for the Evaluation of Probiotics in Food. London Ontario, Canada. April 30 and May 1, 2002.

FOOD AND AGRICULTURAL ORGANIZATION (FAO)/WORLD HEALTH ORGANIZATION (WHO). Expert


Committee on Food Additives. Chloramphenicol. Toxicological Evaluation of Certain Veterinary Drug Residues in
Food (WHO Food Additives Series 23). Geneva: World Health Organisation, pp. 1-71, 1988.

FOOD AND AGRICULTURE ORGANIZATION (FAO) / WOLRD HEALTH ORGANIZATION (WHO). Statistical
information on food-borne disease in Europe microbiological and chemical hazards. In: PAN-EUROPEAN
CONFERENCE ON FOOD SAFETY AND QUALITY, 1, 2002, Budapest. [Proceeding]. Roma: WHO, 2002. 15p.

FOOD AND AGRICULTURE ORGANIZATION (FAO) / WOLRD HEALTH ORGANIZATION (WHO). Statistical
information on food-borne disease in Europe microbiological and chemical hazards. In: PAN-EUROPEAN
CONFERENCE ON FOOD SAFETY AND QUALITY, 1, 2002, Budapest. [Proceeding]. Roma: FAO/WHO, 2002.
Disponível em: <ftp://ftp.fao.org/docrep/fao/meeting/004/y369e/y369e00.pdf>. Acesso em: 07 Feb. 2006.

FOOD AND AGRICULTURE ORGANIZATION (FAO) / WOLRD HEALTH ORGANIZATION (WHO). Statistical
information on food-borne disease in Europe microbiological and chemical hazards. In: PAN-EUROPEAN
CONFERENCE ON FOOD SAFETY AND QUALITY, 1, 2002, Budapest. [Proceeding]. Roma: FAO/WHO, 2002.
15p. Disponível em:<ftp://ftp.fao.org/docrep/fao/meeting/004/y369e/y369e00.pdf>. Acesso em: 07 Fev. 2006.

FORTINA, M.G., et al. Genetic characterization of some lactic acid bacteria occurring in an artisanal protected
denomination origin (PDO) Italian cheese, the Toma piemontese. Food Microbiology, v. 20, p. 397-404, 2003.

FOX, P.F. Cheese: an overview. London: Chapman e Hall,1993, p. 1-36.

FOX, P. F.; GUINEE, T. P.; COGAN, T. M.; et al. Fundamentals of cheese science. Massachusetts: Kluwer Academic,
2000 . 587p.

FRANCIS, C.L.; STARNBACH, M.N.; FALKOW, S. Morphological and cytoskeletal changes in epithelial cells occur
immediately upon interaction with Salmonella typhimurium grow under low-oxygen conditions. Mol. Microbiol., v. 6,
p. 3077-3087, 1992.

FREDENUCCI, I.; CHOMARAT, M.; BOUCAUD, C.; et al. Saccharomyces boulardii fungemia in a patient receiving
Ultra-levure therapy. Clin. Infect. Dis., v. 27, p. 222-223, 1998.

FREILER, J.; DURNING, S.; ENDER, P. Clostridium difficile small bowel enteritis occurring after total colectomy.
Clin. Infect. Dis., v. 33, p. 1429-1431, 2001.

FREITAS, E. I. Detecção de genes de enterotoxinas de Staphylococcus sp. isolados de queijo Minas Frescal. 2005.
106f. Dissertação (Mestrado em Vigilância Sanitária). Instituto Nacional de Controle de Qualidade em Saúde, Fundação
Oswaldo Cruz, Rio de Janeiro.

FRETER, R. Experimental enteric Shigella and Vibrio infections in mice and guinea pigs. J. Exp. Med., v. 104, p.104-8,
1956.

FRETER, R. Mechanisms of association of bacteria with mucosal surface. Ciba Found. Symp., v. 80, p.
36-55, 1981.

FRIEDRICH, M. A bit of culture for children: probiotics may improve health and fight disease. The Journal of the
American Medical Association,v. 284, nº.11 p.1365-1370, 2000.

FROTHINGHAM, R.; DUNCAN, A.J.; WILSON, K.H. Ribosomal DNA sequences of bifidobacteria: implications for
sequence-based identification of the human colonic flora. Microbiol. Ecology Helath Dis., v. 6, p. 23-27, 1993.

FUJISAWA, T.; BENNO, Y.; YAESHIMA, T.; MITSUOKA, T. Taxonomic study of the Lactobacillus acidophilus group
with recognition of Lactobacillus gallinarum sp. nov. and Lactobacillus johnsonii sp. nov. and synonymy of
Lactobacillus acidophilus group A3 (Johnson et al., 1980) with the type strain of Lactobacillus amylovorus (Nakamura,
1981). Int. Journal Syst. Bacteriol., v. 42, p. 487-491, 1992.

FUKUSHIMA, M.; NAKANO, M. Effects of a mixture of organisms, Lactobacillus acidophilus or Streptococcus


faecalis on cholesterol metabolism in rats fed on a fat- and cholesterol-enriched diet. Br. J. Nutr., v. 76, p. 857-867,
1996.

FULLER, R. A review: Probiotics in man and animals. J. Appl. Bacteriol., v.66, nº. 5, p.365-378, 1989.

FULLER, R. Probiotics: The Scientific Basis. New York: Chapman & Hall, 1992. cap.1, p.1-8. .

FULLER, R. Probiotic foods. Current use and future developments. International Food Ingredients, nº. 3, p. 23-
26, 1993.

FUNDAÇÃO DE AMPARO À PESQUISA DE MINAS GERAIS (FAPEMIG) .Tecnologia garante qualidade sem
alterar sabor. Revista Minas faz Ciência, nº. 2, mar./mai. 2000. www.revista.fapemig.br/2/index.html. Acesso em 27 de
nov. 2002.

FURTADO, M. M.; SOUZA, H. M. de; MUNK, A. V. Fabricação do queijo Minas Frescal sem o emprego de culturas
láticas. Revista do Instituto de Laticínios Cândido Tostes, v. 35, n. 207, p. 15-21. jan./ fev. 1980a.

FURTADO, M. M.; WOLFSCHOON-POMBO, A. F.; MUNK, A. V; SOUZA, H. M. de. Estudo conclusivo a respeito
do queijo Minas Frescal por diferentes processos. Revista do Instituto de Laticínios Cândido Tostes,v. 35, nº. 208, p. 13-
16. mar./ abr. 1980b.

FURTADO, M. M. A arte e a ciência do queijo. São Paulo: Globo, 1991. 297p. (Publicação Globo Rural).

FURTADO, M. M.; LOURENÇO NETO, J. P. M. Queijo Minas Frescal. In: Tecnologia de Queijos. 1ª ed. p. 73-75,
1994. Apud: CAMPOS, A. C. Efeito do uso combinado de ácido lático com diferentes proporções de fermento lático
mesofílico no rendimento, proteólise, qualidade microbiológica e propriedades mecânicas do queijo Minas Frescal.
Campinas, 2000. 80f. Dissertação (Mestrado em Tecnologia de Alimentos). Faculdade de Engenharia de Alimentos,
Universidade Estadual de Campinas, Campinas.

FURTADO, M.M. Isolamento de bactérias lácticas de leite cru e soro de queijo de leite cru da região do Serro, Minas
Gerais. 1990. 94f Dissertação (Mestrado em Fdfddsg). Nome da escola: Universidade Federal de Viçosa, Viçosa.

GABUTTI, A. H.; DONNO, A. de; BAGORDO, F.; MONTAGNA, M. T. Comparative survival of faecal and human
contaminants and use of Staphylococcus aureus as um effective indicator of human pollution. Marine Pollution Bulletin,
v. 40, n. 8, p. 697-700, 2000.

GAHAN, C. G. M.; HILL, C. A review: Gastrointestinal phase of Listeria monocytogenes infection. Journal of Applied
Microbiology, Oxford, v.98, n. 6, p. 1345-1353, June, 2005.

GÄNZLE, M.G. Useful properties of Lactobacilli for application as protective cultures in food. University of
Hohenheim, Germany, 160p., 1998 (Tese PhD).

GARCIA-CRUZ, C.H. et al. Estudo microbiológico de queijo tipo Minas-Frescal de produção artesanal, comercializado
na cidade de São José do Rio Preto, SP, Brasil. Revista do Instituto Adolfo Lutz, v. 54, n. 2, p. 78-82, 1994.

GARCIA-LECHUZ, J.; HERNANGOMEZ, S.; JUAN, R. Extra-intestinal infections caused by Clostridium difficile.
Clin. Microbiol. Infect., v. 7, p. 453-457, 2001.

GARRIDO, N. S.; MORAIS, J. M. T.; BRIGANTI, R. C.; OLIVEIRA, M. A.; BERGAMINI, A. M. M.; OLIVEIRA, S.
A. V.; FÁVORO, R. M. D. Avaliação da qualidade físico-química e microbiológica do leite pasteurizado proveniente de
mini e micro-usinas de beneficiamento da região de Ribeirão Preto – SP. Revista do Instituto Adolfo Lutz, São Paulo, v.
60, n. 2, p. 141-146, jul./dez., 2001.

GARTHRIGHT, W. E. Most Probable Number from serial dilutions. In: UNITED STATES. Food and Drug
Administration Bacteriological Analytical Manual., 8a ed., 1998. Appendix 2 (tabela 1 – 3 tubes each). Disponível em:
http://www.cfsan.fda.gov/~ebam/bam-a2.html. Acesso em: 05 set. 2001

GARVIE, E.L.; COLE, C.B.; FULLER, R.; HEWITT, D. The effect of yoghurt on some components of the gut
microflora and on the metabolism of lactose in the rat. J. Appl. Bacteriol., v. 56, p. 237-245, 1984.

GASANOV, U.; HUGHES, D.; HANSHRO, P. M. Methods for the isolation and identification of Listeria spp. and
Listeria monocytogenes: a review. Federation of European Microbiological Societies, Amsterdam, v. 29, n. 11, p. 851-
875, Nov., 2005.

GASSER, F. Eletrophoretic characterization of lactc dehydrogenases in the genus Lactobacillus. Journal of General
Microbiology, London, v. 62, p. 223-239, 1970.

GATTI M .; GIRAFFA, G.; NEVIANI, E. Identificazione e caratterizzazione dei batteri lattici mediante PCR e dosaggio
delle proteine di superficie. Latte, v. 26, n. 8, p. 46-51, 2001

GATTO, V.T.; RIZZOTTI, L.; TORRIANI, S. Genetic diversity of lactic acid bacteria strains from Ragusano cheese as
evaluated by RAPD-PCR. Industria del Latte, v. 38, n.1-2, p. 65-79, 2002.

GARRITY, G. M.; BELL, J. A.; LILBURN, T. G. Taxonomic outline of the prokaryotes. Bergey´s Manual of
Systematic Bacteriology. 2nd ed., 2004.

GAULIN, C.; RAMSAY, D.; RINGUETTE, L.; ISMAIL, J. First documented outbreak of Listeria monocytogenes in
Quebec, 2002. Canada Communicable Disease Report, Quebec, v. 29, n. 21, Nov., 2003. Disponível em: <hc-
sc.gc.ca/pphb-dgspsp/publicat/ccdr-/03vol29/dr2921ea.html>. Acesso em: 01 Mar. 2006.

GAVINI, F.; POURCHER, A.-M.; NEUT, C.; MONGET, D.; ROMOND, C.; OGER, C.; IZARD, D. Phenotypic
differentiation of bifidobacteria of human and animal origin. Int. J. Syst. Bacteriol., v. 41, p. 548-557, 1991.
GEDEK, B.R. Adherence of Escherichia coli serogroup O 157 and the Salmonella typhimurium mutant DT 104 to the
surface of Saccharomyces boulardii. Mycoses, v. 42, p. 261-264, 1999.

GERASI, E. et al. Microbiological study of Manura, a hard cheese made from raw ovine milk in the Greek island
Sifnos. International Journal of Dairy Technology, v. 56, n. 2, p. 117-122, 2003.

GIANELLA, R.A.; FORMAL, S.B.; DAMMIN, G.J.; COLLINS, H. Pathogenesis of salmonellosis. Studies of fluid
secretion, mucosal invasion and morphologic reaction in the rabbit ileum. J. Clin. Invest., v. 52, p. 441-453, 1973.

GIANFRANCESCHI, M.; GATTUSO, A.; TARTARO, S.; AURELI, P. Incidence of Listeria monocytogenes in food
and environmental samples in Italy between 1990 and 1999: serotype distribution in food, environmental and clinical
samples. European Journal Epidemiology, Amsterdam, v. 18, n. 10, p. 1001-1006, Oct.2003.

GIBSON, G.R. Dietary modulation of the human gut microflora using prebiotics. Br. J. Nutr., v. 80, p. 209S-212S,
1998.

GIBSON, G.R. & ROBERFROID, M.B., 1995. Dietary modulation of the human colonic microbiota: Introducing the
concept of prebiotics. J.Nutr. 125:1401-1412.

GIBSON, G.R.; WILLIANS, C.M. Gut fermentation and health advantagens: myth or reality? British J. Nutr., v.81,
p.83-84, 1999.

GIESI, J. H. Sanitation: The key to food safety and public health. Food Tecnology, Chicago, v. 45, n. 12, 74-80, 1991.

GILLILAND, S.E.; NELSON, C.R.; MAXWELL, C. Assimilation of cholesterol by Lactobacillus acidophillus. Appl.
Environ. Microbiol., v. 49, p. 377-381, 1985.

GILLILAND, S.E. Acidophilus milk products: a review of potential benefits to consumers. J. Dairy Sci., v.72, p.2483-
2494, 1989.

GILLILAND, S.E. Beneficial interrelationships between certain microorganisms and humans: candidate
microorganisms for use as dietary adjuncts. J. Food Prot., v. 42, n. 2, p. 164-167, 1978.

GILLILAND, S.E. Health and nutritional benefits from lactic acid bacteria. FEMS Microbiology Reviews, v. 87, p.
175-188, 1990.

GILLILAND, S.E.; SPECK, M.L. Enumeration and identity of lactobacilli in dairy products. J. Food Prot., v. 40, n. 11,
p. 760-762, 1977a.

GILLINGS,M. & HOLLEY,M. -Repetitive element PCR fingerprinting (rep-PCR) using enterobacterial repetitive
intergenic consensus (ERIC) primers is not necessarily directed at ERIC elements. Lett. Appl. Microbiol., 25: 17-21,
1997.

GIRAFFA, G.; VECCHI, P. De.; ROSSI, P.; NICASTRO, G.; FORTINA, M.G. Genotypic heterogeneity among
Lactobacillus helveticus strains isolated from natural cheese strarters. Journal of Applied Microbiology, v. 85, p. 411-
416,1998.

GIRAUD, E.; LELONG, B.; RAIMBAULT, M. Appl. Microbiol. Biotechnol. v. 36, p. 96-99, 1991.

GIRARD, P.; PANSART, Y.; LORENTE, I.; GILLARDIN, J.M. Dose-response relationship and mechanism of action of
Saccharomyces boulardii in castor oil-induced diarrhea in rats. Dig. Dis. Sci., v. 48, p. 770-774, 2003.

GHODDUSI, H.B.; ROBINSON, R.K. Enumeration of starter cultures in fermented milks. Journal of Dairy Research,
v. 63, p. 151-158, 1996.

GODERSKA, K.; CZARNECKA, M.; CZARNECKI, Z. Survival rate of chosen Lactobacillus bacteria type in media of
different pH. Electronic Journal of Polish Agricultural Universities, Food Science and Technology, v. 5, Issue 1, 2002.
Disponível em: http://www.ejpau.media.pl. Acesso em: 25 de novembro de 2001.

GOLDIN, B.R.; GORBACH, S.L. Probiotics for humans. In: Probiotics, the Scientific Basis, ed. R. FULLER.
Chapman & Hall, London, pp. 355-376, 1992.
GOLDIN, R.B.; GORBACH, S.L.; SAXELIN, M.; BARAKAT, S.; GUALTIERI, L.; SALMINEN, S. Survival of
Lactobacillus species (strain GG) in human gastrointestinal tract. Digestive Diseases and Science., v. 37, n. 1, p. 121-
128, 1992.

GOLDIN, B.R. Health benefits of probiotics. Br. J. Nutr., v. 80, p. S203-S207, 1998.

GOMBAS, D. E.; CHEN, Y.; CLAVERO, R. S.; SCOTT, V. N. Survey of Listeria


monocytogenes in ready-t-eat foods. Journal of Food Protection, Des Moines, 55, n. 4, p. 559-569, Apr., 2003.

GOMES, H. A.; GALLO, G. R. Ocorrência de Staphylococcus aureus e produção de enterotoxinas por linhagens
isoladas a partir de leite cru, leite pasteurizado tipo C e queijo minas frescal comercializados em Piracicaba - SP.
Ciência e Tecnologia de Alimentos, Campinas, v. 15, n. 2, p. 158-161, jul./dez., 1995.

GOMES, A.M.P.; MALCATA, F.X. Development of probiotic cheese manufactured from goat milk: response surface
analysis via technological manipulation. J. Dairy Sci., v. 81, p. 1492-1507, 1998d.

GOMES, A.M.P.; MALCATA, F.X.; KLAVER, F.A.M. Growth enhancement of Bifidobacterium lactis Bo and
Lactobacillus acidophilus Ki by milk hydrolyzates. Journal of Dairy Science, v. 81, p. 2817-2825, 1998a.

GOMES, A.M.P.; TEIXEIRA, M.G.; MARCATA, F.X. Viability of Bifidobacterium lactis and Lactobacillus acidophilus
in milk: sodium chloride concentration and storage temperature. Journal of Food Processing and Preservation, v. 22, p.
221-240, 1998b.

GOMES, A.M.P.; MALCATA, F.X. Use of small ruminants’ milks supplemented with available nitrogen as growth
media for Bifidobacterium lactis and Lactobacillus acidophilus. Journal of Applied Microbiology, v. 85, p. 839-948,
1998c.

GOMES, A.M.P.; MALCATA, F.X. Bifidobacterium spp. and Lactobacillus acidophilus: biological, biochemical,
technological and therapeutical properties relevant for use as probiotics. Trens in Food Science & Technology, v. 10, p.
139-157, 1999.

GONZALEZ-MARTINEZ, B.E.; GOMEZ-TREVINO, M. Probiotics. Revista Salud Publica y Nutricion, v. 2, n. 3, 35


p., 2001.

GOODFELOW, M. & MINNIKIN, D.E. Chemical methods in bacterial systematics. London: Academic Press, 401p.
1985.

GOO, V. Y. L.; CHING, G. Q. L.; GOOCH, J. M. Comparison of Brilliant Green Agar and Hektoen Enteric Agar media
in the isolation of Salmonellae from food products. Applied Microbiology, Washington, v. 26, n. 3, p.288-292, sept.,
1973.

GORBACH, S.L.; GOLDIN, B.R. The intestinal microflora and the colon cancer connection. Rev. Infect. Dis., v. 12
(supl. 12), p. S252-S261, 1990.

GORDON, H.A.; PESTI, L. The gnotobiotic animal as tool in the study of host microbial relationships. Bacteriol. Rev.,
v. 35, p. 390-429, 1971.

GORDON, H.A. & PESTI, L. The gnotobiotic animal as a tool in the estudy of host ralationships. Bacteriological
Reviews, 35:390-429, 1971.

GOULET, V.; JAQUET, C.; VAILLANT, V.; REBIÉRE, I.; MOURET, E.; LORENTE, C.; MAILLOT, E.; STAINER, F.
ROCOURT, J. Listeriosis from consumpition of raw-milk cheese. The Lancet, London, v. 345, n. 8964, p. 1581-1582,
June, 1995.

GRANGETTE, C.; MULLER-ALOUF, H.; GOUDERCOURT, D.; GEOFFROY, M.C.; TURNEER, M.; MERCENIER,
A. Mucosal immune responses and protection against tetanus toxin after intranasal immunization with recombinant
Lactobacillus plantarum. Infect. Immun., v. 69, p. 1547-1553, 2001.

GRANUM, P.E. Clostridium perfringens toxins involved in food poisoning. Int. J. Food Microbiol., v. 10, p. 101-112,
1990.

GRAVANI, R. Incidence and control of Listeria monocytogenes in food-processing facilities. In: RYSER, E.; MARTH,
E.H. (Eds.). Listeria, listeriosis and food safety. 2nd. ed. New York: Marcel Dekker. 1999. Chap. 17, p. 657-709.
GRAVES, L. M.; HUNTER, S. B.; ONG, A. R.; SHOONMAKER-BOPP, D.; HISE, K.; KORNSTEIN, L.; DEWITT,
W. E.; HAYES, P. S.; DUNNE, E.; MEAD, P.; SWAMINATHAN, B. Microbiological aspects of the investigation that
traced the 1998 outbreak of listeriosis in the United States to contaminated hot dogs and establishment of molecular
subtyping-based surveillance for Listeria monocytogenes in the PulsedNet Network. Journal of Clinical Microbiology,
Washington, v. 43, n. 5, p. 2350-2355, May, 2005.

GRAVES, L. M.; SWAMINATHAN, B.; HUNTER, S. B. Subtyping Listeria monocytogenes. In: RYSER, E.; MARTH,
E.H. (Ed.) Listeria, listeriosis and food safety. 2nd. ed. New York: Marcel Dekker. 1999. Chap. 9, p. 279-298.

GREEN M. L.; SCOTT, K. J.; ANDERSON, M.; GRIFFIN, M. C. A.; GLOVER, F. A. Chemical characterization of
milk concentrated by ultrafiltration. Journal of Dairy Research, London, v. 51, n. 2, p. 267-278, may 1984.

GRENOV, B. In: SHAH, N.P. Isolation and enumeration of bifidobactérias in fermented milk products: a review.
Michwissenschaft, v.52, p.72-76, 1997.

GRIMONT, F.; GRIMONT, P.D.A. Ribosomal ribonucleic acid gene restriction as potential taxonomic tools. Ann. Inst.
Pasteur Microbiol., v. 137B, p. 165-175, 1986.

GRUNDMANN,H.; SCHNEIDER,C.; HARTUNG,D.; DASCHNER,F.D.; PITT,T.L. -Discriminatory power of three


DNA-based typing techniques for Pseudomonas aeruginosa. J. Clin. Microbiol., 33: 528-34, 1995.

GUEDES NETO, L.G. et al. Lactobacillus e a indústria de laticínios. Revista Leite e Derivados, n. 66 , p. 32-35, 2002.

GUARNER, F.; SCHAAFSMA, G.J. Probiotics. Int. J. Food Microbiol., v. 39, p. 237-238, 1998.

GUERRA, N.P.; CASTRO, L.P. Production of bacteriocin from Lactococcus lactis subsp. lactis CECT 539 and
Pediococcus acidilactici NRRL B-5627 using musselprocessing wastes. Biotechnol. Appl. Biochem., v.36, p.119-125,
2002.

GURR, M.I. Nutritional aspects of fermented milk products. FEMS Microbiol. Reviews, v. 46, p. 337-342, 1987.

GURTLER, V. & STANISICH, V.A. New approaches to typing and identification of bacteria using the 16S-23S rDNA
spacer region. Microbiology, v. 142, p. 3-16, 1996.

GUIMARÃES, R.C. Estrutura e função do RNA. In: COSTA, S.O.P. Genética Molecular e Microorganismos – Os
Fundamentos da Engenharia Genética, Cap. 3, São Paulo: Editora Manole Ltda, 1987.

GUERRA, M.M.M.; BERNARDO, F.M.A. Characterization of the inhibitors effects of L. monocytogenes Scott a
produced by ripening microflora of Alentejo’s traditional cheeses. Revista Portuguesa de Ciências Veterinárias. v. 96, n.
538, p. 65-69, 2001.

GUSLANDI, M.; MEZZI, G.; SORGHI, M.; TESTONI, P.A. Saccharomyces boulardii in maintenance treatment of
Crohn's disease. Dig. Dis. Sci., v. 45, p. 1462-1464, 2000.

GUSTAFERRO,C.A. & PERSING,D.H. -Chemiluminescent universal probe for bacterial ribotyping. J. Clin.
Microbiol., 30: 1039-41, 1992.

GUSTAFSSON, B.E. Germ-free rearing of rats, general techniques. Acta Pathol. Microbiol. Immunol. Scand., v. 111
(supl. LXX), 1948.

GUSTAFSSON, B.E. Vitamin K deficiency in germfree rats. Ann. N. Y. Acad. Sci., v. 78, p. 166-173, 1959.

GUSTAFSSON, B.E.; MIDTVEDT, T.; STRANDBERG, K. Effects of microbial contamination on the cecum
enlargement of germ-free rats. Scand. J. Gastroenterol., v. 5, p. 309-314, 1970.

GUSTAFSSON, B.E. The germ-free: it’s potential and its problems. In COATES, M.E. & GUSTAFSSON, B.E. (eds.).
The Germ-free Animal in Biomedical Research. London: Laboratory Animals Ltd., p. 1-10, 1984.

HAEGHEBAERT, S.; SULEM, T.; BERONDILLE, L.; VANNEROY-ADENOT, E.; BAGNIS, O.; BOUVET, P.;
GRIMONT, F.; BRISABOIS, A.; LE QUERREC, F.; HERVEY, C.; ESPIÉ, E.; VALK, H.; VAILLANT, V. Two
outbreaks of Salmonella Enteritidis phage type 8 linked to the consumption of Catal cheese made with raw milk,
France, 2001. European Communicable Disease Bulletin, France, v.8, n.7/8, p. 151-168, July/Aug., 2003.
HAGLER, L.C.M. & HAGLER, A.N. Taxonomia de microrganismos. In: ROITMAN, I.; TRAVASSOS, L.R.;
AZEVEDOI, J.L. Tratado de Microbiologia, São Paulo: Manole, v.2, p.106-122, 1991.

HALLEN, A.; JARSTRAND, C.; PAHLSON, C. Treatment of bacterial vaginosis with lactobacilli. Sex. Transm. Dis.,
v. 19, p. 146-148, 1992.

HAMILTON-MILLER, J.M.T.; SHAH, S.; SMITH, C.T. “Probiotic” remedies are not what they seem. Br. Med. J., v.
312, p.55-56, 1996.

HAMILTON-MILLER, J.M.; SHAH, S.; WINKLER, J. Public health issues arising from microbiological and labelling
quality of food and supplements containing probiotic microrganisms. Public Health Nutr., v. 2, p. 223-229, 1999.

HAMMES, W.P.; VOGEL, R.F. The genus Lactobacillus. The Lactic Acid Bacteria, v. 2, The Genera of Lactic Acid
Bacteria, WOOD, B.J.B.; HOLZAPFEL, W.H. (Eds.), pp. 19-54, Blackie Academic, London, 1995.

HAMMES, W.P.; VOGEL, R.F. The genera of acid lactic bacteria. London: Blackie Academic Professional, 54p., 1995.

HANSEN, L.T., ALLAN-WOJTAS, P.M., PAULSON, A.T. Tolerance od Bifidobacterium spp. as free cells or as
encapsulated in ca-alginate microspheres to simulated gastro-intestinal conditions. In: Conf. of the Internat. Commitee
on Food Microbiol. & Higiene. Chapter 12 Probiotcs, p.864-867, 1999.

HANSON, L.A.; YOLKEN, R.H. Probiotics, Other Nutritional Factors and Intestinal Microflora. Nestlé Nutrition
Workshop Series, v. 42, Lippincott-Raven, Philadelphia, 1999.

HARDING, F. Milk quality. Glasgow: Blackie Academic Professional, 166 p., 1995.

HART, C.A.; BATT, R.M.; SAUNDERS, J.R. Diarrhoea caused by Escherichia coli. Ann. Trop. Paediatr., v. 13, p. 121-
131, 1993.

HARTEMINK, R.; KOK, B.J.; WEENK, G.H.; ROMBOUTS, F.M. Raffinose-Bifidobacterium (RB) agar, a new
selective medium for bifidobacteria. J. Microbiol. Methods, v. 27, p. 33-43, 1996.

HARVEY, J.; GILMOUR, A. Staphylococcus aureus. In: ROBINSON, R.; BATT, C. A.; PATEL, P. D. (Ed.).
Encyclopedia of food microbiology. London: Academic Press, 2000. v. 3. p. 2066-2071.

HASTINGS, J.W.; HOLTZAPFEL, W.H. Numerical taxonomy of lactobacilli surviving radurization of meat.
International Journal of Food Microbiology, v.4, p. 33-49, 1987.

HATHEWAY, C.L. Toxigenic clostridia. Clin. Microbiol. Rev., v. 3, p. 68-98, 1990.

HAUSER, M.M.; SMITH, R.E. The characterization of lactobacilli from cheddar cheese. II. a numerical analysis of the
data by means of an electronic computer. Canadian Journal of Microbiology, v. 10, p. 757-762, 1964.

HAVENAAR, R.; BRINK, T.B.; HUIS IN’T VELD, J.H.J. Selection of strain for probiotic use. In: Probiotics: Scientific
Basis, ed. R. FULLER. London, Chapman and Hall, pp. 260-295, 1992.

HAYFORD, A.E.; PETERSEN, A.; VOGENSEN, F.K.; JAKOBSEN, M. Use of conserved randomly amplified
polymorphic DNA (RAPD) fragments for characterization of Lactobacillus fermentum in Ghanaian fermented maize
dough. Appl. Environ. Microbiol., v.65, p. 3213-3221, 1999.

HE, F.; MORITA, H.; OUWEHAND, A.C.; HOSODA, M.; HIRAMATSU, M.; KURISAKI, J.; ISOLAURI, E.;
BENNO, Y.; SALMINEN, S. Stimulation of the secretion of pro-inflammatory cytokines by Bifidobacterium strains.
Microbiol. Immunol., v. 46, p. 781-785, 2002.

HEADRICK, M. L.; KORANGY, S.; BEAN, N. H.; ANGULO, F. J.; ALTEKRUSE, S. F.; POTTER, M. E.; KLONTZ,
K. C. The epidemiology of raw milk-associated Foodborne disease outbreaks reported in the United States, 1973
through 1992. American Journal of Public Health, Washington, v. 88, n. 8, p. 1219-1221, Aug., 1998.

HEADRICK, M. L.; KORANGY, S.; BEAN, N. H.; ANGULO, F. J.; ALTEKRUSE, S. F.; POTTER, M. E.; KLONTZ,
K. C. The epidemiology of raw milk- associated foodborne disease outbreaks reported in the United States, 1973
through 1992. American Journal Public Health, Washington, v.88, n. 8, p. 1219-1221, Aug., 1998.
HEATLEY, R.V.; SOBALA, G.M. Acid suppression and the gastric flora. Baillère’s Clin. Gastroenterol. 7:167, 1993.

HEATON, K.W. Bile salts. Page 277, 1985. In Liver and Biliary Disease: Pathophysiology, Diagnosis, Management.
Wright, R.; Millward-Sadler, G.H.; Alberti, K.G.M.M.; Karran, S. Ed. Baillère Tindall, W. D. Saunders Co.,
Philadelphia, PA.

HÉBERTA, E.M. et al. Characterization of natural isolates of Lactobacillus strains to be used as starter cultures in dairy
fermentation International Journal of Food Microbiology v. 59, n. 1-2 , p. 19-27, 2000.

HEKMAT, S.; MCMAHON, D.J. Survival of Lactobacillus acidophilus and Bifidobacterium bifidum in ice cream for
use as a probiotic food. J. Dairy Sci., v. 75, p. 1415-1422, 1992.

HENNEQUIN, C.; KAUFFMANN-LACROIX, C.; JOBERT, A.; VIARD, J.P.; RICOUR, C.; JACQUEMIN, J.L.;
BERCHE, P. Possible role of catheters in Saccharomyces boulardii fungemia. Eur. J. Clin. Microbiol. Infect. Dis., v. 19,
p. 16-20, 2000.

HENNEQUIN, C.; THIERRY, A.; RICHARD, G.F.; LECOINTRE, G.; NGUYEN, H.V.; GAILLARDIN, C.; DUJON,
B. Microsatellite typing as a new tool for identification of Saccharomyces cerevisiae strains. J. Clin. Microbiol., v. 39,
p. 551-559, 2001.

HENSIEK, R.; KRUPP, G.; STACKEBRANDT, E. Development of diagnostic oligonucleotide probes for four
Lactobacillus species occurring in the intestinal tract. Systematic and Applied Microbiology, v. 15, p. 123-128, 1992.

HERVEY, C.; ESPIÉ, E.; VALK, H.; VAILLANT, V. Two outbreaks of Salmonella Enteritidis phage type 8 linked to the
consumption of Catal cheese made with raw milk, France, 2001. European Communicable Disease Bulletin, France, v.
8, n. 7/8, p. 151-168, July/Aug., 2003.

HESSELBARTH, J.; SCHWARZ, S. Comparative ribotyping of Staphylococcus intermedius from dog, pigeons, horses
and mink. Veterinary Microbiology, Utrecht, v. 45, n. 1, p. 11-17, Jan., 1995.

HILL, M.J. Factors controlling the microflora of the healthy upper gastrointestinal tract. In Human Microbial Ecology,
ed. HILL, M.J. & MARSH, P.D., cap. 2, p. 57-85, 1990. Boca Raton, Florida: CRC Press.

HILL, M.J. Intestinal flora and endogenous vitamin synthesis. Eur. J. Cancer Prev., v. 6, p. S43-S45, 1997.

HILTON, E.; ISENBERG, H.D.; ALPERSTEIN, P.; FRANCE, K.; BORENSTEIN, M.T. Ingestion of yogurt containing
Lactobacillus acidophilus as prophylaxis for candidal vaginitis. Ann. Intern. Med., v. 116, p. 353-357, 1992.

HILUY, D. J.; ARAÚJO, R. E. S. Avaliação da qualidade microbiológica de queijos de coalho comercializados em


Fortaleza – CE. Revista Higiene Alimentar, São Paulo, v. 13, n. 61, p. 28-36, maio/abril, 1999.

HIRANO, J.; YOSHIDA, T.; SUGIYAMA, T.; KOIDE, N.; MORI, I.; YOKOCHI, T. The effect of Lactobacillus
rhamnosus on enterohemorrhagic Escherichia coli infection of human intestinal cells in vitro. Microbiol. Immunol., v.
47, p. 405-409, 2003.

HIRAYAMA, K.; RAFTER, J. The role of probiotic bacteria in cancer prevention. Microbes Infect., v. 2, p. 681-686,
2000.

HIROOKA E. Y.; MULLER, E. E.; FREITAS, J. C.; VICENTE, E.; YOSHIMOTO, Y.; BERGDOLL, M. S.
Enterotoxigenicity Staphylococcus intermedius of canine origin. International Journal of Food Microbiology,
Amsterdam, v. 7, n. 1, p. 185-191, Jan., 1988.

HITCHINS, A.D. & MCDONOUGH, F.E. Prophylactic and therapeutic aspects of fermented milk. American Journal
of Clinical Nutrition, v.49, p.675-684, 1989.

HITCHINS, A. D.; FENG, P.; WATIKINS, W. D.; RIPPEY, S. R.; CHANDLER, L. A. Escherichia coli and Coliform
Bacteria In: UNITED STATES. Food and Drug Administration Bacteriological Analytical Manual., 8a ed., 1998. Cap.
4. Disponível em: http://www.cfsan.fda.gov/~ebam/bam-4.html. Acesso em: 05 set. 2001.

HOFFMANN, F. L.; DA SILVA, J. V.; VINTURIM, T. M. Qualidade microbiológica de queijos tipo “Minas Frescal”,
vendidos em feiras livres na região de São José do Rio Preto, SP. Higiene Alimentar, São Paulo, v. 16, n. 96, p.69-76,
maio, 2002.
HOHMANN, A.W.; SCHMIDT, G.; ROWLEY, D. Intestinal colonization and virulence of Salmonella in mice. Infect.
Immun., v. 22, p. 763-770, 1978.

HOIER, E. Use of probiotic starter cultures in dairy products. Food Australia, v. 44, p. 418-420, 1992 a.

HOLCOMB, J.E.; FRANK, J.F.; MCGREGOR, J.U. Viability of Lactobacillus acidophilus and Bifidobacterium
bifidum in soft serve frozen yogurt. Cult. Dairy Prod. J., v. 26, p. 4-5, 1991.

HOLDMAN, L.V.; CATO, E.P.; MOORE, W.E.C. Anaerobe Laboratory Manual. The Virginia Polytechnic Institute and
State. University Anaerobe Laboratory, 156p., 1977.

HOLECKOVÁ, B.; HOLODA, E.; FOTTA, V.; KALINÁCOVÁ, V.; GONDOL, J.; GROLMUS, J. Occurrence of
enterotoxigenic Staphylococcus aureus in food. Annuls of Agricultural and Environmental Medicine, Lublin, v. 9, n. 3,
p. 179182, Mar., 2002.

HOLECKOVÁ, B.; HOLODA, E.; FOTTA, V.; KALINÁCOVÁ, V.; GONDOL, J.; GROLMUS, J. Occurrence of
enterotoxigenic Staphylococcus aureus in food. Annuls of Agricultural and Environmental Medicine, Dublin, v. 9, n. 3,
p. 179182, Mar., 2002.

HOLECKOVÁ, B.; HOLODA, E.; FOTTA, V.; KALINÁCOVÁ, V.; GONDOL, J.; GROLMUS, J. Occurrence of
enterotoxigenic Staphylococcus aureus in food. Annuls of Agricultural and Environmental Medicine, Dublin, v. 9, n. 3,
p. 179182, Mar., 2002.

HOLLIS,R.J.; BRUCE,J.L.; FRITSCHEL,S.J.; PFALLER,M.A. -Comparative evaluation of an automated ribotyping


instrument versus pulsed-field gel electrophoresis for epidemiological investigation of clinical isolates of bacteria.
Diagn. Microbiol. Infect. Dis., 34: 263-8, 1999.

HOLT, J. G.; KRIEG, N. R.; SNEATH, P. H. A.; STALEY, J. T.; WILLIAMS, S. T. Bergey’s of Manual Determinative
Bacteriology. 9ª ed. Philadelphia: Lippincott Williams & Wilkins, 2000, 787p.

HOLT, J.G.; KRIEG, N.R.; SNEATH, P.H.A.; STALAEY, J.T.; WILLIANS, S.T. Gram positive cocci. In: Bergey’s
Manual of Determinative Bacteriology. HOLT, J.C.; KRIEG, N.R.; SNEATH, P.H.; STALEY, J.T.; WULLIAMS, S.T.
(Eds.)., 527p., 9th ed. Williams & Wilkins, Baltimore, 1994.

HOLTZAPFEL, W.H.; HABERER, P.; SNEL, J.; SCHILLINGER, U.; HUIS IN’T VELD, J.H.J. Overview of gut flora
and probiotics. Int J. Food Microbiol., v.41, p.85-101, 1998.

HOLTZAPFEL , W.H.; HABERER, P.; GEISEN, R.; BJORKROTH, J.; SCHILLINGER, U. Taxonomy and importante
features of probiotic microrganisms in food and nutrition. Am. J. Clin. Nutr., v. 73, n. 2 suppl., p. 365S-373S, Feb. 2001.

HOLTZAPFEL, W.H.; SCHILLINGER, U.; Du TOIT, M.; DICKS, L.M.T. Systematics of probiotic lactic acid bacteria
with reference to modern phenotypic and genomic methods. In: Proceedings of the Symposium Probiotics in Man and
Animal, Berlin, June 20-22, 1996. Deutsche Veterinärmedizinische Gesellschaft e.V., Berlin, p.11.

HOLZAPFEL, W.H.; HABERER, P.; SNEL, J.; SCHILLINGER, U.; HUIS IN'T VELD, J.H.J. Overview of gut flora
and probiotics. Int. J. Food Microbiol., v. 41, p. 85-101, 1998.

HOOD, S.K.; ZOTTOLA, E.A. Effect of low pH on the ability of Lactobacillus acidophilus to survive and adhere to
human intestinal cells. J. Food Sci., v. 53, p. 1514-1516, 1988.

HOOPER, L.V.; WONG, M.H.; THELIN, A.; HANSSON, L.; FALK, P.G.; GORDON, J.I. Molecular analysis of
commensal host-microbial relationships in the intestine. Science, v. 291, p. 881-884, 2001.

HOOVER, D.G. Bifidobacteria: activity and potential benefits. Food. Technol., v. 47, n. 6, p. 120-124, 1993.

HOPPU, U.; KALLIOMAKI, M.; LAIHO, K.; ISOLAURI, E. Breast milk - immunomodulatory signals against allergic
diseases. Allergy, v. 56, S23-S26, 2001.

HOSONO, A. Fermented Milk in the Orient’. In: Functions of Fermented Milk: Challenges for the Health Sciences, p.
61-78, Elsevier Science Publishers Ltd., Barking, 1992.

HOVE H, et al. Lactic acid bacteria and the human gastrointestinal tract. European Journal of Clinical Nutrition, n. 53,
p. 339-350, 1999.
HUGAS, M. Bacteriocinogenic lactic acid bacteria for the biopreservation of meat and meat products. Meat Sci., v.49,
p.1537-1542, 1998.

