Você está na página 1de 526

3800 QUESTÕES DE BIOLOGIA

01. Reservas de carboidratos nos músculos esqueléticos ficam na forma de:


a) glicogênio. b) maltose. c) ATP.
d) sacarose. e) glicose.
[A]
02. Os dois gráficos a seguir referem-se à velocidade da reação A+B  C+D, que ocorre em animais de uma mesma espécie, quando suas temperaturas variam. O
gráfico número 1 representa a reação em um indivíduo que, além dos reagentes A e B, possui o polipeptídeo E, que não ocorre no indivíduo do gráfico número 2.

V = velocidade de formação do produto C em mg/hora.


Baseado nos gráficos, responda:
a) Em que grupo de substâncias pode ser classificado o polipeptídeo E?
b) Dê duas justificativas para a sua classificação.
a) Enzima
b) Os catalisadores biológicos atuam dentro de uma faixa "ótima" de temperatura (gráfico 1).
Sem o catalisador a reação é lenta como mostra o gráfico 2.
03. As________ são compostos formados por ________unidos (as) por ligações ________e as _______são ________ orgânicos, de natureza _______sensíveis às
variações de temperatura.
Os termos que corretamente preenchem as lacunas são, respectivamente,
a) gorduras - proteínas - peptídicas - enzimas - açúcares - lipídica.
b) proteínas - aminoácidos - energéticas - gorduras - compostos - protéica.
c) proteínas - aminoácidos - peptídicas - enzimas - catalisadores - protéica.
d) enzimas - aminoácidos - hídricas - proteínas - catalisadores - lipídica.
e) proteínas - açúcares - protéicas - enzimas - açúcares - enzimática.
[C]
04. Se corarmos uma célula animal com um corante específico para RNA, a estrutura mais corada será
a) o lisossomo. b) o complexo de Golgi. c) a mitocôndria.
d) o nucléolo. e) o centríolo.
[D]
05. O esquema a seguir representa um tipo de processo energético utilizado por alguns seres vivos na natureza. Esse processo é denominado:

a) fotossíntese. b) quimiossíntese. c) fermentação.


d) respiração. e) putrefação.
[B]
06. "Ceará joga fora opção alimentar"
Segundo pesquisas da UFC, a cada ano 800 toneladas de carne de cabeça de lagosta não são aproveitadas sendo lançadas ao mar. "0 estudo sobre hidrólise enzimática
de desperdício de lagosta", título do pesquisador Gustavo Vieira, objetiva o uso de material de baixo custo para enriquecer a alimentação de populações carentes. O
processo consiste na degradação de moléculas orgânicas complexas em simples por meio de um catalisador e na posterior liofili zação. O pó resultante é de alto teor
nutritivo, com baixa umidade e resiste, em bom estado de conservação, por longos períodos.
Com base nos processos descritos no artigo anterior, assinale a opção correta.
a) As moléculas orgânicas simples obtidas são glicerídios que são utilizados pelo organismo com função reguladora.
b) As moléculas orgânicas complexas empregadas são proteínas que, ao serem digeridas em aminoácidos são utilizadas pelo organismo com função estrutural.
c) O catalisador do processo é uma enzima capaz de degradar proteínas em monossacarídeos essenciais à liberação de energia para as atividades orgânicas.
d) A hidrólise enzimática de moléculas orgânicas complexas é realizada por catalisador inorgânico em presença de água.
e) O alto teor nutritivo do produto é devido ao fato de as moléculas orgânicas simples obtidas serem sais minerais indispensáveis ao desenvolvimento orgânico.
[B]
07. Analise a seguinte experiência.
PRIMEIRA ETAPA
Procedimento:
Em dois tubos de ensaio, numerados como I e II, acrescenta-se:
TUBO I - água oxigenada + dióxido de manganês
TUBO II - água oxigenada + fígado
Resultado obtido: formação de borbulhas nos dois tubos.
Conclusão: desprendimento de gás oxigênio proveniente da decomposição da água oxigenada devido ao dióxido de manganês (Tubo I ) e alguma substância liberada pela
fígado (Tubo II).
SEGUNDA ETAPA
Procedimento: adição de nova quantidade de água oxigenada nos dois tubos da primeira etapa desta experiência.
Resultado obtido: novo desprendimento de borbulhas (gás oxigênio) nos dois tubos.
Conclusão: O dióxido de manganês (Tubo I) e a substância liberada pelo fígado (Tubo II) não foram consumidas nas reações da primeira etapa experiência.
Com base nesta experiência podemos concluir que o dióxido de manganês e a substância liberada pelo fígado são:
a) enzimas. b) catalisadores. c) ionizadores.

1
d) substâncias orgânicas. e) substâncias inorgânicas.
[B]
08. "Pesquisador brasileiro desenvolve uma bactéria que permite produzir álcool a partir do soro do leite e do bagaço da cana."
A produção do álcool pela bactéria ocorrerá graças a um processo de:
a) fermentação. b) combustão. c) fotólise.
d) oxidação eletrônica. e) respiração aeróbia.
[A]
09. Muitas estruturas do nosso organismo possuem em sua estrutura o colágeno. Quimicamente, o colágeno pertence ao grupo de:
a) carboidratos b) lipídeos c) proteínas
d) glicídeos e) ácidos nucléicos
[C]
10. Um certo tipo de macromolécula destinada à membrana plasmática celular, depende de etapas nucleares e citoplasmáticas par a sua produção, de acordo com os
percursos esquematizados a seguir:

a) Por que essas etapas começam no núcleo?


b) Qual é a composição da macromolécula ao final do percurso I? E do percurso II? Esclareça a diferença, baseando-se nas funções das organelas citoplasmáticas
envolvidas em cada percurso.
a) O núcleo contém DNA que comanda a produção das proteínas através da síntese de RNA.
b) Proteínas e Glicoproteínas porque os ribossomos produzem as proteínas que são associadas aos açúcares no Complexo de Golgi .
11. A organela citoplasmática que se origina a partir do nucléolo e que sintetiza proteínas é o
a) ribossomo. b) centríolo. c) lisossomo.
d) cloroplasto. e) complexo de Golgi.
[A]
12. A produção de ATP numa célula animal ocorre, fundamentalmente,
a) nos golgiossomos. b) nos cromossomos.
c) nos lisossomos. d) nos ribossomos. e) nas mitocôndrias.
[E]
13. Uma célula que perdeu grande quantidade de água só poderá se recuperar se colocada em solução
a) isotônica. b) hipotônica. c) hipertônica.
d) isotônica ou hipertônica. e) isotônica ou hipotônica.
[B]
14. Considere o texto a seguir.
"As células caliciformes do intestino secretam muco que é constituído, fundamentalmente, por glicoproteínas. A parte protéica do muco é sintetizada .......(I)....... e a
polissacarídica, ........(II)........"
Para completar o texto corretamente, I e II devem ser substituídos, respectivamente, por
a) nos ribossomos e nas mitocôndrias.
b) nas mitocôndrias e no complexo de Golgi.
c) no complexo de Golgi e nas mitocôndrias.
d) no retículo endoplasmático rugoso e no complexo de Golgi.
e) no retículo endoplasmático rugoso e nas mitocôndrias.
[D]
15. Dois apreciadores de vinho fizeram várias suposições sobre o assunto.
A alternativa que contém a suposição biologicamente correta é
a) "A acidez do vinho é devida aos ácidos orgânicos presentes nas leveduras utilizadas na sua fabricação."
b) "A doçura de alguns vinhos se deve à fermentação completa dos carboidratos de uva."
c) "A fermentação permite a quebra das ligações peptídicas das proteínas da uva."
d) "As folhas das parreiras realizam a fotossíntese, sem a qual não haverá a matéria-prima para a fermentação."
e) "Se o álcool não fosse adicionado durante a fabricação dos vinhos, beberíamos suco de uva."
[D]
16. Os sintomas a seguir numerados se referem aos efeitos mais marcantes da carência de algumas vitaminas no organismo humano.
I. Deformação no esqueleto e anomalias da dentição.
II. Secura da camada córnea do globo ocular e deficiência visual em ambiente de luz fraca.
III. Dificuldade de coagulação do sangue.
IV. Inflamação da pele e das mucosas, com sangramento.
Esses sintomas estão associados, respectivamente, à carência das vitaminas
a) D, E, C e A b) K, A, B e D c) B, K, A e C
d) B, D, K e A e) D, A, K e C
[E]
17. Na(s) questão(ões) a seguir escreva nos parêntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Os sais minerais existem nos seres vivos de forma
imobilizada ou dissociados em íons. Pequenas variações nas porcentagens de íons podem modificar profundamente a permeabilidad e, irritabilidade e viscosidade de
célula. Analise as propostas apresentadas.
( ) Magnésio (Mg+2) presente na clorofila é, portanto, necessário à fotossíntese.
( ) Cálcio (Ca+2) é necessário para a ação de certas enzimas em importantes processos fisiológicos.
( ) Ferro (Fé+2), presente na hemoglobina, faz parte de pigmentos importantes na respiração (citocromos).
( ) Fosfato (PO4--) é o principal cátion extra e intracelular.
( ) Cloreto (Cl - ) importante cátion presente tanto na hemoglobina quanto na clorofila.
VVVFF

2
18. O exagero na prática de exercícios físicos leva a dores musculares fortes. Isso ocorre devido ao acúmulo de:
a) ácido pirúvico. b) ácido láctico. c) ácido nítrico.
d) ácido fosfoglicérico. e) ácido fólico.
[B]
19. Na(s) questão(ões) a seguir escreva no espaço apropriado a soma dos itens corretos. Sobre as substâncias que compõem os s eres vivos, é correto afirmar que:
01. os carboidratos, os lipídios e as vitaminas são fontes de energia para os seres vivos;
02. a água é a substância encontrada em maior quantidade nos seres vivos;
04. além de sua função energética, os carboidratos estão presentes na formação de algumas estruturas dos seres vivos;
08. as gorduras constituem o principal componente estrutural dos seres vivos;
16. os seres vivos apresentam uma composição química mais complexa do que a matéria bruta, sendo formados por substâncias org ânicas, como as proteínas, os lipídios,
os carboidratos, as vitaminas e os ácidos nucléicos.
02 + 04 + 16 = 22
20. Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. A água é a substância mais abundante na constituição dos mamíferos. É encontrada
nos compartimentos extracelulares (líquido intersticial), intracelulares (no citoplasma) e transcelulares (dentro de órgãos como a bexiga e o estômago). Sobre a água e
sua presença nos mamíferos é CORRETO afirmar que:
01. a quantidade em que é encontrada nos organismos é invariável de espécie para espécie.
02. com passar dos anos, existe uma tendência de aumentar seu percentual em um determinado tecido.
04. é importante fator de regulação térmica dos organismos.
08. em tecidos metabolicamente ativos é inexistente.
16. participa da constituição dos fluidos orgânicos que transportam substâncias dissolvidas por todo o corpo.
32. constitui meio dispersante para facilitar a realização das reações químicas.
04 + 16 + 32 = 52
21. Na(s) questão(ões) a seguir julgue os itens e escreva nos parentesses (V) se for verdadeiro ou (F) se for falso. A "teori a celular", uma das maiores generalizações da
biologia, postula que todos os seres vivos são formados por células. Em relação à morfofisiologia celular, julgue os itens.
( ) As células procariontes caracterizam-se pela ausência de material genético.
( ) As mitocôndrias são organelas responsáveis pela respiração celular.
( ) A carioteca delimita o conteúdo nuclear.
( ) O trifosfato de adenosina (ATP) é um composto químico constituído pela base nitrogenada adenina, pelo açúcar ribose e por três radicais fosfatos.
FVVV
22. Considere os seguintes orgânulos celulares:
I. LISOSSOMO
II. COMPLEXO DE GOLGI
III. CLOROPLASTO
IV. MITOCÔNDRIA
A síntese de ATP (adenosina trifosfato) ocorre normalmente:
a) apenas em III.
b) apenas em IV.
c) apenas em II e III.
d) apenas em III e IV.
e) em I, II, III e IV.
[D]
23. Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. Um dos maiores cientistas de todos os tempos, Louis Pasteur (1822-1895), foi um
pioneiro.
Em 1995, ele foi homenageado pela comunidade científica mundial, por ocasião do centenário de sua morte.
Destacam-se como contribuições de Pasteur:
- "Nada existe no ar, capaz de gerar, a não ser os germes, que este mesmo ar carrega." (Pasteur, apud CIÊNCIA HOJE, p. 10.)
- "Muitas doenças de plantas e animais são causadas pela invasão de germes.
- As perdas na indústria do vinho, por sua transformação em vinagre, na França do século XIX, eram causadas por bactérias.
- O aquecimento moderado, por um determinado período de tempo, eliminava microorganismos que contaminavam o vinho e a cerveja.
- A mortalidade causada por infecções pós-operatórias foi drasticamente diminuída com o uso de processos de esterilização.
- A imunidade à cólera das galinhas, ao carbúnculo e à raiva pôde ser alcançada, através da injeção de vírus artificialmente atenuados.
Entre as repercussões do trabalho de Pasteur no campo da Biologia Celular, pode-se citar:
(01) A reprodução celular é um dos atributos que definem a condição vital.
(02) Microorganismos causadores de doenças limitam-se à categoria das células eucarióticas.
(04) Variações térmicas são insuficientes para provocar alterações em processos celulares de microorganismos.
(08) O sucesso dos procariotos, na contaminação do vinho, se relaciona à simplicidade do seu processo reprodutivo.
(16) Vinho e vinagre são produtos de atividade biológica, envolvendo sistemas enzimáticos correlacionados.
(32) As células procarióticas e eucarióticas se diferenciam basicamente pelos mecanismos de obtenção de energia.
(64) As células são capazes de responder de modo a neutralizar o efeito de um agente infeccioso.
16
24. Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. Foi Louis Pasteur quem observou, pela primeira vez, na década de 1860, que, quando
o oxigênio é introduzido em uma suspensão de células que estão consumindo glicose em alta velocidade, em anaerobiose, essa ve locidade diminui significativamente, à
medida que o oxigênio passa a ser consumido. Ao mesmo tempo, cessa o acúmulo de lactato.
O "efeito Pasteur", descrito anteriormente, se relaciona a aspectos da fisiologia e da estrutura celular, tais como:
(01) A utilização da glicose para obtenção de energia em células aeróbicas facultativas.
(02) A exigência de organelas celulares especializadas para o metabolismo anaeróbico da glicose.
(04) A síntese de lactato como produto final do metabolismo energético mais rentável.
(08) O consumo do oxigênio no processo de degradação completa da molécula de glicose.
(16) A dependência de membranas celulares para síntese de ATP, no processo aeróbico de produção de energia.
(32) O bloqueio da glicólise pela presença de oxigênio nas células aeróbicas.
(64) A relação entre o mecanismo bioenergético utilizado e a quantidade de glicose consumida.
01 + 02 + 08 + 16 + 64 = 91
25. A fenilcetonúria é uma doença que resulta de um defeito na enzima fenilalanina hidroxilase, que participa do catabolismo do aminoácido fenilalanina. A falta de
hidroxilase produz o acúmulo de fenilalanina que, por transaminação, forma ácido fenilpirúvico. Quando em excesso, o ácido fenilpirúvico provoca retardamento mental
severo. Por outro lado, o portador desse defeito enzimático pode ter uma vida normal desde que o defeito seja diagnosticado i mediatamente após o nascimento e que sua
dieta seja controlada. A fenilcetonúria é tão comum que mesmo nas latas de refrigerantes dietéticos existe o aviso: "Este produto contém fenilcetonúricos!".
Qual o principal cuidado a tomar com a dieta alimentar de um portador desse defeito enzimático? Por quê?
Evitar a ingestão de alimentos que contenham o aminoácido fenilalanina pois os "fenilcetonúricos" são incapazes de metaboliza r essa substância e correm risco de
apresentar graves distúrbios metabólicos com conseqüências irreversíveis.
26. Assinale a alternativa que completa CORRETAMENTE as afirmativas a seguir:
As_________ são proteínas especiais que_________ reações químicas que ocorrem no_________ das células. Quando o organismo é aquecido demasiadamente, elas
são__________.

3
a) gorduras; catalisam; interior; desnaturadas
b) moléculas; aceleram; exterior; recriadas
c) enzimas; retardam; exterior; derretidas
d) gorduras; alteram; limite; destruídas
e) enzimas; catalisam; interior; desnaturadas
[E]
27. O esquema abaixo representa o processo de:

a) osmose, onde as moléculas de solvente migram da solução mais concentrada para a solução menos concentrada.
b) osmose, onde as moléculas de soluto migram da solução menos concentrada para a solução mais concentrada.
c) difusão, onde as moléculas de soluto tendem a se distribuir homogeneamente, migrando da região mais concentrada para a região menos concentrada.
d) difusão, onde as moléculas de soluto tendem a se distribuir homogeneamente, migrando da região menos concentrada para a mais concentrada.
e) transporte ativo, onde as molécula de soluto tendem a se distribuir homogeneamente, já que ocorre gasto de energia.
[C]
28. A equação simplificada a seguir, representa o processo de fermentação realizado por microorganismos como o 'Saccharomyces cerevisiae' (levedura).
A → B +C
A, B e C são, respectivamente:
a) glicose, água e gás carbônico.
b) glicose, álcool e gás carbônico.
c) álcool, água e gás carbônico.
d) álcool, glicose e gás oxigênio.
e) sacarose, gás carbônico e água.
[B]
29. A principal substância ORGÂNICA que encontramos nas células dos seres vivos animais é (são):
a) a água. b) gorduras. c) proteínas.
d) sais. e) vitaminas.
[C]
30. A principal substância INORGÂNICA que encontramos nas células dos seres vivos é (são):
a) a água. b) gorduras. c) proteínas.
d) sais. e) vitaminas.
[A]
31. O elemento químico Nitrogênio é essencial para os seres vivos porque entra na composição
a) dos açúcares e gorduras.
b) das proteínas e dos ácidos nucléicos.
c) das gorduras e dos ácidos nucléicos.
d) das vitaminas e dos açúcares.
e) dos ácidos nucléicos e das vitaminas.
[B]
32. Relacione a coluna I com a coluna II:
Coluna I
1. fermentação alcoólica
2. fermentação lática
3. fermentação acética
Coluna II
( ) fabricação de pão
( ) produção de vinagre
( ) fabricação de queijos
A seqüência correta, de cima para baixo, na coluna II é:
a) 1, 2, 3 b) 1, 3, 2 c) 2, 1, 3
d) 2, 3, 1 e) 3, 1, 2
[B]
33. As carnes "salgadas" não se estragam, porque qualquer microorganismo que nela se instalar desidratará e morrerá. Esta carne se encontra no estado:
a) hipotônica b) isotônica c) túrgida
d) osmótica e) hipertônica
[E]
34. O processo químico realizado por certos microorganismos e que tem como produtos finais álcool e gás carbônico denomina-se:
a) fotossíntese b) sudação c) respiração
d) fermentação e) fotólise
[D]
35. Durante a Preparação do pão, para que a massa cresça, adiciona-se um pouco de fermento ('Saccharomyces sp'.). O crescimento da massa está relacionado com a:
a) embebição da farinha pela água eliminada pelo fungo.
b) dilatação da massa em virtude da alta temperatura do forno.
c) formação de vapor d'água no interior da massa.
d) formação de gás carbônico resultante da fermentação.
e) proliferação extraordinária do fermento em função da temperatura.
[D]
36. O corante I é específico para DNA e o corante II para RNA. Um pesquisador usou esses dois corantes em células fixadas e observou sua ação sobre algumas organelas
citoplasmáticas.

4
Assinale, no quadro a seguir, a alternativa que representa os possíveis resultados obtidos por esse pesquisador (o sinal + significa reação positiva e o sinal - negativa).

[D]
37. O esquema a seguir representa dois processos observados numa célula eucariótica.

Assinale a alternativa correta.


a) O processo 1 somente é observado no núcleo da célula, sendo inexistente em todas as outras organelas.
b) Para interromper o processo 2, é necessário bloquear o funcionamento de todo o retículo endoplasmático dessa célula.
c) O processo 2 ocorre principalmente no período S da intérfase.
d) Um dos mais importantes locais de ocorrência do processo 1 é o nucléolo.
e) As moléculas produzidas no processo 2 poderão ser utilizadas como catalisadoras, mas nunca serão constituintes de outras organelas.
[D]
38. Reservas de carboidrato nos músculos ficam na forma de
a) glicogênio. b) lactose. c) amido.
d) sacarose. e) glicose.
[A]
39. Observe o seguinte esquema:

Assinale a alternativa que identifica corretamente as organelas e os processos celulares representados em I e II.
a) I - (ribossomo - síntese de açúcares),
II - (mitocôndria - respiração)
b) I - (cloroplasto - fotossíntese),
II - (ribossomo - respiração)
c) I - (cloroplasto - fotossíntese),
II - (mitocôndria - respiração)
d) I - (mitocôndria - respiração),
II - (cloroplasto - fotossíntese)
e) I - (mitocôndria - sintese de açúcares),
II - (ribossomo - respiração)
[C]
40. Considere as seguintes afirmativas:
I - As proteínas são moléculas de grande importância para os organismos - atuam tanto estruturalmente como também metabolicamente.
II - As enzimas são proteínas que atuam como catalisadores biológicos.
III - Existem proteínas que atuam como linhas de defesa do organismo e algumas delas são conhecidas como anticorpos.
Quais estão corretas?
a) Apenas I b) Apenas II c) Apenas III
d) Apenas II e III e) I, II, III
[E]
41. O esquema a seguir mostra a via metabólica de um aminoácido, levando à formação de alguns hormônios:

5
A respeito deste esquema são feitas as seguintes afirmações:
I - Um indivíduo com a enzima 1 inibida acumulará grandes quantidades de aminoácido 3.
II - Um indivíduo com a enzima 1 inibida deixa de produzir as enzimas 2 e 3.
III - Um indivíduo com a enzima 1 inibida precisa receber os hormônios 1 e 2 de fontes externas.
Quais estão corretas?
a) Apenas I. b) Apenas II. c) Apenas III.
d) Apenas I e II. e) Apenas II e III.
[C]
42. Considere um gato siamês, que difere de outras raças de gatos por sua pelagem característica: escura nas patas, no focinho e no pavilhão auditivo, contrastando com
o resto do corpo, onde é clara. As regiões escuras são as mais frias e nelas, a substância que controla a produção do pigmento responsável pela pelagem escura é ativa,
enquanto nas claras, que são quentes, essa substância é inativa.Pela sua ação no escurecimento da pelagem do animal, conclui -se que essa substância é:
a) um glicídio b) um lipídio c) uma enzima
d) um glicosaminoglicano e) uma vitamina
[C]
43. Assinale a alternativa INCORRETA a respeito da molécula dada pela fórmula geral a seguir

a) É capaz de se ligar a outra molécula do mesmo tipo através de pontes de hidrogênio.


b) Entra na constituição de enzimas.
c) R representa um radical variável que identifica diferentes tipos moleculares dessa substância.
d) Os vegetais são capazes de produzir todos os tipos moleculares dessa substância, necessários à sua sobrevivência.
e) Essas moléculas são unidas umas às outras nos ribossomos.
[A]
44. As hemácias humanas foram selecionadas ao longo da evolução de modo a que desempenhassem hoje em dia suas funções de maneira eficiente. Durante este
processo evolutivo, as mitocôndrias e os núcleos foram perdidos na fase madura. Quais dos processos biológicos a seguir conti nuam a ocorrer, nas hemácias maduras,
apesar desta adaptação?
a) Cadeia transportadora de elétrons. b) Ciclo de Krebs.
c) Glicólise. d) Replicação. e) Transcrição.
[C]
45. Analise o esquema simplificado a seguir:

As fases 1 e 2 do esquema resumem, respectivamente:


a) fotossíntese e fermentação b) respiração e fotossíntese
c) fermentação e respiração d) fotossíntese e respiração
[D]
46. O esquema a seguir resume o consumo (X) e a produção (Y) de ATP, na glicólise, por molécula de glicose oxidada:

Os valores de X e Y são, respectivamente:

6
a) 2 e 4 b) 4 e 2 c) 2 e 8 d) 8 e 4
[A]
47. Catalase é uma enzima que está presente em nosso organismo e é capaz de desdobrar a água oxigenada em água comum e oxigênio, de acordo com a reação:
H2O2 + catalase → 1/2 O2 + H2O
A água oxigenada é usada em curativos como antiséptico. Considerando a reação anterior e o seu uso, podemos afirmar que a água oxigenada é um:
a) catalisador e age contra bactérias anaeróbicas
b) produto que age contra bactérias aeróbicas
c) substrato que age diretamente como cicatrizante
d) substrato que age contra bactérias anaeróbicas
[D]
48. Observe as funções a seguir:
I - Estimula a síntese do colágeno
II - Estimula a migração química
III - Facilita a absorção do ferro
IV - Participa da fosforilação oxidativa
V - Aumenta a disponibilidade energética
Indique a opção que contém a vitamina detentora de todas as funções anteriores:
a) vitamina K b) vitamina D c) vitamina B12‚ d) vitamina C
[D]
49. No processo de contração e relaxamento muscular, o elemento mineral mais diretamente presente é o:
a) cálcio b) iodo c) mercúrio d) ferro
[A]
50. É comum aos processos de fotossíntese e respiração:
a) a utilização de citocromos como transportadores de elétrons
b) o oxigênio como aceptor final de elétrons
c) o NADPH2 reduzir o oxigênio
d) a glicose ser o agente redutor do CO 2
[A]
51. A observação da figura nos permite afirmar que:

a) a molécula de glicose sofrerá um pequeno desdobramento com pouca produção de energia.


b) a "desmontagem" da glicose se dá pela remoção gradativa dos seus hidrogênios (desidrogenação).
c) NAD, FAD e O2 são substâncias fundamentais no processo, já que funcionaram como aceptores intermediários de hidrogênio.
d) a dupla membrana da figura constitui um fator importante para a ocorrência do Ciclo de Krebs.
e) a formação do ácido pirúvico ocorre principalmente na matriz mitocondrial.
[B]
52. Considere as seguintes etapas da respiração celular:
I. Cadeia respiratória;
II. Formação de Acetil-CoA;
III. Ciclo de Krebs;
IV. Glicose.
Assinale a alternativa que contém a seqüência correta dos eventos da respiração celular:
a) I, II, III e IV b) II, IV, III e I c) III, IV, I e II
d) IV, II, III e I e) II, III, I e IV
[D]
53. Analise as equações I, II e III a seguir:
I. 6CO2 + 12H2O → C6H12‚O6 + 6O2 + 6H2O
II. 2NH3 + 3O2 → 2HNO2 + 2H2O
III. C6H12O6 → 2C2H5OH + 2CO2
Assinale a alternativa INCORRETA referente às equações:
a) I representa, de forma simplificada, um processo realizado por organismos clorofilados.
b) II é realizada por certos tipos de bactérias e está relacionada com a ciclagem de nitrogênio nos ecossistemas.
c) II é realizada por animais em geral e não está relacionada com a ciclagem de nitrogênio nos ecossistemas.
d) III representa, de forma simplificada, um processo anaeróbico realizado por certos tipos de fungos, conhecidos como leveduras.
e) I, II e III representam, de forma simplificada, processos bioquímicos relacionados com a ciclagem de matéria nos ecossistemas.
[C]
54. O corante I é específico para identificar a presença de DNA e o corante II é específico para RNA. Numa experiência, foram usados esses dois corantes em dois tipos
diferentes de organelas citoplasmáticas fixadas e observou-se a ação dos mesmos. Qual a alternativa no quadro a seguir que representa corretamente os resultados
esperados dessa experiência, sabendo-se que os sinais (+) e (-) representam, respectivamente, a presença e a ausência de um ácido nucléico?

7
[D]
55. "Cerca de 27 milhões de brasileiros têm intolerância ao leite por deficiência na produção de uma enzima do intestino."
(FOLHA DE SÃO PAULO, 09/08/98)
Sobre a enzima citada no artigo, e as enzimas em geral, podemos afirmar que:
a) aumentam a energia de ativação necessária para as reações.
b) atuam de forma inversamente proporcional ao aumento da temperatura.
c) são altamente específicas em função de seu perfil característico.
d) são estimuladas pela variação do grau de acidez do meio.
e) são consumidas durante o processo, não podendo realizar nova reação do mesmo tipo.
[C]
56. "A margarina finlandesa que reduz o COLESTEROL chega ao mercado americano ano que vem."
"O uso de ALBUMINA está sob suspeita"
"LACTOSE não degradada gera dificuldades digestivas"
As substâncias em destaque nos artigos são, respectivamente, de natureza:
a) lipídica, protéica e glicídica.
b) lipídica, glicídica e protéica.
c) glicídica, orgânica e lipídica.
d) glicerídica, inorgânica e protéica.
e) glicerídica, protéica e inorgânica.
[A]
57. “6.000 a.C.: babilônios e sumérios utilizam lêvedo para produzir cerveja.
4.000 a.C.: egípcios descobre como fazer pão fermentado. Ainda na Antigüidade: transformação do leite em iogurte e uso do mof o na elaboração de queijo.
As informações contidas no artigo anterior envolvem um processo biológico fundamental para os seres vivos que o realizam. Todas as opções apresentam conceitos
corretos sobre esse processo, EXCETO uma. Assinale-a.
a) Na fabricação de iogurte e queijo o produto formado é o ácido láctico.
b) Na fabricação de cerveja e pão os produtos formados são etanol e gás carbônico.
c) Nesse processo a molécula orgânica utilizada é degradada a ácido pirúvico.
d) O saldo energético obtido, nos dois processos, é de 2 ATP.
e) Os seres que realizam este processo objetivam conseguir matéria-prima para sua nutrição.
[E]
58. O esquema a seguir representa reagentes e produtos de reações químicas que ocorrem nas células.

Essa seqüência de reações é um modelo que mostra a


a) ação de uma enzima na síntese de uma substância.
b) produção de ADP a partir de ATP.
c) formação de um nucleotídeo.
d) digestão de uma proteína.
e) oxidação de uma molécula de glicose.
[A]
59. A glicoquinase e a hexoquinase são duas enzimas que reagem com o mesmo substrato, a glicose. Ambas são enzimas intracelulares que fosforilam a glicose formando
glicose 6-fosfato (G6P).
Dependendo da enzima produtora, a G6P pode ou ser degradada na via da glicólise para gerar energia ou então ser usada para síntese de glicogênio.
A glicólise ocorre nos tecidos em geral e a síntese de glicogênio ocorre principalmente no fígado. A síntese do glicogênio somente acontece quando ex iste excesso de
glicose no sangue. Essa é uma forma de armazenar esse açúcar.
Observe a figura a seguir, que apresenta as velocidades de reação dessas duas enzimas em função da concentração da glicose. Níveis normais de glicose no sangue
estão ao redor de 4mM.

8
Qual das duas enzimas gera G6P para síntese de glicogênio hepático? Justifique sua resposta.
A hexoquinase possui uma grande afinidade pela glicose, ou seja, ela atinge a velocidade máxima com uma concentração muito pequena de glicose. A glico quinase exibe
uma afinidade bem menor pois somente atinge sua velocidade máxima em concentrações bem mais altas do substrato. Logo, a enzima que contribui para a formação de
glicogênio hepático é a glicoquinase, pois esta somente produz G6P com máxima eficiência quando há excesso de glicose no sang ue.
60. Nos laboratórios químicos, a maneira mais freqüente de ativar um reação é fornecendo calor, que funciona como energia de ativação. Nos seres vivos, isso não é
possível, pois corre-se o risco de as proteínas serem desnaturadas.
A estratégia desenvolvida pelos seres vivos para superar a barreira inicial das reações foi a utilização de:
a) ATP. b) enzimas. c) hormônios.
d) glicose. e) clorofila.
[B]
61. Sobre o esquema abaixo, são feitas as seguintes afirmativas:

I - a formação de moléculas de proteínas é uma reação de degradação;


II - é através de reações de síntese que o ser vivo consegue energia para a sua vida;
III - o conjunto das reações de síntese e degradação constituem o metabolismo.
A(s) afirmativa(s) é(são):
a) apenas a I. b) apenas a II. c) apenas a III.
d) apenas a I e a II. e) apenas a II e a III.
[C]
62. Comparando o esquema dos dois processos metabólicos representados, podemos afirmar que o(a):

a) aceptor final de hidrogênios, na fermentação, é o oxigênio.


b) molécula de glicose é totalmente degradada, na fermentação.
c) fermentação é encontrada na maioria dos seres vivos unicelulares.
d) formação de ATP na cadeia respiratória só ocorre na respiração.
e) formação de ácido pirúvico é uma exclusiva da respiração.
[D]
63. Desde o início da teoria celular até hoje, muito se tem descoberto acerca da célula, de suas organelas e características, e a respeito dos processos bioquímicos que
nelas ocorrem. Com relação a esse tema, julgue os itens seguintes.
(0) O movimento citoplasmático, conhecido como ciclose, é visível ao microscópio óptico e tem intensidade inversamente proporcional à temperatura.
(1) Alterações na concentração dos íons provocam, nas células, modificações profundas na permeabilidade, na viscosidade e na capacidade de resposta a estímulos.
(2) Mitocôndrias, retículo endoplasmático e lisossomos são comuns às células procarióticas e às eucarióticas.
(3) O número de cloroplastos de uma célula é determinado geneticamente, mantendo-se estável ao longo da vida celular.
(4) O açúcar das frutas é produzido durante o processo de fotossíntese.
(5) O fumo e a atividade física regular têm papéis antagônicos na destruição do excesso de colesterol.
Itens corretos: 1 e 5
Itens errados: 0, 2, 3 e 4
64. Em diversas circunstâncias, ocorre produção de água oxigenada (H 2O2) em nosso organismo. Na presença de íons Fé+2, a água oxigenada dá origem a um radical
livre que ocasiona mutações no DNA. Nesse processo, a enzima catalase é importante, pois catalisa a produção de H 2O e O2 a partir de H2O2. Para a verificação desse
fato, realizou-se um experimento constituído de vários testes, nos quais, em tubos de ensaio contendo H2O2, acrescentaram-se diferentes materiais, conforme especificado
na tabela adiante medindo-se a quantidade de O2 liberada.

9
Com base no experimento apresentado, julgue os seguintes itens.
(0) O experimento evidencia a existência da catalase do fígado.
(1) Os testes mostraram que a liberação de O‚ é diretamente proporcional à concentração de enzima.
(2) No teste VI, não ocorre liberação de O‚ porque o calor desnatura e, conseqüentemente, inativa as enzimas.
(3) testes de III e VI podem ser considerados como sendo os testes realizados para o controle do experimento.
(4) A liberação de O‚ cessa após um curto período de tempo por ocorrer consumo de enzima durante a reação.
Itens corretos: 0 e 2
Itens errados: 1, 3 e 4
65. A síntese protéica envolve um complexo de estruturas celulares que trabalham harmonicamente, como mostra o esquema adiant e.

Com base no esquema e em conhecimentos correlatos, julgue os itens a seguir.


(0) O esquema mostra a síntese protéica em uma célula procariótica.
(1) Os tipos de RNA necessários para a síntese protéica em procariotos e eucariotos são essencialmente diferentes.
(2) Na expressão de um gene eucariótico, a transcrição e a tradução ocorrem simultaneamente.
(3) Uma molécula de RNAm pode ser utilizada para a síntese concomitante de várias moléculas da proteína.
Item correto: 3
Itens errados: 0, 1 e 2
66. O ciclo a seguir esquematizado envolve duas importantes estruturas celulares I e II.

É correto afirmar que


a) as estruturas celulares I e II ocorrem apenas nos vegetais.
b) as estruturas celulares I e II ocorrem nos animais e vegetais.
c) a estrutura celular I ocorre apenas nos vegetais, e a II, apenas nos animais.
d) a estrutura celular I ocorre apenas nos vegetais, e a II ocorre nos animais e vegetais.
e) a estrutura celular I ocorre nos animais e vegetais, e a II ocorre apenas nos vegetais.
[E]
67. As células de nosso músculos executam, em condições normais, a respiração aeróbica. Porém, durante um esforço muscular intenso, se o organismo não consegue
fornecer gás oxigênio suficiente para a respiração celular, as células musculares trabalham anaerobicamente. Esse processo an aeróbico provoca dor e sensação de
queimação nos músculos devido ao acúmulo de:
a) ácido lático. b) ácido ascórbico. c) ácido pirúvico.
d) ácido acético. e) acetil-CoA.
[A]
68. O experimento representado na figura a seguir deve ser analisado em relação ao fenômeno osmose.

10
Com relação a esse experimento são formulados três hipóteses:
I. A pressão osmótica tem sentido A ë B.
II. A proteína com certeza passa de B para A, uma vez que a membrana semipermeável deixa passar soluto.
III. Após um certo tempo não haverá variação do volume de água no lado B, pois é um sistema aberto.
Assinale a alternativa que classifica corretamente cada hipótese como provável (+) ou improvável (-).
a) I. (+), II. (-), III. (-)
b) I. (-), II. (+), III. (-)
c) I. (-), II. (-), III. (+)
d) I. (+), II. (+), III. (+)
e) I. (-), II. (-), III. (-)
[A]
69. O dinitrofenol (DNP) é uma substância que interfere na produção de ATP. Se uma célula receber uma dose dessa substância, o processo de_______ será prejudicado
e conseqüentemente essa célula não poderá_______.
Assinale a alternativa que preenche correta e respectivamente as lacunas da frase anterior.
a) fotossíntese; se reproduzir
b) respiração celular; gerar impulsos nervosos
c) respiração celular; realizar osmose
d) fotossíntese; realizar difusão
e) respiração celular; realizar trocas gasosas
[B]
70. O gato siamês é um animal de rara beleza pois a pelagem de seu corpo é clara com extremidades - orelhas, focinho, pés e cauda - pretas. A presença do pigmento
que dá a cor negra a essas extremidades é o resultado da atividade de uma enzima que fica inativada acima de 34°C. Explique por que esses animais têm a pelagem
negra nas extremidades do corpo.
As extremidades do corpo perdem calor para o meio ambiente com mais facilidade e costumam, portanto, apresentar uma temperatura inferior à do restante do corpo.
Como a enzima só é ativa abaixo de 34°C, a síntese do pigmento que confere cor negra só ocorrerá nas extremidades do corpo.
71. No esquema a seguir os algarismos I e II referem-se a dois processos de produção de energia. As letras X e Y correspondem às substâncias resultantes de cada
processo.

Assinale a alternativa que indica a relação entre o processo de produção de energia e a respectiva substância resultante.
a) Em I o processo é fermentação e a letra X indica a substância água.
b) Em I o processo é respiração e a letra X indica a substância álcool.
c) Em II o processo é fermentação e a letra Y indica a substância água.
d) Em II o processo é respiração e a letra Y indica a substância álcool.
e) Em I o processo é respiração e a letra X indica a substância água.
[E]
72. Considere as afirmativas a seguir, relacionadas ao metabolismo.
I - O glicogênio é a forma de armazenamento da glicose.
II - As proteínas são degradadas, produzindo amônia, e esta é, posteriormente, transformada em uréia.
III - O ácido graxo é o principal produto da metabolização dos lipídos.
Quais estão corretas?
a) Apenas I b) Apenas II c) Apenas I e II
d) Apenas II e III e) I, II e III
[E]
73. Considere a rota metabólica que produz o aminoácido arginina na figura adiante.

Em um experimento, três linhagens de bactérias foram irradiadas com Raios X, que causaram mutações nos genes envolvidos na rota met abólica acima representada.
Para descobrir quais enzimas da rota metabólica foram afetadas, as três linhagens foram cultivadas em m eios suplementados com ornitina, citrulina e arginina, obtendo-
se o resultado mostrado na tabela acima:

11
Sobre esse experimento, podemos afirmar que
a) o gene que codifica a enzima 1 na linhagem I foi afetado.
b) o gene que codifica a enzima 2 na linhagem I foi afetado.
c) o gene que codifica a enzima 3 na linhagem II foi afetado.
d) o gene que codifica a enzima 1 na linhagem II foi afetado.
e) o gene que codifica a enzima 3 na linhagem III foi afetado.
[E]
74. É correto dizer:
a) A membrana plasmática é uma estrutura lipo-protéica presente em todos os tipos celulares e funciona como uma barreira seletiva entre o citoplasma e o núcleo.
b) O controle do metabolismo celular é embasado pela síntese de DNA, pelo RNA, tendo como conseqüência, a síntese protéica.
c) O núcleo é uma estrutura revestida por envoltório nuclear, presente tanto em organismos procariontes como eucariontes.
d) Os vírus são constituídos de uma cápsula protéica e de um ácido nucléico e, para multiplicarem-se precisam de hospedeiro.
e) Pentoses e hexoses são monossacarídeos e, como exemplo, podemos citar a glicose e a ribose, respectivamente.
[D]
75. O esquema a seguir mostra alguns intercâmbios bioquímicos existentes dentro de uma célula vegetal. As setas indicam o per curso de algumas substâncias.

Dê o nome das 6 substâncias que fazem esses percursos e dos respectivos processos metabólicos nos quais elas foram produzidas .
1. RNAm - transcrição
2. Enzimas - tradução
3. O‚ - fotossíntese
4. ATP - respiração aeróbia
5. Proteínas - tradução
6. Glicoproteínas – glicosilação
76. Um médico holandês observou, no final do século XIX, que galinhas alimentadas com arroz polido, ou descascado, apresentav am os sintomas de uma doença
conhecida como beribéri, que era curada com a ingestão da película, ou casca, retirada dos grãos do arroz.
A substância necessária em pequenas quantidades na dieta para evitar o beribéri, é a vitamina denominada:
a) E b) C c) B12 d) A
[C]
77. Observe os esquemas a seguir:

Assinale a alternativa que explica corretamente a diferença de rendimento energético entre os processos 1 e 2.
a) O processo 1 pode ser uma das etapas da fotossíntese, produzindo álcool etílico, enquanto que o processo 2 é a respiração aeróbica e libera muita energia na forma
de ATP.
b) O processo 1 pode ser uma das etapas da respiração aeróbica, produzindo álcool etílico, enquanto o processo 2 é a fotossíntese e libera muita energia na forma de
ATP.
c) O processo 1 é anaeróbico, e parte da energia fica no álcool etílico, enquanto o processo 2 é aeróbico, e a energia vem da glicose decomposta em água e gás carbônico.
d) O processo 1 é aeróbico, e parte da energia fica no álcool etílico, enquanto que o processo 2 é anaeróbico, e a energia vem da degradação da glicose em água e gás
carbônico.
e) O processo 1 é um tipo de fermentação com baixa produção de ATP, ficando a energia no gás carbônico liberado, enquanto que o processo 2 é uma fermentação
completa, liberando energia na forma de 38 ATP.
[C]
78. Células vegetais, depois de mantidas em meio de cultura contendo uracila marcada, foram fixadas e submetidas à autoradiografia, para comprovar os locais que
possuíam esse material. É correto prever que, no citoplasma, encontre-se uracila radioativa SOMENTE nos
a) nucléolos.
b) ribossomos.
c) nucléolos e nas mitocôndrias.
d) ribossomos e nos cloroplastos.
e) ribossomos, nos cloroplastos e nas mitocôndrias.
[E]
79. Considere o esquema a seguir.
Assinale a alternativa da tabela que identifica corretamente as substâncias I e II, liberadas durante o dia e durante a noite.

12
[A]
80. Para a realização de alguns processos fisiológicos, o organismo humano tem a necessidade de íons de cálcio. Dentre os mec anismos que dependem diretamente
destes íons para sua realização, temos:
a) excreção de toxinas e atividade da tiróide.
b) digestão de alimentos básicos e respiração.
c) coagulação do sangue e contração muscular.
d) atividade neurológica e oferta de O‚ às células.
e) crescimento dos ossos e atividade da hipófise.
[C]
81. O cálcio desempenha papel importante em vários processos fisiológicos do homem. Por isso, é indispensável a manutenção dos níveis plasmáticos de cálcio em
estreitos limites, o que ocorre com a participação de alguns hormônios.
Acerca do exposto acima, pode-se afirmar:
a) A diminuição da concentração plasmática de cálcio é um fator de estímulo para a liberação de calcitonina pelas células par afoliculares da tireóide.
b) A diminuição da concentração plasmática de cálcio é um fator de estímulo para a liberação do paratormônio pelas paratireóides.
c) A elevação da concentração plasmática de cálcio é um fator de estímulo para a liberação de triiodotironina e tiroxina pela tireóide.
d) A elevação da concentração plasmática de cálcio é um fator de estímulo para a liberação de aldosterona pelo córtex das adrenais.
e) A diminuição da concentração plasmática de cálcio é um fator de estímulo para a liberação de adrenalina pela medula das adrenais.
[B]
82. Uma bactéria, um fungo e uma samambaia apresentam em comum
a) produção de glicose, através da utilização de energia solar.
b) presença de carioteca, envolvendo os componentes do núcleo celular.
c) utilização de oxigênio no interior de mitocôndrias.
d) presença de DNA como material genético.
e) produção de ATP no interior de plastos.
[D]
83. A invertase é a enzima que hidrolisa a sacarose em glicose e frutose. Incubou-se, em condições adequadas, essa enzima com sacarose, de tal forma que a
concentração inicial, em milimoles por litro, do dissacarídeo fosse de 10mM. Observe os gráficos a seguir:

Aquele que melhor representa a variação das concentrações, em função do tempo de incubação, da sacarose e da glicose, é o de número:
a) 4 b) 3 c) 2 d) 1
[C]
84. Considere o esquema a seguir, referente ao processo respiratório de uma célula eucariota:
Glicose (I)

Ácido Pirúvico (II)

Acetil CoA (III)

Ciclo de Krebs (IV)

Cadeia Respiratória (V)
Assinale a afirmativa INCORRETA:
a) Para que I se transforme em II, é necessário o gasto de ATP.
b) As fases I e II ocorrem fora da mitocôndria.
c) Na conversão de II para III, não há produção local de ATP.
d) Em IV ocorre liberação de CO‚ e formação local de ATP.
e) Em V há quebra da molécula de água, com liberação de oxigênio.
[E]
85. O processo de respiração celular pode ser dividido em três etapas básicas. O esquema a seguir representa uma mitocôndria inserida no hialoplasma, com as indicações
I, II e III.

13
Observe o esquema e assinale a afirmativa CORRETA:
a) A fosforilação oxidativa ocorre no número III.
b) A glicólise ocorre no número I.
c) O ciclo de Krebs ocorre no número II.
d) A etapa fotoquímica ocorre nos números I e II.
e) O ciclo das pentoses ocorre nos números I, II e III.
[C]
86. O gráfico a seguir representa a atividade enzimática de uma determinada reação em função da temperatura:

A seta indica o ponto:


a) ótimo de temperatura para a atividade enzimática.
b) de desnaturação da enzima.
c) de desnaturação do produto.
d) mínimo da temperatura para a reação enzimática.
e) máximo de substrato obtido.
[A]
87. O componente celular em que se forma maior número de moléculas de ATP durante a conversão de uma molécula de glicose em á gua e gás carbônico é
a) o peroxissomo. b) a mitocôndria. c) o cloroplasto.
d) o ribossomo. e) o complexo de Golgi.
[B]
88. A estrutura abaixo, na forma como está representada, refere-se a

a) um aminoácido essencial com função enzimática na célula.


b) um nucleotídeo que participa da estrutura química dos ácidos nucléicos.
c) um nucleosídeo estável que participa da estrutura química dos ácidos nucléicos.
d) um carboidrato não hidrolisável que atua no metabolismo celular.
e) um nucleotídeo que participa de reações bioquímicas como fornecedor de energia.
[E]
89. As células procariontes aeróbicas conseguem reduzir a glicose a CO 2+H2O2 recuperando um total de 40 ATPs por molécula de glicose, com um saldo de 38 ATPs.
Dos 40 ATPs, acima citados, são recuperados na cadeia transportadora de elétrons via NADH e FADH:
a) 30 ATPs b) 32 ATPs c) 34 ATPs d)36 ATPs
[C]
90. O elemento químico fundamental no processo de contração e relaxamento muscular é o:
a) mercúrio b) cálcio c) enxofre d) argônio
[B]
91. A especificidade enzimática consiste na:
a) energia de ativação da enzima
b) vulnerabilidade da enzima de desnaturar-se a temperaturas altas
c) exclusividade da enzima de somente atuar em seu substrato
d) capacidade da enzima de "identificar" o pH específico que propicie a reação
[C]
92. Com relação à energética da célula, é correto afirmar que
01. uma célula muscular passa a transformar ácido pirúvico em ácido láctico em condições anaeróbicas.
02. o processo quer permite as células retirar a energia acumulada nos compostos orgânicos é a respiração celular.
04. tanto o processo de respiração aeróbica como a fermentação ocorre em três etapas: glicose, ciclo de Krebs e cadeia respir atória.
08. lipídios e proteínas não são utilizados como combustíveis pela célula, mesmo na ausência de glicose.
16. a partir de 2 moléculas de glicose são produzidas 6 moléculas de piruvato e 12 moléculas de ATP.
32. a glicólise e o ciclo de Krebs ocorrem no interior das mitocôndrias.

14
VVFFFF
93. Uma substância X é o produto final de uma via metabólica controlada pelo mecanismo de retro-inibição (feed-back) em que, acima de uma dada concentração, X passa
a inibir a enzima 1.

Podemos afirmar que, nessa via metabólica,


a) a quantidade disponível de X tende a se manter constante.
b) o substrato faltará se o consumo de X for pequeno.
c) o substrato se acumulará quando a concentração de X diminuir.
d) a substância A se acumulará quando a concentração de X aumentar.
e) a substância B se acumulará quando o consumo de X for pequeno.
[A]
94. Com base em estudos citológicos, pode-se afirmar:
01) A quantidade de água em um organismo depende da intensidade da atividade metabólica de suas células, do tipo de tecido co nsiderado, da idade do indivíduo e da
espécie a que ele pertence.
02) Uma planta provavelmente aumentará sua taxa de fotossíntese quando for colocada em um local iluminado por luz verde.
04) O processo de transporte de elétrons, acoplado à oxigenação fosforilativa, ocorre na matriz mitocondrial.
08) Células que manifestam alta atividade fagocitária devem apresentar um número elevado de lisossomos.
16) Durante a prófase I meiótica ocorre o "crossing-over", de grande importância na variabilidade genética entre os descendentes.
32) Os peroxissomos atuam na decomposição de H2O2, composto formado como produto final em muitas reações do metabolismo, de efeito altamente lesivo às células.
64) Apenas células de vida livre apresentam cílios, visto serem eles estruturas cuja única função é a movimentação celular.
VFFVVVF
95. O retículo endoplasmático rugoso é responsável pela síntese de transporte de proteínas. No entanto, a síntese protéica é r ealizada por grânulos, que estão aderidos
a ele, denominados de:
a) mitocôndrias. b) ribossomos. c) lisossomos.
d) cloroplastos. e) fagossomos.
[B]
96. Considere as seguintes relações:
Organelas Funções
I ribossomo ......................... síntese de proteínas
II lisossomo .......................... respiração
III mitocôndria ....................... produção de energia
IV complexo de Golgi ........... armazenamento
Estão corretamente relacionadas:
a) todas
b) somente I e III
c) somente II, III e IV
d) somente I, III e IV
e) somente II e IV
[D]
97. Células de certos organismos possuem organelas que produzem ATPs e os utilizam na síntese de substância orgânica a partir de dióxido de carbono. Essas organelas
são:
a) os lisossomos. b) os mitocôndrios. c) os cloroplastos.
d) o sistema de Golgi. e) os nucléolos.
[B]
98. Nos túbulos do néfron há intenso transporte ativo. Portanto, as células das paredes desses túbulos são ricas em:
a) mitocôndrias. b) DNA. c) lisossomos.
d) ribossomos. e) retículo endoplasmático.
[A]
99. A energia liberada em uma seqüência de reações ao longo da cadeia respiratória é utilizada na conversão do ADP+Pi em ATP. Essa seqüência de reações é
denominada:
a) glicólise. b) ciclo de Calvin.
c) fosforilação oxidativa. d) ciclo de Krebs. e) fermentação.
[C]
100. Em relação aos componentes celulares, assinale a alternativa correta.
a) Membrana plasmática é uma estrutura lipoprotéica que funciona como barreira seletiva entre o citoplasma e o núcleo.
b) Parede celular é uma estrutura exoesquelética rígida que circunda e protege o conteúdo da maior parte das células v egetais.
c) Plastos são organelas citoplasmáticas encontradas em células vegetais, recobertas por membranas e incapazes de auto duplic ação.
d) Mitocôndrias são organelas limitadas por membranas, encontradas somente em células animais e que geram energia qu ímica na forma de ATP.
e) Núcleo é uma organela revestida por envoltório nuclear, presente tanto em organismos procariontes como em organismos eucar iontes.
[B]
101. Um antibiótico que atue nos ribossomos mata:
a) bactérias por interferir na síntese de proteínas.
b) bactérias por provocar plasmólise.
c) fungos por interferir na síntese de lipídios.
d) vírus por alterar DNA.
e) vírus por impedir recombinação gênica.
[A]
102. Organelas citoplasmáticas que contêm DNA:
a) mitocôndria e ribossomo.
b) mitocôndria e cloroplasto.
c) nucléolo e cloroplasto.
d) lisossomo e ribossomo.
e) ribossomo e cromossomo.
[B]
103. Leia as afirmativas a seguir:
I - Nas células vegetais, os vacúolos são bem desenvolvidos e possuem como função principal, armazenar água e outras substâncias.

15
II - As células vegetais e as células animais possuem quantidades semelhantes de lisossomos e mitocôndrias.
III - As células vegetais são autótrofas e as células animais são heterótrofas.
Assinale
a) se apenas a I estiver correta.
b) se apenas a II estiver correta.
c) se a II e a III estiverem corretas.
d) se a I e a III estiverem corretas.
e) se todas estiverem corretas.
[D]
104. Uma célula animal está sintetizando proteínas. Nessa situação, os locais indicados por I, II e III na figura a seguir, apresentam alto consumo de:

a) (I) bases nitrogenadas, (II) aminoácidos, (III) oxigênio.


b) (I) bases nitrogenadas, (II) aminoácidos, (III) gás carbônico.
c) (I) aminoácidos, (II) bases nitrogenadas, (III) oxigênio.
d) (I) bases nitrogenadas, (II) gás carbônico, (III) oxigênio.
e) (I) aminoácidos, (II) oxigênio, (III) gás carbônico.
[A]
105. A hipótese de que os cloroplastos e as mitocôndrias tenham surgido através de uma associação simbiótica de um eucarioto primitivo com, respectivamente, bactérias
fotossintetizantes e bactérias aeróbicas, é reforçada pelo fato daquelas organelas celulares:
a) serem estruturas equivalentes, com grande superfície interna.
b) apresentarem DNA próprio.
c) estarem envolvidas, respectivamente, na produção e consumo de oxigênio.
d) apresentarem tilacóides e cristas como as bactérias.
e) serem encontradas tanto em organismos superiores como inferiores.
[B]
106. Na(s) questão(ões) a seguir, escreva no espaço apropriado a soma dos itens corretos. Observe as estruturas celulares, indicadas pelas setas numeradas no desenho
a seguir, e selecione as alternativas corretas:

01) A estrutura 3 está envolvida na transmissão das características genéticas do indivíduo.


02) A remoção da estrutura 4 afetaria profundamente o processo de síntese de proteínas.
04) Se ocorrer uma anomalia na estrutura 5, o primeiro processo celular a ser afetado seria o mecanismo de produção de energi a.
08) A estrutura 2 representa o retículo endoplasmático rugoso ou granular e é a organela responsável pela digestão intracelular.
16) A seqüência correta de estruturas envolvidas na síntese protéica, desde a entrada dos aminoácidos na célula até a eliminação da proteína pronta, é: 2, 6, 7 e 1.
01 + 02 + 04 + 16 = 23
107. Observe a figura a seguir.

A organela citoplasmática envolvida no processo nela esquematizado é denominada


a) ribossomo. b) lisossomo. c) centríolo.
d) mitocôndria. e) cloroplasto.
[B]
108. As enzimas contidas nos lisossomos são sintetizadas pela célula à partir do:
a) complexo de Golgi b) R.E.L. c) R.E.R.
d) mitocôndrio e) centríolo
[C]
109. Considere os seguintes componentes celulares:

16
I. parede celular
II. ribossomos
III. núcleo
IV. membrana plasmática
V. mesossomo
VI. DNA
Uma célula bacteriana é desprovida, apenas, de
a) I b) III c) I e III
d) II e V e) III, IV e VI
[B]
110. A organela citoplasmática que se origina a partir do nucléolo e que sintetiza proteínas é o
a) ribossomo. b) centríolo. c) lisossomo.
d) cloroplasto. e) complexo de Golgi.
[A]
111. A produção de ATP numa célula animal ocorre, fundamentalmente,
a) nos golgiossomos. b) nos cromossomos.
c) nos lisossomos. d) nos ribossomos. e) nas mitocôndrias.
[E]
112. Considere o texto a seguir.
"As células caliciformes do intestino secretam muco que é constituído, fundamentalmente, por glicoproteínas. A parte protéica do muco é s intetizada .......(I)....... e a
polissacarídica, ........(II)........"
Para completar o texto corretamente, I e II devem ser substituídos, respectivamente, por
a) nos ribossomos e nas mitocôndrias.
b) nas mitocôndrias e no complexo de Golgi.
c) no complexo de Golgi e nas mitocôndrias.
d) no retículo endoplasmático rugoso e no complexo de Golgi.
e) no retículo endoplasmático rugoso e nas mitocôndrias.
[D]
113. "A silicose é uma doença muito comum em trabalhadores que lidam com amianto. Um dos componentes do amianto é a sílica, uma substância inorgânica que forma
minúsculos cristais que podem se acumular nos pulmões. As células dos alvéolos pulmonares afetadas por estes cristais acabam sofrendo autólise".
Essa doença está relacionada com organóides citoplasmáticos denominados
a) plastos b) lisossomos c) dictiossomos
d) mitocôndrias e) centríolos
[B]
114. Considere as afirmações apresentadas a seguir.
I. O rendimento energético total de cada molécula de glicose degradada até 6CO‚ e 6H‚O é de 38 ATP (dois na Glicólise e trinta e seis nos processos Mitocondriais).
II. A utilização do oxigênio se dá nas cristas mitocondriais, como aceptor final de hidrogênios.
III. Em alguns microorganismos, o piruvato, proveniente da glicose, é posteriormente metabolizado para produzir moléculas de etanol.
Com relação à fermentação, pode-se afirmar que, das afirmações, apenas
a) a I está correta.
b) a II está correta.
c) a III está correta.
d) a I e a III estão corretas.
e) a II e a III estão corretas.
[C]
115. Sobre as funções das estruturas e das organelas, associe as colunas:
1. Flagelos
2. Lisossomos
3. Cloroplastos
4. Mitocôndrias
( ) movimento de células
( ) realizam a fotossíntese
( ) respiração celular
( ) digestão intracelular
A seqüência correta é:
a) 1, 3, 4 e 2 b) 1, 4, 3 e 2 c) 3, 2, 4 e 1
d) 1, 3, 2 e 4 e) 4, 2, 1 e 3
[A]
116. Observe a reação bioquímica apresentada a seguir e assinale a alternativa correta com relação a esse processo.
6C + 2ADP + 2P → 2PlRUVATO + 2 ATP
a) Trata-se da glicólise, que constitui numa série de reações enzimáticas processadas no interior da mitocôndria.
b) Apresenta um alto rendimento energético.
c) Ocorre consumo de 0‚.
d) O produto desta reação, piruvato, é transformado em ácido acético e este participa de outros processos bioenergéticos, com alto rendimento em ATP.
e) Este processo ocorre somente em células vegetais clorofiladas.
[D]
117. Na digestão intracelular, formam-se no interior do citoplasma celular os VACÚOLOS DIGESTIVOS, que derivam da associação de:
a) fagossomas e pinossomos.
b) fagossomas e ribossomas.
c) lisossomas e orgânulos intracitoplasmáticos.
d) ribossomas e vesículas de pinocitose.
e) lisossomas e fagossomas.
[E]
118. Na(s) questão(ões) a seguir escreva no espaço apropriado a soma dos itens corretos. A MITOCÔNDRIA, que é uma das mais im portantes organelas celulares, possui
DNA, RNA e ribossomos, o que a torna apta à síntese protéica. Dentre as alternativas a seguir, assinale as que exemplificam outros processos que ocorrem na mitocôndria.
01. Ciclo de Krebs.
02. Intercâmbio de substâncias entre a célula e o meio.
04. Glicólise.
08. Fosforilação oxidativa.
16. Regulação osmótica da célula.
01 + 08 = 09

17
119. Na(s) questão(ões) a seguir julgue os itens e escreva nos parentesses (V) se for verdadeiro ou (F) se for falso. A "teoria celular", uma das maiores generalizações da
biologia, postula que todos os seres vivos são formados por células. Em relação à morfofisiologia celular, julgue os itens.
( ) As células procariontes caracterizam-se pela ausência de material genético.
( ) As mitocôndrias são organelas responsáveis pela respiração celular.
( ) A carioteca delimita o conteúdo nuclear.
( ) O trifosfato de adenosina (ATP) é um composto químico constituído pela base nitrogenada adenina, pelo açúcar ribose e por três radicais fosfatos.
FVVV
120. Considere os seguintes orgânulos celulares:
I. LISOSSOMO
II. COMPLEXO DE GOLGI
III. CLOROPLASTO
IV. MITOCÔNDRIA
A síntese de ATP (adenosina trifosfato) ocorre normalmente:
a) apenas em III.
b) apenas em IV.
c) apenas em II e III.
d) apenas em III e IV.
e) em I, II, III e IV.
[D]
121. As mitocôndrias, organelas celulares relacionadas com a produção de energia (ATP), estão presentes em:
a) células animais e vegetais.
b) eucariotos e procariotos.
c) células animais apenas.
d) células vegetais apenas.
e) procariotos.
[A]
122. Assinale a alternativa que contém as organelas celulares relacionadas com a síntese e a secreção de proteínas, respectivamente:
a) Retículo endoplasmático granular e complexo de Golgi.
b) Retículo endoplasmático granular e lisossomos.
c) Complexo de Golgi e mitocôndrias.
d) Mitocôndrias e lisossomos.
e) Retículo endoplasmático liso e complexo de Golgi.
[A]
123. Os macrófagos são células capazes de fagocitar bactérias e outros agentes estranhos que serão digeridos pelas enzimas contidas
a) nas mitocôndrias. b) nos ribossomos. c) nos centríolos.
d) nos lisossomos. e) nos cloroplastos.
[D]
124. Relativamente à organela celular representada na figura a seguir, é correto afirmar que:

a) é formada por uma membrana simples com invaginações chamadas lamelas.


b) está ausente nas células animais, sendo exclusiva de vegetais.
c) apresenta enzimas responsáveis pela quebra de glicose para produção de ATP.
d) possui vesículas membranosas em forma de disco, os tilacóides, com pigmento para absorção de luz.
e) é visível somente ao microscópio eletrônico.
[D]
125. Os lisossomos, organóides observados no citoplasma de células como as das amebas tem por finalidade:
a) a digestão do alimento ingerido.
b) a produção de energia.
c) o transporte de substâncias.
d) o armazenamento de substâncias.
e) a defesa da célula amebiana.
[A]
126. O Complexo de Golgi observado no citoplasma de células animais e vegetais tem por finalidade:
a) a digestão do alimento ingerido.
b) a produção de energia.
c) o transporte de substâncias.
d) o armazenamento e secreção de substâncias.
e) a defesa da célula amebiana.
[D]
127. Durante a embriogênese, ocorre o processo de diferenciação celular, no qual cada célula se especializa para o desempenho de determinada função.
Células com função de secreção, proteção e absorção, todas em intensa atividade metabólica, devem apresentar, respectivamente:
a) desmossomos, microvilosidades, abundância de complexos de Golgi e mitocôndrias.
b) abundância de complexos de Golgi, desmossomos, microvilosidades e maior número de mitocôndrias.
c) abundância de complexos de Golgi, microvilosidades, desmossomos e muitas mitocôndrias.
d) microvilosidades, desmossomos, abundância de mitocôndrias e de retículos endoplasmáticos rugosos.
e) abundância de mitocôndrias, desmossomos, microvilosidades e extensa rede de microfilamentos.
[B]

18
128. Os cílios e flagelos são formados pelos:
a) cloroplastos b) centríolos c) mitocôndrias
d) vacúolos e) nucléolos
[B]
129. Os cloroplastos se originam a partir
a) de proplastos com capacidade de autoduplicação.
b) do retículo endoplasmático rugoso.
c) do retículo endoplasmático liso.
d) do complexo de Golgi.
e) dos nucléolos.
[A]
130. Considere os seguintes eventos numa célula produtora de mucopolissacarídeos:
I. síntese de polipeptídeos
II. combinação de açúcares com polipeptídeos
III. formação dos grãos de secreção
O complexo de Golgi é responsável apenas por
a) I b) II c) III d) I e II e) II e III
[E]
131. Na(s) questão(ões) a seguir, escreva no espaço apropriado a soma dos itens corretos.A Citologia se fundamenta em estudos morfológic os, funcionais e moleculares.
De acordo com os estudos citológicos, é correto afirmar que:
01) As mitocôndrias são responsáveis pela respiração celular tanto em células animais como em células vegetais.
02) O centríolo orienta a formação do fuso mitótico nas células dos vegetais superiores.
04) É possível diferenciar o DNA do RNA pela base pirimídica e pela pentose.
08) O principal componente do núcleo é a cromatina que é constituída por DNA e proteínas.
16) O nucléolo é uma estrutura característica das células eucariontes, visível na interfase.
32) O complexo de Golgi está relacionado a várias funções celulares, sendo a secreção celular uma delas.
01 + 04 + 08 + 16 + 32 = 61
132. Nos eritroblastos ocorre intensa síntese de hemoglobina. Essa síntese relaciona-se diretamente com
a) o complexo de Golgi. b) os centríolos.
c) as mitocôndrias. d) os lisossomos. e) os ribossomos.
[E]
133. O corante I é específico para DNA e o corante II para RNA. Um pesquisador usou esses dois corantes em células fixadas e observou sua ação sobre algumas
organelas citoplasmáticas.
Assinale, no quadro a seguir, a alternativa que representa os possíveis resultados obtidos por esse pesquisador (o sinal + significa reação positiva e o sinal - negativa).

[D]
134. Células musculares, células glandulares e células de um microorganismo de água doce, deverão ter bem desenvolvidas as seguintes organelas, respectivamente:
a) cloroplastos, mitocôndrias e centríolos.
b) complexo de Golgi, retículo endoplasmático liso e lisossomos.
c) mitocôndrias, complexo de Golgi e vacúolo contrátil.
d) retículo endoplasmático rugoso, mitocôndrias e complexo de Golgi.
e) centríolos, vacúolo contrátil e lisossomos.
[C]
135. A figura a seguir indica as diversas etapas do processo que uma ameba realiza para obter alimento.

A organela que se funde ao fagossomo contém


a) produtos finais da digestão.
b) enzimas que sintetizam carboidratos.
c) enzimas digestivas.
d) enzimas da cadeia respiratória.
e) reservas energéticas.
[C]
136. As funções de síntese protéica, síntese de lipídios, digestão intracelular, respiração celular e formação do fuso acromático são realizadas, respectivamente, pelas
seguintes estruturas:
a) ribossomo, retículo endoplasmático liso, mitocôndrias, lisossomos e centríolos
b) ribossomo, retículo endoplasmático liso, lisossomos, mitocôndrias e centríolos

19
c) ribossomo, lisossomos, retículo endoplasmático liso, mitocôndrias e centríolos
d) retículo endoplasmático liso, mitocôndrias, lisossomos, centríolos e ribossomos
e) retículo endoplasmático liso, ribossomos, lisossomos, centríolos e mitocôndrias
[B]
137. Na(s) questão(ões) a seguir, escreva no espaço apropriado a soma dos itens corretos.Sobre células, organelas celulares e suas funções, é corre to afirmar que:
01 - As mitocôndrias estão presentes tanto em células animais quanto em vegetais e são responsáveis pela produção d e energia.
02 - Lisossomas são organelas responsáveis pela digestão intracelular.
04 - Numa célula onde se processa intensa síntese de proteínas encontra-se bastante desenvolvido o retículo endoplasmático granular ou rugoso.
08 - Um organismo multicelular que produza gás carbônico e água a partir da glicose apresenta obrigatoriamente cloroplastos.
16 - A remoção dos centríolos de uma célula impede o processo da fotossíntese,
32 - Os ribossomos podem ser encontrados aderidos ao retículo endoplasmático agranular ou liso.
64 - Entende-se por permeabilidade seletiva o controle de entrada e saída de substâncias da célula, feito pela membrana celular.
01 + 02 + 04 + 64 = 71
138. A célula é um organismo que realiza suas várias funções de uma maneira dinâmica.

O esquema anterior, de uma célula em atividade, só NÃO mostra a:


a) correlação funcional existente entre organelas celulares.
b) captura de substâncias pela célula num processo denominado endocitose.
c) circulação de substâncias por vesículas membranosas na célula.
d) liberação de excreção lipídica para o meio extracelular onde vão atuar.
e) produção, armazenagem e atuação de enzimas digestivas.
[D]
139. Considere as seguintes funções que ocorrem no interior da célula: Digestão intracelular, respiração, tra nsporte de substâncias e secreção. Estas funções são
realizadas respectivamente por
a) Mitocôndria, Complexo de Golgi, Lisossomo e Retículo endoplasmático.
b) Ribossomo, Mitocôndria, Retículo endoplasmático e Complexo de Golgi.
c) Lisossomo, Mitocôndria, Retículo endoplasmático e Complexo de Golgi.
d) Lisossomo, Complexo de Golgi, Mitocôndria e Retículo endoplasmático.
e) Ribossomo, Mitocôndria, Retículo endoplasmático e Complexo de Golgi.
[C]
140. Os centríolos são organelas celulares relacionadas com
a) o surgimento de vacúolos autofágicos.
b) a remoção do excesso de água.
c) o processo de recombinação genética.
d) a formação de cílios e flagelos.
e) os fenômenos de plasmólise e deplasmólise.
[D]
141. Observe o seguinte esquema:

Assinale a alternativa que identifica corretamente as organelas e os processos celulares representados em I e II.
a) I - (ribossomo - síntese de açúcares),
II - (mitocôndria - respiração)
b) I - (cloroplasto - fotossíntese),
II - (ribossomo - respiração)
c) I - (cloroplasto - fotossíntese),
II - (mitocôndria - respiração)
d) I - (mitocôndria - respiração),
II - (cloroplasto - fotossíntese)
e) I - (mitocôndria - sintese de açúcares),
II - (ribossomo - respiração)
[C]
142. "Captura aminoácidos que se encontram dissolvidos no citoplasma e carrega-os ao local da síntese de proteínas".
Essa função é desempenhada pelo
a) RNA mensageiro. b) RNA transportador.

20
c) RNA ribossômico. d) ribossomo. e) DNA.
[B]
143. Observe o desenho a seguir e assinale a alternativa que preenche corretamente os espaços da frase a seguir.

A organela indicada no desenho é o ............., responsável pela eliminação do excesso de ............. que entra por ..... ........ em uma célula que vive em um meio .............
em relação ao seu citoplasma.
a) vacúolo pulsátil; água; osmose; hipotônico.
b) vacúolo digestivo; sais minerais; osmose; hipertônico.
c) vacúolo pulsátil; água; transporte ativo; hipertônico.
d) vacúolo digestivo; sais minerais; difusão; hipertônico.
e) vacúolo pulsátil; sais minerais; transporte ativo; hipertônico.
[A]
144. Na célula representada a seguir, a produção, o armazenamento e a secreção de proteínas são funções exercidas respectivam ente pelas organelas:

a) I, III e V b) I, II e IV c) II, III e V


d) I, IV e V e) II, III e IV
[B]
145. Relacione a coluna A, que apresenta as funções, com a coluna B, onde estão as organelas.
Coluna A
1 - digestão celular
2 - respiração
3 - presença de material genético
4 - presença de substâncias para exportação
Coluna B
( ) núcleo
( ) mitocôndria
( ) lisossoma
( ) complexo de Golgi
A seqüênciar numérica correta, de cima para baixo, na coluna B, é
a) 3 - 4 - 2 – 1 b) 3 - 2 - 1 – 4 c) 4 - 3 - 2 - 1
d) 3 - 1 - 2 – 4 e) 4 - 3 - 1 – 2
[B]
146. Qual das estruturas a seguir está relacionada com o processo da divisão celular e com os movimentos de cílios e flagelos?
a) Retículo endoplasmático. b) Lisossoma. c) Vacúolo.
d) Centríolo. e) Ribossoma.
[D]
147. Relacione a coluna I (organela celular), com a coluna II (função respectiva).
COLUNA I
I - Mitocôndria
II - Ribossomo
III - Lisossomo
IV - Centríolo
COLUNA II
( ) Digestão celular
( ) Síntese protéica
( ) Respiração
( ) Divisão celular
Marque a opção que contém, na coluna II, a seqüência correta, de cima para baixo, de sua relação com a coluna I:
a) III, IV, I, II b) IV, II, III, I c) III, II, I, IV
d) II, I, III, IV [C]
148. Quando a célula engloba gotículas do líquido extracelular, formam-se vesículas de pinocitose que dão origem a vacúolos digestivos unindo-se com
a) fagossomos. b) lisossomos. c) cromossomos.
d) ribossomos. e) centrossomos.
[B]
149. Considere o seguinte texto:
"Em seu processo de diferenciação, os eritroblastos da medula óssea vermelha sintetizam grande quantidade de moléculas de hem oglobina, transformando-se em
reticulócitos que passam para a corrente sangüínea."
O texto permite concluir que eritroblastos são células
a) ricas em ribossomos.
b) ricas em lisossomos.

21
c) dotadas de cílios.
d) dotadas de flagelo.
e) com reservas de gorduras.
[A]
150. Nas células dos eucariontes autótrofos, as enzimas que atuam no processo da fotossíntese estão
a) em invaginações da membrana plasmática.
b) dispersas no citoplasma fundamental.
c) no suco celular do vacúolo.
d) no interior dos cloroplastos.
e) no interior das mitocôndrias.
[D]
151. Considere o seguinte texto:
"Quando uma espermátide se transforma em espermatozóide, seu ...(I)... dá origem ao acrossomo, estrutura repleta de enzimas digestivas; suas ...(II)... concentram-se
na peça intermediária e seu ...(III)... dá origem ao flagelo."
Para completá-lo corretamente, os espaços I, II e III devem ser preenchidos, respectivamente, por:
a) núcleo - reservas nutritivas - centríolo
b) centríolo - reservas nutritivas - núcleo
c) núcleo - mitocôndrias - complexo de Golgi
d) complexo de Golgi - reservas nutritivas - núcleo
e) complexo de Golgi - mitocôndrias – centríolo
[E]
152. Observe os esquemas a seguir que representam dois organismos.

O corpo basal de cada estrutura locomotora corresponde a


a) um centríolo.
b) um ribossomo.
c) um lisossomo.
d) um cloroplasto.
e) uma mitocôndria.
[A]
153. O alto grau de independência de alguns orgânulos citoplasmáticos levou à elaboração da "hipótese endossimbiôntica": esse s orgânulos teriam se originado de
procariontes de vida livre, possivelmente bactérias, que em algum momento associaram-se a uma célula de eucarionte. Esses orgânulos são os
a) cílios e os flagelos.
b) cloroplastos e os lisossomos.
c) cloroplastos e as mitocôndrias.
d) lisossomos e as mitocôndrias.
e) centríolos, os cílios e os flagelos.
[C]
154. Podemos dividir as funções citoplasmáticas em três grupos:
I - síntese e transporte das macromoléculas;
II - metabolismo energético;
III - movimentos celulares.
Quanto às estruturas envolvidas nessas funções, podemos afirmar que:
a) ribossomos, retículo endoplasmático e Complexo de Golgi desempenham funções do tipo I.
b) cloroplastos, mitocôndrias e microtúbulos desempenham funções do tipo II.
c) microtúbulos, microfilamentos e vacúolos desempenham funções do tipo III.
d) peroxissomos e glioxissomos desempenham tanto as funções do tipo I quanto as funções do tipo II.
e) centríolos, cílios e flagelos desempenham tanto as funções do tipo II quanto as funções do tipo III.
[A]
155. Nas células eucariotas vegetais, o cloroplasto é responsável pela:
a) fotossíntese e respiração celular.
b) fotossíntese, apenas.
c) respiração celular, apenas.
d) síntese de proteínas e lípides.
e) síntese de ácidos nucléicos.
[B]
156. Está presente na célula bacteriana:
a) aparelho de Golgi. b) carioteca. c) mitocôndria.
d) retículo endoplasmático. e) ribossomo.
[E]
157. A doença de Tay-Sachs é hereditária e provoca retardamento mental grave e morte do paciente na infância. Essa doença é devida à incapacidade das células de
digerir uma substância cujo acúmulo é responsável pelas lesões no sistema nervoso central.
Com base nessas informações, pode-se afirmar que a organela celular cuja função está alterada nessa doença é
a) a mitocôndria.
b) o complexo de Golgi.
c) o lisossomo.
d) o retículo endoplasmático rugoso.
[C]

22
158. O esquema adiante representa uma célula animal vista ao microscópio eletrônico, na qual algumas estruturas foram numeradas de 1 a 9.

Com relação às estruturas indicadas no esquema, é INCORRETO afirmar que


a) 1, 5 e 6 sofrem intensas modificações na divisão celular.
b) 2, 3 e 7 sintetizam e/ou armazenam substâncias orgânicas.
c) 4 e 8 realizam digestão celular com produção de energia e liberação de CO‚.
d) 5 e 9 são desprovidos de membrana lipoprotéica.
[C]
159. Tendo sua origem na fase de maturação do Complexo de Golgi, os lisossomas são corpúsculos citoplasmáticos arredondados, pequenos, e que possuem grande
quantidade de proteínas no seu interior. Assim, podemos afirmar que os lisossomas estão ligados à função de:
a) digestão intracelular.
b) síntese de proteínas.
c) complexação de lipídeos.
d) coagulação sangüínea.
e) reserva de glicogênio.
[A]
160. Na(s) questão (ões) adiante, escreva no espaço apropriado a soma dos itens corretos.Um feixe de células musculares estriadas, mantido em cultura com todas as
condições ideais, foi submetido a várias séries de contrações e relaxamentos (exercício) por vários dias consecutivos, seguid o de um período de repouso (sem exercício)
de também alguns dias. Durante esses períodos quantificou-se o número de mitocôndrias por célula, possibilitando a elaboração do gráfico a seguir:

A partir desse gráfico e de conhecimentos sobre o assunto enfocado, é correto afirmar:


01) O número de mitocôndrias por célula aumenta durante o exercício porque a célula precisa de muito ATP, e é a mitocôndria que o produz.
02) Há um número mínimo necessário de mitocôndrias por célula para manter o metabolismo desta, mesmo quando em repouso.
04) Se fosse sempre mantida a mesma carga de exercícios, o número de mitocôndrias por célula aumentaria indefinidamente.
08) O número de mitocôndrias aumenta nas células porque elas são fagocitadas do meio de cultura.
16) Quando cessa o exercício, o excesso de mitocôndrias é removido pela digestão intracelular dessas organelas.
32) Se fosse também medido o consumo de oxigênio destas células, o gráfico seria semelhante ao obtido para o número de mitocô ndrias.
01 + 02 + 16 + 32 = 51
161. A maioria das moléculas de ATP que as células utilizam em suas atividades metabólicas forma-se
a) no núcleo celular. b) no retículo endoplasmático.
c) no sistema de Golgi. d) nas mitocôndrias. e) nos lisossomos.
[D]
162. Das estruturas celulares a seguir, aquela cuja existência foi revelada pelo microscópio eletrônico é
a) o nucléolo. b) a cromatina. c) a mitocôndria.
d) o centríolo. e) o retículo endoplasmático.
[E]
163. Uma substância tóxica que interfira com a síntese de proteínas afetará, em primeiro lugar, a função exercida
a) pelo núcleo. b) pelos ribossomos. c) pelas mitocôndrias.
d) pela membrana celular. e) pelos centríolos.
[B]
164. Desde o início da teoria celular até hoje, muito se tem descoberto acerca da célula, de suas organelas e características, e a respeito dos processos bioquímicos que
nelas ocorrem. Com relação a esse tema, julgue os itens seguintes.
(0) O movimento citoplasmático, conhecido como ciclose, é visível ao microscópio óptico e tem intensidade inversamente propor cional à temperatura.
(1) Alterações na concentração dos íons provocam, nas células, modificações profundas na permeabilidade, na viscosidade e na capacidade de resposta a estímulos.
(2) Mitocôndrias, retículo endoplasmático e lisossomos são comuns às células procarióticas e às eucarióticas.
(3) O número de cloroplastos de uma célula é determinado geneticamente, mantendo-se estável ao longo da vida celular.
(4) O açúcar das frutas é produzido durante o processo de fotossíntese.
(5) O fumo e a atividade física regular têm papéis antagônicos na destruição do excesso de colesterol.
Itens corretos: 1 e 5
Itens errados: 0, 2, 3 e 4
165. O esquema a seguir representa uma célula animal sobre a qual são feitas as afirmações a seguir:

23
I. A estrutura 2 representa a parede celular que funciona como uma barreira seletiva entre o citoplasma e o meio ambiente.
II. A estrutura 3 corresponde ao retículo endoplasmático rugoso onde ocorre a síntese protéica.
III. A estrutura 4 desempenha funções relacionadas ao processo de digestão intracelular.
IV. O esquema representa uma célula ingerindo porções líquidas e formando vesículas pinocitóticas.
V. A estrutura 5 está presente apenas nas células animais.
VI. Os plastos responsáveis pela realização da fotossíntese não estão presentes nessa célula.
Assinale a alternativa que reúne as afirmações corretas.
a) III, V e VI.
b) I, II, e IV.
c) II, IV e VI.
d) II, IV, V e VI.
e) I, II, III e V.
[C]
166. Os esquemas abaixo representam aspectos ultra-estruturais de três organelas (I a III) presentes no citoplasma de uma determinada célula e dois processos (A e B)
executados pelas células.

Valendo-se das informações dadas, julgue os seguintes itens.


(1) O processo representado em A ocorre na estrutura III de células vegetais.
(2) A matéria orgânica produzida no processo representado em B é utilizada na estrutura II.
(3) A estrutura II é encontrada em grande quantidade nas células do pâncreas endócrino.
(4) As estruturas I e III contêm DNA.
(5) A primeira etapa do processo representado em B ocorre sem a participação de enzimas.
EECCE
167. Alimento protéico marcado com radioatividade foi fagocitado por paramécios. Poucos minutos depois, os paramécios foram a nalisados e a maior concentração de
radiatividade foi encontrada
a) nos centríolos. b) nas mitocôndrias. c) na carioteca.
d) no nucléolo. e) no retículo endoplasmático.
[E]
168. Os primeiros citologistas, observando alguns seres vivos, detectaram unidades morfológicas comuns a todos eles - as células -, cada uma delas contendo as
informações hereditárias de todo o organismo. Com relação à célula, julgue os itens a seguir.
(0) A destruição do nucléolo de uma célula não afeta o metabolismo dessa célula.
(1) Se a membrana lisossômica se romper dentro de uma célula, causará a destruição desta.
(2) Diferentemente de uma ameba marinha, a ameba de água doce pode não apresentar vacúolos pulsáteis.
(3) As células epiteliais do intestino grosso apresentam microvilosidades que aumentam a superfície de absorção do alimento.
Item correto: 1
Itens errados: 0, 2 e 3
169. De acordo com a "teoria celular", a continuidade da vida tem base na célula, na qual existe um princípio de complementar iedade entre estrutura e função.
Com o auxílio da figura a seguir, que representa uma célula vegetal, julgue os itens que se seguem.

24
(1) A estrutura I está presente tanto nas células procariontes quanto nas eucariontes, sendo responsável pela respiração celular.
(2) A estrutura II é totalmente produzida na estrutura V.
(3) Células glandulares possuem as estruturas III e VI bem desenvolvidas.
(4) No estroma da estrutura IV, encontram-se ácidos nucléicos.
(5) A quantidade de estruturas no citoplasma está relacionada com a atividade metabólica da célula.
Itens corretos: 4 e 5
Itens errados: 1, 2 e 3
170. A figura adiante representa a fagocitose de uma bactéria e alguns eventos celulares subseqüentes.

Com base na figura, julgue os seguintes itens.


(1) A estrutura lipoprotéica das membranas celulares permite-lhe grande mobilidade e eventos como invaginação e fusão.
(2) I representa um lisossomo primário e III, um lisossomo secundário.
(3) II é uma organela rica em proteases, nucleases e lipases.
(4) No interior de IV, encontram-se aminoácidos, açúcares e nucleotídeos provenientes da lise da bactéria.
Itens corretos: 1, 3 e 4
Item errado: 2
171. O gráfico mostra o resultado de um experimento onde se avaliou o consumo de oxigênio de uma solução, pela mitocôndria, e m presença de adenosina difosfato
(ADP) e adenosina trifosfato (ATP).

A partir deste resultado, podemos afirmar que, em relação à taxa de consumo de oxigênio, ocorre:
a) aumento pela adição de ATP e produção ADP
b) aumento pela adição de ADP e produção de ATP
c) diminuição pela adição de ATP e produção de ADP
d) diminuição pela adição de ADP e produção de ATP
[B]
172. Assinale a alternativa que apresenta estruturas encontradas em todos os tipos de células.
a) núcleo, mitocôndrias e ribossomos
b) parede celular, ribossomos e nucléolo
c) centríolo, complexo de Golgi e núcleo
d) ribossomos, membrana plasmática e hialoplasma
e) hialoplasma, carioteca e retículo endoplasmático
[D]
173. Relativamente à célula animal abaixo, assinale a alternativa correta.

a) Se o funcionamento da organela 1 for bloqueado, não ocorrerá transcrição.


b) A organela 2 é membranosa e pouco numerosa em células musculares.
c) A organela 3 é o centríolo, que promove a duplicação dos cromossomos durante a divisão celular.
d) A organela 4 somente aparece em células secretoras.
e) A estrutura 5 está associada à organela 1 , podendo apresentar ribossomos aderidos a ela.
[E]
174. A respeito da organela representada abaixo, assinale a alternativa INCORRETA.

25
a) Está presente em todos os organismos autótrofos.
b) A estrutura 1 apresenta pigmentos que absorvem energia utilizada na produção de ATP.
c) Em 2, há enzimas que utilizam CO‚ para fabricação de glicose.
d) Essa organela possui capacidade de autoduplicação.
e) O processo realizado por essa organela ocorre em 2 etapas, sendo que uma delas não depende de luz.
[A]
175. Podemos definir "condrioma" como:
a) a fase anaeróbica da respiração celular.
b) a degradação total da glicose.
c) um conjunto de mitocôndrias.
d) um processo de liberação de energia pela célula.
e) uma organela citoplasmática exclusiva das células vegetais.
[C]
176. O esquema a seguir representa um espematozóide humano.

Os centríolos e o complexo de Golgi participam, respectivamente, na formação das estruturas


a) I e II b) II e IV c) III e V d) IV e I e) V e III
[E]
177. As mitocôndrias são organelas citoplasmáticas que apresentam estruturas internas chamadas cristas. Essas cristas mitocondriais têm por função
a) capturar glicose.
b) produzir enzimas.
c) aumentar a superfície da membrana interna.
d) aumentar a disponibilidade de lipídios.
e) produzir oxigênio.
[C]
178. Um tecido de determinado animal tem uma alta atividade fagocitária; portanto, a organela encontrada em maior quantidade nesse tecido é a denominada
a) mitocôndria b) complexo de Golgi. c) lisossoma.
d) ribossoma. e) retículo endoplasmático.
[C]
179. "Derrubamos a grande barreira que separava os reinos animal e vegetal: a célula é a unidade da matéria viva." Essa afirm ativa foi feita por cientistas ao descobrirem,
em 1839, aquilo que lírios, águas-vivas, gafanhotos, minhocas, samambaias e humanos têm em comum.
Pode-se dizer que todas as células dos seres acima citados têm as seguintes características:
a) centríolo e lisossomo
b) parede celular e mesossomo
c) núcleo individualizado e mitocôndria
d) material nuclear disperso e cloroplasto
[C]
180. Considere as seguintes estruturas de um espermatozóide:
I - Acrossomo
II - Retículo endoplasmático rugoso
III - Complexo de Golgi
O caminho percorrido pelas enzimas digestivas responsáveis pela perfuração do óvulo é:
a) II III I
b) II I III
c) III II I
d) I II III
[A]
181. Silicose, doença freqüente em operários que trabalham em pedreiras, é um exemplo de conseqüência da autólise celular. A sílica, que se mistura ao ar inspirado,
destrói determinados componentes celulares, cujas enzimas resultam na morte das células pulmonares. Os componentes celulares diretamente afetados pela sílica são
a) os ribossomos. b) os centríolos. c) os lisossomos.
d) as mitocôndrias. e) os peroxissomos.
[C]
182. Diversas espécies de peixes modificam a cor da pele quando submetidas a algumas variações do meio ambiente. As células r esponsáveis por essa alteração contêm
grânulos de pigmentos que se espalham por toda a célula ou se agregam numa posição mais central da mesma, em resposta a estímulos hormonais ou nervosos. Assinale
a opção que indica, corretamente, as estruturas celulares responsáveis pela movimentação dos grânulos de pigmentos no citoplasma.
a) desmossomos b) dictiossomos c) glioxissomos
d) microtúbulos e) ribossomos
[D]

26
183. O acrossomo, presente nos espermatozóides maduros, é essencial para a fecundação. A formação do acrossomo ocorre a partir do:
a) peroxissomo b) lisossomo c) complexo de Golgi
d) centríolo e) retículo endoplasmático liso
[C]
184. Sobre a organela celular representada a seguir, é CORRETO afirmar que:

a) é revestida por unidade de membrana dupla.


b) contém grande quantidade de DNA na sua luz.
c) tem papel importante na síntese de ATP.
d) realiza a fotossíntese.
e) sintetiza carboidratos e armazena proteínas.
[E]
185. Observe a figura a seguir, que representa o corte transversal de um cílio de um protozoário:

A estrutura apontada pela seta corresponde:


a) ao microtúbulo.
b) à unidade de membrana.
c) ao feixe esquelético calcificado.
d) a tecido conjuntivo fibroso.
e) a uma fibra conjuntiva elástica.
[A]
186. Observe a figura a seguir, que corresponde ao esquema de um retículo endoplasmático rugoso observado ao microscópio eletrônico:

As estruturas globulares associadas à face externa da membrana do retículo citoplasmático, como a apontada pela seta, correspondem:
a) a dobras da unidade de membrana que o reveste.
b) ao acúmulo de DNA proveniente do núcleo.
c) aos ribossomos associados à sua face externa.
d) a perfurações para saída de moléculas protéicas.
e) a canais para passagem de íons.
[C]
187. Autofagia e autólise:
a) são denominações diferentes para o mesmo fenômeno.
b) são fenômenos diferentes, sendo que, no primeiro, a célula capta partículas nutritivas do meio extracelular.
c) são fenômenos diferentes, sendo que, no segundo, a célula é destruída pela ruptura dos lisossomos.
d) constituem o mesmo tipo de fenômeno, em que a célula busca alimento nomeio extracelular.
e) constituem o mesmo tipo de fenômeno, sendo que o primeiro corresponde à fagocitose e o segundo, à pinocitose.
[C]
188. Assinale o elemento que NÃO é um componente de uma célula eucariota heterótrofa:
a) Carioteca. b) Mitocôndria. c) Cloroplasto.
d) DNA. e) RNA.
[C]
189. NÃO é uma característica associada à mitocôndria:
a) É envolvida por unidade de membrana dupla.
b) Tem capacidade de autoduplicação.
c) É encontrada em células eucariotas animais e vegetais.
d) Tem função de produção e armazenamento de energia.
e) Não possui DNA em sua matriz.
[E]
190. Sabe-se que as células do ácino no pâncreas são as responsáveis pela produção das enzimas pancreáticas. As estruturas que a nível celular são responsáveis por
esse processo são

27
a) o complexo de Golgi e a mitocôndria.
b) a membrana e o RER.
c) o ribossoma e o REL.
d) o RER e o complexo de Golgi.
e) o REL e o complexo de Golgi.
[D]
191. Com relação às características que diferenciam células bacteriana, vegetal e animal, analise as afirmativas a seguir e assinale a alternativa INCORRETA:
a) A célula vegetal se diferencia da animal por apresentar parede celulósica.
b) A célula animal se diferencia da bacteriana por apresentar complexo de Golgi.
c) A célula bacteriana se diferencia da vegetal por não apresentar cloroplastos.
d) A célula vegetal se diferencia da animal por apresentar plastídeos.
e) A célula bacteriana se diferencia da animal por ter material genético envolto por membrana.
[E]
192. Analisando o esquema a seguir, assinale a alternativa que representa os números I, II e III, respectivamente:

a) fagocitose, clasmocitose e pinocitose.


b) pinocitose, fagocitose e clasmocitose.
c) clasmocitose, pinocitose e fagocitose.
d) clasmocitose, fagocitose e pinocitose.
e) pinocitose, clasmocitose e fagocitose.
[B]
193. O componente celular em que se forma maior número de moléculas de ATP durante a conversão de uma molécula de glicose em água e gás carbônico é
a) o peroxissomo.
b) a mitocôndria.
c) o cloroplasto.
d) o ribossomo.
e) o complexo de Golgi.
[B]
194. Uma célula eucarionte, que realiza síntese protéica para exportação, geralmente utiliza, como vias de direcionamento de saída dos produtos, as organelas:
a) retículo endoplasmático rugoso e complexo de Golgi
b) lisossomos e complexo de Golgi
c) centríolos e lisossomos
d) retículo endoplasmático rugoso e mitocôndrias
[A]
195. As "doenças de depósito", são aquelas em que as células acumulam, no seu interior, certas substâncias, em virtude da sua incapacidade de catabolisar as mesmas.
Isto causa sérios danos às células, por prejuízos, fundamentalmente no "turnover" celular, prejudicando seus processos vitais e podendo levar até à morte. Indique a opção
que contém a organela mais diretamente relacionada à causa dessas doenças.
a) complexo de Golgi b) lisossomo
c) retículo endoplasmático liso d) ribossomo
[B]
196. O desenho representa o processo de

a) secreção celular: A representa a pinocitose e B, complexo de Golgi.


b) digestão intracelular: A representa a fagocitose e B, os peroxissomos.
c) digestão intracelular: A representa a formação do lisossomo e B, a dos peroxissomos.
d) secreção celular: A representa a fagocitose e B, a formação de lisossomos.
e) digestão intracelular: A representa a fagocitose e B, a formação dos lisossomos.
[E]
197. Em relação à ocorrência, origem estrutura e função das organelas citoplasmáticas, assinale a(s) proposição(ões) VERDADEIRA(S).
01. O Complexo de Golgi existe em abundância nas células secretoras e participa da síntese de aminoácidos.
02. Os vacúolos pulsáteis ocorrem em alguns Protistas e participam da manutenção do equilíbrio homeostático.
04. As Mitocôndrias são formadas de enzimas oxidantes e participam do processo de desintoxicação celular.
08. Os lisossomos originam-se do ergastoplasma (RER) e do Complexo de Golgi e participam do processo de respiração celular.
16. Os vacúolos do suco celular são exclusivos das células vegetais, sendo pequenos e numerosos nas células jovens e geralmente único na célula adulta.
32. Os centríolos coordenam o processo de divisão cromossômica.
64. Os plastos são organelas citoplasmáticas que ocorrem em todos os vegetais e em todos os Protistas.

