Você está na página 1de 480

PRÉ-VESTIBULAR

EXTENSIVO
2
MATERIAL DO
PROFESSOR

Material exclusivo para professores


conveniados ao Sistema
Biologia de Ensino
CIÊNCIAS DA NATUREZA
E SUAS TECNOLOGIAS
Dom Bosco
INICIAIS_BIO_PROF_2BI.indd 1 14/12/2018 15:41
DOM BOSCO - SISTEMA DE ENSINO
PRÉ-VESTIBULAR 2
Ciências da natureza e suas tecnologias.
© 2019 – Pearson Education do Brasil Ltda.

Vice-presidência de Educação Juliano Melo Costa


Gerência editorial nacional Alexandre Mattioli
Gerência de produto Silvana Afonso
Autoria Ana Carolina Marinho Mota, Fernanda Lowndes, Leandro Magrini
Coordenação editorial Luiz Molina Luz
Edição de conteúdo Lauro Tozetto
Assistência de edição Bunni Costa
Leitura crítica Rafael Simões, Hannah Hamada, Lorena Milock de Freitas
Preparação e revisão Igor Debiasi, Adriana Bairrada, Luzia Leite, Renata Coppolla, Elaine Faires
Gerência de Design Cleber Figueira Carvalho
Coordenação de Design Diogo Mecabo
Edição de arte Alexandre Silva
Coordenação de pesquisa e
licenciamento Maiti Salla
Pesquisa e licenciamento Cristiane Gameiro, Heraldo Colon, Andrea Bolanho, Sandra Sebastião, Shirlei Sebastião
Ilustrações Alex Cói, Carla Viana, Dayane Cabral, Madine Oliveira
Cartografia Allmaps
Projeto Gráfico Apis design integrado
Diagramação Editorial 5
Capa Apis design integrado
Imagem de capa mvp64/istock
Produtor multimídia Cristian Neil Zaramella
PCP George Baldim

Todos os direitos desta publicação reservados à


Pearson Education do Brasil Ltda.
Av. Santa Marina, 1193 - Água Branca
São Paulo, SP – CEP 05036-001
Tel. (11) 3521-3500
www.pearson.com.br

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
INICIAIS_BIO_PROF_2BI.indd 2 14/12/2018 15:41
APRESENTAÇÃO

Um bom material didático voltado ao vestibular deve ser maior que um grupo de
conteúdos a ser memorizado pelos alunos. A sociedade atual exige que nossos jo-
vens, além de dominar conteúdos aprendidos ao longo da Educação Básica, conheçam
a diversidade de contextos sociais, tecnológicos, ambientais e políticos. Desenvolver
as habilidades a fim de obterem autonomia e entenderem criticamente a realida-
de e os acontecimentos que os cercam são critérios básicos para se ter sucesso no
Ensino Superior.
O Enem e os principais vestibulares do país esperam que o aluno, ao final do Ensino
Médio, seja capaz de dominar linguagens e seus códigos; construir argumentações
consistentes; selecionar, organizar e interpretar dados para enfrentar situações-proble-
ma em diferentes áreas do conhecimento; e compreender fenômenos naturais, proces-
sos histórico-geográficos e de produção tecnológica.
O Pré-Vestibular do Sistema de Ensino Dom Bosco sempre se destacou no mer-
cado editorial brasileiro como um material didático completo dentro de seu segmento
educacional. A nova edição traz novidades, a fim de atender às sugestões apresentadas
pelas escolas parceiras que participaram do Construindo Juntos – que é o programa rea-
lizado pela área de Educação da Pearson Brasil, para promover a troca de experiências,
o compartilhamento de conhecimento e a participação dos parceiros no desenvolvi-
mento dos materiais didáticos de suas marcas.
Assim, o Pré-Vestibular Extensivo Dom Bosco by Pearson foi elaborado por uma
equipe de excelência, respaldada na qualidade acadêmica dos conhecimentos e na prá-
tica de sala de aula, abrangendo as quatro áreas de conhecimento com projeto editorial
exclusivo e adequado às recentes mudanças educacionais do país.
O novo material envolve temáticas diversas, por meio do diálogo entre os conteú-
dos dos diferentes componentes curriculares de uma ou mais áreas do conhecimento,
com propostas curriculares que contemplem as dimensões do trabalho, da ciência, da
tecnologia e da cultura como eixos integradores entre os conhecimentos de distintas
naturezas; o trabalho como princípio educativo; a pesquisa como princípio pedagógi-
co; os direitos humanos como princípio norteador; e a sustentabilidade socioambiental
como meta universal.
A coleção contempla todos os conteúdos exigidos no Enem e nos vestibulares de
todo o país, organizados e estruturados em módulos, com desenvolvimento teórico
associado a exemplos e exercícios resolvidos que facilitam a aprendizagem. Soma-se a
isso, uma seleção refinada de questões selecionadas, quadro de respostas e roteiro de
aula integrado a cada módulo.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
INICIAIS_BIO_PROF_2BI.indd 3 14/12/2018 15:41
SUMÁRIO

5 BIOLOGIA 1A

95 BIOLOGIA 1B

195 BIOLOGIA 2A

245 BIOLOGIA 2B

303 BIOLOGIA 3A

Material exclusivo para professores


conveniados ao Sistema de Ensino 353 BIOLOGIA 3B

Dom Bosco
INICIAIS_BIO_PROF_2BI.indd 4 14/12/2018 15:42
K PHOTO
Y STOC
/ ALAM
IMAGES
BLEND

BIOLOGIA 1A

Material exclusivo para professores


conveniados ao Sistema de Ensino
CIÊNCIAS DA NATUREZA E SUAS TECNOLOGIAS

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 167 14/12/18 12:42
17
168
BIOLOGIA 1A 6 –Material do Professor

RESPIRAÇÃO AERÓBIA

Em 2017, pesquisadores da USP criaram compostos antitumorais por meio da


isatina, um metabólito encontrado em organismos vegetais e animais com potencial
• Energia para os seres vivos uso na fabricação de medicamentos. Nesses compostos foram adicionados alguns
• ATP, a molécula energética íons de metais, como o cobre e o zinco.
• Respiração aeróbia e As modificações estruturais com os compostos de isatina produzidas no labora-
mitocôndrias tório são estáveis, de forma que sua ação é potencializada e permite que entrem na
corrente sanguínea e penetrem facilmente nas células cancerosas.
HABILIDADES As mitocôndrias possuem seu próprio DNA mitocondrial e são responsáveis pela
• Identificar as transfor- respiração aeróbia, na qual as moléculas orgânicas reagem com o oxigênio, para a
mações de energia no formação de energia em forma de moléculas de ATP (adenosina trifosfato).
metabolismo celular. Ao entrar nas células, a isatina liga-se ao DNA e danifica essa molécula por meio
• Reconhecer respiração de processos oxidativos, induzindo a perda do potencial de membrana das mitocôn-
aeróbia como um processo drias. Isso modifica a sua estrutura e, consequentemente, interfere na respiração
do metabolismo celular celular. Assim, a desestruturação das moléculas de DNA celular e mitocondrial pro-
energético.
voca a degradação das células tumorais.
• Identificar os principais

STEVE GSCHMEISSNER/SCIENCE PHOTO LIBRARY/GETTY IMAGES


organismos capazes de
fazer respiração aeróbia.
• Compreender a importância
do processo de respiração
aeróbia para a manutenção
bioenergética dos seres
vivos.

Material exclusivo para professores


conveniados ao Sistema de Ensino Representação de células de linfócitos T (células redondas menores) ligadas a uma célula cancerígena em
micrografia eletrônica. Aumento de 25 000x. Cores fantasia.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 168 14/12/18 12:42
7 –Material do Professor 169

ENERGIA PARA OS SERES VIVOS

BIOLOGIA 1A
A Bioenergética é a área da Biologia que estuda como são realizadas as trans-
formações de energia nos seres vivos. A vida na Terra depende do Sol, considerada
fonte primária de energia que se transformará em energia química por meio da
fotossíntese. Para que aconteça essa transformação, as células vegetais captam a
luz do Sol e convertem H2O (água) e CO2 (gás carbônico) em glicose, amido e outras
moléculas orgânicas ricas em energia, liberando O2 (gás oxigênio) na atmosfera. As
células animais irão degradar as moléculas orgânicas para obter e depois armazenar
essa energia em moléculas de ATP (adenosina trifosfato), liberando CO2 e água.
Os alimentos fornecem a energia necessária para realizar todas as atividades,
como andar, pensar, correr, falar e realizar qualquer outro tipo de ação. Isso porque,
em algum momento, a energia foi captada na forma de fótons de luz solar e arma-
zenada em moléculas de amido, que mais tarde se tornarão constituintes desses
alimentos. Contudo, a energia contida na molécula de ATP não pode ser utilizada
diretamente nos processos energéticos, uma vez que boa parte dela é transformada
em calor, sendo assim danosos às células. Por isso, essa transferência de energia
acontece por meio de diversos processos de transformação bioenergética.

Respiração em célula animal

transporte; movimentação;
Fotossíntese recepção e transmissão
O2
de estímulos; acúmulo e
Trabalho
CO2 transmissão de informação
genética; síntese de com-
H2O ATP postos químicos

Cloroplasto

Mitocôndria

Energia
acumulada em
compostos
Degradação do alimento
químicos
com liberação de energia,
(nutrientes)
CO2 e H2O
nos alimentos

O esquema apresenta a fotossíntese no interior dos cloroplastos de uma planta e posterior degradação dos alimentos
em uma célula animal. Por meio desse processo serão liberados CO2 e H2O para o ambiente e será armazenada a
energia em moléculas de ATP. Elementos representados fora da escala de tamanho. Cores fantasia.

ATP, A MOLÉCULA ENERGÉTICA


A molécula de adenosina trifosfato (ATP) é formada por uma adenina, uma ribose
e três grupos de fosfatos, conforme representado na fórmula a seguir.

NH2

N C
C N
O O O HC
C CH

Material exclusivo para professores


OH P O P O P O CH2 N
N
O
OH OH OH C C
H H
H

conveniados ao Sistema de Ensino


H C C

OH OH

Fórmula estrutural da molécula ATP.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 169 14/12/18 12:42
170 8 –Material do Professor

As ligações que unem os grupos fosfato adicionais TRANSPORTADORES DE HIDROGÊNIO:


BIOLOGIA 1A

são ricas em energia e podem ser desfeitas por rea-


NAD+, NADP+ E FAD
ções de hidrólise, que fazem com que a molécula de
As reações químicas que transferem elétrons são
ATP se converta em ADP (adenosina difosfato), liberan-
denominadas reações de oxirredução, pois o reagente
do grupos fosfato e energia para as células.
que é oxidado perde elétrons e o que ganha é reduzido.
Esse processo faz com que a perda de elétrons libere
ATP → ADP 1 Pi energia e o ganho de elétrons promove o ganho dela.
Durante os processos de síntese e degradação de
A remoção de mais de um grupo fosfato da molé- moléculas orgânicas, há muitas reações com liberação
cula de ADP resulta em um monofosfato de adenosina de elétrons e de átomos de hidrogênio (H1), que são
(AMP), liberando uma quantidade menor de energia. captados por substâncias chamadas transportado-
ras de hidrogênio. As formas oxidadas são o NAD1,
ADP → AMP 1 Pi NADP1 e FAD. Eles são nucleotídeos associados às
A célula pode armazenar a energia em moléculas vitaminas nicotinamida e riboflavina, respectivamente,
de ATP, incorporando um fosfato na molécula de ADP, de forma que são denominados nicotinamida adenina
reação denominada fosforilação. As células fotos- dinucleotídeo (NAD), nicotinamida adenina dinucleo-
sintetizantes utilizam a luz nesse processo. Além tídeo fosfato (NADP) e flavina adenina dinucleotídeo
disso, quando a energia é proveniente da oxidação (FAD). Ao receberem elétrons e hidrogênios, NAD1,
de moléculas orgânicas, o processo é chamado NADP1 e FAD tornam-se reduzidos.
fosforilação oxidativa.
A hidrólise e a fosforilação podem ocorrer simulta- NAD 1 1 H → NADH
neamente, de maneira que a energia liberada em uma NADP1 1 H → NADPH
seja armazenada pela outra. Quando isso acontece, FAD 1 2 H → FADH 2
chamamos de reações acopladas, como quando a gli-
cose é oxidada, transferindo energia para a molécula de Vale lembrar que, embora NAD1 e NADP1 sejam
ATP. O acoplamento de reações diminui a quantidade semelhantes, atuam em processos distintos, uma vez
de energia perdida, de maneira que podemos imaginar que o primeiro atua nos processos catabólicos (como
o ATP como uma bateria que, ao liberar energia, se a fermentação e a respiração, quebrando moléculas
descarrega e se transforma em ADP. para obtenção de energia) e o segundo atua em proces-
sos anabólicos (como a fotossíntese e a quimiossín-
Hidrólise
tese, que sintetizam moléculas e absorvem energia).
ATP ADP 1 Pi
Fosforilação
O FAD também atua em processos catabólicos, mas
em apenas algumas etapas da respiração.

Energia contida Produtos finais


nos nutrientes
CO2
Catabolismo
Glicídios H2O
Lipídios
Prótidos NH3

Liberação

ADP 1 HPO 2-
4
ATP
NAD1 NADH
NADP1 Energia NADPH
FAD química FADH2

Macromoléculas
Moléculas precursoras
celulares Oxidação
Aminoácidos

Material exclusivo para professores


Polissacarídeos Anabolismo Monossacarídeos
Proteínas
Ácidos graxos
Lipídios
Nucleotídeos
Ácidos nucleicos

conveniados ao Sistema de Ensino


Há liberação de energia nos processos catabólicos, que pode ser armazenada em forma de ATP e transportada em forma de
NADH, NADPH e FADH2. Entretanto, a energia é consumida nos processos anabólicos, promovendo a oxidação dessas moléculas
transportadoras.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 170 14/12/18 12:42
9 –Material do Professor 171

RESPIRAÇÃO AERÓBIA E e conseguem se autoduplicar. Acredita-se que as mito-


côndrias tenham sido bactérias aeróbias que há bilhões

BIOLOGIA 1A
MITOCÔNDRIAS de anos foram englobadas por células eucarióticas
(teoria da endossimbiose), como visto na unidade 1.
Quando se fala em respiração, é comum as pessoas A mitocôndria é delimitada por dupla membrana
a associarem com as trocas gasosas realizadas entre lipoproteica, de maneira que a membrana externa é lisa
os indivíduos e o ambiente por meio das brânquias, e a interna é composta de numerosas pregas denomi-
pele e pulmões, ao eliminar CO2 e obter O2. Entretan- nadas cristas mitocondriais. Quanto mais a célula for
to, nesse módulo, o processo de respiração abordado ativa, maior será o número de mitocôndrias presentes.
refere-se à forma de obtenção de energia com base na O espaço interno da mitocôndria é denominado matriz
síntese de ATP, proveniente da degradação da molécula mitocondrial.
de glicose por um processo denominado respiração As atividades mitocondriais associam-se ao meta-
celular. Existem dois tipos de respiração celular: a bolismo energético das células e à produção de ATP de
aeróbia (realizada na presença de oxigênio) e a anae- forma compartimentalizada, por ocorrerem em parte
róbia (realizada na ausência do oxigênio). na matriz parte junto às cristas.
RESPIRAÇÃO AERÓBIA

SCIENCE PHOTO LIBRARY – SPL/SCIENCE PHOTO


LIBRARY – SPL/FOTOARENA
A respiração aeróbia refere-se aos processos bio-
químicos que envolvem oxigênio nas reações com o
objetivo de adquirir energia pela degradação completa
da glicose. Esse processo diferencia-se da respiração
anaeróbia por, além de utilizar o oxigênio proveniente
do ambiente, produzir como saldo final 36 ou 38 ATP.
Observe a equação geral da respiração aeróbia:

C6H12O6 1 6 O2 1 →
→ 6 CO2 1 6 H20 1 energia

Em organismos eucariotos, a respiração aeróbia


ocorre no hialoplasma e nas mitocôndrias. Já em se-
res procariotos irá acontecer no citosol, resultando
em 38 ATP. Micrografia eletrônica de transmissão com a representação esquemática
da estrutura de uma mitocôndria. Aumento desconhecido.
Mitocôndrias e a respiração aeróbia
As mitocôndrias estão presentes em uma das eta- ETAPAS DA RESPIRAÇÃO AERÓBIA
pas da respiração aeróbica. Elas são organelas encon- A respiração aeróbia divide-se em quatro etapas:
tradas nas células eucarióticas, variando entre 1 000 e glicólise, formação do Acetil CoA (ou etapa interme-
50 000 por célula. Possuem ribossomos, DNA próprio diária), ciclo de Krebs e cadeia respiratória.

Respiração aeróbia

CO2 CO2 O2
H2O

e- 1 H1

3 4
1 2 Cadeia
Formação Ciclo de transportadora
Glicose Glicólise Piruvato Acetil CoA Krebs NADH; FADH2
de de elétrons e
Acetil CoA fosforilação

Material exclusivo para professores2 ATP

NADH NADH
2 ATP

Mitocôndria
32 ou 34
ATP

conveniados ao Sistema de Ensino


Visão geral das etapas da respiração aeróbia, enfatizando os locais onde cada uma delas ocorre. A glicólise ocorre no hialoplasma, enquanto a formação
de Acetil CoA e o ciclo de Krebs ocorrem na matriz mitocondrial e a cadeia respiratória ocorre nas cristas mitocondriais. Elementos representados fora da
escala de tamanho. Cores fantasia.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 171 14/12/18 12:42
172 10 – Material do Professor

Glicólise
BIOLOGIA 1A

No hialoplasma ou no citosol acontece a quebra da molécula de glicose (com-


posta de 6 carbonos), dando origem a duas moléculas de piruvato ou ácido pirúvico
(compostas de 3 carbonos cada uma) e quatro moléculas de ATP. O resultado desse
processo é duas moléculas de ATP (visto que dois ATP são consumidos para iniciar a
reação) e átomos de hidrogênio ricos em energia, que serão recolhidos pelo cofator
NAD, transformando-se em NADH2. A representação dessa fase é demonstrada na
equação abaixo:

C6H12O6 1 2 ATP → 2 piruvato 1 2 ATP 1 2 NADH2

Os piruvatos são essenciais no metabolismo celular, já que podem ser usados


tanto nos processos aeróbios como nos anaeróbios. O oxigênio é o fator determi-
nante de qual via o piruvato seguirá. Em condições aeróbias, o piruvato é degradado
em CO2 e H2O na respiração. Já na ausência de oxigênio, é parcialmente degradado
durante a fermentação.

FASE INTERMEDIÁRIA: FORMAÇÃO DO ACETIL CoA


Na fase intermediária estabelecida entre a glicólise e o ciclo de Krebs, o piruvato
originado entra na matriz mitocondrial e é transformado em acetil, reagindo com a
coenzima A (CoA-SH), formando Acetil CoA (uma molécula de 2 carbonos). Durante
esse processo, são liberadas uma molécula de CO2 e uma de hidrogênio (ligado a
NADH2). Observe a equação abaixo.

Acetil 1 CoA 1 NAD1 → Acetil CoA 1 NADH 1 CO2 1 H1

Ciclo de Krebs
O ciclo de Krebs é também conhecido como ciclo do ácido cítrico. Nesta etapa,
o Acetil CoA formado na etapa intermediária combina-se com o oxalacetato (com-
posto de 4 carbonos) na matriz mitocondrial, dando origem ao citrato e liberando a
coenzima A. Ao longo do ciclo, o citrato perde carbonos, produzindo CO2 e moléculas
de hidrogênio. Estes últimos são captados por NAD e FAD. Por fim, o composto de
4 carbonos é formado novamente, reiniciando o ciclo.
Ao final, são formadas duas moléculas de ácido pirúvico; portanto, o rendimento
geral dessa etapa é de 2 moléculas de ATP. Além disso, são liberados CO2, ATP,
NADH2 e FADH2.

Acetil CoA
2C
CoA

Composto de Citrato
4C 6C

NADH 1 H1

FADH2 CO2

ATP NADH 1 H1

Material exclusivo para professores


4C 5C

CO2

conveniados ao Sistema de Ensino


NADH 1 H1

Esquema que representa o Acetil CoA se combinando como oxalacetato


e dando início ao ciclo de Krebs.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 172 14/12/18 12:42
11 – Material do Professor 173

Cadeia respiratória

BIOLOGIA 1A
Esta etapa, também conhecida como cadeia transportadora de elétrons, ocorre
nas cristas mitocondriais e é basicamente o estágio em que os hidrogênios trans-
portados por NAD1 e FAD1 se unem ao oxigênio, produzindo moléculas de água e
ATP. À medida que as moléculas de hidrogênio são transferidas ao longo da cadeia
respiratória, ocorre liberação de elétrons excitados, os quais são captados por vários
transportadores intermediários (proteínas) denominados citocromos. Na passagem
de elétrons pela cadeia respiratória, há liberação de energia suficiente para que uma
molécula de ADP se ligue a mais um fosfato, originando um ATP. Por conta disso,
esse processo é chamado de fosforilação oxidativa.

NADH2 ATP

FAD
2H1
2e

Citocromo b
ATP
2e

Nível Citocromo c
energético 2e

Citocromo a ATP
2e

Citocromo a3
2e

O H2O

As moléculas de NADH e FADH2 dispensam os hidrogênios dentro das cristas mitocondriais, que liberam elétrons
excitados. Estes são transferidos através dos citocromos, produzindo energia para a síntese de ATP.

A cadeia respiratória pode ser comparada a uma cachoeira: à medida que os


elétrons passam pelos citocromos, vão liberando energia; da mesma forma, a água
possui grande energia no início da queda e, ao final, possui baixa energia potencial.
Ao final da passagem pelos componentes da cadeia respiratória, os elétrons são
recolhidos junto aos íons H1 pelo oxigênio, formando moléculas de água.

2e 1 2 H 1 1 ½ O 2 → H 2O

O oxigênio em questão é proveniente do ambiente e é o aceptor final de hidro-


gênio. A falta de oxigênio impede que os elétrons sejam removidos do complexo
de citocromos, cessando a produção de ATP e, consequentemente, promove morte
celular. O cianeto é um veneno poderoso que se liga aos citocromos, estabilizando
os elétrons em trânsito, promovendo o mesmo efeito que a falta de oxigênio.

BALANÇO ENERGÉTICO DA RESPIRAÇÃO AERÓBIA


Ao longo das etapas da respiração aeróbia, foram produzidas diretamente
2 moléculas de ATP na etapa da glicólise, bem como no ciclo de Krebs, totalizando
4 moléculas de ATP. Cada molécula de NADH2 libera energia suficiente para formar 3
moléculas de ATP, assim como cada molécula de FADH2 libera energia para produzir
2 moléculas de ATP.
Na glicólise, foram produzidas 2 moléculas de NADH2, que posteriormente pro-

Material exclusivo para professores


duzem 6 ATP na cadeia respiratória, bem como na etapa intermediária, totalizando
12 moléculas de ATP.
No ciclo de Krebs, são produzidas 6 moléculas de NADH2, que posteriormente
produzem 18 moléculas de ATP. Além disso, são produzidas 2 moléculas de FADH2,

conveniados ao Sistema de Ensino


que posteriormente produzem 4 ATP. Dessa forma, são produzidos ao todo 38 ATP.
Entretanto, algumas células eucarióticas como as da musculatura esquelética
humana e algumas do cérebro, têm como saldo energético o total de 36 ATP por

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 173 14/12/18 12:42
174 12 – Material do Professor

molécula de glicose degradada. Isso acontece devido a um mecanismo relacionado


à entrada de NADH na mitocôndria, no qual há gasto de 1 ATP por NADH. Como
BIOLOGIA 1A

são 2 NADH produzidos na glicólise por molécula de glicose, o fasto total é de


2 ATP. Por isso, dependendo da célula eucariótica, o saldo total de ATP pode ser de
36 ou 38 ATP.

Balanço energético da respiração aeróbia

ATP na
Saldo
Etapa Produz Gasta Ocorrência cadeia
(ATP)
respiratória
4 ATP 2 ATP 1 vez - 2
Glicólise
2 NADH2 1 vez 3 ATPs 6
Formação do
1 NADH2 - 2 vezes 3 ATPs 6
acetil

Ciclo de 3 NADH2 - 2 vezes 3 ATPs 18


Krebs e
1 FADH2 - 2 vezes 2 ATPs 4
cadeia
respiratória 1 ATP - 2 vezes - 2
Total 38

LEITURA COMPLEMENTAR
A glicose é uma molécula de carboidrato de suma importância para o processo de
respiração aeróbia. Entretanto, as proteínas também podem ser utilizadas como fonte
de energia, bem como as gorduras.
Durante a digestão, as proteínas são quebradas em diversos aminoácidos, que serão
utilizados na produção de outras proteínas. Contudo, se houver um excesso de in-
gestão de proteínas, haverá um excesso de aminoácidos, de maneira que eles serão
convertidos em ácido pirúvico por meio de enzimas, ou em produtos intermediários
do ciclo de Krebs.
As gorduras, durante a digestão, são quebradas em ácidos graxos e glicerol. Este último é
convertido em um produto intermediário da etapa da glicólise, sendo utilizado na respi-
ração aeróbia. Além disso, os ácidos graxos também são convertidos em substâncias que
participam do ciclo de Krebs.
Nas etapas da respiração aeróbia os carboidratos, as proteínas e os lipídios estão presentes,
como mostra o quadro. .

Respiração
Glicólise Ciclo de Krebs
aeróbica
Carboidratos Glicose –

Proteínas Aminoácidos Aminoácidos

Lipídios Glicerol Ácidos graxos

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 174 14/12/18 12:42
13 – Material do Professor 175

ROTEIRO DE AULA

BIOLOGIA 1A
Respiração celular

Presença de O2 Ausência de O2

C6H12O6 + 6 O2 → 6 CO2 + 6 H2O + energia


Equação Aeróbia Anaeróbia
geral

Gasto em Saldo em
Etapas: Local: Produz:
ATP: ATP:

Glicólise Hialoplasma 4 ATPs 2 ATPs 2 ATPs

Formação do Matriz 1 NADH2 0 ATP 6 ATPs


Acetil CoA mitocondrial

3 NADH2
Ciclo de Krebs Matriz 0 ATP 24 ATPs
1 FADH2

Material exclusivo para professores mitocondrial


1 ATP

conveniados ao Sistema de Ensino


Cadeia
respiratória
Cristas mitocondriais

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 175 14/12/18 12:42
176 14 – Material do Professor

EXERCÍCIOS DE APLICAÇÃO
BIOLOGIA 1A

1. Uema – A maioria dos seres vivos obtém energia ne- b) No citoplasma ocorrem o ciclo de Krebs e a glicólise.
cessária para a realização de seus processos vitais por c) Nas cristas mitocondriais, local que ocorre a cadeia res-
meio da quebra da molécula de glicose. A energia li- piratória, temos a transferência dos hidrogênios trans-
berada resultante dessa degradação é tão grande que portados pelo NAD e pelo FAD, formando água e ATP.
mataria a célula se fosse realizada de uma única vez. d) O ciclo de Krebs ocorre também nos processos anae-
Essa degradação ocorre em etapas denominadas róbios, enquanto nas etapas da respiração a glicólise
a) glicólise, ciclo do ácido cítrico e cadeia respiratória. é uma rota metabólica que só ocorre nos processos
b) cadeia respiratória, ciclo do ácido cítrico e glicose. aeróbios.
c) gliconeogênese, glicólise e ciclo do ácido cítrico. e) Uma molécula de glicose é quebrada em duas molé-
culas de ácido pirúvico no ciclo de Krebs.
d) glicose, gliconeogênese e cadeia respiratória.
A alternativa A está incorreta porque a glicólise não utiliza O2.
e) ciclo do ácido cítrico, glicose e glicólise. A alternativa B está incorreta porque o ciclo de Krebs ocorre na
matriz mitocondrial. A alternativa D está incorreta porque essa
As etapas da respiração aeróbia são: glicólise, ciclo do ácido
etapa ocorre apenas em processos aeróbios, enquanto a glicó-
cítrico (ou ciclo de Krebs) e cadeia respiratória.
lise ocorre em processos aeróbios e anaeróbios. A alternativa E
está incorreta porque esse processo ocorre durante a glicólise.
2. UFRGS – A mitocôndria é uma organela da célula euca-
5. Udesc – Assinale a alternativa correta quanto à respi-
riótica. Considere as seguintes afirmações sobre essa
ração celular.
organela.
a) Uma das etapas da respiração celular aeróbia é a
I. A membrana interna forma pregas, possibilitando
glicólise, ocorre na matriz mitocondrial e produz
o aumento da superfície que contém proteínas e
Acetil CoA.
enzimas da cadeia respiratória.
b) A respiração celular aeróbia é um mecanismo de que-
II. A membrana externa apresenta aceptores que par-
bra de glicose na presença de oxigênio, produzindo
ticipam da glicólise.
gás carbônico, água e energia.
III. Ela está presente em abundância nas células do te-
c) O ciclo de Krebs é uma das etapas da respiração
cido muscular estriado esquelético.
celular, ocorre no citoplasma da célula e produz duas
Quais estão corretas? moléculas de ácido pirúvico.
a) Apenas I. d) A etapa final da respiração celular é a glicólise, ocorre
na membrana interna da mitocôndria e produz três
b) Apenas II.
moléculas de NADH2, uma molécula de FADH2 e uma
c) Apenas I e III. molécula de ATP.
d) Apenas II e III. e) A cadeia respiratória é a etapa final da respiração
e) I, II e III. celular e ocorre no citoplasma da célula, produzindo
A afirmativa I está correta porque de fato as mitocôndrias pos-
glicose e oxigênio.
suem “pregas”, denominadas cristas, e nelas é realizada a etapa A alternativa A está incorreta porque a glicólise produz ácido
de cadeia respiratória. A afirmativa II está incorreta porque não pirúvico. A alternativa C está incorreta porque ocorre na matriz
necessita de aceptores na etapa da glicólise, uma vez que essa mitocondrial e produz NADH2, FADH2, CO2 e ATP. A alternativa D
etapa se dá pela quebra da molécula de glicose, originando está incorreta porque a etapa final é a cadeia respiratória, pro-
ácido pirúvico. A afirmativa III está correta porque esse tecido duzindo ATPs a partir de NADH2 e FADH2 oriundos das etapas
é o principal componente muscular no corpo dos organismos, anteriores. A alternativa E está incorreta porque essa etapa
responsável pela maioria dos movimentos e necessita de grande ocorre nas cristas mitocondriais e produz ATP e água.
quantidade de energia para realizá-los.

3. Uerj (adaptada) – As células musculares presentes nas 6. Sistema Dom Bosco – Existe uma etapa da respira-
asas das aves migratórias possuem maior concentra- ção aeróbia comum à respiração anaeróbia, realizada
ção de determinada organela, se comparada às células no hialoplasma celular. Cite e explique o que ocorre
musculares do restante do corpo. Esse fato favorece a nessa etapa.
utilização intensa de tais membros por esses animais.
Cite que organela é essa e explique como ela pode A etapa comum entre respiração aeróbia e anaeróbia é denominada
favorecer a intensa utilização muscular.
A organela é a mitocôndria e ela pode favorecer a intensa atividade glicólise. Nela, a molécula de glicose é quebrada, originando duas

muscular nas asas por ser responsável pela produção de energia atra- moléculas de ácido pirúvico, duas moléculas de NADH2 e 4 molé-

vés da respiração aeróbia celular, gerando 38 ATPs por molécula de culas de ATP. Entretanto, duas moléculas de ATP são consumidas

glicose consumida. durante o processo, tendo como saldo final 2 moléculas de ATP.

Material exclusivo para professores


4. IFS (adaptada) – Visando à liberação de energia a partir
da quebra de moléculas orgânicas complexas, temos
a respiração aeróbia que se processa em três etapas
distintas: glicólise, ciclo de Krebs e cadeia respiratória.

conveniados ao Sistema de Ensino


Com relação a essas etapas, indique a alternativa correta:
a) Durante a glicólise, ocorre no citoplasma a utilização
de O2.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 176 14/12/18 12:42
15 – Material do Professor 177

EXERCÍCIOS PROPOSTOS

BIOLOGIA 1A
7. IFTO – Na cadeia respiratória, há transferência de elétrons de um citocromo para outro,
esse processo implica a liberação de energia. Por quem é capturada essa energia? E
quem é o aceptor final de elétrons?
a) Pelo ADP; o NAD.
b) Pelo ATP; o FAD.
c) Pelo ATP; o oxigênio.
d) Pelo ADP; o oxigênio.
e) Pelo ATP; o NAD.

8. UEL-PR – Pode-se considerar a organização e o funcionamento de uma célula eucarió-


tica animal de modo análogo ao que ocorre em uma cidade. Desse modo, a membrana
plasmática seria o perímetro urbano e o citoplasma, com suas organelas, o espaço
urbano. Algumas dessas similaridades funcionais entre a cidade e a célula correspon-
deriam às vias públicas como sendo o retículo endoplasmático, para o transporte e a
distribuição de mercadorias; os supermercados como sendo o complexo golgiense,
responsável pelo armazenamento de mercadorias, e a companhia elétrica como sen-
do as mitocôndrias, que correspondem à usina de força da cidade. Pode-se, ainda,
considerar que a molécula de adenosina trifosfato (ATP) seja a moeda circulante para
o comércio de mercadorias.

Assinale a alternativa que justifica, corretamente, a analogia descrita para as mito-


côndrias.
a) Absorção de energia luminosa utilizada na produção de ATP.
b) Armazenamento de ATP produzido da energia de substâncias inorgânicas.
c) Armazenamento de ATP produzido na digestão dos alimentos.
d) Produção de ATP a partir da oxidação de substâncias orgânicas.
e) Produção de ATP a partir da síntese de amido e glicogênio.

9. Unifor-CE

GLICOSE
Etapa A

PIRUVATO Etapa B

Etapa C

H2O
O2

Observando o esquema acima, avalie as afirmações que se seguem:


I. A etapa anaeróbica do processo de degradação da glicose, que acontece no citosol.
II. A maior parte do NADH é produzida no interior da mitocôndria durante a etapa B.
III. A síntese da maior parte do ATP está acoplada à redução das moléculas de NADH
e FADH2, que se transformam em NAD1 e FAD, respectivamente, e ocorre durante
a etapa B.
IV. A etapa C ocorre nas cristas mitocondriais e produz maior quantidade de ATP do
que a etapa B.
É correto apenas o que se afirma em:

Material exclusivo para professores


a) I e II
b) I e III
c) II e IV

conveniados ao Sistema de Ensino


d) I, II e IV
e) II, III e IV

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 177 14/12/18 12:42
178 16 – Material do Professor

10. UPF-RS (adaptada) – Considere a figura abaixo, a qual representa, de forma esque-
BIOLOGIA 1A

mática, um importante processo da fisiologia celular. Com base na análise da figura,


cite e explique o que acontece na etapa 3.
glicose

ETAPA 1 2 NADH 4 ATP


2 E
ATP
2 piruvato T
A
2 P 6 ATP
2 Acetil CoA NADH
A

2CO2
6 NADH 3 18 ATP

2 ETAPA 2
ATP
2 FADH2 4 ATP
4CO2
O2 H2O

Disponível em: <http://epartfoliosusana.webnode.pt/>. Acesso em: 16 abr. 2014.

11. UEM-PR – A liberação de energia a partir da quebra de moléculas orgânicas complexas


compreende basicamente três fases: glicólise, ciclo de Krebs e cadeia respiratória.
Sobre esse assunto, assinale o que for correto.
01) Na cadeia respiratória, que ocorre nas cristas mitocondriais, o NADH e o FADH2 fun-
cionam como transportadores de íons H1.
02) A glicólise é um processo metabólico que só ocorre em condições aeróbicas,
enquanto o ciclo de Krebs ocorre também nos processos anaeróbicos.
04) Nas células eucarióticas, a glicólise ocorre no citoplasma, enquanto o ciclo de
Krebs e a cadeia respiratória ocorrem no interior das mitocôndrias.
08) No ciclo de Krebs, uma molécula de glicose é quebrada em duas moléculas de
ácido pirúvico.

12. UFPR – A figura abaixo representa o transporte de elétrons (e–) pela cadeia respiratória
presente na membrana interna das mitocôndrias. Cada complexo possui metais que
recebem e doam elétrons de acordo com seu potencial redox, na sequência descrita.
Caso uma droga iniba o funcionamento do citocromo C (cit. c), como ficarão os estados
redox dos componentes da cadeia?
cit. c
e-
3

4
xo

xo
ple
o1

ple
m

m
plex

Co

Co

e–
Com

UQ
e–

e- 2x

NADH 1 H1 NAD1
2 H1 1 ½ O2 H2O

Complexo 1 Ubiquinona (UQ) Complexo 3 Complexo 4


a) reduzido reduzido reduzido oxidado

Material exclusivo para professores


b) reduzido reduzido neutro oxidado
c) oxidado oxidado reduzido reduzido

conveniados ao Sistema de Ensino


d) oxidado oxidado neutro reduzido
e) oxidado oxidado oxidado neutro

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 178 14/12/18 12:42
17 – Material do Professor 179

13. PUC-PR – Leia o fragmento de texto a seguir:

BIOLOGIA 1A
Mars One: já há quem saiba como produzir água e oxigênio em Marte.
Os primeiros colonos da Mars One deverão sobreviver no planeta vizinho suportados por
sistemas que geram oxigênio a partir da eletrólise e produzem água recorrendo a compo-
nentes existentes no solo marciano.
As naves do consórcio Mars One só deverão partir para Marte depois de 2023 – e pelo
meio ainda haverá um reality show para a seleção da primeira colônia humana e recolha
de fundos. As previsões do consórcio holandês apontam para o envio de 24 a 40 pessoas
para o planeta vizinho. O que coloca a questão: como vão viver estas pessoas se algu-
ma vez chegarem a Marte? A resposta à questão já começou a tomar forma: a empresa
Paragon, que havia sido previamente selecionada pelo consórcio Mars One, acaba de dar
a conhecer as linhas mestras de uma solução conhecida como Controle Ambiental do
Habitat de Superfície e Sistema de Suporte à Vida (ECLSS) que terá como objetivo prover
os primeiros colonos de Marte com água e oxigênio a partir de recursos existentes em
Marte ou que derivam da atividade humana enquanto se encontra no denominado plane-
ta vermelho. A Paragon aproveitou a experiência ganha, durante as duas últimas décadas,
no desenvolvimento de suporte da vida humana em ambientes inóspitos para delinear
uma solução composta por cinco módulos – que recriam o ciclo da água e do oxigênio.
Entre os módulos essenciais figura o Sistema de Gestão da Atmosfera (AMS), que tem por
objetivo a produção de oxigênio através da eletrólise da água. Este módulo também estará
apto a detectar incêndios e compostos nocivos, bem como a proceder à monitorização do
dióxido de carbono. A produção de oxigênio será seguramente uma das preocupações
prioritárias para o ambicioso projeto de instalação de uma colônia em Marte, mas não
poderá funcionar sem o apoio de outros módulos. A água usada na eletrólise (que produ-
zirá o oxigênio) será produzida por um Sistema de Processamento de Recursos (ISRPS) a
partir dos componentes existentes no solo marciano. O ISRPS deverá ainda assegurar a
produção de nitrogênio e argônio a partir da atmosfera marciana.
Disponível em: <http://exameinformatica.sapo.pt/noticias/ciencia/2015-07-01-Mars-One-ja-ha-quem-
-saiba-como-produzir-agua-e-oxigenio-em-Marte&gt;. Acesso em: nov. 2018.

Imagine que, pelas condições do planeta, a produção que será feita não seja exata-
mente de oxigênio, mas de um elemento análogo. Se esse elemento conseguisse
ser utilizado pelo corpo, na mitocôndria, ele seria usado para formação de água e,
portanto, seria detectado:
a) no ciclo de Krebs.
b) na glicólise.
c) no ciclo de Calvin.
d) na cadeia respiratória.
e) na fase de Hill.

14. USC (adaptado) – A energia que movimenta e mantém a vida no planeta é o ATP,
a moeda energética. A maioria dos seres vivos produz ATP por meio da respiração
celular. Observe o quadro abaixo que representa o balanço energético de uma res-
piração aeróbia.

ATP na
Saldo
Etapa Produz Gasta Ocorrência cadeia
(ATP)
respiratória
4 ATP I 1 vez – 2 ATP
Glicólise
2 NADH2 – 1 vez II 6 ATP
Ciclo de
1 ATPs – 2 vezes – 2 ATP
Krebs
1 NADH2 – III 3 ATP 6 ATP

Material exclusivo para professores


Cadeia
3 NADH2 – 2 vezes 3 ATP 18 ATP
respiratória
1 FADH2 – 2 vezes 2 ATP IV ATP
Total V ATPs

conveniados ao Sistema de Ensino Fonte: MAZZOCO, A. TORRES, B. Bioquímica básica. 2. ed.


Rio de Janeiro: Guanabara Koogan, 1999. p. 154. (Adaptado).

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 179 14/12/18 12:42
180 18 – Material do Professor

Preencha corretamente os itens I, II, III, IV e V, respectivamente.


BIOLOGIA 1A

15. IFTM-MG – O texto seguinte refere-se ao incêndio ocorrido em uma casa noturna no Brasil.

Incêndio na Boate Kiss


Incêndio na boate Kiss foi um evento não intencional que matou 242 pessoas e feriu 116 ou-
tras em uma discoteca da cidade de Santa Maria, no estado brasileiro do Rio Grande do Sul. O
incêndio ocorreu na madrugada do dia 27 de janeiro de 2013 e foi causado pelo acendimento
de um sinalizador por um integrante de uma banda que se apresentava na casa noturna. [...]
O cianeto, apontado por um laudo técnico como a causa da morte dos estudantes, é uma
substância encontrada na natureza e também é um produto da atividade humana. Dentre
seus usos caseiros e industriais, estão: fumigar navios e edifícios, esterilizar solos, metalurgia,
polimento de prata, inseticidas, venenos para ratos etc. A população está exposta por causa
da fumaça dos automóveis, dos gases liberados pelas incineradoras e, também, pela fumaça
resultante da combustão de materiais contendo cianetos, como os plásticos. [...]
Disponível em: <https://pt.wikipedia.org/wiki/Inc%C3%AAndio_na_boate_Kiss>.
Acesso em: nov. 2018.

O cianeto citado no texto foi apontado como a causa mortis dos estudantes, pois é
capaz de
a) combinar-se com os citocromos da cadeia respiratória, inutilizando-os para o trans-
porte de elétrons, interrompendo o fluxo de elétrons, não havendo assim liberação
de energia, o que leva à morte da célula.
b) ligar-se irreversivelmente com o oxigênio molecular antes que ele chegue nos
tecidos, levando-os à falência múltipla, caracterizando assim, a morte do indivíduo.
c) reagir com o gás carbônico e oxigênio, covalentemente, e mesmo que seja reversí-
vel esta reação, dependendo da dose de cianeto, o indivíduo é conduzido à morte.
d) agir como catalizador na reação entre a água e o gás carbônico, produzindo o ácido
carbônico, e sendo um ácido forte tem-se uma acidose sanguínea com consequente
morte dos indivíduos.
e) participar de reações de hidrólise da água, na reação de Hill, que é uma das etapas
da respiração celular, o que leva à produção de hidrogênio com elevação da acidez
sanguínea, produção de ácido lático, câimbra e asfixia.

16. UFU-MG – O gráfico abaixo mostra o fluxo de entrada em uma célula de uma molé-
cula Q em função do gasto de ATP em condições normais (N) e depois da inibição da
respiração mitocondrial (I).
Analisando atentamente o gráfico apresentado, pode-se inferir que
a) em baixas concentrações intrace-
lulares de ATP o transporte de Q
está em equilíbrio.
N
Fluxo de Q

b) a inibição mitocondrial só apresenta


efeito em baixo fluxo de Q.
c) a entrada de Q requer o metabo-
lismo energético mitocondrial.
I
d) a saída de Q é diretamente pro-

Material exclusivo para professores


porcional ao consumo de ATP.
e) a m o l é c u l a Q c o r r e s p o n d e Gasto de ATP
a glicose.

conveniados ao Sistema de Ensino


17. Uerj (adaptada) – O ciclo de Krebs, que ocorre no interior das mitocôndrias, é um
conjunto de reações químicas aeróbias fundamental no processo de produção de
energia para a célula eucarionte. Ele pode ser representado pelo seguinte esquema:

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 180 14/12/18 12:42
19 – Material do Professor 181

BIOLOGIA 1A
Acetil CoA
2C
CoA

Composto de Citrato
4C 6C

NADH 1 H1

FADH2 CO2

ATP NADH 1 H1

4C 5C

CO2
NADH 1 H1

Admita um ciclo de Krebs que, após a entrada de uma


única molécula de Acetil CoA, ocorra normalmente a
etapa de produção do fumarato. Ao final da passagem
dos produtos desse ciclo pela cadeia respiratória, qual
será a quantidade total de energia produzida, expressa
em adenosinas trifosfato (ATP)?

ESTUDO PARA O ENEM


18. Enem C5-H17 consumidor. Nas células, esse gerenciamento é feito com o
Normalmente, as células do organismo humano realizam uso de uma determinada molécula. Agora mesmo, quando
a respiração aeróbica, na qual o consumo de uma molé- você move o dedo para passar essa página, os músculos
cula de glicose gera 38 moléculas de ATP. Contudo, em de seu dedo estão tirando um pouco de energia dessas
condições anaeróbicas, o consumo de uma molécula de moléculas que estão por perto e usando essa energia para
glicose é capaz de gerar apenas duas moléculas de ATP. contrair as fibras, produzindo o movimento. O mesmo
acontece com qualquer outro processo biológico que use
1
40 energia – isto é, todos!
2
3 Disponível em: <http://www.seara.ufc.br/donafifi/mitocondrias/
mitocondrias04.htm>. Acesso em: nov. 2018.
(unidades arbitrárias)
Consumo de glicose

4
A molécula em questão se trata
20 a) do ATP.
b) do acetil CoA.
c) da glicose.
5 d) dos citocromos.
0 e) do ácido cítrico.
7 14 21 28 35 42
Concentração de oxigênio 20. Sistema Dom Bosco C5-H17
(unidades arbitrárias)
A respiração aeróbia é fundamental na manutenção
Qual curva representa o perfil de consumo de glicose, bioenergética dos organismos. Pode-se comparar as
para manutenção da homeostase de uma célula que ini- células eucarióticas com uma cidade, em que o hia-
cialmente está em uma condição anaeróbica e é subme- loplasma é o interior e a membrana plasmática é a
tida a um aumento gradual da concentração de oxigênio? delimitação da cidade, suas organelas são o espaço
a) 1 d) 4 urbano e as mitocôndrias são a companhia elétrica.
Com base nessa analogia, onde ocorrem a glicólise,
b) 2 e) 5
a formação do acetil CoA, o ciclo do ácido cítrico e a
c) 3 cadeia respiratória, respectivamente?

Material exclusivo para professores


19. Sistema Dom Bosco C5-H17 a) No perímetro urbano e na delimitação da cidade.
Em qualquer situação prática, trocas de energia precisam b) No perímetro urbano e na companhia elétrica.
ser feitas de forma organizada para evitar perdas. Para
c) No interior da cidade e na companhia elétrica.
isso, usamos pilhas, baterias, caixas de água, represas, fios

conveniados ao Sistema de Ensino


elétricos, enfim, um monte de esquemas para organizar a d) No interior da cidade e no perímetro urbano.
produção e o transporte da energia da fonte de geração ao e) Na companhia elétrica e na delimitação da cidade.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 181 14/12/18 12:42
18
182
BIOLOGIA 1A 20 – Material do Professor

RESPIRAÇÃO ANAERÓBIA

O pão é o alimento mais popular do mundo, e quase todas as sociedades têm


alguma receita própria que envolva esse alimento. Os primeiros registros da produ-
• Respiração anaeróbia ção de pães datam de seis mil anos, na região de Mesopotâmia (atual Iraque). Os
• Comparação entre pães eram feitos com uma mistura seca, dura e amarga à base de farinha de trigo,
respiração aeróbia, difundida em diferentes civilizações.
respiração anaeróbia e Ao chegar ao Egito, a receita do pão foi modificada e aprimorada. Os egípcios
fermentação perceberam que, ao misturar a massa velha à massa nova, formavam-se bolhas e,
assim, o pão crescia. Apesar de não saber o motivo desse fenômeno, inventaram,
HABILIDADES por assim dizer, a primeira técnica de fermentação.
• Identificar as Foi somente em 1674 que o cientista Anton van Leeuwenhoek (1632-1723) criou o
transformações de energia primeiro microscópio, com o qual fez as primeiras observações dos microrganismos.
no metabolismo celular. Mais tarde, Louis Pasteur (1822-1895) investigou os microrganismos responsáveis
• Reconhecer respiração pelo crescimento dos pães, as leveduras (em latim, levar e, que significa crescer).
anaeróbia e fermentação Popularmente, ficaram mais conhecidas como fermento, já que são as responsáveis
como processos do por fermentar a massa do pão.
metabolismo celular Na fermentação, as leveduras alimentam-se do açúcar presente nos carboidratos
energético.
da massa do pão. Durante esse processo, ocorre a liberação de álcool e gás carbô-
• Identificar os principais nico, que acarreta a formação das bolhas do pão e o aumento de seu volume. Ao
organismos capazes de assar, o álcool evapora, mas os outros compostos orgânicos produzidos durante as
realizar fermentação.
fermentações permanecem, dando sabor e aroma à massa.
• Diferenciar as respirações
MARLINANGELA | DREAMSTIME.COM

aeróbia e anaeróbia.
• Compreender a
importância do processo
de fermentação para a
indústria e a economia.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 182 14/12/18 12:42
21 – Material do Professor 183

Respiração anaeróbia

BSIP/UIG/GETTY IMAGES

BIOLOGIA 1A
A respiração anaeróbia (do grego an = sem, aeros
= ar e bios = vida) é aquela na qual não há presença
de oxigênio. Os seres anaeróbios obtêm energia por
meio da oxidação (quebra) de moléculas orgânicas,
liberando íons H1. Como o oxigênio está ausente para
formar moléculas de água, quando se une aos íons
H1, pode ocorrer acidificação do citosol. Para que isso
não aconteça, certas substâncias se transformam em
aceptoras finais dos íons H1.
Ilustração de Clostridium tetani, agente causador do tétano, é um
Algumas bactérias conseguem quebrar as molécu- organismo anaeróbio estrito. O tamanho médio de cada célula é de 0,3
las orgânicas nessas condições de forma semelhante por 0,8 μm. Cores fantasia.
à respiração aeróbia. No entanto, vale ressaltar que os
LEITURA COMPLEMENTAR
aceptores finais dos íons H1 são compostos inorgâni-
cos, como o sulfato (SO422), nitrato (NO32) e o carbonato A fermentação pode ter vários significados dependendo
(CO322), sendo retirados por eles do meio intracelular, da área de estudo. Em Bioquímica, por exemplo, ela é
evitando que haja acidose no protoplasma. É impor- definida como o processo em que ocorre degradação
tante lembrar que a respiração anaeróbia realizada por de alimentos por meio de microrganismos, produzindo
bebidas alcoólicas e laticínios. Na indústria, a fermenta-
bactérias que utilizam nitrato e sulfato como aceptores
ção ocorre na ausência de oxigênio, também por meio
finais é essencial para os ciclos do nitrogênio e do
da ação de microrganismos. Em termos científicos, esse
enxofre existentes na natureza.
processo pode ter dois significados, como segue.
A produção de ATP durante a respiração anaeró-
1. Processo que libera energia em condições anae-
bia pode variar dependendo do microrganismo que a
róbias.
realiza e da via metabólica. Em geral, a produção de
ATP é muito baixa quando comparada à respiração 2. Todo processo bioquímico que libera energia
aeróbia. Por conta disso, seres anaeróbios tendem proveniente de carboidratos ou de qualquer
molécula orgânica sem a necessidade de oxigê-
a crescer mais lentamente do que os seres aeró-
nio, utilizando uma molécula inorgânica como
bios. Assim, esse processo pode ser visto como um
aceptor final de elétrons.
fator limitante, pois atua no controle populacional
Esta última definição é a adotada neste módulo.
desses organismos.

