Você está na página 1de 13

SUMÁ

SUMÁRIO

•História da Genética Molecular;


•Organização e estrutura dos genomas;

GENÉTICA MOLECULAR •DNA e RNA


•Dogma Central
9Replicação
9Transcrição
9Tradução
Daniel Macedo de Melo Jorge •Genes e genomas;

danielmacedo.jorge@gmail.com
•Técnicas Genética Molecular
9PCR
9Sequenciamento
9EST

O QUE É GENÉ
GENÉTICA? O QUE É GENÉ
GENÉTICA?

• É o estudo dos genes e de sua transmissão para as Escala Comparativa


gerações futuras.
Terra Célula
• É dividida em:
- Genética Clássica Æ Mendel (1856 – 1865) País Cromossomo
“unidade fundamental da hereditariedade”

- Genética Moderna Æ Watson e Crick (1953)


“pedaço de DNA que codifica uma proteína” Estado Fragmento
cromossômico

Município
Gene

Pessoas Bases de
pares

Acontecimentos na gené
genética Acontecimentos na gené
genética
e genômica e genômica
Acontecimentos na gené
genética
e genômica

Ácido desoxirribonuclé
desoxirribonucléico - DNA

A estrutura do DNA A dupla hé


hélice de DNA

•DNA é o material genético


•Estrutura regular (difração de Raio-X)
•Fitas complementares de nucleotídeos
•Dupla hélice
•DNA associado a proteínas

Nucleotí
Nucleotídeo – A unidade de
A estrutura do DNA
construç
construção do DNA

•Nucleotídeo:
- Açúcar: pentose, desoxirribose
- Fosfato
- Bases nitrogenadas:
- Purina: Adenina guanina
- Pirimidina: citosina timina
- Pareamento
- Ligadas por pontes de hidrogênio

•Ligações fosfodiester
•Quantidade de A = quantidade de T
•Quantidade de G = quantidade de C
Desoxirribose:
o açú
açúcar
car do DNA Bases nitrogenadas

Purinas Pirimidinas

Principais Tipos de RNA

•RNA mensageiro (mRNA): contém a informação genética


para a seqüência de aminoácidos das proteínas

Ácido ribonuclé
ribonucléico - RNA •RNA transportador (tRNA): identifica e transporta os
aminoácidos até o ribossomo

•RNA ribossômico (rRNA): constituinte dos ribossomos

Ribonucleotí
Ribonucleotídeo – O bloco RNA: um ácido nuclé
nucléico com
de construç
construção do RNA estrutura quí
química diferente do DNA
Dogma Central da Biologia
DNA x RNA Molecular

Replicação
DNA RNA
Desoxirribose Ribose
Transcrição
Transcrição
A; G; C; T A; G; C; U Reversa

Dupla fita Fita simples; dobrada


Replicação de
RNA
Armazena informações Transporta
informações; funções Tradução
estrutural e catalítica
Molécula grande Molécula pequena

Proteína

Regras bá
básicas do processo de
Replicaç
Replicação replicaç
replicação do DNA

•Processo semiconservativo
•Início da replicação
•É o processo na qual o - Origem
DNA é duplicado, a partir •Movimento da forquilha de replicação
da fita molde.
- Unidirecional ou bidirecional
•Direção da replicação
- 5’ Æ 3’
•Semidescontinuidade da replicação

Enzimas que participam da


Replicaç
Replicação
replicaç
replicação

•DNA Polimerase
•SSB (Single Strand Binding Protein)
•Primase
•Helicases (DnaB)
•Topoisomerases
•DNA ligase
Transcriç
Transcrição Caracterí
Características da transcriç
transcrição

•É o processo pelo qual uma molécula de RNA é


sintetizada a partir da informação contida na
•RNA é imediatamente liberado do DNA
sequência de nucleotídeos de uma molécula de •Produção simultânea de muitas cópias a partir
DNA de fita dupla do mesmo gene
- Gene com 1.500pb
•Transcrição = 50 segundos
•15 RNA-polimerase/gene
•1 hora = milhares de transcritos

Transcriç
Transcrição Transcriç
Transcrição

DNA fita codificadora


DNA fita molde

RNA transcrito

Processamento do mRNA Íntrons e Éxons


introns
exons
•Íntron – região não-codificante de um
gene, transcrita na mólecula de RNA, mas
removida pelo processamento do RNA
Processamento do transcrito primário
- 80 a 10.000 nucleotídeos

Excisão dos exons •Éxon – Seguimento de um gene formado


por uma seqüência de nucleotídeos que
serão representados no RNA
União dos exons

•Processamento: processo de remoção de


íntrons e junção de éxons no RNA
mensageiro de eucariotos
Traduç
Tradução Traduç
Tradução

•Processo na qual uma seqüência de


mRNA é convertido em uma proteína.