HUGHES, D.B.; HOOVER, D.G. Bifidobacteria: their potential for use in American dairy products. Food Technol.
v.45, n. 4, p.74-83, 1991.

HUIS IN’T VELD, J.H.J.; SHORTT, C. Selection criteria for probiotic microorganisms in gut flora and health-past,
present and future. In: The Royal Society of Medicine Press Ltd, International Consortium and Symposium Series. v.6,
p. 27-36, 1996.

HULL, R.R.; ROBERTS, A.V. Differential enumeration of Lactobacillus acidophilus in yoghurt. Aust. J. Dairy
Technol., v. 39, p. 160-163, 1984.

HUNGER, W. Aesculin-cellobiose agar for the isolation and counting of Lactobacillus acidophilus. Milchwissenschaft.,
v. 41, n. 5, p. 283-285, 1986.

HURST, A. Nisin and other inhibitory substances from lactic acid bacteria. In: BRANEN, A.L. & DAVDSON, P.M.
(Eds). Antimicrobial in Foods. Marcel-Deker, Inc., New York, 1983, p. 327-351.

HURST, A. Nisin. Advances in Apllied Microbiology, v. 7, p. 85-123, 1981.

HØVERSTAD, T. The normal microflora and short chain fatty acids, p. 89-108. In GRUBB, R.; MIDTVEDT, T.;
NORIN, E. (ed.), The Regulatory and Protective Role of the Normal Microflora. Macmillan Press, London, England,
1989.

IBRAHIM, S.A., BEZKOROVAINY, A. A survival of bifidobacteria in the presence of bile salt. J. Sci. Food Agricult.,
v.62, p.351-354, 1993.

IDE, L. P. A.; BENEDET, H. D. Contribuição ao conhecimento do queijo colonial produzido na região serrana do
estado de Santa Catarina, Brasil. Ciência Agrotecnica, Lavras, v. 25, n. 6, p. 1351-1358,nov./dez., 2001.

IGARASHI, M.; LIYAMA, Y.; KATO, R.; TOMITA, M.; ASAMI, N.; EZAWA, I. Effect of Bifidobacterium longum
and lactulose on the strenght of bone in ovariectomized osteoporosis model rats. Bifidus, v.7, p. 139-147, 1994.

IKEDA, T.; TOMATE, N.; YAMAGUCHI, K.; MAKINO, S. Mass outbreak of food poisoning disease caused by small
amounts of Staphylococal enterotoxins A and H. Applied and Environmental Microbiology, Washington, v. 71, n. 5, p.
27932795, May, 2005.

INTERNATIONAL COMMISSION ON MICROBIOLOGICAL SPECIFICATIONS FOR FOODS (ICMSF).


Staphylococcus aureus. In: ICMSF. (Ed). Microorganisms in food 5: characterization of microbial pathogens. New
York: Kluvers Academic, 1996. v. 5, Chap. 17, p. 299-333.

INTERNATIONAL COMMISSION ON MICROBIOLOGICAL SPECIFICATIONS FOR FOODS. Microorganisms in


foods. 1: their significance and methods of enumeration. 2.ed. Toronto:University of Toronto Press, 1988. 436 p. ISBN
08020-2293-6.

INTERNATIONAL COMMISSION ON MICROBIOLOGICAL SPECIFICATIOS FOR FOODS – ICMSF.


Microorganisms in food: Characteristics of microbial pathogens. London: Blackie Academic & Professional, 1998.
513p. v. 5.

INTERNATIONAL COMMISSION ON MICROBIOLOGICAL SPECIFICATIOS FOR FOODS – ICMSF.


Microorganisms in food: Microbiological ecology of food commodities. Gaithersburg: A Chapman & Hall Food
Science Book, An Aspen Publication, p.549-558, 2000. v. 6.

IDF/ISO/AOAC GROUP E-104, 1995. Detection and enumeration of Lactobacillus acidophilus. Bulletin of the IDF
306:23-33.

IDF/ISO/AOAC GROUP E-104, 1995. Detection and enumeration of Lactobacillus acidophilus. Bulletin of the
International Dairy Federation 306, Int. Dairy Federation, Brussels, Belgium, p. 23-33.

INTERNATIONAL DAIRY FEDERATION BULLETIN. Nº 179, Brussels, Belgium, 1984.


INTERNATIONAL DAIRY FEDERATION (IDF). Yogurt: enumeration of characteristic micro-organisms count
technique at 37ºC. Bulletin of the International Dairy Federation, n. 117, p. 1-4, 1983.

INTERNATIONAL DAIRY FEDERATION (IDF). Country reports world dairy situation. Bulletin of the International
Dairy Federation, n. 355, p. 48, 2000.

INTERNATIONAL DAIRY FEDERATION (IDF) The World Dairy Situation. Bulletin of the International Dairy
Federation, n. 378, p. 66, 2002.

IRETON, K.; COSSART, P. Host-pathogen interactions during entry and actinbased movement of Listeria
monocytogenes. Annual Reviews Genetic, v. 31, p. 113-138, 1997.

INSTITUTO PANAMERICANO DE PROTECCIÓN DE LOS ALIMENTOS Y ZOONOSIS (INPPAZ) /


ORGANIZACIÓN PANAMERICANA DE LA SALUD (OPS) / OGANIZACIÓN MUNDIAL DELA SALUDE
(OMS). Vigilancia Epidemiológica. Sistema de información regional para la vigilancia epidemiológica de las
enfermedades transmitidas por alimentos [SIRVETA]. Disponível em:
<http://www.panalimentos.org/sirveta/e/salida2.asp>. Acesso em: 14 Jul. 2006.

INSTITUTO PANAMERICANO DE PROTECCIÓN DE LOS ALIMENTOS Y ZOONOSIS (INPPAZ) /


OGANIZACIÓN PANAMERICANA DE LA SALUD (OPS) / OGANIZACIÓN MUNDIAL DELA SALUDE (OMS).
Vigilancia Epidemiológica. Sistema de información regional para la vigilancia epidemiológica de las enfermedades
transmitidas por alimentos [SIRVETA]. Disponível em: <http://www.panalimentos.org/sirveta/e/salida2.asp>. Acesso
em: 14 Jul. 2006.

ISHIBASHI, N.; SHIMAMURA, S. Bifidobacteria: research and development in Japan. Food Technology, v. 47, p. 126-
134, 1993.

ISHIBASHI, N.; YAMAZAKI, S. Probiotics and safety. Am. J. Nutr., v. 73, p. 465S-470S, 2001.

ISOLAURI, E.; ARVOLA, T.; SUTAS, Y.; MOILANEN, E.; SALMINEN, S. Probiotics in the management of atopic
eczema. Clin. Exp. Allergy, v. 30, p. 1604-1610, 2000.

ISOLAURI, E. Probiotics in the prevention and treatment of allergic disease. Pediatr. Allergy Immunol., v. 12, p. 56S-
59S, 2001.

ISOLAURI, E.; JUNTNEN, M.; RAUTANEN, T.; SILLANAUKEE, P.; KOIVULA, T. A human lactobacillus strain
(Lactobacillus casei sp. strain GG) promotes recovery from acute diarrhea in children. Pediatrics. v. 88, p. 90-97, 1991.

ISOLAURI, E.; SUTAS, Y.; KANKAANPAA, P.; ARVILOMMI, H.; SALMINEN, S. Probiotics: effects on immunity.
Am. J. Clin. Nutr., v. 73, p. 444S-450S, 2001.

ITO, M.; OHNO, T.; TANAKA, R. A specific DNA probe for identification of Bifidobacterium breve. Microbial Ecol.
Health Dis., v. 5, p. 185-192, 1992.

IWANA, H.; MASUDA, H.; FUJISAWA, H.; MITSUOKA, T. Isolation and identification of Bifidobacterium spp. in
commercial yogurts sold in Europe. Bifidobacteria Microflora, v. 12, p. 39-45, 1993.

IZADNIA, F.; WONG, C.T.; KOCOSHIS, S.A. Brewer’s yeast and Saccharomyces boulardii both attenuate Clostridium
difficile-induced colonic secretion in the rat. Dig. Dis. Sci., v. 43, p. 2055-2060, 1998.

JABLONSKI, L. M.; BOHACH, G. A. Staphylococcus aureus. In: DOYLE, M. P.; BEUCHAT, L. R.; MONTVILLE, T.
J. (Ed.). Food microbiology, fundamentals and frontiers. 2nd ed., Washington D. C.: ASM, 2001. Chap. 19, p. 411-434.

JABLONSKI, L. M.; BOHACH, G. A. Staphylococcus aureus. In: DOYLE, M. P.; BEUCHAT, L. R.; MONTVILLE, T.
J. (Ed.). Food microbiology, fundamentals and frontiers. 2nd ed., Washington D. C.: ASM, 2001. Chap. 19, p.411-434.

JABLONSKI, L. M. ; BOHACH, G. A. Staphylococcus aureus. In: DOYLE, M. P.; BEUCHAT, L. R.; MONTVILLE,
T. J. (Ed.). Food microbiology, fundamentals and frontiers. 2nd ed., Washington: ASM, 2001. Chap. 19, p. 411-434.

JACK, R.W; TAGG, J.R; RAY, B. Bacteriocins of Gram positive bacteria. Microbiological Reviews, v. 59, n. 2, p. 171-
200, 1995.

JACOBS, A.; BARNARD, K.; FISHEL, R.; GRADON, J.D. Extracolonic manifestations of Clostridium difficile
infections: Presentation of 2 cases and review of the literature. Medicine, v. 80, p. 88-101, 2001.

JACOBSEN, C.N., NIELSEN, V.R., HAYFORD, A.E., MOLLER, P.L., MICHAELSEN, K.F., PAERREGAARD, A.,
SANDSTRÖM, B., TVEDE, M., JAKOBSEN, M. Screening of probiotic activities of forty-seven strains of
Lactobacillus spp. by in vitro techniques and evaluation of the colonization ability of five selected strains in humans.
Applied and Enviromental Microbioogy. v.65, n.11, p. 4949-5956, nov. 1999.

JAHN, H.U.; ULLRICH, R.; SCHNEIDER, T.; LIEHR, R.M.; SCHIEFERDECKER, H.L.; HOLST, H.; ZEITZ, M.
Immunological and trophical effects of Saccharomyces boulardii on the small intestine in healthy human volunteers.
Digestion, v. 57, p. 95-104, 1996.

JAIN, A.K.; MURTY, M.N.; FLYNN, P.J. Data clustering: a review. ACM Computing Surveys. v.31, n. 3, p. 264-323,
1999.

JACQUET, C.; CATIMEL, B.; BROSCH, R.; BUCHRIESER, C.; DEHAUMONT, P.; GOULET, V.; LEPOUTRE, A.;
VEIT, P.; ROCOURT, J. Investigation related to the epidemic strain involved in the French listeriosis outbreak in 1992.
Applied and Environmental Microbiology, Washington, v. 61, n. 6, p. 2242-2246, June, 1995.

JACQUET, C.; SAINT-CLOMENT, C.; BROUILLE, F.; CATAMEL, B.; ROCOURT, J. La listériose humaine en
France en 1997. Données du Centre National de Référence des Listeria. Bulletin Epidémiologique Hebdomadaire, Paris,
n. 33, p. 142-143, Oct., 1998.

JARRAUD, S.; COZON, G; VANDERNESCH, F.; BES, M.; ETIENNE, J.; LINA, G.
Involvement of enterotoxin G and I in staphylococcal Toxic Shock Syndrome and staphylococcal scarlat fever. Journal
of Clinical Microbiology, Washington v. 37, n. 8, p. 2446-2449, Aug., 1999.

JARRAUD, S.; COZON, G; VANDERNESCH, F.; BES, M.; ETIENNE, J.; LINA, G.
Involvement of enterotoxin G and I in staphylococcal toxic shock syndrome and
staphylococcal scarlat fever. Journal of Clinical Microbiology, Washington v. 37, n. 8, p. 2446-2449, Aug., 1999.

JARRAUD, S.; PEYRAT, M. A.; LIM, A.; TRISTAN, A.; BES, M.; MOUGEL, C.; ETIENNE, J.; VANDENESCH, F.;
BONNEVILLE, M.; LINA, G. cgc, a highly prevalent operon of enterotoxin gene, forms a putative nursery of
superantigens in Staphylococcus aureus. Journal of Immunology, Bethesda, v. 166, n.1, p. 669677, Jan., 2001.

JARRAUD, S.; PEYRAT, M. A.; LIM, A.; TRISTAN, A.; BES, M.; MOUGEL, C.; ETIENNE, J.; VANDENESCH, F.;
BONNEVILLE, M.; LINA, G. cgc, a highly prevalent operon of enterotoxin gene, forms a putative nursery of
superantigens in Staphylococcus aureus. Journal of Immunology, Bethesda, v. 166, n. 1, p. 669677, Jan., 2001.

JARRAUD, S.; PEYRAT, M. A.; LIM, A.; TRISTAN, A.; BES, M.; MOUGEL, C.; ETIENNE, J.; VANDENESCH, F.;
BONNEVILLE, M.; LINA, G. cgc, a highly prevalent operon of enterotoxin gene, forms a putative nursery of
superantigens in Staphylococcus aureus. Journal of Immunology, Bethesda, v. 166, n.1, p. 669677, Jan., 2001.

JAY, J.M. Modern Food Microbiology. New York: International Thompson Publishing, 661 p., 1996.

JENSEN, A.; FREDERIKSEN, W.; GERNE-SMIDT, P. Risk factors for listeriosis in


Denmark, 1989-19990. Scandinavian Journal Infectious Diseases, Stockholm, v. 26, n. 3, p. 171-178, Oct., 1994.

JOHNSON, A.P. Susceptibility of Gram-positive bacteria from ICU patients in UK hospitals to antimicrobial agents.
Journal of Hospital Infection., v. 54, n. 3, p. 179-187, 2003.
JOHANSSON, M.; SANNI, A.; LÖNNER, C.; MOLIN, G. Phenotypically based taxonomy using API 50 CH of
lactobacilli from nigerian ogi, and the occurrence of starch fermenting strains. International journalod Food
Microbiology, v. 25, p. 159-168, 1995.

JOHANSSON, M.L.; MOLIN, G.; JEPPSSON, B.; NOBAEK, S.; AHRNE, S.; BENGRNRK, S.Administration of
different Lactobacillus strains in fermented oatmeal soup: in vivo colonisation ofhuman intestinal mucosa and effect on
the indigenous flora. Applied Environmental Microbiology. v. 59,p. 15-20, 1993.

JOHANSSON, M.L.; QUEDNAU, M.; MOLIN, G.; AHRNÉ, S. Randomly amplified polymorphic DNA (RAPD) for
rapid typing of Lactobacillus plantarum strains. Letters in Applied Microbiology, v. 21, p.155-159, 1995b.

JONES, B.D.; GHORI, N.; FALKOW, S. Salmonella typhimurium initiates murine infection by penetrating and
destroying the specialized epithelial M cells of the Peyer’s patches. J. Exp. Med., v. 180, p. 15-23, 1994.

JONES, C. L.; KHAN, S. A. Nucleotide sequence of the enterotoxin B gene from Staphylococcus aureus.
Journal of Bacteriology, Washington, v. 166, n. 1, p. 20-33, Apr., 1986

JONES, C. L.; KHAN, S. A. Nucleotide sequence of the enterotoxin B gene from Staphylococcus aureus. Journal of
Bacteriology, Washington, v. 166, n. 1, p. 20-33, Apr., 1986.

JONES, C.D. & THOMAS, C.N. The maintenance of strain specificity and bile tolerance whem producing stable
bacteria. In: LYONS. T.P. (Ed.). Biotechnology in the feed industry: prodedings of Allthech’s thirth annual symposium.
Nicholasvile: Allthech Techinical, p. 157-166, 1987.

JØRGENSEN, H. J.; MATHISEN, T.; LØVSETH, A.; OMOE, K.; QVALE, S.; LONCAREVIC, S. An outbreak of
staphylococcal food poisoning caused by enterotoxin H in mashed potato made with raw milk. FEMS Microbiology
Letters, Amsterdam, v. 252, n. 2, p. 267-272, Nov., 2005.

JØRGENSEN, H. J.; MATHISEN, T.; LØVSETH, A.; OMOE, K.; QVALE, S.; LONCAREVIC, S. An outbreak of
staphylococcal food poisoning caused by enterotoxin H in mashed potato made with raw milk. FEMS Microbiology
Letters, Amsterdam, v. 252, n. 2, p. 267-272, 2005.

KABIR, A.M.; AIBA, Y.; TAKAGI, A.; KAMIYA, S.; MIWA, T.; KOGA, Y. Prevention of Helicobacter pylori infection
by lactobacilli in a gnotobiotic murine model. Gut, v. 41, p. 49-55, 1997.

KABUKI, D. Y. Contagem de Listeria spp pelo método do Número Mais Provável (NMP), avaliação de sua ocorrência
em carnes de frango e eficiência de sanitizantes na redução da contaminação por Listeria monocytogenes. Campinas,
1997. 91p. Dissertação (Mestrado em Tecnologia de Alimentos) - Faculdade de Engenharia de Alimentos UNICAMP.

KABUKI, D. Y.; KUAYE, A. Y.; WIEDMANN, M.; BOOR, K. J. Molecular subtyping and tracking of Listeria
monocytogenes in latin-style fresch-cheese processing plants. Journal of Dairy Science, Lancaster, v. 87, n. 9, p. 2803-
2812, Sept. 2004.

KABUKI, D. Y.; KUAYE, A. Y.; WIEDMANN, M.; BOOR, K. J. Molecular subtyping and tracking of Listeria
monocytogenes in latin-style fresh-cheese processing plants. Journal of Dairy Science, Lancaster, v. 87, n. 9, p. 2803-
2812, Sept. 2004.

KABUKI, D. Y. Rastreamento de Listeria monocytogenes em indústrias processadoras de queijo frescal tipo Latino, nos
Estados Unidos da América, empregando a subtipagem molecular. 2005. 135p. Tese (Doutor em Tecnologia de
Alimentos) – Departamento de Tecnologia de Alimentos, Universidade Estadual de Campinas, Campinas, 2005.

KABUKI, D. Y. Rastreamento de Listeria monocytogenes em indústrias processadoras de queijo frescal tipo Latino, nos
Estados Unidos da América, empregando a subtipagem molecular. 2005. 135p. Tese (Doutor em Tecnologia de
Alimentos) – Departamento de Tecnologia de Alimentos, Universidade Estadual de Campinas, Campinas, 2005.

KAILA, M.; ISOLAURI, E.; SOPPI, E.; VRTANEN, E.; LAINE, S.; ARVILOMMI, H. Enhancement of the circulating
antibody secreting cell response in human diarrhea by human Lactobacillus strain. Pediat. Res., v. 32, p. 141-144, 1992.

KAILA, M.; ISOLAURI, E.; SAXELIN, M.; ARVILOMMI, H.; VESIKARI, T. Viable versus inactivated Lactobacillus
strain GG in acute rotavirus diarrhoea. Arch. Dis. Child., v. 72, p. 51-53, 1995.

KAILASAPATHY, K.; RYBKA, S. L. acidophilus and Bifidobacterium spp. their therapeutic potential and survival in
yoghurt. Australian J. Dairy Technol., v. 52, n. 1, p. 28-35, 1997.

KALLIOMAKI, M.; SALMINEN, S.; ARVILOMMI, H.; KERO, P.; KOSKINEN, P.; ISOLAURI, E. Probiotics in
primary prevention of atopic disease: a randomized placebo-controlled trial. Lancet, v. 7, p. 1076-1079, 2001.

KALLIOMAKI, M.; ISOLAURI, E. Role of intestinal flora in the development of allergy. Curr. Opin. Allergy Clin.
Immunol., v. 3, p. 15-20, 2003.

KALLIOMAKI, M.; SALMINEN, S.; POUSSA, T.; ARVILOMMI, H.; ISOLAURI, E. Probiotics and prevention of
atopic disease: 4-year follow-up of a randomized placebo-controlled trial. Lancet, v. 31, p.1869-1871, 2003.

KAMARAS, J.; MURRELL, W.G. The effect of bacterial enterotoxins implicated in SIDS on the rabbit intestine.
Pathology, v. 33, p. 187-196, 2001.
KANBE, M. Uses of intestinal lactic acid bacteria and health. In: Functions of Fermented Milk. eds. Y. NAKAZAWA;
A. HOSONO. Elsevier Applied Science, London, pp. 289-303, 1992.

KANDLER, O.; WEISS, N., 1986. Genus Lactobacillus Beijerinck 1901, 212AL , p. 1209-1234. In: SNEATH, P.H.A.,
MAIR, N.S., SHARPE, M.E. and HOLT, J.G. (eds), Bergey’s Manual of Systematic Bacteriology, vol.2. Baltimore:
Williams & Wilkins.

KANG, Y. J.; FRANK, F. J. Characteristics of biological aerosols in dairy processing plants. Journal of Dairy Science,
Lancaster, v. 73, n. 3, p. 621-626, Mar., 1989.

KAPER, J.B. Molecular pathogenesis of enteropathogenic Escherichia coli, Chapter 12. In MILLER,
V.L.; KAPER, J.B.; PORTNOY, D.A.; ISBERG, R.R. Molecular Genetics of Bacterial Pathogenesis, American Society
of Microbiology, p. 173-195, 1994.

KAUFMANN, P.; PFEFFERKORN, A.; TEUBER, M.; MEILE, L. Identification and


quantification of Bifidobacterium species isolated from food with genus-specific 16S rRNA-target probes by colony
hybridization and PCR. Applied and Environmental Microbiology, v 63, nº4, p.1268-1273, Apr. 1997.

KAUFMANN, S. H. E.; RAUPACH, B.; FINLAY, B. B. Introduction: microbiology and immunology: lessons learned
from Salmonella. Microbes and Infection. v. 3, n. 14 e 15, p. 1177-1181, nov.-dec., 2001.

KAUR, T.; GANGULY, N.K. Modulation of gut physiology through enteric toxins. Mol. Cell. Biochem., v. 253, p. 15-
19, 2003.

KELLS, J.; GILMOUR, A. Incidence of Listeria monocytogenes in two milk processing environments, and assessment
of Listeria monocytogenes blood ágar for isolation. International Journal of Food Microbiology, Amsterdam, v. 91, n. 2
p. 167-174, Mar., 2004

KHAMBATY, F. M.; BENNET, R.W.; SHAH, D. B. Application of pulse field gel electrophoresis to the
epidemiological characterization of Staphylococcus intermedius implicated in a food-related outbreak. Epidemiology
and Infection, London, v. 113, n. 1, p. 75-81, Jan., 1994.

KHAMBATY, F. M.; BENNET, R.W.; SHAH, D. B. Application of pulse field gel electrophoresis to the
epidemiological characterization of Staphylococcus intermedius implicated in a food-related outbreak. Epidemiology
and Infection, London, v. 113, n. 1, p. 75-81, Jan., 1994.

KIM, H.; FENG, P. Bottled water. . In: DOWNES, F.P.; ITO, H. (Ed) Compendium of methods for the microbiological
examination of foods. 4th ed. Washington: American Public Health Association, 2001. Chap. 60, p. 537-576.

KIM, H.S. Characterization of lactobacilli and bifidobacteria as applied to dietary adjuncts. Cult. Dairy Prod. J., v. 23,
p. 6-9, 1988.

KIM, H.S.; GILLILAND, S. Lactobacillus acidophilus as a dietary adjunct for milk to aid lactose digestion in humans.
J. Dairy Sci., v. 66, p. 959-966, 1983.

KIRJAVAINEN, P.V.; APOSTOLOU, E.; ARVOLA, T.; SALMINEN, S.J.; GIBSON, G.R.; ISOLAURI, E.
Characterizing the composition of intestinal microflora as a prospective treatment target in infant allergic disease.
FEMS Immunol. Med. Microbiol., v. 32, p. 1-7, 2001.

KIRJAVAINEN, P.V.; SALMINEN, S.J.; ISOLAURI, E. Probiotic bacteria in the management of atopic disease:
underscoring the importance of viability. J. Pediatr. Gastroenterol. Nutr., v. 36, p. 223-227, 2003.

KLAENHAMMER, T.; ALERMANN, E.; ARIGONI, F.; BOLOTIN, A.; BREIDT, F.; BROADBENT, J.; CANO, R.;
CHAILLOU, S.; DEUTSCHER, J.; GASSON, M.; GUCHTE, M.V. de.; GUZZO, J.; HARTKE, A.; HAWKINS, T.;
HOLS, P.; HUTKINS, R.; KLEEREBEZEM. M.; KOK, J.; KUIPERS, O.; LUBBERS, M.; MAGUIN, E.; MCKAY, L.;
MILLS, D.; NAUTA, A.; OVERBEEK, R.; PEL., H.; PRIDMORE, D.; SAIER, M.; SINDEREN, D.V.; SOROKIN, A.;
STEELE, J.; O’SULLIVAN, D.; VOS,
W. de.; WEIMER, B.; ZAGOREC, M.; SIEZEN, R. Discovering lactic acid bacteria by genomics. Antonie Van
Leeuwenhoek, v. 82, p. 29-58, 2002.

KLAENHAMMER T. et al. Proceedings of the Seventh Symposium on lactic acid bacteria: genetics, metabolism and
applications, v. 82, n. 1-4, p. 29-58, 2002.
KLAENHAMMER, T.R.; KULLEN, M.J. Selection and design of probiotics. Int.J.Food Microbiol. 50:45-57, 1999.

KLAENHAMMER, T.R.; KULLEN, M.J. Selection and design of probiotics. Int. J. Food Microbiol., v. 50, p. 45-57,
1999.

KLAENHAMMER, T.R.; KLEEMAN, E,C, Growth characteristics, bile sensitivity, and freeze damage in colonial
variants of Lactobacillus acidophilus. Appl. Environ. Microbiol., v. 41, n. 6, p. 1461-1467, 1981.

KLAVER, F.A.M.; KINGMA, F.; WEERKAMP, A.H. Growth and survival of bifidobacteria in milk. Netherland Milk
and Dairy Journal, v. 47, p. 151-164, 1993.

KLEEMAN, E.G. & KLAENHAMMER, T.R. Adherence of Lactobacillus species to human fetal intestinal cells. J.
Dairy Sci., v. 65, p. 2063-69, 1982.

KLEIN, G.; BONAPARTE, C.; REUTER, G. Lactobacillus. In: FRENEY, J.; RENAUD, F.; HANSEN, W.; BOLLET,
C. (Eds). Manual de Bactériologie Clinique. v. II, 2nd. Ed. Elsevier, Amsterdam, p. 885-898, 1994.

KLEIN, S.M.; ELMER, G.W.; MCFARLAND, L.V.; SURAWICZ, C.M.; LEVY, R.H. Recovery and elimination of the
biotherapeutic agent, Saccharomyces boulardii, in healthy human volunteers. Pharm. Res., v. 10, p. 1615-1619, 1993.

KLEIN, G.; PACK, A.; BONAPARTE, C.; REUTER, G. Taxonomy and physiology of probiotic lactic acid bacteria. Int.
Journal Food Microbiology, v. 41, p. 103125,
1998.

KLEPPE,K.; OHTSUKA,E.; KLEPPE,R.; MOLINEUX,I.; KHORANA,H.G. -Studies on polynucleotides. XCVI.


Repair replications of short synthetic DNA's as catalyzed by DNA polymerases. J. Mol. Biol., 56: 341-61, 1971.

KNEIFEL, W.; PACHER, B. An X-Glu based agar medium for the selective enumeration of Lactobacillus acidophilus
in yogurt-related milk products. Int. Dairy J., v. 3, p. 277-291, 1993.

KNORR, D. Technology aspects related to microorganisms in functional foods. Trends Food Sci. Technol., v. 9, n.8-9,
p. 295-306, 1998.

KOK, R.G.; WAAL, A. de; SCHUT, F.; WELLING, G.W.; WEENK, G.; HELLINGWERF, K.J. Specific detection and
analysis of a probiotic Bifidobacterium strain in infant feces. Appl. Environ. Microbiol., v. 62, p. 36683672, 1996.

KOLARS, J.C.; LEVITT, M.D.; MOSTAFA-AOUJI, D.A.G.; SAVAIANO, D.A. Yogurt – an autodigesting source of
lactose. New England J. Med., v.310, p.1, 1984.

KLOOS, W.E. Systematics and the natural history of staphylococci. Journal of Applied Bacteriology, v. 70, n. 3, p. 25-
37, 1990.

KOO, F.C.W.; PETERSON, J.W.; HOUSTON, C.W.; MOINA, N.C. Pathogenesis of experimental salmonellosis:
inhibition of protein synthesis by cytotoxin. Infect. Immun., v. 43, p. 93-100, 1984.

KOTLOFF, K.L.; WINICKOFF, J.P.; IVANOFF, B.; CLEMENS, J.D.; SWERDLOW, D.L.;

KOS, B.; SUSKOVIC, J.; GORETA, J.; MATOSIC, S. Effects of protectors on the viability of Lactobacillus
acidophilus M92 in simulated gastrointestinal conditions. Food Technology Biotechnol., v. 38, n. 2, p. 121-127, 2000.

KOSIKOWSKI, F. New cheese-making procedures utilizing ultrafiltration, Food Technology, Chicago, v. 40, n. 6, p.
71-77, jun. 1986.

KOZAK, J.; BALMER, T.; BYRNE, R.; FISHER, K. Prevalence of Listeria monocytogenes in foods: Incidence in dairy
products. Food Control, Oxford, v. 7, n. 4/5, p. 215-221, aug./out. 1996. Special issue.

KOZAK, J.; BALMER, T.; BYRNE, R.; FISHER, K. Prevalence of Listeria monocytogenes in foods: incidence in dairy
products. Food Control, Oxford, v. 7, n. 4/5, Apr./Mar., 1996

KOVACS, D.J.; BERK, T. Recurrent Clostridium difficile-associated diarrhea and colitis treated with Saccharomyces
cerevisiae (baker’s yeast) in combination with antibiotic therapy: a case report. J. Am. Board Farm. Pract., v. 13, p. 138-
140, 2000.
KUHN, M.; GOEBEL, W. Pathogenesis of Listeria monocytogenes. In: RYSER, E.; MARTH, E.H. (Ed.). Listeria,
listeriosis and food safety. 2nd. ed. New York: Marcel Dekker. 1999. Chap. 5, p. 97-130.

KURMANN, J.A. Starters for fermented milks: starters with selected intestinal bacteria. Bulletin on the Intestinal Dairy
Federation, v. 227, p. 41-55, 1998.

KURMANN, J.A.; RASIC, J.L.J. The health potential of products containing bifidobacteria. In: ROBINSON R.K. (ed).
Therapeutic Properties of Fermented Milk. London: Elsevier Applied Science, pp. 117-158, 1991.

KURODA, M.; OHTA, T.; UCHIYMA, I.; BABA, T.; YUZAWA, H.; KOBAYSHI, I.; CUI, L.; OGUCHI, A.; AOKI,
K.; NAGAI, Y.; LIAN, J.; ITO, T.; KANAMORI, M.; MATSUMARU, H.; MARUYAMA, A.; MURAKAMI, H.;
HOSOYAMA, A.; MIZUTANIUI, Y.; TAKAHASHI, N. K.; SAWANO, T.; INOUE, R.; KAITO, C.; SEKIMIZU, K;
HIRAKAWA, H; KUHARA, S.; GOTO, S.; YABUZAKI, J.; KANEHISA, M.; YAMASHITA, A.; OSHIMA, K.;
FURUYA, K.; YOSHINA, C.; SHIBA, T.; HATTORI, M.; OGASAWARA, N.; HAYSHI, H.; HIRAMATSU, K. Whole
genome sequencing of methicillin-resistant Staphylococcus aureus. The Lancet, London, v. 357, n. 9264, p. 1225-1240,
Apr.,2001.

KURTZMAN, C.P.; FELL, J.W. The Yeasts: a Taxonomic Study. 4 ed. Elsevier Science Publishers, Amsterdam, 1998.

LABAN, P.; FAVRE, C.; LARPENT, J.P. Lactobacilli isolated from French saucisson (taxonomic study). Zentralblatt
für Bakteriologie Parasitenkunde, Infektionskrankheiten und Hygiene, Abteilung 1: Originale, Reihe B, 166: 105111,
1978.

LACHICA. R.V.F.; WEISS, K.F.; LANCETTE, G.A. et al. Staphylococcus aureus. In: VANDERZANT, C.;
SPLITTSTOESSER, D.F. Compendium of Methods for the Microbiological Examination of Foods.
3.ed. Washington: APHA, 1992, p.533-547.

LAIHO, K.; OUWEHAND, A.; SALMINEN, S.; ISOLAURI, E. Inventing probiotic functional foods for patients with
allergic disease. Ann. Allergy Asthma Immunol., v. 89, p. 75-82, 2002.

LAMAITA, H. C.; CERQUEIRA, M. M. M. O. P.; CARMO, L. S.; SANTOS, D. A.; PENNA, C. F. A. M.; SOUZA, M.
R. Contagem de Staphylococcus sp. e detecção de enterotoxinas estafilocócicas e toxina da síndrome do choque tóxico
em amostras de leite cru refrigerado. Arquivos Brasileiros de Medicina Veterinária de Zootecnia, Belo Horizonte, v. 57,
n. 5, p. 702-709, maio, 2005.

LAMAITA, H. C.; CERQUEIRA, M. M. M. O. P.; CARMO, L. S.; SANTOS, D. A.; PENNA, C. F. A. M.; SOUZA, M.
R. Contagem de Staphylococcus sp. e detecção de enterotoxinas estafilocócicas e toxina da síndrome do choque tóxico
em amostras de leite crurefrigerado. Arquivos Brasileiros de Medicina Veterinária de Zootecnia, Belo Horizonte, v. 57,
n. 5, p. 702-709, maio, 2005.

LANGE, C.; BRITO, M. A. V. P.; ARCURI, E. F.; BRITO, J. R. F.; TAVARES, W.; CARVALHO, L. B.; MARICATO,
E. Identificação de Staphylococcus coagulasepositivos isolados de leite cru pela técnica de PCR. In: CONGRESSO
BRASILEIRO DE QUALIDADE DO LEITE, 1, 2004, Passo Fundo. Anais. Passo Fundo: Universidade Federal de
Passo Fundo, 2004. p. 1-4.

LANGE, C.; BRITO, M. A. V. P.; ARCURI, E. F.; BRITO, J. R. F.; TAVARES, W.;
CARVALHO, L. B.; MARICATO, E. Identificação de Staphylococcus coagulasepositivos isolados de leite cru pela
técnica de PCR. In: CONGRESSO BRASILEIRO DE QUALIDADE DO LEITE, 1, 2004, Passo Fundo. Anais. Passo
Fundo: Universidade Federal de Passo Fundo, 2004. p. 1-4.

LANCETTE, G.A.; TATINI, S.R. Staphylococcus aureus. In: VANDERZANT, C., SPLITTSTOESSER, D.F.
Compendium of Methods for the Microbiological Examination of Foods. 3.ed. Washington: APHA, 1992, p. 533-547.

LANGENDIJK, P.S.; SCHUT, F.; JANSEN, G.J.; RAANGS, G.C.; KAMPHUIS, G.R.; WILKINSON, M.H.F.;
WELLING, G.W. Quantitative fluorescence in situ hybridization of Bifidobacterium spp. with genus-specific 16S
rRNA-targeted probes and its application in fecal samples. Appl. Environ. Microbiol., v. 61, p. 3069-3075, 1995.

LANKAPUTHRA, E.E.V.; SHAH, N.P. A simple method for selective enumeration of Lactobacillus acidophilus in
yogurt supplemented with L. acidophilus and Bifidobacterium spp. Milchwissenschaft, v. 51, n. 8, p. 446-451, 1996.

LANKAPUTHRA, W.E.V.; SHAH, N.P. Investigation of factors affecting viability of Lactobacillus acidophilus and
bifidobacteria in yoghurt. In: 24th International Dairy Congress Proceedings, Melbourne, Australia, p. 292, 1994.
LANKAPUTHRA, W.E.V.; SHAH, N.P. Survival of Lactobacillus acidophilus and Bifidobacterium spp in the presence
of acid and bile salts. Cult. Dairy Prod. J., v. 30, n. 3, p. 2-7, 1995.

LANKAPUTHRA, W.E.V.; SHAH, N.P.; BRITZ, M.L. Evaluation of media for selective enumeration of Lactobacillus
acidophilus and Bifidobacterium spp. Food Australia, v. 48, n. 3, p. 113-118, March 1996.

LANKAPUTHRA, W.E.V.; SHAH, N.P.; BRITZ, M.L. Survival of bifidobacteria during refrigerated storage in the
presence of acid and hydrogen peroxide. Milchwissenschaft., v. 51, n. 2, p. 65-70, 1996b.

LANKAPUTHRA, W.E.V.; SHAH, N.P. Survival of Lactobacillus acidophilus and Bifidobacterium spp in the presence
of acid and bile salts. Cult. Dairy Prod. J., v.30, n. 3, p. 2-7, 1995.

LAPIERRE, L. Growth of Lactobacillus acidophilus isolated from fermented dairy products on different selective
media. Research paper, Nestlé, 1990.

LAROIA, S.; MARTIN, J.H. Effect of pH on survival of Bifidobacterium bifidum and Lactobacillus acidophilus in
frozen fermented dairy desserts. Cultured Dairy Products Journal. v. 26, p. 13-21, November, 1991a.

LAROIA, S.; MARTIN, J.H. Methods for enumerating and propagating bifidobacteria. Cult. Dairy Prod. Journal, v. 26,
n. 5, p. 32-33, 1991b.

LARSEN, A.G.; VOGENSEN, F.K.; JOSEPHEN, J. Antimicrobial activity of lactic acid bacteria isolated from sour
doughs: purification and characterization of bavaricin A a bacteriocin produced byLactobacillus bavaricus MI401. J.
Appl. Bacteriol. v.75, p.113-122, 1993.

LÁSARO, M.O.; FERREIRA, L.C.S. Vacinas contra diarréia. Biotecnologia, v. 14, p. 28-32, 2000.

LAUER, E.; KANDLER, O. DNA-DNA homology, murein types and enzyme patterns in the strains of the genus
Bifidobacterium. Syst. Appl. Microbiol., v.4,p. 42-64, 1983.

LE BORGEOIS, P.; LAUTIER, M.; RITZENTHALER, P. Chromosome mapping in lactic acid bacteria. FEMS
Microbiology Reviews, Amsterdam, v. 12, p. 109-124, 1993.

LECLERC. V.; DUFOUR, B.; LOMBARD, B.; GAUCHARD, F.; GARIN-BASTUJI, B.; SALVAT, G.; BRISABOIS,
A.; POUMEYROL, M.; DE BUYSER, M.L.; GNANOU-BESSE, N.; LAHELLEC, C. Pathogens in meat and milk
products: surveillance and impact on human health in France. Livestock Production Science, Paris, v. 76, n. 3, p. 195-
202, Sept., 2002.

LECLERC. V.; DUFOUR, B.; LOMBARD, B.; GAUCHARD, F.; GARIN-BASTUJI, B.; SALVAT, G.; BRISABOIS,
A.; POUMEYROL, M.; DE BUYSER, M.L.; GNANOU-BESSE, N.; LAHELLEC, C. Pathogens in meat and milk
products: surveillance and impact on human health in France. Livestock Production Science, Paris, v. 76, n. 2, p. 195-
202, 2002.

LE JEUNE, C.; LONVAUD-FUNEL, A. Lactobacillus hilgardii and Lactobacillus brevis DNA analysis by restriction
fragment length polymorphism (RFLP). Food Microbiology, v. 11 , p. 195-202, 1994.

LE, M.G.; MOULTON, L.H.; HILL, C.; KRAMMER, A. Consumption of dairy produce and alcohol in a case-control
stdy of breast cancer. J. Natl. Cancer Inst., v.77, p.633-636, 1986.

LEBLOND-BOURGET, N.; PHILIPPE, H.; MANGIN, I.; DECARIS, B. 16S rRNA and 16S to 23S internal transcribed
spacer sequence analyses reveal inter-and intraspecific Bifidobacterium phylogeny. Int. J. Syst. Bacteriol., v. 46, n. 1, p.
102111, 1996.

LEE, C.A. Pathogenicity islands and the evolution of bacterial pathogens. Infect. Agents Dis., v. 5, p.1-7, 1996.

LEE, S.Y.; VEDAMUTHU, E.R.; WASHAM, C.J.; REINBOLD, G.W. Na agar medium for the differential enumeration
of yogurt starter bacteria. J. Milk Food Technol. v.37, p.272, 1974.

LEE, Y.K.; SALMINEN, S. The coming of age of probiotics: review. Trends in Food Science & Technology, v. 6, p.
241-245, July 1995.

LEE, Y.K.; WONG, S-F. Stability of lactic acid bacteria in fermented milk. In: SALMINEN, S. VON WRIGHT, A. eds.
Lactic acid bacteria, microbiology and functional aspects. New York: Marcel Dekker Inc., 103-14, 1998.

LEFROCK, J.; ELLIS, C.; WEINSTEIN, L. The impact of hospitalization on the aerobic fecal flora. J. Med. Sci., v.
277, p. 269-274, 1979.

