Você está na página 1de 205

PRÉ-VESTIBULAR

EXTENSIVO
1
MATERIAL DO
PROFESSOR

Material exclusivo para professores


conveniados ao Sistema
Biologia
de Ensino
CIÊNCIAS DA NATUREZA
E SUAS TECNOLOGIAS
Dom Bosco
INICIAIS_BIO_1B_PROF.indd 1 08/10/18 17:05
DOM BOSCO - SISTEMA DE ENSINO
PRÉ-VESTIBULAR 1
Ciências da natureza e suas tecnologias.
© 2019 – Pearson Education do Brasil Ltda.

Vice-presidência de Educação Juliano Melo Costa


Gerência editorial nacional Alexandre Mattioli
Gerência de produto Silvana Afonso
Autoria Ana Carolina Marinho Mota, Sonia Graça Melo, Fernanda Lowndes
Coordenação editorial Luiz Molina Luz
Edição de conteúdo Lauro Tozetto
Assistência de edição Bunni Costa
Leitura crítica Rafael Simões, Hannah Hamada, Lorena Milock de Freitas
Preparação e revisão Igor Debiasi, Adriana Bairrada, Luzia Leite, Renata Coppolla
Gerência de Design Cleber Figueira Carvalho
Coordenação de Design Diogo Mecabo
Edição de arte Alexandre Silva
Assistência de arte Débora Lima
Coordenação de pesquisa e
licenciamento Maiti Salla
Pesquisa e licenciamento Cristiane Gameiro, Heraldo Colon, Andrea Bolanho, Sandra Sebastião, Shirlei Sebastião
Ilustrações Alex Cói, Carla Viana, Dayane Cabral, Madine Oliveira
Cartografia Allmaps
Projeto Gráfico Apis design integrado
Diagramação Editorial 5
Capa Apis design integrado
Imagem de capa mvp64/istock
Produtor multimídia Cristian Neil Zaramella
PCP George Baldim

Todos os direitos desta publicação reservados à


Pearson Education do Brasil Ltda.
Av. Santa Marina. 1193 - Água Branca
São Paulo, SP – CEP 05036-001
Tel. (11) 3521-3500
www.pearson.com.br

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
INICIAIS_BIO_1B_PROF.indd 2 22/10/18 16:43
APRESENTAÇÃO

Um bom material didático voltado ao vestibular deve ser maior que um grupo de
conteúdos a ser memorizado pelos alunos. A sociedade atual exige que nossos jo-
vens, além de dominar conteúdos aprendidos ao longo da Educação Básica, conheçam
a diversidade de contextos sociais, tecnológicos, ambientais e políticos. Desenvolver
as habilidades a fim de obterem autonomia e entenderem criticamente a realida-
de e os acontecimentos que os cercam são critérios básicos para se ter sucesso no
Ensino Superior.
O Enem e os principais vestibulares do país esperam que o aluno, ao final do Ensino
Médio, seja capaz de dominar linguagens e seus códigos; construir argumentações
consistentes; selecionar, organizar e interpretar dados para enfrentar situações-proble-
ma em diferentes áreas do conhecimento; e compreender fenômenos naturais, proces-
sos histórico-geográficos e de produção tecnológica.
O Pré-Vestibular do Sistema de Ensino Dom Bosco sempre se destacou no mer-
cado editorial brasileiro como um material didático completo dentro de seu segmento
educacional. A nova edição traz novidades, a fim de atender às sugestões apresentadas
pelas escolas parceiras que participaram do Construindo Juntos – que é o programa rea-
lizado pela área de Educação da Pearson Brasil, para promover a troca de experiências,
o compartilhamento de conhecimento e a participação dos parceiros no desenvolvi-
mento dos materiais didáticos de suas marcas.
Assim, o Pré-Vestibular Extensivo Dom Bosco by Pearson foi elaborado por uma
equipe de excelência, respaldada na qualidade acadêmica dos conhecimentos e na prá-
tica de sala de aula, abrangendo as quatro áreas de conhecimento com projeto editorial
exclusivo e adequado às recentes mudanças educacionais do país.
O novo material envolve temáticas diversas, por meio do diálogo entre os conteú-
dos dos diferentes componentes curriculares de uma ou mais áreas do conhecimento,
com propostas curriculares que contemplem as dimensões do trabalho, da ciência, da
tecnologia e da cultura como eixos integradores entre os conhecimentos de distintas
naturezas; o trabalho como princípio educativo; a pesquisa como princípio pedagógi-
co; os direitos humanos como princípio norteador; e a sustentabilidade socioambiental
como meta universal.
A coleção contempla todos os conteúdos exigidos no Enem e nos vestibulares de
todo o país, organizados e estruturados em módulos, com desenvolvimento teórico
associado a exemplos e exercícios resolvidos que facilitam a aprendizagem. Soma-se a
isso, uma seleção refinada de questões selecionadas, quadro de respostas e roteiro de
aula integrado a cada módulo.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
INICIAIS_BIO_1B_PROF.indd 3 08/10/18 17:05
SUMÁRIO

5 BIOLOGIA 1A

87 BIOLOGIA 1B

167 BIOLOGIA 2A

247 BIOLOGIA 2B

273 BIOLOGIA 3A

Material exclusivo para professores


conveniados ao Sistema de Ensino 323 BIOLOGIA 3B

Dom Bosco
INICIAIS_BIO_1B_PROF.indd 4 08/10/18 17:05
K PHOTO
Y STOC
/ ALAM
IMAGES
BLEND

BIOLOGIA 1A

Material exclusivo para professores


conveniados ao Sistema de Ensino
CIÊNCIAS DA NATUREZA E SUAS TECNOLOGIAS

Dom Bosco
DB_PV_2019_BIO1A.indd 171 08/10/18 16:30
1
172
BIOLOGIA 1A 6 –Material do Professor

ORIGEM DA VIDA NA TERRA

Em 2017, pesquisadores encontraram um exoplaneta, nomeado LHS 1140b, em uma


constelação dentro da Via Láctea denominada Cetus. Ele apresenta condições favoráveis
para existência de vida e, consequentemente, tem grandes chances de ser habitado.
Em relação à Terra, foram feitas as seguintes inferências: o LHS 1140b está a 40
• Geração espontânea ou
abiogênese anos-luz de distância; sua massa é 6 vezes maior; seu raio é 1,4 vezes maior. Além
disso, ele está 10 vezes mais próximo do seu Sol (a estrela LHS 1140) se comparada
• Biogênese versus abio-
gênese
à distância da Terra em relação a seu Sol. Por ser muito pequeno, o LHS 1140b recebe
muito menos radioatividade do que nosso planeta. Acredita-se que ele tenha sido for-
• Condições na Terra
mado há aproximadamente 5 bilhões de anos, em um processo idêntico ao da Terra.
primitiva e a síntese de
compostos orgânicos
De acordo com pesquisadores, todas essas características favorecem ainda mais a
hipótese de que o LHS 1140b possa abrigar alguma forma de vida.
HABILIDADES

MATJAZ SLANIC/ISTOCKPHOTO.COM
• Interpretar modelos e
experimentos para explicar
fenômenos ou processos
de obtenção e consumo de
energia no ambiente primi-
tivo precursor da vida.
• Compreender o método
científico e os procedimen-
tos próprios das ciências
naturais.

Representação do exoplaneta LHS 1140b orbitando sua estrela, a LHS 1140, presentes na constelação Cetus.
Elementos representados fora da escala de tamanho. Cores fantasia.

Além das características descritas no texto, quais outras possibilitam a existência


de vida em um planeta? Afinal, como surgiu a vida? Neste módulo, abordaremos as
principais teorias que tentaram explicar a origem da vida na Terra.

Geração espontânea ou abiogênese


A teoria da geração espontânea, também conhecida como abiogênese
(a = prefixo de negação; bio = vida; genesis = origem), fundamenta-se na ideia de que
os seres vivos se originam da matéria bruta inanimada. Um dos primeiros a defender
tal concepção foi o filósofo grego Aristóteles (384 a.C.-322 a.C), noção que perdurou
até meados do século XIX.
Essa teoria defendia que a vida se originava de matéria não viva, justificando que
os vermes surgiam espontaneamente do corpo de cadáveres em decomposição ou
que girinos eram gerados da água parada em poças ou da lama do fundo dos rios.

Material exclusivo para professores No século XVII, o belga Jean Baptista Van Helmont realizou um experimento para
comprovar a abiogênese. O cientista guardou grãos de trigo no meio de uma roupa suja
em um local escuro. Após 21 dias, verificou a presença de ratos e concluiu, então, que

conveniados ao Sistema de Ensino


os grãos de trigo haviam se transformado em ratos e que esse fenômeno ocorreu em
virtude do cheiro exalado pela roupa suja. Para o cientista, isso era um indício da existên-
cia de um “princípio vital”, que permitia à matéria bruta transformar-se em um ser vivo.

Dom Bosco
DB_PV_2019_BIO1A.indd 172 08/10/18 16:30
7 –Material do Professor 173

VITALINA/ISTOCKPHOTO.COM
um coberto com gaze e o outro, não. Como resultado,
CONSTANTINOSZ/
ISTOCKPHOTO.COM

TSEKHMISTER/
SHUTTERSTOCK
verificou a presença de larvas nos pedaços de carne do

BIOLOGIA 1A
frasco aberto, enquanto aquele tampado com gaze não
+ = apresentava larvas.
Assim, Redi concluiu que as larvas surgiram de ovos
Receita de Helmont para geração espontânea de ratos em determinado depositados na carne pelas moscas. Portanto, os se-
ambiente.
res vivos não poderiam ser originados da matéria bruta.
Com isso, pela primeira vez, a teoria da geração espon-
LEITURA COMPLEMENTAR tânea foi refutada.
O que é o método científico?
Apesar das conclusões incorretas, Van Helmont não dei- Observação do fenômeno e levantamento da hipótese
Há moscas próximas às carnes expostas ao ar livre. Nessas carnes
xou de seguir passos do método científico para testar sua
nascem larvas. Qual é a origem das larvas?
hipótese. Ele consiste em uma série de etapas e procedi-
mentos criados para testar uma teoria, no qual cientistas
desenvolvem experimentos com base na observação de
Criação da hipótese
um fenômeno para responder a uma pergunta. No caso As larvas surgem de ovos depositados na carne por moscas.
de Helmont, a questão era se seria possível seres vivos
surgirem da matéria bruta. Antes do experimento, foi
criada uma hipótese, ou seja, a resposta que ele esperava Experimento
encontrar. De acordo com a suposição de Helmont, era
possível criar seres vivos da matéria bruta.
Para isso, ele criou o experimento dos grãos de trigo en-

PEARSON EDUCATION LTD


Grupo Grupo
voltos na roupa suja, o que, supostamente, deveria origi- controle experimental
nar ratos. A seguir, analisou se não havia nenhuma falha Um dos
 !"#$%&'$(&)$*#+, Um dos
frascos é
-"./0#'#12$34# frascos é
no experimento e se o resultado fazia sentido. Assim, mantido aber- mantido
)#./"1$%&'$(&)
concluiu que o fenômeno imaginado por ele era possí- to durante
./0#'#12 fechado com
vel. Ou seja, para Helmont, sua hipótese estava correta. alguns dias. gaze durante
alguns dias.
Obviamente, o experimento do cientista belga não teve
o rigor científico necessário, pois hoje sabemos que os
ratos simplesmente foram atraídos pelo cheiro dos grãos
de trigo e do suor da roupa.
123RF.COM

Moscas Moscas não


voam sobre conseguem
a carne e chegar até
 5&66/,)$&77#&'#1
entram no a carne,
/"$,4#$8#&,$9"
frasco. impedidas
,4#$/7#"$%&'2 pela gaze.

Biólogos analisando a água de um rio. Uma das etapas do método Resultado Resultado
científico é examinar os dados disponíveis para testar uma hipótese. Larvas Larvas não
 :/$8&66/,)
aparecem. aparecem.
&77#&'#1
9"$,4#$./0#'#1
Biogênese versus %&'2

abiogênese

Material exclusivo para professores


Com o passar do tempo, surgiram pesquisadores
que contestaram a abiogênese por meio de outra teo- Conclusões
ria, a biogênese. De acordo com eles, os seres vivos Não ocorrem larvas de forma espontânea na
surgem de outros organismos preexistentes. carne. Portanto, a hipótese é confirmada.

conveniados ao Sistema de Ensino


Para comprovar essa teoria, em 1668 o naturalista
Simulação do experimento de Redi, no qual se verificou que larvas não
italiano Francesco Redi (1626-1697) criou um experi- surgem por geração espontânea. Elementos representados fora da escala
mento. Ele colocou pedaços de carne em dois frascos, de tamanho. Cores fantasia.

Dom Bosco
DB_PV_2019_BIO1A.indd 173 08/10/18 16:30
174 8 –Material do Professor

A DÚVIDA RETORNA do conteúdo. Em contrapartida, Needham alegou que


Spallanzani havia aquecido em excesso os frascos, o
BIOLOGIA 1A

Por volta do século XVIII, com um relativo avanço


nas técnicas de microscopia, foi possível descrever or- que teria destruído o princípio vital que possibilitava o
ganismos como bactérias, fungos e protozoários. Isso surgimento de microrganismos no caldo. Nesse emba-
motivou parte da comunidade científica a considerar te, Needham saiu fortalecido.
novamente a abiogênese como justificativa para a ori- Esses pesquisadores viveram em uma época na
gem desses seres microscópicos. qual a corrente de pensamento vigente era o vitalismo
Muitos cientistas defendiam que os microrganis- (em que se acreditava na existência de uma essência da
mos surgiam espontaneamente em todos os lugares, vida, o chamado princípio vital), também usado para
independentemente de haver outros preexistentes, o justificar o movimento dos astros por uma força invisí-
que enfraqueceu a teoria proposta por Redi. vel. Tal pensamento perdurou até o início do século XX.
Para testar a origem dos microrganismos, o naturalista
inglês John Needham (1713-1781), adepto da abiogêne- O EXPERIMENTO DE PASTEUR
se, colocou caldo de carne em alguns frascos, aqueceu O cientista francês Louis

OLEG GOLOVNEV/SHUTTERSTOCK
levemente o líquido e tampou os recipientes com rolhas. Pasteur (1822-1895) acompa-
Após alguns dias, Needham verificou que o caldo estava nhou toda a polêmica envol-
turvo, o que indicava a presença de microrganismos. Com vendo os experimentos de
base nesses resultados, concluiu que os microrganismos Needham e de Spallanzani.
se originavam da matéria inanimada e que o caldo seria o Adepto da teoria da biogêne-
princípio vital que possibilitava o fenômeno. se, Pasteur acreditava que os
O padre italiano, fisiologista e estudioso das ciên- microrganismos existentes
cias naturais Lazzaro Spallanzani (1729-1799) repetiu nos frascos dos experimen-
os experimentos de Needham, porém com algumas tos de Needham vieram do ar,
Louis Pasteur
modificações: adicionou o caldo de carne em frascos, contaminando o caldo.
fechando-os hermeticamente com rolhas e os aqueceu Para testar essa hipótese, Pasteur criou outro expe-
por mais tempo. Após alguns dias, Spallanzani verificou rimento. Colocou o caldo de carne em frascos de longo
ao microscópio que o caldo dos frascos permanecia da gargalo, em forma de “S”, chamados de “pescoço de
mesma forma, sem a presença de microrganismos. cisne”. Sem vedação, esse gargalo possibilitava a en-
trada de ar no frasco, mas não a de microrganismos,
(A) Experimento de Needham. (B) Experimento de Spallanzani. isso porque, após aquecer o caldo, gotículas de água
A)
condensavam-se no gargalo, formando um tipo de “fil-
tro”, em que os microrganismos ficavam retidos.
PEARSON EDUCATION LTD

Durante o processo, alguns frascos foram mantidos


com o gargalo, enquanto outros tiveram o gargalo re-
tirado. Observe a figura a seguir, que simula o experi-
mento de Pasteur.

ALESSANDRO SILVA/PEARSON BRASIL


Caldo de Frasco deixado Crescimento de
carne fervido aberto microrganismos

B)
1. O caldo de 2. O gargalo do 3. O caldo é fervido
carne é despejado frasco é esticado e e esterilizado,
em um frasco de curvado ao fogo matando todos os
pescoço longo microrganismos

Material exclusivo para professores Caldo de


carne fervido
Frasco fechado
com rolha
Sem crescimento
de microrganismos
4. No frasco sem o
gargalo, verifica-se
o crescimento de
5. No frasco com
o gargalo, não
se observam

conveniados ao Sistema de Ensino


microrganismos microrganismos
Spallanzani acreditava que Needham não havia fervido
o caldo o suficiente para matar os microrganismos e que
Esquema resumindo as etapas do experimento de Pasteur.
a falta de vedação dos frascos causou a contaminação

Dom Bosco
DB_PV_2019_BIO1A.indd 174 08/10/18 16:30
9 –Material do Professor 175

Após alguns dias, Pasteur percebeu que os caldos


dos frascos com gargalo estavam da mesma forma,
Condições na Terra

BIOLOGIA 1A
sem a presença de microrganismos. Já os caldos dos
frascos sem gargalo estavam turvos, indicando a pre-
primitiva e a síntese de
sença de microrganismos. compostos orgânicos
Dessa expe- Com a validação da teoria da biogênese, criou-se um
PICTURELAKE/ISTOCKPHOTO.COM

riência, Pasteur novo questionamento: se todos os seres vivos surgem de


concluiu que os outros preexistentes, qual a origem do primeiro de todos?
frascos com garga- Em 1920, tanto o bioquímico russo Aleksandr I.
lo não foram con- Oparin (1894-1980) quanto o geneticista britânico John
taminados por mi- S. Haldane (1892-1964) propuseram que a atmosfera
crorganismos em primitiva terrestre era um ambiente redutor — portan-
virtude da filtração to, doador de elétrons —, no qual moléculas inorgâ-
exercida pelo tubo, nicas simples poderiam formar compostos orgânicos
de maneira que mais complexos, por meio da constituição de ligações
apenas o oxigênio químicas que formam moléculas. Para que essa sínte-
chegava até o cal- se orgânica ocorresse, a energia provinha dos raios das
do. Nos frascos frequentes tempestades e da intensa radiação ultravio-
sem gargalo, hou- leta (UV), já que a camada de ozônio ainda não existia.
ve a contaminação Embora não seja consenso, acredita-se que a at-
Selo da República Centro-Africana em com microrganis- mosfera primitiva era formada por gás hidrogênio (H2),
homenagem a Louis Pasteur.
mos provenientes metano (CH4), amônia (NH3) e vapor de água (H2O). O
do ar, por não haver nada que impedisse sua entrada gás oxigênio não existia, ou estava presente em baixís-
no caldo. simas concentrações.
Assim a teoria da abiogênese foi refutada sem con- Haldane sugeriu, também, que a superfície da cros-
testações. Desde então, a ideia de que os seres vivos ta terrestre era tão quente que levava a um nível in-
são originados de outros organismos preexistentes — tenso de processos, como a evaporação e a condensa-
a biogênese — passou a ser aceita em definitivo pela ção da água, originando o ciclo das chuvas. A água das
comunidade científica. precipitações acumulava-se em depressões na crosta
O experimento de Pasteur propiciou o desenvolvi- terrestre, formando os oceanos primitivos, que eram
mento da técnica de pasteurização, que possibilita a rasos e quentes. Nesses oceanos, as moléculas orgâni-
esterilização de alimentos e bebidas por meio de aqueci- cas trazidas pelo escoamento das chuvas eram diluídas
mento, resultando em sua conservação por mais tempo. em um longo processo, que formaria, após muito tem-
po, uma “sopa de nutrientes”, rica em matéria orgânica,
LIDANTE/SHUTTERSTOCK

na qual surgiu a vida.


SCIENCE PHOTO LIBRARY/ALAMY STOCK PHOTO

Cenário hipotético da Terra primitiva. A atmosfera continha muitos gases


tóxicos e nos oceanos havia uma “sopa nutritiva”, formada por inúmeras

Material exclusivo para professores


substâncias orgânicas.

Essas moléculas orgânicas (carboidratos simples, ami-


noácidos, ácidos graxos e nucleotídeos), submetidas ao

conveniados ao Sistema de Ensino


aquecimento prolongado, possibilitaram a combinação
Alimentos como leite, iogurte, queijo cottage e coalhada são
de aminoácidos entre si, formando proteínas envoltas por
pasteurizados antes de sua comercialização. moléculas de água, os coacervatos (do latim coacervare:

Dom Bosco
DB_PV_2019_BIO1A.indd 175 08/10/18 16:30
176 10 – Material do Professor

formar grupos). É importante destacar que os coacerva- mos resultados, comprovando que, se as condições
BIOLOGIA 1A

tos não eram seres vivos, mas sim a primeira organização da atmosfera primitiva de fato fossem essas, havia
de substâncias orgânicas em um sistema semi-isolado do possibilidade de vida.
meio. Isso possibilitava trocas com o meio externo que Ao analisar o conteúdo da parte que simulava os
resultavam em reações químicas no meio interno, carac- oceanos, os pesquisadores encontraram uma va-
terizando um metabolismo rudimentar. riedade de aminoácidos, os mesmos encontrados
Apesar de não se saber como surgiu a primeira cé- nos seres vivos atuais, além de outros compostos
lula, supõe-se que, com base nos coacervatos, se criou orgânicos.
um ambiente delimitado (intracelular). A partir de então, Atualmente, cientistas afirmam que há 4,6 bi-
outros sistemas equivalentes de delimitações surgiram lhões de anos a Terra possivelmente tinha alto índi-
e proporcionaram o desenvolvimento de locais restritos ce de gases derivados de vulcões, como gás carbô-
para reações entre as moléculas, formando sistemas nico (CO 2), nitrogênio (N 2), hidrogênio (H 2) e sulfeto
organizados, nos quais uma membrana constituída de de hidrogênio (H 2S). No entanto, não se sabe de
lipídios e proteínas envolveu um meio interno que apre- fato se a atmosfera primitiva continha metano e
sentava uma molécula de ácido nucleico. Por meio des- amônia suficientes para serem reduzidos. Por isso,
te, foram possíveis a reprodução e a regulação das rea- acredita-se que essa atmosfera não era nem re-
ções internas. É nesse momento que surge o primeiro dutora nem oxidante. Possivelmente, pequenas
ser vivo, capaz de originar outros semelhantes a ele. “partes” da atmosfera primitiva — provavelmen-
te perto de vulcões — eram redutoras. É possível
MILLER E A EVOLUÇÃO MOLECULAR que os primeiros compostos orgânicos tenham se
Em 1953, os cientistas da Universidade de Chi- formado próximos a vulcões submersos e fontes
cago Stanley Miller e Harold Urey decidiram testar termais no fundo dos oceanos. Essas regiões são
a hipótese de Oparin e Haldane. Para isso, usaram ricas em enxofre inorgânico e compostos ferrosos,
um simulador formado por tubos e balões de vidro usados na síntese de trifosfato de adenosina (ATP)
interligados. Nesse aparelho foram introduzidos me- em alguns organismos atuais, como as bactérias
tano (CH4), amônia (NH3), hidrogênio (H2) e vapor de extremófilas.
água (H 2O).
PABLO HIDALGO/SHUTTERSTOCK

Durante uma semana, o aparelho foi exposto à


alta intensidade de descarga elétrica. O resultado
foi a presença de moléculas orgânicas, incluindo
aminoácidos, o que suporta a hipótese de Oparin e
Haldane. Posteriormente, vários cientistas repetiram
o experimento de Miller e Urey e obtiveram os mes-

Mistura gasosa contendo


SCIENCE PHOTO LIBRARY/ALAMY STOCK PHOTO

Vapor-d’água (H2O)
3 CH4, NH3, H2 e H2O

4 1 - Água
Eletrodo de
2 - Vapor
2 alta-tensão
(60 000V) 3 - Descargas
Saída de elétricas
água fria
4 - Amônia (NH3)
Metano (CH4)
Hidrogênio Erupção do vulcão Tungurahua, no Equador. Possivelmente os primeiros
(H2) compostos orgânicos surgiram próximos a vulcões submersos e a fontes
Condensador 5 - Resfriamento termais oceânicas.
1
5 por água
corrente O experimento de Miller e Urey comprovou que
Entrada de
água fria 6 - Aminoácidos
é possível a síntese de moléculas orgânicas, com
foram base em compostos inorgânicos. Essa ideia é apoia-
Água 6 achados na da também pela análise da composição química de
fervendo amostra
Acúmulo de água meteoritos. Fragmentos de um meteorito de 4,5
e de moléculas
bilhões de anos encontrado em 1969, na Austrália,

Material exclusivo para professores


orgânicas
contêm mais de 80 aminoácidos. Curiosamente as
Esquema do experimento de Miller. Ao ferver a água, o vapor formado proporções desses aminoácidos são similares às
movimenta todo o sistema em um só sentido. Descargas elétricas simulam
os raios e a radiação UV no balão com a mistura gasosa. Após as descargas
produzidas no experimento de Miller.

conveniados ao Sistema de Ensino


elétricas, a mistura é submetida a um resfriamento, semelhante à
condensação nas altas camadas da atmosfera, responsável pelas chuvas. A
porção inferior, em forma de U, simula os oceanos primitivos, que recebiam
as águas das chuvas e os compostos formados na atmosfera.

Dom Bosco
DB_PV_2019_BIO1A.indd 176 08/10/18 16:30
11 – Material do Professor 177

ROTEIRO DE AULA

BIOLOGIA 1A
ORIGEM DA VIDA

Criou uma receita para


geração espontânea de
Helmont ratos a partir de grãos e Redi
roupa suja:

Abiogênese Biogênese

Needham Spallanzani Pasteur Oparin e Raldane

Caldo de carne em Caldo de carne em Experimento com Terra primitiva


frascos levemente frascos com aqueci- tubos “pescoço de
aquecidos. mento prolongado. cisne” que compro-
vou a biogênse.

Superfície terrestre

Material exclusivo para professores


quente, com des-
Criaram um apare- cargas elétricas e
Miley e Urey lho simulando essas radiação solar inten-

conveniados ao Sistema de Ensino


condições. sas e atmosfera for-
mada por CH4, NH3,
H2O e H2.

Dom Bosco
DB_PV_2019_BIO1A.indd 177 08/10/18 16:30
178 12 – Material do Professor

EXERCÍCIOS DE APLICAÇÃO
BIOLOGIA 1A

1. Sistema Dom Bosco – Sobre a hipótese da abiogênese 5. Sistema Dom Bosco – Spallanzani realizou um expe-
ou geração espontânea é correto afirmar que: rimento no qual recipientes contendo caldo de carne
a) tem como base a ideia que os organismos eram ori- fechados com rolha foram aquecidos por um tempo
ginados a partir de outros organismos preexistentes. razoável. Posteriormente, ao observar o caldo em mi-
croscópio, percebeu que não havia nenhum tipo de mi-
b) defende que Deus criou todos os organismos.
crorganismo. Esse experimento foi importante, pois:
c) apoia-se na ideia de que os organismos são origina-
a) a partir dele que a hipótese da abiogênese foi supor-
dos a partir da matéria bruta.
tada.
d) acredita que os organismos vieram para a Terra por
b) os resultados obtidos corroboram a hipótese da bio-
meio de meteoros.
gênese.
Alternativa C. A alternativa A está incorreta porque se trata da hipótese
de biogênese. A alternativa B está incorreta porque se refere ao cria-
c) a partir dele foi comprovada a existência de coacerva-
cionismo. A alternativa D está incorreta porque se refere à panspermia. tos.
d) a partir dele foi comprovada que a Terra primitiva tinha
2. Sistema Dom Bosco – Diferencie a teoria da geração alta concentração de oxigênio.
espontânea da teoria da biogênese.
Alternativa B. Com base nesse experimento, Spallanzani tentou com-
Resposta: A teoria da geração espontânea defende que os or- provar que os organismos não conseguiam se originar com base na ma-
téria bruta, como o caldo de carne.

ganismos são formados com base na matéria inanimada; a teo- 6. UFMT – Sobre a origem dos seres vivos, duas teorias
sustentam uma polêmica nos meios científicos, até
ria da biogênese acredita que um ser vivo origina-se de outro fins do século XIX: a teoria da geração espontânea
(abiogênese) e a teoria da biogênese. Discuta e com-
ser vivo, por reprodução. pare tais teorias, explicando também como foi solu-
cionada a polêmica.
Resposta: Abiogênese: sustentava a ideia de que a vida se

originava da matéria inanimada, de forma contínua, podendo

surgir de qualquer tipo de matéria.


3. UFPI – Por volta de 1860, um famoso cientista demons-
trou que uma suspensão previamente esterilizada de Biogênese: postulava que a vida só se originava de vida pree-
levedo de cerveja em água mantém-se estéril indefini-
damente se for conservada em frasco do tipo “pescoço
xistente, refutando inteiramente a formação de seres com base
de cisne”. Este resultado expressa a ideia chamada:
a) teoria da biogênese.
na matéria bruta.
b) teoria da abiogênese.
c) teoria da pré-formação. A polêmica entre essas teorias foi solucionada por um expe-
d) hipótese heterotrófica.
e) hipótese autotrófica. rimento realizado por Pasteur, com o frasco do tipo “pescoço

Alternativa A. A demonstração feita por Pasteur confirma a teoria de


que só os seres vivos podem originar outros.
de cisne”. Esse experimento mostrou que um líquido, após ser

4. Sistema Dom Bosco – Um cientista, ao tentar provar fervido, não contém seres vivos, pois foram mortos pela fervu-
uma hipótese, deixou uma camisa velha suada com
grãos de trigos em uma sala escura. Após alguns dias, ra. Somente após o resfriamento e a retirada do “pescoço de
percebeu que não havia mais trigos e que surgiram mui-
tos ratos. Esse experimento corrobora: cisne”, os seres vivos aparecem.
a) a hipótese da abiogênese, que justificaria que o trigo
se transformou em ratos.
b) a hipótese da biogênese, pois o rato deve ter sido
originado a partir do suor.
c) a hipótese da biogênese, que explicaria que a camisa
se transformou em ratos.
d) a hipótese da abiogênese que defende que os ratos
foram atraídos ao local pelo cheiro do suor e dos

Material exclusivo para professores


grãos de trigo.
Alternativa A. O experimento descrito foi realizado por Helmont,
adepto da abiogênese. Essa hipótese tem por base a ideia de que os
organismos se originaram com base na matéria bruta. No caso desse

conveniados ao Sistema de Ensino


experimento, o trigo se transformou em ratos, na concepção do cien-
tista da época.

Dom Bosco
DB_PV_2019_BIO1A.indd 178 08/10/18 16:30
13 – Material do Professor 179

EXERCÍCIOS PROPOSTOS

BIOLOGIA 1A
7. Sistema Dom Bosco – No século XVIII Needham realizou a) adição de conservantes durante a produção.
o seguinte experimento: adicionou caldo de carne em um b) desnaturação das proteínas pelo aquecimento.
recipiente e o aqueceu levemente. Depois o fechou com
c) redução do crescimento de colônias de bactérias.
rolha. Após alguns dias, foi observado que o caldo estava
turvo, indicando que havia microrganismos. Qual foi o pro- d) eliminação dos microrganismos pela alta temperatura.
pósito desse experimento? e) impedimento da contaminação pela embalagem utilizada.
a) Testar se os seres vivos surgiam a partir da matéria bruta.
12 Unesp – Uma vez que não temos evidências por obser-
b) Testar se os seres vivos surgiam a partir de outros
vação direta de eventos relacionados à origem da vida,
seres vivos.
o estudo científico desses fenômenos difere do estudo
c) Testar se microrganismos eram capazes de crescer de muitos outros eventos biológicos. Em relação a es-
no caldo de carne. tudos sobre a origem da vida, apresentam-se as afirma-
d) Testar se o caldo de carne mudava de cor ao ser ex- ções seguintes.
posto ao fogo. I. Uma vez que esses processos ocorreram há bilhões
de anos, não há possibilidade de realização de ex-
8. Sistema Dom Bosco – Francisco Redi, no século XVII, perimentos, mesmo em situações simuladas, que
investigou a origem dos vermes nas carnes em decompo- possam contribuir para o entendimento desses pro-
sição. Para isso, ele desenvolveu um experimento do qual cessos.
foram colocados pedações de carne em decomposição II. Os trabalhos desenvolvidos por Oparin e Stanley Mil-
em frascos abertos e em frascos cobertos com gaze. O ler ofereceram pistas para os cientistas na constru-
resultado é que apareceram vermes apenas nos frascos ção de hipóteses plausíveis quanto à origem da vida.
que estavam abertos. O resultado desse experimento foi
III. As observações de Oparin sobre coacervados ofere-
importante na época porque:
ceram indícios sobre um processo que se constituiu,
a) a partir dos resultados obtidos, foi comprovada a ori- provavelmente, em um dos primeiros passos para a
gem de seres vivos a partir da matéria bruta. origem da vida, qual seja, o isolamento de macromo-
b) a partir dos resultados obtidos, foi comprovada a ori- léculas do meio circundante.
gem de seres vivos a partir de seres já existentes – Em relação a estas afirmações, podemos indicar como
teoria da biogênese.
corretas:
c) a partir dos resultados obtidos, foi refutada a hipóte-
se da biogênese. a) I, apenas.
d) foi comprovado que seres heterótrofos surgiram pri- b) II e III, apenas.
meiro. c) II, apenas.
d) I, II e III.
9. Sistema Dom Bosco – Helmont, no século XVII, descre- e) I e II, apenas.
veu um experimento no qual dizia que, ao colocar uma
camisa suada com grãos de trigo em um local escuro, 13. PUC-SP – Na figura abaixo, temos representado um
após 21 dias, apareceriam camundongos. Esse experi- aparelho projetado por Stanley Miller, no início da dé-
mento é um exemplo de qual hipótese? cada de 1950. Por esse aparelho circulavam metano,
a) Hipótese autotrófica. amônia, vapor de água e hidrogênio e, através de ener-
b) Hipótese heterotrófica. gia fornecida por descarga elétrica, produtos de reações
c) Biogênese. químicas como aminoácidos, carboidratos e ácidos gra-
xos eram coletados no alçapão.
d) Abiogênese.

SCIENCE PHOTO LIBRARY/ALAMY STOCK PHOTO


10. Sistema Dom Bosco – Oparin e Haldane admitiram Vapor-d’água (H2O) Mistura gasosa contendo
que a Terra surgiu a aproximadamente 3,5 bilhões de 3 CH4, NH3, H2 e H2O
anos. Cite quais os gases que esses cientistas acredita-
vam estarem presentes na atmosfera primitiva. 4 1 - Água
Eletrodo de
2 - Vapor
2 alta-tensão
(60 000V) 3 - Descargas
Saída de elétricas
água fria
4 - Amônia (NH3)
Metano (CH4)
Hidrogênio
(H2)

1 Condensador 5 - Resfriamento
5 por água
11. Cefet-MG – A produção industrial de leite pode ocorrer corrente

Material exclusivo para professores


Entrada de
por dois processos: por meio da ultrapasteurização, em água fria 6 - Aminoácidos
que se obtém o leite longa vida (UHT) em caixinhas, cuja foram
validade média é de 180 dias em prateleira; e pela pas- Água 6 achados na
teurização que origina o leite em saquinhos que deve ser fervendo amostra

conveniados ao Sistema de Ensino


Acúmulo de água
consumido em até 7 dias, mantido sob refrigeração. O e de moléculas
primeiro processo evita a deterioração desse produto orgânicas
porque nele ocorre:

Dom Bosco
DB_PV_2019_BIO1A.indd 179 08/10/18 16:30
180 14 – Material do Professor

Através desse experimento, Miller testou a hipótese de 16. Sistema Dom Bosco – Ensacar goiabas no pé para evi-
BIOLOGIA 1A

que, na atmosfera primitiva sob ação de raios, tar o aparecimento de bichos é uma ação que lembra
a) compostos orgânicos puderam se formar a partir de um experimento realizado por Redi, que demonstrou
moléculas simples. que larvas não se originam a partir da carne. Esse expe-
rimento corrobora com qual das hipóteses seguir?
b) compostos inorgânicos puderam se formar a partir
de moléculas orgânicas. a) biogênese
c) compostos inorgânicos e orgânicos puderam originar b) abiogênese
os primeiros seres vivos. c) hipótese autotrófica
d) macromoléculas puderam se formar a partir de molé- d) hipótese heterotrófica
culas orgânicas simples.
e) coacervados puderam se formar a partir de molécu- 17. Sistema Dom Bosco
las inorgânicas. “[...] O pesquisador [Jeremy L. England] teria desenvol-
vido uma fórmula matemática que poderia explicar a ca-
14. Sistema Dom Bosco – Miller e Urey criaram um expe- pacidade de seres vivos serem melhores em absorver a
rimento que simulou as condições da Terra primitiva. energia do seu ambiente e dissipá-la em forma de calor
a) Qual era a hipótese de Miller e Urey? em comparação a aglomerados inanimados de átomos de
carbono. A fórmula, baseada em uma física já conhecida,
indicaria que quando um grupo de átomos é guiado por
uma fonte externa de energia (tal como o sol ou combus-
tíveis químicos) e cercada por um meio que mantenha o
calor (como o oceano ou a atmosfera), ela provavelmente
iria se reestruturar gradualmente, de forma a dissipar cada
vez mais energia. Isso poderia significar que, em determi-
nadas condições, a matéria iria inevitavelmente adquirir o
atributo físico associado à vida.
[...]
O trabalho de Jeremy England trata justamente de dois
temas que renderam diversos debates no meio científico
durante muitos anos – a abiogênese e a termodinâmica.
Esses dois termos são constantemente utilizados para
tentar invalidar as hipóteses para o surgimento da vida na
b) Qual foi o resultado do experimento? A hipótese es- Terra e a evolução biológica. [...]”.
tava correta ou incorreta?
MENEGÍDIO, Fabiano B.; RUFO, Henrique P. Equívocos sobre a
origem da vida e a termodinâmica. In: Observatório da Imprensa,
edição 840. Disponível em :<http://observatoriodaimprensa.com.
br/jornal-de-debates/_ed840_equivocos_sobre_a_origem_da_
vida_e_a_termodinamica/>. Acesso em: abr. 2018. (Adaptado)

Explique o conceito da abiogênese.

15. UCDB-MS – Analise as afirmações:


I. Quando se deixa um pedaço de carne exposto ao ar,
nele podem aparecer vermes.
II. Se o frasco que contém os pedaços de carne for co-
berto por uma gaze, os vermes aparecem na gaze e
não na carne.
Essas afirmações fortalecem a teoria de origem da vida
chamada:

Material exclusivo para professores


a) abiogênese.
b) geração espontânea.
c) hipótese de Malthus.

conveniados ao Sistema de Ensino


d) biogênese.
e) heliocêntrica.

Dom Bosco
DB_PV_2019_BIO1A.indd 180 08/10/18 16:30
15 – Material do Professor 181

ESTUDO PARA O ENEM

BIOLOGIA 1A
18. Sistema Dom Bosco C5-H29 a) superfície muito quente, com poucas descargas elé-
A pasteurização é um processo de esterilização tricas e baixo índice de radiação;
de alimentos e bebidas no qual esses são levados b) superfície muito quente, com muitas descargas elé-
a altas temperaturas para exterminar todos os mi- tricas e baixo índice de radiação;
crorganismos que possam estar nesses produtos. A c) superfície muito quente, com muitas descargas elé-
respeito do experimento de Pasteur, não se pode tricas e alto índice de radiação;
afirmar que: d) superfície fria, com muitos gases e alto índice de
a) Pasteur tinha a hipótese de que os microrganismos radiação.
estavam no ar e contaminavam o alimento.
20. Sistema Dom Bosco C5-H17
b) Pasteur utilizou tubos “pescoço de cisne” na saída
dos frascos que continham caldo de carne. “A formação do Atol das Rocas é uma história que exi-
ge no mínimo três disciplinas para ser contada: geolo-
c) Pasteur era adepto da geração espontânea.
gia, oceanografia e biologia. O atol fica no topo de um
d) O tubo “pescoço de cisne” filtrava o ar, de maneira monte submarino de origem vulcânica, de aproxima-
que os microrganismos não entrassem nos frascos. damente 4 mil metros de altitude (mil metros a mais
que o Pico da Neblina, a montanha mais alta do Brasil
19. Sistema Dom Bosco C5-H17
na superfície). Mas sua estrutura não é vulcânica. Tudo
“Mesmo parecendo tão natural, os cientistas ainda estão
que se vê e se toca em Rocas é de origem biogênica
longe de chegar a um consenso quando o assunto é a
[...]”.
origem da vida. Afinal, séculos de pesquisas não foram
suficientes para que alguém conseguisse reproduzir, em ESCOBAR, Herton. Reportagem especial: Atol das Rocas. In: Estadão.
todos os seus detalhes, as condições reais da Terra pri- Disponível em: <http://ciencia.estadao.com.br/blogs/
herton-escobar/reportagem-especial-atol-das-rocas-2/>.
mitiva.“A mais complicada máquina inventada pelos hu-
Acesso em: abr. 2018.
manos não passa de brinquedo diante do mais simples
organismo”, escreveu o biólogo americano e ganhador
do prêmio Nobel de medicina em 1967, George Wald. “A O que significa ter origem biogênica?
maior dificuldade está na minuciosa ajustagem de uma a) Significa que os organismos são originados a partir
molécula na outra, proeza que não está ao alcance de ne- de outros organismos preexistentes.
nhum químico. ”
b) Significa que os organismos são originados a partir da
MORAIS, Jomar . O mistério da vida. In: Superinteressante. matéria bruta.
Disponível em: <https://super.abril.com.br/ciencia/o-misterio-d-vida/>. c) Significa que os organismos são originados por um
Acesso em: abr. 2018. ser superior.
Com base no texto, marque a alternativa que melhor d) Significa que os organismos não existem nesse
descreve a Terra primitiva: local.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A.indd 181 08/10/18 16:30
2
182 16 – Material do Professor

CARACTERÍSTICAS DOS
BIOLOGIA 1A

PRIMEIROS SERES VIVOS

Até pouco tempo, o registro mais antigo de um organismo multicelular era datado
de 600 milhões de anos. No entanto, fósseis encontrados em 2016 sugerem que
• Protobiontes organismos multicelulares de longos centímetros existiram há, aproximadamente,
• Origem dos organismos 1,56 bilhão de anos.
unicelulares A descoberta é liderada por Maoyan Zhu, da Academia Chinesa de Ciências de Nan-
jing, que encontrou um fóssil no norte da China com registros de organismos de até 30
HABILIDADES centímetros de comprimento. As células desses seres mediam entre 6 e 18 micrômetros
• Descrever as caracterís- de diâmetro e eram bastante compactas. Ao compará-los com organismos atuais, foi cons-
ticas dos primeiros seres tatado que os fósseis provavelmente eram eucariotos fotossintéticos, similares às algas.
vivos presentes na Terra Atualmente, a evidência mais antiga de vida na Terra são microfósseis de procario-
primitiva. tos e estruturas rochosas estratificadas muito antigas, produzidas por cianobactérias
• Compreender as evidências há 3,5 bilhões de anos denominadas estromatólitos.
que elucidam a origem dos
LIZGIV/DREAMSTIME.COM

organismos celulares.
• Relatar como se deram os
processos de obtenção e
consumo de energia no am-
biente primitivo precursor
da vida.
• Explicar como foram origi-
nados os seres eucariotos.

Os estromatólitos são estruturas rochosas antigas, de aproximadamente 3,5 bilhões de anos, encontrados no sul
da África e na Austrália.

Neste módulo, abordaremos as principais características dos primeiros seres


vivos que habitaram a Terra. Além disso, serão discutidas as mais relevantes hi-
póteses a respeito da forma de obtenção de energia e como foram originados os
seres eucariotos.

Protobiontes
A reprodução e o metabolismo próprio são características essenciais à vida, por
isso uma propriedade não pode existir sem a outra. Ao longo do tempo, pesquisadores
repetiram o experimento Miller-Urey e obtiveram algumas bases nitrogenadas de ácido
desoxirribonucleico (DNA) e ácido ribonucleico (RNA). No entanto, ainda não foi produ-
zido nada parecido com nucleotídeos. Uma nova hipótese surgiu: se não havia nucleo-
tídeos na “sopa primitiva”, moléculas autorreplicadoras e algum tipo de metabolismo

Material exclusivo para professores rudimentar devem ter surgido na mesma época. Como isso pode ter acontecido?
A resposta pode estar nos protobiontes, um grupo de moléculas formadas de
compostos inorgânicos, rodeadas por uma estrutura semelhante a uma membrana.

conveniados ao Sistema de Ensino


Diferentemente dos coacervatos, os protobiontes podem exibir algumas característi-
cas dos seres vivos, como a reprodução simples e um metabolismo capaz de realizar
a manutenção do meio interno.

Dom Bosco
DB_PV_2019_BIO1A.indd 182 08/10/18 16:30
17 – Material do Professor 183

Em laboratório, experimentos demonstraram que podiam replicar-se e guardar informações sobre os pro-
os protobiontes são formados de compostos orgânicos tobiontes que as carregavam. Os protobiontes primitivos

BIOLOGIA 1A
produzidos abioticamente. Os lipossomos são gotícu- melhor sucedidos aumentaram em número em virtude da
las rodeadas por uma membrana e são formados quan- capacidade de explorar seus recursos mais eficientemente
do lipídios e outras moléculas orgânicas são adicionados e passaram essas habilidades para seus descendentes.
à água. As moléculas de gordura, por serem hidrofóbi- Com o aparecimento das sequências de RNA em
cas, organizam-se em uma parede dupla na superfície protobiontes, muitas mudanças foram possíveis. O
da água, semelhante à bicamada lipídica da membrana RNA pode ter fornecido a matriz para a formação dos
plasmática. Os lipossomos podem multiplicar-se por nucleotídeos de DNA, por exemplo. Com o apareci-
meio da permeabilidade seletiva dessa camada dupla, mento do DNA, é provável que as moléculas de RNA
que incha ou encolhe conforme as trocas osmóticas tenham assumido o papel que desenvolvem atualmen-
com o meio. Também foi observado que, no interior te, de intermediárias na tradução genética, e o “mundo
desses lipossomos, há reações metabólicas simples, de RNA” deu lugar ao “mundo de DNA”, possibilitando o
outra importante característica para a origem da vida. surgimento das mais diferentes formas de vida.

Origem dos organismos


SHADOW_CLUSTER/DREAMSTIME.COM

Parte hidrofílica
do lipídio
Meio interno
(tem afinidade
com a água)
unicelulares
Os primeiros seres vivos da Terra possivelmente fo-
ram procariotos (organismos sem membrana nuclear)
Parte hidrofóbica primitivos que viveram entre 3,5 e 2,1 bilhões de anos
do lipídio atrás. As primeiras evidências de vida foram encontradas
Meio externo (não tem afinidade
com a água)
em rochas denominadas estromatólitos, que datam de
aproximadamente 3,5 bilhões de anos. Os estromatólitos
Representação esquemática de um lipossomo. Elementos são formações rochosas estratificadas, que podem ter
representados fora da escala de tamanho. Cores fantasia. sido formadas da agregação de sedimentos de um grupo
de bactérias fotossintetizantes, as cianobactérias.
AUTORREPLICAÇÃO DE RNA

GETTY IMAGES/ISTOCKPHOTO
E O MEIO COMO UM AGENTE DE
SELEÇÃO NATURAL
Muitos questionam qual material genético teria se
originado primeiro: o ácido desoxirribonucleico (DNA)
ou o ácido ribonucleico (RNA). A ideia mais aceita atual-
mente é de que o RNA foi a molécula precursora da
vida, por conter todas as informações necessárias para
montar uma proteína e pelo fato de conseguir catalisar
as próprias reações, de maneira similar às enzimas.
Essa ideia foi comprovada pelos cientistas Thomas
Cech, da Universidade do Colorado, e Sidney Altman,
da Universidade de Yale, que chamaram esse RNA ca-
talítico de ribozima. Em seu experimento, Cech obser- Estromatólitos na Baía dos Tubarões, oeste da Austrália. A datação dessas
vou que algumas ribozimas fazem cópias complemen- rochas em média é de 3,5 bilhões de anos.
tares de pequenas partes do RNA, quando fornecida a
matéria-prima para a formação de nucleotídeos. Atualmente, estromatólitos podem ser encontrados
Em alguns meios, as moléculas de RNA com determina- em algumas baías quentes, rasas e com alta concen-
dos nucleotídeos são mais estáveis e conseguem se repli- tração de sal. Se esses organismos unicelulares eram
car mais e com menos erros do que outras sequências. Es- complexos o suficiente para formar estromatólitos que
sas moléculas, por serem mais adaptadas ao meio externo, existiram há mais de 3,5 bilhões de anos, é razoável
conseguem deixar mais descendentes, que formam uma pensar que os procariotos primitivos se originaram bem
espécie de família com sequências de nucleotídeos que di- antes, talvez há 3,9 bilhões de anos.