28
FVFFVVF
198. Escolha a(s) alternativa(s) correta(s) com relação à organelas celulares.
01. Lisossomos são pequenas vesículas originadas a partir das mitocôndrias.
02. O complexo de Golgi tem como função receber, armazenar e, freqüentemente, modificar proteínas.
04. Ribossomos são constituídos de RNA e proteínas.
08. Peroxissomos estão relacionados com a quebra de ácidos graxos.
16. As mitocôndrias têm como função principal produzir glicose a partir de CO‚ e H‚O.
32. Os centríolos estão presentes tanto em células animais quanto em células vegetais.
64. O acrossomo de um espermatozóide é formado a partir do complexo de Golgi modificado.
FVVVFFV
199. No que se refere à respiração celular, assinale a alternativa correta.
a) A respiração celular divide-se em três fases: a Glicólise (que ocorre no citoplasma), o Ciclo de Krebs (que ocorre na mitocôndria) e a Cadeia Respiratória (que ocorre
na mitocôndria).
b) A Glicólise é a fase aeróbica da respiração que consiste na degradação da glicose até a formação do ácido pirúvico.
c) Na Glicólise, há a oxidação de moléculas de NAD em NADH‚ e ADP, sendo essa a fase mais energética da respiração celular dos mamíferos.
d) No Ciclo de Krebs, o gás-carbônico é liberado da transformação do ácido pirúvico em ácido cítrico, processo que consome 2 ATPs.
e) Na Cadeia Respiratória, o FAD ganha H+ e se transforma em FADH‚, liberando CO‚ e H‚O.
[A]
200. Em uma situação experimental, camundongos respiraram ar contendo gás oxigênio constituído pelo isótopo ¢©O. A análise de células desses animais deverá detectar
a presença de isótopo ¢©O, primeiramente,
a) no ATP. b) na glicose. c) no NADH.
d) no gás carbônico. e) na água.
[E]
201. Com base em estudos citológicos, pode-se afirmar:
01) A quantidade de água em um organismo depende da intensidade da atividade metabólica de suas células, do tipo de tecido considerado, da idade do indivíduo e da
espécie a que ele pertence.
02) Uma planta provavelmente aumentará sua taxa de fotossíntese quando for colocada em um local iluminado por luz verde.
04) O processo de transporte de elétrons, acoplado à oxigenação fosforilativa, ocorre na matriz mitocondrial.
08) Células que manifestam alta atividade fagocitária devem apresentar um número elevado de lisossomos.
16) Durante a prófase I meiótica ocorre o "crossing-over", de grande importância na variabilidade genética entre os descendentes.
32) Os peroxissomos atuam na decomposição de H‚O‚, composto formado como produto final em muitas reações do metabolismo, de efeito altamente lesivo às células.
64) Apenas células de vida livre apresentam cílios, visto serem eles estruturas cuja única função é a movimentação celular.
VFFVVVF
202.Temos a seguir esquematizado o ciclo de vida de uma determinada planta terrestre. Analisando esse ciclo e desprezando a ocorrência de mutações, pode-se prever
que os componentes com a mesma constituição genética são indicados por:

a) I, II e III. b) I, II e V. c) I, III e IV.


d) II, III e IV. e) III, IV e V.
[B]
203. A figura a seguir representa algumas etapas do ciclo de vida de uma espécie animal. Analise e assinale a alternativa que corresponde às etapas 1, 2 e 3,
respectivamente:

a) meiose, desenvolvimento e fecundação;


b) mitose, fecundação e meiose;
c) mitose, fecundação e desenvolvimento;
d) meiose, fecundação e desenvolvimento;
e) mitose, meiose e fecundação.
[D]
204. Considere as seguintes afirmações.
I - Apesar da grande diversidade de organismos eucariontes existentes e tipos de células que eles apresentam, há basicamente dois tipos de divisão celular: mitose e
meiose.
II - A evolução biológica, pela seleção natural, depende diretamente do processo meiótico.
III - Nos ciclos de vida de organismos que se reproduzem sexualmente, há sempre uma seqüência entre meiose e fertilização.
Quais estão corretas?

29
a) Apenas I. b) Apenas II. c) Apenas III.
d) Apenas I e II. e) I, II e III.
[E]
205. Considere o seguinte ciclo de vida:

Nele, a meiose precede a formação dos


a) gametas e a fase adulta predominante é diplóide.
b) gametas e a fase adulta predominante é haplóide.
c) gametas e ocorre alternância de gerações.
d) esporos e a fase adulta predominante é a diplóide.
e) esporos e ocorre alternância de gerações.
[E]
206. Todo indivíduo eucarionte com reprodução sexuada realiza, em alguma fase de seu ciclo, o processo meiótico.

A observação da figura nos permite classificar esta meiose como:


a) somática. b) gamética. c) espórica.
d) zigótica. e) haplôntica.
[D]
207. O esquema abaixo ilustra o ciclo reprodutivo de um grande número de seres vivos.
Como exemplo de representantes deste ciclo temos:

a) cogumelos. b) algas. c) insetos.


d) avenca. e) ervilha.
[C]
208. Os esquemas a seguir representam três tipos de ciclos de vida.

Os ciclos de vida válidos para todas as samambaias, certas algas e todas as aves são, respectivamente,
a) I, II e III b) I, III e II c) II, III e I
d) III, I e II e) III, II e I
[D]

30
209. Partindo-se de 15 espermatócitos de 1• ordem e 15 ovócitos de 1• ordem, os números de espermatozóides e de óvulos serão:
a) 15 e 15 b) 15 e 60 c) 30 e 15
d) 60 e 15 e) 60 e 60
[D]
210. Considerando que na perereca 'Hyla viridis' o cariótipo normal é 2n=24, quantos cromossomos podemos esperar encontrar, respec tivamente numa ovogônia, num
glóbulo polar, num ovócito primário e num óvulo desse animal?
a) 12, 24, 12, 24; b) 24, 12, 24, 12; c) 24, 24, 12, 12;
d) 24, 12, 12, 24; e) 24, 24, 24, 12;
[B]
211. Sabendo-se que numa cadela o cariótipo normal é 2n=78, quantos cromossomos podemos esperar encontrar, respectivamente numa ovogônia, num glóbulo polar,
num ovócito primário e num óvulo desse animal?
a) 78, 39, 39, 78. b) 39, 39, 78, 78. c) 78, 78, 39, 39.
d) 78, 39, 78, 39. e) 39, 78, 39, 78.
[D]
212. Na perereca ('Hyla viridis') o cariótipo normal é 2n=24, quantos cromossomos podemos esperar encontrar, respectivamente numa espermatogônia, num espermatócito
primário, num espermatócito secundário e num espermatozóide desse animal?
a) 12, 24, 12, 24; b) 24, 12, 24, 12; c) 24, 24, 12, 12;
d) 24, 12, 12, 24; e) 24, 24, 24, 12;
[C]
213. Num gorila fêmea o cariótipo normal é 2n=48, quantos cromossomos podemos esperar encontrar, respectivamente numa ovogônia, num glóbulo polar, num ovócito
primário e num óvulo desse animal?
a) 48, 24, 48, 24. b) 24, 48, 48, 24. c) 24, 48, 24, 48.
d) 48, 48, 24, 24. e) 24, 24, 48, 48.
[A]
214. Em relação ao esquema a seguir, que representa o processo de espermatogênese humana, assinale a alternativa correta:

a) 1 representa uma célula germinativa diplóide.


b) 2 representa um espermatócito primário diplóide.
c) 3 representa um espermatócito secundário haplóide.
d) 5 representa uma espermátide diplóide.
e) 6 representa um espermatozóide diplóide
[A]
215. Em relação à gametogênese humana, responda:
a) Quantos espermatócitos primários se formam a partir de 150 espermatogônias?
b) Quantos óvulos são formados a partir de 346 ovogônias?
a) 150
b) 346
216. Sabendo- se que seres humanos possuem 46 cromossomos em suas células somáticas, pode-se afirmar que no processo de gametogênese no homem
a) as células germinativas têm 23 cromossomos.
b) as espermatogônias têm 46 cromossomos.
c) os espermatócitos primários têm 23 cromossomos.
d) os espermatócitos secundários têm 46 cromossomos.
e) as espermátides têm 46 cromossomos.
[B]
217. Em relação à gametogênese humana, assinale a alternativa INCORRETA:
a) no homem ocorre nos túbulos seminíferos dos testículos.
b) na mulher ocorre nos folículos ovarianos.
c) tem como finalidade reduzir o número de cromossomos à metade.
d) produz células reprodutoras diplóides.
e) produz células reprodutoras haplóides.
[D]
218. Partindo-se de 20 espermatócitos de 1• ordem e 20 ovócitos de 1• ordem, os números de espermatozóides e de óvulos serão:
a) 80 e 20 b) 20 e 20 c) 40 e 20
d) 20 e 40 e) 20 e 80
[A]
219. Sabendo- se que seres humanos possuem 46 cromossomos em suas células somáticas, pode-se afirmar que no processo de gametogênese na mulher
a) as células germinativas têm 23 cromossomos.
b) as ovogônias têm 46 cromossomos.
c) os ovócitos primários têm 23 cromossomos.
d) os ovócitos secundários têm 46 cromossomos.
e) os glóbulos polares possuem 46 cromossomos.
[B]
220. Cada célula germinativa humana que passa pelo processo de gametogênese produz no homem e na mulher, respectivamente
a) um óvulo e quatro espermatozóides.
b) um óvulo e um espermatozóide.
c) quatro óvulos e quatro espermatozóides.

31
d) quatro óvulos e um espermatozóide.
e) quatro espermatozóides e um óvulo.
[E]
221. Considere uma ovogônia de uma mulher heterozigota para o par de alelos Dd. Entre os possíveis gametas formados por essa ovogônia, podemos encontrar:
a) quatro óvulos Dd.
b) quatro óvulos D e quatro óvulos d.
c) dois óvulos D e dois óvulos d.
d) apenas um óvulo Dd.
e) apenas um óvulo D ou um óvulo d.
[E]
222. Na(s) questão(ões) a seguir, escreva no espaço apropriado a soma dos itens corretos.Analisando o processo de gametogênese em mamíferos, é correto afirmar que:
01) O gameta feminino é uma célula grande e imóvel cujo citoplasma aumenta muito durante o processo de formação.
02) Na formação dos espermatozóides, ocorre uma etapa de diferenciação celular após a divisão meiótica.
04) Após a divisão meiótica, de cada ovogônia originam-se quatro ovócitos idênticos.
08) O processo de ovulogênese ocorre em etapas, permanecendo os ovócitos I em estágio inicial da meiose durante grande parte da vida da mulher.
16) De cada espermatogônia que inicia o processo de espermatogênese, formam-se oito espermatozóides.
32) Espermatogônias e espermátides são células haplóides resultantes de etapas do processo de espermatogênese.
64) O número diplóide característico da espécie só é reconstituído no momento da fecundação, quando se forma o zigoto.
01 + 02 + 64 = 67
223. Numere relacionando corretamente:
( ) Ciclo celular
( ) Nucléolo
( ) Espermatogênese
( ) Centrômero
( ) Espermiogênese
1. Desaparece na prófase.
2. Modificação morfológica nas espermátides.
3. Gametogênese masculina.
4. Prende os cromossomos ao fuso
5. Intérfase seguida de divisão
A seqüência numérica correta de cima para baixo é:
a) 5 - 1 - 2 - 3 - 4.
b) 5 - 1 - 3 - 4 - 2.
c) 3 - 4 - 1 - 2 - 5.
d) 1 - 5 - 3 - 4 - 2.
e) 5 - 1 - 2 - 4 - 3.
[B]
224. Considere uma espécie animal em que o número haplóide de cromossomos é 20. Durante o processo de espermatogênese normal, um macho dessa espécie
produzirá:
a) espermatogônias com 20 cromossomos;
b) espermátides com 10 cromossomos;
c) espermatócitos secundários com 20 cromossomos;
d) espermatócitos primários com 10 cromossomos;
e) espermatozóides com 5 cromossomos.
[C]
225. Observe a figura da célula representada a seguir e assinale a alternativa INCORRETA:

a) o flagelo, indicado pelo número 3, é a estrutura responsável pela locomoção.


b) é uma célula formada a partir da diferenciação de uma espermátide, após a meiose de uma espermatogônia.
c) o núcleo, indicado pelo número 2, é o local onde se encontra o material genético.
d) representa um gameta masculino, o qual é produzido no epidídimo.
e) o acrossomo, indicado pelo número 1, é a vesícula que contém enzimas necessárias à penetração no óvulo.
[D]
226. Uma amostra celular foi retirada de um certo organismo diplóide e sem anormalidades cromossômicas para estudo do seu car iótipo. Entre as células observadas, a
representada pelo desenho a seguir foi a única obtida com os cromossomos bem visíveis. Com base neste desenho, assinale a afirmativa mais provável:

a) trata-se de uma célula somática com dois pares de cromossomos homólogos.


b) trata-se de uma célula gamética em meiose - I.
c) trata-se de uma célula somática com número haplóide de cromossomos.
d) trata-se de uma célula mitótica no início da metáfase.
e) trata-se de uma célula germinativa em meiose - II.

32
[E]
227. Um pesquisador fez o seguinte desenho de uma célula observada ao microscópio óptico.

Pode tratar-se de uma célula de


a) ovário. b) sangue. c) linfa.
d) medula óssea. e) pele.
[A]
228. Os espermatozóides são células muito ativas, com enorme capacidade de movimentação. Durante sua formação (espermatogênes e) ocorrem várias fases diferentes,
cuja sequência é:
a) espermatogônia, espermátide, espermatócito I, espermatócito II e espermatozóide.
b) espermátide, espermatócito I, espermatócito II, espermatogônia o espermatozóide.
c) espermatócito I, espermatócito II, espermátide, espermatogônia e espermatozóide.
d) espermatócito I, espermatócito II, espermatogônia, espermátide e espermatozóide.
e) espermatogônia, espermatócito I, espermatócito II, espermátide e espermatozóide.
[E]
229. Com relação à gametogênese masculina, pode-se dizer que:
a) das células germinativas primordiais originam-se espermátides que, por mitose, formam espermatozóides.
b) o homem, antes da puberdade possui um número suficiente de espermatozóides capacitados para a fecundação.
c) ela se passa nos testículos, onde ocorre a espermiogênese.
d) a espermatogênese independe de qualquer ação hormonal.
e) o recém-nascido apresenta nos túbulos seminíferos pequena quantidade de espermatozóides.
[C]
230. Durante a ovulogênese da mulher, são produzidos dois corpúsculos polares. O primeiro e o segundo corpúsculos polares humanos contêm, respectivamente,
a) 46 cromossomos duplicados e 46 cromossomos simples.
b) 46 cromossomos simples e 23 cromossomos simples.
c) 23 cromossomos duplicados e 23 cromossomos simples.
d) 23 cromossomos simples e 23 cromossomos simples.
e) 23 cromossomos simples e nenhum cromossomo.
[C]
231. As figuras a seguir representam os processos de gametogênese em animais.

Supondo que se trate da gametogênese humana, é correto concluir que


a) células com 46 cromossomos existem somente no período 1.
b) as divisões meióticas ocorrem nos períodos 2 e 3.
c) a partir de uma espermatogônia, formam-se dois espermatócitos primários.
d) cada ovócito primário dá origem a um ovócito secundário.
e) a fertilização ocorre durante o período 4.
[D]

232. "Cada caráter é condicionado por um par de fatores que se separam na formação dos gametas". Mendel ao enunciar essa lei já admitia, embora sem conhecer, a
existência das seguintes estruturas e processo de divisão celular, respectivamente:
a) cromossomos, mitose.
b) núcleos, meiose.
c) núcleos, mitose.
d) genes, mitose.
e) genes, meiose.
[E]
233. Considere os seguintes eventos:
I. Permutação ou "crossing-over".
II. Disjunção de cromátides irmãs.
III. Pareamento de cromossomos homólogos.
IV. Disjunção de cromossomos homólogos.
A ordem em que esses eventos ocorrem no processo de meiose é:

33
a) I ë II ë III ë IV.
b) II ë I ë III ë V.
c) III ë I ë IV ë II.
d) III ë IV ë I ë II.
e) IV ë III ë II ë I.
[C]
234. Qual dos seguintes processos ocorre exclusivamente na meiose?
a) Divisão do centrômero.
b) Duplicação dos cromossomos.
c) Migração dos cromossomos.
d) Pareamento dos cromossomos.
e) Espiralização dos cromossomos.
[D]
235. As fases da prófase da primeira divisão meiótica, em seqüência correta, são:
a) paquíteno, leptóteno, diplóteno, zigóteno, diacinese.
b) paquíteno, diacinese, leptóteno, zigóteno, diplóteno.
c) leptóteno, zigóteno, paquíteno, diplóteno, diacinese.
d) leptóteno, paquíteno, zigóteno, diacinese, diplóteno.
e) diacinese, zigóteno, leptóteno, paquíteno, diplóteno.
[C]
236. Analisando o esquema a seguir que representa o ciclo vital de um animal (2N), podemos afirmar que:

a) as células II são gametas produzidos por mitose.


b) as células II são gametas produzidos por meiose.
c) a célula III é o zigoto produzido por meiose.
d) a célula III é um esporo produzido por meiose.
e) a célula III produz I por meiose e diferenciação.
[B]
237. Analisando o esquema adiante que representa o ciclo vital de uma alga haplobionte (N), podemos afirmar que:

a) as células II são gametas produzidos por mitose.


b) as células II são gametas produzidos por meiose.
c) a célula III é o zigoto produzido por meiose.
d) a célula III é um esporo produzido por meiose.
e) a célula III produz o adulto N por meiose e diferenciação.
[A]
238. Analisando o esquema a seguir que representa o ciclo vital de um vegetal, podemos fazer todas as afirmações, EXCETO:

a) as células a e b são gametas produzidos por mitose (I).


b) a geração 2N produz esporo (célula d) por meiose (III).
c) o esporo (célula d) germina por mitose (IV) e se diferencia originando a geração N.
d) a meiose é final ou gamética (III).
e) os vegetais apresentam metagênese ou alternância de gerações.
[D]
239. Na meiose de uma espécie de planta formam-se 16 tétradres ou bivalentes. Qual o número diplóide da espécie?
a) 4. c) 8. c) 16. d) 32. e) 64.
[D]
240. A figura a seguir é característica da Meiose porque só nesse tipo de divisão celular acontece:

34
a) separação dos centríolos.
b) formação do fuso acromático.
c) manutenção da carioteca.
d) pareamento dos cromossomos homólogos.
e) duplicação das cromátides.
[D]
251. Numa dada fase de um processo de divisão celular, os cromossomos homólogos migram para pólos opostos da célula. Essa fase é a
a) metáfase da mitose. b) anáfase da mitose.
c) metáfase da meiose I. d) anáfase da meiose I.
e) anáfase da meiose II.
[D]
252. Com relação à divisão celular, podemos afirmar que
a) a mitose só ocorre em organismos com reprodução sexuada.
b) a mitose permite variabilidade genética, principal diferença do processo em relação à meiose.
c) na meiose não há associação de cromossomos homólogos com troca de partes entre eles, fato que só ocorre na mitose.
d) na meiose não ocorre segregação de genes.
e) o objetivo do processo mitótico é o crescimento do organismo e do processo meiótico é a formação de gametas.
[E]
253. Em relação ao processo de divisão celular, podemos afirmar que:
a) a mitose consiste em duas divisões celulares sucessivas.
b) os óvulos e os espermatozóides são produzidos por divisões mitóticas.
c) durante a meiose não ocorre a permutação ou "crossing-over".
d) a meiose é um processo que dá origem a quatro células haplóides.
e) durante a mitose as cromátides irmãs não se separam.
[D]
254. O quadro a seguir apresenta algumas diferenças entre mitose e meiose.
Assinale a alternativa correta.

[C]
255. Na(s) questão(ões) a seguir escreva nos parêntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Analise as proposições apresentadas com relação
ao tópico "Divisão celular".
( ) Nos organismos pluricelulares, o crescimento e a reparação dos tecidos ocorrem através de mitose.
( ) Na mitose ocorre recombinação de genes e formam-se, ao final do processo, quatro células, todas 2n (diplóide) como a célula mãe.
( ) Em organismos adultos, células em que a capacidade de divisão diminuiu, podem voltar a se dividir ativamente, como é o caso de células ósseas após a ocorrência
de fraturas.
( ) No processo de meiose ocorre uma duplicação cromossômica para duas divisões celulares.
( ) Na primeira divisão meiótica ocorre a segregação das cromátides irmãs de cada cromossomo a na segunda divisão ocorre a separação dos cromossomos homólogos
de cada par.
VFVVF
256. Considere as proposições a seguir e assinale a alternativa correta.
I) A duplicação do DNA ocorre durante a intérfase da célula.
II) Quando uma célula diplóide sofre meiose seu número cromossômico se reduz a 1/4.
III) A duplicação dos centríolos ocorre na telófase da mitose.
a) Apenas a afirmativa I está correta.
b) Estão corretas I e III.
c) Apenas a afirmativa III está correta.
d) Todas são corretas.
e) Todas estão erradas.
[A]
257. Na meiose, para a formação das células reprodutoras, observa-se o emparelhamento de cromossomos homólogos na:
a) metáfase II; b) metáfase I; c) prófase II;
d) anáfase I; e) anáfase II.
[B]

35
258. No processo de meiose há um fenômeno importante e responsável pela evolução das espécies com reprodução sexuada. O nome do processo e a fase em que
ocorre:
a) é o crossing-over e a fase é a prófase I
b) é o crossing-over e a fase é a prófase II
c) é a mutação e a fase é a metáfase I
d) é a mutação e a fase é a metáfase II
e) recombinação genética e a fase é a anáfase I
[A]
259. Uma amostra celular foi retirada de um certo organismo diplóide e sem anormalidades cromossômicas para estudo do seu car iótipo. Entre as células observadas, a
representada pelo desenho a seguir foi a única obtida com os cromossomos bem visíveis. Com base neste desenho, assinale a afirmativa mais provável:

a) trata-se de uma célula somática com dois pares de cromossomos homólogos.


b) trata-se de uma célula gamética em meiose - I.
c) trata-se de uma célula somática com número haplóide de cromossomos.
d) trata-se de uma célula mitótica no início da metáfase.
e) trata-se de uma célula germinativa em meiose - II.
[E]
260. Considere os seguintes eventos:
I. recombinação genética
II. segregação de cromossomos homólogos
III. segregação de cromátides irmãs
IV. alinhamento dos cromossomos na placa equatorial.
Desses, os que ocorrem tanto na mitose quanto na meiose são APENAS
a) I e II b) I e III c) II e III d) II e IV e) III e IV
[E]
261. Nos processos de divisão celular o posicionamento dos cromossomas na metáfase e anáfase é importante porque garante:
a) distribuição eqüitativa dos cromossomas pelas células filhas.
b) pareamento cromossômico para a ocorrência do "crossing-over".
c) duplicação de DNA indispensável à continuidade do processo.
d) formação de cromossomas homólogos e independentes.
e) alinhamento de cromossomas necessário à formação de sinapses.
[A]
262. Uma célula com 16 cromossomos ao sofrer meiose produz:
a) 4 células com 16 cromossomos;
b) 2 células com 8 cromossomos;
c) 2 células com 16 cromossomos;
d) 4 células com 8 cromossomos;
e) 8 células com 16 cromossomos.
[D]
263. Leia com atenção as afirmativas a seguir:
I - Durante a intérfase os cromossomos se duplicam.
II - Na prófase os cromossomos migram para os pólos opostos.
III - Na metáfase os cromossomos atingem o máximo de espiralização.
Dessas afirmativas,
a) apenas I e III são corretas.
b) I, II e III são corretas.
c) são corretas apenas I e II.
d) apenas I é correta.
e) são corretas apenas II e III.
[A]
264. O crossing-over é um importante mecanismo evolutivo, pois proporciona, para a maioria dos seres vivos, recombinação dos seus genes duran te o processo de
produção das células reprodutivas, como os gametas animais. Esse processo ocorre na:
a) prófase da mitose b) metáfase da mitose c) prófase I da meiose
d) metáfase I da meiose e) prófase II da meiose
[C]
265. Ao compararmos mitose com meiose, podemos concluir que:
a) a meiose está associada à reprodução de pluricelulares, e a mitose, ao seu crescimento.
b) a meiose divide à metade o número de cromossomos de uma célula, e a mitose o duplica.
c) a meiose está associada à reprodução de unicelulares, e a mitose, ao seu crescimento.
d) a mitose garante o número cromossomial da espécie, e a meiose, o número cromossomial do indivíduo.
e) a mitose só acontece em células reprodutoras, e a meiose só em células haplóides.
[A]
266. Meiose com formação de esporos haplóides ocorre no ciclo de vida de
a) briófitas, de pteridófitas e de fanerógamas.
b) briófitas e de pteridófitas apenas.
c) fanerógamas apenas.
d) pteridófitas apenas.

36
e) briófitas apenas.
[A]
267. A figura a seguir representa _______________ , que ocorre na _______________ e tem como conseqüência _______________.

A alternativa que preenche correta e respectivamente os espaços anteriores é:


a) o crossing-over; metáfase da mitose; a variabilidade genética.
b) o pareamento de cromátides-irmãs; anáfase I da meiose; a troca de genes alelos.
c) o crossing-over; prófase I da meiose; a variabilidade genética.
d) a segregação de cromossomos homólogos; anáfase I da meiose; a formação de células haplóides.
e) o pareamento de cromossomos homólogos; metáfase da mitose; a formação de gametas.
[C]
268. Um organismo tem constituição cromossômica em suas células somáticas mostrada à esquerda na figura adiante.

Nesse organismo, os conjuntos de cromossomos nas células resultantes da primeira e da segunda divisão meiótica estão representados, respectivamente, em
a) I e II b) I e III c) II e III d) II e IV e) III e IV
[D]
269. Quanto aos cromossomos sexuais X e Y, podemos afirmar que:
a) como não são completamente homólogos, não se pareiam na meiose.
b) como são completamente homólogos, pareiam-se na meiose.
c) se pareiam na meiose, pois possuem uma região homóloga.
d) não se pareiam na meiose, pois possuem uma região não homóloga.
e) os genes que se encontram na região não homóloga do X condicionam um tipo de herança chamado herança restrita ao sexo.
[C]
270. Uma espécie de pernilongo possui 2n = 6 cromossomos. A seguir estão representados fenômenos meióticos pelos quais passam as células gaméticas desse
pernilongo. Marque a alternativa que contém a seqüência correta dos eventos meióticos.

a) A, B, C, D, E b) E, A, D, C, B c) C, E, A, D, B
d) B, D, A, C, E e) D, A, C, E, B
[B]
271. Certa espécie animal tem número diplóide de cromossomos igual a 8 (2n=8).
Uma célula de um indivíduo dessa espécie encontra-se em divisão e apresenta 4 cromossomos simples sendo puxados para cada pólo.
A partir dessa informação, pode-se afirmar que a referida célula se encontra
a) na metáfase da mitose.
b) na anáfase da mitose.
c) na metáfase da 1ª divisão da meiose.
d) na anáfase da 1ª divisão da meiose.
e) na anáfase da 2ª divisão da meiose.
[E]
272. As afirmativas a seguir relacionam a Genética Mendeliana à Divisão Celular.
I - As 1• e 2• Leis de Mendel abordam o comportamento dos genes na formação dos gametas, logo estão relacionadas com o comportamento cromoss ômico na meiose.
II - Dois pares de genes se segregam independentemente, se estiverem localizados em cromossomos diferentes.

37
III - A lei da segregação independente (2• lei) está relacionada às conseqüências do arranjo, ao acaso, de pares de cromossomos homólogos na placa metafásica, na
meiose.
Está(ão) correta(s):
a) somente I. b) somente I e II. c) somente I e III.
d) somente II e III. e) I, II e III.
[E]
273. Considere os processos de divisão celular:
a) mitose
b) meiose
Considere também os seguintes eventos:
I. As células-filhas recebem um cromossomo de cada par de homólogos.
II. Durante o processo, há emparelhamento dos homólogos.
III. Durante o processo, os cromossomos ligam-se às fibras do fuso celular.
IV. As células-filhas e a célula-mãe têm o mesmo número de cromossomos.
A associação correta entre os processos de divisão celular e os eventos considerados é
a) I a, II a+b, III b, IV a
b) I a, II a, III b, IV a+b
c) I b, II a+b, III a, IV b
d) I b, II b, III a+b, IV a
e) I a+b, II b, III b, IV a
[D]
274. A meiose é o processo pelo qual células diplóides podem originar células haplóides, objetivando a formação de células destinadas à reprodução da espécie. A meiose
consiste em duas etapas consecutivas, cada uma com várias subfases sucessivas. Correlacione as etapas da meiose com suas principais características.
(I) Zigóteno da Prófase I
(II) Paquíteno da Prófase I
(III) Metáfase I
(IV) Metáfase II
(V) Telófase
(P) reconstituição nuclear e citocinese
(Q) sinapse cromossômica
(R) formação da placa equatorial dupla
(S) participação dos centrômeros e separação das cromátides
A associação correta é:
a) I - P; III - R; IV - Q; V - S.
b) I - Q; II - P; III - S; IV - R.
c) I - Q; II - R; III - S; IV - P.
d) I - Q; III - R; IV - S; V - P.
e) II - Q; III - S; IV - R; V - P.
[D]
275. Assinale a alternativa da tabela a seguir que identifica corretamente os cromossomos que migram para pólos opostos da célula durante as anáfases da meiose e da
mitose.
a) MEIOSE I - homólogos, MEIOSE II - irmãos, MITOSE - irmãos
b) MEIOSE I - homólogos, MEIOSE II - irmãos, MITOSE - homólogos
c) MEIOSE I - irmãos, MEIOSE II - irmãos, MITOSE - homólogos
d) MEIOSE I - irmãos, MEIOSE II - homólogos, MITOSE - irmãos
e) MEIOSE I - irmãos, MEIOSE II - homólogos, MITOSE – homólogos
[A]
276. Com relação ao processo conhecido como crossing-over, podemos afirmar que o mesmo
a) diminui a variabilidade genética.
b) separa cromátides homólogas.
c) corrige a recombinação gênica.
d) aumenta a variabilidade genética.
e) troca cromossomos entre genes homólogos.
[D]
277. Considerando o desenho, analise as afirmativas a seguir.

I. A e C representam células em metáfase; B e D representam células em anáfase.


II. A representa uma célula em mitose, pois é possível observar os cromossomos homólogos pareados.
III. D representa a separação das cromátides-irmãs, fenômeno que ocorre durante a meiose II e a mitose.
Está(ão) correta(s)
a) apenas I. b) apenas II. c) apenas I e III.
d) apenas III. e) I, II e III.
[C]
278. A mitose e a meiose são dois tipos de divisão celular. Com relação a esses processos, assinale a(s) proposição(ões) VERDADEIRA(S).
01. A mitose é uma divisão do tipo equacional.
02. A meiose ocorre em quatro etapas sucessivas.
04. O número de cromossomos das células resultantes de ambos os processos é igual ao das células que lhes deram origem, porém somente as células que sofreram
meiose podem apresentar recombinação genética.
08. A mitose ocorre nas células somáticas.
16. A meiose ocorre na linhagem germinativa, quando da produção dos gametas.
32. Ambos os processos ocorrem em todos os seres.
64. Em alguns organismos a mitose é utilizada como forma de reprodução.
VFFVVFV
279. A figura adiante representa a citocinese em duas células diferentes, 1 e 2.

38
As células 1 e 2 poderiam corresponder, respectivamente, a células de:
a) homem e banana. b) alface e rato. c) rato e mosquito.
d) caranguejo e coelho. e) babaçu e goiaba.
[A]
280. A figura a seguir representa varias células em diferentes estágios do ciclo de vida. A duplicação do material genético e o rompimento dos centrômeros ocorrem,
respectivamente, em:

a) I e V. b) V e III. c) II e V.
d) II e III. e) III e IV.
[B]
281. Num mamífero adulto, grande quantidade de células em divisão ocorre normalmente
a) no músculo cardíaco. b) na medula espinhal.
c) no cérebro. d) na medula óssea.
e) nos músculos esqueléticos.
[D]
282. Sobre o esquema a seguir que representa o ciclo celular, são feitas 3 afirmativas:

I - A duplicação do ADN acontece no período S.


II - A síntese de proteínas é mais intensa durante a mitose.
III - As células resultantes da mitose diferem da célula-mãe, devido ao fenômeno do "crossing-over".
Está(ão) correta(s) a(s) afirmativa(s):
a) apenas I. b) apenas II. c) apenas I e III.
d) apenas II e III. e) I, II e III.
[A]
283. No processo de mitose:
a) a partir de uma célula diplóide originam-se duas novas células diplóides
b) a partir de uma célula diplóide originam-se quatro novas células diplóides
c) a partir de uma célula haplóide originam-se duas novas células diplóides
d) a partir de uma célula haplóide originam-se quatro novas células diplóides
e) a partir de uma célula diplóide originam-se quatro novas células haplóides
[A]
284. Os gráficos representam a interfase de células diferenciadas de dois tipos, respectivamente:

39
a) estáveis e lábeis. b) estáveis e perenes.
c) lábeis e estáveis. d) lábeis e perenes. e) perenes e lábeis.
[D]
285. Considere as seguintes fases da mitose:
I. telófase
II. metáfase
III. anáfase
Considere também os seguintes eventos:
a. As cromátides-irmãs movem-se para os pólos opostos da célula.
b. Os cromossomos alinham-se no plano equatorial da célula.
c. A carioteca e o nucléolo reaparecem.
Assinale a alternativa que relaciona corretamente cada fase ao evento que a caracteriza.
a) I - a; II - b; III - c
b) I - a; II - c; III - b
c) I - b; II - a; III - c
d) I - c; II - a; III - b
e) I - c; II - b; III – a
[E]
286. Com relação à divisão celular, podemos afirmar que
a) a mitose só ocorre em organismos com reprodução sexuada.
b) a mitose permite variabilidade genética, principal diferença do processo em relação à meiose.
c) na meiose não há associação de cromossomos homólogos com troca de partes entre eles, fato que só ocorre na mitose.
d) na meiose não ocorre segregação de genes.
e) o objetivo do processo mitótico é o crescimento do organismo e do processo meiótico é a formação de gametas.
[E]
287. Em relação ao processo de divisão celular, podemos afirmar que:
a) a mitose consiste em duas divisões celulares sucessivas.
b) os óvulos e os espermatozóides são produzidos por divisões mitóticas.
c) durante a meiose não ocorre a permutação ou "crossing-over".
d) a meiose é um processo que dá origem a quatro células haplóides.
e) durante a mitose as cromátides irmãs não se separam.
[D]
288. O quadro a seguir apresenta algumas diferenças entre mitose e meiose.
Assinale a alternativa correta.

[C]
289. Na(s) questão(ões) a seguir escreva nos parêntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Em relação ao ciclo celular:
( ) a fase G• do ciclo celular é o período durante o qual o DNA é duplicado;
( ) a fase G‚ é o principal período de crescimento do material citoplasmático, inclusive das organelas;
( ) durante a prófase, os centríolos se distanciam e formam-se as fibras do fuso;
( ) na anáfase, ocorre a citocinese;
( ) a desespiralização dos cromossomos ocorre na metáfase.
FFVFF
290. Na(s) questão(ões) a seguir escreva nos parêntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Anal ise as proposições apresentadas com relação
ao tópico "Divisão celular".
( ) Nos organismos pluricelulares, o crescimento e a reparação dos tecidos ocorrem através de mitose.
( ) Na mitose ocorre recombinação de genes e formam-se, ao final do processo, quatro células, todas 2n (diplóide) como a célula mãe.
( ) Em organismos adultos, células em que a capacidade de divisão diminuiu, podem voltar a se dividir ativamente, como é o caso de células ósseas após a ocorrência
de fraturas.
( ) No processo de meiose ocorre uma duplicação cromossômica para duas divisões celulares.
( ) Na primeira divisão meiótica ocorre a segregação das cromátides irmãs de cada cromossomo a na segunda divisão ocorre a separação dos cromossomos homólogos
de cada par.
VFVVF

40
291. Numere relacionando corretamente:
( ) Ciclo celular
( ) Nucléolo
( ) Espermatogênese
( ) Centrômero
( ) Espermiogênese
1. Desaparece na prófase.
2. Modificação morfológica nas espermátides.
3. Gametogênese masculina.
4. Prende os cromossomos ao fuso
5. Intérfase seguida de divisão
A seqüência numérica correta de cima para baixo é:
a) 5 - 1 - 2 - 3 - 4.
b) 5 - 1 - 3 - 4 - 2.
c) 3 - 4 - 1 - 2 - 5.
d) 1 - 5 - 3 - 4 - 2.
e) 5 - 1 - 2 - 4 - 3.
[B]
292. Considere as proposições a seguir e assinale a alternativa correta.
I) A duplicação do DNA ocorre durante a intérfase da célula.
II) Quando uma célula diplóide sofre meiose seu número cromossômico se reduz a 1/4.
III) A duplicação dos centríolos ocorre na telófase da mitose.
a) Apenas a afirmativa I está correta.
b) Estão corretas I e III.
c) Apenas a afirmativa III está correta.
d) Todas são corretas.
e) Todas estão erradas.
[A]
293. Considere os seguintes eventos:
I. recombinação genética
II. segregação de cromossomos homólogos
III. segregação de cromátides irmãs
IV. alinhamento dos cromossomos na placa equatorial.
Desses, os que ocorrem tanto na mitose quanto na meiose são APENAS
a) I e II b) I e III c) II e III d) II e IV e) III e IV
[E]
294. Analise os eventos mitóticos relacionados a seguir:
I. Desaparecimento da membrana nuclear.
II. Divisão dos centrômeros.
III. Migração dos cromossomos para os pólos do fuso.
IV. Posicionamento dos cromossomos na região mediana do fuso.
Qual das alternativas indica corretamente sua ordem temporal?
a) IV - I - II - III.
b) I - IV- III - II.
c) I - II - IV - III.
d) I - IV - II - III.
e) IV - I - III - II.
[D]
295. Nos processos de divisão celular o posicionamento dos cromossomas na metáfase e anáfase é importante porque garante:
a) distribuição eqüitativa dos cromossomas pelas células filhas.
b) pareamento cromossômico para a ocorrência do "crossing-over".
c) duplicação de DNA indispensável à continuidade do processo.
d) formação de cromossomas homólogos e independentes.
e) alinhamento de cromossomas necessário à formação de sinapses.
[A]
296. Mitose é um processo de divisão celular pelo qual uma célula origina duas outras com o mesmo número de cromossomos. Com relação à divisão celular, podemos
afirmar que
a) na mitose a célula-mãe diplóide origina células-filhas haplóides.
b) a interfase caracteriza-se pela pouca atividade metabólica desempenhada pela célula.
c) a mitose é precedida de uma duplicação de material genético.
d) durante a divisão celular a organização do núcleo mantém-se inalterada.
e) no período de mitose a quantidade de DNA mantém-se constante.
[C]
297. Leia com atenção as afirmativas a seguir:
I - Durante a intérfase os cromossomos se duplicam.
II - Na prófase os cromossomos migram para os pólos opostos.
III - Na metáfase os cromossomos atingem o máximo de espiralização.
Dessas afirmativas,
a) apenas I e III são corretas.
b) I, II e III são corretas.
c) são corretas apenas I e II.
d) apenas I é correta.
e) são corretas apenas II e III.
[A]
298. Se a quantidade de DNA de uma célula somática em metáfase mitótica é 2X, as células do mesmo tecido, nas fases G 1 e G2 apresentam, respectivamente, as
seguintes quantidades de DNA:
a) X e X b) X/2 e X c) X/2 e 2X d) X e X/2 e) X e 2X
[E]
299. Ao compararmos mitose com meiose, podemos concluir que:
a) a meiose está associada à reprodução de pluricelulares, e a mitose, ao seu crescimento.
b) a meiose divide à metade o número de cromossomos de uma célula, e a mitose o duplica.
c) a meiose está associada à reprodução de unicelulares, e a mitose, ao seu crescimento.

41
d) a mitose garante o número cromossomial da espécie, e a meiose, o número cromossomial do indivíduo.
e) a mitose só acontece em células reprodutoras, e a meiose só em células haplóides.
[A]
300. Considere os seguintes eventos que ocorrem durante a mitose:
I - Desespiralização dos cromossomos.
II - Desaparecimento da carioteca.
III - Desaparecimento do fuso acromático.
IV - Separação das cromátides irmãs.
V - Reaparecimento do nucléolo.
Assinale a alternativa que reúne os eventos que caracterizam a telófase.
a) I - III - V
b) I - II - IV
c) I - II - III
d) II - III - IV
e) III - IV – V
[A]
301. As figuras a seguir representam a citocinese de dois tipos de células.

Os exemplos de organismos cujas células representam de maneira correta as figuras A e B são, respectivamente,
a) alface e minhoca.
b) homem e lesma.
c) peixe e rato.
d) macaco e trigo.
e) grama e tomate.
[D]
302. Considerando que a ilustração a seguir, referente à divisão de uma célula somática hipotética, apresenta um erro, assinale a alternativa que apresenta a situação que
tornaria o desenho correto.

a) A célula-mãe deveria ter apenas 2 cromossomos e as células-filhas deveriam ter 4 cromossomos, pois têm origem após a duplicação dos cromossomos.
b) A célula-mãe deveria ter 4 cromossomos e as células-filhas deveriam ter 2 cromossomos, pois foram originadas por mitose.
c) A célula-mãe deveria ter 4 cromossomos e as células-filhas deveriam ser 4 e ter cada uma 2 cromossomos, pois seriam o resultado de uma meiose.
d) A célula-mãe deveria ter 4 cromossomos e cada célula-filha 4 cromossomos, pois seriam o resultado de uma mitose.
e) A célula-mãe deveria ter 2 cromossomos e as células-filhas 2 cromossomos, pois seriam o resultado de uma meiose.
[D]
303. No preparo do cariótipo humano se faz necessário que os cromossomos se apresentem bastante individualizados, como mostra a figura:

A fase da mitose favorável a esta individualização cromossomial, como mostra a figura anterior, é a:
a) anáfase c) prófase b) telófase d) metáfase
[D]
304. A figura a seguir representa um corte longitudinal da região de crescimento de uma raiz.

42
Assinale a alternativa que indica corretamente a fase da vida em que se encontram as células representadas.
a) 1 - intérfase, 2 - mitose, 3 - mitose, 4 - mitose
b) 1 - intérfase, 2 - mitose, 3 - meiose, 4 - meiose
c) 1 - mitose, 2 - meiose, 3 - meiose, 4 - meiose
d) 1 - mitose, 2 - intérfase, 3 - mitose, 4 - meiose
e) 1 - meiose, 2 - mitose, 3 - mitose, 4 – mitose
[A]
305. Considerando que uma espécie possua nŽ de cromossomos nas células somáticas 2n = 6, a célula apresentada na figura adiante evidencia estes cromossomos em:

a) metáfase mitótica. b) metáfase I. c) metáfase II.


d) anáfase mitótica. e) anáfase II.
[D]
306. Pontas de raízes são utilizadas para o estudo dos cromossomos de plantas por apresentarem células
a) com cromossomos gigantes do tipo politêníco.
b) com grande número de mitocôndrias.
c) dotadas de nucléolos bem desenvolvidos.
d) em divisão mitótica.
e) em processo de diferenciação.
[D]
307. O diagrama a seguir representa o ciclo de vida de uma célula somática humana, onde X representa o conteúdo de DNA.

Com base nas afirmações do diagrama e em seus conhecimentos, é INCORRETO afirmar que
a) a fase de menor duração do ciclo é a MITOSE.
b) a fase F do ciclo corresponde à INTERFASE.
c) em G1 a célula é haplóide.
d) em S ocorre a duplicação dos cromossomos.
[C]
308. Com o auxílio do diagrama e do gráfico a seguir, relativos ao ciclo celular, julgue os itens abaixo.

43
(1) O gráfico representa um processo importante para o aumento da variabilidade genética.
(2) Na fase I, ocorre síntese de RNA.
(3) Na fase III, a célula tem o dobro dos cromossomos que tem na fase I.
(4) Nas células em A, está ausente o envoltório nuclear.
ECEC
309. Assinale a alternativa da tabela a seguir que identifica corretamente os cromossomos que migram para pólos opostos da célula durante as anáfases da meiose e da
mitose.
a) MEIOSE I - homólogos, MEIOSE II - irmãos, MITOSE - irmãos
b) MEIOSE I - homólogos, MEIOSE II - irmãos, MITOSE - homólogos
c) MEIOSE I - irmãos, MEIOSE II - irmãos, MITOSE - homólogos
d) MEIOSE I - irmãos, MEIOSE II - homólogos, MITOSE - irmãos
e) MEIOSE I - irmãos, MEIOSE II - homólogos, MITOSE – homólogos
[A]
310. A mosca de frutas (Drosophila melanogaster) apresenta 08 cromossomos nas células somáticas.
É correto afirmar, portanto, que uma célula somática do referido inseto apresenta
a) 04 cromátides em G1.
b) 08 cromátides em G2.
c) 32 centrômeros na metáfase.
d) 16 cinetócoros na prófase.
[D]
311. Na mitose, a prófase constitui a fase:
a) terminal, onde a célula se divide.
b) inicial, onde os cromossomos se duplicam e a célula armazena energia para o processo de duplicação.
c) intermediária, onde os cromossomos atingem o grau de condensação máxima.
d) inicial, onde a carioteca e o nucléolo desaparecem e se forma o fuso mitótico.
e) intermediária, onde os centrômeros se dividem e as cromátides irmãs migram para o pólo da célula.
[D]
312. Observe o esquema representativo de um ciclo celular e assinale a alternativa INCORRETA:

a) A duplicação do material genético ocorre na subfase S.


b) A separação das cromátides irmãs ocorre em A.
c) A mitose compreende as fases P, M, A e T.
d) A quantidade de DNA está reduzida à metade em G2.
e) A interfase compreende as subfases G1, S e G2.
[D]
313. Analise o gráfico a seguir:

O momento em que a célula-mãe acabou de se dividir e cada célula-filha tem um conjunto de cromossomos idêntico ao da original é
a) 1 b) 2 c) 3 d) 4 e) 5
[E]
314. A mitose e a meiose são dois tipos de divisão celular. Com relação a esses processos, assinale a(s) proposição(ões) VERDADEIRA(S).
01. A mitose é uma divisão do tipo equacional.
02. A meiose ocorre em quatro etapas sucessivas.

44
04. O número de cromossomos das células resultantes de ambos os processos é igual ao das células que lhes deram origem, porém somente as células que sofreram
meiose podem apresentar recombinação genética.
08. A mitose ocorre nas células somáticas.
16. A meiose ocorre na linhagem germinativa, quando da produção dos gametas.
32. Ambos os processos ocorrem em todos os seres.
64. Em alguns organismos a mitose é utilizada como forma de reprodução.
VFFVVFV
315. A respeito da figura adiante, que representa uma célula em mitose, assinale a alternativa INCORRETA.

a) II é o centro celular, responsável pela formação do aparelho mitótico.


b) III indica fibra do fuso, responsável pelo deslizamento dos cromossomos durante a anáfase.
c) Nos animais, II apresenta um centríolo, que está ausente nos vegetais superiores.
d) Os filamentos de DNA contidos em I são idênticos entre si.
e) Na etapa anterior à representada na figura, ocorreu a duplicação do DNA.
[E]
316. Na membrana plasmática há predominância de:
a) carboidratos e proteínas
b) lípedes e proteínas
c) carboidratos e lípedes
d) carboidratos e ácidos nucléicos
e) ácidos nucléicos e proteínas
[B]
317. Considere os seguintes componentes químicos:
I. lipídios
II. açúcares
III. proteínas
IV. ácidos nucléicos
Assinale, a alternativa que identifica corretamente os componentes básicos de cada estrutura considerada.
1) MEMBRANA PLASMÁTICA
2) PAREDE CELULAR
a) (1) I e II, (2) III e IV
b) (1) I e III, (2) II
c) (1) I e IV, (2) II
d) (1) II, (2) II e III
e) (1) III, (2) I e III
[B]
318. Observe o desenho a seguir, referente ao esquema ultra-estrutural da membrana celular. A natureza química dos componentes 1, 2 e 3, respectivamente, é:

a) lípides; proteínas; proteínas.


b) proteínas; lípides; proteínas.
c) proteínas; proteínas; lípides.
d) lípides; lípides; proteínas.
e) proteínas; lípides; lípides.
[D]
319. Com relação à membrana plasmática e à parede celulósica, é incorreto afirmar que:
a) a membrana plasmática apresenta em sua constituição proteínas, lipídios e hidratos de carbono.
b) o modelo do mosaico fluido, propõe que proteínas integrais estão incluídas na bicamada lipídica da membrana plasmática.
c) o modelo de mosaico fluido admite que tanto as proteínas integrais como os lipídios podem realizar movimentos dentro da bicamada.
d) a parede celular dos vegetais pode ser formada por 3 camadas: lamela média, parede primária e parede secundária.
e) a parede primária atua como elemento cimentante entre duas células vegetais.
[E]
320. O esquema a seguir representa o modelo de organização molecular da membrana plasmática.

45
Assinale a alternativa INCORRETA.
a) Esse mesmo tipo de membrana é encontrado em organelas citoplasmáticas.
b) 1 indica a camada de fosfolipídios.
c) 2 indica proteína responsável pelo transporte de certas substâncias que atravessam a membrana.
d) Trata-se da membrana de uma célula eucariota, já que nas células procariotas há apenas uma camada de fosfolipídios.
e) 3 indica carboidrato que forma o glicocálix.
[D]
321. O modelo a seguir representa a estrutura molecular da membrana plasmática, segundo Singer e Nicholson (1972). Observando-o, leia as afirmativas propostas e
assinale a(s) correta(s):

01. O número 1 indica a parte hidrofóbica dos fosfolipídios que controlam o transporte pela membrana.
02. O número 2 indica as proteínas que formam barreiras para substâncias hidrossolúveis.
04. O número 3 indica uma proteína periférica que facilita a passagem de íons pela membrana.
08. O número 4 indica uma molécula de glicídio que faz parte do glicocálix.
16. O número 5 indica uma proteína transmembrana que dificulta a passagem de gases pela membrana.
32. O número 1 e 2 indicam regiões hidrofílica e hidrofóbica de lipídios, respectivamente.
FFFVFV
322. Para exercerem suas funções de reabsorção, as células epiteliais dos túbulos renais apresentam
a) vilosidades e muitas mitocôndrias.
b) superfície lisa e muitas mitocôndrias.
c) vilosidades e poucas mitocôndrias.
d) superfície lisa e poucas mitocôndrias.
e) grandes vacúolos.
[A]
323. As células animais apresentam um revestimento externo específico, que facilita sua aderência, assim como reações a partí culas estranhas, como, por exemplo, as
células de um órgão transplantado. Esse revestimento é denominado:
a) membrana celulósica. b) glicocálix. c) micro vilosidades.
d) interdigitações. e) desmossomos.
[B]
324. Assinale a ÚNICA proposição CORRETA. O esquema a seguir diz respeito ao:

01. tecido nervoso, sendo A representa os dendritos e B representa a bainha de mielina.


02. tecido nervoso, onde A representa os cílios e B representa o axônio.
04. tecido epitelial, onde A representa as microvilosidades e B representa um ducto de excreção.
08. tecido epitelial, em que A representa os cílios e B representa os desmossomos.
16. tecido epitelial, em que A representa microvilosidades e B representa os desmossomos.
16
325. Durante a embriogênese, ocorre o processo de diferenciação celular, no qual cada célula se especializa para o desempenho de determinada função.
Células com função de secreção, proteção e absorção, todas em intensa atividade metabólica, devem apresentar, respectivamente:
a) desmossomos, microvilosidades, abundância de complexos de Golgi e mitocôndrias.
b) abundância de complexos de Golgi, desmossomos, microvilosidades e maior número de mitocôndrias.

46
c) abundância de complexos de Golgi, microvilosidades, desmossomos e mui tas mitocôndrias.
d) microvilosidades, desmossomos, abundância de mitocôndrias e de retículos endoplasmáticos rugosos.
e) abundância de mitocôndrias, desmossomos, microvilosidades e extensa rede de microfilamentos.
[B]
326. As bactérias não apresentam organelas citoplasmáticas, tais como complexo de Golgi, mitocôndrias, etc., geralmente encontradas em células de seres eucariontes.
Entretanto, as bactérias possuem uma invaginação da membrana plasmática chamada MESOSSOMO que apresenta uma função análoga à da organela:
a) lisossomo b) mitocôndria c) complexo de Golgi
d) plasto e) centríolo
[B]
327. As células da mucosa intestinal aumentam sua superfície de absorção através de uma especialização de sua membrana denomi nada:
a) nexos. b) tonofilamentos. c) desmossomos.
d) microvilos. e) pseudópodos.
[D]
328. A membrana plasmática apresenta algumas transformações, que procedem como especializações destinadas a aumentar o poder de absorção da célula ou a permitir
o seu deslocamento. São exemplos dessas especializações, respectivamente:
a) desmossomas e interdigitações.
b) vacúolos e plastos.
c) cariomembrana e peroxissoma.
d) microvilos e cílios.
e) interdigitações e glioxissomas.
[D]
329. A membrana plasmática pode apresentar modificações ligadas ao aumento da adesão celular.
Assinale a alternativa que apresente exemplos destas modificações nas células epiteliais animais.
a) glicocálix e plasmodesmos
b) glicocálix e interdigitações
c) plasmodesmos e microvilos
d) desmossomos e vilosidades
e) zônula de oclusão e trama terminal
[B]
330. A tabela a seguir compara a concentração de certos íons nas células de 'Nitella' e na água do lago onde vive essa alga.

Os dados permitem concluir que as células dessa alga absorvem:


a) esses íons por difusão.
b) esses íons por osmose.
c) esses íons por transporte ativo.
d) alguns desses íons por transporte ativo e outros por osmose.
e) alguns desses íons por difusão e outros por osmose.
[C]
331. Medidas da concentração de íons de sódio (Na+) e de potássio (K+), dentro e fora dos neurônios gigantes de lula, revelaram os seguintes valores:
[Na+] no citoplasma = 50
[Na+] no meio extracelular = 440
[K+] no citoplasma = 400
[K+] no meio extracelular = 20
Se os neurônios são expostos a um bloqueador respiratório, como o cianeto, a concentração de sódio rapidamente se iguala dentro e fora da célula, o mesmo ocorrendo
com o potássio.
Em condições normais, qual o mecanismo responsável pela manutenção da diferença entre as concentrações iônicas dentro e fora do neurônio?
a) Difusão, pelo qual íons podem atravessar a membrana espontaneamente.
b) Osmose, pelo qual apenas a água atravessa a membrana espontaneamente.
c) Transporte ativo, pelo qual íons atravessam a membrana com gasto de energia.
d) Fagocitose, pelo qual a célula captura partículas sólidas.
e) Pinocitose, pelo qual a célula captura gotículas.
[C]
332. O gráfico a seguir mostra as concentrações relativas de alguns íons no citoplasma da alga verde Nitella e na água circundante. A partir dos conhecimentos sobre
permeabilidade da membrana celular, qual a melhor interpretação para os dados mostrados no gráfico?

a) Os íons difundem-se espontaneamente através da membrana.


b) A diferença de concentração iônica deve-se à osmose.
c) A diferença de concentração iônica se deve à pinocitose.
d) A carga elétrica atrai os íons para dentro da célula.
e) Ocorre transporte ativo dos íons através da membrana.
[E]

47
333. A membrana celular é impermeável à sacarose. No entanto, culturas de lêvedos conseguem crescer em meio com água e sacarose. Isso é possível porque:
a) a célula de lêvedo fagocita as moléculas de sacarose e as digere graças às enzimas dos lisossomos.
b) a célula de lêvedo elimina enzimas digestivas para o meio e absorve o produto da digestão.
c) as células de lêvedo cresceriam mesmo sem a presença desse carboidrato ou de seus derivados.
d) as células de lêvedo têm enzimas que carregam a sacarose para dentro da célula, onde ocorre a digestão.
e) a sacarose se transforma em amido, por ação de enzimas do lêvedos, e entre as célula, onde é utilizada.
[B]
334. A passagem de substâncias através da membrana se dá pelos seguintes processos:
1. Difusão Simples
2. Difusão Facilitada
3. Transporte Ativo
É correto afirmar que os processos envolvidos na passagem de água, O2 , CO2 e substâncias solúveis em lipídios estão representados apenas no(s) item(ns):
a) 2 e 3 b) 1 e 3 c) 2
d) 1 e) 1 e 2
[D]
335. Assinale a alternativa incorreta:
a) a difusão é um processo que ocorre sem gastos de energia
b) a difusão do solvente é chamada Osmose
c) gás carbônico e oxigênio não atravessam a membrana porque não são solúveis em lipídios
d) pequenas moléculas e água passam livremente pela membrana celular
e) a difusão é o movimento de moléculas a favor de um gradiente de concentração
[C]
336. Quando uma célula fagocita uma partícula:
a) a digestão das substâncias fagocitadas ocorre por meio de um processo exógeno à célula em estruturas chamadas de desmossom os
b) há formação de pseudópodes contendo enzimas proteolíticas e ácidos nucléicos
c) a digestão das substâncias fagocitadas é feita pelas enzimas encontradas nos lisossomos
d) a digestão das substâncias fagocitadas ocorre no retículo endoplasmático rugoso com a participação dos ribossomos
[C]
337. A figura a seguir representa uma hemácia (A) que sofre alterações quando mergulhada em um meio hipertônico (1), ou quando mergulhada em um meio hipotônico
(2).

Com base nessas informações RESPONDA:


a) Se uma dose de solução salina, com concentração muito superior à do sangue, for injetada em um cão, qual dos fenômenos, anteriormente representados, pode ocorrer
em suas hemácias? JUSTIFIQUE sua resposta.
b) É correto afirmar que houve, tanto em (1) como em (2), o fenômeno da osmose? JUSTIFIQUE sua resposta.
a) Fenômeno 1, pois as hemácias perderam água por osmose.
b) Sim, porque nos dois casos houve transporte passivo de água através da membrana plasmática das hemácias.
338. Quando temperamos a salada com sal, vinagre e azeite, depois de algum tempo, observamos que as folhas estão murchas. Esse processo é denominado:
a) diapedese b) diálise c) osmose d) hemólise e) difusão
[C]
339. No que diz respeito à osmose, em condições normais, podemos fazer a seguinte afirmação:
a) As hemácias dos mamíferos são hipotônicas em relação ao sangue e à linfa.
b) As células dos animais superiores são isotônicas em relação ao sangue e à linfa.
c) Os paramécios, com vacúolo pulsátil, são isotônicos em relação ao meio ambiente.
d) Os unicelulares, com vacúolo pulsátil, são hipotônicos em relação ao meio ambiente.
e) Os unicelulares de água salgada são geralmente hipotônicos em relação ao meio ambiente.
[B]
340. As carnes "salgadas" não se estragam, porque qualquer microorganismo que nela se instalar desidratará e morrerá. Esta carne se encontra no estado:
a) hipotônica b) isotônica c) túrgida
d) osmótica e) hipertônica
[E]
341. Na figura a seguir, as setas numeradas indicam o sentido do fluxo de água em duas células.

Qual das alternativas identifica corretamente os processos responsáveis pelos fluxos indicados?
a) I - osmose, II - osmose, III - osmose.
b) I - osmose, II - osmose, III - transporte ativo.

48
c) I - osmose, II - transporte ativo, III - transporte ativo.
d) I - transporte ativo, II - transporte ativo, III - osmose.
e) I - transporte ativo, II - transporte ativo, III - transporte ativo.
[B]
342. Uma célula ao ser mergulhada em uma solução, apresenta uma variação de concentração de solutos em função do tempo, de ac ordo com o gráfico a seguir:

De acordo com o gráfico, podemos afirmar que a célula sofreu:


a) desplasmólise b) plasmoptise c) plasmólise
d) hemólise [C]
343. O movimento de moléculas de aminoácidos para o interior das células faz-se, geralmente, por
a) osmose. b) simples difusão. c) difusão facilitada.
d) transporte ativo. e) fagocitose.
[C]
344. O esquema a seguir representa a passagem de íons Na+ (sódio) e K+ (potássio) através da membrana plasmática.

Em relação ao processo esquematizado, podemos afirmar que:


a) por transporte ativo os íons Na+ entram na célula objetivando atingir a isotonia.
b) por difusão os íons K+ entram na célula contra um gradiente de concentração.
c) a entrada de íons K+ por transporte ativo é compensada pela saída de Na+ pelo mesmo processo.
d) a saída de íons Na+ por transporte passivo serve para contrabalançar a entrada dos mesmos íons por transporte ativo.
e) para entrada e saída desses íons da célula não são consumidas moléculas de ATP.
[C]
345. Existe um tipo de troca entre a célula e o meio, que ocorre contra o gradiente de concentração e no qual é necessária a existência de uma proteína carregadora, cuja
ativação depende de gasto de energia.
Esse tipo de troca é denominado:
a) Difusão. b) Difusão facilitada. c) Pinocitose.
d) Fagositose. e) Transporte ativo.
[E]
346. Se colocarmos uma célula animal e outra vegetal em uma solução de NaCl a 1,5%, observaremos que:
a) ambas as células permanecem intactas por estarem mergulhadas em uma solução isotônica.
b) as duas perdem água por osmose e, enquanto a célula animal arrebenta num fenômeno denominado de plasmoptose, a célula vegetal sofre turgência.
c) as duas perdem água por osmose e, enquanto a célula animal murcha, ficando com a superfície enrugada, a célula vegetal sofre plasmólise.
d) o volume de ambas as células aumenta devido à entrada de água por osmose e, enquanto a célula animal sofre hemólise, a célula vegetal sofre turgência.
e) ao serem colocadas em uma solução hipertônica, a célula animal perde água e murcha, enquanto que a célula vegetal, protegida pela parede celular, permanece intacta.
[C]
347. Colocando-se hemácias humanas em diferentes soluções com concentrações iônicas variáveis, pode-se exemplificar a influência que o grau de permeabilidade da
membrana plasmática à água exerce sobre a célula. As conseqüências desse experimento estão demonstradas nos esquemas adiante.

O esquema que representa o comportamento da hemácia, ao ser colocada em um meio hipertônico, é o de número:
a) 1 b) 2 c) 3 d) 4
[A]
348. O mercúrio é um metal pesado cuja forma inorgânica (Hgo) é utilizada de maneira indiscriminada na extração de ouro nos garimpos da Amazônia. Esta forma química
do mercúrio é capaz de formar amálgama com o ouro, separando-o temporariamente de outros metais. Quando o amálgama é submetido a altas temperaturas, ocorre a
volatilização do Hgo, o qual é lançado na atmosfera, obtendo-se assim o ouro puro. Uma vez na atmosfera, o Hg o pode atingir os ambientes aquáticos por deposição
atmosférica úmida e/ou seca. Através da ação microbiológica o Hg o é oxidado a Hg++ para em seguida ser metilado (CH 3Hg+). A forma orgânica (CH3Hg+ - metilmercúrio)
atravessa facilmente a membrana das células e, uma vez dentro delas, altera a função estrutural e/ou enzimática das proteínas.
A respeito da ação do metilmercúrio nas células, é correto afirmar:
( ) Uma enzima participa da troca dos íons Na+ e K+ através da membrana plasmática, que controla o equilíbrio osmótico nas células eucarióticas animais. Apesar do
metilmercúrio (CH3Hg+) ser também um monovalente, não chega a alterar o mecanismo de trocas entre Na+ e K+ nessas células.
( ) A membrana plasmática manter-se-á intacta estrutural e funcionalmente, uma vez que as proteínas presentes na membrana estão imersas e protegidas pela bicamada
lipídica.
( ) Uma vez dentro da célula, o mercúrio certamente não afetará o processo de síntese das proteínas, já que elas ainda não estão completamente formadas.
( ) O mercúrio altera processos importantes no metabolismo celular, como duplicação e transcrição do DNA.
( ) O mercúrio poderá afetar a estrutura dos microtúbulos, prejudicando assim a formação do citoesqueleto, bem como os mo vimentos celulares e/ou o trânsito de
organelas e vesículas dentro da célula.
FFFVV

49
349. Uma célula animal foi mergulhada na solução de cloreto de potássio cuja concentração é semelhante à do plasma sangüíneo (esquema 1). Após um certo tempo, a
concentração de potássio na célula tornou-se vinte vezes maior que a da solução, e o volume da mesma não se alterou (esquema 2). Analise os esquemas:

A explicação para o fenômeno é:


a) O potássio entrou na célula por osmose.
b) Uma enzima lisossômica rompeu a membrana da célula por uma fração de segundo, e o potássio entrou nela.
c) Houve transporte ativo de água para o interior da célula, e esta arrastou o potássio.
d) Houve transporte passivo de potássio para o interior da célula, deslocando água para fora da mesma.
e) Houve transporte ativo de potássio para o interior da célula.
[E]
350. A representação a seguir indica as concentrações intra e extracelulares de sódio e potássio relativas a uma célula animal típica.

Observou-se, em uma experiência, que as concentrações de sódio nos dois compartimentos se tornaram aproximadamente iguais, o mesmo acontecendo com as
concentrações de potássio.
Neste caso poderia ter ocorrido:
a) uma inibição do processo de difusão facilitada.
b) a utilização de um inibidor específico da bomba de cálcio.
c) um estímulo ao processo de osmose.
d) a utilização de um ativador específico da bomba de sódio e potássio.
e) a utilização de um inibidor da cadeia respiratória.
[E]
351. Uma alga marinha unicelular é transferida para água de lago. Embora não possa sobreviver nesse meio, num primeiro momento ela tentará entrar em equilíbrio com
ele
a) formando vacúolos contráteis.
b) perdendo água.
c) absorvendo água.
d) sofrendo hemólise.
e) entrando em plasmólise.
[C]
352. A membrana plasmática é uma membrana semipermeável, não havendo condições, normalmente, para o extravasamento dos colóides citoplasmáticos par a fora da
célula. Sob esse aspecto, a membrana já começa a selecionar o que deve entrar na célula ou dela sair. Considerando os dif erentes processos de passagem através da
membrana plasmática, é CORRETO afirmar que
01. a OSMOSE é a passagem de moléculas de água sempre no sentido do meio mais concentrado para o menos concentrado.
02. a PINOCITOSE é outro tipo de ENDOCITOSE, ocorrendo, neste caso, o englobamento de pequenas porções de substâncias líquidas.
04. no TRANSPORTE ATIVO, enzimas agem como transportadoras de moléculas, tais como o açúcar, ou íons.
16. na DIFUSÃO FACILITADA, participam moléculas especiais, de natureza lipídica e há gasto de energia.
32. para EXOCITOSE, substâncias inúteis à célula são eliminadas com o auxílio dos centríolos.
FVVVFF
353. Através de uma lâmina, em microscópio óptico, é possível distinguir o corte da raiz do corte do caule de uma dicotiledônea jovem porque:
I - O xilema é alternado com o floema na raiz, enquanto que no caule se observa xilema para fora e floema para dentro.
II - O caule não apresenta endoderme nítida e a raiz só possui periciclo.
III - A raiz não possui câmbio e o caule tem.
Para esta questão assinale:
a) Se só uma proposição estiver correta.
b) Se todas as proposições estiverem erradas.
c) Se a primeira e a segunda estiverem corretas.
d) Se a primeira e a terceira estiverem corretas.
e) Se todas as proposições estiverem corretas.
[B]
354. Considere uma espécie de vertebrado cujas células embrionárias têm oito cromossomos. Em quantos grupos de ligações seus genes estarão associados?
a) Dois. b) Quatro. c) Oito. d) Dezesseis. e) Número variável.
[B]
355. A presença de cromatina sexual predominante em número de células femininas está relacionada a cromossomos:
a) Y inativos b) X inativos c) autossômicos inativos
d) autossômicos que não se dividiram e) autossômicos agregados
[B]
356. Na aula de Biologia, o professor fez a seguinte afirmação: "A produção de ribossomos depende, indiretamente, da atividade dos cromossomos.
Em seguida pediu a seus alunos que analisassem a afirmação e a explicassem.
Foram obtidas cinco explicações diferentes, que se encontram a seguir citadas. Assinale a única afirmação correta:

50
a) os cromossomos são constituídos essencialmente por RNA ribossômico e proteínas, material utilizado na produção de ribossom os.
b) os cromossomos são constituídos essencialmente por RNA mensageiro e proteínas, material utilizado na produção de ribossomos.
c) os cromossomos contém DNA; este controla a síntese de ribonucleoproteínas que formarão o nucléolo e que, posteriormente, farão parte dos ribossomos.
d) os cromossomos são constituídos essencialmente por RNA transportador e proteínas, material utilizado na produção de ribossomos.
e) os cromossomos, produzidos a partir do nucléolo, fornecem material para a organização dos ribossomos.
[C]
357. A célula nervosa, o espermatozóide e o zigoto possuem, respectivamente:
a) 46, 46 e 46 cromossomos b) 23, 46 e 23 cromossomos
c) 23, 23 e 46 cromossomos d) 46, 23 e 23 cromossomos
e) 46, 23 e 46 cromossomos
[E]
358. "A intérfase é a fase em que ocorre o repouso celular". A afirmativa está:
a) correta, porque praticamente não há atividade metabólica celular.
b) correta, pois ocorrem apenas alterações no formato da célula.
c) incorreta, porque ocorre movimento dos centríolos.
d) incorreta, porque ocorre a condensação dos cromossomas.
e) incorreta, porque ocorre duplicação do DNA.
[E]
359. Na meiose de uma espécie de planta formam-se 16 tétradres ou bivalentes. Qual o número diplóide da espécie?
a) 4. c) 8. c) 16. d) 32. e) 64.
[D]
360. Se corarmos uma célula animal com um corante específico para RNA, a estrutura mais corada será
a) o lisossomo. b) o complexo de Golgi. c) a mitocôndria.
d) o nucléolo. e) o centríolo.
[D]
361. Os cromossomos das células somáticas de um dado animal foram esquematizados como mostra a figura a seguir:

A partir desse esquema, foram feitas as seguintes deduções sobre esse animal:
I. Suas células diplóides possuem 2n=16 cromossomos.
II. Suas células haplóides apresentam n=8 cromossomos.
III. Seu cariótipo é formado por 4 cromossomos metacêntricos, 2 cromossomos submetacêntricos e 2 cromossomos acrocêntricos.
Dessas afirmações,
a) apenas I é verdadeira.
b) apenas II é verdadeira.
c) apenas III é verdadeira.
d) apenas I e II são verdadeiras.
e) I, II e III são verdadeiras.
[C]
362. Em uma célula eucariótica, as características genéticas responsáveis por todo o controle de atividades celulares estão:
a) nas organelas citoplasmáticas
b) somente nos retículos endoplasmáticos
c) nas cristas mitocondriais
d) encerradas no interior do núcleo, na cromatina
e) somente nos ribossomos
[D]
363. Na(s) questão(ões) a seguir julgue os itens e escreva nos parentesses (V) se for verdadeiro ou (F) se for falso.A elucidação de crimes, como também a identificação
da paternidade, vêm sendo efetuadas com certa facilidade e segurança através do uso de técnicas apropriadas, em que são considerados básicos alguns conceitos de
genética. Sobre esses conceitos, julgue os itens.
( ) Cariótipo é o conjunto de informações sobre os cromossomos de uma determinada espécie.
( ) Genes alelos são genes que ocupam o mesmo "locus" gênico em cromossomos homólogos.
( ) Um dos catalisadores do processo de duplicação do DNA é a enzima DNA polimerase.
( ) Na espécie humana distinguem-se 3 tipos sangüíneos, e os indivíduos do grupo sangüíneo AB são considerados doadores universais.
VVVF
364. Considere a quantidade normal de DNA do núcleo de uma célula da mucosa duodenal humana igual a 2C.
A partir dessa informação, pode-se prever que
a) essa mesma quantidade seja encontrada no núcleo de um linfócido normal.
b) essa mesma quantidade seja encontrada no núcleo de um espermatozóide normal.
c) uma quantidade igual a C seja encontrada no núcleo de um neurônio normal.
d) uma quantidade igual a C/2 seja encontrada no núcleo de um óvulo normal.
e) uma quantidade igual a 4C seja encontrada no núcleo de um blastômero que apresente 46 fios de cromatina.
[A]
355. O número dos cromossomos nas células do cavalo ('Equus caballus') é 64 e no trigo ('Triticum aestivum') é 42.
Quando esses organismos passam pelos processos de mitose e meiose, respectivamente como serão os números cromossômicos de:
(I) Cavalo
(II) Trigo
a) (I) 32 e 64, (II) 42 e 21
b) (I) 128 e 32, (II) 84 e 21
c) (I) 64 e 32, (II) 42 e 21
d) (I) 32 e 16, (II) 42 e 21

51
e) o número de cromossomos não sofre modificações.
[C]
366. Uma célula com 16 cromossomos ao sofrer meiose produz:
a) 4 células com 16 cromossomos;
b) 2 células com 8 cromossomos;
c) 2 células com 16 cromossomos;
d) 4 células com 8 cromossomos;
e) 8 células com 16 cromossomos.
[D]
367. Uma célula procarionte se diferencia de uma célula eucarionte pela ausência de:
a) DNA b) Carioteca c) Citoplasma
d) Membrana Plasmática e) Ribossomos
[B]
368. Considere uma espécie de vertebrado cujas células embrionárias têm oito cromossomos. Em quantos grupos de ligações seus genes estarão associados?
a) Dois. b) Quatro. c) Oito. d) Dezesseis. e) Número variável.
[B]
369. Se a quantidade de DNA de uma célula somática em metáfase mitótica é 2X, as células do mesmo tecido, nas fases G1e G2, apresentam, respectivamente, as
seguintes quantidades de DNA:
a) X e X b) X/2 e X c) X/2 e 2X d) X e X/2 e) X e 2X
[E]
370. Leia com atenção a tirinha a seguir:

Segundo a tirinha, a amiga do Calvin tem DOIS CROMOSSOMOS X. Com base neste dado podemos concluir que:
a) a amiga do Calvin é mutante, por isso é hostil
b) um cromossomo X da amiga do Calvin é ativo e o outro é chamado de cromatina sexual
c) a heterocromatina ocorre no Calvin, pois ele é XY
d) os dois cromossomos X que o Calvin fala é da cobra que quer comê-lo
e) não há cromatina sexual em meninas
[B]
371. A análise citogenética realizada em várias células de um mamífero permitiu elaborar o seguinte esquema:

Ele representa
a) o fenótipo do organismo.
b) o genoma de uma célula haplóide.
c) o genoma de uma célula diplóide.
d) os cromossomos de uma célula haplóide.
e) os cromossomos de uma célula diplóide.
[E]
372. Muitas vezes, durante a realização de eventos esportivos, é realizada a determinação do sexo genético. Este exame é feito pela observação dos cromossomos de
células epiteliais. Pode-se afirmar que neste exame
a) mulheres normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, que corresponde a um dos cromossomos X.
b) homens normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, que corresponde ao cromossomo Y.
c) mulheres normais deveriam apresentar duas estruturas chamadas corpúsculos de Barr, que correspondem aos dois cromossomos X.
d) homens normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, correspondente ao cromossomo X.
e) mulheres normais na fase adulta não deveriam apresentar corpúsculo de Barr.
[A]
373. Numere a coluna inferior, relacionando-a com a superior.
Indivíduos:
1 - 45, X
2 - 46, XX
3 - 49, XXXXX
4 - 49, XXXXY
5 - 47, XXX
Quantidade de cromatinas sexuais (corpúsculos de Barr)
( ) quatro
( ) duas
( ) nenhuma
( ) uma
( ) três
Assinale a opção que apresenta a seqüência correta de numeração.

52
a) 2, 4, 1, 3, 5 b) 3, 5, 1, 2, 4 c) 2, 3, 1, 4, 5
d) 3, 2, 1, 4, 5 e) 2, 1, 3, 4, 5
[B]
374. Algumas células apresentam material nuclear bastante desespiralizado e metabolismo muito alto. Essas características podem indicar:
a) pouca atividade do DNA e, como conseqüência, pouco desenvolvimento das organelas celulares.
b) intensa tradução, exigindo a presença de grande desenvolvimento de retículo endoplasmático liso.
c) intensa transcrição e tradução, exigindo a presença de retículo endoplasmático rugoso muito desenvolvido.
d) intensa duplicação do material genético, demonstrando alta taxa de divisão celular e organelas pouco desenvolvidas.
e) intensa transcrição, exigindo grande desenvolvimento do complexo de Golgi, responsável pela tradução.
[C]
375. Considerando que a ilustração a seguir, referente à divisão de uma célula somática hipotética, apresenta um erro, assinale a alternativa que apresenta a situação que
tornaria o desenho correto.

a) A célula-mãe deveria ter apenas 2 cromossomos e as células-filhas deveriam ter 4 cromossomos, pois têm origem após a duplicação dos cromossomos.
b) A célula-mãe deveria ter 4 cromossomos e as células-filhas deveriam ter 2 cromossomos, pois foram originadas por mitose.
c) A célula-mãe deveria ter 4 cromossomos e as células-filhas deveriam ser 4 e ter cada uma 2 cromossomos, pois seriam o resultado de uma meiose.
d) A célula-mãe deveria ter 4 cromossomos e cada célula-filha 4 cromossomos, pois seriam o resultado de uma mitose.
e) A célula-mãe deveria ter 2 cromossomos e as células-filhas 2 cromossomos, pois seriam o resultado de uma meiose.
[D]
376. Considere as seguintes afirmações relativas ao nucléolo:
I. É uma região de intensa síntese de RNA ribossômico.
II. No nucléolo, as moléculas de RNA ribossômico associam-se a proteínas formando as subunidades que comporão os ribossomos.
III. A organização do nucléolo independe dos cromossomos que compõem o núcleo.
Dessas afirmações, APENAS
a) I é verdadeira.
b) II é verdadeira.
c) III é verdadeira.
d) I e II são verdadeiras.
e) II e III são verdadeiras.
[D]
377. Existem algumas técnicas de coloração que são desenvolvidas para determinar o tipo de substância presente em um determin ado componente celular. Entre eles,
temos o método de FEULGEN, específico para demonstrar a presença de DNA na célula. Se uma célula hepática de uma cobra for submetida a esse método, espera-se
que se veja(m) bem corado(s)
a) retículo endoplasmático rugoso, núcleo e nucléolo.
b) apenas retículo endoplasmático rugoso e núcleo.
c) apenas retículo endoplasmático rugoso e nucléolo.
d) apenas núcleo e nucléolo.
e) apenas núcleo.
[E]
378. A cromatina sexual compreende:
a) o citoplasma de células gaméticas masculinas que se apresentam mais coradas que as femininas.
b) o citoplasma de células gaméticas femininas que se apresentam mais coradas que as masculinas.
c) cromossomo Y condensado em núcleos de hemácias humanas.
d) um dos cromossomos X da mulher, que permanece condensado no núcleo das células, facilmente visualizado na mucosa oral.
e) cromossomos X e Y condensados durante o período da interfase.
[D]
379. No citoplasma de células eucariotas, existem estruturas revestidas por unidade de membrana. Assinale a estrutura celular revestida por membrana DUPLA:
a) Lisossomo
b) Carioteca.
c) Retículo endoplasmático liso.
d) Retículo endoplasmático rugoso.
e) Complexo golgiense.
[B]
380. Um cromossomo é formado por uma longa molécula de DNA associada a proteínas. Isso permite afirmar que o núcleo de uma cé lula somática humana em ... A...
possui ... B... moléculas de DNA. Qual das alternativas indica os termos que substituem corretamente as letras A e B?
a) A = início de intérfase (G1); B = 46.
b) A = fim da intérfase (G2); B = 23.
c) A = início de mitose (prófase); B = 46.
d) A = fim de mitose (telófase); B = 23.
e) A = qualquer fase do cicio celular; B = 92.
[A]
381. Os genes presentes nos cromossomos, em conjunto com fatores ambientais, determinam as características individuais dos seres vivos. Em relação a esse assunto,
julgue os seguintes itens.
(0) Nas regiões não-homólogas dos cromossomos sexuais, é intensa a atividade de recombinação gênica.
(1) Gêmeas univitelinas podem apresentar diferenças fenotípicas relacionadas aos genes localizados no cromossomo X.
(2) Quanto maior a variabilidade genética de uma população, maior é o número de genes em homozigose.
(3) Cada um dos cromossomos do cariótipo humano contém o mesmo número de genes.
Item correto: 1

53
Itens errados: 0, 2 e 3
382. Durante a ovulogênese da mulher, são produzidos dois corpúsculos polares. O primeiro e o segundo corpúsculos polares humanos contêm, respectivamente,
a) 46 cromossomos duplicados e 46 cromossomos simples.
b) 46 cromossomos simples e 23 cromossomos simples.
c) 23 cromossomos duplicados e 23 cromossomos simples.
d) 23 cromossomos simples e 23 cromossomos simples.
e) 23 cromossomos simples e nenhum cromossomo.
[C]
383. Os cromossomos são classificados de acordo com a posição do seu centrômero. Observe os esquemas anteriores e indique a c lassificação dos cromossomos
representados.

a) Telômero, acrocêntrico, metacêntrico.


b) Acêntrico, metacêntrico, mesocêntrico.
c) Acêntrico, acrocêntrico, mesocêntrico.
d) Telocêntrico, acrocêntrico e metacêntrico.
e) Telocêntrico, submetacêntrico, acrocêntrico.
[D]
384. O esquema anterior representa o ciclo mitótico de células em larva de 'Drosophila' (mosca-de-fruta).

O ciclo delimitado pelo retângulo ocorre por diversas vezes seguidas durante um mesmo ciclo celular.
Como conseqüência disso, a condensação cromossômica revelará a presença de um núcleo com a(o):
a) metade da quantidade de material genético do núcleo original.
b) mesma quantidade de material genético do núcleo original.
c) quantidade de material genético original multiplicada várias vezes.
d) número de cromossomas do núcleo original aumentado duas vezes.
e) número de cromossomas do núcleo original reduzido à metade.
[C]
385. A figura anterior representa os diferentes tipos de cromossomos humanos. Os autossomos estão numerados de 1 a 22, e os c romossomos sexuais, designados por
X e Y. Sendo assim, uma célula somática do corpo de uma mulher apresenta:

a) 22 autossomos + Y b) 22 autossomos + XX
c) 22 autossomos + XY d) 44 autossomos + X
e) 44 autossomos + XX
[E]
386. A mosca de frutas (Drosophila melanogaster) apresenta 08 cromossomos nas células somáticas.
É correto afirmar, portanto, que uma célula somática do referido inseto apresenta
a) 04 cromátides em G1.
b) 08 cromátides em G2.
c) 32 centrômeros na metáfase.
d) 16 cinetócoros na prófase.

54
[D]
387. Observe os cromossomos a seguir esquematizados.

As figuras que representam, respectivamente, um conjunto diplóide e o conjunto haplóide correspondente são
a) I e III b) I e IV c) II e III
d) II e IV e) V e I
[B]
388. Os cromossomos são constituídos principalmente por:
a) fosfolipídeos. b) proteínas. c) ácido ribonucléico.
d) enzimas. e) ácido desoxirribonucléico.
[E]
389. Ao se pesquisar a função dos nucléolos realizaram-se experiências com uma linhagem mutante do anfíbio 'Xenopus'. Verificou-se que cruzamentos de indivíduos
desta linhagem produziam prole com alta incidência de morte - os embriões se desenvolviam normalmente e, pouco depois da eclosão, os girinos morriam. Estudos
citológicos mostraram que os núcleos dos embriões ou não apresentavam nucléolos, ou apresentavam nucléolos anormais.
Conclui-se que a primeira atividade celular afetada nestes embriões foi:
a) o processamento do RNA mensageiro
b) a produção de RNA mensageiro
c) a produção de histonas
d) a produção de ribossomos
e) a produção de RNA polimerase
[D]
390. Observe o ciclo reprodutivo da abelha doméstica e assinale a alternativa CORRETA:

Os números 1, 2, 3 e 4 correspondem, respectivamente, a:


a) partenogênese, meiose, mitose e fecundação.
b) meiose, fecundação, mitose e partenogênese.
c) fecundação, meiose, mitose e partenogênese.
d) fecundação, meiose, partenogênese e mitose.
e) meiose, partenogênese, fecundação e mitose.
[D]
391. Sabe-se que o homem possui em torno de 80.000 genes, que, entre outras funções, codificam proteínas.
Considerando-se essa informação e conhecimento sobre o assunto, é CORRETO afirmar que
a) o genótipo das células do tecido nervoso é diferente do genótipo das células do tecido epitelial.
b) o número total de genes, após a diferenciação e a especialização das células, reduz-se.
c) os genes cuja atividade não é necessária ao funcionamento de uma célula perdem a capacidade de duplicação.
d) os genes responsáveis pelo sistema sangüíneo ABO estão presentes nas células epiteliais, mas são incapazes de se expressar.
[D]
392. Indique em qual dos seres vivos, citados a seguir, o ácido desoxirribonucléico (DNA) e o ácido ribonucléico (RNA) não oc orrem em um mesmo indivíduo:
a) bactéria b) protozoário c) vírus
d) fungos e) algas
[C]
393. Um ser vivo acelular que contém apenas um tipo de ácido nucléico pode ser um
a) protozoário b) fungo c) vírus
d) ácaro e) líquen
[C]
394. Entre as características biológicas citadas a seguir, a única pode ser encontrada nos vírus é um:
a) programa genético específico que permite a reprodução de novos seres do mesmo tipo.
b) processo metabólico que requer compostos nitrogenados e de carbono, incluindo os produzidos pelos autótrofos.
c) maquinaria biológica que pode utilizar a energia armazenada em sua célula ou obtida dos alimentos.
d) maquinaria biossintética para a síntese de proteínas.
e) membrana celular que estabelece um limite e regula as trocas de matéria e energia.
[A]
395. "Medicina do futuro recruta vírus "bonzinhos" para vencer câncer e AIDS através de batalhas genéticas."
Utilizando vírus inofensivos como vetores de genes, cientistas estão colocando, nas células dos pacientes, o material genétic o que os médicos desejam.
Tal técnica é possível, pois, na célula hospedeira, o DNA do vírus:
a) inativa as diferentes funções vitais.
b) comanda a produção de proteínas.
c) inibe a respiração celular.

55
d) induz uma mensagem deletéria.
e) estimula a duplicação do DNA celular.
[B]
396. Em relação à AIDS (Síndrome de Imunodeficiência Adquirida), analise as proposições a seguir:
1. É causada por um retrovírus.
2. Pode ser transmitida pelo leite materno das mães contaminadas pelo HIV.
3. O uso de preservativos (camisinha) durante as relações sexuais é uma das principais medidas profiláticas.
4. A transmissão é freqüente pelo contato de mãos.
Considerando o estágio atual de conhecimentos, estão corretos:
a) 1, 3 e 4, apenas
b) 2 e 4, apenas
c) 1, 2 e 3, apenas
d) 2 e 3, apenas
e) 1, 2, 3 e 4
[C]
397. Os vírus, apesar de não possuírem organização celular, podem ser considerados seres vivos, porque:
a) são constituídos de proteínas;
b) possuem moléculas auto-reprodutíveis;
c) possuem maquinaria enzimática necessária que lhes permite a síntese das moléculas, independentes de outras células;
d) crescem e se reproduzem por processos análogos aos das bactérias.
e) todas as afirmativas anteriores estão corretas.
[B]
398. Uma das estratégias mais eficientes que os órgãos de saúde dispõem no combate às doenças infecciosas é a prevenção atrav és da vacinação em massa da
população. Esse combate só é possível quando se conhece o agente causal da doença. Dentre as doenças ocasionadas por VÍRUS, p odemos relacionar as seguintes:
01. Gonorréia.
02. Raiva ou hidrofobia.
04. Cólera.
08. Meningite meningocócica.
16. Poliomielite.
02 + 16 = 18
399. Assinale a alternativa correta a respeito dos vírus.
a) Apresentam membrana plasmática envolvendo seu material interno.
b) Sintetizam ácido nucléico e proteínas para a sua reprodução.
c) Apresentam metabolismo próprio.
d) Não sofrem mutação no seu material genético.
e) Possuem um único tipo de ácido nucléico que, dependendo do vírus, pode ser o DNA ou o RNA.
[E]
400. Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. Penso que a vida resulta da combi nação de quatro processos - metabolismo,
compartimentação, memória e manipulação - e de uma lei de correspondência entre memória e manipulação. Se tomarmos isso como definição, os vírus não podem ser
considerados seres vivos, pois não têm nem metabolismo nem lei de correspondência.
A confrontação do conceito de vida expresso anteriormente com características exibidas pelos vírus permite afirmar:
(01) Os vírus e os seres vivos compartilham uma mesma linguagem na construção de seus genomas.
(02) Os vírus obtêm energia usando os mesmos processos bioenergéticos celulares.
(04) A organização molecular dos vírus expressa a exigência de proteção para o material genético e de reconhecimento pela cél ula hospedeira.
(08) A universalidade do DNA como material genético, entre os vírus, os aproxima da condição biológica.
(16) A condição vital está inevitavelmente associada à estrutura celular.
(32) A capacidade de evoluir é uma propriedade comum aos vírus e aos seres vivos.
01 + 04 + 16 + 32 = 53
401. Impressionados com a notícia do poder arrasador com que o vírus Ebola vem dizimando uma certa população na África, alguns alunos de um colégio s ugeriram
medidas radicais para combater o vírus desta terrível doença. Considerando-se que este agente infeccioso apresenta características típicas dos demais vírus, assinale a
alternativa que contenha a sugestão mais razoável:
a) descobrir urgentemente um potente antibiótico que possa destruir a sua membrana nuclear.
b) alterar o mecanismo enzimático mitocondrial para impedir o seu processo respiratório.
c) injetar nas pessoas contaminadas uma dose maciça de bacteriófagos para fagocitar o vírus.
d) cultivar o vírus "ín vitro", semelhante à cultura de bactérias, para tentar descobrir uma vacina.
e) impedir, de alguma maneira, a replicação da molécula de ácido nucléico do vírus.
[E]
402. O organismo A é um parasita intracelular constituído por uma cápsula protéica que envolve a molécula de ácido nucléico. O organismo B tem uma membrana
lipoprotéica revestida por uma parede rica em polissacarídios que envolvem um citoplasma, onde se encontra seu material genético, constituído por uma molécula circular
de DNA. Esses organismos são, respectivamente:
a) uma bactéria e um vírus.
b) um vírus e um fungo.
c) uma bactéria e um fungo.
d) um vírus e uma bactéria.
e) um vírus e um protozoário.
[D]
403. Característica(s) que todos os seres vivos têm, inclusive os vírus:
a) metabolismo próprio e reprodução
b) reprodução e mutação
c) organização celular
d) núcleo com DNA
e) citoplasma com ribossomos
[B]
404. Qual das alternativas a seguir relaciona apenas doenças causadas por vírus:
a) Febre amarela, Dengue e Sarampo.
b) Malária, Catapora e Meningite.
c) Gripe, Mal de Chagas e Lepra.
d) Amebíase, Lombriga e Amarelão.
e) Elefantíase, Giardíase e Catapora.
[A]
405. Assinale a alternativa que relaciona os seres vivos que não tem estrutura celular e, portanto, não possuem membrana plas mática ou organóides no citoplasma.

56
a) fungos. b) algas. c) moluscos.
d) vírus. e) protozoários.
[D]
406. O organismo que causa o sarampo é um(a):
a) vírus. b) bactéria. c) protozoário.
d) inseto. e) fungo.
[A]
407. O vírus da AIDS é formado por uma cápsula esférica contendo em seu interior o material genético. Este tipo de vírus é chamado RETROVÍRUS porque:

a) o RNA produz um "molde" de molécula de DNA.


b) o RNA, torna-se uma molécula autoduplicável.
c) o DNA possui cadeia simples sem timina.
d) o DNA possui mecanismos de retroação.
e) o DNA e RNA não se pareiam.
[A]
408. Os itens I a VI apresentam, não necessariamente na seqüência, os passos pelos quais um vírus é replicado.
I. síntese das proteínas do vírus.
II. adesão da capa do vírus com a membrana celular.
III. produção de proteínas.
IV. abandono da cápsula.
V. liberação do vírus da célula.
VI. replicação do RNA viral.
Assinale a alternativa que apresenta todos esses passos na seqüência correta.
a) II - IV - I - VI - III - V.
b) VI - IV - I - III - V - II.
c) II - VI - IV - III - I - V.
d) V - II - I - IV - VI - III.
e) II - IV - VI - I - III - V.
[E]
409. É característica do ciclo reprodutivo de um bacteriófago a:
a) penetração por inteiro na célula hospedeira.
b) injeção do material genético, RNA, no interior da célula hospedeira.
c) injeção do material genético, DNA, no interior da célula hospedeira.
d) reprodução sexuada denominada conjugação.
e) reprodução assexuada denominada divisão binária.
[C]
410. Os vírus são minúsculos "piratas" biológicos porque invadem as células, saqueiam seus nutrientes e utilizam as reações químicas das mesmas para se
reproduzir. Logo em seguida os descendentes dos invasores transmitem-se a outras células, provocando danos devastadores. A estes danos, dá-se o nome de virose,
como a raiva, a dengue hemorrágica, o sarampo, a gripe, etc.
(Texto modificado do livro "PIRATAS DA CÉLULA", de Andrew Scott.)
De acordo com o texto, é correto afirmar:
a) Os vírus utilizam o seu próprio metabolismo para destruir células, causando viroses.
b) Os vírus utilizam o DNA da célula hospedeira para produzir outros vírus.
c) Os vírus não tem metabolismo próprio.
d) As viroses resultam sempre das modificações genéticas da célula hospedeira.
e) As viroses são transcrições genéticas induzidas pelos vírus que degeneram a cromatina na célula hospedeira.
[C]
411. Os vírus são entidades que só apresentam propriedades de vida quando estão no interior de células vivas. Fora delas, deixam de apresentar tais propriedades e
podem até cristalizar-se, como os minerais. Os vírus são importantes agentes causadores de doenças humanas, dentre as quais podem apontar:
a) AIDS, sarampo e difteria.
b) sarampo, catapora e herpes.
c) cólera, febre amarela e tétano.
c) febre amarela, sarampo e tétano.
e) disenteria bacilar, hanseníase e poliomielite.
[B]
412. É correto dizer:
a) A membrana plasmática é uma estrutura lipo-protéica presente em todos os tipos celulares e funciona como uma barreira seletiva entre o citoplasma e o núcleo.
b) O controle do metabolismo celular é embasado pela síntese de DNA, pelo RNA, tendo como conseqüência, a síntese protéica.
c) O núcleo é uma estrutura revestida por envoltório nuclear, presente tanto em organismos procariontes como eucariontes.
d) Os vírus são constituídos de uma cápsula protéica e de um ácido nucléico e, para multiplicarem-se precisam de hospedeiro.
e) Pentoses e hexoses são monossacarídeos e, como exemplo, podemos citar a glicose e a ribose, respectivamente.
[D]
413. Pesquisadores têm procurado isolar o vírus da gripe espanhola que, em 1918, matou mais de 20 milhões de pesso as. O trabalho está sendo realizado em um cemitério
de Spitzberg, numa ilha da Noruega, a pouco mais de um quilômetro do Pólo Norte. O conhecimento desse vírus é um caminho impo rtante para o desenvolvimento de
métodos de prevenção para novos casos de epidemias viróticas.
Assinale a opção que apresenta uma característica dos vírus, a qual permite sua existência após tantas décadas transcorridas.
a) Esses organismos apresentam DNA ou RNA como material genético.