LEITÃO, M. F. F. Microbiologia de Alimentos. In: ROITMAN, I.; TRAVASSOS, L. R.; AZEVEDO, J. L (ed). Tratado
de Microbiologia. São Paulo: Manole, 1988, v.

LEITE JÚNIOR, A. F. S.; FLORENTINO, E. R.; OLIVEIRA, E. B. D. de; TORRANO, A. D. M. Qualidade


microbiológica do “queijo de coalho” comercializado à temperatura ambiente ou sob refrigeração, em Campina Grande
(PB), Revista Higiene Alimentar, São Paulo, v.14, n. 73, p. 53-59, jun.2000.

LEITE, C. C.; GUIMARÃES, A. G.; ASSIS, P. N.; ANDRADE, C. S. O. Qualidade bacteriológica do leite integral (tipo
C) comercializado em Salvador – Bahia. Revista Brasileira de Saúde e Produção Animal, Salvador, v. 3, n. 1, p. 21-25,
jan./mar., 2002.

LEITE, C. C.; GUIMARÃES, A. G.; RIBEIRO, N. S.; ASSIS, P. N. Pesquisa de Listeria monocytogenes e Escherichia
coli em queijo do tipo “coalho” comercializado em Salvador. Revista Analítica, Salvador, v. 2, n. 1, p. 38-41, nov.,
2002.

LEITE, M. M.; LIMA, M. G.; REIS, R. B. dos. Ocorrência de Staphylococcus aureus em queijo Minas tipo Frescal.
Revista Higiene Alimentar, São Paulo, v. 19, n. 122, p. 89-93, jun., 2005.

LEITE, M.O., et al. Isolamento e identificação de bactérias lácticas de soro de queijo da região do Serro, Minas Gerais.
Revista do Instituto de Laticínios Cândido Tostes, v. 52, n. 299, p. 3-11, 1997.

LEITE JÚNIOR, A.F.S. et al. Qualidade microbiológica do queijo de coalho comercializado a temperatura ambiente ou
sob refrigeração, em Campina Grande, PB. Higiene Alimentar, v. 14, n. 73, p. 53-59, 2000.

LEITE JÚNIOR, A. F. S.; FLORENTINO, E. R.; OLIVEIRA, E. B. D.; TORRANO, A. D. M. Qualidade


microbiológica do “queijo de coalho” comercializado a temperatura ambiente ou sob refrigeração, emCampina Grande -
PB. Revista Higiene Alimentar, São Paulo, v. 14, n. 73, p. 53-59, jun., 2000.

LEITE JÚNIOR, A. F. S.; FLORENTINO, E. R.; OLIVEIRA, E. B. D.; TORRANO, A. D. M. Qualidade


microbiológica do “queijo de coalho” comercializado a temperatura ambiente ou sob refrigeração, em Campina Grande
- PB. Revista Higiene Alimentar, São Paulo, v. 14, n. 73, p. 53-59, jun., 2000.

LE LOIR, Y.; BARON, F.; GAUTIER, M. Staphylococcus aureus and food poisoning. Genetics and Molecular
Research, Ribeirão Preto, v. 2, n. 1, p. 63-76, Jan., 2003.

LE LOIR, Y. L.; BARON, F.; GAUTIER, M. Staphylococcus aureus and food poisoning. Genetics and Molecular
Research, Ribeirão Preto, v. 2, n. 1, p. 63-76, jan., 2003.

LE LOIR, Y.; BARON, F.; GAUTIER, M. Staphylococcus aureus and food poisoning. Genetics and Molecular
Research, Ribeirão Preto, v. 2, n. 1, p. 63-76, jan., 2003.

LESTIN, F.; PERTSCHY, A.; RIMEK, D. Fungemia after oral treatment with Saccharomyces boulardii in a patient with
multiple co-morbidities. Dtsch. Med. W ochenschr., v. 128, p. 2531-2533, 2003.

LETERTRE, C.; PERELLE, S.; DILASSER, F.; FACH, P. Identification of a new putative enterotoxin SEU encoded by
the egc cluster of Staphylococcus aureus. Journal of Applied Microbiology, Belfast, v. 95, n. 1, p. 38-43, Jan., 2003

LETERTRE, C.; PERELLE, S.; DILASSER, F.; FACH, P. Identification of a new putative enterotoxin SEU encoded by
the egc cluster of Staphylococcus aureus. Journal of Applied Microbiology, Belfast, v. 95, n. 1, p. 38-43, Jan., 2003.

LETERTRE, C.; PERELLE, S.; DILASSER, F.; FACH, P. Identification of a new putative enterotoxin SEU encoded by
the egc cluster of Staphylococcus aureus. Journal of Applied Microbiology, Belfast, v. 95, n. 1, p. 38-43, Jan., 2003.

LEVINE, M.M. Escherichia coli that cause diarrhea: Enterotoxigenic, enteropathogenic, enteroinvasive,
enterohemorrhagic and enteroadherent. J. Infect. Dis., v. 155, p. 377-389, 1987.

LHERM, T.; MONET, C.; NOUGIERE, B.; SOULIER, M.; LARBI, D.; LE GALL, C.; CAEN, D.; MALBRUNOT, C.
Seven cases of fungemia with Saccharomyces boulardii in critically ill patients. Intensive Care Med., v. 28, p. 797-801,
2002.

LIDBECK, A.; NORD, C.E.; RAFTER, J.; NORD, C.; GUSTAFFSON, J.A. Effect of Lactobacillus acidophilus
supplements on mutagen excretion in faeces and urine in humans. Microbiol. Ecol. Health Dis., v. 5, p. 59-67, 1992.

LILLEY, D.M.; STILLWELL, R.H. Probiotics: growth promoting factors produced by microorganisms. Science, v. 147,
p. 747-748, 1965.

LILLY, D.M.; STILLWELL, R.H. Probiotics: growth-promoting factors produced by microoganisms. In: Science. v.
147, p. 747-748, 1965.

LIM, K.S.; HUH, C.S.; BAEK, Y.J.; KIM, H.U. A selective enumeration medium for bifidobacteria in fermented dairy
products. J. Dairy Sci., v. 78, p. 2108-2112, 1995.

LIMA, J.R. et al. Avaliação microscópica do queijo de coalho, queijo de manteiga e manteiga da terra produzidos nos
estados do Ceará e Rio Grande do Norte. Higiene Alimentar, v. 16, n. 99, p. 57-60, 2002.

LIMA, A. F. Staphylococcus coagulase positiva e enterotoxinas em queijo de coalho. 2005. 86p. Dissertação (Mestre
em Tecnologia de Alimentos) – Centro de Ciências Agrárias, Universidade Federal do Ceará, Fortaleza, 2005.

LIMA, A. F. Staphylococcus coagulase positiva e enterotoxinas em queijo de coalho. 2005. 86p. Dissertação (Mestre
em Tecnologia de Alimentos) – Centro de Ciências Agrárias, Universidade Federal do Ceará, Fortaleza, 2005.

LINDGREN, S.E.; DODROGOSZ, W.J. Antagonistic activities of lactic acid bacteria in food and feed fermentations.
FEMS Microbiol Rev., v. 87, p. 149-164, 1990.

LIN, M. Antioxidative ability of lactic acid bacteria. Journal of Agriculture Food Chemistry, v. 47, n. 4, p. 1460-1466,
1999.
LIN, S.Y.; AYRES, J.W.; WINKLER, W.; SANDINE, W.E. Lactobacillus effects on cholesterol: in vitro and in vivo
results. J. Dairy Res., v. 72, p. 2885-2899, 1989.

LING, W.H.; HANNINEN, O.; MYKKANEN, H.; SALMINEN, S.; VON WRIGHT, A. Colonization and fecal enzyme
activities after oral Lactobacillus GG administration in elderly nursing home residents. Ann. Nutr. Metab., v. 36, p. 162-
166, 1992.

LING, W.H.; KORPELA, R.; MYKKANEN, H.; SALMINEN, S.; HANNINEN, O. Lactobacillus strain GG
supplementation decreases colonic hydrolytic and reductive enzyme activities in healthy female adults. J. Nutr., v. 124,
p. 18-23, 1994.

LINNAN, M. J.; MASCOLA, L.; LOU, X. D.; GOULET, V.; MAY, S.; SALMINEN, C. ; HIRD, D. W.; YONEKURA,
M. I.; HAYES, P.; WEAVER, R.; AUDURIER, A.; PLIKAYTIS, B. D.; FANNIN, S. L.; KLEKS, A.; BROOME, C. V.
Epidemic listeriosis associated with mexican-style cheese. New England Journal Medicine, Boston, v. 319, n.13, p. 823-
828, Sept., 1988.

LINTON, R. H.; CARTER, W. H.; PIERSON, M. D.; HACKENEY, C. R.; EIFERT, J. D. Use of modified Gompertz
equation to predict the effects of temperature, pH and NaCl on the inativation of Listeria monocytogenes Scott A heated
in infant formula. Journal of Food Protection, Des Moines, v. 59, n. 1, p.16-23, Jan., 1996.

LIOYD, A.B.; CUMMING, R.B.; KENT, R.D. Prevention of Salmonella typhimurium infection in poultry by
pretreatment of chickens and poults with intestinal extracts. Australiam Veterinary Journal, v.53, p. 82-87, 1977.

LIU,P.Y. & WU,W.L. -Use of different PCR-based DNA fingerprinting techniques and pulsed-field gel electrophoresis
to investigate the epidemiology of Acinetobacter calcoaceticus-Acinetobacter baumannii complex. Diagn. Microbiol.
Infect. Dis., 29: 19-28, 1997.

LUCKEY, T.D. Germfree Life and Gnotobiology. New York: Academic Press, 1963.

LUI, A., SHU, Q., STEVENSON, B., GILL, H. Resistance to low pH, high bile and anti-pathogen properties of lactic
acid bacterial strain MP006. In: Conf. of the Internat. Commitee on Food Microbiol. & Higiene. Chapter 12 Probiotcs,
p. 838843, 1999.

LOGAM, N.A. Bacterial systematics. Blackwell Scientific Publications. 1994.


LOGUERCIO, A.P.; ALEIXO, J.A.G. Microbiologia de queijo tipo Minas Frescal produzido artesanalmente. Ciência
Rural, v. 31, n. 6, p. 1063-1067, 2001.

LOGUERCIO, A. P.; ALEIXO, J. A. G. Microbiologia de queijo Minas Frescal produzido artesanalmente. Ciência
Rural, [on line], v. 31, n. 6, p.1063-1067, 2001. Disponível na World Wide Web: <http://www.scielo.br>. ISSN 0103-
8478.

LOGUERCIO, A. P.; SILVA, W. P. da; ALEIXO, J. A. G.; COSTA, M. M. da; VARGAS, A. C. D. Listeria
monocytogenes: Um importante patógeno de origem alimentar. Revista Higiene Alimentar, São Paulo, v. 15, n. 80/81, p.
39-48, jan./fev. 2001.

LONCAREVIC, S.; JORGENSEN, H. J.; LOVSETH, A.; MATHISEN, T.; ROVIK, L. M. Diversity of Staphylococcus
aureus enterotoxin types within single samples of raw milk and raw milk products. Journal of Applied Microbiology,
Belfast, v. 98, n. 3, p. 344-350, Mar., 2005.

LONCAREVIC, S.; JORGENSEN, H. J.; LOVSETH, A.; MATHISEN, T.; ROVIK, L. M. Diversity of Staphylococcus
aureus enterotoxin types within single samples of raw milk and raw milk products. Journal of Applied Microbiology,
Belfast, v. 98, n. 3, p. 344-350, Mar., 2005.

LONCAREVIC, S.; JORGENSEN, H. J.; LOVSETH, A.; MATHISEN, T.; ROVIK, L. M. Diversity of Staphylococcus
aureus enterotoxin types within single samples of raw milk and raw milk products. Journal of Applied Microbiology,
Belfast, v. 98, n. 3, p. 344-350, Mar., 2005.

LÓPEZ-DIAZ, T.M. Lactic acid bacteria isolated from a hand-made blue cheese. Food microbiology, v. 17, p. 23-32,
2000.

LORTAL, S.; HEIJENOORT, J. VAN; GRUBER, K.; SLEYTR, U.B.; VAN-HEIJENOORT, J. S-layer of Lactobacillus
helveticus ATCC 12046: isolation, chemical characterization and re-formation after extraction with lithium chloride.
Journal of General Microbiology, London, v. 138, n. 3, p. 611-618, Mar. 1992.

LORTAL, S.; VALENCE, F.; BIZET, C.; MAUBOIS, J.L. Eletrophoretic pattern of peptidoglycan hydrolases, a new
tool for bacterial species identification. Research Microbiology, Paris, v. 148, n. 6, p. 461-474, July 1997.

LOU, Y.; YOUSEF, A. E. Characteristics of Listeria monocytogenes important to food processors. In: RYSER, E.;
MARTH, E.H. (Ed.). Listeria, listeriosis and food safety. 2nd ed. New York: Marcel Dekker. 1999. Chap. 6, p. 131-224.

LOURENÇO NETO, J. P. M. O uso de culturas láticas na fabricação de Minas Frescal como alternativa de melhoria de
qualidade. I Seminário Internacional de “Queijos Frescos”. Atibaia, p. 59-75, 1998.

LOVETT, J. L.; FRANCIS, D. W.; HUNT, J. M. Listeria monocytogenes in raw milk: detection, incidence and
pathogenicity. Journal of Food Protection, Ames, v. 50, n. 3, p. 188-192, mar., 1987.

LUNDÉN, J. M.; AUTIO, T. J.; KORKEALA, H. J. Human listeriosis outbreaks linked to dairy products in Europe.
Journal of Dairy Science, Lancaster, v. 87, n. E. Suppl., p. E6-11, July, 2004.

LUKASOVA, J; SUSTACKOVA, A. Enterococci and antibiotic resistance. Acta Veterinaria Brno., v.72, n.
2, p. 315-323, 2003.

LYYTIKÄINEN, O.; AUTIO, T.; MAIJALA, R.; RUUTU, P.; HONKANEN-BUZALSKI, T.; MIETTINEN, M.;
HATAKKA, M.; MIKKOLA, J.; ANTTILA, V. J.; JOHANSSON, T.; RANTALA, L.; AALTO, T.; KORKEALA, H.;
SIITONEN, A. An outbreak of Listeria monocytogenes serotype 3a from butter in Finland. The Journal Infectious
Diseases, Boston, v. 181, n. 5, p. 1838-1841, May, 2000.

MACDONALD, P. D. M.; WHITWAM, R. E.; BOGGS, J. D.; MACCORMACK, J. N.; ANDERSON, K. L.;
REARDON, J. W.; SAAH, J. R.; GRAVES, L. M.; HUNTER, S. B.; SOBEL, J. Outbreak listeriosis among mexican
immigrants as a result of consumption of illicitly produced Mexican-style cheese. Clinical Infectious Diseases, Chicago,
v. 40, n. 5, p. 677-682, Mar., 2005.

MACHADO, G. C.; CHAVES, J. B. P. Estratégias para implantação de um sistema de qualidade em indústria de


laticínios. Revista do Instituto de Laticínios Cândido Tostes, Juiz de Fora, v. 311, n. 54, p. 1-50, jan./mar., 1999.
MACHADO, G. C.; CHAVES, J. B. P. Estratégias para implantação de um sistema de qualidade em indústria de
laticínios. Revista do Instituto de Laticínios Cândido Tostes, Juiz de Fora, v. 311, n. 54, p. 1-50, jan./mar., 1999
MAC FADDIN, J.F. Biochemical tests for identification of medical bacteria. Baltimere: Willians e Wilkins, 2nd Ed., 527
p.,1980.

MACKAY, A.D.; TAYLOR, M.B.; KIBBLER, C.C.; HAMILTON-MILLER, J.M.T Lactobacillus endocarditis caused
by a probiotic organism. Clin. Microbiol. Infect., v. 5, p. 290-292, 1999.

MACKIE, R.; SGHIR, A.; GASKINS, H.R. Developmental microbial ecology of the neonatal gastrointestinal tract.
Am. J. Clin. Nutr., v.69, p. 1035S-1045S, 1999.

MACKIE, R.I.; SGHIR, A.; GASKINS, H.R. Developmental microbial ecology of the neonatal gastrointestinal tract.
Am. J. Clin. Nutr., v.69(suppl), p.1035S-1045S, 1999.

MAIA, O.B.; DUARTE, R.; SILVA, A.M.; CARA, D.C.; NICOLI, J.R. Evaluation of the components of a commercial
probiotic in gnotobiotic mice experimentally challenged with Salmonella enterica subsp. enterica ser. Typhimurium.
Vet. Microbiol., v. 79, p. 183-189, 2001.

MAIJALA, R.; LYYTIKÄINEN, O.; JOHANSSON, T.; AUTIO, T.; AALTO, T.; HAAVISTO, L.; HONKANEN-
BUZALSKI, T. Exposure of Listeria monocytogenes within na epidemic caused by butter in Finland. International
Journal of Food Microbiology, Amsterdam, v. 70, n. 1-2, p.97-109, oct., 2001.

MAKELA, P.H.; VOLTONEV, V.V.; VOLTONEM, M. The role of O antigen (lipopolysaccharide) factors in the
virulence of Salmonella. J. Infect. Dis., v. 128, p. 81-85, 1973.

MAKINO, S. I.; KAWAMOTO, K.; TAKESHI, K.; OKADA, Y.; YAMASAKI, M.; YAMAMOTO, S.; IGIMI, S. An
outbreak of food-borne listeriosis due to cheese in Japan, during 2001. International Journal of Food Microbiology,
Amsterdam, v. 104, n. 2 p. 189-196, Oct., 2005.

MALLIÉ, M.; NGUYEN VAN, P.; BERTOUT, S.; VAILLANT, C.; BASTIDE, J.-M. Genotypic study of
Saccharomyces boulardii compared to the Saccharomyces sensu stricto complex species. J. Mycol. Med., v. 11, p. 19-
25, 2001.

MAN, J.C.de; ROGOSA, M.; SHARPE, M.E. A medium for the cultivation of lactobacilli. Journal of Applied
Bacteriology, Oxford, v. 23, n. 2, p. 130-135, 1960.

MANACHINI, P.L.; PARINI, C. DNA restriction endonuclease cleavage patterns, DNA sequence similary and
phenotypical characteristics in some strains of Lactobacillus helveticus and Lactobacillus jugurti. Antonie van
Leeuwenhock, v. 49, p. 143-152, 1983.

MANAFI, M.; KNEIFEL, W.; BASCOMB, S. Fluorogenic and chromogenic substrates used in bacterial diagnostics.
Microbiol. Rev., v. 55, p. 335-338, 1991.

MANDIL, A.; MORAIS, V. A.; PEREIRA, M. L.; FAGUNDES, J. M. S.; CARMO, L. S.; CORREIA, M. G.;
CASTRO, E. P.; GOMES, M. J. V. M. Staphylococcus aureus em queijo tipo “Minas”. Ciência e Tecnologia de
Alimentos. Campinas, v. 2, n. 2, p. 233-241, jul./dez. 1982.

MANFREDA, G.; DE CESARE, A.; STELLA, S.; COZZI, M.; CANTONI, C. Occurrence and ribotypes of Listeria
monocytogenes in Gorgonzola cheese. International Journal of Food Microbiology, Amsterdam, v. 102, n. 3 p. 287293,
July, 2005.

MANGIN, I.; BOURGET, N.; SIMONET, J.M.; DECARIS, B. Selection of speciesspecific DNA probes which detect
strain restriction polymorphism in four Bifidobacterium species. Res. Microbiol., v. 146, p. 59-71, 1995.

MANGUEIRA, T.F.B. et al. Aceitação sensorial de queijo de coalho com baixo teor de gordura (light) e enriquecido
com ferro. Revista do Instituto de Laticínios Cândido Tostes, v. 56, n. 321, p. 109–116, 2001.

MANOLOPOULOU, E. et al. Evolution of microbial populations during traditional Feta cheese manufacture and
ripening International Journal of Food Microbiology, v. 82, n. 2, p. 153-161, 2003.

MANSOUR-GHANAEI, F.; DEHBASHI, N.; YAZDANPARAST, K.; SHAFAGHI, A. Efficacy of Saccharomyces


boulardii with antibiotics in acute amoebiasis. W orld J. Gastroenterol., v. 9, p. 1832-1833, 2003.
MANZANARES, A. Bactérias beneficiosas al hombre. La Alimentación Latino americana, v. 218, p. 59-65, 1997.

MARGOLLES, A.; RODRIQUEZ A.; REYES-GAVILIÁN, C. G. DE LOS. Some chemical and bacteriological
characteristics of regional cheeses for Austurias, Spain. Journal of Food Protection, Des Moines, v. 59, n. 5, p.509-515.,
may., 1996.

MARRACK, P.; KAPPLER, J. The staphylococcal enterotoxin and their relatives. Science, Washington, v. 248, n. 4956,
p. 705-711, May, 1990.

MARR, J. C.; LYON, J. D.; ROBERSON, J. R; LUPHER, M.; DAVIS, W. C.; BOHACH, G. A. Characterization of a
novel type C staphylococcal enterotoxins: biological end evolutionary implications. Infection and Immunity,
Washington, v. 61, n. 10, p. 4254-4262, Oct., 1993.

MARRAKCHI, A. El; HAMAMA, A. OTHMANI, F. El. Ocorrence of Listeria monocytogenes in milk and dairy
products produced or imported into Morocco. Jounal of Food Protection, Des Moines, v. 56,n. 3, p. 256-259, mar. 1993.

MARSHALL, J.C. Gastrointestinal flora and its alterations in critical illness. Curr. Opin. Clin. Nutr. Metab. Care, v. 2,
p. 405-411, 1999.

MARTEAU, P.; FLOURIÉ, B.; POCHART, P.; CHASTANG, C.; DESJEUX, J.F.; RAMBAUD, J.C. Role of the
microbial lactase (EC 3.2.123) activity from yoghurt on the intestinal absorption of lactose: an in vivo study in lactase
deficient humans. J. Nutrition. v.64,p.71, 1990a.

MARTEAU, P., MINEKUS, M., HAVENAAR, R., HUIS IN’T VELD, J.H.J. Survival of lactic acid bacteria in dynamic
model of the stomach and small intestine: validation and the effects of bile. J. Dairy Sci., v.80, p.1031-1037, 1997.

MARTEAU, P.; MINEKUS, M.; HAVENAAR, R.; HUIS IN'T VELD, J.H. Survival of lactic acid bacteria in a dynamic
model of the stomach and small intestine: validation and the effects of bile. J. Dairy Sci., v. 80, p. 1031-1037, 1997.

MARTEAU, P.; POCHART, P.; BOUHNIK, Y.; RAMBAUD, J.C. Fate and effects of some transiting microorganisms
in the human gastrointestinal tract. World Rev. Nutr. Diet. v.74, p.1, 1993a.

MARTEAU, P.; POCHART, P.; BOUHNIK, Y.; ZIDI, S.; GODEREL, I.; RAMBAUD, J.C. Survie dans I’intestine grêle
de Lactobacillus acidophilus et Bifidobacterium spp. ingérés dans un lait fermenté: une base relationnelle pour
I’utilisation des probiotiques chez I’homme. Gastroentérol. Clin. Biol., v. 16, p.25, 1992.

MARTEAU, P.; RAMBAUD, J.C. Potential of using lactic acid bacteria for therapy and immunomodulation in man.
FEMS Microbiol. Rev., v. 12, p. 207-220, 1993.

MARTEAU, P.R.; VRESE, M.; CELLIER, C.J.; SCHREZENMEIER. Protection from gastrointestinal diseases with the
use of probiotics. Am. J. Clin. Nutr., v. 73, p. 4305-4365, 2001.

MARTINS, C.A. Uma abordagem para pré-processamento de dados textuais am algoritmos de aprendizado. Tese de
Doutoramento, ICMC-USP, 2003.

MARTIN, J.H. Technical considerations for incorporating bifidobacteria and bifidogenic factores into dairy products.
Bull. Int. Dairy Fed., n. 313, 49-51, 1996.

MARTIN, J.H.; CHOU, K.M. Selection of Bifidobacterium spp. for use as dietary adjuncts in cultured dairy foods. I
tolerance to pH of yogurt. Cultured Dairy Prod. J., v. 27, n. 4, p. 21-26, 1992.

MARTIN, S. E.; MYERS, E.R.; LANDOLO, J. J. Staphylococcus aureus. In: HUI, Y.H.; PIERSON, M.D.; GORHAM,
J.R. (Eds.). Foodborn disease handbook – bacterial pathogens. 2nd ed. New York: Marcel Dekker, 2001. v. 1. Chap. 15.
p. 345-381.

MARTIN, S. E.; MYERS, E.R.; LANDOLO, J. J. Staphylococcus aureus. In: HUI, Y.H.; PIERSON, M.D.; GORHAM,
J.R. (Ed.).Foodborn disease handbook – bacterial pathogens. 2nd ed. New York: Marcel Dekker, 2001. v. 1. Chap. 15, p.
345-381.

MARTIN, S. E.; MYERS, E.R.; LANDOLO, J. J. Staphylococcus aureus. In: HUI,


Y.H.; PIERSON, M.D.; GORHAM, J.R. (Ed.). Foodborn disease handbook – bacterial pathogens. 2nd ed. New York:
Marcel Dekker, 2001. v. 1. Chap. 15. p. 345-381.
MAS, M. et al. Ibores’ goat’s milk cheese: microbiological and physical-chemical changes throughout ripening. Lait, v.
82, n. 5, p. 579-587, 2002.

MASSOT, J.; DESCONCLOIS, M.; ASTOIN, J. Protection par Saccharomyces boulardii de la diarrhée à E. coli du
souriceau. Ann. Pharm. Fr., v. 40, p. 445-449, 1983.

MATHAN, M.M.; MATHAN, V.I. Morphology of rectal mucosa of patients with shigellosis. Rev. Infect. Dis., v. 13
(Supl. 4), p. S314-S318, 1991.

MATALON, M.E.; SANDINE, W.E. Improved medium for differentiation of rods and
cocci in yogurt. J. Dairy Sci., v. 69, n. 10, p. 2569-2576, 1986.

MATSUZAKI, T.; CHIN, J. Modulating immune responses with probiotic bacteria. Immunol. Cell. Biol., v. 78, p. 67-
73, 2000.

MATTILA-SANDHOLM, T.; BLUM, S.; COLLINS, J.K.; CRITTENDEN, R.; DE VOS, W.; DUNNE, C.; FONDEN,
R.; GRENOV, G.; ISOLAURI, E.; KIELY, B.; MARTEAU, P.; MORELLI, L.; OUWEHAND, A.; RENIERO, R.;
SAARELA, M.; SALMINEN, S.; SAXELIN, M.; SCHIFFRIN, E.; SHANAHAN, F.; VAUGHAN, E.; VON WRIGHT,
A. Probiotics: towards demonstrating efficacy. Trends Food Sci. Technol., v. 10, p. 393-399, 1999.

MAUBOIS, J. L. New applications of membrane technology in the dairy industry, The Australian Journal of Dairy
Technology, Victoria, v. 46, n. 2, p. 91-95, nov. 1991.

MAUBOIS, J. L; MOCQUOT, G. Application of membrane ultrafiltration to preparation of various types of cheeses.


Journal of Dairy Science, New York, v. 58, n. 7, p. 1001-1007, jul. 1975.

MAYER, A.; REZESSY-SZABO, J.; BOGNAR, C.S.; BUJNA, E.; HOSCHKE, A. Isolation and some biological
properties of human intestinal bifidobactérias. 1999.

MCCARTNEY, A.L.; WANG, W.; TANNOCK, G.W. Molecular analysis of the composition of the bifidobacterial and
lactobacillus microflora of humans. Appl. Environ. Microbiology, v. 62, p. 4608-4613, 1996.

MCCARTHY, T.; PHAN, Q.; MSHAR, P.; MSHAR, R.; HOWARD, R.; HADLER, J. Outbreak multidrug-resistant
Salmonella Newport associated com consumption of Italian-style soft cheese, Connecticut. In: INTERNATIONAL
CONFERENCE ON EMERGING INFECTIOUS DISEASES, 2, 2002, Atlanta. Abstracts. Atlanta: CDC, 2002.
Disponível em:
<http://www.cdc.gov/foodnet/pub/publications/2002/mccarthy_2002.pdf>. Acesso em: 17 Mar. 2006.

MCCARTNEY, A.L.; WENZHI, W.; TANNOCK, G.W. Molecular analysis of the composition of the bifidobacterial
and lactobacillus microflora of humans. Appl. Environ. Microbiol., v. 62, p. 4608-4613, 1996.

MCLAUCHLIN, J. The relationship between Listeria and listeriosis. Food Control, Oxford, v. 7, n. 4/5, p. 187-193,
aug./out. 1996. Special issue.

MCLAUCHLIN, J.; NARAYANAN, G. L.; MITHANI, V.; O’NEILL, G. The detection of enterotoxin and Toxic Shock
Syndrome toxin genes in Staphylococcus aureus by Polimerase Chain Reaction. Journal Food Protection, Des Moines,
v. 63, n. 4, p. 479-488, Apr., 2000.

MCDONALD , L.C.; MCFEETERS, R.F.; DAESCHEL, M.A.; FLEMING, H.P. A differential medium for the
enumeration of homofermentative and heterofermentative lactc acid bacteria. Appl. Environm. Microbiol., v. 53, n. 6, p.
1382-1384, 1987
MCFARLAND, L.V.; BERNASCONI, P. Saccharomyces boulardii: A review of an innovative biotherapeutic agent.
Microb. Ecol. Health Dis., v. 6, p. 157-171, 1993.

MCFARLAND, L.V.; SURAWICZ, C.M.; GREENBERG, R.N.; FEKETY, R.; ELMER, G.W.; MOYER, K.A.;
MELCHER, S.A.; BOWEN, K.E.; COX, J.L.; NOORANI, Z. A randomized placebo-controlled trial of Saccharomyces
boulardii in combination with standard antibiotics for Clostridium difficile disease. J. Am. Med. Assoc., v. 271, p. 1913-
1918, 1994.

MCFARLAND, L.V.; SURAWICZ, C.M.; GREENBERG, R.N.; ELMER, G.W.; MOYER, K.A.; MELCHER, S.A.;
BOWEN, K.E.; COX, J.L. Prevention of beta-lactam-associated diarrhea by Saccharomyces boulardii compared with
placebo. Am. J. Gastroenterol., v. 90, p. 439-448, 1995.
MCFARLAND, L.V. Saccharomyces boulardii is not Saccharomyces cerevisiae. Clin. Infect. Dis., v. 22, p. 200-201,
1996.

MCFARLAND, L.V. Beneficial microbes: health or hazard? Eur. J. Gastroenterol. Hepatol., v. 12, p. 1609-1071, 2000a.

MCFARLAND, L.V. Normal flora: diversity and functions. Microb. Ecol. Health Dis., v. 12, p. 193-207, 2000b.

MCLAUCHLIN, J.; NARAYANAN, G. L.; MITHANI, V.; O’NEILL, G. The detection of enterotoxin and Toxic Shock
Syndrome toxin genes in Staphylococcus aureus by Polimerase Chain Reaction. Journal of Food Protection, Des
Moines, v. 63, n. 4, p. 479-488, Apr., 2000.

MEAD, P. S.; SLUTSKER, L.; DIETZ, V.; MCCAIG, L. F.; BRESEE, J. S.; SHAPIRO, C.; GRIFFINS, P. M.; TAUXE,
R. V. Food-related illness and death in the United States. Emerging Infectious Diseases, Atlanta, v. 5, n. 5, p. 607-625,
1999.

MEAD, P. S.; SLUTSKER, L.; DIETZ, V.; MCCAIG, L. F.; BRESEE, J. S.; SHAPIRO, C.; GRIFFIN, P.M.; TAUXE,
R. V. 1999. Food-related illness and death in the United States. Emerging Infection Disease, Atlanta, v.5, n. 5p. 607–
625, Sep./Oct., 1999.

MEADOW, L.; SCHNEIDER, H.; BEEN, M.O. Salmonella enteritidis bacteremia in childhood. J. Infect. Dis., v. 152,
p. 185-189, 1985.

MEDINA, L.M.; JORDONO, R. Survival od constitutive microflora in commercially


fermented milk containing bifidobacteria during refrigerated storage. J. Food Prot., v. 56, n. 8, p. 731-733, 1994.

MEDINA, L.M.; LOPEZ, M.C.; JORDANO, R. Considerations on the influence of bacterial populations kinetics on the
shelf-life of bat-type products. MicrobiologieAliments-Nutrition, v. 13, p. 177-181, 1995.

MEHROTRA, M.; WANG, G.; JOHNSON, W.M. Multiplex PCR for detection of genes for Staphylococcus aureus
enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. Journal of Clinical
Microbiology, Washington, v. 38, n. 3, p. 1032-1035, Mar., 2000.

MEHROTA, M.; WANG, G.; JOHNSON, W.M. Multiplex PCR for detection of genes for Staphylococcus aureus
enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. Journal of Clinical
Microbiology, Washington, v. 38, n. 3, p. 1032-1035, Mar., 2000.

MEILE, L.; LUDWIG, W.; RUEGER, U.; GUT, C.; KAUFMANN, P.; DASEN, G.; WENGER, S.; TEUBER, M.
Bifidobacterium lactis sp. nov., a moderately oxygen tolerant species isolated from fermented milk. Syst. Appl.
Microbiol., v. 20, p. 5764, 1997.

MENA, C.; ALMEIDA, G.; CARNEIRO, L.; TEIXEIRA, P.; HOGG, T.; GIBBS, P. A. Incidence of Listeria
monocytogenes in different food products commercialized in Portugal. Food Microbiology, Amsterdam v. 21, n. 2, p.
213-216, Apr., 2004.

MENDES, E.S. et al. Staphylococcus aureus, Salmonella spp. E coliformes em queijos de "coalho" comercializados em
Recife. Higiene Alimentar, v. 13, n. 66-67, p. 122-126, 1999.

MENDES, E. S.; LIMA, E. C.; NUMERIANO, A. K. M.; COELHO, M. I. S. Staphylococcus aureus, Salmonella sp. e
coliformes em queijos de "coalho" comercializadas em Recife. Higiene Alimentar, São Paulo, v. 13, n. 66/67, p.
122126, nov./dez. 1999.

MENDES, E. S.; LIMA, E. C.; NUMERIANO, A. K. M.; COELHO, M. I. S. Staphylococcus aureus, Salmonella sp. e
coliformes em queijos de "coalho" comercializadas em Recife. Higiene Alimentar, São Paulo, v. 13, n. 66/67, p.
122126, nov./dez., 1999.

MENDES, E. S.; LIMA, E. C.; NUMERIANO, A. K. M.; COELHO, M. I. S.


Staphylococcus aureus, Salmonella sp. e coliformes em queijos de "coalho" comercializadas em Recife. Higiene
Alimentar, São Paulo, v. 13, n. 66/67, p. 122126, nov./dez., 1999.

MENENDEZ, S.; GODINEZ, M. A. R.; RODRIGUEZ-OTERO, J. L.; CENTENO, J. A. Removal Listeria spp. In a
cheese factory. Journal Food Safety, Tumbuil, v. 17, n. 2, p. 133-139, Sept., 1997.

MENG, J.; DOYLE, M. P.; ZHAO, T.; ZHAO, S. Enterohemorrhagic Escherichia coli. In: DOYLE, M. P.; BEUCHAT,
L. R.; MONTVILLE, T. J. (Ed.). Food microbiology, fundamentals and frontiers. 2nd ed., Washington D. C.: ASM
Press, 2001. Chap. 10, p.193-213.

MERCENIER, A.; PAVAN, S.; POT, B. Probiotics as biotherapeutic agents: present knowledge and future prospects.
Curr. Pharm. Des., v. 9, p. 99-110, 2002.

MESSENS, W.; De VUYST, L. Inhibitory substances produced by Lactobacilli isolated from sourdoughs – a review.
International Journal of Food Microbiology, v.72, p.31-43, 2002.

METCHINIKOFF, E. The Prolongation of Life. GP Putnam’s & Sons, New York, NY. 1908.

METCHNIKOFF, E. The Prolongation of Life. Heinemann, London, UK, 1907.

MEYRAND, A.; VERNOZY-ROZAND, C. Growth and enterotoxin production of Staphylococcus aureus in different
cheeses. Revue Medicine Veterinaire, Paris, v. 150, n. 7, p. 601-616,July, 1999.

MEYRAND, A.; VERNOZY-ROZAND, C. Growth and enterotoxin production of Staphylococcus aureus in different
cheeses. Revue Medicine Veterinaire, Paris, v. 150, n. 7, p. 601-616, jul.,1999.

MEYRAND, A.; VERNOZY-ROZAND, C. Growth and enterotoxin production of Staphylococcus aureus in different
cheeses. Revue Medicine Veterinaire, Paris, v. 150, n. 7, p. 601-616, July, 1999.

MICHINO, H.; OTSUKI, K. Risk factors in causing outbreak of foodborne illness originating in school lunch facilities
in Japan. The Journal of Veterinary Medical Science, Tokyo, v. 62, n. 5, 557-560, 2000.

MIDTVEDT, T. Microbial bile acid transformation. Am. J. Clin. Nutr., v. 27, p. 1341-1347, 1974.

MIDTVEDT, T.; GUSTAFSSON, B.E. Microbial conversion of bilirubin to urobilins in vitro and in vivo. Acta Pathol.
Microbiol. Scand. Sect. B, v. 89, p. 57-60, 1981.

MIDTVEDT, T. Intestinal microflora-associated characteristics. Microecol. Ther., v. 16, p. 121-130, 1986.

MIDTVEDT, T.; CARLSTEDT-DUKE, B.; HÖVERSTAD, T.; MIDTVEDT, A.C.; NORIN, K.E.; SAXERHOLT, H.
1987. Establishment of a biochemically active intestinal ecosystem in ex-germfree rats. Appl. Environ. Microbiol., v.
53, p. 2866-2871, 1987.

BRASIL Ministério da Agricultura, Pecuária e Abastecimento. Portaria nº 146, de 07/03/96. Regulamento Técnico
Geral para Fixação de Requisitos Microbiológicos de Queijos. Brasília: Ministério da Agricultura, Pecuária e
Abastecimento, 1996.

BRASIL. Ministério da Agricultura, Pecuária e Abastecimento. Portaria nº 368, de 04/09/97. Regulamento Técnico
sobre as Condições Higiênico-Sanitárias e de Boas Práticas de Elaboração para Estabelecimentos
Elaboradores/Industrializadores de Alimentos. Brasília: Ministério da Agricultura, Pecuária e Abastecimento, 1997.

BRASIL. Ministério da Agricultura, Pecuária e Abastecimento. Instrução Normativa nº 30, de 26/07/2001.


Regulamentos Técnicos de Identidade e Qualidade de Manteiga da Terra ou Manteiga de Garrafa; Queijo de Coalho e
Queijo de Manteiga. Brasília: Ministério da Agricultura, Pecuária e Abastecimento, 2001.

BRASIL. Ministério da Agricultura Pecuária e Abastecimento. Instrução Normativa nº. 22, de 14/04/2003. Métodos
Analíticos Oficiais Físico-Químicos para Controle de Leite e Produtos Lácteos. Brasília: Ministério da Agricultura,
2003a.

BRASIL. Ministério da Agricultura Pecuária e Abastecimento. Instrução Normativa nº. 9, de 27/06/2003. Proibição de
cloranfenicol e nitrofuranos para uso veterinário e suscetíveis de emprego na alimentação de todos os animais e
insetos. Brasília: Ministério da Agricultura, 2003b.

MITAL, B.K.; CARG, S.K. Acidophilus milk products: manufacture and therapeutics. Food Reviews International, v. 8,
p. 347-389, 1992.

MITEVA, V.I.; ABADJIEVA, A.N.; STEFANOVA, T.T. M13 DNA fingerprinting, a new tool for classification and
identification of Lactobacillus spp. Journal od Applied Bacteriology, v. 73, p. 349-354, 1992.
MITEVA, V.; STEFANOVA, T.; BOUDAKOV, I. et al. Characterization of bacteriocins produced by strains from
traditional Bulgarian dairy products. Systematic ans Applied Microbiology. v. 21, p. 151-161, 1998 a.

MITEVA, V.; IVANOVA, I.; BOUDAKOV, I. et al. Detection and characterization of a novel antibacterial substance
produced by a Lactobacillus delbrueckii strain 1043. Journal of Applied Microbiology, v. 85, p. 603-614, 1998 b.

MITEVA, V.; BOUDAKOV, G.; IVANOVA-STOYANCHEVA, G.; MARINOVA, B.; MITEV, V.; MENGAUD, L.
Differentiation of Lactobacillus delbrueckii subspecies by ribotyping and amplified ribosomal DNA restriction analysis
(ARDRA). Journal of Applied Microbiology, v. 90, p. 909-918, 2001.

MITSUOKA, T. Vergleichende Untersungen über die Bifidobakterien aus dem Verdauungstrakt von Menschen und
Tieren. Zentralbl. Balteriol. Parasitenkd. Infektionskr. Hyg. Abt. I. Orig., v.210, p. 52-64, 1969.

