Você está na página 1de 2

pPROTet.E 6xHN Vector Information GenBank Accession No. Submission in progress.

PT3400-5

Sold as part of Catalog No. 631203

RBS 6xHN tag Aat II Xho I EK site (2080) (2151) MCS Xba I (238)
RBS
6xHN tag
Aat II
Xho I
EK site
(2080)
(2151)
MCS
Xba I (238)
Avr II (349)
P LtetO-1
I T1
III
pPROTet.E
Cm r
. kb
II
Col E1
ori
t 0
Sac I
(1279)
Spe I
(1163)
pPROTet.E Promoter
–33
–10
1
tetO 2
hexamer
tetO 2
hexamer

–33 –10 1 tetO 2 hexamer tetO 2 hexamer •
–33 –10 1 tetO 2 hexamer tetO 2 hexamer •
–33 –10 1 tetO 2 hexamer tetO 2 hexamer •
–33 –10 1 tetO 2 hexamer tetO 2 hexamer •
–33 –10 1 tetO 2 hexamer tetO 2 hexamer •

TCGAGTCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACATCAGCAGGACGCACTGACCGAATTC

86

RBS

ATTAAAGAGGAGAAAGGTACCCATG GGT Kpn I

156

86 RBS ATTAAAGAGGAGAAAGGTACCC ATG GGT Kpn I 156 6xHN tag CAT AAT CAT AAT CAT AAT

6xHN tag

CAT AAT CAT AAT CAT AAT CAT AAT CAT AAT CAC AAC

GGT GGA

EcoR I

EK site

GAT GAC GAT GAC AAG

pPROTet.E MCSs

171

pPROTet.E133 (reading frame 1):

STOPS

•

GTG GTC GAC AAG CTT GGA TCC CTG CAG GCC TCA GGG CCC GAT CGA TGC GGC CGC TTA ATT AAT TAA TCT AGA

Apa I

Sal I

Hind III

BamH I

Pst I

Pvu I

Cla I

+

Not I

Pac I

Ase I

Xba I

171 pPROTet.E33 (reading frame , * indicates added base):

*

STOPS

(reading frame , * indicates added base): • * STOPS GGT GGT CGA CAA GCT TGG

GGT GGT CGA CAA GCT TGG ATC CCT GCA GGC CTC AGG GCC CGA TCG ATG CGG CCG CTT AAT TAA TTA ATC TAG A

Sal I

Hind III

BamH I

Pst I

Apa I

Pvu I

Cla I

+

Not I

171

pPROTet.E333 (reading frame 3, * indicates deleted base):

Pac I

Ase I

STOPS

Xba I

indicates deleted base): • Pac I Ase I STOPS Xba I G * GG TCG ACA

G*GG TCG ACA AGC TTG GAT CCC TGC AGG CCT CAG GGC CCG ATC GAT GCG GCC GCT TAA TTA ATT AAT CTA GA

Sal I

Hind III

BamH I

Pst I

Apa I

Pvu I

Cla I

+

Not I

Pac I

Ase I

Xba I

Restriction Map and Promoter/MCS of the pPROTet.E 6xHN Vectors. All restriction sites shown are unique. The promoter region (bases 1–170) is common to all three vectors.

Notes:

• The attached sequence file and the numbering of the map above are for pPROTet.E133. pPROTet.E133 is one base shorter than pPROTet.E233 and one base longer than pPROTet.E333, as indicated by the asterisks (*) in the MCS diagrams.

• DNA methylation inhibits digestion at the Cla I site (+) in all three vectors. If you wish to use this site to construct new vectors, propagate these vectors in a dam strain.

• The pPROTet.E333-lacZ Control Vector was constructed by cloning the lacZ gene into pPROTet.E333 at the Hind III and Pst I sites.