Material exclusivo para professores


ferem levemente umas das outras. Eventualmente, um erro
de cópia da sequência de nucleotídeos resulta em uma mo- HIPÓTESE HETEROTRÓFICA VERSUS
lécula com forma mais estável que a ancestral e vice-versa. HIPÓTESE AUTOTRÓFICA
É possível que na Terra primitiva tenham ocorrido even- Ao longo do tempo, o meio atuou sobre a forma

conveniados ao Sistema de Ensino


tos de seleção similares. Dessa forma, a biologia molecular de obtenção de energia, produzindo e selecionando
atual provavelmente foi precedida por um “mundo de RNA”, novos mecanismos, como a respiração e a fotossínte-
no qual moléculas de RNA contendo informações genéticas se. No entanto, a maioria do oxigênio atmosférico (O2) é

Dom Bosco
DB_PV_2019_BIO1A.indd 183 08/10/18 16:30
184 18 – Material do Professor

de origem biológica, o que indica que sua ocorrência era De 2,7 bilhões de anos a 2,2 bilhões de anos atrás, a
BIOLOGIA 1A

improvável, ao menos em quantidade suficiente para os quantidade de oxigênio atmosférico aumentou gradual-
processos aeróbios antes do surgimento dos seres vivos mente, com um aumento repentino posterior para mais
capazes de sustentar as vias metabólicas desse processo. de 10% do nível atual. Tal fato teve enorme impacto na
Inicialmente acreditava-se que os primeiros orga- vida terrestre, especialmente entre muitos grupos pro-
nismos eram heterótrofos, por serem simples e, pro- carióticos. Algumas espécies sobrevivem em ambientes
vavelmente, alimentarem-se de moléculas existentes anaeróbios, onde se verificam alguns de seus descen-
no oceano primitivo. Essa ideia é chamada de hipótese dentes, como as arqueias extremófilas (organismos
heterotrófica. De acordo com ela, em virtude de o am- procariotos, mas com características diferentes das bac-
biente aos poucos se tornar rico em dióxido de carbono, térias), a exemplo das halófilas (adaptadas a ambientes
resultado do metabolismo dos seres heterótrofos, os aquáticos e altamente salinos), as termófilas ou hiperter-
organismos autótrofos surgiram depois, promovendo o mófilas (adaptadas a altas temperaturas, entre 70 ºC e
aumento de oxigênio na Terra e de organismos aeróbios. 150 ºC), as psicrófilas (adaptadas a baixas temperaturas)
Outra ideia acerca da forma de obtenção de energia e as radiorresistentes (adaptadas à alta radiação UV).
dos primeiros seres vivos era a hipótese autotrófica, que

GETTY IMAGES/ISTOCKPHOTO
tem como base os organismos quimiossintetizantes que
produzem compostos orgânicos com base em moléculas
de gás carbônico, água e energia. Atualmente essa é a hi-
pótese mais aceita. De acordo com ela, ao longo do tempo
o meio foi modificado e, por conta disso, os organismos
sofreram mutações, gerando posteriormente organismos
fotossintetizantes, o que promoveu o aumento de oxigênio
na Terra e, consequentemente, deu origem a organismos
aeróbios. Com o acúmulo de oxigênio na atmosfera, foi
originada a camada de ozônio, que reduziu a intensidade
de radiação e, assim, possibilitou posteriormente aos orga-
nismos viverem fora do ambiente aquático. Lagoa Vermelha, na Bolívia. O crescimento de colônias de bactérias
Atualmente sabe-se que o oxigênio provém da que- extremófilas modifica as cores da água.
bra da molécula de água durante a fotossíntese. Com a
evolução da fotossíntese o O2 produzido possivelmente Em vista da existência desses organismos em am-
foi dissolvido na água. Ao atingir uma concentração alta bientes hostis à vida (da perspectiva antropogênica),
o suficiente para reagir com o ferro, também dissolvi- muito similares àqueles encontrados nos primórdios da
do, ocorreu a precipitação em óxido de ferro, que se formação do planeta, eles tornaram-se uma das prin-
acumulou nos sedimentos. Após a precipitação do ferro cipais evidências da hipótese autotrófica: as arqueias,
dissolvido, o oxigênio adicional foi dissolvido na água, vivendo em ambientes de condições extremas à vida,
tornando os mares e lagos ambientes saturados. Da sua como fontes termais e fendas vulcânicas, em que rea-
volatilização na água, o O2 conseguiu finalmente entrar lizam a quimiossíntese, produzindo energia do enxofre.
na atmosfera. Essa mudança pode ser vista nas marcas Observe a reação da quimiossíntese.
de ferrugem em rochas ricas em ferro, processo iniciado
há mais de 2,7 bilhões de anos. Isso indica que bacté- FeS + H2S FeS2 + H2 + energia
rias semelhantes às atuais cianobactérias (bactérias que Sulfato Gás Sulfeto Gás
ferroso sulfídrico ferroso hidrogênio
liberam oxigênio durante a fotossíntese) originaram-se
Reação química realizada por arqueias sulforosas.
antes de 2,7 bilhões de anos atrás.
Essa reação provavelmente forneceu energia para os
UNIVERSAL IMAGES / FOTOARENA

primeiros seres vivos que surgiram na Terra. Os organis-


mos que promovem reações químicas entre substâncias
inorgânicas presentes na crosta terrestre para obtenção
de energia são denominados quimiolitoautotróficos.
Staphylotermus marinus é
SCIENCE PHOTO LIBRARY

uma espécie extremófila


encontrada no fundo
do oceano em enxofres

Material exclusivo para professores


vulcânicos, com temperatura
média de 98 °C.

conveniados ao Sistema de Ensino Faixas de formação de ferro são evidências da fotossíntese oxigênica
(algumas estão indicadas nas setas).
O aumento gradual do oxigênio atmosférico foi,
como mencionado, provavelmente protagonizado por

Dom Bosco
DB_PV_2019_BIO1A.indd 184 08/10/18 16:30
19 – Material do Professor 185

ancestrais das cianobactérias. Para os sobreviventes a


essa mudança na atmosfera, muitas adaptações surgi- Célula eucariótica

BIOLOGIA 1A
Plastídio autrótrofa
ram ao longo da evolução, incluindo a respiração celular Engolfamento ancestral
aeróbia, que usa oxigênio no processo de retirada de de procarioto
energia acumulada em moléculas orgânicas. Centenas autótrofo
de milhões de anos depois, o oxigênio sofreu uma ace-
leração no aumento de sua concentração atmosférica. Célula eucariótica
E qual teria sido o fator responsável por isso? Uma hi- com núcleo
e sistema de
pótese é que essa aceleração acompanhou a evolução endomembranas
das células eucarióticas, com uma importante novidade
Núcleo
evolutiva: as mitocôndrias e os cloroplastos.
Membrana
SURGIMENTO DOS EUCARIOTOS nuclear Célula
eucariótica
Os seres eucariotos surgiram há aproximadamente heterótrofa
Retículo
2,1 bilhões de anos, data do fóssil mais antigo e am- endoplasmático
ancestral
plamente aceito como eucarioto. As células eucarió-
Mitocôndria
ticas apresentam organização mais complexa que as Engolfamento
de procarioto
procarióticas, pois contêm estruturas como envelope heterótrofo
nuclear, retículo endoplasmático e mitocôndrias. Além Invaginação anaeróbio
disso, têm um citoesqueleto que lhes possibilita muda- de membrana
rem de forma e, portanto, movimentarem-se e engolfar DNA plasmática
Citoplasma
outras células com maior agilidade.
o
Acredita-se que as células eucarióticas provavel- Temp Membrana
Procarioto ancestral plasmática
mente perderam a parede celular e desenvolveram
dobramentos da membrana plasmática, originando Modelo da origem dos eucariotos por meio da endossimbiose serial.

organelas (várias estruturas que têm diversas funções CAMPBELL, Neil; REECE, Jane B. Biologia. 8. ed.
Porto Alegre: Artmed, 2010. (Adaptado)
celulares) e envoltório nuclear, que delimita o núcleo.
Entre as organelas, vale destacar que as mitocôn- diferentes — como ocorre nas bactérias —, além da
drias (responsáveis pela respiração celular) e os plas- capacidade de se autoduplicarem a partir dos DNAs
tídios (termo geral para os cloroplastos e outras orga- próprios e circulares não associados às histonas.
nelas relacionadas à fotossíntese) surgiram de forma
diferente. Acredita-se que essas organelas eram inicial- Panspermia cósmica
mente procariotos heterótrofos (ancestral da mitocôn- No final do século XIX, cientistas propuseram a hi-
dria) e procariotos autótrofos (ancestral do cloroplasto), pótese denominada panspermia cósmica, segundo
que foram engolfados por células procarióticas maiores. a qual a vida na Terra surgiu por meio de precursores
Essa ideia, proposta pela bióloga norte-americana vindos de outros lugares do espaço, que aqui chegaram
Lynn Margulis (1938-2011) em 1981, é chamada de teo- em meteoritos e poeira cósmica caídos na Terra.
ria da endossimbiose ou modelo endossimbionte. O Embora essa hipótese tenha ganhado força nas
termo endossimbionte refere-se a uma célula que vive últimas décadas, ao serem encontradas substâncias
dentro de outra célula, chamada de hospedeira. Ambas orgânicas como formaldeídos, álcool etílico e alguns
desenvolveram relações simbióticas, mutuamente be- aminoácidos em outros locais do espaço, ela ainda não
néficas, já que o hospedeiro heterotrófico poderia utili- esclarece o surgimento da vida, já que apenas transfere
zar componentes liberados pela célula endossimbionte a dúvida para outro local do espaço.
fotossintética. Em um ambiente com concentrações LEITURA COMPLEMENTAR
cada vez maiores de oxigênio, um hospedeiro anaeróbio
se beneficiaria de um endossimbionte que utiliza o oxigê- LUCA: o último ancestral comum
nio vantajosamente. Com o passar do tempo, hospedeiro De acordo com a teoria celular, proposta em meados do
e endossimbionte tornaram-se extremamente dependen- século XIX pelos cientistas Matthias J. Schleiden (1804-
tes, formando um único organismo. 1881) e Theodor Schwann (1810-1882), uma única célu-
Como nem todos os eucariotos têm plastídios, ape- la, que viveu há aproximadamente 3,5 bilhões de anos,
sar de as mitocôndrias serem comuns a todas as células originou todos os seres vivos existentes. Posteriormente

Material exclusivo para professores


eucarióticas, o modelo endossimbionte serial defende essa célula foi chamada de LUCA (do inglês Last Unique
a ideia de que as mitocôndrias associaram-se antes dos Common Ancestor, o último ancestral comum). Uma das
plastídios, por meio de vários eventos de endossimbio- principais evidências dessa hipótese é o fato de o código
se. Acompanhe tal processo na figura ao lado. genético ser universal, ou seja, ser utilizado para produ-

conveniados ao Sistema de Ensino


Uma gama de indícios sustenta essa teoria, como o zir proteínas tanto em nós, seres humanos, como em uma
fato de que ambas as organelas têm DNA próprio e são bactéria, inclusive contendo genes muito parecidos.
envoltas por duas ou mais membranas de composições

Dom Bosco
DB_PV_2019_BIO1A.indd 185 08/10/18 16:30
186 186 20 – Material do Professor

ROTEIRO DE AULA
BIOLOGIA 1A

Características dos primeiros seres vivos

Tipo de material Organização Tipo de


Metabolismo
genético celular alimentação

protobiontes RNA Unicelulares Hipótese Hipótese

Lipossomos procariotos heterotrófica autotrófica

Encontrados
Catalisam: Montam: Alimenta- Produziam seu
nos
vam-se de: alimento por:
estromatólitos.

moléculas
reações proteínas no oceano quimiossíntese

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A.indd 186 08/10/18 16:30
21 – Material do Professor 187

EXERCÍCIOS DE APLICAÇÃO

BIOLOGIA 1A
1. Sistema Dom Bosco – Os protobiontes são: Com base no texto e nos conhecimentos sobre teorias
a) moléculas formadas por compostos orgânicos envol- da origem da vida, assinale a alternativa correta:
tas de estruturas semelhantes à membrana. a) A teoria da geração espontânea, ou biogênese, por
b) moléculas formadas por compostos inorgânicos en- considerar a multiplicidade de formas de vida exis-
voltas de estruturas semelhantes à membrana. tente, defende a concepção atualmente aceita, se-
c) um conjunto de aminoácidos envolto por água. gundo a qual seres vivos podem surgir por mecanis-
mos que não sejam através da reprodução.
d) um aglomerado de lipídios envoltos por membrana
carboproteica. b) Para a panspermia, a vida na Terra é resultado de pro-
cessos químicos em que compostos orgânicos se
Os protobiontes são moléculas formadas por compostos orgânicos en-
voltas por estruturas semelhantes à membrana.
combinaram formando moléculas inorgânicas com-
plexas as quais deram origem aos seres vivos com
2. PUC-MG – Uma das hipóteses da origem da vida ad- capacidade de reprodução.
mite que a forma mais primitiva de vida se desenvol- c) Segundo a hipótese autotrófica, os primeiros seres
veu lentamente, a partir de substâncias inanimadas em vivos, por serem muito simples, não teriam meca-
ambiente complexo, originando um ser extremamente nismos celulares desenvolvidos para capacitá-los a
simples, incapaz de fabricar seu alimento. produzir substâncias alimentares, obrigando-os a uti-
lizaras substâncias disponíveis no meio.
Essa hipótese é conhecida como:
d) É preconizado pela hipótese heterotrófica que a par-
a) autotrófica. tir da energia consumida por reações químicas entre
b) heterotrófica. componentes orgânicos da crosta terrestre, os pri-
c) geração espontânea. meiros seres vivos produziam suas próprias substân-
cias alimentares.
d) epigênese.
e) Para a hipótese autotrófica, com a formação da ca-
e) pangênese. mada de ozônio na estratosfera, por consequência da
A hipótese heterotrófica defende a ideia de que os primeiros seres vivos
presença do gás oxigênio na atmosfera terrestre, os
eram incapazes de produzir o próprio alimento. seres vivos, antes restritos aos ambientes aquáticos,
passaram a colonizar ambientes de terra firme.
3. Fuvest-SP – Bactérias do tipo rikétsias são consideradas A alternativa A é incorreta, porque a geração espontânea é denominada
células procarióticas incompletas, que não possuem ca- abiogênese, teoria que defende a ideia de que seres vivos surgiram de
matéria inanimada. Além disso, foi a primeira teoria a ser refutada. A
pacidade e multiplicação independente da colaboração alternativa B é incorreta, porque a teoria da panspermia tem como base
de células eucarióticas que elas parasitam. Existem or- a ideia de que seres vivos vieram de fora da Terra. Além disso, toda a
ganelas das células cuja origem evolutiva é atribuída a descrição da hipótese nesta alternativa se trata da origem de coacer-
parasitas intracelulares semelhantes às rickétsias. Qual vados, proposto por Miller e Urey. A alternativa C é incorreta, porque a
descrição se refere à hipótese heterotrófica. A alternativa D é incorreta,
organela presente em células animais e vegetais prova- porque a descrição se refere à hipótese autotrófica.
velmente teve essa origem?
A organela é a mitocôndria. 6. Unicamp-SP – A hipótese mais aceita para explicar a
origem da vida sobre a Terra propõe que os primeiros
seres vivos eram heterótrofos.
a) Que condições teriam permitido que um heterótrofo
sobrevivesse na Terra primitiva?
4. Sistema Dom Bosco – A hipótese autotrófica é mais
aceita devido à existência das arqueobactérias extremó- Mares e oceanos continham matéria orgânica, que podia servir como
filas, pois elas:
alimento para esses primeiros seres vivos da Terra.
a) obtêm energia a partir da fermentação.
b) obtêm energia a partir da fotossíntese.
c) obtêm energia através da respiração celular.
d) obtêm energia através da quimiossíntese. b) Que condições ambientais teriam favorecido o apare-
Arqueobactérias são organismos quimiossintetizantes.
cimento posterior dos autótrofos?
Liberação de CO2 pelos primeiros heterótrofos anaeróbios (fermentado-
5. UEL-PR
res).
A determinação de um ambiente propício à origem da vida
na Terra divide as opiniões dos cientistas. Uns defendem
que o surgimento da vida teria ocorrido, por exemplo, na
sopa primitiva dos oceanos, em superfícies de minerais
de argila, ou, então, em sistemas hidrotermais, solos, at- c) Além das condições ambientais, qual é o outro ar-
gumento para não se aceitar que o primeiro ser vivo
mosfera, lagos e ilhas vulcânicas. Vale a ressalva de que a

Material exclusivo para professores


tenha sido autótrofo?
presença de determinados compostos químicos em me-
teoritos aponta ainda uma contrariedade em relação à Autótrofos dispõem de clorofila e um sistema enzimático complexo para
concepção de que o universo é pobre em matéria orgânica.
que possam produzir matéria orgânica. Por isso, é improvável que te-

conveniados ao Sistema de Ensino


(Adaptado de: FERREIRA, S; ALVES, M, I, C; SIMÕES, P. P. Ambientes e
vida na Terra – os primeiros 4.0 Ga. Estudos do Quaternário, 5,
nham surgido antes dos heterótrofos.
APEC, Porto, 2008, p. 99–116.)

Dom Bosco
DB_PV_2019_BIO1A.indd 187 08/10/18 16:30
188 22 – Material do Professor

EXERCÍCIOS PROPOSTOS
BIOLOGIA 1A

7. Unifal-MG – Do início da vida na Terra, até o apa-


recimento dos seres vivos atuais, aconteceram vários
eventos, como:
I. formação das primeiras células;
II. formação de moléculas orgânicas complexas;
III. aparecimento de organismos capazes de produzir
alimentos pela fotossíntese;
IV. surgimento dos primeiros organismos aeróbicos.
Marque a alternativa que indica a ordem mais aceita,
atualmente, para o acontecimento desses eventos.
a) I — II — IV — III
b) II — III — IV — I
c) I — IV — III — II
d) II — I — III — IV

8. Uerj (adaptada) – Considere a hipótese de que o am-


biente marinho primitivo, sem oxigênio, onde viveram
os primeiros seres vivos, contivesse moléculas orgâni-
cas produzidas por síntese abiótica. Admita, ainda, que
essas moléculas eram por eles decompostas para a
obtenção de energia. O tipo de nutrição e a forma de 11. Sistema Dom Bosco – De acordo com a teoria da en-
obtenção de energia desses organismos deveriam ser, dossimbiose, mitocôndrias e cloroplastos foram origina-
respectivamente, dos de:
a) autotrófica / fermentação. a) procariontes heterótrofos e autótrofos fagocitados
por organismos procariontes heterótrofos de tama-
b) autotrófica / fotossíntese.
nho maior.
c) heterotrófica / fotossíntese.
b) procariontes autótrofos e heterótrofos fagocitados
d) heterotrófica / fermentação. por organismos eucariontes autótrofos.
c) procariontes heterótrofos e autótrofos fagocitados
9. UFPB (adaptada) – Na hora do intervalo, alguns estu- por organismos eucariontes heterótrofos.
dantes estavam discutindo sobre a origem da vida. Ana
argumentou que os primeiros seres vivos deveriam ob- d) eucariontes autótrofos e heterótrofos fagocitados
por procariontes autótrofos.
ter energia através de fermentação, um processo sim-
ples de obtenção de energia. João discordou de Ana,
alegando que os primeiros seres vivos obtinham ener- 12. Cefet-MG – Trabalhos comparativos de sequências de
gia através de quimiossíntese. Gabriel concordou com DNA de diversos organismos classificaram em apenas 3
Ana e falou que inclusive alguns fungos utilizam essa for- grandes grupos (ou domínios) todos os organismos co-
ma de obtenção de energia. Bia argumentou que, inde- nhecidos até então: Bacteria, Archaea e Eukarya. Contra-
pendentemente da forma de obtenção de energia, eles pondo-se ao que se acreditava há 40 anos, as arqueobacté-
vieram de outros planetas. Marina concordou com Bia, rias não originaram as bactérias atuais, mas derivaram do
mas afirmou que só passou a existir seres fotossinteti- mesmo ancestral comum que elas.
zantes depois que os organismos aeróbios apareceram. Disponível em: <http://www.infoescola.com/biologia/archaea/>.
Acesso em: 21 abr. 2015. (Adaptado).
Com base na discussão, considere as seguintes afir-
mativas: Apesar dessa semelhança evolutiva, as arqueobactérias
diferem-se das bactérias porque as primeiras:
I. Ana e Gabriel defendem a hipótese heterotrófica e
João defende a hipótese autotrófica; a) apresentam célula procariótica.
II. Marina e Bia defendem a panspermia; b) contêm tanto DNA quanto RNA.
III. Marina está correta quanto à origem de seres fotos- c) possuem organização unicelular.
sintetizantes e seres aeróbios. d) habitam ambientes com condições extremas.
Estão corretas: e) são capazes de produzir seu próprio alimento.
a) Todas as alternativas.
13. ESCS-DF – No centro do oceano Atlântico, 15 km a oes-
b) Nenhuma das alternativas. te do limite da placa tectônica, na cordilheira mesoa-
c) Apenas I e II. tlântica, erguem-se, do leito marinho, rochas brancas,

Material exclusivo para professores


d) Apenas I e III. uma das quais alcança 60 metros de altura. Essa área,
e) Apenas II e III. denominada Lost City, é um campo de fontes hidroter-
mais, das quais emerge água marinha a temperaturas
10. Fuvest-SP – Acredita- se que os microrganismos seme- entre 40 ºC e 90 ºC. Os estudos geológicos demonstram

conveniados ao Sistema de Ensino


lhantes às bactérias heterotróficas anaeróbicas tenham que esse campo hidrotermal representa um novo tipo
sido os primeiros seres vivos a surgirem na face da Ter- de sistema hidrotérmico, no qual as rochas que com-
ra. Apresente duas justificativas para essa hipótese. põem o fundo do mar não são constituídas por basalto

Dom Bosco
DB_PV_2019_BIO1A.indd 188 08/10/18 16:30
23 – Material do Professor 189

negro, típico do fundo oceânico, mas de peridotito ver-

BIOLOGIA 1A
de, encontrado geralmente no manto. À medida que en-
tra em contato com a água do mar, o peridotito é trans-
formado em serpentinita, e a água aí infiltrada torna-se
mais alcalina; ao reemergir, essa água está desprovida
de oxigênio, que foi substituído por gases ricos em ener-
gia, como o hidrogênio, o metano e o gás sulfídrico. De-
vido à abundância de hidrogênio nos ecossistemas de
Lost City, até um terço dos microrganismos é capaz de
consumir a energia contida no hidrogênio. Tais micror-
ganismos pertencem ao domínio Archaea, são espécies
metanogênicas e habitam o interior das rochas, onde a
temperatura atinge 90 ºC e não há oxigênio. Ali vivem
produzindo ou consumindo o metano; outras bactérias,
sulfurosas, reduzem sulfatos. Em ambientes onde as
temperaturas sequer atingem 40 ºC, vivem organismos 15. Acafe-SC (adaptada)
do domínio Archaea que oxidam o metano e bactérias ENCONTRADA A EVIDÊNCIA DE VIDA MAIS AN-
que consomem oxigênio. A macrofauna é diversa, pelo TIGA
menos tão rica quanto em outras fontes termais que Uma equipe internacional de geólogos, paleontólogos e
existem na cordilheira mesoatlântica. A maioria das es- nanotecnólogos encontrou em rochas canadenses, estru-
pécies existentes em Lost City sobrevive apenas naquele turas tubulares e filamentosas que, segundo interpretam,
ambiente específico. representam bactérias fósseis. Provenientes de fumarolas
As raízes mais profundas da vida. Scientific American Brasil, hidrotermais do fundo do oceano de 3,77 a 4,28 bilhões de
dez./2012 (com adaptações).
anos atrás, esses microfósseis representam as mais antigas
Considerando o texto acima e aspectos a ele relacio- evidências de vida de que temos registro até agora.
nados, julgue os seguintes itens e, a seguir, assinale a Fonte: Jornal El País, 01/03/2017.
opção correta. Disponível em: http://brasil.elpais.com
I. Na base da cadeia alimentar dos ecossistemas de Nesse sentido, marque V para as afirmações verdadei-
Lost City, vivem espécies pertencentes ao domínio ras e F para as falsas.
Archaea que definem os limites de tolerância biológi-
ca em condições extremas. ( ) As bactérias são organismos unicelulares que po-
dem ou não formar colônias. Esses organismos
II. De acordo com o texto, nos ecossistemas de Lost possuem material genético disperso no citoplas-
City, existem organismos pertencentes aos diferen- ma, sendo, portanto, denominados procariontes.
tes domínios da vida.
( ) Segundo a hipótese heterotrófica, os primeiros
III. Devido à profundidade das águas de Lost City, a seres vivos do planeta Terra eram unicelulares,
maioria das espécies ali existentes surgiu em outras procariotos e capazes de sintetizar matéria orgâ-
fontes hidrotermais. nica através da fotossíntese.
IV. As condições de vida nas rochas de Lost City são ( ) Os estromatólitos são rochas estratificadas for-
completamente diferentes das que se suspeita que madas por atividades de microrganismos em am-
tenham constituído a realidade da Terra antes de ini- bientes aquáticos.
ciado o fenômeno da fotossíntese.
( ) De acordo com a teoria da evolução, os seres são
São corretos apenas os itens: imutáveis.
a) I e II. A sequência correta, de cima para baixo, é:
b) I e III. a) V — F— F— V
c) I e IV. b) V — F — V — F
d) II e III c) F — F — V — F
e) II e IV. d) F — V — F — V
14. Sistema Dom Bosco – A hipótese autotrófica é atual- 16. UEL-PR (adaptada) – De acordo com a hipótese he-
mente a mais aceita em relação ao tipo de obtenção de terotrófica, o primeiro ser vivo do planeta Terra obtinha
energia dos primeiros seres vivos. Descreva o que diz energia para seu metabolismo por meio de um proces-
essa hipótese e o que ela suporta. so adequado às condições existenΩtes na atmosfera
primitiva.
Assinale a alternativa que apresenta, corretamente, a
sequência ordenada dos processos energéticos, desde
o surgimento do primeiro ser vivo do planeta de acordo

Material exclusivo para professores


com a hipótese heterotrófica.
a) Fotossíntese, respiração aeróbia e fermentação.
b) Respiração aeróbia, fermentação e fotossíntese.
c) Respiração aeróbia, fotossíntese e fermentação.

conveniados ao Sistema de Ensino


d) Fermentação, fotossíntese e respiração aeróbia.
e) Fermentação, respiração aeróbia e fotossíntese.

Dom Bosco
DB_PV_2019_BIO1A.indd 189 08/10/18 16:30
190 24 – Material do Professor

17. Enem (adaptada) – O gráfico a seguir mostra a concen- Responda:


BIOLOGIA 1A

tração de oxigênio na atmosfera ao longo do tempo. a) O que levou ao aumento inicial de oxigênio na atmos-
fera primitiva?

ENEM
100
Oxigênio (% da quantidade atual)

10

semelhante à do
9
10

planeta Marte

Anteparo de
Atmosfera

Atmosfera
primitiva

ozônio
1

4
b) E o que fez com que a concentração de oxigênio se
0,1 elevasse mais ainda por volta de aproximadamente
3 1,6 bilhão de anos atrás?
2 5 6 7 8
1
0
-4
-3,8

-3,1

-2,7

-2

-1,6

-1
-0,7
-0,6
-0,4
-0,2
-0,1
Tempo (bilhões de anos)
Fonte: https://sites.google.com/site/biologiaemexercicios/
_/rsrc/1431306289473/origem-da-vida/tempo-geologico/
tempo-geol%C3%B3gico.01.gif>

ESTUDO PARA O ENEM


18. Sistema Dom Bosco C4-H16 b) A primeira molécula precursora de vida foi o RNA,
Apesar da grande diversidade biológica, a hipótese de capaz de produzir proteínas e catalisar suas reações.
que a vida na Terra tenha tido uma única origem comum c) A primeira molécula precursora de vida foi o RNA, por
é aceita pela comunidade científica. Uma evidência ser uma molécula de fita simples e servir de molde
que apoia essa hipótese é a observação de processos para construção de outras organelas.
biológicos comuns a todos os seres vivos atualmente d) A primeira molécula precursora de vida foi o DNA,
existentes. por ser uma molécula de fita simples e hoje ser base
principal de vida na maioria dos organismos.
Um exemplo de tal processo é o(a):
a) desenvolvimento embrionário; 20. Sistema Dom Bosco C5-H17
b) reprodução sexuada; Cientistas descobriram o que acreditam ser os fósseis de
c) respiração aeróbica; alguns dos primeiros organismos vivos da Terra. São mi-
núsculos filamentos, pedaços e tubos em rochas localiza-
d) excreção urinária;
das no Canadá que teriam até 4,28 bilhões de anos. Caso a
e) síntese proteica. estimativa de idade dos microfósseis esteja realmente cor-
reta, o surgimento da vida teria acontecido “pouco tempo”
19. Sistema Dom Bosco C5-H17 depois da formação do planeta, há 4,54 bilhões de anos.
“Menor-Salván afirma que a formação dos primeiros Também representaria um salto de centenas de milhões de
compostos orgânicos e o surgimento dos primeiros seres anos atrás com relação à evidência mais antiga até então
vivos deve ter sido um processo muito rápido. ‘Podemos conhecida. O estudo foi publicado na revista científica Na-
passar com rapidez do fosfato inorgânico aos precurso- ture. As conclusões ainda são polêmicas, mas a equipe,
res do RNA e a que se formem outros compostos que formada por cientistas internacionais, diz acreditar não ter
podem desenvolver uma tarefa bioquímica’, afirma. ‘Falo dúvidas quanto à descoberta.
de algo que poderia ocorrer em um período breve, não
GHOSH, Pallab. Cientistas encontram fósseis de 4 bilhões de anos e se
em termos geológicos, mas em termos de uma vida hu- aproximam de origem da vida. Disponível em: <http://www.bbc.
mana’, acrescenta. Nas condições daquela Terra jovem, o com/portuguese/geral-39140741>. Acesso em: abr. 2018.
aparecimento de uma poça de água suja com potencial
para gerar organismos vivos não teria sido fruto de uma A respeito das primeiras formas de vida existentes em
conjunção excepcional de fatores. ‘Eu estou convencido nosso planeta, podemos afirmar que provavelmente
de que é um fenômeno que aconteceu em muitos locais’, a) eram todas autótrofas quimiossintetizantes.
diz Menor-Salván.” b) eram fermentadoras e utilizavam a energia radiante
MEDIAVILA, D. A vida se originou um uma “poça de urina”. para produzir suas moléculas orgânicas.

Material exclusivo para professores


In: El País. 2016. Disponível em: <https://brasil.elpais.com/bra- c) eram heterótrofas e utilizavam substâncias formadas
sil/2016/09/22/ciencia/1474561007_954730.html>. na atmosfera que eram acumuladas nos mares primi-
Acesso em: maio. 2018.
tivos.
Com base no texto, marque a alternativa correta. d) eram aeróbias graças à abundância de átomos de oxi-

conveniados ao Sistema de Ensino


a) A primeira molécula precursora de vida foi o DNA, gênio existente nas águas do oceano.
por servir de molde para a produção de RNA e catali- e) eram fungos primitivos com capacidade de atividade
sar suas reações. fotossintética.

Dom Bosco
DB_PV_2019_BIO1A.indd 190 08/10/18 16:30
3
25 – Material do Professor 191

A CÉLULA E AS

BIOLOGIA 1A
CARACTERÍSTICAS DOS
SERES VIVOS ATUAIS

Em 2011, cientistas britânicos produziram um microscópio óptico que possibilita


enxergar objetos de 50 nanômetros (1 nanômetro corresponde a 1 milionésimo de
milímetro). Essa nova técnica fornece maior resolução das imagens dos vírus e das • Organização celular
células em geral (eucarióticas e procarióticas). Apesar da facilidade atual para obser- • Características dos seres
var em detalhes as organelas celulares e pequenas estruturas, no passado não se vivos
sabia da existência das células, só observadas com o desenvolvimento de lentes de • Formas de vida e adap-
aumento. tações
Há pouco mais de 4 000 anos, os chineses fabricavam lentes com cristais lapidados
de rocha inicialmente para observar as estrelas. No Ocidente, o primeiro registro his- HABILIDADES
tórico da fabricação de lentes foi em 1285, na Itália, para corrigir problemas de visão. • Compreender a organização
Por volta de 1595, os holandeses Zacharias e Hans Janssen construíram o primeiro celular dos seres vivos.
microscópio com as lentes dos óculos que fabricavam. No entanto, esse microscópio • Entender a capacidade
oferecia uma ampliação limitada, de apenas dez vezes o tamanho do objeto observado. de reprodução, evolução,
No final do século XVII, o holandês Anton van Leeuwenhoek (1632-1723) inventou metabolismo e regulação
um microscópio capaz de ampliar em até 200 vezes os objetos. Foi assim que obser- da temperatura corporal.
vou pela primeira vez a existência de microrganismos na água, os quais denominou • Conhecer as variadas
na época de animálculos. formas de obtenção de
Somente em 1665, o inglês Ro- energia dos seres vivos e
parte da estrutura celular.
bert Hooke (1635-1703), ao observar
ao microscópio finas fatias de corti- NATIONAL LIBRARY OF MEDICINE, MARYLAND

ça, descreveu a presença de inúme-


ras e pequenas cavidades parecidas
com favos de mel e preenchidas
com ar. Cada uma dessas estrutu-
ras foi chamada de célula (do latim
cellula, diminutivo de cella, “peque-
no quarto” ou “pequena cavidade”).
Após a publicação das desco-
bertas de Hooke em 1665, muitos
cientistas passaram a usar os mi-
croscópios e observaram que as
células não eram espaços vazios,
mas sim preenchidos por um lí-
quido viscoso, no qual havia uma
estrutura central, que foi chama-
da de núcleo. Mais tarde, esses
elementos foram vistos também
nas células vegetais. Em 1666, o
cientista italiano Marcello Malpighi

Material exclusivo para professores


(1628-1694) observou e descreveu
os glóbulos vermelhos do sangue.
Entre os níveis de organização
biológica, a célula é a coleção mais

conveniados ao Sistema de Ensino


simples de matéria capaz de sobre-
Ilustração de Hooke das estruturas observadas na cortiça (as
viver, por isso chamada de unidade quais chamou de células), publicada mais tarde em seu livro
fundamental da vida. Micrographia, em 1665.

Dom Bosco
DB_PV_2019_BIO1A.indd 191 08/10/18 16:30
192 26 – Material do Professor

Organização celular

ALAMY STOCK PHOTO

AUNT_SPRAY/ISTOCKPHOTO.COM
BIOLOGIA 1A

Da mesma forma que o átomo é a unidade funda-


mental da Química, para a Biologia a célula é a unidade
funcional da vida, já que todos os seres vivos são for-
mados por ela.
Muitas formas de vida são constituídas por apenas
uma célula, por isso denominadas unicelulares, como
é o caso das bactérias, das arqueias, dos protozoários e
de algumas algas e fungos. Eletromicrografia do Herpes vírus, causador da herpes comum humana.
Ao lado direito ilustração representando as estruturas desse vírus.
KATERYNA KON/SHUTTERSTOCK

Elementos representados fora da escala de tamanho. Cores fantasia.

Todos os tipos celulares apresentam alguns ele-


mentos básicos em sua constituição: a membrana
plasmática, que atua como uma barreira seletiva e en-
volve o citoplasma, ou citosol, um fluido gelatinoso e
o material genético.
Quando o material genético está disperso no cito-
plasma sem a presença de membranas o envolvendo,
trata-se de uma célula procariótica. No caso oposto,
em que esse material é envolvido por membranas ca-
racterizando um núcleo verdadeiro, trata-se de uma cé-
Ilustração representando a bactéria Lactobacillus sp., encontrada no
intestino humano e responsável pela fermentação do leite. Elementos lula eucariótica. Em todas as células também existem
representados fora da escala de tamanho. Cores fantasia. os ribossomos, complexos minúsculos sintetizadores
de proteínas.
Os organismos pluricelulares têm várias células.

946174/SHUTTERSTOCK
São seres mais complexos, como as plantas, alguns Cadeia lateral
fungos, algumas algas e todos os animais. Seus corpos de carboidrato
funcionam como “cooperativas” de vários tipos celula-
res, que são especializadas e trabalham em conjunto
para executar suas funções. Por esse motivo, diz-se
que todas as ações de um organismo são iniciadas em
nível celular.
ALAMY STOCK PHOTO

Proteína
Fosfolipídios

Estrutura da membrana plasmática. Elementos representados fora da


escala de tamanho. Cores fantasia.

Características dos seres


vivos
Os seres vivos passam por diversas etapas e pro-
O tuiuiú (Jabiru mycteria) é um ser pluricelular, considerado ave-símbolo cessos durante a vida: nascem, crescem, desenvol-
do Pantanal. Essa cegonha pode medir até 1,4 metro de comprimento e
vem-se, envelhecem e morrem. Essas etapas cons-
1,60 metro de altura, pesando até 8 kg.
tituem o ciclo vital. Conforme a espécie de ser vivo,
Os vírus são uma grande questão quanto à sua or- o ciclo vital pode durar minutos (como acontece com
ganização, pois eles são acelulares, ou seja, não têm algumas bactérias) ou centenas de anos (como ocorre

Material exclusivo para professores


células. Por causa disso, muitos pesquisadores acre- com algumas árvores).
ditam que eles não possam ser considerados seres Algumas características são comuns a todos os se-
vivos. Entretanto, isso é tema de grande discussão, res vivos, como organização celular, respiração, meta-
porque os vírus apresentam moléculas de fundamental bolismo, nutrição e crescimento. Além disso, ocorre a

conveniados ao Sistema de Ensino


importância para a vida, como as proteínas e o ácido transmissão de suas características para as próximas
nucleico, além de se reproduzirem, mesmo que depen- gerações, por meio da reprodução, as quais evoluem ao
dam de uma célula hospedeira para tal. longo do tempo, pelo processo de mutação genética.

Dom Bosco
DB_PV_2019_BIO1A.indd 192 08/10/18 16:31
27 – Material do Professor 193

METABOLISMO E RESPIRAÇÃO CRESCIMENTO

BIOLOGIA 1A
A célula é como uma indústria em minuatura, na Em geral, as células eucarióticas são maiores que
qual ocorrem milhares de reações químicas em espa- as procarióticas. O formato de uma célula geralmente
ços microscópicos. Nos organismos pluricelulares, as está relacionado à sua função no organismo. À medida
células exportam os produtos químicos produzidos para que o tamanho da célula aumenta, o volume também
outras células do corpo. A complexidade, a eficiência e cresce, proporcionalmente à área superficial. Isso ajuda
a integração das reações químicas que acontecem no a explicar o tamanho microscópico da maioria das cé-
interior da célula mantêm o fluxo de energia e matéria lulas e a forma estreita e alongada de outras, como as
nos processos vitais. O conjunto dessas reações quími- células nervosas.
cas é denominado metabolismo.

DENNIS KUNKEL MICROSCOPY/SCIENCE PHOTO LIBRARY


A membrana plasmática e as organelas também estão
ligadas diretamente aos processos metabólicos, já que
A
várias enzimas são produzidas dentro das membranas.
O metabolismo pode ser dividido em anabolismo,
quando ocorre a síntese de substâncias, ou catabolismo,
C
quando acontece a quebra ou degradação de substâncias. B
O anabolismo consome energia para produzir mo-
léculas complexas com base em moléculas simples,
como acontece na síntese de proteínas a partir de ami-
noácidos, ou na fotossíntese, que produz glicose para a
nutrição das plantas.
(C) NELSONAISHIKAWA | DREAMSTIME

Célula procariótica de uma bactéria Moraxella catarrhalis (A) e células


eucarióticas do protozoário Trypanosoma sp. (B) e de um glóbulo
vermelho humano (C). Imagem obtida de microgafia eletrônica de
varredura.

Os organismos maiores não têm, necessariamen-


te, células maiores que organismos menores, mas
sim um número maior de células. Independentemente
do número de células, o crescimento celular – e con-
sequentemente o crescimento em tamanho – é uma
As plantas obtêm energia por meio da fotossíntese – um exemplo característica típica dos seres vivos. Em organismos
de reação anabólica, também denominada biossíntese. Na imagem, pluricelulares, células mortas são repostas por meio da
araucárias (Araucaria angustifolia), pinheiros típicos do Sul do Brasil.
renovação celular.
O maior processo de catabolismo é a respiração celular Para que o crescimento e a renovação celular acon-
aeróbia, que movimenta energia celular utilizando açúcares teçam, o organismo precisa obter substâncias do ali-
e outros combustíveis. Essa energia é usada pelas células mento, já que muitas delas são perdidas e precisam
em diversos tipos de atividades, a exemplo do transporte ser repostas.
de solutos por meio da membrana plasmática, um proces-
so ativo que demanda energia. A respiração é outra carac- NUTRIÇÃO
terística comum aos seres vivos, seja ela aeróbia (na pre- Os organismos diferenciam-se em dois grandes
sença de oxigênio) ou anaeróbia (na ausência de oxigênio). grupos, de acordo com seu modo de nutrição. Como
plantas, algas, arqueias e algumas bactérias são capa-
zes de produzir o próprio alimento por meio de fotossín-
CHIRAWAN SOMSANUK/DREAMSTIME.COM

tese ou quimiossíntese, são denominados autótrofos.


ANNEKA/SHUTTERSTOCK

Vitória-régia

Material exclusivo para professores


(Victoria
amazonica),
planta
encontrada
nos rios da

conveniados ao Sistema de Ensino


Amazônia. Os
Fungos da espécie Saccharomyces cerevisiae, muito utilizados na vegetais são
produção de cerveja, pães e etanol. Realizam sua fermentação por meio organismos
da respiração anaeróbia. Microscopia óptica, aumento desconhecido. autótrofos.

Dom Bosco
DB_PV_2019_BIO1A.indd 193 08/10/18 16:31
194 28 – Material do Professor

Os organismos que não têm a capacidade de pro- • ictiófagos (comem apenas peixes, como o leão-
BIOLOGIA 1A

duzir o próprio alimento são denominados heterótro- -marinho);


fos. Os fungos crescem em seu alimento ou próximo a • coprófagos (alimentam-se de fezes, como o
ele, alimentando-se por absorção (geralmente lançando besouro);
enzimas sobre o alimento, as quais iniciam a digestão • insetívoros (comem insetos, como os sapos, al-
fora de seus corpos). Protozoários e animais ingerem gumas espécies de peixes e o tamanduá);
outros organismos vivos ou matéria orgânica morta • detritívoros (alimentam-se de detritos orgânicos
para obter as moléculas orgânicas necessárias para seu vegetais e animais, como abutres, hienas e urubus).
metabolismo. A maioria dos protozoários e animais, ao
contrário dos fungos, ingere o alimento e depois utiliza REPRODUÇÃO
enzimas dentro de seu corpo, para depois digeri-lo. A características dos seres vivos responsável pela
perpetuação da espécie é a reprodução, que pode ser
assexuada (quando não há formação de gametas; os indi-
víduos são clones uns dos outros) ou sexuada (quando há
formação de gametas, fecundação e troca de material ge-
POSINOTE/SHUTTERSTOCK

nético para que ocorra a formação de um novo indivíduo).

RASPIRATOR/ISTOCKPHOTO.COM
Ilustração representando duas células procarióticas em divisão binária,
principal tipo de reprodução assexuada realizada por bactérias. Elementos
representados fora da escala de tamanho. Cores fantasia.

O bolor do pão é um fungo, organismo heterótrofo que, ao se alimentar,


realiza a decomposição do pão.
Embora vários invertebrados realizem reprodução
assexuada por divisão binária (também denominada
Os seres heterótrofos são subdivididos em: fissão ou cissiparidade) e brotamento, a maioria dos
• carnívoros (alimentam-se apenas de carne, como animais se reproduz sexuadamente. Alguns, incluindo
o leão, o tigre e a onça); os humanos, passam por estágios transitórios de matu-
• herbívoros (comem apenas vegetais, como o ca- ração antes de assumir a forma adulta, enquanto outros
valo, o boi e o coelho); animais passam pelo menos por um estágio larval.
• onívoros (alimentam-se tanto de carne quanto de A larva é um estágio sexualmente imaturo e morfo-
vegetais, como os humanos e algumas espécies logicamente distinto do adulto. Geralmente apresenta
de morcego); hábitos alimentares e comportamentais diferentes do
• hematófagos (alimentam-se do sangue de ou- adulto, inclusive habitando ambientes distintos, como
tros animais, como o barbeiro, o carrapato e algu- é o caso da larva do Aedes aegypti, que tem o estágio
mas espécies de morcego); inicial aquático antes de se tornar terrestre. Animais
com estágio larval apresentam uma fase de metamor-
BELIZAR73/ISTOCKPHOTO.COM

fose, a qual os transforma em indivíduos jovens, muito


semelhantes a um adulto, mas sexualmente imaturos.
KOYA79/ISTOCKPHOTO.COM

Material exclusivo para professores


conveniados ao Sistema de Ensino
Na imagem, um tamanduá-bandeira (Myrmecophaga tridactyla) com
seu filhote, um animal heterótrofo insetívoro, alimentando-se em
um formigueiro.
A reprodução por meio da fecundação de gametas é uma reprodução do
tipo sexuada. Elementos representados fora da escala de tamanho.
Cores fantasia.

Dom Bosco
DB_PV_2019_BIO1A.indd 194 08/10/18 16:31
29 – Material do Professor 195

Ainda nos animais, há indivíduos que trocam de

MACROVECTOR/ISTOCKPHOTO.COM
sexo durante a vida – principalmente peixes e al-

BIOLOGIA 1A
guns lagartos –, assim como existem outros que
apresentam os dois sexos (masculino e feminino)
ao mesmo tempo, com as minhocas. Esta caracte-
rística é muito comum em protistas, fungos e plan-
tas. Existem, ainda, os casos em que organismos
fertilizam os próprios ovos, assim como há outros
que podem se reproduzir sem qualquer forma de fe-
cundação, reprodução assexuada denominada par-
tenogênese, comum em abelhas, processo em que
a reprodução é limitada a poucos indivíduos em uma
grande população.
Fungos, protistas e plantas apresentam ciclos de
vida sexuados ou assexuados. Independentemente
do tipo, a reprodução é a capacidade de os seres
vivos transmitirem suas características às gerações
seguintes, por meio do material genético, que con-
tém todas as informações necessárias para a produ-
Em algum momento ao longo da evolução, o ancestral comum de
ção de proteínas e demais moléculas, manifestando
todas as aves tinha um tipo específico de bico. Entretanto, à medida
as características no novo indivíduo. que as populações se subdividiram e tiveram acesso a diferentes
alimentos, os animais melhor adaptados sobreviveram. Ao longo das
ALEXANDER ERDBEER/SHUTTERSTOCK

gerações, a característica sofreu novas adaptações, resultando em bicos


especializados para determinados tipos de alimento.

HOMEOSTASE, SENSIBILIDADE E
REAÇÃO
É a capacidade de o ser vivo manter seu meio in-
terno relativamente constante. Um exemplo é capaci-
dade de o ser humano começar a tremer quando sen-
te frio ao sair da água gelada, na tentativa de manter
sua temperatura corporal constante, sem perder calor
para o meio.
KERKEZ/ISTOCKPHOTO.COM

As características genéticas dos seres vivos são transmitidas por meio da


reprodução.

EVOLUÇÃO
Todas as células têm relações de parentesco com
suas células ancestrais, que se modificaram ao longo
da extensa história da vida na Terra, de várias maneiras
diferentes.
Os seres vivos têm a capacidade de evoluir, ou seja,
produzir descendentes com modificações que ocorre-
ram ao longo de milhares ou milhões de anos, por meio
de mutações no material genético.
Essas modificações só se mantêm ao longo das
gerações se forem benéficas para tornar os indivíduos

Material exclusivo para professores mais bem adaptados a determinado meio, os quais
terão acesso a mais recursos (como território e ali-
mentos) e produzirão seus descendentes. No caso de

conveniados ao Sistema de Ensino


mutações deletérias (desfavoráveis), possivelmente a
Um exemplo de homeostase é a capacidade de mantermos nossos
espécie será extinta. Esse conceito resume sucinta- corpos em temperatura relativamente constante, como quando trememos
mente a seleção natural, que será estudada adiante. ao sair da água gelada.

Dom Bosco
DB_PV_2019_BIO1A.indd 195 08/10/18 16:31
196 30 – Material do Professor

Essa característica de tremer é o resultado de outra Seres pecilotérmicos têm temperatura corporal se-
BIOLOGIA 1A

característica comum aos seres vivos: a de responder melhante à do ambiente. Portanto, se a temperatura
aos estímulos do meio. Os seres vivos têm sensibilida- ambiental varia, a temperatura corporal também muda.
de aos estímulos e apresentam capacidade de reagir Com exceção das aves e dos mamíferos, todos os ou-
a esses fatores. Uma forma de reação, por exemplo, tros animais são pecilotérmicos.
é a movimentação, que permite obter recursos como Para aumentar a atividade metabólica, muitos animais
alimento, território e parceiros sexuais, além de fugir de usam o calor, aquecendo-se ao Sol. É por isso que é co-
um estímulo negativo ou atacar uma presa. mum ver répteis se esquentando sob troncos e rochas.

OCTAVIO CAMPOS SALLES/ALAMY STOCK PHOTO

ONDREJ PROSICKY/SHUTTERSTOCK
Grupo de jacarés-do-pantanal (Caiman yacare) se aquecendo na beira de
um rio.

Uma onça (Panthera onca) com sua presa, um cateto (Pecari tajacu). A
sensibilidade de perceber um estímulo e a melhor capacidade de fugir ou atacar VIDA LATENTE OU MORTE APARENTE
definem, por exemplo, o sucesso de caçar ou não ser pego por um predador. Alguns seres, como esporos bacterianos, semen-
Apesar de aparentemente estarem sempre para- tes, cistos, esporos de protozoários e os ursos-d’água
das, as plantas também reagem a estímulos do meio (tardígrados), reduzem sua atividade metabólica ao ex-
ambiente, mas, em geral, com menos rapidez que os tremo quando a temperatura ambiental se reduz muito,
animais. ficando quase imperceptível. À medida que a tempe-
ratura ambiental aumenta novamente, esses animais
retornam normalmente às suas atividades metabólicas.
FORMAS DE VIDA E

DOTTEDHIPPO/ISTOCKPHOTO.COM
ADAPTAÇÕES
Os seres vivos são homeotérmicos (endotérmicos,
conseguem manter a temperatura corporal relativamente
constante) ou pecilotérmicos (heterotérmicos ou ectotér-
micos, têm temperatura corporal variável). Os seres ho-
meotérmicos (aves e mamíferos) mantêm a temperatura
corporal relativamente constante, mesmo havendo varia-
ções na temperatura ambiental em virtude da ação de ter-
morreguladores que controlam os processos metabólicos.
Uma grossa camada de gordura sob a pele é uma das adap- Os tardígrados, também conhecidos como ursos-d’água, são animais
tações de animais homeotérmicos a baixas temperaturas. microscópicos que conseguem reduzir seu metabolismo ao extremo em
condições ambientais não favoráveis. Elementos representados fora da
LEO FRANCINI/ALAMY STOCK PHOTO escala de tamanho. Cores fantasia.

As baleias-franca (Eubalaena
Há ainda animais que hibernam quando a tempera-
australis) migram para as tura ambiental está muito baixa, como alguns peixes,
águas tropicais durante o anfíbios, répteis, alguns mamíferos (como castor, mar-
inverno, em que se acasalam
e procriam. Durante o mota, morcego e hamster) e algumas aves (como os

Material exclusivo para professores


verão, vão para as geladas beija-flores). Os ursos não hibernam, pois sua tempera-
águas dos polos, nas quais tura corporal não se altera.
se alimentam. Como são
seres homeotérmicos, Existem também animais que fazem estivação.
contam com uma grossa Quando a temperatura ambiental está muito alta, redu-

conveniados ao Sistema de Ensino


camada de gordura sob a zem suas atividades metabólicas ao extremo. Um exem-
pele, que ajuda a manter
a temperatura do corpo plo de animal que realiza tal processo é o peixe piram-
constante. boia (Lepidosiren paradoxa), presente no Norte do Brasil.

Dom Bosco
DB_PV_2019_BIO1A.indd 196 08/10/18 16:31
31 – Material do Professor 197

ROTEIRO DE AULA

BIOLOGIA 1A
Organização celular

Número de Envoltório
células nuclear

Unicelulares Única célula Presente: Procariotos

Pluricelulares Várias células Ausente: Eucariotos

Características gerais dos seres vivos

Metabolismo Nutrição Respiração Reprodução Evolução

Catabolismo Autótrofos Aeróbia Sexuada

Anabolismo Heterótrofos Anaeróbia Assexuada

Formas de vida e adaptações

Temperatura Vida latente/morte


corporal aparente

Material exclusivo para professores


Homeotérmicos Pecilotérmicos Estivação Hibernação

Temperatura corporal Temperatura corporal

conveniados ao Sistema de Ensino


Altas temperaturas Baixas temperaturas
não varia com o varia com o ambiente
ambiente externo externo

Dom Bosco
DB_PV_2019_BIO1A.indd 197 08/10/18 16:31
198 32 – Material do Professor

EXERCÍCIOS DE APLICAÇÃO
BIOLOGIA 1A

1. Sistema Dom Bosco – Entre as alternativas a seguir, 4. Sistema Dom Bosco – É comum dizer que todos os
marque aquela que corresponde às características dos organismos são formados por células, estruturas conhe-
seres vivos. cidas como a unidade funcional e estrutural dos seres
a) São todos pluricelulares. vivos. Alguns organismos, no entanto, são acelulares e,
por isso, alguns autores não os consideram vivos. Entre
b) São heterótrofos.
os seres listados abaixo, qual é o único que não possui
c) Podem ser aeróbios ou anaeróbios. células em sua constituição?
d) Se reproduzem apenas de forma assexuada. a) Bactérias.
A alternativa A está incorreta, porque podem ser unicelulares ou
pluricelulares. A alternativa B está incorreta, pois os seres vivos b) Fungos.
podem ser autótrofos ou heterótrofos. A alternativa D está in- c) Protozoários.
correta, porque eles podem se reproduzir de forma sexuada ou
assexuada. d) Vírus.
e) Animais.
2. Sistema Dom Bosco – Entre os seres vivos abaixo, as-
Os vírus são seres acelulares.
sinale aquele que é encontrado somente com organiza-
5. Sistema Dom Bosco – Animais homeotérmicos são
ção unicelular.
aqueles que conseguem manter a temperatura corporal
a) Algas e fungos. relativamente constante devido à alta taxa metabólica ou
b) Fungos e bactérias. por meio de comportamentos relacionados a trocas de ca-
c) Bactérias e protozoários. lor com o meio. Entre as opções abaixo, marque a opção
d) Protozoários e animais. que contenha organismos que sejam homeotérmicos:
a) ursos e águias.
Entre os seres vivos listados, apenas as bactérias e os proto-
zoários apresentam somente organização unicelular. Embora b) ursos e cobras.
existam algas e fungos unicelulares, estes organismos também c) cobras e jacarés.
podem apresentar organização pluricelular.
d) águias e lagartos.
3. Sistema Dom Bosco – As células são os componentes Apenas aves e mamíferos são animais homeotérmicos.
fundamentais de todos os seres vivos, portanto ausen-
tes nos vírus. Quais são os elementos básicos de uma 6. UFOP-MG (adaptada) – Considere a capacidade de os
célula e como se chama as células que não possuem seres vivos obterem alimentos. Os animais existiriam se
núcleo organizado? todas as plantas morressem? Justifique sua resposta.
Os componentes básicos são membrana, citoplasma e núcleo. Não, porque os animais são heterótrofos, isto é, dependem da

As células que não têm núcleo organizado são as procarióticas. matéria orgânica produzida pelas plantas (organismos autótro-

fos) para obter energia.

