Você está na página 1de 2

Data: _____ / _____ / 19 Disciplina: Biologia– Mercia Vaz

9º Ano do Ensino Fundamental II Bimestre


Aluno(a): __________________________________________________________________________
Estudo Dirigido

1. O que significa: DNA e RNA

2. As bases nitrogenadas podem dividir-se em dois grupos. Caracterize esses dois grupos, indicando as bases
constituintes;

3. Desenhe a composição de um nucleotídeo, identificando suas partes.

4. Os nucleotídeos estabelecem ligações entre si, formando cadeias polinucleotídicas. Refira como se
designam essas ligações.

05. A molécula de DNA é constituída por...

a) uma cadeia de polipeptídeos unidos por pontes de hidrogênio.


b) duas cadeias de polipeptídeos formando uma dupla hélice.
c) uma cadeia de nucleotídeos que tem a capacidade de se replicar.
d) duas cadeias de nucleotídeos unidas por pontes de hidrogênio.
e) duas cadeias de bases nitrogenadas unidas por polipeptídeos.

06. Numa molécula de DNA, a quantidade de...

a) adenina mais timina é igual à de citosina mais guanina.


b) citosina mais uracila é igual à de timina mais adenina.
c) uracila mais adenina é igual à de citosina mais guanina.
d) guanina mais timina é igual à de citosina mais uracila.
e) adenina mais citosina é igual à de guanina mais timina.

07. O esquema seguinte representa duas cadeias de ácidos nucléicos. Podemos concluir que...

a) I e II correspondem a duas moléculas de RNA.


b) I e II correspondem a duas cadeias de uma molécula de RNA.
c) I e II correspondem a duas cadeias de uma molécula de DNA.
d) I corresponde a uma cadeia de DNA e II a uma cadeia de RNA.
e) I corresponde a uma cadeia de RNA e II a uma cadeia de DNA.

08. O esquema seguinte é referente à estrutura do DNA. Os algarismos 1, 2 e 3 representam, respectivamente...

a) base nitrogenada, desoxirribose e fosfato.


b) base nitrogenada, fosfato e desoxirribose.
c) fosfato, desoxirribose e base nitrogenada.
d) fosfato, base nitrogenada e desoxirribose.
e) desoxirribose, fosfato e base nitrogenada.
09. Escreva a sequência de bases da fita complementar do DNA dupla fita que apresenta uma fita com a sequência:
(5') ATGCCGTATGCATTGCATTC (3')

10. Num organismo um pesquisador verificou que uma molécula de DNA continha 22% de GUANINA. Com base nesta
informação determine qual o percentual de cada uma das outras bases.

11. Cite as principais diferenças entre RNA e DNA quanto à estrutura de nucleotídeos?

12. Se uma fita de DNA tiver constituição 5’ATAAGCGTTAG 3’, como será a molécula complementar de DNA?

13. Diferencie RNAm, RNAt e RNAr.

14. Para que possa ocorrer a síntese de proteínas, devem ocorrer em ordem que eventos?

15. Onde que organela esta relacionada a ocorrência da síntese protéica?

16. Considerando-se o total de bases nitrogenadas do DNA de uma espécie qualquer igual a 100, se nela existirem 15%
de timina, qual será as porcentagens das demais bases?

17. Por que dizemos que a replicação do DNA é semiconserativa?

18. O que é o sítio promotor? E o sinal de terminação?

19. O que é um códon?

20. Por que dizemos que o código genético é degenerado?

Você também pode gostar