Você está na página 1de 22

Tabela 2.

Valores de expressão gênica (em CT) dos genes GADPH, HPRT1 e βG de amostras de RNA de sangue periférico de in
Individuo GAPDH HPRT1 βG
Normal 1 21.09 24 7.04
Normal 2 16 24.67 6.86
Normal 3 22.26 24.79 9.59
Normal 4 17.02 23.57 7.33 NOSSO "MODELO A SEGUIR":
Normal 5 21.05 25.2 8.15
Normal 7 16.95 23.27 6.33
Normal 8 18.84 24.72 6.62
Normal 9 17.55 25.31 7.55
Normal 13 15.77 23.05 5.2
Normal 15 17.97 25.1 6.46
Normal 19 16.73 26.15 5.63
Normal 20 16.69 25.22 5.08
Média
Desvio Padrão
CV

CV - Coeficiente de variação. CT - Threshold cycle.

Para calcular o coeficiente de variação:


Calcule as médias e desvios-padrão de
cada amostra. Depois, calcule o quociente
entre esses dois valores. Coloque o
resultado em percentual.
sangue periférico de indivíduos controles normais.

DELO A SEGUIR":
Tabela 2. Valores de expressão gênica (em CT) dos genes
GADPH, HPRT1 e βG de amostras de RNA de sangue periférico
de indivíduos controles normais.
Indivíduo GAPDH HPRT1 βG
Normal 1 21.09 24.00 7.04
Normal 2 16.00 24.67 6.86
Normal 3 22.26 24.79 9.59
Normal 4 17.02 23.57 7.33
Normal 5 21.50 25.20 8.15
Normal 7 16.95 23.27 6.33
Normal 8 18.84 24.72 6.62
Normal 9 17.55 25.31 7.55
Normal 13 15.77 23.05 5.20
Normal 15 17.97 25.10 6.46
Normal 19 16.73 26.15 5.63
Normal 20 16.69 25.22 5.08
Média 18.20 24.59 6.82
Desvio Padrão 2.23 0.93 1.27
CV 0.12 0.04 0.19
CV - Coeficiente de variação. CT - Threshold cycle.
Formatação de acordo com as normas
de elaboração de teses:

- fonte Times New Roman 14 no título


da tabela;
- título na parte superior, justificado;
- traçado simples, na linha superior,
inferior e entre o cabeçalho e o
conteúdo (permitido, também, entre
o conteúdo informado e o calculado -
porção inferior);
- aberta nas laterais e sem linhas
verticais;
- conteúdo da tabela - fonte Times
New Roman 12 (quando possível);
- legenda, equações, fórmulas e fonte
(quando dados de terceiros) na parte
inferior.
Tabela 2. Valores de expressão gênica (em CT) dos genes
GADPH, HPRT1 e βG de amostras de RNA de sangue periférico
de indivíduos controles normais.
Indivíduo GAPDH HPRT1 βG
Normal 1 21.09 24.00 7.04 A partir da tabela
Normal 2 16.00 24.67 6.86 montada na planilha
anterior, obteremos o
Normal 3 22.26 24.79 9.59 gráfico de dispersão
Normal 4 17.02 23.57 7.33 similar ao modelo
Normal 5 21.50 25.20 8.15 ilustrado ao lado.
Usaremos a fonte Times
Normal 7 16.95 23.27 6.33 New Roman no título
Normal 8 18.84 24.72 6.62 da figura para ficar de
Normal 9 17.55 25.31 7.55 acordo com as normas
(elaboração de teses).
Normal 13 15.77 23.05 5.20
Normal 15 17.97 25.10 6.46
Normal 19 16.73 26.15 5.63
Normal 20 16.69 25.22 5.08
Média 18.20 24.59 6.82
Desvio Padrão 2.23 0.93 1.27
CV 0.12 0.04 0.19
CV - Coeficiente de variação. CT - Threshold cycle.