EXERCÍCIOS PROPOSTOS
7. Cefet-MG (adaptada)– Charles Darwin estudou a dis- adaptações de animais homeotérmicos a baixas tem-
tribuição dos tentilhões no Arquipélago de Galápagos e peraturas.
sua relação com o tipo de bico e o hábito alimentar. c) o esqueleto de quitina dos artrópodes auxilia no con-
A relação entre o tipo de bico e o alimento é definida trole da evaporação da água corpórea.
pela(o):
d) hibernação e estivação expressam reações de alguns
a) possiblidade de extinção das aves. animais, principalmente em função da umidade rela-
b) espaço geográfico ocupado pelos animais. tiva do ar.
c) disponibilidade de recursos no ambiente.
9. UFJF-MG – Há um fenômeno de caráter geral entre os
d) capacidade de adaptação a novos alimentos.
seres vivos que justifica os mecanismos de evolução e
e) deslocamento de cada espécie entre as ilhas. da biodiversidade. Assinale-o.
8. UEM-PR (adaptada) – Em relação ao comportamento a) Reprodução.

Material exclusivo para professores


dos animais com os fatores ambientais, marque a alter- b) Metabolismo.
nativa correta:
c) Mutação.
a) a velocidade da taxa metabólica não varia em função
da temperatura ambiental. d) Nutrição.

conveniados ao Sistema de Ensino


b) uma grossa camada de gordura sob a pele é uma das e) Ciclo vital.

Dom Bosco
DB_PV_2019_BIO1A.indd 198 08/10/18 16:31
33 – Material do Professor 199

10. Unicamp-SP (adaptada) – O gráfico a seguir represen- b) folhas.

BIOLOGIA 1A
ta a eliminação de CO2 pela respiração dos vertebrados c) peixes.
A e B, com relação à temperatura ambiente. d) sangue.
e) sementes.

13. IFMT – A respeito das adaptações observadas em ani-


mais de regiões frias, foram feitas as seguintes afirma-
ções:
Taxa de CO2 eliminado

I. A camada de gordura sob a pele costuma ser mais


grossa.
II. As camadas de pelos ou penas são mais espessas
Animal A que a de animais de outras regiões.
Animal B III. O tamanho dos animais não interfere na adaptação
ao ambiente.
IV. Em muitos casos, a migração serve de adaptação à
vida nessas regiões.
0 10 20 30 40 ºC
Está correto o que se afirma em:
Como são denominados A e B com relação à regulação a) I e II, apenas.
de temperatura corporal? Cite um exemplo de animal b) I, III e IV, apenas.
para A e para B. c) II e III, apenas.
d) I, II e IV, apenas.
e) I, II, III e IV, apenas.

14. Sistema Dom Bosco – Muito se ouve falar sobre me-


tabolismo, principalmente quando o assunto é emagre-
cimento ou quando falamos de animais que hibernam,
como os castores e ouriços. Conceitue metabolismo,
diferenciando anabolismo de catabolismo.

11. Cefet-MG (adaptada) – Os morcegos são adaptados


para o voo por meio de suas asas, da mesma maneira
que as baleias e golfinhos adaptaram-se ao ambiente
aquático por meio das nadadeiras. Apesar das modifi-
cações ao longo da evolução, todos os mamíferos pos- 15. Sistema Dom Bosco – Um réptil pode se aquecer ao Sol
suem um ancestral comum. se sua temperatura cair, ou procurar uma sombra para
se refrescar. Desse modo, movimentando-se entre Sol
A estrutura locomotora dos animais citados favorece e sombra, ele pode ganhar ou perder calor do ambiente. 
sua (seu): Por isso, atualmente, os animais são classificados em
a) hábito alimentar. __________, que usam a energia do Sol para controlar
sua temperatura, e __________, aqueles que usam a
b) reserva de gordura.
energia de seu metabolismo para regular a temperatura
c) funcionalidade sensorial. corporal. Estes gastam mais energia que os __________,
d) adaptação aos ambientes. pois uma parte do alimento é queimada apenas para
e) resistência a variações térmicas. fornecer calor ao corpo, mas estão ativos em qualquer
temperatura. Os __________ conseguem sobreviver por
12. Cefet-MG (adapatada) – Caminhando pela mata, um longos períodos sem ingerir comida, uma vez que não
grupo de alunos encontrou um crânio de um animal precisam gastar energia do alimento para produzir calor,
com dentes caninos bem desenvolvidos e molares au- mas, se a temperatura cair muito, eles ficam inativos.

Material exclusivo para professores


sentes. a) ectotérmicos; ectotérmicos; endotérmicos; endotérmicos 
Após longa discussão, eles concordaram que o animal b) ectotérmicos; endotérmicos; ectotérmicos; endotérmicos 
ao qual esse crânio pertencia alimentava-se basicamen- c) endotérmicos; endotérmicos; ectotérmicos; ectotérmicos 

conveniados ao Sistema de Ensino


te de: d) endotérmicos; ectotérmicos; ectotérmicos; endotérmicos 
a) frutos. e) ectotérmicos; endotérmicos; ectotérmicos; ectotérmicos

Dom Bosco
DB_PV_2019_BIO1A.indd 199 08/10/18 16:31
200 34 – Material do Professor

16. UFPI – Assinale a alternativa que menciona, correta- 17. Unicamp-SP (adaptada) – Os fósseis são uma evidência
BIOLOGIA 1A

mente, o que pode significar, sob o ponto de vista evo- de que nosso planeta foi habitado por organismos que
lutivo, o fato de animais com características primitivas, já não existem atualmente, mas que apresentam seme-
como as esponjas, terem sido um dos primeiros a se lhanças com organismos que o habitam hoje. Cite quatro
formar e serem abundantes até hoje. características que todos os seres vivos têm em comum.
a) Sua estratégia evolutiva não foi bem-sucedida. 
b) A seleção natural não atuou sobre as esponjas. 
c) As esponjas mostraram adaptação às pressões
ambientais. 
d) Não foram expostos a nenhum tipo de pressão
ambiental. 
e) Não apresentaram muita variabilidade genética.

ESTUDO PARA O ENEM


18. Enem C5-H28 pesquisa, Caetano-Anollés, disse: “O simples fato de
Darwin, em viagem às ilhas Galápagos, observou que existir uma biologia universal unificando vírus e célu-
os tentilhões apresentavam bicos com formatos dife- las, agora justifica a construção de uma árvore da vida
rentes em cada ilha, de acordo com o tipo de alimen- que englobe vírus do lado das células”.
tação disponível. Lamarck, ao explicar que o pescoço Disponível em: <https://super.abril.com.br/ciencia/
da girafa teria esticado para colher folhas e frutos no estudo-aponta-que-virus-sao-seres-vivos-sim-senhor/>.
alto das árvores, elaborou ideias importantes sobre a Acesso em: 23 jun. 2018.
evolução dos seres vivos. O texto aponta que uma ideia Uma característica que é comum a todos os seres vi-
comum às teorias da evolução, propostas por Darwin e vos, mas ausente nos vírus é o fato de serem:
por Lamarck, refere-se à interação entre os organismos
e seus ambientes, que é denominada de: a) unicelulares.
a) mutação b) heterótrofos.
b) adaptação c) apresentarem organização celular.
c) seleção natural d) apresentarem envoltório nuclear.
d) recombinação gênica e) apresentarem apenas RNA como material genético.
e) variabilidade genética 20. Sistema Dom Bosco C8-H28
Esquilos, morcegos, marmotas, hamsters e ouriços são al-
19. Sistema Dom Bosco C5-H13
guns dos animais que hibernam. Eles fazem isso para pou-
Em 2003, a descoberta dos mimivírus reacendeu a
par energia já que a comida é escassa em determinadas
pergunta: os vírus realmente não são vivos? Confun-
estações do ano.“Ao hibernar, o animal parece estar morto,
didos com bactérias por quase 10 anos, os mimivírus
mas o que acontece, na verdade, é uma brusca redução nas
são vírus gigantes, que até podem produzir algumas
atividades do seu organismo”, diz a bióloga Cecília Pessutti,
proteínas. E agora um novo estudo da Universidade de
do Zoológico de Sorocaba, SP.
Illinois, que traçou a história evolutiva dos vírus, mos-
Disponível em: <https://mundoestranho.abril.com.br/mundo-
tra evidências de que sim, eles são seres vivos. Para
-animal/quais-animais-hibernam-por-que/>.
fazer isso, foram analisadas “dobras” de mais de 5 mil Acesso em: 23 jun. 2018.
organismos, entre eles, 3,5 mil vírus. Essas dobras são
estruturas de proteína que ficam inscritas no geno- Sobre esse processo:
ma  de células quaisquer e dos próprios vírus. Resul- a) ocorre apenas em animais pecilotérmicos.
tado: 442 dobras são comuns entre  vírus e células, e b) é uma adaptação a altas temperaturas.
apenas 66 são exclusivas dos vírus. Isso quer dizer que,
c) é uma forma de obtenção de energia dos animais.
evolutivamente, os vírus compartilhavam material ge-
nético com as células, mas em algum momento se tor- d) é uma adaptação a baixas temperaturas.
naram entidades diferentes. Em entrevista, o líder da e) obrigatoriamente, esses animais são autótrofos.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A.indd 200 08/10/18 16:31
4
35 – Material do Professor 201

CÉLULAS PROCARIÓTICA

BIOLOGIA 1A
E EUCARIÓTICA

Com a confirmação da existência da célula e o aperfeiçoamento dos microscópios,


os cientistas puderam investigar melhor a unidade básica dos seres vivos.
Em 1855, o cientista alemão Rudolf Virchow (1821-1902) elaborou a hipótese de • Células e organelas mem-
que todas as células eram originadas de outras células preexistentes. Mais tarde branosas
Alexander Fleming (1881-1955) confirmou essa hipótese ao analisar e descrever deta- • Célula procariótica
lhadamente a reprodução celular. • Célula eucariótica

WATERFRAME/ALAMY STOCK PHOTO


HABILIDADES
• Reconhecer a célula como
unidade estrutural e funcio-
nal dos seres vivos.
• Identificar estruturas e
tipos celulares em relação
à presença de membranas
em organelas.
• Reconhecer seres procario-
tos e eucariotos.
• Diferenciar aspectos estru-
turais de células animais
e vegetais.

Células de Paramecium sp. em divisão celular vistas ao microscópio óptico. Cada indivíduo mede cerca de 300 µm
de comprimento.

Virchow teve papel fundamental na definição da teoria celular, a qual, desde


o início de seu desenvolvimento, contou com a colaboração de várias outras hi-
póteses de muitos pesquisadores, colaborando para a construção de uma teoria
consistente.
A teoria celular é uma das grandes ideias revolucionárias da Biologia, gerando
grande impacto no desenvolvimento da ciência, uma vez que se definiu que a célula
desempenha funções estruturais e funcionais nos seres vivos.
Atualmente, sabemos que existem dois tipos celulares, classificados de acordo
com a presença ou não de organelas membranosas. Conhecemos também a fundo

Material exclusivo para professores


as distintas estruturas que compõem as células e resultam em diferentes funções
e especializações. No entanto, há muito a ser descoberto, visto a imensidão de
seres vivos ainda não catalogados e que podem ter células com estruturas ainda
não estudadas.

conveniados ao Sistema de Ensino


Dom Bosco
DB_PV_2019_BIO1A.indd 201 08/10/18 16:31
202 36 – Material do Professor

Células e organelas Em geral as células procarióticas são muito simples


BIOLOGIA 1A

comparadas às eucarióticas. A membrana plasmáti-


membranosas ca separa o meio extracelular do intracelular, além de
controlar a passagem de substâncias de forma seletiva
As células são unidades básicas funcionais e estru-
(permeabilidade seletiva).
turais que constituem todos os seres vivos. Conforme
a presença de organelas com membranas, podem ser

123RF.COM
classificadas em procariótica ou eucariótica. Fímbria: estrutura de
adesão de alguns procariotos
Somente os organismos dos domínios Bacteria e Ar-
chaea têm células procarióticas, enquanto os seres dos
outros domínios são formados por células eucarióticas. Ribossomos: complexos
As células eucarióticas têm maior complexidade de síntese proteica

do que as procarióticas, pois contêm diversos compar- Flagelo:


Cápsula: estrutura
timentos, cada um deles com função específica. Por locomotora
camada
essa razão, podemos compará-las a fábricas. externa
A localização do ácido desoxirribonucleico (DNA) é Nucleoide: região onde
a principal diferença entre as células procarióticas e as o DNA está concentrado
eucarióticas. Nas procarióticas (do grego pro = antes
e karion = núcleo), o DNA não é envolvido por mem- Parede celular: Membrana
branas e está concentrado em uma região denominada estrutura rígida plasmática: delimita
externa o citoplasma
nucleoide. Na célula eucariótica (do grego eu = primei-
ro e karion), o DNA é delimitado por uma membrana
Esquema de uma célula procariótica. Elementos representados fora da
dupla que circunda o núcleo. escala de tamanho. Cores fantasia.
JLCALVO/DREAMSTIME.COM

Sobre a membrana plasmática existe a parede ce-


lular, um envoltório mais espesso e rígido que exerce
a função de proteção e é composto de peptidoglicanos.
Algumas bactérias podem ter a parede celular envolta
em uma cápsula, o que confere maior proteção à célu-
la. Algumas células se locomovem por flagelos, estru-
turas formadas por microtúbulos.
No meio intracelular, encontramos as únicas orga-
nelas das células procarióticas: os ribossomos. Eles
são responsáveis pela síntese de proteínas.
As cianobactérias (eubactérias), procariotos que
fazem parte do reino Bacteria, apresentam lamelas
fotossintetizantes, ou seja, dobras da membrana,
associadas a cianossomos, que são granulações com
pigmentos (ficocianina e ficoeritrina). Esses pigmentos
Fotomicroscopia de neurônios motores, células eucarióticas em que é
absorvem a luz, promovendo a fotossíntese. Diferente
possível visualizar o núcleo (destacado com a seta na imagem). Aumento
desconhecido. dos plastídios com essa mesma função, encontrados
nas plantas, essas lamelas não têm membranas as en-
volvendo.
Célula procariótica
SCIENCE HISTORY IMAGES/ALAMY STOCK PHOTO

As células procarióticas têm como característica Lamela


principal a ausência de membranas nas organelas, in- fotossintetizante
clusive ao redor do material genético (DNA). Este fica Parede
disperso no citoplasma, em uma região denominada celular
nucleoide. Os seres constituídos desse tipo celular
são denominados procariotos, como as bactérias e as Ribossomos
arqueias.

Material exclusivo para professores


Os procariotos apresentam uma molécula de DNA
menor, denominada plasmídeo, constituído de genes
que conferem resistência aos antibióticos e que podem
ser transferidos entre eles por meio da recombinação

conveniados ao Sistema de Ensino


gênica. Tanto o DNA quanto o ácido ribonucleico (RNA)
são circulares, de maneira que não têm extremidades Eletromicrografia de transmissão das estruturas de uma cianobactéria.
como o DNA das células eucarióticas. Aumento de 40.000x.

Dom Bosco
DB_PV_2019_BIO1A.indd 202 08/10/18 16:31
37 – Material do Professor 203

Células eucarióticas dispersas no citoplasma e que se unem no momento


da síntese, enquanto o RNA ribossomal constituinte

BIOLOGIA 1A
Os compartimentos internos das células eucarióti- dessa estrutura é proveniente do nucléolo.
cas (as organelas) fornecem meios diferentes para rea-

MOLEKUUL_BE/SHUTTERSTOCK
lizar funções metabólicas específicas. Assim, proces-
sos químicos que seriam incompatíveis podem ocorrer
ao mesmo tempo dentro da célula.
Além do núcleo, diversas organelas suspensas no
citosol são envolvidas por uma membrana e executam
funções específicas nas células eucarióticas. Essas or-
ganelas estão ausentes na célula procariótica, as quais,
junto com um núcleo verdadeiro, demonstram a dife-
rença na complexidade estrutural entre os dois tipos
celulares.
Tradicionalmente são estudadas as estruturas celu-
lares de células típicas animais e vegetais, como apre-
sentado a seguir. No entanto, vale destacar que as célu-
las de fungos, protozoários e algas (protistas) também
apresentam organização eucariótica.

CÉLULA ANIMAL
Ilustração representando a estrutura molecular de um ribossomo.
A célula animal apresenta várias organelas ligadas Elementos representados fora da escala de tamanho. Cores fantasia.
por membranas. Geralmente a maior organela desse
tipo celular é o núcleo, que pode ocupar posição central Retículo endoplasmático
ou não. Grande parte das atividades metabólicas acon-
É formado por membranas dobradas entre si, cons-
tece no citoplasma, região entre o núcleo e a membra-
tituindo canais ou tubos por onde substâncias são
na plasmática. Existem outros componentes celulares
transportadas para outras partes da célula. Se houver
suspensos no citoplasma, como centrossomos (cen-
presença de ribossomos, o retículo é denominado gra-
tro organizador próximo do núcleo), que apresentam os
nuloso. Caso contrário, é denominado não granulo-
centríolos (estruturas envolvidas na divisão celular). Os
so. Eventualmente, o retículo endoplasmático pode ser
centrossomos e os lisossomos (organelas digestivas
chamado de ergastoplasma.
responsáveis pela hidrólise de macromoléculas) são en-
No retículo endoplasmático granuloso, os ribossomos
contrados somente em células animais.
se encontram aderidos à superfície e participam da sín-
Retículo tese e exportação de proteínas para o meio extracelular.
123RF.COM

endoplasmático Retículo endoplasmático

TEFI/SHUTTERSTOCK
granuloso não granuloso
Complexo
Poros nucleares golgiense Retículo
endoplasmático
Núcleo granuloso
Vesículas
Membrana
nuclear

Centríolos

Microtúbulos

Microfilamentos
Mitocôndria
Ribossomos
Lisossomo
Membrana plasmática
Retículo
Esquema de célula eucariótica animal típica, com as principais endoplasmático

Material exclusivo para professores


organelas. Elementos representados fora da escala de tamanho. não granuloso
Cores fantasia. Retículo endoplasmático granuloso e não granuloso. Elementos
representados fora da escala de tamanho. Cores fantasia.
Ribossomos

conveniados ao Sistema de Ensino


São corpúsculos formados por proteínas e RNA ri- O retículo endoplasmático não granuloso não con-
bossômico que atuam na síntese de proteínas. Os tém ribossomos aderidos à superfície e participa da
ribossomos apresentam duas subunidades isoladas, síntese de lipídios, além da produção de hormônios es-

Dom Bosco
DB_PV_2019_BIO1A.indd 203 08/10/18 16:31
204 38 – Material do Professor

teroides e sexuais. Ele também tem enzimas que parti- Lisossomo


BIOLOGIA 1A

cipam de processos de detoxificação ou destoxificação Derivada do complexo golgiense, é uma vesícula


– que consistem na metabolização de substâncias tóxi- membranosa com enzimas que participam da diges-
cas como álcool, agrotóxicos e medicamentos. tão celular de substâncias capturadas do meio e de
estruturas celulares velhas, sem função.
Complexo golgiense
É formado por um conjunto de sacos membranosos

TTSZ/ISTOCKPHOTO.COM
Membrana Enzimas hidrolíticas
achatados e empilhados que originam vesículas. Está
envolvido em diversas funções, como secreção celular,
armazenamento de substâncias na célula, formação do
acrossomo etc.
O acrossomo é um grande grânulo secretório que ro-
deia e recobre a borda anterior do núcleo dos espermato-
zoides. Contém as enzimas necessárias para fazer com
que o espermatozoide penetre ou se fusione com a mem-
brana plasmática do ovócito para realizar a fecundação.
TEFI/SHUTTERSTOCK

Proteínas de transporte
Ilustração de lisossomo. Elementos representados fora da escala de
tamanho. Cores fantasia.

Peroxissomo
Estrutura semelhante ao lisossomo, tem enzimas
envolvidas no processo de detoxificação ou destoxifi-
cação, metabolizando substâncias tóxicas. Aproximada-
mente 75% do álcool são metabolizados por enzimas do
retículo endoplasmático não granuloso, e 25% são me-
tabolizados por enzimas do peroxissomo, principalmente
Ilustração de complexo golgiense com suas vesículas. Elementos
em células do fígado (hepatócitos) e dos rins. Além disso,
representados fora da escala de tamanho. Cores fantasia. os peroxissomos metabolizam água oxigenada (peróxido
de hidrogênio), proveniente de resíduos de reações quí-
Mitocôndrias micas celulares. Essa substância é tóxica para a célula,
São estruturas membranosas que podem ter o for- entretanto, o peroxissomo a converte em água e oxigê-
mato de um bastão ou de uma esfera. Estão envolvidas nio por ação da catalase, existente em seu interior.
na liberação de energia na célula, utilizando oxigênio

BANANAFISH/SHUTTERSTOCK
nas reações químicas para produzir adenosina trifosfato
(ATP) durante a respiração celular (aeróbia). Essa es- Membrana
simples
trutura apresenta DNA extranuclear, RNA e ribossomos
próprios, além de serem capazes de se autoduplicar.
Proteína
DNA Ribossomos Matriz Membrana Membrana
123RF.COM

externa interna

Enzimas e
catalase

Material exclusivo para professores


Ilustração de peroxissomo. Elementos representados fora do tamanho
de escala. Cores fantasia.

Espaço Centríolos

conveniados ao Sistema de Ensino


Crista mitocondrial intermembranar
Estruturas não membranosas constituídas por nove
Ilustração de mitocôndria. Elementos representados fora da escala de trincas de microtúbulos proteicos em formato cilíndrico.
tamanho. Cores fantasia. Fazem parte da formação de cílios (como os das células

Dom Bosco
DB_PV_2019_BIO1A.indd 204 08/10/18 16:32
39 – Material do Professor 205

da traqueia) e de flagelos (como nos espermatozoides e em algumas bactérias). Atuam


também na divisão celular em células animais, formando o fuso mitótico durante a mitose.

BIOLOGIA 1A
TEFIM/ISTOCKPHOTO.COM

Ilustração de centríolos. Elementos representados fora do tamanho de escala. Cores fantasia.

CÉLULA VEGETAL
A célula vegetal apresenta a maioria das características da célula animal (exceto
centrossomos e lisossomos), porém apresenta outras organelas envoltas por plas-
tídios. O principal tipo de plastídio é o cloroplasto, responsável pela fotossíntese.
Na maioria das células vegetais, existe um grande vacúolo central, também di-
vidido em vacúolos menores em certas espécies de plantas. Os vacúolos realizam
a mesma função digestiva dos lisossomos nas células animais, além de armazenar
água e nutrientes. Externa à membrana plasmática, existe a parede celular, que
confere resistência e proteção celular, impedindo a lise osmótica em meio hipotônico.
É espessa e perfurada por canais denominados plasmodesmas, responsáveis pela
conexão citoplasmática entre células vizinhas, possibilitando a troca de moléculas de
informação funcionais, estruturais ou ainda de xenobióticos entre as células perten-
centes a um mesmo grupo.

Membrana nuclear
123RF.COM

Vacúolo

Núcleo
Cloroplasto

Retículo endoplasmático
Citoplasma

Mitocôndria Complexo golgiense

Material exclusivo para professores Membrana


plasmática
Parede celular

conveniados ao Sistema de Ensino Esquema de uma célula eucariótica vegetal típica. Elementos representados fora da escala de tamanho. Cores
fantasia.

Dom Bosco
DB_PV_2019_BIO1A.indd 205 08/10/18 16:32
206 40 – Material do Professor

Cloroplastos
BIOLOGIA 1A

Estruturas que contêm o pigmento clorofila, responsável por capturar a energia


luminosa para que as plantas realizem a fotossíntese, processo no qual ocorrem rea-
ções químicas que utilizam carbono e hidrogênio para sintetizar carboidratos (glicose)
e oxigênio. Os cloroplastos têm DNA, RNA e ribossomos próprios e são capazes de
realizar autoduplicação, como as mitocôndrias.

BLUERINGMEDIA/SHUTTERSTOCK
Membrana
externa

Granum
Membrana
interna

Lamela Lúmen Estroma Tilacoide

Esquema de cloroplasto. Elementos representados fora da escala de


tamanho. Cores fantasia.

Vacúolos
Os vacúolos são espaços no interior das células vegetais que funcionam como re-
servatório e regulam a entrada e a saída de água, participando do controle osmótico da
célula. Vacúolos de suco celular podem conter enzimas envolvidas na digestão intrace-
lular. Sua membrana é denominada tonoplasto. Acredita-se que essa estrutura resulte
da fusão de pequenas vesículas derivadas da membrana do retículo endoplasmático.
A tabela a seguir resume e relaciona as estruturas e organelas presentes nas
células eucarióticas.

Estrutura celular Função(ões)


Membrana plasmática Permeabilidade seletiva.
Proteção mecânica, presente somente nas células de vegetais
Parede celular
e fungos.
Nucléolo Síntese de ribossomos.
Ribossomo Síntese de proteínas.
Retículo endoplasmático
Síntese de proteínas, armazenamento e transporte de substâncias.
granuloso
Retículo endoplasmático não
Síntese de lipídios, detoxificação e transporte de substâncias.
granuloso
Armazenamento, secreção celular, formação de lisossomos e
Complexo golgiense
acrossomos.
Respiração celular (usa oxigênio e glicose e os transforma em
Mitocôndria
energia na forma de ATP).

Material exclusivo para professores


Lisossomo Digestão intracelular, ausente na célula vegetal.
Peroxissomo Detoxificação.
Formação de cílios, flagelos e fibras do fuso mitótico na divisão
Centríolo
celular, ausente na célula vegetal.

conveniados ao Sistema de Ensino


Cloroplasto
Vacúolo
Fotossíntese, exclusivo da célula vegetal.
Armazenamento e controle osmótico, exclusivo da célula vegetal.

Dom Bosco
DB_PV_2019_BIO1A.indd 206 08/10/18 16:32
41 – Material do Professor 207

ROTEIRO DE AULA

BIOLOGIA 1A
Tipos celulares

Célula procariótica Célula eucariótica

Presença de Presença de
Ausente Presente
organelas: organelas:

Material genético Material genético


Nucleoide Núcleo
reunido no: reunido no:

Presente em: Presente em:

Bactérias Arqueias

Plantas Fungos Protistas Animais

Cloroplastos Parede celular Lisossomo

Vacúolo Centríolos

Parede celular

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A.indd 207 08/10/18 16:32
208 42 – Material do Professor

EXERCÍCIOS DE APLICAÇÃO
BIOLOGIA 1A

1. IFS-SE – Referente às células procarióticas, analise as 4. IFSul – Duas estruturas celulares assemelham-se por
características abaixo e marque a que está incorreta. apresentarem uma membrana externa (lisa) e uma
a) São representadas pelas bactérias e algas azuis. membrana interna (pregueada), porém, em uma das
estruturas, as pregas formam lamelas e, em outra, for-
b) Ausência de cloroplastos.
mam cristas.
c) Ausência de um núcleo verdadeiro.
O enunciado refere-se, respectivamente, às seguintes
d) Ausência de um sistema organoide membranoso.
organelas:
e) Ausência de ribossomos.
a) cloroplastos e lisossomos.
Seres procariotos têm ribossomos dispersos no hialoplasma.
b) lisossomos e cloroplastos.
2. IFSul-MG (adaptada) – Sobre a célula, sua composi- c) cloroplastos e mitocôndrias.
ção, organelas e divisão estão corretas as afirmações: d) lisossomos e mitocôndrias.
I. As células são unidades básicas funcionais e estru- Cloroplastos têm lamela em seu interior, enquanto mitocôndrias
turais que constituem qualquer ser vivo. Somente os apresentam cristas.
organismos dos domínios Bacteria e Archaea consis-
tem em células procarióticas, enquanto os seres dos 5. Sistema Dom Bosco – A mitocôndria e o centríolo são
outros domínios são formados por células eucarióti- estruturas encontradas dentro de um determinado tipo
cas. celular. Cite qual tipo celular e suas principais funções.
II. Em uma célula animal eucariótica existem três com-
ponentes básicos, membrana plasmática ou mem- Presente somente em células eucarióticas. A mitocôndria é
brana citoplasmática, o citoplasma e o núcleo.
III. Dentre as organelas citoplasmáticas está a mitocôn- responsável pela respiração celular (usa oxigênio e glicose e os
dria, em quase todas as células eucariotas, incluindo
animais, plantas, fungos e a maioria dos protistas. transforma em energia na forma de ATP). O centríolo é respon-
Assim como os cloroplastos, estas organelas pos-
suem material genético próprio. A função das mito- sável pela formação de cílios, flagelos e fibras do fuso mitótico
côndrias é produzir energia (ATP) a partir de proces-
sos metabólicos. na divisão celular, ausente na célula vegetal.
IV. Os peroxissomos são vesículas membranosas res-
ponsáveis por produção de lipídios.
Estão corretas as alternativas:
a) I, II, III.
b) I, II e IV.
c) II, III e IV.
d) I, III e IV.
A alternativa IV está incorreta porque os peroxissomos atuam 6. Sistema Dom Bosco – Em geral, sabemos que tanto
contra os radicais livres. as células animais quanto as células vegetais são exem-
plos de células eucarióticas. Entretanto, há caracte-
3. Sistema Dom Bosco – Bacteria e Archaea possuem ca- rísticas específicas de cada uma delas que as tornam
racterísticas próprias que se diferem de outros organis- diferentes, classificando-as inclusive como parte de or-
mos, principalmente em relação ao número de células ganismos bastante complexos. Cite as diferenças entre
que constituem cada um deles e as estruturas celulares esses tipos celulares.
existentes. Entretanto, há características em comum As células animais têm organelas, incluindo mitocôndrias. Já
entre os organismos. Com base em seus conhecimen-
tos, cite as principais semelhanças entre as células pro- as células vegetais apresentam parede celular, cloroplastos e
carióticas e eucarióticas.
Ambas as células têm membrana, citoplasma, material genéti- vacúolos.

co e ribossomos.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A.indd 208 08/10/18 16:32
43 – Material do Professor 209

EXERCÍCIOS PROPOSTOS

BIOLOGIA 1A
7. IFNMG – O surgimento de células eucarióticas é funda- ( ) Bolsa membranosa que contém diversos tipos
mentado pela hipótese de modificações evolutivas das de enzimas digestivas, capazes de digerir grande
células procariontes, a partir de invaginações da mem- variedade de moléculas orgânicas. Funções auto-
brana celular, e delimitação do núcleo, assim como a fágica e heterofágica.
formação de compartimentos individualizados com en- ( ) Rede citoplasmática de tubos e bolsas membra-
zimas, possibilitando a especialização como organoides. nosas, em certas regiões do citoplasma apre-
Em relação aos organoides citoplasmáticos, é correto sentam ribossomos aderidos à sua superfície.
afirmar que: Responsável pela síntese de enzimas, proteínas,
ácidos graxos, fosfolipídios e esteroides.
a) As mitocôndrias apresentam DNA extranuclear e
possuem capacidade de autoduplicação. ( ) É constituído por bolsas membranosas achatadas,
empilhadas umas sobre as outras e por vesículas
b) Os plastídios são estruturas encontradas em todos derivadas delas. Responsável pela síntese de alguns
os tipos celulares eucariontes. carboidratos. Enzimas produzidas por outra organela
c) Os centríolos são estruturas membranosas respon- são “empacotadas” no interior de bolsas membrano-
sáveis pela formação de cílios e flagelos. sas para serem enviadas aos seus locais de atuação.
d) Os ribossomos são formados por duas subunidades, Assinale a alternativa que apresenta a sequência corre-
uma maior e uma menor, e se aderem na membrana ta, de cima para baixo.
do retículo endoplasmático não granuloso para reali-
zação da síntese de proteínas. a) 5-1-6-4-2-3
b) 3-1-5-6-4-2
8. IFPE – Uma das causas da infertilidade masculina é a c) 4-5-2-1-3-6
teratospermia, uma alteração na morfologia dos esper- d) 5-6-4-1-2-3
matozoides que passam a ter a cabeça redonda, não
e) 3-2-5-1-6-4
havendo a formação do acrossomo, que é uma vesícula
repleta de enzimas digestivas, localizada na cabeça do 10. Sistema Dom Bosco – O núcleo é uma estrutura en-
espermatozoide, sendo essencial à sua penetração no contrada dentro de um determinado tipo celular. Cite
ovócito e à fertilização. A organela que produz o acros- qual tipo celular e dê a sua função.
somo é denominada:
a) complexo golgiense.
b) mitocôndria.
c) retículo endoplasmático granuloso.
d) retículo endoplasmático não granuloso.
e) peroxissomo.

9. IFRS – Enumere corretamente as organelas citoplasmá-


ticas de uma célula eucariótica com às suas estruturas
e funções. 11. IFS-SE – A célula eucariótica é formada por um comple-
xo sistema de compartimentos membranosos, que lhe
( 1 ) ribossomo
permite uma maior especialização das atividades me-
( 2 ) retículo endoplasmático tabólicas. A organização e interação entre estes com-
( 3 ) complexo golgiense partimentos lembra o funcionamento de uma fábrica.
( 4 ) lisossomo Comparando-se com as atividades da fábrica, quais os
compartimentos membranosos com função análoga ao
( 5 ) vacúolo
gerador de energia, ao setor de produção e ao setor de
( 6 ) mitocôndria embalagem respectivamente:
( ) Vesículas delimitadas por uma membrana deno- a) Ergastoplasma, lisossomo e centríolo.
minada tonoplasto. Têm funções variadas, depen- b) Ergastoplasma, complexo golgiense e mitocôndria.
dendo do ser vivo. Nos protozoários, são impor-
c) Lisossomo, centríolo e ergastoplasma.
tantes para a regulação osmótica da célula; nos
vegetais, além do controle osmótico, participam d) Mitocôndria, ribossomos e complexo golgiense.
da digestão intracelular e podem atuar como re- e) Mitocôndria, ergastoplasma e complexo golgiense.
servatório de substâncias tóxicas ao vegetal, caso
permanecessem em circulação. 12. IFS-SE – Certos tipos de leucócitos são atraídos pelas bac-
( ) Está presente em todos os seres vivos, formado térias invasoras, e vindo a englobar essas bactérias, irão
por RNA e proteínas. É nesta organela que ocorre destruí-las pela ação de enzimas na digestão celular. Esse
a síntese de proteínas. fenômeno, chamado fagocitose, somente se completará
permitindo a digestão do material englobado, desde que o
( ) É uma organela em forma de bastonete, seu

Material exclusivo para professores


vacúolo formado se una à organela celular denominada:
número na célula varia de dezenas a centenas,
dependendo do tipo celular. Sua matriz possui a) ribossomo;
diversas enzimas, DNA extranuclear, RNA e ribos- b) microfilamento;
somos menores que os citoplasmáticos. Sua prin- c) microtúbulo;

conveniados ao Sistema de Ensino


cipal função é a respiração aeróbia, que fornece
a energia para ser armazenada nas moléculas de d) peroxissomo;
ATP e utilizada nas diversas atividades celulares. e) lisossomo.

Dom Bosco
DB_PV_2019_BIO1A.indd 209 08/10/18 16:32
210 44 – Material do Professor

13. IFS-SE – No citoplasma celular além do citosol ou hialo- (08) Todas as três células possuem ácidos nucleicos
BIOLOGIA 1A

plasma existem as organelas citoplasmáticas. A seguir e sintetizam proteínas através dos processos de
são feitas algumas afirmações, assinale a alternativa transcrição e tradução.
correta. (16) Se considerarmos que as mitocôndrias não exis-
a) O retículo endoplasmático granuloso ou ergasto- tem na célula 2, poderemos então afirmar que
plasma é responsável pela síntese ou produção de esse organismo é fotossintetizante.
lipídios;
b) Os lisossomos são estruturas membranosas dobra- 16. IFPE (adaptada)
das entre si, compostas por enzimas digestivas res- TRABALHADORES VÍTIMAS DE SILICOSE SÃO
ponsáveis pela digestão intracelular, as enzimas são CONDENADOS PARA O TRABALHO
produzidas no complexo golgiense;
O pneumologista Valderio do Valle Dettoni já cuidou de,
c) Mitocôndria é uma organela presente apenas nas cé-
aproximadamente, 60 trabalhadores que adoeceram de
lulas animais e são responsáveis pelo processo de
respiração e produção de energia; silicose nas pedreiras do Norte do Espírito Santo. Por
isso, sabe como poucos os efeitos da doença no orga-
d) O retículo endoplasmático não granuloso é responsá-
vel pela produção de proteínas e enzimas digestivas; nismo e no meio social onde os trabalhadores vivem.
“A silicose não tem tratamento e pode ser progressiva
e) O complexo de golgiense da origem ao acrossomo,
uma estrutura repleta de enzimas digestivas (hialu- mesmo depois que o operário se afasta do trabalho, por-
ronidase), localizada na cabeça do espermatozoide, que a poeira que ele inala vai ocasionar uma ação inflama-
sendo essencial à sua penetração no ovócito e à tória pulmonar e esse processo reduz a capacidade de oxi-
fertilização. genação”, explica. Quando diagnosticados com a doença,
os trabalhadores precisam se afastar imediatamente
14. Sistema Dom Bosco – Um professor pediu ao seu das pedreiras.
aluno que identificasse as diferenças observadas entre
Fonte: <https://www.gazetaonline.com.br/noticias/
uma lâmina de bactéria e uma lâmina do epitélio de um
economia/2017/01/trabalhadores-vitimas-de-silicose-sao-
sagui. Descreva as principais características entre esses condenados-para-o-trabalho-1014019183.html>.
tipos celulares.
Como podemos observar, a silicose é uma doença
progressiva, que afeta trabalhadores da mineração, ex-
tração de rochas, entre outros. Essa doença afeta as
células, de maneira que uma organela celular atua dire-
tamente contra ela. Assinale a alternativa que indique
qual organela é essa:
a) Lisossomos.
b) Ribossomos.
c) Peroxissomos.
d) Complexo golgiense.
e) Centríolos.
15. IFSC (adaptada) – Durante uma aula de laboratório fo-
ram colocadas em frente a um aluno três fotografias 17. Unicamp-SP (adaptada) – Os fungos são organismos
de células. As fotografias foram obtidas por microscópio eucarióticos heterotróficos unicelulares ou multicelula-
eletrônico de transmissão e havia uma lista de algumas
res. Os fungos multicelulares têm os núcleos dispersos
estruturas identificadas para cada célula:
em hifas, que podem ser contínuas ou septadas, e que,
Célula 1: parede celular, mitocôndrias, plasmodesmas e em conjunto, formam o micélio. Mencione uma carac-
vacúolo de suco celular ou central; terística que diferencie a célula de um fungo de uma cé-
Célula 2: mesossoma, plasmídeo, parede celular e ri- lula animal, e outra que diferencie a célula de um fungo
bossomos; de uma célula vegetal.

Célula 3: glicocálix, mitocôndrias, ribossomos e lisos-


somos.
Considerando seus conhecimentos sobre biologia celular,
assinalea a soma da(s) proposição(ões) correta(s).
(01) O plasmídeo corresponde a uma molécula circular
de DNA existente em células procariontes, sen-
do assim o organismo representado pela célula 2
pertence a um organismo do reino Monera, que
inclui, as bactérias e cianobactérias.

Material exclusivo para professores


(02) A presença de parede celular nas células 1 e 2
indica que as duas células pertencem a organis-
mos vegetais.
(04) Se considerarmos que o organismo representado

conveniados ao Sistema de Ensino


pela célula 3 é multicelular e não apresenta pare-
de celular, podemos afirmar que se trata de uma
célula animal.

Dom Bosco
DB_PV_2019_BIO1A.indd 210 08/10/18 16:32
45 – Material do Professor 211

ESTUDO PARA O ENEM

BIOLOGIA 1A
18. Enem C5-H17 c)
Uma indústria está escolhendo uma linhagem de mi- 100
croalgas que otimize a secreção de polímeros comestí- 90
80
veis, os quais são obtidos do meio de cultura de cresci-

Radioatividade (%)
70
mento. Na figura podem ser observadas as proporções Retículo Endoplas-
60
de algumas organelas presentes no citoplasma de cada mático
50 Complexo Golgiense
linhagem. 40 Vesícula de Secreção
30
Perfil das linhagens de microalgas
100% 20
90% 10
80% 0
70% 5 min 10 min 15 min
60% Tempo
50%
40%
d)
30% 100
20% 90
10% 80

Radioatividade (%)
0% Linhagem I Linhagem I Linhagem I Linhagem I Linhagem I
70
Núcleo 20 20 20 20 20 Retículo Endoplas-
60 mático
Retículo Endoplasmático 20 35 15 40 35
Complexo Golgiense 50 40 35 20 15 50 Complexo Golgiense
Mitocôndrias 10 5 30 20 30 40 Vesícula de Secreção
30
Qual é a melhor linhagem para se conseguir maior ren- 20
dimento de polímeros secretados no meio de cultura? 10
0
a) I d) IV 5 min 10 min 15 min
b) II e) V Tempo
c) III e)
100
19. Enem C8-H29 90
Muitos estudos de síntese e endereçamento de pro- 80
Radioatividade (%)

teínas utilizam aminoácidos marcados radioativamen- 70


Retículo Endoplas-
te para acompanhar as proteínas, desde fases iniciais 60 mático
50
de sua produção até seu destino final. Esses ensaios Complexo Golgiense
40 Vesícula de Secreção
foram muito empregados para estudo e caracterização 30
de células secretoras. Após esses ensaios de radioati- 20
vidade, qual gráfico representa a evolução temporal da 10
produção de proteínas e sua localização em uma célula 0
secretora? 5 min 10 min 15 min
Tempo
a)
100
90
20. Enem C5-H17
80 COMPANHEIRA VIAJANTE
Radioatividade (%)

70 Suavemente revelada? Bem no interior de nossas células,


Retículo Endoplas-
60 mático uma clandestina e estranha alma existe. Silenciosamente,
50 Complexo Golgiense
40
ela trama e aparece cumprindo seus afazeres domésticos
Vesícula de Secreção cotidianos, descobrindo seu nicho especial em nossa fogo-
30
20 sa cozinha metabólica, mantendo entropia em apuros, em
10 ciclos variáveis noturnos e diurnos. Contudo, raramente
0 ela nos acende, apensar de sua fornalha consumi-la. Sua
5 min 10 min 15 min
origem? Microbiana, supomos. Julga-se adaptada às célu-
Tempo
las eucariontes, considerando-se como escrava, uma serva
b) a serviço de nossa verdadeira evolução.
100 Fonte: McMURRAY, W.C. The traveler. Trends in Biochemical Sciences.
90 1994 (adaptado).
80
Radioatividade (%)

70 A organela celular descrita de forma poética no texto


Retículo Endoplas-
60 mático
é o (a):
50

Material exclusivo para professores


Complexo Golgiense a) centríolo.
40 Vesícula de Secreção
30 b) lisossomo.
20 c) mitocôndria.
10
d) complexo golgiense.

conveniados ao Sistema de Ensino


0
5 min 10 min 15 min e) retículo endoplasmático não granuloso.
Tempo

Dom Bosco
DB_PV_2019_BIO1A.indd 211 08/10/18 16:32
5
212 46 – Material do Professor

SUBSTÂNCIAS INORGÂNICAS
BIOLOGIA 1A

DA CÉLULA

Uma preocupação constante em nossa sociedade é manter o corpo saudável.


Um importante aliado para atingir esse objetivo é o exercício físico, que pode ser
• Composição química da realizado em academias, clubes ou parques, em grupo ou individualmente. Embora
célula começar a se exercitar seja difícil para muitas pessoas, após algumas semanas é clara
• Substâncias inorgânicas a sensação de bem-estar, uma vez que as endorfinas – substâncias químicas associa-
das à sensação de prazer – são produzidas e liberadas em doses maiores no corpo.
HABILIDADES No entanto, além da prática física, um requisito fundamental para atingir o objeti-
• Relacionar propriedades vo de um corpo saudável é uma alimentação adequada, que não ultrapasse o limite
químicas das substâncias calórico diário. Para isso, é importante que as quantidades de gorduras, carboidratos,
orgânicas e inorgânicas fibras e proteínas estejam equilibradas, já que os componentes químicos que consti-
às finalidades a que se tuem esses nutrientes servirão de matéria-prima para a produção de outras substân-
destinam.
cias no organismo.
• Identificar padrões em

DMYTRO MYKHAILOV/SHUTTERSTOCK
fenômenos e processos vi-
tais dos organismos, como
manutenção do equilíbrio
interno e relações com o
ambiente.
• Compreender interações
entre organismos e
ambiente, em particular
aquelas associadas à saúde
humana, relacionando
conhecimentos científicos,
aspectos culturais e carac-
terísticas individuais.
• Relacionar informações
apresentadas em diferentes
formas de linguagem e
representação usadas nas
ciências físicas, químicas
ou biológicas, como texto
discursivo, gráficos, tabe-
las, relações matemáticas
ou linguagem simbólica. Os frutos são importantes fontes de fibras e vitaminas. Ao serem ingeridas, são metabolizadas no processo
• Utilizar códigos e nomen- de digestão. Esse processo fornece o material necessário para a respiração celular, gerando energia para os
claturas da química para processos vitais.
caracterizar materiais,
substâncias ou transforma- Neste módulo, estudaremos os principais componentes químicos que atuam no
ções químicas. funcionamento celular do nosso corpo, como a água, os sais minerais, os carboidra-
• Caracterizar materiais ou
tos, os lipídios e as vitaminas.
substâncias, identificando

Material exclusivo para professores


etapas, rendimentos ou
implicações biológicas,
Composição química da célula
sociais, econômicas ou am- A Tabela Periódica passou a ter 118 elementos químicos depois da descoberta
bientais de sua obtenção recente de quatro novos elementos químicos, adquiridos de forma sintética em vir-

conveniados ao Sistema de Ensino


ou produção. tude de sua instabilidade no meio natural – Nihonium (símbolo Nh e elemento 113),
Moscovium (símbolo Mc e elemento 115), Tennessine (símbolo Ts e elemento 117)
e Oganesson (símbolo Og e elemento 118). Desses 118, quatro são os principais

Dom Bosco
DB_PV_2019_BIO1A.indd 212 08/10/18 16:32
47 – Material do Professor 213

constituintes da matéria viva na Terra: carbono (C), hi- 30% são águas subterrâneas (armazenadas em aquífe-
drogênio (H), oxigênio (O) e nitrogênio (N). ros) e 1% encontra-se nos rios.

BIOLOGIA 1A
Esses elementos unem-se entre si e a outros, for-

JORISVO/SHUTTERSTOCK
mando substâncias químicas, que podem ser divididas
em substâncias orgânicas (que têm obrigatoriamente
carbono na constituição, sendo consideradas estrutu-
ras complexas e ricas em energia) e substâncias inor-
gânicas (derivadas de minerais, com estruturas mais
simples e pobres em energia).
Em geral, a quantidade dessas substâncias quími-
cas é muito variável na constituição celular dos seres
vivos. Um exemplo é a porcentagem de substâncias
presentes nas células eucarióticas animais, como mos-
tra o gráfico a seguir.

Composição química da célula Corredeiras no Parque Nacional do Iguaçu, em Foz do Iguaçu (PR). A água
é a substância mais abundante em nosso planeta e é essencial à vida.

Lipídios Sais Minerais O Brasil tem cerca de  12% da disponibilidade de


2% 2% Outros água doce do planeta, mas a distribuição natural desse
Carboidratos 1%
recurso não é equilibrada.  A região Norte, por exem-
3%
plo, concentra aproximadamente 80% da quantidade
Ácidos nucleicos
7% de água disponível, mas tem apenas 5% da população
brasileira. Já as regiões próximas ao  oceano Atlântico
Proteínas reúnem mais de 45% da população, porém, menos de
15%
Água 70% 3% dos recursos hídricos do país.
A água é a única substância encontrada na Terra nos
três estados físicos da matéria: sólido, líquido e gasoso.
A quantidade de água presente nos diferentes seres
vivos também pode variar entre seus tecidos e órgãos,
Composição química da célula eucariótica animal. Pelo menos 70% da
além de diferir ao longo da vida do indivíduo, diminuin-
constituição celular é água; 15%, proteínas; 7% são ácidos nucleicos;
3%, carboidratos e 4% são, ao todo, lipídios e sais minerais. do à medida que envelhece. No cérebro humano, por
exemplo, a quantidade de água pode ser encontrada
em uma taxa de 91%, constituindo, portanto, grande
SUBSTÂNCIAS parte da sua massa, enquanto pode atingir até 40% nos
ossos. Todos os organismos apresentam diferentes
INORGÂNICAS quantidades dessa substância, como o corpo da água-
-viva, um cnidário formado por 98% de água.
ÁGUA, A MOLÉCULA DA VIDA
WINGMAR/ISTOCKPHOTO.COM

A água é a substância mais abundante tanto den-


tro do corpo humano quanto em nosso planeta. É,
também, a substância mais procurada por astrôno-
mos em outros corpos celestes, já que ela torna pos-
sível a vida como a conhecemos aqui na Terra. Todos
os seres vivos são formados por água e vivem em
hábitats determinados pela quantidade de água exis-
tente, o que faz dessa substância o elemento funda-
mental para a vida na Terra e possivelmente encon-
trado em outros planetas.
Apesar de 70 a 75% da superfície da Terra estar
imersa em água, ela não está acessível ao consumo

Material exclusivo para professores


do ser humano quando se encontra na forma de gelo
ou vapor, por exemplo. Segundo a Agência Nacional
das Águas (ANA), estima-se que 97,5% da água exis-
tente no mundo é salgada e não é adequada ao nos-

conveniados ao Sistema de Ensino


so consumo direto nem à irrigação de plantações. Dos
2,5% restantes de água doce, a maior parte  (69%)  é
de difícil acesso, pois estão concentrados nas geleiras, Água-viva, animal encontrado em ecossistemas marinhos.

Dom Bosco
DB_PV_2019_BIO1A.indd 213 08/10/18 16:32
214 48 – Material do Professor

LEITURA COMPLEMENTAR molécula de água. É a capacidade que essa substância


BIOLOGIA 1A

tem de ser “contínua” e conseguir atravessar poros,


Em 1995 foi descoberto o primeiro planeta fora do Sis- subir por tubos ou descer por superfícies. É graças à
tema Solar que orbitava uma estrela maior que ele. Foi capilaridade que a água passa por espaços estreitos,
denominado 51 Pegasi b, localizado na área da constela- contra a gravidade. Um exemplo disso é a forma como
ção de Pegasus. A estrela a qual orbitava foi chamada de as plantas obtêm água e nutrientes diluídos provenien-
51 Pegasi. Em 2017, com tecnologias mais avançadas, tes do subsolo. A água que as raízes adquirem do solo
mas ainda não muito precisas, foi identificada uma at-
chega às folhas por meio de uma rede de células con-
mosfera com quantidade de água estimada em cerca de
dutoras dessa substância. Nas folhas, à medida que a
1 molécula de água para 10 mil de gases atmosféricos
água evapora, as ligações de hidrogênio das moléculas
em 51 Pegasi b. No mesmo ano, também foi publicado na
que deixam as nervuras puxam com força as outras
revista científica Nature a descoberta de outros sete plane-
moléculas abaixo, propagando essa força de tração pe-
tas em torno de uma estrela anã fria, chamada Trappist-1,
las células condutoras de água por todo o caminho até
localizada há 40 anos-luz da Terra. Segundo os pesquisa-
as raízes.
dores, há indícios de que pelo menos três desses planetas
são rochosos e têm oceanos em sua superfície.

SIAMBIZKIT/DREAMSTIME.COM
As propriedades da água que contribuem
para a vida
A molécula de água é formada por dois átomos de hi-
drogênio ligados a um átomo de oxigênio, por meio de
ligações covalentes. Como os elétrons são deslocados
para perto do átomo de oxigênio, formando uma zona
negativa e outra positiva do lado oposto, podemos classi-
ficá-la como uma molécula polar. Outra característica im-
portante é que as moléculas de água fazem ligações de
hidrogênio, ou seja, os átomos de hidrogênio (com carga
positiva) interagem com outro átomo mais eletronegativo, O transporte de água nas plantas ocorre pela interação entre as
como é o caso do oxigênio (com carga negativa). propriedades de adesão e coesão, que resultam na capilaridade. A adesão
da água à parede celular pelas ligações de hidrogênio a ajuda a resistir
contra a gravidade, enquanto a coesão das moléculas mantém a coluna de
água dentro da célula.

Essa força de atração entre as moléculas possibilita


a existência de um fenômeno chamado de tensão su-
perficial, que aparenta ser uma película fina na superfí-
cie da água, formada pelas ligações de hidrogênio (coe-
são) entre as moléculas. Por causa dessa característica,
Ligações
de muitos insetos e outros pequenos animais conseguem
hidrogênio andar sob a água sem afundar. A água tem uma tensão
superficial maior que dos outros líquidos.
JANMIKO/ISTOCKPHOTO.COM

Ligações de hidrogênio unem as moléculas de água. Como a disposição


espacial desses átomos não é linear, eles formam um ângulo.
Elementos representados fora da escala de tamanho. Cores fantasia.