MITSUOKA, T. Bifidobacteria and their role in human health. J. Industrial Microbiology, v. 6, p. 263-268, 1990.

MITSUOKA, T. In: Intestinal Bacteria and Health, Tokyo: Harcout Brace Jovanovich Japan, 1978, 208p.

MITSUOKA, T. Intestinal flora and aging. Nutr. Rev., v. 50, p. 438-346, 1992.

MITSUOKA, T. Intestinal flora and human health. Asia Pacific Journal of Clinical Nutrition, v. 1, p. 2-9, 1996.

MODI, R.; HIRVI, Y.; HILL, A.; GRIFFITHS, M.W. Effect of phage on survival of Salmonella enteritidis during
manufacture and storage of cheddar cheese made from raw and pasteurized milk. Journal of Food Protection, Des
Moines, v. 64, n. 7, p. 927-933, July, 2001.

MODLER, H.W. Bifidobacteria and bifidogenic factors. Canadian Institute of Food Science and Technology Journal,
v.23, p. 29-41, 1990.

MODLER, H.W.; MCKELLAR, R.C.; YAGUCHI, M. Bifidobacteria and bifidogenic factors: review. Can. Inst. Food
Sci. Technol. J., v. 23, p. 29-41, 1990a.

MODLER, H.W.; MCKELLER, R.C.; GFF, H.D.; MACKIE, D.A. Using ice cream as a mechanism to incorporate
bifidobacteria and fructooligosaccharides into the human diet. Cultured Dairy Prod. J., v.25, n.3, p.4, 1990 b.

MODLER, H.W.; VILLA-GARCIA, L. The growth of Bifidobacterium longum in a whey based medium and viability
of this organism in frozen yogurt with low and high levels of developed acidity. Cult. Dairy Prod. J., v. 28, p. 4-8, 1993.

MOGENSEN, G. et al. Food microrganisms - health benefits, safety evaluation and strains with documented history of
use in foods. Bulletin of the International Dairy Federation, n. 377, p. 4-9, 2003.

MOLIN, G.; JEPPSSON, B.; AHRNÉ, S.; JOHANSSON, M.L.; NOBAEK, S.; STAHL, M.; BENGMARK, S.
Numerical taxonomy of Lactobacillus spp. associated with healthy and diseased mucosa of the human intestines.
Journal of Applied Bacteriology, v. 74, p. 314-323, 1993.

MONDAY, S. R.; BOHACH, G. A. Use of Multiplex PCR to detect classical and newly described pyrogenic toxin
genes in staphylococcal Isolates Journal of Clinical Microbiology, Washington, v. 37, n. 10, p. 3411-3414, Oct., 1999.

MONDAY, S. R.; BONACH, G. A. Use of multiplex PCR to detect classical and newly described pyrogenic toxin in
Staphylococcus aureus. Journal of Clinical Microbiology, Washington, v. 37, n. 10, 4311-4314, Oct., 1999.

MOORE, W.E.C.; HOLDEMAN, L.V. Human fecal flora: the normal flora of 20 Japanese-Hawaiians. Appl. Microbiol.,
v. 27, p. 961-979, 1974.

MORAIS, P.B.; HAGLER, A.N.; ROSA, C.A.; MENDONÇA-HAGLER, L.C.; KLACZKO, L.B. Yeasts associated
with Drosophila in tropical forests of Rio de Janeiro, Brazil. Can. J. Microbiol., v. 38, p. 1150-1155, 1992.

MORAIS, P.B.; ROSA, C.A.; LINARDI, V.R.; PATARO, C.; MAIA, A.B.R.A. Characterization and succession of yeast
populations associated with spontaneous fermentations during the production of the Brazilian sugar-cane aguardente. W
orld J. Microbiol. Biotechnol., v. 13, p. 241-243, 1997.

MORDARSKI, M. Detection of ribosomal nucleic acid homologies. In: GOODFELLOW, M. & MINNIKIN, D.E.
Chemical Methods in Bacterial Systematics, p. 41-66. London: Academic Press, 1985
MOREA, M. et al. Molecular characterization of the Lactobacillus community in traditional processing of Mozzarella
cheese. International of Food Microbiology, v. 43, n. 1-2, p. 53-60, 1998.

MORENO, I.; LERAYER, A.L.S.;.LEITÃO, M.F.F. Detection and characterization of bacteriocin-producing


Lactococcus lactis strains. Revista de Microbiologia, v.30, p.130-136, 1999.

MORGAN, F.; BONIN, V.; MALLEREAU, M.-P.; PERRIN,G. Survival of Listeria monocytogenes during
manufatured, ripening and storage of soft latic cheese made from raw goat milk. International Journal of Food
Microbiology, Amsterdam, v. 64, n. 1/2, p. 217-221, feb. 2001.

MORI, K.; YAMAZAKI, K.; ISHIYAMA, T.; KATSUMATA, M.; KOBAYASHI, K.; KAWAI, Y.; INOUE, N.;
SHINANO, H. Comparative sequence analysis of genes coding for 16S rRNA of Lactobacillus casei-related taxa.
International Journal of Sistemic Bacteriology, v. 47, p. 54-57, 1997.

MORO, E. Über den Bacillus acidophilus n. spec. Ein Beitrag zur Kenntnis der normalen Darmbacterien des Säuglings
(Bacillus acidophilus n. spec. A contribuition to the knowledge of the normal intestinal bacteria of infantis) Jahrbuch für
Kinderheikunde, 1900, 52:38-55 (in German).

MOUNIER, J.; VASSELON, T.; HELLIO, R.; LESOURD, M.; SANSONETTI, P.J. Shigella flexneri enters human
colonic Caco-2 epithelial cells through their basolateral pole. Infect. Immun., v. 60, p. 237-248, 1992.

MOURA, S. M.; DESTRO, M. T.; FRANCO, B. D. G. M. Incidence of Listeria species in raw and pasteurized milk
produced in São Paulo, Brazil, International Journal of Food Microbiology, Amsterdam, v. 19, n.3, p. 229-236, aug.
1993.

MOUTINHO, F.F.B. Ocorrência de um surto de intoxicação alimentar por toxinas de Staphylococcus aureus no
município de Parati/RJ. In: IV Congresso Estadual de Saúde Pública de Alimentos, Nova Friburgo, RJ, 2001.

MULLIS,K.; FALOONA,F.; SCHARF,S.; SAIKI,R.; HORN,G.; ERLICH,H. -Specific enzymatic amplification of DNA
in vitro: the polymerase chain reaction. Cold Spring Harb. Symp. Quant. Biol., 51 Pt 1: 263-73, 1986.

MUNOA, F.J. & PARES, R. Selective medium for isolation and enumeration of Bifidobacterium spp.
Appl.Environ.Microbiol. 54(7):1715-1718, 1988.

MUNSON, S. H.; TREMAINE, M. T. ; BETLEY, M. J.; WELCH, R. A. Identification and characterization


staphylococcal enterotoxins of type G and from Staphylococcus aureus. Infection and Immunity, Washington, v. 66, n.
7, p. 3337-3348, July, 1998.

MUNSON, S. H.; TREMAINE, M. T. ; BETLEY, M. J.; WELCH, R. A. Identification and characterization


staphylococcal enterotoxins of type G and from Staphylococcus aureus. Infection and Immunity, Washington, v. 66, n.
7, p. 3337-3348, July, 1998.

MURTI, T.W.; BOUILLANNE, C.; LANDON, M.; DESMAZEAUD, M.J. Bacterial growth and volatile compounds in
yoghurt-type products from soymilk containing Bifidobacterium spp. Journal of Food Science, v. 58, p. 153-157, 1992.

MUSTAPHA, A.; JIANG, T.; SAVAIANO, A. Improvement of lactose digestion of unfermenteds acidophilus milk:
influence of bile sensitivity, lactose transport and acid tolerance of Lb. acidophilus. Journal of Dairy Science, v. 80, p.
1537-1545, 1997.

NADER DE MACIAS, M.E.; ROMER, M.E.; APELLA, M.C.; GONZALES, S.N.; OLIVER, G. Prevention of
infectious diarrhea produced by Escherichia coli and Listeria monocytogenes by feeding fermentation milk with
lactobacilli. J. Food Prot., v. 56, p. 401-405, 1993.

NADVORNY, A.; FIGUEIREDO, D. M. S.; SCHMIDT, V. Ocorrência de Salmonella sp. em surtos de doenças
transmitidas por alimentos no Rio Grande do Sul em 2000. Acta Scientiae Veterinariae, Porto alegre, v. 32, n. 1, p. 47-
51, jan., 2004.

NADVORNY, A.; FIGUEIREDO, D. M. S.; SCHMIDT, V. Ocorrência de Salmonella sp. em surtos de doenças
transmitidas por alimentos no Rio Grande do Sul em 2000. Acta Scientiae Veterinariae, Porto Alegre, v. 32, n. 1, p. 47-
51, jan., 2004.

NAIDU, A.S.; BIDLACK, W.R.; CLEMENS, R.A. Probiotic spectra of lactic acid bacteria (LAB). Crit. Rev. Food Sci.
Nutr., v. 39, p. 13-126, 1999.
NAIDU, A.S.; BIDLACK, W.R.; CLEMENS, R.A. Probiotic spectra of lactic acid bacteria (LAB). Critical Reviews in
Food Science and Nutition., v. 38, n. 1, p. 13-126, 1999.

NAIDU, A.S; BIDLACK, W.R; CLEMENS, R.A. Probiotic spectra of lactic acid bacteria. Critical Reviews in Food
Science and Nutrition, v. 38, n.1, p.13-126, 1999.

NÁJERA-SÁNCHEZ, G.; MALDONADO-RODRÍGUEZ, R.; OLVERA, P. R.; GARZA, L. M. Development of two


Multiplex Polymerase Chain Reactions for the detection of enterotoxigenic strains of Staphylococcus aureus isolated
from food. Journal of Food Protection, Des Moines, v. 66, n. 6, p. 1055–1062, June, 2003.

NAKAGAWA, T.; SHIMADA, M.; MUKAI, H.; ASADA, K.; KATO, I.; FUJINO, K.; SATO, T. Detection of alcohol-
tolerant hiochi bactéria by PCR. Appl. Environ. Microbiol., v. 60, p. 637-640, 1994.

NAKAZAWA, Y.; HOSONO, A. (Eds.) Functions of fermented milk. Challenges for the health sciences. London,
England: Elsevier Applied Science, 1992.

NALDINI, M. C. M. Comportamento diferencial de Listeria monocytogenes em queijos Minas Frescal elaborados pelo
método convencional e por acidificação direta. Campinas, 2002. 72p. Dissertação (Mestrado em Tecnologia de
Alimentos) – Faculdade de Engenharia de Alimentos UNICAMP.

NARDI, R.D.; VIEIRA, E.C.; CROCCO-AFONSO, L.C.; SILVA, M.E.; BAMBIRRA, E.A.; ANDRADE, A.M.V.;
NICOLI, J.R. Bacteriological and immunological aspects of conventional and germfree mice infected with Salmonella
typhimurium. Rev. Latinoam. Microbiol., v. 31, p. 239-243, 1991.

NARDI, R.D.; SANTOS, A.R.M.; CARVALHO, M.A.R.; FARIAS, L.M.; BENCHETRIT, L.C.; NICOLI, J.R.
Antagonism against anaerobic and facultative bacteria through a diffusible inhibitory compound produced by a
Lactobacillus sp. isolated from the rat fecal microbiota. Anaerobe, v. 5, p. 409-411, 1999.

NASCIMENTO, F.R.R. et al. Ações da vigilância sanitária perante as condições higiênico-sanitárias do queijo de
coalho comercializado no município de Fortaleza. Revista do Instituto de Laticínios Cândido Tostes, v. 56, n. 321, p.
257-261, 2001.

NASCIMENTO, I. R.; SOBRINHO, D. C. dos S.; OLIVEIRA, E. C. de; FREITAS, M. S.; ARAGÃO, I. N. Qualidade
microbiológica do queijo de coalho submetido a tratamento térmico comercializado em Aracajú - SE. Revista do
Instituto de Laticínios Cândido Tostes, Juiz de Fora, v. 345, n. 60, p. 253-2, jul./ago, 2005.

NASSU, R. T.; BENEVIDES, S. D.; BORGES, M. F.; SILVA, J. B.; LEITE, A. I. N. Implantação de Boas Práticas de
fabricação em uma indústria de laticínios no estado do Rio Grande do Norte. Revista do Instituto de Laticínios Cândido
Tostes, Juiz de Fora, v. 327, n. 57, p. 12-17, jul./ago., 2002.

NASSU, R. T.; LIMA, J. R.; BASTOS, M. S. R.; MACEDO, B. A.; LIMA. M. H. P. Diagnóstico das condições de
processamento de queijo de coalho e manteiga da terra no Estado do Ceará. Revista Higiene Alimentar, São Paulo, v.
15, n. 89, p. 28-36, jul., 2001.

NASSU, R. T.; LIMA, J. R.; BASTOS, M. S. R.; MACEDO, B. A.; LIMA. M. H. P. Diagnóstico das condições de
processamento de queijo de coalho e manteiga da terra no Estado do Ceará. Revista Higiene Alimentar, São Paulo, v.15,
n. 89, p. 28-36, jul., 2001.

NATARO, J.P.; KAPER, J.B. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev., v. 11, p. 142-201, 1998.

NATARO, J. P.; KAPER, J. B. Diarrheagenic Escherichia coli. Clinical Microbiology Review, Washington, v. 11, n. 1,
p.142-201, Jan., 1998.

NATIONAL INSTITUTE OF INFECTIOUS DISEASES (NIID). Staphylococcus food poisoning in Japan. Infectious
Agents Surveillance Report, Tokyo, v. 22, n. 8, p.
185-186, 2001.

NATIONAL INSTITUTE OF INFECTIOUS DISEASES (NIID). Staphylococcus food poisoning in Japan. Infectious
Agents Surveillance Report, Tokyo, v. 22, n. 258, p. 185-186, Aug., 2001.

NAUMOVA, E.S.; KORSHUNOVA, I.V.; JESPERSEN, L.; NAUMOV, G.I. Molecular genetic identification of
Saccharomyces sensu stricto strains from African sorghum beer. FEMS Yeast Res., v. 3, p. 177-184, 2003.
NEBRA, Y.; BLANCH, A.R. A new selective medium for Bifidobacterium spp. Applied and Environmental
Microbiology, v. 65, n. 11, p. 5173-5176, 1999.

NERO, L. A.; MATTOS, M. R.; BELOTI, V.; BARROS, M. A. F.; NETTO, D. P.; PINTO, J. P. A. N.; ANDRADE, J.
N.; SILVA, V. P.; FRANCO, B. G. M. Hazards in non-pasteurized milk on retail sale in Brazil: prevalence of Salmonella
spp., Listeria monocytogenes and chemical residues. Brazilian Journal of Microbiology, São Paulo, v. 35, n. 3, p. 211-
215, jul./set, 2004.

NEVES, M.J.; ETCHEBEHERE, L.; BRANDÃO, R.L.; CASTRO, I.M.; LIMA, M.E.; NICOLI, J.R. Partial
characterization of cholera toxin binding on membranes of Saccharomyces boulardii. Microecol. Ther., v. 29, p. 185-
190, 2002.

NEUMANN, E.; OLIVEIRA, M.A.; CABRAL, C.M.; MOURA, L.N.; NICOLI, J.R.; VIEIRA, E.C.; CARA, D.C.;
PODOPRIGORA, G.I.; VIEIRA, L.Q. Monoassociation with Lactobacillus acidophilus UFV-H2b20 stimulates the
immune defense mechanisms of germfree mice. Braz. J. Med. Biol. Res., v. 31, p. 1565-1573, 1998.

NEUT, C.; BEZIRTZOGLOU, E.; ROMOND, C.; BEERENS, H.; DELCROIX, M.; NOEL, A.M. Bacterial
colonization of the large intestine in newborns delivered by caesarian section. Zentbl. Bakteriol. Mikrobiol. Hyg. Ser., v.
266, p. 330-337, 1987.

NEWBOLD, C.J.; WALLACE, R.J.; CHEN, X.B.; MCINTOSH, F.M. Different strains of Saccharomyces cerevisiae
differ in their effects on ruminal bacterial numbers in vitro and in sheep. J. Anim. Sci., v. 73, p. 1811-1818, 1995.

NIAULT, M.; THOMAS, F.; PROST, J.; ANSARI, F.H.; KALFON, P. Fungemia due to Saccharomyces species in a
patient treated with enteral Saccharomyces boulardii. Clin. Infect. Dis., v. 28, p. 930, 1999.

NICOLAU, E. S.; KUAYE, A. Y.; MESQUITA, A. J.; OLIVEIRA, G. R. Avaliação do potencial de produção e tipo de
enterotoxinas estafilocócicas encontradas em linhagens de Staphylococcus aureus em extratos de amostras de queijo
tipo mussarela fabricado na região de Goiânia - GO. Revista do Instituto de Laticínios Cândido Tostes, Juiz de Fora, v.
56, n. 321, p. 92-101, jul./ago, 2001.

NICOLAU, E. S.; KUAYE, A. Y.; MESQUITA, A. J.; OLIVEIRA, G. R. Avaliação do potencial de produção e tipo de
enterotoxinas estafilocócicas encontradas em linhagens de Staphylococcus aureus em extratos de amostras de queijo
tipo mussarela fabricado na região de Goiânia - GO. Revista do Instituto de Laticínios Cândido Tostes, Juiz de Fora, v.
56, n. 321, p. 92-101,jul./ago, 2001.

NICOLI, J.R.; RAIBAUD, P. In vivo and in vitro antagonistic effect against Clostridium perfringens of a diffusible
compound produced by a Peptostreptococcus sp. from human intestinal flora in mice. Microecol. Ther., v. 20, p. 141-
146, 1990.

NICOLI, J.R. Normal gastrointestinal microbiota in domestic animals and human beings. Enferm. Infec. Microbiol., v.
15, p. 183-190, 1995.

NICOLI, J.R. E VIEIRA, L.Q. Probióticos, prebióticos e simbióticos: moduladores do ecossistema digestivo. Ciência
Hoje, v. 28, p. 34-38, 2000.

NICOLAU, E.S. et al. Avaliação do potencial de produção de enterotoxinas estafilocócicas encontradas em linhagens de
Staphylococcus aureus em extaratos de amostras de queijo tipo mussarela, fabricado na região de Goiânia. In: Anais do
XVII Congresso Nacional de Laticínios. Juiz de Fora, MG, p. 92-101, 2001.

NIGATU, A. Evaluation of numerical analyses of RAPD and API 50 CH patterns to differentiate Lactobacillus
plantarum, Lact. fermentum, Lact. rhamnosus, Lact. sake, Lact. parabuchneri, Lact. gallinarum, Lact. casei, Weissella
minor and related taxa isolated from kocho and tef. Journal of Applied Microbiology, v. 89, p. 969978, 2000.

NIGHSWONGER, B.D.; BRASHEARS, M.M.; GILLILAND, S.E. Viability of Lactobacillus acidophilus and
Lactobacillus casei in fermented milk products during refrigerated storage. Journal of Dairy Science, v. 79, p. 212-219,
1996.

NING, W.; MACKIE, R.I.; GASKINS, H.R. Biotype and ribotype diversity among Lactobacillus isolates from the
mouse ileum. Systematic and Applied Microbiology, v. 20, p. 423-431, 1997.

NOH, D.O.; KIM, S.H.; GILLILAND, S.E. Incorporation of cholesterol into the cellular membrane of Lb. acidophilus
ATCC 43121. Journal of Dairy Science, v. 80, p. 3107-3113, 1997.

NORMANNO, G.; FIRINU, A.; VIRGILIO, S.; MULA, G; DAMBROSIO, A.; POGGIU, A.; DECASLELLI, L.;
MIONI, R.; SCUOTA, S.; BALZONI, G.; DI GIANNATALE, E.; SALINETTI, A. P.; LA SALANDRA, G.; BARTOLI,
M; ZUCCON, F.; PIRINO, T.; SIAS, S.; PARISI, A.; QUAGLIA, N. C.; CELANO, G. V. Coagulasepositive
Staphylococci and Staphylococcus aureus in food products marketed in Italy. International Journal of Food
Microbiology, Amsterdam, v. 98, n. 1, p. 73-79, Jan., 2005.

NORMANNO, G.; FIRINU, A.; VIRGILIO, S.; MULA, G; DAMBROSIO, A.; POGGIU, A.; DECASLELLI, L.;
MIONI, R.; SCUOTA, S.; BALZONI, G.; DI GIANNATALE, E.; SALINETTI, A. P.; LA SALANDRA, G.; BARTOLI,
M; ZUCCON, F.; PIRINO, T.; SIAS, S.; PARISI, A.; QUAGLIA, N. C.; CELANO, G. V. Coagulasepositive
Staphylococci and Staphylococcus aureus in food products marketed in Italy. International Journal of Food
Microbiology, Amsterdam, v. 98, n. 1, p. 7379, Jan., 2005.

NORMANNO, G.; FIRINU, A.; VIRGILIO, S.; MULA, G; DAMBROSIO, A.; POGGIU, A.; DECASLELLI, L.;
MIONI, R.; SCUOTA, S.; BALZONI, G.; DI GIANNATALE, E.; SALINETTI, A. P.; LA SALANDRA, G.; BARTOLI,
M; ZUCCON, F.; PIRINO, T.; SIAS, S.; PARISI, A.; QUAGLIA, N. C.; CELANO, G. V.
CoagulasepositiveStaphylococci and Staphylococcus aureus in food products marketed in Italy. International Journal of
Food Microbiology, Amsterdam, v. 98, n. 1, p. 7379, Jan., 2005.

NORTHFIELD, T.C.; MCCOLL, I. Postprandial concentrations of free and conjugated bile acids down the length of the
normal human small intestine. Gut, v. 14, p. 513-518,
1973.

NORTHFIELD, T.C. & MCCOLL, I. Postprandial concentrations of free and conjugated bile acids down the length of
the normal human small intestine. Gut, v. 14, p. 513, 1973.

NØRRUNG, B.; ANDERSEN, J. K.; SCHLUNDT, J. Incidence and control of Listeria monocytogenes in foods in
Denmark. International Journal of Food Microbiology, Amsterdam, v. 53, n. 2-3 p. 195-203, Dec., 1999.

O’SULLIVAN, D.J., 1999. Methods for the analysis of intestinal microflora. In: TANNOCK, G.W. (Ed.), Probiotics: a
Critical Review, cap.3. Wymondham (UK): Horizon Scientific Press.

O’SULLIVAN, M.G.; THORNTON, G.; O’SULLIVAN, G.C.; COLLINS, J.K. Probiotic bacteria: myth or reality?.
Trends Food Sci. Technol., v. 3, n. 12, p. 309314, 1992.

OBERMANN, H.; LIBUDZISZ, Z. Fermented milks. In: WOOD, B.J.B. (ED.) Microbiology of Fermented Foods, p.
308-350, Blackie Academic & Professional, London, 1988.

OGGIONI, M.R.; POZZI, G.; BALENSIN, P.E.; GALIENI, P.; BIGAZZI, C. Recurrent septicemia in an
immunocompromised patient due to probiotic strains of Bacillus subtilis. J. Clin. Microbiol., v. 36, p. 325-326, 1998.

OLIVE,D.M. & BEAN,P. -Principles and applications of methods for DNA-based typing of microbial organisms. J.
Clin. Microbiol., 37: 1661-9, 1999.

OLIVEIRA, A. M. Investigação do comportamento de estafilococos enterotoxigênicos coagulase negativos, em


alimentos. 1999. 102p. Tese (Doutor em Ciências de Alimentos) – Departamento de Ciências de Alimentos,
Universidade Estadual de Campinas, Campinas, 1999.

OLIVEIRA, C. A. F. de; MORENO, J. F. G.; MESTIERI, L.; GERMANO, P. M. L. Características físico-químicas e


microbiológicas de queijos Minas frescal e Mussarela produzidos em algumas fábricas de laticínios de São Paulo.
Revista Higiene Alimentar, São Paulo, v. 12, n. 55, p. 31-35, mai.-jun., 1998.

OLIVEIRA, J. S. Queijo: Fundamentos Tecnológicos. São Paulo: Ícone/ UNICAMP, 1986, 146p.

OLIVEIRA, J.S.; GARCIA, S. Isolamento e caracterização de culturas lácticas. Revista do Instituto de Laticínios
Cândido Tostes, v. 40, n. 239, p. 19-30, 1986.

OLIVEIRA, A. M. Investigação do comportamento de estafilococos enterotoxigênicos coagulase negativos, em


alimentos. 1999. 102p. Tese (Doutor em Ciências de Alimentos) – Departamento de Ciências de Alimentos,
Universidade Estadual de Campinas, Campinas, 1999.

OLIVIERI, D. A. Avaliação da qualidade microbiologia de amostras de mercado de queijo mussarela, elaborado a partir
de leite de búfala (Bubalus bubalis). 2004. 61p. Dissertação (Mestre em Ciências e Tecnologia de Alimentos) – Escola
Superior deAgricultura “Luiz de Queiroz”, Universidade de São Paulo, Piracicaba, 2004.

OLSEN, S. J.; MACKINON, L. C.; GOULGING, J. S.; SLUTSKER, L. Surveillance for foodborne disease outbreaks,
1992-1997. Morbidity and Mortality Weekly Report, Atlanta, v. 49, n. SS01, p. 1-51, Mar., 2000.

OLSEN, S. J.; MACKINON, L. C.; GOULGING, J. S.; SLUTSKER, L. Surveillance for foodborne diseases outbreaks,
1992-1997. Morbidity and Mortality Weekly Report, Atlanta, v. 49, n. SS01, p. 1-51, Mar., 2000.

OLSEN, S. J.; MACKINON, L. C.; GOUDING, J. S.; BEAN, N. H.; SLUTSKER, L. Surveillance for foodborne
disease outbreaks – United States, 1993-1997. Morbidity and Mortality Weekly Report, Atlanta, v. 49, n. SS01, p.1-51,
Mar., 2000.

OLSEN, S. J.; MACKINON, L. C.; GOULGING, J. S.; SLUTSKER, L. Surveillance for foodborne disease outbreaks,
1992-1997. Morbidity and Mortality Weekly Report, Atlanta, v. 49, n. SS01, p. 1-51, Mar., 2000.

OLSEN, S. J.; YING, M.; DAVIS, M. F.; DEASY, M.; HOLLAND, B.; LAMPIETRO, L.; BAYSINGER, C. M.;
SASSANO, F.; POLK, L. D.; GORMLEY, B.; HUNG, M. J.; PILOT,K.; ORSINI, M.; VAN DUYNE, S.; RANKIN, S.;
GENESE, C.; BRESNITZ, E. A.; SMUCKER, J.; MOLL, M.; SOBEL, J. Multidrug-resistant Salmonella Typhimurium
infection from milk contaminated after pasteurization. Emerging Infectious Diseases, Atlanta, v. 10, n. 5, p. 932-935,
May, 2004.

OLSON, C.F. Parallel algorithms for hierarchical clustering. Parallel Computung, v. 21, n.8, p. 1313-1325, 1995.

OMOE, K.; HU, D. L.; TAKAHASHI-OMOE, H.; NAKANE, A.; SHINAGAWA. Comprehensive analysis of classical
and newly described staphylococcal superantigenic toxin genes in Staphylococcus aureus isolates. FEMS Microbiology
Letters, Amsterdam, v. 246, n. 2, p. 191-198, May, 2005.

OMOE, K.; HU, D. L.; TAKAHASHI-OMOE, H.; NAKANE, A.; SHINAGAWA. K.


Comprehensive analysis of classical and newly described staphylococcal superantigenic toxin genes in Staphylococcus
aureus isolates. FEMS Microbiology Letters, Amsterdam, v. 246, n. 2, p. 191-198, May, 2005.

OMOE, K.; HU, D.L.; TAKAHASHI-OMOE, H.; NAKANE, A.; SHINAGAWA, K. Identification and characterization
of a new staphylococcal enterotoxin-related putative toxin encoded by to kinds of plasmids. Infection and Immunity,
Washington, v. 71, n. 6, p. 6088--6094, June, 2003.

OMOE, K.; HU, D.L.; TAKAHASHI-OMOE, H.; NAKANE, A.; SHINAGAWA, K.


Identification and characterization of a new staphylococcal enterotoxin-related putative toxin encoded by to kinds of
plasmids. Infection and Immunity, Washington, v. 71, n. 6, p. 6088-6094, June, 2003.

OMOE, K.; HU, D.L.; TAKAHASHI-OMOE, H.; NAKANE, A.; SHINAGAWA, K. Identification and characterization
of a new staphylococcal enterotoxin-related putative toxin encoded by to kinds of plasmids. Infection and Immunity,
Washington, v. 71, n. 6, p. 6088--6094, June, 2003.

OMOE, K.; HU, D. L.; TAKAHASHI-OMOE, H.; NAKANE, A.; SHINAGAWA. K. Comprehensive analysis of
classical and newly described staphylococcal superantigenic toxin genes in Staphylococcus aureus isolates. FEMS
Microbiology Letters, Amsterdam, v. 246, n. 2, p. 191-198, May, 2005

OMOE, K.; ISHIKAWA, M.; YU, S.; HU, D.L.; UEDA, S.; SHINAGAWA, K. Detection of seg, seh, and sei genes in
Staphylococcus aureus isolates and determination of the enterotoxin productive of S. aureus isolates harboring seg, seh,
or sei genes. Journal of Clinical Microbiology, Washington v. 40, n. 3, p. 857-862, Mar., 2002.

OMOE, K.; ISHIKAWA, M.; YU, S.; HU, D.L.; UEDA, S.; SHINAGAWA, K. Detection of seg, seh, and sei genes in
Staphylococcus aureus isolates and determination of the enterotoxin productive of S. aureus isolates harboring seg, seh,
or sei genes. Journal of Clinical Microbiology, Washington v. 40, n. 3, p. 857-862, Mar., 2002.

OMOE, K.; ISHIKAWA, M.; YU, S.; HU, D.L.; UEDA, S.; SHINAGAWA, K. Detection of seg, seh, and sei genes in
Staphylococcus aureus isolates and determination of the enterotoxin productive of S. aureus isolates harboring seg, seh,
or sei genes. Journal of Clinical Microbiology, Washington, v. 40, n. 3, p. 857-862, Mar., 2002.

OMORI, G.; KATO, Y. A staphylococcal food-poisoning caused by a coagulasenegative strain. Biken´s


Journal, Berlin, v.2, p. 92- 92, Jan., 1959.
OMORI, G.; KATO, Y. A staphylococcal food-poisoning caused by a coagulasenegative strain. Biken´s Journal, Berlin,
v. 2, p. 92- 92, Jan., 1959.

OMORI, G.; KATO, Y. A staphylococcal food-poisoning caused by a coagulasenegative strain. Biken´s Journal, Berlin,
v. 2, p. 92- 92, Jan., 1959.

ONGOO, I.; FLEET, G.H. Media for the isolation and enumeration of lactic acid bacteria from yoghurts. Aust. J. Dairy
Technol., v. 48, p. 89-92, 1993.

ORWIN, P. M.; FITZGERALD, J. R.; LEUNG, D. Y. M.; GUTERREZ, J. A.; BOACH, G. A.; SCHLIEVERT, P. M.
Characterization of Staphylococcus aureus enterotoxin L. Infection and Immunity, Washington, v. 71, n. 2, p. 2916--
2919, Feb., 2003.

ORWIN, P. M.; FITZGERALD, J. R.; LEUNG, D. Y. M.; GUTERREZ, J. A.; BOACH, G. A.; SCHLIEVERT, P. M.
Characterization of Staphylococcus aureus enterotoxin L. Infection and Immunity, Washington, v. 71, n. 2, p. 2916--
2919, Feb., 2003.

ORWIN, P. M.; FITZGERALD, J. R.; LEUNG, D. Y. M.; GUTERREZ, J. A.; BOACH, G. A.; SCHLIEVERT, P. M.
Characterization of Staphylococcus aureus enterotoxin L. Infection and Immunity, Washington, v. 71, n. 2, p. 2916--
2919, Feb., 2003.

ORWIN, P. M.; LEUNG, D. Y. M.; DONAHUE, H. I.; NOVICK, R. P.; SCHLIEVERT, P. M. Biochemical and
biological properties of staphylococcal enterotoxin K. Infection and Immunity, Washington, v. 69, n. 3, p. 360-366,
Mar., 2001.

ORWIN, P. M.; LEUNG, D. Y. M.; DONAHUE, H. I.; NOVICK, R. P.; SCHLIEVERT, P. M. Biochemical and
biological properties of staphylococcal enterotoxin K. Infection and Immunity, Washington, v. 69, n. 3, p. 360-366,
Mar., 2001.

ÖRSKOV, F.; BIERING-SÖRENSEN, K. Escherichia coli serogroups in breast-fed and bottle-fed infants. Acta Pathol.
Microbiol. Scand. Sect. B, v. 83, p. 25-30, 1975.

OUWEHAND A.C.; SALMINEN, S.J. The health effects of cultured milk products with viable and non-viable bacteria.
Int. Dairy J., v. 8, p. 749-758, 1998.

OUWEHAND, A.C.; SALMINEN, S.; ISOLAURI, E. Probiotics: an overview of beneficial effects. Antonie Van
Leeuwenhoek, v. 82, p. 279-289, 2002.

OUWEHAND, A.C. et al. Health effects of probiotics and culture-containing dairy products in humans. Bulletin of the
International Dairy Federation, n. 380, p. 4-19, 2003.

OUWEHAND, A.C.; KIRJAVAINEN, P.V.; SHORTT, C.; SALMINEN, S. Probiotics: mechanisms and established
effects. Internatonal Dairy Journal. v.9, p. 43-52, 1999.

PACHER, B.; KNEIFEL, W. Development of a culture medium for the detection and enumeration of bifidobacteria in
fermented milk products. Int. Dairy Journal.
v. 6, p. 43-64, 1996.

PACK, A. Protein-fingerprinting zur abgrenzung von spezies und stämmen aus der Lactobacillus acidophilus-gruppe.
Thesis Vet. Med., Free University of Berlin. 1997

PACK, A.; KLEIN, G.; REUTER, G. Zur taxonomischen einstufung von Lactobacillus acidophilus 1 aus
joghurtprodukten. In: Proceeding of the 37th Arbeitstagung des Arbeitsgebietes Lebensmittelhygiene, Vol. II. Deutsche
Veterinärmedizinische Gesellschaft e.V., GieBen, pp. 171-177, 1997

PAGOTTO, F.; DALEY, E.; FARBER, J.; WARBURTON, D. Isolation of Listeria monocytogenes from all food and
environmental samples. In: CANADA. Health Products and Food Branch. Compendium of analytical methods:
laboratory procedures of microbiological analytical of foods, [MFHPB 30]. Ottawa, 2001. Disponível em: <www.hc-
sc.gc.ca/food-aliment>. Acesso em: 22 Out. 2005.

PAGOTTO, F.; DALEY, E.; FARBER, J.; WARBURTON, D. Health products and Food Branch. Isolation of Listeria
monocytogenes from all food and environmental samples. Government of Canada, january 2001. Disponível em:
http://www.hc-sc.ca/food-aliment.. Acesso em 20 set. 2001.
PAIVA. M. S. D.; CARDONHA, A. M. S. Queijo de coalho artesanal e industrializado produzidos no Rio Grande do
Norte. Revista Higiene Alimentar, São Paulo, v.13, n. 61, p. 33-37, jan./fev., 1999.

PAIVA. M. S. D.; CARDONHA, A. M. S. Queijo de coalho artesanal e industrializado produzidos no Rio Grande do
Norte. Revista Higiene Alimentar, São Paulo, v.13, n. 61, p. 33-37, jan./fev., 1999.

PAIVA, M. S. D.; CARDONHA, A. M. S. Queijo de coalho artesanal e industrializado produzidos no Rio Grande do
Norte: estudo comparativo da qualidade microbiológica. Revista Higiene Alimentar, São Paulo, v. 13, n. 61, p. 33-37,
jan./fev., 1999.

PARENT, D.; BOSSENS, M.; BAYOT, D.; KIRKPATRICK, C.; GRAF, F.; WILKINSON, F.E.; KAISER, R.R. Therapy
of bacterial vaginosis using exogenously-applied Lactobacilli acidophili and a low dose of estriol: a placebo-controlled
multicentric clinical trial. Arzneimittelforschung, v. 46, p. 68-73, 1996.

PARKER, R.B. Probiotics: the other half of the antibiotics story. Animal Nutr. Hlth., v. 29, p. 4-8, 1974.

PASSOS, M. H. C. R. Influência da formulação e condições de aquecimento na injuria e destruição de Listeria


monocytogenes em hambúrguer. Campinas, 2000. 242p. Tese (Doutora em Tecnologia de Alimentos) - Faculdade e
Engenharia de Alimentos UNICAMP.

PASSOS, M. H. C. R.; KUAYE, A. Y. Influence of the formulation, cooking time and final internal temperature of beef
hamburgers on the destruction of Listeria monocytogenes. Food Control, Oxford, v. 13, n.1 , jan., 2002.

PATARO, C. Comunidade de leveduras associadas com a fermentação espontânea durante a produção da cachaça de
alambiques de Minas Gerais. Belo Horizonte, Instituto de Ciências Biológicas da UFMG, 2000. (Tese, Doutorado).

PATARO, C.; GUERRA, J.B.; PETRILLO-PEIXOTO, M.L.; MENDONÇA-HAGLER, L.C.; LINARDI, V.R.; ROSA,
C.A. Yeast communities and genetic polymorphism of Saccharomyces cerevisiae strains associated with artisanal
fermentation in Brazil. J. Appl. Microbiol., v. 89, p. 24-31, 2000.

PATIDAR, S.K.; PRAJAPATI, J.B.; DAVE, R.I. Standardization and evakuation of acidophilus lassi. 24th Inter. Dairy
Congress, Melbourne, Australia, sept. 18-22, 1994.

PECQUET, S.; GUILLAUMIN, D.; TANCREDE, C.; ANDREMONT, A. Kinetics of Saccharomyces cerevisiae
elimination from the intestines of human volunteers and effect of this yeast on resistance to microbial colonization in
gnotobiotic mice. Appl. Environ. Microbiol., v. 57, p. 3049-3051, 1991.

PELLEGRINO,F.L.; TEIXEIRA,L.M.; CARVALHO MD,M.G.; ARANHA,N.S.; PINTO,D.O.; MELLO


SAMPAIO,J.L.; D'AVILA,F.A.; FERREIRA,A.L.; AMORIM ED,E.L.; RILEY,L.W.; MOREIRA,B.M. -Occurrence of
a multidrug-resistant Pseudomonas aeruginosa clone in different hospitals in Rio de Janeiro, Brazil. J. Clin. Microbiol.,
40: 2420-4, 2002.

PENNA, F.J.; FILHO, L.A.P.; CALÇADO, A.C.; JUNIOR, H.R.; NICOLI, J.R. Bases experimentais e clínicas atuais
para o emprego dos probióticos. Jornal de Pediatria. v.76, supl. 2, p.209-217, 2000.

PERAPOCH, J.; PLANES, A.M.; QUEROL, A.; LOPEZ, V.; MARTINEZ-BENDAYAN, I.; TORMO, R.;
FERNANDEZ, F.; PEGUERO, G.; SALCEDO, S. Fungemia with Saccharomyces cerevisiae in two newborns, only one
of whom had been treated with ultra-levura. Eur. J. Clin. Microbiol. Infect. Dis., v. 19, p. 468-470, 2000.

PERDIGON, G.; ALVAREZ, S.; RACHID, M.; AGÜERO, G.; GOBBATO, N. Immune system stimulation by
probiotics. J. Dairy Sci., v. 78, p. 1597-1606, 1995.

PERDIGON, G.; VALDEZ, J.G.; RACHID, M. Antitumor activity of yogurt: study of possible immune mechanisms. J.
Dairy Res., v. 65, p. 129-138, 1998.

PERDOMO, J.J.; CAVAILLON, J.M.; HUERRE, M.; OHAYON, H.; GOUNON, P.; SANSONETTI, P.J. Acute
inflammation causes epithelial invasion and mucosal destruction in experimental shigellosis. J. Exp. Med., v. 180, p.
1307-1319, 1994a.

PERDOMO, J.J.; GOUNON, P.; SANSONETTI, P.J. Polymorphonuclear leukocyte transmigration promotes invasion
of colonic epithelial monolayer by Shigella flexneri. J. Clin. Invest., v. 93, p. 633-643, 1994b.
PEREIRA, D.I.A.; GIBSON, G.R. Cholesterol assimilation by lactic acid bacteria and bifidobacteria isolated from the
human gut. Appled and Environmental Microbiology, 68, n.9, p.4689-4693, Sept. 2002.

PEREIRA, K. S.; PEREIRA, J. L. Estafilococos coagulase negativa: potenciais patógenos em alimentos. Revista
Higiene Alimentar, São Paulo, v. 19, n. 129, p. 32-34, mar., 2005.

