BIOINFORMATICS 
 
OBJECTIVE 
 
At the end of this exercise, the student should be able to  
1. Access and explore existing biochemical information from key electronic resources such as 
the National Center for Biotechnology (NCBI), ExPASy server of the Swiss Institute of 
Bioinformatics and Protein Data Bank.  
2. Use the Basic Local Alignment tool (BLAST) for comparing sequences (DNA or protein) to 
other sequences in various organisms.  
3. Learn to utilize the molecular visualization software Swiss PDB Viewer to manipulate and 
analyze the three‐dimensional structures of molecules 
 
INTRODUCTION 
 
A. What is Bioinformatics? 
 
  The cross‐disciplinary field of bioinformatics is defined as “conceptualizing biology in terms 
of  molecules  (in  the  sense  of  physical  chemistry)  and  applying  informatics  techniques  (derived 
from disciplines such as applied math, computer science and statistics) to understand and organize 
the  information  associated  with  these  molecules,  on  a  large  scale.  In  short  bioinformatics  is  a 
management  information  system  for  molecular  biology“(1).  Plainly,  it  is  the  convergence  of 
molecular  biology  and  computational  analysis  to  examine  the  information  associated  with 
biomolecules and it is a synonym for computational molecular biology.  
   
  The goal of bioinformatics is divided into three: First, is to create and maintain databases 
that store large quantities of biological information such as amino acid and nucleotide sequences 
(1,2). This will allow the scientific community easy access to existing data as well as to submit new 
and revised entries (1). However, bioinformatics is not just building databases, its second goal is to 
develop  new  tools  and  algorithms  to  discover  and  uncover  the  wealth  of  information  hidden  in 
those  biological  data  (1,2).  The  third  goal  is  to  implement  these  tools  in  the  analysis  and 
interpretation of the biological information to gain comprehensive insight into living systems (1,2).  
 
Common activities in bioinformatics include analyzing DNA and protein sequences, aligning 
different DNA and protein sequences to identify similarity and cluster them into families of related 
sequences, and predicting and viewing 3‐D structural models of protein structures. Table 1 below 
gives a summary of the biological information examined in bioinformatics.  
 
 
 
 
 
 
 
 
 

1 
 
 

Table 1. Data source analyzed in bioinformatics (2001)1 
Data Source  Data Size   Bioinformatics topics 
Raw DNA Sequence  8.2  million  sequences  Separating coding and non‐coding regions 
(9.5 billion sequences)  Identification or introns and exons 
Gene product prediction 
Forensic Analysis 
Protein Sequence  300,000  sequences  Sequence comparison algorithms 
(~300  amino  acid  Multiple sequence alignment algorithms 
each)  Identification of conserved sequence motifs 
Macromolecular  13,000  structures  Secondary and tertiary prediction 
structure  (~1000  atomic  3D structural alignment algorithms 
coordinates each)  Protein geometry measurements 
Surface and volume shape calculations 
Intermolecular interactions 
Genomes  40  complete  genomes  Characterization of repeats 
(1.6  million‐3  billion  Structural assignments to genes 
bases each)  Phylogenetic analysis 
Genomic‐scale  censuses  (characterization  of  protein  content,  metabolic 
pathways) 
Linkage analysis relating specific genes to diseases 
Gene expression   largest: ~20 time point  Correlating expression patterns 
measurements  for  Mapping expression data to sequence, structural and biochemical data 
~6000 genes 
Literature  11 million citations  Digital libraries for automated bibliographical searches 
Knowledge databases of data form literature 
Metabolic pathways    Pathway simulation 
 
Bioinformatics  is  a  broad  topic  so  for  a  newcomer,  this  field  maybe  overwhelming, 
daunting and confusing at first because of the computational and mathematical content as well as 
the terminology and language of bioinformatics. Furthermore, this field is rapidly evolving that it is 
nearly impossible to keep up with all the progress. This exercise is designed to introduce students 
to  computational  techniques in  the area of  bioinformatics for the analysis  of  biomolecules,  with 
emphasis on proteins and nucleic acids.  
 