Essa ligação, conhecida como propriedade de coe-

Material exclusivo para professores


são, possibilita que as moléculas fiquem fortemente
unidas, garantindo que a água seja estável e fluida em
condições normais de temperatura e pressão. A ade-
são é responsável pela aderência das moléculas de

conveniados ao Sistema de Ensino


água a outras substâncias polares.
Inseto de cerca de 1,5 cm de comprimento pousado sob a água, evento
A capilaridade é um  fenômeno físico  resultante possível em virtude da tensão superficial resultante da resistência das
das interações entre as forças de adesão e coesão da ligações de hidrogênio.

Dom Bosco
DB_PV_2019_BIO1A.indd 214 08/10/18 16:33
49 – Material do Professor 215

Outro aspecto importante das moléculas de água é o favorecer as reações químicas nas células e por dissolver
alto calor específico. Ou seja, é necessária muita ener- a maioria dos solutos, dissociando-os ou hidratando-os.

BIOLOGIA 1A
gia para que ela altere sua temperatura, o que faz com Isso ocorre porque as moléculas de água têm capacida-
que essas moléculas consigam absorver ou ceder uma de de hidrossolubilidade. Ou seja, conseguem facilmente
grande quantidade de calor sem alterar seu estado físico. separar ou dissociar partículas em virtude de seu caráter po-
Como consequência, a água é considerada termorregu- lar, o que reduz as forças de atração dos íons encontrados
ladora, por conseguir estabilizar a temperatura corporal em outras substâncias, possibilitando a eles se dissociar. As
dos seres vivos compatíveis às condições ambientais. substâncias que são dissolvidas na água são hidrofílicas (hi-
dro = água; philus = amigo), enquanto as que não se dissol-
RICOWDE/GETTY IMAGES

vem são hidrofóbicas (hidro = água; phobos = medo). Por


exemplo, a água não adere às moléculas apolares, como as
de gordura, de óleo e de cera, que são lipídios. É por isso que
a água forma gotas em superfícies enceradas ou oleosas.
Outras funções importantes dessa substância são:
• é a molécula fundamental no processo de hidróli-
se (hidro = água; lise = quebra), no qual há quebra
de uma molécula na presença de água, para resul-
tar em outros dois compostos distintos com os
elementos advindos dessa quebra;
• é necessária para que as enzimas consigam atuar
como catalisadoras das reações químicas;
A água é considerada termorreguladora em virtude de seu alto calor específico.
Por isso, quando estamos com calor, ela é capaz de regular nossa temperatura.
• atua na distribuição das substâncias nas células
por meio de seu fluxo (ciclose);
A água em qualquer um dos seus estados (sólido, líqui- • lubrifica as articulações e os olhos, além de com-
do ou gasoso) é considerada um solvente universal, por por a saliva.

SAIS MINERAIS
Os sais minerais são encontrados dissolvidos na água, na forma de íons que atuam no metabolismo. Também
podem ser achados em forma molecular nas estruturas esqueléticas dos animais, como em carapaças, conchas,
ossos, chifres e cascos, em que há carbonato de cálcio e fosfato de cálcio. Diferentemente dos carboidratos, dos
lipídios e das proteínas, os sais minerais são substâncias inorgânicas. Como o corpo não é capaz de produzir mine-
rais, eles devem ser ingeridos por meio da alimentação que contenha quantidades adequadas dessas substâncias.
O excesso de sais minerais no organismo é eliminado por meio das fezes e da urina.
A tabela a seguir apresenta os íons mais comuns, suas funções e onde podemos encontrá-los.

Íons Funções Fontes alimentares


Formação e manutenção dos ossos, dentes e coagulação sanguínea. Leite e derivados e vegetais
Cálcio
Transmissão de impulsos nervosos, batimentos cardíacos e contração muscular. verde-escuros.
Formação e manutenção dos ossos e dentes; constituinte da estrutura dos ácidos Leite e derivados, carnes, aves,
Fósforo
nucleicos e da adenosina trifosfato (ATP), principal reserva de energia. peixes, cereais e legumes.
Atua na contração muscular, na regulação da pressão sanguínea, na transmissão de
Verduras, frutas, legumes, carnes
Potássio impulsos nervosos e na manutenção do equilíbrio hídrico. Participa da síntese de
e leite.
glicogênio, de proteínas e do metabolismo energético.
Regulação do equilíbrio hídrico, relaxamento muscular e transmissão de impulsos
Sódio Sal de cozinha, algas marinhas.
nervosos.

Cloro Manutenção do equilíbrio hídrico e componente do suco gástrico. Sal de cozinha.

Magnésio Participa da contração muscular e é componente da clorofila. Cereais, vegetais e frutas.


Componente da hemoglobina, que tem grande afinidade com o oxigênio, Carnes, fígado, vegetais verde-
Ferro
transportando-o. -escuros e leguminosas.

Material exclusivo para professores Zinco

Cobre
Constituintes de várias enzimas e hormônios, atuante no processo de cicatrização e
na digestão.
Componente de enzimas que participam do metabolismo da hemoglobina.
Carnes, fígado, ovos, mariscos e
cereais.
Fígado, mariscos, nozes e leguminosas.

conveniados ao Sistema de Ensino Iodo


Flúor
Constituinte dos hormônios da glândula tireoide.
Manutenção dos ossos e do esmalte dos dentes.
Peixes, frutos do mar e sal iodado.
Peixes.

Dom Bosco
DB_PV_2019_BIO1A.indd 215 08/10/18 16:33
216 50 – Material do Professor

ROTEIRO DE AULA
BIOLOGIA 1A

SUBSTÂNCIAS INORGÂNICAS

ÁGUA Sais minerais

Considerada uma Cálcio


molécula:

Fósforo
Solvente Polar
Com alto calor
específico
universal Potássio Atua na contração
muscular
Unida por forças
intermoleculares
denominadas Sódio

Pontes de H+ Cloro
Componente do
suco gástrico

Que possibilitam alta Magnésio

Componente da
Ferro
hemoglobina

Cobre

tensão capilaridade

Forma os hormônios
Iodo
da tireoide

Material exclusivo para professores Zinco

conveniados ao Sistema de Ensino Flúor


Manutenção de ossos
e esmalte dental

Dom Bosco
DB_PV_2019_BIO1A.indd 216 08/10/18 16:33
51 – Material do Professor 217

EXERCÍCIOS DE APLICAÇÃO

BIOLOGIA1A
BIOLOGIA 1
1. IFAM – Os elementos químicos mais abundantes na matéria viva são:
a) carbono, hidrogênio, oxigênio e cloro.
b) carbono, hidrogênio, oxigênio e enxofre.
c) carbono, hidrogênio, oxigênio e nitrogênio.
d) carbono, hidrogênio, cloro e sódio.
e) carbono, hidrogênio, cloro e magnésio.
Os seres vivos são constituídos principalmente de substâncias orgânicas, isto é, que têm na compo-
sição carbono, hidrogênio e oxigênio. Além disso, boa parte da composição dos seres vivos são as
proteínas, que têm nitrogênio em sua composição.

2. Sistema Dom Bosco – Correlacione os sais minerais com as suas respectivas funções
no organismo.
1. Ferro 2. Potássio 3. Sódio 4. Cálcio
( ) Atua na formação e manutenção óssea e no processo de coagulação sanguínea.
( ) Atua na contração muscular, na regulação da pressão sanguínea e na transmissão de
impulsos nervosos.
( ) Transporta oxigênio.
( ) Atua na regulação do equilíbrio hídrico e no relaxamento muscular.
A sequência correta é:
a) 1-2-3-4. b) 4-3-2-1. c) 4-2-1-3. d) 4-1-3-2.
O cálcio atua na formação e manutenção óssea e no processo de coagulação sanguínea; o potássio age
na contração muscular, na regulação da pressão sanguínea e na transmissão de impulsos nervosos; o
ferro transporta oxigênio e o sódio atua na regulação do equilíbrio hídrico e no relaxamento muscular.

3. Sistema Dom Bosco – Cite os fatores que podem interferir na taxa de água de um
organismo.
Atividade metabólica e idade. Além disso, varia entre as espécies.

4. UFPA (adaptada) – Em córregos de água e leitos de rios é possível ver pequenos inse-
tos pousados sobre a água. Esses insetos não afundam devido ao(à):
a) presença de pontes de hidrogênio, em função da elevada polaridade da molécula de água.
b) fato de os insetos apresentarem uma densidade menor que a de água.
c) elevada intensidade das forças de dispersão de London, em consequência da polari-
dade das moléculas de água.
d) interação íon-dipolo permanente, originada pela presença de substâncias iônicas na água.
e) imiscibilidade entre a substância inorgânica que recobre as pernas e asas dos inse-
tos e a água.
A tensão superficial da água ocorre em virtude da força das interações entre suas moléculas (ligações de
hidrogênio).
5. Sistema Dom Bosco – Á água é uma substância fundamental para os seres vivos.
Entre as opções a seguir, assinale a alternativa incorreta.
a) A água tem alta capilaridade, característica que possibilita compreender como as
plantas conseguem absorvê-la do solo e distribuir por toda a planta.
b) A água é considerada um solvente universal.
c) A água tem como importante função transportar íons, por ter alto fluxo no interior
das células e dos organismos.
d) A água tem baixa tensão superficial, o que explica por que alguns invertebrados,
como as aranhas, conseguem andar sob ela.
A água tem alta tensão superficial, o que garante que as moléculas estejam unidas o suficiente para um
invertebrado andar sobre ela.

Material exclusivo para professores


6. Sistema Dom Bosco – Descreva a função do fósforo nos seres vivos.
O fósforo atua na formação e manutenção dos ossos e dentes. Além disso, ele é constituinte da estrutura dos

ácidos nucleicos e do ATP, principal reserva de energia.

conveniados ao Sistema de Ensino


Dom Bosco
DB_PV_2019_BIO1A.indd 217 08/10/18 16:33
218 52 – Material do Professor

EXERCÍCIOS PROPOSTOS
BIOLOGIA 1A

7. FTM-MG – Considere um seguimento do rótulo de um Anderson Caires, pesquisador da UFMS. Nem é preciso
produto alimentício, mostrado a seguir: Sol forte para matar as larvas. Até a luz de um dia nublado,
ou de uma lâmpada, é suficiente. As substâncias que serão
Informação nutricional administradas são muito facilmente encontradas. Uma de-
Porção 26 g (2 colheres de sopa) las é a clorofila, que pode ser extraída de qualquer planta
  Quantidade % VD (*) verde, até do mato. A outra é a curcumina, que é extraída
Valores energéticos 129 kcal = 542 kJ 6 de uma raiz, o açafrão. Em pó, é tempero culinário. Como
são naturais não fazem mal. Se uma criança ou animal do-
Carboidratos 9,6 g 9 méstico tiver contato com essa água não tem problema.
Proteínas 6,7 g 3
<http://g1.globo.com/jornal-nacional/noticia/2017/01/pesquisa-
Gorduras totais 7,1 g 13 desenvolve-inseticida-que-usa-luz-contra-larva-do-aedes-aegypti.html>.
Gorduras saturadas 4,4 g 20 Acesso em 3 mar. 2018
Gorduras trans 0g ** Entre as opções a seguir, marque a substância funda-
Fibra alimentar 0g 0 mental à produção do pigmento clorofila.
Sódio 91 mg 4 a) Ferro. c) Cobre.
Vitamina A 180 mcgRE 30 b) Zinco. d) Magnésio.
Vitamina C 14 mg 30
10. Sistema Dom Bosco – Geralmente, ao nos deparar-
Vitamina D 1,5 mcg 30
mos com o rótulo das pastas de dentes, encontramos
Ferro 4,2 mg 30 uma determinada quantidade de fluoreto de sódio em
Cálcio 239 mg 24 sua constituição. Descreva a importância dessa subs-
%Valores diários com base em uma dieta de 2.000 kcal ou tância na constituição desse produto.
8.400 kJ. Seus valores diários podem ser maiores ou menores
dependendo de suas necessidades energéticas.
**Não estabelecido.

A substância inorgânica que, segundo o rótulo acima,


ocorre em maior concentração em porção de 26 mg
(m/m) e sua respectiva função no organismo é:
a) sódio, controle da acidez do meio interno sanguíneo.
b) ferro, funcionamento das células nervosas.
11. Cefet-MG
c) cálcio, participa de reações de coagulação do sangue
O ovo é um recipiente biológico perfeito que contém mate-
e da contração muscular.
rial orgânico e inorgânico em sua constituição. Um de seus
d) vitamina A, participa das reações químicas vitais componentes é a clara ou albúmen, formada predominan-
às células. temente por água e também por proteínas. Caso a galinha
e) carboidratos, fornecimento de energia liberada du- se reproduza antes da liberação do óvulo ocorrerá a for-
rante a respiração ou fermentação celular. mação de um embrião no interior do ovo. Porém, para que
este se desenvolva é necessária uma transferência de calor,
8. Sistema Dom Bosco – Á água é considerada uma subs- que ocorre durante o período em que essas chocam ovos.
tância de suma importância para a vida pois:
a) devido à sua característica apolar, é possível aconte- Disponível em: <http://super.abril.com.br>. (Adaptado).
cer reações de hidrólise. Caso a galinha saia do ninho temporariamente durante
b) sem ela é impossível ocorrer a maioria das reações esse período, o desenvolvimento do embrião não ces-
metabólicas. sará em virtude da água no interior do ovo:
c) pelo fato de ser solvente universal ela consegue inte- a) diluir substâncias tóxicas.
ragir com moléculas hidrofóbicas. b) ser um solvente universal.
d) devido ao seu baixo calor específico, ela pode atuar c) possuir um alto calor específico.
na termorregulação.
d) participar de reações de hidrólise.
9. Sistema Dom Bosco e) apresentar elevado valor nutricional.
Pesquisadores de três universidade públicas descobriram
12. Fuvest-SP – Entre os elementos mais abundantes que
um inseticida que mata a larva do Aedes aegypti com a ocorrem nos oceanos estão:
ajuda da luz. Nos ensaios de laboratório, essas larvas são
a) sais minerais, gases dissolvidos e ácidos húmicos.
expostas a uma luz de led. Em 15 minutos, estão todas eli-

Material exclusivo para professores


minadas. A água nesse caso, contém uma substância de- b) metais pesados, terras raras e gases nobres.
senvolvida por cientistas de três universidades: USP, Uni- c) carbono, nitrogênio, fósforo e enxofre.
versidade Federal de São Carlos, e Universidade Federal de d) hidrogênio, oxigênio, cloro e sódio.
Mato Grosso do Sul. É o fotoinseticida. O nome é porque, e) água, cloreto de sódio e sulfato de magnésio.

conveniados ao Sistema de Ensino


sozinho, ele não mata a larva do mosquito. Mas exposto
à luz, é fatal. “A luz interagindo com uma molécula, oxida 13. Sistema Dom Bosco – Na 93o Corrida Internacional de
as células e mata a larva, como se ela a queimasse”, disse São Silvestre, 30 mil atletas disputaram a tradicional

Dom Bosco
DB_PV_2019_BIO1A.indd 218 08/10/18 16:33
53 – Material do Professor 219

competição pelas ruas de São Paulo. Os vencedores fo- polaridade molecular da água, além das forças de intera-

BIOLOGIA 1A
ram o etíope Dawitt Admasu entre os homens e a que- ção da água que são rompidas pela presença do deter-
niana Flomena Cheyech no feminino. Em geral, obser- gente, respectivamente.
va-se que, após eventos como esses, os participantes a) Angular, polar e dipolo-induzido.
encontram-se com intensa sudorese. Qual é a função
b) Angular, apolar e ligações de hidrogênio.
desse fenômeno biológico?
c) Linear, apolar e forças de London.
a) Aliviar a excreção renal.
d) Angular, polar e ligações de hidrogênio.
b) Manter a temperatura corporal.
e) Trigonal, apolar e ligações de hidrogênio.
c) Eliminar os resíduos metabólicos.
d) Controlar a pressão arterial. 17. Sistema Dom Bosco – Observe os rótulos dos alimen-
tos a seguir.
14. Sistema Dom Bosco
“A sigla NPK seguida de números indica que o produ- Alimento I - Informação nutricional
to é um fertilizante químico. O N é de nitrogênio, o P
significa fósforo e o K é de potássio. Esses elementos são   Quantidade % VD (*)
macronutrientes e estão presentes na maioria dos adu- Valores energéticos 87 kcal = 353 kj 4
bos, pois são necessários para todas as plantas. Os nú-
Carboidratos 10 g 3
meros que vêm depois deles indicam a porcentagem de
cada elemento na composição do adubo. Por exemplo, Proteínas 2g 3
1 kg de adubo NPK com formulação 10-10-10 tem 100 g
Gorduras totais 4g 7
de N, 100 g de P e 100 g de K. O restante, para completar
os 100%, é composto de substâncias sem efeito sobre a Gorduras saturadas 2g 10
planta, ou enchimento. Os valores variam porque cada Gorduras trans 0g **
elemento tem uma função e deve ser usado em maior
ou menor quantidade, de acordo com a necessidade da Fibra alimentar 1,5 g 5
planta em cada etapa do desenvolvimento”. Sódio 1 262 mg 53
Revista Natureza. O que é NPK?. Disponível em: <http://revistanatureza.
com.br/o-que-e-npk/>. Acesso em: 3 mar. 2018. Alimento II - Informação nutricional
Sabendo-se que o nitrogênio é componente dos ácidos   Quantidade % VD (*)
nucleicos e das proteínas, descreva as funções do fós-
foro e do potássio. Valores energéticos 80 kcal = 335 kj 4
Carboidratos 13 g 4
Proteínas 1g 2
Gorduras totais 3g 5
Gorduras saturadas 1,3 g 6
Gorduras trans 0g **
Fibra alimentar 5g 20
Sódio 603 mg 26

Uma pessoa com hipertensão está decidindo qual des-


15. Sistema Dom Bosco – Com o aumento do consumo
ses produtos irá consumir. Com base em seus conheci-
de produtos industrializados, houve consequentemente
mentos, responda:
um crescimento na ingestão de iodo, um importante íon
acrescentado ao sal para evitar doenças como o bócio. a) Por qual(is) alimentos essa pessoa deve optar?
Com base em seus conhecimentos sobre o assunto,
marque a alternativa correta.
a) O iodo é o principal componente dos hormônios pro-
duzidos pela glândula tireoide.
b) O bócio é uma doença cardiovascular, com grande
incidência em pessoas obesas.
c) Os hormônios produzidos pela glândula tireoide são a b) Cite dois componentes do rótulo que podem influen-
tiroxina e a testosterona. ciar no aumento da pressão arterial e explique de que
d) A única fonte de iodo é o sal de cozinha. forma eles exercem essa influência.
16. Sistema Dom Bosco – Os detergentes não biodegra-

Material exclusivo para professores


dáveis diminuem a capacidade de oxigenação da água
e envenenam várias formas de vida aquática, compro-
metendo também a força de interação intermolecular
da água. Como consequência, as tensões superficiais

conveniados ao Sistema de Ensino


da fase líquida também diminuem, possibilitando a for-
mação de bolhas. Escolha, entre as alternativas abaixo,
aquela que apresenta corretamente a geometria e a

Dom Bosco
DB_PV_2019_BIO1A.indd 219 08/10/18 16:33
220 54 – Material do Professor

ESTUDO PARA O ENEM


BIOLOGIA 1A

18. Sistema Dom Bosco C5-H18 Qual das opções a seguir é o principal componente da
Alimentos ácidos, condimentados e gordurosos cos- hemoglobina?
tumam cair como uma bomba em estômagos mais a) Ferro. d) Potássio.
sensíveis. É comer para logo sentir aquela azia ou
b) Cloro. e) Zinco.
queimação.Cafeína, bebidas alcoólicas, cigarro e até
o nervosismo também podem piorar problemas como c) Sódio.
gastrite e úlcera. Segundo uma enquete feita aqui no
20. Sistema Dom Boco C5-H18
site, 34% das pessoas disseram que o estresse é o fa-
A grande maioria das espécies de aranhas é terrestre,
tor que mais desencadeia crises estomacais. Isso ocor-
alguns grupos terrestres são aquáticas opcionais, como
re porque, em situações de tensão, o sistema nervoso
muitas da família Lycosidae, por exemplo a própria ara-
é acionado e estimula a produção de sucogástrico no
nha-de-jardim (Lycosa erythrognatha). Mas existem algu-
estômago, tornando-o mais ácido, de maneira que a
mas aranhas  altamente adaptados à vida junto a corpos
agressão é maior.
d´água, capazes de caminhar sobre a superfície d´água e
Fonte: http://g1.globo.com/bemestar/noticia/2012/04/excesso-de- caçar animais aquáticos,  chamadas de  aranhas pesca-
acidez-no-estomago-causa-ulceras-e-gastrite.html doras  ou  aranhas d’água.  Duas famílias principais são  a
O principal constituinte do suco gástrico é o: Pisauridae e Trechaleidae, ambas bem próximas filogeneti-
camente à Lycosidae. A própria família Lycosidae tem alguns
a) magnésio.
gêneros verdadeiramente aquáticos. Finalmente, alguns
b) potássio.
representantes da família Ctenidae (a mesma família da
c) sódio. Armadeira, Phoneutria spp.) também são aquáticos, como
d) ferro. a Ancylometes. Todas elas lembram bastante as Lycosidae,
e) cloro. mas têm pernas mais alongadas, podem atingir grandes
dimensões (especialmente as Ancylometes, com até 12 cm
19. Sistema Dom Bosco C5-H18 de envergadura incluindo suas pernas).
A planta do fumo, modificada em laboratório, é capaz de
Fonte: <http://www.planetainvertebrados.com.br/index.
produzir hemoglobina, uma proteína das células verme- asp?pagina=especies_ver&id_categoria=28&id_subcategoria=0&com=1&
lhas do sangue. É essa proteína que capta o oxigênio nos id=264&local=2>
pulmões e o distribui pelas demais parte do organismo
Qual das características da água permite esse tipo de
humano. É ela que completa o trabalho da respiração.
adaptação para as aranhas?
“Conseguimos que a planta do fumo produzisse uma
quantidade pequena de hemoglobina. Estamos testando a) Capilaridade.
outros tipos de vegetais, que possibilitem maiores co- b) Solvente universal.
lheitas da proteína’’, disse à  Folha  a pesquisadora Josée c) Tensão superficial.
Pagnier, coautora do experimento. d) Calor específico.
Fonte: http://www1.folha.uol.com.br/fsp/ciencia/fe060301.htm e) Polaridade.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A.indd 220 08/10/18 16:33
6
55 – Material do Professor 221

SUBSTÂNCIAS ORGÂNICAS:

BIOLOGIA 1A
CARBOIDRATOS, LIPÍDIOS
E VITAMINAS

As substâncias orgânicas desempenham diversas funções: compõem as estrutu-


ras dos tecidos e das células, fornecem energia e coordenam as atividades celulares.
Todas essas funções estão relacionadas ao metabolismo, que é o conjunto de rea- • Carboidratos
ções químicas que ocorrem dentro de um organismo e podem ser classificadas em • Lipídios
anabolismo (síntese de moléculas complexas com uso de muita energia) ou cata- • Vitaminas lipossolúveis
bolismo (degradação de moléculas com liberação de energia).
Os compostos orgânicos naturais estão presentes em todos os alimentos que HABILIDADES
ingerimos e nos combustíveis derivados do petróleo (como a gasolina e o óleo diesel). • Identificar os componentes
Também estão no próprio corpo humano, cuja massa é constituída em mais de 60% químicos que servem de
por compostos orgânicos. matéria-prima para a pro-
dução de outras substân-
GETTY IMAGES

cias dentro do organismo.


• Utilizar os códigos e as
nomenclaturas da Química
e da Biologia para caracte-
rizar materiais, substân-
cias ou transformações
químicas.
• Classificar os diferentes
carboidratos de acordo com
o número de moléculas em
sua constituição.
• Entender a função dos
lipídios no organismo.
• Diferenciar as vitaminas
lipossolúveis das vitaminas
hidrossolúveis.

As substâncias naturais orgânicas são aquelas produzidas pelos seres vivos (animais ou vegetais) e são
denominadas biomoléculas. A cana-de-açúcar, por exemplo, produz compostos orgânicos que podem ser
destilados e usados na produção da cachaça e também do álcool etílico, um combustível.

Esses compostos são formados por macromoléculas biológicas, uma forma de


polímero constituído pela união de várias moléculas menores, denominadas monô-
meros. Em alguns carboidratos, um mesmo monômero é repetido inúmeras vezes.
Em outros casos, como nas proteínas e nos ácidos nucleicos, monômeros diferentes
unem-se em uma ordem particular. Cada um desses monômeros é adicionado por

Material exclusivo para professores


meio da repetição da mesma reação catalisada por enzimas. Dessa maneira, todos os
monômeros de uma macromolécula são alinhados na mesma direção, e as termina-
ções da macromolécula são quimicamente distintas.
É por esse motivo que as macromoléculas têm propriedades muito diferentes das

conveniados ao Sistema de Ensino


dos monômeros que as constituem. Esse é o tema deste e dos próximos módulos:
as substâncias orgânicas que atuam no funcionamento celular do nosso corpo, como
carboidratos, lipídios, proteínas e ácidos nucleicos.

Dom Bosco
DB_PV_2019_BIO1A.indd 221 08/10/18 16:33
222 56 – Material do Professor

Carboidratos Quantidade
Nome do
BIOLOGIA 1A

de átomos Fórmula
Os carboidratos também são conhecidos como monossa- Exemplo
de carbono estrutural
açúcares, hidratos de carbono, sacarídeos ou glicídeos. carídeo
(n)
Esse grupo inclui todos os açúcares simples (monossa-
Aldeído
carídeos) e seus polímeros (polissacarídeos). Tanto os
fosfoglicérico
monossacarídeos como os resíduos de polissacarídeos
– tipo de
contêm grupos hidroxila, por isso são classificados
como álcoois.
3 Triose C 3H 6O 3 gliceraldeído
(PGA) –,
Em geral são observados, principalmente, na com-
utilizado na
posição estrutural ou como reserva e fornecimento
fotossíntese.
de energia, de modo que, ao serem decompostos,
Eritrose, um
geram CO2 e H2O. Essas moléculas são compostas
açúcar em
classicamente por átomos de carbono (C), hidrogênio 4 Tetrose C 4H 8O 4
forma de
(H) e oxigênio (O). Alguns têm como característica o
xarope.
gosto adocicado nos alimentos quando são derivados
Ribose
de glicose (mel) ou frutose (frutas), outros fazem parte
(constituinte
da constituição de muitos alimentos e, além de não te-
do RNA) e
rem gosto adocicado, podem não ser digeríveis e têm 5 Pentose C5H10O5
desoxirribose
estruturas mais complexas.
METKALOVA/ISTOCKPHOTO.COM (constituinte
do DNA).
Glicose,
6 Hexose C6H12O6 frutose e
galactose.

A maioria dos carboidratos disponíveis na natureza


é as hexoses, que são encontradas, respectivamente,
nos pães, nas frutas e no leite. Esse tipo de carboidra-
to é a principal fonte de energia para os seres vivos.
Entre as hexoses, a glicose é a mais abundante, pois é
a unidade monomérica da celulose, um polissacarídeo
estrutural, bem como do glicogênio e do amido, que
são polissacarídeos de armazenamento.

MARILYNA/ISTOCKPHOTO.COM

O mel é um tipo de carboidrato com sabor doce característico.

Em geral, os carboidratos são classificadas de


acordo com o número de moléculas em sua cons- Alimentos como pães, massas e vegetais são fontes de carboidratos,
como a glicose e a frutose.
tituição, como monossacarídeos, dissacarídeos e
polissacarídeos.
DISSACARÍDEOS (OLIGOSSACARÍDEOS)
MONOSSACARÍDEOS São moléculas formadas pela união entre 2 e 10 mo-

Material exclusivo para professores


São carboidratos simples, com fórmula geral CnH2nOn, nossacarídeos com função energética. Quando dois mo-
solúveis em água. Seu nome é dado pelo valor de n nossacarídeos se unem para formar um dissacarídeo, há
(número de átomos), que pode variar entre 3 e 6. Os liberação de uma molécula de água, por isso a reação é
monossacarídeos mais comuns apresentam de 5 a 6 chamada de síntese por desidratação. Já na quebra de

conveniados ao Sistema de Ensino


átomos de carbono. A tabela a seguir apresenta alguns um dissacarídeo ocorre a entrada de uma molécula de
exemplos de monossacarídeos, com seus nomes e a água, falando-se em uma quebra por hidrólise, proces-
quantidade de carbono em suas composições. so comum na digestão química dos alimentos.

Dom Bosco
DB_PV_2019_BIO1A.indd 222 08/10/18 16:33
57 – Material do Professor 223

MIND_AND_I/ISTOCKPHOTO.COM POLISSACARÍDEOS

BIOLOGIA 1A
São moléculas constituídas por mais de 10 monossa-
carídeos, insolúveis em água. Podem servir para arma-
zenar grande quantidade de energia, como o glicogênio
ou o amido. O glicogênio é armazenado no fígado e nos
músculos dos animais. Já o amido, de origem vegetal,
encontra-se nas células do parênquima amilífero de cau-
les (batata-inglesa), raízes (mandioca) e sementes (feijão,
lentilha, soja). Ambos são compostos de várias molécu-
las de glicose e, para serem mais bem aproveitados pelo
O açúcar obtido da cana-de-açúcar é um dissacarídeo chamado de nosso metabolismo, passam por algumas modificações.
sacarose.

FOTOZLAJA/ISTOCKPHOTO.COM
Nesta tabela são relacionadas as unidades formado-
ras dos três principais dissacarídeos.
Unidades
Dissacarídeos Fonte
formadoras
Sacarose Glicose + frutose Açúcar da cana.
Açúcar obtido
industrialmente
pela fermentação
Maltose Glicose + glicose
de cereais em
germinação, como
a cevada. A batata, a mandioca e grãos leguminosos como lentilha, ervilhas e soja
Glicose + são exemplos de alimentos nos quais encontramos o amido.
Lactose Açúcar do leite.
+ galactose
O amido se transforma em maltose por meio da
enzima amilase. Depois, a maltose é transformada em
LEITURA COMPLEMENTAR glicose com base na enzima maltase. O glicogênio, por
sua vez, transforma-se em glicose por meio do hormô-
Intolerância à lactose e galactosemia
nio glucagon, produzido pelo pâncreas e por células do
A intolerância à lactose ocorre pela redução da produção tecido gastrointestinal.
da lactase no organismo, principal enzima capaz de que-
brar a lactose (um dissacarídeo) em galactose e glicose,
dois monossacarídeos que são absorvidos pelo organis- amilase maltase
amido maltose glicose
mo. Com a falta dessa enzima, a lactose chega ao intesti-
no grosso sem ter sua forma alterada e nele se acumula,
sendo fermentada pelas bactérias, o que causa diarreias glucagon
e cólicas. De acordo com um artigo científico publicado glicogênio glicose
em 2018 na revista norte-americana Therapeutic Advances
Esquemas representando a transformação do amido e do glicogênio em
in Drug Safety, 70% da população mundial têm algum
moléculas de glicose.
tipo de intolerância à lactose. Pode ser do tipo primário
(forma comum, quando a lactase tem redução natural
Os polissacarídeos também podem ter função es-
durante a adolescência), secundário (doenças intestinais
trutural, como a celulose (presente na parede celular
promovem seu aparecimento) ou crônico (em virtude de
das células vegetais) e a quitina (encontrada no exoes-
problemas genéticos).
queleto dos artrópodes e na parede celular dos fungos).
Outra doença que provoca sintomas semelhantes é aga- A celulose é o polissacarídeo mais abundante na Terra,
lactosemia – doença genética causada por mutações no mas, ao nos alimentarmos de um vegetal, não conse-
cromossomo 9 que, quando presentes nas duas cópias guimos digeri-la por não produzirmos a enzima celulase.
desse cromossomo, impede a produção da enzima que Por outro lado, os herbívoros (cavalos e vacas) e alguns
converte a galactose (um monossacarídeo) em glicose. insetos, como cupins e baratas, conseguem digerir a

Material exclusivo para professores


Como consequência, a galactose é acumulada no intes- celulose por terem microrganismos em seus tubos di-
tino, promovendo diarreias e cólicas. De acordo com a gestórios capazes de produzir a enzima celulase.
Genetic Disease Foundation, essa doença ocorre em 1 a
cada 30 mil recém-nascidos e tem maior frequência em celulase

conveniados ao Sistema de Ensino


países do continente africano e em países sul-america- celulose glicose
nos com descendentes africanos, como o Brasil.
A celulose é digerida pela celulase, transformando-se em glicose.

Dom Bosco
DB_PV_2019_BIO1A.indd 223 08/10/18 16:33
224 58 – Material do Professor

mielina dos neurônios. Atuam como precursoras de


DANTESATTIC/ISTOCKPHOTO.COM
BIOLOGIA 1A

vitaminas e hormônios, como impermeabilizadores de


superfícies de folhas e frutos e como reserva energéti-
ca. Além disso, contribuem para a proteção de órgãos.

W6/ISTOCKPHOTO.COM
A celulose é um polissacarídeo com função estrutural para as plantas,
enquanto a quitina tem essa função no exoesqueleto de artrópodes, como
o besouro.

LEITURA COMPLEMENTAR
A cera das folhas das plantas é formada por lipídios, que impermeabilizam
A diabetes mellitus é uma doença metabólica que pode
a superfície.
ocorrer pela falta de insulina ou defeitos da ação dela
no corpo. Pode ser de dois tipos, classificados de acordo Os lipídios têm várias funções, mas as principais
com a origem do problema: se pelo distúrbio na produ- são reserva energética (realizada pela gordura nos ani-
ção (diabetes mellitus tipo 1) ou na ação da insulina (dia- mais e óleos nos vegetais) e função estrutural (ceras
betes mellitus tipo 2). Esse hormônio, produzido pelo presentes em folhas e frutos). Além disso, essas mo-
pâncreas, especificamente pelas células beta, é responsá- léculas podem ser usadas como isolantes térmicos ou
vel por transportar a glicose para dentro das células de mecânicos ou contribuir para a flutuação.
diversos órgãos e tecidos, nos quais elas serão utilizadas

JUSTINREZNICK/ISTOCKPHOTO.COM
como fonte de energia ou são armazenadas na forma de
glicogênio, como ocorre no fígado. Quando a insulina
não é produzida em quantidades adequadas, ou quando
por ventura há algum mau funcionamento dela, a glico-
se fica solta na corrente sanguínea, aumentando a chan-
ce de ocorrerem doenças cardiovasculares, como infar-
tos e acidentes vasculares cerebrais, além de aumentar a
quantidade de corpos cetônicos, o que pode promover a
hipertensão, causar cegueira e perda da consciência. Isso
pode resultar, em casos mais graves, em morte.

Animais que vivem em ambientes gelados, como ursos, pinguins e focas,


Lipídios têm espessa camada de gordura sob a pele para evitar perda de calor para
o meio, servindo como isolante térmico.
Os lipídios são outra classe de macromoléculas
formadas por estruturas muito variadas e diferem dos Os lipídios são classificados em diferentes tipos. Os
carboidratos por apresentarem menor quantidade de lipídios mais simples são os ácidos graxos – longas
oxigênio e conter átomos de fósforo. Além disso, eles cadeias de hidrocarbonetos com um grupo carboxila no
são pouco solúveis em água (hidrofóbicos). Em con- final. Em geral, os ácidos graxos são encontrados com
trapartida são mais solúveis em compostos orgânicos parte de lipídios mais complexos, tais como os que ve-
apolares, como éter, benzeno, álcool e clorofórmio. remos a seguir. Se houver carboidrato em sua constitui-
Os lipídios apresentam uma “cabeça” polar, hidrofílica ção, esses lipídios são denominados glicolipídio. Quando
(que tem atração pela água) e uma “cauda” apolar, hidrofó- há um grupo fosfato na composição, esses lipídios são
bica. Em um meio aquoso, as “caudas” hidrofóbicas se as- chamados fosfolipídios. Os esteroides e as vitaminas

Material exclusivo para professores


sociam, enquanto as “cabeças” hidrofílicas ficam expostas lipídicas também são lipídios complexos.
à água, formando uma lâmina chamada bicamada lipídica,
que forma a base estrutural das membranas biológicas. Es- GLICERÍDEOS (TRIACILGLICERÓIS)
sas membranas são flexíveis porque as bicamadas lipídicas Também são chamados de triacilgliceróis (ou triglicerí-

conveniados ao Sistema de Ensino


são estabilizadas por forças não covalentes. deos) em virtude dos três resíduos de ácidos graxos que
Essas macromoléculas são encontradas no teci- se ligam a uma molécula de glicerol (um álcool), por meio
do adiposo, nas membranas celulares e na bainha de da reação de esterificação. São altamente hidrofóbicos.

Dom Bosco
DB_PV_2019_BIO1A.indd 224 08/10/18 16:33
59 – Material do Professor 225

SCIENCEPICS/SHUTTERSTOCK
meio extracelular
R1 COOH + HO CH2 R1 CO — O CH2

BIOLOGIA 1A
Esterificação
R2 COOH + HO CH R2 CO — O CH + 3 H2O
cabeça
R3 COOH + HO CH2 R3 CO — O CH2
hidrofílica
Ácidos graxos + glicerol Triacilgliceróis proteína

}
Os glicerídeos são formados pela união entre três ácidos graxos e caudas
uma molécula de glicerol. Essa reação é conhecida como reação de hidrofóbicas
esterificação. }
fosfolipídios
São utilizados como reserva energética nas semen-
tes (óleos) e no tecido adiposo (gordura) dos animais. meio intracelular
Estão presentes em quantidades acima de 40% no cor- Esquema da bicamada lipídica, formada pelo arranjo dos fosfolipídios em
contato com a água. Elementos fora de escala. Cores fantasia.
po animal. Nas sementes oleaginosas entre 18 e 40%.
Essa molécula aumenta a massa corporal do orga-
nismo, visto que, quando carboidratos e proteínas são ESTEROIDES
consumidos em excesso, aglomeram-se sob a forma São outra classe de lipídios encontrada nas mem-
de gotículas de gordura na célula. Nos mamíferos, a branas de eucariotos e, muito raramente, em bactérias.
maioria da gordura recém-sintetizada é estocada em São formados por anéis de carbono. O colesterol é um
forma de triglicerídeo no tecido adiposo que é cons- importante esteroide presente na membrana plasmá-
tituído por células especializadas, os adipócitos. Cada tica dos animais, embora em menor quantidade na
adipócito contém uma grande gota de gordura, que res- membrana plasmática dos vegetais e ausente em pro-
ponde por quase todo o volume celular. Embora esteja cariotos, protistas e fungos.
distribuído por todo o corpo dos mamíferos, o tecido Em mamíferos, o colesterol exerce a função essen-
adiposo se concentra em maior volume logo abaixo da cial de precursora dos hormônios esteroides ou sexuais
pele e na cavidade abdominal. (progesterona, estradiol e testosterona) e dos sais bilia-
Os óleos são as principais formas de reserva ener- res. Também modula a fluidez das membranas celula-
gética das plantas. São derivados de sementes de gi- res e reduz a permeabilidade, graças à sua configura-
rassol, soja, milho e azeitona (fruto da oliveira), sendo ção repleta de anéis de carbono.
muito utilizados em nossa alimentação, na forma de
óleo de cozinha e azeite de oliva e na produção de mar- LEITURA COMPLEMENTAR
garinas. Podem ser encontrados também nos animais, As moléculas de colesterol podem ser transportadas no san-
como o óleo de fígado de bacalhau. gue ligadas a lipoproteínas, que podem ter baixa densidade
(LDL, low density lipoprotein) ou alta densidade (HDL, high
ESFINGOLIPÍDIOS density lipoprotein). O LDL, por ter baixa densidade, quan-
Constituem o segundo grupo mais abundante de do consumido em excesso causa aterosclerose (formação de
lipídios presentes em membranas animais e vegetais. placas de ateroma sobre a parede das artérias e veias, que
Nos mamíferos respondem por grande parte da compo- obstruem o fluxo sanguíneo nesses vasos), que consiste
sição dos tecidos do sistema nervoso central. numa lesão no vaso e na tentativa de reparo que acumula o
A ceramida é formada por um ácido graxo ligado a LDL, células do sistema imune, como macrófagos e células
um grupo amina e é precursora metabólica de todos os musculares presentes na camada média dos vasos do tipo
esfingolipídios. As esfingomielinas, uma família de es- artérias. Como consequência, pode ocorrer um infarto do
fingolipídios, estão presentes na membrana plasmática miocárdio ou um acidente vascular cerebral, dependendo
da maioria dos mamíferos e são o principal constituinte de onde ocorra o rompimento da veia ou artéria. O HDL,
da bainha de mielina, que envolvem algumas células por outro lado, é considerado um bom colesterol, por ter alta
nervosas. densidade e capacidade de remover o excesso do LDL.
A gordura trans é uma modificação industrial que trans-
FOSFOLIPÍDIOS forma as gorduras boas em ruins. O consumo desse tipo
Os fosfolipídios são formados por duas molécu-
de gordura aumenta a taxa de colesterol ruim (LDL) e di-
las de ácidos graxos, uma molécula de glicerol e um minui as taxas do colesterol bom (HDL). Isso pode cau-
grupo fosfato. Constituem a membrana celular, com- sar, por exemplo: a diabetes (visto que há grande acú-
posta de duas camadas de fosfolipídios e algumas mulo de glicose no organismo, e a insulina produzida

Material exclusivo para professores


proteínas que permitem a passagem de substâncias. não consegue transportá-la); a  esteatose (acúmulo de
Em geral, uma parte das moléculas de fosfolipídios gordura no citoplasma de células que não deveriam ar-
tem afinidade com a água e a outra não, de maneira mazenar gordura – não adipócitos –, como é o caso das
que, ao entrarem em contato com a água, a parte hi- células hepáticas), a qual é precursora de muitas outras

conveniados ao Sistema de Ensino


drofílica fica em contato com ela. Já a parte hidrofó- doenças quando persistente, podendo levar a diversos
bica, que não tem afinidade com a água, isola-se para problemas de saúde de grande gravidade.
evitar contato.

Dom Bosco
DB_PV_2019_BIO1A.indd 225 08/10/18 16:33
226 60 – Material do Professor

CERÍDEOS VITAMINAS LIPÍDICAS


BIOLOGIA 1A

Os cerídeos são um tipo de lipídios não encontrados Assim como os esteroides, as quatro vitaminas lipí-
em membranas biológicas. As ceras são formadas por áci- dicas (A, D, E e K) são formadas por anéis de carbono.
dos graxos de cadeia longa e um álcool, também de cadeia Também chamadas de lipossolúveis (solúveis em óleos
longa. São amplamente distribuídos na natureza e fornecem e gorduras), são altamente hidrofóbicas, embora apre-
proteção impermeável às folhas, flores e frutos dos vegetais sentem pelo menos um grupo polar.
e à pele, ao pelo, às penas e aos exoesqueletos dos animais. As vitaminas são substâncias orgânicas fundamen-
A cera de ouvido é secretada por células que reves- tais para o metabolismo, pois atuam na regulação de
enzimas (coenzimas), ativando-as ou inibindo-as, e par-
tem o canal auditivo. Ela lubrifica esse canal e retém par-
ticipam da síntese de outras substâncias como os an-
tículas que poderiam prejudicar a membrana timpânica.
ticorpos.
Nos mamíferos, as vitaminas lipídicas ingeridas são
RIORITA/ISTOCKPHOTO.COM

absorvidas no intestino por um processo semelhante


à absorção de outros nutrientes lipídicos. Após a di-
gestão de quaisquer proteínas capazes de ligarem-se a
elas, essas vitaminas são levadas para a interface celu-
lar do intestino sob a forma de micelas formadas com
sais biliares.
As quatro vitaminas lipossolúveis diferem bastante
entre si, como apresentado na tabela a seguir, que re-
Os cerídeos também são usados pelas abelhas para a produção dos favos laciona suas funções, suas fontes e os distúrbios que
de mel. ocorrem pela falta dessas substâncias.

Distúrbio por
Vitamina Funções Fonte
carência

Cegueira noturna;
Componente de pigmentos Ovos, leite e derivados,
espessamento da córnea;
A (retinol) visuais. Mantém a integridade vegetais amarelos e
ressecamento da pele,
dos epitélios. vermelhos.
mucosa e olhos.

Forma ativa é produzida sob


ação de raios ultravioleta.
Raquitismo (descalcificação e
D (calciferol) Atua na mineralização dos Ovos, leite e derivados.
alterações ósseas).
Lipossolúveis

ossos, além de facilitar a


absorção de cálcio.

Antioxidante. Previne lesões Sementes oleaginosas, folhas


E (tocoferol) Esterilidade e aborto.
na membrana celular. verdes e olhos vegetais.

Atua na produção de fatores Folhas verdes, cereais e


K (naftoquinona) Sangramentos.
coagulantes. fígado.

Material exclusivo para professores Vitaminas hidrossolúveis


Existe outra classe de vitaminas que apresen-
uma outra classe de macromoléculas que estudare-
mos adiante.

conveniados ao Sistema de Ensino


tam diferente composição, as chamadas hidrosso- Assim como a tabela anterior, está relacionado a se-
lúveis (solúveis na água). São todas do complexo B, C guir essas vitaminas com suas funções, suas fontes e
e biotina. Essas vitaminas são, na verdade, coenzimas, os distúrbios que ocorrem pela falta dessas substâncias.

Dom Bosco
DB_PV_2019_BIO1A.indd 226 08/10/18 16:33
61 – Material do Professor 227

Distúrbio por
Vitamina Funções Fonte

BIOLOGIA 1A
carência
Participa das reações de
oxidação dos carboidratos; Beribéri (insuficiência
Carnes, cereais integrais,
B1 (tiamina) auxilia no funcionamento cardíaca, neurite e destruição
leguminosas e cogumelos.
dos músculos e do sistema do sistema nervoso).
nervoso.

Precursora da coenzima
dinucleótido de flavina e Lesões na pele;
adenina (FAD) atuante na Leite, carnes, grãos integrais, lacrimejamento; queimação e
B2 (riboflavina)
respiração celular e no vegetais. coceira nos olhos; síndrome
metabolismo de proteínas, urogenital.
lipídios e glicídios.

Precursora de Nicotinamida
Cereais, leite, grãos Pelagra (diarreia crônica,
Adenina Dinucleotídeo
B3 (niacina) enriquecidos, carne magra e dermatite e alterações
(NADH) atuante no
fígado. neurológicas).
metabolismo energético.

Componente da coenzima A, Fígado, rim, gema de ovo,


Fadiga; distúrbios do sono e
B5 (ácido pantatênico) atuante na respiração celular carnes, brócolis, trigo e
falta de coordenação motora.
e no metabolismo de lipídios. batata.
Hidrossolúveis

Alterações neurológicas,
Atua no metabolismo dos Carnes, cereais integrais e
B6 (piridoxina) dermatite e fraqueza
aminoácidos e lipídios. fígado.
muscular.

Atua no metabolismo de Carnes, fígado, leguminosas,


Anemia e distúrbios
B9 (ácido fólico) aminoácidos e ácidos vegetais de folhas escuras,
gastrointestinais.
nucleicos. banana e melão.

Atua no metabolismo de Fígado, rim, ostra, ovos,


Anemia perniciosa e
B12 (cianocobalamina) ácidos nucleicos e na divisão peixes, leite, carnes de porco
alterações neurológicas.
celular. e frango.

Coenzima no metabolismo
Leveduras, arroz integral,
de aminoácidos e Fadiga; depressão; náusea;
Biotina frutas, nozes, ovos, carne e
lipídios. Produz queratina, dermatite; dores musculares.
leite.
especialmente.

Material exclusivo para professores


C (ácido ascórbico)
Participa da síntese de
colágeno, atua como
antioxidante, facilita a
Frutas cítricas, mamão,
goiaba, caju, alface, tomate,
Escorbuto (lesões na
pele e nas articulações,

conveniados ao Sistema de Ensino


cenoura, pimentão, espinafre sangramento do nariz e da
absorção de ferro e fortalece
e folhas verdes. gengiva).
o sistema imunológico.

Dom Bosco
DB_PV_2019_BIO1A.indd 227 08/10/18 16:33
228 62 – Material do Professor

ROTEIRO DE AULA
BIOLOGIA 1A

Substâncias orgânicas

Têm em sua C, H, O.
composição:

Pentoses

Monossacarídeos

Hexoses

Sacarose

Carboidratos Dissacarídeos Maltose

Lactose

Polissacarídeos

Função

Energética Estrutural

Material exclusivo para professores


Glicogênio Amido Quitina Celulose

conveniados ao Sistema de Ensino


Dom Bosco
DB_PV_2019_BIO1A.indd 228 08/10/18 16:33
63 – Material do Professor 229

ROTEIRO DE AULA

BIOLOGIA 1A
3 ácidos graxos

Glicerídeos +

Glicerol

Esfingolipídios

2 ácidos graxos

Fosfolipídios
Glicerol

Fosfato

Lipídios Esteroides Anéis de carbono

ácidos graxos

Cerídeos +

álcool

Solúveis em óleos Lipossolúveis


e gorduras

Material exclusivo para professores


Vitaminas

Solúveis em água Hidrossolúveis

conveniados ao Sistema de Ensino


Dom Bosco
DB_PV_2019_BIO1A.indd 229 08/10/18 16:33
230 64 – Material do Professor

EXERCÍCIOS DE APLICAÇÃO
BIOLOGIA 1A

1. Sistema Dom Bosco – Os carboidratos, também co- 5. IFMG – A coagulação sanguínea, em condições nor-
nhecidos como açúcares ou hidratos de carbono, po- mais, acontece após o rompimento de um vaso sanguí-
dem ser classificados em: neo. O processo forma um coágulo no local da ruptura,
a) monossacarídeos, oligossacarídeos, polissacarídeos. interrompendo o sangramento e evitando, muitas ve-
zes, hemorragias que podem causar a morte. Uma pes-
b) monossacarídeos, glicolipídios, fosfolipídios.
soa com problemas na coagulação do sangue apresenta
c) monossacarídeos, cerídeos, polissacarídeos. carência em vitamina:
d) monossacarídeos, polissacarídeos, esteroides. a) B1.
Os carboidratos são classificados em monossacarídeos, oligos- b) K.
sacarídeos e polissacarídeos. Todas as outras alternativas têm
classificações de lipídios. c) A.
d) E.
2. PUC-MG (adaptada) – As vitaminas funcionam como
coenzimas. A deficiência de vitaminas provoca enfermi- A vitamina K atua no processo de coagulação. A alternativa A
dades chamadas de doenças de carências. Os sintomas está incorreta, porque a vitamina B1 atua no metabolismo de
carências a seguir estão relacionados, respectivamente, carboidratos, lipídios e na respiração celular. A alternativa C está
incorreta, porque a vitamina A atua na síntese de pigmentos da
com a deficiência das seguintes vitaminas: retina, além de ser importante na manutenção da pele e de epité-
I. Córnea ressecada lios. A alternativa D está incorreta, porque a vitamina E age como
antioxidante, prevenindo lesões na membrana celular.
II. Raquitismo na infância
III. Deficiência na coagulação sanguínea 6. Sistema Dom Bosco – Os carboidratos são moléculas
IV. Anemia perniciosa orgânicas que podem ser classificados em três grupos
diferentes. Cite as funções dos carboidratos, os grupos
a) K, E, B2 e B12
e dê exemplos.
b) B1, D, C e E
Os carboidratos têm função energética e estrutural. Eles po-
c) A, D, K e B12
d) A, E, K e C
dem ser classificados em monossacarídeos, como as hexoses
A falta da vitamina A (retinol) causa xeroftalmia, caracterizada
pelo ressecamento da córnea. A carência da vitamina D (calcife- (glicose, frutose e galactose) e pentoses (desoxirribose e ribo-
rol) leva ao raquitismo. A vitamina K (filoquinona) age na coagu-
lação do sangue, por isso sua ausência ocasiona deficiência na
coagulação. Na anemia perniciosa, há redução do número dos se, presentes no DNA e RNA, respectivamente). Podem ser
glóbulos vermelhos. Ela é decorrente de uma deficiência da vita-
mina B12 (cobalamina).
classificados em oligossacarídeos, que são uniões entre 2 e 10
3. Sistema Dom Bosco – Os lipídios compõem um grupo
heterogêneo de compostos orgânicos cuja única carac-
moléculas de monossacarídeos (maltose, lactose e sacarose).
terística comum é sua pequena solubilidade em água
(hidrofóbicos). Cite os principais grupos e dê exemplos.
Além disso, eles ainda podem ser classificados em polissacarí-
Os lipídios são divididos em glicerídeos, fosfolipídios, esteroi-
deos, quando têm mais de 10 moléculas de monossacarídeos
des e cerídeos. Exemplos deles, respectivamente, são: os trigli-
(celulose e quitina).
cerídeos, a membrana celular, os hormônios sexuais e as ceras.