57
b) Fora de uma célula viva os vírus podem ser cristalizados.
c) Os vírus apresentam um capsídeo protéico envolvendo o material genético.
d) Os vírus têm capacidade de reduzir seu metabolismo.
e) Os vírus promovem a decomposição lenta dos cadáveres em solos gelados.
[B]
414. "Os cientistas examinaram 11 homens aidéticos, dos quais 5 nunca tinham usado medicamentos anti-HIV e 6 haviam usado. Verificaram que 8 pacientes
apresentavam novas mutações do vírus, resistentes às drogas ministradas e passíveis de serem transmitidas a outras pessoas."
De acordo com o texto, o vírus HIV
a) somente sofreu mutação nos homens que tomaram medicamentos antivirais.
b) não sofreu mutação nos homens que nunca usaram medicamentos antivirais.
c) sofreu mutação nas pessoas que tomaram ou não medicamentos antivirais.
d) foi completamente destruído pela ação dos medicamentos antivirais.
e) é facilmente destruído pela ação de mutantes produzidos por medicamentos antivirais.
[C]
415. "Os cientistas examinaram 11 homens aidéticos, dos quais 5 nunca tinham usado medicamentos anti-HIV e 6 haviam usado. Verificaram que 8 pacientes
apresentavam novas mutações do vírus, resistentes às drogas ministradas e passíveis de serem transmitidas a outras pessoas."
Pela análise do texto, pode-se concluir que a fabricação da vacina anti-AIDS
a) apresenta os mesmos problemas que a da vacina contra a gripe.
b) só pode ser feita contra as formas mutantes do HIV.
c) precisa ser feita contra a forma normal do HIV.
d) é fácil de ser efetuada, tendo em vista a estabilidade do HIV.
e) certamente deverá estar no mercado dentro de pouco tempo.
[A]
416. Relativamente aos vírus afirma-se, corretamente, que:
a) No caso dos retrovírus, que causam diversos tipos de infecções, a enzima transcriptase reversa catalisará a transformação do DNA viral em RNA mensageiro.
b) Em qualquer infecção viral, o ácido nucléico do vírus tem a capacidade de se combinar quimicamente com substâncias present es na superfície das células, o que
permite ao vírus reconhecer e atacar o tipo de célula adequado a hospedá-lo.
c) No caso dos vírus que têm como material genético o DNA, este será transcrito em RNA mensageiro, que comandará a síntese de proteínas virais.
d) Em qualquer infecção viral, é indispensável que o capsídeo permaneça intacto para que o ácido nucléico do vírus seja transcrito.
e) Em todos os vírus que têm como material genético o RNA, este será capaz de se duplicar sem a necessidade de se transformar em DNA, originando várias cópias na
célula hospedeira.
[C]

417. Existe uma série de características que distinguem os seres vivos da matéria bruta. Analise as características a seguir e, depois, assinale aquelas características que
são exclusivas dos seres vivos:
I- metabolismo
II- ausência de moléculas
III- reprodução
IV- material genético
Estão CORRETAS:
a) apenas I e III
b) I, II e IV
c) I, III e IV
d) II, III e IV
e) apenas III e IV
[C]
418. Característica(s) que todos os seres vivos têm, inclusive os vírus:
a) metabolismo próprio e reprodução
b) reprodução e mutação
c) organização celular
d) núcleo com DNA
e) citoplasma com ribossomos
[B]
419. Uma célula procarionte se diferencia de uma célula eucarionte pela ausência de:
a) DNA b) Carioteca c) Citoplasma
d) Membrana Plasmática e) Ribossomos
[B]

420. Todos os seres vivos (exceto os vírus) são formados por células. De acordo com o tipo estrutural de células que os compõem, os organismos podem ser classificados
em eucariontes ou procariontes.
Assinale a alternativa correta.
a) Os protozoários e as bactérias possuem células eucarióticas.
b) Os fungos (bolores e leveduras) possuem células eucarióticas.
c) Os fungos e as bactérias possuem células procarióticas.
d) As bactérias e as algas possuem células eucarióticas.
e) As bactérias e os protozoários possuem células procarióticas.
[B]
421. Assinale a opção que contém as estruturas presentes tanto em células vegetais quanto em células animais.
a) Membrana plasmática, parede celular e citoplasma.
b) Retículo endoplasmático, mitocôndrias e Complexo de Golgi.
c) Plastídeos, lisossomos e centríolos.
d) Vacúolos, cariomembrana e lisossomos.
e) Cromossomos, cariomembrana e plastídeos.
[B]

422. Na(s) questão (ões) adiante, escreva no espaço apropriado a soma dos itens corretos.Das características apresentadas a seguir, selecione aquelas que são comuns
tanto a bactéria como a células vegetais e animais.
01) Presença de parede celular rígida.
02) Material genético constituído por DNA.
04) Presença de retículo endoplasmático e complexo de Golgi.
08) Presença de membrana plasmática.

58
16) Utilização de oxigênio como principal fonte de obtenção de energia química.
32) Presença de ribossomas.
64) Vida livre.
Soma = ( )
02 + 08 + 32 = 42
423. Os protistas são seres vivos que podem ser encontrados em toda parte, na terra e na água, assim como no interior de outros organismos, onde atuam como parasitas
ou simbiontes.
Sobre eles são feitas as afirmações a seguir:
I. Cada protista consiste de uma única célula procariótica, na qual o material hereditário se encontra mergulhado diretamente no líquido citoplasmático.
II. Algumas formas parasíticas de protistas provocam doenças bastante conhecidas, como malária, febre amarela e tétano.
III. O Reino Protista engloba seres vivos exclusivamente heterótrofos, pluricelulares, que se alimentam por absorção de nutrientes do meio.
IV. As bactérias e muitos protistas atuam na digestão da celulose no interior do trato digestivo dos animais ruminantes, como cabras, bois, carneiros, veados e girafas.
Dentre essas afirmações, somente
a) I e II estão corretas.
b) I e III estão corretas.
c) II e III estão corretas.
d) III e IV estão corretas.
e) IV está correta.
[E]
424. "Derrubamos a grande barreira que separava os reinos animal e vegetal: a célula é a unidade da matéria viva."
Essa afirmativa foi feita por cientistas ao descobrirem, em 1839, aquilo que lírios, águas-vivas, gafanhotos, minhocas, samambaias e humanos têm em comum.
Pode-se dizer que todas as células dos seres acima citados têm as seguintes características:
a) centríolo e lisossomo
b) parede celular e mesossomo
c) núcleo individualizado e mitocôndria
d) material nuclear disperso e cloroplasto
[C]
425. Durante a evolução celular surgiram subdivisões membranosas, originando organelas, tais como lisossomos e peroxissomos, nas quais um conjunto de enzimas
opera sem a interferência das demais reações que ocorrem em outros compartimentos internos. A célula assim formada constitui o corpo de:
a) arqueobactérias. b) eubactérias. c) cianobactérias.
d) micoplasmas. e) eucariontes.
[E]
426. Assinale o elemento que NÃO é um componente de uma célula eucariota heterótrofa:
a) Carioteca. b) Mitocôndria. c) Cloroplasto.
d) DNA. e) RNA.
[C]

427. Em cianofíceas, ou cianobactérias, não se conhece nenhum processo de reprodução sexuada. Nesse grupo a variabilidade genética é causada especialmente por:
a) recombinação genética b) mutação c) permutação
d) conjugação e) cruzamentos seletivos
[B]
428. Os procariontes diferenciam-se dos eucariontes porque os primeiros, entre outras características:
a) não possuem material genético.
b) possuem material genético como os eucariontes, mas são anucleados.
c) possuem núcleo, mas o material genético encontra-se disperso no citoplasma.
d) possuem material genético disperso no núcleo, mas não em estruturas organizadas denominadas cromossomos.
e) possuem núcleo e material genético organizado nos cromossomos.
[C]
429. A célula bacteriana não possui:
a) membrana plasmática b) parede celular c) núcleo
d) nucleóide e) ribossomos
[C]
430. Observe o esquema a seguir.

Ele representa
a) uma bactéria. b) um protozoário. c) um fungo.
d) uma célula animal. e) uma célula vegetal.
[A]
431. Entre os vários grupos de microrganismos existe um que é representado por seres unicelulares procariontes que podem ser utilizados na produção industrial de
insulina humana. Esse grupo é constituído por
a) bactérias. b) bacteriófagos. c) fungos.
d) protozoários. e) vírus.
[A]
432. A pasteurização, técnica de esterilização parcial de alimentos, como o leite e os sucos industrializados, consiste em
a) aquecer a mais de 200°C, durante 15 minutos, para destruir esporos e fungos.
b) aquecer até 75°C e resfriar bruscamente, entre 0 e 2°C, visando eliminar bactérias patogênicas.

59
c) resfriar a 0°C, durante 15 horas, que resultará em morte de todos os tipos de vírus.
d) transformar o líquido em pasta, por centrifugação contínua e resfriada, para desnaturar proteínas tóxicas.
e) utilizar conservantes bactericidas e fungicidas os quais não alteram o sabor.
[B]
433. Uma célula bacteriana não possui:
a) material hereditário e carioteca.
b) parede celular e centríolo.
c) ribossomas e dictiossoma.
d) membrana plasmática.
e) nucléolo e carioteca.
[E]
434. Comparando uma célula procariótica com células eucarióticas vegetal e animal, em comum as três apresentam:
a) mitocôndrias, centríolos e flagelos
b) membrana plasmática, ribossomos e cromatina
c) membrana esquelética, ribossomos e cromatina
d) parede celular celulósica, membrana plasmática e lisossomos
e) membrana esquelética, membrana plasmática e cromatina
[B]
435. Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos.A biologia é uma das ciências naturais e es tuda os fenômenos relativos à vida. Assinale
as proposições que apresentam associações CORRETAS entre os ramos da biologia e os seus objetos de estudo.
01. Genética - estudo da hereditariedade.
02. Zoologia - estudo dos vegetais.
04. Botânica - estudo dos animais.
08. Citologia - estudo das células.
16. Histologia - estudo dos tecidos.
32. Anatomia - estudos dos fungos.
Soma ( )
01 + 08 + 16 = 25
436. Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. Um dos maiores cientistas de todos os temp os, Louis Pasteur (1822-1895), foi um
pioneiro.
Em 1995, ele foi homenageado pela comunidade científica mundial, por ocasião do centenário de sua morte.
Destacam-se como contribuições de Pasteur:
- "Nada existe no ar, capaz de gerar, a não ser os germes, que este mesmo ar carrega." (Pasteur, apud CIÊNCIA HOJE, p. 10.)
- "Muitas doenças de plantas e animais são causadas pela invasão de germes.
- As perdas na indústria do vinho, por sua transformação em vinagre, na França do século XIX, eram causadas por bactérias.
- O aquecimento moderado, por um determinado período de tempo, eliminava microorganismos que contaminavam o vinho e a cerveja.
- A mortalidade causada por infecções pós-operatórias foi drasticamente diminuída com o uso de processos de esterilização.
- A imunidade à cólera das galinhas, ao carbúnculo e à raiva pôde ser alcançada, através da injeção de vírus artificialmente atenuados.
Entre as repercussões do trabalho de Pasteur no campo da Biologia Celular, pode-se citar:
(01) A reprodução celular é um dos atributos que definem a condição vital.
(02) Microorganismos causadores de doenças limitam-se à categoria das células eucarióticas.
(04) Variações térmicas são insuficientes para provocar alterações em processos celulares de microorganismos.
(08) O sucesso dos procariotos, na contaminação do vinho, se relaciona à simplicidade do seu processo reprodutivo.
(16) Vinho e vinagre são produtos de atividade biológica, envolvendo sistemas enzimáticos correlacionados.
(32) As células procarióticas e eucarióticas se diferenciam basicamente pelos mecanismos de obtenção de energia.
(64) As células são capazes de responder de modo a neutralizar o efeito de um agente infeccioso.
Soma ( )
16
437. Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. A figura a seguir ilustra possíveis conseqüências do uso indiscriminado de antibióticos
no combate a infecções bacterianas.

Em relação ao aspecto da biologia bacteriana esquematizada em B e suas conseqüências, pode-se afirmar:


(01) A conjugação é um processo que exige o contato celular entre os organismos conjugantes.
(02) A recombinação genética é um atributo próprio de células eucarióticas.
(04) A transferência de material genético entre os conjugantes é unidirecional.
(08) A importância evolutiva da conjugação se expressa no aumento do potencial de adaptação, em bactérias.
(16) A transferência de material genético, na conjugação, se caracteriza como um processo de reprodução sexuada.
(32) A conjugação pode ser um mecanismo de transmissão da mensagem que condiciona a resistência.
Soma ( )
01 + 08 + 16 = 25
438. Existe uma série de características que distinguem os seres vivos da matéria bruta. Analise as características a seguir e, depois, assinale aquelas características que
são exclusivas dos seres vivos:
I- metabolismo
II- ausência de moléculas
III- reprodução
IV- material genético

60
Estão CORRETAS:
a) apenas I e III b) I, II e IV c) I, III e IV
d) II, III e IV e) apenas III e IV
[C]
439. O esquema a seguir representa um experimento sobre a influência de soluções bactericidas de diferentes concentrações (A, B, C D) e seu efeito sobre populações
de bactérias. As áreas claras do esquema representam o espectro de ação de cada uma das soluções, indicadas pela respectiva l etra.
Assinale a alternativa CORRETA.

Analisando o esquema, é possível concluir que a ação bactericida de:


a) A < B > C > D
b) A > B > C > D
c) A = C > B > D
d) A < C < B < D
e) A = D < B = C
[D]

440. Qual das características a seguir NÃO corresponde às bactérias:


a) São seres unicelulares.
b) São seres eucariontes..
c) Algumas são patogênicas.
d) Algumas vivem em colônias.
e) A reprodução assexuada é feita por divisão binária.
[B]
441. Seres de organização celular muito simples, com núcleo não organizado, causadores das infecções e que se encontram por toda parte são:
a) algas. b) protozoários. c) vírus.
d) fungos. e) bactérias.
[E]

442. Bactérias e Cianofíceas (ou Cianobactérias) são seres vivos unicelulares e procariontes porque:
a) podem causar doenças no homem e nos animais, possuem membrana plasmática e membrana nuclear.
b) são constituídos por uma célula apenas, não possuem membrana plasmática e possuem membrana nuclear.
c) são constituídos por uma célula apenas, possuem membrana plasmática e não possuem membrana nuclear.
d) são constituídos por uma célula apenas e podem formar colônias.
e) Não formam colônias e podem causar doenças no homem e nos animais.
[C]
443. Nas bactérias, o MESOSSOMO apresenta uma coleção enzimática responsável por um processo que também ocorre:
a) nas lamelas dos cloroplastos.
b) na membrana do retículo endoplasmático rugoso.
c) no nucléolo.
d) no complexo de Golgi.
e) nas cristas mitocondriais.
[E]
444. Está presente na célula bacteriana:
a) aparelho de Golgi. b) carioteca. c) mitocôndria.
d) retículo endoplasmático. e) ribossomo.
[E]
445. Na(s) questão (ões) adiante, escreva no espaço apropriado a soma dos itens corretos.Das características apresentadas a seguir, selecione aquelas que são comuns
tanto a bactéria como a células vegetais e animais.
01) Presença de parede celular rígida.
02) Material genético constituído por DNA.
04) Presença de retículo endoplasmático e complexo de Golgi.
08) Presença de membrana plasmática.
16) Utilização de oxigênio como principal fonte de obtenção de energia química.
32) Presença de ribossomas.
64) Vida livre.
Soma = ( )
02 + 08 + 32 = 42
446. Um cientista, ao descobrir um novo ser vivo, teve como incumbência classificá-lo de acordo com o sistema de Lineu. O ser foi então classificado como:
MONERA - SCHYZOPHYTA - AUTOTRÓFICO
Ele chegou a tal conclusão por se tratar de um organismo:
a) procarionte, unicelular, de reprodução predominantemente assexuada e capaz de realizar fotossíntese.
b) procarionte, unicelular, de reprodução predominantemente sexuada e que retira a molécula orgânica já digerida do ambiente.
c) procarionte, unicelular, sem parede celular, de respiração anaeróbica facultativa.
d) eucarionte, unicelular, com parede celular, de respiração anaeróbica e quimiossintetizantes.
e) eucarionte, pluricelular, com parede celular, de reprodução predominantemente assexuada e capaz de realizar fotossíntese.
[A]

61
447. Assinale a alternativa correta.
a) As bactérias reproduzem-se, geralmente, por divisão binária, uma forma assexuada de reprodução pela qual uma única bactéria pode originar um "clone", ou seja, uma
população de bactérias idênticas.
b) As bactérias e as algas cianofíceas distinguem-se de todos os outros seres vivos porque não possuem carioteca envolvendo o material nuclear, isto é, são eucariontes.
c) As bactérias só vivem isoladas, embora próximas; nunca formam colônias.
d) Em algumas espécies de bactérias observa-se o fenômeno da conjugação, isto é, um tipo de reprodução assexuada.
e) As algas cianofíceas assemelham-se às bactérias, porém são heterótrofas, isto é, produzem a matéria orgânica por fotossíntese.
[A]
448. Entre as doenças sexualmente transmissíveis, são causadas por bactérias
a) a sífilis, a gonorréia e a pediculose pubiana.
b) o cancro mole, a tricomoníase e a gonorréia.
c) o condiloma acuminado, a sífilis e a AIDS.
d) a sífilis, o cancro mole e a gonorréia.
e) a pediculose pubiana, a tricomoníase e a AIDS.
[D]
449. Sobre as cianofíceas, é INCORRETO afirmar que:
a) não possuem núcleo individualizado.
b) possuem clorofila como pigmento fotossintetizante.
c) possuem cromoplastos.
d) a reprodução é somente assexuada.
e) são unicelulares ou coloniais.
[C]

450. Um gene de bactéria com 600 pares de bases nitrogenadas produzirá uma cadeia polipeptídica com número de aminoácidos apr oximadamente igual a
a) 200 b) 300 c) 600 d)1200 e)1800
[A]
451. Uma anomalia genética autossômica recessiva é condicionada por uma alteração na seqüência do DNA. Um homem portador dessa anomalia apresenta a
seqüência timina-citosina-timina enquanto sua mulher, que é normal, apresenta a seqüência timina-adenina-timina. A análise do DNA de um filho do casal mostrou que
ele é portador tanto da seqüência de bases do pai quanto da mãe.
a) O filho terá a doença? Por que?
b) Qual a probabilidade de um outro filho do casal apresentar as duas seqüências iguais à da mãe?
a) Não porque a seqüência herdada do pai é recessiva em relação à materna.
b) A probabilidade de uma outra criança desse casal herdar as duas seqüências maternas é zero porque na fecundação há união das seqüências paterna e materna.
452. Considere um fragmento de DNA com a seguinte seqüência de bases:
GTAGCCTAG
e responda:
a) Qual será a seqüência do RNAm transcrito a partir deste DNA?
b) O mesmo peptídio será obtido a partir deste RNAm e do RNAm da fita complementar? Explique.
a) CAU CGG AUC
b) Somente se formará o mesmo peptídeo se os códons transcritos à partir da fita complementar especificarem os mesmos aminoácidos, devido à degeneração do código
genético.
453. A estrutura química de uma proteína poderá ser modificada se
a) durante sua síntese houver variação dos tipos de aminoácidos disponíveis no citoplasma celular.
b) durante sua síntese houver variação dos tipos de RNA transportadores.
c) sua síntese ocorrer no complexo de Golgi e não no retículo endoplasmático rugoso.
d) uma base púrica substituir uma pirimídica no RNA mensageiro que a codifica.
e) o DNA não se duplicar durante a intérfase.
[D]
454. Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta a seqüência de bases TACTCCGCTTAG e , em sua
cadeia complementar, a seqüência ATGAGGCGAATC, quais são as seqüências de bases de RNAm por ele produzido?
AUG AGG CGA AUC e UAC UCC GCU UAG
455. Que papéis desempenham o RNA mensageiro e do RNA transportador no processo de síntese das proteínas?
RNA mensageiro - determina a ordem dos aminoácidos na cadeia polipeptídica
RNA transportador - ativação e transporte de aminoácidos para os ribossomos no processo de síntese protéica
456. Quais são as duas propriedades fundamentais do DNA que permitem a essa substância desempenhar o papel d e material genético?
REPLICAÇÃO para que possa ser transmitido à descendência e TRANSCRIÇÃO, ou produção do RNA, para controlar as atividades celulares através da síntese de
proteínas.
457. Porque o processo de replicação do DNA é chamada semiconservativa?
A replicação do DNA sempre CONSERVA, nas moléculas-filhas, metade da molécula-mãe.
458. Os códons AGA, CUG, e ACU do RNA mensageiro codificam, respectivamente os aminoácidos arginina, leucina e treonina. Escr eva esses aminoácidos na ordem
correspondente à seqüência TGA - TCT - GAC de um segmento de DNA.
Treonina - Arginina - Leucina
459. A substituição de uma única base na molécula de DNA leva necessariamente à substituição de um aminoácido na proteína a s er sintetizada pela célula. Certo ou
errado? Justifique.
Não. O código genético é degenerado, ou seja, diferentes trincas podem especificar o mesmo aminoácido na síntese das proteínas celulares.
460. Qualquer alteração no DNA pode modificar o funcionamento de uma célula? Justifique.
Não necessariamente, pois a substituição de bases nitrogenadas na cadeia do DNA poderá determinar os mesmos aminoácidos, na m esma ordem, em uma proteína, já
que o código genético é degenerado.
461. Quais os papéis do gene e do ribossomo na síntese das proteínas celulares?
O gene (cístron) determina a ordenação dos aminoácidos das proteínas produzidas em uma célula. Os ribossomos fazem a tradução do código genético do DNA através
da leitura do RNA mensageiro.
462. Dada a seqüência de bases nitrogenadas de um segmento de DNA:
AATGGCATC, responda:
a) Qual é a seqüência de bases da hélice complementar a esse segmento?

62
b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento?
a) TTACCGTAG
b) UUACCGUAG
463. Dado um segmento de RNA mensageiro com a seguinte seqüência de bases: AAUGUAGGC, pergunta-se:
a) Qual a seqüência de bases do DNA que deu origem a esse RNA?
b) Quantos aminoácidos terá o polipeptídeo traduzido, no ribossomo, a partir desse RNA?
a) TTA CAT CCG
b) três
464. Dada a seqüência de bases nitrogenadas de um segmento de DNA a seguir, responda aos itens adiante.
TTTAATGGGCAT
a) Qual é a seqüência de bases da hélice complementar a esse segmento?
b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento?
a) AAATTACCCGTA
b) AAAUUACCCGUA
465. Considere as seguinte tabela que indica seqüências de bases do RNA mensageiro e os aminoácidos por elas codificados.
Com base na tabela fornecida e considerando um segmento hipotético de DNA, cuja seqüência de bases é AAGTTTGGT, qual seria a seqüência de aminoácidos
codificada?

a) Aspargina, leucina, valina.


b) Aspargina, lisina, prolina.
c) Fenilalanina, lisina, prolina.
d) Fenilalanina, valina, lisina.
e) Valina, lisina, prolina.
[C]
466. No DNA de um organismo, 18% das bases nitrogenadas são constituídas por citosina. Que outras bases nitrogenadas devem ex istir neste DNA e em que
proporções? Justifique sua resposta.
Na fita deverá existir 18% de guanina, 32% de adenina e 32% de timina.
O DNA é formado por uma dupla cadeia de polinucleotídeos. Sabendo-se que as cadeias são complementares e o pareamento é sempre adenina com timina e citosina
com guanina, a quantidade de citosina de ser igual a de guanina e a quantidade de adenina de ser igual a de timina.
467. Não é característica do DNA:
a) o açúcar com cinco átomos de carbono.
b) a presença das bases nitrogenadas uracila, guanina, citosina e adenina.
c) a presença de ácido fosfórico.
d) é polinucleotídeo.
e) ocorre nos cromossomos.
[B]
468. Considerando o modelo da estrutura molecular do DNA como representado na figura adiante, responda o que representam os c omponentes 1, 2 e 3,
respectivamente.

1) Ácido fosfórico
2) Desoxirribose
3) Base nitrogenada
469. O que são ácidos nucléicos? Como atuam na síntese de proteínas?
São moléculas (DNA e RNA) que comandam, através da síntese de enzimas, todo o metabolismo celular. Segmentos de DNA (genes) t ranscrevem o RNAm que, nos
ribossomos, associados ao RNAt realizam a tradução do código genético em uma proteína.
470. Em um segmento de DNA que codifica determinada proteína, considere duas situações:
a) um nucleotídeo é suprimido;
b) um nucleotídeo é substituído por outro.
A situação "a", geralmente, é mais drástica que a situação "b". Explique por quê.

63
A supressão de um nucleotídeo pode causar completa ou incompletamente a descodificação da seqüência de bases do DNA provocando alterações na proteína
correspondente ao código alterado.
Uma substituição não necessariamente altera o fenótipo por causa da degeneração do código genético.
471. Recentemente, os meios de comunicação noticiaram o caso de uma mulher norte-americana que, impossibilitada de ter filhos por anomalia no útero, teve seu óvulo
fertilizado "in vitro", e este foi implantado no útero de sua mãe. Assim, quem engravidou e deu à luz foi a mãe da referida mulher. Responda:
a) Do ponto de vista genético, quem é a mãe da criança? Justifique.
b) Qual a porcentagem de genes herdados da parturiente que se encontram no patrimônio genético da criança?
a) A mulher que não podia engravidar porque foi a doadora do óvulo implantado em sua mãe.
b) Em média 25% dos genes seriam herdados da avó parturiente.
472. Uma alteração no DNA pode modificar o funcionamento de uma célula. Por quê?
O DNA comanda, através da síntese de enzimas, todo o metabolismo celular. Uma alteração no DNA pode provocar modificações nas enzimas e consequentemente nas
reações químicas da célula.
473. Certos mutantes nutricionais do fungo Neurospora só conseguem crescer quando aminoácidos são adicionados ao meio de cultura.
Na tabela a seguir, o sinal (+) significa crescimento, e o sinal (-) significa ausência de crescimento.

Sabe-se que as etapas que levam à síntese da arginina são:


substrato → (gene1) → ornitina → (gene2) →
citrulina → (gene3) → arginina
Supondo que em cada mutante há apenas um gene alterado, explique o porquê do mutante Z só crescer quando se adiciona arginina ao meio de cultura.
Cada mutante possui um gene alterado. Z só cresce em meio com arginina, logo apenas o gene 3 do mutante Z apresenta alteração
474. Um antibiótico que atue nos ribossomos mata:
a) bactérias por interferir na síntese de proteínas.
b) bactérias por provocar plasmólise.
c) fungos por interferir na síntese de lipídios.
d) vírus por alterar DNA.
e) vírus por impedir recombinação gênica.
[A]
475. De que maneira o DNA determina a seqüência de aminoácidos das moléculas de proteínas?
O DNA é um polinucleotídeo capaz de produzir o RNA mensageiro. Cada três nucleotídeos (códon) do RNAm será traduzido por um aminoácido ao nível dos ribossomos.
476. Ribossomos são formados por RNA e proteínas, sintetizados pelos processos de transcrição e tradução, respectivamente.
a) Onde esses processos ocorrem na célula eucariótica?
b) O que acontecerá com os processos de transcrição e tradução, se ocorrer uma inativação na Região Organizadora do Nucléolo? Justifique.
a) Transcrição no núcleo ao nível dos cromossomos e tradução no citoplasma ao nível dos ribossomos.
b) Sem a região organizadora do nucléolo não haverá RNA ribossômico, matéria prima para a produção destes organóides e, conse quentemente, cessará a síntese de
proteínas na célula.
477. Organelas citoplasmáticas que contêm DNA:
a) mitocôndria e ribossomo.
b) mitocôndria e cloroplasto.
c) nucléolo e cloroplasto.
d) lisossomo e ribossomo.
e) ribossomo e cromossomo.
[B]
478. A engenharia genética permitiu a introdução, em ratos, do gene humano para produção do hormônio de crescimento, levando à produção de ratos gigantes. Estes
ratos são considerados
a) isogênicos. b) transgênicos. c) infectados.
d) mutantes. e) clones.
[B]
479. A seqüência de aminoácidos de uma proteína é determinada pela seqüência de
a) pentoses da molécula de DNA.
b) pentoses da molécula de RNA - mensageiro.
c) bases da molécula de DNA.
d) bases da molécula de RNA - transportador.
e) bases da molécula de RNA – ribossômico
[C]
480. Importante informação que permitiu o estabelecimento de um modelo para a molécula de DNA foi a verificação de que o número de adenina nucleotídeos era
sempre igual ao de timina nucleotídeos, o mesmo ocorrendo com a guanina e citosina nucleotídeos. O fato nos permite afirmar que os nucleotídeos
a) ocorrem em igual quantidade.
b) ocorrem aos pares na molécula de DNA.
c) púricos pareiam com outros púricos.
d) pirimídicos pareiam com outros pirimídicos.
e) ligam-se como se fossem o corrimão de uma escada.
[B]

64
481. Uma molécula de RNAmensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUUGUGCCCAAC. Assinale a alternativa que contém a seqüência de
bases do segmento da molécula de DNA que deu origem a esse RNA.
a) AAACACGGGTTG
b) TTTCACGGGUUG
c) AAACTCGGGTTG
d) TTTGAGGGGTTG
e) AAACACCCCUUG
[A]
482. Na figura a seguir que representa o modelo da molécula de DNA os números 1, 2 e 3 indicam, respectivamente

a) desoxirribose, ácido fosfórico e base nitrogenada.


b) ácido fosfórico, desoxirribose e base nitrogenada.
c) ribose, ácido fosfórico e base nitrogenada.
d) ácido fosfórico, ribose e base nitrogenada.
e) ácido fosfórico, base nitrogenada e desoxirribose.
[B]
483. Na figura a seguir que representa o modelo da molécula de RNA os números 1, 2 e 3 indicam, respectivamente

a) desoxirribose, ácido fosfórico e base nitrogenada.


b) ácido fosfórico, desoxirribose e base nitrogenada.
c) ribose, ácido fosfórico e base nitrogenada.
d) ácido fosfórico, ribose e base nitrogenada.
e) ácido fosfórico, base nitrogenada e desoxirribose.
[C]
484. Numa molécula de DNA, a quantidade de
a) adenina é igual a de citosina.
b) citosina é igual a de timina.
c) guanina é igual a de citosina.
d) citosina é igual a de adenina.
e) adenina é igual a de uracila.
[C]
485. Griffth em 1928 descobriu que pneumococos sem cápsula, não patogênicos, misturados com um extrato de pneumococos capsulados patogênicos mortos
causavam a morte de cobaias. Nesse extrato o agente transformante era
a) o ácido ribonucléico.
b) o ácido indolilacético.
c) o ácido desoxirribonucléico.
d) uma enzima.
e) uma proteína.
[C]
486. Para funcionar como material genético o ácido desoxirribonucléico (DNA) apresenta a capacidade de autoduplicação. Utiliz ando seus conhecimentos sobre o
material genético, responda:
a) Qual a importância de o DNA autoduplicar-se?
b) Por que essa replicação é semiconservativa?
a) Os genes são constituídos por DNA e se duplicam para que possam ser transmitidos da célula-mãe para as células-filhas durante as divisões celulares e também à
descendência dos seres vivos.
b) A replicação é semiconservativa porque as moléculas-filhas produzidas sempre conservam metade da molécula-mãe.
487. No DNA de um organismo, 20% das bases nitrogenadas são constituídas por adenina. Que outras bases nitrogenadas devem exi stir neste DNA e em que
proporções?
Timina = 20%, Guanina = 30% e Citosina = 30%
488. Ribossomos são formados por RNA e proteínas, sintetizados pelos processos de TRANSCRIÇÃO E TRADUÇÃO, respectivamente.
a) Onde esses processos ocorrem na célula eucariótica?
b) O que acontecerá com os processos de transcrição e tradução, se ocorrer uma destruição do(s) nucléolo(s) de uma célula?.
a) núcleo e ribossomos.

65
b) cessa o processo de tradução.
489. Comparando as estruturas dos ácidos nucléicos desoxirribonucléico (DNA) e ribonucléico (RNA) pode-se afirmar que
a) timina é uma base nitrogenada exclusiva do RNA.
b) uracila é uma base nitrogenada exclusiva do DNA.
c) ribose é um açúcar que entra na composição química do RNA.
d) ácido fosfórico só entra na composição química do DNA.
e) timina pareia com adenina no RNA.
[C]
490. Mencione duas diferenças de natureza molecular entre o DNA e o RNA.
O DNA é um polinucleotídeo formado por uma dupla hélice, contém a pentose desoxirribose e Timina como base pirimidica exclusi va. No RNA observa-se uma hélice
simples contendo nucleotídeos com ribose e como base pirimidica exclusiva encontramos a Uracila.
491. Justifique o termo SEMICONSERVATIVO para caracterizar o processo de replicação do DNA.
As moléculas-filhas sempre conservam metade da molécula-mãe
492. O que são NUCLEOTÍDEOS? Quais são as moléculas que entram em sua composição química?
Unidades estruturais dos ácidos nucléicos (DNA e RNA). Constituídos por ácido fosfórico + açúcar + base nitrogenada
493. Quais são as diferenças observadas nos nucleotídeos que entram na composição do DNA em relação aos que entram na composição do RNA?
DNA - Desoxirribose (pentose) e Timina (base nitrogenada exclusiva)
RNA - Ribose (pentose) e Uracil (base nitrogenada exclusiva)
494. O que representa o desenho a seguir? Qual o nome das moléculas representadas pelos números 1, 2 e 3, respectivamente, sabendo-se que trata-se da unidade
estrutural do ácido desoxirribonucléico (DNA).

1 - ácido fosfórico
2 - açúcar desoxirribose
3 - base nitrogenada (Adenina, Guanina, Citosina ou Uracila)
495. Observe o esquema adiante e responda:

a) Quais são as moléculas representadas pelos números 1, 2 e 3, respectivamente, sabendo-se que trata-se da unidade estrutural do ácido ribonucléico (RNA).
b) Qual é o nome dessa unidade estrutural?
a) (1) = ácido fosfórico, (2) = ribose, (3) = base nitrogenada
b) nucleotídeo
496. No desenho a seguir que representa a estrutura da molécula de DNA, o que representam os números 1, 2 e 3, respectivamente?

1 - fosfato (PO4--)
2 - desoxirribose
3 - base nitrogenada
497. Moléculas de DNA constituídas por duplo filamento helicoidal mantém as cadeias unidas entre si por
a) ligações covalentes.
b) ligações iônicas.

66
c) pontes de hidrogênio.
d) pontes de nitrogênio.
e) ligação metálica.
[C]
498. Sobre o DNA, é INCORRETO afirmar que
a) possui a base nitrogenada uracila.
b) origina o RNA mensageiro
c) reproduz-se de modo semiconservativo.
d) é integrante dos genes e dos cromossomos.
e) é formado de dupla cadeia com formato helicoidal.
[A]
499. Sobre o DNA, é CORRETO afirmar que
a) possui a base nitrogenada uracila.
b) não origina o RNA mensageiro
c) não é capaz de replicar-se.
d) é integrante do nucléolo e dos ribossomos.
e) é formado de dupla cadeia com formato helicoidal.
[E]
500. Sobre o RNA, é INCORRETO afirmar que
a) possui a base nitrogenada uracila.
b) participa da estrutura dos ribossomos.
c) reproduz-se de modo semiconservativo.
d) é traduzido em proteínas nos ribossomos.
e) é formado de simples cadeia com formato helicoidal.
[C]
501. O DNA e o RNA quanto à sua estrutura química, são classificados como
a) polipeptídeos. b) nucleoproteínas. c) polissacarídeos.
d) fosfatídeos. e) polinucleotídeos.
[E]
502. Qual das seguintes bases nitrogenadas NÃO entra na composição química do DNA?
a) Timina. b) Citosina. c) Adenina.
d) Uracila. e) Guanina.
[D]
503. Qual das seguintes bases nitrogenadas NÃO entra na composição química do RNA?
a) Timina. b) Citosina. c) Adenina.
d) Uracila. e) Guanina.
[A]
504. Qual das seguintes moléculas NÃO entra na composição química do DNA?
a) Ribose. b) Desoxirribose. c) Ácido fosfórico.
d) Adenina. e) Guanina.
[A]
505. Qual das seguintes moléculas NÃO entra na composição química do RNA?
a) Ribose. b) Desoxirribose. c) Ácido fosfórico.
d) Adenina. e) Guanina.
[B]
506. Se um segmento de DNA possui a seqüência de bases nitrogenadas TTA CCG ATT ATG, pode-se afirmar que a cadeia complementar a esse segmento terá a
seqüência
a) AAT GGC TAA TAC.
b) UUT GGC TUU UAC.
c) TTA CCG ATT ATG.
d) AAT GGC TAA UAC.
e) AAU GGC UAA UAC.
[A]
507. Dado um segmento de RNA com a seguinte seqüência de bases nitrogenadas: UUA UUU GGC UCC, pode-se dizer que o segmento de DNA que deu origem a
esse RNA era
a) TTA AAA CCG AGG.
b) AAT AAA GGC UCC.
c) AAT AAA CCG AGG.
d) TTA TTT CCG AGG.
e) AAU AAA CCG AGG.
[C]
508. Uma molécula de DNA contém 15% de Guanina. Que outras bases nitrogenadas possui essa molécula e em que proporções?
Segundo a relação de Chargaff (A + G = T + C), pode-se concluir que as outras bases são:
Citosina (C) = 15%, Adenina (A) = 35%, Timina (T) = 35%.
509. Uma cadeia de RNA tem 200 nucleotídeos. Quantos nucleotídeos tinha o DNA que originou esse RNA?
400 nucleotídeos porque o DNA é constituído por duas cadeias complementares e apenas uma cadeia com 200 nucleotídeos serviu de molde para a produção de RNA.
510. Um ser vivo acelular que contém apenas um tipo de ácido nucléico pode ser um
a) protozoário b) fungo c) vírus d) ácaro e) líquen
[C]
511. Os ácidos nucléicos são macromoléculas definidas como polinucleotídeos.
a) Represente um nucleotídeo apontando seus três constituintes moleculares.
b) Quais são as diferenças observadas nos nucleotídeos que entram na composição do DNA em relação aos que entram na composição do RNA?
a) Observe a figura a seguir:

67
b) DNA - desoxirribose e timina
RNA - ribose e uracila
512. Para funcionar como material genético o DNA apresenta duas propriedades fundamentais. São elas:
I - AUTODUPLICAÇÃO
II - TRANSCRIÇÃO
Explique essas duas propriedades
A autoduplicação permite que o DNA produza cópias e possa ser transmitido à descendência. Transcrição é a capacidade do DNA produzir o RNA que será traduzido em
proteína específica nos ribossomos das células.
513. Sabendo-se que numa molécula de DNA formada por uma dupla hélice há 21% de timina, responda quais são as outras bases dessa molécula e em que
proporções ocorrem.
Timina = 21%
Guanina = 29%
Citosina = 29%
514. Considere um segmento de DNA com a seguinte seqüência de bases nitrogenadas:
ATT CTA CGC AAA GGC
a) Quais são as bases da cadeia complementar a esse segmento?
b) Se o segmento dado servir de molde para a produção de RNA, qual será a seqüência de bases desse RNA?
a) TAA GAT GCG TTT CCG
b) UAA GAU GCG UUU CCG
515. Um segmento de RNA mensageiro apresenta a seqüência de bases nitrogenadas a seguir:
AAA UUC GGG GAU.
a) Quais são as bases do segmento de DNA que deu origem a esse RNA?
b) Quantos nucleotídeos existem no DNA que deu origem a essa molécula de RNA mensageiro?
a) TTT AAG CCC CTA
b) 12 nucleotídeos.
516. Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta uma seqüência de bases ACTCCGCTT / TGAGGCGAA,
quais poderiam ser as seqüências de bases do RNA por ele produzido?
UGA GGC GAA e ACU CCG CUU
517. Dada a seqüência de bases nitrogenadas de um segmento de DNA = AAAGGCATT, responda:
a) Qual é a seqüência de bases da hélice complementar a esse segmento?
b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento?
a) TTT CCG TAA
b) UUU CCG UAA
518. No DNA de um organismo, 32% das bases nitrogenadas são constituídas por citosina. Que outras bases nitrogenadas devem ex istir neste DNA e em que
proporções?
As outras bases serão:
Guanina =32%
Adenina = 18%
Timina = 18%
519. Observa-se a presença de DNA nos seguintes organóides citoplasmáticos
a) mitocôndria e ribossomo.
b) ribossomo e cromossomo.
c) nucléolo e cloroplasto.
d) lisossomo e ribossomo.
e) mitocôndria e cloroplasto.
[E]
520. Uma molécula de RNAmensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUUGUGCCCAAA. Assinale a alternativa que contém a seqüência de
bases do segmento da molécula de DNA que deu origem a esse RNA.
a) AAACACGGGTTT
b) TTTCACGGGUUU
c) AAACTCGGGTTT
d) TTTGAGGGGTTT
e) AAACACCCCUUT
[A]
521. No modelo molecular do ácido ribonucléico (RNA) representado adiante os números 1, 2 e 3 indicam, respectivamente

68
a) desoxirribose, ácido fosfórico e base nitrogenada.
b) ácido fosfórico, desoxirribose e base nitrogenada.
c) ribose, ácido fosfórico e base nitrogenada.
d) ácido fosfórico, ribose e base nitrogenada.
e) ácido fosfórico, base nitrogenada e desoxirribose.
[C]
522. Na molécula de DNA, a quantidade de
a) adenina é igual a de citosina.
b) citosina é igual a de timina.
c) guanina é igual a de adenina.
d) citosina é igual a de adenina.
e) adenina é igual a de timina.
[E]
523. Em 1928 Griffth descobriu que pneumococos (bactérias) sem cápsula, não patogênicos, misturados com um extrato de pneumococos capsulados patogênicos
mortos causavam a morte de cobaias. Nesse extrato o agente capaz de transformar bactérias não patogênicas em patogênicas era
a) o ácido ribonucléico.
b) o ácido indolilacético.
c) o ácido desoxirribonucléico.
d) uma enzima.
e) uma proteína.
[C]
524. Comparando as estruturas dos ácidos nucléicos desoxirribonucléico (DNA) e ribonucléico (RNA) NÃO se pode afirmar que
a) timina é uma base nitrogenada exclusiva do DNA.
b) uracila é uma base nitrogenada exclusiva do DNA.
c) ribose é um açúcar que entra na composição química do RNA.
d) ácido fosfórico entra na composição química do DNA e do RNA.
e) timina pareia com adenina no DNA.
[B]
525. Assinale a alternativa que relaciona corretamente o nome das moléculas representadas pelos números 1, 2 e 3, respectivamente, sabendo-se que a figura adiante
representa a unidade estrutural do ácido desoxirribonucléico (DNA).

a) base nitrogenada, ribose e ácido fosfórico.


b) ácido fosfórico, ribose e base nitrogenada.
c) desoxirribose, base nitrogenada e ácido fosfórico.
d) ácido fosfórico, desoxirribose e base nitrogenada.
e) base nitrogenada, desoxirribose e ácido fosfórico.
[D]
526. O modelo molecular dos ácidos nucléicos (DNA e RNA) foi proposto por J. Watson e F. Crick em 1953. Segundo esse modelo esses ácidos são
a) micromoléculas.
b) polipeptídeos.
c) polinucleotídeos.
d) enzimas.
e) lipídios.
[C]
527. É característica do DNA:
a) açúcar com quatro átomos de carbono.
b) presença das bases nitrogenadas uracila, guanina, citosina e adenina.
c) ausência de ácido fosfórico.
d) é polipeptídeo.
e) ocorre nos cromossomos.
[E]
528. Uma molécula de RNAmensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUUGUGCCCAAU. Assinale a alternativa que contém a seqüência de
bases do segmento da molécula de DNA que deu origem a esse RNA.

69
a) AAACACGGGTTA
b) TTTCACGGGUUT
c) AAACTCGGGTTT
d) TTTGAGGGGTTA
e) AAACACCCCUUA
[A]
529. Griffth em 1928 descobriu que bactérias pneumococos sem cápsula, não patogênicos, misturados com um extrato de pneumococos capsulados patogênicos mortos
causavam a morte de cobaias. Em 1944 Avery, McLeod e McCarthy concluíram que o agente capaz de transformar as bactérias era
a) o RNA. b) o AIA. c) o DNA.
d) uma enzima. e) uma proteína.
[C]
530. O ser vivo acelular que contém como material genético apenas um tipo de ácido nucléico é um
a) protozoário b) vírus c) fungo
d) ácaro e) líquen
[B]
531. Uma molécula de DNA contém 15% de Guanina. Assinale a alternativa que relaciona corretamente as outras bases nitrogenadas e suas respectivas proporções?
a) Citosina = 15%, Adenina = 15% e Timina = 15%
b) Citosina = 35%, Adenina = 15% e Timina = 15%
c) Citosina = 15%, Adenina = 35% e Timina = 15%
d) Citosina = 15%, Adenina = 35% e Timina = 35%
e) Citosina = 15%, Adenina = 15% e Timina = 35%
[D]
532. Uma molécula de DNA contém 16% de Citosina. Assinale a alternativa que relaciona corretamente as outras bases nitrogenad as e suas respectivas proporções?
a) Guanina = 16%, Timina = 16% e Adenina = 16%
b) Guanina = 16%, Timina = 34% e Adenina = 34%
c) Guanina = 34%, Timina = 16% e Adenina = 16%
d) Guanina = 34%, Timina = 34% e Adenina = 16%
e) Guanina = 34%, Timina = 34% e Adenina = 16%
[B]
533. A experiência do "liquidificador" realizada por Hersey e Chase demonstrou que a substância que determinava a destruição de bactérias parasitad as pelos vírus
bacteriófagos era
a) uma proteína viral.
b) uma enzima viral.
c) o RNA viral.
d) o DNA viral.
e) um lípide viral.
[D]
534. É característica do RNA:
a) açúcar com quatro átomos de carbono.
b) presença das bases nitrogenadas uracila, guanina, citosina e adenina.
c) ausência de ácido fosfórico.
d) é polipeptídeo.
e) ocorre nos lisossomos.
[B]
535. Numa molécula de DNA formada por uma dupla-hélice a quantidade de
a) adenina é igual a de citosina.
b) citosina é igual a de timina.
c) adenina é igual a de uracila.
d) citosina é igual a de adenina.
e) guanina é igual a de citosina.
[E]
536. Assinale a alternativa que relaciona as estruturas celulares em se observa a presença de DNA:
a) membrana plasmática, centríolos e lisossomos.
b) centríolos, cromossomos e complexo de Golgi.
c) ribossomos, cromosssomos e lisossomos.
d) centríolos, mitocôndrias e cromossomos.
e) lisossomos, complexo de Golgi e ribossomos
[D]
537. O experimento em que foi observado o fenômeno da "transformação bacteriana", ou seja, que bactérias não patogênicas sem cápsula desenvolvem cápsula e
causam a morte de camundongos foi realizada por
a) Mendel. b) Morgan. c) Griffth.
d) Lamarck. e) Darwin.
[C]
538. O experimento do "liquidificador" serviu para demonstrar que o DNA de certos organismos era capaz de causar a destruição de bactérias. Os organismos que
podem infectar bactérias são
a) fungos. b) vírus. c) algas.
d) ácaros. e) protozoários.
[B]
539. Bacteriófagos são
a) protozoários de vida livre.
b) líquenes parasitas.
c) vermes parasitas.
d) vírus.
e) vermes de vida livre.
[D]
540. A experiência do "liquidificador" realizada por Hersey e Chase em 1952 demonstrou que
a) o material genético é formado por proteínas.
b) o material genético é formado de RNA.
c) o material genético é formado de lipídios.
d) o material genético é formado por açúcares.
e) o material genético é formado de DNA.

70
[E]
541. Pneumococos capsulados são bactérias que causam pneumonia em ratos. A presença de uma cápsula
a) torna essas bactérias capazes de sofrer mutação.
b) torna essas bactérias resistentes ao sistema de defesa dos ratos
c) torna essas bactérias resistentes aos antibióticos convencionais.
d) torna essas bactérias inofensivas para os seres humanos.
e) torna essas bactérias incapazes de sofrer transformação.
[B]
542. Sabemos que os genes são constituídos de DNA e estão localizados nas seguintes estruturas celulares:
a) lisossomos, complexo de Golgi e cromossomos.
b) cloroplastos, cromossomos e mitocôndrias.
c) retículo endoplasmático, ribossomos e centríolos.
d) membrana plasmática, ribossomos e cromossomos.
e) vacúolos, centríolos e cromossomos.
[B]
543. Descreva os principais passos seguidos por Griffth em 1928 no experimento que demonstra a "transformação" de bactérias pneumococos sem cápsula, não
patogênicas, em pneumococos com cápsula patogênicas.
Experimento realizado com bactérias 'Pneumococo pneumoniae' sem cápsula (não patogênicas) e com cápsula (patogênicas).
1º) bactérias pneumococo sem cápsula ë ratos = ratos vivos.
2º) bactérias pneumococo com cápsula ë ratos = ratos mortos.
3º) bactérias pneumococo sem cápsula + bactérias capsuladas mortas pelo calor ë ratos = ratos vivos.
4º) bactérias sem cápsula + extrato de bactérias capsuladas mortas pelo calor ë ratos = ratos mortos.
Conclusão: Existe algum agente transformante no extrato de bactérias capsuladas mortas pelo calor que é capaz de modificar as não capsuladas. Esse agente seria o
Ácido Desoxirribonucléico (DNA).
544. Como que os cientistas O. Avery, M. Mac Leod e M. Mac Carthy chegaram à conclusão em 1944 que o "agente transformante" c apaz de permitir o desenvolvimento
da cápsula em pneumococos não capsulados era o ácido desoxirribonucléico?
Trataram o extrato de bactérias pneumococo capsuladas mortas pelo calor com a enzima desoxirribonuclease. Esta enzima hidroli sa o DNA, destruindo, portanto, o agente
transformante capaz de modificar as bactérias sem cápsula não patogênicas em capsuladas patogênicas e letais para os ratos utilizados nos experiment os.
545. O que são bacteriófagos? Qual sua importância na identificação do DNA como material genético?
Vírus utilizados nos experimentos que serviram para demonstrar que o DNA é de fato o material genético.
546. Descreva o experimento realizado por Hersey e Chase em 1952, conhecido como "experiência do liquidificador" na qual util izaram isótopos radioativos de enxofre
(S35) e de fósforo (P32) para 'marcar' vírus parasitas de bactérias, bem como suas conclusões a partir deste trabalho.
1º) bactérias 'Escherichia coli' cultivadas em meio contendo P 32 e S35 ë bactérias marcadas com os elementos radioativos.
2º) Vírus bacteriofagos parasitam as bactérias marcadas e ficam também marcados com P 32 no DNA e S35 na cápsula protéica.
3º) Vírus marcados parasitam bactérias não marcadas.
4º) Antes da lise bacteriana o preparado é levado ao liquidificador e centrifugado.
5º) O sobrenadadante apresenta as cápsulas protéicas marcadas com S 35 e no precipitado há bactérias contendo DNA marcado com P 32.
Conclusão: O DNA viral é a substância capaz de TRANSFORMAR as bactérias em "fábricas" de novos vírus bacteriofagos. Assim o DNA foi definitivamente identificado
como sendo a substância que controla a hereditariedade.
547. A bactéria 'Pneumococo pneumoniae' pode possuir uma cápsula que lhe permite
a) sofrer mutações.
b) desenvolver flagelos.
c) resistir às defesas dos hospedeiros.
d) ficar imune às defesas dos hospedeiros.
e) sobreviver em ambientes sem água.
[C]
548. As evidências de que o DNA é a substância hereditária que determina as características dos seres vivos foram primeiramente observadas em
a) vírus. b) protozoários. c) ácaros.
d) liquens. e) bactérias.
[E]
549. Os vírus são seres acelulares que possuem como material genético
a) DNA e enzimas. b) RNA e enzimas. c) DNA e RNA.
d) DNA ou RNA. e) somente enzimas
[D]
550. O rei Salomão resolveu uma disputa entre duas mulheres que reclamavam a posse de uma criança. Ao propor dividir a criança ao meio, uma das mulheres desistiu.
O rei então concluiu que aquela que havia desistido era de fato a mãe verdadeira. Nos tribunais modernos, um juiz pode utiliz ar a análise dos grupos sanguíneos e teste
de DNA para ajudar a solucionar questões semelhantes. Analisando uma situação em que uma mulher de sangue A atribuía a paternidade de seu filho de sangue O a
um homem de sangue B, o juiz não pôde chegar a nenhuma decisão conclusiva.
a) Explique por quê.
b) Qual deveria ser o grupo sangüíneo do homem para que a decisão pudesse ser conclusiva?
c) Com base no teste de DNA, o juiz concluiu que o homem era pai da criança. Por que o teste de DNA permite tirar conclusões tão precisas em casos com este?
a) Um homem do grupo sangüíneo B pode ser heterozigoto (Ißi) e, portanto, pai de criança do grupo O (ii).
b) Se o homem fosse do grupo AB, com genótipo I AIB, não poderia ser o pai de criança O (ii).
c) O teste de DNA é capaz de comparar as seqüências de bases nitrogenadas de "pais" e "filhos" com acerto de 99,9%. Se as seqüências forem idênticas o indivíduo
testado certamente é o pai biológico da criança.
551. O antibiótico Estreptomicina age sobre as bactérias promovendo a leitura errada do RNAm, a Tetraciclina liga-se à subunidade ribossômica menor e inibe a ligação
do AA-RNAt, o Cloranfenicol inibe a peptidiltransferase na subunidade ribossômica maior e a Rifampicina inibe a RNA polimerase no s ítio de iniciação. Sabe-se que
esses antibióticos são substâncias cuja utilização médica se baseia na inibição das células bacterianas atuando no mecanismo de:
a) fagocitose.
b) secreção de substâncias.
c) síntese protéica.
d) produção de energia.
e) reprodução celular.
[C]
552. Cientistas conseguiram inserir um grande trecho de ADN estranho ao ADN de cobaias como mostra o desenho a seguir:

71
O resultado esperado para este trabalho é que as células que receberam o implante:
a) morram pela presença de ácido nucléico estranho à composição do núcleo.
b) morram por ficarem prejudicadas na realização da síntese protéica.
c) reproduzam-se, produzindo células defeituosas incapazes de sobreviverem.
d) reproduzam-se, transferindo as características implantadas para as células-filhas.
e) cresçam, produzindo anticorpos contra as proteínas estranhas que serão fabricadas.
[D]
553. A hipótese de que os cloroplastos e as mitocôndrias tenham surgido através de uma associação simbiótica de um eucarioto primitivo com, respectivamente,
bactérias fotossintetizantes e bactérias aeróbicas, é reforçada pelo fato daquelas organelas celulares:
a) serem estruturas equivalentes, com grande superfície interna.
b) apresentarem DNA próprio.
c) estarem envolvidas, respectivamente, na produção e consumo de oxigênio.
d) apresentarem tilacóides e cristas como as bactérias.
e) serem encontradas tanto em organismos superiores como inferiores.
[B]
554. A tabela a seguir relaciona trincas de bases do DNA aos aminoácidos correspondentes.

Assinale a alternativa que apresenta a possível seqüência de códons para a formação do seguinte tetrapeptídeo:
GLU - GLI - FEN - LEU
a) GUU - GGU - UUU - CUC;
b) GAA - GGC - TTT - CTC;
c) CTT - CCG - AAA - AAC;
d) GAA - GGA - UUU - CUC;
e) GUU - GGC - UUU - UUG.
[D]
555. O quadro a seguir contém um segmento de DNA, os códons e os anticódons correspondentes.

Para preenchê-lo corretamente, os algarismos I, II, III e IV devem ser substituídos, respectivamente, por
a) GAC, TAA, AGT e CTG
b) GTC, AUU, UCA e GUC
c) GTC, ATT, TCA e GUC
d) CTG, ATT, TCA e CUG
e) CTG, AUU, UCA e CUG
[E]
556. Ao longo da molécula de DNA, existem quatro tipos de genes que atuam como está demonstrado no esquema a seguir:

72
São esses mecanismos que tornam possível a:
a) diferenciação celular.
b) produção de energia.
c) duplicação de RNA.
d) mutação gênica.
e) lise celular.
[A]
557. Considere um segmento de DNA com seqüência de bases indicadas a seguir:
TTATCGGGACCGATCATCGTA
A alteração mais drástica que esta molécula pode sofrer é a:
a) supressão da segunda base nitrogenada.
b) supressão das três primeiras bases nitrogenadas.
c) substituição da quarta base nitrogenada por outra.
d) substituição das três primeiras bases nitrogenadas por outras.
e) inclusão de mais três bases nitrogenadas no final da molécula.
[A]
558. Uma doença genética de herança dominante é causada por mutações em um gene localizado em um autossomo. Os indivíduos A, B e C têm mutações em um
segmento de DNA desse gene, cuja seqüência normal está representada a seguir.

Usando a tabela que relaciona alguns codons aos respectivos aminoácidos e considerando que a fita molde a ser transcrita é aquela assinalada com a letra m,
responda:
a) Quais serão os segmentos de proteínas produzidos, respectivamente, pelos indivíduos A, B e C?
b) Como será o fenótipo (normal ou afetado dos indivíduos A, B e C? Por quê?
Seqüência normal
CAA AAC TGA GGA ATG CAT TTC (m)
GTT TTG ACT CCT TAC GTA AAG
Indivíduo A
CAA AAC TGA GGA ATT CAT TTC (m)
GTT TTG ACT CCT TAA GTA AAG
Indivíduo B
CAT AAC TGA GGA ATG CAT TTC (m)
GTA TTG ACT CCT TAC GTA AAG
Indivíduo C
CAA TAC TGA GGA ATG CAT TTC (m)
GTT ATG ACT CCT TAC GTA AAG
a) Proteína normal:
Val - Leu - Tre - Pro - Tir - Val - Lis
Indivíduo A: Val - Leu - Tre - Pro
Indivíduo B: Val - Leu - Tre - Pro - Tir - Val - Lis
Indivíduo C: Val - Met - Tre - Pro - Tir - Val - Lis
b) A é afetado porque produz uma proteína menor.
B é normal, apesar da substituição de uma base nitrogenada no seu DNA, porque o código genético é degenerado.
C é afetado porque possui um aminoácido diferente em sua proteína.
559. Na síntese protéica, um processo bastante complexo e fundamental para a sobrevivência das células, a participação dos ác idos nucléicos, substâncias químicas
indispensáveis à vida, está corretamente referida em:
a) O DNA transcreve a mensagem genética para o RNA, que serve de modelo para a formação de uma proteína.
b) O DNA transcreve a mensagem genética para o RNA solúvel, que se liga ao ribossomo, local da síntese protéica.
c) O RNA mensageiro contém trincas de nucleotídeos denominadas códons, responsáveis pela transcrição de uma cadeia polipeptídica.
d) O RNA transportador apresenta na sua molécula uma trinca de nucleotídeos denominada anticódon, local de ligação com o aminoácido que ele transporta.
e) O RNA ribossômico se une a proteínas formando o ribossomo, local onde ocorre a transcrição da mensagem genética.
[A]
560. O estudo do mecanismo da síntese de proteínas no interior das células, confirma que:

73
a) a transcrição gênica caracteriza-se pela autoduplicação do DNA
b) três tipos de RNA participam do processo
c) os anticódons localizam-se no RNA-m
d) os códons são trincas de bases nitrogenadas do RNA-t
e) não há evidências que permitam aceitar que o código genético seja considerado degenerado
[B]
561. Com relação à composição química, as moléculas de DNA e RNA diferem entre si quanto ao tipo de
a) açúcar, apenas.
b) base nitrogenada, apenas.
c) base nitrogenada e de açúcar, apenas.
d) base nitrogenada e de fosfato, apenas.
e) base nitrogenada, de açúcar e de fosfato.
[C]
562. O segmento CGATAGACT de uma fita de DNA, após o processo de transcrição, origina a cadeia
a) GUTATUTGA
b) GCUAUCUGA
c) GCTUTCTGU
d) UCTATCTUA
e) GCTATCTGA
[B]
563. "A nova tecnologia do DNA recombinante está permitindo que cientistas dos países do primeiro mundo desenvolvam um projeto denominado GENOMA que tem por
objetivo seqüenciar os cerca de 3 bilhões de bases nitrogenadas que compõem os cromossomos de um ser humano. Ao lado dos inúmeros benefícios desse projeto,
algumas questões de cunho ético têm sido levantadas."
("Ciência Hoje", março/93)

Em relação a esse projeto, o procedimento que pode afetar diretamente o equilíbrio genético de populações humanas é
a) a detecção de indivíduos superdotados intelectualmente por meio de procedimentos laboratoriais.
b) o aumento de seleção genética ou gamética artificial.
c) o emprego de testes genéticos como um novo critério para admissão a empregos.
d) o registro de patentes de seqüências do genoma humano para especulação mercadológica.
e) o uso de testes pró-sintomáticos para a realização de seguros de vida.
[B]
564. Considere estes dados como hipotéticos.
Um casal apresenta, em seus cromossomos de número 21, pontos de quebra por enzimas especiais, indicados no esquema por setas. Essas resultam em fragmentos
de tamanhos diferentes que podem ser utilizados como marcadores genéticos.
No esquema a seguir, os fragmentos são indicados por Kb (1Kb=1000 pares de bases nitrogenadas).
Esse casal tem uma criança com Síndrome de Down devida à trissomia do cromossomo 21. Os resultados obtidos com o estudo dos m arcadores para o cromossomo 21
do pai, da mãe e da criança estão indicados na figura 2, onde cada traço indica a posição e o tamanho dos fragmentos num campo de eletroforese.

Com base nas informações apresentadas e em conhecimento sobre o assunto responda ao que se pede.
1) Identifique o genitor que transmitiu dois cromossomos 21 à criança. Justifique sua resposta.
2) Determine o estágio da meiose, I ou II, em que ocorreu o fenômeno de não separação ou não-disjunção dos cromossomos. Justifique sua resposta.
3) Suponha que a mulher está novamente grávida e que o exame para marcadores do cromossomo 21, como descrito no tex to, foi realizado para o feto através de
punção do líquido amniótico, amniocentese.
Analise o resultado obtido na figura 3.
Pelos resultados apresentados na figura pressupõe-se que a criança deve ser normal. Entretanto, após o nascimento, constatou-se que a criança apresentava Síndrome
de Down. Com base nessa informação, determine:
O genitor onde ocorreu a não-disjunção.
A fase da meiose em que o fenômeno ocorreu.
1) O Pai porque a criança possui apenas 1 cromossomo 21 materno.
2) Divisão I porque a criança possui 2 cromossomos 21 distintos.
3) A criança herdou um cromossomo 21 duplicado de sua mãe (segmento de DNA maior) e a não disjunção, nesse caso, ocorreu na s egunda divisão da meiose.
565. A análise química de duas moléculas de DNA revelou a seguinte composição de bases:
Molécula A
23% de adenina,
23% de timina,
27% de citosina e
27% de guanina;
Molécula B
23% de adenina,
23% de timina,
27% de citosina e
27% de guanina.
Com base nestes dados:
a) O que se pode afirmar a respeito das semelhanças entre estas duas moléculas de DNA?
b) Justifique sua resposta.

74
A única afirmação possível face aos dados é que as duas moléculas possuem as mesmas proporções de bases nitrogenadas. Somente seriam idênticas se a ordenação
das bases fosse exatamente a mesma nas duas moléculas.
566. OBSERVE:
1. O código genético descreve a relação entre a seqüência de bases nitrogenadas e a seqüência de aminoácidos, na proteína que ele especifica.
2. A seqüência de aminoácidos que forma uma cadeia polipeptídica compreende a estrutura secundária de uma proteína.
3. Três bases nitrogenadas adjacentes codificam um aminoácido e formam um códon.
Está(ão) correta(s):
a) 1, apenas b) 1 e 3, apenas c) 3, apenas
d) 1, 2 e 3 e) 2, apenas
[B]
567. No esquema, os números 1, 2 e 3 substituem, respectivamente:

a) repressão gênica, transcrição, replicação


b) replicação, tradução, transcrição
c) amplificação gênica, repressão, tradução
d) replicação, transcrição, tradução
e) transcrição, replicação, tradução
[D]
568. Na(s) questão(ões) a seguir escreva nos parêntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. As proposições a seguir são relativas ao processo
de síntese de proteínas nas células vivas.
( ) A molécula de DNA transcreve no núcleo uma molécula de RNA mensageiro (RNAm) com várias seqüências de três bases - os códons.
( ) Cada códon do RNA mensageiro determinará a colocação de um aminoácido específico na cadeia polipeptídica.
( ) No local onde houver um ribossomo, pequenas moléculas de RNA transportador (RNAt), ligadas a aminoácidos, unem-se ao RNAm por uma seqüência de três
bases - o anticódon.
( ) O processo de síntese de proteínas ao nível do citoplasma é também conhecido como transcrição genética.
( ) Os diversos aminoácidos unem-se através de ligações do tipo éster, dando formação, ao final da leitura do RNAm, a uma proteína funcional.
VVVFF
569. São feitas as seguintes afirmativas a respeito da síntese protéica. Analise-a e assinale alternativa correta.
I) Um RNAt transporta sempre o mesmo aminoácido.
II) A tradução do código genético do RNAm é feita nos ribossomos localizados no retículo endoplasmático rugoso.
III) O anticódon corresponde a uma trinca de bases localizada numa determinada região de todos os RNAt.
a) Apenas II está correta.
b) Todas estão corretas.
c) Estão corretas apenas I e II.
d) Apenas III está correta.
e) Estão corretas apenas I e III.
[B]
570. A composição das bases púricas adenina e guanina do DNA do homem e do cão, são as seguintes:
Homem:
Adenina = 30,4 %
Guanina = ?
Cão:
Adenina = ?
Guanina = 21,0 %
As percentagens que estão faltando para o homem e cão são, respectivamente:
a) 19,6 e 29,0; b) 21,0 e 30,4; c) 29,0 e 30,4;
d) 19,6 e 21,0; e) 30,4 e 21,0.
[A]
571. O genoma da bactéria "Escherichia coli" tem um tamanho de 4×10 6 pares de nucleotídeos. Já o genoma haplóide humano tem 3×10 9 pares de nucleotídeos. Para
replicar o genoma, antes da divisão celular, existe uma enzima, a DNA polimerase, cuja velocidade de reação é equivalente a cerca de 800 nucleotídeos/s. Assim, para
replicar todo o genoma de uma bactéria, a DNA polimerase consumiria cerca de 83 minutos e, para o genoma humano, aproximadamente 43 dias!
Sabemos, no entanto, que o tempo de geração da "E.coli" é de cerca de 20 minutos, e que o tempo médio de replicação de uma célula eucariota é de 12 horas.
Assumindo que a DNA polimerase apresenta uma velocidade de reação constante para todas as espécies analisadas, explique essa aparente contradição.
Várias moléculas de DNA-polimerase iniciam a replicação do DNA, simultâneamente, em diversos sítios do genoma denominados sítios de origem de replicação.
572. O teste de tipagem de DNA revelou que nos seres humanos existe individualidade genômica. Isto significa que cada indivíduo possui variações discretas e
características na seqüência de seu DNA, ou seja, a seqüência de nucleotídeos do DNA de cada pessoa é única (excetuando-se o caso de gêmeos monozigóticos).
Assim, a tipagem do DNA revela um padrão de bandas que é estável (presente no DNA de todos os tecidos) e é transmitido aos descendentes seguindo as leis de
Mendel.
Graças a essas características é possível atualmente realizar testes de paternidade que comparam os padrões de bandas de DNA das pessoas e revelam se um homem
é de fato o pai biológico de uma outra pessoa.
Suponha agora a seguinte situação: um homem acusado de ser o pai de uma criança tenta burlar o teste de tipagem de DNA; um am igo o aconselha a receber uma
transfusão de sangue 2 meses antes do teste (em geral colhe-se o sangue como fonte de células nucleadas).
a) Qual a influência da transfusão sugerida no resultado no exame?
b) Que precauções podem ser tomadas para desmascarar a tentativa de fraude?

75
a) A influência pode ser crucial pois é analisado o DNA fornecido por células nucleadas, como os glóbulos brancos, que podem viver muitos anos e s e duplicar
ativamente.
b) A fraude pode ser evitada colhendo-se células brancas da medula óssea vermelha do indivíduo a ser testado.
573. A tabela mostra a composição das bases nitrogenadas púricas, adenina e guanina, nos DNAs do homem e do boi.
Adenina Guanina
Homem 30,4% ?
Boi ? 21,0%
As porcentagens que estão faltando para o homem e para o boi são, respectivamente:
a) 19,6 e 29,0
b) 21,0 e 30,4
c) 29,0 e 30,4
d) 19,6 e 21,0
e) 30,4 e 21,0
[A]
574. Na espécie humana há dois tipos de hemoglobina, conhecidas como hemoglobinas A e S, que diferem apenas em um aminoácido:
Hemoglobina A:
...valina-histidina-leucina-treonina-prolina-ácido glutâmico...
Hemoglobina S:
...valina-histidina-leucina-treonina-prolina-x...
Essa pequena diferença é suficiente para determinar que uma pessoa portadora de hemoglobina S sofra de anemia falciforme.
Os códons de RNA-m que codificam esses aminoácidos são:
valina - GUU, GUG, GUC, GUA
histidina - CAU, CAC
leucina - UUG, UUA
treonina - ACU, ACC, ACG, ACA
prolina - CCU, CCC, CCG, CCA
ácido glutâmico - GAG, GAA
A mutação pode ocorrer no ADN como mostra o esquema a seguir:

a) Qual é o aminoácido que aparece, na hemoglobina S, no lugar do ácido glutâmico? Justifique sua resposta.
b) Todas as células, a partir da célula que sofre a mutação, serão anômalas? Justifique sua resposta.
a) Valina porque houve uma substituição (T x A) no codon do DNA correspondente a esse aminoácido.
b) Não porque após a replicação do DNA é semiconservativa.
575. O desenho a seguir mostra a síntese de um polipeptídio a partir da molécula de DNA, num certo organismo. Esse organismo é um procarioto ou um eucarioto? Por
quê?

Procarioto porque não existe a carioteca separando o material genético (DNA) do citoplasma, onde se localizam os ribossomos.
576. Os processos de transcrição e tradução gênicas resultam na síntese, respectivamente, de
a) proteínas e de RNA.
b) RNA e de proteínas.
c) DNA e de proteínas.
d) RNA e de DNA.
e) DNA e de RNA.
[B]
577. Um surfista que se expunha muito ao sol sofreu danos em seu DNA em conseqüência de radiações UV, o que resultou em pequenos tumores na pele. Caso ele
venha a ser pai de uma criança, ela
a) só herdará os tumores se tiver ocorrido dano em um gene dominante.
b) só herdará os tumores se tiver ocorrido dano em dois genes recessivos.
c) só herdará os tumores se for do sexo masculino.
d) herdará os tumores, pois houve dano no material genético.
e) não herdará os tumores.
[E]

76
578. Enzimas de restrição são fundamentais à Engenharia Genética porque permitem
a) a passagem de DNA através da membrana celular.
b) inibir a síntese de RNA a partir de DNA.
c) inibir a síntese de DNA a partir de RNA.
d) cortar DNA onde ocorrem seqüências específicas de bases.
e) modificar seqüências de bases do DNA.
[D]
579. Duas mulheres disputam a maternidade de uma menina. Foi realizada a análise de um mesmo trecho do DNA, obtido de um dos cromossomos X de cada mul her e
da menina. As seqüências de bases do referido trecho gênico estão esquematizadas adiante:

Os dados obtidos
a) são suficientes para excluir a possibilidade de qualquer uma das mulheres ser a mãe da menina.
b) São suficientes para excluir a possibilidade de uma das mulheres ser a mãe da menina.
c) não são suficientes, pois o cromossomo X da menina analisado pode ser o de origem paterna.
d) não são suficientes, pois a menina recebe seus dois cromossomos X da mãe e apenas um deles foi analisado.
e) não podem ser considerados, pois uma menina não recebe cromossomo X de sua mãe.
[C]
580. Considere os seguintes fragmentos de ácidos nucléicos que participam da síntese de uma proteína.

Os espaços 1, 2 e 3 ficariam corretamente preenchidos por:


a) ACA; CUC; GAU
b) TGT; GAG; CAU
c) TCT; GUG; GTA
d) UGU; GAG; CAT
e) TGT; CAC; GUA
[B]
581. A tabela a seguir mostra alguns aminoácidos e as trincas de bases no DNA que os identificam:

Se um RNA mensageiro apresenta a seqüência de bases AUU AGA UGU GUU UUA, a seqüência de aminoácidos no polipeptídeo correspondente será, de acordo com
a tabela anterior:
a) Cis - Val - Leu - Arg - Ile
b) Leu - Val - Cis - Arg - Ile
c) Arg - Ile - Val - Leu - Cis
d) Ile - Arg - Cis - Val - Leu
e) Val - Cis - Arg - Ile – Leu
[D]

582. Num dado organismo, o conteúdo de guanina no seu DNA é 30%. Assinale a alternativa que contém a porcentagem correta de cada uma das demais bases
nitrogenadas.
a) Adenina = 20%, Citosina = 20% e Timina = 30%

77
b) Adenina = 20%, Citosina = 30% e Timina = 20%
c) Adenina = 30%, Citosina = 30% e Timina = 30%
d) Adenina = 30%, Citosina = 40% e Timina = 40%
e) Adenina = 40%, Citosina = 30% e Timina = 40%
[B]
583. Partindo-se do conhecimento do RNA m (CCU GAG), indique, nas opções a seguir, qual a seqüência correta do DNA e do RNA transportador.

[C]
584. O esquema a seguir representa a seqüência de aminoácidos de um trecho de uma proteína e os respectivos anticódons dos RNA transportadores.

Assinale a alternativa que contém a seqüência de códons do RNA mensageiro que participou dessa tradução.
a) UUU CGT TTG UGC GUC
b) UUU CGA AAG UGC GUC
c) TTT CGT TTC TGC GTC
d) TTT CGA AAG TGC GTC
e) CCC TAC CCA CAT ACT
[B]
585. O esquema a seguir representa dois processos observados numa célula eucariótica.

Assinale a alternativa correta.


a) O processo 1 somente é observado no núcleo da célula, sendo inexistente em todas as outras organelas.
b) Para interromper o processo 2, é necessário bloquear o funcionamento de todo o retículo endoplasmático dessa célula.
c) O processo 2 ocorre principalmente no período S da intérfase.
d) Um dos mais importantes locais de ocorrência do processo 1 é o nucléolo.
e) As moléculas produzidas no processo 2 poderão ser utilizadas como catalisadoras, mas nunca serão constituintes de outras organelas.
[D]
586. A composição química de uma proteína pode ser alterada se
a) durante sua síntese houver variação dos tipos de aminoácidos disponíveis no citoplasma.
b) durante sua síntese houver variação dos tipos de RNA transportadores.
c) sua síntese ocorrer no retículo endoplasmático liso e não no rugoso.
d) uma base púrica substituir uma pirimídica no RNA mensageiro que a codifica.
e) O DNA não se duplicar durante a interfase.
[D]
587. Um fragmento de DNA de uma espécie de organismo procarionte apresenta a seguinte seqüência de bases: AATATTCGAGTCTAAAGA. Indique qual a seqüência
de mRNA é transcrito a partir deste segmento DNA::
a) TTATAAGCTCAGATTTCT
b) TTATTAGCTCAGATTTCT
c) UUAUUUGGUCAGAUUUGU
d) UUAUAAGCUCAGAUUUCU
e) AATATTCGAGTCTAAAGA

78
[D]
588. Sobre a síntese de proteínas, são feitas as seguintes afirmações:
I - Um RNA-t (RNA transportador) transporta sempre um determinado aminoácido.
Esse aminoácido, porém, pode ser transportado por vários RNA-t.
II - A tradução do código químico do RNA-m (RNA mensageiro) ocorre nos ribossomas localizados no retículo endoplasmático rugoso.
III - As moléculas de RNA-t apresentam numa determinada região da sua molécula uma trinca de bases denominada anticódon.
Assinale a(s) afirmativa(s) correta(s):
a) Apenas II. b) Apenas III. c) Apenas I e II.
d) Apenas II e III. e) I, II e III.
[E]
589. O diagrama ilustra uma fase da síntese de proteínas.

Os algarismos I, II, III e IV correspondem, respectivamente, a:


a) ribossomo, códon, RNAm e RNAt.
b) RNAt, RNAm, ribossomo e códon.
c) RNAt, RNAm, ribossomo e anticódon.
d) RNAm, RNAt, ribossomo e códon.
e) RNAm, RNAt, ribossomo e anticódon.
[B]
590. Um pesquisador que pretende estudar comparativamente a síntese de DNA e RNA em uma célula deve usar nucleotídios radiativos contendo
a) timina e uracila.
b) guanina e timina.
c) citosina e guanina.
d) adenina e timina.
e) citosina e uracila.
[A]
591. A análise química em amostras de cinco lâminas com ácidos nucléicos apresentou os seguintes resultados:
1ª lâmina: ribose
2ª lâmina: uracila
3ª lâmina: dupla-hélice
4ª lâmina: timina
5ª lâmina: 15% de guanina e 25% de citosina.
a) Entre estas lâminas, quais se referem a DNA?
b) Justifique o resultado obtido com a 5ª lâmina.
a) Contém DNA as lâminas de números 3 e 4.
b) As proporções desiguais de citosina e guanina indicam a presença, na quinta lâmina, de um ácido nucléico formado por uma hélice simples, podendo se DNA ou RNA.
592. Em 1952, Hershey e Chase cultivaram bactérias em meio de cultura contendo fósforo radioativo ( 32P) e colocaram bacteriófagos (vírus) para infectar essas células.
Os novos bacteriófagos formados estavam marcados radioativamente. Estes bacteriófagos marcados foram utilizados para infectar outras células bacterianas cultivadas
sem a presença de fósforo radioativo. A marcação radioativa foi detectada dentro destas bactérias.
a) Como se explica que o fósforo radioativo tenha passado para o bacteriófago?
b) Como se explica que as bactérias cultivadas sem a presença de fósforo radioativo tenham sido marcadas?
c) Se, em vez de fósforo, tivesse sido usado enxofre radioativo ( 35S) para marcação de proteínas, os resultados seriam os mesmos? Justifique.
a) Os bacteriófagos utilizam nucleotídeos que contém 32P da bactéria para construir seu material genético (DNA).
b) Os bacteriófagos injetam seu DNA com 32P no interior da bactéria hospedeira, deixando-a marcada com radioatividade.
c) Não. Os vírus não injetam sua capa protéica na célula bacteriana. O 35S radioativo entra na composição de proteínas e não no DNA introduzido pelo vírus.
593. Depois da descoberta da estrutura da molécula do Ácido Desoxirribonucléico (DNA ou ADN), novos métodos de diagnóstico foram desenvolvidos e utilizados para
inúmeros fins (identificação de microrganismos patogênicos, testes de paternidade, mapa genético, medicina forense, entre outros)
Assinale a afirmação correta.
a) A molécula de DNA é constituída por uma fita única e por vários nucleotídeos que têm a transcrição como principal função.
b) A molécula de DNA nas bactérias se encontra na carioteca da célula.
c) A molécula de DNA não é capaz de produzir a molécula de RNA.
d) A molécula de DNA tem função de duplicação e é constituída por uma fita dupla, sendo que cada filamento é composto por vários nucleotídeos.
e) A molécula de DNA, nos organismos eucariontes, não se encontra no núcleo da célula.
[D]
594. Considere as seguintes afirmativas:
I - As proteínas são moléculas de grande importância para os organismos - atuam tanto estruturalmente como também metabolicamente.
II - As enzimas são proteínas que atuam como catalisadores biológicos.
III - Existem proteínas que atuam como linhas de defesa do organismo e algumas delas são conhecidas como anticorpos.
Quais estão corretas?
a) Apenas I b) Apenas II c) Apenas III
d) Apenas II e III e) I, II, III
[E]
595. O esquema a seguir mostra a via metabólica de um aminoácido, levando à formação de alguns hormônios:

79
A respeito deste esquema são feitas as seguintes afirmações:
I - Um indivíduo com a enzima 1 inibida acumulará grandes quantidades de aminoácido 3.
II - Um indivíduo com a enzima 1 inibida deixa de produzir as enzimas 2 e 3.
III - Um indivíduo com a enzima 1 inibida precisa receber os hormônios 1 e 2 de fontes externas.
Quais estão corretas?
a) Apenas I.
b) Apenas II.
c) Apenas III.
d) Apenas I e II.
e) Apenas II e III.
[C]
596. Algumas células apresentam material nuclear bastante desespiralizado e metabolismo muito alto. Essas características podem indicar:
a) pouca atividade do DNA e, como conseqüência, pouco desenvolvimento das organelas celulares.
b) intensa tradução, exigindo a presença de grande desenvolvimento de retículo endoplasmático liso.
c) intensa transcrição e tradução, exigindo a presença de retículo endoplasmático rugoso muito desenvolvido.
d) intensa duplicação do material genético, demonstrando alta taxa de divisão celular e organelas pouco desenvolvidas.
e) intensa transcrição, exigindo grande desenvolvimento do complexo de Golgi, responsável pela tradução.
[C]
597. Considere as seguintes etapas da síntese de proteínas.
I - Transcrição do código genético do DNA em códons do RNA mensageiro.
II - Ligação dos códons de RNA mensageiro aos anticódons correspondentes dos RNAs transportadores.
III - Fixação do RNA mensageiro aos ribossomos.
Qual a seqüência correta dessas etapas durante o processo?
a) I - II - III. b) I - III - II. c) II - III - I.
d) III - II – I e) III - I - II.
[B]
598. Com relação ao código genético, foram feitas as seguintes afirmações:
I. Cada trinca de bases nitrogenadas de uma cadeia do DNA corresponde a um aminoácido.
II. O RNA ribossômico contém as informações para as proteínas que devem ser sintetizadas.
III. O RNA mensageiro, de acordo com o anticódon que possui, liga-se a um aminoácido específico.
IV. Diversos aminoácidos são codificados por mais de uma trinca de nucleotídios.
São verdadeiras APENAS as afirmações
a) I e II b) I e IV c) II e III
d) II e IV e) I, III e IV
[B]
599. Sobre o código genético são feitas as seguintes afirmações:
I - pode existir mais de um códon para determinar um mesmo aminoácido;
II - em todos os seres vivos os códons que codificam um respectivo aminoácido são os mesmos;
III - a tradução da seqüência de bases do RNA para a proteína é feita, a nível citoplasmático, nos ribossomos.
Está(ão) correta(s) afirmativa(s):
a) II apenas.
b) III apenas.
c) I e II apenas.
d) I, II e III.
e) I e III apenas.
[D]
600. O metabolismo celular é controlado por uma série de reações em que estão envolvidas inúmeras proteínas. Uma mutação gêni ca pode determinar a alteração ou a
ausência de algumas dessas proteínas, levando a mudanças no ciclo de vida da célula.
a) Explique a relação que existe entre gene e proteína.
b) Por que podem ocorrer alterações nas proteínas quando o gene sofre mutação?
c) Em que situação uma mutação não altera a molécula protéica?
a) Gene é um segmento do DNA localizado nos cromossomos. Possui um código químico representado por seqüências de bases nitrogenadas (adenina, guanina,
citosina e timina). Cada trinca de bases é capaz de codificar um aminoácido de uma proteína. A seqüência de trincas determinará a seqüência dos aminoácidos de um
polipeptídeo.
b) Mutações são modificações na seqüência ou na composição das bases do DNA (gene) que podem causar a produção de uma proteín a alterada, ou mesmo a não
produção da proteína.
c) A substituição de uma base nitrogenada no DNA pode não causar nenhuma alteração na proteína produzida pela célula porque o código genético é degenerado, ou
seja, um mesmo aminoácido pode ser codificado por diferentes trincas de bases.
601. Em se tratando do processo de síntese de proteínas, é certo afirmar:
a) os aminoácidos que estão no citoplasma são selecionados pelo RNAm
b) todo o processo da síntese de uma proteína ocorre exclusivamente no núcleo da célula
c) o RNAm controla a síntese de uma proteína, mas a síntese dele próprio é controle do DNA
d) o RNAt é responsável pela etapa de transcrição no processo de síntese de uma proteína
[C]

80
602. A análise do esquema abaixo nos permite afirmar que:

I - os ribossomas alinhados nessa molécula de RNA traduzirão os mesmos códons;


II - durante o processo a proteína formada depende, em última análise, de uma molécula de DNA;
III - qualquer proteína formada será conseqüência direta de uma transcrição do RNA.
A(s) afirmativa(s) correta(s) é(são):
a) I apenas. b) I e II apenas. c) I e III apenas.
d) II e III apenas. e) I, II e III.
[B]
603. "EXAME DE PATERNIDADE, NO BRASIL, JÁ PODE SER FEITO COM SALIVA"
"Novo teste pode, pela análise do DNA das células, identificar a paternidade de uma pessoa sem a necessidade de coleta de sangue. Esse tipo de teste é
particularmente indicado para bebês e crianças pequenas."
(O GLOBO, 20/08/98)
Nesse tipo de teste, a semelhança estrutural existente entre as moléculas de DNA é tomada por base para a identificação da paternidade. Essa diferença consiste na(o):
a) seqüência de bases nitrogenadas.
b) aspecto da dupla hélice presente.
c) número de fosfatos contidos.
d) tipo de pentose existente.
e) tipo de desoxirriboses presentes.
[A]
604. Uma substância tóxica que interfira com a síntese de proteínas afetará, em primeiro lugar, a função exercida
a) pelo núcleo. b) pelos ribossomos.
c) pelas mitocôndrias. d) pela membrana celular.
e) pelos centríolos.
[B]
605. Considere os seguintes códons do RNA mensageiro e os aminoácidos por eles especificados:
ACA = treonina
GUU = valina
Assinale a alternativa da tabela a seguir que indica corretamente os anticódons do RNAt e os códons do DNA relacionados com esses aminoácidos.

[C]
606. O ADN é um polímero constituído por vários nucleotídeos e as proteínas são polímeros constituídos por vários aminoácidos. Um gene é constituído por um número
N de nucleotídeos que codifica uma proteína constituída por P aminoácidos.
Por que sempre encontramos N > P ?
Com a descoberta do código genético sabe-se que um aminoácido é sempre codificado por três nucleotídeos, logo o gene que codifica uma proteína tem sempre maior
número de nucleotídeos que de aminoácidos. Sabe-se ainda que existem vários nucleotídeos do gene que servem para a função de regulação e não são transcritos.
607. O gráfico a seguir mostra as alterações no conteúdo de ADN durante o ciclo de vida da maioria das células:

81
Considerando que no tecido nervoso dos adultos não há reprodução celular, construa o gráfico que representa a quantidade de A DN no ciclo celular dessas células.
Justifique sua resposta.
Não havendo reprodução celular nos neurônios não ocorre duplicação do ADN; não havendo portanto a fase S da duplicação do ADN: como conseqüência, também não
existirão as fases G2 e M.

608. Em um organismo pluricelular com vários tecidos, como no caso dos seres humanos, todas as células possuem um genoma idêntico.
Analogamente, é correto afirmar que os ARN mensageiros (ARNm) dos diferentes tecidos são todos idênticos? Justifique sua resp osta
Não. Os tecidos de um mesmo organismo diferenciam-se pelas diferentes proteínas que contêm. Assim, a diferenciação dos tecidos resulta principalmente da transcrição
de genes diferentes, o que naturalmente produz uma composição de RNAm qualitativamente diferente de tecido p ara tecido.
609. A síntese protéica envolve um complexo de estruturas celulares que trabalham harmonicamente, como mostra o esquema adiante.

Com base no esquema e em conhecimentos correlatos, julgue os itens a seguir.


(0) O esquema mostra a síntese protéica em uma célula procariótica.
(1) Os tipos de RNA necessários para a síntese protéica em procariotos e eucariotos são essencialmente diferentes.
(2) Na expressão de um gene eucariótico, a transcrição e a tradução ocorrem simultaneamente.
(3) Uma molécula de RNAm pode ser utilizada para a síntese concomitante de várias moléculas da proteína.
Item correto: 3
Itens errados: 0, 1 e 2
610. Um trecho de fita de DNA com a sequência... TACACCTCTCGT... é responsável pela incorporação respectiva dos seguintes am inoácidos: metionina, triptofano,
arginina e alanina. Considerando as informações apresentadas, julgue os itens que se seguem.
(1) Os códons do mRNA, para os aminoácidos mencionados, são, respectivamente, UAC ACC UCU CGU.
(2) A molécula de DNA referente ao trecho apresentado tem 20% de adenina.
(3) A perda de um nucleotídeo do DNA implicará a alteração dos aminoácidos da cadeia polipeptídica.
(4) A fumaça do cigarro, os raios X e a luz ultravioleta podem produzir mutações na molécula de DNA.
EECC
611. Enquanto o projeto que visa seqüenciar completamente o genoma humano segue seu curso, nos últimos 2 anos chegaram ao fim vários seqüenciamentos do
genoma de bactérias. Em setembro de 1997, foi publicada a sequência do DNA da bactéria 'Escherichia coli.' Os números impressionam: são cerca de 4,6 milhões de
pares de bases, e os genes que codificam proteínas são 4.288. Para surpresa de muitos, 38% desses genes ainda não têm uma função conhecida.
Com o auxílio do texto, julgue os itens a seguir.
(1) O DNA da bactéria 'Escherichia coli' tem cerca de 9,2 milhões de moléculas de fosfato.
(2) Para 38% dos genes, não se sabe a sequência de amionoácidos da proteína.
(3) Pode-se fazer estudos da evolução das bactérias, comparando-se a sequência de DNA de diferentes espécies.
(4) A 'Escherichia coli' pode produzir 8.576 RNAs mensageiros diferentes.
CECE
612. Bactérias foram cultivadas em um meio nutritivo contendo timina radioativa, por centenas de gerações. Dessa cultura, for am isoladas 100 bactérias e transferidas
para um meio sem substâncias radioativas. Essas bactérias sofreram três divisões no novo meio, produzindo 800 bactérias. A análise dos ácidos nucléicos mostrou que
dessas 800 bactérias
a) 100 apresentavam o DNA marcado, mas não o RNA.
b) 200 apresentavam o DNA marcado, mas não o RNA.
c) 400 apresentavam o DNA marcado, mas não o RNA.
d) 200 apresentavam o DNA e o RNA marcados.
e) todas apresentavam o DNA e o RNA marcados.
[B]
613. Existe um número muito grande de substâncias com funções antibióticas. Essas substâncias diferem quanto à maneira pela qual interferem no metabolismo celular.
Assim, a TETRACICLINA liga-se aos ribossomos e impede a ligação do RNA transportador; a MITOMICINA inibe a ação da polimerase do DNA e a ESTREPTOMICINA
causa erros na leitura dos códons do RNA mensageiro. Essas informações permitem afirmar que
I - a TETRACICLINA impede a transcrição e leva a célula bacteriana à morte por falta de RNA mensageiro.
II - a MITOMICINA, por inibir a duplicação do DNA, impede a multiplicação da célula bacteriana.
III - a ESTREPTOMICINA interfere na tradução e leva a célula bacteriana a produzir proteínas defeituosas.
Assinale a alternativa que reúne as afirmações corretas.
a) apenas I é correta.
b) apenas I e II são corretas.

82
c) apenas II e III são corretas.
d) apenas I e III são corretas.
e) I, II e III são corretas.
[C]
614. O esquema a seguir representa a síntese protéica.

Analise o esquema e julgue os itens a seguir.


(0) Ao final da síntese, todas as proteínas representadas no esquema serão iguais.
(1) Os ribossomos estão se movendo da parte de baixo para a de cima do esquema.
(2) No esquema, não está representado o RNA transportador, que também participa do processo.
(3) O conjunto representado pode estar localizado no retículo endoplasmático rugoso.
(4) O número de aminoácidos da proteína dependerá do tamanho do RNA mensageiro.
Itens corretos: 0, 2, 3 e 4
Item errado: 1
615. CÉLULAS IMORTAIS CONTAM AOS CIENTISTAS HISTÓRIA DA EVOLUÇÃO DA HUMANIDADE
Estas células formam um livro, conservado em tanques de nitrogênio líquido que guarda informações desconhecidas sobre a humanidade. Os c apítulos contam
diferentes detalhes da saga do homem na terra: suas andanças pelos continentes, casamentos ancestrais e os ataques de doenças.
(adaptado de, "O Globo")
a) Explique por que o processo de autoduplicação do DNA dá significado à hereditariedade permitindo revelar a história da evolução da humanidade.
b) "... suas andanças pelos continentes, casamentos ancestrais e os ataques de doenças" podem ser estudados através de observações de características morfológicas
e fisiológicas da célula.
Nomeie o processo através do qual o DNA é capaz de controlar e interferir nas características morfológicas e fisiológicas da célula.
a) O DNA produz cópias idênticas de si mesmo.
b) Síntese protéica.
616. Com o auxílio da tabela do código genético representada a seguir, é sempre possível deduzir-se a seqüência de aminoácidos de uma proteína a partir da seqüência
de nucleotídeos do seu gene, ou do RNA-m correspondentes.

Entretanto, o oposto não é verdadeiro, isto é, a partir da seqüência de aminoácidos de uma proteína, não se pode deduzir a se qüência de nucleotídeos do gene.
Explique por quê.
Porque o código genético é degenerado, isto é, para um mesmo aminoácido existem vários códons diferentes.
617. A tipagem de DNA é uma técnica desenvolvida recentemente que permite identificar e estabelecer o grau de parentesco entr e indivíduos.
Para se realizar uma análise patrilínea, isto é, a investigação dos ancestrais paternos, usa-se um marcador do cromossomo Y, que não se altera ao longo das gerações
(salvo em casos de mutações).
Por outro lado, para uma análise matrilínea (materna), lança-se mão do DNA mitocondrial.
Por que o DNA mitocondrial deve ser usado para a análise matrilínea?
Durante a fertilização, somente o DNA nuclear do espermatozóide penetra no óvulo. Por esse motivo, o DNA mitocondrial do zigoto é necessariamente materno.
618. O esquema resume parcialmente as relações funcionais dos ácidos nucleicos que ocorrem na maioria das células vivas.

Considerando-se apenas células eucariontes, as etapas que representam, respectivamente, transcrição, duplicação e tradução são:
a) I, II e III. b) I, III e II. c) II, I e III.

83
d) III, I e II. e) II, III e I.
[A]
619. Os itens a seguir referem-se à estrutura, composição e função dos ácidos nucléicos.
- Estrutura:
I. dupla hélice
II. cadeia simples
- Composição:
1. presença de uracila
2. presença de timina
- Função:
a. síntese de proteínas
b. transcrição gênica
São características do ácido ribonucléico
a) I - 1 – a b) I - 2 – b c) II - 1 - a
d) II - 1 – b e) II - 2 – b
[C]
620. O esquema a seguir mostra um tipo de ciclo reprodutivo dos bacteriófagos.