FERMENTAÇÃO Existem também os organismos anaeróbios fa-


Ao longo da história, o ser humano aprendeu como cultativos, que realizam a fermentação quando não há
oxigênio, e a respiração aeróbia, quando há. É o caso
os microrganismos transformam a matéria orgânica por
de diversas bactérias e fungos, como a Saccharomyces
meio dos processos fermentativos. Assim surgiu a bio-
cerevisiae (levedura).
tecnologia das fermentações, utilizada nas indústrias
alimentícias farmacêuticas e na produção de combus-

MEDISCAN / ALAMY STOCK PHOTO


tível, como o álcool etílico.
A fermentação é um processo anaeróbio que
ocorre no citosol. Basicamente, os hidrogênios li-
berados são recolhidos por compostos orgânicos
derivados da degradação da glicose. Esse processo
ocorre em fungos, bactérias e nas células muscu-
lares de vertebrados, como os humanos, em si-
tuações de contração intensa, em que é gerado o
ácido lático.
As bactérias fermentadoras que se localizam em

Material exclusivo para professores


regiões onde a concentração de oxigênio é próxima
a zero são denominadas anaeróbios estritos, como
As leveduras (Saccharomyces cerevisiae) são exemplos de organismos
o Clostridium tetani, causador do tétano. Para esses anaeróbios facultativos. Micrografia eletrônica de varredura. Aumento de
seres vivos, o gás oxigênio é letal. 3 000x. Cores fantasia.

conveniados ao Sistema de Ensino


Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 183 14/12/18 12:42
184 22 – Material do Professor

O processo de fermentação inicia-se com a glicóli- LEITURA COMPLEMENTAR


BIOLOGIA 1A

se, quando a molécula de glicose é quebrada em duas


moléculas de piruvato, liberando duas moléculas de ATP A produção de pão e vinho e a história
(fase comum à respiração aeróbia e à respiração anaeró- O vinho existe desde aproximadamente 5000 a.C. A be-
bia, conforme descrito no módulo anterior). Em seguida, bida era produzida após o suco de uva ficar em contato
o piruvato segue a via anaeróbia e é degradado em com o ar por certo tempo. Em virtude disso, os egípcios
outras substâncias orgânicas, como o álcool etílico (na acreditavam que o deus Osíris era quem mandava a
fermentação etílica), ácido lático (na fermentação lática) bebida para tornar o povo da Terra menos sofrido, os
e ácido acético ou vinagre (na fermentação acética). gregos pensavam se tratar de um néctar enviado pelo
deus Dionísio, e os romanos acreditavam que a bebida
Fermentação alcoólica era oriunda do deus Baco.
A fermentação alcoólica é realizada principal- Mais tarde, com a criação do microscópio, foi possível
mente por bactérias e leveduras, como a espécie descobrir que tanto o pão quanto o vinho, na verdade,
Saccharomyces cerevisiae. Como produtos, são pro- eram produzidos pela ação de fungos (leveduras) que
duzidos álcool etílico, gás carbônico e ATP. viviam no ar e promoviam a fermentação ao entrar em
A principal finalidade da fermentação é a produ- contato com esses alimentos.
ção de ATP, uma vez que a degradação de moléculas O cientista francês Louis Pasteur (1822 - 1895) em seus
orgânicas gera energia. O CO 2 e o álcool etílico são estudos sobre biogênese também investigou a fermen-
eliminados da célula por serem tóxicos. tação dos alimentos, inclusive do vinho. Por acreditar
que a fermentação era o resultado da ação de micror-
Glicose → Álcool etílico 1 CO2 1 2 ATP ganismos, propôs a toeria microbiana da fermentação.
Para testá-la, analisou um pouco de suco de uva em
um microscópio e percebeu a existência de leveduras
Durante a redução do piruvato são empregados os no líquido. Depois, ferveu um pouco desse suco e
átomos de hidrogênio incorporados pelo NADH2, dando percebeu que as leveduras morriam, e o suco, con-
origem ao álcool etílico. O saldo desse processo é de sequentemente, não se transformava em vinho. Mais
2 ATP para a célula. tarde, foi descoberto que, na verdade, o açúcar pre-
sente na uva era transformado em álcool por meio da
2 NADH2 2 NAD fermentação alcoólica.
2 moléculas 2 etanol 1 2 CO2 1 2 ATP Pasteur observou que suco de uva também pode se
de piruvato tornar vinagre. Por meio de análises dessa bebida no
microscópio, ele verificou a presença de bactérias que
A cerveja é um produto da fermentação alcoólica, se multiplicavam apenas na presença de oxigênio.
produzida por meio da fermentação do suco de ceva- Com base nessas observações, Pasteur propôs, então,
da. O suco da cana-de-açúcar, fermentado e destilado, que as garrafas fossem aquecidas antes de o vinho ser
produz o álcool etílico utilizado como combustível e na depositado e, posteriormente, arrolhadas, para que a
produção de cachaça. bebida não entrasse em contato com o ar. Hoje sabe-se
O pão e o vinho também são produtos da fermen- que quando bactérias trazidas pelas moscas da fruta
tação alcoólica. Nesse caso, o CO2 produzido durante (Drosophila sp.) entram em contato com o suco, realizam
a fermentação é incorporado na massa em pequenas a fermentação acética e transformam o álcool produzi-
câmaras, provocando seu crescimento. O calor ne- do pelas leveduras em vinagre.
cessário para assar a massa faz com que as paredes
dessas câmaras enrijeçam, dando o aspecto alveolar
CANNASUE/ISTOCKPHOTO.COM

característico, e o álcool evapora.


1MORECREATIVE/ISTOCKPHOTO.COM

Material exclusivo para professores


conveniados ao Sistema de Ensino
Além de inventar o processo de pasteurização, Louis Pasteur
descreveu o processo que transforma o vinho em vinagre:
fermentação acética.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 184 14/12/18 12:42
23 – Material do Professor 185

Fermentação lática Outros tipos de fermentação

BIOLOGIA 1A
Na fermentação lática, são produzidas duas mo- Existem outros tipos de fermentação, mas que
léculas de ATP a cada molécula de glicose oxidada ocorrem na presença de oxigênio, a chamada fer-
por bactérias do tipo bacilo. As etapas são similares mentação aeróbia. A fermentação acética é um
à da fermentação alcoólica, com a diferença de que o exemplo desse tipo de fermentação, na qual o produ-
produto final da fermentação lática é o ácido lático e
to final é o ácido acético, também conhecido como
não ocorre descarboxilação do piruvato, ou seja, não
vinagre.
há liberação de moléculas de CO2.
O processo acontece em duas etapas: primeiro
2 NADH2 2 NAD ocorre a fermentação alcoólica, originando o álcool etí-
2 moléculas 2 moléculas lico, conforme já estudado. Em um segundo momento,
de piruvato ácido lático 1 2 ATP o álcool etílico é oxidado parcialmente por bactérias do
gênero Acetobacter, reagindo com O2. Ao final do pro-
cesso, além de o ácido acético ser produzido, também
SILVIAJANSEN/ISTOCKPHOTO.COM

são liberadas moléculas de H2O.

1a etapa:
Glicose → Álcool etílico 1 2 ATP1 CO2

2a etapa:
Álcool etílico 1 O2 → ácido acético 1 2 ATP 1 2 H2O

Queijos, coalhada e iogurtes são produtos da fermentação lática.

Ao realizar uma atividade física muito intensa, como


(C) CHERNETSKAYA | DREAMSTIME.COM

correr após meses sem se exercitar, o oxigênio torna-


-se insuficiente para sustentar a respiração aeróbia nas
células musculares e liberar a energia necessária. Assim,
para contornar essa insuficiência energética, as células
degradam parte da glicose em ácido lático por meio da
fermentação lática, que gera energia na forma de ATP,
mas também duas moléculas de ácido lático. A sensa-
ção de dor muscular, característica desse processo de
fermentação, deve-se ao acúmulo dessa substância no
interior da fibra muscular. Após encerrar a atividade físi-
ca, o ácido lático é conduzido pela corrente sanguínea ao
fígado, onde é convertido novamente em ácido pirúvico
e continua a ser degradado pela respiração aeróbia.
(C) LZF | DREAMSTIME.COM

Material exclusivo para professores O vinagre é produto da fermentação acética.

conveniados ao Sistema de Ensino As células musculares são capazes de produzir ácido lático pela fermentação
lática, o que costuma causar dores intensas nos músculos em uso.
Além do vinagre, existem outros produtos obtidos
por meio de diferentes tipos de fermentação:

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 185 14/12/18 12:42
186
BIOLOGIA 2B
1A 24 – Material do Professor

Produto final da Uso industrial ou Material Tipo de


fermentação comercial inicial microrganismo

Ácido propanoico ou
Herbicida/conservante Ácido lático Bactéria
ácido propiônico

Uso farmacêutico e
Acetona e butanol Melaço Bactéria
industrial

Uso farmacêutico e
Glicerol Melaço Fungo
industrial

Uso alimentício e
Ácido cítrico Melaço Fungo
farmacêutico

Metano Combustível Ácido acético Bactéria

Sorbose Vitamina C (ácido ascórbico) Sorbitol Bactéria

Fonte: TORTORA et al. Microbiologia. 8. ed. Porto Alegre: Artmed, 2004. (Adaptado)

Comparação entre respiração aeróbia,


respiração anaeróbia e fermentação
As respirações aeróbia e anaeróbia apresentam semelhanças e diferenças. Entre
as semelhanças, obtêm energia sob a forma de ATP; apresentam a glicólise como
fase comum; são processos catabólicos e realizam várias reações de oxirredução.
Quanto às diferenças entre os processos, estão as condições de crescimento dos
organismos que os realizam; o aceptor final de elétrons; e a quantidade de energia
produzida, conforme resumido no quadro a seguir.

Número de
Processo de Condições Aceptor final moléculas de
produção de de de hidrogênio ATP produzido
energia crescimento (elétrons) por molécula
de glicose
Respiração Aerobiose O2 38
aeróbia
Anaerobiose Normalmente substâncias Variável (menor que 38,
Respiração inorgânicas (como NO3, mas maior que 2)
anaeróbia SO422, CO322)
Aerobiose ou Molécula orgânica 2
Fermentação anaerobiose
Fonte: TORTORA et al. Microbiologia. 10. ed. Porto Alegre: Artmed, 2012. p. 137. (Adaptado)

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 186 14/12/18 12:42
25 – Material do Professor 187

ROTEIRO DE AULA

BIOLOGIA 1A
RESPIRAÇÃO ANAERÓBIA

Necessita de O2? Não

Degrada: Moléculas orgânicas

Libera: Elétrons

Fermentação

Glicólise

Duas etapas

Redução do piruvato

Tipos

Alcoólica
Lática

Realizada por:
Realizada por:

Leveduras Bactérias e células

musculares

Produtos

Produtos
Álcool etílico

Material exclusivo para professores


Ácido lático

CO2

conveniados ao Sistema de Ensino


2 ATP
2 ATP

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 187 14/12/18 12:42
188 26 – Material do Professor

EXERCÍCIOS DE APLICAÇÃO
BIOLOGIA 1A

1. PUC-MG (adaptada) – Dois processos metabólicos 4. Sistema Dom Bosco – O vinagre é um condimento lí-
distintos estão esquematizados abaixo. quido bastante utilizado no preparo de alimentos, como
V. Glicose – piruvato – fermentação – álcool as saladas. Sabe-se que a síntese desse produto é rea-
lizada por meio do álcool, com o uso de bactérias do
VI. Glicose – piruvato – fermentação – lactato
gênero Acetobacter, que participam do processo
Analisando os processos e de acordo com seus conhe- a) por meio da respiração aeróbia.
cimentos sobre o assunto, marque a afirmativa correta.
b) ao converter o ácido pirúvico em ácido lático.
a) Em uma atividade física prolongada podem ocorrer
c) ao produzir ácido acético.
os dois processos.
d) por meio da fermentação lática.
b) O processo I pode ocorrer na produção de iogurte.
e) por meio da respiração anaeróbia alcoólica.
c) O processo II pode ocorrer na produção de coalhada. A alternativa A está incorreta porque não é realizada a respi-
d) No processo II há mais gasto de ATP para iniciar a ração. A alternativa B está incorreta porque o ácido pirúvico é
via metabólica do que em I. convertido em álcool e, posteriormente, oxidado, produzindo
o ácido acético. A alternativa D está incorreta porque se trata
A alternativa A está incorreta porque ocorrerá apenas a fermentação da fermentação acética. A alternativa E está incorreta porque a
lática. A alternativa B está incorreta porque a fermentação alcoólica é fermentação acética acontece na presença de oxigênio.
muito utilizada na produção de bebidas alcoólicas e combustíveis. Para
a produção de iogurte, é realizada a fermentação lática. A alternativa 5. Sistema Dom Bosco – A fermentação é constituída por
D está incorreta porque, em ambos os processos, há o consumo de duas etapas, sendo a primeira comum à fermentação
dois ATPs, com saldo final de mesmo valor, uma vez que, durante a lática e alcoólica. Assinale a opção que apresenta o
glicólise, são produzidas quatro moléculas de ATP.
nome da primeira etapa da fermentação, seguida de
seu produto final.
2. UnB (adaptada) – A fermentação é um dos processos
a) Glicose, ácido acético.
biológicos que a humanidade utiliza há mais tempo na
preparação de alimento. A respeito desse processo, é b) Glicólise, álcool etílico.
correto afirmar que c) Glicose, ácido lático.
a) a fermentação é um tipo de respiração que consome d) Glicólise, ácido pirúvico.
oxigênio livre. A glicólise é a primeira etapa de qualquer um dos tipos de fermentação.
b) vírus e protozoários são usados frequentemente na Basicamente, ocorre quebra da molécula de glicose em duas moléculas
fermentação industrial. de ácido pirúvico, liberando duas moléculas de ATP.

c) iogurtes e queijos são produzidos a partir da fermen- 6. Sistema Dom Bosco – Determinada molécula foi a
tação lática. engenhosa solução oferecida pela natureza e pela evolu-
d) a adenosina trifosfato (ATP), liberada durante a fer- ção para compor um sistema simples, rápido e robusto
mentação do trigo, faz com que o pão cresça. de troca de energia. Em alguns processos metabólicos,
são gerados, como, saldo final, apenas duas dessas
e) a cachaça e o álcool combustível são obtidos pela
fermentação dos açúcares presentes na uva. moléculas.
Disponível em: <http://www.seara.ufc.br/donafi fi /mitocondrias/
A alternativa A está incorreta porque a fermentação ocorre na mitocondrias04.htm>. Acesso em: nov. 2018.
ausência de oxigênio. A alternativa B está incorreta porque os
organismos utilizados na fermentação são bactérias e fungos. A
alternativa D está incorreta porque o CO 2 é liberado por meio da Identifique essa molécula e explique em quais proces-
quebra da glicose, que permite à massa do pão crescer durante sos ela pode ser produzida com esse saldo final.
a fermentação alcoólica. A alternativa E está incorreta porque a
cachaça e o álcool são provenientes da fermentação do açúcar A molécula responsável pela troca de energia é a adenosina trifosfato
presente na cana-de-açúcar.
(ATP), capaz de carregar energia em sua estrutura. Ela pode ser produ-
3. Sistema Dom Bosco – Existem organismos que não
conseguem sobreviver na presença de oxigênio e, zida com saldo final de duas moléculas nos processos de fermentação
por conta disso, desenvolveram outros métodos de
obtenção de energia. Como são denominados esses lática e fermentação alcoólica.
organismos? Cite um método de obtenção de energia
que eles desenvolveram.

Organismos que não conseguem sobreviver na presença de oxigê-

nio são denominados organismos anaeróbios estritos. Uma forma de

obtenção de energia desenvolvida por esse tipo de organismo é a

fermentação.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 188 14/12/18 12:42
27 – Material do Professor 189

EXERCÍCIOS PROPOSTOS

BIOLOGIA 1A
7. Fuvest-SP Álcool etílico
A Lei 7.678 de 1988 define que “vinho é a bebida obtida
pela fermentação alcoólica do mosto simples de uva sã, Glicose piruvato Álcool lático
fresca e madura”. Na produção de vinho, são utilizadas
Álcool acético
leveduras anaeróbicas facultativas. Os pequenos produto-
res adicionam essas leveduras ao mosto (uvas esmagadas, Quando realizada pela levedura adequada, o tipo de
suco e cascas) com os tanques abertos, para que elas se re- fermentação que leva a massa do pão a inflar e tornar-
produzam mais rapidamente. Posteriormente, os tanques -se macia é aquela representada
são hermeticamente fechados. a) pela produção de ácido lático.
b) pela produção de ácido acético.
Nessas condições, pode-se afirmar, corretamente, que
c) pela produção de álcool etílico.
a) o vinho se forma somente após o fechamento dos d) pela produção de ácido pirúvico.
tanques, pois, na fase anterior, os produtos da ação
das leveduras são a água e o gás carbônico. e) pelas produções de ácidos lático e acético.
b) o vinho começa a ser formado já com os tanques 10. Sistema Dom Bosco – Existem dois tipos de processos
abertos, pois o produto da ação das leveduras, nes- bioquímicos muito importantes para os organismos, por
sa fase, é utilizado depois como substrato para a
serem suas principais fontes de energia: a respiração
fermentação.
aeróbia e a respiração anaeróbia. Entre os processos
c) a fermentação ocorre principalmente durante a que ocorrem na respiração anaeróbia, há dois tipos de
reprodução das leveduras, pois esses organismos fermentação. Com base nisso, cite as principais seme-
necessitam de grande aposte de energia para sua lhanças entre a fermentação e a respiração aeróbia.
multiplicação.
d) a fermentação só é possível se, antes, houver um
processo de respiração aeróbica que forneça energia
para as etapas posteriores, que são anaeróbicas.
e) o vinho se forma somente quando os tanques voltam
a ser abertos, após a fermentação se completar, para
que as leveduras realizem respiração aeróbica.

8. Uniube-MG – A figura abaixo ilustra uma parte impor- 11. UFT – A energia necessária para que ocorra a contração
tante do metabolismo da glicose, conhecida como fer- muscular é proveniente da quebra do ATP (adenosina
mentação lática. Analise-a e, com os conhecimentos trifosfato) disponível no citoplasma das células muscu-
sobre o assunto, assinale a alternativa correta. lares. Em anaerobiose, esse ATP é formado
a) pelo processo de fermentação lática.
C6H12O6 glicólise H
piruvato b) pelo processo de fosforilação oxidativa.
2 CH3 — C — COOH
2 CH3 — C — COOH c) pelo processo de fermentação alcoólica.
2 NAD ⋅ 2 H O
2 ATP 2 NAD ⋅ 2 H O 2 NAD ácido lático d) pela fosforilação do ADP (adenosina difosfato) pela
fosfocreatina.
e) pela fosforilação do ADP (adenosina difosfato) por
fósforo orgânico.
a) O processo de fermentação lática ocorre unicamente
no músculo, quando o oxigênio não é suficiente para
12. Unicastelo-SP – Na padaria, a fila para comprar pão
a produção aeróbica de energia.
era grande. O padeiro justificou que o pão não estava
b) O processo de fermentação lática é realizado por pronto porque a estufa, onde a massa era mantida,
certos tipos de bactérias, tais como os lactobacilos, havia quebrado e a massa não havia crescido.
e é a base do processo de produção de iogurtes e
coalhadas. Na produção do pão, a estufa é importante, pois garante
a temperatura adequada para
c) O processo de fermentação lática ocorre mesmo nas
células musculares que estejam recebendo supri- a) o processo de respiração anaeróbica das leveduras
mento suficiente de oxigênio, pois é o único modo adicionadas à receita, que produzem o oxigênio que
de o músculo obter energia. faz a massa crescer antes de ser assada.
d) O processo de fermentação lática pode ocorrer em b) a expansão do gás carbônico produzido pela respira-
qualquer tecido do corpo humano, mas sempre na ção dos fungos adicionados à receita, expansão essa
ausência de oxigênio. que garante o crescimento da massa.
e) O processo de fermentação lática pode ocorrer c) a evaporação da água produzida pela respiração das
em qualquer tecido do corpo humano, indepen- leveduras adicionadas à receita, sem o que a massa
dentemente do suprimento de oxigênio para esses não cresceria, pelo excesso de umidade.

Material exclusivo para professores


tecidos. d) o processo de fermentação dos fungos adicionados
à receita, o que faz com que a massa cresça antes
9. UEA-AM – Classificadas de acordo com o produto final de ser assada.
obtido no processo, as fermentações podem ser alcoó- e) a evaporação do álcool produzido pela fermentação

conveniados ao Sistema de Ensino


licas, láticas e acéticas. A figura mostra, de forma es- das leveduras adicionadas à receita; álcool que, em
quemática e simplificada, as principais etapas de cada excesso, mataria essas leveduras, prejudicando o
uma das fermentações. crescimento da massa.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 189 14/12/18 12:42
190 28 – Material do Professor

13. Fuvest-SP – Um atleta que participou da corrida São o fermento biológico, pois o fermento químico na
BIOLOGIA 1A

Silvestre desmaiou depois de ter percorrido cerca de presença de altas temperaturas no forno acelera o
800 m devido à oxigenação deficiente em seu cérebro. processo fermentativo, caramelizando substâncias
Sabendo-se que as células musculares podem obter que dão gosto ao pão. Nessa fornada, os pães cres-
energia por meio da respiração aeróbica ou fermen- ceram bastante e ficaram saborosos.
tação, nos músculos do atleta desmaiado deve haver IV. Na fornada D, os pães não cresceram e não ficaram
acúmulo de com o sabor característico de pão, pois, na ausência
a) glicose. da levedura, não há fermentação alcoólica.
b) glicogênio. Estão corretas apenas as afirmativas:
c) monóxido de carbono. a) I e II. c) III e IV.
d) ácido lático. b) II e III. d) I e IV.
e) etanol.
16. UFTM-MG (adaptada) – Um meio de cultura con-
14. Sistema Dom Bosco tendo proteínas, lipídios, glicose e amido recebeu
Quase tão antiga quanto as primeiras civilizações huma- uma espécie de fungo unicelular geneticamente
nas, produzida há milhares de anos, a cerveja é a bebida modificado.
alcoólica mais consumida do mundo – entre todas as ou-
tras, só perde para água e para o café. CO2
Fonte: <https://www.bbc.com/portuguese/brasil243324823>.
Acesso em: nov. 2018.

Concentração de substâncias
Cite o processo que dá origem à cerveja e explique
amido
como ele ocorre.

proteínas

lipídios

glicose

Ao longo de alguns dias, foram medidas as taxas das


15. UFU-MG (adaptada) – Em uma padaria, um padeiro substâncias contidas na cultura, além do gás CO2 pro-
recém-contratado teve muita dificuldade na produção duzido. Os resultados foram expressos no gráfico.
de pães. Uns não cresceram e outros ficaram sem gos-
to algum. Observe abaixo os procedimentos adotados Marque a alternativa correta.
pelo jovem padeiro. a) O fungo realizou apenas respiração celular.
Fornada A – O padeiro acrescentou água fervente ao b) A glicose foi absorvida e utilizada como combustí-
fermento biológico, em vez de utilizar água morna. vel celular.
Fornada B – O padeiro utilizou fermento biológico con- c) O fungo foi capaz de produzir amilases e protea-
gelado, em vez de utilizar fermento fresco. ses, secretadas no meio.
d) As células do fungo não secretam lipases no meio
Fornada C – O padeiro utilizou fermento em pó químico, de cultura.
em vez de utilizar fermento biológico.
Fornada D – O padeiro esqueceu-se de utilizar o fer- 17. Sistema Dom Bosco – Quando realizamos uma in-
mento biológico. tensa atividade física, por exemplo, correr uma grande
distância sem ter muito preparo para isso, as células
Em relação ao processo de fermentação para produção musculares realizam determinado processo para obter
dos pães, julgue as afirmativas a seguir: energia suficiente. Cite o nome desse processo e ex-
plique em que condições ele acontece.
I. Na fornada A, o padeiro matou com água quente
as células do fungo unicelular Saccharomyces ce-
revisiae presentes no fermento biológico. Sem as
células viáveis, não ocorreu fermentação alcoólica
e não houve liberação de gás carbônico na massa.
Nessa fornada, os pães não cresceram.
II. Na fornada B, o padeiro fez com que as células da
levedura presentes no fermento tivessem sua via-

Material exclusivo para professores


bilidade aumentada, devido às baixas temperaturas
que estimulam o crescimento celular. Dessa forma,
uma maior quantidade de gás carbônico foi produzida
durante o processo de fermentação. Nessa fornada,
os pães cresceram bastante.

conveniados ao Sistema de Ensino


III. Na fornada C, o padeiro obteve pães com sabor
muito mais intenso do que aqueles produzidos com

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 190 14/12/18 12:42
29 – Material do Professor 191

ESTUDO PARA O ENEM

BIOLOGIA 1A
18. Sistema Dom Bosco C8-H29 Sobre a produção de bebidas alcoólicas como a citada
O iogurte é um desses alimentos que nunca saem de no texto, é correto afirmar que
moda. Muito já foi dito sobre os supostos benefícios a) a cerveja é produzida por meio da fermentação alcoólica.
de consumir os microrganismos vivos que se abrigam b) o processo bioquímico capaz de produzir a cerveja
no produto, e trata-se de uma indústria que movimenta também produz ácido lático nas células musculares.
bilhões de dólares. Também é muito fácil fazer iogurte
em casa, e o YouTube está cheio de vídeos de pes- c) a cerveja é produzida por meio de bactérias fer-
mentadoras.
soas compartilhando a experiência. Outros gostam de
examinar o produto com microscópio e questionar: “O d) a produção da cerveja se dá a partir do ácido acético.
que tem aqui dentro?” Bem, uma boa resposta seria: e) o processo bioquímico capaz de produzir a cerveja
“Várias reações químicas fascinantes”. ocorre apenas na presença de oxigênio.
Fonte: <https://www.bbc.com/portuguese/
noticias/2015/08/150825_vert_fut_segredos_iogurte_ml>. 20. Enem C8-H29
Acesso em: nov. 2018. O esquema representa, de maneira simplificada,
Sobre a produção do iogurte o processo de produção de etanol utilizando milho
como matéria-prima.
a) ocorre por meio da fermentação acética.
b) ocorre por meio da transformação do açúcar em
ácido lático. Levedura

c) é realizada por meio da quebra da produção de


álcool etílico.
d) os microrganismos responsáveis por sua produção CO2
são os fungos.
Milho Levedura
e) necessita de oxigênio para que seja produzido.
Água
19. Sistema Dom Bosco C5-H17
De acordo com uma pesquisa feita pela empresa alemã Hidrólise Fermentação
Bath-Haas Group, o Brasil está entre os 20 maiores con-
sumidores da bebida no mundo. Na 17ª- posição, o país é A etapa de hidrólise na produção de etanol a partir do
um dos poucos da América Latina entre esses vinte. No milho é fundamental para que
levantamento feito com 40 países, a República Checa saiu a) a glicose seja convertida em sacarose.
na frente com 143 litros anuais por habitante. Em seguida,
b) as enzimas dessa planta sejam ativadas.
aparece a Áustria com 108 litros por pessoa. A Alemanha,
criadora da Oktoberfest, aparece na terceira posição, com c) a maceração favoreça a solubilização em água.
107 litros por habitante. d) o amido seja transformado em substratos utilizá-
Fonte: <https://economia.uol.com.br/ultimas-noticias/infomo-
veis pela levedura.
ney/2012/08/03/brasileiro-esta-entre-os-que-mais-bebem-cerveja-no- e) os grãos com diferentes composições químicas
mundo-veja-o-ranking.htm>. Acesso em: nov. 2018. sejam padronizados.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 191 14/12/18 12:42
19
192
BIOLOGIA 1A 30 – Material do Professor

FOTOSSÍNTESE

O CO 2 é um importante gás atmosférico, responsável pela manutenção da


temperatura da Terra, uma vez que retém na atmosfera o calor proveniente
• Fotossíntese do Sol. O acúmulo desse gás na atmosfera aumenta a temperatura média
• Cloroplasto e pigmentos da Terra e pode, consequentemente, alterar diversos processos biológicos
fotossintetizantes importantes para a preser vação dos seres vivos. Principalmente por isso,
• Etapas da fotossíntese reduzir a emissão de gás carbônico é uma importante medida para evitar o
• Adaptação dos mecanismos
aumento do efeito estufa.
de fixação do carbono em Em 2016, pesquisadores da Universidade de Massachusetts desenvolveram uma
plantas de climas áridos e “superplanta”, capaz de realizar fotossíntese de forma mais eficiente quando com-
quentes parada às plantas comuns. Eles adicionaram nanopartículas de dióxido de cério (um
metal raro) nos cloroplastos de plantas da espécie Arabidopsis sp.
HABILIDADES

KNAUFB/SHUTTERSTOCK
• Compreender como as
células de organismos
fotossintetizantes obtêm
energia.
• Reconhecer a importância
da fotossíntese para a ma-
nutenção da vida na Terra.
• Reconhecer os organismos
capazes de realizar a
fotossíntese.
• Descrever as etapas da
fotossíntese, bem como
seus produtos.
• Entender a função dos pig-
mentos fotossintetizantes.
• Descrever os mecanismos
alternativos desenvolvidos
por plantas de clima árido
para fixação do carbono de
forma eficaz.

Arabidopsis sp., planta modificada por meio de nanotecnologia para maior eficiência na taxa de fotossíntese.

O fluxo maior de elétrons acelera a fotossíntese, fazendo com que o processo

Material exclusivo para professores


fotossintético aumente na taxa de até 30%. De acordo com os pesquisadores, essa
alteração poderia ser um ponto de partida para reduzir o aquecimento global, uma
vez que essa espécie modificada teria maior capacidade de captar moléculas de
CO2 na atmosfera.

conveniados ao Sistema de Ensino


Para a realização da fotossíntese, os únicos nutrientes de que os organismos
autótrofos necessitam são: dióxido de carbono, água e minerais. No entanto, sem
luz, esse processo não ocorre. A vida na Terra é movida à energia luminosa.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 192 14/12/18 12:42
31 – Material do Professor 193

Fotossíntese eucariotos fotossintetizantes e cianobactérias e para


as bactérias fotossintetizantes. Enquanto os eucariotos

BIOLOGIA 1A
A energia luminosa viaja 150 milhões de quilôme- e as cianobactérias retiram hidrogênio da molécula de
tros desde o Sol até chegar à Terra. Aqui, ela é captu- água (H2O), as bactérias fotossintetizantes têm como
rada pelos cloroplastos, organelas que a convertem fonte de hidrogênio o sulfeto de hidrogênio (H2S), por
em energia química, armazenando-a em açúcar e ou- isso receberam o nome de sulfurosas.
tras moléculas orgânicas. Esse processo, denominado

SCIENCE PHOTO LIBRARY - SPL/SCIENCE PHOTO LIBRARY -


SPL/FOTOARENA
fotossíntese, alimenta direta ou indiretamente todas
as formas de vida do planeta.
Os organismos autótrofos utilizam esse processo
para produzir seu alimento, sem se alimentar de subs-
tância qualquer proveniente de outros seres vivos.
Para isso, criam suas próprias moléculas por meio da
fixação de dióxido de carbono (CO 2) e outros mate-
riais inorgânicos obtidos do ambiente. Por utilizarem
a luz como principal fonte de energia para a síntese
de substâncias orgânicas, são denominados fotoau-
tótrofos ou fotossintetizantes, como é o caso da
maioria dos vegetais, de alguns protistas, das cia-
nobactérias e de outras bactérias fotossintetizantes.
JULIANA LUCAS DE SOUSA/DREAMSTIME.COM

Microscopia eletrônica de varredura de bactérias


fotossintéticas sulfurosas do gênero Chorobium.
Aumento de 2 600x. Coresfantasia.

Para comprovar que o gás oxigênio proveniente


da fotossíntese era resultado da água e não do gás
carbônico, foram realizados experimentos com água
(H2O) e gás carbônico (CO2) marcados com oxigênio
isótopo 18 e, com base nisso, demonstrou-se que os
átomos do gás oxigênio (O2) se originam da molécula
de água, e não do gás carbônico. Por produzir enxofre
e não oxigênio, esse tipo de fotossíntese é chamado
de anoxígena.
Na Floresta Amazônica, podem ser encontrados diversos organismos
fotossintetizantes.
Gás oxigênio
Gás oxigênio
18
O2 O2
com isótopo
VISUALS UNLIMITED, INC./DR. ROBERT CALENTINE/
GETTY IMAGES

radioativo

H2O
H218O

CO2 O22
C1818O
C

Com base no experimento realizado com plantas aquáticas em contato


com moléculas marcadas com isótopos radioativos, foi possível
verificar que o gás oxigênio resultante da fotossíntese é proveniente
das moléculas de água. Elementos representados fora da escala de
tamanho. Cores fantasia.

Cianobactérias vistas em microscopia óptica com aumento de 1 000x.


EQUAÇÃO GERAL DA FOTOSSÍNTESE

Material exclusivo para professores ORIGEM DO OXIGÊNIO E FOTOSSÍNTESE


BACTERIANA
OXÍGENA
Por meio desse experimento, foi possível descrever
a equação geral da fotossíntese, na qual o número

conveniados ao Sistema de Ensino


Na década de 1930, Cornelis Bernardys Van Niel de átomos de oxigênio da água (H2O) corresponde ao
(1897-1985) demonstrou que os átomos de hidrogênio número de átomos de oxigênio presentes no gás oxi-
utilizados na fotossíntese têm origens distintas para gênio (O2):

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 193 14/12/18 12:42
194 32 – Material do Professor

e refletir outras, assim, as plantas refletem os com-


BIOLOGIA 1A

6 CO2 + 12 H2O
Luz
C6H12O6 + 6 O2 + 6 H2O primentos de onda referentes às cores vistas por nós.
Clorofila A absorção de luz ocorre principalmente nas faixas do
vermelho e do azul; ao absorver esses comprimentos
Eventualmente, pode ser encontrada a equação de luz, é refletida a luz verde, por isso as plantas apre-
simplificada da fotossíntese em alguns livros: sentam tal coloração.

Absorção de luz
Luz
6 CO2 + 6 H2O C6H12O6 + 6 O2
Clorofila A
Clorofila B
Beta caroteno
Os organismos fotoautótrofos utilizam dióxido de
carbono (CO2) e água (H2O) presentes no ambiente e,
por meio da energia luminosa absorvida pela clorofila,
produzem glicose (C6H12O6) e oxigênio (O2).

Absorção de luz
Os fotoautótrofos têm suma importância para a ma-
nutenção da vida na Terra, pois são os responsáveis por
produzir oxigênio atmosférico por meio da fotossíntese.
Além disso, vale lembrar que eles são a base da maior
parte das cadeias alimentares.

oxigênio
dióxido de
carbono
luz solar

350 400 450 500 550 600 650 700


Comprimento de onda (nm)
É possível observar diferentes espectros de absorção de luz, sendo
maior nas faixas do violeta-azul e laranja-vermelho, e menor na faixa da
cor verde.
glicose

Os carotenoides são pigmentos que absorvem


comprimentos de onda em faixas diferentes das clo-
rofilas. Em geral, eles podem ter diversas cores, como
alaranjados, amarelados ou avermelhados, e, assim
como as clorofilas, absorvem alguns comprimentos
de onda e refletem outros. Além disso, em grande
quantidade, eles podem atribuir diferentes colorações
água
às folhas das plantas. Esses pigmentos podem ser en-
contrados também em organismos não fotossintetizan-
As plantas utilizam dióxido de carbono (CO2) e água (H2O) presentes
no ambiente e, por meio da energia luminosa absorvida pela clorofila, tes e, geralmente, desempenham função antioxidante.
produzem glicose (C6H12O6) e oxigênio (O2). Elementos representados
UTTERSTRÖM PHOTOGRAPHY/ALAMY STOCK PHOTO

fora da escala de tamanho. Cores fantasia.

Cloroplasto e pigmentos
fotossintetizantes
A energia solar tem papel fundamental na fotossín-
tese, uma vez que ela é absorvida por meio de pig-

Material exclusivo para professores


mentos fotossintetizantes, moléculas presentes nos
cloroplastos de células dos organismos capazes de
realizar esse processo.
Os principais pigmentos presentes nas plantas são

conveniados ao Sistema de Ensino


as clorofilas, em especial as clorofilas dos tipos A e B.
Os pigmentos são específicos para comprimentos de As diversas colorações nas folhas se devem à presença de diferentes
onda diferentes e capazes de absorver algumas cores pigmentos fotossintetizantes.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 194 14/12/18 12:43
33 – Material do Professor 195

Etapas da fotossíntese

BIOLOGIA 1A
A fotossíntese pode ser dividida em duas etapas: fase fotoquímica ou fase
clara, em que há participação da energia luminosa; e fase química ou fase
escura, que acontece independentemente da luz. A fotossíntese acontece no
cloroplasto, sendo a fase clara nas lamelas dos tilacoides, e a escura no estroma.

Luz absorvida

12 H2O
6 CO2
Cloroplasto

Transportadores

ADP
Ciclo de
Calvin
12 H2

ATP
Estroma

Tilacoides
6 H2O
6 O2
1 Glicose

Esquema ilustrando as fases clara e escura da fotossíntese. Elementos representados fora


da escala de tamanho. Cores fantasia.

ETAPA FOTOQUÍMICA OU FASE CLARA


Nesta fase, que depende de luz solar para acontecer, as clorofilas perdem elé-
trons quando entram em contato com a energia luminosa. Ocorrem três etapas
de reações químicas, denominadas fosforilação cíclica, fosforilação acíclica e
fotólise da água. Esses processos não acontecem separadamente, e sim todos
ao mesmo tempo, dentro da organela. Um não depende do outro para acontecer.

Fosforilação cíclica
Fosforilação significa adicionar fosfatos e, nesse caso, ocorre na presença
de luz (pode-se encontrar a variação “fotofosforilação” em alguns livros). Uma
molécula de ADP recebe um grupo fosfato e transforma-se em ATP. Para que essa
transformação aconteça, as moléculas de clorofila e outros pigmentos (como os
carotenoides) formam o chamado complexo antena, por serem as substâncias
aceptoras de elétrons e apresentarem enzimas que recebem energia luminosa.
O complexo antena é constituído por diversas moléculas de pigmentos fotossin-
tetizantes (clorofila, carotenoides, entre outros). Ele contém dois centros de reação.
• Fotossistema I: rico em moléculas de clorofila A, que absorvem luz em com-
primentos de onda de 700 nanômetros, por isso as clorofilas A são também
chamadas de P700.
• Fotossistema II: rico em moléculas de clorofila B, que absorvem luz em com-
primentos de onda de 680 nanômetros, por isso as clorofilas B são também
chamadas de P680.

Material exclusivo para professores


A fosforilação cíclica utiliza o fotossistema I, em que a energia luminosa é ab-
sorvida pela clorofila A e libera um elétron, o qual é carreado por um conjunto de
citocromos até que haja a fosforilação da molécula ADP e sua conversão em ATP.

conveniados ao Sistema de Ensino


Conforme os elétrons são transportados na cadeia, eles perdem energia. Ao final
da cadeia, os elétrons retornam às clorofilas do fotossistema I e, por isso, dá-se o
nome de fosforilação cíclica.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 195 14/12/18 12:43
196 34 – Material do Professor

Cadeia
BIOLOGIA 1A

transportadora
ATP
de elétrons

Elétrons
excitados
Energia para
Energia produzir ATP
luminosa

Clorofila Transportador de
elétrons

Clorofila (fotossistema I)

Esquema de fosforilação cíclica. No fotossistema I, ao absorverem luz, as clorofilas A liberam elétrons em


forma energia que, em seguida, são recolhidos e passam por um aceptor de elétrons, formando uma cadeia
de citocromos que resultará na formação de moléculas de ATP. Elementos representados fora da escala de
tamanho. Cores fantasia.

Fosforilação acíclica
Esse processo utiliza-se tanto do fotossistema I quanto do fotossistema II, que
é rico em clorofila B. Pelo fato de os elétrons não retornarem às clorofilas dos fo-
tossistemas dos quais foram originados, como acontece na cíclica, essa etapa é
denominada fosforilação acíclica.
A luz absorvida nos cloroplastos promove a quebra da molécula de água, liberan-
do oxigênio, elétrons e prótons H+. Esse processo é denominado fotólise da água.

Luz
H2O 2 e– + 2 H+ + ½ O2

A luz proveniente do Sol é convertida em energia elétrica, que é convertida em


energia química e armazenada em moléculas de ATP e NADPH2. Portanto, os produtos
finais da etapa fotoquímica são: O2 (liberado na atmosfera durante a fotólise); NADPH
e ADP (que serão utilizados na etapa química); e H+ (utilizado na formação de ATP).

H2O
luz

e- + 2 H+ + ½ O2

Clorofila B
ADP + P ATP
Fotossistema II e -

luz Citocromos

Material exclusivo para professores Clorofila A


e-

e- + 2 H+
NADP

conveniados ao Sistema de Ensino


Fotossistema I NADPH2

A água é quebrada e libera elétrons, que vão repor os elétrons liberados pelo fotossistema II; prótons H+, que são
recolhidos pela ferredoxina, responsável por reduzir o NADP a NADPH2; oxigênio, que é liberado no ambiente.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 196 14/12/18 12:43
35 – Material do Professor 197

ETAPA QUÍMICA OU FASE ESCURA

BIOLOGIA 1A
Esta etapa ocorre no estroma dos cloroplastos e não necessita de energia lu-
minosa. Entretanto, são necessárias moléculas de ATP e NADPH2 produzidas na
etapa fotoquímica. Os átomos de carbono, adquiridos do CO2 da atmosfera, serão
incorporados nas moléculas orgânicas por meio do ciclo das pentoses ou ciclo de
Calvin, originando os carboidratos, como a glicose.

ATP ADP

n CO2 (CH2O)n + H2O

NADPH2 NADPH

Ciclo de Calvin
Nesta etapa, o CO2 une-se à ribulose bifosfato (RuBP), uma substância composta
de cinco carbonos presente no estroma, conhecida pela fixação do carbono e cata-
lisada pela enzima rubisco, formando um composto de seis carbonos chamado de
fosfoglicerato (PGA). Por meio da ação das moléculas de ATP e NADPH2 produzidas
na etapa fotoquímica, o PGA será convertido em gliceraldeido fosfato (PGAL),
composto de três carbonos. O PGAL tem duas principais funções: pode ser usado
na recomposição da RuBP e como substrato do ciclo de Calvin; ou pode, ainda, ser
aplicado na síntese de carboidratos, como a glicose. Pelo fato de o PGAL ser consti-
tuído de três carbonos, as plantas capazes de produzi-lo são denominadas plantas C3.

H2O
CO2
Luz
NADP + Entrada
3CO2
ADP Ciclo de
Calvin
ATP Rubisco 1. Fixação do carbono

NADPH
O2 C2H12O2
3 Ribulose bifosfato
(RuBP) 6 Fosfoglicerato (PGA)
6 ATP

6 ADP
Ciclo de
3 ADP
Calvin
3 ATP 6 Bifosfato (BPG)
6 NADPH
6 NADP+
5 Gliceraldeído 6 Pi
fosfato (PGAL)
6 Gliceraldeído
3. Regeneração da fosfato (PGAL)
ribulose difosfato 2. Produção de
(RuBP) compostos orgânicos

1 Gliceraldeído Glicose e outros


fosfato (PGAL) compostos orgânicos
Rendimento

Esquema do ciclo de Calvin dividido em três etapas. Para cada três moléculas de CO2 que entram no ciclo,
a produção líquida é uma molécula de gliceraldeido fosfato (PGAL). As reações luminosas sustentam o ciclo
regenerando ATP e NADPH.

Material exclusivo para professores


Os carboidratos provenientes da fotossíntese são utilizados pelas plantas na
forma de energia química, isto é, eles atuam na síntese de outras moléculas,
como os aminoácidos e os ácidos graxos, por meio da energia resultante da fo-

conveniados ao Sistema de Ensino


tossíntese. O PGAL tem múltiplas funções e é extremamente importante para
a vida da célula vegetal. Parte dele se mantém no cloroplasto e parte é enviado
ao citosol, onde será convertido em glicose e utilizado na respiração celular,

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 197 14/12/18 12:43
198 36 – Material do Professor

ou em sacarose, principal carboidrato de transporte dessas plantas estão abertos, há entrada de CO2 e,
BIOLOGIA 1A

das plantas, que pode ser convertido em glicose e por meio da ação da enzima PEPcarboxilase, ocorre
utilizado em outras reações metabólicas. O PGAL a formação do malato. Esse composto é armazenado
mantido no cloroplasto é convertido em amido, em como reserva de CO2 nas células do mesofilo foliar.
forma de grânulos no estroma, quando há energia O ciclo de Calvin ocorre nas células clorofiladas que
luminosa. No período sem luz, ele é convertido em se encontram em torno dos feixes vasculares, forman-
sacarose e exportado a outras partes da planta. Vale do a nervura das folhas. Em outras palavras, realiza-se
lembrar que o amido é o principal carboidrato de em local diferente da formação do malato e utiliza o CO2
reserva nas plantas. proveniente desse composto para iniciar o processo.
Dessa forma, a fixação de carbono e a produção de car-

Adaptação dos mecanismos boidratos ocorrem de forma eficaz, com os estômatos


parcialmente fechados, sem grandes perdas durante a
de fixação do carbono em transpiração das plantas.

plantas de climas áridos e

KYNNY/ISTOCKPHOTO.COM
quentes
A fotorrespiração é o processo no qual a eficiên-
cia da fotossíntese é reduzida, pelo fato de o oxigênio
(O 2) ser consumido pela planta, produzindo dióxido
de carbono (CO 2) resultante da degradação de com-
postos intermediários do ciclo de Calvin.
As plantas C3 são aquelas que têm o PGAL com-
posto de três carbonos, como é o caso da soja,
do trigo, das batatas e de todas as árvores. Essas
plantas não apresentam um bom rendimento na pro-
dução de carboidratos na fotossíntese em épocas
quentes, em virtude da grande perda de água. As- O milho é um exemplo de planta C4.
sim, em dias quentes e secos, as plantas fecham os
estômatos, que são estruturas foliares responsáveis As plantas CAM ou MAC são aquelas adaptadas
pela realização de trocas gasosas, além da trans- a climas áridos, por isso abrem seus estômatos du-
piração. Dessa forma, a transpiração é controlada, rante a noite. Elas são assim chamadas por apresen-
evitando a perda de água. Por outro lado, o fecha- tarem o metabolismo ácido das crassuláceas (MAC),
mento dos estômatos reduz as trocas gasosas, o ou crassulacean acid metabolism (CAM), sendo as
que interfere diretamente na fotossíntese. crassuláceas a família à qual elas pertencem. Exem-
plos de plantas MAC são as bromélias, o abacaxi, as
orquídeas, os cactos e todas as plantas que apresen-
DR. GERALD VAN DYKE/GETTY IMAGES

tam folhas suculentas.

VENCAVOLRAB/ISTOCKPHOTO.COM

Micrografia eletrônica da folha do tabaco (Nicotiana tabacum)


evidenciando estômatos abertos e fechados. Aumento de 1 000x. Cores
fantasia.

Material exclusivo para professores


Abacaxis são representantes das plantas CAM.
As plantas C4 têm o malato (composto de quatro
carbonos) como composto orgânico estável na fotos- Para realizar a fixação do carbono de forma efi-
síntese, e não o PGAL, como nas plantas C3. Exemplos ciente e gerar carboidratos, essas plantas produzem

conveniados ao Sistema de Ensino


de plantas C4 são o milho e a cana-de-açúcar. Elas não malato no período da noite, quando os estômatos
têm somente o ciclo de Calvin como via metabólica estão abertos. O ciclo de Calvin ocorre no período
para a fixação do carbono. Assim, quando os estômatos da manhã, na mesma célula onde ocorre a fixação do

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 198 14/12/18 12:43
37 – Material do Professor 199

carbono (mesofilo foliar). Portanto, esses processos acontecem no mesmo local


e estão separados apenas temporalmente.

BIOLOGIA 1A
As principais diferenças entre o metabolismo das plantas C3, C4 e CAM se
encontram no quadro a seguir.