4. Sistema Dom Bosco – Entre as alternativas a seguir,


marque aquela que não se refere à importância biológi-
ca dos lipídios.
a) Funcionam como reserva energética.

Material exclusivo para professores


b) Atuam na impermeabilização de superfícies que so-
frem com a desidratação.
c) Fazem parte da composição da membrana plasmática.
d) Fazem parte da composição de hormônios.

conveniados ao Sistema de Ensino


e) Atuam como catalisadores biológicos.
As proteínas atuam como moléculas catalisadoras.

Dom Bosco
DB_PV_2019_BIO1A.indd 230 08/10/18 16:33
65 – Material do Professor 231

EXERCÍCIOS PROPOSTOS

BIOLOGIA 1A
7. IFMT – A importância da rotulagem nutricional é para II. Os triacilgliceróis servem como reserva energética
que as pessoas possam discernir entre quais alimen- para o organismo, e seus ácidos graxos, quando oxi-
tos são os mais saudáveis e escolher seus produtos dados, liberam pequena quantidade de energia em
de acordo com sua vontade. Todo alimento produzido, comparação aos carboidratos.
comercializado e embalado na ausência do cliente e III. Um dos esteroides mais importantes é o colesterol,
pronto para ser oferecido ao consumidor deve conter presente nas membranas de células animais.
obrigatoriamente rotulagem nutricional. No caso da Está(ão) correta(s):
substância em destaque no rótulo, pode se dizer que:
a) Somente a afirmação I.
INFORMAÇÃO NUTRICIONAL b) Somente a afirmação II.
Porção 10 g (2 colheres de c) Somente as afirmações I e II.
sobremesa) d) Somente as afirmações I e III.
e) Somente as afirmações II e III.
Quantidade por porção %VD*
Valor energético 13 kcal = 10. Sistema Dom Bosco
1
55 kj No período das grandes navegações, entre os séculos XVI
e XVIII, os marinheiros passavam meses no mar e, com
Carboidratos 2g 1
o tempo, eles começavam a ficar com as gengivas incha-
Gorduras totais 0g das, dores nas articulações, muitas manchas roxas na pele
Gorduras saturadas 0g 0 e logo depois morriam. Estima-se que cerca de 1 milhão
Gorduras trans 0g de homens tenham sucumbido a essa doença, de acordo
com dados da Universidade de Londres, para se ter uma
Fibra alimentar 5,7 g 23 ideia, cerca de dois terços da tripulação de Vasco da Gama
Sódio 15 mg 1 teriam sido vítimas da doença. Entre os portugueses, ela
ficou conhecida como “mal de Angola” porque era perto
* Valores diários com base em uma dieta de 2.000 kcal
do país africano que os sintomas se manifestavam mais
ou 8.400 kj. Seus valores energéticos diários podem ser frequentemente.
maiores ou menores dependendo de suas necessidades O Tempo. Disponível em: <http://www.otempo.com.br/interessa/
energéticas. falta-de-vitamina-c-pode-fazer-ressurgir-doen%C3%A7a-
do-s%C3%A9culo-xvi-1.1473473>. Adaptado.

a) Trata-se de uma gordura benéfica ao organismo que Com base nessas informações e em seus conhecimen-
deve ser consumida à vontade. tos, cite que doença é essa e qual é a sua causa.
b) A gordura em questão é formada de ácidos graxos
saturados, formados por alguma ligação dupla entre
os carbonos.
c) A referida gordura, indicada nos rótulos de alimentos
industrializados, contém ácidos graxos insaturados,
portanto, prejudiciais à saúde, quando consumimo-
sem excesso.
d) A Agência Nacional de Vigilância Sanitária (ANVISA)
não obriga os fabricantes a indicar a quantidade de
gordura trans nos rótulos, pois não se sabe nada a
respeito de sua ação no organismo. 11. Acafe (adaptada)
e) A gordura trans é de origem animal, encontrada so- A Organização Mundial da Saúde (OMS) pediu aos go-
mente no leite. vernos que aumentem o imposto sobre as bebidas açuca-
radas para combater o problema da obesidade no mundo,
8. IFNMG – A hemorragia decorrente da ingestão de trevo onde um adulto em cada três está com excesso de peso.
doce por bovinos e ovinos se deve ao dicumarol, subs- Em um novo relatório, a agência nacional da ONU afirma
tância presente nesse vegetal e que exerce ação anta- que existem provas contundentes de que novos impostos
gonista à vitamina: cobrados sobre as bebidas açucaradas, como refrigerantes,
a) B12. “reduziria, proporcionalmente, seu consumo”. Um au-
mento de 20% dos preços desse tipo de bebida teria uma
b) B1.
redução do consumo da ordem de 20%. Em escala mun-
c) E. dial, o número de casos de obesidade duplicou desde 1980.
d) K. Em 2014, mais de 1,9 bilhão de adultos - pessoas de 18
anos ou mais - estavam com excesso de peso, e deles mais

Material exclusivo para professores


9. IFG – Os lipídios mais comuns nas células são os tri- de 600 milhões eram obesos.
glicerídeos (triacilgliceróis), fosfolipídios, glicolipídios e Fonte: g1.globo, 11/10/2016. Disponível em: <http://g1.globo.com>.
esteroides. Em relação aos lipídios, analise as seguintes
afirmações: Nesse sentido, é correto afirmar, exceto:

conveniados ao Sistema de Ensino


I. Trata-se de um grupo de moléculas caracterizadas a) Como problemas de saúde que a obesidade pode
por sua insolubilidade em água e solubilidade em causar pode-se citar: pressão alta, diabetes, câncer
solventes orgânicos; e infertilidade.

Dom Bosco
DB_PV_2019_BIO1A.indd 231 08/10/18 16:33
232 66 – Material do Professor

b) Os carboidratos são moléculas que desempenham Sobre os carboidratos, é incorreto afirmar:


BIOLOGIA 1A

uma ampla variedade de funções, dentre elas: fon- a) Glicose, frutose e galactose são exemplos de monos-
te de energia, reserva energética e estrutural. São sacarídeos.
formados principalmente por carbono (C), hidrogê-
nio (H), oxigênio (O), apresentando a fórmula geral b) A lactose é formada pela união entre uma molécula
(CH2O)n. de glicose e uma molécula de galactose.
c) Os lipídios são moléculas orgânicas formadas a partir c) O amido é um polissacarídeo energético de reserva
da associação entre ácidos graxos e álcool. São in- animal, enquanto o glicogênio é um oligossacarídeo
solúveis em água, mas se dissolvem em solventes energético de reserva vegetal.
orgânicos, como a benzina e o éter. São exemplos de d) Os carboidratos têm como principal função ser fonte
lipídios: os óleos, as gorduras, as ceras e os hormô- de energia.
nios esteroides.
d) Os oligossacarídeos são moléculas de carboidratos 14. UFRJ – Os lipídios são os nutrientes de maior teor caló-
formadas a partir da união entre 2 a 10 monossacarí- rico, seguidos por carboidratos e proteínas. A elevação
deos. Exemplos de oligossacarídeos são a sacarose, dos níveis sanguíneos de insulina é um dos principais
a maltose e a galactose. sinais responsáveis pela mobilização dos excedentes
nutricionais sob forma de lipídios pelo tecido adiposo.
12. IFSC (adaptada) – Todos os seres vivos são formados Com o intuito de evitar esse efeito da insulina, muitas
por componentes químicos básicos: carbono, hidrogê- pessoas recorrem a uma dieta baseada na ingestão ex-
nio, oxigênio, nitrogênio, enxofre e fósforo. Estes ele- clusiva de lipídios e proteínas. Apesar de seus efeitos
mentos podem formar os compostos orgânicos que sobre a saúde serem discutíveis, esse tipo de dieta
constituem nossos corpos e possuem diversas relações pode conduzir efetivamente a uma perda de massa cor-
com a nossa alimentação e metabolismo. Sobre os prin- poral (peso).
cipais componentes químicos dos seres vivos, assinale
a soma da(s) proposição(ões) correta(s). Explique por que uma dieta baseada na exclusão total
01. Os polissacarídeos podem ter função de reserva dos carboidratos, apesar do seu alto valor calórico, não
energética. A espécie humana é capaz de arma- leva ao acúmulo de lipídios no tecido adiposo.
zenar um polissacarídeo, chamado glicogênio, no
fígado e nos músculos. Quando necessário, nos-
so organismo converte glicogênio em glicose para
fornecer energia ao corpo.
02. Atualmente, as necessidades vitamínicas de um
indivíduo já podem ser supridas unicamente atra-
vés do consumo de comprimidos concentrados. A
vantagem é garantir que não faltem vitaminas para
manutenção do organismo. E praticamente não
existem desvantagens, pois o excesso de qualquer
vitamina será eliminado por meio da urina.
04. Para que uma pessoa engorde é necessário que
ela faça ingestão de gordura (lipídios), pois atra- 15. Acafe (adaptada)
vés da ingestão de carboidratos e proteínas nosso
A suplementação com vitamina D3 na dieta reduz a pres-
metabolismo não pode sintetizar lipídios e a pes-
soa não engorda. são arterial sistólica de ratos hipertensos e atua na ex-
pressão de genes relacionados com o controle da pressão
08. O fósforo é um sal mineral que atua na manuten-
arterial, sem induzir danos ao seu DNA ou estimular a pro-
ção de ossos e dentes, além de ser constituinte
dos ácidos nucleicos e do ATP, principal reserva de dução de espécies reativas de oxigênio (EROs) prejudiciais
energia. ao organismo. O resultado é demonstrado em pesquisa
realizada com animais na Faculdade de Ciências Farma-
13. Sistema Dom Bosco cêuticas de Ribeirão Preto (FCFRP) da USP pela bióloga
A capacidade de aproveitar raízes e tubérculos ricos em Carla da Silva Machado, pós-graduanda em genética pela
amido na dieta dos primeiros hominídeos é considerada Faculdade de Medicina de Ribeirão Preto (FMRP) da USP.
um passo potencialmente crucial na diferenciação entre os Novos testes serão necessários para comprovar a eficiência
primeiros Australopitecinos de outros hominídeos”, diz o da suplementação em seres humanos.
estudo, publicado na mais recente edição do The Quarterly Fonte: Secretaria de Estado da Educação- Estado do Paraná,
10/02/2016. Disponível em: http://www.biologia.seed.pr.gov.br
Review of Technology. Em uma linguagem mais simples,
isso quer dizer que uma dieta com alimentos ricos em Acerca das informações contidas no texto e dos conhe-
carboidratos deu a nossos antepassados uma importante cimentos relacionados ao tema é correto afirmar, ex-
vantagem evolutiva (que algumas das dietas modernas ceto:
ou em moda ignoram).Os humanos têm três vezes mais a) As vitaminas são classificadas em dois grupos de
cópias do gene que cria as amilases salivares - enzimas acordo com sua solubilidade: vitaminas hidrossolú-

Material exclusivo para professores


que ajudam a transformar os carboidratos em açúcares - veis, como as vitaminas do complexo B e vitamina C,
do que o resto dos primatas. E essa adaptação, dizem os e as vitaminas lipossolúveis, como as vitaminas D, E,
pesquisadores, começou a ser produzida há aproximada- K e A.
mente um milhão de anos. b) A vitamina D, também conhecida como calciferol,

conveniados ao Sistema de Ensino


BBC Brasil. Disponível em: <http://www.bbc.com/portuguese/ é obtida através da ingestão de alguns alimentos
noticias/2015/08/150824_carboidratos_evolucao_dieta_lab>. e através da biossíntese, estimulada pelas radia-
Acesso em: 3 mar. 2018.. ções solares. Como funções dessa vitamina no corpo

Dom Bosco
DB_PV_2019_BIO1A.indd 232 08/10/18 16:33
67 – Material do Professor 233

humano, podemos citar a manutenção das concen- a) Trata-se dos carboidratos, moléculas altamente

BIOLOGIA 1A
trações de fósforo e cálcio no sangue, a regulação energéticas.
do metabolismo dos ossos, além da fixação de cálcio b) A celulose é um tipo de carboidrato, rico em energia.
nos ossos e dentes.
c) A principal molécula energética dos animais é o
c) A vitamina C atua no metabolismo energético por fa- glicogênio.
zer parte da coenzima A. d) O amido é uma molécula de carboidrato que serve
d) A falta de vitamina D pode causar raquitismo, uma como fonte de energia para os vegetais.
doença que promove descalcificação e alterações
ósseas. 17. Sistema Dom Bosco – A diabetes mellitus é um distúr-
bio metabólico devido à falta da quantidade adequada
16. Sistema Dom Bosco de insulina, produzido pelo pâncreas. Cite qual substân-
Dan Buettner estudou os hábitos alimentares na ilha de cia é estocada pela insulina e o que esse distúrbio me-
Okinawa, no Japão, na cidade de Loma Linda, na Califór- tabólico pode gerar.
nia (EUA), na ilha de Ikaria, na Grécia, na Sardenha (Itália)
e na península de Nicoya, na Costa Rica para tentar desco-
brir do que as pessoas com expectativas de vida mais altas
do mundo se alimentam. “O segredo é dedicar o tempo a
preparar esses alimentos básicos que os humanos conso-
mem há milhares de anos, torná-los saborosos – conside-
rando que nosso paladar foi destruído pelo açúcar, pelo sal
e pela gordura (dos alimentos processados).
Bem-estar. Disponível em: <https://g1.globo.com/bemestar/
noticia/o-que-as-pessoas-comem-nas-regioes-com-as-
expectativas-de-vida-mais-altas-do-mundo.ghtml>.
Acesso em: 3 mar. 2018.

Sobre o açúcar referido no texto, assinale a alternativa


incorreta.

ESTUDO PARA O ENEM


18. Sistema Dom Bosco C4-H14 20. Sistema Dom Bosco C5-H14
Em seres humanos, a fonte primária de obtenção de Carboidratos e lipídios são os principais fornecedores
energia e a principal reserva energética são, respecti- de energia para as plantas e para os animais. A glico-
vamente: se, um carboidrato, é o principal combustível celular,
a) lipídios e proteínas. enquanto amido e glicogênio (carboidratos) e gorduras
b) carboidratos e proteínas. (lipídios) representam reservas energéticas.
c) proteínas e lipídios. A capacidade dos animais de estocarem energia na for-
d) carboidratos e lipídios. ma de carboidratos é
a) grande e, por isso, eles apresentam abundantes es-
19. Sistema Dom Bosco C5-H14
toques de glicogênio no fígado e nos músculos; plan-
A intolerância à lactose é a incapacidade de o corpo tas também estocam muito carboidratos na forma de
digerir lactose – um carboidrato encontrado no leite e
amido.
derivados. Essa incapacidade ocorre quando o intesti-
no delgado deixa de produzir a quantidade necessária b) reduzida e, por isso, apresentam grandes estoques
da enzima lactase, cuja função é quebrar as moléculas de gordura; já as plantas armazenam grande quanti-
de lactose e convertê-las em moléculas menores. Com dade de amido.
base em seus conhecimentos, é correto afirmar que: c) maior que a das plantas, que têm suas reservas
a) essa incapacidade de digestão da lactose se deve constituídas, principalmente, de óleos armazenados
unicamente a distúrbios genéticos. em todo o organismo.
b) a lactose é um polissacarídeo altamente energético. d) menor que a das plantas – enquanto os animais têm
c) a lactose é um dissacarídeo formado por glicose e pequenos estoques de amido, as plantas apresen-
galactose. tam grandes reservas de glicogênio.
d) a molécula de lactose é formada por uma molécula e) igual à das plantas, sendo que os animais apresen-
de maltose e uma de glicose. tam maiores reservas de gordura.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A.indd 233 08/10/18 16:33
7
234 68 – Material do Professor

SUBSTÂNCIAS ORGÂNICAS:
BIOLOGIA 1A

PROTEÍNAS

Atualmente, há 4 880 rinocerontes-negros (Diceros bicornis), divididos em três di-


ferentes subespécies (havia quatro, porém uma foi extinta por volta de 2006). A maio-
• Função e estrutura das ria está distribuída em parques e reservas da Namíbia, Botsuana, Zâmbia, Zimbábue,
proteínas África do Sul e, mais recentemente, em Ruanda, onde 20 animais foram inseridos no
• Desnaturação proteica início do ano de 2017, a fim de reintroduzirem a espécie, extinta na região há dez anos.
De acordo com a “lista vermelha” da União Internacional para a Conservação da
HABILIDADES Natureza (IUCN), essa espécie encontra-se criticamente ameaçada de extinção, em
• Compreender que as virtude principalmente da caça ilegal. Essa classificação é um dos patamares mun-
proteínas são macromo- diais de controle utilizados pela IUCN para preservação das espécies, sendo que,
léculas constituídas de além dela, existem outras oito, compondo as categorias em que as espécies podem
monômeros. ser classificadas quanto ao perigo de extinção.
• Relacionar propriedades

ANGELIKA/ISTOCKPHOTO.COM
químicas das proteínas
às finalidades a que se
destinam.
• Identificar a ampla gama
de estruturas e funções das
proteínas.
• Relacionar informações
apresentadas em várias
formas de linguagem com
os conteúdos de Biologia
e Química.

Rinoceronte-negro fêmea com seu filhote.

O motivo principal da caça ao rinoceronte-negro vem da medicina chinesa, que


usa o pó do chifre raspado ou moído dissolvido em água fervente para tratar febre,
reumatismo, gota e até câncer, prática disseminada também no Vietnã, na Coreia do
Sul e em algumas regiões da Europa. Existe, ainda, a caça por comunidades locais,
que acreditam que o chifre tem propriedades afrodisíacas.
No entanto, não há, até o momento, estudos que comprovem a existência de
qualquer composto presente nos chifres com propriedade curativa, já que estes são,
basicamente, constituídos por queratina, uma proteína que forma também os cascos
dos bovinos e as unhas das nossas mãos e pés, além dos pelos dos animais.
As proteínas contribuem com mais de 50% da massa seca da maioria das células
e são imprescindíveis em praticamente todos os processos metabólicos. Assim como
essa substância, algumas proteínas têm papel estrutural, enquanto outras aceleram
reações químicas ou estão envolvidas no armazenamento, transporte, comunicação,

Material exclusivo para professores


movimento e defesa do organismo.

Função e estrutura das proteínas

conveniados ao Sistema de Ensino


A palavra proteína vem do grego proteios, que significa “em primeiro lugar”. De
fato, a importância dessas grandes moléculas biológicas é tão grande que quase
todas as funções dinâmicas dos seres vivos dependem delas.

Dom Bosco
DB_PV_2019_BIO1A.indd 234 08/10/18 16:33
69 – Material do Professor 235

As proteínas podem desempenhar função estru- Mesmo com a ampla diversidade de funções, todas as
tural (como a queratina e o colágeno) ou energética proteínas são macromoléculas formadas por carbono (C),

BIOLOGIA 1A
(como a albumina, presente no plasma sanguíneo), hidrogênio (H), oxigênio (O) e nitrogênio (N), podendo apre-
além de outras importantes funções, exemplificadas na sentar também enxofre (S). São polímeros formados pela
tabela a seguir. Na maioria dos casos, a função da pro- união entre moléculas menores denominadas aminoáci-
dos, as unidades básicas das proteínas. Os polímeros de
teína depende da habilidade de reconhecer e ligar-se a
aminoácidos são denominados polipeptídeos. Um ou mais
outra molécula.
polipeptídeo, cada um enovelado e estruturado em uma es-
trutura tridimensional específica, forma uma proteína.
Classes Função Exemplos
AMINOÁCIDOS
Aumentam Os aminoácidos, também chamados de monopeptí-
a velocidade deos, são monômeros formados por um átomo de car-
Proteínas das reações Tripsina, amilase, bono (C) central, ligado a um grupo carboxila (COOH)
enzimáticas químicas, ou protease – que atribui a característica ácida –, um grupo amino
seja, catalisam (NH2), um átomo de hidrogênio e um grupo variável,

amino acids
as reações simbolizado pelo radical R.
Anticorpos (também
Proteção do

LUCIANO COSMO/SHUTTERSTOCK
conhecidos como
Proteínas de organismo
imunoglobulinas,
defesa contra agentes
abreviadas Ig), como IgA,
invasores
IgD, IgE, IgG e IgM Carbono central

Coordenação
Proteínas
das atividades Insulina e glucagon
hormonais
do organismo
Hemoglobina (transporte
de oxigênio) e outras
Proteínas de Transporte de
proteínas que realizam o
transporte substâncias
transporte de moléculas
na membrana celular
Queratina (componente Grupo amino
de unhas, cascos, penas,
Grupo R
Proteínas chifres, pelos e cabelos),
Sustentação Grupo carboxila
estruturais colágeno e elastina
Fórmula geral de um aminoácido. Elementos representados fora da
(resistência na pele e nas escala de tamanho. Cores fantasia.
cartilagens)
Ovoalbumina (presente O que diferencia uma proteína da outra é, basica-
na clara do ovo e fonte mente, o número de aminoácidos que constitui cada
de aminoácidos para uma delas e o grupo R presente em cada monopeptí-
o embrião) e caseína deo. Por exemplo, o que difere o aminoácido aspartato
(presente no leite e fonte do glutamato é a composição do radical de cada um
Proteínas de Armazenamento
de aminoácidos para deles, que são, respectivamente, um grupo CH2COO– e
armazenamento de aminoácidos
filhotes de mamíferos). um grupo (CH2)2COO–.
As sementes das
plantas gimnospermas e COOH– COOH–
angiospermas têm esses
tipos de proteína + +

Resposta a Receptores em células


H3N C H H3N C H
Proteínas
estímulos nervosas que detectam
receptoras CH2 CH2
químicos sinais químicos

Material exclusivo para professores


Actina e miosina COO– CH2
Proteínas motoras (contração muscular),
Movimento
e contráteis proteínas formadoras de COO–
Aspartato
cílios e flagelos

conveniados ao Sistema de Ensino


Glutamato
O que difere o aminoácido aspartato do glutamato é o grupo radical R,
CAMPBELL, Neil A.; REECE, Jane B. Biologia.
destacado em verde.
8. ed. Porto Alegre: Artmed, 2010.

Dom Bosco
DB_PV_2019_BIO1A.indd 235 08/10/18 16:33
236 70 – Material do Professor

Existem na natureza 20 aminoácidos, usados pela


BIOLOGIA 1A

célula para construir milhares de proteínas. Eles são Aminoácido 1 Aminoácido 2

classificados em naturais, também denominados não


essenciais (aqueles que o organismo consegue sinte- H
N C
tizar sozinho) e essenciais (os quais o organismo não é
capaz de sintetizar, necessitando adquiri-los via alimen- O
tação). Alguns aminoácidos naturais são considerados R R

essenciais em quadros de enfermidades ou em deter- Grupo carboxila Grupo amino


minadas fases da vida (geralmente na juventude), em
que não são produzidos naturalmente.
É importante lembrar que os aminoácidos essen- Ligação peptídica
ciais variam entre as espécies, pois sempre há aminoá-
cidos que alguns organismos conseguem sintetizar e
outros não. O ser humano, por exemplo, não é capaz R
de sintetizar nove aminoácidos, por isso eles devem
ser adquiridos por meio de uma alimentação rica em R Dipeptídeo Água
proteína, seja de origem vegetal ou animal. Alimentos Ligação peptídica entre dois aminoácidos. Elementos representados
como leite, ovos, carne, gelatina e soja são boas fontes fora da escala de tamanho. Cores fantasia.
desses aminoácidos.
Acompanhe na tabela a comparação das duas clas- O número de ligações peptídicas de uma proteína
ses de aminoácidos para a espécie humana. depende da quantidade de aminoácidos que ela tem.
O composto formado com base em dois aminoácidos é
Não Essenciais chamado dipeptídeo. Cadeias entre três e dez aminoá-
Essenciais
essenciais condicionais* cidos são denominadas oligopeptídeos; as maiores
Alanina (Ala) Arginina (Arg) Isoleucina (Ile) são designadas polipeptídeos, que, por convenção,
Asparagina (Asn) Cisteína (Cis) Leucina (Leu) são chamadas de proteínas. Por exemplo, se uma pro-
teína tem 350 aminoácidos, ela contém 349 ligações
Aspartato (Asp) Glutamina (Gln) Lisina (Lys)
peptídicas entre elas, cuja formação liberou 349 molé-
Glutamato (Glu) Glicina (Gli) Metionina (Met) culas de água. Assim, temos que:
Serina (Ser) Prolina (Pro) Fenilalanina (Phe)
Tirosina (Tyr) Triptofano (Trp) N°- de ligações peptídicas =
Treonina (Thr) = N°- de aminoácidos – 1

Histidina (His)
Duas proteínas com o mesmo número e os mes-
Valina (Val)
mos tipos de aminoácidos ainda podem ser diferentes
* Necessários em certo grau para indivíduos entre si, em virtude da sequência em que eles se en-
jovens em crescimento e/ou durante certas doenças.
contram, mostrando que nesses casos a ordem dos
LEHNINGER, Albert; NELSON, David L.; COX, Michael.
aminoácidos gera uma proteína diferente, com fun-
Princípios de bioquímica de Lehninger. 6. ed. Porto Alegre: Artmed, 2014.
ções distintas.
Polímeros de aminoácidos: a ligação peptídica
Quando dois aminoácidos se posicionam de manei- ESTRUTURA ESPACIAL DAS PROTEÍNAS
ra que o grupo carboxila de um fique adjacente ao grupo É importante destacar que o termo polipeptídeo
amino do outro, ocorre uma reação de desidratação. não é sinônimo de proteína, já que uma proteína fun-
No grupo carboxila de um dos aminoácidos acontece a cional não é apenas uma cadeia polipeptídica, mas sim
quebra da ligação entre o carbono e a hidroxila. No ou- um ou mais polipeptídeos ordenadamente torcidos,
tro aminoácido, a ligação entre o nitrogênio e o hidrogê- enovelados e arranjandos em uma estrutura especial.
nio do grupo amino é quebrada. Nessa reação, ocorre É essa intricada estrutura, cujo nível mais básico é a se-
a condensação entre o carbono do grupo carboxila e o quência de aminoácidos, que resulta nas funções das
nitrogênio do grupo amino, enquanto uma molécula de proteínas. Estas recebem diferentes classificações de
água é retirada. acordo com sua estrutura.

Material exclusivo para professores


Essa interação entre dois ou mais monômeros de A estrutura primária corresponde à sequência
aminoácidos é denominada ligação peptídica, que linear de aminoácidos, determinada pela informa-
terá em uma terminação da cadeia polipeptídica um ção genética hereditária. Um exemplo de estrutura
grupo amino livre e, no lado oposto, um grupo carboxila primária é a endorfina – hormônio neurotransmissor

conveniados ao Sistema de Ensino


livre. Repetida inúmeras vezes, a ligação peptídica gera produzido pela hipófise, formado por 17 aminoácidos
um polipeptídeo, um polímero formado por inúmeros e que atua como um analgésico natural. Esse hormô-
aminoácidos, que constituirá uma proteína. nio é produzido principalmente quando o corpo está

Dom Bosco
DB_PV_2019_BIO1A.indd 236 08/10/18 16:33
71 – Material do Professor 237

praticando atividade física, em que a quantidade de en- A estrutura terciária (frequentemente referida ape-
dorfina liberada é alta e produz sensação de bem-estar, nas como “estrutura”) corresponde a dobramentos en-

BIOLOGIA 1A
conforto e melhora do humor. tre o filamento de aminoácidos, o que possibilita à pro-
teína adquirir uma conformação espacial tridimensional.
Esse tipo de conformação geralmente ocorre em virtude
CHROMATOS/SHUTTERSTOCK

de outros tipos de ligações entre suas partes, como as


ligações dissulfeto. A mioglobina, fundamental no trans-
porte de oxigênio nos músculos, é um tipo de proteína
com essa estrutura.

MOLEKUUL_BE/SHUTTERSTOCK
A endorfina é um hormônio neurotransmissor constituído de estrutura
primária. Cada aminoácido específico, entre os 20 possíveis, é indicado
aqui pelo código de três letras, ocupando cada uma das 17 posições ao
longo da cadeia. Elementos representados fora da escala de tamanho.
Cores fantasia. Representação da molécula de mioglobina. Elementos representados
fora da escala de tamanho. Cores fantasia.

A estrutura secundária corresponde aos segmen-


tos das cadeias polipeptídicas que se enrolam ao re- Proteínas com estrutura quaternária são formadas
dor de um eixo, formando uma escada helicoidal (alfa- por associações de duas ou mais cadeias polipeptídicas
-hélice), estável e mantida por ligações de hidrogênio. agregadas em uma macromolécula funcional. Essa é a
Em geral, quando uma célula sintetiza um polipetídeo, estrutura final da proteína, que resulta da agregação das
a cadeia se dobra espontaneamente, assumindo a es- subunidades polipeptídicas. A molécula hemoglobina é
trutura funcional da proteína. Essas estruturas podem uma proteína globular com essa conformação, formada por
ser filamentares (proteínas fibrosas), como o coláge- quatro subunidades polipeptídicas, responsável pelo trans-
no, ou esféricas (proteínas globulares), como as imu- porte de oxigênio dos tecidos. Cada subunidade tem
noglobulinas. Apesar de proteínas fibrosas terem só um componente não polipeptídico, chamado de heme,
um tipo de estrutura secundária, as proteínas globula- com um átomo de ferro que se liga ao oxigênio.
res podem ter diversos tipos de estrutura secundária

IBREAKSTOCK/DREAMSTIME.COM
na mesma molécula.
MOLEKUUL/ISTOCKPHOTO.COM

Material exclusivo para professores


conveniados ao Sistema de Ensino
O colágeno é uma proteína com estrutura secundária, formada por três
cadeias polipeptídicas de mesmo tamanho, que se enrolam uma em
torno da outra, formando um cabo rígido com conformação helicoidal. Representação da hemoglobina. Elementos representados fora da
Elementos representados fora da escala de tamanho. Cores fantasia. escala de tamanho. Cores fantasia.

Dom Bosco
DB_PV_2019_BIO1A.indd 237 08/10/18 16:33
238 72 – Material do Professor

LEITURA COMPLEMENTAR Desnaturação de proteínas


BIOLOGIA 1A

Anemia falciforme e alterações na conformação Além das cadeias polipeptídicas com sequências
estrutural das proteínas específicas de aminoácidos e seus dobramentos man-
A anemia falciforme é uma doença sanguínea here- tidos por interações químicas, as condições físicas e
ditária caracterizada pela produção de hemoglobinas químicas no ambiente são essenciais para determinar a
em forma de foice, em vez da tradicional forma bicôn- estrutura de uma proteína.
cava. Isso advém de uma alteração de um aminoácido Elevação da temperatura, variação do potencial hi-
glutamato (Glu) para um aminoácido valina (Val) na drogeniônico (pH) e concentração de sal ou introdução
molécula de hemoglobina, alterando a conformação de de determinados compostos químicos podem fazer
sua estrutura primária e resultando em um transporte com que a proteína se desenrole e perca sua forma
menor de oxigênio, além de torná-la mais frágil. original, em uma alteração denominada desnaturação.
Em indivíduos que têm apenas uma cópia do gene Nesse processo, ao assumir um formato errôneo, a pro-
para a anemia (indivíduo heterozigoto), que é recessivo, teína perde sua atividade biológica, tornando-se inativa.
a doença é assintomática e é chamada de traço falciforme,
porque apenas 1% das células vermelhas é produzida
em forma de foice.
A taxa desses indivíduos é alta em regiões da África,
Agente
onde há uma possível relação dessa doença com a gran- desnaturante
de incidência de malária. Indivíduos portadores desse
traço falciforme não desenvolvem a doença ao serem Proteína natural Proteína desnaturada
infectados pelo Plasmodium sp., agente etiológico da ma- A desnaturação de proteínas ocorre quando são expostas a agentes
lária que atinge as hemoglobinas. Essa característica é desnaturantes, como altas temperaturas ou agentes químicos que
transmitida hereditariamente entre as populações, ape- levam à perda de sua conformação e, consequentemente, sua função.

sar de poder levar à morte na infância, se não tratada.


Algumas proteínas podem retornar à configuração
Segundo um estudo publicado em 2011 na revis- espacial original em um processo denominado renatu-
ta Science, esse fato acontece porque a presença de he- ração, se permanecem dissolvidas e o agente desna-
moglobinas falciformes induz a expressão da enzima turante é removido. No entanto, na maioria dos casos,
heme-oxigenase-1 (HO-1), responsável pela catálise de as modificações são irreversíveis.
heme-sanguínea e produção de moléculas de monóxido A clara do ovo, por exemplo, torna-se sólida ao ser co-
de carbono (CO). A alta concentração de CO previne a zida e continua nesse estado físico quando esfria, pois o
invasão e o crescimento do Plasmodium, que se liga à su- calor excessivo aumenta a energia da cadeia polipeptídica
perfície da hemoglobina para alcançar a parede dos va- o suficiente para romper as interações fracas que estabili-
sos sanguíneos e provocar lesões. A alta concentração de zam a estrutura. Esse é o mesmo motivo de febres exces-
monóxido de carbono (CO) impede que o Plasmodium se sivamente altas serem fatais: as proteínas sanguíneas de-
ligue à hemoglobina, de maneira que os indivíduos não sidratam sob condições de altas temperaturas corporais.
são infectados e, assim, não desenvolvem malária. Na maioria dos casos, durante a desnaturação as pro-
Indivíduos que desenvolvem a anemia falciforme teínas tornam-se insolúveis em virtude da quebra das li-
sofrem quando suas células em formato de foice obs- gações originais e da constituição de novos dobramentos,
truem pequenos vasos sanguíneos, impedindo o fluxo mas a sequência de aminoácidos e as ligações peptídicas
sanguíneo. Esse efeito é um exemplo de como alterações permanecem. Isso comprova que a atividade biológica não
sutis na estrutura primária proteica podem causar gra- depende apenas da estrutura primária, embora este seja
ves consequências em sua função. o fator determinante para construir sua forma específica.
BUBAONE/ISTOCKPHOTO.COM
BUBAONE/ISTOCKPHOTO.COM

NATTIKA/SHUTTERSTOCK

Material exclusivo para professores


conveniados ao Sistema de Ensino
Hemácias comuns e em forma de foice, característica da anemia
falciforme. Elementos representados fora da escala de tamanho. Ao ser exposta à alta temperatura de cozimento, a albumina (proteína
Cores fantasia. presente na clara do ovo) tem sua conformação alterada, resultando
na solidificação do ovo.

Dom Bosco
DB_PV_2019_BIO1A.indd 238 08/10/18 16:34
73 – Material do Professor 239

ROTEIRO DE AULA

BIOLOGIA 1A
Aminoácidos

Ligam-se por
Classificados em:
meio de:

Ligações peptídicas Essenciais

Essenciais
Criando cadeias:
condicionais

Polipeptídicas Não essenciais

Formam as:

Proteínas

Estruturas: Função:

Sequência de aminoácidos
Primária
Enzimática

Cadeias polipeptídicas
Hormonal
em formato
Secundária
helicoidal unidas
porligações de H+.
Estrutural

Formato de um
polipetídeo resultado Terciária Defesa
de ligações de
dissulfeto.

Material exclusivo para professores


Estrutura final, resultado da
Transporte

conveniados ao Sistema de Ensino


agregação de subunidades
Quaternária
polipeptídicas.

Dom Bosco
DB_PV_2019_BIO1A.indd 239 08/10/18 16:34
240 74 – Material do Professor

EXERCÍCIOS DE APLICAÇÃO
BIOLOGIA 1A

1. Sistema Dom Bosco – Uma proteína é formada com a) hidrólise.


base no encadeamento de moléculas mais simples b) conjugação.
denominadas:
c) desnaturação.
a) nucleotídeos.
d) regulação.
b) aminoácidos.
e) proteólise.
c) nucleosídeos. Os agentes físicos ou químicos (como elevação da temperatura,
d) glicídios. alteração de pH, concentração de sais ou introdução de agentes
químicos) provocam a desnaturação proteica, que altera a confor-
e) ácidos graxos. mação e as funções da proteína.
As proteínas são macromoléculas formadas pela união de ami- 5. Sistema Dom Bosco – A fórmula estrutural a seguir
noácidos por ligações peptídicas.
representa uma biomolécula importante. Sobre ela, é
2. UFMS – Os animais conseguem sintetizar a maioria incorreto afirmar que:
dos aminoácidos. As reações de síntese ocorrem nas
células do parênquima hepático. Porém, alguns aminoá-
H–
cidos não são sintetizados pelos animais. Em relação a
essas moléculas, assinale a alternativa incorreta.
NH2 C COOH
a) Os aminoácidos naturais são aqueles produzidos no
organismo.
R
b) Os aminoácidos essenciais são aqueles que devem
ser obtidos através da alimentação. a) se trata de um aminoácido.
c) Nas proteínas da carne, do leite e dos ovos, encon- b) a união de duas ou mais moléculas iguais a essa for-
tram-se todos os aminoácidos essenciais, sendo, por mam uma proteína.
isso, considerados alimentos completos. c) uniões entre duas e vinte moléculas dessa formam
d) Os aminoácidos são unidades dos polissacarídeos. oligopeptídeos.
e) Um elevado número de aminoácidos pode se originar d) a união entre duas ou mais moléculas iguais a essa
por hidrólise de uma proteína. ocorre por meio de ligações dissulfeto.
Os aminoácidos são unidades de formação das proteínas. e) essa biomolécula é capaz de constituir hormônios e
enzimas, além de ter funções energética e estrutural.
3. Sistema Dom Bosco – Praticamente todas as funções de A união entre moléculas de aminoácidos ocorre por meio de li-
um ser vivo dependem de macromoléculas denominadas gações peptídicas.
proteínas. Cite e exemplifique duas funções das proteínas. 6. Sistema Dom Bosco – Que partes de uma cadeia po-
As proteínas podem ter função estrutural e energética, como lipeptídica participam das ligações que mantêm a es-
trutura secundária? Que partes participam da estrutura
terciária?
a queratina (presente no cabelo) e a albumina (importante na
A estrutura secundária envolve ligações de hidrogênio entre
nutrição). Outras funções são a hormonal, a enzimática e a ca-
átomos do grupo R das subunidades dos aminoácidos. A es-
talisadora, como anticorpos (que atuam na defesa imunológica
trutura terciária é mantida por ligações covalentes chamadas
do organismo) etc.
de dissulfeto.

4. Sistema Dom Bosco – Quando uma proteína é exposta


a agentes físicos ou químicos que alteram sua confor-
mação e, consequentemente, sua função, ocorre um
fenômeno denominado:

EXERCÍCIOS PROPOSTOS
7. Sistema Dom Bosco – A estrutura de uma proteína me- mas, quando consumidos juntos, tornam-se uma combina-
nos afetada pela perda de pontes de hidrogênio é: ção perfeita, pois se completam. Além de fornecerem diver-
a) estrutura primária. sos nutrientes, os aminoácidos que faltam em um alimento
podem ser encontrados no outro. Por exemplo: o arroz é po-
b) estrutura secundária.
bre no aminoácido lisina, que por sua vez é encontrado em
c) estrutura terciária. abundância no feijão, já o aminoácido metionina é pobre no

Material exclusivo para professores


d) estrutura quaternária. feijão, mas existe em abundância no arroz, por este motivo,
e) todos as estruturas são igualmente afetadas. eles se completam, tornando-se um par perfeito.
Fonte: http://cyberdiet.terra.com.br/arroz-e-feijao-u-par-
8. IFMT perfeito-2-1-1-44.html.

conveniados ao Sistema de Ensino


Arroz e feijão, dois alimentos riquíssimos em nutrientes, po-
dem ser consumidos separadamente, de diversas maneiras,
A importância da dupla “arroz-feijão” reside no fato de
fornecer ao organismo aminoácidos:

Dom Bosco
DB_PV_2019_BIO1A.indd 240 08/10/18 16:34
75 – Material do Professor 241

a) que são utilizados na construção das moléculas de DNA. produzir e como são chamados os aminoácidos produzi-

BIOLOGIA 1A
b) como metionina, utilizado na síntese dos nucleotí- dos com base em outras substâncias.
deos do RNA. a) Aminoácidos naturais e aminoácidos essenciais.
c) essenciais, necessários para a síntese de proteínas. b) Aminoácidos proteicos e aminoácidos não essenciais.
d) naturais que entram na composição dos carboidratos. c) Aminoácidos primários e aminoácidos secundários.
e) sintéticos que constituem os triglicerídeos. d) Aminoácidos globulares e aminoácidos secundários.
e) Aminoácidos essenciais e aminoácidos naturais.
9. IFMT – Analise a figura abaixo:
12. IFTM – O texto seguinte refere-se ao tipo de alimento
das traças.
Esse pequeno inseto de aparência curiosa é mais conheci-
do por causar danos superficiais nos livros. Quando adul-
tas, as traças podem chegar até 1,3 cm. Possuem antenas
longas e curvas, à frente, e três caudas partindo de trás, as
quais chegam a medir 50% do tamanho do corpo. (...)
Embora possam ser encontradas no mundo inteiro, as tra-
ças dão preferência a ambientes úmidos e, habitualmen-
te, só saem de seus esconderijos à noite ou na penumbra.
Alimentam-se de materiais ricos em proteína, açúcar (...).
Fonte: http://www.discolivros.com.br/area_do_biliofilo/
tracas_e_cupins.php

A capa e as páginas de um livro, que as traças usam


para se alimentar, são ricas em:
a) umidade e proteína.
b) umidade, tinta e proteínas.
c) umidade e açúcar.
A principal proteína constituinte do cabelo é a queratina que, d) proteína e açúcar exemplificado pela celulose e glicogênio.
quando aquecida pelas altas temperaturas da chapinha:
e) proteína e açúcar como as pectinas e celuloses.
a) incorpora novos aminoácidos à molécula, alongando-se.
b) sofre um processo denominado desnaturação, so- 13. Unipac-MG – Apesar de a carne bovina ser frequente
frendo alteração na sua estrutura. na dieta humana, a proteína bovina não é encontrada
c) transforma a forma globular em fibrosa. em nosso corpo. Isso ocorre porque:
d) quebra as pontes de hidrogênio que liga o grupo ami- a) o ser humano não possui enzimas para digerir as pro-
na de um aminoácido ao grupo carboxila do aminoá- teínas da carne bovina.
cido seguinte. b) as vitaminas da carne bovina desnaturam durante o
e) provoca modificação na sequência dos aminoácidos cozimento.
que a constituem. c) a proteína bovina sofre digestão e os aminoácidos libe-
rados são usados na produção de proteínas humanas.
10. UFR-RJ – A proteína 1 foi isolada a partir do sangue d) os lipídios presentes na carne bovina impermeabili-
de um vertebrado e a proteína 2 foi isolada a partir de zam suas proteínas, impedindo a absorção.
um meio de cultura de bactérias. Após estudos de se-
e) os aminoácidos presentes na carne bovina são dife-
quenciamento, foi observado que ambas as proteínas
rentes daqueles usados pelas células humanas.
apresentavam, cada uma, 471 resíduos de aminoácidos
em sua estrutura.
14. Sistema Dom Bosco – A doença Kwashiorkor ou doen-
Com base nessas informações, podemos afirmar que ça do desmame é muito comum na África ocidental e
as duas proteínas são iguais entre si? Explique. tem afetado crianças após o desmame em virtude da
severa carência de proteínas e alta quantidade de carboi-
drato na alimentação. Os sintomas dessa doença são:
retardo mental, apatia extrema, edema (inchaço) e queda
da resistência imunológica. Sabendo dessas informações
e com base em seus conhecimentos prévios, explique a
importância do consumo das proteínas para as crianças.

Material exclusivo para professores


11. Sistema Dom Bosco – Para que uma célula possa pro-
duzir suas proteínas, ela precisa de aminoácidos, que
podem ser obtidos de duas formas: ingeridos em ali-
mentos ricos em proteínas, ou produzidos pelas células

conveniados ao Sistema de Ensino


com base em outras moléculas orgânicas. Nas alternati-
vas abaixo, marque respectivamente como são chama-
dos os aminoácidos que um organismo não consegue

Dom Bosco
DB_PV_2019_BIO1A.indd 241 08/10/18 16:34
242 76 – Material do Professor

15. Unirio-RJ – A purificação e análise de uma molécula Sobre os principais componentes químicos dos seres vivos,
BIOLOGIA 1A

biológica indicou a presença de nove diferentes monô- assinale a soma da(s) proposição(ões) corretas:
meros. Podemos afirmar que se trata de um(a): 01. Os polissacarídeos podem ter função de reserva
a) ácido nucleico. energética. A espécie humana é capaz de arma-
b) glicerídeo. zenar um polissacarídeo, chamado glicogênio, no
fígado e músculos. Quando necessário, nosso
c) esteroide. organismo converte glicogênio em glicose para
d) proteína. fornecer energia ao corpo.
e) vitamina. 02. As febres muito altas podem levar um indivíduo
à morte. Isto ocorre devido ao processo de des-
16. EFOA-MG – Além de serem as macromoléculas mais naturação de proteínas que são necessárias para
abundantes nas células vivas, as proteínas desempe- manutenção do metabolismo. A desnaturação
nham diversas funções estruturais e fisiológicas no me- leva à perda da forma proteica e consequente-
tabolismo celular. Com relação a essas substâncias, é mente da sua função.
correto afirmar que: 04. Atualmente as necessidades vitamínicas de um
a) são todas constituídas por sequências monoméricas indivíduo já podem ser supridas unicamente atra-
de aminoácidos e monossacarídeos. vés do consumo de comprimidos concentrados. A
vantagem é garantir que não faltem vitaminas para
b) além de função estrutural, são também as mais impor-
a manutenção do organismo. E praticamente não
tantes moléculas de reserva energética e de defesa.
existem desvantagens, pois o excesso de qualquer
c) são formadas pela união de nucleotídeos por meio vitamina será eliminado por meio da urina.
dos grupamentos amina e hidroxila.
08. As proteínas são formadas por moléculas meno-
d) cada indivíduo produz as suas proteínas, que são co- res denominadas aminoácidos. O organismo hu-
dificadas de acordo com o material genético. mano é capaz de sintetizar alguns aminoácidos
e) a sua estrutura é determinada pela forma, mas não (naturais), enquanto outros não podem ser sinte-
interfere na função ou especificidade. tizados (essenciais). Os aminoácidos essenciais
precisam ser ingeridos através da alimentação.
17. IFSC – Todos os seres vivos são formados por componentes 16. Para que uma pessoa engorde é necessário que
químicos básicos: carbono, hidrogênio, oxigênio, nitrogênio, ela faça ingestão de gordura (lipídios), pois atra-
enxofre e fósforo. Estes elementos podem formar os com- vés da ingestão de carboidratos e proteínas nosso
postos orgânicos que constituem nossos corpos e possuem metabolismo não pode sintetizar lipídios e a pes-
diversas relações com a nossa alimentação e metabolismo. soa não engorda.

ESTUDO PARA O ENEM


18. Enem C8-H30 c) lipídios.
Na década de 1940, na Região Centro-Oeste, produtores ru- d) celulose.
rais, cujos bois, porcos, aves e cabras estavam morrendo por
uma peste desconhecida, fizeram uma promessa que con- e) proteínas.
sistiu em não comer carne e derivados até que a peste fosse
debelada. Assim, durante três meses, arroz, feijão, verduras e 20. Sistema Dom Bosco C8-H30
legumes formaram o prato principal desses produtores. O veneno da cascavel contém uma proteína chamada crotoxina,
que há muitas décadas desafia a ciência. Desde 1938, os pes-
Fonte: O Hoje, 15 de out 2011. (Adaptado) quisadores têm dificuldade para entender seu mecanismo de
Para suprir o déficit nutricional a que os produtores ru- ação. Mas um artigo publicado em março na Scientific Reports,
uma publicação do grupo Nature, pode ter dado um grande
rais se submeteram durante o período da promessa, foi
passo para explicar como ela funciona. Assinado por cientistas
importante eles terem consumido alimentos ricos em:
brasileiros, o trabalho traz uma nova descrição da estrutura
a) vitaminas A e E. da molécula da crotoxina. A principal novidade do artigo é
b) frutose e sacarose. que a estrutura proposta é da molécula de crotoxina em uma
solução líquida – e não em forma de cristal, que é como os
c) aminoácidos naturais. cientistas costumam estudar as proteínas. Para chegar ao re-
d) aminoácidos essenciais. sultado, os pesquisadores combinaram dados da cristalografia
e) ácidos graxos saturados. da proteína com informações obtidas em experimentos com
a molécula em solução. Por meio de uma técnica chamada
espalhamento de raio-X a baixo ângulo, cujos experimentos
19. Enem C8-H30 foram feitos no Instituto de Física da USP, foi possível modelar
Recentemente, um estudo feito em campos de trigo mos- partes da crotoxina que nunca haviam sido vistas.
trou que níveis elevados de dióxido de carbono prejudicam
a absorção de nitrato pelas plantas. Consequentemente, a Fonte: <http://ciencia.usp.br/index.php/2017/04/24/2586/>.
qualidade nutricional desses alimentos pode diminuir à Sobre as estruturas das proteínas, marque a melhor al-
medida que os níveis de dióxido de carbono na atmosfera ternativa:
atingirem as estimativas para as próximas décadas.
a) A estrutura primária é aquela que tem forma seme-

Material exclusivo para professores


BLOOM, A. J. et al. Nitrate assimilation is inhibited by elevated lhante a uma hélice.
CO2 in field-grown wheat. Nature Climate Change, n. 4, abr, 2014
(adaptado).
b) A estrutura secundária é formada por ligações de enxofre.
c) A estrutura terciária é simples e linear.
Nesse contexto, a qualidade nutricional do grão de trigo
d) A estrutura quaternária é formada pela união de vá-

conveniados ao Sistema de Ensino


será modificada primariamente pela redução de:
rias estruturas terciárias.
a) amido. e) Moléculas de proteínas em estruturas secundárias
b) frutose. não sofrem desnaturação.

Dom Bosco
DB_PV_2019_BIO1A.indd 242 08/10/18 16:34
8
77 – Material do Professor 243

SUBSTÂNCIAS ORGÂNICAS:

BIOLOGIA 1A
ENZIMAS E ACELERAÇÃO DAS
REAÇÕES DO METABOLISMO

Serpentes, aranhas, escorpiões, lacraias, taturanas, vespas, formigas, abelhas e


marimbondos são exemplos de animais peçonhentos. São responsáveis por causar
inúmeros acidentes, tanto nas cidades como nas áreas rurais, no Brasil e em diversas • Enzimas
outras partes do mundo. • Príon ou prião
Para autodefesa ou como forma de se alimentarem de suas presas, os animais
peçonhentos produzem substâncias tóxicas em glândulas especializadas no corpo, HABILIDADES
geralmente constituídas de enzimas. • Compreender que enzimas

(C) VBJUNOT | DREAMSTIME.COM


são uma classe de pro-
teínas.
• Relacionar a função das
enzimas com o aumento
da velocidade das reações
químicas.
• Entender os fatores que
afetam a ação enzimática.
• Conhecer o que é um príon
e as principais doenças
relacionadas a ele.

Material exclusivo para professores


A jararaca (na imagem uma Bothrops moojeni) é um animal encontrado por toda a América do Sul. É um dos
principais causadores de acidentes com animais peçonhentos em nosso país. A ação das enzimas presentes em
seu veneno causa a necrose dos tecidos, por degradar as proteínas.

As enzimas são uma classe de proteínas que atuam como catalisadores, acele-

conveniados ao Sistema de Ensino


rando seletivamente as reações químicas sem serem consumidas pela reação. São
moléculas essenciais à vida, já que regulam os processos metabólicos que mantêm
a célula viva.

Dom Bosco
DB_PV_2019_BIO1A.indd 243 08/10/18 16:34
244 78 – Material do Professor

Enzimas As reações catalisadas pelas enzimas são muito


BIOLOGIA 1A

específicas. Mesmo entre isômeros, uma enzima


As proteínas enzimáticas, ou simplesmente enzi- é capaz de reconhecer seu substrato específico.
mas, são macromoléculas altamente numerosas nos Como são proteínas, as enzimas apresentam uma
seres vivos, constituídas por uma ou mais cadeias poli- conformação tridimensional única, formada por
peptídicas, com afinidade intra ou extracelular. uma ordem de aminoácidos, a qual resulta nessa
Essas moléculas atuam como catalisadores de di- especificidade.
versas reações químicas que ocorrem no metabolismo Somente uma região restrita da enzima se liga ao
celular, acelerando a velocidade de uma reação quí- substrato, denominada centro ativo ou sítio ativo,
mica sem sofrer alteração em sua conformação. Além onde ocorre a catálise. A especificidade da enzima é re-
disso, são capazes de participar de uma reação química sultado do ajuste entre a forma do sítio ativo e a forma
inúmeras vezes. do substrato.
Toda reação química entre moléculas envolve tan-
to a quebra quanto a formação de ligações químicas.