B. Selected Databases  
 
Protein Sequence Database 
  UniProt  (Universal  Protein  Resource)  is  a  result  of  the  merger  of  three  separate  protein 
databases.  They  are  the  Swiss  Institute  of  Bioinformatics’  and  the  European  Bioinformatics 
Institute’s Swiss‐Prot and TrEMBL (Translated EMBL Nucleotide Sequence Data Library) databases 
and Georgetown University’s PIR‐PSD (Protein Information Resource Protein Sequence Database). 
UniProtKB/Swiss‐Prot,  the  smaller  component  of  UniProt,  provides  manually  annotated  protein 
sequences  with  additional  information  while  UniProtKB/TrEMBL  provides  computationally 
analyzed sequence records that need to be annotated and later transferred to Swiss‐Prot (3).  
 
Nucleotide Sequences and Genome Sequences Database 
The  GenBank  operated  by  NCBI  (National  Center  for  Biotechnology  Information),  EMBL 
(European  Molecular  Biology  Laboratory)  and  the  DDBJ  (DNA  Data  Bank  of  Japan)  contain 
annotated  nucleotide  sequences.  The  Entrez  Genome  database  by  NCBI  holds  all  complete  and 
partial genomes (1).  
 
 
 
                                                             
1
 Luscombe, N.M.; Greenbaum, D.; Gerstein, M. What is Bioinformatics? An introduction and overview. Yearbook of Medical InformaticsI, 
Schattauer, Stuttgart/New York, 2001.  

 
2 
 
 

Structural Databases 
The  Protein  Data  Bank,  PDB  is  a  repository  of  all  experimentally  determined  three‐
dimensional  (3D)  structure  of  biomolecules  such  as  proteins  and  DNA.  Most  of  these  structures 
are obtained through X‐ray crystallography and NMR (1).  
 
Online Mendelian Inheritance in Man (OMIM) 
OMIM can be accessed through the Entrez database of NCBI.  It is a database that 
catalogues human genes and genetic disorders. It is linked to gene entries in GenBank and 
PubMed articles and sequences.  
 
Publisher’s MEDLINE/Public MEDLINE (PubMed) 
  PubMed is a bibliographic database that can serve as a search engine for abstracts and 
articles published in different biomedical journals.  
 
Closer Look: NCBI’s Entrez interface System 
 
  The Entrez facility maintained by NCBI is an interface system, which serves as a gateway to 
accessed  and  traversed  all‐component  databases  for  protein  and  DNA  sequences,  three‐
dimensional  structure  information,  genome  mapping  and  bibliographic  databases  (5).  PubMed, 
OMIM and Nucleotide (GenBank) are all Entrez databases (5).  
 
C. Tools for Analysis in Bioinformatics 
 
Basic Local Alignment Search Tool (BLAST) 
  BLAST provides sequences similar to the input sequence, which may lead to identification 
of previously characterized sequences, finding of evolutionary related protein (homologous) and 
establishment of function based on sequence similarity (6).  
  
Multiple Sequence Alignment, ClustalW 
  ClustalW  is  a  multiple  sequence  alignment  tool  used  for  DNA  and  protein  sequences.  It 
produces  the  best  match  over  the  length  of  selected  sequences,  highlighting  similarities  and 
differences  (7).  This  is  useful  for  the  identification  of  conserved  patterns  in  protein  families, 
predicting  three‐dimensional  structures  of  proteins  and  discovering  evolutionary  relationships 
between sequences (8).  
 
Deep View (Swiss‐Pdb Viewer) 
Deep  View  is  a  molecular  graphics  program  useful  in  exploring  macromolecular  models  in 
three dimensions. It allows simultaneous loading of several molecules for analysis. Measurement 
of  bond  angles  and  distances  between  atoms,  examination  of  H‐bonding,  mutational  studies  on 
amino  acids  and  side  chain  conformation  and  structural  alignment  are  some  of  the  main 
applications of Deep View (9).  
 
Expert Protein Analysis System (ExPaSy) 
ExPaSy is a proteomics server operated by the Swiss Bioinformatics Institute which consists 
of a variety of databases and tools and software for protein analyses. Databases include UniProt 
while tools and software covers those for identification and characterization of proteins, protein 
to  DNA  reverse  translation,  Blast  similarity  searches  and  predicting  the  secondary  and  tertiary 
structure of proteins (10).  
 