Clima
Separação entre fixação de Estômatos
Tipo mais bem
CO2 e ciclo de Calvin abertos
adaptado
C3 nenhuma separação dia frio e úmido

C4 entre mesófilos e células do feixe vascular dia quente e ensolarado


(espacial)

CAM entre noite e dia (temporal) noite muito quente e seco

LEITURA COMPLEMENTAR
Caatinga: patrimônio do Brasil
A vegetação xerófita típica do bioma, a Caatinga, localizada no nordeste brasileiro e no
norte de Minas Gerais, é o único bioma exclusivamente brasileiro, ocupando cerca de
7% do território.
A Caatinga reúne espécies de plantas adaptadas ao clima árido e seco, que apresentam
caducidade (queda de folhas), raízes profundas, resistência ao fogo e folhagem adaptada
para pouca quantidade de água e retenção de umidade, como os espinhos das cactáceas,
que reduzem a taxa de perda de água pela transpiração. Ao total, tem três estratos ve-
getais: herbáceo (abaixo de dois metros), arbóreo (oito a 12 metros) e o arbustivo (dois a
cinco metros). O aspecto geral da vegetação, na seca, é de uma mata espinhosa, própria
da região do sertão nordestino.
Durante o período de seca (agosto), a temperatura do solo pode atingir 60 °C; assim, há
aceleração da evaporação da água. No verão, há grande incidência de chuvas, de modo
que a terra fica bastante encharcada e as plantas absorvem o máximo de água possível,
com suas raízes bastante desenvolvidas.
Entretanto, o solo raso e cheio de pedras não consegue armazenar água, por isso somente
em áreas próximas às serras é possível realizar agricultura, onde há maior abundância
de chuvas.
SERGIO VIANA/GETTY IMAGES

Material exclusivo para professores


conveniados ao Sistema de Ensino
Caatinga no nordeste brasileiro. Esse bioma contém diversas espécies de plantas com adaptações específicas
para o clima árido.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 199 14/12/18 12:43
200 38 – Material do Professor

ROTEIRO DE AULA
BIOLOGIA 1A

FOTOSSÍNTESE

Principais Organismos Consome Produz Etapas


pigmentos fotossintetizantes

Clorofilas Plantas CO2 Glicose

Carotenoides Cianobactérias

Alguns protistas

Bactérias fotossintetizantes

Fase clara ou Fase escura ou


fotoquímica química

Local:
Local: Tilacoides

Ciclo de Calvin Estroma


produz:

ATP
Fosforilação
cíclica forma: Carboidratos
Fixação de
carbono

Fosforilação NADPH2 Citosol Cloroplasto


acíclica forma:

O2 Na forma de:
Fotólise da
H1
água produz:
Elétrons Glicose Amido

Material exclusivo para professores


Plantas C4 Plantas CAM

conveniados ao Sistema de Ensino


Malato e ciclo de Calvin Malato e ciclo de Calvin
separados espacialmente separados temporalmente

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 200 14/12/18 12:43
39 – Material do Professor 201

EXERCÍCIOS DE APLICAÇÃO

BIOLOGIA 1A
1. Uepa d) o oxigênio produzido na fotossíntese é resultante
das reações independentes da luz.
Se todos os açúcares produzidos pelo processo ilus-
trado abaixo em um ano tivessem a forma de cubos e) os seres autótrofos utilizam o CO2 durante as rea-
de açúcar, haveria 300 quatrilhões deles. Se fossem ções dependentes de luz.
A alternativa B está incorreta porque o hidrogênio originado na fotólise
dispostos em linha, esses cubos se estenderiam da
da água será utilizado na formação de NADPH2. A alternativa C está
Terra até Plutão. Isso representa uma imensa produção incorreta porque essa fase ocorre nos tilacoides do cloroplasto. A
de energia. Sobre o processo abordado no enunciado, alternativa D está incorreta porque o oxigênio é produzido durante a
observe a imagem abaixo e analise as afirmativas: fotólise da água. A alternativa E está incorreta porque o CO2 é utilizado
somente na fase química, no ciclo de Calvin.
3. UEL-PR
Leia o texto a seguir.
CO2
Elysia chlorotica (um tipo de lesma-do-mar) é um molusco
híbrido de animal e vegetal, considerado o primeiro ani-
O2
mal autotrófico. Cientistas identificaram que o Elysia in-
H2O
corporou o gene das algas Vaucheria litorea – o psbO – das
Luz solar quais ele se alimentava, por isso desenvolveu a capacidade
de fazer fotossíntese por aproximadamente nove meses.
Os últimos estudos revelam que o molusco marinho tam-
Folha
bém desenvolveu capacidades químicas, permitindo-lhe
sintetizar clorofila, produzindo, assim, seu alimento. Essa
capacidade é a mais nova proeza do Elysia, cujas habili-
dades evolutivas têm chamado a atenção da comunidade
científica.
C6H12O6 Disponível em: <http://super.abril.com.br/mundo-animal/
Caule criatura-fusao-animal-vegetal-543145.shtml>. Acesso em: 20 jun. 2012.
a) Explique a função da clorofila na fotossíntese.
A função da clorofila é absorver a energia luminosa, transferindo-a para

a reação da fotossíntese. A fotossíntese é um processo celular que


Raiz

consiste na produção de moléculas orgânicas (principalmente glico-


I. Os produtos liberados para o ambiente são água e
oxigênio. se), a partir de substâncias inorgânicas simples, em geral, água e gás
II. O processo ilustrado acima refere-se à respiração
vegetal. carbônico, por meio da clorofila e da presença de energia luminosa.
III. Ocorre absorção de dióxido de carbono pelas folhas.
b) Pelo fato de realizar fotossíntese, qual seria uma
IV. É um processo que ocorre na presença de luz solar.
possível vantagem adaptativa do Elysia chlorotica em
V. A água utilizada no processo é absorvida pelas relação a outros moluscos que são heterotróficos?
folhas.
Uma possível vantagem adaptativa da Elysia chlorotica seria viver em
A alternativa que contém todas as afirmativas cor-
retas é:
ambientes com luz, mas com pouca disponibilidade de alimento, pois
a) I e II
b) I, III e IV ela pode produzir seu próprio alimento.
c) I, III e V
d) II, III e V
4. UERR
e) II, III, IV e V
A fotossíntese é a via pela qual praticamente toda a
A alternativa II está incorreta porque se trata da fotossíntese e a energia entra em nossa biosfer. Isso ocorre através das
alternativa V está incorreta porque a água utilizada no processo é várias reações metabólicas, sendo estas reações divi-
proveniente do solo.
didas em dois principais processos: reações de “claro”
e reações de “escuro”.
2. UFRGS
Em relação às reações de “claro”, assinale a alterna-

Material exclusivo para professores


Sobre a fotossíntese, é correto afirmar que tiva correta que resume os eventos desta fase na
a) as reações dependentes de luz convertem energia fotossíntese.
luminosa em energia química. a) A produção de glicina, durante a fase clara, que utiliza
b) o hidrogênio resultante da quebra da água é elimi- ATP para produção desta molécula.

conveniados ao Sistema de Ensino


nado da célula durante a fotólise. b) A produção de glicose, durante a fotólise da água
c) as reações dependentes de luz ocorrem no estroma e produção de CO2 em presença de luz, ou seja,
do cloroplasto. fotoxidação.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 201 14/12/18 12:43
202 40 – Material do Professor

c) A produção de NADPH2 durante a fotólise da água 6. UEL-PR


BIOLOGIA 1A

e produção de ATP em presença de luz, ou seja,


Leia o texto a seguir.
fotofosforilação.
d) A produção de FADH2 durante a fase clara, utilizando O químico estadunidense Daniel Nocera anunciou o de-
senvolvimento de um dispositivo conhecido como “folha
ATP para produção de citrato.
artificial”, capaz de produzir energia elétrica a partir de
e) A produção de FADPH2 durante a fase clara e pro- luz solar e água sem gerar poluentes. A “folha artificial”
dução de etanol.
utiliza a luz solar para quebrar moléculas de água (H2O),
Durante a fase clara, há produção de NADPH2 e produção de ATP. O
de forma semelhante ao que ocorre nas plantas durante o
NADPH2 é reduzido ao receber os prótons H+ oriundos da fotólise
da água e o ATP é originado da liberação de elétrons do fotossis- processo de fotossíntese. Entretanto, na “folha artificial”,
tema I, que passa pelo citocromo, perdendo energia para que haja os átomos de hidrogênio e de oxigênio são armazenados
produção desta molécula. em uma célula combustível que poderá produzir energia
elétrica imediatamente ou ser utilizada mais tarde. Nunca
uma fonte de energia limpa esteve tão associada ao termo
5. USF-SP “verde”.
Durante a fotossíntese, a reação entre o CO2 e a 1,5-bi- Disponível em: <http://cienciahoje.uol.com.br/noticias/2011/04/
fosfato de ribulose é catalisada pela substância rubisco. fotossintese-sintetica>. Acesso em: 18 maio 2013.
De acordo com alguns autores, essa enzima é a mais a) No processo realizado pela “folha artificial”, são for-
abundante da Terra e representa cerca de 50% do total mados átomos de hidrogênio e de oxigênio. Cite os
de proteínas do cloroplasto. Se um determinado herbi- produtos formados ao final da fase fotoquímica (fase
cida atuar como inibidor da molécula rubisco, a qual é clara) da fotossíntese vegetal.
constituída de (I), a sua aplicação na planta terá como Ao final da fase fotoquímica da fotossíntese vegetal, tem-se
consequência direta o/a (II). como produtos NADPH, ATP e gás oxigênio (O2).

Marque a opção que preenche corretamente (I) e (II).


a) (I) - aminoácidos; (II) - inibição da fotólise.
b) (I) - nucleotídeos; (II) - impedimento da liberação de
O2 pela planta.
c) (I) - monômeros; (II) - bloqueio da fotofosforilação b) O principal objetivo do desenvolvimento da “folha
cíclica. artificial” é a produção de energia elétrica. Qual a
principal utilização da energia armazenada ao final da
d) (I) - aminoácidos; (II) - interrupção do ciclo de Calvin.
fase fotoquímica, no caso da fotossíntese vegetal?
e) (I) - peptídeos; (II) - não produção de ATP no cloro- A energia armazenada ao final da fase fotoquímica na forma de ATP e
plasto.
A rubisco é uma enzima, isto é, um tipo de proteína, e, portanto,
NADPH é utilizada principalmente para a síntese de carboidratos por
é constituída por aminoácidos. Sem ela, não há produção de car-
boidratos, pelo fato de ela fazer parte do ciclo de Calvin. Assim, o
ciclo não consegue se completar.
meio de CO2 durante a etapa química da fotossíntese.

EXERCÍCIOS PROPOSTOS
7. Famerp-SP – As algas são importantes produtoras de fotossintética durante o período diurno. É correto afir-
gás oxigênio, substância fundamental para a maioria mar que essas plantas
dos seres vivos. O gás oxigênio liberado pelas algas a) respiram e fotossintetizam apenas durante o período
provém das diurno.
a) moléculas de piruvato, derivadas da glicólise que b) respiram e fotossintetizam apenas durante o período
ocorre na respiração celular. noturno.
b) moléculas de água, após a fotólise que ocorre na
c) respiram o dia todo e fotossintetizam apenas durante
fotossíntese.
o período diurno.
c) moléculas de glicose, após a glicólise que ocorre na
d) respiram e fotossintetizam o dia todo.
respiração celular.
d) moléculas de nitrato, derivadas da oxidação durante 9. UEPB (adaptada) – Em regiões tropicais como nos-
a quimiossíntese. so país, certas plantas apresentam adaptações às
e) moléculas de gás carbônico, após a etapa química condições ambientais, tais como alta intensidade lu-
da fotossíntese. minosa, altas temperaturas e baixa disponibilidade
de água. Nessas condições, os estômatos podem

Material exclusivo para professores


8. Unicamp-SP permanecer fechados por muito tempo durante o dia,
Algumas plantas de ambientes áridos apresentam o o que reduz a transpiração da planta, mas também
chamado “metabolismo ácido das crassuláceas”, em restringe a entrada de gás carbônico, fundamental
que há captação de CO2 atmosférico durante a noite, para o processo de fotossíntese. Assim, nessas re-

conveniados ao Sistema de Ensino


quando os estômatos estão abertos. Como resulta- giões, foram identificadas plantas com diferentes es-
do, as plantas produzem ácidos orgânicos, que poste- tratégias adaptativas, no que diz respeito ao processo
riormente fornecem substrato para a principal enzima fotossintético.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 202 14/12/18 12:43
41 – Material do Professor 203

Sobre o tema exposto, são apresentadas as proposi- 12. UPE – “Planta no quarto não mata ninguém: Se fosse,

BIOLOGIA 1A
ções a seguir. não haveria um índio vivo na Floresta Amazônica”, ar-
I. O milho e a cana-de-açúcar são exemplos de plantas gumenta o botânico Gilberto Kerbauy, da Universidade
__________________. de São Paulo.
II. Nessas plantas, os estômatos são abertos durante Essa afirmativa baseia-se na seguinte crença:
a noite. a) As plantas consomem o gás carbônico durante o
III. Nessas plantas, ocorre a formação de malato por processo de respiração, diminuindo-o da atmosfera.
meio da ação da enzima PEPcarboxilase. b) À noite, as plantas consomem oxigênio no processo
IV. Os cactos e o abacaxi são exemplos de plantas de respiração, deixando-o rarefeito no quarto.
__________________. c) No processo de fotossíntese, as plantas consomem
Assinale a opção que apresenta a relação correta entre oxigênio e água, deixando o ar mais seco.
as colunas. d) As plantas produzem gases e toxinas à noite para
repelir insetos predadores, intoxicando o ambiente.
a) As afirmativas I e II se referem às plantas C4.
e) No processo de respiração, as plantas consomem
b) As afirmativas III e IV se referem às plantas CAM.
gás carbônico e eliminam oxigênio, que, em excesso,
c) As afirmativas I e III se referem às plantas CAM. pode causar danos ao sistema nervoso.
d) As afirmativas III e IV se referem às plantas C4.
e) As afirmativas I e III se referem às plantas C4. 13. PUC-RS – Baseados nos conhecimentos biológicos,
pesquisadores brasileiros têm buscado converter água
10. Sistema Dom Bosco – A fotossíntese é fundamental e luz solar em combustível. A estratégia é separar oxi-
para a manutenção da vida na Terra. Explique a impor- gênio e hidrogênio pela quebra da molécula de água,
tância desse processo. usando a energia luminosa. Para isso, um nanomate-
rial será usado para absorver a energia luminosa que
promoverá essa reação. Oxigênio e hidrogênio gaso-
sos serão, então, armazenados e, quando recombi-
nados, produzirão eletricidade e água. Um processo
semelhante é realizado naturalmente nos vegetais
durante a fase luminosa da fotossíntese, quando há
__________________ para quebrar a molécula de água
e liberar __________________ gasoso. Com a luz, há
transferência de __________________ para NADP+ e,
finalmente, é gerado(a) __________________, que atuará
como combustível químico.
a) ADP - hidrogênio - oxigênio - clorofila
b) ATP - oxigênio - hidrogênio - ATP
c) ATP - hidrogênio - oxigênio - ADP
11. UERN d) clorofila - oxigênio - hidrogênio - ATP
A figura mostra o esquema do cloroplasto, organela e) clorofila - hidrogênio - oxigênio - ADP
celular responsável pelo processo fotossintético.
14. Sistema Dom Bosco – Durante a fase fotoquímica da
fotossíntese, ocorrem alguns processos metabólicos,
A
B como fosforilação cíclica, fosforilação acíclica e a fo-
tólise da água. Cite as diferenças entre os tipos de
fosforilação.

Assinale a alternativa correta:


a) C corresponde aos tilacoides, onde se encontra a
clorofila.

Material exclusivo para professores


b) A corresponde a uma pilha de tilacoides conhecida
por granum.
c) B corresponde ao estroma, onde há sacos membra-

conveniados ao Sistema de Ensino


nosos denominados tilacoides.
d) C corresponde ao vacúolo, onde há sacos membra-
nosos discoidais chamados granum.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 203 14/12/18 12:43
204 42 – Material do Professor

15. Unesp Suponha que uma cultura de algas verdes seja ilumina-
BIOLOGIA 1A

Um vaso com uma planta de folhas verdes foi colocado da e receba gás carbônico com o isótopo C-14 e água
sobre uma mesa, no centro de um quarto totalmente com o isótopo O-18. Pode-se afirmar que
vedado, de modo a impedir a entrada da luz externa, e a) o gás carbônico participa das etapas A e B e prevê
ali permaneceu por 24 horas. que ocorra produção de glicose com o isótopo C-14
Durante as 12 primeiras horas (período I), a planta foi nas duas etapas.
iluminada com luz verde, de comprimento de onda na b) o gás carbônico participa apenas da etapa A e prevê
faixa de 500 a 550 nm. Nas 12 horas seguintes (período que ocorra produção de glicose com o isótopo C-14
II), a planta foi iluminada com luz laranja-avermelhada, nesta etapa.
de comprimento de onda na faixa de 650 a 700 nm. c) a água participa das etapas A e B e prevê que ocor-
Considerando a incidência da luz sobre a planta e a taxa ra a liberação de oxigênio com o isótopo O-18 nas
fotossintética, é correto afirmar que, aos olhos de um duas etapas.
observador não daltônico que estivesse no quarto, as d) a água participa apenas da etapa A e prevê que
folhas da planta se apresentariam ocorra liberação de oxigênio com o isótopo O-18
a) de cor verde no período I e enegrecidas no período II, nesta etapa.
e a taxa de fotossíntese seria maior no período II e
reduzida ou nula no período I. 17. Sistema Dom Bosco – Plantas que vivem em ambien-
b) enegrecidas no período I e de cor vermelha no perío- tes quentes e secos desenvolveram diferentes meca-
do II, e a taxa de fotossíntese seria maior no período I nismos de fixação do carbono durante a etapa química
e reduzida ou nula no período II. da fotossíntese na tentativa de realizar esse processo
c) enegrecidas no período I e enegrecidas no período II, de forma eficiente, uma vez que o clima faz com que
e em ambos os períodos a planta não realizaria fo- elas percam moléculas de vapor de água, além de in-
tossíntese, mas apenas respiração. terferir diretamente nas trocas gasosas. Explique as
d) de cor verde no período I e de cor vermelha no perío- diferenças entre as adaptações desenvolvidas pelas
do II, e a taxa de fotossíntese seria maior no período I plantas C3 e C4.
do que no período II.
e) de cor verde no período I e de cor verde no período II,
e a taxa de fotossíntese seria maior no período I do
que no período II.

16. Albert Einstein – Analise o esquema abaixo que


se refere, de forma simplificada, ao processo de
fotossíntese.

ATP
NADPH Produto
Luz Etapa A Etapa B
ADP + P final
NADP

ESTUDO PARA O ENEM


18. Enem C2-H5 19. Enem C6-H22
A célula fotovoltaica é uma aplicação prática do efeito Pesquisadores conseguiram estimular a absorção de
fotoelétrico. Quando a luz incide sobre certas substân- energia luminosa em plantas graças ao uso de nano-
cias, libera elétrons que, circulando livremente de átomo tubos de carbono. Para isso, nanotubos de carbono “se
para átomo, formam uma corrente elétrica. Uma célula inseriram” no interior dos cloroplastos por uma mon-
fotovoltaica é composta por uma placa de ferro recober- tagem espontânea, através das membranas dos cloro-
ta por uma camada de selênio e uma película transpa- plastos. Pigmentos da planta absorvem as radiações
rente de ouro. A luz atravessa a película, incide sobre luminosas, os elétrons são “excitados” e se deslocam no
o selênio e retira elétrons, que são atraídos pelo ouro, interior de membranas dos cloroplastos, e a planta uti-
um átomo condutor de eletricidade. A película de ouro liza em seguida essa energia elétrica para a fabricação
é conectada à placa de ferro, que recebe os elétrons e os de açúcares. Os nanotubos de carbono podem absorver
devolve para o selênio, fechando o circuito e formando comprimentos de onda habitualmente não utilizados
uma corrente elétrica de pequena intensidade. pelos cloroplastos, e os pesquisadores tiveram a ideia
DIAS, C. B. Célula fotovoltaica. Disponível em: <http://super.abril. de utilizá-los como “antenas”, estimulando a conversão

Material exclusivo para professores


com.br>. Acesso em: 16 ago. 2012. (Adaptado) de energia solar pelos cloroplastos, com o aumento do
transporte de elétrons.
O processo biológico que se assemelha ao descrito é a Disponível em: <http://lqes.iqm.unicamp.br>.
Acesso em: 14 nov. 2014 (Adaptado)
a) fotossíntese. d) hidrólise do ATP.

conveniados ao Sistema de Ensino


b) fermentação. e) respiração celular.
c) quimiossíntese.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 204 14/12/18 12:43
43 – Material do Professor 205

O aumento da eficiência fotossintética ocorreu pelo fato

BIOLOGIA 1A
de os nanotubos de carbono promoverem diretamente a
HO
a) utilização de água. CO2 2
O2
b) absorção de fótons.
Fotossíntese
c) formação de gás oxigênio.
d) proliferação de cloroplastos.
Triose-P
e) captação de dióxido de carbono. Piruvato Acetil - CoA Ácido graxo
PhaA
20. Enem C5-H17 UDP-glicose Glicose-1-P
SPS Diacilglicerol
AGPase Poli-β-hidroxibutarato
O quadro é um esquema da via de produção de biocom- DGAT
bustível com base no cultivo de uma cianobactéria ge- Sacarose Glicogênio
neticamente modificada com a inserção do gene DGAT. Triacilglicerol
Além da introdução desse gene, os pesquisadores in-
terromperam as vias de síntese de outros compostos
orgânicos, visando aumentar a eficiência na produção Considerando as vias mostradas, uma fonte de matéria-
do biocombustível (triacilglicerol). -prima primária desse biocombustível é o(a)
a) ácido graxo, produzido a partir da sacarose.
b) gás carbônico, adquirido via fotossíntese.
c) sacarose, um dissacarídeo rico em energia.
d) gene DGAT, introduzido por engenharia genética.
e) glicogênio, reserva energética das cianobactérias.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 205 14/12/18 12:43
17
206 44 – Material do Professor

20
BIOLOGIA 1A

RESPIRAÇÃO AERÓBIA

Em 2016, pesquisadores de diversas partes do mundo tiveram acesso à caverna


Movile, localizada no sudoeste da Romênia. O local foi encontrado em 1986, durante
• Fatores limitantes da uma pesquisa para achar a melhor região para a construção de uma usina nuclear.
fotossíntese Os cientistas divulgaram a descoberta de artrópodes, bactérias e outros seres vivos
• Ponto de compensação no ambiente que pensavam ser inóspito. No total, foram catalogadas 175 espécies
luminosa (PCL) vivendo nesse hábitat, o qual apresentava condições ambientais bem específicas.
• Quimiossíntese Entre esses seres, foram descobertas 33 novas espécies de coleópteros, além de
aranhas, escorpiões-marinhos, pseudoescorpiões, sanguessugas e isópodes. Todos
HABILIDADES esses organismos apresentam ausência de visão e pigmentação.
• Compreender e citar como A caverna Movile é considerada única no mundo por suas características,
os fatores internos e principalmente pelo fato de o ar ser bastante pobre em oxigênio e rico em sulfato
externos podem limitar a de hidrogênio – substância produzida por bactérias quimiossintetizantes, as quais
fotossíntese. são predominantes no local. Isso ocorre porque as bactérias fotossintetizantes não
• Descrever as conseguem sobreviver em um ambiente desprovido de luz solar, como é o dessa
consequências da caverna desde cerca de 5,5 milhões de anos atrás. As bactérias quimiossintetizan-
fotossíntese de acordo com tes, por sua vez, obtêm energia pela oxidação do sulfato (SO42–) e do amônio (NH4+),
os fatores limitantes. produzindo uma fonte de carbono e energia por meio dessa reação química.
• Entender o conceito de De acordo com os pesquisadores, o mais intrigante é como esses animais chega-
quimiossíntese. ram a um ambiente tão inóspito e se adaptaram de forma eficaz ao longo do tempo.
• Descrever como a quimios- Segundo o microbiologista J. Collin Murrel, da Universidade de East Aglia, do Reino
síntese produz energia. Unido, as bactérias provavelmente devem existir na caverna há mais de 5 milhões
• Citar os principais de anos. Ainda segundo Murrel, os outros organismos devem ter caído nela ao longo
organismos capazes de do tempo e ali ficaram presos, adaptando-se ao ambiente no decorrer desse longo
realizar a quimiossíntese. período e povoando o ambiente sem a concorrência com outras espécies.

SCIENCE PHOTO LIBRARY - SPL / FOTOARENA

Material exclusivo para professores


conveniados ao Sistema de Ensino Pesquisadores coletando amostras de bactérias da caverna Movile, na Romênia.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 206 14/12/18 12:43
45 – Material do Professor 207

Neste módulo vamos estudar o processo da qui- LEITURA COMPLEMENTAR


miossíntese, por meio do qual substâncias inorgânicas

BIOLOGIA 1A
Para ilustrar os fatores limitantes internos da fotossínte-
são oxidadas e transformadas em substâncias orgâni-
se, podemos imaginar a seguinte situação: considere que
cas, tal como na fotossíntese, porém sem a necessi-
você queira fazer dois bolos. No forno a ser utilizado, há
dade da luz. No entanto, antes de nos aprofundarmos
espaço para ambos e a temperatura para assá-los será
nesse fenômeno, vamos conhecer quais fatores limi-
a mesma (180 ºC). Como você deve saber, para os bolos
tam a ocorrência da fotossíntese.
crescerem é preciso fermento. Porém, ele acaba durante a
preparação do segundo bolo, o qual crescerá menos. Por-
Fatores limitantes da tanto, ainda que com iguais condições (mesmo ambiente,
mesma temperatura e com todos os outros ingredientes,
fotossíntese como farinha, ovos, óleo), o fator determinante para o
crescimento dos bolos é o fermento. Algo semelhante
Como estudado no módulo anterior, a fotossíntese ocorre em relação aos fatores internos na fotossíntese:
é essencial para a vida na Terra, pois sem esse pro- se não houver organelas suficientes, independentemente
cesso não haveria oxigênio disponível no planeta. A do ambiente e de outros fatores, a capacidade de fotos-
intensidade com que as células de seres autótrofos síntese será menor.
realizam essa reação pode ser medida pela quantidade
de CO2 consumido ou de O2 produzido. No entanto,
existem alguns fatores que podem influenciar na con-
centração dessas moléculas.
FATORES EXTERNOS
O britânico Frederick Frost Blackman (1866-1947) Estes se relacionam ao ambiente em que o organis-
foi um botânico, algologista e fisiologista vegetal que mo fotossintético está inserido. Os principais fatores
dedicou sua vida ao estudo da fotossíntese. Décadas externos capazes de limitar a taxa fotossintética são a:
após a sua morte, em 1947, o “princípio de Blackman”, concentração de CO2 na atmosfera, a temperatura,
como é chamado, foi estabelecido em 1995, quando a intensidade luminosa e o comprimento de onda.
outros conhecimentos foram acrescidos por pesquisas

SCIENCE PHOTO LIBRARY - SPL/SCIENCE PHOTO LIBRARY - SPL/FOTOARENA


recentes, o que resultou no seguinte postulado: Gancho de
germinação

Quando um processo metabólico é influencia- Caule


do por vários fatores que atuam isoladamente uns estiolado

dos outros, a velocidade do processo é limitada


pelo fator de menor intensidade.
Folhas

Em geral, os fatores limitantes da fotossíntese são


divididos em internos ou externos.

FATORES INTERNOS Primeiro nó


Para que a fotossíntese aconteça, é necessária a
participação de pigmentos fotossintetizantes, en-
zimas e cofatores. Além disso, quanto maior for o
número de cloroplastos ou outras organelas fotos-
sintetizantes nas células (as cianobactérias), maior
será a taxa fotossintética. Isso ocorre em virtude de
existirem mais pigmentos capazes de transformar O estiolamento é o desenvolvimento anormal dos
vegetais causado pela ausência de luz.
a energia luminosa em energia química. Ou seja, a
energia luminosa que chega até a superfície desses
seres é a mesma, a diferença é a capacidade de ab- Concentração de CO2
sorção que ocorre por meio das organelas providas O CO2 é o substrato da etapa química da fotossín-

Material exclusivo para professores


dessa função. tese que participa do chamado ciclo de Calvin. Sem
Esses elementos são os chamados fatores inter- esse elemento, não há possibilidade de a fotossíntese
nos, os quais são inerentes à célula fotossintética. ocorrer. Quando a concentração de CO2 cresce, a taxa
Portanto, eles não dependem de condições ambientais fotossintética também aumenta. No entanto, quando

conveniados ao Sistema de Ensino


externas. Sem esses fatores, a fotossíntese é reduzida
ou sequer é possível.
o sistema atinge uma concentração saturada de CO2,
a reação de fotossíntese alcança um platô. Ou seja,

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 207 14/12/18 12:43
208 46 – Material do Professor

há um limite para a taxa de fotossíntese. Portanto, a

Taxa de fotossíntese por


BIOLOGIA 1A

relação entre a taxa fotossintética e a concentração

unidade de área foliar


PLANTA C4
de dióxido de carbono (CO2) pode ser representada
da seguinte maneira:
PLANTA C3
Taxa de fotossíntese

1% 50% 100%
Isolação máxima

Luminosidade
0º 20º 40º
Temperatura (ºC)

Comparação entre as taxas de fotossíntese de plantas C3 e C4 em três


parâmetros diferentes: insolação máxima, luminosidade e temperatura.
0,1 0,2 0,3 0,4 % de CO2

Gráfico que relaciona a taxa fotossintética à concentração de CO2. Intensidade luminosa


Este fator influencia na taxa fotossintética, pois, em
Ao pensarmos em nível de ecologia e conservação completa escuridão, é impossível o processo ocorrer.
ambiental, as plantas não são capazes de utilizar todo Assim, quanto maior for a intensidade luminosa, maior
o CO2 liberado na atmosfera pelas atividades huma- será a taxa de fotossíntese.
nas. Ou seja, os níveis de CO2 não resultam em maior
produção de O2. Velocidade
de fotossíntese
As plantas apresentam um limite de utilização do
CO2. Quando todas as enzimas têm o substrato neces-
sário, esse ponto máximo é atingido, e a aquisição de
CO2 da atmosfera é interrompida. Sendo assim, é um Saturação
equívoco achar que há compensação de produção de
O2 em nosso ambiente poluído.

Temperatura
Este fator também influencia na taxa fotossinté- x Intensidade
luminosa
tica, já que existem temperaturas ótimas para que
a fotossíntese seja realizada, as quais variam entre A relação entre a velocidade da fotossíntese e a intensidade luminosa pode
ser observada no ponto x, quando os pigmentos são excitados o suficiente
as espécies. e deixam de absorver a luminosidade, atingindo, assim, a saturação.
A elevação de 10 °C na temperatura pode duplicar
a velocidade das reações enzimáticas. Entretanto, em
temperaturas próximas a 40 °C, há desnaturação das Comprimento de onda
enzimas, o que resulta na perda de sua configuração Este pode ser considerado um fator limitante, por-
espacial e, consequentemente, de sua função, o que que os pigmentos fotossintetizantes captam luz em
impede a ação enzimática no sistema de fotossíntese. diferentes faixas. Por exemplo, as clorofilas A e B pre-
Dessa forma, a relação entre a taxa fotossin- sentes nas plantas têm excelente ação fotossintética
tética e a temperatura pode ser representada da nas faixas do azul e do vermelho e pouca atividade na
seguinte maneira: faixa da cor verde.

Vermelho
Taxa de fotossíntese

Taxa de
fotossíntese
Azul

10 35 50
Verde

Material exclusivo para professores


Temperatura (ºC)

Gráfico que relaciona a taxa de fotossíntese à temperatura. 400 500 600 700 nm

O gráfico representa a relação de absorção de luz pelas clorofilas a e b


A taxa fotossintética em diferentes temperaturas durante a fotossíntese.

conveniados ao Sistema de Ensino


também varia para plantas dos tipos C3 e C4, conforme
pode ser observado no gráfico: O gráfico mostra que a taxa fotossintética é mais
alta. Consequentemente, a fotossíntese é mais efi-

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 208 14/12/18 12:43
47 – Material do Professor 209

ciente nos comprimentos de onda que representam


o azul e o vermelho. Isso mostra que a fotossíntese Situação B Meio-dia

BIOLOGIA 1A
ocorre mais eficazmente nos comprimentos de onda
correspondentes aos maiores índices de absorção da Mitocôndrias Cloropastos
clorofila. Vale lembrar que a fotossíntese não é inexis- Ponto de
tente na faixa do verde, o que comprova a atividade de compensação
CO2 O2 O2 CO2
luminoso (PCL)
outros pigmentos no processo, como os carotenoides.

PONTO DE COMPENSAÇÃO Situação B: relação entre as trocas gasosas das plantas e o ambiente ao
meio-dia, em que há maior intensidade luminosa. Nesse período, a taxa

LUMINOSA (PCL) de respiração aeróbia é igual à taxa fotossintética, o chamado ponto de


compensação luminoso (PCL). Ou seja, tudo o que é liberado é consumido
Além de realizarem a fotossíntese, as plantas exe- pela própria planta, de forma que não há saldo para ser liberado no ambiente.
Assim, as mitocôndrias consomem todo o O2 liberado pelos cloroplastos,
cutam a respiração celular aeróbia, pela qual existe e estes captam todo o CO2 liberado pelas mitocôndrias. Plantas que vivem
absorção de O 2 e liberação de CO 2 no ambiente, em ambientes sombreados apresentam PCL baixo, enquanto as que vivem
processo que ocorre constantemente, na presença em ambientes muito iluminados têm PCL elevado.

ou na ausência de luz, sem sofrer influência da in-


tensidade luminosa. Na situação C a fotossíntese predomina sobre a
respiração, como ocorre durante o dia. Como a produ-
Intensidade ção de compostos orgânicos é superior ao consumo,
do processo
a planta consegue se desenvolver e armazenar os car-
boidratos produzidos. Tal situação é ideal para que ela
Fotossíntese
consiga se desenvolver e se reproduzir.

Respiração Situação C
celular Dia

Mitocôndrias Cloropastos
A B C Intensidade
luminosa
CO2 O2 O2 CO2

Nesse gráfico podemos notar que a respiração celular se mantém


estável em comparação com a fotossíntese, que aumenta sua atividade
conforme cresce a intensidade luminosa. O2 CO2

Situação C: relação entre as trocas gasosas das plantas e o ambiente


Em geral, existem três situações quando se trata de durante o dia. Nesse período, a taxa de fotossíntese é maior que a de
relacionar a fotossíntese à respiração aeróbia. Acom- respiração. As mitocôndrias consomem parte do O2 produzido pelos
cloroplastos, enquanto a outra parte é liberada para o ambiente. Os
panhe os três contextos a seguir. cloroplastos, por sua vez, consomem todo o CO2 produzido pelas
Na situação A, existe baixa intensidade lumino- mitocôndrias mais o CO2 do ambiente, uma vez que a taxa de respiração
sa, como acontece à noite. A planta realiza respiração é menor que a de fotossíntese.
aeróbia normalmente, enquanto a fotossíntese está na
fase química, com a produção de carboidratos. Assim, Em um ecossistema equilibrado, como a Amazônia,
não há liberação de O2 e CO2. as trocas gasosas são pequenas, pois há consumo do
produto liberado (oxigênio, por exemplo) no próprio
Situação A ecossistema. Portanto, esse fato desmitifica a ideia de
Noite
que a Amazônia é o “pulmão” do mundo. Entretanto,
ela tem grande importância em razão de sua grande
Mitocôndrias Cloropastos biodiversidade e por atuar no controle climático.
O controle climático gera uma falsa ideia de que
CO2 O2 X X a Floresta Amazônica seja o pulmão do mundo, pois
a faixa latitudinal acima do Equador ocupada por ela
CO2 O2 seria extremamente desértica em todo o planeta caso
a floresta não existisse. Como visto, o uso de CO2 não
Situação A: relação entre as trocas gasosas das plantas e o ambiente

Material exclusivo para professores


noturno. Nesse período, as mitocôndrias captam O2 e liberam CO2, é ilimitado, de modo que a planta não consome mais
enquanto os cloroplastos produzem carboidratos. do que consegue ou precisa. Sendo assim, ainda há
excesso desse gás na nossa atmosfera, consequen-
Na situação B, a taxa de fotossíntese é igual à de temente, não há produção de O2 compensatório. De

conveniados ao Sistema de Ensino


respiração aeróbia. Nesse caso, foi atingido o ponto qualquer modo, desmatar a área florestal é algo bastante
de compensação luminoso (PCL) ou ponto de com- nocivo, visto que o oxigênio produzido seria reduzido
pensação fótico (PCF). ainda mais, o que afetaria o ecossistema.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 209 14/12/18 12:43
210 48 – Material do Professor

por arqueias e bactérias quimiossintetizantes. A equa-


PEETATHAM KONGKAPECH/GETTY IMAGES
BIOLOGIA 1A

ção global dessa reação pode ser assim representada:

Molécula inorgânica 1 O2 →
→ Molécula inorgânica oxidada 1 energia (ATP)

6 CO2 1 6 H2O 1 energia → C6H12O 1 6 O6

Os principais exemplos de seres quimiossinteti-


zantes são as nitrobactérias, as sulfobactérais e as
ferrobactérias.

NITROBACTÉRIAS
Foto aérea de parte da Floresta Amazônica. Existem dois tipos de bactéria que representam
esse grupo: as Nitrosomonas e as Nitrobacters. As
Em populações mais abertas e dinâmicas, seres primeiras oxidam a amônia e a transformam em nitri-
fotossintetizantes apresentam balanço positivo, porque to. Dessa forma, liberam energia, que é utilizada na
produzem mais substâncias do que consomem. Um produção de carboidratos, como a glicose.
exemplo são as algas marinhas, constituintes da maior
massa fotossintetizante da biosfera, sendo as principais
fornecedoras de oxigênio do planeta. A quantidade de Amônia 1 O2 → Nitrito 1 energia
indivíduos nesse ecossistema que consomem oxigênio
é bem menor que o número de organismos presen- 6 CO2 1 6 H2O 1 energia → C6H12O6 1 6 O2
tes na Floresta Amazônica que também o consomem.
Como resultado, o saldo é positivo, o que dissemina a
liberação de oxigênio para áreas maiores. Bactérias do gênero Nitrobacter, por sua vez,
oxidam o nitrito em nitrato. Como resultado, pro-
DANIEL POLOHA UNDERWATER /ALAMY STOCK PHOTO

duzem glicose.

Nitrito 1 O2 → Nitrato 1 energia

6 CO2 1 6 H2O 1 energia → C6H12O6 1 6 O2

PASIEKA/GETTY IMAGES

As algas marinhas são as principais fornecedoras de oxigênio da biosfera,


o que contribui para o balanço positivo da fotossíntese.

QUIMIOSSÍNTESE
Este processo consiste na produção de compostos
orgânicos por meio da oxidação de compostos inorgâ-
nicos (substâncias que contenham ferro, enxofre ou
hidrogênio, por exemplo). Essa reação não necessita
de luz para ocorrer. Essa é a principal diferença entre
Micrografia eletrônica de transmissão de bactérias do gênero

Material exclusivo para professores


a quimiossíntese e a fotossíntese. No entanto, em Nitrobacter sp. encontradas no mar. Aumento de 6 000× no tamanho
ambas há produção de matéria orgânica que serve de 6 cm × 4,5 cm.
alimento para os organismos heterótrofos.
A energia gerada nesse processo remete ao ATP Esse processo é fundamental para a vida, pois o

conveniados ao Sistema de Ensino


formado pela reação de oxidação, na qual um fosfato nitrito absorvido pelas plantas é convertido em aminoáci-
é transferido para uma molécula de ADP (adenosina di- dos, os quais são a base para a produção de aminoácidos
fosfato) já presente no meio. Esse processo é realizado essenciais aos seres humanos.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 210 14/12/18 12:43
49 – Material do Professor 211

As nitrobactérias estão presentes principalmente LEITURA COMPLEMENTAR


no solo e nas raízes das plantas – ou seja, em um am-

BIOLOGIA 1A
biente sem luz solar. Elas constituem uma importante Cientistas descobrem recife oculto pela pluma
parte da cadeia alimentar, pois, além de ajudarem na do rio Amazonas
fixação de carbono e nitrogênio nas raízes das plantas,
Pesquisadores da Universidade Estadual do Nor-
fornecem energia e matéria-prima para outros organis-
te Fluminense e da Universidade Federal do Rio de
mos em ambientes pobres em oxigênio ou com menor
Janeiro descobriram um vasto e extremamente rico
taxa de decomposição.
recife a 200 km da desembocadura do rio Amazonas,
SULFOBACTÉRIAS debaixo de uma pluma espessa de sedimentos, que
Também conhecidas como tiobactérias, realizam nada mais é que a extremidade das margens dos rios
quimiossíntese com base em compostos sulforosos, onde águas com diferentes densidades se misturam e
como o gás sulfídrico (H2S). As sulfobactérias estão geram uma faixa de águas mais claras próximas à ter-
presentes em grande quantidade nas águas termais. ra, entre Maranhão e Guiana Francesa. De acordo com
Produzem matéria orgânica por meio da energia eles, há diversas espécies endêmicas, isto é, existentes
liberada ao oxidar esses compostos sulfurosos. Assim, apenas naquele local, como esponjas gigantes. O mais
conseguem sobreviver e ainda servem de alimento curioso é que o recife se encontra em um ambiente
para organismos heterótrofos, como anêmonas, ca- improvável de ter tanta riqueza de espécies.
ranguejos, vermes e mariscos.
A ausência de luminosidade é explicada pela exis-
tência da pluma de sedimentos e de matéria orgânica
H2S 1 O2 → SO422 1 energia
que é despejada nos oceanos, que forma uma espécie
de camada de matéria flutuante nas águas mais super-
6 CO2 1 6 H2O 1 energia → C6H12O6 + 6 O2
ficiais, impedindo a luz de passar até camadas mais
fundas de água. Dessa forma, torna-se claro que esses
As sulfobactérias também são encontradas próxi- seres não são capazes de realizar fotossíntese e, assim,
mas a vulcões ou em fissuras do manto oceânico. há grande redução de oxigênio em suspensão, o que
explica por que não devia haver recifes em desem-
FERROBACTÉRIAS bocaduras de rios tropicais com grande quantidade
Tais bactérias oxidam substâncias com ferro em de sedimentos.
sua composição para produzirem matéria orgânica.
As ferrobactérias conseguem oxidar o óxido ferroso O recife é dividido em três setores, sendo que o
em óxido férrico. São comuns em águas residuais de setor norte, que vai do Amapá até a Guiana Francesa,
jazidas e minérios. é o mais interessante: há apenas 2% de luminosidade
e, assim, a cadeia alimentar é baseada em quimios-
óxido ferroso + O2 → óxido férrico + energia síntese, em que algumas bactérias utilizam compostos
nitrogenados e amônia para produzir energia. Além
disso, ainda há corais, esponjas gigantes, peixes e la-
6 CO2 + 6 H2O + energia → C6H12O6 + 6 O2
gostas. Já o setor central, presente diante da ilha do
Marajó, possui uma pluma menos espessa, o que per-
mite a entrada de raios solares e, assim, exibe esponjas
BUITEN-BEELD/ALAMY STOCK PHOTO

e algas calcárias. No setor sul, entre Pará e Maranhão,


encontra-se o Parcel de Manoel Luiz, o maior recife
de corais do Atlântico Sul, considerado o maior ce-
mitério de navios do Brasil. Aparentemente, o recife
descoberto tem formação bastante recente, entre 14 e
12 mil anos atrás, o que pode ser explicado pelo baixo
nível do mar na última era glacial, fazendo com que
o mar baixasse 130 metros, o que tornou a plataforma
continental brasileira exposta. Com o derretimento

Material exclusivo para professores


das calotas glaciais do Hemisfério Norte, o nível do
mar aumentou e alagou a plataforma novamente, o
que propiciou a colonização do ambiente pelos recifes.

conveniados ao Sistema de Ensino


Sapal, um tipo de formação aluvionar peridiodicamente alagada pela água Disponível em: <http://agencia.fapesp.br/cientistas-
salgada, no Parque Nacional de Oosterschelde, nos Países Baixos. A descobrem-recife-oculto-pela-pluma-do-rio-amazonas/23116/>.
formação de biofilme e a coloração metálica na água indicam a existência Acesso em: out. 2018.
de ferrobactérias.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 211 14/12/18 12:43
212 50 – Material do Professor

ROTEIRO DE AULA
BIOLOGIA 1A

QUIMIOSSÍNTESE E FATORES LIMITANTES DA FOTOSSÍNTESE

Fotossíntese Origina carboidratos Quimiossíntese

Oxidação de substâncias
Energia obtida da: Luz solar Energia obtida da:
inorgânicas

Limitantes internos

Realizada por:

Cloroplastos Cofatores Enzimas Pigmentos


Arqueias

Limitantes externos Intensidade luminosa Sulfobactérias

Comprimento de onda
Nitrobactérias

Concentração de CO2
Ferrobactérias

Temperatura

Balanço
fotossíntese/respiração

Ponto de compensação
Noite Dia
luminoso (PCL)

a taxa de fotossíntese

Material exclusivo para professores menor que igual maior que

conveniados ao Sistema de Ensino a taxa de respiração aeróbia

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 212 14/12/18 12:43
51 – Material do Professor 213

EXERCÍCIOS DE APLICAÇÃO

BIOLOGIA 1A
1. Unesp – Um pequeno agricultor construiu em sua pro- 3. Sistema Dom Bosco – A quimiossíntese é um pro-
priedade uma estufa para cultivar alfaces pelo sistema cesso autotrófico utilizado por algumas espécies de
de hidroponia, no qual as raízes são banhadas por uma bactérias e arqueias na ausência de energia luminosa.
solução aerada e com os nutrientes necessários ao de- Descreva de forma geral como ela ocorre e qual seu
senvolvimento das plantas. Para obter plantas maiores principal produto.
e de crescimento mais rápido, o agricultor achou que
A quimiossíntese é um processo no qual algumas bactérias e arqueias
poderia aumentar a eficiência fotossintética das plan-
tas e para isso instalou em sua estufa equipamentos
capazes de controlar a umidade e as concentrações de oxidam matéria inorgânica para produzir energia. Essa energia pos-
CO2 e de O2 na atmosfera ambiente, além de equipa-
mentos para controlar a luminosidade e a temperatura. teriormente é utilizada em reações entre moléculas de CO2 e H2O,

É correto afirmar que o equipamento para controle da


formando compostos orgânicos como a glicose. Além disso, nessa
a) umidade relativa do ar é bastante útil, pois em am-
biente mais úmido, os estômatos permanecerão
fechados por mais tempo, aumentando a eficiência reação ocorre liberação de O2.
fotossintética.
b) temperatura é dispensável, pois independentemente
4. Unesp – O gráfico apresenta as taxas de respiração e
da temperatura ambiente, quanto maior a intensida-
fotossíntese em uma planta em função da intensidade
de luminosa, maior a eficiência fotossintética.
luminosa a que é submetida.
c) concentração de CO2 é bastante útil, pois um aumen-
to na concentração desse gás pode, até certo limite, Taxas de fotossíntese
aumentar a eficiência fotossintética. e de respiração

d) luminosidade é dispensável, pois, independentemen-


te da intensidade luminosa, quanto maior a tempe-
ratura ambiente, maior a eficiência fotossintética.
1
e) concentração de O2 é bastante útil, pois quanto maior
a concentração desse gás na atmosfera ambiente,
maior a eficiência fotossintética.
2
A alternativa A está incorreta porque a umidade do ar é dispensável
se há controle de temperatura. A alternativa B está incorreta, pois a
temperatura é indispensável, uma vez que, se estiver muito quente,
as enzimas que participam da fotossíntese podem desnaturar. A alter-
nativa D está incorreta porque a luz é fundamental para o processo de
fotossíntese. A alternativa E está incorreta, pois o O2 é um produto da A B C Intensidade
fotossíntese, e não um substrato. luminosa

De acordo com os gráficos e os fenômenos que re-


presentam,
2. Sistema Dom Bosco – As enzimas são moléculas
orgânicas de natureza proteica que participam ativa- a) no intervalo A-B a planta consome mais matéria or-
mente de processos biológicos como a respiração e a gânica que aquela que sintetiza e, a partir do ponto
fotossíntese, aumentando sua velocidade. Sobre esse B, ocorre aumento da biomassa vegetal.
assunto, analise as frases a seguir: b) no intervalo A-C a planta apenas consome as reser-
I. A quantidade de enzimas pode ser considerada um vas energéticas da semente e a partir do ponto C,
fator limitante interno da fotossíntese. passa a armazenar energia através da fotossíntese.
II. Quanto maior a temperatura, mais eficiente a enzima c) no intervalo A-C a planta se apresenta em processo
será em sua atividade. de crescimento e, a partir do ponto C, há apenas a
manutenção da biomassa vegetal.
III. A ribulose-bifosfato-carboxilase, conhecida como
rubisco, é uma enzima responsável pela fixação do d) a linha 1 representa a taxa de respiração, enquanto
carbono na fotossíntese. a linha 2 representa a taxa de fotossíntese.
IV. Temperatura e pH são fatores que afetam as ativi- e) no intervalo A-B a variação da intensidade luminosa
dades das enzimas e, consequentemente, a fotos- afeta as taxas de respiração e de fotossíntese, e a
síntese. partir do ponto C, essas taxas se mantêm constantes.

Somente são corretas: A linha 1 representa a taxa fotossintética. A linha 2 refere-se à taxa de
respiração aeróbia. No ponto A, existe consumo de O2 e produção de
a) III e IV CO2, enquanto os cloroplastos produzem apenas carboidratos, sem cap-
tação ou liberação de substâncias para o ambiente. No intervalo de A até
b) I, III e IV B (que é o ponto de compensação luminoso), existe o consumo gradual
c) I e IV da matéria orgânica produzida em A. Depois do ponto de compensação
luminoso (B), o balanço muda. Isso significa que, se anteriormente havia

Material exclusivo para professores


d) I, II e IV maior consumo que produção, agora a taxa fotossintética é maior, o que
e) II, III e IV resulta em maior produção que consumo de componentes orgânicos.
Isso gera armazenamento de energia.
A afirmativa II está incorreta porque as enzimas atuam em temperaturas
ótimas. Caso a temperatura esteja maior, elas serão desnaturadas.

conveniados ao Sistema de Ensino


Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 213 14/12/18 12:43
214 52 – Material do Professor

5. IFSul-MG Chamamos de quimiossíntese o processo em que se utiliza matéria


BIOLOGIA 1A

inorgânica derivada de minerais, como o ferro, para a produção de


Uma equipe internacional de cientistas encontrou evidên- energia. Com base nisso, forma-se matéria orgânica.
cias de microrganismos como bactérias e fungos vivendo
dentro de pedras basálticas encontradas logo abaixo do
fundo do Oceano Pacífico – a uma profundidade de 2,5 km 6. Sistema Dom Bosco – As plantas são capazes de
e cobertas por centenas de metros de sedimentos. Prova- realizar fotossíntese concomitantemente à respiração
aeróbia. Existe um instante em que a taxa fotossintética
velmente a água reage com compostos minerais e ferro, e
é igual à taxa da respiração aeróbia. Cite o nome dado
libera hidrogênio. Os microrganismos usam o hidrogênio
a esse instante e explique o que acontece.
como fonte de energia para converter dióxido de carbono
em material orgânico. O instante em que a taxa fotossintética é igual à de respiração aeróbia
Disponível em: <http://g1.globo.com/ciencia-e-saude/
noticia/2013/03/rochas-abaixo-do-fundo-do-oceano-pacifico-tem- é denominado ponto de compensação luminoso ou ponto de compen-
seres-vivos-diz-estudo.html>. Acesso em: out. 2018.

O processo de nutrição realizado por esses microrganis- sação fótico. O oxigênio liberado pela fotossíntese é consumido na
mos, dos quais os cientistas encontraram evidências,
conforme descrito acima, denomina-se respiração celular, e o CO2 liberado na respiração celular é consumido
a) fotossíntese.
b) quimiossíntese. na fotossíntese, de forma que as trocas gasosas entre a planta e o
c) heterotrófica.
d) anabolismo. ambiente são nulas. 

EXERCÍCIOS PROPOSTOS
7. Sistema Dom Bosco – Tanto o processo de fotossínte- 9. Fuvest-SP– A figura a seguir mostra um equipamen-
se quanto o de quimiossíntese são fundamentais para to que coleta gases produzidos por plantas aquáticas.
a vida de determinados organismos. Cite as diferenças Nele, são colocados ramos que ficam submersos em
e semelhanças entre esses processos. líquido; uma válvula controla a saída dos gases.

válvula

8. Unimontes-MG – Leia o texto.


Já são dois anos! A estação das chuvas chega; as nuvens se
formam, mas não deixam cair uma gota de água. Estamos
em Cabrobó, Pernambuco, a apenas 20 km das margens
do rio São Francisco. A seca espalha suas vítimas na beira a) Que gás (gases) é (são) de um equipamento como
da estrada; o gado morto se incorporou à paisagem num esse, quando a planta é mantida sob mesma tem-
peratura e sob intensidade luminosa:
tempo em que só os urubus conhecem fartura.
a1) inferior ao ponto de compensação fótico?
Disponível em: <https://blogdoenem.com.br/quimiossintese-
fotossintese-bacteriana/>.

