Você está na página 1de 117

CICLO CELULAR

Compreende todo o período que vai desde o ocorre crescimento da célula até alcançar seu
surgimento da célula até o momento em que tamanho normal. Há intensa produção de RNA
ela se divide. O ciclo celular é dividido em duas no núcleo, e síntese de proteínas no citoplasma.
etapas principais: divisão celular e interfase. A
divisão compreende a mitose, divisão do núcleo, 2) Período S: vem de synthesis. Nele, a
e é normalmente seguida imediatamente pela célula duplica seu material genético, graças
citocinese, divisão do citoplasma. à replicação do DNA da cromatina. Após a
duplicação, o cromossomo, que era formado
por um cromonema, passa a ter dois filamentos
INTERFASE unidos pelo centrômero. São duas cromátides-
irmãs.
O período que antecede a divisão celular é
chamado de interfase. Este período é caracteriza- 3) Período G2: duplicado todo o material
se por intensa atividade metabólica. hereditário, a célula entra em outro período de
crescimento, semelhante ao G1, mas com menor
A interfase é dividida em três períodos: produção de RNA e de proteínas. É o momento de
aparecimento das proteínas que irão constituir
1) Período G1: a letra G vem da palavra gap, que o fuso mitótico, assumindo um arranjo especial
CITOGENÉTICA

significa “intervalo”, em inglês. Nesse período, organizado pelos centríolos.

A quantidade de DNA
que a célula possui num
determinado momento do
ciclo celular varia de acordo
com os períodos sendo
mínima no período G1,
dobra em S, atinge o valor
máximo em G2 e volta a ser
mínima na telófase, como
mostrado no gráfico abaixo.

16
Na mitose, verificamos comportamentos
MITOSE característicos dos cromossomos, mudanças na
É o processo de divisão que origina duas células- estrutura do núcleo, da membrana nuclear, dos
filhas com o mesmo número de cromossomos da centríolos e do nucléolo.
célula-mãe. A mitose para os seres unicelulares,
As fases da mitose são em número
significa reprodução. Quando um protozoário
de quatro e são denominadas como:
se divide, está, na verdade, originando 2 novos
prófase, metáfase, anáfase e telófase.
indivíduos.
A. PRÓFASE
Para os pluricelulares, divisão celular se relaciona com
É a mais longa. Tem início com um discreto
1) Crescimento: o aumento do tamanho do
aumento de volume do núcleo. A cromatina
indivíduo se dá pelo aumento do número e do
começa a se espiralizar. Os nucléolos
tamanho das células.
desaparecem.
2) Renovação celular: certos tecidos substituem
Os centríolos já duplicados migram para os polos
periodicamente suas células graças às divisões
da célula. Durante a migração, fibras proteicas
de células precursoras. Assim ocorre a renovação
se colocam como raios ao redor dos centríolos,
dos glóbulos vermelhos do sangue e da camada
formando o áster. Surgem, também, fibras que
superficial da epiderme.
ligam um par de centríolos ao outro, formando o
fuso mitótico ou fuso acromático.

CITOGENÉTICA
3) Regeneração: alguns tecidos, como o tecido
hepático, têm grande poder de substituir células
No final da prófase, a carioteca se rompe e os
mortas graças às divisões das células restantes.
cromossomos, através dos centrômeros, ligam-
4) Cicatrização: nos casos de perda de células se às fibras do fuso mitótico.
devido a lesões acidentais ou provocadas,
B. METÁFASE
ocorre substituição do tecido original por outro,
formando o que chamamos de cicatriz. Isto Os cromossomos se colocam na região equatorial
ocorre quando se faz uma cirurgia, por exemplo. da célula. As cromátides-irmãs, ainda unidas
pelo centrômero, atingem seu grau máximo
5) Manutenção do número de cromossomos
de condensação, tornando-se bem visíveis ao
da célula: a mitose pode ocorrer em células
microscópio. É nesta fase que melhor se visualiza
haploides (N), diploides (2N), triploides (3N), etc.
os cromossomos.
Todas originam 2 células-filhas com o mesmo
número de cromossomos. C. ANÁFASE
As pesquisas mostram que, com o crescimento Seu início é marcado pela divisão dos centrômeros
da célula, a relação entre o volume celular e a e separação das cromátides-irmãs. As fibras
área da sua membrana se torna desproporcional do fuso mitótico se encurtam e tracionam os
até alcançar um valor crítico, que desencadeia a cromossomos arrastando as cromátides-irmãs
divisão celular. Como a superfície da membrana para polos opostos (metacinese).
é importante para as trocas com o meio externo,
se essa superfície fica pequena em relação ao No final dessa fase, em cada polo há número de
volume interno a ser mantido, a célula entra em cromossomos igual ao que havia na célula que
divisão originando duas células-filhas menores iniciou a divisão, embora agora com apenas um
e, portanto, capazes de absorver os nutrientes filamento cada um. Tem início a desespiralização
necessários à sobrevivência da célula ou tecido. dos cromossomos.

www.biologiatotal.com.br 17
D. TELÓFASE
Os cromossomos desespiralizados estão Na região equatorial, em toda a circunferência
dispostos em dois conjuntos, um em cada polo. da célula, surge o sulco de divisão, e, à medida
que se aprofunda, aumenta o estrangulamento
Cada conjunto é envolvido por uma nova nesta região. Ocorre a separação das duas
carioteca, que surge pela fusão de segmentos células-filhas. É a citocinese.
do retículo endoplasmático. Desaparecem os
filamentos do áster e do fuso mitótico.

Cromátides
Cromossomos irmãs
duplicados em
condensação Fibras
cromossômicas
Carioteca

Cromossomos
condensados
Nucléolo em alinhados no
desaparecimento equador
(placa metafásica)

1. Prófase 2. Metáfase

Divisão
citoplasmática
CITOGENÉTICA

(citocinese)
Encurtamento
das fibras
cromossômicas Reaparecimento
dos nucleólos
Cromossomos
irmãos migrando Reorganização
para polos opostos das cariotecas

3. Anáfase 4. Telófase
Etapas da mitose

LEITURA COMPLEMENTAR
Cientistas descobrem que é impossível escapar do
envelhecimento
A fonte da juventude é uma lenda espalhada A busca por algo que nos tornaria sempre
por várias culturas. Quem bebe das suas jovens, é algo que foi muito explorado
águas impede seu envelhecimento e torna- em lendas de diferentes culturas. Porém,
se para sempre jovem. Mas pelo jeito isso para seres vivos multicelulares como nós
sempre será uma lenda, já que os cientistas humanos, a coisa é um pouco difícil... Seres
descobriram que envelhecer pode ser multicelulares são complexos e têm muitos
retardado, mas nunca evitado. tipos diferentes de células, que formam

18
tecidos e que ainda se organizam em órgãos. rapidamente. As células que se proliferam
Ou seja, quando envelhecemos não somos muito rapidamente não formam um tecido
nós, mas cada uma das nossas células. saudável, mas uma massa de células que
pode continuar crescendo continuamente.
Algumas células não são repostas durante Estamos falando dos tumores que teremos na
a nossa vida, então com o passar do tempo, velhice, mesmo não apresentando sintomas
elas simplesmente não fazem o que têm que de alguma doença.
fazer corretamente. Isso, por exemplo, é o
que acontece com o embranquecimento do Então, conforme o tempo passa, para os seres
cabelo. As células não produzem melanina multicelulares essas duas coisas acontecem
como faziam quando eram jovens. Sem a simultaneamente. Se tentarmos fazer
melanina, o cabelo fica branco! com que as células preguiçosas voltem a
trabalhar como antes, podemos desencadear
o crescimento desenfreado das células
cancerígenas. Se por outro lado, tentamos
controlar as células que se proliferam muito,
as células preguiçosas começam a ficar
mais numerosas e os órgãos acabam não
funcionando corretamente.
Os pesquisadores descobriram que envelhecer
é uma verdade incontestável, as células do
nosso corpo estão em constante competição
O envelhecimento causa um outro efeito

CITOGENÉTICA
e isso é o que causa o envelhecimento.
nas células. Ao envelhecerem, em vez de
Fonte: Phys.org.
ficarem “preguiçosas” e diminuírem a
atividade, elas começam a se dividir muito

MITOSE NA CÉLULA VEGETAL


Em linhas gerais, a mitose da célula vegetal
segue os mesmos passos da mitose animal, com
algumas diferenças. As principais diferenças são:

a) A célula vegetal superior não possui


centríolos. Durante a formação do fuso mitótico,
as fibras convergem para pontos localizados em
polos opostos na célula, mas não orientados
em direção aos centríolos. A mitose vegetal é
anastral. Como a célula animal tem centríolo e
forma áster, sua mitose é astral.

b) A célula animal sofre estrangulamento na


Porque mudanças são necessárias! Brincadeiras à parte, a mitose não região equatorial, que termina por dividi-la em
deixa de ser um processo de mudança para a célula, afinal através
dela, ela vai se dividir. A mitose é o processo que resulta em células- duas (citocinese centrípeta). Na célula vegetal,
filhas com o mesmo número de cromossomos da célula-mãe.

www.biologiatotal.com.br 19
não há estrangulamento. No final da telófase, c) Como a formação do fragmoplasto ocorre do
vesículas originadas no complexo de Golgi se centro para a periferia, a citocinese é centrífuga.
colocam no plano equatorial, no centro da célula. Persistem falhas na parede celulósica recém-
O conjunto de vesículas chama-se fragmoplasto, formada, através das quais se estabelecem
que forma a lamela média. pontes citoplasmáticas entre as células. São os
plasmodesmos.
CITOGENÉTICA

Diferença entre a citocinese de uma célula vegetal e uma célula animal.

CONTROLE DA DIVISÃO
CELULAR
Nas células que se dividem ativamente, a o ciclo é interrompido até que o defeito seja
interfase é seguida da mitose, culminando na reparado e o ciclo celular possa continuar. Caso
citocinese. Sabe-se que a passagem de uma fase contrário, a célula é conduzida à apoptose
para outra é controlada por fatores de regulação (morte celular programada).
- de modo geral proteicos – que atuam nos
chamados pontos de checagem do ciclo celular. A origem das células cancerosas está associada
Dentre essas proteínas, se destacam as ciclinas, a anomalias na regulação do ciclo celular e
que controlam a passagem da fase G1 para a à perda de controle da mitose. Alterações do
fase S e da G2 para a mitose. funcionamento de genes controladores do
ciclo celular, em decorrência de mutações, são
Se em algumas dessas fases houver alguma relacionados ao surgimento de um câncer.
anomalia, por exemplo, algum dano no DNA,

20
LEITURA COMPLEMENTAR
Células de mulher que morreu em 1951 salvam vidas até hoje
Tudo começou quando, em 1951, Henrietta Ao final de cada divisão celular, os telômeros
Lacks, uma mulher de origem humilde, perdem partes de sua estrutura, até o
começou a sentir fortes dores no útero. momento em que, após diversas divisões,
Diagnosticada com câncer cervical (no colo estes se tornam pequenos demais para
de útero), seu tumor surpreendeu os médicos protegerem os cromossomos. Quando isto
pela velocidade com que se multiplicava. acontece, as células perdem a sua função
ou morrem, encurtando o tempo de vida do
Henrietta não resistiu ao câncer e morreu organismo.
ainda no mesmo ano, mas deixou um legado
para a ciência. Enquanto sua família sofria a Já as células de Henrietta possuem
dor da sua perda, um novo capítulo se iniciou a capacidade de serem cultivadas
no mundo das pesquisas médicas. indefinidamente em laboratório. Isso porque
elas expressam a enzima telomerase, que
Durante sua cirurgia, uma amostra do seu impede o encurtamento dos telômeros. Para
tumor foi retirada sem autorização. Desde se ter uma ideia, as células de Henrietta já
então, as células de Henrietta – que foram vivem há mais tempo fora do que viveram
batizadas de HeLa em referência às iniciais dentro do seu corpo durante a vida.

CITOGENÉTICA
de seu nome – circulam por laboratórios de
todo o mundo e são usadas para pesquisas Por conta de suas características únicas, as
científicas, tendo se tornado as primeiras células HeLa já permitiram o desenvolvimento
células imortais da história. de vacinas (inclusive a primeira vacina
contra a poliomielite) e tratamentos para
diversas doenças. Elas também já foram até
levadas para o espaço para tentar entender
o que ocorreria com as células humanas em
situações de gravidade zero.
Atualmente, as HeLa são comercializadas
diariamente em todo o mundo, gerando
milhões de lucro. E a família Lacks? Os
familiares só descobriram que parte de
Henrietta estava viva anos mais tarde. Ao
mesmo tempo em que ficaram orgulhosos
Até hoje, as células de Henrietta Lacks, retiradas sem seu
pelas células de Henrietta terem salvado
consentimento durante uma cirurgia, circulam por laboratórios milhares de vidas, se sentiram desrespeitados
de todo o mundo e são usadas para pesquisas científicas.
e lesados por nunca terem sido consultados.
Em 2013, a família conquistou o controle
Células humanas somáticas normais parcial sobre o acesso de cientistas ao
em cultura possuem um potencial de código de DNA das células de Henrietta.
divisão limitado, já que os telômeros Entretanto, eles ainda lutam na justiça por
são encurtados a cada divisão celular, uma indenização.
o que implica no envelhecimento da
célula. Os telômeros são segmentos de Isso levanta uma interessante reflexão sobre
DNA encontrados nas extremidades dos a ética: vale tudo pelo avanço da ciência? O
cromossomos e responsáveis por manter a que você acha disso?
estabilidade estrutural do material genético. Fontes: Biogerontology; New York Times.

www.biologiatotal.com.br 21
EXERCÍCIOS
2 (UECE 2016)Segundo o Instituto Nacional de Câncer
CAIU NO ENEM - 2018 (INCA), as células cancerosas multiplicam-se de
maneira descontrolada, mais rapidamente do que as
Para estudar os cromossomos, é preciso observá- células normais do tecido à sua volta, invadindo-o.
los no momento em que se encontram no Geralmente, elas têm capacidade para formar
ponto máximo da sua condensação. A imagem novos vasos sanguíneos que as nutrirão e manterão
corresponde ao tecido da raiz de cebola, visto as atividades de crescimento descontrolado. O
ao microscópio, e cada número marca uma das acúmulo dessas células forma os tumores malignos.
diferentes etapas do ciclo celular. Dependendo do tipo da célula do tumor, alguns dão
Qual número metástases mais rápidas e mais precocemente, outros
corresponde à o fazem bem lentamente ou até não o fazem.
melhor etapa para Fonte: http://www2.inca.gov.br/wps/wcm/connect
que esse estudo seja /inca/portal/home.
possível? O processo de multiplicação dessas células se dá por
a 1
a mitose.
b 2
b metástase.
c 3
c meiose.
d 4
d disseminação.
e 5

3 (UEL 2016) Observe a figura a seguir e responda à


questão
EXERCÍCIOS

CAIU NA FUVEST - 2018


Células de embrião de drosófila (2n=8), que estavam
em divisão, foram tratadas com uma substância que
inibe a formação do fuso, impedindo que a divisão
celular prossiga. Após esse tratamento, quantos
cromossomos e quantas cromátides, respectivamente,
cada célula terá?
Determinadas substâncias quimioterápicas utilizadas para
a 4 e 4. o tratamento de indivíduos com câncer agem nas células
b 4 e 8. impedindo a sua multiplicação, pois interferem na formação
c 8 e 8. de microtúbulos.
d 8 e 16. A partir dessa informação, assinale a alternativa que
e 16 e 16.
apresenta, corretamente, a ação dessas substâncias nas
células tumorais.
a Bloquear a formação do fuso acromático coordenado
pelos centrossomos.
b Obstruir a permeabilidade seletiva da membrana
plasmática.
c Inibir a produção de enzimas dos peroxissomos.
d Evitar a respiração celular que ocorre nas mitocôndrias.
e Impedir o transporte de nutrientes no ergastoplasma.

4 (PUCRJ 2015) Vimblastina é um fármaco quimioterápico


1 (IFCE 2016) É uma característica da mitose padrão usado para tratar câncer. Devido ao fato de
a originar células-filhas com o dobro do número de ela interferir no alinhamento dos microtúbulos, sua
cromossomos da célula-mãe. efetividade está diretamente relacionada à inibição
b originar células-filhas com metade do número de da
cromossomos da célula-mãe.
c a divisão celular utilizada na formação dos gametas.
a formação do fuso mitótico.
d originar células-filhas com o mesmo número de
b fosforilação de proteínas regulatórias.
cromossomos da célula-mãe. c respiração celular.
e a divisão celular utilizada apenas na formação dos d síntese de DNA.
espermatozoides. e produção de protease.

22
5 (IFSP 2012)Bioquímicos, médicos, biólogos, químicos, a Permanece em G0.
entre outros, podem trabalhar em pesquisa e b Interrompe a síntese de DNA.
descobrir substâncias que podem interferir em algum c Duplica os cromossomos.
mecanismo celular e com isso auxiliar na saúde d Torna-se poliploide.
humana. Entre elas, está a vimblastina, alcaloide e Passa para a fase S.
que impede a formação das proteínas chamadas
microtúbulos, presentes nas fibras do fuso. Ela pode 8 (UFPA 2008) O período que precede a mitose é
a inibir divisões mitóticas, impedindo, assim, o denominado de intérfase. Nessa fase ocorre a
crescimento de um tumor. duplicação do DNA, evento que garante a transmissão
b inibir divisões meióticas, impedindo, assim, a formação das informações existentes na célula original para
de células somáticas. cada uma das células-filhas. A duplicação do DNA
c reduzir a digestão lipídica, favorecendo a perda de origina a formação de pares de
massa corpórea.
a cromátides-irmãs presas uma à outra pelo centrômero.
d facilitar a perda de proteínas durante a digestão,
favorecendo o emagrecimento. b cromossomos homólogos ligados pelos quiasmas.
e estimular a divisão citoplasmática do final da mitose, c nucléolos portadores de genes alelos.
estimulando o crescimento. d cromossomos duplos, cada um com uma cromátide.
e cromatinas diploides dispersas no nucléolo.
6 O DNA apresenta diferentes níveis de
(CEFET MG 2014)
condensação, conforme representado na figura. (UNIFESP 2008) Analise a figura
9

EXERCÍCIOS
A figura representa um cromossomo em metáfase
mitótica. Portanto, os números I e II correspondem a:
a cromossomos emparelhados na meiose, cada um com
uma molécula diferente de DNA.
b cromátides não-irmãs, cada uma com uma molécula
idêntica de DNA.
c cromátides-irmãs, cada uma com duas moléculas
diferentes de DNA.
d cromátides-irmãs, com duas moléculas idênticas de
DNA.
e cromossomos duplicados, com duas moléculas
No momento em que o DNA de uma célula somática diferentes de DNA.
humana for visualizado no nível “F” de condensação, (IFCE 2011) Quando ocorre a divisão celular
está ocorrendo o processo de 10
descontrolada das células de determinada região do
a síntese de proteínas. organismo, pode ocorrer a formação de um tumor.
b multiplicação celular. Nos tumores benignos, as células permanecem no
c permutação cromossômica. local, prejudicando apenaso órgão onde se originou
d produção de ácido ribonucleico. o tumor ou os tecidos vizinhos. O câncer é um tumor
e duplicação do material genético. maligno prejudicial que se espalha para outras
regiões do corpo.
7 (UFG 2008) O ciclo celular pode ser interrompido
em determinadas fases para evitar a produção de O processo celular envolvido nessa desobediência
células com erro no DNA. A ausência de controle genética é chamado de
da divisão celular relaciona-se diretamente com o a ligação e origina células haploides.
desenvolvimento de neoplasia (câncer). Um exemplo b fissão e ocorre nas células eucarióticas dos animais
evoluídos.
de controle do ciclo celular é a interrupção em G1 pela
c mitose e tem participação dos centríolos.
proteína p53, quando uma lesão no DNA é detectada.
d cromossômico e origina duas células diploides.
O que ocorre com uma célula quando essa proteína é
e mitose celular e origina células haploides.
ativada?

www.biologiatotal.com.br 23
13 (UDESC 2015) A figura representa, de maneira resumida,
as fases da Interfase (G1; S e G2) e de Divisão (M) do
ciclo de vida de uma célula, o chamado ciclo celular.

11 (FMP 2017) Na maioria das células eucarióticas, o


sistema de controle celular ativa a progressão do
ciclo celular em três principais pontos de verificação.
Em relação ao ciclo celular, assinale a alternativa
O primeiro ponto de verificação é no final da G1, o
correta.
segundo é o ponto de verificação G2/M, e o terceiro é
a M é a fase mais longa na maioria das células.
a transição entre metáfase e anáfase.
b Em M ocorre a duplicação dos cromossomos.
A figura abaixo representa o sistema de controle do c Em G2 ocorre a verificação do processo de duplicação
ciclo celular em células eucarióticas. do DNA.
d Em S os cromossomos se apresentam altamente
compactados.
e Em G1 inicia-se a compactação dos cromossomos.

14 (FUVEST 2014) A sequência de fotografias abaixo


mostra uma célula em interfase e outras em etapas
da mitose, até a formação de novas células.
EXERCÍCIOS

No segundo ponto de verificação, o evento do ciclo


celular que já está concluído é a
a formação do fuso mitótico
b duplicação dos centrossomos
c condensação dos cromossomos
d desintegração do envelope celular
e ordenação dos cromossomos na placa equatorial Considerando que o conjunto haploide de
cromossomos corresponde à quantidade N de DNA,
12 (UFU 2015)O gráfico a seguir mostra variações da a quantidade de DNA das células indicadas pelos
quantidade de DNA por núcleo durante o ciclo celular números 1, 2, 3 e 4 é, respectivamente,
de uma célula animal. a N, 2N, 2N e N.
b N, 2N, N e N/2.
c 2N, 4N, 2N e N.
d 2N, 4N, 4N e 2N.
e 2N, 4N, 2N e 2N.

15 (UEL 2015) Leia o texto a seguir.


Quando se fala em divisão celular, não valem as
Em qual dos períodos encontramos o cromossomo regras matemáticas: para uma célula dividir significa
constituído por duas cromátides-irmãs, cada uma duplicar. A célula se divide ao meio, mas antes
contendo uma molécula de DNA, e a ocorrência da duplica o programa genético localizado em seus
migração das cromátides-irmãs para os polos da cromossomos. Isso permite que cada uma das células-
célula, respectivamente? filhas reconstitua tudo o que foi dividido no processo.
a T2 e T3. AMABIS, J. M.; MARTHO, G. R. Biologia. v.1. São Paulo: Moderna,
b T1 e T3. 1994. p.203.
c T3 e T4.
d T1 e T4. Considerando uma célula haploide com 8
cromossomos (n=8) assinale a alternativa

24
que apresenta, corretamente, a constituição correta em relação à interfase.
cromossômica dessa célula em divisão na fase de a A interfase é o período em que não ocorre divisão
metáfase da mitose. celular, e a célula permanece sem atividade
metabólica.
a 8 cromossomos distintos, cada um com 1 cromátide.
b As células que não se dividem são normalmente
b 8 cromossomos distintos, cada um com 2 cromátides. mantidas em G0.
c 8 cromossomos pareados 2 a 2 cada um com 1 c O nucléolo desaparece durante o G1.
cromátide.
d A quantidade de DNA permanece constante durante
d 8 cromossomos pareados 2 a 2 cada um com 2 o período S.
cromátides. e O G2 caracteriza-se pela presença de cromossomos
e 8 cromossomos pareados 4 a 4 cada um com 2 constituídos de uma única cromátide.
cromátides.

(FUVEST 2013) Na figura abaixo, está representado o 18 (PUCRS 2008) A mitose ocorre em diferentes estágios:
16
ciclo celular. Na fase S, ocorre síntese de DNA; na fase Na __________, os cromossomos replicados,
M, ocorre a mitose e, dela, resultam novas células, compostos de um par de _________ se condensam,
indicadas no esquema pelas letras C. o fuso é montado, a membrana nuclear desaparece e
o nucléolo não é mais visível.
Na _________, os cromossomos replicados se
alinham no centro da célula.
Na _________, os pares de _________ se separam,
dividindo igualmente os cromossomos para as
células-filhas.
Na _________, as novas células se separam.
Finalmente, a citocinese separa os componentes
citoplasmáticos.
A sequência das palavras que completam

EXERCÍCIOS
corretamente as frases é:
a prófase - centrômeros - anáfase - metáfase -
cromátides - telófase
Considerando que, em G1, existe um par de alelos Bb,
b prófase - centrômeros - metáfase - anáfase -
quantos representantes de cada alelo existirão ao cromátides - telófase
final de S e de G2 e em cada C? c prófase - cromátides - metáfase - anáfase -
a 4, 4 e 4. centrômeros - telófase
b 4, 4 e 2. d telófase - cromátides - metáfase - anáfase -
c 4, 2 e 1. centrômeros - prófase
d 2, 2 e 2. e telófase - centrômeros - anáfase - metáfase -
cromátides - prófase
e 2, 2 e 1.

17 A figura abaixo representa o ciclo celular


(UFRGS 2013) 19 ( CFTMG 2013)Observe a fase do processo de divisão
de uma célula eucariótica. Assinale a alternativa celular de uma célula, cuja ploidia é 2n = 2, conforme
a figura.

Conclui-se que a fase mostrada na figura refere-se à


mitose, pois se fosse meiose
a as cromátides irmãs estariam afastando-se em
direção aos polos da célula.
b a visualização dos cromossomos seria impossível.
c os cromossomos mudariam de formato.
d o número cromossômico seria diferente.

www.biologiatotal.com.br 25
20 (COL. NAVAL 2015)No nosso corpo ocorrem dois tipos 22 (UESC 2011)
de divisão celular: a mitose, nas células do corpo
em geral, e a meiose, nas células germinativas. Com
relação à mitose e à meiose no corpo humano, é
correto afirmar que
a na mitose, a partir de células iniciais com 46
cromossomos, formam-se células com a metade do
número de cromossomos.
b a mitose é a divisão celular que forma os
espermatozoides e os óvulos.
c na meiose, a partir de células iniciais com
46 cromossomos, formam-se células com 23
cromossomos. A imagem representa a variação da quantidade
d a meiose é a divisão celular que permite o crescimento de DNA ao longo do ciclo celular de uma célula
dos organismos e a substituição das células que
envelhecem e morrem. eucariótica.
e tanto na mitose quanto na meiose ocorre perda de Em relação aos eventos que caracterizam as mudanças
cromossomos durante a divisão celular.
observadas na imagem, pode-se afirmar:
a A duplicação do DNA ocorre a partir da etapa G1,
finalizando na G2.
b A redução do número cromossômico é concretizada pela
separação dos cromossomos homólogos na etapa M.
c A divisão equacional da etapa M é justificada a partir dos
eventos de replicação que ocorrem na etapa S.
d A condensação do material genético é essencial para que
o processo de replicação seja plenamente completado na
etapa M.
e A expressão da informação genética é garantida a partir
dos eventos realizados exclusivamente na etapa S.
21 (UEPB 2012) Leia atentamente as proposições abaixo
EXERCÍCIOS

acerca do ciclo celular e, em seguida, assinale a


alternativa correta.
Raramente, durante a telófase, ambas as cromátides de 23 (UEL 2011)O processo de mitose é essencial para
a
um cromossomo podem migrar juntas para o mesmo o desenvolvimento e o crescimento de todos os
polo celular — é a não disjunção cromossômica, que organismos eucariotos.
leva a um erro na distribuição dos cromossomos: uma
das células-filhas fica com um cromossomo a mais
e a outra, com um cromossomo a menos. As duas
situações são denominadas aneuploidias.
b O ciclo celular está divido em duas etapas: divisão
celular, período que compreende a mitose e a
citocinese, e interfase, período compreendido entre
duas divisões celulares consecutivas, sendo este o
período de menor duração total do ciclo celular de
células que se multiplicam ativamente.
c Durante a metáfase, os cromossomos duplicados
são deslocados para a região equatorial da célula.
Prossegue o processo de condensação cromossômica,
que atingirá o nível máximo na anáfase, período em
que também ocorre a separação dos centrômeros e a
consequente separação das cromátides-irmãs. Com base na figura e nos conhecimentos sobre o
d A interfase é subdividida em três fases: G1, que ciclo celular, é correto afirmar:
antecede a duplicação do DNA cromossômico;
S, período em que ocorre a duplicação do DNA a O período durante o qual ocorre a síntese do DNA
cromossômico; G2, período que sucede a duplicação é maior que o período em que não ocorre síntese
cromossômica. Células que se dividem com pouca alguma de DNA.
frequência podem entrar em uma fase denominada b Ao final de um ciclo celular, a quantidade de material
G0: seu metabolismo continua normal, mas a divisão genético, nos núcleos de cada célula-filha, equivale ao
celular é bloqueada; em determinadas situações, a dobro da célula parental.
célula pode ser estimulada a reingressar na fase G1 c O tempo gasto para o pareamento cromossômico na
e volta a se dividir. placa equatorial equivale ao tempo gasto para síntese
e O paquíteno é a segunda subfase da prófase 1, na de DNA.
meiose 1. Nesta subfase, ocorre o fenômeno da d Em mais da metade do tempo da mitose, as cromátides
permutação ou crossing-over, que tem importante estão duplicadas, separadas longitudinalmente,
significado biológico, pois a troca de fragmentos exceto no centrômero.
entre cromátides homólogas permite o rearranjo dos
genes, o que leva a uma maior variedade de gametas e Durante a fase mais longa da mitose, as cromátides-
formados por um indivíduo. irmãs se separam uma da outra e migram para as
extremidades opostas da célula.

26
24 (UPE 2013) A proliferação celular exagerada está III – Cromossomos no equador da célula
diretamente relacionada ao desenvolvimento de IV – Desestruturação da carioteca
câncer. Tem-se como exemplo de bloqueio desse
processo o uso de drogas antimitóticas, que Na metáfase
desorganizam o fuso mitótico. Em relação à formação a ocorrem somente os eventos I e III
e ao papel do fuso mitótico em condições normais, é b ocorrem somente os eventos I e II
CORRETO afirmar que c ocorrem somente os eventos II e IV
a carioteca, membrana nuclear formada por proteínas d ocorrem somente os eventos II e III
a
fibrosas do citoesqueleto, está envolvida na formação do
fuso mitótico, essencial à adesão celular.
27 (CFTMG 2010) A questão refere-se ao gráfico a seguir.
b o citoesqueleto é uma rede citoplasmática de ácidos
nucleicos envolvidos no processo da formação do fuso
mitótico, de lisossomos e do acrossomo, responsáveis
pela mitose.
c os centríolos são cilindros formados por actina e miosina,
envolvidos na formação do fuso mitótico, dos cílios e
flagelos, que auxiliam na movimentação celular.
d os centrômeros são responsáveis pela formação do
fuso mitótico constituído de carboidratos, essencial ao
direcionamento do ciclo celular.
d os microtúbulos são constituídos de tubulinas e formam
o fuso mitótico, responsável pela correta segregação dos
cromossomos durante a divisão celular.
Um pesquisador, com a finalidade de estudar a
forma e o tamanho dos cromossomos de uma célula,
25 (UDESC 2010) Assinale a alternativa correta quanto
interrompeu a divisão celular na fase em que eles se
à mitose na espécie humana, referente à fase da
encontravam na máxima condensação.
anáfase (1), da prófase (2), da telófase (3) e da
metáfase (4), respectivamente: Analisando esse processo, pode-se deduzir,
a (1) Os cromossomos duplicados na interfase começam corretamente, que a fase em questão é a de número

EXERCÍCIOS
a se condensar. (2) Ocorre a separação das duas a 1
cromátides-irmãs. (3) Os cromossomos se deslocam em b 2
direção à região da placa equatoriana e há a formação
do fuso mitótico. (4) Os cromossomos se descondensam c 3
e as fibras do fuso mitótico desaparecem. d 4
b (1) Os cromossomos se deslocam em direção à região
da placa equatoriana e há a formação do fuso mitótico. (UFU 2010)O ciclo celular é um processo fisiológico que
(2) Os cromossomos duplicados na interfase começam 28
a se condensar. (3) Os cromossomos se descondensam acontece todos os dias na dinâmica de funcionamento
e as fibras do fuso mitótico desaparecem. (4) Ocorre a do corpo humano. Seja na reparação, formação
separação das duas cromátides-irmãs. ou renovação de tecidos, ou ainda na formação de
c (1) Ocorre a separação das duas cromátides-irmãs. gametas, a atividade celular é intensa.
(2) Os cromossomos se descondensam e as fibras
do fuso mitótico desaparecem. (3) Os cromossomos Neste processo, são eventos do ciclo celular:
duplicados na interfase começam a se condensar. (4) Os
cromossomos se deslocam em direção à região da placa I - Condensação máxima dos cromossomos.
equatoriana e há a formação do fuso mitótico.
d (1) Os cromossomos duplicados na interfase começam a II - Reorganização do nucléolo.
se condensar. (2) Ocorre a separação das duas cromátides-
irmãs. (3) Os cromossomos se descondensam e as fibras III - Duplicação dos cromossomos.
do fuso mitótico desaparecem. (4) Os cromossomos se
deslocam em direção à região da placa equatoriana e há IV - Separação das cromátides-irmãs.
a formação do fuso mitótico. Os eventos acima citados correspondem,
e (1) Ocorre a separação das duas cromátides-irmãs. (2) respectivamente, a:
Os cromossomos duplicados na interfase começam a se
condensar. (3) Os cromossomos se descondensam e as a Prófase, fase S da intérfase, telófase, anáfase.
fibras do fuso mitótico desaparecem. (4) Os cromossomos b Fase S da intérfase, prófase, metáfase, telófase.
se deslocam em direção à região da placa equatoriana e
há a formação do fuso mitótico. c Metáfase, telófase, fase S da intérfase, anáfase.
d Metáfase, anáfase, prófase, telófase.

26 (UFLA 2010)Apresentam-se a seguir eventos que


ocorrem durante o processo de divisão celular (UPE 2011) A figura abaixo representa um corte
mitótico. 29
histológico de raiz de cebola, na qual estão
Analise os eventos e marque a alternativa CORRETA. enumeradas diferentes fases do ciclo celular.
I – Condensação máxima dos cromossomos
II – Segregação cromatídica

www.biologiatotal.com.br 27
30 (PUCRJ 2015) Considere as afirmações relativas à
mitose.
I. O nucléolo começa a desaparecer na prófase.
II. Os núcleos filhos são geneticamente idênticos ao
núcleo dos pais.
III. As cromátides irmãs se separam no início da
anáfase.
IV. Cromossomos homólogos fazem sinapse na
prófase.
V. Um único núcleo dá origem a dois núcleos-filhos
idênticos.
Assinale a frase que identifica corretamente a fase 5
Estão corretas:
(cinco) e a estrutura apontada com uma seta.
a Apenas I, II, IV, V.
a A interfase está subdividida nas fases S, G1 e G2. A b
estrutura apontada é o cloroplasto. Apenas I, II, III, V.
c Apenas II, III, IV, V.
b Na metáfase, os cromossomos estão alinhados na
placa equatorial. A estrutura apontada é o cloroplasto. d Apenas I, II, V.
c Na metáfase, os cromossomos estão alinhados na e Todas as afirmações.
placa equatorial. A estrutura apontada é a parede
celular.
d Na telófase, ocorre a descondensação dos
cromossomos e a citocinese centrípeta. A estrutura
apontada é o fragmoplasto.
e Na telófase, ocorre a descondensação dos
cromossomos e a citocinese centrífuga. A estrutura
apontada é o fragmoplasto.
EXERCÍCIOS

ANOTAÇÕES

28
GABARITO DJOW
CAIU NO ENEM - 2018 CAIU NA FUVEST - 2018
[C] [D]

MITOSE

1 - [D] 12- [C]


A mitose é um tipo de divisão celular que origina células-filhas O período em que a célula animal possui cromossomos
com o mesmo número de cromossomos da célula-mãe. duplicados e constituídos por duas cromátides-irmãs, cada uma
RESPOSTA COMENTADA http://bit.ly/2FpXQ6s formada por uma molécula de DNA de cadeia dupla é o T3. A
migração das cromátides-irmãs ocorre em T4.
2- [A] RESPOSTA COMENTADA http://bit.ly/2FvfV2U
O aumento do número de células em tumores ocorre sempre
por mitoses. 13- [C]
RESPOSTA COMENTADA http://bit.ly/2G5lIxb Durante o período G2 da interfase ocorre o processo de
verificação do processo de duplicação do DNA ocorrido no
3 - [A] período S. Caso a duplicação não esteja correta, o ciclo celular
As substâncias quimioterápicas utilizadas no combate ao câncer é interrompido.
podem bloquear a formação do fuso acromático coordenado RESPOSTA COMENTADA http://bit.ly/2Gaw0Mv
pelos centrossomos e, dessa forma, impedir que as células
tumorais se multipliquem desordenadamente. 14 - [D]
RESPOSTA COMENTADA http://bit.ly/2G5m9Yl Considerando que a célula 1 é diploide (2N) e está no período G1

CITOGENÉTICA
4- [A] da interfase, pode-se afirmar que a célula 2 acha-se na prófase
da mitose e possui 4N de DNA; a célula 3, em anáfase também
A vimblastina é um medicamento que interfere na formação do apresenta 4N de DNA e a célula 4, no final da telófase, possui 2N
fuso mitótico, por modificar o alinhamento dos microtúbulos de DNA em seu núcleo.
durante a divisão celular. RESPOSTA COMENTADA http://bit.ly/2FrBz8d
RESPOSTA COMENTADA http://bit.ly/2DbQmSv
15 - [B]
5 - [A]
Durante a metáfase da mitose serão observados 8 cromossomos
Os medicamentos inibidores da formação dos microtúbulos de distintos, cada um com 2 cromátides-irmãs unidas pelo
tubulina podem ser utilizados como agentes antimitóticos. A centrômero.
não formação do fuso de divisão é capaz de inibir o crescimento
de tumores. RESPOSTA COMENTADA http://bit.ly/2FuHnOd
RESPOSTA COMENTADA http://bit.ly/2Ftj2bw
16 - [E]
6 - [B] Durante o período S e no período G2 da interfase, os alelos B e
b estão duplicados, apresentando, portanto, dois representantes
Durante o processo de multiplicação celular o material genético de cada. Em C, ao final da mitose, cada célula filha possuirá um
(DNA) encontra-se duplicado e condensado. representante de cada alelo.
RESPOSTA COMENTADA http://bit.ly/2pNXuiU
7- [B] 17 - [B]
RESPOSTA COMENTADA http://bit.ly/2G6zmQL
Durante a interfase não ocorre divisão celular, mas a célula
8- [A] está submetida à intensa atividade metabólica relacionada à
execução de suas mais diferentes funções. As células que não se
RESPOSTA COMENTADA http://bit.ly/2FuUKOg dividem permanecem em uma subfase do G1 que é designada
como G0. O nucléolo está presente durante a interfase e
9 - [D] desaparece durante a divisão celular. O período S caracteriza-se
pela duplicação do DNA resultando em cromossomos compostos
de duas cromátides. Essa constituição é medida no período G2 e
10 - [C] só se desfaz mediante divisão celular.
Um tumor se forma a partir das sucessivas mitoses que ocorrem RESPOSTA COMENTADA http://bit.ly/2pNYCTA
de modo descontrolado em um tecido. A mitose ocorre com a
participação dos centríolos e origina duas células diploides. 18- [C]
RESPOSTA COMENTADA http://bit.ly/2G84yz6 A mitose é uma divisão equacional. Pode ocorrer em células n
e 2n.
11 - [B]
RESPOSTA COMENTADA http://bit.ly/2pNPo9S
A duplicação dos centrossomos ocorre na fase S do ciclo celular,
que antecede o segundo ponto de verificação, G2/M.
RESPOSTA COMENTADA http://bit.ly/2G8DcJ5

www.biologiatotal.com.br 29
19 - [D] cromossomos condensados migram para a região equatorial
da célula, formando a placa equatorial ou metafásica. Logo
Caso a célula 2n = 2 estivesse em metáfase meiótica I, o arranjo após a metáfase inicia-se a anáfase (1), fase em que ocorre a
cromossômico seria diferente e os cromossomos homólogos separação das cromátides-irmãs, puxadas para polos opostos
estariam pareados. Se estivesse em metáfase meiótica II, pelo encurtamento dos microtúbulos do fuso do centrossomo.
o número de cromossomos seria diferente. Nesse caso, Na telófase (3), última fase da mitose, os cromossomos se
observaríamos apenas um cromossomo duplicado preso à região descondensam, as fibras do fuso mitótico desaparecem, uma
meridiana do fuso de microtúbulos. nova carioteca organiza-se ao redor de cada conjunto de
RESPOSTA COMENTADA http://bit.ly/2pOIByG cromossomos e ocorre a divisão citoplasmática (citocinese) para
a formação de duas células-filhas.
20- [C] RESPOSTA COMENTADA http://bit.ly/2pNR4QF
Durante a divisão celular meiótica, as células germinativas
diploides com 46 cromossomos formam células gaméticas 26- [A]
haploides com 23 cromossomos. Durante a mitose, os processos de desestruturação da carioteca
RESPOSTA COMENTADA http://bit.ly/2pOLvno e segregação cromatínica ocorrem, respectivamente, durante a
prófase a anáfase.
21- [D] RESPOSTA COMENTADA http://bit.ly/2pP386i
Células interfásicas podem permanecer no período G0 e não
se dividir. Em determinadas situações, essas células entram no 27- [B]
período G1, passam pelo período S e G2 e sofrem mitose. Esse A fase da mitose em que os cromossomos encontram-se na
fenômeno ocorre em certos tipos celulares específicos, como, por máxima condensação é a metáfase, representado pelo número
exemplo, neurônios, células que, normalmente, não se duplicam. 2. As fases da mitose são: prófase (1), metáfase (2), anáfase (3)
RESPOSTA COMENTADA http://bit.ly/2pPb2Nd e telófase (4).
RESPOSTA COMENTADA http://bit.ly/2pNXoHX
22- [C]
A divisão equacional do material genético durante a anáfase da 28- [C]
mitose só é possível devido à replicação semiconservativa do A sequência das fases do ciclo celular é: interfase (G1, S e G2)
DNA no período S da interfase precedente. → prófase → metáfase → anáfase → telófase. Na fase S da
RESPOSTA COMENTADA http://bit.ly/2pNWv28 telófase ocorre a duplicação dos cromossomos, na metáfase,
a condensação máxima dos cromossomos, na anáfase ocorre
23- [D] a separação das cromátides-irmãs e na telófase ocorre a
reorganização do nucléolo.
CITOGENÉTICA