(PR38331; published 21 August 2003)

pPROTet.E 6xHN

Vector Information

Description:

The pPROTet.E 6xHN vectors, part of the Pro™ Bacterial Expression System (1–4), are highly inducible, tetracycline- regulated bacterial expression vectors available in three reading frames (see sequence on page 1). These vectors contain three modules separated by unique Aat II, Xba I, and Sac I sites to allow for the creation of other vectors by substituting for individual modules.

• Module I (Aat II–Xba I):

Contains the novel hybrid P LtetO-1 promoter, a ribosome binding site (RBS), a 6xHN affinity tag, an enterokinase (EK) site for removal of the 6xHN affinity tag following protein expression, and a multiple cloning site (MCS). The P LtetO-1 promoter takes advantage of the high expression levels from the P L promoter of phage λ, but has had the lambda repressor sites replaced with two copies of operator 2 of the Tn10 tetracycline resistance operon. This new promoter is thus tightly repressed by the Tet repressor protein and induced in response to tetracycline (Tc) and Tc derivatives such as anhydrotetracycline (aTc, Cat. No. 631310), allowing quantitative control of expres - sion over a wide range. Unique EcoR I and Kpn I sites are also located near the RBS to allow cloning upstream or downstream of the RBS, respectively.

• Module II (Xba I–Sac I):

Contains the Col E1 origin of replication and the T1 and t 0 transcription termination sequences.

• Module III (Sac I–Aat II):

Contains the chloramphenicol resistance gene (Cm r ).

Use:

The PROTet.E 6xHN Vectors combine a highly-inducible, tightly-regulated, novel hybrid regulatory unit with a high- copy replication origin to deliver a 2,500-fold range of expression. Gene expression is induced from these vectors in response to the presence of Tc or aTc. The extensive MCS allows cloning at a variety of restriction sites in different frames relative to the RBS and 6xHN tag. The 6xHN epitope is specifically designed to permit rapid and efficient purification of expressed proteins using IMAC resins such as TALON ® resin. pPROTet.E 6xHN Vectors can be used with our PROLar Vectors, which contain a different promoter, for simultaneous expression of two independently regulated genes of interest in the same cell.

Location of Features:

P LtetO-1 hybrid promoter/operator: 6–79

• 5' PROTet Seq Primer binding site: 57–78

• Ribosome binding site: 87–100

• Start codon: 108–110

• 6xHN epitope tag sequence: 114–149

• Enterokinase cleavage site: 156–170

• T1 transcription termination sequence: 243–347

• 3' PROTet Seq Primer binding site: 355–372

• Col E1 origin of replication: 496–1095

• t 0 transcription termination sequence: 1168–1273

• Chloramphenicol resistance gene (Cm r ): 1289–1948

Propagation in E. coli:

• Suitable host strains: DH5αPRO and BL21PRO

• Selectable marker: plasmid confers resistance to chloramphenicol (34 µg/ml) on E. coli hosts

E. coli replication origin: Col E1

• Copy number: high

References:

1. Lutz, R. & Bujard, H. (1997) Nucleic Acids Res. 25(6):1203–1210.

2. PRO Bacterial Expression System (1997) Clontechniques XII(4):6–8.

3. PRO Inducible Bacterial Expression System (1998) Clontechniques XIII(4):18–19.

4. PROTet 6xHN Bacterial Expression System (1999) Clontechniques XIV(4):24–25.

Note: The attached sequence file has been compiled from information in the sequence databases, published literature, and other sources, together with partial sequences obtained by Clontech. This vector has not been completely sequenced.

Notice to Purchaser This product is intended to be used for research purposes only. It is not to be used for drug or diagnostic purposes, nor is it intended for human use. Clontech products may not be resold, modified for resale, or used to manufacture commercial products without written approval of Clontech Laboratories, Inc. Clontech, Clontech logo and all other trademarks are the property of Clontech Laboratories, Inc. Clontech is a Takara Bio Company. ©2005

Clontech Laboratories, Inc.

www.clontech.com

Protocol No. PT3400-5 Version No. PR38331