O cenário evidenciado no texto acima proporciona uma


rica fonte de energia e de átomos de carbono para
produção de moléculas orgânicas pelas bactérias. Con-
siderando essa informação, o texto acima e o assunto
abordado, analise as alternativas abaixo e assinale a que

Material exclusivo para professores


corresponde à classificação das bactérias que atuarão a2) superior ao ponto de compensação fótico?
diretamente nesse contexto.
a) Quimioautotróficas – Nitrobactérias.
b) Quimio-heterotróficas – Saprofágicas.

conveniados ao Sistema de Ensino


c) Fotoautotróficas – Cianobactérias.
d) Fotoautotróficas – Sulfobactérias.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 214 14/12/18 12:43
53 – Material do Professor 215

b) Dois equipamentos, preparados com a mesma quan- 11. Sistema Dom Bosco – A reação química a seguir

BIOLOGIA 1A
tidade de planta e o mesmo volume de líquido, foram representa um processo de obtenção de energia que
mantidos sob as mesmas condições de temperatura provavelmente foi utilizado pelos primeiros seres vivos
e de exposição à luz. Apenas um fator diferiu entre da Terra.
as duas preparações. Após duas horas, verificou- FeS + H2S → FeS2 + H2 1 energia
-se que a quantidade de gases coletada de um dos
equipamentos foi 20% maior do que a do outro. Qual É correto afirmar que os organismos que realizavam
fator que variou entre as preparações, pode explicar esse processo eram
a diferença na quantidade de gases coletada? a) quimiossintetizantes.
b) fermentadores.
c) fotossintetizantes.
d) aeróbios.
e) heterotróficos.

12. Uerj – Em um experimento, os tubos I, II, III e IV, cujas


aberturas estão totalmente vedadas, são iluminados
10. Unicamp-SP – O crescimento das plantas é afetado por luzes de mesma potência, durante o mesmo in-
pelo balanço entre a fotossíntese e a respiração. O pa- tervalo de tempo, mas com cores diferentes. Além da
drão de resposta desses dois importantes processos fi- mesma solução aquosa, cada tubo possui os seguintes
siológicos em função da temperatura é apresentado nos conteúdos:
gráficos abaixo, relativos a duas espécies de plantas. I II III IV

Espécie X

25 Fotossíntese
Processos (mol m−2 s−1)

Respiração
20

algas algas caramujos algas e


15 caramujos

A solução aquosa presente nos quatro tubos tem, ini-


10 cialmente, cor vermelha. Observe, na escala abaixo,
a relação entre a cor da solução e a concentração de
5 dióxido de carbono no tubo.
solução
cor da

0 roxa vermelha amarela


15 20 25 30 35 40 45

Temperatura (ºC) (2) concentração de dióxido de carbono no tubo (1)

Os tubos I e III são iluminados por luz amarela, e os


Espécie Y tubos II e IV por luz azul. Admita que a espécie de alga
25 utilizada no experimento apresente um único pigmento
Fotossíntese
fotossintetizante. O gráfico a seguir relaciona a taxa de
Processos (mol m−2 s−1)

Respiração
fotossíntese desse pigmento em função dos compri-
20
mentos de onda da luz.

15
Taxa de fotossíntese

10

0
15 20 25 30 35 40 45

Temperatura (ºC)
violeta

azul

amarela

vermelha
verde

laranja

Sobre as espécies X e Y, é correto afirmar: 380 440 500 565 590 625 740
Comprimento de onda (nm)
a) Espécie Y não apresenta ganho líquido de carbono
Após o experimento, o tubo no qual a cor da solução

Material exclusivo para professores


a 15 °C.
se modificou mais rapidamente de vermelha para roxa
b) As duas espécies têm perda líquida de carbono a é o representado pelo seguinte número:
45 °C.
a) I
c) A espécie Y crescerá menos do que a espécie X

conveniados ao Sistema de Ensino


a 25 °C. b) II
d) As duas espécies têm ganho líquido de carbono c) III
a 45 °C. d) IV

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 215 14/12/18 12:43
216 54 – Material do Professor

13. IFSul-MG – O plantio de árvores é um valioso ensina- Em relação a esse assunto, assinale a soma da(s)
BIOLOGIA 1A

mento às gerações futuras com vistas a contrabalancear proposição(ões) correta(s).


os efeitos em nosso planeta do acúmulo de gases noci- 01) A principal diferença entre fotossíntese e quimios-
vos à atmosfera. Considerando as taxas de fotossíntese síntese é a origem da energia utilizada para a obten-
e as trocas gasosas das plantas com o ambiente, obser- ção de compostos orgânicos: no primeiro proces-
ve o gráfico e assinale a alternativa incorreta. so, a energia é luminosa. Enquanto no segundo, a
energia é obtida a partir de reações de oxidação.
Quantidade de CO2
consumida na fotossíntese 02) Fotossíntese é o processo realizado pelos seres
vivos clorofilados e que utiliza energia luminosa para
6 sintetizar glicose a partir de oxigênio e água.
5 04) A fotossíntese e a respiração celular não são pro-
A cessos antagônicos, mas sim, complementares: o
Taxa de fotossíntese
4 primeiro sintetiza moléculas orgânicas, enquanto o
segundo degrada tais moléculas, produzindo energia.
3 B
Taxa de respiração 08) Nas células vegetais, a respiração celular ocorre
2
tanto durante o dia quanto à noite. Pois, para que
a célula obtenha energia, é necessário que esse
1 processo se realize a todo momento, independen-
temente da presença ou ausência de luz.
0 16) As células vegetais fazem fotossíntese quando há
1 2 3 4 5 6 7 luz disponível no ambiente; já a respiração celular
Intensidade luminosa ocorre apenas na ausência de luz.
a) “Plantas de sombra” possuem ponto de compen- 32) As plantas são seres autótrofos fotossintetizantes. Por-
sação fótico mais baixo que “plantas de sol”, pois tanto, não realizam o processo de respiração celular,
necessitam de intensidades luminosas menores. já que obtêm a energia diretamente da energia solar.
b) Se a intensidade luminosa for inferior ao ponto de com- 16. Uepa – As plantas terrestres fixam imensa quantidade
pensação fótico, a matéria orgânica produzida com a de gás carbônico, utilizando-o para formar novas molé-
fotossíntese será insuficiente para a planta crescer.
culas orgânicas por meio da fotossíntese (1), sendo o
c) Quando todo o gás oxigênio liberado na fotossínte- oxigênio o produto liberado em grande quantidade. No
se é consumido na respiração celular, a planta não entanto, em florestas maduras, como a floresta Amazô-
mais realiza trocas gasosas, independentemente da nica, cujas árvores já atingiram o equilíbrio, o consumo
intensidade luminosa. de oxigênio pela respiração (2) tende a igualar com sua
d) Sob condições ideais, as taxas de fotossíntese au- produção na fotossíntese. A floresta Amazônica é, por-
mentam até atingir um ponto de saturação luminosa, tanto, autossustentável. Apesar disso, sua conservação
mostrado em A, no qual deixam de aumentar. é essencial para a estabilização do clima na região, no
planeta e para a sobrevivência de um imenso número de
14. Unesp – No dia 16 de fevereiro de 2013, terminou o espécies animais e vegetais que constituem um acervo
horário brasileiro de verão. À meia-noite, os relógios genético de valor incalculável para a humanidade.
foram atrasados em uma hora. Considerando a inten-
Sobre os processos destacados no texto, analise as
sidade da luz solar e os períodos de claro e escuro no
afirmativas abaixo.
intervalo de 24 horas, como estará a taxa fotossintética
das plantas do jardim de uma casa na cidade de São I. No processo 2, parte das moléculas de oxigênio pro-
Paulo ao longo dos quatro meses seguintes? O que duzido na fotossíntese é utilizada imediatamente
isso pode implicar para elas? nas mitocôndrias da célula vegetal e a outra parte é
liberada na forma de celulose.
II. A oxidação de compostos orgânicos para a liberação
de energia necessária às atividades celulares, ocorre
pelo processo 2, em que a molécula de glicose é
decomposta em água e gás carbônico.
III. Na fase luminosa do processo 1, há absorção da luz,
transformação da energia luminosa em energia de ATP,
quebra das moléculas de água em hidrogênio e oxigê-
nio e a estrutura celular onde isso ocorre é o tilacoide.
IV. Luz, temperatura e concentração de gás carbônico,
são os principais fatores que impedem a velocidade
das reações químicas no processo 1, em que o au-
mento da temperatura diminui as reações químicas
da fase escura.
15. IFSC – Um dos fatores limitantes à vida é a obtenção V. A fase escura do processo 1 ocorre no estroma e

Material exclusivo para professores


de energia. Organismos autótrofos são capazes de compreende a formação de glicídeos, a partir de gás
sintetizar compostos orgânicos que são degradados, carbônico do ambiente.
liberando a energia necessária para a realização das A alternativa que contém todas as afirmativas corretas é:
atividades metabólicas celulares. Já os organismos
a) I, II e IV d) II, III e V

conveniados ao Sistema de Ensino


heterótrofos necessitam consumir outros seres para a
obtenção desses compostos, pois não apresentam tal b) I, III e IV e) I, II, III e V
capacidade de síntese. c) II, III e IV

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 216 14/12/18 12:43
55 – Material do Professor 217

17. Unicamp-SP – Algumas plantas de ambientes áridos a) respiram e fotossintetizam apenas durante o

BIOLOGIA 1A
apresentam o chamado “metabolismo ácido das cras- período diurno.
suláceas”, em que há captação do CO2 atmosférico b) respiram e fotossintetizam apenas durante o
durante a noite, quando os estômatos estão abertos. período noturno.
Como resultado, as plantas produzem ácidos orgânicos,
c) respiram o dia todo e fotossintetizam apenas durante
que posteriormente fornecem substrato para a princi-
o período diurno.
pal enzima fotossintética durante o período diurno. É
correto afirmar que essas plantas d) respiram e fotossintetizam o dia todo.

ESTUDO PARA O ENEM


18. Enem C3-H10  c) a vida na Terra depende, em última análise, da ener-
A indústria têxtil utiliza grande quantidade de corantes gia proveniente do Sol.
no processo de tingimento dos tecidos. O escureci- d) o processo respiratório é responsável pela retirada
mento das águas dos rios causado pelo despejo desses de carbono da atmosfera.
corantes pode desencadear uma série de problemas e) a produção de biomassa e de combustível fóssil, por
no ecossistema  aquático. Considerando esse escu- si, é responsável pelo aumento de CO2 atmosférico.
recimento das águas, o impacto negativo inicial que
ocorre é o(a) 20. Enem C5-H17
a) eutrofização. Certas espécies de algas são capazes de absorver rapidamen-
te compostos inorgânicos presentes na água, acumulando-
b) proliferação de algas.
-os durante seu crescimento. Essa capacidade fez com que
c) inibição da fotossíntese. se pensasse em usá-las como biofiltros para limpeza de am-
d) fotodegradação da matéria orgânica. bientes aquáticos contaminados, removendo, por exemplo,
e) aumento da quantidade de gases dissolvidos. nitrogênio e fósforo de resíduos orgânicos e metais pesados
provenientes de rejeitos industriais lançados nas águas. Na
19. Enem C5-H17 técnica do cultivo integrado, animais e algas crescem de for-
A fotossíntese é importante para a vida na Terra. Nos ma associada, promovendo um maior equilíbrio ecológico.
cloroplastos dos organismos fotossintetizantes, a ener- SORIANO, E.M. Filtros vivos para limpar a água. Revista Ciência
gia solar é convertida em energia química que, junta- Hoje. V.37, n. 219, 2005. (Adaptado)
mente com água e gás carbônico (CO2), é utilizada para
a síntese de compostos orgânicos (carboidratos). A fo- A utilização da técnica do cultivo integrado de animais
tossíntese é o único processo de importância biológica e algas representa uma proposta favorável a um ecos-
capaz de realizar essa conversão. Todos os organismos, sistema mais equilibrado porque
incluindo os produtores, aproveitam a energia armaze-
a) os animais eliminam metais pesados, que são usa-
nada nos carboidratos para impulsionar os processos
dos pelas algas para a síntese de biomassa.
celulares, liberando CO2 para a atmosfera e água para
a célula por meio da respiração celular. Além disso, b) os animais fornecem excretas orgânicos nitroge-
grande fração dos recursos energéticos do planeta, nados, que são transformados em gás carbônico
pelas algas.
produzidos tanto no presente (biomassa) como em
tempos remotos (combustível fóssil), é resultante da c) as algas usam os resíduos nitrogenados liberados
atividade fotossintética. pelos animais e eliminam gás carbônico na fotos-
síntese, usado na respiração aeróbica.
As informações sobre obtenção e transformação dos
d) as algas usam os resíduos nitrogenados prove-
recursos naturais por meio dos processos vitais de fo-
nientes do metabolismo dos animais e, durante a
tossíntese e respiração, descritas no texto, permitem síntese de compostos orgânicos, liberam oxigênio
concluir que para o ambiente.
a) o CO2 e a água são moléculas de alto teor energético. e) as algas aproveitam os resíduos do metabolismo dos
b) os carboidratos convertem energia solar em animais e, durante a quimiossíntese de compostos
energia química. orgânicos, liberam oxigênio para o ambiente.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 217 14/12/18 12:43
17
218 56 – Material do Professor

21
BIOLOGIA 1A

NÚCLEO CELULAR

O núcleo celular foi a primeira organela descrita, em 1839 pelo botânico escocês
Robert Brown (1773-1858), o qual usou células de orquídeas para tais observações.
• Organização do núcleo Diversos cientistas antes dele fizeram algumas constatações sobre essa organela,
celular como o holandês Antonie van Leeuwenhoek (1632-1723) e o botânico austríaco
• Atividades fisiológicas do Franz Andreas Bauer (1748-1840). No entanto, somente Robert Brown conseguiu
núcleo celular reconhecê-la como um componente essencial das células. Naquela época, o botânico
imaginou que o núcleo era equivalente a uma semente da célula, quando comparada
HABILIDADES às sementes dos frutos.
• Citar os componentes do

SCIENCE PHOTO LIBRARY – SPL/SCIENCE PHOTO LIBRARY – SPL/FOTOARENA


núcleo celular.
• Explicar a função de
cada estrutura dentro da
organela.
• Compreender a importância
da organela na divisão
celular, na hereditariedade
e na síntese de proteínas.

Eletromicrografia de transmissão de um neurônio que mostra o núcleo celular (região apontada pela seta).
Aumento desconhecido. Cores fantasia.

Acredita-se que a origem evolutiva do núcleo celular tenha se estabelecido por


meio da endossimbiose. Segundo a bióloga Lynn Margulis (1938-2011), esse mesmo
processo originou as mitocôndrias e os cloroplastos. Esse modelo tem como suporte

Material exclusivo para professores


a similaridade entre algumas proteínas nucleares presentes nas células eucarióticas
e procarióticas, como as histonas, comprovando que arqueias foram fagocitadas ou
invadiram outras células primitivas.
Outra hipótese é a teoria da exomembrana, que parte da ideia de que o núcleo

conveniados ao Sistema de Ensino


celular foi originado após a produção de uma nova membrana externa ao redor do
envoltório nuclear, conhecida atualmente como membrana plasmática. A membrana
celular original, por sua vez, transformou-se no núcleo da célula.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 218 14/12/18 12:43
57 – Material do Professor 219

ORGANIZAÇÃO DO NÚCLEO NUCLEOPLASMA

BIOLOGIA 1A
O nucleoplasma é um gel claro, semelhante ao
A existência de um núcleo celular organizado é a hialoplasma, constituído por uma solução aquosa de
principal diferença entre as células eucarióticas e proca- proteínas, RNA, nucleosídeos, nucleotídeos e íons.
rióticas. Nele está contida a maior parte da informação
genética de um organismo, embora os cloroplastos e NUCLÉOLO
as mitocôndrias também apresentem material genético É um corpúsculo sem membrana, em número va-
próprio. A massa do núcleo é constituída por 70% de riável (geralmente um ou dois por núcleo), constituído
água, 22% de proteínas, 7% de DNA e 1% de RNA. por RNA ribossômico. É importante ter cuidado para
O núcleo é composto de envelope nuclear, cromatina, não confundi-lo com os cariossomos, que são formados
nucleoplasma e nucléolo. Observe a imagem a seguir. por moléculas de DNA.
Em células que produzem muitas proteínas, o nu-
NAEBLYS/ALAMY STOCK PHOTO

poros
cléolo é bastante desenvolvido, sendo possível ser
visualizado no início e no final da divisão celular, uma
vez que o RNA ribossômico participa da formação das
subunidades dos ribossomos, importantes na tradução
nucléolo
ou na síntese de proteínas.

SCIENCE PHOTO LIBRARY SPL/SCIENCE PHOTO LIBRARY SPL/FOTOARENA


membrana
cromatina nuclear

Modelo esquemático das estruturas que compõem o núcleo celular.


Elementos representados fora da escala de tamanho. Cores fantasia.

MEMBRANA NUCLEAR
A membrana nuclear, também denominada envelope
nuclear (antigamente denominado carioteca), é a estru-
tura responsável por separar o núcleo celular do citoplas-
ma. Sua composição é lipoproteica, com dois folhetos de
membranas sobrepostos, separados por um espaço de
10 µm (micrometros) – visualizados apenas ao microscó-
pio eletrônico. O envelope nuclear apresenta poros de
aproximadamente 100 µm de diâmetro, por meio dos
quais ocorrem as trocas de substâncias entre o núcleo e
o citoplasma, controladas por um complexo de proteínas.
Na face externa, voltada para o citoplasma, o enve-
lope nuclear tem ribossomos aderidos em continuidade
com as membranas do retículo endoplasmático granu-
lar. Isso possibilita inferir que ambas sejam comparti- Micrografia eletrônica de transmissão de uma célula animal em que se
evidencia o nucléolo (em amarelo) presente no núcleo (em verde). As regiões
mentos do mesmo sistema de membranas. granuladas do nucléolo são RNA ribossômicos. Aumento de 4 500x. Cores
fantasia.
D SPECTOR/GETTY IMAGES

CROMATINA
É formada pelo conjunto de filamentos de DNA, por
histonas (proteínas específicas), RNA e cálcio. Sua dis-
posição e seu grau de condensação variam de acordo
com o tipo celular. No núcleo interfásico, isto é, na fase
em que a célula cresce e aumenta de volume antes
de dividir-se, a cromatina encontra-se descompactada,

Material exclusivo para professores


formando a eucromatina. Quando a célula está em di-
visão celular, a cromatina é bastante compacta e forma
os cromossomos. Nessa fase a denominamos hetero-
cromatina. Vale destacar que as proteínas histonas

conveniados ao Sistema de Ensino


possibilitam que o DNA se torne bastante compacto,
Célula hepática de camundongo vista em microscopia eletrônica de
varredura. Nota-se a membrana nuclear em evidência em virtude da de maneira que a expressão dos genes se torna silen-
coloração laranja-escura nas bordas. Aumento de 22 400x. Cores fantasia. ciada. À medida que o DNA fica menos compacto, a

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 219 14/12/18 12:43
220 58 – Material do Professor

expressão gênica se torna ativa. Assim, a cromatina e

MONKEY BUSINESS IMAGES/SHUTTERSTOCK


BIOLOGIA 1A

os cromossomos são representações morfológicas e


fisiológicas distintas da mesma estrutura.

Cromatina interfásica

Cromossomo Núcleo

Heterocromatina
O núcleo está intimamente relacionado à hereditariedade, pois contém toda
Eucromatina a informação genética. Isso possibilita a transferência de características ao
longo das gerações.

LEITURA COMPLEMENTAR
DNA
Outros componentes do núcleo celular
Recentemente foi descoberta uma série de outros
Esquema que representa as formas variadas que a cromatina pode componentes nucleares. Entre eles estão as estrutu-
assumir. Quando compactada, é denominada heterocromatina;
descompactada, é chamada eucromatina. Elementos representados fora ras conhecidas como corpos de Cajal, possivelmente
da escala de tamanho. Cores fantasia. associados à maquinaria de transcrição celular, a qual
ocorre por meio do processamento de diversos tipos
de RNA.

ATIVIDADES FISIOLÓGICAS O núcleo contém ainda os chamados domínios Pika


(sigla em inglês para associações cariossomais polimór-
DO NÚCLEO ficas da interfase). Essas estruturas foram descobertas
em 1991, mas, apesar de suas funções ainda não serem
Quando mencionamos as atividades fisiológicas de
totalmente compreendidas, acredita-se que estejam asso-
alguma organela ou célula, estamos nos referindo às
ciadas à produção de fatores relacionados à transcrição
funções que elas podem desempenhar.
de alguns tipos de RNAs.
A membrana nuclear tem, primeiramente, a função
de proteger o DNA, uma vez que impede que molécu- Outros componentes pouco conhecidos são os corpos
las nocivas entrem em contato com o material genéti- PML (sigla em inglês para leucemia promielocítica), dis-
co, de modo a preservar a integridade deste. persos pelo nucleoplasma e relacionados provavelmente
O núcleo coordena as reações e as atividades ce- à regulação da transcrição de outras regiões nucleares.
lulares, pois as moléculas precursoras de cada ativi- Os domínios SC35 (ou speckles – assim chamados em
dade em nosso corpo são sintetizadas nas células. E razão de seu aspecto disperso e amorfo observado nas
é somente dentro delas que se encontra a “receita” células de mamíferos) são regiões móveis envolvidas
de como produzi-las com base no DNA. Nessa or- no processamento de RNA, na regulação transcricional
ganela também ocorre o processo de transcrição. O e na apoptose.
RNA mensageiro origina-se com base na fita molde Por fim, há os paraspeckles – estruturas dinâmicas
de DNA. presentes no espaço intercromatínico que se alteram
Por fim, e mais importante, o núcleo está direta- em resposta às mudanças na atividade metabólica
mente envolvido na hereditariedade, pois é respon- celular.
sável por compartilhar características entre genitor Apesar de ainda se saber pouco sobre o funcionamen-
e prole, o que garante a continuidade das espécies. to desses compartimentos nucleares, é consenso que o
Para que as características sejam transmitidas às ge- núcleo celular é muito mais complexo do que se pode
rações futuras, as células passam por divisão celular pensar após um exame superficial. Embora essa orga-

Material exclusivo para professores


(assunto discutido nos próximos módulos). Assim, o nela não apresente uma distinção morfológica entre
material genético da célula genitora é passado para suas regiões, sua especialização territorial fisiológica e
a célula gerada. Esse processo é muito importan- sua plasticidade funcional tornam o ambiente nuclear
te evolutivamente, uma vez que genes vantajosos

conveniados ao Sistema de Ensino


muito dinâmico e o capacitam para desempenhar um
podem ser passados adiante, o que faz crescer a sem-número de tarefas metabólicas necessárias para a
probabilidade de sua frequência aumentar dentro preservação da biologia celular.
de uma população.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 220 14/12/18 12:43
59 – Material do Professor 221

ROTEIRO DE AULA

BIOLOGIA 1A
NÚCLEO CELULAR

Estrutura

Membrana nuclear Delimita o: Núcleo

Nucléolo
Composto de: RNA

Cromatina Morfologia dos: cromossomos

Eucromatina Evidente na: Interfase

Heterocromatina Evidente na: Divisão celular

Atividades fisiológicas

Proteção do: Coordenação de: Atua diretamente na:

DNA Reações metabólicas Transcrição

Atividades celulares

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 221 14/12/18 12:43
222 60 – Material do Professor

EXERCÍCIOS DE APLICAÇÃO
BIOLOGIA 1A

1. PUC-Minas (adaptada) – O bom funcionamento de 3. Sistema Dom Bosco – O núcleo é uma organela pre-
uma célula eucariótica depende da compartimentaliza- sente apenas em organismos eucariotos que possui
ção de processos específicos em organelas como as grande importância, uma vez que é responsável por
indicadas por números na figura a seguir. armazenar toda a informação genética de um indivíduo.
Com base em seus conhecimentos, cite as estruturas
11 4 constituintes desta organela.
8 O núcleo é constituído por membrana nuclear, nucléolo e cromatina.

9
7
6
4. CEFET-MG (adaptada) – O DNA apresenta diferen-
tes níveis de condensação, conforme representado na
5
figura.

A Dupla fita de
DNA (2 nm)
3
2

10

12
DNA ao
1 B
redor de 8
proteínas
C 30 nm histonas
(11 nm)
É correto afirmar que
D
a) 7 tem o nome de cromatina.
300nm
b) 7 contém apenas RNA.
c) 4 é semelhante a um gel escuro rico em íons apenas.
d) 8 é formada apenas por um folheto de membrana. E 700 nm
(7) é o nucléolo, constituído por RNA. (4) é o nucleoplasma, consti-
tuído por um gel claro composto de proteínas, RNA, nucleosídeos,
nucleotídeos e íons. (8) é a membrana nuclear, formada por dois
folhetos de membrana.

F
1 400 nm
2. UFPR – Um pesquisador injetou uma pequena quanti-
dade de timidina radioativa (3H – timidina) em células
eucarióticas com o propósito de determinar a localiza- No momento em que o DNA de uma célula somática
ção dos ácidos nucleicos sintetizados a partir desse humana for visualizado no nível “F” de condensação,
nucleotídeo, utilizando uma técnica muito empregada está ocorrendo o processo de
em biologia celular, a autorradiografia combinada com a) síntese de proteínas.
microscopia eletrônica. b) divisão celular.
Assinale a alternativa que apresenta os dois comparti- c) permutação cromossômica.
mentos celulares nos quais o pesquisador encontrará d) produção de ácido ribonucleico.
ácidos nucleicos radioativos.  
e) duplicação do material genético.
a) Núcleo e mitocôndrias.
b) Citosol e mitocôndrias. Durante a divisão celular, o cromossomo encontra-se con-
densado, conforme mostrado na figura.
c) Núcleo e retículo endoplasmático.

Material exclusivo para professores


d) Citosol e retículo endoplasmático.
e) Peroxissomos e retículo endoplasmático.
Os ácidos nucleicos radioativos serão encontrados no núcleo e nas
mitocôndrias, por serem as principais organelas nas quais está o DNA.

conveniados ao Sistema de Ensino


Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 222 14/12/18 12:43
61 – Material do Professor 223

5. IFCE – O núcleo celular é o local que abriga o material 6. Sistema Dom Bosco – A cromatina é constituinte do

BIOLOGIA 1A
genético nas células eucariontes. No núcleo interfási- núcleo e pode ser definida como eucromatina e hete-
co, fase em que a célula não se encontra em divisão, rocromatina. Explique a diferença morfológica entre
a cromatina aparece imersa na cariolinfa, como um essas definições e o que isso implica em relação à
emaranhado de filamentos longos e finos. Ao iniciar o expressão de genes.
processo de divisão celular, esses filamentos começam No núcleo interfásico, isto é, na fase em que a célula cresce e aumenta
a se condensar em espiral, tornando-se mais curtos e
grossos, passando a ser chamados de
de volume antes de dividir-se, a cromatina encontra-se descompactada,
a) cromonema.
b) cromossomo.
formando a eucromatina. Quando a célula está em divisão celular, a
c) carioteca.
d) DNA. cromatina é bastante compacta e forma os cromossomos. Nessa fase
e) genes.
a denominamos heterocromatina. Vale destacar que as proteínas histo-
O cromossomo é a molécula de DNA condensada em formato
espiralado.
nas possibilitam que o DNA se torne bastante compacto, de maneira

que a expressão dos genes se torna silenciada. À medida que o DNA

fica menos compacto, a expressão gênica se torna ativa.

EXERCÍCIOS PROPOSTOS
7. Ibmec-RJ (adaptada) – O núcleo celular foi descoberto 9. UPF-RS (adaptada) – O núcleo confere às células eu-
pelo pesquisador escocês Robert Brown, que o reco- carióticas algumas vantagens sobre as células proca-
nheceu como componente fundamental das células. O rióticas. Analise as afirmativas a seguir:
nome escolhido para essa organela expressa bem essa I. Separa o processo de transcrição do processo de
ideia: a palavra “núcleo”, de acordo com o dicionário tradução.
brasileiro, significa centro ou parte central. A respeito II. Protege o DNA de choques mecânicos.
da constituição e função do núcleo celular, julgue as
afirmativas, como falsas ou verdadeiras: III. Controla o intercâmbio de substâncias que podem
chegar até o DNA.
I. O núcleo só é encontrado em células eucarion-
tes, portanto as bactérias não apresentam essa Assinale a alternativa correta:
organela. a) Todas as afirmativas estão corretas.
II. Existem células eucariontes com um único nú- b) Apenas a afirmativa I está correta.
cleo, células com vários núcleos e outras células
anucleadas. c) Apenas I e III estão corretas.
III. O núcleo abriga o material genético das células, d) Todas as afirmativas estão erradas.
uma vez que dentro dele se encontram os cro-
mossomos que contêm a informação genética. 10. Sistema Dom Bosco – O nucléolo é uma organela
nuclear de suma importância na síntese de proteínas.
IV. O envoltório nuclear impede a troca de qualquer tipo
Essa afirmativa está correta? Justifique.
de material entre o núcleo e o restante da célula.
a) V – V – F – F d) V – V – V – F
b) F – F – F – V e) V – F – V – V
c) V – F – V – F

8. PUC-Rio – Uma diferença entre células eucariontes e


procariontes está no núcleo. Os indivíduos procariontes
possuem a molécula de DNA espalhada no citoplasma,
enquanto nos indivíduos eucariontes, ela se encontra
no núcleo da célula. Quanto a esse núcleo, é correto
afirmar que
a) um núcleo saudável de uma célula possui sempre 11. UEM-PR (adaptada) – O núcleo é considerado porta-
uma forma redonda e se encontra em seu centro, dor dos fatores hereditários e controlador das ativida-
pois assim controla igualmente toda a célula. des metabólicas da célula animal. Sobre esse assunto,
b) no núcleo se encontra a cromatina, que é a asso- assinale a alternativa correta:
ciação das moléculas de DNA e proteínas, imersa a) Os nucléolos representam o material genético con-
tido no núcleo.

Material exclusivo para professores


no citoplasma e envolvida pela membrana nuclear.
c) o núcleo é a região da célula que controla toda a pro- b) A cromatina nada mais é do que o conjunto de RNA
dução de proteína, já que contém a molécula do DNA. ribossômico.
d) além da molécula do DNA, o núcleo da célula contém c) As proteínas histonas se encontram enoveladas em

conveniados ao Sistema de Ensino


outros organoides, como os ribossomos e o retículo. moléculas de RNA, presentes no nucleoplasma.
e) é o núcleo que caracteriza as bactérias e algas azuis, d) Os fatores hereditários citados no enunciado se re-
já que são seres unicelulares. ferem aos cromossomos.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 223 14/12/18 12:43
224 62 – Material do Professor

12. Unioeste-PR (adaptada) – O núcleo nas células de- 15. Mackenzie (adaptada) – O esquema a seguir repre-
BIOLOGIA 1A

sempenha o papel de portador dos fatores hereditários senta um experimento realizado em amebas.
e controlador das atividades metabólicas. Em relação a
essa importante estrutura e seus constituintes, é cor- 1
reto afirmar que: 2
01) O núcleo interfásico de células vegetais apresenta
uma carioteca cuja estrutura não permite a comu-
nicação com o citoplasma. 3
02) O núcleo de células eucarióticas animais durante a fragmento de
interfase apresenta-se condensado. citoplasma sem
04) O nucléolo é uma estrutura intranuclear, desprovida núcleo
de membranas, composto RNA ribossômico. 4
5
08) Quando o cromossomo encontra-se descompacta- núcleo transplantado para
do, denominamos ele como heterocromatina. o fragmento de citoplasma
16) O nucleoplasma semelhante ao hialoplasma,
contendo proteínas, DNA, nucleosídeos, nucleo-
tídeos e íons. Considere as afirmativas a seguir:
32) Nos cromossomos, a heterocromatina corresponde I. A célula 4 terá as mesmas características genéticas
a regiões que permanecem muito condensadas na da célula 5.
interfase e apresenta-se inativa na transcrição do II. As células musculares são excelentes para extrair
DNA em RNA. DNA por conterem maior quantidade de núcleos.
64) O nucléolo é uma organela nuclear, composta por III. O núcleo é responsável pela reprodução das carac-
RNA mensageiros. terísticas ao longo das gerações.
Assinale:
13. Cefet-MG – Pesquisadores revelaram que não são apenas
os genes que transmitem atributos, como a cor dos olhos, a) se todas as afirmativas estiverem corretas.
entre pais e filhos. Proteínas chamadas histonas também b) se somente as afirmativas I e II estiverem corretas.
são responsáveis por transmitir características hereditárias, c) se somente as afirmativas II e III estiverem corretas.
apesar de sua função primordial ser a manutenção do d) se somente a afirmativa III estiver correta.
DNA na forma de cromatina e cromossomos. Algumas
e) se todas as afirmativas estiverem incorretas.
dessas proteínas são capazes de silenciar genes quando
impedem que o DNA seja desenrolado. Modificando-as, 16. Uerj (adaptada) – Em células eucariotas, a cromatina
os cientistas conseguiram criar características que foram pode se apresentar como eucromatina, uma forma não
transferidas para novas gerações sem alteração nos genes. espiralada, ou como heterocromatina, uma forma muito
Fonte:  Super interessante, 06 abr. 2015. (Adaptado) espiralada. Na metáfase, muitas regiões de eucromatina
Pelo exposto, a função dessas proteínas nas alterações se transformam em heterocromatina, formando cromos-
das características dos organismos ocorre devido à(ao) somos bastante espiralados, conforme mostra o esquema.
Diferentes estágios de
a) habilidade de provocar mutação deletéria.
organização da cromatina
b) bloqueio da transcrição dos genes a serem expressos. cromossomo
cromatina maior espiralização
c) falta de partes do material genético herdado pe- bastante espiralado
eucromatina
los filhos.
d) encurtamento dos cromossomos transferidos aos
descendentes.
e) migração para o citosol alterando a mensagem en- heterocromatina
viada pelo núcleo.

14. Sistema Dom Bosco – O núcleo é uma organela pre- A formação do cromossomo bastante espiralado favo-
sente nas células eucarióticas. Acredita-se que a origem rece o seguinte processo:
evolutiva desta organela é semelhante à origem das
mitocôndrias e cloroplastos, isto é, por meio da endos- a) Transcrição dos genes pela RNA polimerase.
simbiose. Por outro lado, há outro modelo denomina- b) Distribuição do DNA para as células-filhas.
do hipótese exomembrana. Com base nisso, descreva c) Síntese de proteínas nos ribossomos.
como é a membrana nuclear e qual a sua função. d) Redução do cariótipo original.

17. Sistema Dom Bosco – O núcleo é composto de mem-


brana nuclear, nucléolos e cromatina. Além disso, é uma
organela que tem grande importância para a evolução

Material exclusivo para professores


das espécies. Explique o motivo dessa importância.

conveniados ao Sistema de Ensino


Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 224 14/12/18 12:43
63 – Material do Professor 225

ESTUDO PARA O ENEM

BIOLOGIA 1A
18. Uece C5-H17 e a pUL34 – que interagem formando uma vesícula. Esse
A célula eucariótica é compartimentada, a procariótica complexo proteico recobre o vírus e o transporta para fora
não. Esta afirmação faz sentido quando comparamos do núcleo, permitindo que ele infecte uma nova célula e a
os dois padrões de organização celular sob o seguinte doença progrida.
aspecto: Fonte: Estudo mostra como vírus do herpes escapa no núcleo
celular. Disponível em: <https://exame.abril.com.br/ciencia/
a) dimensões celulares. A relação superfície/volume
estudo-mostra-como-virus-do-herpes-escapa-no-nucleo-celular/>.
é maior na célula procariótica que na eucariótica.
Assim, a célula procariótica apresenta-se com uma Sobre a organela da qual o vírus escapa, é correto afir-
área superficial suficientemente grande para satisfa- mar que
zê-la em termos nutritivos. Ao mesmo tempo, o seu
a) as cromatinas presentes no núcleo são pedaços de
espaço interno é adequado à ocorrência das reações
DNA cortados, envolvidos por nucléolos.
metabólicas num ambiente descompartimentado.
b) o vírus escapa por pinocitose.
b) relação nucleoplasmática. A relação nucleoplasmáti-
ca varia de 1/1 a 1/3 na célula eucariótica, mostrando- c) é composta apenas de RNA e proteínas.
-nos que, enquanto o núcleo varia de volume, o cito- d) controla a entrada e a saída de substâncias
plasma permanece com volume constante. Portanto, pela fagocitose.
a compartimentação na célula eucariótica aumenta a e) o vírus consegue alterar o metabolismo da célula
superfície citoplasmática para fazer face ao aumento hospedeira porque é nessa organela que se encontra
de volume do núcleo. o material genético dela.
c) presença de estruturas membranosas. A presença
de mesossoma e nucléolo nas células procarióticas 20. Sistema Dom Bosco C5-H17
dispensa a presença de outras organelas citoplas- Em 2012, cientistas descreveram um novo processo de di-
máticas. visão celular, denominado clerocinese. Basicamente, atra-
d) processo evolutivo. A compartimentação das célu- vés do experimento realizado, foi descrito que a célula do
las eucarióticas é decorrência do processo evoluti- processo final é binucleada, isto é, contém dois núcleos e
vo desenvolvido no sentido da diminuição das suas mais tarde, elas se desenvolvem em células da retina.
superfícies internas, já que as superfícies externas
crescem mais que o volume da célula, na medida em Fonte: <http://g1.globo.com/ciencia-e-saude/noticia/2012/12/
cientistas-identificam-novo-tipo-de-divisao-celular.html>.
que as dimensões celulares aumentam.
e) endossimbiose. Somente as células procarióticas Sobre o fato de essas células serem binucleadas:
sofreram modificações na morfologia celular com a) Há mais DNA presente nesta célula do que nas cé-
base nesse evento evolutivo que resultou na forma- lulas comuns.
ção do núcleo.
b) Os núcleos armazenam apenas RNA.
19. Sistema Dom Bosco C5-H17 c) As proteínas histonas presentes nas cromatinas es-
O mecanismo usado pelo vírus do herpes (HSV-1) para tão diretamente relacionadas à divisão celular.
escapar do núcleo da célula hospedeira após se replicar d) A membrana nuclear tem como função apenas deli-
foi descrito em  dois artigos  publicados na revista Cell. A mitar o núcleo do restante da célula.
estratégia consiste em secretar duas proteínas – a pUL31 e) Os núcleos nada têm a ver com a divisão celular.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 225 14/12/18 12:43
17
226 64 – Material do Professor

22
BIOLOGIA 1A

CROMOSSOMOS

O Projeto Genoma foi um dos maiores projetos internacionais realizados pela


ciência moderna, contando com a participação de 18 países, 250 laboratórios
• Estrutura e tipos e cerca de 5 mil pesquisadores. O Brasil não só contribuiu com a pesquisa em
de cromossomo si, tendo o principal laboratório do projeto instalado na USP, como também
• Células haploides participou do financiamento do projeto, juntamente com os Estados Unidos,
e diploides o Japão, o Reino Unido, a Alemanha, a China e a França. Com esse esforço
• Número de cromossomos em conjunto, foi possível, com precisão de 99%, sequenciar todos os pares
• Cariótipo de bases nitrogenadas do DNA que compõem o genoma humano, que, em
geral, é 99,9% igual em todos os humanos. Além disso, também foi possível
HABILIDADES sequenciar diversas doenças genéticas. De acordo com o Projeto Genoma, há
• Citar as principais aproximadamente 25 mil genes organizados ao longo dos 46 cromossomos
estruturas que compõem que constituem as células somáticas humanas, as células responsáveis pela
os cromossomos e suas formação de tecidos e órgãos.
funções. Com os dados fornecidos pelo Projeto Genoma, diversas pesquisas tornaram-
• Relacionar evolutivamente -se possíveis e novas questões surgiram, assim a caminhada científica só estava
o número de cromossomos começando. Por meio de pesquisa realizada em 2016 por um conjunto de cientis-
em diferentes espécies. tas da Universidade de Edimburgo, da Universidade de Liverpool e de institutos
• Compreender os conceitos de pesquisa dos Estados Unidos e do Japão – os quais fizeram uso do método
e as diferenças entre célu- 3D-CLEM, que utiliza microscópios ópticos, eletrônicos e modelagem compu-
las haploides e diploides. tacional avançada em alta resolução –, foi possível analisar a composição dos
• Definir o conceito cromossomos durante o processo mitótico. Os pesquisadores identificaram que
de cariótipo. grande parcela do volume dos cromossomos estava concentrada nas suas extre-
• Assimilar a importância do midades (30-47% do volume total do cromossomo), que são separadas durante
ideograma para reconhecer as fases da mitose, tornando evidente a falta que faziam quando era medido o
anomalias cromossômicas. volume total do cromossomo normal e aquele em fase mitótica.
Os genes correspondem a apenas 53% da constituição cromossômica em
forma de cromatina, algo surpreendente, pois acreditava-se que os cromossomos
eram compostos principalmente de cromatina. Com essa nova técnica, será pos-
sível fazer novos estudos e buscar compreender melhor a função da bainha, o que
provavelmente ajudará a entender um
ADRIAN T SUMNERGETTY IMAGES

pouco mais sobre doenças congênitas


e o câncer.
O DNA, como molécula primordial,
precisa ser organizado de forma que
contenha toda a informação para oti-
mizar o espaço limitado. O tamanho
do DNA é cerca de 100 000 vezes o
tamanho da célula, o que faz com
que sua organização seja otimizada
para o bom funcionamento e vida da

Material exclusivo para professores


célula, visto que todos os processos
imprescindíveis à célula dependem
dessa molécula. Essa organização e a

conveniados ao Sistema de Ensino


composição dos elementos que auxi-
Microscopia eletrônica
mostra cromossomos liam a organizar esse filamento serão
humanos. Aumento de abordados neste módulo.
6 100x. Cores fantasia.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 226 14/12/18 12:43
65 – Material do Professor 227

Estrutura e tipos de algumas estruturas só visíveis durante a fase de


interfase na divisão celular, na qual ocorre a du-

BIOLOGIA 1A
cromossomo plicação do filamento cromossômico e a geração
de duas cópias cromossômicas conhecidas como
O cromossomo é uma estrutura composta de
cromátides-irmãs. Portanto, durante a divisão celu-
filamentos compactados de DNA associados ao
lar, o centrômero, que é a região de constrição do
redor de proteínas conhecidas como histonas; ele
cromossomo, mantém unidas as duas cromátides-ir-
tem uma conformação espacial semelhante ao for-
mãs para que os microtúbulos do fuso se conectem
mato de um “X”. O ser humano geralmente possui
ao centrômero, movendo os cromossomos duran-
46 cromossomos, organizados em pares: 23 pares,
te o processo de divisão celular. Os cromossomos
sendo 22 de cromossomos autossômicos e um
que não possuem centrômero não conseguem ser
de cromossomos sexuais. Esses cromossomos se
levados para os núcleos recém-formados por esse
encontram no núcleo da célula eucariótica, enquan-
processo e, assim, são perdidos, promovendo con-
to, em procariotos, o cromossomo tem o formato
sequências graves para a célula.
circular (chamado de plasmídeo), sem proteínas as-
sociadas, e encontra-se livre no citoplasma.
Os cromossomos são constituídos por cromati-
nas, que nada mais são que a condensação dos fila- Em certos momentos,
Em outros, ele
um cromossomo
mentos de DNA enrolados nas histonas; a cromatina consiste em uma só
consiste em duas
cromátides-irmãs.
possui níveis de compactação. Quando um filamento cromátide.
de DNA se associa a diversas histonas, ele forma o
Os telômeros são as pontas
nucleossomo, que se assemelha a um “colar de con-
estáveis dos cromossomos.
tas”. Os nucleossomos, portanto, são formados por telômero
DNA e histonas, apresentam diâmetro de 10 nanôme-
tros e são considerados as estruturas primárias da cro-
matina. À medida que essa estrutura se alonga e cresce,
centrômero
ela sofre torção (helicoidização), formando a cromatina
propriamente dita. Dependendo da forma como ocorre duas
cromátides-
essa torção, forma-se a heterocromatina, a chamada -irmãs microtúbulos
cromatina menos condensada; ou a eucromatina, partes do fuso
telômeros
mais condensadas.

um cromossomo um cromossomo O centrômero é uma região


Dupla fita de DNA estreitada do cromosso-
mo, onde se formam os
cinetócoros e se ligam aos
microtúbulos do fuso.

Os cromossomos eucarióticos possuem centrômero e telômero.


Durante a interfase da divisão celular, são duplicados, formando
as cromátides-irmãs. Eventualmente, os cromossomos podem ter
constrições secundárias, que são equivalentes aos centrômeros, mas
em outras porções das cromátides. Elementos representados fora da
o
m

escala de tamanho. Cores fantasia.


so

“Colar de contas”
os
cle

formando a cromatina Fonte da figura: Benjamin A. Pierce. Genética: um enfoque conceitual.


Nu

3. ed. Rio de Janeiro: Editora Guanabara Koogan, 2011.

Fibras de cromatina de
nucleossomos compactos Para melhor compreensão dos tipos cromossômi-
cos, a localização do centrômero é importante, pois
eles podem ser classificados em:
Cromatina
condensada • metacêntricos: quando o centrômero se encon-
tra no meio do cromossomo;
• submetacêntricos: quando o centrômero é um

Material exclusivo para professores


Cromossomo pouco deslocado para uma das extremidades;
possuem os dois braços;
Ilustração que mostra os níveis de condensação dos filamentos de
DNA, enrolados em proteínas histonas e formando os nucleossomos. • acrocêntricos: quando o centrômero está muito
Elementos representados fora da escala de tamanho. Cores fantasia. deslocado para a extremidade, deixando um braço

conveniados ao Sistema de Ensino


bem maior que o outro;
As características dos cromossomos devem estar • telocêntricos: quando o centrômero se encontra
na fase de duplicação para que se possa distinguir em uma das extremidades.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 227 14/12/18 12:43
228 66 – Material do Professor

Nos cromossomos metacêntricos, submetacêntri-

NATHAN DEVERY/SHUTTERSTOCK
BIOLOGIA 1A

cos e acrocêntricos, o braço curto é designado pela


letra p e o braço longo é designado pela letra q. Os
cromossomos telocêntricos, como não possuem um
dos braços, não seguem essa classificação.
ANDREA DANTI/SHUTTERSTOCK

Representação em 3-D do
cromossomo que evidencia
a região dos telômeros,
demarcada em amarelo.
Elementos representados
fora da escala de tamanho.
Cores fantasia.

Na maioria dos tipos celulares, os cromossomos


aparecem em pares, isto é, sempre há dois cromos-
somos de cada tipo, exatamente iguais em tamanho,
forma, posição do centrômero e genes. Quando isso
telocêntrico acontece, dizemos que são cromossomos homólogos.
submetacêntrico
1 1

Gene A
acrocêntrico Gene B
metacêntrico

Classificação dos cromossomos baseada na posição dos centrômeros. 20


Elementos representados fora da escala de tamanho. Cores fantasia.