De acordo com o esquema, verifica-se que


a) ocorre lise da bactéria no fim do ciclo.
b) o DNA viral se incorpora ao cromossomo bacteriano.
c) o DNA viral é destruído pela bactéria.
d) as bactérias perdem a capacidade de se dividir.
e) há grande multiplicação do DNA viral no interior da bactéria.
[B]
621. Meselson e Stahl, em 1957, fizeram um experimento sobre a replicação do DNA. Nesse experimento, a bactéria 'Escherichia coli' foi cultivada, por muitas gerações,
em meio contendo um isótopo pesado de nitrogênio, 15N, até todo o seu DNA estar marcado com esse isótopo. Depois disso, as bactérias foram transferidas para um
meio contendo nitrogênio leve, 14N. As moléculas de DNA das bactérias foram então isoladas e analisadas com relação ao seu conteúdo de 15N e de 14N, sendo
observado o seguinte:

Com relação a esses dados, podemos concluir que


a) a replicação do DNA é semiconservativa.
b) a replicação do DNA é conservativa.
c) a replicação do DNA é randômica.
d) não ocorreu replicação do DNA mas, sim, uma mutação.
e) não ocorreu replicação do DNA mas, sim, transcrição.
[A]
622. Sabendo que o DNA dos vírus bacteriófagos contém fósforo e que a cápsula protéica contém enxofre, Hersey e Chase, em 1952, cultivaram vírus em meio
contendo isótopos de fósforo (32P) e de enxofre (35S). Esses pesquisadores observaram, ao introduzir os vírus marcados em meio contendo bactérias, que os isótopos
de fósforo (32P) apareciam no interior das bactérias e que os isótopos de enxofre ( 35S) permaneciam fora das células. Observaram também que, após lavarem a
superfície das bactérias, retirando o enxofre ( 35S), continuava ocorrendo a replicação dos vírus. Com esse experimento, eles puderam concluir que
a) a informação genética necessária para a síntese de novos vírus está contida no DNA viral.
b) as capas protéicas dos vírus contêm parte importante da informação genética necessária à síntese de novos vírus.
c) o DNA viral precisa estar associado integralmente às capas protéicas para poder se replicar no interior das bactérias.
d) a capa protéica protege o DNA viral da ação de endonucleases no interior do organismo hospedeiro.
e) os vírus bacteriófagos contêm DNA como material genético, e essa molécula é muito rica em enxofre.
[A]
623. Considere a rota metabólica que produz o aminoácido arginina na figura adiante.

84
Em um experimento, três linhagens de bactérias foram irradiadas com Raios X, que causaram mutações nos genes envolvidos na rota metabólica acima representada.
Para descobrir quais enzimas da rota metabólica foram afetadas, as três linhagens foram cultivadas em meios suplementados com ornitina, citrulina e arginina, obtendo-
se o resultado mostrado na tabela acima:
Sobre esse experimento, podemos afirmar que
a) o gene que codifica a enzima 1 na linhagem I foi afetado.
b) o gene que codifica a enzima 2 na linhagem I foi afetado.
c) o gene que codifica a enzima 3 na linhagem II foi afetado.
d) o gene que codifica a enzima 1 na linhagem II foi afetado.
e) o gene que codifica a enzima 3 na linhagem III foi afetado.
[E]
624. Suponha um gene de um eucarioto responsável pela síntese de uma proteína. Nesse gene existem íntrons, ou seja, regiões do ADN cujas informações não estão
presentes na proteína em questão.
As regiões do ARN transcrito correspondentes aos íntrons são eliminadas após o processo de transcrição.
A figura a seguir representa o resultado de uma experiência de hibridação do ARN mensageiro com a cadeia de ADN que lhe deu origem.

A figura mostra cinco regiões, identificadas por números de 1 a 5.


Quais dessas regiões correspondem aos íntrons?
Justifique sua resposta.
As regiões 2 e 4. Essas regiões formam alças justamente por não possuírem as seqüências de nucleotídeos complementares, que f oram eliminadas após o processo de
transcrição.
625. TESTES GENÉTICOS: A Ciência se antecipa à doença
Com o avanço no mapeamento de 100 mil genes dos 23 pares de cromossomos do núcleo da célula (projeto Genoma, iniciado em 1990, nos EUA), já é possível
detectar por meio de exames de DNA (ácido desoxirribonucleico) a probabilidade de uma pessoa desenvolver doenças (...).
(O GLOBO, 10/08/97)
Sabe-se que o citado mapeamento é feito a partir do conhecimento da seqüência de bases do DNA.
O esquema abaixo que representa o pareamento típicos de bases encontradas na molécula de DNA, é:

[A]
626. O gráfico a seguir demonstra a distribuição citoplasmática do número de ribossomos isolados e polirribossomas, em compar ação com o número de cadeias
polipeptídicas em formação durante um certo período de tempo.

85
(Adaptado de ALBERTS, Bruce & outros. "Molecular biology of the cell". New York, Garland Publishing, 1994, p.239)
a) Defina a relação existente entre os ribossomas isolados e a formação das cadeias polipeptídicas. Justifique sua resposta.
b) Descreva a estrutura das cadeias polipeptídicas e a dos polirribossomas.
a) Em ribossomos isolados não há síntese de cadeias polipeptídicas. O RNA mensageiro é necessário pois transmite a mensagem g enética para a síntese dos
polipeptídeos.
b) Polipeptídeos são formados a partir do encadeamento de aminoácidos. Polirribossomos são constituídos de ribossomos ligados ao RNA mensageiro.
627. Um pesquisador injetou RNA mensageiro (mRNA) de vírus em ovócitos de anfíbios. Após certo tempo, verificou que esses ovócitos, além de suas próprias
proteínas, produziam, também, proteínas virais.
Esses dados sugerem que
a) o DNA dos ovócitos foi impedido de se expressar.
b) o mRNA se integrou ao DNA dos ovócitos, comandando a síntese da proteína viral.
c) o material injetado nos ovócitos foi capaz de se autoduplicar.
d) os ovócitos foram capazes de interpretar a informação contida no mRNA viral.
[D]
628. O assunto na aula de Biologia era a evolução do Homem. Foi apresentada aos alunos uma árvore filogenética, igual à mostr ada na ilustração, que relacionava
primatas atuais e seus ancestrais.
Legenda da ilustração:
1 - Símios do Novo Mundo
2 - Símios do Velho Mundo
3 - Gibão
4 - Orangotango
5 - Gorila
6 - Chimpanzé
7 - Homem
I - Hilobatídeos
II - Pongídeos
III - Hominídeos

"Árvore filogenética provável dos antropóides"


Foram feitas comparações entre DNA e proteínas da espécie humana com DNA e proteínas de diversos primatas. Observando a árvor e filogenética, você espera que os
dados bioquímicos tenham apontado, entre os primatas atuais, como nosso parente mais próximo o:
a) Australopithecus.
b) Chimpanzé.
c) Ramapithecus.
d) Gorila.
e) Orangotango.
[B]
629. João ficou intrigado com a grande quantidade de notícias envolvendo DNA: clonagem da ovelha Dolly, terapia gênica, testes de paternidade, engenharia genética,
etc. Para conseguir entender as notícias, estudou a estrutura da molécula de DNA e seu funcionamento e analisou os dados do q uadro a seguir.

86
Analisando-se o DNA de um animal, detectou-se que 40% de suas bases nitrogenadas eram constituídas por Adenina. Relacionando esse valor com o emparelhamento
específico das bases, os valores encontrados para as outras bases nitrogenadas foram:
a) T = 40%; C = 20%; G = 40%
b) T = 10%; C = 10%; G = 40%
c) T = 10%; C = 40%; G = 10%
d) T = 40%; C = 10%; G = 10%
e) T = 40%; C = 60%; G = 60%
[D]
630. João ficou intrigado com a grande quantidade de notícias envolvendo DNA: clonagem da ovelha Dolly, terapia gênica, testes de paternidade, engenharia genética,
etc. Para conseguir entender as notícias, estudou a estrutura da molécula de DNA e seu funcionamento e analisou os dados do quadro a seguir.

Em I está representado o trecho de uma molécula de DNA. Observando o quadro, pode-se concluir que:
a) a molécula de DNA é formada por 2 cadeias caracterizadas por seqüências de bases nitrogenadas.
b) na molécula de DNA, podem existir diferentes tipos de complementação de bases nitrogenadas.
c) a quantidade de A presente em uma das cadeias é exatamente igual à quantidade de A da cadeia complementar.
d) na molécula de DNA, podem existir 5 diferentes tipos de bases nitrogenadas.
e) no processo de mitose, cada molécula de DNA dá origem a 4 moléculas de DNA exatamente iguais.
[A]
631. Uma molécula de DNA apresenta uma dupla hélice de cadeias polinucleotídicas. Nela identificamos 20% de adenina.
Assinale a alternativa correta em relação à porcentagem de guanina.
a) 20% b) 30% c) 40% d) 50% e) 60%
[B]
632. Gerações sucessivas de bactérias da espécie 'Escherichia coli' foram cultivadas num meio cuja única fonte de nitrogênio era o isótopo 15N, o qual se incorporou nas
moléculas de DNA. Posteriormente, essas bactérias foram transferidas para um novo meio, onde existia o 14N como única forma de nitrogênio.
Em relação ao experimento, pode-se prever que, nesse novo meio,
a) ao final da 1ª geração, serão formadas moléculas de DNA apenas com 15N e moléculas apenas com 14N.
b) ao término da 1ª geração, todas as moléculas de DNA apresentarão apenas 14N incorporado.
c) ao término da 2ª geração, cerca de 1/4 do DNA será híbrido, sendo o restante não-híbrido.
d) ao final da 2ª geração, cada molécula híbrida de DNA formará duas moléculas, sendo uma híbrida e outra não.
[D]
633. Células vegetais, depois de mantidas em meio de cultura contendo uracila marcada, foram fixadas e submetidas à autoradiografia, para comprovar os locais que
possuíam esse material. É correto prever que, no citoplasma, encontre-se uracila radioativa SOMENTE nos
a) nucléolos.
b) ribossomos.
c) nucléolos e nas mitocôndrias.
d) ribossomos e nos cloroplastos.
e) ribossomos, nos cloroplastos e nas mitocôndrias.
[E]
634. Considere o seguinte segmento de uma cadeia de DNA e o polipeptídio sintetizado a partir dele:
ATA - GCA - GTG - ACA - CCT
TIROSINA - ARGININA - HISTIDINA - CISTEÍNA - GLICINA
Após a substituição de uma única base nitrogenada no segmento de DNA, o polipeptídio sintetizado passou a apresentar duas argininas.
A seqüência de trincas no RNA mensageiro que pode ter codificado esse polipeptídio alterado é
a) CUC - TGC - TGC - CGC - GGU
b) TUT - CGT - CGT - TGT - GGU
c) CGT - CGT - CAC - TGT - GGA
d) UAU - CTU - CAC - CTU - TTA
e) UAU - CGU - CAC - CGU – GGA
[E]
635. Os cromossomos são constituídos principalmente por:
a) fosfolipídeos.
b) proteínas.

87
c) ácido ribonucléico.
d) enzimas.
e) ácido desoxirribonucléico.
[E]
636. Em células eucariotas mantidas em cultura, adicionou-se o nucleosídeo uridina marcado radioativamente com H 3 ao meio de cultura. Após algum tempo, as células
foram transferidas para um novo meio que não continha o isótopo. Amostras destas células foram retiradas 3, 15 e 90 minutos após a transferência, sendo, então,
colocadas em lâmina de vidro, fixadas e submetidas a auto-radiografia. Esse processo marca a posição aproximada do isótopo dentro da célula, como representado no
esquema a seguir.

a) Cite o tipo de molécula à qual a uridina se incorporou. Justifique sua resposta.


b) Nomeie o compartimento celular que seria marcado, se o nucleosídeo radioativo usado fosse a timidina e justifique sua resposta.
a) Tipo de molécula: ácido ribonucléico (RNA)
Justificativa: a uridina se incorpora ao ácido ribonucléico. Este ácido é principalmente sintetizado no nucléolo, deslocando-se posteriormente para o citoplasma.
b) Compartimento: núcleo
Justificativa: a timidina é exclusiva do DNA, encontrado principalmente no núcleo.
637. A mutação em um gene humano provoca cegueira. Com a utilização de técnicas de genética clássica e molecular, verificou-se que este gene está localizado no
genoma mitocondrial. Sabe-se que todas as mitocôndrias dos indivíduos afetados pela cegueira não possuem o gene normal, mas sim o gene mutado.
a) Informe a percentagem de filhas e filhos cegos de um casal:
I) cuja mulher é normal e o homem é cego;
II) cuja mulher é cega e o homem é normal.
b) Justifique as respostas ao item a.
a)
I) filhas: 0%
filhos: 0%
II) filhas: 100%
filhos: 100%
b) Em seres humanos, a herança do genoma mitocondrial é, exclusivamente, materna, pois as mitocôndrias do espermatozóide não penetram no óvulo. Portanto, o pai
não transmitirá esta característica (cegueira) para a sua prole. Por outro lado, no caso de a mãe ser afetada (cega), esta característica será transmitida para todos os seus
filhos.
638. Considerando as propriedades de duplicação do DNA, observe o resultado do experimento a seguir.

1ª etapa: Em uma cultura com 15N, obtém-se o crescimento de colônias de bactérias, após esse crescimento promove-se o desenvolvimento de mais duas gerações, em
cultura com 14N.
2ª etapa: Extrai-se o DNA de todas as bactérias e obtém-se o seguinte resultado:
- Cultura de crescimento com 15N: 300 moléculas de DNA todas com 15N.
- Cultura de 1ª geração com 14N: 600 moléculas de DNA todas com 15N e 14N.
- Cultura de 2ª geração com 14N: 1200 moléculas de DNA nas quais 600 com 14N e 600 com 15N e 14N.
Explique as porcentagens obtidas em todos os extratos das diferentes culturas no experimento.
Justifique sua resposta.
Cultura de crescimento 15N ë 100% de moléculas de DNA com 15N.
Cultura de 1ª geração ë 100% de moléculas, cada uma com parte da hélice do DNA com 15N e parte com 14N.
Cultura de 2ª geração ë 50% de moléculas com 14N e 50% com 14N - 15N.
A justificativa se baseia na propriedade semi-conservativa da duplicação do DNA.
639. Em um segmento de cadeia ativa de DNA há 20 adeninas e 15 guaninas; no segmento correspondente da cadeia complementar há 10 adeninas e 30 guaninas.
Com base nesses dados, conclui-se que nos segmentos de RNA originários desse DNA haverá
a) 30 citosinas. b) 20 timinas. c) 15 guaninas.
d) 10 uracilas. e) 10 adeninas.
[E]
640. A tabela apresenta o código genético, com os códons e os aminoácidos correspondentes.

88
phe = FENILALANINA; leu = LEUCINA;
ileu = ISOLEUCINA; met = METIONINA;
val = VALINA; ser = SERINA; pro = PROLINA;
thr = TREONINA; ala = ALANINA;
tyr = TIROSINA; his = HISTIDINA;
glu = GLUTAMINA; asn = ASPARAGINA;
lys = LISINA; asp = ASPARTATO;
cys = CISTEÍNA; trp = TRIPTOFANO;
arg = ARGININA; gly = GLICINA
LOPES, Sônia. Bio Volume Único. São Paulo: Saraiva, 1996.
Utilizando a tabela, determine a seqüência de aminoácidos que corresponde à seqüência de DNA
TAC TGA TTG CTA
a) metionina - treonina - asparagina - aspartato
b) metionina - glutamina - histidina - glicina
c) glutamina - treonina - aspartato - arginina
d) glutamina - histidina - glicina - arginina
e) glicina - cisteína - glutamina – treonina
[A]
641. Os códons UGC, UAU, GCC e AGC codificam, respectivamente os aminoácidos cisteína, tirosina, alanina e serina; o códon UA G é terminal, ou seja, indica a
interrupção da tradução. Um fragmento de DNA, que codifica a seqüência serina - cisteína - tirosina - alanina, sofreu a perda da 9ª base nitrogenada. Assinale a
alternativa que descreve o que acontecerá com a seqüência de aminoácidos.
a) O aminoácido tirosina será substituído por outro aminoácido.
b) O aminoácido tirosina não será traduzido, resultando numa molécula com 3 aminoácidos.
c) A seqüência não será traduzida, pois essa molécula de DNA alterada não é capaz de comandar esse processo.
d) A tradução será interrompida no 2º aminoácido.
e) A seqüência não sofrerá prejuízo, pois qualquer modificação na fita de DNA é imediatamente corrigida.
[D]
642. O aminoácido leucina pode ser codificado por mais de uma trinca de nucleotídios do DNA (AAT, GAA e outras). Assim sendo, podemos dizer que
I - o código genético é degenerado, o que significa que um aminoácido pode ser codificado por mais de uma trinca.
II - um aminoácido pode ser codificado por apenas uma trinca de nucleotídios de DNA.
III - assim como a leucina pode ser codificada por diferentes trincas, uma determinada trinca também pode codificar diferentes aminoácidos.
Estão corretas afirmativas:
a) apenas III. b) apenas II. c) apenas I.
d) I e III. ) nenhuma delas.
[C]
643. Uma substância X é o produto final de uma via metabólica controlada pelo mecanismo de retro-inibição (feed-back) em que, acima de uma dada concentração, X
passa a inibir a enzima 1.

Podemos afirmar que, nessa via metabólica,


a) a quantidade disponível de X tende a se manter constante.
b) o substrato faltará se o consumo de X for pequeno.
c) o substrato se acumulará quando a concentração de X diminuir.
d) a substância A se acumulará quando a concentração de X aumentar.
e) a substância B se acumulará quando o consumo de X for pequeno.
[A]
644. Em um organismo, células musculares e células nervosas diferem principalmente por:
a) possuírem genes diferentes.
b) possuírem ribossomos diferentes.
c) possuírem cromossomos diferentes.
d) expressarem genes diferentes.

89
e) utilizarem código genético diferente.
[D]
645. Sabe-se que o homem possui em torno de 80.000 genes, que, entre outras funções, codificam proteínas.
Considerando-se essa informação e conhecimento sobre o assunto, é CORRETO afirmar que
a) o genótipo das células do tecido nervoso é diferente do genótipo das células do tecido epitelial.
b) o número total de genes, após a diferenciação e a especialização das células, reduz-se.
c) os genes cuja atividade não é necessária ao funcionamento de uma célula perdem a capacidade de duplicação.
d) os genes responsáveis pelo sistema sangüíneo ABO estão presentes nas células epiteliais, mas são incapazes de se expressar .
[D]

646. O controle genético de determinado caráter é feito por uma série de quatro alelos de um só locus. O alelo A 1 é dominante sobre os alelos A 2, A3 e A 4; o alelo A2 é
dominante sobre os alelos A 3 e A 4 e o alelo A3 é dominante sobre A 4.
Do cruzamento A1 A2 x A3 A4 devem ser obtidas:
a) quatro classes genotípicas e quatro classes fenotípicas.
b) quatro classes genotípicas e duas classes fenotípicas.
c) quatro classes genotípicas e três classes fenotípicas.
d) três classes genotípicas e três classes fenotípicas.
e) três classes genotípicas e duas classes fenotípicas.
[B]
647. A cor dos pêlos nas cobaias é condicionada por uma série de alelos múltiplos com a seguinte escala de dominância:
C (preta) >C1 (marrom) >C2 (creme) >c (albino).
Uma fêmea marrom teve 3 ninhadas, cada uma com um macho diferente. A tabela a seguir mostra a constituição de cada ninhada.

A partir desses dados é possível afirmar que o macho responsável pela ninhada:
a) 1 era marrom homozigoto.
b) 1 era preto homozigoto.
c) 2 era albino heterozigoto.
d) 2 era creme heterozigoto.
e) 3 era marrom homozigoto.
[D]
648. Se um caráter tem três alelos possíveis, podendo haver seis genótipos, e um segundo caráter apresenta oito genótipos pos síveis, quando ambos forem estudados
simultaneamente, podem ocorrer
a) 7 genótipos.
b) 12 genótipos.
c) 24 genótipos.
d) 48 genótipos.
e) 96 genótipos.
[D]

649. A presença de cromatina sexual predominante em número de células femininas está relacionada a cromossomos:
a) Y inativos
b) X inativos
c) autossômicos inativos
d) autossômicos que não se dividiram
e) autossômicos agregados
[B]
650. O esquema a seguir mostra a formação dos gametas responsáveis pela produção de um indivíduo com alteração do seu número cromossomial.

Entre as características que esse indivíduo passará a apresentar, teremos:


a) sexo masculino.
b) caracteres sexuais desenvolvidos.
c) cariótipo normal.
d) ausência de cromatina sexual.

90
e) estatura elevada.
[D]

651. A figura a seguir se refere à determinação do sexo em algumas espécies de tartarugas e lagartos.
Com base nessa figura pode-se afirmar que

a) a determinação do sexo nesses animais é independente da localização dos ovos no ninho e da época da postura.
b) a determinação do sexo, sob controle de temperatura, pode ser útil em condições de manejo de espécies em extinção.
c) indivíduos de sexo indeterminado, em tartarugas, são produzidos em temperaturas abaixo de 28°C.
d) temperatura maiores que 28°C produzem fêmeas tanto em tartarugas quanto em lagartos.
e) machos são produzidos em baixas temperaturas tanto para tartarugas quanto para lagartos.
[B]
652. Observe a figura.

Essa figura representa a herança do caráter mancha negra numa espécie de peixes em que a determinação do sexo segue o padrão mais comum nas aves.
Com relação ao padrão de herança desse caráter, é correto afirmar-se que
a) a probabilidade do casal em F1 ter um descendente macho e sem mancha negra é zero.
b) a probabilidade de uma fêmea com mancha, cruzada com macho sem mancha, ter descendentes machos sem mancha é de 50%.
c) as fêmeas de F‚ e P sem mancha negra possuem genótipos diferentes,
d) o caráter mancha negra é exclusivo de indivíduos homozigotos.
e) o sexo heterogamético nessa espécie de peixes é o masculino.
[A]
653. Leia o texto a seguir referente à Hipótese de Lyon.
"A pesquisadora inglesa Mary Lyon propôs, em 1961, a hipótese de que fêmeas de mamíferos compensariam a dose dupla de genes do cromossomos X através da
inativação de um desses cromossomos. Assim, as células femininas ficariam iguais às masculinas, que possuem apenas uma cópia funcionante dos genes ligados ao
cromossomo X. A inativação do cromossomo X ocorre ao acaso, independentemente dos genes que possuem, e nos blastômeros iniciais do desenvolvimento
embrionário. Logo, as mulheres apresentam células geneticamente diferentes entre si, pois em algumas estão ativos os genes provenientes do cromossomo X materno
e em outras do cromossomo X paterno. Mulheres heterozigotas para os genes ligados aos cromossomos X expressam o alelo dominan te em algumas células e o alelo
recessivo em outras."
Assinale a alternativa que confirma o texto anterior.
a) Algumas mulheres, heterozigotas para os grupos sangüíneos, são tipo A e B simultaneamente.
b) Algumas mulheres, heterozigotas para a cor do cabelo, são loiras e castanhas, simultaneamente.
c) Algumas mulheres, heterozigotas para o daltonismo (XD Xd), têm visão normal em um dos olhos e daltonismo no outro.
d) Algumas mulheres, heterozigotas para a cor da pele, têm manchas brancas e pretas, simultaneamente.
e) Algumas mulheres, heterozigotas para a cor dos olhos, têm um olho azul e outro castanho.
[C]
654. Na espécie humana, a determinação cromossômica do sexo é dada pelos cromossomos X e Y. O cromossomo Y apresenta genes holândricos, isto é, genes que
não possuem homologia com o cromossomo X. As características condicionadas por tais genes são
a) transmitidas da mãe para 100% das filhas.
b) transmitidas do pai para 100% dos filhos homens.
c) transmitidas do pai só para as filhas.
d) transmitidas do pai para os filhos homens e filhas em 100% dos casos.
e) exclusivas das mulheres.
[B]
655. Durante as Olimpíadas é comum fazer-se teste da cromatina sexual ou corpúsculo de Barr nas mulheres. Esse teste permite o diagnóstico citológico do sexo
feminino. Uma mulher normal apresentará em suas células bucais:
a) Dois cromossomos X, sendo que um deles é a cromatina sexual.
b) Três cromossomos Y, sendo que um deles é a cromatina sexual.
c) Dois cromossomos X e blocos de cromatina sexual.
d) Três cromossomos X, sendo que dois deles formam a cromatina sexual.
e) Um cromossomo X apenas.
[A]

91
656. Na espécie humana a determinação sexual é feita por um par de cromossomos, X e Y. O indivíduo do sexo feminino apresenta dois cromossomos X enquanto que
o indivíduo de sexo masculino apresenta um cromossomo X e outro cromossomo Y. Com base neste texto é INCORRETO afirmar:
a) O sexo masculino é heterogamético e é sempre o homem quem determina o sexo dos filhos
b) O sexo feminino é homogamético e o gameta feminino normal sempre apresenta um cromossomo X
c) na mulher um cromossomo X está sempre condensado e recebe o nome de cromatina sexual
d) A hipertricose auricular é uma característica restrita ao sexo masculino, pois o gene está localizado no cromossomo Y
e) Toda doença hereditária e recessiva ligada ao cromossomo X só afeta as mulheres
[E]
657. O carneiro ('Ovis aries') apresenta 27 cromossomos em seus gametas normais.
A partir desse dado, assinale a alternativa INCORRETA com relação ao número de cromossomos encontrado em diversas células nes sa espécie.
a) Um neurônio de carneiro deve apresentar 52 autossomos.
b) Um linfócito de carneiro deve apresentar 54 cromossomos, incluindo 2 cromossomos sexuais.
c) Um óvulo de ovelha deve apresentar 26 autossomos.
d) Uma célula de carneiro que está na metáfase da mitose deve apresentar 54 cromossomos duplicados.
e) Uma célula muscular de carneiro deve apresentar 54 autossomos, além de 2 cromossomos sexuais.
[E]
658. Em uma espécie animal, cujo 2n = 6, o cariótipo de células somáticas de machos e fêmeas se apresenta como mostram os desenhos a seguir:

A análise desses cariótipos revela que, nessa espécie, a determinação do sexo é feita por um sistema, em que o macho e a fême a são, respectivamente:
a) XY e XX b) YO e XX c) XO e XX
d) XY e XO e) XO e XY
659. A análise do cariótipo de exemplares de uma dada espécie revelou que o número diplóide é idêntico em ambos os sexos e que o sexo heterogamético é o feminino.
Com base nesses dados, é possível dizer que o sistema de determinação do sexo nessa espécie é do tipo
a) XX : XY b) XX : XO ) XX : YO
d) ZZ : ZW e) ZZ : ZO
[D]
660. Leia com atenção a tirinha a seguir:

Segundo a tirinha, a amiga do Calvin tem DOIS CROMOSSOMOS X. Com base neste dado podemos concluir que:
a) a amiga do Calvin é mutante, por isso é hostil
b) um cromossomo X da amiga do Calvin é ativo e o outro é chamado de cromatina sexual
c) a heterocromatina ocorre no Calvin, pois ele é XY
d) os dois cromossomos X que o Calvin fala é da cobra que quer comê-lo
e) não há cromatina sexual em meninas
[B]
661. Muitas vezes, durante a realização de eventos esportivos, é realizada a determinação do sexo genético. Este exame é feito pela observação dos cromossomos de
células epiteliais. Pode-se afirmar que neste exame
a) mulheres normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, que corresponde a um dos cromossomos X.
b) homens normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, que corresponde ao cromossomo Y.
c) mulheres normais deveriam apresentar duas estruturas chamadas corpúsculos de Barr, que correspondem aos dois cromossomos X.
d) homens normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, correspondente ao cromossomo X.
e) mulheres normais na fase adulta não deveriam apresentar corpúsculo de Barr.
[A]
662. Numere a coluna inferior, relacionando-a com a superior.
Indivíduos:
1 - 45, X
2 - 46, XX
3 - 49, XXXXX
4 - 49, XXXXY
5 - 47, XXX
Quantidade de cromatinas sexuais (corpúsculos de Barr)
( ) quatro
( ) duas
( ) nenhuma

92
( ) uma
( ) três
Assinale a opção que apresenta a seqüência correta de numeração.
a) 2, 4, 1, 3, 5 b) 3, 5, 1, 2, 4 c) 2, 3, 1, 4, 5
d) 3, 2, 1, 4, 5 e) 2, 1, 3, 4, 5
[B]
663. A cromatina sexual compreende:
a) o citoplasma de células gaméticas masculinas que se apresentam mais coradas que as femininas.
b) o citoplasma de células gaméticas femininas que se apresentam mais coradas que as masculinas.
c) cromossomo Y condensado em núcleos de hemácias humanas.
d) um dos cromossomos X da mulher, que permanece condensado no núcleo das células, facilmente visualizado na mucosa oral.
e) cromossomos X e Y condensados durante o período da interfase.
[D]
664. Na espécie humana existe um gene raro que causa a displasia ectodérmica anidrótica, que é uma anomalia caracterizada pela ausência das glândulas sudoríparas.
Esse gene se localiza no cromossomo sexual X.
Algumas mulheres, portadoras desse gene em heterozigose, ficam com a pele toda manchada, formando um mosaico de manchas clar as e escuras, quando se passa
um corante sobre a pele.

a) Explique a formação dessas manchas do ponto de vista genético.


b) Por que esse mosaico não pode aparecer em um homem?
a) A mulher que é heterozigota para esse gene, em função da inativação ao acaso de um dos cromossomos X, apresentará regiões da pele em que o gene normal será
ativo e outras regiões em que o gene anormal será o gene ativo.
b) Os homens só têm um cromossomo X, que é sempre funcional e portador de apenas um dos dois genes. Se o cromossomo X do homem tiver o gene em questão, toda
sua pele estará comprometida, caso contrário toda sua pele será normal.
665. Em galinhas, a cor das penas apresenta herança ligada ao sexo. O alelo dominante determina penas barradas e o recessivo, penas pretas. Considere os seguintes
cruzamentos a partir dos quais obtiveram-se as gerações F1 e F2:
I. machos homozigóticos de penas barradas × fêmeas de penas pretas
II. machos de penas pretas × fêmeas de penas barradas
Assinale a alternativa que indica corretamente as gerações nas quais espera-se encontrar galinhas pretas.
a) I – F1: galinha barrada; F2: galinha barrada
II - F1: galinha preta; F2: galinha barrada
b) I - F1: galinha barrada; F2: galinha preta
II - F1: galinha preta; F2: galinha preta
c) I - F1: galinha barrada; F2: galinha barrada
II - F1: galinha preta; F2: galinha preta
d) I - F1: galinha preta; F2: galinha barrada
II - F1: galinha barrada; F2: galinha preta
e) I - F1: galinha barrada; F2: galinha preta
II - F1: galinha barrada; F2: galinha preta
[B]
666. Um estudante, ao analisar os cromossomos de 'Drosophila', encontrou a proporção de 1X : 2A (onde a letra A simboliza o c onjunto haplóide de autossomos). Além
disso, não observou a presença do cromossomo Y. Analisando os dados do estudante, podemos concluir que a mosca é
a) uma fêmea normal.
b) uma fêmea aneuplóide.
c) um macho normal.
d) um macho estéril.
e) um intersexuado.
[D]
667. O estudo de linhagens de galinhas em que aparecia uma anomalia hereditária mostrou que fêmeas afetadas cruzadas com machos normais davam sempre todos
os descendentes machos com a anomalia e as fêmeas normais. A anomalia, provavelmente, é determinada por gene
a) autossômico dominante.
b) autossômico recessivo.
c) recessivo ligado ao cromossomo X.
d) recessivo ligado ao cromossomo Z..
e) dominante ligado ao cromossomo Z..
[E]
668. Um homem afetado por uma doença genética muito rara, de herança dominante, casa-se com uma mulher, não consangüínea. Imagine que o casal tenha doze
descendentes, seis filhos e seis filhas. Responda, justificando sua resposta, qual será a proporção esperada de filhas e filhos afetados pela doença do pai no caso do
gene em questão estar localizado.
a) em um autossomo;
b) no cromossomo X.
a) 6 crianças
b) Nenhum dos filhos será afetado (XaY) e todas as filhas (XAXa) serão afetadas.
669. A hipertricose auricular (pêlos na orelha) é transmitida apenas pelo homem e somente para os filhos do sexo masculino. E ste fenômeno é chamado de:
a) epistasia.
b) codominância.
c) herança holândrica.
d) pleiotropia.

93
e) interação gênica.
[C]
670. Um casal não hemofílico teve um filho do sexo masculino com hemofilia. Indique a alternativa com a probabilidade desse c asal ter uma filha hemofílica:
a) 0% b) 25% c) 50% d) 75% e) 100%
[A]

671. A distrofia muscular de Duchenne é devida a um gene recessivo, ligado ao cromossomo X. O heredograma a seguir refere-se a uma família com esta anomalia.
A probabilidade de A ser portador da anomalia, sabendo-se que a mulher B é homozigota é de

a) 1/8 b) 3/8 c) ½ d) ¼ e) ¾
[C]
672. Um homem tem avó materna e pai com visão normal e avô materno e mãe com daltonismo.
Assinale a alternativa correta quanto aos genótipos do homem e de seus avós maternos.
a) Homem - XdY, Avó - XDXd, Avô - XdY
b) Homem - XDY, Avó - XDXd, Avô - XdY
c) Homem - XdY, Avó - XDXd, Avô - XDY
d) Homem - XDY, Avó - XDXd, Avô - XDY
e) Homem - XdY, Avó - XdXd, Avô – XdY
[A]
673. Um homem hemofílico casa-se com uma mulher normal e homozigota para este caráter. A probabilidade deste casal vir a ter uma filha hemofílica é igual a:
a) zero b) 50% c) 25% d) 12,5% e) 100%
[A]
674. Em drosófila, a cor amarela do corpo é determinada por um gene recessivo localizado no cromossomo X e a cor cinza, pelo alelo dominante. Assinale, a
descendência esperada a partir do cruzamento entre uma fêmea amarela e um macho cinzento.
a) machos: 100% amarelos - fêmeas: 100% cinzentas.
b) machos: 100% cinzentos - fêmeas: 100% amarelas.
c) machos: 100% amarelos - fêmeas: 50% cinzentas e 50% amarelas.
d) machos: 50% cinzentos e 50% amarelos - fêmeas: 100% cinzentas.
e) machos: 50% cinzentos e 50% amarelos - fêmeas: 50% cinzentas e 50% amarelas.
[A]
675. Considere o heredograma a seguir.

A partir da sua análise, é possível concluir que a anomalia é devida provavelmente a um alelo
a) localizado no cromossomo Y.
b) dominante, localizado no cromossomo X.
c) recessivo, localizado no cromossomo X.
d) dominante, situado num autossomo.
e) recessivo, situado num autossomo.
[C]
676. Observe a figura a seguir que apresenta o heredograma de uma família na qual alguns membros apresentam hemofilia, grave anomalia relacionada à alteração no
tempo de coagulação do sangue. Essa figura indica os grupos sangüineos do sistema ABO de alguns dos seus membros.

94
Com base nas informações do heredograma e considerando-se que não ocorreu mutação, é INCORRETO afirmar-se que
a) a probabilidade de II-3 ser portadora do gene da hemofilia é de 50%.
b) a probabilidade de nascimento de outra criança hemofílica e do grupo B para o casal III-6 e III-7 é de 25%.
c) o indivíduo III-4 pode receber sangue de III-6.
d) o indivíduo II-5 tem 50% de probabilidade de formar gametas do tipo iXh.
e) o indivíduo I-1 é heterozigoto para o sistema ABO.
[B]
677. Analise o heredograma.

Em relação à característica representada no heredograma, todas as alternativas são possíveis, EXCETO


a) A herança pode ser autossômica.
b) A herança pode ser ligada ao sexo.
c) A herança pode representar uma família de hemofílicos.
d) I-1 e I-2 podem ser heterozigotos.
e) II-2, II-5 e III-1 podem ser homozigotos dominantes.
[E]
678. Observe a figura.

Essa figura representa a herança do caráter mancha negra numa espécie de peixes em que a determinação do sexo segue o padrão mais comum nas aves.
Com relação ao padrão de herança desse caráter, é correto afirmar-se que
a) a probabilidade do casal em F1 ter um descendente macho e sem mancha negra é zero.
b) a probabilidade de uma fêmea com mancha, cruzada com macho sem mancha, ter descendentes machos sem mancha é de 50%.
c) as fêmeas de F‚ e P sem mancha negra possuem genótipos diferentes,
d) o caráter mancha negra é exclusivo de indivíduos homozigotos.
e) o sexo heterogamético nessa espécie de peixes é o masculino.
[A]
679. Na espécie humana, a determinação cromossômica do sexo é dada pelos cromossomos X e Y. O cromossomo Y apresenta genes holândricos, isto é, genes que
não possuem homologia com o cromossomo X. As características condicionadas por tais genes são
a) transmitidas da mãe para 100% das filhas.
b) transmitidas do pai para 100% dos filhos homens.
c) transmitidas do pai só para as filhas.
d) transmitidas do pai para os filhos homens e filhas em 100% dos casos.
e) exclusivas das mulheres.
[B]
680. Considerando que o heredograma a seguir é o de uma herança dominante, ligada ao X, analise os itens:

95
1. A mulher I.2 é homozigota
2. A mulher I.2 é heterozigota
3. A mulher II.4 é homozigota
4. A mulher III.5 é heterozigota
5. A mulher III.9 é homozigota
Está(ão) correto(s) apenas:
a) 1
b) 2
c) 3
d) 1 e 3
e) 1 e 2
anulado
681. O gene h que determina a hemofilia na espécie humana é recessivo e esta localizado no cromossomo X . Com base no heredograma a seguir, podemos afirmar
corretamente:

a) O genótipo da Sra 5 é XHXH.


b) O genótipo da Sra 5 é XHXh.
c) O genótipo da Sra 8 é XHXH.
d) O genótipo da Sra 9 é XHY.
e) O genótipo da Sra 8 é XhXh.
[B]
682. O daltonismo é uma doença hereditária e ligada ao sexo na espécie humana. Se um homem daltônico, casa-se com uma mulher normal, não portadora do gene
para o daltonismo, a probabilidade desse casal ter um filho homem e daltônico, é:
a) 25 % b) 8 % c) 12,5 % d) 0 %
[D]
683. Na espécie humana a determinação sexual é feita por um par de cromossomos, X e Y. O indivíduo do sexo feminino apresenta dois cromossomos X enquanto que
o indivíduo de sexo masculino apresenta um cromossomo X e outro cromossomo Y. Com base neste texto é INCORRETO afirmar:
a) O sexo masculino é heterogamético e é sempre o homem quem determina o sexo dos filhos
b) O sexo feminino é homogamético e o gameta feminino normal sempre apresenta um cromossomo X
c) na mulher um cromossomo X está sempre condensado e recebe o nome de cromatina sexual
d) A hipertricose auricular é uma característica restrita ao sexo masculino, pois o gene está localizado no cromossomo Y
e) Toda doença hereditária e recessiva ligada ao cromossomo X só afeta as mulheres
[E]
684. Um homem de visão normal e com número normal de dedos casa-se com uma mulher polidáctila e daltônica. Sabendo-se que a polidactilia é uma herança
autossômica dominante, assinale a alternativa correta.
a) Esse casal poderá ter uma filha polidáctila e daltônica.
b) A mãe dessa mulher terá obrigatoriamente o mesmo genótipo para o daltonismo que ela.
c) O pai dessa mulher é daltônico.
d) A mulher é obrigatoriamente filha de pai e mãe polidáctilos.
e) Os filhos homens desse casal serão sempre daltônicos e não polidáctilos.
[C]
685. Assinale a ÚNICA proposição CORRETA.
Em um indivíduo daltônico, do sexo masculino, o gene para o daltonismo encontra-se:
01. em todas as células somáticas.
02. em todas as células gaméticas.
04. apenas nas células do globo ocular.
08. apenas nas células-mãe dos gametas.
16. apenas nos gametas com cromossomo y.
01

686. O raquitismo resistente à vitamina D é uma doença determinada por um gene dominante de herança ligada ao sexo. Na prole de um homem afetado casado com
uma mulher normal, espera-se que
a) tanto os filhos quanto as filhas possam ser normais ou afetados.

96
b) tanto os filhos quanto as filhas sejam sempre afetados.
c) tanto os filhos quanto as filhas sejam sempre normais.
d) apenas as filhas sejam afetadas.
e) apenas os filhos sejam afetados.
[D]
687. Na genealogia a seguir, os símbolos cheios representam pessoas afetadas por uma doença genética rara.

O padrão de herança que melhor explica o heredograma é


a) autossômico dominante, porque a doença afeta os dois sexos.
b) autossômico dominante, porque a doença aparece em todas as gerações.
c) autossômico dominante, porque aproximadamente 50% da prole é afetada.
d) dominante ligado ao sexo, porque todas as filhas de homens afetados são afetadas.
e) recessivo ligado ao sexo, porque não há transmissão de homem para homem.
[D]
688. Em relação aos cromossomas sexuais X e Y, são feitas as seguintes afirmações:
I - quando pareados, são exemplos de cromossomas homólogos;
II - características como a hemofilia, por exemplo, fazem parte do cromossoma X,
III - características como o daltonismo, por exemplo, estão associadas a gens do cromossoma Y.
Estão corretas as seguintes afirmações:
a) apenas I
b) apenas II
c) apenas III
d) apenas II e III
e) todas.
[B]
689. Uma mulher, filha de pai normal e mãe portadora do gene para o daltonismo, casa-se com um homem daltônico e tem uma criança do sexo masculino e daltônica.
É correto afirmar que:
a) essa mulher é daltônica.
b) essa mulher poderia ter uma irmã daltônica.
c) o filho dessa mulher herdou do seu pai o gene para o daltonismo.
d) o genótipo dessa mulher é igual ao de sua mãe.
e) essa mulher não poderá ter uma filha daltônica.
[D]
690. O daltonismo é uma anomalia que apresenta um tipo de herança ligada ao sexo. De acordo com o heredograma, analise as afirmações de I a IV e assinale a
alternativa correta.

I - 100% dos filhos homens do casal 3 e 4 serão daltônicos;


II - 50% das filhas do casal 3 e 4 serão normais portadoras, e 50%, daltônicas;
III - Não é possível identificar o genótipo de 2;
IV - 100% das filhas do casal 3 e 4 serão normais portadoras.
a) Todas as afirmações são verdadeiras.
b) Apenas as afirmações I e II são verdadeiras.
c) Apenas as afirmações I, III e IV são verdadeiras.
d) Apenas as afirmações II e III são verdadeiras.
e) Apenas as afirmações II e IV são verdadeiras.
[D]
691. Considere as seguintes afirmações sobre uma mulher hemofílica:
I- seu pai é hemofílico.
II- sua mãe possui um gene para a hemofilia.
III- sua avó paterna NÃO apresenta o gene para a hemofilia.
Sabendo-se que o gene em questão é recessivo e ligado ao sexo, e excluindo-se a possibilidade de mutação, é possível considerar que APENAS
a) I é verdadeira.
b) II é verdadeira.
c) III é verdadeira.
d) I e II são verdadeiras.

97
e) I e III são verdadeiras.
[D]
692. Um casal tem uma criança de sexo masculino e hemofílica. É correto afirmar, com certeza, que:
a) o pai é normal.
b) o pai é normal e a mãe é hemofílica.
c) o pai e a mãe são hemofílicos.
d) ela recebeu da mãe o gene para a hemofilia.
e) se ela tiver um irmão, este será hemofílico também.
[D]
693. O gene que determina o daltonismo na espécie humana caracteriza o seguinte tipo de herança
a) autossômico dominante.
b) dominante ligado ao sexo.
c) autossômico recessivo.
d) recessivo ligado ao sexo.
e) interação gênica.
[D]
694. Na espécie humana, o genótipo para hemofilia XHY, fenotipicamente representa:
a) homem normal
b) homem hemofílico
c) mulher normal
d) mulher hemofílica
e) homem normal, porém portador
[A]
695. Em moscas de frutas, a cor branca dos olhos é devida à herança ligada ao sexo.
Uma mosca fêmea com olhos coloridos, cuja mãe tinha olhos brancos, cruza-se com macho de olhos brancos. Qual é a probabilidade de se obter uma fêmea de olhos
brancos deste cruzamento?
a) 1,00. b) 0,67. c) 0,50. d) 0,25. e) 0,00.
[D]

696. Existe uma doença condicionada por um gene recessivo, localizado na região não homóloga do cromossomo X, que leva a uma debilidade muscular progressiva
(distrofia muscular progressiva).
- Uma mulher com fenótipo normal tem um irmão afetado e um tio materno também afetado pela doença;
- seus pais não são afetados;
- ela está casada com um homem normal.
Qual a probabilidade de que um(a) filho(a) deste casal venha a ser afetado pela doença?
a) Se a mulher for homozigota, a probalidade é 100%.
b) Se a mulher for homozigota, a probabilidade é zero.
c) Se a mulher for homozigota, a probabilidade é 25%.
d) Se a mulher for heterozigota, a probabilidade é 75%.
e) Se a mulher for heterozigota, a probabilidade é 100%.
[B]
697. Uma criança do sexo feminino, daltônica e canhota, possui pai daltônico e destro e mãe de visão normal e canhota. Sabendo que o uso da mão esquerda é uma
característica recessiva, então a probabilidade do segundo filho ser do sexo masculino e com fenótipos dominantes é:
a) ½ b) ¼ c) 1/6 d) 1/8 e) 1
[D]
698. Acerca da relação entre os cromossomos de um menino e os de seus avós, fizeram-se as seguintes afirmações:
I. Seu cromossomo Y é descendente do Y de seu avô paterno.
II. Seu cromossomo X é descendente de um X de sua avó paterna.
III. Entre seus autossomos, há descendentes de autossomos de seus avós.
Dessas afirmações, estão corretas APENAS
a) I b) II c) III d) I e III e) II e III
[D]
699. O heredograma a seguir representa uma família em que um dos filhos é afetado por doença determinada por um alelo recessivo localizado no cromossomo X.

Se uma das irmãs desse indivíduo casar-se com um homem sadio, a probabilidade desse casal ter um menino afetado é
a) ¾ b) ½ c) ¼ d) 1/8 e) 1/16
[D]
700. Quanto aos cromossomos sexuais X e Y, podemos afirmar que:
a) como não são completamente homólogos, não se pareiam na meiose.
b) como são completamente homólogos, pareiam-se na meiose.
c) se pareiam na meiose, pois possuem uma região homóloga.
d) não se pareiam na meiose, pois possuem uma região não homóloga.
e) os genes que se encontram na região não homóloga do X condicionam um tipo de herança chamado herança restrita ao sexo.
[C]
701. Observe o esquema a seguir:

98
A análise do esquema permite formular as conclusões a seguir, EXCETO uma. Indique-a.
a) O casal 1/2 nunca formará mulheres hemofílicas.
b) O casal 5/6 formará homens hemofílicos.
c) O genótipo de 4 será XHY.
d) O genótipo de 6 será XHXH ou XHXh.
e) O indivíduo 5 com certeza é hemofílico.
[D]
702. O daltonismo é condicionado por um gene recessivo ligado ao sexo. Um homem normal casou-se com uma mulher daltônica. A probabilidade de terem um filho
homem e normal é de:
a) 0 b) ¼ c) 1/3 d) ½ e) 1
[A]
703. Ao fazer um exame de vista para tirar carteira de motorista, um rapaz descobriu que era daltônico. Assinale entre as alternativas a seguir, aquela que contém o
heredograma que NÃO poderia representar a família desse rapaz.

a) 1 b) 2 c) 3 d) 4
[B]
704. Na(s) questão (ões) adiante, escreva no espaço apropriado a soma dos itens corretos. No homem, o gene (h) para hemofilia está localizado no cromossoma X e é
recessivo em relação ao gene (h+) para coagulação normal do sangue. Com base nesta informação, é correto afirmar:
01) Um homem hemofílico, casado com uma mulher homozigota normal, terá 50% de seus filhos afetados, independentemente do sexo.
02) Uma mulher, filha de um indivíduo hemofílico, certamente será hemofilica.
04) Um homem hemofílico, casado com uma mulher homozigota normal, terá todos os seus filhos normais, independentemente do sexo.
08) Um homem hemofilico teve uma filha normal. A probabilidade desta mulher ter uma criança do sexo masculino e hemofilico é igual a 1/4.
04 + 08 = 12
705. Observe a árvore genealógica a seguir, referente a uma família com herança para daltonismo (herança ligada ao sexo e deve-se a um gene recessivo).

Relativamente aos indivíduos anteriores, podemos afirmar:


a) somente o indivíduo 2 é daltônico
b) o genótipo do indivíduo 4 é XdY
c) o indivíduo 1 é normal, porém portador do gene para o daltonismo
d) os indivíduos 4 e 5 são daltônicos
[D]
706. "Tem sido verificado que aproximadamente 25% dos casos de hemofilia A em meninos são decorrentes de mutações novas, isto é, a doença se manifesta em
meninos que não tem história familiar de hemofilia."
Quando nos debruçamos sobre a hemofilia, aprendemos que ela é mais comum nos homens porque:
a) os homens são mais propensos à doença devido à influência do hormônio testosterona.
b) sendo uma herança ligada ao sexo, é suficiente nos homens apenas um alelo para que a doença se manifeste.
c) mulheres hemofílicas precisam de dois alelos dominantes, ao passo que os homens só necessitam de um alelo.
d) mulheres hemofílicas morrem nos primeiros sangramentos menstruais.

99
e) é causada por um alelo típico do cromossoma Y, que é, masculinizante.
[B]
707. Analise o heredograma.

Assinale a alternativa que NÃO contém um tipo de herança compatível com a anomalia representada no heredograma.
a) Ligada ao X.
b) Autossômica recessiva.
c) Ligada ao Y.
d) Autossômica dominante.
[A]
708. A tabela a seguir classifica características hereditárias da espécie humana. Assinale a alternativa que corresponde à cl assificação correta.

[B]
59. No gráfico abaixo temos representado um exemplo de doença ligada ao sexo onde apenas o indivíduo IV é afetado. Feita a análise desse grá fico, podemos afirmar
corretamente que:

a) a anomalia é causada por um gen dominante.


b) o indivíduo I é obrigatoriamente homozigoto.
c) o cromossoma Y paterno pode apresentar o gen para a doença.
d) o casal apresenta 50% de probabilidade de ter filhas afetadas.
e) os indivíduos III e V podem ser homozigotos ou heterozigotos.
[E]
709. Os genes presentes nos cromossomos, em conjunto com fatores ambientais, determinam as características individuais dos seres vivos. Em relação a esse assunto,
julgue os seguintes itens.
(0) Nas regiões não-homólogas dos cromossomos sexuais, é intensa a atividade de recombinação gênica.
(1) Gêmeas univitelinas podem apresentar diferenças fenotípicas relacionadas aos genes localizados no cromossomo X.
(2) Quanto maior a variabilidade genética de uma população, maior é o número de genes em homozigose.
(3) Cada um dos cromossomos do cariótipo humano contém o mesmo número de genes.
Item correto: 1
Itens errados: 0, 2 e 3
710. A hemofilia é uma doença genética cuja herança é ligada ao sexo. Analise o heredograma adiante e assinale a alternativa correta.

100
a) Os indivíduos 1 e 2 são homozigotos normais.
b) O indivíduo 8 é portador do gene para hemofilia.
c) O indivíduo 9 não pode ser hemofílico.
d) Todos os filhos e filhas do indivíduo 10 serão hemofílicos.
e) O indivíduo 14 pode ser homo ou heterozigoto.
[B]
711. Com relação à coloração da pelagem de gatos, observam-se os seguintes fenótipos:

Utilizando as informações anteriores, julgue os itens a seguir.


(0) O caráter cor da pelagem, nos gatos, é condicionado por genes ligados ao cromossomo X, não havendo dominância.
(1) As fêmeas manchadas são heterozigotas para o caráter cor da pelagem.
(2) Os descendentes de uma fêmea amarela, cruzada com um macho preto, serão manchados.
(3) Um gato macho não transmite para seus filhos machos os genes para cor da pelagem.
Itens corretos: 0, 1 e 3
Item errado: 2
712. O raquitismo resistente à vitamina D é uma doença provocada por um gene dominante ligado ao X. Do casamento entre uma mul her afetada e um homem normal,
nasceu uma menina normal. A probabilidade do nascimento de um menino também normal é:
a) 50 % b) 75 % c) 25 % d) 100 % e) 0
[C]

713. Um homem hemofílico e uma mulher daltônica tiveram um filho com síndrome de Klinefelter (47, XXY). Admitindo-se que o gameta anormal tenha sido produzido
pela mulher, espera-se que esse filho do casal seja
a) normal, quanto à hemofilia e ao daltonismo.
b) daltônico e hemofílico.
c) daltônico ou hemofílico.
d) apenas hemofílico.
e) apenas daltônico.
[E]
714. A enzima G-6-PD (glicose-6-fosfato desidrogenase) está presente nas hemácias de indivíduos normais. A ausência dessa enzima, em indivíduos afetados, torna as
hemácias sensíveis a certas drogas e nutrientes, provocando sua destruição. O gene que determina a ausência de G-6-PD é recessivo e situa-se no cromossoma X.
Observe o heredograma que representa uma família com essa característica.

Com base nesse heredograma, é CORRETO afirmar que


a) cada um dos indivíduos representados tem, pelo menos, um gene para ausência de G-6-PD.
b) essa família apresenta dois indivíduos heterozigotos para o gene que determina a G-6-PD.
c) casais como I.1 x I.2 têm probabilidade maior de ter filhos afetados do que de ter filhas afetadas.
d) o indivíduo II-3 pode ter recebido o gene da G-6-PD tanto do seu pai quanto de sua mãe.
[B]

101
715. A hipertricose auricular é uma anomalia genética condicionada por um gene localizado no cromossomo Y. Um homem com hipertricose casa-se, e todos os seus
filhos são homens.
Na próxima geração dessa família esse gene se manifestará
a) em todas as mulheres.
b) em todos os homens.
c) em 50% das mulheres e 50% dos homens.
d) somente nas mulheres heterozigotas.
e) somente nos homens heterozigotos.
[B]
716. Observe os heredogramas a seguir, que tratam de um caso e hemofilia:

Sabendo que o indivíduo 7 é do sexo feminino, a probabilidade de apresentar hemofilia é:


a) 1 b) ½ c) ¼ d) 1/8 e) 1/16
[B]
717. Um casal que possui visão normal para as cores, tem 3 filhos com as seguintes características:
- menina com visão normal para as cores;
- menino com visão normal para as cores;
- menino com daltonismo.
Sabendo-se que o daltonismo é uma herança ligada ao X, a possibilidade de esse casal ter uma filha com daltonismo é
a) zero. b) 1/4. c) 1/2. d) 3/4. e) 1.
[A]
718. Em 'Drosophila', a cor dos olhos é determinada por um gene localizado no cromossomo X sem o correspondente alelo no cromossomo Y. A cor vermelha é
determinada pelo gene W+, enquanto a cor branca é devida ao gene W. Um macho de olhos brancos foi cruzado com uma fêmea heter ozigota. Considerando que
nesses indivíduos o sexo heterogamético é o masculino, a porcentagem de indivíduos de olhos brancos em F 1 será de:
a) zero b) 100 % c) 25 % d) 75 % e) 50 %
[E]
719. A genealogia abaixo nos mostra uma forma de transmissão do daltonismo.

Assinale dentre as alternativas que se seguem, a(s) correta(s).


01. O daltonismo está relacionado com genes localizados em cromossomos autossômicos.
02. O daltonismo é determinado por um gene recessivo, sendo que seu alelo dominante condiciona visão normal.
04. O indivíduo 1 transmite a todas as suas filhas um cromossomo Xd.
08. O indivíduo 8 tem o mesmo fenótipo de sua avó materna.
16. O casal 1 x 2 pode ter filhos homens daltônicos.
32. O genótipo do indivíduo 9 é XdY.
64. O genótipo do indivíduo 5 é XdXd.
FVVVFVF
720. A engenharia genética permitiu a introdução, em ratos, do gene humano para produção do hormônio de crescimento, levando à produção de ratos gigantes. Estes
ratos são considerados
a) isogênicos. b) transgênicos. c) infectados.
d) mutantes. e) clones.
[B]
721. O modelo molecular dos ácidos nucléicos (DNA e RNA) foi proposto por J. Watson e F. Crick em 1953. Segundo esse modelo esses ácidos são
a) micromoléculas. b) polipeptídeos. c) polinucleotídeos.
d) enzimas. e) lipídios.
[C]
722. A experiência do "liquidificador" realizada por Hersey e Chase demonstrou que a substância que determinava a destruição de bactérias parasitadas pelos vírus
bacteriófagos era
a) uma proteína viral.
b) uma enzima viral.
c) o RNA viral.
d) o DNA viral.
e) um lípide viral.
[D]

102
723. O experimento em que foi observado o fenômeno da "transformação bacteriana", ou seja, que bactérias não patogênicas sem cápsula desenvolvem cápsula e
causam a morte de camundongos foi realizada por
a) Mendel. b) Morgan. c) Griffth.
d) Lamarck. e) Darwin.
[C]
724. A experiência do "liquidificador" realizada por Hersey e Chase em 1952 demonstrou que
a) o material genético é formado por proteínas.
b) o material genético é formado de RNA.
c) o material genético é formado de lipídios.
d) o material genético é formado por açúcares.
e) o material genético é formado de DNA.
[E]
725. As evidências de que o DNA é a substância hereditária que determina as características dos seres vivos foram primeiramente observadas em
a) vírus. b) protozoários. c) ácaros.
d) liquens. e) bactérias.
[E]
726. O antibiótico Estreptomicina age sobre as bactérias promovendo a leitura errada do RNAm, a Tetraciclina liga-se à subunidade ribossômica menor e inibe a ligação
do AA-RNAt, o Cloranfenicol inibe a peptidiltransferase na subunidade ribossômica maior e a Rifampicina inibe a RNA polimerase no sítio de iniciação. Sabe-se que
esses antibióticos são substâncias cuja utilização médica se baseia na inibição das células bacterianas atuando no mecanismo de:
a) fagocitose.
b) secreção de substâncias.
c) síntese protéica.
d) produção de energia.
e) reprodução celular.
[C]
727. Cientistas conseguiram inserir um grande trecho de ADN estranho ao ADN de cobaias como mostra o desenho a seguir:

O resultado esperado para este trabalho é que as células que receberam o implante:
a) morram pela presença de ácido nucléico estranho à composição do núcleo.
b) morram por ficarem prejudicadas na realização da síntese protéica.
c) reproduzam-se, produzindo células defeituosas incapazes de sobreviverem.
d) reproduzam-se, transferindo as características implantadas para as células-filhas.
e) cresçam, produzindo anticorpos contra as proteínas estranhas que serão fabricadas.
[D]
728. O estudo do mecanismo da síntese de proteínas no interior das células, confirma que:
a) a transcrição gênica caracteriza-se pela autoduplicação do DNA
b) três tipos de RNA participam do processo
c) os anticódons localizam-se no RNA-m
d) os códons são trincas de bases nitrogenadas do RNA-t
e) não há evidências que permitam aceitar que o código genético seja considerado degenerado
[B]
729. "A nova tecnologia do DNA recombinante está permitindo que cientistas dos países do primeiro mundo desenvolvam um projeto denominado GENOMA que tem por
objetivo seqüenciar os cerca de 3 bilhões de bases nitrogenadas que compõem os cromossomos de um ser humano. Ao lado dos inúmeros benefícios desse projeto,
algumas questões de cunho ético têm sido levantadas." Em relação a esse projeto, o procedimento que pode afetar diretamente o equilíbrio genético de populações
humanas é
a) a detecção de indivíduos superdotados intelectualmente por meio de procedimentos laboratoriais.
b) o aumento de seleção genética ou gamética artificial.
c) o emprego de testes genéticos como um novo critério para admissão a empregos.
d) o registro de patentes de seqüências do genoma humano para especulação mercadológica.
e) o uso de testes pró-sintomáticos para a realização de seguros de vida.
[B]
730. Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. Clones são seres vivos obtidos pelo desenvolvimento de células retiradas de
indivíduos já existentes. A clonagem é um processo que vem sendo desenvolvido rapidamente com vários organismos e, em humanos , encontra barreiras de ordem
ética. Sobre esse processo é CORRETO afirmar:
01. Os clones são como irmãos gêmeos fraternos do doador das células.
02. O material genético do doador das células e do clone é idêntico.
04. Se o doador das células possuir um defeito genético, como o albinismo, seu clone possuirá, também, essa anomalia.
08. Órgãos transplantados do clone para o doador das células serão sempre rejeitados.
16. Já existem seres humanos que foram originados e desenvolvidos plenamente por clonagem.
32. Se o doador de células sofrer a perda de um membro antes de ser realizada a clonagem, o organismo originado posteriormente, por esse processo, nascerá sem o
referido membro.
02 + 04 = 06
731. Enzimas de restrição são fundamentais à Engenharia Genética porque permitem
a) a passagem de DNA através da membrana celular.
b) inibir a síntese de RNA a partir de DNA.
c) inibir a síntese de DNA a partir de RNA.
d) cortar DNA onde ocorrem seqüências específicas de bases.

103
e) modificar seqüências de bases do DNA.
[D]
732. Duas mulheres disputam a maternidade de uma menina. Foi realizada a análise de um mesmo trecho do DNA, obtido de um dos cromossomos X de cada mulher e
da menina. As seqüências de bases do referido trecho gênico estão esquematizadas adiante:

Os dados obtidos
a) são suficientes para excluir a possibilidade de qualquer uma das mulheres ser a mãe da menina.
b) São suficientes para excluir a possibilidade de uma das mulheres ser a mãe da menina.
c) não são suficientes, pois o cromossomo X da menina analisado pode ser o de origem paterna.
d) não são suficientes, pois a menina recebe seus dois cromossomos X da mãe e apenas um deles foi analisado.
e) não podem ser considerados, pois uma menina não recebe cromossomo X de sua mãe.
[C]
733. As técnicas utilizadas pela Engenharia Genética permitem quê se atue em uma substância presente em todas as células, procariontes e eucariontes, sendo
responsável pelo controle do seu metabolismo. Essa substância se denomina
a) DNA, e é formada por cadeias polipeptídicas que apresentam em sua composição os aminoácidos adenina, uracila, citosina e guanina.
b) DNA, e é formada por cadeias polinucleotídicas que apresentam em sua composição as bases nitrogenadas adenina, citosina, guanina e timina.
c) RNA, e é formada por cadeias polinucleotídicas que apresentam em sua composição as bases nitrogenadas adenina, timina, citosina e guanina.
d) polimerase, e é formada por aminoácidos que apresentam em sua composição a desoxirribose.
e) transcriptase, e é formada por aminoácidos que apresentam em sua composição a ribose.
[B]
734. Clone é um população de seres geneticamente idênticos, originados pela multiplicação assexuada de um único genitor ou por manipulação citogenética.
Recentemente os jornais publicaram uma receita de clonagem para "fazer a ovelha "Dolly" da raça "Finn Dorset". A receita propõe os seguintes passos:
Os cientistas retiraram óvulos de uma ovelha adulta da raça "Scottish Blackface". Deles removeram os núcleos e guardaram o r esto. Foram retiradas as células das
glândulas mamárias de uma ovelha adulta da raça "Finn Dorset". Delas são retirados os núcleos, que são guardados. Os ingredientes foram colocados numa solução
química para "hibernar" e esperar um tempo para serem encaixados nos óvulos anucleados. Os cientistas, transferiram o núc leo da célula mamária para o óvulo da
ovelha "Scottish Blackface" Passado um tempo, ele começou a se dividir, formando um aglomerado de células. O aglomerado celul ar foi transferido para o aparelho
reprodutor da ovelha "Scottish Blackface". Dele se formou um embrião que deu origem à Dolly.
Tomando por base o texto, podemos afirmar que:
a) A clonagem está correta mas não revela a tecnologia necessária para as células "hibernarem" e acertarem o tempo, também necessário, para a transferência do
núcleo para o óvulo anucleado.
b) "Dolly" não tem pai mas é, certamente, filha da ovelha da raça "Scottish Blackface", que cedeu o óvulo anucleado.
c) A clonagem está errada, pois o pai é a ovelha da raça "Finn Dorset", uma vez que no seu genótipo há cromossomos de seu avô.
d) A clonagem está correta, pois a genitora é a ovelha da raça "Scottish Blackface", uma vez que "Dolly" veio de seu óvulo.
e) Há uma falha técnica no experimento, pois núcleo de célula de glândula mamária não pode influir nas caraterísticas da "Dol ly".
[A]
735. Uma experiência realizada com coelhos (linhagem pura selvagem) consistiu em submetê-los a uma descarga excessiva de raio-X.
Após o experimento, podemos esperar várias reações, EXCETO:
a) produção de um filhote albino.
b) produção de filhotes anormais.
c) morte em conseqüência da dose de radiação.
d) tornaram-se albinos.
e) tornaram-se estéreis.
[D]
736. Recentemente, o mundo foi abalado pela notícia da produção do clone de uma ovelha. Nessa clonagem, utilizou-se o núcleo de uma célula da mama de uma
ovelha (A) e o citoplasma de um óvulo de outra ovelha (B). É CORRETO concluir que:
a) todos os cromossomos do clone são iguais aos da ovelha A.
b) os autossomos do clone são iguais aos da ovelha A, e os cromossomos sexuais são iguais aos da ovelha B.
c) todos os cromossomos do clone são iguais aos da ovelha B, e os cromossomos sexuais são iguais aos da ovelha A.
d) os autossomos do clone são iguais aos da ovelha B, e os cromossomos sexuais são iguais aos da ovelha A.
e) existem cromossomos no clone que são diferentes de A e de B.
[A]
737. Uma maneira de se obter um clone de ovelha é transferir o núcleo de uma célula somática de uma ovelha adulta A para um óvulo de uma outra ovelha B do qual foi
previamente eliminado o núcleo. O embrião resultante é implantado no útero de uma terceira ovelha C, onde origina um novo indivíduo. Acerca do material genético
desse novo indivíduo, pode-se afirmar que
a) o DNA nuclear e o mitocondrial são iguais aos da ovelha A.
b) o DNA nuclear e o mitocondrial são iguais aos da ovelha B.
c) o DNA nuclear e o mitocondrial são iguais aos da ovelha C.
d) o DNA nuclear é igual ao da ovelha A, mas o DNA mitocondrial é igual ao da ovelha B.
e) o DNA nuclear é igual ao da ovelha A, mas o DNA mitocondrial é igual ao da ovelha C.
[D]
738. Em fevereiro deste ano, um grupo de pesquisadores divulgou ao mundo a ovelha Dolly, obtido por meio da técnica de clonag em. Esses pesquisadores retiraram o
núcleo da célula de uma ovelha (A) e o implantaram num óvulo colhido de uma outra ovelha (B), do qual o núcleo fora previamente removido. Esse óvulo fora
posteriormente implantado no útero de uma terceira ovelha (C), originando Dolly. A partir dos dados envolvidos no experimento realizado pelos pesquisadores, pode-se
prever que Dolly apresente
a) constituição cromossômica da ovelha A e DNA mitocondrial da ovelha B.
b) constituição cromossômica e DNA mitocondrial da ovelha A.
c) constituição cromossômica e DNA mitocondrial da ovelha B.
d) constituição cromossômica da ovelha A e DNA mitocondrial da ovelha C.

104
e) constituição cromossômica e DNA mitocondrial correspondente a uma mistura das três ovelhas.
[A]
739. Na(s) questão (ões) adiante, escreva no espaço apropriado a soma dos itens corretos. Em parte motivada pela necessidade mundial de aumentar a produção de
alimentos, a ciência do melhoramento genético procura encontrar soluções que aumentem a produtividade de certas espécies. Mui tas vezes, usando técnicas
sofisticadas, os cientistas provocam modificações nessas espécies em busca de seus benefícios e atuam à semelhança da natureza. Leia o texto adiante e compare-o
com o esquema.
"Nos próximos meses chegam às lavouras dos Estados Unidos e Canadá sementes de milho, batata e algodão alteradas geneticament e em laboratório, para destruir as
pragas que atacam essas culturas. Os cientistas alteraram o código genético dessas sementes e, nos testes experimentais, escolheram e reproduziram aquelas cujas
plantas apresentassem a capacidade de produzir uma proteína inseticida. Essa proteína, quando ingerida com as folhas, matava os insetos que atacavam as
plantações. Livre dos mesmos, a produtividade das lavouras será bem maior." (Veja, 21/02/1996)
- Da comparação entre o texto e o esquema, é correto afirmar:

01) A afirmativa "Os cientistas alteraram o código genético dessas sementes" está relacionada somente ao item 1 do esquema.
02) A afirmativa "Os cientistas alteraram o código genético dessas sementes" está relacionada aos itens 1, 2 e 4 do esquema.
04) A afirmativa "nos testes experimentais, escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma proteína inseticida" está
relacionada aos itens 3 e 4 do esquema.
08) A afirmativa "nos testes experimentais, escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma proteína inseticida" está
relacionada aos itens 4 e 5 do esquema.
16) A afirmativa "Livre dos mesmos, a produtividade das lavouras será bem maior" refere-se ao item 6 do esquema.
01 + 08 + 16 = 25
740. "EXAME DE PATERNIDADE, NO BRASIL, JÁ PODE SER FEITO COM SALIVA"
"Novo teste pode, pela análise do DNA das células, identificar a paternidade de uma pessoa sem a necessidade de coleta de sangue. Esse tipo de teste é
particularmente indicado para bebês e crianças pequenas."
Nesse tipo de teste, a semelhança estrutural existente entre as moléculas de DNA é tomada por base para a identificação da paternidade. Essa diferença consiste na(o):
a) seqüência de bases nitrogenadas.
b) aspecto da dupla hélice presente.
c) número de fosfatos contidos.
d) tipo de pentose existente.
e) tipo de desoxirriboses presentes.
[A]
741. "Tracy é uma ovelha transgênica, capaz de produzir uma proteína humana cuja deficiência causa problema hepático e pulmonar". Analise as afirmativas a seguir,
referentes à técnica utilizada para obtenção da Tracy.
I. Animal transgênico é aquele que recebe e incorpora genes de outra espécie.
II. As substâncias utilizadas para isolar o gene a ser transplantado são denominados ENZIMAS TRANSGÊNICAS.
III. Para a ligação do DNA transplantado ao DNA hospedeiro a célula utiliza a ENZIMA LIGASE.
IV. A técnica do DNA recombinante foi utilizada para obtenção de Tracy.
Estão corretas apenas as afirmativas:
a) II e III. b) I, II e III. c) I, II e IV.
d) I, III e IV. e) II, III e IV.
[D]
742. Enquanto o projeto que visa seqüenciar completamente o genoma humano segue seu curso, nos últimos 2 anos chegaram ao fim vários seqüenciamentos do
genoma de bactérias. Em setembro de 1997, foi publicada a sequência do DNA da bactéria 'Escherichia coli.' Os números impressionam: são cerca de 4,6 milhões de
pares de bases, e os genes que codificam proteínas são 4.288. Para surpresa de muitos, 38% desses genes ainda não têm uma função conhecida. Com o auxílio do
texto, julgue os itens a seguir.
(1) O DNA da bactéria 'Escherichia coli' tem cerca de 9,2 milhões de moléculas de fosfato.
(2) Para 38% dos genes, não se sabe a sequência de amionoácidos da proteína.
(3) Pode-se fazer estudos da evolução das bactérias, comparando-se a sequência de DNA de diferentes espécies.
(4) A 'Escherichia coli' pode produzir 8.576 RNAs mensageiros diferentes.
CECE
743. Está em andamento o projeto GENOMA, pelo qual se pretende seqüenciar totalmente o DNA humano, ou seja, obter a seqüência de bases nitrogenadas do DNA
de todos os cromossomos de uma pessoa. A esse respeito, julgue os itens que se seguem.
(0) Uma vez obtida a seqüência de um gene, será possível conhecer a seqüência de aminoácidos da proteína correspondente.
(1) As seqüências obtidas corresponderão exatamente ao DNA de qualquer pessoa.
(2) A seqüência de todos os cromossomos será do mesmo tamanho.
(3) O projeto GENOMA tem levantado questões éticas, pelo eventual uso inadequado que se possa fazer do conhecimento obtido, como, por exemplo, a discriminação
de pessoas.
(4) Todos os genes terão a mesma proporção de adenina e guanina.
Itens corretos: 0 e 3
Itens errados: 1, 2 e 4
744. Os morangos de excelente qualidade que se encontram atualmente nos supermercados são produto principalmente de técnicas de propagação vegetativa "in vitro".
A partir de células de um morangueiro, faz-se uma cultura de tecidos e, a partir desta, obtêm-se plantas adultas. Essas técnica permite, por exemplo, a eliminação de
infecções virais presentes na planta-mãe e que, pelo procedimento tradicional, seriam passadas para as plantas-filhas. Com base nessa informação, julgue os itens
adiante.
(1) As plantas obtidas de uma mesma cultura de tecidos são geneticamente iguais.
(2) Uma vantagem dessa técnica é que as plantas produzidas não são suscetíveis ao ataque de pragas.
(3) A cultura de tecidos vegetais facilita o melhoramento genético de plantas, pois as células podem ser manipuladas geneticamente e, a partir delas, podem-se obter
indivíduos adultos com características alteradas.
(4) Uma vez obtida uma variedade de morangueiro com as características ideais, não se justifica preservar as variedades silvestres, muito menos produtivas.

105
Itens corretos: 1 e 3
Itens errados: 2 e 4
745. Desde que Watson e Crick propuseram um modelo para a estrutura do DNA, em 1953, tem-se constatado um progresso fantasticamente acelerado da Biologia
Molecular, do que é exemplo a recente clonagem de uma ovelha. Julgue os itens a seguir, acerca do referido ácido nuc léico.
(1) Apesar de ser o sexto elemento mais abundante no universo e o mais versátil de todos, o carbono não faz parte da estrutur a do DNA.
(2) A coloração de cromossomos com vários matizes é uma técnica atual que se baseia no uso de vários corantes para os diferentes lipídios que constituem os
cromossomos.
(3) No processo de recombinação entre cromátides, ocorre a troca de, no mínimo, um segmento de DNA que corresponde a um gene funcional.
(4) As mutações gênicas implicam necessariamente a modificação do fenótipo do indivíduo.
(5) Nos processos de fecundação natural, a mãe transmite maior quantidade de DNA para o filho do que o pai.
Item correto: 5
Itens errados: 1, 2, 3 e 4
746. As técnicas modernas de biologia molecular têm permitido a inserção de segmentos novos de DNA em células vegetais, em crescimento no meio apropriado, para
gerar uma nova planta com novas características. Estes novos segmentos de DNA introduzidos podem, por exemplo, gerar novas pl antas com reservas modificadas de
lipídios, amido e proteínas em suas sementes ou melhorar a resistência das plantas a pestes e vírus ou ainda aumentar a sobrevivência dest es organismos em
ambientes adversos.
Estas novas plantas são exemplos de organismos criados por engenharia genética e são genericamente conhecidos como:
a) reversos
b) recessivos
c) dominantes
d) transgênicos
[D]
747. Se retirarmos o núcleo de uma célula-ovo de rã e o substituirmos por outro núcleo diplóide de uma célula de tecido epitelial normal de rã já adulta, a nova célula-ovo
assim formada será capaz de produzir outra rã normal.
Dentre as alternativas a seguir, a que apresenta a melhor explicação sobre o que ocorre neste caso, em relação à sequência funcional do DNA da célula diplóide
doadora, é:
a) foi integralmente inativada
b) foi integralmente mantida ativa
c) expressou-se como na célula epitelial
d) expressou-se como na célula germinativa
[B]
748. Recentemente foi noticiada a criação de uma planta transgênica, capaz de produzir hemoglobina. Para que isso fosse possível, essa planta recebeu:
a) os anticódons que determinam a seqüência de aminoácidos nessa proteína.
b) os ribossomos utilizados na produção dessa proteína.
c) o fragmento de DNA, cuja seqüência de nucleotídeos determina a seqüência de aminoácidos da hemoglobina.
d) O RNAm que carrega os aminoácidos usados na síntese de hemoglobina.
e) somente os aminoácidos usados nessa proteína.
[C]
749. Na Argentina, durante a ditadura militar iniciada em 1976, muitas crianças foram seqüestradas com seus pais ou nasceram em centros clandestinos de detenção.
Essas crianças foram adotadas, vendidas ou abandonadas em orfanatos. A Associação Civil "Avós da Praça de Maio" tem buscado l ocalizar essas crianças com a
finalidade de restituí-las a suas famílias legítimas, empregando para isso testes de identificação genética, que são possíveis, atualmente, mesmo na ausência dos pais.
A comparação entre os DNAs mitocondriais de possíveis netos e avós tem sido um dos testes utilizados nesses processos de identificação de parentesco.
A escolha desse teste está relacionada com o fato
a) de o DNA mitocondrial, por ser herdado da avó materna, através das mitocôndrias existentes no citoplasma do ovócito da mãe, permitir traçar árvores familiares
confiáveis.
b) de o DNA mitocondrial, por ser herdado das duas avós, através de uma mistura dos genes do pai e da mãe, garantir um registro familiar que se mantém de geração a
geração.
c) de o DNA mitocondrial, por ser herdado da avó paterna, através das mitocôndrias existentes no citoplasma do ovócito da mãe, permitir traçar árvores familiares
confiáveis.
e) de o DNA mitocondrial, por ser herdado do avô paterno, através das mitocôndrias existentes no citoplasma do espermatozóide do pai, permitir identificar a filiação
com segurança.
[A]
750. Maria teve um filho, e Pedro, seu ex-namorado, nega a paternidade da criança, alegando que o filho pode ser de Paulo (irmão de Pedro), ou de João (primo de
Pedro), ou ainda de um vizinho, Antônio. Para solucionar esse impasse, a família de Maria resolveu fazer um teste de paternidade, e o resultado foi o seguinte.

Assinale a alternativa que interpreta corretamente os resultados do teste.


a) A criança não é filha de nenhum dos supostos pais, pois todos os resultados foram menores que 85%.
b) A criança é filha de Pedro, pois, aproximadamente, 50% dos genes são herdados da mãe e 50%, do pai.
c) A criança é filha de João, pois, para se hibridizarem, os DNAs devem ser diferentes.
d) O teste não foi conclusivo, pois deveríamos ter hibridizado o DNA do pai com o da mãe.
e) Pedro e Paulo são, na verdade, irmãos adotivos.
[B]
751. Todas as alternativas apresentam aplicações da tecnologia do DNA recombinante nas duas últimas décadas, EXCETO
a) Investigação de paternidade e criminalística.
b) Recuperação de espécies extintas.
c) Produção, em bactérias, de proteínas humanas de interesse médico.
d) Terapia gênica de algumas doenças hereditárias.
[B]

106
752. Um pesquisador injetou RNA mensageiro (mRNA) de vírus em ovócitos de anfíbios. Após certo tempo, verificou que ess es ovócitos, além de suas próprias
proteínas, produziam, também, proteínas virais.
Esses dados sugerem que
a) o DNA dos ovócitos foi impedido de se expressar.
b) o mRNA se integrou ao DNA dos ovócitos, comandando a síntese da proteína viral.
c) o material injetado nos ovócitos foi capaz de se autoduplicar.
d) os ovócitos foram capazes de interpretar a informação contida no mRNA viral.
[D]
753. A seqüência a seguir indica de maneira simplificada os passos seguidos por um grupo de cientistas para a clonagem de uma vaca:
I. Retirou-se um óvulo da vaca Z. O núcleo foi desprezado, obtendo-se um óvulo anucleado.
II. Retirou-se uma célula da glândula mamária da vaca W. O núcleo foi isolado e conservado, desprezando-se o resto da célula.
III. O núcleo da célula da glândula mamária foi introduzido no óvulo anucleado. A célula reconstituída foi estimulada para entrar em divisão.
IV. Após algumas divisões, o embrião foi implantado no útero de uma terceira vaca Y, mãe de aluguel. O embrião se desenvolveu e deu origem ao clone.
Considerando-se que os animais Z, W e Y não têm parentesco, pode-se afirmar que o animal resultante da clonagem tem as características genéticas da vaca.
a) Z, apenas b) W, apenas c) Y, apenas
d) Z e da W, apenas e) Z, W e Y
[B]
754. A seqüência a seguir indica de maneira simplificada os passos seguidos por um grupo de cientistas para a clonagem de uma vaca:
I. Retirou-se um óvulo da vaca Z. O núcleo foi desprezado, obtendo-se um óvulo anucleado.
II. Retirou-se uma célula da glândula mamária da vaca W. O núcleo foi isolado e conservado, desprezando-se o resto da célula.
III. O núcleo da célula da glândula mamária foi introduzido no óvulo anucleado. A célula reconstituída foi estimulada para entrar em divisão.
IV. Após algumas divisões, o embrião foi implantado no útero de uma terceira vaca Y, mãe de aluguel. O embrião se desenvolveu e deu origem ao clone.
Se a vaca Y, utilizada como "mãe de aluguel", for a mãe biológica da vaca W, a porcentagem de genes da "mãe de aluguel", pres ente no clone será
a) 0 % b) 25 % c) 50 % d) 75 % e) 100 %
[C]
755. CHEGA AO MERCADO UM NOVO FÁRMACO
INTEIRAMENTE DESENVOLVIDO NO PAÍS
A insulina humana recombinante (IH-r), um dos mais significativos produtos do avanço científico nacional na área da engenharia genética, está prestes a
chegar ao mercado, com o nome de Biohulin: a empresa BIOBRÁS, uma das quatro empresas em todo o mundo e a única no hemisfério sul a deter a tecnologia de
produção desta insulina, inicia em 1999 a comercialização do produto.
Uma parceria entre a BIOBRÁS e a Universidade de Brasília (UnB), em 1988, deu início aos trabalhos. Ao grupo da UnB coube a parte de B iologia Molecular,
desenvolvendo clones de bactérias produtoras de insulina. Esta conquista tecnológica permitirá o desenvolvimento de outros medicamentos, como o hormônio de
crescimento, o interferon e a calcitonina.
Informe PADCT/Ministério da Ciência e Tecnologia, jan/99, p.7(com adaptações).
Com o auxílio do texto, julgue os itens abaixo.
(1) As técnicas de engenharia genética permitem a recombinação de genes entre organismos totalmente diferentes.
(2) Para que uma bactéria passe a produzir insulina humana, ela deve receber altas doses dessa proteína.
(3) O Biohulin será um medicamento destinado ao tratamento de diabéticos.
(4) A partir da insulina produzida por bactérias, pode ser obtido o hormônio de crescimento.
VFVF
756. No filme "Jurassic Park", de Steven Spielberg, cientistas retiraram do intestino de insetos hematófagos fósseis moléculas de DNA de dinossauros. A reconstituição
dessas moléculas teria sido feita através da inserção de fragmentos de DNA de rã.
Apesar da eficiência proposta no filme, na prática esse procedimento é extremamente improvável porque:
a) seria necessário encontrar um genoma completo e conhecer sua ordem nos cromossomas.
b) a composição química do DNA dos dinossauros é diferente das encontradas em espécies atuais.
c) as características do organismo se devem à estrutura primária das proteínas e não do DNA.
d) o DNA coletado sofre mutações durante o período em que ficou fossilizado.
e) não existem técnicas para a inserção de fragmentos de DNA de uma espécie em outra.
[A]
757. Pesquisadores de alguns centros de pesquisa brasileiros, utilizando técnicas de engenharia genética, obtiveram, recentem ente, plantas que produzem proteínas
humanas, entre as quais o hormônio do crescimento (GH). Estas plantas são chamadas transgênicas.
Considere estas informações e assinale a opção incorreta:
a) O gene para a produção de GH é, em geral, introduzido no plasmídeo antes de sua introdução na célula vegetal.
b) a utilização de células vegetais diminui a possibilidade de contaminação humana por vírus animais.
c) Antes de se obter a planta produtora de GH é necessária a produção do DNA recombinante.
d) O RNA mensageiro, relacionado ao GH, quando introduzido na célula vegetal é transcrito em DNA na presença da enzima transcriptase vegetal.
e) O DNA relacionado à síntese do GH pode ser obtido a partir do RNA mensageiro.
[D]
758. No vaga-lume há um gene que determina produção de luciferase, enzima responsável pela oxidação da substância luciferina, levando à produção de luz.
Através da engenharia genética, esse gene foi transferido para uma célula vegetal e, a partir desta, obteve-se uma planta inteira. Após ser regada com solução de
luciferina, a referida planta começou a emitir luz.
O resultado desse experimento indica que a planta
a) incorporou um segmento de RNA do vaga-lume, a partir do qual as células da planta produziram RNA e luciferase.
b) incorporou um segmento de RNA do vaga-lume, a partir do qual as células da planta produziram DNA e luciferase.
c) incorporou um segmento de DNA do vaga-lume, que possibilitou às células da planta a produção de luciferase.
d) incorporou um segmento de DNA do vaga-lume, que não possibilitou a produção de RNA e nem de luciferase.
e) não expressou o gene do vaga-lume.
[C]
759. Em anfíbios, realizaram-se experimentos em que os núcleos de células embrionárias foram transplantados para ovos de anfíbios, que tiveram seus núcleos
retirados.
Considerando-se o total de ovos que não rejeitaram o núcleo transplantado, foi montado o gráfico a seguir:

107
A explicação para a diferença refletida no gráfico é que:
a) os núcleos de mórula estão em um estágio em que todos os genes estão reprimidos.
b) os núcleos de mórula são geneticamente distintos dos outros núcleos em questão.
c) os núcleos de blástula e gástrula não receberam os estímulos citoplasmáticos necessários para o desenvolvimento do embrião.
d) os núcleos de blástula e gástrula têm seus produtos gênicos eliminados por mecanismos de regulação.
e) os núcleos de gástrula já se encontram em estágio de diferenciação.
[E]
760. Os conhecimentos científicos envolvendo a "clonagem" têm proporcionado à humanidade grandes avanços e su a utilização em vegetais tem sido mais fácil e
menos controversa que em animais, porque
a) os mecanismos de regulação gênica nos vegetais são mais simples, devido ao seu menor grau de complexidade.
b) os embriões resultantes da clonagem em vegetais são mais resistentes às modificações ambientais.
c) os vegetais apresentam, em sua maioria, a capacidade de propagação vegetativa, o que facilita a continuidade do processo.
d) a regulação hormonal da reprodução nos vegetais é mais facilmente controlada pelos cientistas.
e) os vegetais produzem maior número de embriões por indivíduo, o que diminui a perda, em caso de rejeição.
[C]
761. Os bacteriófagos são constituídos por uma molécula de DNA envolta em uma cápsula de proteína. Existem diversas espécies, que diferem entre si quanto ao DNA
e às proteínas constituintes da cápsula. Os cientistas conseguem construir partículas virais ativas com DNA de uma espécie e cápsula de outra. Em um experimento, foi
produzido um vírus contendo DNA do bacteriófago T2 e cápsula do bacteriófago T4.
Pode-se prever que a descendência desse vírus terá:
a) cápsula de T4 e DNA de T2.
b) cápsula de T2 e DNA de T4.
c) cápsula e DNA, ambos de T2.
d) cápsula e DNA, ambos de T4.
e) mistura de cápsulas e DNA de T2 e de T4.
[C]
762. Em 1978, registrou-se o nascimento do primeiro bebê gerado 'in vitro'. Desde então, alguns aspectos éticos importantes vêm sendo discutidos em r elação às
conseqüências da aplicação de técnicas de reprodução humana assistida sobre o equilíbrio genético de populações humanas.
Todas as alternativas apresentam procedimentos que podem alterar esse equilíbrio genético, EXCETO
a) Clonagem
b) Doação de embriões
c) Seleção de embriões
d) Seleção de sexo
[B]
763. Considere uma população em que metade dos indivíduos mantém-se heterozigota para um dado gene(Aa), enquanto que a outra metade é composta por
indivíduos duplo-recessivos(aa).
Nessa população a frequência do alelo A é
a) impossível de se determinar.
b) 1,00. c) 0,75. d) 0,50. e) 0,25.
[E]
764. No heredograma adiante o indivíduo 3 é afetado pelo albinismo. Sabendo-se que, na população, a frequência de heterozigoto para o albinismo é de 1/50, qual é a
probabilidade de que o casal 4x5 tenha uma menina albina?

P = 1/600
765. A frequência de indivíduos afetados por uma anomalia genética autossômica recessiva, em uma dada população, era de 0,16. Constatou-se a diminuição dessa
frequência após
a) a morte de 5% da população total por falta de alimento.
b) a imigração de muitos indivíduos homozigotos dominantes.
c) o nascimento de 48 indivíduos afetados entre 300 nascidos.
d) o casamento preferencial de indivíduos heterozigotos.
e) o crescimento da população da população devido a diminuição da predação.
[B]

108
766. O gráfico a seguir mostra a dinâmica das freqüências do gene s, o qual determina a doença chamada siclemia ou anemia falciforme. Os homozigotos siclêmicos
morrem precocemente devido à severa anemia; os heterozigotos sofrem de uma forma branda da anemia mas, por outro lado, são mais resistentes à malária que os
indivíduos normais.
O gráfico refere-se ao período posterior à erradicação da malária.
Qual a explicação para o comportamento das curvas do gráfico?

a) Diminuição da freqüência de mutação de S para s.


b) Seleção contra os portadores do gene s.
c) Aumento da freqüência de mutação de S para s.
d) Cruzamentos preferenciais entre pessoas anêmicas.
e) Cruzamentos preferenciais entre portadores de malária.
[B]
767. Uma população humana foi testada quanto ao sistema MN de grupos sanguíneos.
Os dados obtidos compõem a tabela a seguir:

a) Quais as freqüências dos alelos M e N nessa população?


b)Essa população está em equilíbrio de Hardy-Weinberg para esse loco gênico?
Nº total de alelos na população = 12258 (cada pessoa tem dois alelos)
Nº de alelos M = 6613
Nº de alelos N = 5645
freqüência do alelo M = 6613/12258 = 0,54
freqüência do alelo N = 5645/12258 = 0,46
A população está em equilíbrio porque as freqüências de aproximam da distribuição binomial (p + q) 2 = 1, sendo p a freqüência do alelo M e q a freqüência do alelo N.
768. Uma população em equilíbrio é constituída de 500 indivíduos, dos quais 45 apresentam um fenótipo determinado por gene recessivo.
Com base nesses dados é INCORRETO afirmar-se que
a) a freqüência de indivíduos com fenótipo dominante é 91%
b) cerca de 10% da população é homozigota.
c) o gene dominante é mais freqüente que o recessivo.
d) 30% dos gametas produzidos carregam o alelo recessivo.
e) os heterozigotos representam 42% da população.
[B]
769. A cor da raiz da cenoura é controlada por um par de genes autossômicos. O gene B é responsável pela cor branca e seu alelo recessiv o, pela cor amarela.
Um agricultor colheu 20.000 sementes de uma população panmítica, que se cruza ao acaso, das quais 12.800 desenvolveram plantas com raízes brancas.
A partir dessas informações pode-se afirmar que
a) a freqüência do gene para coloração amarela é de 36% nessa população.
b) a freqüência de heterozigotos nessa população é de 24%.
c) a freqüência de plantas com raízes amarelas será de 64% se a população se mantiver em equilíbrio.
d) a probabilidade de formação de gametas B é de 80% nessa população.
e) a probabilidade de ocorrência de homozigotos nessa população é de 52%.
[E]
770. O gráfico mostra as relações entre as freqüências dos alelos A e a e as freqüência genotípicas AA, Aa e aa numa população em equilíbrio.

109
Numa população em equilíbrio, em que os casamentos ocorrem ao acaso e a freqüência dos genes A e a é de 50%, para cada um. A probabilidade de se encontrarem
indivíduos AA, Aa e aa é, respectivamente,
a) 25%, 50% e 25%.
b) 40%, 30% e 30%.
c) 50%, 25% e 25%.
d) 70%, 15% e 15%.
e) 80%, 10% e 10%.
[A]
771. Numa população em equilíbrio, a freqüência de indivíduos Rh negativos é de 16%.
A probabilidade de ocorrência de indivíduos heterozigotos nessa população é
a) 84%. b) 60%. c) 48%. d) 36%. e) 24%.
[C]
772. Numa população a freqüência do gene dominante W é 0,7. A probabilidade de um indivíduo desta população ser heterozigoto Ww é igual a:
a) 9/100. b) 49/100. c) 3/10. d) 42/100. e) 1/2.
[D]
773. Numa população em equilíbrio de Hardy-Weinberg, formada por 10.000 indivíduos, existem 900 do tipo Rh negativo. Espera-se que o número de indivíduos Rh
positivo homozigoto nessa população seja de
a) 9.100 b) 4.900 c) 4.550 d) 2.100 e) 900
[B]
774. A hemofilia é causada por um gene recessivo (h) localizado no cromossomo X. Se, numa determinada população, um homem em 25.000 é hemofílico, a freqüência
do gene h nessa população é
a) 1/500 b) 1/12.500 c) 1/25.000
d) 1/50.000 e) 1/100.000
[C]
775. A anemia falciforme ou siclemia é uma doença hereditária que leva à formação de hemoglobina anormal e, conseqüentemente, de hemácias que se deformam. É
condicionada por um alelo mutante s. O indivíduo SS é normal, o Ss apresenta anemia atenuada e o ss geralmente morre. Supondo populações africanas com
incidência endêmica de malária, onde a anemia falciforme não sofra influência de outros fatores e onde novas mutações não estejam ocorrendo, a freqüência do gene
a) S permanece constante.
b) S tende a diminuir.
c) S tende a aumentar.
d) s permanece constante.
e) s tende a aumentar.
[C]
776. A anemia falciforme ou siclemia é uma doença hereditária que leva à formação de hemoglobina anormal e, conseqüentemente, de hemácias que se deformam. É
condicionada por um alelo mutante s. O indivíduo SS é normal, o Ss apresenta anemia atenuada e o ss geralmente morre. Verific ou-se que em populações de regiões
onde a malária é endêmica, os heterozigotos (Ss) são mais resistentes à malária do que os normais (SS). Nesse caso são verdadeiras as afirmações a seguir, EXCETO:
a) A malária atua como agente seletivo.
b) O indivíduo ss leva vantagem em relação ao SS.
c) O indivíduo Ss leva vantagem em relação ao SS.
d) Quando a malária for erradicada, ser heterozigoto deixará de ser vantagem.
e) Quando a malária for erradicada, haverá mudança na freqüência gênica da população.
[B]
777. Numa determinada população a capacidade de enrolar a língua é determinada por um gen dominante A. Nessa mesma população foi observado que 64% das
pessoas apresentam esta característica. A freqüência esperada de indivíduos heterozigotos será de:
a) 70% b) 48% c) 36% d) 16% e) 10%
[B]
778. Sabendo-se que a freqüência de um gene recessivo a, numa população, é 0,1, as freqüências genotípicas esperadas para essa população, se estiver em equilíbrio,
serão:
a) AA - 0,9; Aa - 0,09; aa - 0,01
b) AA - 0,81; Aa - 0,18; aa - 0,01
c) AA - 0,81; Aa - 0,09; aa - 0,1
d) AA - 0,72; Aa - 0,18; aa - 0,1
e) AA - 0,25; Aa - 0,50; aa - 0,25
[B]
779. Sabe-se que olhos escuros são dominantes sobre olhos azuis. Sabe-se também que, na maioria das populações da América do Sul predomina o número de
pessoas de olhos escuros, enquanto em diversas populações européias acontece o inverso: pessoas de olhos escuros constituem a minoria. Essa diferença deve-se
fato de
a) a herança da cor dos olhos não obedecer às leis de Mendel.
b) a mecanismo de herança da cor dos olhos não ser ainda bem conhecido.
c) a dominância dos genes relacionados com a cor dos olhos modificar-se com o ambiente.
d) a freqüência dos alelos para olhos escuros ser maior nas populações sul-americanas do que nas européias.
e) tratar-se de um caso de herança quantitativa, que sempre é influenciada por fatores ambientais.
[D]

110
780. A doença de Tay-Sachs resulta da ação de um gene mutante localizado no cromossomo número 15, provocando a degenerescência nervosa mortal. O diagnóstico
pré-natal é possível, e há tentativas de tratamento com algum sucesso em poucos casos. Em certas comunidades da Europa Central, uma em cada 30 pessoas
apresenta fenótipo normal e é heterozigota quanto ao gene determina a doença de Tay-Sachs.
Em 2.700 casamento ocorridos entre membros sadios dessas comunidades, o número esperado de casamentos com ri sco de gerar crianças com degenerescência
nervosa é:
a) 0,3 b) 3 c) 45 d) 60 e) 90
[B]
781. Em uma população em equilíbrio de Hardy-Weinberg, a freqüência do alelo autossômico (b) é de 30%. Se essa população for formada por 1000 indivíduos, espera-
se que sejam heterozigotos
a) 700 b) 420 c) 90 d) 49 e) 21
[B]
782. Analise o heredograma a seguir no qual os símbolos escuros significam a presença de uma anomalia.