Código Gené
Genético Código Gené
Genético

Características do código genético

•Tríplice: 3 bases = códon codificam um aa


• Conceito: •Degenerado ou redundante: um mesmo aminoácido pode ser
São as instruções para sintetizar codificado por vários códons diferentes
moléculas protéicas e estão inscritas em •Não é ambíguo: cada códon é corresponde a somente um
código nas moléculas de DNA dos aminoácido
organismos vivos. •Com sentido: Start códon a um stop códon;
•Universal: o mesmo para todos seres vivos
•Utilização preferencial de codons: codon usage

Código Gené
Genético Código Gené
Genético

Trincas do Código Genético

• Cada trinca de nucleotídeo do DNA corresponde a um aa na


proteína.
• A combinação das 4 letras genéticas TACG, 3 a 3, permite
obter 64 trincas diferentes.
• 61 correspondem a aminoácidos e 3 correspondem a códons
de terminação; UAA, UAG e UGA.
Traduç
Tradução Resumo da traduç
tradução

DNA fita codificadora


DNA fita molde

RNA transcrito

Arg-Tyr-Ser-Val Proteína traduzida

Os Genomas Os Genomas

DNA Fita
Fita simples Organismos Procarióticos: Bactérias
Vírus DNA ou
ou RNA
RNA simples

Fita
Fita Dupla
Dupla
Células DNA
DNA ee RNA
RNA Cromossomo
Plasmídeo
Procarióticas
Procarióticas Eucarióticas
Eucarióticas

Cromossomo
Cromossomo Cromossomo
Cromossomo
Plasmídios
Plasmídios Mitocôndrias
Mitocôndrias
Cloroplastos
Cloroplastos

Os Genomas Os Plasmí
Plasmídios

• Cromossomo + Plasmídeos “Elemento genético, extra-cromossômico, capaz


de replicar independente do cromossomo”
• O genoma da E. coli - Dupla fita de DNA; Circular
- 4.639 kb - 1 – 100(+) Kb; < 1/20 do cromossomo

- 2.400 genes • Diferentes dos vírus


- Não causam danos às células
- 80% da molécula de DNA - Não são formas extracelulares
- 1.897 genes codificantes de proteínas
• Diferentes do cromossomo
- Não contém genes essenciais
O Genoma Humano

23 cromossomos
31.000 genes
3.000 milhões de bases
O Genoma dos Organismos
Eucarió
Eucarióticos

O Genoma Humano O Genoma dos Eucarió


Eucarióticos
Família

• O genoma nuclear:

- E. coli: 2.400 genes; 1.897 codificam proteínas


Célula
- Saccharomyces cerevisiae: 6.600 genes; 5.800
codificam proteínas Exemplos utilização
- Humanos: 100.000 genes, codificam proteínas;
Genoma
nuclear
genes > (+ íntrons)

Genoma mitocondrial

Compactaç
Compactação do DNA em
O Genoma dos Eucarió
Eucarióticos
Cromossomos

•Genoma humano:
• Genoma humano
- Éxons
70% - 23 cromossomos - 1 metro
-Íntrons
- ½ DNA + ½ Proteínas
- DNA repetitivo (não essencial ?)
•Proteínas
- 30%
- RNA polimerase, DNA polimerase, reguladoras, Histonas
- Não codifica
- Não transcreve •Cromatina
- Repetidas muitas vezes - DNA-Proteína Æ Compactação do DNA
Técnicas de Gené
Genética Reaç
Reação em Cadeia da
Molecular Polimerase - PCR

•1983: Kary Mullis


•PCR
•1985: 1º artigo
•Sequenciamento
•Processo patenteado em
•EST 1989 por Cetus Corporation
& Hoffman-LaRoche

•1993: Nobel da Química

PCR PCR

•É difícil exagerar o impacto da PCR na Biologia Molecular


•Grande quantidade de DNA em pouco tempo.
•Baixo custo
•Simplificou e democratizou as técnicas de Biologia
•A amostra de DNA não necessita de estar altamente
Molecular
purificada
•PCR pode amplificar uma única molécula de DNA / RNA
•Possibilitou extender a Biologia Molecular para disciplinas
•O produto do PCR pode ser digerido com enzimas de
nunca pensadas como Ecologia, Direito, Arqueologia,
restrição, sequenciado ou clonado.
Economia, etc.