Gene B
Alguns cromossomos podem apresentar regiões Gene C

denominadas constrições secundárias, de forma Gene D


que a porção separada do corpo dos cromossomos é Gene E
Gene L
denominada zona SAT ou satélite. Essa região está
Gene M
relacionada à formação dos nucléolos, cuja função
principal é a montagem e organização dos ribosso- Os cromossomos 1 são homólogos, isto é, possuem o mesmo
tamanho, forma e posição dos centrômeros, bem como a mesma
mos. Em células com maior atividade de síntese constituição gênica. Entretanto, o cromossomo 20 não é homólogo
proteica, essa região SAT é maior e, consequente- aos cromossomos 1, por ser completamente diferente em todos os
mente, o nucléolo também o é, visto que a princi- aspectos quando comparado aos dois. Elementos representados fora
da escala de tamanho. Cores fantasia.
pal organela responsável pela síntese de proteínas
é o ribossomo.
Outra estrutura importante é o telômero, extre-
midade natural de cada braço do cromossomo. É
Células haploides e
uma parte do cromossomo formada por sequências
muito repetitivas de DNA, que não codifica para
diploides
O número de cromossomos presente no núcleo
nenhuma proteína e serve para proteger as extre-
celular é denominado ploidia. As células somáticas,
midades, como se fossem as pontas de plástico
responsáveis por formar órgãos e tecidos, apresen-
do cadarço dos tênis, que evitam que o fio se abra
tam dois lotes cromossômicos, classificados como
e desfie. Entretanto, o telômero se “desgasta” ao
diploides (2n). Já nas células germinativas formadoras
longo do tempo, pois, com novas divisões celulares
de gametas (ovócitos e espermatozoides), existe apenas
(a fim de multiplicar e/ou regenerar tecidos), essa
um lote cromossômico, classificado como haploide (n).
região se encurta, ficando extremamente pequena
e não conseguindo mais desempenhar a função de
proteger o DNA. A célula então para de se repro-
duzir e entra no estado de senescência ou velhice.
Em 2009, um grupo de pesquisadores descobriu a
relação entre o telômero e as células cancerígenas,

Material exclusivo para professores também associando a ação da enzima telomera-


se. Esses estudiosos ganharam o Prêmio Nobel de
Medicina daquele ano, possibilitando estudos com

conveniados ao Sistema de Ensino


Na imagem à esquerda, temos um conjunto haploide de três cromossomos
essa enzima para o tratamento de alguns tipos de
(n = 3), enquanto na imagem à direita, temos um conjunto diploide de
câncer e de doenças que envolvem a senescência seis cromossomos (2n = 6). Elementos representados fora da escala de
dos telômeros. tamanho. Cores fantasia.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 228 14/12/18 12:43
67 – Material do Professor 229

Os gametas, que são células haploides (n), quando for-


mam o zigoto, tornam-se uma célula diploide (2n). Assim,
Número de cromossomos

BIOLOGIA 1A
durante a fecundação, os 23 cromossomos do espermato- O número de cromossomos pode variar bastante
zoide encontram-se com os 23 cromossomos do ovócito, de uma espécie para outra e isso acontece ao longo
originando um zigoto com 46 cromossomos, no caso dos da evolução, em que algumas espécies perdem cro-
indivíduos que não apresentam anomalias na formação. mossomos e outras ganham ao longo de milhares de
No processo da divisão celular, os gametas podem anos. Observe alguns exemplos na tabela comparativa
apresentar erros em um par de seus cromossomos, entre o número cromossômico.
fazendo com que o zigoto tenha cromossomos a mais,
como na síndrome de Down. Pode ocorrer também a ANIMAL PLOIDIA
falta de cromossomos, dando origem a outras anoma-
Homo sapiens (humano) 2n = 46
lias que serão discutidas adiante.
Nas plantas com flores denominadas angiosper- Pan troglodytes (chimpanzé) 2n = 48
mas, em uma das fases de desenvolvimento estão
Rattus rattus (rato-preto) 2n = 42
presentes as células triploides, com três cromosso-
mos de cada tipo, formando trios em vez de pares. Felis catus domesticus (gato doméstico) 2n = 38
Puma concolor (onça-parda) 2n = 38
WILLIAM RODRIGUES DOS SANTOS/
DREAMSTIME.COM

Cucumis sativus (pepino) 2n = 14


Carica papaya (mamão) 2n = 18
Avena sativa (aveia) 6n = 42
Saccharum officinarum (cana-de-açúcar) 2n = 80
Ascaris univalens (lombriga de rato) 2n = 2

O endosperma presente nas sementes das angiospermas é triploide, Com base nessa tabela, é possível notar que há
isto é, possui três cromossomos de cada tipo. A planta dente-de-leão, espécies com o mesmo número de cromossomos. A
também conhecida como cabeça de vovô, do gênero Taraxacum, é uma
planta angiosperma.
aveia e o rato-preto possuem 42 cromossomos, po-
rém são de filos completamente diferentes e possuem
As células do endosperma, presentes nas sementes ploidias distintas também. Os cromossomos, quando
dessas plantas, responsáveis principalmente pela nutri- comparados entre si, são bastante diferentes em ti-
ção do embrião, são resultado da fusão entre dois dos nú- pos (metacêntricos, acrocêntricos etc.), em relação
cleos polares do óvulo e um núcleo de gameta masculino. aos diversos genes relacionados a características e
funções, bem como às mutações específicas ao longo
2 núcleos espermáticos (n) do DNA. Já espécies mais próximas entre si, como o
gametas masculinos gato doméstico e a onça-parda, apresentam a mesma
grão de pólen
quantidade de lote cromossômico. Organismos aparen-
oosfera (n)
tados tendem a apresentar números de cromossomos,
gameta feminino tipos e genes semelhantes, de modo que muitos des-
sinérgides ses genes são comuns uns aos outros, assim como o
número de mutações no DNA.
núcleos polares
saco embrionário

Cromossomos sexuais
1 fecundação
a antípodas A maioria das espécies apresenta um par de cro-
oosfera + núcleo espermático (2n) mossomos sexuais cujos componentes diferenciam
núcleo embrião os indivíduos em relação ao sexo biológico macho
2n
espermático 1 (2n)
futura e fêmea. No caso da espécie humana, pessoas do
planta sexo feminino possuem um par de cromossomos
idênticos chamados de homogaméticos (XX); já as
endosper-

Material exclusivo para professores


3n ma (3n) pessoas do sexo masculino, um par de cromossomos
diferentes chamados de heterogaméticos (XY). Os
núcleo
demais cromossomos existentes dentro da célula
espermático 2
2a fecundação semente são denominados cromossomos autossômicos, os

conveniados ao Sistema de Ensino


núcleos polares + núcleo espermático (3n) quais não estão ligados ao sexo e fazem parte do
Formação do tecido triploide, o endosperma. Elementos representados patrimônio genético da espécie, como os 23 pares
fora da escala de tamanho. Cores fantasia.
encontrados no cariótipo dos seres humanos.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 229 14/12/18 12:43
230 68 – Material do Professor

LEITURA COMPLEMENTAR

(C) MYSIKRYSA | DREAMSTIME.COM


BIOLOGIA 1A

Telômeros encurtados vs. obesidade


O envelhecimento é caracterizado por um estado in-
flamatório sistêmico crônico das células, que também
ocorre, em menor grau, em indivíduos com obesidade.
Os efeitos adversos da inflamação, como a secreção de
citocinas inflamatórias, o aumento do risco de ocorrên-
cia de danos ao DNA, o encurtamento de telômeros e
a diminuição de defesas antioxidantes, parecem estar
potencializados em sujeitos com obesidade e sua pre-
sença aumenta o risco para o aparecimento precoce de
doenças associadas à idade.
“Isso sugere que tanto o envelhecimento como a obe-
sidade são processos ou estados interconectados que
compartilham características em comum. É como se a
obesidade levasse o indivíduo a um envelhecimento
precoce, porque sua idade cronológica não condiz com
sua idade biológica”, comenta a pesquisadora Florencia
Diferentemente dos seres humanos, nas aves fêmeas está presente Maria Barbé-Tuana, doutora do programa de pós-gra-
um par de cromossomo heterogamético (ZW) e, nos machos, um par de
homogamético (ZZ). duação em Ciências Biológicas: Bioquímica, da Univer-
sidade Federal do Rio Grande do Sul (UFRGS).
Para avaliar se o encurtamento dos telômeros está asso-
Cariótipo ciado com atividade física e obesidade, Florencia propôs
a seguinte hipótese: “Indivíduos com obesidade têm telô-
O cariótipo é o conjunto de cromossomos de meros mais curtos do que indivíduos com peso normal?”.
uma espécie, com todas as suas características Assim, iniciou um estudo transversal experimental, em
(número, tamanho e classificação). Ele pode ser que foram coletadas amostras de sangue de pacientes
observado pelo microscópio principalmente durante do Centro de Obesidade Mórbida e Síndrome Metabó-
a divisão celular, em razão do alto grau de conden- lica, do Hospital São Lucas da Pontifícia Universidade
sação dos cromossomos. Católica do Rio Grande do Sul (PUC-RS). Esse primeiro
Com a imagem obtida pelo microscópio, os cro- estudo confirmou a existência de telômeros encurtados
mossomos são recortados de acordo com o tipo e em em pessoas obesas.
ordem decrescente de tamanho. Então, é montado o
ideograma ou idiograma. Mais pesquisas, mais resultados...
A análise do ideograma é fundamental na detecção Mesmo com esse resultado, a pesquisadora ainda ques-
de anomalias cromossômicas em fetos por meio de tionava se realmente essas células senescentes seriam
alguns exames como amniocentese, no qual uma pe- capazes de modular e transformar aquelas células sa-
quena quantidade do líquido amniótico é coletada para dias em senescentes também. Para isso, ela iniciou um
análise do cariótipo das células somáticas do feto. Com segundo trabalho, também utilizando células de sangue
os dados dessa análise, como o número e a forma dos periférico, mas agora de um indivíduo sadio, incubando
cromossomos, é possível dizer se o feto possui alguma com o plasma de um indivíduo obeso.
anomalia genética. Os resultados encontrados por Florencia elucidaram a
questão inicial de seu trabalho e trouxeram esclareci-
mentos sobre a influência em processos metabólicos e
KATERYNA KON/SHUTTERSTOCK

imunológicos.
“Para nossa surpresa, o que vimos é que realmente as célu-
las, inicialmente saudáveis, quando incubadas com plasma
de indivíduos portadores de obesidade, foram moduladas
para um perfil senescente”, revela a pesquisadora.
Além disso, a obesidade poderia ser também estudada
como uma patologia que leva o indivíduo a níveis mais

Material exclusivo para professores


próximos de um envelhecimento precoce e ao desenvolvi-
mento de processos que podem levar ao desenvolvimento
À esquerda, são apresentados os ideogramas de um cariótipo normal de tumores e cânceres – quando ocorre um evento celular
humano do sexo masculino e, à direita, um cariótipo do sexo feminino em que o controle na multiplicação dessas células fica alte-

conveniados ao Sistema de Ensino


normal. Os 22 pares são denominados cromossomos autossômicos, rado, o desenvolvimento de tumores fica mais suscetível.
enquanto os cromossomos X e Y (circulados em vermelho) são
denominados cromossomos sexuais. Elementos representados fora da Disponível em: <https://sbi.org.br/2018/07/20/noticia-topo/>.
escala de tamanho. Cores fantasia. Acesso em: out. 2018.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 230 14/12/18 12:43
69 – Material do Professor 231

ROTEIRO DE AULA

BIOLOGIA 1A
CROMOSSOMOS

Composição Cariótipo 2 pares de cada


1 de cada tipo
tipo

Cromatina Ocorre em células: Ocorre em células:


Conjunto que pode ser
identifcado em cada
espécie e analisado. Somáticas Germinativas
Composta de:

DNA e histonas Diploides (2n) Haploides (n)

Estruturas constituintes

Constrições Telômero
Centrômero
secundárias

Zona SAT ou satélite


Função:
Mantém as cromátides-
-irmãs unidas na divisão
celular.
Estabilizar o
Função:
cromossomo

Classificação Formar os nucléolos

Submetacêntrico

Metacêntrico

Material exclusivo para professores Telocêntrico

conveniados ao Sistema de Ensino Acrocêntrico

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 231 14/12/18 12:43
232 70 – Material do Professor

EXERCÍCIOS DE APLICAÇÃO
BIOLOGIA 1A

1. UERR – Os cromossomos são estruturas que coram 4. Cefet-MG – Analise a imagem a seguir do cariótipo de
intensivamente com uso de corantes citológicos, sendo um indivíduo que apresenta uma anomalia.
observável à microscopia óptica durante a divisão celu-
lar. Sabendo-se disso, assinale a alternativa correta, do

L. WILLATT, EAST ANGLIAN REGIONAL GENETICS SER-

VICE/SCIENCE PHOTO LIBRARY/FOTOARENA


ponto de vista genético, que define suas características.
a) São definidos como estruturas com lamelas lipopro-
teicas dobradas ordenadamente em espiral, forma-
das por subunidades de glicogênio.
b) Eles podem ser definidos como uma sucessão linear
de genes, unidades de informação genética caracte-
rística de todos os seres vivos.
c) São definidos como pequenas moléculas de lipopro-
teínas, RNA e lignina, contendo informação genética
dos animais.
d) Eles podem ser definidos como finos filamentos ci-
toplasmáticos que estabelecem comunicações entre
as células, formados apenas por proteínas denomi-
nadas purinas.
e) São definidos como estruturas citoplasmáticas que
armazenam amidos e auxiliam no sistema de excre-
A causa dessa anomalia é a ocorrência de:
ção celular.
a) deleção do cromossomo Y.
Os cromossomos são uma sucessão linear de genes, que são
as unidades de informações genéticas, unidos a proteínas. b) curvatura nos cromossomos.
c) troca de partes entre os cromossomos.
2. Unicamp-SP (adaptada) – Em relação a um organis- d) alteração nos tamanhos dos cromossomos.
mo diploide, que apresenta 28 cromossomos em cada e) quantidade de cromossomos maior que o comum.
célula somática, pode-se afirmar que:
a) seu código genético é composto de 28 moléculas Houve trissomia do cromossomo 21, evidenciando a presença
de DNA de fita simples. de um cromossomo a mais desse tipo. Essa é característica da
síndrome de Down.
b) o gameta originado desse organismo apresenta 14
cromossomos.
c) uma célula desse organismo apresenta 28 moléculas 5. Unifesp (adaptada) – Os gatos possuem 38 cromos-
de RNA. somos, com sistema XX/XY de determinação sexual.
Assim, gatas possuem cromossomos XX e gatos pos-
d) seu cariótipo é composto de 28 pares de cromos-
suem cromossomos XY. Sobre a constituição cromos-
somos.
sômica sexual dos gatos do sexo masculino, denomi-
O gameta possui 14 cromossomos. As alternativas A e C estão namos como:
incorretas porque se trata de 28 cromossomos no total, e cada
a) cromossomos heterogaméticos.
um deles é constituído por DNA de fita dupla, enovelando as
proteínas. A alternativa D está incorreta porque o cariótipo terá b) cromossomos homogaméticos.
14 pares de cromossomos.
c) cromossomos homólogos.
3. Sistema Dom Bosco – Os cromossomos são consti- d) cromossomos metacêntricos.
tuídos por DNA e proteínas e é por meio deles que é e) cromossomos acrocêntricos.
armazenada toda a informação genética de um indiví-
duo. Entre as demais estruturas, existe uma na qual os Gatos do sexo masculino possuem cromossomos XY e, por isso,
são denominados cromossomos heterogaméticos.
microtúbulos se ligam durante a divisão celular para mo-
ver as cromátides-irmãs sem separá-las. Cite o nome
6. Sistema Dom Bosco – Os cromossomos podem ter
dessa estrutura.
mais de uma constrição ao longo de sua estrutura. Exis-
A estrutura à qual os microtúbulos se ligam é denominada centrômero. te uma constrição secundária denominada zona SAT ou
satélite, de suma importância para a formação de uma
determinada organela nuclear. Cite que organela é essa
e explique a importância dessa estrutura.
A organela referida no enunciado é o nucléolo, responsável pelo arma-

zenamento do RNA ribossômico. A zona SAT é importante, pois está

Material exclusivo para professores


envolvida na formação dessa organela, que tem como função a organiza-

ção e a formação dos ribossomos, primordiais na síntese de proteínas.

conveniados ao Sistema de Ensino


Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 232 14/12/18 12:43
71 – Material do Professor 233

EXERCÍCIOS PROPOSTOS

BIOLOGIA 1A
7. Sistema Dom Bosco – Observe a imagem a seguir, 12. FGV-SP (adaptada) – A figura ilustra o modelo do iní-
representando quatro cromossomos: cio da fusão de dois núcleos de células reprodutivas
humanas sem anomalias.

DR_MICROBE/ISTOCKPHOTO.COM

CC STUDIO/SCIENCE PHOTO LIBRARY/

FOTOARENA
Com base em seus conhecimentos, marque a alter-
nativa correta:
O número de moléculas de DNA presente em cada
a) Se a figura acima fosse uma célula germinativa, a re-
núcleo é:
presentação do número cromossômico seria 2n = 4.
b) As extremidades dos cromossomos são denomina- a) 22
das cromátides-irmãs. b) 23
c) A figura representa um único cromossomo com seu c) 44
telômero se desgastando ao longo do tempo. d) 46
d) A constrição central é denominada zona SAT. e) 92
e) A figura representa cromossomos telocêntricos.
13. UFMG (adaptada) – O número de cromossomos da
8. PUC-RJ (adaptada) – Os cromossomos são constituí- espécie humana pode, às vezes, apresentar alterações.
dos principalmente por: Pessoas com síndrome de Klinefelter possuem 47 cro-
mossomos; entre eles, os cromossomos sexuais são
a) centrômeros. representados por XXY. Com base nessas informações
b) RNA. e outros conhecimentos sobre o assunto, é incorreto
c) enzimas. afirmar que
d) DNA e proteínas. a) os pais de um indivíduo Klinefelter têm número nor-
mal de cromossomos nas células somáticas.
e) ribossomos.
b) a presença de dois cromossomos X impede a mani-
9. Sistema Dom Bosco – Sobre a estrutura dos cromos- festação do fenótipo masculino.
somos, marque a alternativa correta: c) o número de cromossomos esperado para a espécie
a) Cada cromossomo é formado por quatro cromátides. humana é de 46.
b) Os telômeros são as extremidades do cromosso- d) a fecundação de um ovócito X por um espermatozoi-
mo e têm como função estabilizar a produção de de XY dá origem a um indivíduo Klinefelter.
proteínas.
14. Sistema Dom Bosco – A imagem a seguir representa
c) A zona SAT ou satélite é uma constrição responsável um ideograma do cariótipo de um ser humano.
pelas características sexuais dos indivíduos.
BIOPHOTO ASSOCIATES/GETTY IMAGES

d) O centrômero é responsável por manter as cromátides-


-irmãs unidas durante a divisão celular.

10. Ufla-MG (adaptada) – Na espécie humana, o número


diploide de cromossomos é 46. Quantos cromossomos
serão encontrados, respectivamente, nos espermato-
zoides, ovócitos e células epidérmicas?
a) 23, 23, 46.
b) 22, 22, 46.
c) 22, 22, 44.
d) 23, 23, 44.

Material exclusivo para professores


11. Uerj – Qualquer célula de um organismo pode sofrer
mutações. Há um tipo de célula, porém de grande im-
portância evolutiva, que é capaz de transmitir a muta-
ção diretamente à descendência. As células com essa
característica são denominadas:

conveniados ao Sistema de Ensino


a) diploides.
b) somáticas.
c) germinativas.
d) embrionárias.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 233 14/12/18 12:44
234 72 – Material do Professor

a) Com base em seus conhecimentos, descreva se o Porcos e javalis são subespécies de uma mesma es-
BIOLOGIA 1A

cariótipo pertence a um indivíduo do sexo masculino pécie, Sus scrofa. A referência ao número de cromos-
ou feminino e justifique. somos justifica-se pelo fato de que são considerados
javalis puros apenas os indivíduos com 36 cromosso-
mos. Os porcos domésticos possuem 38 cromossomos
e podem cruzar com javalis. Desse modo, é correto
afirmar que
a) os animais com 37 cromossomos serão filhos de
um leitão ou de uma leitoa, mas não de um casal
de javalis.
b) um híbrido de porco e javali, conhecido como javapor-
co, terá 74 cromossomos, tendo herdado o material
genético de ambas as subespécies.
c) do cruzamento de uma leitoa com um javali, devem
resultar híbridos fêmeas com 38 cromossomos e
b) Classifique os cromossomos 5 com base na posição híbridos machos com 36 cromossomos.
do centrômero. d) os animais não puros terão o mesmo número de cro-
mossomos do porco doméstico, mas não o número
cromossômico do javali.
e) os animais puros, aos quais o restante se refere, são
filhos de casais em que pelo menos um dos animais
paternos tem 36 cromossomos.

17. Unesp (adaptada) – Suponha que a melancia sem


sementes tenha sido originada a partir do cruzamento
entre uma planta diploide com 22 cromossomos e uma
planta tetraploide com 44 cromossomos. Quantos cro-
mossomos terão as células somáticas da planta nova?
Considerando que as sementes são o resultado da re-
produção sexuada, explique por que os frutos dessa
planta não as possuem.

15. Sistema Dom Bosco – Sabemos que todos os orga-


nismos possuem material genético em suas células.
Entretanto, o material genético pode ser armazenado
em formas diferentes. Com base nisso, pode-se afirmar
corretamente que
a) procariotos possuem cromossomos em formato de
X, semelhante aos dos eucariotos.
b) procariotos possuem diversos cromossomos, com
número variável entre as espécies.
c) procariotos possuem um único cromossomo em
formato circular, presente no citoplasma.
d) o número de cromossomos entre organismos eu-
cariotos não varia entre as espécies mais próximas
evolutivamente.

16. Unesp – Leia a placa informativa presente em uma


churrascaria:

JAVALI Restaurante

Material exclusivo para professores


Churrascaria

conveniados ao Sistema de Ensino


SERVIMOS CARNE DE JAVALI PURO
ANIMAIS COM 36 CROMOSSOMOS

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 234 14/12/18 12:44
73 – Material do Professor 235

ESTUDO PARA O ENEM

BIOLOGIA 1A
18. Sistema Dom Bosco C5-H17 d) a representação do número cromossômico nas cé-
A síndrome de Down é causada pela presença de três lulas somáticas será 2n 5 38 ou 2n 5 36.
cromossomos 21 em todas ou na maior parte das células e) felinos possuem o mesmo sistema cromossômico
de um indivíduo. Isso ocorre na hora da concepção de uma que as aves, sendo os machos ZZ.
criança. As pessoas com síndrome de Down, ou trissomia
do cromossomo 21, têm 47 cromossomos em suas células 20. Sistema Dom Bosco C5-H17
em vez de 46, como a maior parte da população.
Observe a figura a seguir, em que as pessoas repre-
Disponível em: <http://www.movimentodown.org.br/sindrome-
-de-down/o-que-e/>. Acesso em: out. 2018.
sentam os cromossomos.

A identificação do fator que origina indivíduos com

CONEYL JAY/GETTY IMAGES


essa síndrome tornou-se possível pela utilização da
técnica de
a) produção do DNA recombinante.
b) clonagem.
c) contagem e identificação dos cromossomos.
d) culturas de células e tecidos.
e) mapeamento do genoma humano.

19. Sistema Dom Bosco C5-H17


De acordo com pesquisas realizadas com a família Feli-
dae, representada pelos pequenos e grandes felinos como
onças, tigres, leões, linces e até mesmo o gato doméstico,
o número cromossômico pode variar entre 18 e 19 nas cé- Ao fazer uma analogia da representação das pessoas
lulas germinativas. na imagem com os cromossomos,
Fonte: Genetics for cat breeders: international
a) apenas os braços podem representar as cromá-
series in pure and applied biology, p. 21.
tides-irmãs.
A respeito da família Felidae, posse afirmar correta- b) o telômero pode ser representado pela cabeça das
mente que pessoas.
a) o número de cromossomos não inclui os cromos- c) os cromossomos representados poderiam ser clas-
somos sexuais. sificados como acrocêntricos.
d) a região abdominal representa uma constrição
b) há entre 40 e 42 cromossomos nas células somáticas. secundária.
c) a representação do número cromossômico nas cé- e) a região abdominal representa uma constrição de-
lulas germinativas será n 5 38 ou n 5 36. nominada centrômero.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 235 14/12/18 12:44
17
236 74 – Material do Professor

23
BIOLOGIA 1A

DIVISÃO CELULAR: MITOSE

Em 2012, pesquisadores da Universidade de Wisconsin-Madison (EUA) identifi-


caram um novo tipo de divisão celular, que acreditam ser a variação da mitose. Esse
• Ciclo celular processo recebeu o nome de clerocinese e foi descrito com base em experimentos
• Mitose realizados com células humanas retiradas da retina.
• Variação da quantidade de O experimento consistiu em deixar essas células passarem pelo processo de
DNA na mitose mitose normalmente até depois da duplicação do núcleo, quando o processo foi
bloqueado, o que levou à criação de uma célula com dois núcleos. Após a observa-
HABILIDADES ção do desenvolvimento dessa célula, os pesquisadores perceberam que ela origina
• Descrever a importância da células comuns da retina, pois se estica demais e consegue concluir a divisão celular
mitose para os organismos. mesmo sem a presença de proteínas que agem ativamente durante a mitose.
• Citar e explicar as etapas Com essa descoberta, eles acreditam poder compreender melhor como as células
do ciclo celular. se multiplicam, o que pode ser um grande passo, inclusive, para entender um pouco
• Conhecer as consequências mais o câncer e, assim, criar novas alternativas para bloquear o desenvolvimento
do ciclo celular e explicar dessa doença.
as etapas da mitose.

TETRAT IMAGES/GETTY IMAGES


• Compreender a variação do
número de cromossomos
durante as etapas do ciclo
celular e da mitose.

O processo de clerocinese foi descrito com base na observação de células da retina.

IMPORTÂNCIA DA DIVISÃO CELULAR


Material exclusivo para professores Mitose e meiose são duas formas de divisão celular. A mitose origina duas
células-filhas idênticas à célula-mãe, com o mesmo número de cromossomos dela.
Por isso, dizemos que é uma divisão equacional, representada por (E!). A meiose,

conveniados ao Sistema de Ensino


por outro lado, é o processo no qual uma célula origina quatro células com metade
do conjunto cromossômico da célula-mãe, tema que será discutido em detalhes no
próximo módulo.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 236 14/12/18 12:44
75 – Material do Professor 237

Existem células que sofrem mitose frequentemen-

OXFORD SCIENTIFIC/GETTY IMAGES


te, como as células da medula óssea (produtoras das

BIOLOGIA 1A
células sanguíneas) e as dos tecidos meristemáticos
vegetais (responsáveis pelo crescimento da planta).
As células do fígado entram em divisão, originando
diversas duplas de outras células iguais após a mor-
te celular proveniente de uma doença como hepati-
te. Existem também células que nunca se dividem,
como os neurônios, as células musculares estriadas e
as musculares cardíacas.
Em organismos que realizam a reprodução assexua-
da, como as algas, as amebas e as bactérias, ao so-
frer divisão celular, um organismo originará dois outros
idênticos geneticamente a ele. Nesse caso, a divisão Embrião de galinha (Gallus gallus) com 12 dias em estágio avançado de
celular é sinônimo de reprodução assexuada. desenvolvimento. Aumento desconhecido.
BIOPHOTO ASSOCIATES/GETTY IMAGES

• Renovação celular – As células dos vários te-


cidos que constituem um organismo precisam
ser renovadas periodicamente, originando células
precursoras por meio da divisão celular. O tecido
epitelial, por exemplo, necessita ser renovado,
em média, a cada 28 dias.

ED RESCHKE/GETTY IMAGES
Micrografia de um Paramecium no estágio final da fissão binária da
mitose, isto é, originando dois organismos geneticamente idênticos.
Aumento de 100x.

A mitose também tem grande importância para


os seres pluricelulares por promover as mudanças
a seguir.
• Desenvolvimento – Embriões são formados por
células que se dividem constantemente, dando
origem aos tecidos e órgãos que constituem um
novo indivíduo. Células do tecido epitelial. Micrografia óptica. Aumento de 250x.
BIOPHOTO ASSOCIATES/GETTY IMAGES

• Regeneração – Células lesadas ou mortas podem


ser substituídas por meio da divisão celular, como
ocorrem em fraturas ósseas, por exemplo.
STEVE ALLEN/GETTY IMAGES

Imagem radiográfica
de osso da perna
humana quebrado. As
células do periósteo, do
endósteo e do tecido
mieloide multiplicam-se

Material exclusivo para professores


e diferenciam-se em
células osteoprogenitoras
Embrião de coelho em desenvolvimento, originado por divisão de novas e osteoblastos. Estas
células. Aumento desconhecido. passam a secretar o
osteoide, que poste-

conveniados ao Sistema de Ensino


• Crescimento – Os organismos crescem devido ao riormente é calcificado
e forma o calo ósseo,
aumento, em número e volume, das células. A mi- unindo e reconstituindo a
tose promove o aumento do número de células. região lesionada.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 237 14/12/18 12:44
238 76 – Material do Professor

Durante o desenvolvimento da célula, a relação


ponto de
BIOLOGIA 1A

entre o volume celular e a área de sua membrana verificação


aumenta até alcançar um valor crítico, desencadean- G2/S
do a divisão. Assim, o crescimento da superfície não duplicação crescimento
acompanha o aumento do seu volume e essa falta de do DNA celular prófa
se
proporção torna a manutenção do metabolismo da G2
S metáfase
célula inviável. Esse fato irá promover a divisão celular M anáfase
para tornar a superfície compatível com o volume no telófas
e
G1 citoc
início de cada ciclo. ines
e

ponto de
CICLO CELULAR verificação
G1/S G0

As células têm determinado tempo de vida e po- G1 1 S 1 G2 5 interfase


M 5 mitose
dem morrer ou se dividir, originando novas células.
Seu destino depende de uma sequência de even- No esquema é possível notar as fases da interfase G1, S e G2. Somente
tos que ocorrem dentro do ciclo celular (ou ciclo após essas três fases a célula poderá iniciar o processo de divisão
mitótico), que compreende a interfase e a mitose celular (mitose ou fase M).

(fase M).

INTERFASE MITOSE
É o período, entre as divisões celulares, de cres- É a divisão celular propriamente dita. Nessa fase,
cimento e desenvolvimento em que diversas reações uma célula origina duas outras células com informa-
bioquímicas ocorrem simultaneamente. Em geral, os ções genéticas exatamente iguais. A mitose é dividida
cromossomos encontram-se relaxados, sendo possí- em cinco estágios: prófase, metáfase, anáfase, teló-
vel vê-los por microscópio óptico apenas em forma fase e citocinese.
de cromatina difusa.
PRÓFASE
A interfase é dividida em três fases: G1, S e G2.
Neste estágio, os cromossomos irão se condensar
e as cromátides-irmãs formadas na fase S da interfase
• G1 significa gap 1 ou intervalo 1. Nessa fase,
ficarão bem evidentes. O fuso mitótico, conhecido
a célula cresce e são produzidas as proteínas
como o arranjo de microtúbulos que move os cromos-
que vão atuar na divisão celular. Em geral, tem
somos, será formado. Em células animais, o fuso cres-
duração média de quatro horas. Ocorre tam-
ce dos centrossomos, estruturas responsáveis por
bém o ponto de verificação G1/S, no qual a
carregar os centríolos, que são compostos de micro-
célula só avança para a fase S se tiver todas as
túbulos. Assim, os centrossomos migram para lados
enzimas necessárias para atuar na replicação
opostos da célula, iniciando o fuso mitótico.
do DNA. A célula pode sair do ciclo celular em
resposta a sinais regulatórios e passar para a

SCIENCE PHOTO LIBRARY/FOTOARENA


fase G0, que a mantém em estado estável e
tamanho constante. Assim, pode permanecer
nessa fase por um longo tempo ou entrar no-
vamente na fase G1.

• A fase S refere-se à replicação do DNA (S de


síntese). Assim, os cromossomos são duplica-
dos e cada um deles passa a apresentar duas
cromátides-irmãs.
BSIP/UIG/GETTY IMAGES

• A fase G2 refere-se a um segundo intervalo –


gap 2. Nela, ocorrem diversos processos bioquí-

Material exclusivo para professores


micos e, ao final, existe o ponto de verificação
G2/M, de forma que a célula só avança para a
fase M de divisão celular caso o DNA não esteja
danificado. Essa verificação é importante, pois,

conveniados ao Sistema de Ensino


se a célula prosseguir para a divisão celular com Micrografia fluorescente de uma célula de um anfíbio durante a prófase.
Nesse momento da mitose, os cromossomos encontram-se condensados
o DNA danificado, haverá inibição da ativação de (em azul) e há formação do fuso mitótico. Aumento desconhecido. Ao
proteínas que atuam nesse processo. lado, representação esquemática dos elementos. Cores fantasia.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 238 14/12/18 12:44
77 – Material do Professor 239

LEITURA COMPLEMENTAR

SCIENCE PHOTO LIBRARY/FOTOARENA

BIOLOGIA 1A
Um estágio nem sempre citado, mas existente
Após a prófase, existe um estágio denominado prome-
táfase, em que ocorre a desintegração da membrana nu-
clear. Os microtúbulos do fuso entram na região nuclear
e ancoram-se ao cinetócoro de uma das cromátides-irmãs,
enquanto os microtúbulos do centrossomo oposto se

BSIP/UIG/GETTY IMAGES
ancoram à outra cromátide e levam os cromossomos
com eles aos próximos estágios da divisão celular.

centrômeros

Micrografia tridimensional de imunofluorescência de uma célula epitelial


de um canguru durante a anáfase. Nesse estágio, as cromátides-irmãs
separam-se e movem-se para os polos opostos. Aumento de 500x. Ao
lado, representação esquemática dos elementos. Cores fantasia.
microtúbulos

TELÓFASE E CITOCINESE
Na telófase, os cromossomos chegam ao polo do
fuso e a membrana nuclear é reconstituída ao redor
de cada grupo de cromossomos, originando dois nú-
cinetócoro cleos dentro de uma mesma célula. Além disso, os
cromossomos encontram-se relaxados, podendo ser
visualizados em forma de cromatina.
Na citocinese, o citoplasma é dividido, formando
duas células.
A imagem mostra as estruturas do cromossomo que fazem parte

SCIENCE PHOTO LIBRARY/FOTOARENA


BSIP/UIG/GETTY IMAGES

da prometáfase. Elementos representados fora da escala de


tamanho. Cores fantasia.

METÁFASE
Neste estágio, os cromossomos encontram-se to-
dos alinhados em um único plano entre os dois cen-
trossomos, formando a placa metafásica.
SCIENCE PHOTO LIBRARY/FOTOARENA

Micrografia tridimensional de imunofluorescência de uma célula epitelial


de um canguru durante a telófase. Nesse estágio, as cromátides chegam
ao polo do fuso e a membrana nuclear é reconstituída. Aumento de 500x.
Ao lado, representação esquemática dos elementos. Cores fantasia. SCIENCE PHOTO LIBRARY/FOTOARENA
BSIP/UIG/GETTY IMAGES

BSIP/UIG/GETTY IMAGES

Micrografia tridimensional de imunofluorescência de uma célula


epitelial de um canguru durante a metáfase. Durante esse estágio, os

Material exclusivo para professores


cromossomos (em azul) formam a placa metafásica, apresentando-se
alinhados em um único plano. Em verde, são evidenciados os
microtúbulos. Aumento de 500x. Ao lado, representação esquemática
dos elementos. Cores fantasia.

conveniados ao Sistema de Ensino


ANÁFASE Micrografia tridimensional de imunofluorescência de uma célula epitelial
de um canguru durante a citocinese. Na citocinese, a membrana
Neste estágio, as cromátides-irmãs separam-se e citoplasmática é reconstituída, originando duas novas células. Aumento de
movem-se para os polos opostos do fuso. 500x. Ao lado, representação esquemática dos elementos. Cores fantasia.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 239 14/12/18 12:44
240 78 – Material do Professor

Vale lembrar que existem algumas diferenças nesse • cada célula produzida é formada por metade do
BIOLOGIA 1A

processo em células animais e vegetais. As células citoplasma e organelas da célula genitora.


de gimnospermas e angiospermas não têm centríolos
Entretanto, a quantidade de organelas e demais
e, portanto, durante a formação do fuso mitótico, as
constituintes presentes no citoplasma não é distribuída
fibras vão para os polos opostos da célula, mas sem a
igualmente entre elas, o que sugere que as células-
orientação dessa organela. Por conta disso, a mitose
-filhas não sejam completamente idênticas.
vegetal é denominada anastral, enquanto a mitose
animal é denominada astral.
VARIAÇÃO DA QUANTIDADE DE DNA NA
Outra diferença é que a célula animal sofre estran-
gulamento na região equatorial, originando a citoci- MITOSE
nese. A célula vegetal, por conta da parede celular, A variação entre o número de cromossomos, cro-
não sofre estrangulamento, mas há um acúmulo de mátides e DNA é grande ao longo do processo de
vesículas oriundas do complexo golgiense, que se acu- divisão celular. Para acompanhar o número dessas
mulam no centro da célula, formando o fragmoplasto estruturas durante todo esse processo, existem duas
e a lamela média. Como o fragmoplasto é originado regras simples:
do centro para as regiões periféricas, a citocinese é 1) para determinar o número de cromossomos, basta
denominada citocinese centrífuga. contar o número de centrômeros existentes;
2) para determinar o número de moléculas de DNA,
SCIENCE PHOTO
LIBRARY/FOTOARENA

é preciso contar as cromátides. Cada cromossomo


consiste em uma única cromátide, ou seja, uma
única molécula de DNA na fase G1 da interfase.
Assim, uma célula 2n = 4 terá quatro cromosso-
Micrografia de divisão celular de cebola. Aumento de 1 000x. mos e quatro cromátides na fase G1 da interfase.
Como ocorre duplicação do DNA na fase S, da fase
G2 até o final da metáfase haverá quatro cromos-
CONSEQUÊNCIAS DA somos e oito cromátides. Na anáfase, o número de

DIVISÃO CELULAR cromossomos por célula sobe para oito e o número


de cromátides se mantém (oito). Por fim, na telófa-
Com o ciclo celular, dois fatos importantes acontecem: se e na citocinese, o número de cromossomos por
• uma célula produz duas novas células com as célula diminui para quatro, bem como o número de
mesmas informações genéticas que as suas, sen- cromátides. Isso pode ser representado da seguinte
do geneticamente idênticas; maneira em formato de gráfico:

G1 S G2 prófase e metáfase anáfase telófase e


prometáfase citocinese

número de
cromossomos 4 4 4 4 4 8 4
por célula

número de
moléculas
de DNA por 4
célula

Material exclusivo para professores


0

Quadro comparativo das fases da mitose em relação ao número de cromossomos por célula e quantidade de moléculas de DNA. Após a síntese de DNA
(fase S), o número de moléculas de DNA aumenta e volta a diminuir na telófase. Entretanto, o número de cromossomos é duplicado apenas na anáfase
e, posteriormente, volta à quantidade inicial.

conveniados ao Sistema de Ensino


Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 240 14/12/18 12:44
79 – Material do Professor 241

ROTEIRO DE AULA

BIOLOGIA 1A
DIVISÃO CELULAR: MITOSE

Uma célula
Duas células iguais Tipo de divisão Equacional (E!)
gera:

Importância
Crescimento Tipo de divisão Renovação celular
funcional

Crescimento celular

Fase G1

Produção de proteínas

Ciclo celular
Fase S Síntese de DNA

Fase G2 Processos bioquímicos

Formação do fuso, desintegração da


Prófase membrana nuclear, cromossomos
condensados ao extremo.

Cromossomos alinhados no plano equatorial.


Metáfase

Fases da mitose Anáfase Separação das cromátides-irmãs.

Cromossomos chegam ao fuso e a membrana nuclear é


Telófase
reconstituída.

Material exclusivo para professores Divisão do citoplasma.

conveniados ao Sistema de Ensino


Citocinese

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 241 14/12/18 12:44
242 80 – Material do Professor

EXERCÍCIOS DE APLICAÇÃO
BIOLOGIA 1A

1. PUC-RJ (adaptada) – Considere as afirmações rela- Considerando as fases apresentadas, descreva o que
tivas à mitose: acontece na fase S da interfase.
IV. O núcleo começa a desaparecer na prófase.
Durante a fase S, ocorre a duplicação do DNA, ou seja, um cromossomo
I. Os núcleos-filhos são geneticamente idênticos ao
núcleo da célula-mãe.
passa a ter duas cromátides-irmãs, dobrando o número de moléculas
II. As cromátides-irmãs separam-se no início da aná-
fase.
de DNA na célula.
III. Os cromossomos duplicam-se na fase G2 do ciclo
celular.
IV. Um único núcleo dá origem a dois núcleos-filhos
idênticos.
Estão corretas: 4. Fuvest-SP – Células de embrião de drosófila (2n=8)
que estavam em divisão foram tratadas com uma subs-
a) apenas I, II, IV e V.
tância que inibe a formação do fuso, impedindo que a
b) apenas I, II, III e V. divisão celular prossiga. Após esse tratamento, quantos
c) apenas II, III, IV e V. cromossomos e quantas cromátides, respectivamente,
d) apenas I, II e V cada célula terá?
e) todas as afirmações. a) 4 e 4
A afirmativa IV está incorreta porque os cromossomos são duplicados b) 4 e 8
na fase S do ciclo celular. c) 8 e 8
d) 8 e 16
2. PUC-RS – Uma diferença importante entre animais e e) 16 e 16
vegetais é o crescimento corporal; ao contrário dos Como a célula é 2n=8, isso quer dizer que ela tem oito cromossomos
animais, as plantas crescem ao longo de toda a vida. O e que, após a divisão celular, as cromátides de todos os cromossomos
crescimento indeterminado dos vegetais se dá graças foram duplicadas, porém não foram separadas devido ao tratamento
aos tecidos embrionários perenes, denominados me- com a substância que inibe a formação do fuso. Sendo assim, cada
célula terá oito cromossomos com duas cromátides cada um, ou seja,
ristemas. Os processos celulares fundamentais para a haverá 16 cromátides.
atividade desse crescimento são a mitose e a diferen-
ciação celular, responsáveis, respectivamente, pelo(a)
_______ e pelo(a) ___________. 5. UFU-MG – O gráfico a seguir mostra variações da quan-
a) proliferação – seleção do número de células nos tidade de DNA por núcleo durante o ciclo celular de
tecidos. uma célula animal.
b) redução do número de cromossomos – proliferação
celular.
T3
c) seleção do número de células – atividade de cres- T2 T4
cimento celular. Concentração
de T1
d) variabilidade dos tipos celulares – aumento do nú- DNA / núcleo
mero de células.
e) aumento do número de células – especialização das
células dos diversos tecidos.
A mitose é responsável pelo aumento do número de células, uma vez Tempo
que, por meio desse processo, são originadas células com o mesmo
número cromossômico que a célula-mãe. Além disso, a diferenciação Em qual dos períodos encontramos o cromossomo
refere-se à especialização das células dos diversos tecidos. constituído por duas cromátides-irmãs, cada uma com
uma molécula de DNA, e a ocorrência da migração das
cromátides-irmãs para os polos da célula, respectiva-
3. Fuvest-SP (adaptada) – Na figura abaixo, está repre- mente?
sentado o ciclo celular. Na fase S ocorre síntese de a) T2 e T3
DNA, na fase M ocorre a mitose e dela resultam novas
células, indicadas pela letra C. b) T1 e T3
c) T3 e T4
C d) T1 e T4
C
A questão fala sobre divisão celular e as fases da interfase, que são:
G1, S e G2. As fases G1 e G2 são o intervalo de tempo e S é a síntese,
M ou seja, duplicação dos elementos. Na primeira fase (T1), a célula está
em descanso, conforme mostra a linha retilínea do gráfico. Na segunda
G2 Divisão fase (T2), os elementos na célula são duplicados (quando a reta sobe).

Material exclusivo para professores


Na terceira fase (T3), a célula entra em descanso novamente e, em
seguida, acontecem as fases da mitose (T4), dividindo os elementos
Mitose G1 (quando a linha cai). A questão pede que se encontre o período em
que o cromossomo tem duas cromátides-irmãs, ou seja, quando elas
já estão duplicadas, e o período em que há migração para os polos,
Interfase

conveniados ao Sistema de Ensino


ocorrendo a divisão celular. Encontramos, então, respectivamente, os
S períodos T3 e T4.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 242 14/12/18 12:44
81 – Material do Professor 243

6. Fuvest-SP (adaptada) – Considere os eventos abaixo:

BIOLOGIA 1A
I. Desintegração do envoltório nuclear. A ordem correta é I, IV, II, III. As afirmativas I e IV acontecem na prófase,
II. Formação da placa equatorial.
III. Cromossomos migram para os polos. a II ocorre na metáfase e a III ocorre na anáfase.
IV. Formação do fuso mitótico.
Com base em seus conhecimentos sobre o processo
de divisão celular, coloque as afirmativas em ordem e
cite em qual etapa elas acontecem.

EXERCÍCIOS PROPOSTOS
7. Unicentro-PR – Uma nova droga no tratamento contra Com base em seus conhecimentos sobre o assunto, cite
o câncer está sendo testada e atinge as células que es- em qual etapa da divisão a célula circulada se encontra
tão em divisão celular, mais especificamente no final da e explique os principais eventos que acontecem nela.
metáfase. Nessas células, a droga impedirá que ocorra a
a) condensação dos cromossomos.
b) separação das cromátides-irmãs.
c) formação do fuso mitótico.
d) formação da placa equatorial.
e) formação de fibras do fuso.

8. UFRGS-RS – Assinale com V (verdadeiro) ou F (falso) 11. IFSUL-RS (adaptada) – Todas as células vegetais e
as afirmações abaixo, referentes aos constituintes do animais apresentam um processo de reprodução cha-
núcleo celular. mado de mitose e outro processo chamado de meiose.
Esses processos diferenciam-se quanto ao tipo de célu-
( ) A carioteca é uma membrana lipoproteica dupla
presente durante a mitose. las envolvidas, tais como células epiteliais, musculares,
gametas etc. A afirmativa que relata corretamente o
( ) Os nucléolos são observados na interfase. processo que envolve a formação das células muscu-
( ) Os cromossomos condensados na fase inicial da lares é a que propõe que uma célula
mitose são constituídos por duas cromátides. a) diploide (2n) forma duas células haploides (n).
( ) Cromossomos homólogos são os que apresentam b) diploide (2n) forma duas células diploides (2n).
constituições diferentes.
c) haploide (n) forma duas células haploides (n).
A sequência correta de preenchimento dos parênteses,
d) haploide (n) forma duas células diploides (2n).
de cima para baixo, é:
a) V – V – F – V d) F – F – V – V 12. UERR-RR – As células em divisão passam por uma se-
b) V – F – V – F e) V – F – F – V quência regular de eventos, dentro de duas fases, cha-
c) F – V – V – F mada ciclo celular. Diante dessa afirmação, assinale a
alternativa correta que cita as duas fases do ciclo celular.
9. PUC-RS – Sobre o processo mitótico, é correto afirmar a) Interfase e mitose.
que b) Mitose e prófase.
a) ocorre apenas em células diploides. c) Interfase e cariotiose.
b) dá origem a gametas haploides. d) Mitose e telófase.
c) é utilizado como forma de reprodução assexuada por e) Interfase e leucinose.
alguns seres vivos.
d) constitui-se como um processo equacional seguido 13. Udesc-SC – A figura representa, de maneira resumida,
de uma fase reducional. as fases da interfase (G1, S e G2) e de divisão (M) do
e) é utilizado por seres vivos, como vegetais e fungos, ciclo de vida de uma célula, o chamado ciclo celular.
para geração de esporos haploides.
DIVISÃO INTERFASE

10. Sistema Dom Bosco – A figura a seguir representa


a lâmina da raiz de cebola, contendo algumas células M G1 S G2
em divisão celular.
BLICKWINKEL/ALAMY STOCK PHOTO

Em relação ao ciclo celular, assinale a alternativa correta.


a) M é a fase mais longa na maioria das células.

Material exclusivo para professores


b) Em M ocorre a duplicação dos cromossomos.
c) Em G2 ocorre verificação do processo de duplicação
do DNA.
d) Em S os cromossomos se apresentam altamente

conveniados ao Sistema de Ensino


compactados.
e) Em G1 inicia-se a compactação dos cromossomos.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 243 14/12/18 12:44
244 82 – Material do Professor

14. Sistema Dom Bosco de DNA das células indicadas pelos números 1, 2, 3 e
BIOLOGIA 1A

A divisão celular se trata da capacidade de uma célula se 4, é respectivamente:


dividir dando origem a outras células. Essa capacidade é a) N, 2N, N e N/2.
de suma importância para todos os organismos vivos. Por b) 2N, 4N, 2N E N.
exemplo, os organismos pluricelulares, como os humanos,
c) 2N, 4N, 4N e N.
contêm dezenas de milhões de células. Entretanto, esse
complexo organismo foi gerado a partir de uma única cé- d) 2N, 4N, 4N e 2N.
lula denominada célula ovo. Além disso, as divisões ce- e) 2N, 4N, 2N e 2N.
lulares são, também, as responsáveis pela regeneração de
diversos órgãos, como o fígado. 16. UEL-PR – Leia o texto a seguir:
Disponível em: <https://www.infoescola.com/citologia/divisao- Quando se fala em divisão celular, não valem as regras mate-
celular/>. máticas: para uma célula dividir significa duplicar. A célula se
divide ao meio, mas antes duplica o programa genético loca-
Com base nessas informações e em seus conhecimen- lizado em seus cromossomos. Isso permite que cada uma das
tos sobre o assunto, explique a importância da mitose
células-filhas reconstitua tudo o que foi dividido no processo.
para os seres assexuados.
Fonte: AMABIS, J. M.; MARTHO, G. R. Biologia. v. 1. São Paulo:
Moderna, 1994. p. 203.
Considerando uma célula haploide com 8 cromos-
somos (n = 8), assinale a alternativa que apresenta,
corretamente, a constituição cromossômica dessa cé-
lula em divisão na fase de metáfase da mitose.
a) 8 cromossomos distintos, cada um com 1 cromátide.
b) 8 cromossomos distintos, cada um com 2 cromátides.
15. Fuvest-SP (adaptada) – A sequência de fotografias
abaixo mostra uma célula em interfase e outras em c) 8 cromossomos pareados 2 a 2 e cada um com 1
cromátide.
etapas da mitose, até a formação de novas células.
d) 8 cromossomos pareados 2 a 2 cada um com duas
cromátides.
SCIENCE PHOTO LIBRARY/FOTOARENA

e) 8 cromossomos pareados 4 e 4 cada um com 2


cromátides.

17. Sistema Dom Bosco – Para que a célula consiga se


reproduzir, é necessário que haja a formação do fuso
1 2 mitótico em uma das etapas da mitose. Cite em qual
etapa ocorre este evento e explique o que ele é.
4

Considerando que o conjunto haploide de cromosso-


mos corresponde à quantidade N de DNA, a quantidade

ESTUDO PARA O ENEM


18. Enem (adaptada) C5-H17 Qual número corresponde à melhor etapa para que esse
Para estudar os cromossomos, é preciso observá-los estudo seja possível?
no momento em que se encontram no ponto máximo a) 1 b) 2 c) 3 d) 4 e) 5
de sua condensação. A imagem corresponde ao tecido
da raiz de cebola, visto ao microscópio, e cada número 19. Sistema Dom Bosco C5-H17
marca uma das diferentes etapas do ciclo celular. A fi gura a seguir se refere à microscopia de luz de
SCIENCE PHOTO LIBRARY/FOTOARENA

células do peixe branco (Coregonus sp.), apresentando


uma determinada etapa de divisão celular.
1
ABBEY MICHAEL/GETTY IMAGES

Material exclusivo para professores 5


4

conveniados ao Sistema de Ensino


Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 244 14/12/18 12:44
83 – Material do Professor 245

Marque a alternativa que corresponda à fase na qual a interface lateral e adjacente dos protofilamentos, no inte-

BIOLOGIA 1A
célula apontada pela seta se encontra. rior do lúmen do microtúbulo. Por fim, o sítio da colchi-
a) Prófase cina está localizado na parte intradimer interface entre
b-tubulina e b-tubulina.
b) Metáfase
Disponível em: <https://www.portaleducacao.com.br/conteudo/
c) Telófase artigos/farmacia/medicamentos-antimitoticos-com-atuacao-no-
d) Prometáfase sitio-de-ligacao-colchicina/57761>.
e) Anáfase Sabendo que essas substâncias atuam diretamente se
ligando às tubulinas, assinale a alternativa correta de
20. Sistema Dom Bosco C5-H17 qual etapa da divisão celular elas bloqueiam.
Na atualidade, existem três tipos de ligação de drogas
a) Prófase
bem determinadas nos sítios na b-tubulina: o domínio
da vinca, o local e o taxano, e o sítio de colchicina. O b) Anáfase
domínio da vinca está localizado de forma adjacente ao c) Metáfase
sítio de troca GTP obrigatório em b-tubulina. O sítio d) Citocinese
do taxano está localizado na parte hidrofóbica, entre a e) Telófase

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 245 14/12/18 12:44
17
246 84 – Material do Professor

24
BIOLOGIA 1A

DIVISÃO CELULAR: MEIOSE

Desde a origem dos primeiros seres vivos até os primeiros 2 bilhões de anos
de vida da Terra, todas as células existentes eram clones umas das outras, já que a
• Fases da meiose e sua única reprodução existente era assexuada.
importância Há aproximadamente 1,5 bilhão de anos, surgiu uma nova possibilidade de re-
• Variação da quantidade de produção, capaz de gerar seres geneticamente diferentes entre si: a reprodução
DNA na meiose sexuada. Isso foi possível graças à divisão celular denominada meiose, em que a
• Meiose × mitose variabilidade genética cria novos rearranjos no DNA, possibilitando o aparecimento
de novas características.
HABILIDADES

RAWPIXEL.COM/ISHUTTERSTOCK
• Descrever a importância da
meiose para os organismos.
• Citar e explicar as etapas
da meiose.
• Compreender a variação do
número de cromossomos
ao longo da meiose.
• Explicar as principais
diferenças entre mitose e
meiose.
• Explicar as principais
diferenças entre meiose I e
meiose II.

A diversidade de características entre as pessoas é resultado da meiose.

FASES DA MEIOSE E SUA IMPORTÂNCIA

Material exclusivo para professores


Assim como ocorre na mitose, a meiose é precedida pela interfase, contemplando
as fases G1, S e G2. Em geral, é composta de dois processos distintos: meiose I
e meiose II.
Cada uma delas é um tipo de divisão celular. Ao final da meiose I, o número de

conveniados ao Sistema de Ensino


cromossomos por célula é reduzido à metade e, por isso, diz-se que se trata de
uma divisão reducional. Em outras palavras, uma célula diploide (2n) produz duas
células haploides (n).