DESIGNUA/SHUTTERSTOCK
Para que os organismos consigam aproveitar os ami- Produtos

noácidos, por exemplo, enzimas proteases (enzimas


Substratos
que quebram ligações peptídicas) digerem as proteínas Sacarose Frutose Glicose
no estômago e no intestino por meio de reações de
hidrólise, com a água e o suco digestivo atuando sobre
essas moléculas.

Enzima Complexo
NH2 H2 O NH2 enzima-substrato

R1 C H 1 R1 C H
H
Enzima
COOH + NH2 C N Ligação
Em uma reação rápida, a enzima combina-se com o substrato, formando
O peptídica o complexo enzima-substrato. Em reação mais lenta, esse complexo se
R2 C H 2 R2 C H desfaz, originando o produto da reação e liberando a enzima. Elementos
representados fora da escala de tamanho. Cores fantasia.
COOH H2O COOH

Alterações na estrutura da enzima podem torná-la


Em (1), reação de síntese de proteínas por meio de ligações peptídicas;
em (2), reação de hidrólise, que permite a degradação da proteína em
inativa porque não será possível o substrato se encai-
aminoácidos. xar no centro ativo. Essa grande especificidade entre o
substrato e a enzima é denominado complexo chave-
Existe outra classe de enzimas que não são proteí- -fechadura.
nas, já que são formadas de RNA (riboenzimas). No en-
tanto, serão discutidas nos próximos módulos. Agora ENERGIA DE ATIVAÇÃO (EA)
concentraremos nossa atenção no estudo das enzimas As reações químicas ocorrem originando novas
proteicas. moléculas por meio do rompimento de ligações que
existiam nos reagentes e da formação de novas li-
INTERAÇÃO ENTRE ENZIMA E gações entre eles. Para transformar uma molécula,
SUBSTRATO geralmente é preciso mudar sua conformação origi-
O nome de uma enzima pode indicar o tipo da rea- nal em outra altamente instável antes de a reação
ção que ela catalisou (hidrolases, transaminases, desi- acontecer.
drogenases etc.) ou o substrato – reagente sobre o Para isso, os reagentes precisam de mais energia
qual ela atua (amilase, protease, lipase etc.). que o normal, geralmente absorvendo energia de seu
O mecanismo de atuação da enzima se inicia entorno na forma de calor. Quando as novas ligações da
quando ela se liga ao substrato (ou substratos, quan- molécula do produto são formadas, a energia é liberada
do há dois ou mais reagentes), formando o com- como calor, e as moléculas voltam à conformação está-
plexo enzima-substrato. Durante essa ligação, a vel com menor energia.
ação catalítica da enzima converte o substrato no(s) Essa quantidade de energia necessária para iniciar a

Material exclusivo para professores


produto(s) da reação. reação é denominada energia de ativação (EA).
Para facilitar a compreensão, imagine a situação
de um pneu furado. Trocá-lo sem o uso de nenhuma
Complexo ferramente é impossível, por causa do peso do car-
Enzima + Enzima +

conveniados ao Sistema de Ensino


enzima- ro. Entretanto, com a ajuda de um macaco hidráu-
substrato produto
-substrato lico portátil, é possível levantar o carro. Nessas cir-
cunstâncias, a energia de ativação (que seria a força

Dom Bosco
DB_PV_2019_BIO1A.indd 244 08/10/18 16:34
79 – Material do Professor 245

necessária para levantar o carro com as mãos) foi re-


duzida em virtude da ação de um cofator (o macaco

BIOLOGIA 1A
Velocidade máxima
hidráulico portátil).

Velocidade da reação
Energia livre

Sem enzima EA sem a Concentração ótima


enzima de substrato

EA da
enzima
Concentração de substrato
Reagentes Com enzima Energia total liberada
Quando a velocidade máxima é alcançada em uma reação, ocorre a
na reação
saturação das enzimas.
Produtos

Tempo
FATORES QUE INTERFEREM NA AÇÃO
As reações necessitam de menos energia com a ação de enzimas. ENZIMÁTICA
Além da concentração de substrato que interfere na
As enzimas são catalisadoras porque aumentam velocidade de uma reação enzimática, a funcionalidade
a velocidade da reação e diminuem a energia de de uma enzima é influenciada por fatores ambientais.
ativação necessária. Quando os produtos são for- Agentes químicos também são responsáveis por afetar
mados, as enzimas se desprendem e mantêm suas a ação enzimática, assim como a presença de molé-
formas inalteradas. Assim, pequenas quantidades culas auxiliares não proteicas, denominadas cofatores.
de enzimas podem ter um enorme impacto sobre
o metabolismo, agindo repetidamente nos ciclos Fatores físicos: temperatura e pH
catalíticos. Quanto maior for a temperatura, maior será a velo-
cidade das reações químicas. No entanto, se houver
CICLO CATALÍTICO NO SÍTIO ATIVO aumento excessivo, ocorrerá a desnaturação das enzi-
DA ENZIMA mas, como em toda proteína.
A desnaturação provoca a alteração na estrutura da
Durante o ciclo catalítico, o substrato é retido no
enzima, que faz com que o substrato não seja mais com-
sítio ativo pelas interações fracas na maioria das rea-
patível com ela, tornando-a completamente inutilizada.
ções enzimáticas, como pontes de hidrogênio e forças
Há uma temperatura na qual a atividade enzimática
iônicas.
é máxima, denominada temperatura ótima. Em ani-
A energia de ativação é diminuída pelo sítio ativo
mais homeotérmicos, a temperatura ótima costuma
e pela reação acelerada. Dessa maneira, o sítio ativo
ser entre 35 °C e 40 °C, o que corresponde à faixa de
atua com um molde para a orientação do substrato e
temperatura natural do corpo.
fornece um microambiente favorável ou participa dire-
tamente na reação catalítica.
Após a conversão dos substratos em produtos, que
são liberados, o sítio ativo fica disponível para a entrada
de novas moléculas de substrato. A duração do ciclo
catalítico é tão rápida que uma única molécula de en-
zima atua em cerca de mil moléculas de substrato por Atividade
segundo. enzimática
No entanto, há um limite para a velocidade, atin-
gido quando a concentração de substrato é alta o
suficiente para que todos os sítios ativos estejam Temperatura
ocupados. Nessa concentração, diz-se que a enzima ótima

está saturada, e a velocidade da reação será deter-

Material exclusivo para professores


minada pela velocidade com que os produtos são
0 10 20 30 40 50 60 70
liberados dos sítios ativos.
A única maneira de aumentar a velocidade de for- Temperatura (°C)
mação de produtos nessas condições de saturação é

conveniados ao Sistema de Ensino


adicionando mais enzimas. Muitas vezes as células au-
mentam suas velocidades de reação, produzindo mais Quando a temperatura diminui, a velocidade das
enzimas. reações também é reduzida, mas a atividade catalítica

Dom Bosco
DB_PV_2019_BIO1A.indd 245 08/10/18 16:34
246 80 – Material do Professor

reaparece quando a temperatura se eleva e chega à parte da enzima. São os inibidores não competitivos,
BIOLOGIA 1A

condição ótima. A redução da atividade enzimática e da que alteram o formato da enzima, causando uma inibi-
taxa metabólica em baixas temperaturas é útil para o ção irreversível. Um exemplo desses inibidores são as
congelamento de sêmen e embriões e para a preserva- toxinas e os venenos, assim como muitos antibióticos
ção de órgãos para transplantes. que inibem enzimas específicas nas bactérias.

LEITURA COMPLEMENTAR LEITURA COMPLEMENTAR


Enzimas e febre Quando falamos em animais com veneno e toxinas,
A febre é o aumento da temperatura do corpo acima do costumamos pensar somente em serpentes, aranhas e
normal, geralmente em resposta a alguma doença infec- escorpiões. No entanto, há outros animais que produ-
ciosa ou inflamatória. zem substâncias tóxicas capazes de matar outros orga-
nismos, como peixes (bagres marinhos, baiacus e raias),
Isso acontece na tentativa de destruir o patógeno que
lagartos (dragão-de-komodo e monstro-de-gila), muitos
esteja afetando os processos biológicos, por meio da al-
anfíbios e até mamíferos (como o ornitorrinco).
teração do ambiente e das condições do organismo. Isso
aumenta a atividade das células de defesa, cuja prolife- Um exemplo é a rã Phyllobates terribilis, da família Den-
ração estimula a mudança de temperatura. drobatidae, espécie endêmica da Colômbia com cerca
de 5,5 cm na fase adulta. Um único indivíduo produz
Entretanto, ao fazer isso, a febre pode comprometer as
quantidade de veneno suficiente para matar dez pessoas
atividades enzimáticas do nosso corpo, causando des-
adultas, sendo classificado como o animal mais tóxico do
naturação nas enzimas e nas proteínas. Por isso é um
mundo. Esse veneno é uma toxina denominada batraco-
processo que deve ser controlado e, se excessivo, antitér-
toxina, que, mesmo em pequenas quantidades, promove
micos devem ser administrados.
paralisia e morte quando entra na corrente sanguínea.
Algumas espécies de bactérias apresentam temperatura
Para identificar anfíbios venenosos, uma regra de ouro
ótima diferente da nossa. Por exemplo: bactérias termó-
costuma ser eficaz para a maioria dos casos: em geral,
filas, que são adaptadas a elevadas temperaturas, têm
anfíbios e outros animais de coloração chamativa (va-
temperatura ótima em torno de 45 ºC-75 ºC. Essas fazem
riando entre vermelho, amarelo, azul e preto) são vene-
parte do grupo designado bactérias termorresistentes e
nosos. Essas cores são um sinal de alerta, funcionando
podem ser encontradas em alimentos não higienizados
como um aviso aos predadores de que esses animais são
ou que não passaram por processo de pasteurização por
altamente tóxicos, capazes de matar. Essa característica
exemplo (processo já visto no módulo anterior), como é
é chamada de aposematismo.
o caso do leite.

GETTY IMAGES/ISTOCKPHOTO
Quanto ao potencial hidrogeniônico (pH), em valores
abaixo (mais ácido) ou acima (mais básico) do pH ótimo
(no qual a atividade biológica é máxima), a atividade en-
zimática é reduzida porque a estrutura tridimensional
é afetada. Lembrando que o pH ótimo varia de enzima
para enzima. Por exemplo: a enzima ptialina encontrada
na boca (na saliva principalmente) tem pH ótimo igual
a 7, enquanto a pepsina encontrada no estômago tem
pH ótimo igual a 2, visto que se encontra em ambien-
te ácido, graças à presença de ácido clorídrico (HCℓ) do
estômago.

Fatores químicos: inibidores de enzima


Rã Phyllobates terribilis.
A ação enzimática pode ser inibida seletivamente
por alguns compostos químicos. Quando estes se li-
gam às enzimas por meio de ligações fracas, a inibição Cofatores enzimáticos
é reversível. Por alguns inibidores serem parecidos com Muitas enzimas precisam de moléculas adjuvantes
a molécula de substrato, ocorre competição pelo sítio não proteicas para desempenhar sua função catalítica.
ativo, por isso denominados inibidores competitivos. Esses auxiliares são denominados cofatores. Esses com-

Material exclusivo para professores


Com essa ligação, a produtividade da enzima é ini- postos podem ser inorgânicos como os íons metálicos
bida, já que os substratos não conseguem entrar no (Zn, Fe, Mg etc.) ou alguma molécula orgânica complexa,
sítio ativo. Essa inibição é revertida ao aumentar a con- chamado de coenzima. Os cofatores podem ligar-se de
centração de substrato, que, em maior concentração, forma permanente ou de forma reversível ao substrato.

conveniados ao Sistema de Ensino


ganha a entrada no sítio ativo. Um exemplo de coenzimas são as vitaminas hidros-
Outro tipo de inibidor não compete com o substrato, solúveis estudadas anteriormente, pois elas ativam en-
mas impede as reações enzimáticas, ao se ligar a outra zimas importantes no metabolismo celular.

Dom Bosco
DB_PV_2019_BIO1A.indd 246 08/10/18 16:34
81 – Material do Professor 247

Os cofatores atuam de diferentes maneiras, mas

SHUTTERSTOCK / MOLEKUUL_BE
em todas elas têm papel essencial na catálise.

BIOLOGIA 1A
Substratos
Cofator

Sítio de
ligação
Estrutura 3D de um príon humano. Elementos representados fora da
Enzima Enzima escala de tamanho. Cores fantasia.
inativa ativa

Essa proteína está associada a algumas doenças de-


Sem o cofator A ligação do
conectado, a enzima cofator ativa a
generativas do sistema nervoso, como a encefalopatia es-
não é ativada enzima pongiforme bovina, popularmente chamada de "doença da
vaca louca”. Essa enfermidade é neurodegenerativa, cau-
Esquema da ligação entre o cofator e a enzima. Elementos sando distúrbios comportamentais e motores. Em seres
representados fora da escala de tamanho. Cores fantasia. humanos esse príon é causador da doença de Creutzfeldt-
-Jakob (também chamada de CJD), doença extremamen-

Príon ou prião te grave que atinge o sistema nervoso central, em que as


células nervosas são deformadas e depois desaparecem,
Em 1982, o cientista Stanley Prusiner nomeou resultando no aspecto espongiforme do encéfalo.
como príon (proteinaceous infection) infecções por for- Ainda hoje o mecanismo bioquímico envolvido na alte-
ma proteíca. ração na proteína que resulta nos príons não é totalmente
Até então, acreditava-se que os vírus eram os agen- compreendido. Algumas encefalopatias espongiformes
tes infecciosos de estrutura mais simples, já que são são hereditárias, porém em humanos são conhecidos dois
formados basicamente por uma molécula de ácido nu- outros tipos de doenças degenerativas provocadas por
cleico revestida por uma cápsula proteica. príons que não são herdadas geneticamente.
No entanto, o príon é um agente infeccioso de estru- Em alguns casos, os príons podem ser transmitidos
tura mais simples que os vírus, visto que não apresenta por manipulações clínicas em procedimentos hospita-
material genético. Ele é formado por proteínas com seu lares, já que estas partículas são muito resistentes à
dobramento alterado, que interagem com outras proteí- esterilização, ou mesmo em órgãos transplantados. A
nas da membrana plasmática de células nervosas e as propagação também pode acontecer pela ingestão da
tornam novos príons. carne de organismos contaminados.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A.indd 247 08/10/18 16:34
248 82 – Material do Professor

ROTEIRO DE AULA
BIOLOGIA 1A

Compostos proteicos

Um ou mais Proteínas
polipeptídeos alteradas

Enzimas Príons

Catalisadores Função: Causam doenças: Infecciosas

Atuam em reagentes
Substratos Que atacam o: Sistema nervoso
denominados:

Enzima-substrato Formam o complexo: A exemplo da: Doença da vaca louca

Modelo chave-fechadura Tem alta


especificidade, por
isso denominado:

Ação enzimática é
afetada por:

Concentração do substrato
Fatores físicos Fatores químicos Cofatores

Temperatura pH Inibidores

Material exclusivo para professores


conveniados ao Sistema de Ensino Competitivos Não competitivos

Dom Bosco
DB_PV_2019_BIO1A.indd 248 08/10/18 16:34
83 – Material do Professor 249

EXERCÍCIOS DE APLICAÇÃO

BIOLOGIA 1A
1. UFV-MG – O gráfico a seguir representa a atividade 4. Sistema Dom Bosco – Uma das funções das enzimas
enzimática de uma determinada reação em função da é agir como catalisadores nas reações. Entre as opções
temperatura: a seguir, marque aquela que melhor explica a função de
uma enzima catalisadora.
a) Enzimas catalisadoras atuam reduzindo a energia de
ativação.
b) Enzimas catalisadoras atuam aumentando a energia
de ativação.
c) Enzimas catalisadoras atuam alterando o pH do meio.
Atividade da enzima na reação

d) Enzimas catalisadoras atuam aumentando o número


de carbonos no substrato.
Enzimas catalisadoras atuam reduzindo a energia de ativação. As alter-
nativas C e D estão incorretas porque as enzimas não interferem no pH
do meio nem aumentam o número de átomos em outras substâncias.

5. UFSCar – Considere as quatro frases seguintes.


I. Enzimas são proteínas que atuam como catalisado-
res de reações químicas.
II. Cada reação química que ocorre em um ser vivo, ge-
ralmente, é catalisada por um tipo de enzima.
0 10 20 30 40 50 60 ºC III. A velocidade de uma reação enzimática independe
de fatores como temperaturas e pH do meio.
Temperatura (°C)
IV. As enzimas sofrem um enorme processo de desgas-
te durante a reação química da qual participam.
A seta indica o ponto:
São verdadeiras as afirmações:
a) ótimo de temperatura para a atividade enzimática.
b) de desnaturação da enzima. a) I e III, apenas.
c) de desnaturação do produto. b) III e IV, apenas.
d) mínimo da temperatura para a reação enzimática. c) I e II, apenas.
e) máximo de substrato obtido. d) I, II e IV, apenas.
A seta indica a temperatura ótima, na qual a atividade da enzima
e) I, II, III e IV.
na reação é a mais elevada possível.
A temperatura e o pH interferem na atividade enzimática. As
enzimas são catalisadores que não são consumidos na reação
2. Sistema Dom Bosco – Entre as opções abaixo, mar- enzimática.
que a que apresenta fatores que podem interferir na 6. Sistema Dom Bosco – O que é um príon? Descreva
função das enzimas: sua importância médica.
a) pH do ambiente, temperatura e concentração do
substrato. O príon é uma molécula de proteína infecciosa encontrada na
b) pH do ambiente, concentração do substrato e solubi-
lidade. membrana plasmática das células nervosas que interagem com
c) temperatura, solubilidade e quantidade de ligações
peptídicas. outras proteínas e as tornam novos príons. Essa proteína está
d) solubilidade, quantidade de ligações peptídicas e
concentração do substrato. associada a algumas doenças, como a doença da vaca louca e

Os fatores que influenciam no funcionamento das enzimas são


o pH, a temperatura e a concentração do substrato. outras enfermidades neurodegenerativas.

3. Sistema Dom Bosco – Cofatores são moléculas que


funcionam de diversas maneiras, tendo em comum o
papel essencial na catálise. O que é um cofator? Dê
exemplos.

Cofatores são enzimas que atuam ligadas a outros compostos.

Um exemplo de cofator são as vitaminas, porque, para atuar no

Material exclusivo para professores


metabolismo celular, elas necessitam geralmente de íons a fim

de que sejam ativadas ou inibidas.

conveniados ao Sistema de Ensino


Dom Bosco
DB_PV_2019_BIO1A.indd 249 08/10/18 16:34
250 84 – Material do Professor

EXERCÍCIOS PROPOSTOS
BIOLOGIA 1A

7. UFU-MG – O rúmen ou pança dos ruminantes e o ceco


dos roedores são estruturas que se assemelham funcio-
nalmente porque:
a) ambos possuem a enzima pepsina, que transforma
as proteínas em unidades menores.
11. Sistema Dom Bosco
b) ambos secretam HCL, que, ao longo do tubo digestó-
rio, irá ativar as enzimas inativas. O uso de enzimas em processos industriais é de grande
interesse, em especial devido à facilidade de obtenção (por
c) ambos possuem microrganismos que secretam enzi-
biotecnologia) e às vantagens em relação aos catalisadores
mas para a digestão de celulose.
(aceleradores de reações) químicos, como maior especifi-
d) suas mucosas secretam a enzima celulase, que atua cidade, menor consumo energético e maior velocidade de
na digestão da celulose.
reação. Além disso, a catálise enzimática tem outros be-
e) ambos possuem pH ótimo para a ação da tripsina so- nefícios, como o aumento da qualidade dos produtos, em
bre a digestão da celulose. relação à catálise química; a redução dos custos de labora-
tório e de maquinário, graças à melhoria do processo; ou a
8. Sistema Dom Bosco – As enzimas são macromolécu-
fabricação controlada de pequenas quantidades. 
las que reduzem a energia de ativação das reações quí-
Ciência Hoje. Enzimas: – poderosa ferramenta na indústria.
micas, aumentando a velocidade com que acontecem.
Disponível em: <http://cienciahoje.org.br/artigo/enzimas-pode-
Estas moléculas são uma classe de: rosa-ferramenta-na-industria/>. Acesso em: 10 jun. 2018.
a) proteínas.
Sobre o uso de enzimas como catalisadoras, é correto
b) sais minerais.
afirmar que:
c) lipídios.
a) aumentam a energia de ativação de uma reação.
d) carboidratos.
b) aumentam a quantidade de substrato utilizado no
processo.
9. Sistema Dom Bosco – A figura a seguir ilustra o quão
específicos são uma enzima e seu substrato. c) reduzem a energia de ativação de uma reação.
d) reduzem a velocidade das reações.
Substrato Substrato
12. FMP-RS – O gráfico a seguir mostra como a concentra-
ção do substrato afeta a taxa de reação química.

Taxa máxima
Taxa de reação

Reação com
enzima

Reação sem
enzima

Enzima Enzima
Concentração do substrato
Sobre o modelo representado no esquema, é correto
afirmar que: O modo de ação das enzimas e a análise do gráfico per-
mitem concluir que:
a) a enzima se liga a qualquer tipo de substrato.
b) o complexo chave-fechadura, do qual a enzima só se a) todas as moléculas de enzimas estão unidas às mo-
liga ao seu substrato específico. léculas de substrato quando a reação catalisada atin-
ge a taxa máxima.
c) o local onde o substrato se liga à enzima é chamado
b) com uma mesma concentração de substrato, a taxa
de sítio inativo.
de reação com enzima é menor que a taxa de reação
d) substratos são moléculas que degradam as enzimas. sem enzima.
c) a reação sem enzima possui energia de ativação me-
10. Sistema Dom Bosco – Explique como ocorrem as inte- nor do que a reação com enzima.
rações entre as enzimas e seus substratos e dê o con-
ceito do modelo chave-fechadura. d) o aumento da taxa de reação com enzima é inversa-
mente proporcional ao aumento da concentração do
substrato.

Material exclusivo para professores


e) a concentração do substrato não interfere na taxa de
reação com enzimas porque estas são inespecíficas.

13. IFNMG – Um técnico de laboratório colocou, separada-

conveniados ao Sistema de Ensino


mente, em seis tubos de ensaio, soluções de amido e
soluções de proteína, juntamente com suas respectivas
enzimas digestivas. As soluções apresentavam diferentes

Dom Bosco
DB_PV_2019_BIO1A.indd 250 08/10/18 16:34
85 – Material do Professor 251

índices de pH e diferentes temperaturas, de acordo 16. Sistema Dom Bosco – O gráfico a seguir mostra a ati-

BIOLOGIA 1A
com a tabela seguinte: vidade enzimática de acordo com a concentração do
substrato.
Tubo pH Temperatura (°C)
I 2 20

II 7 40
Velocidade
da reação
III 8 80

IV 2 40

V 8 20
Concentração de substrato
VI 7 80
De acordo com seus conhecimentos, marque a alterna-
Passados alguns minutos, observou-se a ocorrência do tiva correta.
processo digestivo. A digestão do amido e a digestão da a) À medida que a concentração do substrato aumenta,
proteína ocorreram, respectivamente, nos tubos: a velocidade da reação também aumenta.
a) IV e VI. b) À medida que a concentração do substrato aumenta,
b) II e III. a velocidade da reação diminui.
c) I e III. c) Se a concentração da enzima for constante, a veloci-
d) II e IV. dade da reação aumentará repentinamente.
d) Se a concentração da enzima for pequena, a velocida-
14. Sistema Dom Bosco – Descreva como uma enzima ca- de da reação reduzirá.
talisa as reações químicas.
17. Sistema Dom Bosco – As proteínas são substâncias
fundamentais na constituição de qualquer ser vivo. Al-
gumas proteínas – as enzimas – têm importante papel
como catalizadoras das reações do metabolismo celu-
lar. No entanto, essas moléculas são, em geral, extre-
mamente suscetíveis ao aumento da temperatura; a
maioria delas deixa de funcionar corretamente a tempe-
raturas superiores a 50 ºC.
Qual é a explicação para esse fenômeno?

15. UPF-RS – A maioria das reações metabólicas de um or-


ganismo somente ocorre se houver a presença de enzi-
mas. Sobre as enzimas, analise as afirmativas abaixo.
I. A ação enzimática sofre influência de fatores como
temperatura e potencial de hidrogênio; variações
nesses fatores alteram a funcionalidade enzimática.
II. São formadas por aminoácidos e algumas delas po-
dem conter também componentes não proteicos
adicionais, como, por exemplo, carboidratos, lipídios,
metais ou fosfatos.
III. Apresentam alteração em sua estrutura após a rea-
ção que catalisam, uma vez que perdem aminoáci-
dos durante o processo.
IV. A ligação da enzima com seu respectivo substrato
tem elevada especificidade. Assim, alterações na
forma tridimensional da enzima podem torná-la afun-
cional, porque impedem o encaixe de seu centro ati-
vo ao substrato.

Material exclusivo para professores


Está correto apenas o que se afirma em:
a) I, II e IV.
b) I, II e III.
c) II, III e IV.

conveniados ao Sistema de Ensino


d) III e IV.
e) I, III e IV.

Dom Bosco
DB_PV_2019_BIO1A.indd 251 08/10/18 16:34
252 86 – Material do Professor

ESTUDO PARA O ENEM


BIOLOGIA 1A

18. Sistema Dom Bosco C5-H17 do corpo da abelha, e aumenta a atividade da MAP qui-
Uma bebê australiana conhecida apenas por “Baby Z” tor- nase, que acelera seu desenvolvimento”.
nou-se a primeira pessoa da história a ser curada de uma Galileu. Cientistas descobrem proteína que transforma abelha em
doença fatal chamada deficiência do cofator de molibdênio, rainha. Disponível em: <http://revistagalileu.globo.com/Revista/
que conduz a comprometimento neurológico logo após o Common/0,,EMI228521-17770,00-CIENTISTAS+DESCOBREM+PR
OTEINA+QUE+TRANSFORMA+ABELHA+EM+RAINHA.html>
nascimento. O tratamento experimental, desenvolvido pela
Acesso em: 10 jun. 2018.
Universidade de Colônia, na Alemanha, havia sido até en-
tão testado apenas em camundongos. O anúncio do suces- O que acontecerá com a enzima P70-S6 Kinase 1 se a
so na primeira aplicação humana foi feito nesta quinta-feira colmeia for exposta a um forno elétrico industrial que
[05/11/2009]. Normalmente, esta forma de erro inato do constantemente é utilizado, chegando a temperaturas
metabolismo mata seus portadores em apenas alguns meses em torno de 200° C?
após o nascimento.“Baby Z”tem agora 18 meses de vida, in- a) A enzima sofrerá desnaturação.
forma o jornal australiano“Herald Sun”. b) A enzima funcionará normalmente.
G1: BEBÊ australiana é a primeira da história a ser curada de doen- c) A enzima se multiplicará.
ça genética rara. Disponível em: <http://g1.globo.com/Noticias/ d) A enzima produzirá mais de uma abelha-rainha.
Ciencia/0,,MUL1367623-5603,00-BEBE+AUSTRALIANA+E+A+D
A+HISTORIA+A+SER+CURADA+DE+DOENCA+GENETICA+R 20. Sistema Dom Bosco C5-H17
ARA.html>. Acesso em: 10 jun. 2018. Um caso suspeito de Creutzfeldt-Jakob (DCJ), semelhante ao
A respeito da deficiência do cofator de molibdênio, mal da vaca louca, está sendo monitorado em Teresina pela Se-
pode-se afirmar corretamente que: cretaria de Estado da Saúde (Sesapi). A doença é uma condição
que afeta o cérebro, ocasionando extensas lesões que levam
a) é uma doença na qual o indivíduo não consegue pro- a rápida instalação de demência e distúrbios do movimento.
duzir molibdênio.
Segundo a Sesapi, a paciente de 59 anos veio da cidade do Rio
b) é uma doença na qual o indivíduo não consegue pro- de Janeiro com sintomas do agravo, trazida pela família para tra-
duzir a enzima que se liga ao molibdênio. tamento em Teresina e desde o dia 28 de dezembro do ano pas-
c) é uma doença na qual o indivíduo produz molibdênio sado vem sendo acompanhada pelaVigilância Epidemiológica
em excesso. da Secretaria que tomou todas as providências cabíveis ao caso.
d) é uma doença na qual o indivíduo produz excesso da Nesse período, a paciente já passou por diversos hospitais,
enzima que atua como cofator do molibdênio. sendo submetida a exames e tratamentos. Hoje, está na Uni-
dade de Terapia Intensivo (UTI), com quadro instável, devido à
19. Sistema Dom Bosco C5-H17 natureza da doença degenerativa e sem tratamento para cura.
As abelhas são divididas em rainhas (férteis)  e operá- G1. Caso suspeito de doença semelhante ao ‘mal da vaca louca’ é
rias (estéreis). A larva de abelha do sexo feminino  Apis monitorado. Disponível em: <http://g1.globo.com/pi/piaui/noti-
mellifera pode se tornar operária, a abelha comum, ou ra- cia/2017/02/caso-suspeito-de-doenca-semelhante-ao-mal-da-
inha – de corpo mais longo, evolução mais rápida e vida vaca-louca-e-monitorado.html>. Acesso em: 10 jun. 2018.
mais longa. A rainha põe ovos que originam as operárias Doenças priônicas, como a doença de Creutzfeldt-
e os zangões, ou abelhas macho. Só agora cientistas des- -Jakob, são:
cobriram o fator responsável pela transformação de uma
larva de abelha comum em rainha: a proteína 57-kDa, a) derivadas do excesso de sais minerais no corpo.
presente na geleia real. Um estudo, conduzido pelo pes- b) oriundas da falta de lipídios na alimentação.
quisador Masaki Kamakura, da Universidade de Toyama, c) oriundas do excesso de consumo de carboidrato.
no Japão, descobriu que a proteína 57-kDa ativa a enzima d) derivadas de proteínas e infectam outras proteínas,
P70-S6 Kinase 1, responsável pelo aumento do tamanho alterando suas funções.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A.indd 252 08/10/18 16:34
K PHOTO
Y STOC
/ ALAM
IMAGES
BLEND

BIOLOGIA 1B

Material exclusivo para professores


conveniados ao Sistema de Ensino
CIÊNCIAS DA NATUREZA E SUAS TECNOLOGIAS

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 167 08/10/18 16:37
Material exclusivo para professores
conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1B_P3.indd 168 08/10/18 16:37
9
89 – Material do Professor 169

SUBSTÂNCIAS ORGÂNICAS:

BIOLOGIA 1B
ÁCIDOS NUCLEICOS

Durante a Primeira Guerra Mundial (1914-1918), grande número de pessoas mor-


reu por pneumonia. Dez anos após o fim do conflito, o médico militar e bacteriologista
britânico Frederick Griffith (1881-1941) foi convocado para desenvolver pesquisas so- • Composição química dos
bre um tipo de pneumonia, denominado pneumonia lobar, que atinge grande parte ácidos nucleicos
do pulmão. • Ácido desoxirribonucleico
Ao estudar a bactéria causadora dessa doença, a Streptococcus pneumoniae, (DNA)
Griffith percebeu que havia linhagens virulentas (fatais para a cobaia de estudo) e
não virulentas, uma forma mais branda que não causava a morte. HABILIDADES
Griffith ficou curioso ao notar que havia pacientes contaminados com dois ou mais • Reconhecer mecanismos
tipos de bactérias, sendo que eles só poderiam ter sido infectados com uma. Então, de transmissão da vida,
criou a hipótese de que haveria uma transformação de um tipo de bactéria em outro. prevendo ou explicando a
Em seu experimento, o pesquisador utilizou duas variantes de pneumococos: a vi- manifestação de caracterís-
rulenta, reconhecida por apresentar cápsulas constituídas de polissacarídeos, o que dá ticas dos seres vivos.
um aspecto liso à colônia de bactérias – por isso, identificada como S (do inglês smooth, • Interpretar textos, imagens,
liso); e a linhagem não virulenta, que não tem cápsulas de polissacarídeos, o que dá gráficos e esquemas dos
um aspecto rugoso à colônia, por isso identificada como R (do inglês rough, rugoso). ácidos nucleicos.
Para comprovar sua hipótese, Griffith injetou células virulentas S, mortas pelo ca- • Relacionar estrutura tridi-
lor, misturadas com células vivas da linhagem R, não virulentas. O esperado era que, mensional das moléculas
como as células virulentas estavam mortas, e as não virulentas não faziam efeito, de DNA e de RNA com as
funções por elas desempe-
os camundongos sobrevivessem. Porém, os animais morriam. Posteriormente, eram
nhadas.
encontradas células vivas da linhagem S em seus corpos.
• Compreender o que é o mé-
todo científico e reconhecer
1 3 Injeção sua importância.
Injeção
Cobaia
Cobaia morre vive

Linhagem
Linhagem S morta pelo
S viva calor

Fervura

2 Injeção 4 Bactérias da linhagem


Injeção
S vivas são isoladas de
cobaias mortas
Cobaia vive

Cobaia
morre
Mistura de
Linhagem Linhagem
linhagem S viva com

Material exclusivo para professores


R viva S viva
linhagem R morta

Diagrama com o experimento de Griffith. Ao injetar células da linhagem S, constituídas por cápsulas de

conveniados ao Sistema de Ensino


polissacarídeos, o camundongo morre (1). Por outro lado, se as células da linhagem R forem injetadas no
camundongo, ele não morrerá (2), mesmo se essas células forem mortas por aquecimento (3). Entretanto, quando o
camundongo recebe uma injeção de células mortas da linhagem S misturadas às células da linhagem R ele morre (4).
Elementos representados fora da escala de tamanho. Cores fantasia.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 169 08/10/18 16:37
170 90 – Material do Professor

Com base nesse experimento, Griffith concluiu que

123RF.COM
BIOLOGIA 1B

havia um “agente transformante” que possibilitava à li-


nhagem de células R modificar-se em linhagem S. Isso
corroborava a ideia de que não só a virulência era afeta-
da, como os tipos encontrados em um mesmo indiví-
duo eram passíveis de ter sofrido transformações.
A pesquisa de Griffith incitou outros cientistas.
Em 1944, outro grupo de pesquisadores liderado por
Oswald Avery (1877-1955) isolou uma substância con-
centrada com “poder transformante”, aplicando nela di-
versas enzimas para descobrir do que esse composto
era feito. Eles testaram algumas enzimas: amilases (que
degradam polissacarídeos); proteases (as quais degra-
dam proteínas); ribonucleases (que degradam RNA) e
dnases (as quais degradam DNA). Apenas o tratamento
com a dnase foi capaz de afetar esse “poder transfor-
mante”, concluindo então que o DNA era o responsável
pelas mudanças na virulência e no tipo, indicando que
essa molécula tinha capacidades ainda não exploradas.
P P
COMPOSIÇÃO QUÍMICA DOS
D D
ÁCIDOS NUCLEICOS A T
Os ácidos nucleicos são formados por nucleotí- P P
deos constituídos por um grupo fosfato, uma pen-
tose (monossacarídeo formado por cinco carbonos) e D D
uma base nitrogenada. C G
Se houver a retirada do grupo fosfato, essa molécula
é denominada nucleosídeo, que constitui uma forma
Esquema representando no retângulo vermelho em destaque a ligação
degradada do nucleotídeo e cuja função é reciclar os
entre os nucleotídeos do grupo fosfato (P) e a pentose (D) em uma
componentes do ácido nucleico (pentose e base nitro- molécula de DNA. Elementos representados fora da escala de tamanho.
genada) para uso na síntese de novos ácidos nucleicos. Cores fantasia.

PENTOSE
Fosfato
A pentose é um açúcar, mais especificamente um
monossacarídeo, composto de cinco átomos de car-
Nucleosídeo bono. As pentoses encontradas nos ácidos nucleicos
podem ser a desoxirribose (C5H10O4) – no DNA – e a
ribose (C5H10O5) – no RNA. A diferença entre elas é a
Base nitrogenada presença de um átomo de oxigênio a menos na deso-
xirribose.
Pentose
LILIYA623/DREAMSTIME.COM

Nucleotídeo

Os nucleotídeos são formados por um grupo fosfato, uma pentose e


uma base nitrogenada.

GRUPO FOSFATO
É originado com base no ácido fosfórico (H3PO4),

Material exclusivo para professores


por meio da perda de átomos de hidrogênio. Ele cons-
titui os ácidos nucleicos num geral, tanto ácido desoxir-
ribonucleico (DNA) quanto o ácido ribonucleico (RNA).
As ligações entre os nucleotídeos, para formar fila-

conveniados ao Sistema de Ensino


mentos maiores, ocorre entre o grupo fosfato de um
nucleotídeo e a pentose de outro nucleotídeo (durante
essa junção, há liberação de uma molécula de água). Fórmula estrutural da ribose (esquerda) e da desoxirribose (direita).

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 170 08/10/18 16:37
91 – Material do Professor 171

BASES NITROGENADAS

BIOLOGIA 1B
As bases nitrogenadas são moléculas compostas de anéis formados de carbono e nitrogênio. Essas estruturas
são classificadas em bases púricas ou purinas, constituídas por dois anéis centrais (adenina e guanina) e bases
pirimídicas ou pirimidinas, constituídas por um anel central (citosina, timina e uracila).

Bases nitrogenadas

H N H O

N C N C H
Púricas
C N C N
H C H C
C C C C
N N N N H
H N H
H H
Adenina Guanina

O O H N H
H
H C H C H C H
N C C H N C N C
Pirimídicas
C C H C C C C
O N O N H O N H
H
H H H
Timina Uracila Citosina

Bases nitrogenadas e suas fórmulas estruturais.

No DNA estão as bases nitrogenadas adenina, gua- Nas mitocôndrias e cloroplastos é encontrado um DNA
nina, citosina e timina, enquanto no RNA encontramos próprio e específico, diferente do que reside no núcleo
adenina, guanina, citosina e uracila, no lugar da timina, da célula eucariótica. Essa característica é explicada pela
constituindo uma das importantes diferenças entre o teoria endossimbiótica, como já estudado.
DNA e o RNA, conforme veremos adiante.

JACK0M/ISTOCKPHOTO.COM
Ácido desoxirribonucleico Cromossomo

(DNA)
O DNA é fundamental para a vida porque é por
meio dele que é transmitida toda a informação gené-
tica para as próximas gerações, garantindo a perpe-
tuação das espécies. Núcleo
O DNA atua no funcionamento das células e na da célula
eucariótica
produção de proteínas, por meio das quais ele con-
DNA
trola as reações e estruturas do nosso organismo.
Para tanto é capaz de duplicar-se, gerando cópias de
si mesmo. Ocasionalmente, durante este processo,
ele pode sofrer mutações, as quais produzem variabi- Esquema mostrando o nível de complexidade do enovelamento do DNA.
lidade na síntese de proteínas e, consequentemente, Elementos representados fora da escala de tamanho. Cores fantasia.
dentro de uma população. Essa variabilidade genéti-

Material exclusivo para professores


ca proveniente das mutações pode refletir em novas
características para o indivíduo, mas também confe-
rir alterações metabólicas e patogênicas.
Em células procarióticas, essa molécula é encontra-
da no citoplasma, em formato circular, sem a delimita-
ção de um núcleo verdadeiro em uma região denomi-

conveniados ao Sistema de Ensino


Em células eucarióticas, o DNA é encontrado asso- nada nucleoide. Essa característica possibilita que os
ciado às proteínas presentes no núcleo, o que dá origem procariotos tenham seu DNA mais suscetível à ocorrên-
à cromatina, em filamentos chamados cromossomos. cia de mutações.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 171 08/10/18 16:37
172 92 – Material do Professor

dos raios foi observada em um filme fotográfico em


KATERYNA KON/DREAMSTIME.COM

Nucleoide (DNA)
BIOLOGIA 1B

virtude da produção de pontos. Assim, era obtida a


posição dos átomos constituintes da molécula.

SCIENCE SOURCE/GETTY IMAGES


Representação da localização do DNA em uma célula procariótica.
Elementos representados fora da escala de tamanho. Cores fantasia.

A NATUREZA QUÍMICA DO DNA


O DNA é uma molécula formada por duas fitas
complementares (compostas do grupo fosfato), por
uma pentose do tipo desoxirribose e por combina-
ções entre as bases nitrogenadas adenina, guanina,
citosina e timina.
As fitas complementares são ligadas entre si, com-
plementando-se por meio de ligações de hidrogênio, de
maneira que 50% das bases nitrogenadas são púricas;
os outros 50% são pirimídicos, fato constatado pelo
bioquímico austríaco Erwin Chargaff (1905-2002) em Rosalind Franklin foi crucial na descoberta da estrutura do DNA.
diversas espécies.
Com base nos resultados obtidos por ela, o DNA
Organismo Adenina Timina Guanina Citosina aparentava ser longo e fino, com duas partes iguais
Ser paralelas existentes ao longo da molécula. Também se
30,4 30,1 19,6 19,9 constatou que ele tinha formato helicoidal, como repre-
humano
Carneiro 29,3 29,2 20,7 20,8
sentado na imagem abaixo.

Trigo 27,3 27,2 22,7 22,8

SCIENCE PHOTO LIBRARY


Bactéria
24,7 23,5 26,0 25,7
E. coli
Proporção de bases nitrogenadas em moléculas de DNA de diferentes
espécies (em %).

Chargaff também verificou que a quantidade de


adenina era semelhante à de timina, assim como a
quantidade de guanina era igual à de citosina, fato que
ajudou a desvendar a estrutura do DNA. Essa relação é
denominada regra de Chargaff, que pode ser expressa
da seguinte maneira:

A =T G=C ou A + G =1
T+C

DESCOBERTA DA ESTRUTURA DO DNA:

Material exclusivo para professores UMA HISTÓRIA POLÊMICA


Por volta de 1951, a cristalógrafa britânica Rosalind
Franklin (1920-1958) realizou um trabalho com difra-

conveniados ao Sistema de Ensino


ção de raios X sobre a molécula de DNA, na tentativa
Imagem obtida por Rosalind como resultado da difração do raio X sobre a
de descrever sua estrutura. Um raio X foi disparado molécula de DNA, indicando que ele poderia ter estrutura helicoidal, com
sobre o DNA em sua forma hidratada, e a dispersão duas partes paralelas iguais ao longo da molécula.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 172 08/10/18 16:37
93 – Material do Professor 173

O biólogo molecular e geneticista James Watson Portanto, a estrutura do DNA pode ser comparada a
(1928) assistiu a um seminário na universidade em que uma escada em espiral, de maneira que seu corrimão

BIOLOGIA 1B
Rosalind realizava suas pesquisas. Ela apresentou a representa os filamentos formados por ligações entre
foto da estrutura de uma molécula chamada DNA B, es- pentoses e fosfatos, e seus degraus representam as
pécie de DNA hidratado. Criticada por Watson em seus ligações de hidrogênio entre as bases nitrogenadas.
postulados, nos quais ele mencionava que ela deveria

GINTON/ISTOCKPHOTO.COM
ter correlacionado a estrutura helicoidal com a forma do
DNA, o pesquisador não se deu conta de que a própria
Rosalind deixou claro que só publicaria suas descober-
tas quando obtivesse também a imagem do DNA A,
forma menos hidratada que o B, o cerne de sua pes-
quisa. Além disso, o intuito da pesquisa da cientista era
diferente do de Watson, o qual, com seu colega Francis
Crick (1916-2004), buscava estruturar a molécula, corre-
lacionando com sua função genética.
Maurice Wilkins (1916-2004), colega de trabalho de
Rosalind, compartilhou os resultados de sua pesquisa
– sem ela saber – para Watson e Crick, o que possibi-
litou a eles completar o “quebra-cabeça” sobre como
era a estrutura do DNA. Em 1962, Wilkins, Watson e
Crick receberam o Prêmio Nobel pela descoberta da
estrutura do DNA. Rosalind morreu no anonimato, aos
37 anos, com câncer de ovário. Somente após mui-
tas décadas seu nome veio à tona, sendo reconhecida
como uma das responsáveis pela descrição da estru-
tura do DNA.
O modelo proposto por Watson e Crick foi denomi-
nado dupla-hélice, porque eles acreditavam que o DNA
era formado por dois filamentos polinucleotídicos heli- Como o grupo fosfato se encontra sempre ligado ao
coidais, unidos por ligações de hidrogênio entre as bases carbono 5 da pentose e se liga sempre ao carbono 3 da
nitrogenadas. Eles ainda propuseram que sempre have- pentose do nucleotídeo seguinte, dizemos que o sentido
ria duas ligações de hidrogênio entre adenina e timina e dos ácidos nucleicos é sempre de 5’ para 3’. Como os fi-
três ligações de hidrogênio entre guanina e citosina. lamentos são complementares, o sentido da segunda fita
será invertido em relação à sua fita complementar. Para
facilitar a compreensão, imagine que você tenha apenas
JACK0M/ISTOCKPHOTO.COM

uma fita do DNA:


Dupla-
-hélice
5’ -ATCGGGCCAATGCCC- 3’

Cromossomo A sua fita complementar será:

D D
3’ -TAGCCCGGTTACGGG- 5’
D D Fosfato
Guanina Note que elas são complementares, ou seja, o A
Pentose
D D Adenina (adenina) sempre faz par com T (timina), assim como o C
Ligações de Timina (citosina) sempre faz par com o G (guanina) e a direção
D hidrogênio
D Citosina da fita é sempre de 5’ para 3’ em ambas as fitas, mas no
5’ 3’
sentido inverso na fita complementar à primeira.

DUPLICAÇÃO DO DNA

Material exclusivo para professores


Representação do modelo de DNA dupla-hélice em que o DNA
apresenta estrutura helicoidal de dois filamentos polinucleotídicos
A duplicação ou replicação do DNA ocorre quando
enrolados entre si, formados por ligações entre fosfato e pentose, uma molécula de DNA origina outras duas moléculas
no sentido 5’ para 3’. A estrutura de dupla-hélice é estabilizada por idênticas, provenientes de seus filamentos que sepa-

conveniados ao Sistema de Ensino


ligações de hidrogênio entre as bases, sendo sempre duas ligações de
hidrogênio entre adenina e timina e três ligações de hidrogênio entre ram e servem de molde para uma nova molécula.
guanina e citosina. Elementos representados fora da escala de tamanho. Para que a duplicação possa ocorrer, existe a atuação
Cores fantasia.
de um conjunto de enzimas, descritas na tabela a seguir.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 173 08/10/18 16:38
174 94 – Material do Professor

ELLEPIGRAFICA/SHUTTERSTOCK
Enzima Função Molécula
BIOLOGIA 1B

Primase Sintetiza os iniciadores (primers) mãe


para a duplicação
DNA topoisomerases Desenrola a dupla fita
Helicase Separa a dupla fita
DNA polimerase Sintetiza a nova fita

A separação dos filamentos acontece por meio da


enzima helicase, que rompe as ligações de hidrogênio, Fitas
responsáveis pela união entre as bases nitrogenadas. originais

Com a atuação da proteína DNA topoisomerase, o fila-


mento fica em linha reta para que a helicase possa agir
corretamente, separando as fitas em duas paralelas,
facilitando o pareamento na próxima etapa.

Nucleotídeos Replicação Filamentos de DNA


Fitas
novas

3'

5'

Molécula-filha
Helicase Topoisomerase
Molécula-filha

Simultaneamente, a enzima DNA polimerase mon-


A duplicação do DNA é dita semiconservativa, por originar duas novas
ta um novo filamento usando um dos filamentos do moléculas idênticas ao DNA original, utilizando uma de suas fitas.
DNA que foi cortado pela helicase como molde. Elementos representados fora da escala de tamanho. Cores fantasia.

No início dos estudos da duplicação do DNA, foram


Filamento molde propostos vários modelos. Entre eles, três se destaca-
ram pela coerência: a duplicação era semiconservativa,
conservativa ou dispersiva.
Na duplicação semiconservativa, as duas fitas de
Novo filamento DNA se desconectam, e cada uma serve de modelo
3'
para a síntese de uma fita complementar nova. O re-
5'
sultado são duas moléculas de DNA, sendo uma fita
original e uma fita nova.
A duplicação conservativa resulta em uma molé-
cula formada por duas fitas originais de DNA (idênticas
à molécula original de DNA) e outra molécula consti-

Material exclusivo para professores


DNA polimerase
tuída de duas novas fitas (com exatamente a mesma
Os filamentos recém-sintetizados pelo DNA polime- sequência da molécula original).
rase se ligam aos filamentos originais do DNA, forman- A duplicação dispersiva resulta em duas moléculas

conveniados ao Sistema de Ensino


do duas novas moléculas idênticas. Como os filamen- de DNA, que são misturas ou “híbridas” de DNA parental
tos da molécula original se conservam, dizemos que a e da molécula-filha. Nesse modelo, cada fita individual é
duplicação do DNA é semiconservativa. uma colcha de retalhos do DNA novo e do original.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 174 08/10/18 16:38
95 – Material do Professor 175

dioativo pesado de nitrogênio, capaz de marcar o

BIOLOGIA 1B
A B C DNA desses organismos.
Durante a extração de DNA, ao serem centrifugadas
em solução de NaCℓ, perceberam que essas moléculas
formavam uma única banda no tubo. As bactérias fo-
ram transferidas para meios contendo 14N, um isótopo
radioativo leve.
Os cientistas fizeram o mesmo processo e perce-
beram que havia uma banda que ocupava uma posição
acima da apresentada na primeira etapa do experimen-
to, em virtude da menor densidade, o que evidenciava
Modelos de replicação do DNA: semiconservativo (A), conservativo (B) que uma das fitas continuava com 15
N e que a outra
e dispersivo (C).
passava a incorporar o 14
N. As bactérias foram sub-
metidas novamente a uma nova divisão no meio que
Por muito tempo não se soube qual dos três mode-
los poderia ser o mais próximo do que realmente acon- continha 14N. O resultado foi a formação de duas faixas
tece na duplicação do DNA, até que se provou que a com densidades diferentes nos tubos: uma faixa com
duplicação é semiconservativa. densidade maior, de amostras que continham filamen-
tos 14N15N, e uma faixa menos densa, de amostras que
EVIDÊNCIAS DA DUPLICAÇÃO continham filamentos 14N14N.
SEMICONSERVATIVA Deixaram, então, as bactérias se multiplicarem mais
Em 1958, os geneticistas norte-americanos Meselson
uma vez e obtiveram resultados semelhantes, entre-
e Stahl fizeram um experimento para comprovar se a
replicação do DNA era semiconservativa. Para isso, tanto, com faixa menos espessa de 14N15N do que aque-
eles deixaram bactérias E. coli se multiplicarem em la que continha filamentos 14N14N, o que indicava que a
meios de cultura contendo 15N, um isótopo não ra- duplicação do DNA era semiconservativa.

Experimento:
Qual modelo de replicação – conservativo, dispersivo ou semiconservativo – será o do DNA da E. coli?
(a) (b) (c) (d)
Métodos: Transferência para Replicação Replicação
Meio o meio contendo no meio no meio
com 15N
14
N e replicação contendo 14N contendo 14N

Centrifugação Centrifugação Centrifugação Centrifugação

14
N leve

15
N
pesado

DNA das bactérias Após replicação, o DNA Após uma segunda rodada de Amostras obtidas de rounds
cultivadas em aparece como uma única replicação, o DNA aparece em duas adicionais de replicação
Resultados: meio contendo 15N banda intermediária entre bandas, uma na posição do DNA apareceram em duas
aparecem como o esperado para o DNA híbrido (14N15N) e outra na posição do bandas, como mostrado no
uma única banda. com 15N e o DNA com 14N. DNA que continha apenas 14N. experimento (c).

Material exclusivo para professores


DNA original
Filamento Novo
parental filamento

conveniados ao Sistema de Ensino


Conclusão: A replicação do DNA em bactérias E. coli é semiconservativa.