PEREIRA, K. S.; PEREIRA, J. L. Estafilococos coagulase negativa: potenciais patógenos em alimentos. Revista
Higiene Alimentar, São Paulo, v. 19, n. 129, p. 32-34, mar., 2005.

PEREIRA, M.L. et al. Enumeração de coliformes fecais e presença de Salmonella sp. em queijo Minas. Arquivo
Brasileiro de Medicina Veterinária e Zootecnia, v. 51, n. 5, p. 427-431, 1999.

PEREIRA, M. L.; CARMO, L. S.; SANTOS, E. J.; PEREIRA, J. L.; BERGDOLL, M. S. Enterotoxin H in
staphylococcal food poisoning. Journal of Food Protection,
Des Moines, v. 59, n. 5, p. 559-561, May, 1996.

PEREIRA, M. L.; CARMO, L. S.; SANTOS, E. J.; PEREIRA, J. L.; BERGDOLL, M. Enterotoxin H in staphylococcal
food poisoning. Journal of Food Protection, Des Moines, v.59, n. 5, p. 559-561, May, 1996.

PEREIRA, M. L.; CASTELOIS, M. C. A.; BASTOS, E. M. A. F.; CAIAFFA, W. T., FALEIRO, E. S. C. Enumeração de
coliformes fecais e presença de Salmonella sp. em queijo Minas. Arquivo Brasileiro de Veterinária e Zootecnia, Belo
Horizonte, v. 51, n. 5, p. 427-431, out., 1999.

PEREIRA, M. L.; CASTELOIS, M. C. A.; BASTOS, E. M. A. F.; CAIAFFA, W. T., FALEIRO, E. S. C. Enumeração de
coliformes fecais e presença de Salmonella sp. em queijo Minas. Arquivo Brasileiro de Veterinária e Zootecnia, Belo
Horizonte, v 51, n. 5, p. 427-431, out., 1999.

PEREIRA, M. L.; CARMO, J. S.; PEREIRA, J. L. Comportamento de Staphylococcus coagulase negativos


pauciprodutores de enterotoxinas, em alimentos experimentalmente inoculados. Ciência e Tecnologia de Alimentos,
Campinas, v. 21, n. 2, p. 171-175, maio/ago., 2001.

PEREIRA, M. L.; CARMO, J. S.; PEREIRA, J. L. Comportamento de estafilococos coagulase negativos


pauciprodutores de enterotoxinas, em alimentos experimentalmente inoculados. Ciência e Tecnologia de Alimentos,
Campinas, v. 21, n. 2, p. 171-175,maio/ago., 2001.

PEREIRA, M. L.; CARMO, J. S.; PEREIRA, J. L. Comportamento de Staphylococcus coagulase negativos


pauciprodutores de enterotoxinas, em alimentos experimentalmente inoculados. Ciência e Tecnologia de Alimentos,
Campinas, v. 21, n. 2, p. 171-175, maio/ago., 2001.

PEREIRA, M. L.; CARMO, L. S.; SANTOS, E. J.; PEREIRA, J. L.; BERGDOLL, M. S. Enterotoxin H in
staphylococcal food poisoning. Journal of Food Protection, Des Moines, v.59, n. 5, p. 559-561, May, 1996.

PEREIRA, M. L.; GASTELOIS, M. C. A.; BASTOS, E. M. A. F.; CAIAFFA, W. T.; FALEIRO, E.S.C. Enumeração de
coliformes fecais e presença de Salmonella sp. em queijo Minas. Arquivo Brasileiro de Medicina Veterinária e
Zootecnia, Belo Horizonte [on line], v. 51, n.5, 427-431., out., 1999. Disponível na World Wide Web:
<http://www.scielo.br>.

PERET FILHO, L.A.; PENNA, F.J.; BAMBIRRA, E.A.; NICOLI, J.R. Dose effect of oral Saccharomyces boulardii
treatments on morbidity and mortality in immunosuppressed mice. J. Med. Microbiol., v. 47, p. 111-116, 1998.

PEREZ, E.F.J. et al. Indigenous lactic acid bacteria in Idiazabal ewes’ milk cheese. International Dairy Journal, v. 8, n.
8, p. 725-732, 1998.

PÉREZ, P.F.; KOCIUBINSKI, G.; GÓMES, ZAVAGLIA, A.; BIBILONI, R.; MINNAARD, J.; DISALVO, E.A.;
ANTONI, G.L. de Bifidobacteria from human origem: isolation, characterization and study of selected properties. 1999.

PEREZ, R. M. Perfil sensorial, físico-químico e funcional de queijo de coalho comercializado no município de


Campinas - SP. 2005. 122p. Dissertação (Mestre em Tecnologia de Alimentos) – Departamento de tecnologia de
Alimentos, Universidade Estadual de Campinas, Campina, 2005.

PEREZ, R. M. Perfil sensorial, físico-químico e funcional de queijo de coalho comercializado no município de


Campinas - SP. 2005. 122p. Dissertação (Mestre em Tecnologia de Alimentos) – Departamento de tecnologia de
Alimentos, Universidade Estadual de Campinas, Campina, 2005.
PERESI, J. T. M.; GRACIANO, R. A. S.; ALMEIDA, I. A. Z. C. de; LIMA S. I. de; RIBEIRO, A. K.; CARVALHO, I.
S. de; LIMA, M. de. Queijo Minas tipo Frescal artesanal e industrial. Qualidade microscópica, microbiológica e teste de
sensibilidade aos agentes antimicrobianos. Revista Higiene Alimentar, São Paulo, v. 15, n. 83, p.63-70, abr. 2001.

PERSI, J. T. M. Queijo Minas tipo frescal artesanal e industrial: qualidade microscópica, microbiológica e teste de
sensibilidade aos agentes antimicrobianos. Revista Higiene Alimentar, São Paulo, v. 15, n. 83, p.63-70, abr., 2001.

PETTERSSON, L.; GRAF, W.; SEVELIN, V. Survival of Lactobacillus acidophilus NCDO 1748 in the human
gastrointestinal tract. 2. Ability to pass the stomach and intestine in vivo. p. 127. In: Nutrition and the Intestinal Flora.
HALLGREN, B. (Ed). Symp. Swed. Nutr. Found. XV, Almqvist and Wiksell, Uppsala, Sweden, 1985.

PFALLER,M.A.; ACAR,J.; JONES,R.N.; VERHOEF,J.; TURNIDGE,J.; SADER,H.S. - Integration of molecular


characterization of microorganisms in a global antimicrobial resistance surveillance program. Clin. Infect. Dis., 32
Suppl 2: S156-S167, 2001.

PFALLER,M.A.; HOLLIS,R.J.; SADER,H.S. -Molecular Biology -PFGE Analysis of Chromossomal Restriction


Fragments. In: ISENBERG H.D. -Clinical Microbiology Procedures Handbook. ASM Press ed. Washington, ASM
Press, 1992. p.p.10.5.c.1-p.10.5.c.11.

PFALLER,M.A.; WENDT,C.; HOLLIS,R.J.; WENZEL,R.P.; FRITSCHEL,S.J.; NEUBAUER,J.J.; HERWALDT,L.A.


-Comparative evaluation of an automated ribotyping system versus pulsed-field gel electrophoresis for epidemiological
typing of clinical isolates of Escherichia coli and Pseudomonas aeruginosa from patients with recurrent gram-negative
bacteremia. Diagn. Microbiol. Infect. Dis., 25: 1-8, 1996.

PHILPOTT, D.J.; EDGEWORTH, J.D.; SANSONETTI, P.J. The pathogenesis of Shigella flexneri infection: lessons
from in vitro and in vivo studies. Phil. Trans. R. Soc. Lond., v. 355, p. 575-586, 2000.

PIMBLEY, D. W.; PATEL, P. D. A review of analytical methods for the detection of bacterial toxins, Journal of Applied
Microbiology Symposium Supplement, London, v. 84, n. S1, p. 98S-109S, July, 1998.

PIMENTEL, F.E. et al. Presença de Staphylococcus sp. enterotoxigênico e de enterotoxinas em queijo ralado. Revista
do Instituto de Laticínios Cândido Tostes, v. 57, n. 327, p. 227-229, 2002.

PINI, P. N.; GILBERT, R. J. The ocorrence in the U.K. of Listeria species in raw chickens and soft cheeses.
International Journal of Food Microbiology, Amsterdam, v. 6, n. 4, p. 317-326, jun. 1988.

PINTADO, C. M. B. S.; OLIVEIRA, A.; PAMPULHA, M. E.; FERREIRA, M. A. S. S. Prevalence and characterization
of Listeria monocytogenes isolated from soft cheese. Food Microbiology, Amsterdam v. 21, n. 2, p. 213-216, Apr.,
2004.

PINTO, A. T.; BERGMANN, G. P. Fatores predisponentes da ocorrência de enfermidades transmitidas por alimentos.
Revista Higiene Alimentar, São Paulo, v. 104/105, n. 17, p. 153-154, jan./fev., 2003.

PINTO, M. S.; MARTÍNS, J. M.; ARAÚJO, R. A. B. M.; PIRES, A. C. S.; DUARTE, G. K.; CUNHA, L. R;
FURTADO, M. M.; FERREIRA, C. L. L. F. Diagnóstico sócio-econômico e cultural dos produtores e avaliação
microbiológica do queijo minas artesanal da região do Serro – MG. Revista do Instituto de laticínios Cândido Tostes,
Juiz de Fora, v. 59, n. 339, p. 86-92, jul./ago., 2004.

PINTO, M. S. Diagnóstico socioeconômico, cultural e avaliação dos parâmetros químicos e microbiológicos do queijo
artesanal do Serro – MG. 2004. 158p. Dissertação (Mestre em Ciência etecnologia de Alimentos) – Departamento de
tecnologia de Alimentos, Universidade Federal de Viçosa, Viçosa, 2004.

PINTO, P. S. A.; GERMANO, M. I. S.; GERMANO, P. M. L. Queijo Minas: problema emergente de saúde pública.
Higiene Alimentar, São Paulo, v. 10, n. 44, p.22-27, ago., 1996.

PLAYNE, M.J. Probiotic Foods. The Food Industry Conference Food Pro 93, International Food Processing Machinery
and Technology Exhibition and Conference. Sydney, 12-14 July, 1993.

POCHART, P.; DEWIT, O.; DESJEUX, J.F.; BOURLIOX, P. Viable starter culture b-galactosidase activity and lactose
in duodenum after yoghurt ingestion in lactosedeficient humans. Am. J. Clin. Nutr., v. 49, p. 828, 1989.

POCHART, P.; MARTEAU, P.; BOUHNIK, Y.; GODEREL, I.; BOURLIOUX, P.; RAMBAUD, J.C. Survival of
bifidobacteria ingested via fermented milk during their passage through the human small intestine: an in vivo study
using intestinal perfusion. American Journal of Clinical Nutrition, v. 55, n. 1, p. 78-80, 1992.

PLEASANTS, J.R. Gnotobiotics. In: MELBY Jr, E.C.; ALTMANN, N.H. Handbook of Laboratory Animal Science.
Cleveland, CRC press, p. 119-174, 1974.

PLETINCX, M.; LEGEIN, J.; VANDENPLAS, Y. Fungemia with Saccharomyces boulardii in a 1-year-old girl with
protracted diarrhea. J. Pediatr. Gastroenterol. Nutr., v. 21, p. 113-115, 1995.

PONGPECH, P.; HENTGES, D.J. Inhibition of Shigella sonnei and enterotoxigenic Escherichia coli by volatile fatty
acid in mice. Microb. Ecol. Health Dis., v. 2, p. 153-161, 1989.

POT, B.; HERTEL, C.; LUDWIG, W.; DESCHEEMAEKE, P.; KERSTERS, K.; SCHLEIFER, K-H. Identification and
classification of Lactobacillus acidophilus, L. gasseri and L.johnsonii strains by SDS-PAGE and rRNA-targeted
oligonucleotide probe hybridization. Journal of General Microbiology, v. 139, p. 513-517, 1993.

POT, B.; LUDWING, W.; KERSTERS, K.; SCHLEIFER, K.-H. Taxonomy of lactic acid bacteria. In: DE VUYST, L.;
VANDAMME, E.J. (Eds.), Bacteriocins of Lactic Acid Bacteria, Microbiology, Genetics andApplications. Chapman &
Hall, London, UK, pp. 13-90, 1994.

POTES, M.E.; MARINHO, A. Variabilidade microbiológica do queijo produzido na região de Évora durante o processo
de maturação. Revista Portuguesa de Ciências Veterinárias, v. 97, n. 527, p. 154-160, 1998.

POTHOULAKIS, C.; KELLY, C.P.; JOSHI, M.A.; GAO, N.; O'KEANE, C.J.; CASTAGLIUOLO, I.; LAMONT, J.T.
Saccharomyces boulardii inhibits Clostridium difficile toxin A binding and enterotoxicity in rat ileum.
Gastroenterology, v. 104, p. 1108-1115, 1993.

POTHOULAKIS, C. Pathogenesis of Clostridium difficile-associated diarrhea. Eur. J. Gastroenterol. Hepatol., v. 8, p.


1041-1047, 1996.

POUPARD, J.A.; HUSSAIN, I.; NORRIS, R. Biology of the bifidobacteria. Bacteriological Reviews, v. 37, n. 2, p. 136-
165, 1973.

PRADO, C.S., et al. Atividade antimicrobiana de bactérias lácticas de embutidos curados frente a Listeria
monocytogenes. Arquivo Brasileiro de Medicina Veterinária e Zootecnia, v. 52, n. 4 p. 417-423, 2000.

PRAJAPATI, J.B. & DAVE, R.I. Associative growth of L. acidophilus and S. thermophilus in buffalo milk. 24th Inter.
Dairy Congress, Melbourne, Australia, sept. 18-22, 1994.

PRASAD, J., GILL, H., SMART, J. & GOPAL, P.K. Selection and characterization of Lactobacillus and
Bifidobacterium strains for use as probiotics. Int.dairy Journal 8:993-1002, 1998.

PRIEST, F.; AUSTIN, B. Modern Bacterial Taxonomy. 2nd. ed. Chapman & Hall. 1993.

PRIEST, F.G.; BARBOUR, E.A. Numerical taxonomy of lactic acid bacteria and some related taxa. In:
GOODFELLOW, M.; JONES, D.; PRIEST, F.G., eds. Computer Assisted Bacterial Systematics. London, Academic
Press, 1985, p. 137- 164.

PRITCHARD, T. J.; FLANDERS, K. J.; DONELLY, C. W. Comparison of incidence of Listeria on equipment versus
environmental sites within dairy processing plants. International Journal of Food Microbiology, Amsterdam, v. 26, n. 3
p. 375-384, Aug., 1995.

PRZYREMBEL, H. Consideration of possible legislation within existing regulatory frameworks. The American Journal
of Clinical Nutrition, v. 73, p. 471S-475S, 2001.

PUPO, G.M.; KARADIS, D.K.R.; LAN, R.; REEVES, P.R. Evolutionary relationships among pathogenic and non-
pathogenic Escherichia coli strains inferred from multilocus enzyme electrophoresis and mdh sequence studies. Infect.
Immun., v. 64, p. 2685-2692, 1997.

PUSEY, P.L. Effect of nectar on microbial antagonists evaluated for use in control of fire blight of pome fruits.
Physiopathology, v. 89, n. 1, p. 39-49, 1999.

QAMAR, A.; ABOUDOLA, S.; WARNY, M.; MICHETTI, P.; POTHOULAKIS, C.; LAMONT, J.T.; KELLY, C.P.
Saccharomyces boulardii stimulates intestinal immunoglobulin A immune response to Clostridium difficile toxin A in
mice. Infect. Immun., v. 69, p. 2762-2765, 2001.

QUEIROZ, D.M.M.; MENDES, E.N.; TOLEDO, M.R.F.; TRABULSI, L.R. Identification of a new enteroinvasive
Escherichia coli strain. Res. Microbiol., v. 141, p. 703-706, 1990.

RESOLUÇÃO RDC 02 de 07/01/02. Regulamento técnico de substâncias bioativas e probióticas isolado com alegação
de propriedade funcional e/ou de saúde. Agência Nacional de Vigilância Sanitária (ANVISA), Ministério da Saúde,
D.O.U. de 09/01/2002.

RAIMUNDO, I. de C.; VALLE, R. H. P.; ABREU, L. R.; FIORINI, E. Avaliação microbiológica de ricotas
comercializadas no município de Alfenas – MG. In: Congresso Brasileiro de Ciência e Tecnologia de Alimentos, 18.,
2002, Porto Alegre. Anais. Porto Alegre: Sociedade Brasileira de Ciência e Tecnologia de Alimentos – SBCTA. (ISBN:
85-8912301-4). CD-ROM.

RAMARE, F.; NICOLI, J.R.; DABARD, J.; CORRING, T.; LADIRE, M.; GUEUGNEAU, A.M.; RAIBAUD, P.
Trypsin-dependent production of an antibacterial substance by a human Peptostreptococcus strain in gnotobiotic rats
and in vitro. Appl. Environ. Microbiol., v. 59, p. 2876-2883, 1993.

RAMBACH, A. New plate medium for facilitated differentiation of Salmonella spp from Proteus spp and other enteric
bacteria. Applied and Environmental Microbiology, Washington, v. 56, n. 1, p.301-303, jan., 1990.

RAMOS E SILVA, E.O.T.; PANETTA, J.C.; ISHIZUKA, M.M. Efeito microbicida da fase de filagem, durante a
fabricação de "Mozzarella" elaborada com leite cru de búfala. Higiene Alimentar, v. 13, n. 59, p. 28-34, 1999

RAMOS, S. N. M.; COSTA, C. A. Ocorrência de Listeria monocytogenes em queijo artesanal tipo coalho
comercializado na cidade de Manaus – MA, Brasil. Acta Amazônica, Manaus, v. 33, n. 4, p. 613-618, out./dez., 2003.

RAPINI, L.S. et al. Pesquisa de Salmonella sp., Escherichia coli, Listeria sp. e Staphylococcus sp. e detecção de
enterotoxinas em queijo tipo coalho. In: Anais do XIX Congresso Nacional de Laticínios. Juiz de Fora, MG, p. 61-65,
2002.

RAPINI, L. C.; FEIJÓ, L. D.; VERAS, J. F.; NASCIMENTO, K. F.; AMADO, J. B.; COUTO, I. P.; CARMO, L. S.;
SILVA, M. C. C.; CERQUEIRA, M. M. O. P. Pesquisa de Salmonella sp., Escherichia coli, Listeria sp. e
Staphylococcus sp. e detecção de enterotoxinas estafilocócicas em queijo de coalho. Revista do Instituto de Laticínios
Cândido Tostes, Juiz de Fora, v. 57, n. 327, p. 60-65, jul./ago, 2002.

RAPINI , L. S.; FEIJÓ, L. D.; VERAS, J. F.; NASCIMENTO, K. F.; AMADO, J. B.; COUTO, I. P.; CARMO, L. S.;
SILVA, M. C. C.; CERQUIRA, M. M. O. P. Pesquisa de Salmonella sp., Escherichia coli, Listeria sp. e Staphylococcus
sp. e detecção de enterotoxinas estafilocócicas em queijo tipo coalho. Revista do Instituto de laticínios Cândido Tostes,
Juiz de Fora, v. 57, n. 327, p. 60-65, jul./ago., 2002.

RAPINI, L. S.; FEIJÓ, L. D.; VERAS, J. F.; NASCIMENTO, K. F.; AMADO, J. B.; COUTO, I. P.; CARMO, L. S.;
SILVA, M. C. C.; CERQUIRA, M. M. O. P. Pesquisa de Salmonella sp., Escherichia coli, Listeria sp. e Staphylococcus
sp. e detecção de enterotoxinas estafilocócicas em queijo tipo coalho. Revista do Instituto de laticínios Cândido Tostes,
Juiz de Fora, v. 57, n. 327, p. 60-65, jul./ago., 2002.

RASIC, J. L. Cultured media for detection and enumeration of bifidobacteria in fermented milk products. Bull. Int.
Dairy Fed., n. 252, p. 24-34, 1990.

RASIC, J.L.; KURMAN, J.A. Bifidobacteria and Their Role. Basel:Birklhäuser Verlag, 1983, 295p.

RASIC, J.L. Nutritive value of yogurt. Cultured Dairy Prod.J., v.22, p. 6-9, 1987.

RASIC, J.L.; KURMAN, J.A. In: Bifidobacteria and Their Roles. Experientia Suppl. 39, ed. Birkhäuser Verlag, Basel,
Switzerland, Boston, MA, Stuttgart, Germany, 1983, 295p.

RATTANACHAIKUNSOPON, P.; PLUMKHACHOM, P. A bacteriocin produced by Lactobacillus lactis subsp. lactis


isolated from thai fermented foods. ScienceAsia. v.26, p.195-200, 2000.

RATNAM, S.; STRATTON, F.; O’KEEFE, C.; ROBERTS, A.; COATES, R. Salmonella Enteritidis outbreak due to
contaminated cheese – Newfoundland. Canada communicable Disease Report, Ottawa, v. 25, n. 3, p. 17-19, Feb.,
1999.
RAUTAVA, S.; ISOLAURI, E. The development of gut immune responses and gut microbiota: effects of probiotics in
prevention and treatment of allergic disease. Curr. Issues Intest. Microbiol., v. 3, p. 15-22, 2002.

RAUTIO, M.; JOUSIMIES-SOMER, H.; KAUMA, H.; PIETARINEN, I.; SAXELIN, M.; TYNKKYNEN, S.;
KOSKELA, M. Liver abscess due to a Lactobacillus rhamnosus strain indistinguishable from L. rhamnosus strain GG.
Clin. Infect. Dis., v. 28, p. 1159-1160, 1999.

RAVULA, R.R.; SHAH, N.P. Selective enumeration of Lactobacillus casei from yogurt and fermented milk drinks.
Biotechnol. Tech., v. 12, p. 819-822, 1998a.

REIBNITZ, M.G.R.; TAVARES, L.B.B.; GARCIA, J.A. Presencia de coliformes fecales Escherichia coli y
Staphylococcus aureus coagulasa y DNAsa positivos en queso "colonial" comercializado en el Municipio de Blumenau,
Estado de Santa Catarina, Brasil. Revista Argentina de Microbiologia, v. 30, n. 1, p. 8-12, 1998.

REIBNITZ, M.; GARCÍA, T. L. J. Presencia de coliformes fecales, Escherichia coli y Staphylococcus aureus coagulase
y DNasa positivos en queso "colonial" comercializado en el municipio de Blumenau, Estado de Santa Catarina, Brasil.
Revista Argentina Microbiologia, Buenos Aires, v. 30, n. 1, p. 8–12, ENE./mar., 1998.

REID, G.; BRUCE, A.W. Low vaginal pH and urinary-tract infection. Lancet, v. 346, p. 8991-8992, 1995.

REID, G. Probiotic therapy and functional foods for prevention of urinary tract infections: state of the art and science.
Curr. Infect. Dis. Rep., v. 2, p. 518-522, 2000.

REID, G. Probiotic agents to protect the urogenital tract against infection. Am. J. Clin. Nutr., v. 73, p. 437S-443S, 2001.

REID, G.; BRUCE, A.W.; FRASER, N.; HEINEMANN, C.; OWEN, J.; HENNING, B. Oral probiotics can resolve
urogenital infections. FEMS Immunol. Med. Microbiol., v. 30, p. 49-52, 2001.

REID, G. Testing the efficacy of probiotics. In: Probiotics a Critical Review, pp. 129-140. G.W. TANNOCK, ed.
Horizon Scientific Press, Wymondham, 1999a

REIS, F.G., WOLF, B., LIMA, R.B., SANTOS, D.A., NEVES,.C.S., SALVA, T.J.G., MORENO, I., LERAYER, A.L.S.
Seleção de bactérias lácticas resistentes a sais biliares. Anais do XV Congresso Nacional de Laticínios. p.102-107,
1998.

REISER, R. F.; ROBBINS, R.N.; NOLETO, A. L.; KHOE, G.P.; BERGDOLL, M. S. Identification, purification, and
some physicochemical properties of staphylococcal enterotoxin C3. Infection and Immunity, Washington, v. 45, n. 3, p.
625-630, Sept., 1984.

REN, K.; BANNAN, J. D.; PANCHOLI, V.; CHEUNG, A. L.; ROBBINS, J. C.; FISCHETTI, V. A.; ZABRISKIE, J. B.
Characterization and biological properties of a new staphylococcal enterotoxin, The Journal Experimental of Medicine,
New York, v. 180, n. 5 , p. 1675-1683, Nov., 1994.

REN, K.; BANNAN, J. D.; PANCHOLI, V.; CHEUNG, A. L.; ROBBINS, J. C.; FISCHETTI, V. A.; ZABRISKIE, J. B.
Characterization and biological properties of a new staphylococcal enterotoxin, The Journal Experimental of Medicine,
New York, v. 180, n. 5, p. 1675-1683, Nov., 1994.

REN, T. J.; FRANK, F.J. Measurement of airborne contamination in two commercials ice cream plants. Journal of Food
Protection, Des Moines, v. 55, n. 1, p. 927-933, Jan., 1992.

RENNER, E.; ABD EL-SALAM, M. H. Application of ultrafiltration in the dairy industry. London: Elsevier science
publishiers, 1991. 371p.

REQUE , E.F. Isolamento, identificação e estudos fisiológicos da bactéria de ação probiótica (Lactobacillus fermentum
LPB) para uso em frangos de corte. Dissertação (Mestrado em Tecnologia Química); Universidade Federal do Paraná.
Curitiba, 1999.

REQUE, E.F.; PANDEY, A.; FRANCO, S.G.; SOCCOL, C.R. Isolation, identification and physiological study of
Lactobacillus fermentum LPB for use as probiotic in chickens. Brazilian Journal of Microbiology, v. 31, p. 303-307,
2000.

REUTER, G. Bifidobacteria cultures as components of yoghurt-like products. Bifidobacteria Microflora, v. 9, p. 107,


1990.

REUTER, G. Present and future of probiotics in Germany and in Central Europe. Bioscience and Microflora, v. 16, p.
43-51, 1997a.

REUTER, G. Vergleichende Untersuchunge über die Bifidus-Flora im Säuglingsund Erwachsenenstuhl. Zentralbl.


Bakteriol. Parasitenkd. Infektionskr. Hyg. Abt. 1 Orig. Reihe A, v.191, p.486-507, 1963.

RIBEIRO, H.JR. Diarrheal disease in a developing nation. Am. J. Gastroenterol., v. 95, p. S14-15, 2000.

RIBEIRO, M.J.S.; LEÃO, L.S.C.; MORAIS, P.B.; ROSA, C.A.; PANEK, A.D. Trehalose accumulation by tropical
yeast strains submitted to stress conditions. Antonie Van Leeuwenhoek, v. 75, p. 245-251, 1999.

RICHARD, V.; AUWERA, P.; SNOECK, R.; DANEAU, D.; MEUNIER, F. Nosocomial bacteremia caused by Bacillus
species. Eur. J. Clin. Microbiol. Infect. Dis., v. 7, p. 783-785, 1988.

RICHARDSON, D. Probiotics and products innovation. Nutrition and Food Science, v. 4, p. 27-33, 1996.

RIEGLER, M.; SEDIVY, R.; POTHOULAKIS, C.; HAMILTON, G.; ZACHERL, J.; BISCHOF, G.; COSENTINI, E.;
FEIL, W.; SCHIESSEL, R.; LAMONT, J.T. Clostridium difficile toxin B is more potent than toxin A in damaging
human colonic epithelium in vitro. J. Clin. Investig., v. 95, p. 2004-2011, 1995.

RIJNDERS, B.J.; VAN WIJNGAERDEN, E.; VERWAEST, C.; PEETERMANS, W.E. Saccharomyces fungemia
complicating Saccharomyces boulardii treatment in a non-immunocompromised host. Intensive Care Med., v. 26, p.825,
2000.

RILEY, M.A.; WERTZ, J.E. Bacteriocins: evolution, ecology and application. Annual Review of Microbiology, v. 56, p.
117-137, 2003.

RIJPENS, N. P.; HERMAN, L. M. F. Molecular methods for identification and detection of bacterial food pathogens.
Journal of AOAC International, Gaithersburg, v. 85, n. 4, p. 984- 995, Jun./July, 2002.

RIQUELME, A.J.; CALVO, M.A.; GUZMAN, A.M.; DEPIX, M.S.; GARCIA, P.; PEREZ, C.; ARRESE, M.;
LABARCA, J.A. Saccharomyces cerevisiae fungemia after Saccharomyces boulardii treatment in immunocompromised
patients. J. Clin. Gastroenterol., v. 36, p. 41-43, 2003.

RIUS, N.; SOLE, M.; FRANCIS, A.; LOREN, J.G. Buffering capacity and membrane H+ conductance of lactic acid
bacteria. FEMS Microbiol. Lett., v. 120, p. 291-296, 1994.

ROBBINS, R.; GOULD, S.; BERGDOLL, M.S. Detecting the enterotoxigenicity of Staphylococcus aureus strains.
Applied Microbiology, v. 28, n. 6, p. 946-950, 1974.

ROBERFROID, M.B. Prebiotics: preferential substrates for specific germs? Am. J. Clin. Nutr., v. 73, p. 406-409, 2001.

ROBINSON, R.K. Therapeutic properties of fermented milks. New York: Elsevier, 185p., 1991

ROBINS-BROWNE, R.M.; PATH, F.F.; MYRON, M.; LEVINE, D.T.P.H. The fate of ingested lactobacilli in the
proximal small intestine. Am. J. Clin. Nutr., v. 34, p. 514, 1981.

ROBINSON, R.K. Survival of Lactobacillus acidophilus in fermented products. Suid Afrikaanse Tydskrif Suiwelkunde.
v. 19, p. 25-27., 1987.
RODGERS, S. Preserving non-fermented refrigerated foods with microbial cultures: a review. Food Sci. Technol.,v.12,
p.276-284, 2001.

ROCHA, J. A. K. Estudo da presença de Listeria monocytogenes e Bacillus cereus em indústria processadora de queijo
Minas frescal. 2004. 85p. Dissertação (Mestre em Tecnologia de Alimentos) – Departamento de Tecnologia de
Alimentos, Universidade Estadual de Campinas, 2004.

ROCOURT, J. Risk factores for listeriosis. Food Control, Oxford, v. 7, n. 4/5, p. 195-202, aug./out. 1996. Special issue.

RODRIGUES, Ana Cristina Persichini. Efeito de Saccharomyces boulardii contra os enteropatógenos Salmonella
enteritidis var. Typhimurium, Shigella flexneri e Escherichia coli enteroinvasora em camundongos NMRI gnotobióticos
e convencionais. Belo Horizonte, Instituto de Ciências Biológicas da UFMG, 1995. (Dissertação, Mestrado).
RODRIGUES, A.C.; NARDI, R.M.; BAMBIRRA, E.A.; VIEIRA, E.C.; NICOLI, J.R. Effect of Saccharomyces
boulardii against experimental oral infection with Salmonella typhimurium and Shigella flexneri in conventional and
gnotobiotic mice. J. Appl. Bacteriol., v. 81, p. 251-256, 1996.

RODRIGUES, A.C.; CARA, D.C.; FRETEZ, S.H.G.G.; CUNHA, F.Q.; VIEIRA, E.C.; NICOLI, J.R.; VIEIRA, L.Q.
Saccharomyces boulardii stimulates sIgA production and the phagocytic system of gnotobiotic mice. J. Appl.
Microbiol., v. 88, p. 1-12, 2000.

RODRIGUEZ, L.; NUNEZ, F.; CORDOBA, J. J.; BERMUDEZ, E.; ASNSIO, M. A. Gram-positive, catalase cocci
from dry cured Iberian ham and their enterotoxigenic potential. Applied and Environmental Microbiology, Washington,
v. 62, n. 6, p. 1897-1902, June, 1996.

RODRIGUEZ, L.; NUNEZ, F.; CORDOBA, J. J.; BERMUDEZ, E.; ASNSIO, M. A. Gram-positive, catalase cocci
from dry cured Iberiam ham and their enterotoxigenic potential. Applied and Environmental Microbiology, Washington,
v. 62, n. 6, p. 1897-1902, June, 1996.

RODTONG, S.; TANNOCK, G.W. Differentiation of Lactobacillus strains by ribotyping. Applied Environmental
Microbiology, v. 59, n. 10, p. 3480-3484, 1993.

ROISSART, H.; LUQUET, F.M. (Eds.) Bactéries Lactiques. Aspects fondamentaux et technologiques (v. 2), pp. 144-
146, France: Lorica, 1994.

ROLFE, R.D. Interactions among microorganisms of the indigenous intestinal flora and their influence on the host. Rev.
Infect. Dis., v. 6, p. S73-S79, 1984.

ROLFE, R.D. The role of probiotic cultures in the control of gastrointestinal health. J. Nutr., v. 130, p. 396S-402S,
2000.

ROSEC, J. P.; GUIRAUD, O. Staphylococcal enterotoxin genes of classical and new types detected by PCR in France.
International Journal of Food Microbiology, Amsterdam, v. 77, n. 1/2, p. 61-70, Jan./Feb. 2002.

ROSEC, J. P.; GUIRAUD, J. P.; DALET, C.; RICHARD, N. Enterotoxin production by staphylococci isolated from
foods in France. International Journal of Food Microbiology, Amsterdam, v. 35, n. 3, p. 213-221, Mar. 1997.

ROSEC, J. P.; GIGAUD, O. Staphylococcal enterotoxin genes of classical and new types detected by PCR in France.
International Journal of Food Microbiology, Amsterdam, v. 77, n. 1/2, p. 61-70, Jan./Feb. 2002.

ROSEC, J. P.; GUIRAUD, J. P.; DALET, C.; RICHARD, N. Enterotoxin production by staphylococci isolated from
foods in France. International Journal of Food Microbiology, Amsterdam, v. 35, n. 3, p. 213-221, Mar. 1997.

ROSEC, J. P.; GUIRAUD, J. P.; DALET, C.; RICHARD, N. Enterotoxin production by staphylococci isolated from
foods in France. International Journal of Food Microbiology, Amsterdam, v. 35, n. 3, p. 213-221, mar. 1997.

ROSS, R.P; MORGAN, S; HILL, C. Preservation and fermentation: past, present and future.International Journal of
Food Microbiology, v. 79, p. 3-16, 2002.

ROMLING,U.; FIEDLER,B.; BOSSHAMMER,J.; GROTHUES,D.; GREIPEL,J.; VON DER,H.H.; TUMMLER,B.


-Epidemiology of chronic Pseudomonas aeruginosa infections in cystic fibrosis. J. Infect. Dis., 170: 1616-21, 1994.

ROMLING,U. & TUMMLER,B. -Achieving 100% typeability of Pseudomonas aeruginosa by pulsed-field gel
electrophoresis. J. Clin. Microbiol., 38: 464-5, 2000.

ROSS, R. P.; STANTON, C.; HILL, C.; FITZGERALD, G. F.; COFFEY, A. Novel cultures for cheese improvement.
Trends in Food Science & Technology, New York, v. 11, n. 3, p.96-104, mar., 2000.

ROSSI, D.A. Isolamento, identificação e caracterização da biodiversidade de Lactobacillus helveticus isolados de soro-
fermento de laticínios brasileiros. 2001. 99f. Tese (Doutorado em Ciência dos Alimentos)-Universidade Federal de
Lavras, Lavras, 2001.

ROTIMI, V.O.; DUERDEN, B.I. The development of the bacterial flora in normal neonates. J. Med. Microbiol., v. 14,
p. 51-62, 1981.
ROUSHDY, I.M., EHRMANN, M.A., VOGEL, R.F. Molecular identification and characterization of halo-tolerant
lactic acid bacteria isolated from soft pickled Domiati cheese. Advances in Food Sciences, v. 20, n. 1-2, p. 40-45, 1998.

ROUSSEL, Y.; COLMIN, C.; SIMONET, J.M.; DECARIS, B. Strain characterisation, genome size and plasmid content
in Lb. acidophilus group (Hansen and Mocquot). Journal of Applied Bacteriology, v. 74, p. 549-556, 1993.

ROY, D., & WARD, P. Rapid detection of Bifidobacterium dentium by enzymatic hydrolysis of b-glucuronide
substrates. J. Food Prot., v.55, p. 291-295, 1992.

ROY, D.; BERGER, J.L.; REUTER, G. Characterization of dairy-related Bifidobacterium spp. based on their b-
galactosidase electrophoretic patterns. Int. J. Food Microbiol., v. 23, p. 55-70, 1994.

ROY, D.; DESJARDINS, M.L.; MONDOU, F. Selection of Bifidobacteria for use under cheese-making conditions.
Milchwisswenschaft, v. 3, p. 139-142, 1995.

ROY, D.; SIROIS, S. Molecular differentiation of Bifidobacterium especies with amplified ribosomal DNA restriction
analysis and alignment of short regions of the ldh gene. FEMS Microbiol. Lett., v.191, p.17-24, 2000.

ROY, D.; WARD, P.; CHAMPAGNE, G. Differentiation of bifidobacteria by use of pulsed-field gel electrophoresis and
polymerase chain reaction. International Journal of Food Microbiology, v. 29, p. 11-29, 1996.

RUDOLF, M.; SCHERER, S. High incidence of Listeria monocytogenes in European red smear cheese. International
Journal of Food Microbiology, Amsterdam, v. 63, n. 1/2, p. 91-98, jan. 2001.

RUDOLF, M.; SCHERER, S. Incidence of Listeria monocytogenes in European red smear cheese. International Journal
of Food Microbiology, Amsterdam, v. 63, n. 1-2 p. 91-98, Jan., 2001.

RYAN, E.T.; CALDERWOOD, S.B. Cholera vaccines. Clin. Infec. Dis., v. 31: 561-565, 2000.

RYBKA, S.; KAILASAPATHY, K. Media for the enumeration of yoghurt bacteria. Int. Dairy Journal., v. 6, p. 839-850,
1996.

RYBKA, S.;KAILASAPATHY, K. The survival of cultures bacteria in fresh and freeze-dried AB yoghurts. The
Australian Journal of Dairy Technology, v. 50, p. 51-57, 1995.

RYSER, E. T. Incidence and behaviour of Listeria monocytogenes in cheese and other fermented dairy products. In:
RYSER, E.; MARTH, E.H. (Ed.). Listeria, listeriosis and food safety. 2nd ed. New York: Marcel Dekker. 1999. Chap.
12, p. 411-358.

RYSER, E. T. Incidence and behaviour of Listeria monocytogenes in cheese and other fermented dairy
products. In: RYSER, E.; MARTH, E. H. (Ed.). Listeria, listeriosis and food safety. 2nd ed. New York: Marcel Dekker,
1999b. Chap. 12, p. 411-358.

RYSER, E. T.; MARTH, E. H. Listeria, listeriosis and food safety. 2. ed. New York: Marcel Dekker, 1999. Cap. 5, 738p.

SÃO PAULO. Comunicado Conjunto CVS / IAL nº 1/03 de 15 de janeiro de 2003. Tornam público os resultados do
Programa de Análise Fiscal de Alimentos – Programa Paulista 2002, instituído pelo Centro de Vigilância Sanitária em
conjunto com o Instituto Adolfo Lutz. Secretaria do Estado da Saúde. Diário Oficial, Estado de São Paulo, 01 fev. 2003,
seção 1. Suplemento.

SECRETARIA DE DEFESA AGROPECUÁRIA (SDA). Aprova o regulamento técnico de identidade e qualidade de


manteiga da terra, queijo de coalho e queijo de manteiga. Instrução Normativa n° 30 de 26 de junho de 2001.

SECRETARIA DE DEFESA AGROPECUÁRIA (SDA). Aprova o regulamento técnico de identidade e qualidade de


manteiga da terra, queijo de coalho e queijo de manteiga. Instrução Normativa n° 30 de 26
de junho de 2001. Diário Oficial da União. Brasília, DF, 16 jul. 2001a.

SECRETARIA DE DEFESA AGROPECUÁRIA (SDA). Aprova o regulamento técnico de identidade e qualidade de


manteiga da terra, queijo de coalho e queijo de manteiga. Instrução Normativa n° 30 de 26 de junho de 2001. Diário
Oficial da União. Brasília, DF, 16 jul. 2001a. Disponível em:
<http://200.252.165.21/sda/dipoa/instnorm30aiiirtqueijomanteiga.htm>. Acesso em: 28 jan. 2006.
SAARELA, M.; MOGENSEN, G.; FONDÉN, R.; MÄTTÖ, J.; MATILLA-SANDHOLM, T. Probiotic bacteria: safety,
functional and technological properties. Journal of Biotechnology, v. 84, p. 197-215, 2000.

SAAVEDRA, J.M. Microbes to fight microbes: a not so novel approach to controlling diarrheal disease. J. Pediatr.
Gastroenterol. Nutr., v. 21, p. 25-29, 1995.

SAAVEDRA, J.M. Probiotics and infectious diarrhea. The Americam Journal of Gastroenterology, v. 95, n. 1, p. S16-
18, 2000.

SABIKHI, L.; MATHUR, B.N.; SABIKHI, L. Probiotic cultures in dairy foods: a review. Indian Journal of Dairy
Science, v. 54, n. 4, p. 178-184, 2001.