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 246 14/12/18 12:44
85 – Material do Professor 247

Ao final da meiose II, o número de cromossomos

BLACKJACK3D/ISTOCKPHOTO.COM
por célula é igual, sendo chamada de divisão equa-

BIOLOGIA 1A
cional, como na mitose. Ou seja, cada uma das duas
células haploides (n) originadas na primeira divisão
produzem outras duas iguais, totalizando quatro cé-
lulas haploides (n) ao final do processo. Embora a
meiose II seja muito semelhante à mitose, apresenta
características diferentes: o número de cromosso-
mos já foi reduzido à metade na meiose I, e a célula
não começa o processo com o mesmo número de
cromossomos.

prófase I metáfase I anáfase I

meiose I
(2n)

telófase I Os gametas masculinos e femininos são formados na meiose.

MEIOSE I
A meiose I é constituída por cinco estágios seme-
lhantes ao da mitose – prófase I, metáfase I, anáfase I,
telófase I e citocinese –, com algumas diferenças que
serão discutidas ao longo deste módulo.
prófase II
Prófase I
A prófase I é um estágio longo, dividido em cinco
subestágios: leptoteno, zigoteno, paquiteno, diploteno
e diacinese.
metáfase II
meiose II
(n) leptoteno zigoteno paquiteno diploteno diacinese

quiasmas
anáfase II
Etapas da prófase I. Elementos representados fora da escala de
tamanho. Cores fantasia.

No leptoteno, os cromossomos contraem-se, tor-


nando-se visíveis. No zigoteno, a condensação dos
telófase II
cromossomos continua e os homólogos formam pares,
ficando uns bem próximos aos outros – sinapse.
No paquiteno, os cromossomos tornam-se mais
curtos e grossos, desenvolvendo-se o complexo si-
A meiose ocorre em duas fases: meiose I e meiose II. Elementos naptonêmico entre os homólogos. Nesse momento,
representados fora da escala de tamanho. Cores fantasia.
ocorre o crossing-over, isto é, os cromossomos ho-
mólogos trocam informações genéticas entre si. Esse
Vale destacar que, além de produzir variabilidade é o processo que promove a variabilidade genética, de
genética, a meiose é de grande relevância para os maneira que os gametas produzidos ao final da meio-
seres vivos, pois é por meio desse processo que são se são completamente diferentes uns dos outros. A

Material exclusivo para professores


formadas as células reprodutivas (gametas) localiza- seleção natural ainda atua sob os organismos gerados,
das nas gônadas de animais ou plantas de reprodução possibilitando àqueles que tiverem características mais
sexuada. Esses gametas unem-se para formar um zi- vantajosas para o ambiente em que vivem sobreviver
goto, originando novos indivíduos com carga genética por mais tempo, deixando descendentes com as mes-

conveniados ao Sistema de Ensino


diferente da dos progenitores. mas características que as suas.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 247 14/12/18 12:44
248 86 – Material do Professor

No diploteno, os centrômeros dos cromossomos


BIOLOGIA 1A

homólogos separam-se, mas permanecem ligados pe-


los quiasmas, que são resultados do crossing-over. Na
diacinese, os cromossomos continuam se condensan-
do e os quiasmas se movem para as pontas deles à
medida que se separam.

Célula em anáfase I. Elementos representados fora da escala de


tamanho. Cores fantasia.

Telófase I e citocinese (ou intercinese)




Na telófase I, os cromossomos chegam aos polos




do fuso e o citoplasma divide-se. Na citocinese (ou


quiasmas
intercinese), a membrana nuclear reconstitui-se ao
redor dos cromossomos que se encontram agrupados
Célula em prófase I. Elementos representados fora da escala de em cada polo do fuso, o fuso se desfaz e os cromosso-
tamanho. Cores fantasia.
mos se descondensam. Esse período corresponde ao
período intermediário entre a meiose I e a meiose II.
Metáfase I
Esse estágio inicia-se quando os cromossomos
homólogos se encontram alinhados na placa metafá-
sica e continuam unidos pelos quiasmas (formados
na prófase I).

Célula em telófase I. Elementos representados fora da escala de


tamanho. Cores fantasia.

MEIOSE II
A meiose II é similar à mitose, contendo as mesmas
fases: prófase II, metáfase II, anáfase II, telófase II
e citocinese.

Prófase II

Material exclusivo para professores


Célula em metáfase I. Elementos representados fora da escala de
tamanho. Cores fantasia.
Nesse estágio, os cromossomos se recondensam,
o envoltório nuclear se desfaz novamente e o fuso é
Anáfase I reconstituído. Em algumas células, os cromossomos

conveniados ao Sistema de Ensino


Nesse estágio, os cromossomos homólogos continuam condensados e o fuso não é desintegra-
separam-se, embora as cromátides irmãs perma- do, de forma que elas já passam diretamente para
neçam juntas. a metáfase II.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 248 14/12/18 12:44
87 – Material do Professor 249

BIOLOGIA 1A
Células em prófase II. Elementos representados fora da escala de
tamanho. Cores fantasia.

Metáfase II
Essa fase é semelhante à mitose, pois os cromos-
somos individuais se alinham na placa metafásica, com
Células em telófase II. Elementos representados fora da escala de
as cromátides irmãs voltadas para os polos do fuso. tamanho. Cores fantasia.

As principais diferenças entre mitose, meiose I e


meiose II estão resumidas no quadro a seguir.

Evento Mitose Meiose I Meiose II

Ocorre Não Sim Não


crossing-over?

Células em metáfase II. Elementos representados fora da escala de


O que se separa Cromátides Pares de Cromátides
tamanho. Cores fantasia. na anáfase? irmãs cromossomos irmãs
homólogos

Anáfase II O que se Cromossomos Pares de Cromossomos


Nesse estágio, os cinetócoros das cromátides irmãs alinha na placa individuais cromossomos individuais
separam-se, sendo levadas para polos opostos. Assim, metafásica?
cada cromátide é um cromossomo distinto.
Ocorre divisão Sim Sim Sim
celular?

Os homólogos Não Sim Não


formam pares?

Há variabilidade Não Sim Não


genética?

Células em anáfase II. Elementos representados fora da escala de VARIAÇÃO DA QUANTIDADE


DE DNA NA MEIOSE
tamanho. Cores fantasia.

Na meiose, também há variação na quantidade de


Telófase II e citocinese DNA no núcleo em dois momentos: durante a sepa-

Material exclusivo para professores


Nesse estágio, os cromossomos chegam aos po-
los do fuso e descondensam-se, a membrana nuclear
é reconstituída ao redor dos cromossomos e o fuso
ração dos cromossomos homólogos (anáfase I) e na
separação das cromátides irmãs (anáfase II). Se, por
exemplo, uma célula tiver oito cromossomos (2n = 8),

conveniados ao Sistema de Ensino


desintegra-se. Na citocinese, a membrana citoplas- na anáfase I ela terá oito cromossomos e 16 cromáti-
mática é reconstituída, originando duas novas células des irmãs e, na anáfase II, quatro cromossomos e oito
cada uma (total de quatro células). cromátides irmãs.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 249 14/12/18 12:44
250 88 – Material do Professor

Variação do DNA nas fases da meiose.


BIOLOGIA 1A

interfase meiose I meiose II


G2 PI MI
4Q

S AI

G1 TI PII MII
2Q

2n n
AII

TII
Q
n

0
tempo

MEIOSE × MITOSE
Tanto a mitose como a meiose se referem a processos de divisão celular e,
embora até os nomes sejam semelhantes, os resultados de ambas são bem
diferentes. A tabela abaixo apresenta o comparativo detalhado das diferenças
entre esses processos.

Resumo das diferenças gerais entre mitose e meiose

Mitose Meiose

Número de divisão nuclear 1 2

Número de cromossomos das Metade dos cromossomos quando


Igual ao da célula-mãe
células-filhas comparada à célula-mãe

Tipo de divisão Equacional (E!) Reducional (R!) + Equacional (E!)

Número final de células-filhas


2 células 4 células
de uma célula parental

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 250 14/12/18 12:44
89 – Material do Professor 251

ROTEIRO DE AULA

BIOLOGIA 1A
MEIOSE

1 célula diploide (2n) gera: 2 células haploides (n) Tipo de divisão: Reducional (R!)

Importância Variabilidade genética Formação de gametas

Etapas

Interfase

Meiose I Crossing-over

Prófase I Leptoteno Zigoteno Paquiteno Diploteno Diacinese

Metáfase I Cromossomos homólogos alinhados na placa equatorial.

Anáfase I Cromossomos homólogos separam-se em direção aos polos opostos.

Telófase II
Cromossomos homólogos chegam aos polos.

Citocinese Citoplasma divide-se, originando duas células.

Meiose II

Prófase II Cromossomos condensados, formação do fuso, núcleo desfeito.

Metáfase II Cromossomos alinhados na placa equatorial.

Anáfase II
Cromátides irmãs separam-se em direção a polos opostos.

Material exclusivo para professores


Telófase II Cromátides irmãs chegam aos polos.

conveniados ao Sistema de Ensino


Citocinese
Citoplasma divide-se, originando duas células (total = 4).

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 251 14/12/18 12:44
252 90 – Material do Professor

EXERCÍCIOS DE APLICAÇÃO
BIOLOGIA 1A

1. Ifsul-RS – Todas as células vegetais e animais apresentam


um processo de reprodução chamado mitose e outro pro-
cesso de reprodução chamado meiose. Esses processos
diferenciam-se quanto ao tipo de células envolvidas, tais
como células epiteliais, musculares, gametas etc.
A afirmativa que relata corretamente o processo que
envolve a formação das últimas células referidas acima 4. UFPA-PA – O gráfico a seguir representa variações na
é a que propõe que uma célula: quantidade de DNA ao longo do ciclo de vida de uma
a) diploide (2n) forma duas células haploides (n). célula (X = unidade arbitrária de DNA por célula).
b) haploide (2n) forma quatro células haploides (n). Quantidade
c) diploide (2n) forma quatro células haploides (n). de DNA
3
d) haploide (2n) forma duas células haploides (n). 4X
Células diploides formam ao final quatro células haploides na meiose. 2 4
2X 1 5
2. Famerp-SP – A figura representa uma célula em uma 6
7
das fases de certa divisão celular: X

Tempo

Sobre esse ciclo vital de uma célula, representado no


gráfico a seguir, é correto afirmar:
a) A interfase está representada pela fase 3.
b) As fases 1, 2 e 3 representam os períodos G1, S e
G2, que resumem todo o ciclo vital de uma célula.
c) As fases 1, 2 e 3 representam o período em que a
célula se encontra em interfase, e as fases 4, 5, 6
e 7, subsequentes, são características da célula em
divisão mitótica, quando, ao final, ocorre redução à
metade da quantidade de DNA na célula.
Supondo que essa divisão celular se concretize, geran- d) A célula representada é diploide: seu DNA foi duplica-
do células-filhas, pode-se afirmar que do no período S da interfase (fase 2) e, posteriormen-
a) serão originadas quatro células-filhas geneticamente te, passou pelas duas fases da meiose, originando
idênticas. células-filhas com metade da quantidade de DNA
b) cada célula-filha terá quatro cromossomos diferentes. (fase 7, células haploides).
c) cada célula-filha terá dois cromossomos diferentes. e) A fase 3 é caracterizada por um período em que não
há variação na quantidade de DNA na célula, portanto
d) serão originadas duas células-filhas geneticamente essa fase representa uma célula durante os períodos
idênticas. da mitose: prófase, metáfase e anáfase.
e) a divisão ocorreu em uma célula somática, originando A alternativa A está incorreta porque a interfase refere-se às fases 1, 2 e
duas células-filhas idênticas. ao início da 3. A alternativa B está incorreta porque o ciclo vital da célula
A meiose é reducional, portanto, uma célula diploide 2n = 4 poderá resume-se a todo o processo, incluindo a divisão celular. A alternativa C
formar quatro células com dois cromossomos. está incorreta porque se refere ao processo de meiose. A alternativa E
está incorreta porque se refere à fase G2, prófase e metáfase da meiose I.
3. Unicamp-SP (adaptada) – Considerando o esquema a
seguir como uma representação simplificada da meiose, 5. Mackenzie-SP (adaptada) – Em uma célula em metá-
indique quais células são haploides e quais são diploides. fase II, é possível observar
a) cromossomos c) cromátides irmãs.
A homólogos. d) envoltório nuclear.
b) quiasmas. e) tétrades.
Durante a metáfase II, as cromátides irmãs encontram-se alinhadas
B C na placa equatorial.
6. Sistema Dom Bosco – A divisão celular é um processo
no qual uma célula se divide, formando duas células idên-
D E ticas (no caso da mitose) ou quatro células diferentes (no
caso da meiose), com toda a informação genética relativa
à espécie. Com base nisso e em seus conhecimentos,
explique a importância da meiose para os seres vivos.
F G H I A meiose possibilita a existência de variabilidade genética em razão do

Material exclusivo para professores


Apenas a célula A é diploide. As outras são haploides (B, C, D, E, F,

G, H e I).
crossing-over presente na prófase I da meiose I. Além disso, é nesse

processo que se formam as células reprodutivas (gametas) localizadas

conveniados ao Sistema de Ensino


nas gônadas de animais ou plantas de reprodução sexuada, as quais

se unem para formar um novo indivíduo.

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 252 14/12/18 12:44
91 – Material do Professor 253

EXERCÍCIOS PROPOSTOS

BIOLOGIA 1A
7. PUC-RJ – O gato doméstico (Felis domesticus) tem 36 pa- c) Na diacinese, as cromátides permanecem no centro
res de cromossomos em suas células somáticas. Sabendo celular, a carioteca se refaz, os núcleos reaparecem
disso, o número de cromossomos nos espermatozoides e os centríolos atingem os polos celulares.
maduros do gato, o número de cromátides irmãs existen- d) A prófase I é uma fase curta em que os centríolos que
tes em uma célula que está entrando na primeira divisão não sofreram duplicação na interfase permanecem
meiótica e o número de cromátides irmãs que estão en- no centro celular e a carioteca se desintegra ao final.
trando na segunda divisão meiótica são, respectivamente: e) No leptoteno, o emparelhamento dos cromossomos
a) 18, 72 e 36. d) 36, 72 e 72. é chamado de sinapse cromossômica.
b) 72, 144 e 144. e) 36, 144 e 72.
12. Unitins-TO – A mitose e a meiose são dois tipos de
c) 18, 36 e 72.
divisão celular. Em relação a esses processos, podemos
afirmar que:
8. Sistema Dom Bosco – A meiose é um processo fun-
damental à propagação da vida no planeta. Essa divisão I. A meiose resulta em quatro células haploides.
é encontrada nos seres vivos no(a) II. A mitose resulta em duas células com o mesmo
a) formação de gametas apenas. número de cromossomos da célula original.
b) formação de esporos apenas. III. O processo de meiose tem um número de fases
maior do que a mitose.
c) formação de gametas e formação de esporos.
IV. A mitose ocorre em células somáticas e a meiose,
d) zigoto e formação de gametas. em células reprodutivas.
e) zigoto, formação de gametas e formação de esporos. V. O número de cromossomos das células resultantes
na mitose é igual ao das células que lhes deram
9. Uece – Considere os eventos abaixo, que podem ocor- origem e somente as que sofreram meiose podem
rer na mitose ou na meiose. apresentar recombinação gênica.
I. Emparelhamento dos cromossomos homólogos Está(ão) correta(s) a(s) afirmativa(s):
duplicados.
II. Alinhamento dos cromossomos no plano equato- a) I, II, III, IV e V. d) III, IV e V apenas.
rial da célula. b) I, II e V apenas. e) IV apenas.
III. Permutação de segmentos entre cromossomos c) II e III apenas.
homólogos.
IV. Divisão dos centrômeros, resultando na separação 13. Uepa – O crescimento populacional humano é pro-
das cromátides irmãs. duto da reprodução sem controle, que agrava os pro-
blemas de superpopulação mundial. Por outro lado, a
No processo de multiplicação celular para reparação de reprodução nos organismos unicelulares ocorre por
tecidos, os eventos relacionados à distribuição equita- divisão celular, enquanto nos organismos multicelu-
tiva do material genético entre as células resultantes lares esse processo é responsável pelo crescimento
estão contidos somente em: e reparo de tecidos.
a) I e III. c) II e III. Sobre o processo em destaque, analise as afirmativas
b) II e IV. d) I e IV. abaixo.
I. A prófase I da meiose I possui cinco subfa-
10. Sistema Dom Bosco – Tanto a mitose quanto a meiose
ses: leptoteno, zigoteno, paquiteno, diploteno
são processos de divisão celular. Embora até os nomes e diacinese.
sejam semelhantes, existem algumas diferenças entre
esses dois processos. Explique-as. II. Na telófase, os cromossomos começam a se deses-
piralizar e adquirem a forma de fita.
III. Na anáfase, ocorre a separação das cromátides.
IV. Na meiose I, a metáfase I caracteriza-se pelo ali-
nhamento dos pares homólogos na placa equa-
torial.
V. O produto da meiose são quatro células haploides.
A alternativa que contém todas as afirmativas corretas é:
a) I, II e IV. d) III, IV e V.
b) I, III e V. e) I, II, III, IV e V.
c) II, III e V.

14. Sistema Dom Bosco – A divisão celular consiste em


11. PUC-PR – Sobre a divisão celular, considerando a pró- produzir novas células que contenham toda a informa-

Material exclusivo para professores


fase I da meiose I, é correto afirmar que: ção genética de uma determinada espécie. No caso
a) A característica mais marcante do diploteno é que da meiose, são produzidas quatro células completa-
os cromossomos ainda emparelhados se cruzam em mente diferentes em razão da ocorrência do crossing-
certos pontos chamados quiasmas. -over, além disso, as células-filhas contêm metade do

conveniados ao Sistema de Ensino


b) No paquiteno ocorre o afastamento dos cromosso- material genético presente na célula materna. Para que
mos homólogos e os cromômeros são bem visíveis, elas sejam originadas, a célula materna passa por dois
formando as cromátides irmãs. estágios diferentes, denominados meiose I e meiose II,

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 253 14/12/18 12:44
254 92 – Material do Professor

respectivamente. Explique as principais diferenças en- 16. PUC-MG – As figuras representam três diferentes fases
BIOLOGIA 1A

tre esses estágios. ou etapas (A, B e C) de possíveis divisões celulares.

A B C

É incorreto afirmar que:


a) C, A e B não podem ocorrer como fases da mesma
meiose.
15. Uern (adaptada) – O organismo humano é formado por b) A célula inicial meiótica possui 2n = 4.
dois tipos de células: as diploides ou somáticas, conhe- c) As fi guras A e B podem ocorrer tanto na mitose
cidas por formarem todas as células do corpo humano, como na meiose.
e as haploides ou gametas, que são células sexuais d) A permutação gênica pode ocorrer em C.
e apresentam metade do número de cromossomos.
A maioria dessas células está sempre se renovando, 17. Uerj (adaptada) – Considere um animal que possui 8
gerando novas células pelos processos de mitose e cromossomos em suas células diploides. Nos esque-
meiose. O esquema a seguir representa as fases da mas A e B, estão representadas duas células desse
reprodução celular. animal em processo de divisão celular.
A B

1 2 3 4

Observe as figuras e analise as afirmativas a seguir.


I. A anáfase I da meiose e a telófase da mitose estão
representadas pelas figuras 4 e 2, respectivamente. Com base nos esquemas, cite as respectivas etapas
II. As figuras 2 e 3 representam a telófase I da meiose da divisão celular apresentadas.
e a metáfase da mitose.
III. Durante a fase representada pela figura 2, ocorre o
desaparecimento do envoltório nuclear, e o material
do núcleo mistura-se ao citoplasma.
IV. A figura 3 corresponde à metáfase I da meiose, em
que os cromossomos se alinham na região equa-
torial da célula.
V. Durante a fase da figura 1, em que os cromossomos
se tornam mais curtos e mais espessos, o processo
é chamado condensação.
Estão corretas apenas as afirmativas:
a) I, II e IV. c) I, IV e V.
b) II, III e V. d) II, III e IV.

ESTUDO PARA O ENEM


18. Enem C5-H17 De acordo com a ação antitumoral descrita, que função
O paclitaxel é um triterpeno poli-hidroxilado que foi celular é diretamente afetada pelo paclitaxel?
originalmente isolado da casca de Taxus brevifolia, ár- a) Divisão celular.
vore de crescimento lento e em risco de extinção, mas
b) Transporte passivo.

Material exclusivo para professores


agora é obtido por rota química semissintética. Esse
fármaco é utilizado como agente quimioterápico no c) Equilíbrio osmótico.
tratamento de tumores de ovário, mama e pulmão. Seu d) Geração de energia.
mecanismo de ação antitumoral envolve sua ligação à e) Síntese de proteínas.

conveniados ao Sistema de Ensino


tubulina, interferindo com a função dos microtúbulos.
Disponível em: <www.teses.usp.br>.
Acesso em: 29 fev. 2012. (Adaptado)

Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 254 14/12/18 12:44
93 – Material do Professor 255

19. Sistema Dom Bosco C5-H17 20. Sistema Dom Bosco C5-H17

BIOLOGIA 1A
A maioria das pessoas, quando anuncia um nascimento, O Brasil possui um grande número de espécies distintas,
menciona o sexo do bebê, porém não sente a necessidade entre animais, vegetais e microrganismos, envoltas em
de especificar a espécie. Isso porque uma das característi- uma imensa complexidade e distribuídas em uma grande
cas da vida é a habilidade dos organismos de reproduzir variedade de ecossistemas.
a própria espécie – elefantes geram elefantes e humanos SANDES, A. R. R.; BLASI, G. Biodiversidade e diversidade química e
geram humanos. A reprodução das espécies está intima- genética. Disponível em: <http://novastecnologias.com.br>.
mente relacionada às divisões celulares. Acesso em: 22 set. 2015. (Adaptado)
CAMPBELL, N. A. Biologia. 8. ed. Porto Alegre: Artmed, 2010.
O incremento da variabilidade ocorre em razão da per-
Sobre a divisão celular denominada meiose, é correto muta genética, a qual propicia a troca de segmentos
afirmar que entre cromátides não irmãs na meiose.
a) produz duas células idênticas. Essa troca de segmentos é determinante na:
b) produz quatro células idênticas.
a) produção de indivíduos mais férteis.
c) produz quatro células diferentes por conta do
b) transmissão de novas características adquiridas.
crossing-over, originando a variabilidade genética.
d) as células sofrem mutações que originam a variabi- c) recombinação genética na formação dos gametas.
lidade genética. d) ocorrência de mutações somáticas nos descendentes.
e) produz todas as células presentes nos órgãos e) variação do número de cromossomos característico
e tecidos. da espécie.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 255 14/12/18 12:44
Material exclusivo para professores
conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1A_M17_24.indd 256 14/12/18 12:44
K PHOTO
Y STOC
/ ALAM
IMAGES
BLEND

BIOLOGIA 1B

Material exclusivo para professores


conveniados ao Sistema de Ensino
CIÊNCIAS DA NATUREZA E SUAS TECNOLOGIAS

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 169 14/12/18 12:48
170 96 – Material do Professor

25
REPRODUÇÃO ASSEXUADA,
BIOLOGIA 1B

SEXUADA E CICLOS
HAPLOBIONTES

As algas do gênero Spyrogira são capazes de se reproduzir de uma maneira


curiosa. Com o auxílio do microscópio óptico, é possível identificar na célula dessas
• Reprodução assexuada algas uma estrutura que aparenta ser um espinho, chamado tubo de conjugação,
• Reprodução sexuada que é usado para furar a célula da alga vizinha. Ao analisar o processo mais a fundo,
• Ciclos de vida pode-se observar que essa estrutura é, na verdade, usada para transferir o material
genético, caracterizando uma nova forma de reprodução sexuada.
HABILIDADES Consequentemente, indivíduos dessa espécie apresentam variações genéticas
• Citar e descrever os tipos pelo fato de receberem um pedaço de DNA diferente da alga vizinha e, depois,
de reprodução assexuada. passarem outros pedaços de DNA a outros indivíduos.
Acredita-se que esse modelo de reprodução explique a origem da reprodução
• Reconhecer organismos
capazes de realizar repro- sexuada por meio de genes parasitas introduzidos em outros organismos, tornando-
dução assexuada. -os diversificados geneticamente e, assim, aumentando a chance de sobrevivência
em determinados ambientes.
• Compreender a importância
da reprodução sexuada.

M I WALKER/GETTY IMAGES
• Citar e descrever os ciclos
haplontes.
• Reconhecer organismos
capazes de realizar ciclos
haplontes.
• Relacionar mitose com
reprodução assexuada.
• Relacionar meiose com
reprodução sexuada.

Algas do gênero Spyrogira trocando material genético entre si. Aumento de 150x.

Material exclusivo para professores REPRODUÇÃO ASSEXUADA


Reprodução assexuada é o processo no qual um organismo produz outros dois
organismos geneticamente idênticos a ele. Em termos de nível celular, podemos dizer

conveniados ao Sistema de Ensino


que é o método pelo qual uma célula se multiplica por mitose. Há diversas formas
de reprodução assexuada, entre as quais se destacam: a fissão (divisão) binária, a
esporulação e o brotamento.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 170 14/12/18 12:48
97 – Material do Professor 171

Fissão binária em planária

BIOLOGIA 1B
2n n

2n 2n n n

Na reprodução assexuada, uma célula origina duas novas células com


o mesmo número cromossômico que ela mesma, sendo, portanto,
todas geneticamente iguais.

FISSÃO BINÁRIA
É um processo também conhecido como cissipa-
ridade, bipartição ou divisão binária, em que um orga- Fissão binária, seguida de regeneração, em planárias. Elementos
nismo-mãe, geralmente unicelular, origina dois organis- representados fora da escala de tamanho. Cores fantasia.
mos geneticamente idênticos, ou seja, com o mesmo
material genético que o seu. Organismos unicelulares, É importante salientar que, apesar de ser essen-
como bactérias, algumas algas e alguns protozoários, cialmente um processo que gera clones do organismo-
são capazes de realizar esse tipo de reprodução. Além -mãe, na fissão binária ainda é possível ocorrer varia-
desses organismos, podemos observar a ocorrência ções genéticas entre os indivíduos, ou entre eles em
de fissão binária em organismos pluricelulares, como relação ao original. Isso porque existe a possibilidade
a planária, um platelminto. de haver mutações, por exemplo, durante o processo
de duplicação do DNA, podendo gerar variabilidade en-
ED RESCHKE/GETTY IMAGES

tre os indivíduos nesse tipo de reprodução assexuada.

ESPORULAÇÃO
A esporulação, diferentemente das outras reprodu-
ções vistas até aqui, ocorre por meio da disseminação
de esporos, células especializadas que tendem a se
desenvolver em condições ambientais favoráveis, ge-
rando novos indivíduos. Esse tipo de reprodução ocorre
em fungos e algumas algas.
ALLA VASYLENKO/SHUTTERSTOCK

Paramecium, um protozoário unicelular em divisão binária, visto por meio


de microscopia óptica. Aumento de 100x.

Nas bactérias, assim como nas células dos orga-


nismos eucariontes, a fissão binária só ocorre após
o aumento da célula e a formação de um septo que Os pães mofados demonstram a presença de esporos fúngicos.
separa a progenitora da célula-filha. Nesses casos, o
DNA sofre duplicação para originar organismos viáveis. O termo esporulação também é utilizado para
Como citado anteriormente, as planárias, apesar de denominar o processo pelo qual bactérias produzem

Material exclusivo para professores


serem organismos pluricelulares, também são capazes esporos para resistir a condições ambientais desfa-
de realizar esse tipo de processo. No caso delas, não voráveis. Essas bactérias entram em uma espécie de
há uma preparação antes de a divisão ocorrer, de modo casulo de proteção, onde ficam em estado de latência
que elas sofrem constrição na região mediana do cor- até que o ambiente volte a ser favorável ao seu de-

conveniados ao Sistema de Ensino


po, separando cabeça de cauda. Em seguida, ocorre senvolvimento. No entanto, essa não é considerada
o desenvolvimento do restante do organismo em um uma forma de reprodução, mas sim de resistência às
processo chamado de regeneração. condições ambientais adversas.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 171 14/12/18 12:48
172 98 – Material do Professor

(A) Esquema do morango com


ALFRED PASIEKA/GETTY IMAGES

ELENA MASIUTKINA/ALA-
MY STOCK PHOTO
A estolho saindo do caule e formando
BIOLOGIA 1B

um novo indivíduo.

(B) Ilustração do fungo

KATERYNA KON/
SHUTTERSTOCK
B Saccharomyces cerevisiae. Nota-se
as áreas circulares de algumas
células, que são cicatrizes de gemas
no ponto em que as células-filhas
antigas se separaram na conclusão
da divisão celular. Elementos
representados fora da escala de
Em microscopia eletrônica de transmissão, é possível observar os
tamanho. Cores fantasia.
esporos da bactéria Clostridium tetani, causadora do tétano, altamente

ANDREY NEKRASOV /
ALAMY STOCK PHOTO
resistente a ambientes desfavoráveis. Aumento de 2 000x. (C) Poríferos, exemplo de animais
C capazes de se reproduzirem por
brotamento.
BROTAMENTO
Também chamado de gemiparidade, esse processo
consiste na formação de brotos geneticamente idên-
ticos ao genitor, que se separam do indivíduo-mãe e
formam novos indivíduos. O brotamento ocorre em
uma variedade de organismos, entre eles as plantas, FRAGMENTAÇÃO
como as angiospermas, bem como os animais, como Tipo de reprodução em que um ou mais pedaços do
os poríferos (esponjas) e os cnidários. indivíduo dão origem a um novo indivíduo. Diferente-
Esse tipo de reprodução é aproveitado na indústria mente do processo de fissão binária, há possibilidade
agrícola, em pesquisas e paisagismo, pois é utilizado de o indivíduo originar-se de múltiplos fragmentos.
principalmente em plantações de grande porte, com Além disso, esse tipo de reprodução assexuada envol-
a técnica de propagação denominada estaquia. Ela ve a capacidade elevada de regeneração de animais
é realizada depois do plantio de um ramo, galho ou com pouca diferenciação tecidual, como é o caso da
propriamente de um broto da planta, que, após enraizar- estrela-do-mar, que é o principal animal a realizar o
-se no solo, desenvolve-se como novo indivíduo. Esse processo regenerativo.
método é utilizado principalmente para jardins, reflo-
AQUAPIX/SHUTTERSTOCK

restamento, ornamentação etc. Nem todas as plantas


têm essa capacidade, mas aquelas que a possuem se
tornam valiosas, pois a estaquia garante a conservação
da qualidade da planta original e as plantas desenvol-
vem-se mais rapidamente.
SHAWEI26/SHUTTERSTOCK

Estrela-do-mar nodosa (Fromia nodosa).

Diferentemente do que se pode pensar, a planária,


apesar de sofrer regeneração, não é classificada como

Material exclusivo para professores


A pitanga (Eugenia uniflora) é uma planta que comumente é fragmentação em relação ao tipo de reprodução as-
submetida à estaquia, tanto nas plantações quanto nos quintais de
residências urbanas. sexuada, pois apenas as partes da cauda e da cabeça
podem originar novos indivíduos. É raro que outros
O morango, alguns tipos de samambaia e algumas fragmentos originem novo indivíduo no caso delas.

conveniados ao Sistema de Ensino


espécies de grama formam caules denominados esto- Além da estrela-do-mar, algumas cianobactérias e
lhos, que se ramificam e originam brotos que posterior- algas filamentosas realizam esse tipo de reprodução
mente se transformam em novos indivíduos. assexuada.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 172 14/12/18 12:48
99 – Material do Professor 173

REPRODUÇÃO SEXUADA

NIKOLAY_VORONIN/SHUTTERSTOCK

BIOLOGIA 1B
A reprodução sexuada acontece quando dois indi-
víduos diferentes combinam seus materiais genéti-
cos e originam um novo indivíduo com características
distintas. Esse tipo de reprodução proporciona varia-
bilidade genética das espécies por meio de trocas de
genes diferentes entre indivíduos; essa variabilidade
é gerada pela recombinação gênica de cromossomos
que acontece durante o crossing-over, na prófase I da
meiose, e na segregação independente, na anáfase I.
Produzir descendência diversa é uma vantagem
evolutiva muito grande, pois aumenta a chance de exis- Ovos fecundados de sapos.
tirem indivíduos capazes de sobreviver em diferentes
ambientes, adaptando-se a eles, em razão da grande Já a fecundação interna ocorre dentro do corpo de
diversidade de recombinações geradas, passando suas um dos progenitores, geralmente o feminino. Portanto,
características aos descendentes. para que essa fecundação ocorra, é necessário que haja
O ciclo de vida de organismos sexuados consiste inoculação interna dos gametas de um dos parentais,
numa série de alterações pelas quais eles passam. O geralmente o masculino. Esse processo denomina-se
ciclo inicia-se quando os gametas se encontram, dando cópula e, em muitas espécies, vem acompanhado de
origem a um zigoto, e termina quando o indivíduo de- rituais de acasalamento. Em comparação com a fecun-
senvolvido passa a produzir seus gametas. Portanto, há dação externa, suas vantagens são: menor perda ou
dois ciclos importantes que estão intimamente ligados morte dos gametas durante o processo e independên-
a esse processo: a fecundação e a meiose. cia do ambiente para que ocorra.
A fecundação basicamente refere-se à fusão

KATERYNA KON/SHUTTERSTOCK
dos gametas feminino e masculino, que são células
haploides (n) originando um indivíduo diploide (2n).
Como já estudado, a meiose origina quatro células
haploides (n) diferentes tendo como base uma única
célula diploide (2n).

Fecundação Meiose

Espermatozoides indo ao encontro do ovócito, a fim de realizar a


2n fecundação dentro do sistema reprodutor feminino. Elementos
n n representados fora da escala de tamanho. Cores fantasia.

Após a fecundação interna, o embrião ainda pode se


n n
desenvolver de formas diferentes. Portanto, os animais
2n
com fecundação interna podem ser divididos em três
classes, de acordo com o modo de desenvolvimento
n n n n
do embrião:
• ovíparos: após a fecundação, a fêmea bota um
ovo no ambiente, que contém o embrião que irá
Esquema simplificado da formação de gametas por meio da
fecundação e da meiose. se desenvolver dentro desse “receptáculo”, dis-
põe de nutrientes e fornece proteção ao indivíduo
que se desenvolve ali. Exemplos: aves em geral,
A fecundação externa consiste na junção dos game- crocodilos, jacarés, lagartos, entre outros.
tas haploides no ambiente externo. Um bom exemplo • vivíparos: o embrião desenvolve-se dentro do
é o que acontece com os anuros, como sapos, rãs e

Material exclusivo para professores


corpo materno, saindo apenas após estar desen-
pererecas: as fêmeas liberam os ovos, todos juntos, volvido o suficiente (cada animal dessa classifi-
e o macho, por sua vez, precisa liberar gametas sufi- cação tem um período específico de gestação).
cientes para fecundá-los. Todo o processo de geração e Exemplo: mamíferos em geral.

conveniados ao Sistema de Ensino


desenvolvimento do zigoto, e depois do girino, ocorre • ovovivíparos: após a fecundação, há formação
no ambiente aquático, que auxilia no deslocamento do ovo, porém ele permanece dentro do corpo
dos gametas masculinos até o feminino. dos progenitores. Exemplo: cavalo-marinho.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 173 14/12/18 12:48
174 100 – Material do Professor

CICLOS DE VIDA
BIOLOGIA 1B

Nos seres vivos, a meiose acontece em vários momentos da vida: logo após a
fecundação, sendo denominada meiose inicial ou zigótica, durante a formação
dos gametas (meiose gamética ou final) ou durante o ciclo de vida, tal como na
formação de esporos (meiose intermediária ou espórica). Os tipos de meiose
estão relacionados ao ciclo de vida dos organismos.
Os ciclos de vida podem ser haplobiontes, isto é, em todas as fases do ciclo
celular o número do conjunto cromossômico presente nas células (ploidia) do indi-
víduo permanece constante. O ciclo haplobionte ainda pode ser dividido em ciclo
haplobionte haplonte, se os organismos forem haploides, e haplobionte diplonte,
se os organismos forem diploides. O ciclo de vida também pode ser diplobionte,
no qual existem tanto organismos haploides quanto diploides.
Em geral, a meiose inicial está relacionada com o ciclo haplobionte haplonte,
a meiose gamética está relacionada com o ciclo de vida haplobionte diplonte e a
meiose espórica está relacionada com o ciclo de vida diplobionte. Neste módulo,
iniciaremos o estudo analisando o ciclo de vida haplobionte.

CICLO HAPLOBIONTE HAPLONTE


O ciclo haplobionte haplonte (ou apenas ciclo haplonte) ocorre na maioria dos
fungos, em alguns protozoários e em algumas algas.
No caso dos fungos, ocorre fusão de duas hifas haploides, originando hifas
dicarióticas – dois núcleos (n) separados, no mesmo local –, que se desenvolvem,
transformando-se em corpo frutífero (chapéu) ou basidiocarpo. Na parte inferior
dessa estrutura, existem hifas dicarióticas que se fundem, assim como os núcleos,
gerando um indivíduo diploide (2n), e sofrem meiose. A partir de então, são origi-
nados quatro núcleos haploides (n), que crescem e formam uma projeção chamada
basídio, responsável pela formação de esporos (basidioesporos), os quais germinam
e reiniciam o ciclo.

lamela (ampliação) meiose zigótica


fusão de núcleos
(fecundação) R!

liberação dos
basidiósporos
zigotos (2n) basidiósporos
(n)
corpo de
frutificação
(basidiocarpo)

hifas haploides germinação de


(n) basidiósporos

micélio
dicariótico

fusão de micélios
hifas dicarióticas compatíveis

fusão nuclear meiose formação de


(fecundação) R! basidiósporos

Material exclusivo para professores hifas dicarióticas zigoto (2n)


núcleos haploides
basídio

basidiósporos

conveniados ao Sistema de Ensino


(n) (n)

Ciclo reprodutivo haplobionte haplonte de fungos basidiomicetos. Elementos representados fora da escala de
tamanho. Cores fantasia.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 174 14/12/18 12:48
101 – Material do Professor 175

Nesse ciclo, o indivíduo adulto é haploide (n) e

GEORGE GRALL/GETTY IMAGES


gera gametas por meio da mitose. A fecundação

BIOLOGIA 1B
ocorre, originando um zigoto diploide (2n), e ele
passa por meiose, originando esporos haploides (n).
Pelo fato de a meiose ocorrer logo após a formação
do zigoto, ela é denominada meiose pós-zigótica. Phyllomedusa
bicolor
Esse ciclo é caracterizado por ter alternância de
reproduzindo-se
fases (n → 2n). sexuadamente
onde há
indivíduos haploides produção de
(n) gametas.

(n)

(n)

gametas Algumas
gameta (+) gameta (–)
algas também
fecundação realizam o ciclo
haplobionte
(n) zigoto (2n) diplonte.

mitose meiose
Nesse ciclo, o indivíduo adulto é diploide (2n)
pós-zigótica
e gera gametas haploides (n) por meio da meiose.
A fecundação origina um zigoto diploide (2n), que
indivíduo haploide (n)
se desenvolve por mitose até chegar à vida adulta.
Esquema que representa o ciclo haplobionte haplonte. Nesse ciclo, o
Como a meiose ocorre na formação dos gametas,
zigoto sofre meiose e desenvolve-se por mitose, produzindo gametas ela é denominada meiose gamética e apresenta
haploides que originarão um novo indivíduo. Elementos representados alternância de fases (n → 2n).
fora da escala de tamanho. Cores fantasia.

CICLO HAPLOBIONTE DIPLONTE


indivíduos haploides
O ciclo haplobionte diplonte, também chamado de (n)
ciclo diplonte, ocorre na maioria dos animais (incluindo
o ser humano) e em algumas algas.
DUTCH CITIES/ALAMY STOCK PHOTO

(n)

(n)

gametas
gameta (+) gameta (–)

fecundação

(n) zigoto (2n)

meiose mitose
gamética

indivíduo adulto
diploide (2n)
Esquema do ciclo haplobionte diplonte. O zigoto desenvolve-se por

Material exclusivo para professores


mitose, produzindo gametas haploides que originam um novo indivíduo.
Mamíferos como o lobo-guará (Chrysocyon brachyurus) apresentam ciclo Elementos representados fora da escala de tamanho. Cores fantasia.
haplobionte diplonte.

conveniados ao Sistema de Ensino


Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 175 14/12/18 12:48
176 102 – Material do Professor

ROTEIRO DE AULA
BIOLOGIA 1B

CICLOS DE VIDA

Reprodução assexuada

Mitose
Forma de divisão celular:

Divisão binária Brotamento


Esporulação

Fungos
Bactérias Alguns animais
Protozoários Algas Plantas

Algas Algas

Reprodução sexuada

Meiose
Forma de divisão celular:

Haplobionte

Diplobionte

Material exclusivo para professores


Haplonte Diplonte

conveniados ao Sistema de Ensino


Meiose inicial
Meiose gamética Meiose espórica

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 176 14/12/18 12:48
103 – Material do Professor 177

EXERCÍCIOS DE APLICAÇÃO

BIOLOGIA 1B
1. Unisinos-RS (adaptada) – O ciclo de vida dos animais Cite o nome desses ciclos e quais organismos se re-
é caracterizado pelo crescimento, reprodução e morte produzem dessa forma.
dos indivíduos. Sabendo que o crescimento ocorre por
meio de sucessivas divisões celulares e reprodução, pela Os ciclos acima referem-se, respectivamente, ao ciclo haplobionte haplonte
formação dos gametas e consequentemente fecundação
com um gameta de outro indivíduo da mesma espécie, e ao ciclo haplobionte diplonte. O ciclo haplobionte haplonte é realizado pela
qual das alternativas abaixo indica, respectivamente, o
tipo de divisão celular envolvido nos processos de cres- maioria dos fungos e por algumas algas, enquanto o ciclo haplobionte di-
cimento do organismo e formação dos gametas?
a) Fissão binária e meiose. d) Mitose e meiose. plonte é realizado pela maioria dos animais e por algumas espécies de algas.
b) Meiose e mitose. e) Fissão binária e mitose.
c) Mitose e fissão binária.
A mitose é o processo que permite os organismos crescerem, e a
4. Fatec-SP – As estratégias de reprodução sexuada são
meiose forma os gametas. adaptações dos organismos aos ambientes. Elas deter-
minam os ciclos de vida dos milhões de espécies de
2. Imed-RS (adaptada) – Em relação aos esporos, analise
eucariontes. Esses ciclos são classificados em:
as assertivas abaixo.
I. São células haploides formadas nos fungos para • haplobionte haplonte (como o dos fungos sapró-
reprodução. fitos Rhizopus);
II. São formados por algumas espécies de bactérias • haplobionte diplonte (como o dos Animalia);
durante condições ambientais adversas. • diplobionte (como o das plantas Embryophyta).
III. Estão presentes no ciclo reprodutivo de protozoários. A principal diferença entre esses ciclos consiste no
Quais estão corretas? momento em que ocorre
a) Apenas II. d) Apenas II e III. a) mitose
b) Apenas I e II. e) Todas as afirmativas. b) dipausa
c) Apenas I e III. c) esporulação
A afirmativa III está incorreta, porque os esporos são produzidos por d) nascimento
fungos, certas bactérias e, também, por algumas plantas.
e) meiose
3. Sistema Dom Bosco – Os esquemas a seguir represen- A diferença principal entre os ciclos haplobiontes e entre o ciclo diplo-
tam ciclos reprodutivos de espécies de algas diferentes. bionte é o momento em que a meiose acontece.
indivíduos haploides (n)
5. UFRN (adaptada) – Em um experimento, um tipo de
planta que se reproduz tanto de forma sexuada como
de forma assexuada é cultivado em dois ambientes ar-
tificiais distintos (I e II). No ambiente I, as condições de
(n) temperatura e umidade são constantes e não há presen-
ça de insetos. No ambiente II, há insetos e a tempera-
(n) tura e a umidade são instáveis. Considerando os dois
ambientes, a reprodução que teria melhor resultado na
gametas gameta (+) gameta (–) produção vegetal é:
fecundação
a) reprodução sexuada, nos dois ambientes, pois esta
(n) zigoto (2n) gera indivíduos idênticos que produzem um maior
número de plantas.
mitose meiose
pós-zigótica
b) no ambiente II, reprodução assexuada, pois uma
planta bem adaptada vai gerar um descendente
indivíduo haploide (n)
também bem adaptado.
c) nos dois ambientes, reprodução assexuada, pois
esta gera plantas já maduras e adaptadas, não apre-
indivíduos haploides (n)
sentando fragilidades em presença de pragas.
d) no ambiente II, reprodução sexuada, pois esta gera
sempre uma variedade de indivíduos que se adapta-
rão melhor em determinados ambientes.
Reprodução sexuada gera variabilidade e automaticamente possibilita
(n)
que os organismos se adaptem melhor a determinados ambientes,
enquanto a reprodução assexuada não gera variabilidade genética.
(n)

gametas
gameta (+) gameta (–)
6. Uerj – As populações de um caramujo que pode se re-
produzir tanto de modo assexuado quanto sexuado são

Material exclusivo para professores


fecundação
frequentemente parasitadas por uma determinada es-
(n) zigoto (2n) pécie de verme. No início de um estudo de longo prazo,
verificou-se que, entre os caramujos parasitados, foram
mitose
meiose selecionados aqueles que se reproduziam sexuadamente.

conveniados ao Sistema de Ensino


gamética
Observou-se que, ao longo do tempo, novas populações
indivíduo adulto diploide (2n) de caramujo, livres dos parasitas, podem voltar a se repro-
duzir de modo assexuado por algumas gerações.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 177 14/12/18 12:48
178 104 – Material do Professor

Explique por que a reprodução sexuada foi inicialmente se-


BIOLOGIA 1B

lecionada nos caramujos e, ainda, por que voltar à reprodu- aparecerem novas características, inclusive algumas que podem conferir
ção assexuada pode ser vantajoso para esses moluscos.
maior resistência aos parasitas. Em populações livres dos parasitas, ou
Enquanto são parasitados, os caramujos que se reproduzem de modo

seja, um meio mais estável, a variabilidade genética deixa de ser tão im-
sexuado são selecionados. Isso se explica pelo fato de a reprodução se-

portante, e a reprodução assexuada passa a ser selecionada como mais


xuada produzir variabilidade genética, enquanto a reprodução assexuada

vantajosa, pois produz indivíduos mais rapidamente.


produz, em geral, cópias dos indivíduos, de modo que há chance de

EXERCÍCIOS PROPOSTOS
7. PUC-RS – Para responder à questão, analise as informa- 10. Sistema Dom Bosco – O esquema a seguir representa
ções sobre as etapas necessárias para que ocorra a varia- o ciclo de vida de um determinado organismo.
bilidade genética em seres vivos com reprodução sexuada. I
indivíduo gametas
1. Fertilização aleatória. haploide
2. Crossing-over na prófase da meiose II. II

3. Segregação independente na anáfase da meiose I. zigoto


4. Introdução do órgão reprodutor masculino no órgão III
reprodutor feminino. Com base nisso e em seus conhecimentos, responda:
Está/Estão correta(s) apenas a(s) etapa(s): a) Como é chamado esse ciclo de vida?
a) 1 c) 2 e 4 e) 2, 3 e 4
b) 1 e 3 d) 1, 2 e 3

8. Cefet-MG – Em 2001, após ataque terrorista que cau-


sou a queda do World Trade Center, foram enviadas pelo
correio cartas contendo a bactéria Bacillus anthracis. As b) Como é denominado o processo em II?
cartas contaminadas só foram identificadas quando um
funcionário do endereço destinatário morreu por inala-
ção do pó branco. A sobrevivência do microrganismo
citado, durante o envio da carta, foi possível pela(o)
a) presença de células vegetativas, com alto potencial c) Em I e III, ocorrem dois tipos de divisão celular.
de proliferação. Nomeie-os corretamente.
b) formação de esporos, forma de resistência a ambien-
tes desfavoráveis.
c) isolamento térmico, para evitar oscilações de tem-
peratura e choque térmico.
d) adição de material nutritivo, necessário às atividades
vitais do microrganismo.
e) proximidade do endereço remetente e destinatário,
para garantir viabilidade celular. 11. Mackenzie-SP
9. UFPE – A figura a seguir representa algumas etapas Um fungo, uma tragédia
do ciclo de vida de uma espécie animal. Analise e as- Em 1845, na Irlanda, irrompeu uma devastadora praga da ba-
sinale a alternativa que corresponde às etapas 1, 2 e tata, que resultou em perdas quase que totais nas colheitas do
3, respectivamente: produto agrícola mais importante do país. Nos anos seguintes,
adulto diploide essa praga levou as populações de camponeses ao desespe-
ro com mais de um milhão de mortes causadas pela fome, já
1
que a batata era o seu produto e alimento básico. A mangra ou
mancha da batata é causada por um fungo parasita, o Phyto-
3 células phthora infestans. As plantas afetadas têm suas folhas e tubér-
haploides culos apodrecidos, e a transmissão por esporos, é muito rápida.
Fonte: Trecho extraído do livro de Cesar e Cezar, volume II.

A respeito da reprodução dos fungos, são feitas as


célula diploide

Material exclusivo para professores


2 seguintes afirmações:
a) meiose, desenvolvimento e fecundação I. Todos eles apresentam reprodução assexuada rea-
b) mitose, fecundação e meiose lizada por esporos.
c) mitose, fecundação e desenvolvimento II. Nem todos eles apresentam reprodução sexuada.

conveniados ao Sistema de Ensino


d) meiose, fecundação e desenvolvimento III. O esporo do fungo é uma célula haploide que, sozi-
e) mitose, meiose e fecundação nha, pode dar origem a um novo indivíduo.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 178 14/12/18 12:48
105 – Material do Professor 179

IV. Os fungos mais simples, os ficomicetos, só apre- 16. Unesp – A enxertia consiste em implantar parte de uma

BIOLOGIA 1B
sentam reprodução assexuada. planta viva em outra planta de igual ou diferente espé-
Estão corretas: cie. A planta introduzida (enxerto) produz folhas, flores
e frutos, enquanto a planta receptora (porta-enxerto)
a) I e II c) I, II e III e) II e IV capta água e nutrientes do solo.
b) I e III d) II e III
A figura esquematiza uma das técnicas indicadas para a
12. Sistema Dom Bosco – Em relação ao ciclo haplobionte enxertia entre espécies de hortaliças, tais como pepino,
haplonte, marque a alternativa correta. abóbora, melão e melancia.
a) Refere-se a organismos adultos haploides.
Corte do
b) Refere-se a organismos adultos diploides. enxerto
As superfícies do enxerto e
c) Nesse ciclo, a meiose é denominada espórica. do porta-enxerto devem per-
manecer em contato firme
d) A meiose é denominada gamética.