Experimento de Meselson e Stahl em busca da comprovação de qual seria o modelo correto de replicação do DNA.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 175 08/10/18 16:38
176 96 – Material do Professor

ROTEIRO DE AULA
BIOLOGIA 1B

Ácidos nucleicos

Fosfato Pentose Base nitrogenada

Púrica Pirimídica

Ribose Desoxirribose

RNA DNA

Tipo de fita Fita dupla

Bases nitrogenadas A, G, C e T

Duplicação Semiconservativa

Mediada pelas
enzimas

Material exclusivo para professores Helicase DNA polimerase

conveniados ao Sistema de Ensino


Dom Bosco
DB_PV_2019_BIO1B_P3.indd 176 08/10/18 16:38
97 – Material do Professor 177

EXERCÍCIOS DE APLICAÇÃO

BIOLOGIA 1B
1. PUC-SP – A molécula do DNA é formada por 4. Sistema Dom Bosco – Em um experimento, foi obser-
a) uma cadeia de polipeptídios unidos por pontes de hi- vado que, no DNA de determinado organismo, o con-
drogênio. teúdo de citosina era de 30%. Assinale, no quadro abai-
xo, a alternativa que indica corretamente os percentuais
b) duas cadeias de polipeptídios dispostas como uma
de guanina, adenina e timina.
dupla hélice.
c) uma cadeia de nucleotídeos que tem capacidade de Guanina Adenina Timina
se duplicar.
a) 15% 35% 35%
d) duas cadeias de nucleotídeos unidas por pontes de
hidrogênio. b) 20% 25% 25%
e) duas cadeias de bases nitrogenadas unidas por poli- c) 30% 20% 20%
peptídios. d) 10% 10% 10%
O DNA é um ácido nucleico formado por duas cadeias de nucleo-
tídeos unidas por pontes de hidrogênio, aparentando uma dupla e) 35% 25% 10%
hélice. Essas cadeias de nucleotídeos se unem por pontes de
hidrogênio, por meio de suas bases nitrogenadas complementa- A relação das bases do DNA segue a proporção A = T e C = G.
res (A = T ; A = U ; C = G). Se 30% das bases são citosina, têm-se 30% de guanina, 20%
de adenina e 20% de timina.
2. Sistema Dom Bosco – Sobre a estrutura do DNA, é 5. Sistema Dom Bosco – São bases nitrogenadas púricas:
incorreto afirmar que: a) adenina e citosina.
a) possui estrutura bidimensional, publicada por b) adenina e guanina.
Watson e Crick.
c) guanina e citosina.
b) possui dois filamentos polinucleotídicos.
d) guanina e uracila.
c) há ligações de hidrogênio que unem as bases nitro-
genadas de ambos os filamentos.
Adenina e guanina são bases nitrogenadas púricas por conter
d) o sentido dos filamentos é sempre de 5’ para 3’. dois anéis em sua composição.
A estrutura do DNA descrita por Watson e Crick é em formato
tridimensional em dupla hélice. 6. Unicamp-SP – Considere a seguinte constatação, com
relação à duplicação de ácidos nucleicos: “o DNA pode
produzir mais moléculas iguais a si próprio”. Como se-
3. Sistema Dom Bosco – Meselson e Stahl em 1958 fize- ria explicada essa constatação, sabendo também que o
ram um experimento para descrever como seria a repli- DNA quando isolado da célula e purificado é incapaz de
cação do DNA em bactérias E. coli e eles concluíram, a realizar a sua duplicação?
partir dos resultados obtidos, que a replicação do DNA
Para ocorrer a duplicação do DNA, é necessária a atuação de
é semiconservativa. Explique o que isso significa.
A replicação do DNA é semiconservativa porque as moléculas enzimas que estão no meio celular.

originadas têm um filamento original da molécula parental e um

filamento recém-sintetizado pelo DNA polimerase.

EXERCÍCIOS PROPOSTOS

7. IFS (adaptada) – Com relação aos ácidos nucleicos, é DNA é semiconservativa?


incorreto afirmar que: a) Durante a divisão da molécula original, somente uma
a) em moléculas de DNA, não existe uracila. das fitas é copiada; a outra permanece inativa.
b) são funções dos ácidos nucleicos na célula a síntese b) No início do processo replicativo, forma-se um total
proteica e transmissão de informações genéticas. de seis fitas de DNA.
c) temos unicamente a desoxirribose como pentose.
c) As duas fitas de DNA parental são copiadas, originan-

Material exclusivo para professores


d) os RNA possuem cadeias únicas, enquanto os DNA do moléculas-filhas com somente uma das fitas.
possuem duas cadeias polinucleotídicas.
d) As enzimas que participam dos processos de replica-
e) apenas o DNA apresenta-se enrolado em hélice, o
ção são somente de origem materna.
mesmo não ocorre com o RNA.

conveniados ao Sistema de Ensino


e) No fim da replicação, cada uma das moléculas resul-
8. PUC-RS – Qual das alternativas a seguir apresenta a tantes apresenta metade do número de pontes de
informação que nos permite dizer que a replicação do hidrogênio.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 177 08/10/18 16:38
178 98 – Material do Professor

9. Sistema Dom Bosco – O ácido desoxirribonucleico, 13. Sistema Dom Bosco – Rosalind Franklin foi uma cris-
BIOLOGIA 1B

ou DNA, é considerado a molécula da vida. Por meio talógrafa que trabalhava com difração de raios X em
de sua duplicação, as características genéticas são moléculas, método que aplicou na molécula de ácido
preservadas e transmitidas aos descendentes da es- desoxirribonucleico. O que Rosalind Franklin estava ten-
pécie. Descreva a sequência de eventos que ocorre tando descobrir?
durante a duplicação do DNA. a) Como era a estrutura do DNA hidratado (DNA B)
e menos hidratado (DNA A), com enfoque nesse
último.
b) Como ocorria a replicação do DNA e sua correlação
com a genética.
c) Como era a estrutura do RNA e sua relação com es-
tudos gênicos.
d) Como era a estrutura dos ácidos nucleicos e sua cor-
10. Sistema Dom Bosco – Qual é a função da helicase e da relação com a genética.
DNA polimerase durante a replicação do DNA?
14. Fuvest-SP – Por que a duplicação do DNA é chamada
de semiconservativa?

11. IFSul-MG – No artigo publicado na revista científica 15. Unesp – Erros podem ocorrer, embora em baixa fre-
Nature, em 1953, Watson e Crick descrevem a estru- quência, durante os processos de replicação, transcri-
tura molecular do DNA, inclusive o pareamento obriga- ção e tradução do DNA. Entretanto, as consequências
tório entre a adenina (A) e a timina (T), e entre a gua- desses erros podem ser mais graves, por serem herdá-
nina (G) e a citosina (C), e afirmam: “Não escapou da veis, quando ocorrem:
nossa atenção que o pareamento específico que nós a) na transcrição, apenas.
postulamos sugere imediatamente um possível meca- b) na replicação, apenas.
nismo de cópia do material genético”. Eles sugeriram c) na replicação e na transcrição, apenas.
um modelo de como essa molécula deveria replicar.
d) na transcrição e na tradução, apenas.
Meselson e Stahl, em 1958, realizaram experimentos
utilizando isótopos de nitrogênio que foram incorpora- e) em qualquer um dos três processos.
dos às bases nitrogenadas para avaliar como se daria a
replicação da molécula. 16. IFSul-MG – Leia o texto abaixo:
Carta sobre descoberta de DNA vendida por 4 milhões de
Tais experimentos levaram à conclusão de que:
euros: em 1953, Francis Crick dirigiu uma carta ao seu fi-
a) a replicação é conservativa, isto é, as moléculas fi- lho de 12 anos para comunicar a descoberta da estrutura
lhas sintetizadas são iguais à molécula mãe. do DNA, já retratada por Wilkins e Franklin por difração
b) a replicação é dispersiva, isto é, uma molécula de de raios-X. A carta foi vendida num leilão em Nova Ior-
DNA origina duas moléculas de DNA. que, por 4 milhões de euros. Há 60 anos, Crick enviou essa
c) a replicação é semiconservativa, isto é, as moléculas missiva de sete páginas onde explicava o que era o ácido
filhas apresentam duas fitas moldes. desoxirribonucleico (DNA) e enumerava as quatro bases
d) a replicação é semiconservativa, isto é, as moléculas que o compunham, descoberta feita com seu colega James
filhas consistem de uma fita parental e uma recém- Watson, ambos ganhadores do Prêmio Nobel. Uma frase
-sintetizada. da carta diz: “cremos ter descoberto o mecanismo básico
de cópia pelo qual a vida surge da vida. Como deves ima-
12. UFRGS-RS – Cinco amostras com ácidos nucleicos ginar, estamos muito emocionados”.
foram analisadas quimicamente e apresentaram os se-
Fonte: http://www.cienciahoje.pt/index.php?oid=574428op=all.
guintes resultados:
I. 1a amostra: ribose; A partir dos seus conhecimentos e tendo por base a
II. 2a amostra: timina; descoberta abordada no texto apresentado, assinale a
alternativa correta.
III. 3a amostra: dupla hélice;
a) O DNA é composto por quatro bases nitrogenadas,
IV. 4a amostra: uracila;
que apresentam proporções iguais entre si.
V. 5a amostra: 20% de guanina e 30% de citosina.
b) As bases nitrogenadas do DNA são: A (adenina),

Material exclusivo para professores


Entre essas amostras, quais se referem a DNA? U (uracila), G (guanina) e C (citosina).
a) Apenas I e II. c) Após essa descoberta, foi confirmada a previsão de
b) Apenas I e III. muitos cientistas, que atribuíam às proteínas a porta-
bilidade dos fatores genéticos.
c) Apenas II e III.

conveniados ao Sistema de Ensino


d) O modelo proposto por Crick e Watson retratava uma
d) Apenas II e IV. estrutura tridimensional do DNA, na qual duas cadeias
e) Apenas II e V. helicoidais se enrolavam em torno do mesmo eixo.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 178 08/10/18 16:38
99 – Material do Professor 179

17. Sistema Dom Bosco – Griffith realizou um experimento

BIOLOGIA 1B
em 1928 para tentar descobrir o que tornava a linhagem
de E. coli virulenta fatal para o camundongo e sua hi-
pótese era de que poderia ser a presença da cápsula
de polissacarídeos. Para isso, Griffith matou algumas
células virulentas por aquecimento e as injetou em ca-
mundongos. Eles sobreviveram, o que permitiu concluir
que as cápsulas de polissacarídeos não provocavam a
morte. Contudo, ao injetar células virulentas mortas
pelo calor misturadas com células vivas da linhagem
não virulenta, os camundongos morriam e eram encon-
tradas células vivas da linhagem virulenta.
Descreva qual é a importância do experimento de Griffith.

ESTUDO PARA O ENEM


18. Sistema Dom Bosco C5-H15
Em 1950, Erwin Chargaff e colaboradores estudavam a
composição química do DNA e observaram que a quanti- a) G G G C T T C G
dade de adenina (A) é igual à de timina (T), e a quantidade
de guanina (G) é igual à de citosina (C) na grande maioria C C G G A A G C
das duplas fitas de DNA. Em outras palavras, esses cien-
tistas descobriram que o total de purina (A + G) e o total
de pirimidinas (C + T) eram iguais. Um professor traba- b) C C T C G A C T
lhou esses conceitos em sala de aula e apresentou como
exemplo uma fita simples de DNA com 20 adeninas, 25
G G A G C T G A
timinas, 30 guaninas e 25 citosinas.
Qual a quantidade de cada um dos nucleotídeos, quan-
do considerada a dupla fita de DNA formada pela fita c) A A T T C C T A

simples exemplificada pelo professor?


T T A A G G A T
a) Adenina: 20; Timina: 25; Guanina: 25; Citosina: 30.
b) Adenina: 25; Timina: 20; Guanina: 45; Citosina: 45.
c) Adenina: 45; Timina: 45; Guanina: 55; Citosina: 55. d) T T A C G G C G

d) Adenina: 50; Timina: 50; Guanina: 50; Citosina: 50.


e) Adenina: 55; Timina: 55; Guanina: 45; Citosina: 45. A A T G C C G C

19. Enem C2-H17


e) C C T A G G A A
A reação em cadeia da polimerase (PCR, na sigla em
inglês) é uma técnica de biologia molecular que permite
G G A T C C T T
replicação in vitro do DNA de forma rápida. Essa técnica
surgiu na década de 1980 e permitiu avanços científicos
em todas as áreas de investigação genômica. A dupla 20. Sistema Dom Bosco C5-H13
hélice é estabilizada por ligações de hidrogênio, duas Em nosso intestino delgado, as moléculas do DNA (áci-
entre as bases adenina (A) e timina (T) e três entre as do desoxirribonucleico) presentes no alimento são dife-
bases guanina (G) e citosina (C). Inicialmente, para que ridas e originam:
o DNA possa ser replicado, a dupla hélice precisa ser
a) apenas aminoácidos.
totalmente desnaturada (desenrolada) pelo aumento da
temperatura, quando são desfeitas as ligações de hidro- b) fosfato, glicídio e bases nitrogenadas.
gênio entre as diferentes bases nitrogenadas. c) glicídio, bases nitrogenadas e aminoácidos.
Qual dos segmentos de DNA será o primeiro a desna- d) RNA transportador, RNA mensageiro e RNA ribossômico.
turar totalmente durante o aumento da temperatura na e) átomos livres de carbono, nitrogênio, oxigênio, hidro-
reação de PCR? gênio e fósforo.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1B_P3.indd 179 08/10/18 16:38
10
180
BIOLOGIA 1B 100 – Material do Professor

SUBSTÂNCIAS
ORGÂNICAS: RNA

Os defensores da hipótese denominada “mundo do ácido ribonucleico (RNA)”


alegam que esta deve ser a “molécula da vida” por ser extremamente versátil. Esse
• Ácido ribonucleico (RNA) modelo de vida foi lançado por Walter Gilbert, vencedor do prêmio Nobel de Química
em 1980.
HABILIDADES
Além de armazenar informação genética em algumas espécies menos complexas
• Reconhecer mecanismos
(que não precisam necessariamente de um envoltório nuclear), de possuir apenas
de transmissão da vida,
prevendo ou explicando a
uma fita que é capaz de guardar informação genética e de estar presente em todos
manifestação de caracterís- os seres vivos, o RNA exibe atividade enzimática, função que em geral cabe às pro-
ticas dos seres vivos. teínas, como vimos anteriormente.
• Interpretar textos, imagens, O RNA com esse papel duplo foi chamado de ribozima em 1989 pelo bioquímico
gráficos e esquemas dos estadunidense Thomas Cech, laureado com o Nobel de Química juntamente com o
ácidos nucleicos. cientista Sidney Altman por essa descoberta.
• Relacionar a estrutura No entanto, cientistas levantaram alguns problemas com essa hipótese. O primei-
das moléculas de dife- ro é que a atividade enzimática da ribozima está associada à sua ação como trans-
rentes classes de RNA
portadora da informação genética, portanto isso seria uma especialização funcional,
com as funções por elas
desempenhadas. como um “acessório” integrado ao sistema de transcrição da informação genética
contida no DNA, ao contrário do que é proposta na hipótese de que a ribozima teria
somente função enzimática. Essa propriedade é diferente da mostrada pelas enzimas
proteicas, que promovem melhor e mais variado a catálise.
O segundo problema é que não há ribozimas nos organismos procariotos (sem
núcleo), que, acredita-se, antecederam os eucariotos e continuam a viver com seu
RNA sem atividade enzimática.
Há, ainda, o problema que diz respeito à síntese do RNA em um cenário primitivo.
Mesmo com os recursos dos laboratórios atuais, a síntese do RNA não é simples,
pois exige condições muito especiais.
Entretanto, recentemente, um grupo de pesquisa da Inglaterra propôs uma
estratégia de síntese de RNA que poderia ocorrer no cenário da Terra primitiva,
usando como substâncias precursoras o glicolaldeído e o gliceraldeído. Os pes-
quisadores conseguiram produzir os ribonucleotídeos (compostos que, unidos em
longa cadeia, constituem o RNA) com boa eficiência. Mesmo assim, concluíram
que, para tornar possível a síntese do RNA, seria necessário que a Terra primitiva
tivesse fontes de glicolaldeído e de gliceraldeído, o que não ajuda muito a causa
da primazia do RNA.

ÁCIDO RIBONUCLEICO (RNA)


O ácido ribonucleico ou RNA é uma molécula originada a partir do molde de uma

Material exclusivo para professores


das fitas do ácido desoxirribonucleico (DNA), capaz de transcrever informações
contidas nele e levá-las para o citoplasma, de maneira que essas informações serão
traduzidas nos ribossomos e se transformarão em proteínas.

conveniados ao Sistema de Ensino


Sendo produzida a partir do DNA, ela também é uma cadeia polinucleotídica, po-
rém simples, possuindo apenas uma fita, capaz de dobrar-se em torno de si mesma,
mas sem emparelhar suas bases entre si.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 180 08/10/18 16:38
101 – Material do Professor 181

Nos seres procarióticos, o RNA é encontrado junto


aos ribossomos e disperso no citoplasma. Já nos vírus,

BIOLOGIA 1B
METKALOVA/ISTOCKPHOTO.COM G U A
G
o RNA está contido no interior da cápsula proteica.
G sem C
G A C
retranca
A
Ligação de hidrogênio
C Camada de lipídios
C U
A

KATERYNA KON/SHUTTERSTOCK
A A
U U
U A G RNA
G
C U
A A Envelope
G
U
proteico
U C
G
G G
G
U A
A A
A
A
Bases

C
Fosfato
A C G
A Enzimas
G

Esquema da estrutura de uma partícula de vírus influenza, que possui o


Representação dos dobramentos em uma molécula genérica de RNA. RNA como material genético. Elementos representados fora da escala
Diferentemente do DNA, o RNA não segue uma conformação predefinida. de tamanho. Cores fantasia.
Elementos representados fora da escala de tamanho. Cores fantasia.

A molécula de RNA possui em sua conformação um DNA RNA


grupo fosfato e uma pentose (ribose) e dispõe de bases
nitrogenadas: adenina, guanina, citosina e uracila. Tipo de fita Dupla Simples

DNA-molde RNA Citoplasma Bases Adenina, guanina, Adenina, guanina,


Transcrição
nitrogenadas citosina e timina citosina e uracila
Tradução
(ribossomos) Tipo de
Desoxirribose Ribose
pentose
Eucariotos: Eucariotos:
Proteínas núcleo, mitocôndrias citoplasma,
e cloroplastos. núcleo, retículo
Em seres eucarióticos essa molécula pode ser encon- endoplasmático
trada no núcleo, constituindo o nucléolo, e junto à croma- rugoso, ribossomos,
tina, em menor quantidade. Também pode ser encontrada Localização mitocôndrias,
dispersa no citoplasma como componente estrutural dos cloroplastos.
ribossomos, aderidos às membranas do retículo endo- Procariotos: Procariotos:
plasmático rugoso e nas mitocôndrias e nos cloroplastos. citoplasma, formato citoplasma,
circular. ribossomos.
PHANIE/ALAMY STOCK PHOTO

TIPOS DE RNA
Há diversos tipos de RNA, cada um com função
diferente. Entre eles, os mais importantes são o
RNA mensageiro (mRNA), o RNA transportador
A (tRNA) e o RNA ribossômico (rRNA).

Material exclusivo para professores


RNA mensageiro (mRNA)
É uma molécula de fita simples produzida a partir
B
de um processo denominado transcrição, do qual um

conveniados ao Sistema de Ensino


dos filamentos do DNA foi utilizado como molde. Ele
Eletromicrografia de célula humana. Em células eucarióticas o RNA pode
estar presente no nucléolo (A) ou disperso no citoplasma (B). Aumento contém as informações necessárias para a formação
desconhecido. de proteínas.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 181 08/10/18 16:38
182 102 – Material do Professor

RNA ribossômico (rRNA)


BIOLOGIA 1B

mRNA Forma-se a partir da região organizadora do nucléo-


lo, presente em alguns cromossomos, e tem como fun-
Enzimas ção associar-se às proteínas que constituem a estrutura
dos ribossomos e orientar o mRNA e o tRNA durante a
síntese de proteínas.

CHIRAWAN SOMSANUK/DREAMSTIME.COM
Proteína
DNA #molde
Transcrição Aminoácido

rRNA
Formação do mRNA. Elementos fora de escala de tamanho. Cores fantasia.

RNA transportador (tRNA)


Molécula de fita simples, variando entre 80 e 100 tRNA
nucleotídeos dobrados entre si em aspecto de folha de
trevo, igualmente produzido a partir de um dos filamen-
tos do DNA. Uma de suas alças é denominada anticó-
don porque é complementar a uma trinca de nucleotí-
deos encontrada no RNA mensageiro (mRNA).
mRNA
Cada trinca de nucleotídeos forma um aminoácido Códon
específico. Certas combinações de trincas de nucleotí-
deos acabam por produzir o mesmo aminoácido, porém
é imprescindível que essa trinca contenha a informação Os três principais tipos de RNA trabalham juntos para formar uma proteína.
correta, pois erros de apenas uma base nitrogenada Elementos fora de escala de tamanho. Cores fantasia.
podem gerar um aminoácido diferente que irá interferir
na produção de determinada proteína que é necessária O rRNA faz parte da estrutura dos ribossomos, en-
para a homeostase do corpo. Esse RNA, portanto, tem quanto o mRNA é lido por essa estrutura, e o tRNA
como função transportar os aminoácidos para que haja transporta os aminoácidos para que ocorra a síntese
a síntese de proteínas e, por isso, há em torno de 20 de proteína.
tipos de tRNA, uma vez que existem 20 aminoácidos
na natureza. LEITURA COMPLEMENTAR
Outros tipos de RNA
TTSZ/ISTOCKPHOTO.COM

Além dos mRNA, tRNA e rRNA, há várias outras classes


de RNA presentes nos núcleos das células eucarióticas.
Os pequenos RNA nucleares (snRNA) combinam-
-se com subunidades proteicas para formar pequenas
ribonucleoproteínas nucleares (snRNP, ou snurps). Há
também os pequenos RNA nucleolares (snoRNA), que
participam do processamento do rRNA. Já os pequenos
RNAs presentes no citoplasma das células eucarióticas
são denominados scRNA. Os microRNA (miRNA) e
os pequenos RNA de interferência (siRNA) atuam na
degradação do mRNA, inibindo a síntese de proteínas.
Além de todas essas classes, há o RNA de interação Piwi
(piRNA), uma molécula não codificante que interage
com proteínas do tipo Piwi, encontrado nos testículos
dos mamíferos, e provavelmente atua na regulação e no
desenvolvimento dos espermatozoides.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1B_P3.indd 182 08/10/18 16:38
103 – Material do Professor 183

ROTEIRO DE AULA

BIOLOGIA1B
BIOLOGIA
RNA

Bases
Origem Fita do tipo Tipos
nitrogenadas

Adenina
DNA Simples
mRNA tRNA rRNA
Uracila

Citosina
Localização Guanina
Síntese Transporte Estrutura
de: de: do:

Em eucariotos: Em procariotos: Proteínas Aminoácidos Ribossomo

Retículo endoplasmático Citoplasma

granular

Ribossomos
Ribossomos

Núcleo

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1B_P3.indd 183 08/10/18 16:38
184 104 – Material do Professor

EXERCÍCIOS DE APLICAÇÃO
BIOLOGIA 1B

1. Sistema Dom Bosco – Sobre o RNA é correto afirmar que: Então:


a) possui fita dupla. a) todas são verdadeiras.
b) contém timina em sua estrutura. b) somente I e II são verdadeiras.
c) é originado a partir do DNA, em um processo deno- c) somente I e III são verdadeiras.
minado tradução. d) somente II e III são verdadeiras.
d) atua na síntese de proteínas. e) apenas uma das afirmações é verdadeira.
O RNA possui fita simples, contém uracila em sua estrutura e é originado a Os nucleotídeos são as unidades que formam os ácidos nucleicos (DNA e
partir do DNA em um processo denominado transcrição. RNA). O RNA é uma cadeia simples de nucleotídeos, ao contrário do DNA, que
é uma cadeia dupla de nucleotídeos.
2. Sistema Dom Bosco – A molécula de RNA é encontra- Existem cinco tipos de bases nitrogenadas compondo os nucleotídeos: a
adenosina (A), a timina (T), a uracila (U), a guanina (G) e a citosina (C).
da em eucariotos nos seguintes locais, exceto: Os nucleotídeos que apresentam uracila como base nitrogenada são exclusivos
a) retículo endoplasmático liso. da molécula de RNA, bem como os nucleotídeos que apresentam timina como
base nitrogenada são exclusivos da molécula de DNA.
b) núcleo.
6. Sistema Dom Bosco – Observe a seguir o quadro com-
c) ribossomo. O RNA é encontrado no retículo endoplasmáti- parativo de DNA e RNA.
d) citoplasma. co rugoso, onde há ribossomos.

3. Sistema Dom Bosco – No início do século XX foram DNA RNA


identificados dois tipos de ácidos nucleicos: o ácido de- Açúcar
soxirribonucleico (DNA) e o ácido ribonucleico (RNA). Desoxirribose Ribose
Descreva a estrutura do RNA.
(pentose)
O RNA é um ácido nucleico de fita simples, composto das bases nitrogena-
Adenina Adenina
Bases Guanina Guanina
das adenina, guanina, citosina e uracila. nitrogenadas Citosina Citosina
Uracila Timina
Filamento Simples Duplo
Núcleo, mitocôndria, Núcleo, citoplasma
cloroplasto e ribossomos
(eucariotos), (eucariotos), livre
Localização citoplasma no citoplasma
4. Acafe-SC – Com relação às moléculas de ácido ribonu-
cleico (RNA), é correto afirmar que:
(procariotos). e associado
a) são poliésteres de desoxirribose.
a ribossomos
(procariotos).
b) têm estrutura primária helicoidal dupla.
c) são as mesmas do ácido desoxirribonucleico.
Identifique o(s) erro(s) cometido(s) e justifique sua
d) formam hélices duplas polirribonucleotídeos.
resposta.
e) são hélices simples de polirribonucleotídeos.
O ácido ribonucleico (RNA) é formado por uma cadeia O erro está presente no campo filamento, já que o DNA tem filamento
simples (uma hélice simples) de polímeros de ribonucleotídeos.
5. Mack-SP – Considere as afirmações abaixo a respeito duplo e o RNA, filamento simples.
dos ácidos nucleicos.
I. Nucleotídeos são as unidades que os constituem.
II. O RNA é formado por uma sequência simples de nu-
cleotídeos.
III. Só o RNA apresenta a uracila em sua formação.

EXERCÍCIOS PROPOSTOS
7. IFS (adaptada) – Com relação aos ácidos nucleicos, é 8. IFSul-RS – Podemos dizer que toda vida na Terra é a
incorreto afirmar que: mesma vida, isso porque os ácidos nucleicos, DNA e
a) em moléculas de DNA, não existe uracila. RNA, são a base molecular de todos os organismos vi-
b) são funções dos ácidos nucleicos na célula a síntese vos. Uma das diferenças significativas entre os ácidos

Material exclusivo para professores


proteica e a transmissão de informações genéticas. nucleicos DNA e RNA é a:
c) temos unicamente a desoxirribose como pentose.
a) ribose no RNA e pentose no DNA.
d) o RNA possui cadeias únicas, enquanto o DNA pos-
b) uracila no DNA e timina no RNA.
sui duas cadeias polinucleotídicas.

conveniados ao Sistema de Ensino


e) apenas o DNA apresenta-se enrolado em hélice; o c) timina no DNA e uracila no RNA.
mesmo não ocorre com o RNA. d) ribose no RNA e uracila no DNA.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 184 08/10/18 16:38
105 – Material do Professor 185

9. Unisanta-SP – Na hidrólise de ácidos nucleicos, as ba- 15. UFSCar-SP – Um pesquisador interessado em produ-

BIOLOGIA 1B
ses pirimídicas produzidas pelo RNA são: zir, em tubo de ensaio, uma proteína nas mesmas con-
a) citosina e guanina. dições em que essa síntese ocorre nas células utilizou
ribossomos de células de rato, RNA mensageiro de
b) adenina e uracila.
células de macaco, RNA transportador de células de
c) citosina e timina. coelho e aminoácidos ativos de células de sapo. A pro-
d) adenina e timina. teína produzida teria uma sequência de aminoácidos
e) citosina e uracila. idêntica à do:
a) rato.
10. UFU-MG – As moléculas de DNA formam, pelo menos, b) sapo.
3 tipos diferentes de RNA, cujas funções são de grande
c) coelho.
importância para a célula viva. Quais são eles e que pa-
pel desempenham no metabolismo celular? d) macaco.
e) macaco e do rato.

16. Fuvest-SP (adaptada) – Um pesquisador está traba-


lhando em um projeto na tentativa de fazer compara-
ções entre as moléculas de DNA e RNA. Assinale a al-
ternativa que melhor represente diferenças entre essas
moléculas.
a) Presença de timina no DNA e uracila no RNA.
b) Ribose no DNA e desoxirribose no RNA.
c) Grupo fosfato marcado.
d) Quantidade de guanina e citosina maior no DNA do
que no RNA.

17. PUC-SP (adaptada) – O corante I é específico para


11. Sistema Dom Bosco – Entre as opções a seguir, mar- DNA, e o corante II, para RNA. Um pesquisador usou
que aquela que indica qual dos tipos de RNA é respon- esses dois corantes em células fixadas e observou sua
sável pela síntese de proteínas. ação sobre algumas organelas citoplasmáticas.
a) RNA mensageiro. Assinale, no quadro a seguir, a alternativa que represen-
b) RNA transportador. ta os possíveis resultados obtidos por esse pesquisador
c) RNA ribossomal. (o sinal + significa reação positiva, e o sinal -, negativa).
d) RNA de interferência. Depois, justifique sua resposta.

12. Sistema Dom Bosco – Entre as opções a seguir, mar-


Complexo
que aquela que indica qual dos tipos de RNA é respon- Ribossomo Mitocôndria
sável pelo transporte de aminoácidos. golgiense
a) RNA nuclear. Corante Corante Corante Corante Corante Corante
b) RNA mensageiro. I II I II I II
c) RNA transportador.
a) + + + – – –
d) RNA ribossomal.
b) + + – + + –
13. Sistema Dom Bosco – Entre as opções a seguir, mar-
que aquela que indica qual dos tipos de RNA é respon- c) + – – + – +
sável pela constituição estrutural dos ribossomos.
a) RNA transportador. d) – + – – + +
b) RNA ribossomal. e) – + + + + –
c) RNA mensageiro.
d) RNA de interferência.

14. Sistema Dom Bosco – Cite onde está localizado o RNA


em seres procarióticos.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1B_P3.indd 185 08/10/18 16:38
186 106 – Material do Professor

ESTUDO PARA O ENEM


BIOLOGIA 1B

18. Sistema Dom Bosco C2-H13 ao retículo endoplasmático, recebendo a denominação de


Um estudo publicado pela revista Science [...] mostra uma retículo granular. Quando participam da síntese celular,
maneira de editar o RNA, material genético responsável essas estruturas permanecem agrupadas [...] formando os
pela transmissão de informação entre o DNA e o maqui- polissomos.
nário produtor de proteína dentro das células.
RIBEIRO, Krukemberghe. Ribossomos. Brasil Escola.
Trata-se de um novo avanço usando um recurso recém-des- Disponível em: <https://brasilescola.uol.com.br/biologia
coberto que tem abalado o meio científico: o Crispr (pro- /ribossomos.htm>. Acesso em: 25 jul. 2018.
nuncia-se ‘crísper’), um método para editar código genético A molécula na qual os ribossomos permanecem agrupa-
por meio de moléculas usadas por microrganismos para im- dos é chamada de:
pedir a invasão de vírus e que, a partir dessa nova pesquisa,
pode ajudar também a reescrever código RNA. O recurso já a) RNA de interferência.
vem sendo experimentado para a edição de DNA, dando- b) RNA transportador.
-lhe determinadas características desejadas pelos cientistas. c) RNA ribossomal.
G1. Cientistas descobrem maneira de editar RNA em células. d) RNA mensageiro.
<https://g1.globo.com/ciencia-e-saude/noticia/
cientistas-descobrem-maneira-de-editar-rna-em-celulas.ghtml>. 20. Sistema Dom Bosco C8-H13
Acesso em: 25 jun. 2018. Adaptado.
O ácido ribonucleico (RNA) é formado a partir de um
O texto cita o ácido ribonucleico, uma molécula que: molde de DNA e possui fita simples, formado por nu-
a) é originada a partir de uma molécula de DNA. cleotídeos compostos de uma pentose (ribose), uma
base nitrogenada (adenina, uracila, guanina e citosina)
b) possui fita dupla.
e um grupamento fosfato. Como é chamado o processo
c) é encontrada somente em bactérias. que origina o RNA?
d) não tem a capacidade de produzir aminoácidos. a) Transcrição.
b) Tradução.
19. Sistema Dom Bosco C8-H28
Os ribossomos são grânulos livres imersos no hialoplasma c) Transdução.
das células procarióticas e eucarióticas e também aderidos d) Replicação.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1B_P3.indd 186 08/10/18 16:38
11
107 – Material do Professor 187

TRANSCRIÇÃO:

BIOLOGIA 1B
PROCESSAMENTO DO RNA

Considerado o menor tamanduá

JOÃO MARCOS ROSA/NITRO IMAGENS/LATINSTOCK


do mundo, o tamanduaí (Cyclopes
didactylus), ou tamanduá-anão, é • Do gene à proteína
um pequeno e discreto exemplar • Transcrição: síntese do
da ordem Pilosa, a mesma do pri- RNA controlada pelo DNA
mo grandalhão tamanduá-bandeira • Modificação no RNA após
(Myrmecophaga tridactyla) e do pe- a transcrição em células
eucarióticas
queno tamanduá-mirim (Tamandua
tetradactyla), que pode ser visto no HABILIDADES
chão ou nas árvores. • Compreender as interações
De hábitos arborícolas, o taman- genéticas entre DNA e
duaí alimenta-se de insetos, assim RNA, que determinam a
como os outros parentes, mas pre- produção de proteínas nos
fere fincar seus pés redondos (que seres vivos.
inspiraram o nome científico) nos • Sequenciar etapas que
compõem o processo de
galhos das árvores, onde se prende
síntese proteica.
usando a longa cauda preênsil em
• Interpretar modelos para
vez da majestosa cauda do taman- explicar a manifestação
duá-bandeira. das características dos
Até pouco tempo, acreditava-se seres vivos.
que havia uma única espécie de taman-
duaí espalhada desde a América Cen-
tral até o sul da Amazônia e em uma Exemplar de tamanduaí (Cyclopes didactylus) encontrado
em área de desmatamento na Floresta Nacional de Carajás,
pequena parte do litoral nordestino. em Parauapebas, Pará.
Em um estudo publicado em
2017 no Zoological Journal of the Linnean Society, pesquisadores brasileiros demons-
traram, com base em análises feitas em um período de dez anos, que existem outras
sete espécies de tamanduaís nessas regiões, e duas dessas espécies estão restritas a
regiões muito afetadas pelo desmatamento.
“Existem diferenças de coloração dos membros anteriores e posteriores e do dor-
so”, afirma a pesquisadora Flávia Miranda, autora principal do artigo. “Alguns têm pre-
sença de faixa ventral e outros, não. E alguns têm diferenças de caracteres, que a gente
chama de caracteres discretos, com o crânio um pouco mais arredondado”, completa.
Para que haja variações tão claras quanto a cor da pelagem e a forma do crânio obser-
vadas nas espécies do tamanduaí, as mutações ocorridas no ácido desoxirribonucleico
(DNA), de modo geral, modificaram toda a estrutura e o processo de síntese de proteínas,
afetando nesse processo o “alfabeto” contido nos ácidos rubonucleicos (RNAs) – isto é, a

Material exclusivo para professores


ordem dos nucleotídeos contidos nele e em suas proteínas. Como consequência, essas
populações podem ser suficientemente diferenciadas em nível genético para representar
uma significativa unidade evolutiva, ou seja, uma espécie diferente de outras.

conveniados ao Sistema de Ensino


Esse exemplo ilustra o ponto principal que estudaremos: o DNA herdado por um or-
ganismo é responsável por características específicas uma vez que determina a síntese
de proteínas e de RNA envolvidas na síntese proteica.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 187 08/10/18 16:38
188 108 – Material do Professor

Do gene à proteína
BIOLOGIA 1

Para formar proteínas, é necessário que a informação existente no DNA seja lida
e passada para uma molécula intermediária, o RNA. Posteriormente, o RNA será lido
por ribossomos e, assim, constituirá a proteína montada, que produzirá um fenótipo
específico, isto é, a expressão de uma característica como a cor dos cabelos ou a
produção de uma proteína que atue em um processo bioquímico específico.
O fenótipo é determinado por regiões específicas no DNA, onde estão as
informações necessárias para produzir cada tipo de proteína. Essas regiões co-
dificantes são denominadas genes e constituem o genótipo.

DNA (gene) proteína

expressão da
característica

A expressão gênica é o processo em que o DNA coordena a síntese de proteínas


(ou, em alguns casos, apenas de RNA).
Imagine que a molécula de DNA é uma estante de biblioteca e cada livro é o gene
que terá a informação específica para gerar apenas uma proteína. Por conta disso, é
comum dizer que, se há gene, há uma proteína.
MAXIPHOTO/ISTOCKPHOTO.COM

Se o DNA fosse uma biblioteca, cada gene corresponderia a um livro.

No entanto, as proteínas só podem ser geradas a partir de regiões codifican-


tes. Existem outras regiões no DNA que são denominadas não codificantes ou junk
DNA (DNA lixo; apesar do nome, essas regiões não são inúteis ou descartáveis), que
são responsáveis pela regulação da expressão dos genes, ativando-os ou inibindo-os;
aliás, a maior porção do nosso DNA (mais de 80%) é composto deles. Essas regiões
podem ser comparadas às atas das bibliotecas, que servem apenas para controle dos
funcionários e raramente teremos acesso a elas.
A expressão de genes que codificam proteínas é dividida em dois estágios: a
transcrição e a tradução. Esta última será estudada posteriormente.

Transcrição: síntese do RNA controlada


pelo DNA
Apesar de os genes fornecerem as informações para a produção de proteínas

Material exclusivo para professores


específicas, eles não constroem diretamente uma proteína. A ponte entre o DNA e a
síntese proteica é o RNA.
A leitura do DNA, ou seja, a leitura dos seus componentes, mais especificamente das
suas bases nitrogenadas (adenina, guanina, citosina e timina) resultará em uma mensa-

conveniados ao Sistema de Ensino


gem, o RNA mensageiro; quando essa mensagem for lida, ela resultará na sequência de
aminoácidos na proteína. Para isso, o RNA mensageiro (mRNA) é produzido a partir de

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 188 08/10/18 16:38
109 – Material do Professor 189

uma fita molde de DNA, sendo complementar a esta última molécula. Esse processo é
denominado transcrição, a síntese de RNA sob o controle do DNA.

BIOLOGIA 1
Como visto anteriormente, o RNA é quimicamente similar ao DNA, com algumas
ressalvas que o caracterizam especificamente, como: a base nitrogenada uracila em
vez de timina; uma ribose em vez de uma desoxirribose e possuir apenas uma fita em
vez de duas. Assim, cada nucleotídeo ao longo de uma fita de DNA apresenta: adeni-
na, guanina, citosina e timina como base nitrogenada, e cada nucleotídeo ao longo de
uma fita de RNA apresenta adenina, guanina, citosina e uracila.
Como pudemos observar, existem algumas palavras novas que foram enuncia-
das nesta introdução do processo de síntese proteica. Esses termos fazem parte
do vocabulário genético e serão fundamentais para que entendamos as etapas do
mecanismo em si. São eles:
• Complementariedade
Essa palavra é utilizada para indicar como a leitura do DNA é feita e como é gerado
o RNA. Lembre-se de que o DNA possui dois filamentos, compostos de nucleotídeos
que se pareiam de acordo com suas bases nitrogenadas, seguindo a ordem: adenina-
-timina e citosina-guanina.
Observe a molécula de DNA com sua fita correspondente representada a seguir:

ACTTGACCATGCA Filamento 1

TGAACTGGTACGT Filamento 2

Suponha que o filamento 2 seja utilizado como molde para formar a molécula
de mRNA.

ACTTGACCATGCA DNA

T GA AC T G G TAC G T

ACUUGACCAUGCA mRNA

Observe que a sequência do RNA mensageiro (mRNA) é complementar à sequên-


cia do DNA, do qual foi originada, e apenas a timina foi substituída por uracila. Tanto
o DNA como o RNA utilizam a mesma linguagem química e a informação é simples-
mente transcrita, ou copiada, de uma molécula à outra. Portanto, o mRNA carrega a
mensagem genética do DNA até a maquinaria de síntese proteica da célula.
Da mesma maneira que o filamento de DNA serve de molde para a síntese do novo
filamento complementar durante a duplicação do DNA, ela também é usada como mol-
de para a formação de uma sequência complementar de nucleotídeos de RNA.
• Transcrição
A transcrição está presente nos três domínios da vida: Bacteria, Archaea e Eukarya.
Nos eucariotos, esse processo acontece no núcleo, onde a enzima RNA-polimerase
separa as duas fitas de DNA e une os nucleotídeos de RNA à medida que formam pares
de bases ao longo da cadeia molde de DNA. Essa enzima só atua na direção 5’ ⇒ 3’.
Os mecanismos básicos da transcrição são os mesmos em procariotos e eu-
cariotos, mas como os domínios Bacteria e Archaea não apresentam membrana

Material exclusivo para professores


delimitando o núcleo de suas células (característica que define a célula eucariótica),
o seu DNA não está separado dos ribossomos e de outras estruturas envolvidas na
síntese de proteínas. Nesse caso, a transcrição ocorre no próprio citoplasma, tam-
bém com a atuação da RNA-polimerase.

conveniados ao Sistema de Ensino


A maioria dos estudos atuais acerca da transcrição foi realizada em bactérias e em cé-
lulas eucarióticas, o foco de nosso estudo. Todavia, vale destacar que pesquisas recentes

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 189 08/10/18 16:38
190 110 – Material do Professor

sobre esse processo em arqueas demonstraram que existe uma única RNA-polimerase
em suas células que difere consideravelmente da RNA-polimerase encontrada nas bac-
BIOLOGIA 1

térias, mas é similar às três RNA-polimerases encontradas em eucariotos. Além disso,


eucariotos e arqueas possuem um complexo conjunto de fatores de transcrição, diferen-
temente das bactérias. As poucas informações sobre o término da transcrição de arqueas
demonstram maior similaridade com o término de eucariotos que de bactérias.
• Genes
O gene é um segmento de uma molécula de DNA que contém um código para
a produção dos aminoácidos da cadeia polipeptídica e as sequências reguladoras
para a expressão, embora, como dito anteriormente, haja regiões não codificantes,
ou seja, que não codificam mensagem nenhuma para produção de uma proteína.
As sequências codificantes são chamadas de éxons. Elas são intercaladas por re-
giões não codificantes, chamadas de íntrons, que são retiradas para a preparação do
pré-RNAm por meio de um processo chamado splicing, deixando o RNAm apenas com
a região que de fato possui sequências que codificarão proteínas. Em muitos genes, o
tamanho cumulativo dos éxons é muito menor que o de íntrons.
Em um gene que codifica uma proteína, a molécula de RNA resultante equivale à
informação transcrita para a construção da proteína do gene, assim como as informa-
ções contidas na página de um livro que, como um transcrito, podem ser reproduzi-
das em quantas cópias for necessário.

ETAPAS DA TRANSCRIÇÃO
A transcrição possui três etapas: iniciação, alongamento e término.
A iniciação acontece quando a enzima helicase rompe as ligações de hidrogênio
das fitas desenroladas por topoisomerases de DNA. A RNA-polimerase reconhece o
trecho promotor, uma sequência específica de nucleotídeos ao longo da fita de DNA
que marcam onde é iniciada a transcrição. A faixa de DNA transcrita na fita de RNA é
denominada unidade de transcrição.
O alongamento é a fase em que a RNA-polimerase desloca-se sob o fi-
lamento molde do DNA, percorrendo a dupla-hélice, adicionando nucleo-
tídeos complementares e sintetizando o transcrito de RNA na direção
5’ ⇒ 3’. Durante o avanço da síntese de RNA, a nova molécula de RNA se separa da
fita molde de DNA e a dupla-hélice de DNA é novamente formada.

Promotor
Unidade de transcrição

5’ 3’
3’ 5’ Fita não molde de DNA
DNA
1. Iniciação. Após a RNA-polimerase
ligar-se ao promotor, as fitas de DNA são Ponto de início Nucleotídeos
desenroladas e a polimerase inicia a síntese RNA-polimerase de RNA
de RNA no ponto de início da fita molde. RNA-polimerase
5’ 3’
3’ 5’ T C C A A
3’ A T
Fita molde do DNA C T U
2. Elongação. A polimerase se desloca
cadeia abaixo (downstream), desenrola a T Extremidade 3’ G
DNA U
A A C
cadeia de DNA sintetizando o transcrito desenrolado C
Transcrito A U C C A
de RNA na direção 5’ ⇒ 3’. Com o 5’ C A
de RNA A
deslocamento da RNA-polimerase, as fitas
de DNA formam novamente a dupla-hélice. T A G G T T
DNA enrolado novamente
5’ 3’ 5’
3’ 5’ Direção da transcrição
3. Terminação. Finalmente, o transcrito de (downstream) Fita molde
Transcrito de RNA de DNA

Material exclusivo para professores


RNA é liberado e a polimerase se desliga
da cadeia de DNA.
RNA recém-sintetizado
5’ 3’
3’ 5’

conveniados ao Sistema de Ensino


Transcrito de RNA completo

Estágios da transcrição. Esquema baseado em: CAMPBELL, Neil A.; REECE, Jane B. Biologia. 8. ed. Porto Alegre: Artmed, 2010.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 190 08/10/18 16:38
111 – Material do Professor 191

Assim como na fase de iniciação há a região promotora que compreende uma se-
quência que sinaliza o início do processo transcricional, a fase de término dispõe de me-

BIOLOGIA 1
canismo similar, que sinaliza onde termina a transcrição, o trecho terminador. O término
ocorre quando a RNA-polimerase encontra essa sequência terminadora no DNA e desli-
ga-se do filamento molde, liberando o transcrito, o pré-RNAm que é usado pelo mRNA.

Modificação no RNA após a transcrição em


células eucarióticas
No núcleo de células eucarióticas há enzimas que modificam o pré-mRNA antes que
as mensagens sejam transportadas no citoplasma. Durante o processamento do RNA,
as duas extremidades do transcrito são modificadas e ocorre um processo de edição do
transcrito de RNA (pré-RNAm), denominado splicing alternativo, que é a remoção dos
íntrons e união dos éxons. Os éxons podem ser montados de variadas maneiras, gerando
múltiplas combinações na sequência do RNA e produzindo diferentes proteínas.

Gene Splicing alternativo

DNA Exon 1 Exon 2 Exon 3 Exon 4

Exon 1 Exon 2 Exon 3 Exon 1 Exon 2 Exon 4

Exon 1 Exon 2 Exon 3 Exon 4 Tradução


Proteína A Proteína B
O splicing alternativo remove os íntrons e une os éxons, produzindo diferentes tipos de proteínas na tradução.

Na maioria dos casos, alguns segmentos da molécula de RNA são clivados


e as partes remanescentes são unidas novamente. Esse processo é similar à
edição de um vídeo, em que as partes que não serão usadas são descartadas.
Passado esse processo, o RNA mensageiro propriamente dito se desloca para
o citoplasma para iniciar a tradução ou síntese de proteínas.

LEITURA COMPLEMENTAR
Transcriptase reversa: uma arma fatal do HIV
A transcriptase reversa é uma enzima que faz a trans-

GETTY IMAGES
crição ao contrário, ou seja, ela utiliza um RNA para
produzir um DNA, que é incorporado ao genoma do
hospedeiro, não sendo destruído pelas defesas do hos-
pedeiro por ser reconhecido como algo próprio, dando
a oportunidade de o vírus atacar e se reproduzir de for-
ma ininterrupta. Essa é a estratégia usada por vírus que
tem como material genético o RNA, denominados re-
trovírus. É o caso do vírus da imunodeficiência humana
(HIV), o vírus causador da síndrome da imunodeficiên-
cia adquirida (Aids, na sigla em inglês).
O HIV ataca o sistema imunológico adicionando seu RNA
dentro dos linfócitos T e, assim, alterando o controle des-
sas células para que façam novas cópias de seu genoma.
Depois de se multiplicarem, essas células são rompidas e Representação do vírus HIV.
os novos retrovírus atacam outras células. Elementos representados fora da
escala de tamanho. Cores fantasia.
Ser soropositivo não significa necessariamente que o indivíduo tem Aids, já que na

Material exclusivo para professores


maioria das vezes o HIV pode permanecer em estado latente por muitos anos no
corpo, sem apresentar sintomas. Atualmente, a pessoa soropositiva tem uma vida
normal, desde que descubra a infecção no início e faça acompanhamento médico.

conveniados ao Sistema de Ensino


A Aids só é desenvolvida quando esses retrovírus começam a destruir as células de
defesa e se multiplicam rapidamente, possibilitando a instalação de doenças oportunistas.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 191 08/10/18 16:38
192 112 – Material do Professor

ROTEIRO DE AULA
BIOLOGIA 1B

Expressão
DNA da proteína

Transcrição

Iniciação Alongamento Término

Deslocamento sob a
Helicase RNA-polimerase Trecho: Terminador
fita molde do DNA

Rompe ligações de H+ Desliga-se da


Sentido: 5' ⇒ 3'
da dupla hélice fita molde:

Trecho: Promotor RNA-polimerase

RNA-polimerase Liberação do:

Pré-RNAm

Região Região não


codificante: codificante:

Material exclusivo para professores Éxons Íntrons

conveniados ao Sistema de Ensino Splicing alternativo

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 192 08/10/18 16:38
113 – Material do Professor 193

EXERCÍCIOS DE APLICAÇÃO

BIOLOGIA 1B
1. Sistema Dom Bosco – A respeito da transcrição, não é 4. Sistema Dom Bosco – O RNA é uma molécula sinteti-
correto afirmar que esse processo: zada no núcleo da célula eucariótica e no citoplasma de
a) produz proteínas. A transcrição é um processo que tem células procarióticas. Nos dois tipos de célula, para que
como objetivo produzir RNA mensageiro. o RNA seja sintetizado é preciso de um gene, que:
b) utiliza o DNA como molde.
a) transporta aminoácidos. É uma enzima atuante na trans-
c) ocorre no sentido 5’ para 3’. crição, isto é, produz RNA.
b) produz ribossomos.
d) seu produto é constituído de éxons e íntrons.
c) atua na produção de DNA.
2. Sistema Dom Bosco – A transcrição é o processo de d) atua na produção de RNA.
produção de uma molécula de RNA a partir de uma fita
molde de DNA. As etapas da transcrição são: 5. Sistema Dom Bosco – A transcrição é um processo
a) iniciação, alongamento e término. que tem como objetivo produzir RNA. Entre as opções
abaixo, assinale a alternativa incorreta.
b) iniciação, alongamento e parada.
a) O RNA é formado a partir de uma fita do DNA, que é
c) iniciação, desenvolvimento e parada. utilizada como molde.
d) iniciação, desenvolvimento e término. b) O RNA possui apenas regiões codificantes.
As etapas da transcrição são denominadas iniciação, alongamento
e término. c) No RNA são encontradas regiões denominadas ín-
3. Sistema Dom Bosco – O RNA é uma molécula sinteti- trons.
zada no núcleo da célula eucariótica e no citoplasma de d) O RNA é uma fita polinucleotídica simples, com pre-
células procarióticas. Nos dois tipos de célula, para que sença de uracila.
o RNA seja sintetizado é preciso do gene. Explique o O RNA, assim como o DNA, é composto de regiões codificantes e
não codificantes, denominadas, respectivamente, de éxons e íntrons.
que é um gene. 6. Sistema Dom Bosco – Quais as principais enzimas
Um gene é uma região codificante do DNA que contém as informações atuantes no processo de transcrição? Justifique tam-
bém suas funções.
necessárias para produzir uma proteína e contém tanto o código para Para que aconteça a transcrição é necessária a atuação das enzimas

a produção dos aminoácidos da cadeia polipeptídica como sequências helicase e RNA-polimerase. A helicase abre a fita do DNA, rompendo

não codificadoras. as ligações de hidrogênio que unem as bases nitrogenadas. Já a RNA-

-polimerase lê a fita do DNA utilizada como molde e monta o RNA com-

plementar a ela, adicionando os nucleotídeos correspondentes às bases

do DNA.