O que é necessá
necessário? Termocicladores

Mg2+
DNA
polimerase
dCTP
dGTP Iniciadores
dNTPs
dTTP
dATP

Em solução tampão de PCR, H2O ultra-filtrada (pH 7,0)


e óleo mineral.
Mecanismo Desnaturaç
Desnaturação

• Divide-se em 3 passos principais, que se repetem por •Processo no qual ocorre a separação da
25 a 35 ciclos: fita dupla de DNA por meio da elevação da
- Desnaturação temperatura.
- Hibridação
- Extensão

• A quantidade de DNA final segue


uma função exponencial, onde:
N=N0.2n
•N: número final de cadeias de DNA
•N0: número inicial de DNA molde (template)
www.dbbm.fiocruz.br/helpdesk/mbiology/PCRcurso.pdf
•As amostras são aquecidas a 94-96 ºC
•n: número de repetições do ciclo durante um a vários minutos.

Hibridaç
Hibridação Extensão

•A temperatura é reduzida a 55-65 ºC durante • Eleva-se a temperatura a 72ºC durante 2 minutos.


alguns minutos.

• O DNA polimerase atua junto dos iniciadores


que hibridaram, começando a duplicação da
•Os iniciadores hibridam com as seqüências
cadeia e recrutando no meio os nucleótidos
complementares do Molde.
complementares disponíveis.

Sequenciamento Sequenciamento

•Método didesoxi conhecido também como de


Reação de
terminadores de cadeia ou de Sanger
Sequenciamento

Molde

Taq
polimerase

Primer

Deoxinucleotídeos

Dideoxinucleotídeos
Polimerizaç
Polimerização de DNA Polimerizaç
Polimerização de DNA

G
C C
T T T A T T T T
C T G C G
C C
C A A G T T C AA A T
C A A G T
C A A C T T C A A C T T
G T G G G T GG G
A T G C AGT
A C CC C A T G A C CC TC A G
5’ 3’ G 5’ 3’ G
ATGCTTC A ATGCTTC A
||||||| |||||||||
TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA
3’ 5’ 3’ 5’

Polimerizaç
Polimerização de DNA Polimerizaç
Polimerização de DNA

T C T C
C T G A G C T T
C
T A A GA T T A T T TT C T AC
C C T G
C A AC T T T G C CA A GC
G T G G
G AC A T G
G C A T A G
G T G A
C A
A C C C A T G GC A C
5’ 3’ G 5’ 3’
ATGCTTCTG
ATGCTTCTG A ATGCTTCTGGCAGATCT
ATGCTTCTGGCAGATCT
|||||||||| |||||||||||||||||
TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA
3’ 5’ 3’ 5’

Polimerizaç
Polimerização de DNA Polimerizaç
Polimerização de DNA

A
T GAA
T T G A
C A TT C AAT G C G T T T T
T GA G C T C
C CA C A GC TT T GT GT C T AA
G T C A GT A G
G A T G
C C
C G CA GC A T
A C CC AC
CC
5’ 3’ G G 5’ 3’
ATGCTTCTGGCAGATCT
ATGCTTCTGGCAGATCT A ATGCTTCTGGCAGA
ATGCTTCTGGCAGAT
T
||||||||||||||||| |||||||||||||||
TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA
3’ 5’ 3’ 5’
Polimerizaç
Polimerização de DNA Polimerizaç
Polimerização de DNA

CC A A T
T T T TT GAA T GAA CC T
G A G A T
C G C A G T GT
GT GT C T AA G A G C T G G C T
T C T AA C G
A G T T T C T G
C G C CA C C C CA GC A
AC AC
5’ 3’ 5’ 3’
ATGCTTCTGGCAGA
ATGCTTCTGGCAGAT
T ATGCTTCTGGCAGA
ATGCTTCTGGCAGAT
T
||||||||||||||| |||||||||||||||
TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA
3’ 5’ 3’ 5’