SABIONI, J. G.; NASCIMENTO, D.; PEREIRA, J. L. Intoxicação estafilocócica causada por queijo tipo “Minas” em
Ouro Preto, Minas Gerais, 1992. Revista Higiene Alimentar, São Paulo, v. 8, n. 33, p. 22-23, jan., 1994.

SABIONI, J. G.; NASCIMENTO, D.; PEREIRA, J. L. intoxicação estafilocócica causada por queijo tipo “Minas” em
Ouro Preto, Minas Gerais, 1992. Revista Higiene Alimentar, São Paulo, v. 8, n. 33, p. 22-23, jan., 1994.

SABIONI, J. G.; MAIA, A. R. P. Correlação entre a população de Staphylococcus aureus e a atividade de


termonuclease em queijo Minas Frescal. Revista Higiene Alimentar, São Paulo, v. 12, n. 54, p. 13-17, mar./abr. 1998.

SABIONI, J. G.; HIROOKA, E.L.; SOUZA, M.L.R. Intoxicação alimentar por queijo “Minas” contaminado com
Staphylococcus aureus. Revista da Saúde Pública, São Paulo, v. 22, n. 5, p. 458-461, out., 1988.

SABIONI, J. G.; HIROOKA, E.L.; SOUZA, M.L.R. Intoxicação alimentar por queijo “Minas” contaminado com
Staphylococcus aureus. Revista da Saúde Pública, São Paulo, v. 22, n. 5, p. 458-461, 1988.

SABOYA, L.V.; OETTERER, M.; OLIVEIRA, A.J. Propriedades profiláticas e terapêuticas de leites fermentados –
uma revisão. Ciência e Tecnologia dos Alimentos, v. 31, n. 2, p. 176-185, 1997.

SADER,H.S.; HOLLIS,R.J.; PFALLER,M.A. -The use of molecular techniques in the epidemiology and control of
infectious diseases. Clin. Lab Med., 15: 407-31, 1995.

SADER,H.S.; PIGNATARI,A.C.; LEME,I.L.; BURATTINI,M.N.; TANCRESI,R.; HOLLIS,R.J.; JONES,R.N.


-Epidemiologic typing of multiply drug-resistant Pseudomonas aeruginosa isolated from an outbreak in an intensive
care unit. Diagn. Microbiol Infect. Dis., 17: 13-8, 1993.

SADZIKOWSKI, M.R.; SPERRY, J.F.; WILKINS, T.D. Cholesterol reducing bacterium from human feces. Appl.
Environ. Microbiol., v. 34, p. 355-362, 1977.

SAINT-MARC, T.; ROSSELLO-PRATS, L.; TOURAINE, J.L. Efficacy of Saccharomyces boulardii in the treatment of
diarrhea in AIDS (letter). Ann. Med. Intern., v. 142, p. 64-65, 1991.

SAKATA, S.; KITAHARA, M.; SAKAMOTO, M.; HAYASHI, H.; FUKUYAMA, M.; BENNO, Y. Unification of
Bifidobacterium infantis and Bifidobacterium longum. JSEM Paper in Press, Published online 14 march 2002.

SAKURAI, T.; HAJIRO, K.; TAKAKUWA, H. Liver abscess caused by Clostridium difficile. Scand. J. Infect. Dis., v.
33, p. 69-70, 2001.

SALMINEN, S.; ISOLAURI, E.; ONNELA, T. Gut flora in normal and disorders status. Chemotherapy, v. 41, p. 5-15,
1995.

SALMINEN, S.; DEIGHTON, M.A.; GORBACH, S. In: Lactic Acid Bacteria (SALMINEN, S. and VON WRIGHT,
A., EDS), p. 199-225, Marcel Dekker Inc., New York, 1993.

SALMINEN, S.; BOUSLEY, C.; BOUTRON-RUAULT, M.C.; CONTOR, L.; CUMMUNGS, J.; FRANCK,
A.;GIBSON, G.; ISOLAURI, E.; MOREAU, M.C.; ROBERFROID, M.; ROWLAND, I. Gastrointestinal physiology
and function: targets for functional food development. In: Functional Food Science in Europe, ILSI Europe,
Brussels,1997.

SALMINEN, S.; DEIGHTON, M.A.; BENNO, Y.; GORBACH, S.L. Lactic acid bacteria in health and disease. In:
SALMINEN, S., VON WRIGHT, A., Eds. Lactic acid bacteria: microbiology and functional aspects. 2nd ed. New York:
Marcel Dekker Inc, p. 211-54, 1998a
SALMINEN, S.; VON WRIGHT, A.; MORELLI, L.; MARTEAU, P.; BRASSART, D.; DE VOS, W.M.; FONDEN, R.;
SAXELIN, M.; COLLINS, K.; MOGENSEN, G.; BIRKELAND, S.E.; MATILA-SANDHOLM, T. Demonstration of
safety of probiotics – a review. International Journal of Food Microbiology, v. 44, p. 93-106, 1998b.

SALMINEN, S.; BOUSLEY, M.C.; BOUTRON-RUAULT, M.C. ; CUMMINGS, J.H.; FRANCK, A.;.
GIBSON, G.R.; ISOLAURI, E.; MOREAU, M.C.; ROBERFROID, M.; ROWLAND, I. Functional food science and
gastrointestinal physiology and function. Brit. J. Nutr., v. 80, p. 5147S-5171S, 1998c.

SALMINEN, S.; VON WRIGHT, A. Lactic acid bacteria. New York: Marcel Dekker, 442 p., 1993.

SALTIJERAL, J. A.; ALVAREZ, V. B.; GARCIA, B. Presence of Listeria in Mexican cheeses. Journal of Food Safety,
Trumbull, v. 19, n. 4, p. 241-247, Dec., 1999.

SALTIJERAL, J. A.; ALVAREZ, V. B.;GARCIA, B. Presence of Listeria monocytogenes in Mexican cheeses. Journal
of Food Safety, Trumbull, v.19, n. 4, p. 241-247, dec. 1999.

SALUSTIANO, V. C.; ANDRADE, N.J.; BRANDÃO, S. C. C.; AZEREDO, R. M. C.; LIMA, S. A. K.


Microbiological air quality of processing areas in a dairy plant as evaluated by the sedimentation technique and a one-
stage air sampler. Brazilian Journal of Microbiology, São Paulo, v. 34, n. 2, 255-259, Apr./June, 2003.

SALYERS, A.A.; WHITT, D.D. Bacterial Pathogenesis: A Molecular Approach. Washington D.C., ASM Press, 1994.

SAMPAIO, I.B.M. Estatística aplicada à experimentação animal. Belo Horizonte: UFMG, 221 p., 1998.

SAMONA, A.; ROBINSON, R.K. Effect of yogurt cultures on the survival of bifidobacteria in fermented milks. J. Soc.
Dairy Technol., v. 47, p. 58-60, 1994.

SANDERS, M.E. Summary of conclusions from a concensus panel of experts on health attributes of lactic cultures:
significance of fluid milk products containing cultures. J. Dairy Sci., v. 76, p. 1819-1828, 1993.

SANDERS, M.E.; HUIS IN’T VELD, J. Bringing a probiotic-containing functional food to the market: microbiological,
product, regulatory and labeling issues. Antonie Van Leewenhoek International Journal of General and Molecular
Microbiology, v. 76, p. 293-315, 1999.

SANDERS, M.E., WALKER, D.C., WALKER, K.M., AOYAMA, K., KLAENHAMMER, T.R. Performance of
commercial culture in fluid milk applications. J. Dairy Sci., v.79, p. 943-955, 1996.

SANDERS, M.E.; WALKER, D.C.; WALKER, K.M.; AOYAMA, K.; KLAENHAMMER, T.R. Performance of
commercial cultures in fluid milk pplications. J. Dairy Sci., v. 79, p. 943-955, 1996.

SANDVIG, K. Shiga toxins. Toxicon, v. 39, p. 1629-1635, 2001.

SANSONETTI, P.J.; ADAK, G.K; LEVINE, M.M. Global burden of Shigella infections: implications for vaccine
development and implementation of control strategies. W HO Bull., v. 77, p. 651-666, 1999.

SANTOS, F. A.; NOGUEIRA, N. A. P.; CUNHA, G. M. A. Aspectos microbiológicos do queijo tipo coalho
comercializado em Fortaleza – Ceará. Boletim do Centro de Pesquisa e Processamento de Alimentos, Curitiba, v. 13, n.
1, p. 31-61 jan./jun., 1995.

SAREM-DAMERDJII, L.-O.; SAREM, F.; MARCHAL, L.; NICOLAS, J.-P. In vitro colonization ability of human
colon mucosa by exogenous Lactobacillus strains. FEMS Microbiol. Lett., v. 131, p. 133-137, 1995.

SARKER, M.R.; CARMAN, R.J.; MCCLANE, B.A. Inactivation of the gene (cpe) encoding Clostridium perfringens
enterotoxin eliminates the ability of two cpe-positive C. perfringens type A human gastrointestinal disease isolates to
affect rabbit ileal loops. Mol. Microbiol., v. 33, p. 946-958, 1999.

SARKER, M.R.; SHIVERS, R.P.; SPARKS, S.; JUNEJA, V.K.; MCCLANE, B.A. Comparative experiments to
examine the effects of heating on vegetative cells and spores of Clostridium perfringens isolates carrying plasmid
versus chromosomal enterotoxin genes. Appl. Environ. Microbiol., v. 66, p. 3234-3240, 2000.

SARTOR, R.B. Microbial factors in Crohn’s disease, ulcerative colitis and experimental intestinal inflammation, p. 96-
124, 1995. In KIRSTNER, J.B.; SHORTER, R.G. (ed.). The Inflammatory Bowel Disease, 4. ed. The Williams &
Wilkins Co., Baltimore, Md.

SAVAIANO, D.A.; ABDELHAK, A.; ABOUEL-ANOUAR, D.A.G.; SMITH, D.E.; LEVITT, M.D. Lactose
malabsorption from yogurt, pasteurized yogurt, sweet acidophilus milk, and cultured milk in lactase-deficient
individuals. Am. J. Clin. Nutr., v. 40, p. 1219-1223, 1984.

SAVAGE, D.C. Microbial ecology of the gastrointestinal tract. Annu. Rev. Microbiol., v. 31, p. 107-133, 1977.

SAVAGE, D.C. Microbial ecology of the gastrointestinal tract. Annu. Rev. Microbiol., v. 31, p. 107-133, 1977.

SAVAGE, D.C. Factors influencing biocontrol of bacterial pathogens in the intestine. Food Technol., v. 7, p. 82-87,
1987.

SAVAGE, D.C. Mucosal Microbiota, 1999. In Mucosal Immunology. OGRA, P.L.; MESTECKY, J.; LAMM, M.E.;
STROBER, W.; BIENENSTOCK, J.; MCGHEE, J.R. (Eds). San Diego: Academic Press, p. 19-30.

SAVIDGE, T.C.; PAN, W.H.; NEWMAN, P., O'BRIEN, M., ANTON, P.M.; POTHOULAKIS, C. Clostridium difficile
toxin B is an inflammatory enterotoxin in human intestine. Gastroenterology, v. 125, p. 413-420, 2003.

SAXELIN, M.; PESSI, T.; SALMINEN, S. Fecal recovery following oral administration of Lactobacillus strain GG
(ATCC 53103) in gelatine capsules to healthy volunteers. Int. J. Food Microbiol., v. 25, p. 199-203, 1995.

SAXELIN, M.; RAUTELIN, H.; SALMINEN, S.; MAKELA, P.H. Safety of commercial products with viable
Lactobacillus strains. Infect. Dis. Clin. Pract., v. 5, p. 331-335, 1996.

SCARPIGNATO, C.; RAMPAL, P. Prevention and treatment of traveler’s diarrhea: a clinical pharmacological
approach. Chemotherapy, v. 41, p. 48-81, 1995.

SCARDOVI, V. Genus Bifidobacterium Orla-Jensen 1924, 472AL. Page 14181434 In: SNEATH, P.H.A.; MAIR, N.S.;
SHARPE, M.E.; HOLT, J.G. (eds), Bergey’s Manual of Systematic Bacteriology. v. 2. Williams & Wilkins, Baltimore,
MD, 1986.

SCARDOVI, V. The Genus Bifidobacterium. In: STARR, M.P.; STOLIP, H.; TRUPER, H.G.; BALOW, A.;
SCHLEGEL, H.G. The Procaryotes, a Handbook on Habitats, Isolation, and Identification of Bacteria, ed.. New York:
Springer Verlag, 1981.

SCARDOVI, V.; TROVATELLI, L.D.; BIAVATI, B.; ZANI, G. Bifidobacterium cuniculi, Bifidobacterium choerinum,
Bifidobacterium boum, and Bifidobacterium pseudocatenulatum – for new especies and their deoxyribonucleic acid
homology relationships. Int. J. Syst. Bacteriol., v. 29, p. 291-311, 1979.

SCEVOLA, D.; PERVERSI, L.; CAVANNA, C.; CANDIANI, C.; UBERTI, F.; CASTIGLIONI, B.; MARONE, P. Acid
tolerance and fecal recovery following oral administration of Saccharomyces cerevisiae. J. Chemother., v. 15, p. 143-
147, 2003.

SCHELLENBERG, D.; BONINGTON, A.; CHAMPION, M.; LANCASTER, R.; WEBB, S.; MAIN, J. Treatment of
Clostridium difficile diarrhea with brewer`s yeast. Lancet, v. 343, p. 171-172, 1994.

SCHIFFRIN, E.J.; BRASSART, D.; SERVIN, A.L.; ROCHAT, F.; DONNET-HUGHES, A. Immune modulation of
blood leukocytes in humans by lactic acid bacteria: criteria for strain selection. Am. J. Clin. Nutr., v. 66, p. 515S-520S,
1997.

SCHLEIFER, K.H.; EHRMANN, M.; BEIMFOHR, C.; BROCKMANN, E.; LUDWING, W.; AMANN, R. Application
of molecular methods for the classification and identification of lactic acid bacteria. Int. Dairy J., v. 5, p. 1081-1094,
1995.

SCHILLINGER, U. Bacteriocins of lactic acid bacteria. In: BILLS, D.D.; KUNG, S. (eds). Biotechnology and Food
Safety. Butterworth-Heinemann, Boston, 1990, p. 55-74.

SCHILLINGER, U. Isolation and identification of lactobacilli from novel-type probiotic and mild yoghurts and their
stability during refrigerated storage. International Journal of Food Microbiology, v. 47, p. 79-87, 1999.

SCHIOPPA, F.; PRETE, V.; DIEL MONTANARO, D. Addition of Lactobacillus to yoghurt. Riv. Soc. Ital. Scie.
Aliment., v. 10, p. 247-252, 1981.
SCHLEIFER, K.H. Recent changes in the taxonomy of lactic acid bacteria. FEMS Microbiol. Rev., v. 46, p. 201-203,
1987.

SCHLECH, W. F.; LAVIGNE, P. M. BORTOLUSSI, R. A.; ALLEN, A. C. HALDANE, E. V.; WORT, A. J.;
HIGHTOWER, A. W.; JOHNSON, S. E.; KING, S. H.; NICHOLLS, E. S.; BROOME, C. V. Epidemic listeriosis –
evidence for transmission by food. The New England Journal of Medicine, Waltham, v. 308, n. 4, p. 203206, jan. 1983.

SCHLEIFER, K.; LUDWIG, W. Phylogeny of the genus Lactobacillus and related genera. Syst. Appl. Microbiol., v. 14,
p. 461-467, 1995.

SCHMIDT, H.; HENKEL, B.; KARCH, H. A gene cluster closely related to type II secretion pathway operons of gram-
negative bacteria is located on the large plasmid of enterohemorrhagic Escherichia coli O157 strains. FEMS Microbiol.
Lett.,v. 148, p. 265-272, 1997.

SCHMIDT, H.; HENSEL, M. Pathogenicity islands in bacterial pathogenesis. Clinical Microbiology Reviews,
Washington, v. 17, n. 1, p. 14-56, Jan., 2004.

SCHREZENMEIR, J. & DE VRESE, M. Probiotics, prebiotics, and synbioticsapproaching a definition. Am. J. Clin.
Nutr., v. 73, p. 361S-364S, 2001.

SCHREZENMEIR, J.; DE VRESE, M. Probiotics, prebiotics and symbiotics – approaching a definition. Am. J. Clin.
Nutr., v. 73, p. 361S-364S, 2001.

SEELINGER, H. P. R.; JONES, D. Genus Listeria. In: SNEATH, P. H. A.; MAIR, N. S.; SHARPE, M. E. Bergey’s
Manual of Sistematic Bacteriology. 9. ed. Baltimore: Willians & Wilkins, p. 1235-1245, 1986. v. 2.

SELLARS, R.L. Acidophilus products. In: Therapeutic Properties of Fermented Milks. ROBINSON, R.K., (ed.), p. 81-
116, London: Elsevier Science Publishers Ltd, 1991.

SENA, M.J. et al. Detecção da toxina da Síndrome do Choque Tóxico (TSST-1) à partir de cepas de Staphylococcus
aureus isoladas de queijo de coalho, comercializado em Recife – PE. In: Anais do XVI Congresso Nacional de
Laticínios, Juiz de Fora, MG, p. 232-237, 1998.

SENA, M.J. et al. Características físico-químicas de queijo de coalho comercializado em Recife, PE. Higiene
Alimentar, v. 14, n. 74, p. 41-44, 2000.

SENA, M.J. Perfil epidemiológico, resistência a antibióticos e aos conservantes nisina e sistema lactoperoxidase de
Staphylococcus sp. isolados de queijos coalho comercializados em Recife - PE. Belo Horizonte: UFMG. Tese de
Doutorado, 75 p., 2000.

SENA, M. J. Perfil epidemiológico, resistência a antibióticos e aos conservantes nisina e sistema lactoperoxidase de
Staphylococcus sp. isolados de queijos de coalho comercializados em Recife-PE. Belo Horizonte – MG., 2000. 75p.
Tese (Doutora em veterinária) - Faculdade de veterinária, Universidade Federal de Minas Gerais, Belo Horizonte, 2000.

SENA, M. J. Perfil epidemiológico, resistência a antibióticos e aos conservantes nisina e sistema lactoperoxidase de
Staphylococcus sp. isolados de queijos de coalho comercializados em Recife-PE.2000. 75p. Tese (Doutora em
veterinária) - Faculdade de veterinária, Universidade Federal de Minas Gerais, Belo Horizonte, 2000.

SENA, M. J.; CERQUEIRA, M. M. O. P.; SANTOS, D. A.; LEOCARDIO FILHO, G.; DIAS, R. S. Salmonelas
isoladas de “queijo tipo coalho”: caracterização sorológica e resistência a agentes antimicrobianos. Recife (PE). Revista
do Instituto Adolfo Lutz, v. 58, n. 1, p. 13-17, 1999.

SGORBATI, B.; BIAVATI, B.; PALENZONA, D. The genus Bifidobacterium, p. 279-306. In: B.J.B. WOOD & W.H.
HOLZAPFEL (Ed.) In: The Lactic Acid Bacteria v. 2, The genera of lactic acid bacteria. Cap. 8, Chapman & Hall,
Glasgow, Scotland, 1995.

SHACKELFORD, L. Effect of feeding fermented milk on the incidence of chemically induced colon tumors in rats.
Nutrition and Cancer, 5(3-4):159-164, 1983.

SHAH, N.P. Isolation and enumeration of bifidobacteria in fermented milk products: a review. Milchwissenschaft, v. 52,
n. 2, p. 71-76, 1997a.
SHAH, N.P. Probiotic bacteria: selective enumeration and survival in dairy foods. J. of Dairy Science, v. 83, p. 894-907,
2000.

SHAH, N.P.; LANKAPUTHRA, W.E.V.; BRITZ, M.L.; KYLE, W.S.A. Survival of Lactobacillus acidophilus and
Bifidobacterium bifidum in commercial yogurt during refrigerated storage. Int. Dairy J., v. 5, p. 515-521, 1995.

SHAHANI, K. Natural antibiotic activity of Lactobacillus acidophilus and bulgaricus. Cultured Dairy Products Journal,
v. 11, n. 4, p. 14-17, 1976.

SHARMA, N. K.; REES, C. E. D.; DODD, C.R. Development of a single-reaction Multiplex PCR toxin typing assay
for Staphylococcus aureus strains. Applied and Environmental Microbiology, Washington, v. 66, n. 4, p. 1347-1353,
Apr., 2000.

SHARPE, M.E. The genus Lactobacillus. p. 1653-1679. In: STARR, M.P.; STOLP, H.; TRUPER, H.G.; BALOWS, A.;
SCHLEGEL, H.G. (ed). The Prokaryotes. Springer-Verlag, Berlin. 1981.

SHORTT, C. Host-microflora interface in health and disease. Trends in Food Science & Technology., v. 10, p. 182-185,
1999b.

SHORTT, C. The probiotic century: historical and current perspectives. Trends in Food Science & Technology., v. 10, p.
411-417, 1999a.

SILBERT, S. Tipagem molecular de bacilos gram negativos não fermentadores: comparação e aplicabilidade de
diferentes técnicas. Universidade Federal de São Paulo, Escola Paulista de Medicinal (Tese Doutor em Ciências), 97p.,
2004.

SILVA, A.M.; BAMBIRRA, E.A.; OLIVEIRA, A.L.; SOUZA, P.P.; GOMES, D.A.; VIEIRA, E.C.; NICOLI, J.R.
Protective effect of bifidus milk on the experimental infection with Salmonella enteritidis subsp. typhimurium in
conventional and gnotobiotic mice. J. Appl. Microbiol., v. 86, p. 331-336, 1999.

SILVA, C. C.; RODRIGUES, M. M.; MARTINS, B. R.; EDUARDO, M. B. P.; BASSIT, N. P.; CÉSAR, M. L. V. S.;
KATO, M. A. M.; FERNADES, S. A.; THIAGO, C.; PIMENTEL, E. P.; PAVANELLI, E. I.; COLLEONE, R. P.;
VIGILATO, M. A. N.; RANDI, A.P. Toxinfecção alimentar por Salmonella em, São Paulo/ SP, Setembro de 2004.
Boletim Epidemiológico Paulista, São Paulo, v. 1, n.11, p. 1-8, set, 2004. Disponível em:
<http://www.cve.saude.sp.gcia/bepa11_salmo.htm>. Acesso em: 07 abr. 2006.

SILVA, C. C.; RODRIGUES, M. M.; MARTINS, B. R.; EDUARDO, M. B. P.; BASSIT, N. P.; CÉSAR, M. L. V. S.;
KATO, M. A. M.; FERNADES, S. A.; THIAGO, C.; PIMENTEL, E. P.; PAVANELLI, E. I.; COLLEONE, R. P.;
VIGILATO, M. A. N.; RANDI, A.P. Toxinfecção alimentar por Salmonella em, São Paulo/ sp., Setembro de 2004.
Boletim Epidemiológico Paulista, São Paulo, v. 1, n.11, p. 1-8, set, 2004. Disponível em:
<http://www.cve.saude.sp.gcia/bepa11_salmo.htm>. Acesso em: 07 abr. 2006.

SILVA, I.M.M. et al. Occurrence of Listeria spp. In critical control points and the environment of Minas Frescal
cheese processing. International Journal of Food Microbiology, v. 81, n. 3, p. 241-248, 2003.

SILVA, J.F. et al. Monitoramento da qualidade de queijo minas frescal fabricado artesanalmente. Revista Indústria de
Laticínios, n. 34, p. 71-75, 2001.

SILVA, M.; JACOBUS, N.V.; DENEKE, C.; GORBACH, S.L. Antimicrobial substance from a human Lactobacillus
strain. Antimicrob. Agents Chemother., v. 8, p. 1231-1233, 1987.

SILVA, M. C. C.; CASTRO, D. G. Ocorrência de surto de intoxicação alimentar causada por queijo tipo “Minas“.In:
CONGRESSO NACIONAL DE LATICÍNIOS, XIII., 1995, Juiz de Fora. Anais. Juiz de Fora: EPAMIG/ELCT, 1995. p.
145-7.

SILVA, M.C.D. et al. Incidence of Listeria monocytogenes in cheese produced in Rio de Janeiro, Brazil. Journal of
Food Protection, v. 61, n. 3, p. 354-356, 1998.

SILVA, M. C. D.; DESTRO, M. T.; HOFER, E.; TIBANA, A. Characterization and evaluation of some virulence
markers of Listeria monocytogenes strains isolated from brasilian cheeses using molecular, biochemical and serotyping
techniques. International Journal of Food Microbiology, Amsterdam, v. 63, n. 3, p. 275280, Feb., 2001.
SILVA, M. C. D.; HOFER, E.; TIBANA, A. Incidence of Listeria monocytogenes in cheese produced in Rio de Janeiro,
Brazil. Journal of Food Protection, Des Moines, v. 61, n. 3, p. 354-356, Mar., 1998.

SILVA, M. C. D.; HOFER, E.; TIBANA, A. Incidence of Listeria monocytogenes in cheese produced in Rio de Janeiro,
Brazil. Journal of Food Protection, v. 61, n. 3, p. 354-356, Mar., 1998.

SILVA, M. C. D.; HOFER, E. TIBANA, A. Incidence of Listeria monocytogenes in cheese produced in Rio de Janeiro,
Brazil. Journal of Food Protection, Des Moines, v. 61, n. 3, p. 354-356, mar.1998.

SILVA, M.E. Modelos experimentais para o estudo de doença de Chagas, camundongos e ratos isentos de germes e
convencionais. Belo Horizonte, Instituto de Ciências Biológicas da UFMG, 1986 (Dissertação, Mestrado).

SILVA, I. M. M.; ALMEIDA, R. C. C.; ALVES, M. A. O.; ALMEIDA, P. F. Occurrence of Listeria spp. in critical
control points and the environment of Minas Frescal cheese processing. International Journal of Food Microbiology,
Amsterdam, v. 81, n. 3, p. 241-248, Mar., 2003.

SILVA, S.H.; VIEIRA, E.C.; DIAS, R.S.; NICOLI, J.R. Antagonism against Vibrio cholerae by diffusible substances
produced by bacterial components of the human faecal microbiota. J. Med. Microbiol., v. 50, p. 161-164, 2001.

SILVERMAN, H.; ROMANO, J.; ELMER, G. The Vitamin Book. New York: Bantam Books, 1999.

SIMON, G.L.; GORBACH, S.L. Intestinal flora and gastrointestinal function. Page 1729 In: Physiology of the
Gastrointestinal Tract. v.2. 2nd ed. L. R. JOHNSON, ed. Raven Press, New York, NY, 1987.

SINGH, J.; KHANNA, A.; CHANDAR, H. Effect of incubation temperature and heat treatments of milk from milk of
cow and buffalo on acid and flavour production by S. thermophilus and L. bulgaricus. J. Food Prot., v.43, p. 399-400,
1980

SINGH, R.; CHAUDHARY, L.C.; KAMRA, D.N.; PATHAK, N.N. Effect of feeding yeast Saccharomyces cerevisiae
cell suspension on growth and nutrient utilization in rabbits. Indian J. Anim. Sci., v. 65, p. 104-106, 1995.

SKELKVALE, R.; UEMURA, T. Experimental diarrhea in human volunteers following oral administration of
Clostridium perfringens enterotoxin. J. Appl. Bacteriol., v. 43, p. 281-286, 1977.

SMITH, H.W.; CRABB, W.E. The faecal bacterial flora of animals and man: its development in the young. J. Pathol.
Bacteriol., v. 82, p. 53-66, 1961.

SNALL, P.L.; ISBERG, R.R.; FALKOW, S. Comparison of the ability of enteroinvasive Escherichia coli, Salmonella
typhimurium, Yersinia pseudotuberculosis and Yersinia enterocolitica to enter and replicate within Hep-2 cells. Infect.
Immun., v. 55, p. 1674-1679, 1987.

SNEATH, P.H.A. & SOKAL, R.R. Numerical taxonomy. W.H. FREEMAN, San Francisco 1973.

SNEATH, P.H.A.; KRIEG, N.R.; HOLT, J.G.; SNEATH, P.H.A.; STALEY, J.J.; WILLIANS, S.T. Bergey’s Manual of
Determinatice Bacteriology. Baltimore: Willians & Wilkins, 1994. 787p.

SNEATH, P.H.A.; MAIR, N.S.; SHARP, M.E.; HOLT, J.G. Bergey’s Manual of Systematic Bacteriology. Baltimore:
Willians & Wilkins, 1986. v.2, 1599p.

SOOMRO, A. H.; ARAIN, M. A.; KHASKHELL, M.; BHUTTO, B. Isolation of Escherichia coli from raw milk and
products in relation to public health sold under market conditions at Tandojam. Pakistan Journal of Nutrition, Tandojam,
v. 1, n. 3, p. 151-152, May/June, 2002.

SORIANO, J. M.; FRONT, G.; RICO, H.; MOLTÓ, J. C.; MAÑES, J. Incidence of enterotoxigenic Staphylococci and
their toxins in foods. Journal of Food Protection, Des Moines, v. 65, n. 5, p. 857-860, May, 2002 .

SORIANO, J. M.; FRONT, G.; MOLTÓ, J. C.; MAÑES, J. Enterotoxigenic staphylococci and their toxins in restaurant
foods. Trends in Food Science and Technology, Cambridge, v. 13, n. 2, p. 60-67, Feb., 2002.

SOUSA, R.A. Incidência de L. monocytogenes em queijo tipo coalho artesanal comercializado à temperatura ambiente
em Fortaleza -CE. 2002. 78p. Dissertação (Mestrado em Tecnologia de Alimentos) - Departamento de Tecnologia de
Alimentos, Universidade Federal de Ceará, Fortaleza, 2002.
SOUSA, S. Ocorrência de Listeria spp. em queijo de massa crua tipo coalho, comercializado no município de João
Pessoa – PB. 1999. 120p. Dissertação (Mestre em Ciência e Tecnologia de Alimentos) – Departamento de Tecnologia
Química e de Alimentos, Universidade Federal da Paraíba, João Pessoa, 1999.

SOUSA, S. Ocorrência de Listeria spp. em queijo de massa crua tipo coalho, comercializado no município de João
Pessoa – PB. 1999. 120p. Dissertação (Mestre em Ciência e Tecnologia de Alimentos) – Departamento de Tecnologia
Química e de Alimentos, Universidade Federal da Paraíba, João Pessoa, 1999.

SOUTHERN, E.M. -Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol.
Biol., 98: 503-17, 1975.

SPANGLER, BA. Structure and function of cholera toxin and the related Escherichia coli heat-labile enterotoxin.
Microbiol. Rev., v. 56, p. 622-647, 1992.

SPECK, M.L. Enumeration of viable Lactobacillus acidophilus organisms in dairy products. J. Food Prot., v. 41, n. 2, p.
135-137, 1978.

STACKEBRANDT, E. & TEUBER, M. Molecular taxonomy and phylogenetic position of lactic acid bacteria.
Biochemie, v. 70, p. 1025-1030, 1987.

STACKEBRANDT, E. & RAINEY, F.A. Partial and complete 16S rDNA sequences, their use in generation of 16S
phylogenetic trees and their implications in molecular ecological studies. In: AKKERMANS, D.L.; VAN ELSAS, J.D.;
de BRUIJIN, F.J. (Eds). Molecular
Microbial Ecology Manual. P.1-17, Kluwer Academic Publishers, Dordrecht, The Netherlands, 1995.

STAHL, M.; MOLIN, G. Classification if Lactobacillus reuteri by restriction endonuclease analysis of chromosomal
DNA. International Journal of Systematic Bacteriology, v. 44, n.1 p. 9-14, 1994.

STAHL, M.; MOLIN, G.; PERSSON, A.; AHRNÉ, S.; STAHL, S. Restriction endonuclease patterns and multi-variate
analysis as a classification tool Lactobacillus spp. Int. J. Syst. Bacteriol., v.40, n. 2, p. 189-193, 1990.

STARK, R.L.; DUNCAN, C.L. Biological characteristics of Clostridium perfringens type A enterotoxin. Infect.
Immun., v. 4, p. 89-96, 1971.

STARK, P.L.; LEE, A. The microbial ecology of the large bowel of breast-fed and formula-fed infants during the first
year of life. J. Med. Microbiol., v. 15, p. 189-203,
1982.

STEFANO, DE R.; KAUFMANN, C.; SILVA, C.P.; TONON, A.; RIBEIRO, E.P. Desenvolvimento de um iogurte
probiótico de baixa acidez. XVII Congresso Brasileiro de Ciência e Tecnol. Alimentos, Fortaleza, p.43, 2000.

STILES, M.E.; HOLTZAPFEL, W.H. Review article. Lactic acid bacteria of food and their current taxonomy. Int. J.
Food Microbiol., v. 36, p. 1-29, 1997.

STRANDBERG, K.; SEDVALL, G.; MIDTVEDT, T.; GUSTAFSSON, B.E. effect of some biologically
active amines on the cecum wall of germ-free rats. Proc. Soc. Exp. Biol. Med., v. 121, p. 699-702, 1966.

STRUELENS,M.J.; DE GHELDRE,Y.; DEPLANO,A. -Comparative and library epidemiological typing systems:


outbreak investigations versus surveillance systems. Infect. Control Hosp. Epidemiol., 19: 565-9, 1998.

STULL, T.L.; LIPUMA, J.J.; EDLIND, T.D. A broad-spectrum probe for molecular epidemiology of bacteria:
ribosomal RNA. J. Infect. Dis., v. 157, p. 280-286, 1988.

SU, Y. C.; WONG, A. C. L. Identification and purification of a new staphylococcal enterotoxin, H. Applied and
Environmental Microbiology, Washington, v. 61, n. 4, p. 1438-1443, Apr., 1995.

SU, Y.; WONG, A. C. L. Current perspectives on detection of staphylococcal enterotoxins. Journal of Food Protection,
Des Moines, v. 60, n. 2, p. 195-202, Feb., 1997.

SU, Y. C.; WONG, A. C. L. Identification and purification of a new staphylococcal enterotoxin, H. Applied and
Environmental Microbiology, Washington, v. 61, n. 4, p.1438-1443, Apr., 1995.

SUNG, J.Y.; SHAFFER, E.A.; COSTERTON, J.W. Antibacterial activity of bile salts against common biliary
pathogens. Effects of hydrophobicity of the molecule and in the presence of phospholipids. Dig. Dis. Sci., v. 38, p.
2104-2112, 1993.

SUNG, J.Y.; SHAFFER, E.A.; COSTERTON, J.W. Antibacterial activity of bile salts against common biliary
pathogens. Effects of hydrophobicity of the molecule and in the presence of phospholipids. Dig. Dis. Sci., v. 38, p.
2104, 1993.

SURAWICZ, C.M.; ELMER, G.W.; SPEELMAN, P.; MCFARLAND, L.V.; CHINN, J.; VAN BELL, G. Prevention of
antibiotic-associated diarrhea by Saccharomyces boulardii. Gastroenterology, v. 96, p. 981-988, 1989a.

SURAWICZ, C.M.; MCFARLAND, L.V.; ELMER, G.; CHINN, J. Treatment of recurrent Clostridium difficile colitis
with vancomycin and Saccharomyces boulardii. Am. J. Gastroenterol., v. 84, p. 1285-1287, 1989b.

SURAWICZ, C.M.; MCFARLAND, L.V.; GREENBERG, R.N.; RUBIN, M.; FEKETY, R.; MULLIGAN, M.E.;
GARCIA, R.J.; BRANDMARKER, S.; BOWEN, K.; BORJAL, D.; ELMER, G.W. The search for a better treatment for
recurrent Clostridium difficile disease use of high-dose vancomycin combined with Saccharomyces boulardii. Clin.
Infect. Dis., v. 31, 1012-1017, 2000.

SURAWICZ, C.M. Probiotics, antibiotic-associated diarrhoea and Clostridium difficile diarrhoea in humans. Best Pract.
Res. Clin. Gastroenterol., v. 17, p. 775-783, 2003.

SUSKOVIC, J.; BRKIC, B.; MATOSIC, S.; MARIC, V. Lb. acidophilus M92 as potential probiotic strain.
Milchwissenschaft, v. 52, p. 430-435, 1997.

SUSKOVIC, J.; KOS, BLAZENKA; JADRANKA, G.; MATOSIC, S. Role of lactic acid bacteria and bifidobacteria in
synbiotic effect. Food Technol. Biotechnol., v. 39, n. 3, p. 227-235, 2001.

SUTHERINAD, P.; PORRIT, R. Dissemination and ecology of Listeria monocytogenes in Australia dairy factory
environment. Food Australia, Waterloo, 48, n. 4, p.172, 174-176, 178, Apr., 1996.

SWAMINATHAN, B. Listeria monocytogenes. In: DOYLE, M. P.; BEUCHAT, L. R.; MONTVILLE, T. J. (Ed.). Food
microbiology, fundamentals and frontiers. 2nd ed., Washington D. C.: ASM, 2001. Chap. 18, p. 383-409.

TAGG, J.R., DAJAMI, A.S., WANNAMAKER, L.W. Bacteriocin of Gram positive bacteria. Bacteriological Reviews,
v. 40, n. 3, p. 722-756, 1976.

TAGG, J.R. & McGIVEN, A.R. Assay System for bacteriocins. Applied Microbiology, Washington, 21 (5): 943, 1971.

TAILLIEZ, P.; QUÉNEE, P.; CHOPIN, A. Estimation de la diversité parmi les souches de la collection CNRZ:
application de la RAPD à un groupe de lactobacilles. Lait, v, 76, p. 147-158, 1996.

TAKEUCHI, A. Electron microscope studies of experimental Salmonella infection. I. Penetration into the intestinal
epithelium by Salmonella typhimurium. Am. J. Pathol., v. 50, p. 109-136, 1967.

TAMINE, A.Y.; MARSHALL, V.M.E. Microbiology and technology of fermented milks. In: Microbiology and
biochemistry of cheese and fermented milk. LAW, B.A., (Ed.), pp.57-152, Blackie Academic & Professional, London,
1997.

TAMINE, A.Y.; MARSHALL, V.M.E.; ROBINSON, R.K. Microbiological and technological aspects of milks
fermented by bifidobacteria. J. Dairy Res., v. 62, p. 151-187, 1995.

TAMINE, A.Y.; ROBINSON, R.K. Fermented milk and their future trends. Part II. Technological aspects. Journal of
Dairy Reserch, n. 55, p. 281-307, 1988.

TAMINE, A.Y.; ROBINSON, R.K. Yogurt: Science and Technology. Oxford:Pergamon Press, p. 276-374, 1985.

TANNOCK, G.W. Microecologia dos lactobacilos e bifidobactérias que habitam o aparelho digestivo: conhecimentos
básicos para o êxito na pesquisa sobre probióticos. In: Probióticos, outros fatores nutricionais e a microflora intestinal.
Nestlé Nutrition Services. Nestec Ltd. Vevey, Suíça, p.1-3, 1998 a.

TANNOCK, G. Analysis of the intestinal microflora: a renaissance. Antonie van Leeuwenhoek, v. 76, p. 265-278,
1999b.
TANNOCK, G. Identification of Lactobacilli and Bifidobacteria. In: Probiotics a Critical Review. p. 45-56, Horizon
Scientific Press, Wymondham, 1999 a.

TANNOCK, G.W.; TILSALA-TIMISJÄRVI, S.; RODTONG, S.; MUNRO, J.H.K.; ALATOSSAVA, T. Identification of
Lactobacillus isolates from the gastrointestinal tract, silage, and yoghurt by 16S-23S rRNA gene intergenic spacer
region sequence comparisons. Appl. Environ. Microbiol., v. 65, p. 4264-4267, 1999.

TANNOCK, G.W. Microbial interactions and influences in gastrointestinal tract. Lactobacilli and the gastrointestinal
tract. Proc. IV ISME, p. 526-532, 1986.

TANNOCK, G.W. et al. Identification of Lactobacillus isolates from the gastro-intestinal tract, silage and yoghurt by
the 16S-23S rDNA gene intergenic spacer region sequence comparisons. Applied and Environmental Microbiology, v.
65, n. 9, p. 4264-4267, 1999.

TASTEYRE, A.; BARC, M.C.; KARJALAINEN, T.; BOURLIOUX, P.; COLLIGNON, A. Inhibition of in vitro
cell adherence of Clostridium difficile by Saccharomyces boulardii. Microb. Pathog., v. 32, p. 219-25, 2002.

TAVARIA, F.K., MALCATA, F.X. On the microbiology of Serra da Estrela cheese: geographical and chronological
considerations. Food Microbiology, v. 17, n. 3, p. 293-304, 2000.

TEITELBAUM, J.E.; WALKER, W.A. Nutritional impact of pre- and probiotics as protective gastrointestinal
organisms. Annu. Rev. Nutr., v. 22, p. 107-138, 2002.

TEJADA-SIMON, M.V.; LEE, J.H.; USTUNOL, Z.; PESTKA, J.J. Ingestion of yogurt containing Lactobacillus
acidophilus and Bifidobacterium to potentiate immunoglobulin A responses to cholera toxin in mice. J. Dairy Sci., v. 82,
p. 649-660, 1999.