EXERCÍCIOS PROPOSTOS

7. Sistema Dom Bosco – Sobre a replicação do DNA e a organização dos aminoácidos na sequência determi-
transcrição: nada pelo código genético.
a) ambos os processos têm a atuação da DNA-polimerase. d) A mutação constitui uma alteração na sequência de
b) ambos os processos têm a atuação da RNA-polimerase. bases nitrogenadas de um segmento de DNA e pode
ser provocada por radiações, por raios cósmicos, por
c) ambos acontecem nos citoplasmas dos seres proca- raios X ou mesmo por exposição aos raios ultraviole-
riotos e no núcleo dos seres eucarióticos. ta do sol.
d) o sentido do processo em ambos é de 3’ para 5’. e) Todas as células do corpo têm a mesma coleção de
genes, mas, apesar disso, encontramos células com
8. PUC-RJ – Com relação ao código genético e à síntese formas e funções diferentes. Este processo chama-
de proteínas, assinale a afirmação falsa. -se diferenciação celular.
a) Na molécula de DNA, encontramos sempre desoxir-
ribose e cinco tipos de bases: adenina, guanina, cito- 9. IFTM – Se fosse possível sintetizar in vitro uma proteí-
sina, timina e uracila. na, nas mesmas condições em que essa síntese ocorre
b) Os ácidos nucleicos podem aparecer livres na célula nas células, utilizando-se de ribossomos de células de

Material exclusivo para professores


ou podem estar associados a proteínas, compondo preá do cerrado de Goiás, RNA mensageiro de células
os cromossomos e ribossomos na forma de molécu- de camundongo do brejo de Mato Grosso do Sul, RNA
las complexas de nucleoproteínas. transportador de células de sagui da Mata Atlântica no
c) Duas grandes etapas estão envolvidas na síntese Espírito Santo e aminoácidos derivados de célula bacte-

conveniados ao Sistema de Ensino


das proteínas: a transcrição, que compreende a pas- riana coletada na lagoa da Pampulha em Belo Horizonte,
sagem do código genético do DNA para o RNA, e a proteína produzida teria a estrutura primária (sequên-
a tradução, que compreende o trabalho do RNA de cia de aminoácidos) idêntica à:

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 193 08/10/18 16:38
194 114 – Material do Professor

a) não seria possível, pois os sistemas enzimáticos e Qual a sequência correta, de cima para baixo?
BIOLOGIA 1B

celulares são peculiares a cada espécie.


a) 3-1-2-1 b) 3-2-1-1 c) 1-2-3-2 d) 1-2-3-2
b) uma mistura de todas as células.
c) do sagui. 13. Sistema Dom Bosco – A diversidade de formas, tama-
d) do preá. nhos e funções, observada nos mais diferentes tipos de
um mesmo organismo, está relacionada aos processos
e) do camundongo do brejo.
que ocorrem separadamente em cada um dos tipos ce-
10. Sistema Dom Bosco – O RNA é uma molécula de lulares. Tal diversidade é consequência do padrão de:
fita simples, originada a partir da molécula de DNA e a) replicação do DNA.
contém regiões codificantes e não codificantes. Cite o b) sequência de nucleotídeos do DNA.
nome dessas regiões e explique suas funções. c) sequência de nucleotídeos do RNA.
d) transcrição célula-específico.

14. Vunesp (adaptada) – O dogma central da biologia, se-


gundo o qual o DNA transcreve RNA e este orienta a
síntese de proteínas, precisou ser revisto quando se
descobriu que alguns tipos de vírus têm RNA por ma-
terial genético. Nesses organismos, esse RNA orien-
ta a transcrição de DNA, num processo denominado
transcrição reversa.
Explique como ocorre esse processo e cite um vírus
que o realiza.
11. Cefet-MG – A síndrome da imunodeficiência adquirida, co-
nhecida popularmente como aids, é uma doença transmi-
tida por um vírus que tem como material genético o RNA.
Ao infectar o linfócito TCD4+, importante célula de defesa
do corpo, esse vírus introduz, além do ácido nucleico, a
transcriptase reversa. Essa enzima converte o RNA viral em
DNA viral, possibilitando sua replicação, com consequente
falência do sistema imunológico do indivíduo. Quando o nú-
mero de linfócitos cai abaixo de 200 por mm3 de sangue, é
necessário que o paciente faça uso do conjunto de medica-
mentos com ação antirretroviral, conhecido como coquetel.
Considerando-se que, após esse tratamento, o número
de linfócitos de determinado paciente aumentou, é cor- 15. IFSC
reto concluir que esse fármaco promoveu a: “Parece ficção científica, mas é ciência. Os replicadores são
a) proliferação de linfócitos TCD4+. a razão da vida, a unidade da evolução. Eles estão den-
b) inibição da enzima transcriptase reversa. tro do leitor e de mim. Eles nos criaram, o nosso corpo
e a nossa mente, e a preservação deles é a razão última
c) destruição dos vírus presentes no paciente.
da nossa existência. Percorreram um longo caminho, esses
d) imunização dos pacientes ao vírus da aids.
replicadores. Agora, respondem pelo nome de genes, e nós
e) incapacitação da transferência do RNA viral. somos as suas máquinas de sobrevivência.”

12. Cefet-MG – A síndrome da imunodeficiência adquiri- Fonte: DAWKINS, R. O gene egoísta. 2. ed. São Paulo:
da, conhecida popularmente como aids, é uma doença Companhia das Letras, 2007.
transmitida por um vírus que tem como material gené- Sobre conceitos de genética e síntese de proteínas, assi-
tico o RNA. Ao infectar o linfócito TCD4+, importante nale o número correspondente à proposição correta ou à
célula de defesa do corpo, esse vírus introduz, além do soma das proposições corretas.
ácido nucleico, a transcriptase reversa. Essa enzima
converte o RNA viral em DNA viral, possibilitando sua Os replicadores, mencionados no texto acima, corres-
replicação, com consequente falência do sistema imu- pondem a trechos de moléculas de DNA.
nológico do indivíduo. Quando o número de linfócitos 02. As moléculas de DNA são capazes de armazenar in-
cai abaixo de 200 por mm3 de sangue, é necessário que formação codificada e de duplicar-se. A informação
o paciente faça uso do conjunto de medicamentos com armazenada pode ser utilizada pelo organismo no
ação antirretroviral, conhecido como coquetel. processo de síntese proteica.
1. Transcrição 04. O fenótipo corresponde a todo o conjunto de genes
2. Splicing que um indivíduo possui em suas células.

Material exclusivo para professores


3. Replicação 08. As sequências de bases nitrogenadas que fazem
parte da composição do DNA correspondem a um
( ) Processo catalisado pela DNA-polimerase.
código capaz de produzir diretamente os principais
( ) Processo catalisado pela RNA-polimerase. constituintes de um ser vivo: carboidratos, lipídios e

conveniados ao Sistema de Ensino


( ) Processo que consiste na remoção de íntrons e vitaminas.
junção dos éxons. 16. Sem a presença de moléculas de RNA, o processo
( ) Produz RNA. de síntese de proteínas fica comprometido.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 194 08/10/18 16:38
115 – Material do Professor 195

16. Unifor-CE – Considere um RNA transportador cujo an- 17. Sistema Dom Bosco – A fita a seguir representa o fila-

BIOLOGIA 1B
ticódon é CUG. O códon correspondente no RNA men- mento molde do DNA utilizado durante o processo de
sageiro e a trinca de nucleotídeos na fita do DNA que é transcrição: 5’-ATCGTGCATTGCAGTCAGGCCT-3’. Justi-
transcrita são, respectivamente: fique o produto da transcrição.
a) CTG e GAC.
b) TAC e GUC.
c) AUT e CAG.
d) CUG e CTG.
e) GAC e CTG.

ESTUDO PARA O ENEM


18. Sistema Dom Bosco C4-H13 comportarem como fatores de transcrição [...]. Os genes
A ideia do DNA “lixo”, sugerida há alguns anos, foi substituí- de cada fator de transcrição foram feitos de unidades di-
da pela ideia do RNA “luxo”, referindo-se à imensa quantida- ferentes de DNA que codificam as partes funcionais das
de de RNA que é produzido para diversas outras funções proteínas, como um domínio que pode se ligar ao DNA,
além da síntese proteica. Uma das especulações trazidas e outro que fornece a proteína com acesso ao núcleo da
pelos biólogos e ainda não respondida é a do papel dessas célula.
regiões não codificantes ao longo do processo evolutivo.
[...]
Como são chamadas as regiões não codificantes? Isto criou um circuito fechado que pouco afetou a vida
a) Éxon. normal da célula. Devido ao looping provocado pelo se-
b) Íntron. gundo fator de transcrição sobre seu próprio gene, o se-
c) RNA. gundo fator de transcrição continuou sendo produzido
mesmo quando a galactose foi eliminada do ambiente das
d) DNA.
células (desativando assim a atividade do primeiro gene).
e) Ribossomo. Silver disse que isto basicamente manteve a memória da
exposição à galactose.
19. Sistema Dom Bosco C8-H13
“O projeto Genoma Humano permitiu que cientistas ‘Pense nisto como uma exposição das células a algo que de-
identificassem todos os genes que constituem um ser hu- pois é removido, mas que elas se lembram de ter visto’, ela
mano, mas não definiu o que cada um deles faz. disse. ‘Imagine mais à frente poder construir uma célula ca-
paz não apenas de contar que foi exposta a algo, mas quanto
O novo mapeamento se tornou possível com a descober-
ou quando’. Silver disse que seu laboratório tentará construir
ta de um processo chamado interferência de RNA (ácido
essa célula, que então seria implantada em mamíferos para
ribonucleico), que é usado pelo corpo para ‘desligar’ genes
detectar e informar a extensão do dano causado por radiação
individualmente, mantendo os outros em funcionamento”.
UV, que danifica o DNA e é um fator de risco para desenvol-
BBC Brasil. Descoberta da função de genes pode ajudar combate ao câncer. vimento de câncer”.
<https://www.bbc.com/portuguese/ciencia/030204_genesir.shtml>.
Disponível Acesso em: 25 jun. 2018. SWAMINATHAN, Nikhil. Genes sintéticos dão a células algo para se
lembrarem. Scientific American Brasil. Disponível:
Essa molécula capaz de “desligar” genes: <http://www2.uol.com.br/sciam/noticias/
a) é formada a partir de uma proteína. genes_sinteticos_dao_a_celulas_algo_para_se_lembrarem.html>.
Acesso em: 25 jun. 2018.
b) possui apenas regiões codificantes.
Com base no texto, o que se entende por fatores de
c) possui apenas regiões não codificantes.
transcrição?
d) carrega as informações para produzir uma proteína.
a) São proteínas que atuarão na síntese de RNA.
e) não atua na expressão gênica.
b) São moléculas de RNA que atuarão na síntese de DNA.
20. Sistema Dom Bosco C8-H13 c) São moléculas de DNA que vão atuar na síntese de DNA.
“Silver e sua equipe construíram dois novos genes que d) São proteínas que vão atuar na replicação.
codificariam duas proteínas artificiais projetadas para se
e) São íntrons que se alojam dentro das células.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1B_P3.indd 195 08/10/18 16:38
12
196 116 – Material do Professor

TRADUÇÃO: SÍNTESE DE
BIOLOGIA 1B

PROTEÍNAS

No ano de 2013, pesquisadores da Universidade Federal de Minas Gerais des-


creveram uma nova espécie de anta, a Tapirus kabomani, popularmente chamada de
• Código genético anta-pretinha. Essa é a quinta espécie do gênero Tapirus e a primeira a ser identificada
• Tradução ou síntese de em 150 anos. Não eram catalogadas novas espécies de grande porte desde 1992
• proteínas nem novas espécies de antas desde 1865.
Para identificar essa nova espécie, os pesquisadores compararam o tamanho do
HABILIDADES crânio da anta-pretinha com o da anta-brasileira (Tapirus terrestris). Novas análises
• Compreender as interações genéticas utilizando o DNA mitocondrial desses animais foram feitas, a fim de avaliar
genéticas entre DNA e o quanto o material genético era diferente e tentar determinar a proximidade evolutiva
RNA, as quais determinam entre elas.
a produção de proteínas Quando comparada à anta-brasileira, a nova espécie foi descrita com pelagem
nos seres vivos. negra, porte menor, cabeça com testa mais larga e crista sagital do crânio mais curta.
• Caracterizar as proprie- Em relação às análises genéticas, foram identificadas sete mutações no DNA mito-
dades básicas do código condrial, em genes que atuam na respiração celular.
genético.

MIROSLAV_1
• Sequenciar etapas que
compõem o processo de
síntese proteica.
• Interpretar modelos para
explicar a manifestação
das características dos
seres vivos.
• Relacionar informações em
diversas formas.

Anta-brasileira com seu filhote. A anta-pretinha é uma espécie irmã, originada por meio de mutações no material
genético.

Com base nos dados genéticos e nas características morfológicas, foi feita a aná-
lise filogenética, a qual indicou que a anta-pretinha (Tapirus kabomani) é uma espécie
similar à anta-brasileira (T. terrestris). Ou seja, em algum momento elas tiveram um
ancestral comum, que, por meio de modificações no ácido desoxirribonucleico (DNA)
ao longo de milhares de anos, se diferenciou nessas duas espécies.
As mutações no DNA são importantes para que haja variação nas características,

Material exclusivo para professores


inclusive possibilitando delimitar novas espécies e inferir as relações evolutivas en-
tre elas. Para que haja variações tão claras quanto as observadas na anta-pretinha
(T. kabomani), as mutações ocorridas no DNA, de modo geral, modificaram o “alfabeto”
contido nos ácidos ribonucleicos (RNAs), o que consequentemente alterou a produção

conveniados ao Sistema de Ensino


de algumas proteínas.
Neste módulo, vamos compreender como a informação genética é passada da
molécula de RNA mensageiro (mRNA) às proteínas.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 196 08/10/18 16:38
117 – Material do Professor 197

Código genético • caso a combinação fosse feita em uma trinca –


arranjos de 3 bases –, haveria 64 possíveis códi-

BIOLOGIA 1B
O mRNA maduro, produzido ao final da transcrição, gos, número maior que o necessário.
é formado por bases nitrogenadas. A sequência dessas Entretanto, por meio de experimentações, os cien-
bases forma um código genético, que especifica tipos
tistas chegaram à conclusão de que alguns dos aminoá-
diferentes de aminoácidos a serem produzidos.
cidos são codificados por mais de uma trinca, portanto
Ao constatarem que as instruções para a síntese
há combinação de três bases que codificam o mesmo
proteica estavam escritas na forma de um código no
DNA, os pesquisadores identificaram um novo proble- aminoácido. Essa trinca de bases nitrogenadas recebe
ma: se existiam apenas 4 bases nitrogenadas, como o nome de códon.
poderiam ser expressos 20 aminoácidos?

OXFORD DESIGNERS & ILLUSTRATORS


LTD/PEARSON EDUCATION LTD
Trincas
DNA
A CADA TRÊS BASES, UM CÓDON A
T T
T
C G T G T
A
C T G
A
A
A primeira conclusão foi a de que o código genético A A G
C
A
G C
C C A
não poderia ser uma linguagem em que cada símbolo A
U G C U A

correspondesse a uma palavra, como acontece nos ca- A Filamento


Bases Códons
racteres chineses. Então, a nova questão era: quantas T de mRNA C C
T
A
G
bases nitrogenadas correspondem a um aminoácido?
G
A T G A T
C T G
T
C
Considerando que há apenas 4 possibilidades de ba- G

ses nitrogenadas presentes no mRNA e 20 aminoácidos


A
U U
G C A

conhecidos, foram elaboradas as seguintes hipóteses:


• se cada base nitrogenada fosse traduzida em 1 ami-
noácido, haveria apenas 4 aminoácidos possíveis; As trincas de bases nitrogenadas do filamento molde de DNA
• se 2 bases juntas especificassem 1 aminoácido, transferem a informação genética para o filamento de mRNA na
haveria 16 arranjos possíveis, não completando forma de códons, que serão traduzidos durante a síntese proteica.
Elementos representados fora da escala de tamanho. Cores fantasia.
os 20 aminoácidos conhecidos;

Segunda base
U C A G
UGU
UUU UAU
Serina UGC Cisteína
UUC Fenilalanina UAC
UCU Tirosina Códon de U
U UCC UGA parada C
UCA A Terceira base
Primeira base do mRNA
Triptofano G (extremidade
UCG Códon de
do mRNA UUA Leucina UAA
UUG UAG parada
(extremidade UGG
3’ do códon)
5’ do códon)
CAU
Prolina CAC Arginina
CUU CCU
Histidina
CGU U
CUC CCC CGC C
C CUA Leucina CCA CGA A
CUG CCG
CAA
CGG G
Glutamina
CAG
AGU Serina
AUU AAU
Treonina AGC
AUC
Isoleucina
ACU AAC
Asparagina U
AUA ACC C
A ACA A
Metionina Arginina
ACG AAA AGA G
e códon de Lisina
AUG AAG AGG
iniciação

Material exclusivo para professores


G
GUU
GUC
GCU
GCC
Alanina
GAU
GAC
Ácido
aspártico
GGU
GGC
Glicina
U
C
A

conveniados ao Sistema de Ensino


GUA Valina GCA Ácido GGA
GAA
GUG GCG
GAG
glutâmico GGG G
Os 64 códons do código genético. As bases do códon de mRNA são lidas a partir da primeira.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 197 08/10/18 16:38
198 118 – Material do Professor

Existem 64 códons na natureza, os quais resultam delineados, visto que há um equilíbrio a ser sustentado
BIOLOGIA 1B

em 20 tipos de aminoácidos. Para cada um desses có- no ecossistema, e modificações nos organismos que
dons, há anticódons, que são trincas complementares compõem esse ambiente podem gerar efeitos indese-
aos códons do mRNA, presentes em uma das pontas jados de grandes proporções. Modificar uma espécie
do tRNA. de vegetal para que ele seja mais resistente a uma pra-
ga, favorecendo sua produção de maneira mais rápida e
O código genético é degenerado e redundante sem uso de muitos agrotóxicos, é uma das utilizações
Como você pôde observar na tabela, há mais có- dos OGMs. No entanto, o impacto que essas novas
dons que aminoácidos. Isso acontece porque um ami- espécies causam para o ecossistema ainda é tema de
noácido pode ser traduzido por meio de diferentes amplos debates.
combinações de três bases nitrogenadas. Ou seja, o

GETTY IMAGES
códon é degenerado.
Analise como exemplo o aminoácido leucina: há
seis códons para esse aminoácido. Essa característica
do código genético é vantajosa, pois, caso aconteça
uma mutação, há maiores chances de a proteína sofrer
alterações em virtude de aminoácidos errados serem
sintetizados.

O código não é ambíguo


Diferentes códons podem determinar um mesmo
aminoácido, mas isso não ocorre para casos de um
códon codificar aminoácidos diferentes. Diz-se, então,
que o código genético é não ambíguo, portanto não
apresenta duplo sentido. Nos OGMs podem-se usar trechos do código genético de outros seres
vivos para expressar a proteína que resultará na característica desejada.
Códon de iniciação Atualmente grande parte da produção de milho e soja é de OGMs.
A metionina (códon AUG) é um aminoácido denomi-
nado códon de iniciação. Isso significa que a síntese Tradução ou síntese de proteínas
de proteínas começa somente após a adição do ami- Tradução é o evento que resulta na síntese de pro-
noácido metionina e que toda proteína o tem como pri- teínas no qual estão envolvidos os três tipos principais
meiro aminoácido em sua composição. Se a metionina de RNA, como abordado anteriormente. Em células eu-
não for necessária na estrutura da proteína, esse ami- carióticas, após a transcrição e a maturação no núcleo,
noácido poderá ser retirado após a tradução se com- o mRNA migra até o citoplasma com os códons que
pletar. Caso haja mais de um aminoácido metionina, o determinam a sequência de aminoácidos formadores
primeiro deles marcará o início da síntese. da proteína. O RNA ribossômico (rRNA) compõe, com
as proteínas, os ribossomos. Estes são estruturas
Códons de parada ou término
constituídas em uma subunidade maior e outra menor,
Dos 64 códons existentes, apenas três não codifi-
que contêm três sítios: A (no qual ocorre a entrada do
cam nenhum aminoácido (UAA, UAG e UGA), mas tra-
aminoácido), P (em que fica o peptídeo em formação) e
zem uma importante mensagem: são os códigos que
o sítio E (saída do RNA transportador – tRNA).
avisam quando a síntese deve ser interrompida, sendo
chamados de códons de parada (também conhecidos
como stop codons). Assim, se houver 50 códons em Sítio A
um mRNA, esse códon traduzirá uma proteína consti- Sítio P
tuída de 49 aminoácidos.
TTSZ/ISTOCKPHOTO.COM

Subunidade
O código genético é universal maior
Todos os aminoácidos encontrados nos mais dife-
rentes seres vivos são identificados pelos mesmos có-
dons, o que torna o código universal. Assim, o material
genético de uma espécie pode produzir a mesma pro-
teína em outras espécies. Subunidade menor

Material exclusivo para professores


Essa característica foi fundamental para que os or-
ganismos geneticamente modificados (OGM) fossem Esquema das principais partes de um ribossomo. Elementos
desenvolvidos e para compreender melhor as relações representados fora da escala de tamanho. Cores fantasia.

evolutivas em nível genético entre os seres vivos.

conveniados ao Sistema de Ensino


O tRNA tem, em uma de suas subunidades, a
Modificar geneticamente um organismo é algo que sequência ACC, em que os aminoácidos se ligam.
deve ser bem elaborado e ter objetivos claramente Para o reconhecimento dos códons do mRNA, na

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 198 08/10/18 16:38
119 – Material do Professor 199

outra extremidade do tRNA, está o anticódon espe- Aminoácido


cífico para cada aminoácido correspondente. Dessa

BIOLOGIA 1B
Trp
forma, é determinada a posição do aminoácido na Subunidade maior
proteína. do ribossomo

É importante lembrar que o sentido, tanto da trans-


Met
crição quanto da tradução, é sempre de 5’ para 3’, para
E P A ACC tRNA
que as informações não sejam lidas de trás para frente.
Por exemplo, considere a molécula de RNA mensageiro
a seguir:
Anticódon
UAC

5' mRNA ...AUGUGGUUC... 3'


5’ AAUCUCAUGGUUAUGCCGGAUUCAUCCUGAUU 3’
Códon
Subunidade menor
do ribossomo
O ribossomo vai andar sob essa molécula e só ini-
Esquema da iniciação. Elementos representados fora da escala de
ciará a tradução ao reconhecer o códon da metionina tamanho. Cores fantasia.
(AUG). Após isso, ele vai ler os códons sempre em trin-
cas, e os tRNA transportarão os aminoácidos corres- O alongamento é iniciado quando o tRNA da me-
pondentes a essas trincas. tionina se liga ao sítio P do ribossomo. O tRNA que
apresenta o anticódon correspondente ao códon se-
guinte do mRNA se aloja no sítio A do ribossomo.
5’ AGAUCUCAUGGUUAUGCCGGAUUCAUCCUGAUU 3’ Com isso, ocorre a formação de uma ligação pep-
tídica entre os aminoácidos e o tRNA da metionina
é liberado para o citoplasma, saindo pelo sítio E. O
Note que há mais de um AUG nessa sequência, de ribossomo se desloca sob o mRNA, de forma que os
maneira que a iniciação se dará sempre a partir do pri- dois aminoácidos passam a ocupar o sítio P, mantendo
meiro códon encontrado. o sítio A sempre vazio para a entrada do próximo ami-
noácido. Esse processo acontece ao longo de todo o
mRNA, formando a cadeia polipeptídica.
5’ AGAUCUCAUGGUUAUGCCGGAUUCAUCCUGAUU 3’
Subunidade maior do ribossomo

Met
Portanto, a sequência de aminoácidos será: Phe
P A
UAC AAA

Met- Val- Met- Pro- Asp- Ser- Ser 5' AUGUUUCGA 3'

Subunidade menor
do ribossomo
Nesse exemplo nota-se a presença de dois ami- Cadeia polipeptídica
Met
noácidos do tipo serina com códons diferentes, o que
evidencia como o código é degenerado. Além disso,
Phe Arg
mesmo que a sequência contenha oito códons, apenas E
P A
sete foram traduzidos, pois o códon de parada (em ver- UAC
melho) não é traduzido. AAA GCU
5' AUGUUUCGA 3'
ETAPAS DA TRADUÇÃO
O processo de tradução pode ser dividido em três Esquema do alongamento. Elementos representados fora da escala de
tamanho. Cores fantasia.
etapas: iniciação, alongamento e terminação.
A iniciação acontece quando a subunidade me-

Material exclusivo para professores


O alongamento continua até o momento em que o
nor do ribossomo se liga ao tRNA da metionina (o
códon apresentado ao sítio A do ribossomo pelo mRNA
iniciador). Juntos, percorrem o mRNA até encontrar seja um dos três que indicam término: UGA, UAA e
o códon de iniciação (AUG). Feito isso, a subunida- UAG. É importante ressaltar que esses códons não são

conveniados ao Sistema de Ensino


de maior do ribossomo se une à subunidade menor, reconhecidos por nenhum RNAt. Quando o sítio A é
como se uma concha fosse fechada. Então, a tradu- ocupado por proteínas citoplasmáticas chamadas fato-
ção é iniciada. res de liberação – que reconhecem os códons finali-

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 199 08/10/18 16:38
200 120 – Material do Professor

zadores –, ocorre a terminação da síntese proteica. O Vários ribossomos podem se deslocar simultanea-
BIOLOGIA 1B

polipeptídio é liberado, e as subunidades do ribossomo mente pela mesma molécula de mRNA, produzindo
dissociam-se, ficando livres no citoplasma, assim como diversas proteínas ao mesmo tempo.
o mRNA. A metionina inicial pode ser removida do po-
lipeptídio pronto. Ou pode ser, então, mantida, fazendo
parte da proteína formada. EVENTOS PÓS-
Polipeptídeo Último
-TRADUCIONAIS
tRNA Após o fim da tradução, as proteínas recém-forma-
tRNA
liberado
Subunidade das ainda não apresentam funcionalidade. É necessário
maior do que elas sofram modificações causadas por eventos
ribossomo
denominados pós-traducionais.
Em certos casos, alguns aminoácidos são remo-
vidos ou modificados, havendo também associações
entre as proteínas e os carboidratos para se tornarem
ativos. Um dos eventos pós-traducionais mais impor-
mRNA
Códon de parada ou tantes é o dobramento de algumas proteínas, o que
de terminação
origina as estruturas secundária e terciária. Entre as
proteínas que realizam esses dobramentos, as mais co-
Subunidade pequena
Proteína
códon nhecidas são as pertencentes à classe das chaperonas.
do ribossomo
citoplasmática unida
ao códon de parada Observe na tabela a comparação entre as caracte-
Esquema do término. Elementos representados fora da escala de rísticas da replicação, transcrição e tradução que resul-
tamanho. Cores fantasia. tam na formação de proteínas.

Replicação Transcrição Tradução

Produto DNA RNA Proteína

Molécula molde DNA DNA mRNA

Produtor DNA polimerase RNA polimerase Ribossomo

Sentido 5’ para 3’ 5’ para 3’ 5’ para 3’

Local em procariotos Citoplasma Citoplasma Citoplasma

Citoplasma e retículo
Local em eucariotos Núcleo Núcleo
endoplasmático

LEITURA COMPLEMENTAR
Chaperonas: as damas de companhia moleculares
O termo chaperon deriva da língua francesa e era usado no passado para se referir às damas de companhia que acompa-
nhavam jovens moças solteiras em passeios e, até mesmo, durante o namoro. Partindo desse raciocínio, as chaperonas
moleculares receberam esse nome por atuar auxiliando outras proteínas durante o enovelamento proteico, processo em
que a proteína assume forma e função específicas.
Utilizando energia da quebra de adenosina trifosfato (ATP), as chaperonas desenovelam proteínas com erros, auxiliando-
-as a atingir a configuração terciária certa. Costumam atuar especialmente após períodos de estresse térmico, em que a
célula sofre modificações e passa a produzir mais proteínas.
Como muitas proteínas são produzidas, as chaperonas verificam as moléculas que estão corretas e auxiliam as
que precisam ser reconfiguradas. Quando não há possibilidade de conserto, as chaperonas encaminham as pro-

Material exclusivo para professores


teínas à destruição.

conveniados ao Sistema de Ensino


Dom Bosco
DB_PV_2019_BIO1B_P3.indd 200 08/10/18 16:38
121 – Material do Professor 201

ROTEIRO DE AULA

BIOLOGIA1B
BIOLOGIA
Código genético

Formado por Degenerado Informação


trincas de bases presente no mRNA
denominadas: necessária à:

Redundante Tradução

Códons
Universal

Não ambíguo

Sequências que
determinam:
Etapas

Aminoácidos Término Iniciação Terminação


Início Alongamento

AUG Códon: Ligação entre: Códon:

AUG
Ribossomos

UAA
tRNA

UAG

Stop códon

Material exclusivo para professores UGA

conveniados ao Sistema de Ensino


Liberação da
cadeia peptídica
da proteína

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 201 08/10/18 16:38
202 122 – Material do Professor

EXERCÍCIOS DE APLICAÇÃO
BIOLOGIA 1B

1. Fuvest-SP
“Há uma impressionante continuidade entre os seres vi-
vos (...). Talvez o exemplo mais marcante seja o da con-
servação do código genético (...) em praticamente todos
os seres vivos. Um código genético de tal maneira “uni-
versal” é evidência de que todos os seres vivos são apa-
rentados e herdaram os mecanismos de leitura do RNA
de um ancestral comum”.
(Morgante & Meyer, Darwin e a Biologia,
O Biólogo 10:12–20, 2009.) 4. Sistema Dom Bosco – Os ribossomos, também cha-
mados de ribossomas, são pequenas estruturas em
O termo “código genético” refere-se: forma de grânulos que estão presentes nas células pro-
a) ao conjunto de trincas de bases nitrogenadas; cada carióticas e eucarióticas. Sobre o ribossomo é correto
trinca correspondendo a um determinado aminoácido. afirmar que:
b) ao conjunto de todos os genes de um organismo, a) é uma enzima que atua na transcrição.
capazes de sintetizar diferentes proteínas. b) é uma estrutura que atua na replicação do DNA.
c) ao conjunto de proteínas sintetizadas a partir de uma c) é uma estrutura formada por duas subunidades.
sequência específica de RNA.
d) é uma estrutura formada por 4 sítios na subunidade
d) a todo o genoma de um organismo, incluindo regiões maior.
expressas e não expressas. O ribossomo é constituído pela subunidade maior (na qual há três sítios: E,
e) à síntese de RNA a partir de um dos filamentos P e A) e pela subunidade menor.
de DNA. 5. Unifor-CE – Considere um RNA transportador cujo an-
O código genético é a relação entre uma trinca de bases nitrogenadas e ticódon é CUG. O códon correspondente no RNA men-
o aminoácido por ela codificada. É universal, isto é, o código genético é sageiro e a trinca de nucleotídeos na fita do DNA que é
único para todos os seres do planeta.
transcrita são, respectivamente:
2. Sistema Dom Bosco – O código genético é chamado
a) CTG e GAC. c) AUT e CAG. e) GAC e CTG.
de degenerado porque:
b) TAC e GUC. d) CUG e CTG.
a) um códon é correspondente a vários aminoácidos.
Para responder a essa questão, é fundamental que o aluno se lembre
b) o anticódon é lido no mRNA. de que adenina só se liga à timina e que a citosina só se liga à guani-
na. Também é importante lembrar que timina é encontrada apenas no
c) vários códons correspondem a um mesmo aminoácido. DNA e a uracila, somente no RNA. Sendo assim, como o anticódon do
d) um anticódon corresponde a vários aminoácidos. RNA transportador é CUG, no RNA mensageiro encontraremos GAC. No
Um aminoácido pode ser traduzido por mais de um códon, mas o contrá- DNA, por sua vez, é encontrado CTG.
rio não ocorre. 6. Sistema Dom Bosco – O código genético do DNA se
3. Sistema Dom Bosco – A tradução é um processo fun- expressa por trincas de bases, denominadas códons.
damental para que exista variabilidade fenotípica. Expli- Cada códon corresponde a determinado aminoácido. Ex-
que a razão que justifique esse fenômeno. plique porque o código genético é chamado de universal.
A variabilidade fenotípica reflete nas características diferentes de indiví- O código genético é universal porque a correspondência entre os có-

duo para indivíduo. Essa variabilidade só é possível graças ao genoma, o dons e os aminoácidos é praticamente a mesma para a maioria dos se-

conjunto de genes que resulta na mensagem que contém as trincas de res vivos, o que significa que o material genético de uma espécie pode

aminoácidos que codificarão proteínas, formadas no processo de tradu- produzir a mesma proteína em outras espécies.

ção. Sendo assim, a expressão dessas proteínas, na ordem específica e

única, só se dá por meio da tradução.

EXERCÍCIOS PROPOSTOS

7. Sistema Dom Bosco – Observe a seguinte sequência c) serão traduzidos 11 aminoácidos.


de RNA mensageiro: d) há um códon de parada no meio da sequência.

Material exclusivo para professores


5’-AGAUCUCAUGGUUAUGCCGGAUUCAUCCUGAUU -3’ 8. IFMG – A síntese de proteínas, processo que se inicia
no núcleo celular e é concluído nos ribossomos, é cons-
tituído por duas etapas, a transcrição e a tradução, que
Sobre essa sequência, pode-se afirmar corretamente que:
envolvem a participação do DNA (ácido desoxirribonu-

conveniados ao Sistema de Ensino


a) é necessário uma fita complementar para que haja cleico) e RNA (ácido ribonucleico). Quanto aos proces-
a tradução. sos de transcrição e tradução, marque a alternativa que
b) serão traduzidos 5 aminoácidos. contém a afirmação correta.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 202 08/10/18 16:38
123 – Material do Professor 203

a) Cada aminoácido apresenta um único códon para a 12. Sistema Dom Bosco – Na etapa de finalização da sín-

BIOLOGIA 1B
sua codificação. tese proteica, a produção da proteína é interrompida
b) Na transcrição há a participação do ribossomo. quando se encontra um códon denominado códon de
c) O conjunto de três bases nitrogenadas presentes no terminação. Assim que esse códon é encontrado, o fa-
RNA mensageiro recebe o nome de anticódon. tor de liberação atua liberando a cadeia formada. Entre
os códons abaixo, qual não representa um códon de
d) A sequência de aminoácidos formadores da proteína terminação?
é determinada indiretamente pela molécula de DNA.
a) UAA. b) UAG. c) UGA. d) AUG.
9. IFRS – As características morfológicas e fisiológicas
de um ser vivo dependem dos tipos de proteínas do 13. Sistema Dom Bosco
seu organismo. A síntese dessas proteínas, por sua “Insatisfeito com os diagnósticos que recebeu dos médicos
vez, depende do DNA em interação com o RNA, de sobre sua filha, que nasceu há 9 anos com um distúrbio
determinadas enzimas, de ribossomos e outras estru- raro, Rienhoff, um empresário do ramo de biotecnologia,
turas celulares. Sobre a síntese de proteínas, marque decidiu resolver o problema com as próprias mãos. Após
a alternativa correta: quase uma década de exames clínicos, consultas com es-
a) Um gene pode ser definido como um segmento de pecialistas e até testes de DNA caseiros com equipamen-
RNA que atua como molde para a produção de uma tos usados, ele publicou em julho deste ano [2013] um
molécula de DNA. ensaio científico na revista americana Medical Genetics, em
b) No processo de produção de RNA mensageiro, de- que descreve em detalhes o que ele assegura ser o proble-
nominado de transcrição gênica, as duas cadeias ma de seu filha: uma mutação em um gene essencial para
de DNA se separam e uma delas serve de molde o crescimento normal dos músculos”.
ao RNA.
SPARROW, Thomas. Pai descobre sozinho mutação genética que afeta sua
c) Um códon é uma sequência de três nucleotídeos no
filha. BBC Brasil. Disponível em: <http://www.bbc.com/portuguese/noti-
RNA transportador. cias/2013/09/130920_pai_doenca_filha_mdb>. Acesso em: jun. 2018.
d) Nos procariontes, o processo de tradução gênica
Sobre a informação no texto, assinale a alternativa correta.
é realizado no citoplasma das células, enquanto
que o de transcrição gênica é realizado no interior a) A mutação no gene não afetará a transcrição.
do núcleo. b) A mutação no gene não afetará a tradução.
e) Na transcrição gênica, a trinca de bases nitrogenadas c) A mutação afetará apenas a transcrição, mas não
ACG produz o códon TGC no RNA mensageiro. a tradução.
d) A mutação afetará a transcrição e a tradução, de for-
10. Sistema Dom Bosco – Para a formação de uma proteí- ma que produzirá um fenótipo diferente do esperado.
na, diferentes processos ocorrem a partir da molécula
de DNA. Cite as estruturas envolvidas no processo de 14. Unicamp-SP – A imagem abaixo representa o proces-
tradução e explique suas funções. so de tradução.

Ribossomo

Met Glu Lis


Aminoácido
Val
Polipeptídeo Leu

Cite o nome das estruturas representadas pelas letras A


e B, respectivamente. Indique em quais estruturas celu-
11. Unifor-CE – Um cientista sintetizou uma proteína cons- lares ocorre esse processo em seres eucariotos.
tituída por uma cadeia de 112 aminoácidos. Neste caso,
quantas moléculas de RNA mensageiro (RNAm) e quan-
tas moléculas de RNA transportador (RNAt) foram usa-

Material exclusivo para professores


das na biossíntese?
a) Uma molécula de RNAm e 112 moléculas de RNAt.
b) 112 moléculas de RNAm e uma molécula de RNAt.
c) 112 moléculas de RNAm e 112 moléculas de RNAt.

conveniados ao Sistema de Ensino


d) Uma molécula de RNAm e 56 moléculas de RNAt.
e) 56 moléculas de RNAm e uma molécula de RNAt.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 203 08/10/18 16:38
204 124 – Material do Professor

15. UFRGS-RS – Considere as seguintes etapas da síntese 17. Sistema Dom Bosco – A ciência estima que seja de
BIOLOGIA 1B

de proteínas: 30 mil o número de genes da espécie humana; no en-


I. Transcrição do código genético do DNA em códons tanto, o número de proteínas diferentes está estimado
do RNA mensageiro. entre 100 mil a 120 mil. Para a síntese e expressão das
II. Ligação dos códons de RNA mensageiro aos anticó- proteínas acontecer estão envolvidos a transcrição e a
dons correspondentes dos RNAs transportadores. tradução. Cite semelhanças e diferenças entre a trans-
III. Fixação do RNA mensageiro aos ribossomos. crição e a tradução.

Qual a sequência correta dessas etapas durante o


processo?
a) I – II – III. c) II – III – I. e) III – I – II.
b) I – III – II. d) III – II – I.

16. Sistema Dom Bosco – Em um experimento, um seg-


mento de DNA contendo a região codificadora para a
formação de uma proteína foi expresso em bactérias,
utilizadas como plasmídeos. Sabendo-se que o 37o có-
don da sequência do RNA mensageiro produzido era
um códon de parada, é correto afirmar que:
a) A proteína resultante contém 37 aminoácidos.
b) A proteína resultante contém 38 aminoácidos.
c) A proteína resultante contém 36 aminoácidos.
d) Quando há códon de parada, a proteína não é produzida.

ESTUDO PARA O ENEM


18. Enem C4-H13 20. Enem C4-H13
Apesar da grande diversidade biológica, a hipótese de A figura seguinte representa um modelo de transmis-
que a vida na Terra tenha tido uma única origem comum são da informação genética nos sistemas biológicos.
é aceita pela comunidade científica. Uma evidência que
No fim do processo, que inclui a replicação, a transcri-
apoia essa hipótese é a observação de processos bioló-
gicos comuns a todos os seres vivos atualmente exis- ção e a tradução, há três formas proteicas diferentes
tentes. Um exemplo de tal processo é o(a): denominadas a, b e c.
a) desenvolvimento embrionário.
Replicação Tradução
b) reprodução sexuada. Proteína a
c) respiração aeróbica. DNA RNA Proteína b
d) excreção urinária. Transição
Proteína c
e) síntese proteica.

19. Enem C8-H16 Depreende-se do modelo que:


O formato das células de organismos pluricelulares a) a única molécula que participa da produção de proteí-
é extremamente variável. Existem células discoides, nas é o DNA.
como é o caso das hemácias, as que lembram estrelas,
como os neurônios, e ainda algumas alongadas, como b) o fluxo de informação genética, nos sistemas biológi-
as musculares. Em um mesmo organismo, a diferencia- cos, é unidirecional.
ção dessas células ocorre por: c) as fontes de informação ativas durante o processo
a) produzirem mutações específicas. de transcrição são as proteínas.
b) possuírem DNA mitocondrial diferentes. d) é possível obter diferentes variantes proteicas a par-
c) apresentarem conjunto de genes distintos. tir de um mesmo produto de transcrição.
d) expressarem porções distintas do genoma. e) Um grupo de três letras no RNA-mensageiro consti-
e) terem um número distinto de cromossomos. tui o anticódon, a partir desta transcrição.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1B_P3.indd 204 08/10/18 16:38
13
125 – Material do Professor 205

ESTRUTURA E FUNÇÃO DA

BIOLOGIA 1B
MEMBRANA PLASMÁTICA

A membrana plasmática é uma fina camada que delimita a vida, já que ela divide a
célula viva e o ambiente em que se encontra. Como vimos no início de nosso estudo,
um dos primeiros episódios no surgimento da vida na Terra pode ter sido a formação • Estrutura da membrana
de uma membrana que separou o meio interno do meio externo de uma célula, pos- plasmática
sibilitando trocas de substâncias. • Especializações da
Assim como uma alfândega é a repartição governamental que administra a entra- membrana plasmática
da e a saída de mercadorias para o exterior e realiza a cobrança de tributos, a mem-
HABILIDADE
brana plasmática funciona como uma fronteira que controla o tráfego de substâncias
• Descrever a constituição
para o interior e o exterior da célula.
da membrana plasmática e
compreender suas funções
(C) BRASILNUT | DREAMSTIME.COM

e as principais junções
entre as células.

Na alfândega as malas e as pessoas são inspecionadas antes de entrar em outro país, assim como a membrana
plasmática verifica as substâncias que entram e saem da célula.

Material exclusivo para professores Como todas as membranas biológicas, a membrana plasmática apresenta per-
meabilidade seletiva, possibilitando que algumas substâncias tenham mais facilidade
de atravessá-la que outras. Certas substâncias precisam “pagar tributos”, na forma de

conveniados ao Sistema de Ensino


adenosina trifosfato (ATP), por meio de tipos especiais de transportes intracelulares.
É a estrutura molecular de cada membrana plasmática que possibilita a comparti-
mentalização de regiões especializadas no interior da célula.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 205 08/10/18 16:38
206 126 – Material do Professor

Estrutura da membrana Por serem fluidas, as membranas não são cama-


BIOLOGIA 1B

das estáticas em que as moléculas estão rigidamen-


plasmática te presas a um local. A maioria dos lipídios e algumas
proteínas podem se mover lateralmente no plano da
A membrana plasmática é uma estrutura bas-
membrana. No entanto, é muito raro que uma molé-
tante fina, possível de ser visualizada apenas ao mi-
cula mova-se transversalmente por meio da membrana
croscópio eletrônico. Os constituintes básicos das
(mudando de uma camada para outra), visto que seria
membranas são os lipídios e as proteínas, embora
necessário que a porção hidrofílica da molécula atraves-
os carboidratos também tenham grande importância.
sasse a porção hidrofóbica da membrana.
Geralmente essas macromoléculas estão presentes
Nas células animais, a fluidez da membrana plasmá-
na maioria das células, na proporção de 75% de lipí-
dios para 25% de proteínas, por isso a membrana é tica é garantida também por moléculas de colesterol
denominada lipoproteica. presas entre as moléculas de fosfolipídios, podendo
Em 1972, os cientistas S. J. Singer e G. Nicholson torná-la mais ou menos densa de acordo com a quan-
propuseram um modelo para explicar a estrutura da tidade dessas moléculas e a temperatura. A 37 ºC
membrana plasmática, o qual denominaram modelo (temperatura média que um organismo humano pode
do mosaico fluido. Segundo ele, a membrana é uma atingir), o colesterol torna a membrana menos fluida,
estrutura fluída como um “mosaico” e é formada por limitando o movimento dos fosfolipídios, por exemplo.
uma bicamada fosfolipídica, com proteínas distribuídas
entre elas e individualmente inseridas. FUNÇÃO DOS CARBOIDRATOS DA
Com já discutido durante o estudo sobre os lipí- MEMBRANA
dios, em virtude da estrutura molecular anfipática As moléculas de carboidratos presentes nas mem-
(formada por uma região hidrofílica e outra hidrofóbi- branas plasmáticas de animais e alguns protozoários
ca) da molécula lipídica, a capacidade de formar mem- estão aderidas a alguns lipídios e a proteínas, forman-
branas é inerente aos lipídios. Além disso, a maioria do os glicolipídios (lembre-se de que glico refere-se
das proteínas presentes na membrana também apre- aos carboidratos) e as glicoproteínas, voltados para o
senta regiões hidrofílicas e hidrofóbicas em sua estru- meio extracelular. Estas associações formam o glico-
tura molecular. cálix, ou glicocálice, cujas funções são proteger, reter
nutrientes e fazer o reconhecimento celular. Neste últi-
TOMASZ SWIERCZYNSKI/SHUTTERSTOCK

Meio extracelular Cabeça hidrofílica mo mecanismo, o glicocálix pode atuar como receptor
de outras moléculas que funcionam como mensageiros
químicos (como os hormônios ou algumas proteínas)
e desencadear reações químicas no meio intracelular.
Os carboidratos constituintes do glicocálix podem
variar entre indivíduos de espécies diferentes, entre in-
Meio intracelular Cauda hidrofóbica divíduos da mesma espécie e até mesmo de um tipo ce-
lular para outro no mesmo indivíduo. Quando não ocor-
Esquema da bicamada fosfolipídica em corte transversal. Elementos
representados fora da escala de tamanho. Cores fantasia.
re o reconhecimento célula-célula, reações alérgicas
podem ser desencadeadas. Um exemplo é o sistema
Esse arranjo molecular maximiza o contato entre sanguíneo humano, que tem quatro tipos – designados
as regiões hidrofílicas das proteínas e dos fosfolipí- por A, B, AB e O. Indivíduos do tipo sanguíneo A terão
dios com a água do citoplasma e do líquido extracelu- no glicocálix um tipo de carboidrato diferente de indiví-
lar, deixando a parte hidrofóbica voltada ao ambiente duos do tipo sanguíneo B, por exemplo. Isso reflete a
não aquoso. variação nos carboidratos da superfície das hemácias.

FUNÇÃO DAS PROTEÍNAS DA


DESIGNUA/DREAMSTIME.COM

Proteína Carboidrato
globular
MEMBRANA
O aspecto do modelo mosaico fluido é resultado da
Bicamada inserção de diferentes proteínas ao longo da membrana.
fosfolipídica
Enquanto os fosfolipídios formam o principal tecido dela,
as proteínas determinam a maior parte das funções.

Material exclusivo para professores


Conforme o tipo celular, haverá diferentes tipos de
Regiões
proteínas de membrana. Os principais são as proteínas
hidrofóbicas integrais e as periféricas.
Regiões hidrofílicas da proteína As proteínas integrais atravessam a porção hidro-

conveniados ao Sistema de Ensino


da proteína
fóbica da bicamada lipídica. Quando atravessam total-
O modelo mosaico fluido para membranas. Elementos representados mente a membrana, são chamadas de transmembra-
fora da escala de tamanho. Cores fantasia.
nas. No caso das proteínas que se estendem apenas

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 206 08/10/18 16:38
127 – Material do Professor 207

em parte da região hidrofóbica, são denominadas

THIS CONTENT IS SUBJECT TO COPYRIGHT.


integrais. Existem, ainda, algumas dessas proteínas

BIOLOGIA 1B
que têm um canal hidrofílico em seu centro, que
possibilita a passagem de substâncias hidrofílicas.
As proteínas periféricas são aquelas que não es-
tão embebidas na bicamada lipídica. São na verdade
apêndices que estão frouxamente ligados à superfície
da membrana, geralmente nas porções expostas de
proteínas integrais.
Em uma única célula pode haver várias proteínas
desempenhando uma única função, assim como é
possível que uma única proteína desempenhe múlti-
plas funções. Assim, além de ser um mosaico fluido, a
membrana é funcional e estrutural.
DESIGNUA/DREAMSTIME.COM

Porção extracelular
da membrana Eletromicrografia de transmissão de uma célula epitelial de um
intestino delgado humano em que se observam as microvilosidades.
Glicocálix Carboidrato Glicolipídio
Aumento de 6.000x.
Proteína
globular Colesterol A doença celíaca é uma reação imunológica ao glú-
ten. Ela causa uma inflamação grave no intestino e pode
levar à desnutrição por má absorção de nutrientes. Nos
celíacos, partículas não digeridas das proteínas do glú-
ten – como a gliadina, presente no trigo – conseguem
atravessar a parede intestinal. Isso desencadeia uma
reação do sistema imunológico, que agride as células
Proteína integral
da camada superficial do intestino delgado, gerando
Porção citoplasmática Proteína periférica uma inflamação.
da membrana
INTERDIGITAÇÕES
Estrutura detalhada da membrana plasmática de uma célula animal em As interdigitações realizadas pelas membranas plas-
corte transversal. Elementos representados fora da escala de tamanho.
Cores fantasia. máticas de duas células pareadas são especializações
de comunicação celular, cujo propósito é ampliar a su-
perfície de contato entre essas células.
ESPECIALIZAÇÕES DA É comum que uma região de membranas interdi-
gitadas seja o local em que ocorra alguma junção, que
MEMBRANA PLASMÁTICA pode ser descrita como evaginações e invaginações
Conforme o tipo celular, a membrana plasmática complementares para o interior do corpo de uma e de
tem várias especializações, seja ela de um organismo outra célula pareada. Seu local de ocorrência predomi-
unicelular ou pluricelular. Em determinadas células, é nante é a região lateral das células em proximidade. É
possível que a membrana plasmática apresente modifi- comum em células epiteliais.
cações que estão ligadas a uma especialização da fun-
(C) JLCALVO | DREAMSTIME.COM

ção. Algumas dessas diferenciações são bem conheci-


das nas células da superfície interna do intestino, como
as microvilosidades.

MICROVILOSIDADES
São minúsculas estruturas que formam um den-
so revestimento em forma de escova. Estendem-se
pela membrana plasmática, na superfície das células

Material exclusivo para professores


intestinais, aumentando assim a superfície de conta-
to para a absorção dos nutrientes. A vantagem é que
a microvilosidade aumenta a eficácia da absorção, e
é por isso que as células do epitélio do intestino del-

conveniados ao Sistema de Ensino


gado e dos túbulos renais são repletas dessas proje-
Micrografia eletrônica de transmissão mostrando interdigitações celulares
ções da membrana, tendo em vista que são áreas em complexas (uma delas destacada em vermelho) de quatro células
que a absorção é prioridade. epiteliais. Coloração artificial. Aumento desconhecido.

Dom Bosco
DB_PV_2019_BIO1B_P3.indd 207 08/10/18 16:39
208 128 – Material do Professor

Em células vegetais existem, ainda, os plasmodes- JUNÇÕES INTERCELULARES


BIOLOGIA 1B

mos, que são canais da membrana plasmática que atra- São estruturas ligadas à membrana que estão rela-
vessam a parede celular, possibilitando a conexão entre cionadas à adesão entre as células vizinhas. A seguir
os citoplasmas de células vizinhas e, consequentemen- constam alguns exemplos.
te, o transporte de água e de fotoassimilados entre as
células vegetais adjacentes. Desmossomos
Uma das mais importantes junções celulares são
CÍLIOS E FLAGELOS os desmossomos (do grego desmos = ligação e so-
São estruturas citoplasmáticas anexas à membrana matos = corpo). São pontos em forma de botões de
plasmática das células, originadas no prolongamento pressão constituídos por duas metades que se encai-
dos centríolos, constituídos de proteínas motoras, for- xam, fixando células adjacentes.
mando um conjunto de microtúbulos. Em cada célula existe uma placa circular de proteí-
O comprimento é variado, sendo os cílios mais na, situada junto à membrana. Das placas partem subs-
curtos e em maior quantidade na superfície da célula, tâncias colantes, chamadas desmogleínas, que atra-
enquanto os flagelos são mais longos e geralmente vessam as membranas e grudam as células na região
pouco numerosos. de contato.
A função desempenhada por cílios e flagelos é A função dessas estruturas é fixar filamentos inter-
basicamente locomotora. Por exemplo, os esperma- mediários de queratina, os quais servem para dar rigi-
tozoides e os gametas de briófitas e pteridófitas se dez ao citoplasma, pois formam uma rede contínua por
deslocam em direção ao gameta feminino por meio todo o tecido.
de flagelos.