13. Fuvest-SP – As plantas podem reproduzir-se sexuada O enxerto é inserido


no tubo de fixação
ou assexuadamente, e cada um desses modos de re-
produção tem impacto diferente sobre a variabilidade
Colocação
genética gerada.  de um tubo
Analise as seguintes situações: Corte do para fixação
porta-enxerto do enxerto
I. Plantação de feijão para subsistência, em agricultura
familiar.
II. Plantação de variedade de cana-de-açúcar adequada
à região, em escala industrial.
III. Recuperação de área degradada, com o repovoa- Suponha que um enxerto de pepino (Cucumis sativus)
mento por espécies de plantas nativas. tenha sido introduzido em um porta-enxerto de abóbora
Com base na adequação de maior ou menor variabilida- (Cucurbita moschata). Os frutos produzidos por essa
de genética para cada situação, a escolha da reprodução enxertia serão
assexuada é a indicada para a) pepinos cujas sementes darão origem a exemplares
a) I, apenas. c) III, apenas e) I, II e III. de Curcubita moschata.
b) II, apenas. d) II e III, apenas b) híbridos estéreis com características de Cucumis
sativuse e de Curcubita moschata.
14. Sistema Dom Bosco – Cite e explique as vantagens da c) abóboras cujas sementes darão origem a exemplares
fecundação interna em relação à fecundação externa. de Cucumis sativus.
d) abóboras cujas sementes darão origem a exemplares
de Cucumis moschata.
e) pepinos cujas sementes darão origem a exemplares
de Cucumis sativus.

17. Sistema Dom Bosco


Os seres vivos podem reproduzir-se de duas maneiras
principais: sexuadamente ou assexuadamente. Esta última
forma não envolve o encontro de gametas, diferentemente
15. Sistema Dom Bosco da forma sexuada, que envolve as células reprodutivas. Or-
ganismos com reprodução sexuada podem apresentar três
A reprodução sexuada possui algumas desvantagens,
tipos de ciclos reprodutivos diferentes: ciclo haplobionte
como, por exemplo, demandar grande quantidade de
haplonte, ciclo haplobionte diplonte e ciclo diplobionte. 
energia para adquirir parceiros, pelo fato de que apenas
metade do material genético é passado para a próxima ge- Disponível em: <https://mundoeducacao.bol.uol.com.br/biologia/
tipos-ciclos-vida.htm>. Acesso em: out. 2018.
ração e em populações com baixa densidade, o indivíduo
precisa andar quilômetros para encontrar seu par. Por ou- Cite o tipo de meiose que difere os ciclos haplontes
tro lado, esse processo ainda é o mais comum na natureza. entre si e como são os organismos adultos encontrados
Disponível em: <https://edisciplinas.usp.br/pluginfi- em cada um deles.
le.php/3996382/mod_resource/content/1/2%20%20
Evolu%C3%A7%C3%A3o%20da%20reprodu%C3%A7%C3%A3o%20
sexual%2C%20investimentos.pdf>. Acesso em: out. 2018.
Sabendo disso, e com base em seus conhecimentos,
marque a melhor alternativa que represente a principal
vantagem da reprodução sexuada.

Material exclusivo para professores


a) Produção de indivíduos geneticamente iguais aos
parentais.
b) Produção de grande número de indivíduos.
c) Recombinação gênica, gerando variabilidade.

conveniados ao Sistema de Ensino


d) Alta taxa de sobrevivência entre indivíduos.
e) Certeza de adaptabilidade a qualquer ambiente.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 179 14/12/18 12:48
180 106 – Material do Professor

ESTUDO PARA O ENEM


BIOLOGIA 1B

18. Enem C3-H11 organismo adulto


mitose
A reprodução vegetativa de plantas por meio de esta- (2n)
cas é um processo natural. A humanidade, observando gametas
esse processo, desenvolveu uma técnica para propagar d) meiose (n)
plantas em escala comercial. A base genética dessa
técnica é semelhante àquela presente no(a) zigoto
(2n) fecundação
a) transgenia. d) controle biológico.
b) clonagem. e) melhoramento
c) hibridização. genético.
meiose
19. Enem C5-H17 organismo adulto
(2n)
Os seres vivos apresentam deferentes ciclos de vida,
gametas
caracterizados pelas fases nas quais gametas são pro-
e) mitose (n)
duzidos e pelos processos reprodutivos que resultam
na geração de novos indivíduos.
zigoto
fecundação
Considerando-se um modelo simplificado padrão para (2n)
geração de indivíduos viáveis, a alternativa que corres-
ponde ao observado em seres humanos é:
20. Sistema Dom Bosco C5-H17
esporófito meiose esporos A dengue é uma doença causada por um vírus que é
(2n) (n) transmitido pela picada da fêmea do Aedes aegypti. Basi-
zigoto camente, esse tipo de mosquito se caracteriza pelo tama-
a) (2n) nho pequeno, coloração marrom média e por nítida faixa
curva branca de cada lado do tórax. Além disso, há listras
gametas gametófito brancas nas pernas. A fêmea deposita até 100 ovos nas pa-
fecundação (n) (n) redes interna de recipientes que possam acumular água
parada. Ao entrar em contato com a água, os ovos se tor-
organismo adulto mitose nam larvas, que dão origem às pupas. Dela, surge o adulto
(2n) num ciclo de aproximadamente 7 dias. Machos e fêmeas
se encontram, copulam e a fêmea deposita os ovos, dando
gametas
b) meiose (n)
início ao ciclo novamente.
Disponível em: <www.dengue.sc.gov.br/>. Acesso em: out. 2018.
zigoto
(2n) fecundação
Com base nisso, marque a melhor alternativa a respeito
do ciclo de vida do Aedes aegypti:
organismo adulto meiose
a) O ciclo de vida desse organismo é haplonte.
(2n)
b) A meiose ocorre após a formação do zigoto.
gametas
c) mitose (n) c) O ciclo de vida desse organismo é diplonte.
d) A meiose ocorre após a formação de esporos.
zigoto e) A reprodução desse organismo se dá através do
(2n) fecundação brotamento.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 180 14/12/18 12:48
107 – Material do Professor 181

26
CICLO DIPLOBIONTE E

BIOLOGIA 1B
OUTROS PADRÕES
REPRODUTIVOS

Caso não sejam interrompidas, duas minhocas podem permanecer unidas reali-
zando a cópula durante horas. Nesse processo, o esperma é transferido, e os ovos
são fertilizados. Em algumas semanas, esses ovos se tornam novas minhocas e • Ciclo diplobionte
a reprodução sexuada estará completa. Mas quem será a mãe? Embora simples, • Diferentes padrões repro-
talvez a resposta seja inesperada: ambas as minhocas. dutivos
MAJNA

HABILIDADES
• Descrever e compreender
a importância do ciclo
diplobionte.
• Reconhecer organismos
que realizam o ciclo
diplobionte.
• Conhecer outros padrões
reprodutivos e alguns
dos organismos que os
realizam.

Minhocas do gênero Lumbricus acasalando.

Tendemos a pensar na reprodução somente como a fecundação do gameta fe-


minino pelo gameta masculino, já que esse é o principal evento para a geração de
novos indivíduos da espécie humana.
A reprodução, no entanto, é uma característica biológica extremamente com-
plexa e diversificada. Em algumas espécies, indivíduos trocam de sexo biológico
durante a vida, enquanto em outras, os dois sexos (masculino e feminino) estão
presentes no mesmo indivíduo, como é o caso das minhocas e de muitas plantas.
Existem organismos que fertilizam os próprios ovos, assim como há espécies que
não dependem da copulação (sexo) para se reproduzir. Em alguns animais, como
as abelhas, a reprodução é restrita a poucos indivíduos dentro de uma população.
As adaptações evolutivas são a chave para o sucesso reprodutivo dos seres
vivos. Indivíduos são efêmeros e passageiros, o que explica o porquê de a evolução
não ocorrer nos indivíduos, mas em populações ao longo do tempo. Os diferentes
ciclos de vida e formas de reprodução garantem a geração de novos indivíduos que
transcendem o tempo de vida limitado daqueles que lhes originaram, o que mantém
a espécie.

Ciclo diplobionte

Material exclusivo para professores


O ciclo diplobionte (também chamado de haplodiplobionte) ocorre nos ciclos
de vida de organismos cuja divisão meiótica leva à formação de esporos haploides
por um indivíduo diploide (também conhecido como esporófito, ou geração esporo-
fítica). Cada esporo haploide, produzido pela geração esporofítica diploide, origina um

conveniados ao Sistema de Ensino


indivíduo também haploide (conhecido como gametófito ou geração gametofítica),
que produz gametas por meio de divisões mitóticas. Após a fecundação, os zigotos
desenvolvem-se em novos esporófitos.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 181 14/12/18 12:48
182
BIOLOGIA 1B 108 – Material do Professor

gametófitos
(indivíduos haploides)

gameta gameta
esporos
fecundação

Meiose
zgoto
esta célula
passa por esporófito
meiose (indivíduo diploide)

Representação da meiose espórica, que ocorre nas plantas terrestres e em muitas algas. Elementos
representados fora da escala de tamanho. Cores fantasia.

A alternância entre haploide e diploide nas gerações é conhecida, em certos


casos, como metagênese. Alguns fungos e a maioria das algas pluricelulares e das
plantas são capazes de realizá-la, uma vez que todas apresentam fase gametofítica
– responsável pela formação dos gametas (n) – e fase esporofítica – responsável
pela produção de esporos (n).
A duração e o tamanho relativo do esporófito e do gametófito variam entre os
diversos grupos. Em plantas, por exemplo, como as briófitas (musgos), a fase game-
tofítica é mais duradoura quando comparada à fase esporofítica. Já nas angiospermas
(plantas com flores), a fase esporofítica é a mais duradoura.

Briófita Pteridófita Gimnosperma Angiosperma


Fase
esporofítica
(diplofase)

Fase
gametofítica
(haplofase)

Todas as plantas e a maioria das algas apresentam ciclo diplobionte, com alternância de gerações. Elementos
representados fora da escala de tamanho. Cores fantasia.

Soros em folhas de samambaias.


REPRODUÇÃO EM SAMAMBAIAS
ENRISCAPES

Nas samambaias, as folhas são o esporófito maduro


da planta, responsável por produzir esporos, que são
os pontos pretos presos a ela, também chamados de
soros. Vale lembrar que o esporófito é um organismo
diploide, enquanto o soro é haploide, pois é nesse mo-
mento que ocorre a meiose.

Material exclusivo para professores


Ao caírem no solo, os soros germinam e originam
gametófitos, os quais são chamados de protalo, uma
estrutura responsável pela produção dos gametas mas-
culinos e femininos. O protalo tem formato de cora-

conveniados ao Sistema de Ensino


ção e apresenta os arquegônios (nos quais é possível
observar a oosfera) e anterídios (responsáveis pela
produção de gametas masculinos).

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 182 14/12/18 12:48
109 – Material do Professor 183

BUCCANEER / ALAMY STOCK PHOTO

BIOLOGIA 1B
Corte longitudinal do protalo
observado na lupa. Aumento
desconhecido.

Na presença de água, o anterozoide flagelado nada até encontrar a oosfera (fe-


cundação), formando um zigoto (2n). O embrião inicia seu desenvolvimento, neces-
sitando do gametófito apenas por um curto período de tempo. O embrião forma,
então, um novo esporófito (2n), que se enraíza no solo e inicia um novo ciclo.

1 O esporângio libera os esporos. A maioria


2 Embora esta ilustração apresente
das espécies de samambaias produz um
único tipo de esporo que desenvolve em um oosferas e gametas masculinos
gametófito fotossintetizante bissexual. originados do mesmo gametófito, uma
variedade de macanismos promove
Legenda fertilização cruzada entre gametófitos.

Haploide (n)
Diploide (2n)

Esporo
(n)
MEIOSE

Fase inferior gameta


do gametófito masculino (n)
maduro (n)

oosfera (n)
Esporófito
maduro (2n)
zigoto (2n) FERTILIZAÇÃO

3 O espermatozoide utiliza o
5 Na fase inferior das flagelo para nadar até as oos-
feras no arquegônio. Um atrativo

Material exclusivo para professores


folhas reprodutivas do
gametófito (n) secretado pelo arquegônio ajuda
esporófito estão as
a direcionar o gameta masculino.
regiões chamadas de
soros (n). Cada soro 4 Um zigoto se desenvolve em um novo
é um agrupamento esporófito e a planta jovem cresce para fora de

conveniados ao Sistema de Ensino


de esporângios. um arquegônio do gametófito progenitor.

Ciclo de vida das samambaias. Elementos representados fora da escala de tamanho. Cores fantasia.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 183 14/12/18 12:49
184 110 – Material do Professor

LEITURA COMPLEMENTAR Durante todo o ciclo de vida dos cnidários, todos os


BIOLOGIA 1B

Metagênese em cnidários indivíduos são diploides (2n), e apenas os gametas


Apesar do que se pode pensar, quando falamos em me- (feminino e masculino) são haploides (n). A seguir,
tagênese de celenterados, os cnidários, estamos nos re- podemos observar um esquema do ciclo metagênico
ferindo a uma alternância de gerações diferente do que dos cnidários.
acontece no ciclo diplobionte de samambaias. No caso
desses animais, a metagênese se refere à alternância de

AEKIKUIS
tipos de reprodução (assexuada e sexuada), em que os água-viva adulta
indivíduos de cada fase reprodutiva são completamente
distintos uns dos outros. No entanto, a haploidia para
essa metagênese é aquela característica de ciclo haplo- efíria
bionte diplonte, em que apenas o gameta é haploide. Ovo
Nesse caso, o ciclo de vida é inigualável. Por exemplo,
na fase de vida das medusas e das águas-vivas, os or-
ganismos são diploides, existindo machos e fêmeas.
Sua reprodução é do tipo sexuada, com fecundação
larva plânula
dos gametas femininos de um indivíduo pelos gametas
masculinos de outro indivíduo, o que origina o zigoto. estróbilo
VIRUNJA

pólipo

Ciclo de vida de medusas e organismos envolvidos nesse processo.


Elementos representados fora da escala de tamanho. Cores fantasia.

Diferentes padrões
reprodutivos
Existem dois modos principais de reprodução de-
sempenhada pelos seres vivos. Na reprodução sexua-
Com o desenvolvimento do zigoto, originam-se as lar- da, a fusão de gametas haploides forma uma célula di-
vas pelágicas, chamadas de plântulas, que, ao encon- ploide, o zigoto. Nesse caso, o indivíduo formado pode
trarem um substrato adequado, fixam-se a ele e origi- originar gametas por meio da meiose. Na reprodução
nam pólipos. Por meio de um processo de evaginação assexuada, essa fusão de gametas não acontece, e
e do desenvolvimento de diversas camadas de pólipo, o novo indivíduo é formado por mitose. No módulo an-
inicia-se a reprodução assexuada, em que as camadas terior, foram apresentados alguns tipos de reprodução
denominadas gomos se dividem em discos sobrepos- assexuada. Neste serão estudados outros padrões de
tos (estrobilação). Desses discos que se desprendem, reprodução com base nas divisões celulares mitóticas
originam-se medusas pequenas, chamadas de efírias, e meióticas.
que crescerão e se reproduzirão de forma sexuada.
PARTENOGÊNESE
Esse é um tipo de reprodução assexuada em que
MORPHART CREATION

o indivíduo se desenvolve a partir de um ovócito não


fecundado. Em geral, esse processo reprodutivo tem
como vantagem o baixo consumo energético, uma
vez que os indivíduos não necessitam procurar um
parceiro. A partenogênese também possibilita gran-
de dispersão, já que a maioria dos organismos produz
grande número de ovos de uma só vez. Alguns tipos
de vermes, formigas, vespas e abelhas se reproduzem

Material exclusivo para professores


por partenogênese. No caso das abelhas, os machos
(zangões) são adultos férteis e haploides que surgem
por partenogênese. As abelhas fêmeas são adultos
diploides que se desenvolvem a partir de ovos fertili-

conveniados ao Sistema de Ensino


Processo de estrobilação em pólipos. A estrutura passa a ter o
nome de estróbilo quando está com esse aspecto. Elementos zados – portanto, ocorre meiose. Dependendo da dieta
representados fora da escala de tamanho. Cores fantasia. que recebem, as abelhas tornam-se estéreis (operárias)
ou férteis (rainha).

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 184 14/12/18 12:49
111 – Material do Professor 185

WILDLIFE GMBH / ALAMY STOCK PHOTO HERMAFRODITISMO

BIOLOGIA 1B
Organismos sésseis (fixos) como plantas e alguns
animais, a exemplo das esponjas e alguns moluscos,
encontram na locomoção uma barreira para realizarem
a reprodução sexuada.
O hermafroditismo é uma adaptação evolutiva para
esse problema, pois o indivíduo apresenta os sistemas
reprodutivos masculino e feminino. Isso possibilita o
cruzamento entre dois indivíduos, como o exemplo
das minhocas citadas na introdução. Cada organismo
recebe e doa espermatozoides durante a cópula. Exis-
tem, ainda, espécies capazes de se autofecundarem.
Da esquerda para a direita: abelha-rainha, zangão e abelha-operária da
espécie Apis mellifera.
Em virtude dessa possível autofecundação, a taxa
de endogamia é alta. Ou seja, o grau de parentesco é
Entre os vertebrados, a partenogênese é observa- próximo entre os indivíduos da espécie, o que facilita
da em cerca de uma a cada mil espécies. Exemplos a ocorrência de doenças, mutações genéticas e con-
incluem espécies de tubarão-martelo, sucuri e dragão- sequente extinção daquela população. Por isso, em
-de-komodo. muitas plantas hermafroditas há estratégias para coibir
essa autofecundação, tais como o amadurecimento
LABETAA ANDRE

das estruturas femininas e masculinas em tempos di-


ferentes.

POLIEMBRIONIA
A poliembrionia ocorre quando um zigoto, durante
seu desenvolvimento, produz células que se separam
e continuam a se desenvolver, originando novos em-
briões.

Gametas (n) → fecundação → zigoto (2n) →


→ separação das células → vários zigotos (2n)
A sucuri (Eunectes murinus) consegue reproduzir-se por partenogênese
na ausência de machos.
Esse evento reprodutivo é muito comum na família
Existe ainda uma forma mais complexa de partenogê- Dasypodidae, representada pelos tatus, no qual um
nese que envolve a duplicação dos cromossomos após zigoto é capaz de originar até quatro filhotes idênticos
a meiose, produzindo descentes diploides. Tal processo geneticamente. Esse processo também explica a ori-
ocorre em vários gêneros de peixes, anfíbios e répteis. gem de gêmeos monozigóticos (idênticos) na espécie
Algumas espécies de lagartos fêmeas reproduzem-se humana.
exclusivamente por esse modo de partenogênese, por- Em animais como o tatu, para o qual essa é uma
tanto não existem machos nessas espécies. No entanto, condição natural, é vantajoso gerar mais de um filhote,
as fêmeas têm comportamento de corte e acasalamen- uma vez que a poliembrionia ocorre em razão do com-
to típicos de espécies do mesmo gênero que realizam portamento reprodutivo dos parentais para garantir o
reprodução sexuada. Isso é importante para que haja sucesso reprodutivo.
maior liberação do hormônio sexual feminino estradiol
JEFF FOOTT/GETTY IMAGENS

e progesterona, essenciais para a ovulação.


WILD HORIZONS/UNIVERSAL IMAGES GROUP/
LATINSTOCK

Material exclusivo para professores


conveniados ao Sistema de Ensino Fêmeas de Aspidoscelis flagellicauda descansando ao sol.
A poliembrionia é comum em tatus (Dasypus novemcinctus). Esse
processo explica a existência de gêmeos idênticos ou monozigóticos.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 185 14/12/18 12:49
186 112 – Material do Professor

PEDOGÊNESE

UNIVERSAL IMAGES GROUP


BIOLOGIA 1B

Nesse processo, organismos que ainda se encon-


tram no estágio de larva realizam reprodução asse-
xuada, mais especificamente a partenogênese. Um
exemplo é o platelminto Schistosoma mansoni, cau-
sador da esquistossomose. Esse organismo realiza a
pedogênese no interior do caramujo e origina formas
infectantes denominadas cercárias. Esse processo é
bem útil do ponto de vista evolutivo para modos de vida
parasitas, pois tem como vantagem o encurtamento
do ciclo reprodutivo e o aumento do número de des-
cendentes gerados.
Cardume de bodião-de-cabeça-azul (Thalassoma bifasciatum), animal
SPL DC/LATINSTOCK

que apresenta mudança de sexo, pois alguns indivíduos fêmeas se


transformam em machos.

Em certas espécies de ostras, ocorre o processo


inverso: alguns machos se tornam fêmeas. Ao atingir
determinado tamanho, acontece a troca de sexo, uma
vez que um maior porte do corpo possibilita maior pro-
dução de gametas. Essa adaptação resulta em maior
sucesso reprodutivo, já que mais gametas liberados
no ambiente geram mais descendentes.

NEOTENIA
Esse processo consiste na maturidade genital e
na reprodução sexual precoce de indivíduos que não
perderam completamente as características de larva.
Um exemplo são as salamandras, que, mesmo ainda
A larva cercária de Schistosoma mansoni é gerada por meio da apresentando brânquias e morfologia larval, conse-
pedogênese. Micrografia óptica com aumento de 64×.
guem reproduzir-se sexuadamente.

MUDANÇA DE SEXO

PHOTOSTOCK-ISRAEL/SCIENCE PHOTO LIBRARY


Em algumas espécies, a mudança de sexo ocorre
naturalmente durante a vida. Esse padrão reprodutivo
é comum em peixes e anfíbios, como ocorre na espé-
cie Thalassoma bifasciatum (bodião-de-cabeça-azul),
ser vivo que forma grandes haréns constituídos por
um único macho e várias fêmeas. Quando o macho
morre, a fêmea maior (geralmente mais velha) sofre
mudanças hormonais e fisiológicas que a tornam um
indivíduo macho. Dentro de uma semana, passa a pro-
duzir espermatozoides e a fecundar as fêmeas. Essa
característica assegura o sucesso na reprodução da
espécie, visto que machos de maior porte tendem a Salamandra-de-fogo (Salamandra salamandra), espécie que se reproduz
defender melhor o harém contra intrusos. por neotenia.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 186 14/12/18 12:49
113 – Material do Professor 187

ROTEIRO DE AULA

BIOLOGIA 1B
CICLO DIPLOBIONTE

Reprodução
Sexuada
do tipo:

Divisão
Meiose espórica
celular:

Forma:

Representa:
Esporos haploides Gametófito Fase haploide

Fecundação gera:

Representa:
Zigoto diploide Esporófito Fase diploide

Sofre nova meiose originando esporos haploides

Alternância de gerações haploides e diploides,


Metagênese
também chamada de:

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 187 14/12/18 12:49
188 114 – Material do Professor

EXERCÍCIOS DE APLICAÇÃO
BIOLOGIA 1B

1. Unitins-TO – A alternância de gerações ou metagênese feminino pelo gameta masculino; o ovócito divide-se
é um tipo de ciclo de vida encontrado nas plantas e de forma a gerar um novo embrião, sem fertilização.
alguns grupos de animais. A expressão “alternância” se Essa reprodução ocorre em abelhas melíferas, entre
aplica somente quando o estágio multicelular haploide as quais os machos são haploides.
se alterna com III. A reprodução sexuada gera maior variabilidade ge-
a) estágio diploide unicelular. nética em razão dos processos de crossing-over na
formação dos gametas, fecundação e mutações
b) estágio haploide unicelular.
aleatórias, enquanto a reprodução assexuada possui
c) estágio haploide multicelular. apenas as mutações como fonte de variabilidade.
d) estágio diploide multicelular. IV. Os gêmeos monozigóticos, idênticos ou univitelinos
e) estágio diploide multicelular ou unicelular. originam-se a partir de células de um zigoto que se
Aplica-se o termo alternância quando o estágio multicelular haploide separaram e se desenvolveram em dois indivíduos
se alterna com o estágio multicelular diploide. independentes.
a) I, II, III e IV são afirmativas verdadeiras.
b) I, II, III e IV são afirmativas falsas.
2. UPE (adaptada) – Os zangões, machos das abelhas,
são formados por um processo de partenogênese. Já c) apenas I e II são afirmativas verdadeiras.
as abelhas operárias são fruto de um processo de fe- d) apenas II e III são afirmativas verdadeiras.
cundação. Diante dessas informações, analise as afir- e) apenas I e IV são afirmativas verdadeiras.
mativas a seguir:
Todas as afirmativas estão corretas.
I. Por serem fruto de partenogênese, os machos pos-
suem o dobro de cromossomos encontrados na 5. IFPE (adaptada) – No reino Plantae, encontramos os
abelha-rainha. grupos vegetais, cuja metagênese (alternância de ge-
II. A abelha-rainha possui ovócitos com o mesmo nú- rações) é bem marcante. Com relação a seus ciclos
mero de cromossomos encontrados nas células reprodutivos, é correto afirmar que:
somáticas das operárias, pois ela também é uma a) Os esporos são células haploides formadas pela
fêmea. meiose.
III. Todas as fêmeas possuem suas células somáticas b) Nas briófitas, a fase dominante é o esporófito e a
diploides, enquanto os machos possuem células fase passageira é o gametófito.
haploides.
c) O gametófito é diploide (2n), sendo formado pela
IV. A abelha-rainha tem ovócitos que são haploides. Ao germinação dos gametas.
serem fecundados, geram indivíduos com células
diploides. d) Nas angiospermas, a fase dominante é o gametófito
e a fase passageira é o esporófito.
Estão corretas:
e) Nas pteridófitas, o gametófito é diploide e chamado
a) I e II c) II e III e) III e IV de protonema.
b) I e III d) II e IV A meiose é espórica. A afirmativa B está incorreta, porque a fase dura-
doura é o gametófito. A afirmativa C está incorreta, pois o gametófito
é haploide e produz gametas. A afirmativa D está incorreta, porque a
A afirmativa I está incorreta, porque eles têm metade dos cromossomos fase duradoura nas angiospermas é a esporofítica. A afirmativa E está
na abelha-rainha. A afirmativa II está incorreta, pois a abelha-rainha terá incorreta, pois o gametófito é haploide e o nome dado ao gametófito
o ovócito com o mesmo número de cromossomos que os zangões. das briófitas é protonema.

3. Sistema Dom Bosco – O Schistosoma mansoni, cau- 6. Sistema Dom Bosco – Perus são capazes de reprodu-
sador da esquistossomose, é um platelminto capaz de zir-se por meio da partenogênese quando as fêmeas são
se reproduzir enquanto ainda se encontra no estágio separadas por muito tempo de machos. Esse processo
larval, originando cercárias. O modo de reprodução é raro em perus selvagens, mas se observa em várias
desse organismo é assexuado ou sexuado? Como é populações de cativeiro.
denominado esse processo de reprodução?
Esse modo de reprodução é assexuado, denominado pedogênese. Com base nisso e em seus conhecimentos, explique
o que é a partenogênese e explique as vantagens de
se reproduzir dessa forma.
A partenogênese é um processo no qual os indivíduos são originados a

4. Faceres-SP (adaptada) – A reprodução é o processo partir do ovócito não fecundado. Esse processo reprodutivo tem como
pelo qual os seres vivos originam novos indivíduos seme-
lhantes a si mesmos. É pela reprodução que os organis- vantagem o baixo consumo energético (uma vez que os indivíduos que
mos garantem a sobrevivência da espécie. Há duas for-
mas distintas de reprodução: a sexuada e a assexuada.
se reproduzem dessa maneira não necessitam procurar um parceiro) e

Material exclusivo para professores


Analise as afirmativas sobre os dois tipos de reprodução
e assinale a alternativa correta: a possibilidade de grande dispersão (já que a maioria dos organismos
I. Bactérias, protozoários e algas unicelulares reprodu-
zem-se por cissiparidade ou divisão binária, quando produz grande número de ovócitos de uma só vez).

conveniados ao Sistema de Ensino


uma única célula origina duas células-filhas.
II. A partenogênese é um tipo de reprodução em que o
embrião se desenvolve sem a fecundação do gameta

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 188 14/12/18 12:49
115 – Material do Professor 189

EXERCÍCIOS PROPOSTOS

BIOLOGIA 1B
7. Sistema Dom Bosco – Os vegetais apresentam ciclo de vida conhecido como diplo-
bionte. Isso se deve ao fato de que
a) os gametas das plantas são diploides e o adulto é haploide.
b) os gametas das plantas são haploides e o adulto é diploide.
c) o ciclo apresenta alternância entre adultos haploides e diploides.
d) os gametas e os adultos são diploides.
e) os gametas e os adultos são haploides.

8. Unitins-TO – Nos animais e nas plantas, a meiose gamética e a meiose espórica


resultarão, respectivamente, em
a) gametas e esporos haploides. d) esporos e gametas diploides.
b) gametas e esporos diploides. e) zigotos e gametas diploides.
c) esporos e zigotos haploides.

9. Sistema Dom Bosco – As salamandras são animais conhecidos por se reproduzirem


de forma considerada precoce, por manter algumas características ainda juvenis,
como a morfologia larval e as brânquias. Sobre esse processo reprodutivo, é correto
afirmar que
a) é um processo sexuado, denominado pedogênese.
b) é um processo sexuado, denominado neotenia.
c) é um processo sexuado, denominado poliembrionia.
d) é um processo assexuado, denominado partenogênese.
e) é um processo onde há alternância de gerações.

10. Sistema Dom Bosco – Os tatus (Dasypodidae sp.) têm a capacidade de produzir vários
organismos originados da fecundação de apenas um ovócito com um espermatozoide.
Explique que processo reprodutivo é esse e como ele ocorre.

11. Sistema Dom Bosco – O esquema a seguir representa o ciclo reprodutivo de um


organismo com alternância de gerações.

gametófito
(n)

esporo gametas
haploide

(n) (n) e (n)

meiose fertilização
diploide

Material exclusivo para professores esporângio

esporófito
zigoto

conveniados ao Sistema de Ensino


(2n)

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 189 14/12/18 12:49
190 116 – Material do Professor

A respeito desse ciclo de vida, é correto afirmar que


BIOLOGIA 1B

a) apresenta meiose espórica.


b) os gametas são diploides
c) os esporos são diploides
d) o gametófito produz esporos.

12. PUC-SP – Analise a tira de quadrinhos abaixo:

FERNANDO GONSALES
Embora hermafroditas, os caramujos normalmente têm fecundação cruzada, meca-
nismo que leva a descendência a apresentar
a) aumento de variabilidade genética em relação à autofecundação e maior chance
de adaptação das espécies ao ambiente.
b) diminuição da variabilidade genética em relação à autofecundação e maior chance
de adaptação das espécies ao ambiente.
c) variabilidade genética semelhante à da autofecundação e as mesmas chances de
adaptação das espécies ao ambiente.
d) diminuição de variabilidade genética em relação à autofecundação e menor chance
de adaptação das espécies ao ambiente.
e) variabilidade genética semelhante à da autofecundação e menor chance de adap-
tação das espécies ao ambiente.

13. UFSC (adaptada) – Há registros de declínio expressivo de populações de abelhas


melíferas em vários países, inclusive no Brasil. O desaparecimento das fabricantes de
mel preocupa não só pela ameaça à existência desse produto, mas também porque
as abelhas têm chamado a atenção principalmente pelo importante papel ecológico.
Elas são responsáveis por 70% da polinização dos vegetais consumidos no mundo,
ao transportar o pólen de uma flor para outra. Entre as prováveis causas para o de-
saparecimento das abelhas estão os componentes químicos presentes nos defensi-
vos agrícolas, as mudanças climáticas e a infestação por um ácaro que se alimenta
da hemolinfa das abelhas. Na busca por respostas, o Instituto Tecnológico Vale, em
Belém (PA), em colaboração com a Organização de Pesquisa da Comunidade Científica
e Industrial, na Austrália, desenvolveu microssensores, que são colados no tórax das
abelhas da espécie Apis mellifera africanizada para avaliação do seu comportamento
sob a influência de pesticidas e de eventos climáticos.
ERENO, Dinorah. Abelhas vigiadas. Pesquisa Fapesp: 221, p. 70-73, jul. 2014. Disponível em: <https://
enem.estuda.com/questoes/?resolver=&prova=&q=&inicio=&cat=6&q=partenog%EAnese&dificuldade
=&ignorar=1questão 33>. (Adaptado)

Sobre assuntos relacionados ao texto, analise as afirmativas a seguir:


01) Os zangões são organismos diploides.
02) As abelhas-operárias são diploides e diferenciam-se da abelha-rainha por se ali-
mentar de geleia real enquanto larva.
04) Os zangões são originados por meio da partenogênese.
08) Se o zangão e a abelha-rainha cruzarem, nascem apenas abelhas fêmeas.

Material exclusivo para professores


A alternativa que apresenta a soma das afirmativas corretas é:
a) 03
b) 07
c) 10

conveniados ao Sistema de Ensino


d) 12
e) 19

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 190 14/12/18 12:49
117 – Material do Professor 191

14. Unesp (adaptada) – No Brasil, está largamente distribuída a espécie Schistosoma

BIOLOGIA 1B
mansoni, em especial no Nordeste e no Leste. Esse platelminto causa a esquistos-
somose, conhecida como “barriga-d’água”. No Brasil, a esquistossomose encontra-se
em franca expansão, com focos surgindo nas cidades do sul e noroeste de Minas
Gerais. Essa doença tem no homem seu principal hospedeiro definitivo, sendo que as
modificações ambientais, introduzidas por ele, favorecem a sua proliferação.
Com base nessas informações e em seus conhecimentos, marque a alternativa correta:
a) As cercárias são as formas infectantes e reproduzem-se sexuadamente.
b) As cercárias são formas de esporos produzidas por partenogênese.
c) Esse platelminto se reproduz por esporulação.
d) Esse platelminto possui alternância de gerações, tendo o ciclo diplobionte.
e) Esse platelminto produz cercarias, que abandonam o caracol por meio da pedogênese.

15. Sistema Dom Bosco – O esquema a seguir representa o ciclo reprodutivo de


um organismo.

anterozoide
GAMETÓFITO II
I oosfera

esporos
V

ESPORÓFITO zigoto
IV III

Com base nisso e em seus conhecimentos, cite o nome do ciclo em questão, dê ao


menos um exemplo de organismos capazes de realizá-lo e cite a ploidia de cada fase.

16. Sistema Dom Bosco – Os esquemas a seguir representam os principais ciclos de


vida existentes. É correto afirmar que os esquemas I, II e III se referem, respectiva-
mente, aos ciclos

adulto gametófito
(n) (n)
gametas
(n) e (n)
esporo gametas esporo gametas
haploide

haploide

haploide

(n) (n) e (n) (n) (n) e (n)

meiose fertilização meiose fertilização meiose fertilização


diploide

diploide

diploide

zigoto
zigoto esporângio zigoto

Material exclusivo para professores


(2n)

adulto
esporófito (2n)
(2n)

conveniados ao Sistema de Ensino


I II III

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 191 14/12/18 12:49
192 118 – Material do Professor

a) haplobionte haplonte, haplobionte diplonte e haplodiplobionte.


BIOLOGIA 1B

b) haplodiplobionte, haplobionte haplonte e haplobionte diplonte.


c) haplobionte diplonte, haplobionte haplonte e haplodiplobionte.
d) haplobionte haplonte, haplodiplobionte e haplobionte diplonte.
e) haplobionte diplonte, haplodiplobionte e haplobionte haplonte.

17. Unifor-CE (adaptada) – A figura abaixo mostra o ciclo de vida de um cnidário.

II

III

V IV

Cite o nome de cada fase de vida do cnidário enumeradas.

ESTUDO PARA O ENEM


18. Sistema Bom Bosco C5-H17
Botânicos de São Paulo, em colaboração com colegas dos Estados Unidos, verificaram que
a parede celular de várias espécies de samambaias apresenta uma composição diferente
de outras estruturas de revestimento de plantas já caracterizadas. Eles acreditam ter iden-
tificado um terceiro tipo de parede celular, rica em manose, um tipo de açúcar que forma
polímeros chamados mananos e aparece em proporções baixas em outros tipos de parede.
Além de mais informações sobre a estrutura e a evolução do mundo vegetal, o estudo pode
favorecer o aproveitamento de outras plantas – de paredes externas menos resistentes –
para produzir biocombustíveis e papéis com características especiais.
Disponível em:: <http://revistapesquisa.fapesp.br/wp-content/uploads/2011/11/046-047-189.pdf>.
Acesso em: dez. 2018.

A respeito do ciclo reprodutivo presente nas samambaias, é correto é afirmar que


a) as folhas das samambaias são os gametófitos e produzem gametas que

Material exclusivo para professores


são haploides.
b) as folhas das samambaias são os esporófitos e essas estruturas são diploides.
c) os esporófitos produzem esporos diploides.

conveniados ao Sistema de Ensino


d) o ciclo de vida dessa planta é haplonte.
e) a estrutura que lembra o formato de coração é denominada esporófito e é uma
estrutura diploide.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 192 14/12/18 12:49
119 – Material do Professor 193

19. Enem C5-H17

BIOLOGIA 1B
Em certas localidades ao longo do Rio Amazonas, são encontradas populações de de-
terminada espécie de lagarto que se reproduzem por partenogênese. Essas populações
são constituídas, exclusivamente, por fêmeas que procriam sem machos, gerando
apenas fêmeas. Isso se deve a mutações que ocorrem ao acaso nas populações bis-
sexuadas. Avalie as afirmações seguintes, relativas a esse processo de reprodução.
I. Na partenogênese, as fêmeas dão origem apenas a fêmeas, enquanto, nas popu-
lações bissexuadas, cerca de 50% dos filhotes são fêmeas.
II. Se uma população bissexuada se mistura com uma que se reproduz por parteno-
gênese, esta última desaparece.
III. Na partenogênese, um número x de fêmeas é capaz de produzir o dobro do núme-
ro de descendentes de uma população bissexuada de x indivíduos, uma vez que,
nesta, só a fêmea põe ovos.
É correto o que se afirma
a) apenas em I.
b) apenas em II.
c) apenas em I e III.
d) apenas em II e III.
e) em I, II e III.

20. Sistema Dom Bosco C5-H17


Uma pesquisa feita no Hospital Santa Catarina, em São Paulo, constatou que a idade mé-
dia das mães influencia na incidência de gêmeos monozigóticos (idênticos) e dizigóticos
(fraternos). A geneticista Gloria Colletto, especialista em epidemiologia genética, estudou
os 89.491 partos feitos no hospital de 1979 a 1998. Do total, 88.530 foram partos únicos,
em 935 deles nasceram gêmeos e 26 foram de trigêmeos. Nos vinte anos pesquisados, foi
constatado o aumento da taxa de gêmeos e trigêmeos. Em cada mil partos, a incidência de
gêmeos subiu de 1% para 1,3%, enquanto o número de trigêmeos passou de aproximada-
mente 0 para 0,6% no período.
Disponível em: <http://agencia.fapesp.br/idade-materna-influencia-no-
nascimento-de-gemeos/715/>. Acesso em: dez. 2018.

A respeito dos gêmeos monozigóticos pode-se afirmar corretamente que


a) desenvolvem-se a partir da fecundação de dois ovócitos diferentes.
b) desenvolvem-se a partir de um ovócito não fecundado que se divide em dois.
c) são o resultado de um ovócito fertilizado, ou zigoto, dividido em dois.
d) são o resultado de meioses sucessivas que dividem a célula em dois organis-
mos diferentes.
e) são produzidos somente na ausência de machos da espécie.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 193 14/12/18 12:49
8
194 120 – Material do Professor

27
BIOLOGIA 1B

FUNDAMENTOS DA GENÉTICA

Em 2016, pesquisadores do Instituto Max Planck de Antropologia Evolutiva, na


Alemanha, realizaram análises genéticas de ossos de uma neandertal encontrada
• Base da Genética nas montanhas Altai, na Sibéria. Com base no genoma encontrado, os cientistas
• Vocabulário genético descobriram que os seres humanos modernos e os neandertais começaram a se
miscigenar há 100 mil anos. Esse estudo contraria a hipótese anteriormente aceita de
HABILIDADES que esse cruzamento genético teria começado há 60 mil anos. Existem sequências
• Compreender a importância específicas de DNA, características do Homo sapiens moderno, no genoma dessa
da Genética. neandertal, o que indica, portanto, que ela era parente de um Homo sapiens moderno.
• Explicar a diferença entre Essas análises ajudam a compreender como ocorreu a migração humana e suge-
gene, genoma e alelo. rem, inclusive, que os cruzamentos entre as espécies ocorreram fora da África, em
• Assimilar os conceitos de razão da falta de vestígios de neandertais no continente africano. Outra evidência
locus gênico e cromosso- dessa migração foi a descoberta de fósseis humanos em Israel. Outras pesquisas
mos homólogos. também indicam que havia seres humanos na China em torno de 80 mil anos atrás.
Portanto, concluiu-se que o cruzamento entre neandertais e humanos pode ter
ocorrido em algum lugar do Sudeste Asiático.
Os genes neandertais ainda

SABENA JANE BLACKBIRD / ALAMY STOCK PHOTO


podem ser encontrados até hoje
em nosso genoma. De acordo
com estudos, as porções do
DNA que herdamos de nossos
parentes extintos estão relacio-
nadas principalmente ao siste-
ma imunológico. Com base em
estudos genéticos como esses,
podemos compreender o quão
informativo o genoma pode ser
para diversas áreas do conhe-
cimento. Assim, compreender
alguns conceitos fundamentais
nos ramos da Genética é muito
importante para o desenvolvi-
mento científico.

Material exclusivo para professores


conveniados ao Sistema de Ensino Nessa imagem, à frente está a representação
do esqueleto de um neandertal; atrás, um
esqueleto de um humano moderno.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 194 14/12/18 12:49
121 – Material do Professor 195

BASE DA GENÉTICA

BIOLOGIA 1B
Para entender a Genética moderna, é importante conhecermos sua história. A
linha do tempo a seguir mostra os principais eventos desde o surgimento da Gené-
tica até a contemporaneidade.

HISTÓRICO DE DESCOBERTAS DA GENÉTICA

1865 Mendel publica os resultados de seu estudo com ervilhas, no qual sugere a existência de um
fator responsável pelas características que são transmitidas ao longo das gerações.
1900 Hugo de Vries, Carl Correns e Erick Von Tschermarks realizam experimentos similares ao de Mendel
e chegam às mesmas conclusões. Redescoberta da importância dos experimentos de Mendel.
1903 Os cromossomos são considerados as unidades da hereditariedade.

1905 O termo Genética é usado pela primeira vez em uma carta escrita por W. Bateson.
1910 T. H. Morgan descreve que os fatores responsáveis pela hereditariedade estão localizados
nos cromossomos.
1927 O termo mutação é definido como mudanças físicas no fator de hereditariedade.

1928 Griffith descreve a existência de uma molécula responsável pela hereditariedade,


transmissível entre bactérias Pneumococcus (princípio transformante).
1953 J. D. Watson e F. H. C. Crick descrevem a estrutura do DNA como formada por uma dupla
hélice unida por ligações de hidrogênio entre bases púricas e pirimídicas, graças à imagem
com a técnica de difração de raios X do DNA gerada por Rosalind Franklin.
1956 Jo Hin Tijo e Albert Levan descrevem o número correto de cromossomos da espécie humana
(2n = 46).

1958 F. H. C. Crick prediz a descoberta do RNA: para que um aminoácido seja formado, uma
molécula intermediária deve ser gerada, contendo a informação genética responsável por
sua produção.
1958 A experiência de Meselson-Stahl demonstra que a molécula de DNA é semiconservativa.
1961 O código genético é organizado em trincas (códons).

1989 Um gene humano é sequenciado pela primeira vez, com o intuito de se compreender a
fibrose cística.
1995 O DNA do primeiro organismo vivo (bactéria Haemophilus influenzae) é sequenciado.
1996 O primeiro mamífero é clonado, a ovelha Dolly.

1998 O primeiro genoma eucarionte multicelular é sequenciado (C. elegans).


2001 O primeiro rascunho da sequência do genoma humano é publicado.
2003 O genoma humano é sequenciado com 99% de precisão (Projeto Genoma).
Morre a ovelha Dolly.
2010 Produção da primeira célula artificial com base em DNA sintético.
2012 O DNA não codificante, conhecido como DNA lixo, é descrito assumindo funcionalidade
importante na expressão dos genes e no desenvolvimento.

Todas as descobertas genéticas só se tornaram possíveis com base no entendi-

Material exclusivo para professores


mento sobre sua matéria-prima principal, o DNA (ácido desoxirribonucleico). No
DNA estão contidas as informações necessárias para compreender cada detalhe dos
organismos, como metabolismo, desenvolvimento e funções de cada célula ou tecido.

conveniados ao Sistema de Ensino


GENES
Foi visto anteriormente que o DNA é composto por uma pentose, bases nitro-
genadas e um grupo fosfato, formando um nucleotídeo.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 195 14/12/18 12:49
196 122 – Material do Professor

ZVITALIY/ISHUTTERSTOCK
Extremidade 5’ Extremidade 3’
BIOLOGIA 1B

Pontes de hidrogênio
Extremidade 3’

Extremidade 5’
Bases
Estrutura de nitrogenadas
açúcar e fosfato complementares

Dupla fita de DNA

1 unidade de dobramento do DNA – 3,4 nm

Adenina (A) Timina (T) Guanina (G) Citosina (C)

Estrutura de um nucleotídeo, que forma a dupla fita de DNA, por meio do pareamento de bases nitrogenadas.
Esse pareamento de bases constitui uma região codificadora de proteína, ou seja, uma região específica do DNA
que é lida, transcrita e traduzida em uma proteína (gene). Elementos representados fora da escala de tamanho.
Cores fantasia.

Embora pareça que a ordem das bases nitrogenadas para codificar proteínas com funções específicas. Por
no DNA é aleatória, ela tem função específica e forma ge- exemplo, vamos considerar os genes A e B. Apesar de
nes e regiões reguladoras. Foram necessários milhões o gene A ser menor que o gene B, os dois apresentam
de anos para formar essa ordem. Várias possibilidades fo- um trecho de pares de bases em comum que codificam
ram “testadas”, de modo que essas regiões codificassem para os mesmos aminoácidos. No entanto, as cadeias
proteínas compatíveis com a vida e nos conferissem as polipeptídicas formadas pelos aminoácidos são dife-
adaptações que apresentamos atualmente. rentes. Portanto, os genes também o são. Observe:
GAATGGCTCAATTGCCAAGCTA → gene A
DESIGNUA/ISHUTTERSTOCK

célula
CGGCTACTACTACTCAATTGCCGGTCAGGACT → gene B
núcleo

cromossomo
Entre as principais características do DNA, está a ca-
pacidade de replicação. Para isso, a dupla fita de DNA é
aberta, expondo as duas fitas individuais com as bases
nitrogenadas expostas para que novas bases possam se
centrômero ligar e formar uma nova fita complementar para cada fita
do DNA de origem. Com as fitas moldes sendo comple-
DNA
mentadas, são produzidas duas novas moléculas de DNA.
estrutura de
pentose e fosfato Outro aspecto importante dessa molécula é a
cromátides-irmãs
mutabilidade. Ao longo do processo de replicação do
gene
DNA, é possível que ocorram alterações na sequência de
citosina
guanina
bases nitrogenadas, de maneira que pode ser adiciona-
adenina
timina
da, por exemplo, uma guanina no lugar de uma adenina,

Material exclusivo para professores


pareando erroneamente com uma timina. Essa simples
troca de uma base pode gerar alteração na produção de
As regiões codificadoras, os genes, estão presentes nos cromossomos,
em uma das cromátides-irmãs. Elementos representados fora da escala um aminoácido, que pode ser trocado por outro, o que
de tamanho. Cores fantasia. gera uma proteína errada. É possível que algumas das

conveniados ao Sistema de Ensino


cópias geradas com base nessa fita sejam passadas para
Os genes podem variar de tamanho e cada um deles as próximas gerações e originem novas características,
é responsável por conter as informações necessárias vantajosas ou não para o indivíduo.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 196 14/12/18 12:49
123 – Material do Professor 197

Por fim, outra característica importante do DNA é


mutação
a tradução em forma e função. A molécula de DNA

BIOLOGIA 1B
é utilizada como molde para transcrição de uma molé- TAGCACGT dupla fita recém-
cula de fita simples de mRNA, que contém uracila no -sintetizada
ATCGTGCA
lugar de timina. Essa fita de mRNA é lida e utilizada
como molde para que as trincas de bases nitrogena- ATCGTGCA
dupla fita de
das nela contidas sejam traduzidas em aminoácidos DNA molde
TAGCGCGT
e composta em uma cadeia de proteína. mutação
ATCGCGCA dupla fita recém-
-sintetizada
VOCABULÁRIO GENÉTICO TAGCGCGT

Os termos utilizados em Genética não são comuns No modelo de estrutura molecular de DNA acima, hipoteticamente
em nosso cotidiano. Por isso, entendê-los e associá- ocorrem duas mutações durante a replicação. A timina é trocada por
uma adenina em uma fita. Na outra fita, a timina é substituída por uma
-los aos conceitos corretos é fundamental para melhor citosina. Repare que as fitas recém-sintetizadas com base na fita molde
compreender esse tema. também são diferentes por conta das mutações.

UDAIX/SHUTTERSTOCK
GENOMA RNA Transcrição
Trata-se do conjunto de todos os genes Proteína
o
s c ri ç ã
presentes no DNA existente nas células de
um organismo. No passado, esse conceito Gene Gene Gene Gene
n
Tr a

era relacionado ao número de cromossomos


presentes nas células haploides de organis-
mos ou espécies. Assim, na espécie humana,
o
s c ri ç ã

há 23 cromossomos com aproximadamente DNA

19 mil genes codificantes. A seguir, podemos


n
Tr a

Proteína
observar um gráfico comparativo entre o ta- Tradução
RNA
manho do genoma dos principais grupos de ácido ribonucleico
organismos existentes, em que o tamanho
do genoma é representado em megabase Citosina Guanina Adenina Uracila Timina
(1Mb = 106 bases). Podemos perceber que
o tamanho do genoma das angiospermas é DNA
o mais variável, enquanto a média geral do Ácido desoxirribonucleico

tamanho dos genomas em outros organis- O esquema mostra a formação do RNA com base no DNA. As informações
mos é entre 5 mil e 10 mil Mb, ou seja, em contidas no RNA são responsáveis pela produção das proteínas formadas pela união
de polipeptídeos.
torno de 10 bilhões de bases nucleotídicas.