TEJADA-SIMON, M.V.; LEE, J.H.; USTUNOL, Z.; PESTKA, J.J. Ingestion of yogurt containing Lactobacillus
acidophilus and Bifidobacterium to potenciate immunoglobulin responses to cholera toxin in mice. Journal of Dairy
Science, v. 82, n. 4, p. 649-660, 1999a.

TEJADA-SIMON, M.V.; PESTKA, J.J. Proinflammatory cytokine and nitric oxide induction in murine macrophages by
cell wall and cytoplasmic extracts of lactic acid bacteria. Journal of Food Protection, v. 62, p. 1435-1444, 1999b.

TEMMERMAN, R.; POT, B.; HUYS, G.; SWINGS, J. Identification and antibiotic susceptibility of bacterial isolates
from probiotic products. International Journal of Food Microbiology, 2002. (Disponível em:
www.elsevier.com/locate/ijfoodmicro)

TENOVER,F.C.; ARBEIT,R.D.; GOERING,R.V.; The Molecular Typing Working Group Of The Society For
Healthcare Epidemiology Of America -How to Select and Interpret Molecular Strain Typing Methods for
Epidemiological Studies of Bacterial Infections: A Review for Healthcare Epidemiologists. Infection Control and
Hospital Epidemiology, 18: 426-39, 1997.

TENOVER, F.C.; ARBEIT,R.D.; GOERING,R.V.; MICKELSEN,P.A.; MURRAY,B.E.; PERSING,D.H.;


SWAMINATHAN,B. -Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis:
criteria for bacterial strain typing. J. Clin. Microbiol., 33: 2233-2239, 1995.

TERAGUCHI, S.; UEHARA, M.; OGASA, K.; MITSUOKA, T. Enumeration of bifidobacteria in dairy products. Jpn.
J. Bact., v.33, n.6, p. 753-761, 1978.

TERAHARA, M.; NISHIDE, S.; KANEKO, T. Preventive effect of Lactobacillus delbrueckii subsp. bulgaricus on the
oxidation of LDL. Biosciences, Biotechnology and Biochemistry, v. 64, n. 9, p. 1868-1873, 2000.

TESHIMA, E. Seleção de bactérias bífidas isoladas de lactentes e modulação da microbiota intestinal por meio de
probiótico, prebiótico e simbiótico. 2001. 113f. Tese (Doutorado em Ciência e Tecnologia de Alimentos)-Universidade
Federal de Viçosa, Viçosa, 2001.

TETRA PAK Dairy Processing Handbook. Lund: Tetra Pak Processing Systems AB, 436 p., 1995.

THARMARAJ, N.; SHAH, N.P. Selective enumeration of Lactobacillus delbrueckii ssp. bulgaricus, Streptococcus
thermophilus, Lactobacillus acidophilus, Bifidobacteria, Lactobacillus casei, Lactobacillus rhamnosus, and
Propionibacteria. J. of Dairy Science, v. 86, n. 7, p. 2288-2296, 2003.
THOMPSON,C.J.; DALY,C.; BARRETT,T.J.; GETCHELL,J.P.; GILCHRIST,M.J.;LOEFFELHOLZ,M.J. -Insertion
element IS3-based PCR method for subtyping Escherichia coli O157:H7. J. Clin. Microbiol., 36: 1180-4, 1998.

THORMANN, C.E.; OSBORN, T.C. Use of RAPD & RFLP markers for gemplasm evaluation. In: Applications of
RAPD technology to plant breeding. Minneapólis, 1992. p. 9-11.

TIMISJAVI, A.T.; ALATOSSAVA, T. Development of oligonucleotide primers from the 16S-23S rRNA intergenic
sequences for identifying dairy and probiotic lactic acid bactéria by PCR. International Journal of Food Microbiology, v.
35, p. 4956, 1997.

TINDALL, B. J.; GRIMONT, P. A. D., GARRITY G. M.; EUZÉBY J. P. Nomenclature and taxonomy of the genus
Salmonella. International Journal of Systematic Evolutionary Microbiology, Reading, v. 55, n. 1, p.521-524, Jan., 2005.

TISSALA-TIMISJARVI, A.; ALATOSSAVA, T. Development of oligonucleotide primers from the 16S-23S rDNA
intergenic sequences for identifying different dairy and probiotic lactic acid bacteria by PCR. International Journal of
Food Microbiology, v. 35, n. 1, p. 49-56, 1997.

TOMPKIN, R. B. Control of Listeria monocytogenes in the food-processing environment. Journal of Food Protection,
Des Moines, v. 65, n. 4, p. 709-725, Nov., 2002.

TORRIANI, S.; VESCOVO, M.; SCOLARI, G. An Overview on Lactobacillus helveticus. Annali di Microbiologia ed
Enzimologia, Milano, v. 44, p. 163-191, 1994.

TOWNER, K.J.; COCKAYNE, A. Molecular methods for microbial identification and typing. Chapman & Hall,
London, 1993.

TRAMER, J. Nisin in food preservation. Chemistry and Industry, v.12, n.3, p.446-450, 1966.

TREXLER, P.C. A rationale for the development of gnotobiotics. Lab. Anim., v. 12, p. 257-262, 1978.

TUCAN, E. U.; MARTIN, S. E. Combined effects of salts and temperature on the thermal destruction of
Staphylococcus aureus MF-31. Journal of Food Science, Chicago, v. 55, n. 3, p.833-836, May-June, 1990.

TUOMOLA, E.; CRITTENDEN, R.; MARTIN, P.; ISOLAURI, E.; SALMINEN, S. Quality assurance criteria for
probiotic bacteria. Am. J. Clin. Nutr. 73 (suppl), p.393S-8S, 2001.

TYNKKYNEN, S.; SATOKARI, R.; SAARELA, M.; MATILA-SANDHOLM, T.; SAXELIN, M. Comparation of
ribotyping, randomly amplified polymorphic DNA analysis, and pulsed-field gel electrophoresis in typing of
Lactobacillus rhamnosus and L. casei strains. Appl. Environ. Microbiol., v. 65, p. 3908-3914, 1999.

UDO, E. E.; AL-BUSTAN, M. A.; JACOB, L. E.; CHUGH, T. D. Enterotoxin production by coagulase-negative
staphylococci in restaurant workers from Kuwait city may be a potential cause of food poisoning. Journal of Medical
Microbiology, London, v. 48, n. 9, p. 819-823, Sept., 1999.

UDO, E. E.; AL-BUSTAN, M. A.; JACOB, L. E.; CHUGH, T. D. Enterotoxin production by coagulase-negative
staphylococci in restaurant workers from Kuwait city may be a potential causal of food poisoning. Journal of Medical
Microbiology, London, v. 48, n. 9, p. 819-823, Sept., 1999.

UDO, E. E.; AL-BUSTAN, M. A.; JACOB, L. E.; CHUGH, T. D. Enterotoxin production by coagulase-negative
staphylococci in restaurant workers from Kuwait city may be a potential cause of food poisoning. Journal of Medical
Microbiology, London, v. 48, n. 9, p. 819-823, Sept., 1999.

UNITED STATES DEPARTMENT OF AGRICULTURE (USDA). In action. Disponível em


http://www.fsis.usda.gov/os/topics/In_action.htm . Acessado em 1 ago., 2001.

UNITED STATES DERPARTMENT OF AGRICULTURE (USDA). Economic Research Service. Economics of


foodborne disease: food and pathogens. Disponível em: <http://www.ers.usda.gov/Briefing/FoodboeneDisease/
foodandpathogens.htm>. Acesso em: 12 Maio
2006.

UNITED STATES DEPARTMENT OF AGRICULTURE (USDA). Economic Research Service. Economics of


foodborne disease: food and pathogens.
Disponível em: <http://www.ers.usda.gov/Briefing/FoodboeneDisease/foodandpathogens.htm>. Acesso em: 12 May
2006.

URAZ, G.; SIMSEK, H.; MARAS, Y. The inhibitory effects of Lactobacillus casei and Lactobacillus helveticus on
Bacillus species isolated from raw milk in various salt concentrations. International Journal of Dairy Technology, v.
54, n. 4, p. 146-150, 2001.

VAILLANT, V.; HAEGHEBAERT, S.; DESENCLOS, J. C.; BOUVET, P.; GRIMONT, F.; GRIMONT, P. A.;
BURNENS, A. P. Outbreak of Salmonella dublin infection in France, November - December 1995. Euro Surveillance,
Paris, v. 1, n. 2, p. 9-10, Aug., 1996.

VALDEZ, G.F. de.; GIORI, G.S. de. Effectiviness of soy milk as food carrier for Lactobacillus acidophilus. Journal of
Food Protection, v. 56, p. 320-322, 1993.

VANDAMME, P.; POT, B.; GILLS, M.; DE VOS, P.; KERSTERS, K.; SWINGS, J. Polyphasic taxonomy, a consensus
approach to bacterial systematics. Microbiological Reviews, v. 60, p. 407-438, 1996.

VANDENBERG, P.A. Lactic acid bacteria, their metabolic products and interference with microbial growth. FEMS
Microbiol. Rev., v. 12, p. 221-238, 1993.

VAN DER AA KUHLE, A.; JESPERSEN, L. The taxonomic position of Saccharomyces boulardii as evaluated by
sequence analysis of the D1/D2 domain of 26S rDNA, the ITS1-5.8S rDNA-ITS2 region and the mitochondrial
cytochrome-c oxidase II gene. Syst. Appl. Microbiol., v. 26, p. 564-571, 2003.

VAN DER WAAIJ, D. Bioregulation of the digestive tract microflora. Rev. Sci. Techn. Off. Inter. Epizoot., v. 8, p. 333-
345, 1989.

VAN DENDER, A. G. F.; MORENO, I. Estudos de processos alternativos para a fabricação de queijo Minas Frescal.
Revista do Instituto de Laticínios Cândido Tostes, Juiz de Fora, v. 47.n. 279/281, p. 76-77, 1992.

VAN DENDER, A. G. F. Contribuição ao estudo do uso da ultrafiltração de leite na fabricação de queijo Minas Frescal.
Campinas, 1995. 176p. Tese (Doutorado em Tecnologia de Alimentos) - Faculdade de Engenharia de Alimentos
UNICAMP.

VAN DENDER, A. G. F, MASSAGUER-ROIG, S.; CAMPOS, S.D. da S. Alterações físico-químicas e vida de


prateleira do queijo Minas Frescal tradicional e fabricado pelo método MMV. In: CONGRESSO NACIONAL DE
LATICÍNIOS, 16., 1998, Juiz de Fora. Anais. Juiz de Fora: EPAMIG/ELCT, 1998. p. 67-83.

VAN DER WAAJI, D.; VRIES, J.M.B.D.; LEKKERKERK-WEES, E.C.V.D. Colonization resistance of the digestive
tract in conventional and antibiotic-treated mice. Journal of Hygiene, v. 69, p. 405-411, 1971.

VANNUFFEL, P.; GIGI, J.; EZZEDINE, H.; VANDERCAM, B.; DELMEE, M.; WAUTERS, G.; GALA, J. L. Specific
detection of methicillin-resistant Staphylococcus species by multiplex PCR. Journal of Clinical Microbiology,
Washington, v. 33, n. 11, p. 2864-2867, Nov., 1995.

VANNUFFEL, P.; HEUSTERSPREUTE, M.; BOUYER, M.; VANDERCAM, B.; PHILIPPE, M; GALA J. L.
Molecular characterization of femA from Staphylococcus hominis and Staphylococcus saprophyticus, and femA-based
discrimination of staphylococcal species. Research Microbiology, Paris, v. 150, n. 2, p. 129-141, Mar., 1999.

VANNUFFEL, P.; LATERRE, P. F.; BOUYER, M.; GIGI, J.; VANDERCAM, B.; REYNAERT, M.; GALA, J. L. Rapid
and specific molecular identification of methicillin-resistant Staphylococcus aureus in endotracheal aspirates from
mechanically ventilated Patients. Journal of Clinical Microbiology, Washington, v. 36, n. 8, p. 2366-2368, Aug., 1998.

VAN´T VEER, P.; DEKKER, J.M.; LEMERS, J.W.J.; KOK, F.J.; SCHOUTEN, E.G.; BRANTS, H.A.M.;
STURMANS, F.; HURMUS, R.J.J. Consumption of fermented milk products and breast cancer: a case control study in
the Netherlands. Cancer Res., v.49, p. 4020-4023, 1989.

VANZO, S. P.; AZEVEDO, R. V. P. Detecção de S. aureus em manipuladores de alimentos – perfil de resistência a


antibióticos e quimioterápicos. Revista Higiene Alimentar, São Paulo, v. 17, n. 104/105, p. 114-123, jan./fev., 2003.
VARIANE, S.F. Caracterização molecular de linhagens de Lactobacillus fermentum. 1996. 53 f. Dissertação (Mestrado)
-Faculdade de Engenharia de Alimentos, Universidade Estadual de Campinas, Campinas, São Paulo, 1996.

VARNAM, A. H.; SUTHERLAND, J. P. Milk and milk products. Technology, chemistry and microbiology. London:
Chapman & Hall, 1994, cap. 7, v. 1, série: Food products series.
VAUGHAN, E.E. et al. Isolation from food sources, of lactic acid bacteria that produced antimicrobials. Journal of
Applied Bacteriology, v. 76 n. 2, p. 118-123, 1994.
VAUGHAN, E.E.; SCHUT, F.; HEILIG, H.G.H.J.; ZOETENDAL, E.G.; DE VOS, W.M.; AKKERMANS, A.D.L. A
molecular view of the intestinal ecosystem. Curr. Issues Intest. Microbiol., v. 1, p. 1-12, 2000.

VAZQUEZ-BOLAND, J. A.; KUHN, M.; BERCHE, P.; CHAKRABORTY, T.; DOMINGUES-BERNAL, G.;
GOEBEL, W.; GONZALEZ-ZORN, B.; WEHLAND, J.; KREFT, J. Listeria pathogenesis and molecular virulence
determinants. Clinical Microbiology Reviews, Washington, v. 14, n. 3, p. 584-640, July, 2001.

VÁZQUEZ-SALINAS, C.; RODAS-SUÁREZ, O.; QUIÑÓNEZ-RAMIREZ, E. I. Occurrence of Listeria species in


raw milk in farms on the outskirts of Mexico city. Food Microbiology, v. 18, n. 2, p. 177-181, apr., 2001.

VENTURA, M.; ELLI, M.; RENIERO, R.; ZINK, R. Molecular microbiol analysis of Bifidobacterium isolates from
different environments by the species-specific amplified ribosomal DNA restriction analysis (ARDRA). FEMS
Microbiol. Eco., v. 36, p. 113-121, 2001.

VERAS, J. F.; SANTOS, D. A.; CARMO, L. S.; FERNANDES, T. M. G.; AZALIM, C. C.; SILVA, M. C. C.;
MARTNS, R. T.; CERQUEIRA, M. M.O.P. Levantamento de surtos de toxinfecção alimentar envolvendo leite e
produtos derivados no estado de Minas Gerais. Revista Higiene Alimentar, São Paulo, v.17, n. 104/105, p. 218-119,
jan./fev., 2003.

VERAS, J. F.; SANTOS, D. A.; CARMO, L. S.; FERNANDES, T. M. G.; AZALIM, C. C.; SILVA, M. C. C.;
MARTNS, R. T.; CERQUEIRA, M. M.O.P. Levantamento de surtos de toxinfecção alimentar envolvendo leite e
produtos derivados no estado de Minas Gerais. Revista Higiene Alimentar, São Paulo, v. 17, n. 104/105, p. 218-119,
jan./fev., 2003.

VERAS, J. F.; SANTOS, D. A.; CARMO, L. S.; FERNANDES, T. M. G.; AZALIM, C.C.; SILVA, M. C. C.; MARTNS,
R. T.; CERQUEIRA, M. M.O.P. Levantamento de surtos de toxinfecção alimentar envolvendo leite e produtos
derivados no estado de Minas Gerais. Revista Higiene Alimentar, São Paulo, v.17, n. 104/105, p. 218119, jan./fev.,
2003.

VERNOZY-ROZAND, C.; MAZUY, C.; PERRIN, G.; HAOND, F.; BES, M.; BRUN, Y.; FLEURETTE, J.
Identification Micrococcaceae isolated from goat’s milk and cheese in the Poitou-Charentes region. International
Journal of Food Microbiology, Amsterdam, v. 30, n. 3, p. 373-378, Mar., 1996a.

VERNOZY-ROZAND, C.; MAZUY, C.; PERRIN, G.; HAOND, F.; BES, M.; BRUN, Y.; FLEURETTE, J.
Identification Micrococcaceae isolated from goat’s milk and cheese in the Poitou-Charentes region. International
Journal of Food Microbiology, Amsterdam, v. 30, n. 3, p. 373-378, Mar., 1996a.

VERNOZY-ROZAND, C.; MAZUY, C.; PERRIN, G.; HAOND, F.; BES, M.; BRUN,
Y.; FLEURETTE, J. Identification Micrococcaceae isolated from goat’s milk and cheese in the Poitou-Charentes region.
International Journal of Food Microbiology, Amsterdam, v. 30, n. 3, p. 373-378, Mar., 1996a.

VERNOZY-ROZAND, C.; MAZUY, C.; PREVOST, G.; LAPEYRE, C.; BES, M.; BRUN, Y.; FLEURETTE, J.
Enterotoxin production by coagulase-negative staphylococcal isolated from goats and cheese. International Journal of
Food Microbiology, Amsterdam, v. 30, n. 3, p. 271-280, Mar., 1996b.

VERNOZY-ROZAND, C.; MAZUY, C.; PREVOST, G.; LAPEYRE, C.; BES, M.; BRUN, Y.; FLEURETTE, J.
Enterotoxin production by coagulase-negative staphylococcal isolated from goats and cheese. International Journal of
Food Microbiology, Amsterdam, v. 30, n. 3, p. 271-280, Mar., 1996b.

VERNOZY-ROZAND, C.; MAZUY, C.; PREVOST, G.; LAPEYRE, C.; BES, M.; BRUN, Y.; FLEURETTE, J.
Enterotoxin production by coagulase-negative staphylococcal isolated from goats and cheese. . International Journal of
Food Microbiology, Amsterdam, v. 30, n. 3, p. 271-280, Mar., 1996b.

VERNOZY-ROZAND, C.; MAZUY, C.; PREVOST, G.; LAPEYRE, C.; BES, M; BRUM, Y.; FLEURETTE, J.
Enterotoxin production by coagulase-negative staphylococci isolated from goat’s milk and cheese. International Journal
of Food Microbiology, Amsterdam, v. 30, n. 3, p.271-280, jul., 1996.

VESA, T.; MARTEAU, P.; KORPELA, R. Lactose intolerance. Am. J. Clin. Nutr., v. 19, p. 165S-175S, 2000.
VERSALOVIC,J.; KOEUTH,T.; LUPSKI,J.R. -Distribution of repetitive DNA sequences in eubacteria and application
to fingerprinting of bacterial genomes. Nucleic Acids Res., 19: 6823-31, 1991.

VIEDMA,D.; MARIN,M.; CERCENADO,E.; ALONSO,R.; RODRIGUEZ-CRÉIXEMS,M.; BOUZA,E. -Evidence of


Nosocomial Stenotrophomonas maltophilia cross-infection in a neonatology unit analyzed bt three molecular typing
methods. Infect. Control Hosp. Epidemiol., 20: 816-20, 1999.

VIEIRA, L.Q.; OLIVEIRA, M.R.; NEUMANN, E.; NICOLI, J.R.; VIEIRA, E.C. Parasitic infections in germfree
animals. Braz. J. Med. Biol. Res., v. 31, p. 105-110, 1998.

VIEIRA, S. D. A.; GOUDEDRÁNCHE, H.; DUCRUET, P.; MAUBOIS, J. L. Parâmetros para fabricação de queijo
Minas Frescal por meio de ultrafiltração. Revista do Instituto de Laticínios Cândido Tostes, Juiz de Fora, v.39, n. 235,
p.53-58, set./out. 1984.

VIGGIANO, M.; BADETTI, C.; BERNINI, V.; GARABEDIAN, M.; MANELLI, J.C. Saccharomyces boulardii
fungemia in a patient with severe burns. Ann. Fr. Anesth. Reanim., v. 14, p. 356-358, 1995.

VILLAR, R. G.; MACEK, M. D.; SIMONS, S.; HAYS, P. S.; GOLDOFT, M. J.; LEWIS, J. H.; ROWAN, L. L.;
HURSH, D.; PATNODE, M.; MEAD, P.S. Investigation of multidrug-resistant Salmonella serotype Typhimurium
DT104 infections linked to raw-milk cheese in Washington, State. The Journal of the American Medical association,
Chicago, v. 281, n. 19, p. 1811-1816, May, 1999.

VINDEROLA, C.G.; REINHEIMER, J.A. Culture media for the enumeration of Bifidobacterium bifidum and
Lactobacillus acidophilus in the presence of yoghurt bacteria. International Dairy Journal, v. 9, p. 497-505, 1999.

VIOTTO, W.H. Ultrafiltração de soro doce de queijo Minas Frescal. Efeito de pré-tratamentos do soro no desempenho
da membrana e na composição e solubilidade do concentrado proteico de soro. Campinas, 1993. 229p. Tese (Doutorado
em Tecnologia de Alimentos) - Faculdade de Engenharia de Alimentos UNICAMP.

WAAK, E.; THAM, W.; DANIELSSON-THAM, M. Prevalence and fingerprinting of Listeria monocytogenes strains
isolated from raw whole milk in farm bulk tanks and in dairy plant receiving tanks. Applied and Environmental
Microbiology, Washington, v. 68, n. 7, p. 3366-3370, July, 2002.

WANG, R.F.; CAO, W.W.; CERNIGILIA, C.E. PCR detection and quantification of predominant anaerobic bacteria in
human and animal fecal samples. Appl. Environ. Microbiol., v. 62, p. 1242-1247, 1996.

WERBER, D.; DREESMAN, J.; FEIL, F.; VAN TREECK, U.; FELL, G.; ETHELBRG, S.; FISHER, I. S. T.;
BEHNKE, S. C.; BARTELT, E.; WEISE, E.; ELLIS, A. SIITONEN, A.; ANDERSON, Y; TSCHÄPE, H.; KRAMER,
M. H.; AMMON, A. International outbreak of Salmonella Orangeburg due to German chocolate. BMC Infectious
Diseases, London, v. 5, n. 7, p. 1-10, Feb., 2005.

WARD, L.J.H. & TIMMINS, M.J. Differentiation of Lactobacillus casei, Lactobacillus paracasei and Lactobacillus
rhamnosus by polymerase chain reaction. Letters in Applied Microbiology, v. 29, p. 90-92, 1999.

WASSEF, J.S.; KEREN, D.F.; MAILLOUX, J.L. Role of M cells in initial antigen uptake and in ulcer formation in the
rabbit intestinal loop model of shigellosis. Infect. Immun., v. 57, p. 858-863, 1989.

WELSH, J.; McCLELLAND, M. Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Research,
Oxford, n. 18, p. 7213-7218, 1990.

WIEDMANN, M.; BRUCE, J. L.; KEATING, C.; JOHNSON, A. E.; MCDONOUGH, P. L.; BATT, C. A. Ribotypes
and virulence gene polymorphisms suggest three distinct Listeria monocytogenes lineages with differences in
pathogenic potential. Infection and Immunity, Washington, v. 65, n. 7, p. 2707-2716, July, 1997.

WIEDMANN, M. Molecular subtyping methods for Listeria monocytogenes. Journal of AOAC International,
Gaithersburg, v. 85, n. 2, p. 524-531, Mar./Apr., 2002.

WIJSMAN, M.R.; JOHANNA, L.P.; HEREIJGERS, M.; GROOTE, J.M.F.H. Selective enumeration of bifidobacteria in
fermented milk. Neth. Milk Dairy J., v. 43, p. 395, 1989.

WILLIAMS, A.G.; BANKS, J.M. Proteolytic and hydrolitic enzymes activities in non-starter lactic acid bacteria
(NSLAB) isolated from Cheddar cheese manufacturated in the United Kingdom. International Dairy Journal, v. 7, n.
12, p. 763-774, 1997.

WILLIANS, J.G.K.; KUBELIK, A.R.; LIVAK, K.J.; RAFALSKI, J.A.; TINGEY, S.V. DNA polymorphisms amplified
by arbitrary primers are useful as genetic markes. Nucleic Acid Res., v.18, p. 6531-6535, 1990.

WILLIAMS, A.G.; WITHERS, S.E.; BANKS, J.M. Energy sources of non-starter lactic acid bacteria isolated from
Cheddar cheese. International Dairy Journal, v. 10, n. 1-2, p. 17-23, 2000.

WINKOWSKI, K.; CRANDALL, A.D.; MONTVILLE, T.J. Inhibition of Listeria monocytogenes by Lactobacillus
bavaricus MN in beef systems at refrigeration temperatures. Applied Environmental Microbiology, v. 59, n. 8, p. 2552-
2557, 1993.

WILSON, K.H.; PERINI, F. Role of competition for nutrients of Clostridium difficile by the colonic microflora. Infect.
Immun., v. 56, p. 2610-2614, 1988.

WISTROM, J.; NORRBY, S.R.; MYHRE, E.B.; ERIKSSON, S.; GRANSTROM, G.; LAGERGREN, L.; ENGLUND,
G. Frequency of antibiotic-associated diarrhoea in 2462 antibiotic-treated hospitalized patients: a prospective study. J.
Antimicrob. Chemother., v. 47, p. 43-50, 2001.

WOLFSCHOON-POMBO, A. F.; FURTADO, M. M.; MUNCK, A. V. Estudo da fabricação do queijo Minas Frescal
com ácido lático em substituição ao fermento lático, Anais do V Congresso Nacional de Laticínios,
EPAMIG/DTA/ILCT, p.160182, 1978.

WOESE, C.R. Bacterial evolution. Microbiol. Rev., v. 51, p. 1221-71, 1987.

WOHLT, J.E.; CORCIONE, T.J.; ZAJAC, P.K. Effect of yeast on feed intake and performance of cows fed diets based
on corn silage during early lactation. J. Dairy Sci., v. 87, p. 1345-1352, 1998.

WOLLOSWSKI, I.; JI, S.T.; BAKALINSKY, A.T.; NEUDECKER, C.; POOL-ZOBEL, B.L. Bacteria used for the
production of yogurt inactivate carcinogens and prevent DNA damage in the colon of rats. J. Nutr., v. 129, p. 77-82,
1999.

WOOD, B.J.B. The lactic acid bacteria in health and disease, v. 1, pp. 151-339, Elsevier Appl. Sci., London, England,
1992.

WORLD HEALTH ORGANIZATION (WHO), 2002a. Disponível em http://www.who.int/medicines. Acesso em 06


de setembro 2002.

WORLD HEALTH ORGANIZATION (WHO), 2002b. Disponível em


http://www.who.int/emc/diseases/cholera/questionsaboutcholera.html. Acesso em 06 de setembro 2002.

WOLRD HEALTH ORGANIZATION (WHO). Food safety and foodborne illness. Geneva: World Health Organization,
Fact sheet, nº 237, Jan., 2002.

YAESHIMA, T. Benefits of bifidobacteria to human health. Bull. Int. Dairy Fed., n. 313, p. 36-42, 1996.

YAESHIMA, T.; FUJISAWA, T.; MITSUOKA, T. Bifidobacterium globosum, subjective synonym of Bifidobacterium
pseudolongum, and description of Bifidobacterium pseudolongum subsp. globosum comb. nov. System. Appl.
Microbiol., v.15, p.380-385, 1992.

YAESHIMA, T.; TAKAHASHI, S.; ISHIBASHI, N.; SHIMAMAURA, S. Identification of bifidobacteria from dairy
products and evaluation of a micro plate hybridisation method. International Journal of Food Microbiology, v. 30, p.
303-313, 1996.

YAMAMOTO, N.; AKINO, A.; TAKANO, T. Antihypertensive effect of the peptides derived from casein by na
extracellular proteinase from Lactobacillus helveticus CP790. Journal of Dairy Science, Champaign, v. 77, n. 4, p. 917-
922, Apr. 1994.

YAMAMOTO, T.; MOROTOMI, M.; TANAKA, R. Species-specific oligonucleotide probes for five Bifidobacterium
species detected in human intestinal microflora. Appl. Environ. Microbiol., v. 58, p.4076-4079, 1992.

YARROW, D. Methods for the isolation, maintenance, classification and identification of yeasts. In KURTZMAN, C.P.;
FELL, J.W. The Yeasts: a Taxonomic Study. 4 ed. Elsevier Science Publishers, Amsterdam, p. 77-100, 1998.
YARWOOD, J. M.; MCCORMICK, J. K.; PAUSTIAN, M. L.; ORWIN, P. M.; KAPUR, V.; SCHLIEVERT, P. M.
Characterization and Expression Analysis of Staphylococcus aureus Pathogenicity Island 3: implications for the
evolution of staphylococcal pathogenicity islands. Journal Biological Chemistry, v. 277, n. 15, p. 13138-13147, April,
2002.

YEUNG, P.S.M.; SANDERS, M.E.; KITTS, C.L.; CANO, R.; TONG, P.S. Speciesspecific identification of commercial
probiotic strains. J. Dairy Sci., v.85, p. 10391051, 2002.

YEUNG, P.S.M.; CANO, R.; TONG, P.S.; SANDERS, M.E. Comparison of API, 16S rDNA sequencing and fatty acid
analysis as methods to speciate commercial probiotic bacteria. J. Dairy Sci., v. 82, p. 6, 1999.

YOON, Y.H.; WON, B.R. Antagonism against Helicobacter pylori and proteolysis of Lactobacillus helveticus
CU631 and strain identification. Journal of Asian Australian Animal Sciences. v. 15, n. 7, p. 1057-1065, 2002.

YUN, J. J.; BARBANO, D. M. Departament of Food Science, Cornell University september/91, Adaptação AOAC
(1995), 15a ed, metodologia 971.19.

YUNIS A.A; BLOOMBERG G.R. Chloramphenicol toxicity, clinical features and pathogenesis. Program.
Hematological, v. 4, 138-159, 1994.

ZAVAGLIA, G.A.; KOCIUBINSKI, G.; PEREZ, P.; DE ANTONI, G. Isolation and characterization of Bifidobacterium
strains for probiotic formulation. J. Food Protection, v. 61, n. 7, p. 865-873, 1998.

ZAVAGLIA, A.G.; URRAZA, P. de. ANTONI, G. de. Characterization of Bifidobacterium longum and breve strains by
SDS=PAGE and ERIC-PCR., 2000

ZBINDEN, R. GÖNCZI, E.E.; ALTWEGG, M. Inhibition of Saccharomyces boulardii (nom. inval.) on cell invasion of
Salmonella typhimurium and Yersinia enterocolitica. Microb. Ecol. Health Dis., v. 11, p. 158-162, 1999.

ZHANG, S.; IANDOLO, J. J.; STEWART, G. C. The enterotoxin D plasmid of Staphylococcus aureus encodes a
second enterotoxin determinant (sej). FEMS Microbiology Letters, Amsterdam, v. 168, nº. 2, p. 227 - 233, Nov., 1998.

ZHONG, W.; MILLS, K.; BIALKOWSKA-HOBRZANSKA, H.; REID, G. Differentiation of Lactobacillus species by
molecular typing. Applied and Environmental Microbiology., v. 64, p. 2418-2423, 1998.

ZIEMER, C.J. & GIBSON, G.R. An overview of probiotics, prebiotics and synbiotics in the functional food concept:
perspectives and future strategies. Int. Dairy J., v.8, p. 473-479, 1998.

ZIPRIN, R. L.; HUME, M. H. Human salmonellosis: general medical aspects. In: HUI, Y.H.; PIERSON, M.D.;
GORHAM, J.R. (Ed.). Foodborne disease handbook. 2nd ed. New York: Marcel Dekker, 2001. v. 1, Chap. 13, p. 285-
321.

ZUNIC, P.; LACOTTE, J.; PEGOIX, M.; BUTEUX, G.; LEROY, G.; MOSQUET, B.; MOULIN, M. Saccharomyces
boulardii fungemia. A propos d’un cas. Therapie, v. 46, p. 498-489, 1991.

ZYCHLISNKY, A.; PREVOST, M.C.; SANSONETTI, P.J. Shigella flexneri induces apoptosis in infected macrophages.
Nature, v. 358, p. 167-169, 1992.

ZYCHLISNKY, A.; FITTING, C.; CAVAILLON, J.M.; SANSONETTI, P.J. Interleukin-1 is released by murine
macrophages during apoptosis induced by Shigella flexneri. J. Clin. Invest., v. 94, p. 1328-1332, 1994.
7. ANEXOS

Anexo A - Fluxogramas de produção de queijo de coalho artesanal e industrial

Fluxograma 1: Fluxograma de produção de queijo de coalho do laticínio BL

Recepção da matéria prima



Padronização da gordura do leite a 3%

Pasteurização a 76°C/15 a 20 segundos

Adição de ingredientes: coalho liquido 20mL/100L e cloreto de cálcio 20mL/100L

Coagulação 35°C/40 minutos

Corte da massa (corte pequeno)

Mexedura de 1 hora

Dessoragem

Salga da massa 12Kg de sal para 2.800 L

Enformagem com pano

Prensagem por 30 minutos

Viragem da forma

Prensagem por 30 minutos

Câmara fria (4°C) 12-24 horas

Corte

Embalagem a vácuo

Câmara fria (5-6°C)

Transporte

Comercialização
Fluxograma 2: Fluxograma de produção de queijo de coalho do laticínio LV

Recepção da matéria prima



Padronização da gordura do leite a 3,2%

Pasteurização 75°C/15 a 20 segundos

Adição de coalho liquido 30-50 ml para 100L

Adição de cloreto de cálcio 30-50ml para 100L

Adição de cultura mesofílica

Coagulação por 40 minutos

Corte da massa (grão pequeno)

mexedura por 20 minutos a 35°C

Descanso por 20 minutos

Retirada do soro

Salga da massa

Enformagem

Prensa por 20 minutos

Viragem da forma

Prensa por 20 minutos

Embalagem a vácuo

Camara fria 5-10°C
Fluxograma 3: Fluxograma de produção de queijo de coalho da fazenda AQ.

Recepção do leite ordenhado



Adição de coalho liquido

Coagulação por 40 minutos a 1 hora

Mexedura por aproximadamente 5 minutos

Repouso por 10 minutos

Retirada do soro com balde

Transferência da massa para um saco

Enformagem

Prensagem

Estocagem em “freezer” a 10°C por 12 horas

Retirada da forma

Estocagem em freezer a 10°C

Retirada 1 dia antes da venda

Lavagem

Embalagem

Comercialização
Fluxograma 4: Fluxograma de produção de queijo de coalho da fazenda CM.

Recepção do leite da própria fazenda



Adição de bicarbonato de sódio e coalho em pó dissolvido em água

Coagulação 40-45 minutos

Corte da massa (1cm)

Primeira mexedura 5 min.→ Descanso 5 min.

Segunda mexedura 5 min. → Descanso 5 min.

Terceira mexedura → Descanso 5 min.

Retirada do soro

Colocação da massa em formas

Pensa 5 min.

Salga

Colocação das formas em prateleiras para escorrer o soro por 12 horas

Refrigeração

Embalagem

Comercialização
Anexo B - Gram de culturas isoladas de queijo de coalho artesanal (AB e CM).

Figura 10: Gram de cultura isolada de queijo de coalho artesanal (AB), identificada como
Lactobacillus fermentum.
Figura 11: Gram de cultura isolada de queijo de coalho artesanal (AB), identificada como
Streptococcus thermophilus.

Figura 12: Gram de cultura isolada de queijo de coalho artesanal (CM), identificada como
Weissella confusa.
Anexo C - Resultados dos seqüenciamentos dos produtos de PCR16S-23S clonados em vetor
Topo.