Durante a prófase, fase mais longa da mitose, o material genético


encontra-se duplicado e separado longitudinalmente, exceto no RESPOSTA COMENTADA http://bit.ly/2pNZgQX
centrômero, região que prende as cromátides irmãs.
29- [E]
RESPOSTA COMENTADA http://bit.ly/2pOPTT9
A fase identificada corresponde à telófase da mitose, que ocorre
24- [E] nas células da raiz da cebola. Nessa fase, os cromossomos sofrem
descondensação e a célula se divide por meio da formação da
Os microtúbulos do fuso mitótico são constituídos pela proteína lamela média, a partir de fragmoplastos arranjados de forma
tubulina e são responsáveis pela correta separação durante o centrífuga na região equatorial do citoplasma.
processo de divisão celular.
RESPOSTA COMENTADA http://bit.ly/2pOauH9
RESPOSTA COMENTADA http://bit.ly/2pP9z9C
30- [B]
25- [E]
O pareamento (sinapse) dos cromossomos homólogos ocorre no
A primeira fase da mitose é a prófase (2), quando se inicia a zigóteno da prófase I da meiose.
condensação dos cromossomos e ocorre a fragmentação
da carioteca. A fase seguinte é a metáfase (4), quando os RESPOSTA COMENTADA http://bit.ly/2pNWLAg

ANOTAÇÕES

30
MITOSE
(FUVEST 2017) O sulfato de vincristina é uma 16 Na prófase ocorre o desaparecimento da carioteca. A
14 lâmina nuclear se desfaz e as membranas componentes da
substância usada para o tratamento de tumores. carioteca fragmentam-se em pequenas vesículas, que se
Esse quimioterápico penetra nas células e liga-se à espalham pelo citoplasma.
tubulina, impedindo a formação de microtúbulos. (UFJF-PISM 1 2016) As divisões celulares, mitose e meiose,
17
a Que processo celular, importante para o tratamento, é são processos importantes para a manutenção e
bloqueado, quando não se formam microtúbulos? Como os
microtúbulos participam desse processo? perpetuação das espécies. Durante o ciclo celular, nos
b Para o tratamento, o quimioterápico pode ser colocado
dois tipos de divisões celulares, o período em que a
dentro de lipossomos, vesículas limitadas por bicamada célula não está se dividindo (intérfase), é conhecido
de constituição lipoproteica. Que estrutura celular tem como período de “repouso” celular. Com base no seu
composição semelhante à do lipossomo, o que permite que
ambos interajam, facilitando a ação do quimioterápico na conhecimento sobre o ciclo celular responda:
célula? a Por que o termo “repouso” celular é inapropriado para a
intérfase?
b Em qual período da intérfase observa-se uma maior
quantidade de DNA?
c Quantas cromátides apresentam os cromossomos no
período G2 da intérfase?
EXERCÍCIOS APROFUNDADOS

15 (UEPG 2016) Sobre os processos envolvidos nas etapas


de divisão celular, assinale o que for correto.
01 Nos seres eucariotos e sexuados ocorrem dois tipos de
divisão celular: mitose, que forma células com o mesmo
número de cromossomos e com informações genéticas
idênticas à célula-mãe; e meiose, que reduz o número de 18 (UEM-PAS 2016)Sobre a divisão celular nos eucariotos,
cromossomos à metade (haploide). assinale o que for correto.
02 A célula permanece em interfase na maior parte do tempo, 01 A meiose e a fecundação são fenômenos opostos, pois a
período em que os cromossomos permanecem em um meiose, sendo uma divisão reducional, produz gametas
intenso grau de compactação e com baixa atividade das com metade do número de cromossomos, típico de uma
organelas. espécie, enquanto a fecundação restitui a diploidia.
04 Na fase de prófase da meiose I, o crossing-over permite 02 A interfase é um período do ciclo celular que antecede a
trocas de pedaços entre os cromossomos homólogos, mitose e a meiose. Nela não ocorrem eventos importantes
fazendo surgir novas combinações genéticas. para a geração de novas células.
08 Na primeira etapa da meiose, os cromossomos homólogos 04 Na meiose, os cromossomos homólogos separam-se
se separam durante a anáfase I. durante a anáfase I e, durante a anáfase II, separam-se as
cromátides.
16 (UEPG 2016) A divisão da célula faz parte do que os 08 Ao final da mitose, a citocinese das células vegetais ocorre
do centro para a periferia, recebendo o nome de citocinese
biólogos denominam ciclo celular. Este é um período
centrífuga.
que se inicia com a origem da célula, a partir de uma
16 Em células animais, o crossing-over ocorre na prófase, em
célula preexistente, e termina quando ela se divide cromossomos não homólogos da mitose ou da meiose.
em duas células-filhas.
19 Após a descoberta da estrutura
(UNICID - MEDICINA 2016)
Com relação ao ciclo celular, assinale o que for da molécula de DNA, surgiram três modelos para
correto. explicar como ocorre sua duplicação. A figura ilustra
01 Os citologistas dividem o ciclo celular em duas etapas: três possíveis modelos de duplicação da molécula de
divisão celular e interfase. A divisão celular compreende a DNA.
mitose e a citocinese (divisão do citoplasma).
02 A interfase é definida como o período entre duas divisões
celulares consecutivas. Durante a interfase, os filamentos
cromossômicos permanecem descondensados e distribuídos
no interior do núcleo, constituindo a cromatina.
04 Na interfase, a célula está em plena atividade, produzindo
moléculas de RNA que são utilizadas na síntese proteica.
É também durante a interfase que a célula cresce e que
as moléculas de DNA dos cromossomos se duplicam,
preparando a célula para a próxima divisão.
08 As fases da mitose são, em sequência: prófase, metáfase,
anáfase, telófase.

6
a Dos modelos apresentados, qual deles representa a C Por que a mitose da célula vegetal é chamada de acêntrica?
duplicação da molécula de DNA proposto por Watson e
Crick? Justifique sua resposta.
b Em que fase do ciclo celular mitótico ocorre a duplicação
da molécula de DNA? Por que a célula precisa realizar esse
processo?

22 (UFSC 2015) A figura abaixo representa a chegada e a


proliferação de células tumorais no tecido hepático
provenientes do tecido pulmonar.

20 (IFSC 2015) Considerando a figura abaixo e sobre o


ciclo celular, assinale a soma da(s) proposição(ões)
CORRETA(S):

EXERCÍCIOS APROFUNDADOS
Com base na figura e nos conhecimentos atuais
sobre o câncer, é CORRETO afirmar que:
01 falhas nos mecanismos de controle do ciclo celular podem
desencadear a formação de tumores.
02 no câncer, as células mitóticas se transformam em células
01 A origem das células cancerosas está associada a anomalias
meióticas.
na regulação do ciclo celular e à perda de controle da mitose.
A mitose é um processo de divisão celular característico de 04 uma das estratégias nas pesquisas de combate ao câncer
02 é a indução à apoptose das células tumorais por meio da
células somáticas vegetais e animais, podendo ocorrer em manipulação da regulação gênica.
outros eucariotos.
08 a figura representa um exemplo de metástase.
04 A mitose é constituída pelas seguintes fases: prófase,
metáfase, anáfase e telófase. Alguns autores costumam 16 o câncer é uma doença de origem genética sobre a qual
citar uma quinta fase – a prometáfase – intermediária entre nenhum fator ambiental tem influência.
a prófase e a metáfase. No final da mitose, a separação do 32 as células tumorais apresentam alta taxa metabólica
citoplasma é chamada de cariocinese. devido à intensa proliferação celular.
08 Resumidamente, a mitose é o processo pelo qual uma célula
haploide dá origem a duas outras células diploides, idênticas (UFSC 2014)O gráfico indica, em escala logarítmica, a
à célula-mãe e entre si. 23
A interfase é um período de intensa atividade metabólica e
relação dos casos de câncer em diversos órgãos com
16
de maior duração do ciclo celular. a idade dos indivíduos.
32 Na anáfase os cromossomos atingem o máximo em Com relação ao gráfico e ao desenvolvimento
espiralização, encurtam e se localizam na região equatorial
da célula. de câncer, indique a soma da(s) proposição(ões)
CORRETA(S)
21 (UFJF-PISM 1 2015)Sabemos que cada tipo de célula
possui um período específico para a realização do
ciclo celular e que há dois tipos de divisão celular:
mitose e meiose.
De acordo com as etapas abaixo, responda:
a Qual a principal diferença encontrada entre metáfase
mitótica e a metáfase I da meiose?
b Na mitose, em quais fases ocorrem os seguintes fenômenos?
(1) desaparecimento do núcleo, (2) divisão dos centrômeros
e (3) migração das cromátides irmãs.

www.biologiatotal.com.br 7
01 Nos indivíduos na faixa de 20 a 30 anos, são mais comuns
casos de câncer de esôfago.
02 O tipo de câncer com maior probabilidade de se
desenvolver a partir dos 50 anos, tanto em homens quanto
em mulheres, é o da próstata.
04 Entre os tipos mostrados no gráfico, o câncer de pele é o
que afeta de maneira mais precoce os indivíduos.
08 Uma pessoa de 80 anos tem aproximadamente 500 vezes
mais chances de ter câncer de próstata do que uma pessoa (UEPG 2011) No que se refere à cromatina, assinale o
26
de 40 anos. que for correto.
16 Não se pode concluir que a idade dos indivíduos esteja 01 Aparece em todas as etapas da mitose: prófase, metáfase,
relacionada com o desenvolvimento de cânceres. anáfase e telófase.
32 As mutações genéticas que levam uma célula a se 02 Aparece apenas na anáfase, pois, apenas nesta etapa a
tornar cancerosa têm origem em fatores ambientais ou cromatina é importante no processo da divisão celular.
hereditários.
Está presente no núcleo interfásico e aparece durante a
64 Estatisticamente, o câncer de esôfago é mais precoce que 04 divisão celular com uma organização estrutural diferente,
o de estômago. transformando-se nos cromossomos.
08 É formada por nucleoproteínas.

24 (UEM-PAS 2014)A continuidade da vida na Terra deve-se


à reprodução, ou seja, à capacidade de os organismos 27 (UFSC 2011) Assinale a(s) proposição(ões) correta(s).
produzirem descendentes semelhantes a si mesmos. O ciclo celular é dividido em duas etapas: Divisão
Sobre a reprodução dos seres vivos, assinale o que Celular e Interfase. Nesta última etapa (Interfase),
for correto. subdividida em G1 – S – G2, a célula realiza seu
01 Nas bactérias e nos protozoários, a reprodução assexuada metabolismo e se prepara, quando necessário, para a
EXERCÍCIOS APROFUNDADOS

envolve a duplicação do material genético e a divisão do etapa da divisão celular.


próprio organismo.
01 O tempo que as células permanecem na etapa chamada de
02 A reprodução sexuada de organismos eucariontes
unicelulares e pluricelulares envolve fusão de material Interfase é o mesmo entre os diferentes tipos celulares.
genético dos gametas. 02 No período do desenvolvimento embrionário, o ciclo celular
04 A reprodução sexuada possibilita a variabilidade genética compreende etapas de Interfases longas e etapas de
dos descendentes, a qual decorre das recombinações entre divisões celulares rápidas.
cromossomos durante a meiose. 04 Na fase S da Interfase ocorre o processo de duplicação do
08 Os animais apresentam ciclo de vida haplobionte diplonte, DNA.
com a fusão de dois gametas haploides, originados por 08 Durante a Interfase o DNA está em plena atividade,
meiose gamética, e formação de zigoto diploide. formando o RNA com as informações para a síntese
16 Nas plantas, o ciclo de vida diplonte envolve a meiose proteica.
espórica, com formação do esporófito haploide, que produz 16 Em G2 a quantidade de DNA é a mesma que em G1.
gametas diploides. 32 A frequência com que as células entram em divisão celular
varia com o tipo e o estado fisiológico de cada uma delas.
(UEL 2013) Um pesquisador determinou as variações 64 Na etapa chamada de divisão celular, pode ocorrer tanto
25 a mitose como a meiose, em qualquer célula do corpo
nos números de cromossomos e de moléculas de humano.
DNA, ao longo do tempo, em células vegetais em
reprodução sexuada e assexuada. As variações na 28 (UERJ 2011) Normalmente não se encontram neurônios
quantidade de moléculas em cada célula, nos dois no cérebro em plena divisão celular. Entretanto,
casos, estão representadas nas figuras A e B. no Mal de Alzheimer, grandes quantidades dessas
células iniciam anormalmente o ciclo de divisão.
Estudos mostram que até 10% dos neurônios nas
regiões atingidas por tal degeneração tentaram
iniciar a divisão celular. Contudo, nenhum deles
conseguiu terminá-la, pois não foi observado o sinal
mais característico da consumação da divisão de
uma célula: cromossomos alinhados no meio dos
neurônios.
S. Herculano-Houzel. Adaptado de O cérebro nosso de cada dia.
Rio de Janeiro: Vieira e Lent, 2002.

Nomeie o tipo de divisão celular ao qual o texto faz


referência e a fase dessa divisão correspondente ao
a Que tipo de divisão celular está caracterizado na figura
A? E na figura B? Qual tipo corresponde às células em alinhamento dos cromossomos.
reprodução sexuada? Qual tipo corresponde às células em
reprodução assexuada? Justifique suas respostas.
b Explique as características genéticas dos descendentes das
reproduções sexuada e assexuada.

8
29 (UNESP 2010) Apelo assexual – Caso único na natureza,
espécie de formiga dispensou seus machos e descobriu
que, ao menos para ela, sexo não vale a pena.
Trata-se da Mycocepurus smithii, uma espécie de
formiga que não tem machos: a rainha bota ovos a Qual é o número de cromossomos em uma célula haploide
que crescem sem precisar de fertilização, originando do organismo em questão? Justifique sua resposta.
operárias estéreis ou futuras rainhas. Aparentemente, b Identifique se a célula representada é de um animal ou
este mecanismo de reprodução traz uma de uma planta. Aponte duas características que permitam
fazer sua identificação. Justifique.
desvantagem, que é a falta de diversidade genética
que pode garantir a sobrevivência da espécie em
desafios ambientais futuros.
Duas hipóteses foram levantadas para explicar a
origem destes ovos diploides: a primeira delas diz que
os ovos são produzidos por mitoses e permanecem
diploides sem passar por uma fase haploide; a
segunda sugere que se formam dois ovos haploides (UEG 2010) A apoptose é conceituada como a morte
que fertilizam um ao outro. 32
celular programada, sendo um evento biológico muito
(Unesp Ciência, novembro de 2009. Adaptado.) comum nos tecidos animais. Sobre essa temática,
Considere as duas hipóteses apresentadas pelo texto. responda ao que se pede:
Cada uma dessas hipóteses, isoladamente, reforça a Identifique uma contribuição deste fenômeno na

EXERCÍCIOS APROFUNDADOS
ou fragiliza a suposição de que essa espécie teria manutenção das células corporais dos organismos vivos.
desvantagem por perda de variabilidade genética? b Exemplifique, utilizando um grupo de animais, um processo
biológico que pode ser considerado apoptose.
Justifique suas respostas.

30 (UEPG 2010) Sobre a intérfase, que é o período que 33 (UEM 2016) Em células eucarióticas, a relação
precede a divisão celular, assinale o que for correto. nucleoplasmática (RNP) é dada pela fórmula
VN
01 Na intérfase a célula produz proteínas, aumenta de tamanho RNP =
e gera a duplicação do DNA presente na cromatina.
na qual VN representa o volume do núcleo
VC − VN
,

02 A intérfase é muito mais longa do que a divisão celular


celular e VC representa o volume total da célula.
propriamente dita. O aspecto do núcleo nessa fase é muito Assinale o que for correto.
diferente daquele observado durante a divisão celular.
01 Em células eucarióticas, o material genético fica localizado
04 Durante a divisão celular a cromatina se organiza e
transforma-se em vários bastonetes individuais, os no núcleo.
cromossomos. 02 No processo de mitose de células eucarióticas, a
Nucléolos e carioteca, presentes durante toda a intérfase, fragmentação do envoltório nuclear (carioteca) se inicia na
08
desaparecem durante a divisão celular. prófase.
04 A relação nucleoplasmática também pode ser obtida pela
16 Se observada na intérfase, a cromatina parece um conjunto V
fórmula V .
N
embaralhado de filamentos finos. Durante a divisão celular, C

cada um desses filamentos espirala-se, enrolando-se sobre


VN
1−
VC
si mesmo. Dessa forma, o filamento fica mais curto e mais 08 Uma célula com RNP = 2 tem menos de 60% de seu volume
espesso, condensando-se.
ocupado pelo núcleo.
(UNICAMP 2010)O esquema a seguir representa três 16 Em uma célula esférica, cujo núcleo é também esférico com
31
fases do ciclo celular de uma célula somática de um raio igual à metade do raio da célula, tem-se RNP =
1
7
.

organismo diploide.

www.biologiatotal.com.br 9
GABARITO DJOW
MITOSE
14: a) O tratamento com o sulfato de vincristina bloqueia o 20: 01 + 02 + 16 = 19.
processo de divisão celular mitótico. Os microtúbulos, formados [04] Falsa. A divisão do citoplasma corresponde à citocinese.
pela proteína tubulina, prendem-se aos cromossomos duplicados [08] Falsa. A mitose de uma célula haploide origina duas células
pelos seus centrômeros e fracionam os cromossomos-filhos para haploides.
os polos opostos da célula. Eles são os responsáveis pela correta [32] Falsa. A máxima espiralização cromossômica ocorre durante
separação das cromátides-irmãs durante a anáfase da mitose. a metáfase.
b) A estrutura celular que apresenta a composição química
semelhante ao lipossomo é a membrana plasmática. A fusão 21: a) Na mitose a placa equatorial é formada pelos
das vesículas com a membrana celular permite a introdução do cromossomos duplicados e não pareados. Na Meiose I a placa
quimioterápico no meio intracelular. equatorial é formada por bivalentes (homólogos pareados).
b) 1 – prófase; 2 – anáfase; 3 –anáfase.
15: 01 + 04 + 08 = 13. c) Por não apresentar centríolo.
[01] Verdadeiro. Nos seres vivos eucariotos e sexuados, a
mitose forma duas células-filhas com o mesmo número de 22: 01 + 04 + 08 + 32 = 45.
cromossomos da célula-mãe; e a meiose reduz pela metade o [02] Falso. A proliferação celular descontrolada que caracteriza o
número de cromossomos, tornando-se haploide. câncer é exclusivamente mitótica.
[02] Falso. O tempo da interfase depende do tipo de célula e [16] Falso. O desenvolvimento do câncer é influenciado por
seu estado fisiológico e os cromossomos estão descondensados. diversos fatores ambientais, tais como: tabagismo, radiação UV,
EXERCÍCIOS APROFUNDADOS

Dependendo do estágio da interfase, a célula permanece em entre outros.


atividade ou repouso.
[04] Verdadeiro. O crossing-over ocorre na prófase I, em que
há trocas entre os cromossomos homólogos, aumentando a 23: 04 + 08 + 32 = 44.
variabilidade genética. [01] INCORRETO: O câncer de esôfago é mais comum na faixa
[08] Verdadeiro. Os cromossomos homólogos se separam acima dos 70 anos.
durante a anáfase I (meiose I). [02] INCORRETO: O câncer de próstata somente ocorre em
homens.
[16] INCORRETO: O gráfico mostra uma correlação direta entre a
16: 01 + 02+ 04 + 08 + 16 = 31. idade avançada e a incidência de câncer.
Todos os itens estão corretos e relacionados ao ciclo celular [64] INCORRETO: Estatisticamente, o câncer de estômago é mais
observado em células que se renovam. precoce que o de esôfago.
17: a) Durante a interfase, as células produzem RNA, 24: 01 + 02 + 04 + 08 = 15.
proteínas e aumentam o seu volume (período G1). No período Em todos os organismos vivos diploides (2N) e sexuados, os
S ocorre síntese de DNA e, consequentemente, a duplicação dos gametas sempre serão células haploides (N).
cromossomos.
b) A maior quantidade de DNA é verificada no período G2 da
interfase. 25: a) No esquema da figura A está representada a mitose,
c) Em humanos com cariótipo normal, verificam-se no período e na figura B a meiose. As células em reprodução sexuada
G2, 46 cromossomos duplicados, cada um com 2 cromátides, e, correspondem à meiose, isto é, figura B. Podemos justificar pela
portanto, 92 cromátides no total. produção de quatro células ao final do processo e redução no
número de cromossomos em cada célula formada. Na reprodução
assexuada a estabilidade no número de cromossomos nas
18: 01 + 04 + 08 = 13. células formadas é o ponto principal, ou seja, mantém o número
A meiose é uma divisão celular reducional, com metade dos de cromossomos que pode ser observado na formação das duas
cromossomos da espécie em questão. Nela, os cromossomos células ao final do processo.
homólogos são separados durante a anáfase I e as cromátides b) Os descendentes formados pelo processo de reprodução
durante a anáfase II. O crossing-over é um processo que ocorre sexuada diferem dos pais por apresentar uma mistura de material
na prófase I da meiose, com troca de material genético entre genético de ambos, já no processo de reprodução assexuada as
cromossomos homólogos. A fecundação é a junção dos gametas características genéticas se mantêm como ocorre na clonagem.
haploides, originando células diploides. A interfase é um período
do ciclo celular, chamado de S, importante para a divisão
celular, momento de síntese, onde ocorre a duplicação do DNA, 26: 04 + 08 = 12.
para posterior divisão. A citocinese centrífuga é característica A cromatina torna-se evidente à microscopia óptica e eletrônica
das células vegetais e corresponde ao processo de divisão do durante a metáfase e anáfase, devido à condensação ou
citoplasma, iniciando do centro da célula, avançando para as espiralização das nucleoproteínas.
extremidades.
27: 04 + 08 + 32 = 44
19: a) O modelo C representa a duplicação da molécula de O período interfásico varia de acordo com o tipo celular
DNA proposta por Watson e Crick, indicando que cada uma das considerado. Durante o período de desenvolvimento embrionário,
moléculas de DNA serve como molde para a formação de uma as células normalmente apresentam período interfásico curto
nova cadeia, chamada de replicação semiconservativa. e divisões mitóticas rápidas. No período G2 da interfase, os
b) A duplicação da molécula de DNA ocorre na Intérfase, no cromossomos estão duplicados, contendo o dobro da quantidade
intervalo chamada S (Síntese), processo que antecede a mitose de DNA observado no período G1. A meiose ocorre apenas nas
propriamente dita. A célula precisa replicar o DNA para a divisão células componentes da linhagem celular germinativa presentes
e produção de uma nova célula. nos testículos e ovários.

10
28: Mitose; metáfase. contribuições da apoptose na manutenção das células somáticas
Neurônios são células somáticas que normalmente não sofrem de organismos vivos. Uma delas está no controle do número
divisão. A presença de cromossomos duplicados, condensados e de células de um organismo, que é efetivado não apenas pela
alinhados no interior das células indica que estão passando pela velocidade da divisão celular, mas também pelo controle da morte
metáfase mitótica celular. Se as células não são mais necessárias, elas morrem pela
ativação da morte celular programada. Outra contribuição desse
29:A hipótese de que ovos diploides surgem por divisões fenômeno na manutenção das células corporais dos mamíferos
mitóticas de células precursoras diploides reforça a suposição é o desencadeamento da apoptose nas células portadoras de
de que essa espécie de formiga apresenta desvantagem por DNA lesado, o que contribui para a diminuição da frequência de
perda de variabilidade genética, pois a mitose produz células câncer nesses organismos.
cromossômica e geneticamente idênticas. b) A metamorfose das rãs é um exemplo da utilização de
A hipótese de que os ovos diploides são resultantes da fusão de apoptose por um grupo de animais. Quando um girino se
células haploides pressupõe que essas células haploides foram transforma numa rã, as células na cauda são induzidas a sofrer
formadas por divisões meióticas, nas quais ocorrem fenômenos apoptose e morrem. A cauda que não é mais necessária para a
que ampliam a variabilidade genética: o crossing-over rã desaparece.
(permutação), a segregação independente dos cromossomos
homólogos e a união de células recombinadas. Essa hipótese 33: 01 + 02 + 04 + 16 = 23.
fragiliza a suposição de perda de variabilidade genética na [Resposta do ponto de vista da disciplina de Biologia]
população de formigas. [01] Correta.
[02] Correta.
30: 01 + 02 + 04 + 08 + 16 = 31 [Resposta do ponto de vista da disciplina de Matemática]
VN VN
Todas as afirmativas são corretas. A intérfase é o período do VC VC VN VC V
ciclo celular que precede a divisão celular. Durante a intérfase, = = ⋅ =N
VN VC − VN VC VC − VN VC − VN
a célula realiza suas funções metabólicas, cresce em tamanho, 1−
produz proteínas e duplica seu DNA. Durante a divisão celular a VC VC
cromatina condensa-se tornando-se mais espessa e curta, sendo [04] Correta. Simplificando a relação dada:
então denominada cromossomo.

EXERCÍCIOS APROFUNDADOS
[08] Incorreta. Uma célula com RNP = 2 tem mais de 60% de seu
volume ocupado pelo núcleo. Calculando:
31:a) o número de cromossomos na célula haploide do 2=
VN 2
→ 2VC − 2VN = VN → 2VC = 3VN → VN = VC → VN ≈ 0,67VC
organismo em questão é 2 (n=2). Na anáfase representada VC − VN 3
é possível observar a separação das cromátides irmãs de 4
cromossomos. Sabendo que a célula diploide apresenta um par [16] Correta. Calculando:
de cada cromossomo, conclui-se que 2n é igual a 4 e, portanto, 4
VC = ð R3
n=2. 3
b) a célula representada é de um animal. As características desta 4 R3 4
célula que permitem sua identificação são: ausência de parede =
VN =ð ð R3
3 8 24
celular, citocinese centrípeta e presença de centríolos. 4 4 4
VN ð R3
24 4 24 4 1
=
RNP → = 24 = 24 = ⋅ = → RNP =
VC − VN 4 4 4 4 32 − 4 24 28 28 7
32:a) A apoptose é um mecanismo útil para manter o 3
ð R3 −
24
ð R3 −
3 24 24
equilíbrio interno dos organismos multicelulares. Várias são as

ANOTAÇÕES

www.biologiatotal.com.br 11
SÍNTESE PROTEICA
A síntese de proteínas dentro da célula ocorre
devido à interação do núcleo com o citoplasma.
No núcleo o DNA sintetiza o RNAm (mensageiro)
de uma das suas cadeias, transcrevendo o código
de uma proteína específica.

Depois de produzido, o RNAm desloca-se para o


citoplasma e liga-se aos ribossomos que passam
agora a “ler” a sequência de bases nitrogenadas
do RNAm.

A leitura do código é feita por “trincas” de bases


nitrogenadas; cada “trinca” do RNA corresponde
a um códon que irá determinar a colocação de
um aminoácido específico na cadeia proteica.
Isso caracteriza a tradução do código genético.

CITOGENÉTICA
CÓDIGO GENÉTICO
O gene corresponde a uma sequência particular
de DNA, codificadora de uma informação
Na figura acima está representado o dogma central
da biologia: replicação, transcrião e tradução. O dna,
(proteína ou RNA).
como molécula mais importante de uim ser vivo,
passa por estas transformações para manter a vida
A expressão gênica envolve a cópia de regiões
Existem 64 códons diferentes que codificam 20 específicas do DNA (os genes) numa molécula
aminoácidos. Logo, cada aminoácido da proteína de mRNA e a passagem da informação contida
é codificado por 1, 2, 3 ou 4 códons do RNAm, na sequência de nucleotídeos desse mRNA para
sendo o código genético chamado degenerado. uma sequência de aminoácidos. As moléculas
de RNA são sintetizadas por um processo
Para a formação da proteína participam os RNAm, conhecido como transcrição, similar a replicação
RNAt e ribossomos. Os RNAt são moléculas do DNA. Quando se diz que um gene é expresso
pequenas que possuem um anticódon, o qual em um dado tecido, significa que neste tecido
deve reconhecer o aminoácido específico, fixá- é feita uma molécula de mRNA usando este
lo e, com ele a reboque, procurar um local do gene como molde e esta molécula de RNA serve
RNAm (um códon) onde o seu anticódon encaixe como molde para a “montagem” da proteína
perfeitamente. O apoio para isso será dado pelo correspondente Neste processo uma das fitas do
ribossomo. DNA atua como modelo para que o pareamento
de bases complementares possa acontecer.
A identificação dos aminoácidos na cadeia Após a transcrição do DNA a fita de mRNA é
polipeptídica se dá em função da sequência de liberada da molécula de DNA, voltando o DNA a
códons do RNAm. Estes podem ser identificados conformação original. O mRNA então transcrito
de acordo com a tabela a seguir: dirige a síntese da molécula proteica, enquanto

www.biologiatotal.com.br 59
outras moléculas de RNA (tRNA) servem como específicos no DNA. Como cada molécula de
transportadores dos aminoácidos envolvidos, ou mRNA pode ser traduzida em milhares de cópias
se encontram como componentes ribossômicos. de uma cadeia polipeptídica, a informação
Em síntese, o DNA pode se replicar e dar origem contida numa pequena região do DNA pode
a novas moléculas de DNA; pode ainda ser dirigir a síntese de milhões de cópias de uma
transcrito em RNA, e este por sua vez traduz o proteína específica.
código genético em proteínas. Isso é conhecido
como o Dogma Central da Biologia. Conter a informação genética significa não
somente armazenar e transmitir ao longo das
A quantidade de mRNA produzido a partir de gerações, mas expressar, ou seja, servir de molde
uma região particular do DNA é controlada por para a síntese de RNAs e alguns desses serem
proteínas regulatórias, que se ligam a sítios traduzidos nas proteínas correspondentes.
CITOGENÉTICA

LEITURA COMPLEMENTAR
Entenda o filme “O óleo de Lorenzo”!
O filme “O óleo de Lorenzo” conta a história real de filme termina com a descoberta de um óleo – o óleo de
um menino de oito anos que possui uma doença rara Lorenzo – que reduz fortemente o desenvolvimento da
chamada adrenoleucodistrofia (ALD). Lutando contra o doença. Mas qual a relação entre a doença de Lorenzo, o
tempo em uma época em que pouco se sabia sobre a óleo que estagnou seu desenvolvimento e os neurônios
doença, os pais do menino passaram a pesquisar por que todos nós possuímos?
si próprios um possível tratamento para a criança. O

60
impulsos nervosos são transmitidos entre os neurônios
sendo deslocados ao longo dos axônios. Ao redor desses
prolongamentos existe uma camada protetora chamada
bainha de mielina, que também facilita a transmissão
de impulsos nervosos, otimizando a comunicação entre
os neurônios. Agora que sabemos como funcionam os
neurônios e a bainha de mielina, podemos entender de
que forma a ALD resulta em distúrbios neuronais: os
ácidos graxos de cadeia longa acumulados no tecido
cerebral destroem a bainha de mielina, interferindo no
deslocamento dos impulsos e dificultando a transmissão
nervosa.

Lorenzo ficou famoso ao sobreviver por muito tempo a esta


doença que até então não tem cura. Imagem: Daily Mail

A adrenoleucodistrofia é uma doença genética ligada ao


cromossomo X, e que por isso acomete principalmente
homens. Extremamente rara, a ALD resulta de alterações
em uma proteína transportadora de membrana dos
peroxissomos – responsáveis pela degradação dos A bainha de mielina otimiza o transporte de impulsos
ácidos graxos –, interferindo na atividade normal nervosos ao longo do axônio, e sua destruição resulta
destas organelas. Uma vez alterada, a proteína não em danos no sistema neurológico dos pacientes com

CITOGENÉTICA
adrenoleucodistrofia. Imagem: John Wiley & Sons, Inc.
consegue mais realizar sua função e os ácidos graxos
de cadeia longa, que deveriam entrar nos peroxissomos Mas de que forma o óleo de Lorenzo impede o
para serem degradados, acumulam-se nos tecidos do desenvolvimento da doença? O óleo é uma mistura
organismo, resultando em sintomas progressivos, como de ácidos graxos de cadeia curta que, aliado a uma
fraqueza corporal e distúrbios neurológicos.Os distúrbios dieta restritiva, reduz a produção de ácidos graxos de
neurológicos são os sintomas mais importantes da cadeia longa, diminuindo seu acúmulo no organismo.
doença e ocorrem devido ao acúmulo dos ácidos graxos A real eficácia do óleo ainda não está comprovada
nos tecidos cerebrais, que resultam na redução da cientificamente, mas o tratamento parece ter surtido
transmissão de impulsos nervosos. Mas de que maneira efeito em Lorenzo, que viveu até os 30 anos de idade –
o acúmulo de ácidos graxos interferem na transmissão 20 anos a mais do que o previsto pelos médicos.
nervosa?Nossos neurônios são células diferenciadas
com prolongamentos compridos chamados axônios. Os Fonte: Biochimie.

ANOTAÇÕES

www.biologiatotal.com.br 61
EXERCÍCIOS
CAIU NA UEM - 2016
Sobre o material genético, assinale o que for correto.
01 A duplicação do material genético de eucariotos ocorre durante a anáfase da mitose.
02 Entende-se por gene o segmento de DNA capaz de codificar um RNA.
04 Em um gene ativo, a RNA polimerase está complementando os desoxinucleotídeos da região codificante com
ribonucleotídeos complementares e realizando ligações fosfo-di-ester entre eles.
08 Toda mutação em genes que codificam proteínas em eucariotos altera a sequência de aminoácidos na proteína
codificada neste gene.
16 Eucariotos se distinguem de procariotos, neste quesito, por possuírem histonas associadas ao DNA, formando
cromatina.

longo polímero de unidades simples de nucleotídeos


(monômeros), e sua cadeia principal, por moléculas
de açúcares e fosfato intercaladas, unidas por ligações
fosfodiéster. Ligada a cada molécula de açúcar, está
uma das quatro bases nitrogenadas, cuja sequência,
ao longo da molécula de DNA, constitui a informação
EXERCÍCIOS

1 (UECE 2015) A molécula de DNA armazena genética. A leitura dessas sequências é realizada
informação genômica que é transcrita e traduzida pelo RNA mensageiro (ácido ribonucleico), que copia
por mecanismos elegantes como os de transcrição parte da cadeia de DNA por um processo chamado
e tradução. Entretanto, entre os distintos indivíduos transcrição, e, posteriormente, a informação contida
biológicos construídos por mensagem contida no neste é “traduzida” em proteínas pela tradução.
DNA, há uma singularidade biológica que se repete, Embora a maior parte do RNA produzido seja
mas se diferencia pelo modo como esta é organizada. utilizada na síntese de proteínas, pode também ter
Essa descrição corresponde à(s) função estrutural (RNA ribossômico), que faz parte da
a molécula de RNAr. constituição dos ribossomos.
b moléculas de RNAt. Das bases nitrogenadas listadas abaixo, qual ocorre
c bases nitrogenadas.
exclusivamente na estrutura do DNA?
d molécula de RNAm.
a Adenina
b Uracila
(UECE 2015) Sobre os ácidos nucleicos (DNA e RNA) c Timina
2 d Guanina
é correto afirmar que
e Citosina
a o RNA é formado por segmentos denominados genes,
responsáveis pela produção de proteínas nos seres
vivos.
b o processo de produção de uma molécula de RNA a 4 (IFSUL 2011) As proteínas são substâncias essenciais
partir de uma molécula de DNA é chamado de tradução. da estrutura das células vivas e podem ser formadas
c DNA é composto por uma desoxirribose e um grupo por um ou mais polipeptídios. O processo de síntese
fosfato, sendo suas quatro bases nitrogenadas:
adenina, citosina, guanina e timina. de uma cadeia polipeptídica consiste em unir
d dentre as bases nitrogenadas, a timina é exclusiva do aminoácidos de acordo com a sequência de códons
RNA. de RNAm.
Como essa sequência é determinada pelas bases de
DNA que serviu de molde ao RNAm, a síntese de
3 (UNISINOS 2012) Em 1953, James Watson e Francis proteínas é denominada
Crick descreveram a estrutura do DNA (ácido
desoxirribonucleico). O DNA armazena as informações a duplicação semiconservativa.
genéticas que coordenam o desenvolvimento e b transcrição gênica.
o funcionamento dos seres vivos em unidades c tradução gênica.
chamadas genes. Sua estrutura é formada por um d programação genética.

62
a as moléculas de DNA das duas células carregam
5 (PUCRJ 2010) Como consequência de uma mutação informações diferentes.
hipotética em uma molécula de RNA mensageiro,
podemos esperar que ocorram diversas mudanças, à b os genes que estão se expressando nas duas células
são diferentes.
exceção de alterações:
c o mecanismo de tradução do RNA difere nas duas
a na transcrição reversa desse RNA para DNA. células.
b na autoduplicação do DNA que o originou. d o mecanismo de transcrição do DNA nas duas células
c na tradução dessa molécula de RNA. é diferente.
e os RNA transportadores das duas células são diferentes.
d moleculares em proteínas estruturais originadas desse
RNA.
e funcionais em proteínas enzimáticas originadas desse
RNA. 9 (UNESP 2004) Erros podem ocorrer, embora em
baixa frequência, durante os processos de replicação,
transcrição e tradução do DNA. Entretanto, as
6 (ENEM 2009) A figura seguinte representa um consequências desses erros podem ser mais graves,
modelo de transmissão da informação genética nos por serem herdáveis, quando ocorrem
sistemas biológicos. No fim do processo, que inclui a a na transcrição, apenas.
replicação, a transcrição e a tradução, há três formas b na replicação, apenas.
proteicas diferentes denominadas a, b e c. c na replicação e na transcrição, apenas.
d na transcrição e na tradução, apenas.
e em qualquer um dos três processos.

(CFTMG 2007) A figura a seguir representa o processo


Depreende-se do modelo que 10 de síntese de proteínas denominado tradução, do
a a única molécula que participa da produção de qual participam três tipos de RNA com a possibilidade
proteínas é o DNA.
de serem:
b o fluxo de informação genética, nos sistemas biológicos,
é unidirecional. 1 - associados às proteínas, compondo os ribossomos.
c as fontes de informação ativas durante o processo de

EXERCÍCIOS
transcrição são as proteínas. 2 - estruturados em filamentos simples, contendo o
d é possível obter diferentes variantes proteicas a partir códon.
de um mesmo produto de transcrição.
3 - ligados aos aminoácidos, constituindo o anticódon.
e a molécula de DNA possui forma circular e as demais
moléculas possuem forma de fita simples linearizadas.

7 (UFRGS 2008) O esquema a seguir representa uma


etapa do processo de tradução.