Sabendo-se que a freqüência de heterozigotos na população é 1/20, a probabilidade do casal III.1 x III.2 vir a ter uma criança com a anomalia é
a) 1/420 b) 1/160 c) 1/120 d) 1/80 e) 1/50
[C]
783. Uma população em que atuam os princípios postulados por Hardy e Weinberg, as freqüências genotípicas de um determinado par de alelos "a" se distribui de
acordo com o gráfico destacado:
Marque o gráfico que representa a freqüência genotípica após 12 gerações:

[E]
784. Na espécie humana, há certas proteínas no sangue que permitem classificar as pessoas como pertencentes ao tipo sangüíneo M, N ou MN. Essa característica é
determinada por um par de alelos entre os quais não há dominância. Se em uma população em equilíbrio de Hardy -Weinberg, a freqüência de indivíduos do grupo M é
49%, as freqüências esperadas de indivíduos dos grupos N e MN são, respectivamente,
a) 9% e 42% b) 17% e 34% c) 18% e 21%
d) 21% e 18% e) 34% e 17%
[A]
785. Suponha que uma variedade de determinada planta possua um gene que lhe confere vantagem em relação a uma outra variedade da mesma população. Com o
tempo, a freqüência desse gene tende a aumentar devido
a) ao fato de ser recessivo.
b) às mutações que continua a sofrer.
c) à seleção natural.
d) ao seu efeito dominante.
e) à oscilação genética.
[C]
786. A sensibilidade (gosto amargo) do ser humano ao PTC (feniltiocarbamida) se deve a um gene autossômico dominante I e a insensibilidade, ao seu alelo recessiv o i.
Sabendo-se que, numa população de 1200 pessoas, as freqüências dos genes I e i são, respectivamente, 0,8 e 0,2, os números esperados de pessoas sensíveis e
insensíveis nessa população são, respectivamente:
a) 960 e 240. b) 768 e 432. c) 1008 e 192.
d) 1152 e 48. e) 816 e 384.
[D]
787. Para se determinar o tipo sangüíneo de uma pessoa, foram colocadas três gotas de seu sangue sobre uma lâmina de vidro, adicionando-se, a cada uma, soros
anti-A, anti-Rh e anti-B, conforme o esquema adiante. Após alguns segundos, notou-se aglomeração de hemácias apenas no local onde havia soros anti-B e anti-A.
Com relação a esses resultados, assinale a opção correspondente ao possível genótipo da pessoa em teste:

111
a) IAIARR b) IAIBrr c) IBiRr d) IAirr e) iiRR
[B]
788. Duas mulheres disputam a maternidade de uma criança, que, ao nascer, apresentou a doença hemolítica ou eritroblastose fetal. O sangue das duas mulheres foi
testado com o uso do soro anti-Rh (anti-D) como mostra o esquema a seguir.

Qual das mulheres poderia ser a verdadeira mãe daquela criança? Justifique sua resposta.
A mãe da criança é a mulher número dois porque é Rh negativo já que seu sangue não sofre aglutinação em presença de soro anti-Rh (anti-D).
789. Um banco de sangue possui 5 litros de sangue tipo AB, 3 litros de tipo A, 8 litros B e 2 litros O. Para transfusões em i ndivíduos O, A, B e AB estão disponíveis,
respectivamente:
a) 2, 5, 10 e 18 litros.
b) 2, 3, 5 e 8 litros.
c) 18, 8, 13 e 5 litros.
d) 2, 3, 8 e 16 litros.
e) 2, 5, 18 e 10 litros.
[A]
790. No heredograma a seguir estão indicados os fenótipos dos grupos sangüíneos ABO e Rh.
O indivíduo 6 deverá ser, em relação aos locos
dos sistemas ABO e Rh, respectivamente:

a) heterozigoto - heterozigoto.
b) heterozigoto - homozigoto dominante.
c) heterozigoto - homozigoto recessivo.
d) homozigoto - heterozigoto.
e) homozigoto - homozigoto dominante.
[A]
791. Utilizando-se três lâminas de microscopia, foi colocada uma gota de sangue humano em cada uma delas. A cada gota foi juntada igual quantidade de soro anti-A na
primeira, soro anti-B na segunda e soro anti-Rh na terceira. Após a mistura do sangue com os respectivos soros, foi observada aglutinação nas duas primeiras lâminas.
A partir desses dados podemos afirmar que o indivíduo, quanto aos grupos sanguíneos ABO e fator Rh, é:
a) B e Rh positivo.
b) AB e Rh negativo.
c) A e Rh negativo.
d) AB e Rh positivo.
e) A e Rh positivo.
[B]
792. A afirmação que uma mulher Rh- não deve casar-se com um homem Rh+:
a) é correta, pois todos os filhos desse casal serão abortados.
b) é correta, pois todos os filhos desse casal terão uma doença grave fetal caracterizada por uma anemia profunda (Eritroblastose fetal).
c) é incorreta, pois o primeiro filho em geral não tem a anemia, mesmo sendo Rh+, bem como todos os filhos Rh- não serão atin gidos pela doença e esta só atinge uma
pequena fração de casos em outras gestações de filhos Rh+.

112
d) é incorreta, pois filhos Rh+, mesmo no caso de glóbulos vermelhos atingirem a circulação materna em sucessivas gestações, não serão atingidos pela Eritroblastose
fetal.
e) é incorreta, pois não existe influência do fator Rh positivo ou negativo nos casos de Eritroblastose fetal.
[C]
793. A herança do sistema ABO é do tipo:
a) com dominância. b) quantitativa. c) polialelia.
d) pleiotropia. e) poligênica.
[C]
794. Qual das opções a seguir relaciona os grupos sangüíneos de um doador universal ideal?
a) ARh- b) ABRh+ c) Orh+
d) ABRh- e) ORh-
[E]
795. Uma mulher com útero infantil, RH+ homozigota, casa-se com um homem RH-. Impedida de ter filhos, o casal decide ter um "bebê de proveta" e contrata uma "mãe
de aluguel" para receber em seu útero o zigoto formado por aquele casal. O que o casal não sabia é que a "mãe de aluguel" tivera três filhos, sendo que o último
apresentara a doença hemolítica do recém-nascido. A probabilidade de o "bebê de proveta" nascer com a doença hemolítica do recém-nascido é:
a) mínima, visto que seu pai é RH-.
b) mínima, visto que sua mãe genética é RH+.
c) alta, já que o "bebê de proveta", com absoluta certeza, será RH+.
d) nula, visto que a doença hemolítica do recém-nascido só ocorre quando a mãe é RH- e o pai RH+.
e) alta, pois a "mãe de aluguel" é RH+.
[C]

796. Um determinado banco de sangue possui 4 litros de sangue tipo AB, 7 litros de sangue tipo A, 1 litro de sangue tipo B e 9 litros de sangue tipo O, todos Rh+. Se
houver necessidade de transfusões sanguíneas para um indivíduo com sangue tipo AB, Rh+, estarão disponíveis para ele, do total acima mencionado:
a) 4 litros. b) 8 litros. c) 12 litros. d) 13 litros. e) 21 litros.
[E]
797. A tabela a seguir foi elaborada a partir de testes para determinação dos grupos sangüíneos de seis pessoas de uma academia de ginástica. O sinal positivo (+)
significa "aglutina" e o sinal negativo (-) significa "não aglutina". Após analisar a tabela, assinale a alternativa que indica os grupos sangüíneos de todas as pessoas
quanto aos sistemas ABO e Rh, mantendo a seqüência disposta na tabela.

a) O, Rh-/ AB, Rh+/ B, Rh-/ A,Rh+/ O,Rh+/ A,Rh-


b) O, Rh+/ AB, Rh-/ B, Rh+/ A, Rh-/ O, Rh-/ A, Rh+
c) AB, Rh-/ O, Rh+/ A, Rh-/ B, Rh+/ AB, Rh+/ B, Rh-
d) AB, Rh+/ O, Rh-/ A, Rh+/ B, Rh-/ AB, Rh-/ B, Rh+
e) AB, Rh+/ O, Rh-/ B, Rh+/ A, Rh-/AB, Rh-/ A, Rh+
[D]
798. Num caso de investigação de paternidade, foram realizados exames para identificação de grupos sangüíneos e análise de DNA. A tabela a seguir resume os
resultados parciais da análise de grupos sangüíneos (do menino, de sua mãe e do suposto pai) e de duas seqüências de DNA ( do menino e do suposto pai),
correspondentes a um segmento localizado num autossomo e outro no cromossomo X.
Considerando apenas a tabela adiante, podemos afirmar que:

a) os resultados dos grupos sangüíneos excluem a possibilidade do homem ser o pai da criança; os outro exames foram desnecess ários.
b) os resultados dos grupos sangüíneos não excluem a possibilidade do homem ser o pai da criança, mas a seqüência de DNA do cromossomo X exclui.
c) os resultados dos grupos sangüíneos e de DNA não excluem a possibilidade do homem ser pai da criança.
d) os três resultados foram necessários para confirmar que o homem é mesmo o pai da criança.
e) os resultados de DNA contradizem os resultados dos grupos sangüíneos.
[C]
799. Nas hemáceas de um indivíduo pertencente ao grupo sangüíneo B:
a) existe o aglutinógeno B
b) existe o aglutinógeno A
c) existe a aglutinina A
d) existe a aglutinina B
e) existem o aglutinógeno A e a aglutinina B
[A]

113
800. A incompatibilidade materno-fetal ao antígeno Rh pode determinar um doença denominada Eritroblastose Fetal. Se uma mulher foi orientada a usar a vacina a nti-
Rh logo após o nascimento do primeiro filho, podemos dizer que seu fator Rh, o do seu marido e o da criança são, respectivamente:
a) negativo; negativo; negativo.
b) negativo; negativo; positivo.
c) negativo; positivo; positivo.
d) positivo; negativo; positivo.
e) positivo; positivo; negativo.
[C]
801. Uma mulher Rh+, cujo pai é Rh-, é casada com um homem Rh+, cuja mãe é Rh-. A probabilidade desse casal vir a ter uma cri ança Rh- é de
a) 100% b) 75% c) 50% d) 25% e) 0%
[D]
802. Uma mulher com grupos sangüíneos B, N, Rh+ teve três crianças com pais distintos:
CRIANÇAS
I. O, MN, Rh-
II. AB, N, Rh+
III. B, N, Rh-
PAIS
a. A, N, Rh-
b. A, M, Rh-
c. B, N, Rh+
Assinale a alternativa que relaciona corretamente cada criança ao seu pai.
a) I - a; II - b; III - c
b) I - a; II - c; III - b
c) I - b; II - a; III - c
d) I - b; II - c; III - a
e) I - c; II - b; III – a
[C]
803. O heredograma a seguir representa uma família na qual foram determinados os grupos sangüíneos do sistema ABO para alguns dos membros, e do sistema Rh
para todos os membros.
Com base nas informações contidas no heredograma e em seus conhecimentos sobre o assunto, é INCORRETO afirmar-se que

a) a probabilidade do indivíduo I-2 formar gametas iR é de 50%.


b) a probabilidade de II-4 ter uma criança com eritroblastose fetal é de O%.
c) os indivíduos Rh-positivos da geração II pertencem ao grupo sangüíneo A, e os Rh-negativos, ao grupo O.
d) o indivíduo I-1 é heterozigoto para uma das características.
e) os indivíduos II-3 e II-4 podem apresentar os dois tipos de aglutinina do sistema ABO.
[C]
804. A eritroblastose fetal é uma doença hemolítica adquirida apresentada por alguns recém-nascidos, sendo observado, além da anemia, icterícia e aumento do baço e
fígado. Esta condição é provocada por incompatibilidade sangüínea do fator Rh, exclusivamente:
a) quando a mãe é Rh+ e o filho Rh-;
b) quando a mãe é Rh- e o filho Rh+;
c) quando a mãe é Rh- e o pai Rh+;
d) quando a mãe é Rh+ e o pai Rh-;
e) independente do Rh materno, o filho é Rh-.
[B]
805. Observe a árvore genealógica a seguir, para o grupo sangüíneo (ABO) em uma família:
Legenda:
Grupo "A": A/A ou A/O
Grupo "B": B/B ou B/O
Grupo "AB": A/B
Grupo "O": O/O

OBS:
1. O indivíduo 2 é mulher do grupo sangüíneo "A"

114
2. O indivíduo 4 é homem do grupo sangüíneo "B"
3. O indivíduo 5 é mulher do grupo sangüíneo "O"
Sobre a árvore anterior, marque a opção correta:
a) o indivíduo 3 é do grupo sangüíneo "AB"
b) o indivíduo 1 pode ser do grupo sangüíneo "AB"
c) o indivíduo 1 é do grupo sangüíneo "A"
d) o indivíduo 1 é do grupo sangüíneo "O"
[B]
806. Considerando os casamentos a seguir, uma criança de tipo sangüíneo B, Rh+ poderá ser filha:

a) somente do casal I.
b) do casal I ou do casal IV.
c) o casal III ou do casal IV.
d) somente do casal II
e) do casal I ou do casal II ou do casal III.
[E]
807. Na(s) questão(ões) a seguir julgue os itens e escreva nos parentesses (V) se for verdadeiro ou (F) se for falso. A eluci dação de crimes, como também a
identificação da paternidade, vêm sendo efetuadas com certa facilidade e segurança através do uso de técnicas apropriadas, em que são considerados básicos alguns
conceitos de genética. Sobre esses conceitos, julgue os itens.
( ) Cariótipo é o conjunto de informações sobre os cromossomos de uma determinada espécie.
( ) Genes alelos são genes que ocupam o mesmo "locus" gênico em cromossomos homólogos.
( ) Um dos catalisadores do processo de duplicação do DNA é a enzima DNA polimerase.
( ) Na espécie humana distinguem-se 3 tipos sangüíneos, e os indivíduos do grupo sangüíneo AB são considerados doadores universais.
VVVF
808. Em um hospital há um homem necessitando de uma transfusão de emergência. Sabe-se que ele pertence ao grupo sangüíneo A e que, no hospital, há quatro
indivíduos que se ofereceram para doar sangue.
Foi realizada a determinação de grupos sangüíneos do sistema ABO dos quatro indivíduos, com a utilização de duas gotas de san gue de cada um deles, que, colocadas
em uma lâmina, foram, em seguida, misturadas aos soros anti-A e anti-B. Os resultados são apresentados a seguir:

Observação:
o sinal + significa aglutinação de hemácias;
o sinal - significa ausência de aglutinação.
A partir dos resultados observados, poderão doar sangue ao referido homem, os indivíduos:
a) I e II b) I e III c) II e III d) II e IV e) III e IV
[A]
809. Uma mulher de sangue tipo A, casada com um homem de sangue tipo B, teve um filho de sangue tipo O. Se o casal vier a ter outros 5 filhos, a chance deles
nascerem todos com sangue do tipo O é
a) igual à chance de nascerem todos com sangue do tipo AB.
b) menor que a chance de nascerem todos com sangue do tipo AB.
c) maior que a chance de nascerem todos com sangue do tipo AB.
d) menor que a chance de nascerem sucessivamente com sangue do tipo AB, A, B, A e B.
e) maior que a chance de nascerem sucessivamente com sangue do tipo AB, B, B, A e A.
[A]
810. Jorge, que tem tipo sangüíneo A, Rh- e é filho de pai tipo A e mãe tipo B, recebeu transfusão de sangue de sua mulher Tânia, que é filha de pai e mãe do tipo B.
Sabendo-se que Tânia teve eritroblastose fetal ao nascer, a probabilidade do casal ter uma criança do tipo A, Rh+ é:
a) 100% b) 25% c) 75% d) 50% e) 0
[B]
811. Um homem de genótipo AB casa-se com uma mulher receptora universal. Os tipos de sangue dos filhos são apenas:
a) A e AB b) A e B c) A, B, AB d) A, B, O e) A, O
[C]
812. Sendo um homem de sangue tipo O, pergunta-se:
I - Se esse homem casar-se com uma mulher de sangue tipo AB, quais os prováveis tipos de sangue dos filhos do casal?
II - Se casar-se com uma mulher de sangue tipo A, qual a probabilidade do nascimento de uma criança do tipo AB?

115
A alternativa que responde corretamente às perguntas anteriores é:
a) (I) - A ou B ou O; (II) - zero
b) (I) - O ou A ou B; (II) - 50%
c) (I) - A ou B; (II) - 50%
d) (I) - A ou B; (II) - zero
e) (I) - A ou B; (II) - 25%
[D]
813. Na(s) questão(ões) a seguir, escreva no espaço apropriado a soma dos itens corretos. Com base nos estudos de Genética, é correto afirmar que:
01) Uma planta de sementes brancas, autofecundada, será heterozigota para o caráter se entre os seus descendentes aparecerem alguns com sementes am arelas e
outros com sementes brancas.
02) Uma mulher do grupo sanguíneo A cuja mãe é do grupo O, casando-se com um homem doador-universal, terá filhos apenas do grupo sangüíneo O.
04) Indivíduos heterozigotos para duas características produzem quatro tipos de gametas.
08) Na interação gênica, ou polimeria, os genes de um par agem combinando-se com outro par (ou outros pares), a fim de condicionar um determinado fenótipo.
16) Sendo a hemofilia uma anomalia condicionada por um gene recessivo ligado ao sexo, uma criança hemofílica nascida de pais normais só poderá ser do sexo
feminino,
01 + 08 = 09
814. Uma mulher Rh- casou-se e teve um filho. Numa segunda gestação a criança apresentou um quadro de eritroblastose fetal. Com estes dados, indique qual a opção
que apresenta o fenótipo para o fator Rh da mãe, do pai e da criança, respectivamente.
a) Mãe Rh negativo, Pai Rh positivo e Criança Rh positivo.
b) Mãe Rh positivo, Pai Rh positivo e Criança Rh negativo.
c) Mãe Rh positiva, Pai Rh negativo e Criança Rh negativa.
d) Mãe Rh positivo, Pai Rh negativo e Criança Rh positivo.
e) Mãe Rh negativo, Pai Rh positivo e Criança Rh negativo.
[A]
815. Uma mulher que possui aglutinina anti-B no seu sangue, teve um filho do grupo O. Sabendo-se que o marido tem o aglutinogênio B, os genótipos do casal são:
a) IAi e IAi. b) IAIA e IBi. c) IAi e IBi.
d) IAIB e IAIA. e) IAi e IBIB.
[C]
816. A observação do esquema a seguir, que representa a genealogia de uma família em relação aos grupos sanguíneos MN, nos permite a firmar que:

a) sangue MN é característica determinada por gene dominante.


b) os indivíduos 4 e 5 são heterozigotos.
c) o casal 3 e 4 poderá ter filhos dos três tipos de grupos sanguíneos.
d) se o indivíduo 5 casar-se com uma mulher de sangue N, todos os filhos serão heterozigotos.
e) um próximo filho do casal 6 e 7 poderá ser do grupo N.
[D]
817. A transfusão de sangue do tipo B para uma pessoa do grupo A, resultaria em
a) reação de anticorpos anti-B do receptor com os glóbulos vermelhos do doador.
b) reação dos antígenos B do receptor com os anticorpos anti-B do doador.
c) formação de anticorpos anti-A e anti-B pelo receptor.
d) nenhuma reação, porque A é receptor universal.
e) reação de anticorpos anti-B do doador com antígenos A do receptor.
[A]
818. Quanto ao surgimento da eritroblastose fetal ou doença hemolítica do recém-nascido podemos afirmar que ela ocorre quando o pai e a mãe respectivamente
apresentam:
a) Rh positivo e Rh negativo.
b) Rh negativo e Rh positivo.
c) Rh positivo e Rh positivo.
d) Rh negativo e Rh negativo.
e) Rh positivo e Rh neutro.
[A]
819. Assinale a alternativa que esquematiza as transfusões que podem ser feitas entre indivíduos com diferentes grupos sanguíneos do sistema ABO (as setas indicam
o sentido das transfusões).

116
[A]
820. Uma criança tem genótipo igual ao pai, que é receptor universal e teve eritroblastose fetal. Então é INCORRETO afirmar que:
a) a mãe é certamente Rh-.
b) o pai possui genótipo IAIB.
c) a mãe pode pertencer ao tipo sangüíneo O.
d) essa criança é certamente heterozigota para o fator Rh.
e) a mãe pode ter genótipo IAi.
[C]
821. Assinale a alternativa que completa corretamente as lacunas no texto a seguir.
Uma mulher é do tipo sangüíneo Rh-, homozigota recessiva e seu marido é Rh+. Se ele for ................., ................. Rh+. A mãe reconhecerá os glóbulos vermelhos do
embrião como estranhos e produzirá anticorpos anti-Rh. Isto só acontecerá quando houver passagem do sangue do embrião para a circulação materna.
a) homozigoto, nenhum dos filhos será
b) heterozigoto, todos os filhos serão
c) homozigoto, todos os filhos serão
d) heterozigoto, nenhum dos filhos será
e) homozigoto, metade dos filhos será
[C]
822. Observe a árvore genealógica a seguir, para o grupo sangüíneo ABO em uma família:

Marque a opção correta:


a) o indivíduo nº 5 pode ser de grupo sangüíneo "AB"
b) o indivíduo nº 1 é do grupo sangüíneo "AB"
c) o indivíduo nº 6 é do grupo sangüíneo "AB"
d) o indivíduo nº 7 não pode ser filho do casal 5×6
[B]
823. Sabe-se que, numa família, dois irmãos são do grupo sangüíneo A, outro é do grupo AB e outro do grupo O. Dos pares de genótipos a seguir, o único que pode ser
dos pais desses indivíduos é
a) ii × IBi
b) IAi × IAIB
c) IAi × IBi
d) IAIA × IAIB
e) IAIA × IBIB
[C]
824. Os grupos sanguíneos de uma população foram estudados no que se refere ao sistema MN dos seus indivíduos. Verificou-se que existiam, numa porcentagem de
9%, portadores de sangue do tipo N. Assim, a freqüência dos indivíduos do grupo MN dessa população é de:
a) 79%. b) 61%. c) 50%. d) 49%. e) 42%.
[E]
825. Pais cujo grupo sanguíneo são AB e O, têm cinco filhos com os seguintes fenótipos: dois são O, um A, um B e um AB. Quantos filhos biológicos tem esse casal?
a) 5 b) 4 c) 3 d) 2 e) 1
[D]
826. Indivíduos sem antígeno Rh nas hemácias são considerados recessivos. Carlos, que tem Rh® e é homozigoto, casou-se com Elaine, que tem Rh-. Ambos possuem
o mesmo grupo sangüíneo. Fazendo um exame pré-natal e relatando esse fato ao médico, o mesmo ficou:
a) despreocupado e não fez qualquer recomendação relativa ao fato.
b) despreocupado, não fez qualquer recomendação, apenas solicitando ao casal que o procurasse no momento da segunda gestação.
c) preocupado, recomendando que, logo após o parto, a mãe recebesse soro anti-Rh. Numa segunda gravidez, entretanto, disse que esse procedimento não seria mais
necessário.
d) bastante preocupado, inclusive pela informação de compatibilidade de grupo sangüíneo, recomendando bastante atenção em cada gravidez, de maneira que, após
cada parto, a mãe receba o soro anti-Rh.
e) bastante preocupado, dizendo ao casal que a gravidez era de altíssimo risco e eles não poderiam mais ter outro filho.
[D]
827. Suponha que um grupo de pessoas, pertence a uma determinada seita religiosa, imigrou para uma região, há mais de meio século.
A população originária desse grupo vive até hoje no mesmo local, totalmente isolada.
Nas tabelas a seguir, são mostradas as freqüências aproximadas dos grupos sangüíneos do sistema ABO da população original (tabela 1) e da população atual (tabela
2).

117
Qual das alternativas a seguir apresenta uma explicação possível para a mudança na freqüência dos grupos sangüíneos nessa população?
a) O gene O é dominante sobre os genes A e B. Assim, os casamentos entre as pessoas O e A e entre pessoas O e B produzem apen as descendentes pertencentes ao
grupo O.
b) O gene O é dominante sobre os genes A e B. Assim, os casamentos entre pessoas O e A e entre pessoas O e B apresentam 50% de chance de produzir
descendentes pertencentes ao grupo O.
c) O gene O é recessivo e, portanto, o casamento entre pessoas pertencentes ao grupo O origina apenas descendentes do grupo O.
d) As pessoas pertencentes ao grupo AB são recessivas e, portanto, apresentam pouca chance de existir numa população.
e) As pessoas pertencentes ao grupo AB só recebem sangue de AB. Essa situação leva a uma menor fr eqüência dessas pessoas na população.
[C]
828. Um laboratorista realizou exames de sangue em cinco indivíduos e analisou as reações obtidas com os reagentes anti -A, anti-B, anti-Rh, para a determinação da
tipagem sangüínea dos sistemas ABO e Rh. Os resultados obtidos encontram-se no quadro seguinte.

Com base nesses resultados, indique quais os indivíduos que serão considerados, respectivamente, receptor e doador universal.
a) 5 e 2. b) 4 e 3. c) 3 e 4. d) 2 e 5. e) 1 e 4.
[C]
829. Observe o diagrama geral das possíveis trocas sangüíneas por doação e recepção no sistema "ABO":

A(s) seta(s) cujo sentido (doação ë recepção) está(ão) errado(s) é(são):


a) 4 e 5 b) 2 c) 1 d) 3
[A]
830. Dois casais suspeitavam da troca de seus bebês no berçário da maternidade. Os casais e os bebês foram submetidos à tipagem do sangue quanto ao sistema
ABO, cujos resultados obtidos são mostrados na tabela adiante. Analisando-os, pode-se identificar os pais de cada bebê.

Após identificar os pais do bebê n.°2, calcule a probabilidade, em porcentagem, de que um futuro irmão deste bebê seja do sexo masculino e venha a ter tipo sangüíneo
diferente do irmão. Despreze a parte fracionária do seu resultado, caso exista.
37 %

118
831. Um homem sofreu um acidente e precisou de transfusão sangüínea. Analisado o seu sangue, verificou-se a presença de anticorpos anti-A e ausência de anti-B. No
banco de sangue do hospital, havia três bolsas disponíveis, sendo que o sangue da bolsa 1 apresentava todos os tipos de antíg enos do sistema ABO, o sangue da bolsa
2 possuía anticorpos anti-A e anti-B e a bolsa 3 possuía sangue com antígenos somente do tipo B. Esse homem pode receber sangue:
a) apenas da bolsa 1.
b) apenas da bolsa 3.
c) da bolsa 2 ou da bolsa 3.
d) da bolsa 1 ou da bolsa 2.
e) apenas da bolsa 2.
[C]
832. Em um banco de sangue de um hospital, as etiquetas que identificavam os tipos sangüíneos estavam em código, e, por acidente, o livro onde estavam registrados
os códigos foi perdido. Para que os frascos contendo sangue fossem identificados, foram feitos testes com amostras correspondentes a cada código, e o resultado foi o
seguinte:

Baseados nesse teste, podemos afirmar que


a) existem 105 litros de sangue disponíveis para um receptor AB Rh+
b) existem 135 litros de sangue disponíveis para um receptor AB Rh-
c) existem 105 litros de sangue disponíveis para um receptor A Rh+
d) existem 135 litros de sangue disponíveis para um receptor O Rh+
e) existem 25 litros de sangue disponíveis para um receptor O Rh-
[E]
833. Os dois gráficos a seguir representam as quantidades de anticorpos anti-Rh presentes no sangue de uma mulher (Rh-) em gestações distintas.

Pela observação dos gráficos e considerando que essa mulher teve um filho em cada gestação e nunca recebeu transfusão de sangue, é correto concluir que,
a) em X, a mãe transferiu anticorpos anti-Rh para o 1º filho Rh-, o qual teve eritroblastose fetal.
b) em X, a mãe foi sensibilizada com o sangue Rh+ do 2Ž filho, o qual não teve eritroblastose fetal.
c) em Y, a mãe transferiu anticorpos anti-Rh para o 2º filho Rh+, o qual teve eritroblastose fetal.
d) em Y, a mãe foi sensibilizada com o fator Rh- do 1º filho, o qual não teve eritroblastose fetal.
[C]
834. Um casal possui o seguinte genótipo para o fator Rh: Pai=Rr; Mãe=rr. Considerando apenas o fator Rh, a probabilidade de esse casal vir a ter um filho do sexo
masculino, com ocorrência de eritroblastose fetal, é:
a) 1 b) ½ c) 1/3 d) ¼ e) 1/8
[D]
835. Uma criança tem tipo sangüíneo do tipo AB. Os tipos sangüíneos dos pais biológicos dessa criança são:
a) A e A. b) B e B. c) A e O. d) A e B. e) AB e O.
[D]
836. Alexsander não sabe qual é o seu grupo sangüíneo e o seu tipo de Rh. Entretanto sabe que seu pai é A+, sua mãe O+ e seu irmão é A-. Assinale a opção que
contém o(s) grupo(s) sangüíneo(s) e o(s) tipo(s) de Rh que Alexsander pode ter:
a) TIPO SANGÜÍNEO: A, somente;
FATOR Rh: positivo ou negativo;
b) TIPO SANGÜÍNEO: O, somente;
FATOR Rh: positivo, somente;
c) TIPO SANGÜÍNEO: A ou O;
FATOR Rh: negativo ou positivo;
d) TIPO SANGÜÍNEO: A ou O;
FATOR Rh: positivo, somente;
e) TIPO SANGÜÍNEO: O, somente;
FATOR Rh: negativo, somente;
[C]
837. Após uma primeira gravidez bem sucedida, uma mãe abortou três vezes. Seu caso foi diagnosticado, em consulta médica, com o eritroblastose fetal. Em relação à
patologia observada nesta família, assinale a alternativa CORRETA:
a) A mãe é Rh positivo.
b) Os abortados certamente eram Rh negativo.
c) Este casal jamais poderá ter outros filhos.
d) A criança é Rh negativo.

119
e) O pai é Rh positivo.
[E]
838. A respeito do heredograma abaixo, que considera o sistema sangüíneo ABO, assinale a alternativa INCORRETA.

a) O indivíduo 9 pode ser doador universal.


b) O indivíduo 7 pertence ao grupo sangüíneo A.
c) O indivíduo 6 é homozigoto.
d) O indivíduo 1 é receptor universal.
e) O indivíduo 8 é heterozigoto.
[C]
839. Considerando o casamento entre um homem tipo sangüíneo A+, cujo pai era O-, com uma mulher B+ cuja mãe era A-, assinale a(s) alternativa(s) correta(s).
01. A probabilidade de nascer 1 filha mulher B+ é 3/16.
02. A probabilidade de nascer 1 filho homem O- é nula.
04. A probabilidade de nascer 1 filho homem e 1 filha mulher AB é 9/1024.
08. A probabilidade de nascer filho homem AB- é 1/16.
16. A probabilidade de nascer 1 filho homem A+ é 1/8.
32. A probabilidade de nascer 2 filhas mulheres A- é 1/1024.
FFVFFV
840. Lúcia e João são do tipo sangüíneo Rh positivo e seus irmãos, Pedro e Marina, são do tipo Rh negativo. Quais dos quatro irmãos podem vir a ter filhos com
eritroblastose fetal?
a) Marina e Pedro.
b) Lúcia e João.
c) Lúcia e Marina.
d) Pedro e João.
e) João e Marina.
[E]
841. Determinada característica quantitativa depende da ação de cinco pares de genes. Do cruzamento entre dois indivíduos com genótipo AaBbCcDdEe resultam
a) 5 classes fenotípicas.
b) 9 classes fenotípicas.
c) 10 classes fenotípicas.
d) 11 classes fenotípicas.
e) 15 classes fenotípicas.
[D]
842. A pigmentação da pele humana é condicionada por pares de genes com ausência da dominância. Suponhamos que apenas dois pares de genes estivessem
envolvidos na cor de pele: o negro seria SSTT e o branco, sstt.
Um homem mulato, heterozigoto nos dois pares, tem 6 filhos com uma mulher mulata de genótipo igual ao seu. Sobre os filhos do casal, pode-se afirmar que:
a) todos são mulatos como os pais.
b) cada um deles tem uma tonalidade de pele diferente da outro.
c) um ou mais deles podem ser brancos.
d) a probabilidade de serem negros é maior do que a de ser brancos.
e) 50% apresenta pele branca e 50%, pele negra.
[C]
843. As diferenças hereditárias entre os indivíduos de uma população podem ser classificadas em qualitativas e quantitativas. A esse respeito, assinale a opção correta.
a) Na herança de caracteres quantitativos, existe um grande contraste entre as características que um dado traço fenotípico pode apresentar.
b) Na herança de caracteres qualitativos, um dado traço de fenótipo apresenta-se sob grande variedade de formas, em geral com pequenas diferenças entre si.
c) Altura, peso e cor da pele são exemplos de algumas características quantitativas do homem.
d) Os caracteres qualitativos, em sua maioria, sofrem grande influência do meio.
e) A altura não é uma característica hereditária, já que um indivíduo cresce menos se não receber a alimentação adequada na i nfância.
[C]
844. Supondo que na aboboreira existam 3 pares de genes que influem no peso do fruto, uma planta aabbcc origina frutos com aproximadamente 1.500 gramas e uma
planta AABBCC, frutos ao redor de 3.000 gramas. Se essas duas plantas forem cruzadas, o peso aproximado dos frutos produzidos pelas plantas F 1 será de
a) 3 000 gramas. b) 2 500 gramas. c) 2 250 gramas.
d) 2 000 gramas. e) 1 500 gramas.
[C]
845. Admita que a diferença de comprimento das orelhas nos coelhos seja um caso de herança quantitativa envolvendo dois pares de genes com segregação
independente. Animais sem nenhum gene dominante possuem orelhas com 4,0cm. Cada gene dominante aumenta em 1,0cm o comprimento das orelhas. O cruzamento
que produzirá na descendência uma maior porcentagem de coelhos com orelhas de no mínimo 7,0cm é o
a) AaBb x AaBb b) AaBb x aaBB c) AAbb x aaBB
d) Aabb x AABB e) AABB x aabb
[A]
846. O gráfico a seguir representa um tipo de herança onde os caracteres variam de forma gradativa.
As opções a seguir são exemplos deste tipo de herança no homem, EXCETO uma. Assinale-a.

120
a) Estatura. b) Inteligência. c) Obesidade.
d) Fator RH. e) Cor da pele.
[D]
847. Em um caso de herança quantitativa, estão envolvidos três pares de genes, "a", "b" e "c". Cruzando-se dois indivíduos triplo heterozigotos, a proporção de
homozigotos esperada é de:
a) ½ b) 1/8 c) 1/16 d) 1/32 e) 1/64
[B]
848. A tabela a seguir classifica características hereditárias da espécie humana. Assinale a alternativa que corresponde à classificação correta.

[B]
849. A altura dos espécimes de uma determinada planta encontrada no cerrado varia entre 12cm e 108cm. Os responsáveis por ess a variação são 3 pares de genes
com segregação independente, que interferem igualmente na altura da planta. Determine a altura, em centímetros, esperada para a primeira geração de um cruzamento
entre dois indivíduos com os genótipos AABBCC e aabbCC.
76 cm
850. A altura de uma planta depende de dois pares de genes, A e B. O gráfico adiante mostra a variação da altura dos descendentes de dois indivíduos diíbridos.

Com relação ao gráfico, julgue os itens que se seguem.


(1) Os efeitos quantitativos dos alelos A e B são, respectivamente, 40 e 30cm.
(2) A freqüência de descendentes heterozigotos, para os dois genes, é de 50%.
(3) Estão ilustrados cinco genótipos.
(4) A herança apresentada é poligênica.
Item correto: 4
Itens errados: 1, 2 e 3
851. A altura de uma certa espécie de planta é determinada por dois pares de genes A e B e seus respectivos alelos a e b. Os alelos A e B apresentam efeito aditivo e,
quando presentes, cada alelo acrescenta à planta 0,15m. Verificou-se que plantas desta espécie variam de 1,00m a 1,60m de altura.
Cruzando-se plantas AaBB com aabb pode-se prever que, entre os descendentes,
a) 100% terão 1,30m de altura.
b) 75% terão 1,30m e 25% terão 1,45m de altura.
c) 25% terão 1,00m e 75% terão 1,60m de altura.
d) 50% terão 1,15m e 50% terão 1,30m de altura.
e) 25% terão 1,15m, 25% 1,30m, 25% 1,45m e 25% 1,60m de altura.
[D]
852. Para uma determinada planta, suponha que a diferença entre um fruto de 10cm de comprimento e um de 20cm de comprimento s eja devida a dois genes, cada um
com dois alelos, que têm efeito aditivo e que se segregam independentemente. Na descendência do cruzamento entre dois indivíduos que produzem frutos com 15cm,
espera-se uma proporção de plantas com frutos de 17,5cm igual a
a) 9/16 b) ½ c) 3/16 d) ¼ e) 1/8
[D]

121
853. Os seguintes conceitos genéticos foram escritos por um aluno que estava com dúvidas sobre a matéria e que pediu a um professor qualificado que os conferisse:
I - Os genes em um mesmo cromossomo tendem a ser herdados juntos e são denominados "genes ligados"
II - Quando uma característica particular de um organismo é governada por muitos pares de genes, que possuem efeitos similares e aditivos, nós dizemos que esta
característica é uma característica poligênica.
III - Quando três ou mais alelos, para um dado "locus", estão presentes na população, dizemos que este "locus" possui alelos múltiplos.
IV - Um organismo com dois alelos idênticos para um "locus" em particular é considerado homozigoto para este "locus", enquanto um organismo com dois alelos
diferentes para um mesmo "locus" é considerado heterozigoto para este "locus".
V - A aparência de um indivíduo com respeito a uma dada característica herdada é chamada de fenótipo.
Quais afirmativas o professor diria que estão corretas?
a) Apenas II, III e IV
b) Apenas I, II, III e IV
c) Apenas I, II, III e V
d) Apenas II, III, IV e V
e) I, II, III, IV e V
[E]
854. A massa de um determinado tipo de fruto depende da ação de dois genes A e B, não alelos, independentes e de ação cumulativa (polimeria). Esses genes
contribuem com valores idênticos para o acréscimo de massa. Os genes a e b, alelos de A e B respectivamente, não contribuem para o acréscimo de massa. O fruto de
uma planta de genótipo AABB tem 40 gramas de massa enquanto o de uma planta de genótipo aabb tem 20 gramas.
Determine a massa do fruto de uma planta de genótipo AABb. Justifique sua resposta.
Se os genes a e b não contribuem para o peso e o fruto aabb tem 20g, teremos
AABB = 40 g - 20 g = 20 g.
Logo, cada gene A ou B contribui com 5 g.
Portanto o fruto de genótipo AABb terá
20 + 15 = 35 g.
855. Um estudante de 23 anos, doador de sangue tipo universal, é moreno, tem estatura mediana e pesa 85 kg. Todas as alternativas apresentam características
hereditárias desse estudante que são influenciadas pelo ambiente, EXCETO
a) Altura b) Grupo sangüíneo c) Cor da pele d) Peso
[B]
856. Um novo tipo de tratamento da AIDS começou a ser testado no Brasil e consiste em transmitir anticorpos anti -HIV, contidos no plasma de pessoas contaminadas há
muitos anos mas sem os sintomas da doença, para pessoas aidéticas sintomáticas. Tal tratamento, cuja intenção é fortalecer a defesa desses indivíduos, denomina-se
a) imunoterapia ativa.
b) imunoterapia passiva.
c) profilaxia.
d) quimioterapia.
e) vacinoterapia.
[B]
857. As vacinas utilizadas nas campanhas de imunização em massa são constituídas de
a) anticorpos que destruirão o agente infeccioso específico.
b) anticorpos que persistirão ativos por toda a vida do receptor.
c) drogas capazes de aumentar a resistência à infecção.
d) microorganismos ou produtos deles derivados que induzirão a formação de anticorpos.
e) soros obtidos de animais que neutralizarão os antígenos específicos.
[D]
858. Os meios de comunicação têm convocado dentistas e outros profissionais da saúde para a vacinação contra a hepatite B. Vacinar consiste em injetar no organismo:
a) microrganismos vivos para provocar a doença de forma branda. O corpo imunizado produzirá antígenos específicos.
b) uma substância que combata a doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos resistentes.
c) microrganismos mortos ou atenuados que, reconhecidos pelo corpo como antígenos, induzam a produção de anticorpos específic os.
d) o plasma, retirado de convalescentes, para que o corpo produza então os antígenos específicos.
e) o soro obtido através do sangue de animais, como os cavalos, criados em laboratório, onde recebem grande quantidade de antígenos.
[C]
859. Um coelho recebeu, pela primeira vez, a injeção de uma toxina bacteriana e manifestou a resposta imunitária produzindo a antitoxina (anticorpo). Se após certo
tempo for aplicada uma segunda injeção da toxina no animal, espera-se que ele
a) não resista a essa segunda dose.
b) demore mais tempo para produzir a antitoxina.
c) produza a antitoxina mais rapidamente.
d) não produza mais a antitoxina por estar imunizado.
e) produza menor quantidade de antitoxina.
[C]
860. Após um traumatismo, um paciente teve que se submeter a uma cirurgia que removeu uma parte do seu corpo. Recuperou-se e passou a viver normalmente. A
parte retirada era
a) o fígado. b) o diafragma. c) a hipófise.
d) o pâncreas. e) o baço.
[E]
861. Todas as estruturas citadas a seguir podem ser ligadas à defesa do organismo, EXCETO:
a) pâncreas b) amídalas c) baço
d) timo e) gânglios linfáticos
[A]
862. Um organismo recebeu uma primeira dose de um antígeno X e, como resposta imune, produziu anticorpos específicos.
Se, após algum tempo, for aplicada uma segunda dose do mesmo antígeno, espera-se que o organismo:
a) reaja da mesma forma como reagiu à primeira dose.
b) reaja sem utilizar seus anticorpos.
c) não produza mais anticorpos, por estar imunizado.
d) não consiga reagir a essa segunda dose.
e) produza anticorpos mais rapidamente.
[E]
863. Leia com atenção a tirinha do Frank & Ernest

122
Existe um erro de fundamento biológico na estorinha da tirinha. Assinale a alternativa que esclarece o erro:
a) é que vírus do tipo "A" não sofre efeito de vacina alguma
b) é que a vacina não combate vírus, somente doenças causadas por bactérias
c) é que a vacina não combate vírus, ela proporciona ao nosso organismo produzir defesas, os anticorpos, que são específicos aos seus antígenos, no caso o vírus "A"
d) é que a vacina é feita de vírus, portanto ela não pode destruir o que a produz
e) é que o vírus impede a ação da vacina, inibindo a sua atividade de defesa, que é o sistema "chave-fechadura"
[C]
864. Os meios de comunicação têm noticiado que a Unicef (Fundo das Nações Unidas para a Infância) estabeleceu como uma das metas, a serem cumpridas até o ano
2.000, a imunização de 90% das crianças, o que reduzirá a mortalidade infantil em pelo menos um terço.
Para que esta meta seja atingida, é necessária a vacinação, que consiste em injetar no organismo:
a) vírus ou bactérias vivas para provocar a doença de forma branda. O corpo, imunizado, produzirá antígenos específicos.
b) um medicamento eficaz no combate à doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos específicos e resistentes.
c) vírus ou bactérias mortos ou atenuado que, reconhecidos pelo corpo como antígenos, induzam a produção de anticorpos específicos.
d) o plasma, retirado de pessoas que já tiveram a doença, para que o corpo produza antígenos e anticorpos específicos.
e) o soro obtido através do sangue de animais, como os cavalos, criados em laboratório, onde recebem grande quantidade de antígenos.
[C]
865. Ao ser picado por uma cobra peçonhenta, você deverá procurar recurso através de
a) vacina, porque contém antígenos específicos.
b) soro, porque estimula o organismo a produzir anticorpos.
c) vacina, porque já contém anticorpos.
d) soro, porque já contém anticorpos.
e) vacina, porque estimula o organismo a produzir anticorpos.
[D]
866. Quando uma pessoa é picada por um animal peçonhento, deve procurar socorro através de
a) soro, que induzirá a formação de anticorpos.
b) soro, porque é composto antígenos específicos.
c) soro, porque contém anticorpos prontos.
d) vacina, porque fornecerá ao organismo elementos de defesa.
e) vacina, para eliminar quimicamente o veneno.
[C]
867. Um sério risco a que está exposto o trabalhador rural em nosso país é o de acidentes com animais peçonhentos. Dentre est es um dos mais temíveis e agressivos
do gênero é a cobra surucucu.
Com relação à surucucu, considere as proposições:
1 - Pertence ao gênero Bothrops e seu veneno tem potente ação neurotóxica e coagulante.
2 - Pertence ao gênero Crotalus e seu veneno tem ação neurotóxica e homolítica.
3 - Seu veneno tem ação proteolítica e coagulante e o antiofídico específico é o soro antibotrópico.
4 - O princípio ativo do seu veneno provoca intensa dor no local da inoculação, podendo haver gangrena, especialmente no caso de se utilizar torniquetes.
As proposições que estão corretas são as indicadas por:
a) 2 e 3 b) 1, 2 e 4 c) 3 e 4 d) 1 e 4 e) 2, 3 e 4
[C]
868. A alergia é uma hipersensibilidade desenvolvida em relação a determinadas substâncias, os alergênicos, que são reconheci das por um tipo especial de anticorpo. A
reação alérgica ocorre quando as moléculas do alergênico
a) ligam-se a moléculas do anticorpo presas à membrana dos mastócitos, que reagem liberando histaminas.
b) desencadeiam, nos gânglios linfáticos, uma grande proliferação de linfócitos específicos.
c) são reconhecidas pelas células de memória, que se reproduzem e fabricam grande quantidade de histaminas.
d) ligam-se aos anticorpos e migram para os órgãos imunitários primários onde são destruídas.
e) são fagocitadas pelos mastócitos e estimulam a fabricação das interleucinas.
[A]
869. O gráfico a seguir exemplifica como a exposição de um homem normal, repetidas vezes, a um mesmo tipo de antígeno (ex.: vírus) provoca, após um certo espaço
de tempo, uma resposta do organismo.

Podemos atribuir esta resposta do organismo ao fenômeno de memória imunológica, que tem como conseqüência:
a) o aumento da produção de anticorpos

123
b) a inibição da produção de anticorpos
c) o aumento da produção de antígenos
d) a inibição da produção de antígenos
[A]
870. A partir do recente surto de sarampo na cidade do Rio de Janeiro, o governo decidiu iniciar uma campanha de imunização das crianças. A imunização contra
diversos tipos de doenças é atingida através de vacinação, que consiste em injetar no organismo:
a) o soro obtido através do sangue de animais criados em laboratório, como macacos, onde recebem grande quantidade de antígenos e anticorpos específicos.
b) o plasma retirado de pessoas que já tiveram a doença, para que o organismo produza antígenos e anticorpos específicos.
c) um agente químico eficaz no combate a doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos específicos.
d) vírus ou bactérias mortos ou atenuados que, reconhecidos pelo organismo como antígenos, induzem a produção de anticorpos específicos.
e) vírus ou bactérias vivos, em quantidade pequena, para provocar a doença de forma branda, pois o corpo imunizado produzirá anti corpos específicos.
[D]
871. A variação da quantidade de anticorpos específicos foi medida por meio de uma experiência controlada, em duas crianças durante um certo período de tempo. Para
a imunização de cada uma das crianças foram utilizados dois procedimentos diferentes:
Criança I: aplicação de soro imune
Criança II: vacinação.
O gráfico que melhor representa as taxas de variação da quantidade de anticorpos nas crianças I e II é:

[B]
872. Duas crianças foram levadas a um posto de saúde: uma delas, para se prevenir contra poliomielite; a outra, para atendimento, em virtude de uma picada de
serpente peçonhenta.
Indique o que deve ser aplicado em cada criança, RESPECTIVAMENTE.
a) vacina (porque contém antígenos) e soro (porque contém anticorpos)
b) soro (porque contém antígenos) e vacina (porque contém anticorpos)
c) vacina (porque contém anticorpos) e soro (porque contém antígenos)
d) soro (porque contém anticorpos) e vacina (porque contém antígenos)
[A]

873. "Os cientistas examinaram 11 homens aidéticos, dos quais 5 nunca tinham usado medicamentos anti-HIV e 6 haviam usado. Verificaram que 8 pacientes
apresentavam novas mutações do vírus, resistentes às drogas ministradas e passíveis de serem transmitidas a outras pessoas."
Pela análise do texto, pode-se concluir que a fabricação da vacina anti-AIDS
a) apresenta os mesmos problemas que a da vacina contra a gripe.
b) só pode ser feita contra as formas mutantes do HIV.
c) precisa ser feita contra a forma normal do HIV.
d) é fácil de ser efetuada, tendo em vista a estabilidade do HIV.
e) certamente deverá estar no mercado dentro de pouco tempo.
[A]
874. O soro antiofídico é ministrado em pessoas picadas por cobra peçonhenta porque:
a) induz a formação de anticorpos.
b) contém anticorpos.
c) é um antibiótico.
d) provoca imunização.
e) possui antígenos específicos.
[B]
875. Um casal de surdos teve dois filhos com audição normal. Sabendo se que a surdez é determinada por qualquer dos genes recessivos d ou e, em homozigose,
espera se que o genótipo dos filhos seja
a) ddee. b) Ddee. c) DDEE. d) DdEe. e) DDee.
[D]
876. Em camundongos, a coloração da pelagem é determinada por dois pares de genes, Aa e Cc, com segregação independente. O gene A determina coloração aguti e
é dominante sobre seu alelo a que condiciona coloração preta. O gene C determina a produção de pigmentos e é dominante sobre seu alelo c que inibe a formação de
pigmentos dando origem a indivíduos albinos. Do cruzamento de um camundongo preto com um albino, foram obtidos apenas descendentes agutis. Qual é o genótipo
desse casal?
a) aaCC x aacc
b) Aacc x aaCc
c) aaCc x AAcc
d) AaCc x AaCc
e) aaCC x Aacc
[E]
877. Em cebola, dois pares de genes que apresentam segregação independente participam na determinação da cor do bulbo: o alel o dominante I impede a
manifestação de cor e o recessivo i permite a expressão; o alelo dominante A determina cor vermelha e o recessivo a, cor amarela. Uma proporção de 2 incolores: 1
vermelho: 1 amarelo é esperada entre os descendentes do cruzamento
a) IIAA x IiAa b) IiAA x iiAa c) IIaa x ii aa
d) IiAa x IiAa e) IiAa x iiaa
[E]
878. Em coelhos, o gene P produz pelagem preta e o seu alelo recessivo p, pelagem parda desde que esteja presente o gene A. Os animais aa são sempre albinos.
Considerando que ocorra segregação independente entre esses genes, a partir do cruzamento PpAa x ppaa espera-se uma proporção fenotípica de
a) 1 preto: 1 pardo: 2 albinos.

124
b) 1 preto: 1 pardo.
c) 1 preto: 1 albino.
d) 1 preto: 3 albinos.
e) 1 pardo: 3 albinos.
[A]
879. As diversas substâncias ingeridas pelo homem são transformadas em outras, durante os processos metabólicos. Essas transformações são catalisadas por
diferentes enzimas. O esquema abaixo representa alguns passos da síntese de melanina.

Com base no esquema e sabendo que indivíduos incapazes de sintetizar a melanina são albinos, julgue os itens seguintes.
(1) Na produção de melanina a partir de fenilalanina, atuam três mRNAs.
(2) Indivíduos albinos podem apresentar homozigose recessiva bb e cc.
(3) Um casal de indivíduos albinos pode ter filhos com pigmentação normal.
(4) O gene B é epistático sobre o gene C.
CCCC
880. Nos camundongos, a pelagem pode ser aguti, preta ou albina. A figura a seguir mostra as reações bioquímicas envolvidas na síntese de pigmentos .

Com base na figura foram feitas as seguintes afirmações:


I - A formação de qualquer pigmento no pêlo depende da presença do alelo P.
II - Quando animais pretos homozigóticos são cruzados com certos albinos também homozigóticos, os descendentes são todos aguti.
III - Trata-se de um caso de interação gênica do tipo epistasia recessiva.
Pode-se considerar correto o que é afirmado em
a) I, somente.
b) III, somente.
c) I e II, somente.
d) II e III, somente.
e) I, II e III.
[E]
881. A cor da pelagem em cavalos depende, dentre outros fatores, da ação de dois pares de genes Bb e Ww. O gene B determina p êlos pretos e o seu alelo b determina
pêlos marrons. O gene dominante W "inibe" a manifestação da cor, fazendo com que o pêlo fique branco, enquanto que o alelo recessivo w permite a manifestação da
cor. Cruzando-se indivíduos heterozigotos para os dois pares de genes obtém-se:
a) 3 brancos: 1 preto
b) 9 brancos: 3 pretos: 3 mesclados de marrom e preto: 1 branco
c) 1 preto: 2 brancos: 1 marrom
d) 12 brancos: 3 pretos: 1 marrom
e) 3 pretos: 1 branco
[D]
882. A audição normal depende da presença de pelo menos um dominante de dois pares de genes, D e E que se segregam independentemente. Caso você examine a
prole de um grande número de casamentos em que ambos os conjuges são duplo heterozigotos para esses dois pares de genes, que proporção fenotípica você espera
encontrar?
15/16 audição normal : 1/16 surdos
883. Na ervilha-de-cheiro existem dois pares de genes que condicionam a cor da flor (Cc e Pp). A presença do gene C ou P ou ausência de ambos pr oduz flor branca. A
presença de ambos simultaneamente produz flor púrpura.
Cruzando-se duas plantas de flores brancas, obtém-se em F1 plantas produtoras de flores coloridas, na proporção de 3 brancas: 1 colorida. Os genótipos das plantas
cruzadas são, respectivamente:
a) CCpp x ccPP b) CCpp x ccPp c) Ccpp x ccPP
d) Ccpp x ccPp e) CcPp x CcPp
[D]
884. Observe a figura.

125
Todas as alternativas contêm genótipos possíveis para os porquinhos vermelhos de F2, EXCETO
a) AABB b) AaBB c) Aabb
d) AaBb e) AABb
[C]
885. Na(s) questão(ões) a seguir, escreva no espaço apropriado a soma dos itens corretos. Com base nos estudos de Genética, é correto afirmar que:
01) Uma planta de sementes brancas, autofecundada, será heterozigota para o caráter se entre os seus descendentes aparecerem alguns com sementes amarelas e
outros com sementes brancas.
02) Uma mulher do grupo sanguíneo A cuja mãe é do grupo O, casando-se com um homem doador-universal, terá filhos apenas do grupo sangüíneo O.
04) Indivíduos heterozigotos para duas características produzem quatro tipos de gametas.
08) Na interação gênica, ou polimeria, os genes de um par agem combinando-se com outro par (ou outros pares), a fim de condicionar um determinado fenótipo.
16) Sendo a hemofilia uma anomalia condicionada por um gene recessivo ligado ao sexo, uma criança hemofílica nascida de pais normais só poderá ser do sexo
feminino,
01 + 08 = 09
886. O esquema a seguir evidencia que a formação de melanina não depende apenas da ação de um gen. No processo ali representado, está ocorrendo a ação
conjunta de dois gens.

Situações como essa são conhecidas como:


a) polialelia. b) poligens. c) norma de reação.
d) interação gênica. e) alelos múltiplos.
[D]
887. Considere uma espécie de vertebrado cujas células embrionárias têm oito cromossomos. Em quantos grupos de ligações seus genes estarão associados?
a) Dois. b) Quatro. c) Oito.
d) Dezesseis. e) Número variável.
[B]
888. Considere uma espécie de vertebrado cujas células somáticas têm 12 cromossomos. Em quantos grupos de ligações seus genes estarão associados?
a) Quatro. b) Seis. c) Três. d) Oito. e) Dez.
[B]
889. Considere uma espécie de vertebrado cujas células embrionárias têm oito cromossomos. Em quantos grupos de ligações seus genes estarão associados?
a) Dois. b) Quatro. c) Oito.
d) Dezesseis. e) Número variável.
[B]
890. Suponha que 100 células germinativas entram em meiose e que essas células tenham o seguinte genótipo:

Quantos gametas recombinantes serão formados se 20 das 100 células apresentarem permutação na meiose?
a) 20 b) 40 c) 80 d) 160 e) 180
[B]

126
891. Mendel, nas primeiras experiências sobre hereditariedade, trabalhou com apenas uma característica de cada vez. Posterior mente, ele acompanhou a transmissão
de dois caracteres ao mesmo tempo, e os resultados levaram-no a concluir que: "fatores para dois ou mais caracteres são transmitidos para os gametas de modo
totalmente independente ". Esta observação foi enunciada como "2ª Lei de Mendel" ou "Lei da Segregação Independente", a qual não é válida para os genes que estão
em ligação gênica ou "linkage", isto é, genes que estão localizados nos mesmos cromossomos. Observando as seguintes proporções de gametas produzidos pelo
dihíbrido AaBb em três situações distintas,
I - AB (25%); Ab (25%); aB (25%); ab (25%),
II - AB (50%); ab (50%),
III - AB (40%); Ab (10%); aB (10%); ab (40%),
pode-se afirmar que:
a) I e II são situações nas quais os genes segregam-se independentemente.
b) II e III são situações nas quais ocorre segregação independente e ligação gênica sem "crossing-over", respectivamente,
c) I e III são situações nas quais ocorre segregação independente e ligação gênica com "crossing-over", respectivamente.
d) II é uma situação na qual ocorre ligação gênica com "crossing-over".
e) III é uma situação na qual ocorre ligação gênica sem "crossing-over".
[C]
892. Os seguintes conceitos genéticos foram escritos por um aluno que estava com dúvidas sobre a matéria e que pediu a um professor qualificado que os conferisse:
I - Os genes em um mesmo cromossomo tendem a ser herdados juntos e são denominados "genes ligados"
II - Quando uma característica particular de um organismo é governada por muitos pares de genes, que possuem efeitos similares e aditivos, nós dizemos que esta
característica é uma característica poligênica.
III - Quando três ou mais alelos, para um dado "locus", estão presentes na população, dizemos que este "locus" possui alelos múltiplos.
IV - Um organismo com dois alelos idênticos para um "locus" em particular é considerado homozigoto para este "locus", enquanto um organismo com dois alelos
diferentes para um mesmo "locus" é considerado heterozigoto para este "locus".
V - A aparência de um indivíduo com respeito a uma dada característica herdada é chamada de fenótipo.
Quais afirmativas o professor diria que estão corretas?
a) Apenas II, III e IV
b) Apenas I, II, III e IV
c) Apenas I, II, III e V
d) Apenas II, III, IV e V
e) I, II, III, IV e V
[E]
893. O cruzamento de dois indivíduos, um com genótipo AaBb e outro com genótipo aabb resultou numa F1 com as seguintes propor ções:
AaBb = 35%
aabb = 35%
Aabb = 15%
aaBb = 15%
Com esses resultados, pode-se concluir que os genes "a" e "b":
a) estão em um mesmo braço do cromossomo.
b) seguem as leis do diibridismo.
c) constituem um caso de interação gênica.
d) são pleiotrópicos.
e) são epistáticos.
[A]
894. Considerando os genes X, Y e Z de um cromossomo, sabe-se que há 15% de recombinação entre os genes X e Y, entre Y e Z há 30% e entre os genes Z e X
ocorre 45%. Qual a posição relativa desses três genes no cromossomo?
a) ZXY b) XYZ c) YZX d) XZY e) YXZ
[B]
895. Sabendo-se que as freqüências de permutação entre os genes A e C é de 20% e entre os genes B e C é de 10%, então a distância entre os genes A e B será
a) 10 morganídeos.
b) 30 morganídeos.
c) 10 ou 30 morganídeos.
d) 20 morganídeos.
e) 20 ou 10 morganídeos.
[C]
896. Sabendo-se que as freqüências de permutação entre os genes A e C é de 40% e entre os genes B e C é de 15%, então a distância entre os genes A e B será
a) 45 morganídeos.
b) 25 morganídeos.
c) 40 morganídeos.
d) 25 ou 15 morganídeos.
e) 40 ou 15 morganídeos.
[D]
897. Supondo-se que a distância entre locos gênicos seja de 16 morganídios, a taxa de recombinação entre eles é de
a) 8% b) 16% c) 32% d) 42% e) 84%
[B]
898. Analisando-se dois pares de genes em ligamento fatorial ("linkage") representados pelo híbrido BR/br, uma certa espécie apresentou a seg uinte proporção de
gametas:
BR - 48,5%
br - 48,5%
Br - 1,5%
bR - 1,5%
Pela análise dos resultados, pode-se concluir que a distância entre os genes B e R é de:
a) 48,5 morganídeos.
b) 97 morganídeos.
c) 1,5 morganídeo.
d) 3 morganídeos.
e) 50 morganídeos.
[D]
899. Numa certa espécie de milho, o grão colorido é condicionado por um gene dominante B e o grão liso por um gene dominante R . Os alelos recessivos b e r
condicionam, respectivamente, grãos brancos e rugosos. No cruzamento entre um indivíduo colorido liso com um branco rugoso, surgiu uma F1, com os seguintes
descendentes:
150 indivíduos que produziam sementes coloridas e lisas,
150 indivíduos que produziam sementes brancas e rugosas,
250 indivíduos que produziam sementes coloridas e rugosas e

127
250 indivíduos que produziam sementes brancas e lisas.
A partir desses resultados, podemos concluir que o genótipo do indivíduo parental colorido liso e a distância entre os genes B e R são
a) BR/br; 62,5 U.R. b) BR/br; 37,5 U.R.
c) Br/bR; 62,5 U.R. d) Br/bR; 37,5 U.R. e) BR/br; 18,75 U.R.
[D]
900. Analise as proposições:
1. Modificações hereditárias que ocorrem num locus específico são chamadas de mutações gênicas.
2. Os principais agentes mutagênicos são as radiações ionizantes e os raios-ultravioleta.
3. As mutações do tipo substituição de base acarretam a alteração de vários aminoácidos nas proteínas.
Está(ão) correta(s):
a) 1, apenas
b) 1 e 3, apenas
c) 3, apenas
d) 1, 2 e 3
e) 2, apenas
[A]
901. Atualmente são bem conhecidos os efeitos adversos à saúde humana, causados por diversos poluentes ambientais, especialmente aqueles que possuem
potencialidades mutagênicas ou carcinogênicas, os quais, devido à sua interação com mecanismos genéticos, podem causar mutações e doenças nas gerações futuras.
Assinale as afirmações corretas:
I - Mutações são modificações bruscas do material genético que podem ser transmitidas à prole (descendência ou células filhas).
II - A mutação pode ser espontânea ou induzida por agentes físicos, químicos ou biológicos com potencial mutagênico.
III - Mutação é toda alteração do material genético, que resulta sempre de segregação ou recombinação cromossômicas.
IV - Mutações gênicas podem ser causadas por poluentes ambientais o provocar alterações responsáveis pelo aparecimento de genótipos diferentes numa população.
A alternativa que contém as afirmações corretas é:
a) I e III. b) II e III. c) I, II e IV.
d) IV e III. e) III.
[C]
902. Um surfista que se expunha muito ao sol sofreu danos em seu DNA em conseqüência de radiações UV, o que resultou em pequenos tumores na pele. Caso ele
venha a ser pai de uma criança, ela
a) só herdará os tumores se tiver ocorrido dano em um gene dominante.
b) só herdará os tumores se tiver ocorrido dano em dois genes recessivos.
c) só herdará os tumores se for do sexo masculino.
d) herdará os tumores, pois houve dano no material genético.
e) não herdará os tumores.
[E]
903. Monossomia do cromossomo X, ovários rudimentares, mau desenvolvimento dos caracteres sexuais secundários, baixa estatura são, entre outros, dados que
podem ser relacionados com a síndrome:
a) de Marfan b) de Klinefelter c) de Down
d) de Turner e) de Patau
[D]
904. A constituição genética dos indivíduos com síndrome de Klinefelter é:
a) 45A XX b) 44A XYY c) 44A XXY
d) 45A XO e) 47A XXY
[B]
905. A síndrome de Down ou mongolismo é uma anomalia causada por:
a) uma mutação gênica
b) uma deficiência cromossômica
c) uma diminuição do número de cromossomos no genoma
d) um aumento do número de cromossomos do genoma
e) uma inversão cromossômica
[D]
906. Se na ovulogênese, não houver disjunção do par de cromossomos sexuais, os óvulos correspondentes, sendo fecundados, poderão dar origem a casos de
a) síndrome de Turner
b) síndrome de Klinefelter
c) síndrome de Down
d) síndrome de Patau
e) a e b são possíveis
[E]
907. Duas espécies de plantas A(2n = 8) e B(2n = 6) foram cruzadas produzindo um híbrido interespecífico que, germinando, produz alguns grãos de pólen que foram
utilizados para fecundar óvulos da espécie B. Assinale a opção que relaciona o nível de ploidia e o número de cromossomos da descendência.
a) 2n = 7 b) 2n = 10 c) 3n = 7
d) 3n = 10 e) 4n = 14
[D]
908. Duas espécies de plantas A(2n = 8) e B(2n = 10) foram cruzadas produzindo um híbrido interespecífico que, germinando, produz alguns grãos de pólen que foram
utilizados para fecundar óvulos da espécie B. Assinale a opção que relaciona o nível de ploidia e o número de cromossomos da descendência.
a) 2n = 7 b) 2n = 14 c) 3n = 14
d) 3n = 10 e) 4n = 14
[C]
909. A figura a seguir representa uma sinapse (pareamento) anormal observado quando ocorre a mutação cromossômica estrutural denominada:

128
a) inversão pericêntrica
b) translocação
c) duplicação
d) deleção
e) isocromossomos
[A]
910. Suponha que o seguinte processo ocorre em uma comunidade onde convivem diferentes espécies de gramínea:
Qual das alternativas a seguir indica corretamente o valor de 2N dos híbridos III e IV do processo esquematizado?

III IV
a) 65 , 65.
b) 65 ,130.
c) 70 , 60.
d) 130 , 65.
e) 130 , 130.
[B]
911. As alterações do número de cromossomos, tais como: presença de um cromossomo 21 a mais; 47 cromossomos, sendo dois X e um Y e 45 cromossomos, tendo
apenas um X, determinam, respectivamente, as síndromes de:
a) Down, Klinefelter e Turner.
b) Morgan, Turner e Klinefelter.
c) Turner, Down e Morgan.
d) Down, Turner e Klinefelter.
e) Klinefelter, Turner e Down.
[A]
912. O esquema a seguir mostra a formação dos gametas responsáveis pela produção de um indivíduo com alteração do seu número cromossomial.

Entre as características que esse indivíduo passará a apresentar, teremos:


a) sexo masculino.
b) caracteres sexuais desenvolvidos.
c) cariótipo normal.
d) ausência de cromatina sexual.
e) estatura elevada.
[D]
913. A respeito das mutações, leia as afirmações a seguir.
I - Ocorrem para adaptar o indivíduo ao ambiente.
II - Ocorrem em células sexuais e somáticas.
III - Podem alterar o número, a forma e o tamanho dos cromossomos.
A(s) afirmação(ões) correta(s) é(são):
a) somente a II.

129
b) somente a I e a II.
c) somente a I e a III.
d) somente a II e a III.
e) a I, a II e a III.
[D]
914. Na figura a seguir, em I, temos uma célula diplóide 2n = 6 cromossomos. Em II, III e IV, temos exemplos, respectivamente , de

a) haploidia; translocação; inversão paracêntrica.


b) haploidia; inversão pericêntrica; translocação.
c) monossomia; translocação; inversão pericêntrica.
d) monossomia; translocação; inversão paracêntrica.
e) monossomia; inversão paracêntrica; translocação.
[D]
915. A fenilcetonúria e a miopia são doenças decorrentes da ação de genes autossômicos recessivos. Do casamento entre uma mulher normal, filha de mãe com
fenilcetonúria e pai míope, com um homem normal para fenilcetonúria e míope, nasceu uma criança de visão normal e fenilcetonúrica. A probabilidade desse casal ter
uma criança normal para as duas características é:
a) 1/8 b) ½ c) 3/8 d) 7/8 e) ¾
[C]
916. Vegetais maiores, mais vigorosos e, por esse motivo, mais vantajosos economicamente, ocorrem casualmente na natureza. Es ses vegetais podem ser
reproduzidos pelo homem, artificialmente, usando técnicas de melhorando genético. Como exemplo, podemos citar o uso da Colchicina, que induz à
a) haploidia.
b) inversão cromossômica.
c) poliploidia.
d) recombinação gênica.
e) translocação cromossômica.
[C]
917. A estrutura química de uma proteína poderá ser modificada se
a) durante sua síntese houver variação dos tipos de aminoácidos disponíveis no citoplasma celular.
b) durante sua síntese houver variação dos tipos de RNA transportadores.
c) sua síntese ocorrer no complexo de Golgi e não no retículo endoplasmático rugoso.
d) uma base púrica substituir uma pirimídica no RNA mensageiro que a codifica.
e) o DNA não se duplicar durante a intérfase.
[D]
918. Considere estes dados como hipotéticos.
Um casal apresenta, em seus cromossomos de número 21, pontos de quebra por enzimas especiais, indicados no esquema por setas. Essas resultam em fragmentos
de tamanhos diferentes que podem ser utilizados como marcadores genéticos.
No esquema a seguir, os fragmentos são indicados por Kb (1Kb=1000 pares de bases nitrogenadas).
Esse casal tem uma criança com Síndrome de Down devida à trissomia do cromossomo 21. Os resultados obtidos com o estudo dos marcadores par a o cromossomo 21
do pai, da mãe e da criança estão indicados na figura 2, onde cada traço indica a posição e o tamanho dos fragmentos num campo de eletroforese.

Com base nas informações apresentadas e em conhecimento sobre o assunto responda ao que se pede.
1) Identifique o genitor que transmitiu dois cromossomos 21 à criança. Justifique sua resposta.
2) Determine o estágio da meiose, I ou II, em que ocorreu o fenômeno de não separação ou não-disjunção dos cromossomos. Justifique sua resposta.
3) Suponha que a mulher está novamente grávida e que o exame para marcadores do cromossomo 21, como descrito no texto, foi realizado para o feto através de
punção do líquido amniótico, amniocentese.
Analise o resultado obtido na figura 3.
Pelos resultados apresentados na figura pressupõe-se que a criança deve ser normal. Entretanto, após o nascimento, constatou-se que a criança apresentava Síndrome
de Down. Com base nessa informação, determine:
O genitor onde ocorreu a não-disjunção. A fase da meiose em que o fenômeno ocorreu.
1) O Pai porque a criança possui apenas 1 cromossomo 21 materno.
2) Divisão I porque a criança possui 2 cromossomos 21 distintos.
3) A criança herdou um cromossomo 21 duplicado de sua mãe (segmento de DNA maior) e a não disjunção, nesse caso, ocorreu na s egunda divisão da meiose.
919. Muitas aberrações cromossômicas humanas se manifestam como síndromes bem definidas e de fácil constatação pela análise do cariótipo. Na tabela a seguir são
dados cinco casos cuja veracidade você deverá analisar. Assinale nos parêntesses V se for verdadeira ou F se a afirmação for falsa.

130
FVVVF
920. Numa dada espécie, um indivíduo trissômico apresenta um cariótipo contendo 97 cromossomos. Qual o número de cromossomos que deve ser encontrado em um
espermatozóide normal nessa espécie?
48
921. Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. Doença pode ser definida como um desequilíbrio do organismo ou ausência de
bem-estar físico e mental. Ela pode ter inúmeras causas e variar de intensidade e manifestação. Com relação a esse tema, é CORRETO afirmar:
01. O alcoolismo, o tabagismo e a dependência de outras drogas são exemplos de causas que podem resultar em doenças.
02. Doenças genéticas são aquelas causadas por alterações do patrimônio genético e podem passar de pais para filhos, através do material genético.
04. Doenças traumáticas são aquelas que se originam de acidentes, podendo resultar em fratura de ossos, hemorragias, etc.
08. Doenças funcionais resultam do mau desempenho ou da perda de um órgão ou sistema.
16. Doenças transmissíveis são as transmitidas por patógenos ou por seus produtos.
32. O mongolismo é um exemplo de doença hereditária, enquanto a eritroblastose fetal é uma doença congênita.
01 + 02 + 04 + 08 + 16 + 32 = 63
922. Considere um segmento de DNA com seqüência de bases indicadas a seguir:
TTATCGGGACCGATCATCGTA
A alteração mais drástica que esta molécula pode sofrer é a:
a) supressão da segunda base nitrogenada.
b) supressão das três primeiras bases nitrogenadas.
c) substituição da quarta base nitrogenada por outra.
d) substituição das três primeiras bases nitrogenadas por outras.
e) inclusão de mais três bases nitrogenadas no final da molécula.
[A]
923. O esquema a seguir representa a formação dos gametas responsáveis pela produção de um indivíduo com alteração do seu núm ero cromossomial.

Entre as características que este indivíduo passará a apresentar, teremos:


a) sexo masculino.
b) cariótipo normal.
c) estatura elevada.
d) caracteres sexuais desenvolvidos.
e) ausência de cromatina sexual.
[E]
924. Num dado organismo, foram encontradas células somáticas normais com seis cromossomos (I) e células aberrantes (II e III) cujos cariótipos estão esquematizados
a seguir.

As aberrações cromossômicas dos cariótipos II e III são, respectivamente, do tipo


a) monossomia e trissomia.
b) monossomia e poliploidia.

131
c) nulissomia e trissomia.
d) nulissomia e poliploidia.
e) nulissomia e monossomia.
[A]
925. Por razões pouco conhecidas, durante a meiose pode ocorrer a não-disjunção de um determinado par de cromossomas, acarretando anomalias cromossomiais.
Como exemplo de anomalia cromossomial autossômica temos:
a) mongolismo.
b) daltonismo.
c) hemofilia.
d) Síndrome de Turner.
e) Síndrome de Klinefelter.
[A]
926. A síndrome de Klinefelter é uma anomalia genética devido à:
a) presença de três cromossomos autossômicos nŽ 21.
b) ausência de um cromossomo autossômico nŽ 21.
c) presença de um cromossomo X e dois cromossomos Y.
d) presença de um cromossomo Y e dois cromossomos X.
e) ausência de cromossomos sexuais.
[D]
927. Uma pesquisadora analisou células da mucosa bucal de frentistas de postos de gasolina. Foram encontradas muitas células que, além do núcleo, apresentavam
micronúcleos originados em cromossomos defeituosos.
Quanto a esses micronúcleos, podemos supor que se originaram a partir de
a) translocação. b) substituição. c) deleção.
d) deslocação. e) bipartição.
[C]
928. O número de cromossomos de uma espécie é 2n=20. O sistema de determinação do sexo é do tipo ZW. O cariótipo que representa uma euploidia é:
a) 20, ZW b) 20, ZZ c) 30, ZWW
d) 19, ZO e) 21, ZZW
[C]
929. Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. Indivíduos portadores da doença "xeroderma pigmentosum", condição genética
autossômica recessiva, apresentam, em células epidérmicas, extrema sensibilidade à luz solar, resultando em alta freqüência de câncer d e pele, principalmente na face.
Alguns desses pacientes também desenvolvem anormalidades neurológicas, que parecem resultar da mort e prematura de células nervosas.
Estudos genéticos, em células de organismos afetados, revelam a existência de defeitos no sistema enzimático responsável pelo reparo de moléculas de DNA
danificadas pela exposição a agentes mutagênicos.
Uma análise da situação apresentada anteriormente permite afirmar:
(01) Agentes mutagênicos incluem fatores físicos que alteram a estrutura da molécula de DNA.
(02) A falha em mecanismos celulares que preservam a fidelidade da mensagem genética predispõe ao câncer.
(04) A condição genética dos indivíduos com "xeroderma pigmentosum" é determinada pela exposição à radiação ultravioleta.
(08) A morte prematura de células nervosas resulta dos efeitos do acúmulo de lesões na molécula de DNA.
(16) Os genes que condicionam o "xeroderma pigmentosum" são característicos de células epidérmicas.
(32) A ocorrência de alterações em células nervosas e em células epidérmicas pode estar relacionada à sua origem embriológica comum.
(64) A precisão dos sistemas de reparo do DNA inviabiliza o processo evolutivo.
01 + 02 + 08 + 32 = 43
930. A figura abaixo esquematiza a não-disjunção cromossômica.

A respeito desse tema, julgue os itens abaixo.


(1) As fibras do fuso acromático são importância fundamental para as migrações cromossômicas características da anáfase.
(2) Os erros na distribuição de cromossomos que levam às aneuploidias são freqüentes no processo de meiose e raros nas mitoses.
(3) As aberrações cromossômicas numéricas causam grandes alterações no funcionamento celular, produzindo doenças graves e até mesmo a morte.
(4) As síndromes de Down e de Turner, causadas por não-disjunções cromossômicas, são exemplo de trissomia e de monossomia.
CECC
931. "Era um burrinho pedrês, miúdo e resignado, vindo de Passa-Tempo, Conceição do Serro, ou não sei onde no sertão. Chamava-se Sete-de-Ouros, e já fora tão
bom, como outro não existiu e nem pode haver igual."
Todas as alternativas apresentam características biológicas do burrinho referido nesse texto, EXCETO
a) É resultante do cruzamento de égua com jumento.
b) Tem características morfológicas idênticas às de um dos pais.
c) É um típico exemplo de animal híbrido.
d) Produz gametas inviáveis.
[B]
932. Pela análise dos cromossomas, é possível detectar a anomalia que caracteriza a síndrome de Down. O esquema a seguir apresenta quatro eventos da divisão
celular.

132
Os eventos possíveis da meiose que levam à síndrome de Down são os de número:
a) 1 e 4 b) 1 e 3 c) 2 e 3 d) 2 e 4
[C]
933. A anemia falciforme ou siclemia é uma doença hereditária que leva à formação de hemoglobina anormal e, conseqüentemente, de hemácias que se deformam. É
condicionada por um alelo mutante s. O indivíduo SS é normal, o Ss apresenta anemia atenuada e o ss geralmente morre. O esquema a seguir mostra a seqüência do
DNA que leva à formação da hemoglobina normal e a que leva à formação da hemoglobina alterada.
Considere os segmentos de DNA a seguir:

Trata-se de um caso de mutação por


a) perda de um par de bases no DNA, sem alteração do aminoácido codificado.
b) adição de um par de bases no DNA, sem alteração do aminoácido codificado.
c) inversão de um par de bases no DNA, sem alteração do aminoácido codificado.
d) inversão de um par de bases no DNA, com alteração do aminoácido codificado, mas não da proteína correspondente.
e) inversão de um par de bases no DNA, com alteração do aminoácido codificado e da proteína correspondente.
[E]
934. Em uma certa espécie de animal selvagem, os machos normais apresentam complemento cromossômico igual a 2n=6,XY. Entretanto, um indivíduo anormal foi
identificado na população e seu cariótipo foi representado pela seguinte forma:

Considerando-se os dados anteriores, pode-se afirmar que o indivíduo é:


a) trissômico. b) poliplóide. c) triplóide.
d) haplóide. e) monossômico.
[A]
935. Na espécie humana, a anomalia conhecida como síndrome de Down ou mongolismo deve-se à
a) mutação de um gene autossômico.
b) mutação de um gene do cromossomo X.
c) existência de um autossomo extra.
d) existência de um cromossomo X extra.
e) falta de um cromossomo X.
[C]
936. A mutação gênica, nos organismos eucariontes
a) constitui a principal fonte de variabilidade genética.
b) ocorre exclusivamente pela ação de agentes mutagênicos.
c) origina apenas seres recessivos.
d) ocorre devido a alterações na molécula de DNA.
e) origina somente combinações gênicas adaptativas.
[A]
937. Vários são os processos que atuam na evolução. Dentre eles, o único que fornece material genético novo a um determinado conjunto gênico preexistente é a:
a) mutação gênica. b) recombinação gênica.
c) seleção natural. d) reprodução assexuada.

133
e) reprodução sexuada.
[A]
938. Na(s) questão(ões) a seguir, escreva no espaço apropriado a soma dos itens corretos. Um canil, especializado na criação de dálmatas, escolheu dois irmãos de
uma ninhada e os cruzou. Desse cruzamento resultaram oito filhotes que, na sua maioria, apresentaram as mesmas características dos pais. Observou-se, entretanto,
que, dos oito cãezinhos, dois nasceram cegos. À luz dos conhecimentos de genética, esse fato pode ser explicado porque houve:
01) Heterose, reduzindo o vigor da ninhada.
02) Efeito genético da consangüinidade.
04) Herança ligada ao cromossomo sexual.
08) Segregação monogênica dominante.
16) Deriva genética, fixando aleatoriamente alguns genes.
32) Semiletalidade, ou seja, efeitos nocivos que podem surgir devido a genótipos recessivos produzidos através do cruzamento entre indivíduos aparentados.
02 + 08 + 32 = 42
939. A respeito das mutações, leia as afirmações a seguir.
I - Ocorrem para adaptar o indivíduo ao ambiente.
II - Ocorrem em células sexuais e somáticas.
III - Podem alterar o número, a forma e o tamanho dos cromossomos.
A(s) afirmação(ões) correta(s) é(são):
a) somente a II.
b) somente a I e a II.
c) somente a I e a III.
d) somente a II e a III.
e) a I, a II e a III.
[D]
940. Observe a seqüência de bases nitrogenadas.

Todas as afirmativas são corretas quanto à seqüência, EXCETO


a) A introdução de uma adenina (A) entre as trincas indicadas por 2 e 3 pode alterar toda a transcrição a partir desse ponto.
b) A mutação da 3 • base na trinca indicada por 9 pode traduzir um aminoácido diferente.
c) A seqüência pertence a um DNA e pode codificar um polipeptídeo contendo, pelo menos, 27 aminoácidos.
d) A trinca indicada por 5 pode transcrever um códon CGA, o qual é reconhecido pelo anti-códon GCU.
e) A troca da primeira base, em quaisquer das trincas indicadas, pode resultar na troca do aminoácido respectivo na proteína.
[C]
941. Analise as proposições:
1. Modificações hereditárias que ocorrem num locus específico são chamadas de mutações gênicas.
2. Os principais agentes mutagênicos são as radiações ionizantes e os raios-ultravioleta.
3. As mutações do tipo substituição de base acarretam a alteração de vários aminoácidos nas proteínas.
Está(ão) correta(s):
a) 1, apenas b) 1 e 3, apenas c) 3, apenas
d) 1, 2 e 3 e) 2, apenas
[A]
942. Atualmente são bem conhecidos os efeitos adversos à saúde humana, causados por diversos poluentes ambientais, especialmente aqueles que possuem
potencialidades mutagênicas ou carcinogênicas, os quais, devido à sua interação com mecanismos genéticos, podem causar mutações e doenças nas gerações futuras.
Assinale as afirmações corretas:
I - Mutações são modificações bruscas do material genético que podem ser transmitidas à prole (descendência ou células filhas).
II - A mutação pode ser espontânea ou induzida por agentes físicos, químicos ou biológicos com potencial mutagênico.
III - Mutação é toda alteração do material genético, que resulta sempre de segregação ou recombinação cromossômicas.
IV - Mutações gênicas podem ser causadas por poluentes ambientais o provocar alterações responsáveis pelo aparecimento de genótipos diferentes numa população.
A alternativa que contém as afirmações corretas é:
a) I e III. b) II e III. c) I, II e IV.
d) IV e III. e) III.
[C]
943 Analise as afirmativas a seguir, a respeito das mutações.
I - Sempre que o ambiente se torna desfavorável, o ser vivo reage sofrendo uma mutação gênica.
II - As mutações transmitidas às gerações futuras são aquelas que ocorrem em células germinativas.
III - As mutações ocorridas em células somáticas são de grande valor adaptativo para a perpetuação da espécie.
Está(ão) correta(s)
a) I apenas b) II apenas. c) III apenas.
d) I e II apenas. e) II e III apenas.
[B]
944. Recentemente, cientistas confirmaram suas suspeitas de que existem pessoas imunes à AIDS. A partir do estudo de um grupo de 1850 pessoas, os cientistas
afirmaram que a imunidade está relacionada a uma mutação genética, apresentada por 3% dos pacientes estudados. Os cientistas consideraram esse percentual muito
elevado.
A característica da mutação, que permite que ela ocorra em grande número de indivíduos, por ter sido transmitida de geração em geração, é:
a) impedir a multiplicação de determinado vírus no interior das células
b) evitar a ação de agentes externos sobre os genes
c) representar uma vantagem para a sobrevivência
d) ocorrer em resposta à necessidade de adaptação
[C]

134
945. Uma bactéria sofre uma mutação pontual em uma região do seu DNA, que era:
TAC CTT ATA GAT
Ocorreu uma mudança na terceira base, que passou de citidina a guanina. Indique o RNA mensageiro codificado pela seqüência de DNA mutada.
a) ATC GAA TAT CTA
b) ATG GAA TAT CTA
c) AUC UAU AAG GUA
d) AUC GAA UAU CUA
e) AUG G GAA UAU CUA
[D]
946. Pode-se afirmar que a mutação
a) sempre ocorre para adaptar o indivíduo ao ambiente.
b) aumenta a freqüência de crossing-over.
c) aumenta o número de alelos disponíveis em um locus.
d) sempre é dominante e prejudicial ao organismo.
[C]
947. Considere o seguinte segmento de uma cadeia de DNA e o polipeptídio sintetizado a partir dele:
ATA - GCA - GTG - ACA - CCT
TIROSINA - ARGININA - HISTIDINA - CISTEÍNA - GLICINA
Após a substituição de uma única base nitrogenada no segmento de DNA, o polipeptídio sintetizado passou a apresentar duas argininas.
A seqüência de trincas no RNA mensageiro que pode ter codificado esse polipeptídio alterado é
a) CUC - TGC - TGC - CGC - GGU
b) TUT - CGT - CGT - TGT - GGU
c) CGT - CGT - CAC - TGT - GGA
d) UAU - CTU - CAC - CTU - TTA
e) UAU - CGU - CAC - CGU – GGA
[E]
948. Em certo fungo, ocorre a seqüência de reações a seguir esquematizada que leva à síntese do aminoácido arginina.

Verificou-se que certos fungos mutantes só conseguem sintetizar arginina quando a ornitina é acrescentada ao meio de cultura. Esses fungos devem ter sofrido mutação
no gene
a) X, somente. b) Y, somente. c) Z, somente.
d) X ou no gene Y. e) X ou no gene Z.
[A]
949. Considerando os genes X, Y e Z de um cromossomo, sabe-se que há 15% de recombinação entre os genes X e Y, entre Y e Z há 30% e entre os genes Z e X
ocorre 45%. Qual a posição relativa desses três genes no cromossomo?
a) ZXY b) XYZ c) YZX d) XZY e) YXZ
[B]
950. O cruzamento CD/cd x cd/cd produziu 300 descendentes. Quantos deverão ser diferentes dos pais, sabendo-se que a frequência de permutação é de 10%
a) 30 b) 15 c) 270 d) 290 e) 45
[A]
951. O cruzamento AB/ab x ab/ab produziu 450 descendentes. Quantos deverão ser diferentes dos pais, sabendo-se que a frequência de permutação é de 20%
a) 30 b) 90 c) 430 d) 360 e) 45
[B]
952. Um cruzamento entre dois indivíduos, com os genótipos DdEe x ddee, originou 42 descendentes com genótipo DdEe, 160 Ddee, 168 ddEe e 40 ddee. Sobre os
genes D e E podemos concluir que:
a) estão ligados e há permuta entre eles.
b) estão ligados e não há permuta entre eles.
c) segregam-se independentemente e há permuta entre eles.
d) segregam-se independentemente e não há permuta entre eles.
e) não estão ligados, logo segregam-se independentemente.
[A]
953. Na meiose de um indivíduo AB/ab, ocorre "crossing-over" entre esses genes em 40% das células. A freqüência de gametas AB, Ab, aB e ab produzidos por esse
indivíduo deve ser, respectivamente,
a) 10%, 40%, 40% e 10%
b) 30%, 20%, 20% e 30%
c) 30%, 30%, 20% e 20%
d) 40%, 10%, 10% e 40%
e) 40%, 40%, 10% e 10%
[D]
954. Especiação é um processo de formação de novas espécies. O mecanismo diretamente responsável pela especiação é chamado de :
a) hibridação.
b) isolamento reprodutivo.
c) esterilização.
d) recombinação gênica.
e) multiplicação celular.
[B]

135
955. Na(s) questão(ões) a seguir escreva nos parêntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Anal ise os dados apresentados a seguir, que trata
dos tipos e percentuais de gametas produzidos por um indivíduo de genótipo não divulgado (indivíduo parental).
AB = 47,4%
Ab = 2,6%
aB = 2,6%
ab = 47,4%
( ) Trata-se de um caso de genes de segregação independente, determinando uma distribuição 1:1:1:1:
( ) 5,2% dos gametas apresentam combinações alélicas diferentes daquelas existentes nos
cromossomos do indivíduo parental.
( ) O indivíduo parental é um heterozigoto AB/ab e, portanto, um heterozigoto "Cis".
( ) O indivíduo parental é um heterozigoto aB/Ab, ou seja, um heterozigoto "Trans".
( ) Considerando que 5,2% dos gametas são recombinantes, pode-se inferir que ocorreu quiasma entre os locos "A" e "B" em 94,8% das células meióticas que
originaram estes gametas.
FVVFF
956. Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. Considerando inclusive a possibilidade de permuta genética, um indivíduo portador
do genótipo ABD//abD poderá produzir os seguintes gametas:
01. Portador apenas de A ou a, sem alelos B e D.
02. a b D
04. portador apenas de B ou d, sem alelos A e D.
08. A B D
16. a B D
32. portador apenas de D, sem alelos A e B.
64. A b D
02 + 08 + 16 + 64 = 90
957. Em determinada espécie, os locos dos genes A e B situam-se no mesmo cromossomo. Na meiose de um indivíduo duplo-heterozigoto AB/ab ocorre permutação
entre esses locos em 80% das células. A porcentagem esperada de gametas Ab que o indivíduo formará é
a) 10% b) 20% c) 30% d) 40% e) 80%
[B]
958. Se a distância entre dois locos gênicos é de 20 unidades, a partir de um determinado cruzamento espera-se obter os seguintes descendentes:
+ + 10
+ d 40
c + 40
c d 10
Esses cruzamento poderia ser
a) ++/++ x cd/cd
b) ++/cd x cd/cd
c) +d/+d x c+/c+
d) +d/c+ x cd/cd
e) +d/cd x c+/cd
[D]
959. No órgão reprodutor de um animal, há 1000 (mil) células, em cujos núcleos estão os cromossomas, como mostra o desenho a seguir:

Se em todas as células ocorrer "crossing-over" entre os gens A e B, e se cada uma originar 4 (quatro) gametas, podemos afirmar que:
a) todos os gametas formados conterão as combinações resultantes do "crossing".
b) a proporção de gametas com as formas não "crossing" seria maior do que a de gametas com as formas "crossing".
c) a ocorrência do "crossing" não altera a seqüência dos gens nos cromossomas, porque só as cromátides irmãs são envolvidas.
d) as proporções entre os tipos de gametas seriam iguais às que ocorrem quando os genes estão em cromossomas diferentes.
e) não é possível calcular essas proporções, porque os gametas recebem cromossomas ao acaso.
[D]
960. Analisando-se dois pares de genes em ligamento fatorial ("linkage") representados pelo híbrido BR/br, uma certa espécie apresentou a seg uinte proporção de gametas:
BR - 48,5%
br - 48,5%
Br - 1,5%
bR - 1,5%
Pela análise dos resultados, pode-se concluir que a distância entre os genes B e R é de:
a) 48,5 morganídeos.
b) 97 morganídeos.
c) 1,5 morganídeo.
d) 3 morganídeos.
e) 50 morganídeos.
[D]
961. A figura a seguir representa _______________ , que ocorre na _______________ e tem como conseqüência _______________.

136
A alternativa que preenche correta e respectivamente os espaços anteriores é:
a) o crossing-over; metáfase da mitose; a variabilidade genética.
b) o pareamento de cromátides-irmãs; anáfase I da meiose; a troca de genes alelos.
c) o crossing-over; prófase I da meiose; a variabilidade genética.
d) a segregação de cromossomos homólogos; anáfase I da meiose; a formação de células haplóides.
e) o pareamento de cromossomos homólogos; metáfase da mitose; a formação de gametas.
[C]
962. Suponha que 100 células germinativas entram em meiose e que essas células tenham o seguinte genótipo:

Quantos gametas recombinantes serão formados se 20 das 100 células apresentarem permutação na meiose?
a) 20 b) 40 c) 80 d) 160 e) 180
[B]
963. Em um caso de "linkage", dois genes A e B, autossômicos, distam entre si 20 UR. Considere o seguinte cruzamento:
Fêmea (Ab/aB) X Macho (ab/ab)
Qual é a freqüência esperada de machos com o genótipo AB/ab?
a) 100% b) 50% c) 25% d) 10% e) 5%
[E]
964. Com relação ao processo conhecido como crossing-over, podemos afirmar que o mesmo
a) diminui a variabilidade genética.
b) separa cromátides homólogas.
c) corrige a recombinação gênica.
d) aumenta a variabilidade genética.
e) troca cromossomos entre genes homólogos.
[D]
965. Numa certa espécie de milho, o grão colorido é condicionado por um gene dominante B e o grão liso por um gene dominante R. Os alelos recessivos b e r
condicionam, respectivamente, grãos brancos e rugosos. No cruzamento entre um indivíduo colorido liso com um branco rugoso, surgiu uma F•, com os seguintes
descendentes:
150 indivíduos que produziam sementes coloridas e lisas,
150 indivíduos que produziam sementes brancas e rugosas,
250 indivíduos que produziam sementes coloridas e rugosas e
250 indivíduos que produziam sementes brancas e lisas.
A partir desses resultados, podemos concluir que o genótipo do indivíduo parental colorido liso e a distância entre os genes B e R são
a) BR/br; 62,5 U.R.
b) BR/br; 37,5 U.R.
c) Br/bR; 62,5 U.R.
d) Br/bR; 37,5 U.R.
e) BR/br; 18,75 U.R.
[D]
966. Com relação ao processo denominado permutação ou crossing over, é correto afirmar:
01. É a troca de gametas que ocorre durante o cruzamento de dois indivíduos da mesma espécie.
02. É a troca de micronúcleos entre indivíduos unicelulares para renovar o seu material genético.
04. É o processo que origina novos arranjos gênicos resultantes de trocas de fragmentos de cromátides homólogas.
08. É o pareamento de cromossomos homólogos de modo a se tornarem bivalentes.
16. É o processo de duplicação dos cromossomos para garantir a manutenção da espécie.
32. É um processo que ocorre necessariamente durante a mitose.
64. É o processo responsável pela variabilidade genética entre organismos de uma mesma espécie.
FFVFFFV
967. No heredograma adiante o indivíduo 3 é afetado pelo albinismo. Sabendo-se que, na população, a frequência de heterozigoto para o albinismo é de 1/50, qual é a
probabilidade de que o casal 4x5 tenha uma menina albina?

