Você está na página 1de 39

Termociclador

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

Técnica que permite a amplificação


da quantidade de DNA específico
utilizando a enzima Taq DNA
polimerase, sequências iniciadoras
específicas (primers) e variações de
temperatura controladas.
ETAPAS DO PCR
1. Adição de reagentes
DNA
ETAPAS DO PCR
1. Adição de reagentes
DNA
dATP
dCTP
dGTP
dTTP
(nucleotideos)
ETAPAS DO PCR
1. Adição de reagentes
DNA
Taq polimerase dATP
Primers dCTP
Tampão dGTP
Água dTTP
(nucleotideos)
Taq DNA polimerase

O nome Taq vem de Thermus aquaticus, a


qual é uma bactéria encontrada
sobrevivendo a altas temperaturas em
geisers no Yellow Stone National Park.
Taq DNA polimerase

Termoestabilidade limitada

Temperatura T 1/2 (minuto)

92,5oC 130
95,0oC 40
97,5oC 5
Taq DNA polimerase
 Trata-se de uma enzima cuja atividade é mantida
durante 45 minutos a 95°C.

• Sua quantificação é dada em Unidades (U), sendo que


cada U é definida como a quantidade de enzima capaz de
incorporar 10 nM de dNTP em cerca de 30 min a 72°C.

• Na maioria dos protocolos são utilizadas 2,0 a 2,5 U


(0,5 l) de enzima em volume final de 100 l.

• É importante deixar claro que o excesso de enzima


também pode prejudicar a eficiência da reação, podendo
inclusive inibi-la.
Seqüências dos primers

• Os primers (forward e reverse) devem ser


construídos de acordo com a conveniência do
investigador, de modo que esses possuam
seqüências complementares a determinadas
regiões do DNA que limitam os segmentos a
serem amplificados.
Problemas comuns no Desenho de
Primers

• Auto-complementariedade

• Complementariedade entre primers


Auto Complementariedade

• Formação de alça

GAACTACCACTGAAGATACTTCAGT

HOTGACTTC Tm = 71oC
ACTGAA
Complementariedade entre
Primers

• Formação de “primer dimer”

5‟ GAACTACCATAGACACACTGAAGGOH3‟
5 „ CTTCAGGTCAAGAACTTCCTTCAGTOH3‟

3‟OHTGACTTCCTCAAGAACTGGACTTC
GAACTACCATAGACACACTGAAGGOH3‟
Desoxinucleotídios trifosfatados
(dNTP)
• São as bases nitrogenadas que constituirão as
novas cadeias de DNA.

• Sua concentração numa reação pode variar de


20 a 200 uM sendo importante que as quatro
devam variar em concentrações equivalentes.

• Quando estão em excesso (um nucleotídeo ou


todos) podem ocorrer erros de incorporação de
bases, gerando cópias alteradas
Íon magnésio
• O íon magnésio (Mg++) é um co-fator enzimático que
desempenha um papel de extrema importância na
atividade da enzima Taq DNA polimerase.

• Sua concentração em torno de 1,5 mM é aplicável a


maioria das necessidades.

- Se a concentração de Mg2+ é muito baixa, temos


pouco ou nenhum produto

- Se a concentração de Mg2+ é muito elevada, a


PCR tem baixa especificidade. Observa-se muitas
bandas ou “smear”.
Smear
PCR “Requerimentos”

• Cloreto de Magnésio: .5-2.5mM


• Tampão: pH 8.3-8.8
• dNTPs: 20-200µM
• Primers: 0.1-0.5µM
• DNA Polimerase: 1-2.5 units
• DNA Alvo:  1 µg
ETAPAS DO PCR
1. Adição de reagentes
DNA
Taq polimerase dATP
Primers dCTP
Tampão dGTP
Água dTTP
(nucleotideos)
ETAPAS DO PCR
1. Adição de reagentes
DNA
Taq polimerase dATP
Primers dCTP
Tampão dGTP
Água dTTP
(nucleotideos)

94ºC

DENATURAÇÃO

2. Alternância de temperaturas
(Termociclador)
ETAPAS DO PCR
1. Adição de reagentes
DNA
Taq polimerase dATP
Primers dCTP
Tampão dGTP
Água dTTP
(nucleotideos)

94ºC 57ºC

DENATURAÇÃO ANELAMENTO

2. Alternância de temperaturas
(Termociclador)
ETAPAS
1. Adição de reagentes
DO PCR
DNA
Taq polimerase dATP
Primers dCTP
Tampão dGTP
Água dTTP
(nucleotideos)

94ºC 57ºC 72ºC

DENATURAÇÃO ANELAMENTO EXTENSÃO

2. Alternância de temperaturas
(Termociclador)
25-40 (35) CICLOS

http://www.roche.pt/portugal/index.cfm/produtos/equipamentos-de-diagnostico/products/molecular-diag/intro-pcr/
94ºC

DENATURAÇÃO
Primer forward Primer reverse
57ºC

ANELAMENTO
Taq
DNA polimerase

72ºC

EXTENSÃO
Temperatura média (Tm) de Anelamento
 Essa temperatura está relacionada, por exemplo,
com a quantidade das bases C Ponte
e G, de modo que
de Hidrogênio
quanto maior for o número dessas bases,
fosfato
a
temperatura de hibridização tende apentose
aumentar.
Citosina

Guanina

Timidina

• Normalmente primers de 18 a 25 nucleotídios


Adenina
contendo 50 a 60% de G + C são adequados.