Angiospermas
Gimnospermas
Monilófitas
Licófitas
Briófitas
Nematódeos
Platelmintos
Anelídeos
Equinodermos
Moluscos
Aracnídeos
Crustáceos
Insetos
Mamíferos
Aves
Répteis
Anfíbios
Peixes teleósteos

Material exclusivo para professores


Peixes condrictes
Peixes dipnoicos
Peixes cartilaginosos
Peixes agnatos
10 100 1 000 10 000 100 000

conveniados ao Sistema de Ensino


Tamanho do genoma (Mb)

Gráfico comparativo do tamanho do genoma de diversos organismos.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 197 14/12/18 12:49
198 124 – Material do Professor

LEITURA COMPLEMENTAR os sexos) e sexuais (responsáveis principalmente por


BIOLOGIA 1B

determinar o sexo, sendo o feminino representado por


O tamanho do genoma humano XX e o masculino por XY em seres humanos). Nas
De acordo com um estudo publicado na revista Human aves, ZZ está relacionado à fêmea e ZW, ao macho. A
Molecular Genetics em 2014, o genoma humano tem apro- representação dos cromossomos varia de acordo com
ximadamente 19 mil genes, 1 700 a menos do que os genes os grupos de organismos estudados.
encontrados nas anotações mais recentes e bem abaixo

ZUZANAE/SHUTTERSTOCK
do esperado inicialmente. Além disso, foi concluído cromossomos
Cariótipo humano
nesse projeto que quase todos os genes encontrados têm autossômicos
ancestralidade com datação de mais de 50 milhões de
anos atrás, bem antes de os primeiros primatas surgirem.
Mais de 90% dos genes humanos foram originados em
organismos metazoários primitivos, há milhões de anos. 1 2 3 4 5
Essa informação nos faz compreender que as diferenças
entre primatas e humanos está relacionada à regulação
gênica e a diferenças nas funções básicas das proteínas. 6 7 8 9 10 11 12
Para chegarem a esses resultados, foram realizadas aná-
lises de proteômica – ferramenta com grande eficácia
para detectar moléculas de proteínas. Com base em 13 14 15 16 17 18
dados de sete estudos com espectrometria de massa,
foram avaliados mais de 50 tecidos humanos no intui- cromossomos
19 20 21 22 23 24
to de identificar quais genes realmente são capazes de sexuais
produzir proteínas.
Cariótipo humano de um indivíduo do sexo masculino. A presença
Essa metodologia serviu para identificar apenas 12 mil dos cromossomos sexuais XX determina o sexo biológico feminino.
proteínas e suas regiões correspondentes no genoma. A presença dos cromossomos XY determina o sexo masculino. Os
demais cromossomos, denominados autossômicos, não apresentam
Essa divergência do número inicial de genes (19 mil para diferenças entre os sexos. Elementos representados fora da escala de
12 mil) ocorre em razão da existência de proteínas que tamanho. Cores fantasia.
não codificam características visíveis ou porque o qua-
dro de leitura não suporta a capacidade de codificação
delas. Entretanto, não é porque as proteínas não apare- Locus, alelos e genes
cem no método de proteômica que necessariamente elas Os genes, como mencionado anteriormente, são
não são expressas, pois podem estar em concentrações os segmentos de DNA capazes de codificar proteínas
muito baixas, ter uma vida muito curta ou ainda estar e correspondem a aproximadamente 2% do total do
presentes em apenas alguns tecidos restritos, localiza- genoma. O local ocupado pelo gene no cromossomo
ções de difícil detecção pela técnica etc. é denominado locus gênico. Quando nos referimos a
mais de um local ou a mais de um gene, dizemos que
Mesmo assim, isso nos leva a refletir a respeito da quanti-
são loci gênicos (no plural). Esse mesmo local é ocupa-
dade de genes e da complexidade dos organismos: temos
do pelos mesmos genes nos cromossomos homólogos.
um número de genes muito semelhante ao número dos
nematódeos (Caenorhabditis elegans), um verme que mede
Cada gene pode ter variações de sua cópia, de for-
aproximadamente um centímetro de comprimento. Isso
ma que, em um dos cromossomos homólogos, pode
sugere que a complexidade humana não está relacionada
ter uma variante da que está no outro cromossomo.
à quantidade de genes, mas em como eles são usados. Essas duas variantes muitas vezes geram a codificação
de proteínas diferentes. Por exemplo, a sequência A
Fonte: <http://sci-hub.tw/10.1093/hmg/ddu309/>.
Acesso em: 8 nov. 2018. (Adaptado). Tradução interna/ Public codifica para uma proteína X, enquanto a sequência a,
Broadcasting Service. presente no seu cromossomo homólogo, codifica para
uma proteína Y. Assim, dizemos que alelo é a variação
que determinado gene pode ter entre os cromossomos
homólogos. Para fins didáticos, o gene A pode ser, por
COMPONENTES DA GENÉTICA exemplo, o responsável pela cor dos olhos, para o qual
o alelo A produz olhos castanhos e o alelo a, olhos
Cromossomos
azuis. Na realidade, a cor dos olhos é um processo
O DNA está presente em forma de cromossomos

Material exclusivo para professores


muito mais complexo e envolve muitos genes (esse
no núcleo das células eucariontes, em formato de assunto será discutido em outros módulos). Quando
cromatina. São chamamos de cromossomos homó- um gene tem apenas uma variação, os alelos podem
logos quando os pares contêm as mesmas informa- ser representados como alelo A e a ou B e b, respec-

conveniados ao Sistema de Ensino


ções genéticas para características idênticas. tivamente. Além disso, quando o gene tem mais de
Os cromossomos são classificados em autossômicos quatro variantes (por exemplo, alelos A1, A2, A3 e A4),
(responsáveis pelas características comuns a ambos dizemos que o gene é polimórfico.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 198 14/12/18 12:49
125 – Material do Professor 199

JOSHYA/SHUTTERSTOCK
O fenótipo, por sua vez, é definido como uma carac-
terística apresentada no indivíduo, seja em relação à mor-

BIOLOGIA 1B
locus A

fologia, à fisiologia, à bioquímica ou ao comportamento.

AGE FOTOSTOCK / ALAMY STOCK PHOTO


cromossomo
cromossomo alelo A1 alelo A2 homólogo 1’
homólogo 1

locus B

Os alelos são a variação de um mesmo gene e ocupam o mesmo locus


nos cromossomos homólogos. Elementos representados fora da escala
de tamanho. Cores fantasia.

O genótipo refere-se à constituição gênica de um


indivíduo, isto é, aos genes que este tem. Geralmente
A presença de sardas
os genes são representados por letras (Aa, AA, aa,
é um exemplo de
A1A1, A1A2 etc.). fenótipo.

LEITURA COMPLEMENTAR
Autofecundação, fecundação cruzada e combinações gênicas
As diferentes formas de reprodução resultam em aumento ou diminuição da variabili-
dade genética. Na autofecundação, os gametas femininos e masculinos são provenien-
tes do mesmo indivíduo. Isso é comum na maioria das plantas e em alguns animais
hermafroditas, como a tênia, capaz de realizar esse tipo de fecundação. Do ponto de
vista evolutivo, esse processo é bastante desvantajoso porque reduz a variabilidade
genética dos indivíduos gerados, se comparado à fecundação cruzada.
Ao longo da evolução, a fecundação cruzada ocorreu entre gametas originados de
indivíduos diferentes e de sexos diferentes. Embora existam animais hermafrodi-
tas, isto é, que têm os dois aparelhos reprodutivos, algumas espécies monoicas se
reproduzem por meio da fecundação cruzada, como caramujos e minhocas. Isso
resulta no aumento da variabilidade genética das populações durante a meiose, o
que gera novas combinações gênicas. Tal processo possibilita aos novos indivíduos
receberem alelos variáveis, o que promove novas adaptações ao ambiente.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 199 14/12/18 12:49
200 126 – Material do Professor

ROTEIRO DE AULA
BIOLOGIA 1B

FUNDAMENTOS DA GENÉTICA

Histórico de descobertas na Genética Vocabulário genético

1965 Mendel Genoma

Conjunto dos genes contidos


Com base em experimentos com ervilhas, no DNA da célula ou espécie.
sugeriu a existência de fatores responsáveis
pela hereditariedade.
Cromossomos

1953 Watson, Crick e Franklin


Classificados em

Descrição da estrutura do DNA

Sexuais Autossômicos

1996 É clonado o primeiro mamífero

Genes Alelos

2003 Sequenciamento do genoma humano


Localização dos genes:

Características do DNA
Locus

Genótipo
Replicação

Mutação Constituição gênica do indivíduo

Fenótipo
Tradução

Material exclusivo para professores Características presentes no


indivíduo

conveniados ao Sistema de Ensino


Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 200 14/12/18 12:49
127 – Material do Professor 201

EXERCÍCIOS DE APLICAÇÃO

BIOLOGIA 1B
1. Sistema Dom Bosco – A Genética é uma área de pes- Essa afirmativa está correta? Justifique.
quisa que tem avançado bastante nos últimos anos,
necessitando, inclusive, que o material genético seja Sim, porque um gene pode ter vários alelos que produzem proteínas dife-
transformado em dados binários para que sejam analisa-
dos por meio de softwares potentes. Com base nessas rentes. Consequentemente, produzirão novas características. Além disso,
informações e em seu conhecimento sobre o assunto,
marque a alternativa com o nome correto de todo o estas podem variar de acordo com a interação do gene com o ambiente.
conjunto gênico presente nas células dos organismos.
a) Locus
b) Gene
c) Alelo 4. Fuvest-SP (adaptada) – O genoma é o conjunto de
d) Cromossomo todos os genes de um organismo.
e) Genoma É correto afirmar que o genoma
O nome de todo o conjunto gênico presente nas células dos orga- a) varia entre os tecidos do corpo de um indivíduo.
nismos é genoma.
b) é semelhante em indivíduos de uma mesma espécie,
2. Sistema Dom Bosco – A respeito das características mas difere entre espécies.
do DNA que permitem que ele seja a base principal c) não distingue procariotos de eucariotos.
de todo avanço nas pesquisas em Genética, marque a d) é o mesmo em todas as formas de vida.
alternativa correta. A alternativa A está incorreta, porque não varia entre os tecidos. A alter-
a) Ao longo do processo de replicação, podem ocorrer nativa C está incorreta, pois consegue distinguir eucariotos de procario-
tos. A alternativa D está incorreta, porque varia entre as formas de vida.
mutações, que permitem produzir diferentes pro-
teínas e, consequentemente, novas características 5. Unifor-CE (adaptada) – Um estudante, ao iniciar o
fenotípicas. curso de Genética, anotou o seguinte:
b) O DNA consegue se replicar, de maneira que sua I. O gene é todo o genoma do indivíduo.
cópia é sempre conservativa.
II. Cada par de alelos presentes nas células diploides
c) O fato de o DNA possuir cinco nucleotídeos (adenina, separam-se na meiose, de forma que cada célula
guanina, citosina, timina e uracila) e estes estarem haploide recebe apenas um alelo do par.
em qualquer ordem permite que produzam genes di-
ferentes e, consequentemente, proteínas diferentes. III. Locus é o lugar onde o cromossomo se encontra.
d) A molécula de DNA é utilizada para produção de Com base em seus conhecimentos, marque a alter-
proteínas, e um locus será utilizado como molde para nativa correta.
sua formação. a) A afirmativa I está correta.
A alternativa B está incorreta, porque a cópia é semiconservativa. A
alternativa C está incorreta, pois o DNA não tem uracila. A alternativa D b) A afirmativa II está incorreta.
está incorreta, porque as proteínas são geradas com base nos genes.
O locus é o local onde se encontra o gene que tem a informação para c) A afirmativa III está incorreta.
produzir determinada proteína. d) As afirmativas I e II estão incorretas.
e) As afirmativas I e III estão incorretas.
3. UnB (adaptada)
A afirmativa I está incorreta, porque o gene é uma região codificante
O que é VIDA? do genoma responsável pela produção de uma proteína. A afirma-
tiva III está incorreta, pois o locus é uma região onde se encontra
Para a ciência, o conceito de vida para um ser vivo é algo determinado gene ou alelo.
que precisa atender a certas definições. Entre elas: temos
a definição de vida segundo a Genética: “Um sistema vivo 6. Cesesp-PE (adaptada) – O gene do albinismo somente
se expressa quando está em par e situa-se no mesmo
é capaz de evoluir por seleção natural”. Genes diferentes
locus, sendo a cor de pele, o caráter normal, transmi-
são responsáveis por características diferentes do organis-
tido por um gene que se expressa mesmo em dose
mo. Na reprodução, esse código genético é passado para
simples. Descreva o que significa a palavra destacada.
o organismo gerado. Ocasionalmente, pequenas “falhas”
ocorrem na replicação do código, e surgem indivíduos com Locus é a região onde se encontra determinado gene ou alelo em um
pequenas variações – ou mutações.”
cromossomo.
Com base no texto e em seus conhecimentos, analise
a frase a seguir: Diferentes características podem ser
codificadas por um mesmo gene.

EXERCÍCIOS PROPOSTOS
7. Sistema Dom Bosco – A Genética é a ciência que es- permite os estudos genéticos nos mais diversos

Material exclusivo para professores


tuda a transmissão de caracteres herdados ao longo contextos:
das gerações. Esse ramo foi iniciado em 1865 com a) Constituir os cromossomos.
os experimentos de Mendel, nos quais descreveu
b) Apresentar somente regiões codificantes.
a existência de um fator responsável por transmitir
c) Replicar-se, ser traduzido e ser mutável.

conveniados ao Sistema de Ensino


as características aos descendentes. Hoje sabemos
que é o DNA. Marque a alternativa que apresente d) Ter a estrutura em formato de dupla hélice.
as principais características dessa molécula que e) Apresentar timina em sua composição.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 201 14/12/18 12:49
202 128 – Material do Professor

8. PUC-RS (adaptada) – Ervilhas amarelas são A1A1. O d) São cópias mutadas dos cromossomos.
BIOLOGIA 1B

símbolo “A1” se refere a ______, que se localiza em e) São cópias variantes de um mesmo gene.
um locus do cromossomo. Marque a alternativa que
completa corretamente a frase acima: 12. Sistema Dom Bosco – Genoma é o conjunto básico
a) um genoma d) um alelo de cromossomos que aparece nos gametas. No caso da
b) um locus e) uma cromátide espécie humana, é formado por 23 cromossomos, nos
c) um cromossomo quais estão localizados todos os genes da espécie. O
maior cromossomo humano, o de número 1, apresenta
9. Cesgranrio-RJ (adaptada) – As células de um in- um DNA com 250 milhões de pares de bases, enquanto o
divíduo, para um determinado locus, apresentam cromossomo Y, o menor desse genoma, tem 50 milhões de
___________ em _____________. pares de bases. O genoma humano apresenta 3 bilhões de
pares de bases que representam 100 000 genes; assim, o
As lacunas da frase podem ser corretamente preen- comprimento médio de um gene é de 3 000 pares de bases.
chidas por:
O gene é
a) o mesmo gene – em ambos os cromossomos ho-
mólogos a) um tipo de RNA.
b) genes diferentes – em cromossomos diferentes b) a parte do DNA capaz de produzir proteínas.
c) a região não codificante do DNA.
c) o mesmo gene – em cromossomos sexuais
d) o local onde encontramos os alelos.
d) o genoma completo – em ambos os cromossomos
homólogos e) uma porção do cromossomo que ajuda na estrutu-
ração da molécula.
e) o genoma completo – em cromossomos diferentes
13. Sistema Dom Bosco – No programa de melhoramento
10. Sistema Dom Bosco – De acordo com pesquisas rea- genético desenvolvido na Universidade Federal Rural do
lizadas em 2012, os macacos bonobos e os humanos Semiárido (Ufersa), foram obtidas famílias de melão gália
partilham 98,7% do mesmo mapa genético e isso os a partir de cinco gerações originadas por autofecunda-
tornam muitos mais similares entre si. Curiosamente, ção provenientes do cruzamento entre os híbridos das
essa porcentagem é a mesma compartilhada entre o linhagens DRG 1537 e AMR-04, com o intuito de avaliar
genoma dos seres humanos e os chipanzés. determinados fenótipos, como peso médio do fruto, pro-
Disponível em: <http://g1.globo.com/ciencia-e-saude/noti-
porção da cavidade interna, espessura da polpa, firmeza da
cia/2012/06/mapa-genetico-do-macaco-bonobo-e-987-igual-ao-
-humano-diz-nature.html>. Acesso em: 8 nov. 2018. polpa , entre outros aspectos, e relacioná-los às possíveis
alterações quando são produzidos em determinados am-
Descreva como o genoma pode ser conceituado. bientes O resultado encontrado foi que há diferenças nos
fenótipos em relação aos ambientes em que foram pro-
duzidos, principalmente em razão da grande variação da
composição do solo e do manejo de cultura em cada local.
A respeito esse tipo de cruzamento, é correto afir-
mar que
a) promove variabilidade genética nos organismos.
b) somente os melões são capazes de realizar a auto-
fecundação.
c) a autofecundação ocorre por meio da fecundação
entre gametas oriundos de um mesmo indivíduo.
d) a autofecundação ocorre por meio da fecundação
11. Sistema Dom Bosco – O gene MC1R possui diversos
entre gametas oriundos de organismos diferentes.
alelos associados aos cabelos ruivos, pele clara e sar-
das em europeus. Ainda, sabe-se que a atuação do gene
14. UFMG (adaptada) – Observe esta figura, em que está
MC1R determina a proporção entre eumelanina (colo-
representado o cromossomo X:
ração castanha/preta) e feomelanina (amarela/vermelha)
presente nos melanócitos. Com base nisso, Simões e co-
laboradores em 2013 avaliaram a relevância dos alelos do
MC1R na população brasileira e descobriram que existe
Gene dominante para a
grande variação, sendo mais da metade relacionada à Gene dominante para síntese de G-6-PD
feomelanina, enquanto algumas mutações foram mais visão em cores
relacionadas à eumelanina. Mutação + ambiente
Mutação favorável
A alternativa que melhor descreve o que são os alelos

Material exclusivo para professores


está representada por:
Daltonismo Crise hemolítica anemia
a) São o número de pontes de hidrogênio existentes
em um cromossomo. A enzima G-6-PD (glicose-6-fosfato desidrogenase), pre-
sente nas hemácias, está envolvida no metabolismo da
b) São a quantidade de nucleotídeos presentes dentro

conveniados ao Sistema de Ensino


glicose. Sabe-se que a deficiência dessa enzima torna a
de um gene.
hemácia sensível a certas drogas, por exemplo, alguns
c) São loci diferentes presentes nos cromossomos. tipos de analgésicos.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 202 14/12/18 12:49
129 – Material do Professor 203

Agora analise este quadro:

BIOLOGIA 1B
Variante da Atividade
Genes Quadro clínico
G-6-PD enzimática (%)
B B 100 Normal
A A 80-100 Normal

Sensibilidade a drogas; crise


A- A- 10-20 hemolítica leve

Sensibilidade a drogas; crise


Med B- 0-5
hemolítica grave

Considerando a figura do cromossomo X apresentada e as informações contidas nesse


gráfico, responda: os genes que determinam os diferentes tipos da enzima G-6-PD
são alelos? Justifique sua resposta.

15. Sistema Dom Bosco – Evidências comprovam que os vikings eram muito mais sofisti-
cados e bem viajados do que sua reputação bárbara indica. Testes de DNA mostram que
quatro famílias diferentes na Islândia têm uma variante genética comum apenas a nativos
americanos e asiáticos. Um estudo realizado pela Universidade da Islândia oferece provas
convincentes de que pelo menos uma mulher americana nativa foi levada do continente
para a Islândia, sendo que seu DNA remonta a pelo menos 1 700, e, de acordo com uma
mutação, provavelmente até centenas de anos antes. Há pouca evidência histórica que
sustente essa teoria, entretanto. Enquanto os vikings relataram contato com os nativos
(que eles chamavam de “Skraelings”), a maioria desse contato era aparentemente hostil.
Analisando-se o DNA, foi possível inferir essa informação, o que inclusive é pouco
relacionado com evidências históricas, conforme explicado no texto acima. Com base
nessas informações e em seus conhecimentos, cite e explique as principais caracte-
rísticas do DNA que possibilitam realizar análises como essa.

16. UEPB (adaptada) – Sobre o vocabulário genético, associe corretamente os numerais


com as letras:
I. genótipo III. gene
II. fenótipo

Material exclusivo para professores


A. Cada segmento de DNA capaz de transcrever sua mensagem em uma molécula
de RNA.
B. É a constituição genética de um organismo, ou seja, o conjunto de alelos que ele
herdou dos genitores.

conveniados ao Sistema de Ensino


C. São as características internas ou externas de um ser vivo, geneticamente deter-
minadas.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 203 14/12/18 12:49
204 130 – Material do Professor

Assinale a alternativa correta: 17. UFPI – As células musculares são diferentes das células
BIOLOGIA 1B

a) I-A ; II-B ; III-C nervosas porque


b) I-B ; II-A ; III-C a) contêm genes diferentes.
c) I-B ; II-C ; III-A b) possuem maior número de genes.
d) I-A ; II-C ; III-B c) usam códigos genéticos diferentes.
e) I-C ; II-B ; III-A d) possuem menor número de genes.
e) expressam genes diferentes.

ESTUDO PARA O ENEM


18. Enem (adaptado) C5-H17 19. Enem C5-H17
Define-se genoma como o conjunto de todo o material Em um hospital, acidentalmente, uma funcionária
genético de uma espécie que, na maioria dos casos, são ficou exposta a uma alta quantidade de radiação libe-
as moléculas de DNA. Durante muito tempo, especulou- rada por um aparelho de raios X em funcionamento.
-se sobre a possível relação entre o tamanho do genoma Posteriormente, ela engravidou e seu filho nasceu
medido pelo número de pares de bases (pb), o número de com grave anemia. Foi verificado que a criança apre-
proteínas produzidas e a complexidade do organismo. As sentava a doença em razão da exposição anterior da
primeiras respostas começam a aparecer e já deixam claro mãe à radiação.
que essa relação não existe, como mostra a tabela abaixo.
O que justifica, nesse caso, o aparecimento da anemia
na criança?
Tamanho
No de a) A célula-ovo sofreu uma alteração genética.
Nome estimado
Espécie proteínas
comum do genoma b) As células somáticas da mãe sofreram uma mutação.
descritas
(pb) c) A célula gamética materna que foi fecundada sofreu
Oryza sativa Arroz 5.000.000.000 224.181 uma mutação.
Mus Camundongo 3.454.200.000 249.081 d) As hemácias da mãe que foram transmitidas à crian-
musculus ça não eram normais.

Homo Homem 3.400.000.000 459.114 e) As células hematopoiéticas sofreram alteração do


número de cromossomos.
sapiens
Rattus Rato 2.900.000.000 109.077 20. Sistema Dom Bosco C5-H17
norvegicus A partir da genômica, área da ciência que estuda o geno-
ma de um organismo, muitas informações importantes são
Drosophila Mosca-da- 180.000.000 86.266
obtidas, como a presença de mutações nos genes BRCA1
melanogaster -fruta
e BRCA2 – genes de suscetibilidade ao câncer de mama.
De acordo com as informações acima: Para obter essas informações, pesquisadores utilizam di-
a) A maior porção do genoma é codificante e produz versas técnicas moleculares que se baseiam em extrair,
proteínas. amplificar, sequenciar e analisar o material genético de
determinado organismo.
b) A produção de proteínas não está vinculada à mo-
lécula de DNA. A respeito do genoma, é correto afirmar que
c) O tamanho do genoma não é diretamente propor- a) é constituído por todos os DNAs de um organismo.
cional ao número de proteínas produzidas pelo or-
ganismo. b) é constituído apenas por regiões codificantes.
d) Quanto mais complexo o organismo, maior o tama- c) é constituído apenas por íntrons.
nho de seu genoma.
e) Genomas com mais de um milhão de pares de bases d) são como denominamos os cromossomos sexuais.
são encontrados apenas nos seres invertebrados.

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 204 14/12/18 12:49
8
131 – Material do Professor 205

GENÓTIPO, FENÓTIPO
28

BIOLOGIA 1B
E LINHAGENS

A população das Ilhas Salomão, localizadas ao sul do Oceano Pacífico, próximo à


Austrália, tem como características pele negra e cabelos loiros. A região da Oceania
que compreende as Ilhas Salomão e um conjunto de outras ilhas recebe o nome de • Genótipo e fenótipo
Melanésia justamente em referência a esta característica de sua população: pele • Linhagem
com maior concentração de melanina.
Acreditava-se que esses traços físicos tão distintos fossem o resultado da expo- HABILIDADES
sição excessiva ao sol associada a uma dieta rica em peixes. Outra hipótese era de • Compreender os conceitos
que as madeixas loiras fossem herança de ancestrais europeus que exploraram a de genótipo e fenótipo.
região no passado. Entretanto, em 2012, pesquisadores da Universidade de Standford • Diferenciar alelos dominan-
(EUA) realizaram a análise genética de 43 pessoas negras e loiras e 42 negras de tes de alelos recessivos.
cabelos pretos, totalizando 85 amostras coletadas ao longo das ilhas. Com base nos • Identificar genótipos homo-
resultados encontrados, os cientistas descobriam que essa ocorrência de cabelos zigotos e heterozigotos.
loiros é algo bem diferente: a população das Ilhas Salomão tem uma variante em um • Entender o que são
gene, chamado TYRP1, que atua na pigmentação. Segundo a doutora Kenny e sua linhagens.
equipe, essa variante não existe nas populações europeias. Dessa forma, todos os
• Identificar linhagens puras
indivíduos com o genótipo TT têm cabelos loiros, enquanto aqueles com o genótipo ou selvagens e linhagens
CT ou CC têm cabelos escuros. híbridas.
O alelo T, ao ser traduzido, produz uma proteína que contém o aminoácido
• Compreender o que é
cisteína, enquanto indivíduos que têm o alelo C produzem uma proteína que con- fenocópia.
tém o aminoácido arginina na mesma posição. Ou seja, em vez de uma cisteína,
é produzida uma arginina, e essa variação altera a pigmentação dos cabelos.
Isso mostra como uma única variação de um gene é capaz de resultar em uma
característica única, incomum no resto do mundo.
OLIVER FOERSTNER/SHUTTERSTOCK

Material exclusivo para professores


conveniados ao Sistema de Ensino Criança nativa das Ilhas Salomão.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 205 14/12/18 12:49
206 132 – Material do Professor

GENÓTIPO E FENÓTIPO
BIOLOGIA 1B

Um gene codifica uma proteína e pode ter variantes denominados alelos. Con-
siderando que o gene está localizado no cromossomo e que esse cromossomo tem
dois braços, podemos dizer que os alelos estão em pares. O conjunto alélico refe-
rente ao gene é denominado genótipo, sendo este responsável por expressar as
características de um indivíduo.
Os alelos são representados por letras. Por exemplo: em ervilhas, temos os alelos
A e a, que, quando aparecem juntos, produzem indivíduos de cores diferentes. Os
genótipos de ervilhas amarelas são AA ou Aa, e o das
ervilhas verdes é aa.
JOSHYA/SHUTTERSTOCK

Em cromossomos homólogos, podemos observar


cor dos olhos
diversos genes com características diferentes, que tra-
duzem proteínas com funções distintas umas das outras.
Seus alelos estão localizados nas mesmas regiões dos
cromossomos homólogos.
tipo sanguíneo Os genótipos dos organismos são denominados
homozigotos quando existem duas cópias do mesmo
alelo (AA ou aa) e heterozigotos quando há cópias
de alelos diferentes (Aa). No exemplo da cor de ervi-
cor do cabelo
lhas, os genótipos AA ou aa (amarelas) são homozigotos,
e os genótipos heterozigotos são Aa (verdes).
Os alelos são classificados também quanto à do-
crescimento minância, podendo ser dominantes ou recessivos. Um
alelo dominante é aquele cuja presença de apenas
uma cópia já é suficiente para expressar determinada
característica. Sendo assim, os alelos dominantes po-
Cromossomos homólogos que contêm genes diferentes. Elementos dem estar presentes tanto em genótipos homozigóticos
representados fora da escala de tamanho. Cores fantasia. quanto em genótipos heterozigóticos.

Genes e alelos
Gene: Unidade hereditária
Ocupam o
mesmo locus em
cromossomos
homólogos
Locus: local definido
ocupado pelo gene no
cromossomo

A A A a a a

homozigoto heterozigoto homozigoto


AA Aa aa

Representação esquemática do local em que os genes estão e as possíveis combinações dos alelos. Elementos

Material exclusivo para professores


representados fora da escala de tamanho. Cores fantasia.

No exemplo da cor de ervilhas, a característica amarela é resultante da combi-


nação dos alelos, gerando dois genótipos.

conveniados ao Sistema de Ensino Genótipos: AA e Aa → Característica: ervilha amarela

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 206 14/12/18 12:49
133 – Material do Professor 207

No caso de recessivo, são necessárias duas cópias à dos coelhos naturalmente negros, sendo essa
do mesmo alelo para que determinada característica característica considerada uma fenocópia destes últi-

BIOLOGIA 1B
seja expressa. Portanto, eles sempre apresentam ge- mos. Isso acontece porque, embora o genótipo dos
nótipo homozigoto. coelhos himalaia seja o mesmo, ele se expressa de
forma diferente por influência dos fatores ambien-
Genótipo: aa → Característica: ervilha verde tais – nesse caso, a temperatura.

LINN CURRIE/SHUTTERSTOCK
O fenótipo é a expressão de um genótipo por meio
de características visíveis, influenciadas ou não por fa-
tores ambientais. Um exemplo da expressão fenotípica
é o formato de “V” do cabelo na testa.
ALLSTAR PICTURE LIBRARY / ALAMY STOCK PHOTO

Coelho da raça himalaia.

Outros exemplos de fenocópias podem ser obser-


vados em humanos, como cabelos tingidos e bronzea-
mento artificial. Trata-se de fenótipos diferentes dos
genótipos dos indivíduos, que ocorrem por causa de
influências ambientais (externas).

Fenótipo é a característica manifestada resultante de um genótipo. O "bico SHUTTERSTOCK


de viúva” (cabelo em V no meio da testa) é um fenótipo dominante.
O bronzeamento da pele produz uma característica fenotípica diferente
Fatores ambientais podem determinar o apareci- daquela que o genótipo induz.
mento de um fenótipo completamente diferente do
correspondente ao genótipo existente no indivíduo. LEITURA COMPLEMENTAR
Quando esse fenômeno ocorre em virtude de in-
fluências ambientais, é denominado fenocópia. Os Primeiro homem britânico era negro e tinha
coelhos da raça “himalaia”, que vivem em regiões de olho azul, diz estudo
temperaturas elevadas, têm pelagem branca e colo- Os primeiros habitantes da Grã-Bretanha, que viveram
ração escura na cauda, no focinho, nas orelhas e nas

Material exclusivo para professores


há cerca de 10 mil anos, provavelmente tinham a pele
patas. Dependendo da variação de temperatura no am- negra de acordo com uma análise do DNA do mais an-
biente, as manchas escuras podem se alastrar pelo tigo esqueleto humano encontrado na ilha. De acordo
animal, cobrindo áreas maiores do corpo, ou podem com os cientistas, 10% dos habitantes brancos da Grã-

conveniados ao Sistema de Ensino


aparecer manchas em outras regiões. Entretanto, -Bretanha atual, entre aqueles que têm ancestrais britâ-
quando vivem em regiões de baixas temperaturas, nicos, descendem dessa primeira população.
esses animais apresentam pelagem escura, similar

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 207 14/12/18 12:49
208 134 – Material do Professor

O fóssil no qual os estudos se basearam, conhecido como do passado com base em como elas se parecem hoje – e
BIOLOGIA 1B

Homem de Cheddar, é um esqueleto do período Meso- que as associações entre características físicas às quais
lítico – há cerca de 10 mil anos –, descoberto em 1903 na nos acostumamos não são algo fixo”, declarou Booth.
caverna Gough, na Garganta de Cheddar, em Somerset. Exame. Disponível em: <https://exame.abril.com.br/ciencia/primeiro-
A pesquisa foi realizada por cientistas do Museu de His- homem-britanico-era-negro-e-tinha-olho-azul-diz-estudo/>.
Acesso em: nov. 2018. (Adaptado)
tória Natural do Reino Unido.

GRANT ROONEY PREMIUM / ALAMY STOCK PHOTO


Inicialmente, acreditava-se que o Homem de Cheddar
tinha pele clara e cabelo liso, mas a reconstrução de sua
aparência com base na análise do DNA sugere forte-
mente que ele tinha olhos azuis, pele “muito escura ou
negra” e cabelos escuros e crespos.

Além de ser o mais antigo fóssil da espécie humana


– o Homo sapiens – já encontrado em território britâni-
co, o Homem de Cheddar é também o esqueleto mais
completo dessa época. De acordo com os cientistas, as
populações que viviam na Europa adquiriram um tom
de pele cada vez mais claro ao longo do tempo, porque
a pele branca absorve mais luz solar, produzindo mais
vitamina D.

A nova descoberta sugere que a pele clara surgiu mais


tarde, após o surgimento da agricultura, provavelmente
porque ao mudar a dieta as populações europeias co- A diversidade das características fenotípicas e genotípicas entre as
populações mundiais decorre das migrações ocorridas no passado.
meçaram a obter menos vitamina D a partir de fontes
como peixes.

“Até recentemente, sempre se supunha que os humanos


se adaptaram rapidamente para ter uma pele mais clara
LINHAGEM
Linhagem ou variedade é o conjunto de indivíduos
depois de sua entrada na Europa há 45 mil anos. A pele
de uma espécie que têm o mesmo genótipo (deno-
mais clara é mais eficiente para absorver a luz ultra-
minada linhagem genotípica) ou o mesmo fenótipo
-violeta e isso ajuda os humanos a evitar a deficiência de
(denominada linhagem fenotípica).
vitamina D em climas com menos luz solar”, explicou
As linhagens genotípicas sempre apresentam o
um dos autores do estudo, Tom Booth, do Museu de
mesmo fenótipo, exceto quando há influência ambien-
História Natural do Reino Unido.
tal. Porém, as linhagens fenotípicas podem expressar
O Homem de Cheddar, porém, tem marcadores gené- genótipos diferentes.
ticos de pigmentação da pele normalmente associados O quadro a seguir representa três genótipos, sendo
ao biotipo das populações sub-saharianas, segundo o eles: PP, Pp (alelos dominantes) e pp (alelos recessi-
cientista. A descoberta, de acordo com ele, é coerente vos). Já o fenótipo apresenta apenas duas classes: uma
com várias outras descobertas relacionadas a fósseis de pelagem preta e outra branca. Nesse caso, existem
humanos do Mesolítico em toda a Europa. apenas duas classes de fenótipos, uma vez que há
dominância de um alelo sobre o outro.
“Ele é apenas um indivíduo, mas também é um in-
dicativo da população europeia naquela época. Eles Genótipo Fenótipo
tinham pele escura e a maior parte deles tinha olhos
bem claros – azuis ou verdes – e cabelos castanhos es- PP pelagem preta
curos. O Homem de Cheddar subverte as expectativas
sobre os tipos de traços genéticos que ocorrem juntos”, Pp pelagem preta
afirmou Booth. pp pelagem branca
De acordo com o cientista, o estudo indica que os olhos

Material exclusivo para professores


azuis se tornaram comuns na Europa muito antes da Há também divisões, como linhagens puras, que
pele clara e do cabelo loiro – características que só come- ocorrem em maior frequência na natureza e são origi-
çaram a se generalizar depois do advento da agricultura. nadas por autofecundação, as quais resultam de um
genótipo homozigoto. Já em linhagens híbridas,

conveniados ao Sistema de Ensino


“Ele (o Homem de Cheddar) nos lembra que não po- os genótipos são originados por fecundação cruzada
demos fazer suposições sobre a aparência das pessoas de duas linhagens puras e costumam apresentar ge-
nótipos heterozigotos.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 208 14/12/18 12:49
135 – Material do Professor 209

O cruzamento de plantas cujas pétalas são púr-


preciso fazer uma análise comparativa com múmias dos
puras geram descendentes com as mesmas carac-

BIOLOGIA 1B
imperadores dos Incas, mas achar esses restos é pratica-
terísticas, gerando linhagens puras. O cruzamento
mente impossível hoje”, acrescenta Santos.
entre plantas de pétalas brancas e plantas de pétalas
púrpuras resulta em pétalas púrpuras, sendo esta O artigo revela também que as duas linhagens mas-
uma linhagem híbrida. culinas estão intimamente relacionadas às populações
DIANA TALIUN/SHUTTERSTOCK
ISKYDANCER/SHUTTERSTOCK

andinas Quéchuas e Aimarás, que vivem em localida-


geradas por autofecundação des ao sul de Cusco, sede do antigo império; no norte
da Bolívia, onde floresceu o Império Tiwanaku (400 a
1200 d.C.); e ao redor do Lago Titicaca (na fronteira de
Peru e Bolívia). Essas localidades aparecem nos mitos
de origem da família real Inca.
linhagem linhagem
pura com pura com “Filtramos esse universo para os povos dos Andes, a
pétalas pétalas fim de simplificar as análises e aumentar a eficiência do
púrpuras brancas
trabalho”, comenta Fabrício Santos. O cruzamento das
informações genéticas revelou, ainda, pequenas diferen-
cruzamento ças entre linhagens indígenas das famílias Panakas que
remetem à época do Império Inca. Santos acrescenta que
uma das linhagens de cromossomos Y está distribuída
atualmente em vários indígenas dos Andes, o que po-
deria ser explicado pelos relatos de que os imperadores
linhagem híbrida tinham filhos com outras mulheres.

Além de atrair novas informações que contribuam para


o avanço das pesquisas, a divulgação desses primei-
ros resultados, de acordo com o professor, serve para
Representação das linhagens puras e híbridas de rosas com pétalas demonstrar que a “associação de dados da história e
púrpura e brancas.
da genealogia com técnicas da genética é fundamental
para resgatar histórias que os conquistadores europeus
tentaram apagar”.
LEITURA COMPLEMENTAR
RIGUEIRA JR., Itamar. Universidade Federal de Minas Gerais.
Pesquisa do IBC encontra linhagens genéticas Disponível em: <https://ufmg.br/comunicacao/noticias/
que podem estar ligadas a governantes incas pesquisadores-do-icb-encontraram-linhagens-geneticas-que-podem-
estar-ligadas-a-governantes-incas>. Acesso em: nov. 2018.

Cientistas do Brasil, do Peru e da Bolívia analisaram

BOGGY/DREAMSTIME.COM
amostras de DNA de supostos descentes dos clãs impe-
riais, que constituíam a realeza inca; as análises foram
realizadas em 19 indivíduos de 12 famílias que se de-
claram descendentes de imperadores Incas. Os estudos
identificaram duas linhagens paternas que remetem a
dois membros reais de épocas diferentes e que podem
estar ligadas direta ou indiretamente aos governantes
ou a um processo de expansão populacional ocorrida
nos Andes, nos anos 1000 a 1450 d.C.

“Identificamos duas linhagens de cromossomos Y (pas-


sados de pai para filho) que podem ter sido herdadas
dos imperadores Incas, pois são encontradas em algu-
mas famílias Panakas, que se proclamam descendentes”,
conta o professor e geneticista Fabricio Santos da UFMG
(Universidade Federal de Minas Gerais), que é um dos Análises genéticas revelaram pequenas diferenças entre linhagens
autores brasileiros da pesquisa. “Para atestar isso, seria

Material exclusivo para professores


indígenas das famílias Panakas, que remetem à época do Império Inca.

conveniados ao Sistema de Ensino


Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 209 14/12/18 12:49
210 136 – Material do Professor

ROTEIRO DE AULA
BIOLOGIA 1B

GENÓTIPO

Conjunto de alelos de determinado: Gene

Homozigoto
Responsável por expressar características
de um indivíduo que pode ser:
Heterozigoto

Manifestação de um genótipo: Fenótipo

Condicionado pelo
Homozigoto
alelo recessivo

Expressa fenótipo diferente daquele


Fenocópia
determinado pelo seu genótipo

Sofre influência Ambiental

LINHAGEM

Ocorre por fecundação cruzada: Genótipo

Híbrida Heterozigoto

Material exclusivo para professores


Ocorre por autofecundação: Genótipo

conveniados ao Sistema de Ensino


Pura Homozigoto

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 210 14/12/18 12:49
137 – Material do Professor 211

EXERCÍCIOS DE APLICAÇÃO

BIOLOGIA 1B
1. Unisinos-RS – A expressividade de um gene é o 5. Uece (adaptada) – Os geneticistas puseram à pro-
“grau de intensidade” com que ele se manifesta no va a hipótese de que a determinação e a transmissão
fenótipo do indivíduo, traduzindo o grau de expressão hereditária dos grupos sanguíneos M, MN e N é feita
do _____________. Além disso, fatores ambientais ou por genes localizados em um determinado par cromos-
intrínsecos condicionam o grau de expressividade de sômico. Esses grupos sanguíneos não mostram inci-
alguns _____________. Assim, esta expressão pode ser dência preferencial por nenhum dos sexos, de maneira
uniforme ou variável, resultando no aparecimento de que os geneticistas complementaram a sua hipótese
vários padrões de _______________. especificando que o par cromossômico que contém
os genes responsáveis pela produção dos antígenos
As lacunas são corretamente preenchidas, respecti-
M e N nas hemácias é autossômico, ou seja, não se
vamente, por:
encontram nos cromossomos sexuais. De acordo com
a) fenótipo, fenótipos, genótipos. essa informação e seus conhecimentos em genética,
b) fenótipo, genótipos, fenótipos. assinale a opção correta.
c) genótipo, fenótipos, genótipos. a) Considerando que os genes pertencentes a dois di-
d) genótipo, genótipos, fenótipos. ferentes locus são denominados alelos (do grego =
allelon, cada outro), pode-se dizer os genes M e N
e) genótipo, genótipos, genótipos. constituem um par de alelos.
O grau de expressão dos genótipos pode variar em função de fatores
ambientais, promovendo o aparecimento de vários fenótipos. b) Os genótipos MM e NN são, pois, homozigotos, en-
quanto o genótipo MN é heterozigoto.
c) Indivíduos que possuem genótipo MM, filhos de pais
2. Sistema Dom Bosco – É comum que, em experimen-
que apresentam os mesmos genótipos, representam
tos relacionados à herança de características ao longo uma linhagem híbrida.
das gerações em plantas, elas sejam autofecundadas
em diversas gerações para ter certeza se aparecerão d) O caso no texto dessa questão exemplifica um exem-
novas características ou não. Com base nessas infor- plo clássico de fenocópia.
A alternativa A está incorreta porque os genes se encontram no mesmo
mações, marque a alternativa correta. locus. A alternativa C está incorreta porque serão exemplos de linhagem
a) Plantas originadas por autofecundação são conside- pura, por terem sempre os mesmos genótipos. A alternativa D está in-
radas de linhagem pura. correta porque fenocópia se refere a um fenótipo induzido por condições
ambientais, mas assemelhado a outro determinado geneticamente.
b) Plantas originadas por autofecundação são conside-
radas de linhagem híbrida.
c) Plantas originadas por fecundação cruzada são con- 6. Sistema Dom Bosco – Os coelhos da raça himalaia
sideradas de uma linhagem pura. são caracterizados por apresentarem pelagem branca
d) Todas as plantas de linhagem pura são heterozigotas. e manchas escuras no focinho, nas orelhas, na cauda e
nas patas. Entretanto, quando esses indivíduos nascem
Plantas originadas por fecundação cruzada são denominadas linhagens
híbridas e são sempre heterozigotas, enquanto as linhagens puras são em regiões frias, eles apresentam pelagem completa-
sempre homozigotas. mente escura, sendo confundidos com coelhos negros.
Sabendo-se que o genótipo responsável por ambas as
variações na cor do pelo não sofreu mutações, como
3. Sistema Dom Bosco – A capacidade de sentir o sa- você explica a ocorrência desse evento?
bor de fenitilcarbamida, substância de sabor amargo,
é determinada pela presença do alelo P dominante. Trata-se de um exemplo de fenocópia, isto é, o genótipo foi influenciado
Em uma cidade, 75% da população consegue sentir o
sabor amargo, e 25%, não. Cite os possíveis genótipos pelo ambiente (no caso, a temperatura da região), e, por conta disso,
dentro da população para esse fenótipo.
Sabendo que o alelo P é responsável pela capacidade de sentir o sabor o fenótipo foi expresso de forma diferente.

amargo, aqueles que o sentem podem ser PP ou Pp. Já as pessoas que

não conseguem sentir o amargo apresentam genótipo pp.

4. Sistema Dom Bosco – _________ se refere à constitui-


ção genética de um organismo, representando o con-
junto completo de genes herdados por um indivíduo.
A palavra que melhor completa a frase é:
a) Genótipo
b) Gene

Material exclusivo para professores


c) Alelo
d) Cromossomo
O genótipo refere-se à constituição genética de um organismo. A alter-
nativa B está incorreta porque o gene se refere a uma região codificante

conveniados ao Sistema de Ensino


específica do DNA. Todo gene tem um genótipo. A alternativa C está
incorreta porque alelo é a variação da cópia de um gene. A alternativa
D está incorreta porque cromossomo é a molécula na qual são encon-
trados os genes.

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 211 14/12/18 12:49
212 138 – Material do Professor

EXERCÍCIOS PROPOSTOS
BIOLOGIA 1B

7. Sistema Dom Bosco – Plantas de linhagem híbrida são originadas por fecundação
cruzada entre plantas de linhagens puras. Com base nessa informação, marque a
alternativa correta:
a) Indivíduos da linhagem pura têm alelos relativos a um mesmo gene em locus
diferentes.
b) Indivíduos da linhagem pura apresentam genótipo heterozigoto.
c) Indivíduos da linhagem híbrida têm genótipo homozigoto.
d) Indivíduos da linhagem híbrida apresentam genótipo heterozigoto.

8. Sistema Dom Bosco – O quadro a seguir representa a coloração da pelagem de cães


da raça labrador.

JAGODKA/SHUTTERSTOCK

JAGODKA/SHUTTERSTOCK
ERIC ISSELEE/SHUTTERSTOCK

Preto Chocolate Amarelo


BBEE BbEE BBee
BbEE bbEe Bbee
BBEe Bbee
BbEe

Com base nessas informações, é correto afirmar:


a) Há três classes fenotípicas e sete classes genotípicas.
b) Há três classes fenotípicas e três classes genotípicas.
c) Há nove classes fenotípicas e três classes genotípicas.
d) Há três classes fenotípicas e nove classes genotípicas.

9. Sistema Dom Bosco – Uma planta de flor amarela foi cruzada com uma planta de
flor vermelha. O resultado desse cruzamento originou plantas com flores vermelhas.
A respeito desse experimento, marque a alternativa correta:
a) As plantas com flores vermelhas originadas do cruzamento representam uma li-
nhagem pura.
b) As plantas com flores vermelhas originadas do cruzamento representam uma li-
nhagem híbrida.
c) As plantas com flores vermelhas utilizadas no cruzamento representam uma li-
nhagem híbrida.
d) As plantas com flores brancas utilizadas no cruzamento representam uma linhagem
híbrida.

10. UnB (adaptada)

Material exclusivo para professores


conveniados ao Sistema de Ensino
Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 212 14/12/18 12:49
139 – Material do Professor 213

A cor da pele é definida pela interação de um número ainda não completamente deli-

BIOLOGIA 1B
mitado de genes com o meio ambiente. A figura anterior mostra um heterograma de
uma família que apresenta mutação em um gene principal de cor da pele, representado
na cor branca. A cor preta representa um alelo selvagem.
No que diz respeito à cor da pele, indivíduos com o mesmo genótipo podem apresentar
diferentes fenótipos, e indivíduos com o mesmo fenótipo podem apresentar diferentes
genótipos. Essa afirmativa está correta? Justifique sua resposta.

11. Univag-MT (adaptada) – A tabela a seguir representa as porcentagens dos grupos


sanguíneos nas populações 1 e 2. Os genótipos para os tipos sanguíneos são: ii para
tipo O (genótipo recessivo) e ab para AB. Sangues Rh positivo possuem genótipo RR
ou Rr, enquanto sangues Rh negativos possuem genótipo rr (genótipo recessivo).

Sangue Sangue Sangue Sangue


O1 AB1 O2 AB2

População 1 36% 3,5% 4% 0,5%

População 2 40% 7% 0,31% 0,05%

Com relação aos genótipos que determinam os fenótipos nos sistemas de tipagem
sanguínea ABO e Rh, é correto afirmar que:
a) 4% da população 1 é homozigota para ambos os fenótipos.
b) 0,31% da população 2 é homozigota dominante.
c) 0,05% da população 2 é heterozigota para ambos os fenótipos.
d) 3,5% da população 1 é homozigota para ambos os fenótipos.
e) 36% da população 1 é heterozigota para ambos os fenótipos.

12. Fuvest-SP (adaptada) – Uma planta heterozigota de ervilha com vagens infladas pro-
duziu por autofecundação uma descendência constituída por dois tipos de indivíduos:
com vagens infladas e com vagens achatadas.
Com base nessas informações, marque a alternativa correta:
a) As plantas parentais representam uma linhagem híbrida.
b) As vagens infladas da geração produzida são obrigatoriamente homozigotas.
c) As vagens infladas da geração produzida são obrigatoriamente heterozigotas.
d) As vagens achatadas são homozigotas dominantes.

13. Imepac-MG (adaptada) – O albinismo é uma característica de herança recessiva,


produzida pelo genótipo aa. Um cão albino, ao cruzar com uma cadela de pelagem
normal (fêmea 1), produziu três ninhadas em um total de 19 animais, todos com
pelagem de cor normal. O mesmo cão, ao cruzar com outra cadela normal (fêmea 2),
produziu uma ninhada com quatro filhotes, sendo dois normais e dois albinos. Com
base nessas informações e em seus conhecimentos, marque a alternativa correta:
a) Os filhotes originados da fêmea 1 possuem genótipo homozigoto.

Material exclusivo para professores


b) Os filhotes de pelagem normal, filhos da fêmea 2, possuem genótipo heterozigoto.
c) A fêmea 2 tem genótipo homozigoto.
d) Os filhotes albinos, filhos da fêmea 2, são heterozigotos.

conveniados ao Sistema de Ensino


14. UFRGS (adaptada) – Suponha que a condição bruxo seja uma característica de herança
genética dominante. Rony, Neville e Draco são bruxos, filhos de pais bruxos, provenien-

Dom Bosco
DB_PV_2019_BIO1_M25_32_P3.indd 213 14/12/18 12:49
214 140 – Material do Professor

tes de famílias bruxas tradicionais. Hermione é bruxa, a) A doença é expressa por mais de um gene, que, atra-
BIOLOGIA 1B

mas filha de trouxas (não bruxos). Simas é bruxo, filho vés da transcrição, controla a síntese de um lipídeo
de uma bruxa e de um trouxa. Harry é bruxo, filho de que interfere nas secreções pancreáticas.
bruxos, sendo sua mãe filha de trouxas. Com base no b) A doença é expressa por alelos em heterozigose, o
texto e em seus conhecimentos sobre genética: que reduz a secreção de enzimas pancreáticas, pois
a) Classifique as famílias de Simas e Draco em relação o gene recessivo do par inibe a ação da permeasse.
ao tipo de linhagem. c) A doença é expressa por alelos dominantes em
homozigose, que promovem a síntese de muco
que, liberado em excesso, determina a normalida-
de pancreática.
d) A doença é provocada por pelo menos um alelo do-
minante, que promove a dificuldade de secreção das
enzimas pancreáticas.
e) Um par de alelos recessivos, que levam à formação
de muco no duto pancreático, impedindo a passagem
do suco pancreático para o intestino.

16. Fuvest-SP (adaptada) – A pelagem negra em porqui-


nhos-da-índia é dominante sobre a pelagem branca.
Um criador possui um lote de animais negros, filhos
de outros animais negros, e um outro lote de animais
brancos, filhos de outros animais brancos. Curioso com
o resultado, ele cruzou um indivíduo negro com um
indivíduo branco, esperando que a prole tivesse colo-
ração intermediária. Com base nessas informações e
b) Harry é menos bruxo que Rony? Justifique sua em seus conhecimentos, marque a melhor alternativa:
resposta.
a) Toda a prole nasceu com pelagem cinza.
b) Os indivíduos negros representam linhagem híbrida.
c) Os indivíduos brancos representam linhagem pura.
d) A prole representa uma linhagem pura.

17. Sistema Dom Bosco – As galinhas da raça andaluza


são de origem espanhola. Nessa raça, o cruzamento de