3 
 
 

PROCEDURE 
 
A. PubMed2 
Go to www.pubmed.org 
Do a basic search on a human biomedical topic of your own choice in pubmed, which has a 
genetic component.  
1. What search term(s) did you use? 
2. How many hits do you get? 
3. Give the reference of the first citation on the list 
4. Is this reference available in full‐text? 
5. How would you adjust your search to give only review papers 
a. How many hits did you get?  
b. Give the citation of he review paper you found 
c. Is this available in full‐text 
6. Are there any books in the PubMed library that discuss the topic that you chose? How 
do you find them?  
a. Cite the book source that gives the best discussion of your topic 
b. Why did you consider this the best? 
7. Use the OMIM database on PubMed to look up the genetics associated with your topic. 
a. What is the entry number and title for this genetic topic? 
b. Is there a location for this gene in the human genome? Which chromosome is it 
located? Click the gene map locus 
8. Using the key PubMed and OMIM information that you found, give a brief summary 
about the topic that you chose 
9. Give the key references 
 
B. Swiss Prot3 
Go to www.expasy.org, then go to database, click Swiss‐Prot and TrEMBL and search for a 
protein. Choose one that you think is an interesting match. Click to see the NiceProt view 
and answer the following questions: 
1. Swiss‐Prot ID Name and Code 
2. Organism where it comes from 
3. Full name and alternate name for this protein 
4. How many amino acids? 
5. Based on the general annotations, describe the general function of this protein and 
where it is expressed. 
6. Does this protein have any non‐protein components such as metal ions, other 
cofactors, prosthetic groups or sugars attached via glycosylation sites? If yes, please 
describe. 
7. Where is the active site or binding site of this protein, if any. 
                                                             
2  st
Bioinformatics Module by Nina Rosario L. Rojas PhD for Chem 349 Special Topics in Biochemistry 1  sem 2007‐2008 [Unpublished] 
 
3
Bioinformatics Module by Nina Rosario L. Rojas PhD for Chem 349 Special Topics in Biochemistry 1  sem 2007‐2008 [Unpublished] 
st

4 
 
 

8. Look at the gene ontology, what functional descriptions are associated with your 
protein 
9. Look at the feature section and note what other features are listed, what are shown by 
the graphical view? 
10. Are there any variants of this protein? Note any of them. 
11. Look for the secondary structures. Describe the secondary structure of your selected 
protein and determine which secondary structure predominates? 
12. Look at the amino acid sequence, choose a chain and determine the pI and MW. What 
results do you get? 
13. Click blast, what information do you get? 
14. Click alignment, paste two sequences, what information do you get? 
15. Is a three‐dimensional structure of this protein available? Look for a PDB link, if any. If 
there are several PDB IDs, just choose one 
16. Give the citation for the 3‐D structure 
17. Give the molecular description 
18. What can you say about the tertiary structure? Click on Jmol 
19. What experimental data were used to predict the 3‐D structure? 
20. Go back to the main entry page, go to features, what key domains/motifs are present 
in this protein and what aa residues are in each 
21. Cick ProtParam and analyze parameters of the protein. Study the results, what 
information are given? 
Go back to main entry page, click FASTA format link. Copy and paste into notepad the 
sequence of your protein.  
22. Go to tools from the main page and go to the section on DNA to protein. Go to reverse 
translate and get the nucleotide sequences that code for your protein.  Why is the 
codon usage table an important parameter? 
23. Go to the primary structure analysis and go to ProtScale.  Choose alpha helix (Chou and 
Fasman) what information can you get? 
24. Choose any other parameter that you want in #23 
25. Go to the section on secondary structure prediction. Go to JPred and paste your 
protein sequence. Choose one of the hits found 
26. Give a short summary of what your protein is like and what it does, based on your 
ExPaSy findings.  
 
C. NCBI BLAST4 
Go to www.ncbi.nlm.nih.gov/. Select BLAST. (You can use this site http://www.digital‐
world‐biology.com/BLAST to access an on‐line tutorial for this program.)  
1. Select nucleotide BLAST (blastn) 
2. Input your own random nucleotide sequence (fill the first line of the Query Box: e.g. 
CATATTACTATGGGTACTCTTA) 
3. In “Choose databases”, select ‘other’ 
                                                             
4  
Adapted from Bioinformatics: An Interactive Introduction to NCBI by Seth Bordenstein 
http://serc.carleton.edu/microbelife/k12/bioinformatics/index.html (accessed November 2010) 
5 
 
 