AB1 MRS - primer 16S

GGGTGATATCCGGCCTGGTTTAATGGCCGTCACACCACGAGAGTTTGTAACACCGAAGT
CGGTGAGGTAACCTTTTAGTGAGCCAGCCGCCTAAGGTGGGATAGATGATTTGGGTGTG
AAGTCGTAACAAGGTAGCCGTATCGGAAGTGTGCGTGCTGGATCACCTCCTTTCTAAGT
GATAAACTGTGAAGCACGTTTGGGTATTTGTTTAGTTTTTGAGAGTGTCTTGTGTGTGTG
CCTTAGCTCAAGCTGGTGAGANGCTGCCTGCTTTTGCACTGCAGTGAGTGTCAGCTGTG
TTCGATCCCTGCTAGTGCTCCATTGAATCGAAAGATTCAAGTATTTGTCCATTTGAAAATT
TGAATATCTATATCAAATTCCATATGTAAGTAATTACATATAGATAGTAACAAGAAAATAAA
CCGAAACGCTGTGAATATTTAATGAGTTAGGTCGAAAGGCCAAAAATAAGGTTAAGTTA
ATAAGGGCGCACGGTGGATGCCTTGGCACTAGAAGCCGATGAAGGACGTGACTAACGA
CGAAATGGCTTTGGGGAAGCTGTAAGTGAGCAATGATCCAGAGATGTCCGAATGGGGG
AATGCGAGAATTTGNTGGAATGGAANTG

AB1 MRS - primer 16S

GGGGATATCCGGCCTGNATTACGGCCGTCACACACGAGAGTTTGTAACACCGAAGTCTG
GGTGAGGTAACCTTTTAGTGAGCAGCCGCCTAAGGTGGGATAGATGATTGGGGTGAAGT
CGTAACAAGGTAGCCGTATCGGAAGGGTTGGCTGTGCTGGATCACCTCCTTTCTAAGGAT
AAACGGAAGCACTGTTTTGGGTATTTGTTTAGTTTTGAGAGGTCTTGTTGGGGGCTTAGC
TCAGCCTTGGGGAGGAAGCCGCCTGGTTTGGCACCGCCAGGAAGGCCGCGGGGTCTCG
AACTCCCGGTTAGCGCCTCCTATGGATACTCCGAAGAAGATTCAATGTTATTTGTCCATT
GAACAATTTGAATATCTATATCAAATTCCATATGTAAGTAATTACATATAGATAGTAACAAG
AAAATAAACCGAAACGCTGTGAATATTTAATGAGTTAGGTCGAAAGGCCAAAAATAAGG
TTAAGTTAATAAGGGCGCACGGTTGGATGCCTTGGCACTAGAAGCCGATGAAGGACGTG
ACTAACGACGAAATGCTTGGGGAGCTGTAAGTGAGCAATGATCCAGAGATGTCCGAATG
GGGGAAANCGNAATCCNGGGAAGTCACTTGACACCATGNCCANGAGGCCATATTTGTA
ANAAAAATTATCGGTAAGATCTGGACCANGCTCACGGCANNAAAAGNATTATCACTAAA
TACACACGATATNAAGACGAGTATAATCCCGACTAANTNANNAAAGACNNGATAAACAA
AANCNNTCATATATACAAACGGGGTTATTNGTGCCCNTAATCAGCCACACTNNACCACA
CTGNTNTCGGAGACANTNAACA

AB2 MRS - primer 16S

TNGTTCTGATGTCGGGCCTNNATTACGGCCGTCACACATGAGAGTTTGTAACACGAAGC
GGTGGCGTAACCTTTTAGTGGAGCGAGCGTCTAAGTGTGGGACAAATGATTAGTGGTGA
AGTCGTAACAAGGTAGCCGTAGTGAGAACCTGCGTGCTGGATCACCTCCTTTCTAAGTG
AAACAGACTGAAAGTCTGACGTGAAACCTGCACACACGAAACTTTGTTTAGTTTTGAG
GGGATCACCCTCAAGCACCCTAACGGGTGCGACTTTGTTCTTTGAAAACTGGATATCATT
GTATTAATTTGTTTTAAATTTGCCTGAGAACACAGCTGTATTTGTATGAGTTTCTGAAAAA
GAAATTCGCATCGCATAACCTGCTGACGCAAGTCAGTACAGGTTAACTGTTACAAATGG
GCGCACGGTGTGATGCCTTGTGCACTAGGTGAGCCGATGAAGTGACGTGAACTAATACC
GATCATGCTTCGGGGAGCTATAAAGTAACGCTTTTGATCCGGAGATTTCCGAATTGGTGG
TGAACCAACTCGCTACCCACAAGNCCTTACCTCCACTATGACCCCATATATAACTAATTN
ACAACGTAATTAAATCAACANCCTACNCGCCGCNTATATANTCGT

AB2 MRS - primer 16S

TTTTGTTTTCGAATCGGGCTTGGTTACGGCCGTCACACATGGAGAGTTTGTAACACGAA
GCGGTGGCGTAACCTTTTAGTGGAGCGAGCGTCTAAGTGTGGGACAAATGATTAGGGTG
AAGTCGTAACAAGGTAGCCGTAGGAGAACCTGCGTGCTGGATCACCTCCTTTCTAAGGA
AACAGACTGAAAGTCTGACGNGAAACCTGCACACACGAAACTTTGTTAGTTTTGAGGG
GATCACCCTCAAGCACCCTAACGGGTGCGACTTTGTTCTTTGAAAACTGGATATCATTTG
TATTAATTGTTTTAAATTTGCCGAGAACACAGCGTATTTGTATGAGTTTCTGAAAAAGAA
ATTCGCATCGCATAACCGCTGACGCAAGTCAGTACAGGTTAAGTTACAAAGGGCTGCAC
TGGTGGATGCCTTGTGCACTAGGAGCCGATGAAGTGACTGGAACTAATACCGATATGCTT
CGGGGAGCTATAATGTAAGCTTTGATCCGGAGGATTTCCGAANTGGTGGGAACCNATTN
TACTCAANAGTNTTAAANTAATNNACCCCAAAAAA

AB3 MRS - primer 16S

TTTTTTTGTTTTTTTTTGTGATACTTCGGGCTGGTTAACGGCGTCACACATGAGAGTTTGT
AACACCAAGTCGGTGGGGTAACTTTTAGGAGCCAGCGCTAAGGTGGGACAGATGATTA
GGGTGAAGTCGTAACAAGGTAGCCGTAGGAGAACCTGCGTGCTGGATCACCTCCTTTCT
AAGGAATTAATCGGAAACCTACACATTGTCGAAACAGTGTTCAGTTTTGAGGGGTTTAC
CTCTCAGCTTGTACTTTGAAAACTAAATAATATCAATTTCTAATAACAATCAAGAAAACC
GAGAACACCGCGTTATGAGTTTTTAACGAATTATAATCGCATACTCAACTAACTTGACCT
GATCTACGATCAGTACAGGTTACAGTTATGAAGGGCGCATGGTGACATGCCTTGGTACTA
GGAGCCCGATGACAGGAACGGGAGACCTAAACCATCCCTGACTNNTTGCCTTCCGTCGC
TGTGACGCTGTGATAATGCTA

A3 MRS - primer 16S

TTTTTTTGNTTTTTTTTGTATCCGGCTCGTGTTATGCCGTCNACCATGGAGCAGTTTGTGA
ACNCAAGTCGGTGGGGTAACTTTTAGTGAGCAGCGCTAAGTGTGGGACAGATGATTAGG
GTGAAGTCGTAACAAGGTAGCCCGTAGTGAGAACCCTGCGGCTGGATCACCTCCTTTCT
AAGTGAATTAATCGGAAACCTACACATTTGTCGAAACAAGTGTTCAGTTTTTGAGTGGG
TTTACCTCTCAGTCTTGTACTTTGAAAACTAAATAATATCAATTTCTAATAAAATCTAATGA
AAACCGAGAAAACTANCTGTGTTTATTTTGAGGTTTTTTAAACTGAAATTATAATCGCTAT
ACTCAATTAACTTTTGACTTGAATACTANGGATACAAGT

AQ2 MRS - primer 16S

TGGGGCAAAGCTCGATATTCGGCCTTGATTAATGGCCGTCACACACGAGACGTTTGNAA
CACGAAGTCNGTGAGTGTAACCTTTTTTGGAGCAGCGCTAAATGTNGGATAGATGATTT
GGGGTGAAGTCGTAACAATGTAGCCTGTATCGGAAGTGTGCGTGCTGGATCACCTCCTT
TCTAAGTGAATATTACGTGAAATACACATTCGTCTTACCTTTATGGTTCCATGTATTTTTGG
AAGATGTGTTCCTNAACCTCCTTCCAAAACACAATTTCTGCTTCCATTTTGGAAAACACC
CTTGTGGACTAATTTGNACAATGCTAAATANATTAANTTCTCATTNACNCACTCCACCCC
TTCNCTACCNNTCCCCCCCTNCTTTATCNAATTTCATNCNN

BL1 MRS - primer 16S

GGTACTGTGANCGTCCGGCCCTTGTTTAACGCCGGTCACACACGAGAGTTTGTACACCG
AAGTCGGTGAGTGTAACCTTTTAGTGAGCCAGCCGCTAAGTGTGGGATAGATGATTGGG
GTGAAGTCGTAACAAGGTAGCCTGTATCGGAAGTGTGCGTGCTGGATCACCTCCTTTCT
AAGTGATAAACGGAAGCACGTTTGGGTATTTGTAGTTGAGAGGTCTTGTGGGGCCTTAG
CTCAGCTGGTGAGAGCGCCTGCTTTGCACGCAGTGAGTGTCAGCGGTTCGATCCCGCTA
GGCTCCATTGAATCGAAAGATTCAAGTATTGTCCATTGAAAATTGAATATCTATATCAAAT
TCCATATGTAAGTAATTACATATAGATAGTAACAAGAAAATAATACCTGANAACTGCNTG
GTNATATTTTAAATTGAAGGTTCAGGGTCGAAANGTGTCCAAAAAATAAGGGTATTAAG
TNTTTAAATACATNGGANGTCA

BL1 MRS - primer 16S

GGGGCCCCCCCCCGACTCNGCCTCGGTANTGTCCGTCACACCACCGACGACCTTTGGAC
TNAACGTCGGTACGGTACCCTTTTACGTGACGCAGCGCTAAGGTGGGATAGATGATTGG
GGTGAAGTCGTAACAAGGTAGCCGTATCGGAAGGTGCGGTGGATCACCTCCTTTCTAAG
TGATAAACGGAAGCACGTTTGGGTATTTGTTAGTGAGAGGTCTTGTGGGGCCTTACTCA
CTGGGAGAGCTGCCTGCTTTGCCACGCCAGGCAGGTCCAGCGGTTCCGCATCCCCGCTA
GGCTCCCATTGCAATCGCAAAGCATTCCAAGTCATTTGTCCCATTTGCAACAATTGCAAT
ATCTATCATCCAAATTCCCATATGTAAGTAATTCACCATCATAGATAGTCAACAAGCAAAA
TAAACGAAAGCTGTGAATATTAATGCAGTAGGTCAAGGGCAANATAANAGGGGTTAACG
GTATACCTTAAAAGGGTGNAGCATA

CM3 MRS - primer 16S

GAAAATNAGAGAANGGACNGTNNGGGANGTGTGGANGTGGTNTGTGTGGGGGGTGGG
CNGTTNCNGTATNTNCGCNNTNGTCANGATGTGANGTTGANGTTTGTGAGTTAGNNGTC
TTCANTGTTTGTAGAGNGTATGNNGTATGGTTTTGATGTACNTNTANCANTTGCGTCGGT
TGTGCTTGGGNTTTTNATTATTGTGNTATGTTGTNTGTAGTTGAGNTTNGANTGTAGNGT
GGGTATATTTGTTTTTATCTATTCCNTCTCCTNCATGTGTCAACNGTGNGTNCTATNNATT
NATGTTCTTTCT

CM3 MRS - primer 16S

AAACTTTTTTTTTGTTTTTTTTCTGCGGACATCTGGCCTGNGATTAATGCCTGTCACACCA
TGCAGCCGTTTGGAACTNACCAAGCTGGTNGNTGTCAACTTCTGGGCAGCCCANCTGT
CTCAATGTGGGCACAGCATGCATTCAGTGGTGAAGTCTGTGCAACGCNCATGGCAGCCT
GCATGCAGCAACTGCNGTGCTGGCATCTANCCCCTTNCCATNTTTCCCTAAATGTGACAN
CANATCCTGTGNCANACACCCCTTAACCCATCCAATTTACCCAAATTCCTAGNAATAAAA
CCTTAAAAATAAATTACCNAAATAATATTATATNNCCNCNTTGCCAATTCTACAACCACNC
ATTCCCACATAANTCTAANATTCTATAATCACTTACTACTT

CM4 MRS - primer 16S

TTTTTTTGTTTTTTCTCGATTTCGGCCTCGGTTATGGCCGTCACACACGAGACCTTTGGA
ACTCGAAGTCGGTGAGTGTAACCTTTTTGGAGCAGCGCCTAAGTGTGGGATAGATGATT
GGGGTGAAGTCGTAACAANGTACCTGTATCGGAATGTGCGTGTGGATCACCTCCTTTCTA
AGTGAATATACGTGAAATACACATCGCTACTTTGTCAGTGAAGTGTCCTAACCTCCTCAA
NAAACCATTTC

LV1 MRS - primer 16S

CTTTTTTTTTGGNTTTTTTTGTGATATCCGGCCTCGTTATGCCGTCACACACGAGACTTTG
TAACTACGAAGTCGGTGAGGTAACCTTTTTGGAGCAGCCGCCTAAGGTGGGATAGATGA
TTGGGGTGAAGTCTGTAACAAGGTAGCCGATACGGAAGGTGCTGGCTGGATCACCTCCT
TTCTAAGTGAATATTACTGTGAGACTACACAATATTGTTTTACTTATGTTCAGTTTTTGAG
AGGTTTACTCTCAAACACTATAGTGTATCATTNGAAAACTTGGATAATTTTGAAGTAAATT
GTAATGTATTACAAAACNCTGGAACANCTGCTGTTGAAATTGATGTATTNTATNAAATAA
AAGTATCAATTTGCATANAATANATACTTTGGATCTAAACTTACTAATCTGTNTTAGTAAA
GAAATTGTGATTTCAAACAAAACCCCCC

LV1 MRS - primer 16S

CNANCNNNACCGCCGNCGCGCNGCACGNCNANNCCCGCGCGGGCAGCTGNNCGGGGC
GNTTTTTTTTTTTTNTCTGTGGCCTTTCTTTNTCCCTGTCCCTGCTCGTACCTGGCCCCNG
GTTTCCTGTCCTGTCACACCACCGACTGACNCNCCCTGGGTCNCTGTNTTTNGCCGTCG
TGTGACGTGTACCNCCCTATCAGTTGTGCNGCCANGTCCTTGTCTCATTACACTGTGTTT
GTTGTGACATATANATCATTGACATANTTGTGTGGTGTTTGACATGC

AQ4 M17 - primer 16S

CGGAAGTCGGCCCTGTCTTNCGCCGTCACACACGAGAGTTTGTAATACAAGCCGGTGAG
CTAACCTTTTAGGGAGGCAGCGTCTAAGGTAGGATAGATGATTGGGGTGAAGTCGTAAC
AAGGTAGCCGTATCGGAAGGTGCGGCTGGATCACCTCCTTTCTAAGGAAAAATGTTGCT
TAGGCAAAACATGGGATAACTGTATTGGGAATGTCTGTTATTAGTTTGAGAGGTTTATAC
CTAAAACTGTAAAAATCTTCTCTAACAGAAGAAGGGGCCTTAGCTCAGCTGGGAGAGC
GCCTGCTTTGCACGCAGGAGGTCAGCGGTTCGATCCCGCTAGGCTCCATTGTCAACGAA
GACATAAAAATAGGCTTAGGATGTTGAAAGAGGCGTTTAGCTTCTAGAAACTCAACTAG
ATTTGATCATTGAAAACTGAATAACAATTTCTAAAATAACAAGAAATAAACCGAGAAGT
GGCGTAGTAATACGTCACCTCAAAAAAAGCGTGAGTATGAAAATACTCAATACTTATTAC
CAGATACTTAAATGTATCGAATTAAAGGTTAAGTTAATAAGGGCGCACGGTGGATGCCTT
GGCACTAGAAGGGGGATGAAGGACGTGACTAACTACGAAAATTCTACGGGGGGAGCTG
TAAGGTAAGCATTTGATCCCGTAGGGTGTCCGATGGGGGGACACCCCAACCACGGGCTA
NGTCCTTACNTACCCACAGTCATACCCAAGGCGCCTCCTAA

AQ4 M17 - primer 16S

CGGCCTTGTCTTACGCCGTCACACACGAGAGTTTGTAATACAAGCGGTNAGCTAACCTT
TTAGGAGGCAGCGTCTAAGGTAGGATAGATGATTGGGGTGAAGTCGTAACAAGGTAGCC
GTATCGGAAGGTGCGGCTGGATCACCTCCTTTCTAAGGAAAAATGTTTGCTTAGGCAAA
ACATGGATACTGTATTTGGGAATGTTTCTGTTTATTTAGTTTTGAGAGGTTTATACCTAAA
CTGTAAAAATCTTCTCTAACAGAAGAAGGGGCCTTAGCTCAGCTGGGAGAGCGCCTGCT
TTGCACGCAGGAGGTCAGCGGTTCGATCCCGCTAGGCTCCATTGTCAACGAAGACATAA
AAATAGGCTTAGGATGTTGAAAGAGGCGTTTAGCTTCTAGAAACTCAACTAGATTTGATC
ATTGAAAACTGAATAACAATTTCTAAAATAACAAGAAATAAACCGAGAAGTGGCGTAGT
AATACGTCACCTCAAAAAAAGCGTGAGTATGAAAATACTCAAATACTTATTACCAGATAC
TTAAATGTATCGAATTAAAGGTTAAGTTAATAAGGGCGCACGGTGGATGCCTTGGCACTA
GAAGGCGATGAAGGACGTGACTAACTACGAAATTCTACGGGGAGCTGTAAGTAAGCATT
GATCCGTAGTGTCCGAATGGGGGNANGCCCAACCAGGGGGGCTATGGTCATTACNTATC
GCTAGATTGTCCATAGCGTTGGGGCCTACCATANTTNGCACGGGCCATTGATNCTAATAA
CAAATTGCATCGAAGNTTAGNTTCTTA

BL2 M17 - primer 16S

GGCTGGTTATGGCCGTACACANGAGAGTTTGTAACACGAAGTCGGTGAAGTAACCTTTT
AGGAGCTACGGCTAAAGNGTGGGANAAATAATGGGGGTNAAGTGAACAAAGGTAGCG
GATATGGNAAGNNGTGGTTGGATATAACTTCTTTATTAAGGATAAGGGAAGAAGTAAGTT
TAGTTAGNTTGAAGTGTTTGTNGG
CM2 M17< - primer 16S

GAAAAGCTGAAGTCGGGCCTNNATACGCCGTCACACACGGGAGTTGGGAGTACGAAGT
AGGTTGCTAACGAAGGGAGGGCGCTTCCTAAGGTAAGACCGATGACTGGGGTGAAGTC
GTAACAAGGTAGCCGTATCGGAAGGTGCGGCTGGATCACCTCCTTTCTAAGTGAATATAT
ACAAAGACGTGAGCATTCAACTTTATTCAGTTGAGTGGGTAGTCATAAACCTAATGCCA
AGAATCACACTTCTTGATTTGTTGTGGTGCCTTAGCTCAGCGTGGGAGATGCTGCCTGCA
TTATGCACGCAGGAGTGTCAGCTGGTTCTGATCCCTGCTAGTGCTCCATTGTCCAGACAA
TGACTGTTTAAAATCACTTTGAACACCATTTGANNAATCACTANTATAACAAATATCTAAT
TAACGAATNAAATTAAATCTCTAAAAAAATGGCT

CM2 M17> - primer 16S

TTTTTTNTTTTTTTTTCTGTGTCGGCCTTTNATTACGGCCGTCACACATGGAGAGTTGGTA
TGCNNCGAGTAGGTAACTGTAACCTTTTAGGAAGGCNCTTACCACTTTGTGATTCATGAC
TGGGGTGAAGTCGTAACAANGGTAACCGNAGGGAACCTGGTGGTGGATCACTTCTTACT
TAANAAAACTGCTTTGATTGTACACAGATTGTT

CM3 M17 - primer 16S

GNAATCGATCATTCGGGCTNTACNTACGGCCGGTCACACCATGGGAGGTGGGTTGGCAA
GAAGTATGTAGCTTAACCTTCGGGGAGGGCGCTTACCACTTTGTGATTCNTGACTGGGG
TGAAGTCGTAACAAGGTAACCTGTAGTGGGAACCTGCGTGTTGGATCACCTCCTTACTG
AAGATACCTTCCCGGAAGTGCTCACACATGGAATTTGTTCTTGACTACAGANANNAACG
TTAAATTGACGCACGTGACCTGTGCATTGACCGAACAGTACAGTAAAC

CM3 M17 - primer 16S

TTCCCTTTTTTCTGATTCGGCCTTNCTTCGGCCGGTCACACCATGGGAGTGGGTTGNAGA
AGTAGGTAGCTTAACCTTCGGGAGGGCGCTTACACTTTGTGATTCATGACTGGGGTGAA
GTCGTAACAAGGTAACCTGTAGTGGGAACCTGCGTGTTGGATCACCTCCTTACCTGAAG
ATACCTTCCCGCGAAGTGCTCACACAGATTGTCTGATAAAAAGTATGAGCAGACTGGCT
TGCCGAAAGATCGAGTAGNCACTTTTTGTTGTCCCCCTTCCGTACTAAGNCGCGTATAGA
GAACCTCCNCGNCCTCTTTTACACGGTGGTGTGCACCACAGGGGTGTTACAGAATCCCT
CATTAGGGGGGCACAGCACCATTTTGCCTTTTGTGNTTGACAGTGGTAGAACNCGGGNT
TGTACTNCGCA
SM4 M17 - primer 16S

TTTGGCCTCTGATCGTCCGGCCTTGTTTAACGCCGTCACACCACGAGAGTTTGTAACACC
GAAGTCNGTGANGTAACCTTTTAGTGAGCAGCGCCTAAGGTGGGATAGATGATTGGGGT
GAAGTCGTAACAAGGTAGCCGTATCGGAAGTGTGCGTGCTGGATCACCTCCTTTCTAAG
TGATAAACGTGAAGCACGTTTGGGTATTTGTTTAGTTTTGAGAGTGTCTTGTGGGGCCTT
AGCTCAGCTGGTGAGAGCGCCTGCTTTGCACGCAGGAGTGTCAGCTGTGTTCGATCCCT
GCTAGTGCTCCATTGAATCGAAATGATTCAACGTATTTGTCCATTTGAAAATTTGAATATC
TATATCAAATTCCATATGTACAGTAATTACATATAGATAGTAACCAATGAAAATAAANCTG
AAAACGCTGTTGAATTATTTAACATTGAAGTTTAGGGTCTGGAAAAAGGGCCAAAAAAC
ATAATGGGTTAANGTTAACACTAAANGNGGGCAGACAAACAGGGAGTGTGGAATGCAC
ANTTGNGGATCGAC

SM4 M17 - primer 16S

GGCNANCCNTGATATGGCTGGTTANGCCGTCACACCACGAGAGTTTGTAACTACGAAGT
CGGTGAGGTAACCTTTTAGTGAGCCAGCGCCTAAGGTGGGATAGATGATTGGGGTGAAG
TCGTAACAAGGTAGCCGTATCGGAAGGTGCGGCTGGATCACCTCCTTTCTAAGTGATAA
ACTGGAAGCACGTTTGGGTATTGTTTAGTTTTGAGAGGTCTTGTGGGGCCTTAGCTCAGC
TGGGAGAGCGCCTGCTTTGCACGCAGTGAGNGTCAGCTGGTTCTGATCCCTGCTAGTGC
TCCATTTGAATCGAAAGATTCAAGTATTTGTCCATTGAAAATTGAATATCTATATCAAATT
CCATATGTAAGTAATTACATATAGATAGTAACAATGAAAATAAACCTGAAACTGCTGTGAA
TATTTAATGAGTTAGGTCGAAAGGGCAAAAATAAGTGTTAAGTTAAATAAGNGGCGCAC
TGGTTGGGATGCCATTGGGAAACATAAGAAAAGGCCCAGATTAGAAAAAGGANTGGTT
GGAAGTAAAATGAAA

AB1 MRS - primer 23S

TCATATGGCCAGGGCTCTCCCACGGNGCGCCCCTANTATAACNCTAAACCTAATTTATGG
GCCTATTCGAGACCNACTTCATAACATNTATCCACAGGGGTTCCGGGTTAATTTCCTTGG
TAACCAATCCTAATATTGTGTAACTACCTNNACCTTATTGGGACATTTGGCATCNTCAGAC
ATCTTCCAATTTTCTCCCAATTGGTGCACCATTACATTTTGGACATTCCTTCCGGAATCCC
CACATGGGACAGCCTTAAGCGGTGGGAACTCGGACAANCCGGTTGAACCTTCCTGGCG
GTTGCANAAGCAATGGCGTGCTTCTTCCCAAAGGTTTTGATAGCTATAAAGTGTGGCCCC
AACAAAGACACCTTTCTTTCCACACACATTAAACAACCGA

AB1 MRS - primer 23S

CGACCGATACTATNACGCCCCACTGGTNAGTGATGCACGCTGTCTCTAACCCGGGTCTAT
TTGCCACGGTATCCNCGGGGGGCCCTATATAAACTAAACCCTAATTNCTGGGCCTAANNA
GACCTNAACTTCACNTAAACTNATTCACCACAGGGGGGTTCCNGGTTACTTTCCCTGGN
TAACNATANTCATATTANTGGTACANTAACCTATACCTATATTGGGACACTTTGAGACTATT
ACGAGANTATTTCCACATTTTTCCACTTGGGACCACNTACTTTGGACNTTCCTTTCCAGA
CTTCCAATTGGGACGCCTATACTGNCGTGGAGATTCGAGAACCCGGGTATAGAACCTTCC
TTGTGACGAGTTNGGCAAAGGCAAGTGGCGGCTATCTTCCCCCAGGGCTATTGAGGGCT
ATAATGTGGCCCCCACAAAGAANCCTTCTTTCAAAAACTTAAAACCAATTTACCCCCCA
AAAACNGGNTTGGCTTCNCCCGGGGGTNTCACATCCCTTTTTCAGGACACACGTGGGCA
TCGGGTCGAAACTCCCTTAAGGNCCCGGGGCAAACCCTATTCTCCCGGNATTTANNCGT
GGG

AB2 MRS - primer 23S

CNCCCACCNGCCACCNCNCCACCTNTANANCCCCACACNCTCTNACACTACACTATACA
TATAGTCTCCGCCCCCACGGGGGGTTTTATAGAGTANTATGNGCCCCCGANGGCCCTTAA
CNANTCTTGGAGGACCTCCCTATATTGCCAAGGGGCTATNNNCACTGTGTGTGNGTGCC
CATTGTGGAAACTTNANCCGGTCACTTGTGNACTTTGTGCGGTCTCNANGACTGTGGGT
TCACNNNTGCGCACANGTGCGCACAAATTTTCCTCTTTTTATCCACAGACACACACTCTC
ACTTTCACCACAACATCTCANCGGGCCTGTGGGTGTATCTCTCTCGTGGTGGCCCACATT
TTAACACACCACCACACCAAATTATACACATTTNCACCACACATAGTGAGATATANACTC
CACNAAGTTTATCTCACAACAACAGGTACAACA

AB2 MRS - primer 23S

GACCTGAACATAATATACGCCCNCCATAGGTTTATANTAAGCCGGGCATAAACTCTGNGC
TCCTATATTGGCAAGGGGTTCCACGGGTGGCGCCCCTTGTGTACTCTTAANCCTGGTACT
GGACTTGCGTACAGGGGGTANTNGNAAAGGNAGAAATTCCTTTTCACNGAGAAACTTC
TTACCAAATTCCGNCTGGGGTCTCTGGCANTTTAACAACCAATTTACTTACCAATTGGAT
TATCCAGGTTATNCACAAGNAACCAAAGGGTCGGCACCCGGTAAGGTGGTGGCCTGGA
GTGTGGTTGATTCCCCTTCAAANTTACAACAAAGGTACCGGTGGTGTGCAGTGGTTCCC
GGTCAGNAACTTTCANGTCTGGTTACCTTATAGAAAAGTGGAGGGTGATCCAAAGCCGG
CAGGGTCCTTCCTTAGGGGTTTATCCTATTGGGTT

AB3 MRS - primer 23S

TTATGCTCCCGCGGTCTCTTACCCCCGGTGTGCCTTTATACCACAGGGGCTATTACAACAT
GTGTGTGCCCCTTACANTATACACTTATAACCCTTATACCCCGCGGCTTGGATAGACANTT
TTTGGCTCACACGGNTACACGTTTGTAGANCGTATATTGTGGGAGACNTAATACTACACT
TCTGTGGTTCACACACACCTCTCTACACACATTTACACCGCGCGCGTGGTTGTGTTTNCT
CCTCGCGGTGNTATCATCCTCTTGTGAGCACCTTTTTCACCTTACAACGACAACACATCT
TTGTGGGACAACATCTTANCCTTNACACNGTATTATTTATCCACCAACNAGTGTTTTAAC
CCACAGCGGCCNTGTGATCCGACACGGGGGGTAACAAC

AQ1 MRS - primer 23S

AGACTCATGAGGTATGTAAGNANNTGNGTTNNNTGNTTTTTNCTTTGCTATNNTCANATC
TTAGACTACANGCAAATACTATNTAAGNTNANNAATTTNTTGGATATNTANATNNAACNT
ANTATTTTTACTNNNNTAGTTAGNGNATGGGATTCTTNATNTNTGANNTANNCGATATAAT
NGGNNANANGANGGATGCAGCTTGGTGGTTGGAAGANATAGAAANGGATGNATTANAN
TATNNNACANGTGGTAAGTANCCAAAAATANTANACAATNATCNGTNNANNAGAAANA
AATATAAGGAGTGGNNNTGCTGTATNNATAGCGTNAGTNTANTAANCAATTNGGATGNN
ACTGGGGTGGAANGTGCGGANGGGNTTTAATGTGTGACTGTNNAGTNTANNTCTGGTG
GCTTGCNTGTNTNNGCGTTCTGGGTGCNTTGTNAACGTNCAAACNGCATNTAANNACN
GAACAGTGCTANTGGACNAGNGTNNTGTCTGTNACTTNNTTTGNTCTTTGTTGTTGNTG
GATCGGTCNTTGNGNGCNGTTNNCTTTGGTNGTGTGA

AQ1 MRS - primer 23S

ACCCTNTTGGAATTCTTATGCCCCCAGTGTTTACATTNCGAGTTCGCGGCCTATACCCGG
GNTCTCTTTTGGCGGTTCCACCGTGNGGGCCTCTTGTGGACCTTANCCTCGTGNACCGG
GCCTGGGGTGTCACANGGGGTATNTGGGACACTGGGGTNACACNATTTCCTCTAATTCA
TATTCTACGAGACACACATNCCTATACACCACAATATACAGGGCTGTGGGTGNGTCCTCT
GGGGGGCACAATTTACACACACACCCTATTCNCACCCACACCAATTGTGGCNATATATTC
CCACGAGGGTTATCCACAACANGGGACANACCACAAGTNGTTCGAGCACACCCTGGNC
TTATCANGGGGTGGGNNGTTGGCCAATTGNGACACACGGGTGGG

AQ2 MRS - primer 23S

TTTTTCTTTATATTTATATAGCCCCTGTTAATGTAGCGGCTATACGGCTCTAGTAGCAGGCT
TCCCCGGGGGCGCCTATATCTTTAACCTATTCAACCTACAGGGTGGGGCTCTGGANCCAT
CCTCCTAGCGAATAAAAAGGGTAAATCATTAAAGTAGGCANTTGGACTTTATTTAAAAAA
CTTCATTNCCAAGGCTGGTGGTCCTCGGTTGGTTGGATCCGTTGAATCATAATTCCCAGT
ATTTTCAATNGAANCGGANNTNGTGTGTGGAGCAGTTAAGAC

AQ2 MRS - primer 23S

CTGTCTTNTCAGCCCCCCCAGTTGTTTAGTGTTAGCCNGGCCTNNNCCTCGGTCTCCTAT
TGGCTGGCTATCCCCGGGGGCGCCCTATATTCCTCTTANCCCTTTATCCACCTTACGGGGT
GGGGCTCTNGACCCCANTTNCTTCTCTCTCAGTCGTGNCAATGAGACAAGTGTGTTTAC
AACTCCAATCACGNGNTCAAGGCCAATATTGTGNACAACTTCATATTACACAACACCCTC
TTCCTATACTCCCACATGGCTGNGNGTGGTCCCNCTCGGAGGACTAGGGGAAATGGGAA
T

BL1 MRS - primer 23S

CCCAGTACGCCAACGCCCCACGTGAATGGTAGACGCGCNAACGCGGTATTATGGCNAGG
TATCCACGTGGGGCGCCCTATTTAANTNAACCTAATTTTGGGCCTTTCGAGACCAAATTC
ATAAATTATTCNCAGGCGGTTCCGGGTTAATTTCCTGGTANCAATCAATATGGTANTACNT
TACCTTATTGGGANTTTGGATAATAGNATANTCCATTTTCAATGGGCACANTACACTTTG
GANAGTTCTNTNCGGAATCCCAGATGTGGCAGCCTTAAGCGTGGGGAAATCGGAAACC
GGGTTTGAACCTTCCTGTGCGGTTGCAAAAGCATGGGGCGGCTTCTTCCCCAANTTTGA
AGGCTTAAATGGCCCCCCAAAAAAAGAACCTTCTTTCAAAAATTAAAAACAATTAACCC
AAAAGAGGTTGCTTTATCCCGGGTTTTAATCCCCTTTTNGACACAGGCGAGNGTGCGAA
TNCCCTAAAGTCCNGGGACAAACCTTTATCCCGGGATATANCCGTGTGTTTACAACCCTT
TGGGTTTTCCACGCAAAGTTTTTCAACCCCCCTCAAAATTCCATCTTAAATTCCCCCCA
AACCTT
Anexo D - Perfil de digestão dos fragmentos amplificados por PCR do espaçador 16S-23S rRNA de diferentes espécies de BAL

Tabela 17: Perfil de digestão dos fragmentos amplificados por PCR do espaçador 16S-23S rRNA de diferentes espécies de BAL

16S 28 74 121 215 238/ 273/ 326/ 333/ 420 420 464 544 23S
414 527 352 384
Enzimas SphI NcoI NheI SspI SfuI HindIII DraI VspI Eco RI HincII AvrII EcoRV Esp.
L. casei - - - - - + + + - - - +
L. rhamnosus - - - - - + + - - - - +
L. fermentum + - - - - - - + - - - -
L. acidophilus - + - - - + - - + - + -
L. lactis - - - - - - + - - - + - HaeII
/
PvuII
E. faecalis - - - + ? - - - - - - - PvuII
Anexo E - Perfil bioquímico de cepas de Staphylococcus spp. isolados de queijo de coalho
artesanal e industrial

Tabela 18: Perfil bioquímico de cepas de Staphylococcus spp. isolados de queijo de coalho
artesanal e industrial.

Linhagens Coagulase Termonuclease Maltose Manitol Hemólise Catalase Gram


AQAT1 + + + + + + CG+
AQAT2 + + + + + + CG+
AQAT3 + + + + + + CG+
AQAT4 + + + + + + CG+
AQAT5 + + + + + + CG+
AQTP1 + + + + + + CG+
AQTP2 + + + + + + CG+
AQTP3 + + + + + + CG+
AQTP4 + + + + + + CG+
AQTP5 + + + + + + CG+
CMTP1 + + + + + + CG+
CMTP2 + + + + + + CG+
CMTP3 + + + + + + CG+
CMTP4 + + + + + + CG+
CMTP5 + + + + + + CG+
LVAT1 + + + + + + CG+
LVAT2 + + + + + + CG+
LVAT3 + + + + + + CG+
LVAT4 + + + + + + CG+
LVAT5 - - + + + + CG+
SMTP1 + + + + + + CG+
SMTP2 + + + - + + CG+
SMTP3 + + + + + + CG+
SMTP4 + + + + + + CG+
SMTP5 + + + + + + CG+
ABTP1 + + + + + + CG+
ABTP2 + + + + + + CG+
ABTP3 + + + + + + CG+
ABTP4 + + + + + + CG+
ABTP5 + + + + + + CG+
BLTP1 + + + + + + CG+
BLTP2 + + + + + + CG+
BLTP3 + + + + + + CG+
BLAT1 + + + + + + CG+
BLAT2 - - + + - - CG+
BLAT3 - - + + - - CG+
Legenda: AT = colônia atípica; TP = colônia típica; CG+ = cocos Gram positivo
Anexo F - Identificação bioquímica de linhagens de Staphylococcus spp. isolados de queijo de
coalho artesanal e industrial.

Quadro 5: Identificação bioquímica de linhagens de Staphylococcus spp. isolados de queijo de


coalho artesanal e industrial.

Queijo Staphylococcus spp. (número de linhagens)


BL S. aureus (4); S. cohnii (2)
LV S. aureus (4); S. cohnii (1)
AQ S. aureus (10)
CM S. aureus (5)
AB S. aureus (5)
SM S. aureus (4); S. intermedius (1)
Anexo G - Antagonismo frente a Listeria monocytogenes e teste de sensibilidade aos antimicrobianos
de Lactobacillus casei.

Figura 13: Antagonismo de Lactobacillus casei isolado de queijo de coalho artesanal frente a
Listeria monocytogenes.
Figura 14: Teste de sensibilidade de Lactobacillus casei isolado de queijo de coalho artesanal
frente à diversas drogas antimicrobianas.
Anexo H - Diversidade da microbiota presente em queijo de coalho artesanal e industrial,
produzidos no estado de Pernambuco

Quadro 6: Diversidade da microbiota presente em queijo de coalho artesanal e industrial, produzidos no estado de
Pernambuco

Amostra Microrganismos isolados


AB Streptococcus thermophilus, Lactobacillus fermentum, Lactobacillus casei,
Staphylococcus aureus
AQ Lactobacillus rhamnosus, Lactococcus lactis, Enterococcus faecalis,
Staphylococcus aureus
BL Streptococcus thermophilus, Staphylococcus aureus
CM Weissella confusa, Enterococcus faecalis, Lactococcus lactis, Erwinia
amylovora, Escherichia coli, Staphylococcus aureus
LV Enterococcus faecalis, Lactobacillus acidophilus, Staphylococcus aureus,
Staphylococcus cohnii
SM Streptococcus thermophilus, Staphylococcus aureus, Staphylococcus
intermedius
Anexo I - Produção industrial e artesanal de queijo de coalho.

As figuras 15, 16, 17 e 18 mostram as instalações do laticínio (BL) visitado, localizado no município de São Bento do
Una (PE), onde foi coletada uma amostra de queijo de coalho industrial.

Figura 15: Silos de estocagem de leite

Figura 16: Detalhe de piso e parede da área de recepção do leite

Figura 17: Vista interna da sala de processamento de queijos


Figura 18: Detalhe da sala de processamento de queijos
As figuras 19, 20, 21, 22 e 23 mostram o segundo laticínio (LV) visitado, localizado no município de Água Preta
(PE), onde foi coletada amostra de queijo de coalho industrial.

Figura 19: Área de recepção do leite.

Figura 20: Tanque de fabricação de queijo de coalho

Figura 21: Processo de salga na massa do queijo de coalho


Figura 22: Enformagem do queijo de coalho

Figura 23: Sistema de ordenha mecânica da Fazenda onde está localizada a indústria LV
As figuras 24, 25, 26, 27, 28 e 29 mostram as instalações desta fazenda (AQ), onde foi coletada amostra de queijo de
coalho artesanal.

Figura 24: Recepção do leite na sala de produção de queijo


Figura 25: Leite colocado no recipiente para coagulação

Figura 26: Utensílios utilizados para produção dos queijos


Figura 27: Mexedura e quebra do coágulo

Figura 28: Massa do queijo dessorando dentro de sacos de plástico


Figura 29: Enformagem dos queijos

As figuras 30, 31 e 32 mostram as instalações desta fazenda (CM), onde foi coletada amostra de queijo de coalho
artesanal.

Figura 30: Vista externa do local destinado à produção de queijos


Figura 31: Utensílios utilizados para fabricação dos queijos

Figura 32: Enformagem dos queijos


Anexo J - Extração do DNA total

Após o isolamento, purificação e caracterização fisiológica dos microrganismos isolados de queijo


de coalho artesanal e industrial, os mesmos foram cultivados em cinco mL de caldo MRS e caldo
M17 para extração do DNA. A figuras 33, 34, 35 e 36 demonstram os DNA’s totais obtidos destas
culturas, através da fotodocumentação de géis de agarose (1,0%), submetidos à eletroforese,
utilizando-se 100V durante 30 minutos.

Figura 33: DNA total de amostras de microrganismos fermentadores de lactose, isolados de queijo
de coalho em ágar MRS (canaletas da esquerda para a direita: 1-marcador de peso molecular; 2-
AB1; 3-AB2; 4-AB3; 5-marcador de peso molecular; 6-CM1; 7-CM2; 8-CM3; 9-CM4; 10-LV1; 11-
LV2 e 12-LV3).

Figura 34: DNA total de amostras de microrganismos fermentadores de lactose, isolados de queijo
de coalho em ágar M17 (canaletas da esquerda para a direita: 1-AQ1; 2-AQ2; 3-AQ3; 4-AQ4; 5-
CM1; 6-CM2; 7-CM3; 8-CM4; 9-SM1; 10-SM2; 11-SM3; 12-SM4).
Figura 35: DNA total de amostras de microrganismos fermentadores de lactose, isolados de queijo
de coalho em ágar M17 (canaletas da esquerda para a direita: 1-marcador de peso molecular; 2-
AB1; 3-AB2; 4-AB3; 5-AB4; 6-marcador de peso molecular; 7-LV1; 8-LV2; 9-LV3; 10-LV4; 11-
vazia; 12-vazia).

Figura 36: DNA total de amostras de microrganismos fermentadores de lactose, isolados de queijo
de coalho em ágar MRS (canaletas da esquerda para a direita:1-vazia; 2-SM1; 3-SM2; 4-BL1; 5-
BL2; 6-AQ1; 7-AQ2) e M17 (amostras da esquerda para a direita: 8-BL1; 9-BL2; 10-BL3; 11-BL4
e 12-marcador de peso molecular).
Anexo L - Amplificação da região intergênica 16S-23S por PCR

Os resultados destas PCR’s são apresentados nas figuras 37, 38 e 39. Pela observação das fotos dos
géis de agarose 1,4%, submetidos a 100V por 45 minutos, pode-se verificar a presença de diferentes
espécies de microrganismos, evidenciado por diferentes perfis de amplificação (número de bandas
amplificadas e pesos moleculares distintos).

Figura 37: PCR 16S-23S de DNA de amostras de microrganismos fermentadores de lactose,


isolados de queijo de coalho, em ágar MRS (canaletas da esquerda para a direita: 1-marcador de
peso molecular; 2-AB1; 3-AB2; 4-AB3; 5-CM1; 6-CM2; 7-CM3; 8-CM4; 9-LV1; 10-LV2; 11-LV3
e 12-marcador de peso molecular)

Figura 38: PCR 16S-23S de DNA de amostras de microrganismos fermentadores de lactose,


isolados de queijo de coalho, em ágar MRS (canaletas da esquerda para a direita: 1-marcador de
peso molecular; 2-AQ1; 3-AQ2; 4-BL1; 5-BL2; 6-SM1 e 7-SM2) e M17 (canaletas da esquerda
para a direita: 8-BL1; 9-BL2; 10-BL3; 11-BL4 e 12-marcador de peso molecular).
Figura 39: PCR 16S-23S de DNA de amostras de microrganismos fermentadores de lactose,
isolados de queijo de coalho, em ágar M17 (canaletas da esquerda para direita: 1-marcador de peso
molecular; 2-AQ1; 3-AQ2; 4-AQ3; 5-AQ4; 6-CM4; 7-CM3; 8-CM2; 9-SM1; 10-SM2; 11-SM3 e
12-SM4) .
Anexo M - Digestão enzimática dos produtos de PCR

As figuras 40, 41, 42 e 43 ilustram alguns dos resultados das digestões enzimáticas. Através da
observação das mesmas, pode-se identificar alguns microrganismos isolados ao nível de espécie,
quando os perfis de digestão são comparados aos padrões.

Figura 40: Digestão de produtos de PCR 16S-23S de cultura identificada como Lactobacillus
rhamnosus (canaletas/enzimas da esquerda para a direita: 1-SphI, 2-NcoI, 3-NheI, 4-SspI, 5-SfuI, 6-
EcoRV, 7-DraI, 8-VspI, 9-EcoRI, 10-HpaI, 11-HindIII e 12- marcador de peso molecular).

Figura 41: Digestão de produtos de PCR 16S-23S de culturas identificadas como Lactobacillus
casei e Lactobacillus fermentum (canaletas/enzimas da esquerda para a direita: 1-marcador de peso
molecular, 2-SphI, 3-NcoI, 4-NheI, 5-SspI, 6-SfuI, 7-EcoRV, 8-DraI, 9-VspI, 10-EcoRI, 11-HpaI,
12-HindIII).
Figura 42: Digestão de produtos de PCR 16S-23S de culturas identificadas como Lactobacillus
rhamnosus (canaletas/enzimas da esquerda para a direita: 1-marcador de peso molecular, 2-SphI, 3-
NcoI, 4-NheI, 5-SspI, 6-SfuI, 7-EcoRV, 8-DraI, 9-VspI, 10-EcoRI, 11-HpaI, 12-HindIII).

Figura 43: Digestão de produto de PCR 16S-23S de cultura identificada como Lactobacillus sp. do
grupo acidófilo (canaletas/enzimas da esquerda para a direita: 1-marcador de peso molecular, 2-
SphI, 3-NcoI, 4-NheI, 5-SspI, 6-SfuI, 7-EcoRV, 8-DraI, 9-VspI, 10-EcoRI, 11-HpaI, 12-HindIII)