Esses tipos de RNA são, respectivamente,


a ribossômico, mensageiro, transportador.
b transportador, mensageiro, ribossômico.
c mensageiro, ribossômico, transportador.
d ribossômico, transportador, mensageiro.
Assinale a alternativa que identifica, correta e
respectivamente, os componentes indicados pelas
setas 1, 2 e 3 do esquema.
a polipeptídeo - RNA transportador - códon
b proteína - RNA mensageiro - anticódon 11 (FATEC 2017) Hormônio do crescimento de plantas é
c RNA mensageiro - RNA ribossômico - anticódon alvo de pesquisa chinesa
d RNA mensageiro - RNA ribossômico - RNA transportador
Um grupo de pesquisadores tem como principal
e polipeptídeo - RNA mensageiro - aminoácido objetivo desvendar o funcionamento dos hormônios
nas plantas.
8 (UFSCAR 2007) O exame de um epitélio e do tecido “Um desses fitormônios é o etileno, molécula de gás
nervoso de um mesmo animal revelou que suas
que regula uma ampla gama de processos, incluindo
células apresentam diferentes características. Isso
o amadurecimento de frutos, o envelhecimento de
ocorre porque
folhas e de flores, a tolerância ao estresse e a defesa

www.biologiatotal.com.br 63
contra patógenos”, explicou o pesquisador Hongwei a formação dos nucleotídeos.
Guo, professor da Escola de Ciências da Vida da b tradução do RNA mensageiro.
Universidade de Pequim. c formação dos triglicerídeos.
d transcrição do DNA.
“Temos estudado fatores que medeiam a regulação
e síntese dos polissacarídeos.
de respostas de plantas ao etileno, como a interação
com outros fitormônios. Essas interações indicam
a existência de complexas redes de sinalização na 13 (UNICAMP 2012) Em um experimento, um segmento
ação do etileno nas plantas”. Entre esses outros de DNA que contém a região codificadora de uma
hormônios, o pesquisador mencionou a citocinina, a proteína humana foi introduzido em um plasmídeo
auxina e a giberelina. e passou a ser expresso em uma bactéria. Considere
que o 50º códon do RNA mensageiro produzido na
“Identificamos que os fatores de transcrição bactéria a partir desse segmento seja um códon de
conhecidos como EIN3 e EIL1 representam uma parada da tradução. Nesse caso, é correto afirmar
integração fundamental nas ações entre o etileno e que:
outros fitormônios”, disse Guo.
a A proteína resultante da tradução desse RNA
Fatores de transcrição como o EIN3 e EIL1 são mensageiro possui 50 aminoácidos.
proteínas essenciais no controle da expressão b A proteína resultante da tradução desse RNA
genética. Quando elas se ligam ao DNA de células mensageiro possui 49 aminoácidos.
eucarióticas, permitem que haja uma ligação entre c A proteína resultante da tradução desse RNA
mensageiro possui 150 aminoácidos.
a enzima RNA-polimerase e o DNA, possibilitando,
d Nenhuma proteína é formada, pois esse RNA
assim, a transcrição e a futura tradução. mensageiro apresenta um códon de parada.
Caso a equipe de pesquisadores consiga suprimir
fatores de transcrição como o EIN3 e o EIL1 em
14 (IFSP 2012) A produção de uma proteína no interior
algumas células, elas deverão apresentar, quando das células eucarióticas poderia ser comparada a
comparadas às demais células, uma linha de produção de uma indústria. Para que
a maior concentração de DNA. o trabalho ocorra, é necessária a síntese de uma
EXERCÍCIOS

b maior concentração de clorofilas. molécula de RNA mensageiro e esta será utilizada


c maior concentração de cloroplastos. pelos ribossomos para que a proteína seja sintetizada.
d menor concentração de celulose. Pode-se afirmar que
e menor concentração de RNA. a a síntese de RNA mensageiro ocorre no citosol e a
síntese proteica ocorre no núcleo celular.
b a síntese de RNA mensageiro é denominada tradução e
12 (UNESP 2016) Nas células ocorrem reações químicas a de proteínas chama-se transcrição.
para a síntese de moléculas orgânicas necessárias c o RNA mensageiro apresenta uma sequência de
à própria célula e ao organismo. A figura mostra anticódons que serão traduzidos pelos ribossomos.
a reação química de formação de uma estrutura d a proteína é formada por aminoácidos que foram
molecular maior a partir da união de três outras trazidos pelos RNA mensageiros até os ribossomos.
moléculas menores. e os ribossomos realizam a tradução da molécula de RNA
mensageiro no citosol da célula.

15 (UERJ 2014) As características abaixo são referentes


aos processos de replicação, transcrição e tradução,
que ocorrem em seres vivos.
I. A síntese de proteínas tem início antes mesmo do
a
término da transcrição.
b
c II. A grande maioria dos genes contém íntrons,
d retirados antes da tradução.
III. A síntese de proteínas sempre ocorre em
ribossomos livres no citoplasma.
IV. O processo de replicação possui uma única origem.
As características I, II, III e IV estão associadas,
respectivamente, aos organismos indicados em:
a eucariotos – eucariotos – procariotos – eucariotos
b eucariotos – procariotos – eucariotos – procariotos
c procariotos – eucariotos – procariotos – procariotos
Esta reação química ocorre no interior da célula d procariotos – procariotos – eucariotos – procariotos
durante a

64
16 (FUVEST 2012) Uma mutação, responsável por uma - o códon UGG aparece duas vezes na porção desse
doença sanguínea, foi identificada numa família. Abaixo RNA que codifica o peptídeo.
estão representadas sequências de bases nitrogenadas,
Observe, na tabela abaixo, a identificação de alguns
normal e mutante; nelas estão destacados o sítio de
códons:
início da tradução e a base alterada.

O aminoácido metionina, introduzido no peptídeo


pelo códon iniciador, é imediatamente removido
após o término da tradução.
O ácido nucleico representado acima e o número de
aminoácidos codificados pela sequência de bases, A percentagem de triptofano na composição da
entre o sítio de início da tradução e a mutação, estão molécula desse peptídio é de:
corretamente indicados em: a 1,48%
a DNA; 8. b 1,55%
b DNA; 24. c 4,44%
c DNA; 12. d 4,65%
d RNA; 8.
e RNA; 24.

19 (UFC 2007) O pesquisador Gustavo obtém pectinase,


no meio de cultura líquido, produzida pelo fungo
17 (UFTM 2011) Considere o seguinte trecho: ‘Aspergillus niger’, para ser empregada na indústria de
(...) apesar de suas enormes diferenças, peixes e sucos. Gustavo não precisa destruir o fungo para obter

EXERCÍCIOS
mamíferos têm aproximadamente os mesmos genes, a enzima; ele simplesmente separa o meio de cultura do
tal como os crocodilos e os pardais. microrganismo e isola a enzima deste meio. De acordo
(François Jacob. O ratinho, a mosca e o homem.) com o texto, assinale a alternativa correta.
a O ‘Aspergillus niger’ é um organismo que possui
O que explica a produção dessa diferença é
mesossomo; desta forma, a síntese da enzima ocorre
a a existência de um código genético universal e nas membranas do mesossomo e depois ela é secretada
degenerado entre os seres vivos. para o meio de cultura.
b a ocorrência do mesmo tipo de transcrição e de b O caminho da produção da pectinase começa com
tradução que acontecem nesses genes. a transcrição, no citoplasma, do seu RNAm, que é
c que diferentes tipos de RNA mensageiro são transcritos traduzido por ribossomos e depois é ancorado nas
em cada espécie. membranas do retículo endoplasmático rugoso, onde
a tradução é concluída.
d a preservação do dogma central da biologia, isto é, um
gene para cada proteína. c A síntese da pectinase começa no citoplasma e termina
nas membranas do retículo endoplasmático rugoso.
e a existência de um ancestral comum entre os mais Em seguida, esta enzima passa para o complexo de
distintos seres vivos. Golgi e é secretada, via vesículas de secreção, para o
meio de cultura.
d A síntese da pectinase começa no núcleo e termina
nas membranas do retículo endoplasmático liso. Em
18 (UERJ 2010) Alguns vírus, como o da poliomielite, seguida, esta enzima passa para o lisossomo, depois
contêm RNA de fita simples (+), que podem funcionar para o complexo de Golgi e é secretada, via vesículas
diretamente como mensageiros na célula infectada. de secreção, para o meio de cultura.
Esses RNA possuem uma sequência nucleotídica e A síntese da pectinase começa no mesossomo e termina
necessária para que o códon de iniciação da síntese nas membranas do retículo endoplasmático rugoso.
proteica seja identificado, como mostra o esquema a Em seguida, esta enzima passa para o complexo de
seguir: Golgi e é secretada, via vesículas de secreção, para o
meio de cultura.

Considere, para um RNAm desse tipo, que sintetiza um


20 (UFU 2007) O gráfico a seguir representa a
produção de proteínas por duas populações celulares
peptídeo viral, as seguintes informações: mantidas “in vitro”. A primeira população celular
- se a base nitrogenada adenina do códon de iniciação é representada pela sequência 1 e a segunda pela
é a de número 1, a base uracila do códon de terminação sequência 2. A seta vertical indica o tempo exato de
será a de número 133, seguindo-se o sentido da
tradução; administração da Droga x.

www.biologiatotal.com.br 65
a Apenas 1.
b Apenas 2.
c Apenas 3.
d Apenas 1 e 2.
e 1, 2 e 3.

22 (UECE 2009) Sobre os Ácidos Nucleicos, são feitas as


seguintes afirmações:
I. São macromoléculas, de elevada massa molecular, que
possuem ácido fosfórico, açúcares e bases purínicas e
pirimidínicas, em sua composição.
Com base no gráfico apresentado, é correto afirmar
que a Droga x inibe o processo de tradução de forma II. Ocorrem em todas as células vivas e são responsáveis
pelo armazenamento e transmissão da informação
a mais lenta na sequência 2. genética e por sua tradução, que é expressa pela síntese
b mais rápida na sequência 2. protéica.
c mais rápida na sequência 1. III. Encontram-se presentes no núcleo dos procariotos e
d que em ambas as sequências a velocidade é a mesma dispersos no hialoplasma dos eucariotos.
IV. Encontram-se, normalmente, organizados sob a
forma de fita simples ou dupla.
Das quatro afirmações anteriores, são verdadeiras
a apenas a I, a II e a IV.
b a I, a II, a III e a IV.
c apenas a III e a IV.
d apenas a I e a II.
21 (UFRGS 2010) Leia o quadrinho a seguir.
EXERCÍCIOS

23 (UPE-SSA 3 2016) A angiogênese é um mecanismo


bem regulado em nosso organismo, sendo
fundamental durante o desenvolvimento embrionário.
Na fase adulta, no entanto, esses vasos sanguíneos,
que, às vezes, brotam fora de hora e de lugar, podem
estar relacionados a problemas graves, como o câncer.
Nesse caso, o tumor só consegue se desenvolver, se
houver suprimento sanguíneo, que o alimenta e o
ajuda a crescer e a se espalhar por outros tecidos. Há
muito se sabe que os genes HIF1A e VEGFA são os
principais responsáveis pela regulação da formação
da angiogênese. O que os ativava ou desativava, no
entanto, permanecia sendo um mistério.
Os microRNAs são moléculas, que controlam a
expressão de um tipo específico de RNA mensageiro
e inibem a expressão das moléculas às quais se ligam.
Segundo Diana Nunes, “Quando um microRNA se
Considere o enunciado a seguir, referente ao
liga a um RNA mensageiro, como no caso do VEGFA,
significado da resposta de Mafalda, e as três
ele o regula negativamente, impedindo sua tradução
propostas para completá-lo.
em proteína.”
A expressão direção 5’→3’ refere-se Fonte: http://revistapesquisa.fapesp.br/2015/03/23/freios-
moleculares/(Adaptado).
1. à ligação entre fosfato e açúcar no processo de
Acesso em: julho 2015.
replicação do DNA.
Sobre isso, analise os itens a seguir:
2. à atividade da enzima RNA polimerase no processo
de transcrição do RNA. I. O RNAm descrito no texto transmite as instruções
contidas nos genes, levando à produção de proteínas,
3. à união entre os aminoácidos no processo de
que iniciam o desenvolvimento de novos vasos
tradução das proteínas.
sanguíneos.
Quais propostas estão corretas? II. Na regulação descrita, microRNAs específicos se

66
ligavam aos RNAs mensageiros de HIF1A e VEGFA, II. Nos eucariotos e procariotos, uma molécula de RNAm
impedindo que eles fossem traduzidos em proteínas passa pela tradução, para dar origem a um peptídeo.
e, com isso, se iniciasse o surgimento de novos vasos III. Nos eucariotos, o ribossomo pode acoplar-se ao
sanguíneos. retículo endoplasmático, durante o processo de tradução.
III. Se a expressão dos microRNAs for aumentada, os
RNAs mensageiros de HIF1A e VEGFA ficarão livres para Das afirmações acima,
produzir proteínas e iniciar a angiogênese. a apenas I está correta.
IV. A regulação desses genes ocorre durante a replicação b apenas II está correta.
e começa quando a RNA polimerase se encaixa no c apenas III está correta.
promotor, iniciando a síntese do RNAm. d apenas I e III estão corretas.

Estão CORRETOS e apenas II e III estão corretas.

a I e II.
b I e III.
c II e III.
d II e IV. 26 (UEPB 2011) Analise as proposições abaixo,
referentes ao processo de síntese, armazenamento e
e III e IV.
utilização de polipeptídeos em células eucarióticas.
I. O processo de síntese de polipeptídeos ocorre
nos ribossomos, que são estruturas constituídas
(UFRGS 2016) No bloco superior abaixo, são citados
24 por proteínas associadas a um ácido ribonucleico
processos relacionados à síntese proteica; no inferior, ribossômico (RNAr). Para a síntese de proteínas
seus eventos característicos. ocorrer, o ribossomo associa-se ao RNA mensageiro
Associe adequadamente o bloco inferior ao superior. (RNAm) e desloca-se sobre ele, traduzindo a sua
informação. À medida que o ribossomo se desloca, o
1. Transcrição
polipeptídeo vai sendo formado.
2. Tradução
II. A síntese de proteínas recebe a denominação de
( ) A síntese de RNA, a partir do DNA, é catalisada Tradução, e pode ocorrer em polissomos livres no

EXERCÍCIOS
pela polimerase do RNA. citosol ou em polissomos associados às membranas
( ) O RNAt que transporta o aminoácido metionina do retículo endoplasmático, caso em que o retículo
emparelha-se com um códon AUG, presente na passa a receber a denominação de ergastoplasma.
molécula de RNAm. III. Quando proteínas são produzidas no
( ) O sítio P é sempre ocupado pelo RNAt que carrega ergastoplasma, penetram diretamente no interior do
a cadeia polipeptídica em formação. retículo e seguem para o complexo golgiense onde
passam por processos de concentração, modificação
( ) A região promotora é uma sequência de bases e eliminação. Esta última etapa pode ocorrer para
nitrogenadas do DNA que determina o local de incorporação de proteínas na membrana plasmática,
encaixe da polimerase do RNA. no processo de secreção celular através de vesículas
A sequência correta de preenchimento dos secretoras ou na formação de lisossomos.
parênteses, de cima para baixo, é Assinale a alternativa que contém a(s) proposição(ões)
a 1 – 1 – 2 – 2. correta(s):
b 1 – 2 – 2 – 1.
a I, apenas
c 1 – 2 – 2 – 2.
b I e II, apenas
d 2 – 1 – 1 – 1.
c II e III, apenas
e 2 – 1 – 1 – 2. d I e III, apenas
e I, II e III

(UCS 2012) O DNA desempenha suas funções por


25 meio do RNA mensageiro (RNAm). A maioria das
27 (UFLA 2010) Analise as seguintes proposições
moléculas de RNA, por sua vez, orienta a produção em relação à replicação e transcrição do DNA e ao
de proteínas. processo de tradução e, a seguir, marque a alternativa
Considere as seguintes afirmações em relação aos CORRETA.
processos de expressão gênica. I - Nos processos de replicação e transcrição as
I. Nos procariotos, a transcrição gênica dá origem principais enzimas envolvidas são a RNA polimerase
a um pré-RNAm, que posteriormente passa pelo e a DNA polimerase, respectivamente.
processo de splicing para gerar o RNAm. II - O processo de tradução ocorre no citoplasma.

www.biologiatotal.com.br 67
III - A replicação do DNA é conservativa. dá origem ao RNAm pode alterar a tradução a partir
a Apenas as proposições II e III estão corretas. daquele ponto.
b Apenas as proposições I e III estão corretas. V. A associação entre aminoácidos para formar
c Apenas a proposição II está correta.
proteínas depende de ligações peptídicas.
d As proposições I, II e III estão corretas.
Estão CORRETAS as afirmativas:
a I , IV e V apenas.
b I, II e III apenas.
(UFPEL 2008) As proteínas são sintetizadas pelos
28 ribossomos livres no citoplasma ou no retículo c II, III e IV apenas.
endoplasmático rugoso. O ribossomo fornece o local d I, II, III, IV e V.
apropriado para que os aminoácidos sejam ligados e
assim formem a proteína.
Analise as afirmativas.
I. O retículo endoplasmático rugoso promove a síntese 30 (UERJ 2005) A mutação em um gene, por
dos ribossomos e produz RNA. consequência da substituição de uma única base
II. O ribossomo se desloca ao longo da molécula de na estrutura do DNA, pode acarretar modificações
RNAr e assim vai traduzindo a informação em proteínas. importantes na atividade biológica da proteína
III. Para cada códon do DNA mensageiro é adicionado codificada por esse gene.
um aminoácido, portanto o número de códons é Considere que a estrutura normal de um RNA
correspondente ao número de aminoácidos existentes.
mensageiro de um peptídio e sua estrutura alterada
IV. O retículo endoplasmático rugoso abriga os em virtude da troca de uma única base no gene
ribossomos que serão levados até o RNAm pelo RNAt.
correspondente são:
V. As proteínas correspondem às informações que
existem no DNA, pois todos os nucleotídeos do DNA 5’ AUGUGGUUUGCACACAAAUGAUAA 3’ (normal)
são utilizados no processo de tradução. 5’ AUGUGGUUUGAACACAAAUGAUAA 3’ (alterada)
Quantas afirmativas estão INCORRETAS?
CITOGENÉTICA

A tabela a seguir identifica alguns códons.


a Uma.
b Duas.
c Três.
d Quatro.
e Cinco.

29 (PUCMG 2007) Sobre o esquema a seguir, foram


feitas algumas afirmações.

Observe que:
- o códon da metionina é também o do início da
tradução;
- os códons de término da tradução são UAA, UAG
e UGA.
O aminoácido encontrado no peptídio normal e
aquele que o substituiu no peptídio mutante são,
respectivamente:
I. O esquema representa o mecanismo da tradução,
a lisina e cisteína
onde interagem os três tipos de RNAs.
b treonina e triptofano
II. O pareamento do códon com anticódon c alanina e ácido glutâmico
específico resulta na entrada do aminoácido correto, d fenil alanina e ácido aspártico
determinado pela sequência codificadora.
III. Toda molécula de RNAm possui um códon de
iniciação, que é sempre o mesmo - AUG.
IV. A perda de um único nucleotídeo no gene que

68
GABARITO DJOW
CAIU NA UEM - 2016
02 + 04 + 16 = 22.
[01] Incorreto: A duplicação do material genético de eucariotos ocorre durante o período 5 da
interfase.
[08] Incorreto: A substituição de um nucleotídeo por outro, na molécula de DNA, pode não alterar a
sequência dos aminoácidos da proteína codificada, porque o código genético é degenerado.

SINTESE PROTEICA
1 - [C] 10 - [A]
As moléculas de DNA que constituem o material genético dos
seres vivos são formadas por quatro tipos de nucleotídeos que
se diferenciam pelas bases nitrogenadas A, T, C e G. A diferença 11 - [E]
consiste apenas no número e na ordem em que essas bases são
encadeadas nos genes. A supressão dos fatores de transcrição resultará na menor
produção de moléculas de RNA.

2- [C]
Os genes são segmentos do DNA. A produção do RNA a 12- [B]
partir de um molde de DNA é denominado transcrição. A base Durante a tradução ribossômica do RNA mensageiro, os
nitrogenada timina ocorre no DNA. aminoácidos são desencadeados e ligados por meio de ligações
covalentes amídicas conhecidas como ligações peptídicas.

CITOGENÉTICA
3 - [C]
A base pirimídica timina aparece na molécula de DNA. 13- [B]
A proteína resultante da tradução do RNA mensageiro com 50
códons apresentará 49 aminoácidos, porque o último códon, de
4- [C] parada, determina o fim da síntese e não é capaz de codificar
qualquer aminoácido.
A síntese de uma proteína consiste na tradução dos códons do
RNA mensageiro na forma de uma sequência de aminoácidos.
Cada códon do RNAm é uma sequência de três nucleotídeos
que determina a posição exata do aminoácido na cadeia 14 - [E]
polipeptídica. A síntese de uma proteína no citosol envolve a tradução de
uma molécula de RNA mensageiro por meio de um conjunto de
ribossomos e de vários RNAs transportadores que conduzem os
5 - [B] aminoácidos corretos para seu encadeamento.
Uma mutação em uma molécula de RNA pode causar alterações
moleculares na proteína resultante sua da tradução, que podem 15 - [C]
culminar numa alteração funcional nessa proteína. Se o RNA for
de uma célula que tenha uma transcriptase reversa, alterações na [I], [III] e [IV] são fenômenos gênicos que ocorrem em células
transcrição reversa desse RNA também poderão ser observadas. procarióticas, como bactérias e cianobactérias. Os íntrons
Apenas não poderão ocorrer alterações na autoduplicação do correspondem aos trechos não codificantes do DNA e ocorrem,
DNA que o originou. normalmente, em células eucarióticas, as quais são verificados
em proctistas, fungos, plantas e animais.
RESPOSTA COMENTADA http://bit.ly/2qexmg7
6 - [D]
A figura mostra que a partir da transcrição de um único RNA,
16 - [D]
houve a tradução de três proteínas diferentes (proteínas “a”, O ácido nucleico representado é o RNA mensageiro, que será
“b” e “c”). traduzido em proteína nos ribossomos. Entre o sítio de início da
tradução e a mutação existem 24 nucleotídeos que formam 8
códons. Esse trecho será traduzido em uma sequência com 8
7- [A] aminoácidos.
RESPOSTA COMENTADA http://bit.ly/2qemqiL

8- [B] 17 - [C]
As diferenças observadas entre os animais citados no texto se
deve à expressão diferencial de seus genes.
9 - [B] RESPOSTA COMENTADA http://bit.ly/2qesrvI

www.biologiatotal.com.br 69
18- [D] Em procariotos, os ácidos nucleicos, DNA e RNA, encontram-se
dispersos no citosol.
Como o esquema mostra, a sequência de nucleotídeos inicial do RESPOSTA COMENTADA http://bit.ly/2qewY1j
RNA viral induz o reconhecimento do códon de iniciação, que
corresponde ao aminoácido metionina. Segue-se a sequência
nucleotídica que será traduzida em proteína. A tradução é 23- [A]
bloqueada quando o códon de terminação, que não corresponde [III] Incorreto. O aumento da expressão dos genes VEGFA e
a aminoácido algum, é atingido. Dessa maneira, se a base HIF1A provoca inibição da angiogênese.
adenina (A) do códon de iniciação (AUG) é 1, e a base uracila (U),
a primeira de qualquer um dos possíveis códons de terminação [IV] Incorreto. A síntese do RNAm ocorre durante a transcrição.
(UAG, UAA ou UAC), é 133, pode-se dizer que o número total
RESPOSTA COMENTADA http://bit.ly/2qesSpH
de bases que formam a sequência que será traduzida em
aminoácidos é de 133-1=132. Como cada 3 bases formam um 24- [B]
códon, o número de aminoácidos codificados pelo RNA será de
132 ÷3 = 44. Porém, a metionina introduzida pelo códon de A correlação entre os eventos de transcrição (1) e tradução (2),
iniciação é imediatamente removida após a síntese, fazendo de cima para baixo é: 1 – 2 – 2 – 1.
com que o peptídio formado tenha 44-1= 43 aminoácidos. RESPOSTA COMENTADA http://bit.ly/2qercwz
Como dois códons desse peptídeo são do triptofano (UGG), a
proporção desse aminoácido na molécula do peptídeo será de 2
em 43, ou seja, 4,65%. 25- [E]
RESPOSTA COMENTADA http://bit.ly/2qeyFvH [I]. Falso: A remoção dos introns e o agrupamento dos exons
(splicing) durante o processamento do RNAm somente ocorre
19 - [C] em eucariotos.
RESPOSTA COMENTADA http://bit.ly/2qentPu RESPOSTA COMENTADA http://bit.ly/2qewGaJ

20- [B] 26- [E]


RESPOSTA COMENTADA http://bit.ly/2qeBCw9 Todas as afirmações estão corretas e correlacionadas ao processo
de síntese dos polipeptídeos em células eucarióticas animais.
21- [D]
RESPOSTA COMENTADA http://bit.ly/2qegmqo
A molécula de DNA é constituída por uma cadeia de nucleotídeos.
Cada nucleotídeo, por sua vez, é formado por um grupo fosfato, 27- [C]
um açúcar (desoxirribose) e uma base nitrogenada (timina,
citosina, guanina ou adenina). Para formar a molécula de DNA, A principal enzima envolvida na replicação do DNA é a DNA
CITOGENÉTICA

necessária se faz a ligação entre os nucleotídeos. O grupo polimerase e no processo de transcrição é a RNA polimerase. A
hidroxila do carbono-3 da pentose do primeiro nucleotídeo liga- replicação do DNA é semiconservativa, pois cada molécula recém-
se ao grupo fosfato ligado à hidroxila do carbono-5 da pentose formada conserva uma das cadeias de nucleotídeos da molécula
do segundo nucleotídeo. Devido a essa formação, a cadeia original. Os processos de replicação e transcrição ocorrem no
de DNA fica com uma direção determinada, isto é, em uma núcleo e o processo de tradução ocorre no citoplasma.
extremidade temos livre a hidroxida do carbono-5 da primeira RESPOSTA COMENTADA http://bit.ly/2qeaMnG
pentose e na outra temos livre a hidroxila do carbono-3 da
última pentose. Isso determina que o crescimento do DNA se 28- [E]
faça na direção 5’ → 3’. A ligação entre o fosfato e o açúcar RESPOSTA COMENTADA http://bit.ly/2qeERDG
no processo de replicação do DNA e a atividade da enzima RNA
polimerase no processo de transcrição do DNA em RNA ocorre 29- [D]
sempre na direção 5’ → 3’.
RESPOSTA COMENTADA http://bit.ly/2qeFlKg RESPOSTA COMENTADA http://bit.ly/2qemlLT

22- [A] 30- [C]


RESPOSTA COMENTADA http://bit.ly/2qejmD2
Organismos procariotos, como as arqueobactérias e eubactérias
(bactérias e cianobactérias), não possuem núcleo organizado.

ANOTAÇÕES

70
contato@biologiatotal.com.br
/biologiajubilut contato@biologiatotal.com.br
Biologia Total com Prof./biologiajubilut
Jubilut
@paulojubilut Biologia Total com Prof. Jubilut
@Prof_jubilut @paulojubilut
biologiajubilut @Prof_jubilut
biologiajubilut
+biologiatotalbrjubilut
SINTESE PROTEICA
45 (Ufpr 2017) Uma cultura de bactérias idênticas, todas 47 (Uepg 2016) James Watson e Francis Crick resolveram
contendo apenas uma molécula de DNA, é colocada a estrutura do DNA em 1953, rendendo-lhes inclusive
em um meio de cultura no qual os nucleotídeos um prêmio Nobel. Em relação às características desta
são marcados radioativamente. Elas são mantidas molécula, assinale o que for correto.
nesse meio por dois ciclos de divisão celular; ou 01 Uma mutação em uma única base nitrogenada não
seja, cada bactéria terá originado quatro bactérias- é capaz de prejudicar a estrutura de uma proteína e
levar a manifestação de uma doença. Já as mutações
filhas. Depois, são mantidas por mais um ciclo de cromossômicas, por exemplo, trissomia do 21, são
divisão em um meio com nucleotídeo não radioativo. extremamente graves.
Cada molécula de DNA é formada por duas cadeias 02 A replicação do DNA é dita semiconservativa, sendo que
polinucleotídicas enroladas helicoidalmente. cada uma das fitas é utilizada como molde para a síntese
de uma fita complementar, polimerizada pela enzima DNA
a A partir de uma bactéria dessa colônia, quantas cadeias polimerase.
polinucleotídicas conterão marcação radioativa e quantas
cadeias não conterão marcação radioativa ao final dos três 04 O DNA é uma molécula constituída por nucleotídeos
ciclos? organizados em fita única, os quais se unem por ligações
denominadas pontes de hidrogênio.
b Explique o motivo de sua resposta no item anterior. O DNA é constituído por vários nucleotídeos em sequência,
08
os quais são formados por um grupo fosfato, uma base
nitrogenada e uma pentose, a desoxirribose.

EXERCÍCIOS APROFUNDADOS
16 Uma sequência de DNA, denominada gene, pode ser
transcrita em moléculas de RNA pela enzima RNA
polimerase, processo denominado de transcrição.

48 (Unicid - Medicina 2016) Após a descoberta da


estrutura da molécula de DNA, surgiram três modelos
para explicar como ocorre sua duplicação. A figura
46 (Unisa - Medicina 2017) Analise a tabela, que contém ilustra três possíveis modelos de duplicação da
uma parte do código genético.
molécula de DNA.

Considere um segmento de DNA com a seguinte


sequência de bases nitrogenadas, em que a seta
indica o sentido da transcrição:
a Dos modelos apresentados, qual deles representa a
duplicação da molécula de DNA proposto por Watson e
a Suponha que um ribossomo traduziu o RNA mensageiro Crick? Justifique sua resposta.
sintetizado a partir desse segmento de DNA, quantos b Em que fase do ciclo celular mitótico ocorre a duplicação
aminoácidos são codificados por este ribossomo? Cite o da molécula de DNA? Por que a célula precisa realizar esse
nome do último aminoácido que fará parte da molécula processo?
transcrita.
b Caso ocorra uma mutação e a décima quinta base
nitrogenada seja substituída pela base timina (T), qual
será o anticódon do RNA transportador que se emparelha
com o códon codificado após a mutação? De acordo com
a propriedade do código genético, explique por que essa
mutação pode ser considerada silenciosa.

49 Ufu 2016) Observe a tabela a seguir.

www.biologiatotal.com.br 17
a O código genético define as regras químicas que os seres
vivos utilizam na tradução da informação dos seus genes.
Uma vez alterado o código genético, o resultado da
tradução também é modificado. Qual a importância de cada
códon? Qual o produto modificado resultante da tradução?
b Imagine que o produto da tradução do código genético foi
sintetizado no pâncreas e deve ser utilizado em outro lugar
do organismo. Uma vez que a biossíntese foi acompanhada
nas células com a marcação de isótopos radiativos
das unidades constituintes (monômeros) do referido
produto, qual a sequência de estruturas citoplasmáticas
você espera encontrar nas unidades marcadas,
Abreviatura dos aminoácidos: respectivamente?
Phe=fenilalanina; His=histidina; Leu=leucina; Gin=glutamina;
Ile=isoleucina; Asn=aspargina; Met=metionina; Lys=lisina;
Val=valina; Asp=ácido aspártico; Ser=serina; Glu=ácido glutâmico;
Pro=prolina; Cys=cisteína; Thr=treonina; Trp=triptofano;
Ala=alanina; Arg=arginina; Tyr=tirosina; Gly=glicina.

*A abreviatura Pare corresponde aos códons de parada.

Considere a seguinte sequência de bases nitrogenadas


do DNA:
TAG GCT AAT GCT CGT ATT
A partir das informações apresentadas, responda:
EXERCÍCIOS APROFUNDADOS

aQual será a sequência de bases nitrogenadas na duplicação


do DNA? 51 (Uerj 2015) Considere uma molécula de DNA sem
b A transcrição gênica formará quantos códons e quais são qualquer mutação e que apresente 16% de bases
eles? nitrogenadas de citosina.
c A tradução sintetizará quais aminoácidos? Determine os percentuais de guanina e de timina
encontrados nessa molécula, justificando suas
respostas.

50 (Usf 2016) Uma equipe de investigadores da


Universidade de Aveiro (UA) quebrou uma das
regras sagradas da biologia: o código genético não
é imutável. Estes investigadores descobriram que 52 (Unifesp 2015) Alguns antibióticos são particularmente
o fungo patogênico Candida albicans utiliza um usados em doenças causadas por bactérias. A
código genético diferente do dos outros seres vivos tetraciclina é um deles; sua ação impede que o RNA
e conseguiram compreender como é que este fungo transportador (RNAt) se ligue aos ribossomos da
o alterou e, agora, conseguiram realizar a primeira bactéria, evitando a progressão da doença.
alteração artificial em laboratório. a Que processo celular é interrompido pela ação da
A investigação dos doutorandos Ana Rita Bezerra e tetraciclina? Qual é o papel do (RNAt) nesse processo?
João Simões, sob coordenação de Manuel Santos, b Em que local, na bactéria, ocorre a síntese do (RNAt)? Cite
professor do Departamento de Biologia da UA e dois outros componentes bacterianos encontrados nesse
mesmo local.
investigador do Centro de Estudos do Ambiente e do
Mar (CESAM), decorreu ao longo dos últimos quatro
anos e foi agora publicada na «Proceedings of the
National Academy of Sciences» (PNAS).
Disponível em: <http://www.cienciahoje.pt/index.
php?oid=57972&op=a>
Acesso em: 02/10/2015, às 10h02min.

Com base no texto, responda ao que se pede.

18
53 (PUCRJ 2015) A sequência de DNA a seguir ocorre
no filamento codificante de um gene estrutural em
a Das partes assinaladas, quais são codificadoras, ou seja,
uma bactéria. quais contêm informações que vão fazer parte do transcrito
final e da proteína? Explique.
b Alguns indivíduos possuem uma mutação em “A”, o que
gera uma atividade enzimática reduzida. Entretanto, não
existem diferenças estruturais entre as enzimas codificadas
pelos genes com e sem esta mutação. Como tal fato pode
ser explicado?

a Qual é a sequência do RNA mensageiro, transcrita a partir


desse trecho de DNA?
b Qual é a sequência de aminoácidos do polipeptídeo
56 (Uepg 2014) As características morfológicas e
fisiológicas de um ser vivo dependem dos tipos

EXERCÍCIOS APROFUNDADOS
codificado por esse RNA mensageiro? (use a tabela do de proteínas do seu organismo. Ao comandar a
código genético)
c Se uma mutação ocorre no nucleotídeo T (indicado com
fabricação das proteínas, o ácido desoxirribonucleico
uma seta), substituindo-o por A, qual será a sequência (DNA) consegue regular a atividade das células. A
de aminoácidos depois da transcrição e tradução? (use a informação gênica do DNA é transcrita em ácido
tabela do código genético) ribonucleico (RNA) e posteriormente é traduzida
na proteína. Com relação a esses processos e
biomoléculas, assinale o que for correto.
01 O RNA é formado por uma única fita polinucleotídica. Nessa
fita, a pentose é sempre a ribose e as bases nitrogenadas
são a adenina, citosina, guanina e uracila.
02 No processo de duplicação semiconservativo do DNA,
a enzima DNA-ligase faz as ligações do tipo pontes de
hidrogênio para unir a duas fitas do DNA.
04 O RNA transportador ou de transferência (RNA-t) transporta
aminoácidos até o local da síntese da proteína.
08 O RNA ribossômico (RNA-r) carreia os códons (trinca de
bases) que serão decodificados em aminoácidos.
16 Em eucariotos, o RNA é fabricado no núcleo, tendo como
54 (Uem-pas 2014) Sabe-se que todos os seres vivos são molde um setor da molécula do DNA (gene), e migra para
formados por unidades básicas denominadas células. o citoplasma, onde desempenha sua função na síntese da
Em relação a essas unidades estruturais e funcionais proteína.
dos seres vivos, assinale o que for correto.
01 Na célula eucariótica, os cromossomos estão no interior
de um envoltório membranoso, composto por duas 57 (Unicamp 2014) A imagem abaixo representa o
membranas. processo de tradução.
02 Nas células, quando uma proteína vai ser sintetizada, uma
região do DNA do núcleo da célula é copiada por uma
enzima chamada RNA polimerase.
04 Núcleo, mitocôndrias e cloroplastos são as únicas organelas
celulares que possuem DNA.
08 A retirada do nucléolo de uma célula implicará a intensa
síntese de ribossomos.
16 Nas células, a água atravessa a membrana celular por
difusão facilitada, pois sua molécula é polar e as moléculas
de lipídios formam uma camada interna hidrofóbica.

55 (Pucrj 2014) A figura abaixo representa um gene


eucariótico de uma determinada enzima. “A” é a
região promotora do gene; “B” e “D” são éxons; e
“C” é um íntron.

www.biologiatotal.com.br 19
a Quais são as estruturas representadas pelas letras A e B, Com base nestas informações, responda:
respectivamente? a Como se denominam as etapas 01 e 02, respectivamente?
b Nos eucariotos, em quais estruturas celulares esse processo
ocorre? b Após uma imunização ativa, como ocorre a ação do
produto final desse processo?

61 (Uem 2016) Considerando a estrutura e a função


58 (Uem 2013) O núcleo é considerado portador dos do DNA e dos RNAs, e fazendo uso das estruturas I
fatores hereditários e controlador das atividades e II abaixo, assinale o que for correto.
metabólicas da célula animal. Sobre esse assunto,
assinale a(s) alternativa(s) correta(s).
01 Os nucléolos representam o material genético contido no
núcleo, sendo resultantes da associação entre proteínas e
moléculas de DNA.
02 Cromossomos homólogos são os dois representantes de
cada par cromossômico presente em células diploides,
provenientes originalmente do par de gametas.
04 Um trecho da molécula de DNA cromossômico que contém
EXERCÍCIOS APROFUNDADOS

informações para sintetizar a cadeia de aminoácidos de


uma proteína é definido como gene.
08 A principal função da carioteca é manter o conteúdo nuclear
separado do meio citoplasmático, impedindo o intercâmbio
de substâncias entre o núcleo e o citoplasma.
16 A análise do cariótipo de um feto revela a forma, o número
01 A estrutura I representa um ribonucleotídeo, enquanto a
e o tamanho dos cromossomos, possibilitando detectar estrutura II representa um nucleotídeo.
alterações cromossômicas antes do nascimento da criança.
02 A estrutura II possui ao todo quatro carbonos assimétricos,
enquanto a estrutura I possui cinco carbonos assimétricos.
04 A estrutura I possui um carbono primário, enquanto a
59 (Uepg 2013) Considerando os ácidos nucleicos,
estrutura II não possui nenhum carbono primário.
assinale o que for correto.
08 Em uma das extremidades de uma molécula de RNAt há
Tanto o DNA quanto o RNA são formados de sequências uma trinca de bases nitrogenadas, denominada anticódon,
01 de moléculas denominadas de nucleotídeos, os quais são
capaz de se emparelhar, por ligações de hidrogênio, ao
constituídos de uma pentose, uma base nitrogenada e um códon complementar do RNAm.
grupo fosfato.
16 As bases citosina (C) e guanina (G) interagem mutuamente
02
Existem 5 tipos principais de bases nitrogenadas: por meio de três ligações de hidrogênio, enquanto que as
adenina, timina, guanina, citosina e uracila. A uracila é bases timina (T) e adenina (A) interagem mutuamente por
exclusivamente encontrada na molécula de RNA. meio de duas ligações de hidrogênio na estrutura espiral
Durante a duplicação, novas fitas de DNA são formadas do DNA.
04
baseadas em um molde de DNA pré-existente, o qual é
descartado ao fim do processo.
08 Durante o processo denominado síntese proteica, ou
tradução, a informação presente no DNA é transferida ao QUESTÃO BAGA
RNA, no núcleo da célula.
16 Nos eucariotos, durante todo o processo de divisão Imagine uma proteína que funciona no RE, mas requer
celular, o DNA pode ser encontrado em sua forma mais modificação no complexo de Golgi antes de alcançar
descompactada.
essa função. Descreva a rota da proteína pela célula,
começando com a molécula de RNAm que especifica
(Ufg 2013) A figura a seguir esquematiza as duas a proteína.
60 etapas envolvidas no processo de síntese proteica em
um linfócito B.

20
GABARITO DJOW
SINTESE PROTEICA
45: a) Ao final do primeiro ciclo, cada bactéria terá uma cadeia 52: a) O processo interrompido pelo antibiótico é a tradução do
polinucleotídica normal e uma radiotiva. No segundo ciclo, duas RNAm, isto é, a síntese das proteínas bacterianas. O RNAt conduz
bactérias terão uma cadeia normal e uma radioativa e duas os aminoácidos ativados aos ribossomos.
apresentarão as duas cadeias marcadas com radioatividade. b) O RNAt é transcrito a partir do DNA disperso no citosol da
Ao término do terceiro ciclo ocorrem duas bactérias com as bactéria. No citosol bacteriano encontram-se ribossomos e
duas cadeias normais e seis bactérias com uma cadeia sem plamídeos.
radioatividade e uma cadeia radioativa.
b) O resultado do experimento é explicado pelo fato de a 53: a)
replicação do DNA ser semiconservativa. 5’-GAAUGUCAGAACUGCCAUGCUUCAUAUGAAUAGACCU
CUAG-3’
46: a) São codificados seis aminoácidos, sendo cinco tipos b) AUG–UCA–GAA–CUG–CCA–UGC–UUC–AUA–UGA-AUAGA
diferentes. O último aminoácido será a histidina. CCUCUAG Met–Ser–Glu–Leu–Pro–Cys–Phe–Ile–Término
b) O anticódon será GCU. A mutação pode ser considerada c) AUG–UCA–GAA–CUG–CCA–UGC–UUC–AUA–AGA-AUA-
silenciosa porque codifica para o mesmo aminoácido. GAC-CUC-UAG Met–Ser–Glu–Leu–Pro–Cys–Phe–Ile–Arg-Ile-
Asp-Leu-Término
47: 02 + 08 + 16 = 26.
[01] Falso. Dependendo da base nitrogenada e o códon podem 54: 01 + 02 + 04 = 07.
ocorrer mudanças na estrutura da proteína. [08] Falso. O nucléolo é o local onde ocorre a biossíntese dos
[02] Verdadeiro. A replicação do DNA é catalisada por enzimas ribossomos.