4. Select BLAST and wait for the results page to load. The time it takes to get it depends 
on the type of search and the number of peers using the NCBI website at the same 
time.  
5. Did your sequence produce a significant hit? How many? 
6. Click Search summary. How many sequences did it search in the database? How many 
nucleotide letters did it search in the database? 
7. Repeat analysis this time using your own random amino acid sequence (e.g. 
MISSPIGGYISENIGMATIC). Select protein BLAST (blastp) 
8. Did your sequence produce a significant hit? How many? 
Close the results page when you are done. 
9. Select nucleotide BLAST to go back to its page.  
10. Copy and paste the unknown nucleotide sequence given to you by your instructor. 
Make sure to copy the entire sequence including the > symbol and the name. 
11. Repeat the search you perform above using this unknown sequence. Wait for the 
results.  
12. What is the E‐value and score for the first matching sequence? What is the significance 
of the E‐value? 
13. How many sequences can you find with an E‐value larger than 0.01? 
14. What is the most likely identity of this sequence?  What data supports this conclusion? 
15. What are the 3 closest relatives based on sequence similarity? What other organisms 
encode for this gene based on nucleotide sequence similarity? 
Close the results page when you are done. 
16. Return to the nucleotide BLAST page.  Cut the sequence given to you by pasting only 
the paste only the first 50 base pairs in the query box.  
17. Repeat the BLAST search you performed above with the larger sequence and wait for 
the results to appear. 
18. How do these E‐values compare with the ones you obtained above?  Is the identity of 
the best hit different from when you used the complete nucleotide sequence? 
19. From the two BLAST searches, what can you deduce abut how the length of a query 
sequence affects your confidence in the sequence search? 
20. Give the first five sequences from the list that produces significant alignments.  
21. Repeat the analysis using the unknown amino acid sequence given to you by your 
instructor.  
22. What is the most likely identity of this sequence?  What data supports this conclusion? 
 
D. Deep View (This is a take‐home activity for the students). Refer to the tutorial provided.  
 
1.  Download Deep View from http://spdbv.vital‐it.ch/. Spdbv stands for Swiss PDB 
Viewer. Make sure to choose the version that is compatible for your operating system.  
2. Open the zip file and extract the files to the Desktop.  
3. Click the file to start the program.  
4. Upon opening of the file, there will be two windows that will pop‐up. One is the 
“Swiss‐PdbViewer 4.0.1" window and the smaller one is the "About Swiss‐
PdbViewer..." window. Just click the X mark on the right side of the window to close 
the "About Swiss‐PdbViewer..." window.  
5. Download the DeepView manual from http://spdbv.vital‐it.ch/Swiss‐
PdbViewerManualv3.7.pdf. Be familiar with the basic movement control.  
6 
 
 

6. Load the pdb file to Deep View. To do this, click “File” then choose “Import”.  On the 
text box, type in “2DN1”, the code for human hemoglobin. Click “PDB file” under “Grab 
from Server:” Another option is the “Open PDB File” from the “File” menu. If a prompt 
appears, click “Ok”.  Also close the inset that appears before you proceed.  
7. Familiarize with the basic controls. The first four buttons represent: (1) place the 
image to the center of the screen (2) translate (3) zoom in and out (4) rotate 
8. Change display by clicking this series “Display”> render in 3D and Display > render in 
solid 3D. 
9. Select the alignment window (“Window”>Alignment)  
10.  Look for all the Histidine residues (H) by running the cursor over the sequence. 
Observe how amino acid residues are distinguished. 
11. Go to the control panel (“Window”>control panel) 
12. Select the entire protein by clicking to the far left of the first column.  The text for all 
the residues will turn red. Select the entire protein and color the residues by their 
secondary structure (Color>by Secondary structure).   Which color corresponds to 
which type of secondary structure?   
13. Overlay the ribbon view of the protein by right‐clicking the “ribn” title on the top of the 
column.   How would you describe the tertiary structure of this protein?  
14. Deselect the ribbon view by removing all the “v”s.  To do this, right‐click again in the 
“ribn” column. 
15. Find the Heme on the control panel. Change its color to something more visible (box 
on far right of Zn in the control panel) 
16. Go to the control panel and select the entire protein and then select the 
Ramachandran window (“Window”>Ramachandran).   
17.  Look at the residues within the outlined yellow regions.  What secondary structure 
does each region of the plot corresponds to? 
18.  Is there a deviant amino acid, one outside the blue and yellow outine? If yes, 
determine its identity.  
19. Choose a point within the yellow region, click on it and move its angle. What happens 
to the tertiary structure?  Close the Ramachandran window.  
20. Center the complete model 3INC in CPK colors, and display H‐bonds.  
21. Label A His 509 by clicking on the label column next to it.  
22. Click the MUTATE button (second from right in button row), and then click any atom of 
A SER9. Select Glycine (G) from the pop‐up menu that appears. What are the effects of 
the amino acid replacement? 
23. To accept changes after using the MUTATION button, simply click it again and click YES 
on the dialog box that appears.  Gly 50 on the Control Panel window will replace His 
50.  
24. Perform energy minimizations on the insulin molecule. Go to Tools  Energy 
Minimization then click File> Save> Current layer.  
25.  Load 2DN1 and the mutant file.  
26. You can control the visibility of the two layers by checking or unchecking under the vis 
column. Try superimposing the two layers by checking the vis for both layers.  
Differentiate the two structures. Close the window after.  
27.  Download PDB file 2DN2 (human hemoglobin deoxygenated) and load it with 2DN1. 
Differentiate the structure.  
 