• Para se calcular a TM (temperatura média de


hibridização) de primers com até 20 nucleotídios
aplica-se a seguinte formula:

4 x (C + G) +2 x (A + T) = TM
Tempo de extensão dos primers

• Esse fator depende do comprimento do


segmento a ser amplificado e da concentração
do DNA molde utilizado na reação.

• A temperatura ótima de extensão dos primers é


de 72°C (temperatura ótima de atividade da
polimerase) e o tempo de extensão de 1
minuto é considerado suficiente para estender
produtos de aproximadamente 1.250 pb (em
condições ideais).
Tempo e temperatura de desnaturação

• As condições de desnaturação utilizadas


normalmente são de 95°C por 5 minutos
(desnaturação inicial) e por 30 segundos
(desnaturação na ciclagem), sendo que
temperaturas mais altas podem ser utilizadas
quando se trabalha com seqüências moldes
ricas em G+C.

• Temperaturas muito altas e tempos longos de


desnaturação levam a perda de atividade da
enzima
Amplificação de DNA
(exponencial)

Plateau
Linear
Gel EtBr

Log [DNA]

Geométrica

X ciclos
y = 2X
Amplificação de DNA
(Platô)
Número de cópias de 1 molécula de DNA após 34 ciclos: 1.580.000.000
CYCLE NUMBER AMOUNT OF DNA
0 1
1 2
2 4
3 8
4 16
5 32
6 64
7 128
8 256
9 512
10 1,024
11 2,048
12 4,096
13 8,192
14 16,384
15 32,768
16 65,536
17 131,072
18 262,144
19 524,288
20 1,048,576
21 2,097,152
22 4,194,304
23 8,388,608
24 16,777,216
25 33,554,432
26 67,108,864
27 134,217,728
28 268,435,456
29 536,870,912
30 1,073,741,824
31 1,400,000,000
32 1,500,000,000
33 1,550,000,000
34 1,580,000,000
Reação:
DNA
Enzima Taq
Primer
Nucleotídeos
Análise
Tampão
Água
dos dados
Luz Ultravioleta

Fotodocumentação

Termociclador

Eletroforese
em gel de agarose
Reação +
de PCR Brometo de Etídeo
+
Tampão
Corado
(Loading Buffer)
ELETROFORESE EM GEL DE AGAROSE 2%
REVELAÇÃO DO BROMETO DE ETÍDEO
COM LUZ ULTRAVIOLETA
FOTODOCUMENTAÇÃO DO GEL DE AGAROSE 2%
UTILIZANDO MARCADOR LADER 100 pb

1400
1300

600
500
400
300

200

100

Marcador
de pares
de base
(pb)
FOTODOCUMENTAÇÃO DO GEL DE AGAROSE 2%
UTILIZANDO MARCADOR LADER 100 pb

1400
1300

600 600 600


500
400 400 400 400
300

200

100 100 100 100 100

Marcador
de pares TAMANHO ESTIMADO DOS FRAGMENTOS DE
de base
(pb) DNA AMPLIFICADOS
Variações da técnica de PCR

- Reverse Transcriptase -PCR (RT-PCR): amplifica RNAm,


construindo cópias complementares de DNA (cDNA).

- Real Time-PCR: PCR quantitativo utilizado para determinação


de carga viral.

- Nested-PCR: amplifica seqüências de DNA de baixa


frequência (exemplo: diagnóstico de parasitoses).
Aplicações do PCR

• A alta sensibilidade do método de PCR, bem como


a sua especificidade, nos permite amplificar uma
seqüência-alvo mesmo a partir de amostras com
baixo grau de pureza e de quantidades mínimas
de DNA, o que torna o método viável não só para a
pesquisa básica mas também para a pesquisa
aplicada.
Aplicações do PCR

Os produtos amplificados por PCR podem ter as seguintes


utilidades/ aplicações:

1. Detecção de deleções / inserções determinadas pela


geração de produtos amplificados que apresentam
alterações em seu tamanho.

2. Detecção de mutacões pontuais (substituição de


bases), conhecidas ou não, que geram polimorfismos
genéticos podem ser determinadas pela ação das
enzimas de restrição ou através do seqüenciamento.
Aplicações do PCR
3. No diagnóstico pré-natal ou pré-implantacional
(particularmente para doenças herdadas).
4. Na tipagem para transplantes de órgãos e
susceptibilidade para doenças auto-imunes
específicas (detecção de polimorfismo para HLA).
5. No diagnóstico e prognóstico de doenças de ordem
genética, como o câncer, através do estudo dos
genes relacionados a essas doenças.
6. Na medicina forense (DNA fingerprint).
7. No diagnóstico de doenças infecciosas por agentes
patogênicos diversos

Você também pode gostar