EXERCÍCIOS APROFUNDADOS
polimerases, onde cada uma das fitas serve de molde para a [16] Falso. Nas células, o transporte de água pela membrana
síntese da fita complementar. plasmática ocorre por osmose, sem a participação de proteínas
[04] Falso. O DNA é formado por duas fitas, constituídas por facilitadoras.
nucleotídeos, enroladas em forma de hélice.
[08] Verdadeiro. O DNA é formado por sequências de nucleotídeos 55: a) “B” e “D”. Somente os éxons contém informação do
e estes são formados por uma pentose (desoxirribose), uma base transcrito final e da proteína. A região promotora é reconhecida
nitrogenada e um grupo fosfato. pela RNA polimerase para o início da transcrição. Os íntrons são
[16] Verdadeiro. A transcrição ocorre a partir de uma parte do inicialmente transcritos, mas depois retirados no processo de
DNA, formando RNAs, a partir da enzima RNA polimerase. splicing e não fazem parte do transcrito final ou da proteína.
b) A mutação ocorrida em “A” não gera alteração na estrutura
48: a) O modelo C representa a duplicação da molécula de da proteína. Entretanto, a atividade enzimática é reduzida
DNA proposta por Watson e Crick, indicando que cada uma das porque a ligação entre a RNA polimerase e a região promotora
moléculas de DNA serve como molde para a formação de uma é mais fraca, o que leva a uma diminuição na expressão gênica.
nova cadeia, chamada de replicação semiconservativa.
b) A duplicação da molécula de DNA ocorre na Intérfase, no 56: 01 + 04 + 16 = 21.
intervalo chamada S (Síntese), processo que antecede a mitose [02] Falso. No processo de duplicação semiconservativo do DNA,
propriamente dita. A célula precisa replicar o DNA para a divisão a enzima DNA-ligase faz as ligações entre os segmentos de DNA
e produção de uma nova célula. na fita com duplicação descontínua.
[08] Falso. O RNA mensageiro (RNA-m) carreia os códons (trinca
de bases) que serão decodificados em aminoácidos.
49: a) Cadeia complementar do DNA:
ATC CGA TTA CGA GCA TAA. 57: a) RNA mensageiro (A) e RNA transportador (B).
b) A transcrição produzirá um segmento de RNA mensageiro b) A síntese dos polipeptídeos ocorre nos ribossomos livres
com 6 códons. A saber: do citosol e naqueles aderidos às membranas do retículo
AUC CGA UUA CGA GCA UAA. endoplasmático.
c) A tradução produzirá um peptídeo com os seguintes
aminoácidos: isoleucina – arginina – leucina – arginina – alanina.
58: 02 + 04 + 16 = 22.
[01] Incorreto: Os nucléolos são estruturas intracelulares
50: a) Cada códon é formado por três bases nitrogenadas (parte formadas pela associação de moléculas de DNA, proteínas e
dos nucleotídeos) que codificarão aminoácidos, constituindo RNA ribossômico.
uma mensagem em código, conhecida como código genético. O [08] Incorreto: O envoltório nuclear (carioteca) é formado
produto resultante da tradução é a proteína. por uma membrana dupla e porosa que regula o intercâmbio
b) Ribossomos, Retículo endoplasmático granular e Complexo de substâncias entre o citoplasma e o núcleo das células
golgiense, sendo este o caminho da síntese de proteínas no eucarióticas.
citoplasma.
59: 01 + 02 = 03.
51: Devido ao pareamento obrigatório das bases nitrogenadas [04] Incorreto: Durante a duplicação do DNA, as moléculas-filhas
do DNA, a quantidade de citosina é igual à de guanina e a conservam a metade da molécula-mãe.
quantidade de adenina é igual à quantidade de timina. Dessa [08] Incorreto: Durante o processo de tradução, os códons
forma, temos: 16% de C e 16% de G, somando 32% das bases do RNAmensageiro são traduzidos em sequência específica dos
do DNA. O restante, 68%, é dividido igualmente entre A e T. aminoácidos que formam as proteínas.
Logo, temos: 34% de A e 34% de T. [16] Incorreto: Nos eucariotos, durante o processo de divisão
celular, o DNA cromossômico sofre especialização durante a
prófase.

www.biologiatotal.com.br 21
60: a) Etapa 01: transcrição; etapa 02: tradução. [04] Incorreta. Carbono primário: átomo de carbono ligado a um
b) A imunização ativa estimula os linfócitos B à produção de único átomo de carbono ou a nenhum outro átomo de carbono.
anticorpos (produto final), moléculas proteicas capazes de se A estrutura I possui seis carbonos primários, enquanto a
ligarem ao antígeno, inativando-o e tornando-o mais fácil de ser estrutura II não possui cinco.
fagocitado por macrófagos, neutrófilos e eosinófilos (células de
defesa).

61: 08 + 16 = 24.
[Resposta do ponto de vista da disciplina de Biologia]
[01] Incorreta. A estrutura I é um desoxirribonucleotídeo do
DNA, porque contém a base nitrogenada timina.

[Resposta do ponto de vista da disciplina de Química]


[02] Incorreta. A estrutura II possui ao todo três carbonos
assimétricos, enquanto a estrutura I possui quatro carbonos
assimétricos.

QUESTÃO BAGA
O RNAm é sintetizado no núcleo e então passa para
fora através do poro nuclear para ser traduzido em um
ribossomo ligado ao RE rugoso. A proteína é sintetizada
EXERCÍCIOS APROFUNDADOS

no lúmen do RE e talvez modificada lá. Uma vesícula de


transporte carrega a proteína para o complexo de Golgi.
Após modificações adicionais no Golgi, outra vesícula de
transporte a carrega de volta para o RE, onde realizará seu
papel na célula.

ANOTAÇÕES

22
contato@biologiatotal.com.br
/biologiajubilut contato@biologiatotal.com.br
Biologia Total com Prof./biologiajubilut
Jubilut
@paulojubilut Biologia Total com Prof. Jubilut
@Prof_jubilut @paulojubilut
biologiajubilut @Prof_jubilut
biologiajubilut
+biologiatotalbrjubilut
CITOGENÉTICA

PAULO JUBILUT
2018
SUMÁRIO
CITOGENÉTICA 03
Núcleo 03
Ciclo Celular 16
Mitose 16
Meiose 30
Anomalias Cromossômicas 44
Síntese Proteica 55
NÚCLEO
O núcleo é o centro de controle das atividades
NÚCLEO INTERFÁSICO
celulares; local em que o DNA mantém sua
atividade genética, sintetizando RNAs que serão O núcleo interfásico recebe esta denominação
mais tarde traduzidos em proteínas para manter porque só pode ser observado durante a
as atividades celulares e do organismo. É também interfase - período do ciclo celular em que
responsável pelas características hereditárias a célula aumenta o seu volume, tamanho e
dor organismos. Sua descoberta é atribuída ao número de organelas.
escocês Robert Brown (1773 - 1858), que batizou a
O núcleo interfásico é chamado também
organela numa analogia aos frutos - “núcleo” vem
de “núcleo em repouso”, embora
do grego nux, que significa “semente”.
inapropriadamente – pois nesse período há
O núcleo é uma estrutura – de forma geralmente intensa atividade metabólica, com síntese de
esférica ou ovoide – presente nas células DNA, RNA e proteínas, para que em seguida a
eucariontes que contém o material genético (DNA) célula possa dividir-se.
envolto por uma dupla camada lipoproteica –

CITOGENÉTICA
a envoltório nuclear. Nas células procariontes,
o material genético encontra-se disperso no CARACTERÍSTICAS GERAIS
citoplasma e não está delimitado pela envoltório
nuclear, podendo estar mais concentrado em uma Na maioria das células, o núcleo é único,
determinada região, que é chamada de nucleoide. esférico e tem posição central. Todavia, existem
Portanto, o estudo do núcleo só pode ser feito a células anucleadas (os glóbulos vermelhos
partir de uma célula eucarionte. dos mamíferos), binucleadas (células do
fígado) e multinucleadas (células musculares e
O núcleo pode ser estudado em dois momentos osteoclastos).
da vida da célula: durante a divisão celular,
quando sofre várias modificações e durante A envoltório nuclear (membrana nuclear)
o período entre duas divisões sucessivas – a só é visível ao microscópio eletrônico e está
interfase. estruturada com duas camadas de membrana
sobrepostas. Possui poros grandes que permitem
trocas de macromoléculas, como proteínas,
Envelope Nuclear entre o núcleo e o citoplasma.
Membrana Externa
Membrana Interna
Cromatina No lado voltado para o citoplasma, a envoltório
Heterocromatina nuclear tem ribossomos aderidos, e apresenta
Eucromatina
uma continuidade com as membranas do
Poro Nuclear
retículo endoplasmático, o que sugere que
Nucleoplasma ambas sejam porções de um mesmo sistema
Nucléolo de membranas. Sua composição é lipoproteica.
Ribossomos A massa do núcleo é formada por água, DNA,
proteínas e RNA.
Estruturas interna e externa do núcleo celular

www.biologiatotal.com.br 3
O interior do núcleo é ocupado pela cariolinfa A posição ocupada pelo centrômero permite
(ou nucleoplasma), material gelatinoso, classificar os cromossomos em:
proteico, claro, semelhante ao hialoplasma, mas
com maior concentração de RNA e de proteínas. 1. metacêntricos: o centrômero fica no meio do
cromossomo;
O nucléolo é um corpúsculo denso, esférico,
formado principalmente por RNA. Habitualmente, 2. submetacêntricos: o centrômero é deslocado
há 1 nucléolo em cada núcleo, embora possa para uma das extremidades, e o cromossomo
haver 2 ou estar ausente. O nucléolo desaparece tem dois braços;
no início da divisão celular, voltando a aparecer
no seu final. 3. acrocêntricos: o centrômero se localiza bem
próximo de uma extremidade, e um braço é bem
Além desses componentes, é extremamente maior que o outro;
importante a cromatina, que é o conjunto de
filamentos cromossômicos (DNA). 4. telocêntricos: o centrômero está em uma das
extremidades.

CROMATINA
É formada por uma rede de filamentos de DNA
e por proteínas básicas chamadas histonas. É
o DNA do núcleo que contém as informações
CITOGENÉTICA

genéticas e controla o metabolismo celular.

Cada filamento descondensado (desespiralizado) Metacêntrico Submetacêntico Acrocêntrico Telocêntrico


na interfase é um cromonema. Durante a Tipos de cromossomos de acordo com a localização do centrômero

divisão, esses cromonemas sofrem condensação


e encurtamento, sendo vistos individualizados Em um dos braços, pode haver uma área de
cada um deles como um cromossomo. estreitamento, a constrição secundária. A
porção separada do corpo do cromossomo pela
constrição secundária é a zona SAT, também
chamada zona satélite ou região organizadora
CROMOSSOMOS do nucléolo.

Os cromossomos são filamentos de cromatina Célula


que se condensam durante a divisão celular,
Núcleo
variando em número, forma e posição de
Cromossomo
centrômero nas diferentes espécies.

Durante a espiralização da cromatina, as


regiões de heterocromatina condensam-se mais
que as de eucromatina, originando regiões
de estreitamento nos cromossomos. São as
constrições. Todos os cromossomos têm pelo
menos uma constrição, chamada centrômero Gene
(cinetócoro ou constrição primária).

Esquema da localização do gene dentro do cromossomo

4
Cada segmento de cromossomo capaz de denominamos o número cromossômico como
determinar a produção de uma proteína e é diploide ou 2n, pois há dois lotes idênticos
chamado de gene. O cromossomo pode ser (dois cromossomos de cada par). Nos gametas,
então definido como “uma sequência linear de encontra-se apenas um lote n de cromossomos,
genes”. chamado haploide.

Os cromossomos geralmente ocorrem aos pares, O número cromossômico é constante para


chamados cromossomos homólogos. São iguais espécie: em seres humanos, existem 23 pares
quanto ao tamanho, à forma, à posição do de cromossomos numa célula somática; em
centrômero e aos genes que transportam. moscas, existem apenas 4 pares; em patos, por
exemplo existem 40 pares.
Uma célula somática (muscular, por exemplo),
que contém cromossomos aos pares, Veja na tabela abaixo outros exemplos.

CITOGENÉTICA
Na maioria das espécies, há um par de de acordo com o tipo e em ordem decrescente
cromossomos, cujos componentes são diferentes de tamanho. A essa montagem dá-se o nome de
no macho e na fêmea. São os cromossomos idiograma.
sexuais. Na espécie humana, a mulher possui
um par idêntico (XX) enquanto o homem possui
um par formado por cromossomos diferentes
(XY). Os demais cromossomos, iguais para o
macho e a fêmea, são chamados autossomos.

O conjunto de características dos cromossomos


de uma espécie constitui o seu cariótipo (número
de cromossomos, tamanho e classificação). Uma
vez fotografados ao microscópio, podem ser
recortados, e os pares de homólogos agrupados

www.biologiatotal.com.br 5
LEITURA COMPLEMENTAR
Entenda a citogenética de javalis, javaporcos e porcos
Muita gente acha que todo híbrido é estéril, Um estudo realizado pela Universidade de
e não é! Um exemplo disso? O javaporco! O Tennessee, nos Estados Unidos, acompanhou
animal nasce com 37 cromossomos, é fértil, o cruzamento de javalis para verificar
e da sua prole podem vir filhos com 36 e 38 como nasceriam as proles. Curiosamente, o
cromossomos, número cromossômico do resultado entre o cruzamento de javaporcos
javali-europeu e dos porcos, respectivamente. híbridos gerou descendentes de 36, 37
Quer saber como diferenciar esses animais e e 38 cromossomos, número que seria
os híbridos? Vem com a gente! correspondente a javalis, javaporcos e
porcos. A surpresa é que TODOS os animais
Nativo da Europa, Ásia e norte da África,
resultantes são híbridos!
o javali-europeu (Sus s. scrofa), chegou
na América do Sul no início do século XX,
para ser utilizado na caça esportiva. No
Brasil, foi introduzido ainda na década de
60 para alavancar o consumo de carne no
sul do País. Apesar da aparência “fofa”
de um simpático porquinho, os javalis são
CITOGENÉTICA

animais agressivos que invadem lavouras,


e facilmente adaptam-se a quaisquer
ambientes. Isso é uma vantagem para o
animal, concordam? Sim. É pra ele, mas não
é pra gente! Um animal exótico com essas
características, sem predadores naturais,
que se reproduz com facilidade, torna-se
rapidamente uma ameaça aos ecossistemas
naturais e espécies nativas. E o problema
não para por aí... Criadores resolveram testar
o que aconteceria no cruzamento entre um
javali e um porco doméstico. O resultado?
Um animal chamado javaporco que vem
causando transtornos por todo o mundo!

Como assim, Jubilut?


Por mais que os animais tenham a aparência Pela aparência, você é capaz de
diferenciar cada um dos animais?
semelhante entre si, a genética não mente!
Vamos falar dos seus cromossomos, por Híbrido e fértil?
exemplo... Nós, humanos, possuímos 46
cromossomos. Javalis (o javali-europeu – Sus Talvez você não saiba, mas nem todo híbrido
s. scrofa – é considerado o cariótipo padrão é infértil como a mula (cruzamento entre
para este animal), possuem 36 e porcos um jumento e uma égua). Isso quer dizer
domésticos possuem 38 cromossomos. que sim, as fêmeas do javaporco são férteis!
Pensem comigo: um animal resultante do Nenhum animal híbrido é estéril devido ao
cruzamento desses 2 já citados, teria quantos número cromossômico ser ímpar ou par, ou
cromossomos? 36? 37? 38? Na biologia tudo a diferentes espécies terem sido cruzadas.
tem uma exceção, e aqui não é diferente....

6
A esterilidade está relacionada a não- Se tem 36, 37 e 38 cromossomos, os
formação de gametas, como consequência animais resultantes do cruzamento são
de uma meiose incorreta, devido a não haver de espécies diferentes?
homologia (semelhança genética) entre os
cromossomos. Existem várias situações em Sim! Para a análise dos suínos em questão,
que o conjunto cromossômico apresenta utilizar o cariótipo não fornece a informação
número ímpar, mas acontece a formação correta. O fato de um animal possuir 36 ou
de gametas, já que houve o pareamento 38 cromossomos, não garante que ele seja
de cromossomos. Confere o resultado do um javali-europeu ou um porco doméstico.
cruzamento apresentado no estudo: Por exemplo... Em um cruzamento de 2
híbridos, temos descentes com os 3 números
cromossômicos, e todos eles são híbridos!
Para avaliar “quem é o animal”, são
necessárias análises que utilizam marcadores
moleculares. Junto com o estudo do cariótipo,
a análise é capaz de fornecer a “identidade”
que buscamos.
Depois de tantas análises genéticas, o
que podemos concluir, Jubilut?
Como explicar isso? Não podemos julgar o livro pela capa (e nem
pelo cariótipo), afinal, o que vai determinar
No caso destes suínos, o que acontece quem é o animal, é a análise molecular dele,
é uma fusão cêntrica, ou translocação

CITOGENÉTICA
combinada com a análise cromossômica.
Robertsoniana, entre os cromossomos 15 Javalis e javaporcos são bastante parecidos,
e 17 dos suínos. Um javaporco híbrido, e a identificação por aspectos físicos apenas,
com 37 cromossomos, contém apenas um pode falhar. Fique de olho na genética se
cromossomo submetacêntrico (quando quiser garantir a identificação correta!
o centrômero está no centro), formado
pela fusão do 15 com o 17. Já o javali-
europeu, com 36 cromossomos, não possui
um par de cromossomos 17. Animais com
38 cromossomos, os porcos domésticos,
possuem um par de cromossomos 17.

Fontes: Brazilian Journal of Veterinary Research and Animal


A figura acima ilustra o cariótipo de 3 animais diferentes. Science, MOTA, L., JAVALIS E A TRANSLOCAÇÃO ROBERTSONIANA
Na figura A, um javali-europeu com 36 cromossomos; Na 15/17: É UMA AMEAÇA?, Pesquisa Agropecuária Brasileira, Revista
figura B, um porco doméstico, com 38 cromossomos; Na Científica Eletrônica De Medicina Veterinária, The Journal of the
figura C, um javaporco com 37 cromossomos Society for Reproduction and Fertility.

ANOTAÇÕES

www.biologiatotal.com.br 7
EXERCÍCIOS
CAIU NA UTFPR - 2017 CAIU NA UERJ 2017
O núcleo celular contém todas as informações sobre a Em células eucariotas, a cromatina pode se apresentar
função e a estrutura da célula. Analise as afirmativas a como eucromatina, uma forma não espiralada, ou
seguir sobre a estrutura do núcleo celular eucariótico. como heterocromatina, uma forma muito espiralada.
Na metáfase, muitas regiões de eucromatina se
I. O material genético do núcleo localiza-se em
transformam em heterocromatina, formando
estruturas chamadas cromossomos.
cromossomos bastante espiralados, conforme mostra
II. Os nucléolos são orgânulos delimitados por uma o esquema.
membrana e constituídos de DNA.
III. A carioteca ou membrana nuclear é dupla e porosa.
IV. O nucleoplasma ou suco nuclear é formado por
água, ribossomos e material genético.
Estão corretas apenas as afirmativas:
a I e II.
b II e III.
c III e IV. Considerando uma mitose típica, a formação do
d I e III. cromossomo bastante espiralado favorece o seguinte
e II e IV.
processo:
a transcrição dos genes pela RNA polimerase
b distribuição do DNA para células-filhas
EXERCÍCIOS

c síntese de proteínas nos ribossomos


d redução do cariótipo original

Fernando Giovana
Auxílio na formação de cílios e Associação ao RNAm para
flagelos. desempenhar sua função.
Carlos Rodrigo

1 (IFSP 2016) Cada pessoa tem um padrão de DNA Síntese de proteínas que serão Síntese de alguns glicídios
exportadas pela célula. e modificação de proteínas,
particular. Um filho herda 50% de suas moléculas preparando-as para secreção.
de DNA da mãe e 50% do pai. No núcleo de cada
Mayara Gustavo
célula somática (célula dos tecidos que constituem
o corpo) há 23 pares de cromossomos homólogos: Digestão de componentes Presença de equipamento
desgastados da própria célula. próprio para síntese de
23 desses cromossomos vieram do óvulo e os proteínas.
outros 23, do espermatozoide. A união do óvulo Lígia
com o espermatozoide deu origem ao zigoto. Esse Síntese de ácidos nucleicos.
zigoto originou o embrião e depois o feto. Como
cada cromossomo é formado por uma molécula de A professora também desenhou na quadra de esportes
DNA e de proteínas, há em cada célula somática da escola uma grande célula animal, com algumas de
__________ de DNA. suas organelas (fora de escala), conforme mostra a
figura.
Assinale a alternativa que completa corretamente o
espaço acima.
a 23 moléculas
b 92 moléculas
c 46 moléculas
d 69 moléculas
e 56 moléculas

2 (UNESP 2016) A professora distribuiu aos alunos


algumas fichas contendo, cada uma delas, uma
descrição de características de uma organela celular.
Ao lado, as fichas recebidas por sete alunos.

8
Ao comando da professora, os alunos deveriam correr No momento em que o DNA de uma célula somática
para a organela cuja característica estava escrita na humana for visualizado no nível “F” de condensação,
ficha em seu poder. está ocorrendo o processo de
a síntese de proteínas.
Carlos e Mayara correram para a organela indicada
b multiplicação celular.
pela seta 7; Fernando e Rodrigo correram para a
c permutação cromossômica.
organela indicada pela seta 5; Giovana e Gustavo
d produção de ácido ribonucleico.
correram para a organela indicada pela seta 4; Lígia
e duplicação do material genético.
correu para a organela indicada pela seta 6.
Os alunos que ocuparam o lugar correto na célula
5 (IFCE 2014) O núcleo celular é o local que abriga o
desenhada foram
material genético nas células eucariontes. No núcleo
a Mayara, Gustavo e Lígia.
interfásico, fase em que a célula não se encontra em
b Rodrigo, Mayara e Giovana.
divisão, a cromatina aparece imersa na cariolinfa,
c Gustavo, Rodrigo e Fernando.
como um emaranhado de filamentos longos e
d Carlos, Giovana e Mayara.
finos. Ao iniciar o processo de divisão celular, esses
e Fernando, Carlos e Lígia.
filamentos começam a se condensar em espiral,
tornando-se mais curtos e grossos, passando a ser
3 (UFPR 2015) Um pesquisador injetou uma pequena chamados de
quantidade de timidina radioativa (3H-timidina) em
células com o propósito de determinar a localização a cromonema.
dos ácidos nucleicos sintetizados a partir desse b cromossomo.
c carioteca.
nucleotídeo, utilizando uma técnica muito empregada
d DNA.
em biologia celular, a autorradiografia combinada
com microscopia eletrônica. e genes.

Assinale a alternativa que apresenta os dois 6 (UNIFESP 2008) Analise a figura


compartimentos celulares nos quais o pesquisador

EXERCÍCIOS
encontrará ácidos nucleicos radioativos.
a Núcleo e mitocôndrias.
b Citosol e mitocôndrias.
c Núcleo e retículo endoplasmático.
d Citosol e retículo endoplasmático.
e Peroxissomos e retículo endoplasmático.

O DNA apresenta diferentes níveis de


(CEFET MG 2014) A figura representa um cromossomo em metáfase
4 mitótica. Portanto, os números I e II correspondem a:
condensação, conforme representado na figura.
a cromossomos emparelhados na meiose, cada um com
uma molécula diferente de DNA.
b cromátides não-irmãs, cada uma com uma molécula
idêntica de DNA.
c cromátides-irmãs, cada uma com duas moléculas
diferentes de DNA.
d cromátides-irmãs, com duas moléculas idênticas de
DNA.
e cromossomos duplicados, com duas moléculas
diferentes de DNA.

7 (PUCSP 2008) Encontra-se a seguir esquematizado o


cromossomo 21 humano. O desenho foi feito com
base na observação ao microscópio de um linfócito
(glóbulo branco) em divisão. A partir da análise do
desenho, assinale a alternativa INCORRETA.

www.biologiatotal.com.br 9
a O cromossomo encontra-se duplicado e bem
condensado.
b Ele pode ser observado durante a metáfase da divisão
celular.
c As cromátides, indicadas por A e A’, são constituídas
por moléculas de DNA diferentes.
d O centrômero localiza-se próximo a uma das
extremidades desse cromossomo e este apresenta um (FATEC 2014) Mapas conceituais são diagramas que
de seus braços bem maior que o outro. 11
organizam informações sobre um determinado
e Atrissomia desse cromossomo é responsável pela
síndrome de Down. assunto por meio da interligação de conceitos através
de frases de ligação.
(CFTMG 2004) Analise o quadro a seguir Os conceitos geralmente são destacados por
8 molduras e são utilizadas setas para indicar o sentido
das proposições.
O mapa conceitual a seguir refere-se à relação entre
cromossomos e proteínas, e nele quatro conceitos
foram omitidos.

Após a análise, é correto afirmar que


uma célula em mitose no organismo I originará 04
a
células com 23 cromossomos.
b os gametas do organismo II apresentam 78 Os conceitos I, II, III e IV podem ser substituídos,
cromossomos. correta e respectivamente, por
c uma célula do parênquima clorofiliano de III apresenta a RNA, DNA, aminoácidos e nucleotídeos.
EXERCÍCIOS

22 cromossomos.
b RNA, DNA, nucleotídeos e aminoácidos.
d as células companheiras dos vasos liberianos de IV c
possuem 11 cromossomos. DNA, RNA, nucleotídeos e aminoácidos.
d DNA, RNA, monossacarídeos e aminoácidos.
9 (FUVEST 2005) Quando afirmamos que o metabolismo e DNA, RNA, monossacarídeos e nucleotídeos.
da célula é controlado pelo núcleo celular, isso
significa que 12 (UFPI 2009) A grande parte do DNA em células
a todas as reações metabólicas são catalisadas por
eucarióticas está compactada em __1__, formados
moléculas e componentes nucleares. imediatamente após a __2__, que é composta por
b o núcleo produz moléculas que, no citoplasma,
um núcleo com oito proteínas __3__, com DNA
promovem a síntese de enzimas catalisadoras das enrolado em torno deste núcleo, formando um fio
reações metabólicas. cromossômico helicoidal chamado __4__.
c o núcleo produz e envia, para todas as partes da célula,
moléculas que catalisam as reações metabólicas. Marque a alternativa que completa corretamente o
d dentro do núcleo, moléculas sintetizam enzimas trecho anterior.
catalisadoras das reações metabólicas. a 1-microssomos; 2-transcrição; 3-não histônicas;
e o conteúdo do núcleo passa para o citoplasma e atua 4-nucleoide.
diretamente nas funções celulares, catalisando as
b 1-microssomos; 2-replicação; 3-histônicas; 4-fio de
reações metabólicas.
cromossomo extranuclear.
c 1-nucleossomos; 2-replicação; 3-histônicas;
10 CFTMG 2005) O núcleo de uma célula é formado
4-solenoide.
por cromossomos de diversas formas e tamanhos, d 1-microssomos; 2-tradução; 3-endonucleases;
podendo, às vezes, apresentar um ou mais 4-mesossomo.
cromossomos de cada tipo. A ploidia de um ser vivo e 1-nucleossomos; 2-transcrição; 3-não histônicas; 4-fio
cuja célula é 2n = 2 está representada em: de cromossomo plasmidial.

a b 13 (CFTCE 2007) Em relação ao núcleo das células e seus


constituintes, é CORRETO afirmar que:
a no núcleo eucariótico, o conjunto haploide de
cromossomos é denominado cariótipo, enquanto o
número, a forma e o tamanho dos cromossomos são
denominados de genoma
c d b o núcleo interfásico de células vegetais apresenta uma
carioteca, cuja estrutura não permite a comunicação
com o citoplasma
c o nucléolo é uma estrutura intranuclear

10
d em células procariontes, existem proteínas seja por atuarem como traçadores radioativos, ou como
responsáveis pela condensação das fitas de DNA, fontes de radiações.
denominadas histonas
e a cromatina é uma estrutura presente, tanto no Uma plântula de ‘Vicia faba’ foi colocada para crescer
citoplasma, como no núcleo de células eucarióticas em meio de cultura onde a única fonte de timidina
(nucleotídeo com a base timina) era radioativa. Após um
14 (PUCMG 2007) O envelope nuclear encerra o DNA e
único ciclo de divisão celular foram feitas preparações
define o compartimento nuclear.
citológicas de células da ponta da raiz, para a análise
Assinale a afirmativa INCORRETA sobre o envelope da radioatividade incorporada (auto-radiografia). A
nuclear. radioatividade será observada em
a É formado por duas membranas concêntricas e a ambas as cromátides dos cromossomos metafásicos.
contínuas, com composições protéicas diferentes, todas as proteínas da célula.
b
perfuradas por grandes aberturas denominadas poros
nucleares. c todas as organelas da célula.
b O surgimento da membrana nuclear determinou a d somente uma das cromátides de cada cromossomo
separação dos processos de transcrição e tradução. metafásico.
c Os fosfolípides das membranas nucleares externa e e todos os ácidos nucléicos da célula.
interna são produzidas no retículo endoplasmático
liso.
d Os poros nucleares permitem o livre trânsito de (ENEM 2015) Um importante princípio da biologia,
moléculas entre o núcleo e o citoplasma, sem 18 relacionado à transmissão de caracteres e à
necessidade de seleção.
embriogênese humana, foi quebrado com a descoberta
(PUCMG 2005)
15 do microquimerismo fetal. Microquimerismo é o nome
dado ao fenômeno biológico referente a uma pequena
população de células ou DNA presente em um indivíduo,
mas derivada de um organismo geneticamente distinto.
Investigando-se a presença do cromossomo Y, foi
revelado que diversos tecidos de mulheres continham

EXERCÍCIOS
Analise a figura anterior e assinale a alternativa células masculinas. A análise do histórico médico revelou
INCORRETA. uma correlação extremamente curiosa: apenas as
A estrutura representada apresenta dupla membrana
mulheres que antes tiveram filhos homens apresentaram
a
com poros que permitem a passagem de algumas microquimerismo masculino. Essa correlação levou
moléculas. à interpretação de que existe uma troca natural entre
b A cromatina é constituída por moléculas de DNA células do feto e maternas durante a gravidez.
enroladas em torno de histonas e pode apresentar-se
em níveis variados de condensação. MUOTRI, A. Você não é só você: carregamos células maternas na
maioria de nossos órgãos. Disponível em: http://g1.globo.com. Acesso
c Durante a divisão celular, a cromatina se desenrola das em: 4 dez. 2012 (adaptado).
histonas para que possa ocorrer a duplicação do DNA.
O princípio contestado com essa descoberta, relacionado
d Cromatina e cromossomos são encontrados em
fases diferentes, na interfase e na divisão celular, ao desenvolvimento do corpo humano, é o de que
respectivamente. o fenótipo das nossas células pode mudar por
a
influência do meio ambiente.
b a dominância genética determina a expressão de
(PUCSP 2004) Um cientista, examinando ao microscópio alguns genes.
16
células somáticas de um organismo diploide 2n = 14, c as mutações genéticas introduzem variabilidade no
observa nos núcleos que se encontram na fase G1 da genoma.
d
intérfase um emaranhado de fios, a cromatina. Se fosse mitocôndrias e o seu DNA provêm do gameta materno.
e as nossas células corporais provêm de um único
possível desemaranhar os fios de um desses núcleos, o
zigoto.
cientista encontraria quantas moléculas de DNA?
a 14
b 7
c (UNICAMP 2011)Em relação a um organismo diploide,
1 19
d 28 que apresenta 24 cromossomos em cada célula
e 2 somática, pode-se afirmar que
aseu código genético é composto por 24 moléculas de
DNA de fita simples.
(PUCCAMP 2004) Os radioisótopos, apesar de temidos pela b o gameta originado desse organismo apresenta 12
17 população que os associa a acidentes nucleares e danos moléculas de DNA de fita simples em seu genoma
haploide.
ambientais, exercem importante papel na sociedade c uma célula desse organismo na fase G2 da interfase
atual. São hoje praticamente indispensáveis à medicina, apresenta 48 moléculas de DNA de fita dupla.
engenharia, indústria, hidrologia, antropologia e à d seu cariótipo é composto por 24 pares de cromossomos.
pesquisa acadêmica em diversas áreas do conhecimento,

www.biologiatotal.com.br 11
22 (CFTMG 2008) Com relação às várias estruturas
presentes no núcleo das células eucariotas, afirma-se:
I - O nucléolo é constituído, principalmente, de ácido
desoxirribonucléico (DNA).
II - A carioteca apresenta duas membranas
lipoproteicas.
III - Na fase G1 são produzidos RNA e proteínas.
2015) Assinale com V (verdadeiro) ou F (falso) IV - A cromatina e os cromossomos ocorrem,
20 (UFRGS
as afirmações abaixo, referentes aos constituintes do simultaneamente, na fase G1 da intérfase.
núcleo celular.
São corretas apenas as afirmativas
( ) A carioteca é uma membrana lipoproteica dupla
presente durante as mitoses. a I e III.
b I e IV.
( ) Os nucléolos, corpúsculos ricos em RNA ribossômico,
c II e III.
são observados na interfase.
d II e IV.
( ) Os cromossomas condensados na fase inicial da
mitose são constituídos por duas cromátides.
( ) Cromossomas homólogos são os que apresentam 23 (UEM 2013) O núcleo é considerado portador dos
seus genes com alelos idênticos. fatores hereditários e controlador das atividades
metabólicas da célula animal. Sobre esse assunto,
A sequência correta de preenchimento dos parênteses,
assinale a(s) alternativa(s) correta(s).
de cima para baixo, é
a 01 Os nucléolos representam o material genético contido
V - V - F - V. no núcleo, sendo resultantes da associação entre
b V - F - V - F. proteínas e moléculas de DNA.
c F - V - V - F. Cromossomos homólogos são os dois representantes
02
d F - F - V - V. de cada par cromossômico presente em células
e V - F - F - V. diploides, provenientes originalmente do par de
EXERCÍCIOS

gametas.
04 Um trecho da molécula de DNA cromossômico que
21 (IBMECRJ 2013) O núcleo celular foi descoberto pelo contém informações para sintetizar a cadeia de
pesquisador escocês Robert Brown, que o reconheceu aminoácidos de uma proteína é definido como gene.
como componente fundamental das células. O nome 08 A principal função da carioteca é manter o conteúdo
escolhido para essa organela expressa bem essa nuclear separado do meio citoplasmático, impedindo
o intercâmbio de substâncias entre o núcleo e o
ideia: a palavra “núcleo”, de acordo com o dicionário citoplasma.
brasileiro, significa centro ou parte central. A respeito A análise do cariótipo de um feto revela a forma, o
16
da constituição e função do núcleo celular, julgue as número e o tamanho dos cromossomos, possibilitando
afirmativas, como FALSAS ou VERDADEIRAS: detectar alterações cromossômicas antes do
nascimento da criança.
I. O núcleo só é encontrado em células eucariontes,
portanto as bactérias não apresentam essa organela. 24 (PUCMG 2015) O bom funcionamento de uma célula
eucariota depende da compartimentalização
I. Existem células eucariontes com um único
de processos específicos em organelas como as
núcleo, células com vários núcleos e outras células
indicadas por números na figura a seguir. A organela
anucleadas.
2 é derivada da organela 3.
III. O núcleo abriga o código genético das células, uma
vez que dentro dele se encontram os cromossomos
que contém a informação genética.
IV. A carioteca é o envoltório nuclear, que impede a
troca de qualquer tipo de material entre o núcleo e o
restante da célula.
a V–V–F–F
b F–F–F–V
c V–F–V–F
d V–V–V–F
e V–F–V–V

12
A relação entre a estrutura numerada e sua função Assinale a alternativa CORRETA.
celular está INCORRETA em: a Células são as unidades estruturais (morfológicas)
a 1 → Usina de força que utiliza energia existente e funcionais (fisiológicas) dos organismos vivos e
sob determinada forma e a converte em outra mais representam a menor porção de matéria viva dotada
facilmente utilizada pela célula. da capacidade de autoduplicação independente. Todas
as células do corpo humano possuem membrana
b 2 → Vesícula que pode conter proteínas que podem plasmática, citoplasma e núcleo.
estar envolvidas na digestão intracelular ou são
destinadas ao meio extracelular. b A pinocitose é o processo utilizado pela célula para
englobar partículas sólidas, que lhe irão servir de
c 3 → Local onde proteínas sintetizadas podem ser alimento.
modificadas, selecionadas, empacotadas e enviadas
para suas destinações celulares ou extracelulares. c A fagocitose é um processo pelo qual certas células
ingerem líquidos ou pequenas partículas através de
d 4 → Local onde ocorre a replicação do material minúsculos canais que se formam em sua membrana
genético e a decodificação da informação genética. plasmática.
d Na maioria das células os cromossomos encontram-
se em pares. As células diplóides apresentam 46
(IFSC 2015) Célula: a menor unidade viva cromossomos. Há também as células haploides
25 (23 cromossomos), estas, possuem apenas metade
Um dia você já foi um ovo. Não como um ovo de uma do número de cromossomos e normalmente são
ave, mas uma única célula chamada célula-ovo ou encontradas nas células germinativas masculina e
zigoto. Essa célula se multiplicou e originou trilhões feminina.
de outros tipos diferentes de células que formam o e Existem as células eucariontes e as procariontes.
Estas últimas possuem carioteca (membrana nuclear):
seu corpo. Essa célula se originou após a união de as plantas, animais e os fungos. As eucariontes não
um espermatozoide do seu pai e um óvulo da sua possuem membrana nuclear: as algas azuis e as
mãe. Com essa união você recebeu metade das bactérias.
características do seu pai e metade das de sua mãe.
FONTE: Carvalho, W; Guimarães, M; Ciências para nosso tempo.
1ªed. Curitiba: Positivo, 2011.

EXERCÍCIOS
ANOTAÇÕES

www.biologiatotal.com.br 13
GABARITO DJOW
CAIU NA UTFPR - 2017
[D]
[I] Correta: os cromossomos são formados por material genético, sendo DNA mais proteínas.
[II] Incorreta: os nucléolos não são delimitados por membrana e formados por RNA, proteínas e sequências de DNA.
[III] Correta: a carioteca é formada por dupla camada, contendo vários poros.
[IV] Incorreta: o nucleoplasma é constituído basicamente por água e proteínas.

CAIU NA UERJ - 2017


[B]

NÚCLEO
1 - [C] em moléculas de RNA (II). O DNA e o RNA são macromoléculas
formadas pelo encadeamento de nucleotídeos (III), enquanto as
As células somáticas humanas com cariótipo normal contêm, no proteínas são formadas por diferentes sequências de unidades
núcleo, 46 cromossomos e, portanto, 46 moléculas de DNA. estruturais denominadas aminoácidos (IV).
RESPOSTA COMENTADA http://bit.ly/2FYXchm RESPOSTA COMENTADA http://bit.ly/2FUibBO
2- [A] 12- [C]
Mayara acertou, pois correu em direção ao lisossomo, organela O DNA nuclear observado em células eucarióticas encontra-se
responsável pela digestão intracelular. Gustavo acerta, porque associado à proteínas, formando octâmeros (8 histonas), com
CITOGENÉTICA

as mitocôndrias contêm ribossomos e sintetizam proteínas. Lígia filamentos duplos de DNA enrolados ao redor das proteínas,
também acertou, pois foi ao núcleo, local onde se localiza o formando um conjunto de nucleossomos.
material genético formado pelo DNA, um tipo de ácido nucleico. RESPOSTA COMENTADA http://bit.ly/2D0A5Qo
RESPOSTA COMENTADA http://bit.ly/2D1KOtI
13- [C]
3 - [A] RESPOSTA COMENTADA http://bit.ly/2CXSoW9
A timidina radioativa (3H-timidina) será incorporada ao DNA
nuclear e mitocontrial. 14 - [D]
RESPOSTA COMENTADA http://bit.ly/2FTKAI4 RESPOSTA COMENTADA http://bit.ly/2FTzWBh

4- [B] 15 - [C]
Durante o processo de multiplicação celular o material genético RESPOSTA COMENTADA http://bit.ly/2q0yzbM
(DNA) encontra-se duplicado e condensado.
16 - [A]
RESPOSTA COMENTADA http://bit.ly/2FXKfo4
RESPOSTA COMENTADA http://bit.ly/2q0nmYD
5 - [B]
17 - [A]
Os cromossomos observados durante o processo de divisão
celular correspondem aos filamentos da cromatina duplicados RESPOSTA COMENTADA http://bit.ly/2q0kLxM
e espiralizados. 18- [E]
RESPOSTA COMENTADA http://bit.ly/2FVmNaF
O texto cita a correlação entre mulheres que já tiveram filhos
6 - [D] do sexo masculino e a presença de células portadoras do
RESPOSTA COMENTADA http://bit.ly/2D0wim9 cromossomo Y em seus tecidos. Tal fato contesta o dogma de
que todas as células de um indivíduo são provenientes do zigoto.
7- [C] RESPOSTA COMENTADA http://bit.ly/2q0lJKo
RESPOSTA COMENTADA http://bit.ly/2FSRnSl 19 - [C]
8- [C] No período G2 da interfase os 24 cromossomos acham-se
RESPOSTA COMENTADA http://bit.ly/2D2Hw9t duplicados. Cada um é formado por duas cromátides irmãs,
unidas pelo centrômero. Cada cromátide é constituída por
9 - [B] uma molécula de DNA de cadeia dupla. Dessa forma, em G2,
RESPOSTA COMENTADA http://bit.ly/2FWj4dg observam-se 48 moléculas de DNA, cada uma formada por uma
dupla hélice.
10 - [B] RESPOSTA COMENTADA http://bit.ly/2q0gWJ3
RESPOSTA COMENTADA http://bit.ly/2Fjkr4E 20- [C]
11 - [C] A carioteca é constituída por membrana lipoproteica dupla
presente durante o período interfásico.
Os cromossomos são compostos por DNA (I) e proteínas
histônicas. Os genes são segmentos do DNA que serão transcritos RESPOSTA COMENTADA http://bit.ly/2q0kLhh

14
21- [D] 24- [D]
O núcleo celular é uma estrutura que apresenta poros por onde A decodificação da informação genética contida no DNA
passam enzimas produzidas no citoplasma e permite a passagem nuclear é realizada a partir da tradução das moléculas de RNA
de substâncias produzidas no núcleo para o citoplasma, mensageiro nos ribossomos livres no citosol, nos ribossomos
por exemplo, moléculas de RNA. Portanto, há passagem de aderidos ao retículo endoplasmático granuloso e em ribossomos
substâncias entre o citoplasma e o núcleo. situados no interior de organelas, tais como mitocôndrias e
plastídios.
RESPOSTA COMENTADA http://bit.ly/2q0hhLM
22- [C]
RESPOSTA COMENTADA http://bit.ly/2q0lW0a
25- [D]
Em humanos, as células somáticas, geralmente, apresentam 46
23- 02 + 04 + 16 = 22. cromossomos. As haploides, denominadas gametas, possuem 23
[01] Incorreto: Os nucléolos são estruturas intracelulares formadas cromossomos.
pela associação de moléculas de DNA, proteínas e RNA ribossômico. RESPOSTA COMENTADA http://bit.ly/2q13nsN
[08] Incorreto: O envoltório nuclear (carioteca) é formado
por uma membrana dupla e porosa que regula o intercâmbio
de substâncias entre o citoplasma e o núcleo das células
eucarióticas.