137
P = 1/600
968. No heredograma a seguir os símbolos cheios representam indivíduos portadores de uma anomalia genética. Qual é a probabil idade de o indivíduo 9 ser portador
dessa anomalia?

P = 1/6
969. Os heredogramas a seguir apresentam o padrão de herança de um mesmo caráter em cinco diferentes famílias, identificadas por 1, 2, 3, 4 e 5. Os círculos
representam as mulheres e os quadrados, os homens. Os símbolos cheios indicam que o indivíduo é portador do caráter.

Supondo que não haja mutação, analise os heredogramas e assinale a alternativa correta.
a) A família l permite concluir que se trata de um caráter dominante ligado ao cromossomo X.
b) A família 2 permite concluir que se trata de um caráter autossômico recessivo.
c) A família 3 permite concluir que se trata de um caráter recessivo, ligado ao cromossomo X.
d) A família 4 permite concluir que se trata de um caráter recessivo, ligado ao cromossomo Y.
e) A família 5 mostra que o caráter não pode ser controlado por gene ligado ao cromossomo X.
[B]
970. Na espécie humana há um tipo de surdez hereditária que é determinada por um par de genes. No heredograma a seguir, as pessoas surdas estão representadas
por símbolos hachurados:
Com base nessa afirmação, assinale a opção correta quanto ao tipo de herança e os genótipos dos indivíduos 1, 2, 3 e 4, respectivamente:

a) autossômica dominante - ss, Ss, ss e ss.


b) autossômica dominante - SS, ss, SS e SS.
c) autossômica dominante - Ss, SS, Ss e Ss.
d) autossômica recessiva - SS, ss, Ss e SS.
e) autossômica recessiva - Ss, ss, Ss e Ss.
[E]

138
971. Analise o heredograma que representa a herança de um tipo de disfunção dos músculos esqueléticos e cardíaco em seres hum anos.

Com relação ao heredograma, é correto afirmar-se que


a) a herança para esse tipo de característica é recessiva e ligada ao sexo.
b) a ocorrência da característica nessa família se deve aos casamentos consangüíneos.
c) a probabilidade de mulheres descendentes de IV-1 serem afetadas é zero.
d) as mulheres afetadas apresentam fenótipos idênticos aos de suas mães.
e) o casamento de III-4 com indivíduo de fenótipo igual a II-4 tem como resultado esperado 1OO% de mulheres afetadas.
[D]
972. Analise o heredograma.

Em relação à característica representada no heredograma, todas as alternativas são possíveis, EXCETO


a) A herança pode ser autossômica.
b) A herança pode ser ligada ao sexo.
c) A herança pode representar uma família de hemofílicos.
d) I-1 e I-2 podem ser heterozigotos.
e) II-2, II-5 e III-1 podem ser homozigotos dominantes.
[E]
973. Na(s) questão(ões) a seguir escreva nos parêntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Um pesquisador apresentou a seus alunos o
heredograma a seguir, relativo a uma certa doença observada por ele em humanos. Sabendo-se que os indivíduos afetados estão representados em negrito e os
normais em branco, pode-se afirmar:

( ) a doença é causada por um alelo recessivo;


( ) trata-se de um caso de herança parcialmente ligada ao sexo;
( ) a doença é causada por um alelo dominante;
( ) trata-se de um caso de herança ligada ao sexo;
( ) é um caso de polialelia com epistasia recessiva.
VFFFF
974. Analise a genealogia a seguir, onde foi estudado o caráter BRAQUIDACTILIA (dedos curtos), que é determinado por um par de genes:

139
Nessa família, os indivíduos 1, 2, 3, 4 e 7 são braquidáctilos, enquanto os indivíduos 5 e 8 apresentam dedos normais.
Considerando essas informações e desprezando a possibilidade de ocorrência de mutação, pode-se afirmar que o indivíduo 6:
a) é braquidáctilo e homozigoto.
b) é braquidáctilo e heterozigoto.
c) tem dedos normais e é homozigoto.
d) tem dedos normais e é heterozigoto.
e) pode ser ou não braquidáctilo e é homozigoto.
[B]
975. Analise o heredograma a seguir, onde os indivíduos masculinos são representados por quadrados e os femininos por círculos.

Sobre as informações contidas no heredograma, podemos afirmar que os indivíduos heterozigotos são:
a) 1, 2, 3, 4
b) 1, 2, 4, 5
c) 1, 2, 6, 8
d) 4, 5, 6, 7
e) 3, 5, 9
[C]
976. No heredograma a seguir, círculos representam mulheres, quadrados representam homens e símbolos preenchidos representam indivíduos portadores de certa
característica.

Com base na análise do heredograma, pode-se concluir que a característica em questão é condicionada por gene
a) dominante, localizado no cromossomo X.
b) recessivo, localizado no cromossomo X.
c) dominante, localizado em um autossomo.
d) recessivo, localizado em um autossomo.
e) localizado no cromossomo Y.
[D]
977. O esquema a seguir representa indivíduos de três gerações de uma família. Os símbolos escuros indicam os portadores de uma anomalia hereditária.

140
Analisando-se a genealogia, conclui-se que a anomalia é determinada por gene
a) dominante, localizado no cromossomo x.
b) dominante, localizado no cromossomo y.
c) dominante, localizado em autossomo.
d) recessivo, localizado no cromossomo y.
e) recessivo, localizado em autossomo.
[E]
978. O tipo de herança genética apresentada pelos indivíduos afetados é:

a) autossômica dominante.
b) autossômica recessiva.
c) ligada ao x dominante.
d) ligada ao x recessiva.
e) ligada ao y.
[A]
979. Se os indivíduos 7 e 11 se casarem, a probabilidade desse casal ter uma filha com o mesmo fenótipo do avô materno é de:

a) ½ b) ¼ c) 1/8 d) 1/3 e) 2/3


[B]
980. O heredograma a seguir representa a herança de um par de genes entre os quais há dominância. Os símbolos escuros representam indivíduos que exibem a
característica recessiva.

Nesse heredograma NÃO se pode determinar o genótipo do indivíduo


a) 1 b) 3 c) 5 d) 6 e) 7
[E]

141
981. Na espécie humana há um tipo de doença hereditária muito rara denominada Aquiropodia, que é determinada por um par de ge nes. No heredograma a seguir, os
aquirópodos estão representados por símbolos hachurados.

Com base na análise do heredograma, assinale a afirmativa INCORRETA.


a) Pode-se dizer que a Aquiropodia é condicionada por um alelo recessivo a.
b) Pode-se assumir que os indivíduos II.1 e II.5 possuem o genótipo AA, já que a condição herdada em análise é muito rara.
c) Não é possível ter certeza sobre o genótipo de alguns indivíduos, como é o caso dos indivíduos II.3 e III.5.
d) Os pais dos aquirópodos são primos.
e) O genótipo dos indivíduos IV.2 e IV.4 é aa.
[C]
982. O esquema mostra a genealogia de uma família. Os símbolos escuros representam os indivíduos míopes e os claros, os indiv íduos de visão normal.

A probabilidade do casal I x II ter uma criança míope é


a) imprevisível, porque a mulher tanto pode ser homozigota como heterozigota.
b) nula, porque a mulher tem o gene dominante em homozigose.
c) 1/2, porque 50% dos gametas da mulher transportam o gene recessivo.
d) 1/4, porque o casal já tem três filhos com visão normal.
e) 1/4, porque o gene para a miopia é recessivo.
[C]
983. A acondroplasia (uma das formas de nanismo) é causada por um gene dominante autossômico.
Da união de um homem acondroplásico com uma mulher normal resulta um filho normal.
Este se casa com uma mulher normal cujos pais eram normais (conforme heredograma abaixo).

Em relação aos descendentes deste último casamento e ao caráter em questão, considerando ausência de mutação, é correto afirm ar:
( ) O descendente será obrigatoriamente heterozigoto.
( ) A freqüência genotípica na descendência será 1:2:1.
( ) A probabilidade de acondroplasia na descendência é igual a zero.
( ) A probabilidade de heterozigose na descendência em relação a este locus é igual a zero.
( ) A freqüência fenotípica numa prole numerosa será 3:1.
( ) Numa prole numerosa, a freqüência fenotípica será de 1 acondroplásico para 1 normal.
FFVVFF
984. O heredograma mostra a incidência de uma anomalia genética em grupo familiar.

142
Após a análise deste heredograma, podemos afirmar:
a) todos os indivíduos normais são homozigotos recessivos;
b) a anomalia é condicionada por um gene recessivo;
c) a anomalia ocorre apenas em homozigotos dominantes;
d) todos os indivíduos normais são homozigotos dominantes;
e) todos os indivíduos normais são homozigotos dominantes ou heterozigotos.
[A]
985. A calvície é uma característica influenciada pelo sexo e o gene que a condiciona se comporta como recessivo no sexo femi nino e dominante no sexo masculino.
Observe a genealogia a seguir, relativa a essa característica.

A probabilidade do casal 3×4 ter o primeiro filho homem e que venha a ser calvo, é:
a) ½ b) ¼ c) 1/8 d) 1/6
[B]
986. A anemia falciforme é causada pela presença de uma hemoglobina anormal. Essa doença é herdada como autossômica recessiva. Considerando o heredograma
apresentado inicialmente os indivíduos I - 2 e I - 3 forem heterozigotos e os indivíduos I - 1 e I - 4 forem homozigotos normais, quem poderá ser afetado pela doença?

a) Apenas III - 1 e III - 2.


b) Apenas II - 1 e II - 3.
c) Apenas II - 2 e II - 4.
d) II - 1, II - 2, II - 3 e II - 4.
e) II - 1, II - 3, III - 1 e III - 2.
[A]
987. Considerando o heredograma abaixo, onde os indivíduos afetados pela síndrome unha-rótula (deformação nas unhas e nas rótulas) aparecem em preto, é correto
afirmar:

01) A anomalia é causada por gene provavelmente recessivo.

143
02) A anomalia é causada por gene provavelmente dominante.
04) Trata-se de gene localizado no cromossomo X.
08) Trata-se de gene localizado no cromossomo Y.
16) Trata-se de gene autossômico.
32) Trata-se de Herança Intermediária.
64) Trata-se de Herança Holândrica.
FVFFVFF
988. A talassemia é uma doença hereditária que resulta em anemia. Indivíduos homozigotos MM apresentam a forma mais grave, id entificada como talassemia maior e
os heterozigotos MN, apresentam uma forma mais branda chamada de talassemia menor. Indivíduos homozigotos NN são normais. Sab endo-se que todos os indivíduos
com talassemia maior morrem antes da maturidade sexual, qual das alternativas a seguir representa a fração de indivíduos adultos, descendentes do cruzamento de um
homem e uma mulher portadores de talassemia menor, que serão anêmicos?
a) ½ b) ¼ c) 1/3 d) 2/3 e) 1/8
[D]
989. Mendel cruzou duas variedades de 'Mirabilis jalapa', uma com flores vermelhas e outra com flores brancas. Na geração F• todas as flores eram rosas. Indique qual
será o resultado do cruzamento da variedade de flores rosas (F‚).
a) 25% brancas : 25% vermelhas : 50% rosas
b) 25% brancas : 50% vermelhas : 25% rosas
c) 100% rosas
d) 50% vermelhas : 50% rosas
e) 50% brancas : 25% vermelhas : 25% rosas
[A]
990. Do cruzamento entre aves andaluzas de coloração azulada, nasceram 15 filhotes azulados, 7 brancos e 8 pretos. Trata-se de um caso de _____________ e os
indivíduos parentais são _______________. O preenchimento correto das lacunas é, respectivamente:
a) herança quantitativa e homozigotos dominantes.
b) codominância e heterozigotos
c) linkage e heterozigotos.
d) herança ligada ao sexo e homozigotos recessivos.
e) epistasia e homozigotos dominantes.
[B]
991. Valéria gostava muito de flores. Observando seu jardim, notou a existência de plantas de uma mesma espécie, que possuíam indivíduos com flores brancas, rosas
e vermelhas. Curiosa para saber como se dava a transmissão desse caráter, Valéria promoveu uma autofecundação nas plantas de cor rosa e, para sua surpresa,
obteve plantas que davam flores brancas, vermelhas e rosas, estas últimas em quantidade duas vezes maior que as plantas de fl or branca e vermelha, obtendo plantas
que só davam flores de cor rosa.
Valéria concluiu CORRETAMENTE que:
a) trata-se de dominância da cor rosa sobre as demais.
b) trata-se de um caso de co-dominância entre os genes alelos que determinam o padrão de cor.
c) as plantas de flor rosa eram recessivas.
d) as plantas de flor vermelha eram dominantes e as de cor branca recessivas.
e) trata-se de um caso de gene letal, pois o cruzamento de plantas de flores brancas e vermelhas só originou flores rosas.
[B]
992. Um casal de africanos teve três filhos. O primeiro morreu aos 5 anos de idade, em conseqüência de anemia, falciforme; o segundo é normal e bastante suscetível a
malária (doença endêmica na região); o último é normal, porém pouco suscetível a malária. Assinale a opção em que se indicam , corretamente, o membro da família
com seu respectivo genótipo e o padrão de herança da anemia falciforme.
a) 2º filho → homozigoto recessivo
Herança: dominância completa;
b) pai → heterozigoto
Herança: epistasia dominante;
c) 3º filho → heterozigoto
Herança: co-dominância;
d) mãe → homozigoto dominante
Herança: pleiotropia.
[C]
993. Observe o esquema.

Com base nesse esquema e em conhecimentos sobre o assunto, é CORRETO afirmar que
a) o gene HbA é dominante sobre o gene HbS.
b) os indivíduos HbA/HbS e HbS/HbS devem apresentar os mesmos níveis de hemoglobina anormal.
c) os indivíduos que produzem só hemácias anormais podem ser curados por meio de transfusão sangüínea.
d) um determinado genótipo pode produzir diferentes fenótipos.
[D]
994. Moscas de coloração acinzentada cruzadas entre si fornecem moscas de cor preta. Para determinarmos se uma mosca cinza é homozigota ou heterozigota quanto
ao par de genes que condicionam esse caráter, o procedimento correto é analisar a prole resultante do cruzamento dessa mosca com outra de
a) cor preta.
b) cor cinza.
c) genótipo igual ao seu.
d) fenótipo igual ao seu.
e) fenótipo dominante.
[A]

144
995. "Cada caráter é condicionado por um par de fatores que se separam na formação dos gametas". Mendel ao enunciar essa lei já admitia, embora sem conhecer, a
existência das seguintes estruturas e processo de divisão celular, respectivamente:
a) cromossomos, mitose.
b) núcleos, meiose.
c) núcleos, mitose.
d) genes, mitose.
e) genes, meiose.
[E]
996. Dois grupos de mudas obtidas a partir de um mesmo clone de plantas verdes foram colocados em ambientes diferentes: um cl aro e outro escuro. Depois de alguns
dias, as plantas que ficaram no escuro estavam estioladas o que significa que os dois grupos apresentam:
a) o mesmo genótipo e fenótipos diferentes.
b) o mesmo fenótipo e genótipos diferentes.
c) genótipos e fenótipos iguais.
d) genótipos e fenótipos diferentes.
e) genótipos variados em cada grupo.
[A]
997. "Casais de pigmentação da pele normal, que apresentam genótipo __(I)__ podem ter filhos albinos. O gene para o albinismo é __(II)__ e não se manifesta nos
indivíduos __(III)__. São albinos apenas os indivíduos de genótipo __(IV)__."
No trecho acima, as lacunas I, II, III e IV devem ser preenchidas
correta e, respectivamente, por:
a) AA, dominante, homozigoto e aa.
b) AA, recessivo, homozigoto e Aa.
c) Aa, dominante, heterozigotos e aa.
d) Aa, recessivo, heterozigotos e aa.
e) aa, dominante, heterozigotos e AA.
[D]
998. Considere os seguintes cruzamentos para ervilha, sabendo que V representa o gene que determina cor amarela dos cotilédon es e é dominante sobre o alelo v, que
determina cor verde.
I. VVx vv
II. Vv x Vv
III. Vv x vv
Um pé de ervilha, heterozigoto e que, portanto, produz vagens com sementes amarelas e com sementes verdes, pode resultar
a) apenas do cruzamento I.
b) apenas do cruzamento II.
c) apenas do cruzamento III.
d) apenas dos cruzamentos II e III.
e) dos cruzamentos I, II e III.
[D]
999. Um gato preto (A) foi cruzado com duas gatas (B e C) também pretas. O cruzamento do gato A com a gata B produziu 8 filhotes, todos pretos; o cruzamento do
gato A com a gata C produziu 6 filhotes pretos e 2 amarelos. A análise desses resultados permite concluir que:
a) a cor preta é dominante, A e C são homozigotos.
b) a cor preta é dominante, A e B são homozigotos.
c) a cor preta é dominante, A e C são heterozigotos.
d) a cor preta é recessiva, A e C são homozigotos.
e) a cor preta é recessiva, B e C são heterozigotos.
[C]
1000. Dois genes alelos atuam na determinação da cor das sementes de uma planta: (A), dominante, determina a cor púrpura e (a), recessivo, determina a cor amarela.
A tabela a seguir apresenta resultados de vários cruzamentos feitos com diversas linhagens dessa planta:

Apresentam genótipo (Aa) as linhagens:


a) I e III b) II e III c) II e IV
d) I e IV e) III e IV I
[C]
1001. Pedro e seus filhos, João e Maria, têm uma doença determinada por um gene dominante. Não há outros afetados na família. Esse gene:
a) está no cromossomo X.
b) está no cromossomo Y.
c) está num autossomo.
d) pode estar no cromossomo X ou no Y.
e) pode estar num cromossomo ou num autossomo
[C]
1002. Na espécie humana há um tipo de surdez hereditária que é determinada por um par de genes. No heredograma a seguir, as pessoas surdas estão representadas
por símbolos hachurados:
Com base nessa afirmação, assinale a opção correta quanto ao tipo de herança e os genótipos dos indivíduos 1, 2, 3 e 4, respectivamente:

145
a) autossômica dominante - ss, Ss, ss e ss.
b) autossômica dominante - SS, ss, SS e SS.
c) autossômica dominante - Ss, SS, Ss e Ss.
d) autossômica recessiva - SS, ss, Ss e SS.
e) autossômica recessiva - Ss, ss, Ss e Ss.
[E]
1003. Considere uma ovogônia de uma mulher heterozigota para o par de alelos Dd. Entre os possíveis gametas formados por essa ovogônia, podemos encontrar:
a) quatro óvulos Dd.
b) quatro óvulos D e quatro óvulos d.
c) dois óvulos D e dois óvulos d.
d) apenas um óvulo Dd.
e) apenas um óvulo D ou um óvulo d.
[E]
1004. Qual a porcentagem de descendentes Aa nascidos de uma mãe Aa?
a) 25% b) 50% c) 75%
d) 100% e) depende do pai.
[B]
1005. Sabendo-se que o albinismo é um caráter recessivo, determine a porcentagem de descendentes com o fenótipo igual ao do pai, resultantes do casamento de um
homem heterozigoto para esse fator, com uma mulher de igual genótipo.
a) 0% b) 25% c) 50% d) 75% e) 100%
[D]
1006. Num homem heterozigoto para determinado caráter, a porcentagem provável de espermatozóides que conterão o gene recessivo desse caráter é de:
a) 0% b) 25% c) 50% d) 75% e) 100%
[C]
1007. Considere que o comprimento da cauda, numa dada espécie, seja condicionado por um par de alelos. Animais com cauda longa foram cruzados repetidas vezes
entre si originando sempre descendentes com cauda longa. Os descendentes, quando cruzados entre si, também só originaram filhotes de cauda longa.
A partir desses dados, só é possível concluir que
a) o caráter é recessivo.
b) o caráter é dominante.
c) os animais cruzados eram homozigotos.
d) os animais cruzados eram heterozigotos.
e) o genótipo dos descendentes difere do dos pais.
[C]
1008. Uma planta feminina de angiosperma com genótipo PP foi cruzada com uma masculina pp. As sementes resultantes devem apresentar embrião e endosperma,
respectivamente,
a) PP e pp b) Pp e Pp c) Pp e PPP
d) Pp e PPp e) PP e Ppp
[D]
1009. Em cobaias, a cor preta do pêlo é condicionada por um alelo dominante e a cor branca, pelo alelo recessivo. Um cruzamento-teste de um indivíduo de cor preta
produziu descendentes brancos e pretos em igual número. Se esses descendentes pretos forem cruzados entre si, a proporção fen otípica esperada na prole será de
a) 3 pretos, 1 branco
b) 2 pretos, 1 branco
c) 1 preto, 3 brancos
d) 1 preto, 2 brancos
e) 1 preto, 1 branco
[A]
1010. Quando Mendel cruzou plantas de ervilha apresentando vagens de coloração verde com plantas de vagens de coloração amarelas, obteve na primeira geração
(F1) todos os descendentes de coloração verde. Na segunda geração (F 2) obteve 428 verdes e 152 amarelas. Todas as alternativas apresentam conclusões a partir
desses resultados, EXCETO
a) A expressão do alelo recessivo do gene desaparece apenas em F 1.
b) As plantas com vagens verdes ou amarelas da geração parental devem ser homozigotas.
c) O alelo dominante do gene se expressa em cor verde.
d) O caráter é controlado por um par de genes.
e) Os indivíduos que apresentam vagens de coloração verde em F‚ são heterozigotos.
[E]
1011. A coloração das flores de ervilha é determinada por herança autossômica.
A figura a seguir representa um dos cruzamentos realizados por Mendel entre plantas de ervilhas com flores púrpuras e plantas com flores brancas.
Se Mendel utilizasse como genitor masculino as plantas de flores púrpuras e como feminino, as plantas de flores brancas, os descendentes obtidos em F1
apresentariam

146
a)100% de flores brancas.
b)100% de flores púrpuras.
c) 75% de flores púrpuras e 25% de flores brancas.
d) 50% de flores púrpuras e 50% de flores brancas.
e)100% de flores de coloração rósea.
[B]
1012. Os vários tipos de diabete são hereditários, embora o distúrbio possa aparecer em crianças cujos pais são normais. Em algumas dessas formas, os sintomas
podem ser evitados por meio de injeções diárias de insulina. A administração de insulina aos diabéticos evitará que eles tenh am filhos com este distúrbio?
a) Não, pois o genótipo dos filhos não é alterado pela insulina.
b) Não, pois tanto o genótipo como o fenótipo dos filhos são alterados pela insulina.
c) Sim, pois a insulina é incorporada nas células e terá ação nos filhos.
d) Sim, pois a insulina é incorporada no sangue fazendo com que os filhos não apresentem o distúrbio.
e) Depende do tipo de diabete, pois nesses casos o genótipo pode ser alterado evitando a manifestação da doença nos filhos.
[A]
1013. O gene autossômico, que condiciona pêlos curtos em cobaias, é dominante em relação ao gene que determina pêlos longos. Do cruzamento de cobaias
heterozigotas nasceram 300 cobaias, das quais 240 tinham pêlos curtos. Entre as cobaias de pêlos curtos, o número esperado de heterozigotos é:
a) 45. b) 60. c) 90. d) 160. e) 180.
[D]
1014. Na(s) questão(ões) a seguir escreva nos parêntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Um pesquisador apresentou a seus alunos o
heredograma a seguir, relativo a uma certa doença observada por ele em humanos. Sabendo-se que os indivíduos afetados estão representados em negrito e os
normais em branco, pode-se afirmar:

( ) a doença é causada por um alelo recessivo;


( ) trata-se de um caso de herança parcialmente ligada ao sexo;
( ) a doença é causada por um alelo dominante;
( ) trata-se de um caso de herança ligada ao sexo;
( ) é um caso de polialelia com epistasia recessiva.
VFFFF
1015. Na(s) questão(ões) a seguir escreva no espaço apropriado a soma dos itens corretos. Os termos a seguir fazem parte da nomenclatura genética básica. Assinale
as alternativas que trazem o significado correto de cada um desses termos:
01. GENE é sinônimo de molécula de DNA.
02. GENÓTIPO é a constituição genética de um indivíduo.
04. DOMINANTE é um dos membros de um par de alelos que se manifesta inibindo a expressão do outro.
08. FENÓTIPO é a expressão do gene em determinado ambiente.
16. GENOMA é o conjunto de todos os alelos de um indivíduo.
02 + 04 + 08 = 14
1016. Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. TEXTO I:
Como muito mais organismos de cada espécie nascem do que provavelmente sobrevivem e como, conseqüentemente, há uma freqüente luta pela existência, segue-se
que qualquer organismo que varia de modo proveitoso para si próprio, sob condições de vida complexas e algumas vezes variávei s, terá uma melhor oportunidade de
sobrevivência e, assim, de ser "naturalmente selecionado" .
(Darwin, apud DARNELL, p. 2 - traduzido)
TEXTO II:
Os híbridos, de cada par de caracteres diferenciais, formam sementes das quais a metade novamente desenvolve a forma híbrida, enquanto a outra metade produz
plantas que permanecem constantes e recebem os caracteres dominantes e recessivos em partes iguais.
(Mendel, apud FREIRE-MAIA, p. 1117)
Em relação às idéias de Darwin e de Mendel, exemplificadas nos textos, pode-se dizer:
(01) As "plantas que permanecem constantes" ao longo das gerações são homozigotas.
(02) A herança de um caráter é determinada pela fusão dos fatores condicionantes, na descendência.
(04) A citação de Mendel expressa a proporção genotípica 1:2:1, esperada em F2.
(08) A seleção natural pode preservar características diferentes, em diferentes ambientes.
(16) O trabalho de Darwin afirma a constância genética do mundo biológico.
(32) Variações referidas por Darwin transmitem-se à descendência segundo o padrão mendeliano de herança.
01 + 04 + 08 = 13

147
1017. Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. A idéia da eugenia, que se ocupa do aperfeiçoamento físico e mental da espécie
humana, perigosamente em alta em países desenvolvidos da Europa, se sustenta em premissas incorretas, que violam princípios sociais e admitem conceitos biológicos
errôneos, como na citação:
Os cromossomos, (...) os determinantes (...) se entrechocam, lutam entre si, selecionam-se, eliminando-se com o glóbulo polar os mais fracos, os inferiores, e
persistindo nos pronúcleos resultantes os mais aptos, os mais fortes.
(Kehl apud BIZZO, p. 30)
Considerando-se os princípios biológicos que regem a herança, pode-se afirmar:
(01) A subordinação aos princípios mendelianos reduz a variabilidade nas espécies que se reproduzem sexuadamente.
(02) A segregação dos cromossomos homólogos, na primeira divisão meiótica, é aleatória.
(04) O efeito de um determinado gene depende do ambiente em que ele é expresso.
(08) Os fatores genéticos se misturam e se diluem ao longo das gerações.
(16) A aplicação de princípios eugênicos comprometeria a sobrevivência da espécie humana.
(32) Alterações do fenótipo, adquiridas por indivíduos de uma geração, repercutem além dela, atingindo su a prole.
(64) As repercussões da eugenia em populações humanas descartam sua aplicação para qualquer fim.
02 + 04 + 08 + 16 + 64 = 94
1018. De acordo com a primeira lei de Mendel, um indivíduo heterozigoto para um caráter regulado por dominância completa, provavelmente produzirá a seguinte
porcentagem de gametas:
a) 100% com alelo recessivo.
b) 100% com alelo dominante.
c) 50% com alelo recessivo e 50% com alelo dominante.
d) 75% com alelo dominante e 25% com alelo recessivo.
e) 75% com alelo recessivo e 25% com alelo dominante.
[C]
1019. No homem, a acondroplasia é uma anomalia determinada por um gene autossômico dominante.
Qual é a probabilidade de um casal de acondroplásicos, que já tem uma menina normal, vir a ter um menino acondroplásico?
a) 1 b) ¾ c) 3/8 d) ¼ e) 1/8
[B]
1020. De uma população de 100 camundongos foi retirado ao acaso um indivíduo com deficiência da enzima E, caráter condicionado por um alelo recessivo a. É correto
afirmar que
a) seus pais podem ser fenotipicamente normais.
b) seus pais são certamente heterozigotos.
c) a freqüência do alelo a é 0,1.
d) a freqüência do alelo a é 0,2.
e) 1% dos indivíduos da população têm deficiência da enzima E.
[A]
1021. Uma mulher normal, casada com um portador de doença genética de herança autossômica dominante, está grávida de um par de gêmeos. Qual é a probabilidade
de que pelo menos um dos gêmeos venha a ser afetado pela doença no caso de serem, respectivamente, gêmeos monozigóticos ou di zigóticos?
a) 25% e 50% b) 25% e 75% c) 50% e 25%
d) 50% e 50% e) 50% e 75%
[E]
1022. Moscas de asas longas cruzadas entre si fornecem moscas com asas vestigiais. Para determinarmos se uma mosca de asa lon ga é homozigota ou heterozigota
quanto ao par de genes que condicionam este caráter, o procedimento correto é analisar a prole resultante do cruzamento desta mosca com outra de:
a) asa vestigial.
b) de asa longa.
c) genótipo igual ao seu.
d) fenótipo igual ao seu.
e) fenótipo dominante.
[A]
1023. Algumas variedades de canários mudam de cor dependendo da alimentação que recebem. Esta mudança indica que o:
a) fenótipo depende do ambiente.
b) genótipo depende do ambiente.
c) fenótipo depende do genótipo e do meio ambiente.
d) genótipo depende do fenótipo e do meio ambiente.
e) genótipo depende dos genes.
[C]
1024. Do cruzamento de duas moscas com asas, nasceram 120 descendentes com asas e 40 sem asas. Se os 120 descendentes com asas forem cruzados com
moscas sem asas e se cada cruzamento originar 100 indivíduos, o número esperado de indivíduos com asas e sem asas será, respectivamente,
a) 6.000 e 3.000
b) 6.000 e 6.000
c) 8.000 e 4.000
d) 9.000 e 3.000
e) 12.000 e 4.000
[C]
1025. No heredograma a seguir, círculos representam mulheres, quadrados representam homens e símbolos preenchidos representam indivíduos portadores de certa
característica.

Com base na análise do heredograma, pode-se concluir que a característica em questão é condicionada por gene
a) dominante, localizado no cromossomo X.

148
b) recessivo, localizado no cromossomo X.
c) dominante, localizado em um autossomo.
d) recessivo, localizado em um autossomo.
e) localizado no cromossomo Y.
[D]
1026. O esquema a seguir representa indivíduos de três gerações de uma família. Os símbolos escuros indicam os portadores de uma anomalia hereditária.

Analisando-se a genealogia, conclui-se que a anomalia é determinada por gene


a) dominante, localizado no cromossomo x.
b) dominante, localizado no cromossomo y.
c) dominante, localizado em autossomo.
d) recessivo, localizado no cromossomo y.
e) recessivo, localizado em autossomo.
[E]
1027. O tipo de herança genética apresentada pelos indivíduos afetados é:

a) autossômica dominante.
b) autossômica recessiva.
c) ligada ao x dominante.
d) ligada ao x recessiva.
e) ligada ao y.
[A]
1028. Considere as seguintes proposições:
1 - Em nenhuma hipótese a calvície ocorre na mulher, por se tratar de herança ligada ao sexo.
2 - Um homem calvo (homozigoto) transmite a característica da calvície a todos os filhos homens nascidos de seu casamento com uma mulher não calva.
3 - A calvície é dominante no sexo masculino
4 - A calvície pode ser originada por causas ambientais, mas na maioria dos casos, é claramente hereditária.
5 - Uma mulher será calva se seus pais forem calvos e se sua mãe (heterozigota) possuir um de seus genitores calvo.
Concluiu-se com relação a estas proposições que:
a) Apenas a 2, a 3 e a 4 são corretas.
b) Apenas a 1, a 2 e a 3 são corretas.
c) Apenas a 1, a 3 e a 4 são corretas.
d) Apenas a 1, a 2 , a 3 e a 4 são corretas.
e) Apenas a 2, a 3, a 4 e a 5 são corretas.
[E]
1029. Em tomates, o estame pode ser de cor púrpura ou verde. Cruzando-se plantas de estames de cor púrpura com plantas de estames verdes, obteve-se uma
geração F• composta apenas de indivíduos com estames de cor púrpura. Se esses indivíduos forem retrocruzados com os parentais de estames verdes, então a
porcentagem de descendentes com estames verdes será de:
a) 25% b) 50% c) 75% d) 0 e) 100%
[B]
1030. Esta figura representa o cruzamento de drosófilas de asas normais com indivíduos de asas enroladas, mutantes, criadas em temperatura de 25°C.

149
As moscas de genótipo igual ao do tipo III, quando criadas em temperatura de 16°C, apresentam asas normais.
O resultado desse fenômeno ilustra
a) a adaptação dos mutantes.
b) a influência do ambiente na expressão do genótipo.
c) a transmissão dos caracteres adquiridos.
d) o processo de seleção natural.
[B]
1031. Na espécie humana há um tipo de doença hereditária muito rara denominada Aquiropodia, que é determinada por um par de genes. No heredograma a seguir, os
aquirópodos estão representados por símbolos hachurados.

Com base na análise do heredograma, assinale a afirmativa INCORRETA.


a) Pode-se dizer que a Aquiropodia é condicionada por um alelo recessivo a.
b) Pode-se assumir que os indivíduos II.1 e II.5 possuem o genótipo AA, já que a condição herdada em análise é muito rara.
c) Não é possível ter certeza sobre o genótipo de alguns indivíduos, como é o caso dos indivíduos II.3 e III.5.
d) Os pais dos aquirópodos são primos.
e) O genótipo dos indivíduos IV.2 e IV.4 é aa.
[C]
1032.
O esquema anterior mostra uma experiência com um coelho himalaia. A mudança ocorrida na coloração do pêlo em função da queda de temperatura demonstra o efeito
da:

a) norma de reação.
b) mutação gênica.
c) expressividade de um gene.
d) penetrância de um gene.
e) alteração do genótipo pelo ambiente.
[A]
1033. No Brasil, uma lei determina que os recém-nascidos sejam submetidos ao "teste do pezinho", por meio do qual se identifica a fenilcetonúria, doença hereditária
que pode levar ao retardamento mental, com prejuízo da fala e dos movimentos. Se detectada a tempo, essa doença pode ser controlada ministrando-se ao recém-
nascido uma dieta especial. O heredograma seguinte ilustra uma situação em que há indivíduos fenilcetonúricos.

150
Considerando o heredograma, julgue os itens abaixo.
(1) O caráter fenilcetonúrico apresenta herança autossômica dominante.
(2) O cruzamento entre os indivíduos 10 e 11 ilustra como a consangüinidade influencia o aparecimento de doenças hereditárias .
(3) Os homens normais representados no heredograma são necessariamente heterozigotos.
(4) A probabilidade de que o casal formado pelos indivíduos 10 e 11 tenha um descendente do sexo masculino fenilcetonúrico é igual a 12,5%.
(5) A dieta especial a que devem ser submetidos os recém-nascidos fenilcetonúricos tende a alterar a frequência do gene da fenilcetonúria na população.
ECEEC
1034. Em uma população de mariposas, 96% dos indivíduos têm cor clara e 4%, cor escura. Indivíduos escuros cruzados entre si produzem, na maioria das vezes,
descendentes claros e escuros. Já os cruzamentos entre indivíduos claros produzem sempre apenas descendentes de cor clara. Esses resultados sugerem que a cor
dessas mariposas é condicionada por
a) um par de alelos, sendo o alelo para cor clara dominante sobre o que condiciona cor escura.
b) um par de alelos, sendo o alelo para cor escura dominante sobre o que condiciona cor clara.
c) um par de alelos, que não apresentam dominância um sobre o outro.
d) dois genes ligados com alta taxa de recombinação entre si.
e) fatores ambientais, como a coloração dos troncos onde elas pousam.
[B]
1035. A primeira lei de Mendel ou lei da segregação significa:
a) um cruzamento onde se considera apenas um gene, representado por dois alelos.
b) um cruzamento de dois genitores homozigotos contrastantes.
c) um cruzamento de dois genitores heterozigotos.
d) a separação de um par de alelos durante a formação dos gametas.
e) um caráter controlado por dois ou mais genes.
[D]
1036. Sabe-se que a transmissão hereditária da cor das flores conhecidas como copo-de-leite se dá por herança mendeliana simples, com dominância completa. Em um
cruzamento experimental de copos-de-leite vermelhos, obteve-se uma primeira geração – F1 - bastante numerosa, numa proporção de 3 descendentes vermelhos para
cada branco (3:1). Analisando o genótipo da F1, os cientistas constataram que apenas um em cada três descendentes vermelhos era homozigoto para essa
característica.
De acordo com tais dados, pode-se afirmar que a produção genotípica da F 1 desse cruzamento experimental foi:
a) 4 Aa
b) 2 Aa : 2 aa
c) 3 AA : 1 Aa
d) 1 AA : 2 Aa : 1 aa
[D]
1037. A acondroplasia (uma das formas de nanismo) é causada por um gene dominante autossômico.
Da união de um homem acondroplásico com uma mulher normal resulta um filho normal.
Este se casa com uma mulher normal cujos pais eram normais (conforme heredograma abaixo).

Em relação aos descendentes deste último casamento e ao caráter em questão, considerando ausência de mutação, é correto afirm ar:
( ) O descendente será obrigatoriamente heterozigoto.
( ) A freqüência genotípica na descendência será 1:2:1.
( ) A probabilidade de acondroplasia na descendência é igual a zero.
( ) A probabilidade de heterozigose na descendência em relação a este locus é igual a zero.
( ) A freqüência fenotípica numa prole numerosa será 3:1.
( ) Numa prole numerosa, a freqüência fenotípica será de 1 acondroplásico para 1 normal.
FFVVFF
1038. No cruzamento de plantas verdes, normais, é possível o aparecimento de indivíduos albinos. Embora plantas albinas morram antes de produzirem sementes, a
característica "albinismo" não desaparece entre elas. Isto se explica porque:
a) muitas plantas verdes são heterozigóticas.
b) plantas normais homozigóticas tornam-se albinas na ausência de luz.
c) plantas albinas tornam-se verdes na presença de luz.
d) o gene para albinismo é ativado no escuro.
e) o albinismo impede a síntese de clorofila.
[A]

151
1039. A calvície é uma característica influenciada pelo sexo e o gene que a condiciona se comporta como recessivo no sexo fem inino e dominante no sexo masculino.
Observe a genealogia a seguir, relativa a essa característica.

A probabilidade do casal 3×4 ter o primeiro filho homem e que venha a ser calvo, é:
a) ½ b) ¼ c) 1/8 d) 1/6
[B]
1040. Em porquinhos da Índia, o pêlo pode ser preto ou marrom. Uma fêmea preta foi cruzada com um macho marrom, produzindo uma F 1 composta por indivíduos
marrons e pretos em igual quantidade. Retrocruzando-se um macho preto de F1 com a fêmea parental, 75% dos filhotes produzidos em F 2 tinham pêlo preto e 25%
apresentavam pêlo marrom. A partir desses resultados, assinale a alternativa correta.
a) 50% dos indivíduos pretos de F2 eram heterozigotos.
b) Os indivíduos pretos de F1 eram homozigotos.
c) Todos os indivíduos pretos de F2 eram heterozigotos.
d) Todos os indivíduos marrons eram homozigotos.
e) Os indivíduos pretos da geração F1 eram heterozigotos e a fêmea parental era homozigota.
[D]
1041. Uma população experimental contém 200 indivíduos AA, 200 aa e 200 Aa. Todos os indivíduos AA foram cruzados com indivíduos aa e os indivíduos Aa foram
cruzados entre si. Considerando que cada casal produziu 2 descendentes, espera-se encontrar entre os filhotes:
a) AA - 50
Aa - 500
aa - 50
b) AA - 100
Aa - 400
aa - 100
c) AA - 100
Aa - 1000
aa - 100
d) AA - 200
Aa - 200
aa - 200
e) AA - 200;
Aa - 800;
aa – 100
[A]
1042. O gráfico a seguir mostra a dinâmica das freqüências do gene s, o qual determina a doença chamada siclemia ou anemia falciforme. Os homozigotos siclêmicos
morrem precocemente devido à severa anemia; os heterozigotos sofrem de uma forma branda da anemia mas, por outro lado, são mais resistentes à malária que os
indivíduos normais.
O gráfico refere-se ao período posterior à erradicação da malária.
Qual a explicação para o comportamento das curvas do gráfico?

a) Diminuição da freqüência de mutação de S para s.


b) Seleção contra os portadores do gene s.
c) Aumento da freqüência de mutação de S para s.
d) Cruzamentos preferenciais entre pessoas anêmicas.
e) Cruzamentos preferenciais entre portadores de malária.
[B]
1043. A talassemia é uma doença hereditária que resulta em anemia. Indivíduos homozigotos MM apresentam a forma mais grave, i dentificada como talassemia maior e
os heterozigotos MN, apresentam uma forma mais branda chamada de talassemia menor. Indivíduos homozigotos NN são normais. Sabendo-se que todos os indivíduos
com talassemia maior morrem antes da maturidade sexual, qual das alternativas a seguir representa a fração de indivíduos adul tos, descendentes do cruzamento de um
homem e uma mulher portadores de talassemia menor, que serão anêmicos?
a) ½ b) ¼ c) 1/3 d) 2/3 e) 1/8
[D]
1044. Na espécie humana, o albinismo é causado por um gene autossômico recessivo. A probabilidade do primeiro filho de um homem albino casado com uma mulher
normal, mas heterozigota, ser albino e do sexo masculino é:
a) nula b) 25 % c) 50 % d) 75 % e) 100 %
[B]

152
1045. Em aves, existe uma anomalia que se caracteriza pelo encurtamento das asas. Quando aves anômalas heterozigóticas são cruzadas, originam uma
descendência com indivíduos anômalos e normais numa proporção de 2 :1, respectivamente. A partir desses dados, é possível deduzir que o alelo que condiciona a
anomalia é
a) letal em homozigose. b) letal recessivo. c) pleiotrópico.
d) hipostático. e) epistático.
[A]
1046. Um determinado casal normal, mas heterozigoto para o albinismo, solicitou aconselhamento genético sobre a possibilidade de vir a ter crianças apresentando a
condição albina. Qual a probabilidade desse casal ter:
a) quatro crianças albinas?
b) uma criança albina e do sexo feminino?
c) uma criança normal heterozigota e do sexo masculino?
d) Represente o provável heredograma desse casal, admitindo-se que as suposições feitas nas letras (b) e (c), realmente se concretizem.
a) 1/256
b) 1/8
c) 1/4
d) Observe a figura a seguir:

1047. No homem, a acondroplasia é uma anomalia determinada por um gene autossômico dominante.
Qual é a probabilidade de um casal de acondroplásicos, que já tem uma menina normal, vir a ter um menino acondroplásico?
a) 1
b) 3/4
c) 3/8
d) 1/4
e) 1/8
[B]
1048. Uma mulher normal, casada com um portador de doença genética de herança autossômica dominante, está grávida de um par d e gêmeos. Qual é a probabilidade
de que pelo menos um dos gêmeos venha a ser afetado pela doença no caso de serem, respectivamente, gêmeos monozigóticos ou dizigóticos?
a) 25% e 50% b) 25% e 75% c) 50% e 25%
d) 50% e 50% e) 50% e 75%
[E]
1049. Se os indivíduos 7 e 11 se casarem, a probabilidade desse casal ter uma filha com o mesmo fenótipo do avô materno é de:

a) ½ b) ¼ c) 1/8 d) 1/3 e) 2/3


[B]
1050. A fenilcetonúria é uma doença com herança autossômica recessiva. Em certa comunidade européia, uma em cada 20 pessoas c om fenótipo normal é
heterozigótica quanto ao gene que determina a fenilcetonúria. Em 800 casamentos ocorridos entre membros sadios dessa comunidade, qual o número esperado de
casamentos com risco de gerar crianças fenilcetonúricas?
a) 2. b) 8. c) 16. d) 40. e) 80.
[A]
1051. O esquema mostra a genealogia de uma família. Os símbolos escuros representam os indivíduos míopes e os claros, os indivíduos de visão normal.

153
A probabilidade do casal I x II ter uma criança míope é
a) imprevisível, porque a mulher tanto pode ser homozigota como heterozigota.
b) nula, porque a mulher tem o gene dominante em homozigose.
c) 1/2, porque 50% dos gametas da mulher transportam o gene recessivo.
d) 1/4, porque o casal já tem três filhos com visão normal.
e) 1/4, porque o gene para a miopia é recessivo.
[C]
1052. Fenilcetonúria é uma doença hereditária humana resultante da inabilidade do organismo de processar o aminoácido fenilal anina, que está presente nas proteínas
da dieta humana, e é causada por um alelo recessivo por herança Mendeliana simples. Um casal decide ter um filho, mas consulta um geneticista porque o homem tem
uma irmã com fenilcetonúria, e a mulher tem um irmão com esta mesma doença. Não há outros casos conhecidos nas famílias. A pr obabilidade de sua primeira criança
ter fenilcetonúria é de:
a) 1/2. b) 1/4. c) 1/9. d) 2/3. e) 4/9.
[C]
1053. Considere a figura a seguir que representa o resultado da primeira divisão meiótica de uma célula feminina:

a) Indique o genótipo do embrião formado a partir da fecundação do óvulo resultante dessa célula por um espermatozóide de um macho recessivo para os dois pares de
genes considerados.
b) Quais os possíveis genótipos dos filhos possíveis do mesmo casal?
a) o oócito AAbb formará, na segunda divisão meiótica, óvulo do tipo Ab, que fecundado por um espermatozóide ab produzirá um embrião de genótipo Aabb.
b) A mulher de genótipo AaBb cruzando com um homem aabb poderá ter filhos com os seguintes genótipos: AaBb, Aabb, aaBb, aabb.
1054. Do casamento entre uma mulher albina com cabelos crespos e um homem normal com cabelos crespos, cuja mãe é albina, nasceram duas crianças, uma com
cabelos crespos e outra com cabelos lisos. A probabilidade de que uma terceira criança seja albina com cabelos crespos é:
a) 75% b) 50% c) 37,5% d) 25% e) 12,5%
[C]
1055. Um casal de surdos teve dois filhos com audição normal. Sabendo se que a surdez é determinada por qualquer dos genes recessivos d ou e, em homozigose,
espera se que o genótipo dos filhos seja
a) ddee. b) Ddee. c) DDEE. d) DdEe. e) DDee.
[D]
1056. O cruzamento entre duas linhagens de ervilhas, uma com sementes amarelas e lisas (VvRr) e outra com sementes amarelas e rugosas (Vvrr), originou 800
indivíduos. Quantos indivíduos devem ser esperados para cada um dos fenótipos obtidos?
a) amarelas-lisas = 80
amarelas-rugosas = 320
verdes-lisas = 320
verdes-rugosas = 80.
b) amarelas-lisas = 100
amarelas-rugosas = 100
verdes-lisas = 300
verdes-rugosas = 300.
c) amarelas-lisas = 200
amarelas-rugosas = 200
verdes-lisas = 200
verdes-rugosas = 200.
d) amarelas-lisas = 300
amarelas-rugosas = 300
verdes-lisas = 100
verdes-rugosas=100.
e) amarelas-lisas = 450
amarelas-rugosas = 150
verdes-lisas = 150
verdes-rugosas=50.
[D]
1057. As flores de uma determinada planta podem ser vermelhas ou amarelas. Dois pares de genes (Vv e Aa) determinam essa característica: plantas V_A_ produzem
flores vermelhas e plantas V_aa, vvA_ ou vvaa, flores amarelas. Na descendência do cruzamento VvAa x VvAa espera-se encontrar uma proporção fenotípica de

154
a) 1 vermelha: 1 amarela
b) 9 amarelas: 7 vermelhas
c) 9 vermelhas: 7 amarelas
d) 15 amarelas: 1 vermelha
e) 15 vermelhas: 1 amarela
[C]
1058. Na genealogia a seguir, está representada a herança de duas características determinadas por genes autossômicos.

Quais são os indivíduos obrigatoriamente heterozigotos para as duas características?


a) 6, 7, 13 e 14
b) 5, 8, 9, 12 e 15
c) 1, 2, 3, 4, 7 e 13
d) 6, 9, 10, 11, 14, 15 e 16
e) 1, 2, 3, 4, 7, 9, 13 e 15
[C]
1059. Na genealogia a seguir, está representada a herança de duas características determinadas por genes autossômicos.

Quais são os indivíduos que seguramente produzem um só tipo de gameta?


a) 6, 7, 8, 9, 13 e 14
b) 6, 8, 11, 14 e 16
c) 5, 9, 10, 12 e 15
d) 3, 4, 8, 9 e 15
e) 1, 2, 3, 4 e 13
[B]
1060. No homem, a polidactilia é um caráter dominante e a miopia, uma anomalia recessiva. Os genes responsáveis por essas car acterísticas situam-se em autossomos
e apresentam segregação independente. Uma mulher com polidactilia e miopia, cuja mãe era normal para as duas características, é casada com um homem normal,
cujo pai era míope. A probabilidade desse casal ter uma criança com polidactilia e miopia é
a) 0% b) 25% c) 50% d) 75% e) 100%
[B]
1061. Em humanos a polidactilia é condicionada por um gene dominante, sendo os indivíduos homozigotos recessivos portadores de pés e mãos normais (com 5 dedos
cada). Por sua vez, o albinismo é condicionado por um gene recessivo, sendo que o alelo dominante produz em seus portadores pigmentação normal. Ambos os locos
citados são autossômicos. Considere este caso: Antônio, um homem com pés e mãos normais, porém albino, casa-se com Maria, mulher normal para o albinismo,
polidáctila a e filha de um homem homozigoto e normal para os dois caracteres e de uma mulher albina e polidáctila.
A partir das informações anteriores, assinale a alternativa CORRETA.
a) Todos os filhos desse casal deverão ser albinos.
b) Não existe qualqueir chance de nascer um filho polidáctilo dessa relação.
c) Antônio poderá produzir 2 tipos de gametas diferentes para essas características.
d) A mãe de Maria é, obrigatoriamente, homozigota para as duas características.
e) Maria produzirá gametas de 4 tipos diferentes para essas características.
[E]
1062. Em coelhos, o gene P produz pelagem preta e o seu alelo recessivo p, pelagem parda desde que esteja presente o gene A. Os animais aa são sempre albinos.
Considerando que ocorra segregação independente entre esses genes, a partir do cruzamento PpAa x ppaa espera-se uma proporção fenotípica de
a) 1 preto: 1 pardo: 2 albinos.
b) 1 preto: 1 pardo.
c) 1 preto: 1 albino.
d) 1 preto: 3 albinos.
e) 1 pardo: 3 albinos.
[A]
1063. Numa ave doméstica, o gene C condiciona plumagem branca e o seu alelo recessivo, plumagem colorida; o gene P determina patas com plumas e o seu alelo
recessivo, patas sem plumas. Esses pares de genes são autossômicos e segregam independentemente. Uma ave branca com patas com plumas, homozigota para os
dois pares de genes, foi cruzada com uma colorida com patas sem plumas. Se os decendentes obtidos forem cruzados entre si, es pera-se que a proporção de aves
homozigotas para os dois pares de genes seja de
a) 9/16 b) 6/16 c) 4/16 d) 3/16 e) 1/16
[C]

155
1064. Um homem albino e de olhos claros casa-se com uma mulher de pele normal e de olhos escuros. Deste casal, nasce uma criança albina o de olhos claros. Qual o
genótipo dos pais a da criança?
a) aacc, AaCc, aacc.
b) Aacc, AACC, Aacc.
c) AaCC, AaCc, AaCC.
d) aaCC, aacc, aacc.
e) aacc, AaCc, AaCc.
[A]
1065. Um casal, ambos polidáctilos (com mais de 5 dedos) e de visão normal, tem uma criança normal para polidactilia, mas míope. Considerando-se que ambas as
anomalias são autossômicas e os respectivos genes estão em cromossomos diferentes, então, a probabilidade do casal ter outra criança normal para as duas
características é:
a) 1 b) 1/16 c) 3/16 d) 9/16 e) 0
[C]
1066. Considere que a surdez no homem esteja relacionada a dois pares de genes (Dd - Ee) localizados em cromossomos não homólogos. Os indivíduos homozigotos
dd ou ee são surdos; os indivíduos com audição normal possuem, pelo menos, um gene D e um E.
Qual é a probabilidade de um casal DdEE × ddEe vir a ter uma criança com surdez?
a) 0% b) 25% c) 50% d) 75% e) 100%
[C]
1067. Na(s) questão(ões) a seguir, escreva no espaço apropriado a soma dos itens corretos. Imagine uma espécie animal na qual um gene A determina a formação do
olho e seu alelo recessivo determina a ausência de olhos. Um outro gene B dominante determina a pigmentação clara do olho, enquanto seu alelo recessivo determina a
cor escura. Sabe-se que o gene A está em um cromossomo e B em outro. Feito um cruzamento entre dois indivíduos duplamente heterozigóticos, é c orreto afirmar que:
01 - 9/16 dos descendentes desse cruzamento terão olhos normais e com pigmentação escura.
02 - 3/16 dos descendentes desse cruzamento terão olhos normais e com pigmentação clara.
04 - 4/16 dos descendentes nascerão sem olhos.
08 - Estes problemas envolve a Segunda Lei de Mendeliana, ou seja "Lei da Segregação Independente dos Caracteres".
02 + 04 + 08 = 14
1068. Observe o heredograma a seguir:

Sabendo-se que a miopia e o uso da mão esquerda não condicionados por genes recessivos, considere as seguintes afirmações:
I - Os indivíduos 2 e 4 têm o mesmo genótipo.
II - Se o indivíduo 3 se casar com um homem de visão normal (heterozigoto) e canhoto, terão 25% de chance de ter uma filha canhota e de visão normal.
III - O indivíduo 5 é heterozigoto para o gene do uso da mão esquerda e o indivíduo 6 é heterozigoto para o gene da miopia.
Assinale:
a) se todas as afirmativas forem corretas.
b) se somente as afirmativas I e III forem corretas.
c) se somente as afirmativas II e III forem corretas.
d) se somente as afirmativas I e II forem corretas.
e) se somente a afirmativa II for correta.
[A]
1069. Sabendo-se que a miopia e o uso da mão esquerda não condicionados por genes recessivos, analise a genealogia a seguir e responda.

A probabilidade do casal 4 x 5 ter uma criança diíbrida é:


a) 1/8 b) 3/16 c) 1/16 d) ¼ e) ½
[D]
1070. Em ervilha, o gene que determina a forma lisa da vagem (C) é dominante sobre o gene que determina vagens com constrições (c). O gene que determina plantas
de altura normal (H) é dominante sobre o gene que determina plantas anãs (h). Cruzando-se plantas CCHH com plantas CcHh, espera-se obter na descendência:
a) 50% de plantas anãs com vagens lisas e 50% de plantas de altura normal com vagens com constrições.
b) 100% de plantas anãs com vagens com constrições.
c) 100% de plantas de altura normal com vagens com constrições.
d) 100% de plantas anãs com vagens lisas.
e) 100% de plantas de altura normal com vagens lisas.
[E]
1071. Qual é a probabilidade de um casal de duplo heterozigotos para dois pares de genes autossômicos com segregação independente vir a ter um descendente com
apenas uma característica dominante?

156
a) 15/16 b) 9/16 c) 6/16 d) 3/16 e) 1/16
[C]
1072. Considere que em cavalos a coloração do pêlo resulta da ação de dois pares de genes autossômicos localizados em cromossomos não homólogos. O gene M
condiciona cor preta e seu alelo m, cor marrom; o gene B determina coloração uniforme e seu alelo b, manchas brancas em qualq uer cor de pelagem. Um macho preto
com manchas brancas (I), cujo pai era marrom uniforme (II), é cruzado com uma fêmea marrom com manchas brancas (III), cuja mãe era preta uniforme (IV). Assinale, a
seguir, a alternativa que contém os genótipos dos indivíduos mencionados.
a) I - (mmBb), II - (Mmbb), III - (MmBb), IV - (mmbb)
b) I - (Mmbb), II - (mmBb), III - (mmBb), IV - (Mmbb)
c) I - (MMbb), II - (mmBb), III - (mmbb), IV - (MmBb)
d) I - (mmbb), II - (MmBb), III - (Mmbb), IV - (mmBb)
e) I - (Mmbb), II - (mmBb), III - (mmbb), IV - (MmBb)
[E]
1073. No cruzamento entre indivíduos heterozigotos para dois pares de genes que se segregam independentemente, espera-se que a proporção de descendentes
heterozigotos para apenas um par de genes seja
a) 9/16 b) ½ c) ¼ d) 3/16 e) 1/16
[B]
1074. Um pesquisador averiguava a transmissão de caracteres em vegetais ao longo de gerações, determinados por genes que se s egregavam independentemente.
Cruzando dois indivíduos homozigotos, sendo um dominante e outro recessivo, ele obteve a primeira linhagem, na qual promoveu autofecundação. Como resultado,
obteve quatro tipos de fenótipos, na proporção de 9:3:3:1. Quantos caracteres esse pesquisador estudava?
a) 1 b) 2 c) 3 d) 4 e) 5
[B]
1075. Um criador fez cruzamentos entre porquinhos-da-índia para estudar as características: cor e tamanho do pêlo. Observou os seguintes resultados:
GERAÇÃO P:
pêlo preto curto X pêlo marrom longo
GERAÇÃO F1:
pêlo preto curto
GERAÇÃO F2:
81 pêlo preto curto
27 pêlo preto longo
27 pêlo marrom curto
09 pêlo marrom longo
Com base nesses resultados, é INCORRETO afirmar que
a) as características pêlo preto e curto são dominantes.
b) as duas características segregam-se independentemente.
c) os indivíduos da geração F1 são homozigotos.
d) os indivíduos da geração P formam um só tipo de gameta.
[C]
1076. As afirmativas a seguir relacionam a Genética Mendeliana à Divisão Celular.
I - As 1º e 2º Leis de Mendel abordam o comportamento dos genes na formação dos gametas, logo estão relacionadas com o comportame nto cromossômico na meiose.
II - Dois pares de genes se segregam independentemente, se estiverem localizados em cromossomos diferentes.
III - A lei da segregação independente (2º lei) está relacionada às conseqüências do arranjo, ao acaso, de pares de cromossomos hom ólogos na placa metafásica, na
meiose.
Está(ão) correta(s):
a) somente I. b) somente I e II. c) somente I e III.
d) somente II e III. e) I, II e III.
[E]
1077. Mendel, nas primeiras experiências sobre hereditariedade, trabalhou com apenas uma característica de cada vez. Posteriormente, ele acompanhou a transmissão
de dois caracteres ao mesmo tempo, e os resultados levaram-no a concluir que: "fatores para dois ou mais caracteres são transmitidos para os gametas de modo
totalmente independente ". Esta observação foi enunciada como "2ª Lei de Mendel" ou "Lei da Segregação Independente", a qual não é válida para os genes que estão
em ligação gênica ou "linkage", isto é, genes que estão localizados nos mesmos cromossomos. Observando as seguintes proporções de gametas produzidos pelo
dihíbrido AaBb em três situações distintas,
I - AB (25%); Ab (25%); aB (25%); ab (25%),
II - AB (50%); ab (50%),
III - AB (40%); Ab (10%); aB (10%); ab (40%),
pode-se afirmar que:
a) I e II são situações nas quais os genes segregam-se independentemente.
b) II e III são situações nas quais ocorre segregação independente e ligação gênica sem "crossing-over", respectivamente,
c) I e III são situações nas quais ocorre segregação independente e ligação gênica com "crossing-over", respectivamente.
d) II é uma situação na qual ocorre ligação gênica com "crossing-over".
e) III é uma situação na qual ocorre ligação gênica sem "crossing-over".
[C]
1078. Do cruzamento entre dois indivíduos portadores do genótipo CcDd, a probabilidade de ocorrência na F1 de indivíduos com o mesmo genótipo dos pais, é:
a) zero b) ½ c) ¼ d) 1/8
[C]
1079. Plantas de genótipo AaBb foram intercruzadas. Sabendo-se que os alelos representados por letras maiúsculas são dominantes e que os não-alelos sofrem
segregação independente, os números de genótipos e de fenótipos diferentes entre os descendentes desses cruzamentos são, respectivamente,
a) 3 e 2 b) 6 e 3 c) 9 e 4 d) 12 e 8 e) 16 e 9
[C]
1080. A fenilcetonúria e a miopia são doenças decorrentes da ação de genes autossômicos recessivos. Do casamento entre uma mulher normal, filha de mãe com
fenilcetonúria e pai míope, com um homem normal para fenilcetonúria e míope, nasceu uma criança de visão normal e fenilcetonúrica. A probabilidade desse casal ter
uma criança normal para as duas características é:
a) 1/8 b) ½ c) 3/8 d) 7/8 e) ¾
[C]
1081. Em uma determinada espécie animal, foram analisadas duas características com segregação independente e herança co-dominante: cor e textura do pêlo. Para a
cor do pêlo, os homozigotos podem ser vermelhos ou brancos. Para a textura, os homozigotos têm pêlo liso ou crespo. Calcule a porcentagem esperada de
descendentes fêmeas com pêlo vermelho crespo oriundas do cruzamento de dois animais duplamente heterozigotos. Des preze a parte fracionária de seu resultado,
caso exista.
1/32 = 3%
1082. A mosca-de-fruta 'Drosophila melanogaster' pode apresentar asas vestigiais ou longas e corpo cinza ou ébano. Cruzando-se um macho de corpo cinza e asas
vestigiais com uma fêmea de corpo ébano e asas longas (parentais – P1) obteve-se F1 que deu origem a F2 através da autofecundação, como mostra a figura a seguir.

157
Após a análise dos resultados dos cruzamentos, foram feitas as afirmativas abaixo.
I - A probabilidade de ocorrência do mesmo genótipo dos indivíduos de F1 em F2 é de 4/16.
II - Os genes para cor do corpo e pra tipo de asa estão localizados num mesmo cromossoma.
III - Em F‚, a probabilidade de ocorrência de homozigose dominante é a mesma de homozigose recessiva.
IV - O gene para corpo ébano só está presente na geração P 1 e em parte de F2.
V - Os genes para cor do corpo e forma das asas segregam-se independentemente durante a formação dos gametas.
As afirmativas corretas são:
a) I, II e IV, apenas.
b) I, II e V , apenas.
c) I, III e V , apenas.
d) II, III e IV , apenas.
e) III, IV e V, apenas.
[C]
1083. Uma abelha rainha tem os seguintes pares de genes alelos que se segregam independentemente: AaBBccDdEE. Sabendo-se que os zangões surgem de óvulos
que se desenvolvem por partenogênese, quantos genótipos diferentes, relativos a esses cinco pares de genes podem apresentar os zangões filhos dessa rainha?
a) Um. b) Dois. c) Quatro. d) Oito. e) Dezesseis.
[C]
1084. Do cruzamento de dois indivíduos com genótipo AaBbCc, a probabilidade de surgir um descendente com genótipo que apresenta, pelo menos, um gene
dominante, é
Obs.: Considere um tipo de herança mendeliana.
a) 1/64 b) 63/64 c) 1/32 d) 1/16 e) ¼
[B]
1085. Considere um homem heterozigoto para o gene "A", duplo recessivo para o gene "D" e homozigoto dominante para o gene "F". Considere ainda que todos esses
genes situam-se em cromossomos diferentes. Entre os gametas que poderão se formar encontraremos apenas a(s) combinação(ões):
a) AdF. b) AADDFF. c) AaddFF.
d) AdF e adF. e) ADF e adf.
[D]
1086. Uma abelha rainha tem os seguintes pares de genes alelos que segregam independentemente: AaBbDdEe. Sabendo-se que os zangões surgem de óvulos que se
desenvolvem por partenogênese, quantos genótipos diferentes, relativos a esses quatro pares de genes, podem apresentar os zangões filhos dessa rainha?
a) Um b) Dois c) Quatro d) Oito e) Dezesseis
[E]
1087. Se a mitose ocorre em uma célula de genótipo AaBbCc, onde os três pares de genes estão em pares de cromossomos distint os, os genótipos das células
resultantes serão:
a) ABC, ABc, aBC, AbC, Abc, abC, abc
b) ABC, abc
c) Aa, Bb, Cc
d) AABBCC, aabbcc
e) AaBbCc
[E]
1088. Se a meiose ocorre numa célula de genótipo AaBbCc, onde os três pares de genes estão em pares de cromossomos separados, quais serão os genótipos das
células resultantes?
a) Aa, Bb e Cc
b) ABC e abc
c) ABC, ABc, aBC, aBc, AbC, Abc, abC e abc
d) AaBbCc
e) AABBCC e aabbcc
[C]
1089. Considere a segunda lei de Mendel ou lei da distribuição independente e indique os gametas produzidos pelo genótipo aaBbccDdEE.
a) a; B; b; c; D; d ; E.
b) aBcDE; aBcdE; abcDE; abcdE.
c) aa; Bb; cc; Dd; EE.
d) aaBb; ccDd; aaEE; BbDd.
e) aB; bc; cD; dE.
[B]
1090. Assinale a alternativa correta.
Em experimentos envolvendo três características independentes (triibridismo), se for realizado um cruzamento entre indivíduos AaBbCc, a freqüência de descendentes
AABbcc será igual a
a) 8/64 b) 1/16 c) 3/64 d) ¼ e) 1/32
[E]
1091. No homem, a polidactilia é um caráter dominante e a miopia, uma anomalia recessiva. Os genes responsáveis por essas características situam-se em autossomos
e apresentam segregação independente. Uma mulher com polidactilia e miopia, cuja mãe era normal para as duas características, é casada com um homem normal,
cujo pai era míope. A probabilidade desse casal ter uma criança com polidactilia e miopia é
a) 0% b) 25% c) 50% d) 75% e) 100%
[B]

158
1092. Um casal, ambos polidáctilos (com mais de 5 dedos) e de visão normal, tem uma criança normal para polidactilia, mas míope. Considerando-se que ambas as
anomalias são autossômicas e os respectivos genes estão em cromossomos diferentes, então, a probabilidade do casal ter outra criança normal para as duas
características é:
a) 1 b) 1/16 c) 3/16 d) 9/16 e) 0
[C]
1093. Considere que a surdez no homem esteja relacionada a dois pares de genes (Dd - Ee) localizados em cromossomos não homólogos. Os indivíduos homozigotos
dd ou ee são surdos; os indivíduos com audição normal possuem, pelo menos, um gene D e um E.
Qual é a probabilidade de um casal DdEE × ddEe vir a ter uma criança com surdez?
a) 0% b) 25% c) 50% d) 75% e) 100%
[C]
1094. Observe o heredograma a seguir:

Sabendo-se que a miopia e o uso da mão esquerda não condicionados por genes recessivos, considere as seguintes afirmações:
I - Os indivíduos 2 e 4 têm o mesmo genótipo.
II - Se o indivíduo 3 se casar com um homem de visão normal (heterozigoto) e canhoto, terão 25% de chance de ter uma filha canhota e de visão normal.
III - O indivíduo 5 é heterozigoto para o gene do uso da mão esquerda e o indivíduo 6 é heterozigoto para o gene da miopia.
Assinale:
a) se todas as afirmativas forem corretas.
b) se somente as afirmativas I e III forem corretas.
c) se somente as afirmativas II e III forem corretas.
d) se somente as afirmativas I e II forem corretas.
e) se somente a afirmativa II for correta.
[A]
1095. Sabendo-se que a miopia e o uso da mão esquerda não condicionados por genes recessivos, analise a genealogia a seguir e responda.

A probabilidade do casal 4 x 5 ter uma criança diíbrida é:


a) 1/8 b) 3/16 c) 1/16 d) ¼ e) ½
[D]
1096. Qual é a probabilidade de um casal de duplo heterozigotos para dois pares de genes autossômicos com segregação independente vir a ter um descendente com
apenas uma característica dominante?
a) 15/16 b) 9/16 c) 6/16 d) 3/16 e) 1/16
[C]
1097. Uma criança do sexo feminino, daltônica e canhota, possui pai daltônico e destro e mãe de visão normal e canhota. Sabendo que o uso da mão esquerda é uma
característica recessiva, então a probabilidade do segundo filho ser do sexo masculino e com fenótipos dominantes é:
a) ½ b) ¼ c) 1/6 d) 1/8 e) 1
[D]
1098. No cruzamento entre indivíduos heterozigotos para dois pares de genes que se segregam independentemente, espera-se que a proporção de descendentes
heterozigotos para apenas um par de genes seja
a) 9/16 b) ½ c) ¼ d) 3/16 e) 1/16
[B]
1099. Do cruzamento entre dois indivíduos portadores do genótipo CcDd, a probabilidade de ocorrência na F 1 de indivíduos com o mesmo genótipo dos pais, é:
a) zero
b) 1/2
c) 1/4
d) 1/8
[C]
1100. No coração dos mamíferos há passagem de sangue.
a) da aurícula esquerda para o ventrículo esquerdo.
b) do ventrículo direito para a aurícula direita.
c) do ventrículo direito para o ventrículo esquerdo.
d) da aurícula direita para a aurícula esquerda.
e) da aurícula direita para o ventrículo esquerdo.
[A]

159
1101. O esquema a seguir apresenta o percurso do sangue no corpo humano.
Assinale a alternativa que indica corretamente as regiões desse percurso onde se espera encontrar as maiores concentrações de oxigênio, glicose e uréia.

oxigênio/ glicose/ uréia.


a) I III VI.
b) II III VII.
c) II VII VI.
d) I IV VII.
e) II IV VI.
[E]
1102. Em relação ao sistema circulatório humano, são feitas as seguintes afirmativas:
I - No coração, o sangue que penetra na aurícula esquerda é arterial e chega através das veias pulmonares.
II - O coração envia sangue venoso aos pulmões através das artérias pulmonares, que saem do ventrículo esquerdo.
III - Através da artéria aorta, o sangue chega ao ventrículo esquerdo de onde é distribuído para todo o corpo.
Indique a alternativa correta:
a) todas são verdadeiras.
b) somente I e II são verdadeiras.
c) somente II e III são verdadeiras.
d) somente I é verdadeira.
e) somente II é verdadeira.
[D]
1103. Nos mamíferos, pode-se encontrar sangue venoso:
a) na aurícula direita, na artéria pulmonar e na veia cava.
b) no ventrículo direito, na veia pulmonar e na veia cava.
c) na aurícula direita, na veia pulmonar e na artéria aorta.
d) na aurícula esquerda, na artéria pulmonar e na veia cava.
e) no ventrículo esquerdo, na veia pulmonar e na artéria aorta.
[A]
1104. O sistema circulatório dos artrópodos diferencia-se do dos cordados por não transportar
a) gases da respiração.
b) hormônios.
c) resíduos orgânicos.
d) nutrientes.
e) água.
[A]
1105. Jogadores de futebol que vivem em altitudes próximas à do nível do mar sofrem adaptações quando jogam em cidades de grande altitude. Algumas adaptações
são imediatas, outras só ocorrem após uma permanência de pelos menos 3 semanas. Qual alternativa inclui as reações imediatas e as que podem ocorrer a longo
prazo?
a) IMEDIATAS: aumentam a freqüência respiratória, os batimentos cardíacos e a pressão arterial.
A LONGO PRAZO: diminui o número de hemácias.
b) IMEDIATAS: diminuem a freqüência respiratória e os batimentos cardíacos; aumenta a pressão arterial.
A LONGO PRAZO: aumenta o número de hemácias.
c) IMEDIATAS: aumentam a freqüência respiratória e os batimentos cardíacos; diminui a pressão arterial.
A LONGO PRAZO: diminui o número de hemácias.
d) IMEDIATAS: aumentam a freqüência respiratória, os batimentos cardíacos e a pressão arterial; diminui a pressão arterial.
A LONGO PRAZO: aumenta o número de hemácias.
e) IMEDIATAS: aumentam a freqüência respiratória, os batimentos cardíacos e a pressão arterial.
A lONGO PRAZO: aumenta o número de hemácias.
[D]
1106. A figura a seguir representa diferentes padrões de coração de vertebrados. Qual a seqüência indica a ordem crescente da eficiência circulatória, com relação ao
transporte de gases, conferida pelos três corações?

a) 1, 2, 3 b) 1, 3, 2 c) 3, 2, l
d) 2, 1, 3 e) 3, 1, 2
[E]
1107. No tecido sangüíneo humano, a substância intersticial liquida e os neutrófilos podem ser responsáveis, respectivamente,
a) pelo transporte de alimentos e transporte de oxigênio.
b) pelo transporte de gás carbônico e transporte de oxigênio.
c) pela produção de hemácias e fagocitose de elementos estranhos ao organismo.
d) pela fagocitose de elementos estranhos ao organismo e transporte de gás carbônico.
e) pelo transporte de gás carbônico e fagocitose de elementos estranhos ao organismo.

160
[E]
1108. Ao observarmos a circulação humana, quando comparamos artérias e veias, podemos afirmar que:
a) veias conduzem sempre sangue carbonado, assim como as artérias sempre possuem sangue oxigenado.
b) veias levam sangue do coração para os tecidos, e as artérias trazem sangue dos tecidos para o coração.
c) artérias e veias apresentam grande número de válvulas que impedem o retorno do sangue ao coração.
d) o grau de elasticidade do tecido muscular liso presente em artérias e veias é o mesmo.
e) a pressão do sangue nas veias é mais baixa que nas artérias.
[E]
1109. Relacione as descrições dos Sistemas Circulatórios com seus respectivos Filos animais.
I - Ausente. O alimento é distribuído diretamente da cavidade gastrovascular.
II - Ausente. O alimento é distribuído pelo intestino muito ramificado.
III - Ausente. O alimento é distribuído pelo fluido da cavidade pseudocelômica.
IV - Presente, do tipo fechado, com vasos pulsáteis e sangue dotado de pigmentos respiratórios.
V - Presente, do tipo aberto, com coração e vasos sanguíneos, onde circula o fluido celômico.
P - Artrópodos.
Q - Anelídeos.
R - Moluscos.
S - Nematelmintos.
T - Platelmintos.
U - Cnidários.
Assinale a opção que contém as associações corretas.
a) I - P; II - Q; III - R; IV - S; V - T
b) I - P; II - Q; III - R; IV - T; V - U
c) I - P; II - Q; III - R; IV - U; V - T
d) I - U; II - T; III - S; IV - Q; V - P
e) I - U; II - T; III - S; IV - S; V – Q
[D]
1110. O termo hipóxia refere-se à condição na qual a disponibilidade ou a utilização de oxigênio está reduzida. Os indivíduos B, C, D e E, relacionados na tabela a
seguir, estão submetidos, a diferentes formas de hipóxia. O indivíduo A tem metabolismo de oxigênio normal. Considere que o peso, o sexo e a idade de todos os
indivíduos são os mesmos.

a) Qual dos indivíduos está sofrendo as conseqüências de uma dieta pobre em ferro? Qual apresenta insuficiência cardíaca e ci rculação deficiente? Em que dados você
baseou suas conclusões?
b) Qual deles está sofrendo de envenenamento que impede suas células de usar o oxigênio? Justifique a resposta.
c) Observa-se uma aceleração da freqüência respiratória quando sobe o nível de gás carbônico. Explique como isso acontece.
a) O paciente C porque apresenta hemoglobina abaixo do normal, D porque está com um débito cardíaco baixo.
b) O paciente E porque a taxa de oxigênio no sangue venoso é muito próxima à taxa observada no sangue arterial.
c) O gás carbônico estimula o bulbo raquidiano a aumentar a freqüência respiratória,
1111. Comparando-se a estrutura e a fisiologia dos corações dos vertebrados, podemos considerar válida a seguinte afirmativa:
a) no coração dos peixes passa apenas sangue venoso
b) o coração dos anfíbios é dotado de. quatro câmaras, duas aurículas (ou átrios) e dois ventrículos
c) no coração das aves passa apenas sangue arterial
d) o coração dos répteis apresenta-se com três câmaras, uma aurícula (ou átrio) e dois ventrículos
e) no coração dos mamíferos, as duas aurículas (ou átrios) recebem sangue venoso e os dois ventrículos recebem sangue arterial
[A]
1112. Nos vertebrados terrestres, a circulação sistêmica tem início e término, respectivamente, na
a) artéria aorta e na veia cava.
b) veia cava e na artéria aorta.
c) artéria pulmonar e na veia cava.
d) artéria aorta e na veia pulmonar.
e) veia pulmonar e na artéria pulmonar.
[A]
1113. Na circulação dos peixes, o sangue sai do coração pela aorta ventral e dirige-se diretamente para
a) as brânquias.
b) o encéfalo.
c) os órgãos dos sentidos.
d) o estômago e para o intestino.
e) a musculatura do tronco e da cauda.
[A]
1114. Observe o esquema referente ao sistema circulatório de um vertebrado adulto representado na figura a seguir.
Com base nesse esquema e em seus conhecimentos sobre o assunto, assinale a alternativa que contém o grupo de vertebrados nele apresentado.

161
a) Anfíbios. b) Aves. c) Mamíferos.
d) Peixes. e) Répteis.
[D]
1115. A substância que impede a coagulação do sangue humano nos vasos sanguíneos é (ou são)
a) a trombina. b) a heparina. c) o fibrinogênio.
d) a vitamina K. e) íons de cálcio.
[B]
1116. Observe o esquema que se refere ao sistema cárdio-respiratório de um determinado animal.

Com base nesse esquema e em seus conhecimentos sobre o assunto, pode-se afirmar que
a) a estrutura 3 é característica de animais de circulação fechada.
b) a estrutura 6 representa uma artéria e, junto com 7 participa da grande circulação.
c) a função de 2 é realizada pela bexiga natatória no tubarão.
d) o órgão 1 é típico de répteis.
e) o teor de 0‚ em 4 maior do que em 5.
[A]
1117. Observe o quadro que contém a representação do sistema nervoso e do coração de alguns grupos de vertebrados. Essa representação foi feita de forma
aleatória, não mostrando correspondência entre sistema nervoso e coração para cada grupo nem apresentando seqüência evolutiva.

A alternativa que apresenta a associação correta encontrada em peixes é


a) I – 4 b) II – 3 c) III - 2
d) III – 4 e) IV – l
[B]
1118. Na(s) questão(ões) a seguir escreva nos parêntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Sobre os proces ses fisiológicos:
( ) a circulação nos peixes é fechada, simples e completa, enquanto nos anfíbios é dupla e incompleta, com mi stura de sangue arterial e venoso; no homem, é
fechada, dupla e completa;
( ) nos rins, a reabsorção tubular é um processo passivo para todas as substâncias, exceto água, sendo controlada pelo ADH (hormônio antidiurético);
( ) no arco reflexo, a resposta motora a um estímulo não depende da percepção consciente;
( ) a hematose é um processo que ocorre nos alvéolos pulmonares;
( ) o FSH (hormônio folículo estimulante) estimula o amadurecimento do folículo, o qual produz estrógenos, que estimul am a produção de FSH, num exemplo de
retroalimentação negativa.
VFVVF
1119. As fibras que compõem o tecido muscular cardíaco são:
a) lisas, anastomosadas e de contração voluntária;
b) estriadas, anastomosadas e de contração involuntária;
c) estriadas, não anastomosadas e de contração involuntária;
d) estriadas, anastomosadas e de contração voluntária;
e) lisas, anastomosadas e de contração involuntária.
[B]

162
1120. Com relação à circulação humana, analise as afirmativas a seguir e assinale a opção correta:
I) O sangue venoso, que contém o dióxido de carbono excretado pelas diversas células do organismo, passa pelo coração e, circ ulando por veias, vai até os pulmões.
II) Substâncias não utilizadas pelas células e que podem prejudicar o organismo quando acumuladas, passam para o sangue e são eliminadas pelos rins e pulmões.
III) A nível dos alvéolos pulmonares, o dióxido de carbono é liberado e o oxigênio absorvido pelo sangue. O sangue arterial v olta ao coração circulando por veias e daí é
bombeado para todo o corpo via artérias.
a) Todas estão corretas.
b) Apenas a I está correta.
c) Apenas a I é falsa.
d) Estão corretas a I e II.
e) Todas são falsas.
[C]
1121. Em relação ao sistema circulatório dos mamíferos, podemos afirmar que:
a) as hemácias são circulares, anucleadas e o coração é formado por quatro cavidades
b) as hemácias são ovais, nucleadas e o coração é formado quatro cavidades
c) as hemácias são ovais, anucleadas e o coração é formado três cavidades
d) as hemácias são circulares, nucleadas e o coração é formado quatro cavidades
e) as hemácias são circulares, anucleadas e o coração é formado por três cavidades
[A]
1122. Um estudante observou que um determinado vaso sangüíneo apresentava paredes espessas e que o sangue que circulava em seu interior era de um vermelho
escuro. Podemos afirmar corretamente que o vaso em questão era a:
a) veia pulmonar, que leva sangue venoso do coração para o pulmão.
b) veia cava, que traz sangue venoso do corpo em direção ao coração.
c) veia pulmonar, que leva sangue arterial do pulmão para o coração.
d) artéria pulmonar, que leva sangue venoso do coração para o pulmão.
e) artéria pulmonar, que leva sangue arterial do pulmão para o coração.
[D]
1123. Na(s) questão(ões) a seguir julgue os itens e escreva nos parentesses (V) se for verdadeiro ou (F) se for falso. Problemas do coração estão entre os principais
fatores de mortalidade em nosso país. Os itens a seguir referem-se direta ou indiretamente a este órgão, julgue-os.
( ) O coração é um órgão essencialmente muscular cuja função é a propulsão do sangue através do organismo.
( ) Nas aves e nos mamíferos o coração é completamente dividido em 4 câmaras: 2 aurículas e 2 ventrículos.
( ) Dietas alimentares ricas em gorduras podem comprometer o diâmetro dos vasos sangüíneos importantes, facilitando a incidência do enfarto do miocárdio.
( ) O transporte dos nutrientes e oxigênio para todas as células do organismo é uma das funções do sangue.
VVVV
1124. Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. Durante os primeiros 4.700 anos da história escrita da humanidade, desconhecia-
se o fato mais elementar sobre o sangue - que ele circula. Foram William Harvey (1578-1657) e Marcello Malpighi (1628-1694) que, no século XVII, demonstraram esse
fato.
O conhecimento sobre a importância evolutiva dos sistemas circulatórios, sua estrutura e as funções orgânicas a eles relacion adas permite afirmar:
(01) O fato de o sangue circular atende à necessidade de distribuição de substâncias às diversas partes do organismo.
(02) A manutenção da corrente sangüínea dentro de artérias, capilares e veias caracteriza o sistema circulatório fechado.
(04) O sistema circulatório foi fundamental para o sucesso evolutivo dos animais pluricelulares.
(08) As funções exercidas através do sistema circulatório prescindem da presença de células no sangue.
(16) Um sistema circulatório aberto dispensa a presença de uma estrutura propulsora do sangue.
(32) A presença de pigmentos sangüíneos está associada à função protetora do sistema circulatório.
01 + 02 + 04 = 07
1125. Após um traumatismo, um paciente teve que se submeter a uma cirurgia que removeu uma parte do seu corpo. Recuperou-se e passou a viver normalmente. A
parte retirada era
a) o fígado. b) o diafragma. c) a hipófise.
d) o pâncreas. e) o baço.
[E]
1126. Leia o trecho com atenção:
O coração apresenta quatro câmaras, duas aurículas e dois ventrículos e, nesse caso, não se misturam sangue arterial e venoso. A circulação é dupla, o que permite
melhor controle da pressão arterial. O sistema circulatório é mais eficiente, possibilitando uma chegada rápida dos alimentos aos tecidos, garantindo, assim, o controle
da temperatura corpórea. Qual da alternativas a seguir apresenta um animal que não se relaciona com o trecho descrito?
a) águia b) preguiça c) pingüim
d) ornitorrinco e) cobra
[E]
1127. As afirmações a seguir se referem à circulação do sangue no nosso organismo. Está correto afirmar que:
a) "veias" são vasos que levam o sangue para fora do coração;
b) o sangue sai do coração através das aurículas;
c) para voltar a um certo ponto o sangue passa duas vezes pelo coração;
d) "artérias" são vasos que levam o sangue para o coração;
e) as válvulas fornecem o retorno do sangue às aurículas.
[C]
1128. No que se refere ao tipo de coração, os animais podem apresentar o coração dividido em 2,3 e 4 cavidades, classificando-se respectivamente como:
a) mamíferos, peixes, aves;
b) peixes, anfíbios, aves;
c) anfíbios, répteis, mamíferos;
d) peixes, aves, anfíbios;
e) mamíferos, peixes, répteis.
[B]
1129. O coração humano é formado por:
a) 1 aurícula e 2 ventrículos.
b) 2 aurículas e 2 ventrículos.
c) 2 aurículas e 1 ventrículo.
d) 2 átrios e 2 aurículas.
e) 1 aurícula e 1 ventrículo.
[B]
1130. Uma pessoa ao ser transportada para uma, região de alta altitude, onde a atmosfera é rarefeita, sofrerá:
a) aumento do número de leucócitos;
b) diminuição do número de plaquetas;
c) aumento do número de hemáceas;

163
d) aumento do número de plaquetas;
e) a pessoa nada sofrerá.
[C]
1131. Ler atentamente as 3 afirmativas referentes à atuação das hemácias,
I - O gás carbônico combina-se com a hemoglobina formando carbo-hemoglobina
II - Nos pulmões, a hemoglobina liberta gás carbônico e recebe oxigênio
III - Nos vasos capilares, através da linfa, o oxigênio é liberado da hemoglobina e chega às células
e assinalar:
a) se apenas I estiver correta
b) se apenas II estiver correta
c) se II e III estiverem corretas
d) se I e III estiverem corretas
e) se as 3 afirmativas estivarem corretas
[E]
1132. Numere a segunda coluna de acordo com a primeira e assinale a alternativa que apresenta a ordem correta.
1 - Conduzem o sangue do coração para as diversas partes do corpo.
2 - Permitem a grande irrigação sangüínea com todas as células do corpo.
3 - Coletam o sangue das diversas partes do corpo e conduzem-no de volta ao coração.
( ) Veias
( ) Artérias
( ) Capilares
a) 2, 1, 3 b) 2, 3, 1 c) 3, 1, 2
d) 3, 2, 1 e) 1, 3, 2
[C]
1133. Em relação aos animais vertebrados, considere as seguintes características:
I- Sangue arterial separado do venoso nas aurículas e misturado no ventrículo
II- Presença de um único ventrículo.
III- Pelo coração passa apenas sangue venoso.
Peixes e anfíbios têm em comum:
a) I e II. b) apenas I. c) apenas II.
d) apenas II e III. e) I, II e III.
[C]
1134. Considerando-se os sistemas circulatórios de um caramujo, de um sapo e de um cachorro, é INCORRETO afirmar que:
a) o coração do sapo apresenta três cavidades e o do cachorro possui quatro.
b) em todos eles é possível encontrar um coração impulsionando o sangue pelo corpo.
c) as lacunas são espaços observados no sistema circulatório do caramujo, mas inexistente no sapo e no cachorro.
d) o caramujo e o sapo apresentam circulação dupla incompleta e o cachorro tem circulação dupla completa.
e) em todos eles o sistema circulatório está associado ao transporte, tanto de alimentos como de gases respiratórios.
[D]
1135. Coração com três cavidades, dois átrios e um ventrículo. O átrio direito recebe sangue venoso, o átrio esquerdo recebe sangue arterial, misturando-se no
ventrículo. Isso é encontrado exclusivamente nos
a) anfíbios. b) peixes. c) répteis.
d) ofídios e peixes. e) peixes e anfíbios.
[A]
1136. Entre os principais agentes poluidores do ar atmosférico destaca-se o monóxido de carbono (CO), que é um gás venenoso, inodoro e incolor, liberado
profusamente pela queima de combustível em automóveis.
Um dos efeitos desse poluente na saúde humana é
a) diminuição da capacidade de formação de anticorpos no sangue.
b) irritação nas mucosas do aparelho respiratório, causando doenças como asma, bronquite e enfisema pulmonar.
c) asfixia provocada pela inutilização da molécula de hemoglobina no transporte dos gases respiratórios.
d) Perturbações cardíacas em casos extremos de exposição prolongada.
e) aumento da incidência de câncer pulmonar.
[C]
1137. O coração dos anfíbios possui
a) um átrio e um ventrículo, ambos sem septos.
b) um átrio com septo parcial e um ventrículo sem septo.
c) um átrio e um ventrículo, ambos com septos parciais.
d) dois átrios e um ventrículo.
e) dois átrios e dois ventrículos.
[D]
1138. O deslocamento de um atleta para locais de grande altitude pode acarretar-lhe algumas alterações no organismo. A curto prazo, provoca modificações da
atividade respiratória e, a longo prazo, produz alterações sangüíneas. Assim, este indivíduo apresenta
a) hiperventilação e diminuição do número de hemácias.
b) hiperventilação e aumento do número de hemácias.
c) hipoventilação e diminuição do número de hemácias.
d) hipoventilação e aumento do número de hemácias.
e) isoventilação e manutenção do número de hemácias.
[B]
1139. A sístole do(a) .................... lança sangue, através da(s) ......................... para os pulmões, .......................... .
1 - Veias Pulmonares Direita.
2 - Veia Cava Superior.
3 - Átrio Direito.
4 - Ventrículo Direito.
5 - Veia Cava Inferior.
6 - Ventrículo Esquerdo.
7 - Átrio Esquerdo.
8 - Veias Pulmonares Esquerda.
9 - Artéria Pulmonar.
10 - Aorta.

164
Assinale a alternativa cujos termos preenchem corretamente as lacunas da afirmativa anterior.
a) 4 - 9 - onde ocorrerá a hematose.
b) 6 - 10 - de onde irá para todo o corpo.
c) 3 - 2 e 5 - onde ocorrerá a hematose.
d) 7 - 1 e 8 - onde será oxigenado.
e) 6 - 10 - onde será oxigenado.
[A]
1140. A hipotermia pode ser utilizada em algumas intervenções cirúrgicas. Entre estas podemos citar a cirurgia cardíaca. Quai s as vantagens de submetermos um
organismo à hipotermia?
I - A circulação fica muito reduzida.
II - O sangramento é mínimo.
III - Há uma elevação da taxa metabólica.
Quais estão corretas?
a) Apenas I b) Apenas II c) Apenas III
d) Apenas I e II e) Apenas II e III
[D]
1141. O colesterol é um importante constituinte das membranas celulares, estando relacionado à síntese dos hormônios esteróides e sai s biliares. No plasma ele é
encontrado ligado a corpúsculos lipoprotéicos conforme mostra a figura:

LDL - (Low Density Lipoprotein ou lipoproteína de baixa densidade)


HDL - (High Density Lipoprotein ou lipoproteína de alta densidade)
Considere a afirmativa:
- Há uma relação direta entre as taxas de colesterol no sangue e a incidência de ateromas, tromboses e infartos.
Marque a opção que apresenta conclusão correta acerca desta afirmativa.
a) Concentrações de HDL e LDL não possuem importância na avaliação da predisposição para o infarto.
b) Alta concentração de HDL e baixa LDL significam pequeno risco de infarto.
c) Alta concentração de LDL e baixa de HDL significam menor risco de infarto.
d) O aumento das taxas de colesterol depende somente da alimentação e não influenciado por fatores genéticos, estresse, fumo e diminuição de atividade física.
e) A afirmativa é incorreta, pois não há provas significativas que correlacionem os níveis de colesterol com a incidência de tromboses e infartos.
[B]
1142. As figuras a seguir mostram o coração de um mamífero em diferentes fases de seu funcionamento.

Representam, respectivamente, o final da sístole auricular e o início da sístole ventricular as figuras


a) I e II b) II e III c) III e I
d) III e IV e) IV e III
[D]
1143. A função do nódulo sinoatrial no coração humano é:
a) regular a circulação coronariana.
b) controlar a abertura e fechamento da válvula tricúspide.

165
c) funcionar como marcapasso, controlando a ritmicidade cardíaca.
d) controlar a abertura e fechamento da válvula mitral.
e) controlar a pressão diastólica da aorta.
[C]
1144. Dois animais, A e B, têm sistema circulatório aberto. O sistema respiratório de A é traqueal, e o de B, branquial.
Com base nessa descrição, escolha a alternativa correta.
a) A pode ser uma barata e B pode ser um peixe.
b) A pode ser um gafanhoto e B pode ser um mexilhão.
c) A pode ser um caracol e B pode ser uma mariposa.
d) A pode ser uma minhoca e B pode ser uma aranha.
e) A pode ser uma aranha e B pode ser uma planária.
[B]
1145. Após o processo de trocas gasosas nos pulmões, o sangue retorna ao coração através:
a) do sistema porta-hepático
b) das veias pulmonares
c) das carótidas
d) das artérias pulmonares
[B]
1146. O esquema a seguir representa o coração humano em corte longitudinal.

A região que controla a freqüência dos batimentos cardíacos, denominada nódulo sino-atrial, está indicada por
a) I b) II c) III d) IV e) V
[C]
1147. A figura refere-se a um esquema simplificado do sistema circulatório de um mamífero.

De acordo com o esquema, é correto afirmar que


a) a estrutura I representa a artéria aorta, que conduz sangue arterial a partir do ventrículo direito do coração.
b) a estrutura II representa as veias cavas, que transportam sangue venoso ao átrio direito.
c) a estrutura III indica as veias pulmonares, que conduzem sangue venoso a partir do ventrículo direito.
d) a estrutura IV refere-se à artéria pulmonar, que leva sangue arterial ao átrio esquerdo.
e) nas estruturas I e II as taxas de O2 e CO2 sofrem profundas alterações, quando o sangue passa pelo coração, e este fenômeno denomina-se hematose.
[B]
1148. Alguns jogos da Taça Libertadores da América são realizados na cidade de La Paz, situada a 3635m de altitude. Os jogadores do Rio de Janeiro transportados
para esta cidade podem apresentar o seguinte processo:
a) redução do número de leucócitos.
b) aumento de leucócitos e aumento da pressão sangüínea.
c) redução da pressão sangüínea.
d) redução do número de hemácias.
e) aumento do número de hemácias.
[E]
1149. DROGA ANTICÂNCER É TESTADA COM SUCESSO
"Os cientistas Hong Li e He Lu usaram angiostatina, endostatina e a proteína uroquinase geneticamente modificada. Esta última acelera a angiogênese
(desenvolvimento de vasos que alimentam as células), mas com a manipulação do gene da proteína, foi possível obter o efeito i nverso: a fabricação de uma molécula
que bloqueia o tumor".
A ação normal da uroquinase de acelerar a angiogênese se exerce, primordialmente, sobre as seguintes células:
a) musculares b) endoteliais c) leucocitárias d) fibroblásticas
[B]
1150. No sangue, existem fragmentos citoplasmáticos possuidores de uma enzima, a tromboplastina, que, em presença de íons cálcio, converte a protrombina em
trombina. Esses corpúsculos são denominados de:
a) Hemácias. b) Monócitos. c) Plaquetas.
d) Neutrófilos. e) Basófilos.
[C]
1151. Observe a figura a seguir, que representa o desenho esquemático de um coração humano:

166
São vasos que transportam sangue venoso:
a) 1, 2 e 3 b) 1 e 2 apenas c) 1 e 4 apenas
d) 2 e 3 apenas e) 2 e 4 apenas
[B]
1152. Assinale o animal cujo sistema circulatório NÃO têm a função de transporte de gases:
a) Minhoca. b) Barata. c) Polvo.
d) Lagosta. e) Rã.
[B]
1153. O esquema abaixo representa o coração humano.