Seqü
Seqüenciamento de DNA Gel de sequenciamento de DNA
ATGCTTCT
ATGCTTCT
ATGCTTCT
ATGCTTCTG
ATGCTTCTG
ATGCTTCTGG
G
ATGCTTCTGG
ATGCTTCTGGCC
ATGCTTCTGGC
ATGCTTCTGGCAA
ATGCTTCTGGCA
ATGCTTCTGGCAG G
ATGCTTCTGGCAG
ATGCTTCTGGCAGA A
ATGCTTCTGGCAGA
ATGCTTCTGGCAGAT T
ATGCTTCTGGCAGAT
ATGCTTCTGGCAGATC C
ATGCTTCTGGCAGATC
ATGCTTCTGGCAGATCT T
ATGCTTCTGGCAGATCT
ATGCTTCTGGCAGATCTG G
ATGCTTCTGGCAGATCTG
ATGCTTCTGGCAGATCTGA A
ATGCTTCTGGCAGATCTGA
ATGCTTCTGGCAGATCTGAA A
ATGCTTCTGGCAGATCTGAA
ATGCTTCTGGCAGATCTGAAC C
ATGCTTCTGGCAGATCTGAAC
ATGCTTCTGGCAGATCTGAACA A
ATGCTTCTGGCAGATCTGAACAG
ATGCTTCTGGCAGATCTGAACA G
ATGCTTCTGGCAGATCTGAACAG
ATGCTTCTGGCAGATCTGAACAGT T
ATGCTTCTGGCAGATCTGAACAGT
ATGCTTCTGGCAGATCTGAACAGTG G
ATGCTTCTGGCAGATCTGAACAGTG
ATGCTTCTGGCAGATCTGAACAGTGT T
ATGCTTCTGGCAGATCTGAACAGTGT
ATGCTTCTGGCAGATCTGAACAGTGTT T
ATGCTTCTGGCAGATCTGAACAGTGTT
ATGCTTCTGGCAGATCTGAACAGTGTTA A
ATGCTTCTGGCAGATCTGAACAGTGTTA
ATGCTTCTGGCAGATCTGAACAGTGTTAC C
ATGCTTCTGGCAGATCTGAACAGTGTTAC
ATGCTTCTGGCAGATCTGAACAGTGTTACT T
ATGCTTCTGGCAGATCTGAACAGTGTTACT
ATGCTTCTGGCAGATCTGAACAGTGTTACTG G
ATGCTTCTGGCAGATCTGAACAGTGTTACTG
ATGCTTCTGGCAGATCTGAACAGTGTTACTGA A
ATGCTTCTGGCAGATCTGAACAGTGTTACTGA
ATGCTTCTGGCAGATCTGAACAGTGTTACTGAT T
ATGCTTCTGGCAGATCTGAACAGTGTTACTGAT
ATGCTTCTGGCAGATCTGAACAGTGTTACTGATA A
ATGCTTCTGGCAGATCTGAACAGTGTTACTGATA
ATGCTTCTGGCAGATCTGAACAGTGTTACTGATAT T
ATGCTTCTGGCAGATCTGAACAGTGTTACTGATAT
ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATT T
ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATT
ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTG G
ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTG
ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGC C
ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGC
ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCT
ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCT
ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCTT
ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCTT
T
T G A T C
ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCTT

Sequenciadores

Seqüenciamento parcial de
transcritos
O que são ESTs? Seqü
Seqüenciamento parcial de
transcritos
EST= Expressed Sequence Tag cDNA
REGIÃO CODIFICADORA
(Etiquetas de Seqüências Expressas) ATG STOP

intron
exon
s
s AAAAA
EST 5’
5’ TTTTTT
Processamento do transcrito EST 3’
3’
primário
AAAAA
Excisão dos exons EST 5’
5’ TTTTTT
EST 3’
3’
União dos exons
AAAAA
EST 5’
5’ TTTTTT
EST 3’
3’

Seqü
Seqüenciamento parcial de
transcritos Agradecimentos
AAAA • Ao Prof. Dr. Sergio Lifschitz.
TTTTT
EST 5’
5’ EST 3’
3’ • Ao comitê organizador do BSB e ao
AAAA
comitê do IWGD.
“Cluster”
TTTTT
de ESTs ou • A todos os presentes.
de “reads” EST 5’
5’ AAAA
TTTTT
EST 5’
5’ AAAA
TTTTT

EST 5’
5’ AAAA
TTTTT
Seqüência
“consenso”