ANOTAÇÕES

CITOGENÉTICA

www.biologiatotal.com.br 15
CITOGENÉTICA

2018
EXERCÍCIOS APROFUNDADOS

PAULO JUBILUT
NÚCLEO
1 (UEPG 2015) O núcleo delimitado por membrana é 4 (UEM 2013) O núcleo é considerado portador dos
uma estrutura de células eucarióticas e responsável fatores hereditários e controlador das atividades
pelo controle das funções celulares. Com relação à metabólicas da célula animal. Sobre esse assunto,
organização, estrutura e função do núcleo, assinale assinale a(s) alternativa(s) correta(s).
o que for correto. 01 Os nucléolos representam o material genético contido no
01 A hemácia humana é uma célula anucleada, ou seja, núcleo, sendo resultantes da associação entre proteínas e
durante a sua diferenciação, perdeu o núcleo. moléculas de DNA.
02 O nucléolo é uma região do núcleo mais densa, não 02 Cromossomos homólogos são os dois representantes de
delimitada por membrana, que se cora mais intensamente cada par cromossômico presente em células diploides,
com corantes básicos. Esse local é de intensa transcrição do provenientes originalmente do par de gametas.
ácido ribonucleico ribossômico (RNAr). Nos cromossomos, 04 Um trecho da molécula de DNA cromossômico que contém
essas regiões são denominadas de regiões organizadoras informações para sintetizar a cadeia de aminoácidos de
de nucléolo. uma proteína é definido como gene.
04 A cromatina presente no núcleo consiste em DNA associado 08 A principal função da carioteca é manter o conteúdo nuclear
a proteínas histônicas e é o material que forma cada um dos separado do meio citoplasmático, impedindo o intercâmbio
cromossomos. de substâncias entre o núcleo e o citoplasma.
08 Todas as trocas entre núcleo e citoplasma ocorrem na forma 16 A análise do cariótipo de um feto revela a forma, o número
de transporte ativo realizado por proteínas transmembranas
EXERCÍCIOS APROFUNDADOS

e o tamanho dos cromossomos, possibilitando detectar


presentes na carioteca. alterações cromossômicas antes do nascimento da criança.

2 (UEM-PAS 2014) Sabe-se que todos os seres vivos são


5 (UFSC 2012) Utilizando-se Microscopia Eletrônica de
formados por unidades básicas denominadas células.
Transmissão foram obtidas as imagens abaixo. Na
Em relação a essas unidades estruturais e funcionais
Figura A, observa-se um plasmócito obtido da medula
dos seres vivos, assinale o que for correto.
óssea de cobaia (aumento de 25.000 X). Na Figura
01 Na célula eucariótica, os cromossomos estão no interior B, observa-se uma célula pancreática de um morcego
de um envoltório membranoso, composto por duas
membranas. (aumento de 95.000 X).
02 Nas células, quando uma proteína vai ser sintetizada, uma
região do DNA do núcleo da célula é copiada por uma
enzima chamada RNA polimerase.
04 Núcleo, mitocôndrias e cloroplastos são as únicas organelas
celulares que possuem DNA.
08 A retirada do nucléolo de uma célula implicará a intensa
síntese de ribossomos.
16 Nas células, a água atravessa a membrana celular por
difusão facilitada, pois sua molécula é polar e as moléculas
de lipídios formam uma camada interna hidrofóbica.

3 O núcleo é uma estrutura celular delimitada


(IFSC 2014)
pela carioteca que existe apenas em organismos
eucariontes. Sobre o núcleo, assinale a soma da(s)
proposição(ões) CORRETA(S). Com relação às estruturas apontadas pelas setas,
01 O núcleo é uma estrutura presente em todas as células
assinale a(s) proposição(ões) CORRETA(S).
animais. 01 A estrutura indicada pelo número 2 é a menos condensada
02 O núcleo armazena o material genético que contém a do núcleo e corresponde ao nucleoplasma.
informação para a produção de proteínas da célula. 02 A estrutura indicada pelo número 3 é o retículo
04 As moléculas de DNA estão arranjadas na forma de endoplasmático liso.
cromossomos, que são associações do DNA com proteínas 04 A estrutura indicada pelo número 1 corresponde aos
denominadas histonas. lisossomos responsáveis pela digestão celular.
08 Na espécie humana há 46 cromossomos nas células 08 Nas regiões escuras no núcleo, indicada pelo número 2,
somáticas e 23 nas células gaméticas. Alterações no encontra-se a maior concentração de DNA.
número de cromossomos causam anomalias genéticas. A estrutura indicada pelo número 4 corresponde a um
16
16 A informação contida no DNA é transcrita a RNA cloroplasto, pois se visualiza nitidamente a estrutura
mensageiro, que é transportado ao citoplasma onde a lamelar do granum.
sequência de nucleotídeos será traduzida a uma sequência As organelas presentes nas Figuras A e B não apresentam
de aminoácidos no complexo de Golgi. 32
membranas de separação com o citoplasma.
64 Dentro da estrutura indicada pelo número 4 ocorrem etapas
da cadeia respiratória e do ciclo de Krebs.

2
6 (UEMA 2016) A Acetabularia é uma alga marinha, 9 (UFSCAR 2010) A edição n.º 76 da revista Scientific
unicelular, com cerca de 5cm de altura, cuja estrutura American Brasil, de 2008, noticiou que pesquisadores
é formada por um “chapéu” (ou umbela) e uma da Harvard Medical School, nos Estados Unidos,
haste (ou pé), onde se localiza o núcleo. Analise as conseguiram construir um modelo da célula primitiva,
experiências de microdissecção realizadas com essa que surgiu há, aproximadamente, 3,5 bilhões de
alga, demonstradas nos esquemas abaixo. anos e que deu início à jornada da vida na Terra. A
partir dessa célula primitiva surgiram os dois tipos
fundamentais de células: um, presente em bactérias e
cianobactérias e o outro, presente em todos os demais
seres vivos conhecidos atualmente, exceto vírus. Esse
feito científico é de extrema importância, pois pode
fornecer informações mais precisas de como esse
processo de diversificação aconteceu.
a Quais são os dois tipos celulares a que o texto faz referência,
e qual é a diferença mais marcante entre eles, visível com o
auxílio do microscópio óptico?
b Em um organismo pluricelular, podemos observar células
com um mesmo código genético desempenhando funções
muito diferentes, por exemplo, um neurônio e uma célula
muscular. Como isso é possível?

Com base nas experiências apresentadas, explique os

EXERCÍCIOS APROFUNDADOS
resultados observados, destacando o papel do núcleo
celular.

(UEG 2010) Na década de 1930, o biólogo alemão


10
Joachim Hammerling, com o objetivo de entender a
importância do núcleo celular, realizou transplantes
entre duas espécies de algas unicelulares marinhas:
a Acetabularia mediterranea, cuja umbela tem
(UEPG 2011) No que se refere à cromatina, assinale o forma lisa, e a Acetabularia crenulata, cuja umbela
7 tem forma ondulada. A seguir, está a representação
que for correto.
01 Aparece em todas as etapas da mitose: prófase, metáfase,
esquemática dos experimentos realizados.
anáfase e telófase.
02 Aparece apenas na anáfase, pois, apenas nesta etapa a
cromatina é importante no processo da divisão celular.
04 Está presente no núcleo interfásico e aparece durante a
divisão celular com uma organização estrutural diferente,
transformando-se nos cromossomos.
08 É formada por nucleoproteínas.

8 (UEM 2011) Identifique o que for correto sobre as


características gerais dos cromossomos.
01 Durante a interfase, ocorre a duplicação dos cromossomos,
e essas cópias unidas de um cromossomo duplicado são Sobre os resultados obtidos a partir dos experimentos,
denominadas cromátides-irmãs.
explique:
02 A posição do centrômero serve de critério para classificar
os cromossomos em três tipos: metacêntrico, acrocêntrico a o que ocorreu em A e B, com ambas espécies;
e telocêntrico. o que ocorre em C quando há a enxertia do pedúnculo de
b
04 Os genes da espécie humana distribuem-se em A. mediterranea em uma base de A. crenulata.
cromossomos autossomos e sexuais. Cada pessoa herda
dois conjuntos de 23 desses cromossomos, um proveniente
da mãe e outro do pai.
08 Nos eucariontes, o material genético chamado de cromatina
é separado do citoplasma pela membrana nuclear.
16 As alterações cromossômicas estruturais correspondem
a modificações na sequência dos genes ao longo do
filamento, podendo ser provocadas por vírus, radiação ou
substâncias químicas.

www.biologiatotal.com.br 3
11 (UFPR 2010)O complexo de poro nuclear é a estrutura 13 (UEM 2016) Em células eucarióticas, a relação
que regula o trânsito de grandes moléculas (como nucleoplasmática (RNP) é dada pela fórmula
RNA e proteínas) entre o núcleo celular e o citoplasma. VN
RNP = , na qual VN representa o volume
O número de complexos de poro encontrados no VC − VN do núcleo celular e Vc representa
envoltório nuclear pode variar entre diversos tipos
o volume total da célula.
celulares.
a Coloque em ordem crescente de número de complexos Assinale o que for correto.
de poro por núcleo os seguintes tipos celulares: neurônio, 01 Em células eucarióticas, o material genético fica localizado
espermatozoide, adipócito. no núcleo.
02 No processo de mitose de células eucarióticas, a
Número de complexos de poro por núcleo celular fragmentação do envoltório nuclear (carioteca) se inicia na
prófase.
< < 04 A relação nucleoplasmática também pode ser obtida pela
fórmula VN
VC
V
1− N
b Justifique a ordem escolhida, com base nos conhecimentos VC
de biologia e fisiologia celular.
08 Uma célula com RNP=2 tem menos de 60% de seu volume
ocupado pelo núcleo.
16 Em uma célula esférica, cujo núcleo é também esférico com
raio igual à metade do raio da célula, tem-se RNP = 1 .
7
EXERCÍCIOS APROFUNDADOS

QUESTÃO BAGA
12 (UERJ 2007) As células animais possuem núcleo
delimitado por um envoltório poroso que funciona Quando uma célula inicia o processo de divisão, seus
como uma barreira entre o material nuclear e o cromossomos se tornam mais curtos, mais espessos e
citoplasma. As células vegetais, apesar de possuírem visíveis individualmente em um microscópio óptico.
núcleo similar, diferem das animais por apresentarem Explique o que está acontecendo ao nível molecular
um envoltório externo à membrana plasmática,
denominado parede celular.
Aponte o motivo pelo qual o envoltório nuclear
deve apresentar poros. Em seguida, cite as funções
da parede celular dos vegetais e seu principal
componente químico.

ANOTAÇÕES

4
GABARITO DJOW
NÚCLEO
1: 01 + 02 + 04 = 07. genoma, ou seja, o mesmo conjunto de genes, porém, cada tipo
[08] Falso: Parte das trocas entre o núcleo e o citoplasma celular expressa apenas alguns desses genes, o que permite sua
ocorre na forma de transporte ativo realizado por proteínas especialização e o desempenho de funções específicas. Nessa
transmembrana situados nos poros e membranas do envoltório questão, a expressão “código genético” foi usada com o sentido
nuclear. Esse fenômeno envolve o transporte de macromoléculas, “informação genética” ou “genoma”. O código genético,
tais como proteínas e RNA. na verdade, é o mesmo para todos os seres vivos e refere-se
à relação que existe entre uma trinca de nucleotídeos de um
RNAm e um aminoácido.
2: 01 + 02 + 04 = 07.
[08] Falso. O nucléolo é o local onde ocorre a biossíntese dos
ribossomos. 10: a) Quando a umbela de ambas espécies foram removidas,
[16] Falso. Nas células, o transporte de água pela membrana a célula regenerou outra igual, respectivamente lisa em A.
plasmática ocorre por osmose, sem a participação de proteínas mediterranea e ondulada em A. crenulata.
facilitadoras. b) Quando o pedúnculo de A. mediterrânea foi enxertado em
uma base de A. crenulata, aconteceu a regeneração de uma
umbela com características intermediárias entre as das duas
3: 02 + 04 + 08 = 14. espécies. Quando essa umbela intermediária foi novamente
[01] Falsa: As hemácias de mamíferos são células anucleadas. removida, a célula regenerou uma umbela ondulada típica da
[16] Falsa: A síntese das proteínas ocorre nos ribossomos. espécie doadora da base nucleada, A. crenulata. Quando a
umbela mista foi removida, aconteceu a regeneração de uma
4: 02 + 04 + 16 = 22. umbela típica de A. crenulata. Esse experimento demonstra que
[01] Incorreto: Os nucléolos são estruturas intracelulares o núcleo é o responsável por essas regenerações.

EXERCÍCIOS APROFUNDADOS
formadas pela associação de moléculas de DNA, proteínas e
RNA ribossômico. 11: a) espermatozoide < adipócito < neurônio
[08] Incorreto: O envoltório nuclear (carioteca) é formado b) Células que apresentam menor metabolismo de síntese (RNAs
por uma membrana dupla e porosa que regula o intercâmbio e proteínas) possuem uma menor quantidade de complexos de
de substâncias entre o citoplasma e o núcleo das células poro.
eucarióticas.
12: É necessário haver trocas de material, como nucleotídeos,
5: 08 + 64 = 72. RNA e proteínas, entre o núcleo e o citoplasma.
(01) Falso. A estrutura apontada pela seta 2 corresponde à Proteger e dar sustentação e resistência à célula vegetal.
cromatina nuclear. A parede celular é formada principalmente por celulose.
(02) Falso. A estrutura apontada pela seta 3 é o retículo
endoplasmático rugoso.
(04) Falso. A estrutura 1 é a cromatina nuclear descondensada. 13: 01 + 02 + 04 + 16 = 23.
(16) Falso. A estrutura 4 é uma mitocôndria. [Resposta do ponto de vista da disciplina de Biologia]
(32) Falso. O núcleo e as mitocôndrias são revestidos por [01] Correta.
membrana dupla. [02] Correta.
[Resposta do ponto de vista da disciplina de Matemática]
[04] Correta. Simplificando a relação dada:
6: Em [A], apenas o disco foi removido, aparecendo após VN VN
algum tempo um novo disco, indicando que o núcleo comanda VC VC VN VC V
o controle de regeneração. Em [B], o núcleo foi removido e um = = ⋅ =N
V VC − VN VC VC − VN VC − VN
disco normal apareceu após algum tempo, mas com o passar 1− N
VC VC
do tempo perdeu novamente o disco, indicando que a alga
provavelmente estava em estágio inicial e perdeu o comando [08] Incorreta. Uma célula com RNP = 2 tem mais de 60% de seu
de controle do núcleo retirado. Em [C], um núcleo de uma volume ocupado pelo núcleo. Calculando:
determinada espécie foi transplantado para o “pé” anucleado 2=
VN 2
→ 2VC − 2VN = VN → 2VC = 3VN → VN = VC → VN ≈ 0,67VC
de outra, retirando-se o disco, aparecendo, após algum tempo, VC − VN 3
um novo disco, do doador, indicando o comando nuclear na [16] Correta. Calculando:
regeneração. 4
VC = ð R3
3
7: 04 + 08 = 12. 4 R3 4
=
VN = ð R3
A cromatina torna-se evidente à microscopia óptica e eletrônica ð
3 8 24
durante a metáfase e anáfase, devido à condensação ou 4
ð R3
4 4
espiralização das nucleoproteínas. =
RNP
VN
→ 24 = 24 = 24 =
4 24
⋅ =
4
→ RNP =
1
VC − VN 4 4 4 4 32 − 4 24 28 28 7
ð R3 − ð R3 −
3 24 3 24 24
8: 01 + 04 + 08 + 16 = 29.
A posição do centrômero permite a classificação dos cromossomos
em quatro tipos: telocêntrico (centrômero terminal), acrocêntrico
(centrômero subterminal), submetacêntrico (centrômero
submediano) e metacêntrico (centrômero mediano). QUESTÃO BAGA
Cada cromossomo consiste em uma molécula de
9: O texto faz referência às células procarióticas e às células DNA longa e ligada a várias moléculas proteicas, uma
eucarióticas. A diferença mais marcante entre esses dois tipos combinação chamada cromatina. Quando uma célula
celulares é a presença, apenas nas células eucarióticas, de inicia a divisão, cada cromossomo se torna “condensado”
carioteca, a membrana nuclear que envolve o material genético na medida em que sua massa difusa de cromatina se
e permite a existência de um núcleo organizado. enrola.
Todas as células somáticas de um indivíduo possuem o mesmo

www.biologiatotal.com.br 5
SINTESE PROTEICA
45 (Ufpr 2017) Uma cultura de bactérias idênticas, todas 47 (Uepg 2016) James Watson e Francis Crick resolveram
contendo apenas uma molécula de DNA, é colocada a estrutura do DNA em 1953, rendendo-lhes inclusive
em um meio de cultura no qual os nucleotídeos um prêmio Nobel. Em relação às características desta
são marcados radioativamente. Elas são mantidas molécula, assinale o que for correto.
nesse meio por dois ciclos de divisão celular; ou 01 Uma mutação em uma única base nitrogenada não
seja, cada bactéria terá originado quatro bactérias- é capaz de prejudicar a estrutura de uma proteína e
levar a manifestação de uma doença. Já as mutações
filhas. Depois, são mantidas por mais um ciclo de cromossômicas, por exemplo, trissomia do 21, são
divisão em um meio com nucleotídeo não radioativo. extremamente graves.
Cada molécula de DNA é formada por duas cadeias 02 A replicação do DNA é dita semiconservativa, sendo que
polinucleotídicas enroladas helicoidalmente. cada uma das fitas é utilizada como molde para a síntese
de uma fita complementar, polimerizada pela enzima DNA
a A partir de uma bactéria dessa colônia, quantas cadeias polimerase.
polinucleotídicas conterão marcação radioativa e quantas
cadeias não conterão marcação radioativa ao final dos três 04 O DNA é uma molécula constituída por nucleotídeos
ciclos? organizados em fita única, os quais se unem por ligações
denominadas pontes de hidrogênio.
b Explique o motivo de sua resposta no item anterior. O DNA é constituído por vários nucleotídeos em sequência,
08
os quais são formados por um grupo fosfato, uma base
nitrogenada e uma pentose, a desoxirribose.

EXERCÍCIOS APROFUNDADOS
16 Uma sequência de DNA, denominada gene, pode ser
transcrita em moléculas de RNA pela enzima RNA
polimerase, processo denominado de transcrição.

48 (Unicid - Medicina 2016) Após a descoberta da


estrutura da molécula de DNA, surgiram três modelos
para explicar como ocorre sua duplicação. A figura
46 (Unisa - Medicina 2017) Analise a tabela, que contém ilustra três possíveis modelos de duplicação da
uma parte do código genético.
molécula de DNA.

Considere um segmento de DNA com a seguinte


sequência de bases nitrogenadas, em que a seta
indica o sentido da transcrição:
a Dos modelos apresentados, qual deles representa a
duplicação da molécula de DNA proposto por Watson e
a Suponha que um ribossomo traduziu o RNA mensageiro Crick? Justifique sua resposta.
sintetizado a partir desse segmento de DNA, quantos b Em que fase do ciclo celular mitótico ocorre a duplicação
aminoácidos são codificados por este ribossomo? Cite o da molécula de DNA? Por que a célula precisa realizar esse
nome do último aminoácido que fará parte da molécula processo?
transcrita.
b Caso ocorra uma mutação e a décima quinta base
nitrogenada seja substituída pela base timina (T), qual
será o anticódon do RNA transportador que se emparelha
com o códon codificado após a mutação? De acordo com
a propriedade do código genético, explique por que essa
mutação pode ser considerada silenciosa.

49 Ufu 2016) Observe a tabela a seguir.

www.biologiatotal.com.br 17
a O código genético define as regras químicas que os seres
vivos utilizam na tradução da informação dos seus genes.
Uma vez alterado o código genético, o resultado da
tradução também é modificado. Qual a importância de cada
códon? Qual o produto modificado resultante da tradução?
b Imagine que o produto da tradução do código genético foi
sintetizado no pâncreas e deve ser utilizado em outro lugar
do organismo. Uma vez que a biossíntese foi acompanhada
nas células com a marcação de isótopos radiativos
das unidades constituintes (monômeros) do referido
produto, qual a sequência de estruturas citoplasmáticas
você espera encontrar nas unidades marcadas,
Abreviatura dos aminoácidos: respectivamente?
Phe=fenilalanina; His=histidina; Leu=leucina; Gin=glutamina;
Ile=isoleucina; Asn=aspargina; Met=metionina; Lys=lisina;
Val=valina; Asp=ácido aspártico; Ser=serina; Glu=ácido glutâmico;
Pro=prolina; Cys=cisteína; Thr=treonina; Trp=triptofano;
Ala=alanina; Arg=arginina; Tyr=tirosina; Gly=glicina.

*A abreviatura Pare corresponde aos códons de parada.

Considere a seguinte sequência de bases nitrogenadas


do DNA:
TAG GCT AAT GCT CGT ATT
A partir das informações apresentadas, responda:
EXERCÍCIOS APROFUNDADOS

aQual será a sequência de bases nitrogenadas na duplicação


do DNA? 51 (Uerj 2015) Considere uma molécula de DNA sem
b A transcrição gênica formará quantos códons e quais são qualquer mutação e que apresente 16% de bases
eles? nitrogenadas de citosina.
c A tradução sintetizará quais aminoácidos? Determine os percentuais de guanina e de timina
encontrados nessa molécula, justificando suas
respostas.

50 (Usf 2016) Uma equipe de investigadores da


Universidade de Aveiro (UA) quebrou uma das
regras sagradas da biologia: o código genético não
é imutável. Estes investigadores descobriram que 52 (Unifesp 2015) Alguns antibióticos são particularmente
o fungo patogênico Candida albicans utiliza um usados em doenças causadas por bactérias. A
código genético diferente do dos outros seres vivos tetraciclina é um deles; sua ação impede que o RNA
e conseguiram compreender como é que este fungo transportador (RNAt) se ligue aos ribossomos da
o alterou e, agora, conseguiram realizar a primeira bactéria, evitando a progressão da doença.
alteração artificial em laboratório. a Que processo celular é interrompido pela ação da
A investigação dos doutorandos Ana Rita Bezerra e tetraciclina? Qual é o papel do (RNAt) nesse processo?
João Simões, sob coordenação de Manuel Santos, b Em que local, na bactéria, ocorre a síntese do (RNAt)? Cite
professor do Departamento de Biologia da UA e dois outros componentes bacterianos encontrados nesse
mesmo local.
investigador do Centro de Estudos do Ambiente e do
Mar (CESAM), decorreu ao longo dos últimos quatro
anos e foi agora publicada na «Proceedings of the
National Academy of Sciences» (PNAS).
Disponível em: <http://www.cienciahoje.pt/index.
php?oid=57972&op=a>
Acesso em: 02/10/2015, às 10h02min.

Com base no texto, responda ao que se pede.

18
53 (PUCRJ 2015) A sequência de DNA a seguir ocorre
no filamento codificante de um gene estrutural em
a Das partes assinaladas, quais são codificadoras, ou seja,
uma bactéria. quais contêm informações que vão fazer parte do transcrito
final e da proteína? Explique.
b Alguns indivíduos possuem uma mutação em “A”, o que
gera uma atividade enzimática reduzida. Entretanto, não
existem diferenças estruturais entre as enzimas codificadas
pelos genes com e sem esta mutação. Como tal fato pode
ser explicado?

a Qual é a sequência do RNA mensageiro, transcrita a partir


desse trecho de DNA?
b Qual é a sequência de aminoácidos do polipeptídeo
56 (Uepg 2014) As características morfológicas e
fisiológicas de um ser vivo dependem dos tipos

EXERCÍCIOS APROFUNDADOS
codificado por esse RNA mensageiro? (use a tabela do de proteínas do seu organismo. Ao comandar a
código genético)
c Se uma mutação ocorre no nucleotídeo T (indicado com
fabricação das proteínas, o ácido desoxirribonucleico
uma seta), substituindo-o por A, qual será a sequência (DNA) consegue regular a atividade das células. A
de aminoácidos depois da transcrição e tradução? (use a informação gênica do DNA é transcrita em ácido
tabela do código genético) ribonucleico (RNA) e posteriormente é traduzida
na proteína. Com relação a esses processos e
biomoléculas, assinale o que for correto.
01 O RNA é formado por uma única fita polinucleotídica. Nessa
fita, a pentose é sempre a ribose e as bases nitrogenadas
são a adenina, citosina, guanina e uracila.
02 No processo de duplicação semiconservativo do DNA,
a enzima DNA-ligase faz as ligações do tipo pontes de
hidrogênio para unir a duas fitas do DNA.
04 O RNA transportador ou de transferência (RNA-t) transporta
aminoácidos até o local da síntese da proteína.
08 O RNA ribossômico (RNA-r) carreia os códons (trinca de
bases) que serão decodificados em aminoácidos.
16 Em eucariotos, o RNA é fabricado no núcleo, tendo como
54 (Uem-pas 2014) Sabe-se que todos os seres vivos são molde um setor da molécula do DNA (gene), e migra para
formados por unidades básicas denominadas células. o citoplasma, onde desempenha sua função na síntese da
Em relação a essas unidades estruturais e funcionais proteína.
dos seres vivos, assinale o que for correto.
01 Na célula eucariótica, os cromossomos estão no interior
de um envoltório membranoso, composto por duas 57 (Unicamp 2014) A imagem abaixo representa o
membranas. processo de tradução.
02 Nas células, quando uma proteína vai ser sintetizada, uma
região do DNA do núcleo da célula é copiada por uma
enzima chamada RNA polimerase.
04 Núcleo, mitocôndrias e cloroplastos são as únicas organelas
celulares que possuem DNA.
08 A retirada do nucléolo de uma célula implicará a intensa
síntese de ribossomos.
16 Nas células, a água atravessa a membrana celular por
difusão facilitada, pois sua molécula é polar e as moléculas
de lipídios formam uma camada interna hidrofóbica.

55 (Pucrj 2014) A figura abaixo representa um gene


eucariótico de uma determinada enzima. “A” é a
região promotora do gene; “B” e “D” são éxons; e
“C” é um íntron.

www.biologiatotal.com.br 19
a Quais são as estruturas representadas pelas letras A e B, Com base nestas informações, responda:
respectivamente? a Como se denominam as etapas 01 e 02, respectivamente?
b Nos eucariotos, em quais estruturas celulares esse processo
ocorre? b Após uma imunização ativa, como ocorre a ação do
produto final desse processo?

61 (Uem 2016) Considerando a estrutura e a função


58 (Uem 2013) O núcleo é considerado portador dos do DNA e dos RNAs, e fazendo uso das estruturas I
fatores hereditários e controlador das atividades e II abaixo, assinale o que for correto.
metabólicas da célula animal. Sobre esse assunto,
assinale a(s) alternativa(s) correta(s).
01 Os nucléolos representam o material genético contido no
núcleo, sendo resultantes da associação entre proteínas e
moléculas de DNA.
02 Cromossomos homólogos são os dois representantes de
cada par cromossômico presente em células diploides,
provenientes originalmente do par de gametas.
04 Um trecho da molécula de DNA cromossômico que contém
EXERCÍCIOS APROFUNDADOS

informações para sintetizar a cadeia de aminoácidos de


uma proteína é definido como gene.
08 A principal função da carioteca é manter o conteúdo nuclear
separado do meio citoplasmático, impedindo o intercâmbio
de substâncias entre o núcleo e o citoplasma.
16 A análise do cariótipo de um feto revela a forma, o número
01 A estrutura I representa um ribonucleotídeo, enquanto a
e o tamanho dos cromossomos, possibilitando detectar estrutura II representa um nucleotídeo.
alterações cromossômicas antes do nascimento da criança.
02 A estrutura II possui ao todo quatro carbonos assimétricos,
enquanto a estrutura I possui cinco carbonos assimétricos.
04 A estrutura I possui um carbono primário, enquanto a
59 (Uepg 2013) Considerando os ácidos nucleicos,
estrutura II não possui nenhum carbono primário.
assinale o que for correto.
08 Em uma das extremidades de uma molécula de RNAt há
Tanto o DNA quanto o RNA são formados de sequências uma trinca de bases nitrogenadas, denominada anticódon,
01 de moléculas denominadas de nucleotídeos, os quais são
capaz de se emparelhar, por ligações de hidrogênio, ao
constituídos de uma pentose, uma base nitrogenada e um códon complementar do RNAm.
grupo fosfato.
16 As bases citosina (C) e guanina (G) interagem mutuamente
02
Existem 5 tipos principais de bases nitrogenadas: por meio de três ligações de hidrogênio, enquanto que as
adenina, timina, guanina, citosina e uracila. A uracila é bases timina (T) e adenina (A) interagem mutuamente por
exclusivamente encontrada na molécula de RNA. meio de duas ligações de hidrogênio na estrutura espiral
Durante a duplicação, novas fitas de DNA são formadas do DNA.
04
baseadas em um molde de DNA pré-existente, o qual é
descartado ao fim do processo.
08 Durante o processo denominado síntese proteica, ou
tradução, a informação presente no DNA é transferida ao QUESTÃO BAGA
RNA, no núcleo da célula.
16 Nos eucariotos, durante todo o processo de divisão Imagine uma proteína que funciona no RE, mas requer
celular, o DNA pode ser encontrado em sua forma mais modificação no complexo de Golgi antes de alcançar
descompactada.
essa função. Descreva a rota da proteína pela célula,
começando com a molécula de RNAm que especifica
(Ufg 2013) A figura a seguir esquematiza as duas a proteína.
60 etapas envolvidas no processo de síntese proteica em
um linfócito B.

20
GABARITO DJOW
SINTESE PROTEICA
45: a) Ao final do primeiro ciclo, cada bactéria terá uma cadeia 52: a) O processo interrompido pelo antibiótico é a tradução do
polinucleotídica normal e uma radiotiva. No segundo ciclo, duas RNAm, isto é, a síntese das proteínas bacterianas. O RNAt conduz
bactérias terão uma cadeia normal e uma radioativa e duas os aminoácidos ativados aos ribossomos.
apresentarão as duas cadeias marcadas com radioatividade. b) O RNAt é transcrito a partir do DNA disperso no citosol da
Ao término do terceiro ciclo ocorrem duas bactérias com as bactéria. No citosol bacteriano encontram-se ribossomos e
duas cadeias normais e seis bactérias com uma cadeia sem plamídeos.
radioatividade e uma cadeia radioativa.
b) O resultado do experimento é explicado pelo fato de a 53: a)
replicação do DNA ser semiconservativa. 5’-GAAUGUCAGAACUGCCAUGCUUCAUAUGAAUAGACCU
CUAG-3’
46: a) São codificados seis aminoácidos, sendo cinco tipos b) AUG–UCA–GAA–CUG–CCA–UGC–UUC–AUA–UGA-AUAGA
diferentes. O último aminoácido será a histidina. CCUCUAG Met–Ser–Glu–Leu–Pro–Cys–Phe–Ile–Término
b) O anticódon será GCU. A mutação pode ser considerada c) AUG–UCA–GAA–CUG–CCA–UGC–UUC–AUA–AGA-AUA-
silenciosa porque codifica para o mesmo aminoácido. GAC-CUC-UAG Met–Ser–Glu–Leu–Pro–Cys–Phe–Ile–Arg-Ile-
Asp-Leu-Término
47: 02 + 08 + 16 = 26.
[01] Falso. Dependendo da base nitrogenada e o códon podem 54: 01 + 02 + 04 = 07.
ocorrer mudanças na estrutura da proteína. [08] Falso. O nucléolo é o local onde ocorre a biossíntese dos
[02] Verdadeiro. A replicação do DNA é catalisada por enzimas ribossomos.

EXERCÍCIOS APROFUNDADOS
polimerases, onde cada uma das fitas serve de molde para a [16] Falso. Nas células, o transporte de água pela membrana
síntese da fita complementar. plasmática ocorre por osmose, sem a participação de proteínas
[04] Falso. O DNA é formado por duas fitas, constituídas por facilitadoras.
nucleotídeos, enroladas em forma de hélice.
[08] Verdadeiro. O DNA é formado por sequências de nucleotídeos 55: a) “B” e “D”. Somente os éxons contém informação do
e estes são formados por uma pentose (desoxirribose), uma base transcrito final e da proteína. A região promotora é reconhecida
nitrogenada e um grupo fosfato. pela RNA polimerase para o início da transcrição. Os íntrons são
[16] Verdadeiro. A transcrição ocorre a partir de uma parte do inicialmente transcritos, mas depois retirados no processo de
DNA, formando RNAs, a partir da enzima RNA polimerase. splicing e não fazem parte do transcrito final ou da proteína.
b) A mutação ocorrida em “A” não gera alteração na estrutura
48: a) O modelo C representa a duplicação da molécula de da proteína. Entretanto, a atividade enzimática é reduzida
DNA proposta por Watson e Crick, indicando que cada uma das porque a ligação entre a RNA polimerase e a região promotora
moléculas de DNA serve como molde para a formação de uma é mais fraca, o que leva a uma diminuição na expressão gênica.
nova cadeia, chamada de replicação semiconservativa.
b) A duplicação da molécula de DNA ocorre na Intérfase, no 56: 01 + 04 + 16 = 21.
intervalo chamada S (Síntese), processo que antecede a mitose [02] Falso. No processo de duplicação semiconservativo do DNA,
propriamente dita. A célula precisa replicar o DNA para a divisão a enzima DNA-ligase faz as ligações entre os segmentos de DNA
e produção de uma nova célula. na fita com duplicação descontínua.
[08] Falso. O RNA mensageiro (RNA-m) carreia os códons (trinca
de bases) que serão decodificados em aminoácidos.
49: a) Cadeia complementar do DNA:
ATC CGA TTA CGA GCA TAA. 57: a) RNA mensageiro (A) e RNA transportador (B).
b) A transcrição produzirá um segmento de RNA mensageiro b) A síntese dos polipeptídeos ocorre nos ribossomos livres
com 6 códons. A saber: do citosol e naqueles aderidos às membranas do retículo
AUC CGA UUA CGA GCA UAA. endoplasmático.
c) A tradução produzirá um peptídeo com os seguintes
aminoácidos: isoleucina – arginina – leucina – arginina – alanina.
58: 02 + 04 + 16 = 22.
[01] Incorreto: Os nucléolos são estruturas intracelulares
50: a) Cada códon é formado por três bases nitrogenadas (parte formadas pela associação de moléculas de DNA, proteínas e
dos nucleotídeos) que codificarão aminoácidos, constituindo RNA ribossômico.
uma mensagem em código, conhecida como código genético. O [08] Incorreto: O envoltório nuclear (carioteca) é formado
produto resultante da tradução é a proteína. por uma membrana dupla e porosa que regula o intercâmbio
b) Ribossomos, Retículo endoplasmático granular e Complexo de substâncias entre o citoplasma e o núcleo das células
golgiense, sendo este o caminho da síntese de proteínas no eucarióticas.
citoplasma.
59: 01 + 02 = 03.
51: Devido ao pareamento obrigatório das bases nitrogenadas [04] Incorreto: Durante a duplicação do DNA, as moléculas-filhas
do DNA, a quantidade de citosina é igual à de guanina e a conservam a metade da molécula-mãe.
quantidade de adenina é igual à quantidade de timina. Dessa [08] Incorreto: Durante o processo de tradução, os códons
forma, temos: 16% de C e 16% de G, somando 32% das bases do RNAmensageiro são traduzidos em sequência específica dos
do DNA. O restante, 68%, é dividido igualmente entre A e T. aminoácidos que formam as proteínas.
Logo, temos: 34% de A e 34% de T. [16] Incorreto: Nos eucariotos, durante o processo de divisão
celular, o DNA cromossômico sofre especialização durante a
prófase.

www.biologiatotal.com.br 21
60: a) Etapa 01: transcrição; etapa 02: tradução. [04] Incorreta. Carbono primário: átomo de carbono ligado a um
b) A imunização ativa estimula os linfócitos B à produção de único átomo de carbono ou a nenhum outro átomo de carbono.
anticorpos (produto final), moléculas proteicas capazes de se A estrutura I possui seis carbonos primários, enquanto a
ligarem ao antígeno, inativando-o e tornando-o mais fácil de ser estrutura II não possui cinco.
fagocitado por macrófagos, neutrófilos e eosinófilos (células de
defesa).

61: 08 + 16 = 24.
[Resposta do ponto de vista da disciplina de Biologia]
[01] Incorreta. A estrutura I é um desoxirribonucleotídeo do
DNA, porque contém a base nitrogenada timina.

[Resposta do ponto de vista da disciplina de Química]


[02] Incorreta. A estrutura II possui ao todo três carbonos
assimétricos, enquanto a estrutura I possui quatro carbonos
assimétricos.

QUESTÃO BAGA
O RNAm é sintetizado no núcleo e então passa para
fora através do poro nuclear para ser traduzido em um
ribossomo ligado ao RE rugoso. A proteína é sintetizada
EXERCÍCIOS APROFUNDADOS

no lúmen do RE e talvez modificada lá. Uma vesícula de


transporte carrega a proteína para o complexo de Golgi.
Após modificações adicionais no Golgi, outra vesícula de
transporte a carrega de volta para o RE, onde realizará seu
papel na célula.

ANOTAÇÕES

22
contato@biologiatotal.com.br
/biologiajubilut contato@biologiatotal.com.br
Biologia Total com Prof./biologiajubilut
Jubilut
@paulojubilut Biologia Total com Prof. Jubilut
@Prof_jubilut @paulojubilut
biologiajubilut @Prof_jubilut
biologiajubilut
+biologiatotalbrjubilut
ANOMALIAS CROMÔSSOMICAS
Estes tipos de anomalias alteram a estrutura
MUTAÇÕES NUMÉRICAS
ou o número de cromossomos e podem até ser
detectadas através de exames médicos (muitas Quando ocorre meiose, formam-se gametas
vezes efetuados em situações de doenças com um número de cromossomos diferente do
familiares conhecidas no planejamento de que seria normal. Um cariótipo que apresente o
uma gravidez) tais como pela determinação número normal de cromossomos é denominado
do cariótipo. Podemos dividi-las em dois tipos: euploide. Caso a célula seja haploide (n)
estruturais e numéricas. ou diploide (2n) o número de cópias dos
cromossomos varia.
MUTAÇÕES ESTRUTURAIS a) poliploidia: quando numa célula todos
os cromossomos se apresentam num número
Correspondem a alterações da morfologia e da
idêntico, mas superior ao esperado numa
estrutura do cromossomo devido a fenômenos
situação de euploidia. Resulta geralmente de
de repetição, remoção ou troca de local de
um erro na separação dos cromossomos durante
porções do cromossomo (que incluem um
a meiose, podendo em casos raros resultar na
número variado de genes). Embora possa não
CITOGENÉTICA

união de mais de dois gametas. No ser humano,


ocorrer a perda de genes, o rearranjo da ordem
a poliploidia é letal, mas em plantas e alguns
no cromossomo pode levar a grandes alterações
peixes, por exemplo, é comum e pode levar à
da expressão gênica.
formação de novas espécies.
a) corte: perda de material cromossômico, que
pode incluir número variado de genes.
b) aneuploidia: a célula apresenta alterações
b) translocação: transferência de material de
numéricas de um ou mais cromossomas, mas não
um cromossomo para outro não homólogo ou
do conjunto cromossomico total. Se surgirem
para novo local dentro do mesmo cromossomo
mais do que dois cromossomas homólogos
– translocação simples; troca de segmentos
num dos pares, designa-se por polissomia. Pode
entre dois cromossomos não homólogos –
surgir, assim, uma trissomia (2n + 1) ou uma
translocação recíproca.
tetrassomia (2n + 2). Se ocorrer uma diminuição
c) duplicação: adição de um segmento do do número de cromossomos homólogos, poderá
cromossomo homólogo, originando um conjunto surgir uma monossomia (2n –1) ou num caso
de genes duplicado. mais extremo uma nulissomia (2n – 2) quando
um determinado tipo de cromossomas está
d) inversão: inversão da ordem dos genes no ausente da célula.
cromossomo.