O sangue que deixa o ventrículo direito (VD) e o que deixa o ventrículo esquerdo (VE) irão, respectivamente, para a
a) artéria pulmonar e para a artéria aorta.
b) artéria pulmonar e para a veia pulmonar.
c) artéria aorta e para a artéria pulmonar.
d) artéria aorta e para a veia pulmonar.
e) veia pulmonar e para a artéria aorta.
[A]
1154. São funções do sistema linfático:
I - drenagem de líquidos dos tecidos;
II - retenção de partículas estranhas e células mortas;
III - proteção do organismo contra agentes infecciosos.
Está(ão) CORRETA(S)
a) I e II. b) I e III. c) II e III.
d) I, II e III. e) apenas III.
[D]
1155. Indique a opção que contém somente seres vivos que apresentam os sistemas circulatórios ABERTOS.
a) polvos, mexilhões e ostras
b) ostras, lulas e mariscos
c) mexilhões, lulas e polvos
d) mariscos, mexilhões e ostras
[D]
1156. A respeito das minhocas, é correto afirmar que:
a) são pseudocelomadas.
b) têm sistema circulatório fechado.
c) são de sexos separados.
d) têm digestão intracelular.
e) têm desenvolvimento indireto.
[B]
1157. A figura a seguir mostra o coração de um mamífero.

167
Assinale a alternativa correta:
a) 3, 4 e 5 são artérias que levam o sangue do coração para outras partes do corpo.
b) 1, 2 e 5 são veias que trazem o sangue venoso do corpo para o coração.
c) 5 são veias que levam o sangue do coração para os pulmões.
d) 4 é uma artéria que leva o sangue do coração para as demais partes do corpo.
e) 3 e 4 transportam o sangue arterial.
[D]
1158. Relativo ao sistema circulatório nos vertebrados, é correto afirmar que
01. no coração dos peixes só passa sangue arterial.
02. nos anfíbios a circulação é simples e completa.
04. nos répteis em geral o coração apresenta 4 cavidades, sendo 2 átrios e 2 ventrículos.
08. nas aves e nos mamíferos a circulação é dupla e completa.
16. a artéria aorta é dirigida para a esquerda nas aves e para a direita nos mamíferos.
32. nos mamíferos o sangue venoso proveniente do corpo chega ao átrio esquerdo pela veia safena.
64. nas aves o sangue que chega ao átrio esquerdo é rico em CO 2 enquanto o sangue chega ao átrio direito é rico em O 2.
FFFVFFF
1159. Ao passar pelas vilosidades do intestino delgado, o sangue de uma pessoa alimentada
a) perde gás oxigênio e ganha aminoácidos.
b) perde gás oxigênio e perde glicose.
c) ganha gás oxigênio e ganha aminoácidos.
d) ganha gás carbônico e perde glicose.
e) perde gás carbônico e ganha aminoácidos.
[A]
1160. Um animal X, recentemente descoberto, apresenta as características abaixo quanto à respiração e circulação.
X possui respiração aérea, efetuada através de uma estrutura respiratória fina e ramificada, a qual fica alojada em uma cavidade respiratória interna. Existem 5 (cinco)
orifícios externos para a entrada de ar nessa cavidade, comunicando-se com ela através de tubos reforçados por anéis de quitina. Um pequeno conjunto de músculos
auxilia na expansão e retração da cavidade respiratória, possibilitando a entrada e a saída do ar ambiental. As trocas gasosas ocorrem entre a estrutura respiratória e
inúmeros vasos sangüíneos a ela associados, cujo sangue contém pigmentos que auxiliam no transporte dos gases respiratórios. Esses vasos sangüíneos são
ramificações de um vaso principal que transporta o sangue bombeado pelo coração. Este sangue, após a oxigenação, retorna por um outro vaso ao coração, onde se
mistura ao sangue venoso.
Com relação às características descritas acima, é correto afirmar:
01) A estrutura respiratória de X, fina e ramificada, facilita as trocas gasosas no animal, pela diminuta espessura a ser atr avessada pelos gases e pela grande superfície
de contato entre ar e sangue.
02) O fato de a estrutura respiratória de X ficar alojada numa cavidade respiratória está diretamente relacionado ao hábito da respiração aérea desse animal.
04) A presença de pigmentos transportadores de gases respiratórios no sangue permite classificar X unicamente como animal vertebrado.
08) O vaso de X que transporta o sangue do coração até a estrutura respiratória tem função análoga à das veias pulmonares dos vertebrados.
16) Os músculos que promovem alteração de volume da cavidade respiratória de X desempenham uma função análoga à do diafragma, no homem.
32) A circulação de X é do tipo dupla e completa, como aquela existente nas aves e mamíferos.
VVFFVF
1161. Uma pessoa excreta mais uréia quando come mais:
a) amido. b) proteína. c) sacarose.
d) gordura. e) glicose.
[B]
1162. O sangue de um mamífero que chega à veia cava inferior, vindo do fígado, contém, relativamente, grande quantidade de:
a) oxigênio e de uréia.
b) gás carbônico e de uréia.
c) uréia e pequena de gás carbônico.
d) gás carbônico e pequena de uréia.
e) de oxigênio e pequena de uréia.
[B]
1163. Indique a alternativa em que a estrutura do aparelho excretor não corresponde à encontrada no organismo relacionado:
a) planária ------------------------ células-flama.
b) ameba -------------------------- vacúolo pulsátil.
c) minhoca ------------------------ nefrídios.
d) homem adulto ---------------- rim mesonefro.
e) gafanhoto --------------------- túbulos de Malpighi.
[D]
1164. Nos túbulos do néfron há intenso transporte ativo. Portanto, as células das paredes desses túbulos são ricas em:
a) mitocôndrias. b) DNA. c) lisossomos.
d) ribossomos. e) retículo endoplasmático.
[A]
1165. Recentemente descobriu-se que, quando aumenta a pressão nos átrios (aurículas) cardíacos, estes secretam um hormônio - o fator atrial - que tem ação direta
sobre os néfrons, as unidades filtradoras dos rins. Entre outros efeitos, o fator atrial produz dilatação da arteríola aferente, combinada com a constrição da arteríola
eferente (veja o esquema a seguir que representa um néfron).

168
Dessas informações, pode-se deduzir que a secreção de fator atrial provoca:
a) maior filtração glomerular, formação de mais urina, diminuição da pressão sangüínea.
b) menor filtração glomerular, formação de mais urina, diminuição da pressão sangüínea.
c) maior filtração glomerular, formação de menos urina, elevação da pressão sangüínea.
d) menor filtração glomerular, formação de menos urina, elevação da pressão sangüínea.
e) menor filtração glomerular, formação de mais urina, elevação da pressão sangüínea.
[A]
1166. Uma pessoa excreta mais uréia quando come mais:
a) amido. b) proteína. c) glicose. d) gordura. e) sacarose.
[B]
1167. Vinte pessoas normais beberam, cada uma, 2 litros de água num intervalo de 2 horas. A seguir temos os gráficos que registram as médias das variações dos
volumes urinários e das concentrações do hormônio anti-diurético (ADH) no sangue em função do tempo.

A análise dos gráficos permite concluir que


a) o hormônio ADH tem efeito diurético, o que faz aumentar o volume urinário.
b) o volume urinário não tem nenhuma relação com a secreção do hormônio ADH.
c) há uma relação diretamente proporcional entre a concentração do hormônio ADH e o volume urinário.
d) o aumento do volume urinário influi sobre os rins, inibindo a secreção do hormônio ADH.
e) há uma relação inversamente proporcional entre a concentração do hormônio ADH e o volume urinário.
[E]
1168. A excreção está relacionada à eliminação de substâncias prejudiciais resultantes do metabolismo.
Dos órgãos citados a seguir, assinale aquele que NÃO está associado a esta função.
a) Pulmões.
b) Fígado.
c) Rins.
d) Pele.
e) Pâncreas.
[E]
1169. Os tubarões acumulam uréia no sangue, como artifício de sobrevivência ao meio marinho, porque:
a) a água do mar é hipotônica em relação ao seu meio interno, o que favorece a desidratação.
b) os vacúolos pulsáteis das células branquiais não são eficientes na expulsão do excesso de água absorvida.
c) tornando-se isotônicos em relação ao mar, a osmorregulação é controlada.
d) o sangue elimina os sais absorvidos pelo intestino por osmose.
e) há excessiva eliminação de urina, e a perda da uréia diminui a concentração de sais no sangue.
[C]
1170. Considere as listas a seguir referentes a estruturas e funções do sistema excretor humano.
I. néfron
II. bexiga
III. uretra
IV. ureter
a. condução de urina para o meio externo
b. produção de urina
c. armazenamento de urina
d. condução de urina até o órgão armazenador
Assinale a alternativa que associa corretamente cada estrutura à sua função.
a) Ia, IIb, IIIc, IVd
b) Ib, IIc, IIIa, IVd
c) Ib, IId, IIIc, IVa
d) Ic, IIa, IIId, IVb
e) Id, IIc, IIIb, Iva
[B]
1171. A abelha, a cobra e o pardal têm em comum:
a) circulação aberta.

169
b) cordão nervoso ventral.
c) desenvolvimento direto.
d) queratina produzida pela epiderme.
e) excreção de ácido úrico.
[E]
1172. Com relação aos mecanismos de excreção desenvolvidos durante a evolução dos seres vivos, todas as afirmativas estão corretas,
EXCETO
a) As traquéias dos insetos eliminam produtos nitrogenados.
b) O sistema excretor funciona de modo a manter constante a composição do sangue.
c) Os protonefrídios são os órgãos de excreção das planárias.
d) Os protozoários e os poríferos realizam a excreção por difusão.
e) Os rins, assim como os pulmões e a pele, participam da excreção no homem.
[A]
1173. O sangue, nos mamíferos, é filtrado a nível da(os):
a) cápsula de Bowman;
b) túbulos contornados proximais;
c) túbulos contornados distais;
d) alça de Henle;
e) ductos coletores.
[A]
1174. No homem, várias substâncias presentes no sangue chegam ao néfron, atravessam a cápsula de Bowman e atingem o túbulo re nal. Várias dessas substâncias
são, normalmente, reabsorvidas, isto é, do néfron elas são lançadas novamente no sangue, retornando a outras partes do corpo.
Entre essas substâncias normalmente reabsorvidas, no nível do néfron podem ser citadas:
a) água e uréia.
b) água e glicose.
c) glicose e uréia.
d) água e ácido úrico.
e) aminoácidos e uréia.
[B]
1175. Foram analisadas amostras de urina de cinco pessoas. A composição dessas amostras é a seguinte:
I. ácido úrico, glicose, água e cloreto de sódio
II. uréia, ácido úrico, água e cloreto de sódio
III. proteínas, uréia, água e glicose
IV. uréia, ácido úrico, glicose, água e cloreto de sódio
V. uréia, proteínas, água e cloreto de sódio
A amostra que corresponde a um indivíduo normal é a
a) V b) IV c) III d) II e) I
[D]
1176. Em caso de hipertensão, recomenda-se uma dieta sem sal porque este atua
a) diminuindo o volume de sangue circulante.
b) aumentando o volume de sangue circulante.
c) reduzindo o calibre dos vasos sangüíneos.
d) dilatando o calibre dos vasos sangüíneos.
e) obstruindo os capilares arteriais com placas de ateroma.
[B]
1177. A ingestão de bebidas alcoólicas inibe a liberação do hormônio responsável pelo aumento da permeabilidade das membranas das células dos túbulos renais.
Com isso, é diminuída a reabsorção:
a) passiva de água, o que diminui a concentração sangüínea e concentra a urina.
b) passiva de água, o que aumenta a concentração sangüínea e dilui a urina.
c) passiva de água, o que diminui a concentração sangüínea e dilui a urina.
d) ativa de água, o que aumenta a concentração sangüínea e dilui a urina.
e) ativa de água, o que diminui a concentração sangüínea e concentra a urina.
[B]
1178. A respeito do sistema excretor, é correto afirmar que:
a) uma lagartixa excreta predominantemente uréia.
b) além da eliminação de excretas, esse sistema é responsável pela osmorregulação.
c) os rins de anfíbios, como em qualquer vertebrado, retiram excretas somente do sangue.
d) planárias por serem aquáticas, não apresentam estruturas especializadas em excreção.
e) como é aquática, a excreção de uma baleia é igual à de um peixe.
[B]
1179. Assinale a alternativa que relaciona, respectivamente, os tipos de aparelhos excretores que são observados em mamíferos , aves e insetos:
a) rins, rins e túbulos de Malpighi.
b) nefrídios, rins e túbulos de Malpighi.
c) rins, rins e glândulas verdes.
d) células-flama, rins e rins.
e) rins, rins e rins.
[A]
1180. Qual é o tipo de sistema excretor observado em minhocas?
a) rins.
b) túbulos de Malpighi.
c) glândulas verdes.
d) glândulas coxais.
e) nefrídios
[E]
1181. A manutenção da estabilidade do ambiente fisiológico interno de um organismo é exercida por diversos órgãos. Por exempl o, os rins são responsáveis, entre
outras coisas, pela estabilidade dos níveis de sais, água e açúcar do sangue. Assinale a opção que indica corretamente o nome do mecanismo referido anteriormente:
a) Homeotermia. b) Homeostase. c) Organogênese.
d) Ontogenia. e) Etologia.
[B]
1182. Observe os seguintes esquemas, que representam estruturas excretoras.

170
Assinale a alternativa correta:
a) A estrutura 1 retira excretas do celoma do animal.
b) A estrutura 2 é encontrada em animais como as tênias.
c) A estrutura 2 pode retirar excretas tanto do celoma quanto do sangue.
d) A estrutura 1 pode ser encontrada em águas-vivas.
e) As estruturas 1 e 2 são encontradas em artrópodos.
[C]
1183. Através da placenta, estrutura que contém tecidos da mãe e do embrião, o organismo materno fornece oxigênio e nutrientes, recolhendo, também, os resíduos do
metabolismo do embrião.
Em condições normais, o mecanismo de trocas materno-fetal ocorre:
a) por uma circulação única materno-fetal, isto é, o sangue da mãe entra em contato direto com o do embrião.
b) por livre difusão, em que a oxigenação, nutrição e remoção de excretas são feitas através de trocas entre a circulação fetal e materna.
c) por transporte ativo, em que o sangue do embrião atrai os nutrientes e o oxigênio do sangue materno.
d) pela ação de hormônios gonadotróficos, que fazem o transporte dos elementos do sangue materno para o fetal.
e) pelo líquido da bolsa d'água, que recebe os nutrientes e oxigênio do sangue materno, difundindo-os até o sangue do embrião.
[B]
1184. As brânquias em peixes ósseos marinhos, além da função respiratória, têm papel excretor e osmorregulador. A respeito das adaptações de peixes ósseos
marinhos ao meio em que vivem, podemos afirmar que:
a) bebem água salgada, que é absorvida no intestino, e eliminam o excesso de sais pelas brânquias.
b) eliminam, pelas brânquias, grandes quantidades de água e o excesso de sais.
c) absorvem água salgada pelas brânquias e eliminam o excesso de sais por essas estruturas.
d) acumulam altas taxas de uréia no sangue e a eliminam gradativamente pelas brânquias.
e) eliminam grandes quantidades de água pelo intestino e eliminam o excesso de sais pelas brânquias.
[A]
1185. A reabsorção de água pelos rins regula a osmorregularidade do sangue, graças à ação de um hormônio produzido pela hipófise. Esse hormônio é:
a) somatotrofina.
b) epinefrina.
c) secretina.
d) hormônio antidiurético.
e) hormônio luteinizante.
[D]
1186. Em qual dos ambientes a seguir vivem vertebrados cujo principal produto de excreção é amônia?
a) Deserto. b) Floresta úmida. c) Floresta temperada.
d) Mar. e) Cerrado.
[D]
1187. Considere as afirmativas a seguir:
I - Todos os animais aquáticos excretam amônia por não apresentarem problemas quanto à obtenção de água.
II - O ácido úrico, por ser o excreta menos solúvel em água, é eliminado principalmente por animais terrestres como aves e répt eis.
III - Os mamíferos excretam uréia porque, apesar de serem terrestres em sua maioria, geralmente são vivíparos e têm bom suprimento de água.
Então:
a) todas as afirmativas são verdadeiras.
b) somente a afirmativa I é verdadeira.
c) somente as afirmativas I e II são verdadeiras.
d) somente as afirmativas II e III são verdadeiras.
e) somente a afirmativa II é verdadeira.
[D]
1188. Relacione as colunas a seguir , identificando corretamente os tipos de estruturas excretoras dos animais:
1 - ameba
2 - rato
3 - minhoca
4 - planária
5 - gafanhoto
( ) tubos de Malpighi
( ) nefrídios
( ) rins
( ) vacúolo pulsátil
( ) células-flama
A ordem correta, na segunda coluna, de cima para baixo, é
a) 2 - 1 - 5 - 3 - 4
b) 5 - 3 - 2 - 1 - 4
c) 4 - 1 - 2 - 5 - 3
d) 1 - 4 - 2 - 3 - 5
e) 5 - 4 - 3 - 2 – 1
[B]
1189. Peixes e anfíbios adultos possuem em comum:
a) coração dotado de duas câmaras: um átrio e um ventrículo.
b) respiração branquial.

171
c) rins mesonéfricos (torácicos).
d) fecundação interna.
e) intestino terminando em cloaca.
[C]
1190. Um dos mecanismos de homeostase do nosso organismo, é remover excretas resultantes das atividades celulares. Assinale a alternativa cujos excretas provêm
do metabolismo das PROTEÍNAS:
a) aminoácidos, CO2 e uréia
b) uréia, fezes e amônia
c) suor, ácido úrico e aminoácido
d) ácido úrico, uréia e amônia
[D]
1191. Observe a figura a seguir.

Nela estão representadas células características do sistema excretor dos


a) insetos.
b) anelídeos.
c) moluscos.
d) nematelmintos.
e) platelmintos.
[E]
1192. "Exame confirma doping de jogador"
Foi positivo o resultado da contraprova do exame de urina realizado.
A presença de substâncias tóxicas na urina resultam de um processo realizado no rim a que se denomina:
a) reabsorção tubular.
b) absorção tubular.
c) filtração glomerular.
d) reabsorção ativa.
e) excreção glomerular.
[C]
1193. O hormônio ADH atua sobre os túbulos renais promovendo absorção de água do filtrado glomerular. A deficiência na secreç ão desse hormônio faz com que a
pessoa produza
a) muita urina, com alta concentração de excreções.
b) muita urina, com baixa concentração de excreções.
c) pouca urina, com alta concentração de excreções.
d) pouca urina, com baixa concentração de excreções.
e) quantidade normal de urina, com alta concentração de excreções.
[B]
1194. Conforme noticiado na imprensa em abril de 1996, as mortes de pacientes submetidos à hemodiálise em um hospital de Caruaru, Pernambuco, foram devidas á
presença de algas azuis na água utilizada nos aparelhos de hemodiálise.
A provável ação das algas azuis foi a
a) competição pelo O2 livre no sangue levando à cianose.
b) formação de colônias levando à obstrução de vasos sangüíneos.
c) liberação de toxinas na água provocando lesões hepáticas.
d) utilização do nitrogênio das proteínas acarretando deficiência nutricional.
[C]
1195. São vertebrados homeotérmicos, cuja excreção de produtos nitrogenados ocorre principalmente na forma de ácido úrico,
a) somente as aves.
b) somente os mamíferos.
c) as aves e os mamíferos.
d) as aves e os répteis.
e) os anfíbios adultos e os mamíferos.
[A]
1196. - Eliminação das células sangüíneas que estão velhas demais.
- Formação de uréia.
- Armazenamento de energia para qualquer eventualidade.
- Maior glândula do corpo humano.
Todas essas características típicas de um super-orgão estão relacionadas ao (à):
a) baço. b) rim. c) pâncreas.
d) fígado. e) hipófise.
[D]
1197. Os rins são órgãos relacionados com excreção e controle hídrico. Das estruturas a seguir, todas apresentam a mesma função dos rins, EXCETO:
a) os vacúolos contráteis.
b) os cnidócitos.
c) as células-flama.
d) os nefrídios.
e) as glândulas verdes.
[B]
1198. Produzido pelo hipotálamo e eliminado na circulação sangüínea pelo lobo posterior da hipófise, o hormôni o ADH irá atuar:
a) na bexiga.
b) na uretra e na bexiga.
c) no bacinete.
d) nos ureteres e na uretra.
e) nos túbulos contornados distais.

172
[E]
1199. A tabela a seguir indica as quantidades ( em porcentagem) de excretas nitrogenados na urina de dois animais.

Sobre esses dados, fizeram-se as seguintes afirmações:


I. O animal (a) provavelmente vive em habitat terrestre e o animal (b), em habitat aquático ou de transição entre água e terr a.
II. A urina de (a) é rica em ácido úrico, altamente tóxico, que necessita de grande quantidade de água para ser eliminado.
III. A urina de (b) é rica em substâncias solúveis e muito tóxicas.
IV. O animal (a) pode ser uma tartaruga e (b) pode ser um sapo.
Dessas afirmações, são corretas SOMENTE
a) I e III b) II e IV c) I, II e III
d) I, III e IV e) II, III e IV
[D]
1200. A estrutura excretora encontrada em anelídeos, platelmintos, anfíbios, crustáceos e aracnídeos é, respectivamente,
a) nefrídio, células-flama, rim, glândula verde, túbulos de Malpighi.
b) células-flama, nefrídio, rim, túbulos de Malpighi, glândula verde.
c) glândula verde, nefrídio, rim, células-flama, túbulos de Malpighi.
d) nefrídio, rim, glândula verde, túbulos de Malpighi, células-flama.
e) túbulos de Malpighi, glândula verde, nefrídio, células-flama, rim.
[A]
1201. Deixe o xixi do Maradona em paz, droga!

(FOLHA DE S. PAULO/97)
O teste antidoping, que freqüentemente aparece nas notícias dos jornais, é feito a partir do exame da urina de atletas. Isso se torna possível porque através do néfron -
unidade funcional dos rins - é executada a tarefa de:
a) absorver glicose
b) eliminar catabólitos
c) secretar aminoácidos
d) filtrar glóbulos sangüíneos
[B]
1202. Considere os grupos de animais:
- o grupo (a), correspondente aos crustáceos que regulam a osmolaridade de seus líquidos corporais somente em uma faixa estreita de variações de osmolaridade do
meio ambiente;
- o grupo (b), correspondente à maioria dos invertebrados marinhos que estão em equilíbrio osmótico com o meio ambiente;
- o grupo (c), correspondente aos vertebrados marinhos que regulam ativamente a osmolaridade de seus líquidos corporais.
O gráfico, a seguir, representa a relação entre a osmolaridade dos líquidos corporais e a osmolaridade do mei o ambiente em que se encontram estes três grupos de
animais:

A relação entre a osmolaridade do meio ambiente e a osmolaridade dos líquidos corporais dos animais correspondentes aos grupos (a), (b) e (c) está representada,
respectivamente, pelas linhas indicadas por:
a) III, II, I b) III, I, II c) II, I, III
d) II, III, I e) I, II, III
[B]
1203. Considere dois indivíduos adultos, metabolicamente normais, designados por A e B.
O indivíduo A tem uma dieta rica em proteínas e pobre em carbohidratos. O indivíduo B, ao contrário, tem uma dieta pobre em proteínas e rica em carbohidratos. Pode-
se prever que na urina do indivíduo A exista
a) menor concentração de uréia que na urina de B e que a concentração de glicose seja a mesma na urina de ambos.
b) maior concentração de uréia que na urina de B e que não se encontre glicose na urina de ambos.
c) maior concentração de uréia e maior concentração de glicose que na urina de B.
d) menor concentração de uréia e menor concentração de glicose que na urina de B.
e) a mesma concentração de uréia e glicose que a encontrada na urina de B.
[B]
1204. Observe a figura a seguir, relativa ao esquema de um néfron:

173
A ingestão de bebidas alcoólicas provoca a redução de ADH, o hormônio antidiurético, armazenado na neuro-hipófise, que irá alterar a permeabilidade dos
componentes:
a) 1 e 5 b) 2 e 4 c) 3 e 1
d) 4 e 5 e) 5 e 2
[D]
1205. Considere a frase a seguir,
"Nos mamíferos, as células eliminam ...I... para o sangue e, no fígado, essa substância é transformada em ...II..."
Para completá-la corretamente, é necessário substituir I e II, respectivamente, por
a) uréia e amônia.
b) uréia e ácido úrico.
c) ácido úrico e uréia.
d) amônia e ácido úrico.
e) amônia e uréia.
[E]
1206. A porção do néfron assinalada com um asterisco na figura corresponde à estrutura

a) onde ocorre a ultrafiltração do plasma sangüíneo.


b) com função de excretar o excesso de sal, observada em répteis e aves.
c) onde ocorre reabsorção de glicose e aminoácidos.
d) responsável pela formação de urina concentrada, observada em aves e mamíferos.
e) onde ocorre secreção de substâncias estranhas ao organismo.
[D]
1207. Assinale a alternativa correta quanto aos produtos de excreção em animais.
a) A amônia ocorre, principalmente, em animais terrestres.
b) A uréia ocorre, principalmente, nas formas aquáticas de água doce.
c) O ácido úrico ocorre, principalmente, em formas aquáticas marinhas.
d) A uréia dissolvida em água ocorre em moluscos terrestres, insetos e alguns répteis, formando urina.
e) O ácido úrico em forma pastosa ocorre em insetos, alguns répteis e aves, sendo eliminado junto com as fezes.
[E]
1208. O esquema adiante, representa o aparelho excretor humano. As setas A e B indicam o sentido do fluxo sangüíneo. Os números 1, 2 e 3 indicam, respectivamente:

a) Artéria aorta, ureter e veia cava.


b) Veia cava, ureter e artéria aorta.
c) Veia cava, uretra e artéria aorta.
d) Artéria aorta, uretra e veia cava.
e) Artéria aorta, uretra e veia porta.
[A]
1209. A degradação dos aminoácidos ingeridos na alimentação gera como subproduto a amônia. Nos mamíferos, a amônia é transform ada em uréia. Esse processo
ocorre

174
a) no pâncreas. b) no fígado. c) nos rins.
d) na bexiga urinária. e) no baço.
[B]
1210. O gráfico a seguir apresenta duas curvas que indicam o que acontece com o metabolismo de animais: uma para animais que mantêm cons tante a temperatura do
corpo e outra para animais cuja temperatura do corpo é igual à do ambiente.

Que animais têm curvas do tipo Y?


a) Camundongo, canário e rã.
b) Caranguejo, lula e pescada.
c) Elefante, baleia e avestruz.
d) Gaivota, pescada e jacaré.
e) Baleia, tubarão e pescada.
[B]
1211. Cada uma das curvas do gráfico adiante mostra a correlação entre a temperatura corporal de um vertebrado (A ou B) e a temperatura do ambiente.

Os animais A e B podem ser respectivamente:


a) coelho e lagarto.
b) pombo e cavalo.
c) sapo e jacaré.
d) lagartixa e gato.
e) tartaruga e galinha.
[A]
1212. Vinte pessoas normais beberam, cada uma, 2 litros de água num intervalo de 2 horas. A seguir temos os gráficos que registram as médias das variações dos
volumes urinários e das concentrações do hormônio anti-diurético (ADH) no sangue em função do tempo.

A análise dos gráficos permite concluir que


a) o hormônio ADH tem efeito diurético, o que faz aumentar o volume urinário.
b) o volume urinário não tem nenhuma relação com a secreção do hormônio ADH.
c) há uma relação diretamente proporcional entre a concentração do hormônio ADH e o volume urinário.
d) o aumento do volume urinário influi sobre os rins, inibindo a secreção do hormônio ADH.
e) há uma relação inversamente proporcional entre a concentração do hormônio ADH e o volume urinário.
[E]
1213. A temperatura do corpo da maioria dos animais acompanha a variações da temperatura do ambiente. Temperaturas muito baixas podem determinar a paralisação
das atividades do animal e, até mesmo, sua morte.
Animais que conseguem manter a temperatura do corpo e níveis ideais do metabolismo, apesar das variações do ambiente são os(as):
a) tubarões. b) sapos. c) cobras.
d) baleias. e) jacarés.
[D]
1214. Os tubarões acumulam uréia no sangue, como artifício de sobrevivência ao meio marinho, porque:
a) a água do mar é hipotônica em relação ao seu meio interno, o que favorece a desidratação.

175
b) os vacúolos pulsáteis das células branquiais não são eficientes na expulsão do excesso de água absorvida.
c) tornando-se isotônicos em relação ao mar, a osmorregulação é controlada.
d) o sangue elimina os sais absorvidos pelo intestino por osmose.
e) há excessiva eliminação de urina, e a perda da uréia diminui a concentração de sais no sangue.
[C]
1215. Observe a figura a seguir.

O animal representado vive em regiões áridas e possui urina muito hipertônica em relação ao sangue.
Todas as alternativas apresentam adaptações desse animal ao meio ambiente, EXCETO
a) Ausência de transpiração mesmo em altas temperaturas.
b) Eliminação de amônia como produto nitrogenado.
c) Eliminação de fezes praticamente desidratadas.
d) Eliminação de pouca água na urina.
e) Hábitos noturnos e ocupação de buracos na terra durante o dia.
[B]
1216. Mamíferos aquáticos, como os cetáceos, possuem um espesso revestimento de tecido adiposo com importante função para
a) facilitar a flutuação.
b) proteção contra predadores.
c) evitar perda de calor.
d) evitar perda de água.
e) moldar o corpo, tornando-o mais hidrodinâmico.
[C]
1207. Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. A figura a seguir ilustra a relação entre a temperatura ambiente e a temperatura
corporal de dois animais.

Com base na análise dessa ilustração, pode-se concluir:


(01) Os animais representados exibem a mesma capacidade de regulação térmica.
(02) Em animais endotérmicos, a fonte preferencial de calor para o corpo é o metabolismo.
(04) Animais exotérmicos mantêm uma relação direta entre a temperatura do corpo e a do ambiente.
(08) A disponibilidade de alimento permite a regulação térmica em répteis.
(16) A endotermia é uma vantagem evolutiva para animais terrestres.
(32) Adaptações na superfície do corpo dos mamíferos estão associadas à sua condição de animais endotérmicos.
(64) Animais exotérmicos e endotérmicos apresentam as mesmas características anatômicas e fisiológicas quanto ao sistema circulatório.
02 + 04 + 16 + 32 = 54
1208. Em um ambiente com temperatura mantida constante em 18°C, qual dos animais a seguir necessitará maior consumo de alimento em relação ao tamanho de seu
corpo?
a) Sapo. b) Jacaré. c) Sabiá. d) Tubarão. e) Jararaca.
[C]
1209. Quando à temperatura dos animais podem ser:
(1) pecilotérmico
(2) homeotérmicos.
Classifique os animais: rato, pato, cobra, sapo, tubarão, de acordo com a temperatura.
a) 1 - 2 - 1 - 2 - 1;
b) 1 - 1 - 2 - 2 - 2;
c) 2 - 2 - 2 - 1 - 1;
d) 2 - 1 - 2 - 1 - 2;
e) 2 - 2 - 1 - 1 - 1;
[E]
1210. Uma pessoa ao ser transportada para uma, região de alta altitude, onde a atmosfera é rarefeita, sofrerá:
a) aumento do número de leucócitos;
b) diminuição do número de plaquetas;
c) aumento do número de hemáceas;
d) aumento do número de plaquetas;
e) a pessoa nada sofrerá.
[C]
1211. Todos os seres vivos mantêm um ambiente interno estável, mesmo quando as condições ambientais externas apresentarem var iações. Essa estabilidade,
denominada _____I_____, é garantida por um conjunto de reações químicas ordenadas, que constituem o _____II_____. Assim, cada ser vivo mantém a sua própria
vida e, através do processo de _____III_____, garante a sobrevivência de sua espécie.
Assinale a alternativa que contém os termos que preencham, corretamente, as lacunas I, II e III.
a) I = metabolismo;
II = homeostase;

176
III = reprodução
b) I = metabolismo;
II = reação a estímulos do ambiente;
III = reprodução
c) I = reação a estímulos do ambiente;
II = reprodução;
III = adaptação
d) I = homeostase;
II = metabolismo;
III = reprodução
e) I = homeostase;
II = reprodução;
III = adaptação
[D]
1212. A manutenção da estabilidade do ambiente fisiológico interno de um organismo é exercida por diversos órgãos. Por exempl o, os rins são responsáveis, entre
outras coisas, pela estabilidade dos níveis de sais, água e açúcar do sangue. Assinale a opção que indica corretamente o nome do mecanismo referido anteriormente:
a) Homeotermia. b) Homeostase. c) Organogênese.
d) Ontogenia. e) Etologia.
[B]
1213. As brânquias em peixes ósseos marinhos, além da função respiratória, têm papel excretor e osmorregulador. A respeito das adaptações de peixes ósseos
marinhos ao meio em que vivem, podemos afirmar que:
a) bebem água salgada, que é absorvida no intestino, e eliminam o excesso de sais pelas brânquias.
b) eliminam, pelas brânquias, grandes quantidades de água e o excesso de sais.
c) absorvem água salgada pelas brânquias e eliminam o excesso de sais por essas estruturas.
d) acumulam altas taxas de uréia no sangue e a eliminam gradativamente pelas brânquias.
e) eliminam grandes quantidades de água pelo intestino e eliminam o excesso de sais pelas brânquias.
[A]
1214. As afirmativas a seguir são relacionadas aos mecanismos termorreguladores presentes em seres homeotérmicos:
I - A manutenção da temperatura corpórea é importante, porque a hipotermia e a hipertermia causam avarias no funcionamento enzimático.
II - Em baixas temperaturas ambientais, a vasodilatação periférica diminui o fluxo sanguíneo, implicando o aquecimento das partes externas do corpo, que passam calor
para os tecidos internos.
III - Em altas temperaturas ambientais, um fator básico de regulação é a sudorese, pois a água do suor evapora, retirando calor da pele, o que não permite que a
temperatura do corpo se eleve muito.
Assinale a(s) afirmativa(s) correta(s):
a) Apenas I,
b) Apenas I e I;
c) Apenas I e III.
d) Apenas II e III.
e) I, II e III.
[C]
1215. Observe o desenho a seguir e assinale a alternativa que preenche corretamente os espaços da frase a seguir.

A organela indicada no desenho é o ............., responsável pela eliminação do excesso de ............. que entra por ............. em uma célula que vive em um m eio .............
em relação ao seu citoplasma.
a) vacúolo pulsátil; água; osmose; hipotônico.
b) vacúolo digestivo; sais minerais; osmose; hipertônico.
c) vacúolo pulsátil; água; transporte ativo; hipertônico.
d) vacúolo digestivo; sais minerais; difusão; hipertônico.
e) vacúolo pulsátil; sais minerais; transporte ativo; hipertônico.
[A]
1216. Qual das seguintes alternativas apresenta apenas animais homeotérmicos?
a) Tucano, jacaré, jararaca.
b) Peru, capivara, tamanduá.
c) Lagartixa, morcego, tatu.
d) Perereca, sabiá, tartaruga.
e) Peixe-boi, coelho, camaleão.
[B]
1217. A vantagem dos animais homeotermos em relação aos pecilotermos está em que os primeiros:
a) mantêm temperaturas sempre mais baixas que aquelas temperatura do meio.
b) mantêm temperaturas sempre mais altas que aquelas temperatura do meio.
c) podem variar sua temperatura corporal de acordo com a necessidade.
d) mantêm a temperatura do corpo constante, favorecendo o metabolismo.
e) quando as temperaturas são muito baixas, elevam a temperatura corporal.
[D]
1218. Os animais a seguir representados são bastante diferentes na sua aparência, mas apresentam várias características comuns.

177
Entre essas características NÃO se inclui
a) fecundação interna.
b) homeotermia.
c) oviparidade.
d) respiração pulmonar.
[B]
1219. O gráfico a seguir representa como um determinado tipo de animal reage às variações de temperatura do ambiente. Para manifestar essa reação, seu corpo lança
mão de mecanismos fisiológicos diferenciados em locais de clima quente e de clima frio.

Assinale a opção que apresenta corretamente os mecanismos fisiológicos adequados a cada uma das situações.
a) CLIMA QUENTE - contração dos vasos sangüíneos superficiais.
CLIMA FRIO: eriçamento de pêlos e penas.
b) CLIMA QUENTE - dilatação de vasos sangüíneos superficiais.
CLIMA FRIO: respiração ofegante.
c) CLIMA QUENTE: diminuição da circulação abaixo da pele.
CLIMA FRIO: tremor do corpo.
d) CLIMA QUENTE: respiração ofegante.
CLIMA FRIO: dilatação de vasos sangüíneos superficiais.
e) CLIMA QUENTE: aumento da sudorese.
CLIMA FRIO: contração dos vasos sangüíneos superficiais.
[E]
1220. As aves não possuem glândulas sudoríparas e mantêm a temperatura do corpo constante.
A estratégia adaptativa utilizada por esses animais, quando a temperatura ambiente está muito alta, é o aumento de
a) perda de água na expiração.
b) metabolismo de carboidratos.
c) quantidade de gás carbônico no sangue.
d) consumo de oxigênio.
[A]
1221. Considere as seguintes funções do tegumento dos animais em geral:
I. proteger o organismo
II. realizar trocas gasosas
III. secretar substâncias lubrificantes
IV. manter a temperatura do corpo
Com relação à pele dos vertebrados, pode-se verificar em todos os grupos
a) apenas I
b) apenas I e II
c) apenas I e III
d) apenas I, II e III
e) I, II, III e IV
[A]
1222. A adaptação dos animais a diversos ambientes fez com eles lançassem mão de diferentes mecanismos fisiológicos como modos de aproveitamento de energia.
Em relação à fisiologia animal, julgue os itens que se seguem.
(0) Nas aves e nos mamíferos, as gorduras funcionam como isolamento térmico, impedindo a perda de calor pela pele.
(1) Um dos fatores que garantem a sobrevivência dos répteis em ambientes desérticos, onde o alimento é escasso, é que eles utilizam a energia solar para o
aquecimento do corpo.
(2) As funções desempenhadas pelos sistemas digestivo, muscular e excretor, no homem, são exercidas, na ameba, pelo vacúolo digestivo, pelo vacúolo contrátil e
pelos pseudópodes, respectivamente.
(3) A taxa metabólica dos animais homeotermos é diretamente proporcional à sua massa corporal.
Itens corretos: 0 e 1
Itens errados: 2 e 3
1223. Considere os mecanismos relacionados com a manutenção da temperatura corporal do homem.
I - Relaxamento dos músculos involuntários.
II - Diminuição da taxa de metabolismo.
III - Contrações musculares involuntárias.

178
IV - Respiração ofegante.
V - Aumento da taxa de metabolismo.
Os mecanismos que permitirão manter a temperatura corporal de um homem em uma sauna, submetida a uma temperatura aci ma de 40°C são, apenas,
a) III, IV e V. b) I, II e V. c) I, II e IV.
d) I, IV e V. e) II, III e IV.
[C]
1224. Durante o verão, deparamo-nos com temperaturas ambientais muito elevadas, que provocam elevação da temperatura corporal, desencadeando respostas
reguladoras.
Escolha, entre as alternativas a seguir, a que apresenta o conjunto correto de respostas reguladoras desencadeadas pela elevação da temperatura corporal.
a) Aumento da pressão arterial e sudorese
b) Constrição das arteríolas da pele e tremores
c) Dilatação das arteríolas da pele e sudorese
d) Arritmia cardíaca e tremores
e) Diminuição da pressão arterial e tremors
[C]
1225. O gráfico abaixo refere-se à relação entre a temperatura corporal de dois grupos de animais e a temperatura do ambiente.

Com o auxílio do gráfico, julgue os itens seguintes.


(1) Algumas ordens de animais que fazem parte do grupo I apresentam fecundação externa.
(2) Do ponto de vista evolutivo, os animais do grupo II são inferiores aos do grupo I.
(3) Animais do grupo II podem possuir o corpo coberto de escamas ou de penas.
(4) No coração de animais do grupo I, ocorre mistura de sangue rico em O 2 e rico em CO2.
FVFF
1226. O gráfico a seguir mostra o consumo de oxigênio de certos animais em função da temperatura ambiente.

Exemplos de animais que apresentam curvas como a do gráfico são:


a) cavalo, sapo e papagaio.
b) baleia, onça e pintassilgo.
c) sapo, rã e tartaruga.
d) jacaré, pardal e anta.
e) cachorro, cascavel e canário.
[C]
1227. Os répteis, por dependerem do calor do meio ambiente para se aquecerem e por variar a temperatura de seus corpos conforme as variações da temperatura do
ambiente, podem ser chamados, respectivamente, de animais
a) homeotérmicos, pecilotérmicos.
b) pecilotérmicos, ectotérmicos.
c) ectotérmicos, homeotérmicos.
d) heterotérmicos, endotérmicos.
e) ectotérmicos, heterotérmicos.
[E]
1228. Reservas de carboidratos nos músculos esqueléticos ficam na forma de:
a) glicogênio. b) maltose. c) ATP.
d) sacarose. e) glicose.
[A]
1229. Nos diversos tipos de invertebrados, encontramos diferentes estruturas relacionadas com a locomoção. Associe os grupos de invertebrados com as estruturas ou
mecanismos locomotores e, depois, assinale a alternativa que apresenta a correlação CORRETA.
(I) anelídeos
(II) celenterados
(III) equinodermos
(IV) insetos voadores
(1) asas, geralmente membranosas
(2) esqueletos hidrostático
(3) musculatura esquelética
(4) sistema ambulacral

179
a) I - 4; III - 3
b) II - 2; IV - 4
c) I - 2; III - 4
d) II - 3; III - 1
e) I - 4; IV – 1
[C]
1230. Considere os tipos de fibras musculares e as ações a seguir:
I. cardíaca
II. estriada
III. lisa
a) contração involuntária e lenta.
b) contração voluntária, em geral vigorosa.
c) contração involuntária e rápida.
Assinale a alternativa que associa corretamente os tipos de fibras musculares com sua respectiva ação.
a) Ia, IIb, IIIc b) Ia, IIc, IIIb c) Ib, IIc, IIIa
d) Ic, IIa, IIIb e) Ic, IIb, IIIa
[E]
1231. Associar os músculos com as funções que desempenham,
A - bíceps
B - costureiro
C - trapézio
D - deltoide
E - tríceps
I - movimenta a perna para a frente
II - sua contração levanta o braço
III - flexiona o antebraço sobre o braço
IV - sua contração levanta o ombro
V - sua contração distende o antebraço
Assinale a resposta cuja associação está correta:
a) A - I / B - II / C - III / D - V / E - IV
b) A - II / B - V / C - I / D - III / E - IV
c) A - III / B - I / C - IV / D - II / E - V
d) A - V / B - III / C - II / D - IV / E - I
e) A - IV / B - II / C - I / D - III / E – IV
[C]
1232. As afirmações a seguir, referem-se aos três tipos de tecido muscular humano.
I - Todos apresentam as miofibrilas, que são estruturas protéicas com capacidade de contração.
II - Como conseqüência da contratilidade, esses tecidos apresentam células com grande quantidade de mitocôndrias.
III - Actina e miosina são as proteínas responsáveis pela contração desses tecidos, num processo que necessita da presença de íons cálcio e magnésio.
Assinale:
a) se todas estiverem corretas.
b) se apenas I e II estiverem corretas.
c) se apenas I e III estiverem corretas.
d) se apenas II e III estiverem corretas.
e) se apenas III estiver correta.
[A]
1233. Reservas de carboidrato nos músculos ficam na forma de
a) glicogênio. b) lactose. c) amido.
d) sacarose. e) glicose.
[A]
1234. No processo de contração e relaxamento muscular, o elemento mineral mais diretamente presente é o:
a) cálcio b) iodo c) mercúrio d) ferro
[A]
1235. Considere a figura a seguir. O animal nela representado locomove-se da mesma maneira que

a) um peixe. b) um caracol. c) uma planária.


d) um camarão. e) uma medusa.
[E]
1236. Os "canhoneiros", como são chamados os chutadores mais potentes, constituem um pequeno e seleto grupo entre os jogadores de futebol. A velocidade de
contração do sistema muscular dos "canhoneiros" é extremamente alta. Eles já nasceram com músculos super-rápidos, embora um bom programa de treinamento possa
aumentar consideravelmente a potência de um jogador de chute médio, bem como de qualquer atleta.
SUPERINTERESSANTE, 1988.
Considerando essas informações, julgue os itens que se seguem.
(1) A potência do chute depende da quantidade de terminações nervosas em cada grupo de células musculares.
(2) O mesmo tipo de célula muscular que proporciona o chute é encontrado também no músculo cardíaco.
(3) O volume das fibras musculares aumenta com uma atividade muscular de esforço.
(4) Alguns músculos, quando se está dormindo, mantêm-se em um estado de pequena contração.
CECC

180
1237. "... diz com que pernas eu devo seguir ... se na bagunça do teu coração, meu sangue errou de veia e se perdeu ..." (trecho da letra da m úsica "Eu Te Amo", de
Chico Buarque).
Neste poema, Chico Buarque cita vários componentes do corpo humano. Considerando aspectos histológicos, é correto afirmar:
( ) Para que as pernas se movimentem é necessária a atuação do sistema nervoso.
( ) Os vasos sangüíneos são revestidos internamente pelo endotélio, um tecido epitelial de revestimento que possui uma única camada de células, facilitando a troca
de nutrientes e catabólitos entre o sangue (na região dos capilares) e os tecidos.
( ) O tabagismo contribui para o surgimento de patologias cardíacas e também pode modificar o epitélio das vias respiratórias.
( ) O sangue é um importante meio de transporte para hormônios, os quais atuam no controle de secreção de várias glândulas.
( ) A realização de um movimento útil, como caminhar, só é possível porque a musculatura estriada esquelética é unida ao esqueleto.
( ) As células do sangue relacionadas com o processo de defesa do organismo são os leucócitos. Os eritrócitos participam do transporte de gases e hormônios no ser
humano.
VVVVVF
1238. Um animal que só possui musculatura longitudinal e que usa a pressão hidrostática do líquido pseudocelomático como antagonista da musculatura pode ser uma
a) minhoca. b) lombriga. c) planária.
d) anêmona. e) estrela-do-mar.
[B]
1239. O elemento químico fundamental no processo de contração e relaxamento muscular é o:
a) mercúrio b) cálcio c) enxofre d) argônio
[B]
1240. "Só uma pessoa com bom condicionamento cardiovascular terá energia suficiente para suportar uma carga de exercícios de musculação", diz o professor Ney
Pereira, coordenador do Curso de Pós-Graduação em Educação Física e Fisioterapia da Universidade Gama Filho - RJ."
Sobre o assunto, é correto afirmar:
01) No adulto, o músculo estriado cardíaco, quando lesado, é regenerado a partir do tecido epitelial adjacente, o qual tem gr ande capacidade de regeneração.
02) O oxigênio que o organismo recebe durante a realização de atividade física é distribuído pelo sangue através do plasma sa ngüíneo.
04) A contração do músculo estriado cardíaco é importante para que o sangue circule no interior dos vasos.
08) O músculo estriado esquelético, muito trabalhado nas academias para a obtenção de um melhor resultado estético, depende d o sistema nervoso para se contrair.
16) No caso de um atleta, além da atividade física, uma alimentação equilibrada se faz necessária. Os nutrientes encontrados nos alimentos ingeridos são absorvidos
pelos vasos sangüíneos do tecido epitelial de revestimento do intestino.
32) Para que um indivíduo consiga realizar exercícios de musculação, a estrutura óssea é muito importante, pois o esqueleto é um conjunto de estruturas rígidas em que
se ligam as fibras do músculo estriado cardíaco.
64) As glândulas sudoríparas, responsáveis pela excreção do suor, são importantes durante a atividade física, pois eliminam do organismo resíduos metabólicos e
ajudam a manter constante a temperatura corpórea.
FFVVFFV
1241. Reservas de carboidratos no fígado ficam na forma de:
a) amido. b) glicogênio. c) sacarose.
d) lactose. e) glicose.
[B]
1242. Com o título "Boca Livre", a Revista Veja, Edição 1928, Ano 26, nŽ 30, de 28 de julho de 1993, página 55, publicou artigo sobre uma nova droga ainda em testes,
o Orlistat, desenvolvido pelo laboratório Hoffmann-La Roche. A reportagem diz que essa droga "...bloqueia (uma fatia dessas) enzimas, impedindo que elas desdobrem
as enormes moléculas de gordura em fragmentos menores. Assim, a gordura não tem como atravessar as paredes do intestino e não chega à corrente sangüínea." As
enzimas que o Orlistat bloqueia correspondem às:
a) proteases. b) lipases. c) amilases.
d) lactases. e) peptidases.
[B]
1243. Os animais, salvo raras exceções, alimentam-se a partir da incorporação do material nutriente através do sistema digestivo. Quanto a esse processo, no homem, é
incorreta a afirmação:
a) A saliva amolece os alimentos e inicia a quebra do amido com auxílio da ptialina.
b) A digestão de proteínas inicia-se no estômago, por ação da pepsina.
c) Os sais biliares emulsionam as gorduras, facilitando a ação das lipases.
d) O suco intestinal, composto por diversas enzimas, quebra o alimento em molécula simples, para que possam ser absolvidas.
e) As moléculas são absorvidas no intestino grosso, que apresenta vilosidades e microvilosidades celulares, que aumentam a ár ea de absorção.
[E]
1244. No processo digestivo, as moléculas orgânicas devem ser quebradas em moléculas mais simples para que possam ser absorvidas. Dentre elas, o a mido é um
carboidrato:
a) cuja digestão inicia na boca por ação da ptialina.
b) digerido pela lipase no duodeno.
c) que forma um complexo vitamínico que é absorvido, sem digestão, na região do intestino delgado.
d) extremamente simples e, por isso absorvido, sem alterações, na região do intestino delgado.
e) digerido no estômago por ação do ácido clorídrico.
[A]
1245. Uma das doenças mais comuns entre as tripulações que participaram das grandes navegações apresenta, como sintomas, hemorragia nas muc osas, sob a pele e
nas articulações. Essa doença, causada pela falta de vitamina C, é conhecida como:
a) beribéri. b) anemia. c) escarlatina.
d) escorbuto. e) raquitismo.
[D]
1246. Com relação às cáries dentárias, pode-se dizer que:
a) todas as cáries produzem, inicialmente, sensações dolorosas que tendem a desaparecer à medida que a destruição atinge a de ntina.
b) uma vez instaladas, é aconselhável o uso do fio dental no seu tratamento.
c) é o resultado de interação entre dente, bactérias patogênicas e dieta alimentar.
d) sua evolução não afeta outras partes do organismo.
e) as cáries que se instalam em dentes da primeira dentição não necessitam ser tratadas, uma vez que esses dentes serão substituídos pelos dentes da dentição
permanente.
[C]
1247. As________ são compostos formados por ________unidos (as) por ligações ________e as _______são ________ orgânicos, de natureza _______sensíveis às
variações de temperatura.
Os termos que corretamente preenchem as lacunas são, respectivamente,
a) gorduras - proteínas - peptídicas - enzimas - açúcares - lipídica.
b) proteínas - aminoácidos - energéticas - gorduras - compostos - protéica.
c) proteínas - aminoácidos - peptídicas - enzimas - catalisadores - protéica.
d) enzimas - aminoácidos - hídricas - proteínas - catalisadores - lipídica.
e) proteínas - açúcares - protéicas - enzimas - açúcares - enzimática.

181
[C]
1248. Além de sua função digestiva, o pâncreas atua ativamente na coordenação hormonal, já que é também uma glândula endócrina. Assinale a opção que apresenta
respectivamente os papéis digestivo e de coordenação.
a) Emulsão de gorduras e liberação de aldosterona.
b) Liberação de pepsina e produção de gastrina.
c) Acidificação do quimo e liberação de tripsina.
d) Desaminação de aminoácidos e produção de insulina.
e) Desdobramento do amido e produção de glucagon.
[E]
1249. Em 16/08/94 o jornal FOLHA DE SÃO PAULO apresentou uma reportagem sobre a vitamina A. O artigo dava destaque às conseqüência benéficas de suplemento
periódico dessa vitamina. Porém abordava, também, problemas causados pela ingestão excessiva da mesma, e doenças provenientes de sua ingestão deficitária.
A vitamina A, por sua "natureza química", armazena seu excesso ingerido em determinado "órgão" do corpo humano gerando problemas or gânicos, bem como sua falta
acarreta "problemas carenciais".
Com base na afirmação destacada, assinale a opção correta que relaciona, respectivamente, a natureza química, o órgão acumulador do excesso e a hipovitaminose
(problema carencial), correspondentes a esta vitamina.
a) lipossolúvel, fígado e cegueira noturna.
b) lipossolúvel, baço e bócio endêmico.
c) lipossolúvel, pâncreas e escorbuto.
d) hidrossolúvel, pâncreas e beriberi.
e) hidrossolúvel, fígado e raquitismo.
[A]
1250. A carência de vitaminas representadas por I, II e III produz avitaminoses cujos sintomas são, respectivamente, escorbuto, raquitismo e cegueira noturna. Que
alternativa apresenta as vitaminas correspondentes aos números I, II e III?
a) I - vit. C ,II - vit. D, III - vit. E
b) I - vit. E ,II - vit. B, III - vit. A
c) I - vit. C ,II - vit. D, III - vit. A
d) I - vit. A ,II - vit. B, III - vit. E
e) I - vit. C ,II - vit. B, III - vit. A
[C]
1251. Enzimas que atuam em pH alcalino sobre gorduras, em pH neutro sobre carboidratos e em pH ácido sobre proteínas podem ser encontradas, respectivamente:
a) no pâncreas, na boca e no estômago.
b) no pâncreas, na vesícula biliar e no estômago
c) na vesícula biliar, na boca e no duodeno.
d) na boca, no pâncreas e no estômago.
e) no pâncreas, na boca e no duodeno.
[A]
1252. Após uma cirurgia de emergência, devido à presença de grande quantidade de cálculos biliares, uma pessoa teve retirada a sua vesícula biliar. Portanto, pode-se
esperar que
a) a bile passará a ser lançada diretamente na corrente sangüínea.
b) a secreção da bile será feita de forma contínua, não se restringindo aos períodos de digestão.
c) não haverá mais produção da bile.
d) o emulsionamento das gorduras ficará a cargo apenas das lipases do suco pancreático e do suco entérico.
e) o emulsionamento das gorduras ocorrerá no jejuno, local da liberação da bile.
[B]
1253. Realizou-se um experimento com quatro tubos de ensaio. Colocou-se:
tubo I: ptialina + amido;
tubo II: colocou-se ptialina + sacarose;
tubo III: colocou-se pepsina + manteiga e
tubo IV: colocou-se pepsina + carne + HCØ.
Deve-se observar digestão somente nos tubos
a) I e II b) I e III c) I e IV d) II e III e) II e IV
[C]
1254. Para demonstrar experimentalmente a digestão de proteínas no estômago de mamíferos, é mais adequado colocar um fragment o de carne com água, em um
recipiente em agitação constante e mantido a 36°C, adicionando-se APENAS
a) bicarbonato de sódio.
b) pepsina e bicarbonato de sódio.
c) pepsina e ácido clorídrico.
d) ácido clorídrico.
e) pepsina.
[C]
1255. Observe o esquema que representa a obtenção de energia por um vertebrado.
Com base nesse esquema e em seus conhecimentos sobre o assunto, é INCORRETO afirmar-se que

a) a energia produzida está armazenada na glicose.


b) a etapa 1 é extracelular.
c) a liberação de CO2 ocorre na etapa 2.
d) as etapas 1 e 2 envolvem participação de enzimas.
e) o O2 participa da formação de água na etapa 2.

182
[A]
1256. Observe o quadro a seguir.
Com base nesse quadro, é INCORRETO afirmar-se que

a) o leite de jumenta é o mais parecido com o leite humano.


b) o leite de cabra tem cerca de 3,5 vezes mais proteínas do que o leite humano.
c) o leite em pó é o que mais se assemelha ao leite de vaca.
d) o leite de vaca é o mais gorduroso.
e) os leites de vaca e de cabra são mais energéticos do que o leite humano.
[D]
1257. Observe as figuras referentes ao tubo digestivo de dois animais A e B. Em relação aos animais que apresentam esses tubos digestivos, é INCORRETO afirm ar-se
que

a) a interação com microrganismos para obtenção de energia é fundamental para o animal A.


b) o animal A é um consumidor primário.
c) o animal B pode pertencer ao terceiro nível trófico.
d) o animal B possui estruturas especializadas para matar e dilacerar suas presas.
e) os animais A e B apresentam relação de competição por alimento.
[E]
1258. Todas as afirmativas referem-se às vantagens do leite materno para os recém-nascidos, EXCETO
a) Contém anticorpos que aumentam as defesas.
b) Contém hormônios adequados ao desenvolvimento.
c) Dispensa preparação prévia.
d) Possui maior digestibilidade porque coagula em pequenos flocos.
e) Possui vitamina D e ferro em quantidade suficiente ao desenvolvimento.
[B]
1259. A pasteurização, técnica de esterilização parcial de alimentos, como o leite e os sucos industrializados, consiste em
a) aquecer a mais de 200°C, durante 15 minutos, para destruir esporos e fungos.
b) aquecer até 75°C e resfriar bruscamente, entre 0 e 2°C, visando eliminar bactérias patogênicas.
c) resfriar a 0°C, durante 15 horas, que resultará em morte de todos os tipos de vírus.
d) transformar o líquido em pasta, por centrifugação contínua e resfriada, para desnaturar proteínas tóxicas.
e) utilizar conservantes bactericidas e fungicidas os quais não alteram o sabor.
[B]
1260. Observe a figura.

Nessa figura estão representadas glândulas do sistema digestivo cuja enzima típica atua sobre um substrato que resulta num produto.
A alternativa que mostra a relação correta entre o substrato e seu respectivo produto é
a) amido e maltose.
b) gorduras e ácidos graxos.
c) lactose e galactose.

183
d) peptídeos e aminoácidos.
e) sacarose e glicose.
[A]
1261. Observe as figuras em que estão representados três grupos de seres vivos.

Indique a alternativa que apresenta o grupo de seres vivos com digestão exclusivamente intracelular.
a) apenas 1.
b) apenas 2.
c) apenas 3.
d) 1 e 2.
e) 2 e 3.
[A]
1262. Os sintomas a seguir numerados se referem aos efeitos mais marcantes da carência de algumas vitaminas no organismo huma no.
I. Deformação no esqueleto e anomalias da dentição.
II. Secura da camada córnea do globo ocular e deficiência visual em ambiente de luz fraca.
III. Dificuldade de coagulação do sangue.
IV. Inflamação da pele e das mucosas, com sangramento.
Esses sintomas estão associados, respectivamente, à carência das vitaminas
a) D, E, C e A b) K, A, B e D c) B, K, A e C
d) B, D, K e A e) D, A, K e C
[E]
1263. Na(s) questão(ões) a seguir escreva nos parêntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa.Tendo a figura como um elemento ilustrador,
analise as proposições apresentadas com relação à digestão nos ruminantes.

( ) Os ruminantes, entre os quais citamos bois e cabras, durante várias horas do dia apenas cortam os vegetais e os engol em sem mastigação.
( ) Na primeira câmara estomacal (rúmen), que funciona como armazenadora, ocorre uma intensa fermentação, proporcionada p or uma abundante flora bacteriana.
( ) Pouco a pouco, o alimento passa para a 2Ž câmara (retículo) onde é compactado em massas mais ou menos esféricas e, por inversão voluntária do peristaltismo
do esôfago, essas massas voltam à boca e só então demoradamente mastigadas.
( ) Numa segunda deglutição passa diretamente para a terceira câmara (Omaso ou coagulador) onde atua o suco gástrico digerindo os alimentos e parte das bactérias
simbiônticas que digerem celulose, passando o alimento para a 4Ž e última câmara - o abomaso.
( ) É no Abomaso (folhoso) que termina a digestão e onde ocorre uma intensa ação mecânica e continua a fermentação.
VVVFF
1264. Na digestão intracelular, formam-se no interior do citoplasma celular os VACÚOLOS DIGESTIVOS, que derivam da associação de:
a) fagossomas e pinossomos.
b) fagossomas e ribossomas.
c) lisossomas e orgânulos intracitoplasmáticos.
d) ribossomas e vesículas de pinocitose.
e) lisossomas e fagossomas.
[E]
1265. Através da digestão, as moléculas orgânicas, que são grandes e complexas devem ser hidrolisadas para serem absorvidas. Dentre elas, o amido é um
carboidrato:
a) cuja digestão começa na boca pela ação da lipase salivar.
b) formado por cerca de 30.000 moléculas de glicose, do mesmo tamanho que o glicogênio e a celulose.
c) que forma um complexo, que é absorvido pelo intestino delgado, depois da combinação.
d) digerido pela amilase salivar, na primeira etapa, produz maltose que, pela ação da maltase, produz 2 moléculas de glicose.
e) digerido no estômago pela ação do ácido gástrico e carboidratases diversas.
[D]
1266. A desnutrição ou a subnutrição infantil é um grave problema de saúde pública, principalmente em países subdesenvolvidos, porque ela provoca a carência de
algumas substâncias que são essenciais ao organismo humano, entre elas as vitaminas. Analise as proposições a seguir relacionadas a algumas vitaminas, suas
funções, suas fontes usuais e as doenças causadas por suas deficiências.
I) O ácido fólico age sobretudo na síntese de nucleoproteínas e sua deficiência causa danos principalmente no processo de maturação das hemácias, levando à anemia.
As frutas cítricas representam a única fonte natural de ácido fólico.
II) O caroteno atua na formação de pigmentos visuais e na manutenção estrutural dos epitélios. É sintetizado principalmente por enterobactérias e sua deficiência leva à
cegueira noturna e ao ressecamento da pele.

184
III) A vitamina D age no desenvolvimento dos ossos e é obtida principalmente de óleo de peixes, fígado e leite e também pela ação da luz solar sobre a pele. Sua
deficiência provoca o raquitismo.
a) Apenas a I é verdadeira.
b) Apenas II é verdadeira.
c) Apenas a III é verdadeira.
d) Estão corretas a I e a II.
e) Estão corretas a II e a III.
[C]
1267. Na(s) questão(ões) a seguir escreva no espaço apropriado a soma dos itens corretos.Nos últimos anos, tem sido crescente o uso indiscriminado de medicamentos
à base de vitaminas. Sobre essas substâncias reguladoras do metabolismo é correto afirmar que:
01. o excesso de vitaminas hidrossolúveis pode trazer problemas porque se acumulam no organismo atingindo níveis de toxicidade;
02. as vitaminas lipossolúveis dissolvem-se bem em gorduras e não se acumulam no organismo;
04. são lipossolúveis as vitaminas A, D, E e K;
08. normalmente, não há a menor necessidade de tomar medicamentos à base de vitaminas quando o indivíduo recebe uma dieta var iada, com carne, leite, legumes,
verduras e frutas;
16. as vitaminas D e K são utilizadas para retardar o envelhecimento, pois funcionam como antioxidantes, reparando, assim, os danos causados pelos radicais livres.
08 + 04 = 12
1268. Quando uma célula fagocita uma partícula:
a) a digestão das substâncias fagocitadas ocorre por meio de um processo exógeno à célula em estruturas chamadas de desmossom os
b) há formação de pseudópodes contendo enzimas proteolíticas e ácidos nucléicos
c) a digestão das substâncias fagocitadas é feita pelas enzimas encontradas nos lisossomos
d) a digestão das substâncias fagocitadas ocorre no retículo endoplasmático rugoso com a participação dos ribossomos
[C]
1269. Indique a opção que contenha, apenas, enzimas digestivas liberadas pelo pâncreas:
a) amilase, pepsina b) tripsina, quimotripsina
c) pepsina, tripsina d) lactase, amilase
[B]
1270. Relacione a coluna 1 com a coluna 2, relativas às vitaminas e seus efeitos carenciais:
Coluna 1
I. Vitamina "A"
II. Vitamina "D"
III. Vitamina "B"
IV. Vitamina "C"
Coluna 2
( ) xeroftalmia
( ) polineurite
( ) raquitismo
( ) escorbuto
Indique a opção que contenha, na coluna 2, a sua correlação com a coluna 1, de cima para baixo:
a) I, II, III e IV
b) I, III, II e IV
c) III, I, II e IV
d) IV, I, II e III
[B]
1271. Uma pessoa que tenha sofrido uma cirurgia para retirada do estômago deverá ter prejuízo, principalmente, na digestão de :
a) proteínas. b) amido. c) lipídios.
d) ácidos nucléicos. e) vitaminas.
[A]
1272. Num experimento, foram montados 3 tubos de ensaio conforme o esquema a seguir. Sabendo-se que a catalase é uma enzima presente no fígado, que acelera a
reação de quebra da água oxigenada em água e oxigênio, assinale a alternativa ERRADA.

a) O tubo A apresentará um borbulhamento, indicativo da liberação de oxigênio.


b) No tubo B não haverá borbulhamento, pois a fervura do fígado desnaturou a catalase presente.
c) No tubo C não haverá borbulhamento, pois a alteração de pH também pode desnaturar as enzimas.
d) O aumento da quantidade de água oxigenada no tubo A será sempre acompanhado do aumento na velocidade da reação.
e) Se o fígado do tubo A estiver triturado, a reação será mais intensa, pois haverá maior superfície de contato entre a enzim a e o seu substrato.
[D]
1273. O alimento, no sistema digestivo humano, percorre os seguintes órgãos, antes de chegar ao intestino delgado:
a) faringe - laringe - diafragma - estômago
b) boca - faringe - esôfago - estômago
c) boca - traquéia - fígado - intestino grosso
d) faringe - esôfago - pâncreas - fígado
e) esôfago - vesícula biliar - fígado – estômago
[B]
1274. Com relação às vitaminas, assinale a alternativa CORRETA:
a) a vitamina K é encontrada em vegetais folhosos e no alho, mas também é sintetizada naturalmente pela flora bacteriana do intestino delgado.
b) todas as vitaminas são substâncias orgânicas que pertencem ao grupo das aminas.
c) uma das funções da vitamina A é aumentar a absorção intestinal de cálcio e fosfato.

185
d) cegueira noturna é um sintoma característico de deficiência de vitamina B1 (tiamina).
e) a beribéri, uma espécie de neurite, é causada pela deficiência da vitamina E.
[A]
1275. No sistema digestivo de mamíferos, uma das funções do suco pancreático é:
a) neutralizar a acidez do alimento que chega ao estômago.
b) emulsificar as gorduras para torná-las solúveis.
c) converter as gorduras em ácidos graxos e glicerol.
d) decompor proteínas e carboidratos pela ação da lipase pancreática.
e) facilitar a digestão do bolo alimentar pelas enzimas da bile.
[C]
1276. Em uma amostra retirada do tubo digestivo de uma pessoa que se alimentara há duas horas, foram encontrados lipídios, peptídios e maltose, em pH baixo. Pode-
se concluir que o material foi coletado
a) da boca. b) do esôfago. c) do duodeno.
d) do estômago. e) do intestino grosso.
[D]
1277. Em qual das alternativas a seguir as três funções mencionadas são realizadas pelo fígado?
a) Regular o nível de glicose no sangue, transformar amônia em uréia, produzir bile.
b) Regular o nível de glicose no sangue, transformar amônia em uréia, secretar quimotripsina.
c) Regular o nível de glicose no sangue, produzir ácido clorídrico, secretar quimotripsina.
d) Produzir bile, transformar amônia em uréia, produzir ácido clorídrico.
e) Produzir bile, produzir ácido clorídrico, secretar quimotripsina.
[A]
1278. Os meios de comunicação, recentemente, divulgaram que a venda de carne para a população caiu em 60%, sem haver aumento no consumo de aves e peixes.
Este fato é preocupante porque indica que foi reduzida a ingestão de nutrientes com função plástica, que são:
a) glicídios b) lipídios c) vitaminas
d) sais minerais e) proteínas
[E]
1279. A energia que usamos para realizar os movimentos provém da degradação dos alimentos que ingerimos. Entre os nutrientes que ingerimos, indique o mais
utilizado na produção desta energia:
a) proteína; b) carboidrato; c) lipídio;
d) sais minerais; e) água.
[B]
1280. As crianças que vivem nas regiões afetadas pela seca são as maiores vítimas da FOME, pois as proteínas, os minerais e as vitaminas, de que necessitam para
crescer e repor as energias gastas, estão praticamente ausentes de sua dieta alimentar.
Assinale a alternativa que apresenta doenças causadas, respectivamente, pela falta de FERRO e VITAMINA A.
a) raquitismo e anemia.
b) escorbuto e cegueira-noturna.
c) cegueira-noturna e raquitismo.
d) anemia e cegueira-noturna.
e) anemia e escorbuto.
[D]
1281. Assinale a alternativa que relaciona um alimento rico em vitamina C (ácido ascórbico)
a) arroz. b) feijão. c) carne. d) laranja. e) alface.
[D]
1282. Quais são os alimentos ricos em vitamina A (retinol e betacaroteno)?
a) arroz e feijão.
b) fígado e alface.
c) gema de ovo e cenoura.
d) macarrão e agrião.
e) camarão e sardinha.
[C]
1283. Marque a alternativa que indica o alimento mais rico em proteínas:
a) feijão b) alface c) cenoura d) carne e) arroz
[D]
1284. Qual é o alimento mais rico em calorias?
a) fígado de boi. b) agrião. c) macarrão.
d) sardinha e) feijão.
[C]
1285. É função da bile, suco produzido pelo fígado, armazenado na vesícula biliar e lançado no intestino:
a) Digerir carboidratos.
b) Emulsionar proteínas.
c) Digerir lipídios.
d) Emulsionar lipídios.
e) Digerir vitaminas.
[D]
1286. Não sofrem digestão:
a) sais minerais, água e ácidos nucléicos.
b) sais minerais, água e vitaminas.
c) sais minerais, ácidos nucléicos e proteínas.
d) água, proteínas e polissacarídeos.
e) água, proteínas e lipídios.
[B]
1287. Qual dos alimentos a seguir tem função basicamente energética?
a) mel b) bife c) cenoura d) sal e) ovo
[A]
1288. A xeroftalmia é caracterizada pela secura da camada córnea do globo ocular. A xeroftalmia é determinada por uma deficiência de vitamina:
a) A b) B c) C d) D e) E
[A]

186
1289. Entre as pessoas muito pobres, a deficiência calórica e protéica está comumente associada à deficiência de vitaminas e sais minerais . Assinale a alternativa que
indica os efeitos causados pela deficiência ou ausência das vitaminas A, D e de FERRO.
a) raquitismo, cegueira noturna, distrofia muscular.
b) raquitismo, escorbuto, hemorragia.
c) anemia, esterilidade, raquitismo.
d) cegueira noturna, hemorragia, escorbuto.
e) cegueira noturna, raquitismo, anemia.
[E]
1290. Uma determinada enzima, retirada de um órgão do aparelho digestivo de um mamífero, foi distribuída igualmente em 8 tubos de ensaio. o tipo de alimento e o pH
de cada tubo estão informados na tabela a seguir.

Os tubos de ensaio foram mantidos a 37°C e após 10 horas observou-se digestão do alimento apenas no tubo III. Com base nesses dados, é possível concluir que a
enzima utilizada e o órgão de onde foi retirada são, respectivamente,
a) amilase pancreática e intestino.
b) maltase e estômago.
c) tripsina e intestino.
d) ptialina e boca.
e) pepsina e estômago.
[E]
1291. Considere o seguinte texto:
"... o órgão responsável pela digestão (...) acha-se escondido na profundidade de nosso abdômen, bem protegido, colado na parede lá atrás (...) uma pequena massa
que pesa menos de 100 g, mas constitui um laboratório maravilhoso (...) seus sucos são tão poderosos que são capazes de atacar qualquer tipo de comida (...)"
O órgão, a que o texto se refere, é
a) o intestino delgado. b) a vesícula biliar. c) o estômago.
d) o pâncreas. e) o fígado.
[D]
1292. Tiflossole e cecos intestinais são estruturas presentes no tubo digestivo de alguns animais. Nos seres humanos, suas funções são desempenhadas:
a) pelas vilosidades e microvilosidades intestinais.
b) pelo estômago.
c) pelo fígado.
d) pela mucosa gástrica.
e) pelo esôfago.
[A]
1293. A figura a seguir indica as diversas etapas do processo que uma ameba realiza para obter alimento.

A organela que se funde ao fagossomo contém


a) produtos finais da digestão.
b) enzimas que sintetizam carboidratos.
c) enzimas digestivas.
d) enzimas da cadeia respiratória.
e) reservas energéticas.
[C]
1294. A pepsina, a bile e a tripsina são produzidas, respectivamente, pelo:
a) estômago, pâncreas e fígado
b) estômago, fígado e pâncreas
c) fígado, pâncreas e estômago
d) pâncreas, estômago e fígado
e) pâncreas, fígado e estômago
[B]
1295. Cães a que se extraíram o pâncreas passaram a apresentar sintomas similares aos do diabetes humano. Com o duto pancreático amarrado, apenas distúrbios
digestivos. A experiência nos permite concluir que:
a) o pâncreas apresenta a função de glândula digestiva com exclusividade.
b) a função primordial do pâncreas em cães é secretora.
c) tanto a função digestiva como a função hormonal são funções inerentes ao pâncreas.

187
d) o diabetes humano pode ser causado por lesões no duto pancreático.
e) o pâncreas é responsável pela produção de gastrina.
[C]
1296. A bile apresenta importância digestiva, porque:
a) seus pigmentos (bilirrubina e biliverdina) fazem hidrólise de gorduras.
b) seus pigmentos darão a cor típica das fezes.
c) cria condições, através de alcalinizações, para o bom funcionamento das enzimas pancreáticas e intestinais.
d) cria condições, através de seus sais biliares, para a tripsina emulsionar as gorduras.
e) associa suas enzimas às enzimas do pâncreas e do intestino delgado, para completar o trabalho digestivo.
[C]
1297. As enzimas atuam de forma mais eficiente quando o pH do meio é ideal.
O gráfico a seguir representa a ação de três enzimas.

Pode-se afirmar que a enzima:


a) A é produzida sob a forma de zimogênio.
b) A desdobra polissacarídeos em dissacarídeos.
c) B desdobra lipídios em ácidos graxos.
d) B é produzida sob estímulo da gastrina.
e) C inicia a digestão de protídios.
[A]
1298. Num tubo de ensaio, mantido a 37°C, foram colocados, pela ordem, suco gástrico de um animal. Mg(OH) 2 e um pedaço de carne.
Analise as seguintes afirmativas:
I - O Mg(OH)2 não interfere na reação do suco gástrico.
II - A carne não deve ser digerida pois é rica em proteínas, cuja digestão só ocorre no intestino delgado.
III - A pepsina presente no suco gástrico não irá digerir a carne, pois houve uma alteração no pH.
IV - Este tubo poderia ser mantido a qualquer temperatura, pois ela não interfere na ação de enzimas.
Está(ão) correta(s):
a) Somente a afirmativa I.
b) As afirmativas I e II.
c) Somente a afirmativa III.
d) As afirmativas III e IV.
e) As afirmativas I e IV.
[C]
1299. Considere a seguinte esquema do sistema digestivo humano.

Os órgãos que produzem enzimas digestivas que digerem proteínas são:


a) 1, 4 e 5. b) 1, 4 e 6. c) 4, 5 e 6.
d) 1, 3 e 7. e) 2, 3 e 8.
[C]
1300. A remoção de um órgão de um animal reduziu a capacidade de digerir lipídios, proteínas e amido e provocou aumento da taxa de glicose no sangue. Esse órgão é
a) a glândula adrenal. b) o pâncreas. c) a tireóide.
d) a paratireóide. e) a hipófise.
[B]
1301. A digestão dos Poríferos (esponjas) é intracelular e realizada por células chamadas
a) arqueócitos. b) porócitos. c) coanócitos.
d) pinacócitos. e) amebócitos.
[C]
1302. O amido é um carboidrato presente no pão, no macarrão, na batata e nas massas em geral. A digestão desse polissacarídeo
a) inicia-se na boca, pela ação da amilase salivar, e termina no estômago, com a ação do suco gástrico.
b) tem início e término na boca, com a ação da amilase salivar.
c) inicia-se na boca, com a ação da amilase salivar, e termina no intestino delgado, com a ação da amilase pancreática.
d) inicia-se na boca, com a ação da amilase salivar, e termina no estômago, com a ação da amilase pancreática.
e) inicia-se na boca, com a ação da amilase salivar, e termina no pâncreas, com a ação da amilase pancreática.
[C]

188
1303. Os fenilcetonúricos têm falta de uma enzima do fígado responsável pelo metabolismo do aminoácido fenilalanina. Para que essa substância não se acumule no
sangue, sua dieta alimentar deve restringir, dentre os nutrientes mencionados a seguir,
a) as proteínas apenas.
b) os carboidratos apenas.
c) as gorduras apenas.
d) as gorduras e os carboidratos.
e) as gorduras e as proteínas.
[A]
1304. A comunicação da vesícula biliar com o intestino delgado é feita pelo ducto biliar, que libera a bile. Se por algum motivo houver uma obstrução do ducto biliar, o
que poderá ocorrer?
a) A pepsina perderá sua atividade.
b) A digestão dos carboidratos ocorrerá mais rapidamente.
c) Produzirá uma alcalinização do intestino.
d) A digestão dos lipídios será mais lenta.
e) Haverá mais tripsina atuando sobre os lipídios.
[D]
1305. A bile, produzida pelo fígado, tem como função
a) lubrificar a mucosa intestinal.
b) emulsionar as gorduras.
c) digerir as proteínas.
d) provocar a contração da vesícula biliar.
e) estimular a secreção gástrica.
[B]
1306. Observe as funções a seguir:
I - Estimula a síntese do colágeno
II - Estimula a migração química
III - Facilita a absorção do ferro
IV - Participa da fosforilação oxidativa
V - Aumenta a disponibilidade energética
Indique a opção que contém a vitamina detentora de todas as funções anteriores:
a) vitamina K b) vitamina D
c) vitamina B12 d) vitamina C
[D]
1307. As enzimas tripsina, ptialina e lipase, têm, respectivamente, como substrato:
a) proteína, gordura e carboidrato
b) gordura, carboidrato e proteína
c) proteína, carboidrato e gordura
d) carboidrato, proteína e gordura
[C]
1308. Os esquemas a seguir mostram as quantidades relativas de proteínas (P) e de lipídios (L) em diversos tipos de carnes.

Uma pessoa com colesterol elevado deve abster-se de ingerir


a) frango e ganso.
b) frango e porco.
c) ganso e porco.
d) frango e coelho.
e) porco e coelho.
[C]
1309. Graças à nutrição, o ser vivo faz a reconstrução das partes desgastadas e forma também novas células no interior do cor po durante o período de crescimento.
Esse processo é conhecido como crescimento por:
a) intuscepção. b) aposição. c) deposição.
d) fermentação. e) catabolismo.
[A]
1310. O esquema a seguir representa interações hormonais que auxiliam na liberação de secreções no sistema digestivo humano.

189
Assinale a única opção que NÃO está de acordo com o processo digestivo no homem.
a) A colecistocinina desencadeia o esvaziamento da vesícula biliar no duodeno.
b) A secretina estimula a liberação do suco pancreático no duodeno.
c) A gastrina propicia o aumento das secreções gástricas com seu conteúdo proteolítico.
d) A vesícula biliar libera suas enzimas lipolíticas estimulada pela colecistocina.
e) O pâncreas, estimulado pela secretina, possibilita a alcalinização do intestino delgado.
[D]
1311. Leia o texto a seguir, escrito por Jons Jacob Berzelius em 1828.
"Existem razões para supor que, nos animais e nas plantas, ocorrem milhares de processos catalíticos nos líquidos do corpo e nos tecidos. Tudo indica que, no futuro,
descobriremos que a capacidade de os organismos vivos produzirem os mais variados tipos de compostos químicos reside no poder catalítico de seus tecidos." A
previsão de Berzelius estava correta, e hoje sabemos que o "poder catalítico" mencionado no texto deve-se
a) aos ácidos nucléicos.
b) aos carboidratos.
c) aos lipídios.
d) às proteínas.
e) às vitaminas.
[D]
1312. Esta tabela mostra o teor de proteínas, carboidratos e lípides em alguns alimentos, expresso em gramas por 100g de peso seco.

Com base nos dados da tabela, assinale a alternativa que contém a dieta mais adequada para um jogador de futebol antes de uma competição.
a) Arroz com farinha de mandioca.
b) Arroz com toucinho.
c) Carne seca com farinha de mandioca.
d) Carne seca com toucinho.
[A]
1313. Esta tabela refere-se ao teor de minerais e vitaminas, expressos em mg por 100g de parte comestível de alguns alimentos.

Com base nos dados dessa tabela, assinale a alternativa que contém uma recomendação alimentar INADEQUADA.
a) Abacate para pessoas que sofrem de béri-béri.
b) Couve para alguém com osteoporose e xeroftalmia.
c) Goiaba para quem sofre de escorbuto.
d) Grão-de-bico para pessoas anêmicas.
[A]
1314. Na aula de Biologia, o professor pediu a seus alunos que analisassem a seguinte afirmação relativa à fisiologia da digestão:
"A pepsina e a tripsina são enzimas proteolíticas produzidas no estômago e atuam preferencialmente em meio ácido".
Essa afirmação
a) esta correta.
b) está incorreta, já que as duas enzimas não são proteolíticas.
c) está incorreta, já que as duas enzimas atuam preferencialmente em meio alcalino.
d) está incorreta, já que apenas a pepsina é produzida no estômago e atua preferencialmente em meio ácido.
e) está incorreta, já que apenas a tripsina é produzida no estômago e atua preferencialmente em meio ácido.
[D]
1315. O esquema a seguir apresenta partes do aparelho digestivo humano com órgãos numerados de I a V.

190
Em relação à bile, podemos afirmar corretamente que é produzida no órgão:
a) I e armazenada no órgão II.
b) I e secretada para o órgão IV.
c) I e contém enzimas que digerem as gorduras.
d) II e armazenada no órgão I.
e) II e secretada para o órgão IV.
[A]
1316. Considere as seguintes etapas da digestão.
I - Absorção de nutrientes.
II - Adição de ácido clorídrico ao suco digestivo.
III - Início da digestão das proteínas.
IV - Adição da bile e do suco pancreático ao suco digestivo.
V - Início da digestão do amido.
Dentre esses processos, ocorrem no intestino delgado apenas
a) I e IV. b) I e III. c) II e III.
d) II e IV. e) III e V.
[A]
1317. Assinale a alternativa em que há uma correspondência correta da segunda coluna com o enunciado da primeira coluna:
Primeira Coluna
I - Tem função no processo digestivo e armazena glicogênio
II - Digestão de proteínas
III - Tripsina
IV - Absorção de sais
V - Ptialina
Segunda Coluna
( ) Intestino grosso
( ) Boca
( ) Pâncreas
( ) Fígado
( ) Estômago

a) IV, II, III, I e V


b) IV, V, III, I e II
c) II, IV, III, V e I
d) V, IV, III, I e II
[B]
122. Observe os conceitos a seguir, relativos aos aspectos anatômicos de órgãos da digestão, no homem:
I - Se classificam em parótidas, sublinguais e submandibulares
II - É um canal de contrações voluntárias que desloca o alimento para o esôfago
III - Realiza movimentos peristálticos involuntários, com o objetivo de deslocar o bolo alimentar para o estômago
a) glândulas salivares, intestino e esôfago
b) língua, intestino e esôfago
c) língua intestino e faringe
d) glândulas salivares, faringe e esôfago
[D]
1318. "Cerca de 27 milhões de brasileiros têm intolerância ao leite por deficiência na produção de uma enzima do intestino."
Sobre a enzima citada no artigo, e as enzimas em geral, podemos afirmar que:
a) aumentam a energia de ativação necessária para as reações.
b) atuam de forma inversamente proporcional ao aumento da temperatura.
c) são altamente específicas em função de seu perfil característico.
d) são estimuladas pela variação do grau de acidez do meio.
e) são consumidas durante o processo, não podendo realizar nova reação do mesmo tipo.
[C]
1319. Consideram-se aminoácidos essenciais para um determinado animal, aqueles
a) de que ele necessita e sintetiza a partir de outras substâncias.
b) de que ele necessita mas não consegue sintetizar, tendo que recebê-los em sua dieta.
c) de que ele necessita apenas nas primeiras etapas de seu desenvolvimento.
d) obtidos diretamente a partir de vegetais, que são os únicos organismos a sintetizá-los.
e) resultantes da degradação de suas próprias proteínas.
[B]
1320. - Eliminação das células sangüíneas que estão velhas demais.
- Formação de uréia.
- Armazenamento de energia para qualquer eventualidade.
- Maior glândula do corpo humano.
Todas essas características típicas de um super-orgão estão relacionadas ao (à):
a) baço. b) rim. c) pâncreas.
d) fígado. e) hipófise.
[D]

191
1321. O sufocamento por alimento é responsável por quase 3.000 mortes, anualmente, nos EUA, mais do que os acidentes com armas de fogo ou aviões.
O sufocamento ocorre quando uma porção do alimento bloqueia o(a):
a) brônquio. b) esôfago. c) glote.
d) laringe. e) faringe.
[C]
1322. Muitas pessoas consomem alimentos dietéticos para perder peso. Mas podem incorrer no erro de comer um chocolate sem açúcar, rico em calorias, e engordar
sem saber. Uma portaria de maio de 1996 do Ministério da Saúde define como "diet" o alimento especialmente formulado para pessoas com necessidades específicas e
não necessariamente para emagrecer. Um leite para criança, por exemplo, pode ser dietético não pela quantidade de calorias, m as por possuir nutrientes especiais para
o desenvolvimento do bebê. "Diet" pode ser um sal sem cloreto de sódio, um pão que não contenha glúten ou um cereal enriqueci do com fibras. Ao contrário do que se
pensa, "diet" não quer dizer que o alimento seja sem açúcar. Já o produto "light" pode ter 30% a menos e gordura, açúcar ou proteína, comparado à composição normal,
mas não é específico para um tipo de necessidade, como é o "diet". Nem todos os "lights" são recomendados para diabéticos.
Com o auxílio do texto, julgue os itens seguintes.
(1) Caloria é uma unidade de medida que indica a quantidade de gordura dos alimentos.
(2) Sal "diet" sem cloreto de sódio pode ser recomendado para pessoas com pressão alta ou com determinados problemas renais.
(3) Um alimento sem fenilalanina pode ser classificado como "diet".
(4) Um produto "light" que possua glicose ou amido não é indicado para um diabético.
ECCC
1323. Qual cirurgia comprometeria mais a função do sistema digestório e por quê: a remoção dos vinte e cinco centímetr os iniciais do intestino delgado (duodeno) ou a
remoção de igual porção do início do intestino grosso?
a) A remoção do duodeno seria mais drástica, pois nele ocorre a maior parte da digestão intestinal.
b) A remoção do duodeno seria mais drástica, pois nele ocorre a absorção de toda a água de que o organismo necessita para sobreviver.
c) A remoção do intestino grosso seria mais drástica, pois nele ocorre a maior parte da absorção dos produtos do processo digestório.
d) A remoção do intestino grosso seria mais drástica, pois nele ocorre a absorção de toda a água de que o organismo necessita para sobreviver.
e) As duas remoções seriam igualmente drásticas, pois, tanto no duodeno quanto no intestino grosso, ocorrem digestão e absorç ão de nutrientes e de água.
[A]
1324. Algumas pessoas se submetem a uma cirurgia de diminuição do estômago, como auxiliar no processo de emagrecimento. Esse procedimento tem como
finalidade:
a) a diminuição da digestão de gorduras e carboidratos, processo que ocorre nesse órgão.
b) a diminuição da superfície de absorção de nutrientes.
c) fazer com que o indivíduo se sinta saciado com menor quantidade de alimento.
d) aumentar a velocidade dos movimentos peristálticos, eliminando mais rápido o bolo fecal.
e) alterar o pH do meio, dificultando a digestão total do alimento.
[C]
1325. A ____________ é uma enzima proteolítica do ___________ que surge a partir de um precursor, _______________, quando em meio_________.
Assinale a opção que completa perfeitamente as lacunas da sentença anterior.
a) pepsina, suco gástrico, pepsinogênio, ácido.
b) ptialina, suco gástrico, amilase salivar, ácido.
c) gastrina, suco gástrico, glicogênio, ácido.
d) mucina gástrica, estômago, pepsinogênio, básico.
e) amilase pancreática, intestino, amilase salivar, básico.
[A]
1326. A figura ilustra um modelo do sistema "chave-fechadura", onde observamos enzima, substrato e produto do sistema digestivo humano.

a) Se o substrato fosse uma proteína que estivesse sendo degradada no estômago, qual seria a enzima específica e o produto obtido neste órgão?
b) Se a digestão de um determinado alimento ocorresse no intestino delgado e os produtos obtido fossem glicerol e ácidos grax os, quais seriam, respectivamente, o
substrato e a enzima?
a) Enzima do suco gástrico: Pepsina. A degradação de proteínas no estômago resulta em moléculas menores denominadas peptídeos. Após a digestão dos peptídeos
no intestino delgado formam-se os aminoácidos que podem ser absorvidos e utilizados pelo organismo.
b) Substrado: Lipídios
Enzima: Lipase pancreática e Lipase entérica.
1327. Os músculos envolvidos no deslocamento do corpo e nos movimentos do sistema digestivo são, respectivamente, dos tipos
a) estriado e liso.
b) esquelético e estriado.
c) liso e estriado.
d) liso e esquelético.
e) estriado cardíaco e liso.
[A]
1328. Comparando-se o aparelho digestivo dos mamíferos herbívoros - como, por exemplo, a cabra - com o aparelho digestivo dos mamíferos carnívoros, observa-se
geralmente
a) presença de maior número de dentes e de rúmen.
b) presença de dentes mais aplanados e de rúmen.
c) presença de menor número de dentes e ausência de estômago.
d) presença de dentes mais pontiagudos e de estômago.
e) presença de dentes mais escuros e ausência de rúmen.
[B]
1329. Um médico holandês observou, no final do século XIX, que galinhas alimentadas com arroz polido, ou descascado, apresentavam os sintomas de uma doença
conhecida como beribéri, que era curada com a ingestão da película, ou casca, retirada dos grãos do arroz.
A substância necessária em pequenas quantidades na dieta para evitar o beribéri, é a vitamina denominada:
a) E b) C c) B1 d) A
[C]
1340. O aumento de peso é considerado um fator determinante do aparecimento de hipertensão arterial em crianças e adolescentes.
Todas as alternativas apresentam procedimentos recomendados para abaixar a pressão arterial, EXCETO
a) Estimular o consumo de fibras vegetais nas refeições.
b) Praticar atividades físicas regulares.

192
c) Evitar o consumo diário de carnes vermelhas.
d) Usar queijo curado em uma das refeições diárias.
[D]
1341. Na produção de compotas, devem ser adotadas algumas medidas para evitar-se a contaminação do alimento por microrganismos.
Todas as alternativas apresentam medidas que podem garantir a assepsia desse processo, EXCETO
a) A adição de conservantes, para impedir o crescimento dos microrganismos.
b) A manutenção do meio aquoso, para evitar o crescimento de bactérias.
c) A fervura, para desinfecção dos recipientes em que os doces serão guardados.
d) A retirada do ar no momento de se fechar o recipiente que contém o doce.
[B]
1342. Tomando uma grande dose de vitamina A, uma pessoa pode suprir suas necessidades por vários dias; porém, se fizer o mesmo em relação à vitamina C, não terá
o mesmo efeito, necessitando de reposições diárias dessa vitamina.
Essa diferença na forma de administração se deve ao fato de a vitamina:
a) A ser necessária em menor quantidade.
b) A ser sintetizada no próprio organismo.
c) A ser lipossolúvel e ficar armazenada no fígado.
d) C ser mais importante para o organismo.
e) C fornecer energia para as reações metabólicas.
[C]
1343. A hemorragia decorrente da ingestão de trevo doce por bovinos e ovinos se deve ao dicumarol, substância presente nesse vegetal e que exerce ação antagonista
à vitamina
a) E b) B12 c) B1 d) K
[D]
1344. A ingestão de alimentos gordurosos (frituras, por exemplo) provoca a secreção de bile, e esta promove o emulsionamento das gorduras, facilitando a ação da
lipase.
Marque a opção que contém o hormônio estimulante da secreção da bile e o órgão onde ele é produzido.
a) Hormônio: secretina; Órgão: pâncreas;
b) Hormônio: secretina; Órgão: fígado;
c) Hormônio: colecistocinina; Órgão: vesícula;
d) Hormônio: colecistocinina; Órgão: duodeno;
[D]
1345. No nosso organismo, a falta de bile no intestino delgado dificulta a digestão, principalmente de:
a) amido. b) gorduras. c) proteínas.
d) vitaminas. e) enzimas.
[B]
1346. Durante o processo de digestão de alimentos pelo homem, observa-se uma variação do pH ao longo do aparelho digestivo. Considerando essa variação, podemos
dizer que o pH:
a) na boca é ácido, no estômago é alcalino e é neutro no intestino.
b) na boca e no estômago é ácido, tornando-se próximo ao neutro do intestino.
c) na boca é alcalino, no estômago é neutro e no intestino ácido.
d) na boca é próximo ao neutro, no estômago torna-se ácido e no intestino volta a ser alcalino.
e) tende a apresentar uma tendência geral à acidificação.
[D]
1347. VITAMINAS
"Megadoses de desconfiança"
Utilização de tratamento alternativos e práticas de terapia ortomolecular provocam polêmica entre médicos.
Algumas vitaminas, entre elas o ácido ascórbico e o tocoferol ou vitamina E, são preconizadas em doses elevadas pelos defensores da chamada medicina
ortomolecular, com o objetivo de prevenir uma série de doenças provocadas, segundo eles, por um acúmulo de radicais livres no organismo.
A utilização com essa finalidade está baseada na seguinte propriedade química dos compostos citados:
a) oxidante b) redutora
c) detergente d) emulsionante
[B]
1348. A invertase é a enzima que hidrolisa a sacarose em glicose e frutose. Incubou-se, em condições adequadas, essa enzima com sacarose, de tal forma que a
concentração inicial, em milimoles por litro, do dissacarídeo fosse de 10mM. Observe os gráficos a seguir:

Aquele que melhor representa a variação das concentrações, em função do tempo de incubação, da sacarose e da glicose, é o de número:
a) 4 b) 3 c) 2 d) 1
[C]
1349. NÃO apresentam tubo digestivo completo:
a) Platelmintos. b) Nematódeos. c) Moluscos.
d) Anelídeos. e) Aracnídeos.
[A]
1350. Uma pessoa cujas glândulas gástricas não estão produzindo ácido clorídrico, certamente terá dificuldades na digestão de
a) amido. b) vegetais. c) açúcares.
d) gorduras. ) proteínas.
[E]
1351. A especificidade enzimática consiste na:

193
a) energia de ativação da enzima
b) vulnerabilidade da enzima de desnaturar-se a temperaturas altas
c) exclusividade da enzima de somente atuar em seu substrato
d) capacidade da enzima de "identificar" o pH específico que propicie a reação
[C]
1352. A celíase é uma doença caracterizada pela intolerância ao glúten presente em trigo, centeio e aveia. Nas pessoas que apresentam essa doença, o glúten provoca
a atrofia da mucosa que reveste internamente o intestino delgado, tornando-a lisa. Assinale a alternativa que descreve a(s) conseqüência(s) dessa lesão.
a) Diarréia e emagrecimento, pois a superfície de absorção de nutrientes diminui.
b) Diarréia por incapacidade de emulsionar e digerir lipídios.
c) Diarréia e desidratação por dificuldade de reabsorção de água.
d) Desnutrição por incapacidade de digestão de carboidratos e de proteínas.
e) Anemia devida à hemorragia apresentada.
[A]
1353. Ao passar pelas vilosidades do intestino delgado, o sangue de uma pessoa alimentada
a) perde gás oxigênio e ganha aminoácidos.
b) perde gás oxigênio e perde glicose.
c) ganha gás oxigênio e ganha aminoácidos.
d) ganha gás carbônico e perde glicose.
e) perde gás carbônico e ganha aminoácidos.
[A]
1354. Segundo estudo feito na Etiópia, crianças que comiam alimentos preparados em panelas de ferro apresentaram um a redução da taxa de anemia de 55 para 13%.
Essa redução pode ser explicada pelo fato de que o ferro,
a) aquecido, ativa vitaminas do complexo B presentes nos alimentos prevenindo a anemia.
b) contido nos alimentos, se transforma facilmente durante o cozimento e é absorvido pelo organismo.
c) oriundo das panelas, modifica o sabor dos alimentos, aumentando o apetite das crianças.
d) proveniente das panelas, é misturado aos alimentos e absorvido pelo organismo.
[D]
1355. Após um acidente automobilístico uma pessoa teve que se submeter a uma cirurgia que lhe removeu uma parte de seu corpo. Após a recuperação pas sou a viver
normalmente. A parte retirada era:
a) o fígado. b) o pâncreas. c) a hipófise.
d) o baço. e) o diafragma.
[D]
1356. O hormônio folículo-estimulante induz as células foliculares a liberar estrógeno, responsável pelo crescimento do endométrio. As estruturas relac ionadas com a
descrição acima são:
a) hipófise, tiróide e testículo.
b) hipófise, ovário e útero.
c) tiróide, supra-renal e útero.
d) pâncreas, ovário e supra-renal.
e) pâncreas, tiróide e testículo.
[B]
1357. Nos testes de gravidez, a substância cuja presença é pesquisada na urina é:
a) o hormônio folículo estimulante.
b) o hormônio luteinizante.
c) a gonadotrofina coriônica.
d) o estrógeno.
e) a progesterona.
[C]
1358. Glândula de grande importância na regulação endócrina geral, pois controla, direta ou indiretamente, outras glândulas, através de seus hormônios tróficos.
A frase refere-se:
a) à hipófise.
b) à tireóide.
c) às supra-renais.
d) às paratireóides.
e) ao pâncreas.
[A]
1359. O diabete insípido e o diabete melito resultam, respectivamente, da deficiência:
a) do lobo posterior da hipófise (ou do hipotálamo) e do pâncreas.
b) do pâncreas e do córtex adrenal.
c) do lobo anterior da hipófise e do córtex adrenal.
d) do pâncreas e da tiróide.
e) do lobo anterior da hipófise e do pâncreas.
[A]
1360. Qual das glândulas endócrinas relacionadas a seguir precisa de iodo como matéria prima?
a) hipófise b) adrenais c) tiróide
d) ovários e) testículos
[C]
1361. Dentre as glândulas relacionadas a seguir, a que não tem a sua secreção regulada diretamente por hormônios hipofisários é:
a) a tiróide b) as adrenais c) os ovários
d) o pâncreas e) os testículos
[D]
1362. Um paciente adulto procurou um endocrinologista porque estava com baixo peso, metabolismo basal muito alto, nervosismo e globo ocular saliente (exoftalmia). A
disfunção hormonal que poderia ser responsável pelo quadro apresentado pelo paciente envolve:
a) o pâncreas. b) a paratireóide. c) a adrenal.
d) a tiróide. e) a supra-renal.
[D]
1363. O gráfico a seguir representa as variações das concentrações plasmáticas de dois hormônios ovarianos durante o ciclo menstrual de uma mulher.