Expressão Gênica
30.00

25.00

20.00
Valores de CT

GAPDH
15.00
HPRT1
βG

10.00

5.00

0.00
0 2 4 6 8 10 12 14

Amostras controles
5.00

0.00
0 2 4 6 8 10 12 14

Amostras controles
NOSSO "MODELO A SEGUIR":

Expressão Gênica

30

25

20
Valores de CT

GAPDH
15 HPRT1
βG
10

0
0 5 10 15
Amostras controles
5

0
0 5 10 15
Amostras controles

Figura 7. Valores de expressão gênica (em CT) dos genes GADPH, HPRT1 e βG de
amostras de RNA de sangue periférico de indivíduos controles normais.
GAPDH
HPRT1
βG

15
15

PRT1 e βG de
Vendedores Vendas (em milhões R$)
Mário 540
Michelly 785
Ronaldo 254
Tales 428
Rogerio 377
Rafael 278
TOTAL

Relembrando

Acesse o menu Inserir - opção Gráficos;

Na aba “Tipos Padrão”, escolha como Tipo


de Gráfico de Colunas ;

Clique em Avançar;

Na aba “Intervalo de dados”, selecione as


linhas e colunas necessárias para
confecção do gráfico;

Clique em avançar;

Conclua o processo e teremos nosso gráfico


Vendedores Vendas (em milhões R$)
Mário 540
Michelly 785 Vendas Bimestrai
Ronaldo 254
Thales 428 800

Rogério 377 700


Rafael 278
600
TOTAL 2662
500

400

300

Escolhemos um título para 200


ilustrar nosso trabalho.
100

0
Mário Michelly Ronaldo Thales Rogério Rafael
Vendas Bimestrais

Vendas (em milhões R$)

o Thales Rogério Rafael


Candidatos Votos (x 1.000) Votos (%)
X 2842 35
Com
Y 812 10 mo
Z 3248 40
Brancos 568 7
Nulos 649 8
TOTAL 8119 100

Relembrando

Acesse o menu Inserir - opção Gráficos;

Na aba “Tipos Padrão”, escolha como


Tipo de Gráfico o Pizza ;

Clique em Avançar;

Na aba “Intervalo de dados”, selecione


as linhas e colunas necessárias para
confecção do gráfico;

Clique em avançar;

Conclua o processo e teremos nosso


gráfico
Com base na planilha apresentada
montaremos um gráfico PIZZA!
Candidatos Votos (x 1.000) Votos (%)
X 2842 35
Y 812 10
Z 3248 40
Brancos 568 7
Nulos 649 8
TOTAL 8119 100

Eleições 2009

X
Y
Z
Brancos
Nulos

Candidatos x 1.000
X 2842 Valores podem aparecer em
Y 812 números absolutos ou
percentuais
Z 3248
Brancos 568
Nulos 649
TOTAL 8119

ELEIÇÕES 2009

568
2842
649

X
Y
Z
Brancos
568
2842
649

X
Y
Z
Brancos
Nulos
3248 812

ELEIÇÕES 2009

7%
35%
8%

X
Y
Z
Brancos
Nulos
40% 10%
7%
Eleições 2009
35%
8%

Optamos por escolher o 40% 10%


gráfico 3D e escolhemos um
título para ilustrar nosso
trabalho.

Eleições 2009
X
35%
Nulos
Brancos 8%
7%

Z Y
em aparecer em 40% 10%
absolutos ou
centuais

Eleições 2009
ões 2009
35%

X
Y
Z
Brancos
Nulos

10%

ões 2009
X
35%

X
Y
Z
Brancos
Nulos

Y
10%

ões 2009

X
Y
Z
Brancos
Nulos
X
Y
Z
Brancos
Nulos
Quadro 1. Oligonucleotide Primers
Primer Sequence GeneBank
Targets Forward Primer Reverse Primer Product Size (bp) Accession No.
NK1 ggcaacgtagtggtgatatg ggcaacgtagtggtgatatg 462 NM012667
CRLR atcgcacacttcagttggac atcgcacacttcagttggac 423 L27487
RAMP1 ggctcatcatctcttcatgg ggctcatcatctcttcatgg 483 NM031645
Collagen I cagacgggagtttcacctc cagacgggagtttcacctc 103 J04464
Collagen III ctgccattgctggagttg ctgccattgctggagttg 644 AJ005395
Biglycan gatgacttcaaaggcctcca gatgacttcaaaggcctcca 499 NM_017087
Versican cgagactggagctactgatgg cgagactggagctactgatgg 480 XM_215451
Decorin atctccgagtggtgcagtg atctccgagtggtgcagtg 297 NM_24129
Adaptado de: Bring DK et al., J Orthop Res. 2009.