Estas mutações ocorrem durante a divisão


celular, e nos casos do corte e translocação,
podem estar associadas a um crossing over
entre cromossomos não homólogos.

44
Estas mutações estão associadas a fenómenos
de não-disjunção dos cromossomos durante
a meiose I ou II. A não-disjunção pode
igualmente afetar os autossomos como os
cromossomos sexuais. No homem a maior
parte das aneuploidias autossômicas tem
origem materna, em parte porque os oocitos só
terminam o seu desenvolvimento 10 ou mais
anos depois de terem sido formados, estando
sujeitos a uma série de agentes potencialmente
mutagênicos. O exemplo mais comum e mais
conhecido é o da trissomia 21 ou síndrome
de Down (mongolismo) em que os indivíduos
possuem um cromossomo 21 extra.

O portador da síndrome de Down, possui 47


cromossomos em cada uma das suas células ao
invés do normal que é 46.

CITOGENÉTICA

Diferentes formas que os cromossomos sexuais são


encontrados nas diversas espécies de animais.

www.biologiatotal.com.br 45
LEITURA COMPLEMENTAR
Por que a Síndrome de Down ocorre mais frequentemente
com o aumento da idade materna?

A trissomia do cromossomo 21 foi descrita A trissomia do cromossomo 21 é a mais comum


pela primeira vez pelo médico britânico de ocorrer, e também a que leva a uma maior
John Langdon Down – por isso recebeu o compatibilidade com a vida. Cópias extras dos
nome Síndrome de Down. Menos de cem cromossomos 13 ou 18 (Síndromes de Patau
anos após sua descrição, em 1933, alguns e Edwards, respectivamente), por exemplo,
conceitos básicos da síndrome já haviam levam a alterações severas nos indivíduos,
sido estudados, e já neste período a trissomia muitos deles não sobrevivendo por mais que
passou a ser associada ao aumento da idade uma semana após o parto.
materna.
A aneuploidia – número anormal de
cromossomos – do cromossomo 21
resulta principalmente da não-disjunção
dos cromossomos durante a meiose I. Ao
CITOGENÉTICA

contrário do que normalmente ocorre, estes


cromossomos permanecem unidos e são
transportados juntos para um dos pólos que
darão origem aos gametas. Quando a não-
disjunção ocorre durante a meiose II, são as
cromátides irmãs que permanecem unidas.

Apenas na década de 1960, porém, alguns


estudos iniciais confirmaram esta associação,
ainda que os pesquisadores não conseguissem
compreender seus motivos genéticos ou
bioquímicos. Mais recentemente, análises
em larga escala possibilitaram estudos dos
gametas humanos e seus cromossomos,
permitindo um maior entendimento das reais
origens desta e de outras trissomias. A não-disjunção pode ocorrer durante a meiose I, dando
origem a dois gametas com trissomia, ou durante a meiose
Atualmente, após a análise de milhares II, resultando em um único gameta com trissomia.

de diferentes casos, os pesquisadores Este processo de não-disjunção é comum,


puderam afirmar com maior embasamento podendo ocorrer em até 10% das meioses
que a grande maioria das trissomias deriva femininas. Porém, as chances de erros durante
de erros meióticos ocorridos no material a meiose feminina aumentam drasticamente
genético materno. De acordo com um estudo após os 35 anos de idade, aumentando os riscos
americano, por exemplo, apenas 5% dos de ocorrência de aneuploidia, especialmente
casos de trissomia derivam de erros meióticos as trissomias. Para compreender a relação
ocorridos no material genético paterno. da idade materna com a não-disjunção

46
cromossomal, é necessário compreender
o processo de ovogênese – processo de
formação dos gametas – humana.

A ovogênese tem seu início ainda durante o


período fetal, quando as células germinativas
femininas iniciam os processos de mitose
e crescimento celular. Quando chegam ao
estágio de ovócito primário, todas as células
Relação entre a idade materna e a proporção de
reprodutivas cessam sua divisão, durante crianças nascidas com trissomia no cromossomo 21.
a prófase I da meiose. Com a menarca –
Além disso, em muitos casos de ocorrência de
primeira menstruação da mulher – os ovócitos
aneuploidias, o próprio organismo percebe o erro
primários completam o processo de meiose e,
ocorrido e tende a abortar espontaneamente o
a cada mês, vão sendo liberados.
embrião, uma vez que sua viabilidade é muito
Assim, durante aproximadamente 45 anos, mais baixa. Esta capacidade de aborto pode ser
os ovócitos primários finalizam o processo diminuída, porém, em mulheres de maior idade,
meiótico e são liberados durante a ovulação o que também contribui para o aumento na
– mais corretamente denominada ovocitação. quantidade de crianças nascidas com trissomias.
Acredita-se que, com o passar dos anos, estes
Como já comentado anteriormente, erros
ovócitos tornam-se mais “velhos”, e, com

CITOGENÉTICA
meióticos ocorridos durante a formação dos
isto, aumentam as chances de ocorrência de
gametas não são encontrados apenas em
erros durante a meiose. Fatores que podem
indivíduos do sexo feminino. A ocorrência de
alterar-se com o passar do tempo e contribuir
trissomias devido a erros na meiose masculina,
para a ocorrência de erros são a destruição
porém, possui uma prevalência muito mais baixa
das fibras cromossômicas ou a deterioração
na população, e é, por este motivo, muito menos
dos centrômeros – região que prende o
estudada pela ciência.
cromossomo ao seu fuso.
Fonte: National Institutes of Health e Portal de Periódicos da UEM.

SÍNDROME DE PATAU ou Trissomia do 13 congênitos também estão comumente presente


nesta síndrome, bem como defeitos urogenitais
Normalmente, os seres humanos apresentam que englobam criptorquidia nos meninos, útero
23 pares de cromossomos, ou seja, são 46 bicornado e ovários hipoplásicos nas meninas.
cromossomos repartidos em 23 pares de 2 Tanto nas mãos quanto nos pés pode haver
cromossomos. Indivíduos com essa síndrome polidactilia.
apresentam um cromossomo a mais no par 13,
por isso é conhecida como trissomia do 13.

Os portadores da trissomia 13 apresentam


graves malformações do sistema nervoso central,
como, por exemplo, arrinencefalia; baixo peso
ao nascimento; defeitos na formação dos olhos
ou ausência dos mesmos; problemas auditivos;
anormalidades no controle da respiração; fenda
palatina e/ou lábio leporino; rins policísticos;
malformação das mãos. Defeitos cardíacos

www.biologiatotal.com.br 47
LEITURA COMPLEMENTAR
Síndrome de Patau: você conhece esta síndrome?
A formação dos gametas envolve processos 25 anos de idade. A taxa de sobrevivência à trissomia
metabólicos complexos que, em caso de erro, podem do cromossomo 13 aumenta, porém, em alguns casos
levar a condições fatais ou alterações na normalidade diferenciados da síndrome.
do futuro embrião. Um pequeno erro durante a divisão
celular, por exemplo, pode resultar na incorreta A trissomia em sua forma mais severa é denominada
separação dos cromossomos, ocasionando o que trissomia completa, quando todas as células do
chamamos de trissomias. indivíduo possuem uma cópia extra do cromossomo. A
trissomia em sua forma mosaica, por outro lado, ocorre
A trissomia do cromossomo 21 – Síndrome de Down – é quando algumas células possuem a cópia extra. Já a
a mais comum, e, apesar de resultar em anormalidades trissomia parcial resulta de uma cópia extra de metade
e déficits no desenvolvimento, não envolve grandes do cromossomo. Existe, ainda, a trissomia resultante
riscos à vida dos portadores. Por outro lado, a da translocação Robertsoniana, quando o cromossomo
trissomia de demais cromossomos geralmente resulta extra encontra-se ligado a outro cromossomo.
na inviabilidade do embrião.Descrita pela primeira vez
em 1656, a trissomia do cromossomo 13 – Síndrome
de Patau – leva a condições severas e é associada
a baixas taxas de sobrevivência. Malformações do
sistema nervoso central, defeitos no sistema cardíaco
e anormalidades renais são alguns dos efeitos desta
trissomia. Anatomicamente, microftalmia (redução do
bulbo ocular), polidactilia (maior número de dedos) e
CITOGENÉTICA

lábio leporino (abertura no céu da boca) podem ser


observados. Os tipos de trissomia do cromossomo 13: a trissomia
completa é a forma mais severa da síndrome.
Felizmente, a trissomia do cromossomo 13 é
extremamente rara, ocorrendo em aproximadamente Atualmente, o diagnóstico pré-natal da síndrome
1 a cada 12 mil nascidos vivos. As bases genéticas consiste em métodos ultrassônicos, bioquímicos e
desta trissomia foram descobertas apenas em 1960 citogenéticos. Entretanto, estes métodos ainda são
– três séculos após ter sido descrita pela primeira vez considerados insuficientes, uma vez que o diagnóstico
–, a partir de pesquisas realizadas pelo geneticista ocorre mais facilmente após o segundo trimestre da
Klaus Patau. Os fatores que levam à trissomia ainda gestação e principalmente após o parto, através da
não são completamente compreendidos, porém, assim observação de anormalidades anatômicas.
como a Síndrome de Down, a Síndrome de Patau está
relacionada à idade materna. Em busca de uma melhora neste quadro, diversas
pesquisas têm experimentado o desenvolvimento de
novos métodos de diagnose pré-natal. Um grupo de
pesquisadores americanos, por exemplo, pesquisa a
utilização do plasma materno para o sequenciamento
genético em busca desta e outras trissomias. Além de
ser pouco invasivo aos fetos, este tem se mostrado um
método bastante eficiente, detectando praticamente
todos os casos antes do segundo trimestre de gestação.
Além disso, o desenvolvimento de cirurgias de reparação
tem melhorado a vida dos poucos sobreviventes à
trissomia. Cirurgias cardíacas, maxilofaciais e plásticas
Natalia possui uma metade extra do cromossomo 13 –
podem melhorar o desempenho e a funcionalidade
condição conhecida como trissomia parcial do cromossomo 13. anatômica dos órgãos afetados, apesar de não resultar
em grandes melhoras na taxa de sobrevivência dos
Dentre as gestações corretamente diagnosticadas com pacientes. Apesar disto, a grande maioria dos indivíduos
a síndrome, menos de 20% conseguem ser levadas afetados por esta trissomia ainda apresentam
até o momento do parto. Menos de 10% dos nascidos características inviáveis à vida e, na maior parte dos
sobrevivem ao primeiro ano de vida, e a grande maioria casos (cerca de 98%) não sobrevivem à gestação ou ao
não sobrevive a mais que uma semana. Algumas parto.
dezenas de casos de sobrevivência foram reportados
em todo o mundo, sendo o mais famoso deles o da Fonte: Advances in Clinical and
ginasta Jenna Cole, que no ano passado completou Experimental Medicine e Genetics in Medicine.

48
SÍNDROME DE EDWARDS

A síndrome de Edwards, também conhecida


como trissomia 18, é uma síndrome genética
causada por uma trissomia do cromossomo 18.
Assim, como a síndrome de patau o indivíduo
também apresenta 47 cromossomos.

As características mais comuns são: estatura


elevada e magros, com braços relativamente
longos; pênis pequeno; testículos pouco
desenvolvidos; pouca pilosidade no púbis;
níveis elevados de LH e FSH, podem apresentar
uma diminuição no crescimento de barba;
ginecomastia (crescimento das mamas), devido
aos níveis de estrogênio (hormônio feminino)
Esta síndrome provoca atrasos no
mais elevados do que os de testosterona
desenvolvimento do feto, resultando em

CITOGENÉTICA
malformações graves como cabeça pequena, pés (hormônio masculino).
com sola arredondada e problemas cardíacos,
por exemplo, que não podem ser corrigidos e
que, por isso, impedem a sobrevivência do bebê.

MUTAÇÕES CROMOSSÔMICAS
NUMÉRICAS RELACIONADAS
AO SEXO

SÍNDROME DE KLINEFELTER

A síndrome de Klinefelter ocorre quando


uma pessoa do sexo masculino apresenta um
cromossomo X a mais. Por causa da presença
de um X a mais na genética sexual, a síndrome
de Klinefelter é, muitas vezes, designada como
síndrome 47 ou XXY.

Dos 46 cromossomos humanos, os dois


cromossomos sexuais determinam o sexo de
SÍNDROME DE TURNER
uma pessoa. Na grande maioria das vezes, a
síndrome de Klinefelter ocorre por causa de uma A síndrome de Turner é bastante rara e atinge
cópia extra do cromossomo X em cada célula apenas indivíduos de sexo feminino que só
(XXY). A maioria dos casos ocorre por erro na apresenta um cromossomos X ao invés de dois.
formação dos espermatozoides, na meiose I.

www.biologiatotal.com.br 49
Esta mutação difere das anteriores por apresentar
um cromossomo a menos no cariótipo,
chamaremos essa mutação cromossômica
numérica de monossomia. Esta síndrome se
caracteriza por apresentarem 45 cromossomos.
Geralmente o erro
na meiose é de
origem paterna.
Justamente por
possuir apenas
um cromossomo
X, essas mulheres
não formam SÍNDROME DO DUPLO Y
cromatina sexual
ou corpúsculo de A síndrome do duplo Y, como o nome já diz,
Barr. afeta homens que possuem duas cópias do
cromossomo Y. Possuem o cariótipo 47XYY.

Os sintomas são estatura elevada e mudanças


comportamentais, como por exemplo uma
tendência maior a desenvolver comportamentos
CITOGENÉTICA

violentos. Alguns estudos observaram que 3%


dos homens de um presídio apresentam esse
cromossomo Y a mais no seu cariótipo.

SÍNDROME DO TRIPLO X

Mulheres com cariótipo 47 XXX Elas


apresentam fenótipo normal, são férteis, mas
muitas possuem um leve retardamento mental.
Apresentam corpúsculo de Barr.

LEITURA COMPLEMENTAR
Nova técnica torna possível a reprodução em
indivíduos inférteis
Para auxiliar no tratamento da infertilidade humana, um camundongos e os animais que eram inférteis, após a
grupo de pesquisadores ingleses conseguiu desenvolver realização dos procedimentos, foram capazes de gerar
uma técnica capaz de eliminar um cromossomo extra descendentes saudáveis e férteis.
que impede a reprodução. A técnica já foi testada em

50
Nossos cromossomos X e Y são os grandes responsáveis A partir de estímulos químicos, os pesquisadores
pela determinação biológica do nosso sexo. fizeram com que essas células-tronco se
Normalmente, pessoas do sexo biológico masculino diferenciassem e se tornassem esperma. O esperma,
possuem 1 cromossomo X e 1 cromossomo Y (XY), quando injetado nos testículos dos camundongos,
enquanto que pessoas do sexo biológico feminino, foi capaz de se desenvolver, tornando-se esperma
possuem 2 cromossomos X (XX). Mas nem sempre é maduro. Este, foi coletado e utilizado em técnicas de
assim... Por conta de alterações durante a divisão celular, reprodução assistida, e o indivíduo foi capaz de gerar
1 em cada 500 homens nascem com um cromossomo descendentes saudáveis e férteis.
X ou Y extra, e por isso são portadores de um tipo de
síndrome. Se uma pessoa possui um cromossomo X a
mais (XXY), ele é portador da Síndrome de Klinefelter;
quando possui um cromossomo Y a mais (XYY), ele é
portador da Síndrome do Duplo Y. Estudar ambas as
síndromes, mostrou que uma das consequências dessa
alteração cromossômica numérica era a infertilidade.
Para auxiliar no tratamento da infertilidade humana,
um grupo de pesquisadores ingleses conseguiu
desenvolver uma técnica capaz de eliminar este
cromossomo extra que impede a fertilidade.
A pesquisa foi realizada a partir da retirada de
pequenas partes teciduais de orelhas de camundongos
que possuíam algum tipo de trissomia relacionada aos O experimento é preliminar e mais pesquisas serão
cromossomos sexuais: XXY ou XYY. Do tecido conjuntivo necessárias para saber se a técnica também funcionará
extraído, os pesquisadores retiraram fibroblastos, em humanos. Os pesquisadores ainda não conseguiram
que são células responsáveis principalmente pela produzir esperma maduro fora do corpo, e esta parte
síntese de colágeno e elastina (proteínas que dão do procedimento (ao injetar as células-tronco em um
firmeza e elasticidade à nossa pele). O procedimento hospedeiro) oferece risco de formação de tumores.

CITOGENÉTICA
consistiu em transformar os fibroblastos retirados em A redução desse risco, ou descoberta de uma nova
células-tronco que seriam capazes de se diferenciar maneira de produzir esperma maduro fora do corpo de
em esperma. Durante a aplicação da técnica, os um hospedeiro, é fundamental para que experimentos
pesquisadores perceberam que algumas das células possam ser realizados em humanos num futuro próximo.
modificadas perderam o cromossomo sexual extra, Fonte: Science.
responsável por causar a infertilidade.

ANOTAÇÕES

www.biologiatotal.com.br 51
a duplicação.

EXERCÍCIOS b
c
inversão.
deleção.
translocação.
d
e isocromossomo.

4 (PUCRJ 2010) Em um laboratório de citogenética, o


(PUCPR 2016) Algumas mutações genéticas, como a geneticista deparou-se com o idiograma obtido do
1 síndrome de Down, ocorrem quando um segmento de cariótipo de uma criança, mostrado a seguir:
um cromossomo se prende a outro cromossomo que
não é o seu homólogo. Assim, não necessariamente a
síndrome de Down é causada por uma trissomia livre
do cromossomo 21, mas também pode ser causada
pela situação descrita, que é uma:
a duplicação.
b translocação.
c deleção.
d inversão pericêntrica.
e inversão acêntrica. Observando-se esse idiograma, é CORRETO afirmar
que essa criança apresenta o fenótipo de:
a um menino com Síndrome de Klinefelter.
b uma menina com Síndrome de Klinefelter.
2 (UDESC 2015) Analise a figura que representa um c um menino com Síndrome de Down.
cariótipo humano.
d um menino com Síndrome de Turner.
EXERCÍCIOS

e uma menina com Síndrome de Turner.

5 (UFF 2007) O cariótipo humano é constituído pelo


conjunto completo dos cromossomos ordenados de
um indivíduo.
No exame pré-natal de um casal cuja futura mãe
tenha mais de 35 anos de idade e apresente casos de
doenças genéticas na família, o médico deve indicar
uma avaliação do cariótipo fetal.
A representação refere-se ao cariótipo de um(a):
a homem com a síndrome de Klinefelter.
b homem com a síndrome de Down.
c mulher normal.
d mulher com a síndrome de Klinefelter.
e homem com um número normal de cromossomos.

a
3 (UFJF-PISM 3 2015) Cientistas conseguiram,
b
pela primeira vez, “silenciar” a molécula de DNA
excedente, que caracteriza a Síndrome de Down. c
Num experimento com amostras de células, os d
pesquisadores inativaram uma das três cópias
do cromossomo 21, que caracteriza a anomalia, O cariótipo humano esquematizado é referente a um
tornando as células tratadas similares às de pessoas indivíduo com certas características apontadas em
típicas, com apenas duas cópias. uma das opções. Indique-a.
Disponível em: <http://www1.folha.uol.com.br/ a Normal e do sexo masculino
ciencia/2013/07/1312642-tecnica-
experimental-corrige-sindrome-de-down-em-celula.shtml>. b Com síndrome de Klinefelter e do sexo masculino
Acessado em 10/ago./2014. c Com síndrome de Down e do sexo masculino
Além da trissomia do cromossomo 21, a Síndrome d Com síndrome de Klinefelter e do sexo feminino
de Down também pode ocorrer por: e Com síndrome de Down e do sexo feminino

52
(UFPA 2016) A síndrome de Down consiste em um
6 (UFF 2008) Alguns indivíduos podem apresentar 9
conjunto de desordens físicas e mentais causadas
características específicas de Síndrome de Down sem
o comprometimento do sistema nervoso. Este fato se pela presença de um cromossomo 21 extra. Sobre
deve à presença de tecidos mosaicos, ou seja, tecidos esta e demais condições associadas, avalie o que se
que apresentam células com um número normal de afirma a seguir:
cromossomos e outras células com um cromossomo
a mais em um dos pares (trissomia). Este fato é I. Nesta síndrome, ocorrem alterações no número de
devido a uma falha no mecanismo de divisão celular cromossomos, sem que ocorram necessariamente
denominada de não-disjunção. alterações estruturais nas moléculas de DNA da
Assinale a alternativa que identifica a fase da divisão célula.
celular em que esta falha ocorreu.
a anáfase II da meiose
II. Alterações deste tipo são classificadas como
b anáfase I da meiose
aneuploidias. No caso da síndrome de Down está
c anáfase da mitose correto afirmar que a fórmula cariotípica dos
d metáfase da mitose indivíduos afetados é 2n+1.
e metáfase II da meiose III. A causa para a ocorrência da maioria das
aneuploidias é a não disjunção (não segregação) de
cromossomos no curso da meiose.
IV. A incidência de síndrome de Down está relacionada
7 (UEPA 2014) Pela primeira vez, cientistas conseguiram com a idade materna: mães com idade mais elevada
identificar uma maneira de neutralizar a alteração
genética responsável pela Síndrome de Down. Em um têm risco maior de darem à luz crianças com a
estudo feito com células de cultura, pesquisadores síndrome.
da Universidade de Massachusetts, Estados Unidos, Está correto o que se afirma em:
“desligaram” o cromossomo extra, presente nas células a I, II e IV, apenas.
de pessoas com o distúrbio. Assim, eles foram capazes b I, II e III, apenas.
de corrigir padrões anormais de crescimento celular, c II, III e IV, apenas.
característicos da Síndrome de Down. A descoberta abre d I, III e IV, apenas.

EXERCÍCIOS
portas para o desenvolvimento de novos mecanismos e I, II, III e IV.
que poderão ajudar no tratamento do distúrbio.
Adaptado de: http://veja.abril.com.br/noticia/ciencia/
cientistasdesligam-gene-que-causa-a-sindrome-de-down

Sobre a alteração cromossômica referida no texto,


afirma-se que:
a o cariótipo de mulheres com a síndrome é representado
por 45,X.
b o cariótipo de homens com a síndrome é representado
por 47,XXY. 10 (ACAFE 2015) Recentemente foi noticiado que
cientistas conseguiram “silenciar” cromossomo extra
c trata-se de uma monossomia do cromossomo sexual Y. responsável pela síndrome de Down. A inserção de um
d trata-se de uma trissomia do cromossomo 21. gene pode “calar” a cópia extra do cromossomo 21,
e os portadores da síndrome são altos e apresentam que causa a síndrome de Down, segundo um estudo
ginecomastia e azoospermia.
publicado na revista Nature. O método pode ajudar
pesquisadores a identificar os caminhos celulares
por trás dos sintomas como deficiência cognitiva e
8 (PUCRJ 2007) Existem algumas pessoas chamadas
especiais porque possuem uma série de características desenvolver tratamentos direcionados. A pesquisa foi
diferentes da maioria da população. Entre essas, feita com células-tronco em laboratório.
estão aquelas que possuem a ‘Síndrome de Down’,
também conhecida como Mongolismo. Em relação a “A correção genética de centenas de genes em todo
essa síndrome, podemos afirmar que: um cromossomo extra se manteve fora do reino da
possibilidade [ate agora]. Nossa esperança e que
a é uma anomalia genética, causada pela presença de 3
cromossomos 21 e transmitida sempre pela mãe. para as pessoas que vivem com a síndrome de Down,
b é uma anomalia congênita, causada pela presença de 3 esta primeira prova abra várias novas possibilidades
cromossomos 21 e transmitida sempre pela mãe. excitantes para estudar a síndrome, e traga para a
c é uma anomalia genética, causada pela presença de consideração a terapia cromossômica”, diz Jeanne
3 cromossomos 21 e transmitida por qualquer um dos Lawrence, uma bióloga celular da Escola de Medicina
pais.
da Universidade de Massachusetts, nos EUA, principal
d é uma anomalia congênita, causada pela ausência de
um cromossomo sexual X ou Y. autora do estudo.
e é uma anomalia genética, causada pela translocação Fonte: Ciência Hoje, 17/07/2013
de um dos cromossomos 21 para um 22. Disponível em: http://noticias.uol.com.br/ciencia

www.biologiatotal.com.br 53
Acerca das informaçõees acima e dos conhecimentos toda a coleção de cromossomos com a formação de
relacionados ao tema, assinale a alternativa correta. células n, 3n, 4n e sucessivamente.
a Quando há um aumento ou diminuição de um par de
IV. A síndrome de Down é um tipo de mutação
cromossomos, denominamos aneuploidia, podendo ser
autossômica, como a Síndrome de Down, ou sexual, cromossômica estrutural em que ocorre a trissomia
como a Síndrome de Patau. do cromossomo 21; a síndrome do Cri du Chat é um
b Crianças portadoras da Síndrome de Down têm 47 exemplo de mutação cromossômica numérica que
cromossomos, pois têm três cromossomos 21, ao invés ocorre na ausência de um fragmento do braço curto
de dois. Esta cópia extra de cromossomo expressará no
organismo algumas características físicas específicas. do cromossomo 5.
Porém, o problema de saúde e de aprendizado
provocado por essa trissomia varia de acordo com Assinale a alternativa correta.
a genética familiar da criança e fatores ambientais, a Somente as afirmativas III e IV são verdadeiras.
dentre outros. b Somente as afirmativas II e IV são verdadeiras.
c O fator cromossômico causador da Síndrome de Down c
e a não-disjunção mitótica, podendo ocorrer tanto na Somente as afirmativas I, II e III são verdadeiras.
primeira quanto na segunda divisão. Quando acontece d Somente as afirmativas I, II e IV são verdadeiras.
na primeira divisão, todos os gametas apresentam e Somente as afirmativas I e III são verdadeiras.
alteração numérica. Porém, quando ocorre na segunda
divisão, teremos metade dos gametas normais e a
outra metade com alteração numérica.
d Processo semelhante ao utilizado pelos cientistas para
inativar o cromossomo 21 extra ocorre naturalmente 13 (UFRGS 2007) Na novela Páginas da Vida, um dos
com um dos cromossomos X da mulher. O cromossomo temas tratados foi o nascimento de uma criança com
X inativado é sempre o que apresenta genes que síndrome de Down. Trata-se de uma menina gêmea
determinam doenças genéticas, mecanismo este de um menino que não apresenta a síndrome.
chamado de compensação de dose.
Com base nessas informações, considere as
afirmações a seguir.
I - Esses gêmeos são dizigóticos.
11 (UFRGS 2014) Em julho de 2013, pesquisadores da
Universidade de Massachusetts publicaram artigo,
II - A síndrome de Down é uma aneuploidia sexual.
demonstrando ser possível desligar o cromossomo 21 III - A síndrome dessa menina pode ser decorrente de
EXERCÍCIOS

extra, responsável pela Síndrome de Down. Os autores um erro durante a meiose I ou II.
mimetizaram o processo natural de desligamento Quais estão corretas?
cromossômico conhecido para mamíferos.
a Apenas I.
Assinale com V (verdadeiro) ou F (falso) as afirmações b Apenas II.
abaixo, referentes a esse processo natural. c Apenas III.
( ) O desligamento cromossômico ocorre em fêmeas. d Apenas I e III.
( ) O cromossomo desligado naturalmente é o X. e Apenas II e III.
( ) O corpúsculo de Barr corresponde a um autossomo
específico de fêmeas.
( ) O desligamento cromossômico ocorre a partir da 14 (UFSC 2009) Aproximadamente uma a cada 600
puberdade. crianças nasce com síndrome de Down, pois anomalias
A sequência correta de preenchimento dos parênteses, cromossômicas são frequentes na população. Na
grande maioria dos casos, isso se deve à presença
de cima para baixo, é de um cromossomo 21 extranumerário. Quando bem
a V – V – F – F. assistidas, pessoas com síndrome de Down alcançam
b V – F – V – F. importantes marcos no desenvolvimento e podem
c F – V – V – F. estudar, trabalhar e ter uma vida semelhante à dos
demais cidadãos.Sobre as anomalias no número de
d F – F – V – V.
cromossomos, é CORRETO afirmar que:
e V – F – F – V.
01 ocorrem ao acaso, sempre devido a um erro na
ovulogênese.
02 podem acontecer devido a erros na transcrição do RNA.
12 (UDESC 2012) Analise as proposições abaixo, em 04 podem ocorrer tanto na espermatogênese quanto na
relação às mutações: ovulogênese.
I. As mutações gênicas são alterações na sequência 08 ocorrem mais em meninas do que em meninos.
dos nucleotídeos do material genético. 16 ocorrem somente em filhos e filhas de mulheres que
dão à luz em idade avançada.
II. As mutações cromossômicas numéricas são aquelas 32 ocorrem preferencialmente em populações de menor
que não modificam a quantidade de cromossomos de renda, com menor escolaridade e pouca assistência
médica.
uma célula e sim a estrutura do cromossomo.
64 estão intimamente ligadas à separação incorreta dos
III. As euploidias são casos de mutações cromossomos na meiose.
cromossômicas, ocorrendo redução ou aumento em

54
(UFPR 2013) Na síndrome de Down, geralmente
17
ocorre uma trissomia do cromossomo 21, ou seja,
a pessoa apresenta três cópias (cromátides) desse
cromossomo, ao invés de apenas duas. Na maioria
dos casos de síndrome de Down, a terceira cópia do
cromossomo 21 é originada devido a um erro durante
15 (UFSC 2007) As anomalias cromossômicas são
bastante frequentes na população humana; um
a formação dos gametas do pai ou da mãe. Que tipo
exemplo disso é que aproximadamente uma a cada de erro, durante a formação dos gametas do pai ou da
600 crianças no mundo nasce com síndrome de Down. mãe do portador de síndrome de Down, leva a uma
Na grande maioria dos casos, isso se deve à presença trissomia como essa?
de um cromossomo 21 extranumerário. Quando bem
assistidas, pessoas com síndrome de Down alcançam
importantes marcos no desenvolvimento e podem
estudar, trabalhar e ter uma vida semelhante à dos
demais cidadãos.
Sobre as anomalias do número de cromossomos, é
CORRETO afirmar que:
01 podem ocorrer tanto na espermatogênese quanto na
ovulogênese.
02 ocorrem mais em meninas do que em meninos.
18 (UNICAMP 2008) A síndrome de Down, também
04 ocorrem somente em filhos e filhas de mulheres de chamada trissomia do cromossomo 21, afeta cerca de
idade avançada.
0,2% dos recém-nascidos. A síndrome é causada pela
08 estão intimamente ligadas à separação incorreta dos presença de um cromossomo 21 a mais nas células
cromossomos na meiose.
16 ocorrem ao acaso, devido a um erro na gametogênese. dos afetados, isto é, em vez de dois cromossomos 21,
32 ocorrem preferencialmente em populações de menor
a pessoa tem três. A trissomia do cromossomo 21 é
renda, com menor escolaridade e pouca assistência originada durante as anáfases I ou II da meiose.
médica. a Quando ocorre a meiose? Cite um evento que só ocorre

EXERCÍCIOS
64 podem acontecer devido a erros na duplicação do DNA. na meiose.
b Explique os processos que ocorrem na anáfase I e na
anáfase II que levam à formação de células com três
cromossomos 21.
16 (FAC. SANTA MARCELINA - MEDICINA 2016) 21 de
março é o Dia Internacional da Síndrome de Down
A data foi instituída pela Organização das Nações
Unidas (ONU) em 2006 e faz alusão ao fato de
as pessoas com Síndrome de Down possuírem 3
cromossomos no par 21. Segundo o Ministério da
Saúde, no Brasil, de cada 600 a 800 nascimentos, um
é de portador da Síndrome de Down.
(www.planetaeducacao.com.br. Adaptado.)

Considerando um casal cromossomicamente normal,


(UFRJ 2006) Ao analisar o cariótipo de células obtidas
explique: 19
de uma criança com síndrome de Down, observou-se
a o evento que, na formação dos gametócitos secundários que 70% das células apresentavam 47 cromossomos,
do pai ou da mãe, poderia levar à formação de uma
criança com Síndrome de Down. por exibirem a trissomia do cromossomo 21, e que
b como, ainda que os gametas produzidos pelos pais 30% das células apresentavam um cariótipo normal,
sejam cromossomicamente normais, o zigoto formado ou seja, 46 cromossomos, sem trissomia do 21.
possa dar origem a uma criança com Síndrome de
Down. Responda se o fenômeno da não-disjunção do par de
cromossomos 21 ocorreu antes ou depois da formação
do zigoto. Justifique sua resposta.

www.biologiatotal.com.br 55
20 (UFU 2004) A ilustração adiante mostra o cariótipo
de um indivíduo do sexo masculino com Síndrome de
Down. QUESTÃO BAGA
Cerca de 5% dos indivíduos com síndrome de Down
têm uma translocação cromossômica na qual a terceira
cópia do cromossomo 21 está ligada ao cromossomo
14. Caso essa translocação tenha ocorrido na gônada
de um dos pais, como ela poderia levar a à síndrome de
Down na criança?

Adaptado de Amabis, J. M e Martho, G. R.


“Biologia das células”. São Paulo: Moderna. 2002.

a Qual é a aneuploidia existente na Síndrome de Down?


b Quais são os mecanismos responsáveis pelo
aparecimento desta aneuploidia?
c Qual é a relação existente entre idade materna e a
Síndrome de Down?
EXERCÍCIOS

ANOTAÇÕES

56
GABARITO DJOW
ANOMALIAS CROMOSSÔMICAS
A inativação de um dos cromossomos X de fêmeas levaria a
1 - [B] uma compensação de dose, já que assim machos e fêmeas têm
A translocução dos cromossomos 14 e 21 ou 21 e 22 podem uma quantidade similar de produtos codificados pelos genes do
provocar a síndrome de Down. cromossomo X. A inativação de um X em fêmeas ocorre no início
RESPOSTA COMENTADA http://bit.ly/2pGW6S3 do desenvolvimento embrionário.
RESPOSTA COMENTADA http://bit.ly/2pGKtu9
2- [E]
O cariótipo apresentado revela os 23 pares de cromossomos de 12- [E]
um homem normal, contendo vinte e dois pares de autossomos, [I]. As mutações gênicas são aquelas que alteram o gene
um cromossomo X e um cromossomo Y. presente no material genético, como por exemplo, aumento,
RESPOSTA COMENTADA http://bit.ly/2pGWm3t diminuição ou troca de nucleotídeos.
[II]. As mutações cromossômicas alteram o número de
3 - [D] cromossomos em uma célula.
Além da trissomia do cromossomo 21, a Síndrome de Down [III]. As euploidias alteram o número em toda coleção de
também pode ocorrer por translocações dos cromossomos 21 cromossomos de uma célula.
e 22 ou 14 e 21.
[IV]. A síndrome de Down é um tipo de mutação numérica, em
RESPOSTA COMENTADA http://bit.ly/2pGD3XU que há um cromossomo a mais, neste caso o cromossomo 21,
recebendo o nome de trissomia. A síndrome do Cri du Chat é
4- [A] uma mutação estrutural denominada deleção, onde parte do
O portador da síndrome de Klinefelter apresenta um cariótipo cromossomo 5.
com presença de um cromossomo sexual (alossomo) X a mais
RESPOSTA COMENTADA http://bit.ly/2pGGyh7
que um indivíduo normal (47,XXY). Desse modo o idiograma
desse indivíduo deve se apresentar com 47 cromossomos,

CITOGENÉTICA
13- [D]
sendo 44 autossomo, 2 alossomos X e um alossomo Y,
RESPOSTA COMENTADA http://bit.ly/2pGGu0E
apresentando o fenótipo masculino, porém, apresentando
algumas características sexuais secundárias femininas durante
14 - (04) + (64) = 68
a puberdade.
RESPOSTA COMENTADA http://bit.ly/2pGMHdb
RESPOSTA COMENTADA http://bit.ly/2pGEbe9
15 - 01 + 08 + 16 = 25
5 - [E] RESPOSTA COMENTADA http://bit.ly/2pGJL02
RESPOSTA COMENTADA http://bit.ly/2Gcdmnx
16 - a) O evento meiótico que ocorre nos gametócitos
6 - [C] secundários, do pai ou da mãe, que podem levar à formação
RESPOSTA COMENTADA http://bit.ly/2pGJytF de uma criança com Síndrome de Down é a não disjunção das
cromátides do cromossomo 21.
7- [D] b) Uma criança com Síndrome de Down pode ser formada, em
Os indivíduos portadores da Síndrome de Down possuem um cerca de 2% dos casos, por um mosaico de células originadas a
cromossomo 21 extra, apresentando uma trissomia autossômica. partir dos primeiros blastômeros formados a partir de um zigoto
RESPOSTA COMENTADA http://bit.ly/2pGHD8z 2N = 46, no qual ocorreu um erro por não disjunção mitótica das
cromátides-irmãs do cromossomo 21. Dessa forma, o indivíduo
8- [C] passa a possuir duas linhagens celulares: uma linhagem 2N= 46
RESPOSTA COMENTADA http://bit.ly/2pGGfmt e outra 2N=47.
RESPOSTA COMENTADA http://bit.ly/2pGVjk9
9 - [E]
Tosos os itens estão corretos e relacionados à Síndrome de 17 - A síndrome de Down, geralmente, é causada pela não
Down. disjunção das cromátides do cromossomo 21 durante a anáfase
RESPOSTA COMENTADA http://bit.ly/2pGUiZ4 II da meiose paterna ou materna.
RESPOSTA COMENTADA http://bit.ly/2pGEG82
10 - [B]
A síndrome de Patau é autossômica (trissomia do cromossomo 18- a) A meiose ocorre por ocasião da produção de gametas, nos
13). O fator causador de aneuploidias é a não disjunção meiótica. animais, e esporos, nos vegetais. A separação dos cromossomos
O cromossomo X inativo em mulheres normais é materno em homólogos é um processo exclusivo da meiose.
50% de suas células somáticas e 50%, paterno. b) Na anáfase I, o fenômeno da não-disjunção do par dos
RESPOSTA COMENTADA http://bit.ly/2pGP3sE
cromossomos 21 fará com que uma das células-filhas tenha
2 exemplares. No caso da anáfase II, a não-separação das
11 -[A] cromátides poderá levar à formação de gametas com 2
A cromatina sexual ou corpúsculo de Barr é o cromossomo X cromossomos 21.
que permanece inativo na interfase de fêmeas de mamíferos. RESPOSTA COMENTADA http://bit.ly/2pGJyKi

www.biologiatotal.com.br 57
19 - A não-disjunção foi pós-zigótica, decorrente de uma
divisão mitótica anômala. Se a não-disjunção tivesse ocorrido
antes da fecundação, o cariótipo anormal seria detectado em QUESTÃO BAGA
todas as células pesquisadas.
Na meiose, um cromossomo 14-21 combinado se
RESPOSTA COMENTADA http://bit.ly/2pGD7XH comportará como um cromossomo. Se um gameta recebe
o cromossomo 14-21combinado e uma cópia normal do
20- a) Trissomia do cromossomo 21. cromossomo 21, ocorrerá a trissomia 21 quando este
b) A síndrome de Down geralmente é causada pela não gameta combinar com um gameta normal durante a
disjunção cromossômica durante a gametogênese paterna ou fertilização.
materna. Pode ocorrer também por meio da translocação dos
cromossomos 14/21 ou 21/22.
c) O aumento da incidência da síndrome de Down é proporcional
ao aumento da idade materna no momento da gestação.
RESPOSTA COMENTADA http://bit.ly/2pGOoai

ANOTAÇÕES
CITOGENÉTICA

58
MEIOSE
Centríolo
Célula

Núcleo

Interfase
A meiose (sigla = R!) é um processo de divisão Duplicação dos
cromossomos
celular pelo qual uma célula diploide (2n) homólogos e
centríolos
origina quatro células haploides (n), reduzindo
à metade o número de cromossomos constante Início da

Leptóteno
separação dos
de uma espécie. Desta forma, a meiose somente centríolos

ocorre em células diploides e tem por objetivo


a formação de células reprodutivas. A meiose Fuso

Zigóteno
é dividida em duas etapas: a primeira divisão Formação do
fuso acromático e
acromático
em

meiótica (meiose I) e a segunda divisão meiótica emparelhamento formação


dos cromossomos
(meiose II).

Paquíteno
Prófase I
Tétrade
Na primeira etapa, também denominada ou
bivalente
reducional, ocorre a diminuição no número
de cromossomos. Na segunda, equacional, o

Diplóteno
número de cromossomos das células que se Quiasma

dividem é mantido igual aos das células que se


CITOGENÉTICA

formam.

Diacinese
Dependendo do grupo de organismos, a meiose Terminalização de
quiasmas
pode ocorrer em diferentes momentos do
ciclo de vida: na formação de gametas (meiose
Metafase I

gamética), na produção de esporos (meiose Terminalização de


quiasmas
espórica) e logo após a formação do zigoto
(meiose zigótica).
Anafase I

Separação dos
Seguem agora as fases da meiose o os principais cromossomos
análogos
eventos que ocorrem em cada etapa:
Telófase I

Citocinese
(divisão celular)

MEIOSE I
Duplicação dos
Prófase II

centríolos e
condensação dos
1. Prófase I → Principais eventos: cromossomos

Condensação dos cromossomos


Metafase II

Cromossomos
ligados ao fuso
Desaparecimento da carioteca

Desaparecimento do nucléolo
Anafase II

Separação dos
cromossomos
irmãos
Duplicação e migração dos centríolos para os
polos da célula.
Telófase II

Citocinese
(divisão
celular)
Esquema com todas as fases da mitose.