194
Quais são, respectivamente, os hormônios A e B?
a) Luteinizante e folículo-estimulante.
b) Folículo-estimulante e luteinizante.
c) Luteinizante e progesterona.
d) Progesterona e estrógeno.
e) Estrógeno e progesterona.
[C]
1364. Recentemente descobriu-se que, quando aumenta a pressão nos átrios (aurículas) cardíacos, estes secretam um hormônio - o fator atrial - que tem ação direta
sobre os néfrons, as unidades filtradoras dos rins. Entre outros efeitos, o fator atrial produz dilatação da arteríola aferente, combinada com a constrição da arteríola
eferente (veja o esquema a seguir que representa um néfron).

Dessas informações, pode-se deduzir que a secreção de fator atrial provoca:


a) maior filtração glomerular, formação de mais urina, diminuição da pressão sangüínea.
b) menor filtração glomerular, formação de mais urina, diminuição da pressão sangüínea.
c) maior filtração glomerular, formação de menos urina, elevação da pressão sangüínea.
d) menor filtração glomerular, formação de menos urina, elevação da pressão sangüínea.
e) menor filtração glomerular, formação de mais urina, elevação da pressão sangüínea.
[A]
1365. No esquema a seguir,(I) indica a passagem de glicose do sangue para o fígado e (II) a passagem de glicose do fígado par a o sangue.
Os hormônios que controlam as passagens I e II são, respectivamente:
(I) sangue ë fígado
(II) fígado ë sangue
a) adrenalina; aldosterona.
b) insulina; aldosterona.
c) insulina; glucagon.
d) glucagon; insulina
e) aldosterona; adrenalina.
[C]
1366. Na puberdade, ocorrem alterações morfo-fisiológicas e comportamentais, no homem e na mulher. Tais alterações decorrem da ação hormonal que determina o
aparecimento dos caracteres sexuais secundários. Os hormônios responsáveis por tais alterações são, respectivamente,
a) ACTH e ADH.
b) Progesterona e Luteinizante.
c) Progesterona e Estrógeno.
d) Luteinizante e Testosterona.
e) Testosterona e Estrógeno.
[E]
1367. Além de sua função digestiva, o pâncreas atua ativamente na coordenação hormonal, já que é também uma glândula endócrina. Assinale a opção que apresenta
respectivamente os papéis digestivo e de coordenação.
a) Emulsão de gorduras e liberação de aldosterona.
b) Liberação de pepsina e produção de gastrina.
c) Acidificação do quimo e liberação de tripsina.
d) Desaminação de aminoácidos e produção de insulina.
e) Desdobramento do amido e produção de glucagon.
[E]
1368. Na(s) questão(ões) a seguir, escreva no espaço apropriado a soma dos itens corretos. Numa situação de perigo, um animal fica em estado de alerta (defesa). O
comportamento apresentado depende de uma série de reações que envolvem diversos sistemas orgânicos. Com relação a esse estado, é correto afirmar que:
01) O sistema nervoso terá papel decisivo no preparo do animal para enfrentar o perigo ou realizar a fuga.
02) Haverá liberação de adrenalina, ocorrendo aumento da pressão arterial e maior irrigação dos músculos e do cérebro.
04) A freqüência respiratória aumentará, pois o animal necessitará de mais oxigênio para o seu metabolismo.
08) A reação imediata do animal frente ao perigo dependerá diretamente do sistema linfático.
16) A freqüência cardíaca aumentará para melhorar a irrigação sangüínea dos tecidos.
01 + 02 + 04 + 16 = 23

195
1369. "Durante uma excursão a cavalo que fiz nos arredores de uma vila de Goiás, senti-me de repente como, que num país fantástico. Um terço das pessoas que
encontrei tinha uma enorme bola no pescoço, [...] Os matutos não compartilhavam meu espanto. Já estão acostumados com o "papo" ou "bócio endêmico".
A anomalia citada no texto está associada à hipofunção de uma glândula endócrina, devido à carência de uma substância. Esta glândula e esta substância são,
respectivamente:
a) hipófise e mercúrio.
b) tireóide e iodo.
c) paratireóides e cálcio.
d) pâncreas e insulina.
e) adrenais e adrenalina.
[B]
1370. OSTEOPOROSE AFETA 25% DAS MULHERES NA MENOPAUSA.
Para prevenção da osteoporose recomendam-se, entre outras medidas, caminhadas e sol. Esse tratamento preventivo leva o organismo a produzir
a) estrogênios, que reduzem a atividade osteoclástica dos ossos.
b) estrogênios, que são necessários para uma maior absorção de cálcio e de fosfato nos ossos.
c) vitamina A, que é o radical prostético de enzimas que atuam na absorção de cálcio e fósforo.
d) vitamina C, necessária nos processos de cicatrização das fraturas, por aumentar a atividade osteoblástica dos ossos.
e) vitamina D, que aumenta a absorção do cálcio pelo intestino.
[E]
1371. A hipófise NÃO exerce influência sobre
a) o testículo. b) a tireóide. c) as adrenais.
d) o pâncreas. e) o ovário.
[D]
1372. Os hormônios que estimulam a tireóide e as gônadas dos mamíferos são produzidos
a) pela paratireóide.
b) pela adeno-hipófise.
c) pela neuro-hipófise.
d) pelo córtex da supra-renal.
e) pela medula da supra-renal.
[B]
1373. Observe o esquema que representa secção de uma região de testículo humano.

Com base no esquema e em seus conhecimentos sobre o assunto, CITE


a) o número total de cromossomos existentes nas células indicadas pelos números 1 e 4.
b) uma função das células indicadas pelos números 5 e 6.
c) o(s) número(s) correspondente(s) à(s) célula(s) que sofre(m) ação do hormônio folículo estimulante (FSH) e as que sofre(m) ação do hormônio luteinizante (ICSH).
d) o(s) número correspondente(s) à(s) célula(s) que terão sua função primordial impedida pela vasectomia e as que serão afetadas pelo uso de pílula anticoncepcional
masculina de efeito semelhante às já existentes para as mulheres.
a) Espermatozóide (cel. 1) é n=23, Espermátide (cel. 2) é n=23, Espermatócito I (cel. 3 ) é 2n=46 e Espermatogônia (cel. 4) é 2n=46.
b) Células de Leydig (5) produzem testosterona, Células de Sertoli (6) contribuem para o amadurecimento dos espermatozóides.
c) Sofrem ação do FSH as espermatogônias (4) e ação do LH as células de Leydig (5).
d) Espermatozóides (cel. 1) e Espermatogônias (cel. 4).
1374. Considere as seguintes funções de controle do sistema endócrino:
I. concentração de cálcio e fósforo.
II. crescimento geral do corpo.
III. atividade das gônadas.
IV. metabolismo do açúcar no corpo dos mamíferos.
As glândulas que correspondem a estas funções são, respectivamente,
a) paratireóides - hipófise - hipófise - pâncreas.
b) tireóide - hipófise - hipófise - pâncreas.
c) paratireóides - hipófise - hipófise - timo.
d) supra-renal - hipófise - timo - pâncreas.
e) hipófise - supra-renal - pâncreas - tireóide.
[A]
1375. Relacione a afirmação com o gráfico
"O glucagon tem efeito inverso ao da insulina aumentando o nível de glicose no sangue, pois atua estimulando a transformação de glicogênio em glicose no fígado"

196
Os dados para construção deste gráfico foram registrados a partir do instante zero, quando a pessoa ingeriu 50mL de solução glicosada.
Podemos afirmar que, no momento
a) B, a taxa de glucagon é baixa nas pessoas normais.
b) B, a taxa de glucagon é alta nas pessoas normais.
c) C, a taxa de glicose é baixa em decorrência da diminuição de glucagon ou do consumo metabólico.
d) A, a taxa de glicose é baixa em decorrência do aumento da taxa de glucagon ou do consumo metabólico.
e) A, a taxa de glucagon é alta porque a de glicose está normal.
[A]
1376. Na(s) questão(ões) a seguir escreva nos parêntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Vários fatores interagem no processo de
formação e estruturação definitiva dos ossos, sendo muito importantes a nutrição (vitamina D, cálcio e fósforo) e os hormônios da tireóide e paratireóides. E m relação a
estes fatores, analise as proposições a seguir.
( ) O hormônio Tirocalcitonina remove cálcio do plasma sangüíneo, incorporando-o à matriz óssea.
( ) O Paratormônio remove o cálcio da matriz óssea, levando-o ao plasma.
( ) Um excesso de Tirocalcitonina no organismo descalcifica os ossos, tornando-os mais sujeitos a fraturas.
( ) O Paratormônio é responsável pela remoção do cálcio do plasma e por sua incorporação à matriz óssea.
( ) Os hormônios Paratormônio e Tirocalcitonina mantêm as taxas de cálcio e fósforo no plasma sangüíneo regulando as troc as desses elementos entre a matriz
óssea e o plasma.
VVFFV
1377. Na(s) questão(ões) a seguir escreva nos parêntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. O S istema Endócrino é um dos sistemas
reguladores do corpo. A respeito deste sistema e de seus componentes:
( ) as glândulas são tecidos epiteliais especializados para secreção;
( ) os hormônios, por serem transportados pelo sangue, apresentam ação em todos os tecidos do corpo;
( ) o FSH E o LH são dois hormônios produzidos pelo hipotálamo;
( ) o hormônio do crescimento (somatotropina) é produzido na hipófise;
( ) a Insulina e o Glucagon são dois hormônios relacionados com o metabolismo da glicose, e são produzidos no Pâncreas.
VFFVV
1378. As funções sexuais femininas são reguladas pelos hormônios: folículo estimulante (FSH), luteinizante (LH), estrógeno (estradiol) e progesterona.
Considere as seguintes afirmações relacionadas a tais hormônios:
I - Os hormônios folículo estimulante (FSH) e progesterona são produzidos pela adenohipófise.
II - A ovulação ocorre quando o nível do hormônio luteinizante (LH) atinge seu valor mais elevado.
III- O hormônio progesterona atinge seu valor máximo após a ovulação.
Podemos dizer que:
a) Somente a afirmação I está correta.
b) Somente a afirmação II está correta.
c) As afirmações I e II estão corretas.
d) As afirmações II e III estão corretas.
e) Todas as afirmações estão corretas.
[D]
1379. Associe corretamente as duas colunas relacionando os hormônios e sua ação principal e assinale a alternativa que traz a seqüência correta dos números.
1) Ocitocina
2) Tiroxina
3) Insulina
4) Adrenalina
5) Progesterona
( ) desenvolve a parede uterina para a implantação do ovo e mantém a gravidez;
( ) contrai a musculatura uterina;
( ) eleva a pressão arterial;
( ) controla a glicose no sangue;
( ) eleva o metabolismo basal.
a) 5, 4, 1, 3 e 2;
b) 1, 5, 4, 3 e 2;
c) 5, 1, 4, 3 e 2;
d) 1, 4, 2, 3 e 5;
e) 5, 1, 2, 3 e 4.
[C]
1380. Analise as proposições a seguir e assinale a opção correta:
I) Um dos hormônios produzidos pela glândula supra-renal reforça a ação dos nervos simpáticos e estimula a degradação do glicogênio hepático e muscular.
II) Os hormônios tireoidianos atuam no crescimento e desenvolvimento do indivíduo; a glândula que os produz atua no metabolis mo do iodo.
III) A testosterona e a androsterona são hormônios sexuais masculinos produzidos pelas células de Leydig localizadas entre os túbulos seminíferos.
a) estão corretas apenas I e III;
b) todas estão erradas;
c) apenas a I é falsa;
d) estão corretas apenas I e II;
e) todas estão corretas.
[E]
1381. Acerca do diabetes melito, importante doença crônica do homem, é INCORRETO afirmar que;
a) a presença de glicose na urina é importante sinal
b) é fator de risco para o enfarte do miocardio

197
c) sempre se deve, primariamente, a doenças do fígado
d) leva à poliúria
[C]
1382. "Durante todo o ano de 1995, o governo deixou de fornecer iodato de potássio aos fabricantes de sal. O iodo é essencial para o ser humano. Problemas, porém,
só se manifestam em populações subnutridas, que não incluem em sua alimentação produtos do mar, uma rica fonte natural de iodo."
Assinale a alternativa que apresenta, respectivamente, o nome da glândula afetada e a doença provocada pela falta desse elemento.
a) adeno - hipófise e nanismo
b) tireóide e bócio
c) supra-renal e doença de Cushing
d) pâncreas e 'diabetes mellitus'
e) neuro-hipófise e 'diabetes insipidus'
[B]
1383. O ADH é um hormônio produzido pela _____, responsável pela osmorregulação. A ingestão de água _____ a produção desse hormônio, _____ a eliminação de
urina.
Assinale a alternativa que preenche correta e ordenadamente os espaços.
a) hipófise - inibe - aumentando
b) supra-renal - estimula - diminuindo
c) hipófise - estimula - diminuindo
d) tireóide - inibe - diminuindo
e) pâncreas - inibe – aumentando
[A]
1384. Na(s) questão(ões) a seguir julgue os itens e escreva nos parentesses (V) se for verdadeiro ou (F) se for falso. As glâ ndulas endócrinas apresentam como
característica distintiva a ausência de ducto, por essa razão os hormônios por ela secretados são diretamente lançados à corrente sangüínea. Existem 6 glândulas
endócrinas de grande importância no funcionamento do organismo e outras de menor relevância. Sobre essas 6 glândulas endócrinas, julgue os itens.
( ) Uma das funções da hipófise anterior ou adeno hipófise é secretar o hormônio de crescimento.
( ) A glândula tireóide, situada na parte interior do esôfago, tem como função a produção de FSH e LH.
( ) O pâncreas contém milhares de ilhotas de Langerhans. Estas ilhotas são constituídas por vários tipos celulares, entre elas as c élulas alfa relacionada à secreção
de glucagon e as células beta, ligadas à secreção de insulina.
VFV
1385. O hormônio responsável pelo aumento da concentração de glicose no sangue é
a) a epinefrina. b) a ocitocina. c) a insulina.
d) a tiroxina. e) o glucagon.
[E]
1386. É comum ouvir expressões como estas:
"Meu coração disparou", "Fiquei tão nervoso que comecei a suar", "Senti a boca seca". Estas reações são características de um estado emocional alterado, e são
controladas sob a ação do(s):
a) sistema nervoso autônomo.
b) sistema nervoso somático.
c) hormônios da tireóide.
d) nervos do cerebelo.
e) centro nervoso medular.
[A]
1387. A concentração de glicose no sangue depende da atuação de dois hormônios, como mostra o esquema a seguir:

Estes hormônios, representados pelas letras A e B, são respectivamente:


a) insulina e glucagon.
b) insulina e adrenalina.
c) adrenalina e glucagon.
d) adrenalina e insulina.
e) glucagon e insulina.
[A]
1388. Se uma pessoa leva um susto, seus vasos sangüíneos se contraem (fica branca) e seu coração acelera os batimentos (dispara). Isto acontece porque:
a) as glândulas supra-renais liberam no sangue uma grande quantidade de adrenalina
b) o pâncreas libera no sangue uma grande quantidade de insulina
c) o pâncreas libera no duodeno uma grande quantidade de suco pancreático
d) as glândulas sudoríparas se contraem repentinamente
e) a hipófise libera no sangue uma grande quantidade de hormônio gonadotrópico
[A]
1389. O aumento da glândula tireóide, acarreta uma doença muito comum chamada bócio. Esta doença relaciona-se com a falta de:
a) ferro; b) cálcio; c) fluor; d) iodo; e) enxofre.
[D]
1390. A eliminação do excesso de açúcar pela urina chama-se:
a) tetania. b) doença de Addison. c) cretinismo.
d) diabete. e) nanismo.
[D]

198
1391. A glândula__________se localiza na região do pescoço, na frente da traquéia, sendo responsável pela produção do hormônio __________, cuja função é
__________. O aumento do volume dessa glândula é conhecido como__________.
Assinale a alternativa que preenche correta e respectivamente as lacunas do texto:
a) tireóide; FSH; o controle do crescimento; diabetes
b) hipófise; ACTH; a estimulação das supra-renais; bócio
c) tireóide; tiroxina; o controle do metabolismo; bócio
d) adrenal; insulina; o controle da taxa de glicose; diabetes
e) paratireóide; TSH; o controle do metabolismo de cálcio; tetania
[C]
1392. Glândula endócrina localizada no pescoço e responsável, através de seus hormônios, pela regulação do metabolismo do cor po humano. O texto refere-se à (ao)
a) tiróide. ) pâncreas. c) hipófise.
d) paratiróide. e) timo.
[A]
1393. O iodo é um elemento químico abundante em alimentos como os frutos-do-mar. Esse elemento é essencial para a produção dos hormônios da glândula endócrina
denominada
a) pâncreas. b) ovário. ) tiróide.
d) hipófise. e) timo.
[C]
1394. A regulação das concentrações dos elementos químicos sódio e cloro é desempenhado pelos mineralocorticóides. Aldosterona é um exemplo destes hormônios
produzidos pela(s)
a) ilhotas pancreáticas.
b) hipófise.
c) glândulas paratiróides.
d) glândulas adrenais.
e) tiróide.
[D]
1395. A glândula endócrina responsável pela regulação do nível de cálcio e fósforo no sangue humano é (são)
a) as paratiróides. b) os ovários. c) as supra-renais.
d) a hipófise. e) o timo.
[A]
1396. As glândulas são estruturas formadas por agrupamentos de células epiteliais que se multiplicam e penetram no tecido conjuntivo subjacente. Como exemplos de
glândulas exócrinas, mesócrinas e endócrinas temos, respectivamente:
a) Salivares, Hipófise e Sebáceas
b) Salivares, Pâncreas e Tireóide
c) Tireóide, Fígado e Hipófise
d) Sebáceas, Pâncreas e Salivares
e) Sebáceas, Hipófise e Fígado
[B]
1397. Assinale a opção que indica os hormônios que atuam na liberação do óvulo (ovócito secundário):
a) ocitocina e estradiol
b) estradiol e progesterona
c) progesterona e folículo estimulante
d) luteinizante e gonadotrofina
e) folículo estimulante e luteinizante
[E]
1398. Cães a que se extraíram o pâncreas passaram a apresentar sintomas similares aos do diabetes humano. Com o duto pancreático amarrado, apenas distúrbios
digestivos. A experiência nos permite concluir que:
a) o pâncreas apresenta a função de glândula digestiva com exclusividade.
b) a função primordial do pâncreas em cães é secretora.
c) tanto a função digestiva como a função hormonal são funções inerentes ao pâncreas.
d) o diabetes humano pode ser causado por lesões no duto pancreático.
e) o pâncreas é responsável pela produção de gastrina.
[C]
1399. A reabsorção de água pelos rins regula a osmorregularidade do sangue, graças à ação de um hormônio produzido pela hipófise. Esse hormônio é:
a) somatotrofina.
b) epinefrina.
c) secretina.
d) hormônio antidiurético.
e) hormônio luteinizante.
[D]
1400. A remoção de um órgão de um animal reduziu a capacidade de digerir lipídios, proteínas e amido e provocou aumento da taxa de glicose no sangue. Esse órgão é
a) a glândula adrenal. b) o pâncreas. c) a tireóide.
d) a paratireóide. e) a hipófise.
[B]
1401. O hormônio feminino responsável pela ovulação denomina-se
a) progesterona.
b) estrógeno.
c) testosterona.
d) folículo estimulante (FSH).
e) luteinizante (LH).
[E]
1402. Os recentes avanços da Biotecnologia têm permitido a produção dos chamados Anticorpos Monoclonais, cujas aplicações se ampliam, já movimentando um
mercado gerador de centenas de milhões de dólares anuais. Uma das utilizações mais freqüentes se relaciona à pesquisa da gonadotrofina coriônica no sangue. Tal
técnica permite a detecção desta substância, mesmo quando presente em pequenas concentrações.
A presença da gonadotrofina no sangue humano representa:
a) Diagnóstico positivo para Hipertiroidismo.
b) Diagnóstico positivo para Hipotiroidismo.
c) Diagnóstico negativo para Hiperglicemia.
d) Diagnóstico positivo para Pancreatite.
e) Diagnóstico positivo para Gravidez.
[E]

199
1403. A secreção do hormônio de crescimento STH produz quais dos seguintes efeitos?
a) lipólise amenta, absorção cálcio aumenta e síntese protéica diminui.
b) lipólise aumenta, absorção cálcio aumenta e síntese protéica amenta.
c) lipólise diminui, absorção cálcio diminui, síntese protéica diminui.
d) lipólise diminui, absorção cálcio amenta e síntese protética amenta.
e) lipólise aumenta, absorção cálcio diminuiu, síntese protéica diminuiu.
[B]
1404. "Suave caminho de volta ao sono natural"
Novas pesquisas condenam o uso de comprimidos de melatonina e médicos defendem a receita tradicional contra insônia: medidas antiestresse e dieta sem
cafeína.
(MARINHO, Antônio, In: O Globo, Jornal da Família, 25/08/96)
O texto produzido alerta para o uso indiscriminado e abusivo de melatonina como medicamento. Esta substância é normalmente produzida pelo organismo e
tem efeito sobre vários órgãos e sistemas. Seus níveis de concentração são finamente regulados para as diferentes situações biológicas. Havendo interferência externa
neste processo de "feedback", podem ocorrer alterações orgânicas indesejáveis.
A melatonina é produzida na:
a) pineal b) hipófise c) tireóide
d) paratireóide e) adrenal
[A]
1405. " (...) Até a menopausa, as mulheres contam com uma proteção natural inexistente no metabolismo masculino. É................ - o hormônio sexual produzido nos
ovários. Sua presença no sangue reduz os níveis de colesterol "ruim" (o LDL e o VLDL), aumenta os de colesterol "bom" (HDL) e ajuda a preservar a parte interna das
artérias."
Assinale a alternativa que preenche corretamente a lacuna do texto.
a) a aldosterona b) a insulina c) a testosterona
d) a adrenalina e) o estrógeno
[E]
1406. O esquema a seguir faz parte do ciclo menstrual humano:

Considerando-se os hormônios I, II, III e IV e suas funções, podemos afirmar corretamente:


Observe:
FSH = hormônio folículo estimulante
LH = hormônio luteinizante
a) I é o LH, II é o FSH
b) III e IV agem sobre o útero
c) II é o chamado hormônio da gestação
d) I é progesterona e IV é o estrógeno
[B]
1407. Associe os hormônios da coluna superior com as glândulas que os produzem, apresentadas na coluna inferior.
I - paratirina
II - aldosterona
III - glucagon
IV - ocitocina
V - somatotrófico
VI - triiodotironina
( ) hipófise
( ) tireóide
( ) paratireóides
( ) supra-renais
( ) pâncreas
A seqüência correta da coluna inferior é:
a) I, II, III, IV, V
b) IV, VI, I, II, III
c) V, VI, I, II, III
d) V, VI, I, IV, III
e) VI, V, IV, III, II
[C]
1408. O estresse, a chamada doença do século, não é exclusiva da espécie humana. Certamente você já viu algumas fêmeas defendendo seus filhotes, um animal em
fuga de um predador ou ainda um animal acuado e que deve enfrentar o agressor para sobreviver. Essas situações típicas de estresse estão associados ao seguinte par
de fatores.
a) atropina Ì sistema nervoso parassimpático.
b) adrenalina Ì sistema nervoso simpático.
c) adrenalina Ì sistema nervoso somático.
d) noradrenalina Ì sistema nervoso central.
e) noradrenalina Ì sistema nervoso somático.
[B]
1409. Relacione o hormônio à sua função:
1. Testosterona
2. Ocitocina
3. Insulina
4. Somatotrófico

200
5. Estrógeno
( ) estimula o crescimento.
( ) estimula a contração de musculatura uterina.
( ) responsável pelos caracteres sexuais masculinos.
( ) regula a taxa de glicose.
( ) responsável pelos caracteres sexuais femininos e pelo desenvolvimento da parede uterina.
Marque a alternativa que contém a seqüência CORRETA encontrada:
a) 1, 2, 3, 4 e 5.
b) 4, 2, 1, 3 e 5.
c) 2, 4, 3, 5 e 1.
d) 1, 4, 5, 3 e 2.
e) 3, 1, 4, 5 e 2.
[B]
1410. O hormônio ADH atua sobre os túbulos renais promovendo absorção de água do filtrado glomerular. A deficiência na secreç ão desse hormônio faz com que a
pessoa produza
a) muita urina, com alta concentração de excreções.
b) muita urina, com baixa concentração de excreções.
c) pouca urina, com alta concentração de excreções.
d) pouca urina, com baixa concentração de excreções.
e) quantidade normal de urina, com alta concentração de excreções.
[B]
1411. Esta tabela contém os valores de alguns hormônios, dosados no sangue de uma mulher, e os intervalos de valores consider ados normais, expressos em unidades
internacionais.

Entre os possíveis distúrbios que a mulher pode apresentar NÃO se inclui


a) a alteração do ciclo menstrual.
b) a disfunção hipofisária.
c) o aumento da diurese.
d) o aumento do metabolismo basal.
[D]
1412. Sabe-se que populações de regiões do Brasil Central têm, como principal fonte de iodo, o sal de cozinha. Amostras de sal refinado, analisadas recentemente pelo
Instituto Adolfo Lutz de São Paulo, mostraram índices de iodo muito inferiores aos exigidos pela legislação brasileira.
Entre os distúrbios provocados pela utilização prolongada desse tipo de sal pela população NÃO se inclui
a) a deficiência mental nas crianças.
b) o aumento do metabolismo.
c) o atraso do crescimento das crianças.
d) o crescimento excessivo da tireóide.
[B]
1413. São exemplos de glândulas exócrinas e endócrinas, respectivamente, a(s):
a) tireóide e as paratireóides.
b) hipófise e as sebáceas.
c) salivares e a tireóide.
d) sudoríparas e as mamárias.
e) adrenais e a tireóide.
[C]
1414. Na(s) questão (ões) adiante, escreva no espaço apropriado a soma dos itens corretos. Foi encontrado o diário de um naturalista, em que ele descreve os padrões
de sobrevivência, crescimento corpóreo e crescimento populacional de uma espécie de sabiá e de uma de tatuzinho-de-jardim, representados respectivamente na figura
a seguir pelos números I e II, em um ecossistema preservado. Alguns desses dados estão representados graficamente adiante:
Considere S = sobrevivência

Com base nos gráficos anteriores, é correto afirmar:


01) Na curva de crescimento populacional do sabiá, observa-se a existência de mecanismos controladores internos na população (crescimento autolimitante).
02) Na curva do crescimento corpóreo do tatuzinho-de-jardim, os intervalos marcados com B correspondem a períodos subseqüentes à muda do exoesqueleto quitinoso.

201
04) Os padrões de crescimento corpóreo do sabiá e do tatuzinho-de-jardim são similares.
08) Pela análise das curvas de sobrevivência, o sabiá apresenta alta mortalidade no período inicial do cicio de vida, ao contrário do tatuzinho-de-jardim, que apresenta
baixa mortalidade nesse mesmo período.
02
1415. Observe as assertivas a seguir, relativas a alguns hormônios com o seu respectivo efeito principal:
I - PROLACTINA: Estimula a produção de leite nas glândulas mamárias.
II - TESTOSTERONA: Estimula os caracteres primários femininos.
III - ADRENALINA: Aumenta a pressão arterial e o ritmo cardíaco.
São assertivas corretas somente:
a) I b) I e II c) II e III d) I e III
[D]
1416. Assinale a alternativa que associa corretamente uma glândula endócrina com um dos seus respectivos hormônios e o principal problema causado pela deficiência
do mesmo.
a) Hipófise: secreta o ADH (hormônio antidiurédico), cuja deficiência causa excesso de açúcar no sangue.
b) Pâncreas: secreta insulina, cuja deficiência causa diabete melito.
c) Tireóide: secreta tiroxina, cuja deficiência causa ativação do metabolismo.
d) Adrenal: secreta paratormônio, cuja deficiência causa tetania muscular.
e) Ovários: secreta progesterona, cuja deficiência causa ausência dos caracteres sexuais femininos.
[B]
1417. Os gráficos mostrados na figura abaixo representam as variações nos níveis dos hormônios hipofisários e ovarianos durante o ciclo menstrual da mulher.

Com o auxílio dos gráficos, julgue os seguintes itens.


(1) O primeiro dia do ciclo menstrual corresponde ao primeiro dia da menstruação.
(2) O aumento da taxa de FSH induz o desenvolvimento dos folículos ovarianos.
(3) No momento da ovulação, as taxas de estrógenos e de LH estão elevadas.
(4) Os gráficos ilustram a situação que ocorre em mulheres que estão sob efeito de pílulas anticoncepcionais.
CCCE
202202202202. Produzido pelo hipotálamo e eliminado na circulação sangüínea pelo lobo posterior da hipófise, o hormônio ADH irá atuar:
a) na bexiga.
b) na uretra e na bexiga.
c) no bacinete.
d) nos ureteres e na uretra.
e) nos túbulos contornados distais.
[E]
202202202202. Observe o desenho a seguir, que representa um corpo humano com a indicação de algumas glândulas.

A disfunção das glândulas indicadas com as letras A, B, C e D pode acarretar, respectivamente,


a) nanismo, taquicardia, cretinismo e diabetes.
b) cretinismo, bócio, nanismo e diabetes.
c) gigantismo, bócio, diabetes e taquicardia.
d) nanismo, bócio, taquicardia e diabetes.
e) cretinismo, gigantismo, diabetes e taquicardia.
[D]
202202202202. O esquema adiante contém dados sobre a função endócrina na mulher.

202
Com base nesse esquema, é correto afirmar:
( ) A glândula X, ou hipófise, produz, entre outros, o hormônio H 1, ou adrenocorticotrópico (ACTH).
( ) O ovário produz H2 ou estrógeno, se for estimulado pelo hormônio folículo-estimulante (FSH), proveniente da glândula X.
( ) O hormônio luteinizante (LH) é capaz de manter a produção de progesterona pelo corpo lúteo ovariano.
( ) A glândula Z, ou adrenal, pode liberar também a adrenalina, um hormônio importante no preparo do organismo para reações de alarme e fuga.
( ) A descamação da parede interna uterina, ou menstruação, é devida unicamente a uma queda nos níveis plasmáticos de estrógeno.
( ) Altos níveis plasmáticos dos hormônios tireoidianos levam a uma redução na produção do hormônio estimulante da tireóide (TSH) por X, fenômeno denominado
retroalimentação negativa e essencial na homeostase do organismo.
( ) O funcionamento altamente integrado do sistema endócrino permite respostas mais rápidas se comparadas àquelas mediadas pelo sistema nervoso.
VVVVFVF
1421. Matéria publicada em jornal diário discute o uso de anabolizantes (apelidados de "bombas") por praticantes de musculaçã o. Segundo o jornal, os anabolizantes
são hormônios que dão uma força extra aos músculos. Quem toma consegue ganhar massa muscular mais rápido que normalmente. Iss o porque uma pessoa pode
crescer até certo ponto, segundo sua herança genética e independentemente do quanto ela se exercite. Um professor de musculação diz: "Comecei a tomar bomba por
conta própria. Ficava nervoso e tremia. Fiquei impotente durante uns seis meses. Mas como sou lutador de vale-tudo, tenho que tomar".
A respeito desta matéria, dois amigos fizeram os seguintes comentários:
I. O maior perigo da auto-medicação é seu fator anabolizante, que leva à impotência sexual.
II. O crescimento corporal depende tanto dos fatores hereditários quanto do tipo de alimentação da pessoa, se pratica ou não esportes, se dorme as 8 horas diárias.
III. Os anabolizantes devem ter mexido com o sistema circulatório do professor de musculação, pois ele até ficou impotente.
IV. Os anabolizantes são mais perigosos para os homens, pois as mulheres, além de não correrem o risco da impotência, são protegidas pelos hormônios femininos.
Tomando como referência as informações da matéria do jornal e o que se conhece da fisiologia humana, pode-se considerar que estão corretos os comentários:
a) I, II, III e IV.
b) I, II e IV, apenas.
c) III e IV, apenas.
d) II e III, apenas.
e) I, II e III, apenas.
[D]
1422. Um estudante leu uma reportagem a respeito de uma mulher norte-americana que cometeu um crime, mas foi absolvida por apresentar tensão pré-menstual
(TPM). Interessado no assunto, o estudante leu que a TPM afeta 35% das mulheres em idade reprodutiva e que seus sintomas mais freqüentes são irritabili dade,
ansiedade, tensão, depressão, fadiga, choro fácil, cansaço e dor nas mamas. Os sintomas psíquicos da TPM parecem estar relaci onados a uma diminuição da
serotonina, uma substância neurotransmissora, em resposta às alterações dos hormônios sexuais. O aumento da serotonina, por s ua vez, pode acontecer pela prática
de exercícios físicos. Os sintomas físicos da TPM parecem estar relacionados com as alterações hormonais típicas da segunda metade do ciclo menstrual.

FIGURA I - Alterações hormonais hipofisárias e ovarianas no decorrer do ciclo menstrual.


FIGURA II - Concentração relativa dos hormônios excretados na urina da mulher no decorrer da gravidez
(Figuras adaptadas de Amabis e Martho. BIOLOGIA E SAÚDE HUMANAS. p. 101-3.)
Com o auxílio das informações obtidas pelo estudante, julgue os itens abaixo.
(1) Logo após a ovulação, ocorre um aumento dos níveis de progesterona.
(2) As alterações dos níveis de estrógenos que ocorrem antes da menstruação ou logo após o parto, ilustradas nas figuras I e II, podem levar a mulher a estados de
depressão.
(3) A reposição hormonal pode aliviar problemas de depressão para a mulher em menopausa.
(4) Os níveis de hormônios produzidos pelos ovários são controlado pelo sistema nervoso.
(5) Inexiste correlação entre a produção de substâncias neurotransmissoras e a produção do hormônio LH.
VVVVF
1423. Um estudante leu uma reportagem a respeito de uma mulher norte-americana que cometeu um crime, mas foi absolvida por apresentar tensão pré-menstual
(TPM). Interessado no assunto, o estudante leu que a TPM afeta 35% das mulheres em idade reprodutiva e que seus sintomas mais freqüentes são irritabilidade,
ansiedade, tensão, depressão, fadiga, choro fácil, cansaço e dor nas mamas. Os sintomas psíquicos da TPM parecem estar relaci onados a uma diminuição da
serotonina, uma substância neurotransmissora, em resposta às alterações dos hormônios sexuais. O aumento da serotonina, por sua vez, pode acontecer pela prática
de exercícios físicos. Os sintomas físicos da TPM parecem estar relacionados com as alterações hormonais típicas da segunda m etade do ciclo menstrual.

203
FIGURA I - Alterações hormonais hipofisárias e ovarianas no decorrer do ciclo menstrual.
FIGURA II - Concentração relativa dos hormônios excretados na urina da mulher no decorrer da gravidez
(Figuras adaptadas de Amabis e Martho. BIOLOGIA E SAÚDE HUMANAS. p. 101-3.)
Em relação ao texto e às figuras, julgue os itens que se seguem.
(1) Por serem estimulantes, o café, o álcool e o fumo podem diminuir os sintomas da TPM.
(2) As dores nas mamas, referidas no texto e possivelmente causadas por maior retenção de água, podem ser atenuadas pela ingestão de alimentos salgados.
(3) Os hormônios estrógeno e FSH estão em altas concentrações no sangue de mulheres em períodos férteis.
(4) O pico de gonadotrofina coriônica mostrado na figura II é comumente observado nas mulheres que utilizam pílulas anticoncepcionais.
FFFF
1424. Analise as frases a seguir.
I. As células que revestem o folículo de Graaf, antes da maturação do óvulo, produzem o hormônio 1, estimuladas pelo hormônio 2 da hipófise.
II. Após a ovulação, forma-se o corpo lúteo por estímulo do hormônio 3 da hipófise.
III. O corpo lúteo secreta o hormônio 4.
Os hormônios 1, 2, 3 e 4 são, respectivamente:
a) progesterona, hormônio folículo estimulante, hormônio luteinizante e estrógeno.
b) hormônio folículo estimulante, estrógeno, progesterona e hormônio luteinizante.
c) hormônio folículo estimulante, progesterona, estrógeno e hormônio luteinizante.
d) estrógeno, progesterona, hormônio folículo estimulante e hormônio luteinizante.
e) estrógeno, hormônio folículo estimulante, hormônio luteinizante e progesterona.
[E]
1425. O gráfico abaixo representa as variações de determinados hormônios no sangue de um animal durante alguns dias.

a) A que classe de vertebrado deve pertencer esse animal?


b) Identifique os eventos ocorridos nos momentos indicados pela:
b1) seta I.
b2) seta II.
c) Suponha a administração de alta dose de progesterona e estrogênio na corrente sangüínea desse animal antes do início do ci clo.
Como conseqüência disso, o que aconteceria com as taxas de:
C1) FSH?
C2) LH?
a) Mamíferos.
B1) Ovulação.
B2) Nidação; implantação de embrião no útero; formação de placenta (qualquer um deles).
C1) Diminuiria.
C2) Diminuiria.
1426. O cálcio desempenha papel importante em vários processos fisiológicos do homem. Por isso, é indispensável a manutenção dos níveis plasmáticos de cálcio em
estreitos limites, o que ocorre com a participação de alguns hormônios.
Acerca do exposto acima, pode-se afirmar:
a) A diminuição da concentração plasmática de cálcio é um fator de estímulo para a liberação de calcitonina pelas células parafoliculares da tireóide.
b) A diminuição da concentração plasmática de cálcio é um fator de estímulo para a liberação do paratormônio pelas paratireói des.
c) A elevação da concentração plasmática de cálcio é um fator de estímulo para a liberação de triiodotironina e tiroxina pela tireóide.
d) A elevação da concentração plasmática de cálcio é um fator de estímulo para a liberação de aldosterona pelo córtex das adr enais.
e) A diminuição da concentração plasmática de cálcio é um fator de estímulo para a liberação de adrenalina pela medula das adrenais.
[B]
1427. A produção do hormônio luteinizante estimula as células intersticiais ou de "Leydig" a liberar um hormônio que, por sua vez, é responsável pela manutenção dos
caracteres sexuais.
Qual das alternativas a seguir, corresponde, corretamente ao que está descrito no texto?
a) A HIPÓFISE produz o HORMÔNIO LUTEINIZANTE que estimula os TESTÍCULOS a produzirem TESTOSTERONA.
b) Os TESTÍCULOS produzem o HORMÔNIO LUTEINIZANTE que estimula a HIPÓFISE a produzir ESTRÓGENO.
c) O HORMÔNIO LUTEINIZANTE estimula os TESTÍCULOS a produzirem ESTRÓGENO que estimula a HIPÓFISE.
d) O HORMÔNIO LUTEINIZANTE estimula os OVÁRIOS a produzirem PROGESTERONA que estimula a HIPÓFISE.
e) O HIPOTÁLAMO produz o HORMÔNIO LUTEINIZANTE que estimula a HIPÓFISE a produzir TESTOSTERONA.
[A]
1428. As pílulas anticoncepcionais femininas possuem substâncias que:

204
a) provocam a morte dos espermatozóides na entrada do colo do útero.
b) inibem o batimento flagelar dos espermatozóides.
c) tornam a parede do óvulo impenetrável para o espermatozóide.
d) provocam o fechamento das tubas uterinas.
e) impedem a ocorrência do fenômeno da ovulação.
[E]
1429. O homem cresce, de um modo geral, até próximo aos 20 anos. O crescimento em altura do indivíduo é coordenado, principalmente, por atividade glandular.
Assinale a alternativa que apresenta o nome da glândula que produz o hormônio de crescimento:
a) Pâncreas. b) Hipófise. c) Tireóide.
d) Rim. e) Fígado.
[B]
1430. Na urina de uma mulher foi verificada a presença de gonadotrofina coriônica. Essa substância indica que a mulher
a) está menstruada.
b) está grávida.
c) tem diabetes.
d) tem falta de cálcio.
e) tem metabolismo basal baixo.
[B]
1431. Assinale a(s) alternativa(s) em que a relação GLÂNDULA, PRODUTO e FUNÇÃO está(ão) correta(s).
01. tireóide - calcitonina - dificulta a remoção de cálcio de ossos.
02. hipotálamo - tiroxina - estímulo nervoso.
04. córtex da supra-renal - adrenalina - metabolismo da glicose.
08. medula da supra-renal - cortisol - vasoconstrição.
16. pâncreas - insulina - reduz concentração de glicose no sangue.
32. paratireóide - antidiurético - vasoconstrição.
64. adeno-hipófise - adrenocorticotrófico - estimula o córtex da adrenal.
VFFFVFV
1432. O esquema adiante representa, de maneira simplificada, as inter-relações do sistema nervoso. Assinale a alternativa correta em relação à análise desse esquema:

a)1 representa uma fibra sensorial do sistema nervoso somático.


b) 2 representa uma fibra motora do sistema nervoso simpático
c) 1 e 4 representam fibras motoras do sistema nervoso autônomo.
d) 3 e 4 representam fibras do sistema nervoso autônomo.
e) 3 representa uma fibra motora e 4 uma fibra sensorial.
[D]
1433. Dendritos são estruturas que
a) transmitem o impulso para outras células nervosas ou para órgãos efetores.
b) nascem do corpo celular por uma região piramidal.
c) são células em cujas terminações há liberação de mediadores químicos responsáveis pelas sinapses.
d) são prolongamentos dos neurônios que conduzem o impulso nervoso para o corpo celular.
e) contém em seu interior o axônio.
[D]
1434. Um indivíduo, após sofrer lesão em seu cerebelo poderá desempenhar todas as funções a seguir, EXCETO:
a) lembrar-se do nome de um amigo.
b) retirar a mão, se espetada por um alfinete.
c) resolver, mentalmente um problema matemático.
d) pular corda.
e) ouvir música.
[D]
1435. Se uma pessoa sofrer lesão no hipotálamo, é de se esperar que apresente problemas de
a) memória e inteligência.
b) mastigação, deglutição, fonação.
c) coordenação motora, postura e equilíbrio.
d) visão, audição e olfato.
e) temperatura corporal, sono e apetite.
[E]
1436. No homem, o controle dos movimentos respiratórios é exercido:
a) pelo cérebro. b) pelo cerebelo. c) pelo bulbo.
d) pela medula. e) pela hipófise.
[C]
1437. Qual dos seguintes comportamentos envolve maior número de órgãos do sistema nervoso?
a) Salivar ao sentir o aroma de comida gostosa.
b) Levantar a perna quando o médico toca com martelo no joelho do paciente.
c) Piscar com a aproximação brusca de um objeto.
d) Retirar bruscamente a mão ao tocar um objeto muito quente.
e) Preencher uma ficha de identificação.
[E]

205
1438. Foram feitas três afirmações com relação à evolução do sistema nervoso dos invertebrados. Julgue-as.
I - Verifica-se uma centralização e cefalização já nos Poríferos (Espongiários).
II - As medusa são os primeiros invertebrados a apresentarem centralização do sistema nervoso.
III - Anelídeos e Artrópodes possuem sistema nervoso ganglionar em posição ventral.
Está(ão) correta(s) a(s) afirmativa(s):
a) I e II b) II e III c) I e III d) II e) III
[E]
1439. Foi seccionada uma área do sistema nervoso de um mamífero. Em seguida, constatou-se que o referido animal não manteve seu equilíbrio corpóreo,
permanecendo deitado no chão.
A área seccionada em questão faz parte:
a) do bulbo. b) do cerebelo. c) do hipotálamo.
d) das meninges. e) do sistema nervoso autônomo.
[B]
1440. A figura a seguir mostra os componentes de um arco reflexo.

No esquema anterior, o neurônio de associação e o corpo celular do neurônio sensorial estão localizados, respectivamente
a) na substância cinzenta e no gânglio.
b) na substância cinzenta e na raiz ventral.
c) no gânglio e na raiz ventral.
d) no gânglio e na substância cinzenta.
e) na raiz ventral e no gânglio.
[A]
1441. Vegetais e animais possuem células que, mesmo sendo estruturalmente diferentes, apresentam as mesmas funções. No entanto, existe um tipo celular que
desempenha uma função que é exclusiva dos animais. Esta função é de:
a) reprodução.
b) sustentação.
c) secreção glandular.
d) condução de líquidos internos.
e) condução de estímulos nervosos.
[E]
1442. Os anestésicos, largamente usados pela Medicina, tornam regiões ou todo o organismo insensível à dor porque atuam:
a) nos axônios, aumentando a polarização das células.
b) nas sinapses, impedindo a transmissão do impulso nervoso.
c) nos dendritos, invertendo o sentido do impulso nervoso.
d) no corpo celular dos neurônios, bloqueando o metabolismo.
e) na membrana das células, aumentando a bomba de sódio.
[B]
1443. Em relação à evolução do sistema nervoso dos invertebrados são feitas as afirmações a seguir:
I) Ocorre uma centralização e uma cefalização à medida que animal se torna mais complexo.
II) A maioria desses animais apresenta tubo nervoso de localização ventral.
III) As medusas são os primeiros animais a terem um controle central de mensagens.
Está(ão) correta(s) a(s) afirmativa(s):
a) apenas I. b) apenas I e II. c) apenas I e III.
d) apenas II e III. e) I, II e III.
[B]
1444. "As alterações no ritmo dos movimentos respiratórios, que ocorrem durante a realização de atividades físicas intensas, devem-se à influência da concentração
elevada de ........(I)........ sobre o ........(II)........."
Para completar corretamente a frase anterior, deve-se substituir I e II, respectivamente, por
a) O2 e bulbo. b) CO e bulbo. c) CO2 e bulbo.
d) N2 e cerebelo. e) CO2 e cerebelo.
[C]
1445. Todas as alternativas apresentam modalidades já verificadas de interação de seres vivos com o meio ambiente, EXCETO
a) A capacidade de certos peixes se defenderem
com campo elétrico.
b) A orientação das abelhas pela posição do sol.
c) A orientação dos morcegos por ultra-som.
d) A percepção pelas cobras da radiação infravermelha emitida por presas.
e) A visão estereoscópica em anfíbios.
[E]
1446. Rede nervosa e gânglios nervosos constituem dois tipos primitivos de sistema nervoso encontrados, respectivamente, em
a) esponja e sanguessuga.
b) hidra e planária.
c) lombriga e caracol.
d) minhoca e medusa.
e) paramécio e borboleta.
[B]
1447. Na(s) questão(ões) a seguir escreva nos parêntesses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Sobre os processes fisiológicos:

206
( ) a circulação nos peixes é fechada, simples e completa, enquanto nos anfíbios é dupla e incompleta, com mistura de san gue arterial e venoso; no homem, é
fechada, dupla e completa;
( ) nos rins, a reabsorção tubular é um processo passivo para todas as substâncias, exceto água, sendo controlada pelo ADH (hormônio antidiurético);
( ) no arco reflexo, a resposta motora a um estímulo não depende da percepção consciente;
( ) a hematose é um processo que ocorre nos alvéolos pulmonares;
( ) o FSH (hormônio folículo estimulante) estimula o amadurecimento do folículo, o qual produz estrógenos, que estimulam a produção de FSH, num exemplo de
retroalimentação negativa.
VFVVF
1448. O sentido da audição é formado por mecanorreceptores. Além de "ouvir sons", o ouvido também é responsável por:
a) olfato b) equilíbrio c) gustação d) tato e) visão
[B]
1449. O sistema nervoso autônomo é dividido em simpático e parassimpático. Os hormônios que atuam controlando as ati vidades de ambos são, respectivamente:
a) insulina e adrenalina
b) adrenalina e glucagon
c) tiroxina e acetilcolina
d) glucagon e adrenalina
e) adrenalina e acetilcolina
[E]
1450. A labirintite é uma inflamação e um de seus principais sintomas são distúrbios de equilíbrio como a tontura, que impede a pessoa de se locomover e até mesmo
de se levantar. Assinale a alternativa que apresenta a estrutura afetada.
a) cóclea b) canais semicirculares c) cerebelo
d) janela oval e) trompa de Eustáquio
[B]
1451. Examine a seguinte lista de eventos que ocorrem durante a propagação de um impulso nervoso:
I. Neurotransmissores atingem os dendritos.
II. Neurotransmissores não liberados pelas extremidades do axônio.
III. O impulso se propaga pelo axônio.
IV. O impulso se propaga pelos dendritos.
V. O impulso chega ao corpo celular.
Que alternativa apresenta a seqüência temporal correta desses eventos?
a) V - III - I - IV - II
b) I - IV - V - III - II
c) I - IV - III - II - V
d) II - I - IV - III - V
e) II - III - I - IV – V
[B]
1452. Os esquemas a seguir mostram, de forma simplificada, a condução do impulso nervoso:

Sabe-se que, no neurônio em repouso, há grande quantidade de íons sódio no meio externo e de potássio no meio interno (1). No momento em que o estímulo nervoso
se propaga (2), ocorre alteração de permeabilidade da membrana com intensa entrada de Na® e discreta saída de K®, o que leva o meio interno a ficar "positivo" e o
meio externo a ficar "negativo". Após a passagem do estímulo (3), normaliza-se a permeabilidade da membrana e a situação inicial é retomada.
Assinale a alternativa incorreta com relação ao mecanismo acima descrito:
a) esse mecanismo não depende de consumo de ATP (energia) para se realizar.
b) esse mecanismo depende do processo de respiração celular para se realizar.
c) nesse mecanismo, está envolvido movimento de entrada e de saída de íons do neurônio.
d) nesse mecanismo, constata-se a existência de transporte ativo de ions.
e) nesse mecanismo, constata-se inversão do estado elétrico da membrana do neurônio.
[A]
1453. A noção de equilíbrio e postura do corpo nos é fornecida:
a) pela janela oval do ouvido interno;
b) pelos canais semicirculares do ouvido médio;
c) pelo estribo do ouvido médio;
d) pelos canais semicirculares do ouvido interno;
e) pelo estribo do ouvido interno.
[D]
1454. O cerebelo, órgão do Sistema Nervoso Central, é responsável - entre outras funções - pela
a) visão. b) coordenação motora. c) salivação.
d) cor da pele. e) audição.
[B]
1455. A unidade estrutural e funcional do Sistema Nervoso humano é (são)
a) as fibras estriadas. b) os glomérulos. c) os hepatócitos.
d) os neurônios. e) as hemáceas.
[D]
1456. O gráfico a seguir mostra a variação do potencial da membrana do neurônio quando estimulado.

207
O potencial de ação para. um determinado neurônio:
a) varia de acordo com a intensidade do estímulo, isto é, para intensidades pequenas temos potenciais pequenos e para maiores , potenciais maiores.
b) é sempre o mesmo, porém a intensidade do estímulo não pode ir além de determinado valor, pois o neurônio obedece à 'lei do tudo ou nada'.
c) varia de acordo com a 'lei do tudo ou nada.
d) aumenta ou diminui na razão inversa da intensidade do
estímulo.
e) é sempre o mesmo, qualquer que seja o estímulo, porque o neurônio obedece à "lei do tudo ou nada".
[E]
1457. O controle da freqüência respiratória humana é feito pelo __________ baseado na taxa de __________ sangüíneo, que é transportado principalmente na forma de
__________ .
Assinale a alternativa que preenche correta e respectivamente os espaços da frase anterior.
a) cérebro; O2; oxiemoglobina
b) cerebelo; CO2; carboemoglobina
c) bulbo; CO2; bicarbonato
d) cerebelo; O2; oxiemoglobina
e) cérebro; CO2; bicarbonato
[C]
1458. Em alguns acidentes em provas automobilísticas, têm-se dado como causa de lesões sérias ou morte do piloto a desaceleração violenta sofrida pelo encéfalo,
mesmo que não haja fratura da caixa craniana. Porém, há um mecanismo de proteção do encéfalo, responsável por absorver os choques mecânicos, exercido:
a) pelas meninges.
b) pelo líqüido cefalorraquidiano.
c) somente pela aracnóide.
d) tanto pela aracnóide como pela dura-máter.
e) somente pela dura-máter.
[B]
1459. O sentido do tato é proporcionado pela presença de corpúsculos neuroepiteliais situados nas estruturas da pele e das mucosas. Os corpúsculos que percebem as
sensações de frio e pressão, nessa ordem, denominam-se:
a) Ruffini e Krause
b) Ruffini e Vater-Paccini
c) Ruffini e Meissner
d) Krause e Vater-Paccini
e) Krause e Meissner
[D]
1460. A observação do desenho a seguir nos permite concluir que, na passagem do impulso nervoso pelas sinapses, ocorre:

a) a liberação de mediadores químicos ou de neurormônios.


b) o contato direto do axônio de uma célula com os dendritos de outra célula.
c) o fenômeno da bomba de sódio e potássio entre as células.
d) a troca de cargas elétricas ao nível das sinapses.
e) o envolvimento da bainha de mielina, que atua como um isolante elétrico.
[A]
1461. Uma doença degenerativa do cerebelo humano provocará alterações, provavelmente,
a) nos movimentos respiratórios.
b) no equilíbrio do corpo.
c) na memória e no raciocínio.
d) na visão e na audição
e) nos batimentos cardíacos.
[B]
1462. Para que um impulso nervoso possa ser transmitido de um neurônio a outro, é necessária a liberação, na fenda sináptica, de mediadores químicos. Um desses
mediadores é a
a) insulina. b) tirosina. c) vasopressina.
d) acetilcolina. e) histamina.
[D]

208
1463. O ritmo respiratório, que depende da quantidade de determinado gás no sangue, é controlado pelo bulbo. Desta forma, considere as seguintes afirmações:
I - No caso de esforço físico, há uma diminuição da quantidade de oxigênio dissolvido no plasma, percebida pelo bulbo, o que prov oca aumento do ritmo respiratório.
II - Por estímulo do bulbo, ocorre contração do diafragma e conseqüente aumento do volume pulmonar, o que força a entrada de ar.
III - O controle exercido pelo bulbo é inconsciente.
Então apenas:
a) I está correta.
b) II está correta.
c) I e III estão corretas.
d) II e III estão corretas.
e) I e II estão corretas.
[D]
1464. No esquema a seguir, 1, 2 e 3 são, respectivamente, neurônios

a) motor, associativo e sensorial.


b) sensorial, motor e associativo.
c) sensorial, associativo e motor.
d) motor, sensorial e associativo.
e) associativo, sensorial e motor.
[A]
1465. A função do nódulo sinoatrial no coração humano é:
a) regular a circulação coronariana.
b) controlar a abertura e fechamento da válvula tricúspide.
c) funcionar como marcapasso, controlando a ritmicidade cardíaca.
d) controlar a abertura e fechamento da válvula mitral.
e) controlar a pressão diastólica da aorta.
[C]
1466. A sinapse é:
a) um tipo de fibra muscular envolvida no processo de contração cardíaca.
b) uma célula sangüínea envolvida na liberação de tromboplastina para o processo de coagulação.
c) um tipo de reprodução sexuada, que envolve a formação de gametas, realizada por protozoários ciliados.
d) uma região de contato entre a extremidade do axônio de um neurônio e a superfície de outras células.
e) um fenômeno que explica o fluxo de seiva bruta em espermatófitas.
[D]
1467. Possuem sistema nervoso, EXCETO:
a) Agnatos. b) Cnidários. c) Anelídeos.
d) Poríferos. e) Moluscos.
[D]
1468. O filme "O óleo de Lorenzo" conta a história de um menino afetado por uma doença chamada leucodistrofia, que leva a deficiências auditivas, visuais e motoras.
Essas deficiências devem-se à destruição da bainha de mielina das células nervosas.
Analise a figura a seguir, referente a uma célula nervosa na qual alguns componentes foram numerados de 1 a 4
Assinale a alternativa que contém o número correspondente à bainha de mielina.

a) 1 b) 2 c) 3 d) 4
[C]
1469. Estão numeradas de I a III, no esquema a seguir as partes fundamentais do neurônio, que são, respectivamente:

209
a) I - axônio; II - dendritos; III - corpo celular
b) I - axônio; II - corpo celular; III - dendritos
c) I - dendritos; II - axônio ; III - corpo celular
d) I - corpo celular; II - axônio; III - dendritos
e) I - corpo celular; II - impulso nervoso; III – sinapse
[D]
1470. O reflexo patelar ou rotuliano envolve a participação seqüencial dos seguintes componentes:
a) órgão receptor, via aferente, via eferente e órgão efetor.
b) órgão receptor, neurônios associativos e órgão efetor.
c) órgão receptor, via aferente, neurônios associativos, via eferente e órgão efetor.
d) via aferente e via eferente.
e) órgão receptor, neurônios associativos, via eferente e órgão efetor.
[A]
1471. Observando o esquema abaixo, que representa um neurônio em repouso, podemos afirmar que, nestas condições:

a) se a membrana do neurônio for atingida por um estímulo, as quantidades de íons Na + e K+ dentro e fora da membrana se igualam.
b) devido à diferença de cargas entre as faces externa e interna, o neurônio está polarizado.
c) a ocorrência do impulso nervoso depende de estímulos de natureza elétrica.
d) a quantidade de íons K+ é menor na parte interna do neurônio devido à sua saída por osmose.
e) as concentrações dos íons Na+ e K+ se fazem sem gasto de energia, sendo exemplo de transporte ativo.
[B]
1472. A figura abaixo mostra como o sistema nervoso regula a movimentação de um membro do corpo humano. Com o auxílio dela, j ulgue os itens seguintes.

(1) Embora a movimentação dos membros seja habitualmente voluntária, a figura mostra um ato reflexo.
(2) As setas A e B indicam o sentido de condução da informação nervosa.
(3) O corpo celular do neurônio motor está localizado dentro do sistema nervoso central.
(4) O movimento da perna depende da liberação de mediadores químicos nas sinapses nervosas e neuromusculares.
CECC
1473. A figura representa um arco-reflexo: o calor da chama de uma vela provoca a retração do braço e o afastamento da mão da fonte de calor. Imagine duas
situações: em A seria seccionada a raiz dorsal do nervo e em B, a raiz ventral.

210
Considere as seguintes possibilidades relacionadas à transmissão dos impulsos nervosos neste arco-reflexo:
I - A pessoa sente a queimadura, mas não afasta a mão da fonte de calor.
II - A pessoa não sente a queimadura e não afasta a mão da fonte de calor.
III - A pessoa não sente a queimadura, mas afasta a mão da fonte de calor.
Indique quais dessas possibilidades aconteceriam na situação A e na situação B, respectivamente,
a) A - I; B - II. b) A - I; B - III. c) A - II; B - I.
d) A - II; B - III. e) A - III; B - II.
[C]
1474. A respeito da sinapse representada abaixo, é correto afirmar que:

a) só está presente no sistema nervoso central.


b) o impulso nervoso passa de 2 para 1.
c) a liberação das substância presentes em 3 determina a passagem de impulso de um neurônio para outro.
d) as substâncias presentes em 3 são produzidas exclusivamente nas células desse sistema.
e) é possível haver contato físico entre 1 e 2.
[C]
1475. O dinitrofenol (DNP) é uma substância que interfere na produção de ATP. Se uma célula receber uma dose dessa substância, o processo de_______ será
prejudicado e conseqüentemente essa célula não poderá_______.
Assinale a alternativa que preenche correta e respectivamente as lacunas da frase anterior.
a) fotossíntese; se reproduzir
b) respiração celular; gerar impulsos nervosos
c) respiração celular; realizar osmose
d) fotossíntese; realizar difusão
e) respiração celular; realizar trocas gasosas
[B]
1476. As figuras a seguir esquematizam o sistema nervoso de uma hidra e de uma planária.

Com base nesses esquemas, fizeram-se as afirmações a seguir.


I. O sistema nervoso da planária pode ser considerado mais evoluído que o da hidra.
II. A hidra possui um centro nervoso, que envia ordens para todas as partes do corpo, enquanto a planária não apresenta centr alização do sistema nervoso.
III. O sistema nervoso da hidra é difuso e o da planária é ganglionar.
Dessas afirmações, somente
a) I é correta. b) II é correta. c) III é correta.
d) I e III são corretas. e) II e III são corretas.
[D]
1477. Segundo a revista britânica New Scientist, a doença "da vaca louca", que se acreditava acometer apenas bovinos, atinge também habitantes da Papua, na Nova
Guiné, afetando células do cérebro e causando descontrole motor.
As figuras numeradas a seguir indicam relações das células do sistema nervoso com outras estruturas.

211
A relação existente entre as células do sistema nervoso central e aquelas responsáveis pela atividade motora, prejudicada quando a referida doença ocorre, está
representada na figura de número:
a) 1 b) 2 c) 3 d) 4
[B]
1478. Podemos analisar a organização morfofuncional do sistema nervoso dos vertebrados quando observamos a reação do indivíduo ao tocar com a mão um objeto
muito quente: a musculatura do esqueleto é estimulada e ele retrai a mão da fonte de calor.
Esse fenômeno pode ser explicado pela atuação dos componentes da seguinte estrutura:
a) arco reflexo
b) cordão nervoso ventral
c) eixo hipotálamo- hipófise
d) rede nervosa epidérmica
[A]
1479. O vestibular é um momento decisivo na vida do estudante, o qual pode apresentar uma certa ansiedade antes e durante as provas.
Nesse momento, o organismo sofre intensas alterações fisiológicas.
Como um exemplo de alteração estimulada pelo sistema nervoso simpático, pode-se citar a(o):
a) contração da bexiga.
b) contração da pupila.
c) diminuição da pressão sangüínea.
d) aumento da freqüência cardíaca.
e) aumento da peristalse intestinal.
[D]
1480. Um motorista infrator, ao dirigir, na Via Costeira, em alta velocidade, perdeu o controle do carro numa curva, sofrendo um acidente. Ao chegar ao pronto-socorro,
diagnosticou-se uma isquemia cerebral (bloqueio da circulação nas artérias que fornecem sangue ao encéfalo) no lobo frontal do cérebro.
Como conseqüência, poderá haver comprometimento da capacidade do motorista para
a) piscar sob o estímulo de uma luz intensa.
b) salivar ao sentir o aroma de uma comida.
c) preencher uma ficha de identificação.
d) sentir dor ao encostar num ferro quente.
[C]
1481. Um gato com uma lesão no cerebelo, terá dificuldade de
a) respirar. b) alimentar-se. c) eliminar excretas.
d) equilibrar-se. e) produzir anticorpos.
[D]
1482. São células MAIS DIFERENCIADAS e com MENOR capacidade de reprodução:
a) neurônios b) epiteliais de revestimento
c) hepatócitos d) fibroblastos
[A]
1483. Relacione as estruturas apontadas na figura adiante com as respectivas funções.

( ) controle das emoções, percepção sensorial e controle motor.


( ) controle da respiração, digestão e batimentos cardíacos.
( ) controle do equilíbrio e tônus muscular.
( ) liga os hemisférios cerebrais ao cerebelo.
A seqüência encontrada, de cima para baixo, é:
a) 1, 3, 4, 2. b) 3, 2, 1, 4. c) 4, 2, 1, 3.
d) 2, 1, 4, 3. e) 3, 4, 2, 1.
[C]
1484. Nos testes de gravidez, a substância cuja presença é pesquisada na urina é:
a) o hormônio folículo estimulante.
b) o hormônio luteinizante.
c) a gonadotrofina coriônica.
d) o estrógeno.
e) a progesterona.

212
[C]
1485. Dois irmãos se originam de blastômeros provenientes de um mesmo zigoto.
Pode-se afirmar que os mesmos são gêmeos:
a) univitelinos e, obrigatoriamente, do mesmo sexo.
b) univitelinos, podendo ser de sexos diferentes.
c) fraternos e, obrigatoriamente, do mesmo sexo.
d) fraternos, podendo ser de sexos diferentes.
e) fraternos e, obrigatoriamente, de sexos diferentes.
[A]
1486. Alguns seres vivos, como as abelhas e os pulgões, conseguem produzir indivíduos sem que a fêmea receba o espermatozóide para fecundar o óvulo. Este
fenômeno é chamado de:
a) poliembrionia. b) partenogênese. c) metagênese.
d) nidação. e) filogenia.
[B]
1487. Inicialmente o pólipo reproduz-se assexuadamente, por brotamento, originando as medusas. Estas formarão gametas que depois se unirão para a formação dos
zigotos. Dos zigotos surgem larvas que nadam livremente até se fixarem para dar início a novos pólipos. Esse tipo de reproduç ão, denominado metagênese, ocorre nos
a) celenterados. b) poríferos. c) anelídeos.
d) moluscos. e) artrópodes.
[A]
1488. 'Apis melifera' é a espécie utilizada pelos apicultores do Vale do Paraíba para produzir mel, própolis, geléia real e outros produtos. Seus óvulos, se fecundados,
dão origem:
a) somente às fêmeas férteis.
b) somente aos machos férteis.
c) somente às fêmeas estéreis.
d) às fêmeas férteis e às estéreis.
e) somente aos machos estéreis.
[D]
1489. No processo evolutivo foram selecionados os seres de fecundação externa que liberam uma grande quantidade de gametas para o meio ambiente. As hidras, no
entanto, reproduzem-se rapidamente, embora lancem um pequeno número de gametas na água. A explicação para esse fato é que as hidras apresentam um acelerado
processo de reprodução:
a) assexuada por divisão binária.
b) assexuada por esporulação.
c) assexuada por brotamento.
d) sexuada por autofecundação.
e) sexuada por partenogênese.
[C]
1490. Os gêmeos univitelinos e os gêmeos fraternos originam-se, respectivamente:
a) de um óvulo fecundado por um espermatozóide e de um óvulo fecundado por dois espermatozóides.
b) de um óvulo fecundado por um espermatozóide e de dois óvulos fecundados por dois espermatozóides.
c) da fusão de dois óvulos com dois corpúsculos polares e de um óvulo fecundado por dois espermatozóides.
d) de um óvulo fecundado por dois espermatozóides e de dois óvulos fecundados por dois espermatozóides.
e) da fusão de dois óvulos com dois corpúsculos polares e de dois óvulos fecundados por dois espermatozóides.
[B]
1491. A esterilização masculina chamada vasectomia é um método contraceptivo que só deve ser utilizado por homens que não des ejam mais ter filhos, pois sua
reversão é muito difícil.
O processo da vasectomia consiste em:
a) inutilizar os tubos seminíferos para que os espermatozóides não sejam mais produzidos.
b) seccionar os canais deferentes, não sendo mais possível eliminação dos espermatozóides.
c) remover a vesícula seminal para que o sêmen fique bastante diminuído.
d) inocular hormônios nos testículos para dificultar a ereção do pênis.
e) alterar o funcionamento da próstata, reduzindo a quantidade de espermatozóides produzida.
[B]
1492. Observe as figuras que representam espermatozóides de vários tipos de animais.
Todas as alternativas contêm parâmetros que podem diferenciar esses espermatozóides, EXCETO

a) A dimensão da cabeça.
b) O formato da cabeça.
c) O grau de ploidia.
d) O tamanho da cauda.
e) O volume do citoplasma.
[C]
1493. A ocorrência de gravidez na adolescência tem aumentado consideravelmente. O conhecimento e o uso adequado de métodos contraceptivos podem reverter esse
problema.
Em relação a esses métodos, é CORRETO afirmar-se que
a) o diafragma impede a nidação da mórula.
b) o dispositivo intra-uterino, D.I.U, impede a chegada dos espermatozóides ao útero.
c) o método hormonal feminino, pílula, impede a ovulação.

213
d) o método de tabela é eficiente se forem evitadas relações sexuais entre o l2° e o l4° dia do ciclo.
e) o preservativo masculino, camisinha, tem ação espermicida.
[C]
1494. Observe a figura em que se representa um fenômeno biológico.

Todas as alternativas apresentam benefícios resultantes desse fenômeno, EXCETO


a) Aumento da aeração no solo.
b) Aumento da eficiência na ciclagem dos nutrientes na agricultura.
c) Aumento do número de consumidores favorecendo o fluxo de energia.
d) Maior disponibilidade de alimento para os peixes.
e) Manutenção da diversidade no ecossistema.
[D]
1495. Uma senhora deu à luz dois gêmeos de sexos diferentes. o marido, muito curioso, deseja saber informações sobre o desenvolvimento de seus filhos, a partir da
fecundação. O médico respondeu-lhe, corretamente, que:
a) dois óvulos foram fecundados por um único espermatozóide.
b) um óvulo, fecundado por um espermatozóide, originou um zigoto, o qual dividiu-se em dois zigotos, formando dois embriões.
c) um óvulo foi fecundado por dois espermatozóides, constituindo dois embriões.
d) dois óvulos, isoladamente, foram fecundados, cada um por um espermatozóide, originando dois embriões.
e) o uso de medicamentos durante a gestação causou alterações no zigoto, dividindo-o em dois.
[D]
1496. O desenvolvimento de um novo ser a partir de gametas femininos não fecundados, pode ser observado em alguns i nsetos e plantas, porém é muito raro em
mamíferos. Esse tipo de reprodução é conhecido como:
a) Partenogênese.
b) Brotamento.
c) Gametogênese.
d) Cissiparidade.
e) Esquizogênese.
[A]
1497. Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. Clones são seres vivos obtidos pelo desenvolvimento de células retiradas de
indivíduos já existentes. A clonagem é um processo que vem sendo desenvolvido rapidamente com vários organismos e, em humanos , encontra barreiras de ordem
ética. Sobre esse processo é CORRETO afirmar:
01. Os clones são como irmãos gêmeos fraternos do doador das células.
02. O material genético do doador das células e do clone é idêntico.
04. Se o doador das células possuir um defeito genético, como o albinismo, seu clone possuirá, também, essa anomalia.
08. Órgãos transplantados do clone para o doador das células serão sempre rejeitados.
16. Já existem seres humanos que foram originados e desenvolvidos plenamente por clonagem.
32. Se o doador de células sofrer a perda de um membro antes de ser realizada a clonagem, o organismo originado posteriormente, por esse processo, nascerá sem o
referido membro.
02 + 04 = 06
1498. Na(s) questão(ões) a seguir julgue os itens e escreva nos parentesses (V) se for verdadeiro ou (F) se for falso. Antigamente no Brasil era comum famílias com
número elevado de filhos. Hoje, vários fatores culturais, econômicos, sociais influenciam a opção dos casais por um número reduzido de filhos. Existem vários métodos
de contracepção, sobre eles julgue os itens.
( ) As pílulas anticoncepcionais podem ser usadas para inibir o desenvolvimento dos folículos ou então bloquear o proces so de ovulação.
( ) A laqueadura consiste na retirada do útero.
( ) O condon, popularmente conhecido como camisinha, é considerado um método contraceptivo de barreira, sendo também de enorme eficiência no controle de
doenças sexualmente transmissíveis.
VFV
1499. Observe a figura da célula representada a seguir e assinale a alternativa INCORRETA:

a) o flagelo, indicado pelo número 3, é a estrutura responsável pela locomoção.


b) é uma célula formada a partir da diferenciação de uma espermátide, após a meiose de uma espermatogônia.
c) o núcleo, indicado pelo número 2, é o local onde se encontra o material genético.
d) representa um gameta masculino, o qual é produzido no epidídimo.
e) o acrossomo, indicado pelo número 1, é a vesícula que contém enzimas necessárias à penetração no óvulo.

214
[D]
1500. Considere os processos adiante:
I. reprodução assexuada
II. reprodução sexuada
III. produção de indivíduos geneticamente idênticos
IV. meiose
Na formação de clones de organismos pluricelulares ocorrem, necessariamente, APENAS
a) I e II b) I e III c) I e IV
d) II e III e) III e IV
[D]
1501. Os gêmeos Renato e Marcelo e as gêmeas Cristina e Fernanda originaram-se de zigotos distintos. Já Eduardo e Rodrigo desenvolveram-se a partir de
blastômeros originados de um mesmo zigoto.
Assinale a alternativa correta relativa aos gêmeos citados:
a) Os três pares de gêmeos são fraternos.
b) Os três pares de gêmeos são univitelinos.
c) Dois dos pares de gêmeos são fraternos.
d) Apenas Eduardo e Rodrigo são gêmeos fraternos.
e) Apenas os gêmeos Renato e Marcelo e as gêmeas Cristina e Fernanda são univitelinos.
[C]
1502. São tipos de reprodução assexuada:
a) conjunção, bipartição e partenogênese;
b) divisão múltipla, brotamento e bipartição;
c) fecundação, conjunção e regeneração;
d) conjunção, divisão múltipla e bipartição;
e) bipartição, fecundação e partenogênese.
[B]
1503. A capacidade de regenerar órgãos perdidos é tanto maior quanto:
a) mais desenvolvido for o ser vivo.
b) menos desenvolvido for o ser vivo.
c) mais inteligente for o ser vivo.
d) mais bem adaptado for o ser vivo.
e) maior o metabolismo do ser vivo.
[B]
1504. Observe a legenda;
1. trompa de falópio
2. testículo
3. duto ejaculador
4. vagina
5. canal deferente
6. epidídimo
7. uretra
8. útero
Para que a fecundação ocorra, o espermatozóide deverá percorrer:
a) 2 - 6 - 5 - 3 - 7 - 4 - 8 - 1
b) 6 - 5 - 4 - 3 - 7- 8 - 1 - 2
c) 4 - 7 - 6 - 5 - 1 - 2 - 3 - 8
d) 3 - 2 - 5 - 7 - 6 - 4 - 8 - 1
e) 1 - 2 - 3 - 4 - 5 - 6 - 7 – 8
[A]
1505. O DIU (dispositivo intra-uterino) é um contraceptivo que tem como ação principal:
a) matar os espermatozóides.
b) impedir que os espermatozóides cheguem ao óvulo.
c) impedir a ovulação.
d) matar o óvulo no momento da ovulação.
e) impedir que o embrião se fixe à parede interna do útero.
[A]
1506. As Classes de Vertebrados em que se observa fecundação interna são:
a) peixes, anfíbios e répteis.
b) anfíbios, répteis e aves.
c) répteis, aves e mamíferos.
d) anfíbios, répteis e mamíferos.
e) peixes, anfíbios e mamíferos.
[C]
1507. Assinale a opção que indica os hormônios que atuam na liberação do óvulo (ovócito secundário):
a) ocitocina e estradiol
b) estradiol e progesterona
c) progesterona e folículo estimulante
d) luteinizante e gonadotrofina
e) folículo estimulante e luteinizante
[E]
1508. Na(s) questão(ões) a seguir, escreva no espaço apropriado a soma dos itens corretos. Considerando os conceitos gerais sobre Embriologia, é correto afirmar que:
01) Nos espermatozóides, as mitocôndrias situadas na região intermediária são as "centrais de energia" para a intensa atividade motora do flagelo.
02) Nos marsupiais os filhotes nascem prematuramente e completam seu desenvolvimento na bolsa marsupial.
04) A penetração de um único espermatozóide no óvulo caracteriza a monospermia. Há casos de polispermia, ou seja, entrada de mais de um espermatozóide no óvulo,
e isto caracteriza a formação de gêmeos.
08) Na segmentação do ovo ocorrem muitas mitoses, resultando muitos blastômeros de tamanhos cada vez menores.
16) O âmnio é o anexo embrionário que se constitui numa bolsa preenchida pelo líquido amniótico e que tem por função proteger o embrião contra choques mecânicos e
desidratação.
01 + 02 + 08 + 16 = 27
1509. Indivíduos hermafroditas costumam garantir a variabilidade genética através de:
a) partenogênese.

215
b) fecundação cruzada.
c) autofecundação.
d) brotamento.
e) estrobilização.
[B]
1510. Da gestação de uma mulher nasceram duas crianças. Sobre o fato foram levantadas algumas hipóteses. Assinale a CORRETA.
a) Se as crianças forem de sexos diferentes, sua origem foi por poliembrionia
b) Se forem dois meninos, pode ter ocorrido poliembrionia.
c) Se forem univitelinos, sua origem foi a poliovulação.
d) Se forem crianças idênticas, originaram-se pelo fenômeno da poliovulação.
e) Se as crianças forem do mesmo sexo, então, certamente, ocorreu o fenômeno da poliembrionia.
[B]
1511. Na(s) questão(ões) a seguir, escreva no espaço apropriado a soma dos itens corretos. Sobre os aspectos principais da em briologia dos cordados, é correto
afirmar que:
01 - Âmnio, alantóide e saco vitelínico são exemplos de anexos embrionários.
02 - O sexo do indivíduo é estabelecido por ocasião da fecundação.
04 - Denomina-se anfimixia o fenômeno da fusão dos pró-nucleos masculino e feminino.
08 - A sequência das fases no desenvolvimento embrionário é: zigoto, segmentação, gástrula e blástula.
16 - O tipo de segmentação depende, entre outros fatores, da quantidade de vitelo acumulada no ovo.
32 - Os mamíferos são animais diploblásticos, pois seus tecidos originam-se da ectoderme e endoderme.
01 + 02 + 04 + 16 = 23
1512. O hormônio feminino responsável pela ovulação denomina-se
a) progesterona.
b) estrógeno.
c) testosterona.
d) folículo estimulante (FSH).
e) luteinizante (LH).
[E]
1513. Os recentes avanços da Biotecnologia têm permitido a produção dos chamados Anticorpos Monoclonais, cujas aplicações se ampliam, já movimentando um
mercado gerador de centenas de milhões de dólares anuais. Uma das utilizações mais freqüentes se relaciona à pesquisa da gona dotrofina coriônica no sangue. Tal
técnica permite a detecção desta substância, mesmo quando presente em pequenas concentrações.
A presença da gonadotrofina no sangue humano representa:
a) Diagnóstico positivo para Hipertiroidismo.
b) Diagnóstico positivo para Hipotiroidismo.
c) Diagnóstico negativo para Hiperglicemia.
d) Diagnóstico positivo para Pancreatite.
e) Diagnóstico positivo para Gravidez.
[E]
1514. Em uma comparação sob o ponto de vista de favorecimento evolutivo e adaptação, a reprodução sexuada é mais importante que a assexuada. Qual das
alternativas a seguir, com relação à reprodução sexuada, melhor justifica esta afirmativa?
a) Sempre se processa após meiose que produz gametas.
b) É exclusiva de forma de vida mais evoluída.
c) Dá origem a um maior número de descendentes.
d) Permite uma maior constância no genoma dos descendentes.
e) Promove uma maior variabilidade genética na população
[E]
1515. A fecundação é o processo reprodutivo que se desencadeia pela fusão do gameta masculino com o feminino.
Marque a opção que apresenta o trajeto correto do espermatozóide desde o local de sua produção até o local onde acontece a fecundação.
a) Testículo → Epidídimo → Ducto Deferente → Uretra → Vagina → Útero → Tuba Uterina.
b) Testículo → Epidídimo → Túbulo Eferente → Uretra → Vagina → Útero → Tuba Uterina → Ovário.
c) Testículo → Ducto Deferente → Epidídimo → Uretra → Vagina → Útero → Tuba Uterina → Ovário.
d) Testículo → Ducto Deferente → Próstata → Uretra → Vagina → Útero → Tuba Uterina.
e) Testículo → Epidídimo → Túbulo Eferente → Uretra → Vagina → Útero → Tuba Uterina.
[A]
1516. " (...) Até a menopausa, as mulheres contam com uma proteção natural inexistente no metabolismo masculino. É................ - o hormônio sexual produzido nos
ovários. Sua presença no sangue reduz os níveis de colesterol "ruim" (o LDL e o VLDL), aumenta os de colesterol "bom" (HDL) e ajuda a preservar a parte interna das
artérias."
Assinale a alternativa que preenche corretamente a lacuna do texto.
a) a aldosterona
b) a insulina
c) a testosterona
d) a adrenalina
e) o estrógeno
[E]
216517. A figura a seguir mostra um útero humano contendo dois embriões em desenvolvimento.

Esses gêmeos possuem em comum


a) somente o âmnio.

216
b) somente a placenta.
c) somente o cório.
d) somente o cório e a placenta.
e) a placenta, o cório e âmnio.
[D]
1518. Bactérias formam clones desde o início da vida na Terra"
Hoje, algumas espécies de tatus produzem, por clonagem, de quatro a doze filhotes. Esse tipo de clonagem é possível porque:
a) a fêmea produz um grande número de ovos.
b) os zigotos formados são conseqüência de meioses constantes.
c) o zigoto formado é capaz de se dividir várias vezes.
d) a grande produção de gametas masculinos garante o desenvolvimento de zigotos.
e) as mitoses existentes em cada zigoto são conseqüência de recombinação gênica.
[C]
1519. Falando sobre reprodução de metazoários, o Prof. Francisco dispunha de cinco animais para uma aula prática:
1 - 'Schistossoma mansoni'
2 - mosca
3 - bolacha-da-praia
4 - sapo
5 - tartaruga
O Prof. Francisco pediu aos seus alunos que construíssem uma tabela, separando aqueles animais que tinham fecundação interna e externa. Marque a alternativa que
contém a separação CORRETA:
a) Interna: 1, 3 e 5 - Externa: 2 e 4
b) Interna: 3, 4 e 5 - Externa: 1 e 2
c) Interna: 1, 2 e 5 - Externa: 3 e 4
d) Interna: 2, 4 e 5 - Externa: 1 e 3
e) Interna: 4 e 5 - Externa: 1, 2 e 3
[C]
1520. Dois estudantes, nadando numa lagoa, observaram alguns organismos na água e estabeleceram o seguinte diálogo:
" - Olha os girinos, filhotes de sapo.
- Não são girinos, são alevinos.
- Mas. . . O que são alevinos?
- São filhotes de peixe, animais dióicos."
Com base nesse diálogo e em seus conhecimentos biológicos, é INCORRETO afirmar que
a) os alevinos são etapas do desenvolvimento dos peixes.
b) os girinos são etapas de metamorfose.
c) os peixes realizam fecundação cruzada.
d) os sapos realizam fecundação interna.
[D]
1521. Observe o esquema que representa parte do sistema reprodutor feminino.

Momentos após a ejaculação, vários espermatozóides percorrem a mucosa do útero e dirigem-se para uma das trompas. Parte destes espermatozóides encontram o
óvulo e liberam enzimas que enfraquecem as barreiras que o envolvem. Um espermatozóide entra em contato com a superfície do óvulo, e as membranas celulares e os
núcleos de ambos se fundem.
a) Quais são os fenômenos ocorridos em I e II, respectivamente?
b) Qual o nome da fase do desenvolvimento embrionário representada em III, e qual o processo de divisão celular ocorrido até a implantação observada em IV?
a) I - ovulação, II - fecundação ou fertilização.
b) III - mórula e o processo de divisão celular que ocorre até a implantação do embrião é a mitose.
1522. A vasectomia tem sido um dos recursos procurados atualmente por homens que não desejam ter filhos. A eficácia desse método anticoncepcional deve-se a.
a) impedimento da ejaculação.
b) ausência de espermatozóides no sêmen.
c) impedimento da produção de espermatozóides.
d) alteração do controle hormonal.
[B]
1523. Um professor apresentou à classe o seguinte problema:
- Qual deverá ser a variação do peso de um ovo de galinha, durante o processo de desenvolvimento embrionário do pintinho, até um dia antes de seu nascimento?
Os alunos apresentaram diferentes respostas expressas pelas curvas a seguir. Assinale a alternativa que mais se aproxima da resposta correta.

217
[B]
1524. Para que uma população sobreviva às mudanças que o ambiente sofre ao longo do tempo, é necessário que seus indivíduos
a) apresentem variabilidade genética.
b) cruzem-se com outros, de espécies diferentes e mais vigorosas.
c) apresentem apenas reprodução assexuada.
d) sofram os efeitos do isolamento geográfico ou do isolamento reprodutivo.
e) adquiram novas características hereditárias, por influência do ambiente em modificação.
[A]
1525. Assinale a alternativa correta quanto à fecundação externa.
a) É uma forma de reprodução assexuada.
b) Tem de ocorrer necessariamente na água.
c) Representa economia na formação de gametas.
d) Leva sempre a um desenvolvimento direto sem fase larval.
e) Ocorre unicamente em invertebrados.
[B]
1526. LIXO DE PROVETA
"Aproximadamente 3.3000 embriões humanos congelados foram dissolvidos em água e álcool na Inglaterra. Os chamados bebês de pr oveta, apesar de serem
fecundados em frascos de vidro, são mais tarde transferidos para o útero da mulher. A estrutura embrionária que funcionará como órgão de respiração e excreção do
embrião é o(a):
a) alantóide. b) âmnio. c) córion.
d) saco vitelínico. e) placenta.
[E]
1527. Pela observação do esquema a seguir, podemos concluir que o zangão foi originado por:

a) gametogênese.
b) partenogênese.
c) gemulação.
d) conjugação.
e) brotamento.
[B]
1528. Em relação reprodução humana, julgue os seguintes itens.
(0) Os testículos precisam de uma temperatura maior que a corporal para produzirem os espermatozóides.
(1) A obstrução total dos canais deferentes leva à esterilidade masculina.
(2) A pílula anticoncepcional torna os espermatozóides menos capazes de fecundar um óvulo, além de agir na parede do útero, i mpedindo a fixação do ovo.
(3) Os hormônios que regulam o ciclo menstrual geralmente favorecem a ocorrência da ovulação por volta da metade do ciclo.
(4) A formação dos gametas femininos inicia-se na puberdade.
Itens corretos: 1 e 3
Itens errados: 0, 2 e 4
1529. As figuras abaixo mostram as principais partes dos gametas masculino (em A, com aumento de 1.250 vezes) e feminino (em B, com aumento de 200 vezes).

218
Considerando os dados relativos às figuras apresentadas, julgue os itens que se seguem.
(1) A estrutura I é pobre em enzimas.
(2) A energia necessária para o batimento do flagelo provém da estrutura II.
(3) Na espécie humana, a produção dos gametas representados pela figura A é muito maior que a dos representados pela figura B .
(4) No processo de fecundação, a membrana celular da célula B sofre significativas modificações.
ECCC
1530. Os gráficos mostrados na figura abaixo representam as variações nos níveis dos hormônios hipofisários e ovarianos durante o ciclo menstrual da mulher.

Com o auxílio dos gráficos, julgue os seguintes itens.


(1) O primeiro dia do ciclo menstrual corresponde ao primeiro dia da menstruação.
(2) O aumento da taxa de FSH induz o desenvolvimento dos folículos ovarianos.
(3) No momento da ovulação, as taxas de estrógenos e de LH estão elevadas.
(4) Os gráficos ilustram a situação que ocorre em mulheres que estão sob efeito de pílulas anticoncepcionais.
CCCE
1531. Após ser fecundado, o óvulo humano passa a se chamar ovo e multiplica-se para formar o embrião. Inicialmente, são duas, depois, quatro células, que, com o
passar do tempo, originam os órgãos e os sistemas. A figura abaixo ilustra embriões humanos com diferentes idades.

Com o auxílio do texto e da figura, julgue os itens que se seguem.


(1) A fecundação promove aumento da variabilidade genética.
(2) O embrião de 18 dias formou-se por diferenciação celular do zigoto e subsequente proliferação deste.
(3) Aos 24 dias de idade, o embrião é constituído por três folhetos embrionários, que originarão os tecidos do organismo.
(4) A ação das drogas psicotrópicas e medicamentosas é muito mais prejudicial ao embrião após a oitava semana de gravidez.
CEEE
1532. O tema da fecundação "in vitro" tem aparecido com freqüência nos meios de comunicação, seja pelo uso por pessoas famosas, seja pelo debate ético suscitado,
por exemplo, pela destruição massiva de embriões humanos. Basicamente, a técnica de fecundação "in vitro" consiste nos seguin tes passos:
I - indução de superovulação na mulher com o uso de hormônios;
II - cirurgia para a extração dos óvulos maduros (cerca de oito);
III - fecundação "in vitro" dos óvulos por espermatozóides;
IV - introdução de cerca de quatro dos embriões resultantes no útero da mulher; e
V - congelamento dos embriões restantes em N‚ líquido, na maioria das vezes.
Mesmo com esse procedimento, utilizando-se vários embriões, a gravidez ocorre em cerca de apenas 30% dos casos, nas clínicas mais avançadas.
Considerando o exposto anteriormente, julgue os itens que se seguem.
(0) A probabilidade de nidação será maior ou menor, dependendo da fase do ciclo menstrual em que se encontra a mulher que recebe os embriões .
(1) O passo I é necessário porque, normalmente, só amadurecem dois óvulos por mês, um em cada ovário.
(2) Se, no passo IV, houver nidação de dois embriões, haverá o nascimento de gêmeos idênticos.
(3) O passo V preserva os embriões pela drástica diminuição do metabolismo desses.
Itens corretos: 0 e 3
Itens errados: 1 e 2
1533. Para os namorados que este mês estão celebrando a paixão, a atração física é um botão mágico que só o amor é capaz de ligar. Mas, para os cientistas, o
desejo sexual é um processo bioquímico que desequilibra rapidamente todo o corpo, diagnosticável por vários sintomas. Não se consegue tirar os olhos "daquela"

219
pessoa, o coração dispara, as mãos suam, dá vontade de falar pelos cotovelos, as pernas ficam meio bambas, a fome desaparece e é preciso suspirar profundamente
para respirar melhor.
Com o auxílio do texto, julgue os itens seguintes.
(1) Os sintomas do desejo sexual dependem de fatores psicológicos, que variam de um indivíduo para outro, para que sejam desencadeados.
(2) Receptores táteis e quimiorreceptores permitem ao sistema nervoso perceber o afago e o perfume da pessoa amada.
(3) A palidez que uma pessoa pode apresentar ao ser paquerada é conseqüência da interação dos sistemas nervoso e circulatório.
(4) A coordenação endócrina provoca respostas mais rápidas que a coordenação nervosa.
(5) O apaixonado ofega porque perde o controle voluntário do ritmo da respiração.
Itens corretos: 1, 2 e 3
Itens errados: 4 e 5
1534. Observe o esquema a seguir, que ilustra a formação de gêmeos:

Os indivíduos que se desenvolverão, a partir dos embriões assinalados no esquema, resultam, na maioria dos casos, da fertiliz ação de:
a) um ovócito por um espermatozóide
b) dois ovócitos por um espermatozóide
c) um ovócito por dois espermatozóides
d) dois ovócitos por dois espermatozóides
[D]
1535. O fenômeno da fecundação humana envolve o espermatozóide em uma série de eventos seqüenciais até a penetração no ovócito, conforme esquema a seguir:

Das regiões que normalmente devem ser atravessadas pelo espermatozóide para que ocorra a fecundação, aquela que envolve o fen ômeno de reação acrosômica é:
a) a zona pelúcida
b) o espaço perivitelino
c) a membrana plasmática
d) a camada de células foliculares
[A]
1536. A eficiência dos métodos anticoncepcionais mais utilizados pode ser verificada observando-se o quadro a seguir:

a) Explique por que o método da tabela é um dos menos seguros.


b) O método da pílula anticoncepcional diferencia-se dos demais em relação à forma pela qual se evita a gravidez. Explique por quê.
a) Porque o ciclo menstrual das mulheres não é sempre regular.
b) A pílula é o único método que impede a liberação do gameta através de hormônios que interferem no ciclo menstrual.
1537. Observe as figuras.

220
Com base nas figuras e em conhecimentos sobre o assunto, é INCORRETO afirmar que
a) a corte sexual é um comportamento adaptativo necessário para ovulação da galinha.
b) o comportamento do macho é estimulado pela ação da testosterona.
c) o agachamento sexual facilita o encontro das cloacas para introdução do sêmen na fêmea.
d) o macho se diferencia da fêmea quanto ao tamanho da crista e das penas e pelo canto.
[A]
1538. Com o auxílio da figura abaixo, na qual são apresentadas etapas do desenvolvimento do embrião e do feto humanos, julgue os itens seguintes.

(1) A frase "a ontogenia repete a filogenia" é válida para todas as etapas de desenvolvimento mostradas na figura.
(2) O período de organogênese inicia-se após 28 dias da fecundação.
(3) Durante as etapas da gravidez mostradas na figura, o organismo da mulher apresenta modificações hormonais profundas.
(4) No início do desenvolvimento embrionário, as divisões celulares acontecem após as células atingirem crescimento máximo.
FFVF
1539. As pílulas anticoncepcionais femininas possuem substâncias que:
a) provocam a morte dos espermatozóides na entrada do colo do útero.
b) inibem o batimento flagelar dos espermatozóides.
c) tornam a parede do óvulo impenetrável para o espermatozóide.
d) provocam o fechamento das tubas uterinas.
e) impedem a ocorrência do fenômeno da ovulação.
[E]
1540. Há casos em que óvulos não fecundados dão origem a um animal. Nesse caso,