 
7 
 
 

DISCUSSION 

1. Submit a presentation about your selected protein using all the computational analyses 
discussed.  

REFERENCES 

1. Luscombe, N.M.; Greenbaum, D.; Gerstein, M. What is Bioinformatics? An introduction and 
overview. Yearbook of Medical InformaticsI, Schattauer, Stuttgart/New York, 2001.  
2. Bioinformatics. http://www.ncbi.nlm.nih.gov/About/primer/bioinformatics.html (accessed 
November 2010) 
3. GenBank, RefSeq, TPA and UniProt: What’s in a Name? 
http://www.microbemagazine.org/index.php?option=com_content&view=article&id=1270
:genbank‐refseq‐tpa‐and‐uniprot‐whats‐in‐a name&catid=347:letters&Itemid=419 
(accessed November 2010) 
4. Online Mendelian Inheritnace in Man. (http://www.nslij‐genetics.org/search_omim.html 
(accessed November 2010) 
5. NCBI’s Entrez System by Alex E. Lash.  
6. BLAST: Basic Local Alignment Sequence Tools by Jonathan M. Urbach 
7. ClustalW. http://www.ebi.ac.uk/Tools/clustalw/ (accessed November 2010) 
8. ClustalW. (http://www‐bimas.cit.nih.gov/clustalw/clustalw.html) (accessed November 
2010) 
9. Swiss‐Pdb Viewer DeepView v4.0 by Nicolas Guex , Alexandre Diemand , Manuel C. Peitsch , & 
Torsten Schwede. (http://spdbv.vital‐it.ch/) 
10. Bioinformatics:Proteomics:ExPASy Proteomics Server. http://bioinformatics‐made‐
easy.blogspot.com/2009/11/expasy‐proteomics‐server.html (accessed November 2010) 
11. Bioinformatics Module by Nina Rosario L. Rojas PhD for Chem 349 Special Topics in 
Biochemistry 1st sem 2007‐2008 [Unpublished] 
12. Bioinformatics: An Interactive Introduction to NCBI by Seth Bordenstein 
http://serc.carleton.edu/microbelife/k12/bioinformatics/index.html (accessed 
November 2010) 
13. Ship,N.J.; D. B. Zamble. Analyzing 3‐D Structure of Human Carbonic Anhydrase II and Its 
Mutants Using Deep View and Protein Data Bank. J. Chem. Ed. [Online], 2005, 82, 1805‐
1808 
14. Deep View Tutorial, project submitted by Saluria, J. V.; Vergara, C. J.; Hermosa, C.; Ventura, 
I. R. Chem 146.1, 1st semester, 2010‐2011 
15. Deep View Tutorial, project submitted by Estandarte, A. K.; Estevanez, P. J.; Garcia, M.C.; 
Reyes, Roy.  Chem 146.1, 1st semester, 2010‐2011 
16. Deep View Tutorial, project submitted by Alcan.; Estevanez, P. J.; Garcia, M.C.; Reyes, Roy.  
Chem 146.1, 1st semester, 2010‐2011 
 

 
 

8 
 
 

 
DISCUSSION 

2. Submit a presentation about your selected protein using all the computational analyses 
discussed.  

3. Obtain your assigned nucleotide sequence and copy of the worksheet from this site: 
http://www.digitalworldbiology.com/BLAST/62000sequences.html. Submit your answers 
to the guide questions included in the worksheet. 

9