30
É uma fase muito extensa, constituída por 5 Momento em que ocorre o crossing-over, isto
subfases: é, troca de segmentos (permutação de genes)
entre cromossomos homólogos;
a) Leptóteno – inicia-se a individualização dos
cromossomos estabelecendo a condensação d) Diplóteno – começo da separação dos
(espiralização), com maior compactação dos homólogos, configurado de regiões quiasmas
cromonemas; (ponto de intercessão existente entre os braços
entrecruzados, portadores de características
b) Zigóteno – aproximação dos cromossomos similares);
homólogos, sendo esse denominado de sinapse;
e) Diacinese – finalização da prófase I,
c) Paquíteno – máximo grau de condensação com separação definitiva dos homólogos,
dos cromossomos na prófase I, os braços curtos já com segmentos trocados. A carioteca
e longos ficam mais evidentes e definidos, (envoltório membranoso nuclear) desaparece
dois desses braços, em respectivos homólogos, temporariamente.
se ligam formando estruturas denominadas
bivalentes ou tétrades.

CITOGENÉTICA
Crossing-over ou recombinação genética, fenômeno que acontece durante a meiose e garante a variabilidade genética das populações de espécies.

2. Metáfase I → os cromossomos ficam separação do centrômero (ponto de ligação


agrupados na região equatorial da célula, das cromátides irmãs em um cromossomo).
associados às fibras do fuso. Como principal
evento:

Pareamento dos cromossomos homólogos na 4. Telófase I → Principais eventos:


placa equatorial da célula.
Desespiralização dos cromossomos,
retornando ao aspecto filamentoso;

3. Anáfase I → Tem como principais eventos: Reaparecimento do nucléolo bem como da


carioteca;
Encurtamento das fibras do fuso;
Divisão do citoplasma (citocinese), originando
Separação dos cromossomos homólogos duas células haploides.
para os polos da célula. Nessa fase não há

www.biologiatotal.com.br 31
Normalmente, logo após a meiose I terminar, 3. Anáfase II → Principais eventos:
ocorre a citocinese I, resultando na separação
de duas células-filhas, que logo iniciam a meiose Separação das cromátides irmãs, puxadas
II. Nesse pequeno intervalo entre a meiose I e II, pelas fibras em direção a pólos opostos.
os centrossomos se duplicam em cada uma das
células-filhas recém-formadas.
4. Telófase II → Principais eventos:

MEIOSE II Reaparecimento da carioteca;

Reorganização do nucléolo;
1. Prófase II → Principais eventos:
Divisão do citoplasma completando a
Os cromossomos voltam a se condensar; divisão meiótica, totalizando 4 células filhas
haploides.
O nucléolo e a carioteca desaparecem
novamente; Ao final, a análise que deve ser feita é que o
produto final da meiose são células haploides,
Os centríolos se duplicam e se dirigem para ou seja, ocorre a redução da carga cromossômica
os polos, formando o fuso acromático. original da espécie.

O gráfico abaixo mostra a variação da


CITOGENÉTICA

quantidadede DNA em uma única célula durante


2. Metáfase II → Principais eventos: a meiose.

Os cromossomos se organizam no plano A meiose I é chamada de reducional, há redução


equatorial, com suas cromátides ainda unidas do número de cromossomos e da quantidade
pelo centrômero, ligando-se às fibras do fuso. de DNA. Já para o número de cromossomos
a meiose II é considerada equacional, porém
para a quantidade de DNA é reducional (pela
separação das cromátides irmãs).

Meiose I Meiose II
Interfase
G2 PI MI
4Q

S AI

G1 TI PII MII
2Q
2n n AII
TII
Q
n

0
Tempo

32
Na tabela a seguir você pode comparar as diferenças entre Mitose e Meiose.

CITOGENÉTICA

www.biologiatotal.com.br 33
LEITURA COMPLEMENTAR
Terapia anti-idade: método de alongamento de telômeros
Por mais que pintemos nossos cabelos e Parrish, utilizou a si mesma como organismo-
utilizemos tratamentos para manter a pele teste para um novo método de terapia de
livre de rugas, é inevitável: a idade chega rejuvenescimento. Em setembro de 2015, a
para todos! E mesmo que ela possa ser CEO teve amostras de suas células sanguíneas
disfarçada fisicamente, biologicamente não analisadas e recebeu, logo em seguida, as
temos como escapar. Pelo menos não por terapias gênicas para realongar os telômeros.
enquanto!
Para analisar os resultados das terapias, os
A cada momento, novas divisões são telômeros são analisados a partir dos linfócitos
realizadas por todas as células do nosso T das amostras sanguíneas, recebendo então
organismo, e, a cada uma dessas divisões uma “nota”, de acordo com seu tamanho.
celulares, nossos telômeros tornam-se mais Seis meses após a aplicação dos tratamentos,
curtos. Biologicamente falando, quanto mais novas amostras foram coletadas, e a análise
curtos forem os telômeros de um organismo, dos telômeros das células de Elizabeth
mais próximo do fim este organismo estará. demonstrou que, a princípio, as terapias
realmente funcionam!
CITOGENÉTICA

Imagem: Reinhard Stindl, Wikimedia Commons.

Imagem traduzida de: Universidade de Liège.

A cada nova divisão celular, os telômeros


Os telômeros (marcados em vermelho) tornam-se mais curtos. A nova terapia promete
protegem as extremidades dos cromossomos. realongar os telômeros envelhecidos.

Segundo os pesquisadores responsáveis, os


Os telômeros são segmentos de DNA telômeros, que possuíam 6.71kb em setembro
encontrados nas extremidades dos do ano passado, passaram a apresentar um
cromossomos e responsáveis por manter a tamanho médio de 7.33kb após as terapias,
estabilidade estrutural do material genético. o que representaria um rejuvenescimento
Ao final de cada divisão celular, os telômeros celular de aproximadamente 20 anos!
perdem partes de sua estrutura, até o Segundo a empresa, novas amostras serão
momento em que, após diversas divisões, coletadas e constantemente analisadas, para
estes se tornam pequenos demais para que os resultados possam ser realmente
protegerem os cromossomos. Quando isto confirmados.
acontece, as células perdem a sua função
ou morrem, encurtando o tempo de vida do Muito além das questões estéticas, o
organismo. rejuvenescimento celular pode ser utilizado
para combater doenças relacionadas ao
Por este motivo, estas estruturas envelhecimento humano, dentre elas o mal
sempre foram alvos de estudos contra o de Parkinson e de Alzheimer, doenças que
envelhecimento humano. Agora, A CEO até então não possuem cura e são de difícil
da empresa americana BioViva, Elizabeth tratamento.

34
A princípio, o tratamento é efetivo apenas tecidos e órgãos, este pode tornar-se um real
quando utilizado em células sanguíneas. tratamento contra o envelhecimento celular!
Porém, caso novos estudos resultem no Fonte: BioViva Inc.
desenvolvimento de terapias para os demais

ANOTAÇÕES

EXERCÍCIOS

www.biologiatotal.com.br 35
EXERCÍCIOS 2 (PUCSP 2016) Nos esquemas abaixo temos a
representação de um cromossomo em duas fases
CAIU NA PUCRJ- 2017 sequenciais (A e B) da divisão celular:
Sobre os processos de divisão celular (meiose e mitose),
verifica-se que: :
a na anáfase (mitose), ocorre a separação das cromátides
irmãs, enquanto na anáfase I (meiose) ocorre a separação
dos cromossomos homólogos.
b ao final do processo meiótico, uma célula de conjunto
cromossômico 2n gera duas células-filhas de conjunto
cromossômico n.
c ao final do processo mitótico, uma célula de conjunto As fases A e B em questão são observadas
cromossômico 2n gera duas células-filhas de conjunto
cromossômico n. a exclusivamente na mitose.
d tanto a meiose quanto a mitose geram variação genética. b exclusivamente na meiose.
e o crossing-over ocorre na metáfase I. c na mitose e na primeira divisão da meiose.
d na mitose e na segunda divisão da meiose.

CAIU NA UERJ - 2017


3 (FGV 2015)As figuras ilustram o processo de crossing-
Considere um animal que possui oito cromossomos over, que ocorre na prófase I da meiose.
em suas células diploides. Nos esquemas A e B, estão
representadas duas células desse animal em processo
de divisão celular.
EXERCÍCIOS

Com base nos esquemas, são identificados os seguintes


O aumento da variabilidade genética, gerada por esse
tipos de divisão celular em A e B, respectivamente:
processo, ocorre em função da permuta de
a meiose e mitose
a alelos entre cromátides irmãs.
b mitose e meiose
b alelos entre cromátides homólogas.
c mitose e mitose c não alelos entre cromossomos homólogos.
d meiose e meiose d não alelos entre cromátides irmãs.
e não alelos entre cromossomos não homólogos.

4 (CFTMG 2014) Por intermédio das divisões celulares,


os animais são capazes de produzir gametas (meiose),
de crescer e regenerar tecidos lesionados (mitose).
A diferença fundamental entre essas divisões é que
apenas na meiose ocorre
1 (FAC. SANTA MARCELINA - MEDICINA 2017) A figura a formação do fuso acromático.
representa uma célula animal em uma fase da meiose. b duplicação do material genético.
c segregação de cromossomos homólogos.
d espiralização do DNA ao redor de proteínas.

5 (UFRGS 2014) Observe o desenho abaixo, refere-se a uma


célula

a
Qual fase da meiose está representada na figura?
a anáfase I b
c
b anáfase II
c prófase II d
d metáfase II e

36
a germinativa em metáfase I. a Metáfase da Mitose.
b somática em prófase. b Anáfase da Mitose.
c germinativa em prófase II. c Anáfase I da Meiose.
d somática em metáfase. d Metáfase II da Meiose.
e germinativa em anáfase II. e Anáfase II da Meiose.

6 (CEFET MG 2014) Analise o processo de divisão (UDESC 2012) Assinale a alternativa correta quanto à
9
celular representado de forma simplificada. característica da meiose.
a Quando sofre mutações, estas são do tipo somáticas e
induzem a célula à apoptose.
b Garante a manutenção das características genéticas ao
longo dos anos.
c Garante a variabilidade genética da espécie, através do
crossing over.
d Reduz as características genéticas do indivíduo pela
metade, ou seja, incompletas.
e Reduz as características da célula, por isso requer uma
nova duplicação do material genético.

10 (FGV 2013) Observe a figura que ilustra uma célula


em determinada etapa de um processo de divisão
A diferença numérica de cromossomos entre o início e celular.
o fim desse processo objetiva
a manter a ploidia da espécie.
b impedir o surgimento de trissomias.
c diminuir o tempo do próximo ciclo celular.
d facilitar a duplicação do material genético.

EXERCÍCIOS
e favorecer a eliminação de genes indesejáveis.

7 (UFSM 2013) Ao observar a produção de vinho


em uma vinícola, um grupo de turistas percebeu Sendo 2n o número diploide de cromossomos, é
que vários tipos de uvas eram utilizados para fazer correto afirmar que tal célula encontra-se em anáfase
o vinho. Esses tipos ocorrem devido também à da mitose de uma célula-mãe
reprodução sexuada. a 2n = 8, ou anáfase I da meiose de uma célula-mãe 2n = 8.
A divisão celular meiótica garante o aumento da b 2n = 16, ou anáfase II da meiose de uma célula-mãe 2n = 8.
variabilidade genética através do(a) c 2n = 4, ou anáfase I da meiose de uma célula-mãe 2n = 8.
d 2n = 8, ou anáfase II da meiose de uma célula-mãe 2n = 16.
a pareamento dos cromossomos homólogos durante a
prófase I. e 2n = 4, ou anáfase II da meiose de uma célula-mãe 2n = 8.
b terminalização dos quiasmas na diacinese.
c permuta que ocorre entre cromátides não irmãs no
paquíteno.
d formação das tétrades na telófase II.
e formação do complexo sinaptonêmico no zigóteno.

(IFSP 2013) Após uma aula sobre divisão celular, em


8
células eucariontes, o professor projeta a imagem de
11 (Unicamp 2017) Considerando o esquema a seguir
como uma representação simplificada da meiose,
uma célula 2n=4, que representa uma das etapas indique a alternativa correta.
estudadas, e pergunta a seus alunos qual fase e
divisão celular estão sendo representadas.
Observe a imagem da representação projetada e
assinale, das alternativas abaixo, qual a resposta
correta para a questão proposta pelo professor.

a A, B, D e F são diploides.
b B, C, D e E são formados na telófase I.
c A, B, D e G são células idênticas quanto ao seu material
genético.
d B, C, D e I são haploides.

www.biologiatotal.com.br 37
12 (UFRGS 2016) Os diagramas abaixo se referem a 35%
a células em diferentes fases da meiose de um b 12,5%
determinado animal. c 50%
d 6,25%
e 100%

16 (UEPB 2012) Leia atentamente as proposições abaixo


acerca do ciclo celular e, em seguida, assinale a
Os diagramas 1, 2 e 3 correspondem, respectivamente, a
alternativa correta.
a prófase I, metáfase I e telófase II.
b a Raramente, durante a telófase, ambas as cromátides de um
prófase II, anáfase I e telófase I. cromossomo podem migrar juntas para o mesmo polo celular
c prófase I, metáfase II e anáfase II. — é a não disjunção cromossômica, que leva a um erro na
d prófase II, anáfase II e telófase I. distribuição dos cromossomos: uma das células-filhas fica
com um cromossomo a mais e a outra, com um cromossomo
e prófase I, anáfase I e metáfase II.
a menos. As duas situações são denominadas aneuploidias.
b O ciclo celular está divido em duas etapas: divisão celular,
período que compreende a mitose e a citocinese, e interfase,
13 (IMED 2016) Suponha que uma determinada espécie período compreendido entre duas divisões celulares
de tartaruga possua 550 cromossomos no núcleo de consecutivas, sendo este o período de menor duração total
uma célula do coração. Podemos supor, então, que do ciclo celular de células que se multiplicam ativamente.
quando essa célula entrar em mitose, serão geradas c Durante a metáfase, os cromossomos duplicados são
_____ células __________ que apresentam _____ deslocados para a região equatorial da célula. Prossegue
o processo de condensação cromossômica, que atingirá o
cromossomos cada. Já, caso uma célula do sistema nível máximo na anáfase, período em que também ocorre a
reprodutor dessa tartaruga realize meiose, esse separação dos centrômeros e a consequente separação das
processo gerará células __________ com _____ cromátides-irmãs.
cromossomos. d A interfase é subdividida em três fases: G1, que antecede a
duplicação do DNA cromossômico; S, período em que ocorre
Assinale a alternativa que preenche, correta e a duplicação do DNA cromossômico; G2, período que sucede
EXERCÍCIOS

a duplicação cromossômica. Células que se dividem com


respectivamente, as lacunas do trecho acima. pouca frequência podem entrar em uma fase denominada
a 02 – somáticas – 550 – somáticas – 275 G0: seu metabolismo continua normal, mas a divisão celular
b 04 – sexuais – 275 – somáticas – 550 é bloqueada; em determinadas situações, a célula pode ser
estimulada a reingressar na fase G1 e volta a se dividir.
c 02 – somáticas – 550 – sexuais – 275
e O paquíteno é a segunda subfase da prófase 1, na meiose
d 02 – diploides – 275 – haploides – 275 1. Nesta subfase, ocorre o fenômeno da permutação ou
e 04 – diploides – 04 – sexuais – 225 crossing-over, que tem importante significado biológico, pois
a troca de fragmentos entre cromátides homólogas permite
o rearranjo dos genes, o que leva a uma maior variedade de
gametas formados por um indivíduo.
14 (IFSUL 2015) Todas as células vegetais e animais
apresentam um processo de reprodução chamado
de mitose e outro processo de reprodução chamado
de meiose. Esses processos diferenciam-se quanto ao
tipo de células envolvidas, tais como células epiteliais, 17 (UFPA 2012) Os processos celulares estão interligados
de tal forma que cada organela, cada componente
musculares, gametas, etc. do citoquesqueleto e o citosol encontram-se direta
ou indiretamente vinculados a eventos fisiológicos
A afirmativa que relata corretamente o processo que celulares. Uma forma de correlação fisiológica direta,
envolve a formação das últimas células referidas entre membrana, citoplasma e núcleo, está indicada na
acima é a que propõe que uma célula alternativa:
a diploide (2n) forma duas células haploides (n). A duplicação dos centríolos direciona a mobilização
b haploide (2n) forma quatro células haploides (n). dos microtúbulos e consequente redistribuição de
c a
diploide (2n) forma quatro células haploides (n). organelas para futuras células filhas.
d haploide (2n) forma quatro células haploides (n). Fagocitose de bactérias resulta na formação de
um fagolisossomo, o qual transporta, durante a
b digestão, moléculas básicas ao citosol que podem ser
15 (UDESC 2015) Sabendo-se que durante a meiose direcionadas às atividades das demais organelas, como
ocorre a separação dos cromossomos homólogos
lipídios, aminoácidos, monossacarídeos e nucleotídeos.
(cromossomos com mesma forma e tamanho, sendo
um paterno e outro materno), considere então apenas A exocitose pode ser observada tanto na liberação de
quatro pares destes cromossomos homólogos em uma enzimas de digestão extracelular, como na liberação
c de neurotransmissores dentro de uma fenda sináptica.
espermatogônia que inicia a meiose. A possibilidade
Ambos os processos necessitam de sinais extracelulares
de um indivíduo formar um espermatozoide que para ocorrer.
possua apenas cromossomos de origem paterna é de:

38
d O bloqueio da difusão de O2 para dentro da célula
afeta a respiração celular, o que leva ao declínio
comprometedor das atividades mitocondriais e induz
morte celular programada.
e Receptores de superfície induzem reações enzimáticas
em cascata que resultam na fosforilação de proteínas
de membrana nuclear e desintegração desta, o que
marca o início do processo de divisão celular.
21 (ULBRA 2016) Uma das atividades desempenhadas
pela célula é a divisão. A divisão celular é fundamental
para o crescimento dos organismos multicelulares e,
18 (COL. NAVAL 2015) No nosso corpo ocorrem dois tipos de
divisão celular: a mitose, nas células do corpo em geral, e a
também, a base da reprodução. A mitose e a meiose
são os dois tipos de divisão de células eucarióticas.
meiose, nas células germinativas. Com relação à mitose e à
meiose no corpo humano, é correto afirmar que Analise as afirmativas abaixo:
na mitose, a partir de células iniciais com 46 I. Na mitose, as duas células-filhas resultantes da
a cromossomos, formam-se células com a metade do
número de cromossomos. divisão são idênticas entre si e à célula parental.
a mitose é a divisão celular que forma os II. Na anáfase mitótica, os cromossomos homólogos
b espermatozoides e os óvulos.
são separados e movidos em direção aos polos
na meiose, a partir de células iniciais com 46
c
cromossomos, formam-se células com 23 cromossomos. opostos da célula.

d
a meiose é a divisão celular que permite o crescimento III. Na prófase I meiótica, ocorre recombinação de
dos organismos e a substituição das células que material genético entre cromossomos pareados.
envelhecem e morrem.
tanto na mitose quanto na meiose ocorre perda de IV. Na anáfase I da meiose, as cromátides-irmãs
e cromossomos durante a divisão celular. migram para os polos opostos da célula.
Está(ão) correta(s):
a I e III.
19 (UPF 2013) As figuras abaixo mostram, de forma

EXERCÍCIOS
b I, III e IV.
esquemática, células de um mesmo organismo em
c Somente a I.
diferentes fases da mitose ou da meiose I. As células
somáticas desse indivíduo apresentam número d III e IV.
cromossômico 2n=6. Identifique em que fase da divisão e II e IV.
celular se encontram as células representadas nas
figuras 1 a 5, respectivamente:

22 (FAC. ALBERT EINSTEIN - MEDICINA 2016) O gráfico


abaixo refere-se ao processo de divisão celular que
ocorre durante a espermatogênese humana:

a metáfase, telófase I, prófase, metáfase I, telófase.


b metáfase I, anáfase, prófase I, metáfase, anáfase I.
c metáfase, anáfase I, prófase, metáfase I, anáfase.
d prófase I, anáfase I, metáfase, prófase I, anáfase.
e prófase, anáfase, metáfase I, prófase, anáfase I.

(PUCPR 2015) Sobre a divisão celular, considerando a


20
prófase I da Meiose I, é CORRETO dizer que:
a a característica mais marcante do diplóteno é que os Nesse processo de divisão ocorre
cromossomos ainda emparelhados se cruzam em certos a duplicação dos cromossomos nos intervalos I e II e
pontos chamados quiasmas. as fases que caracterizam esse processo ocorrem nos
b no paquíteno ocorre o afastamento dos cromossomos intervalos III, IV, V e VI.
homólogos e os cromômeros são bem visíveis formando b duplicação dos cromossomos nos intervalos II e III e
as cromátides-irmãs. as fases que caracterizam esse processo ocorrem nos
c no leptóteno, o emparelhamento dos cromossomos é intervalos IV, V e VI.
chamado de sinapse cromossômica. c separação de cromátides-irmãs, levando à formação
d na diacinese, as cromátides permanecem no centro de células com 23 cromossomos simples ao final do
celular, a carioteca se refaz, os nucléolos reaparecem e os intervalo IV e maturação dos espermatozoides nos
centríolos atingem os polos celulares. intervalos V e VI.
e a prófase I é uma fase curta em que os centríolos que não d separação de cromossomos homólogos no intervalo IV
sofreram duplicação na interfase permanecem no centro e separação de cromátides-irmãs no intervalo VI.
celular e a carioteca se desintegra ao final dessa fase.

www.biologiatotal.com.br 39
(UFPA 2016) O gráfico a seguir representa variações (PUCRJ 2015) Considere as afirmações relativas à
23 na quantidade de DNA ao longo do ciclo de vida de 25 mitose.
uma célula. (X= unidade arbitrária de DNA por célula).
I. O nucléolo começa a desaparecer na prófase.
II. Os núcleos filhos são geneticamente idênticos ao
núcleo dos pais.
III. As cromátides irmãs se separam no início da anáfase.
IV. Cromossomos homólogos fazem sinapse na prófase.
V. Um único núcleo dá origem a dois núcleos-filhos
Sobre esse ciclo vital de uma célula, representado no idênticos.
gráfico, é correto afirmar: Estão corretas:
a A interfase está representada pela fase 3. a Apenas I, II, IV, V.
b Apenas I, II, III, V.
b As fases 1, 2 e 3 representam os períodos G1, S e G2,
que resumem todo o ciclo vital de uma célula. c Apenas II, III, IV, V.
c As fases 1, 2 e 3 representam o período em que a d Apenas I, II, V.
célula se encontra em interfase, e as fases 4, 5, 6 e 7 e Todas as afirmações.
subsequentes são características da célula em divisão
mitótica, quando, ao final, ocorre redução à metade da
quantidade de DNA na célula.
d A célula representada é diploide: seu DNA foi duplicado
no período S da interfase (fase 2) e, posteriormente,
passou pelas duas fases da meiose, originando células- 26 (UDESC 2015) As células em geral são estimuladas a
filhas com metade da quantidade de DNA (fase 7, se dividirem quando atingem um determinado tamanho,
células haploides). assim como por substâncias denominadas de fatores
e A fase 3 é caracterizada por um período em que não de crescimento celular, passando pelo chamado Ciclo
há variação na quantidade de DNA na célula, portanto Celular, que é subdivido em três fases: G1 – S – G2.
essa fase representa uma célula durante os períodos da
EXERCÍCIOS

mitose: prófase, metáfase e anáfase. Analise as proposições em relação ao ciclo celular, e


assinale (V) para verdadeira e (F) para falsa.
I. Na fase S ocorre a duplicação do DNA.
24 (UEPA 2015) O crescimento populacional humano II. Na fase G2 ocorre o pareamento dos cromossomos
é produto da reprodução sem controle, que agrava homólogos.
os problemas de superpopulação mundial. Por outro
lado, a reprodução nos organismos unicelulares ocorre III. Na fase G1 todo o DNA está altamente condensado.
por divisão celular, enquanto que nos organismos IV. Na fase S só ocorre em células que entram em mitose.
multicelulares esse processo é responsável pelo
crescimento e reparo de tecidos. V. Na fase G1 e na G2 as células apresentam a mesma
quantidade de DNA.
Sobre o processo em destaque, analise as afirmativas
abaixo. Assinale a alternativa correta, de cima para baixo.
a F - F- V - V - F
I. A prófase I da meiose I possui cinco subfases: leptóteno, b V-V-F-F-F
zigóteno, paquíteno, diplóteno e diacinese. c V-F-F-F-F
II. Na telófase os cromossomos começam a se d F-V-V-F-F
desespiralizar e adquirem a forma de fita. e F-F-F-V-V

III. Na anáfase ocorre a separação das cromátides.


IV. Na meiose I, a metáfase I se caracteriza pelo
alinhamento dos pares homólogos na placa equatorial. 27 (UECE 2014) Considere os eventos abaixo, que
podem ocorrer na mitose ou na meiose.
V. O produto da meiose são quatro células haploides. I. Emparelhamento dos cromossomos homólogos
A alternativa que contém todas as afirmativas corretas é: duplicados.
a I, II e IV II. Alinhamento dos cromossomos no plano equatorial
b I, III e V da célula.
c II, III e V
d III, IV e V III. Permutação de segmentos entre cromossomos
e I, II, III, IV e V homólogos.
IV. Divisão dos centrômeros, resultando na separação
das cromátides irmãs.

40
No processo de multiplicação celular para reparação IV. A figura 2 corresponde a metáfase I da meiose, em
de tecidos, os eventos relacionados à distribuição que os cromossomos se alinham na região equatorial
equitativa do material genético entre as células da célula.
resultantes estão contidos somente em
V. Durante a fase da figura 1, em que os cromossomos
a I e III.
tornam-se mais curtos e mais espessos, o processo e
b II e IV.
c
chamado condensação.
II e III.
d I e IV. Estão corretas apenas as afirmativas
a I, II e IV.
b II, III e V.
c I, III, IV e V.
28 (UERN 2013) O organismo humano é formado por d
dois tipos de células: as diploides ou somáticas, II, III e IV.
conhecidas por formarem todas as células do
corpo humano, e as haploides ou gametas, que são 29 (PUCRJ 2013) Considere as afirmativas abaixo acerca
células sexuais e apresentam metade do número de dos processos de divisão celular:
cromossomos. A maioria dessas células está sempre
I. Na mitose, a célula-mãe dá origem a duas células
se renovando, gerando novas células pelos processos
filhas geneticamente idênticas.
de mitose e meiose. O esquema a seguir representa
as fases da reprodução celular. II. Em todos os organismos que fazem reprodução
sexuada, a produção de gametas se dá por meiose.
III. Na primeira fase da meiose, ocorre o pareamento e
a segregação dos cromossomos homólogos.
IV. Na mitose, os cromossomos são alinhados na placa
equatorial e ocorre a separação das cromátides irmãs.
Observe as figuras e analise as afirmativas a seguir. Estão corretas:

EXERCÍCIOS
I. A anáfase I da meiose está representada pela figura 3. a Todas as afirmativas.
b Somente I e IV.
II. A figura 2 representam a metáfase da mitose. c Somente I, III e IV.
III. Durante a fase representada pela figura 1, ocorre d Somente I, II e IV.
o desaparecimento da carioteca, e inicia o processo e Somente I, II e III.
de condensação dos cromossomos.

ANOTAÇÕES

www.biologiatotal.com.br 41
GABARITO DJOW
CAIU NA PUCRJ - 2017
[A] CAIU NA UERJ - 2017
Ao final do processo mitótico, uma célula de conjunto cromossômico [D]
2n gera duas células-filhas de conjunto cromossômico 2n. O crossing- O esquema A representa a disjunção dos cromossomos
over ocorre na prófase I. Ao final do processo meiótico, uma célula
de conjunto cromossômico 2n gera quatro células-filhas de conjunto homólogos durante a meiose I e o esquema B, a disfunção
cromossômico n. Somente a meiose gera variação genética. de cromátides, observada na meiose II.

MEIOSE
1 - [A] contém metade das informações do individuo e após o encontro
com outro gameta restabelece as características da espécie no
Encontra-se na anáfase I, onde ocorre a separação dos novo individuo formado.
cromossomos homólogos. RESPOSTA COMENTADA http://bit.ly/2Fu43Ck
RESPOSTA COMENTADA http://bit.ly/2FxWD0Y
10 - [E]
2- [D]
A figura representa a anáfase da mitose de uma célula diploide
A duplicação dos centrômeros e a separação das cromátides- 2n=4, ou a anáfase II da meiose de uma célula-mãe 2n=8.
irmãs ocorre durante a anáfase da mitose e anáfase da segunda
divisão da meiose. RESPOSTA COMENTADA http://bit.ly/2Gk3uYO

RESPOSTA COMENTADA http://bit.ly/2FuALDB


11 - [D]
3 - [B] No esquema simplificado do processo de divisão celular meiótico,
O crossing-over amplia a variabilidade genética através da a célula A é diploide (2N), enquanto B, D, E, F, G, H e I são células
permuta de genes alelos entre cromátides homologas. haploides (N).
RESPOSTA COMENTADA http://bit.ly/2GkzSuv RESPOSTA COMENTADA http://bit.ly/2tDWF1N
CITOGENÉTICA

4- [C] 12- [E]


A separação dos cromossomos homólogos é um fenômeno A figura 1 ilustra a prófase I, fase da meiose em que se verifica
observado apenas durante a primeira divisão celular meiótica. o pareamento dos cromossomos homólogos e o crossing-over
(ou permutação). Em 2 observa-se a anáfase I com a disjunção
RESPOSTA COMENTADA http://bit.ly/2tLIxDR dos cromossomos homólogos. A figura 3 mostra a metáfase II
onde os cromossomos duplicados estão arranjados na região
5 - [A] mediana do fuso acromático, estando cada centrômero ligado
a dois microtúbulos.
O desenho apresentado mostra uma célula diploide na qual
os cromossomos homólogos encontram-se pareados na placa RESPOSTA COMENTADA http://bit.ly/2tGQwC1
equatorial da célula em processo meiótico. Portanto, trata-se de
uma célula germinativa em metáfase I. Células mitóticas não 13- [C]
apresentam pareamento de cromossomos homólogos. Ao sofrer mitose, cada célula da tartaruga produz duas células-
RESPOSTA COMENTADA http://bit.ly/2FvC8SC filhas somáticas, as quais apresentam 550 cromossomos. Caso
uma célula germinativa realize meiose, serão formadas células
6 - [A] sexuais (gametas) contendo 275 cromossomos.
A redução do número cromossômico de 2N para N, durante a RESPOSTA COMENTADA http://bit.ly/2tDz9lp
meiose, compensa a união dos gametas garantindo a constância
da ploidia da espécie ao longo das gerações sucessivas. 14 - [C]
RESPOSTA COMENTADA http://bit.ly/2Fu8r4g O processo meiótico que leva à formação de gametas, em
animais, ocorre em células germinativas diploides (2n) e forma,
7- [C] a partir de cada uma, quatro células haploides (n).
Durante a divisão celular meiótica ocorre a permuta entre RESPOSTA COMENTADA http://bit.ly/2tILB3u
cromátides internas de cromossomos homólogos (não irmãs)
durante o período denominado paquíteno da prófase I. 15 - [D]
RESPOSTA COMENTADA http://bit.ly/2GgG8Dr Sabendo-se que a probabilidade do gameta masculino receber
o cromossomo paterno, do par existente na espermatogônia, é
8- [C] igual a 50% a probabilidade de os quatro cromossomos serem
de origem paterna é igual a 0,5x0,5x0,5x0,5= 0,0625 = 6,25%
A disjunção dos pares de cromossomos homólogos ocorre
durante a anáfase I da meiose. RESPOSTA COMENTADA http://bit.ly/2oVayVq
RESPOSTA COMENTADA http://bit.ly/2tH3Xlr
16 - [D]
9 - [C] Células interfásicas podem permanecer no período G0 e não
se dividir. Em determinadas situações, essas células entram no
A meiose é um tipo de divisão celular que envolve células período G1, passam pelo período S e G2 e sofrem mitose. Esse
germinativas que, portanto um erro pode ser passado para a fenômeno ocorre em certos tipos celulares específicos, como, por
geração seguinte, havendo mutação um erro pode criar novas exemplo, neurônios, células que, normalmente, não se duplicam.
características na população. Os gametas formados na meiose
RESPOSTA COMENTADA http://bit.ly/2oVg6iJ

42
17 - [E] 24- [E]
Uma correlação direta entre membrana, citoplasma e núcleo Todos os itens estão corretos e relacionados aos processos de
está relacionada na alternativa [E]. Durante a prófase da divisão celular.
divisão celular, ocorre a desintegração do envoltório nuclear, RESPOSTA COMENTADA http://bit.ly/2pBoce0
fenômeno induzido por proteínas citoplasmáticas ativadas por
estímulos desencadeados por receptores situados na membrana
plasmática. 25- [B]
O pareamento (sinapse) dos cromossomos homólogos ocorre no
zigóteno da prófase I da meiose.
18- [C] RESPOSTA COMENTADA http://bit.ly/2oVc61k
Durante a divisão celular meiótica, as células germinativas
diploides com 46 cromossomos formam células gaméticas 26- [C]
haploides com 23 cromossomos. [II] Falsa. O pareamento dos cromossomos homólogos ocorre
RESPOSTA COMENTADA http://bit.ly/2oVkGgK durante o zigoteno da prófase I da meiose.
[III] Falsa. Durante o período G1 da interfase o DNA acha-se
19 - [C] altamente descondensado.
A figura 1 mostra a célula somática em metáfase da mitose; em [IV] Falsa. O período S, quando ocorre a síntese de DNA ocorre
2 observamos a célula germinativa em anáfase I; em 3 observa- em células somáticas e germinativas.
se a prófase. A figura 4 representa a metáfase I e a 5 a anáfase
da mitose. [V] Falsa. No período G2 da interfase as células apresentam
RESPOSTA COMENTADA http://bit.ly/2oV6rso
o dobro da quantidade de DNA do que o verificado durante o
período G1, porque os cromossomos estão duplicados na fase
20- [A] que antecede a divisão celular.
RESPOSTA COMENTADA http://bit.ly/2oVdwsP
O diplóteno da prófase I é caracterizado pelo aparecimento
dos quiasmas, isto é, pontos de contato nos locais onde
ocorreram trocas de segmentos entre as cromátides internas 27- [B]
dos cromossomos homólogas duplicados, fenômeno conhecido No processo de multiplicação celular para a reparação de
como crossing-over ou permutação. tecidos ocorrem mitoses. Nesse processo de divisão celular, há
RESPOSTA COMENTADA http://bit.ly/2oV4pZ8 o alinhamento dos cromossomos no plano equatorial da célula
(metáfase) e divisão dos centrômeros, determinando a separação
21- [A] das cromátides-irmãs (anáfase).

CITOGENÉTICA
RESPOSTA COMENTADA http://bit.ly/2oVoLSj
Na anáfase mitótica, não há separação de cromossomos
homólogos, mas das cromátides-irmãs. Já na anáfase I meiótica,
ocorre a separação de cromossomos homólogos para os polos 28- [C]
opostas da célula. A figura I representa a primeira fase da divisão celular, a
RESPOSTA COMENTADA http://bit.ly/2oVlEtf prófase, nela há o desaparecimento da membrana nuclear e
inicia o processo de condensação dos cromossomos. A figura
22- [D] 2 representa a metáfase da meiose I, nesta os cromossomos
homólogos estão alinhados. A figura 3 representa a Metáfase
Durante a espermatogênese humana, a separação dos I da meiose.
cromossomos homólogos ocorre no intervalo IV ( fase RESPOSTA COMENTADA http://bit.ly/2oVr33x
reducional), enquanto a separação das cromátides-irmãs se dá
no intervalo VI.
29- [C]
RESPOSTA COMENTADA http://bit.ly/2oVs7o3
Na única alternativa incorreta, a II, a produção dos gametas
23- [D] pode se dar por mitose em determinados organismos.
RESPOSTA COMENTADA http://bit.ly/2oV3KXE
A célula representada é diploide (2N). Durante o ciclo celular
ocorreu a duplicação dos cromossomos no período S da interfase
(2), seguida de disjunção cromossômica na anáfase I (4) e
disjunção de cromátides irmãs na anáfase II (7) do processo
meiótico.
RESPOSTA COMENTADA http://bit.ly/2oV75pO

ANOTAÇÕES

www.biologiatotal.com.br 43
01 as fases da meiose dos indivíduos X, Y e Z, representadas
MEIOSE 02
nos esquemas, são, respectivamente: metáfase I, metáfase
II e anáfase II.
os indivíduos Y e Z são heterozigotos para os quatro genes
34 (FAC. SANTA MARCELINA - MEDICIN 2017) A figura representa representados.
uma célula animal em uma fase da meiose. considerando apenas os genes representados e ocorrendo a
04 correta separação das cromátides, a célula do indivíduo X,
representada acima, pode originar dois tipos de gametas:
ABDE e ABDe.
08 esta espécie hipotética possui dois pares de cromossomos
metacêntricos e um par submetacêntrico.
16 considerando outra célula do indivíduo Y, sem a ocorrência
de permutação que envolva os genes representados e sem
erros de segregação, a probabilidade de formar um gameta
com os quatro alelos dominantes é de 6,25%.
32 os gametas produzidos pela célula do indivíduo Z,
representada acima, terão um número n diferente da
espécie.

37 (UEM-PAS 2016) Sobre a divisão celular nos


eucariotos, assinale o que for correto.
a Qual fase da meiose está representada na figura? Justifique
sua resposta. 01 A meiose e a fecundação são fenômenos opostos, pois a
meiose, sendo uma divisão reducional, produz gametas
b Indique quantos cromossomos estarão presentes em cada com metade do número de cromossomos, típico de uma
uma das células formadas, ao final dessa meiose. Justifique espécie, enquanto a fecundação restitui a diploidia.
EXERCÍCIOS APROFUNDADOS

sua resposta. A interfase é um período do ciclo celular que antecede a


02
mitose e a meiose. Nela não ocorrem eventos importantes
para a geração de novas células.
04 Na meiose, os cromossomos homólogos separam-se
durante a anáfase I e, durante a anáfase II, separam-se as
cromátides.
08 Ao final da mitose, a citocinese das células vegetais ocorre
do centro para a periferia, recebendo o nome de citocinese
centrífuga.
16 Em células animais, o crossing-over ocorre na prófase, em
cromossomos não homólogos da mitose ou da meiose.
35 (UEPG 2016) Sobre os processos envolvidos nas
etapas de divisão celular, assinale o que for correto.
01 Nos seres eucariotos e sexuados ocorrem dois tipos de 38 (FMJ 2016) A imagem ilustra um fenômeno que
divisão celular: mitose, que forma células com o mesmo ocorre durante uma das fases da meiose I.
número de cromossomos e com informações genéticas
idênticas à célula-mãe; e meiose, que reduz o número de
cromossomos à metade (haploide).
02 A célula permanece em interfase na maior parte do tempo,
período em que os cromossomos permanecem em um
intenso grau de compactação e com baixa atividade das
organelas.
04 Na fase de prófase da meiose I, o crossing-over permite
trocas de pedaços entre os cromossomos homólogos,
fazendo surgir novas combinações genéticas.
08 Na primeira etapa da meiose, os cromossomos homólogos
se separam durante a anáfase I.
a Nomeie a fase em que ocorre esse fenômeno. Explique em
que consiste esse processo.
36 (UFSC 2016) Os esquemas abaixo representam b Além do fenômeno ilustrado, existe outro que aumenta
as combinações genéticas e que ocorre na metáfase I. O
os cromossomos de células em diferentes fases da que caracteriza essa fase? Por que ela promove diferentes
meiose de três indivíduos de uma espécie hipotética combinações genéticas?
2n=6.

Com base nos esquemas e nos conhecimentos sobre


biologia celular e genética, é CORRETO afirmar que:

12
39 (UEM-PAS 2016) Uma nova estratégia para perder 42 (UEL 2013) Um pesquisador determinou as variações
peso, baseada nas informações contidas no material nos números de cromossomos e de moléculas de
genético de cada um, está ganhando espaço no Brasil DNA, ao longo do tempo, em células vegetais em
e no mundo. Batizada de “dieta do DNA”, o método reprodução sexuada e assexuada. As variações na
propõe ajudar, decisivamente, no emagrecimento, quantidade de moléculas em cada célula, nos dois
por meio de análises das variações genéticas casos, estão representadas nas figuras A e B.
relacionadas à capacidade do corpo de reagir aos
alimentos e ao treino físico. Ele fornece respostas a
respeito da sensibilidade ao carboidrato e à gordura
saturada e se há intolerância a glúten e lactose.
(Revista Isto É, 17/06/2015)

Sobre o assunto e com base nas aplicações do


conhecimento genético, assinale a(s) alternativa(s)
correta(s).
01 A dieta do DNA consiste em um método de transgenia.
02 Os resultados do Projeto Genoma Humano não oferecem a Que tipo de divisão celular está caracterizado na figura
nenhum avanço na identificação dos genes associados à A? E na figura B? Qual tipo corresponde às células em
obesidade. reprodução sexuada? Qual tipo corresponde às células em
04 A dieta do DNA é aceitável, pois as pessoas diferem entre reprodução assexuada? Justifique suas respostas.
si quanto ao material genético que possuem. b Explique as características genéticas dos descendentes das
08 A análise do DNA, conhecida como fingerprint do DNA reproduções sexuada e assexuada.
(impressão digital do DNA), é realizada cortando o DNA

EXERCÍCIOS APROFUNDADOS
com enzimas de restrição e analisando por eletroforese.
16 A existência de diferenças genéticas entre os indivíduos
de uma população é chamada de recombinação genética.

40 (UEM-PAS 2015) Identifique o que for correto sobre


os processos de divisão celular (meiose e mitose):
01 Nos animais ocorre meiose zigótica; já em algumas
espécies de fungos, protozoários e em todas as plantas, a
meiose é do tipo gamética.
02 A mitose é o mecanismo mais comum de reprodução dos 43 (UFPR 2013) Na síndrome de Down, geralmente
organismos unicelulares eucarióticos. ocorre uma trissomia do cromossomo 21, ou seja,
04 Nas células animais, em razão da presença de centríolos, a pessoa apresenta três cópias (cromátides) desse
a mitose é denominada cêntrica; e, em consequência da cromossomo, ao invés de apenas duas. Na maioria
existência do áster, a mitose é denominada astral. dos casos de síndrome de Down, a terceira cópia do
08 As fibras do fuso se formam apenas em células animais. cromossomo 21 é originada devido a um erro durante
16 As permutações rearranjam características preexistentes, a formação dos gametas do pai ou da mãe. Que tipo
mas não determinam o surgimento de novos alelos, que só
acontece devido às mutações. de erro, durante a formação dos gametas do pai ou da
mãe do portador de síndrome de Down, leva a uma
trissomia como essa?
41 (UNIFESP 2015) Charles Darwin explicou o
mecanismo evolutivo por meio da ação da seleção
natural sobre a variabilidade dos organismos, mas
não encontrou uma explicação adequada para
a origem dessa variabilidade. Essa questão, no
entanto, já havia sido trabalhada anos antes por
Gregor Mendel e, em 2015, comemoram-se os 150
anos da publicação de seus resultados, conhecidos
como Leis de Mendel.
a A que se refere a Segunda Lei de Mendel? Por que ela
explica o surgimento da variabilidade dos organismos?
b Cite e explique um outro processo que também tenha como
resultado a geração de variabilidade no nível genético. 44 (UNIFESP 2012) Durante a prófase I da meiose, pode
ocorrer o crossing over ou permuta gênica entre os
cromossomos das células reprodutivas.
a Explique o que é crossing over e sua importância para as
espécies.
b Considerando que a maioria das células de um organismo
realiza divisão celular mitótica para se multiplicar, justifique
o fato de as células reprodutivas realizarem a meiose.

www.biologiatotal.com.br 13
45 (UNESP 2012) Bom seria se todas as frutas fossem como
a banana: fácil de descascar e livre do inconveniente
dos caroços. Para darem uma forcinha à natureza,
47 (UFTM 2012) Considere uma célula com o genótipo
pesquisadores desenvolveram versões sem sementes em a seguir e suponha que ela entre em divisão meiótica.
laboratório [...]. Para criar frutos sem sementes a partir
de versões com caroços, como acontece com a melancia,
é preciso cruzar plantas com números diferentes de
cromossomos, até que se obtenha uma fruta em que as
sementinhas não se desenvolvam. (Veja, 25.01.2012.)

a Qual será a composição de alelos nessa célula ao final da


fase S da interfase? Justifique sua resposta.
b Suponha que ao final dessa meiose não tenha ocorrido
crossing-over ou mutação. Qual fenômeno poderia ocorrer
na meiose que promoveria um aumento na variabilidade
genética dos gametas formados? Explique esse fenômeno.
EXERCÍCIOS APROFUNDADOS

a Suponha que, no caso exemplificado, a melancia sem


sementes tenha sido obtida a partir do cruzamento
entre uma planta diploide com 22 cromossomos e
uma planta tetraploide com 44 cromossomos.
b Quantos cromossomos terão as células somáticas da
nova planta? Considerando que as sementes são o
resultado da reprodução sexuada, explique por que
os frutos dessa planta não as possuem.
48 (UDESC 2011) Em organismos de reprodução
sexuada pode ocorrer, durante a prófase I da meiose
I, na formação dos gametas, um evento denominado
permutação, permuta genética ou crossing-over.
Em relação ao contexto, responda:
a no que consiste o crossing-over?
b qual a função do crossing-over?

46 (UNESP 2012) Os indivíduos não são coisas estáveis.


Eles são efêmeros. Os cromossomos também caem
no esquecimento, como as mãos num jogo de cartas
pouco depois de serem distribuídas. Mas as cartas,
em si, sobrevivem ao embaralhamento. As cartas são
os genes. Eles apenas trocam de parceiros e seguem
em frente. É claro que eles seguem em frente. É
essa a sua vocação. Eles são os replicadores e nós,
suas máquinas de sobrevivência. Quando tivermos QUESTÃO BAGA
cumprido a nossa missão, seremos descartados. Os
genes, porém, são cidadãos do tempo geológico: os Sob quais circunstancias o intercruzamento durante a
genes são para sempre. meiose não contribuiria para a variação genética entre
(Richard Dawkins. O gene egoísta, 2008.) as células-filhas?
Considerando a reprodução sexuada, explique o
que o autor do texto quis dizer ao comparar cada
cromossomo, e o conjunto cromossômico de uma
pessoa, às mãos de cartas que se desfazem assim
que são distribuídas. Considerando o mecanismo de
duplicação do DNA, explique a afirmação de que os
genes são para sempre.

14
GABARITO DJOW
MEIOSE
34: a) Encontra-se na anáfase I, onde ocorre a separação dos [02] Incorreta. O Projeto Genoma Humano oferece avanços em
cromossomos homólogos. relação aos genes sobre a propensão à obesidade.
b) Estarão presentes três cromossomos em cada célula ao final [04] Correta. A dieta do DNA pode ser considerada aceitável,
dessa meiose, pois na anáfase I serão separados os cromossomos pois o material genético difere de pessoa para pessoa.
homólogos e na anáfase II as cromátides-irmãs. [08] Correta. A impressão digital do DNA é uma técnica
empregada para identificação de indivíduos, através de seu DNA,
isolando-o e utilizando enzimas de restrição para fragmentá-lo
35: 01 + 04 + 08 = 13. em pedaços, analisando-os por eletroforese.
[01] Verdadeiro. Nos seres vivos eucariotos e sexuados, a mitose [16] Incorreta. A recombinação genética aumenta a variação
forma duas células-filhas com o mesmo número de cromossomos genética entre os indivíduos de uma população.
da célula-mãe; e a meiose reduz pela metade o número de
cromossomos, tornando-se haploide.
[02] Falso. O tempo da interfase depende do tipo de célula e 40: 02 + 04 + 16 = 22.
seu estado fisiológico e os cromossomos estão descondensados. [01] Falso. Em animais a meiose é gamética. Nas plantas é
Dependendo do estágio da interfase, a célula permanece em espórica e em algumas espécies de protozoários, algas e fungos,
atividade ou repouso. a meiose é zigótica.
[04] Verdadeiro. O crossing-over ocorre na prófase I, em que [08] Falso. As fibras do fuso mitótico são constituídas por
há trocas entre os cromossomos homólogos, aumentando a microtúbulos e ocorrem nas células que se dividem, em todos
variabilidade genética. os organismos eucariontes (fungos, protoctistas, animais e
[08] Verdadeiro. Os cromossomos homólogos se separam vegetais).
durante a anáfase I (meiose I).
41: a) A segunda Lei de Mendel refere-se à segregação

EXERCÍCIOS APROFUNDADOS
independente dos pares de genes não alelos e situados em
36: 04 + 08 + 16 + 32 = 60. pares de cromossomos diferentes. A produção da variabilidade
genética acontece porque os genes situados em cromossomos
Gabarito Oficial: 04 + 08 + 32 = 44. distintos se segregam e se combinam de todas as formas
[01] Incorreta: X- Metáfase II e Z- anáfase I. possíveis nas células reprodutoras e nos descendentes.
[02] Incorreta: O indivíduo Z é homozigoto para os genes d, e b) A variabilidade genética também ocorre pelo crossing-over
e A. (permutação) que envolve a troca de segmentos cromossômicos
[16] Correta: A probabilidade do indivíduo Y formar um gameta homólogos, mutações gênicas que atingem os genes contidos
portador dos genes DEBA é de 50%. Porém, a probabilidade de no DNA e cromossômicas que podem alterar o número e (ou) a
outra célula, com outro arranjo metafásico de seus cromossomos, estrutura dos cromossomos de uma espécie.
formar um gameta portador dos genes dominantes DEBA, sem
que ocorra permutação, será igual a 1 1 1 1
× × =. 42: a) No esquema da figura A está representada a mitose,
2 2 2 8 e na figura B a meiose. As células em reprodução sexuada
correspondem à meiose, isto é, figura B. Podemos justificar pela
37: 01 + 04 + 08 = 13. produção de quatro células ao final do processo e redução no
A meiose é uma divisão celular reducional, com metade dos número de cromossomos em cada célula formada. Na reprodução
cromossomos da espécie em questão. Nela, os cromossomos assexuada a estabilidade no número de cromossomos nas
homólogos são separados durante a anáfase I e as cromátides células formadas é o ponto principal, ou seja, mantém o número
durante a anáfase II. O crossing-over é um processo que ocorre de cromossomos que pode ser observado na formação das duas
na prófase I da meiose, com troca de material genético entre células ao final do processo.
cromossomos homólogos. A fecundação é a junção dos gametas b) Os descendentes formados pelo processo de reprodução
haploides, originando células diploides. A interfase é um período sexuada diferem dos pais por apresentar uma mistura de material
do ciclo celular, chamado de S, importante para a divisão genético de ambos, já no processo de reprodução assexuada as
celular, momento de síntese, onde ocorre a duplicação do DNA, características genéticas se mantêm como ocorre na clonagem.
para posterior divisão. A citocinese centrífuga é característica
das células vegetais e corresponde ao processo de divisão do
citoplasma, iniciando do centro da célula, avançando para as 43: A síndrome de Down, geralmente, é causada pela não
extremidades. disjunção das cromátides do cromossomo 21 durante a anáfase
II da meiose paterna ou materna.
38: a) A fase em que ocorre esse fenômeno é a Prófase I. 44: a) O crossing-over (ou permutação gênica) corresponde
Consiste na troca de pedaços entre cromátides homólogas (troca
de segmentos entre cromossomos homólogos). à troca de segmentos entre cromossomos homólogos. Esse
b) A metáfase I é caracterizada pelo emparelhamento dos fenômeno produz recombinação gênica que será transmitida à
cromossomos homólogos na região equatorial (meio da célula descendência. A permuta gênica é uma das formas pelas quais
ou máxima condensação cromossômica). Os cromossomos é produzida a variabilidade genética entre indivíduos de uma
homólogos se emparelham ao acaso (segregação independente mesma espécie.
ou separação ao acaso ou arranjo aleatório ou pareamento ao b) A meiose reduz o número cromossômico pela metade. Dessa
acaso ou segunda lei de Mendel) e ao serem “puxados”, devido forma, a meiose compensa a fecundação de gametas e garante
ao encurtamento dos fusos, permitem diferentes combinações a constância do número cromossômico ao longo das gerações.
genéticas.
45: As células somáticas da nova planta apresentarão 33
39: 04 + 08 = 12. cromossomos, de acordo com o cruzamento adiante:
[01] Incorreta. A dieta do DNA é uma estratégia para perder peso,
de acordo com as informações contidas no material genético
de cada indivíduo. Enquanto que transgenia ou transgênicos
consiste no desenvolvimento de organismos geneticamente
modificados, através de cruzamentos em laboratório.

www.biologiatotal.com.br 15
Os híbridos F1 (2N = 33) não sofrem meiose normal por não o aumento da variabilidade genética. Nesse processo, os
apresentarem pares de cromossomos homólogos. Os organismos cromossomos e alelos são segregados e combinados de todas
formados não formam gametas normais que possam ser as formas possíveis na formação dos gametas, durante a meiose.
fecundados e acabam produzindo frutos sem sementes normais.
48: a) O crossing-over consiste na troca de pedaços de
46: Os cromossomos e os genes são como as cartas de um cromátides entre cromossomos homólogos.
baralho. A cada mão, são formadas novas combinações de cartas, b) A função do crossing-over é aumentar a variabilidade genética
assim como, a cada geração, as permutações e a segregação, na formação dos gametas, por meio da mistura de genes ao
independente dos cromossomos homólogos, produzem novas longo do cromossomo.
combinações gênicas e cromossômicas nos gametas envolvidos
na reprodução sexuada. A replicação semiconservativa do DNA
garante que as duas cadeias pareadas do DNA se separem e
se complementem, permitindo que as instruções genéticas se
perpetuem nas células filhas e nas gerações futuras. QUESTÃO BAGA
Se os segmentos das cromátides materna e paterna
47: a) Genótipos: AA aa BB bb. Ao final da fase S da interfase que sofrem crossing over são geneticamente idênticos
os cromossomos encontram-se duplicados e constituídos, cada e, portanto, possuem os mesmos dois alelos para cada
um, por duas cromátides irmãs idênticas entre si e unidas pelo gene, então os cromossomos recombinantes serão
centrômero. geneticamente equivalentes aos cromossomos parentais.
b) Na ausência de crossing-over ou mutação, a segregação O crossing over contribui para a variação genética apenas
independente dos pares de cromossomos homólogos garante quando envolve o rearranjo de alelos diferentes.

ANOTAÇÕES
EXERCÍCIOS APROFUNDADOS

16
MITOSE E MEIOSE
EXERCÍCIOS COM GRÁFICO

PAULO JUBILUT
célula, respectivamente?

EXERCÍCIOS a) T2 e T3.
b) T1 e T3.
c) T3 e T4.
1. (Ufpa 2016) O gráfico a seguir representa variações d) T1 e T4.
na quantidade de DNA ao longo do ciclo de vida de
uma célula. (X= unidade arbitrária de DNA por célula).
3. (cftmg 2011) Os gráficos a seguir representam
processos de divisão celular, em que X é o número
haploide de material genético.

Sobre esse ciclo vital de uma célula, representado no


gráfico, é correto afirmar:

a) A interfase está representada pela fase 3. E incorreto afirmar que o processo


b) As fases 1, 2 e 3 representam os períodos G1, S e
a) I permite o crescimento de plantas.
G2, que resumem todo o ciclo vital de uma célula.
b) II ocorre nos testículos e ovários.
MEIOSE E MITOSE

c) As fases 1, 2 e 3 representam o período em que


a célula se encontra em interfase, e as fases 4, 5, 6 c) I pode ocorrer em hemácias maduras.
e 7 subsequentes são características da célula em d) II está ligado à variabilidade genética.
divisão mitótica, quando, ao final, ocorre redução
à metade da quantidade de DNA na célula.
d) A célula representada é diploide: seu DNA 4. (Ufpb 2010) Nos organismos eucariontes, cada
foi duplicado no período S da interfase (fase 2) cromossomo contém uma molécula de DNA. Nas
e, posteriormente, passou pelas duas fases da células somáticas diploides (2n) desses organismos,
meiose, originando células-filhas com metade da os cromossomos ocorrem aos pares e os que
quantidade de DNA (fase 7, células haploides). formam cada par são denominados cromossomos
homólogos.
e) A fase 3 é caracterizada por um período em
que não há variação na quantidade de DNA na Na tabela e no gráfico a seguir, constam informações
célula, portanto essa fase representa uma célula sobre o número diploide de cromossomos em
durante os períodos da mitose: prófase, metáfase diferentes organismos e sobre a variação na
e anáfase. quantidade de DNA, ao longo do ciclo celular.
Drosófila

2. (Ufu 2015) O gráfico a seguir mostra variações


Homem

Cebola

da quantidade de DNA por núcleo durante o ciclo Organismo


Gato
Cão

celular de uma célula animal.


Número diploide
46 78 08 16 38
de cromossomos

Em qual dos períodos encontramos o cromossomo Considerando as informações dadas, os fenômenos


constituído por duas cromátides-irmãs, cada uma característicos da mitose e a análise da tabela e do
contendo uma molécula de DNA, e a ocorrência da gráfico, identifique as afirmativas corretas:
migração das cromátides-irmãs para os polos da

2
( ) Nos núcleos das células somáticas do gato, a) Quantas cromátides estão presentes no início
no final do período S, existirão 76 moléculas de da fase M do gráfico I? E ao final da fase M2 do
DNA distribuídas nos 19 pares de cromossomos gráfico II?
homólogos. b) Quantas moléculas de DNA estão presentes no
início da fase M do gráfico I? E ao final da fase M2
( ) Nas células somáticas do cão, na metáfase do gráfico II?
mitótica, os 39 pares de cromossomos homólogos
estarão alinhados na região equatorial.

( ) Nos núcleos das células da drosófila, no final do


período G2, existirão 8 moléculas de DNA.

( ) Nos núcleos das células do homem, no início


da prófase, existirão 46 pares de cromossomos
homólogos iniciando o processo de espiralização.

( ) Nos núcleos das células de cebola, no final da


telófase, as células recém-formadas estarão com 8 7. (Unesp 2006) O gráfico representa as mudanças
moléculas de DNA. (quantitativas) no conteúdo do DNA nuclear durante
eventos envolvendo divisão celular e fecundação em
camundongos.

5. (cftmg 2010) A questão refere-se ao gráfico a


seguir.

MEIOSE E MITOSE
Um pesquisador, com a finalidade de estudar a
forma e o tamanho dos cromossomos de uma célula,
interrompeu a divisão celular na fase em que eles se
Os intervalos C-D, L-M e P-Q correspondem,
encontravam na máxima condensação.
respectivamente, a fases em que ocorrem a
Analisando esse processo, pode-se deduzir,
a) replicação, meiose II e mitose.
corretamente, que a fase em questão é a de número
b) meiose I, meiose II e replicação.
a) 1 c) mitose, meiose I e fecundação.
b) 2 d) mitose, meiose I e meiose II.
c) 3 e) mitose, meiose II e fecundação.
d) 4

8. (Unifesp 2006) Assinale o gráfico que representa


6. (Unifesp 2009) Os gráficos I e II representam o corretamente a quantidade de DNA no núcleo de
conteúdo de DNA durante divisões celulares. uma célula de mamífero durante as fases da meiose.
Considere M(I) = 1a divisão e M(II) = 2a divisão.

Considerando-se um cromossomo:

www.biologiatotal.com.br 3
porções. Em uma delas, adicionou-se afidicolina
e, na outra, colchicina. Após algumas horas, foram
retiradas, da mesma forma, 100 células de cada
porção, sendo também determinada a quantidade
de DNA por célula. Esses resultados estão mostrados
nos dois outros gráficos a seguir.

9. (Uel 2006) Analise o gráfico a seguir.


Sabendo-se que:

- a afidicolina inibe a enzima DNA polimerase;

- a colchicina inibe a polimerização das subunidades


MEIOSE E MITOSE

que formam os microtúbulos.

a) analise o resultado do experimento mostrado


no gráfico I e calcule a porcentagem de células
que se encontram nas fases do ciclo celular G1, S
e G2 + M;
b) identifique os gráficos que representam,
respectivamente, os resultados dos experimentos
Com base no gráfico e nos conhecimentos sobre a onde houve adição de afidicolina e de colchicina
meiose, é correto afirmar: ao meio de cultura. Justifique sua resposta.

a) A linha horizontal contínua (não-tracejad


representa a variação no número de cromossomos
durante a meiose.
b) A permuta entre os cromossomos homólogos
deve ocorrer após o tempo 2 e antes do tempo 5.
c) A separação dos cromossomos homólogos
ocorre entre o tempo 10 e o tempo 11.
d) A linha horizontal tracejada corresponde à
variação na quantidade de DNA durante a meiose. 11. (Ufrn 2005) Os gráficos a seguir foram obtidos a
e) A replicação do DNA, que ocorre durante a fase partir das variações do volume celular e do número
S da interfase, tem início no tempo 0. de células, observados durante um intervalo de 20
horas em uma cultura de células.

10. (Uff 2005) Células eucarióticas que possuem um


ciclo de divisão em torno de 24 horas estão sendo
cultivadas em meio adequado. Em um determinado
momento, coletam-se, aleatoriamente, 100 células
dessa cultura e determina-se a quantidade de DNA
em cada uma delas. Os resultados estão mostrados
a seguir, no gráfico I.

O restante da cultura foi, então, dividido em duas

4
A partir da análise dos gráficos, atenda às solicitações 13. (Ufscar 2002) O gráfico mostra a variação da
a seguir. quantidade de DNA de uma célula somática durante
as diversas fases de sua vida.
a) Explique por que o volume médio das células
varia dessa forma ao longo do tempo de
observação.
b) Estabeleça uma relação entre os dois gráficos.

TEXTO PARA A PRÓXIMA QUESTÃO:

O cruzamento entre plantas de variedades diferentes


de uma mesma espécie é muito utilizado para a
obtenção de cultivares mais produtivos. No gráfico, a mitose propriamente dita e a interfase
correspondem, respectivamente, aos períodos de
Dois espécimes de variedades diferentes de uma tempo
planta oleaginosa foram cruzados visando à
obtenção de uma variedade mais resistente à seca. a) 4 a 6 e 1 a 4.
Considere que duas das características dessa planta, b) 2 a 4 e 3 a 5.
referentes à folha e à semente, são definidas por
c) 3 a 5 e 1 a 3.
alelos segregados independentemente, conforme a
lista a seguir. d) 1 a 3 e 4 a 6.
e) 2 a 5 e 3 a 5.
P - semente com “pelos”

MEIOSE E MITOSE
p - semente lisa 14. (Ufrj 2001) Um pesquisador determinou as
variações nas concentrações de ADN ao longo do
C - folha coberta com cera tempo, em células do ovário e do epitélio intestinal
de um animal. As variações na quantidade de ADN
c - folha sem cera
em cada célula nos dois casos estão registradas nas
Os gráficos a seguir mostram a composição dos figuras 1 e 2.
alelos para essas duas características nas plantas
Qual das figuras (1 ou 2) corresponde às células do
parentais.
ovário e qual corresponde ao epitélio intestinal.
Justifique.

12. (Ufrn 2005) O gráfico que representa o número de


alelos encontrados na mitose de uma célula obtida
de uma planta resultante do cruzamento entre os
parentais é:

www.biologiatotal.com.br 5
15. (Ufg 2000) Este gráfico representa a quantidade de DNA em uma
célula animal, durante seu ciclo celular. Em relação
ao teor de DNA neste ciclo,

( ) na fase A, ocorre a duplicação do DNA.

( ) na fase B, ocorre separação das cromátides irmãs.

( ) na fase C, ocorre a intensa síntese de DNA.

( ) na fase D, ocorre a divisão dos centrômeros.

ANOTAÇÕES
MEIOSE E MITOSE

6
GABARITO DJOW
MITOSE E MEIOSE

1: [D] 7: [C]
A célula representada é diploide (2N). Durante o ciclo celular
ocorreu a duplicação dos cromossomos no período S da 8: [B]
interfase (2), seguida de disjunção cromossômica na anáfase I
(4) e disjunção de cromátides irmãs na anáfase II (7) do processo
meiótico. 9: [B]

2: [C] 10: a) 40% na fase G1 ; 36% na fase S e 24% nas fases G2 + M.


O período em que a célula animal possui cromossomos b) O gráfico III representa o experimento em presença de
duplicados e constituídos por duas cromátides-irmãs, cada uma afidicolina. Essa substância, inibindo a DNA polimerase, bloqueia
formada por uma molécula de DNA de cadeia dupla é o T3. A a síntese do DNA. Em consequência, as células se acumulam na
migração das cromátides-irmãs ocorre em T4. fase G1.
O gráfico II representa os resultados após a adição de colchicina.
3: [C] Essa substância, impedindo a formação de microtúbulos, paralisa
Hemácias maduras não possuem núcleo e, por esse motivo, são a divisão celular nas etapas iniciais da fase M (mitose). Dessa
incapazes de sofrer divisão. forma, as células tendem a se acumular nessa fase, contendo o
dobro de DNA em relação à fase G1 do ciclo celular.
4: V – V – F – F – F.
Nos núcleos das células da drosófila, no final do período G2, 11: a) As células crescem até atingir o tamanho máximo permitido
existirão 16 moléculas de DNA, já que seus 8 cromossomos pela relação superfície x volume, após o que passam a se dividir,

MEIOSE E MITOSE
estão duplicados, cada um formado por duas cromátides irmãs. produzindo células com volume igual à metade da célula-mãe.
Na prófase de células humanas ocorre 23 pares de cromossomos b) O aumento no número de células é resultante das mitoses,
homólogos, iniciando o processo de espiralização. Na telófase que ocorrem a cada vez que o volume celular atinge seu valor
mitótica das células da cebola, os núcleos recém-formados máximo e a célula se divide.
estarão com 16 cromossomos e 16 moléculas de DNA.
12: [C]
5: [B]
A fase da mitose em que os cromossomos encontram-se na 13: [A]
máxima condensação é a metáfase, representado pelo número
2. As fases da mitose são: prófase (1), metáfase (2), anáfase (3)
e telófase (4). 14: A figura 1 corresponde ao epitélio intestinal, pois a
quantidade de ADN inicialmente é duplicada e volta ao valor
inicial, caracterizando uma divisão celular por mitose. A figura 2
6: a) O cromossomo está duplicado, portanto, apresenta corresponde às células do ovário, pois a quantidade final de ADN
duas cromátides-irmãs. Não apresenta cromátides, pois o é igual à metade da quantidade inicial, indicando a ocorrência
cromossomo não está duplicado. da divisão celular por meiose.
b) Duas, pois cada cromátide é formada por uma molécula
de DNA. Uma molécula de DNA, pois o cromossomo não está 15: F F F F
duplicado, ou seja, não apresenta cromátides-irmãs.

ANOTAÇÕES

www.biologiatotal.com.br 7
SUPER INTENSIVO
caderno 4

PAULO JUBILUT
irmãs. Em seguida eles são condensados e tornam-se

CITOGENÉTICA individualizados.

Variam em número, forma e posição de centrômero


nas diferentes espécies, podendo ser classificados
1. NÚCLEO em metacêntricos, submetacêntricos, acrocêntricos e
telocêntricos.

Estrutura em geral esférica ou ovoide presente apenas


nas células eucarióticas.

Composto por quatro componentes básicos: cariolinfa,


carioteca, cromatina e nucléolo.

Cariolinfa: material semelhante ao citoplasma, mas


com maior concentração de RNA e de proteínas.
Metacêntrico Submetacêntico Acrocêntrico Telocêntrico
Tipos de cromossomos de acordo com a localização do centrômero
Carioteca: duas camadas de membranas
lipoproteicas sobrepostas com grandes poros (para Células diploides (2n) possuem pares de cromossomos
a troca de macromoléculas). – chamados cromossomos homólogos –, que são
iguais quanto ao tamanho, à forma, à posição do
Cromatina: conjunto de filamentos cromossômicos
centrômero e aos genes que transportam.
(DNA) presente no núcleo. As regiões mais
condensadas são chamadas de heterocromatina e Células haploides (n) possuem apenas um tipo de
as menos condensadas, de eucromatina. cada cromossomo.
Nucléolo: corpúsculo denso, esférico, formado O conjunto de características dos cromossomos de
principalmente por RNA ribossômico. uma espécie constitui o seu cariótipo (número de
cromossomos, tamanho e classificação).
Funções: centro de controle das atividades celulares.
É nele que se encontram os cromossomos, que são O conjunto de moléculas de DNA de um organismo
responsáveis pelas características hereditárias dos constitui seu genoma.
organismos.

Envelope Nuclear 2. MITOSE


Membrana Externa
Membrana Interna
Cromatina Divisão celular equacional: duas células-filhas com o
Heterocromatina mesmo número de cromossomos que a célula-mãe.
Eucromatina
Poro Nuclear Subdividida em 4 fases: prófase, metáfase, anáfase e
Nucleoplasma telófase.

Nucléolo Organismos pluricelulares: relacionada ao aumento


Ribossomos do número de células, crescimento do corpo e
regeneração de partes lesadas.
Estruturas interna e externa do núcleo celular
Organismos unicelulares: responsável pela
2. CROMOSSOMOS reprodução.

Alterações genéticas podem interferir no controle


Molécula de DNA associada a diversas proteínas. da divisão celular, levando à multiplicação celular
desenfreada, que pode resultar em um tumor. Caso
São duplicados durante a divisão celular, passando a
este tumor tenha capacidade de afetar tecidos
serem formados por dois filamentos – as cromátides-
vizinhos ele é denominado câncer.

2
Centríolo
Célula

Núcleo

Interfase
Duplicação dos
cromossomos
homólogos e
centríolos

Início da

Leptóteno
separação dos
centríolos

Fuso

Zigóteno
Formação do acromático
fuso acromático e em
emparelhamento formação
dos cromossomos

Paquíteno
Prófase I
Tétrade
ou
bivalente

Diplóteno
Quiasma

Diacinese
Terminalização de
quiasmas
Metafase I

Terminalização de
quiasmas
Anafase I

Separação dos
cromossomos
análogos
Telófase I

Citocinese
(divisão celular)

Duplicação dos
Prófase II

centríolos e
condensação dos
cromossomos
Metafase II

Cromossomos
ligados ao fuso
Anafase II

Separação dos
cromossomos
irmãos
Telófase II

Citocinese
(divisão
celular)
Esquema com todas as fases da mitose.
ETAPAS DA MITOSE ETAPAS DA MEIOSE

www.biologiatotal.com.br 3
3. MEIOSE

Divisão celular reducional: quatro células-filhas com


metade dos números de cromossomos da célula-mãe.

A redução no número de cromossomos se deve ao


fato dos cromossomos serem duplicados durante a
interfase, que é seguida por duas divisões celulares:
meiose I e meiose II.

Cada divisão é subdividida em 8 fases: prófase I e II,


metáfase I e II, anáfase I e II e telófase I e II.

Durante a prófase I pode ocorrer a troca de fragmentos


entre cromossomos homólogos – denominado
crossing-over. Este processo é um dos responsáveis
pela variabilidade genética existente entre seres vivos.

Erros durante a meiose podem causar a não disjunção


de cromossomos homólogos ou das cromátides-irmãs 5. ANOMALIAS CROMOSSÔMICAS
(na anáfase I ou II, respectivamente), produzindo
gametas com mais ou menos cromossomos. Em diversas espécies, nascer indivíduos com
alterações cromossômicas em relação ao cariótipo
padrão da espécie. Estas alterações podem ser
estruturais – quando afetam a estrutura de um ou
4. SÍNTESE PROTEICA mais cromossomos, ou numéricas – quando um
individuo tem mais ou menos cromossomos que o
As informações para a síntese de proteínas estão cariótipo padrão da espécie.
codificadas na molécula de DNA em uma linguagem
chamada de código genético. Mutações Cromossômicas numéricas:

É dividida em duas etapas: transcrição e tradução. Euploidias: variação de todo um conjunto básico
de cromossomos. Ex: haploidia (células com um
Transcrição: neste processo uma fita de DNA é conjunto de cromossomos haploide) e poliploidia
utilizada como molde para a produção de RNA. (tês ou mais conjuntos cromossômicos).

Tradução: O RNA mensageiro (RNAm) é “lido” Aneuploidia: alteração numérica de um ou alguns


por um ribossomo, que é responsável por cromossomos no genoma. Exemplos: Síndrome
unir aminoácidos de acordo com sequência de Down (trissomia do cromossomo 21, 2n +1) e
correspondente no RNA mensageiro. Nesse Síndrome de Turner (monossomia do cromossomo
processo os aminoácidos são recrutados de acordo X, 2n-1).
com o código genético, neste código, cada trinca
de bases nitrogenadas determina a produção de
um aminoácido

Esquema da síntese de proteínas por um ribossomo SÍNDROME DE DOWN

4
Mutações cromossômicas estruturais: Duplicação: adição de um segmento do
cromossomo homólogo, originando um conjunto
Deleção: perda de material cromossômico, que de genes duplicado.
pode incluir número variado de genes.
Inversão: inversão de um segmento de cromossomo.
Translocação: transferência de material de um
cromossomo para outro não homólogo.

EXERCÍCIOS
1. (IFSP 2017) Existem dois tipos de divisão celular que a) V – V – F – F.
servem para a produção de células-filha, a fim de desenvolver b) V – F – V – F.
o organismo e/ou repor células dos tecidos ou para a c) V – F – F – V.
sua reprodução. Na espécie humana, há, em indivíduos
d) F – V – V – F.
normais, 46 cromossomos, sendo que, para indivíduos do
sexo masculino: 46, XY e, para indivíduos do sexo feminino: e) F – V – F – V.
46, XX. Assinale a alternativa que explica corretamente a
divisão celular em um indivíduo do sexo masculino que
produz gametas e a divisão celular em um indivíduo do sexo 3. ( IFCE 2016) Observe os ciclos de vida apresentados a seguir.
feminino que produz células somáticas, em que constem,
respectivamente, em cada um dos indivíduos:

1) nome da divisão celular; 2) quantas células-filha são


resultantes; 3) o número de cromossomos; e 4) componente(s)
do par sexual.

a) 1) Meiose; 2) 4 células-filha; 3) 23 cromossomos; 4) 23, X


ou 23, Y / 1) Mitose; 2) 2 células-filha; 3) 46 cromossomos;
4) 46, XX.
b) 1) Meiose; 2) 2 células-filha; 3) 23 cromossomos; 4) 23, XY
/ 1) Mitose; 2) 4 células-filha; 3) 46 cromossomos; 4) 46, XX.
c) 1) Meiose; 2) 4 células-filha; 3) 23 cromossomos; 4) 23, X
/ 1) Mitose; 2) 2 células-filha; 3) 46 cromossomos; 4) 46, XY. É incorreto afirmar que
d) 1) Mitose; 2) 2 células-filha; 3) 46 cromossomos; 4) 46,
XX / 1) Meiose; 2) 4 células-filha; 3) 23 cromossomos; 4) 23, a) o ciclo de vida I é observado na espécie humana, na qual
X ou 23, Y. a fecundação entre os gametas ocorre na tuba uterina,
levando à formação da célula-ovo ou zigoto, que apresenta
e) 1) Mitose; 2) 2 células-filha; 3) 46 cromossomos; 4) 46, XY
a mesma quantidade de cromossomos do indivíduo
/ 1) Meiose; 2) 4 células-filha; 3) 23 cromossomos; 4) 23,X.
diploide.
b) no ciclo de vida II, a meiose é do tipo espórica, ou
2. (UFRGS 2017) Assinale com V (verdadeiro) ou F (falso) as intermediária, e a quantidade de cromossomos dos
afirmações abaixo, referentes à gametogênese em humanos. esporos é a metade da quantidade de cromossomos
observada no indivíduo diploide, indicando, assim, que a
( ) Em homens e em mulheres, a gametogênese tem início meiose ocorre para a sua formação.
na puberdade. c) o ciclo II é observado em plantas e algumas espécies
de algas, nas quais ocorre uma alternância de gerações,
( ) Em homens, a gametogênese ocorre nos túbulos sendo uma geração diploide, chamada de esporófito, e
seminíferos. outra haploide, chamada de gametófito.
d) no ciclo de vida I, a meiose é do tipo zigótica ou inicial,
( ) Em mulheres, a gametogênese produz quatro células
pois a quantidade de cromossomos presentes nos
haploides funcionais por mês.
indivíduos adultos diploides é o dobro da quantidade de
( ) Em homens e em mulheres, o hormônio folículo cromossomos observada na célula-ovo ou zigoto.
estimulante atua na maturação dos gametas. e) os ciclos de vida representados acima ocorrem durante
a reprodução sexuada de diferentes grupos de seres vivos,
A sequência correta de preenchimento dos parênteses, de nos quais observa-se o desenvolvimento dos zigotos a
cima para baixo, é partir de sucessivas mitoses, até a formação de novos
indivíduos diploides.

www.biologiatotal.com.br 5
4. (FGV 2016) O esquema a seguir ilustra um ciclo celular no a) IV apresenta dois pares de centríolos.
qual a célula realiza uma divisão mitótica. b) III está realizando síntese protéica.
c) II possui número haploide de cromossomos.
d) I apresenta fuso mitótico completamente formado.

6. (UFC 2003) As especializações das células das plantas estão


sempre associadas à estrutura das paredes celulares. Assim,
nos diferentes tecidos vegetais, as células têm paredes de
espessura e composição química variadas. No final da mitose,
na região central da célula, inicia-se a formação de lamelas
para originar a parede celular. A organela celular responsável
por essa formação é o:

a) aparelho de Golgi.
b) retículo endoplasmático.
c) cloroplasto.
d) vacúolo.
e) lisossomo.

7. (PUCSP 2003) Analise os ciclos de vida a seguir:

Com relação aos eventos característicos ocorridos durante


esse ciclo celular, é correto afirmar que

a) a condensação dos cromossomos ocorre conjuntamente


com o pareamento dos homólogos.
b) a separação das cromátides ocorre imediatamente após
a reorganização da membrana nuclear.
c) a duplicação do DNA é condição obrigatória para a
manutenção da ploidia celular original.
d) o posicionamento dos cromossomos no plano mediano
(equatorial) da célula ocorre durante a intérfase.
e) a mitose é o período de maior atividade celular tendo em
vista a expressão gênica nos cromossomos.
Com relação aos ciclos, é INCORRETO afirmar que
5. (UFRN 2003) A fotomicrografia adiante mostra células em
a) no ciclo I ocorre meiose gamética.
divisão na ponta da raiz da cebola.
b) no ciclo II ocorre meiose espórica.
c) nos ciclos I e II a formação dos indivíduos diploides a
partir do zigoto ocorre por mitose.
d) o ciclo II é apresentado por certas algas, plantas e pela
maioria dos animais.
e) o ciclo I é apresentado pela espécie humana.

8. (FUVEST 2003) Qual dos seguintes eventos ocorre no ciclo


de vida de toda espécie com reprodução sexuada?

a) Diferenciação celular durante o desenvolvimento


embrionário.
b) Formação de células reprodutivas dotadas de flagelos.
c) Formação de testículos e de ovários.
Campbell, M.A., Reece, J.B. Mitchell, L.G.. Biology. 5 ed. Menlo Park: Addison
Wesley Longman, 1999. p. 222. d) Fusão de núcleos celulares haploides.
e) Cópula entre macho e fêmea.
De acordo com o estágio em que cada célula numerada se
encontra, pode-se afirmar que

6
9. (MACKENZIE 2003) celular espontânea. Portanto, a inativação de qualquer um
dos componentes ou operadores do sistema de checagem
ou de apoptose poderia provocar a proliferação contínua das
células e possível desenvolvimento de tumores cancerosos.
Um exemplo observável das consequências de apoptoses é o
descamar da pele após sua exposição prolongada a radiação
solar intensa.

10. (PUCMG 2003) O esquema abaixo ilustra o texto anterior,


representando o ciclo celular de células somáticas de
mamíferos.

No esquema acima, que representa o ciclo de vida dos


vegetais I, II, III e IV, temos, respectivamente, os processos de
divisão celular:

a) mitose, meiose, mitose e mitose.


b) mitose, mitose, mitose e meiose.
c) meiose, mitose, mitose e mitose.
d) mitose, mitose, meiose e mitose.
e) meiose, mitose, meiose e mitose.
Assinale a alternativa incorreta

TEXTO PARA A PRÓXIMA QUESTÃO: a) A apoptose pode ser um mecanismo de defesa do


organismo.
O ciclo celular é interrompido entre as fases G1/S e G2/mitose, b) Lesões do DNA podem ativar a apoptose celular.
e proteínas especiais controlam a evolução do ciclo celular das c) Lesões no DNA podem suprimir a apoptose.
novas células. Entre S/G2 algumas proteínas checam possíveis d) Qualquer mutação que não seja corrigida pela apoptose
falhas e erros na linha de produção, decidem se o ciclo celular produzirá câncer.
avança ou é paralisado iniciando um processo de destruição
do material genético, conhecido como APOPTOSE, ou morte

ANOTAÇÕES

www.biologiatotal.com.br 7
GABARITO DJOW
1: [A] 5: [D]
O nome da divisão celular que produz gametas é meiose, resultando em 4
células-filha, com 23 cromossomos cada, sendo os pares sexuais no sexo
masculino 23, X e 23, Y. A divisão celular que produz células somáticas 6: [A]
é a mitose, produzindo 2 células-filha, com a mesma quantidade de
cromossomos cada, 46, sendo em uma mulher 46, XX.
7: [D]

2: [E]
8: [D]
Em mulheres, a gametogênese tem início na vida embrionária. Após a
puberdade até a menopausa – caso haja fecundação – serão formados: um
óvulo funcional e três glóbulos polares. 9: [C]

3: [D] 10: [D]


No ciclo de vida I, a quantidade de cromossomos presentes nos indivíduos
adultos diploides é a mesma quantidade de cromossomos do zigoto, através
da união dos gametas haploides.

4: [C]
A síntese de DNA durante o período 5 da interfase determina a duplicação
cromossômica, condição fundamental para a manutenção da ploidia das
células- filhas.

ANOTAÇÕES